Gene Literature Dashboard

Viewing May 2021 — 733 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← April 2021 June 2021 →
Also flagged:cancertyrosine kinaseimatinibtumorantibodiespolypeptides
Journal Article 2021-05-31 No Snippets Zhong L, Li Y, Xiong L, Wang W, Wu M, Yuan T, Yang W, Tian C, Miao Z, Wang T, Yang S.
Show Full Abstract

Due to the advantages in efficacy and safety compared with traditional chemotherapy drugs, targeted therapeutic drugs have become mainstream cancer treatments. Since the first tyrosine kinase inhibitor imatinib was approved to enter the market by the US Food and Drug Administration (FDA) in 2001, an increasing number of small-molecule targeted drugs have been developed for the treatment of malignancies. By December 2020, 89 small-molecule targeted antitumor drugs have been approved by the US FDA and the National Medical Products Administration (NMPA) of China. Despite great progress, small-molecule targeted anti-cancer drugs still face many challenges, such as a low response rate and drug resistance. To better promote the development of targeted anti-cancer drugs, we conducted a comprehensive review of small-molecule targeted anti-cancer drugs according to the target classification. We present all the approved drugs as well as important drug candidates in clinical trials for each target, discuss the current challenges, and provide insights and perspectives for the research and development of anti-cancer drugs.

Also flagged:AutophagyALSasamyotrophic lateral sclerosispathogenesisCHMP2B
Journal Article 2021-05-31 No Snippets Chua JP, De Calbiac H, Kabashi E, Barmada SJ.
Show Full Abstract

Mechanisms of protein homeostasis are crucial for overseeing the clearance of misfolded and toxic proteins over the lifetime of an organism, thereby ensuring the health of neurons and other cells of the central nervous system. The highly conserved pathway of autophagy is particularly necessary for preventing and counteracting pathogenic insults that may lead to neurodegeneration. In line with this, mutations in genes that encode essential autophagy factors result in impaired autophagy and lead to neurodegenerative conditions such as amyotrophic lateral sclerosis (ALS). However, the mechanistic details underlying the neuroprotective role of autophagy, neuronal resistance to autophagy induction, and the neuron-specific effects of autophagy-impairing mutations remain incompletely defined. Further, the manner and extent to which non-cell autonomous effects of autophagy dysfunction contribute to ALS pathogenesis are not fully understood. Here, we review the current understanding of the interplay between autophagy and ALS pathogenesis by providing an overview of critical steps in the autophagy pathway, with special focus on pivotal factors impaired by ALS-causing mutations, their physiologic effects on autophagy in disease models, and the cell type-specific mechanisms regulating autophagy in non-neuronal cells which, when impaired, can contribute to neurodegeneration. This review thereby provides a framework not only to guide further investigations of neuronal autophagy but also to refine therapeutic strategies for ALS and related neurodegenerative diseases.<b>Abbreviations</b>: ALS: amyotrophic lateral sclerosis; Atg: autophagy-related; CHMP2B: charged multivesicular body protein 2B; DPR: dipeptide repeat; FTD: frontotemporal dementia; iPSC: induced pluripotent stem cell; LIR: LC3-interacting region; MAP1LC3/LC3: microtubule associated protein 1 light chain 3; MTOR: mechanistic target of rapamycin kinase; PINK1: PTEN induced kinase 1; RNP: ribonuclear protein; sALS: sporadic ALS; SPHK1: sphingosine kinase 1; TARDBP/TDP-43: TAR DNA binding protein; TBK1: TANK-binding kinase 1; TFEB: transcription factor EB; ULK: unc-51 like autophagy activating kinase; UPR: unfolded protein response; UPS: ubiquitin-proteasome system; VCP: valosin containing protein.

Also flagged:Neurodegenerative diseasesautophagymetabolismgene expressionCas9pathogenesis
Journal Article 2021-05-31 ✓ 1 Snippet Jami MS, Murata H, Barnhill LM, Li S, Bronstein JM.
In-Text Gene Mentions

…(i) Netrins andDCC/UNC-5 receptors; (ii) Plexin,…

Show Full Abstract

Neurodegenerative diseases are a major cause of disability in the world, but their etiologies largely remain elusive. Genetic factors can only account for a minority of risk for most of these disorders, suggesting environmental factors play a significant role in the development of these diseases. Prolonged exposure to air pollution has recently been identified to increase the risk of Alzheimer's and Parkinson's diseases, but the molecular mechanisms by which it acts are not well understood. Zebrafish embryos exposed to diesel exhaust particle extract (DEPe) lead to dysfunctional autophagy and neuronal loss. Here, we exposed zebrafish embryos to DEPe and performed high throughput proteomic and transcriptomic expression analyses from their brains to identify pathogenic pathways induced by air pollution. DEPe treatment altered several biological processes and signaling pathways relevant to neurodegenerative processes, including xenobiotic metabolism, phagosome maturation, and amyloid processing. The biggest induction of gene expression in brains was in Cyp1A (over 30-fold). The relevance of this expression change was confirmed by blocking induction using CRISPR/Cas9, which resulted in a dramatic increase in sensitivity to DEPe toxicity, confirming that Cyp1A induction was a compensatory protective mechanism. These studies identified disrupted molecular pathways that may contribute to the pathogenesis of neurodegenerative disorders. Ultimately, determining the molecular basis of how air pollution increases the risk of neurodegeneration will help in the development of disease-modifying therapies.

Also flagged:type 2 diabeteslipidmetabolismcell cyclecell proliferationto
Journal Article 2021-05-31 ✓ 2 Snippets Feng P, Zeng T, Yang H, Chen G, Du J, Chen L, Shen J, Tao Z, Wang P, Yang L, Lu L.
In-Text Gene Mentions
⭐ same-sentence co-mention

In addition, ten candidate genes (Cmip, Tmem132b, Mphosph6, Smg7, Lyst, Zbtb37, Serpinc1, Npl, Tmem132c and Plcg2) ranking within the top 10 FST values with log2 (θπ ratio (θπ, wild duck/θπ, domestic duck) ≥ 0.84 were functionally involved in cellular adhesion function, type 2 diabetes, lipid metabolism, cell cycle, liver cell proliferation and muscle functioning [31–36] (Table 1).

⭐ same-sentence co-mention

…, Zbtb37 ,Serpinc1, Npl ,…

Show Full Abstract

<h4>Background</h4>Duck is an ancient domesticated animal with high economic value, used for its meat, eggs, and feathers. However, the origin of indigenous Chinese ducks remains elusive. To address this question, we performed whole-genome resequencing to first explore the genetic relationship among variants of these domestic ducks with their potential wild ancestors in eastern China, as well as understand how the their genomes were shaped by different natural and artificial selective pressures.<h4>Results</h4>Here, we report the resequencing of 60 ducks from Chinese spot-billed ducks (Anas zonorhyncha), mallards (Anas platyrhnchos), Fenghua ducks, Shaoxing ducks, Shanma ducks and Cherry Valley Pekin ducks of eastern China (ten from each population) at an average effective sequencing depth of ~ 6× per individual. The results of population and demographic analysis revealed a deep phylogenetic split between wild (Chinese spot-billed ducks and mallards) and domestic ducks. By applying selective sweep analysis, we identified that several candidate genes, important pathways and GO categories associated with artificial selection were functionally related to cellular adhesion, type 2 diabetes, lipid metabolism, the cell cycle, liver cell proliferation, and muscle functioning in domestic ducks.<h4>Conclusion</h4>Genetic structure analysis showed a close genetic relationship of Chinese spot-billed ducks and mallards, which supported that Chinese spot-billed ducks contributed to the breeding of domestic ducks. During the long history of artificial selection, domestic ducks have developed a complex biological adaptation to captivity.

Also flagged:netrin-1vascular endothelial growth factorVEGFproliferative diabetic retinopathyPDRdiabetic macular edema
Journal Article 2021-05-31 ✓ 1 Snippet Okutucu M, Fındık H, Aslan MG, Arpa M.
In-Text Gene Mentions

…that dependence receptors’ (DCCand UNC5H, type…

Show Full Abstract

<h4>Background</h4>To evaluate alterations in the serum concentrations of vascular endothelial growth factor (VEGF) and netrin-1 after intravitreal bevacizumab (BCZ) injection for the treatment of diabetic macular edema (DME).<h4>Methods</h4>This prospective case-control study included a total of 50 participants assigned to one of three groups, including 10 individuals with DME and non-proliferative diabetic retinopathy (NPDR), 13 with DME, and proliferative diabetic retinopathy (PDR), and 27 healthy individuals as a control group. Serum VEGF and netrin-1 concentrations were measured by enzyme-linked immunosorbent assays (ELISAs) immediately before, as well as 1 week and 1 month after, intravitreal BCZ injection.<h4>Results</h4>The mean VEGF serum concentrations in the PDR and NPDR groups were 388.4 and 196.9 pg/mL at baseline, respectively. After 1 week, these concentrations changed to 193.41 and 150.23 pg/mL, respectively (P = 0.001 and P = 0.005, respectively); after 1 month, the concentrations were 97.89 and 76.46 pg/mL, respectively (P = 0.001 and P = 0.009, respectively). The mean netrin-1 serum concentrations in the PDR patients and NPDR groups were 318.2 and 252.7 pg/mL at baseline, respectively. After 1 week, these concentrations increased to 476.6 and 416.3 pg/mL, respectively (P = 0.033 and P = 0.005, respectively), and after 1 month, they were 676.6 and 747.5 pg/mL, respectively (P = 0.001 and P = 0.005, respectively). The correlation analysis revealed a significant inverse relationship between changes in serum VEGF and netrin-1 concentrations in both the PDR and NPDR groups (r = - 0.685, P = 0.029).<h4>Conclusions</h4>Intravitreal BCZ injections work systemically to significantly decrease serum VEGF levels, leading to a significant upregulation in the concentration of another angiogenic mediator, netrin-1.

Also flagged:congenital heart diseaseCCintrauterine infectioncataractcataractsheart diseases
Journal Article 2021-05-31 ✓ 3 Snippets Li X, Si N, Song Z, Ren Y, Xiao W.
In-Text Gene Mentions

In addition, some monogenic diseases, CNV syndromes, and intrauterine infection-related diseases involve concurrent cataract and heart defects, such as oculo-facio-cardio-dental syndrome (OFCD) caused by BCOR mutations [10], FBXL4-related encephalomyopathic mitochondrial DNA depletion syndrome by FBXL4 mutations [11], Sengers syndrome caused by AGK mutations [12], Nance-Horan syndrome caused by NHS mutations [13], Down’s syndrome caused by trisomy 21 [14], and congenital rubella syndrome caused by rubella virus intrauterine infection [15].

…[ 10 ],FBXL4-related encephalomyopathic mi…

…depletion syndrome byFBXL4mutations [ 11…

Show Full Abstract

<h4>Background</h4>Congenital cataract (CC) and congenital heart disease (CHD) are significant birth defects. In clinical practice, the concurrence of CC and CHD is frequently observed in patients. Additionally, some monogenic diseases, copy number variation (CNV) syndromes, and diseases associated with intrauterine infection involve both cataract and heart defects. However, little is known about the association between CC and CHD. Here, we characterised the demographic, clinical, and genetic features of patients with CC and heart defects.<h4>Methods</h4>Medical records for 334 hospitalised patients diagnosed with CC were reviewed. Demographic and clinical features of patients with CC with and without CHD were compared. Clinical and genomic information for patients with 'cataract' and 'cardiac defects' were reviewed from Database of Chromosomal Imbalance and Phenotype in Humans using Ensembl Resources (DECIPHER). Microarray-based comparative genomic hybridisation and whole-exome sequencing were performed in 10 trio families with CC and CHD to detect de novo genomic alterations, including copy number variants and single nucleotide changes.<h4>Results</h4>In a retrospective analysis of 334 patients with CC over the past 10 years at our hospital, we observed a high proportion of patients (41.13%) with CHD (including innocent CHD, which reported as left-to-right shunt in echocardiography test). The CC with CHD group had higher incidences of preterm birth and Down's syndrome than the CC without CHD group. Atrial septal defect was the most frequent heart defect. A total of 44 cases with cataracts and heart diseases were retrieved from Database of Chromosomal Imbalance and Phenotype in Humans using Ensembl Resources (DECIPHER). In total, 52 genomic alterations were reported, 44% of which were de novo germline variants. In the 10 trio families with CC and CHD, we found de novo CNVs responsible for two well-known chromosomal disorders and identified a novel pathogenic mutation in GJA8 responsible for CC.<h4>Conclusions</h4>We observed significant associations between CHD and CC in our 10-year patient cohort. Based on the cohort and data from DECIPHER, developmental syndromes in some patients were due to genetic defects, thus explaining the concurrence of CC and CHD. Additionally, we detected de novo mutations as an independent cause of cataracts. Our findings suggest that developmental syndromes in patients with CC deserve more attention in clinical practice by ophthalmologists.

Also flagged:Chromatinadenomascolon cancerPol IIColorectal Cancercolorectal cancers
Journal Article 2021-05-31 ✓ 1 Snippet Orouji E, Raman AT, Singh AK, Sorokin A, Arslan E, Ghosh AK, Schulz J, Terranova C, Jiang S, Tang M, Maitituoheti M, Callahan SC, Barrodia P, Tomczak K, Jiang Y, Jiang Z, Davis JS, Ghosh S, Lee HM, Reyes-Uribe L, Chang K, Liu Y, Chen H, Azhdarinia A, Morris J, Vilar E, Carmon KS, Kopetz SE, Rai K.
In-Text Gene Mentions

POU3F2

Show Full Abstract

<h4>Objective</h4>Enhancer aberrations are beginning to emerge as a key epigenetic feature of colorectal cancers (CRC), however, a comprehensive knowledge of chromatin state patterns in tumour progression, heterogeneity of these patterns and imparted therapeutic opportunities remain poorly described.<h4>Design</h4>We performed comprehensive epigenomic characterisation by mapping 222 chromatin profiles from 69 samples (33 colorectal adenocarcinomas, 4 adenomas, 21 matched normal tissues and 11 colon cancer cell lines) for six histone modification marks: H3K4me3 for Pol II-bound and CpG-rich promoters, H3K4me1 for poised enhancers, H3K27ac for enhancers and transcriptionally active promoters, H3K79me2 for transcribed regions, H3K27me3 for polycomb repressed regions and H3K9me3 for heterochromatin.<h4>Results</h4>We demonstrate that H3K27ac-marked active enhancer state could distinguish between different stages of CRC progression. By epigenomic editing, we present evidence that gains of tumour-specific enhancers for crucial oncogenes, such as <i>ASCL2</i> and <i>FZD10,</i> was required for excessive proliferation. Consistently, combination of MEK plus bromodomain inhibition was found to have synergistic effects in CRC patient-derived xenograft models. Probing intertumour heterogeneity, we identified four distinct enhancer subtypes (EPIgenome-based Classification, EpiC), three of which correlate well with previously defined transcriptomic subtypes (consensus molecular subtypes, CMSs). Importantly, CMS2 can be divided into two EpiC subgroups with significant survival differences. Leveraging such correlation, we devised a combinatorial therapeutic strategy of enhancer-blocking bromodomain inhibitors with pathway-specific inhibitors (PARPi, EGFRi, TGFβi, mTORi and SRCi) for EpiC groups.<h4>Conclusion</h4>Our data suggest that the dynamics of active enhancer underlies CRC progression and the patient-specific enhancer patterns can be leveraged for precision combination therapy.

Also flagged:Hereditary haemochromatosisironHaemojuvelinhaemochromatosisHJVliver failure
Journal Article 2021-05-31 ✓ 1 Snippet Shubin AD, De Gregorio L, Hwang C, MacConmara M.
In-Text Gene Mentions

HFE

Show Full Abstract

Hereditary haemochromatosis results in multiorgan dysfunction secondary to iron overload. Haemojuvelin (HJV)-associated haemochromatosis, is a rapidly progressing form of haemochromatosis caused by mutation in the HJV that frequently results in heart and liver failure. Herein, we describe the successful treatment of a 39-year-old woman with decompensated heart failure and liver cirrhosis requiring extracorporeal membrane oxygenation who was successfully treated with combined heart-liver transplantation. Following her life-saving multiorgan transplantation, she was also noted to have rapid correction of her serum ferritin to normal levels. She remains healthy with excellent allograft function and normal iron and ferratin levels 4 years after the procedure. To our knowledge, this case is the first demonstration that combined heart-liver transplantation is a feasible option for patients with heart and liver failure secondary to HJV-associated haemochromatosis and indeed offers a long-standing corrective solution to treat this condition and restore physiologically normal iron metabolism.

Also flagged:cellulasescellulaseprotein-secretionrapamycinavermectintylosin
Journal Article 2021-05-31 No Snippets Tu R, Zhang Y, Hua E, Bai L, Huang H, Yun K, Wang M.
Show Full Abstract

Streptomyces are one of the most important industrial microorganisms for the production of proteins and small-molecule drugs. Previously reported flow cytometry-based screening methods can only screen spores or protoplasts released from mycelium, which do not represent the filamentous stationary phase Streptomyces used in industrial cultivation. Here we show a droplet-based microfluidic platform to facilitate more relevant, reliable and rapid screening of Streptomyces mycelium, and achieved an enrichment ratio of up to 334.2. Using this platform, we rapidly characterized a series of native and heterologous constitutive promoters in Streptomyces lividans 66 in droplets, and efficiently screened out a set of engineered promoter variants with desired strengths from two synthetic promoter libraries. We also successfully screened out several hyperproducers of cellulases from a random S. lividans 66 mutant library, which had 69.2-111.4% greater cellulase production than the wild type. Our method provides a fast, simple, and powerful solution for the industrial engineering and screening of Streptomyces in more industry-relevant conditions.

Also flagged:Glucosemitochondriametabolismneurodegenerative diseasemitochondrialtumor
Journal Article 2021-05-31 ✓ 1 Snippet Han R, Liang J, Zhou B.
In-Text Gene Mentions

HD is caused by an expansion of the CAG tract within exon 1 of the huntingtin gene (htt), which encodes a polyglutamine stretch in the HTT protein.

Show Full Abstract

Glucose is the main circulating energy substrate for the adult brain. Owing to the high energy demand of nerve cells, glucose is actively oxidized to produce ATP and has a synergistic effect with mitochondria in metabolic pathways. The dysfunction of glucose metabolism inevitably disturbs the normal functioning of neurons, which is widely observed in neurodegenerative disease. Understanding the mechanisms of metabolic adaptation during disease progression has become a major focus of research, and interventions in these processes may relieve the neurons from degenerative stress. In this review, we highlight evidence of mitochondrial dysfunction, decreased glucose uptake, and diminished glucose metabolism in different neurodegeneration models such as Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD). We also discuss how hypoxia, a metabolic reprogramming strategy linked to glucose metabolism in tumor cells and normal brain cells, and summarize the evidence for hypoxia as a putative therapy for general neurodegenerative disease.

Also flagged:multiple sclerosisMSexperimental autoimmune encephalomyelitisAutoimmune Encephalomyelitischronic disease of the central nervous systemneurological disorders
Journal Article 2021-05-31 ✓ 1 Snippet Aharoni R, Eilam R, Arnon R.
In-Text Gene Mentions

The antioxidant protein peroxiredoxin 6 (PRDX6) that lowers MMP9 expression, fibrinogen leakage, and free radical damage, is also elevated in astrocytes of MS patients and EAE mice [132].

Show Full Abstract

In multiple sclerosis (MS), astrocytes respond to the inflammatory stimulation with an early robust process of morphological, transcriptional, biochemical, and functional remodeling. Recent studies utilizing novel technologies in samples from MS patients, and in an animal model of MS, experimental autoimmune encephalomyelitis (EAE), exposed the detrimental and the beneficial, in part contradictory, functions of this heterogeneous cell population. In this review, we summarize the various roles of astrocytes in recruiting immune cells to lesion sites, engendering the inflammatory loop, and inflicting tissue damage. The roles of astrocytes in suppressing excessive inflammation and promoting neuroprotection and repair processes is also discussed. The pivotal roles played by astrocytes make them an attractive therapeutic target. Improved understanding of astrocyte function and diversity, and the mechanisms by which they are regulated may lead to the development of novel approaches to selectively block astrocytic detrimental responses and/or enhance their protective properties.

Also flagged:Iron DeficiencyAnemiairon-deficiency anemiaIDAironHemoglobin
Journal Article 2021-05-31 ✓ 2 Snippets Sales CH, Rogero MM, Sarti FM, Fisberg RM.
In-Text Gene Mentions

…frequency of theHFEgene in chromosome…

…there are other non-HFE-associated hereditary hemochr…

Show Full Abstract

Anemia is a worldwide concern. This cross-sectional population-based study examined the prevalence of iron-deficiency anemia (IDA) among residents of São Paulo (<i>n</i> = 898; 12-93 years), considering sociodemographic factors, dietary iron inadequacy, and food contributors to iron intake. Blood cell count and iron biomarkers were quantified. Dietary iron intake was measured using two 24-h dietary recalls. Iron intake inadequacy was estimated using a probabilistic approach. The prevalence of anemia was 6.7%, depleted iron stores 5.1%, and IDA 1.1%. Women of all age groups, older adults, and those who were underweight or obese had the highest prevalence of anemia, and female adolescents had the highest prevalence of depleted iron stores. Female adolescents and adults were more vulnerable to depleted iron stores. Male adults and older adults had a considerable prevalence of iron overload. Except for female adolescents and adults, all groups had mild probabilities of inadequate iron intake. The main food iron contributor was wheat flour. Hemoglobin concentrations were directly associated with being an adult, having a higher income, and inversely associated with being female. Serum ferritin concentrations were directly associated with age and inversely correlated with female sex. Residents of São Paulo had a low prevalence of anemia, iron deficiency, and IDA, and sociodemographic factors interfered with these parameters.

Also flagged:tumortumorscancermetabolismChromatin remodelersgene silencing
Journal Article 2021-05-31 No Snippets Loras A, Segovia C, Ruiz-Cerdá JL.
Show Full Abstract

Bladder cancer (BC) represents a clinical, social, and economic challenge due to tumor-intrinsic characteristics, limitations of diagnostic techniques and a lack of personalized treatments. In the last decade, the use of liquid biopsy has grown as a non-invasive approach to characterize tumors. Moreover, the emergence of omics has increased our knowledge of cancer biology and identified critical BC biomarkers. The rewiring between epigenetics and metabolism has been closely linked to tumor phenotype. Chromatin remodelers interact with each other to control gene silencing in BC, but also with stress-inducible factors or oncogenic signaling cascades to regulate metabolic reprogramming towards glycolysis, the pentose phosphate pathway, and lipogenesis. Concurrently, one-carbon metabolism supplies methyl groups to histone and DNA methyltransferases, leading to the hypermethylation and silencing of suppressor genes in BC. Conversely, α-KG and acetyl-CoA enhance the activity of histone demethylases and acetyl transferases, increasing gene expression, while succinate and fumarate have an inhibitory role. This review is the first to analyze the interplay between epigenome, metabolome and cell signaling pathways in BC, and shows how their regulation contributes to tumor development and progression. Moreover, it summarizes non-invasive biomarkers that could be applied in clinical practice to improve diagnosis, monitoring, prognosis and the therapeutic options in BC.

Also flagged:TumorHead and Neck Cancershead and neck squamous cell carcinomasHNSCCcancersgenome
Journal Article 2021-05-31 ✓ 2 Snippets Qin T, Li S, Henry LE, Liu S, Sartor MA.
In-Text Gene Mentions

Walline et al., used DIPS to identify HPV insertion sites and found that 7 of 9 HPV(+) cell lines exhibited integrations in cancer-related genes including TP63, DCC, JAK1, TERT, ATR, ETV6, PGRP, PTPRN2 and TMEM237, which indicates integration is a potential carcinogenic driver [56].

…including TP63 ,DCC, JAK1 ,…

Show Full Abstract

Until recently, research on the molecular signatures of Human papillomavirus (HPV)-associated head and neck cancers mainly focused on their differences with respect to HPV-negative head and neck squamous cell carcinomas (HNSCCs). However, given the continuing high incidence level of HPV-related HNSCC, the time is ripe to characterize the heterogeneity that exists within these cancers. Here, we review research thus far on HPV-positive HNSCC molecular subtypes, and their relationship with clinical characteristics and HPV integration into the host genome. Different omics data including host transcriptomics and epigenomics, as well as HPV characteristics, can provide complementary viewpoints. Keratinization, mesenchymal differentiation, immune signatures, stromal cells and oxidoreductive processes all play important roles.

Also flagged:KinasesGSK3p38 MAPKCDKsbrain disordercognitive decline
Journal Article 2021-05-31 ✓ 5 Snippets D'Mello SR.
In-Text Gene Mentions

Although much of the currently-developed therapeutic approaches for AD target Aβ or Tau [8,9] and mut-Htt for HD [10], this review aims to impress upon the reader that the neuropathological action of these proteins requires or is regulated by the three kinases that the review focuses on and makes the case for targeting these kinases, possibly in combination with approaches that are currently being clinically tested, such as genetic knockdown or immunotherapy.

Protective phosphorylation of mut-Htt by CDK5 was confirmed in another study in primary striatal neurons from HD mice and subjected to DNA-damage using camptothecin [435].

An important target of GSK3 is HDAC3, a protein that is required for the neurotoxic effect of mut-Htt in cultured neurons [106,107] and promotes neurodegeneration and behavioral deficits in HD mice [103,104,105].

Although mut-Htt (like wild-type Htt) is expressed ubiquitously, HD is characterized by selective degeneration of medium-spiny neurons (MSNs) of the striatum and, to a lesser extent, pyramidal neurons in specific layers of the cortex [5].

Based on the finding that knockdown of Htt in adult HD mice has no obvious adverse effects, much of the current therapeutic focus has been on approaches that lower Htt/mut-Htt expression [108,109].

Show Full Abstract

Alzheimer's disease (AD) is a mostly sporadic brain disorder characterized by cognitive decline resulting from selective neurodegeneration in the hippocampus and cerebral cortex whereas Huntington's disease (HD) is a monogenic inherited disorder characterized by motor abnormalities and psychiatric disturbances resulting from selective neurodegeneration in the striatum. Although there have been numerous clinical trials for these diseases, they have been unsuccessful. Research conducted over the past three decades by a large number of laboratories has demonstrated that abnormal actions of common kinases play a key role in the pathogenesis of both AD and HD as well as several other neurodegenerative diseases. Prominent among these kinases are glycogen synthase kinase (GSK3), p38 mitogen-activated protein kinase (MAPK) and some of the cyclin-dependent kinases (CDKs). After a brief summary of the molecular and cell biology of AD and HD this review covers what is known about the role of these three groups of kinases in the brain and in the pathogenesis of the two neurodegenerative disorders. The potential of targeting GSK3, p38 MAPK and CDKS as effective therapeutics is also discussed as is a brief discussion on the utilization of recently developed drugs that simultaneously target two or all three of these groups of kinases. Multi-kinase inhibitors either by themselves or in combination with strategies currently being used such as immunotherapy or secretase inhibitors for AD and knockdown for HD could represent a more effective therapeutic approach for these fatal neurodegenerative diseases.

Also flagged:cancersdegradationsdegradationmethoxyethylene glycolhydroxy methacrylate
Journal Article 2021-05-31 No Snippets Hung SF, Wen YH, Yu LY, Chiu HC, Chiang YT, Lo CL.
Show Full Abstract

In the treatment of cancers, small interfering ribonucleic acids (siRNAs) are delivered into cells to inhibit the oncogenic protein's expression; however, polyanions, hydrophilicity, and rapid degradations in blood, endosomal or secondary lysosomal degradation hamper clinal applications. In this study, we first synthesized and characterized two copolymers: methoxy poly(ethylene glycol)-b-poly(2-hydroxy methacrylate-ketal-pyridoxal) and methoxy poly(ethylene glycol)-b-poly(methacrylic acid-co-histidine). Afterwards, we assembled two polymers with the focal adhesion kinase (FAK) siRNA, forming polyplex-mixed micelles for the treatment of the human colon cancer cell line HCT116. In terms of the physiological condition, the cationic pyridoxal molecules that were conjugated on the copolymer with ketal bonds could electrostatically attract the siRNA. Additionally, the pyridoxal could form a hydrophobic core together with the hydrophobic deprotonated histidine molecules in the other copolymer and the hydrophilic polyethylene glycol (PEG) shell to protect the siRNA. In an acidic condition, the pyridoxal would be cleaved from the polymers due to the breakage of the ketal bonds and the histidine molecules can simultaneously be protonated, resulting in the endosome/lysosome escape effect. On the basis of our results, the two copolymers were successfully prepared and the pyridoxal derivatives were identified to be able to carry the siRNA and be cleavable by the copolymers in an acidic solution. Polyplex-mixed micelles were prepared, and the micellar structures were identified. The endosome escape behavior was observed using a confocal laser scanning microscopy (CLSM). The FAK expression was therefore reduced, and the cytotoxicity of siRNA toward human colon cancer cells was exhibited, rapidly in 24 h. This exceptional anticancer efficiency suggests the potential of the pH-sensitive polyplex-mixed micellar system in siRNA delivery.

Also flagged:Soxtranscription factorsinitiationtranslationalSox transcription factorsSox2
Journal Article 2021-05-31 ✓ 5 Snippets Zhang Y, Hou L.
In-Text Gene Mentions

Deletion of Sox6 in mice leads to death two weeks after giving birth due to atrioventricular heart block and cardiac and skeletal myopathies [78].

…as Sox2, Sry,Sox6, and Sox9 allow…

…SoxA group), SOX2,SOX6(a member of…

…including Sox2, Sry,Sox6, and Sox9 fine-tune…

…coiled-coil domain ofSox6interacts with DAX-1…

Show Full Abstract

Sox proteins are known as crucial transcription factors for many developmental processes and for a wide range of common diseases. They were believed to specifically bind and bend DNA with other transcription factors and elicit transcriptional activation or repression activities in the early stage of transcription. However, their functions are not limited to transcription initiation. It has been showed that Sox proteins are involved in the regulation of alternative splicing regulatory networks and translational control. In this review, we discuss the current knowledge on how Sox transcription factors such as Sox2, Sry, Sox6, and Sox9 allow the coordination of co-transcriptional splicing and also the mechanism of SOX4-mediated translational control in the context of RNA polymerase III.

Also flagged:GlucocorticoidGlucocorticoid hormonesmood disordersschizophreniapost-traumatic stress disorderdepression
Journal Article 2021-05-31 No Snippets Mourtzi N, Sertedaki A, Charmandari E.
Show Full Abstract

Stress is defined as a state of threatened or perceived as threatened homeostasis. The well-tuned coordination of the stress response system is necessary for an organism to respond to external or internal stressors and re-establish homeostasis. Glucocorticoid hormones are the main effectors of stress response and aberrant glucocorticoid signaling has been associated with an increased risk for psychiatric and mood disorders, including schizophrenia, post-traumatic stress disorder and depression. Emerging evidence suggests that life-stress experiences can alter the epigenetic landscape and impact the function of genes involved in the regulation of stress response. More importantly, epigenetic changes induced by stressors persist over time, leading to increased susceptibility for a number of stress-related disorders. In this review, we discuss the role of glucocorticoids in the regulation of stress response, the mechanism through which stressful experiences can become biologically embedded through epigenetic alterations, and we underline potential associations between epigenetic changes and the development of stress-related disorders.

Also flagged:neurodegenerative diseaseHDHuntingtinamino acidglutaminepolyglutamine
Journal Article 2021-05-31 ✓ 5 Snippets de Armas-Rillo S, Fumagallo-Reading F, Luis-Ravelo D, Abdul-Jalbar B, González-Hernández T, Lahoz F.
In-Text Gene Mentions

We successfully used random lasing to discriminate among three cell profiles: non-transfected N2A cells, which were used as a control (NT), N2A cells transfected with a non-pathogenic form of Huntingtin (HTT-Q23), and N2A cells transfected with a pathogenic form of Huntingtin (HTT-Q74), which was used as a cell model of HD.

Huntington’s disease (HD) is an autosomal dominant, chronic, incurable neurodegenerative disease caused by an anomalous expansion of the trinucleotide sequence CAG, which encodes the amino acid glutamine within the Huntingtin gene (HTT; [19]).

Huntington’s disease (HD) is an autosomal dominant, incurable neurodegenerative disease caused by mutation in the huntingtin gene (HTT).

…huntingtin gene (HTT).…

…Huntingtin gene (HTT; [ 19…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant, incurable neurodegenerative disease caused by mutation in the huntingtin gene (<i>HTT</i>). <i>HTT</i> mutation leads to protein misfolding and aggregation, which affect cells' functions and structural features. Because these changes might modify the scattering strength of affected cells, we propose that random lasing (RL) is an appropriate technique for detecting cells that express mutated <i>HTT</i>. To explore this hypothesis, we used a cell model of HD based on the expression of two different forms-pathogenic and non-pathogenic-of <i>HTT</i>. The RL signals from both cell profiles were compared. A multivariate statistical analysis of the RL signals based on the principal component analysis (PCA) and linear discriminant analysis (LDA) techniques revealed substantial differences between cells that expressed the pathogenic and the non-pathogenic forms of <i>HTT</i>.

Also flagged:cancercolorectal cancerGene ExpressionneoantigensMMRPD1
Journal Article 2021-05-31 ✓ 1 Snippet Ma R, Qu X, Che X, Yang B, Li C, Hou K, Guo T, Xiao J, Liu Y.
In-Text Gene Mentions

…TIGIT, TNFRSF9, andTNFSF4had low expression…

Show Full Abstract

<h4>Purpose</h4>Immune checkpoints, as pivotal regulators of immune escape in cancer, can motivate the emergence of immune checkpoint inhibitors (ICIs). The aim of this study is to identify the expression of the immune checkpoint genes (ICGs) in colorectal cancer (CRC) and to relate their individual as well as combined expression to prognosis and therapeutic effectiveness in CRC.<h4>Methods</h4>RNA expression of 47 ICGs and clinical information of CRC patients were collected from two public databases to elucidate the expression levels and prognostic values of these ICGs in CRC. Then, the Shapiro-Wilk normality test was used to determine the normality of variables. Overall survival (OS) rates of each subset were found by Kaplan-Meier method, and the statistical significance was determined by the Log rank test (<i>p</i> < 0.05).<h4>Results</h4>The expression of 13 and 9 ICGs was significantly associated with CRC prognosis in The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) cohorts. A series of ICGs was found to be significantly associated with TMB, neoantigens and MMR in CRC indicating that the combination of immunotherapy treatment biomarkers and ICGs may achieve accurate prognostic stratification of CRC, and potentially identify CRC cases that might respond to checkpoint inhibitors (CPIs). The subsets of high or low PD1/PD-L1/IDO1 expression stratified by CD48 were accurately associated with prognosis in CRC. In addition, in vitro experiments confirmed that VTCN1(B7-H4)-KD increases anti-PD-L1-mediated NK cell cytotoxicity on CRC tumor cells.<h4>Conclusion</h4>Although the expression of a single immune-checkpoint molecule does not predict the efficacy of immunotherapy in CRC, our findings infer that subsets defined by ICGs are associated with prognosis and imply the possibility that VTCN1 and CD48 serve as new immunotherapeutic targets.

Also flagged:Gestational Hypertensionhypertensive disorder of pregnancygestationGHcoagulationdegranulation
Journal Article 2021-05-31 ✓ 5 Snippets Zhou C, Song C, Huang X, Chen S, Long Y, Zeng S, Yang H, Jiang M.
In-Text Gene Mentions

Although this is the first study to report on the correlation between SERPINC1 or SERPINA5 levels and GH, Auer et al demonstrated that circulating levels of SERPINA3 (another member of the same family) were increased in hypertensive placental diseases and that SERPINA3 was expressed in syncytiotrophoblast, indicating that this protein could be released into the maternal circulation by the placenta, therefore leading to increased circulating levels.12 SERPINC1 is also named antithrombin III, a physiological anticoagulative protein produced by hepatocytes.13 Recent studies have shown that thrombin is involved development of a more malignant tumor phenotype in vivo by activating tumor adhesion to the subendothelial matrix, growth, metastasis and angiogenesis.14–16 These results conclude that SERPINC1 can repress the proliferation and migration of cancer cells by interacting with thrombin.

SERPINC1 was also reported to efficiently inhibit migration and induce apoptosis of endothelial cells by perturbing focal adhesion kinase (FAK) signaling and consequently disrupting cell-matrix interactions, which inhibit tumor angiogenesis.17 The process of trophoblast invasion in placentation is similar to tumor growth and metastasis, although it is more tightly controlled.

…C member 1 (SERPINC1), serpin family A…

…a combination ofSERPINC1, CK18 and HRG…

…Plasma levels ofSERPINC1, SERPINA5, CFHR5, clusterin,…

Show Full Abstract

<h4>Background</h4>Gestational hypertension (GH), a hypertensive disorder of pregnancy (HDP), is a leading cause of maternal and fetal mortality due to the lack of clarity on its exact etiology and clinically feasible prediction models. This study was performed to discover novel biomarkers before 20 weeks gestation and thereby construct an early GH prediction model.<h4>Methods</h4>This study was designed based on differentially expressed protein screening followed by clinical validation. In the screening phase, a nested case-controlled study was conducted by plasma proteomic analyses using label-free LC-MS/MS and plasma samples from seven pre-GH cases before 20-week gestation and seven age- and gestational week-matched controls. In the validation phase, 10 proteins with differential expression in the screening phase were validated by ELISA or electrochemiluminescence in an independent study consisting of 29 pre-GH cases before 20-week gestation and 29 matched controls.<h4>Results</h4>In the screening phase, 149 proteins were found to be differentially expressed between the two groups and were predominantly involved in complement and coagulation cascades, platelet degranulation and positive regulation of cell motility. Further validation showed that serpin family C member 1 (SERPINC1), serpin family A member 5 (SERPINA5), complement factor H-related protein 5 (CFHR5), clusterin, cytokeratin 18 (CK18) and histidine-rich glycoprotein (HRG) levels were significantly higher in women who later developed GH compared to women with uncomplicated pregnancies (<i>P</i><0.05). Binary logistic regression analysis was used to determine the combination efficacy of models for early prediction of GH. The model with a combination of SERPINC1, CK18 and HRG had a significantly better discriminatory power (AUC = 0.91, 95% CI 0.83-0.98) compared to the models with those proteins alone as independent predictors of GH.<h4>Conclusion</h4>Plasma levels of SERPINC1, SERPINA5, CFHR5, clusterin, CK18 and HRG are potential novel predictive biomarkers of GH, and a prediction model using a combination of SERPINC1, CK18 and HRG has good discriminatory performance for GH before 20 weeks gestation.

Also flagged:staphylococcal mastitisHPserum amyloid ASAApathogenesisacute phase response
Journal Article 2021-05-31 No Snippets El-Deeb W, Fayez M, Alhumam N, Elsohaby I, Quadri SA, Mkrtchyan H.
Show Full Abstract

Staphylococcal mastitis (SM) is a frequent disease in the dairy cattle that is costly to treat. This study aimed to investigate the alterations in the levels of procalcitonin (PCT), neopterin (NPT), haptoglobin (HP), serum amyloid A (SAA), proinflammatory cytokines (IL-1<i>β</i>, IL-8, TNF-<i>α</i>, IF-<i>γ</i>) and oxidative stress (OS) biomarkers in Holstein dairy cows with SM under field conditions. In addition, we also evaluated the role of examined biomarkers in disease pathogenesis and their use as diagnostic biomarkers for the disease in dairy cows. Fifty-three dairy cows with SM, including those with infections caused by <i>Staphylococcus aureus</i> (<i>n</i> = 42) and methicillin resistant <i>S. aureus</i> (MRSA) (<i>n</i> = 11) were selected for this study. In addition, 20 healthy dairy cows were enrolled as a control group. Higher serum levels of PCT, NP, IL-1<i>β</i>, IL-8, TNF-<i>α</i>, IF-<i>γ</i>, HP and SAA and a state of OS was detected in SM group in comparison with the controls. Moreover, the levels of all examined biomarkers in mastitic cows with <i>S. aureus</i> when compared with those infected with MRSA was not significantly different. All examined biomarkers demonstrated a significant degree of discrimination between SM cows and healthy controls (the area under the curve (AUC) ranged from 83.6 for <i>S</i>AA to 100 for PCT). Our study showed that SM in dairy cows was associated with substantial changes in serum PCT, NPT, Acute phase proteins (APPs), proinflammatory cytokines, and OS levels. This study demonstrates that clinical examination in tandem with quantification of PCT, NPT, APPs and cytokines, OS biomarkers could be a useful assessment tool for SM in dairy cows.

Also flagged:somatosensationinnervationtouch receptorFLPmicrotubuleaxons
Journal Article 2021-05-31 No Snippets Yin C, Peterman E, Rasmussen JP, Parrish JZ.
Show Full Abstract

Somatosensory neurons (SSNs) densely innervate our largest organ, the skin, and shape our experience of the world, mediating responses to sensory stimuli including touch, pressure, and temperature. Historically, epidermal contributions to somatosensation, including roles in shaping innervation patterns and responses to sensory stimuli, have been understudied. However, recent work demonstrates that epidermal signals dictate patterns of SSN skin innervation through a variety of mechanisms including targeting afferents to the epidermis, providing instructive cues for branching morphogenesis, growth control and structural stability of neurites, and facilitating neurite-neurite interactions. Here, we focus onstudies conducted in worms (<i>Caenorhabditis elegans</i>), fruit flies (<i>Drosophila melanogaster</i>), and zebrafish (<i>Danio rerio</i>): prominent model systems in which anatomical and genetic analyses have defined fundamental principles by which epidermal cells govern SSN development.

Also flagged:Secretionestrous cyclessubfertilityluteinizing hormoneLHovulation
Journal Article 2021-05-31 No Snippets Guo Y, Wu Y, Shi J, Zhuang H, Ci L, Huang Q, Wan Z, Yang H, Zhang M, Tan Y, Sun R, Xu L, Wang Z, Shen R, Fei J.
Show Full Abstract

<i>miR-29a/b<sub>1</sub></i> was reportedly involved in the regulation of the reproductive function in female mice, but the underlying molecular mechanisms are not clear. In this study, female mice lacking <i>miR-29a/b<sub>1</sub></i> showed a delay in vaginal opening, irregular estrous cycles, ovulation disorder and subfertility. The level of luteinizing hormone (LH) was significantly lower in plasma but higher in pituitary of mutant mice. However, egg development was normal in mutant mice and the ovulation disorder could be rescued by the superovulation treatment. These results suggested that the LH secretion was impaired in mutant mice. Further studies showed that deficiency of <i>miR-29a/b<sub>1</sub></i> in mice resulted in an abnormal expression of a number of proteins involved in vesicular transport and exocytosis in the pituitary, indicating the mutant mice had insufficient LH secretion. However, the detailed mechanism needs more research.

Also flagged:Oral Squamous Cell CarcinomaOSCCcancer of the oral cavitytumorsPTK6mismatch repair
Journal Article 2021-05-31 ✓ 1 Snippet Patel K, Bhat FA, Patil S, Routray S, Mohanty N, Nair B, Sidransky D, Ganesh MS, Ray JG, Gowda H, Chatterjee A.
In-Text Gene Mentions

…, BRINP1 ,CACNA1E, CNTRL ,…

Show Full Abstract

Oral squamous cell carcinoma (OSCC) is a common cancer of the oral cavity in India. Cigarette smoking and chewing tobacco are known risk factors associated with OSCC. However, genomic alterations in OSCC with varied tobacco consumption history are not well-characterized. In this study, we carried out whole-exome sequencing to characterize the mutational landscape of OSCC tumors from subjects with different tobacco consumption habits. We identified several frequently mutated genes, including <i>TP53</i>, <i>NOTCH1</i>, <i>CASP8</i>, <i>RYR2</i>, <i>LRP2</i>, <i>CDKN2A</i>, and <i>ATM</i>. <i>TP53</i> and <i>HRAS</i> exhibited mutually exclusive mutation patterns. We identified recurrent amplifications in the 1q31, 7q35, 14q11, 22q11, and 22q13 regions and observed amplification of <i>EGFR</i> in 25% of samples with tobacco consumption history. We observed genomic alterations in several genes associated with PTK6 signaling. We observed alterations in clinically actionable targets including <i>ERBB4</i>, <i>HRAS</i>, <i>EGFR</i>, <i>NOTCH1</i>, <i>NOTCH4</i>, and <i>NOTCH3</i>. We observed enrichment of signature 29 in 40% of OSCC samples from tobacco chewers. Signature 15 associated with defective DNA mismatch repair was enriched in 80% of OSCC samples. <i>NOTCH1</i> was mutated in 36% of samples and harbored truncating as well as missense variants. We observed copy number alterations in 67% of OSCC samples. Several genes associated with non-receptor tyrosine kinase signaling were affected in OSCC. These molecules can serve as potential candidates for therapeutic targeting in OSCC.

Also flagged:Hirschsprung diseaseHSCRDown syndromechromosomepathogenesisDSCAM
Journal Article 2021-05-31 ✓ 4 Snippets Lu YJ, Yu WW, Cui MM, Yu XX, Song HL, Bai MR, Wu WJ, Gu BL, Wang J, Cai W, Chu X.
In-Text Gene Mentions

In addition, DSCAM and deleted in colorectal carcinomas (DCC) are both receptors of netrin-1, which serves as an important axon guidance cue during neural development (Ly et al., 2008).

…colorectal carcinomas (DCC) are both…

…Deficiency ofDccresulted in loss…

…of netrin-1 /DCC/ DSCAM pathway…

Show Full Abstract

Hirschsprung disease (HSCR) has a higher incidence in children with Down syndrome (DS), which makes trisomy 21 a predisposing factor to HSCR. <i>DSCAM</i> and <i>BACE2</i> are close together on the HSCR-associated critical region of chromosome 21. Common variants of <i>DSCAM</i> and rare variants of <i>BACE2</i> were implicated to be associated with sporadic HSCR. However, the submucosal neuron defect of DS mouse model could not be rescued by normalization of <i>Dscam</i>. We aimed to explore the contribution of <i>DSCAM</i> and <i>BACE2</i> to the development of the enteric nervous system (ENS) and HSCR susceptibility. We genotyped 133 tag single-nucleotide polymorphisms (SNPs) in <i>DSCAM</i> and <i>BACE2</i> gene region in 420 HSCR patients and 1,665 controls of Han Chinese. Expression of <i>DSCAM</i> and <i>BACE2</i> homologs was investigated in the developing gut of zebrafish. Overexpression and knockdown of the homologs were performed in zebrafish to investigate their roles in the development of ENS. Two <i>DSCAM</i> SNPs, rs430255 (<i>P</i> <sub><i>Addtive</i></sub> = 0.0052, <i>OR</i> = 1.36, 95% CI: 1.10-1.68) and rs2837756 (<i>P</i> <sub><i>Addtive</i></sub> = 0.0091, <i>OR</i> = 1.23, 95% CI: 1.05-1.43), showed suggestive association with HSCR risk. Common variants in <i>BACE2</i> were not associated with HSCR risk. We observed <i>dscama</i>, <i>dscamb</i>, and <i>bace2</i> expression in the developing gut of zebrafish. Knockdown of <i>dscama</i>, <i>dscamb</i>, and <i>bace2</i> caused a reduction of enteric neurons in the hindgut of zebrafish. Overexpression of <i>DSCAM</i> and <i>bace2</i> had no effects on neuron number in the hindgut of zebrafish. Our results suggested that common variation of <i>DSCAM</i> contributed to HSCR risk in Han Chinese. The dysfunction of both <i>dscams</i> and <i>bace2</i> caused defects in enteric neuron, indicating that <i>DSCAM</i> and <i>BACE2</i> might play functional roles in the occurrence of HSCR. These novel findings might shed new light on the pathogenesis of HSCR.

Also flagged:Rho GTPasesubiquitin E3 ligasesdegradationbindingubiquitin E3 ligasesmall GTPases
Journal Article 2021-05-31 No Snippets Podieh F, Hordijk PL.
Show Full Abstract

Cullin3-based ubiquitin E3 ligases induce ubiquitination of substrates leading to their proteasomal or lysosomal degradation. BTB proteins serve as adaptors by binding to Cullin3 and recruiting substrate proteins, which enables specific recognition of a broad spectrum of targets. Hence, Cullin3 and its adaptors are involved in myriad cellular processes and organ functions. Cullin3-based ubiquitin E3 ligase complexes target small GTPases of the Rho subfamily, which are key regulators of cytoskeletal dynamics and cell adhesion. In this mini review, we discuss recent insights in Cullin3-mediated regulation of Rho GTPases and their impact on cellular function and disease. Intriguingly, upstream regulators of Rho GTPases are targeted by Cullin3 complexes as well. Thus, Rho GTPase signaling is regulated by Cullin3 on multiple levels. In addition, we address current knowledge of Cullin3 in regulating vascular function, focusing on its prominent role in endothelial barrier function, angiogenesis and the regulation of blood pressure.

Also flagged:Inflammatory cytokinesinflammatory bowel diseasesimmune responsesparasitic infectionstype 2 cytokinesulcerative colitis
Journal Article 2021-05-31 ✓ 1 Snippet Gonzalez Acera M, Patankar JV, Diemand L, Siegmund B, Neurath MF, Wirtz S, Becker C.
In-Text Gene Mentions

…the datasets wereTNFSF4, DENND1B, STAT6 ,…

Show Full Abstract

Inflammatory cytokines initiate and sustain the perpetuation of processes leading to chronic inflammatory conditions such as inflammatory bowel diseases (IBD). The nature of the trigger causing an inflammatory reaction decides whether type 1, type 17, or type 2 immune responses, typically characterized by the respective T- helper cell subsets, come into effect. In the intestine, Type 2 responses have been linked with mucosal healing and resolution upon an immune challenge involving parasitic infections. However, type 2 cytokines are frequently elevated in certain types of IBD in particular ulcerative colitis (UC) leading to the assumption that Th2 cells might critically support the pathogenesis of UC raising the question of whether such elevated type 2 responses in IBD are beneficial or detrimental. In line with this, previous studies showed that suppression of IL-13 and other type 2 related molecules in murine models could improve the outcomes of intestinal inflammation. However, therapeutic attempts of neutralizing IL-13 in ulcerative colitis patients have yielded no benefits. Thus, a better understanding of the role of type 2 cytokines in regulating intestinal inflammation is required. Here, we took a comparative transcriptomic approach to address how Th2 responses evolve in different mouse models of colitis and human IBD datasets. Our data show that type 2 immune-related transcripts are induced in the inflamed gut of IBD patients in both Crohn's disease and UC and across widely used mouse models of IBD. Collectively our data implicate that the presence of a type 2 signature rather defines a distinct state of intestinal inflammation than a disease-specific pathomechanism.

Also flagged:lung cancercancernon-small cell lung cancerNSCLCcancersadenocarcinoma
Journal Article 2021-05-31 No Snippets Huang L, Rong Y, Tang X, Yi K, Wu J, Wang F.
Show Full Abstract

The high incidence and mortality of lung cancer make early detection of lung cancer particularly important. At present, the diagnosis of lung cancer mainly depends on diagnostic imaging and tissue biopsy. However, current diagnostics are not satisfactory owing to the low specificity and inability of multiple sampling. Accumulating evidence indicates that circular RNAs (circRNAs) play a critical role in cancer progression and are promising cancer biomarkers. In particular, circRNAs are considered novel specific diagnostic markers for non-small cell lung cancer (NSCLC). Liquid biopsy is an important method in the early diagnosis of cancer due to its high sensitivity and specificity, as well as the possibility of performing multiple sampling. circRNAs are stably present in exosomes and sometimes become part of circulating nucleic acids, making them ideal for liquid biopsy. In this review, we summarize the advances in the research on circRNAs in NSCLC, and also highlight their potential applications for NSCLC detection.

Also flagged:BiopolymerAdsorptionHalloysite nanotubescadmiumcoppernickel
Journal Article 2021-05-31 No Snippets Hassan M, Hassan M, Liu Y, Naidu R, Naidu R, Du J, Qi F, Donne SW, Islam MM.
Show Full Abstract

Halloysite nanotubes (HNT) and ball-milled biochar (BC) incorporated biocompatible mesoporous adsorbents (HNT-BC@Alg) were synthesized for adsorption of aqueous heavy-metal ions. HNT-BC@Alg outperformed the BC, HNT, and BC@Alg in removing cadmium (Cd), copper (Cu), nickel (Ni), and lead (Pb). Mesoporous structure (∼7.19 to 7.56 nm) of HNT-BC@Alg was developed containing an abundance of functional groups induced from encapsulated BC and tubular HNT, which allowed heavy metals to infiltrate and interact with the adsorbents. Siloxane groups from HNT, oxygen-containing functional groups from BC, and hydroxyl and carboxyl groups from alginate polymer play a significant role in the adsorption of heavy-metal ions. The removal percentage of heavy metals was recorded as Pb (∼99.97 to 99.05%) > Cu (∼95.01 to 90.53%) > Cd (∼92.5 to 55.25%) > Ni (∼80.85 to 50.6%), even in the presence of 0.01/0.001 M of CaCl<sub>2</sub> and Na<sub>2</sub>SO<sub>4</sub> as background electrolytes and charged organic molecule under an environmentally relevant concentration (200 μg/L). The maximum adsorption capacities of Ni, Cd, Cu, and Pb were calculated as 2.85 ± 0.08, 6.96 ± 0.31, 16.87 ± 1.50, and 26.49 ± 2.04 mg/g, respectively. HNT-BC@Alg has fast sorption kinetics and maximum adsorption capacity within a short contact time (∼2 h). Energy-dispersive X-ray spectroscopy (EDS) elemental mapping exhibited that adsorbed heavy metals co-distributed with Ca, Si, and Al. The reduction of surface area, pore volume, and pore area of HNT-BC@Alg (after sorption of heavy metals) confirms that mesoporous surface (2-18 nm) supports diffusion, infiltration, and interaction. However, a lower range of mesoporous diameter of the adsorbent is more suitable for the adsorption of heavy-metal ions. The adsorption isotherm and kinetics fitted well with the Langmuir isotherm and the pseudo-second-order kinetic models, demonstrating the monolayer formation of heavy-metal ions through both the physical sorption and chemical sorption, including pore filling, ion exchange, and electrostatic interaction.

Also flagged:Idiopathic hypoparathyroidismhypocalcaemiahypoparathyroidismpsychosisgeneralized parasthesiasextrapyramidal syndrome
Journal Article 2021-05-31 ✓ 1 Snippet Kaeley N, Baid H, Chawang H, Vempalli N.
In-Text Gene Mentions

…mmune polyendocrine syndromes,hemochromatosis, magnesium deficiency and…

Show Full Abstract

Idiopathic hypoparathyroidism is one of the important and treatable causes of hypocalcaemia. Patients with hypocalcaemia as a consequence of hypoparathyroidism can have varied neuropsychiatric presentations such as intractable seizures, depressive symptoms, psychosis, generalized parasthesias and extrapyramidal syndrome. Many times these patients are being wrongly treated as a case of depression without addressing the underlying cause. We present a case of 26-year-old female patient who presented in emergency with multiple episodes of complex partial seizures since the last 6 months and under the treatment for depression for 2 years. She was diagnosed as a case of hypocalcemia and hypoparathyroidism was considered as the underlying cause.

Also flagged:SecretionDRXproALTtumorsmemory
Journal Article 2021-05-31 No Snippets Yu J, Liu S, Wang Y, He X, Zhang Q, Qi Y, Zhou D, Xie Z, Li X, Huang Y.
Show Full Abstract

The combination of tumor ablation and immunotherapy is a promising strategy against tumor relapse and metastasis. Photothermal therapy (PTT) triggers the release of tumor-specific antigens and damage associated molecular patterns (DAMPs) in-situ. However, the immunosuppressive tumor microenvironment restrains the activity of the effector immune cells. Therefore, systematic immunomodulation is critical to stimulate the tumor microenvironment and augment the anti-tumor therapeutic effect. To this end, polyethylene glycol (PEG)-stabilized platinum (Pt) nanoparticles (Pt NPs) conjugated with a PD-L1 inhibitor (BMS-1) through a thermo-sensitive linkage were constructed. Upon near-infrared (NIR) exposure, BMS-1 was released and maleimide (Mal) was exposed on the surface of Pt NPs, which captured the antigens released from the ablated tumor cells, resulting in the enhanced antigen internalization and presentation. In addition, the Pt NPs acted as immune adjuvants by stimulating dendritic cells (DCs) maturation. Furthermore, BMS-1 relieved T cell exhaustion and induced the infiltration of effector T cells into the tumor tissues. Thus, Pt NPs can ablate tumors through PTT, and augment the anti-tumor immune response through enhanced antigen presentation and T cells infiltration, thereby preventing tumor relapse and metastasis.

Also flagged:serotonin transportersynapticmood disorderslong-term potentiationlong-term depressioncell proliferation
Journal Article 2021-05-30 ✓ 5 Snippets Wilson C, Rogers J, Chen F, Li S, Adlard PA, Hannan AJ, Renoir T.
In-Text Gene Mentions

…in serotonin transporter (5-HTT) knockout (KO) mice.…

…reduced LTP in5-HTTKO mice that…

…appeared normal in5-HTTKO, exercise decreased…

…both WT and5-HTTKO mice.…

…Furthermore, although5-HTTKO mice had…

Show Full Abstract

Deficits in hippocampal cellular and synaptic plasticity are frequently associated with cognitive and mood disorders, and indeed common mechanisms of antidepressants are thought to involve neuroplastic processes. Here, we investigate hippocampal adult-born cell survival and synaptic plasticity (long-term potentiation, LTP, and long-term depression, LTD) in serotonin transporter (5-HTT) knockout (KO) mice. From 8 weeks of age, mice either continued in standard-housing conditions or were given access to voluntary running wheels for 1 month. Electrophysiology was performed on hippocampal slices to measure LTP and LTD, and immunohistochemistry was used to assess cell proliferation and subsequent survival in the dentate gyrus. The results revealed a reduced LTP in 5-HTT KO mice that was restored to wild-type (WT) levels after chronic exercise. While LTD appeared normal in 5-HTT KO, exercise decreased the magnitude of LTD in both WT and 5-HTT KO mice. Furthermore, although 5-HTT KO mice had normal hippocampal adult-born cell survival, they did not benefit from the pro-proliferative effects of exercise observed in WT animals. Taken together, these findings suggest that reduced 5-HTT expression is associated with significant alterations to functional neuroplasticity. Interestingly, 5-HTT appeared necessary for exercise-induced augmentation of adult-born hippocampal cell survival, yet exercise corrected the LTP impairment displayed by 5-HTT KO mice. Together, our findings further highlight the salience of serotonergic signalling in mediating the neurophysiological benefits of exercise.

Also flagged:neurogenesismemoryZMAT4NR2F2learning or memorySLC6A13
Journal Article 2021-05-30 ✓ 1 Snippet Zhang H, Li J, Ren J, Sun S, Ma S, Zhang W, Yu Y, Cai Y, Yan K, Li W, Hu B, Chan P, Zhao GG, Belmonte JCI, Zhou Q, Qu J, Wang S, Liu GH.
In-Text Gene Mentions

…TEAD1 for NSC,SOX6for OPC, CREB5…

Show Full Abstract

The hippocampus plays a crucial role in learning and memory, and its progressive deterioration with age is functionally linked to a variety of human neurodegenerative diseases. Yet a systematic profiling of the aging effects on various hippocampal cell types in primates is still missing. Here, we reported a variety of new aging-associated phenotypic changes of the primate hippocampus. These include, in particular, increased DNA damage and heterochromatin erosion with time, alongside loss of proteostasis and elevated inflammation. To understand their cellular and molecular causes, we established the first single-nucleus transcriptomic atlas of primate hippocampal aging. Among the 12 identified cell types, neural transiently amplifying progenitor cell (TAPC) and microglia were most affected by aging. In-depth dissection of gene-expression dynamics revealed impaired TAPC division and compromised neuronal function along the neurogenesis trajectory; additionally elevated pro-inflammatory responses in the aged microglia and oligodendrocyte, as well as dysregulated coagulation pathways in the aged endothelial cells may contribute to a hostile microenvironment for neurogenesis. This rich resource for understanding primate hippocampal aging may provide potential diagnostic biomarkers and therapeutic interventions against age-related neurodegenerative diseases.

Also flagged:spinocerebellar ataxiaataxiacerebellar cognitive affective syndromeSCA48cerebellar atrophyHSC70-interacting protein
Journal Article 2021-05-30 No Snippets Pakdaman Y, Berland S, Bustad HJ, Erdal S, Thompson BA, James PA, Power KN, Ellingsen S, Krooni M, Berge LI, Sexton A, Bindoff LA, Knappskog PM, Johansson S, Aukrust I.
Show Full Abstract

Variants in <i>STUB1</i> cause both autosomal recessive (SCAR16) and dominant (SCA48) spinocerebellar ataxia. Reports from 18 <i>STUB1</i> variants causing SCA48 show that the clinical picture includes later-onset ataxia with a cerebellar cognitive affective syndrome and varying clinical overlap with SCAR16. However, little is known about the molecular properties of dominant <i>STUB1</i> variants. Here, we describe three SCA48 families with novel, dominantly inherited <i>STUB1</i> variants (p.Arg51_Ile53delinsProAla, p.Lys143_Trp147del, and p.Gly249Val). All the patients developed symptoms from 30 years of age or later, all had cerebellar atrophy, and 4 had cognitive/psychiatric phenotypes. Investigation of the structural and functional consequences of the recombinant C-terminus of HSC70-interacting protein (CHIP) variants was performed in vitro using ubiquitin ligase activity assay, circular dichroism assay and native polyacrylamide gel electrophoresis. These studies revealed that dominantly and recessively inherited <i>STUB1</i> variants showed similar biochemical defects, including impaired ubiquitin ligase activity and altered oligomerization properties of the CHIP. Our findings expand the molecular understanding of SCA48 but also mean that assumptions concerning unaffected carriers of recessive <i>STUB1</i> variants in SCAR16 families must be re-evaluated. More investigations are needed to verify the disease status of SCAR16 heterozygotes and elucidate the molecular relationship between SCA48 and SCAR16 diseases.

Also flagged:organizationbiosynthesistransmembrane proteinsribosomesendoplasmic reticulummembranes
Journal Article 2021-05-30 ✓ 1 Snippet Lashkevich KA, Dmitriev SE.
In-Text Gene Mentions

…vertebrate neurons, includingSTAU1and STAU2 (homologues…

Show Full Abstract

Spatial organization of protein biosynthesis in the eukaryotic cell has been studied for more than fifty years, thus many facts have already been included in textbooks. According to the classical view, mRNA transcripts encoding secreted and transmembrane proteins are translated by ribosomes associated with endoplasmic reticulum membranes, while soluble cytoplasmic proteins are synthesized on free polysomes. However, in the last few years, new data has emerged, revealing selective translation of mRNA on mitochondria and plastids, in proximity to peroxisomes and endosomes, in various granules and at the cytoskeleton (actin network, vimentin intermediate filaments, microtubules and centrosomes). There are also long-standing debates about the possibility of protein synthesis in the nucleus. Localized translation can be determined by targeting signals in the synthesized protein, nucleotide sequences in the mRNA itself, or both. With RNA-binding proteins, many transcripts can be assembled into specific RNA condensates and form RNP particles, which may be transported by molecular motors to the sites of active translation, form granules and provoke liquid-liquid phase separation in the cytoplasm, both under normal conditions and during cell stress. The translation of some mRNAs occurs in specialized "translation factories," assemblysomes, transperons and other structures necessary for the correct folding of proteins, interaction with functional partners and formation of oligomeric complexes. Intracellular localization of mRNA has a significant impact on the efficiency of its translation and presumably determines its response to cellular stress. Compartmentalization of mRNAs and the translation machinery also plays an important role in viral infections. Many viruses provoke the formation of specific intracellular structures, virus factories, for the production of their proteins. Here we review the current concepts of the molecular mechanisms of transport, selective localization and local translation of cellular and viral mRNAs, their effects on protein targeting and topogenesis, and on the regulation of protein biosynthesis in different compartments of the eukaryotic cell. Special attention is paid to new systems biology approaches, providing new cues to the study of localized translation.

Also flagged:PathogenesisIntrahepatic cholestasis of pregnancyliver diseaseskinpruritusbile acids
Journal Article 2021-05-30 No Snippets Xiao J, Li Z, Song Y, Sun Y, Shi H, Chen D, Zhang Y.
Show Full Abstract

Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-specific liver disease. The maternal symptoms are characterized by skin pruritus and elevated bile acids, causing several adverse outcomes for fetuses, including an increased risk of preterm birth, meconium-stained amniotic fluid, neonatal depression, respiratory distress syndrome, and stillbirth. Genetic, hormonal, immunological, and environmental factors contribute to the pathogenesis of ICP, and the estrogen-bile acid axis is thought to play a dominant role. The advances in the past 10 years uncover more details of this axis. Moreover, dysregulation of extracellular matrix and oxygen supply, organelle dysfunction, and epigenetic changes are also found to cause ICP, illuminating more potential drug targets for interfering with. Here, we summarize the molecular pathogenesis of ICP with an emphasis on the advancement in the past 10 years, aiming to give an updated full view of this field.

bioRxiv 2021-05-30 Preprint (No Snippets API) Liu Z, Duan X, Sun X, Zhong J, Zhong W, Yu B, Zhao Z, Mai Z, Liu H, Li S, Wu W, Zeng G.
Show Full Abstract

Randall’s plaque is significantly associated with the occurrence of nephrolithiasis. However, the microenvironment of Randall’s plaque is poorly characterized. To investigate the microenvironment of Randall’s plaque, we analyzed single-cell RNA data of 3 Randall’s plaque and 3 normal renal papillae tissue and identified 11 different cell types. We screened differentially expressed genes among all cell types between Randall’s plaque and normal renal papillae. The microenvironment showed two cell types with multiple stone formation-associated transcriptomic programs. Contrary to previous studies, we did not observe macrophage M1/M2 imbalance. Notably, we detected ossification-associated macrophage is enriched in Randall’s plaque and validated GPNMB and ACP5 were potential biomarkers on the ossification-associated macrophage. We also identified an endothelial subset harboring active communication (COL15A1+ PCDH17+ endothelial, DPECs) with other cells. Together with Immunofluorescence, we validated ossification-associated macrophage and DPECs are enriched in Randall’s plaque tissue. Finally, cell-to-cell communication revealed that Loop of Henle, DPECs, and osteoblasts-associated macrophages was the main source of SPP1 signaling. Our work will further the understanding of the microenvironment among Randall’s plaque tissues and provide deep insight into immune modulation.

Also flagged:spinal cord injuriesaxonprotein synthesisgrowth conescollagengene expressions
Journal Article 2021-05-29 ✓ 1 Snippet Zhang N, Lin J, Lin VPH, Milbreta U, Chin JS, Chew EGY, Lian MM, Foo JN, Zhang K, Wu W, Chew SY.
In-Text Gene Mentions

…transcription factor 6 (Sox6), 2’,3’‐cyclic nucleotide 3’…

Show Full Abstract

Current treatment approaches toward spinal cord injuries (SCI) have mainly focused on overcoming the inhibitory microenvironment that surrounds lesion sites. Unfortunately, the mere modulation of the cell/tissue microenvironment is often insufficient to achieve desired functional recovery. Therefore, stimulating the intrinsic growth ability of injured neurons becomes crucial. MicroRNAs (miRs) play significant roles during axon regeneration by regulating local protein synthesis at growth cones. However, one challenge of using miRs to treat SCI is the lack of efficient delivery approaches. Here, a 3D fiber-hydrogel scaffold is introduced which can be directly implanted into a spinal cord transected rat. This 3D scaffold consists of aligned electrospun fibers which provide topographical cues to direct axon regeneration, and collagen matrix which enables a sustained delivery of miRs. Correspondingly, treatment with Axon miRs (i.e., a cocktail of miR-132/miR-222/miR-431) significantly enhances axon regeneration. Moreover, administration of Axon miRs along with anti-inflammatory drug, methylprednisolone, synergistically enhances functional recovery. Additionally, this combined treatment also decreases the expression of pro-inflammatory genes and enhance gene expressions related to extracellular matrix deposition. Finally, increased Axon miRs dosage with methylprednisolone, significantly promotes functional recovery and remyelination. Altogether, scaffold-mediated Axon miR treatment with methylprednisolone is a promising therapeutic approach for SCI.

Also flagged:Haemochromatosischronic kidney diseasePrimary haemochromatosishereditary haemochromatosisironarterial hypertension
Journal Article 2021-05-29 ✓ 5 Snippets Zakrocka I, Baranowicz-Gąszczyk I, Załuska W.
In-Text Gene Mentions

…the haemochromatosis gene (HFE).…

…in patients withoutHFEmutations or other…

…genetic study showedHFEC282Y heterozygosity.…

…occur in heterozygoticHFEpatients after kidney…

…Mutations inHFE, including C282Y and…

Show Full Abstract

<h4>Background</h4>Iron overload is inevitably related to chronic kidney disease (CKD) treatment. Haemochromatosis leads to multiorgan damage and is associated with increased mortality. Primary haemochromatosis is the most common autosomal recessive disease in white populations. In most cases, the classic form of hereditary haemochromatosis is caused by mutations, mainly C282Y and H63D, in the haemochromatosis gene (HFE). Secondary haemochromatosis can be triggered by iron administration and blood transfusions. Haemochromatosis is rarely reported in kidney transplant recipients. Atypical factors may evoke haemochromatosis in patients without HFE mutations or other standard risk factors.<h4>Case presentation</h4>In the current study, we present a patient who started to have haemochromatosis symptoms after kidney transplantation. A 37-year-old man after kidney transplantation from a deceased donor was admitted to the hospital due to high serum ferritin levels and impaired graft function. The patient's past medical history included arterial hypertension, embolization of both renal arteries and necrosis of the left femoral head. Glomerulonephritis was suspected as a cause of CKD; however, severe kidney failure was diagnosed, kidney biopsy was not performed, and the patient started intermittent haemodialysis. While on dialysis to treat anaemia, the patient had received erythropoietin and iron intravenously, and the maximal serum ferritin level was 2115 ng/ml. After kidney transplantation, ferritin levels started to increase rapidly, with a maximum level of 9468 ng/ml one and a half years after surgery. His genetic study showed HFE C282Y heterozygosity. Symptoms of haemochromatosis, such as skin hyperpigmentation, elevated activity of aminotransferases, impaired glucose tolerance and heart failure, were observed. Therapeutic phlebotomy was started, and 36 procedures were performed. After treatment, graft function significantly improved, most haemochromatosis symptoms resolved, and the serum ferritin level significantly decreased.<h4>Conclusions</h4>Haemochromatosis can occur in heterozygotic HFE patients after kidney transplantation. Iron administration, infections, type of immunosuppression and liver dysfunction should be considered potential triggers of haemochromatosis in this group of patients.

Also flagged:Synthesisoleic acidL-cysteinecarbodiimideamidecarboxylic acid
Journal Article 2021-05-29 No Snippets Vizcarra-Pacheco M, Ley-Flores M, Matrecitos-Burruel AM, López-Esparza R, Fernández-Quiroz D, Lucero-Acuña A, Zavala-Rivera P.
Show Full Abstract

One of the main challenges facing materials science today is the synthesis of new biodegradable and biocompatible materials capable of improving existing ones. This work focused on the synthesis of new biomaterials from the bioconjugation of oleic acid with L-cysteine using carbodiimide. The resulting reaction leads to amide bonds between the carboxylic acid of oleic acid and the primary amine of L-cysteine. The formation of the bioconjugate was corroborated by Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy, and nuclear magnetic resonance (NMR). In these techniques, the development of new materials with marked differences with the precursors was confirmed. Furthermore, NMR has elucidated a surfactant structure, with a hydrophilic part and a hydrophobic section. Ultraviolet-visible spectroscopy (UV-Vis) was used to determine the critical micellar concentration (CMC) of the bioconjugate. Subsequently, light diffraction (DLS) was used to analyze the size of the resulting self-assembled structures. Finally, transmission electron microscopy (TEM) was obtained, where the shape and size of the self-assembled structures were appreciated.

Also flagged:mtROS18Smitochondrialileitismitochondrial-targetedCD
Journal Article 2021-05-29 ✓ 1 Snippet Alula KM, Jackson DN, Smith AD, Kim DS, Turner K, Odstrcil E, Kaipparettu BA, Dassopoulos T, Venuprasad K, Feagins LA, Theiss AL.
In-Text Gene Mentions

…ACADS, ACOT12, ACOX1,ECI2, FAAH).…

Show Full Abstract

Paneth cell defects in Crohn's disease (CD) patients (called the Type I phenotype) are associated with worse clinical outcomes. Recent studies have implicated mitochondrial dysfunction in Paneth cells as a mediator of ileitis in mice. We hypothesized that CD Paneth cells exhibit impaired mitochondrial health and that mitochondrial-targeted therapeutics may provide a novel strategy for ileal CD. Terminal ileal mucosal biopsies from adult CD and non-IBD patients were characterized for Paneth cell phenotyping and mitochondrial damage. To demonstrate the response of mitochondrial-targeted therapeutics in CD, biopsies were treated with vehicle or Mito-Tempo, a mitochondrial-targeted antioxidant, and RNA transcriptome was analyzed. During active CD inflammation, the epithelium exhibited mitochondrial damage evident in Paneth cells, goblet cells, and enterocytes. Independent of inflammation, Paneth cells in Type I CD patients exhibited mitochondrial damage. Mito-Tempo normalized the expression of interleukin (IL)-17/IL-23, lipid metabolism, and apoptotic gene signatures in CD patients to non-IBD levels. When stratified by Paneth cell phenotype, the global tissue response to Mito-Tempo in Type I patients was associated with innate immune, lipid metabolism, and G protein-coupled receptor (GPCR) gene signatures. Targeting impaired mitochondria as an underlying contributor to inflammation provides a novel treatment approach for CD.

Also flagged:PERKATF4Sorafenibkinasehepatocellular carcinomacancer
Journal Article 2021-05-29 ✓ 3 Snippets Lin JC, Yang PM, Liu TP.
In-Text Gene Mentions

A lncRNA, ZFAS1 (ZNFX1 antisense RNA 1) has been found to promote HCC metastasis.

…A lncRNA, ZFAS1 (ZNFX1 antisense RNA 1antisense RNA 1)…

…ZFAS1 (ZNFX1 antisense RNA 1antisense RNA 1),…

Show Full Abstract

Sorafenib, a multi-kinase inhibitor, is the first-line treatment for advanced hepatocellular carcinoma (HCC) patients. However, this drug only provides a short improvement of patients' overall survival, and drug resistance is commonly developed. Thus, the identification of resistant factor(s) or biomarker(s) is needed to develop more efficient therapeutic strategies. Long, non-coding RNAs (lncRNAs) have recently been viewed as attractive cancer biomarkers and drive many important cancer phenotypes. A lncRNA, <i>ZFAS1</i> (ZNFX1 antisense RNA 1) has been found to promote HCC metastasis. This study found that sorafenib induced <i>ZFAS1</i> expression specifically in sorafenib-resistant HCC cells. Although <i>ZFAS1</i> knockdown did not restore the sensitivity of HCC cells to sorafenib, its expression may act as a resistant biomarker for sorafenib therapy. Bioinformatics analysis predicted that sorafenib tended to induce pathways related to endoplasmic reticulum (ER) stress and the unfolded protein response (UPR) in sorafenib-resistant HCC cells. In vitro experimental evidence suggested that sorafenib induced protein kinase RNA-like ER kinase (PERK)/activating transcription factor 4 (ATF4)-dependent <i>ZFAS1</i> expression, and sorafenib resistance could be overcome by PERK/ATF inhibitors. Therefore, PERK/ATF4/<i>ZFAS1</i> signaling axis might be an attractive therapeutic and prognostic biomarker for sorafenib therapy in HCC.

Also flagged:transportationgene expressionclustered regularly interspaced short palindromicCRISPRCas9
Journal Article 2021-05-29 No Snippets Chebii VJ, Mpolya EA, Muchadeyi FC, Domelevo Entfellner JB.
Show Full Abstract

Ungulates are a group of hoofed animals that have long interacted with humans as essential sources of food, labor, clothing, and transportation. These consist of domesticated, feral, and wild species raised in a wide range of habitats and biomes. Given the diverse and extreme environments inhabited by ungulates, unique adaptive traits are fundamental for fitness. The documentation of genes that underlie their genomic signatures of selection is crucial in this regard. The increasing availability of advanced sequencing technologies has seen the rapid growth of ungulate genomic resources, which offers an exceptional opportunity to understand their adaptive evolution. Here, we summarize the current knowledge on evolutionary genetic signatures underlying the adaptations of ungulates to different habitats.

Also flagged:obsessive-compulsive disorderserotoninObsessive-Compulsive Personality DisorderBrain-Derived Neurotrophic FactorBDNFbehavioral
Journal Article 2021-05-29 ✓ 1 Snippet Simpson HB, Foa EB, Wheaton MG, Gallagher T, Gershkovich M, Schmidt AB, Huppert JD, Campeas RB, Imms PA, Cahill SP, DiChiara C, Tsao SD, Puliafico AC, Chazin D, Asnaani A, Moore K, Tyler J, Steinman SA, Sanchez-LaCay A, Capaldi S, Snorrason I, Turk-Karan E, Vermes D, Kalanthroff E, Pinto A, Hahn CG, Xu B, Van Meter PE, Katechis M, Scodes J, Wang Y.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Practice guidelines for adults with obsessive-compulsive disorder (OCD) recommend augmenting serotonin reuptake inhibitors (SRIs) with exposure and ritual prevention (EX/RP). However, fewer than half of patients remit after a standard 17-session EX/RP course. We studied whether extending the course increased overall remission rates and which patient factors predicted remission. Participants were 137 adults with clinically significant OCD (Yale-Brown Obsessive Compulsive Scale [Y-BOCS] score ≥18) despite an adequate SRI trial (≥12 weeks). Continuing their SRI, patients received 17 sessions of twice-weekly EX/RP (standard course). Patients who did not remit (Y-BOCS ≤12) received up to 8 additional sessions (extended course). Of 137 entrants, 123 completed treatment: 49 (35.8%) remitted with the standard course and another 46 (33.6%) with the extended course. Poorer patient homework adherence, more Obsessive-Compulsive Personality Disorder (OCPD) traits, and the Brain-Derived Neurotrophic Factor (BDNF) Val66MET genotype were associated with lower odds of standard course remission. Only homework adherence differentiated non-remitters from extended course remitters. Extending the EX/RP course from 17 to 25 sessions enabled many (69.3%) OCD patients on SRIs to achieve remission. Although behavioral (patient homework adherence), psychological (OCPD traits), and biological (BDNF genotype) factors influenced odds of EX/RP remission, homework adherence was the most potent patient factor overall.

Also flagged:cell protrusionscell bodieshepatocellular carcinomacancermicrotubuletumors
Journal Article 2021-05-29 No Snippets Cai W, Ji J, Wu B, Hao K, Ren P, Jin Y, Yang L, Tong Q, Shen Z.
Show Full Abstract

Increasing evidence suggest that hepatocellular carcinoma (HCC) HCCLM3 cells initially develop pseudopodia when they metastasize, and microRNAs (miRNAs/miRs) and circular RNAs (circRNAs) have been demonstrated to serve important roles in the development, progression and metastasis of cancer. The present study aimed to isolate the cell bodies (CBs) and cell protrusions (CPs) from HCCLM3 cells, and screen the miRNAs and circRNAs associated with HCC infiltration and metastasis in CBs and CPs. The Boyden chamber assay has been confirmed to effectively isolate the CBs and CPs from HCCLM3 cells via observation of microtubule immunofluorescence, DAPI staining and nuclear protein H3 western blotting. Following high-throughput sequencing of the successfully isolated CBs and CPs, 64 pairs of miRNAs, including 23 pairs of upregulated genes and 41 pairs of downregulated genes, and 260 sets of circRNAs, including 127 upregulated genes and 133 downregulated genes, were significantly differentially expressed, using the following criteria: HP/HB ratio, fold change ≥|1.5|, P<0.05). PCR analysis verified that changes in the expression levels of hsa-let-7a-5p, hsa-let-7c-3p, hsa-miR-30c-5p, hsa_circ_0059580, hsa_circ_0067475, hsa_circ_0002100 and hsa_circ_00072309 were consistent with the sequencing results. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were performed to analyze the functions and roles of the differentially expressed miRNAs and circRNAs. The interaction maps between miRNAs and circRNAs were constructed, and signaling pathway maps were analyzed to determine the molecular mechanism and regulation of the differentially expressed miRNAs and circRNAs. Taken together, the results of the present study suggest that the Boyden chamber assay can be used to effectively isolate the somatic CBs and CPs of HCC, which can be used to screen the miRNAs and circRNAs associated with invasion and metastasis of HCC.

Also flagged:actinTGFβ1PAX8COL1VCANl l s
Journal Article 2021-05-29 No Snippets Delaine-Smith RM, Maniati E, Malacrida B, Nichols S, Roozitalab R, Jones RR, Lecker LSM, Pearce OMT, Knight MM, Balkwill FR.
Show Full Abstract

In a multi-level "deconstruction" of omental metastases, we previously identified a prognostic matrisome gene expression signature in high-grade serous ovarian cancer (HGSOC) and twelve other malignancies. Here, our aim was to understand how six of these extracellular matrix (ECM) molecules, COL11A1, cartilage oligomeric matrix protein, FN1, versican, cathepsin B, and COL1A1, are upregulated in cancer. Using biopsies, we identified significant associations between TGFβR activity, Hedgehog (Hh) signaling, and these ECM molecules and studied the associations in mono-, co-, and tri-culture. Activated omental fibroblasts (OFs) produced more matrix than malignant cells, directed by TGFβR and Hh signaling cross talk. We "reconstructed" omental metastases in tri-cultures of HGSOC cells, OFs, and adipocytes. This combination was sufficient to generate all six ECM proteins and the matrisome expression signature. TGFβR and Hh inhibitor combinations attenuated fibroblast activation and gel and ECM remodeling in these models. The tri-culture model reproduces key features of omental metastases and allows study of diseased-associated ECM.

Also flagged:ClareSARSCancerLymphoma1001Melanoma
Journal Article 2021-05-29 No Snippets Vega-Tapia F, Peñaloza E, Krause BJ.
Show Full Abstract

Whether arterial-venous differences of primary endothelial cells commonly used for vascular research are preserved <i>in vitro</i> remains under debate. To address this issue, a meta-analysis of Affymetrix transcriptomic data sets from human umbilical artery (HUAECs) and vein (HUVEC) endothelial cells was performed. The meta-analysis showed 2,742 transcripts differentially expressed (false discovery rate <0.05), of which 78% were downregulated in HUVECs. Comparisons with RNA-seq data sets showed high levels of agreement and correlation (p < 0.0001), identifying 84 arterial-venous identity markers. Functional analysis revealed enrichment of key vascular processes in HUAECs/HUVECs, including nitric oxide- (NO) and hypoxia-related genes, as well as differences in miRNA- and ncRNA-mRNA interaction profiles. A proof of concept of these findings in primary cells exposed to hypoxia <i>in vitro</i> and <i>in vivo</i> confirmed the arterial-venous differences in NO-related genes and miRNAs. Altogether, these data defined a cross-platform arterial-venous transcript profile for cultured HUAEC-HUVEC and support a preserved identity involving key vascular pathways post-transcriptionally regulated <i>in vitro</i>.

Also flagged:Chronic Venous DiseaseCVDvenous disordervaricose veinschronic venous insufficiencyvenous leg ulcer
Journal Article 2021-05-29 No Snippets Raffetto JD, Khalil RA.
Show Full Abstract

Chronic venous disease (CVD) is a common venous disorder of the lower extremities. CVD can be manifested as varicose veins (VVs), with dilated and tortuous veins, dysfunctional valves and venous reflux. If not adequately treated, VVs could progress to chronic venous insufficiency (CVI) and lead to venous leg ulcer (VLU). Predisposing familial and genetic factors have been implicated in CVD. Additional environmental, behavioral and dietary factors including sedentary lifestyle and obesity may also contribute to CVD. Alterations in the mRNA expression, protein levels and proteolytic activity of matrix metalloproteinases (MMPs) have been detected in VVs and VLU. MMP expression/activity can be modulated by venous hydrostatic pressure, hypoxia, tissue metabolites, and inflammation. MMPs in turn increase proteolysis of different protein substrates in the extracellular matrix particularly collagen and elastin, leading to weakening of the vein wall. MMPs could also promote venous dilation by increasing the release of endothelium-derived vasodilators and activating potassium channels, leading to smooth muscle hyperpolarization and relaxation. Depending on VVs severity, management usually includes compression stockings, sclerotherapy and surgical removal. Venotonics have also been promoted to decrease the progression of VVs. Sulodexide has also shown benefits in VLU and CVI, and recent data suggest that it could improve venous smooth muscle contraction. Other lines of treatment including induction of endogenous tissue inhibitors of metalloproteinases (TIMPs) and administration of exogenous synthetic inhibitors of MMPs are being explored, and could provide alternative strategies in the treatment of CVD.

Also flagged:ubiquitinethylene glycol-isopropylacrylamideconjugationpolymerhalogen
Journal Article 2021-05-29 No Snippets Burridge KM, Parnell RF, Kearns MM, Page RC, Konkolewicz D.
Show Full Abstract

Protein-polymer bioconjugates present a way to make enzymes more efficient and robust for industrial and medicinal applications. While much work has focused on mono-functional conjugates, i.e. conjugates with one type of polymer attached such as poly(ethylene glycol) or poly(N-isopropylacrylamide), there is a practical interest in gaining additional functionality by synthesizing well-defined bifunctional conjugates in a hetero-arm star copolymer architecture with protein as the core. Using ubiquitin as a model protein, a synthetic scheme was developed to attach two different polymers (OEOMA and DMAm) directly to the protein surface, using orthogonal conjugation chemistries and grafting-from by photochemical living radical polymerization techniques. The additional complexity arising from attempts to selectively modify multiple sites led to decreased polymerization performance and indicates that ICAR-ATRP and RAFT are not well-suited to bifunctional bioconjugates applications. Nonetheless, the polymerization conditions preserve the native fold of the ubiquitin and enable production of a hetero-arm star protein-polymer bioconjugate.

Also flagged:Artemisininmalariamitochondriadihydroartemisininmitochondrialoxygen
Journal Article 2021-05-28 No Snippets Connelly SV, Manzella-Lapeira J, Levine ZC, Brzostowski J, Krymskaya L, Rahman RS, Ellis AC, Amin SN, Sá JM, Wellems TE.
Show Full Abstract

Artemisinin and its semisynthetic derivatives (ART) are fast acting, potent antimalarials; however, their use in malaria treatment is frequently confounded by recrudescences from bloodstream <i>Plasmodium</i> parasites that enter into and later reactivate from a dormant persister state. Here, we provide evidence that the mitochondria of dihydroartemisinin (DHA)-exposed persisters are dramatically altered and enlarged relative to the mitochondria of young, actively replicating ring forms. Restructured mitochondrial-nuclear associations and an altered metabolic state are consistent with stress from reactive oxygen species. New contacts between the mitochondria and nuclei may support communication pathways of mitochondrial retrograde signaling, resulting in transcriptional changes in the nucleus as a survival response. Further characterization of the organelle communication and metabolic dependencies of persisters may suggest strategies to combat recrudescences of malaria after treatment. <b>IMPORTANCE</b> The major first-line treatment for malaria, especially the deadliest form caused by Plasmodium falciparum, is combination therapy with an artemisinin-based drug (ART) plus a partner drug to assure complete cure. Without an effective partner drug, ART administration alone can fail because of the ability of small populations of blood-stage malaria parasites to enter into a dormant state and survive repeated treatments for a week or more. Understanding the nature of parasites in dormancy (persisters) and their ability to wake and reestablish actively propagating parasitemias (recrudesce) after ART exposure may suggest strategies to improve treatment outcomes and counter the threats posed by parasites that develop resistance to partner drugs. Here, we show that persisters have dramatically altered mitochondria and mitochondrial-nuclear interactions associated with features of metabolic quiescence. Restructured associations between the mitochondria and nuclei may support signaling pathways that enable the ART survival responses of dormancy.

Also flagged:Aim2FACLPSActinkeyyou
Journal Article 2021-05-28 No Snippets Robinson EK, Jagannatha P, Covarrubias S, Cattle M, Smaliy V, Safavi R, Shapleigh B, Abu-Shumays R, Jain M, Cloonan SM, Akeson M, Brooks AN, Carpenter S.
Show Full Abstract

Determining the layers of gene regulation within the innate immune response is critical to our understanding of the cellular responses to infection and dysregulation in disease. We identified a conserved mechanism of gene regulation in human and mouse via changes in alternative first exon (AFE) usage following inflammation, resulting in changes to the isoforms produced. Of these AFE events, we identified 95 unannotated transcription start sites in mice using a de novo transcriptome generated by long-read native RNA-sequencing, one of which is in the cytosolic receptor for dsDNA and known inflammatory inducible gene, <i>Aim2</i>. We show that this unannotated AFE isoform of <i>Aim2</i> is the predominant isoform expressed during inflammation and contains an iron-responsive element in its 5'UTR enabling mRNA translation to be regulated by iron levels. This work highlights the importance of examining alternative isoform changes and translational regulation in the innate immune response and uncovers novel regulatory mechanisms of <i>Aim2</i>.

Also flagged:VEGF
Journal Article 2021-05-28 No Snippets PLOS ONE Staff.
Show Full Abstract

[This corrects the article DOI: 10.1371/journal.pone.0241442.].

Also flagged:brain disorderscancersorganizationneurodegenerative disordersbrain cancersneural disorders
Journal Article 2021-05-28 ✓ 1 Snippet Luo J, Li P.
In-Text Gene Mentions

it is caused by abnormal expansion of CAG repeat in Huntingtin gene (HTT), more than 40 of CAG repeats will confer HD and induce the neural cell death in the striatum and cortex [113].

Show Full Abstract

The sheer complexities of brain and resource limitation of human brain tissue greatly hamper our understanding of the brain disorders and cancers. Recently developed three-dimensional (3D) brain organoids (BOs) are self-organized and spontaneously differentiated from human pluripotent stem cells (hPSCs) in vitro, which exhibit similar features with cell type diversity, structural organization, and functional connectivity as the developing human brain. Based on these characteristics, hPSC-derived BOs (hPDBOs) provide new opportunities to recapitulate the complicated processes during brain development, neurodegenerative disorders, and brain cancers in vitro. In this review, we will provide an overview of existing BO models and summarize the applications of this technology in modeling the neural disorders and cancers. Furthermore, we will discuss the challenges associated with their use as in vitro models for disease modeling and the potential future direction.

Also flagged:Xdystoniaparkinsonismneurodegenerative disorderhexanucleotidemismatch
Journal Article 2021-05-28 ✓ 2 Snippets Laabs BH, Klein C, Pozojevic J, Domingo A, Brüggemann N, Grütz K, Rosales RL, Jamora RD, Saranza G, Diesta CCE, Wittig M, Schaake S, Dulovic-Mahlow M, Quismundo J, Otto P, Acuna P, Go C, Sharma N, Multhaupt-Buell T, Müller U, Hanssen H, Kilpert F, Franke A, Rolfs A, Bauer P, Dobričić V, Lohmann K, Ozelius LJ, Kaiser FJ, König IR, Westenberger A.
In-Text Gene Mentions

HD is a severe movement disorder caused by trinucleotide repeat (CAG)n expansions in the coding region of the HTT gene resulting in an extended stretch of glutamine residues.

…both disease genes,HTTand TAF1 ,…

Show Full Abstract

X-linked dystonia-parkinsonism is a neurodegenerative disorder caused by a founder retrotransposon insertion, in which a polymorphic hexanucleotide repeat accounts for ~50% of age at onset variability. Employing a genome-wide association study to identify additional factors modifying age at onset, we establish that three independent loci are significantly associated with age at onset (p < 5 × 10<sup>-8</sup>). The lead single nucleotide polymorphisms collectively account for 25.6% of the remaining variance not explained by the hexanucleotide repeat and 13.0% of the overall variance in age at onset in X-linked dystonia-parkinsonism with the protective alleles delaying disease onset by seven years. These regions harbor or lie adjacent to MSH3 and PMS2, the genes that were recently implicated in modifying age at onset in Huntington's disease, likely through a common pathway influencing repeat instability. Our work indicates the existence of three modifiers of age at onset in X-linked dystonia-parkinsonism that likely affect the DNA mismatch repair pathway.

Also flagged:lysosomal storage diseaseC8aNpc2cancerdiabetesanxiety
Journal Article 2021-05-28 No Snippets Mohammed Y, Michaud SA, Pětrošová H, Yang J, Ganguly M, Schibli D, Flenniken AM, Nutter LMJ, Adissu HA, Lloyd KCK, McKerlie C, Borchers CH.
Show Full Abstract

We proteotyped blood plasma from 30 mouse knockout strains and corresponding wild-type mice from the International Mouse Phenotyping Consortium. We used targeted proteomics with internal standards to quantify 375 proteins in 218 samples. Our results provide insights into the manifested effects of each gene knockout at the plasma proteome level. We first investigated possible contamination by erythrocytes during sample preparation and labeled, in one case, up to 11 differential proteins as erythrocyte originated. Second, we showed that differences in baseline protein abundance between female and male mice were evident in all mice, emphasizing the necessity to include both sexes in basic research, target discovery, and preclinical effect and safety studies. Next, we identified the protein signature of each gene knockout and performed functional analyses for all knockout strains. Further, to demonstrate how proteome analysis identifies the effect of gene deficiency beyond traditional phenotyping tests, we provide in-depth analysis of two strains, C8a<sup>-/-</sup> and Npc2<sup>+/-</sup>. The proteins encoded by these genes are well-characterized providing good validation of our method in homozygous and heterozygous knockout mice. Ig alpha chain C region, a poorly characterized protein, was among the differentiating proteins in C8a<sup>-/-</sup>. In Npc2<sup>+/-</sup> mice, where histopathology and traditional tests failed to differentiate heterozygous from wild-type mice, our data showed significant difference in various lysosomal storage disease-related proteins. Our results demonstrate how to combine absolute quantitative proteomics with mouse gene knockout strategies to systematically study the effect of protein absence. The approach used here for blood plasma is applicable to all tissue protein extracts.

Also flagged:GRSMETTL15obesityLMX1BNEDD4LGALNT10
Journal Article 2021-05-28 ✓ 3 Snippets Huang LO, Morgen CS, Ängquist L, Nohr EA, Kilpeläinen TO, Hansen T, Sørensen TIA, Schnurr TM.
In-Text Gene Mentions

NEGR1

OLFM4

…plus rs9568856 (nearOLFM4) that was…

Show Full Abstract

<h4>Objectives</h4>Genetic predisposition and maternal body mass index (BMI) are risk factors for childhood adiposity, defined by either BMI or overweight. We aimed to investigate whether childhood-specific genetic risk scores (GRSs) for adiposity-related traits are associated with childhood adiposity independent of maternal BMI, or whether the associations are modified by maternal BMI.<h4>Methods</h4>We constructed a weighted 26-SNP child BMI-GRS and a weighted 17-SNP child obesity-GRS in overall 1674 genotyped children within the Danish National Birth Cohort. We applied a case-cohort (N = 1261) and exposure-based cohort (N = 912) sampling design. Using logistic regression models we estimated associations of the GRSs and child overweight at age 7 years and examined if the GRSs influence child adiposity independent of maternal BMI (per standard deviation units).<h4>Results</h4>In the case-cohort design analysis, maternal BMI and the child GRSs were associated with increased odds for childhood overweight [OR for maternal BMI: 2.01 (95% CI: 1.86; 2.17), OR for child BMI-GRS: 1.56 (95% CI: 1.47; 1.66), and OR for child obesity-GRS 1.46 (95% CI: 1.37; 1.54)]. Adjustment for maternal BMI did not change the results, and there were no significant interactions between the GRSs and maternal BMI. However, in the exposure-based cohort design analysis, significant interactions between the child GRSs and maternal BMI on child overweight were observed, suggesting 0.85-0.87-fold attenuation on ORs of child overweight at higher values of maternal BMI and child GRS.<h4>Conclusion</h4>GRSs for childhood adiposity are strongly associated with childhood adiposity even when adjusted for maternal BMI, suggesting that the child-specific GRSs and maternal BMI contribute to childhood overweight independent of each other. However, high maternal BMI may attenuate the effects of child GRSs in children.

Also flagged:cognitionepilepsygene expressionbrain disordersactincell projection organization
Journal Article 2021-05-28 ✓ 1 Snippet Ayhan F, Kulkarni A, Berto S, Sivaprakasam K, Douglas C, Lega BC, Konopka G.
In-Text Gene Mentions

SOX6

Show Full Abstract

The hippocampus supports many facets of cognition, including learning, memory, and emotional processing. Anatomically, the hippocampus runs along a longitudinal axis, posterior to anterior in primates. The structure, function, and connectivity of the hippocampus vary along this axis. In human hippocampus, longitudinal functional heterogeneity remains an active area of investigation, and structural heterogeneity has not been described. To understand the cellular and molecular diversity along the hippocampal long axis in human brain and define molecular signatures corresponding to functional domains, we performed single-nuclei RNA sequencing on surgically resected human anterior and posterior hippocampus from epilepsy patients, identifying differentially expressed genes at cellular resolution. We further identify axis- and cell-type-specific gene expression signatures that differentially intersect with human genetic signals, identifying cell-type-specific genes in the posterior hippocampus for cognitive function and the anterior hippocampus for mood and affect. These data are accessible as a public resource through an interactive website.

Also flagged:Co-expressionvascular diseasePorto-sinusoidal vascular diseasevascular liver diseaseportal hypertensioncirrhosis
Journal Article 2021-05-28 ✓ 2 Snippets Hernández-Gea V, Campreciós G, Betancourt F, Pérez-Campuzano V, Seijo S, Díaz A, Gallego-Durán R, Olivas P, Orts L, Magaz M, Baiges A, Turon F, Sidorova J, Romero-Gómez M, Lozano JJ, García-Pagán JC.
In-Text Gene Mentions

Serpin family (SERPINC1), the apolipoproteins (APOA, APOB, APOC), ATP synthases (ATP5G1, ATP5B), fibrinogen genes (FGB, FGA) and alpha-2-macroglobulin were identified as highly connective genes that may have an important role in PSVD pathogenesis.<h4>Conclusion</h4>PSVD has a unique transcriptomic profile and we have identified deregulation of pathways involved in vascular homeostasis as the main pathogenic event of disease development.<h4>Lay summary</h4>Porto-sinusoidal vascular disease is a rare but life-shortening disease that affects mainly young people.

…Serpin family (SERPINC1), the apolipoproteins (APOA,…

Show Full Abstract

<h4>Background & aims</h4>Porto-sinusoidal vascular disease (PSVD) is a rare vascular liver disease of unknown etiology that causes portal hypertension. It usually affects young individuals and shortens live expectancy. The deregulated pathways involved in PSVD development are unknown and therefore we lack curative treatments. The purpose of this study was to integrate transcriptomic and clinical data by comprehensive network-based modeling in order to uncover altered biological processes in patients with PSVD.<h4>Methods</h4>We obtained liver tissue samples from 20 consecutive patients with PSVD and 21 sex- and age-matched patients with cirrhosis and 13 histologically normal livers (HNL) (initial cohort) and performed transcriptomic analysis. Microarray data were analyzed using weighted gene correlation network analysis to identify clusters of highly correlated genes differently expressed in patients with PSVD. We next evaluated the molecular pathways enriched in patients with PSVD and the core-related genes from the most significantly enriched pathways in patients with PSVD. Our main findings were validated using RNA sequencing in a different cohort of PSVD, cirrhosis and HNL (n = 8 for each group).<h4>Results</h4>Patients with PSVD have a distinctive genetic profile enriched mainly in canonical pathways involving hemostasis and coagulation but also lipid metabolism and oxidative phosphorylation. Serpin family (SERPINC1), the apolipoproteins (APOA, APOB, APOC), ATP synthases (ATP5G1, ATP5B), fibrinogen genes (FGB, FGA) and alpha-2-macroglobulin were identified as highly connective genes that may have an important role in PSVD pathogenesis.<h4>Conclusion</h4>PSVD has a unique transcriptomic profile and we have identified deregulation of pathways involved in vascular homeostasis as the main pathogenic event of disease development.<h4>Lay summary</h4>Porto-sinusoidal vascular disease is a rare but life-shortening disease that affects mainly young people. Knowledge of the disrupted pathways involved in its development will help to identify novel therapeutic targets and new treatments. Using a systems biology approach, we identify that pathways regulating endothelial function and tone may act as drivers of porto-sinusoidal vascular disease.

Also flagged:acute myocardial infarctionHematoxylinluciferase
Journal Article 2021-05-28 ✓ 5 Snippets Long R, Gao L, Li Y, Li G, Qin P, Wei Z, Li D, Qian C, Li J, Yang G.
In-Text Gene Mentions

miR-1271-5p decreased cardiomyocyte apoptosis induced by hypoxia and alleviated cardiac injury in AMI via down-regulating SOX6 expression.<h4>Conclusion</h4>We identified that M2-Exos could carry miR-1271-5p to reduce apoptosis of cardiomyocytes and promote cardiac repair via down-regulating SOX6.

M2 macrophage-derived exosomes carry miR-1271-5p to alleviate cardiac injury in acute myocardial infarction through down-regulating SOX6.

…rction through down-regulatingSOX6.…

SOX6is a direct…

…AMI via down-regulatingSOX6expression.<h4>Conclusion</h4>…

Show Full Abstract

<h4>Background</h4>Emerging evidence has indicated that exosomes serve as key regulators in acute myocardial infarction (AMI). This study was determined to investigate the effect of M2 macrophage-derived exosomes (M2-Exos) in AMI and the further mechanism.<h4>Methods</h4>M2 macrophages were induced and M2-exos were isolated and verified. The AMI mouse model was prepared by ligation of the left anterior descending coronary artery (LAD) and then intravenously injected with the isolated M2-exos. The mouse cardiac function was assessed by echocardiography. Hematoxylin and eosin (HE) staining and TUNEL assay were conducted to examine myocardial lesion and apoptosis in cardiac tissues. The expressions of associated molecules were detected by quantitative real time-PCR (qRT-PCR) and western blot. MTT assay, Flow cytometry and Dual-luciferase reporter assay were carried out to detect cell viability, apoptosis and the interaction of miRNA and the target.<h4>Result</h4>M2-Exos could promote cardiac repair in AMI mice. M2-Exos suppressed apoptosis and enhanced viability of hypoxia-induced cardiomyocytes through delivery of miR-1271-5p. SOX6 is a direct target of miR-1271-5p. miR-1271-5p decreased cardiomyocyte apoptosis induced by hypoxia and alleviated cardiac injury in AMI via down-regulating SOX6 expression.<h4>Conclusion</h4>We identified that M2-Exos could carry miR-1271-5p to reduce apoptosis of cardiomyocytes and promote cardiac repair via down-regulating SOX6.

Also flagged:Pancreatic Cancerchronic pancreatitiscancerpancreatitispancreatic diseasesgene expression
Journal Article 2021-05-28 ✓ 5 Snippets Al-Fatlawi A, Malekian N, García S, Henschel A, Kim I, Dahl A, Jahnke B, Bailey P, Bolz SN, Poetsch AR, Mahler S, Grützmann R, Pilarsky C, Schroeder M.
In-Text Gene Mentions

Table 3 summarises the significant variants. In the analysis of cancer (rPDAC + nrPC) vs. CP, three variants in the genes GSDMD and B4GALT5 showed a high association with pancreatic cancer in its two profiles (rPDAC and nrPC). In the gene GSDMD, one variant was significantly associated with cancer and another with CP. Wang et al. discuss GSDMD’s potential as a cancer target due to its role in pyroptosis gasdermin mediated programmed cell death [32]. It is highly connected with the CASP gene family (see Figure S1_6a), which is strongly related to the poor prognosis of pancreatic cancer [33].

In particular, the genes B4GALT5 and GSDMD, which harbour three of the most significant variants, are closely related to cancer progression and the elevation of CA19-9 levels.

Table 3 shows the identified significant variants for each analysis. Overall, four variants in the genes GSDMD, B4GALT5, and VPS36 were significantly associated with pancreatic cancer, with p-values of minus four orders of magnitude or better. Other variants were associated with CP with high affinity. Moreover, six variants present in 10% or below of our samples were highly significant. More than 90% of these variants appeared in cancer, and only less than 10% were in CP. One of them (rs3093553) was already defined as a risk factor for breast cancer in two GWAS studies (see Table 4).

…the genes GSDMD,B4GALT5, and VPS36…

…two variants inB4GALT5were in moderate…

Show Full Abstract

For optimal pancreatic cancer treatment, early and accurate diagnosis is vital. Blood-derived biomarkers and genetic predispositions can contribute to early diagnosis, but they often have limited accuracy or applicability. Here, we seek to exploit the synergy between them by combining the biomarker CA19-9 with RNA-based variants. We use deep sequencing and deep learning to improve differentiating pancreatic cancer and chronic pancreatitis. We obtained samples of nucleated cells found in peripheral blood from 268 patients suffering from resectable, non-resectable pancreatic cancer, and chronic pancreatitis. We sequenced RNA with high coverage and obtained millions of variants. The high-quality variants served as input together with CA19-9 values to deep learning models. Our model achieved an area under the curve (AUC) of 96% in differentiating resectable cancer from pancreatitis using a test cohort. Moreover, we identified variants to estimate survival in resectable cancer. We show that the blood transcriptome harbours variants, which can substantially improve noninvasive clinical diagnosis.

Also flagged:Waterpeptidesamino acidscollagenamino acidhydroxyapatite
Journal Article 2021-05-28 No Snippets Melgosa R, Marques M, Paiva A, Bernardo A, Fernández N, Sá-Nogueira I, Simões P.
Show Full Abstract

The valorization of Atlantic cod (<i>Gadus morhua</i>) frames from a filleting industry was investigated using subcritical water extraction and hydrolysis (SBW) at different temperatures (90, 140, 190 and 250 °C) and 100 bar to obtain extracts rich in proteins, peptides and amino acids. Up to 57.7 g of extract per 100 g of codfish frames were obtained, with nearly total recovery of the protein fraction. At each temperature, protein extracts of decreasing molecular weight were obtained, according to SEC-GPC results. Most of the protein present in the raw material and extracts was collagen and collagen fragments, as suggested by the amino acid profile. Codfish SBW extracts did not show cytotoxicity in the range of concentrations tested and the protein extract obtained at the lowest temperature (90 °C) showed the highest anti-inflammatory potential in human intestinal epithelium cell model. The mineralized residue left after SBW treatment of cod frames was identified as practically pure, crystalline, hydroxyapatite, that may find applications in biomedical field and hard-tissue engineering. This study shows the possible valorization of cod frames using green extraction methods such as SBW process to obtain protein extracts for food and nutraceutical applications.

Also flagged:EstrogenBreast Cancerepithelial-mesenchymal-transitioncancerE-cadherin-
Journal Article 2021-05-28 No Snippets Zbiral B, Weber A, Iturri J, Vivanco MDM, Toca-Herrera JL.
Show Full Abstract

Excessive estrogen exposure is connected with increased risk of breast cancer and has been shown to promote epithelial-mesenchymal-transition. Malignant cancer cells accumulate changes in cell mechanical and biochemical properties, often leading to cell softening. In this work we have employed atomic force microscopy to probe the influence of estrogen on the viscoelastic properties of MCF-7 breast cancer cells cultured either in normal or hormone free-medium. Estrogen led to a significant softening of the cells in all studied cases, while growing cells in hormone free medium led to an increase in the studied elastic and viscoelastic moduli. In addition, fluorescence microscopy shows that E-cadherin distribution is changed in cells when culturing them under estrogenic conditions. Furthermore, cell-cell contacts seemed to be weakened. These results were supported by AFM imaging showing changes in surfaces roughness, cell-cell contacts and cell height as result of estrogen treatment. This study therefore provides further evidence for the role of estrogen signaling in breast cancer.

Also flagged:HspB4αA-Crystallindiabetesphosphorylationdiabetic retinopathyinflammatory response
Journal Article 2021-05-28 No Snippets Nath M, Shan Y, Myers AM, Fort PE.
Show Full Abstract

<h4>Purpose</h4>We have previously demonstrated that HspB4/αA-crystallin, a molecular chaperone, plays an important intrinsic neuroprotective role during diabetes, by its phosphorylation on residue 148. We also reported that HspB4/αA-crystallin is highly expressed by glial cells. There is a growing interest in the potential causative role of low-grade inflammation in diabetic retinopathy pathophysiology and retinal Müller glial cells' (MGCs') participation in the inflammatory response. MGCs indeed play a central role in retinal homeostasis via secreting various cytokines and other mediators. Hence, this study was carried out to delineate and understand the regulatory function of HspB4/αA-crystallin in the inflammatory response associated with metabolic stresses.<h4>Methods</h4>Primary MGCs were isolated from knockout HspB4/αA-crystallin mice. These primary cells were then transfected with plasmids encoding either wild-type (WT), phosphomimetic (T148D), or non-phosphorylatable mutants (T148A) of HspB4/αA-crystallin. The cells were exposed to multiple metabolic stresses including serum starvation (SS) or high glucose with TNF-alpha (HG + T) before being further evaluated for the expression of inflammatory markers by qPCR. The total protein expression along with subcellular localization of NF-kB and the NLRP3 component was assessed by Western blot.<h4>Results</h4>Elevated levels of IL-6, IL-1β, MCP-1, and IL-18 in SS were significantly diminished in MGCs overexpressing WT and further in T148D as compared to EV. The HG + T-induced increase in these inflammatory markers was also dampened by WT and even more significantly by T148D overexpression, whereas T148A was ineffective in either stress. Further analysis revealed that overexpression of WT or the T148D, also led to a significant reduction of Nlrp3, Asc, and caspase-1 transcript expression in serum-deprived MGCs and nearly abolished the NF-kB induction in HG + T diabetes-like stress. This mechanistic effect was further evaluated at the protein level and confirmed the stress-dependent regulation of NLRP3 and NF-kB by αA-crystallin.<h4>Conclusions</h4>The data gathered in this study demonstrate the central regulatory role of HspB4/αA-crystallin and its modulation by phosphorylation on T148 in retinal MGCs. For the first time, this study demonstrates that HspB4/αA-crystallin can dampen the stress-induced expression of pro-inflammatory cytokines through the modulation of multiple key inflammatory pathways, therefore, suggesting its potential as a therapeutic target for the modulation of chronic neuroinflammation.

Also flagged:DeferoxamineDeferoxamine Bironbindingferricamino
Journal Article 2021-05-28 ✓ 1 Snippet Bellotti D, Remelli M.
In-Text Gene Mentions

…β-thalassemia major) andhemochromatosis.…

Show Full Abstract

Deferoxamine B is an outstanding molecule which has been widely studied in the past decade for its ability to bind iron and many other metal ions. The versatility of this metal chelator makes it suitable for a number of medicinal and analytical applications, from the well-known iron chelation therapy to the most recent use in sensor devices. The three bidentate hydroxamic functional groups of deferoxamine B are the centerpiece of its metal binding ability, which allows the formation of stable complexes with many transition, lanthanoid and actinoid metal ions. In addition to the ferric ion, in fact, more than 20 different metal complexes of deferoxamine b have been characterized in terms of their chemical speciation in solution. In addition, the availability of a terminal amino group, most often not involved in complexation, opens the way to deferoxamine B modification and functionalization. This review aims to collect and summarize the available data concerning the complex-formation equilibria in solutions of deferoxamine B with different metal ions. A general overview of the progress of its applications over the past decade is also discussed, including the treatment of iron overload-associated diseases, its clinical use against cancer and neurodegenerative disorders and its role as a diagnostic tool.

Also flagged:conjugationimmune responsespeptidesmallpoxcowpoxinfectious diseases
Journal Article 2021-05-28 No Snippets Lu L, Duong VT, Shalash AO, Skwarczynski M, Toth I.
Show Full Abstract

The production of subunit nanovaccines relies heavily on the development of a vaccine delivery system that is safe and efficient at delivering antigens to the target site. Nanoparticles have been extensively investigated for vaccine delivery over the years, as they often possess self-adjuvanting properties. The conjugation of antigens to nanoparticles by covalent bonds ensures co-delivery of these components to the same subset of immune cells in order to trigger the desired immune responses. Herein, we review covalent conjugation strategies for grafting protein or peptide antigens onto other molecules or nanoparticles to obtain subunit nanovaccines. We also discuss the advantages of chemical conjugation in developing these vaccines.

Also flagged:colorectal cancertumorM-CSFCXCL-8IL-6TIMP-1
Journal Article 2021-05-28 ✓ 1 Snippet Łukaszewicz-Zając M, Mroczko B.
In-Text Gene Mentions

…inactivation ( TP53,DCC, SMAD4, APC ),…

Show Full Abstract

The global burden of colorectal cancer (CRC) is expected to increase, with 2.2 million new cases and 1.1 million annual deaths by 2030. Therefore, the establishment of novel biomarkers useful in the early diagnosis of CRC is of utmost importance. A number of publications have documented the significance of the overexpression of several specific proteins, such as inflammatory mediators, in CRC progression. However, little is known about the potential utility of these proteins as circulating blood tumor biomarkers of CRC. Therefore, in the present review we report the results of our previous original studies as well as the findings of other authors who investigated whether inflammatory mediators might be used as novel biomarkers in the diagnosis and prognosis of CRC. Our study revealed that among all of the tested proteins, serum M-CSF, CXCL-8, IL-6 and TIMP-1 have the greatest value in the diagnosis and progression of CRC. Serum TIMP-1 is useful in differentiating between CRC and colorectal adenomas, whereas M-CSF and CRP are independent prognostic factors for the survival of patients with CRC. This review confirms the promising significance of these proteins as circulating biomarkers for CRC. However, due to their non-specific nature, further validation of their sensitivity and specificity is required.

Also flagged:HDACsDiabetes mellitusmetabolic syndromehyperglycemiahistone deacetylaseHDAC
Journal Article 2021-05-28 No Snippets Dewanjee S, Vallamkondu J, Kalra RS, Chakraborty P, Gangopadhyay M, Sahu R, Medala V, John A, Reddy PH, De Feo V, Kandimalla R.
Show Full Abstract

Diabetes mellitus (DM) is one of the principal manifestations of metabolic syndrome and its prevalence with modern lifestyle is increasing incessantly. Chronic hyperglycemia can induce several vascular complications that were referred to be the major cause of morbidity and mortality in DM. Although several therapeutic targets have been identified and accessed clinically, the imminent risk of DM and its prevalence are still ascending. Substantial pieces of evidence revealed that histone deacetylase (HDAC) isoforms can regulate various molecular activities in DM via epigenetic and post-translational regulation of several transcription factors. To date, 18 HDAC isoforms have been identified in mammals that were categorized into four different classes. Classes I, II, and IV are regarded as classical HDACs, which operate through a Zn-based mechanism. In contrast, class III HDACs or Sirtuins depend on nicotinamide adenine dinucleotide (NAD<sup>+</sup>) for their molecular activity. Functionally, most of the HDAC isoforms can regulate β cell fate, insulin release, insulin expression and signaling, and glucose metabolism. Moreover, the roles of HDAC members have been implicated in the regulation of oxidative stress, inflammation, apoptosis, fibrosis, and other pathological events, which substantially contribute to diabetes-related vascular dysfunctions. Therefore, HDACs could serve as the potential therapeutic target in DM towards developing novel intervention strategies. This review sheds light on the emerging role of HDACs/isoforms in diabetic pathophysiology and emphasized the scope of their targeting in DM for constituting novel interventional strategies for metabolic disorders/complications.

Also flagged:FGFRFibroblast Growth Factor Receptorasskeletal disorderscancerendocytosis
Journal Article 2021-05-28 No Snippets Szybowska P, Kostas M, Wesche J, Haugsten EM, Wiedlocha A.
Show Full Abstract

FGFR (fibroblast growth factor receptor) signaling controls fundamental processes in embryonic, fetal and adult human life. The magnitude, duration, and location of FGFR signaling must be strictly controlled in order to induce the correct biological response. Uncontrolled receptor signaling has been shown to lead to a variety of diseases, such as skeletal disorders and cancer. Here we review the numerous cellular mechanisms that regulate and turn off FGFR signaling, once the receptor is activated. These mechanisms include endocytosis and endocytic sorting, phosphatase activity, negative regulatory proteins and negative feedback phosphorylation events. The mechanisms act together simultaneously or sequentially, controlling the same or different steps in FGFR signaling. Although more work is needed to fully understand the regulation of FGFR signaling, it is clear that the cells in our body have evolved an extensive repertoire of mechanisms that together keep FGFR signaling tightly controlled and prevent excess FGFR signaling.

Also flagged:ion-transportsodiumsaltchlorophyllresponses tosignal transduction
Journal Article 2021-05-28 No Snippets Le TD, Gathignol F, Vu HT, Nguyen KL, Tran LH, Vu HTT, Dinh TX, Lazennec F, Pham XH, Véry AA, Gantet P, Hoang GT.
Show Full Abstract

Rice tolerance to salinity stress involves diverse and complementary mechanisms, such as the regulation of genome expression, activation of specific ion-transport systems to manage excess sodium at the cell or plant level, and anatomical changes that avoid sodium penetration into the inner tissues of the plant. These complementary mechanisms can act synergistically to improve salinity tolerance in the plant, which is then interesting in breeding programs to pyramidize complementary QTLs (quantitative trait loci), to improve salinity stress tolerance of the plant at different developmental stages and in different environments. This approach presupposes the identification of salinity tolerance QTLs associated with different mechanisms involved in salinity tolerance, which requires the greatest possible genetic diversity to be explored. To contribute to this goal, we screened an original panel of 179 Vietnamese rice landraces genotyped with 21,623 SNP markers for salinity stress tolerance under 100 mM NaCl treatment, at the seedling stage, with the aim of identifying new QTLs involved in the salinity stress tolerance via a genome-wide association study (GWAS). Nine salinity tolerance-related traits, including the salt injury score, chlorophyll and water content, and K<sup>+</sup> and Na<sup>+</sup> contents were measured in leaves. GWAS analysis allowed the identification of 26 QTLs. Interestingly, ten of them were associated with several different traits, which indicates that these QTLs act pleiotropically to control the different levels of plant responses to salinity stress. Twenty-one identified QTLs colocalized with known QTLs. Several genes within these QTLs have functions related to salinity stress tolerance and are mainly involved in gene regulation, signal transduction or hormone signaling. Our study provides promising QTLs for breeding programs to enhance salinity tolerance and identifies candidate genes that should be further functionally studied to better understand salinity tolerance mechanisms in rice.

Also flagged:OxygencancerlysineglutamateimidazolePerfluorohexanoate
Journal Article 2021-05-28 No Snippets Chen Y, Zhang L, Li F, Sheng J, Xu C, Li D, Yu H, Liu W.
Show Full Abstract

<h4>Introduction</h4>Photodynamic therapy (PDT) has been widely researched by cancer therapists in recent years. This study aims to establish a drug delivery system combining PDT and chemotherapy to show that chemotherapeutic drugs provide oxygen to PDT, while PDT promotes the release of chemotherapeutic drug.<h4>Methods</h4>Firstly, poly(ethylene glycol)-lysine(Ce6)-block-poly(L-glutamate)-imidazole (mPEG-lys(Ce6)-PGA-AIM) was synthesized and self-assembled into micelles that exhibited pH- and ROS-responsiveness and buffering capacity. Perfluorohexanoate-modified cisplatin (FCP), as oxygen carriers, was encapsulated into mPEG-lys(Ce6)-PGA-AIM micelles. Then, the properties of micelles and their biological functions in vivo and in vitro were investigated.<h4>Results</h4>The micelles exhibited remarkabe stability, pH regulated drug release, good biocompatibility and effective tumor penetration. Cellular uptake demonstrated the efficient endosome/lysosome escape of CFMs, which facilitates the intracellular drug release. Both in vitro and in vivo experiments reflected that CFMs with laser irradiation showed significantly improved therapeutic activity compared with single PDT or chemotherapy.<h4>Conclusion</h4>Chemotherapy and PDT were combined in the form of mutual assistance to provide a promising strategy for clinical treatment.

Also flagged:Acyclic nucleoside phosphonatesaminothiazoleadenylate cyclaseadenine nucleobaseadefovirfructose 1,6-bisphosphatase
Journal Article 2021-05-28 No Snippets Břehová P, Chaloupecká E, Česnek M, Skácel J, Dračínský M, Tloušťová E, Mertlíková-Kaiserová H, Soto-Velasquez MP, Watts VJ, Janeba Z.
Show Full Abstract

A series of novel acyclic nucleoside phosphonates (ANPs) was synthesized as potential adenylate cyclase inhibitors, where the adenine nucleobase of adefovir (PMEA) was replaced with a 5-substituted 2-aminothiazole moiety. The design was based on the structure of MB05032, a potent and selective inhibitor of fructose 1,6-bisphosphatase and a good mimic of adenosine monophosphate (AMP). From the series of eighteen novel ANPs, which were prepared as phosphoroamidate prodrugs, fourteen compounds were potent (single digit micromolar or submicromolar) inhibitors of Bordetella pertussis adenylate cyclase toxin (ACT), mostly without observed cytotoxicity in J774A.1 macrophage cells. Selected phosphono diphosphates (nucleoside triphosphate analogues) were potent inhibitors of ACT (IC<sub>50</sub> as low as 37 nM) and B. anthracis edema factor (IC<sub>50</sub> as low as 235 nM) in enzymatic assays. Furthermore, several ANPs were found to be selective mammalian AC1 inhibitors in HEK293 cell-based assays (although with some associated cytotoxicity) and one compound exhibited selective inhibition of mammalian AC2 (only 12% of remaining adenylate cyclase activity) but no observed cytotoxicity. The mammalian AC1 inhibitors may represent potential leads in development of agents for treatment of human inflammatory and neuropathic pain.

Also flagged:fibrinogenvWFvon Willebrand factorintracerebral hemorrhageIschemic StrokeAtherosclerosis
Journal Article 2021-05-28 No Snippets Baez SC, García Del Barco D, Hardy-Sosa A, Guillen Nieto G, Bringas-Vega ML, Llibre-Guerra JJ, Valdes-Sosa P.
Show Full Abstract

<b>Background:</b> Acute stroke treatment is a time-critical process in which every minute counts. Laboratory biomarkers are needed to aid clinical decisions in the diagnosis. Although imaging is critical for this process, these biomarkers may provide additional information to distinguish actual stroke from its mimics and monitor patient condition and the effect of potential neuroprotective strategies. For such biomarkers to be effectively scalable to public health in any economic setting, these must be cost-effective and non-invasive. We hypothesized that blood-based combinations (panels) of proteins might be the key to this approach and explored this possibility through a systematic review. <b>Methods:</b> We followed the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analysis) guidelines for systematic review. Initially, the broader search for biomarkers for early stroke diagnosis yielded 704 hits, and five were added manually. We then narrowed the search to combinations (panels) of the protein markers obtained from the blood. <b>Results:</b> Twelve articles dealing with blood-based panels of protein biomarkers for stroke were included in the systematic review. We observed that NR2 peptide (antibody against the NR2 fragment) and glial fibrillary acidic protein (GFAP) are brain-specific markers related to stroke. Von Willebrand factor (vWF), matrix metalloproteinase 9 (MMP-9), and S100β have been widely used as biomarkers, whereas others such as the ischemia-modified albumin (IMA) index, antithrombin III (AT-III), and fibrinogen have not been evaluated in combination. We herein propose the following new combination of biomarkers for future validation: panel 1 (NR2 + GFAP + MMP-9 + vWF + S100β), panel 2 (NR2 + GFAP + MMP-9 + vWF + IMA index), and panel 3 (NR2 + GFAP + AT-III + fibrinogen). <b>Conclusions:</b> More research is needed to validate, identify, and introduce these panels of biomarkers into medical practice for stroke recurrence and diagnosis in a scalable manner. The evidence indicates that the most promising approach is to combine different blood-based proteins to provide diagnostic precision for health interventions. Through our systematic review, we suggest three novel biomarker panels based on the results in the literature and an interpretation based on stroke pathophysiology.

Also flagged:PI3KCDFDeltalung adenocarcinomaS11cholesterol synthesis
Journal Article 2021-05-28 ✓ 1 Snippet Li C, Tian C, Liu Y, Liang J, Zeng Y, Yang Q, Liu Y, Wu D, Wu J, Wang J, Zhang K, Gu F, Hu Y, Liu L.
In-Text Gene Mentions

…TNFRSF4, TNFRSF9, andTNFSF4) in subtype NC3…

Show Full Abstract

Lung adenocarcinoma has entered into an era of immunotherapy with the development of immune checkpoint inhibitors (ICIs). The identification of immune subtype is crucial to prolonging survival in patients. The tumor microenvironment (TME) and metabolism have a profound impact on prognosis and therapy. The majority of previous studies focused on only one aspect, while both of them are essential to the understanding of tumorigenesis and development. We hypothesized that lung adenocarcinoma can be stratified into immune subgroups with alterations in the TME infiltration. We aimed to explore the "TME-Metabolism-Risk" patterns in each subtypes and the mechanism behind. Glycolysis and cholesterol were selected for the analysis of metabolic states based on the first half of the study. Bioinformatic analysis was performed to investigate the transcriptomic and clinical data integrated by three lung adenocarcinoma cohorts (GSE30219, GSE31210, GSE37745, <i>N</i> = 415). The results were validated in an independent cohort (GSE50081, <i>N</i> = 127). In total, 415 lung adenocarcinoma samples were integrated and analyzed. Four major immune subtypes were indentified using bioinformatic analysis. Subtype NC1, characterized by a high level of glycolysis, with extremely low microenvironment cell infiltration. Subtype NC2, characterized by the "Silence" and "Cholesterol biosynthesis Predominant" metabolic states, with a middle degree infiltration of microenvironment cell. Subtype NC3, characterized by the lack of "Cholesterol biosynthesis Predominant" metabolic state, with abundant microenvironment cell infiltration. Subtype NC4, characterized by "Mixed" metabolic state, with a relatively low microenvironment cell infiltration. Least absolute shrinkage and selection operator (LASSO) regression and multivariate analyses were performed to calculate the risk of each sample, and we attempted to find out the potential immune escape mechanism in different subtypes. The result revealed that the lack of immune cells infiltration might contribute to the immune escape in subtypes NC1 and NC4. NC3 was characterized by the high expression of immune checkpoint molecules and fibroblasts. NC2 had defects in activation of innate immune cells. There existed an obviously survival advantage in subtype NC2. Gene set enrichment analysis (GSEA) and Gene Ontology analysis indicated that the PI3K-AKT-mTOR, TGF-β, MYC-related pathways might be correlated with this phenomenon. In addition, some differentially expressed genes (DEGs) were indentified in subtype NC3, which might be potential targets for survival phenotype transformation.

Also flagged:S12drytermwaterS11SOM
Journal Article 2021-05-28 No Snippets Jia W, Zhang R, Zhu Z, Shi L.
Show Full Abstract

Large variations in the bioactivities and composition of milk fat globule membrane (MFGM) proteins were observed between Saanen dairy goat and Holstein bovine at various lactation periods. In the present study, 331, 250, 182, and 248 MFGM proteins were characterized in colostrum and mature milk for the two species by Q-Orbitrap HRMS-based proteomics techniques. KEGG pathway analyses displayed that differentially expressed proteins in colostrum involved in galactose metabolism and an adipogenesis pathway, and the differentially expressed proteins in mature milk associated with lipid metabolism and a PPAR signaling pathway. These results indicated that the types and functions of MFGM proteins in goat and bovine milk were different, and goat milk had a better function of fatty acid metabolism and glucose homeostasis, which can enhance our understanding of MFGM proteins in these two species across different lactation periods, and they provide significant information for the study of lipid metabolism and glycometabolism of goat milk.

Also flagged:GAPDHNucleotideReverse TranscriptionGene ExpressionChronic Rhinosinusitisnasal polyps
Journal Article 2021-05-28 ✓ 2 Snippets Yu J, Kang X, Xiong Y, Luo Q, Dai D, Ye J.
In-Text Gene Mentions

CircRNA-WBSCR17 aggravates the inflammatory response of human renal tubular epithelial cells induced by high glucose by targeting the miR-185-5p/SOX6 axis (Li et al., 2020).

…by targeting the miR-185-5p/SOX6axis ( Li…

Show Full Abstract

<b>Introduction:</b> Chronic rhinosinusitis (CRS) is often classified primarily on the basis of the absence or presence of nasal polyps (NPs), that is, as CRS with nasal polyps (CRSwNP) or CRS without nasal polyps (CRSsNP). Additionally, according to the percentage of eosinophils, CRSwNP can be further divided into eosinophilic CRSwNP (ECRSwNP) and non-ECRSwNP. CRSwNP is a significant public health problem with a considerable socioeconomic burden. Previous research reported that the pathophysiology of CRSwNP is a complex, multifactorial disease. There have been many studies on its etiology, but its pathogenesis remains unclear. Dysregulated expression of microRNAs (miRNAs) has been shown in psoriasis, rheumatoid arthritis, pulmonary fibrosis, and allergic asthma. Circular RNAs (circRNAs) are also involved in inflammatory diseases such as rheumatoid arthritis, septic acute kidney injury, myocardial ischemia/reperfusion injury, and sepsis-induced liver damage. The function of miRNAs in various diseases, including CRSwNP, is a research hotspot. In contrast, there have been no studies on circRNAs in CRSwNP. Overall, little is known about the functions of circRNAs and miRNAs in CRSwNP. This study aimed to investigate the expression of circRNAs and miRNAs in a CRSwNP group and a control group to determine whether these molecules are related to the occurrence and development of CRSwNP. <b>Methods:</b> Nine nasal mucosa samples were collected, namely, three ECRSwNP samples, three non-ECRSwNP samples, and three control samples, for genomic microarray analysis of circRNA and microRNA expression. All of the tissue samples were from patients who were undergoing functional endoscopic sinus surgery in our department. Then we selected some differentially expressed miRNAs and circRNAs for qPCR verification. Meanwhile, GO enrichment analysis and KEGG pathway analysis were applied to predict the biological functions of aberrantly expressed circRNAs and miRNAs based on the GO and KEGG databases. Receiver operating characteristic (ROC) curve analysis and principal component analysis (PCA) were performed to confirm these molecules are involved in the occurrence and development of CRSwNP. <b>Results:</b> In total, 2,875 circRNAs showed significant differential expression in the CRSwNP group. Specifically, 1794 circRNAs were downregulated and 1,081 circRNAs were upregulated. In the CRSwNP group, the expression of 192 miRNAs was significantly downregulated, and none of the miRNAs were significantly upregulated. GO and KEGG analysis showed differential circRNAs and miRNAs were enriched in "amoebiasis," "salivary secretion," "pathways in cancer," and "endocytosis." Through qRT-PCR verification, the expression profiles of hsa-circ-0031593, hsa-circ-0031594, hsa-miR-132-3p, hsa-miR-145-5p, hsa-miR-146a-5p, and hsa-miR-27b-3p were shown to have statistical differences. In addition, ROC curve analysis showed that the molecules with the two highest AUCs were hsa-circ-0031593 with AUC 0.8353 and hsa-miR-145-5p with AUC 0.8690. Through PCA with the six ncRNAs, the first principal component explained variance ratio was 98.87%. The AUC of the six ncRNAs was 0.8657. <b>Conclusion:</b> In our study, the expression profiles of ECRSwNP and non-ECRSwNP had no statistical differences. The differentially expressed circRNAs and miRNAs between CRSwNP and control may play important roles in the pathogenesis of CRSwNP. Altered expression of hsa-circ-0031593 and hsa-miR-145-5p have the strongest evidence for involvement in the occurrence and development of CRSwNP because their AUCs are higher than the other molecules tested in this study.

Also flagged:RafRKIPWaterionsRaf kinase inhibitory proteinMEK
Journal Article 2021-05-28 ✓ 3 Snippets Parate S, Rampogu S, Lee G, Hong JC, Lee KW.
In-Text Gene Mentions

The molecular details of RAF proto-oncogene serine/threonine protein kinase and its inhibitory protein RKIP/PEBP1 were retrieved from UniProtKB database with UniProt ID P04049 (RAF1_HUMAN) and P30086 (PEBP1_HUMAN), respectively, with proteins of lengths 307 (C-Raf) and 187 (RKIP) amino acids.

…its inhibitory protein RKIP/PEBP1were retrieved from…

…(RAF1_HUMAN) and P30086 (PEBP1_HUMAN), respectively, with pr…

Show Full Abstract

Protein-protein interactions are indispensable physiological processes regulating several biological functions. Despite the availability of structural information on protein-protein complexes, deciphering their complex topology remains an outstanding challenge. Raf kinase inhibitory protein (RKIP) has gained substantial attention as a favorable molecular target for numerous pathologies including cancer and Alzheimer's disease. RKIP interferes with the RAF/MEK/ERK signaling cascade by endogenously binding with C-Raf (Raf-1 kinase) and preventing its activation. In the current investigation, the binding of RKIP with C-Raf was explored by knowledge-based protein-protein docking web-servers including HADDOCK and ZDOCK and a consensus binding mode of C-Raf/RKIP structural complex was obtained. Molecular dynamics (MD) simulations were further performed in an explicit solvent to sample the conformations for when RKIP binds to C-Raf. Some of the conserved interface residues were mutated to alanine, phenylalanine and leucine and the impact of mutations was estimated by additional MD simulations and MM/PBSA analysis for the wild-type (WT) and constructed mutant complexes. Substantial decrease in binding free energy was observed for the mutant complexes as compared to the binding free energy of WT C-Raf/RKIP structural complex. Furthermore, a considerable increase in average backbone root mean square deviation and fluctuation was perceived for the mutant complexes. Moreover, per-residue energy contribution analysis of the equilibrated simulation trajectory by HawkDock and ANCHOR web-servers was conducted to characterize the key residues for the complex formation. One residue each from C-Raf (Arg398) and RKIP (Lys80) were identified as the druggable "hot spots" constituting the core of the binding interface and corroborated by additional long-time scale (300 ns) MD simulation of Arg398Ala mutant complex. A notable conformational change in Arg398Ala mutant occurred near the mutation site as compared to the equilibrated C-Raf/RKIP native state conformation and an essential hydrogen bonding interaction was lost. The thirteen binding sites assimilated from the overall analysis were mapped onto the complex as surface and divided into active and allosteric binding sites, depending on their location at the interface. The acquired information on the predicted 3D structural complex and the detected sites aid as promising targets in designing novel inhibitors to block the C-Raf/RKIP interaction.

Also flagged:TNFSF14TNFSF13TNFRSF9EDA2RTNFRSF21FASLG
Journal Article 2021-05-28 ✓ 2 Snippets Zhang W, Li C, Wu F, Li N, Wang Y, Hu Y, Fang T, Yuan H, He H.
In-Text Gene Mentions

TNFSF4

SERPINC1

Show Full Abstract

<b>Background:</b> Kidney renal clear cell carcinoma (KIRC) has the highest incidence rate in renal cell carcinoma (RCC). Although bioinformatics is widely used in cancer, few reliable biomarkers of KIRC have been found. Therefore, continued efforts are required to elucidate the potential mechanism of the biogenesis and progression of KIRC. <b>Methods:</b> We evaluated the expression of tumor necrosis factor (TNF) family genes in KIRC, and constructed a prognostic signature. We validated the signature by another database and explored the relationship between the signature and progression of KIRC. We assessed the prognostic value, immune infiltration, and tumor mutation burden (TMB) of the signature in KIRC. <b>Results:</b> We selected four key genes (<i>TNFSF14</i>, <i>TNFRSF19</i>, <i>TNFRSF21</i>, and <i>EDA</i>) to construct the TNF-related signature. We divided the KIRC patients into high- and low-risk groups based on the signature. Patients with higher risk scores had shorter overall survival and worse prognosis. With another database, we validated the value of the signature. The signature was considered as an independent risk factor. A higher level of risk score was relevant to higher level of immune infiltration, especially T regulatory cells, CD8<sup>+</sup> T cells, and macrophages. The signature was also associated with TMB scores, and it may have an effect on assessing the efficacy of immunotherapy. <b>Conclusion:</b> This is the first TNF-family-related signature of KIRC and we demonstrated its effectiveness. It played a significant role in predicting the prognosis of patients with KIRC. It also has the potential to become a powerful tool in guiding the immunotherapy of KIRC patients in clinical practice.

Also flagged:SahaDiamondetherdiethyl etherisopropanolair
Journal Article 2021-05-28 ✓ 1 Snippet Makarov K, Saha S, Ghatak T, Fridman N, Eisen MS.
In-Text Gene Mentions

DCC

Show Full Abstract

A new class of actinide complexes [(L)An(N{SiMe<sub>3</sub>}<sub>2</sub>)<sub>3</sub>] (An = Th or U) (<b>Th1</b>-<b>Th3</b> and <b>U1-U3</b>) supported by highly nucleophilic seven-membered N-heterocyclic iminato ligands were synthesized and fully characterized by single-crystal X-ray diffraction. These complexes were successfully exploited as powerful catalysts for the addition of alcohols to carbodiimides to yield the corresponding desirable isourea products at room temperature with short reaction times and excellent yields. Thorough stoichiometric, thermodynamic, and kinetic studies were carried out, allowing us to propose a plausible mechanism for the catalytic reaction.

Also flagged:metalsOsteoarthritischronic diseasemusculoskeletal disorderagingobesity
Journal Article 2021-05-28 No Snippets Wei W, Dai H.
Show Full Abstract

In spite of the considerable achievements in the field of regenerative medicine in the past several decades, osteochondral defect regeneration remains a challenging issue among diseases in the musculoskeletal system because of the spatial complexity of osteochondral units in composition, structure and functions. In order to repair the hierarchical tissue involving different layers of articular cartilage, cartilage-bone interface and subchondral bone, traditional clinical treatments including palliative and reparative methods have showed certain improvement in pain relief and defect filling. It is the development of tissue engineering that has provided more promising results in regenerating neo-tissues with comparable compositional, structural and functional characteristics to the native osteochondral tissues. Here in this review, some basic knowledge of the osteochondral units including the anatomical structure and composition, the defect classification and clinical treatments will be first introduced. Then we will highlight the recent progress in osteochondral tissue engineering from perspectives of scaffold design, cell encapsulation and signaling factor incorporation including bioreactor application. Clinical products for osteochondral defect repair will be analyzed and summarized later. Moreover, we will discuss the current obstacles and future directions to regenerate the damaged osteochondral tissues.

Also flagged:FlashMethoxydeuteriumsilicaindenpent
Journal Article 2021-05-28 ✓ 1 Snippet Zhang XY, Ning C, Mao B, Wei Y, Shi M.
In-Text Gene Mentions

DCC

Show Full Abstract

Classical cyclopropylcarbinyl radical clock reactions have been widely applied to conduct mechanistic studies for probing radical processes for a long time; however, alkylidenecyclopropanes, which have a similar molecular structure to methylcyclopropanes, surprisingly have not yet attracted researcher's attention for similar ring opening radical clock processes. In recent years, photocatalytic NHPI ester activation chemistry has witnessed significant blooming developments and provided new synthetic routes for cross-coupling reactions. Herein, we wish to report a non-classical ring opening radical clock reaction using innovative NHPI esters bearing alkylidenecyclopropanes upon photoredox catalysis, providing a brand-new synthetic approach for the direct preparation of a variety of alkynyl derivatives. The potential synthetic utility of this protocol is demonstrated in the diverse transformations and facile synthesis of bioactive molecules or their derivatives and medicinal substances.

bioRxiv 2021-05-28 Preprint (No Snippets API) Wong NM, Dipasquale O, Turkheimer F, Findon JL, Wichers RH, Dimitrov M, Murphy CM, Stoencheva V, Robertson DM, Murphy DG, Daly E, McAlonan GM.
Show Full Abstract

Alterations in the serotonergic control of brain pathways responsible for facial-emotion processing in people with autism spectrum disorder (ASD) may be a target for intervention. However, the molecular underpinnings of autistic-neurotypical serotonergic differences are challenging to access in vivo. Receptor-Enriched Analysis of functional Connectivity by Targets (REACT) has helped define molecular-enriched fMRI brain networks based on a priori information about the spatial distribution of neurochemical systems from available PET templates. Here, we used REACT to estimate the dominant fMRI signal related to the serotonin transporter (5-HTT) distribution during processing of aversive facial expressions of emotion processing in adults with and without ASD. We first predicted a group difference in baseline (placebo) functioning of this system. We next used a single 20 mg oral dose of citalopram, i.e. a serotonin reuptake inhibitor, to test the hypothesis that network activity in people with and without ASD would respond differently to inhibition of 5-HTT. To confirm the specificity of our findings, we also repeated the analysis with 5-HT 1A, 5-HT 1B , 5-HT 2A , and 5-HT 4 receptor maps. We found a baseline group difference in the 5-HTT-enriched response to faces in the ventromedial prefrontal cortex. A single oral dose of citalopram ‘shifted’ the response in the ASD group towards the neurotypical baseline but did not alter response in the control group. Our findings suggest that the 5HTT-enriched functional network is dynamically different in ASD during processing of socially relevant stimuli. Whether this acute neurobiological response to citalopram in ASD translates to a clinical target will be an important next step.

Also flagged:ferrocenyltriarylmethyliumferroceneFluorenyliumThioxanthyliumferrocenium
Journal Article 2021-05-27 No Snippets Casper LA, Linseis M, Demeshko S, Azarkh M, Drescher M, Winter RF.
Show Full Abstract

Three new electrochromic ferrocenyl triarylmethylium dyes with fluorenylium (1 a<sup>+</sup> , 1 b<sup>+</sup> ) or thioxanthylium (1 c<sup>+</sup> ) residues were selected in order to keep the intrinsic differences of redox potentials for ferrocene oxidation and triarylmethylium reduction small and to trigger valence tautomerism (VT). UV/Vis/NIR and quantitative EPR spectroscopy identified paramagnetic diradical isomers 1 a<sup>..+</sup> -1 c<sup>..+</sup> alongside diamagnetic forms 1 a<sup>+</sup> -1 c<sup>+</sup> , which renders these complexes magnetochemical switches. The diradical forms 1 a<sup>..+</sup> -1 c<sup>..+</sup> as well as the one-electron-reduced triarylmethyl forms of the complexes were found to dimerize in solution. For radical 1 a<sup>.</sup> , dimerization occurs on the timescale of cyclic voltammetry; this allowed us to determine the kinetics and equilibrium constant for this process by digital simulation. Mößbauer spectroscopy indicated that 1 a<sup>+</sup> and 1 b<sup>+</sup> retain VT even in the solid state. UV/Vis/NIR spectro-electrochemistry revealed the poly-electrochromic behaviour of these complexes by establishing the distinctly different electronic absorption profiles of the corresponding oxidized and reduced forms.

Also flagged:cytokineantibodiesimmune responsesCoV‐2 infectionSARS‐CoV‐2 infectionCD169
Journal Article 2021-05-27 No Snippets Chan YH, Fong SW, Poh CM, Carissimo G, Yeo NK, Amrun SN, Goh YS, Lim J, Xu W, Chee RS, Torres-Ruesta A, Lee CY, Tay MZ, Chang ZW, Lee WH, Wang B, Tan SY, Kalimuddin S, Young BE, Leo YS, Wang CI, Lee B, Rötzschke O, Lye DC, Renia L, Ng LFP.
Show Full Abstract

The immune responses and mechanisms limiting symptom progression in asymptomatic cases of SARS-CoV-2 infection remain unclear. We comprehensively characterized transcriptomic profiles, cytokine responses, neutralization capacity of antibodies, and cellular immune phenotypes of asymptomatic patients with acute SARS-CoV-2 infection to identify potential protective mechanisms. Compared to symptomatic patients, asymptomatic patients had higher counts of mature neutrophils and lower proportion of CD169<sup>+</sup> expressing monocytes in the peripheral blood. Systemic levels of pro-inflammatory cytokines were also lower in asymptomatic patients, accompanied by milder pro-inflammatory gene signatures. Mechanistically, a more robust systemic Th2 cell signature with a higher level of virus-specific Th17 cells and a weaker yet sufficient neutralizing antibody profile against SARS-CoV-2 was observed in asymptomatic patients. In addition, asymptomatic COVID-19 patients had higher systemic levels of growth factors that are associated with cellular repair. Together, the data suggest that asymptomatic patients mount less pro-inflammatory and more protective immune responses against SARS-CoV-2 indicative of disease tolerance. Insights from this study highlight key immune pathways that could serve as therapeutic targets to prevent disease progression in COVID-19.

Also flagged:organizationmicrotubulesmitosisspindlechromosomesmembrane
Journal Article 2021-05-27 No Snippets Gai Y, Cook B, Setru S, Stone HA, Petry S.
Show Full Abstract

The organization of microtubules (MTs) is critical for cells during interphase and mitosis. During mitotic spindle assembly, MTs are made and organized around chromosomes in a process regulated by RanGTP. The role of RanGTP has been explored in Xenopus egg extracts, which are not limited by a cell membrane. Here, we investigated whether cell-sized confinements affect the assembly of RanGTP-induced MT networks in Xenopus egg extracts. We used microfluidics to encapsulate extracts within monodisperse extract-in-oil droplets. Importantly, we find that the architecture of Ran-induced MT networks depends on the droplet diameter and the Ran concentration, and differs from structures formed in bulk extracts. Our results highlight that both MT nucleation and physical confinement play critical roles in determining the spatial organization of the MT cytoskeleton.

Also flagged:Hydroxyapatitecalcium chloridebone formationosteogenesissurface antigencell growth
Journal Article 2021-05-27 No Snippets Bajuri MY, Selvanathan N, Dzeidee Schaff FN, Abdul Suki MH, Ng AMH.
Show Full Abstract

<h4>Background</h4>Managing massive bone defects, a great challenge to orthopaedics reconstructive surgery. The problem arise is the supply of suitable bone is limited with many complications. Tissue-engineered hydroxyapatite bone (TEHB) scaffold impregnated with osteoprogenitor cells developed as an alternative to promote bone regeneration.<h4>Methods</h4>This animal protocol has been approved by Universiti Kebangsaan Malaysia Animal Ethical Committee. The TEHB scaffold prepared from hydroxyapatite using gel casting method. A total of six adolescent female sheep were chosen for this study. Later, all the sheep were euthanized in a proper manner and the bone harvested for biomechanical study. Bone marrow was collected from iliac crest of the sheep and bone marrow stem cells (BMSCs) isolated and cultured. BMSCs then cultured in osteogenic medium for osteoprogenitor cells development and the plasma collected was seeded with osteoprogenitor cells mixed with calcium chloride. Bone defect of 3 cm length of tibia bone created from each sheep leg and implanted with autologous and TEHB scaffold in 2 different groups of sheep. Wound site was monitored weekly until the wound completely healed and conventional X-ray performed at week 1 and 24. Shear test was conducted to determine the shear force on the autologous bone and TEHB scaffold after implantation for 24 weeks.<h4>Results</h4>All of the sheep survived without any complications during the study period and radiograph showed new bone formation. Later, the bone harvested was for biomechanical study. The highest shear force for the autologous group was 13 MPa and the lowest was 5 MPa while for the scaffold group, the highest was 10 MPa and the lowest was 3 MPa. Although, proximal and distal interface of autologous bone graft shows higher shear strength compared to the TEHB scaffold but there is no significant difference in both groups, p value > 0.05. Histologically in both proximal and distal interface in both arms shows bone healing and woven bone formation.<h4>Conclusion</h4>TEHB scaffold impregnated with osteoprogenitor cells has the potential to be developed as a bone substitute in view of its strength and capability to promote bone regeneration.

Also flagged:pyrrolidineacetoxyS21sodiumaminobenzyl
Journal Article 2021-05-27 ✓ 2 Snippets Guzelj S, Nabergoj S, Gobec M, Pajk S, Klančič V, Slütter B, Frkanec R, Štimac A, Šket P, Plavec J, Mlinarič-Raščan I, Jakopin Ž.
In-Text Gene Mentions

DCC

…the co-stimulatory moleculeTNFSF4(also known as…

Show Full Abstract

We report on the design, synthesis, and biological evaluation of a series of nucleotide-binding oligomerization-domain-containing protein 2 (NOD2) desmuramylpeptide agonists with improved <i>in vitro</i> and <i>in vivo</i> adjuvant properties. We identified two promising compounds: <b>68</b>, a potent nanomolar <i>in vitro</i> NOD2 agonist, and the more lipophilic <b>75</b>, which shows superior adjuvant activity <i>in vivo</i>. Both compounds had immunostimulatory effects on peripheral blood mononuclear cells at the protein and transcriptional levels, and augmented dendritic-cell-mediated activation of T cells, while <b>75</b> additionally enhanced the cytotoxic activity of peripheral blood mononuclear cells against malignant cells. The C<sub>18</sub> lipophilic tail of <b>75</b> is identified as a pivotal structural element that confers <i>in vivo</i> adjuvant activity in conjunction with a liposomal delivery system. Accordingly, liposome-encapsulated <b>75</b> showed promising adjuvant activity in mice, surpassing that of muramyl dipeptide, while achieving a more balanced Th1/Th2 immune response, thus highlighting its potential as a vaccine adjuvant.

Also flagged:Nitrateoxygenmetabolismsodiumwatergene expression
Journal Article 2021-05-27 ✓ 2 Snippets Keller RM, Beaver LM, Reardon PN, Prater MC, Truong L, Robinson MM, Tanguay RL, Stevens JF, Hord NG.
In-Text Gene Mentions

…muscle differentiation (sox6).…

sox6

Show Full Abstract

Dietary nitrate supplementation improves exercise performance by reducing the oxygen cost of exercise and enhancing skeletal muscle function. However, the mechanisms underlying these effects are not well understood. The purpose of this study was to assess changes in skeletal muscle energy metabolism associated with exercise performance in a zebrafish model. Fish were exposed to sodium nitrate (60.7 mg/L, 303.5 mg/L, 606.9 mg/L), or control water, for 21 days and analyzed at intervals (5, 10, 20, 30, 40 cm/s) during a 2-h strenuous exercise test. We measured oxygen consumption during an exercise test and assessed muscle nitrate concentrations, gene expression, and the muscle metabolome before, during, and after exercise. Nitrate exposure reduced the oxygen cost of exercise and increased muscle nitrate concentrations at rest, which were reduced with increasing exercise duration. In skeletal muscle, nitrate treatment upregulated expression of genes central to nutrient sensing (<i>mtor</i>), redox signaling (<i>nrf2a</i>), and muscle differentiation (<i>sox6</i>). In rested muscle, nitrate treatment increased phosphocreatine (<i>P</i> = 0.002), creatine (<i>P</i> = 0.0005), ATP (<i>P</i> = 0.0008), ADP (<i>P</i> = 0.002), and AMP (<i>P</i> = 0.004) compared with rested-control muscle. Following the highest swimming speed, concentration of phosphocreatine (<i>P</i> = 8.0 × 10<sup>-5</sup>), creatine (<i>P</i> = 6.0 × 10<sup>-7</sup>), ATP (<i>P</i> = 2.0 × 10<sup>-6</sup>), ADP (<i>P</i> = 0.0002), and AMP (<i>P</i> = 0.004) decreased compared with rested nitrate muscle. Our data suggest nitrate exposure in zebrafish lowers the oxygen cost of exercise by changing the metabolic programming of muscle prior to exercise and increasing availability of energy-rich metabolites required for exercise.<b>NEW & NOTEWORTHY</b> We show that skeletal muscle nitrate concentration is higher with supplementation at rest and was lower in groups with increasing exercise duration in a zebrafish model. The higher availability of nitrate at rest is associated with upregulation of key nutrient-sensing genes and greater availability of energy-producing metabolites (i.e., ATP, phosphocreatine, glycolytic intermediates). Overall, nitrate supplementation may lower oxygen cost of exercise through improved fuel availability resulting from metabolic programming of muscle prior to exercise.

Also flagged:sugarneurotransmittermetabolismdysbacteriosistrimethylaminecholine
Journal Article 2021-05-27 ✓ 1 Snippet Guo Y, Zhu X, Zeng M, Qi L, Tang X, Wang D, Zhang M, Xie Y, Li H, Yang X, Chen D.
In-Text Gene Mentions

DCCwas employed to…

Show Full Abstract

Gut microbiota (GM) metabolites can modulate the physiology of the host brain through the gut-brain axis. We wished to discover connections between the GM, neurotransmitters, and brain function using direct and indirect methods. A diet with increased amounts of sugar and fat (high-sugar and high-fat (HSHF) diet) was employed to disturb the host GM. Then, we monitored the effect on pathology, neurotransmitter metabolism, transcription, and brain circularRNAs (circRNAs) profiles in mice. Administration of a HSHF diet-induced dysbacteriosis, damaged the intestinal tract, changed the neurotransmitter metabolism in the intestine and brain, and then caused changes in brain function and circRNA profiles. The GM byproduct trimethylamine-n-oxide could degrade some circRNAs. The basal level of the GM decided the conversion rate of choline to trimethylamine-n-oxide. A change in the abundance of a single bacterial strain could influence neurotransmitter secretion. These findings suggest that a new link between metabolism, brain circRNAs, and GM. Our data could enlarge the "microbiome-transcriptome" linkage library and provide more information on the gut-brain axis. Hence, our findings could provide more information on the interplay between the gut and brain to aid the identification of potential therapeutic markers and mechanistic solutions to complex problems encountered in studies of pathology, toxicology, diet, and nutrition development.

Also flagged:CSRP3CancerDeathNucleotideCASQ2TTN
Journal Article 2021-05-27 No Snippets Holmström L, Pylkäs K, Tervasmäki A, Vähätalo J, Porvari K, Pakanen L, Kaikkonen KS, Perkiömäki JS, Kiviniemi AM, Kerkelä R, Ukkola O, Myerburg RJ, Huikuri HV, Junttila J.
Show Full Abstract

The contribution of genetic variants to non-ischemic sudden cardiac death (SCD) due to acquired myocardial diseases is unclear. We studied whether SCD victims with hypertension/obesity related hypertrophic myocardial disease harbor potentially disease associated gene variants. The Fingesture study has collected data from 5869 autopsy-verified SCD victims in Northern Finland. Among SCD victims, 740 (13%) had hypertension and/or obesity as the most likely explanation for myocardial disease with hypertrophy and fibrosis. We performed next generation sequencing using a panel of 174 cardiac genes for 151 such victims with the best quality of DNA. We used 48 patients with hypertension and hypertrophic heart as controls. Likely pathogenic variants were identified in 15 SCD victims (10%) and variants of uncertain significance (VUS) were observed in additional 43 SCD victims (28%). In controls, likely pathogenic variants were present in two subjects (4%; p = 0.21) and VUSs in 12 subjects (25%; p = 0.64). Among SCD victims, presence of potentially disease-related variants was associated with lower mean BMI and heart weight. Potentially disease related gene variants are common in non-ischemic SCD but further studies are required to determine specific contribution of rare genetic variants to the extent of acquired myocardial diseases leading to SCD.

Also flagged:MSH5calAPEHTRAF3USP4RBX1 1
Journal Article 2021-05-27 ✓ 5 Snippets Levey DF, Stein MB, Wendt FR, Pathak GA, Zhou H, Aslan M, Quaden R, Harrington KM, Nuñez YZ, Overstreet C, Radhakrishnan K, Sanacora G, McIntosh AM, Shi J, Shringarpure SS, 23andMe Research Team, Million Veteran Program, Concato J, Polimanti R, Gelernter J.
In-Text Gene Mentions

VRK2

ZNFX1

CSE1L

STAU1

DDX27

Show Full Abstract

Major depressive disorder is the most common neuropsychiatric disorder, affecting 11% of veterans. Here we report results of a large meta-analysis of depression using data from the Million Veteran Program, 23andMe, UK Biobank and FinnGen, including individuals of European ancestry (n = 1,154,267; 340,591 cases) and African ancestry (n = 59,600; 25,843 cases). Transcriptome-wide association study analyses revealed significant associations with expression of NEGR1 in the hypothalamus and DRD2 in the nucleus accumbens, among others. We fine-mapped 178 genomic risk loci, and we identified likely pathogenicity in these variants and overlapping gene expression for 17 genes from our transcriptome-wide association study, including TRAF3. Finally, we were able to show substantial replications of our findings in a large independent cohort (n = 1,342,778) provided by 23andMe. This study sheds light on the genetic architecture of depression and provides new insight into the interrelatedness of complex psychiatric traits.

Also flagged:GadoliniummetalsIron oxideironoxideanemia
Journal Article 2021-05-27 ✓ 1 Snippet Daldrup-Link HE, Theruvath AJ, Rashidi A, Iv M, Majzner RG, Spunt SL, Goodman S, Moseley M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Gadolinium chelates have been used as standard contrast agents for clinical MRI for several decades. However, several investigators recently reported that rare Earth metals such as gadolinium are deposited in the brain for months or years. This is particularly concerning for children, whose developing brain is more vulnerable to exogenous toxins compared to adults. Therefore, a search is under way for alternative MR imaging biomarkers. The United States Food and Drug Administration (FDA)-approved iron supplement ferumoxytol can solve this unmet clinical need: ferumoxytol consists of iron oxide nanoparticles that can be detected with MRI and provide significant T1- and T2-signal enhancement of vessels and soft tissues. Several investigators including our research group have started to use ferumoxytol off-label as a new contrast agent for MRI. This article reviews the existing literature on the biodistribution of ferumoxytol in children and compares the diagnostic accuracy of ferumoxytol- and gadolinium-chelate-enhanced MRI. Iron oxide nanoparticles represent a promising new class of contrast agents for pediatric MRI that can be metabolized and are not deposited in the brain.

Also flagged:ZearalenoneantibodiesBSAoximeesterOVA
Journal Article 2021-05-27 No Snippets Wang Y, Wang X, Zhang H, Fotina H, Jiang J.
Show Full Abstract

This study aimed to detect and monitor total Zearalenone (ZEN) and its five homologs (ZENs) in cereals and feed. The monoclonal antibodies (mAbs) with a high affinity and broad class specificity against ZENs were prepared, and the conditions of a heterologous indirect competitive ELISA (icELISA) were preliminarily optimized based on the ZEN mAbs. The immunogen ZEN-BSA was synthesized using the oxime active ester method (OAE) and identified using infrared (IR) and ultraviolet (UV). The coating antigen ZEN-OVA was obtained via the 1,4-butanediol diglycidyl ether method (BDE). Balb/c mice were immunized using a high ZEN-BSA dose with long intervals and at multiple sites. A heterologous indirect non-competitive ELISA (inELISA) and an icELISA were used to screen the suitable cell fusion mice and positive hybridoma cell lines. The ZEN mAbs were prepared by inducing ascites in vivo. The standard curve was established, and the sensitivity and specificity of the ZEN mAbs were determined under the optimized icELISA conditions. ZEN-BSA was successfully synthesized at a conjugation ratio of 17.2:1 (ZEN: BSA). Three hybridoma cell lines, 2D7, 3C2, and 4A10, were filtered, and their mAbs corresponded to an IgG1 isotype with a κ light chain. The mAbs titers were between (2.56 to 5.12) × 10<sup>2</sup> in supernatants and (1.28 to 5.12) × 10<sup>5</sup> in the ascites. Besides, the 50% inhibitive concentration (IC50) values were from 18.65 to 31.92 μg/L in the supernatants and 18.12 to 31.46 μg/L in the ascites. The affinity constant (<i>Ka</i>) of all of the mAbs was between 4.15 × 10<sup>9</sup> and 6.54 × 10<sup>9</sup> L/mol. The IC50 values of mAb 2D7 for ZEN, α-ZEL, β-ZEL, α-ZAL, β-ZAL and ZAN were 17.23, 16.71, 18.27, 16.39, 20.36 and 15.01 μg/L, and their cross-reactivities (CRs, %) were 100%, 103.11%, 94.31%, 105.13%, 84.63%, and 114.79%, respectively, under the optimized icELISA conditions. The limit of detection (LOD) for ZEN was 0.64 μg/L, and its linear working range was between 1.03 and 288.55 μg/L. The mAbs preparation and the optimization of icELISA conditions promote the potential development of a rapid test ELISA kit, providing an alternative method for detecting ZEN and its homologs in cereals and feed.

Also flagged:InterphasechromatinChromosomeschromosomenucleusorganization
Journal Article 2021-05-27 ✓ 1 Snippet Peterson SC, Samuelson KB, Hanlon SL.
In-Text Gene Mentions

Condensinsare multi-unit, ring-like…

Show Full Abstract

Interphase chromatin, despite its appearance, is a highly organized framework of loops and bends. Chromosomes are folded into topologically associating domains, or TADs, and each chromosome and its homolog occupy a distinct territory within the nucleus. In <i>Drosophila</i>, genome organization is exceptional because homologous chromosome pairing is in both germline and somatic tissues, which promote interhomolog interactions such as transvection that can affect gene expression in <i>trans</i>. In this review, we focus on what is known about genome organization in <i>Drosophila</i> and discuss it from TADs to territory. We start by examining intrachromosomal organization at the sub-chromosome level into TADs, followed by a comprehensive analysis of the known proteins that play a key role in TAD formation and boundary establishment. We then zoom out to examine interhomolog interactions such as pairing and transvection that are abundant in <i>Drosophila</i> but rare in other model systems. Finally, we discuss chromosome territories that form within the nucleus, resulting in a complete picture of the multi-scale organization of the <i>Drosophila</i> genome.

Also flagged:HomeostasisPhosphatephosphate transportersacquired disordersFGFR1cFibroblast Growth Factor 23
Journal Article 2021-05-27 No Snippets Figueres L, Beck-Cormier S, Beck L, Marks J.
Show Full Abstract

Phosphate homeostasis is essential for health and is achieved via interaction between the bone, kidney, small intestine, and parathyroid glands and via intricate processes involving phosphate transporters, phosphate sensors, and circulating hormones. Numerous genetic and acquired disorders are associated with disruption in these processes and can lead to significant morbidity and mortality. The role of the kidney in phosphate homeostasis is well known, although it is recognized that the cellular mechanisms in murine models and humans are different. Intestinal phosphate transport also appears to differ in humans and rodents, with recent studies demonstrating a dominant role for the paracellular pathway. The existence of phosphate sensing has been acknowledged for decades; however, the underlying molecular mechanisms are poorly understood. At least three phosphate sensors have emerged. PiT2 and FGFR1c both act as phosphate sensors controlling Fibroblast Growth Factor 23 secretion in bone, whereas the calcium-sensing receptor controls parathyroid hormone secretion in response to extracellular phosphate. All three of the proposed sensors are expressed in the kidney and intestine but their exact function in these organs is unknown. Understanding organ interactions and the mechanisms involved in phosphate sensing requires significant research to develop novel approaches for the treatment of phosphate homeostasis disorders.

Also flagged:Breast Cancermetastatic diseasecancerprimary tumorsprimary tumorlocalized disease
Journal Article 2021-05-27 ✓ 2 Snippets Borriello L, Condeelis J, Entenberg D, Oktay MH.
In-Text Gene Mentions

…the site ofDCCorigin.…

…and/or re-dissemination ofDCCfrom metastatic foci.…

Show Full Abstract

Although metastatic disease is the primary cause of mortality in cancer patients, the mechanisms leading to overwhelming metastatic burden are still incompletely understood. Metastases are the endpoint of a series of multi-step events involving cancer cell intravasation, dissemination to distant organs, and outgrowth to metastatic colonies. Here we show, for the first-time, that breast cancer cells do not solely disseminate to distant organs from primary tumors and metastatic nodules in the lymph nodes, but also do so from lung metastases. Thus, our findings indicate that metastatic dissemination could continue even after the removal of the primary tumor. Provided that the re-disseminated cancer cells initiate growth upon arrival to distant sites, cancer cell re-dissemination from metastatic foci could be one of the crucial mechanisms leading to overt metastases and patient demise. Therefore, the development of new therapeutic strategies to block cancer cell re-dissemination would be crucial to improving survival of patients with metastatic disease.

Also flagged:choreaneurodegenerative diseasesbasal ganglia disordersvasculitisinfectionsHD
Journal Article 2021-05-27 ✓ 4 Snippets Achenbach J, Faissner S, Saft C.
In-Text Gene Mentions

The neurodegenerative Huntington’s disease (HD) is caused by a CAG-trinucleotide repeat expansion in the huntingtin gene (HTT), resulting in manifold heterogeneous motoric, psychiatric, and cognitive impairments [1].

We analyzed the periodic dataset five (PDS-5) and included patients from category 3 (hdcat 3: motor-manifest HD), having a diagnostic confidence level of 4 (Diagconf 4: having unequivocal motor-manifest symptoms of HD/>99% confidence), a Unified Huntington′s Disease Rating Scale (UHDRS)—total motor score (TMS) >5, a genetically confirmed report with ≥36 cytosine-adenine-guanine (CAG) repeats in the huntingtin gene (HTT), and an age >18 years.

…huntingtin gene (HTT), resulting in…

…huntingtin gene (HTT) , and an…

Show Full Abstract

<h4>Background</h4>There is a broad range of potential differential diagnoses for chorea. Besides rare, inherited neurodegenerative diseases such as Huntington's disease (HD) chorea can accompany basal ganglia disorders due to vasculitis or infections, e.g., with the human immunodeficiency virus (HIV). The clinical picture is complicated by the rare occurrence of HIV infection and HD.<h4>Methods</h4>First, we present a case suffering simultaneously from HIV and HD (HIV/HD) focusing on clinical manifestation and disease onset. We investigated cross-sectional data regarding molecular genetic, motoric, cognitive, functional, and psychiatric disease manifestation of HIV/HD in comparison to motor-manifest HD patients without HIV infection (nonHIV/HD) in the largest cohort of HD patients worldwide using the registry study ENROLL-HD. Data were analyzed using ANCOVA analyses controlling for covariates of age and CAG repeat length between groups in IBM SPSS Statistics V.25.<h4>Results</h4>The HD diagnosis in our case report was delayed by approximately nine years due to the false assumption that the HIV infection might have been the cause of chorea. Out of <i>n</i> = 21,116 participants in ENROLL-HD, we identified <i>n</i> = 10,125 motor-manifest HD patients. <i>n</i> = 23 male participants were classified as suffering from HIV infection as a comorbidity, compared to <i>n</i> = 4898 male non-HIV/HD patients. Except for age, with HIV/HD being significantly younger (<i>p</i> < 0.050), we observed no group differences regarding sociodemographic, genetic, educational, motoric, functional, and cognitive parameters. Male HIV/HD patients reported about a 5.3-year-earlier onset of HD symptoms noticed by themselves compared to non-HIV/HD (<i>p</i> < 0.050). Moreover, patients in the HIV/HD group had a longer diagnostic delay of 1.8 years between onset of symptoms and HD diagnosis and a longer time regarding assessment of first symptoms by the rater and judgement of the patient (all <i>p</i> < 0.050). Unexpectedly, HIV/HD patients showed less irritability in the Hospital Anxiety and Depression Scale (all <i>p</i> < 0.05).<h4>Conclusions</h4>The HD diagnosis in HIV-infected male patients is secured with a diagnostic delay between first symptoms noticed by the patient and final diagnosis. Treating physicians therefore should be sensitized to think of potential alternative diagnoses in HIV-infected patients also afflicted by movement disorders, especially if there is evidence of subcortical atrophy and a history of hyperkinesia, even without a clear HD-family history. Those patients should be transferred for early genetic testing to avoid further unnecessary diagnostics and improve sociomedical care.

Also flagged:Knee OsteoarthritisOAdegenerative knee joint diseaseOsteoarthritismusculoskeletal disorderageing
Journal Article 2021-05-27 No Snippets Zacharjasz J, Mleczko AM, Bąkowski P, Piontek T, Piontek T, Bąkowska-Żywicka K.
Show Full Abstract

Knee osteoarthritis (OA) is a degenerative knee joint disease that results from the breakdown of joint cartilage and underlying bone, affecting about 3.3% of the world's population. As OA is a multifactorial disease, the underlying pathological process is closely associated with genetic changes in articular cartilage and bone. Many studies have focused on the role of small noncoding RNAs in OA and identified numbers of microRNAs that play important roles in regulating bone and cartilage homeostasis. The connection between other types of small noncoding RNAs, especially tRNA-derived fragments and knee osteoarthritis is still elusive. The observation that there is limited information about small RNAs different than miRNAs in knee OA was very surprising to us, especially given the fact that tRNA fragments are known to participate in a plethora of human diseases and a portion of them are even more abundant than miRNAs. Inspired by these findings, in this review we have summarized the possible involvement of microRNAs and tRNA-derived fragments in the pathology of knee osteoarthritis.

Also flagged:essential tremorETLINGO1SLC1A2STK32BPPARGC1A
Journal Article 2021-05-27 No Snippets Jiménez-Jiménez FJ, Alonso-Navarro H, García-Martín E, Álvarez I, Pastor P, Agúndez JAG.
Show Full Abstract

There are many reports suggesting an important role of genetic factors in the etiopathogenesis of essential tremor (ET), encouraging continuing the research for possible genetic markers. Linkage studies in families with ET have identified 4 genes/loci for familial ET, although the responsible gene(s) have not been identified. Genome-wide association studies (GWAS) described several variants in <i>LINGO1</i>, <i>SLC1A2</i>, <i>STK32B</i>, <i>PPARGC1A</i>, and <i>CTNNA3</i>, related with ET, but none of them have been confirmed in replication studies. In addition, the case-control association studies performed for candidate variants have not convincingly linked any gene with the risk for ET. Exome studies described the association of several genes with familial ET (<i>FUS</i>, <i>HTRA2</i>, <i>TENM4</i>, <i>SORT1</i>, <i>SCN11A</i>, <i>NOTCH2NLC</i>, <i>NOS3</i>, <i>KCNS2</i>, <i>HAPLN4</i>, <i>USP46</i>, <i>CACNA1G</i>, <i>SLIT3</i>, <i>CCDC183</i>, <i>MMP10</i>, and <i>GPR151</i>), but they were found only in singular families and, again, not found in other families or other populations, suggesting that some can be private polymorphisms. The search for responsible genes for ET is still ongoing.

Also flagged:organ developmentLPPLMNB2ERBB4GABRB2NTM
Journal Article 2021-05-27 No Snippets Cho S, Manjula P, Kim M, Cho E, Lee D, Lee SH, Lee JH, Seo D.
Show Full Abstract

Korean native chickens (KNCs) comprise an indigenous chicken breed of South Korea that was restored through a government project in the 1990s. The KNC population has not been developed well and has mostly been used to maintain purebred populations in the government research institution. We investigated the genetic features of the KNC population in a selection signal study for the efficient improvement of this breed. We used 600K single nucleotide polymorphism data sampled from 191 KNCs (NG, 38; NL, 29; NR, 52; NW, 39; and NY, 33) and 54 commercial chickens (Hy-line Brown, 10; Lohmann Brown, 10; Arbor Acres, 10; Cobb, 12; and Ross, 12). Haplotype phasing was performed using EAGLE software as the initial step for the primary data analysis. Pre-processed data were analyzed to detect selection signals using the 'rehh' package in R software. A few common signatures of selection were identified in KNCs. Most quantitative trait locus regions identified as candidate regions were associated with traits related to reproductive organs, eggshell characteristics, immunity, and organ development. Block patterns with high linkage disequilibrium values were observed for LPP, IGF11, LMNB2, ERBB4, GABRB2, NTM, APOO, PLOA1, CNTN1, NTSR1, DEF3, CELF1, and MEF2D genes, among regions with confirmed selection signals. NL and NW lines contained a considerable number of selective sweep regions related to broilers and layers, respectively. We recommend focusing on improving the egg and meat traits of KNC NL and NW lines, respectively, while improving multiple traits for the other lines.

Also flagged:Polymerazidesalkynesdendrimers1,2,3-triazolespolymers
Journal Article 2021-05-27 No Snippets Cervera-Procas R, Serrano JL, Omenat A.
Show Full Abstract

Highly functional macromolecules with a well-defined architecture are the key to designing efficient and smart materials, and these polymeric systems can be tailored for specific applications in a diverse range of fields. Herein, the formation of a new liquid crystalline polymeric network based on the crosslinking of dendrimeric entities by the Cu<sup>I</sup>-catalyzed variant of the Huisgen 1,3-dipolar cycloaddition of azides and alkynes to afford 1,2,3-triazoles is reported. The polymeric material obtained in this way is easy to process and exhibits a variety of properties, which include mesomorphism, viscoelastic behavior, and thermal contraction. The porous microstructure of the polymer network determines its capability to absorb solvent molecules and to encapsulate small molecules, like organic dyes, which can be released easily afterwards. Moreover, all these properties may be easily tuned by modifying the chemical structure of the constituent dendrimers, which makes this system a very interesting one for a number of applications.

Decoding LncRNAs.

Also flagged:nucleotidestumoursgene expressionRNA polymerase IIlocalisationchromatin
Journal Article 2021-05-27 No Snippets Borkiewicz L, Kalafut J, Dudziak K, Przybyszewska-Podstawka A, Telejko I.
Show Full Abstract

Non-coding RNAs (ncRNAs) have been considered as unimportant additions to the transcriptome. Yet, in light of numerous studies, it has become clear that ncRNAs play important roles in development, health and disease. Long-ignored, long non-coding RNAs (lncRNAs), ncRNAs made of more than 200 nucleotides have gained attention due to their involvement as drivers or suppressors of a myriad of tumours. The detailed understanding of some of their functions, structures and interactomes has been the result of interdisciplinary efforts, as in many cases, new methods need to be created or adapted to characterise these molecules. Unlike most reviews on lncRNAs, we summarize the achievements on lncRNA studies by taking into consideration the approaches for identification of lncRNA functions, interactomes, and structural arrangements. We also provide information about the recent data on the involvement of lncRNAs in diseases and present applications of these molecules, especially in medicine.

Also flagged:photonethylene oxidepropylene oxidecancerwatercadmium
Journal Article 2021-05-27 No Snippets Nawrot KC, Zareba JK, Toporkiewicz M, Chodaczek G, Wawrzynczyk D, Kulbacka J, Bazylinska U, Nyk M.
Show Full Abstract

<h4>Introduction</h4>Semiconductor nanoplatelets (NPLs) are promising materials for nonlinear optical microscopy since they feature good two-photon absorption (TPA) properties, narrow photoluminescence spectra and high quantum yields of luminescence. Nevertheless, the use of semiconductor NPLs is inevitably connected with concerns about heavy metal ion toxicity and their intrinsically hydrophobic character.<h4>Methods</h4>Our contribution focuses on the design and engineering of coloidal bionanomaterial consisting of two-dimensional highly luminescent CdSe semiconductor NPLs loaded into spherical and homogeneous polymeric nanocarriers (NCs) based on poly(ethylene oxide) and poly(propylene oxide) block co-polymer. The biocompatibility and usefulness of the NPLs-loaded polymeric NCs in two-photon induced bioimaging was demonstrated <i>in</i> <i>vitro</i>by cytotoxicity and two-photon microscopic studies using eukaryotic (normal fibroblasts and cancer ovarian) cells.<h4>Results</h4>The encapsulated NPLs maintain their intensive and spectrally narrow photoluminescence, as well as preserve good TPA properties, while the surrounding polymer shell imparts hydrophilic character and non-toxicity towards eukaryotic cells. Specifically, TPA cross-sections of the colloidal NCs loaded with NPLs show large values reaching up to 2.0 × 10<sup>8</sup> GM, with simultaneously two-photon brightness reaching 2.2 × 10<sup>7</sup> GM at 870 nm. MTT proliferation assay performed on cell lines treated with encapsulated NPLs revealed at least 70% viability of normal human gingival fibroblast (HGF) and cancer ovarian (MDAH-2774) cells, while the results of multiphoton imaging of murine (L-929) fibroblasts suggest that the encapsulated NPLs are capable of labelling the target cells enabling their visualization.<h4>Conclusion</h4>As a result, we obtained water dispersible and temporally stable hydrophilic NPLs-loaded NCs that offer excellent, both one- and two-photon excited fluorescence preserving optical properties of the raw hydrophobic and colloidal NPLs. The biological responses upon eukaryotic cells indicate that the encapsulation process protects cells from the toxic influence of cadmium simultaneously preserving the unique multiphoton properties of the active cargo which opens a promising perspective for its application in multiphoton cancer bioimaging excited at the "optical transmission window" of biological tissues in near-infrared range.

Also flagged:Naringeninmyocardial ischemiaPI3KAKTIschemic heart diseasedeath
Journal Article 2021-05-27 ✓ 1 Snippet Li SH, Wang MS, Ke WL, Wang MR.
In-Text Gene Mentions

SOX6

Show Full Abstract

Ischemic heart disease (IHD) is a leading cause of death in patients with type 1 diabetes. The key to treating IHD is to restore blood supply to the ischemic myocardium, which inevitably causes myocardial ischemia reperfusion (MI/R) injury. Although naringenin (Nar) prevents MI/R injury, the role of Nar in diabetic MI/R (D-MI/R) injury remains to be elucidated. The PI3K/AKT signaling pathway and microRNA (miR)-126 have previously been shown to serve anti-MI/R injury roles. The present study aimed to investigate the protection of Nar against D-MI/R injury and the role of the miR-126-PI3K/AKT axis. Diabetic rats were treated distilled water or Nar (25 or 50 mg/kg, orally) for 30 days and then exposed to MI/R. The present results revealed that Nar alleviated MI/R injury in streptozotocin (STZ)-induced diabetic rats, as shown below: the reduction myocardial enzymes levels was measured using spectrophotometry, the increase of cardiac viability was detected by MTT assay, the inhibition of myocardial oxidative stress was measured using spectrophotometry and the enhancement of cardiac function were recorded using a hemodynamic monitoring system. Furthermore, Nar upregulated the myocardial miR-126-PI3K/AKT axis in D-MI/R rats. These results indicated that Nar alleviated MI/R injury through upregulating the myocardial miR-126-PI3K/AKT axis in STZ-induced diabetic rats. The current findings revealed that Nar, as an effective agent against D-MI/R injury, may provide an effective approach in the management of diabetic IHD.

Also flagged:Tumorextracellularcell growthImmunecancerprimary tumor
Journal Article 2021-05-27 ✓ 1 Snippet Khalaf K, Hana D, Chou JT, Singh C, Mackiewicz A, Kaczmarek M.
In-Text Gene Mentions

…by miR-18a viaSOX6, WNK2, and PTEN…

Show Full Abstract

The tumor microenvironment (TME) is a complex and ever-changing "rogue organ" composed of its own blood supply, lymphatic and nervous systems, stroma, immune cells and extracellular matrix (ECM). These complex components, utilizing both benign and malignant cells, nurture the harsh, immunosuppressive and nutrient-deficient environment necessary for tumor cell growth, proliferation and phenotypic flexibility and variation. An important aspect of the TME is cellular crosstalk and cell-to-ECM communication. This interaction induces the release of soluble factors responsible for immune evasion and ECM remodeling, which further contribute to therapy resistance. Other aspects are the presence of exosomes contributed by both malignant and benign cells, circulating deregulated microRNAs and TME-specific metabolic patterns which further potentiate the progression and/or resistance to therapy. In addition to biochemical signaling, specific TME characteristics such as the hypoxic environment, metabolic derangements, and abnormal mechanical forces have been implicated in the development of treatment resistance. In this review, we will provide an overview of tumor microenvironmental composition, structure, and features that influence immune suppression and contribute to treatment resistance.

Also flagged:RAP1GA1PTGER4EML2TNFSF10TSPAN9krt17
Journal Article 2021-05-27 ✓ 5 Snippets Hoffmann S, Roeth R, Diebold S, Gogel J, Hassel D, Just S, Rappold GA.
In-Text Gene Mentions

SOX6

sox6

Interestingly, multiple sox family members (sox5, sox6, sox8, and sox18) were significantly dysregulated in shox-deficient pectoral fins together with other genes (nppa, nppc, cdkn1a, cdkn1ca, cyp26b1, and cy26c1), highlighting an important role for these genes in shox-related growth disorders.

Multiple members of the sex determining region Y-box (sox) family (sox5, sox6, sox8a, and sox18) were shown to be significantly dysregulated in shox-deficient pectoral fins among other genes (nppa, nppc, cdkn1a, cdkn1ca, cyp26b1, and cy26c1), highlighting the important role of various gene family members in Shox-related growth disorders.

…( sox5 ,sox6, sox8 ,…

Show Full Abstract

<i>SHOX</i> deficiency causes a spectrum of clinical phenotypes related to skeletal dysplasia and short stature, including Léri-Weill dyschondrosteosis, Langer mesomelic dysplasia, Turner syndrome, and idiopathic short stature. SHOX controls chondrocyte proliferation and differentiation, bone maturation, and cellular growth arrest and apoptosis <i>via</i> transcriptional regulation of its direct target genes <i>NPPB</i>, <i>FGFR3</i>, and <i>CTGF</i>. However, our understanding of SHOX-related pathways is still incomplete. To elucidate the underlying molecular mechanisms and to better understand the broad phenotypic spectrum of <i>SHOX</i> deficiency, we aimed to identify novel SHOX targets. We analyzed differentially expressed genes in <i>SHOX</i>-overexpressing human fibroblasts (NHDF), and confirmed the known SHOX target genes <i>NPPB</i> and <i>FGFR</i> among the most strongly regulated genes, together with 143 novel candidates. Altogether, 23 genes were selected for further validation, first by whole-body characterization in developing <i>shox</i>-deficient zebrafish embryos, followed by tissue-specific expression analysis in three <i>shox</i>-expressing zebrafish tissues: head (including brain, pharyngeal arches, eye, and olfactory epithelium), heart, and pectoral fins. Most genes were physiologically relevant in the pectoral fins, while only few genes were also significantly regulated in head and heart tissue. Interestingly, multiple <i>sox</i> family members (<i>sox5</i>, <i>sox6</i>, <i>sox8</i>, and <i>sox18</i>) were significantly dysregulated in <i>shox</i>-deficient pectoral fins together with other genes (<i>nppa</i>, <i>nppc</i>, <i>cdkn1a</i>, <i>cdkn1ca</i>, <i>cyp26b1</i>, and <i>cy26c1</i>), highlighting an important role for these genes in <i>shox</i>-related growth disorders. Network-based analysis integrating data from the Ingenuity pathways revealed that most of these genes act in a common network. Our results provide novel insights into the genetic pathways and molecular events leading to the clinical manifestation of <i>SHOX</i> deficiency.

Also flagged:osteosarcomabone cancerGene Expressiontranscription factorTFcancer
Journal Article 2021-05-27 ✓ 1 Snippet Jia Y, Liu Y, Han Z, Tian R.
In-Text Gene Mentions

…degree = 10),OLFM4(olfactomedin 4, degree…

Show Full Abstract

<h4>Background</h4>Osteosarcoma (OS) is the most primary malignant bone cancer in children and adolescents with a high mortality rate. This work aims to screen novel potential gene signatures associated with OS by integrated microarray analysis of the Gene Expression Omnibus (GEO) database.<h4>Material and methods</h4>The OS microarray datasets were searched and downloaded from GEO database to identify differentially expressed genes (DEGs) between OS and normal samples. Afterwards, the functional enrichment analysis, protein-protein interaction (PPI) network analysis and transcription factor (TF)-target gene regulatory network were applied to uncover the biological function of DEGs. Finally, two published OS datasets (GSE39262 and GSE126209) were obtained from GEO database for evaluating the expression level and diagnostic values of key genes.<h4>Results</h4> In total 1,059 DEGs (569 up-regulated DEGs and 490 down-regulated DEGs) between OS and normal samples were screened. Functional analysis showed that these DEGs were markedly enriched in 214 GO terms and 54 KEGG pathways such as pathways in cancer. Five genes (CAMP, METTL7A, TCN1, LTF and CXCL12) acted as hub genes in PPI network. Besides, METTL7A, CYP4F3, TCN1, LTF and NETO2 were key genes in TF-gene network. Moreover, Pax-6 regulated four key genes (TCN1, CYP4F3, NETO2 and CXCL12). The expression levels of four genes (METTL7A, TCN1, CXCL12 and NETO2) in GSE39262 set were consistent with our integration analysis. The expression levels of two genes (CXCL12 and NETO2) in GSE126209 set were consistent with our integration analysis. ROC analysis of GSE39262 set revealed that CYP4F3, CXCL12, METTL7A, TCN1 and NETO2 had good diagnostic values for OS patients. ROC analysis of GSE126209 set revealed that CXCL12, METTL7A, TCN1 and NETO2 had good diagnostic values for OS patients.

Also flagged:GAPDHovarian cancerOCgynaecologic cancerdeathnucleotides
Journal Article 2021-05-27 ✓ 1 Snippet Li H, Wang S, Yao Q, Liu Y, Yang J, Xu L, Yang G.
In-Text Gene Mentions

…proteins ZNF135 andZNF311were both positively…

Show Full Abstract

<h4>Aims</h4>Dysregulated long noncoding RNAs (lncRNAs) contributing to ovarian cancer (OC) development may serve as prognostic biomarker. We aimed to explore a lncRNA signature to serve as prognostic biomarker of OC.<h4>Methods</h4>Univariate Cox regression was conducted on the lncRNA expression dataset from the TCGA cohort, and 246 genes significantly associated with survival were retained for building a model. A random forest survival model was carried out, and a model was developed using 6 genes with the highest frequency. The selected genes were applied in a Cox multivariate regression model for prognostic prediction by calculating the risk score. We also used CCK-8, EdU, and colony formation assays to validate the function of these lncRNAs in OC cells.<h4>Results</h4>This study confirmed that the 6-lncRNA combined signature was related to OC prognosis. Systematic analysis demonstrated that lncRNA-associated genes were enriched in oncogenic signalling pathways. Five out of the 6 lncRNAs participated in OC proliferation.<h4>Conclusion</h4>We established a 6-lncRNA combined signature for OC prognosis, which may serve as powerful prognostic biomarker for OC after further validation.

Also flagged:colorectal cancerCRCSOX9NANOGSOX2CST
Journal Article 2021-05-27 ✓ 5 Snippets Liu Y, Wu H, Luo T, Luo Q, Meng Z, Shi Y, Li F, Liu M, Peng X, Liu J, Xu C, Tang W.
In-Text Gene Mentions

MMS22L

(F) Immunofluorescence images showing the time-dependent variation in SOX9 and MMS22L colocalization in RKO cells treated with oxaliplatin.

Furthermore, we revealed a mechanism by which SOX9 regulates the expression and nuclear translocation of MMS22L and oxaliplatin resistance in CRC cells and provided a new focus for solving the problem of oxaliplatin resistance in CRC patients.

In addition, we investigated the effect of oxaliplatin in tumors with SOX9 overexpression and low expression of MMS22L in vivo.

The SOX9/MMS22L Axis Regulates Oxaliplatin Resistance in vivo

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is estimated to be one of the most common cancers and the leading cause of cancer-related death worldwide. SOX9 is commonly overexpressed in CRC and participates in drug resistance. In addition, DNA damage repair confers resistance to anticancer drugs. However, the correlation between DNA damage repair and high SOX9 expression is still unclear. In this study, we aimed to investigate the function and the specific underlying mechanism of the SOX9-dependent DNA damage repair pathway in CRC.<h4>Methods</h4>The expression levels of SOX9 and MMS22L in CRC were examined by immunohistochemistry (IHC) and TCGA analysis. RNA sequencing was conducted in RKO SOX9-deficient cells and RKO shControl cells. Mechanistic studies were performed in CRC cells by modulating SOX9 and MMS22L expression, and we evaluated drug sensitivity and DNA damage repair signaling events. In addition, we investigated the effect of oxaliplatin in tumors with SOX9 overexpression and low expression of MMS22L <i>in vivo</i>.<h4>Results</h4>Our study showed that SOX9 has a higher expression level in CRC tissues than in normal tissues and predicts poor prognosis in CRC patients. Overexpression and knockdown of SOX9 were associated with the efficacy of oxaliplatin. In addition, SOX9 activity was enriched in the DNA damage repair pathway <i>via</i> regulation of MMS22L expression and participation in DNA double-strand break repair. SOX9 was upregulated and formed a complex with MMS22L, which promoted the nuclear translocation of MMS22L upon oxaliplatin treatment. Moreover, the <i>x</i>enograft assay results showed that oxaliplatin abrogated tumor growth from cells with MMS22L downregulation in mice.<h4>Conclusions</h4>In CRC, activation of the SOX9-MMS22L-dependent DNA damage pathway is a core pathway regulating oxaliplatin sensitivity. Targeting this pathway in oxaliplatin-resistant CRC cells is a promising therapeutic option.

Also flagged:Butyrophilin 3Atype I transmembrane proteinimmunoglobulinIgBTN3A1BTN3A2
Journal Article 2021-05-27 ✓ 5 Snippets Chen S, Li Z, Huang W, Wang Y, Fan S.
In-Text Gene Mentions

BTN3A1 has a unique pocket lined with basic amino acid residues, including histidine (His351 and His378), arginine (Arg412, Arg418 and Arg469) and lysine (Lys393), providing a highly positively charged environment that can complement the negative charge of the pyrophosphate portion but position 351 of the B30.2 structure of BTN3A3 is arginine 17, 21.

LSECtin is a transmembrane protein highly expressed in tumor-associated macrophages (TAMs), while BTN3A3 is the receptor of LSECtin on breast cancer cells.

Among them, there are many studies on tumor immunity of BTN3A1, which shows that it is essential for the activation of Vγ9Vδ2 T cells, while BTN3A3 is expected to become a potential therapeutic target for breast cancer.

4. BTN3A3 and cancer

Although there are few studies on BTN3A2 and BTN3A3 in tumors, more and more evidence shows that BTN3A2 and BTN3A3 also play an important role in tumors.

Show Full Abstract

The Butyrophilin 3A (BTN3A) family is a type I transmembrane protein belonging to the immunoglobulin (Ig) superfamily. The family contains three members: BTN3A1, BTN3A2 and BTN3A3, which share 95% homology in the extracellular domain. The expression of BTN3A family members is different in different types of tumors, which plays an important role in tumor prognosis. Among them, there are many studies on tumor immunity of BTN3A1, which shows that it is essential for the activation of Vγ9Vδ2 T cells, while BTN3A3 is expected to become a potential therapeutic target for breast cancer. Recent studies have shown that the BTN3A family is closely related to the occurrence and development of tumors. Now the BTN3A family has become one of the research hotspots and is expected to become new tumor prediction and treatment targets.

Also flagged:chromosomal regionsformyelomamyelomaCDH20Multiple myelomaadult-onset
Journal Article 2021-05-27 No Snippets Griffin Waller R, Madsen MJ, Gardner J, Sborov DW, Camp NJ.
Show Full Abstract

<h4>Aim</h4>High-risk pedigrees (<i>HRPs</i>) are a powerful design to map highly penetrant risk genes. We previously described Shared Genomic Segment (SGS) analysis, a mapping method for single large extended pedigrees that also addresses genetic heterogeneity inherent in complex diseases. SGS identifies shared segregating chromosomal regions that may inherit in only a subset of cases. However, single large pedigrees that are individually powerful (at least 15 meioses between studied cases) are scarce. Here, we expand the SGS strategy to incorporate evidence from two extended HRPs by identifying the same segregating risk locus in both pedigrees and allowing for some relaxation in the size of each HRP.<h4>Methods</h4>Duo-SGS is a procedure to combine single-pedigree SGS evidence. It implements statistically rigorous duo-pedigree thresholding to determine genome-wide significance levels that account for optimization across pedigree pairs. Single-pedigree SGS identifies optimal segments shared by case subsets at each locus across the genome, with nominal significance assessed empirically. Duo-SGS combines the statistical evidence for SGS segments at the same genomic location in two pedigrees using Fisher's method. One pedigree is paired with all others and the best duo-SGS evidence at each locus across the genome is established. Genome-wide significance thresholds are determined through distribution-fitting and the Theory of Large Deviations. We applied the duoSGS strategy to eleven extended, myeloma HRPs.<h4>Results</h4>We identified one genome-wide significant region at 18q21.33 (0.85 Mb, <i>P</i> = 7.3 × 10<sup>-9</sup>) which contains one gene, <i>CDH20</i>. Thirteen regions were genome-wide suggestive: 1q42.2, 2p16.1, 3p25.2, 5q21.3, 5q31.1, 6q16.1, 6q26, 7q11.23, 12q24.31, 13q13.3, 18p11.22, 18q22.3 and 19p13.12.<h4>Conclusion</h4>Our results provide novel risk loci with segregating evidence from multiple HRPs and offer compelling targets and specific segment carriers to focus a future search for functional variants involved in inherited risk formyeloma.

bioRxiv 2021-05-27 Preprint (No Snippets API) Kitambi SS, Chandrasekar G.
Show Full Abstract

POU genes are characterized by a conserved POU DNA-binding domain, and are divided into six subclasses. Class III and IV POU genes are predominantly expressed in the developing nervous system. POU class III genes are critical for several neuronal cell differentiation and class IV POU genes serve important functions in the differentiation and survival of sensory neurons. In this study, we attempted to identify POU genes in the zebrafish and pufferfish genomes by using existing bioinformatics tools. We analysed the expression of zebrafish brn1 . 2 and brn3a genes ( brn3a1 and brn3a2) ) using whole-mount in situ hybridisation. Similarly to the mammalian orthologue, zebrafish brn1 . 2 was widely expressed in the forebrain, midbrain and hindbrain. During the late stages of embryogenesis, brn1 . 2 expressing cells were located in the preoptic area and in the auditory vesicles. Expression of both zebrafish brn3a genes was detected in trigeminal ganglia, cranial sensory ganglia, sensory neurons along the dorsal spinal cord, in the anterior and posterior lateral line placodes (ALL and PLL), retinal ganglion cell layer, optic tectum and in small cell clusters in the forebrain and hindbrain. Similar to mammalian Brn3a, zebrafish brn3a genes were detected in the retina and sensory structures. However, different domains of expression were also observed, namely in spinal sensory neurons, and lateral line system.

Also flagged:Glioblastoma multiformeGBMmalignant cancerbreast cancergliomaAMOTL2
Journal Article 2021-05-26 ✓ 1 Snippet Chen X, Lu Y, Guo G, Zhang Y, Sun Y, Guo L, Li R, Nan Y, Yang X, Dong J, Jin X, Huang Q.
In-Text Gene Mentions

…complexes and recruitinghistone modifying co-modifying co-activators, such…

Show Full Abstract

Glioblastoma multiforme (GBM) is the most prevalent type of malignant cancer in the adult central nervous system; however, its mechanism remains unclear. Angiomotin‑like 2 (AMOTL2) is a member of the motin family of angiostatin‑binding proteins. It has been reported as an oncogene in cervical and breast cancer, but its association with glioma remains unknown. The aim of the present study was to investigate AMOTL2‑regulated processes in glioma cell lines using extensive <i>in vitro</i> assays and certain bioinformatics tools. These results revealed that AMOTL2 was downregulated in high‑grade glioma cells and tissues, with patients with glioma exhibiting a high AMOTL2 expression having a higher survival rate. The results of the glioma cell phenotype experiment showed that AMOTL2 suppressed GBM proliferation, migration and invasion. In addition, immunoblotting, co‑immunoprecipitation and immunofluorescence assays demonstrated that AMOTL2 could directly bind to β‑catenin protein, the key molecule of the Wnt signaling pathway, and regulate its downstream genes by regulating β‑catenin nuclear translocation. In conclusion, the present study demonstrated that AMOTL2 inhibited glioma proliferation, migration and invasion by regulating β‑catenin nuclear localization. Thus, AMOTL2 may serve as a therapeutic target to further improve the prognosis and prolong survival time of patients with glioma.

Also flagged:deathcancerneurodegenerative diseasemitochondrialpeptidetissue homeostasis
Journal Article 2021-05-26 No Snippets Li K, van Delft MF, Dewson G.
Show Full Abstract

Apoptotic cell death is implicated in both physiological and pathological processes. Since many types of cancerous cells intrinsically evade apoptotic elimination, induction of apoptosis has become an attractive and often necessary cancer therapeutic approach. Conversely, some cells are extremely sensitive to apoptotic stimuli leading to neurodegenerative disease and immune pathologies. However, due to several challenges, pharmacological inhibition of apoptosis is still only a recently emerging strategy to combat pathological cell loss. Here, we describe several key steps in the intrinsic (mitochondrial) apoptosis pathway that represent potential targets for inhibitors in disease contexts. We also discuss the mechanisms of action, advantages and limitations of small-molecule and peptide-based inhibitors that have been developed to date. These inhibitors serve as important research tools to dissect apoptotic signalling and may foster new treatments to reduce unwanted cell loss.

Also flagged:fertilizationageingcell cycleUBE2CUBCCDC34
Journal Article 2021-05-26 No Snippets Yuan L, Yin P, Yan H, Zhong X, Ren C, Li K, Chin Heng B, Zhang W, Tong G.
Show Full Abstract

Oocyte ageing is a key bottleneck and intractable challenge for in vitro fertilization treatment of aged female patients. The underlying molecular mechanisms of human oocyte ageing remain to be elucidated. Hence, this study aims to investigate the key genes and relevant biological signalling pathways involved in human oocyte ageing. We isolated mRNA for single-cell RNA sequencing from MII human oocytes donated by patients undergoing intracytoplasmic sperm injection. Nine RNA-seq datasets were analyzed, which included 6 older patients(average 42.67±2.25 years) and 3 younger patients (average 25.67±2.08 years). 481 differentially expressed genes (DEGs) were identified, including 322 upregulated genes enriched in transcription, ubiquitination, epigenetic regulation, and cellular processes, and 159 downregulated genes enriched in ubiquitination, cell cycle, signalling pathway, and DNA repair. The STRING database was used to analyse protein-protein interactions, and the Cytoscape software was used to identify hub genes. From these DEGs, 17 hub genes were identified including 12 upregulated genes (UBE2C, UBC, CDC34, UBR1, KIF11, ASF1B, PRC1, ESPL1, GTSE1, EXO1, UBA1, KIF4A) and 5 downregulated genes (UBA52, UBE2V2, SKP1, CCNB1, MAD2L1). The significant key biological processes that are associated with these hub genes include ubiquitin-mediated proteolysis, ubiquitination-related pathways, oocyte meiosis, and cell cycle. Among these, UBE2C may play a crucial role in human oocyte ageing.

Also flagged:Proteasomeneurodegenerative diseaseslocalizationsiodixanolgamma-enolaseENO2
Journal Article 2021-05-26 ✓ 1 Snippet Esfahanian N, Nelson M, Autenried R, Pattison JS, Callegari E, Rezvani K.
In-Text Gene Mentions

Htt

Show Full Abstract

Defects in the activity of the proteasome or its regulators are linked to several pathologies, including neurodegenerative diseases. We hypothesize that proteasome heterogeneity and its selective partners vary across brain regions and have a significant impact on proteasomal catalytic activities. Using neuronal cell cultures and brain tissues obtained from mice, we compared proteasomal activities from two distinct brain regions affected in neurodegenerative diseases, the striatum and the hippocampus. The results indicated that proteasome activities and their responses to proteasome inhibitors are determined by their subcellular localizations and their brain regions. Using an iodixanol gradient fractionation method, proteasome complexes were isolated, followed by proteomic analysis for proteasomal interaction partners. Proteomic results revealed brain region-specific non-proteasomal partners, including gamma-enolase (ENO2). ENO2 showed more association to proteasome complexes purified from the striatum than to those from the hippocampus. These results highlight a potential key role for non-proteasomal partners of proteasomes regarding the diverse activities of the proteasome complex recorded in several brain regions.

Also flagged:polynucleic acidbindingmembranesenzyme activitytumorexcretion
Journal Article 2021-05-26 No Snippets Binzel DW, Li X, Burns N, Khan E, Lee WJ, Chen LC, Ellipilli S, Miles W, Ho YS, Guo P.
Show Full Abstract

RNA nanotechnology is the bottom-up self-assembly of nanometer-scale architectures, resembling LEGOs, composed mainly of RNA. The ideal building material should be (1) versatile and controllable in shape and stoichiometry, (2) spontaneously self-assemble, and (3) thermodynamically, chemically, and enzymatically stable with a long shelf life. RNA building blocks exhibit each of the above. RNA is a polynucleic acid, making it a polymer, and its negative-charge prevents nonspecific binding to negatively charged cell membranes. The thermostability makes it suitable for logic gates, resistive memory, sensor set-ups, and NEM devices. RNA can be designed and manipulated with a level of simplicity of DNA while displaying versatile structure and enzyme activity of proteins. RNA can fold into single-stranded loops or bulges to serve as mounting dovetails for intermolecular or domain interactions without external linking dowels. RNA nanoparticles display rubber- and amoeba-like properties and are stretchable and shrinkable through multiple repeats, leading to enhanced tumor targeting and fast renal excretion to reduce toxicities. It was predicted in 2014 that RNA would be the third milestone in pharmaceutical drug development. The recent approval of several RNA drugs and COVID-19 mRNA vaccines by FDA suggests that this milestone is being realized. Here, we review the unique properties of RNA nanotechnology, summarize its recent advancements, describe its distinct attributes inside or outside the body and discuss potential applications in nanotechnology, medicine, and material science.

Also flagged:Pulmonary arteriovenous malformationsstrokecerebral abscessmyocardial infarctionpulmonary haemorrhagePulmonary arteriovenous malformation
Journal Article 2021-05-26 No Snippets Kramdhari H, Valakkada J, Ayyappan A.
Show Full Abstract

Pulmonary arteriovenous malformations (PAVM) are abnormal communication of a branch of the pulmonary artery and pulmonary vein circumventing the intervening pulmonary capillaries. This results in a right-to-left (R-L) shunt and its related manifestations, which include hampered gas exchange leading to hypoxaemia, dyspnoea, paradoxical emboli leading to stroke, cerebral abscess, myocardial infarction and pulmonary haemorrhage due to rupture of the PAVM. Endovascular transcatheter embolization of the feeding vessels with coils or occlusion devices is the current standard care of treatment and preferred treatment modality. The articles aim to provide insights into the current trends in diagnosis, the current recommendations, approach and management options for patients with PAVM.

Also flagged:polycythemiajaundiceHyperbilirubinemiaironIron deficiency anemiahypertension
Journal Article 2021-05-26 ✓ 2 Snippets Shao H, Gao S, Lu Q, Zhao X, Hua Y, Wang X.
In-Text Gene Mentions

However, our study demonstrated that DCC did not increase the rate of phototherapy, although DCC resulted in elevated transcutaneous bilirubin on the day of birth temporarily and the increasing rate of polycythemia on the third day after birth.

…the role ofDCCin the two…

Show Full Abstract

<h4>Background</h4>Delayed cord clamping in full-term neonates is widely recommended, while in practice, it is rarely implemented in cesarean section due to the fear of neonatal jaundice and excessive maternal blood loss. The optimal timing of cord clamping remains uncertain. This study was to fully evaluate the effects of delayed cord clamping on short-term hematological status and jaundice in term neonates delivered by cesarean section.<h4>Methods</h4>This retrospective study enrolled 796 women, who were allocated into the early cord clamping group (n = 377) and the delayed cord clamping group (n = 419). The latter group was further divided into two subgroups (30-60 s, 61-120 s). The outcomes were neonatal transcutaneous bilirubin levels on 0 to 5 days of life and the rate of phototherapy. For neonates who had blood tests on the first three days of life, their hemoglobin and hematocrit were compared among groups.<h4>Results</h4>Compared with the early cord clamping group, delayed cord clamping merely increased the transcutaneous bilirubin level of neonates on the day of birth rather than that on the following five days. The heel peripheral blood sample size of 1-3 days in the early cord clamping group was 61, 25 and 33, and in the delayed cord clamping group was 53, 46 and 32, respectively. Delayed cord clamping at 30-60 s resulted in the higher neonatal hemoglobin level on day 3 and an increased rate of neonatal polycythemia, without a higher rate of phototherapy. Delayed cord clamping beyond 60 s did not further improve hematological status in term neonates born by cesarean section.<h4>Conclusion</h4>In cesarean section, delayed cord clamping for 30-60 s improved the early hematological status of term neonates without the enhanced requirement of phototherapy for neonatal jaundice.

Also flagged:deathanxietyDeathsdementiapsychosisCOVID-19
Journal Article 2021-05-26 No Snippets Bakolis I, Stewart R, Baldwin D, Beenstock J, Bibby P, Broadbent M, Cardinal R, Chen S, Chinnasamy K, Cipriani A, Douglas S, Horner P, Jackson CA, John A, Joyce DW, Lee SC, Lewis J, McIntosh A, Nixon N, Osborn D, Phiri P, Rathod S, Smith T, Sokal R, Waller R, Landau S.
Show Full Abstract

<h4>Objectives</h4>To investigate changes in daily mental health (MH) service use and mortality in response to the introduction and the lifting of the COVID-19 'lockdown' policy in Spring 2020.<h4>Design</h4>A regression discontinuity in time (RDiT) analysis of daily service-level activity.<h4>Setting and participants</h4>Mental healthcare data were extracted from 10 UK providers.<h4>Outcome measures</h4>Daily (weekly for one site) deaths from all causes, referrals and discharges, inpatient care (admissions, discharges, caseloads) and community services (face-to-face (f2f)/non-f2f contacts, caseloads): Adult, older adult and child/adolescent mental health; early intervention in psychosis; home treatment teams and liaison/Accident and Emergency (A&E). Data were extracted from 1 Jan 2019 to 31 May 2020 for all sites, supplemented to 31 July 2020 for four sites. Changes around the commencement and lifting of COVID-19 'lockdown' policy (23 March and 10 May, respectively) were estimated using a RDiT design with a difference-in-difference approach generating incidence rate ratios (IRRs), meta-analysed across sites.<h4>Results</h4>Pooled estimates for the lockdown transition showed increased daily deaths (IRR 2.31, 95% CI 1.86 to 2.87), reduced referrals (IRR 0.62, 95% CI 0.55 to 0.70) and reduced inpatient admissions (IRR 0.75, 95% CI 0.67 to 0.83) and caseloads (IRR 0.85, 95% CI 0.79 to 0.91) compared with the pre lockdown period. All community services saw shifts from f2f to non-f2f contacts, but varied in caseload changes. Lift of lockdown was associated with reduced deaths (IRR 0.42, 95% CI 0.27 to 0.66), increased referrals (IRR 1.36, 95% CI 1.15 to 1.60) and increased inpatient admissions (IRR 1.21, 95% CI 1.04 to 1.42) and caseloads (IRR 1.06, 95% CI 1.00 to 1.12) compared with the lockdown period. Site-wide activity, inpatient care and community services did not return to pre lockdown levels after lift of lockdown, while number of deaths did. Between-site heterogeneity most often indicated variation in size rather than direction of effect.<h4>Conclusions</h4>MH service delivery underwent sizeable changes during the first national lockdown, with as-yet unknown and unevaluated consequences.

Also flagged:mitochondrialgene expressionprotein synthesistranscription factorsCHOPC/EBPβ
Journal Article 2021-05-26 ✓ 5 Snippets Kaspar S, Oertlin C, Szczepanowska K, Kukat A, Senft K, Lucas C, Brodesser S, Hatzoglou M, Larsson O, Topisirovic I, Trifunovic A.
In-Text Gene Mentions

Similar changes (Fig. 3A) were previously described in other cellular and in vivo models for mitochondrial OXPHOS defects, confirming that DARS2 deficiency causes a stress response relevant for many mitochondrial disease states (11–14).

The most up-regulated transcripts in DARS2 KO hearts encoded enzymes involved in one-carbon metabolism, serine biosynthesis, and trans-sulfuration, as well as Gdf15 and Fgf21 (Fig. 3, A and B, and table S2), the two cytokines shown to be excreted from tissues upon OXPHOS deficiency (25, 26).

We previously showed that DARS2 depletion mediated by Ckmm-Cre expression induces dilated cardiomyopathy preceding any pathological phenotypes in skeletal muscle (2).

CHOP deficiency in the absence of DARS2 resulted in dilated cardiomyopathy (Fig. 1B and fig.

While only minor perturbations in amino acid levels were observed in DARS2 KO hearts, most amino acids were significantly up-regulated in DKO mice (fig.

Show Full Abstract

In response to disturbed mitochondrial gene expression and protein synthesis, an adaptive transcriptional response sharing a signature of the integrated stress response (ISR) is activated. We report an intricate interplay between three transcription factors regulating the mitochondrial stress response: CHOP, C/EBPβ, and ATF4. We show that CHOP acts as a rheostat that attenuates prolonged ISR, prevents unfavorable metabolic alterations, and postpones the onset of mitochondrial cardiomyopathy. Upon mitochondrial dysfunction, CHOP interaction with C/EBPβ is needed to adjust ATF4 levels, thus preventing overactivation of the ATF4-regulated transcriptional program. Failure of this interaction switches ISR from an acute to a chronic state, leading to early respiratory chain deficiency, energy crisis, and premature death. Therefore, contrary to its previously proposed role as a transcriptional activator of mitochondrial unfolded protein response, our results highlight a role of CHOP in the fine-tuning of mitochondrial ISR in mammals.

Also flagged:Cell cycleAnnexin Vpropidium iodideBCRPtumorFACS
Journal Article 2021-05-26 No Snippets Zhang S, Peng X, Li X, Liu H, Zhao B, Elkabets M, Liu Y, Wang W, Wang R, Zhong Y, Kong D.
Show Full Abstract

PARP inhibitors have been approved for the therapy of cancers with homologous recombination (HR) deficiency based on the concept of "synthetic lethality". However, glioblastoma (GBM) patients have gained little benefit from PARP inhibitors due to a lack of BRCA mutations. Herein, we demonstrated that concurrent treatment with the PARP inhibitor rucaparib and the PI3K inhibitor BKM120 showed synergetic anticancer effects on GBM U251 and U87MG cells. Mechanistically, BKM120 decreased expression of HR molecules, including RAD51 and BRCA1/2, and reduced HR repair efficiency in GBM cells, therefore increasing levels of apoptosis induced by rucaparib. Furthermore, we discovered that the two compounds complemented each other in DNA damage response and drug accumulation. Notably, in the zebrafish U87MG-RFP orthotopic xenograft model, nude mouse U87MG subcutaneous xenograft model and U87MG-Luc orthotopic xenograft model, combination showed obviously increased antitumor efficacy compared to each monotherapy. Immunohistochemical analysis of tumor tissues indicated that the combination obviously reduced expression of HR repair molecules and increased the DNA damage biomarker γ-H2AX, consistent with the in vitro results. Collectively, our findings provide new insight into combined blockade of PI3K and PARP, which might represent a promising therapeutic approach for GBM.

Also flagged:atrophyage-related locomotive syndromemuscle atrophyagingorthostatic intolerancesynthesis
Journal Article 2021-05-26 No Snippets Furukawa S, Chatani M, Higashitani A, Higashibata A, Kawano F, Nikawa T, Numaga-Tomita T, Ogura T, Sato F, Sehara-Fujisawa A, Shinohara M, Shimazu T, Takahashi S, Watanabe-Takano H.
Show Full Abstract

The musculoskeletal system provides the body with correct posture, support, stability, and mobility. It is composed of the bones, muscles, cartilage, tendons, ligaments, joints, and other connective tissues. Without effective countermeasures, prolonged spaceflight under microgravity results in marked muscle and bone atrophy. The molecular and physiological mechanisms of this atrophy under unloaded conditions are gradually being revealed through spaceflight experiments conducted by the Japan Aerospace Exploration Agency using a variety of model organisms, including both aquatic and terrestrial animals, and terrestrial experiments conducted under the Living in Space project of the Japan Ministry of Education, Culture, Sports, Science, and Technology. Increasing our knowledge in this field will lead not only to an understanding of how to prevent muscle and bone atrophy in humans undergoing long-term space voyages but also to an understanding of countermeasures against age-related locomotive syndrome in the elderly.

Also flagged:methyl-CpG binding protein 2neurodevelopmental disorderMECP2transcriptional regulatorgene expressionNF-κB
Journal Article 2021-05-26 No Snippets Marballi K, MacDonald JL.
Show Full Abstract

Mutations in the methyl-CpG binding protein 2 (MECP2) gene cause Rett syndrome (RTT), an X-linked neurodevelopmental disorder predominantly impacting females. MECP2 is an epigenetic transcriptional regulator acting mainly to repress gene expression, though it plays multiple gene regulatory roles and has distinct molecular targets across different cell types and specific developmental stages. In this review, we summarize MECP2 loss-of-function associated transcriptome and proteome disruptions, delving deeper into the latter which have been comparatively severely understudied. These disruptions converge on multiple biochemical and cellular pathways, including those involved in synaptic function and neurodevelopment, NF-κB signaling and inflammation, and the vitamin D pathway. RTT is a complex neurological disorder characterized by myriad physiological disruptions, in both the central nervous system and peripheral systems. Thus, treating RTT will likely require a combinatorial approach, targeting multiple nodes within the interactomes of these cellular pathways. To this end, we discuss the use of dietary supplements and factors, namely, vitamin D and polyunsaturated fatty acids (PUFAs), as possible partial therapeutic agents given their demonstrated benefit in RTT and their ability to restore homeostasis to multiple disrupted cellular pathways simultaneously. Further unravelling the complex molecular alterations induced by MECP2 loss-of-function, and contextualizing them at the level of proteome homeostasis, will identify new therapeutic avenues for this complex disorder.

Also flagged:pyrimidine nucleotidesectonucleotidasespyrimidinebindingcalciumtrifluoromethyl
Journal Article 2021-05-26 No Snippets Oliva P, Scortichini M, Dobelmann C, Jain S, Gopinatth V, Toti KS, Phung NB, Junker A, Jacobson KA.
Show Full Abstract

The G<sub>q</sub>-coupled P2Y<sub>6</sub> receptor (P2Y<sub>6</sub>R) is a component of the purinergic signaling system and functions in inflammatory, cardiovascular and metabolic processes. UDP, the native P2Y<sub>6</sub>R agonist and P2Y<sub>14</sub>R partial agonist, is subject to hydrolysis by ectonucleotidases. Therefore, we have synthesized UDP/CDP analogues containing a stabilizing α,β-methylene bridge as P2Y<sub>6</sub>R agonists and identified compatible affinity-enhancing pyrimidine modifications. A distal binding region on the receptor was explored with 4-benzyloxyimino cytidine 5'-diphosphate analogues and their potency determined in a calcium mobilization assay. A 4-trifluoromethyl-benzyloxyimino substituent in 25 provided the highest human P2Y<sub>6</sub>R potency (MRS4554, 0.57 µM), and a 5-fluoro substitution of the cytosine ring in 28 similarly enhanced potency, with >175- and 39-fold selectivity over human P2Y<sub>14</sub>R, respectively. However, 3-alkyl (31-33, 37, 38), β-d-arabinofuranose (39) and 6-aza (40) substitution prevented P2Y<sub>6</sub>R activation. Thus, we have identified new α,β-methylene bridged N<sup>4</sup>-extended CDP analogues as P2Y<sub>6</sub>R agonists that are highly selective over the P2Y<sub>14</sub>R.

Also flagged:HbaLiver massHemoglobinFtl1Transferriniron
Journal Article 2021-05-26 No Snippets Prajapati M, Conboy HL, Hojyo S, Fukada T, Budnik B, Bartnikas TB.
Show Full Abstract

Iron is essential for erythropoiesis and other biological processes, but is toxic in excess. Dietary absorption of iron is a highly regulated process and is a major determinant of body iron levels. Iron excretion, however, is considered a passive, unregulated process, and the underlying pathways are unknown. Here we investigated the role of metal transporters SLC39A14 and SLC30A10 in biliary iron excretion. While SLC39A14 imports manganese into the liver and other organs under physiological conditions, it imports iron under conditions of iron excess. SLC30A10 exports manganese from hepatocytes into the bile. We hypothesized that biliary excretion of excess iron would be impaired by SLC39A14 and SLC30A10 deficiency. We therefore analyzed biliary iron excretion in Slc39a14-and Slc30a10-deficient mice raised on iron-sufficient and -rich diets. Bile was collected surgically from the mice, then analyzed with nonheme iron assays, mass spectrometry, ELISAs, and an electrophoretic assay for iron-loaded ferritin. Our results support a model in which biliary excretion of excess iron requires iron import into hepatocytes by SLC39A14, followed by iron export into the bile predominantly as ferritin, with iron export occurring independently of SLC30A10. To our knowledge, this is the first report of a molecular determinant of mammalian iron excretion and can serve as basis for future investigations into mechanisms of iron excretion and relevance to iron homeostasis.

Also flagged:HOTAIRBreast CancercancersHOXtumorcancer
Journal Article 2021-05-26 No Snippets Shi Y, Huang Q, Kong X, Zhao R, Chen X, Zhai Y, Xiong L.
Show Full Abstract

Breast cancer is one of the most devastating cancers with high morbidity and mortality in females worldwide. Breast tumorigenesis and further development present great uncertainty and complexity, and efficient therapeutic approaches still lack. Accumulating evidence indicates HOX transcript antisense intergenic RNA (HOTAIR) is dysregulated in cancers and has emerged as a novel hotspot in the field. In breast cancer, aberrant HOTAIR expression is responsible for advanced tumor progression by regulating multifarious signaling pathways. Besides, HOTAIR may act as competitive endogenous RNA to bind to several microRNAs and suppress their expressions, which can subsequently upregulate the levels of targeted downstream messenger RNAs, thereby leading to further cancer progression. In addition, HOTAIR works as a promising biomarker and predictor for breast cancer patients' diagnosis or outcome prediction. Recently, HOTAIR is potentially considered to be a drug target. Here, we have summarized the induction of HOTAIR in breast cancer and its impacts on cell proliferation, migration, apoptosis, and therapeutic resistance, as well as elucidating the underlying mechanisms. This review aims to provide new insights into investigations between HOTAIR and breast cancer development and inspire new methods for studying the association in depth.

Also flagged:neurodegenerative disordersenile dementiaAutophagymitophagyβ-amyloid
Journal Article 2021-05-26 No Snippets Silvestro S, Chiricosta L, Gugliandolo A, Iori R, Rollin P, Perenzoni D, Mattivi F, Bramanti P, Mazzon E.
Show Full Abstract

Alzheimer's disease (AD) is a progressive neurodegenerative disorder and represents the most common form of senile dementia. Autophagy and mitophagy are cellular processes that play a key role in the aggregation of β-amyloid (Aβ) and tau phosphorylation. As a consequence, impairment of these processes leads to the progression of AD. Thus, interest is growing in the search for new natural compounds, such as Moringin (MOR), with neuroprotective, anti-amyloidogenic, antioxidative, and anti-inflammatory properties that could be used for AD prevention. However, MOR appears to be poorly soluble and stable in water. To increase its solubility MOR was conjugated with α-cyclodextrin (MOR/α-CD). In this work, it was evaluated if MOR/α-CD pretreatment was able to exert neuroprotective effects in an AD in vitro model through the evaluation of the transcriptional profile by next-generation sequencing (NGS). To induce the AD model, retinoic acid-differentiated SH-SY5Y cells were exposed to Aβ<sub>1-42</sub>. The MOR/α-CD pretreatment reduced the expression of the genes which encode proteins involved in senescence, autophagy, and mitophagy processes. Additionally, MOR/α-CD was able to induce neuronal remodeling modulating the axon guidance, principally downregulating the Slit/Robo signaling pathway. Noteworthy, MOR/α-CD, modulating these important pathways, may induce neuronal protection against Aβ<sub>1-42</sub> toxicity as demonstrated also by the reduction of cleaved caspase 3. These data indicated that MOR/α-CD could attenuate the progression of the disease and promote neuronal repair.

Also flagged:FerroptosisdeathirontumorsColon cancerBRAF
Journal Article 2021-05-26 ✓ 5 Snippets Zhu J, Kong W, Xie Z.
In-Text Gene Mentions

These genes could be roughly classified into iron metabolism (CISD1), lipid metabolism (PEBP1, FDFT1), and amino acid and glutathione metabolism (GSS) [10,27,28].

Figure 1C shows the mRNA expression levels of fifteen prognostic ferroptosis-related genes between normal and colon cancer samples in the GEO database. We found tumors showed a high expression of ABCC1, ACACA, FANCD2, GLS2, GSS, KEAP1, NFS1, and PEBP1 and a low expression of HMGCR and LPCAT3 compared to that of normal samples (Figure 1C, TCGA database was shown in Figure S2A). It was found that tumors with a high expression of FDFT1 showed a low expression of the CRYAB and a high expression of the HMGCR. Tumors with high expression of GSS showed a high expression of NFS1, ABCC1, and NOX1 (Figure 1D). Among 399 samples, 69 experienced mutations of 15 prognostic ferroptosis-related genes, with a frequency of 17.29%. It was found that ACACA (32/69) exhibited the highest mutation frequency followed by ABCC1 (23/69), while CISD1 as well a PEBP1 did not show any mutations in colon cancer samples (Figure 1E,F).

PEBP1 affects various diseases including cancer, Alzheimer’s disease, and pancreatitis, which makes it a logical target for individualized therapy and disease-specific intervention [35,36].

…NOX1 , andPEBP1( Figure 1…

…, NOX1 ,PEBP1) were associated…

Show Full Abstract

Ferroptosis is a new type of programmed cell death, which occurs with iron dependence. Previous studies have showed that ferroptosis plays an important regulatory role in the occurrence and development of tumors. Colon cancer is one of the major morbidities and causes of mortality in the world. This study used RNA-seq and colon cancer clinical data to explore the relationship between ferroptosis-related genes and colon cancer. Based on the fifteen prognostic ferroptosis-related genes, two molecular subgroups of colon cancer were identified. Surprisingly, we also found cluster2 was characterized by lower mutation burden and expression of checkpoint genes, better survival, and higher expression of <i>NOX1</i>. Moreover, cluster2 has fewer BRAF mutations. We also found the expression of <i>NOX1</i> is related to the status of BRAF. Finally, using 15 ferroptosis-related genes from The Cancer Genome Atlas cohort, we constructed a prognosis model, and this model may be used to predict the prognosis of patients in clinics.

Also flagged:TumorSTATSTATsmyeloproliferative neoplasmscancerJAK1
Journal Article 2021-05-26 ✓ 2 Snippets Klein K, Stoiber D, Sexl V, Witalisz-Siepracka A.
In-Text Gene Mentions

In contrast, Tofacitinib was not effective in a patient with DDX3X-MLLT10 T-ALL carrying an activating JAK3 mutation [249].

…a patient with DDX3X-MLLT10T-ALL carrying an…

Show Full Abstract

The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway propagates signals from a variety of cytokines, contributing to cellular responses in health and disease. Gain of function mutations in JAKs or STATs are associated with malignancies, with <i>JAK2</i><i><sup>V617F</sup></i> being the main driver mutation in myeloproliferative neoplasms (MPN). Therefore, inhibition of this pathway is an attractive therapeutic strategy for different types of cancer. Numerous JAK inhibitors (JAKinibs) have entered clinical trials, including the JAK1/2 inhibitor Ruxolitinib approved for the treatment of MPN. Importantly, loss of function mutations in JAK-STAT members are a cause of immune suppression or deficiencies. MPN patients undergoing Ruxolitinib treatment are more susceptible to infections and secondary malignancies. This highlights the suppressive effects of JAKinibs on immune responses, which renders them successful in the treatment of autoimmune diseases but potentially detrimental for cancer patients. Here, we review the current knowledge on the effects of JAKinibs on immune cells in the context of hematological malignancies. Furthermore, we discuss the potential use of JAKinibs for the treatment of diseases in which lymphocytes are the source of malignancies. In summary, this review underlines the necessity of a robust immune profiling to provide the best benefit for JAKinib-treated patients.

Also flagged:extracellular matrix proteinsWntNotchBone morphogenic proteinmineralizationbone formation
Journal Article 2021-05-26 ✓ 2 Snippets Aasebø E, Brenner AK, Hernandez-Valladares M, Birkeland E, Berven FS, Selheim F, Bruserud Ø.
In-Text Gene Mentions

…the Golgi system (B4GALT5, FAM20A), intracellular traff…

…one metabolism/mineralization:B4GALT5, ELN, FBN2, TLR4,…

Show Full Abstract

Mesenchymal stem cells (MSCs) can differentiate into osteoblasts, and therapeutic targeting of these cells is considered both for malignant and non-malignant diseases. We analyzed global proteomic profiles for osteoblasts derived from ten and MSCs from six healthy individuals, and we quantified 5465 proteins for the osteoblasts and 5420 proteins for the MSCs. There was a large overlap in the profiles for the two cell types; 156 proteins were quantified only in osteoblasts and 111 proteins only for the MSCs. The osteoblast-specific proteins included several extracellular matrix proteins and a network including 27 proteins that influence intracellular signaling (Wnt/Notch/Bone morphogenic protein pathways) and bone mineralization. The osteoblasts and MSCs showed only minor age- and sex-dependent proteomic differences. Finally, the osteoblast and MSC proteomic profiles were altered by ex vivo culture in serum-free media. We conclude that although the proteomic profiles of osteoblasts and MSCs show many similarities, we identified several osteoblast-specific extracellular matrix proteins and an osteoblast-specific intracellular signaling network. Therapeutic targeting of these proteins will possibly have minor effects on MSCs. Furthermore, the use of ex vivo cultured osteoblasts/MSCs in clinical medicine will require careful standardization of the ex vivo handling of the cells.

Also flagged:Tumortumorspathogenesisliver cancerHepatocellular Carcinomacancer
Journal Article 2021-05-26 ✓ 1 Snippet Barcena-Varela M, Lujambio A.
In-Text Gene Mentions

…diseases such ashemochromatosis(HFE1 gene alterations),…

Show Full Abstract

Hepatocellular carcinoma (HCC) represents a global health problem. The incidence keeps increasing and current therapeutic options confer limited benefits to the patients. Tumor heterogeneity plays a central role in this context, limiting the availability of predictive biomarkers and complicating the criteria used to choose the most suitable therapeutic option. HCC heterogeneity occurs at different levels: within the population (inter-patient heterogeneity) and within tumors from the same patient (intra-patient and intra-tumor heterogeneity). Experts in the field have made many efforts to classify the patients based on clinicopathological characteristics and molecular signatures; however, there is still much work ahead to be able to integrate the extra-tumor heterogeneity that emerges from the complexity of the tumor microenvironment, which plays a critical role in the pathogenesis of the disease and therapy responses. In this review, we summarize tumor intrinsic and extrinsic sources of heterogeneity of the most common etiologies of HCC and summarize the most recent discoveries regarding the evolutionary trajectory of liver cancer cells and the influence of tumor-extrinsic factors such as the microbiome and the host immune system. We further highlight the potential of novel high-throughput methodologies to contribute to a better understanding of this devastating disease and to the improvement of the clinical management of patients.

Also flagged:tick-borne diseaseHeartwaterbiotinvirulence factorshost cellimmune responses
Journal Article 2021-05-26 ✓ 2 Snippets Marcelino I, Holzmuller P, Coelho A, Mazzucchelli G, Fernandez B, Vachiéry N.
In-Text Gene Mentions

…and 3 protocadherins (PCDH17, PCDHGA2 and PCDHGC3),…

…of phospholipase A2 (PRDX6, over-expressed) and mitogen-…

Show Full Abstract

The Rickettsiales <i>Ehrlichia ruminantium</i>, the causal agent of the fatal tick-borne disease Heartwater, induces severe damage to the vascular endothelium in ruminants. Nevertheless, <i>E. ruminantium-</i>induced pathobiology remains largely unknown. Our work paves the way for understanding this phenomenon by using quantitative proteomic analyses (2D-DIGE-MS/MS, 1DE-nanoLC-MS/MS and biotin-nanoUPLC-MS/MS) of host bovine aorta endothelial cells (BAE) during the in vitro bacterium intracellular replication cycle. We detect 265 bacterial proteins (including virulence factors), at all time-points of the <i>E. ruminantium</i> replication cycle, highlighting a dynamic bacterium-host interaction. We show that <i>E. ruminantium</i> infection modulates the expression of 433 host proteins: 98 being over-expressed, 161 under-expressed, 140 detected only in infected BAE cells and 34 exclusively detected in non-infected cells. Cystoscape integrated data analysis shows that these proteins lead to major changes in host cell immune responses, host cell metabolism and vesicle trafficking, with a clear involvement of inflammation-related proteins in this process. Our findings led to the first model of <i>E. ruminantium</i> infection in host cells in vitro, and we highlight potential biomarkers of <i>E. ruminantium</i> infection in endothelial cells (such as ROCK1, TMEM16K, Albumin and PTPN1), which may be important to further combat Heartwater, namely by developing non-antibiotic-based strategies.

Also flagged:Liver FibrosisType 2 Diabetes MellitusNAFLDnon-alcoholic fatty liver diseaseHormoneobesity
Journal Article 2021-05-26 ✓ 1 Snippet Du J, Chai S, Zhao X, Sun J, Zhang X, Huo L.
In-Text Gene Mentions

…hepatitis, Wilson disease,hemochromatosis; (4) administration of…

Show Full Abstract

<h4>Purpose</h4>To evaluate the effects of serum thyroid hormone levels on advanced liver fibrosis in cases with NAFLD (non-alcoholic fatty liver disease) and T2DM (type 2 diabetes mellitus).<h4>Patients and methods</h4>A total of 1422 cases with T2DM who were admitted to Peking University International Hospital between December 2014 and October 2019 were retrospectively analyzed. Standard anthropometry as well as clinical and laboratory evaluation were performed on all patients. Abdominal ultrasonography was performed to diagnose NAFLD. NFS (NAFLD fibrosis score) was used to identify advanced fibrosis in patients with T2DM and NAFLD.<h4>Results</h4>In cases with T2DM and NAFLD, the serum FT3 level in cases with advanced fibrosis was lower than that in those without advanced fibrosis (4.79±0.89 vs 4.28±1.19, <i>P</i> < 0.05), and significant difference was not found in serum levels of FT4 and TSH between cases with advanced fibrosis and those without advanced fibrosis (<i>P</i> > 0.05). The incidence of advanced fibrosis declined as the rise of serum FT3 levels (<i>P</i> <sub>trend</sub> < 0.05). Besides, FT3 (OR, 0.492; 95% CI, 0.384-0.631) was noted as a factor influencing advanced fibrosis in cases with T2DM and NAFLD (<i>P</i>< 0.05).<h4>Conclusion</h4>In cases with T2DM and NAFLD, the incidence of advanced fibrosis is negatively correlated with serum FT3 levels, and a low FT3 level is an independent risk factor of advanced fibrosis.

Also flagged:STIP1Annexin VmetforminGastric CancerAGSCell Proliferation
Journal Article 2021-05-26 No Snippets Wang WH, Chen SK, Huang HC, Juan HF.
Show Full Abstract

Metformin is one of the most widely used anti-diabetic drugs in type-II diabetes treatment. The mechanism of decreasing blood glucose is believed to suppress hepatic gluconeogenesis by increasing muscular glucose uptake and insulin sensitivity. Recent studies suggest that metformin may reduce cancer risk; however, its anticancer mechanism in gastric cancers remains unclear. Here, we aim to evaluate the anticancer effects of metformin on human gastric adenocarcinoma (AGS) cells. Our results showed that metformin inhibited AGS cell proliferation in a dose-dependent manner. Using small-scale quantitative proteomics, we identified 177 differentially expressed proteins upon metformin treatment; among these, nine proteins such as 26S proteasome non-ATPase regulatory subunit 2 (PSMD2), stress-induced phosphoprotein 1 (STIP1), and adenylyl cyclase-associated protein 1 (CAP1) were significantly altered. We found that metformin induced cell cycle arrest at the G0/G1 phase, suppressed cell migration, and affected cytoskeleton distribution. Additionally, patients with highly expressed PSMD2, STIP1, and CAP1 have a poor clinical outcome. Our study provides a novel view of developing therapies for gastric cancer.

Also flagged:Alcohol Use DisorderAcute Alcoholic Hepatitisalcoholic hepatitisAHalcohol-related liver diseasesteatohepatitis
Journal Article 2021-05-26 ✓ 1 Snippet Ting PS, Gurakar A, Wheatley J, Chander G, Cameron AM, Chen PH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Severe alcoholic hepatitis portends a high risk of mortality without liver transplantation. Transplant outcomes in patients with severe alcoholic hepatitis exhibit a strong inverse association with post-transplant alcohol relapse. The ingredients most central to ameliorating alcohol relapse risk may include destigmatized post-transplant alcohol monitoring, a nonpunitive clinician-patient partnership, and multimodal therapies to maintain abstinence and mitigate high-risk drinking. We here review the core principles of post-liver transplant management specific to alcohol use disorder.

Also flagged:Cas9zinc-finger nucleasestranscription activator-like effector nucleasesclustered regularly interspaced short palindromicCRISPR-associated protein 9oncogenes
Journal Article 2021-05-26 ✓ 1 Snippet Behr M, Zhou J, Xu B, Zhang H.
In-Text Gene Mentions

Huntington's disease (HD) is caused by a mutation to the huntingtin (HTT) gene causing expression of an altered HTT protein that is neurotoxic and is commonly inherited in an autosomal dominant pattern.143

Show Full Abstract

Within less than a decade since its inception, CRISPR-Cas9-based genome editing has been rapidly advanced to human clinical trials in multiple disease areas. Although it is highly anticipated that this revolutionary technology will bring novel therapeutic modalities to many diseases by precisely manipulating cellular DNA sequences, the low efficiency of <i>in vivo</i> delivery must be enhanced before its therapeutic potential can be fully realized. Here we discuss the most recent progress of <i>in vivo</i> delivery of CRISPR-Cas9 systems, highlight innovative viral and non-viral delivery technologies, emphasize outstanding delivery challenges, and provide the most updated perspectives.

Also flagged:-19palladiumCOVID-19metalsSilverPlatinum
Journal Article 2021-05-26 No Snippets Yousaf I.
Show Full Abstract

We examine the risk transmission from the COVID-19 to metal (precious and industrial) and energy markets using the BEKK-MGARCH model. The findings reveal the significant and negative volatility transmission from the COVID-19 to gold, palladium, and brent oil markets, suggesting the safe-haven properties of these markets. The COVID-19 risk is not transmitted to the industrial metal market, whereas the rise in COVID-19 volatility leads to an increase in WTI oil market volatility. These results provide useful insights to investors and policymakers regarding risk management, asset pricing, and financial market stability during the COVID-19 pandemic.

Also flagged:lactic acidosiscarbohydratemetabolic disordersmitochondrial disorderspyruvate dehydrogenase deficiency-box and leucine-rich repeat protein 4
Journal Article 2021-05-25 ✓ 4 Snippets İnci A, Aktaş E, Cengiz Ergin FB, Okur İ, Biberoğlu G, Ezgü FS, Tümer L.
In-Text Gene Mentions

The first case with FBXL4 mutation successfully treated with a parenteral ketogenic diet for lactic acidosis.

The effectiveness of the KD is revealed in mitochondrial disorders, mainly in pyruvate dehydrogenase deficiency.<h4>Case report</h4>A 4-year-old girl who was diagnosed with an F-box and leucine-rich repeat protein 4 (FBXL4) gene mutation was hospitalized with sepsis.

…first case withFBXL4mutation successfully treated…

…repeat protein 4 (FBXL4) gene mutation was…

Show Full Abstract

<h4>Background</h4>The ketogenic diet (KD) is a low-carbohydrate, high-fat diet that has been used as an effective nonpharmacological treatment in many neurological and metabolic disorders for a long time. The effectiveness of the KD is revealed in mitochondrial disorders, mainly in pyruvate dehydrogenase deficiency.<h4>Case report</h4>A 4-year-old girl who was diagnosed with an F-box and leucine-rich repeat protein 4 (FBXL4) gene mutation was hospitalized with sepsis. She was first given standard parenteral nutrition (PN) because of gastrointestinal problems. During the disease course, lactic acidosis became prominent and did not respond to pharmacological treatment; standard PN was gradually switched to parenteral KD, and lactate levels decreased after parenteral KD. The patient was discharged with an enteral KD.<h4>Conclusion</h4>This is the first case of mitochondrial depletion syndrome effectively treated with parenteral KD for lactic acidosis.

Also flagged:ironbone morphogenetic proteinserythropoiesisdegradationexporterbone morphogenetic protein
Journal Article 2021-05-25 ✓ 2 Snippets Fisher AL, Babitt JL.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

Iron homeostasis is tightly regulated to balance the iron requirement for erythropoiesis and other vital cellular functions, while preventing cellular injury from iron excess. The liver hormone hepcidin is the master regulator of systemic iron balance by controlling the degradation and function of the sole known mammalian iron exporter ferroportin. Liver hepcidin expression is coordinately regulated by several signals that indicate the need for more or less iron, including plasma and tissue iron levels, inflammation, and erythropoietic drive. Most of these signals regulate hepcidin expression by modulating the activity of the bone morphogenetic protein (BMP)-SMAD pathway, which controls hepcidin transcription. Genetic disorders of iron overload and iron deficiency have identified several hepatocyte membrane proteins that play a critical role in mediating the BMP-SMAD and hepcidin regulatory response to iron. However, the precise molecular mechanisms by which serum and tissue iron levels are sensed to regulate BMP ligand production and promote the physical and/or functional interaction of these proteins to modulate SMAD signaling and hepcidin expression remain uncertain. This critical commentary will focus on the current understanding and key unanswered questions regarding how the liver senses iron levels to regulate BMP-SMAD signaling and thereby hepcidin expression to control systemic iron homeostasis.

Also flagged:inclCdh5Cd2Cd79aperoxideLTBP1
Journal Article 2021-05-25 ✓ 2 Snippets Schupp JC, Adams TS, Cosme C, Raredon MSB, Yuan Y, Omote N, Poli S, Chioccioli M, Rose KA, Manning EP, Sauler M, DeIuliis G, Ahangari F, Neumark N, Habermann AC, Gutierrez AJ, Bui LT, Lafyatis R, Pierce RW, Meyer KB, Nawijn MC, Teichmann SA, Banovich NE, Kropski JA, Niklason LE, Pe'er D, Yan X, Homer RJ, Rosas IO, Kaminski N.
In-Text Gene Mentions

…such as ENG,PCDH17, CLEC14A, CLEC1A (C-type…

…including PTGS1 andPTGIS, and with…

Show Full Abstract

<h4>Background</h4>Cellular diversity of the lung endothelium has not been systematically characterized in humans. We provide a reference atlas of human lung endothelial cells (ECs) to facilitate a better understanding of the phenotypic diversity and composition of cells comprising the lung endothelium.<h4>Methods</h4>We reprocessed human control single-cell RNA sequencing (scRNAseq) data from 6 datasets. EC populations were characterized through iterative clustering with subsequent differential expression analysis. Marker genes were validated by fluorescent microscopy and in situ hybridization. scRNAseq of primary lung ECs cultured in vitro was performed. The signaling network between different lung cell types was studied. For cross-species analysis or disease relevance, we applied the same methods to scRNAseq data obtained from mouse lungs or from human lungs with pulmonary hypertension.<h4>Results</h4>Six lung scRNAseq datasets were reanalyzed and annotated to identify >15 000 vascular EC cells from 73 individuals. Differential expression analysis of EC revealed signatures corresponding to endothelial lineage, including panendothelial, panvascular, and subpopulation-specific marker gene sets. Beyond the broad cellular categories of lymphatic, capillary, arterial, and venous ECs, we found previously indistinguishable subpopulations; among venous EC, we identified 2 previously indistinguishable populations: pulmonary-venous ECs (COL15A1<sup>neg</sup>) localized to the lung parenchyma and systemic-venous ECs (COL15A1<sup>pos</sup>) localized to the airways and the visceral pleura; among capillary ECs, we confirmed their subclassification into recently discovered aerocytes characterized by <i>EDNRB</i>, <i>SOSTDC1</i>, and <i>TBX2</i> and general capillary EC. We confirmed that all 6 endothelial cell types, including the systemic-venous ECs and aerocytes, are present in mice and identified endothelial marker genes conserved in humans and mice. Ligand-receptor connectome analysis revealed important homeostatic crosstalk of EC with other lung resident cell types. scRNAseq of commercially available primary lung ECs demonstrated a loss of their native lung phenotype in culture. scRNAseq revealed that endothelial diversity is maintained in pulmonary hypertension. Our article is accompanied by an online data mining tool (www.LungEndothelialCellAtlas.com).<h4>Conclusions</h4>Our integrated analysis provides a comprehensive and well-crafted reference atlas of ECs in the normal lung and confirms and describes in detail previously unrecognized endothelial populations across a large number of humans and mice.

Also flagged:Pulmonary Hypertensionleftheart diseasePHEndothelin receptorprostacyclins
Journal Article 2021-05-25 ✓ 1 Snippet Lteif C, Ataya A, Duarte JD.
In-Text Gene Mentions

5‐HTT indicates serotonin receptor gene; eNOS, endothelial nitric oxide synthase gene; and PH‐LHD, pulmonary hypertension in left heart disease.

Show Full Abstract

Pulmonary hypertension (PH) attributable to left heart disease (LHD) is believed to be the most common form of PH and is strongly associated with increased mortality and morbidity in this patient population. Specific therapies for PH-LHD have not yet been identified and the use of pulmonary artery hypertension-targeted therapies in PH-LHD are not recommended. Endothelin receptor antagonists, phosphodiesterase-5 inhibitors, guanylate cyclase stimulators, and prostacyclins have all been studied in PH-LHD with conflicting results. Understanding the mechanisms underlying PH-LHD could potentially provide novel therapeutic targets. Fibrosis, oxidative stress, and metabolic syndrome have been proposed as pathophysiological components of PH-LHD. Genetic associations have also been identified, offering additional mechanisms with biological plausibility. This review summarizes the evidence and challenges for treatment of PH-LHD and focuses on underlying mechanisms on the horizon that could develop into potential therapeutic targets for this disease.

Also flagged:lackfatty liverhepatitissteatosisLiver diseasebilirubin
Journal Article 2021-05-25 ✓ 1 Snippet Bernardo S, Crespo R, Saraiva S, Barata R, Gonçalves S, Nogueira P, Cortez-Pinto H, Machado MV.
In-Text Gene Mentions

…cholangitis, Wilson’s disease,hemochromatosis, or α1-antitrypsin deficiency…

Show Full Abstract

<h4>Background</h4>Most long-term heavy drinkers do not have clinically evident chronic liver disease (CLD). However, at any time-point, their risk of developing CLD remains unknown. We aimed to evaluate the long-term outcomes of a group of heavy drinkers, without evidence of CLD at baseline.<h4>Methods</h4>A cohort of 123 long-term heavy drinkers without CLD were prospectively recruited in 2002 and retrospectively followed until 2018.<h4>Results</h4>At baseline (2002), median alcohol consumption was 271±203g/day during 21.5±20 years, 65% being abstinent during the previous 1.75±5 months. Patients were followed for 14±3 years. During follow-up, 53% reported any alcohol intake. Alcohol consumption during follow-up associated weakly with either 1- or 6-months previous abstinence at baseline. Until 2018, progression to CLD occurred in 6%, associating with years of alcohol intake during follow-up (OR 1.15 [1.01-1.31]) and baseline alkaline-phosphatase (OR 1.05 [1.01-1.10]). During follow-up, being abstinent for at least 1 year positively associated with CLD-free survival. 27% died (55% of cancer-mostly oropharyngeal cancer, 27% of cardiovascular disease, and 9% of liver disease), with a mean age of 71 years [69-74] (10 years less than the expected in the Portuguese population). Achieving abstinence for at least 1 year positively associated with overall survival, while smoking, and hepatic steatosis at baseline associated negatively.<h4>Conclusion</h4>Long-term heavy drinkers seemed to have a decreased life expectancy compared with the overall Portuguese population. Cancer was the main cause of death. Our results suggest that progression to CLD depends mostly on continued alcohol intake. Alcohol abstinence, even if temporary, seems to decrease the risks of CLD and mortality.

Also flagged:fibrinfibrinogenexocytosisregulation of tube diameterextracellular exosomePlatelet activation
Journal Article 2021-05-25 No Snippets Lemoine GG, Scott-Boyer MP, Ambroise B, Périn O, Droit A.
Show Full Abstract

<h4>Background</h4>Network-based analysis of gene expression through co-expression networks can be used to investigate modular relationships occurring between genes performing different biological functions. An extended description of each of the network modules is therefore a critical step to understand the underlying processes contributing to a disease or a phenotype. Biological integration, topology study and conditions comparison (e.g. wild vs mutant) are the main methods to do so, but to date no tool combines them all into a single pipeline.<h4>Results</h4>Here we present GWENA, a new R package that integrates gene co-expression network construction and whole characterization of the detected modules through gene set enrichment, phenotypic association, hub genes detection, topological metric computation, and differential co-expression. To demonstrate its performance, we applied GWENA on two skeletal muscle datasets from young and old patients of GTEx study. Remarkably, we prioritized a gene whose involvement was unknown in the muscle development and growth. Moreover, new insights on the variations in patterns of co-expression were identified. The known phenomena of connectivity loss associated with aging was found coupled to a global reorganization of the relationships leading to expression of known aging related functions.<h4>Conclusion</h4>GWENA is an R package available through Bioconductor ( https://bioconductor.org/packages/release/bioc/html/GWENA.html ) that has been developed to perform extended analysis of gene co-expression networks. Thanks to biological and topological information as well as differential co-expression, the package helps to dissect the role of genes relationships in diseases conditions or targeted phenotypes. GWENA goes beyond existing packages that perform co-expression analysis by including new tools to fully characterize modules, such as differential co-expression, additional enrichment databases, and network visualization.

Also flagged:cancersBHLF1LINC00312LINC00672NAG7STMN1
Journal Article 2021-05-25 No Snippets Liu Y, Hu Z, Zhang Y, Wang C.
Show Full Abstract

Epstein Barr-virus (EBV) is related to several cancers. Long non-coding RNAs (lncRNAs) act by regulating target genes and are involved in tumourigenesis. However, the role of lncRNAs in EBV-associated cancers is rarely reported. Understanding the role and mechanism of lncRNAs in EBV-associated cancers may contribute to diagnosis, prognosis and clinical therapy in the future. EBV encodes not only miRNAs, but also BART lncRNAs during latency and the BHLF1 lncRNA during both the latent and lytic phases. These lncRNAs can be targeted regulate inflammation, invasion, and migration and thus tumourigenesis. The products of EBV also directly and indirectly regulate host lncRNAs, including LINC00312, NORAD CYTOR, SHNG8, SHNG5, MINCR, lncRNA-BC200, LINC00672, MALATI1, LINC00982, LINC02067, IGFBP7-AS1, LOC100505716, LOC100128494, NAG7 and RP4-794H19.1, to facilitate tumourigenesis using different mechanisms. Additionally, lncRNAs have been previously validated to interact with microRNAs (miRNAs), and lncRNAs and miRNAs mutually suppress each other. The EBV-miR-BART6-3p/LOC553103/STMN1 axis inhibits EBV-associated tumour cell proliferation. Additionally, H. pylori-EBV co-infection promotes inflammatory lesions and results in EMT. HPV-EBV co-infection inhibits the transition from latency to lytic replication. KSHV-EBV co-infection aggravates tumourigenesis in huNSG mice. COVID-19-EBV co-infection may activate the immune system to destroy a tumour, although this situation is rare and the mechanism requires further confirmation. Hopefully, this information will shed some light on tumour therapy strategies tumourigenesis. Additionally, this strategy benefits for infected patients by preventing latency to lytic replication. Understanding the role and expression of lnRNAs in these two phases of EBV is critical to control the transition from latency to the lytic replication phase. This review presents differential expressed lncRNAs in EBV-associated cancers and provides resources to aid in developing superior strategies for clinical therapy.

Also flagged:binHistone modificationrunCTCFchromosomesArl6ip5
Journal Article 2021-05-25 ✓ 3 Snippets Lee DI, Roy S.
In-Text Gene Mentions

DCC

…TADs with significantDCCacross cell lines…

…K562); based onDCC, HiCseg, GRiNCH, and…

Show Full Abstract

High-throughput chromosome conformation capture assays, such as Hi-C, have shown that the genome is organized into organizational units such as topologically associating domains (TADs), which can impact gene regulatory processes. The sparsity of Hi-C matrices poses a challenge for reliable detection of these units. We present GRiNCH, a constrained matrix-factorization-based approach for simultaneous smoothing and discovery of TADs from sparse contact count matrices. GRiNCH shows superior performance against seven TAD-calling methods and three smoothing methods. GRiNCH is applicable to multiple platforms including SPRITE and HiChIP and can predict novel boundary factors with potential roles in genome organization.

Also flagged:neurological diseasemyotonic dystrophiesamyotrophic lateral sclerosiscerebellar ataxianeuropathyvestibular areflexia syndrome
Journal Article 2021-05-25 ✓ 1 Snippet Chintalaphani SR, Pineda SS, Deveson IW, Kumar KR.
In-Text Gene Mentions

…enrichment of C9orf72,HTT, FMR1 and…

Show Full Abstract

<h4>Background</h4>Short tandem repeat (STR) expansion disorders are an important cause of human neurological disease. They have an established role in more than 40 different phenotypes including the myotonic dystrophies, Fragile X syndrome, Huntington's disease, the hereditary cerebellar ataxias, amyotrophic lateral sclerosis and frontotemporal dementia.<h4>Main body</h4>STR expansions are difficult to detect and may explain unsolved diseases, as highlighted by recent findings including: the discovery of a biallelic intronic 'AAGGG' repeat in RFC1 as the cause of cerebellar ataxia, neuropathy, and vestibular areflexia syndrome (CANVAS); and the finding of 'CGG' repeat expansions in NOTCH2NLC as the cause of neuronal intranuclear inclusion disease and a range of clinical phenotypes. However, established laboratory techniques for diagnosis of repeat expansions (repeat-primed PCR and Southern blot) are cumbersome, low-throughput and poorly suited to parallel analysis of multiple gene regions. While next generation sequencing (NGS) has been increasingly used, established short-read NGS platforms (e.g., Illumina) are unable to genotype large and/or complex repeat expansions. Long-read sequencing platforms recently developed by Oxford Nanopore Technology and Pacific Biosciences promise to overcome these limitations to deliver enhanced diagnosis of repeat expansion disorders in a rapid and cost-effective fashion.<h4>Conclusion</h4>We anticipate that long-read sequencing will rapidly transform the detection of short tandem repeat expansion disorders for both clinical diagnosis and gene discovery.

Also flagged:LSD1MethylationmucusNEUROD1trefoil factor 3tumor
Journal Article 2021-05-25 ✓ 1 Snippet Miller SA, Policastro RA, Sriramkumar S, Lai T, Huntington TD, Ladaika CA, Kim D, Hao C, Zentner GE, O'Hagan HM.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Despite the connection of secretory cells, including goblet and enteroendocrine (EEC) cells, to distinct mucus-containing colorectal cancer histologic subtypes, their role in colorectal cancer progression has been underexplored. Here, our analysis of The Cancer Genome Atlas (TCGA) and single-cell RNA-sequencing data demonstrates that EEC progenitor cells are enriched in <i>BRAF</i>-mutant colorectal cancer patient tumors, cell lines, and patient-derived organoids. In <i>BRAF</i>-mutant colorectal cancer, EEC progenitors were blocked from differentiating further by DNA methylation and silencing of NEUROD1, a key gene required for differentiation of intermediate EECs. Mechanistically, secretory cells and the factors they secrete, such as trefoil factor 3, promoted colony formation and activation of cell survival pathways in the entire cell population. Lysine-specific demethylase 1 (LSD1) was identified as a critical regulator of secretory cell specification <i>in vitro</i> and in a colon orthotopic xenograft model, where LSD1 loss blocks formation of EEC progenitors and reduces tumor growth and metastasis. These findings reveal an important role for EEC progenitors in supporting colorectal cancer. SIGNIFICANCE: This study establishes enteroendocrine progenitors as a targetable population that promotes <i>BRAF</i>-mutant colorectal cancer and can be blocked by LSD1 inhibition to suppress tumor growth.

Also flagged:Ig kappa chain V-I region GalFBLN1secreted phosphoprotein 24H factor 1keratin, type I cytoskeletal 14keratin, type I cytoskeletal 16
Journal Article 2021-05-25 ✓ 1 Snippet Mao K, Tan Q, Ma Y, Wang S, Zhong H, Liao Y, Huang Q, Xiao W, Xia H, Tan X, Luo P, Xu J, Long D, Jin Y.
In-Text Gene Mentions

…as SERPINA1_P01009 andPRDX6_P30041(Peroxiredoxin 6) were …

Show Full Abstract

More and more patients suffered from Coronavirus disease 2019 (COVID-19) have got recovery gradually due to suitable intervention. Increasing data mainly studies the clinical characteristics of recovered COVID-19 patients, and their molecular changes especially proteome changes also play the same important role in understanding of biological characteristics of recovered COVID-19 patients as clinical characteristics do. In our study, we reported the whole lung-ground glass-CT value-average of mild/severe recovered patients 3 months after discharge without underlying diseases was significantly lower than that of healthy subjects. Then we isolated the extracellular vesicles (EVs) of plasma from 19 healthy subjects and 67 recovered COVID-19 patients. Mass Spectrometry was used to catalogue the proteins of these EVs compared to a defined group of controls. Identified 174 proteins were differentially expressed in the EVs of COVID-19 patients compared with healthy subjects, which involved in lipid metabolic process, response to cellular, and response to stress oxygen-containing compound. Besides, we identified several protein of plasma EVs in recovered patients associated with coagulation activity, inflammatory reaction, immune response, and low organ function. In addition, proteins correlating with clinical index such as alkaline phosphatase (ALP) and alanine aminotransferase (ALT) were also detected. Moreover, we also identified many unique or characteristic associations found in the recovered COVID-19 patients, which especially involved the kidney, serum electrolyte levels, and inflammation functions. This finding suggests that monitoring the situation of recovered patients might be useful, especially the indexes of coagulation, inflammation, immunity, and organ function, which can prevent bleeding, reinfection and organ dysfunction.

Also flagged:alpha-fetoproteinAFPcell-cell junctionscell-cell adhesionALBPuromycin
Journal Article 2021-05-25 No Snippets Ellero AA, van den Bout I, Vlok M, Cromarty AD, Hurrell T.
Show Full Abstract

Three-dimensional models are considered a powerful tool for improving the concordance between in vitro and in vivo phenotypes. However, the duration of spheroid culture may influence the degree of correlation between these counterparts. When using immortalised cell lines as model systems, the assumption for consistency and reproducibility is often made without adequate characterization or validation. It is therefore essential to define the biology of each spheroid model by investigating proteomic dynamics, which may be altered relative to culture duration. As an example, we assessed the influence of culture duration on the relative proteome abundance of HepG2 cells cultured as spheroids, which are routinely used to model aspects of the liver. Quantitative proteomic profiling of whole cell lysates labelled with tandem-mass tags was conducted using liquid chromatography-tandem mass spectrometry (LC-MS/MS). In excess of 4800 proteins were confidently identified, which were shared across three consecutive time points over 28 days. The HepG2 spheroid proteome was divergent from the monolayer proteome after 14 days in culture and continued to change over the successive culture time points. Proteins representing the recognised core hepatic proteome, cell junction, extracellular matrix, and cell adhesion proteins were found to be continually modulated.

Also flagged:Tween-20Ammoniumpolynucleotide kinaseadd 2Tris(hydroxymethyl)aminomethanephosphorylation
Journal Article 2021-05-25 ✓ 1 Snippet Delley CL, Abate AR.
In-Text Gene Mentions

HFE

Show Full Abstract

Barcode beads allow efficient nucleic acid tagging in single cell genomics. Current barcode designs, however, are fabricated with a particular application in mind. Repurposing to novel targets, or altering to add additional targets as information is obtained is possible but the result is suboptimal. Here, we describe a modular framework that simplifies generation of multifunctional beads and allows their easy extension to new targets.

Also flagged:seed germinationgene expressionsignal transductionsugarsamino acidstyrosinase
Journal Article 2021-05-25 ✓ 1 Snippet Mei M, Wei J, Ai W, Zhang L, Lu XJ.
In-Text Gene Mentions

…6 genes (PRDX6) were down-regulated.…

Show Full Abstract

Magnolia sieboldii K. Koch (M. sieboldii) is a deciduous Chinese tree species of the Magnoliaceae family with high ornamental, medicinal, and economic benefits. The germination of M. sieboldii seeds under natural conditions is extremely difficult, thereby hindering the cultivation and breeding of this important species. The molecular mechanisms underlying M. sieboldii seed germination remain unclear due to the lack of genomic and transcriptomic resources. Here, we integrated both mRNA and miRNA sequencing to identify the genes and pathways related to M. sieboldii germination. A comprehensive full-length transcriptome containing 158,083 high-quality unigenes was obtained by single-molecule real-time (SMRT) sequencing technology. We identified a total of 13,877 genes that were differentially expressed between non-germinated and germinated seeds. These genes were mainly involved in plant hormone signal transduction and diverse metabolic pathways such as those involving lipids, sugars, and amino acids. Our results also identified a complex regulatory network between miRNAs and their target genes. Taken together, we present the first transcriptome of M. sieboldii and provide key genes and pathways associated with seed germination for further characterization. Future studies of the molecular basis of seed germination will facilitate the genetic improvement M. sieboldii.

Also flagged:cognitive deficitsmental illnessschizophreniadepressionpsychiatric disorderscognition
Journal Article 2021-05-25 No Snippets Lam M, Chen CY, Ge T, Xia Y, Hill DW, Trampush JW, Yu J, Knowles E, Davies G, Stahl EA, Huckins L, Liewald DC, Djurovic S, Melle I, Christoforou A, Reinvang I, DeRosse P, Lundervold AJ, Steen VM, Espeseth T, Räikkönen K, Widen E, Palotie A, Eriksson JG, Giegling I, Konte B, Hartmann AM, Roussos P, Giakoumaki S, Burdick KE, Payton A, Ollier W, Chiba-Falek O, Koltai DC, Need AC, Cirulli ET, Voineskos AN, Stefanis NC, Avramopoulos D, Hatzimanolis A, Smyrnis N, Bilder RM, Freimer NB, Cannon TD, London E, Poldrack RA, Sabb FW, Congdon E, Conley ED, Scult MA, Dickinson D, Straub RE, Donohoe G, Morris D, Corvin A, Gill M, Hariri AR, Weinberger DR, Pendleton N, Bitsios P, Rujescu D, Lahti J, Le Hellard S, Keller MC, Andreassen OA, Deary IJ, Glahn DC, Huang H, Liu C, Malhotra AK, Lencz T.
Show Full Abstract

Broad-based cognitive deficits are an enduring and disabling symptom for many patients with severe mental illness, and these impairments are inadequately addressed by current medications. While novel drug targets for schizophrenia and depression have emerged from recent large-scale genome-wide association studies (GWAS) of these psychiatric disorders, GWAS of general cognitive ability can suggest potential targets for nootropic drug repurposing. Here, we (1) meta-analyze results from two recent cognitive GWAS to further enhance power for locus discovery; (2) employ several complementary transcriptomic methods to identify genes in these loci that are credibly associated with cognition; and (3) further annotate the resulting genes using multiple chemoinformatic databases to identify "druggable" targets. Using our meta-analytic data set (N = 373,617), we identified 241 independent cognition-associated loci (29 novel), and 76 genes were identified by 2 or more methods of gene identification. Actin and chromatin binding gene sets were identified as novel pathways that could be targeted via drug repurposing. Leveraging our transcriptomic and chemoinformatic databases, we identified 16 putative genes targeted by existing drugs potentially available for cognitive repurposing.

Also flagged:osimertinibselumetinibepidermal growth factor receptorEGFRtyrosine kinasenon-small cell lung cancer
Journal Article 2021-05-25 No Snippets Chen W, Yu D, Sun SY, Li F.
Show Full Abstract

Osimertinib (OSI) is the first FDA-approved third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI). It can be used for treating non-small cell lung cancer (NSCLC) patients with activating EGFR mutation and for patients who are resistant to first-generation EGFR TKIs due to T790M resistance mutation. However, patients treated with OSI ultimately develop acquired resistance, which prevents its long-term benefit for patients. Therefore, the development of effective strategies to overcome OSI resistance will address a significant clinical challenge and benefit patients by prolonging their survival time. Our previous studies indicated that combination therapy was a promising strategy for overcoming OSI resistance. In this study, we developed nanoparticle (NP) formulations for co-delivery of osimertinib (OSI) and selumetinib (SEL) to treat OSI-resistant NSCLC effectively. We conjugated SEL with PEG through a reactive oxygen species (ROS)-responsive linker to generate polyethylene glycol (PEG)-SEL conjugate prodrug (PEG-S-SEL). Due to the amphiphilic nature of PEG-S-SEL, it can self-assemble in an aqueous solution to form micelle NP and serve as a delivery carrier for OSI. The ROS-responsive linker can facilitate the release of drugs in the tumor microenvironment with elevated ROS levels. OSI and SEL combination NP can overcome OSI resistance by simultaneously inhibiting both EGFR and mitogen-activated protein kinase (MEK), thus effectively inducing apoptosis in OSI-resistant NSCLC cells and inhibiting OSI-resistant tumors in vivo. In conclusion, the OSI+SEL NP combination therapy showed promising anticancer efficacy and demonstrated potential for treating NSCLC patients with OSI acquired resistance. STATEMENT OF SIGNIFICANCE: Osimertinib (OSI) is the first FDA-approved third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor. It has been successfully used for treating non-small cell lung cancer (NSCLC) patients with activating EGFR mutation. However, patients treated with OSI ultimately develop acquired resistance. This study developed OSI and selumetinib (SEL) co-delivering nanoparticles to overcome OSI-acquired resistance in NSCLC. PEG-SEL conjugate functions as reactive oxygen species (ROS)-responsive prodrug and forms micelle nanoparticles through self-assembly to deliver OSI. The combination NP can simultaneously inhibit EGFR and mitogen-activated protein kinase (MEK), thus effectively inducing apoptosis in OSI-resistant NSCLC cells. In summary, the OSI and SEL nanoparticle combination therapy showed promising anticancer efficacy and demonstrated potential for treating NSCLC patients with OSI acquired resistance.

Also flagged:Mitochondrial Disordersmitochondrial diseaselactatealanineprolinerespiratory chain enzyme
Journal Article 2021-05-25 ✓ 2 Snippets Forny P, Footitt E, Davison JE, Lam A, Woodward CE, Batzios S, Bhate S, Chakrapani A, Cleary M, Gissen P, Grunewald S, Hurst JA, Scott R, Heales S, Jacques TS, Cullup T, Rahman S.
In-Text Gene Mentions

Twenty-five of the 85 patients received a confirmed genetic diagnosis via the clinical exome panel, with the following affected genes: FBXL4 (n = 4), AARS2 (n = 2), ELAC2 (n = 2), LRPPRC (n = 2), C12orf65, CA5A, CACNA1A, EARS2, EXOSC3, FOXRED1, GRIN2A, IBA57, LAMA2, MMAB, NDUFB11, PDHA1, RMND1, SDHA, and VPS13B (all n = 1; underlined genes are not considered mitochondrial disease genes and were identified via additional panel analysis) (table 1).

…following affected genes:FBXL4(n = 4),…

Show Full Abstract

<h4>Objective</h4>We hypothesized that novel investigative pathways are needed to decrease diagnostic odysseys in pediatric mitochondrial disease and sought to determine the utility of clinical exome sequencing in a large cohort with suspected mitochondrial disease and to explore whether any of the traditional indicators of mitochondrial disease predict a confirmed genetic diagnosis.<h4>Methods</h4>We investigated a cohort of 85 pediatric patients using clinical exome sequencing and compared the results with the outcome of traditional diagnostic tests, including biochemical testing of routine parameters (lactate, alanine, and proline), neuroimaging, and muscle biopsy with histology and respiratory chain enzyme activity studies.<h4>Results</h4>We established a genetic diagnosis in 36.5% of the cohort and report 20 novel disease-causing variants (1 mitochondrial DNA). Counterintuitively, routine biochemical markers were more predictive of mitochondrial disease than more invasive and elaborate muscle studies.<h4>Conclusions</h4>We propose using biochemical markers to support the clinical suspicion of mitochondrial disease and then apply first-line clinical exome sequencing to identify a definite diagnosis. Muscle biopsy studies should only be used in clinically urgent situations or to confirm an inconclusive genetic result.<h4>Classification of evidence</h4>This is a Class II diagnostic accuracy study showing that the combination of CSF and plasma biochemical tests plus neuroimaging could predict the presence or absence of exome sequencing confirmed mitochondrial disorders.

Also flagged:estrusdiestruspolycystic ovary syndromeovarian carcinomaanxietyepilepsy
Journal Article 2021-05-25 ✓ 5 Snippets An X, Zhang Y, Li F, Wang Z, Yang S, Cao B.
In-Text Gene Mentions

PTGIS is a monooxygenase that catalyzes steroids synthesis and converts prostaglandin precursor into prostaglandin I2, taking a critical role in reproductive processes [43,44].

It can be seen that TIMP1 participates in the HIF-1 signaling pathway (ko04066), 3BHSD participates in Aldosterone synthesis and secretion (ko04925), Ovarian Steroidogenesis (ko04913), and Steroid hormone biosynthesis (ko00140), and PTGIS participates in Arachidonic acid metabolism (ko00590), which are important in follicular and ovarian developments [36,37,38,39].

…, 3BHSD, andPTGIS, and differentially…

…34 ], andPTGIS[ 35 ],…

…, 3BHSD, andPTGISwas explored (…

Show Full Abstract

Estrous cycle is one of the placental mammal characteristics after sexual maturity, including estrus stage (ES) and diestrus stage (DS). Estrous cycle is important in female physiology and its disorder may lead to diseases, such as polycystic ovary syndrome, ovarian carcinoma, anxiety, and epilepsy. In the latest years, effects of non-coding RNAs and messenger RNA (mRNA) on estrous cycle have started to arouse much concern, however, a whole transcriptome analysis among non-coding RNAs and mRNA has not been reported. Here, we report a whole transcriptome analysis of goat ovary in estrus and diestrus periods. Estrus synchronization was conducted to induce the estrus phase and on day 32, the goats shifted into the diestrus stage. The ovary RNA of estrus and diestrus stages was respectively collected to perform RNA-sequencing. Then, the circular RNA (circRNA), microRNA (miRNA), long non-coding RNA (lncRNA), and mRNA databases of goat ovary were acquired, and the differential expressions between estrus and diestrus stages were screened to construct circRNA-miRNA-mRNA/lncRNA and lncRNA-miRNA/mRNA networks, thus providing potential pathways that are involved in the regulation of estrous cycle. Differentially expressed mRNAs, such as <i>MMP9</i>, <i>TIMP1</i>, <i>3BHSD,</i> and <i>PTGIS</i>, and differentially expressed miRNAs that play key roles in the regulation of estrous cycle, such as miR-21-3p, miR-202-3p, and miR-223-3p, were extracted from the network. Our data provided the miRNA, circRNA, lncRNA, and mRNA databases of goat ovary and each differentially expressed profile between ES and DS. Networks among differentially expressed miRNAs, circRNAs, lncRNAs, and mRNAs were constructed to provide valuable resources for the study of estrous cycle and related diseases.

Also flagged:Extracellularglycosaminoglycanshyaluronanlecticanproteoglycanscell-associated proteoglycans
Journal Article 2021-05-25 No Snippets Melrose J, Hayes AJ, Bix G.
Show Full Abstract

<h4>Background</h4>The extracellular matrix of the PNS/CNS is unusual in that it is dominated by glycosaminoglycans, especially hyaluronan, whose space filling and hydrating properties make essential contributions to the functional properties of this tissue. Hyaluronan has a relatively simple structure but its space-filling properties ensure micro-compartments are maintained in the brain ultrastructure, ensuring ionic niches and gradients are maintained for optimal cellular function. Hyaluronan has cell-instructive, anti-inflammatory properties and forms macro-molecular aggregates with the lectican CS-proteoglycans, forming dense protective perineuronal net structures that provide neural and synaptic plasticity and support cognitive learning.<h4>Aims</h4>To highlight the central nervous system/peripheral nervous system (CNS/PNS) and its diverse extracellular and cell-associated proteoglycans that have cell-instructive properties regulating neural repair processes and functional recovery through interactions with cell adhesive molecules, receptors and neuroregulatory proteins. Despite a general lack of stabilising fibrillar collagenous and elastic structures in the CNS/PNS, a sophisticated dynamic extracellular matrix is nevertheless important in tissue form and function.<h4>Conclusions</h4>This review provides examples of the sophistication of the CNS/PNS extracellular matrix, showing how it maintains homeostasis and regulates neural repair and regeneration.

Also flagged:TK2thymidine kinase 2β-actinGAPDHα-actinfructose-bisphosphate aldolase
Journal Article 2021-05-25 ✓ 1 Snippet Laine-Menéndez S, Domínguez-González C, Blázquez A, Delmiro A, García-Consuegra I, Fernández-de la Torre M, Hernández-Laín A, Sayas J, Martín MÁ, Morán M.
In-Text Gene Mentions

…Peroxiredoxin 6 (PRDX6) levels were lower…

Show Full Abstract

Our goal was to analyze <i>post</i><i>mortem</i> tissues of an adult patient with late-onset thymidine kinase 2 (TK2) deficiency who died of respiratory failure. Compared with control tissues, we found a low mtDNA content in the patient's skeletal muscle, liver, kidney, small intestine, and particularly in the diaphragm, whereas heart and brain tissue showed normal mtDNA levels. mtDNA deletions were present in skeletal muscle and diaphragm. All tissues showed a low content of OXPHOS subunits, and this was especially evident in diaphragm, which also exhibited an abnormal protein profile, expression of non-muscular β-actin and loss of GAPDH and α-actin. MALDI-TOF/TOF mass spectrometry analysis demonstrated the loss of the enzyme fructose-bisphosphate aldolase, and enrichment for serum albumin in the patient's diaphragm tissue. The TK2-deficient patient's diaphragm showed a more profound loss of OXPHOS proteins, with lower levels of catalase, peroxiredoxin 6, cytosolic superoxide dismutase, p62 and the catalytic subunits of proteasome than diaphragms of ventilated controls. Strong overexpression of TK1 was observed in all tissues of the patient with diaphragm showing the highest levels. TK2 deficiency induces a more profound dysfunction of the diaphragm than of other tissues, which manifests as loss of OXPHOS and glycolytic proteins, sarcomeric components, antioxidants and overactivation of the TK1 salvage pathway that is not attributed to mechanical ventilation.

Also flagged:TGF-βSMAD4transforming growth factor-βcell growthSMADcancer
Journal Article 2021-05-25 No Snippets Rajasekaran N, Song K, Lee JH, Wei Y, Erkin ÖC, Lee H, Shin YK.
Show Full Abstract

SMAD4, a key regulator of transforming growth factor-β (TGF-β) signaling, plays a major role in cell growth, migration, and apoptosis. In particular, TGF-β/SMAD induces growth arrest, and SMAD4 induces the expression of target genes such as <i>p21WAF1</i> and <i>p15INK4b</i> through its interaction with several cofactors. Thus, inactivating mutations or the homozygous deletion of <i>SMAD4</i> could be related to tumorigenesis or malignancy progression. However, in some cancer types, <i>SMAD4</i> is neither mutated nor deleted. In the current study, we demonstrate that TGF-β signaling with a preserved SMAD4 function can contribute to cancer through associations with negative pathway regulators. We found that nuclear respiratory factor-1 (NRF1) is a novel interaction SMAD4 partner that inhibits TGF-β/SMAD4-induced <i>p15INK4b</i> mRNA expression by binding to SMAD4. Furthermore, we confirmed that NRF1 directly binds to the core region of the <i>SMAD4</i> promoter, thereby decreasing <i>SMAD4</i> mRNA expression. On the whole, our data suggest that NRF1 is a negative regulator of SMAD4 and can interfere with TGF-β/SMAD-induced tumor suppression. Our findings provide a novel perception into the molecular basis of TGF-β/SMAD4-signaling suppression in tumorigenesis.

Also flagged:positroninfectionosteomyelitisphosphonatespeptidesinfections
Journal Article 2021-05-25 No Snippets Jødal L, Afzelius P, Alstrup AKO, Jensen SB.
Show Full Abstract

<h4>Introduction</h4>Radiotracers are widely used in medical imaging, using techniques of gamma-camera imaging (scintigraphy and SPECT) or positron emission tomography (PET). In bone marrow infection, there is no single routine test available that can detect infection with sufficiently high diagnostic accuracy. Here, we review radiotracers used for imaging of bone marrow infection, also known as osteomyelitis, with a focus on why these molecules are relevant for the task, based on their physiological uptake mechanisms. The review comprises [<sup>67</sup>Ga]Ga-citrate, radiolabelled leukocytes, radiolabelled nanocolloids (bone marrow) and radiolabelled phosphonates (bone structure), and [<sup>18</sup>F]FDG as established radiotracers for bone marrow infection imaging. Tracers that are under development or testing for this purpose include [<sup>68</sup>Ga]Ga-citrate, [<sup>18</sup>F]FDG, [<sup>18</sup>F]FDS and other non-glucose sugar analogues, [<sup>15</sup>O]water, [<sup>11</sup>C]methionine, [<sup>11</sup>C]donepezil, [<sup>99m</sup>Tc]Tc-IL-8, [<sup>68</sup>Ga]Ga-Siglec-9, phage-display selected peptides, and the antimicrobial peptide [<sup>99m</sup>Tc]Tc-UBI<sub>29-41</sub> or [<sup>68</sup>Ga]Ga-NOTA-UBI<sub>29-41</sub>.<h4>Conclusion</h4>Molecular radiotracers allow studies of physiological processes such as infection. None of the reviewed molecules are ideal for the imaging of infections, whether bone marrow or otherwise, but each can give information about a separate aspect such as physiology or biochemistry. Knowledge of uptake mechanisms, pitfalls, and challenges is useful in both the use and development of medically relevant radioactive tracers.

Also flagged:mitochondrialmetabolismdeathcancercardiovascular diseasescation
Journal Article 2021-05-25 No Snippets Modesti L, Danese A, Angela Maria Vitto V, Ramaccini D, Aguiari G, Gafà R, Lanza G, Giorgi C, Pinton P.
Show Full Abstract

The divalent cation calcium (Ca<sup>2+</sup>) is considered one of the main second messengers inside cells and acts as the most prominent signal in a plethora of biological processes. Its homeostasis is guaranteed by an intricate and complex system of channels, pumps, and exchangers. In this context, by regulating cellular Ca<sup>2+</sup> levels, mitochondria control both the uptake and release of Ca<sup>2+</sup>. Therefore, at the mitochondrial level, Ca<sup>2+</sup> plays a dual role, participating in both vital physiological processes (ATP production and regulation of mitochondrial metabolism) and pathophysiological processes (cell death, cancer progression and metastasis). Hence, it is not surprising that alterations in mitochondrial Ca<sup>2+</sup> (mCa<sup>2+</sup>) pathways or mutations in Ca<sup>2+</sup> transporters affect the activities and functions of the entire cell. Indeed, it is widely recognized that dysregulation of mCa<sup>2+</sup> signaling leads to various pathological scenarios, including cancer, neurological defects and cardiovascular diseases (CVDs). This review summarizes the current knowledge on the regulation of mCa<sup>2+</sup> homeostasis, the related mechanisms and the significance of this regulation in physiology and human diseases. We also highlight strategies aimed at remedying mCa<sup>2+</sup> dysregulation as promising therapeutical approaches.

Also flagged:colorectal cancertranscription factorbindingtumorLINC02006cancer
Journal Article 2021-05-25 ✓ 5 Snippets Hennig EE, Kluska A, Piątkowska M, Kulecka M, Bałabas A, Zeber-Lubecka N, Goryca K, Ambrożkiewicz F, Karczmarski J, Olesiński T, Zyskowski Ł, Ostrowski J.
In-Text Gene Mentions

Accordingly, NEGR1 was identified as a commonly downregulated gene in various types of human cancers, including CRC, suggesting its contribution to tumor suppression [41], while NEGR1 overexpression reduced the tumorigenic properties of ovarian cancer cell line SKOV-3 cells [41].

Given that adhesion properties are crucial in tumor cell migration and invasion during metastasis, NEGR1 may play a role in malignant transformation by regulating intercellular and cell-to-matrix interactions [42].

Previous GWASs have indicated an association of the rs17575184 polymorphism with asthma in children (p = 4 × 10−3) [37], whereas other SNPs in NEGR1 were implicated in body weight regulation [38,39] and dyslexia [40].

…genes (rs17575184 inNEGR1, rs11060839 in PIWIL1,…

…regions (rs17575184 inNEGR1at 1p31.1, rs11060839…

Show Full Abstract

Despite great efforts, most of the genetic factors contributing to the risk of colorectal cancer (CRC) remain undetermined. Including small but homogenous populations in genome-wide association studies (GWAS) can help us discover new common risk variants specific to the studied population. In this study, including 465 CRC patients and 1548 controls, a pooled DNA samples-based GWAS was conducted in search of genetic variants associated with CRC in a Polish population. Combined with a new method of selecting single-nucleotide polymorphisms (SNPs) for verification in individual DNA samples, this approach allowed the detection of five new susceptibility loci not previously reported for CRC. The discovered loci were found to explain 10% of the overall risk of developing CRC. The strongest association was observed for rs10935945 in long non-coding RNA <i>LINC02006</i> (3q25.2). Three other SNPs were also located within genes (rs17575184 in <i>NEGR1,</i> rs11060839 in <i>PIWIL1,</i> rs12935896 in <i>BCAS3</i>), while one was intergenic (rs9927668 at 16p13.2). An expression quantitative trait locus (eQTL) bioinformatic analysis suggested that these polymorphisms may affect transcription factor binding sites. In conclusion, four of the identified variants were located within genes likely involved in tumor invasiveness and metastasis. Therefore, they could possibly be markers of poor prognosis in CRC patients.

Also flagged:Serotonin Transporter5-HT transporterSLC6A4SerotoninPostthoracotomy pain syndromePTPS
Journal Article 2021-05-25 ✓ 5 Snippets Kimura A, Yamasaki H, Ishii H, Yoshida H, Shimizu M, Mori T.
In-Text Gene Mentions

A previous study indicated that polymorphisms of OPRM1, 5-HTT, and 5-HT1A did not affect pain mechanism on their own, but there were genetic interactions between the mu-opioid receptor and 5-HT structures in the modulation of fibromyalgia.31 Considering these findings, genetic variation alone did not regulate the pain mechanism, but genetic interactions might influence pain regulation.

…human 5-HT transporter (5-HTT) gene (SLC6A4) features…

…that affect the5-HTTexpression.…

…The 5-HT transporter (5-HTT) is an essential…

…associated with reduced5-HTTgene transcription and…

Show Full Abstract

<h4>Purpose</h4>Serotonin (5-HT) is highly associated with pain modulation. The human 5-HT transporter (5-HTT) gene (SLC6A4) features several polymorphisms in its promoter region (5-HTTLPR) that affect the 5-HTT expression. The S allele of 5-HTTLPR induces low 5-HT tone, and it may influence the modulation of chronic pain. Meanwhile, pain occurs in 40-50% of patients after thoracic surgery, and its mechanism remains under investigation. This study assessed the role of 5-HTTLPR polymorphisms in postthoracotomy pain severity.<h4>Patients and methods</h4>A total of 178 patients undergoing pneumonectomy were enrolled. The genotypes of 5-HTTLPR were divided into two groups: S/S group and S/L or L/L group. Linear mixed-effects models were used to assess the association between 5-HTTLPR genotypes and the numerical rating scale (NRS) score change over time.<h4>Results</h4>Among the participants, data were obtained for 162 patients. The genotype distribution was as follows: S/S, 67.3%; S/L or L/L, 32.7%. No significant difference in patient characteristics was found between the genotype groups. There was no significant interaction between the 5-HTTLPR genotypes and the NRS score change over time (p = 0.842).<h4>Conclusion</h4>Polymorphisms in 5-HTTLPR were not associated with postthoracotomy pain severity.

Also flagged:Uterine fibroidsleiomyomasgynecological tumorsanemiainfertilityFibroids
Journal Article 2021-05-25 ✓ 2 Snippets Navarro A, Bariani MV, Yang Q, Al-Hendy A.
In-Text Gene Mentions

…thrombomodulin, PAI-1, andATIIIin the endometrium,…

…fibrinolysis (PAI1, tPA,ATIII, and TM).…

Show Full Abstract

Uterine fibroids (leiomyomas) are the most common benign gynecological tumors in women of reproductive age worldwide. They cause heavy menstrual bleeding, usually leading to severe anemia, pelvic pain/pressure, infertility, and other debilitating morbidities. Fibroids are believed to be monoclonal tumors arising from the myometrium, and recent studies have demonstrated that fibroids actively influence the endometrium globally. Studies suggest a direct relationship between the number of fibroids removed and fertility problems. In this review, our objective was to provide a complete overview of the origin of uterine fibroids and the molecular pathways and processes implicated in their development and growth, which can directly affect the function of a healthy endometrium. One of the most common characteristics of fibroids is the excessive production of extracellular matrix (ECM) components, which contributes to the stiffness and expansion of fibroids. ECM may serve as a reservoir of profibrotic growth factors such as the transforming growth factor β (TGF-β) and a modulator of their availability and actions. Fibroids also elicit mechanotransduction changes that result in decreased uterine wall contractility and increased myometrium rigidity, which affect normal biological uterine functions such as menstrual bleeding, receptivity, and implantation. Changes in the microRNA (miRNA) expression in fibroids and myometrial cells appear to modulate the TGF-β pathways and the expression of regulators of ECM production. Taken together, these findings demonstrate an interaction among the ECM components, TGF-β family signaling, miRNAs, and the endometrial vascular system. Targeting these components will be fundamental to developing novel pharmacotherapies that not only treat uterine fibroids but also restore normal endometrial function.

Also flagged:Chagas diseasefatty acidsmonounsaturatedinfectionCCL2catalase
Journal Article 2021-05-25 No Snippets de Souza DMS, Silva MC, Farias SEB, Menezes APJ, Milanezi CM, Lúcio KP, Paiva NCN, de Abreu PM, Costa DC, Pinto KMC, Costa GP, Silva JS, Talvani A.
Show Full Abstract

<b>Background:</b> <i>Trypanosoma cruzi</i> is a protozoan parasite that causes Chagas disease and affects 6-7 million people mainly in Latin America and worldwide. Here, we investigated the effects of hyperlipidic diets, mainly composed of olive oil or lard on experimental <i>T. cruzi</i> infection. C57BL/6 mice were fed two different dietary types in which the main sources of fatty acids were either monounsaturated (olive oil diet) or saturated (lard diet). <b>Methods:</b> After 60 days on the diet, mice were infected with 50 trypomastigote forms of <i>T. cruzi</i> Colombian strain. We evaluated the systemic and tissue parasitism, tissue inflammation, and the redox status of mice after 30 days of infection. <b>Results:</b> Lipid levels in the liver of mice fed with the lard diet increased compared with that of the mice fed with olive oil or normolipidic diets. The lard diet group presented with an increased parasitic load in the heart and adipose tissues following infection as well as an increased expression of <i>Tlr2</i> and <i>Tlr9</i> in the heart. However, no changes were seen in the survival rates across the dietary groups. Infected mice receiving all diets presented comparable levels of recruited inflammatory cells at 30 days post-infection but, at this time, we observed lard diet inducing an overproduction of CCL2 in the cardiac tissue and its inhibition in the adipose tissue. <i>T. cruzi</i> infection altered liver antioxidant levels in mice, with the lard diet group demonstrating decreased catalase (CAT) activity compared with that of other dietary groups. <b>Conclusions:</b> Our data demonstrated that <i>T. cruzi</i> growth is more favorable on tissue of mice subjected to the lard diet. Our findings supported our hypothesis of a relationship between the source of dietary lipids and parasite-induced immunopathology.

Also flagged:immunosuppressiondwarf syndromelymphomaimmune responsesmetabolismresponse to stimuli
Journal Article 2021-05-25 ✓ 2 Snippets Yang D, Lv X, Zhang S, Zheng S.
In-Text Gene Mentions

…(PRDX4), peroxiredoxin 6 (PRDX6), glutathione peroxidase 3…

…our study, PRDX4,PRDX6, and GPX3 expression…

Show Full Abstract

Reticuloendotheliosis virus (REV) is a type C avian retrovirus that causes immunosuppression, dwarf syndrome, and lymphoma in infected hosts. In this study, we used tandem mass tag (TMT) labeling and liquid chromatography-tandem mass spectrometry (LC-MS/MS) to characterize protein alterations in chicken bursa of Fabricius, before and after REV infection at 7, 14, 21, and 28 days. Our data showed that 1,127, 999, 910, and 1,138 differentially expressed proteins were significantly altered at 7, 14, 21, and 28 days after REV infection, respectively. Morphological analysis showed that REV infection reduced in cortical lymphocytes, bursal follicle atrophy, and nuclear damage. Bioinformatics analysis indicated these proteins were mainly involved with immune responses, energy metabolism, cellular processes, biological regulation, metabolic processes, response to stimuli, and multicellular organismal process. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway cluster analysis showed that post-infection, proteins were enriched in the cell cycle, Wnt signaling, antigen processing and presentation, cytokine receptor interaction, adenosine 3',5'-cyclic monophosphate signaling pathway, and NF-κB signaling. In addition, we observed that peroxiredoxin 4 (PRDX4), peroxiredoxin 6 (PRDX6), glutathione peroxidase 3 (GPX3), catalase (CAT), and peroxidasin (PXDN) were involved in oxidative stress. Some heat shock protein (HSP) family members such as HSPH1, DNAJA4, HSPA8, and HSPA4L also changed significantly after REV infection. These findings help clarify interactions between REV and the host and provides mechanistic insights on REV-induced host immunosuppression.

Also flagged:Small GTPasesdevelopmental syndromespediatric cancersGTPasesRASnucleotide
Journal Article 2021-05-25 ✓ 1 Snippet Lauri A, Fasano G, Venditti M, Dallapiccola B, Tartaglia M.
In-Text Gene Mentions

For the disease genes and diseases depicted here, besides the literature cited in the text, refer to Novarino et al. (2014); Wakil et al. (2019) (ARF-like 6 interacting protein 1 mutations in neuropathy with spastic paraplegia, microcephaly, leukoencephalopathy, and seizures); Griscelli and Prunieras (1978) (mutations in RAB2 in Griscelli syndrome affecting the immune system); Cogli et al. (2009); Lupo et al. (2009); Stendel et al. (2010), for the motor and sensory neuropathies Charcot–Marie–Tooth type 2B and type 4 (CMT2B and CMT4), caused by mutations in RAB7 and RAB11 effector SH3TC2, respectively; Harvey et al. (2010) (mutations in the ARF-specific GAP encoding gene AGAP1 in pediatric high-risk B-cell ALL); Roberti et al. (2009) (gene rearrangement in the RAB-specific GAP encoding gene RABGAP1L in patient with Klinefelter syndrome who developed AML).

Show Full Abstract

While individually rare, disorders affecting development collectively represent a substantial clinical, psychological, and socioeconomic burden to patients, families, and society. Insights into the molecular mechanisms underlying these disorders are required to speed up diagnosis, improve counseling, and optimize management toward targeted therapies. Genome sequencing is now unveiling previously unexplored genetic variations in undiagnosed patients, which require functional validation and mechanistic understanding, particularly when dealing with novel nosologic entities. Functional perturbations of key regulators acting on signals' intersections of evolutionarily conserved pathways in these pathological conditions hinder the fine balance between various developmental inputs governing morphogenesis and homeostasis. However, the distinct mechanisms by which these hubs orchestrate pathways to ensure the developmental coordinates are poorly understood. Integrative functional genomics implementing quantitative <i>in vivo</i> models of embryogenesis with subcellular precision in whole organisms contribute to answering these questions. Here, we review the current knowledge on genes and mechanisms critically involved in developmental syndromes and pediatric cancers, revealed by genomic sequencing and <i>in vivo</i> models such as insects, worms and fish. We focus on the monomeric GTPases of the RAS superfamily and their influence on crucial developmental signals and processes. We next discuss the effectiveness of exponentially growing functional assays employing tractable models to identify regulatory crossroads. Unprecedented sophistications are now possible in zebrafish, i.e., genome editing with single-nucleotide precision, nanoimaging, highly resolved recording of multiple small molecules activity, and simultaneous monitoring of brain circuits and complex behavioral response. These assets permit accurate real-time reporting of dynamic small GTPases-controlled processes in entire organisms, owning the potential to tackle rare disease mechanisms.

Also flagged:peptideslipaseamino acidpeptidewaterbinding
Journal Article 2021-05-25 ✓ 1 Snippet Ketprayoon T, Noitang S, Sangtanoo P, Srimongkol P, Saisavoey T, Reamtong O, Choowongkomon K, Karnchanatat A.
In-Text Gene Mentions

…inhibitor), and aDPP-IIIinhibitor, while GY…

Show Full Abstract

De-oiled rice bran (DORB) is a potentially useful by-product of the rice bran oil industry. DORB may prove to be an important protein source, and also contains many other micronutrients. This study has the principal aim of optimizing the process of DORB protein hydrolysate preparation, and then testing the hydrolysate to determine its lipase inhibitory activity. DORB underwent hydrolysis using Alcalase® and response surface methodology (RSM). The resulting degree of hydrolysis (DH) was then monitored along with the extent of any lipase inhibitory activity. The optimum levels of lipase inhibition were obtained at a temperature of 49.88 °C, a duration of 150.43 minutes, and 1.53% Alcalase® used for the sample 5% (w/v) solution. In these conditions, the DH value was 35.65%, and the IC<sub>50</sub> value for lipase inhibitory activity was 2.84 μg mL<sup>-1</sup>. Five ranges of different molecular weights were obtained <i>via</i> fractionation, whereupon it was determined that the highest level of inhibitory activity was achieved by the <0.65 kDa fraction. This fraction was then further purified <i>via</i> RP-HPLC, and the resulting peak had a retention time of 21.75 minutes (<i>F</i> <sub>2</sub> sub-fraction) and exhibited high lipase inhibitory activity. Mass spectrometry was used to determine the amino acid sequence for this peak, identified as FYLGYCDY. This particular peptide is categorized as bitter, with a non-toxic profile, and having poor water solubility. The synthesized form of this peptide showed lipase inhibitory activity measured by an IC<sub>50</sub> value of 0.47 ± 0.02 μM. The Lineweaver-Burk plot revealed that FYLGYCDY is a non-competitive inhibitor, while analysis of the docking results provided details of the FYLGYCDY peptide binding site with the porcine pancreatic lipase (PPL) complex, which is a competitive type. It can be inferred from these findings that DORB may prove a useful raw material source for the production of anti-obesity peptides which might enhance the therapeutic and commercial performance of functional foods and healthcare products.

Also flagged:E13tamoxifenSOX10NOS1Phox2bRET
Journal Article 2021-05-24 ✓ 1 Snippet Gao T, Wright-Jin EC, Sengupta R, Anderson JB, Heuckeroth RO.
In-Text Gene Mentions

…only GDNF and netrin/DCCsignaling in this…

Show Full Abstract

Retinoic acid (RA) signaling is essential for enteric nervous system (ENS) development, since vitamin A deficiency or mutations in RA signaling profoundly reduce bowel colonization by ENS precursors. These RA effects could occur because of RA activity within the ENS lineage or via RA activity in other cell types. To define cell-autonomous roles for retinoid signaling within the ENS lineage at distinct developmental time points, we activated a potent floxed dominant-negative RA receptor α (RarαDN) in the ENS using diverse CRE recombinase-expressing mouse lines. This strategy enabled us to block RA signaling at premigratory, migratory, and postmigratory stages for ENS precursors. We found that cell-autonomous loss of RA receptor (RAR) signaling dramatically affected ENS development. CRE activation of RarαDN expression at premigratory or migratory stages caused severe intestinal aganglionosis, but at later stages, RarαDN induced a broad range of phenotypes including hypoganglionosis, submucosal plexus loss, and abnormal neural differentiation. RNA sequencing highlighted distinct RA-regulated gene sets at different developmental stages. These studies show complicated context-dependent RA-mediated regulation of ENS development.

Also flagged:FKBP15lombafilomycin A1FKBP8FKBP10FKBP11
Journal Article 2021-05-24 ✓ 5 Snippets Bailus BJ, Scheeler SM, Simons J, Sanchez MA, Tshilenge KT, Creus-Muncunill J, Naphade S, Lopez-Ramirez A, Zhang N, Lakshika Madushani K, Moroz S, Loureiro A, Schreiber KH, Hausch F, Kennedy BK, Ehrlich ME, Ellerby LM.
In-Text Gene Mentions

HTT

Abbreviations: ACTB/β-actin: actin beta; AD: Alzheimer disease; BafA1: bafilomycin A1; BCA: bicinchoninic acid; BBB: blood brain barrier; BSA: bovine serum albumin; CoIP: co-immunoprecipitation; DMSO: dimethyl sulfoxide; DTT: dithiothreitol; FKBPs: FK506 binding proteins; HD: Huntington disease; HTT: huntingtin; iPSC: induced pluripotent stem cells; MAP1LC3/LC3:microtubule associated protein 1 light chain 3; MAPT/tau: microtubule associated protein tau; MES: 2-ethanesulfonic acid; MOPS: 3-(N-morphorlino)propanesulfonic acid); MSN: medium spiny neurons; mHTT: mutant huntingtin; MTOR: mechanistic target of rapamycin kinase; NSC: neural stem cells; ON: overnight; PD: Parkinson disease; PPIase: peptidyl-prolyl cis/trans-isomerases; polyQ: polyglutamine; PPP1R1B/DARPP-32: protein phosphatase 1 regulatory inhibitor subunit 1B; PTSD: post-traumatic stress disorder; RT: room temperature; SQSTM1/p62: sequestosome 1; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis; TBST:Tris-buffered saline, 0.1% Tween 20; TUBA: tubulin; ULK1: unc-51 like autophagy activating kinase 1; VCL: vinculin; WT: littermate controls.

Our results suggest a model in which lowering the levels or activity of FKBP5 leads to increased autophagy, a structural change in the HTT protein likely due to a change in a proline site(s) in the protein and subsequent clearance of the protein (Figure 12).

CAG codes for glutamine and, therefore, the expansion of CAG in the HTT gene results in a polyQ (polyglutamine) expanded tract at the N terminus of the HTT protein, which drives disease pathogenesis.

The orientation of the proline-rich regions affects the conformation of the HTT protein and subsequent formation of aggregates in vitro [39–43].

Show Full Abstract

Current disease-modifying therapies for Huntington disease (HD) focus on lowering mutant HTT (huntingtin; mHTT) levels, and the immunosuppressant drug rapamycin is an intriguing therapeutic for aging and neurological disorders. Rapamycin interacts with FKBP1A/FKBP12 and FKBP5/FKBP51, inhibiting the MTORC1 complex and increasing cellular clearance mechanisms. Whether the levels of FKBP (FK506 binding protein) family members are altered in HD models and if these proteins are potential therapeutic targets for HD have not been investigated. Here, we found levels of FKBP5 are significantly reduced in HD R6/2 and zQ175 mouse models and human HD isogenic neural stem cells and medium spiny neurons derived from induced pluripotent stem cells. Moreover, FKBP5 interacts and colocalizes with HTT in the striatum and cortex of zQ175 mice and controls. Importantly, when we decreased FKBP5 levels or activity by genetic or pharmacological approaches, we observed reduced levels of mHTT in our isogenic human HD stem cell model. Decreasing FKBP5 levels by siRNA or pharmacological inhibition increased LC3-II levels and macroautophagic/autophagic flux, suggesting autophagic cellular clearance mechanisms are responsible for mHTT lowering. Unlike rapamycin, the effect of pharmacological inhibition with SAFit2, an inhibitor of FKBP5, is MTOR independent. Further, <i>in vivo</i> treatment for 2 weeks with SAFit2, results in reduced HTT levels in both HD R6/2 and zQ175 mouse models. Our studies establish FKBP5 as a protein involved in the pathogenesis of HD and identify FKBP5 as a potential therapeutic target for HD.<b>Abbreviations</b> : ACTB/β-actin: actin beta; AD: Alzheimer disease; BafA1: bafilomycin A<sub>1</sub>; BCA: bicinchoninic acid; BBB: blood brain barrier; BSA: bovine serum albumin; CoIP: co-immunoprecipitation; DMSO: dimethyl sulfoxide; DTT: dithiothreitol; FKBPs: FK506 binding proteins; HD: Huntington disease; HTT: huntingtin; iPSC: induced pluripotent stem cells; MAP1LC3/LC3:microtubule associated protein 1 light chain 3; MAPT/tau: microtubule associated protein tau; MES: 2-ethanesulfonic acid; MOPS: 3-(N-morphorlino)propanesulfonic acid); MSN: medium spiny neurons; mHTT: mutant huntingtin; MTOR: mechanistic target of rapamycin kinase; NSC: neural stem cells; ON: overnight; PD: Parkinson disease; PPIase: peptidyl-prolyl <i>cis/trans</i>-isomerases; polyQ: polyglutamine; PPP1R1B/DARPP-32: protein phosphatase 1 regulatory inhibitor subunit 1B; PTSD: post-traumatic stress disorder; RT: room temperature; SQSTM1/p62: sequestosome 1; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis; TBST:Tris-buffered saline, 0.1% Tween 20; TUBA: tubulin; ULK1: unc-51 like autophagy activating kinase 1; VCL: vinculin; WT: littermate controls.

Also flagged:iron deficiencyironFerritinoverloadinfectioniron‐loading syndromes
Journal Article 2021-05-24 No Snippets Garcia-Casal MN, Pasricha SR, Martinez RX, Lopez-Perez L, Peña-Rosas JP.
Show Full Abstract

<h4>Background</h4>Reference standard indices of iron deficiency and iron overload are generally invasive, expensive, and can be unpleasant or occasionally risky. Ferritin is an iron storage protein and its concentration in the plasma or serum reflects iron stores; low ferritin indicates iron deficiency, while elevated ferritin reflects risk of iron overload. However, ferritin is also an acute-phase protein and its levels are elevated in inflammation and infection. The use of ferritin as a diagnostic test of iron deficiency and overload is a common clinical practice.<h4>Objectives</h4>To determine the diagnostic accuracy of ferritin concentrations (serum or plasma) for detecting iron deficiency and risk of iron overload in primary and secondary iron-loading syndromes.<h4>Search methods</h4>We searched the following databases (10 June 2020): DARE (Cochrane Library) Issue 2 of 4 2015, HTA (Cochrane Library) Issue 4 of 4 2016, CENTRAL (Cochrane Library) Issue 6 of 12 2020, MEDLINE (OVID) 1946 to 9 June 2020, Embase (OVID) 1947 to week 23 2020, CINAHL (Ebsco) 1982 to June 2020, Web of Science (ISI) SCI, SSCI, CPCI-exp & CPCI-SSH to June 2020, POPLINE 16/8/18, Open Grey (10/6/20), TRoPHI (10/6/20), Bibliomap (10/6/20), IBECS (10/6/20), SCIELO (10/6/20), Global Index Medicus (10/6/20) AIM, IMSEAR, WPRIM, IMEMR, LILACS (10/6/20), PAHO (10/6/20), WHOLIS 10/6/20, IndMED (16/8/18) and Native Health Research Database (10/6/20). We also searched two trials registers and contacted relevant organisations for unpublished studies.<h4>Selection criteria</h4>We included all study designs seeking to evaluate serum or plasma ferritin concentrations measured by any current or previously available quantitative assay as an index of iron status in individuals of any age, sex, clinical and physiological status from any country.<h4>Data collection and analysis</h4>We followed standard Cochrane methods. We designed the data extraction form to record results for ferritin concentration as the index test, and bone marrow iron content for iron deficiency and liver iron content for iron overload as the reference standards. Two other authors further extracted and validated the number of true positive, true negative, false positive, false negative cases, and extracted or derived the sensitivity, specificity, positive and negative predictive values for each threshold presented for iron deficiency and iron overload in included studies. We assessed risk of bias and applicability using the Quality Assessment of Diagnostic Accuracy Studies (QUADAS)-2 tool. We used GRADE assessment to enable the quality of evidence and hence strength of evidence for our conclusions.<h4>Main results</h4>Our search was conducted initially in 2014 and updated in 2017, 2018 and 2020 (10 June). We identified 21,217 records and screened 14,244 records after duplicates were removed. We assessed 316 records in full text. We excluded 190 studies (193 records) with reasons and included 108 studies (111 records) in the qualitative and quantitative analysis. There were 11 studies (12 records) that we screened from the last search update and appeared eligible for a future analysis. We decided to enter these as awaiting classification. We stratified the analysis first by participant clinical status: apparently healthy and non-healthy populations. We then stratified by age and pregnancy status as: infants and children, adolescents, pregnant women, and adults. Iron deficiency We included 72 studies (75 records) involving 6059 participants. Apparently healthy populations Five studies screened for iron deficiency in people without apparent illness. In the general adult population, three studies reported sensitivities of 63% to 100% at the optimum cutoff for ferritin, with corresponding specificities of 92% to 98%, but the ferritin cutoffs varied between studies. One study in healthy children reported a sensitivity of 74% and a specificity of 77%. One study in pregnant women reported a sensitivity of 88% and a specificity of 100%. Overall confidence in these estimates was very low because of potential bias, indirectness, and sparse and heterogenous evidence. No studies screened for iron overload in apparently healthy people. People presenting for medical care There were 63 studies among adults presenting for medical care (5042 participants). For a sample of 1000 subjects with a 35% prevalence of iron deficiency (of the included studies in this category) and supposing a 85% specificity, there would be 315 iron-deficient subjects correctly classified as having iron deficiency and 35 iron-deficient subjects incorrectly classified as not having iron deficiency, leading to a 90% sensitivity. Thresholds proposed by the authors of the included studies ranged between 12 to 200 µg/L. The estimated diagnostic odds ratio was 50. Among non-healthy adults using a fixed threshold of 30 μg/L (nine studies, 512 participants, low-certainty evidence), the pooled estimate for sensitivity was 79% with a 95% confidence interval of (58%, 91%) and specificity of 98%, with a 95% confidence interval of (91%, 100%). The estimated diagnostic odds ratio was 140, a relatively highly informative test. Iron overload We included 36 studies (36 records) involving 1927 participants. All studies concerned non-healthy populations. There were no studies targeting either infants, children, or pregnant women. Among all populations (one threshold for males and females; 36 studies, 1927 participants, very low-certainty evidence): for a sample of 1000 subjects with a 42% prevalence of iron overload (of the included studies in this category) and supposing a 65% specificity, there would be 332 iron-overloaded subjects correctly classified as having iron overload and 85 iron-overloaded subjects incorrectly classified as not having iron overload, leading to a 80% sensitivity. The estimated diagnostic odds ratio was 8.<h4>Authors' conclusions</h4>At a threshold of 30 micrograms/L, there is low-certainty evidence that blood ferritin concentration is reasonably sensitive and a very specific test for iron deficiency in people presenting for medical care. There is very low certainty that high concentrations of ferritin provide a sensitive test for iron overload in people where this condition is suspected. There is insufficient evidence to know whether ferritin concentration performs similarly when screening asymptomatic people for iron deficiency or overload.

Also flagged:lung squamous cell carcinomaLUSCtumourcancerADGRF1ATF7IP2
Journal Article 2021-05-24 ✓ 1 Snippet Wang K, Li Y, Wang J, Chen R, Li J.
In-Text Gene Mentions

…genes, 5 genes,STAU1, ADGRF1, ATF7IP2, MALL…

Show Full Abstract

<h4>Background</h4>There is currently no formal consensus on the administration of adjuvant chemotherapy to stage I lung squamous cell carcinoma (LUSC) patients despite the poor prognosis. The side effects of adjuvant chemotherapy need to be balanced against the risk of tumour recurrence. Prognostic markers are thus needed to identify those at higher risks and recommend individualised treatment regimens.<h4>Methods</h4>Clinical and sequencing data of stage I patients were retrieved from the Lung Squamous Cell Carcinoma project of the Cancer Genome Atlas (TCGA) and three tissue microarray datasets. In a novel K-resample gene selection algorithm, gene-wise Cox proportional hazard regressions were repeated for 50 iterations with random resamples from the TCGA training dataset. The top 200 genes with the best predictive power for survival were chosen to undergo an L1-penalised Cox regression for further gene selection.<h4>Results</h4>A total of 602 samples of LUSC were included, of which 42.2% came from female patients, 45.3% were stage IA cancer. From an initial pool of 11,212 genes in the TCGA training dataset, a final set of 12 genes were selected to construct the multivariate Cox prognostic model. Among the 12 selected genes, 5 genes, STAU1, ADGRF1, ATF7IP2, MALL and KRT23, were adverse prognostic factors for patients, while seven genes, NDUFB1, CNPY2, ZNF394, PIN4, FZD8, NBPF26 and EPYC, were positive prognostic factors. An equation for risk score was thus constructed from the final multivariate Cox model. The model performance was tested in the sequestered TCGA testing dataset and validated in external tissue microarray datasets (GSE4573, GSE31210 and GSE50081), demonstrating its efficacy in stratifying patients into high- and low-risk groups with significant survival difference both in the whole set (including stage IA and IB) and in the stage IA only subgroup of each set. The prognostic power remains significant after adjusting for standard clinical factors. When benchmarked against other prominent gene-signature based prognostic models, the model outperformed the rest in the TCGA testing dataset and in predicting long-term risk at eight years in all three validation datasets.<h4>Conclusion</h4>The 12-gene prognostic model may serve as a useful complementary clinical risk-stratification tool for stage I and especially stage IA lung squamous cell carcinoma patients to guide clinical decision making.

Also flagged:diabetespulmonary nodulesCancertype 2 diabetesRenal Failurechronic obstructive bronchitis
Journal Article 2021-05-24 ✓ 1 Snippet Gaudillière M, Marsot C, Balaire L, Groisne L, Moret M, Villar-Fimbel S, Douek P, Moulin P, Charrière S.
In-Text Gene Mentions

…(post pancreatic surgery,hemochromatosis, post pancreatitis, pancreati…

Show Full Abstract

<h4>Aim</h4>Noninvasive assessment of infraclinic coronary atherosclerosis by coronary artery calcium score (CAC) measurement leads to the identification of incidental findings. The aim of this study was to determine the prevalence of incidental findings following systematic CAC assessment in diabetic patients with high cardiovascular risk, to identify the determinants, and to assess the midterm consequences of these findings in patient care.<h4>Methods</h4>732 consecutive asymptomatic patients (187 type 1 diabetes (TD1), 482 type 2 diabetes (TD2) and 63 type 3 diabetes (TD3)) aged 60.6±0.7 years who had a CAC assessment by Multiple Detector Computed Tomography between 2015 and 2017 were systematically included. Clinical and biological data were collected from medical electronic files.<h4>Results</h4>117/732 diabetic patients (16.0%) had incidental findings of which 105 (14.3%) were unknown. Incidental findings were more frequent in TD3 (23.8%) and TD2 (17.0%) than in TD1 (10.7%) (p = 0.05). 76 diabetic patients (10.4%) had lung abnormalities, mainly pulmonary nodules (31 patients, 4.2%). The other incidental finding were pericardial (1.5%), vascular (1.2%), thymic (0.7%) and digestive diseases (0.5%). 42.6% of patients with incidental findings had an additional TDM and 56.8% a specialized medical advice. In 10 patients (9.3% of incidental findings), the identification of incidental finding led to a specific treatment of the underlying disease. In multivariate analysis, microalbuminuria, type of diabetes (TD2/TD3 vs TD1) and smoking were significantly associated with incidental findings (p = 0.003; p = 0.026; p = 0.050 respectively).<h4>Conclusions</h4>Incidental findings are not rare in diabetic patients upon CAC assessment. A fraction of them are accessible to specific treatment. These findings raise the question if a systematic low dose chest TDM should be conducted in TD2 or TD3 patients and in any diabetic smokers by enlarging the window used for CAC assessment.

Also flagged:CD45CD24gene expressionHoechst 33342Epcam-
Journal Article 2021-05-24 No Snippets Manco R, Averbukh I, Porat Z, Bahar Halpern K, Amit I, Itzkovitz S.
Show Full Abstract

Single-cell RNA sequencing combined with spatial information on landmark genes enables reconstruction of spatially-resolved tissue cell atlases. However, such approaches are challenging for rare cell types, since their mRNA contents are diluted in the spatial transcriptomics bulk measurements used for landmark gene detection. In the small intestine, enterocytes, the most common cell type, exhibit zonated expression programs along the crypt-villus axis, but zonation patterns of rare cell types such as goblet and tuft cells remain uncharacterized. Here, we present ClumpSeq, an approach for sequencing small clumps of attached cells. By inferring the crypt-villus location of each clump from enterocyte landmark genes, we establish spatial atlases for all epithelial cell types in the small intestine. We identify elevated expression of immune-modulatory genes in villus tip goblet and tuft cells and heterogeneous migration patterns of enteroendocrine cells. ClumpSeq can be applied for reconstructing spatial atlases of rare cell types in other tissues and tumors.

Also flagged:neurodegenerative disordergene expressionHDepigenetic modificationsmethylationchromatin
Journal Article 2021-05-24 ✓ 3 Snippets Hyeon JW, Kim AH, Yano H.
In-Text Gene Mentions

Huntington's disease (HD) is a devastating and fatal monogenic neurodegenerative disorder characterized by progressive loss of selective neurons in the brain and is caused by an abnormal expansion of CAG trinucleotide repeats in a coding exon of the huntingtin (HTT) gene.

…the huntingtin (HTT) gene.…

HTT

Show Full Abstract

Huntington's disease (HD) is a devastating and fatal monogenic neurodegenerative disorder characterized by progressive loss of selective neurons in the brain and is caused by an abnormal expansion of CAG trinucleotide repeats in a coding exon of the huntingtin (HTT) gene. Progressive gene expression changes that begin at premanifest stages are a prominent feature of HD and are thought to contribute to disease progression. Increasing evidence suggests the critical involvement of epigenetic mechanisms in abnormal transcription in HD. Genome-wide alterations of a number of epigenetic modifications, including DNA methylation and multiple histone modifications, are associated with HD, suggesting that mutant HTT causes complex epigenetic abnormalities and chromatin structural changes, which may represent an underlying pathogenic mechanism. The causal relationship of specific epigenetic changes to early transcriptional alterations and to disease pathogenesis require further investigation. In this article, we review recent studies on epigenetic regulation in HD with a focus on DNA and histone modifications. We also discuss the contribution of epigenetic modifications to HD pathogenesis as well as potential mechanisms linking mutant HTT and epigenetic alterations. Finally, we discuss the therapeutic potential of epigenetic-based treatments.

Also flagged:anaemiaerythropoietin receptorpegolroxadustatmyelodysplastic syndromeerythropoiesis
Journal Article 2021-05-24 ✓ 1 Snippet Ikenoue T, Furumatsu Y, Kitamura T.
In-Text Gene Mentions

…failure and secondaryhemochromatosis; she was diagnosed…

Show Full Abstract

Treatment of anaemia and reduction of transfusion are major therapeutic goals in patients with low-risk myelodysplastic syndrome (MDS). Although erythropoiesis-stimulating agents (ESAs) are widely used to reduce transfusion requirement, ESAs lose effectiveness within 12 months. We report a 65-year-old Japanese woman diagnosed with low-risk MDS who underwent long-term use of continuous epoetin β pegol, an erythropoietin receptor activator (CERA), and her treatment after CERA failure. She received darbepoetin alpha (DPO) for transfusion-dependent anaemia and was free from transfusion. However, after 8 months, DPO lost effectiveness. She then received CERA and recovered from anaemia. Her haemoglobin level remained >10 g/dl for 3 years and 4 months. However, even CERA lost effectiveness, and she received roxadustat treatment with CERA, leading to recovery from anaemia again. Although further evidence is required, the extension of the no-transfusion period provided by ESAs and roxadustat is important and is awaited among low-risk MDS patients.

Also flagged:TumourProliferationcancerchromatinchromatin assembly factor 1CAF-1
Journal Article 2021-05-24 ✓ 1 Snippet Sykaras AG, Pergaris A, Theocharis S.
In-Text Gene Mentions

…Thehistone chaperone complexchaperone complex chromatin…

Show Full Abstract

The discovery of novel biomarkers of diagnostic, prognostic, and therapeutic value is a major challenge of current cancer research. The assessment of tumour cell proliferative capacity is pivotal for grading and clinical decision-making, highlighting the importance of proliferation markers as diagnostic and prognostic tools. Currently, the immunohistochemical analysis of Ki-67 expression levels is routinely used in clinical settings to assess tumour proliferation. Inasmuch as the function of Ki-67 is not fully understood and its evaluation lacks standardization, there is interest in chromatin regulator proteins as alternative proliferation markers of clinical value. Here, we review recent evidence demonstrating that chromatin assembly factor 1 (CAF-1), a histone chaperone selectively expressed in cycling cells, is a proliferation marker of clinical value. CAF-1 expression, when evaluated by immunocytochemistry in breast cancer cytology smears and immunohistochemistry in cancer biopsies from several tissues, strongly correlates with the expression of Ki-67 and other proliferation markers. Notably, CAF-1 expression is upregulated in almost all cancers, and CAF-1 overexpression is significantly associated, in most cancer types, with high histological tumour grade, advanced stage, recurrence, metastasis, and decreased patient survival. These findings suggest that CAF-1 is a robust, reproducible, and feasible proliferation marker of prognostic importance. CAF-1 may represent an attractive alternative or complementary to Ki-67 for cancer stratification and clinical guidance.

Also flagged:TumorCancerpaclitaxelhyaluronic acidnon-melanoma skin cancerCD44
Journal Article 2021-05-24 No Snippets Bellei B, Caputo S, Migliano E, Lopez G, Marcaccini V, Cota C, Picardo M.
Show Full Abstract

<h4>Background</h4>Cancer-associated fibroblasts (CAFs) facilitate many aspects of cancer development by providing a structural framework rich in bioactive compounds. There are emerging studies proposing a combination of conventional anti-cancer therapies directed against neoplastic cells to molecules targeting tumor microenvironments.<h4>Methods</h4>The study evaluated the pharmacological properties of the anti-tumor agent paclitaxel conjugated to hyaluronic acid (HA) regarding non-melanoma skin cancer (NMSC) and the surrounding fibroblasts. This molecule, named Oncofid-P20 (Onco-P20), preferentially targets cells expressing high levels of CD44, the natural ligand of HA.<h4>Results</h4>Consistent with paclitaxel's mechanism of action involving interference with the breakdown of microtubules during cell division, highly sensitive carcinoma cells rapidly underwent apoptotic cell death. Interestingly, less sensitive cells, such as dermal fibroblasts, resisted the Onco-P20 treatment and experienced a prolonged growth arrest characterized by morphological change and significant modification of the gene expression profile. Onco-P20-treated fibroblasts exhibited reduced growth factor production, downmodulation of the Wnt signaling pathway, and the acquisition of a marked pro-inflammatory profile. Independently of direct exposure to taxol, in the presence of Onco-P20-treated fibroblasts or in their conditioned medium, carcinoma cells had a reduced proliferation rate. Similar to NHF, fibroblasts isolated from skin cancer lesions or from adjacent tissue acquired anti-neoplastic activity under Onco-P20 treatment.<h4>Conclusion</h4>Collectively, our data demonstrate that Onco-P20, exerting both a direct and an NHF-mediated indirect effect on carcinoma cells, is a candidate for an innovative therapy alternative to surgery for the treatment of NMSC.

Also flagged:LINC00659cancercolon cancercell proliferationcell cyclegastric cancer
Journal Article 2021-05-24 ✓ 1 Snippet Gong P, Xu Y, Liu M, Shen X, Mao Y, Li Y, Zhang K, Yu S, Fan H.
In-Text Gene Mentions

…KIF3B, PIGT andB4GALT5), nuclear function (CSEL1),…

Show Full Abstract

Long non-coding RNAs (lncRNAs) serve an important role in the progression of cancer. LINC00659 was recently identified as a novel oncogenic lncRNA involved in colon cancer cell proliferation via modulating the cell cycle. However, the function of LINC00659 in other types of cancer, especially in gastric cancer (GC), remains unknown. In the present study, bioinformatics analysis combined with cell experiments were performed to explore the function of LINC00659 in GC. It was revealed that LINC00659 expression was significantly upregulated in GC tissues and cell lines. Increased levels of LINC00659 were associated with advanced tumor stage and unfavorable prognosis of patients with GC. Additionally, upregulated LINC00659 expression promoted the migration and invasion of GC cells. Further analysis using a bioinformatics method revealed that matrix metalloproteinase 15 and IQ motif-containing GTPase activating protein 3 were potential downstream targets of LINC00659 involved in tumor metastasis, although the precise underlying mechanism requires further exploration.

Also flagged:BPRcarbon dioxidehydroxyapatitechitosandiazorst
Journal Article 2021-05-24 No Snippets Chai Y, Liu Z, Du Y, Wang L, Lu J, Zhang Q, Han W, Wang T, Yu Y, Sun L, Ou L.
Show Full Abstract

Highly efficient removal of bilirubin from whole blood directly by hemoperfusion for liver failure therapy remains a challenge in the clinical field due to the low adsorption capacity, poor mechanical strength and low biocompatibility of adsorbents. In this work, a new class of nanocomposite adsorbents was constructed through an inorganic-organic co-crosslinked nanocomposite network between vinyltriethoxysilane (VTES)-functionalized hydroxyapatite nanoparticles (V-Hap) and non-ionic styrene-divinylbenzene (PS-DVB) resins (PS-DVB/V-Hap) using suspension polymerization. Notably, our adsorbent demonstrated substantially improved mechanical performance compared to the pure polymer, with the hardness and modulus increasing by nearly 3 and 2.5 times, respectively. Moreover, due to the development of a mesoporous structure, the prepared PS-DVB/V-Hap3 exhibited an ideal adsorption capacity of 40.27 mg g<sup>-1</sup>. More importantly, the obtained adsorbent beads showed outstanding blood compatibility and biocompatibility. Furthermore, <i>in vivo</i> extracorporeal hemoperfusion verified the efficacy and biosafety of the adsorbent for directly removing bilirubin from whole blood in pig models, and this material could potentially prevent liver damage and improve clinical outcomes. Taken together, the results suggest that PS-DVB/V-Hap3 beads can be used in commercial adsorption columns to threat hyperbilirubinemia patients through hemoperfusion, thus replacing the existing techniques where plasma separation is initially required.

Also flagged:copper chlorideactincopperHemolysisamine groupsHep
Journal Article 2021-05-24 ✓ 3 Snippets Ma Q, Shi X, Tan X, Wang R, Xiong K, Maitz MF, Cui Y, Hu Z, Tu Q, Huang N, Shen L, Yang Z.
In-Text Gene Mentions

…to antithrombin III (ATIII) by sulfurized pentosaccharid…

…effect of activatedATIIIon coagulation factors…

…of thrombin byATIIIthus inhibited coagulation…

Show Full Abstract

Mimicking the nitric oxide (NO)-release and glycocalyx functions of native vascular endothelium on cardiovascular stent surfaces has been demonstrated to reduce in-stent restenosis (ISR) effectively. However, the practical performance of such an endothelium-mimicking surfaces is strictly limited by the durability of both NO release and bioactivity of the glycocalyx component. Herein, we present a mussel-inspired amine-bearing adhesive coating able to firmly tether the NO-generating species (e.g., Cu-DOTA coordination complex) and glycocalyx-like component (e.g., heparin) to create a durable endothelium-mimicking surface. The stent surface was firstly coated with polydopamine (pDA), followed by a surface chemical cross-link with polyamine (pAM) to form a durable pAMDA coating. Using a stepwise grafting strategy, Cu-DOTA and heparin were covalently grafted on the pAMDA-coated stent based on carbodiimide chemistry. Owing to both the high chemical stability of the pAMDA coating and covalent immobilization manner of the molecules, this proposed strategy could provide 62.4% bioactivity retention ratio of heparin, meanwhile persistently generate NO at physiological level from 5.9 ± 0.3 to 4.8 ± 0.4 × 10<sup>-10</sup> mol cm<sup>-2</sup> min<sup>-1</sup> in 1 month. As a result, the functionalized vascular stent showed long-term endothelium-mimicking physiological effects on inhibition of thrombosis, inflammation, and intimal hyperplasia, enhanced re-endothelialization, and hence efficiently reduced ISR.

Also flagged:adult-onset neurodegenerative diseaseHDparvalbuminsomatostatincalretinincholine acetyltransferase
Journal Article 2021-05-24 ✓ 3 Snippets Rallapalle V, King AC, Gray M.
In-Text Gene Mentions

Huntington’s disease (HD) is caused by a CAG repeat expansion in the gene that encodes for the huntingtin (HTT) protein, resulting in an expanded polyglutamine repeat (MacDonald et al., 1993).

…for the huntingtin (HTT) protein, resulting in…

…TheHTTprotein is expressed…

Show Full Abstract

Huntington's disease (HD) is a dominantly inherited, adult-onset neurodegenerative disease characterized by motor, psychiatric, and cognitive abnormalities. Neurodegeneration is prominently observed in the striatum where GABAergic medium spiny neurons (MSN) are the most affected neuronal population. Interestingly, recent reports of pathological changes in HD patient striatal tissue have identified a significant reduction in the number of parvalbumin-expressing interneurons which becomes more robust in tissues of higher disease grade. Analysis of other interneuron populations, including somatostatin, calretinin, and cholinergic, did not reveal significant neurodegeneration. Electrophysiological experiments in BACHD mice have identified significant changes in the properties of parvalbumin and somatostatin expressing interneurons in the striatum. Furthermore, their interactions with MSNs are altered as the mHTT expressing mouse models age with increased input onto MSNs from striatal somatostatin and parvalbumin-expressing neurons. In order to determine whether BACHD mice recapitulate the alterations in striatal interneuron number as observed in HD patients, we analyzed the number of striatal parvalbumin, somatostatin, calretinin, and choline acetyltransferase positive cells in symptomatic 12-14 month-old mice by immunofluorescent labeling. We observed a significant decrease in the number of parvalbumin-expressing interneurons as well as a decrease in the area and perimeter of these cells. No significant changes were observed for somatostatin, calretinin, or cholinergic interneuron numbers while a significant decrease was observed for the area of cholinergic interneurons. Thus, the BACHD mice recapitulate the degenerative phenotype observed in the parvalbumin interneurons in HD patient striata without affecting the number of other interneuron populations in the striatum.

Also flagged:Neoplasmscancertumorcell proliferationcell migrationmethylation
Journal Article 2021-05-24 No Snippets Canberk S, Lima AR, Pinto M, Soares P, Máximo V.
Show Full Abstract

It has been widely described that cancer genomes have frequent alterations to the epigenome, including epigenetic silencing of various tumor suppressor genes with functions in almost all cancer-relevant signalling pathways, such as apoptosis, cell proliferation, cell migration and DNA repair. Epigenetic alterations comprise DNA methylation, histone modification, and microRNAs dysregulated expression and they play a significant role in the differentiation and proliferation properties of TC. In this review, our group assessed the published evidence on the tumorigenic role of epigenomics in Hurthle cell neoplasms (HCN), highlighting the yet limited, heteregeneous and non-validated data preventing its current use in clinical practice, despite the well developed assessment techniques available. The identified evidence gaps call for a joint endeavour by the medical community towards a deeper and more systematic study of HCN, aiming at defining epigenetic markers in early diagnose, allowing for accurate stratification of maligancy and disease risk and for effective systemic treatment.

Also flagged:topCFSOvarian CancertumourOCtranscription factors
Journal Article 2021-05-24 ✓ 1 Snippet He T, Huang L, Li J, Wang P, Zhang Z.
In-Text Gene Mentions

…positively regulated GSTM5,PTGIS, ENPP2, and P4HA3…

Show Full Abstract

<b>Background:</b> The tumour immune microenvironment plays an important role in the biological mechanisms of tumorigenesis and progression. Artificial intelligence medicine studies based on big data and advanced algorithms are helpful for improving the accuracy of prediction models of tumour prognosis. The current research aims to explore potential prognostic immune biomarkers and develop a predictive model for the overall survival of ovarian cancer (OC) based on artificial intelligence algorithms. <b>Methods:</b> Differential expression analyses were performed between normal tissues and tumour tissues. Potential prognostic biomarkers were identified using univariate Cox regression. An immune regulatory network was constructed of prognostic immune genes and their highly related transcription factors. Multivariate Cox regression was used to identify potential independent prognostic immune factors and develop a prognostic model for ovarian cancer patients. Three artificial intelligence algorithms, random survival forest, multitask logistic regression, and Cox survival regression, were used to develop a novel artificial intelligence survival prediction system. <b>Results:</b> The current study identified 1,307 differentially expressed genes and 337 differentially expressed immune genes between tumour samples and normal samples. Further univariate Cox regression identified 84 prognostic immune gene biomarkers for ovarian cancer patients in the model dataset (GSE32062 dataset and GSE53963 dataset). An immune regulatory network was constructed involving 63 immune genes and 5 transcription factors. Fourteen immune genes (PSMB9, FOXJ1, IFT57, MAL, ANXA4, CTSH, SCRN1, MIF, LTBR, CTSD, KIFAP3, PSMB8, HSPA5, and LTN1) were recognised as independent risk factors by multivariate Cox analyses. Kaplan-Meier survival curves showed that these 14 prognostic immune genes were closely related to the prognosis of ovarian cancer patients. A prognostic nomogram was developed by using these 14 prognostic immune genes. The concordance indexes were 0.760, 0.733, and 0.765 for 1-, 3-, and 5-year overall survival, respectively. This prognostic model could differentiate high-risk patients with poor overall survival from low-risk patients. According to three artificial intelligence algorithms, the current study developed an artificial intelligence survival predictive system that could provide three individual mortality risk curves for ovarian cancer. <b>Conclusion:</b> In conclusion, the current study identified 1,307 differentially expressed genes and 337 differentially expressed immune genes in ovarian cancer patients. Multivariate Cox analyses identified fourteen prognostic immune biomarkers for ovarian cancer. The current study constructed an immune regulatory network involving 63 immune genes and 5 transcription factors, revealing potential regulatory associations among immune genes and transcription factors. The current study developed a prognostic model to predict the prognosis of ovarian cancer patients. The current study further developed two artificial intelligence predictive tools for ovarian cancer, which are available at https://zhangzhiqiao8.shinyapps.io/Smart_Cancer_Survival_Predictive_System_17_OC_F1001/ and https://zhangzhiqiao8.shinyapps.io/Gene_Survival_Subgroup_Analysis_17_OC_F1001/. An artificial intelligence survival predictive system could help improve individualised treatment decision-making.

Also flagged:CoagulationPneumoniaCOVID-19FDPCOVID-19 pneumoniaCoronavirus disease 2019
Journal Article 2021-05-24 ✓ 5 Snippets Xu J, Zhang Y, Li Y, Liao K, Zeng X, Zeng X, Meng R, Zhou W, Wang K, Gong Y, Hua F, Xu J, Qiu J.
In-Text Gene Mentions

…APTT, PT, DD,ATIII, and FDP) were…

…and antithrombin III (ATIII).…

…APTT, PT, DD,ATIII, and FDP, were…

…was 13.62 ±0.87,ATIIIlevel was 89.19…

…13.62 ± 0.99,ATIIIlevel was 87.39…

Show Full Abstract

<b>Objective:</b> We aimed to explore the dynamic changes in coagulation function and the effect of age on coagulation function in patients with pneumonia under admission and non-admission treatment. <b>Methods:</b> We included 178 confirmed adult inpatients with COVID-19 from Wuhan Union Hospital Affiliated to Huazhong University of Science and Technology (Wuhan, China). Patients were classified into common types, and all were cured and discharged after hospitalization. We recorded the time of the first clinical symptoms of the patients and performed blood coagulation tests at the time of admission and after admission. In total, eight factors (TT, FIB, INR, APTT, PT, DD, ATIII, and FDP) were analyzed. Patients were classified into four groups according to the time from the first symptom onset to hospital admission for comparative analysis. The patients who were admitted within 2 weeks of disease onset were analyzed for the dynamic changes in their blood coagulation tests. Further division into two groups, one group comprising patients admitted to the hospital within 2 weeks after the onset of disease and the other comprising patients admitted to the hospital 2 weeks after disease onset, was performed to form two groups based on whether the patient ages were over or under 55 years. Chi-square tests and <i>T</i> tests were used to explore the dynamic changes in coagulation function and the influence of age on the results of coagulation function tests. <b>Results:</b> A total of 178 inpatients, 34 of whom underwent dynamic detection, were included in this analysis. We divided these patients into four groups according to the interval between the onset of COVID-19 pneumonia and the time to admission in the hospital: the 1-7 days (group 1), 8-14 days (group 2), 15-21 days (group 3), and >21-days (group 4). Eight factors all increased within 2 weeks after onset and gradually decreased to normal 2 weeks before the patient was admitted. The changes in coagulation function of patients admitted to the hospital were similar. After being admitted to the hospital, the most significant decreases among the eight factors were between week 2 and 3. There were distinct differences among the eight factors between people older than 55 years and those younger than 55 years. In the first 2 weeks after being admitted, the levels of the eight factors in patients >55 years were significantly higher than those in patients <55 years, and after another 2 weeks of treatment, the factor levels in both age groups returned to normal. <b>Conclusion:</b> The eight factors all increased within 2 weeks after onset and gradually decreased to normal after 2 weeks regardless of treatment. Compared with patients younger than 55 years, patients older than 55 years have greater changes in their blood coagulation test values.

Also flagged:CYP24A1cancerscutaneous squamous cell carcinomaRNase RdigestionCDS2
Journal Article 2021-05-24 No Snippets Zhang Z, Guo H, Yang W, Li J.
Show Full Abstract

<b>Objective:</b> Aberrantly expressed exosomal circular RNAs (circRNAs) have been reported in various human cancers. Nevertheless, it remains elusive in cutaneous squamous cell carcinoma (cSCC). Herein, based on RNA-seq, we systematically uncovered the expression and implication of exosomal circRNAs in cSCC. <b>Methods:</b> Plasma exosomes derived from cSCC and healthy subjects were characterized by nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM), and western blot. Differentially expressed exosomal circular RNAs (circRNAs) were screened by RNA-seq analysis, which were validated by RT-qPCR. Among them, the biological structure of circ-CYP24A1 was validated by Sanger sequencing and RNase R digestion. Si-circ-CYP24A1 was transfected into exosomes, followed by incubation with A431 and SCL-1 cells. Then, viability, apoptosis, migration, and invasion were evaluated by CCK-8, TUNEL staining and migration assays. <b>Results:</b> This study identified 25 up- and 76 down-regulated exosomal circRNAs in cSCC than healthy subjects. Among them, circulating circ-CYP24A1 was confirmed to be up-regulated in cSCC. Circ-CYP24A1 had a covalently closed circular structure and was not sensitive to RNase R digestion. After incubation with si-circ-CYP24A1-transfected exosomes, proliferation, migration, and invasion were lowered while apoptosis was enhanced in A431 and SCL-1 cells. Meanwhile, si-circ-CYP24A1-transfected exosomes significantly decreased the expression of downstream targets CDS2, MAVS, and SOGA in cSCC cells. <b>Conclusion:</b> Collectively, our study identified that targeting exosomal circ-CYP24A1 could suppress cSCC progression by weakening tumor malignant behaviors, which might provide a promising therapeutic target and non-invasive diagnostic biomarker for cSCC.

Also flagged:hepatocellular carcinomatumorSDC3NCF2WARSLiver cancer
Journal Article 2021-05-24 ✓ 5 Snippets Huang C, Jiang X, Huang Y, Zhao L, Li P, Liu F.
In-Text Gene Mentions

Among the 12-gene risk-scoring model, SDC3, NCF2, BTN3A3, and WARS have never been reported as the prognostic factor for HCC.

BTN3A3 has not been reported as its role of HCC.

SDC3, NCF2, BTN3A3, and WARS were noticed as a novel prognostic factor for HCC.

However, BTN3A3 was considered as a tumor suppressor gene, which could promote cellular apoptosis of nonsmall cell lung cancer (Jeon et al., 2016).

…SDC3, NCF2,BTN3A3, and WARS were…

Show Full Abstract

The prognostic prediction of hepatocellular carcinoma (HCC) is still challenging. Immune cells play a crucial role in tumor initiation, progression, and drug resistance. However, prognostic value of immune-related genes in HCC remains to be further clarified. In this study, the mRNA expression profiles and corresponding clinical information of HCC patients were downloaded from public databases. Then, we estimated the abundance of immune cells and identified the differentially infiltrated and prognostic immune cells. The weighted gene co-expression network analysis (WGCNA) was performed to identify immune-related genes in TCGA cohort and GEO cohort. The least absolute shrinkage and selection operator (LASSO) Cox regression model was applied to establish a risk-scoring model in the TCGA cohort. HCC patients from the GSE14520 datasets were utilized for risk model validation. Our results found that high level of dendritic cell (DC) infiltration was associated with poor prognosis. Over half of the DC-related genes (58.2%) were robustly differentially expressed between HCC and normal specimens in the TCGA cohort. 17 differentially expressed genes (DEGs) were found to be significantly associated with overall survival (OS) by univariate Cox regression analysis. A 12-gene risk-scoring model was established to evaluate the prognosis of HCC. The high-risk group exhibits significantly lower OS rate of HCC patients than the low-risk group. The risk-scoring model shows benign predictive capacity in both GEO dataset and TCGA dataset. The 12-gene risk-scoring model may independently perform prognostic value for HCC patients. Receiver operating characteristic (ROC) curve analysis of the risk-scoring model in GEO cohort and TCGA cohort performed well in predicting OS. Taken together, the 12-gene risk-scoring model could provide prognostic and potentially predictive information for HCC. SDC3, NCF2, BTN3A3, and WARS were noticed as a novel prognostic factor for HCC.

Also flagged:pigeon pox virus infectionmethicillinbeta-lactamsaminoglycosidestetracyclinesmacrolides
Journal Article 2021-05-24 No Snippets Chrobak-Chmiel D, Kwiecień E, Golke A, Dolka B, Adamczyk K, Biegańska MJ, Spinu M, Binek M, Rzewuska M.
Show Full Abstract

Pigeons are widespread bird species in urban regions (<i>Columba livia</i> forma <i>urbana</i>) and may carry pathogens with zoonotic potential. In recent years, more and more data indicate that these zoonotic pathogens are multidrug resistant. Our results confirmed that global trend. Three different multidrug-resistant pathogens were isolated from an oral cavity of a racing pigeon with lesions typical for pigeon pox virus infection. <i>Staphylococcus aureus</i> was recognized as methicillin resistant, thus resistant to all beta-lactams. Additionally, it was also resistant to many other classes of antibiotics, namely: aminoglycosides, tetracyclines, phenicols, lincosamides, and macrolides. <i>Escherichia coli</i> showed resistance to all antimicrobials tested, and it was classified as intermediate to amikacin. Moreover, <i>Candida albicans</i> resistant to clotrimazole, natamycin, flucytosine, and amphotericin and intermediate to ketoconazole, nystatin, and econazole was also isolated. This raises the question how pigeons acquire such highly resistant strains. Therefore, more data are needed concerning the resistance to antibiotics in strains from domestic and wild pigeons in Poland. Until the problem is fully understood, it will be challenging to implement adequate planning of any control measures and check their effectiveness.

Also flagged:EstrogenTumorspathogenesisendometrial cancerstumorSystem Tumors
Journal Article 2021-05-24 ✓ 1 Snippet Tu J, Yang H, Jiang L, Chen Y, Yu Chen, Li Z, Li L, Zhang Y, Chen X, Chen H, Yu Z.
In-Text Gene Mentions

Ma et al. [9] proved that estrogen promotes the expression of Olfactomedin 4 (OLFM4) by repressing miR-486-5p in ovarian cancer cells.

Show Full Abstract

The pathogenesis of ovarian and endometrial cancers is closely associated with estrogen-related pathways. These estrogen-dependent tumors seriously threaten the health and quality of life in women. Noncoding RNAs (ncRNAs) are defined as RNAs that do not encode proteins, including microRNAs (miRNAs) and long noncoding RNAs (lncRNAs), both of which have been reported in estrogen-dependent female reproductive system tumors. This review systematically summarizes the role of ncRNAs in estrogen-dependent tumors and common patterns of regulatory mechanisms to explore their future research directions in tumor diagnosis, treatment, and prognosis. This may provide new ideas for the potential application of ncRNAs in estrogen-dependent female reproductive system tumors.

Also flagged:HIC1SEPT9DKK3IL-6KRT19ALX4
Journal Article 2021-05-24 No Snippets Mazouji O, Ouhajjou A, Incitti R, Mansour H.
Show Full Abstract

Colorectal cancer (CRC) is one of the most common cancers worldwide, being the third most diagnosed in the world and the second deadliest. Solid biopsy provides an essential guide for the clinical management of patients with colorectal cancer; however, this method presents several limitations, in particular invasiveness, and cannot be used repeatedly. Recently, clinical research directed toward the use of liquid biopsy, as an alternative tool to solid biopsy, showed significant promise in several CRC clinical applications, as (1) detect CRC patients at early stage, (2) make treatment decision, (3) monitor treatment response, (4) predict relapses and metastases, (5) unravel tumor heterogeneity, and (6) detect minimal residual disease. The purpose of this short review is to describe the concept, the characteristics, the genetic components, and the technologies used in liquid biopsy in the context of the management of colorectal cancer, and finally we reviewed gene alterations, recently described in the literature, as promising potential biomarkers that may be specifically used in liquid biopsy tests.

Also flagged:Triptolidebiosynthesisabietanesolid tumorssynthesisditerpenoid
Journal Article 2021-05-24 No Snippets Gao J, Zhang Y, Liu X, Wu X, Huang L, Gao W.
Show Full Abstract

Triptolide, an abietane-type diterpenoid isolated from <i>Tripterygium wilfordii</i> Hook. F., has significant pharmacological activity. Research results show that triptolide has obvious inhibitory effects on many solid tumors. Therefore, triptolide has become one of the lead compounds candidates for being the next "blockbuster" drug, and multiple triptolide derivatives have entered clinical research. An increasing number of researchers have developed triptolide synthesis methods to meet the clinical need. To provide new ideas for researchers in different disciplines and connect different disciplines with researchers aiming to solve scientific problems more efficiently, this article reviews the research progress made with analyzes of triptolide pharmacological activity, biosynthetic pathways, and chemical synthesis pathways and reported in toxicological and clinical studies of derivatives over the past 20 years, which have laid the foundation for subsequent researchers to study triptolide in many ways.

Also flagged:Cognitive impairmenttype 2 diabetesdiabetescognitionhypertensionCI
Journal Article 2021-05-24 ✓ 1 Snippet Verma S, Agarwal S, Tashok S, Verma A, Giri R.
In-Text Gene Mentions

ACE-IIIis a sensitive…

Show Full Abstract

<h4>Background and aim</h4>There have been few studies from South Asia which have shown increased prevalence of cognitive impairment (CI) in diabetes. CI may further hamper self-care and independent living. The present study was designed to evaluate the impairment in cognition and self-care among patients with type 2 diabetes.<h4>Materials and methods</h4>We assessed cognitive function in 54 type 2 diabetes participants and compared them with 54 healthy controls, using Addenbrooke's Cognitive Examination-III (ACE-III) test. Assessment of self-care was done by using Katz index of independence in activities of daily living and revised Summary of Diabetes Self-Care Activities (SDSCA) measures.<h4>Results</h4>The mean age and HbA1c of cases was 64.5 ± 5.3 years and 8.8 ± 2.5%, respectively. Cognitive impairment was more prevalent among type 2 diabetes participants (Odds ratio 31.3, CI: 10-100, P < 0.0001) with mean Addenbrooke's score of 74.9 ± 11.2 compared to 86.9 ± 5.3 in controls (t-statistic = 7.09, 95% CI: 8.6 to 15.3, P < 0.0001). The adjusted Odds ratio for CI was 9.46 after adjustment for hypertension. All the sub-domains of cognition were affected. The burden of CI was more among females and in those with poor glycemic control (HbA1C > 7.5%) when compared to controls. The diabetic participants with CI had poor SDSCA scores compared to those with no CI.<h4>Conclusion</h4>Diabetes may cause CI and is related to poor self-care. Considering a high prevalence of CI in diabetes, cognitive assessment should be a part of overall evaluation. ACE-III is a sensitive and convenient tool for this purpose.

Also flagged:melatonininflammatory diseasesFerritin-periodontitischronic periodontitis
Journal Article 2021-05-24 ✓ 1 Snippet Faramarzi M, Sadighi M, Chitsazi M, Esmailzadeh M, Foladvand G.
In-Text Gene Mentions

…be associated withhemochromatosisand neuronal damage…

Show Full Abstract

<h4>Background</h4>Ferritin is an acute-phase protein that is increased in inflammatory diseases. Melatonin has been studied due to its antioxidant effects and the elimination of free radicals. The aim of this study was to evaluate the effect of melatonin supplement as an adjunct to routine periodontal treatment on serum ferritin levels in patients with periodontitis.<h4>Materials and methods</h4>Forty patients with chronic periodontitis were included in this randomized controlled clinical trial study. Twenty patients received nonsurgical periodontal treatment and twenty patients received nonsurgical periodontal treatment with adjunctive use of melatonin. Serum ferritin concentrations and periodontal parameters were recorded at baseline and 3 months after periodontal therapy. Serum ferritin level and periodontal parameters comparison at baseline and 3 months after periodontal treatment was done by Wilcoxon signed-rank test and paired sample <i>t</i>-test, respectively. Differences between test and control groups were evaluated by Mann-Whitney U-test for ferritin level and independent <i>t</i>-test for periodontal parameters, and a <i>P</i> ≤ 0.05 was considered statistically significant.<h4>Results</h4>Serum ferritin level decreased in both the control and test group in 3 months follow-up compared to baseline (<i>P</i> < 0.001). The reduction in ferritin levels in the test group was more than the control group, but this difference was not statistically significant (<i>P</i> = 0.414). Improvement in periodontal parameters were not significant between two groups (<i>P</i> = 0.489), but improvement rates in the test group were more than control.<h4>Conclusion</h4>Melatonin, as an adjunct to periodontal therapy, showed additional benefits in the reduction of serum ferritin levels and improvement of periodontal parameters.

Also flagged:autoantibodiesironautoantibodynew-onset diabetesthrombocytopenialeucopenia
Journal Article 2021-05-24 ✓ 5 Snippets Yazdali Koylu N, Koylu B, Sokmensuer C, Balaban Y.
In-Text Gene Mentions

…was 498 µg/L.HFEgene mutation analysis…

…possible linkage betweenhemochromatosisand predisposition to…

…mutation in theHFEgene, accounting for…

…of HH patients (HFE-related HH).…

…Two other importantHFEgene mutations are…

Show Full Abstract

The presence of autoantibody positivity with an elevated ferritin level and high transferrin saturation can create a diagnostic dilemma. This report describes the challenging case of 38-year-old male patient who presented with new-onset diabetes, malaise, weight loss, dark-yellow skin discoloration, and splenomegaly. Initial laboratory tests revealed thrombocytopenia, leucopenia, an elevated unconjugated bilirubin level, and mildly elevated liver enzymes in a cholestatic pattern. Antinuclear antibody and anti-smooth muscle antibody findings were positive with titers of 1/160 and 1/320, respectively, along with hypergammaglobulinemia. The transferrin saturation value was 92% and the ferritin level was 498 µg/L. HFE gene mutation analysis revealed a C282Y heterozygote mutation, which is not diagnostic, but supported a diagnosis of hereditary hemochromatosis (HH). A liver biopsy is the most accurate way to differentiate autoimmune hepatitis from HH, and confirmed a diagnosis of HH. This case highlights the importance of paying close attention to all findings to avoid misdiagnosis and treatment which might result in dangerous outcomes. Additionally, in spite of a genetic test, a liver biopsy has great value as an important tool to determine an accurate diagnosis in patients with iron overload, especially in patients with concomitant autoantibody positivity.

Also flagged:Hepatocellular CarcinomaCirrhosisFibrosisliver cirrhosisliver diseasenonalcoholic fatty liver disease
Journal Article 2021-05-23 ✓ 2 Snippets Pinyopornpanish K, Al-Yaman W, Dasarathy S, Romero-Marrero C, McCullough A.
In-Text Gene Mentions

…40%, and 40% (hemochromatosis); and 12%, 40%,…

hemochromatosis

Show Full Abstract

<h4>Background</h4>The data on hepatocellular carcinoma (HCC) patients without liver cirrhosis is scarce.<h4>Aims</h4>To study the epidemiology, underlying etiology and fibrosis distribution in noncirrhotic HCC and compare the survival outcomes to cirrhotic HCC.<h4>Methods</h4>We conducted a retrospective study including all adult patients diagnosed with HCC at two US tertiary academic centers from 2000 to 2015. Univariable and multivariable Cox regression analyses were performed to evaluate the variables associated with patient survival.<h4>Results</h4>Two thousand two hundred and thirty-seven HCC patients were included in the final analysis, of which, 13% had no liver cirrhosis. The most common underlying liver disease in non-cirrhotic patients was cryptogenic cause (40%), followed by nonalcoholic fatty liver disease (NAFLD) (25.2%) and hepatitis C (19%). The percentage of F0-F1, F2, and F3 was 72%, 17%, and 11% (cryptogenic cause); 69%, 12%, and 19% (NAFLD); 50%, 17%, and 33% (alcohol); 33%, 39%, and 28% (hepatitis B); 20%, 40%, and 40% (hemochromatosis); and 12%, 40%, and 48% (hepatitis C), respectively. In non-cirrhotic compared to cirrhotic patients, the tumor was more likely to be larger and fell outside Milan criteria (all p < 0.001). Cirrhotic patients had significant shorter survival than non-cirrhotic patients (p < 0.001). On the multivariable analysis, having liver cirrhosis (HR 1.48; 1.21-1.82, p < 0.001), combined viral hepatitis and alcohol use (HR 1.51; 1.23-1.88, p < 0.001), morbid obesity (HR 1.31; 1.01-1.69, p = 0.040) and underweight (HR 2.06; 1.27-3.34, p = 0.004) were associated with worse patient survival.<h4>Conclusions</h4>The fibrosis distribution in non-cirrhotic HCC differed among each etiology of liver diseases. Despite more advanced HCC, patients without cirrhosis had significantly longer survival than those with cirrhosis.

Also flagged:Colorectal Cancercancergene expressioncell cyclep53tumor
Journal Article 2021-05-23 ✓ 1 Snippet Patil AR, Leung MY, Roy S.
In-Text Gene Mentions

PRDX6was present in…

Show Full Abstract

Colorectal cancer (CRC) is the third most common cancer that contributes to cancer-related morbidity. However, the differential expression of genes in different phases of CRC is largely unknown. Moreover, very little is known about the role of stress-survival pathways in CRC. We sought to discover the hub genes and identify their roles in several key pathways, including oxidative stress and apoptosis in the different stages of CRC. To identify the hub genes that may be involved in the different stages of CRC, gene expression datasets were obtained from the gene expression omnibus (GEO) database. The differentially expressed genes (DEGs) common among the different datasets for each group were obtained using the robust rank aggregation method. Then, gene enrichment analysis was carried out with Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases. Finally, the protein-protein interaction networks were constructed using the Cytoscape software. We identified 40 hub genes and performed enrichment analysis for each group. We also used the Oncomine database to identify the DEGs related to stress-survival and apoptosis pathways involved in different stages of CRC. In conclusion, the hub genes were found to be enriched in several key pathways, including the cell cycle and p53 signaling pathway. Some of the hub genes were also reported in the stress-survival and apoptosis pathways. The hub DEGs revealed from our study may be used as biomarkers and may explain CRC development and progression mechanisms.

Also flagged:Platinumnanoparticlenasopharyngeal carcinomatumorcancercell cycle
Journal Article 2021-05-23 No Snippets Ding Y, Xiao X, Zeng L, Shang Q, Jiang W, Xiong S, Duan X, Shen J, Wang R, Guo J, Pan Y.
Show Full Abstract

Despite extensive use of radiotherapy in nasopharyngeal carcinoma (NPC) treatment because of its high radiosensitivity, there have been huge challenges in further improving therapeutic effect, meanwhile obviously reducing radiation damage. To this end, synergistic chemoradiotherapy has emerged as a potential strategy for highly effective NPC therapy. Here, we developed RGD-targeted platinum-based nanoparticles (RGD-PtNPs, denoted as RPNs) to achieve targeted chemoradiotherapy for NPC. Such nanoparticles consist of an RGD-conjugated shell and a <i>cis</i>-platinum (CDDP) crosslinking core. Taking advantage of RGD, the RPNs may effectively accumulate in tumor, penetrate into tumor tissues and be taken by cancer cells, giving rise to a high delivery efficiency of CDDP. When they are fully enriched in tumor sites, the CDDP loaded RPNs can act as radiotherapy sensitizer and chemotherapy agents. By means of X-ray-promoted tumor cell uptake of nanoparticle and CDDP-induced cell cycle arrest in radiation-sensitive G2/M phases, RPNs may offer remarkable therapeutic outcome in the synergistic chemoradiotherapy for NPC.

bioRxiv 2021-05-23 Preprint (No Snippets API) Tran HT, Tran DH, Pham TNM, Phung HTT.
Show Full Abstract

<h4>ABSTRACT</h4> Listeria monocytogenes is one of the most common types of food poisoning bacteria which can cause serious foodborne diseases or even lethality. Generally, L. monocytogenes can be detected using traditional microbiology or molecular biology techniques, notably PCR. However, the application of these methods at the field is restricted due to the strict requirement of equipment and skilled personnel. In this study, recombinase polymerase amplification (RPA), an isothermal PCR assay was developed to rapidly detect L. monocytogenes in the crude samples. The results showed that the RPA reaction, without requiring complex thermal cycles, was well-performed in the optimal conditions of 39°C within only 25 minutes. The limit of detection was identified as 310 fg of L. monocytogenes genomic DNA, which was 1000-fold more sensitive than the conventional PCR. In addition, RPA also succeeded to directly detect L. monocytogenes cells at a concentration as low as 2.5 × 10 1 Colony Forming Unit (CFU)/ml in pure cultures and 2.5 × 10 2 CFU/ml in crude samples without sample extraction or processing. Therefore, RPA established in this study could be an alternative standard method to confirm the presence of L. monocytogenes in food. Accordingly, this rapid and sensitive method could be further applied to clinical testing for the diagnosis of L. monocytogenes infection, especially in areas with limited settings.

Also flagged:HuntingtinagingHuntington's diseaseHDautosomal‐dominant inherited neurodegenerative disordercognitive decline
Journal Article 2021-05-22 ✓ 1 Snippet Fisher RS, Jimenez RM, Soto E, Kalev D, Elbaum-Garfinkle S.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease is caused by a polyglutamine (polyQ) expansion in the huntingtin protein which results in its abnormal aggregation in the nervous system. Huntingtin aggregates are linked to toxicity and neuronal dysfunction, but a comprehensive understanding of the aggregation mechanism in vivo remains elusive. Here, we examine the morphology of polyQ aggregates in Caenorhabditis elegans mechanosensory neurons as a function of age using confocal and fluorescence lifetime imaging microscopy. We find that aggregates in young worms are mostly spherical with homogenous intensity, but as the worm ages aggregates become substantially more heterogeneous. Most prominently, in older worms we observe an apparent core/shell morphology of polyQ assemblies with decreased intensity in the center. The fluorescence lifetime of polyQ is uniform across the aggregate indicating that the dimmed intensity in the assembly center is most likely not due to quenching or changes in local environment, but rather to displacement of fluorescent polyQ from the central region. This apparent core/shell architecture of polyQ aggregates in aging C. elegans neurons contributes to the diverse landscape of polyQ aggregation states implicated in Huntington's disease.

Also flagged:diabetesHMG-CoA-Reductasecoronary artery diseasecholesteroldiabetes mellituscoronary artery calcification
Journal Article 2021-05-22 No Snippets Pechlivanis S, Jung D, Moebus S, Lehmann N, Mahabadi AA, Hoffmann P, Erbel R, Nöthen MM, Bachmann HS.
Show Full Abstract

HMG-CoA-Reductase inhibitors (HMGRIs) are currently the most widely used group of drugs in patients with coronary artery disease (CAD) and are given preemptively to patients with high levels of cholesterol, including those with diabetes mellitus (DM). However, intake of HMGRIs also increases the progression of coronary artery calcification (CAC) and the risk of developing DM. This study aimed to investigate whether HMGRI intake interacts with the diabetes-associated genetic risk score (GRS) to affect CAC progression using data from the population-based Heinz Nixdorf Recall (HNR) study. CAC was measured in 3157 participants using electron-beam computed tomography twice, at baseline (CAC<sub>b</sub>) and 5 years later (CAC<sub>5y</sub>). CAC progression was classified as slow, expected, or rapid based on predicted values. Weighted DM GRS was constructed using 100 diabetes mellitus-associated single nucleotide polymorphisms (SNPs). We used log-linear regression to evaluate the interaction of HMGRI intake with diabetes-associated GRS and individual SNPs on CAC progression (rapid vs. expected/slow), adjusting for age, sex, and log(CAC<sub>b</sub> + 1). The prevalence of rapid CAC progression in the HNR study was 19.6%. We did not observe any association of the weighted diabetes mellitus GRS with the rapid progression of CAC (relative risk (RR) [95% confidence interval (95% CI)]: 1.01 [0.94; 1.10]). Furthermore, no indication of an interaction between GRS and HMGRI intake was observed (1.08 [0.83; 1.41]). Our analyses showed no indication that the impact of HMGRIs on CAC progression is significantly more severe in patients with a high genetic risk of developing DM than in those with a low GRS.

Also flagged:mitochondria-paclitaxelcancermitochondriamitochondria-targetingtriphenylphosphonium
Journal Article 2021-05-22 No Snippets Wang H, Shi W, Zeng D, Huang Q, Xie J, Wen H, Li J, Yu X, Qin L, Zhou Y.
Show Full Abstract

<h4>Background</h4>Mitochondria play a role in the occurrence, development, drug resistance, metastasis, and other functions of cancer and thus are a drug target. An acid-activated mitochondria-targeting drug nanocarrier with redox-responsive function was constructed in the present study. However, whether this vector can precisely delivery paclitaxel (PTX) to enhance therapeutic efficacy in drug-resistant lung cancer is unknown.<h4>Results</h4>Acid-cleavable dimethylmaleic anhydride (DA) was used to modify pluronic P85-conjugated mitochondria-targeting triphenylphosphonium (TPP) using disulfide bonds as intermediate linkers (DA-P85-SS-TPP and DA-P-SS-T). The constructed nanocarriers demonstrated enhanced cellular uptake and selective mitochondrial targeting at extracellular pH characteristic for a tumor (6.5) and were characterized by extended circulation in the blood. TPP promoted the targeting of the DA-P-SS-T/PTX nanomicelles to the mitochondrial outer membrane to decrease the membrane potential and ATP level, resulting in inhibition of P-glycoprotein and suppression of drug resistance and cancer metastasis. PTX was also rapidly released in the presence of high glutathione (GSH) levels and directly diffused into the mitochondria, resulting in apoptosis of drug-resistant lung cancer cells.<h4>Conclusions</h4>These promising results indicated that acid-activated mitochondria-targeting and redox-responsive nanomicelles potentially represent a significant advancement in cancer treatment. GRAPHIC ABSTARCT.

Also flagged:SynthesisTerpolymerspolymersPolymerizationblock copolymersstyrene
Journal Article 2021-05-22 No Snippets Skandalis A, Sentoukas T, Giaouzi D, Kafetzi M, Pispas S.
Show Full Abstract

This review article aims to cover the most recent advances regarding the synthesis of linear ABC-type triblock terpolymers and star-shaped polymers by RAFT polymerization, as well as their self-assembly properties in aqueous solutions. RAFT polymerization has received extensive attention, as it is a versatile technique, compatible with a great variety of functional monomers and reaction conditions, while providing exceptional and precise control over the final structure, with well-defined side-groups and post-polymerization engineering potential. Linear triblock terpolymers synthesis can lead to very interesting novel ideas, since there are countless combinations of stimuli/non-stimuli and hydrophilic/hydrophobic monomers that someone can use. One of their most interesting features is their ubiquitous ability to self-assemble in different nanostructures depending on their degree of polymerization (DP), block composition, solubilization protocol, internal and external stimuli. On the other hand, star-shaped polymers exhibit a more stable nanostructure, with a distinct crosslinked core and arm blocks that can also incorporate stimuli-responsive blocks for "smart" applications.

Also flagged:insulindithizoneC peptideC-peptidecell differentiationsex-determining region
Journal Article 2021-05-22 ✓ 4 Snippets Rajabi H, Aslani S, Rahbarghazi R.
In-Text Gene Mentions

…of NeuroD1 andSOX6that could affect…

…Dynamics ofSOX6and NeuroD1 following…

…study showed thatSOX6was downregulated, indicating…

…data suggest thatSOX6could be considered…

Show Full Abstract

Mesenchymal stem cells have the fundamental ability to differentiate into multiple cells such as osteoblasts, neural cells, and insulin-producing cells. MicroRNAs (miRNAs) are single-strand and small non-coding RNAs involved in stem cells orientation into mature cells. There is no comprehensive data about the dynamic of distinct miRNAs during the differentiation of mesenchymal cells from adipose tissue into insulin-producing cells. In this study, we first differentiated adipose-derived mesenchymal stem cells into insulin-producing cells by a three-stepwise protocol. Differentiation capacity was confirmed by the dithizone staining method and hormone (insulin and C peptide) release analysis via electrochemiluminescence technique. In the final phase, the expression of hsa-miR-101a and hsa-miR-107 and two pancreatic genes, sex-determining region Y-box (<i>SOX</i>) 6 and neuronal differentiation 1 (<i>NeuroD1</i>) were examined during the differentiation procedure on days 0, 7, 14, 21, and 28 after induction, by using real-time PCR assay. The level of C-peptide and insulin were also measured at the end of the experiment. Dithizone staining showed trans-differentiation of adipose-derived mesenchymal stem cells into pancreatic β cells evidenced with red-to-brown appearance compared to the control group, indicating the potency to insulin production. These features were at maximum levels 28 days after cell differentiation. Real-time PCR revealed the increase of <i>NeuroD1</i> and reduction of <i>SOX</i>6 during differentiation of stem cells toward insulin-producing cells (P <0.05). Both miR-101a and miR-107 showed prominent expression at day 28 (P <0.05). Changes in the expression of miR-101a and miR-107coincided with alteration of <i>NeuroD1</i> and <i>SOX6</i> that could affect mesenchymal stem cells commitment toward insulin-like beta cells.

Also flagged:spermatogenesisSARSmanchette1001VEGFintellectual disability
Journal Article 2021-05-21 ✓ 1 Snippet Iivonen AP, Kärkinen J, Yellapragada V, Sidoroff V, Almusa H, Vaaralahti K, Raivio T.
In-Text Gene Mentions

…, TUBB3 ,DCC, SMCHD1 ,…

Show Full Abstract

Patients with deletions on chromosome 9q31.2 may exhibit delayed puberty, craniofacial phenotype including cleft lip/palate, and olfactory bulb hypoplasia. We report a patient with congenital HH with anosmia (Kallmann syndrome, KS) and a de novo 2.38 Mb heterozygous deletion in 9q31.2. The deletion breakpoints (determined with whole-genome linked-read sequencing) were in the FKTN gene (9:108,331,353) and in a non-coding area (9:110,707,332) (hg19). The deletion encompassed six protein-coding genes (FKTN, ZNF462, TAL2, TMEM38B, RAD23B, and KLF4). ZNF462 haploinsufficiency was consistent with the patient's Weiss-Kruszka syndrome (craniofacial phenotype, developmental delay, and sensorineural hearing loss), but did not explain his KS. In further analyses, he did not carry rare sequence variants in 32 known KS genes in whole-exome sequencing and displayed no aberrant splicing of 15 KS genes that were expressed in peripheral blood leukocyte transcriptome. The deletion was 1.8 Mb upstream of a KS candidate gene locus (PALM2AKAP2) but did not suppress its expression. In conclusion, this is the first report of a patient with Weiss-Kruszka syndrome and KS. We suggest that patients carrying a microdeletion in 9q31.2 should be evaluated for the presence of KS and KS-related features.

Also flagged:azaindanetRNA synthetaseiridoidalkaloidssynthesispyridinium
Journal Article 2021-05-21 No Snippets Harmange Magnani CS, Maimone TJ.
Show Full Abstract

Altemicidin and related <i>Streptomyces</i>-derived monoterpene alkaloids possess dense, highly polar azaindane cores as well as potent cytotoxic and tRNA synthetase inhibitory properties. The congested α-amino acid motif decorating their presumed iridoid-like core structure has proven to be both a synthetic challenge and a biosynthetic mystery to date. Herein, we report a distinct, abiotic strategy to these alkaloids resulting in a concise synthesis of altemicidin from simple chemical feedstocks. Key chemical findings include the exploitation of a dearomative pyridinium addition and dipolar cycloaddition sequence to stereospecifically install the quaternary amine moiety, and a chemoselective molybdenum-mediated double reduction to establish the fully functionalized azaindane nucleus with minimal redox manipulations.

Also flagged:Netrin-1axonalfluoresceinbiotinaxonal growthin colorectal carcinoma
Journal Article 2021-05-21 ✓ 4 Snippets Wen J, Deng X, Huang C, An Z, Liu M.
In-Text Gene Mentions

Moreover, low-intensity pulsed ultrasound at 0.12 W/cm<sup>2</sup> significantly enhanced the axonal growth guidance by activation of netrin-1 and DCC (deleted in colorectal carcinoma) expression as determined by Western blots assay.

…dance Growth through Netrin-1/DCCSignal Pathway in…

…of netrin-1 andDCC(deleted in colorectal…

…ultrasound activated netrin-1/DCCsignaling and further…

Show Full Abstract

Low-intensity pulsed ultrasound is found to be effective in axonal regeneration, while the role of ultrasound in axonal growth guidance is still unclear. This study was performed to explore the neuroprotective role of low-intensity pulsed ultrasound (US) both in vitro and in vivo. Primary cultured rat cortical neurons were subjected to 1.0 MHz ultrasound for 5 min every day at intensity of 0, 0.008, 0.12, and 0.21 W/cm<sup>2</sup>. Our results demonstrated that low-intensity pulsed ultrasound significantly increased neuronal cell viability and inhibited neuronal apoptosis in vitro as determined by fluorescein diacetate assay (FDA) and a TdT-mediated biotin-dUTP nicked-end labeling (TUNEL) assay. Moreover, low-intensity pulsed ultrasound at 0.12 W/cm<sup>2</sup> significantly enhanced the axonal growth guidance by activation of netrin-1 and DCC (deleted in colorectal carcinoma) expression as determined by Western blots assay. More interestingly, we further found that low-intensity pulsed ultrasound treatment at 0.21 W/cm<sup>2</sup> promoted the functional restoration of rat injured nerves in vivo, decreased hemorrhage, and reversed the injury process by activating positive netrin-1 expression as seen in the immunohistochemistry (IHC) assay. Thus, our study strongly demonstrated that low-intensity pulsed ultrasound activated netrin-1/DCC signaling and further mediated neurite outgrowth. It would be a new approach to nerve regeneration in the future.

Also flagged:myelinoligodendrocytesRasPI3KRhoGTPasescytoskeleton
Journal Article 2021-05-21 No Snippets Binamé F, Pham-Van LD, Bagnard D.
Show Full Abstract

In demyelinated lesions, astrocytes, activated microglia and infiltrating macrophages secrete several factors regulating oligodendrocyte precursor cells' behaviour. What appears to be the initiation of an intrinsic mechanism of myelin repair is only leading to partial recovery and inefficient remyelination, a process worsening over the course of the disease. This failure is largely due to the concomitant accumulation of inhibitory cues in and around the lesion sites opposing to growth promoting factors. Here starts a complex game of interactions between the signalling pathways controlling oligodendrocytes migration or differentiation. Receptors of positive or negative cues are modulating Ras, PI3K or RhoGTPases pathways acting on oligodendrocyte cytoskeleton remodelling. From the description of this intricate signalling network, this review addresses the extent to which the modulation of the global response to inhibitory cues may pave the route towards novel therapeutic approaches for myelin repair.

Also flagged:Sepsis-Induced Lung InjurysepsisCaspase-3Caspase-9collagenpulmonary fibrosis
Journal Article 2021-05-21 ✓ 5 Snippets Zhang W, Li J, Yao H, Li T.
In-Text Gene Mentions

Also, a study has provided a proof that increased Sox6 was involved in sepsis-induced cardiac apoptosis [10].

High expression of miR-499-5p can attenuate cell apoptosis in lung tissues and inhibit inflammation of sepsis-induced lung injury mice via depleting Sox6, and it is a potential candidate marker and therapeutic target for sepsis-induced lung injury.

In addition, it was revealed that restored miR-499-5p or depleted Sox6 alleviated lung tissues pathology, reduced lung injury score, collagen fibers and the degree of pulmonary fibrosis, and reduced TUNEL positive cells, Caspase-3 and Caspase-9 protein expression in lung tissues of sepsis-induced lung injury mice.

Similarly, a previous study has revealed that the expression of Sox6 was remarkably elevated in the kidney tissues of mice with diabetic kidney disease [31].

W/D ratio and Sox6 were increased while miR-499-5p was decreased in lung tissues of sepsis-induced lung injury mice.

Show Full Abstract

<h4>Background</h4>MicroRNAs (miRs) are known to participate in sepsis; hence, we aim to discuss the protective effect of miR-499-5p targeting sex-determining region Y-related high-mobility-group box 6 (Sox6) on sepsis-induced lung injury in mice.<h4>Methods</h4>The sepsis-induced lung injury model was established by cecal ligation and puncture. The wet/dry weight (W/D) ratio, miR-499-5p, Sox6, Caspase-3 and Caspase-9 expression in lung tissues of mice were tested. Lung injury score, collagen fibers and the degree of pulmonary fibrosis in lung tissues were determined. Further, the cell apoptosis in lung tissues was measured. The inflammatory factors contents and oxidative stress indices in bronchoalveolar lavage fluid (BALF) and lung tissues were detected via loss- and gain-of-function assays. The targeting relation between miR-499-5p and Sox6 was verified.<h4>Results</h4>W/D ratio and Sox6 were increased while miR-499-5p was decreased in lung tissues of sepsis-induced lung injury mice. Restored miR-499-5p or depleted Sox6 alleviated lung tissues pathology, reduced lung injury score, collagen fibers, the degree of pulmonary fibrosis, TUNEL positive cells, Caspase-3 and Caspase-9 protein expression and inflammatory factors contents in BALF and lung tissues as well as oxidative stress response in lung tissues of sepsis-induced lung injury mice. miR-499-5p targeted Sox6.<h4>Conclusion</h4>High expression of miR-499-5p can attenuate cell apoptosis in lung tissues and inhibit inflammation of sepsis-induced lung injury mice via depleting Sox6, and it is a potential candidate marker and therapeutic target for sepsis-induced lung injury.

Also flagged:Spinocerebellar ataxiacerebellar ataxiaspinocerebellar ataxiasdiseasescerebellar disorderscognitive deficits
Journal Article 2021-05-21 No Snippets Brooker SM, Edamakanti CR, Akasha SM, Kuo SH, Opal P.
Show Full Abstract

The spinocerebellar ataxias (SCAs) are a group of dominantly inherited diseases that share the defining feature of progressive cerebellar ataxia. The disease process, however, is not confined to the cerebellum; other areas of the brain, in particular, the brainstem, are also affected, resulting in a high burden of morbidity and mortality. Currently, there are no disease-modifying treatments for the SCAs, but preclinical research has led to the development of therapeutic agents ripe for testing in patients. Unfortunately, due to the rarity of these diseases and their slow and variable progression, there are substantial hurdles to overcome in conducting clinical trials. While the epidemiological features of the SCAs are immutable, the feasibility of conducting clinical trials is being addressed through a combination of strategies. These include improvements in clinical outcome measures, the identification of imaging and fluid biomarkers, and innovations in clinical trial design. In this review, we highlight current challenges in initiating clinical trials for the SCAs and also discuss pathways for researchers and clinicians to mitigate these challenges and harness opportunities for clinical trial development.

Also flagged:breast cancerEGFVWCEcell adhesiontumornucleotide
Journal Article 2021-05-21 ✓ 1 Snippet Huo Q, Li Z, Chen S, Wang J, Li J, Xie N.
In-Text Gene Mentions

…membrane (GO: 0044214),HFE-transferrin receptor complex …

Show Full Abstract

<h4>Purpose</h4>Von Willebrand Factor C and EGF Domains (VWCE) is an important gene that regulates cell adhesion, migration, and interaction. However, the correlation between VWCE expression and immune infiltrating in breast cancer remain unclear. In this study, we investigated the correlation between VWCE expression and immune infiltration levels in breast cancer.<h4>Methods</h4>The expression of VWCE was analyzed by the tumor immune estimation resource (TIMER) and DriverDB databases. Furthermore, genes co-expressed with VWCE and gene ontology (GO) enrichment analysis were investigated by the STRING and Enrichr web servers. Also, we performed the single nucleotide variation (SNV), copy number variation (CNV), and pathway activity analysis through GSCALite. Subsequently, the relationship between VWCE expression and tumor immunity was analyzed by TIMER and TISIDB databases, and further verified the results using Quantitative Real-Time PCR (RT-PCR), Western blotting, and immunohistochemistry.<h4>Results</h4>The results showed that the expression of VWCE mRNA in breast cancer tissue was significantly lower than that in normal tissues. We found that the expression level of VWCE was associated with subtypes, estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER2) status of breast cancer patients, but there was no significant difference in the expression of VWCE was found in age and nodal status. Further analyses indicated that VWCE was correlated with the activation or inhibition of multiple oncogenic pathways. Additionally, VWCE expression was negatively correlated with the expression of STAT1 (Th1 marker, r = - 0.12, p = 6e-05), but positively correlated with the expression of MS4A4A (r = 0.28, p = 0). These results suggested that the expression of VWCE was correlated with immune infiltration levels of Th1 and M2 macrophage in breast cancer.<h4>Conclusions</h4>In our study, VWCE expression was associated with a better prognosis and was immune infiltration in breast cancer. These findings demonstrate that VWCE is a potential prognostic biomarker and correlated with tumor immune cell infiltration, and maybe a promising therapeutic target in breast cancer.

Also flagged:Protein Phosphatase 2Bpostsynaptic densitiesPSDparallel fibersynapsesglutamate receptors
Journal Article 2021-05-21 No Snippets Lin Z, Wu B, Paul MW, Li KW, Yao Y, Smal I, Proietti Onori M, Hasanbegovic H, Bezstarosti K, Demmers J, Houtsmuller AB, Meijering E, Hoebeek FE, Schonewille M, Smit AB, Gao Z, De Zeeuw CI.
Show Full Abstract

Protein phosphatase 2B (PP2B) is critical for synaptic plasticity and learning, but the molecular mechanisms involved remain unclear. Here we identified different types of proteins that interact with PP2B, including various structural proteins of the postsynaptic densities (PSDs) of Purkinje cells (PCs) in mice. Deleting PP2B reduced expression of PSD proteins and the relative thickness of PSD at the parallel fiber to PC synapses, whereas reexpression of inactive PP2B partly restored the impaired distribution of nanoclusters of PSD proteins, together indicating a structural role of PP2B. In contrast, lateral mobility of surface glutamate receptors solely depended on PP2B phosphatase activity. Finally, the level of motor learning covaried with both the enzymatic and nonenzymatic functions of PP2B. Thus, PP2B controls synaptic function and learning both through its action as a phosphatase and as a structural protein that facilitates synapse integrity.<b>SIGNIFICANCE STATEMENT</b> Phosphatases are generally considered to serve their critical role in learning and memory through their enzymatic operations. Here, we show that protein phosphatase 2B (PP2B) interacts with structural proteins at the synapses of cerebellar Purkinje cells. Differentially manipulating the enzymatic and structural domains of PP2B leads to different phenotypes in cerebellar learning. We propose that PP2B is crucial for cerebellar learning via two complementary actions, an enzymatic and a structural operation.

Also flagged:Depressionmental disordergene-expressionB3GALTLFADS1TCTEX1D1
Journal Article 2021-05-21 ✓ 3 Snippets Li X, Su X, Liu J, Li H, Li M, 23andMe Research Team, Li W, Luo XJ.
In-Text Gene Mentions

…, GMPPB ,STAU1, NDUFA2 and…

…FANCL, TMEM161B-AS1, GMPPB,STAU1, NDUFA2, GPX1 and…

…, GMPPB ,STAU1, NDUFA2 ,…

Show Full Abstract

Depression is the most prevalent mental disorder with substantial morbidity and mortality. Although genome-wide association studies (GWASs) have identified multiple risk variants for depression, due to the complicated gene regulatory mechanisms and complexity of linkage disequilibrium (LD), the biological mechanisms by which the risk variants exert their effects on depression remain largely unknown. Here, we perform a transcriptome-wide association study (TWAS) of depression by integrating GWAS summary statistics from 807,553 individuals (246,363 depression cases and 561,190 controls) and summary-level gene-expression data (from the dorsolateral prefrontal cortex (DLPFC) of 1003 individuals). We identified 53 transcriptome-wide significant (TWS) risk genes for depression, of which 23 genes were not implicated in risk loci of the original GWAS. Seven out of 53 risk genes (B3GALTL, FADS1, TCTEX1D1, XPNPEP3, ZMAT2, ZNF501 and ZNF502) showed TWS associations with depression in two independent brain expression quantitative loci (eQTL) datasets, suggesting that these genes may represent promising candidates. We further conducted conditional analyses and identified the potential risk genes that driven the TWAS association signal in each locus. Finally, pathway enrichment analysis revealed biologically pathways relevant to depression. Our study identified new depression risk genes whose expression dysregulation may play a role in depression. More importantly, we translated the GWAS associations into risk genes and relevant pathways. Further mechanistic study and functional characterization of the TWS depression risk genes will facilitate the diagnostics and therapeutics for depression.

Also flagged:organogenesisRSPO3morphogenesiscancerVEGFAHMGA1
Journal Article 2021-05-21 ✓ 3 Snippets Christakoudi S, Evangelou E, Riboli E, Tsilidis KK.
In-Text Gene Mentions

…region including lociZNF664and FAM101 ,…

…(readthrough region withZNF664)…

Zinc finger protein 664finger protein 664…

Show Full Abstract

Genetic studies have examined body-shape measures adjusted for body mass index (BMI), while allometric indices are additionally adjusted for height. We performed the first genome-wide association study of A Body Shape Index (ABSI), Hip Index (HI) and the new Waist-to-Hip Index and compared these with traditional indices, using data from the UK Biobank Resource for 219,872 women and 186,825 men with white British ancestry and Bayesian linear mixed-models (BOLT-LMM). One to two thirds of the loci identified for allometric body-shape indices were novel. Most prominent was rs72959041 variant in RSPO3 gene, expressed in visceral adipose tissue and regulating adrenal cell renewal. Highly ranked were genes related to morphogenesis and organogenesis, previously additionally linked to cancer development and progression. Genetic associations were fewer in men compared to women. Prominent region-specific associations showed variants in loci VEGFA and HMGA1 for ABSI and KLF14 for HI in women, and C5orf67 and HOXC4/5 for ABSI and RSPO3, VEGFA and SLC30A10 for HI in men. Although more variants were associated with waist and hip circumference adjusted for BMI compared to ABSI and HI, associations with height had previously been reported for many of the additional variants, illustrating the importance of adjusting correctly for height.

Also flagged:Type 2 Diabetes MellitusTSTurner Syndromechromosomal disorderchromosomefollicle-stimulating hormone
Journal Article 2021-05-21 No Snippets Farooqui A, Alhazmi A, Haque S, Tamkeen N, Mehmankhah M, Tazyeen S, Ali S, Ishrat R.
Show Full Abstract

The information on the genotype-phenotype relationship in Turner Syndrome (TS) is inadequate because very few specific candidate genes are linked to its clinical features. We used the microarray data of TS to identify the key regulatory genes implicated with TS through a network approach. The causative factors of two common co-morbidities, Type 2 Diabetes Mellitus (T2DM) and Recurrent Miscarriages (RM), in the Turner population, are expected to be different from that of the general population. Through microarray analysis, we identified nine signature genes of T2DM and three signature genes of RM in TS. The power-law distribution analysis showed that the TS network carries scale-free hierarchical fractal attributes. Through local-community-paradigm (LCP) estimation we find that a strong LCP is also maintained which means that networks are dynamic and heterogeneous. We identified nine key regulators which serve as the backbone of the TS network. Furthermore, we recognized eight interologs functional in seven different organisms from lower to higher levels. Overall, these results offer few key regulators and essential genes that we envisage have potential as therapeutic targets for the TS in the future and the animal models studied here may prove useful in the validation of such targets.

Also flagged:GAPDHCancerphosphorylationTLOC1ZNF238Cell cycle phase
Journal Article 2021-05-21 ✓ 5 Snippets Guo M, Goudarzi KM, Abedi S, Pieber M, Sjöberg E, Behnan J, Zhang XM, Harris RA, Bartek J, Lindström MS, Nistér M, Hägerstrand D.
In-Text Gene Mentions

POU3F2

TRIM38

SERPINC1

ZNF664

PRDX6

Show Full Abstract

Intratumoral heterogeneity is a characteristic of glioblastomas that contain an intermixture of cell populations displaying different glioblastoma subtype gene expression signatures. Proportions of these populations change during tumor evolution, but the occurrence and regulation of glioblastoma subtype transition is not well described. To identify regulators of glioblastoma subtypes we utilized a combination of in vitro experiments and in silico analyses, using experimentally generated as well as publicly available data. Through this combined approach SOX2 was identified to confer a proneural glioblastoma subtype gene expression signature. SFRP2 was subsequently identified as a SOX2-antagonist, able to induce a mesenchymal glioblastoma subtype signature. A subset of patient glioblastoma samples with high SFRP2 and low SOX2 expression was particularly enriched with mesenchymal subtype samples. Phenotypically, SFRP2 decreased tumor sphere formation, stemness as assessed by limiting dilution assay, and overall cell proliferation but increased cell motility, whereas SOX2 induced the opposite effects. Furthermore, an SFRP2/non-canonical-WNT/KLF4/PDGFR/phospho-AKT/SOX2 signaling axis was found to be involved in the mesenchymal transition. Analysis of human tumor tissue spatial gene expression patterns showed distinct expression of SFRP2- and SOX2-correlated genes in vascular and cellular areas, respectively. Finally, conditioned media from SFRP2 overexpressing cells increased CD206 on macrophages. Together, these findings present SFRP2 as a SOX2-antagonist with the capacity to induce a mesenchymal subtype transition in glioma cells located in vascular tumor areas, highlighting its role in glioblastoma tumor evolution and intratumoral heterogeneity.

Also flagged:bone-related disordersextracellularvesiclescalciummineralhydroxyapatite
Journal Article 2021-05-21 No Snippets Samal S, Dash P, Dash M.
Show Full Abstract

The increasing incidence of bone-related disorders is causing a burden on the clinical scenario. Even though bone is one of the tissues that possess tremendous regenerative potential, certain bone anomalies need therapeutic intervention through appropriate delivery of a drug. Among several nanosystems and biologics that offer the potential to contribute towards bone healing, the exosomes from the class of extracellular vesicles are outstanding. Exosomes are extracellular nanovesicles that, apart from the various advantages, are standing out of the crowd for their ability to conduct cellular communication. The internal cargo of the exosomes is leading to its potential use in therapeutics. Exosomes are being unraveled in terms of the mechanism as well as application in targeting various diseases and tissues. Through this review, we have tried to understand and review all that is already established and the gap areas that still exist in utilizing them as drug delivery vehicles targeting the bone. The review highlights the potential of the exosomes towards their contribution to the drug delivery scenario in the bone microenvironment. A comparison of the pros and cons of exosomes with other prevalent drug delivery systems is also done. A section on the patents that have been generated so far from this field is included.

Also flagged:ExosomesHodgkin Lymphomaextracellularvesiclescancernodular sclerosis
Journal Article 2021-05-21 ✓ 1 Snippet Repetto O, Lovisa F, Elia C, Enderle D, Romanato F, Buffardi S, Sala A, Pillon M, Steffan A, Burnelli R, Mussolin L, Mascarin M, De Re V.
In-Text Gene Mentions

…protease C1 inhibitor,antithrombin-III, and chromogranin-A) have…

Show Full Abstract

Exosomes and other small extracellular vesicles (EVs) are potential sources of cancer biomarkers. Plasma-derived EVs have not yet been studied in pediatric Hodgkin lymphoma (HL), for which predictive biomarkers of relapse are greatly needed. In this two-part proteomic study, we used two-dimensional difference gel electrophoresis (2D-DIGE) followed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) to analyze EV proteins of plasma collected at diagnosis from children with nodular sclerosis HL, relapsed or not. EVs isolated using membrane affinity had radii ranging from 20 to 130 nm and contained the programmed cell death 6-interacting (ALIX) and the tumor susceptibility gene 101 (TSG101) proteins, whereas calnexin (CANX) was not detected. 2D-DIGE identified 16 spots as differentially abundant between non-relapsed and relapsed HL (|fold change| ≥ 1.5, <i>p</i> < 0.05). LC-MS/MS identified these spots as 11 unique proteins, including five more abundant in non-relapsed HL (e.g., complement C4b, C4B; fibrinogen γ chain, FGG) and six more abundant in relapsed HL (e.g., transthyretin, TTR). Shotgun LC-MS/MS on pooled EV proteins from non-relapsed HL identified 161 proteins, including 127 already identified in human exosomes (ExoCarta data). This EV cargo included 89 proteins not yet identified in exosomes from healthy plasma. Functional interrogation by the Database for Annotation, Visualization and Integrated Discovery (DAVID) revealed that the EV proteins participate in platelet degranulation and serine-type endopeptidase activity as the most significant Gene Ontology (GO) biological process and molecular function (<i>p</i> < 0.01).

Also flagged:Peptideseleniumbindingpeptidessurface antigeninfectious disease
Journal Article 2021-05-21 No Snippets Tran P, Kopel J, Fralick JA, Reid TW.
Show Full Abstract

This study examines the use of a covalently selenium-bonded peptide and phage that binds to the <i>Yersinia pestis</i> F1 antigen for the targeting and killing of <i>E. coli</i> expressing this surface antigen. Using a Ph.D.-12 phage-display library for affinity selection of the phage which would bind the F1 antigen of <i>Y. pestis</i>, a phage displaying a peptide that binds the F1 antigen with high affinity and specificity was identified. Selenium was then covalently attached to the display phage and the corresponding F1-antigen-binding peptide. Both the phage and peptides with selenium covalently attached retained their binding specificity for the <i>Y. pestis</i> F1 antigen. The phage or peptide not labeled with selenium did not kill the targeted bacteria, while the phage or peptide labeled with selenium did. In addition, the seleno-peptide, expressing the F1 targeting sequence only, killed cells expressing the F1 antigen but not the parent strain that did not express the F1 antigen. Specifically, the seleno-peptide could kill eight logs of bacteria in less than two hours at a 10-µM concentration. These results demonstrate a novel approach for the development of an antibacterial agent that can target a specific bacterial pathogen for destruction through the use of covalently attached selenium and will not affect other bacteria.

Also flagged:Kaurane-Type Diterpenesleishmaniasiskauranestetracyclic diterpenesPTR1cutaneous leishmaniasis
Journal Article 2021-05-21 No Snippets Herrera-Acevedo C, Flores-Gaspar A, Scotti L, Mendonça-Junior FJB, Scotti MT, Coy-Barrera E.
Show Full Abstract

The current treatments against <i>Leishmania</i> parasites present high toxicity and multiple side effects, which makes the control and elimination of leishmaniasis challenging. Natural products constitute an interesting and diverse chemical space for the identification of new antileishmanial drugs. To identify new drug options, an <i>in-house</i> database of 360 kauranes (tetracyclic diterpenes) was generated, and a combined ligand- and structure-based virtual screening (VS) approach was performed to select potential inhibitors of <i>Leishmania major</i> (<i>Lm</i>) pteridine reductase I (PTR1). The best-ranked kauranes were employed to verify the validity of the VS approach through <i>Lm</i>PTR1 enzyme inhibition assay. The half-maximal inhibitory concentration (IC<sub>50</sub>) values of selected bioactive compounds were examined using the random forest (RF) model (i.e., 2β-hydroxy-menth-6-en-5β-yl <i>ent</i>-kaurenoate (<b>135</b>) and 3α-cinnamoyloxy-<i>ent</i>-kaur-16-en-19-oic acid (<b>302</b>)) were below 10 μM. A compound similar to <b>302</b>, 3α-<i>p</i>-coumaroyloxy-<i>ent</i>-kaur-16-en-19-oic acid (<b>302a</b>), was also synthesized and showed the highest activity against <i>Lm</i>PTR1. Finally, molecular docking calculations and molecular dynamics simulations were performed for the VS-selected, most-active kauranes within the active sites of PTR1 hybrid models, generated from three <i>Leishmania</i> species that are known to cause cutaneous leishmaniasis in the new world (i.e., <i>L. braziliensis</i>, <i>L. panamensis,</i> and <i>L. amazonensis</i>) to explore the targeting potential of these kauranes to other species-dependent variants of this enzyme.

Also flagged:HeparinCopolymerLDHhypersensitivitydegradationbiochanin A
Journal Article 2021-05-21 No Snippets Adepu S, Luo H, Ramakrishna S.
Show Full Abstract

Drug-eluting stents have been widely implanted to prevent neointimal hyperplasia associated with bare metal stents. Conventional polymers and anti-proliferative drugs suffer from stent thrombosis due to the non-selective nature of the drugs and hypersensitivity to polymer degradation products. Alternatively, various herbal anti-proliferative agents are sought, of which biochanin A (an isoflavone phytoestrogen) was known to have anti-proliferative and vasculoprotective action. PLA-PEG diblock copolymer was tagged with heparin, whose degradation releases heparin locally and prevents thrombosis. To get a controlled drug release, biochanin A was loaded in layered double hydroxide nanoparticles (LDH), which are further encapsulated in a heparin-tagged PLA-PEG copolymer. LDH nanoparticles are synthesized by a co-precipitation process; in situ as well as ex situ loading of biochanin A were done. PLA-PEG-heparin copolymer was synthesized by esterification reaction, and the drug-loaded nanoparticles are coated. The formulation was characterized by FTIR, XRD, DSC, DLS, and TEM. In vitro drug release studies, protein adhesion, wettability, hemocompatibility, and degradation studies were performed. The drug release was modeled by mathematical models to further emphasize the mechanism of drug release. The developed drug-eluting stent coating is non-thrombogenic, and it offers close to zero-order release for 40 days, with complete polymer degradation in 14 weeks.

Also flagged:KDEL receptorendoplasmic reticulumlumencalciumKDEL receptorsIRE1
Journal Article 2021-05-21 ✓ 2 Snippets Wires ES, Trychta KA, Kennedy LM, Harvey BK.
In-Text Gene Mentions

A study demonstrated that misfolded proteins, such as huntington (Htt) in Huntington’s disease, superoxide dismutase 1 (SOD1) in ALS, and α-synuclein (a-syn) in Parkinson’s disease, were all shown to increase KDEL receptor expression, and the knock down of KDEL receptors led to increased levels of the disease-related proteins.

Likewise, studies investigating the IRE1 pathway in Huntington’s disease and ALS found that XBP1 deficiency was protective against neuron degeneration in their respective models, and also lead to an increase in autophagy dependent clearance of Htt and SOD-1 [46].

Show Full Abstract

The KDEL receptor retrieval pathway is essential for maintaining resident proteins in the endoplasmic reticulum (ER) lumen. ER resident proteins serve a variety of functions, including protein folding and maturation. Perturbations to the lumenal ER microenvironment, such as calcium depletion, can cause protein misfolding and activation of the unfolded protein response (UPR). Additionally, ER resident proteins are secreted from the cell by overwhelming the KDEL receptor retrieval pathway. Recent data show that KDEL receptors are also activated during the UPR through the IRE1/XBP1 signaling pathway as an adaptive response to cellular stress set forth to reduce the loss of ER resident proteins. This review will discuss the emerging connection between UPR activation and KDEL receptors as it pertains to ER proteostasis and disease states.

Also flagged:Colorectal Canceroxygencancerdeathrectal cancerhereditary colorectal cancer syndrome
Journal Article 2021-05-21 No Snippets Basnet U, Patil AR, Kulkarni A, Roy S.
Show Full Abstract

Every year, more than a million individuals are diagnosed with colorectal cancer (CRC) across the world. Certain lifestyle and genetic factors are known to drive the high incidence and mortality rates in some groups of individuals. The presence of enormous amounts of reactive oxygen species is implicated for the on-set and carcinogenesis, and oxidant scavengers are thought to be important in CRC therapy. In this review, we focus on the ethnicity-based CRC disparities in the U.S., the negative effects of oxidative stress and apoptosis, and gene regulation in CRC carcinogenesis. We also highlight the use of antioxidants for CRC treatment, along with screening for certain regulatory genetic elements and oxidative stress indicators as potential biomarkers to determine the CRC risk and progression.

Also flagged:Bone homeostasisbone remodelingembryogenesisossificationOsteoblast differentiationtranscription factor
Journal Article 2021-05-21 No Snippets Chan WCW, Tan Z, To MKT, Chan D.
Show Full Abstract

Bone is a dynamic tissue constantly responding to environmental changes such as nutritional and mechanical stress. Bone homeostasis in adult life is maintained through bone remodeling, a controlled and balanced process between bone-resorbing osteoclasts and bone-forming osteoblasts. Osteoblasts secrete matrix, with some being buried within the newly formed bone, and differentiate to osteocytes. During embryogenesis, bones are formed through intramembraneous or endochondral ossification. The former involves a direct differentiation of mesenchymal progenitor to osteoblasts, and the latter is through a cartilage template that is subsequently converted to bone. Advances in lineage tracing, cell sorting, and single-cell transcriptome studies have enabled new discoveries of gene regulation, and new populations of skeletal stem cells in multiple niches, including the cartilage growth plate, chondro-osseous junction, bone, and bone marrow, in embryonic development and postnatal life. Osteoblast differentiation is regulated by a master transcription factor RUNX2 and other factors such as OSX/SP7 and ATF4. Developmental and environmental cues affect the transcriptional activities of osteoblasts from lineage commitment to differentiation at multiple levels, fine-tuned with the involvement of co-factors, microRNAs, epigenetics, systemic factors, circadian rhythm, and the microenvironments. In this review, we will discuss these topics in relation to transcriptional controls in osteogenesis.

Also flagged:Hereditary Hyperferritinemia Cataract SyndromeFerritin LHereditary hyperferritinemia-cataract syndromeHHCScataractsiron
Journal Article 2021-05-21 ✓ 1 Snippet Celma Nos F, Hernández G, Ferrer-Cortès X, Hernandez-Rodriguez I, Navarro-Almenzar B, Fuster JL, Bermúdez Cortés M, Pérez-Montero S, Tornador C, Sanchez M.
In-Text Gene Mentions

…following nine genes:HFE, HFE2, HAMP, TFR2,…

Show Full Abstract

Hereditary hyperferritinemia-cataract syndrome (HHCS) is a rare disease characterized by high serum ferritin levels, congenital bilateral cataracts, and the absence of tissue iron overload. This disorder is produced by mutations in the iron responsive element (IRE) located in the 5' untranslated regions (UTR) of the light ferritin (<i>FTL</i>) gene. A canonical IRE is a mRNA structure that interacts with the iron regulatory proteins (IRP1 and IRP2) to post-transcriptionally regulate the expression of proteins related to iron metabolism. Ferritin L and H are the proteins responsible for iron storage and intracellular distribution. Mutations in the FTL IRE abrogate the interaction of FTL mRNA with the IRPs, and de-repress the expression of FTL protein. Subsequently, there is an overproduction of ferritin that accumulates in serum (hyperferritinemia) and excess ferritin precipitates in the lens, producing cataracts. To illustrate this disease, we report two new families affected with hereditary hyperferritinemia-cataract syndrome with previous known mutations. In the diagnosis of congenital bilateral cataracts, HHCS should be taken into consideration and, therefore, it is important to test serum ferritin levels in patients with cataracts.

Also flagged:GAPDHsynthesisDNA polymerasemeltgene expressionTPM
Journal Article 2021-05-21 No Snippets Zhang Y, Qian L, Liu Y, Liu Y, Yu W, Zhao Y.
Show Full Abstract

<b>Background:</b> Alzheimer's disease (AD) is a chronic progressive neurodegenerative disease. The characteristic pathologies include extracellular senile plaques formed by β-amyloid protein deposition, neurofibrillary tangles formed by hyperphosphorylation of tau protein, and neuronal loss with glial cell hyperplasia. Circular RNAs (circRNAs) are rich in miRNA-binding sites (miRNA response elements, MREs), which serve as miRNA sponges or competitive endogenous RNAs (ceRNAs). Although several research groups have identified dysregulated circRNAs in the cerebral cortex of SAMP8 mice or APP/PS1 mice using deep RNA-seq analysis, we need to further explore circRNA expression patterns, targets, functions and the signaling pathways involved in the pathogenesis of AD and in particular the hippocampal circRNA expression profiles in AD. <b>Methods:</b> We used deep RNA sequencing to investigate circRNA-ceRNA network patterns in the hippocampus of APP/PS1 mice. <b>Results:</b> In our study, 70 dysregulated circRNAs, 39 dysregulated miRNAs and 121 dysregulated mRNAs were identified between the APP/PS1 group and the wild-type group at 8 months in the hippocampus of the mice. Through correlation analysis, we identified 11 dysregulated circRNAs, 7 dysregulated miRNAs and 8 dysregulated mRNAs forming 16 relationships in the circRNA-miRNA-mRNA regulatory network. Gene ontology (GO) analysis indicated that the dysregulated circRNAs were most enriched in biological metabolic processes. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the dysregulation of circRNAs was enriched in the cGMP-PKG signaling pathway, cAMP signaling pathway, Hippo signaling pathway, platelet activation, long-term potentiation and axon guidance. In addition, our findings preliminarily verified that the novel_circ_0003012/mmu-miR-298-3p/Smoc2 signaling axis may regulate the pathophysiology of AD by affecting the cGMP-PKG signaling pathway. <b>Conclusions:</b> These newly identified circRNAs in networks and signaling pathways reveal potential diagnostic or therapeutic targets for AD.

Also flagged:IL-10TryptophanDTRInterleukin 10chlamydial infectionimmune response
Journal Article 2021-05-21 No Snippets Li Q, Li X, Quan H, Wang Y, Qu G, Shen Z, He C.
Show Full Abstract

<i>Chlamydia psittaci</i> (<i>C. psittaci</i>) is a common zoonotic agent that affects both poultry and humans. Interleukin 10 (IL-10) is an anti-inflammatory factor produced during chlamydial infection, while dendritic cells (DCs) are powerful antigen-presenting cells that induce a primary immune response in the host. However, IL-10 and DCs regulatory mechanisms in <i>C. psittaci</i> infection remain elusive. <i>In vivo</i> and <i>in vitro</i> investigations of the regulatory mechanisms were performed. IL-10<sup>-/-</sup> mice, conditional DCs depletion mice (zinc finger dendritic cell-diphtheria toxin receptor [zDC-DTR]), and double-deficient mice (DD, IL-10<sup>-/-</sup>/zDC<sup>DTR/DTR</sup>) were intranasally infected with <i>C. psittaci</i>. The results showed that more than 90% of IL-10<sup>-/-</sup> mice, 70% of wild-type mice, and 60% of double-deficient mice survived, whereas all zDC-DTR mice died. A higher lymphocyte proliferation index was found in the IL-10 inhibitor mice and IL-10<sup>-/-</sup> mice. Moreover, severe lesions and high bacterial loads were detected in the zDC-DTR mice compared with double-deficient mice. <i>In vitro</i> studies revealed increased OX40-OX40 ligand (OX40-OX40L) activation and CD4<sup>+</sup>T cell proliferation. Besides, the expression of indoleamine 2, 3-dioxygenase (IDO), and regulatory T cells were significantly reduced in the co-culture system of CD4<sup>+</sup> T cells and IL-10<sup>-/-</sup> DCs in <i>C. psittaci</i> infection. Additionally, the activation of the NLR family pyrin domain-containing 3 (NLRP3) inflammasome increased to facilitate the apoptosis of DCs, leading to rapid clearance of <i>C. psittaci</i>. Our study showed that IL-10<sup>-/-</sup> upregulated the function of deficient DCs by activating OX40-OX40L, T cells, and the NLPR3 inflammasome, and inhibiting IDO, and regulatory T cells. These effects enhanced the survival rate of mice and <i>C. psittaci</i> clearance. Our research highlights the mechanism of IL-10 interaction with DCs, OX40-OX40L, and the NLPR3 inflammasome, as potential targets against <i>C. psittaci</i> infection.

Also flagged:Allergic RhinitisCelladherens junctionsdesmosomeshemidesmosomespathogenesis
Journal Article 2021-05-21 No Snippets Nur Husna SM, Tan HT, Md Shukri N, Mohd Ashari NS, Wong KK.
Show Full Abstract

Allergic rhinitis (AR) is a common disorder affecting up to 40% of the population worldwide and it usually persists throughout life. Nasal epithelial barrier constitutes the first line of defense against invasion of harmful pathogens or aeroallergens. Cell junctions comprising of tight junctions (TJs), adherens junctions, desmosomes and hemidesmosomes form the nasal epithelial barrier. Impairment of TJ molecules plays causative roles in the pathogenesis of AR. In this review, we describe and discuss the components of TJs and their disruption leading to development of AR, as well as regulation of TJs expression by epigenetic changes, neuro-immune interaction, epithelial-derived cytokines (thymic stromal lymphopoietin, IL-25 and IL-33), T helper 2 (Th2) cytokines (IL-4, IL-5, IL-6 and IL-13) and innate lymphoid cells. These growing evidence support the development of novel therapeutic approaches to restore nasal epithelial TJs expression in AR patients.

Also flagged:Androgen ReceptorGliomaARglioblastomaGBMenzalutamide
Journal Article 2021-05-21 ✓ 1 Snippet Zhao N, Wang F, Ahmed S, Liu K, Zhang C, Cathcart SJ, DiMaio DJ, Punsoni M, Guan B, Zhou P, Wang S, Batra SK, Bronich T, Hei TK, Lin C, Zhang C.
In-Text Gene Mentions

CSC, cancer stem cell; PDCC, partially differentiated cancer cell; DCC, differentiated cancer cell.

Show Full Abstract

Targeting androgen receptor (AR) has been shown to be promising in treating glioblastoma (GBM) in cell culture and flank implant models but the mechanisms remain unclear. AR antagonists including enzalutamide are available for treating prostate cancer patients in clinic and can pass the blood-brain barrier, thus are potentially good candidates for GBM treatment but have not been tested in GBM orthotopically. Our current studies confirmed that in patients, a majority of GBM tumors overexpress AR in both genders. Enzalutamide inhibited the proliferation of GBM cells both <i>in vitro</i> and <i>in vivo</i>. Although confocal microscopy demonstrated that AR is expressed but not specifically in glioma cancer stem cells (CSCs) (CD133+), enzalutamide treatment significantly decreased CSC population in cultured monolayer cells and spheroids, suppressed tumor sphere-forming capacity of GBM cells, and downregulated CSC gene expression at mRNA and protein levels in a dose- and time-dependent manner. We have, for the first time, demonstrated that enzalutamide treatment decreased the density of CSCs <i>in vivo</i> and improved survival in an orthotopic GBM mouse model. We conclude that AR antagonists potently target glioma CSCs in addition to suppressing the overall proliferation of GBM cells as a mechanism supporting their repurposing for clinical applications treating GBM.

Also flagged:Interleukin-15atherosclerosisatherosclerotic plaquesIL-15non-alcoholic fatty liver diseaseNAFLD
Journal Article 2021-05-21 ✓ 1 Snippet Tarantino G, Citro V, Balsano C, Capone D.
In-Text Gene Mentions

…e.g., Wilson disease,hemochromatosis, or anti-trypsin deficiency,…

Show Full Abstract

Common carotid intima-media thickness (IMT) represents a functional and structural marker of early, precocious, and subclinical atherosclerosis, independently from the carotid plaque. Macrophage cells, which have been detected in adipose tissue and atherosclerotic plaques, are regulated by interleukin-15 (IL-15). At the light of the conflicting results concerning the role of IL-15 in atherosclerosis, the aim of the study was to retrospectively evaluate in a population of 80 obese patients, with median age of 46 years (IQR 34-53 years), with a low rate of comorbidities but with non-alcoholic fatty liver disease (NAFLD) or hepatic steatosis (HS), the relationship between IMT and serum concentrations of IL-15. Anthropometric measures, metabolic profile, and serum inflammatory markers, as well as the levels of IL-15, MCP-1, b FGF, and GM-CSF, were analyzed by a bead-based assay. IMT, HS, subcutaneous, and visceral adipose tissues were detected by ultrasonography. The IL-15 levels of the obese patients were increased with respect to those of 44 young healthy subjects, i.e., 2.77 (1.21-4.8) vs. 1.55 (1-2.4) pg/mL (<i>P</i> = 0.002). In the univariate analysis, IL-15 levels were associated to IMT and to those of MCP-1, b FGF, and GM-CSF, without any relation to other inflammatory markers such as CRP and ferritin, except fibrinogen. In the multivariate analysis, after adjusting the HS severity for the extent of visceral adiposity, a dramatic change in prediction of IMT by HS was shown (β from 0.29 to 0.10, <i>P</i> from 0.008 to 0.37). When the visceral adipose tissue was combined with IL-15, on the one hand, and the well-known coronary artery disease (CAD) risk factors-i.e., age, gender, smoking status, HDL-cholesterol concentrations, triglycerides levels, and HOMA-on the other, only age and IL-15 remained the predictors of IMT (β = 0.60, <i>P</i> = 0.0001 and β = 0.25, <i>P</i> = 0.024, respectively). There was no association of IL-15 with various anthropometric parameters nor with body fat distribution and severity of HS, also after adjusting for age. Age is resulted to be the main factor in the prediction of IMT and thus of early atherosclerosis. The prediction of IMT by IL-15 coupled with the lack of prediction by the well-known CAD risks is in agreement with recent data, which emphasizes the main role of the immune system in the onset/worsening of atherosclerosis, even though the role of visceral adiposity should be further deepened. Age and IL-15 levels were both predictors of early atherosclerosis in this population of obese patients with NAFLD, suggesting a possible role of this cytokine in the atherosclerosis process.

Also flagged:T1DMpeptidespathogenesistype 1 diabetes mellituspeptideinsulin
Journal Article 2021-05-21 ✓ 1 Snippet Zhang F, Zhou M, Li S, Gu J, Qian Y, He S, Hong L, Sun L, Zhang X, Ji W.
In-Text Gene Mentions

…lar ribonucleoprotein complex,histone acetyltransferase complexacetyltransferase complex, pig…

Show Full Abstract

Bioactive peptides attract growing concerns for their participation in multiple biological processes. Their roles in the pathogenesis of type 1 diabetes mellitus remain poorly understood. In this study, we used LC-MS/MS technology to compare the peptide profiling between pancreatic tissue of T1DM mice and pancreatic tissue of matched control groups. A total of 106 peptides were differentially expressed in T1DM pancreatic tissue, including 43 upregulated and 63 downregulated peptides. Most of the precursor proteins are insulin. Further bioinformatics analysis (GO and pathway analysis) indicated that the potential functions of these differential peptides were tightly related to regulation of endoplasmic reticulum stress. In conclusion, this study highlights new candidate peptides and provides a new perspective for exploring T1DM pathogenesis and clinical treatments.

Also flagged:programmed cell death protein 1PD-1cancerkinasestumorPuromycin
Journal Article 2021-05-21 ✓ 5 Snippets Peled M, Adam K, Mor A.
In-Text Gene Mentions

In the primary publication, we proposed that VRK2 is a unique therapeutic target and that combination of VRK2 inhibitors with PD-1 blockade may improve cancer immunotherapy.

In addition, we used VRK2 inhibition by a pharmacologic approach in the MC38 tumor mouse model, to show the combined outcome of anti PD-1 treatment with VRK2 inhibition.

Following these results, we assessed if pharmacologic inhibition of VRK2 in the MC38 syngeneic mouse tumor model could enhance T cell responses by targeting the PD-1 pathway and potentially augmenting T cell activation with PD-1 blockade (Fig. 2A).

To this end we used AZD-7762, an inhibitor of VRK2 and the checkpoint kinases (CHK1 and CHK2) [1].

…the identification ofVRK2as a mediator…

Show Full Abstract

Therapeutic programmed cell death protein 1 (PD-1) blockade enhances <i>T</i> cell mediated anti-tumor immunity, but many patients do not respond, and a significant proportion develops inflammatory toxicities. To develop better therapeutics and to understand the signaling pathways downstream of PD-1 we performed phosphoproteomic interrogation of PD-1 to identify key mediators of PD-1 signaling. Hereby, supporting data of the research article "VRK2 inhibition synergizes with PD-1 blockade to improve <i>T</i> cell responses" are presented. In the primary publication, we proposed that VRK2 is a unique therapeutic target and that combination of VRK2 inhibitors with PD-1 blockade may improve cancer immunotherapy. Here, we provide data on the effect of other kinases on PD-1 signaling utilizing shRNA knockdown of the different kinases in Jurkat <i>T</i> cells. In addition, we used VRK2 inhibition by a pharmacologic approach in the MC38 tumor mouse model, to show the combined outcome of anti PD-1 treatment with VRK2 inhibition. These data provide additional targets downstream PD-1 and point toward methods of testing the effect of the inhibition of these targets on tumor progression <i>in vivo</i>.

Also flagged:MucormycosisCOVID-19coronavirus disease 2019Diabetes mellitussteroidsdiabetic ketoacidosis
Journal Article 2021-05-21 ✓ 1 Snippet Singh AK, Singh R, Joshi SR, Misra A.
In-Text Gene Mentions

…iron overload orhemochromatosis, deferoxamine or desferrioxam…

Show Full Abstract

<h4>Background and aims</h4>There are increasing case reports of rhino-orbital mucormycosis in people with coronavirus disease 2019 (COVID-19), especially from India. Diabetes mellitus (DM) is an independent risk factor for both severe COVID-19 and mucormycosis. We aim to conduct a systematic review of literature to find out the patient's characteristics having mucormycosis and COVID-19.<h4>Methods</h4>We searched the electronic database of PubMed and Google Scholar from inception until May 13, 2021 using keywords. We retrieved all the granular details of case reports/series of patients with mucormycosis, and COVID-19 reported world-wide. Subsequently we analyzed the patient characteristics, associated comorbidities, location of mucormycosis, use of steroids and its outcome in people with COVID-19.<h4>Results</h4>Overall, 101 cases of mucormycosis in people with COVID-19 have been reported, of which 82 cases were from India and 19 from the rest of the world. Mucormycosis was predominantly seen in males (78.9%), both in people who were active (59.4%) or recovered (40.6%) from COVID-19. Pre-existing diabetes mellitus (DM) was present in 80% of cases, while concomitant diabetic ketoacidosis (DKA) was present in 14.9%. Corticosteroid intake for the treatment of COVID-19 was recorded in 76.3% of cases. Mucormycosis involving nose and sinuses (88.9%) was most common followed by rhino-orbital (56.7%). Mortality was noted in 30.7% of the cases.<h4>Conclusion</h4>An unholy trinity of diabetes, rampant use of corticosteroid in a background of COVID-19 appears to increase mucormycosis. All efforts should be made to maintain optimal glucose and only judicious use of corticosteroids in patients with COVID-19.

Also flagged:polycythemia verahereditary haemochromatosisHHirongenetic disordersdiabetes
Journal Article 2021-05-21 ✓ 2 Snippets van Bommel EJ, Kelder D, Hoeks MP, Herbers AH.
In-Text Gene Mentions

…mutations in theHFEgene, characterized by…

…PV patients) andHFEmutations [ 4…

Show Full Abstract

No abstract available.

bioRxiv 2021-05-21 Preprint (No Snippets API) Nolan LS, Chen J, Cláudia Gonçalves A, Bullen A, Steel KP, Dawson SJ, Gale JE.
Show Full Abstract

Cell cycle associated protein 1 (Caprin1) is an RNA-binding protein that can regulate the cellular post-transcriptional response to stress. It is a component of both stress granules and neuronal RNA granules and is implicated in neurodegenerative disease, synaptic plasticity and long-term memory formation. Our previous work suggested that Caprin1 also plays a role in the response of the cochlea to stress. Here, targeted inner ear-deletion of Caprin1 in mice leads to an early onset, progressive hearing loss. Auditory brainstem responses from Caprin1 -deficient mice show reduced thresholds, with a significant reduction in wave-I amplitudes compared to wildtype. Whilst hair cell structure and numbers were normal, the inner hair cell-spiral ganglion neuron (IHC-SGN) synapse revealed abnormally large post-synaptic GluA2 receptor puncta, a defect consistent with the observed wave-I reduction. Unlike wildtype mice, mild-noise-induced hearing threshold shifts in Caprin1 -deficient mice did not recover. Oxidative stress triggered TIA-1/HuR-positive stress granule formation in ex-vivo cochlear explants from Caprin1- deficient mice, showing that stress granules could still be induced. Taken together, these findings suggest that Caprin1 plays a key role in maintenance of auditory function, where it regulates the normal status of the IHC-SGN synapse.

Also flagged:ARDScoronavirus disease 2019COVID-19infectionclottingMac-1
Journal Article 2021-05-20 ✓ 1 Snippet Reyes L, A Sanchez-Garcia M, Morrison T, Howden AJM, Watts ER, Arienti S, Sadiku P, Coelho P, Mirchandani AS, Zhang A, Hope D, Clark SK, Singleton J, Johnston S, Grecian R, Poon A, McNamara S, Harper I, Fourman MH, Brenes AJ, Pathak S, Lloyd A, Blanco GR, von Kriegsheim A, Ghesquiere B, Vermaelen W, Cologna CT, Dhaliwal K, Hirani N, Dockrell DH, Whyte MKB, Griffith D, Cantrell DA, Walmsley SR.
In-Text Gene Mentions

…in NDN likeantithrombin-III( Figure 5A…

Show Full Abstract

<b>Background:</b> Acute respiratory distress syndrome (ARDS) is a severe critical condition with a high mortality that is currently in focus given that it is associated with mortality caused by coronavirus disease 2019 (COVID-19). Neutrophils play a key role in the lung injury characteristic of non-COVID-19 ARDS and there is also accumulating evidence of neutrophil mediated lung injury in patients who succumb to infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). <b>Methods:</b> We undertook a functional proteomic and metabolomic survey of circulating neutrophil populations, comparing patients with COVID-19 ARDS and non-COVID-19 ARDS to understand the molecular basis of neutrophil dysregulation. <b>Results:</b> Expansion of the circulating neutrophil compartment and the presence of activated low and normal density mature and immature neutrophil populations occurs in ARDS, irrespective of cause. Release of neutrophil granule proteins, neutrophil activation of the clotting cascade and upregulation of the Mac-1 platelet binding complex with formation of neutrophil platelet aggregates is exaggerated in COVID-19 ARDS. Importantly, activation of components of the neutrophil type I interferon responses is seen in ARDS following infection with SARS-CoV-2, with associated rewiring of neutrophil metabolism, and the upregulation of antigen processing and presentation. Whilst dexamethasone treatment constricts the immature low density neutrophil population, it does not impact upon prothrombotic hyperinflammatory neutrophil signatures. <b>Conclusions:</b> Given the crucial role of neutrophils in ARDS and the evidence of a disordered myeloid response observed in COVID-19 patients, this work maps the molecular basis for neutrophil reprogramming in the distinct clinical entities of COVID-19 and non-COVID-19 ARDS.

Also flagged:GScancerhereditary cancerPALB2breast cancerovarian cancer
Journal Article 2021-05-20 ✓ 1 Snippet Miller DT, Lee K, Chung WK, Gordon AS, Herman GE, Klein TE, Stewart DR, Amendola LM, Adelman K, Bale SJ, Gollob MH, Harrison SM, Hershberger RE, McKelvey K, Richards CS, Vlangos CN, Watson MS, Martin CL, ACMG Secondary Findings Working Group.
In-Text Gene Mentions

HFE

Show Full Abstract

No abstract available.

Also flagged:PALB2cancercardiovascular diseaseslipid disordershereditary cancer
Journal Article 2021-05-20 No Snippets Miller DT, Lee K, Gordon AS, Amendola LM, Adelman K, Bale SJ, Chung WK, Gollob MH, Harrison SM, Herman GE, Hershberger RE, Klein TE, McKelvey K, Richards CS, Vlangos CN, Stewart DR, Watson MS, Martin CL, ACMG Secondary Findings Working Group.
Show Full Abstract

No abstract available.

Also flagged:alanineseed germinationtranscription factorsSQUAMOSA PROMOTER BINDING PROTEIN-LIKESPLMYB
Journal Article 2021-05-20 No Snippets Bhogireddy S, Mangrauthia SK, Kumar R, Pandey AK, Singh S, Jain A, Budak H, Varshney RK, Kudapa H.
Show Full Abstract

Beyond the most crucial roles of RNA molecules as a messenger, ribosomal, and transfer RNAs, the regulatory role of many non-coding RNAs (ncRNAs) in plant biology has been recognized. ncRNAs act as riboregulators by recognizing specific nucleic acid targets through homologous sequence interactions to regulate plant growth, development, and stress responses. Regulatory ncRNAs, ranging from small to long ncRNAs (lncRNAs), exert their control over a vast array of biological processes. Based on the mode of biogenesis and their function, ncRNAs evolved into different forms that include microRNAs (miRNAs), small interfering RNAs (siRNAs), miRNA variants (isomiRs), lncRNAs, circular RNAs (circRNAs), and derived ncRNAs. This article explains the different classes of ncRNAs and their role in plant development and stress responses. Furthermore, the applications of regulatory ncRNAs in crop improvement, targeting agriculturally important traits, have been discussed.

Also flagged:HDCAPcytosineadenineguaninebrain disease
Journal Article 2021-05-20 ✓ 1 Snippet Abeyasinghe PM, Long JD, Razi A, Pustina D, Paulsen JS, Tabrizi SJ, Poudel GR, Georgiou-Karistianis N.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Potential therapeutic targets and clinical trials for Huntington's disease have grown immensely in the last decade. However, to improve clinical trial outcomes, there is a need to better characterize profiles of signs and symptoms across different epochs of the disease to improve selection of participants.<h4>Objective</h4>The objective of the present study was to best distinguish longitudinal trajectories across different Huntington's disease progression groups.<h4>Methods</h4>Clinical and morphometric imaging data from 1082 participants across IMAGE-HD, TRACK-HD, and PREDICT-HD studies were combined, with longitudinal times ranging between 1 and 10 years. Participants were classified into 4 groups using CAG and age product. Using multivariate linear mixed modeling, 63 combinations of markers were tested for their sensitivity in differentiating CAG and age product groups. Next, multivariate linear mixed modeling was applied to define the best combination of markers to track progression across individual CAG and age product groups.<h4>Results</h4>Putamen and caudate volumes, individually and/or combined, were identified as the best variables to both differentiate CAG and age product groups and track progression within them. The model using only caudate volume best described advanced disease progression in the combined data set. Contrary to expectations, combining clinical markers and volumetric measures did not improve tracking longitudinal progression.<h4>Conclusions</h4>Monitoring volumetric changes throughout a trial (alongside primary and secondary clinical end points) may provide a more comprehensive understanding of improvements in functional outcomes and help to improve the design of clinical trials. Alternatively, our results suggest that imaging deserves consideration as an end point in clinical trials because of the prospect of greater sensitivity. © 2021 International Parkinson and Movement Disorder Society.

Also flagged:dyneinautophagosomeAutophagyautophagosomesaxonaxons
Journal Article 2021-05-20 ✓ 5 Snippets Cason SE, Carman PJ, Van Duyne C, Goldsmith J, Dominguez R, Holzbaur ELF.
In-Text Gene Mentions

Deficits in neuronal autophagy are observed in most neurodegenerative diseases, and disease-causing mutations occur in proteins involved in autophagy, including PINK1 in Parkinson’s disease, TBK1 in amyotrophic lateral sclerosis, and Huntingtin (Htt) in Huntington’s disease (Wong and Holzbaur, 2015).

…sclerosis, and Huntingtin (Htt) in Huntington’s disease…

Httand its interacting…

…its interacting partner,Htt-associated protein 1protein 1 (HAP1),…

Httcan bind dynein,…

Show Full Abstract

Autophagy is a degradative pathway required to maintain homeostasis. Neuronal autophagosomes form constitutively at the axon terminal and mature via lysosomal fusion during dynein-mediated transport to the soma. How the dynein-autophagosome interaction is regulated is unknown. Here, we identify multiple dynein effectors on autophagosomes as they transit along the axons of primary neurons. In the distal axon, JIP1 initiates autophagosomal transport. Autophagosomes in the mid-axon require HAP1 and Huntingtin. We find that HAP1 is a dynein activator, binding the dynein-dynactin complex via canonical and noncanonical interactions. JIP3 is on most axonal autophagosomes, but specifically regulates the transport of mature autolysosomes. Inhibiting autophagosomal transport disrupts maturation, and inhibiting autophagosomal maturation perturbs the association and function of dynein effectors; thus, maturation and transport are tightly linked. These results reveal a novel maturation-based dynein effector handoff on neuronal autophagosomes that is key to motility, cargo degradation, and the maintenance of axonal health.

Also flagged:SAS4GAPDHbinalpha factorisnSAS
Journal Article 2021-05-20 ✓ 1 Snippet Boltengagen M, Samel-Pommerencke A, Fechtig D, Ehrenhofer-Murray AE.
In-Text Gene Mentions

…loss of thehistone deacetylase complexdeacetylase complex Rpd3L,…

Show Full Abstract

The acetylation of H4 lysine 16 (H4 K16Ac) in Saccharomyces cerevisiae counteracts the binding of the heterochromatin complex SIR to chromatin and inhibits gene silencing. Contrary to other histone acetylation marks, the H4 K16Ac level is high on genes with low transcription, whereas highly transcribed genes show low H4 K16Ac. Approximately 60% of cellular H4 K16Ac in S. cerevisiae is provided by the SAS-I complex, which consists of the MYST-family acetyltransferase Sas2, Sas4 and Sas5. The absence of SAS-I causes inappropriate spreading of the SIR complex and gene silencing in subtelomeric regions. Here, we investigated the genome-wide dynamics of SAS-I dependent H4 K16Ac during DNA replication. Replication is highly disruptive to chromatin and histone marks, since histones are removed to allow progression of the replication fork, and chromatin is reformed with old and new histones after fork passage. We found that H4 K16Ac appears in chromatin immediately upon replication. Importantly, this increase depends on the presence of functional SAS-I complex. Moreover, the appearance of H4 K16Ac is delayed in genes that are strongly transcribed. This indicates that transcription counteracts SAS-I-mediated H4 K16 acetylation, thus "sculpting" histone modification marks at the time of replication. We furthermore investigated which acetyltransferase acts redundantly with SAS-I to acetylate H4 K16Ac. esa1Δ sds3Δ cells, which were also sas2Δ sir3Δ in order to maintain viability, contained no detectable H4 K16Ac, showing that Esa1 and Sas2 are redundant for cellular H4 K16 acetylation. Furthermore, esa1Δ sds3Δ sas2Δ sir3Δ showed a more pronounced growth defect compared to the already defective esa1Δ sds3Δ sir3Δ. This indicates that SAS-I has cellular functions beyond preventing the spreading of heterochromatin.

Also flagged:Axin2Olig1Dkk4Aqp3TgfaHoxa1
Journal Article 2021-05-20 ✓ 4 Snippets Boyer A, Zhang X, Levasseur A, Abou Nader N, St-Jean G, Nagano MC, Boerboom D.
In-Text Gene Mentions

Cacna1e

Unc13c

…family member 6 (SHISA6) [ 21 ],…

SHISA6may therefore render…

Show Full Abstract

Spermatogenesis requires that a careful balance be maintained between the self-renewal of spermatogonial stem cells (SSCs) and their commitment to the developmental pathway through which they will differentiate into spermatozoa. Recently, a series of studies employing various in vivo and in vitro models have suggested a role of the wingless-related MMTV integration site gene family/beta-catenin (WNT/CTNNB1) pathway in determining the fate of SSCs. However, conflicting data have suggested that CTNNB1 signaling may either promote SSC self-renewal or differentiation. Here, we studied the effects of sustained CTNNB1 signaling in SSCs using the Ctnnb1tm1Mmt/+; Ddx4-CreTr/+ (ΔCtnnb1) mouse model, in which a stabilized form of CTNNB1 is expressed in all germ cells. ΔCtnnb1 mice were found to have reduced testis weights and partial germ cell loss by 4 months of age. Germ cell transplantation assays showed a 49% reduction in total functional SSC numbers in 8 month-old transgenic mice. In vitro, Thy1-positive undifferentiated spermatogonia from ΔCtnnb1 mice formed 57% fewer clusters, which was associated with decreased cell proliferation. A reduction in mRNA levels of genes associated with SSC maintenance (Bcl6b, Gfra1, Plzf) and increased levels for markers associated with progenitor and differentiating spermatogonia (Kit, Rarg, Sohlh1) were detected in these cluster cells. Furthermore, RNAseq performed on these clusters revealed a network of more than 900 genes regulated by CTNNB1, indicating that CTNNB1 is an important regulator of spermatogonial fate. Together, our data support the notion that CTNNB1 signaling promotes the transition of SSCs to undifferentiated progenitor spermatogonia at the expense of their self-renewal.

Also flagged:Thyroid cancer, medullaryThyroid Neoplasmsthyroid cancerdifferentiated thyroid cancerdifferentiated thyroid carcinomaABS
Journal Article 2021-05-20 No Snippets Maghsoomi Z, Emami Z, Malboosbaf R, Malek M, Khamseh ME.
Show Full Abstract

<h4>Background</h4>It has been shown that a subgroup of patients with differentiated thyroid cancer (DTC) and medullary thyroid carcinoma (MTC) would progress to advanced stages of thyroid cancer. Therefore, the present study was done to systematically review available evidence in order to investigate efficacy and safety of peptide receptor radionuclide therapy (PRRT) in the patients with advanced radioiodine refractory differentiated thyroid cancer (RR-DTC) and metastatic MTC.<h4>Methods</h4>For this purpose, relevant studies investigated safety and efficacy of PRRT in the patients with advanced RR-DTC and metastatic MTC were identified by searching Medline (Pubmed, Ovid, and Ebsco), Scopus, Embase, Web of Science, and Cochrane Library databases (from database inception to March 24, 2021). The review was performed according to the preferred reporting items for systematic reviews and meta-analyses (PRISMA) statement. Searching was done independently by two investigators. Two researchers independently extracted the data and any disagreement was adjudicated by consensus. Quality of the studies was assessed using the tool of case reports/series in systematic reviews.<h4>Results</h4>Among 2284 related papers, 41 papers met the inclusion criteria. A total of 157 patients with RR-DTC were treated with PPRT. Biochemical and objective responses (partial and complete) were observed in 25.3 and 10.5% of patients, respectively. Among 220 patients with metastatic MTC, biochemical and objective responses were observed in 37.2 and 10.6% of the patients, respectively. Forty-six deaths were reported in 95 patients with advanced RR-DTC. In addition, 63 deaths were observed in 144 patients with metastatic MTC. Major side effects were reported in 124 patients treated with <sup>90</sup>Y -based agent. In the patients treated with 177Lu-DOTA-TATE and 111In-Octreotide, mild and transient hematologic or renal complications were reported.<h4>Conclusion</h4>Findings of the study revealed that in the absence of the established treatment for the patients with RR-DTC and metastatic MTC, PRRT could be effective with few adverse events.<h4>Trial registration</h4>PROSPERO registration number: CRD42019125245 .

Also flagged:steroidhip joint diseasepathogenesisGene Expressionpolymerasestaphylococcus aureus infection
Journal Article 2021-05-20 ✓ 2 Snippets Lin T, Chen W, Yang P, Li Z, Wei Q, Liang D, Wang H, He W, Zhang Q.
In-Text Gene Mentions

…genes include MKRN1,FBXL4, GABARAPL2, MAP1LC3B, SIAH2,…

…MAPK1, AKT2, MKRN1,FBXL4, GABARAPL2, MAP1LC3B, SIAH2,…

Show Full Abstract

<h4>Background</h4>Steroid-induced osteonecrosis of the femoral head (ONFH) is a common hip joint disease and is difficult to be diagnosed early. At present, the pathogenesis of steroid-induced ONFH remains unclear, and recognized and effective diagnostic biomarkers are deficient. The present study aimed to identify potentially important genes and signaling pathways involved in steroid-induced ONFH and investigate their molecular mechanisms.<h4>Methods</h4>Microarray data sets GSE123568 (peripheral blood) and GSE74089 (cartilage) were obtained from the Gene Expression Omnibus database, including 34 ONFH samples and 14 control samples. Morpheus software and Venn diagram were used to identify DEGs and co-expressed DEGs, respectively. Besides, we conducted Kyoto Encyclopedia of Genome (KEGG) and gene ontology (GO) pathway enrichment analysis. We construct a protein-protein interaction (PPI) network through GEO2R and used cytoHubba to divide the PPI network into multiple sub-networks. Additionally, quantitative real-time polymerase chain reaction (qRT-PCR) was performed to verify the bioinformatics analysis results.<h4>Results</h4>A total of 118 intersecting DEGs were obtained between the peripheral blood and cartilage samples, including 40 upregulated genes and 78 downregulated genes. Then, GO and KEGG pathway enrichment analysis revealed that upregulated DEGs focused on the signaling pathways related to staphylococcus aureus infection, leishmaniasis, antigen processing, and presentation, as well as asthma and graft-versus-host disease. Downregulated genes were concentrated in the FoxO signaling pathway, AMPK signaling pathway, signaling pathway regulating stem cell pluripotency, and mTOR signaling pathway. Some hub genes with high interactions such as CXCR1, FPR1, MAPK1, FOXO3, FPR2, CXCR2, and TYROBP were identified in the PPI network. The results of qRT-PCR demonstrated that CXCR1, FPR1, and TYROBP were upregulated while MAPK1 was downregulated in peripheral blood of steroid-induced ONFH patients. This was consistent with the bioinformatics analysis.<h4>Conclusions</h4>The present study would provide novel insight into the genes and associated pathways involved in steroid-induced ONFH. CXCR1, FPR1, TYROBP, and MAPK1 may be used as potential drug targets and biomarkers for the diagnosis and prognosis of steroid-induced ONFH.

Also flagged:InsulinglucosediabetesbiosynthesisAutophagyorganelle
Journal Article 2021-05-20 No Snippets Pearson GL, Gingerich MA, Walker EM, Biden TJ, Soleimanpour SA.
Show Full Abstract

Insulin-producing pancreatic β-cells are central to glucose homeostasis, and their failure is a principal driver of diabetes development. To preserve optimal health β-cells must withstand both intrinsic and extrinsic stressors, ranging from inflammation to increased peripheral insulin demand, in addition to maintaining insulin biosynthesis and secretory machinery. Autophagy is increasingly being appreciated as a critical β-cell quality control system vital for glycemic control. Here we focus on the underappreciated, yet crucial, roles for selective and organelle-specific forms of autophagy as mediators of β-cell health. We examine the unique molecular players underlying each distinct form of autophagy in β-cells, including selective autophagy of mitochondria, insulin granules, lipid, intracellular amyloid aggregates, endoplasmic reticulum, and peroxisomes. We also describe how defects in selective autophagy pathways contribute to the development of diabetes. As all forms of autophagy are not the same, a refined view of β-cell selective autophagy may inform new approaches to defend against the various insults leading to β-cell failure in diabetes.

Also flagged:small cell carcinomasGAPDHTIRAPMYD88tumorsCHGA
Journal Article 2021-05-20 ✓ 5 Snippets Norton JP, Augert A, Eastwood E, Basom R, Rudin CM, MacPherson D.
In-Text Gene Mentions

POU3F2

Treatment of both JHU-LX108 and MSK-LX227C for 48 h with MLN4924 (100 nM) resulted in decreased protein levels of neuroendocrine regulators INSM1, ASCL1, FOXA2, and POU3F2 (Fig. 5A; Supplemental Fig. S5A).

Remarkably, suppression of an overlapping set of critical neuroendocrine regulators including INSM1, ASCL1, FOXA2, and POU3F2 was consistently observed in both the highly responsive SCLC and extrapulmonary small cell models.

Included in the genes down-regulated upon MLN4924 treatment (Fig. 4C) are key regulators of neuroendocrine differentiation: INSM1, ASCL1, FOXA2, and POU3F2. We were particularly interested in ASCL1 suppression upon neddylation inhibition given the requirement of mouse mSCLC for ASCL1 expression (Borromeo et al. 2016).

Maintenance of neuroendocrine differentiation can be essential for small cell carcinomas (Borromeo et al. 2016; Augert et al. 2019), and we found that MLN4924 treatment resulted in the suppression of expression of master regulators of neuroendocrine cell differentiation including INSM1, ASCL1, FOXA2, and POU3F2 in sensitive PDX models.

Show Full Abstract

Small cell lung carcinoma (SCLC) is among the most lethal of all solid tumor malignancies. In an effort to identify novel therapeutic approaches for this recalcitrant cancer type, we applied genome-scale CRISPR/Cas9 inactivation screens to cell lines that we derived from a murine model of SCLC. SCLC cells were particularly sensitive to the deletion of NEDD8 and other neddylation pathway genes. Genetic suppression or pharmacological inhibition of this pathway using MLN4924 caused cell death not only in mouse SCLC cell lines but also in patient-derived xenograft (PDX) models of pulmonary and extrapulmonary small cell carcinoma treated ex vivo or in vivo. A subset of PDX models were exceptionally sensitive to neddylation inhibition. Neddylation inhibition suppressed expression of major regulators of neuroendocrine cell state such as INSM1 and ASCL1, which a subset of SCLC rely upon for cell proliferation and survival. To identify potential mechanisms of resistance to neddylation inhibition, we performed a genome-scale CRISPR/Cas9 suppressor screen. Deletion of components of the COP9 signalosome strongly mitigated the effects of neddylation inhibition in small cell carcinoma, including the ability of MLN4924 to suppress neuroendocrine transcriptional program expression. This work identifies neddylation as a regulator of neuroendocrine cell state and potential therapeutic target for small cell carcinomas.

Also flagged:gestationInsulin-like growth factor Itype 1 ROPretinopathy of prematuritytype
Journal Article 2021-05-20 ✓ 1 Snippet Thomas D, Madathil S, Thukral A, Sankar MJ, Chandra P, Agarwal R, Deorari A.
In-Text Gene Mentions

…ROPScore in DetectingType 1 Retinopathy1 Retinopathy of…

Show Full Abstract

<h4>Background</h4>Algorithms for predicting retinopathy of prematurity (ROP) requiring treatment need to be validated in Indian settings to determine if the burden of screening can be reduced without compromising the sensitivity of existing gestation and weight-based cut offs.<h4>Objective</h4>To evaluate the performance of the available algorithms namely, WINROP (Weight, Insulin-like growth factor I, Neonatal ROP), CHOP-ROP (Children's Hospital of Philadelphia ROP) and ROPScore in predicting type 1 ROP and time from alarm to treatment by each algorithm.<h4>Study design</h4>Ambispective observational.<h4>Setting</h4>Tertiary care neonatal intensive care unit in India.<h4>Participants</h4>Neonates less than 32 weeks or less than 1500 g born between July, 2013 to June, 2019 (N=578), who underwent ROP screening.<h4>Primary outcome</h4>Sensitivity, specificity and time from alarm to treatment by each algorithm.<h4>Results</h4>The sensitivity and specificity of WINROP was 85% and 36%, for CHOP-ROP it was 54% and 71%, and for ROPScore it was 73% and 67%, respectively in detecting type 1 ROP. A total of 50/51 (98%) of neonates with type 1 ROP underwent treatment at median gestation of 9 weeks and median time from alarm to treatment by WINROP, CHOP-ROP and ROPScore was 7, 7 and 3 weeks, respectively.<h4>Conclusion</h4>WINROP, CHOP-ROP and ROPScore were not sensitive enough to replace the gestational age, weight and risk factor-based screening criteria for type 1 ROP.

Also flagged:cyclin-Oprotein 6protein 5lectindiacylglycerol kinase etaprotein 2
Journal Article 2021-05-20 ✓ 3 Snippets Tian Y, Hu Q, Zhang R, Zhou B, Xie D, Wang Y, Zhang X, Yang L.
In-Text Gene Mentions

Gpr52

…by RNA-seq analysis:GPR52and GPR35 (Supplementary…

GPR52is a Gs…

Show Full Abstract

The development of adjuvants has been an empirical process. Efforts to develop a new design and evaluation system for novel adjuvants are not only desirable but also necessary. Moreover, composite adjuvants that contain two or more types of adjuvants to synergistically enhance the immune response are important for adjuvant and vaccine design. Innate defense regulator peptides (IDRs) are promising adjuvants for clinical immunotherapy because they exhibit multifaceted immunomodulatory capabilities. However, the rational design and discovery of IDRs that have improved immunomodulatory activities have been hampered by the lack of screening techniques and the great challenges in the identification of their interaction partners. Here, we describe a screening and evaluation system for IDR design. On the basis of in vitro screening, the optimized IDR DP7 recruited neutrophils, monocytes and macrophages to the site of infection. The adjuvant, comprising the DP7 and CpG oligonucleotide (CpG), induced chemokine/cytokine expression, enhanced the antigen uptake by dendritic cells and upregulated surface marker expression in dendritic cells. Vaccination with the NY-ESO-1 or OVA antigens combined with the adjuvant alum/CpG/DP7 strongly suppressed tumor growth in mice which was due to the improvement of antigen-specific humoral and cellular immunity. Regarding the mechanism of action, GPR35 may be the potential interaction partner of DP7. Our study revealed the potential application of the screening and evaluation system as a strategy for rationally designing effective IDRs or composite adjuvants and identifying their mechanism of action.

Also flagged:cancermemorygene expressionPD-1Tumorren
Journal Article 2021-05-20 ✓ 2 Snippets Andreatta M, Corria-Osorio J, Müller S, Cubas R, Coukos G, Carmona SJ.
In-Text Gene Mentions

For example, Gzma, Gzmk, and Ccl5 were significantly more expressed in CD8_EM cells from most cancer types, both murine and human; Pdcd1, Havcr2, and Prf1, among other genes, identified CD8+ exhausted cells; Xcl1, Tnfsf4, and Tox, among others, marked precursor exhausted CD8+ T cells; Sell, Tcf7, Il7r, and Ccr7 were enriched in both CD4+ and CD8+ naive-like cells; Foxp3, Il2ra, Ctla4 and several other genes identified Tregs; Tox2 and Tbc1d4 were differentially expressed in Tfh; and Cd40lg, Anxa1 and Rora were enriched in T helper cells.

…cells; Xcl1 ,Tnfsf4, and Tox…

Show Full Abstract

Single-cell RNA sequencing (scRNA-seq) has revealed an unprecedented degree of immune cell diversity. However, consistent definition of cell subtypes and cell states across studies and diseases remains a major challenge. Here we generate reference T cell atlases for cancer and viral infection by multi-study integration, and develop ProjecTILs, an algorithm for reference atlas projection. In contrast to other methods, ProjecTILs allows not only accurate embedding of new scRNA-seq data into a reference without altering its structure, but also characterizing previously unknown cell states that "deviate" from the reference. ProjecTILs accurately predicts the effects of cell perturbations and identifies gene programs that are altered in different conditions and tissues. A meta-analysis of tumor-infiltrating T cells from several cohorts reveals a strong conservation of T cell subtypes between human and mouse, providing a consistent basis to describe T cell heterogeneity across studies, diseases, and species.

Also flagged:HRPELANECTSGPRTN3StreptavidinBeta-tubulin
Journal Article 2021-05-20 No Snippets Cheung P, Schaffert S, Chang SE, Dvorak M, Donato M, Macaubas C, Foecke MH, Li TM, Zhang L, Coan JP, Schulert GS, Grom AA, Henderson LA, Nigrovic PA, Elias JE, Gozani O, Mellins ED, Khatri P, Utz PJ, Kuo AJ.
Show Full Abstract

Chromatin undergoes extensive reprogramming during immune cell differentiation. Here we report the repression of controlled histone H3 amino terminus proteolytic cleavage (H3ΔN) during monocyte-to-macrophage development. This abundant histone mark in human peripheral blood monocytes is catalyzed by neutrophil serine proteases (NSPs) cathepsin G, neutrophil elastase and proteinase 3. NSPs are repressed as monocytes mature into macrophages. Integrative epigenomic analysis reveals widespread H3ΔN distribution across the genome in a monocytic cell line and primary monocytes, which becomes largely undetectable in fully differentiated macrophages. H3ΔN is enriched at permissive chromatin and actively transcribed genes. Simultaneous NSP depletion in monocytic cells results in H3ΔN loss and further increase in chromatin accessibility, which likely primes the chromatin for gene expression reprogramming. Importantly, H3ΔN is reduced in monocytes from patients with systemic juvenile idiopathic arthritis, an autoinflammatory disease with prominent macrophage involvement. Overall, we uncover an epigenetic mechanism that primes the chromatin to facilitate macrophage development.

Also flagged:chromatinneuropsychiatric disordersneurogenesisgene expressiontranscriptional activatorsneuropsychiatric disorder
Journal Article 2021-05-20 ✓ 1 Snippet Liang D, Elwell AL, Aygün N, Krupa O, Wolter JM, Kyere FA, Lafferty MJ, Cheek KE, Courtney KP, Yusupova M, Garrett ME, Ashley-Koch A, Crawford GE, Love MI, de la Torre-Ubieta L, Geschwind DH, Stein JL.
In-Text Gene Mentions

…the motif ofPOU3F2(also known as…

Show Full Abstract

Common genetic risk for neuropsychiatric disorders is enriched in regulatory elements active during cortical neurogenesis. However, it remains poorly understood as to how these variants influence gene regulation. To model the functional impact of common genetic variation on the noncoding genome during human cortical development, we performed the assay for transposase accessible chromatin using sequencing (ATAC-seq) and analyzed chromatin accessibility quantitative trait loci (QTL) in cultured human neural progenitor cells and their differentiated neuronal progeny from 87 donors. We identified significant genetic effects on 988/1,839 neuron/progenitor regulatory elements, with highly cell-type and temporally specific effects. A subset (roughly 30%) of chromatin accessibility-QTL were also associated with changes in gene expression. Motif-disrupting alleles of transcriptional activators generally led to decreases in chromatin accessibility, whereas motif-disrupting alleles of repressors led to increases in chromatin accessibility. By integrating cell-type-specific chromatin accessibility-QTL and brain-relevant genome-wide association data, we were able to fine-map and identify regulatory mechanisms underlying noncoding neuropsychiatric disorder risk loci.

Also flagged:cell cycleRNA-binding proteincancerRNA-binding protein Staufen1cell divisioncell proliferation
Journal Article 2021-05-20 ✓ 5 Snippets Bonnet-Magnaval F, DesGroseillers L.
In-Text Gene Mentions

The new tumorigenic equilibrium in STAU1-mediated gene regulation observed in cancer cells can be further altered by a slight increase in STAU1 expression that favours expression of pro-apoptotic genes and cell death.

Misregulation of STAU1 expression and/or functions changes the fragile balance in the expression of pro- and anti-proliferative and apoptotic genes and favours a novel equilibrium that supports cell proliferation and cancer development.

The STAU1-dependent cell cycle regulon is a good model to study how abnormal expression of an RNA-binding protein promotes cell growth and provides an advantageous selection of malignant cells in the first step of cancer development.

…RNA-binding protein Staufen1 (STAU1) to the control…

…In non-transformed cells,STAU1balances the expression…

Show Full Abstract

In recent years, an increasing number of reports have linked the RNA-binding protein Staufen1 (STAU1) to the control of cell decision making. In non-transformed cells, STAU1 balances the expression of messenger RNA (mRNA) regulons that regulate differentiation and well-ordered cell division. Misregulation of STAU1 expression and/or functions changes the fragile balance in the expression of pro- and anti-proliferative and apoptotic genes and favours a novel equilibrium that supports cell proliferation and cancer development. The misregulation of STAU1 functions causes multiple coordinated modest effects in the post-transcriptional regulation of many RNA targets that code for cell cycle regulators, leading to dramatic consequences at the cellular level. The new tumorigenic equilibrium in STAU1-mediated gene regulation observed in cancer cells can be further altered by a slight increase in STAU1 expression that favours expression of pro-apoptotic genes and cell death. The STAU1-dependent cell cycle regulon is a good model to study how abnormal expression of an RNA-binding protein promotes cell growth and provides an advantageous selection of malignant cells in the first step of cancer development.

Also flagged:organogenesistranscription factorsNRG1cellhomeobox transcription factorCDX2
Journal Article 2021-05-20 ✓ 5 Snippets Yu Q, Kilik U, Holloway EM, Tsai YH, Harmel C, Wu A, Wu JH, Czerwinski M, Childs CJ, He Z, Capeling MM, Huang S, Glass IA, Higgins PDR, Treutlein B, Spence JR, Camp JG.
In-Text Gene Mentions

…intestine, LGR5 andOLFM4( Barker et…

…stomach and intestine,OLFM4is highly enriched…

…(ISC; LGR5 +/OLFM4+) localized to…

…(c6, LGR5 +/OLFM4+), enterocyte precursors…

…features, such asOLFM4, CDX2 ,…

Show Full Abstract

Organs are composed of diverse cell types that traverse transient states during organogenesis. To interrogate this diversity during human development, we generate a single-cell transcriptome atlas from multiple developing endodermal organs of the respiratory and gastrointestinal tract. We illuminate cell states, transcription factors, and organ-specific epithelial stem cell and mesenchyme interactions across lineages. We implement the atlas as a high-dimensional search space to benchmark human pluripotent stem cell (hPSC)-derived intestinal organoids (HIOs) under multiple culture conditions. We show that HIOs recapitulate reference cell states and use HIOs to reconstruct the molecular dynamics of intestinal epithelium and mesenchyme emergence. We show that the mesenchyme-derived niche cue NRG1 enhances intestinal stem cell maturation in vitro and that the homeobox transcription factor CDX2 is required for regionalization of intestinal epithelium and mesenchyme in humans. This work combines cell atlases and organoid technologies to understand how human organ development is orchestrated.

Also flagged:hipcalchromosomessunguaninehow
Journal Article 2021-05-20 ✓ 5 Snippets Nagashima S, Maruyama J, Honda K, Kondoh Y, Osada H, Nawa M, Nakahama KI, Ishigami-Yuasa M, Kagechika H, Sugimura H, Iwasa H, Arimoto-Matsuzaki K, Nishina H, Hata Y.
In-Text Gene Mentions

High expression of CSE1L correlates with high expression of nuclear TAZ in human cancers

WWTR1 silencing attenuated CSE1L-promoted colony formation, motility, and invasiveness of human lung cancer and glioblastoma cells.

Conversely, CSE1L silencing blocked TAZ-promoted colony formation, motility, and invasiveness in human lung cancer and glioblastoma cells.

Finally, we wanted to know whether and how CSE1L expression correlates with TAZ expression in cancer patients.

High expression of CSE1L is associated with a poor prognosis in cancers and is considered to be a prognostic marker (14, 15, 16, 17).

Show Full Abstract

The transcriptional coactivator with PDZ-binding motif (TAZ) (WWTR1) induces epithelial-mesenchymal transition and enhances drug resistance in multiple cancers. TAZ has been shown to interact with transcription factors in the nucleus, but when phosphorylated, translocates to the cytoplasm and is degraded through proteasomes. Here, we identified a compound TAZ inhibitor 4 (TI-4) that shifted TAZ localization to the cytoplasm independently of its phosphorylation. We used affinity beads to ascertain a putative target of TI-4, chromosomal segregation 1 like (CSE1L), which is known to be involved in the recycling of importin α and as a biomarker of cancer malignancy. We found that TI-4 suppressed TAZ-mediated transcription in a CSE1L-dependent manner. CSE1L overexpression increased nuclear levels of TAZ, whereas CSE1L silencing delayed its nuclear import. We also found via the in vitro coimmunoprecipitation experiments that TI-4 strengthened the interaction between CSE1L and importin α5 and blocked the binding of importin α5 to TAZ. WWTR1 silencing attenuated CSE1L-promoted colony formation, motility, and invasiveness of human lung cancer and glioblastoma cells. Conversely, CSE1L silencing blocked TAZ-promoted colony formation, motility, and invasiveness in human lung cancer and glioblastoma cells. In human cancer tissues, the expression level of CSE1L was found to correlate with nuclear levels of TAZ. These findings support that CSE1L promotes the nuclear accumulation of TAZ and enhances malignancy in cancer cells.

Also flagged:Leucine zipper transcription factor-like 1LZTFL1intraflagellar transporter protein 27IFT27Intraflagellar transportIFT
Journal Article 2021-05-20 No Snippets Huang Q, Li W, Zhou Q, Awasthi P, Cazin C, Yap Y, Mladenovic-Lucas L, Hu B, Jeyasuria P, Zhang L, Granneman JG, Hess RA, Ray PF, Kherraf ZE, Natarajan V, Zhang Z.
Show Full Abstract

Intraflagellar transport (IFT) is an evolutionarily conserved mechanism essential for the assembly and maintenance of most eukaryotic cilia and flagella, including mammalian sperm tails. Depletion of IFT27, a component of the IFT complex, in male germ cells results in infertility associated with disrupted sperm flagella structure and motility. Leucine zipper transcription factor-like 1 (LZTFL1) is an IFT27 associated protein. LZTFL1, also known as BBS17, is a Bardet-Biedl syndrome (BBS) associated protein. Patients carrying biallelic variants of LZTFL1 gene exhibit the common BBS phenotypes. The global Lztfl1 knockout mice showed abnormal growth rate and retinal degeneration, typical of BBS phenotype. However, it is not clear if Lztfl1 has a role in male fertility. The LZTFL1 protein is highly and predominantly expressed in mouse testis. During the first wave of spermatogenesis, the protein is only expressed during spermiogenesis phase from the round spermatid stage and displays a cytoplasmic localization with a vesicular distribution pattern. At the elongated spermatid stage, LZTFL1 is present in the developing flagella and appears also close to the manchette. Fertility of Lztfl1 knockout mice was significantly reduced and associated with low sperm motility and a high level of abnormal sperm (astheno-teratozoospermia). In vitro assessment of fertility revealed reduced fertilization and embryonic development when using sperm from homozygous mutant mice. In addition, we observed a significant decrease of the testicular IFT27 protein level in Lztfl1 mutant mice contrasting with a stable expression levels of other IFT proteins, including IFT20, IFT81, IFT88 and IFT140. Overall, our results support strongly the important role of LZTFL1 in mouse spermatogenesis and male fertility.

Also flagged:ironBMPSMADSTAT3hereditary hemochromatosispeptide hormone
Journal Article 2021-05-20 ✓ 5 Snippets Moris W, Verhaegh PLM, Masclee AAM, Swinkels DW, Laarakkers CM, Koek GH, van Deursen CTBM.
In-Text Gene Mentions

…a proper functioningHFE, resulting in blockage…

…increase hepcidin inHFE‐hereditary hemochromatosis…

…1 InHFE‐hereditary hemochromatosis (H…

…hepcidin levels inHFE‐HH in times…

…homozygosity in theHFEgene, at the…

Show Full Abstract

We present a p.C282Y homozygous patient with high hepcidin levels and normal iron parameters during systemic inflammation. This suggests that in the absence of a proper functioning HFE, resulting in blockage of the BMP/SMAD pathway, the innate low hepcidin concentration can be upregulated by inflammation, probably via the JAK/STAT3 pathway.

Also flagged:Toll-like receptorTLRinflammatory responsesmitochondrialmetabolismacetyl
Journal Article 2021-05-20 No Snippets Timblin GA, Tharp KM, Ford B, Winchester JM, Wang J, Zhu S, Khan RI, Louie SK, Iavarone AT, Ten Hoeve J, Nomura DK, Stahl A, Saijo K.
Show Full Abstract

Macrophages generate mitochondrial reactive oxygen species and mitochondrial reactive electrophilic species as antimicrobials during Toll-like receptor (TLR)-dependent inflammatory responses. Whether mitochondrial stress caused by these molecules impacts macrophage function is unknown. Here, we demonstrate that both pharmacologically driven and lipopolysaccharide (LPS)-driven mitochondrial stress in macrophages triggers a stress response called mitohormesis. LPS-driven mitohormetic stress adaptations occur as macrophages transition from an LPS-responsive to LPS-tolerant state wherein stimulus-induced pro-inflammatory gene transcription is impaired, suggesting tolerance is a product of mitohormesis. Indeed, like LPS, hydroxyoestrogen-triggered mitohormesis suppresses mitochondrial oxidative metabolism and acetyl-CoA production needed for histone acetylation and pro-inflammatory gene transcription, and is sufficient to enforce an LPS-tolerant state. Thus, mitochondrial reactive oxygen species and mitochondrial reactive electrophilic species are TLR-dependent signalling molecules that trigger mitohormesis as a negative feedback mechanism to restrain inflammation via tolerance. Moreover, bypassing TLR signalling and pharmacologically triggering mitohormesis represents a new anti-inflammatory strategy that co-opts this stress response to impair epigenetic support of pro-inflammatory gene transcription by mitochondria.

Also flagged:Ferroptosisdeathironlipidmetabolismamino acids
Journal Article 2021-05-20 No Snippets Xu W, Deng H, Hu S, Zhang Y, Zheng L, Liu M, Chen Y, Wei J, Yang H, Lv X.
Show Full Abstract

Ferroptosis is a new type of programmed cell death characterized by intracellular iron accumulation and lipid peroxidation that leads to oxidative stress and cell death. The metabolism of iron, lipids, and amino acids and multiple signalling pathways precisely regulate the process of ferroptosis. Emerging evidence has demonstrated that ferroptosis participates in the occurrence and progression of various pathological conditions and diseases, such as infections, neurodegeneration, tissue ischaemia-reperfusion injury and immune diseases. Recent studies have also indicated that ferroptosis plays a critical role in the pathogenesis of acute lung injury, chronic obstructive pulmonary disease, pulmonary fibrosis, pulmonary infection and asthma. Herein, we summarize the latest knowledge on the regulatory mechanism of ferroptosis and its association with iron, lipid and amino acid metabolism as well as several signalling pathways. Furthermore, we review the contribution of ferroptosis to the pathogenesis of lung diseases and discuss ferroptosis as a novel therapeutic target for various lung diseases.

Also flagged:Colorectal cancerdeathcancertumorscolon cancerKRAS
Journal Article 2021-05-20 ✓ 1 Snippet Cerrito MG, Grassilli E.
In-Text Gene Mentions

…as APC, TP53,DCCand SMAD family…

Show Full Abstract

Colorectal cancer is the fourth cause of death from cancer worldwide, mainly due to the high incidence of drug-resistance toward classic chemotherapeutic and newly targeted drugs. In the last decade or so, the development of novel high-throughput approaches, both genome-wide and chemical, allowed the identification of novel actionable targets and the development of the relative specific inhibitors to be used either to re-sensitize drug-resistant tumors (in combination with chemotherapy) or to be synthetic lethal for tumors with specific oncogenic mutations. Finally, high-throughput screening using FDA-approved libraries of "known" drugs uncovered new therapeutic applications of drugs (used alone or in combination) that have been in the clinic for decades for treating non-cancerous diseases (re-positioning or re-purposing approach). Thus, several novel actionable targets have been identified and some of them are already being tested in clinical trials, indicating that high-throughput approaches, especially those involving drug re-positioning, may lead in a near future to significant improvement of the therapy for colon cancer patients, especially in the context of a personalized approach, i.e., in defined subgroups of patients whose tumors carry certain mutations.

Also flagged:vocalizationsFOXP2nucleus
Journal Article 2021-05-20 No Snippets Beccacece L, Abondio P, Cilli E, Restani D, Luiselli D.
Show Full Abstract

Music is an exclusive feature of humankind. It can be considered as a form of universal communication, only partly comparable to the vocalizations of songbirds. Many trends of research in this field try to address music origins, as well as the genetic bases of musicality. On one hand, several hypotheses have been made on the evolution of music and its role, but there is still debate, and comparative studies suggest a gradual evolution of some abilities underlying musicality in primates. On the other hand, genome-wide studies highlight several genes associated with musical aptitude, confirming a genetic basis for different musical skills which humans show. Moreover, some genes associated with musicality are involved also in singing and song learning in songbirds, suggesting a likely evolutionary convergence between humans and songbirds. This comprehensive review aims at presenting the concept of music as a sociocultural manifestation within the current debate about its biocultural origin and evolutionary function, in the context of the most recent discoveries related to the cross-species genetics of musical production and perception.

Also flagged:GlucosemembranesGlucose transportersGLUTsintegral membrane proteinsAD
Journal Article 2021-05-20 ✓ 3 Snippets Kyrtata N, Emsley HCA, Sparasci O, Parkes LM, Dickie BR.
In-Text Gene Mentions

…the role ofSLC2A14, the gene encoding…

…controls, showing thatSLC2A14polymorphisms appear to…

…GLUT14 demonstrate thatSLC2A14polymorphisms may increase…

Show Full Abstract

<b>Introduction:</b> Alzheimer's disease (AD) is characterized by cerebral glucose hypometabolism. Hypometabolism may be partly due to reduced glucose transport at the blood-brain barrier (BBB) and across astrocytic and neuronal cell membranes. Glucose transporters (GLUTs) are integral membrane proteins responsible for moving glucose from the bloodstream to parenchymal cells where it is metabolized, and evidence indicates vascular and non-vascular GLUTs are altered in AD brains, a process which could starve the brain of glucose and accelerate cognitive decline. Here we review the literature on glucose transport alterations in AD from human and rodent studies. <b>Methods:</b> Literature published between 1st January 1946 and 1st November 2020 within EMBASE and MEDLINE databases was searched for the terms "glucose transporters" AND "Alzheimer's disease". Human and rodent studies were included while reviews, letters, and <i>in-vitro</i> studies were excluded. <b>Results:</b> Forty-three studies fitting the inclusion criteria were identified, covering human (23 studies) and rodent (20 studies). Post-mortem studies showed consistent reductions in GLUT1 and GLUT3 in the hippocampus and cortex of AD brains, areas of the brain closely associated with AD pathology. Tracer studies in rodent models of AD and human AD also exhibit reduced uptake of glucose and glucose-analogs into the brain, supporting these findings. Longitudinal rodent studies clearly indicate that changes in GLUT1 and GLUT3 only occur after amyloid-β pathology is present, and several studies indicate amyloid-β itself may be responsible for GLUT changes. Furthermore, evidence from human and rodent studies suggest GLUT depletion has severe effects on brain function. A small number of studies show GLUT2 and GLUT12 are increased in AD. Anti-diabetic medications improved glucose transport capacity in AD subjects. <b>Conclusions:</b> GLUT1 and GLUT3 are reduced in hippocampal and cortical regions in patients and rodent models of AD, and may be caused by high levels of amyloid-β in these regions. GLUT3 reductions appear to precede the onset of clinical symptoms. GLUT2 and GLUT12 appear to increase and may have a compensatory role. Repurposing anti-diabetic drugs to modify glucose transport shows promising results in human studies of AD.

Also flagged:Huntington's diseaseHDbehaviouralcognitive impairmentcytosineadenine
Journal Article 2021-05-20 ✓ 2 Snippets Ghazaleh N, Houghton R, Palermo G, Schobel SA, Wijeratne PA, Long JD.
In-Text Gene Mentions

Huntington's disease (HD) is a rare, genetic, neurodegenerative disease caused by a cytosine adenine guanine (CAG) repeat expansion variant of the huntingtin gene (HTT) (1) and is characterised by a triad of cognitive, behavioural, and motor symptoms (2, 3).

…huntingtin gene (HTT) ( 1…

Show Full Abstract

Huntington's disease (HD) is characterised by a triad of cognitive, behavioural, and motor symptoms which lead to functional decline and loss of independence. With potential disease-modifying therapies in development, there is interest in accurately measuring HD progression and characterising prognostic variables to improve efficiency of clinical trials. Using the large, prospective Enroll-HD cohort, we investigated the relative contribution and ranking of potential prognostic variables in patients with manifest HD. A random forest regression model was trained to predict change of clinical outcomes based on the variables, which were ranked based on their contribution to the prediction. The highest-ranked variables included novel predictors of progression-being accompanied at clinical visit, cognitive impairment, age at diagnosis and tetrabenazine or antipsychotics use-in addition to established predictors, cytosine adenine guanine (CAG) repeat length and CAG-age product. The novel prognostic variables improved the ability of the model to predict clinical outcomes and may be candidates for statistical control in HD clinical studies.

Also flagged:gene expressionhatchingEDPHcell proliferationorganization
Journal Article 2021-05-20 ✓ 1 Snippet Ibrahim MMA, Nelson JR, Archer GS, Athrey G.
In-Text Gene Mentions

…, RBP4 ,SERPINC1, SFTPA1 ,…

Show Full Abstract

Lighting is a crucial environmental variable in poultry operations, but illumination during incubation is relatively understudied. The ability to stimulate development or immune performance using <i>in ovo</i> lighting is a promising approach for improving poultry health and welfare. This study investigated how monochromatic green light during incubation and vaccination method and timing affected chicken splenic gene expression patterns. We performed this study with 1,728 Hy-Line white layer eggs incubated under two light treatments during incubation: continuous dark and continuous green monochromatic light, over the entire incubation period. Half the eggs in each light treatment received <i>in ovo</i> vaccination, applied on embryonic day 18 (ED18). The remaining half were vaccinated by spraying on hatch day. After hatching, the light treatments followed the industry-standard lighting regimens. The study had six treatment groups with light-dark pairs for non-vaccinated, <i>in ovo</i> vaccinated, and post-hatch vaccinated. We assessed splenic gene expression at ED18 and at 7 days post-hatch (PH) in all the treatments. We isolated and sequenced 24 mRNA libraries on the Illumina platform, followed by bioinformatics and differential gene expression analyses. RNAseq analysis showed between 62 and 6,755 differentially expressed genes (DEGs) between comparisons, with the most prominent differences observed between ED and PH samples, followed by comparisons between vaccination methods. In contrast, light vs. dark treatments at ED showed limited effects on transcriptomic profiles. However, we observed a synergistic effect of lighting during incubation on post-hatch vaccination responses, with differentially expressed genes (DEGs) unique to the light treatment showing stimulation of cell proliferation with significance for immune activity (inferred from gene ontology terms). Gene ontology and pathway analysis indicated biological processes like cellular component organization or biogenesis, rhythmic process, developmental process, response to stimulus, and immune system processes were explained by the DEGs. While lighting is an important source of circadian stimulation, other controlled studies are required to clarify whether <i>in ovo</i> circadian entrainment plays a role in modulating immune responses.

Also flagged:HistoneCTCFmethylationmodificationschromatinbinding
Journal Article 2021-05-20 ✓ 1 Snippet Davenport KM, Massa AT, Bhattarai S, McKay SD, Mousel MR, Herndon MK, White SN, Cockett NE, Smith TPL, Murdoch BM, Ovine FAANG Project Consortium.
In-Text Gene Mentions

…(TAGL, Six2, RRTF1,Sox6, SVP, and TGA2).…

Show Full Abstract

The Ovine Functional Annotation of Animal Genomes (FAANG) project, part of the broader livestock species FAANG initiative, aims to identify and characterize gene regulatory elements in domestic sheep. Regulatory element annotation is essential for identifying genetic variants that affect health and production traits in this important agricultural species, as greater than 90% of variants underlying genetic effects are estimated to lie outside of transcribed regions. Histone modifications that distinguish active or repressed chromatin states, CTCF binding, and DNA methylation were used to characterize regulatory elements in liver, spleen, and cerebellum tissues from four yearling sheep. Chromatin immunoprecipitation with sequencing (ChIP-seq) was performed for H3K4me3, H3K27ac, H3K4me1, H3K27me3, and CTCF. Nine chromatin states including active promoters, active enhancers, poised enhancers, repressed enhancers, and insulators were characterized in each tissue using ChromHMM. Whole-genome bisulfite sequencing (WGBS) was performed to determine the complement of whole-genome DNA methylation with the ChIP-seq data. Hypermethylated and hypomethylated regions were identified across tissues, and these locations were compared with chromatin states to better distinguish and validate regulatory elements in these tissues. Interestingly, chromatin states with the poised enhancer mark H3K4me1 in the spleen and cerebellum and CTCF in the liver displayed the greatest number of hypermethylated sites. Not surprisingly, active enhancers in the liver and spleen, and promoters in the cerebellum, displayed the greatest number of hypomethylated sites. Overall, chromatin states defined by histone marks and CTCF occupied approximately 22% of the genome in all three tissues. Furthermore, the liver and spleen displayed in common the greatest percent of active promoter (65%) and active enhancer (81%) states, and the liver and cerebellum displayed in common the greatest percent of poised enhancer (53%), repressed enhancer (68%), hypermethylated sites (75%), and hypomethylated sites (73%). In addition, both known and <i>de novo</i> CTCF-binding motifs were identified in all three tissues, with the highest number of unique motifs identified in the cerebellum. In summary, this study has identified the regulatory regions of genes in three tissues that play key roles in defining health and economically important traits and has set the precedent for the characterization of regulatory elements in ovine tissues using the Rambouillet reference genome.

Also flagged:CancerTumorextracellular-cell communicationsolid tumors
Journal Article 2021-05-20 No Snippets Raskov H, Orhan A, Gaggar S, Gögenur I.
Show Full Abstract

Our understanding of the tumor microenvironment (TME), including the interplay between tumor cells, stromal cells, immune cells, and extracellular matrix components, is mandatory for the innovation of new therapeutic approaches in cancer. The cell-cell communication within the TME plays a pivotal role in the evolution and progression of cancer. Cancer-associated fibroblasts (CAF) and tumor-associated macrophages (TAM) are major cell populations in the stroma of all solid tumors and often exert protumorigenic functions; however, the origin and precise functions of CAF and TAM are still incompletely understood. CAF and TAM hold significant potential as therapeutic targets to improve outcomes in oncology when combined with existing therapies. The regulation of CAF/TAM communication and/or their differentiation could be of high impact for improving the future targeted treatment strategies. Nevertheless, there is much scope for research and innovation in this field with regards to the development of novel drugs. In this review, we elaborate on the current knowledge on CAF and TAM in cancer and cancer immunotherapy. Additionally, by focusing on their heterogenous functions in different stages and types of cancer, we explore their role as potential therapeutic targets and highlight certain aspects of their functions that need further research.

Also flagged:metabolismorganizationlumenmicrovillimucuscell
Journal Article 2021-05-20 ✓ 1 Snippet Bonis V, Rossell C, Gehart H.
In-Text Gene Mentions

…as LGR5 andOLFM4, despite continuing prolifera…

Show Full Abstract

The single-layered, simple epithelium of the gastro-intestinal tract controls nutrient uptake, coordinates our metabolism and shields us from pathogens. Despite its seemingly simple architecture, the intestinal lining consists of highly distinct cell populations that are continuously renewed by the same stem cell population. The need to maintain balanced diversity of cell types in an unceasingly regenerating tissue demands intricate mechanisms of spatial or temporal cell fate control. Recent advances in single-cell sequencing, spatio-temporal profiling and organoid technology have shed new light on the intricate micro-structure of the intestinal epithelium and on the mechanisms that maintain it. This led to the discovery of unexpected plasticity, zonation along the crypt-villus axis and new mechanism of self-organization. However, not only the epithelium, but also the underlying mesenchyme is distinctly structured. Several new studies have explored the intestinal stroma with single cell resolution and unveiled important interactions with the epithelium that are crucial for intestinal function and regeneration. In this review, we will discuss these recent findings and highlight the technologies that lead to their discovery. We will examine strengths and limitations of each approach and consider the wider impact of these results on our understanding of the intestine in health and disease.

Also flagged:osteomalaciaspondyloarthritisankylosing spondylitisASAlkaline phosphataseALP
Journal Article 2021-05-20 No Snippets Zhao Z, Chen W, Wang Y, Jin J, Zhao Y, Zhu J, Huang F.
Show Full Abstract

<b>Aim:</b> To compare the clinical and radiological characteristics of osteomalacia and spondyloarthritis/ankylosing spondylitis (SpA/AS) in order to provide a basis for differential diagnosis. <b>Methods:</b> We carried out a retrospective analysis of patients who were diagnosed with osteomalacia at the First Medical Center of 301 Hospital (Beijing, China) from January 2012 to January 2019. The clinical and radiological data of all patients were collected; at the same time, we selected age- and gender-matched patients with SpA/AS for comparison. <b>Results:</b> We enrolled a total of 76 patients, 38 with osteomalacia, and 38 with SpA/AS. The mean ages of the two groups were, respectively 44.62 ± 14.90 years and 44.85 ± 9.76 years (<i>P</i> > 0.05). Of patients with osteomalacia, 65.79% (<i>n</i> = 25) had previously been misdiagnosed with SpA/AS. In the osteomalacia and SpA/AS groups, there were, respectively 31 and 33 patients with low back pain, 22 and 13 patients with peripheral arthralgia, and 13 and 3 patients with heel pain. Alkaline phosphatase (ALP) level was significantly higher in the osteomalacia than in the SpA/AS group (<i>P</i> < 0.05). Serum phosphorus levels, erythrocyte sedimentation rate (ESR), C-reactive protein (CRP) levels, and bone mineral density (BMD) were significantly lower in the osteomalacia group than the SpA/AS group (<i>P</i> < 0.05). Twenty-five patients in the osteomalacia group underwent sacroiliac-joint magnetic-resonance imaging (SIJ-MRI); abnormalities were found in 10 of these patients, seven of whom met the definition for positive SIJ-MRI according to 2009 Assessment of SpondyloArthritis international Society (ASAS) criteria. All seven presented with bilateral sacral involvement. Logistic-regression analysis found that the odds ratio (OR) for bone erosion score was 0.551; the higher this score, the lower the possibility of osteomalacia. <b>Conclusion:</b> Clinical and radiological presentations of patients with osteomalacia could highly simulate those of patients with spondyloarthritis; identifying the differences between these two diseases could effectively decrease the misdiagnosis rate.

Also flagged:Hepatocellular carcinomaLINC01134RHPN1MKLN1MAPKAPK5cancer
Journal Article 2021-05-20 ✓ 1 Snippet Feng Y, Hu X, Ma K, Zhang B, Sun C.
In-Text Gene Mentions

…cycle, DNA replication,histone acetyltransferase complexacetyltransferase complex, fat…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a common malignancy with a poor prognosis. Therefore, there is an urgent call for the investigation of novel biomarkers in HCC. In the present study, we identified 6 upregulated lncRNAs in HCC, including LINC01134, RHPN1-AS1, NRAV, CMB9-22P13.1, MKLN1-AS, and MAPKAPK5-AS1. Higher expression of these lncRNAs was correlated to a more advanced cancer stage and a poorer prognosis in HCC patients. Enrichment analysis revealed that these lncRNAs played a crucial role in HCC progression, possibly through a series of cancer-related biological processes, such as cell cycle, DNA replication, histone acetyltransferase complex, fatty acid oxidation, and lipid modification. Moreover, competing endogenous RNA (ceRNA) network analysis revealed that these lncRNAs could bind to certain miRNAs to promote HCC progression. Loss-of-function assays indicated that silencing of RHPN1-AS1 significantly suppressed HCC proliferation and migration. Though further validations are still needed, these identified lncRNAs could serve as valuable potential biomarkers for HCC prognosis.

Also flagged:neurodegenerative diseasespolypeptidesdegradationAlzheimer's diseaseParkinson's diseaseamyotrophic lateral sclerosis
Journal Article 2021-05-20 ✓ 3 Snippets Bai Y, Wan W, Huang Y, Jin W, Lyu H, Xia Q, Dong X, Gao Z, Liu Y.
In-Text Gene Mentions

In HEK293T cells transiently expressing Htt-97Q-SNAP whose aggregation leads to Huntington's disease,90,91 CCVJ-SNAP probe detected perinuclear puncta (Fig. 7c, 488 nm channel).

Visualization of protein co-aggregation in live cells. (a) Experiment scheme and potential outcomes. (b) Structures of Mero-Halo and CCVJ-SNAP probes. (c) CCVJ detected the aggregation of Htt-97Q-SNAP protein in live cells. (d) Mero detected the aggregation of SOD1(G85R)-Halo upon inhibition of proteosome by MG132. (e) Htt-97Q-SNAP co-aggregated with SOD1(G85R)-Halo even without MG132 inhibition. Green: CCVJ fluorescence, 488 nm channel. Red: Mero fluorescence, 543 nm channel.

…cells transiently expressingHtt-97Q-SNAP whose aggregation le…

Show Full Abstract

Co-aggregation of multiple pathogenic proteins is common in neurodegenerative diseases but deconvolution of such biochemical process is challenging. Herein, we developed a dual-color fluorogenic thermal shift assay to simultaneously report on the aggregation of two different proteins and quantitatively study their thermodynamic stability during co-aggregation. Expansion of spectral coverage was first achieved by developing multi-color fluorogenic protein aggregation sensors. Orthogonal detection was enabled by conjugating sensors of minimal fluorescence crosstalk to two different proteins <i>via</i> sortase-tag technology. Using this assay, we quantified shifts in melting temperatures in a heterozygous model protein system, revealing that the thermodynamic stability of wild-type proteins was significantly compromised by the mutant ones but not <i>vice versa</i>. We also examined how small molecule ligands selectively and differentially interfere with such interplay. Finally, we demonstrated these sensors are suited to visualize how different proteins exert influence on each other upon their co-aggregation in live cells.

Also flagged:intellectual disabilitiesperiventricularheterotopiacorpus callosumcystscerebellar malformation
Journal Article 2021-05-20 ✓ 1 Snippet Lu YT, Hsu CY, Liu YT, Chan CK, Chuang YC, Lin CH, Chang KP, Ho CJ, Ng CC, Lim KS, Tsai MH.
In-Text Gene Mentions

…NEDD4L, ACTG1, andARFGEF2have been recently…

Show Full Abstract

<h4>Background</h4>Periventricular nodular heterotopia (PVNH) is caused by abnormal neuronal migration, resulting in the neurons accumulate as nodules along the surface of the lateral ventricles. PVNH often cause epilepsy, psychomotor development or cognition problem. Mutations in FLNA (Filamin A) is the most common underlying genetic etiology. Our purpose is to delineate the clinical and imaging spectrum that differentiates FLNA-positive and FLNA-negative PVNH patients.<h4>Methods</h4>We included 21 patients with confirmed PVNH. The detailed clinical information, electroencephalography, and other clinical findings were recorded. Detailed brain MR imaging was assessed. Mutation analysis of the FLNA gene was used Sanger sequencing or a next generation sequencing based assay.<h4>Results</h4>FLNA mutations were identified in 9 patients (7 females and 2 males), including two nonsense, two splice site, three frameshift, and two missense mutations. In FLNA-positive group, 8 patients had anterior predominant bilateral symmetric presentation and only one had asymmetrical distribution and dilated ventricles. Extra-cerebral features were more often observed in FLNA-positive group than FLNA-negative group.<h4>Conclusion</h4>Genetics of PVNH is heterogenous, and mutations in FLNA gene account for less than half of the patients in our cohort. Our finding between FLNA-positive and FLNA-negative patients could guide the clinicians to select relevant genetic testing.

bioRxiv 2021-05-20 Preprint (No Snippets API) Beumer J, Geurts MH, Lamers MM, Puschhof J, Zhang J, van der Vaart J, Mykytyn AZ, Breugem TI, Riesebosch S, Schipper D, van den Doel PB, Lau Wd, Pleguezuelos-Manzano C, Busslinger G, Haagmans BL, Clevers H.
Show Full Abstract

Rapid identification of host genes essential for virus replication may expedite the generation of therapeutic interventions. Genetic screens are often performed in transformed cell lines that poorly represent viral target cells in vivo, leading to discoveries that may not be translated to the clinic. Intestinal organoids (IOs) are increasingly used to model human disease and are amenable to genetic engineering. To discern which host factors are reliable anti-coronavirus therapeutic targets, we generate mutant clonal IOs for 19 host genes previously implicated in coronavirus biology. We verify ACE2 and DPP4 as entry receptors for SARS-CoV/SARS-CoV-2 and MERS-CoV respectively. SARS-CoV-2 replication in IOs does not require the endosomal Cathepsin B/L proteases, but specifically depends on the cell surface protease TMPRSS2. Other TMPRSS family members were not essential. The newly emerging coronavirus variant B.1.1.7, as well as SARS-CoV and MERS-CoV similarly depended on TMPRSS2. These findings underscore the relevance of non-transformed human models for coronavirus research, identify TMPRSS2 as an attractive pan-coronavirus therapeutic target, and demonstrate that an organoid knockout biobank is a valuable tool to investigate the biology of current and future emerging coronaviruses.

Also flagged:Hydrogenanionhalogenferroceneferroceniumwater
Journal Article 2021-05-19 No Snippets Patrick SC, Hein R, Docker A, Beer PD, Davis JJ.
Show Full Abstract

Sensing anionic species in competitive aqueous media is a well-recognised challenge to long-term applications across a multitude of fields. Herein, we report a comprehensive investigation of the electrochemical anion sensing performance of novel halogen bonding (XB) and hydrogen bonding (HB) bis-ferrocene-(iodo)triazole receptors in solution and at self-assembled monolayers (SAMs), in a range of increasingly competitive aqueous organic solvent media (ACN/H<sub>2</sub> O). In solution, the XB sensor notably outperforms the HB sensor, with substantial anion recognition induced cathodic voltammetric responses of the ferrocene/ferrocenium redox couple persisting even in highly competitive aqueous solvent media of 20 % water content. The response to halides, in particular, shows a markedly lower sensitivity to increasing water content associated with a unique halide selectivity at unprecedented levels of solvent polarity. The HB sensor, in contrast, generally displayed a preference towards oxoanions. A significant surface-enhancement effect was observed for both XB/HB receptive films in all solvent systems, whereby the HB sensor generally displayed larger responses towards oxoanions than its halogen bonding analogue.

Also flagged:lung cancermethylationHOXA3HOXA4RUNX3BRICD5
Journal Article 2021-05-19 No Snippets Zhao N, Ruan M, Koestler DC, Lu J, Marsit CJ, Kelsey KT, Platz EA, Michaud DS.
Show Full Abstract

<h4>Background</h4>DNA methylation markers have been associated with lung cancer risk and may identify aetiologically relevant genomic regions, or alternatively, be markers of disease risk factors or biological processes associated with disease development.<h4>Methods</h4>In a nested case-control study, we measured blood leukocyte DNA methylation levels in pre-diagnostic samples collected from 430 participants (208 cases; 222 controls) in the 1989 CLUE II cohort. We compared DNA methylation levels with case/control status to identify novel genomic regions, both single CpG sites and differentially methylated regions (DMRs), while controlling for known DNA methylation changes associated with smoking using a previously described pack-years-based smoking methylation score. Stratification analyses were conducted over time from blood draw to diagnosis, histology, and smoking status.<h4>Results</h4>We identified 16 single CpG sites and 40 DMRs significantly associated with lung cancer risk (q < 0.05). The identified genomic regions were associated with genes including H19, HOXA3/HOXA4, RUNX3, BRICD5, PLXNB2, and RP13. For the single CpG sites, the strongest association was noted for cg09736286 in the DIABLO gene (OR [for 1 SD] = 2.99, 95% CI: 1.95-4.59, P-value = 4.81 × 10-7). We found that CpG sites in the HOXA3/HOXA4 region were hypermethylated in cases compared to controls.<h4>Conclusion</h4>The single CpG sites and DMRs that we identified represented significant measurable differences in lung cancer risk, providing potential biomarkers for lung cancer risk stratification. Future studies will need to examine whether these regions are causally related to lung cancer.

Also flagged:NOTCH4KCNU1SRCSGPP2RAF1PFKFB2
Journal Article 2021-05-19 No Snippets Fuemmeler BF, Dozmorov MG, Do EK, Zhang JJ, Grenier C, Huang Z, Maguire RL, Kollins SH, Hoyo C, Murphy SK.
Show Full Abstract

<h4>Background</h4>Maternal smoking during pregnancy is related to altered DNA methylation in infant umbilical cord blood. The extent to which low levels of smoke exposure among nonsmoking pregnant women relates to offspring DNA methylation is unknown.<h4>Objective</h4>This study sought to evaluate relationships between maternal prenatal plasma cotinine levels and DNA methylation in umbilical cord blood in newborns using the Infinium HumanMethylation 450K BeadChip.<h4>Methods</h4>Participants from the Newborn Epigenetics Study cohort who reported not smoking during pregnancy had verified low levels of cotinine from maternal prenatal plasma (0 ng/mL to <4 ng/mL), and offspring epigenetic data from umbilical cord blood were included in this study (n=79). Multivariable linear regression models were fit to the data, controlling for cell proportions, age, race, education, and parity. Estimates represent changes in response to any 1-ng/mL unit increase in exposure.<h4>Results</h4>Multivariable linear regression models yielded 29,049 CpGs that were differentially methylated in relation to increases in cotinine at a 5% false discovery rate. Top CpGs were within or near genes involved in neuronal functioning (<i>PRKG1</i>, <i>DLGAP2</i>, <i>BSG</i>), carcinogenesis (<i>FHIT</i>, <i>HSPC157</i>) and inflammation (<i>AGER</i>). Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses suggest cotinine was related to methylation of gene pathways controlling neuronal signaling, metabolic regulation, cell signaling and regulation, and cancer. Further, enhancers associated with transcription start sites were enriched in altered CpGs. Using an independent sample from the same study population (n=115), bisulfite pyrosequencing was performed with infant cord blood DNA for two genes within our top 20 hits (<i>AGER</i> and <i>PRKG1</i>). Results from pyrosequencing replicated epigenome results for <i>PRKG1</i> (cg17079497, estimate=-1.09, standard error (SE)=0.45, p=0.018) but not for AGER (cg09199225; estimate=-0.16, SE=0.21, p=0.44).<h4>Discussion</h4>Secondhand smoke exposure among nonsmoking women may alter DNA methylation in regions involved in development, carcinogenesis, and neuronal functioning. These novel findings suggest that even low levels of smoke exposure during pregnancy may be sufficient to alter DNA methylation in distinct sites of mixed umbilical cord blood leukocytes in pathways that are known to be altered in cord blood from pregnant active smokers. https://doi.org/10.1289/EHP8099.

Also flagged:cancercentriolesGAPDHdinucleotidesdelta90th
Journal Article 2021-05-19 No Snippets de Wolf B, Oghabian A, Akinyi MV, Hanks S, Tromer EC, van Hooff JJE, van Voorthuijsen L, van Rooijen LE, Verbeeren J, Uijttewaal ECH, Baltissen MPA, Yost S, Piloquet P, Vermeulen M, Snel B, Isidor B, Rahman N, Frilander MJ, Kops GJPL.
Show Full Abstract

Aneuploidy is the leading cause of miscarriage and congenital birth defects, and a hallmark of cancer. Despite this strong association with human disease, the genetic causes of aneuploidy remain largely unknown. Through exome sequencing of patients with constitutional mosaic aneuploidy, we identified biallelic truncating mutations in CENATAC (CCDC84). We show that CENATAC is a novel component of the minor (U12-dependent) spliceosome that promotes splicing of a specific, rare minor intron subtype. This subtype is characterized by AT-AN splice sites and relatively high basal levels of intron retention. CENATAC depletion or expression of disease mutants resulted in excessive retention of AT-AN minor introns in ˜ 100 genes enriched for nucleocytoplasmic transport and cell cycle regulators, and caused chromosome segregation errors. Our findings reveal selectivity in minor intron splicing and suggest a link between minor spliceosome defects and constitutional aneuploidy in humans.

Also flagged:COVID-19D-dimerLDHdiabetesthrombosisdeath
Journal Article 2021-05-19 ✓ 1 Snippet Xiong X, Chi J, Gao Q.
In-Text Gene Mentions

…in SARS-CoV-1 andMERS-CoV-1[ 7 ].…

Show Full Abstract

<h4>Background</h4>Coagulation abnormalities in COVID-19 patients accompanied with poor prognosis. This study aimed to determine the prevalence and risk factors of thrombotic events on COVID-19 patients.<h4>Methods</h4>We systematically reviewed all the studies about thrombotic events on COVID-19 patients in PubMed, Embase, Web of Science, MedRxiv, bioRxiv, from Dec 1, 2019 to July 5, 2020. The weighted mean difference (MD) or odds ratio (OR) or relative risk (RR) with 95 % confidence intervals (CI) for clinical data in COVID-19 patients with or without thrombotic events was calculated.<h4>Results</h4>12 articles contained 1083 patients were included for meta-analysis. The prevalence of thrombosis was 22 % (95 % CI 0.08-0.40) in COVID-19 patients and increased to 43 % (95 % CI 0.29-0.65) after admission to the intensive care unit (ICU). Compared with non-thrombotic patients, thrombotic patients had higher levels of D-dimer (MD = 2.79 μg/ml, 95 % CI 2.27-3.31 μg/ml), lactate dehydrogenase (LDH) (MD = 112.71 U/L, 95 % CI 62.40-163.02 U/L), and white blood cells (WBC) (MD = 1.14 *10<sup>9</sup>/L, 95 % CI 0.47-1.81*10<sup>9</sup>/L) while decreased lymphocytes (MD= -0.20*10<sup>9</sup>/L, 95 % CI -0.38 - -0.02*10<sup>9</sup>/L). Age, platelet counts, and male sex tended to be risks while diabetes tended to be a protection for thrombosis for COVID-19 patients, although no statistical difference was achieved. Finally, patients with thrombosis were at a higher risk of death (OR = 2.39, 95 % CI 1.36-4.20).<h4>Conclusions</h4>Prevalence of thrombosis in COVID-19 patients was high, especially in ICU, though pharmacologic thromboembolism prophylaxis was applied. Therefore, higher levels of D-dimer, LDH, WBC, and decreased lymphocytes needed to be paid close attention to in patients with COVID-19.

Also flagged:NucleusHuntington's diseaseHDneurodegenerative disorderdeathbehavioral
Journal Article 2021-05-19 ✓ 4 Snippets Malaiya S, Cortes-Gutierrez M, Herb BR, Coffey SR, Legg SRW, Cantle JP, Colantuoni C, Carroll JB, Ament SA.
In-Text Gene Mentions

Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder caused by a trinucleotide expansion in exon 1 of the huntingtin (<i>HTT</i>) gene.

…the huntingtin (HTT) gene.…

…the HD mutation,HttQ175 /+ ,…

HTT

Show Full Abstract

Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder caused by a trinucleotide expansion in exon 1 of the huntingtin (<i>HTT</i>) gene. Cell death in HD occurs primarily in striatal medium spiny neurons (MSNs), but the involvement of specific MSN subtypes and of other striatal cell types remains poorly understood. To gain insight into cell type-specific disease processes, we studied the nuclear transcriptomes of 4524 cells from the striatum of a genetically precise knock-in mouse model of the HD mutation, <i>Htt</i><sup><i>Q175</i>/+</sup>, and from wild-type controls. We used 14- to 15-month-old male mice, a time point at which multiple behavioral, neuroanatomical, and neurophysiological changes are present but at which there is no known cell death. Thousands of differentially expressed genes (DEGs) were distributed across most striatal cell types, including transcriptional changes in glial populations that are not apparent from RNA-seq of bulk tissue. Reconstruction of cell type-specific transcriptional networks revealed a striking pattern of bidirectional dysregulation for many cell type-specific genes. Typically, these genes were repressed in their primary cell type, yet de-repressed in other striatal cell types. Integration with existing epigenomic and transcriptomic data suggest that partial loss-of-function of the polycomb repressive complex 2 (PRC2) may underlie many of these transcriptional changes, leading to deficits in the maintenance of cell identity across virtually all cell types in the adult striatum.<b>SIGNIFICANCE STATEMENT</b> Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder characterized by specific loss of medium spiny neurons (MSNs) in the striatum, accompanied by more subtle changes in many other cell types. It is thought that changes in transcriptional regulation are an important underlying mechanism, but cell type-specific gene expression changes are not well understood, particularly at time points relevant to the onset of disease-related symptoms. Single-nucleus (sn)RNA-seq in a genetically precise mouse model enabled us to identify novel patterns of transcriptional dysregulation because of HD mutations, including bidirectional dysregulation of many cell type identity genes that may be driven by partial loss-of-function of the polycomb repressive complex (PRC). Identifying these regulators of transcriptional dysregulation in HD can be leveraged to design novel disease-modifying therapeutics.

Also flagged:C1orf61SEZ6L2HAT1TBR1BCHELIX1
Journal Article 2021-05-19 ✓ 4 Snippets Pokhilko A, Handel AE, Curion F, Volpato V, Whiteley ES, Bøstrand S, Newey SE, Akerman CJ, Webber C, Clark MB, Bowden R, Cader MZ.
In-Text Gene Mentions

DCC

SOX6

ECI2

…, GLIS3 ,POU3F2, SP4 ,…

Show Full Abstract

Single-cell RNA sequencing (scRNA-seq) is a widely used method for identifying cell types and trajectories in biologically heterogeneous samples, but it is limited in its detection and quantification of lowly expressed genes. This results in missing important biological signals, such as the expression of key transcription factors (TFs) driving cellular differentiation. We show that targeted sequencing of ∼1000 TFs (scCapture-seq) in iPSC-derived neuronal cultures greatly improves the biological information garnered from scRNA-seq. Increased TF resolution enhanced cell type identification, developmental trajectories, and gene regulatory networks. This allowed us to resolve differences among neuronal populations, which were generated in two different laboratories using the same differentiation protocol. ScCapture-seq improved TF-gene regulatory network inference and thus identified divergent patterns of neurogenesis into either excitatory cortical neurons or inhibitory interneurons. Furthermore, scCapture-seq revealed a role for of retinoic acid signaling in the developmental divergence between these different neuronal populations. Our results show that TF targeting improves the characterization of human cellular models and allows identification of the essential differences between cellular populations, which would otherwise be missed in traditional scRNA-seq. scCapture-seq TF targeting represents a cost-effective enhancement of scRNA-seq, which could be broadly applied to improve scRNA-seq resolution.

Also flagged:SRSF8SRA1SRSF11SRSF1MS2RRM2
Journal Article 2021-05-19 ✓ 2 Snippets Lei S, Zhang B, Huang L, Zheng Z, Xie S, Shen L, Breitzig M, Czachor A, Liu H, Luo H, Chen Y, Liu K, Sun H, Zheng Q, Li Q, Wang F.
In-Text Gene Mentions

Firstly, we selected several genes related to tumor metastasis through the NCBI database and literature, including SRA1, DBF4 zinc finger B (DBF4B), ZNFX1 antisense RNA 1 (ZFAS1), colorectal neoplasia differentially expressed (CRNDE), endoplasmic reticulum lectin (OS9), and others.

…( DBF4B ),ZNFX1antisense RNA 1…

Show Full Abstract

Steroid receptor RNA activator 1 (SRA1) has been described as a novel transcriptional co-activator that affects the migration of cancer cells. Through RT-PCR, we identified that skipping exon 3 of SRA1 produces two isoforms, including the truncated short isoform, SRA1-S, and the long isoform, SRA1-L. However, the effect of these two isomers on the migration of HCC cells, as well as the specific mechanism of exon 3 skipping remain unclear. In this study, we found up regulated expression of SRSF1 and SRA1-L in highly metastatic HCCLM3, as well as in HCCs with SRSF1 demonstrating the strongest correlation with SRA1-L. In contrast, we observed a constitutively low expression of SRA1-S and SRSF1 in lowly metastatic HepG2 cells. Overexpression of SRSF1 or SRA1-L promoted migration and invasion by increasing the expression of CD44, while SRA1-S reversed the effect of SRSF1 and SRA1-L in vitro. In addition, lung metastasis in mice revealed that, knockdown of SRSF1 or SRA1-L inhibited the migration of HCC cells, while SRA1-L overexpression abolished the effect of SRSF1 knockout and instead promoted HCC cells migration in vivo. More importantly, RNA immunoprecipitation and Cross-link immunoprecipitation analyses showed that SRSF1 interacts with exon 3 of SRA1 to up regulate the expression of SRA1-L in HCC cells. RNA pull-down results indicated that SRSF1 could also bind to exon 3 of SRA1 in vitro. Finally, minigene -MS2 mutation experiments showed that mutation of the SRA1 exon 3 binding site for SRSF1 prevented the binding of SRA1 pre-mRNA. In summary, our results provide experimental evidence that SRA1 exon 3 inclusion is up regulated by SRSF1 to promote tumor invasion and metastasis in hepatocellular carcinoma.

Also flagged:lipopolysaccharideRNF213ubiquitinbacterial infectionUbiquitylationtranslational protein
Journal Article 2021-05-19 ✓ 1 Snippet Otten EG, Werner E, Crespillo-Casado A, Boyle KB, Dharamdasani V, Pathe C, Santhanam B, Randow F.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

Ubiquitylation is a widespread post-translational protein modification in eukaryotes and marks bacteria that invade the cytosol as cargo for antibacterial autophagy<sup>1-3</sup>. The identity of the ubiquitylated substrate on bacteria is unknown. Here we show that the ubiquitin coat on Salmonella that invade the cytosol is formed through the ubiquitylation of a non-proteinaceous substrate, the lipid A moiety of bacterial lipopolysaccharide (LPS), by the E3 ubiquitin ligase ring finger protein 213 (RNF213). RNF213 is a risk factor for moyamoya disease<sup>4,5</sup>, which is a progressive stenosis of the supraclinoid internal carotid artery that causes stroke (especially in children)<sup>6,7</sup>. RNF213 restricts the proliferation of cytosolic Salmonella and is essential for the generation of the bacterial ubiquitin coat, both directly (through the ubiquitylation of LPS) and indirectly (through the recruitment of LUBAC, which is a downstream E3 ligase that adds M1-linked ubiquitin chains onto pre-existing ubiquitin coats<sup>8</sup>). In cells that lack RNF213, bacteria do not attract ubiquitin-dependent autophagy receptors or induce antibacterial autophagy. The ubiquitylation of LPS on Salmonella that invade the cytosol requires the dynein-like core of RNF213, but not its RING domain. Instead, ubiquitylation of LPS relies on an RZ finger in the E3 shell. We conclude that ubiquitylation extends beyond protein substrates and that ubiquitylation of LPS triggers cell-autonomous immunity, and we postulate that non-proteinaceous substances other than LPS may also become ubiquitylated.

Also flagged:erythrocytosispolycythaemia veraHbidiopathic erythrocytosisIESE
Journal Article 2021-05-19 ✓ 5 Snippets Anžej Doma S, Drnovšek E, Kristan A, Fink M, Sever M, Podgornik H, Belčič Mikič T, Debeljak N, Preložnik Zupan I.
In-Text Gene Mentions

Among 24 patients tested for common HFE mutations using Sanger sequencing, only one patient was diagnosed with hereditary haemochromatosis type 1 (HFE1), thus classified as SE patient.

…regulatory genes (HFE) , namely c.845G…

…tested for commonHFEmutations using Sanger…

…haemochromatosis type 1 (HFE1), thus classified as…

…incidence of heterozygousHFEmutations, but possible…

Show Full Abstract

Erythrocytosis has a diverse background. While polycythaemia vera has well defined criteria, the diagnostic approach and management of other types of erythrocytosis are more challenging. The aim of study was to retrospectively analyse the aetiology and management of non-clonal erythrocytosis patients referred to a haematology outpatient clinic in an 8-year period using a 3-step algorithm. The first step was inclusion of patients with Hb > 185 g/L and/or Hct > 0.52 in men and Hb > 165 g/L and/or Hct > 0.48 in women on two visits ≥ two months apart, thus confirming true erythrocytosis. Secondly, polycythaemia vera was excluded and secondary causes of erythrocytosis (SE) identified. Thirdly, idiopathic erythrocytosis patients (IE) were referred to next-generation sequencing for possible genetic background evaluation. Of the 116 patients, 75 (65%) are men and 41 (35%) women, with non-clonal erythrocytosis 34/116 (29%) had SE, 15/116 (13%) IE and 67/116 (58%) stayed incompletely characterized (ICE). Patients with SE were significantly older and had significantly higher Hb and Hct compared to patients with IE. Most frequently, SE was attributed to obstructive sleep apnoea and smoking. Phlebotomies were performed in 56, 53 and 40% of patients in the SE, IE, and ICE group, respectively. Approx. 70% of patients in each group received aspirin. Thrombotic events were registered in 12, 20 and 15% of SE, IE and ICE patients, respectively. Congenital erythrocytosis type 4 (ECYT4) was diagnosed in one patient. The study demonstrates real-life management of non-clonal erythrocytosis which could be optimized using a 3-step diagnostic algorithm.

Also flagged:Peroxiredoxin 6Brain Diseasesperoxiredoxinsglutathione peroxidaseacidic calcium-independent phospholipaseaiPLA2
Journal Article 2021-05-19 ✓ 5 Snippets Liao J, Zhang Y, Chen X, Zhang J.
In-Text Gene Mentions

Here, we reviewed the characteristics of the available Prdx6 genetic mouse models and the research progresses made with regard to PRDX6 in neuropsychiatric disorders, including neurodegenerative diseases, brain aging, stroke, neurotrauma, gliomas, major depressive disorder, drug addiction, post-traumatic stress disorder, and schizophrenia.

…Peroxiredoxin 6 (PRDX6), the only mammalian…

…of the availablePrdx6genetic mouse models…

…with regard toPRDX6in neuropsychiatric disorders,…

…important roles ofPRDX6in neuropsychiatric disorders…

Show Full Abstract

Peroxiredoxin 6 (PRDX6), the only mammalian 1-Cys member of the peroxiredoxins (PRDXs) family, has multiple functions of glutathione peroxidase (Gpx) activity, acidic calcium-independent phospholipase (aiPLA2) activity, and lysophosphatidylcholine acyl transferase (LPCAT) activity. It has been documented to be involved in redox homeostasis, phospholipid turnover, glycolipid metabolism, and cellular signaling. Here, we reviewed the characteristics of the available Prdx6 genetic mouse models and the research progresses made with regard to PRDX6 in neuropsychiatric disorders, including neurodegenerative diseases, brain aging, stroke, neurotrauma, gliomas, major depressive disorder, drug addiction, post-traumatic stress disorder, and schizophrenia. The present review highlights the important roles of PRDX6 in neuropsychiatric disorders and may provide novel insights for the development of effective pharmacological treatments and genetic therapies.

Also flagged:tumorextracellularchemokinesmetabolismangiogenesiscancer
Journal Article 2021-05-19 No Snippets Mhaidly R, Mechta-Grigoriou F.
Show Full Abstract

The tumor microenvironment (TME) has been identified as one of the driving factors of tumor progression and invasion. Within this microenvironment, cancer-associated fibroblasts (CAF) have multiple tumor-promoting functions and play key roles in drug resistance, through multiple mechanisms, including extracellular matrix (ECM) remodeling, production of growth factors, cytokines, and chemokines, and modulation of metabolism and angiogenesis. More recently, a growing body of evidence has shown that CAF also modulate immune cell activity and suppress anti-tumor immune response. In this review, we describe the current knowledge on CAF heterogeneity in terms of identity and functions. Moreover, we analyze how distinct CAF subpopulations differentially interact with immune cells, with a particular focus on T lymphocytes. We address how specific CAF subsets contribute to cancer progression through induction of an immunosuppressive microenvironment. Finally, we highlight potential therapeutic strategies for targeting CAF subpopulations in cancer.

Also flagged:Arhgef4APCstimulated guanine nucleotide exchange factor 1Asef1colorectal cancersPSD-95
Journal Article 2021-05-19 No Snippets Lee K, Yoo KS, Park YS, Kim HK.
Show Full Abstract

The role of Arhgef4, also known as adenomatous polyposis coli (APC)-stimulated guanine nucleotide exchange factor 1 (Asef1), has been identified in colorectal cancers. Interestingly, Arhgef4 is more highly expressed in brain regions than intestinal regions, suggesting a role in neurons. In our previous study, we reported that Arhgef4 negatively regulates the level of PSD-95 in excitatory post-synaptic regions by binding with Staufen1. However, modulation of Arhgef4 guanine nucleotide exchange factor (GEF) activity in neurons has not been reported. We examined the configuration of protein interactions when Arhgef4 binds to APC and/or Staufen1. Arhgef4 simultaneously binds to Staufen1 with APC. Staufen1 overexpression blocked the GEF activity of Arhgef4. Consistent with this, Staufen1 overexpression blocked the Arhgef4-induced increase in dendritic protrusions in cultured neurons. Taken together, our data suggest that the GEF activity of Arhgef4 could be negatively modulated by Staufen1 binding.

Also flagged:Ironranitidineproton pumpsulfateanemiaIron deficient anemia
Journal Article 2021-05-19 ✓ 1 Snippet Hailstone E, Falkos S, Vidal R, Jones KA, Gaillard PR, Fan S, Chung AM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>We assessed the impact of acid suppression therapy (i.e., ranitidine or proton pump inhibitors) on iron supplementation and its ability to maintain or alter laboratory values that are commonly associated with anemia.<h4>Methods</h4>This was a prospective, observational trial. The primary outcome was changes in serum iron levels from baseline. Secondary outcomes were changes in hemoglobin (Hgb) and hematocrit (Hct), transfusions, and maintenance of an alkalotic gastric pH.<h4>Results</h4>Thirty-four patients (mean 24 ± 43 months) met inclusion criteria. The serum iron levels increased to 50.9 ± 24.6 mcg/dL by day 3. The mean difference from baseline was 1.5 mcg/dL (95% CI, 1.14-1.98, p = 0.0056). Gastric pH increased to 4.68 ± 1.49 on day 5. The mean Hgb and Hct increased on day 5 to 10 ± 1.06 g/dL and 29.6% ± 3.27%, respectively. The mean difference of Hgb was 1.15 g/dL (95% CI, 0.51-1.78, p = 0.0009). The mean difference of Hct was 3.04% (95% CI, 1.11-4.97, p = 0.0032).<h4>Conclusions</h4>The use of antacids along with oral ferrous sulfate supplementation did not affect the absorption of iron. Serum iron, Hgb, and Hct all showed statistically significant increases despite combined antacid and iron therapy. Thus, despite use of antacids, combination use showed increases in iron absorption.

Also flagged:cancergene expressionnucleotidestranslationalbindingcomplex
Journal Article 2021-05-19 No Snippets Yousef M, Goy G, Mitra R, Eischen CM, Jabeer A, Bakir-Gungor B.
Show Full Abstract

A better understanding of disease development and progression mechanisms at the molecular level is critical both for the diagnosis of a disease and for the development of therapeutic approaches. The advancements in high throughput technologies allowed to generate mRNA and microRNA (miRNA) expression profiles; and the integrative analysis of these profiles allowed to uncover the functional effects of RNA expression in complex diseases, such as cancer. Several researches attempt to integrate miRNA and mRNA expression profiles using statistical methods such as Pearson correlation, and then combine it with enrichment analysis. In this study, we developed a novel tool called miRcorrNet, which performs machine learning-based integration to analyze miRNA and mRNA gene expression profiles. miRcorrNet groups mRNAs based on their correlation to miRNA expression levels and hence it generates groups of target genes associated with each miRNA. Then, these groups are subject to a rank function for classification. We have evaluated our tool using miRNA and mRNA expression profiling data downloaded from The Cancer Genome Atlas (TCGA), and performed comparative evaluation with existing tools. In our experiments we show that miRcorrNet performs as good as other tools in terms of accuracy (reaching more than 95% AUC value). Additionally, miRcorrNet includes ranking steps to separate two classes, namely case and control, which is not available in other tools. We have also evaluated the performance of miRcorrNet using a completely independent dataset. Moreover, we conducted a comprehensive literature search to explore the biological functions of the identified miRNAs. We have validated our significantly identified miRNA groups against known databases, which yielded about 90% accuracy. Our results suggest that miRcorrNet is able to accurately prioritize pan-cancer regulating high-confidence miRNAs. miRcorrNet tool and all other supplementary files are available at https://github.com/malikyousef/miRcorrNet.

Also flagged:systemic inflammation-related diseasesliver diseasepiracetampsychological stresssodium dodecylsulfate
Journal Article 2021-05-19 ✓ 1 Snippet González-Fernández R, Grigoruţă M, Chávez-Martínez S, Ruiz-May E, Elizalde-Contreras JM, Valero-Galván J, Martínez-Martínez A.
In-Text Gene Mentions

…GLRX5, PRDX2, PRDX5,PRDX6, and TXNRD1 (proteins…

Show Full Abstract

<h4>Background</h4>Chronic psychological distress is considered today a pandemic due to the modern lifestyle and has been associated with various neurodegenerative, autoimmune, or systemic inflammation-related diseases. Stress is closely related to liver disease exacerbation through the high activity of the endocrine and autonomic nervous systems, and the connection between the development of these pathologies and the physiological effects induced by oxidative stress is not yet completely understood. The use of nootropics, as the cognitive enhancer and antioxidant piracetam, is attractive to repair the oxidative damage. A proteomic approach provides the possibility to obtain an in-depth comprehension of the affected cellular processes and the possible consequences for the body. Therefore, we considered to describe the effect of distress and piracetam on the liver proteome.<h4>Methods</h4>We used a murine model of psychological stress by predatory odor as a distress paradigm. Female Sprague-Dawley rats were distributed into four experimental groups (<i>n</i> = 6 - 7/group) and were exposed or not to the stressor for five days and treated or not with piracetam (600 mg/kg) for six days. We evaluated the liver proteome by one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (1D-SDS-PAGE) followed by liquid chromatography-tandem mass spectrometry (GeLC-MS/MS). Besides, we analyzed the activity of liver antioxidant enzymes, the biochemical parameters in plasma and rat behavior.<h4>Results</h4>Our results showed that distress altered a wide range of proteins involved in amino acids metabolism, glucose, and fatty acid mobilization and degradation on the way to produce energy, protein folding, trafficking and degradation, redox metabolism, and its implications in the development of the non-alcoholic fatty liver disease (NAFLD). Piracetam reverted the changes in metabolism caused by distress exposure, and, under physiological conditions, it increased catabolism rate directed towards energy production. These results confirm the possible relationship between chronic psychological stress and the progression of NAFLD, as well as we newly evidenced the controversial beneficial effects of piracetam. Finally, we propose new distress biomarkers in the liver as the protein DJ-1 (PARK7), glutathione peroxidase 1 (GPX), peroxiredoxin-5 (PRDX5), glutaredoxin 5 (GLRX5), and thioredoxin reductase 1 (TXNDR1), and in plasma as biochemical parameters related to kidney function such as urea and blood urea nitrogen (BUN) levels.

Also flagged:Selenbp1LipidMetabolismSelenium-binding protein 1Selenbp2fatty acid
Journal Article 2021-05-19 No Snippets Song Y, Kurose A, Li R, Takeda T, Onomura Y, Koga T, Mutoh J, Ishida T, Tanaka Y, Ishii Y.
Show Full Abstract

Selenium-binding protein 1 (Selenbp1) is a 2,3,7,8-tetrechlorodibenzo-<i>p</i>-dioxin inducible protein whose function is yet to be comprehensively elucidated. As the highly homologous isoform, Selenbp2, is expressed at low levels in the kidney, it is worthwhile comparing wild-type C57BL mice and Selenbp1-deficient mice under dioxin-free conditions. Accordingly, we conducted a mouse metabolomics analysis under non-dioxin-treated conditions. DNA microarray analysis was performed based on observed changes in lipid metabolism-related factors. The results showed fluctuations in the expression of numerous genes. Real-time RT-PCR confirmed the decreased expression levels of the cytochrome P450 4a (Cyp4a) subfamily, known to be involved in fatty acid ω- and ω-1 hydroxylation. Furthermore, peroxisome proliferator-activated receptor-α (Pparα) and retinoid-X-receptor-α (Rxrα), which form a heterodimer with Pparα to promote gene expression, were simultaneously reduced. This indicated that reduced Cyp4a expression was mediated via decreased Pparα and Rxrα. In line with this finding, increased levels of leukotrienes and prostaglandins were detected. Conversely, decreased hydrogen peroxide levels and reduced superoxide dismutase (SOD) activity supported the suppression of the renal expression of Sod1 and Sod2 in Selenbp1-deficient mice. Therefore, we infer that ablation of Selenbp1 elicits oxidative stress caused by increased levels of superoxide anions, which alters lipid metabolism via the Pparα pathway.

Also flagged:Type 2 diabeteschronic diseasehyperglycemiacarbohydratemetabolisminsulin
Journal Article 2021-05-19 No Snippets Vezza T, de Marañón AM, Canet F, Díaz-Pozo P, Marti M, D'Ocon P, Apostolova N, Rocha M, Víctor VM.
Show Full Abstract

Type 2 diabetes is a chronic disease widespread throughout the world, with significant human, social, and economic costs. Its multifactorial etiology leads to persistent hyperglycemia, impaired carbohydrate and fat metabolism, chronic inflammation, and defects in insulin secretion or insulin action, or both. Emerging evidence reveals that oxidative stress has a critical role in the development of type 2 diabetes. Overproduction of reactive oxygen species can promote an imbalance between the production and neutralization of antioxidant defence systems, thus favoring lipid accumulation, cellular stress, and the activation of cytosolic signaling pathways, and inducing β-cell dysfunction, insulin resistance, and tissue inflammation. Over the last few years, microRNAs (miRNAs) have attracted growing attention as important mediators of diverse aspects of oxidative stress. These small endogenous non-coding RNAs of 19-24 nucleotides act as negative regulators of gene expression, including the modulation of redox signaling pathways. The present review aims to provide an overview of the current knowledge concerning the molecular crosstalk that takes place between oxidative stress and microRNAs in the physiopathology of type 2 diabetes, with a special emphasis on its potential as a therapeutic target.

Also flagged:Transcription Factor β-CateninAKTGSK3ββ-galactosidasetranscription factorGlomerular Injury
Journal Article 2021-05-19 No Snippets Srivastava T, Heruth DP, Duncan RS, Rezaiekhaligh MH, Garola RE, Priya L, Zhou J, Boinpelly VC, Novak J, Ali MF, Joshi T, Alon US, Jiang Y, McCarthy ET, Savin VJ, Sharma R, Johnson ML, Sharma M.
Show Full Abstract

Increased fluid flow shear stress (FFSS) in solitary kidney alters podocyte function <i>in vivo</i>. FFSS-treated cultured podocytes show upregulated AKT-GSK3β-β-catenin signaling. The present study was undertaken to confirm (i) the activation of β-catenin signaling in podocytes in vivo using unilaterally nephrectomized (UNX) TOPGAL mice with the β-galactosidase reporter gene for β-catenin activation, (ii) β-catenin translocation in FFSS-treated mouse podocytes, and (iii) β-catenin signaling using publicly available data from UNX mice. The UNX of TOPGAL mice resulted in glomerular hypertrophy and increased the mesangial matrix consistent with hemodynamic adaptation. Uninephrectomized TOPGAL mice showed an increased β-galactosidase expression at 4 weeks but not at 12 weeks, as assessed using immunofluorescence microscopy (<i>p</i> < 0.001 at 4 weeks; <i>p</i> = 0.16 at 12 weeks) and X-gal staining (<i>p</i> = 0.008 at 4 weeks; <i>p</i> = 0.65 at 12 weeks). Immunofluorescence microscopy showed a significant increase in phospho-β-catenin (Ser552, <i>p</i> = 0.005) at 4 weeks but not at 12 weeks (<i>p</i> = 0.935) following UNX, and the levels of phospho-β-catenin (Ser675) did not change. In vitro FFSS caused a sustained increase in the nuclear translocation of phospho-β-catenin (Ser552) but not phospho-β-catenin (Ser675) in podocytes. The bioinformatic analysis of the GEO dataset, #GSE53996, also identified β-catenin as a key upstream regulator. We conclude that transcription factor β-catenin mediates FFSS-induced podocyte (glomerular) injury in solitary kidney.

Also flagged:MetforminNervousbiguanidetype 2 diabetesneurological diseasesepileptic disorders
Journal Article 2021-05-19 ✓ 1 Snippet Sanz P, Serratosa JM, Sánchez MP.
In-Text Gene Mentions

Huntington’s disease is an autosomal, dominant inherited disorder related to the presence of a defective huntingtin gene (Htt) [51].

Show Full Abstract

Metformin is a drug in the family of biguanide compounds that is widely used in the treatment of type 2 diabetes (T2D). Interestingly, the therapeutic potential of metformin expands its prescribed use as an anti-diabetic drug. In this sense, it has been described that metformin administration has beneficial effects on different neurological conditions. In this work, we review the beneficial effects of this drug as a neuroprotective agent in different neurological diseases, with a special focus on epileptic disorders and Lafora disease, a particular type of progressive myoclonus epilepsy. In addition, we review the different proposed mechanisms of action of metformin to understand its function at the neurological level.

Also flagged:Gastric Intestinal MetaplasiaIntestinal metaplasiaIMgastric cancertransmembranePOPDC1
Journal Article 2021-05-19 ✓ 5 Snippets Gingold-Belfer R, Kessler-Icekson G, Morgenstern S, Rath-Wolfson L, Zemel R, Boltin D, Levi Z, Herman-Edelstein M.
In-Text Gene Mentions

…with LGR5 ,OLFM4, CDX2 ,…

…including LGR5 ,OLFM4, and EPHB2…

…some ( LGR5,OLFM4, TERT ) were…

…few ( LGR5,OLFM4) were elevated…

…markers such asOLFM4and EPHB2 ,…

Show Full Abstract

Intestinal metaplasia (IM) is an intermediate step in the progression from premalignant to malignant stages of gastric cancer (GC). The Popeye domain containing (<i>POPDC</i>) gene family encodes three transmembrane proteins, POPDC1, POPDC2, and POPDC3, initially described in muscles and later in epithelial and other cells, where they function in cell-cell interaction, and cell migration. <i>POPDC1</i> and <i>POPDC3</i> downregulation was described in several tumors, including colon and gastric cancers. We questioned whether IM-to-GC transition involves <i>POPDC</i> gene dysregulation. Gastric endoscopic biopsies of normal, IM, and GC patients were examined for expression levels of <i>POPDC1-3</i> and several suggested IM biomarkers, using immunohistochemistry and qPCR. Immunostaining indicated lower POPDC1 and POPDC3 labeling in IM compared with normal tissues. Significantly lower <i>POPDC1</i> and <i>POPDC3</i> mRNA levels were measured in IM and GC biopsies and in GC-derived cell lines. The reduction in focal IM was smaller than in extensive IM that resembled GC tissues. <i>POPDC1</i> and <i>POPDC3</i> transcript levels were highly correlated with each other and inversely correlated with <i>LGR5</i>, <i>OLFM4</i>, <i>CDX2</i>, and several mucin transcripts. The association of <i>POPDC1</i> and <i>POPDC3</i> downregulation with IM-to-GC transition implicates a role in tumor suppression and highlights them as potential biomarkers for GC progression and prospective treatment targets.

Also flagged:DementiaCTGFSARSSCG2INSeIF2alpha
Journal Article 2021-05-19 ✓ 3 Snippets Tang X, Uhl S, Zhang T, Xue D, Li B, Vandana JJ, Acklin JA, Bonnycastle LL, Narisu N, Erdos MR, Bram Y, Chandar V, Chong ACN, Lacko LA, Min Z, Lim JK, Borczuk AC, Xiang J, Naji A, Collins FS, Evans T, Liu C, tenOever BR, Schwartz RE, Chen S.
In-Text Gene Mentions

Interestingly, we also detected the upregulation of acinar cell markers, including PRSS1, PRSS2, CPA1, CPA2, CPB1, SPINK1, and OLFM4. We further validated the upregulation of trypsin1 in beta cells of autopsy samples of COVID-19 subjects.

…SPINK1 , andOLFM4( Figure 4…

…SPINK1 , andOLFM4.…

Show Full Abstract

Recent clinical data have suggested a correlation between coronavirus disease 2019 (COVID-19) and diabetes. Here, we describe the detection of SARS-CoV-2 viral antigen in pancreatic beta cells in autopsy samples from individuals with COVID-19. Single-cell RNA sequencing and immunostaining from ex vivo infections confirmed that multiple types of pancreatic islet cells were susceptible to SARS-CoV-2, eliciting a cellular stress response and the induction of chemokines. Upon SARS-CoV-2 infection, beta cells showed a lower expression of insulin and a higher expression of alpha and acinar cell markers, including glucagon and trypsin1, respectively, suggesting cellular transdifferentiation. Trajectory analysis indicated that SARS-CoV-2 induced eIF2-pathway-mediated beta cell transdifferentiation, a phenotype that could be reversed with trans-integrated stress response inhibitor (trans-ISRIB). Altogether, this study demonstrates an example of SARS-CoV-2 infection causing cell fate change, which provides further insight into the pathomechanisms of COVID-19.

Also flagged:Formate dehydrogenaseMronucleic acidFucose-specific lectinInfectinfection
Journal Article 2021-05-19 No Snippets Lee MR, Kim JC, Park SE, Lee SJ, Kim WJ, Lee DH, Kim JS.
Show Full Abstract

The longhorned tick, <i>Haemaphysalis longicornis</i> (Acari: Ixodidae), is a hard tick and a vector for severe fever with thrombocytopenia syndrome (SFTS) virus. The number of patients infected with SFTS is rapidly increasing. Recently, the invertebrate pathogen <i>Metarhizium anisopliae</i> JEF-290 was reported to be useful to control the tick as an alternative to chemical acaricides, which are not easily applicable in human living areas where the tick is widely spread. In this study, we analyzed how the tick and the fungal pathogen interact at the transcriptional level. Field-collected tick nymphs were treated with JEF-290 conidia at 1 × 10<sup>8</sup> conidia/ml. In the early stage of infection with 2.5% mortality, the infected ticks were subjected to RNA sequencing, and non-infected ticks and fungal masses served as controls. Fungus and tick genes were mostly up-regulated at the early stage of infection. In the gene set enrichment analysis of the infecting fungus, catabolic processes that included lipids, phospholipids, and detoxification processes, the response to oxidative stress, and toxic substances were significantly up-regulated. In this fungal up-regulation, various lipase, antioxidant enzyme, and hydrolase genes were highly transcribed. The gene set enrichment analysis of the infected tick showed that many peptide synthesis processes including translation, peptide metabolism, ribonucleotide metabolism, and energy production processes that included ATP generation and ADP metabolism were significantly up-regulated. Structurally, mitochondria and ribosome subunit genes in ticks were highly transcribed to upregulate these processes. Together these results indicate that JEF-290 initiates process that infects the tick while the tick actively defends against the fungal attack. This work provides background to improve our understanding of the early stage of fungal infection in longhorned tick.

Also flagged:Receptor-interacting proteincancerserine/threonine and tyrosine kinase-like kinasesreceptor interacting proteinsreceptor interacting protein kinasestumor
Journal Article 2021-05-19 ✓ 2 Snippets Zhang L, Guo W, Yu J, Li C, Li M, Chai D, Wang W, Deng W.
In-Text Gene Mentions

Further analysis showed the overexpression of RIP4 significantly stimulated PC cell invasion and migration by the proteasome-mediated phosphatidylethanolamine binding protein 1 (PEBP1) degradation-induced activation of the RAF1/MEK/ERK pathway.

Among them, PEBP1, as a physiological endogenous inhibitor of the RAF1/MEK/ERK pathway, can impede the proliferation, migration, and invasion of PC cells 108.

Show Full Abstract

A deep and comprehensive understanding of factors that contribute to cancer initiation, progression, and evolution is of essential importance. Among them, the serine/threonine and tyrosine kinase-like kinases, also known as receptor interacting proteins (RIPs) or receptor interacting protein kinases (RIPKs), is emerging as important tumor-related proteins due to its complex regulation of cell survival, apoptosis, and necrosis. In this review, we mainly review the relevance of RIP to various malignant digestive neoplasms, including esophageal cancer, gastric cancer, colorectal cancer, hepatocellular carcinoma, gallbladder cancer, cholangiocarcinoma, and pancreatic cancer. Consecutive research on RIPs and its relationship with malignant digestive neoplasms is required, as it ultimately conduces to the etiology and treatment of cancer.

Also flagged:Foxb1Foxa1Sim1Nr4a2Fezf2Ebf3
Journal Article 2021-05-19 ✓ 1 Snippet López-González L, Alonso A, García-Calero E, de Puelles E, Puelles L.
In-Text Gene Mentions

…Netrin1 –/– orDCC–/– mutants, which…

Show Full Abstract

The tuberal hypothalamic ventral premamillary nucleus (VPM) described in mammals links olfactory and metabolic cues with mating behavior and is involved in the onset of puberty. We offer here descriptive and experimental evidence on a migratory phase in the development of this structure in mice at E12.5-E13.5. Its cells originate at the retromamillary area (RM) and then migrate tangentially rostralward, eschewing the mamillary body, and crossing the molecularly distinct perimamillary band, until they reach a definitive relatively superficial ventral tuberal location. Corroborating recent transcriptomic studies reporting a variety of adult glutamatergic cell types in the VPM, and different projections in the adult, we found that part of this population heterogeneity emerges already early in development, during tangential migration, in the form of differential gene expression properties of at least 2-3 mixed populations possibly derived from subtly different parts of the RM. These partly distribute differentially in the core and shell parts of the final VPM. Since there is a neighboring acroterminal source of Fgf8, and Fgfr2 is expressed at the early RM, we evaluated a possible influence of Fgf8 signal on VPM development using hypomorphic Fgf8<sup>neo/null</sup> embryos. These results suggested a trophic role of Fgf8 on RM and all cells migrating tangentially out of this area (VPM and the subthalamic nucleus), leading in hypomorphs to reduced cellularity after E15.5 without alteration of the migrations proper.

Also flagged:liver diseasesliver diseaseorgan failureascitesHEcreatinine
Journal Article 2021-05-19 ✓ 1 Snippet Valantine B, Sundaray N, Mishra D, Sahu S, Narayan J, Panda BN, Singh A.
In-Text Gene Mentions

…storage disorders likehemochromatosis.…

Show Full Abstract

<h4>Background and aim</h4>Acute-on-chronic liver failure (ACLF) is a transpiring entity, which possesses high short-term/early mortality (28 days). Several mortality predictors have been studied, but none were proved reliable. Serum ferritin, an acute phase reactant and marker of hepatic necro-inflammation, is found to predict mortality in multiple liver diseases. We aimed to evaluate the role of serum ferritin and other clinical features, biochemical parameters and conventional scoring systems in predicting early mortality among ACLF.<h4>Methods</h4>A prospective cohort study was done from October 2017 to March 2019 at a tertiary care (non-transplant) center in eastern India. A total of consecutive 50 ACLF patients diagnosed, based on Asia Pacific Association for the Study of liver disease definition, were investigated for ferritin and other laboratory parameters on day-0, day-7, and followed up for 28 days.<h4>Results</h4>Although the majority did not have organ failure (ACLF grade 0) according to European Association for Study of Liver-chronic liver failure sequential organ failure assessment criteria, early mortality was high (56%). On undergoing univariate analysis, multiple variables (ascites, HE, creatinine, total leucocyte count (TLC), bilirubin, albumin) predicted mortality. However, on multivariate analysis, only total bilirubin independently predicted. None of the scores on day-0 were predictive, while model for end-stage liver disease [area under the receiver operating characteristics (AUROC)-0.703, 95% confidence interval [CI]: 0.535-0.859] and Child-Turcotte-Pugh (AUROC-0.697, 95% CI: 0.550-0.855) on day-7 did.<h4>Conclusion</h4>ACLF is a dynamic process; day-7 assessment with above predictors, to be considered a milestone for prognostication and opting treatment modalities. Serum ferritin does not predict early mortality in ACLF.

Also flagged:Infective EndocarditisHeparinclottingIEfibrinogenalbumin
Journal Article 2021-05-19 ✓ 1 Snippet Kimura Y, Okahara S, Abo K, Koyama Y, Kuriyama M, Ono K, Hidaka H.
In-Text Gene Mentions

…them received humanantithrombin-IIIconcentrate.<h4>Conclusions</h…

Show Full Abstract

<h4>Objectives</h4>Heparin resistance (HR), defined as a decrease in heparin responsiveness, can result in adverse events with prolonged duration of surgery. Although some clinical risk factors have been suggested, the relationship with the surgical diagnosis is unclear. The aim of present study was to elucidate the clinical predictors of HR including the surgical diagnosis.<h4>Design</h4>This retrospective cohort study determined the incidence of HR (defined as activated clotting time [ACT] <400 seconds after 250-350 IU/kg of heparin administration) and heparin sensitivity index (HSI) was calculated from the rate of change in ACT per heparin dose. Preoperative demographic data, medication history, and laboratory data also were analyzed.<h4>Setting</h4>Single institution, tertiary care hospital.<h4>Participants</h4>Adult patients who underwent cardiovascular surgery with cardiopulmonary bypass between January 2012 and September 2018.<h4>Interventions</h4>None.<h4>Measurements and main results</h4>Of 287 patients, 88 (30.7%) were classified as HR. In univariate analysis, infective endocarditis (IE), platelet count, and serum fibrinogen and albumin levels were associated with HR. After adjustment for baseline ACT and initial heparin dose, IE (odds ratio 4.57, [95% CI: 1.10-19.1]; p = 0.037) and albumin ≤3.5 g/dL (3.17, [1.46-6.93]; p = 0.004) were associated independently with HR. Patients with IE had significantly lower HSI than those with other diseases. All HR patients were treated with additional heparin, and 17 of them received human antithrombin-III concentrate.<h4>Conclusions</h4>Infective endocarditis and preoperative hypoalbuminemia were associated independently with HR. The optimal anticoagulation strategy for patients with these risk factors requires further investigations based on the authors' findings.

Also flagged:hypoglycemiadiabetesserotoninnorepinephrineprediabetesglucose
Journal Article 2021-05-19 No Snippets Fischer LE, Wolfe BM, Fino N, Elman MR, Flum DR, Mitchell JE, Pomp A, Pories WJ, Purnell JQ, Patti ME, LABS Investigators.
Show Full Abstract

<h4>Background</h4>Postbariatric hypoglycemia (PBH) can be a devastating complication for which current therapies are often incompletely effective. More information is needed regarding frequency, incidence, and risk factors for PBH.<h4>Objectives</h4>To examine hypoglycemia symptoms following Roux-en-Y gastric bypass (RYGB) and laparoscopic adjustable gastric banding (LAGB) and baseline and in-study risk factors.<h4>Setting</h4>Multicenter, at 10 US hospitals in 6 geographically diverse clinical centers.<h4>Methods</h4>A prospective, longitudinal cohort study of adults undergoing RYGB or LAGB as part of clinical care between 2006 and 2009 were recruited and followed until January 31, 2015, with baseline and annual postoperative research assessments. We analyzed baseline prevalence and post-operative incidence and frequency of self-reported hypoglycemia symptoms as well as potential preoperative risk factors.<h4>Results</h4>In all groups, postoperative prevalence of hypoglycemia symptoms was 38.5%. Symptom prevalence increased postoperatively from 2.8%-36.4% after RYGB in patients without preoperative diabetes (T2D), with similar patterns in prediabetes (4.9%-29.1%). Individuals with T2D had higher baseline hypoglycemia symptoms (28.9%), increasing after RYGB (57.9%). Hypoglycemia symptoms were lower after LAGB, with 39.1% reported hypoglycemia symptoms at only 1 postoperative visit with few (4.0%) having persistent symptoms at 6 or more annual visits. Timing of symptoms was not restricted to the postprandial state. Symptoms of severe hypoglycemia were reported in 2.6-3.6% after RYGB. The dominant risk factor for postoperative symptoms was preoperative symptoms; additionally, baseline selective serotonin (SSRI) and serotonin-norepinephrine (SNRI) reuptake inhibitor use was also associated with increased risk in multivariable analysis. Weight loss and regain were not related to hypoglycemia symptom reporting.<h4>Conclusion</h4>Hypoglycemia symptoms increase over time after RYGB, particularly in patients without diabetes. In a small percentage, symptoms can be persistent or severe and require hospitalization. Preoperative hypoglycemia symptoms and SSRI/SNRI use in RYGB patients without diabetes is associated with increased risk of symptoms.

Also flagged:invasive cancerscancerpancreatic cancerpeptidesbiomoleculepost-translational modifications
Journal Article 2021-05-19 No Snippets Miles HN, Delafield DG, Li L.
Show Full Abstract

Innovations in medical technology and dedicated focus from the scientific community have inspired numerous treatment strategies for benign and invasive cancers. While these improvements often lend themselves to more positive prognoses and greater patient longevity, means for early detection and severity stratification have failed to keep pace. Detection and validation of cancer-specific biomarkers hinges on the ability to identify subtype-specific phenotypic and proteomic alterations and the systematic screening of diverse patient groups. For this reason, clinical and scientific research settings rely on high throughput and high sensitivity mass spectrometry methods to discover and quantify unique molecular perturbations in cancer patients. Discussed within is an overview of quantitative proteomics strategies and a summary of recent applications that enable revealing potential biomarkers and treatment targets in prostate, ovarian, breast, and pancreatic cancer in a high throughput manner.

Also flagged:type 2 diabetes mellitusdiabetesglucosehypoglycemiahyperglycemiaType 2 Diabetes
Journal Article 2021-05-18 No Snippets Augstein P, Heinke P, Vogt L, Kohnert KD, Salzsieder E.
Show Full Abstract

<h4>Background</h4>The increasing prevalence of type 2 diabetes mellitus (T2D) and specialist shortage has caused a healthcare gap that can be bridged by a decision support system (DSS). We investigated whether a diabetes DSS can improve long- and/or short-term glycemic control.<h4>Methods</h4>This is a retrospective observational cohort study of the Diabetiva program, which offered a patient-tailored DSS using Karlsburger Diabetes-Management System (KADIS) once a year. Glycemic control was analyzed at baseline and after 12 months in 452 individuals with T2D. Time in range (TIR; glucose 3.9-10 mmol/L) and Q-Score, a composite metric developed for analysis of continuous glucose profiles, were short-term and HbA1c long-term measures of glycemic control. Glucose variability (GV) was also measured.<h4>Results</h4>At baseline, one-third of patients had good short- and long-term glycemic control. Q-Score identified insufficient short-term glycemic control in 17.9% of patients with HbA1c <6.5%, mainly due to hypoglycemia. GV and hyperglycemia were responsible in patients with HbA1c >7.5% and >8%, respectively. Application of DSS at baseline improved short- and long-term glycemic control, as shown by the reduced Q-Score, GV, and HbA1c after 12 months. Multiple regression demonstrated that the total effect on GV resulted from the single effects of all influential parameters.<h4>Conclusions</h4>DSS can improve short- and long-term glycemic control in individuals with T2D without increasing hypoglycemia. The Q-Score allows identification of individuals with insufficient glycemic control. An effective strategy for therapy optimization could be the selection of individuals with T2D most at need using the Q-Score, followed by offering patient-tailored DSS.

Also flagged:transcription-coupled repairdefectRAD54L2sumoUBCMEP-1
Journal Article 2021-05-18 ✓ 1 Snippet Kim H, Ding YH, Lu S, Zuo MQ, Tan W, Conte D, Dong MQ, Mello CC.
In-Text Gene Mentions

…components of apolycomb repressiverepressive complex (PRC2)…

Show Full Abstract

Germlines shape and balance heredity, integrating and regulating information from both parental and foreign sources. Insights into how germlines handle information have come from the study of factors that specify or maintain the germline fate. In early <i>Caenorhabditis elegans</i> embryos, the CCCH zinc finger protein PIE-1 localizes to the germline where it prevents somatic differentiation programs. Here, we show that PIE-1 also functions in the meiotic ovary where it becomes SUMOylated and engages the small ubiquitin-like modifier (SUMO)-conjugating machinery. Using whole-SUMO-proteome mass spectrometry, we identify HDAC SUMOylation as a target of PIE-1. Our analyses of genetic interactions between <i>pie-1</i> and SUMO pathway mutants suggest that PIE-1 engages the SUMO machinery both to preserve the germline fate in the embryo and to promote Argonaute-mediated surveillance in the adult germline.

Also flagged:Hedgehog co-receptorHedgehogHhHh receptorbindingheparin
Journal Article 2021-05-18 ✓ 1 Snippet Yang S, Zhang Y, Yang C, Wu X, El Oud SM, Chen R, Cai X, Wu XS, Lan G, Zheng X.
In-Text Gene Mentions

…the netrin receptorDCC, the Slit receptor…

Show Full Abstract

Hedgehog (Hh) signaling patterns embryonic tissues and contributes to homeostasis in adults. In <i>Drosophila</i>, Hh transport and signaling are thought to occur along a specialized class of actin-rich filopodia, termed cytonemes. Here, we report that Interference hedgehog (Ihog) not only forms a Hh receptor complex with Patched to mediate intracellular signaling, but Ihog also engages in <i>trans</i>-homophilic binding leading to cytoneme stabilization in a manner independent of its role as the Hh receptor. Both functions of Ihog (<i>trans</i>-homophilic binding for cytoneme stabilization and Hh binding for ligand sensing) involve a heparin-binding site on the first fibronectin repeat of the extracellular domain. Thus, the Ihog-Ihog interaction and the Hh-Ihog interaction cannot occur simultaneously for a single Ihog molecule. By combining experimental data and mathematical modeling, we determined that Hh-Ihog heterophilic interaction dominates and Hh can disrupt and displace Ihog molecules involved in <i>trans</i>-homophilic binding. Consequently, we proposed that the weaker Ihog-Ihog <i>trans</i> interaction promotes and stabilizes direct membrane contacts along cytonemes and that, as the cytoneme encounters secreted Hh ligands, the ligands trigger release of Ihog from <i>trans</i> Ihog-Ihog complex enabling transport or internalization of the Hh ligand-Ihog-Patched -receptor complex. Thus, the seemingly incompatible functions of Ihog in homophilic adhesion and ligand binding cooperate to assist Hh transport and reception along the cytonemes.

Also flagged:actindefectsGKAPsucroseionsoctyl glucoside
Journal Article 2021-05-18 ✓ 1 Snippet Suzuki T, Terada N, Higashiyama S, Kametani K, Shirai Y, Honda M, Kai T, Li W, Tabuchi K.
In-Text Gene Mentions

…ArgBP2, Begain, Caskin1,Densin-180, Disable homolog-2-interactin…

Show Full Abstract

A purification protocol was developed to identify and analyze the component proteins of a postsynaptic density (PSD) lattice, a core structure of the PSD of excitatory synapses in the central nervous system. "Enriched"- and "lean"-type PSD lattices were purified by synaptic plasma membrane treatment to identify the protein components by comprehensive shotgun mass spectrometry and group them into minimum essential cytoskeleton (MEC) and non-MEC components. Tubulin was found to be a major component of the MEC, with non-microtubule tubulin widely distributed on the purified PSD lattice. The presence of tubulin in and around PSDs was verified by post-embedding immunogold labeling EM of cerebral cortex. Non-MEC proteins included various typical scaffold/adaptor PSD proteins and other class PSD proteins. Thus, this study provides a new PSD lattice model consisting of non-microtubule tubulin-based backbone and various non-MEC proteins. Our findings suggest that tubulin is a key component constructing the backbone and that the associated components are essential for the versatile functions of the PSD.

Also flagged:tuberculosisTBsynthesisinfectionsRifampinpyrazinamide
Journal Article 2021-05-18 ✓ 1 Snippet Walter ND, Born SEM, Robertson GT, Reichlen M, Dide-Agossou C, Ektnitphong VA, Rossmassler K, Ramey ME, Bauman AA, Ozols V, Bearrows SC, Schoolnik G, Dolganov G, Garcia B, Musisi E, Worodria W, Huang L, Davis JL, Nguyen NV, Nguyen HV, Nguyen ATV, Phan H, Wilusz C, Podell BK, Sanoussi ND, de Jong BC, Merle CS, Affolabi D, McIlleron H, Garcia-Cremades M, Maidji E, Eshun-Wilson F, Aguilar-Rodriguez B, Karthikeyan D, Mdluli K, Bansbach C, Lenaerts AJ, Savic RM, Nahid P, Vásquez JJ, Voskuil MI.
In-Text Gene Mentions

…C3HeB/FeJ mouse developstype 1 granulomas1 granulomas (Fig.…

Show Full Abstract

There is urgent need for new drug regimens that more rapidly cure tuberculosis (TB). Existing TB drugs and regimens vary in treatment-shortening activity, but the molecular basis of these differences is unclear, and no existing assay directly quantifies the ability of a drug or regimen to shorten treatment. Here, we show that drugs historically classified as sterilizing and non-sterilizing have distinct impacts on a fundamental aspect of Mycobacterium tuberculosis physiology: ribosomal RNA (rRNA) synthesis. In culture, in mice, and in human studies, measurement of precursor rRNA reveals that sterilizing drugs and highly effective drug regimens profoundly suppress M. tuberculosis rRNA synthesis, whereas non-sterilizing drugs and weaker regimens do not. The rRNA synthesis ratio provides a readout of drug effect that is orthogonal to traditional measures of bacterial burden. We propose that this metric of drug activity may accelerate the development of shorter TB regimens.

Also flagged:nucleotidestructural proteineclosionviral infectionhatchingRNA polymerase
Journal Article 2021-05-18 No Snippets Zhang J, Wang F, Yuan B, Yang L, Yang Y, Fang Q, Kuhn JH, Song Q, Ye G.
Show Full Abstract

We identified a 9332-nucleotide-long novel picornaviral genome sequence in the transcriptome of an agriculturally important parasitoid wasp (Pachycrepoideus vindemmiae (Rondani, 1875)). The genome of the novel virus, Rondani's wasp virus 1 (RoWV-1), contains two long open reading frames encoding a nonstructural and a structural protein, respectively, and is 3'-polyadenylated. Phylogenetic analyses firmly place RoWV-1 into the dicistrovirid genus Cripavirus. We detected RoWV-1 in various tissues and life stages of the parasitoid wasp, with the highest virus load measured in the larval digestive tract. We demonstrate that RoWV-1 is transmitted horizontally from infected to uninfected wasps but not vertically to wasp offspring. Comparison of several important biological parameters between the infected and uninfected wasps indicates that RoWV-1 does not have obvious detrimental effects on wasps. We further demonstrate that RoWV-1 also infects Drosophila melanogaster (Meigen, 1830), the hosts of the pupal ectoparasitoid wasps, and thereby increases its pupal developmental duration and fecundity, but decreases the eclosion rate. Together, these results suggest that RoWV-1 may have a potential benefit to the wasp by increasing not only the number of potential wasp hosts but also the developmental time of the hosts to ensure proper development of wasp offspring.

Also flagged:VP1hand, foot, and mouth diseaseEV71 infection
Journal Article 2021-05-18 No Snippets Chen M, He S, Yan Q, Zhang J, Li C, Su X, Zhang S, Li T, Ge S, Chen M, Zhang J, Xia N.
Show Full Abstract

Enterovirus 71 (EV71) has caused large hand, foot, and mouth disease (HFMD) epidemics among young children, and EV71 infection is the leading cause of severe HFMD cases and deaths. In mainland China, the prevalence and risk factors of non-C4 EV71 strains are still unclear. In this study, we monitored non-C4 strains over a 10-year HFMD epidemiological surveillance period in Xiamen. The 5'UTR and VP1 coding region of EV71 strains were amplified by RT-nested PCR and sequenced. Thirty-two non-C4 EV71 strains were identified during 2009-2018. This study provides important information about the prevalence of EV71 in China that will be applicable for development of vaccines and diagnostic reagents as well as establishment of policies for HFMD prevention and control.

Also flagged:Lipoic Acidforkhead box O3aFOXO3acell proliferationcluster of differentiation 31CD31
Journal Article 2021-05-18 No Snippets Ñaupas LVS, Brito DCC, de Souza SS, Brandão FAS, da Silva RF, da Silva Raposo R, de Oliveira Monteiro Moreira AC, Araújo AA, Alves BG, Guedes MIF, Silva JYG, Cordova A, Figueiredo JR, Rodrigues APR.
Show Full Abstract

This study evaluated the effect of adding alpha lipoic acid (ALA) to the vitrification solution of sheep ovarian tissue on 7 days of in vitro culture or 15 days of xenotransplantion. ALA was used at two different concentrations (100 μM: ALA100 and 150 μM: ALA150). Ovarian tissue was evaluated by classical histology (follicular morphology, development, and stromal cell density); immunohistochemistry for forkhead box O3a (FOXO3a); Ki67 (cell proliferation); cluster of differentiation 31 (CD31); and alpha smooth muscle actin (α-SMA). Reactive oxygen species (ROS) levels in ovarian tissue, as well as malondialdehyde (MDA) and nitrite levels in the culture medium, were assessed. Similar percentage of morphologically normal follicles was found in the vitrified ovarian tissue in the presence of ALA100 or ALA150 after in vitro culture or xenotransplantation. Follicular development from all treatments was higher (P < 0.05) than the control group. Moreover, an activation of primordial follicles was observed by FOXO3a. Stromal cell density and immunostaining for Ki67 and CD31 were significantly higher (P < 0.05) in ALA150 vitrified tissue. No difference (P > 0.05) was found in α-SMA between ALA concentrations after in vitro culture or xenograft. ROS levels in the ovarian tissue were similar (P > 0.05) in all treatments, as well as MDA and nitrite levels after 7 days of culture. We concluded that the addition of ALA 150 is able to better preserve the stromal cell density favoring granulosa cell proliferation and neovascularization.

Also flagged:VEGF receptor 2KDRmucusCFairway obstructionCytokines
Journal Article 2021-05-18 ✓ 1 Snippet Jiang M, Fang Y, Li Y, Huang H, Wei Z, Gao X, Sung HK, Hu J, Qiang L, Ruan J, Chen Q, Jiang D, Whitsett JA, Ai X, Que J.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Mucus-secreting goblet cells are the dominant cell type in pulmonary diseases, e.g., asthma and cystic fibrosis (CF), leading to pathologic mucus metaplasia and airway obstruction. Cytokines including IL-13 are the major players in the transdifferentiation of club cells into goblet cells. Unexpectedly, we have uncovered a previously undescribed pathway promoting mucous metaplasia that involves VEGFa and its receptor KDR. Single-cell RNA sequencing analysis coupled with genetic mouse modeling demonstrates that loss of epithelial VEGFa, KDR, or MEK/ERK kinase promotes excessive club-to-goblet transdifferentiation during development and regeneration. Sox9 is required for goblet cell differentiation following Kdr inhibition in both mouse and human club cells. Significantly, airway mucous metaplasia in asthmatic and CF patients is also associated with reduced KDR signaling and increased SOX9 expression. Together, these findings reveal an unexpected role for VEGFa/KDR signaling in the defense against mucous metaplasia, offering a potential therapeutic target for this common airway pathology.

Also flagged:membranecell migrationcell morphogenesismembranescell motilityaxon
Journal Article 2021-05-18 No Snippets Sherwood DR.
Show Full Abstract

Basement membranes (BMs) are thin, dense forms of extracellular matrix that underlie or surround most animal tissues. BMs are enormously complex and harbor numerous proteins that provide essential signaling, mechanical, and barrier support for tissues during their development and normal functioning. As BMs are found throughout animal tissues, cells frequently migrate, change shape, and extend processes along BMs. Although sometimes used only as passive surfaces by cells, studies in developmental contexts are finding that BMs are often actively modified to help guide cell motility and cell morphogenesis. Here, I provide an overview of recent work revealing how BMs are remodeled in remarkably diverse ways to direct cell migration, cell orientation, axon guidance, and dendrite branching events during animal development.

Also flagged:Prostate CancerPCaAScancerdeathprostate-specific antigen
Journal Article 2021-05-18 No Snippets Gandellini P, Ciniselli CM, Rancati T, Marenghi C, Doldi V, El Bezawy R, Lecchi M, Claps M, Catanzaro M, Avuzzi B, Campi E, Colecchia M, Badenchini F, Verderio P, Valdagni R, Zaffaroni N.
Show Full Abstract

Active surveillance (AS) has evolved as a strategy alternative to radical treatments for very low risk and low-risk prostate cancer (PCa). However, current criteria for selecting AS patients are still suboptimal. Here, we performed an unprecedented analysis of the circulating miRNome to investigate whether specific miRNAs associated with disease reclassification can provide risk refinement to standard clinicopathological features for improving patient selection. The global miRNA expression profiles were assessed in plasma samples prospectively collected at baseline from 386 patients on AS included in three independent mono-institutional cohorts (training, testing and validation sets). A three-miRNA signature (<i>miR-511-5p</i>, <i>miR-598-3p</i> and <i>miR-199a-5p</i>) was found to predict reclassification in all patient cohorts (training set: AUC 0.74, 95% CI 0.60-0.87, testing set: AUC 0.65, 95% CI 0.51-0.80, validation set: AUC 0.68, 95% CI 0.56-0.80). Importantly, the addition of the three-miRNA signature improved the performance of the clinical model including clinicopathological variables only (AUC 0.70, 95% CI 0.61-0.78 vs. 0.76, 95% CI 0.68-0.84). Overall, we trained, tested and validated a three-miRNA signature which, combined with selected clinicopathological variables, may represent a promising biomarker to improve on currently available clinicopathological risk stratification tools for a better selection of truly indolent PCa patients suitable for AS.

Also flagged:RNA-Binding Proteinsneurodegenerative diseasesamyotrophic lateral sclerosisinclusion bodiesmetabolismfrontotemporal dementia
Journal Article 2021-05-18 ✓ 5 Snippets Kinoshita C, Kubota N, Aoyama K.
In-Text Gene Mentions

HD is caused by the expansion of CAG trinucleotide repeats (in excess of 38 repeats) on chromosome 4 in exon 1 of the gene coding huntingtin (HTT) with autosomal-dominant inheritance [214].

HuR stabilizes HTT mRNA by interacting with its exon 11 in a mutant HTT-dependent manner, which might contribute to HD progression through the enhancement of mutant HTT protein accumulation [227].

…gene coding huntingtin (HTT) with autosomal-dominant inhe…

…HuR stabilizesHTTmRNA by interacting…

…in a mutantHTT-dependent manner, which might…

Show Full Abstract

The number of patients with neurodegenerative diseases (NDs) is increasing, along with the growing number of older adults. This escalation threatens to create a medical and social crisis. NDs include a large spectrum of heterogeneous and multifactorial pathologies, such as amyotrophic lateral sclerosis, frontotemporal dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease and multiple system atrophy, and the formation of inclusion bodies resulting from protein misfolding and aggregation is a hallmark of these disorders. The proteinaceous components of the pathological inclusions include several RNA-binding proteins (RBPs), which play important roles in splicing, stability, transcription and translation. In addition, RBPs were shown to play a critical role in regulating miRNA biogenesis and metabolism. The dysfunction of both RBPs and miRNAs is often observed in several NDs. Thus, the data about the interplay among RBPs and miRNAs and their cooperation in brain functions would be important to know for better understanding NDs and the development of effective therapeutics. In this review, we focused on the connection between miRNAs, RBPs and neurodegenerative diseases.

Also flagged:ThalassemiaHistoneγ-globingene expressiontranscription factorsquantitative
Journal Article 2021-05-18 ✓ 1 Snippet Zakaria NA, Islam MA, Abdullah WZ, Bahar R, Mohamed Yusoff AA, Abdul Wahab R, Shamsuddin S, Johan MF.
In-Text Gene Mentions

…HBS1L-MYB , andSOX6, elevates the HbF…

Show Full Abstract

Thalassemia, an inherited quantitative globin disorder, consists of two types, α- and <i>β</i>-thalassemia. <i>β</i>-thalassemia is a heterogeneous disease that can be asymptomatic, mild, or even severe. Considerable research has focused on investigating its underlying etiology. These studies found that DNA hypomethylation in the β-globin gene cluster is significantly related to fetal hemoglobin (HbF) elevation. Histone modification reactivates γ-globin gene expression in adults and increases β-globin expression. Down-regulation of γ-globin suppressor genes, i.e., <i>BCL11A</i>, <i>KLF1</i>, <i>HBG-XMN1</i>, <i>HBS1L-MYB</i>, and <i>SOX6,</i> elevates the HbF level. <i>β</i>-thalassemia severity is predictable through <i>FLT1</i>, <i>ARG2</i>, <i>NOS2A</i>, and <i>MAP3K5</i> gene expression. <i>NOS2A</i> and <i>MAP3K5</i> may predict the <i>β</i>-thalassemia patient's response to hydroxyurea, a HbF-inducing drug. The transcription factors NRF2 and <i>BACH1</i> work with antioxidant enzymes, i.e., <i>PRDX1</i>, <i>PRDX2</i>, <i>TRX1</i>, and <i>SOD1</i>, to protect erythrocytes from oxidative damage, thus increasing their lifespan. A single <i>β</i>-thalassemia-causing mutation can result in different phenotypes, and these are predictable by <i>IGSF4</i> and <i>LARP2</i> methylation as well as long non-coding RNA expression levels. Finally, the coinheritance of <i>β</i>-thalassemia with α-thalassemia ameliorates the <i>β</i>-thalassemia clinical presentation. In conclusion, the management of <i>β</i>-thalassemia is currently limited to genetic and epigenetic approaches, and numerous factors should be further explored in the future.

Also flagged:Pregnane X ReceptorPXRtranscription factormetabolismsteroidseconazole
Journal Article 2021-05-18 No Snippets Creusot N, Garoche C, Grimaldi M, Boulahtouf A, Chiavarina B, Bourguet W, Balaguer P.
Show Full Abstract

The nuclear receptor pregnane X receptor (PXR) is a ligand-dependent transcription factor that regulates genes involved in xenobiotic metabolism in mammals. Many studies suggest that PXR may play a similar role in fish. The interaction of human PXR (hPXR) with a variety of structurally diverse endogenous and exogenous chemicals is well described. In contrast, little is known about the zebrafish PXR (zfPXR). In order to compare the effects of these chemicals on the PXR of these two species, we established reporter cell lines expressing either hPXR or zfPXR. Using these cellular models, we tested the hPXR and zfPXR activity of various steroids and pesticides. We provide evidence that steroids were generally stronger activators of zfPXR while pesticides were more potent on hPXR. In addition, some chemicals (econazole nitrate, mifepristone, cypermethrin) showed an antagonist effect on zfPXR, whereas no antagonist chemical has been identified for hPXR. These results confirm significant differences in the ability of chemicals to modulate zfPXR in comparison to hPXR and point out that zfPXR assays should be used instead of hPXR assays for evaluating the potential risks of chemicals on aquatic species.

Also flagged:ChromatinSystemic Lupus ErythematosusSLEautoimmune diseasetranscription factorsantibodies
Journal Article 2021-05-18 ✓ 1 Snippet Yu H, Hong X, Wu H, Zheng F, Zeng Z, Dai W, Yin L, Liu D, Tang D, Dai Y.
In-Text Gene Mentions

…in DC-2 (HNF1B,POU3F2, TFAP2A, and ZNF740)…

Show Full Abstract

<h4>Objective</h4>Systemic lupus erythematosus (SLE) is a complex autoimmune disease, and various immune cells are involved in the initiation, progression, and regulation of SLE. Our goal was to reveal the chromatin accessibility landscape of peripheral blood mononuclear cells (PBMCs) in SLE patients at single-cell resolution and identify the transcription factors (TFs) that may drive abnormal immune responses.<h4>Methods</h4>The assay for transposase accessible chromatin in single-cell sequencing (scATAC-seq) method was applied to map the landscape of active regulatory DNA in immune cells from SLE patients at single-cell resolution, followed by clustering, peak annotation and motif analysis of PBMCs in SLE.<h4>Results</h4>Peripheral blood mononuclear cells were robustly clustered based on their types without using antibodies. We identified twenty patterns of TF activation that drive abnormal immune responses in SLE patients. Then, we observed ten genes that were highly associated with SLE pathogenesis by altering T cell activity. Finally, we found 12 key TFs regulating the above six genes (<i>CD83</i>, <i>ELF4</i>, <i>ITPKB</i>, <i>RAB27A</i>, <i>RUNX3</i>, and <i>ZMIZ1</i>) that may be related to SLE disease pathogenesis and were significantly enriched in SLE patients (p <0.05, FC >2). With qPCR experiments on <i>CD83</i>, <i>ELF4</i>, <i>RUNX3</i>, and <i>ZMIZ1</i> in B cells, we observed a significant difference in the expression of genes (<i>ELF4</i>, <i>RUNX3</i>, and <i>ZMIZ1</i>), which were regulated by seven TFs (EWSR1-FLI1, MAF, MAFA, NFIB, NR2C2 (var. 2), TBX4, and TBX5). Meanwhile, the seven TFs showed highly accessible binding sites in SLE patients.<h4>Conclusions</h4>These results confirm the importance of using single-cell sequencing to uncover the real features of immune cells in SLE patients, reveal key TFs in SLE-PBMCs, and provide foundational insights relevant for epigenetic therapy.

Also flagged:Nucleic AcidPax5CXCR4-proCyclosporineiNOS
Journal Article 2021-05-18 ✓ 1 Snippet Bassani B, Tripodo C, Portararo P, Gulino A, Botti L, Chiodoni C, Jachetti E, Bolli N, Ciciarello M, Joehrens K, Anagnostopoulos I, Na IK, Curti A, Colombo MP, Sangaletti S.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

<h4>Background</h4>Within the bone marrow (BM), mature T cells are maintained under homeostatic conditions to facilitate proper hematopoietic development. This homeostasis depends upon a peculiar elevated frequency of regulatory T cells (Tregs) and immune regulatory activities from BM-mesenchymal stem cells (BM-MSCs). In response to BM transplantation (BMT), the conditioning regimen exposes the BM to a dramatic induction of inflammatory cytokines and causes an unbalanced T-effector (Teff) and Treg ratio. This imbalance negatively impacts hematopoiesis, particularly in regard to B-cell lymphopoiesis that requires an intact cross-talk between BM-MSCs and Tregs. The mechanisms underlying the ability of BM-MSCs to restore Treg homeostasis and proper B-cell development are currently unknown.<h4>Methods</h4>We studied the role of host radio-resistant cell-derived CD40 in restoring Teff/Treg homeostasis and proper B-cell development in a murine model of BMT. We characterized the host cellular source of CD40 and performed radiation chimera analyses by transplanting WT or <i>Cd40-KO</i> with WT BM in the presence of T-reg and co-infusing WT or - <i>Cd40-KO</i> BM-MSCs. Residual host and donor T cell expansion and activation (cytokine production) and also the expression of Treg fitness markers and conversion to Th17 were analyzed. The presence of <i>Cd40+</i> BM-MSCs was analyzed in a human setting in correlation with the frequency of B-cell precursors in patients who underwent HSCT and variably developed acute graft-versus-host (aGVDH) disease.<h4>Results</h4>CD40 expression is nearly undetectable in the BM, yet a <i>Cd40-KO</i> recipient of WT donor chimera exhibited impaired B-cell lymphopoiesis and Treg development. Lethal irradiation promotes CD40 and OX40L expression in radio-resistant BM-MSCs through the induction of pro-inflammatory cytokines. OX40L favors Teff expansion and activation at the expense of Tregs; however, the expression of CD40 dampens OX40L expression and restores Treg homeostasis, thus facilitating proper B-cell development. Indeed, in contrast to dendritic cells in secondary lymphoid organs that require CD40 triggers to express OX40L, BM-MSCs require CD40 to inhibit OX40L expression.<h4>Conclusions</h4>CD40+ BM-MSCs are immune regulatory elements within BM. Loss of CD40 results in uncontrolled T cell activation due to a reduced number of Tregs, and B-cell development is consequently impaired. GVHD provides an example of how a loss of CD40+ BM-MSCs and a reduction in B-cell precursors may occur in a human setting.

Also flagged:Coronary Atherosclerosisatherosclerosisheart attackhematoxylinlipoproteinpolymerase
Journal Article 2021-05-18 ✓ 3 Snippets Zhou Y, Zhang S, Ji W, Gan X, Hua L, Hou C, Chen J, Wang Y, He S, Zhou H, Jia E.
In-Text Gene Mentions

…that GON4L, STMN1,ZNFX1, CD9, HSD17B4, M6PR,…

…STMN1 , andZNFX1by adsorbing miRNAs,…

…STMN1 , andZNFX1was weakened.…

Show Full Abstract

We aimed to investigate differentially expressed long non-coding RNAs (lncRNAs) and messenger RNAs (mRNAs) in atherosclerosis and validate the expression of lncRNAs and co-expressed target genes in proliferation and migration models of human coronary artery smooth muscle cells (HCASMCs). Ten coronary artery specimens from a subject who died from a heart attack were employed. The pathological analysis was analyzed by hematoxylin and eosin (H&E) staining, and the lncRNAs and mRNAs were identified by RNA sequencing. Bioinformatic analyses were performed to predict possible mechanisms. The proliferation and migration of HCASMCs were induced with oxidized low-density lipoprotein (ox-LDL). Differentially expressed lncRNAs and mRNAs were validated by quantitative real-time polymerase chain reaction (qRT-PCR). In this study, 68 lncRNAs and 222 mRNAs were identified differentially expressed in atherosclerosis. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses showed that the Fanconi anemia pathway may be involved in atherosclerosis. <i>GON4L</i> was found to be the co-localized target gene of LNC_000439, and 14 genes had high correlations with the expression of seven lncRNAs. In addition, nine lncRNA-miRNA-mRNA networks were constructed, and 53 co-expressed gene modules were detected with weighted gene co-expression network analysis (WGCNA). LNC_000684, LNC_001046, LNC_001333, LNC_001538, and LNC_002115 were downregulated, while LNC_002936 was upregulated in proliferation and migration models of HCASMCs. In total, six co-expressed mRNAs were upregulated in HCASMCs. This study suggests that the differentially expressed lncRNAs identified by RNA sequencing and validated in smooth muscle cells may be a target for regulating HCASMC proliferation and migration in atherosclerosis, which will provide a new diagnostic basis and therapeutic target for the treatment of cardiovascular diseases.

Also flagged:mineralscalcium ionscalciumhydroxyapatitegelatinwater
Journal Article 2021-05-18 No Snippets Li X, He Z, Xu J, Zhang L, Liang Y, Yang S, Wang Z, Zhang D, Gao F, Li H.
Show Full Abstract

The chemical composition and hardness of bovine bone, porcine bone, chicken bone, and rabbit bone were compared, as well as the influence of nanoprocessing on the physicochemical characteristics of these bone powders. A series of nanofabrication processes led to an increase in bone minerals and the loss of protein and fat. The hardness of softened bovine bone was still the largest, whereas chicken and rabbit bones were relatively soft. There were no significant differences in the functional groups between nanoscale bone powders. Overall, nanomachining significantly reduced and homogenized the bone particle size and improved the color and release rate of calcium ions of bone powders at the same time; these effects were different for several bones. Nanoscale rabbit bone had higher comminution efficiency, as well as satisfactory nutritional value, color, and product yield, which supports its strong development potential.

Also flagged:AIDSsynthesisamino acidheterocyclespyransflavones
Journal Article 2021-05-18 No Snippets Kumar D, Sharma P, Shabu, Kaur R, Lobe MMM, Gupta GK, Ntie-Kang F.
Show Full Abstract

The HIV/AIDS pandemic is a serious threat to the health and development of mankind, which has affected about 37.9 million people worldwide. The increasing negative health, economic and social impacts of this disease have led to the search for new therapeutic candidates for the mitigation of AIDS/HIV. However, to date, there is still no treatment that can cure this disease. Furthermore, the clinically available drugs have numerous severe side effects. Hence, the synthesis of novel agents from natural leads is one of the rational approaches to obtain new drugs in modern medicinal chemistry. This review article is an effort to summarize recent developments with regards to the discovery of novel analogs with promising biological potential against HIV/AIDS. Herein, we also aim to discuss prospective directions on the progress of more credible and specific analogues. Besides presenting design strategies, the present communication also highlights the structure-activity relationship together with the structural features of the most promising molecules, their IC<sub>50</sub> values, mechanistic insights and some interesting key findings revealed during their biological evaluation. The interactions with the amino acid residues of the enzymes responsible for HIV-1 inhibition are also discussed. This collection will be of great interest for researchers working in this area.

Also flagged:Protein kinase CK2Ser/Thr protein kinasecancerinfectionshostCOVID-19
Journal Article 2021-05-17 ✓ 1 Snippet Borgo C, D'Amore C, Sarno S, Salvi M, Ruzzene M.
In-Text Gene Mentions

Huntington’s disease (HD) is a dominant neurodegenerative disease caused by an expanded CAG repeat in the HTT gene encoding the Huntingtin protein (HTT).

Show Full Abstract

CK2 is a constitutively active Ser/Thr protein kinase, which phosphorylates hundreds of substrates, controls several signaling pathways, and is implicated in a plethora of human diseases. Its best documented role is in cancer, where it regulates practically all malignant hallmarks. Other well-known functions of CK2 are in human infections; in particular, several viruses exploit host cell CK2 for their life cycle. Very recently, also SARS-CoV-2, the virus responsible for the COVID-19 pandemic, has been found to enhance CK2 activity and to induce the phosphorylation of several CK2 substrates (either viral and host proteins). CK2 is also considered an emerging target for neurological diseases, inflammation and autoimmune disorders, diverse ophthalmic pathologies, diabetes, and obesity. In addition, CK2 activity has been associated with cardiovascular diseases, as cardiac ischemia-reperfusion injury, atherosclerosis, and cardiac hypertrophy. The hypothesis of considering CK2 inhibition for cystic fibrosis therapies has been also entertained for many years. Moreover, psychiatric disorders and syndromes due to CK2 mutations have been recently identified. On these bases, CK2 is emerging as an increasingly attractive target in various fields of human medicine, with the advantage that several very specific and effective inhibitors are already available. Here, we review the literature on CK2 implication in different human pathologies and evaluate its potential as a pharmacological target in the light of the most recent findings.

Also flagged:colorectal cancerpolyposischromogranin ACancerHematoxylinserine residue
Journal Article 2021-05-17 ✓ 4 Snippets Jennelle LT, Dampier CH, Tring S, Powell S, Casey G.
In-Text Gene Mentions

OLFM4

…CD166, LRIG1, MSI1,OLFM4, and PTK7.…

…LGR5 (Miltenyi), orOLFM4(Cell Signaling) (Table…

…Ki67, LGR5, andOLFM4.…

Show Full Abstract

<h4>Introduction</h4>Familial adenomatous polyposis (FAP) is a hereditary colorectal cancer (CRC) syndrome characterized by accelerated adenoma development due to inherited (or de novo) mutations in the APC regulator of WNT signaling pathway (APC) gene. The mechanism underlying this accelerated polyp development in subjects with FAP has not been defined. Given that LGR5+ stem cells drive crypt cell proliferation, we hypothesized that FAP crypts would demonstrate aberrant leucine-rich repeat-containing G-protein-coupled receptor 5 (LGR5) staining patterns.<h4>Methods</h4>Biopsies were taken from 11 healthy subjects, 7 subjects with Lynch syndrome, 4 subjects with FAP, and 1 subject with MUTYH-associated polyposis syndrome during routine screening or surveillance colonoscopy. Crypt staining was evaluated by immunohistochemistry of paraffin-embedded tissue sections. Stem cell numbers were estimated by immunofluorescence staining of isolated crypts using antibodies against LGR5 and other proteins.<h4>Results</h4>Subjects with FAP exhibited a greater number of LGR5+ stem cells in their crypts than healthy subjects and subjects with Lynch syndrome and MUTYH-associated polyposis syndrome. Most crypts of subjects with FAP harbored LGR5+ cells located above the lower third of the crypts.<h4>Discussion</h4>These findings support a model in which inactivation of one copy of APC leads to increased numbers of LGR5+ stem cells, many of which are ectopic, in colon crypts of subjects with FAP. Overabundant and ectopic LGR5+ stem cells could lead to an expanded proliferative zone of dividing cells more likely to develop mutations that would contribute to the accelerated adenoma development observed in FAP.

Also flagged:GolgiDegradationmacroautophagyCalcoco1ZDHHC17Neurological Disorders
Journal Article 2021-05-17 No Snippets Yamamoto A.
Show Full Abstract

Degradation by macroautophagy can be highly selective, but given the promiscuity of cargo receptors, questions remain surrounding how this selectivity is achieved. In this issue, Nthiga et al. (2021. J. Cell Biol.https://doi.org/10.1083/jcb.202006128) show how the adaptor Calcoco1 distinguishes cargo by how it binds.

Also flagged:Cyclic PeptidesProtein Kinasesignal transductioncancerargininetryptophan
Journal Article 2021-05-17 No Snippets Sanner MF, Zoghebi K, Hanna S, Mozaffari S, Rahighi S, Tiwari RK, Parang K.
Show Full Abstract

Under-expression or overexpression of protein kinases has been shown to be associated with unregulated cell signal transduction in cancer cells. Therefore, there is major interest in designing protein kinase inhibitors as anticancer agents. We have previously reported [WR]<sub>5</sub>, a peptide containing alternative arginine (R) and tryptophan (W) residues as a non-competitive c-Src tyrosine kinase inhibitor. A number of larger cyclic peptides containing alternative hydrophobic and positively charged residues [WR]<sub><i>x</i></sub> (<i>x</i> = 6-9) and hybrid cyclic-linear peptides, [R<sub>6</sub>K]W<sub>6</sub> and [R<sub>5</sub>K]W<sub>7</sub>, containing R and W residues were evaluated for their protein kinase inhibitory potency. Among all the peptides, cyclic peptide [WR]<sub>9</sub> was found to be the most potent tyrosine kinase inhibitor. [WR]<sub>9</sub> showed higher inhibitory activity (IC<sub>50</sub> = 0.21 μM) than [WR]<sub>5</sub>, [WR]<sub>6</sub>, [WR]<sub>7</sub>, and [WR]<sub>8</sub> with IC<sub>50</sub> values of 0.81, 0.57, 0.35, and 0.33 μM, respectively, against c-Src kinase as determined by a radioactive assay using [γ-<sup>33</sup>P]ATP. Consistent with the result above, [WR]<sub>9</sub> inhibited other protein kinases such as Abl kinase activity with an IC<sub>50</sub> value of 0.35 μM, showing 2.2-fold higher inhibition than [WR]<sub>5</sub> (IC<sub>50</sub> = 0.79 μM). [WR]<sub>9</sub> also inhibited PKCa kinase activity with an IC<sub>50</sub> value of 2.86 μM, approximately threefold higher inhibition than [WR]<sub>5</sub> (IC<sub>50</sub> = 8.52 μM). A similar pattern was observed against Braf, c-Src, Cdk2/cyclin A1, and Lck. [WR]<sub>9</sub> exhibited IC<sub>50</sub> values of <0.25 μM against Akt1, Alk, and Btk. These data suggest that [WR]<sub>9</sub> is consistently more potent than other cyclic peptides with a smaller ring size and hybrid cyclic-linear peptides [R<sub>6</sub>K]W<sub>6</sub> and [R<sub>5</sub>K]W<sub>7</sub> against selected protein kinases. Thus, the presence of R and W residues in the ring, ring size, and the number of amino acids in the structure of the cyclic peptide were found to be critical in protein kinase inhibitory potency. We identified three putative binding pockets through automated blind docking of cyclic peptides [WR]<sub>(5-9)</sub>. The most populated pocket is located between the SH2, SH3, and N-lobe domains on the opposite side of the ATP binding site. The second putative pocket is formed by the same domains and located on the ATP binding site side of the protein. Finally, a third pocket was identified between the SH2 and SH3 domains. These results are consistent with the non-competitive nature of the inhibition displayed by these molecules. Molecular dynamics simulations of the protein-peptide complexes indicate that the presence of either [WR]<sub>5</sub> or [WR]<sub>9</sub> affects the plasticity of the protein and in particular the volume of the ATP binding site pocket in different ways. These results suggest that the second pocket is most likely the site where these peptides bind and offer a plausible rationale for the increased affinity of [WR]<sub>9</sub>.

Also flagged:KCNJ11MyoD1potassium channelsgene expressionpolymerasemetabolic syndromes
Journal Article 2021-05-17 ✓ 5 Snippets Fernandes AC, da Silva VH, Goes CP, Moreira GCM, Godoy TF, Ibelli AMG, Peixoto JO, Cantão ME, Ledur MC, de Rezende FM, Coutinho LL.
In-Text Gene Mentions

…KCNJ11, MyoD1 andSOX6, known to…

…, MyoD1 andSOX6, were annotated…

…, PIK3C2A andSOX6genes, which might…

…associated with theSOX6, a gene…

…level of theSOX6gene was positively…

Show Full Abstract

<h4>Background</h4>Copy number variations (CNVs) are a major type of structural genomic variants that underlie genetic architecture and phenotypic variation of complex traits, not only in humans, but also in livestock animals. We identified CNVs along the chicken genome and analyzed their association with performance traits. Genome-wide CNVs were inferred from Affymetrix® high density SNP-chip data for a broiler population. CNVs were concatenated into segments and association analyses were performed with linear mixed models considering a genomic relationship matrix, for birth weight, body weight at 21, 35, 41 and 42 days, feed intake from 35 to 41 days, feed conversion ratio from 35 to 41 days and, body weight gain from 35 to 41 days of age.<h4>Results</h4>We identified 23,214 autosomal CNVs, merged into 5042 distinct CNV regions (CNVRs), covering 12.84% of the chicken autosomal genome. One significant CNV segment was associated with BWG on GGA3 (q-value = 0.00443); one significant CNV segment was associated with BW35 (q-value = 0.00571), BW41 (q-value = 0.00180) and BW42 (q-value = 0.00130) on GGA3, and one significant CNV segment was associated with BW on GGA5 (q-value = 0.00432). All significant CNV segments were verified by qPCR, and a validation rate of 92.59% was observed. These CNV segments are located nearby genes, such as KCNJ11, MyoD1 and SOX6, known to underlie growth and development. Moreover, gene-set analyses revealed terms linked with muscle physiology, cellular processes regulation and potassium channels.<h4>Conclusions</h4>Overall, this CNV-based GWAS study unravels potential candidate genes that may regulate performance traits in chickens. Our findings provide a foundation for future functional studies on the role of specific genes in regulating performance in chickens.

Also flagged:youHAMPSLC40A1hepatocellular carcinomaGene expressioncarcinoma
Journal Article 2021-05-17 ✓ 2 Snippets Hu L, Wu C.
In-Text Gene Mentions

Evaluation of the expression of TFR1 (TFRC), TFR2, HFE, HJV (HFE2), and SLC40A1 in proliferative hepatocytes of HCC and para-carcinoma tissues (Additional file 8: Figure S6) revealed no significant differences in expression between the two types of proliferative hepatocytes and between hepatocytes from HCC and para-carcinoma tissues (Additional file 1: Tables S5, S6).

…), TFR2 ,HFE, HJV (…

Show Full Abstract

<h4>Background</h4>Identification of factors associated with proliferation in the hepatocellular carcinoma (HCC) microenvironment aids in understanding the mechanisms of disease progression and provides druggable targets. Gene expression profiles of individual cells in HCC and para-carcinoma tissues can be effectively obtained using the single-cell RNA sequencing (scRNA-Seq) technique. Here, we aimed to identify proliferative hepatocytes from HCC and para-carcinoma tissues, detect differentially expressed genes between the two types of proliferative hepatocytes, and investigate their potential roles in aberrant proliferation.<h4>Results</h4>Two respective gene signatures for proliferative cells and hepatocytes were established and used to identify proliferative hepatocytes from HCC and para-carcinoma tissues based on scRNA-Seq data. Gene expression profiles between the two types of proliferative hepatocytes were compared. Overall, 40 genes were upregulated in proliferative hepatocytes from para-carcinoma tissue, whereas no upregulated genes were detected in those from HCC tissue. Twelve of the genes, including HAMP, were specifically expressed in the liver tissue. Based on previous reports, we found that HAMP modulates cell proliferation through interaction with its receptor SLC40A1. Comprehensive analysis of cells in HCC and para-carcinoma tissues revealed that: (1) HAMP is specifically expressed in hepatocytes and significantly downregulated in malignant hepatocytes; (2) a subset of macrophages expressing SLC40A1 and genes reacting to various infections is present in para-carcinoma but not in HCC tissue. We independently validated the findings with scRNA-Seq and large-scale tissue bulk RNA-Seq/microarray analyses.<h4>Conclusion</h4>HAMP was significantly downregulated in malignant hepatocytes. In addition, a subset of macrophages expressing SLC40A1 and genes reacting to various infections was absent in HCC tissue. These findings support the involvement of HAMP-SLC40A1 signaling in aberrant hepatocyte proliferation in the HCC microenvironment. The collective data from our in silico analysis provide novel insights into the mechanisms underlying HCC progression and require further validation with wet laboratory experiments.

Also flagged:gliomacell proliferationmalignant neoplasmpost-transcriptionalgene expressionpathogenesis
Journal Article 2021-05-17 No Snippets Wang L, Liu Y, Yu Z, Gong J, Deng Z, Ren N, Zhong Z, Cai H, Tang Z, Cheng H, Chen S, He Z.
Show Full Abstract

Glioma is an extremely aggressive malignant neoplasm of the central nervous system. MicroRNA (miRNA) are known to bind to specific target mRNA to regulate post-transcriptional gene expression and are, therefore, currently regarded as promising biomarkers for glioma diagnosis and prognosis. The aim of the present study was to examine the pathogenesis and potential molecular markers of glioma by comparing the differential expression of miRNA and mRNA between glioma tissue and peritumor brain tissue. We explored the impact of screened core miRNA and mRNA on cell proliferation, invasion, and migration of glioma. An miRNA expression profile dataset (GSE90603) and a transcriptome profile dataset (GSE90598) were downloaded from combined miRNA-mRNA microarray chips in the Gene Expression Omnibus (GEO) database. Overall, 59 differentially expressed miRNAs (DEMs) and 419 differentially expressed genes (DEGs) were identified using the R limma software package. FunRich software was used to predict DEM target genes and miRNA-gene pairs, and Perl software was used to find overlapping genes between DEGs and DEM target genes. There were 129 overlapping genes regulated by nine miRNAs between target genes of the DEMs and DEGs. The Chinese Glioma Genome Atlas(CGGA) was analyzed in order to identify miRNAs with diagnostic and prognostic significance. MiR-139-5p, miR-137, and miR-338-3p were validated to be significantly linked to prognosis in glioma patients. Finally, we validated that miR-139-5p affected glioma malignant biological behavior via targeting gamma-aminobutyric acid A receptor alpha 1(GABRA1) through rescue experiments. Low miR-139-5p expression was correlated with survival probability and World Health Organization (WHO) grade. MiR-139-5p overexpression inhibited cell proliferation, migration, and invasion of glioma in vitro. GABRA1 was identified as a functional downstream target of miR-139-5p. Decreased GABRA1 expression was related to similar biological roles as miR-139-5p overexpression while upregulation of GABRA1 effectively reversed the inhibition effects of miR-139-5p. These results demonstrate a novel axis for miR-139-5p/GABRA1 in glioma progression and provide potential prognostic predictors and therapeutic target for glioma patients.

Also flagged:NEFMmethylationneurofilamentbreast cancerBRCATumor
Journal Article 2021-05-17 ✓ 1 Snippet Li D, Zhao W, Zhang X, Lv H, Li C, Sun L.
In-Text Gene Mentions

…TMEM173, TNFRSF13B, TNFRSF17,TNFSF4(1 < R…

Show Full Abstract

<h4>Background</h4>This study aims to determine whether NEFM (neurofilament medium) DNA methylation correlates with immune infiltration and prognosis in breast cancer (BRCA) and to explore NEFM-connected immune gene signature.<h4>Methods</h4>NEFM transcriptional expression was analyzed in BRCA and normal breast tissues using Oncomine and Tumor Immune Estimation Resource (TIMER) databases. The relationship between NEFM DNA methylation and NEFM transcriptional expression was investigated in TCGA. Potential influence of NEFM DNA methylation/expression on clinical outcome was evaluated using TCGA BRCA, The Human Protein Atlas and Kaplan-Meier plotter databases. Association of NEFM transcriptional expression/DNA methylation with cancer immune infiltration was investigated using TIMER and TISIDB databases.<h4>Results</h4>High expression of NEFM correlated with better overall survival (OS) and recurrence-free survival (RFS) in TCGA BRCA and Kaplan-Meier plotter, whereas NEFM DNA methylation with worse OS in TCGA BRCA. NEFM transcriptional expression negatively correlated with DNA methylation. NEFM DNA methylation significantly negatively correlated with infiltrating levels of B, CD8<sup>+</sup> T/CD4<sup>+</sup> T cells, macrophages, neutrophils and dendritic cells in TIMER and TISIDB. NEFM expression positively correlated with macrophage infiltration in TIMER and TISIDB. After adjusted with tumor purity, NEFM expression weekly negatively correlated with infiltration level of B cells, whereas positively correlated with CD8<sup>+</sup> T cell infiltration in TIMER gene modules. NEFM expression/DNA methylation correlated with diverse immune markers in TCGA and TISIDB.<h4>Conclusions</h4>NEFM low-expression/DNA methylation correlates with poor prognosis. NEFM expression positively correlates with macrophage infiltration. NEFM DNA methylation strongly negatively correlates with immune infiltration in BRCA. Our study highlights novel potential functions of NEFM expression/DNA methylation in regulation of tumor immune microenvironment.

Also flagged:SPLABRβ-galhearingMitochondrialaging
Journal Article 2021-05-17 ✓ 5 Snippets Miwa T, Wei FY, Tomizawa K.
In-Text Gene Mentions

Cdk5rap1-KO or CNT mouse embryonic fibroblasts, provided by Prof. Kazuhito Tomizawa (Kumamoto University) [22] were cultured in 24-well plates (0.2 × 106 cells/well) in a high-glucose OptiMEM medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and 1% penicillin/streptomycin solution (Thermo Fisher Scientific) at 37 °C and 5% CO2.

Furthermore, we did not find any age-related changes in SV thickness despite early aging and increased apoptosis in Cdk5rap1-KO MEFs and the importance of SV thickness for AHL pathogenesis [30, 34].

To assess the cochlear surface morphology, the Cdk5rap1-KO and CNT mice were fixed using 4% paraformaldehyde by cardiac perfusion under deep anesthesia induced by intraperitoneal injection of 4 mg/kg xylazine (Bayer, Shawnee Mission, KS, USA) and 120 mg/kg ketamine-HCl (Daiichi Sankyo, Tokyo, Japan) in 0.9% NaCl.

Furthermore, pyruvate and lactate levels were significantly higher in the cochlea of Cdk5rap1-KO mice than those in the CNT mice at 20 weeks (Fig. 5d, e; pyruvate, P = 0.01, F(1, 5) = 12.6, P = 0.04; lactate, P = 0.003, F(1, 5) = 24.6, P = 0.03).

We observed a significant reduction in fumarate concentration in the cochlea of Cdk5rap1-KO mice compared to that of the CNT mice at 4 and 12 weeks of age (Fig. 5c; P = 0.001 both, F(1, 5) = 14.6, P = 0.001); however, no significant differences were observed at 20 weeks of age (Fig. 5c; P = 0.30).

Show Full Abstract

Mitochondrial dysfunction is associated with aging and age-related hearing loss (AHL). However, the precise mechanisms underlying the pathophysiology of hearing loss remain unclear. Cdk5 regulatory subunit-associated protein 1 (CDK5RAP1) enables efficient intramitochondrial translation by catalyzing the deposition of 2-methylthio modifications on mitochondrial tRNAs. Here we investigated the effect of defective mitochondrial protein translation on hearing and AHL in a Cdk5rap1 deficiency C57BL/6 mouse model. Compared to control C57BL/6 mice, Cdk5rap1-knockout female mice displayed hearing loss phenotypically similar to AHL from an early age. The premature hearing loss in Cdk5rap1-knockout mice was associated with the degeneration of the spiral ligament and reduction of endocochlear potentials following the loss of auditory sensory cells. Furthermore, cultured primary mouse embryonic fibroblasts displayed early onset of cellular senescence associated with high oxidative stress and cell death. These results indicate that the CDK5RAP1 deficiency-induced defective mitochondrial translation might cause early hearing loss through the induction of cellular senescence and cochlear dysfunction in the inner ear. Our results suggest that the accumulation of dysfunctional mitochondria might promote AHL progression. Furthermore, our findings suggest that mitochondrial dysfunction and dysregulated mitochondrial tRNA modifications mechanistically cause AHL. Understanding the mechanisms underlying AHL will guide future clinical investigations and interventions in the attempt to mitigate the consequences of AHL.

Also flagged:XPR1EFNA4CKAP5NKAPLANKRD42KNCN
Journal Article 2021-05-17 ✓ 4 Snippets Zhao B, Shan Y, Yang Y, Yu Z, Li T, Wang X, Luo T, Zhu Z, Sullivan P, Zhao H, Li Y, Zhu H.
In-Text Gene Mentions

DCC

…and GWAS (DCC, LRRC37A, ANKRD42 ,…

…ten ( ANKRD42,DCC, LRRC37A, NUP210L, DOK5,…

…we found thatDCC, MIR1-1HG, DPP4 ,…

Show Full Abstract

Structural variations of the human brain are heritable and highly polygenic traits, with hundreds of associated genes identified in recent genome-wide association studies (GWAS). Transcriptome-wide association studies (TWAS) can both prioritize these GWAS findings and also identify additional gene-trait associations. Here we perform cross-tissue TWAS analysis of 211 structural neuroimaging and discover 278 associated genes exceeding Bonferroni significance threshold of 1.04 × 10<sup>-8</sup>. The TWAS-significant genes for brain structures have been linked to a wide range of complex traits in different domains. Through TWAS gene-based polygenic risk scores (PRS) prediction, we find that TWAS PRS gains substantial power in association analysis compared to conventional variant-based GWAS PRS, and up to 6.97% of phenotypic variance (p-value = 7.56 × 10<sup>-31</sup>) can be explained in independent testing data sets. In conclusion, our study illustrates that TWAS can be a powerful supplement to traditional GWAS in imaging genetics studies for gene discovery-validation, genetic co-architecture analysis, and polygenic risk prediction.

Also flagged:CisplatinHYPMPGPEP1LCOX7A1AGO2GNG11
Journal Article 2021-05-17 ✓ 5 Snippets Monroe JD, Moolani SA, Irihamye EN, Lett KE, Hebert MD, Gibert Y, Smith ME.
In-Text Gene Mentions

MRPL39

As miR-25-5p may be sponged via phenanthriplatin-mediated upregulation of lnc-MRPL39-10 (Table 3), this miRNA could be downregulated in A549 cells, which is associated with anti-cancer effect via PI3K signaling25.

…sequence homology to lnc-MRPL39-10, a lncRNA upregulated…

…complex reduces, and lnc-MRPL39-10, which phenanthriplatin in…

…miR-25-5p via increased lnc-MRPL39-10 expression could promote…

Show Full Abstract

The monofunctional platinum(II) complex, phenanthriplatin, acts by blocking transcription, but its regulatory effects on long-noncoding RNAs (lncRNAs) have not been elucidated relative to traditional platinum-based chemotherapeutics, e.g., cisplatin. Here, we treated A549 non-small cell lung cancer and IMR90 lung fibroblast cells for 24 h with either cisplatin, phenanthriplatin or a solvent control, and then performed microarray analysis to identify regulated lncRNAs. RNA22 v2 microRNA software was subsequently used to identify microRNAs (miRNAs) that might be suppressed by the most regulated lncRNAs. We found that miR-25-5p, -30a-3p, -138-5p, -149-3p, -185-5p, -378j, -608, -650, -708-5p, -1253, -1254, -4458, and -4516, were predicted to target the cisplatin upregulated lncRNAs, IMMP2L-1, CBR3-1 and ATAD2B-5, and the phenanthriplatin downregulated lncRNAs, AGO2-1, COX7A1-2 and SLC26A3-1. Then, we used qRT-PCR to measure the expression of miR-25-5p, -378j, -4516 (A549) and miR-149-3p, -608, and -4458 (IMR90) to identify distinct signaling effects associated with cisplatin and phenanthriplatin. The signaling pathways associated with these miRNAs suggests that phenanthriplatin may modulate Wnt/β-catenin and TGF-β signaling through the MAPK/ERK and PTEN/AKT pathways differently than cisplatin. Further, as some of these miRNAs may be subject to dissimilar lncRNA targeting in A549 and IMR90 cells, the monofunctional complex may not cause toxicity in normal lung compared to cancer cells by acting through distinct lncRNA and miRNA networks.

Also flagged:AFRS21chi2howpsychoticpsychiatric diseases
Journal Article 2021-05-17 ✓ 5 Snippets Mullins N, Forstner AJ, O'Connell KS, Coombes B, Coleman JRI, Qiao Z, Als TD, Bigdeli TB, Børte S, Bryois J, Charney AW, Drange OK, Gandal MJ, Hagenaars SP, Ikeda M, Kamitaki N, Kim M, Krebs K, Panagiotaropoulou G, Schilder BM, Sloofman LG, Steinberg S, Trubetskoy V, Winsvold BS, Won HH, Abramova L, Adorjan K, Agerbo E, Al Eissa M, Albani D, Alliey-Rodriguez N, Anjorin A, Antilla V, Antoniou A, Awasthi S, Baek JH, Bækvad-Hansen M, Bass N, Bauer M, Beins EC, Bergen SE, Birner A, Bøcker Pedersen C, Bøen E, Boks MP, Bosch R, Brum M, Brumpton BM, Brunkhorst-Kanaan N, Budde M, Bybjerg-Grauholm J, Byerley W, Cairns M, Casas M, Cervantes P, Clarke TK, Cruceanu C, Cuellar-Barboza A, Cunningham J, Curtis D, Czerski PM, Dale AM, Dalkner N, David FS, Degenhardt F, Djurovic S, Dobbyn AL, Douzenis A, Elvsåshagen T, Escott-Price V, Ferrier IN, Fiorentino A, Foroud TM, Forty L, Frank J, Frei O, Freimer NB, Frisén L, Gade K, Garnham J, Gelernter J, Giørtz Pedersen M, Gizer IR, Gordon SD, Gordon-Smith K, Greenwood TA, Grove J, Guzman-Parra J, Ha K, Haraldsson M, Hautzinger M, Heilbronner U, Hellgren D, Herms S, Hoffmann P, Holmans PA, Huckins L, Jamain S, Johnson JS, Kalman JL, Kamatani Y, Kennedy JL, Kittel-Schneider S, Knowles JA, Kogevinas M, Koromina M, Kranz TM, Kranzler HR, Kubo M, Kupka R, Kushner SA, Lavebratt C, Lawrence J, Leber M, Lee HJ, Lee PH, Levy SE, Lewis C, Liao C, Lucae S, Lundberg M, MacIntyre DJ, Magnusson SH, Maier W, Maihofer A, Malaspina D, Maratou E, Martinsson L, Mattheisen M, McCarroll SA, McGregor NW, McGuffin P, McKay JD, Medeiros H, Medland SE, Millischer V, Montgomery GW, Moran JL, Morris DW, Mühleisen TW, O'Brien N, O'Donovan C, Olde Loohuis LM, Oruc L, Papiol S, Pardiñas AF, Perry A, Pfennig A, Porichi E, Potash JB, Quested D, Raj T, Rapaport MH, DePaulo JR, Regeer EJ, Rice JP, Rivas F, Rivera M, Roth J, Roussos P, Ruderfer DM, Sánchez-Mora C, Schulte EC, Senner F, Sharp S, Shilling PD, Sigurdsson E, Sirignano L, Slaney C, Smeland OB, Smith DJ, Sobell JL, Søholm Hansen C, Soler Artigas M, Spijker AT, Stein DJ, Strauss JS, Świątkowska B, Terao C, Thorgeirsson TE, Toma C, Tooney P, Tsermpini EE, Vawter MP, Vedder H, Walters JTR, Witt SH, Xi S, Xu W, Yang JMK, Young AH, Young H, Zandi PP, Zhou H, Zillich L, HUNT All-In Psychiatry, Adolfsson R, Agartz I, Alda M, Alfredsson L, Babadjanova G, Backlund L, Baune BT, Bellivier F, Bengesser S, Berrettini WH, Blackwood DHR, Boehnke M, Børglum AD, Breen G, Carr VJ, Catts S, Corvin A, Craddock N, Dannlowski U, Dikeos D, Esko T, Etain B, Ferentinos P, Frye M, Fullerton JM, Gawlik M, Gershon ES, Goes FS, Green MJ, Grigoroiu-Serbanescu M, Hauser J, Henskens F, Hillert J, Hong KS, Hougaard DM, Hultman CM, Hveem K, Iwata N, Jablensky AV, Jones I, Jones LA, Kahn RS, Kelsoe JR, Kirov G, Landén M, Leboyer M, Lewis CM, Li QS, Lissowska J, Lochner C, Loughland C, Martin NG, Mathews CA, Mayoral F, McElroy SL, McIntosh AM, McMahon FJ, Melle I, Michie P, Milani L, Mitchell PB, Morken G, Mors O, Mortensen PB, Mowry B, Müller-Myhsok B, Myers RM, Neale BM, Nievergelt CM, Nordentoft M, Nöthen MM, O'Donovan MC, Oedegaard KJ, Olsson T, Owen MJ, Paciga SA, Pantelis C, Pato C, Pato MT, Patrinos GP, Perlis RH, Posthuma D, Ramos-Quiroga JA, Reif A, Reininghaus EZ, Ribasés M, Rietschel M, Ripke S, Rouleau GA, Saito T, Schall U, Schalling M, Schofield PR, Schulze TG, Scott LJ, Scott RJ, Serretti A, Shannon Weickert C, Smoller JW, Stefansson H, Stefansson K, Stordal E, Streit F, Sullivan PF, Turecki G, Vaaler AE, Vieta E, Vincent JB, Waldman ID, Weickert TW, Werge T, Wray NR, Zwart JA, Biernacka JM, Nurnberger JI, Cichon S, Edenberg HJ, Stahl EA, McQuillin A, Di Florio A, Ophoff RA, Andreassen OA.
In-Text Gene Mentions

TRIM38

ABT1

BTN3A3

HMGN4

HFE

Show Full Abstract

Bipolar disorder is a heritable mental illness with complex etiology. We performed a genome-wide association study of 41,917 bipolar disorder cases and 371,549 controls of European ancestry, which identified 64 associated genomic loci. Bipolar disorder risk alleles were enriched in genes in synaptic signaling pathways and brain-expressed genes, particularly those with high specificity of expression in neurons of the prefrontal cortex and hippocampus. Significant signal enrichment was found in genes encoding targets of antipsychotics, calcium channel blockers, antiepileptics and anesthetics. Integrating expression quantitative trait locus data implicated 15 genes robustly linked to bipolar disorder via gene expression, encoding druggable targets such as HTR6, MCHR1, DCLK3 and FURIN. Analyses of bipolar disorder subtypes indicated high but imperfect genetic correlation between bipolar disorder type I and II and identified additional associated loci. Together, these results advance our understanding of the biological etiology of bipolar disorder, identify novel therapeutic leads and prioritize genes for functional follow-up studies.

Also flagged:aceruloplasminemiafluoresceinpigmentationironRetinal degenerationCeruloplasmin
Journal Article 2021-05-17 ✓ 1 Snippet Furashova O, Mielke S, Lindner U.
In-Text Gene Mentions

…in a hereditaryhemochromatosisgene.…

Show Full Abstract

<h4>Purpose</h4>To report ocular manifestations of aceruloplasminemia in two adult White siblings.<h4>Methods</h4>The ocular findings were investigated using a multimodal imaging approach including color fundus photography, fluorescein angiography, autofluorescence imaging, and spectral-domain optical coherence tomography.<h4>Results</h4>A 43-year-old woman and a 39-year-old man were diagnosed with aceruloplasminemia based on clinical symptoms, laboratory tests, liver biopsy, and genetic examination of the ceruloplasmin gene confirming the homozygotic mutation G708S. Both patients had no ophthalmologic symptoms, unremarkable anterior segment, and visual acuity of 20/20 in both eyes. Indirect ophthalmoscopy of the fundus revealed subtle yellowish color with punctate inhomogeneous pigmentation in the whole retina. The autofluorescence images demonstrated remarkable punctate hyperfluorescence involving the central and peripheral retina. Spectral-domain optical coherence tomography images showed normal retinal structure in the macular area with intact outer retinal layers. Fluorescein angiography showed a slightly inhomogeneous pattern of hypofluorescence and hyperfluorescence from the early until late angiography phase.<h4>Conclusion</h4>We describe two adult cases of ocular manifestations of a rare hereditary condition with systemic iron overload. Retinal degeneration in aceruloplasminemia might be overlooked on a routine ophthalmic examination and requires at least an autofluorescence image because initial damage at the level of retinal pigment epithelium is not always visible on ophthalmoscopy.

Also flagged:CFTRdiabetesCFsecretionsCognate receptorsIGFBP7
Journal Article 2021-05-17 ✓ 1 Snippet Rotti PG, Evans IA, Zhang Y, Liang B, Cunicelli N, O'Malley Y, Norris AW, Uc A, Engelhardt JF.
In-Text Gene Mentions

PEBP1

Show Full Abstract

<h4>Background</h4>Cystic fibrosis (CF) related diabetes is the most common comorbidity for CF patients and associated with islet dysfunction. Exocrine pancreas remodeling in CF alters the microenvironment in which islets reside. Since CFTR is mainly expressed in pancreatic ductal epithelium, we hypothesized altered CF ductal secretions could impact islet function through paracrine signals.<h4>Method</h4>We evaluated the secretome and cellular proteome of polarized WT and CF ferret ductal epithelia using quantitative ratiometric mass spectrometry. Differentially secreted proteins (DSPs) or expressed cellular proteins were used to mine pathways, upstream regulators and the CFTR interactome to map candidate CF-associated alterations in ductal signaling and phenotype. Candidate DSPs were evaluated for their in vivo pancreatic expression patterns and their functional impact on islet hormone secretion.<h4>Results</h4>The secretome and cellular proteome of CF ductal epithelia was significantly altered relative to WT and implicated dysregulated TGFβ, WNT, and BMP signaling pathways. Cognate receptors of DSPs from CF epithelia were equally distributed among endocrine, exocrine, and stromal pancreatic cell types. IGFBP7 was a downregulated DSP in CF ductal epithelia in vitro and exhibited reduced CF ductal expression in vivo. IGFBP7 also altered WT islet insulin secretion in response to glucose. Many CFTR-associated proteins, including SLC9A3R1, were differentially expressed in the CF cellular proteome. Upstream regulators of the differential CF ductal proteome included TGFβ, PDX1, AKT/PTEN, and INSR signaling. Data is available via ProteomeXchange with identifier PXD025126.<h4>Conclusion</h4>These findings provide a proteomic roadmap for elucidating disturbances in autocrine and paracrine signals from CF pancreatic ducts and how they may alter islet function and maintenance.

Also flagged:PDSAUreainfectiontermcommunity acquired pneumoniaCAP
Journal Article 2021-05-17 No Snippets Do NTT, Li R, Dinh HTT, Nguyen HTL, Dao MQ, Nghiem TNM, Nadjm B, Luong KN, Cao TH, Le DTK, Cluzeau F, Ngo CQ, Chu HT, Vu DQ, van Doorn HR, Roberts CM.
Show Full Abstract

<h4>Objectives</h4>To test the effectiveness of a quality improvement programme to promote adherence to national quality standards (QS) for patients hospitalized with community-acquired pneumonia (CAP), exploring the factors that hindered improvements in clinical practice.<h4>Methods</h4>An improvement bundle aligned to the QS was deployed using plan-do-study-act methodology in a 600 bed hospital in northern Vietnam from July 2018 to April 2019. Proposed care improvements included CURB65 score guided hospitalization, timely diagnosis and inpatient antibiotic treatment review to limit the spectrum and duration of IV antibiotic use. Interviews with medical staff were conducted to better understand the barriers for QS implementation.<h4>Results</h4>The study found that improvements were made in CURB65 score documentation and radiology results available within 4 h (<i>P </i><<i> </i>0.05). There were no significant changes in the other elements of the QS studied. We documented institutional barriers relating to the health reimbursement mechanism and staff cultural barriers relating to acceptance and belief as significant impediments to implementation of the standards.<h4>Conclusions</h4>Interventions led to some process changes, but these were not utilized by clinicians to improve patient management. Institutional and behavioural barriers documented may inhibit wider national uptake of the QS. National system changes with longer term support and investment to address local behavioural barriers are likely to be crucial for future improvements in the management of CAP, and potentially other hospitalized conditions, in Vietnam.

Also flagged:Arachidonoylhydroperoxyphosphatidylethanolamine15-lipoxygenasePE-binding protein 1phospholipid
Journal Article 2021-05-17 ✓ 5 Snippets Mikulska-Ruminska K, Anthonymuthu TS, Levkina A, Shrivastava IH, Kapralov AA, Bayır H, Kagan VE, Bahar I.
In-Text Gene Mentions

Under physiological conditions, arachidonic acid (AA), a polyunsaturated fatty acid (PUFA) also termed cis-5,8,11,14-ETE or shortly ETE, is the preferred substrate of these non-heme iron-containing enzymes; but under inflammatory conditions, such as those stimulated by interleukin-13/4, the formation of the complex 15LOX/PEBP1 shifts the substrate-specificity of 15LOX from free AA to AA esterified into PE (or ETE-PE).

…Arachidonoyl PE by 15LOX/PEBP1: Mechanism and Role…

…PE-binding protein 1 (PEBP1).…

…15LOX-2 complexed withPEBP1, LC-MS redox lipidomics,…

…● interference with 15LOX/PEBP1activity remained unclear.…

Show Full Abstract

We recently discovered an anti-ferroptotic mechanism inherent to M1 macrophages whereby high levels of NO<sup>●</sup> suppressed ferroptosis via inhibition of hydroperoxy-eicosatetraenoyl-phosphatidylethanolamine (HpETE-PE) production by 15-lipoxygenase (15LOX) complexed with PE-binding protein 1 (PEBP1). However, the mechanism of NO<sup>●</sup> interference with 15LOX/PEBP1 activity remained unclear. Here, we use a biochemical model of recombinant 15LOX-2 complexed with PEBP1, LC-MS redox lipidomics, and structure-based modeling and simulations to uncover the mechanism through which NO<sup>●</sup> suppresses ETE-PE oxidation. Our study reveals that O<sub>2</sub> and NO<sup>●</sup> use the same entry pores and channels connecting to 15LOX-2 catalytic site, resulting in a competition for the catalytic site. We identified residues that direct O<sub>2</sub> and NO<sup>●</sup> to the catalytic site, as well as those stabilizing the esterified ETE-PE phospholipid tail. The functional significance of these residues is supported by in silico saturation mutagenesis. We detected nitrosylated PE species in a biochemical system consisting of 15LOX-2/PEBP1 and NO<sup>●</sup> donor and in RAW264.7 M2 macrophages treated with ferroptosis-inducer RSL3 in the presence of NO<sup>●</sup>, in further support of the ability of NO<sup>●</sup> to diffuse to, and react at, the 15LOX-2 catalytic site. The results provide first insights into the molecular mechanism of repression of the ferroptotic Hp-ETE-PE production by NO<sup>●</sup>.

Also flagged:ADcognitive declineneurodegenerative disorderdementiaextracellularbeta-amyloid
Journal Article 2021-05-17 ✓ 1 Snippet Vélez JI, Samper LA, Arcos-Holzinger M, Espinosa LG, Isaza-Ruget MA, Lopera F, Arcos-Burgos M.
In-Text Gene Mentions

…the genetic variantRC3H1-rs10798302, and years…

Show Full Abstract

Machine learning (ML) algorithms are widely used to develop predictive frameworks. Accurate prediction of Alzheimer's disease (AD) age of onset (ADAOO) is crucial to investigate potential treatments, follow-up, and therapeutic interventions. Although genetic and non-genetic factors affecting ADAOO were elucidated by other research groups and ours, the comprehensive and sequential application of ML to provide an exact estimation of the actual ADAOO, instead of a high-confidence-interval ADAOO that may fall, remains to be explored. Here, we assessed the performance of ML algorithms for predicting ADAOO using two AD cohorts with early-onset familial AD and with late-onset sporadic AD, combining genetic and demographic variables. Performance of ML algorithms was assessed using the root mean squared error (RMSE), the R-squared (<i>R</i><sup>2</sup>), and the mean absolute error (MAE) with a 10-fold cross-validation procedure. For predicting ADAOO in familial AD, boosting-based ML algorithms performed the best. In the sporadic cohort, boosting-based ML algorithms performed best in the training data set, while regularization methods best performed for unseen data. ML algorithms represent a feasible alternative to accurately predict ADAOO with little human intervention. Future studies may include predicting the speed of cognitive decline in our cohorts using ML.

Also flagged:OxygenMetabolismMultiple myelomahematological diseaseimmunoglobulinsdeath
Journal Article 2021-05-17 ✓ 2 Snippets Caillot M, Dakik H, Mazurier F, Sola B.
In-Text Gene Mentions

GLRX2/3 and TXN are overexpressed in MM molecular subtypes with adverse prognosis (namely PR, MS, HY), whereas PRDX6 and SOD1 expression are associated with a shorter overall survival [81,128].

…MS, HY), whereasPRDX6and SOD1 expression…

Show Full Abstract

Multiple myeloma (MM) is a common hematological disease characterized by the accumulation of clonal malignant plasma cells in the bone marrow. Over the past two decades, new therapeutic strategies have significantly improved the treatment outcome and patients survival. Nevertheless, most MM patients relapse underlying the need of new therapeutic approaches. Plasma cells are prone to produce large amounts of immunoglobulins causing the production of intracellular ROS. Although adapted to high level of ROS, MM cells die when exposed to drugs increasing ROS production either directly or by inhibiting antioxidant enzymes. In this review, we discuss the efficacy of ROS-generating drugs for inducing MM cell death and counteracting acquired drug resistance specifically toward proteasome inhibitors.

Also flagged:Iron Deficiency Anemiaironceliac diseaseCDIDAsulphate
Journal Article 2021-05-17 No Snippets Talarico V, Giancotti L, Mazza GA, Miniero R, Bertini M.
Show Full Abstract

The iron absorption process developsmainly in the proximal duodenum. This portion of the intestine is typically destroyed in celiac disease (CD), resulting in a reduction in absorption of iron and subsequent iron deficiency anemia (IDA). In fact, the most frequent extra-intestinal manifestation (EIM) of CD is IDA, with a prevalence between 12 and 82% (in relation with the various reports) in patients with new CD diagnosis. The primary treatment of CD is the gluten-free diet (GFD), which is associated with adequate management of IDA, if present. Iron replacement treatment historically has been based on oral products containing ferrous sulphate (FS). However, the absorption of FS is limited in patients with active CD and unpredictable in patients on a GFD. Furthermore, a poor tolerability of this kind of ferrous is particularly frequent in patients with CD or with other inflammatory bowel diseases. Normalization from anemic state typically occurs after at least 6 months of GFD, but the process can take up to 2 years for iron stores to replenish.

Also flagged:-Related Kinase(VRK) 1Vaccinia-related kinaseserin/threonine kinasedamage response
Journal Article 2021-05-17 ✓ 1 Snippet Carrión-Marchante R, Frezza V, Salgado-Figueroa A, Pérez-Morgado MI, Martín ME, González VM.
In-Text Gene Mentions

…in the nucleus,VRK2located in nucleus…

Show Full Abstract

Vaccinia-related kinase (VRK) 1 is a serin/threonine kinase that plays an important role in DNA damage response (DDR), phosphorylating some proteins involved in this process such as 53BP1, NBS1 or H2AX, and in the cell cycle progression. In addition, VRK1 is overexpressed in many cancer types and its correlation with poor prognosis has been determined, showing VRK1 as a new therapeutic target in oncology. Using in vitro selection, high-affinity DNA aptamers to VRK1 were selected from a library of ssDNA. Selection was monitored using the enzyme-linked oligonucleotide assay (ELONA), and the selected aptamer population was cloned and sequenced. Three aptamers were selected and characterized. These aptamers recognized the protein kinase VRK1 with an affinity in the nanomolar range and showed a high sensibility. Moreover, the treatment of the MCF7 breast cell line with these aptamers resulted in a decrease in cyclin D1 levels, and an inhibition of cell cycle progression by G1 phase arrest, which induced apoptosis in cells. These results suggest that these aptamers are specific inhibitors of VRK1 that might be developed as potential drugs for the treatment of cancer.

Also flagged:Mitophagyagingmitochondriamacroautophagyoxygenmitochondrial
Journal Article 2021-05-17 ✓ 1 Snippet De Gaetano A, Gibellini L, Zanini G, Nasi M, Cossarizza A, Pinti M.
In-Text Gene Mentions

…horbol 12-myristate 13-acetatePRDX6Peroxiredoxin-6 Prx3 Peroxired…

Show Full Abstract

Mitochondrial dysfunction is a hallmark of aging. Dysfunctional mitochondria are recognized and degraded by a selective type of macroautophagy, named mitophagy. One of the main factors contributing to aging is oxidative stress, and one of the early responses to excessive reactive oxygen species (ROS) production is the induction of mitophagy to remove damaged mitochondria. However, mitochondrial damage caused at least in part by chronic oxidative stress can accumulate, and autophagic and mitophagic pathways can become overwhelmed. The imbalance of the delicate equilibrium among mitophagy, ROS production and mitochondrial damage can start, drive, or accelerate the aging process, either in physiological aging, or in pathological age-related conditions, such as Alzheimer's and Parkinson's diseases. It remains to be determined which is the prime mover of this imbalance, i.e., whether it is the mitochondrial damage caused by ROS that initiates the dysregulation of mitophagy, thus activating a vicious circle that leads to the reduced ability to remove damaged mitochondria, or an alteration in the regulation of mitophagy leading to the excessive production of ROS by damaged mitochondria.

Also flagged:Cannabinoidcannabinoidsendocannabinoidsendocannabinoidbiosynthesisdegradation
Journal Article 2021-05-17 No Snippets Ghosh S, Stansak K, Walters BJ.
Show Full Abstract

Plants of the genus <i>Cannabis</i> have been used by humans for millennia for a variety of purposes. Perhaps most notable is the use of certain <i>Cannabis</i> strains for their psychoactive effects. More recently, several biologically active molecules within the plants of these <i>Cannabis</i> strains, called phytocannabinoids or simply cannabinoids, have been identified. Furthermore, within human cells, endogenous cannabinoids, or endocannabinoids, as well as the receptors and secondary messengers that give rise to their neuromodulatory effects, have also been characterized. This endocannabinoid system (ECS) is composed of two primary ligands-anandamide and 2-arachidonyl glycerol; two primary receptors-cannabinoid receptors 1 and 2; and several enzymes involved in biosynthesis and degradation of endocannabinoid ligands including diacylglycerol lipase (DAGL) and monoacylglycerol lipase (MAGL). Here we briefly summarize cannabinoid signaling and review what has been discerned to date with regard to cannabinoid signaling in the auditory system and its roles in normal physiological function as well as pathological conditions. While much has been uncovered regarding cannabinoid signaling in the central nervous system, less attention has been paid to the auditory system specifically. Still, evidence is emerging to suggest that cannabinoid signaling is critical for the development, maturation, function, and survival of cochlear hair cells (HCs) and spiral ganglion neurons (SGNs). Furthermore, cannabinoid signaling can have profound effects on synaptic connectivity in CNS structures related to auditory processing. While clinical cases demonstrate that endogenous and exogenous cannabinoids impact auditory function, this review highlights several areas, such as SGN development, where more research is warranted.

Also flagged:Infectioninflammatory diseaseviral infectionsinfectious diseaseinfectionsparasitic infection
Journal Article 2021-05-17 No Snippets Zandstra J, Jongerius I, Kuijpers TW.
Show Full Abstract

Febrile patients, suffering from an infection, inflammatory disease or autoimmunity may present with similar or overlapping clinical symptoms, which makes early diagnosis difficult. Therefore, biomarkers are needed to help physicians form a correct diagnosis and initiate the right treatment to improve patient outcomes following first presentation or admittance to hospital. Here, we review the landscape of novel biomarkers and approaches of biomarker discovery. We first discuss the use of current plasma parameters and whole blood biomarkers, including results obtained by RNA profiling and mass spectrometry, to discriminate between bacterial and viral infections. Next we expand upon the use of biomarkers to distinguish between infectious and non-infectious disease. Finally, we discuss the strengths as well as the potential pitfalls of current developments. We conclude that the use of combination tests, using either protein markers or transcriptomic analysis, have advanced considerably and should be further explored to improve current diagnostics regarding febrile infections and inflammation. If proven effective when combined, these biomarker signatures will greatly accelerate early and tailored treatment decisions.

Also flagged:zeolitealuminosilicatesactivityZeolitesmethanolhydrocarbons
Journal Article 2021-05-17 No Snippets Simancas R, Chokkalingam A, Elangovan SP, Liu Z, Sano T, Iyoki K, Wakihara T, Okubo T.
Show Full Abstract

Zeolites have been successfully employed in many catalytic reactions of industrial relevance. The severe conditions required in some processes, where high temperatures are frequently combined with the presence of steam, highlight the need of considering the evolution of the catalyst structure during the reaction. This review attempts to summarize the recently developed strategies to improve the hydrothermal framework stability of zeolites.

Also flagged:IL-8Interferonsgamma 2LactosylceramideCytokine ProductionIL-6
Journal Article 2021-05-17 ✓ 1 Snippet Guebel DV, Torres NV, Acebes Á.
In-Text Gene Mentions

…, EFNAB2 ,SOX6, VCAM1 ,…

Show Full Abstract

Compromise of the vascular system has important consequences on cognitive abilities and neurodegeneration. The identification of the main molecular signatures present in the blood vessels of human hippocampus could provide the basis to understand and tackle these pathologies. As direct vascular experimentation in hippocampus is problematic, we achieved this information by computationally disaggregating publicly available whole microarrays data of human hippocampal homogenates. Three conditions were analyzed: 'Young Adults', 'Aged', and 'aged with Mild Cognitive Impairment' (MCI). The genes identified were contrasted against two independent data-sets. Here we show that the endothelial cells from the Younger Group appeared in an 'activated stage'. In turn, in the Aged Group, the endothelial cells showed a significant loss of response to shear stress, changes in cell adhesion molecules, increased inflammation, brain-insulin resistance, lipidic alterations, and changes in the extracellular matrix. Some specific changes in the MCI group were also detected. Noticeably, in this study the features arisen from the Aged Group (high tortuosity, increased bifurcations, and smooth muscle proliferation), pose the need for further experimental verification to discern between the occurrence of arteriogenesis and/or vascular remodeling by capillary arterialization. This article has an associated First Person interview with the first author of the paper.

Also flagged:cancerreplication forksHRdeficiencyovarian cancersFanconi anaemia syndromes
Journal Article 2021-05-17 No Snippets Matos-Rodrigues G, Guirouilh-Barbat J, Martini E, Lopez BS.
Show Full Abstract

Genetic instability is a hallmark of cancer cells. Homologous recombination (HR) plays key roles in genome stability and variability due to its roles in DNA double-strand break and interstrand crosslink repair, and in the protection and resumption of arrested replication forks. HR deficiency leads to genetic instability, and, as expected, many HR genes are downregulated in cancer cells. The link between HR deficiency and cancer predisposition is exemplified by familial breast and ovarian cancers and by some subgroups of Fanconi anaemia syndromes. Surprisingly, although RAD51 plays a pivotal role in HR, i.e., homology search and in strand exchange with a homologous DNA partner, almost no inactivating mutations of <i>RAD51</i> have been associated with cancer predisposition; on the contrary, overexpression of RAD51 is associated with a poor prognosis in different types of tumours. Taken together, these data highlight the fact that RAD51 differs from its HR partners with regard to cancer susceptibility and expose what we call the 'RAD51 paradox'. Here, we catalogue the dysregulations of HR genes in human pathologies, including cancer and Fanconi anaemia or congenital mirror movement syndromes, and we discuss the RAD51 paradox.

Also flagged:AF10DOT1LpeptideH3K79 methyltransferase DOT1-likeALL1chromosome
Journal Article 2021-05-16 No Snippets Zhou Z, Kang S, Huang Z, Zhou Z, Chen S.
Show Full Abstract

The interaction of the solo H3K79 methyltransferase DOT1-like (DOT1L) and its regulatory factor ALL1-fused gene from chromosome 10 protein (AF10) is crucial for the transcription of developmental genes such as HOXA in acute leukemia. The octapeptide motif and leucine zipper region of AF10 is responsible for binding DOT1L and catalyzing H3K79 monomethylation to demethylation. However, the characteristics of the mechanism between DOT1L and AF10 are not clear. Here, we present the crystal structures of coiled-coil regions of DOT1L-AF10 and AF10-inhibitory peptide, demonstrating the inhibitory peptide could form a compact complex with AF10 via a different recognition pattern. Furthermore, an inhibitory peptide with structure-based optimization is identified and decreases the HOXA gene expression in a human cell line. Our studies provide an innovative pharmacologic basis for therapeutic intervention in leukemia.

Also flagged:spondin 2SPON2KDM5DRPS4Y1degranulationimmune response
Journal Article 2021-05-16 ✓ 5 Snippets Zhou P, Xiang CX, Wei JF.
In-Text Gene Mentions

In our pre‐experiments, we measured SPON2, OLFM4, XIST, TSIX, KDM5D, and RPS4Y1 expressions in BA patients and healthy children detected using qRT‐PCR analysis.

Bioinformatics analysis showed that SPON2, OLFM4, XIST, and TSIX were significantly upregulated, while KDM5D and RPS4Y1 were reduced in BA.

However, there were no significant differences among OLFM4, XIST, TSIX, KDM5D, and RPS4Y1 levels between BA patients and healthy children; hence, we chose SPON2 to conduct the following experiments.

…showed that SPON2,OLFM4, XIST, and TSIX…

…e, 5’‐CACAAACGAGACCAGCGAGT‐3’;OLFM4forward, 5’‐GACCAAGCTGAAAGAGTG…

Show Full Abstract

<h4>Background</h4>Bronchial asthma (BA) was a heterogeneous disease characterized by chronic airway inflammation. Spondin 2 (SPON2) was reported to be implicated in the integrin pathway, protein metabolism, and drug-induced lupus erythematosus. The purpose of this study was to evaluate the significance of SPON2 in BA diagnosis and treatment.<h4>Methods</h4>Peripheral blood samples were obtained from 137 BA pediatric patients (61 mild-to-moderate BA and 76 severe BA) and 59 healthy children. Subject's information, clinical indexes, pulmonary ventilation functions were recorded in the two groups. Peripheral blood mononuclear cells (PBMCs) were isolated from patients' samples. qRT-PCR and ELISA assays were employed to examine the levels of SPON2 and inflammatory cytokines, respectively. Pearson's correlation analysis confirmed the association between SPON2 and inflammatory cytokines. Receiver operating characteristic (ROC) analysis was used to evaluate the potentials of SPON2 in terms of BA detection and discriminating against the severity of BA.<h4>Results</h4>Bioinformatics analysis showed that SPON2, OLFM4, XIST, and TSIX were significantly upregulated, while KDM5D and RPS4Y1 were reduced in BA. GO analysis verified that these six genes were mainly involved in neutrophil degranulation, neutrophil activation involved in immune response, neutrophil activation, and neutrophil-mediated immunity. After isolating PBMCs, we found that SPON2 was remarkably increased in BA pediatric group compared with healthy children, and the relative levels of SPON2 were related to the severity of BA. The receiver operating characteristic (ROC) analysis revealed the high potentials of SPON2 in BA diagnosis (AUC was 0.8080) and severity distinctions (AUCs were 0.7341 and 0.8541, respectively). Also, we found that there were significant differences in fractional exhaled nitric oxide (FeNO), forced expiratory volume in 1 s (FEV1)%, FEV1/ forced vital capacity (FVC)%, immunoglobulin E (IgE), serum eosinophils, and serum neutrophils between mild-to-moderate BA group and severe BA group. Finally, SPON2 was negatively correlated with IL-12 while positively associated with IL-4, IL-13, and IL-17A.<h4>Conclusions</h4>SPON2 was a viable biomarker for diagnosing and degree of severity in BA, providing more insight into exploring BA and treatment's pathogenesis.

Also flagged:Acyclovirfetal hemoglobinγ-globinBCL11Aβ-thalassemiasickle cell anemia
Journal Article 2021-05-16 ✓ 3 Snippets Ali H, Khan F, Ghulam Musharraf S.
In-Text Gene Mentions

…repressors, BCL11A andSOX6trans-acting factors.…

…BCL11A, FOP1, KLF1SOX6, and GATA-1.…

…repressors BCL11A andSOX6was observed at…

Show Full Abstract

Pharmacological reactivation of developmentally silenced fetal hemoglobin (HbF) is an attractive approach to ameliorate the clinical manifestations of β-thalassemia and sickle cell anemia. Hydroxyurea, the only HbF inducer, has obtained regulatory approval. However, hydroxyurea non-responders and associated myelosuppression making its widespread use undesirable. A high level of HbF with safe and effective agents remains an elusive therapeutic goal for this global health burden. This study demonstrated the effect of acyclovir on γ-globin expression and erythropoiesis, associated with increased HbF production. In vitro, human erythroleukemia cells and human CD34<sup>+</sup> erythroid progenitors, and in vivo β-YAC transgenic mice were used as experimental models. We found that acyclovir significantly induces expression of the γ-globin gene and HbF synthesis in CD34<sup>+</sup> erythroid progenitors, without affecting terminal erythroid differentiation and erythroid cell proliferation. In contrast to other HbF inducers, no associated cytotoxicity with acyclovir was observed. Further, we reported the effect of acyclovir on γ-globin gene transcriptional regulators including BCL11A, FOP1, KLF1 SOX6, and GATA-1. Significant downregulation of the γ-globin repressors BCL11A and SOX6 was observed at both mRNA and protein levels. Whereas, GATA-1, a master erythroid transcription factor, was upregulated in acyclovir treated human CD34<sup>+</sup> erythroid culture. Similarly, the HbF inducing effect of acyclovir in β-YAC transgenic mice revealed a good in vitro correlation, with a substantial increase in fetal globin mRNA, and F cells population. These findings collectively suggest acyclovir as an effective HbF inducer and pave the way to evaluate its clinical efficacy in treating β-globin disorders.

bioRxiv 2021-05-16 Preprint (No Snippets API) Mösbauer K, Fritsch VN, Adrian L, Bernhardt J, Gruhlke MCH, Slusarenko AJ, Niemeyer D, Antelmann H.
Show Full Abstract

<h4>ABSTRACT</h4> The Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) pandemic is a major health burden. Volatile garlic organosulfur compounds, such as the thiol-reactive allicin (diallyl thiosulfinate) exert strong antimicrobial activity against various respiratory pathogens. Here, we investigated the antiviral activity of allicin against SARS-CoV-2 in infected Vero E6 and Calu-3 lung cells. Calu-3 cells showed greater allicin tolerance due >4-fold increased GSH levels compared to Vero E6. However, biocompatible allicin doses efficiently inhibited viral replication in both cell lines. Proteome analyses of SARS-CoV-2 infected Calu-3 cells revealed a strong induction of the antiviral interferon-stimulated gene (ISG) signature (e.g. cGAS, Mx1, IFIT, IFIH, IFI16, IFI44, 2’5’OAS and ISG15), pathways of vesicular transport, tight junctions (KIF5A/B/C, OSBPL2, CLTC1, ARHGAP17) and ubiquitin modification (UBE2L3/5), as well as reprogramming of host metabolism, transcription and translation. Allicin abrogated the ISG host response and reverted the host cellular pathways to levels of uninfected Calu-3 cells, confirming the antiviral and immunomodulatory activity of allicin in the host proteome. Thus, biocompatible doses of allicin could be promising for protection of lung cells against SARS-CoV-2.

bioRxiv 2021-05-16 Preprint (No Snippets API) Kim E, Gonzalez AM, Pradhan B, van der Torre J, Dekker C.
Show Full Abstract

Condensin, a structural maintenance of chromosomes (SMC) complex, has been shown to be a molecular motor protein that organizes chromosomes by extruding loops of DNA. In cells, such loop extrusion is challenged by many potential conflicts, e.g., the torsional stresses that are generated by other DNA-processing enzymes. It has so far remained unclear how DNA supercoiling affects loop extrusion. Here, we use time-lapse single-molecule imaging to study condensin-driven DNA loop extrusion on supercoiled DNA. We find that condensin binding and DNA looping is stimulated by positive supercoiled DNA where it preferentially binds near the tips of supercoiled plectonemes. Upon loop extrusion, condensin collects all nearby plectonemes into a single supercoiled loop that is highly stable. Atomic force microscopy imaging shows that condensin generates supercoils in the presence of ATP. Our findings provide insight into the topology-regulated loading and formation of supercoiled loops by SMC complexes and clarify the interplay of loop extrusion and supercoiling.

Also flagged:CFTR
Journal Article 2021-05-15 ✓ 1 Snippet Allbee Q, Barber R.
In-Text Gene Mentions

…genes, CFTR andHFE, as well as…

Show Full Abstract

Biology is a data-driven discipline facilitated greatly by computer programming skills. This article describes an introductory experiential programming activity that can be integrated into distance learning environments. Students are asked to develop their own Python programs to identify the nature of alleles linked to disease. This activity effectively engages students in a problem solving exercise that provides an opportunity for application of basic programming skills as well as understanding eukaryotic gene structure. We provide sets of mapped alleles for two well-known genes, CFTR and HFE, as well as a suite of relevant Python programs to achieve these outcomes or allow subsequent exercise modifications.

Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDFibrosisNASHsteatosisnonalcoholic steatohepatitis
Journal Article 2021-05-15 ✓ 1 Snippet Troelstra MA, Witjes JJ, van Dijk AM, Mak AL, Gurney-Champion O, Runge JH, Zwirs D, Stols-Gonçalves D, Zwinderman AH, Ten Wolde M, Monajemi H, Ramsoekh S, Sinkus R, van Delden OM, Beuers UH, Verheij J, Nieuwdorp M, Nederveen AJ, Holleboom AG.
In-Text Gene Mentions

…NAFLD (auto‐immune hepatitis,hemochromatosis, hepatitis B and/or…

Show Full Abstract

<h4>Background</h4>Noninvasive diagnostic methods are urgently required in disease stratification and monitoring in nonalcoholic fatty liver disease (NAFLD). Multiparametric magnetic resonance imaging (MRI) is a promising technique to assess hepatic steatosis, inflammation, and fibrosis, potentially enabling noninvasive identification of individuals with active and advanced stages of NAFLD.<h4>Purpose</h4>To examine the diagnostic performance of multiparametric MRI for the assessment of disease severity along the NAFLD disease spectrum with comparison to histological scores.<h4>Study type</h4>Prospective, cohort.<h4>Population</h4>Thirty-seven patients with NAFLD.<h4>Field strength/sequence</h4>Multiparametric MRI at 3.0 T consisted of magnetic resonance (MR) spectroscopy (MRS) with multi-echo stimulated-echo acquisition mode, magnitude-based and three-point Dixon using a two-dimensional multi-echo gradient echo, MR elastography (MRE) using a generalized multishot gradient-recalled echo sequence and intravoxel incoherent motion (IVIM) using a multislice diffusion weighted single-shot echo-planar sequence.<h4>Assessment</h4>Histological steatosis grades were compared to proton density fat fraction measured by MRS (PDFF<sub>MRS</sub> ), magnitude-based MRI (PDFF<sub>MRI-M</sub> ), and three-point Dixon (PDFF<sub>Dixon</sub> ), as well as FibroScan® controlled attenuation parameter (CAP). Fibrosis and disease activity were compared to IVIM and MRE. FibroScan® liver stiffness measurements were compared to fibrosis levels. Diagnostic performance of all imaging parameters was determined for distinction between simple steatosis and nonalcoholic steatohepatitis (NASH).<h4>Statistical tests</h4>Spearman's rank test, Kruskal-Wallis test, Dunn's post-hoc test with Holm-Bonferroni P-value adjustment, receiver operating characteristic curve analysis. A P-value <0.05 was considered statistically significant.<h4>Results</h4>Histological steatosis grade correlated significantly with PDFF<sub>MRS</sub> (r<sub>s</sub>  = 0.66, P < 0.001), PDFF<sub>MRI-M</sub> (r<sub>s</sub>  = 0.68, P < 0.001), and PDFF<sub>Dixon</sub> (r<sub>s</sub>  = 0.67, P < 0.001), whereas no correlation was found with CAP. MRE and IVIM diffusion and perfusion significantly correlated with disease activity (r<sub>s</sub>  = 0.55, P < 0.001, r<sub>s</sub>  = -0.40, P = 0.016, r<sub>s</sub>  = -0.37, P = 0.027, respectively) and fibrosis (r<sub>s</sub>  = 0.55, P < 0.001, r<sub>s</sub>  = -0.46, P = 0.0051; r<sub>s</sub>  = -0.53, P < 0.001, respectively). MRE and IVIM diffusion had the highest area-under-the-curve for distinction between simple steatosis and NASH (0.79 and 0.73, respectively).<h4>Data conclusion</h4>Multiparametric MRI is a promising method for noninvasive, accurate, and sensitive distinction between simple hepatic steatosis and NASH, as well as for the assessment of steatosis and fibrosis severity.<h4>Level of evidence</h4>2 TECHNICAL EFFICACY: 2.

Also flagged:chromosomeovarian failurecongenital malformations of the heartendocrine disordersosteoporosisautoimmune disorders
Journal Article 2021-05-15 ✓ 1 Snippet Kita T, Tajima T, Chosa E.
In-Text Gene Mentions

…5/6 and 9 (SOX5/SOX6and SOX9).…

Show Full Abstract

<h4>Background</h4>Turner's syndrome, discoid meniscus, and Blount's disease have all been studied in isolation, but, to the best of our knowledge, there have been no studies reporting a patient with all three. Thus, the first case of Turner's syndrome with discoid meniscus and Blount's disease is presented.<h4>Case presentation</h4>A 5-year-old Japanese girl with a history of Turner's syndrome and Blount's disease complained of pain in her left knee. Magnetic resonance imaging showed a discoid lateral meniscus tear, and arthroscopic partial meniscectomy was performed, providing a good outcome.<h4>Conclusions</h4>In this report, some possible explanations regarding the concomitant presence of these three diseases are discussed. A possible explanation in this case is that the patient with Turner's syndrome had a discoid lateral meniscus that might have been induced by some genetic factors associated with Turner's syndrome, and then the discoid lateral meniscus might have been the mechanical stress that caused Blount's disease.

Also flagged:gene expressionCongenital Heart Diseaseheart failureligandreceptorreverse transcription
Journal Article 2021-05-15 No Snippets Samad T, Wu SM.
Show Full Abstract

The development of single cell RNA sequencing technologies has accelerated the ability of scientists to understand healthy and disease states of the cardiovascular system. Congenital heart defects occur in approximately 40,000 births each year and 1 out of 4 children are born with critical congenital heart disease requiring surgical interventions and a lifetime of monitoring. An understanding of how the normal heart develops and how each cell contributes to normal and pathological anatomy is an important goal in pediatric cardiovascular research. Single cell sequencing has provided the tools to increase the ability to discover rare cell types and novel genes involved in normal cardiac development. Knowledge of gene expression of single cells within cardiac tissue has contributed to the understanding of how each cell type contributes to the anatomic structures of the heart. In this review, we summarize how single cell RNA sequencing has been utilized to understand cardiac developmental processes and congenital heart disease. We discuss the advantages and disadvantages of whole cell versus single nuclei RNA sequencing and describe the approaches to analyze the interactomes, transcriptomes, and differentiation trajectory from single cell data. We summarize the currently available single cell RNA sequencing technologies and technical aspects of performing single cell analysis and how to overcome common obstacles. We also review data from the recently published human and mouse fetal heart atlases and advancements that have occurred within the field due to the application of these single cell tools. Finally we highlight the potential for single cell technologies to uncover novel mechanisms of disease pathogenesis by leveraging findings from genome wide association studies.

Also flagged:PolyunsaturatedALBAPOA1IVDMAT1AOAT
Journal Article 2021-05-15 ✓ 5 Snippets Liput KP, Lepczyński A, Nawrocka A, Poławska E, Ogłuszka M, Jończy A, Grzybek W, Liput M, Szostak A, Urbański P, Roszczyk A, Pareek CS, Pierzchała M.
In-Text Gene Mentions

OAT and PRDX6 were further analyzed as representatives of amino acid metabolism and oxidative stress regulation processes, respectively.

…proteins (OAT andPRDX6) were normalized using…

…technical replicates forPrdx6and Oat of…

…High levels ofPRDX6were found in…

…OAT andPRDX6were further analyzed…

Show Full Abstract

The aim of the study was to evaluate the effect of different types of high-fat diets (HFDs) on the proteomic profile of mouse liver. The analysis included four dietary groups of mice fed a standard diet (STD group), a high-fat diet rich in SFAs (SFA group), and high-fat diets dominated by PUFAs with linoleic acid (LA, C18:2n-6) to α-linolenic acid (ALA, C18:3n-3) ratios of 14:1 (14:1 group) and 5:1 (5:1 group). After three months of diets, liver proteins were resolved by two-dimensional gel electrophoresis (2DE) using 17 cm non-linear 3-10 pH gradient strips. Protein spots with different expression were identified by MALDI-TOF/TOF. The expression of 13 liver proteins was changed in the SFA group compared to the STD group (↓: ALB, APOA1, IVD, MAT1A, OAT and PHB; ↑: ALDH1L1, UniProtKB-Q91V76, GALK1, GPD1, HMGCS2, KHK and TKFC). Eleven proteins with altered expression were recorded in the 14:1 group compared to the SFA group (↓: ARG1, FTL1, GPD1, HGD, HMGCS2 and MAT1A; ↑: APOA1, CA3, GLO1, HDHD3 and IVD). The expression of 11 proteins was altered in the 5:1 group compared to the SFA group (↓: ATP5F1B, FTL1, GALK1, HGD, HSPA9, HSPD1, PC and TKFC; ↑: ACAT2, CA3 and GSTP1). High-PUFA diets significantly affected the expression of proteins involved in, e.g., carbohydrate metabolism, and had varying effects on plasma total cholesterol and glucose levels. The outcomes of this study revealed crucial liver proteins affected by different high-fat diets.

Also flagged:SynthesisCeramicnanomaterialshydrogenperoxidesilane
Journal Article 2021-05-15 No Snippets Tawade BV, Apata IE, Pradhan N, Karim A, Raghavan D.
Show Full Abstract

The synthesis of polymer-grafted nanoparticles (PGNPs) or hairy nanoparticles (HNPs) by tethering of polymer chains to the surface of nanoparticles is an important technique to obtain nanostructured hybrid materials that have been widely used in the formulation of advanced polymer nanocomposites. Ceramic-based polymer nanocomposites integrate key attributes of polymer and ceramic nanomaterial to improve the dielectric properties such as breakdown strength, energy density and dielectric loss. This review describes the "grafting from" and "grafting to" approaches commonly adopted to graft polymer chains on NPs pertaining to nano-dielectrics. The article also covers various surface initiated controlled radical polymerization techniques, along with templated approaches for grafting of polymer chains onto SiO<sub>2</sub>, TiO<sub>2</sub>, BaTiO<sub>3</sub>, and Al<sub>2</sub>O<sub>3</sub> nanomaterials. As a look towards applications, an outlook on high-performance polymer nanocomposite capacitors for the design of high energy density pulsed power thin-film capacitors is also presented.

Also flagged:Fatty Liver Diseasehepatopathymetabolic-related disorderssteatohepatitishepatocellular-carcinomametabolic syndrome
Journal Article 2021-05-15 ✓ 1 Snippet Dallio M, Romeo M, Gravina AG, Masarone M, Larussa T, Abenavoli L, Persico M, Loguercio C, Federico A.
In-Text Gene Mentions

…homeostatic iron regulator (HFE) C282Y rs1800562, and…

Show Full Abstract

Metabolic- (dysfunction) associated fatty liver disease (MAFLD) represents the predominant hepatopathy and one of the most important systemic, metabolic-related disorders all over the world associated with severe medical and socio-economic repercussions due to its growing prevalence, clinical course (steatohepatitis and/or hepatocellular-carcinoma), and related extra-hepatic comorbidities. To date, no specific medications for the treatment of this condition exist, and the most valid recommendation for patients remains lifestyle change. MAFLD has been associated with metabolic syndrome; its development and progression are widely influenced by the interplay between genetic, environmental, and nutritional factors. Nutrigenetics and nutrigenomics findings suggest nutrition's capability, by acting on the individual genetic background and modifying the specific epigenetic expression as well, to influence patients' clinical outcome. Besides, immunity response is emerging as pivotal in this multifactorial scenario, suggesting the interaction between diet, genetics, and immunity as another tangled network that needs to be explored. The present review describes the genetic background contribution to MAFLD onset and worsening, its possibility to be influenced by nutritional habits, and the interplay between nutrients and immunity as one of the most promising research fields of the future in this context.

Also flagged:LipidDmt1IronFpn1iron-loading disorderhereditary hemochromatosis
Journal Article 2021-05-15 ✓ 3 Snippets Wang X, Zhang M, Woloshun RR, Yu Y, Lee JK, Flores SRL, Merlin D, Collins JF.
In-Text Gene Mentions

…For example, theHemochromatosisSociety Netherlands, in…

…“Dietary Advice in HFE-Hemochromatosis” states that: “…it…

…best treatment forhemochromatosis.…

Show Full Abstract

Intestinal iron transport requires an iron importer (Dmt1) and an iron exporter (Fpn1). The hormone hepcidin regulates iron absorption by modulating Fpn1 protein levels on the basolateral surface of duodenal enterocytes. In the genetic, iron-loading disorder hereditary hemochromatosis (HH), hepcidin production is low and Fpn1 protein expression is elevated. High Fpn1-mediated iron export depletes intracellular iron, causing a paradoxical increase in Dmt1-mediated iron import. Increased activity of both transporters causes excessive iron absorption, thus initiating body iron loading. Logically then, silencing of intestinal Dmt1 or Fpn1 could be an effective therapeutic intervention in HH. It was previously established that Dmt1 knock down prevented iron-loading in weanling <i>Hamp</i> (encoding hepcidin) KO mice (modeling type 2B HH). Here, we tested the hypothesis that Dmt1 silencing combined with dietary iron restriction (which may be recommended for HH patients) will mitigate iron loading once already established. Accordingly, adult <i>Hamp</i> KO mice were switched to a low-iron (LFe) diet and (non-toxic) folic acid-coupled, ginger nanoparticle-derived lipid vectors (FA-GDLVs) were used to deliver negative-control (NC) or Dmt1 siRNA by oral, intragastric gavage daily for 21 days. The LFe diet reduced body iron burden, and experimental interventions potentiated iron losses. For example, Dmt1 siRNA treatment suppressed duodenal Dmt1 mRNA expression (by ~50%) and reduced serum and liver non-heme iron levels (by ~60% and >85%, respectively). Interestingly, some iron-related parameters were repressed similarly by FA-GDLVs carrying either siRNA, including <sup>59</sup>Fe (as FeCl<sub>3</sub>) absorption (~20% lower), pancreatic non-heme iron (reduced by ~65%), and serum ferritin (decreased 40-50%). Ginger may thus contain bioactive lipids that also influence iron homeostasis. In conclusion, the combinatorial approach of FA-GDLV and Dmt1 siRNA treatment, with dietary iron restriction, mitigated pre-existing iron overload in a murine model of HH.

Also flagged:cytokinepulmonary edemasubclavian steal syndromeaneurysmsmembranelung failure
Journal Article 2021-05-15 ✓ 1 Snippet Krabbe H, Klassen S, Bleidorn J, Jacobs MJ, Krabbe J, Babendreyer A, Martin C.
In-Text Gene Mentions

…prostaglandin I2 receptor (Ptgis) and in retrograde…

Show Full Abstract

Retrograde perfusion may occur during disease, surgery or extracorporeal circulation. While it is clear that endothelial cells sense and respond to changes in blood flow, the consequences of retrograde perfusion are only poorly defined. Similar to shear stress or disturbed flow, retrograde perfusion might result in vasomotor responses, edema formation or inflammation in and around vessels. In this study we investigated in rats the effects of retrograde perfusion in isolated systemic vessels (IPV) and in pulmonary vessels of isolated perfused lungs (IPL). Anterograde and retrograde perfusion was performed for 480 min in IPV and for 180 min in the IPL. Perfusion pressure, cytokine levels in perfusate and bronchoalveolar lavage fluid (BALF), edema formation and mRNA expression were studied. In IPV, an increased perfusion pressure and initially also increased cytokine levels were observed during retrograde perfusion. In the IPL, increased edema formation occurred, while cytokine levels were not increased, though dilution of cytokines in BALF due to pulmonary edema cannot be excluded. In conclusion, effects of flow reversal were visible immediately after initiation of retrograde perfusion. Pulmonary edema formation was the only effect of the 3 h retrograde perfusion. Therefore, further research should focus on identification of possible long-term complications of flow reversal.

Also flagged:ethyleneMagnetiteFolic AcidFRimineCancer
Journal Article 2021-05-15 No Snippets Ortega-Muñoz M, Plesselova S, Delgado AV, Santoyo-Gonzalez F, Salto-Gonzalez R, Giron-Gonzalez MD, Iglesias GR, López-Jaramillo FJ.
Show Full Abstract

Magnetite nanoparticles (MNPs) coated by branched poly (ethylene-imine) (PEI) were synthesized in a one-pot. Three molecular weights of PEI were tested, namely, 1.8 kDa (sample <b>MNP-1</b>), 10 kDa (sample <b>MNP-2</b>), and 25 kDa (sample <b>MNP-3</b>). The <b>MNP-1</b> particles were further functionalized with folic acid (FA) (sample <b>MNP-4</b>). The four types of particles were found to behave magnetically as superparamagnetic, with <b>MNP-1</b> showing the highest magnetization saturation. The particles were evaluated as possible hyperthermia agents by subjecting them to magnetic fields of 12 kA/m strength and frequencies ranging between 115 and 175 kHz. <b>MNP-1</b> released the maximum heating power, reaching 330 W/g at the highest frequency, in the high side of reported values for spherical MNPs. In vitro cell viability assays of <b>MNP</b><b>-1</b> and <b>MNP-4</b> against three cell lines expressing different levels of FA receptors (FR), namely, HEK (low expression), and HeLa (high expression), and HepG2 (high expression), demonstrated that they are not cytotoxic. When the cells were incubated in the presence of a 175 kHz magnetic field, a significant reduction in cell viability and clone formation was obtained for the high expressing FR cells incubated with <b>MNP-4</b>, suggesting that <b>MNP-4</b> particles are good candidates for magnetic field hyperthermia and active targeting.

Also flagged:glioblastomabrain tumoragingGBMCALCRLGUCY2F
Journal Article 2021-05-15 ✓ 2 Snippets Wang H, Li S, Liu H, Bian S, Huang W, Xing C, Wang Y.
In-Text Gene Mentions

POU3F2

BTN2A2

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) is an aggressive brain tumor and the mechanisms of progression are very complex. Accelerated aging is a driving factor of GBM. However, there has not been thorough research about the mechanisms of GBM progression based on aging acceleration.<h4>Methods</h4>The aging predictor was modeled based on normal brain samples. Then an aging acceleration background network was constructed to explore GBM mechanisms.<h4>Results</h4>The accelerated aging-related mechanisms provided an innovative way to study GBM, wherein integrative analysis of somatic mutations and differential expression revealed key pathologic characteristics. Moreover, the influence of the immune system, the nervous system and other critical factors on GBM were identified. The survival analysis also disclosed crucial GBM markers.<h4>Conclusion</h4>An integrative analysis of multi-omics data based on aging acceleration identified new driving factors for GBM.

Also flagged:ENO1antibodycervical cancerα-enolasemembranescytoplasm
Journal Article 2021-05-15 No Snippets Gou Y, Li F, Huo X, Hao C, Yang X, Pei Y, Li N, Liu H, Zhu B.
Show Full Abstract

α-enolase (ENO1), highly expressing in cell membranes, cytoplasm and nuclei of cervical cancer and other tumors, acts as a plasminogen receptor and a glycolytic enzyme. ENO1 is found to be associated with tumorigenesis, invasion and migration, and proves to be an ideal target of tumor therapy. In this study, ENO1 monoclonal antibodies (ENO1mAb) was prepared to blockade ENO1 and the therapeutic role was observed in cervical cancer cells. First, ENO1mAb was prepared and screened by evaluating the inhibitory effect on migration and invasion of cervical cancer cells, which is supposed to block ENO1 expressed on cell membrane. Second, folic acid (FA) conjugated PLGA nanoparticles (FA-SS-PLGA) targeting tumor cells were prepared to mediate ENO1mAb entry into cells and its anti-tumor effects were investigated <i>in vitro</i>. We found that PLGA/FA-SS-PLGA nanoparticles-mediated ENO1mAb could antagonize the activity of ENO1 enzyme, significantly decreased the contents of lactic acid and pyruvate, and inhibited the proliferation, migration and clone formation of cervical cancer cells compared with the sham control (<i>P</i> < 0.05). In summary, ENO1mAb could specifically block ENO1 expressed on cell membrane and inhibit ENO1 glycolysis enzyme activity inside tumor cells, and plays a therapeutic role against cervical cancer cells. It suggests that ENO1mAb has promising anti-tumor effects.

Also flagged:gestationchronic lung diseaseshematological diseasesCD34chorioamnionitisHBeAg
Journal Article 2021-05-15 No Snippets Ren Z, Xu F, Wang J, Zhong Z, Wei W, Wen J, Wang Q, Guocheng L, Yang J.
Show Full Abstract

<h4>Background</h4>Umbilical cord blood (UCB) is a new and convenient source of stem cells reported to be safe and effective in preventing and treating preterm complications. The initial processing step for this therapy involves cord blood collection and isolation of the mononuclear cell (MNC) layer. However, there is limited information regarding the feasibility and safety of cord blood collection in preterm infants, and whether cord blood cell quality and quantity are adequate for treating complications in preterm infants. UCB units from preterm infants are currently discarded due to safety concerns regarding collection and owing to the harvesting of inadequate volumes for banking. This study aimed to investigate the feasibility and safety of UCB collection following delayed cord clamping (DCC) for preventing and treating complications in preterm infants.<h4>Methods and materials</h4>Singleton preterm infants below 35 weeks gestation were assigned to two cohorts: cord blood collection and non-cord blood collection groups. Mortality and preterm complications in the two groups were compared to evaluate the safety of cord blood collection in preterm infants. The characteristics of the cord blood cells in preterm infants were investigated by comparing the cord blood parameters before and after processing with those of term infants born during the same period.<h4>Results</h4>There were 90 preterm infants and 120 term neonates enrolled in this study. Compared to those of the term group, the preterm neonates had significantly less cord blood volume and fewer cell numbers. Nevertheless, the MNC number in the preterm group was 1.92±1.35×10<sup>8</sup> per kg, which fulfilled the previously reported targeted cell dose (5×10<sup>7</sup> cells/kg) suitable for application to improve preterm complications. There was no significant difference regarding complications in the preterm neonates with or without cord blood collection.<h4>Conclusions</h4>The collection of UCB after DCC in preterm infants is feasible and safe. The cell numbers and quality fulfill the criteria for use in improving preterm complications. Cord blood MNCs from preterm neonates should be reconsidered as an ideal source for use in stem cell therapy for preterm complications.

Also flagged:Deferoxaminehypoxia-inducible factor 1αHIF-1αGFPgreen fluorescent proteinsecretion
Journal Article 2021-05-15 ✓ 1 Snippet Du R, Zhao J, Wen Y, Zhu Y, Jiang L.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

In previous studies, we found that deferoxamine (DFO) improved the migration of dental pulp cells (DPCs). The present study aimed to determine whether the effects of DFO on the migration of DPCs were regulated via hypoxia-inducible factor 1α (HIF-1α). Recombinant adenovirus vectors carrying short hairpin RNA (shRNA) targeting the human HIF-1α gene (pAd-GFP-shRNA-HIF-1α) and green fluorescent protein (GFP) were constructed. The expression of HIF-1α was inhibited by pAd-GFP-shRNA-HIF-1α at messenger RNA and protein levels. The secretion of stromal cell-derived factor 1α (SDF-1α) or vascular endothelial growth factor (VEGF) in DPCs treated with 10 μM DFO was higher than that in the control condition. The migration of DPCs was enhanced by 10 μM DFO. However, the effects of DFO on DPCs were partially reversed by silencing the HIF-1α gene in enzyme-linked immunosorbent assay or migration assay. Cumulatively, we conclude that DFO upregulated the secretion of SDF-1α or VEGF in DPCs and improved the migration of DPCs through HIF-1α.

Also flagged:keyyouCB2howkinasesphosphorylation
Journal Article 2021-05-14 ✓ 1 Snippet Zhang H, Cao X, Tang M, Zhong G, Si Y, Li H, Zhu F, Liao Q, Li L, Zhao J, Feng J, Li S, Wang C, Kaulich M, Wang F, Chen L, Li L, Xia Z, Liang T, Lu H, Feng XH, Zhao B.
In-Text Gene Mentions

VRK2was used as…

Show Full Abstract

The human kinome comprises 538 kinases playing essential functions by catalyzing protein phosphorylation. Annotation of subcellular distribution of the kinome greatly facilitates investigation of normal and disease mechanisms. Here, we present Kinome Atlas (KA), an image-based map of the kinome annotated to 10 cellular compartments. 456 epitope-tagged kinases, representing 85% of the human kinome, were expressed in HeLa cells and imaged by immunofluorescent microscopy under a similar condition. KA revealed kinase family-enriched subcellular localizations and discovered a collection of new kinase localizations at mitochondria, plasma membrane, extracellular space, and other structures. Furthermore, KA demonstrated the role of liquid-liquid phase separation in formation of kinase condensates. Identification of MOK as a mitochondrial kinase revealed its function in cristae dynamics, respiration, and oxidative stress response. Although limited by possible mislocalization due to overexpression or epitope tagging, this subcellular map of the kinome can be used to refine regulatory mechanisms involving protein phosphorylation.

Also flagged:AtlastinULK1autophagosomeFIP200ATG13ATG101
Journal Article 2021-05-14 ✓ 1 Snippet Liu N, Zhao H, Zhao YG, Hu J, Zhang H.
In-Text Gene Mentions

…FAM134B, Rtn3, Sec62,CCPG1, and TEX264, have…

Show Full Abstract

Dynamic targeting of the ULK1 complex to the ER is crucial for initiating autophagosome formation and for subsequent formation of ER-isolation membrane (IM; autophagosomal precursor) contact during IM expansion. Little is known about how the ULK1 complex, which comprises FIP200, ULK1, ATG13, and ATG101 and does not exist as a constitutively coassembled complex, is recruited and stabilized on the ER. Here, we demonstrate that the ER-localized transmembrane proteins Atlastin 2 and 3 (ATL2/3) contribute to recruitment and stabilization of ULK1 and ATG101 at the FIP200-ATG13-specified autophagosome formation sites on the ER. In ATL2/3 KO cells, formation of FIP200 and ATG13 puncta is unaffected, while targeting of ULK1 and ATG101 is severely impaired. Consequently, IM initiation is compromised and slowed. ATL2/3 directly interact with ULK1 and ATG13 and facilitate the ATG13-mediated recruitment/stabilization of ULK1 and ATG101. ATL2/3 also participate in forming ER-IM tethering complexes. Our study provides insights into the dynamic assembly of the ULK1 complex on the ER for autophagosome formation.

Also flagged:silveratrophydeferoxamineironinflammatory responsebrain atrophy
Journal Article 2021-05-14 ✓ 3 Snippets Donley DW, Realing M, Gigley JP, Fox JH.
In-Text Gene Mentions

Mutant HTT results in altered transcription, axonal transport, mitochondrial function, vesicular trafficking, inflammation, and oxidative stress are some of the mechanisms implicated in HD [3].

Huntington’s disease (HD) is an autosomal-dominant neurodegenerative disorder caused by a CAG-repeat expansion in exon 1 of the huntingtin gene (HTT) and results from expression of mutant huntingtin protein (mHTT) which misfolds in neurons and microglial cells [1,2].

…huntingtin gene (HTT) and results…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a dominant CAG-repeat expansion in the huntingtin gene. Microglial activation is a key feature of HD pathology, and is present before clinical disease onset. The kynurenine pathway (KP) of tryptophan degradation is activated in HD, and is thought to contribute to disease progression. Indoleamine-2,3-dioxygenase (IDO) catalyzes the first step in this pathway; this and other pathway enzymes reside with microglia. While HD brain microglia accumulate iron, the role of iron in promoting microglial activation and KP activity is unclear. Here we utilized the neonatal iron supplementation model to investigate the relationship between iron, microglial activation and neurodegeneration in adult HD mice. We show in the N171-82Q mouse model of HD microglial morphologic changes consistent with immune activation. Neonatal iron supplementation in these mice promoted neurodegeneration and resulted in additional microglial activation in adults as determined by increased soma volume and decreased process length. We further demonstrate that iron activates IDO, both in brain lysates and purified recombinant protein (EC50 = 1.24 nM). Brain IDO activity is increased by HD. Neonatal iron supplementation further promoted IDO activity in cerebral cortex, altered KP metabolite profiles, and promoted HD neurodegeneration as measured by brain weights and striatal volumes. Our results demonstrate that dietary iron is an important activator of microglia and the KP pathway in this HD model, and that this occurs in part through a direct effect on IDO. The findings are relevant to understanding how iron promotes neurodegeneration in HD.

Also flagged:genisteinosteoarthritisiodoacetatematrix metalloproteinaseMMPMMP-13
Journal Article 2021-05-14 ✓ 4 Snippets Cheng X, Xu P.
In-Text Gene Mentions

Induction of osteoarthritis significantly increased the expression of <i>MMP-8</i>, <i>MMP-13</i>, and <i>IHH</i>, but decreased <i>Col2</i>, <i>Sox5</i>, and <i>Sox6</i> expression (<i>p</i> < 0.001); these were partially prevented in the GTG.

…<i>MMP-13</i>, <i>Sox5</i>/<i>Sox6</i>, Indian hedgehog (<i>IHH<…

…Col2</i>, <i>Sox5</i>, and <i>Sox6</i> expression (<i>p</i> <…

…of <i>Sox5</i> and <i>Sox6</i> expression.…

Show Full Abstract

The study aimed to investigate the preservative effects of genistein on articular cartilage in an experimental model of knee osteoarthritis in rats. Thirty male Wistar rats were assigned to 3 equal groups: sham group, osteoarthritis control group (OAG), and genistein-treated osteoarthritis group (GTG). Intra-articular injections of monosodium iodoacetate were used for osteoarthritis induction. After 2 weeks of rest for the induction of the inflammatory process, genistein (30 mg/kg/day) vs. saline gavage was administered for 8 weeks. The expression of matrix metalloproteinase <i>(MMP)-8</i> and <i>MMP-13</i>, <i>Sox5</i>/<i>Sox6</i>, Indian hedgehog (<i>IHH</i>), and <i>Col2</i> were evaluated in medial femoral condyle sections by immunohistochemical staining. The number of chondrocytes and cartilage thicknesses were also measured and compared among the groups. No significant change in cartilage thickness was observed in GTG compared with OAG (<i>p</i> = 0.188). Chondrocyte count was significantly higher in the articular cartilage of GTG compared with OAG (<i>p</i> = 0.006). Induction of osteoarthritis significantly increased the expression of <i>MMP-8</i>, <i>MMP-13</i>, and <i>IHH</i>, but decreased <i>Col2</i>, <i>Sox5</i>, and <i>Sox6</i> expression (<i>p</i> < 0.001); these were partially prevented in the GTG. Our findings support the effectiveness of genistein treatment in the prevention of articular cartilage damage in the experimental model of knee osteoarthritis. The proposed mechanism of action is through the suppression of the <i>MMP</i>, <i>IHH</i>, and <i>Col2</i> pathways, besides the induction of <i>Sox5</i> and <i>Sox6</i> expression. <b>Novelty:</b> Genistein prevents articular cartilage damage in the experimental model of knee osteoarthritis. The osteoprotective effect is manifested by the modulation of expression of MMP, Sox, IHH, and Col2 proteins.

Also flagged:lysosomesorganellesdegradationlysosomeatherosclerosisneurodegenerative diseases
Journal Article 2021-05-14 ✓ 3 Snippets Zhang Z, Yue P, Lu T, Wang Y, Wei Y, Wei X.
In-Text Gene Mentions

HD is a rare autosomal­dominant neurodegenerative disease caused by detrimental aggregation­prone HTT mutants (mHTT) with an aberrant expansion of cysteine, adenine, and guanine (CAG) trinucleotide repeats within exon 1 of the HTT gene [116–118].

As mentioned above, activating autophagy by Latrepirdine and CCI-779 are potential therapy methods for PD [114] and HTT [124], respectively.

HTTmutants…

Show Full Abstract

Long known as digestive organelles, lysosomes have now emerged as multifaceted centers responsible for degradation, nutrient sensing, and immunity. Growing evidence also implicates role of lysosome-related mechanisms in pathologic process. In this review, we discuss physiological function of lysosomes and, more importantly, how the homeostasis of lysosomes is disrupted in several diseases, including atherosclerosis, neurodegenerative diseases, autoimmune disorders, pancreatitis, lysosomal storage disorders, and malignant tumors. In atherosclerosis and Gaucher disease, dysfunction of lysosomes changes cytokine secretion from macrophages, partially through inflammasome activation. In neurodegenerative diseases, defect autophagy facilitates accumulation of toxic protein and dysfunctional organelles leading to neuron death. Lysosomal dysfunction has been demonstrated in pathology of pancreatitis. Abnormal autophagy activation or inhibition has been revealed in autoimmune disorders. In tumor microenvironment, malignant phenotypes, including tumorigenesis, growth regulation, invasion, drug resistance, and radiotherapy resistance, of tumor cells and behaviors of tumor-associated macrophages, fibroblasts, dendritic cells, and T cells are also mediated by lysosomes. Based on these findings, a series of therapeutic methods targeting lysosomal proteins and processes have been developed from bench to bedside. In a word, present researches corroborate lysosomes to be pivotal organelles for understanding pathology of atherosclerosis, neurodegenerative diseases, autoimmune disorders, pancreatitis, and lysosomal storage disorders, and malignant tumors and developing novel therapeutic strategies.

Also flagged:glutamate delta 1 receptorsGlutamate delta 1GluD1glutamate delta 2GluD2ionotropic glutamate receptors
Journal Article 2021-05-14 No Snippets Andrews PC, Dravid SM.
Show Full Abstract

Glutamate delta 1 (GluD1) and glutamate delta 2 (GluD2) form the delta family of ionotropic glutamate receptors; these proteins plays widespread roles in synaptic architecture, motor behavior, and cognitive function. Though the role of GluD2 at cerebellar parallel fiber-Purkinje cell synapses is well established, attention now turns to the function of GluD receptors in the forebrain. GluD1 regulates synaptic assembly and modulation in multiple higher brain regions, acting as a postsynaptic cell adhesion molecule with effects on both excitatory and inhibitory transmission. Furthermore, variations and mutations in the GRID1 gene, which codes for GluD1, and in genes which code for proteins functionally linked to GluD1, are associated with mental disorders including autism, schizophrenia, bipolar disorder, and major depression. Cerebellin (Cbln) family proteins, the primary binding partners of delta receptors, are secreted C1q-like proteins which also bind presynaptic neurexins (NRXNs), forming a tripartite synaptic bridge. Published research explores this bridge's function in regions including the striatum, hippocampus, cortex, and cerebellum. In this review, we summarize region- and circuit-specific functions and expression patterns for GluD1 and its related proteins, and their implications for behavior and disease.

Also flagged:Hepatitisporphyriainfectionironinterferonribavirin
Journal Article 2021-05-14 ✓ 1 Snippet John JJ, Sterling RK.
In-Text Gene Mentions

…overload smoking, HCV,hemochromatosisgene mutation, estrogen…

Show Full Abstract

Porphyria cutanea tarda (PCT) is the most common porphyria and has a strong association with hepatitis C virus (HCV) infection and iron overload. Previous HCV treatment regimens, including interferon with or without ribavirin, may precipitate PCT relapse. Few case reports have shown that newer oral therapies, such as direct-acting antiviral agents, can successfully treat PCT parallel with HCV treatment. We present a case of a patient with non-iron-associated mixed porphyria that dramatically improved with direct-acting antiviral agent therapy for his HCV supporting the association of porphyria with chronic HCV.

Also flagged:Tumor Necrosis Factor-alphapreeclampsiaPETNF-αnitric oxideEtanercept
Journal Article 2021-05-14 No Snippets Travis OK, Tardo GA, Giachelli C, Siddiq S, Nguyen HT, Crosby MT, Johnson T, Brown AK, Williams JM, Cornelius DC.
Show Full Abstract

We recently reported that adoptive transfer of cytolytic Natural Killer cells (cNKs) from the Reduced Uterine Perfusion Pressure (RUPP) rat induces a preeclampsia (PE)-like phenotype in pregnant rats, accompanied by increased TNF-α. The purpose of this study was to investigate a role for increased TNF-α to induce oxidative stress (ROS), decrease nitric oxide (NO) bioavailability, and induce vascular dysfunction as mechanisms of hypertension (HTN) and intrauterine growth restriction (IUGR) in RUPPs. Pregnant Sprague Dawley rats underwent the RUPP or a Sham procedure on gestation day (GD) 14. On GDs 15 and 18, a subset of Sham and RUPP rats received i.p.injections of vehicle or 0.4 mg/kg of Etanercept (ETA), a soluble TNF-α receptor (n = 10/group). On GD18, Uterine Artery Resistance Index (UARI) was measured, and on GD19, mean arterial pressure (MAP), fetal and placental weights were measured, and blood and tissues were processed for analysis. TNF-α blockade normalized the elevated MAP observed RUPP. Additionally, both fetal and placental weights were decreased in RUPP compared to Sham, and were normalized in RUPP + ETA. Placental ROS was also increased in RUPP rats compared to Sham, and remained elevated in RUPP + ETA. Compared to Sham, UARI was elevated in RUPPs while plasma total nitrate was reduced, and these were normalized in ETA treated RUPPs. In conclusion, TNF-α blockade in RUPPs reduced MAP and UARI, improved fetal growth, and increased NO bioavailability. These data suggest that TNF-α regulation of NO bioavailability is a potential mechanism that contributes to PE pathophysiology and may represent a therapeutic target to improve maternal outcomes and fetal growth.

Also flagged:AdenosineG-protein coupled adenosine receptorssleepagingstrokeepilepsy
Journal Article 2021-05-14 ✓ 5 Snippets Garcia-Gil M, Camici M, Allegrini S, Pesi R, Tozzi MG.
In-Text Gene Mentions

More recently, human astrocytes and striatal neurons have been obtained from pluripotent stem cells (iPSCs) derived from unaffected individuals and HD patients with HTT gene containing increased number of CAG repeats and used to study the effect of mutant HTT on bioenergetics (HD iPSC Consortium, 2020; Hamilton et al., 2020).

HD is a neurodegenerative disorder that is caused by expanded CAG repeats within the exon-1 of the gene coding for huntingtin (HTT).

Striatal density of ENT1 expression and the expression of ENT1 transcript were significantly increased in mouse expressing HTT with 175 repeats and in postmortem prefrontal cortex from HD patients, respectively (Guitart et al., 2016).

The authors suggested that mutated HTT could interact with and suppress the activity of the extracellular enzymes involved in nucleotide catabolism thereby contributing to HD pathology (Toczek et al., 2018).

The decline in energy metabolism observed in HD may be caused both by a gain-of-function of the mutated HTT protein and also by the loss of HTT function.

Show Full Abstract

Adenosine, acting both through G-protein coupled adenosine receptors and intracellularly, plays a complex role in multiple physiological and pathophysiological processes by modulating neuronal plasticity, astrocytic activity, learning and memory, motor function, feeding, control of sleep and aging. Adenosine is involved in stroke, epilepsy and neurodegenerative pathologies. Extracellular concentration of adenosine in the brain is tightly regulated. Adenosine may be generated intracellularly in the central nervous system from degradation of AMP or from the hydrolysis of S-adenosyl homocysteine, and then exit via bi-directional nucleoside transporters, or extracellularly by the metabolism of released nucleotides. Inactivation of extracellular adenosine occurs by transport into neurons or neighboring cells, followed by either phosphorylation to AMP by adenosine kinase or deamination to inosine by adenosine deaminase. Modulation of the nucleoside transporters or of the enzymatic activities involved in the metabolism of adenosine, by affecting the levels of this nucleoside and the activity of adenosine receptors, could have a role in the onset or the development of central nervous system disorders, and can also be target of drugs for their treatment. In this review, we focus on the contribution of 5'-nucleotidases, adenosine kinase, adenosine deaminase, AMP deaminase, AMP-activated protein kinase and nucleoside transporters in epilepsy, cognition, and neurodegenerative diseases with a particular attention on amyotrophic lateral sclerosis and Huntington's disease. We include several examples of the involvement of components of the adenosine metabolism in learning and of the possible use of modulators of enzymes involved in adenosine metabolism or nucleoside transporters in the amelioration of cognition deficits.

Also flagged:CancerTumorgene expressionneoplasmscolorectal cancermelanoma
Journal Article 2021-05-14 No Snippets Xiao H, Zhang J, Wang K, Song K, Zheng H, Yang J, Li K, Yuan R, Zhao W, Hui Y.
Show Full Abstract

Tumor-infiltrating immune cells are important components in the tumor microenvironment (TME) and different types of these cells exert different effects on tumor development and progression; these effects depend upon the type of cancer involved. Several methods have been developed for estimating the proportion of immune cells using bulk transcriptome data. However, there is a distinct lack of methods that are capable of predicting the immune contexture in specific types of cancer. Furthermore, the existing methods are based on absolute gene expression and are susceptible to experimental batch effects, thus resulting in incomparability across different datasets. In this study, we considered two common neoplasms as examples (colorectal cancer [CRC] and melanoma) and introduced the Tumor-infiltrating Immune Cell Proportion Estimator (TICPE), a cancer-specific qualitative method for estimating the proportion of tumor-infiltrating immune cells. The TICPE was based on the relative expression orderings (REOs) of gene pairs within a sample and is notably insensitive to batch effects. Performance evaluation using public expression data with mRNA mixtures, single-cell RNA-Seq (scRNA-Seq) data, immunohistochemistry data, and simulated bulk RNA-seq samples, indicated that the TICPE can estimate the proportion of immune cells with levels of accuracy that are clearly superior to other methods. Furthermore, we showed that the TICPE could effectively detect prognostic signals in patients with tumors and changes in the fractions of immune cells during immunotherapy in melanoma. In conclusion, our work presented a unique novel method, TICPE, to estimate the proportion of immune cells in specific cancer types and explore the effect of the infiltration of immune cells on the efficacy of immunotherapy and the prognosis of cancer. The source code for TICPE is available at https://github.com/huitingxiao/TICPE.

Also flagged:Cas9uPARTumorEGFRMelanomamembrane
Journal Article 2021-05-14 No Snippets Biagioni A, Chillà A, Del Rosso M, Fibbi G, Scavone F, Andreucci E, Peppicelli S, Bianchini F, Calorini L, Li Santi A, Ragno P, Margheri F, Laurenzana A.
Show Full Abstract

uPAR is a globular protein, tethered to the cell membrane by a GPI-anchor involved in several cancer-related properties and its overexpression commonly correlates with poor prognosis and metastasis. We investigated the consequences of uPAR irreversible loss in human melanoma and colon cancer cell lines, knocking out its expression by CRISPR/Cas9. We analyzed through flow cytometry, western blotting and qPCR, the modulation of the most known cancer stem cells-associated genes and the EGFR while we observed the proliferation rate exploiting 2D and 3D cellular models. We also generated uPAR "rescue" expression cell lines as well as we promoted the expression of only its 3'UTR to demonstrate the involvement of uPAR mRNA in tumor progression. Knocking out PLAUR, uPAR-encoding gene, we observed an inhibited growth ratio unexpectedly coupled with a significant percentage of cells acquiring a stem-like phenotype. <i>In vivo</i> experiments demonstrated that uPAR loss completely abrogates tumorigenesis despite the gained stem-like profile. Nonetheless, we proved that the reintroduction of the 3'UTR of PLAUR gene was sufficient to restore the wild-type status validating the hypothesis that such a region may act as a "molecular sponge". In particular miR146a, by binding PLAUR 3' UTR region might be responsible for uPAR-dependent inhibition of EGFR expression.

Also flagged:CarbonNanotubesingle-walled carbon nanotubes-carbon nanotubeconjugation
Journal Article 2021-05-14 No Snippets Yeniyurt Y, Kilic S, Güner-Yılmaz ÖZ, Bozoglu S, Meran M, Baysak E, Kurkcuoglu O, Hizal G, Karatepe N, Batirel S, Güner FS.
Show Full Abstract

Due to their structural characteristics at the nanoscale level, single-walled carbon nanotubes (SWNTs), hold great promise for applications in biomedicine such as drug delivery systems. Herein, a novel single-walled carbon nanotube (SWNT)-based drug delivery system was developed by conjugation of various Fmoc-amino acid bearing polyethylene glycol (PEG) chains (Mw = 2,000, 5,000, and 12,000). In the first step, full-atom molecular dynamics simulations (MD) were performed to identify the most suitable Fmoc-amino acid for an effective surface coating of SWNT. Fmoc-glycine, Fmoc-tryptophan, and Fmoc-cysteine were selected to attach to the PEG polymer. Here, Fmoc-cysteine and -tryptophan had better average interaction energies with SWNT with a high number of aromatic groups, while Fmoc-glycine provided a non-aromatic control. In the experimental studies, non-covalent modification of SWNTs was achieved by Fmoc-amino acid-bearing PEG chains. The remarkably high amount of Fmoc-glycine-PEG, Fmoc-tryptophan-PEG, and Fmoc-cysteine-PEG complexes adsorbed onto the SWNT surface, as was assessed via thermogravimetric and UV-vis spectroscopy analyses. Furthermore, Fmoc-cysteine-PEG<sub>5000</sub> and Fmoc-cysteine-PEG<sub>12000</sub> complexes displayed longer suspension time in deionized water, up to 1 and 5 week, respectively, underlying the ability of these surfactants to effectively disperse SWNTs in an aqueous environment. <i>In vitro</i> cell viability assays on human dermal fibroblast cells also showed the low cytotoxicity of these two samples, even at high concentrations. In conclusion, synthesized nanocarriers have a great potential for drug delivery systems, with high loading capacity, and excellent complex stability in water critical for biocompatibility.

Also flagged:Sepsisinfectionseptic shocktoimmune responsecoagulation
Journal Article 2021-05-14 ✓ 2 Snippets Jarczak D, Kluge S, Nierhaus A.
In-Text Gene Mentions

Also, overexpression of MMP8, olfactomedin 4 (OLFM4), and interleukin 1 receptor type 2 (IL1R2) is associated with disease severity and the occurrence of organ failure in patients with AKI (246, 247).

…MMP8, olfactomedin 4 (OLFM4), and interleukin 1…

Show Full Abstract

Sepsis is a life-threatening condition and a global disease burden. Today, the heterogeneous syndrome is defined as severe organ dysfunction caused by a dysregulated host response to infection, with renewed emphasis on immune pathophysiology. Despite all efforts of experimental and clinical research during the last three decades, the ability to positively influence course and outcome of the syndrome remains limited. Evidence-based therapy still consists of basic causal and supportive measures, while adjuvant interventions such as blood purification or targeted immunotherapy largely remain without proof of effectiveness so far. With this review, we aim to provide an overview of sepsis immune pathophysiology, to update the choice of therapeutic approaches targeting different immunological mechanisms in the course of sepsis and septic shock, and to call for a paradigm shift from the pathogen to the host response as a potentially more promising angle.

Also flagged:ironmyelodysplastic syndromeerythropoiesisoxygenhematopoiesisTet methylcytosine dioxygenase 2
Journal Article 2021-05-14 ✓ 2 Snippets Petzer V, Theurl I, Weiss G, Wolf D.
In-Text Gene Mentions

In contrast to HFE-related diseases, where the genetic defect directly affects the hepcidin-ferroportin axis, the genetic defect in thalassemia causes a decreased hemoglobin production [15,16,17].

…In contrast toHFE-related diseases, where the…

Show Full Abstract

Systemic iron overload is multifactorial in patients suffering from myelodysplastic syndrome (MDS). Disease-immanent ineffective erythropoiesis together with chronic red blood cell transfusion represent the main underlying reasons. However, like the genetic heterogeneity of MDS, iron homeostasis is also diverse in different MDS subtypes and can no longer be generalized. While a certain amount of iron and reactive oxygen species (ROS) are indispensable for proper hematological output, both are harmful if present in excess. Consequently, iron overload has been increasingly recognized as an important player in MDS, which is worth paying attention to. This review focuses on iron- and ROS-mediated effects in the bone marrow niche, their implications for hematopoiesis and their yet unclear involvement in clonal evolution. Moreover, we provide recent insights into hepcidin regulation in MDS and its interaction between erythropoiesis and inflammation. Based on Tet methylcytosine dioxygenase 2 (<i>TET2</i>), representing one of the most frequently mutated genes in MDS, leading to disturbances in both iron homeostasis and hematopoiesis, we highlight that different genetic alteration may have different implications and that a comprehensive workup is needed for a complete understanding and development of future therapies.

Also flagged:Menkes diseaseMDcoppermetabolismcell migrationATP7A
Journal Article 2021-05-14 ✓ 1 Snippet Martinez-Fierro ML, Cabral-Pacheco GA, Garza-Veloz I, Acuña-Quiñones J, Martinez-de-Villarreal LE, Ibarra-Ramirez M, Beuten J, Sanchez-Guerrero SE, Villarreal-Martinez L, Delgado-Enciso I, Rodriguez-Sanchez IP, Zuñiga-Ramirez VZ, Cardenas-Vargas E, Romero-Diaz V.
In-Text Gene Mentions

…anemia, liver disease,hemochromatosis, thyroid disorders (hypothyro…

Show Full Abstract

Menkes disease (MD) is a rare and often lethal X-linked recessive syndrome, characterized by generalized alterations in copper transport and metabolism, linked to mutations in the ATPase copper transporting α (<i>ATP7A</i>) gene. Our objective was to identify genomic alterations and circulating proteomic profiles related to MD assessing their potential roles in the clinical features of the disease. We describe the case of a male patient of 8 months of age with silvery hair, tan skin color, hypotonia, alterations in neurodevelopment, presence of seizures, and low values of plasma ceruloplasmin. Trio-whole-exome sequencing (Trio-WES) analysis, plasma proteome screening, and blood cell migration assays were carried out. Trio-WES revealed a hemizygous change c.4190C > T (p.S1397F) in exon 22 of the <i>ATP7A</i> gene. Compared with his parents and with child controls, 11 plasma proteins were upregulated and 59 downregulated in the patient. According to their biological processes, 42 (71.2%) of downregulated proteins had a participation in cellular transport. The immune system process was represented by 35 (59.3%) downregulated proteins (<i>p</i> = 9.44 × 10<sup>-11</sup>). Additional studies are necessary to validate these findings as hallmarks of MD.

Also flagged:cancertumourglycosylationprostate cancerprostate specific antigenglycopeptide
Journal Article 2021-05-14 ✓ 1 Snippet Gabriele C, Prestagiacomo LE, Cuda G, Gaspari M.
In-Text Gene Mentions

As a result, they identified a five protein signature comprising GALNTL4, FN, AZGP1, BGN and ECM1 that predicted patients having tumours with a Gleason score <7 or ≥7 with an AUC of 0.788; and a four protein signature comprising ASPN, CTSD, HYOU1 and OLFM4 discriminating between BPH and PCa groups with an AUC of 0.726.

Show Full Abstract

Aberrant glycosylation has long been known to be associated with cancer, since it is involved in key mechanisms such as tumour onset, development and progression. This review will focus on protein glycosylation studies in cells, tissue, urine and serum in the context of prostate cancer. A dedicated section will cover the glycoforms of prostate specific antigen, the molecule that, despite some important limitations, is routinely tested for helping prostate cancer diagnosis. Our aim is to provide readers with an overview of mass spectrometry-based glycoproteomics of prostate cancer. From this perspective, the first part of this review will illustrate the main strategies for glycopeptide enrichment and mass spectrometric analysis. The molecular information obtained by glycoproteomic analysis performed by mass spectrometry has led to new insights into the mechanism linking aberrant glycosylation to cancer cell proliferation, migration and immunoescape.

medRxiv 2021-05-14 Preprint (No Snippets API) Krueger T, Gogolewski K, Bodych M, Gambin A, Giordano G, Cuschieri S, Czypionka T, Perc M, Petelos E, Rosińska M, Szczurek E.
Show Full Abstract

<h4>Background</h4> The introduction of COVID-19 vaccination passes (VPs) by many countries coincided with the Delta variant fast becoming dominant across Europe. A thorough assessment of their impact on epidemic dynamics is still lacking. <h4>Methods</h4> Here, we propose the VAP-SIRS model that considers possibly lower restrictions for the VP holders than for the rest of the population, imperfect vaccination effectiveness against infection, rates of (re-)vaccination and waning immunity, fraction of never-vaccinated, and the increased transmissibility of the Delta variant. <h4>Results</h4> Some predicted epidemic scenarios for realistic parameter values yield new COVID-19 infection waves within two years, and high daily case numbers in the endemic state, even without introducing VPs and granting more freedom to their holders. Still, suitable adaptive policies can avoid unfavorable outcomes. <h4>Conclusions</h4> While VP holders could initially be allowed more freedom, the lack of full vaccine effectiveness and increased transmissibility will require accelerated (re-)vaccination, wide-spread immunity surveillance, and/or minimal long-term common restrictions. <h4>Plain language summary</h4> Assessing the impact of vaccines, other public health measures, and declining immunity on SARS-CoV-2 control is challenging. This is particularly true in the context of vaccination passes, whereby vaccinated individuals have more freedom of making contacts than unvaccinated ones. Here, we use a mathematical model to simulate various scenarios and investigate the likelihood of containing COVID-19 outbreaks in example European countries. We demonstrate that both Alpha and Delta SARS-CoV-2 variants inevitably lead to recurring outbreaks when measures are lifted for vaccination pass holders. High revaccination rates and a lowered fraction of the unvaccinated population increase the benefit of vaccination passes. These observations are important for policy making, highlighting the need for continued vigilance, even where the epidemic is under control, especially when new variants of concern emerge.

Also flagged:asthmacorticosteroidstrichostatin ACACNA2D3WNT5APDE10A
Journal Article 2021-05-13 ✓ 1 Snippet Hernandez-Pacheco N, Vijverberg SJ, Herrera-Luis E, Li J, Sio YY, Granell R, Corrales A, Maroteau C, Lethem R, Perez-Garcia J, Farzan N, Repnik K, Gorenjak M, Soares P, Karimi L, Schieck M, Pérez-Méndez L, Berce V, Tavendale R, Eng C, Sardon O, Kull I, Mukhopadhyay S, Pirmohamed M, Verhamme KMC, Burchard EG, Kabesch M, Hawcutt DB, Melén E, Potočnik U, Chew FT, Tantisira KG, Turner S, Palmer CN, Flores C, Pino-Yanes M, Maitland-van der Zee AH, PiCA and SysPharmPedia consortia.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Rationale</h4>Substantial variability in response to asthma treatment with inhaled corticosteroids (ICS) has been described among individuals and populations, suggesting the contribution of genetic factors. Nonetheless, only a few genes have been identified to date. We aimed to identify genetic variants associated with asthma exacerbations despite ICS use in European children and young adults and to validate the findings in non-Europeans. Moreover, we explored whether a gene-set enrichment analysis could suggest potential novel asthma therapies.<h4>Methods</h4>A genome-wide association study (GWAS) of asthma exacerbations was tested in 2681 children of European descent treated with ICS from eight studies. Suggestive association signals were followed up for replication in 538 European asthma patients. Further evaluation was performed in 1773 non-Europeans. Variants revealed by published GWAS were assessed for replication. Additionally, gene-set enrichment analysis focused on drugs was performed.<h4>Results</h4>10 independent variants were associated with asthma exacerbations despite ICS treatment in the discovery phase (p≤5×10<sup>-6</sup>). Of those, one variant at the <i>CACNA2D3-WNT5A</i> locus was nominally replicated in Europeans (rs67026078; p=0.010), but this was not validated in non-European populations. Five other genes associated with ICS response in previous studies were replicated. Additionally, an enrichment of associations in genes regulated by trichostatin A treatment was found.<h4>Conclusions</h4>The intergenic region of <i>CACNA2D3</i> and <i>WNT5A</i> was revealed as a novel locus for asthma exacerbations despite ICS treatment in European populations. Genes associated were related to trichostatin A, suggesting that this drug could regulate the molecular mechanisms involved in treatment response.

Also flagged:PP1BS4gene expressionOCA2thrombocytopenia-absent radius syndromeStargardt disease
Journal Article 2021-05-13 ✓ 1 Snippet Houge G, Laner A, Cirak S, de Leeuw N, Scheffer H, den Dunnen JT.
In-Text Gene Mentions

…functional grade 3 (HFE, a “VUS+”) and…

Show Full Abstract

The American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG-AMP) system for variant classification is score based with five classes: benign, likely benign, variant of unknown significance (VUS), likely pathogenic, and pathogenic. Here, we present a variant classification model that can be an add-on or alternative to ACMG classification: A stepwise system that can classify any type of genetic variant (e.g., hypomorphic alleles, imprinted alleles, copy number variants, runs of homozygosity, enhancer variants, and variants related to traits). We call it the ABC system because classification is first functional (A), then clinical (B), and optionally a standard comment that fits the clinical question is selected (C). Both steps A and B have 1-5 grading when knowledge is sufficient, if not, class "zero" is assigned. Functional grading (A) only concerns biological consequences with the stages normal function (1), likely normal function (2), hypothetical functional effect (3), likely functional effect (4), and proven functional effect (5). Clinical grading (B) is genotype-phenotype focused with the stages "right type of gene" (1), risk factor (2), and pathogenic (3-5, depending on penetrance). Both grades are listed for each variant and combined to generate a joint class ranging from A to F. Importantly, the A-F classes are linked to standard comments, reflecting laboratory or national policy. In step A, the VUS class is split into class 0 (true unknown) and class 3 (hypothetical functional effect based on molecular predictions or de novo occurrence), providing a rationale for variant-of-interest reporting when the clinical picture could fit the finding. The system gives clinicians a better guide to variant significance.

Also flagged:CB2Huntington diseaseHDFragile X syndromeepilepsymovement disorder
Journal Article 2021-05-13 ✓ 2 Snippets Kacher R, Lejeune FX, Noël S, Cazeneuve C, Brice A, Humbert S, Durr A.
In-Text Gene Mentions

Thus, in HD, modest expansions of 40 repeats in huntingtin gene (HTT) are associated with the appearance of motor, cognitive, and psychiatric disturbances in mid- or late adulthood, whereas large expansions of over 80 repeats cause childhood onset with additional features such as epilepsy and a more rapidly fatal course (Bates et al., 2015b; Sun et al., 2017).

…huntingtin gene (HTT) are associated…

Show Full Abstract

Recent work on Huntington disease (HD) suggests that somatic instability of CAG repeat tracts, which can expand into the hundreds in neurons, explains clinical outcomes better than the length of the inherited allele. Here, we measured somatic expansion in blood samples collected from the same 50 HD mutation carriers over a twenty-year period, along with post-mortem tissue from 15 adults and 7 fetal mutation carriers, to examine somatic expansions at different stages of life. Post-mortem brains, as previously reported, had the greatest expansions, but fetal cortex had virtually none. Somatic instability in blood increased with age, despite blood cells being short-lived compared to neurons, and was driven mostly by CAG repeat length, then by age at sampling and by interaction between these two variables. Expansion rates were higher in symptomatic subjects. These data lend support to a previously proposed computational model of somatic instability-driven disease.

Also flagged:NSIAPPIionsHCDMS2ppm
Journal Article 2021-05-13 ✓ 1 Snippet Michiels TJM, van Veen MA, Meiring HD, Jiskoot W, Kersten GFA, Metz B.
In-Text Gene Mentions

…1 fmol/μL angiotensin-I,angiotensin-III, and oxytocin as…

Show Full Abstract

Currently, animal tests are being used to confirm the potency and lack of toxicity of toxoid vaccines. In a consistency approach, animal tests could be replaced if production consistency (compared to known good products) can be proven in a panel of in vitro assays. By mimicking the in vivo antigen processing in a simplified in vitro approach, it may be possible to distinguish aberrant products from good products. To demonstrate this, heat-exposed diphtheria toxoid was subjected to partial digestion by cathepsin S (an endoprotease involved in antigen processing), and the peptide formation/degradation kinetics were mapped for various heated toxoids. To overcome the limitations associated with the very large number of samples, we used common reference-based tandem mass tag (TMT) labeling. Instead of using one label per condition with direct comparison between the set of labels, we compared multiple labeled samples to a common reference (a pooled sample containing an aliquot of each condition). In this method, the number of samples is not limited by the number of unique TMT labels. This TMT multiplexing strategy allows for a 15-fold reduction of analysis time while retaining the reliability advantage of TMT labeling over label-free quantification. The formation of the most important peptides could be followed over time and compared among several conditions. The changes in enzymatic degradation kinetics of diphtheria toxoid revealed several suitable candidate peptides for use in a quality control assay that can distinguish structurally aberrant diphtheria toxoid from compliant toxoids.

Also flagged:WAVE1lonGAPDHGluN2BGCLCGluN2A
Journal Article 2021-05-13 ✓ 2 Snippets Esparza-Moltó PB, Romero-Carramiñana I, Núñez de Arenas C, Pereira MP, Blanco N, Pardo B, Bates GR, Sánchez-Castillo C, Artuch R, Murphy MP, Esteban JA, Cuezva JM.
In-Text Gene Mentions

PRDX6

…SOD1, peroxiredoxin 6 (PRDX6), glutathione reductase (GSR)…

Show Full Abstract

The mitochondrial ATP synthase emerges as key hub of cellular functions controlling the production of ATP, cellular signaling, and fate. It is regulated by the ATPase inhibitory factor 1 (IF1), which is highly abundant in neurons. Herein, we ablated or overexpressed IF1 in mouse neurons to show that IF1 dose defines the fraction of active/inactive enzyme in vivo, thereby controlling mitochondrial function and the production of mitochondrial reactive oxygen species (mtROS). Transcriptomic, proteomic, and metabolomic analyses indicate that IF1 dose regulates mitochondrial metabolism, synaptic function, and cognition. Ablation of IF1 impairs memory, whereas synaptic transmission and learning are enhanced by IF1 overexpression. Mechanistically, quenching the IF1-mediated increase in mtROS production in mice overexpressing IF1 reduces the increased synaptic transmission and obliterates the learning advantage afforded by the higher IF1 content. Overall, IF1 plays a key role in neuronal function by regulating the fraction of ATP synthase responsible for mitohormetic mtROS signaling.

Also flagged:chromatinsegmentationssegmentationchromosomehistone H3lysine
Journal Article 2021-05-13 ✓ 4 Snippets Hoskens H, Liu D, Naqvi S, Lee MK, Eller RJ, Indencleef K, White JD, Li J, Larmuseau MHD, Hens G, Wysocka J, Walsh S, Richmond S, Shriver MD, Shaffer JR, Peeters H, Weinberg SM, Claes P.
In-Text Gene Mentions

…lead SNP rs6695444,CACNA1Eis a potentially…

…Mutations in theCACNA1Ecause developmental and…

…by mutations inCACNA1Eis less clear.…

…in patients withCACNA1Emutations, but no…

Show Full Abstract

The analysis of contemporary genomic data typically operates on one-dimensional phenotypic measurements (e.g. standing height). Here we report on a data-driven, family-informed strategy to facial phenotyping that searches for biologically relevant traits and reduces multivariate 3D facial shape variability into amendable univariate measurements, while preserving its structurally complex nature. We performed a biometric identification of siblings in a sample of 424 children, defining 1,048 sib-shared facial traits. Subsequent quantification and analyses in an independent European cohort (n = 8,246) demonstrated significant heritability for a subset of traits (0.17-0.53) and highlighted 218 genome-wide significant loci (38 also study-wide) associated with facial variation shared by siblings. These loci showed preferential enrichment for active chromatin marks in cranial neural crest cells and embryonic craniofacial tissues and several regions harbor putative craniofacial genes, thereby enhancing our knowledge on the genetic architecture of normal-range facial variation.

Also flagged:RACK1polyglutaminePolyglutamine diseasesneurodegenerative diseasesdeathMachado-Joseph disease
Journal Article 2021-05-13 ✓ 3 Snippets Xie J, Han Y, Wang T.
In-Text Gene Mentions

…gene huntingtin (htt) [ 14…

…with mutated Huntington (Htt).…

…pressing GFP-tagged N-terminalHttwith 96 CAG…

Show Full Abstract

Polyglutamine diseases are neurodegenerative diseases caused by the expansion of polyglutamine (polyQ) tracts within different proteins. Although multiple pathways have been found to modulate aggregation of the expanded polyQ proteins, the mechanisms by which polyQ tracts induced neuronal cell death remain unknown. We conducted a genome-wide genetic screen to identify genes that suppress polyQ-induced neurodegeneration when mutated. Loss of the scaffold protein RACK1 alleviated cell death associated with the expression of polyQ tracts alone, as well as in models of Machado-Joseph disease (MJD) and Huntington's disease (HD), without affecting proteostasis of polyQ proteins. A genome-wide RNAi screen for modifiers of this rack1 suppression phenotype revealed that knockdown of the E3 ubiquitin ligase, POE (Purity of essence), further suppressed polyQ-induced cell death, resulting in nearly wild-type looking eyes. Biochemical analyses demonstrated that RACK1 interacts with POE and ERK to promote ERK degradation. These results suggest that RACK1 plays a key role in polyQ pathogenesis by promoting POE-dependent degradation of ERK, and implicate RACK1/POE/ERK as potent drug targets for treatment of polyQ diseases.

Also flagged:Ataxin-2cell growthcarbonpoly(A) binding proteinbindingPan2
Journal Article 2021-05-13 ✓ 2 Snippets Tuong Vi DT, Fujii S, Valderrama AL, Ito A, Matsuura E, Nishihata A, Irie K, Suda Y, Mizuno T, Irie K.
In-Text Gene Mentions

…MRPL17 , andMRPL39), mitochondrial ribosome…

…, MRPL17 ,MRPL39), (D) genes…

Show Full Abstract

Pbp1, the yeast ortholog of human Ataxin-2, was originally isolated as a poly(A) binding protein (Pab1)-binding protein. Pbp1 regulates the Pan2-Pan3 deadenylase complex, thereby modulating the mRNA stability and translation efficiency. However, the physiological significance of Pbp1 remains unclear since a yeast strain harboring PBP1 deletion grows similarly to wild-type strain on normal glucose-containing medium. In this study, we found that Pbp1 has a role in cell growth on the medium containing non-fermentable carbon sources. While the pbp1Δ mutant showed a similar growth compared to the wild-type cell on a normal glucose-containing medium, the pbp1Δ mutant showed a slower growth on the medium containing glycerol and lactate. Microarray analyses revealed that expressions of the genes involved in gluconeogenesis, such as PCK1 and FBP1, and of the genes involved in mitochondrial function, such as COX10 and COX11, were decreased in the pbp1Δ mutant. Pbp1 regulated the expressions of PCK1 and FBP1 via their promoters, while the expressions of COX10 and COX11 were regulated by Pbp1, not through their promoters. The decreased expressions of COX10 and COX11 in the pbp1Δ mutant were recovered by the loss of Dcp1 decapping enzyme or Xrn1 5'-3'exonuclease. Our results suggest that Pbp1 regulates the expressions of the genes involved in gluconeogenesis and mitochondrial function through multiple mechanisms.

Also flagged:D29NatCDH5PTPRCVWFCD34
Journal Article 2021-05-13 ✓ 2 Snippets Johnson KR, Mallon BS, Fann YC, Chen KG.
In-Text Gene Mentions
⭐ same-sentence co-mention

…, PWP1 ,STAU1, SUDS3 ,…

⭐ same-sentence co-mention

…, STAU1 ,SUDS3, TBX3 ,…

Show Full Abstract

The ground or naive pluripotent state of human pluripotent stem cells (hPSCs), which was initially established in mouse embryonic stem cells (mESCs), is an emerging and tentative concept. To verify this vital concept in hPSCs, we performed a multivariate meta-analysis of major hPSC datasets via the combined analytic powers of percentile normalization, principal component analysis (PCA), t-distributed stochastic neighbor embedding (t-SNE), and SC3 consensus clustering. This robust bioinformatics approach has significantly improved the predictive values of our meta-analysis. Accordingly, we revealed various similarities or dissimilarities between some naive-like hPSCs (NLPs) generated from different laboratories. Our analysis confirms some previous studies and provides new evidence concerning the existence of three distinct naive-like pluripotent states. Moreover, our study offers global transcriptomic markers that define diverse pluripotent states under various hPSC growth protocols.

Also flagged:intellectual disabilitycalciumglobal developmental delaymental retardationdevelopmental delaydefects
Journal Article 2021-05-13 ✓ 5 Snippets Kessi M, Chen B, Peng J, Yan F, Yang L, Yin F.
In-Text Gene Mentions

CACNA1E

…, CACNA2D2 ,CACNA1E, CACNA1F ,…

CACNA1E, CACNA1G ,…

…CACNA1A , andCACNA1E.…

…– 84 ],CACNA1E[ 85 ],…

Show Full Abstract

<h4>Background</h4>Calcium ions are involved in several human cellular processes including corticogenesis, transcription, and synaptogenesis. Nevertheless, the relationship between calcium channelopathies (CCs) and intellectual disability (ID)/global developmental delay (GDD) has been poorly investigated. We hypothesised that CCs play a major role in the development of ID/GDD and that both gain- and loss-of-function variants of calcium channel genes can induce ID/GDD. As a result, we performed a systematic review to investigate the contribution of CCs, potential mechanisms underlying their involvement in ID/GDD, advancements in cell and animal models, treatments, brain anomalies in patients with CCs, and the existing gaps in the knowledge. We performed a systematic search in PubMed, Embase, ClinVar, OMIM, ClinGen, Gene Reviews, DECIPHER and LOVD databases to search for articles/records published before March 2021. The following search strategies were employed: ID and calcium channel, mental retardation and calcium channel, GDD and calcium channel, developmental delay and calcium channel.<h4>Main body</h4>A total of 59 reports describing 159 cases were found in PubMed, Embase, ClinVar, and LOVD databases. Variations in ten calcium channel genes including CACNA1A, CACNA1C, CACNA1I, CACNA1H, CACNA1D, CACNA2D1, CACNA2D2, CACNA1E, CACNA1F, and CACNA1G were found to be associated with ID/GDD. Most variants exhibited gain-of-function effect. Severe to profound ID/GDD was observed more for the cases with gain-of-function variants as compared to those with loss-of-function. CACNA1E, CACNA1G, CACNA1F, CACNA2D2 and CACNA1A associated with more severe phenotype. Furthermore, 157 copy number variations (CNVs) spanning calcium genes were identified in DECIPHER database. The leading genes included CACNA1C, CACNA1A, and CACNA1E. Overall, the underlying mechanisms included gain- and/ or loss-of-function, alteration in kinetics (activation, inactivation) and dominant-negative effects of truncated forms of alpha1 subunits. Forty of the identified cases featured cerebellar atrophy. We identified only a few cell and animal studies that focused on the mechanisms of ID/GDD in relation to CCs. There is a scarcity of studies on treatment options for ID/GDD both in vivo and in vitro.<h4>Conclusion</h4>Our results suggest that CCs play a major role in ID/GDD. While both gain- and loss-of-function variants are associated with ID/GDD, the mechanisms underlying their involvement need further scrutiny.

Also flagged:keratinthioldisulfideextracellularkeratins
Journal Article 2021-05-13 No Snippets Chen M, Ren X, Dong L, Li X, Cheng H.
Show Full Abstract

Dynamic covalently crosslinking (DCC) hydrogels can mimic extracellular matrix and have the functions such as self-healing, self-adapting, and shape memory. The DCC keratin hydrogels based on thiol group-disulfide bonds exchange strategy have no reports so far as we know. Herein, inspired by the rich content of the intramolecular disulfide bonds and free thiol groups in the keratins extracted by reducing agents, we report a simple thiol-disulfide bonds exchange strategy for preparing the DCC keratin hydrogels. While the pH value of the keratin solution extracted by reducing agents was adjusted to 9.5-10.0, the keratin hydrogels showed the characteristic with injectability, self-healing, self-adapting, biocompatibility, and redox-responsive capacity. The extracted type II neutral/alkali keratin plays a critical role in imparting the keratin hydrogels with the reversibility behaviors due to that the keratins could build dynamic covalent bonds through thiol oxidation and disulfide exchange reactions in alkali conditions. This strategy provides an inspiration for forming DCC keratin hydrogel by avoiding the extra introduction of chemical crosslinking agents.

Also flagged:oxygengene expressionchromatinbreast cancerTFbinding
Journal Article 2021-05-13 No Snippets Levings DC, Lacher SE, Palacios-Moreno J, Slattery M.
Show Full Abstract

Reactive oxygen species (ROS) are important signaling molecules in many physiological processes, yet excess ROS leads to cell damage and can lead to pathology. Accordingly, cells need to maintain tight regulation of ROS levels, and ROS-responsive transcriptional reprogramming is central to this process. Although it has long been recognized that oxidative stress leads to rapid, significant changes in gene expression, the impact of oxidative stress on the underlying chromatin accessibility landscape remained unclear. Here, we asked whether ROS-responsive transcriptional reprogramming is accompanied by reprogramming of the chromatin environment in MCF7 human breast cancer cells. Using a time-course exposure to multiple inducers of oxidative stress, we determined that the widespread ROS-responsive changes in gene expression induced by ROS occur with minimal changes to the chromatin environment. While we did observe changes in chromatin accessibility, these changes were: (1) far less numerous than gene expression changes after oxidative stress, and (2) occur within pre-existing regions of accessible chromatin. Transcription factor (TF) footprinting analysis of our ATAC-seq experiments identified 5 TFs or TF families with evidence for ROS-responsive changes in DNA binding: NRF2, AP-1, p53, NFY, and SP/KLF. Importantly, several of these (AP-1, NF-Y, and SP/KLF factors) have not been previously implicated as widespread regulators in the response to ROS. In summary, we have characterized genome-wide changes in gene expression and chromatin accessibility in response to ROS treatment of MCF7 cells, and we have found that regulation of the large-scale transcriptional response to excess ROS is primarily constrained by the cell's pre-existing chromatin landscape.

Also flagged:gene expressiongenetic diseasescanceroligonucleotidesplicing factorsoligonucleotides
Journal Article 2021-05-13 No Snippets El Marabti E, Abdel-Wahab O.
Show Full Abstract

RNA splicing is the enzymatic process by which non-protein coding sequences are removed from RNA to produce mature protein-coding mRNA. Splicing is thereby a major mediator of proteome diversity as well as a dynamic regulator of gene expression. Genetic alterations disrupting splicing of individual genes or altering the function of splicing factors contribute to a wide range of human genetic diseases as well as cancer. These observations have resulted in the development of therapies based on oligonucleotides that bind to RNA sequences and modulate splicing for therapeutic benefit. In parallel, small molecules that bind to splicing factors to alter their function or modify RNA processing of individual transcripts are being pursued for monogenic disorders as well as for cancer.

Also flagged:Spinal Disordershistone methyltransferaseSETD2pathogenesisinflammatory bowel diseasetrimethyltransferase
Journal Article 2021-05-13 ✓ 5 Snippets Liu M, Rao H, Liu J, Li X, Feng W, Gui L, Tang H, Xu J, Gao WQ, Li L.
In-Text Gene Mentions

Clinically, we also found that expression level of SETD2 in IBD samples is positively correlated with the expressions of PRDX3, PRDX6, GCLM and SRXN1, respectively.

…overexpression of antioxidantPRDX6in Setd2 Vil-KO…

…including Prdx3 ,Prdx6, Gclm ,…

…of Prdx3 ,Prdx6, Gclm and…

…that of PRDX3,PRDX6, GCLM and SRXN1…

Show Full Abstract

Epigenetic regulation disorder is important in the onset and pathogenesis of inflammatory bowel disease (IBD). SETD2, a trimethyltransferase of histone H3K36, is frequently mutated in IBD samples with a high risk of developing colorectal cancer (CRC). However, functions of SETD2 in IBD and colitis-associated CRC remain largely undefined. Here, we found that SETD2 modulates oxidative stress to attenuate colonic inflammation and tumorigenesis in mice. SETD2 expression became decreased in IBD patients and dextran sodium sulfate (DSS)-induced colitic mice. Setd2<sup>Vil-KO</sup> mice showed increased susceptibility to DSS-induced colitis, accompanied by more severe epithelial barrier disruption and markedly increased intestinal permeability that subsequently facilitated inflammation-associated CRC. Mechanistically, we found that Setd2 depletion resulted in excess reactive oxygen species (ROS) by directly down-regulating antioxidant genes, which led to defects in barrier integrity and subsequently inflammatory damage. Moreover, overexpression of antioxidant PRDX6 in Setd2<sup>Vil-KO</sup> intestinal epithelial cells (IECs) largely alleviated the overproductions of ROS and improved the cellular survival. Together, our findings highlight an epigenetic mechanism by which SETD2 modulates oxidative stress to regulate intestinal epithelial homeostasis and attenuate colonic inflammation and tumorigenesis. SETD2 might therefore be a pivotal regulator that maintains the homeostasis of the intestinal mucosal barrier.

Also flagged:MethylationSchizophreniaBipolar Disordermajor depressive disorderpsychiatric disordersBDNF
Journal Article 2021-05-13 ✓ 1 Snippet Zhou J, Li M, Wang X, He Y, Xia Y, Sweeney JA, Kopp RF, Liu C, Chen C.
In-Text Gene Mentions

Only BDNF (Carlberg et al., 2014; Tadić et al., 2014; Lieb et al., 2018; Wang et al., 2018b; Hsieh et al., 2019; Wagner et al., 2019), 5-HTT (Kang et al., 2013; Domschke et al., 2014; Okada et al., 2014; Iga et al., 2016), and HTR1B (Gassó et al., 2017; Wang et al., 2018a) were assessed in multiple MDD studies.

Show Full Abstract

Pharmacotherapy is the most common treatment for schizophrenia (SCZ), bipolar disorder (BD), and major depressive disorder (MDD). Pharmacogenetic studies have achieved results with limited clinical utility. DNA methylation (DNAm), an epigenetic modification, has been proposed to be involved in both the pathology and drug treatment of these disorders. Emerging data indicates that DNAm could be used as a predictor of drug response for psychiatric disorders. In this study, we performed a systematic review to evaluate the reproducibility of published changes of drug response-related DNAm in SCZ, BD and MDD. A total of 37 publications were included. Since the studies involved patients of different treatment stages, we partitioned them into three groups based on their primary focuses: (1) medication-induced DNAm changes (<i>n</i> = 8); (2) the relationship between DNAm and clinical improvement (<i>n</i> = 24); and (3) comparison of DNAm status across different medications (<i>n</i> = 14). We found that only BDNF was consistent with the DNAm changes detected in four independent studies for MDD. It was positively correlated with clinical improvement in MDD. To develop better predictive DNAm factors for drug response, we also discussed future research strategies, including experimental, analytical procedures and statistical criteria. Our review shows promising possibilities for using BDNF DNAm as a predictor of antidepressant treatment response for MDD, while more pharmacoepigenetic studies are needed for treatments of various diseases. Future research should take advantage of a system-wide analysis with a strict and standard analytical procedure.

Also flagged:Psychiatric Disordersneurological disordersepilepsymigraineessential tremorsstroke
Journal Article 2021-05-13 ✓ 2 Snippets Küpeli Akkol E, Tatlı Çankaya I, Şeker Karatoprak G, Carpar E, Sobarzo-Sánchez E, Capasso R.
In-Text Gene Mentions

Together with, HD is caused by a repetitive trinucleotide in the Huntingtin (Htt) gene.

It regulates autophagic function that improves movement coordination and motor function, which may be useful in clearing misfolded proteins in the HD state. With the activation of an autophagic function, also decreases mutant htt deposits and aggregation

Show Full Abstract

Psychiatric disorders are frequently encountered in many neurological disorders, such as Alzheimer's and Parkinson diseases along with epilepsy, migraine, essential tremors, and stroke. The most common comorbid diagnoses in neurological diseases are depression and anxiety disorders along with cognitive impairment. Whether the underlying reason is due to common neurochemical mechanisms or loss of previous functioning level, comorbidities are often overlooked. Various treatment options are available, such as pharmacological treatments, cognitive-behavioral therapy, somatic interventions, or electroconvulsive therapy. However oral antidepressant therapy may have some disadvantages, such as interaction with other medications, low tolerability due to side effects, and low efficiency. Natural compounds of plant origin are extensively researched to find a better and safer alternative treatment. Experimental studies have shown that phytochemicals such as alkaloids, terpenes, flavonoids, phenolic acids as well as lipids have significant potential in <i>in vitro</i> and <i>in vivo</i> models of psychiatric disorders. In this review, various efficacy of natural products in <i>in vitro</i> and <i>in vivo</i> studies on neuroprotective and their roles in psychiatric disorders are examined and their neuro-therapeutic potentials are shed light.

Also flagged:juvenile diseasechoreaHuntingtinAdenineanxietysulpiride
Journal Article 2021-05-13 ✓ 2 Snippets Chen S, Liang T, Xue T, Xue S, Xue Q.
In-Text Gene Mentions

HTT

…the Huntington protein (HTT) gene on chromosome…

Show Full Abstract

<b>Background:</b> Huntington's disease (HD) is a progressive neurodegenerative disorder. Generally, it is characterized by deficits in cognition, behavior, and movement. Recent studies have shown that pridopidine is a potential and effective drug candidate for the treatment of HD. In the present study, we performed a meta-analysis to evaluate the efficacy and safety of pridopidine in HD. <b>Methods:</b> The MEDLINE, EMBASE, CENTRAL, and Clinicaltrials.gov databases were searched for randomized controlled trials (RCTs) which had that evaluated pridopidine therapy in HD patients. <b>Results:</b> We pooled data from 1,119 patients across four RCTs. Patients in the pridopidine group had a significantly lower Unified Huntington's Disease Rating Scale (UHDRS)-modified Motor Score (mMS) (MD -0.79, 95% CI = -1.46 to -0.11, <i>p</i> = 0.02) than those in the placebo group. Additionally, no differences were observed in the UHDRS-Total Motor Score (TMS) (MD -0.91. 95% CI = -2.03 to 0.21, <i>p</i> = 0.11) or adverse events (RR 1.06, 95% CI = 0.96 to 1.16, <i>p</i> = 0.24) in the pridopidine and placebo groups. In the subgroup analysis, the short-term (≤12 weeks) and long-term (>12 weeks) subgroups exhibited similar efficacy and safety with no statistical significance in TMS, mMS, or adverse events. However, TMS (MD -1.50, 95% CI = -2.87 to -0.12, <i>p</i> = 0.03) and mMS (MD -1.03, 95% CI = -1.87 to -0.19, <i>p</i> = 0.02) were observed to be improved significantly when the dosage of pridopidine ≥90 mg/day. Additionally, pridopidine (≥90 mg/day) increased total adverse events (RR 1.11, 95% CI = 1.00 to 1.22, <i>p</i> = 0.04) compared with placebo. On this basis, we analyzed the incidence of various adverse events when the dosage was ≥90 mg/day. Nonetheless, these results were within the acceptable threshold, although patients developed symptoms, such as nasopharyngitis and insomnia. <b>Conclusion:</b> Pridopidine improved mMS and had no statistical significance in association with TMS or adverse events. Pridopidine (≥90 mg/day) improved TMS and mMS but increased adverse events, such as nasopharyngitis and insomnia. More RCTs were expected to assess pridopidine in HD.

Also flagged:NeuregulinTumorGliomasbrain lower grade gliomaglioblastoma multiformeGBM
Journal Article 2021-05-13 ✓ 1 Snippet Zhao WJ, Ou GY, Lin WW.
In-Text Gene Mentions

…BTNL2, CD200R1, CD244,TNFSF4and BTLA.…

Show Full Abstract

Gliomas, including brain lower grade glioma (LGG) and glioblastoma multiforme (GBM), are the most common primary brain tumors in the central nervous system. Neuregulin (NRG) family proteins belong to the epidermal growth factor (EGF) family of extracellular ligands and they play an essential role in both the central and peripheral nervous systems. However, roles of NRGs in gliomas, especially their effects on prognosis, still remain to be elucidated. In this study, we obtained raw counts of RNA-sequencing data and corresponding clinical information from 510 LGG and 153 GBM samples from The Cancer Genome Atlas (TCGA) database. We analyzed the association of NRG1-4 expression levels with tumor immune microenvironment in LGG and GBM. GSVA (Gene Set Variation Analysis) was performed to determine the prognostic difference of NRGs gene set between LGG and GBM. ROC (receiver operating characteristic) curve and the nomogram model were constructed to estimate the prognostic value of NRGs in LGG and GBM. The results demonstrated that NRG1-4 were differentially expressed in LGG and GBM in comparison to normal tissue. Immune score analysis revealed that NRG1-4 were significantly related to the tumor immune microenvironment and remarkably correlated with immune cell infiltration. The investigation of roles of m<sup>6</sup>A (N6-methyladenosine, m<sup>6</sup>A)-related genes in gliomas revealed that NRGs were prominently involved in m<sup>6</sup>A RNA modification. GSVA score showed that NRG family members are more associated with prognosis in LGG compared with GBM. Prognostic analysis showed that NRG3 and NRG1 can serve as potential independent biomarkers in LGG and GBM, respectively. Moreover, GDSC drug sensitivity analysis revealed that NRG1 was more correlated with drug response compared with other NRG subtypes. Based on these public databases, we preliminarily identified the relationship between NRG family members and tumor immune microenvironment, and the prognostic value of NRGs in gliomas. In conclusion, our study provides comprehensive roles of NRG family members in gliomas, supporting modulation of NRG signaling in the management of glioma.

Also flagged:host cellssecretionsecretoryorganellesdense granulesmicroneme proteins
Journal Article 2021-05-13 ✓ 1 Snippet Sun H, Li J, Wang L, Yin K, Xu C, Liu G, Xiao T, Huang B, Wei Q, Gong M, Cao J.
In-Text Gene Mentions

…enriched and includedneuronal growth regulator 1growth regulator 1,…

Show Full Abstract

<i>Toxoplasma gondii</i>, a representative model organism belonging to the phylum Apicomplexa, can infect almost all warm-blooded organisms, including humans. The invasion of host cells <i>via</i> host-parasite interaction is the key step for <i>T. gondii</i> to complete its life cycle. Herein we performed tandem mass tag analysis to investigate global proteomic changes in host cells (human foreskin fibroblasts, HFFs) [HFFs infected with <i>T. gondii</i> (HT) <i>vs</i>. HFFs (H)] and <i>T. gondii</i> [HT <i>vs</i>. <i>T. gondii</i> (T)] during intracellular infection. Overall, 3477 and 1434 proteins were quantified, of which 375 and 1099 proteins were differentially expressed (adjusted p-value < 0.05 and >1.5 or <0.67-fold change) in host cells and <i>T. gondii</i>, respectively. <i>T. gondii</i> invasion relies on the secretion of numerous secretory proteins, which originate from three secretory organelles: micronemes, rhoptries, and dense granules. In the HT <i>vs</i>. T group, few secretory proteins were upregulated, such as microneme proteins (MICs: MIC6, MIC10), rhoptry bulb proteins (ROPs: ROP5, ROP17), and dense granule proteins (GRAs: GRA4, GRA5, GRA12). In contrast, dozens of known secretory proteins were significantly downregulated in <i>T. gondii</i>-infected HFFs. In HFFs, gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses revealed a large number of differentially expressed proteins (DEPs) enriched in metabolic processes and immune-associated signaling pathways, such as NF-κB, cAMP, and Rap1 signaling pathways. Further, in case of <i>T. gondii</i>, DEPs were involved in ribosome biogenesis, citrate cycle, and galactose metabolism, indicating that cell biosynthesis and metabolism of <i>T. gondii</i> were altered after host cell invasion. These findings reveal novel modifications in the proteome of host cells as well as <i>T. gondii</i>, helping us better understand the mechanisms underlying host-parasite interaction.

Also flagged:Leukodystrophymetachromatic leukodystrophyMLDsaposin bPelizaeus-Merzbacher-like diseasePelizaeus-Merzbacher disease
Journal Article 2021-05-13 ✓ 1 Snippet Alfadhel M, Almuqbil M, Al Mutairi F, Umair M, Almannai M, Alghamdi M, Althiyab H, Albarakati R, Bashiri FA, Alshuaibi W, Ba-Armah D, Saleh MA, Al-Asmari A, Faqeih E, Altuwaijri W, Al-Rumayyan A, Balwi MA, Ababneh F, Alswaid AF, Eyaid WM, Almontashiri NAM, Alhashem A, Hundallah K, Bertoli-Avella A, Bauer P, Beetz C, Alrifai MT, Alfares A, Tabarki B.
In-Text Gene Mentions

…pathogenic variants inDARS2( NM_018122.4 :…

Show Full Abstract

<b>Background:</b> Leukodystrophies (LDs) are inherited heterogeneous conditions that affect the central nervous system with or without peripheral nerve involvement. They are individually rare, but collectively, they are common. Thirty disorders were included by the Global Leukodystrophy Initiative Consortium (GLIA) as LDs. <b>Methods:</b> We conducted a retrospective chart review of a consecutive series of patients diagnosed with different types of LD from four large tertiary referral centers in Riyadh, Saudi Arabia. Only those 30 disorders defined by GLIA as LDs were included. <b>Results:</b> In total, 83 children from 61 families were identified and recruited for this study. The male-to-female ratio was 1.5:1, and a consanguinity rate of 58.5% was observed. An estimated prevalence of 1:48,780 or 2.05/100,000 was observed based on the clinical cohort, whereas a minimum of 1:32,857 or 3.04/100,000 was observed based on the local genetic database. The central region of the country exhibited the highest prevalence of LDs (48.5%). The most common LD was metachromatic leukodystrophy (MLD), and it accounted for 25.3%. The most common disorder based on carrier frequency was AGS. Novel variants were discovered in 51% of the cases, but 49% possessed previously reported variants. Missense variants were high in number and accounted for 73% of all cases. Compared with other disorders, MLD due to saposin b deficiency was more common than expected, Pelizaeus-Merzbacher-like disease was more prevalent than Pelizaeus-Merzbacher disease, and X-linked adrenoleukodystrophy was less common than expected. The mortality rate among our patients with LD was 24%. <b>Conclusion:</b> To the best of our knowledge, this is the largest cohort of patients with LD from Saudi Arabia. We present epidemiological, clinical, radiological, and genetic data. Furthermore, we report 18 variants that have not been reported previously. These findings are of great clinical and molecular utility for diagnosing and managing patients with LD.

Also flagged:cox1nucleotideepilepsyepilepsy syndromeWest syndromeDravet syndrome
Journal Article 2021-05-13 ✓ 5 Snippets Sun D, Liu Y, Cai W, Ma J, Ni K, Chen M, Wang C, Liu Y, Zhu Y, Liu Z, Zhu F.
In-Text Gene Mentions

For example, there are a number of trials including rapamycin/everolimus, targeting the mTOR pathway, for the treatment of tuberous sclerosis complex and related WS (43); retigabine for the treatment of KCNQ2-related WS (44); and topiramate for the treatment of CACNA1E-related WS (31).

In contrast, in 22 infants with WS, 8 cases (7/22, 31.8%) were caused by pathogenic or likely pathogenic variants from a variety of genes, including GABRA1, GABRA2, KCNT1, SCN3A, CACNA1E, PHGDH, and PRRT2 (in del 16p11.2).

One pathogenic variant in de novo status was found in the CACNA1E gene, which encodes calcium voltage-gated channel subunit alpha1 E. The disease-causing variants in CACNA1E has recently been identified as a cause of developmental and epileptic encephalopathies (31).

…new disease-causing genes,CACNA1Eand WDR26 .…

…found in theCACNA1Egene, which encodes…

Show Full Abstract

<b>Background:</b> Epileptic encephalopathies (EEs) are a pediatric entity with highly phenotypic and genetic heterogeneity. Both single nucleotide variants (SNVs)/Indels and copy number variations (CNVs) could be the causes. Whole exome sequencing (WES) is widely applied to detect SNVs/Indels, but the bioinformatics approach for detecting CNVs is still limited and weak. In the current study, the possibility of profiling both disease-causing SNVs/Indels and CNVs in a single test based on WES in EEs was evaluated. <b>Methods:</b> The infants diagnosed with EEs were enrolled from a single pediatric epilepsy center between January 2018 and February 2020. Demographic and clinical data were collected. In WES data, the pathogenic SNVs were identified through an in-house pipeline, and pathogenic CNVs were identified by CNVkit. The diagnostic rate was evaluated, and the molecular findings were characterized. <b>Results:</b> A total of 73 infants were included; 36 (49.32%) of them were males. The median age was 7 months. Thirty-two (43.84%) infants had been diagnosed with epilepsy syndrome. The most common type of syndrome was West syndrome (22/73, 30.1%), followed by Dravet syndrome (20/77, 27.4%). Fifty-four (73.97%) had intellectual development delay. The genetic cause of EEs, pathogenic or likely pathogenic variants, were successfully discovered in 46.6% (34/73) of the infants, and 29 (39.7%) infants carried SNVs/Indels, while 5 (6.8%) carried CNVs. The majority of the disease-causing variants were inherited in <i>de novo</i> pattern (25, 71.4%). In addition to showing that the variants in the ion channel encoding genes accounted for the main etiology, we discovered and confirmed two new disease-causing genes, <i>CACNA1E</i> and <i>WDR26</i>. Five discovered CNVs were deletions of 2q24.3, 1p36, 15q11-q13, 16p11.2, and 17p13.3, and all were confirmed by array comparative genomic hybridization. <b>Conclusion:</b> The application of both SNVs/Indels and CNVs detection in a single test based on WES yielded a high diagnosis rate in EEs. WES may serve as a first-tier test with cost-effective benefit in EEs.

Also flagged:Extracellular vesiclesmembranevesiclesvesicleneurodegenerative diseasesmembranes
Journal Article 2021-05-13 No Snippets Beatriz M, Vilaça R, Lopes C.
Show Full Abstract

Extracellular vesicles (EVs) are nano-sized membrane-enclosed particles released by cells that participate in intercellular communication through the transfer of biologic material. EVs include exosomes that are small vesicles that were initially associated with the disposal of cellular garbage; however, recent findings point toward a function as natural carriers of a wide variety of genetic material and proteins. Indeed, exosomes are vesicle mediators of intercellular communication and maintenance of cellular homeostasis. The role of exosomes in health and age-associated diseases is far from being understood, but recent evidence implicates exosomes as causative players in the spread of neurodegenerative diseases. Cells from the central nervous system (CNS) use exosomes as a strategy not only to eliminate membranes, toxic proteins, and RNA species but also to mediate short and long cell-to-cell communication as carriers of important messengers and signals. The accumulation of protein aggregates is a common pathological hallmark in many neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and prion diseases. Protein aggregates can be removed and delivered to degradation by the endo-lysosomal pathway or can be incorporated in multivesicular bodies (MVBs) that are further released to the extracellular space as exosomes. Because exosome transport damaged cellular material, this eventually contributes to the spread of pathological misfolded proteins within the brain, thus promoting the neurodegeneration process. In this review, we focus on the role of exosomes in CNS homeostasis, their possible contribution to the development of neurodegenerative diseases, the usefulness of exosome cargo as biomarkers of disease, and the potential benefits of plasma circulating CNS-derived exosomes.

Also flagged:ECMExtracellular Vesiclestype 1 diabetes mellitusT1DMextracellularvesicles
Journal Article 2021-05-13 ✓ 3 Snippets Bai C, Ren Q, Liu H, Li X, Guan W, Gao Y.
In-Text Gene Mentions

…Then, plasmids ofSOX6, PDE7B, and FBW7,…

…2 and thenSOX6( Iguchi et…

…FBW7, but notSOX6or PDE7B, significantly…

Show Full Abstract

Pancreatic beta cell transplantation is the ideal method for treatment of type 1 diabetes mellitus (T1DM), and the generation of beta cells from induced pluripotent stem cells (iPSCs) of patients is a promising strategy. In this study, we improved a previous strategy to produce beta cells using extracellular vesicles (EVs) derived from mature beta cells and differentiated beta cells from iPSCs (i-Beta cells), which secreted insulin under glucose stimulation <i>in vitro</i> and ameliorated hyperglycemia <i>in vivo</i>. Mechanistic analyses revealed that EV-carried microRNA (miR)-212/132 (EV-miR-212/132) directly bound to the 3' UTR of FBW7 to prevent its translation and FBW7 combined with NGN3 to accelerate its proteasomal degradation. EV-miR-212/132 stabilized NGN3 expression to promote differentiation of endocrine cells from induced iPSCs. Moreover, NGN3 bound to PDX1 to enhance transcription of endogenous miR-212/132 and formed a positive regulatory circuit that maintained the functions of mature pancreatic beta cells.<h4>Conclusion</h4>This study describes a novel approach for beta cell production and supports the use of iPSCs for cell replacement therapy of T1DM.

Also flagged:clpPlonhslVchromosomesATPaseLon protease
Journal Article 2021-05-13 ✓ 3 Snippets Charbon G, Mendoza-Chamizo B, Campion C, Li X, Jensen PR, Frimodt-Møller J, Løbner-Olesen A.
In-Text Gene Mentions

DARS2

…( DARS1 andDARS2sites) ( Fujimitsu…

…Δ DARS1 ΔDARS2(lower DnaA ATP…

Show Full Abstract

During steady-state <i>Escherichia coli</i> growth, the amount and activity of the initiator protein, DnaA, controls chromosome replication tightly so that initiation only takes place once per origin in each cell cycle, regardless of growth conditions. However, little is known about the mechanisms involved during transitions from one environmental condition to another or during starvation stress. ATP depletion is one of the consequences of long-term carbon starvation. Here we show that DnaA is degraded in ATP-depleted cells. A chromosome replication initiation block is apparent in such cells as no new rounds of DNA replication are initiated while replication events that have already started proceed to completion.

Also flagged:MethylationGene ExpressionS100A8S100A9PathogenesisObesity
Journal Article 2021-05-13 No Snippets Chen N, Miao L, Lin W, Zou D, Huang L, Huang J, Shi W, Li L, Luo Y, Liang H, Pan S, Peng J.
Show Full Abstract

<b>Background:</b> To explore the association of DNA methylation and gene expression in the pathology of obesity. <b>Methods:</b> (1) Genomic DNA methylation and mRNA expression profile of visceral adipose tissue (VAT) were performed in a comprehensive database of gene expression in obese and normal subjects. (2) Functional enrichment analysis and construction of differential methylation gene regulatory networks were performed. (3) Validation of the two different methylation sites and corresponding gene expression was done in a separate microarray dataset. (4) Correlation analysis was performed on DNA methylation and mRNA expression data. <b>Results:</b> A total of 77 differentially expressed mRNAs matched with differentially methylated genes. Analysis revealed two different methylation sites corresponding to two unique genes-s100a8-cg09174555 and s100a9-cg03165378. Through the verification test of two interesting different expression positions [differentially methylated positions (DMPs)] and their corresponding gene expression, we found that methylation in these genes was negatively correlated to gene expression in the obesity group. Higher S100A8 and S100A9 expressions in obese subjects were validated in a separate microarray dataset. <b>Conclusion:</b> This study confirmed the relationship between DNA methylation and gene expression and emphasized the important role of S100A8 and S100A9 in the pathogenesis of obesity.

Also flagged:axonsaxonallocalizationaxonglycoproteinsguidance receptors
Journal Article 2021-05-13 ✓ 2 Snippets Mutalik SP, Gupton SL.
In-Text Gene Mentions

…the netrin receptorDCC(deleted in colorectal…

…UNC-5 heterodimerizes withDCCto induce repulsion…

Show Full Abstract

How millions of axons navigate accurately toward synaptic targets during development is a long-standing question. Over decades, multiple studies have enriched our understanding of axonal pathfinding with discoveries of guidance molecules and morphogens, their receptors, and downstream signalling mechanisms. Interestingly, classification of attractive and repulsive cues can be fluid, as single guidance cues can act as both. Similarly, guidance cues can be secreted, chemotactic cues or anchored, adhesive cues. How a limited set of guidance cues generate the diversity of axonal guidance responses is not completely understood. Differential expression and surface localization of receptors, as well as crosstalk and spatiotemporal patterning of guidance cues, are extensively studied mechanisms that diversify axon guidance pathways. Posttranslational modification is a common, yet understudied mechanism of diversifying protein functions. Many proteins in axonal guidance pathways are glycoproteins and how glycosylation modulates their function to regulate axonal motility and guidance is an emerging field. In this review, we discuss major classes of glycosylation and their functions in axonal pathfinding. The glycosylation of guidance cues and guidance receptors and their functional implications in axonal outgrowth and pathfinding are discussed. New insights into current challenges and future perspectives of glycosylation pathways in neuronal development are discussed.

Also flagged:Mineralshaematopoiesiscollagenhydroxylapatitemineralbioapatite
Journal Article 2021-05-13 No Snippets Ulian G, Moro D, Valdrè G.
Show Full Abstract

Hard tissues (e.g., bone, enamel, dentin) in vertebrates perform various and different functions, from sustaining the body to haematopoiesis. Such complex and hierarchal tissue is actually a material composite whose static and dynamic properties are controlled by the subtle physical and chemical interplay between its components, collagen (main organic part) and hydroxylapatite-like mineral. The knowledge needed to fully understand the properties of bony and dental tissues and to develop specific applicative biomaterials (e.g., fillers, prosthetics, scaffolds, implants, etc.) resides mostly at the atomic scale. Among the different methods to obtains such detailed information, atomistic computer simulations (in silico) have proven to be both corroborative and predictive tools in this subject. The authors have intensively worked on quantum mechanical simulations of bioapatite and the present work reports a detailed review addressed to the crystal-chemical, physical, spectroscopic, mechanical, and surface properties of the mineral phase of bone and dental tissues. The reviewed studies were conducted at different length and time scales, trying to understand the features of hydroxylapatite and biological apatite models alone and/or in interaction with simplified collagen-like models. The reported review shows the capability of the computational approach in dealing with complex biological physicochemical systems, providing accurate results that increase the overall knowledge of hard tissue science.

Also flagged:bipolar disordersynapsesmorphine addictionpathogenesisPathophysiologymood impairment
Journal Article 2021-05-13 No Snippets Ghafouri-Fard S, Badrlou E, Taheri M, Dürsteler KM, Beatrix Brühl A, Sadeghi-Bahmani D, Brand S.
Show Full Abstract

<h4>Aim</h4>Bipolar disorder is a multifactorial disorder being linked with dysregulation of several genes. Among the recently acknowledged factors in the pathophysiology of bipolar disorder are non-coding RNAs (ncRNAs).<h4>Methods</h4>We searched PubMed and Google Scholar databases to find studies that assessed the expression profile of miRNAs, lncRNAs and circRNAs in bipolar disorder.<h4>Results</h4>Dysregulated ncRNAs in bipolar patients have been enriched in several neuron-related pathways such as GABAergic and glutamatergic synapses, morphine addiction pathway and redox modulation.<h4>Conclusion</h4>Altered expression of these transcripts in bipolar disorder provides clues for identification of the pathogenesis of this disorder and design of targeted therapies for the treatment of patients.

Also flagged:Resistant hypertensionchronic kidney diseaseheart failurestrokemyocardial infarctionrenin
Journal Article 2021-05-13 ✓ 2 Snippets Bădilă E, Japie C, Weiss E, Balahura AM, Bartoș D, Scafa Udriște A.
In-Text Gene Mentions

…of angiotensin-II toangiotensin-III.…

…formation of brainangiotensin-III[ 68 ].…

Show Full Abstract

Resistant hypertension (R-HTN) implies a higher mortality and morbidity compared to non-R-HTN due to increased cardiovascular risk and associated adverse outcomes-greater risk of developing chronic kidney disease, heart failure, stroke and myocardial infarction. R-HTN is considered when failing to lower blood pressure below 140/90 mmHg despite adequate lifestyle measures and optimal treatment with at least three medications, including a diuretic, and usually a blocker of the renin-angiotensin system and a calcium channel blocker, at maximally tolerated doses. Hereby, we discuss the diagnostic and therapeutic approach to a better management of R-HTN. Excluding pseudoresistance, secondary hypertension, white-coat hypertension and medication non-adherence is an important step when diagnosing R-HTN. Most recently different phenotypes associated to R-HTN have been described, specifically refractory and controlled R-HTN and masked uncontrolled hypertension. Optimizing the three-drug regimen, including the diuretic treatment, adding a mineralocorticoid receptor antagonist as the fourth drug, a β-blocker as the fifth drug and an α1-blocker or a peripheral vasodilator as a final option when failing to achieve target blood pressure values are current recommendations regarding the correct management of R-HTN.

Also flagged:CalciumPhosphorusCaSRParathyroid hormonePTHVitamin D
Journal Article 2021-05-13 No Snippets Papadopoulou A, Bountouvi E, Karachaliou FE.
Show Full Abstract

Calcium (Ca) and Phosphorus (P) hold a leading part in many skeletal and extra-skeletal biological processes. Their tight normal range in serum mirrors their critical role in human well-being. The signalling "voyage" starts at Calcium Sensing Receptor (CaSR) localized on the surface of the parathyroid glands, which captures the "oscillations" of extracellular ionized Ca and transfers the signal downstream. Parathyroid hormone (PTH), Vitamin D, Fibroblast Growth Factor (FGF23) and other receptors or ion-transporters, work synergistically and establish a highly regulated signalling circuit between the bone, kidneys, and intestine to ensure the maintenance of Ca and P homeostasis. Any deviation from this well-orchestrated scheme may result in mild or severe pathologies expressed by biochemical and/or clinical features. Inherited disorders of Ca and P metabolism are rare. However, delayed diagnosis or misdiagnosis may cost patient's quality of life or even life expectancy. Unravelling the thread of the molecular pathways involving Ca and P signaling, we can better understand the link between genetic alterations and biochemical and/or clinical phenotypes and help in diagnosis and early therapeutic intervention.

Also flagged:Autism Spectrum DisorderOrganophosphatesOrganochlorinePyrethroidNeonicotinoidCarbamate
Journal Article 2021-05-13 No Snippets Biosca-Brull J, Pérez-Fernández C, Mora S, Carrillo B, Pinos H, Conejo NM, Collado P, Arias JL, Martín-Sánchez F, Sánchez-Santed F, Colomina MT.
Show Full Abstract

Autism spectrum disorder (ASD) is a complex set of neurodevelopmental pathologies characterized by impoverished social and communicative abilities and stereotyped behaviors. Although its genetic basis is unquestionable, the involvement of environmental factors such as exposure to pesticides has also been proposed. Despite the systematic analyses of this relationship in humans, there are no specific reviews including both human and preclinical models. The present systematic review summarizes, analyzes, and discusses recent advances in preclinical and epidemiological studies. We included 45 human and 16 preclinical studies. These studies focused on Organophosphates (OP), Organochlorine (OC), Pyrethroid (PT), Neonicotinoid (NN), Carbamate (CM), and mixed exposures. Preclinical studies, where the OP Chlorpyrifos (CPF) compound is the one most studied, pointed to an association between gestational exposure and increased ASD-like behaviors, although the data are inconclusive with regard to other ages or pesticides. Studies in humans focused on prenatal exposure to OP and OC agents, and report cognitive and behavioral alterations related to ASD symptomatology. The results of both suggest that gestational exposure to certain OP agents could be linked to the clinical signs of ASD. Future experimental studies should focus on extending the analysis of ASD-like behaviors in preclinical models and include exposure patterns similar to those observed in human studies.

Also flagged:Soft-Tissue Sarcomastumorssarcomasoft-tissue sarcomalocalized diseasemetastatic disease
Journal Article 2021-05-13 ✓ 2 Snippets Montella L, Altucci L, Sarno F, Buonerba C, De Simone S, Facchini BA, Franzese E, De Vita F, Tafuto S, Berretta M, Facchini G.
In-Text Gene Mentions

DCC 3014 is a colony-stimulating factor-1 receptor (CSF1R/c-FMS) inhibitor, which has been evaluated in combination with avelumab in various STS (phase I NCT04242238).

DCC-3014 is an investigational orally administered, potent, and highly selective inhibitor of CSF1R.

Show Full Abstract

Soft-tissue sarcomas are rare tumors characterized by pathogenetic, morphological, and clinical intrinsic variability. Median survival of patients with advanced tumors are usually chemo- and radio-resistant, and standard treatments yield low response rates and poor survival results. The identification of defined genomic alterations in sarcoma could represent the premise for targeted treatments. Summarizing, soft-tissue sarcomas can be differentiated into histotypes with reciprocal chromosomal translocations, with defined oncogenic mutations and complex karyotypes. If the latter are improbably approached with targeted treatments, many suggest that innovative therapies interfering with the identified fusion oncoproteins and altered pathways could be potentially resolutive. In most cases, the characteristic genetic signature is discouragingly defined as "undruggable", which poses a challenge for the development of novel pharmacological approaches. In this review, a summary of genomic alterations recognized in most common soft-tissue sarcoma is reported together with current and future therapeutic opportunities.

Also flagged:Cervical CancercancerPCK1FCGR1Adeathpsychological stress
Journal Article 2021-05-13 No Snippets Cho O, Kim DW, Cheong JY.
Show Full Abstract

Plasma exosomal miRNAs are key regulators of cell-cell interactions associated with several biological functions in patients with cancer. This pilot study aimed to investigate the log<sub>2</sub> fold change (log<sub>2</sub>FC) of the expression of exosomal miRNAs and related mRNAs in the blood of patients with cervical cancer to identify prognostic markers better than those currently available. We sequenced plasma exosomal RNA from 56 blood samples collected from 28 patients with cervical cancer, who had been treated with concurrent chemoradiotherapy (CCRT). Changes in the expression of miRNAs and mRNAs before and after CCRT were represented as log<sub>2</sub>FC. Their biological functions were studied by miRNA-mRNA network analysis, using ingenuity pathway analysis, after the selection of two groups of miRNAs, each associated with early progression (EP) and metastasis, also described as initial stage. Seven patients experienced EP, three of whom died within four months after progression. Reduced levels of miR-1228-5p, miR-33a-5p, miR-3200-3p, and miR-6815-5p and increased levels of miR-146a-3p in patients with EP revealed unresolved inflammation, with accompanying increased expression of <i>PCK1</i> and decreased expression of <i>FCGR1A.</i> Increased levels of miR-605-5p, miR-6791-5p, miR-6780a-5p, and miR-6826-5p and decreased levels of miR-16-1-3p (or 15a-3p) were associated with the degree of metastasis and led to the systemic activation of myeloid, endothelial, and epithelial cells, as well as neurons, phagocytes, and platelets. Log<sub>2</sub>FCs in the expression of miRNAs and mRNAs from plasma exosomes after CCRT are associated with EP and metastasis, reflecting unresolved inflammation and systemic microenvironmental factors, respectively. However, this study, supported by preliminary data insufficient to reach clear conclusions, should be verified in larger prospective cohorts.

Also flagged:pathogenesispsoriasisPSskin diseasestrokemyocardial infarction
Journal Article 2021-05-13 No Snippets Liu X, Frost J, Bowcock A, Zhang W.
Show Full Abstract

(1) Background: Understanding the function of circular RNAs (circRNAs), a class of noncoding RNA, in psoriatic skin can provide important insights into the complex regulation of genes contributing to the pathogenesis of psoriasis. (2) Methods: A novel method was applied to RNA-seq datasets from 93 skin biopsy samples to comprehensively identify circRNAs of all types, i.e., canonical circRNAs from the intron-exon junctions of mRNAs and interior circRNAs (i-circRNAs) from the interior regions of exons, introns, and intergenic regions. Selected circRNAs were experimentally validated by qRT-PCR and Sanger sequencing. CircRNAs with abundant and differential expression were identified and their putative function as competing endogenous RNAs (ceRNAs) was analyzed by an integrated analysis of circRNAs, microRNAs, and mRNAs. (3) Results: With a comprehensive search using no information of splicing signals, we systematically identified 179 highly abundant circRNAs in psoriatic skin. Many of these were reported for the first time and many were differentially expressed in involved versus normal or uninvolved skin. Validation based on three additional RNA-seq datasets confirmed most of the identified circRNAs in psoriatic skin. Experimental analyses confirmed the expression of the well-known circRNA CDR1as, a canonical circRNA, and a novel i-circRNA in psoriasis. We also identified many circRNAs that may act as ceRNAs to regulate the expression of mRNA genes in psoriasis-related signaling pathways in psoriasis. (4) Conclusions: The result of the study suggested that circRNAs are abundant in psoriatic skin, have distinct characteristics, and contribute to psoriatic pathogenesis.

Also flagged:PSMD13PSMD14TRAF7MUL1ASB12CBL
Journal Article 2021-05-13 ✓ 4 Snippets Guo H, Li Y, Liu Y, Chen L, Gao Z, Zhang L, Zhou N, Guo H, Shi B.
In-Text Gene Mentions

TRIM38

KLHL20

FBXL4

RC3H1

Show Full Abstract

<b>Background:</b> Clear cell renal cell carcinoma (ccRCC) is a common malignant tumor of the urinary system. The ubiquitin proteasome system (UPS) plays an important role in the generation, metabolism and survival of tumor. We are aimed to make a comprehensive exploration of the UPS's role in ccRCC with bioinformatic tools, which may contribute to the understanding of UPS in ccRCC, and give insight for further research. <b>Methods:</b> The UPS-related genes (UPSs) were collected by an integrative approach. The expression and clinical data were downloaded from TCGA database. R soft was used to perform the differentially expressed UPSs analysis, functional enrichment analysis. We also estimated prognostic value of each UPS with the help of GEPIA database. Two predicting models were constructed with the differentially expressed UPSs and prognosis-related genes, respectively. The correlations of risk score with clinical characteristics were also evaluated. Data of GSE29609 cohort were obtained from GEO database to validate the prognostic models. <b>Results:</b> We finally identified 91 differentially expressed UPSs, 48 prognosis related genes among them, and constructed a prognostic model with 18 UPSs successfully, the AUC was 0.760. With the help of GEPIA, we found 391 prognosis-related UPSs, accounting for 57.84% of all UPSs. Another prognostic model was constructed with 28 prognosis-related genes of them, and with a better AUC of 0.825. Additionally, our models can also stratify patients into high and low risk groups accurately in GSE29609 cohort. Similar prognostic values of our models were observed in the validated GSE29609 cohort. <b>Conclusions:</b> UPS is dysregulated in ccRCC. UPS related genes have significant prognostic value in ccRCC. Models constructed with UPSs are effective and applicable. An abnormal ubiquitin proteasome system should play an important role in ccRCC and be worthy of further study.

Also flagged:cDNA18SACTBGAPDHHPRT1Zinc
Journal Article 2021-05-13 No Snippets Nguyen HTT, Morgan N, Roberts JR, Wu SB, Swick RA, Toghyani M.
Show Full Abstract

This study was conducted to investigate the effects of zinc (Zn), as a combination of oxide (ZnO) and sulfate (ZnSO<sub>4</sub>), compared with incremental levels of zinc hydroxychloride (ZH) on tibia traits, intestinal integrity, expression of selected jejunal genes, cecal short chain fatty acids and microbial composition in broilers. Day-old male Ross 308 chicks (n = 784) were randomly allocated to seven dietary treatments, each replicated seven times with 16 chicks per replication. The dietary treatments included a negative control diet (NC) with no supplemental Zn, a positive control (PC) with 100 mg/kg supplemental Zn from an ionic bound source combination (50 mg/kg ZnO + 50 mg/kg ZnSO<sub>4</sub>), and the NC diet supplemented with one of 20, 40, 60, 80, or 100 mg/kg Zn as ZH. The diets were fed over starter (1-14 d) and grower (14-35 d) phases, with tissue and digesta samples collected from 3 birds per replicate on days 14 and 35. The results showed that dietary Zn level had a significant effect on tibia breaking strength on d 35 (P < 0.05), and tibia Zn concentration both on d 14 and d 35 (P < 0.01). Dietary Zn levels linearly (P < 0.01) increased cecal lactic acid production, increased Lactobacillus, and decreased Bacillus and total bacteria counts (P < 0.05). Inclusion of 80 and 100 mg/kg Zn as ZH tended to upregulate the expression of claudin-1 (P = 0.088) and tight junction protein-1 (P = 0.086). The results obtained in this study suggest that a non-Zn supplemented diet can negatively influence tibia development and gut microbiota composition in broiler chickens. Higher supplemental Zn in the diet alters cecal microbiota population in favor of Lactobacillus and can decrease the total bacterial load. Supplemental Zn level in the feed have the potential to manipulate the jejunal gut integrity at a molecular level.

Also flagged:andrographolidenon-alcoholic steatohepatitisNASHtransaminaseTNFMAPK8
Journal Article 2021-05-13 No Snippets Li L, Li SH, Jiang JP, Liu C, Ji LL.
Show Full Abstract

<h4>Objective</h4>To investigate the mechanisms of andrographolide against non-alcoholic steatohepatitis (NASH) based on network pharmacology, so as to provide a reference for further study of andrographolide in the treatment of NASH and other metabolic diseases.<h4>Methods</h4>The methionine- and choline-deficient (MCD) diet-induced NASH mice were treated by administration of andrographolide, and serum transaminase and pathological changes were analyzed. The network pharmacology-based bioinformatic strategy was then used to search the potential targets, construct protein-protein interaction (PPI) network, analyze gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment, and conduct molecular docking to explore the molecular mechanisms.<h4>Results</h4>The predicted core targets TNF, MAPK8, IL6, IL1B and AKT1 were enriched in non-alcoholic fatty liver disease (NAFLD) signaling pathway and against NASH by regulation of <i>de novo</i> fatty acids synthesis, anti-inflammation and anti-oxidation.<h4>Conclusion</h4>This work provides a scientific basis for further demonstration of the anti-NASH mechanisms of andrographolide.

Research Square 2021-05-13 Preprint (No Snippets API) Fakhroo AD, Nasarallah GK, Khan T, Cyprian FS, Ali FA, Ata MM, Taleb S, Hssain AA, Eid AH, Abu-Raddad LJ, Al-Khal A, Thani AAA, Marr N, Yassine HM.
Show Full Abstract

<h4>Background: </h4> The heterogeneity of COVID-19 lies within its diverse symptoms and severity, ranging from mild to lethal. Acute respiratory distress syndrome (ARDS) has been shown to be the leading cause of mortality in COVID-19 patients, characterized by a hyper cytokine storm. Autoimmunity is proposed to occur as a result of COVID-19, given the high similarity of the immune responses observed in COVID-19 and autoimmune diseases. Results Here, we investigate the level of autoimmune antibodies in COVID-19 patients with different severities. Initial screening for antinuclear antibodies (ANA) IgG revealed that 1.6% (2/126) and 4% (5/126) of ICU COVID-19 cases developed strong and moderate ANA levels, respectively. However, all the non-ICU cases (n = 273) were ANA negative. The high ANA level was confirmed by immunofluorescence (IFA) and large-scale autoantibody screening by phage immunoprecipitation-sequencing (PhIP-Seq). Indeed, the majority of the samples showed "speckled" ANA pattern by microscopy, and we demonstrate that samples of ICU patients with strong and moderate ANA levels contain autoantibody specificities that predominantly targeted proteins involved in intracellular signal transduction, metabolism, apoptotic processes, and cell death; further denoting reactivity to nuclear and cytoplasmic antigens. Conclusion Our results further support the notion of routine screening for autoimmune responses in COVID-19 patients, which might help improve disease prognosis and patient management. Further, results provide compelling evidence that ANA-positive individuals should be excluded from being donors for convalescent plasma therapy in the context of Covid-19.

Also flagged:systemic lupus erythematosuscardiometabolic disordersSLEatrial fibrillationischemic strokecoronary artery disease
Journal Article 2021-05-12 ✓ 1 Snippet Kawai VK, Shi M, Liu G, Feng Q, Wei W, Chung CP, Walunas TL, Gordon AS, Linneman JG, Hebbring SJ, Harley JB, Cox NJ, Roden DM, Stein CM, Mosley JD.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Objectives</h4>To test the hypothesis that genetic predisposition to systemic lupus erythematosus (SLE) increases the risk of cardiometabolic disorders.<h4>Methods</h4>Using 41 single nucleotide polymorphisms (SNPs) associated with SLE, we calculated a weighted genetic risk score (wGRS) for SLE. In a large biobank we tested the association between this wGRS and 9 cardiometabolic phenotypes previously associated with SLE: atrial fibrillation, ischemic stroke, coronary artery disease, type 1 and type 2 diabetes, obesity, chronic kidney disease, hypertension, and hypercholesterolemia. Additionally, we performed a phenome-wide association analysis (pheWAS) to discover novel clinical associations with a genetic predisposition to SLE. Findings were replicated in the Electronic Medical Records and Genomics (eMERGE) Network. To further define the association between SLE-related risk alleles and the selected cardiometabolic phenotypes, we performed an inverse variance weighted regression (IVWR) meta-analysis.<h4>Results</h4>The wGRS for SLE was calculated in 74,759 individuals of European ancestry. Among the pre-selected phenotypes, the wGRS was significantly associated with type 1 diabetes (OR [95%CI] =1.11 [1.06, 1.17], P-value = 1.05x10<sup>-5</sup>). In the PheWAS, the wGRS was associated with several autoimmune phenotypes, kidney disorders, and skin neoplasm; but only the associations with autoimmune phenotypes were replicated. In the IVWR meta-analysis, SLE-related risk alleles were nominally associated with type 1 diabetes (P = 0.048) but the associations were heterogeneous and did not meet the adjusted significance threshold.<h4>Conclusion</h4>A weighted GRS for SLE was associated with an increased risk of several autoimmune-related phenotypes including type I diabetes but not with cardiometabolic disorders.

Also flagged:CUL3cullin 3degradationBECN1beclin 1autophagy
Journal Article 2021-05-12 ✓ 1 Snippet Li X, Yang KB, Chen W, Mai J, Wu XQ, Sun T, Wu RY, Jiao L, Li DD, Ji J, Zhang HL, Yu Y, Chen YH, Feng GK, Deng R, Li JD, Zhu XF.
In-Text Gene Mentions

KLHL20

Show Full Abstract

Macroautophagy/autophagy plays an important role during the development of human cancer. BECN1 (beclin 1), a core player in autophagy regulation, is downregulated in many kinds of malignancy. The underlying mechanism, however, has not been fully illuminated. Here, we found that CUL3 (cullin 3), an E3 ubiquitin ligase, could interact with BECN1 and promote the K48-linked ubiquitination and degradation of this protein; In addition, CUL3 led to a decrease in autophagic activity through downregulating BECN1. We also found that KLHL38 was a substrate adaptor of the CUL3 E3 ligase complex-mediated ubiquitination and degradation of BECN1. In breast and ovarian cancer, CUL3 could promote the proliferation of tumor cells, and the expression of CUL3 was related to poor prognosis in patients. Our study reveals the underlying mechanism of BECN1 ubiquitination and degradation that affects autophagic activity and subsequently leads to tumor progression, providing a novel therapeutic strategy that regulates autophagy to combat cancer.<b>Abbreviations</b>: ATG: autophagy-related BECN1: beclin 1 CHX: cycloheximide CoIP: co-immunoprecipitation CUL3: cullin 3 IP: immunoprecipitation MS: mass spectrometry PtdIns3K: phosphatidylinositol 3-kinase UPS: ubiquitin-proteasome system.

Also flagged:Sykmethylationtumorcancersdecitabinewound healing
Journal Article 2021-05-12 ✓ 3 Snippets Bu F, Zhu X, Liu S, Lin K, Zhu J, Huang J.
In-Text Gene Mentions

…2G ), andTNFSF4(Figure 2H ).…

…CXCL12, ENTPD1, andTNFSF4.…

…34 The solubleTNFSF4in the blood…

Show Full Abstract

<h4>Background</h4>Metastasis of colorectal cancer (CRC) extremely affects the prognosis of CRC patients. Recently, the genetic methylation has been shown to associate with tumor metastasis. This research aimed to explore the Syk gene, which is frequently hypermethylated in different cancers, and its impact on the metastasis of CRC cells.<h4>Methods</h4>We employed the UALCAN database for the detection of the methylation levels of Syk in different cancers. CIBERSORT, TIMER and TISIDB tools were employed to analyze the association of Syk expression with immune features of CRC. Treatment with decitabine has been noted to restore the expression of Syk in CRC cells. The invasion and migration abilities of CRC cell lines were determined using transwell and wound healing assays. The correlation between Syk and c-Myc was established using the GEPIA2 database and Western blot assays. ​Results: Our results, based on UALCAN, revealed that the methylation level of Syk was altered in diverse cancers including colon adenocarcinoma. We found that expression profile and methylation level of Syk was correlated with immune features of colon adenocarcinoma. Decitabine can restore the expression of Syk in HCT116 and SW480 cells, hence affecting their migration and invasion. Results from GEPIA2 showed that Syk expression was correlated with c-Myc, while Western blotting analysis revealed a negative association between the expression level of Syk and c-Myc. ​Conclusions:​ ​This study demonstrates that the expression of Syk could be restored by decitabine in colorectal cancer, thus affecting the migration and invasion abilities of CRC cells.

Also flagged:FerroptosispathogenesisGene ExpressionLUADlung adenocarcinomalung adenocarcinomas
Journal Article 2021-05-12 ✓ 3 Snippets Zhu G, Huang H, Xu S, Shi R, Gao Z, Lei X, Zhu S, Zhou N, Zu L, Mello RA, Chen J, Xu S.
In-Text Gene Mentions

…that FANCD2 andPEBP1were the hub…

…, ACSL3 ,PEBP1, PGD ).…

…( ACSL3 ,PEBP1), (anti) oxidant…

Show Full Abstract

<h4>Background</h4>The prevalence of lung adenocarcinomas (LUADs) has dramatically increased in recent decades. Ferroptosis is a process of iron-dependent regulatory cell death. It is still unclear whether the expression of ferroptosis-related genes (FRGs) is involved in the pathogenesis and survival of patients with LUAD.<h4>Methods</h4>We retrieved LUAD data from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases and used LASSO Cox regression analysis to select the gene signature suitable for modeling. The risk score was calculated according to the model, and the patients were divided into high- and low-risk groups according to the median risk score. Functional enrichment analysis was carried out by this group, and a model for predicting clinical prognosis was established by combining this group with clinical factors.<h4>Results</h4>Gene set enrichment analysis (GSEA) and single-sample gene set enrichment analysis (ssGSEA) analysis showed that there were several immune-related pathways and immune infiltration differences between high- and low-risk groups. A prognostic model integrating 10 ferroptosis-related genes (FR-DEGs), and clinical factors were constructed and validated in an external cohort.<h4>Conclusions</h4>The FR-DEGs signature was related to immune infiltration, and a model based on FR-DEGs and clinical factors was established to predict the prognosis of patients with LUAD.

Also flagged:MMP12MMP13Mef2cRunx2igf1rhdac4
Journal Article 2021-05-12 ✓ 3 Snippets Simonds MM, Schlefman AR, McCahan SM, Sullivan KE, Rose CD, Brescia AMC.
In-Text Gene Mentions

Sox6

…(TGFBI, MMP9, COL1A1,SOX6, and MMP2) is…

…p = 0.042),SOX6( p =…

Show Full Abstract

<h4>Background</h4>We examined influences of conditioned media from chondrocytes (Ch) on juvenile idiopathic arthritis synovial fibroblasts (JFLS) and potential for JFLS to undergo endochondral bone formation (EBF).<h4>Methods</h4>Primary cells from three control fibroblast-like synoviocytes (CFLS) and three JFLS were cultured in Ch-conditioned media and compared with untreated fibroblast-like synoviocytes (FLS). RNA was analyzed by ClariomS microarray. FLS cells cultured in conditioned media were exposed to either TGFBR1 inhibitor LY3200882 or exogenous BMP4 and compared with FLS cultured in conditioned media from Ch (JFLS-Ch). Media supernatants were analyzed by ELISA.<h4>Results</h4>In culture, JFLS downregulate BMP2 and its receptor BMPR1a while upregulating BMP antagonists (NOG and CHRD) and express genes (MMP9, PCNA, MMP12) and proteins (COL2, COLX, COMP) associated with chondrocytes. Important TGFβ superfamily member gene expression (TGFBI, MMP9, COL1A1, SOX6, and MMP2) is downregulated when JFLS are cultured in Ch-conditioned media. COL2, COLX and COMP protein expression decreases in JFLS-Ch. BMP antagonist protein (NOG, CHRD, GREM, and FST) secretion is significantly increased in JFLS-Ch. Protein phosphorylation increases in JFLS-Ch exposed to exogenous BMP4, and chondrocyte-like phenotype is restored in BMP4 presence, evidenced by increased secretion of COL2 and COLX. Inhibition of TGFBR1 in JFLS-Ch results in overexpression of COL2.<h4>Conclusions</h4>JFLS are chondrocyte-like, and Ch-conditioned media can abrogate this phenotype. The addition of exogenous BMP4 causes JFLS-Ch to restore this chondrocyte-like phenotype, suggesting that JFLS create a microenvironment favorable for endochondral bone formation, thereby contributing to joint growth disturbances in juvenile idiopathic arthritis.

Also flagged:fibromyalgiaserotoninserotonin transporterFMSglutamatedepression
Journal Article 2021-05-12 ✓ 5 Snippets Ellerbrock I, Sandström A, Tour J, Fanton S, Kadetoff D, Schalling M, Jensen KB, Sitnikov R, Kosek E.
In-Text Gene Mentions

Some studies have investigated combined effects of 5-HT1A and 5-HTT genotypes, e.g. in major depression, mediating the influence of negative life events [65] and 5-HT1A */G and 5-HTTlow showing increased amygdala response to emotional stimuli [66], though results were not entirely consistent [67].

Here, we tested the effects of genetic variants of the 5‐HT1A receptor (CC/G-carriers) and 5-HTT (high/intermediate/low expression) on mood, pain sensitivity, cerebral processing of evoked pain (functional MRI) and concentrations of GABA and glutamate (MR spectroscopy) in rostral anterior cingulate cortex (rACC) and thalamus in FMS and healthy controls (HC).

…the serotonin transporter (5-HTT).…

…receptor (CC/G-carriers) and5-HTT(high/intermediate/low express…

…signalling (5-HT 1A CC/5-HTThigh genotypes) being…

Show Full Abstract

The neurotransmitter serotonin, involved in the regulation of pain and emotion, is critically regulated by the 5-HT<sub>1A</sub> autoreceptor and the serotonin transporter (5-HTT). Polymorphisms of these genes affect mood and endogenous pain modulation, both demonstrated to be altered in fibromyalgia subjects (FMS). Here, we tested the effects of genetic variants of the 5-HT<sub>1A</sub> receptor (CC/G-carriers) and 5-HTT (high/intermediate/low expression) on mood, pain sensitivity, cerebral processing of evoked pain (functional MRI) and concentrations of GABA and glutamate (MR spectroscopy) in rostral anterior cingulate cortex (rACC) and thalamus in FMS and healthy controls (HC). Interactions between serotonin-relevant genes were found in affective characteristics, with genetically inferred high serotonergic signalling (5-HT<sub>1A</sub> CC/5-HTT<sub>high</sub> genotypes) being more favourable across groups. Additionally, 5-HT<sub>1A</sub> CC homozygotes displayed higher pain thresholds than G-carriers in HC but not in FMS. Cerebral processing of evoked pressure pain differed between groups in thalamus with HC showing more deactivation than FMS, but was not influenced by serotonin-relevant genotypes. In thalamus, we observed a 5-HT<sub>1A</sub>-by-5-HTT and group-by-5-HTT interaction in GABA concentrations, with the 5-HTT high expressing genotype differing between groups and 5-HT<sub>1A</sub> genotypes. No significant effects were seen for glutamate or in rACC. To our knowledge, this is the first report of this serotonergic gene-to-gene interaction associated with mood, both among FMS (depression) and across groups (anxiety). Additionally, our findings provide evidence of an association between the serotonergic system and thalamic GABA concentrations, with individuals possessing genetically inferred high serotonergic signalling exhibiting the highest GABA concentrations, possibly enhancing GABAergic inhibitory effects via 5-HT.

Also flagged:inflammatory bowel diseaseinflammatory bowel diseasesCrohn's diseaseimmune responsepathogenesismethylation
Journal Article 2021-05-12 No Snippets Hornschuh M, Wirthgen E, Wolfien M, Singh KP, Wolkenhauer O, Däbritz J.
Show Full Abstract

Epigenetics has become a promising field for finding new biomarkers and improving diagnosis, prognosis, and drug response in inflammatory bowel disease. The number of people suffering from inflammatory bowel diseases, especially Crohn's disease, has increased remarkably. Crohn's disease is assumed to be the result of a complex interplay between genetic susceptibility, environmental factors, and altered intestinal microbiota, leading to dysregulation of the innate and adaptive immune response. While many genetic variants have been identified to be associated with Crohn's disease, less is known about the influence of epigenetics in the pathogenesis of this disease. In this review, we provide an overview of current epigenetic studies in Crohn's disease. In particular, we enable a deeper insight into applied bioanalytical and computational tools, as well as a comprehensive update toward the cell-specific evaluation of DNA methylation and histone modifications.

Also flagged:brain tumorsnucleotidesgene expressioncancerscancerbrain tumor
Journal Article 2021-05-12 ✓ 2 Snippets Kim SH, Lim KH, Yang S, Joo JY.
In-Text Gene Mentions

The ZNFX1 antisense RNA 1 (ZFAS1) lncRNA located on chromosome 20q13 is another lncRNA involved in progression and metastasis of various cancers [93].

ZNFX1antisense RNA 1…

Show Full Abstract

Brain tumors are associated with adverse outcomes despite improvements in radiation therapy, chemotherapy, and photodynamic therapy. However, treatment approaches are evolving, and new biological phenomena are being explored to identify the appropriate treatment of brain tumors. Long non-coding RNAs (lncRNAs), a type of non-coding RNA longer than 200 nucleotides, regulate gene expression at the transcriptional, post-transcriptional, and epigenetic levels and are involved in a variety of biological functions. Recent studies on lncRNAs have revealed their aberrant expression in various cancers, with distinct expression patterns associated with their instrumental roles in cancer. Abnormal expression of lncRNAs has also been identified in brain tumors. Here, we review the potential roles of lncRNAs and their biological functions in the context of brain tumors. We also summarize the current understanding of the molecular mechanisms and signaling pathways related to lncRNAs that may guide clinical trials for brain tumor therapy.

Also flagged:ferroptosisdeathironlipidoxygennervous system diseases
Journal Article 2021-05-12 No Snippets Xie B, Guo Y.
Show Full Abstract

Ferroptosis is a newly identified form of nonapoptotic regulated cell death characterized by iron-dependent accumulation of lipid reactive oxygen species. Morphologically and biochemically different from known types of cell death and apoptosis, ferroptosis promotes nervous system diseases, renal failure, ischemia-reperfusion injury, and the treatment of tumors. It could be induced by several mechanisms, including inhibition of glutathione peroxidase 4, lack of cysteine, and peroxidation of polyunsaturated fatty acids, but could be inhibited by iron chelators, lipophilic antioxidants, and some specific inhibitors. Ferroptosis is found to be closely related to the tumorigenesis, invasion, and metastasis of tumors. Noncoding RNAs (ncRNAs), including long noncoding RNAs (lncRNAs), microRNAs, and circular RNAs, do not encode proteins. NcRNAs are found to be capable of regulating the molecular mechanism of ferroptosis in tumor cells post transcription. Ferroptosis provides a new method for cancer treatment. Although several studies have confirmed the important role of ferroptosis in cancer treatment, its specific affecting mechanism is unclear. Here we reviewed the molecular mechanism of ferroptosis in tumor cells and the relationship between ferroptosis and the three important ncRNAs.

Also flagged:actingelatineTOBHPOJUPPRL
Journal Article 2021-05-12 No Snippets Phan HTT, Furuki E, Hunziker L, Rybak K, Tan KC.
Show Full Abstract

The fungus Parastagonospora nodorum is the causal agent of septoria nodorum leaf blotch (SNB) and glume blotch which are common in many wheat growing regions in the world. The disease is complex and could be explained by multiple interactions between necrotrophic effectors secreted by the pathogen and matching susceptibility genes in wheat. An Australian P. nodorum population was clustered into five groups with contrasting properties. This study was set to identify their pathogenicity profiles using a diverse wheat panel of 134 accessions which are insensitive to SnToxA and SnTox1 in both in vitro and in vivo conditions. SNB seedling resistance/susceptibility to five representative isolates from the five clusters, responses to crude culture-filtrates (CFs) of three isolates and sensitivity to SnTox3 semi-purified effector together with 11,455 SNP markers have been used for linkage disequilibrium (LD) and association analyses. While quantitative trait loci (QTL) on 1D, 2A, 2B, 4B, 5B, 6A, 6B, 7A, 7D chromosomes were consistently detected across isolates and conditions, distinct patterns and isolate specific QTL were also observed among these isolates. In this study, SnTox3-Snn3-B1 interaction for the first time in Australia and SnTox3-Snn3-D1 interaction for the first time in bread wheat were found active using wild-type isolates. These findings could be due to new SnTox3 haplotype/isoform and exotic CIMMYT/ICARDA and Vavilov germplasm used, respectively. This study could provide useful information for dissecting novel and different SNB disease components, helping to prioritise research targets and contributing valuable information on genetic loci/markers for marker-assisted selection in SNB resistance wheat breeding programme.

Also flagged:oncogenesiscancerFHITprostate cancerdefectscancers
Journal Article 2021-05-12 No Snippets Simpson BS, Pye H, Whitaker HC.
Show Full Abstract

Recent developments in sequencing the cancer genome have provided the first in-depth mapping of structural variants (SV) across 38 tumour types. Sixteen signatures of structural variants have been proposed which broadly characterise the variation seen across cancer types. One signature shows increased duplications and deletions at fragile sites, with little association with the typical DNA repair defects. We discuss how, for many of these fragile sites, the clinical impacts are yet to be explored. One example is NAALADL2, one of the most frequently altered fragile sites in the cancer genome. The copy-number variations (CNVs) which occur at fragile sites, such as NAALADL2, may span many genes without typical DNA repair defects and could have a large impact on cell signalling.

Also flagged:ironmyoglobinmenstruationexcretionoverloadhereditary hemochromatosis
Journal Article 2021-05-12 ✓ 1 Snippet Muehler MR, Vigen K, Hernando D, Zhu A, Colgan TJ, Reeder SB.
In-Text Gene Mentions

…iron overload includedhemochromatosis( n =…

Show Full Abstract

<h4>Objectives</h4>To evaluate the reproducibility of liver R2* measurements between a 2D cardiac ECG-gated and a 3D breath-hold liver CSE-MRI acquisition for liver iron quantification.<h4>Methods</h4>A total of 54 1.5 T MRI exams from 51 subjects (18 women, 36 men, age 35.2 ± 21.8) were included. These included two sub-studies with 23 clinical MRI exams from 19 patients identified retrospectively, 24 participants with known or suspected iron overload, and 7 healthy volunteers acquired prospectively. The 2D cardiac and the 3D liver R2* maps were acquired in the same exam. Either acquisitions were reconstructed using a complex R2* algorithm that accounts for the presence of fat and residual phase errors due to eddy currents. Data were analyzed using colocalized ROIs in the liver.<h4>Results</h4>Linear regression analysis demonstrated high Pearson's correlation and Lin's concordance coefficient for the overall study and both sub-studies. Bland-Altman analysis also showed good agreement, except for a slight increase of the mean R2* value above ~ 400 s<sup>-1</sup>. The Kolmogorow-Smirnow test revealed a non-normal distribution for (R2* 3D-R2* 2D) values from 0 to 600 s<sup>-1</sup> in contrast to the 0-200 s<sup>-1</sup> and 0-400 s<sup>-1</sup> subpopulations. Linear regression analysis showed no relevant differences other than the intercept, likely due to only 7 measurements above 400 s<sup>-1</sup>.<h4>Conclusions</h4>The results demonstrate that R2*-measurements in the liver are feasible using 2D cardiac R2* maps compared to 3D liver R2* maps as the reference. Liver R2* may be underestimated for R2* > 400 s<sup>-1</sup> using the 2D cardiac R2* mapping method.

Also flagged:cirrhosisliver diseasesLiver Injurychronic hepatitismetabolismalcoholic hepatitis
Journal Article 2021-05-12 ✓ 1 Snippet Liu L, Yang F.
In-Text Gene Mentions

activator of transcription 1

Show Full Abstract

Acute and chronic hepatitis, cirrhosis, and other liver diseases pose a serious threat to human health; however, liver transplantation is the only reliable treatment for the terminal stage of liver diseases. Previous researchers have shown that mesenchymal stem cells (MSCs) are characterized by differentiation and paracrine effects, as well as anti-oxidative stress and immune regulation functions. When MSCs are transplanted into animals, they migrate to the injured liver tissue along with the circulation, to protect the liver and alleviate the injury through the paracrine, immune regulation and other characteristics, making mesenchymal stem cell transplantation a promising alternative therapy for liver diseases. Although the efficacy of MSCs transplantation has been confirmed in various animal models of liver injury, many researchers have also proposed various pretreatment methods to improve the efficacy of mesenchymal stem cell transplantation, but there is still lack a set of scientific methods system aimed at improving the efficacy of transplantation therapy in scientific research and clinical practice. In this review, we summarize the possible mechanisms of MSCs therapy and compare the existing methods of MSCs modification corresponding to the treatment mechanism, hoping to provide as a reference to help future researchers explore a safe and simple transplantation strategy.

Also flagged:Phospholipase activityEndothelial LipaseANGPTL3HEKhepariniron
Journal Article 2021-05-12 ✓ 5 Snippets Mohammad G, Matakidou A, Robbins PA, Lakhal-Littleton S.
In-Text Gene Mentions

…but not inhemochromatosismice harboring a…

…iron overload inhemochromatosis

…intact) than inhemochromatosismice (in which…

…Although bothhemochromatosisand dietary iron…

…remained unaltered inhemochromatosismice ( Supplementary…

Show Full Abstract

The hepcidin/ferroportin axis controls systemic iron homeostasis by regulating iron acquisition from the duodenum and reticuloendothelial system, respective sites of iron absorption and recycling. Ferroportin is also abundant in the kidney, where it has been implicated in tubular iron reabsorption. However, it remains unknown whether endogenous hepcidin regulates ferroportin-mediated iron reabsorption under physiological conditions, and whether such regulation is important for kidney and/or systemic iron homeostasis. To address these questions, we generated a novel mouse model with an inducible kidney-tubule specific knock-in of fpnC326Y, which encodes a hepcidin-resistant ferroportin termed FPNC326Y. Under conditions of normal iron availability, female mice harboring this allele had consistently decreased kidney iron but only transiently increased systemic iron indices. Under conditions of excess iron availability, male and female mice harboring this allele had milder kidney iron overload, but greater systemic iron overload relative to controls. Additionally, despite comparable systemic iron overload, kidney iron overload occurred in wild type mice fed an iron-loaded diet but not in hemochromatosis mice harboring a ubiquitous knock-in of fpnC326Y. Thus, our study demonstrates that endogenous hepcidin controls ferroportin-mediated tubular iron reabsorption under physiological conditions. It also shows that such control is important for both kidney and systemic iron homeostasis in the context of iron overload.

Also flagged:hematological malignanciesethanolInsulinCollagenase IIextracellularcollagen
Journal Article 2021-05-12 No Snippets Gleitz HFE, Snoeren IAM, Fuchs SNR, Leimkühler NB, Schneider RK.
Show Full Abstract

Bone marrow (BM) mesenchymal stromal cells play an important role in regulating stem cell quiescence and homeostasis; they are also key contributors to various hematological malignancies. However, human bone marrow stromal cells are difficult to isolate and prone to damage during isolation. This protocol describes a combination of mechanical and enzymatic isolation of BM stromal cells from human BM biopsies, followed by FACS sorting to separate stromal sub-populations including mesenchymal stromal cells, fibroblasts, and Schwann cells for single-cell RNA sequencing. For complete details on the use and execution of this protocol, please refer to Leimkühler et al. (2020).

Also flagged:CGGneurological disordersneurodegenerative diseasesmetabolismRNA binding proteinsFXTAS
Journal Article 2021-05-12 ✓ 1 Snippet Xu K, Li Y, Allen EG, Jin P.
In-Text Gene Mentions

Similarly, in Huntington’s disease, which is caused by a CAG repeat expansion in the huntingtin gene (HTT), AMT-130, an AAV-delivered miRNA that targets Htt has been applied to reduce HTT levels successfully, leading to an improvement of neuropathology.

Show Full Abstract

Non-coding repeat expansions, such as CGG, GGC, CUG, CCUG, and GGGGCC, have been shown to be involved in many human diseases, particularly neurological disorders. Of the diverse pathogenic mechanisms proposed in these neurodegenerative diseases, dysregulated RNA metabolism has emerged as an important contributor. Expanded repeat RNAs that form particular structures aggregate to form RNA foci, sequestering various RNA binding proteins and consequently altering RNA splicing, transport, and other downstream biological processes. One of these repeat expansion-associated diseases, fragile X-associated tremor/ataxia syndrome (FXTAS), is caused by a CGG repeat expansion in the 5'UTR region of the fragile X mental retardation 1 (<i>FMR1</i>) gene. Moreover, recent studies have revealed abnormal GGC repeat expansion within the 5'UTR region of the <i>NOTCH2NLC</i> gene in both essential tremor (ET) and neuronal intranuclear inclusion disease (NIID). These CGG repeat expansion-associated diseases share genetic, pathological, and clinical features. Identification of the similarities at the molecular level could lead to a better understanding of the disease mechanisms as well as developing novel therapeutic strategies. Here, we highlight our current understanding of the molecular pathogenesis of CGG repeat expansion-associated diseases and discuss potential therapeutic interventions for these neurological disorders.

Also flagged:Small GTPasesRhoRho GTPasesRhoARac1Cdc42
Journal Article 2021-05-12 No Snippets Guiler W, Koehler A, Boykin C, Lu Q.
Show Full Abstract

Classical Rho GTPases, including RhoA, Rac1, and Cdc42, are members of the Ras small GTPase superfamily and play essential roles in a variety of cellular functions. Rho GTPase signaling can be turned on and off by specific GEFs and GAPs, respectively. These features empower Rho GTPases and their upstream and downstream modulators as targets for scientific research and therapeutic intervention. Specifically, significant therapeutic potential exists for targeting Rho GTPases in neurodegenerative diseases due to their widespread cellular activity and alterations in neural tissues. This study will explore the roles of Rho GTPases in neurodegenerative diseases with focus on the applications of pharmacological modulators in recent discoveries. There have been exciting developments of small molecules, nonsteroidal anti-inflammatory drugs (NSAIDs), and natural products and toxins for each classical Rho GTPase category. A brief overview of each category followed by examples in their applications will be provided. The literature on their roles in various diseases [e.g., Alzheimer's disease (AD), Parkinson's disease (PD), Amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), and Multiple sclerosis (MS)] highlights the unique and broad implications targeting Rho GTPases for potential therapeutic intervention. Clearly, there is increasing knowledge of therapeutic promise from the discovery of pharmacological modulators of Rho GTPases for managing and treating these conditions. The progress is also accompanied by the recognition of complex Rho GTPase modulation where targeting its signaling can improve some aspects of pathogenesis while exacerbating others in the same disease model. Future directions should emphasize the importance of elucidating how different Rho GTPases work in concert and how they produce such widespread yet different cellular responses during neurodegenerative disease progression.

Also flagged:BDNFBrain-derived neurotrophic factorneurotrophininfertilityinfertilefertilization
Journal Article 2021-05-12 ✓ 1 Snippet Zhang Q, Su J, Kong W, Fang Z, Li Y, Huang Z, Wen J, Wang Y.
In-Text Gene Mentions

…miR-10a-5p, such ashtt, pten, arnt, rora…

Show Full Abstract

Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays critical roles in the physiological process of oocyte mature and IVF outcomes of patients with infertility. However, the regulation of BDNF expression in the microenvironment surrounding the oocyte is still unknown. We initially predicted some microRNA (miRNA) candidates targeting <i>bdnf</i> with a series of bioinformatics analysis tools to determine the underlying regulatory mechanisms of BDNF, particularly the effect of miRNAs on BDNF expression. Then, we assessed whether the expression of these 14 selected miRNAs was negatively associated with BDNF expression in follicular fluid (FF) samples obtained from mature (>18 mm) or immature (<15 mm) follicles. Finally, we used the candidate miRNAs, miR-103a-3p and miR-10a-5p, to further investigate the relationship between their expression in FF and the outcomes of infertile patients undergoing IVF-ET treatment. The results of the bioinformatics analysis revealed 14 miRNAs that might directly regulate BDNF expression and might have a close relationship with oocyte development. BDNF was expressed at significantly lower levels in FF from immature follicles than in FF from mature follicles, and only the expression of miR-103a-3p and miR-10a-5p was negatively correlated with BDNF expression in FF. Moreover, in another cohort of 106 infertile women undergoing IVF-ET treatment, miR-103a-3p or miR-10a-5p expression predicted the developmental status of the corresponding oocytes in which high expression of miR-103a-3p or miR-10a-5p resulted in a poor quality of embryo on days 3 and 5 during the IVF-ET treatment. In conclusion, our study is the first to show that miR-103a-3p or miR-10a-5p negatively affects the maturation of oocytes by regulating the expression of BDNF in human FF. Additionally, the expression levels of miR-103a-3p or miR-10a-5p in FF may predict the outcomes of IVF, which are helpful for improving embryo selection and consequently the IVF success rate in the clinic.

Also flagged:CD40Antibodyhemoproteinshemolytic disordershemeiron
Journal Article 2021-05-12 ✓ 1 Snippet Pfefferlé M, Ingoglia G, Schaer CA, Hansen K, Schulthess N, Humar R, Schaer DJ, Vallelian F.
In-Text Gene Mentions

…iron overload (i.e.,hemochromatosis) ( 48 –…

Show Full Abstract

Clearance of red blood cells and hemoproteins is a key metabolic function of macrophages during hemolytic disorders and following tissue injury. Through this archetypical phagocytic function, heme is detoxified and iron is recycled to support erythropoiesis. Reciprocal interaction of heme metabolism and inflammatory macrophage functions may modify disease outcomes in a broad range of clinical conditions. We hypothesized that acute hemolysis and heme induce acute anti-inflammatory signals in liver macrophages. Using a macrophage-driven model of sterile liver inflammation, we showed that phenylhydrazine (PHZ)-mediated acute erythrophagocytosis blocked the anti-CD40 antibody-induced pathway of macrophage activation. This process attenuated the inflammatory cytokine release syndrome and necrotizing hepatitis induced by anti-CD40 antibody treatment of mice. We further established that administration of heme-albumin complexes specifically delivered heme to liver macrophages and replicated the anti-inflammatory effect of hemolysis. The anti-inflammatory heme-signal was induced in macrophages by an increased intracellular concentration of the porphyrin independently of iron. Overall, our work suggests that induction of heme-signaling strongly suppresses inflammatory macrophage function, providing protection against sterile liver inflammation.

Also flagged:CBFA2T3DiamondPDXDC1SCAND3TSPAN3HDAC4
Journal Article 2021-05-12 No Snippets Young JI, Slifer S, Hecht JT, Blanton SH.
Show Full Abstract

Non-syndromic cleft lip with or without cleft palate (NSCLP) is the most common craniofacial birth defect. The etiology of NSCLP is complex with multiple genes and environmental factors playing causal roles. Although studies have identified numerous genetic markers associated with NSCLP, the role of epigenetic variation remains relatively unexplored. Because of their identical DNA sequences, monozygotic (MZ) twins discordant for NSCLP are an ideal model for examining the potential contribution of DNA methylation to non-syndromic orofacial clefting. In this study, we compared the patterns of whole genome DNA methylation in six MZ twin pairs discordant for NSCLP. Differentially methylated positions (DMPs) and regions (DMRs) were identified in NSCLP candidate genes, including differential methylation in <i>MAFB</i> and <i>ZEB2</i> in two independent MZ twin pairs. In addition to DNA methylation differences in NSCLP candidate genes, we found common differential methylation in genes belonging to the Hippo signaling pathway, implicating this mechanosensory pathway in the etiology of NSCLP. The results of this novel approach using MZ twins discordant for NSCLP suggests that differential methylation is one mechanism contributing to NSCLP, meriting future studies on the role of DNA methylation in familial and sporadic NSCLP.

Also flagged:HuntingtinHpoligopeptidescytoplasmglutamate decarboxylaseciliary beating
Journal Article 2021-05-12 ✓ 5 Snippets Katow H, Katow T, Yoshida H, Kiyomoto M.
In-Text Gene Mentions

To examine potential artificial fragmentation of Hp-Htt at and after the 2aPL, the other sea urchin protein Hp-Tjp1 (Tight junction protein 1) that is composed of 1402 amino acids and attains 154.4 kDa (HpBase: http://cell-innovation.nig.ac.jp/cgi-bin/Hpul_public/Hpul_annot_search_output.cgi) (Access on: 3 March 2021) and connects between embryonic ectodermal cells [17,18,19] was examined as a control for loading and lysate degradation.

Huntington’s disease (HD) is a major neurodegenerative disorder in humans, involving involuntary body movements and dementia in the later stages, which is caused by the mutation of a gene, huntingtin (HTT).

In the mutant Htt, the N-terminal region that contains cytosine-adenine-guanine (CAG) repeats expand extensively and subjected to be numerous neuropathological studies, including its molecular mechanisms [1].

The epitope of anti-Huntingtin Ab of Sp-Htt was NH2-C+274TSPATSPQEGEGS287-COOH in the amino acid sequence (SPU_012067.1) registered in EchinoBase (http://legacy.echinobase.org/Echinobase/AboutEB) (Access on: 3 March 2021), and was chosen based on GenScript’s Optimum Antigen design tool (https://www.genscript.com/antigen-design.html) (Access on: 3 March 2021) analysis.

…examined using the anti-Hp-Httantibody (Ab) raised…

Show Full Abstract

The multiple functions of the wild type Huntington's disease protein of the sea urchin <i>Hemicentrotus pulcherrimus</i> (Hp-Htt) have been examined using the anti-Hp-Htt antibody (Ab) raised against synthetic oligopeptides. According to immunoblotting, Hp-Htt was detected as a single band at around the 350 kDa region at the swimming blastula stage to the prism larva stage. From the 2-arm pluteus stage (2aPL), however, an additional smaller band at the 165 kDa region appeared. Immunohistochemically, Hp-Htt was detected in the nuclei and the nearby cytoplasm of the ectodermal cells from the swimming blastula stage, and the blastocoelar cells from the mid-gastrula stage. The Ab-positive signal was converged to the ciliary band-associated strand (CBAS). There, it was accompanied by several CBAS-marker proteins in the cytoplasm, such as glutamate decarboxylase. Application of <i>Hp-Htt morpholino</i> (<i>Hp-Htt-MO</i>) has resulted in shortened larval arms, accompanied by decreased 5-bromo-2-deoxyuridin (BrdU) incorporation by the ectodermal cells of the larval arms. <i>Hp-Htt-MO</i> also resulted in lowered ciliary beating activity, accompanied by a disordered swirling pattern formation around the body. These <i>Hp-Htt-MO</i>-induced deficiencies took place after the onset of CBAS system formation at the larval arms. Thus, Hp-Htt is involved in cell proliferation and the ciliary beating pattern regulation signaling system in pluteus larvae.

Also flagged:PeptidesPeptideGroup A StreptococcusGAS) infectionmembraneslipopeptide
Journal Article 2021-05-12 No Snippets Yang J, Firdaus F, Azuar A, Khalil ZG, Marasini N, Capon RJ, Hussein WM, Toth I, Skwarczynski M.
Show Full Abstract

Peptide-based vaccine development represents a highly promising strategy for preventing Group A Streptococcus (GAS) infection. However, these vaccines need to be administered with the help of a delivery system and/or immune adjuvant. Cell-penetrating peptides (CPPs) have been used as a powerful tool for delivering various therapeutic agents, including peptides, as they can overcome the permeability barrier of cell membranes. Here, we used CPPs to deliver our lead lipopeptide-based vaccine (LCP-1). CPPs were anchored through a spacer to LCP-1-bearing multilamellar and unilamellar liposomes and administered to Swiss outbred mice. Tat<sub>47-57</sub> conjugated to two palmitic acids via a (Gly)<sub>6</sub> spacer (to form a liposome-anchoring moiety) was the most efficient system for triggering immune responses when combined with multilamellar liposomes bearing LCP-1. The immunostimulatory potential of a variety of other CPPs was examined following intranasal administration in mice. Among them, LCP-1/liposomes/Tat<sub>47-57</sub> and LCP-1/liposomes/KALA induced the highest antibody titers. The antibodies produced showed high opsonic activity against clinically isolated GAS strains D3840 and GC2 203. The use of the CPP-liposome delivery system is a promising strategy for liposome-based GAS vaccine development.

Also flagged:coronavirus diseaseCOVID-19proteaseMprodaclatasvirteniposide
Journal Article 2021-05-12 No Snippets Tam NM, Pham MQ, Ha NX, Nam PC, Phung HTT.
Show Full Abstract

The coronavirus disease (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has rapidly spread worldwide recently, leading to global social and economic disruption. Although the emergently approved vaccine programs against SARS-CoV-2 have been rolled out globally, the number of COVID-19 daily cases and deaths has remained significantly high. Here, we attempt to computationally screen for possible medications for COVID-19 <i>via</i> rapidly estimating the highly potential inhibitors from an FDA-approved drug database against the main protease (Mpro) of SARS-CoV-2. The approach combined molecular docking and fast pulling of ligand (FPL) simulations that were demonstrated to be accurate and suitable for quick prediction of SARS-CoV-2 Mpro inhibitors. The results suggested that twenty-seven compounds were capable of strongly associating with SARS-CoV-2 Mpro. Among them, the seven top leads are daclatasvir, teniposide, etoposide, levoleucovorin, naldemedine, cabozantinib, and irinotecan. The potential application of these drugs in COVID-19 therapy has thus been discussed.

Also flagged:Degradationligninferulatechromosomecatecholγ-carboxymuconolactone decarboxylase
Journal Article 2021-05-11 ✓ 1 Snippet Chakraborty J, Suzuki-Minakuchi C, Tomita T, Okada K, Nojiri H.
In-Text Gene Mentions

Pseudomonas resinovorans CA10

Show Full Abstract

A novel gene cluster involved in the degradation of lignin-derived monoaromatics such as <i>p</i>-hydroxybenzoate, vanillate, and ferulate has been identified in the thermophilic nitrate reducer <i>Thermus oshimai</i> JL-2. Based on conserved domain analyses and metabolic pathway mapping, the cluster was classified into upper- and peripheral-pathway operons. The upper-pathway genes, responsible for the degradation of <i>p</i>-hydroxybenzoate and vanillate, are located on a 0.27-Mb plasmid, whereas the peripheral-pathway genes, responsible for the transformation of ferulate, are spread throughout the plasmid and the chromosome. In addition, a lower-pathway operon was also identified in the plasmid that corresponds to the <i>meta-</i>cleavage pathway of catechol. Spectrophotometric and gene induction data suggest that the upper and lower operons are induced by <i>p</i>-hydroxybenzoate, which the strain can degrade completely within 4 days of incubation, whereas the peripheral genes are expressed constitutively. The upper degradation pathway follows a less common route, proceeding via the decarboxylation of protocatechuate to form catechol, and involves a novel thermostable γ-carboxymuconolactone decarboxylase homolog, identified as protocatechuate decarboxylase based on gene deletion experiments. This gene cluster is conserved in only a few members of the <i>Thermales</i> and shows traces of vertical expansion of catabolic pathways in these organisms toward lignoaromatics.<b>IMPORTANCE</b> High-temperature steam treatment of lignocellulosic biomass during the extraction of cellulose and hemicellulose fractions leads to the release of a wide array of lignin-derived aromatics into the natural ecosystem, some of which can have detrimental effects on the environment. Not only will identifying organisms capable of using such aromatics aid in environmental cleanup, but thermostable enzymes, if characterized, can also be used for efficient lignin valorization. However, no thermophilic lignin degraders have been reported thus far. The present study reports <i>T. oshimai</i> JL-2 as a thermophilic bacterium with the potential to use lignin-derived aromatics. The identification of a novel thermostable protocatechuate decarboxylase gene in the strain further adds to its significance, as such an enzyme can be efficiently used in the biosynthesis of <i>cis</i>,<i>cis</i>-muconate, an important intermediate in the commercial production of plastics.

Also flagged:KARSPS3derPM5Pgk1Tara
Journal Article 2021-05-11 ✓ 2 Snippets Cappuccio G, Ceccatelli Berti C, Baruffini E, Sullivan J, Shashi V, Jewett T, Stamper T, Maitz S, Canonico F, Revah-Politi A, Kupchik GS, Anyane-Yeboa K, Aggarwal V, Benneche A, Bratland E, Berland S, D'Arco F, Alves CA, Vanderver A, Longo D, Bertini E, Torella A, Nigro V, Telethon Undiagnosed Diseases Program, D'Amico A, van der Knaap MS, Goffrini P, Brunetti-Pierri N.
In-Text Gene Mentions

LysRS are involved in myelin formation and defects in other ARSes (e.g., AARS2, DARS2, EARS2, and LARS2) have been found to be responsible for leukodystrophy (van der Knaap et al., 2019).

…(e.g., AARS2 ,DARS2, EARS2 ,…

Show Full Abstract

KARS1 encodes a lysyl-transfer RNA synthetase (LysRS) that links lysine to its cognate transfer RNA. Two different KARS1 isoforms exert functional effects in cytosol and mitochondria. Bi-allelic pathogenic variants in KARS1 have been associated to sensorineural hearing and visual loss, neuropathy, seizures, and leukodystrophy. We report the clinical, biochemical, and neuroradiological features of nine individuals with KARS1-related disorder carrying 12 different variants with nine of them being novel. The consequences of these variants on the cytosol and/or mitochondrial LysRS were functionally validated in yeast mutants. Most cases presented with severe neurological features including congenital and progressive microcephaly, seizures, developmental delay/intellectual disability, and cerebral atrophy. Oculo-motor dysfunction and immuno-hematological problems were present in six and three cases, respectively. A yeast growth defect of variable severity was detected for most variants on both cytosolic and mitochondrial isoforms. The detrimental effects of two variants on yeast growth were partially rescued by lysine supplementation. Congenital progressive microcephaly, oculo-motor dysfunction, and immuno-hematological problems are emerging phenotypes in KARS1-related disorder. The data in yeast emphasize the role of both mitochondrial and cytosolic isoforms in the pathogenesis of KARS1-related disorder and supports the therapeutic potential of lysine supplementation at least in a subset of patients.

Also flagged:neuroticismcardiovascular diseasemajor depressive disorderinsomniaschizophreniaattention-deficit/hyperactivity disorder
Journal Article 2021-05-11 ✓ 2 Snippets Zhang F, Baranova A, Zhou C, Cao H, Chen J, Zhang X, Xu M.
In-Text Gene Mentions

We highlighted key genes contributing to the causal associations between neuroticism and MDD, including RBFOX1, RERE, SOX5, and TCF4, and those contributing to the causal associations between neuroticism and cardiovascular diseases, including MAD1L1, ARNTL, RERE, and SOX6.

…ARNTL, RERE, andSOX6.…

Show Full Abstract

We investigated the relationship between neuroticism and 16 mental and 18 physical traits using summary results of genome-wide association studies for these traits. LD score regression was used to investigate genetic correlations between neuroticism and the 34 health outcomes. Mendelian randomization was performed to investigate mutual causal relationships between neuroticism and the 34 health outcomes. Neuroticism genetically correlates with a majority of health-related traits and confers causal effects on 12 mental traits (major depressive disorder (MDD), insomnia, subjective well-being (SWB, negatively), schizophrenia, attention-deficit/hyperactivity disorder, alcohol dependence, loneliness, anorexia nervosa, anxiety disorder, bipolar disorder, obsessive-compulsive disorder, and psychiatric disorders) and two physical diseases (cardiovascular disease and hypertensive disease). Conversely, MDD, SWB, and insomnia have a causal effect on neuroticism. We highlighted key genes contributing to the causal associations between neuroticism and MDD, including RBFOX1, RERE, SOX5, and TCF4, and those contributing to the causal associations between neuroticism and cardiovascular diseases, including MAD1L1, ARNTL, RERE, and SOX6. The present study indicates that genetic variation mediates the causal influences of neuroticism on mental health and cardiovascular diseases.

Also flagged:Raf Kinase Inhibitory ProteinRKIPMAP kinasetranscription factorsBACH1breast cancer
Journal Article 2021-05-11 ✓ 5 Snippets Yesilkanal AE, Yang D, Valdespino A, Tiwari P, Sabino AU, Nguyen LC, Lee J, Xie XH, Sun S, Dann C, Robinson-Mailman L, Steinberg E, Stuhlmiller T, Frankenberger C, Goldsmith E, Johnson GL, Ramos AF, Rosner MR.
In-Text Gene Mentions

Lists of genes that correlate with RKIP (PEBP1) and BACH1 were also downloaded directly from cBioportal, as the data base already has these correlation matrices generated for each TCGA cancer type.

…Inhibitory Protein (RKIP;PEBP1), is a regulator…

…Phospho-TAOK3(Ser177) +Phospho TAOK2…

…Individual siGENOME humanTAOK3siRNA, Dharmacon, (D-004844-02…

PEBP1Forward: GCTCTACACCTTGGTCCTGAC…

Show Full Abstract

Metastasis suppression by high-dose, multi-drug targeting is unsuccessful due to network heterogeneity and compensatory network activation. Here, we show that targeting driver network signaling capacity by limited inhibition of core pathways is a more effective anti-metastatic strategy. This principle underlies the action of a physiological metastasis suppressor, Raf Kinase Inhibitory Protein (RKIP), that moderately decreases stress-regulated MAP kinase network activity, reducing output to transcription factors such as pro-metastastic BACH1 and motility-related target genes. We developed a low-dose four-drug mimic that blocks metastatic colonization in mouse breast cancer models and increases survival. Experiments and network flow modeling show limited inhibition of multiple pathways is required to overcome variation in MAPK network topology and suppress signaling output across heterogeneous tumor cells. Restricting inhibition of individual kinases dissipates surplus signal, preventing threshold activation of compensatory kinase networks. This low-dose multi-drug approach to decrease signaling capacity of driver networks represents a transformative, clinically relevant strategy for anti-metastatic treatment.

Also flagged:Brighthydroxylapatitelackrunhydroxyapatiteions
Journal Article 2021-05-11 No Snippets Ruiz-Agudo E, Ruiz-Agudo C, Di Lorenzo F, Alvarez-Lloret P, Ibañez-Velasco A, Rodriguez-Navarro C.
Show Full Abstract

Mineralization of hydroxylapatite (HAp), the main inorganic phase in bone, follows nonclassical crystallization routes involving metastable precursors and is strongly influenced by organic macromolecules. However, the effect of small organic molecules such as citrate on the formation of HAp is not well constrained. Using potentiometric titration experiments and titration calorimetry, in combination with a multianalytical approach, we show that citrate stabilizes prenucleation species as well as a liquid-like calcium phosphate precursor formed before any solid phase nucleates in the system. The stabilization of a liquid-like precursor phase could facilitate infiltration into the cavities of the collagen fibrils during bone mineralization, explaining the enhancement of collagen-mediated mineralization by citrate reported in previous studies. Hence, citrate can influence bone mineralization way before any solid phase (amorphous or crystalline) is formed. We also show that HAp formation after amorphous calcium phosphate (ACP) in the absence and presence of citrate results in nanoplates of about 5-12 nm thick, elongated along the <i>c</i> axis. Such nanoplates are made up of HAp nanocrystallites with a preferred <i>c</i> axis orientation and with interspersed ACP. The nanoplatelet morphology, size, and preferred crystallographic orientation, remarkably similar to those of bone HAp nanocrystals, appear to be an intrinsic feature of HAp formed from an amorphous precursor. Our results challenge current models for HAp mineralization in bone and the role of citrate, offering new clues to help answer the long-standing question as to why natural evolution favored HAp as the mineral phase in bone.

Also flagged:SLC2A12CLGNDPTSLIT1BLVRBmon
Journal Article 2021-05-11 No Snippets Ahmad S, Drag MH, Salleh SM, Cai Z, Nielsen MO.
Show Full Abstract

<h4>Background</h4>Early life malnutrition is known to target adipose tissue with varying impact depending on timing of the insult. This study aimed to identify differentially expressed genes in subcutaneous (SUB) and perirenal (PER) adipose tissue of 2.5-years old sheep to elucidate the biology underlying differential impacts of late gestation versus early postnatal malnutrition on functional development of adipose tissues. Adipose tissues were obtained from 37 adult sheep born as twins to dams fed either NORM (fulfilling energy and protein requirements), LOW (50% of NORM) or HIGH (110% of protein and 150% of energy requirements) diets in the last 6-weeks of gestation. From day 3 to 6 months of age, lambs were fed high-carbohydrate-high-fat (HCHF) or moderate low-fat (CONV) diets, and thereafter the same moderate low-fat diet.<h4>Results</h4>The gene expression profile of SUB in the adult sheep was not affected by the pre- or early postnatal nutrition history. In PER, 993 and 186 differentially expressed genes (DEGs) were identified in LOW versus HIGH and NORM, respectively, but no DEG was found between HIGH and NORM. DEGs identified in the mismatched pre- and postnatal nutrition groups LOW-HCHF (101) and HIGH-HCHF (192) were largely downregulated compared to NORM-CONV. Out of 831 DEGs, 595 and 236 were up- and downregulated in HCHF versus CONV, respectively. The functional enrichment analyses revealed that transmembrane (ion) transport activities, motor activities related to cytoskeletal and spermatozoa function (microtubules and the cytoskeletal motor protein, dynein), and responsiveness to the (micro) environmental extracellular conditions, including endocrine and nervous stimuli were enriched in the DEGs of LOW versus HIGH and NORM. We confirmed that mismatched pre- and postnatal feeding was associated with long-term programming of adipose tissue remodeling and immunity-related pathways. In agreement with phenotypic measurements, early postnatal HCHF feeding targeted pathways involved in kidney cell differentiation, and mismatched LOW-HCHF sheep had specific impairments in cholesterol metabolism pathways.<h4>Conclusions</h4>Both pre- and postnatal malnutrition differentially programmed (patho-) physiological pathways with implications for adipose functional development associated with metabolic dysfunctions, and PER was a major target.

Also flagged:prostate cancerARgene expressionbindingandrogenandrogen receptor
Journal Article 2021-05-11 ✓ 1 Snippet Huang CF, Lingadahalli S, Morova T, Ozturan D, Hu E, Yu IPL, Linder S, Hoogstraat M, Stelloo S, Sar F, van der Poel H, Altintas UB, Saffarzadeh M, Le Bihan S, McConeghy B, Gokbayrak B, Feng FY, Gleave ME, Bergman AM, Collins C, Hach F, Zwart W, Emberly E, Lack NA.
In-Text Gene Mentions

…tivators (CBP/p300, SRC/p160),chromatin modifiersmodifiers (SWI/SNF-BRG1), and…

Show Full Abstract

<h4>Background</h4>Androgen receptor (AR) is critical to the initiation, growth, and progression of prostate cancer. Once activated, the AR binds to cis-regulatory enhancer elements on DNA that drive gene expression. Yet, there are 10-100× more binding sites than differentially expressed genes. It is unclear how or if these excess binding sites impact gene transcription.<h4>Results</h4>To characterize the regulatory logic of AR-mediated transcription, we generated a locus-specific map of enhancer activity by functionally testing all common clinical AR binding sites with Self-Transcribing Active Regulatory Regions sequencing (STARRseq). Only 7% of AR binding sites displayed androgen-dependent enhancer activity. Instead, the vast majority of AR binding sites were either inactive or constitutively active enhancers. These annotations strongly correlated with enhancer-associated features of both in vitro cell lines and clinical prostate cancer samples. Evaluating the effect of each enhancer class on transcription, we found that AR-regulated enhancers frequently interact with promoters and form central chromosomal loops that are required for transcription. Somatic mutations of these critical AR-regulated enhancers often impact enhancer activity.<h4>Conclusions</h4>Using a functional map of AR enhancer activity, we demonstrated that AR-regulated enhancers act as a regulatory hub that increases interactions with other AR binding sites and gene promoters.

Also flagged:Tribblespathogenesisdiabetic retinopathyTRIB3HIF1αglucose
Journal Article 2021-05-11 ✓ 2 Snippets Pitale PM, Saltykova IV, Adu-Agyeiwaah Y, Li Calzi S, Satoh T, Akira S, Gorbatyuk O, Boulton ME, Pardue MT, Garvey WT, Athar M, Grant MB, Gorbatyuk MS.
In-Text Gene Mentions

Given the early metabolic changes in diabetic retinas at 4 weeks, we analyzed the expression profile of the genes known to associate with DR, including Hif1α, Aif1, Cox2, Icam1, Nf-kb, Rc3h1 (Roquin), Zc3h12a (Regnase or Mcp-1–induced protein-1), and Vegf. We found that TRIB3 ablation in diabetic retinas tremendously diminished expression levels of these genes.

…, Nf-kb ,Rc3h1(Roquin), Zc3h12a (Regnase…

Show Full Abstract

The current understanding of the molecular pathogenesis of diabetic retinopathy does not provide a mechanistic link between early molecular changes and the subsequent progression of the disease. In this study, we found that human diabetic retinas overexpressed TRIB3 and investigated the role of TRIB3 in diabetic retinal pathobiology in mice. We discovered that TRIB3 controlled major molecular events in early diabetic retinas via HIF1α-mediated regulation of retinal glucose flux, reprogramming cellular metabolism, and governing of inflammatory gene expression. These early molecular events further defined the development of neurovascular deficit observed in mice with diabetic retinopathy. TRIB3 ablation in the streptozotocin-induced mouse model led to significant retinal ganglion cell survival and functional restoration accompanied by a dramatic reduction in pericyte loss and acellular capillary formation. Under hypoxic conditions, TRIB3 contributed to advanced proliferative stages by significant upregulation of GFAP and VEGF expression, thus controlling gliosis and aberrant vascularization in oxygen-induced retinopathy mouse retinas. Overall, our data reveal that TRIB3 is a master regulator of diabetic retinal pathophysiology that may accelerate the onset and progression of diabetic retinopathy to proliferative stages in humans and present TRIB3 as a potentially novel therapeutic target for diabetic retinopathy.

Also flagged:TBK1TRAF3virus infectioninnate immunityVP3beta interferon
Journal Article 2021-05-11 ✓ 1 Snippet Deng T, Hu B, Wang X, Lin L, Zhou J, Xu Y, Yan Y, Zheng X, Zhou J.
In-Text Gene Mentions

…cell factor Staufen1 (STAU1) and protein kinase…

Show Full Abstract

The host innate immune system develops various strategies to antagonize virus infection, and the pathogen subverts or evades host innate immunity for self-replication. In the present study, we discovered that <i>Avibirnavirus</i> infectious bursal disease virus (IBDV) VP3 protein significantly inhibits MDA5-induced beta interferon (IFN-β) expression by blocking IRF3 activation. Binding domain mapping showed that the CC1 domain of VP3 and the residue lysine-155 of tumor necrosis factor receptor-associated factor 3 (TRAF3) are essential for the interaction. Furthermore, we found that the CC1 domain was required for VP3 to downregulate MDA5-mediated IFN-β production. A ubiquitination assay showed that lysine-155 of TRAF3 was the critical residue for K33-linked polyubiquitination, which contributes to the formation of a TRAF3-TBK1 complex. Subsequently, we revealed that VP3 blocked TRAF3-TBK1 complex formation through reducing K33-linked polyubiquitination of lysine-155 on TRAF3. Taken together, our data reveal that VP3 inhibits MDA5-dependent IRF3-mediated signaling via blocking TRAF3-TBK1 complex formation, which improves our understanding of the interplay between RNA virus infection and the innate host antiviral immune response.<b>IMPORTANCE</b> Type I interferon plays a critical role in the host response against virus infection, including <i>Avibirnavirus.</i> However, many viruses have developed multiple strategies to antagonize the innate host antiviral immune response during coevolution with the host. In this study, we first identified that K33-linked polyubiquitination of lysine-155 of TRAF3 enhances the interaction with TBK1, which positively regulates the host IFN immune response. Meanwhile, we discovered that the interaction of the CC1 domain of the <i>Avibirnavirus</i> VP3 protein and the residue lysine-155 of TRAF3 reduced the K33-linked polyubiquitination of TRAF3 and blocked the formation of the TRAF3-TBK1 complex, which contributed to the downregulation of host IFN signaling, supporting viral replication.

Also flagged:immune responsecarbohydratemetabolisminflammatory responseshypoxia-inducible factor 1αHIF1-α
Journal Article 2021-05-11 ✓ 2 Snippets Horváth M, Nagy G, Zsindely N, Bodai L, Horváth P, Vágvölgyi C, Nosanchuk JD, Tóth R, Gácser A.
In-Text Gene Mentions

…= 2.552) andSLC2A14(GLUT14; LFC =…

…(SLC2A1) and GLUT14 (SLC2A14), two glucose transporters…

Show Full Abstract

Oral epithelial cells monitor microbiome composition and initiate immune response upon dysbiosis, as in the case of <i>Candida</i> imbalances. <i>Candida</i> species, such as <i>C. albicans</i> and <i>C. parapsilosis</i>, are the most prevalent yeasts in the oral cavity. Comparison of healthy oral epithelial cell responses revealed that while <i>C. albicans</i> infection robustly activated inflammation cascades, <i>C. parapsilosis</i> primarily activated various inflammation-independent pathways. In posttranscriptional regulatory processes, several miRNAs were altered by both species. For <i>C. parapsilosis</i>, the dose of yeast cells directly correlated with changes in transcriptomic responses with higher fungal burdens inducing significantly different and broader changes. MicroRNAs (miRNAs) associated with carbohydrate metabolism-, hypoxia-, and vascular development-related responses dominated with <i>C. parapsilosis</i> infection, whereas <i>C. albicans</i> altered miRNAs linked to inflammatory responses. Subsequent analyses of hypoxia-inducible factor 1α (HIF1-α) and hepatic stellate cell (HSC) activation pathways predicted target genes through which miRNA-dependent regulation of yeast-specific functions may occur, which also supported the observed species-specific responses. Our findings suggest that <i>C. parapsilosis</i> is recognized as a commensal at low doses by the oral epithelium; however, increased fungal burden activates different pathways, some of which overlap with the inflammatory processes robustly induced by <i>C. albicans</i> <b>IMPORTANCE</b> A relatively new topic within the field of immunology involves the role of miRNAs in innate as well as adaptive immune response regulation. In recent years, posttranscriptional regulation of host-pathogenic fungal interactions through miRNAs was also suggested. Our study reveals that the distinct nature of human oral epithelial cell responses toward <i>C. parapsilosis</i> and <i>C. albicans</i> is possibly due to species-specific fine-tuning of host miRNA regulatory processes. The findings of this study also shed new light on the nature of early host cell transcriptional responses to the presence of <i>C. parapsilosis</i> and highlight the species' potential inflammation-independent host activation processes. These findings contribute to our better understanding of how miRNA deregulation at the oral immunological barrier, in noncanonical immune cells, may discriminate between fungal species, particularly <i>Candida</i> species with high or low pathogenic potential.

Also flagged:Aortic diseaseMarfan syndromeThoracic aortic aneurysmdissectionnitric oxidecytoskeleton
Journal Article 2021-05-11 No Snippets de la Fuente-Alonso A, Toral M, Alfayate A, Ruiz-Rodríguez MJ, Bonzón-Kulichenko E, Teixido-Tura G, Martínez-Martínez S, Méndez-Olivares MJ, López-Maderuelo D, González-Valdés I, Garcia-Izquierdo E, Mingo S, Martín CE, Muiño-Mosquera L, De Backer J, Nistal JF, Forteza A, Evangelista A, Vázquez J, Campanero MR, Redondo JM.
Show Full Abstract

Thoracic aortic aneurysm, as occurs in Marfan syndrome, is generally asymptomatic until dissection or rupture, requiring surgical intervention as the only available treatment. Here, we show that nitric oxide (NO) signaling dysregulates actin cytoskeleton dynamics in Marfan Syndrome smooth muscle cells and that NO-donors induce Marfan-like aortopathy in wild-type mice, indicating that a marked increase in NO suffices to induce aortopathy. Levels of nitrated proteins are higher in plasma from Marfan patients and mice and in aortic tissue from Marfan mice than in control samples, indicating elevated circulating and tissue NO. Soluble guanylate cyclase and cGMP-dependent protein kinase are both activated in Marfan patients and mice and in wild-type mice treated with NO-donors, as shown by increased plasma cGMP and pVASP-S239 staining in aortic tissue. Marfan aortopathy in mice is reverted by pharmacological inhibition of soluble guanylate cyclase and cGMP-dependent protein kinase and lentiviral-mediated Prkg1 silencing. These findings identify potential biomarkers for monitoring Marfan Syndrome in patients and urge evaluation of cGMP-dependent protein kinase and soluble guanylate cyclase as therapeutic targets.

Also flagged:antibodybindingCOVID-19antibodiesSpike proteinsinfection
Journal Article 2021-05-11 No Snippets Guo Y, Huang L, Zhang G, Yao Y, Zhou H, Shen S, Shen B, Li B, Li X, Zhang Q, Chen M, Chen D, Wu J, Fu D, Zeng X, Feng M, Pi C, Wang Y, Zhou X, Lu M, Li Y, Fang Y, Lu YY, Hu X, Wang S, Zhang W, Gao G, Adrian F, Wang Q, Yu F, Peng Y, Gabibov AG, Min J, Wang Y, Huang H, Stepanov A, Zhang W, Cai Y, Liu J, Yuan Z, Zhang C, Lou Z, Deng F, Zhang H, Shan C, Schweizer L, Sun K, Rao Z.
Show Full Abstract

COVID-19 pandemic caused by SARS-CoV-2 constitutes a global public health crisis with enormous economic consequences. Monoclonal antibodies against SARS-CoV-2 can provide an important treatment option to fight COVID-19, especially for the most vulnerable populations. In this work, potent antibodies binding to SARS-CoV-2 Spike protein were identified from COVID-19 convalescent patients. Among them, P4A1 interacts directly with and covers majority of the Receptor Binding Motif of the Spike Receptor-Binding Domain, shown by high-resolution complex structure analysis. We further demonstrate the binding and neutralizing activities of P4A1 against wild type and mutant Spike proteins or pseudoviruses. P4A1 was subsequently engineered to reduce the potential risk for Antibody-Dependent Enhancement of infection and to extend its half-life. The engineered antibody exhibits an optimized pharmacokinetic and safety profile, and it results in complete viral clearance in a rhesus monkey model of COVID-19 following a single injection. These data suggest its potential against SARS-CoV-2 related diseases.

Also flagged:NQO-1Nrf2membraneTelAnimal DiseasesPark7
Journal Article 2021-05-11 No Snippets Han EJ, Kim SY, Han HJ, Kim HS, Kim KN, Fernando IPS, Madusanka DMD, Dias MKHM, Cheong SH, Park SR, Han YS, Lee K, Ahn G.
Show Full Abstract

The present study aimed to evaluate the protective effect of a methanol extract of Sargassum horneri (SHM), which contains 6-hydroxy-4,4,7a-trimethyl-5,6,7,7a-tetrahydrobenzofuran-2(4H)-one (HTT) and apo-9'-fucoxanthinone, against ultraviolet B (UVB)-induced cellular damage in human keratinocytes and its underlying mechanism. SHM significantly improved cell viability of UVB-exposed human keratinocytes by reducing the generation of intracellular reactive oxygen species (ROS). Moreover, SHM inhibited UVB exposure-induced apoptosis by reducing the formation of apoptotic bodies and the populations of the sub-G<sub>1</sub> hypodiploid cells and the early apoptotic cells by modulating the expression of the anti- and pro-apoptotic molecules, Bcl-2 and Bax, respectively. Furthermore, SHM inhibited NF-κB p65 activation by inducing the activation of Nrf2/HO-1 signaling. The cytoprotective and antiapoptotic activities of SHM are abolished by the inhibition of HO-1 signaling. In further study, SHM restored the skin dryness and skin barrier disruption in UVB-exposed human keratinocytes. Based to these results, our study suggests that SHM protects the cells against UVB-induced cellular damages through the Nrf2/HO-1/NF-κB p65 signaling pathway and may be potentially useful for the prevention of UVB-induced skin damage.

Also flagged:CCNA1Cancerneck cancercytoplasmic membranegene expressionCDKN2A
Journal Article 2021-05-11 ✓ 5 Snippets Hier J, Vachon O, Bernstein A, Ibrahim I, Mlynarek A, Hier M, Alaoui-Jamali MA, Maschietto M, da Silva SD.
In-Text Gene Mentions

…association included TIMP3,DCC, DAPK, CDH1, CCNA1,…

…hypermethylation of TIMP3,DCC, DAPK1, CDH1, CCNA1,…

…, CCNA1 ,DCCand TIMP3 were…

…transcriptome data forDCCand CCNA1 in…

…P16 , TIMP3,DCC, DAPK, MINT31, RARβ,…

Show Full Abstract

In addition to chronic infection with human papilloma virus (HPV) and exposure to environmental carcinogens, genetic and epigenetic factors act as major risk factors for head and neck cancer (HNC) development and progression. Here, we conducted a systematic review in order to assess whether DNA hypermethylated genes are predictive of high risk of developing HNC and/or impact on survival and outcomes in non-HPV/non-tobacco/non-alcohol associated HNC. We identified 85 studies covering 32,187 subjects where the relationship between DNA methylation, risk factors and survival outcomes were addressed. Changes in DNA hypermethylation were identified for 120 genes. Interactome analysis revealed enrichment in complex regulatory pathways that coordinate cell cycle progression (CCNA1, SFN, ATM, GADD45A, CDK2NA, TP53, RB1 and RASSF1). However, not all these genes showed significant statistical association with alcohol consumption, tobacco and/or HPV infection in the multivariate analysis. Genes with the most robust HNC risk association included TIMP3, DCC, DAPK, CDH1, CCNA1, MGMT, P16, MINT31, CD44, RARβ. From these candidates, we further validated CD44 at translational level in an independent cohort of 100 patients with tongue cancer followed-up beyond 10 years. CD44 expression was associated with high-risk of tumor recurrence and metastasis (P = 0.01) in HPV-cases. In summary, genes regulated by methylation play a modulatory function in HNC susceptibility and it represent a critical therapeutic target to manage patients with advanced disease.

Also flagged:genetic disordersMetabolismDiabetesGastrointestinal CancerTumorreflex
Journal Article 2021-05-11 ✓ 1 Snippet Brockman DG, Austin-Tse CA, Pelletier RC, Harley C, Patterson C, Head H, Leonard CE, O'Brien K, Mahanta LM, Lebo MS, Lu CY, Natarajan P, Khera AV, Aragam KG, Kathiresan S, Rehm HL, Udler MS.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Purpose</h4>To evaluate the diagnostic yield and clinical relevance of clinical genome sequencing (cGS) as a first genetic test for patients with suspected monogenic disorders.<h4>Methods</h4>We conducted a prospective randomized study with pediatric and adult patients recruited from genetics clinics at Massachusetts General Hospital who were undergoing planned genetic testing. Participants were randomized into two groups: standard-of-care genetic testing (SOC) only or SOC and cGS.<h4>Results</h4>Two hundred four participants were enrolled, 202 were randomized to one of the intervention arms, and 99 received cGS. In total, cGS returned 16 molecular diagnoses that fully or partially explained the indication for testing in 16 individuals (16.2% of the cohort, 95% confidence interval [CI] 8.9-23.4%), which was not significantly different from SOC (18.2%, 95% CI 10.6-25.8%, P = 0.71). An additional eight molecular diagnoses reported by cGS had uncertain relevance to the participant's phenotype. Nevertheless, referring providers considered 20/24 total cGS molecular diagnoses (83%) to be explanatory for clinical features or worthy of additional workup.<h4>Conclusion</h4>cGS is technically suitable as a first genetic test. In our cohort, diagnostic yield was not significantly different from SOC. Further studies addressing other variant types and implementation challenges are needed to support feasibility and utility of broad-scale cGS adoption.

Also flagged:Autism spectrum disorderneurodevelopmental disordertranslationalAutism‐spectrum disorderneurodevelopmental diseasesmedical disorders
Journal Article 2021-05-11 No Snippets Longo F, Klann E.
Show Full Abstract

Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by deficits in social communication and the presence of restricted patterns of interest and repetitive behaviors. ASD is genetically heterogeneous and is believed to be caused by both inheritable and de novo gene variations. Studies have revealed an extremely complex genetic landscape of ASD, favoring the idea that mutations in different clusters of genes interfere with interconnected downstream signaling pathways and circuitry, resulting in aberrant behavior. In this review, we describe a select group of candidate genes that represent both syndromic and non-syndromic forms of ASD and encode proteins that are important in transcriptional and translational regulation. We focus on the interplay between dysregulated translation and transcription in ASD with the hypothesis that dysregulation of each synthetic process triggers a feedback loop to act on the other, which ultimately exacerbates ASD pathophysiology. Finally, we summarize findings from interdisciplinary studies that pave the way for the investigation of the cooperative impact of different genes and pathways underlying the development of ASD.

Also flagged:glucoseDNDiabetic nephropathydiabetespathogenesisCircular
Journal Article 2021-05-11 ✓ 5 Snippets Zhao L, Chen H, Zeng Y, Yang K, Zhang R, Li Z, Yang T, Ruan H.
In-Text Gene Mentions

Circular RNA circ_0000712 regulates high glucose-induced apoptosis, inflammation, oxidative stress, and fibrosis in (DN) by targeting the miR-879-5p/SOX6 axis.

…by targeting the miR-879-5p/SOX6axis.…

…Transcription Factor 6 (SOX6) levels were detected…

…IV), andSOX6were assessed by…

…and circ_0000712 orSOX6was predicted by…

Show Full Abstract

Diabetic nephropathy (DN), a frequent diabetes complication, has complex pathogenesis. Circular RNAs (circRNAs) circ_0000712 has been reported to be upregulated in kidney tissues and high glucose (HG)-inducted Mesangial cells (MCs). This study is designed to explore the role and mechanism of circ_0000712 in the HG-inducted MCs injury in DN. Circ_0000712, microRNA-879-5p (miR-879-5p), and SRY-Box Transcription Factor 6 (SOX6) levels were detected by real-time quantitative polymerase chain reaction (RT-qPCR). Cell apoptosis was examined by flow cytometry assay. Protein levels of B-cell lymphoma-2 (Bcl-2), Bcl-2 related X protein (Bax), fibronectin (FN), collagen type I (Col. I), collagen type IV (Col. IV), and SOX6 were assessed by western blot assay. Levels of interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor α (TNF-α) were measured by enzyme-linked immunosorbent assay (ELISA). Reactive oxygen species (ROS) generation, Lactate Dehydrogenase (LDH) activity, and Superoxide Dismutase (SOD) activity were detected by the corresponding kits. The binding relationship between miR-879-5p and circ_0000712 or SOX6 was predicted by starBase and Targetscan, and then verified by a dual-luciferase reporter and RNA Immunoprecipitation (RIP) assays. Circ_0000712 and SOX6 were highly expressed, and miR-879-5p was decreased in db/db DN mice and HG-inducted SV40-MES13 cells. Furthermore, circ_0000712 deficiency repressed HG-caused apoptosis, inflammation, oxidative stress, and fibrosis in SV40-MES13 cells. Mechanically, circ_0000712 could regulate SOX6 expression by sponging miR-879-5p. Circ_0000712 knockdown could hinder HG-inducted SV40-MES13 cell injury through targeting the miR-879-5p/SOX6 axis, implying a possible circRNA-targeted therapy for DN.

Also flagged:methylationtumorCD4immune responseGlioblastomaGBM
Journal Article 2021-05-11 ✓ 1 Snippet Bam M, Chintala S, Fetcko K, Williamsen BC, Siraj S, Liu S, Wan J, Xuei X, Liu Y, Leibold AT, Dey M.
In-Text Gene Mentions

…the corresponding ligands (TNFSF4, TRAF2, TRAF3, TRAF5)…

Show Full Abstract

CD4+ helper T (Th) cells play a critical role in shaping anti-tumor immunity by virtue of their ability to differentiate into multiple lineages in response to environmental cues. Various CD4+ lineages can orchestrate a broad range of effector activities during the initiation, expansion, and memory phase of endogenous anti-tumor immune response. In this clinical corelative study, we found that Glioblastoma (GBM) induces multi- and mixed-lineage immune response in the tumor microenvironment. Whole-genome bisulfite sequencing of tumor infiltrating and blood CD4+ T-cell from GBM patients showed 13571 differentially methylated regions and a distinct methylation pattern of methylation of tumor infiltrating CD4+ T-cells with significant inter-patient variability. The methylation changes also resulted in transcriptomic changes with 341 differentially expressed genes in CD4+ tumor infiltrating T-cells compared to blood. Analysis of specific genes involved in CD4+ differentiation and function revealed differential methylation status of TBX21, GATA3, RORC, FOXP3, IL10 and IFNG in tumor CD4+ T-cells. Analysis of lineage specific genes revealed differential methylation and gene expression in tumor CD4+ T-cells. Interestingly, we observed dysregulation of several ligands of T cell function genes in GBM tissue corresponding to the T-cell receptors that were dysregulated in tumor infiltrating CD4+ T-cells. Our results suggest that GBM might induce epigenetic alterations in tumor infiltrating CD4+ T-cells there by influencing anti-tumor immune response by manipulating differentiation and function of tumor infiltrating CD4+ T-cells. Thus, further research is warranted to understand the role of tumor induced epigenetic modification of tumor infiltrating T-cells to develop effective anti-GBM immunotherapy.

Also flagged:Angelman SyndromeASchromosomemethylationRett syndromeAngelman syndromes
Journal Article 2021-05-11 ✓ 1 Snippet Strom SP, Hossain WA, Grigorian M, Li M, Fierro J, Scaringe W, Yen HY, Teguh M, Liu J, Gao H, Butler MG.
In-Text Gene Mentions

…, CART ,NEGR1, and PPARG…

Show Full Abstract

Establishing or ruling out a molecular diagnosis of Prader-Willi or Angelman syndrome (PWS/AS) presents unique challenges due to the variety of different genetic alterations that can lead to these conditions. Point mutations, copy number changes, uniparental isodisomy (i-UPD) 15 of two subclasses (segmental or total isodisomy), uniparental heterodisomy (h-UPD), and defects in the chromosome 15 imprinting center can all cause PWS/AS. Here, we outline a combined approach using whole-exome sequencing (WES) and DNA methylation data with methylation-sensitive multiplex ligation-dependent probe amplification (MLPA) to establish both the disease diagnosis and the mechanism of disease with high sensitivity using current standard of care technology and improved efficiency compared to serial methods. The authors encourage the use of this approach in the clinical setting to confirm and establish the diagnosis and genetic defect which may account for the secondary genetic conditions that may be seen in those with isodisomy 15, impacting surveillance and counseling with more accurate recurrence risks. Other similarly affected individuals due to other gene disorders or cytogenetic anomalies such as Rett syndrome or microdeletions would also be identified with this streamlined approach.

Also flagged:BPIFB4OCXBPIFB6BPIL3TENPREG4
Journal Article 2021-05-11 No Snippets Le Roy N, Stapane L, Gautron J, Hincke MT.
Show Full Abstract

The avian eggshell is a remarkable biomineral, which is essential for avian reproduction; its properties permit embryonic development in the desiccating terrestrial environment, and moreover, are critically important to preserve unfertilized egg quality for human consumption. This calcium carbonate (CaCO<sub>3</sub>) bioceramic is made of 95% calcite and 3.5% organic matrix; it protects the egg contents against microbial penetration and mechanical damage, allows gaseous exchange, and provides calcium for development of the embryonic skeleton. In vertebrates, eggshell occurs in the Sauropsida and in a lesser extent in Mammalia taxa; avian eggshell calcification is one of the fastest known CaCO<sub>3</sub> biomineralization processes, and results in a material with excellent mechanical properties. Thus, its study has triggered a strong interest from the researcher community. The investigation of eggshell biomineralization in birds over the past decades has led to detailed characterization of its protein and mineral constituents. Recently, our understanding of this process has been significantly improved using high-throughput technologies (i.e., proteomics, transcriptomics, genomics, and bioinformatics). Presently, more or less complete eggshell proteomes are available for nine birds, and therefore, key proteins that comprise the eggshell biomineralization toolkit are beginning to be identified. In this article, we review current knowledge on organic matrix components from calcified eggshell. We use these data to analyze the evolution of selected matrix proteins and underline their role in the biological toolkit required for eggshell calcification in avian species. Amongst the panel of eggshell-associated proteins, key functional domains are present such as calcium-binding, vesicle-binding and protein-binding. These technical advances, combined with progress in mineral ultrastructure analyses, have opened the way for new hypotheses of mineral nucleation and crystal growth in formation of the avian eggshell, including transfer of amorphous CaCO<sub>3</sub> in vesicles from uterine cells to the eggshell mineralization site. The enrichment of multi-omics datasets for bird species is critical to understand the evolutionary context for development of CaCO<sub>3</sub> biomineralization in metazoans, leading to the acquisition of the robust eggshell in birds (and formerly dinosaurs).

Also flagged:Primary tumorcancerFGFRAdenocarcinomaTP53TTN
Journal Article 2021-05-11 ✓ 2 Snippets Duan Q, Tang C, Ma Z, Chen C, Shang X, Yue J, Jiang H, Gao Y, Xu B.
In-Text Gene Mentions

…TP53, AAR2, CCDC108,CACNA1E, RYR3, LRP1B etc.…

…AAR2, CCDC108 andCACNA1Egenes.…

Show Full Abstract

Gastroesophageal junction (GEJ) cancer is a tumor that occurs at the junction of stomach and esophagus anatomically. GEJ cancer frequently metastasizes to lymph nodes, however the heterogeneity and clonal evolution process are unclear. This study is the first of this kind to use single cell DNA sequencing to determine genomic variations and clonal evolution related to lymph node metastasis. Multiple Annealing and Looping Based Amplification Cycles (MALBAC) and bulk exome sequencing were performed to detect single cell copy number variations (CNVs) and single nucleotide variations (SNVs) respectively. Four GEJ cancer patients were enrolled with two (Pt.3, Pt.4) having metastatic lymph nodes. The most common mutation we found happened in the TTN gene, which was reported to be related with the tumor mutation burden in cancers. Significant intra-patient heterogeneity in SNVs and CNVs were found. We identified the SNV subclonal architecture in each tumor. To study the heterogeneity of CNVs, the single cells were sequenced. The number of subclones in the primary tumor was larger than that in lymph nodes, indicating the heterogeneity of primary site was higher. We observed two patterns of multi-station lymph node metastasis: one was skip metastasis and the other was to follow the lymphatic drainage. Taken together, our single cell genomic analysis has revealed the heterogeneity and clonal evolution in GEJ cancer.

Also flagged:FerroptosisOxytosisIschemic Strokedeathperoxideslipid
Journal Article 2021-05-11 No Snippets Ren JX, Li C, Yan XL, Qu Y, Yang Y, Guo ZN.
Show Full Abstract

Oxidative stress is a key cause of ischemic stroke and an initiator of neuronal dysfunction and death, mainly through the overproduction of peroxides and the depletion of antioxidants. Ferroptosis/oxytosis is a unique, oxidative stress-induced cell death pathway characterized by lipid peroxidation and glutathione depletion. Both oxidative stress and ferroptosis/oxytosis have common molecular pathways. This review summarizes the possible targets and the mechanisms underlying the crosstalk between oxidative stress and ferroptosis/oxytosis in ischemic stroke. This knowledge might help to further understand the pathophysiology of ischemic stroke and open new perspectives for the treatment of ischemic stroke.

Also flagged:gentamycinsaponinsilicaiodineS21S22
Journal Article 2021-05-11 No Snippets Tiwari VS, Joshi P, Yadav K, Sharma A, Chowdhury S, Manhas A, Kumar N, Tripathi R, Haq W.
Show Full Abstract

A series of novel 4-aminoquinoline analogues bearing a methyl group at 4-aminoquinoline moiety were synthesized <i>via</i> a new and robust synthetic route comprising <i>in situ</i> <i>tert</i>-butoxycarbonyl (Boc) deprotection-methylation cascade resulting in the corresponding N-methylated secondary amine using Red-Al and an efficient microwave-assisted strategy for the fusion of N-methylated secondary amine with 4-chloroquinoline nucleus to access the series of novel 4-<i>N</i>-methylaminoquinoline analogues. The new series of compounds were evaluated for their antimalarial activity in <i>in vitro</i> and <i>in vivo</i> models. Among 21 tested compounds, <b>9a</b>-<b>i</b> have shown a half-maximal inhibitory concentration (IC<sub>50</sub>) value less than 0.5 μM (<i>i.e</i>., <500 nM) against both chloroquine-sensitive strain 3D7 and chloroquine-resistant strain K1 of <i>Plasmodium falciparum</i> with acceptable cytotoxicity. Based on the <i>in vitro</i> antimalarial activity, selected compounds were screened for their <i>in vivo</i> antimalarial activity against <i>Plasmodium yoelii nigeriensis</i> (a multidrug-resistant) parasite in Swiss mice. Most of the compounds have shown significant inhibition on day 4 post infection at the oral dose of 100 mg/kg. Compound <b>9a</b> has shown 100% parasite inhibition on day 4, and out of five treated mice, two were cured till the end of the experiment. The present study suggests that 4-methylamino substitution is well tolerated for the antiplasmodial activity with reduced toxicity and therefore will be highly useful for the discovery of a new antimalarial agent against drug-resistant malaria.

Also flagged:AKTBone Metastasis of Solid Tumorsbreast cancerprostate cancerbone metastaseshypercalcemia
Journal Article 2021-05-11 No Snippets Hinz N, Jücker M.
Show Full Abstract

Solid tumors, such as breast cancer and prostate cancer, often form bone metastases in the course of the disease. Patients with bone metastases frequently develop complications, such as pathological fractures or hypercalcemia and exhibit a reduced life expectancy. Thus, it is of vital importance to improve the treatment of bone metastases. A possible approach is to target signaling pathways, such as the PI3K/AKT pathway, which is frequently dysregulated in solid tumors. Therefore, we sought to review the role of the serine/threonine kinase AKT in bone metastasis. In general, activation of AKT signaling was shown to be associated with the formation of bone metastases from solid tumors. More precisely, AKT gets activated in tumor cells by a plethora of bone-derived growth factors and cytokines. Subsequently, AKT promotes the bone-metastatic capacities of tumor cells through distinct signaling pathways and secretion of bone cell-stimulating factors. Within the crosstalk between tumor and bone cells, also known as the vicious cycle, the stimulation of osteoblasts and osteoclasts also causes activation of AKT in these cells. As a consequence, bone metastasis is reduced after experimental inhibition of AKT. In summary, AKT signaling could be a promising therapeutical approach for patients with bone metastases of solid tumors.

Also flagged:Respiratory Complexesmitochondrialcytosolorganellenuclear genomerespiratory chain
Journal Article 2021-05-11 ✓ 2 Snippets Needs HI, Protasoni M, Henley JM, Prudent J, Collinson I, Pereira GC.
In-Text Gene Mentions

Δψ: mitochondrial transmembrane potential; α-syn: alpha-synuclein; Aβ: amyloid-beta peptide; AD: Alzheimer’s Disease; AGK: acylglycerol kinase; AIF: apoptosis inducing factor; ALS: Amyotrophic lateral sclerosis; APP: amyloid precursor protein; CCCP: carbonyl cyanide-m-lorophenylhydrazone; CHCHD: coiled-coil-helix-coiled-coil-helix domain; CI-V: mitochondrial respiratory complexes one to five; cryo-EM: cryogenic electron microscopy; DAMPs: damage-associated molecular patterns; Drp1: mitochondrial fission GTPase dynamin-related protein 1; eIF2α: eukaryotic translation initiation factor 2 alpha; ER: endoplasmic reticulum; ETC: electron transport chain; Fe/S: iron/sulphur; HD: Huntington’s disease; HSR: heat shock response; Hsp: heat-shock protein; HTT: Huntingtin; IBM: inner boundary membrane; IMM: inner mitochondrial membrane; IMS: intermembrane space; iMTS: internal mitochondrial targeting sequence like signal sequence; ISR: integrated stress response; LHON: Leber hereditary optic neuropathy; MCIA: mitochondrial complex I intermediate assembly; MCSR: mitochondrial to cytosolic stress response; MDVs: mitochondrial-derived vesicles; MIA: mitochondrial IMS assembly; MICOS: mitochondrial contact site and cristae organising system; MIM: insertase of the outer mitochondrial membrane; MIP: mitochondrial intermediate peptidase; mitoCPR: mitochondrial compromised protein import response; mitoTAD: mitochondrial protein translocation-associated degeneration; MITRAC: Mitochondrial Translation Regulation Assembly intermediate of Cytochrome c oxidase; mPOS: mitochondrial precursor over-accumulation stress; MPP: mitochondrial processing peptidase; mtDNA: mitochondrial DNA; MTS: mitochondrial targeting sequence; NFTs: neurofibrillary tangles; NLS: nuclear localisation sequence; OMM: outer mitochondrial membrane; OXA1: mitochondrial oxidase assembly protein 1; PAM: presequence translocase-associated motor; PD: Parkinson’s disease; ROS: reactive oxygen species; SAM: sorting and assembly machinery; SC: supercomplexes; SN: Substantia Nigra; TIM22: translocase of the inner membrane 23; TIM23: translocase of the inner membrane 23; TOM: translocase of the outer membrane; TOM-CC: translocase of the outer membrane core complex; UQCC1 and UQCC2: ubiquinol-cytochrome c reductase complex assembly factors 1 and 2; UPRam: UPR activated by the mistargeting of proteins; UPRmt: mitochondrial unfolded protein response; UTR: untranslated region.

The genetic cause of HD is an abnormal expansion of polyglutamine repeats (encoded by the CAG codon) in the huntingtin gene (HTT) [309].

Show Full Abstract

The fact that >99% of mitochondrial proteins are encoded by the nuclear genome and synthesised in the cytosol renders the process of mitochondrial protein import fundamental for normal organelle physiology. In addition to this, the nuclear genome comprises most of the proteins required for respiratory complex assembly and function. This means that without fully functional protein import, mitochondrial respiration will be defective, and the major cellular ATP source depleted. When mitochondrial protein import is impaired, a number of stress response pathways are activated in order to overcome the dysfunction and restore mitochondrial and cellular proteostasis. However, prolonged impaired mitochondrial protein import and subsequent defective respiratory chain function contributes to a number of diseases including primary mitochondrial diseases and neurodegeneration. This review focuses on how the processes of mitochondrial protein translocation and respiratory complex assembly and function are interlinked, how they are regulated, and their importance in health and disease.

Also flagged:GLUT5fructosecancerfructose transportersGLUTfructose-specific transporter
Journal Article 2021-05-11 No Snippets Nahrjou N, Ghosh A, Tanasova M.
Show Full Abstract

Specific link between high fructose uptake and cancer development and progression highlighted fructose transporters as potential means to achieve GLUT-mediated discrimination between normal and cancer cells. The gained expression of fructose-specific transporter GLUT5 in various cancers offers a possibility for developing cancer-specific imaging and bioactive agents. Herein, we explore the feasibility of delivering a bioactive agent through cancer-relevant fructose-specific transporter GLUT5. We employed specific targeting of GLUT5 by 2,5-anhydro-D-mannitol and investigated several drug conjugates for their ability to induce cancer-specific cytotoxicity. The proof-of-concept analysis was carried out for conjugates of chlorambucil (CLB) in GLUT5-positive breast cancer cells and normal breast cells. The cytotoxicity of conjugates was assessed over 24 h and 48 h, and significant dependence between cancer-selectivity and conjugate size was observed. The differences were found to relate to the loss of GLUT5-mediated uptake upon increased conjugate size and hydrophobicity. The findings provide information on the substrate tolerance of GLUT5 and highlight the importance of maintaining appropriate hydrophilicity for GLUT-mediated delivery.

Also flagged:GSK-3βMyosinlocomotionglucoseprotein synthesisproteolysis
Journal Article 2021-05-11 ✓ 1 Snippet Mirzoev TM, Sharlo KA, Shenkman BS.
In-Text Gene Mentions

In our laboratory, it was found out that both PMS and L-arginine administration can prevent myh7b/mir-499 downregulation, SOX6 mRNA accumulation as well as PGC-1α decline in rat soleus during 7-day rat HS [114,121].

Show Full Abstract

Skeletal muscles, being one of the most abundant tissues in the body, are involved in many vital processes, such as locomotion, posture maintenance, respiration, glucose homeostasis, etc. Hence, the maintenance of skeletal muscle mass is crucial for overall health, prevention of various diseases, and contributes to an individual's quality of life. Prolonged muscle inactivity/disuse (due to limb immobilization, mechanical ventilation, bedrest, spaceflight) represents one of the typical causes, leading to the loss of muscle mass and function. This disuse-induced muscle loss primarily results from repressed protein synthesis and increased proteolysis. Further, prolonged disuse results in slow-to-fast fiber-type transition, mitochondrial dysfunction and reduced oxidative capacity. Glycogen synthase kinase 3β (GSK-3β) is a key enzyme standing at the crossroads of various signaling pathways regulating a wide range of cellular processes. This review discusses various important roles of GSK-3β in the regulation of protein turnover, myosin phenotype, and oxidative capacity in skeletal muscles under disuse/unloading conditions and subsequent recovery. According to its vital functions, GSK-3β may represent a perspective therapeutic target in the treatment of muscle wasting induced by chronic disuse, aging, and a number of diseases.

Also flagged:Infectionbarberry infectionrust infectionPstbarberry infectionsrust
Journal Article 2021-05-11 No Snippets Sinha P, Chen X.
Show Full Abstract

Barberry (<i>Berberis</i> spp.) is an alternate host for both the stripe rust pathogen, <i>Puccinia striiformis</i> f. sp. <i>tritici</i> (<i>Pst</i>), and the stem rust pathogen, <i>P. graminis</i> f. sp. <i>tritici</i> (<i>Pgt</i>), infecting wheat. Infection risk was assessed to determine whether barberry could be infected by either of the pathogens in Asia and Southeastern Europe, known for recurring epidemics on wheat and the presence of barberry habitats. For assessing infection risk, mechanistic infection models were used to calculate infection indices for both pathogens on barberry following a modeling framework. In East Asia, Bhutan, China, and Nepal were found to have low risks of barberry infection by <i>Pst</i> but high risks by <i>Pgt</i>. In Central Asia, Azerbaijan, Iran, Kazakhstan, southern Russia, and Uzbekistan were identified to have low to high risks of barberry infection for both <i>Pst</i> and <i>Pgt</i>. In Northwest Asia, risk levels of both pathogens in Turkey and the Republic of Georgia were determined to be high to very high. In Southwest Asia, no or low risk was found. In Southeastern Europe, similar high or very high risks for both pathogens were noted for all countries. The potential risks of barberry infection by <i>Pst</i> and/or <i>Pgt</i> should provide guidelines for monitoring barberry infections and could be valuable for developing rust management programs in these regions. The framework used in this study may be useful to predict rust infection risk in other regions.

Also flagged:Ovarian CancerOCgynecologic malignancySPARCTHBS1BRCA1
Journal Article 2021-05-11 ✓ 5 Snippets Ahn HS, Ho JY, Yu J, Yeom J, Lee S, Hur SY, Jung Y, Kim K, Choi YJ.
In-Text Gene Mentions

Among these, F2, SERPINC1, and SERPINA5 were found to be related to estrogen procoagulant effects in the Elsevier pathway collection in Enrichr [28].

…Diego, CA, USA),SERPINC1(DSPC10, R&D Systems,…

…Among these, F2,SERPINC1, and SERPINA5 were…

…other two proteins,SERPINC1, MRC1, seemed to…

…results, four proteins,SERPINC1, CDH2, MRC1, and…

Show Full Abstract

Ovarian cancer (OC) is the most lethal gynecologic malignancy and in-time diagnosis is limited because of the absence of effective biomarkers. Germline <i>BRCA1/2</i> genetic alterations are risk factors for hereditary OC; risk-reducing salpingo-oophorectomy (RRSO) is pursued for disease prevention. However, not all healthy carriers develop the disease. Therefore, identifying predictive markers in the <i>BRCA1/2</i> carrier population could help improve the identification of candidates for preventive RRSO. In this study, plasma samples from 20 OC patients (10 patients with <i>BRCA1/2</i> wild type (<sub>wt</sub>) and 10 with the <i>BRCA1/2</i> variant (<sub>var</sub>)) and 20 normal subjects (10 subjects with <i>BRCA1/2</i><sub>wt</sub> and 10 with <i>BRCA1/2</i><sub>var</sub>) were analyzed for potential biomarkers of hereditary OC. We applied a bottom-up proteomics approach, using nano-flow LC-MS to analyze depleted plasma proteome quantitatively, and potential plasma protein markers specific to the <i>BRCA1/2</i> variant were identified from a comparative statistical analysis of the four groups. We obtained 1505 protein candidates from the 40 subjects, and SPARC and THBS1 were verified by enzyme-linked immunosorbent assay. Plasma SPARC and THBS1 concentrations in healthy <i>BRCA1/2</i> carriers were found to be lower than in OC patients with <i>BRCA1/2</i><sub>var</sub>. If plasma SPARC concentrations increase over 337.35 ng/mL or plasma THBS1 concentrations increase over 65.28 μg/mL in a healthy <i>BRCA1/2</i> carrier, oophorectomy may be suggested.

Also flagged:Waterneurodegenerative diseasesvitamin EautophagymitochondrialCoenzyme
Journal Article 2021-05-11 ✓ 1 Snippet Wear D, Vegh C, Sandhu JK, Sikorska M, Cohen J, Pandey S.
In-Text Gene Mentions

Combining a diet of 0.2% CoQ10 and minocycline, Stack et al. demonstrated improved survival, behavioral performance, and improved biochemical pathologies including brain atrophy, neuronal atrophy, and HTT aggregation compared to either treatment alone in R6/2 transgenic mice (Table 1) [41].

Show Full Abstract

The world continues a desperate search for therapies that could bring hope and relief to millions suffering from progressive neurodegenerative diseases such as Alzheimer's (AD) and Parkinson's (PD). With oxidative stress thought to be a core stressor, interests have long been focused on applying redox therapies including coenzyme-Q<sub>10</sub>. Therapeutic use has failed to show efficacy in human clinical trials due to poor bioavailability of this lipophilic compound. A nanomicellar, water-dispersible formulation of coenzyme-Q<sub>10</sub>, Ubisol-Q<sub>10</sub>, has been developed by combining coenzyme-Q<sub>10</sub> with an amphiphilic, self-emulsifying molecule of polyoxyethanyl α-tocopheryl sebacate (derivatized vitamin E). This discovery made possible, for the first time, a proper assessment of the true therapeutic value of coenzyme-Q<sub>10</sub>. Micromolar concentrations of Ubisol-Q<sub>10</sub> show unprecedented neuroprotection against neurotoxin exposure in in vitro and in vivo models of neurodegeneration and was extremely effective when delivered either prior to, at the time of, and most significantly, post-neurotoxin exposure. These findings indicate a possible way forward for clinical development due to effective doses well within Federal Drug Administration guidelines. Ubisol-Q<sub>10</sub> is a potent mobilizer of astroglia, antioxidant, senescence preventer, autophagy activator, anti-inflammatory, and mitochondrial stabilizer. Here we summarize the work with oil-soluble coenzyme-Q<sub>10</sub>, its limitations, and focus mainly on efficacy of water-soluble coenzyme-Q<sub>10</sub> in neurodegeneration.

Also flagged:DapagliflozinType 2 Diabetes MellitusNonalcoholic fatty liver diseaseNAFLDchronic liver diseasesodium-glucose cotransporter-2
Journal Article 2021-05-11 ✓ 1 Snippet Das C, Tripathy D, Swain S, Sudhakaran N, Uthansingh K, Mallick P, Pati GK.
In-Text Gene Mentions

…disorders, such ashemochromatosisand Wilson’s disease,…

Show Full Abstract

Introduction Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease, with a global prevalence of 20%-40%. Approximately 40%-60% of patients with type 2 diabetes mellitus (DM2) experience NAFLD; out of which 20%-40% cases may have higher severity. Due to the scarcity of available reports from the eastern part of India, we aimed to evaluate the effects of dapagliflozin, a sodium-glucose cotransporter-2 inhibitor used in these types of cases. Material and methods The study included consecutive patients with DM2 and NAFLD, treated with dapagliflozin at 10 mg daily for six months. All patients underwent detailed anthropometric, biochemical, abdominal ultrasonography, and transient elastography studies at baseline and after therapy as well as a comparative analysis. Results In the 100 patients included in our study, the male patients outnumbered the female patients (male-to-female ratio, 4.27:-1) and the mean age at presentation was 44.11 ± 8.24 years. The mean body mass index significantly decreased over the course of the therapy, from 27.31± 1.87 kg/m<sup>2</sup> at baseline to 26.21 ± 1.51 kg/m<sup>2</sup> after the therapy. The patients' transaminitis, dyslipidemia, and glycemic status significantly improved over the course of the therapy. We also observed significant (p < 0.05) improvement in hepatic steatosis by the end of the treatment. Although transient elastography by FibroScan-measured hepatic fibrosis score (Echosens, Paris, France) significantly decreased from 6.95 ± 1.42 to 6 ± 1.44 kPa, hepatic fibrosis did not improve significantly (p ≥ 0.05) following therapy. Conclusion Although dapagliflozin improved body mass index, transaminitis, dyslipidemia, glycemic status, and hepatic steatosis, it had a minimal effect on hepatic fibrosis.

Also flagged:GLP-1 receptorType 2 diabetes mellituscardiovascular diseasesCVDatherosclerosishypertension
Journal Article 2021-05-11 ✓ 1 Snippet Ma X, Liu Z, Ilyas I, Little PJ, Kamato D, Sahebka A, Chen Z, Luo S, Zheng X, Weng J, Xu S.
In-Text Gene Mentions

This suppression is independent of plasma cholesterol changes and BW reduction through regulating markers of plaque instability and inflammation including those linked to plaque hemorrhage (CD163), matrix turnover (matrix metalloproteinase (MMP)-3, MMP-13), cholesterol metabolism (prostaglandin I2 synthase (PTGIS), ATP-binding cassette transporter 1 (ABCA1)), leukocyte recruitment (C-C motif chemokine ligand 2 (CCL2), osteopontin (OPN), interleukin (IL)-6), and leukocyte rolling, extravasation and adhesion (vascular cell adhesion molecule (VCAM)-1, E-selectin (SELE)) 16.

Show Full Abstract

Type 2 diabetes mellitus (T2DM) is closely associated with cardiovascular diseases (CVD), including atherosclerosis, hypertension and heart failure. Some anti-diabetic medications are linked with an increased risk of weight gain or hypoglycemia which may reduce the efficacy of the intended anti-hyperglycemic effects of these therapies. The recently developed receptor agonists for glucagon-like peptide-1 (GLP-1RAs), stimulate insulin secretion and reduce glycated hemoglobin levels without having side effects such as weight gain and hypoglycemia. In addition, GLP1-RAs demonstrate numerous cardiovascular protective effects in subjects with or without diabetes. There have been several cardiovascular outcomes trials (CVOTs) involving GLP-1RAs, which have supported the overall cardiovascular benefits of these drugs. GLP1-RAs lower plasma lipid levels and lower blood pressure (BP), both of which contribute to a reduction of atherosclerosis and reduced CVD. GLP-1R is expressed in multiple cardiovascular cell types such as monocyte/macrophages, smooth muscle cells, endothelial cells, and cardiomyocytes. Recent studies have indicated that the protective properties against endothelial dysfunction, anti-inflammatory effects on macrophages and the anti-proliferative action on smooth muscle cells may contribute to atheroprotection through GLP-1R signaling. In the present review, we describe the cardiovascular effects and underlying molecular mechanisms of action of GLP-1RAs in CVOTs, animal models and cultured cells, and address how these findings have transformed our understanding of the pharmacotherapy of T2DM and the prevention of CVD.

Also flagged:Breast Cancercancermetabolismmalignant tumorsmalignant diseasesDeath
Journal Article 2021-05-11 ✓ 1 Snippet Wang X, Wang C, Guan J, Chen B, Xu L, Chen C.
In-Text Gene Mentions

Tumor-associated macrophages (TAMs) with elevated LSECtin expression interacts with its receptor BTN3A3, expressed in cancer cells, to promote the stemness of breast cancer cells in a cell-cell contact dependent manner (Fig. 1) 15.

Show Full Abstract

Breast cancer is the most commonly diagnosed and the most lethal cancer in females both in China and worldwide. Currently, the origin of cancer stem cells, the heterogeneity of cancer cells, the mechanism of cancer metastasis and drug resistance are the most important issues that need to be addressed. Chinese investigators have recently made new discoveries in basic breast cancer researches, especially regarding cancer stem cells, cancer metabolism, and microenvironments. These efforts have led to a deeper understanding of drug resistance and metastasis and have also indicated new biomarkers and therapeutic targets. These findings emphasized the importance of the cancer stem cells for targeted therapy. In this review, we summarized the latest important findings in this field in China.

Also flagged:potassiumlithiumsynthesissodiumhydrogensulfur
Journal Article 2021-05-11 No Snippets Li P, Kim H, Kim KH, Kim J, Jung HG, Sun YK, Sun YK.
Show Full Abstract

The growing demand for green energy has fueled the exploration of sustainable and eco-friendly energy storage systems. To date, the primary focus has been solely on the enhancement of lithium-ion battery (LIB) technologies. Recently, the increasing demand and uneven distribution of lithium resources have prompted extensive attention toward the development of other advanced battery systems. As a promising alternative to LIBs, potassium-ion batteries (KIBs) have attracted considerable interest over the past years owing to their resource abundance, low cost, and high working voltage. Capitalizing on the significant research and technological advancements of LIBs, KIBs have undergone rapid development, especially the anode component, and diverse synthesis techniques, potassiation chemistry, and energy storage applications have been systematically investigated and proposed. In this review, the necessity of exploring superior anode materials is highlighted, and representative KIB anodes as well as various structural construction approaches are summarized. Furthermore, critical issues, challenges, and perspectives of KIB anodes are meticulously organized and presented. With a strengthened understanding of the associated potassiation chemistry, the composition and microstructural modification of KIB anodes could be significantly improved.

Also flagged:cell cyclecancerlung cancercell proliferationdeathmetabolism
Journal Article 2021-05-11 No Snippets Marima R, Hull R, Dlamini Z, Penny C.
Show Full Abstract

The profiling and identification of genes that are differentially expressed is frequently used to underpin the underlying molecular mechanisms of biological conditions and provides a molecular foothold on biological questions of interest. However, this can be a daunting task since there is a cross talk and overlap of some of the components of the signalling pathways. The deregulation of the cell cycle signalling pathway is a hallmark of cancer, including lung cancer. Proper regulation of the cell cycle results in cellular homeostasis between cell proliferation and cell death. The comprehension of the cell cycle regulation in drug metabolism studies is of significance. This study aimed at elucidating the regulation of cell cycle genes' in response to LPV/r in lung cells. Thus, this study describes methodology for revealing molecular mechanisms employed by LPV/r to induce stress on genomic DNA. This approach is based on the interrogation of a panel of 84 genes related to the cell cycle pathway, and how the differentially expressed genes' expression pattern corroborates loss in nuclear integrity (phenotypic observation). MAD2L2, AURKB and CASP3 gene expressions were further confirmed by RT-qPCR. Furthermore, the use of <i>in-silico</i> bioinformatics tools integrates the molecular profiles and phenotypic changes. This approach revealed the activation of the DNA damage response (DDR) pathway in response to LPV/r treatment. The proposed methodology will aid in the comprehension of drug metabolism at genotypic and phenotypic levels.•Gene profiling often reveals the underlying molecular mechanisms.•RT<sup>2</sup> PCR gene arrays have integrated patented quality controls and allow reliable gene expression analysis.•<i>In-silico</i> bioinformatics analysis help reveal pathways affected, that often correspond to phenotypic changes/features.

Also flagged:Non-Alcoholic SteatohepatitisNASHobesitycirrhosislipidAlanine transaminase
Journal Article 2021-05-11 ✓ 1 Snippet Elyasinia F, Jalali SM, Zarini S, Sadeghian E, Sorush A, Pirouz A.
In-Text Gene Mentions

…and C, andhemochromatosis) and 6) Age…

Show Full Abstract

BACKGROUND Non-alcoholic steatohepatitis (NASH) is a serious comorbidity in patients with obesity and because of the high risk of cirrhosis and the extreme mortality rate of NASH, approaching effective treatment methods, and improvements are crucial. Following few studies comparing the impact of laparoscopic gastric bypass (LGB) and laparoscopic sleeve gastrectomy (LSG) surgery on NASH, our study was conducted to assess the effect of these two surgical methods separately in patients with NASH through ultrasonography, and concurrently, on other factors such as lipid profiles and blood pressure to reduce the complications of complex obesity surgeries on patients and also provide a solution to prevent NASH-related cirrhosis. METHODS This study was performed at Imam Khomeini Hospital Complex; Vali-e-Asr Hospital affiliated to Tehran University of Medical Sciences.All patients with obesity who had undergone bariatric surgery at Vali-e-Asr Hospital during 2017 and 2018 were included in this prospective cohort study. Weight, body mass index (BMI), blood pressure, Alanine transaminase(ALT), Aspartate transaminase(AST),lipid profile and Fasting blood sugar(FBS)were evaluated before and one year after surgery. The patients underwent an ultrasound examination before surgery to determine the fatty liver grade. The type of operation (sleeve or bypass) was governed by the patient him/herself after receiving thorough clarifications about the available methods, their complications, and expected outcomes. In addition, by the separation of fatty liver grading with ultrasound modality, the correlation between ultrasound grading, laboratory results, and the rate of weight loss in patients who undergone both sleeve and bypass surgeries were evaluated and compared during a one-year follow-up. RESULTS In this study, 44 patients were included. 22 patients underwent laparoscopic sleeve gastrectomy (LSG), and 22 patients underwent laparoscopic gastric bypass (LGB) surgery. The mean age of the patients was 40.45 ± 12.01 years. 35 patients (79.5%) were women, and 9 patients (20.5%) were men. Most patients (81.8%) had grade I and II in terms of preoperative liver ultrasonography results. Bariatric surgery (LSG and LGB) greatly enhanced NASH's hepatic status in liver ultrasonography. Since the liver status of patients with preoperative ultrasonography was not significantly different between the two groups, there was no substantial distinction among the two groups in this regard, postoperatively. Weight and BMI, lipid profile, liver enzymes, FBS, and mean arterial blood pressure (MAP) were significantly reduced individually in both groups and all patients one year after surgery. None of the postoperative variables and their modifications had a prominent difference between the two groups except for High-density lipoprotein(HDL)level after surgery. The postoperative HDL was considerably higher in the LGB group (<i>p</i> = 0.014). However, the changes in HDL were not statistically different between both groups. The levels of AST, ALT, total cholesterol, LDL, and FBS were associated with the NASH grade. CONCLUSION Both types of LSG and LGB bariatric surgeries have been shown to significantly reduce BMI and improve lipid profiles, liver enzymes, and blood glucose levels in patients one year after surgery. The NASH status was also ameliorated considerably. The two types of surgery were not remarkably different in these modifications. Besides, there was a significant correlation between AST, ALT, total cholesterol, LDL, and FBS levels with the NASH grade.

Preprints.org 2021-05-11 Preprint (No Snippets API) Jagomäe T, Singh K, Philips M, Jayaram M, Seppa K, Tekko T, Gilbert SF, Vasar E, Lilleväli K.
Show Full Abstract

The members of the IgLON superfamily of cell adhesion molecules facilitate fundamental cellular communication during brain development, maintain functional brain circuitry, and are associated with several neuropsychiatric disorders. Usage of alternative promoter-specific 1a and 1b mRNA isoforms in Lsamp, Opcml, Ntm and the single promoter of Negr1 in the mouse and human brain has been previously described. To determine the precise spatiotemporal expression dynamics of Lsamp, Opcml, Ntm isoforms and Negr1, in the developing brain, we generated isoform-specific RNA probes and carried out in situ hybridization in the developing (embryonic, E10.5, 13.5, 17; post natal, P0) and adult mouse brains. We show that promoter-specific expression of IgLONs is established early during pallial development (at E10.5), where it remains throughout its differentiation through adulthood. In the diencephalon, midbrain and hindbrain, strong expression patterns are initiated a few days later and begin fading after birth, being only faintly expressed during adulthood. Thus, the expression of specific IgLONs in the developing brain may provide the means for regionally specific functionality as well as for specific regional vulnerabilities. The current study will therefore improve the understanding of how IgLON genes are implicated in the development of neuropsychiatric disorders.

Also flagged:HydroxyapatitemineralizationosteogenesisOPNmineralphosphorylation
Journal Article 2021-05-10 No Snippets Holzinger J, Kotisch H, Richter KW, Konrat R.
Show Full Abstract

Extracellular matrix glycoproteins play a major role in bone mineralization and modulation of osteogenesis. Among these, the intrinsically disordered protein osteopontin (OPN) is associated with the inhibition of formation, growth and proliferation of the bone mineral hydroxyapatite (HAP). Furthermore, post-translational modifications like phosphorylation can alter conformations and interaction properties of intrinsically disordered proteins (IDPs). Therefore, the actual interaction of OPN with a HAP surface on an atomic level and how this interaction is affected by phosphorylation is of great interest. Here, we study the interaction of full-length OPN on the surface of suspended HAP nanoparticles by solution NMR spectroscopy. We report the binding modes of this IDP and provide evidence for the influence of hyperphosphorylation on the binding character and an explanation for the differing roles in biomineralization. Our study moreover presents an easy and suitable option to measure interaction of nanoparticles in a stable suspension with full-length proteins.

Also flagged:brain developmentdeathSBNO1intellectual disability
Journal Article 2021-05-10 No Snippets Qian L, Gao F, Yan B, Yang L, Wang W, Bai L, Ma X, Yang J.
Show Full Abstract

<h4>Introduction</h4>Birth parameters have long been reported to have a role in human intelligence. However, the causalities reported in previous observational studies were controversial. Our study aims to provide an unbiased investigation of the causal associations between birth parameters and human intelligence using the Mendelian randomization (MR) approach.<h4>Methods</h4>Genetic instrumental variables for MR analyses were extracted from large genome-wide association studies of infant head circumference (N = 10,768), birth length (N = 28,489), and birth weight (N = 321,223). Data for intelligence were obtained from a meta-analysis of genome-wide association studies of 269,867 individuals of the European ancestry. Primary MR analysis was performed using the standard inverse-variance weighted method, and sensitivity analyses were performed using the weighted median, MR-Egger, and MR-PRESSO methods.<h4>Results</h4>Using 10 single nucleotide polymorphisms as instrumental variables, we found that 1 standard deviation increase in infant head circumference was associated with 0.14-fold higher scores in intelligence tests (β = 0.14, 95% confidence interval: 0.09 to 0.18, P<sub>IVW</sub> =2.05 × 10<sup>-9</sup> ). The causal relationship was robust when sensitivity analyses were performed. However, birth length and birth weight had no significant associations with intelligence.<h4>Conclusion</h4>Our findings suggested infant head circumference, but not birth weight and length were associated with intelligence, which might indicate that brain development rather than general fetal growth was responsible for the development of intelligence.

Also flagged:keyyouhowChromatinhistonehistones H2A
Journal Article 2021-05-10 No Snippets Tachiwana H, Dacher M, Maehara K, Harada A, Seto Y, Katayama R, Ohkawa Y, Kimura H, Kurumizaka H, Saitoh N.
Show Full Abstract

In eukaryotes, histone variant distribution within the genome is the key epigenetic feature. To understand how each histone variant is targeted to the genome, we developed a new method, the RhIP (<i>R</i>econstituted <i>h</i>istone complex <i>I</i>ncorporation into chromatin of <i>P</i>ermeabilized cell) assay, in which epitope-tagged histone complexes are introduced into permeabilized cells and incorporated into their chromatin. Using this method, we found that H3.1 and H3.3 were incorporated into chromatin in replication-dependent and -independent manners, respectively. We further found that the incorporation of histones H2A and H2A.Z mainly occurred at less condensed chromatin (open), suggesting that condensed chromatin (closed) is a barrier for histone incorporation. To overcome this barrier, H2A, but not H2A.Z, uses a replication-coupled deposition mechanism. Our study revealed that the combination of chromatin structure and DNA replication dictates the differential histone deposition to maintain the epigenetic chromatin states.

Also flagged:neuropsychiatric disordersautism spectrum disorderdevelopmental disorderepileptic encephalopathyEEintellectual disability
Journal Article 2021-05-10 No Snippets Li K, Fang Z, Zhao G, Li B, Chen C, Xia L, Wang L, Luo T, Wang X, Wang Z, Zhang Y, Jiang Y, Pan Q, Hu Z, Guo H, Tang B, Liu C, Sun Z, Xia K, Li J.
Show Full Abstract

The clinical similarity among different neuropsychiatric disorders (NPDs) suggested a shared genetic basis. We catalogued 23,109 coding de novo mutations (DNMs) from 6511 patients with autism spectrum disorder (ASD), 4,293 undiagnosed developmental disorder (UDD), 933 epileptic encephalopathy (EE), 1022 intellectual disability (ID), 1094 schizophrenia (SCZ), and 3391 controls. We evaluated that putative functional DNMs contribute to 38.11%, 34.40%, 33.31%, 10.98% and 6.91% of patients with ID, EE, UDD, ASD and SCZ, respectively. Consistent with phenotype similarity and heterogeneity in different NPDs, they show different degree of genetic association. Cross-disorder analysis of DNMs prioritized 321 candidate genes (FDR < 0.05) and showed that genes shared in more disorders were more likely to exhibited specific expression pattern, functional pathway, genetic convergence, and genetic intolerance.

Also flagged:autophagyphosphatasespost-translational modificationskinasesdegradationcell differentiation
Journal Article 2021-05-10 No Snippets Licheva M, Raman B, Kraft C, Reggiori F.
Show Full Abstract

Eukaryotic cells use post-translational modifications to diversify and dynamically coordinate the function and properties of protein networks within various cellular processes. For example, the process of autophagy strongly depends on the balanced action of kinases and phosphatases. Highly conserved from the budding yeast <i>Saccharomyces cerevisiae</i> to humans, autophagy is a tightly regulated self-degradation process that is crucial for survival, stress adaptation, maintenance of cellular and organismal homeostasis, and cell differentiation and development. Many studies have emphasized the importance of kinases and phosphatases in the regulation of autophagy and identified many of the core autophagy proteins as their direct targets. In this review, we summarize the current knowledge on kinases and phosphatases acting on the core autophagy machinery and discuss the relevance of phosphoregulation for the overall process of autophagy.

Also flagged:provirusescancerNucleic Acidpersistent infectiongenetic diseasepolymerase
Journal Article 2021-05-10 No Snippets Sun C, Chang KC, Abate AR.
Show Full Abstract

Targeted sequencing enables sensitive and cost-effective analysis by focusing resources on molecules of interest. Existing methods, however, are limited in enrichment power and target capture length. Here, we present a novel method that uses compound nucleic acid cytometry to achieve million-fold enrichments of molecules >10 kbp in length using minimal prior target information. We demonstrate the approach by sequencing HIV proviruses in infected individuals. Our method is useful for rare target sequencing in research and clinical applications, including for identifying cancer-associated mutations or sequencing viruses infecting cells.

Also flagged:nogllaOpsingamropamino
Journal Article 2021-05-10 No Snippets Drozdova P, Kizenko A, Saranchina A, Gurkov A, Firulyova M, Govorukhina E, Timofeyev M.
Show Full Abstract

<h4>Background</h4>Vision is a crucial sense for the evolutionary success of many animal groups. Here we explore the diversity of visual pigments (opsins) in the transcriptomes of amphipods (Crustacea: Amphipoda) and conclude that it is restricted to middle (MWS) and long wavelength-sensitive (LWS) opsins in the overwhelming majority of examined species.<h4>Results</h4>We evidenced (i) parallel loss of MWS opsin expression in multiple species (including two independently evolved lineages from the deep and ancient Lake Baikal) and (ii) LWS opsin amplification (up to five transcripts) in both Baikal lineages. The number of LWS opsins negatively correlated with habitat depth in Baikal amphipods. Some LWS opsins in Baikal amphipods contained MWS-like substitutions, suggesting that they might have undergone spectral tuning.<h4>Conclusions</h4>This repeating two-step evolutionary scenario suggests common triggers, possibly the lack of light during the periods when Baikal was permanently covered with thick ice and its subsequent melting. Overall, this observation demonstrates the possibility of revealing climate history by following the evolutionary changes in protein families.

Also flagged:aphthous stomatitisSLEinterferonSTAT1TNFAIP3DNASE1L3
Journal Article 2021-05-10 ✓ 1 Snippet Girardelli M, Valencic E, Moressa V, Margagliotta R, Tesser A, Pastore S, Spadola O, Athanasakis E, Severini GM, Taddio A, Tommasini A.
In-Text Gene Mentions

…→ NP_005051 ),RC3H1( NM_001300850 →…

Show Full Abstract

<h4>Background</h4>Recurrent aphthous stomatitis with systemic signs of inflammation can be encountered in inflammatory bowel disease, Behçet's disease (BD), Systemic Lupus Erythematosus (SLE). In addition, it has been proposed that cases with very early onset in childhood can be underpinned by rare monogenic defects of immunity, which may require targeted treatments. Thus, subjects with early onset recurrent aphthous stomatitis receiving a clinical diagnosis of BD-like or SLE-like disease may deserve a further diagnostic workout, including immunologic and genetic investigations.<h4>Objective</h4>To investigate how an immunologic, genetic and transcriptomics assessment of interferon inflammation may improve diagnosis and care in children with recurrent aphthous stomatitis with systemic inflammation.<h4>Methods</h4>Subjects referred to the pediatric rheumatologist for recurrent aphthous stomatitis associated with signs of systemic inflammation from January 2015 to January 2020 were enrolled in the study and underwent analysis of peripheral lymphocyte subsets, sequencing of a 17-genes panel and measure of interferon score.<h4>Results</h4>We enrolled 15 subjects (12 females, median age at disease onset 4 years). The clinical diagnosis was BD in 8, incomplete BD in 5, BD/SLE overlap in 1, SLE in 1. Pathogenic genetic variants were detected in 3 patients, respectively 2 STAT1 gain of function variants in two patients classified as BD/SLE overlap and SLE, and 1 TNFAIP3 mutation (A20 haploinsufficiency) in patients with BD. Moreover 2 likely pathogenic variants were identified in DNASE1L3 and PTPN22, both in patients with incomplete BD. Interferon score was high in the two patients with STAT1 GOF mutations, in the patient with TNFAIP3 mutation, and in 3 genetic-negative subjects. In two patients, the treatment was modified based on genetic results.<h4>Conclusions</h4>Although recurrent aphthous stomatitis associated with systemic inflammation may lead to a clinical diagnosis of BD or SLE, subjects with early disease onset in childhood deserve genetic investigation for rare monogenic disorders. A wider genetic panel may help disclosing the genetic background in the subset of children with increased interferon score, who tested negative in this study.

Also flagged:DHODHcancerdihydroorotate dehydrogenaseflavinmitochondrialenzyme
Journal Article 2021-05-10 No Snippets Zhou Y, Tao L, Zhou X, Zuo Z, Gong J, Liu X, Zhou Y, Liu C, Sang N, Liu H, Zou J, Gou K, Yang X, Zhao Y.
Show Full Abstract

Human dihydroorotate dehydrogenase (DHODH) is a flavin-dependent mitochondrial enzyme catalyzing the fourth step in the de novo pyrimidine synthesis pathway. It is originally a target for the treatment of the non-neoplastic diseases involving in rheumatoid arthritis and multiple sclerosis, and is re-emerging as a validated therapeutic target for cancer therapy. In this review, we mainly unravel the biological function of DHODH in tumor progression, including its crucial role in de novo pyrimidine synthesis and mitochondrial respiratory chain in cancer cells. Moreover, various DHODH inhibitors developing in the past decades are also been displayed, and the specific mechanism between DHODH and its additional effects are illustrated. Collectively, we detailly discuss the association between DHODH and tumors in recent years here, and believe it will provide significant evidences and potential strategies for utilizing DHODH as a potential target in preclinical and clinical cancer therapies.

Also flagged:Serotonin transporterdepressionmajor depressive disorderpositronbehavioralbinding
Journal Article 2021-05-10 ✓ 5 Snippets Svensson JE, Svanborg C, Plavén-Sigray P, Kaldo V, Halldin C, Schain M, Lundberg J.
In-Text Gene Mentions

The serotonin transporter (5-HTT) has received a lot of attention in MDD research, in part since it is the primary mechanism to decrease extracellular 5-HT12, but also because it is the target of the most commonly used antidepressant drugs13.

The observed increase in [11C]MADAM binding can have several causes, such as (i) lower levels of serotonin in the synapse, freeing up more 5-HTT for [11C]MADAM to bind to; (ii) an increase of the number of synapses expressing 5-HTT; or, (iii), an increase of the 5-HTT concentration in existing synapses.

The observed increase of available 5-HTT indicates a degree of plasticity in the serotonin system in vivo in MDD patients.

…The serotonin transporter (5-HTT) has received a…

…has shown reduced5-HTTbinding in the…

Show Full Abstract

Molecular imaging studies have shown low cerebral concentration of serotonin transporter in patients suffering from depression, compared to healthy control subjects. Whether or not this difference also is present before disease onset and after remission (i.e. a trait), or only at the time of the depressive episode (i.e. a state) remains to be explored. We examined 17 patients with major depressive disorder with positron emission tomography using [<sup>11</sup>C]MADAM, a radioligand that binds to the serotonin transporter, before and after treatment with internet-based cognitive behavioral therapy. In all, 17 matched healthy control subjects were examined once. Cerebellum was used as reference to calculate the binding potential. Differences before and after treatment, as well as between patients and controls, were assessed in a composite cerebral region and in the median raphe nuclei. All image analyses and confirmatory statistical tests were preregistered. Depression severity decreased following treatment (p < 0.001). [<sup>11</sup>C]MADAM binding in patients increased in the composite region after treatment (p = 0.01), while no change was observed in the median raphe (p = 0.51). No significant difference between patients at baseline and healthy controls were observed in the composite region (p = 0.97) or the median raphe (p = 0.95). Our main finding was that patients suffering from a depressive episode show an overall increase in cerebral serotonin transporter availability as symptoms are alleviated. Our results suggest that previously reported cross-sectional molecular imaging findings of the serotonin transporter in depression most likely reflect the depressive state, rather than a permanent trait. The finding adds new information on the pathophysiology of major depressive disorder.

Also flagged:isopentenyladenineCytochrome P450oxindole-3-acetic acidCationairtrans-Zeatin
Journal Article 2021-05-10 No Snippets Kumar A, Friedman H, Tsechansky L, Graber ER.
Show Full Abstract

In-planta mechanisms of biochar (BC)-mediated improved growth were evaluated by examining oxidative stress, metabolic, and hormonal changes of Arabidopsis wild-type plants under basal or acute heat stress (-HS/ + HS) conditions with or without BC (+ BC/-BC). The oxidative stress was evaluated by using Arabidopsis expressing redox-sensitive green fluorescent protein in the plastids (pla-roGFP2). Fresh biomass and inflorescence height were greater in + BC(‒HS) plants than in the -BC(‒HS) plants, despite similar leaf nutrient levels, photosystem II (PSII) maximal efficiencies and similar oxidative poise. Endogenous levels of jasmonic and abscisic acids were higher in the + BC(‒HS) treatment, suggesting their role in growth improvement. HS in ‒BC plants caused reductions in inflorescence height and PSII maximum quantum yield, as well as significant oxidative stress symptoms manifested by increased lipid peroxidation, greater chloroplast redox poise (oxidized form of roGFP), increased expression of DNAJ heat shock proteins and Zn-finger genes, and reduced expression of glutathione-S-transferase gene in addition to higher abscisic acid and salicylic acid levels. Oxidative stress symptoms were significantly reduced by BC. Results suggest that growth improvements by BC occurring under basal and HS conditions are induced by acclimation mechanisms to 'microstresses' associated with basal growth and to oxidative stress of HS, respectively.

Also flagged:Endoplasmic reticulumCtBP2TIAM1localizationphosphorylationdoxycycline
Journal Article 2021-05-10 ✓ 5 Snippets Meijer BJ, Smit WL, Koelink PJ, Westendorp BF, de Boer RJ, van der Meer JHM, Vermeulen JLM, Paton JC, Paton AW, Qin J, Dekker E, Muncan V, van den Brink GR, Heijmans J.
In-Text Gene Mentions

OLFM4

…markers Lgr5 ,Olfm4and Bmi1 (Fig.…

…of Lgr5 andOlfm4levels (Fig. 4…

…measured Lgr5 andOlfm4expression levels over…

…of Lgr5 andOlfm4and promoted restoration…

Show Full Abstract

Enforcing differentiation of cancer stem cells is considered as a potential strategy to sensitize colorectal cancer cells to irradiation and chemotherapy. Activation of the unfolded protein response, due to endoplasmic reticulum (ER) stress, causes rapid stem cell differentiation in normal intestinal and colon cancer cells. We previously found that stem cell differentiation was mediated by a Protein kinase R-like ER kinase (PERK) dependent arrest of mRNA translation, resulting in rapid protein depletion of WNT-dependent transcription factor c-MYC. We hypothesize that ER stress dependent stem cell differentiation may rely on the depletion of additional transcriptional regulators with a short protein half-life that are rapidly depleted due to a PERK-dependent translational pause. Using a novel screening method, we identify novel transcription factors that regulate the intestinal stem cell fate upon ER stress. ER stress was induced in LS174T cells with thapsigargin or subtilase cytotoxin (SubAB) and immediate alterations in nuclear transcription factor activity were assessed by the CatTFRE assay in which transcription factors present in nuclear lysate are bound to plasmid DNA, co-extracted and quantified using mass-spectrometry. The role of altered activity of transcription factor CtBP2 was further examined by modification of its expression levels using CAG-rtTA3-CtBP2 overexpression in small intestinal organoids, shCtBP2 knockdown in LS174T cells, and familial adenomatous polyposis patient-derived organoids. CtBP2 overexpression organoids were challenged by ER stress and ionizing irradiation. We identified a unique set of transcription factors with altered activation upon ER stress. Gene ontology analysis showed that transcription factors with diminished binding were involved in cellular differentiation processes. ER stress decreased CtBP2 protein expression in mouse small intestine. ER stress induced loss of CtBP2 expression which was rescued by inhibition of PERK signaling. CtBP2 was overexpressed in mouse and human colorectal adenomas. Inducible CtBP2 overexpression in organoids conferred higher clonogenic potential, resilience to irradiation-induced damage and a partial rescue of ER stress-induced loss of stemness. Using an unbiased proteomics approach, we identified a unique set of transcription factors for which DNA-binding activity is lost directly upon ER stress. We continued investigating the function of co-regulator CtBP2, and show that CtBP2 mediates ER stress-induced loss of stemness which supports the intestinal stem cell state in homeostatic stem cells and colorectal cancer cells.

Also flagged:HDRSox2topF10nucleuspuromycin
Journal Article 2021-05-10 No Snippets Li PP, Margolis RL.
Show Full Abstract

Cas9 nucleases permit rapid and efficient generation of gene-edited cell lines. However, in typical protocols, mutations are intentionally introduced into the donor template to avoid the cleavage of donor template or re-cleavage of the successfully edited allele, compromising the fidelity of the isogenic lines generated. In addition, the double-stranded breaks (DSBs) used for editing can introduce undesirable "on-target" indels within the second allele of successfully modified cells via non-homologous end joining (NHEJ). To address these problems, we present an optimized protocol for precise genome editing in human iPSCs that employs (1) single guided Cas9 nickase to generate single-stranded breaks (SSBs), (2) transient overexpression of BCL-XL to enhance survival post electroporation, and (3) the PiggyBac transposon system for seamless removal of dual selection markers. We have used this method to modify the length of the CAG repeat contained in exon 7 of PPP2R2B. When longer than 43 triplets, this repeat causes the neurodegenerative disorder spinocerebellar ataxia type 12 (SCA12); our goal was to seamlessly introduce the SCA12 mutation into a human control iPSC line. With our protocol, ~ 15% of iPSC clones selected had the desired gene editing without "on target" indels or off-target changes, and without the deliberate introduction of mutations via the donor template. This method will allow for the precise and efficient editing of human iPSCs for disease modeling and other purposes.

Also flagged:Cadherin-13brain disorderstranslationalautismattention-deficit/hyperactivity disorderCDH13
Journal Article 2021-05-10 ✓ 1 Snippet Mossink B, van Rhijn JR, Wang S, Linda K, Vitale MR, Zöller JEM, van Hugte EJH, Bak J, Verboven AHA, Selten M, Negwer M, Latour BL, van der Werf I, Keller JM, Klein Gunnewiek TM, Schoenmaker C, Oudakker A, Anania A, Jansen S, Lesch KP, Frega M, van Bokhoven H, Schubert D, Nadif Kasri N.
In-Text Gene Mentions

…DLX1-6, LHX6, ZEB2,SOX6, Fig. 1f…

Show Full Abstract

Activity in the healthy brain relies on a concerted interplay of excitation (E) and inhibition (I) via balanced synaptic communication between glutamatergic and GABAergic neurons. A growing number of studies imply that disruption of this E/I balance is a commonality in many brain disorders; however, obtaining mechanistic insight into these disruptions, with translational value for the patient, has typically been hampered by methodological limitations. Cadherin-13 (CDH13) has been associated with autism and attention-deficit/hyperactivity disorder. CDH13 localizes at inhibitory presynapses, specifically of parvalbumin (PV) and somatostatin (SST) expressing GABAergic neurons. However, the mechanism by which CDH13 regulates the function of inhibitory synapses in human neurons remains unknown. Starting from human-induced pluripotent stem cells, we established a robust method to generate a homogenous population of SST and MEF2C (PV-precursor marker protein) expressing GABAergic neurons (iGABA) in vitro, and co-cultured these with glutamatergic neurons at defined E/I ratios on micro-electrode arrays. We identified functional network parameters that are most reliably affected by GABAergic modulation as such, and through alterations of E/I balance by reduced expression of CDH13 in iGABAs. We found that CDH13 deficiency in iGABAs decreased E/I balance by means of increased inhibition. Moreover, CDH13 interacts with Integrin-β1 and Integrin-β3, which play opposite roles in the regulation of inhibitory synaptic strength via this interaction. Taken together, this model allows for standardized investigation of the E/I balance in a human neuronal background and can be deployed to dissect the cell-type-specific contribution of disease genes to the E/I balance.

Also flagged:Synthesisgene expressionhereditary cancersAutismDown SydromeDeafness
Journal Article 2021-05-10 ✓ 1 Snippet Young JL, Mak J, Stanley T, Bass M, Cho MK, Tabor HK.
In-Text Gene Mentions

Hemochromatosis

Show Full Abstract

<h4>Purpose</h4>Asian Americans have been understudied in the literature on genetic and genomic services. The current study systematically identified, evaluated, and summarized findings from relevant qualitative and quantitative studies on genetic health care for Asian Americans.<h4>Methods</h4>A search of five databases (1990 to 2018) returned 8,522 unique records. After removing duplicates, abstract/title screening, and full text review, 47 studies met inclusion criteria. Data from quantitative studies were converted into "qualitized data" and pooled together with thematic data from qualitative studies to produce a set of integrated findings.<h4>Results</h4>Synthesis of results revealed that (1) Asian Americans are under-referred but have high uptake for genetic services, (2) linguistic/communication challenges were common and Asian Americans expected more directive genetic counseling, and (3) Asian Americans' family members were involved in testing decisions, but communication of results and risk information to family members was lower than other racial groups.<h4>Conclusion</h4>This study identified multiple barriers to genetic counseling, testing, and care for Asian Americans, as well as gaps in the research literature. By focusing on these barriers and filling these gaps, clinical genetic approaches can be tailored to meet the needs of diverse patient groups, particularly those of Asian descent.

Also flagged:polyglutamineextracellularvesiclesHuntingtinHDneurodegenerative disease
Journal Article 2021-05-10 ✓ 1 Snippet Kuang X, Nunn K, Jiang J, Castellano P, Hardikar U, Horgan A, Kong J, Tan Z, Dai W.
In-Text Gene Mentions

HTT

Show Full Abstract

Aggregates of mutant huntingtin (mHTT) containing an expanded polyglutamine (polyQ) tract are hallmarks of Huntington's Disease (HD). Studies have shown that mHTT can spread between cells, leading to the propagation of misfolded protein pathology. However, the structure of transmissive mHTT species, and the molecular mechanisms underlying their transmission remain unknown. Using correlative light and electron microscopy (CLEM) and cryo-electron tomography (cryo-ET), we identified two types of aggregation-prone granules in conditioned medium from PC12 cells expressing a mHTT N-terminal fragment: densities enclosed by extracellular vesicles (EVs), and uncoated, amorphous meshworks of heterogeneous oligomers that co-localize with clusters of EVs. In vitro assays confirmed that liposomes induce condensation of polyQ oligomers into higher-order assemblies, resembling the uncoated meshworks observed in PC12 conditioned medium. Our findings provide novel insights into formation and architecture of transmissive mHTT proteins, and highlight the potential role of EVs as both carriers and modulators of transmissive mHTT proteins.

Also flagged:cognitionbehavioralpsychiatricsecretionestradiolprogesterone
Journal Article 2021-05-10 No Snippets Delevich K, Klinger M, Okada NJ, Wilbrecht L.
Show Full Abstract

Across species, adolescence is a period of growing independence that is associated with the maturation of cognitive, social, and affective processing. Reorganization of neural circuits within the frontal cortex is believed to contribute to the emergence of adolescent changes in cognition and behavior. While puberty coincides with adolescence, relatively little is known about which aspects of frontal cortex maturation are driven by pubertal development and gonadal hormones. In this review, we highlight existing work that suggests puberty plays a role in the maturation of specific cell types in the medial prefrontal cortex (mPFC) of rodents, and highlight possible routes by which gonadal hormones influence frontal cortical circuit development.

Also flagged:methylationDi(2-ethylhexyl) phthalatephthalateepigenetic modificationsphthalatescytosines
Journal Article 2021-05-10 No Snippets Liu S, Wang K, Svoboda LK, Rygiel CA, Neier K, Jones TR, Cavalcante RG, Colacino JA, Dolinoy DC, Sartor MA.
Show Full Abstract

Di(2-ethylhexyl) phthalate (DEHP) is a type of phthalate plasticizer found in a variety of consumer products and poses a public health concern due to its metabolic and endocrine disruption activities. Dysregulation of epigenetic modifications, including DNA methylation, has been shown to be an important mechanism for the pathogenic effects of prenatal exposures, including phthalates. In this study, we used an established mouse model to study the effect of perinatal DEHP exposure on the DNA methylation profile in liver (a primary target tissue of DEHP) and blood (a common surrogate tissue) of both juvenile and adult mice. Despite exposure ceasing at 3 weeks of age (PND21), we identified thousands of sex-specific differential DNA methylation events in 5-month old mice, more than identified at PND21, both in blood and liver. Only a small number of these differentially methylated cytosines (DMCs) overlapped between the time points, or between tissues (i.e. liver and blood), indicating blood may not be an appropriate surrogate tissue to estimate the effects of DEHP exposure on liver DNA methylation. We detected sex-specific DMCs common between 3-week and 5-month samples, pointing to specific DNA methylation alterations that are consistent between weanling and adult mice. In summary, this is the first study to assess the genome-wide DNA methylation profiles in liver and blood at two different aged cohorts in response to perinatal DEHP exposure. Our findings cast light on the implications of using surrogate tissue instead of target tissue in human population-based studies and identify epigenetic biomarkers for DEHP exposure.

Also flagged:Ureaplasma Urealyticum-Orchitismale infertilityzincsugarinfection
Journal Article 2021-05-10 No Snippets Bin DH, Zhang SY, Zhan M, Li L, Li YQ, Zhou X, Lu FG, Zhou Q, He QH.
Show Full Abstract

<b>Background:</b> Ureaplasma urealyticum (UU) infection is the most common cause of male infertility. Zhibai Dihuang Decoction (ZBDHD) can improve the rate of forwarding motility sperm, sperm deformity rate, seminal plasma zinc and refined berry sugar levels. <b>Methods:</b> The potential targets of ZBDHD are obtained from The Encyclopedia of Traditional Chinese Medicine (ETCM). Orchitis-related targets were collected from the Genecards and OMIM databases. The Cytoscape and the Database for Annotation, Visualization and Integrated Discovery (DAVID) were utilized to construct and analyzed the networks. Finally, a rat model of orchitis caused by UU infection was used to detect related indicators of mitochondrial energy metabolism using TUNEL apoptosis detection technology, loss cytometry, Real-Time Quantitative Reverse Transcription PCR (qRT-PCR) and Western Blot. <b>Results:</b> A total of 795 ZBDHD targets and 242 orchitis-related targets were obtained. The "ZBDHD- orchitis PPI network" was constructed and analyzed. ZBDHD can regulate signaling pathways and biological processes related to mitochondrial energy metabolism. The results of experimental studies have shown that ZBDHD maintains the integrity of sperm mitochondrial respiratory chain function by enhancing mitochondrial Na<sup>+</sup>-K<sup>+</sup>-ATPase and Ca2<sup>+</sup>-Mg<sup>2+</sup>-ATPase activities, promotes the synthesis of mitochondrial ATP, and improves sperm energy supply, thereby improving the motility, vitality and survival rate of sperm, and effectively improving the quality of semen in UU-infected rats (<i>p</i> < 0.05). <b>Conclusion:</b>This study discovered the multi-pathway mechanism of ZBDHD intervention in UU-induced orchitis through integrated pharmacological strategies, which provides a reference for further research on the mechanism of ZBDHD intervention in orchitis in the direction of mitochondrial energy metabolism.

Also flagged:Neurological Disordersbrain developmentneuronal migrationneurodegenerative diseasesneurodevelopmental disordersneurodegenerative disorders
Journal Article 2021-05-10 ✓ 1 Snippet Bose R, Banerjee S, Dunbar GL.
In-Text Gene Mentions

…1 of theHTTgene, while other…

Show Full Abstract

Modeling neurological disorders is challenging because they often have both endogenous and exogenous causes. Brain organoids consist of three-dimensional (3D) self-organizing brain tissue which increasingly is being used to model various aspects of brain development and disorders, such as the generation of neurons, neuronal migration, and functional networks. These organoids have been recognized as important <i>in vitro</i> tools to model developmental features of the brain, including neurological disorders, which can provide insights into the molecular mechanisms involved in those disorders. In this review, we describe recent advances in the generation of two-dimensional (2D), 3D, and blood-brain barrier models that were derived from induced pluripotent stem cells (iPSCs) and we discuss their advantages and limitations in modeling diseases, as well as explore the development of a vascularized and functional 3D model of brain processes. This review also examines the applications of brain organoids for modeling major neurodegenerative diseases and neurodevelopmental disorders.

Also flagged:SLC31A1ATP7BMTF1PDHBATP7ALIAS
Journal Article 2021-05-10 No Snippets Bries AE, Webb JL, Vogel B, Carrillo C, Day TA, Kimber MJ, Valentine RJ, Rowling MJ, Clark S, Schalinske KL, McNeill EM.
Show Full Abstract

Eggs are protein-rich, nutrient-dense, and contain bioactive ingredients that have been shown to modify gene expression and impact health. To understand the effects of egg consumption on tissue-specific mRNA and microRNA expression, we examined the role of whole egg consumption (20% protein, w/w) on differentially expressed genes (DEGs) between rat (<i>n</i> = 12) transcriptomes in the prefrontal cortex (PFC), liver, kidney, and visceral adipose tissue (VAT). Principal component analysis with hierarchical clustering was used to examine transcriptome profiles between dietary treatment groups. We performed Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis as well as genetic network and disease enrichment analysis to examine which metabolic pathways were the most predominantly altered in each tissue. Overall, our data demonstrates that whole egg consumption for 2 weeks modified the expression of 52 genes in the PFC, 22 genes in VAT, and two genes in the liver (adj <i>p</i> < 0.05). Additionally, 16 miRNAs were found to be differentially regulated in the PFC, VAT, and liver, but none survived multiple testing correction. The main pathways influenced by WE consumption were glutathione metabolism in VAT and cholesterol biosynthesis in the PFC. These data highlight key pathways that may be involved in diseases and are impacted by acute consumption of a diet containing whole eggs.

Also flagged:BMP-2bone morphogenetic proteinossificationosteogenesisbone formationhydroxyapatite
Journal Article 2021-05-10 No Snippets Wadhwa P, Lee JH, Zhao BC, Cai H, Rim JS, Jang HS, Lee ES.
Show Full Abstract

Our study was aimed to analyze the osteoinductive effect of powdered and block type autogenous bone graft along with bone morphogenetic protein (BMP-2) as compared to synthetic bone graft. Three circular bicortical defects were made in the calvaria of each rabbit and randomly divided into three groups as follows: powdered tooth biomaterial+BMP-2, block tooth biomaterial+BMP-2, and control group: synthetic bone+BMP-2. The samples taken from these defects after 4 and 8 weeks were analyzed histologically along with micro CT analysis. In our study, both powered and block type tooth autogenous bone graft successfully stimulated mesenchymal cells leading to endochondral ossification and bone regeneration. We observed that the powered bone graft material which is acid insoluble especially is preferable as a carrier for BMP-2.

Also flagged:myopicLens OpacitiescataractARCnucleusdigestion
Journal Article 2021-05-10 No Snippets Zhang S, Zhang K, He W, Lu Y, Zhu X.
Show Full Abstract

<h4>Purpose</h4>To investigate and compare the lens phosphoproteomes in patients with highly myopic cataract (HMC) or age-related cataract (ARC).<h4>Methods</h4>In this study, we undertook a comparative phosphoproteome analysis of the lenses from patients with HMC or ARC. Intact lenses from ARC and HMC patients were separated into the cortex and nucleus. After protein digestion, the phosphopeptides were quantitatively analyzed with TiO<sub>2</sub> enrichment and liquid chromatography-mass spectrometry. The potential functions of different phosphopeptides were assessed by Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.<h4>Results</h4>In total, 522 phosphorylation sites in 164 phosphoproteins were identified. The number of phosphorylation sites was significantly higher in the cortex than in the nucleus, in both ARC and HMC lenses. The differentially phosphorylated peptides in the lens cortex and nucleus in HMC eyes were significantly involved in the glutathione metabolism pathway. The KEGG pathway enrichment analysis indicated that the differences in phosphosignaling mediators between the ARC and HMC lenses were associated with glycolysis and the level of phosphorylated phosphoglycerate kinase 1 was lower in HMC lenses than in ARC lenses.<h4>Conclusions</h4>We provide an overview of the differential phosphoproteomes of HMC and ARC lenses that can be used to clarify the molecular mechanisms underlying their different phenotypes.

Also flagged:hydrogenchlorinetriclocarbantriclosandiphenylurea
Journal Article 2021-05-10 No Snippets Iacopetta D, Catalano A, Ceramella J, Saturnino C, Salvagno L, Ielo I, Drommi D, Scali E, Plutino MR, Rosace G, Sinicropi MS.
Show Full Abstract

In the late 1930s and early 1940s, it was discovered that the substitution on aromatic rings of hydrogen atoms with chlorine yielded a novel chemistry of antimicrobials. However, within a few years, many of these compounds and formulations showed adverse effects, including human toxicity, ecotoxicity, and unwanted environmental persistence and bioaccumulation, quickly leading to regulatory bans and phase-outs. Among these, the triclocarban, a polychlorinated aromatic antimicrobial agent, was employed as a major ingredient of toys, clothing, food packaging materials, food industry floors, medical supplies, and especially of personal care products, such as soaps, toothpaste, and shampoo. Triclocarban has been widely used for over 50 years, but only recently some concerns were raised about its endocrine disruptive properties. In September 2016, the U.S. Food and Drug Administration banned its use in over-the-counter hand and body washes because of its toxicity. The withdrawal of triclocarban has prompted the efforts to search for new antimicrobial compounds and several analogues of triclocarban have also been studied. In this review, an examination of different facets of triclocarban and its analogues will be analyzed.

Also flagged:OCT4MyelinationWhite matter atrophyHDbehavioralglial cell-derived neurotrophic factor
Journal Article 2021-05-10 ✓ 2 Snippets Yu JH, Nam BG, Kim MG, Pyo S, Seo JH, Cho SR.
In-Text Gene Mentions

Huntington’s disease (HD) pathology caused by an expansion of the cytosine-adenine-guanine (CAG) repeats within the HTT gene is characterized by massive loss of neurons in striatum and deep layers of the cortex as well as early and progressive thinning of white matter (WM) [1].

…repeats within theHTTgene is characterized…

Show Full Abstract

White matter atrophy has been shown to precede the massive loss of striatal GABAergic neurons in Huntington's disease (HD). This study investigated the effects of <i>in vivo</i> expression of reprogramming factor octamer-binding transcription factor 4 (OCT4) on neural stem cell (NSC) niche activation in the subventricular zone (SVZ) and induction of cell fate specific to the microenvironment of HD. R6/2 mice randomly received adeno-associated virus 9 (AAV9)-OCT4, AAV9-Null, or phosphate-buffered saline into both lateral ventricles at 4 weeks of age. The AAV9-OCT4 group displayed significantly improved behavioral performance compared to the control groups. Following AAV9-OCT4 treatment, the number of newly generated NSCs and oligodendrocyte progenitor cells (OPCs) significantly increased in the SVZ, and the expression of OPC-related genes and glial cell-derived neurotrophic factor (GDNF) significantly increased. Further, amelioration of myelination deficits in the corpus callosum was observed through electron microscopy and magnetic resonance imaging, and striatal DARPP32<sup>+</sup> GABAergic neurons significantly increased in the AAV9-OCT4 group. These results suggest that <i>in situ</i> expression of the reprogramming factor OCT4 in the SVZ induces OPC proliferation, thereby attenuating myelination deficits. Particularly, GDNF released by OPCs seems to induce striatal neuroprotection in HD, which explains the behavioral improvement in R6/2 mice overexpressing OCT4.

Also flagged:STAT3cancerSTATdegradationtumorcancers
Journal Article 2021-05-10 No Snippets Zhou H, Bai L, Xu R, McEachern D, Chinnaswamy K, Li R, Wen B, Wang M, Yang CY, Meagher JL, Sun D, Stuckey JA, Wang S.
Show Full Abstract

Signal transducer and activator of transcription 3 (STAT3) is an attractive cancer therapeutic target. We report herein our extensive <i>in vitro</i> and <i>in vivo</i> evaluations of SD-91, the product of the hydrolysis of our previously reported STAT3 degrader SD-36. SD-91 binds to STAT3 protein with a high affinity and displays >300-fold selectivity over other STAT family protein members. SD-91 potently and effectively induces degradation of STAT3 protein and displays a high selectivity over other STAT members and >7000 non-STAT proteins in cells. A single administration of SD-91 selectively depletes STAT3 protein in tumor tissues with a persistent effect. SD-91 achieves complete and long-lasting tumor regression in the MOLM-16 xenograft model in mice even with weekly administration. Hence, SD-91 is a potent, highly selective, and efficacious STAT3 degrader for extensive evaluations for the treatment of human cancers and other diseases for which STAT3 plays a key role.

Also flagged:heat shock protein 70HSP70brain-derived neurotrophic factorBDNFadrenocorticotropic hormoneACTH
Journal Article 2021-05-10 No Snippets Bourbeau KC, Moriarty TA, Bellovary BN, Bellissimo GF, Ducharme JB, Haeny TJ, Zuhl MN.
Show Full Abstract

<h4>Context</h4>Chronic heat exposure promotes cardiovascular and cellular adaptations, improving an organism's ability to tolerate subsequent stressors. Heat exposure may also promote neural adaptations and alter the neural-hormonal stress response. Hot-temperature yoga (HY) combines mind-body exercise with heat exposure. The added heat component in HY may induce cardiovascular and cellular changes, along with neural benefits and modulation of stress hormones.<h4>Aims</h4>The purpose of the present study is to compare the cardiovascular, cellular heat shock protein 70 (HSP70), neural, and hormonal adaptations of HY versus normal-temperature yoga (NY).<h4>Settings and design</h4>Twenty-two subjects (males = 11 and females = 11, 26 ± 6 years) completed 4 weeks of NY (<i>n</i> = 11) or HY (<i>n</i> = 11, 41°C, 40% humidity). Yoga sessions were performed 3 times/week following a modified Bikram protocol.<h4>Subjects and methods</h4>Pre- and posttesting included (1) hemodynamic measures during a heat tolerance test and maximal aerobic fitness test; (2) neural and hormonal adaptations using serum brain-derived neurotrophic factor (BDNF) and adrenocorticotropic hormone (ACTH), along with a mental stress questionnaire; and (3) cellular adaptations (HSP70) in peripheral blood mononuclear cells (PBMCs).<h4>Statistical analysis</h4>Within- and between-group Student's <i>t</i>-test analyses were conducted to compare pre- and post-VO<sub>2</sub> max, perceived stress, BDNF, HSP70, and ACTH in HY and NY groups.<h4>Results</h4>Maximal aerobic fitness increased in the HY group only. No evidence of heat acclimation or change in mental stress was observed. Serum BDNF significantly increased in yoga groups combined. Analysis of HSP70 suggested higher expression of HSP70 in the HY group only.<h4>Conclusions</h4>Twelve sessions of HY promoted cardiovascular fitness and cellular thermotolerance adaptations. Serum BDNF increased in response to yoga (NY + HY) and appeared to not be temperature dependent.

Also flagged:COVID-19-19ARCH
Journal Article 2021-05-10 No Snippets Salisu AA, Obiora K.
Show Full Abstract

This study examines the hedging effectiveness of financial innovations against crude oil investment risks, both before and during the COVID-19 pandemic. We focus on the non-energy exchange traded funds (ETFs) as proxies for financial innovations given the potential positive correlation between energy variants and crude oil proxies. We employ a multivariate volatility modeling framework that accounts for important statistical features of the non-energy ETFs and oil price series in the computation of optimal weights and optimal hedging ratios. Results show evidence of hedging effectiveness for the financial innovations against oil market risks, with higher hedging performance observed during the pandemic. Overall, we show that sectoral financial innovations provide resilient investment options. Therefore, we propose that including the ETFs in an investment portfolio containing oil could improve risk-adjusted returns, especially in similar financial crisis as witnessed during the pandemic. In essence, our results are useful for investors in the global oil market seeking to maximize risk-adjusted returns when making investment decisions. Moreover, by exploring the role of structural breaks in the multivariate volatility framework, our attempts at establishing robustness for the results reveal that ignoring the same may lead to wrong conclusions about the hedging effectiveness.

Authorea Preprints 2021-05-10 Preprint (No Snippets API) Diamandis DC, Papadopoulos A, Honda R, Balaskas A, David S.
Show Full Abstract

H63D syndrome is a phenotype of a homozygous mutation of the HFE gene H63D, which is otherwise known to cause at most mild classical hemochromatosis. H63D syndrome leads to an iron overload in the body (especially in the brain, heart, liver, skin and male gonads) in the form of non-transferrin bound iron (NTBI) poisoning. Hallmark symptoms and causal factor for H63D syndrome is a mild hypotransferrinemia with transferrin saturation values >50%. H63D syndrome is an incurable multi-organ disease, leading to permanent disability. Our objective was to detect the prevalence of narcolepsy and narcolepsy with cataplexy in patients with H63D syndrome.

Also flagged:PCOSdegranulationcell adhesioncell activationblood coagulationhemostasis
Journal Article 2021-05-09 No Snippets Yu Y, Tan P, Zhuang Z, Wang Z, Zhu L, Qiu R, Xu H.
Show Full Abstract

<h4>Background</h4>The aim of this study was to apply proteomic methodology for the analysis of proteome changes in women with polycystic ovary syndrome (PCOS).<h4>Material and methods</h4>All the participators including 31 PCOS patients and 31 healthy female as controls were recruited, the clinical characteristics data was recorded at the time of recruitment, the laboratory biochemical data was detected. Then, a data-independent acquisition (DIA)-based proteomics method was performed to compare the serum protein changes between PCOS patients and controls. In addition, Western blotting was used to validate the expression of identified proteomic biomarkers.<h4>Results</h4>There were 80 proteins differentially expressed between PCOS patients and controls significantly, including 54 downregulated and 26 upregulated proteins. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analysis showed that downregulated proteins were enriched in platelet degranulation, cell adhesion, cell activation, blood coagulation, hemostasis, defense response and inflammatory response terms; upregulated proteins were enriched in cofactor catabolic process, hydrogen peroxide catabolic process, antioxidant activity, cellular oxidant detoxification, cellular detoxification, antibiotic catabolic process and hydrogen peroxide metabolic process. Receiver operating characteristic curves analysis showed that the area under curve of Histone H4 (H4), Histone H2A (H2A), Trem-like transcript 1 protein (TLT-1) were all over than 0.9, indicated promising diagnosis values of these proteins. Western blotting results proved that the detected significant proteins, including H4, H2A, TLT-1, Peroxiredoxin-1, Band 3 anion transport protein were all differently expressed in PCOS and control groups significantly.<h4>Conclusion</h4>These proteomic biomarkers provided the potentiality to help us understand PCOS better, but future studies comparing systemic expression and exact role of these candidate biomarkers in PCOS are essential for confirmation of this hypothesis.

Also flagged:obesitybehavioralMC4RBDNFFTOTMEM18
Journal Article 2021-05-09 ✓ 2 Snippets Rana S, Sultana A, Bhatti AA.
In-Text Gene Mentions

The five key obesity-associated genetic variants namely MC4R rs17782313, BDNF rs6265, FTO rs1421085, TMEM18 rs7561317, and NEGR1 rs2815752 were genotyped using the TaqMan allelic discrimination assays.

…TMEM18 rs7561317, andNEGR1rs2815752 were genotyped…

Show Full Abstract

The studies investigating gene-gene and gene-environment (or gene-behavior) interactions provide valuable insight into the pathomechanisms underlying obese phenotypes. The Pakistani population due to its unique characteristics offers numerous advantages for conducting such studies. In this view, the current study was undertaken to examine the effects of gene-gene and gene-environment/behavior interactions on the risk of obesity in a sample of Pakistani population. A total of 578 adult participants including 290 overweight/obese cases and 288 normal-weight controls were involved. The five key obesity-associated genetic variants namely MC4R rs17782313, BDNF rs6265, FTO rs1421085, TMEM18 rs7561317, and NEGR1 rs2815752 were genotyped using the TaqMan allelic discrimination assays. The data related to behavioral factors, such as eating pattern, diet consciousness, the tendency toward fat-dense food (TFDF), sleep duration, sleep-wake cycle (SWC), shift work (SW), and physical activity levels were collected via a questionnaire. Gene-gene and gene-behavior interactions were analyzed by multifactor dimensionality reduction and linear regression, respectively. In our study, only TMEM18 rs7561317 was found to be significantly associated with anthropometric traits with no significant effect of gene-gene interactions were observed on obesity-related phenotypes. However, the genetic variants were found to interact with the behavioral factors to significantly influence various obesity-related anthropometric traits including BMI, waist circumference, hip circumference, waist-to-hip ratio, waist-to-height ratio, and percentage of body fat. In conclusion, the interaction between genetic architecture and behavior/environment determines the outcome of obesity-related anthropometric phenotypes. Thus, gene-environment/behavior interaction studies should be promoted to explore the risk of complex and multifactorial disorders, such as obesity.

Also flagged:cardiac hypertrophyheart failurepyrazinephenylephrineANPAMPK
Journal Article 2021-05-09 No Snippets Li XX, Zhang P, Yang Y, Wang JJ, Zheng YJ, Tan JL, Liu SY, Yan YM, Zhang YY, Cheng YX, Yang HT.
Show Full Abstract

Cardiac hypertrophy is a common adaptive response to a variety of stimuli, but prolonged hypertrophy leads to heart failure. Hence, discovery of agents treating cardiac hypertrophy is urgently needed. In the present study, we investigated the effects of QF84139, a newly synthesized pyrazine derivative, on cardiac hypertrophy and the underlying mechanisms. In neonatal rat cardiomyocytes (NRCMs), pretreatment with QF84139 (1-10 μM) concentration-dependently inhibited phenylephrine-induced hypertrophic responses characterized by fetal genes reactivation, increased ANP protein level and enlarged cardiomyocytes. In adult male mice, administration of QF84139 (5-90 mg·kg<sup>-1</sup>·d<sup>-1</sup>, i.p., for 2 weeks) dose-dependently reversed transverse aortic constriction (TAC)-induced cardiac hypertrophy displayed by cardiomyocyte size, left ventricular mass, heart weights, and reactivation of fetal genes. We further revealed that QF84139 selectively activated the AMPK signaling pathway without affecting the phosphorylation of CaMKIIδ, ERK1/2, AKT, PKCε, and P38 kinases in phenylephrine-treated NRCMs and in the hearts of TAC-treated mice. In NRCMs, QF84139 did not show additive effects with metformin on the AMPK activation, whereas the anti-hypertrophic effect of QF84139 was abolished by an AMPK inhibitor Compound C or knockdown of AMPKα2. In AMPKα2-deficient mice, the anti-hypertrophic effect of QF84139 was also vanished. These results demonstrate that QF84139 attenuates the PE- and TAC-induced cardiac hypertrophy via activating the AMPK signaling. This structurally novel compound would be a promising lead compound for developing effective agents for the treatment of cardiac hypertrophy.

Also flagged:Huntington diseaseHDautosomal dominant neurodegenerative diseasecytosineadenosineguanine
Journal Article 2021-05-09 ✓ 4 Snippets Chuang CL, Demontis F.
In-Text Gene Mentions

Huntington disease (HD) is an autosomal dominant neurodegenerative disease that is caused by expansion of cytosine/adenosine/guanine repeats in the huntingtin (HTT) gene, which leads to a toxic, aggregation-prone, mutant HTT-polyQ protein.

…in the huntingtin (HTT) gene, which leads…

…response to mutantHTTactivity in peripheral…

HTT

Show Full Abstract

Huntington disease (HD) is an autosomal dominant neurodegenerative disease that is caused by expansion of cytosine/adenosine/guanine repeats in the huntingtin (HTT) gene, which leads to a toxic, aggregation-prone, mutant HTT-polyQ protein. Beyond the well-established mechanisms of HD progression in the central nervous system, growing evidence indicates that also peripheral tissues are affected in HD and that systemic signaling originating from peripheral tissues can influence the progression of HD in the brain. Herein, we review the systemic manifestation of HD in peripheral tissues, and the impact of systemic signaling on HD pathogenesis. Mutant HTT induces a body wasting syndrome (cachexia) primarily via its activity in skeletal muscle, bone, adipose tissue, and heart. Additional whole-organism effects induced by mutant HTT include decline in systemic metabolic homeostasis, which stems from derangement of pancreas, liver, gut, hypothalamic-pituitary-adrenal axis, and circadian functions. In addition to spreading via the bloodstream and a leaky blood brain barrier, HTT-polyQ may travel long distance via its uptake by neurons and its axonal transport from the peripheral to the central nervous system. Lastly, signaling factors that are produced and/or secreted in response to therapeutic interventions such as exercise or in response to mutant HTT activity in peripheral tissues may impact HD. In summary, these studies indicate that HD is a systemic disease that is influenced by intertissue signaling and by the action of pathogenic HTT in peripheral tissues. We propose that treatment strategies for HD should include the amelioration of HD symptoms in peripheral tissues. Moreover, harnessing signaling between peripheral tissues and the brain may provide a means for reducing HD progression in the central nervous system.

Also flagged:liver diseasechronic hepatitis Balcoholic liver diseaseNASHfibrosischronic liver disease
Journal Article 2021-05-09 ✓ 1 Snippet Laroia ST, Vellore Srinivasan S, Yadav K, Rastogi A, Kumar S, Kumar G, Kumar M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Purpose</h4>To assess the performance of shear wave ultrasound elastography (SWE) for non-invasive grading of fibrosis in normal BMI patients with varied aetiology chronic liver disease.<h4>Method</h4>Prospective SWE liver and spleen stiffness (LS, SS respectively) of 124 patients (94 men, mean age 45.4 ± 12.4 years, mean BMI 19.66 ± 1.49) with CLD of mixed aetiology, who underwent liver biopsy, between January 2019-20 was analysed using receiver operating curve (ROC) and classification analysis regression tree (CART) to determine fibrosis cut-off values and nominal logistical regression to quantify fibrosis.<h4>Results</h4>Of 124 patients, 50 (40%) had non-alcoholic steatohepatitis (NASH), 31 (25%) chronic hepatitis B (CHB) and 43 (35%) alcoholic liver disease (ALD) on biopsy. Overall mean LS and SS of the study population was 11.81 ± 5.9 and 16.88 ± 10.8 kPa, respectively. LS cut-off value <8 kPa was consistent with F0, 9-14 kPa for F1-F2 and >14.9 kPa for F3-F4 fibrosis on biopsy. On application of CART, LS value < 5.3 kPa was discriminative for NASH, 5.32 to <12.64 kPa for CHB, >12.64 kPa for ALD, SS <15.3 kPa was discriminative for NASH, 15.3-30 kPa for CHB and >30 kPa for ALD in our study population.<h4>Conclusion</h4>SWE is a viable non-invasive tool for assessment of liver fibrosis grading in a population of mixed aetiology CLD. LS values <i>in conjunction with</i> SS are promising predictors of F2-F3 fibrosis with <i>potential to discriminate</i> select categories like CHB and NASH in such a population.

Also flagged:FGF2Gene Expressionfibroblast growth factor 2CNN1VAV3CAP
Journal Article 2021-05-09 No Snippets Li J, Wang H, Dong C, Huang J, Ma W.
Show Full Abstract

<h4>Introduction</h4>The purpose of this study was to explore the regulatory mechanisms of FGF2 in carotid atherosclerotic plaque development using bioinformatics analysis.<h4>Material and methods</h4>Expression profiles of 32 atheroma plaque (AP) and 32 paired distant macroscopically intact (DMI) tissues samples in the GSE43292 dataset were downloaded from the Gene Expression Omnibus database. Following identification of differential expression genes (DEGs), correlation analysis of fibroblast growth factor 2 (FGF2) and DEGs was conducted. Subsequently, functional enrichment analysis and the protein-protein interaction network for FGF2 significantly correlated DEGs were constructed. Then, microRNAs (miRNAs) that regulated FGF2 and regulatory pairs of long noncoding RNA (lncRNA)-miRNA were predicted to construct the lncRNA-miRNA-FGF2 network.<h4>Results</h4>A total of 101 DEGs between AP and DMI samples were identified, and 31 DEGs were analyzed to have coexpression relationships with FGF2, including 23 positively correlated and 8 negatively correlated DEGs. VAV3 had the lowest r value among all FGF2 negatively correlated DEGs. FGF2 positively correlated DEGs were closely related to "regulation of smooth muscle contraction" (e.g., calponin 1 (CNN1)), while FGF2 negatively correlated DEGs were significantly associated with "platelet activation" (e.g., Vav guanine nucleotide exchange factor 3 (VAV3)). In addition, a total of 12 miRNAs that regulated FGF2 were predicted, and hsa-miR-15a-5p and hsa-miR-16-5p were highlighted in the lncRNA-miRNA-FGF2 regulatory network.<h4>Conclusions</h4>CNN1 might cooperate with FGF2 to regulate smooth muscle contractility during CAP formation. VAV3 might cooperate with FGF2 to be responsible for the development of CAP through participating in platelet activation. Hsa-miR-15a-5p and hsa-miR-16-5p might participate in the development of CAP via regulating FGF2.

Also flagged:peripheral nerve injurysciatic nerve injurywound healingphosphatasebindingMAPK
Journal Article 2021-05-08 No Snippets Zhang Y, Zhu Z, Liu X, Xu S, Zhang Y, Xu Y, He B.
Show Full Abstract

The regulatory role of lncRNAs in the early stage post peripheral nerve injury (PNI) is not yet clear. In this study, next-generation sequencing was used to perform deep sequencing on normal sciatic nerves (control) and lesional tissues derived on the 4th (D4) and 7th days (D7) after sciatic nerve injury in rats. Time-point unique differentially expressed lncRNAs (DElncRNAs) were analyzed for functional enrichment. The results showed that 776 DElncRNAs were unique to D4, and their functions were mainly enriched in wound healing, phosphatase binding and MAPK signaling pathways; 317 DElncRNAs were unique to D7, and their functions were mainly enriched in ion transmembrane transporter channel activity; 579 DElncRNAs were shared by these two days, and their functions were mainly enriched in axongenesis, the PI3K-Akt signaling pathway and cell cycle. Furthermore, lncRNA-mRNA interaction networks were constructed in functions or pathways with a high enrichment rate. Finally, 3 mRNAs and 4 lncRNAs in the axongenesis interaction network were selected, and their expression levels were verified by RT-qPCR. This study preliminarily revealed the regulatory role of lncRNAs at different time points in the early stage post PNI, which provides potential targets for basic research and clinical treatment of PNI.

Also flagged:sugarsugarstype 1 diabetesdiabeteslipidwater
Journal Article 2021-05-08 No Snippets Sylvetsky AC, Moore HR, Kaidbey JH, Halberg SE, Cogen FR, DiPietro L, Elmi A, Goran MI, Streisand R.
Show Full Abstract

<h4>Background</h4>Low-calorie sweeteners (LCSs) provide sweetness without sugar or calories and are used to replace added sugars by many children with type 1 diabetes (T1D). However, the role of LCSs in diabetes management and cardiometabolic health is unclear.<h4>Objective</h4>The Diabetes Research in Kids Study (DRINK-T1D) aims to investigate effects of LCS restriction on glycemic variability, visceral adiposity, lipid profiles, and systemic inflammation among children 6-12 years old with T1D.<h4>Methods</h4>Children with T1D, who report habitual consumption of foods and beverages containing LCSs, are recruited from the Washington Nationals Diabetes Care Complex (DCC) at Children's National Hospital (CNH) in Washington, DC. Following a phone screening and two-week run-in period involving continuation of usual LCS intake, children are randomized to 12 weeks of LCS restriction (replacement of diet beverages with still or sparkling water and avoidance of other sources of LCSs) or continued usual LCS intake (control). The primary outcome is the difference in change in glycemic variability in the LCS restriction group versus the control group. Change in glycemic variability will be assessed as the difference in daily average time-in-range (TIR), measured using continuous glucose monitoring (CGM) during two weeks at the end of the 12-week intervention, compared with during the two-week run-in period prior to randomization. Participants also complete a variety of anthropometric, metabolic, dietary, and behavioral assessments throughout the 14-week study.<h4>Conclusions</h4>DRINK-T1D is an innovative, randomized controlled trial, evaluating effects of LCS restriction on glycemic variability and cardiometabolic health in children with T1D. Findings of DRINK-T1D will support or challenge the common practice of recommending LCS use in this patient population and will have clinically relevant implications for pediatric T1D management.<h4>Trial registration</h4>ClinicalTrials.gov Identifier NCT04385888.

Also flagged:HYPmetabolismprotein synthesislocomotionoxygenlipid
Journal Article 2021-05-08 ✓ 1 Snippet Naya-Català F, Martos-Sitcha JA, de Las Heras V, Simó-Mirabet P, Calduch-Giner JÀ, Pérez-Sánchez J.
In-Text Gene Mentions

…Among others, theactivator of basal transcription 1of basal transcription…

Show Full Abstract

On-growing juveniles of gilthead sea bream were acclimated for 45 days to mild-hypoxia (M-HYP, 40-60% O<sub>2</sub> saturation), whereas normoxic fish (85-90% O<sub>2</sub> saturation) constituted two different groups, depending on if they were fed to visual satiety (control fish) or pair-fed to M-HYP fish. Following the hypoxia conditioning period, all fish were maintained in normoxia and continued to be fed until visual satiation for 3 weeks. The time course of hypoxia-induced changes was assessed by changes in blood metabolic landmarks and muscle transcriptomics before and after exhaustive exercise in a swim tunnel respirometer. In M-HYP fish, our results highlighted a higher contribution of aerobic metabolism to whole energy supply, shifting towards a higher anaerobic fitness following normoxia restoration. Despite these changes in substrate preference, M-HYP fish shared a persistent improvement in swimming performance with a higher critical speed at exercise exhaustion. The machinery of muscle contraction and protein synthesis and breakdown was also largely altered by mild-hypoxia conditioning, contributing this metabolic re-adjustment to the positive regulation of locomotion and to the catch-up growth response during the normoxia recovery period. Altogether, these results reinforce the presence of large phenotypic plasticity in gilthead sea bream, and highlights mild-hypoxia as a promising prophylactic measure to prepare these fish for predictable stressful events.

Also flagged:Hepatocellular carcinomacancerdeathliver cancertumourslipid
Journal Article 2021-05-08 ✓ 2 Snippets Sorop A, Constantinescu D, Cojocaru F, Dinischiotu A, Cucu D, Dima SO.
In-Text Gene Mentions

This mechanism was linked to the expression of the LRRC7 (Leucine-rich repeat-containing 7) gene involved in CTC reattachment and the reformation of tumour cell seeding.

The uptake of exosomes secreted by CTC cells greatly improved the migratory and invasive abilities of HCC cells, with miR-25-5p declared as the main target of LRRC7. Inhibition of exosomal miR-25-5p reversed these effects [96].

Show Full Abstract

Hepatocellular carcinoma (HCC) is the fifth most common cancer worldwide and the second most common cause of cancer-related death globally. This type of liver cancer is frequently detected at a late stage by current biomarkers because of the high clinical and biological heterogeneity of HCC tumours. From a plethora of molecules and cellular compounds, small nanoparticles with an endosomal origin are valuable cancer biomarkers or cargos for novel treatments. Despite their small sizes, in the range of 40-150 nm, these particles are delimited by a lipid bilayer membrane with a specific lipid composition and carry functional information-RNA, proteins, miRNAs, long non-coding RNAs (lncRNAs), or DNA fragments. This review summarizes the role of exosomal microRNA (miRNA) species as biomarkers in HCC therapy. After we briefly introduce the exosome biogenesis and the methods of isolation and characterization, we discuss miRNA's correlation with the diagnosis and prognosis of HCC, either as single miRNA species, or as specific panels with greater clinical impact. We also review the role of exosomal miRNAs in the tumourigenic process and in the cell communication pathways through the delivery of cargos, including proteins or specific drugs.

Also flagged:Skeletal disordersosteoporosismineralbone disorderschromosomecystathionine beta synthase
Journal Article 2021-05-08 ✓ 5 Snippets Jansen S, Baulain U, Habig C, Ramzan F, Schauer J, Schmitt AO, Scholz AM, Sharifi AR, Weigend A, Weigend S.
In-Text Gene Mentions

In addition to SOX6, the podocan gene (PODN) is another candidate that was associated with two traits, namely BBS and BMD of the humerus.

…GGA 5 (SOX6), GGA 8…

…and AX-76772658 (SOX6) were associated…

…and AX-76772658 (SOX6) ( Table…

…6 gene (SOX6), which encodes…

Show Full Abstract

Skeletal disorders, including fractures and osteoporosis, in laying hens cause major welfare and economic problems. Although genetics have been shown to play a key role in bone integrity, little is yet known about the underlying genetic architecture of the traits. This study aimed to identify genes associated with bone breaking strength and bone mineral density of the tibiotarsus and the humerus in laying hens. Potentially informative single nucleotide polymorphisms (SNP) were identified using Random Forests classification. We then searched for genes known to be related to bone stability in close proximity to the SNPs and identified 16 potential candidates. Some of them had human orthologues. Based on our findings, we can support the assumption that multiple genes determine bone strength, with each of them having a rather small effect, as illustrated by our SNP effect estimates. Furthermore, the enrichment analysis showed that some of these candidates are involved in metabolic pathways critical for bone integrity. In conclusion, the identified candidates represent genes that may play a role in the bone integrity of chickens. Although further studies are needed to determine causality, the genes reported here are promising in terms of alleviating bone disorders in laying hens.

Also flagged:anaemiaHbgestationmiscarriagemiscarriageschromosomal
Journal Article 2021-05-08 ✓ 1 Snippet Díaz-López A, Ribot B, Basora J, Arija V.
In-Text Gene Mentions

…unless they havehemochromatosis.…

Show Full Abstract

To evaluate whether women with anaemia or high haemoglobin (Hb) in early pregnancy would be at higher risk of miscarriage, this population-based cohort study involved 9453 women whose pregnancies were monitored at primary care centres between 2007 and 2012. The computerised clinical histories were used to collect: Hb measurements (up to 14 weeks of gestation), miscarriage before or by 24 weeks of gestation, and other maternal characteristics. The relation between anaemia (Hb < 110 g/L), normal Hb (110-140 g/L, reference), and high Hb concentrations (≥140 g/L) with miscarriage were expressed as adjusted OR with 95%CI. Restricted cubic spline models were applied to evaluate the dose-response relationships. A total of 520 (5.5%) women were recorded as having a miscarriage. The rate of miscarriage in anaemia, normal Hb, and high Hb concentrations was 8.4%, 5.1%, and 10.2%, respectively. Compared with women with normal Hb at the first trimester, the multivariable-adjusted OR for miscarriage was 2.11 (95%CI, 1.38-3.21) for women with anaemia and 1.83 (95%CI, 1.29-2.58) for women with high Hb. Hb concentrations showed a U-shaped association with miscarriage, with the lowest incidence among women with Hb of 120-130 g/L. These data highlight the importance of considering anaemia and high Hb levels in early pregnancy as harmful indicators for miscarriage.

Also flagged:strokeneurodegenerative diseasesaxonscell bodyaxonallipid
Journal Article 2021-05-08 No Snippets Hernaiz-Llorens M, Martínez-Mármol R, Roselló-Busquets C, Soriano E.
Show Full Abstract

Central nervous system damage caused by traumatic injuries, iatrogenicity due to surgical interventions, stroke and neurodegenerative diseases is one of the most prevalent reasons for physical disability worldwide. During development, axons must elongate from the neuronal cell body to contact their precise target cell and establish functional connections. However, the capacity of the adult nervous system to restore its functionality after injury is limited. Given the inefficacy of the nervous system to heal and regenerate after damage, new therapies are under investigation to enhance axonal regeneration. Axon guidance cues and receptors, as well as the molecular machinery activated after nervous system damage, are organized into lipid raft microdomains, a term typically used to describe nanoscale membrane domains enriched in cholesterol and glycosphingolipids that act as signaling platforms for certain transmembrane proteins. Here, we systematically review the most recent findings that link the stability of lipid rafts and their composition with the capacity of axons to regenerate and rebuild functional neural circuits after damage.

Also flagged:methyl alcoholsilicaMNPSrlartesunateESI
Journal Article 2021-05-07 ✓ 1 Snippet Botta L, Cesarini S, Zippilli C, Filippi S, Bizzarri BM, Baratto MC, Pogni R, Saladino R.
In-Text Gene Mentions

DCC

Show Full Abstract

A library of five hybrids and six dimers of dihydroartemisinin and artesunic acid has been synthetized in a stereo-controlled manner and evaluated for the anticancer activity against metastatic melanoma cell line (RPMI7951). Among novel derivatives, three artesunic acid dimers showed antimelanoma activity and cancer selectivity, being not toxic on normal human fibroblast (C3PV) cell line. Among the three dimers, the one bearing 4-hydroxybenzyl alcohol as a spacer showed no cytotoxic effect (CC<sub>50</sub> >300 μM) and high antimelanoma activity (IC<sub>50</sub> =0.05 μM), which was two orders of magnitude higher than that of parent artesunic acid, and of the same order of commercial drug paclitaxel. In addition, this dimer showed cancer-type selectivity towards melanoma compared to prostate (PC3) and breast (MDA-MB-231) tumors. The occurrence of a radical mechanism was hypothesized by DFO and EPR analyses. Qualitative structure activity relationships highlighted the role of artesunic acid scaffold in the control of toxicity and antimelanoma activity.

Also flagged:FKBP51FK506 binding protein 51FKBP52FKBP12macrocyclesbinding
Journal Article 2021-05-07 No Snippets Voll AM, Meyners C, Taubert MC, Bajaj T, Heymann T, Merz S, Charalampidou A, Kolos J, Purder PL, Geiger TM, Wessig P, Gassen NC, Bracher A, Hausch F.
Show Full Abstract

Subtype selectivity represents a challenge in many drug discovery campaigns. A typical example is the FK506 binding protein 51 (FKBP51), which has emerged as an attractive drug target. The most advanced FKBP51 ligands of the SAFit class are highly selective vs. FKBP52 but poorly discriminate against the homologs and off-targets FKBP12 and FKBP12.6. During a macrocyclization pilot study, we observed that many of these macrocyclic analogs have unanticipated and unprecedented preference for FKBP51 over FKBP12 and FKBP12.6. Structural studies revealed that these macrocycles bind with a new binding mode featuring a transient conformation, which is disfavored for the small FKBPs. Using a conformation-sensitive assay we show that this binding mode occurs in solution and is characteristic for this new class of compounds. The discovered macrocycles are non-immunosuppressive, engage FKBP51 in cells, and block the cellular effect of FKBP51 on IKKα. Our findings provide a new chemical scaffold for improved FKBP51 ligands and the structural basis for enhanced selectivity.

Also flagged:progressive diseaseCisplatinprostate cancerCancersolid tumorsALT
Journal Article 2021-05-07 ✓ 1 Snippet Kelley KC, Grossman KF, Brittain-Blankenship M, Thorne KM, Akerley WL, Terrazas MC, Kosak KM, Boucher KM, Buys SS, McGregor KA, Werner TL, Agarwal N, Weis JR, Sharma S, Ward JH, Kennedy TP, Sborov DW, Shami PJ.
In-Text Gene Mentions

…Wilson’s disease orhemochromatosiswere excluded as…

Show Full Abstract

<h4>Background</h4>Disulfiram and metals inactivate key oncoproteins resulting in anti-neoplastic activity. The goal of this study was to determine the maximum tolerated dose of copper when administered with disulfiram in patients with advanced solid tumors and liver involvement.<h4>Methods</h4>Disulfiram 250 mg was administered daily in 28-day cycles. Four doses of copper gluconate were tested (2, 4, 6, and 8 mg of elemental copper) in a standard 3 + 3 dose escalation design. Patients were evaluated for dose limiting toxicities and response. Protein S-glutathionylation was evaluated as a pharmacodynamic marker.<h4>Results</h4>Twenty-one patients were enrolled and 16 patients were evaluable for dose limiting toxicities. Among the 21 patients, there was a median of 4 lines of prior chemotherapy. Five Grade 3 toxicities were observed (anorexia, elevated aspartate aminotransferase or AST, elevated alkaline phosphatase, fever, and fatigue). Response data was available for 15 patients. Four patients had stable disease with the longest duration of disease control being 116 days. The median duration of treatment for evaluable patients was 55 days (range 28-124). Reasons for discontinuation included functional decline, disease progression, and disease-associated death. Increased S-glutathionylation of serum proteins was observed with treatment.<h4>Conclusion</h4>Disulfiram 250 mg daily with copper gluconate (8 mg of elemental copper) was well-tolerated in patients with solid tumors involving the liver and was not associated with dose limiting toxicities. While temporary disease stabilization was noted in some patients, no objective responses were observed. Treatment was associated with an increase in S-glutathionylation suggesting that this combination could exert a suppressive effect on cellular growth and protein function.<h4>Trial registration</h4>NCT00742911 , first posted 28/08/2008.

Also flagged:gliomatumorgliomasluciferaseVEGFAglioblastoma
Journal Article 2021-05-07 ✓ 1 Snippet Qi L, Wang W, Zhao G, Jiang H, Zhang Y, Zhao D, Jin H, Yu H, Xu H.
In-Text Gene Mentions

…B2M, GBP2, IRF1,TRIM38, HLA-G, OAS2, HLA-E,…

Show Full Abstract

Circular RNAs (circRNAs) are a group of noncoding RNAs derived from back-splicing events. CircRNA is reported to be involved in various tumor progressions, including glioma. Although there are a few reports of circular RNAs participating in gliomas, it is still unclear whether circular RNAs regulate the occurrence of gliomas. In our research, we found that the expression of circITGA7 in glioma tissues and glioma cells increased significantly. Knocking down circITGA7 can significantly inhibit the proliferation of glioma cells and reduce cell metastasis. Through analysis and dual-luciferase report assay, we found that circITGA7 acts as a sponge for miR-34a-5p targeting VEGFA in glioma. Our study showed that circITGA7 regulates the proliferation and metastasis of glioma cell lines (SW1783&U373) by regulating the miR-34a-5p/VEGFA pathway. In conclusion, our study revealed a regulatory loop for the circITGA7/miR-34a-5p/VEGFA axis to regulate glioma development.

Also flagged:primary breast cancermetastatic breast cancerHDAC3ABATGRIN1PLCB1
Journal Article 2021-05-07 ✓ 2 Snippets Mirsadeghi L, Haji Hosseini R, Banaei-Moghaddam AM, Kavousi K.
In-Text Gene Mentions

…TBL1XR1, SIRT4, KRAS,CACNA1E, PRKCG, GPS2, SIN3A,…

…is observed inCACNA1E, NCOR1, KDM6B, and…

Show Full Abstract

<h4>Background</h4>Today, there are a lot of markers on the prognosis and diagnosis of complex diseases such as primary breast cancer. However, our understanding of the drivers that influence cancer aggression is limited.<h4>Methods</h4>In this work, we study somatic mutation data consists of 450 metastatic breast tumor samples from cBio Cancer Genomics Portal. We use four software tools to extract features from this data. Then, an ensemble classifier (EC) learning algorithm called EARN (Ensemble of Artificial Neural Network, Random Forest, and non-linear Support Vector Machine) is proposed to evaluate plausible driver genes for metastatic breast cancer (MBCA). The decision-making strategy for the proposed ensemble machine is based on the aggregation of the predicted scores obtained from individual learning classifiers to be prioritized homo sapiens genes annotated as protein-coding from NCBI.<h4>Results</h4>This study is an attempt to focus on the findings in several aspects of MBCA prognosis and diagnosis. First, drivers and passengers predicted by SVM, ANN, RF, and EARN are introduced. Second, biological inferences of predictions are discussed based on gene set enrichment analysis. Third, statistical validation and comparison of all learning methods are performed by some evaluation metrics. Finally, the pathway enrichment analysis (PEA) using ReactomeFIVIz tool (FDR < 0.03) for the top 100 genes predicted by EARN leads us to propose a new gene set panel for MBCA. It includes HDAC3, ABAT, GRIN1, PLCB1, and KPNA2 as well as NCOR1, TBL1XR1, SIRT4, KRAS, CACNA1E, PRKCG, GPS2, SIN3A, ACTB, KDM6B, and PRMT1. Furthermore, we compare results for MBCA to other outputs regarding 983 primary tumor samples of breast invasive carcinoma (BRCA) obtained from the Cancer Genome Atlas (TCGA). The comparison between outputs shows that ROC-AUC reaches 99.24% using EARN for MBCA and 99.79% for BRCA. This statistical result is better than three individual classifiers in each case.<h4>Conclusions</h4>This research using an integrative approach assists precision oncologists to design compact targeted panels that eliminate the need for whole-genome/exome sequencing. The schematic representation of the proposed model is presented as the Graphic abstract.

Also flagged:NOX4pancreatic cancerendoplasmic reticulumpancreatic ductal adenocarcinomaPDACNADPH oxidase 4
Journal Article 2021-05-07 ✓ 3 Snippets Jain P, Dvorkin-Gheva A, Mollen E, Malbeteau L, Xie M, Jessa F, Dhavarasa P, Chung S, Brown KR, Jang GH, Vora P, Notta F, Moffat J, Hedley D, Boutros PC, Wouters BG, Koritzinsky M.
In-Text Gene Mentions

…with PRDX1 andPRDX6localized to the…

…of PRDX1 toPRDX6genes and their…

…Prdx5 , andPrdx6knockout mice raises…

Show Full Abstract

There is an urgent need to identify vulnerabilities in pancreatic ductal adenocarcinoma (PDAC). PDAC cells acquire metabolic changes that augment NADPH production and cytosolic redox homeostasis. Here, we show that high NADPH levels drive activity of NADPH oxidase 4 (NOX4) expressed in the endoplasmic reticulum (ER) membrane. NOX4 produces H<sub>2</sub>O<sub>2</sub> metabolized by peroxiredoxin 4 (PRDX4) in the ER lumen. Using functional genomics and subsequent in vitro and in vivo validations, we find that PDAC cell lines with high NADPH levels are dependent on PRDX4 for their growth and survival. PRDX4 addiction is associated with increased reactive oxygen species, a DNA-PKcs-governed DNA damage response and radiosensitivity, which can be rescued by depletion of NOX4 or NADPH. Hence, this study has identified NOX4 as a protein that paradoxically converts the reducing power of the cytosol to an ER-specific oxidative stress vulnerability in PDAC that may be therapeutically exploited by targeting PRDX4.

Also flagged:involucrinEpidermalIVLCas9IRF1NFIC
Journal Article 2021-05-07 No Snippets Mathyer ME, Brettmann EA, Schmidt AD, Goodwin ZA, Oh IY, Quiggle AM, Tycksen E, Ramakrishnan N, Matkovich SJ, Guttman-Yassky E, Edwards JR, de Guzman Strong C.
Show Full Abstract

The genetic modules that contribute to human evolution are poorly understood. Here we investigate positive selection in the Epidermal Differentiation Complex locus for skin barrier adaptation in diverse HapMap human populations (CEU, JPT/CHB, and YRI). Using Composite of Multiple Signals and iSAFE, we identify selective sweeps for LCE1A-SMCP and involucrin (IVL) haplotypes associated with human migration out-of-Africa, reaching near fixation in European populations. CEU-IVL is associated with increased IVL expression and a known epidermis-specific enhancer. CRISPR/Cas9 deletion of the orthologous mouse enhancer in vivo reveals a functional requirement for the enhancer to regulate Ivl expression in cis. Reporter assays confirm increased regulatory and additive enhancer effects of CEU-specific polymorphisms identified at predicted IRF1 and NFIC binding sites in the IVL enhancer (rs4845327) and its promoter (rs1854779). Together, our results identify a selective sweep for a cis regulatory module for CEU-IVL, highlighting human skin barrier evolution for increased IVL expression out-of-Africa.

Also flagged:behavioursCDKN1Agene expressionDOK7fitUBC
Journal Article 2021-05-07 ✓ 1 Snippet Abend M, Amundson SA, Badie C, Brzoska K, Hargitai R, Kriehuber R, Schüle S, Kis E, Ghandhi SA, Lumniczky K, Morton SR, O'Brien G, Oskamp D, Ostheim P, Siebenwirth C, Shuryak I, Szatmári T, Unverricht-Yeboah M, Ainsbury E, Bassinet C, Kulka U, Oestreicher U, Ristic Y, Trompier F, Wojcik A, Waldner L, Port M.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Large-scale radiation emergency scenarios involving protracted low dose rate radiation exposure (e.g. a hidden radioactive source in a train) necessitate the development of high throughput methods for providing rapid individual dose estimates. During the RENEB (Running the European Network of Biodosimetry) 2019 exercise, four EDTA-blood samples were exposed to an Iridium-192 source (1.36 TBq, Tech-Ops 880 Sentinal) at varying distances and geometries. This resulted in protracted doses ranging between 0.2 and 2.4 Gy using dose rates of 1.5-40 mGy/min and exposure times of 1 or 2.5 h. Blood samples were exposed in thermo bottles that maintained temperatures between 39 and 27.7 °C. After exposure, EDTA-blood samples were transferred into PAXGene tubes to preserve RNA. RNA was isolated in one laboratory and aliquots of four blinded RNA were sent to another five teams for dose estimation based on gene expression changes. Using an X-ray machine, samples for two calibration curves (first: constant dose rate of 8.3 mGy/min and 0.5-8 h varying exposure times; second: varying dose rates of 0.5-8.3 mGy/min and 4 h exposure time) were generated for distribution. Assays were run in each laboratory according to locally established protocols using either a microarray platform (one team) or quantitative real-time PCR (qRT-PCR, five teams). The qRT-PCR measurements were highly reproducible with coefficient of variation below 15% in ≥ 75% of measurements resulting in reported dose estimates ranging between 0 and 0.5 Gy in all samples and in all laboratories. Up to twofold reductions in RNA copy numbers per degree Celsius relative to 37 °C were observed. However, when irradiating independent samples equivalent to the blinded samples but increasing the combined exposure and incubation time to 4 h at 37 °C, expected gene expression changes corresponding to the absorbed doses were observed. Clearly, time and an optimal temperature of 37 °C must be allowed for the biological response to manifest as gene expression changes prior to running the gene expression assay. In conclusion, dose reconstructions based on gene expression measurements are highly reproducible across different techniques, protocols and laboratories. Even a radiation dose of 0.25 Gy protracted over 4 h (1 mGy/min) can be identified. These results demonstrate the importance of the incubation conditions and time span between radiation exposure and measurements of gene expression changes when using this method in a field exercise or real emergency situation.

Also flagged:UbiquitinCX-5461cancershomologous recombinationtumorsFanconi Anemia
Journal Article 2021-05-07 ✓ 4 Snippets Masud T, Soong C, Xu H, Biele J, Bjornson S, McKinney S, Aparicio S.
In-Text Gene Mentions

For MUS81 and MMS22L.3, only CX-5461-IC30 showed a consistent decrease in competitive fitness effect.

…of UBE2N, RNF168,MMS22Land MUS81 in…

…ure-specific endonuclease, andMMS22Lwhich localizes to…

…replication forks, asMMS22L-TONSL heterodimer, especially…

Show Full Abstract

CX-5461 is a G-quadruplex (G4) ligand currently in trials with initial indications of clinical activity in cancers with defects in homologous recombination repair. To identify more genetic defects that could sensitize tumors to CX-5461, we tested synthetic lethality for 480 DNA repair and genome maintenance genes to CX-5461, pyridostatin (PDS), a structurally unrelated G4-specific stabilizer, and BMH-21, which binds GC-rich DNA but not G4 structures. We identified multiple members of HRD, Fanconi Anemia pathways, and POLQ, a polymerase with a helicase domain important for G4 structure resolution. Significant synthetic lethality was observed with UBE2N and RNF168, key members of the DNA damage response associated ubiquitin signaling pathway. Loss-of-function of RNF168 and UBE2N resulted in significantly lower cell survival in the presence of CX-5461 and PDS but not BMH-21. RNF168 recruitment and histone ubiquitination increased with CX-5461 treatment, and nuclear ubiquitination response frequently co-localized with G4 structures. Pharmacological inhibition of UBE2N acted synergistically with CX-5461. In conclusion, we have uncovered novel genetic vulnerabilities to CX-5461 with potential significance for patient selection in future clinical trials.

Also flagged:secoxygenratTelComplex IVDAC
Journal Article 2021-05-07 ✓ 1 Snippet Jiang J, Giri T, Raghuraman N, Cahill AG, Palanisamy A.
In-Text Gene Mentions

…Prdx1, Prdx2, Prdx3,Prdx6, Sod1, Sod2, Sod3,…

Show Full Abstract

Use of maternal oxygen for intrauterine resuscitation is contentious because of the lack of evidence for its efficacy and the possibility of fetal harm through oxidative stress. Because the developing brain is rich in lipids and low in antioxidants, it remains vulnerable to oxidative stress. Here, we tested this hypothesis in a term pregnant rat model with oxytocin-induced fetal distress followed by treatment with either room air or 100% oxygen for 6 h. Fetal brains from both sexes were subjected to assays for biomarkers of oxidative stress (4-hydroxynonenal, protein carbonyl, or 8-hydroxy-2'-deoxyguanosine), expression of genes mediating oxidative stress, and mitochondrial oxidative phosphorylation. Contrary to our hypothesis, maternal hyperoxia was not associated with increased biomarkers of oxidative stress in the fetal brain. However, there was significant upregulation of the expression of select genes mediating oxidative stress, of which some were male-specific. These observations, however, were not accompanied by changes in the expression of proteins from the mitochondrial electron transport chain. In summary, maternal hyperoxia in the setting of acute uteroplacental ischemia-hypoxia does not appear to cause oxidative damage to the developing brain.

Also flagged:SLC37A4endoplasmic reticulummultitransmembrane proteinglucosephosphatasesglycogen storage disorder 1b
Journal Article 2021-05-07 ✓ 1 Snippet Ng BG, Sosicka P, Fenaille F, Harroche A, Vuillaumier-Barrot S, Porterfield M, Xia ZJ, Wagner S, Bamshad MJ, Vergnes-Boiteux MC, Cholet S, Dalton S, Dell A, Dupré T, Fiore M, Haslam SM, Huguenin Y, Kumagai T, Kulik M, McGoogan K, Michot C, Nickerson DA, Pascreau T, Borgel D, Raymond K, Warad D, University of Washington Center for Mendelian Genomics (UW-CMG), Flanagan-Steet H, Steet R, Tiemeyer M, Seta N, Bruneel A, Freeze HH.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

SLC37A4 encodes an endoplasmic reticulum (ER)-localized multitransmembrane protein required for transporting glucose-6-phosphate (Glc-6P) into the ER. Once transported into the ER, Glc-6P is subsequently hydrolyzed by tissue-specific phosphatases to glucose and inorganic phosphate during times of glucose depletion. Pathogenic variants in SLC37A4 cause an established recessive disorder known as glycogen storage disorder 1b characterized by liver and kidney dysfunction with neutropenia. We report seven individuals who presented with liver dysfunction multifactorial coagulation deficiency and cardiac issues and were heterozygous for the same variant, c.1267C>T (p.Arg423<sup>∗</sup>), in SLC37A4; the affected individuals were from four unrelated families. Serum samples from affected individuals showed profound accumulation of both high mannose and hybrid type N-glycans, while N-glycans in fibroblasts and undifferentiated iPSC were normal. Due to the liver-specific nature of this disorder, we generated a CRISPR base-edited hepatoma cell line harboring the c.1267C>T (p.Arg423<sup>∗</sup>) variant. These cells replicated the secreted abnormalities seen in serum N-glycosylation, and a portion of the mutant protein appears to relocate to a distinct, non-Golgi compartment, possibly ER exit sites. These cells also show a gene dosage-dependent alteration in the Golgi morphology and reduced intraluminal pH that may account for the altered glycosylation. In summary, we identify a recurrent mutation in SLC37A4 that causes a dominantly inherited congenital disorder of glycosylation characterized by coagulopathy and liver dysfunction with abnormal serum N-glycans.

Also flagged:Apolipoprotein E4COVID-19
Journal Article 2021-05-07 No Snippets Hubacek JA, Dlouha L, Dusek L, Majek O, Adamkova V.
Show Full Abstract

No abstract available.

Also flagged:glioblastomaGBMbrain tumoursgliomatumoursegmentation
Journal Article 2021-05-07 No Snippets Knobe S, Dzierma Y, Wenske M, Berdel C, Fleckenstein J, Melchior P, Palm J, Nuesken FG, Hunt A, Engwer C, Surulescu C, Yilmaz U, Reith W, Rübe C.
Show Full Abstract

Glioblastoma (GBM) is one of the most common primary brain tumours in adults, with a dismal prognosis despite aggressive multimodality treatment by a combination of surgery and adjuvant radiochemotherapy. A detailed knowledge of the spreading of glioma cells in the brain might allow for more targeted escalated radiotherapy, aiming to reduce locoregional relapse. Recent years have seen the development of a large variety of mathematical modelling approaches to predict glioma migration. The aim of this study is hence to evaluate the clinical applicability of a detailed micro- and meso-scale mathematical model in radiotherapy. First and foremost, a clinical workflow is established, in which the tumour is automatically segmented as input data and then followed in time mathematically based on the diffusion tensor imaging data. The influence of several free model parameters is individually evaluated, then the full model is retrospectively validated for a collective of 3 GBM patients treated at our institution by varying the most important model parameters to achieve optimum agreement with the tumour development during follow-up. Agreement of the model predictions with the real tumour growth as defined by manual contouring based on the follow-up MRI images is analyzed using the dice coefficient. The tumour evolution over 103-212 days follow-up could be predicted by the model with a dice coefficient better than 60% for all three patients. In all cases, the final tumour volume was overestimated by the model by a factor between 1.05 and 1.47. To evaluate the quality of the agreement between the model predictions and the ground truth, we must keep in mind that our gold standard relies on a single observer's (CB) manually-delineated tumour contours. We therefore decided to add a short validation of the stability and reliability of these contours by an inter-observer analysis including three other experienced radiation oncologists from our department. In total, a dice coefficient between 63% and 89% is achieved between the four different observers. Compared with this value, the model predictions (62-66%) perform reasonably well, given the fact that these tumour volumes were created based on the pre-operative segmentation and DTI.

Also flagged:GlucocorticoidsAndrogensimmune responseinfectioncancersteroid hormones
Journal Article 2021-05-07 ✓ 1 Snippet Busada JT, Peterson KN, Khadka S, Xu X, Oakley RH, Cook DN, Cidlowski JA.
In-Text Gene Mentions

Olfm4

Show Full Abstract

<h4>Background & aims</h4>The immune compartment is critical for maintaining tissue homeostasis. A weak immune response increases susceptibility to infection, but immune hyperactivation causes tissue damage, and chronic inflammation may lead to cancer development. In the stomach, inflammation damages the gastric glands and drives the development of potentially preneoplastic metaplasia. Glucocorticoids are potent anti-inflammatory steroid hormones that are required to suppress gastric inflammation and metaplasia. However, these hormones function differently in males and females. Here, we investigate the impact of sex on the regulation of gastric inflammation.<h4>Methods</h4>Endogenous glucocorticoids and male sex hormones were removed from mice using adrenalectomy and castration, respectively. Mice were treated with 5α-dihydrotestosterone (DHT) to test the effects of androgens on regulating gastric inflammation. Single-cell RNA sequencing of gastric leukocytes was used to identify the leukocyte populations that were the direct targets of androgen signaling. Type 2 innate lymphoid cells (ILC2s) were depleted by treatment with CD90.2 antibodies.<h4>Results</h4>We show that adrenalectomized female mice develop spontaneous gastric inflammation and spasmolytic polypeptide-expressing metaplasia (SPEM) but that the stomachs of adrenalectomized male mice remain quantitatively normal. Simultaneous depletion of glucocorticoids and sex hormones abolished the male-protective effects and triggered spontaneous pathogenic gastric inflammation and SPEM. Treatment of female mice with DHT prevented gastric inflammation and SPEM development when administered concurrent with adrenalectomy and also reversed the pathology when administered after disease onset. Single-cell RNAseq of gastric leukocytes revealed that ILC2s expressed abundant levels of both the glucocorticoid receptor (Gr) and androgen receptor (Ar). We demonstrated that DHT treatment potently suppressed the expression of the proinflammatory cytokines Il13 and Csf2 by ILC2s. Moreover, ILC2 depletion protected the stomach from SPEM development.<h4>Conclusions</h4>Here, we report a novel mechanism by which glucocorticoids and androgens exert overlapping effects to regulate gastric inflammation. Androgen signaling within ILC2s prevents their pathogenic activation by suppressing the transcription of proinflammatory cytokines. This work revealed a critical role for sex hormones in regulating gastric inflammation and metaplasia.

Also flagged:atopic dermatitisasthmaallergic rhinitiseosinophilic esophagitisallergic diseaseallergic diseases
Journal Article 2021-05-07 No Snippets Gabryszewski SJ, Hill DA.
Show Full Abstract

<h4>Objective</h4>The classical allergic march model posits that atopy begins in infancy with atopic dermatitis and progresses to asthma and allergic rhinitis in a subset of individuals. The growing prevalence and severity of allergic diseases have prompted renewed interest in refining this model. This review outlines epidemiologic evidence for the existence of allergic march trajectories (distinct paths of atopy development in individuals); reviews the roles that genetics, environment, and disease endotypes play in determining trajectory outcomes; and discusses the clinical utility of the trajectory model.<h4>Data sources</h4>PubMed search of English-language articles and reviews without date limits pertaining to the epidemiology, genetics, and immunologic mechanisms of allergic march trajectories and disease endotypes.<h4>Study selections</h4>Studies and reviews were selected based on their high quality and direct relevance to the review topic.<h4>Results</h4>Recent work in the field has revealed that immunoglobulin E-mediated food allergy and eosinophilic esophagitis are components of the allergic march. Furthermore, the field is acknowledging that variability exists in the number and sequence of allergic manifestations that individuals develop. These allergic march pathways, or trajectories, are influenced by genetic, environmental, and psychosocial factors that are incompletely understood.<h4>Conclusion</h4>Continued elucidation of the landscape and origins of allergic march trajectories will inform efforts to personalize allergic disease prevention, diagnosis, and treatment.

Also flagged:lung adenocarcinomaLUADCancerLung cancermalignant tumourstumour
Journal Article 2021-05-07 ✓ 3 Snippets Lin J, Lu S, Jiang Z, Hu C, Zhang Z.
In-Text Gene Mentions

CSE1L was correlated with overall survival in patients with hepatocellular carcinoma (Zhang et al., 2019c).

…+ (−0.4367*SPRY2) + (0.3850*CSE1L) + (−0.3940*ELAVL4) +…

CSE1Lwas correlated with…

Show Full Abstract

<h4>Background</h4>Individual mortality risk predicted curve at the individual level can provide valuable information for directing individual treatment decision. The present study attempted to explore potential post-transcriptional biological regulatory mechanism related with overall survival of lung adenocarcinoma (LUAD) patients through competitive endogenous RNA (ceRNA) network and develop two precision medicine predictive tools for predicting the individual mortality risk curves for overall survival of LUAD patients.<h4>Methods</h4>Multivariable Cox regression analyses were performed to explore the potential prognostic indicators, which were used to construct a prognostic model for overall survival of LUAD patients. Time-dependent receiver operating characteristic (ROC) curves were used to assess the predictive performance of prognostic model.<h4>Results</h4>There were 494 LUAD patients in model cohort and 233 LUAD patients in validation cohort. Differentially expressed mRNAs, miRNAs, and lncRNAs were identified between LUAD tissues and normal tissues. A ceRNA regulatory network was constructed on previous differentially expressed mRNAs, miRNAs, and lncRNAs. Fourteen mRNA biomarkers were identified as independent risk factors by multivariate Cox regression and used to develop a prognostic model for overall survival of LUAD patients. The C-indexes of prognostic model in model group were 0.786 (95% CI [0.744-0.828]), 0.736 (95% CI [0.694-0.778]) and 0.766 (95% CI [0.724-0.808]) for one year, two year and three year overall survival respectively. Two precision medicine predicted tools were developed for predicting individual mortality risk curves for LUAD patients.<h4>Conclusion</h4>The current study explored potential post-transcriptional biological regulatory mechanism and prognostic biomarkers for overall survival of LUAD patients. Two on-line precision medicine predictive tools were helpful to predict the individual mortality risk predicted curves for overall survival of LUAD patients. Smart Cancer Survival Predictive System could be used at https://zhangzhiqiao2.shinyapps.io/Smart_cancer_predictive_system_9_LUAD_E1002/.

Also flagged:inflammatory responseC-reactive proteinIL-2IL-6IL-10leukocytic elastase
Journal Article 2021-05-07 ✓ 1 Snippet Morozova A, Zorkina Y, Pavlov K, Pavlova O, Abramova O, Ushakova V, Mudrak AV, Zozulya S, Otman I, Sarmanova Z, Klyushnik T, Reznik A, Kostyuk G, Chekhonin V.
In-Text Gene Mentions

5-HTTis encoded by…

Show Full Abstract

We investigated the associations of <i>DRD3</i> rs6280, <i>HTR1A</i> rs6295, <i>BDNF</i> rs6265, <i>SCL6A4</i> rs16965628, and <i>5HT2A</i> rs7322347 with schizophrenia in a case-control study, and associations of these genetic variants with several clinical features. We also investigated markers of inflammatory response (C-reactive protein, IL-2, IL-6, IL-10), the activity of leukocytic elastase (LE) and α1-proteinase inhibitor (a1-PI), antibodies to S100B and myelin basic protein (MBP) in schizophrenia. Clinical symptoms were assessed on three scales: Positive and Negative Syndrome Scale, The Bush - Francis Catatonia Rating Scale and Frontal Assessment Battery. All SNPs were typed using predesigned TaqMan SNP genotyping assays. The biomarkers related to the immune system were routinely tested using ELISA kits. The association with schizophrenia was found for <i>DRD3</i> rs6280 (<i>p</i> = 0.05) and <i>HTR2A</i> rs7322347 (<i>p</i> = 0.0013). We found differences between groups by parameters of LE and a1-PI and LE/a1-PI (<i>p</i> < 0.001). And IL-6 was evaluated in the schizophrenia group (<i>p</i> < 0.001). We showed that patients with the TT allele (<i>BDNF</i> rs6265) had more severe impairments in frontal lobe function. a1-PI can serve as a marker for assessing the severity of frontal lobe damage in patients with frontal dementia. We found some biological parameters reflecting the severity of frontal dysfunction in schizophrenia.

Also flagged:Methylationglucoseinsulininsulin insufficiencydiabetesgene expression
Journal Article 2021-05-07 No Snippets Parveen N, Dhawan S.
Show Full Abstract

Pancreatic beta cells play a central role in regulating glucose homeostasis by secreting the hormone insulin. Failure of beta cells due to reduced function and mass and the resulting insulin insufficiency can drive the dysregulation of glycemic control, causing diabetes. Epigenetic regulation by DNA methylation is central to shaping the gene expression patterns that define the fully functional beta cell phenotype and regulate beta cell growth. Establishment of stage-specific DNA methylation guides beta cell differentiation during fetal development, while faithful restoration of these signatures during DNA replication ensures the maintenance of beta cell identity and function in postnatal life. Lineage-specific transcription factor networks interact with methylated DNA at specific genomic regions to enhance the regulatory specificity and ensure the stability of gene expression patterns. Recent genome-wide DNA methylation profiling studies comparing islets from diabetic and non-diabetic human subjects demonstrate the perturbation of beta cell DNA methylation patterns, corresponding to the dysregulation of gene expression associated with mature beta cell state in diabetes. This article will discuss the molecular underpinnings of shaping the islet DNA methylation landscape, its mechanistic role in the specification and maintenance of the functional beta cell phenotype, and its dysregulation in diabetes. We will also review recent advances in utilizing beta cell specific DNA methylation patterns for the development of biomarkers for diabetes, and targeting DNA methylation to develop translational approaches for supplementing the functional beta cell mass deficit in diabetes.

Also flagged:topdapigene expressionAcute graft-versus-host diseaseaGVHDribonucleic acid
Journal Article 2021-05-07 No Snippets Yu Z, Qin C, Cao M, He X, Ren H, Liu H.
Show Full Abstract

Acute graft-versus-host disease (aGVHD) remains a significant and severe complication of allogeneic hematopoietic stem cell transplantation (allo-HSCT). Due to the occurrence of aGVHD, allo-HSCT significantly increases the mortality rate compared with autologous hematopoietic stem cell transplantation (auto-HSCT). In this study, auto-HSCT and allo-HSCT aGVHD mouse models were built to detect the difference in CD4<sup>+</sup> lymphocyte in different tissues based on ribonucleic acid sequencing (RNA-Seq) analysis. Clustering analysis, functional annotation, and pathway enrichment analysis were performed on differentially expressed genes (DEGs). The protein-protein interaction (PPI) network was used to find hub genes. CD4<sup>+</sup>T cells were activated by MLR and cytokine stimulation. Cells were sorted out by a flow cell sorter. The selected genes were verified by qRT-PCR, histology, and immunofluorescence staining. The GSE126518 GEO dataset was used to verify the hub genes. Enrichment analysis revealed four immune-related pathways that play an important role in aGVHD, including immunoregulatory interactions between a lymphoid and a nonlymphoid cell, chemokine receptors binding chemokines, cytokine and cytokine receptor interaction, and the chemokine signaling pathway. At the same time, with the PPI network, 11 novel hub genes that were most likely to participate in immunoregulation in aGVHD were identified, which were further validated by qRT-PCR and the GSE126518 dataset. Besides, the protein expression level of Cxcl7 was consistent with the sequencing results. In summary, this study revealed that immunoregulation-related DEGs and pathways played a vital role in the onset of aGVHD. These findings may provide some new clues for probing the pathogenesis and treatment of aGVHD.

Also flagged:Gastric Cancercancerextracellulartyrosine kinase receptorsimmune responsemetabolism
Journal Article 2021-05-07 No Snippets Tutunchi S, Akhavan S, Bereimipour A, Hossein Ghaderian SM.
Show Full Abstract

Gastric cancer affects millions of people each year; it is the fifth deadliest cancer globally. Due to failure to perform routine tests such as endoscopy, it is usually diagnosed in the invasive stages. Therefore, finding diagnostic biomarkers in blood can help to speed up the initial diagnosis of cancer. This study aimed to find appropriate diagnostic biomarkers in the extracellular matrix of noninvasive to invasive stages of gastric cancer patients, using bioinformatics analysis. First, we selected the appropriate datasets from the GEO database. We evaluated the genes' signaling pathways, biological processes, and molecular functions. More accurately, we assessed the genes, in which their protein products are released into the extracellular matrix; we evaluated their protein network. Then, we validated the candidate proteins in the GEPIA and TCGA databases. The extracellular matrix, tyrosine kinase receptors, and immune response pathways are effective factors, which are related to the highly expressed genes and metabolism; cell cycle pathways are also impressive on low-expression genes. 69 highly expressed proteins are released into the extracellular matrix. After drawing the protein network, 5 proteins were selected as more suitable candidates for further studies. These proteins' expression significantly increases in the human samples, and the survival chart showed up to about 80% mortality in the individuals over time. With integrated bioinformatics analysis, BGN, LOX, MMP-9, SERPINE1, and TGFB1 proteins have been selected as suitable diagnostic biomarkers for noninvasive to invasive stages of gastric cancer. Further studies are needed to evaluate more precise mechanisms between these proteins.

Also flagged:Leukemialeukocyte cancercancerhomoharringtonineharringtoninealkaloids
Journal Article 2021-05-07 No Snippets Maher T, Ahmad Raus R, Daddiouaissa D, Ahmad F, Adzhar NS, Latif ES, Abdulhafiz F, Mohammed A.
Show Full Abstract

Leukemia is a leukocyte cancer that is characterized by anarchic growth of immature immune cells in the bone marrow, blood and spleen. There are many forms of leukemia, and the best course of therapy and the chance of a patient's survival depend on the type of leukemic disease. Different forms of drugs have been used to treat leukemia. Due to the adverse effects associated with such therapies and drug resistance, the search for safer and more effective drugs remains one of the most challenging areas of research. Thus, new therapeutic approaches are important to improving outcomes. Almost half of the drugs utilized nowadays in treating cancer are from natural products and their derivatives. Medicinal plants have proven to be an effective natural source of anti-leukemic drugs. The cytotoxicity and the mechanisms underlying the toxicity of these plants to leukemic cells and their isolated compounds were investigated. Effort has been made throughout this comprehensive review to highlight the recent developments and milestones achieved in leukemia therapies using plant-derived compounds and the crude extracts from various medicinal plants. Furthermore, the mechanisms of action of these plants are discussed.

Also flagged:BiocatalysisSynthesisbiopolymersBiosynthesispolysaccharidespeptides
Journal Article 2021-05-07 No Snippets Nikulin M, Švedas V.
Show Full Abstract

Trends in the dynamically developing application of biocatalysis for the synthesis and modification of polymers over the past 5 years are considered, with an emphasis on the production of biodegradable, biocompatible and functional polymeric materials oriented to medical applications. The possibilities of using enzymes not only as catalysts for polymerization but also for the preparation of monomers for polymerization or oligomers for block copolymerization are considered. Special attention is paid to the prospects and existing limitations of biocatalytic production of new synthetic biopolymers based on natural compounds and monomers from biomass, which can lead to a huge variety of functional biomaterials. The existing experience and perspectives for the integration of bio- and chemocatalysis in this area are discussed.

Also flagged:Epidermal Growth Factor Receptorreceptor tyrosine kinaseEGFRcancersignal transductionmelanoma
Journal Article 2021-05-07 ✓ 1 Snippet Monroe JD, Basheer F, Gibert Y.
In-Text Gene Mentions

PRDX6 is upregulated in human melanoma cells, increases cell proliferation by activating Src signaling via the production of arachidonic acid, and its expression depends on EGFR signaling [114].

Show Full Abstract

Studies conducted in several fish species, e.g., <i>Xiphophorus hellerii</i> (green swordtail) and <i>Xiphophorus</i> maculatus (southern platyfish) crosses, <i>Oryzias latipes</i> (medaka), and <i>Danio rerio</i> (zebrafish), have identified an oncogenic role for the receptor tyrosine kinase, Xmrk, a gene product closely related to the human epidermal growth factor receptor (EGFR), which is associated with a wide variety of pathological conditions, including cancer. Comparative analyses of Xmrk and EGFR signal transduction in melanoma have shown that both utilize STAT5 signaling to regulate apoptosis and cell proliferation, PI3K to modulate apoptosis, FAK to control migration, and the Ras/Raf/MEK/MAPK pathway to regulate cell survival, proliferation, and differentiation. Further, Xmrk and EGFR may also modulate similar chemokine, extracellular matrix, oxidative stress, and microRNA signaling pathways in melanoma. In hepatocellular carcinoma (HCC), Xmrk and EGFR signaling utilize STAT5 to regulate cell proliferation, and Xmrk may signal through PI3K and FasR to modulate apoptosis. At the same time, both activate the Ras/Raf/MEK/MAPK pathway to regulate cell proliferation and E-cadherin signaling. Xmrk models of melanoma have shown that inhibitors of PI3K and MEK have an anti-cancer effect, and in HCC, that the steroidal drug, adrenosterone, can prevent metastasis and recover E-cadherin expression, suggesting that fish Xmrk models can exploit similarities with EGFR signal transduction to identify and study new chemotherapeutic drugs.

Also flagged:Ferritinironiron deficiencyHyperferritinemialiver diseasesynthesis
Journal Article 2021-05-07 ✓ 5 Snippets Sandnes M, Ulvik RJ, Vorland M, Reikvam H.
In-Text Gene Mentions

Approximately 82–90% of clinical disease in Caucasian HH patients is related to homozygosity for the missense variant C282Y of the homeostatic iron regulator gene (HFE gene), referred to as hemochromatosis type 1 or HFE hemochromatosis [23,29,74,75].

While transferrin saturation measurements are far less requested in clinical practice compared to ferritin, it is highly relevant when suspecting HFE hemochromatosis, as combined elevations in ferritin and transferrin saturation have proven to be an easy and inexpensive screening for appropriate candidates for HFE genetic testing [31,76,116,117].

However, the additional finding of a raised transferrin saturation increases the likelihood of hyperferritinemia being related to HFE hemochromatosis, compared to that of an isolated ferritin >1000 μg/L in Caucasians.

…case definition forHFE hemochromatosishemochromatosis: C282Y homozyg…

…to other disease-associatedHFEgenotypes are, therefore,…

Show Full Abstract

Ferritin is one of the most frequently requested laboratory tests in primary and secondary care, and levels often deviate from reference ranges. Serving as an indirect marker for total body iron stores, low ferritin is highly specific for iron deficiency. Hyperferritinemia is, however, a non-specific finding, which is frequently overlooked in general practice. In routine medical practice, only 10% of cases are related to an iron overload, whilst the rest is seen as a result of acute phase reactions and reactive increases in ferritin due to underlying conditions. Differentiation of the presence or absence of an associated iron overload upon hyperferritinemia is essential, although often proves to be complex. In this review, we have performed a review of a selection of the literature based on the authors' own experiences and assessments in accordance with international recommendations and guidelines. We address the biology, etiology, and epidemiology of hyperferritinemia. Finally, an algorithm for the diagnostic workup and management of hyperferritinemia is proposed, and general principles regarding the treatment of iron overload are discussed.

Also flagged:Muscle EXcessMEX3AHNRNPKbindingE3 ligasecancers
Journal Article 2021-05-07 No Snippets Lederer M, Müller S, Glaß M, Bley N, Ihling C, Sinz A, Hüttelmaier S.
Show Full Abstract

MEX3A belongs to the MEX3 (Muscle EXcess) protein family consisting of four members (MEX3A-D) in humans. Characteristic for MEX3 proteins is their domain structure with 2 HNRNPK homology (KH) domains mediating RNA binding and a C-terminal really interesting new gene (RING) domain that harbors E3 ligase function. In agreement with their domain composition, MEX3 proteins were reported to modulate both RNA fate and protein ubiquitination. MEX3 paralogs exhibit an oncofetal expression pattern, they are severely downregulated postnatally, and re-expression is observed in various malignancies. Enforced expression of MEX3 proteins in various cancers correlates with poor prognosis, emphasizing their oncogenic potential. The latter is supported by MEX3A's impact on proliferation, self-renewal as well as migration of tumor cells in vitro and tumor growth in xenograft studies.

Also flagged:Ironnon-transfusion dependent thalassemiaThalassemiaHAMPβ-globinα-globin
Journal Article 2021-05-07 ✓ 2 Snippets Bharadwaj N, Peyam S, Bhatia P, Bhatia A, Das R, Singh M, Bansal D, Trehan A, Jain R.
In-Text Gene Mentions

…and hemojuvelin (HFE).…

HFE

Show Full Abstract

Patients with non-transfusion dependent thalassemia (NTDT) develop variable degrees of iron overload. Possible genes which may be implicated in causing iron overload are hepcidin (<i>HAMP</i>) and hemojuvelin (<i>HFE</i>). There is variable data assessing the role of <i>c.-582Y A</i> > <i>G HAMP</i> gene and <i>H63D</i> hotspot in <i>HFE-1</i> gene in causing iron overload, while role of <i>HFE-2</i> gene is undetermined. Twenty-five patients with NTDT (≥ 10 years) were assessed for iron overload. Genetic analysis for β-globin, α-globin, <i>HAMP, HFE-2</i> and <i>C282Y</i> and <i>H63D</i> hotspots in <i>HFE-1</i> genes was performed. T2*MRI demonstrated elevated LIC in 48% patients. No mutations were detected in <i>HAMP</i> gene or <i>HFE-1</i> hotspots. Four single nucleotide variations (SNV) were detected in <i>HFE-2</i> gene in 4 (20%) patients, including a novel SNV, <i>p.Gln315Arg</i> in 2 patients in heterozygous state. This is a likely pathogenic mutation; however, in heterozygous state, it did not lead to iron overload. <i>HAMP</i> and <i>HFE-2</i> gene variations were infrequently seen in this pilot study, with no significant impact on iron overload. Presence of SNV <i>p.Gln315Arg</i>in <i>HFE-2</i> gene needs to be evaluated in larger sample sizes in our population to determine the incidence in homozygous state and its association with iron overload.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s12288-021-01442-9.

Also flagged:polyethylene glycol methyl ethermethacrylatestearic acidstearyl ethyl methacrylatedoxorubicintriple negative breast cancer
Journal Article 2021-05-07 No Snippets Sarkar P, Ghosh S, Saha R, Sarkar K.
Show Full Abstract

In this work, core-shell supramolecular assembly polymeric nano-architectures containing hydrophilic and hydrophobic segments were synthesized <i>via</i> reversible addition fragmentation chain transfer (RAFT) polymerization. Herein, polyethylene glycol methyl ether methacrylate (PEGMA), and stearic acid were used to synthesize the poly(PEGMA) homopolymer and stearyl ethyl methacrylate (SEMA), respectively. Then, PEGMA and SEMA were polymerized through controlled RAFT polymerization to obtain the final diblock copolymer, poly(PEGMA-<i>co</i>-SEMA) (BCP). Model anticancer drug, doxorubicin (DOX) was loaded on BCPs. Interestingly, efficient DOX release was observed at acidic pH, similar to the cancerous environment pH level. Significant cellular uptake of DOX loaded BCP50 (BCP50-DOX) was observed in MDA-MB-231 triple negative breast cancer cells and resulted in a 35 fold increase in anticancer activity against MDA MB-231 cells compared to free DOX. Scanning electron microscopy (SEM) imaging confirmed the apoptosis mediated cellular death. These core-shell supramolecular assembly polymeric nano-architectures may be an efficient anti-cancer drug delivery system in the future.

Research Square 2021-05-07 Preprint (No Snippets API) Lin X, Wang F, Liu J, Lin Y, Li L, Li Z, Pan J, Song Y, Chen C, Xu Q.
Show Full Abstract

<h4>Background: </h4> Stemness and chemoresistance contribute to cervical cancer recurrence and metastasis. It is meaningful to develop alternative targets for eliminating cancer stem cells (CSCs) properties, suppressing metastasis, and alleviating chemoresistance in cervical cancer. This study clarifies the role of CENPK in cervical cancer stemness and chemoresistance and its clinical significance in cancer progression. Methods Human cervical cancer cell lines, xenografts, and clinical samples were used for expression and functional analysis. CENPK expression in cervical cancer was analyzed by bioinformatics based on a microarray and TCGA database and immunohistochemistry based on 119 paraffin-embedded cervical cancer specimens and 35 paraffin-embedded adjacent normal tissues in a tissue chip. Results CENPK served as an oncogene by promoting CSCs properties, DNA damage repair, epithelial-mesenchymal transition and DNA replication, thus inducing cisplatin/carboplatin resistance, cell metastasis and proliferation in cervical cancer. Intriguingly, targeting CENPK markedly prolonged the survival time of cervical cancer-bearing mice, and improved chemotherapy sensitivity of cervical cancer cells in vivo . CENPK also interacted with tumor suppressor gene SOX6 to activate Wnt signaling and inactivate p53 signaling. CENPK modulated expression of key regulators in CSCs properties, DNA damage repair, epithelial-mesenchymal transition and DNA replication by disrupting SOX6-β-catenin interaction, promoting β-catenin expression and nuclear translocation, and facilitating SOX6-mediated p53 ubiquitination and nuclear export, thus stimulating cervical cancer stemness, chemoresistance, metastasis and proliferation by. Interestingly, the RAD21/SMC3 complex, downstream targets of β-catenin, enhanced CENPK transcription to form a positive regulatory circuit through Wnt signaling. Facilitation of Wnt signaling by iRhom2 further activated the CENPK/SOX6-β-catenin-RAD21/SMC3 loop and conferred cervical cancer progression, suggesting a Wnt-p53 pathway crosstalk. Importantly, CENPK was upregulated in cervical cancer, correlated with cancer recurrence, and independently predicted poor patient prognosis. Conclusions This work identifies CENPK as a prognostic indicator and highlights targeting of CENPK as a novel strategy in the treatment of cervical cancer.

Also flagged:CortFoscorticosteroneco-bindingmemoryCamk2a
Journal Article 2021-05-06 No Snippets Buurstede JC, van Weert LTCM, Colucci P, Gentenaar M, Viho EMG, Koorneef LL, Schoonderwoerd RA, Lanooij SD, Moustakas I, Balog J, Mei H, Kielbasa SM, Campolongo P, Roozendaal B, Meijer OC.
Show Full Abstract

Glucocorticoids enhance memory consolidation of emotionally arousing events via largely unknown molecular mechanisms. This glucocorticoid effect on the consolidation process also requires central noradrenergic neurotransmission. The intracellular pathways of these two stress mediators converge on two transcription factors: the glucocorticoid receptor (GR) and phosphorylated cAMP response element-binding protein (pCREB). We therefore investigated, in male rats, whether glucocorticoid effects on memory are associated with genomic interactions between the GR and pCREB in the hippocampus. In a two-by-two design, object exploration training or no training was combined with post-training administration of a memory-enhancing dose of corticosterone or vehicle. Genomic effects were studied by chromatin immunoprecipitation followed by sequencing (ChIP-seq) of GR and pCREB 45 min after training and transcriptome analysis after 3 hr. Corticosterone administration induced differential GR DNA-binding and regulation of target genes within the hippocampus, largely independent of training. Training alone did not result in long-term memory nor did it affect GR or pCREB DNA-binding and gene expression. No strong evidence was found for an interaction between GR and pCREB. Combination of the GR DNA-binding and transcriptome data identified a set of novel, likely direct, GR target genes that are candidate mediators of corticosterone effects on memory consolidation. Cell-specific expression of the identified target genes using single-cell expression data suggests that the effects of corticosterone reflect in part non-neuronal cells. Together, our data identified new GR targets associated with memory consolidation that reflect effects in both neuronal and non-neuronal cells.

Also flagged:coagulationfibrinolysisantithrombin IIIprothrombinthrombinHb
Journal Article 2021-05-06 ✓ 1 Snippet Ren C, Lu H, Xia H, Zhang J, Cao B, Wang Y, Lu D, Cao R.
In-Text Gene Mentions

…the values ofATIII, PT, APTT, TT,…

Show Full Abstract

<h4>Background</h4>Thrombotic complications following splenectomy have been documented. However, there has been sparse literature regarding thrombotic complications following splenic artery embolization (SAE).The objective of this study was to determine changes in coagulation and fibrinolysis and assess the thrombotic risk after SAE in patients with blunt splenic injury (BSI).<h4>Methods</h4>This study included 38 BSI patients who were hemodynamically stable on admission. SAE was performed if the splenic injury was classed as grade III or greater and had no requirement of immediate surgery. Platelet (PLT), fibrinogen (FIB), D-dimers (D-D), fibrinogen/fibrin degradation products (FDP), antithrombin III (AT III), prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT), hemoglobin (Hb), and hematocrit (Hct) were measured before SAE procedures and then 1d, 3d, and 7d after SAE.<h4>Results</h4>The technical success rate of SAE and the splenic salvage rate were 100%. There was no mortality. Compared with pre-SAE values, the levels of PLT, FIB, D-D, and FDP increased significantly at 3 days and 7 days after SAE (p < 0.05). However, AT III, PT, APTT, TT, Hb, and Hct showed no statistically significant difference at 1d, 3d, and 7d after SAE (p > 0.05).<h4>Conclusion</h4>Alterations in PLT and hemostatic parameters might contribute to the increased risk of thrombotic complications in BSI patients undergoing SAE. Thromboembolism following SAE should be considered and thrombotic prophylaxis should be recommended.

Also flagged:alcohol abuseanxietydepressionChronic Liver Diseaseliver diseasehepatocellular carcinoma
Journal Article 2021-05-06 ✓ 1 Snippet Fazekas C, Kniepeiss D, Arold N, Matzer F, Wagner-Skacel J, Schemmer P.
In-Text Gene Mentions

…us-associated liver cirrhosis,hemochromatosis, autoimmune-hepatitis, alpha-…

Show Full Abstract

<h4>Background</h4>Health-related quality of life (HrQoL) and workability are related parameters to measure success of therapy. Both have been insufficiently explored in patients after liver transplantation (LT). Particularly little is known about patients' attitude to return to work, employment status before LT, and how frequently there is any employment at any time after LT.<h4>Methods</h4>This is a single-center retrospective cohort study including 150 adult outpatients after LT. Liver transplantations had been performed between 1993 and 2018. The study was carried out from February to July 2018. The exclusion criteria were combined transplantations, positive screening for current alcohol abuse, and anxiety or depression. To evaluate HrQoL and fitness to work, the patients were tested using the Short Form 36, the Chronic Liver Disease Questionnaire, and the Work Ability Index.<h4>Key results</h4>The return rate of sufficiently filled-in questionnaires was 46.8% (66 patients). The mean age of patients was 59.9 years (SD=10.8), ranging from 25 to 78 years old. HrQoL was partly comparable to the normal population. Workability sum scores with a mean value of 31.61 (SD 9.79) suggested moderate workability at present. While only 28.8% of respondents were ever employed after LT, 45.5% currently wished to work or would have wished to work.<h4>Conclusions</h4>HRQL seems to be partly similar to population data, and subjective workability seems to be moderate in patients after LT. Despite a positive attitude to return to work in almost half of respondents, a lower rate of actual return to work was found in this study.

Also flagged:synthesishydroxyapatitemineralcathepsin KCtskbisphosphonate
Journal Article 2021-05-06 ✓ 1 Snippet Richard ET, Morinaga K, Zheng Y, Sundberg O, Hokugo A, Hui K, Zhou Y, Sasaki H, Kashemirov BA, Nishimura I, McKenna CE.
In-Text Gene Mentions

DCC

Show Full Abstract

We describe the design and synthesis of OFS-1, an Osteoadsorptive Fluorogenic Sentinel imaging probe that is adsorbed by hydroxyapatite (HAp) and bone mineral surfaces, where it generates an external fluorescent signal in response to osteoclast-secreted cathepsin K (Ctsk). The probe consists of a bone-anchoring bisphosphonate moiety connected to a Förster resonance energy transfer (FRET) internally quenched fluorescent (IQF) dye pair, linked by a Ctsk peptide substrate, GHPGGPQG. Key structural features contributing to the effectiveness of OFS-1 were defined by structure-activity relationship (SAR) and modeling studies comparing OFS-1 with two cognates, OFS-2 and OFS-3. In solution or when preadsorbed on HAp, OFS-1 exhibited strong fluorescence when exposed to Ctsk (2.5-20 nM). Time-lapse photomicrographs obtained after seeding human osteoclasts onto HAp-coated well plates containing preadsorbed OFS-1 revealed bright fluorescence at the periphery of resorbing cells. OFS-1 administered systemically detected early osteolysis colocalized with orthotopic engraftment of RPMI-8226-Luc human multiple myeloma cells at a metastatic skeletal site in a humanized mouse model. OFS-1 is thus a promising new imaging tool for detecting abnormal bone resorption.

Also flagged:ESR1schizophreniaDMPoddgene expressionneurodegenerative diseases
Journal Article 2021-05-06 No Snippets Guevara EE, Hopkins WD, Hof PR, Ely JJ, Bradley BJ, Sherwood CC.
Show Full Abstract

Identifying the molecular underpinnings of the neural specializations that underlie human cognitive and behavioral traits has long been of considerable interest. Much research on human-specific changes in gene expression and epigenetic marks has focused on the prefrontal cortex, a brain structure distinguished by its role in executive functions. The cerebellum shows expansion in great apes and is gaining increasing attention for its role in motor skills and cognitive processing, including language. However, relatively few molecular studies of the cerebellum in a comparative evolutionary context have been conducted. Here, we identify human-specific methylation in the lateral cerebellum relative to the dorsolateral prefrontal cortex, in a comparative study with chimpanzees (Pan troglodytes) and rhesus macaques (Macaca mulatta). Specifically, we profiled genome-wide methylation levels in the three species for each of the two brain structures and identified human-specific differentially methylated genomic regions unique to each structure. We further identified which differentially methylated regions (DMRs) overlap likely regulatory elements and determined whether associated genes show corresponding species differences in gene expression. We found greater human-specific methylation in the cerebellum than the dorsolateral prefrontal cortex, with differentially methylated regions overlapping genes involved in several conditions or processes relevant to human neurobiology, including synaptic plasticity, lipid metabolism, neuroinflammation and neurodegeneration, and neurodevelopment, including developmental disorders. Moreover, our results show some overlap with those of previous studies focused on the neocortex, indicating that such results may be common to multiple brain structures. These findings further our understanding of the cerebellum in human brain evolution.

Also flagged:neurodegenerative diseasesADgene expressionNeurodegenerative disorderneurodegenerative diseasedementia
Journal Article 2021-05-06 ✓ 2 Snippets Chowdhury UN, Ahmad S, Islam MB, Alyami SA, Quinn JMW, Eapen V, Moni MA.
In-Text Gene Mentions

Both HD and SMA are entirely monogenic conditions caused by a mutation in the huntingtin gene (HTT) [22] and the SMN1 gene [23] respectively.

…the huntingtin gene (HTT) [ 22 ]…

Show Full Abstract

Alzheimer's disease (AD) is the commonest progressive neurodegenerative condition in humans, and is currently incurable. A wide spectrum of comorbidities, including other neurodegenerative diseases, are frequently associated with AD. How AD interacts with those comorbidities can be examined by analysing gene expression patterns in affected tissues using bioinformatics tools. We surveyed public data repositories for available gene expression data on tissue from AD subjects and from people affected by neurodegenerative diseases that are often found as comorbidities with AD. We then utilized large set of gene expression data, cell-related data and other public resources through an analytical process to identify functional disease links. This process incorporated gene set enrichment analysis and utilized semantic similarity to give proximity measures. We identified genes with abnormal expressions that were common to AD and its comorbidities, as well as shared gene ontology terms and molecular pathways. Our methodological pipeline was implemented in the R platform as an open-source package and available at the following link: https://github.com/unchowdhury/AD_comorbidity. The pipeline was thus able to identify factors and pathways that may constitute functional links between AD and these common comorbidities by which they affect each others development and progression. This pipeline can also be useful to identify key pathological factors and therapeutic targets for other diseases and disease interactions.

Also flagged:fitmemoryCrownHarpcognitive impairmentAlzheimer dementia
Journal Article 2021-05-06 ✓ 1 Snippet Calderón C, Beyle C, Véliz-García O, Bekios-Calfa J.
In-Text Gene Mentions

…the validity ofACE-IIIand its adaptation…

Show Full Abstract

The Addenbrooke's Cognitive Examination III is one of the most widely used tests to assess cognitive impairment. Although previous studies have shown adequate levels of diagnostic utility to detect severe impairment, it has not shown sensitivity to detect mild decline. The aim of this study was to evaluate the psychometric properties of Addenbrooke's Cognitive Examination III in a large sample of elderly people through Item Response Theory, due to the lack of studies using this approach. A cross-sectional study was conducted with 1164 people from the age of 60 upwards, of which 63 had a prior diagnosis of Alzheimer dementia. The results showed that, globally, the Addenbrooke's Cognitive Examination III possesses adequate psychometrics properties. Furthermore, the information function test shows that the subscales have different sensitivity to different levels of impairment. These results can contribute to determining patterns of cognitive deterioration for the adequate detection of different levels of dementia. An optimized version is suggested which may be an economic alternative in the applied field.

Also flagged:SrfGAPDHairPik3r2Hras1Fn1
Journal Article 2021-05-06 ✓ 1 Snippet Chan LSA, Gu LC, Wells RA.
In-Text Gene Mentions

…leads to secondaryhemochromatosiswith significant pathophysiolo…

Show Full Abstract

<h4>Background</h4>Patients with myelodysplastic syndrome (MDS) require chronic red blood cell (RBC) transfusion due to anemia. Multiple RBC transfusions cause secondary iron overload and subsequent excessive generation of reactive oxygen species (ROS), which leads to mutations, cell death, organ failure, and inferior disease outcomes. We hypothesize that iron loading promotes AML development by increasing oxidative stress and disrupting important signaling pathways in the bone marrow cells (BMCs). Conversely, iron chelation therapy (ICT) may reduce AML risk by lowering iron burden in the iron-loaded animals.<h4>Methods</h4>We utilized a radiation-induced acute myeloid leukemia (RI-AML) animal model. Iron overload was introduced via intraperitoneal injection of iron dextran, and iron chelation via oral gavage of deferasirox. A total of 86 irradiated B6D2F1 mice with various levels of iron burden were monitored for leukemia development over a period of 70 weeks. The Kaplan-Meier estimator was utilized to assess AML free survival. In addition, a second cohort of 30 mice was assigned for early analysis at 5 and 7 months post-irradiation. The BMCs of the early cohort were assessed for alterations of signaling pathways, DNA damage response and gene expression. Statistical significance was established using Student's t-test or ANOVA.<h4>Results</h4>Iron loading in irradiated B6D2F1 mice accelerated RI-AML development. However, there was a progressive decrease in AML risk for irradiated mice with increase in iron burden from 7.5 to 15 to 30 mg. In addition, ICT decreased AML incidence in the 7.5 mg iron-loaded irradiated mice, while AML onset was earlier for the 30 mg iron-loaded irradiated mice that received ICT. Furthermore, analysis of BMCs from irradiated mice at earlier intervals revealed accelerated dysregulation of signaling pathways upon iron loading, while ICT partially mitigated the effects.<h4>Conclusions</h4>We concluded that iron is a promoter of leukemogenesis in vivo up to a peak iron dose, but further iron loading decreases AML risk by increasing cell death. ICT can partially mitigate the adverse effects of iron overload, and to maximize its benefit this intervention should be undertaken prior to the development of extreme iron overload.

Also flagged:MARCKSmyristoylated alanine-rich C-kinaseprotein kinase Cmembranecalmodulinphosphatidylinositol
Journal Article 2021-05-06 ✓ 1 Snippet Iyer DN, Faruq O, Zhang L, Rastgoo N, Liu A, Chang H.
In-Text Gene Mentions

Likewise, another cancer-associated pathway [79, 80] modulated by MARCKS is the Netrin-1 signaling through the Deleted in Colorectal Cancer (DCC) receptor [81].

Show Full Abstract

The myristoylated alanine-rich C-kinase substrate (MARCKS) protein has been at the crossroads of multiple signaling pathways that govern several critical operations in normal and malignant cellular physiology. Functioning as a target of protein kinase C, MARCKS shuttles between the phosphorylated cytosolic form and the unphosphorylated plasma membrane-bound states whilst regulating several molecular partners including, but not limited to calmodulin, actin, phosphatidylinositol-4,5-bisphosphate, and phosphoinositide-3-kinase. As a result of these interactions, MARCKS directly or indirectly modulates a host of cellular functions, primarily including cytoskeletal reorganization, membrane trafficking, cell secretion, inflammatory response, cell migration, and mitosis. Recent evidence indicates that dysregulated expression of MARCKS is associated with the development and progression of hematological cancers. While it is understood that MARCKS impacts the overall carcinogenesis as well as plays a part in determining the disease outcome in blood cancers, we are still at an early stage of interpreting the pathophysiological roles of MARCKS in neoplastic disease. The situation is further complicated by contradictory reports regarding the role of phosphorylated versus an unphosphorylated form of MARCKS as an oncogene versus tumor suppressor in blood cancers. In this review, we will investigate the current body of knowledge and evolving concepts of the physical properties, molecular network, functional attributes, and the likely pathogenic roles of MARCKS in hematological malignancies. Key emphasis will also be laid upon understanding the novel mechanisms by which MARCKS determines the overall disease prognosis by playing a vital role in the induction of therapeutic resistance. Additionally, we will highlight the importance of MARCKS as a valuable therapeutic target in blood cancers and will discuss the potential of existing strategies available to tackle MARCKS-driven blood cancers.

Also flagged:Tumortranscription factorspost-translational modificationscancergenetic diseasedeath
Journal Article 2021-05-06 ✓ 1 Snippet Tripathi A, Kashyap A, Tripathi G, Yadav J, Bibban R, Aggarwal N, Thakur K, Chhokar A, Jadli M, Sah AK, Verma Y, Zayed H, Husain A, Bharti AC, Kashyap MK.
In-Text Gene Mentions

…Siah2) interacts withDCC(deleted in colorectal…

Show Full Abstract

Reversion of tumor to a normal differentiated cell once considered a dream is now at the brink of becoming a reality. Different layers of molecules/events such as microRNAs, transcription factors, alternative RNA splicing, post-transcriptional, post-translational modifications, availability of proteomics, genomics editing tools, and chemical biology approaches gave hope to manipulation of cancer cells reversion to a normal cell phenotype as evidences are subtle but definitive. Regardless of the advancement, there is a long way to go, as customized techniques are required to be fine-tuned with precision to attain more insights into tumor reversion. Tumor regression models using available genome-editing methods, followed by in vitro and in vivo proteomics profiling techniques show early evidence. This review summarizes tumor reversion developments, present issues, and unaddressed challenges that remained in the uncharted territory to modulate cellular machinery for tumor reversion towards therapeutic purposes successfully. Ongoing research reaffirms the potential promises of understanding the mechanism of tumor reversion and required refinement that is warranted in vitro and in vivo models of tumor reversion, and the potential translation of these into cancer therapy. Furthermore, therapeutic compounds were reported to induce phenotypic changes in cancer cells into normal cells, which will contribute in understanding the mechanism of tumor reversion. Altogether, the efforts collectively suggest that tumor reversion will likely reveal a new wave of therapeutic discoveries that will significantly impact clinical practice in cancer therapy.

Also flagged:chromosomal regionsanapc2aladchp2chromosomeschromosome
Journal Article 2021-05-06 No Snippets López ME, Cádiz MI, Rondeau EB, Koop BF, Yáñez JM.
Show Full Abstract

Animal domestication and artificial selection give rise to gradual changes at the genomic level in populations. Subsequent footprints of selection, known as selection signatures or selective sweeps, have been traced in the genomes of many animal livestock species by exploiting variation in linkage disequilibrium patterns and/or reduction of genetic diversity. Domestication of most aquatic species is recent in comparison with land animals, and salmonids are one of the most important fish species in aquaculture. Coho salmon (Oncorhynchus kisutch), cultivated primarily in Chile, has been subjected to breeding programs to improve growth, disease resistance traits, and flesh color. This study aimed to identify selection signatures that may be involved in adaptation to culture conditions and traits of productive interest. To do so, individuals of two domestic populations cultured in Chile were genotyped with 200 thousand SNPs, and analyses were conducted using iHS, XP-EHH and CLR. Several signatures of selection on different chromosomal regions were detected across both populations. Some of the identified regions under selection contained genes such anapc2, alad, chp2 and myn, which have been previously associated with body weight in Atlantic salmon, or sec24d and robo1, which have been associated with resistance to Piscirickettsia salmonis in coho salmon. Findings in our study can contribute to an integrated genome-wide map of selection signatures, to help identify the genetic mechanisms of phenotypic diversity in coho salmon.

Also flagged:fartopperoxiredoxin 6Telperoxidasesperoxiredoxins
Journal Article 2021-05-06 ✓ 5 Snippets Chowhan RK, Hotumalani S, Rahaman H, Singh LR.
In-Text Gene Mentions

Prdx6

This peroxidase activity is mediated by a reduced cysteine residue (also referred to as peroxidatic Cys) that donates its electron to neutralize peroxide and then recycle back into its native form with the help of reductants like thioredoxin (Prdx1-5) and glutathione (Prdx6).

…Peroxiredoxin 6 (Prdx6), the ubiquitously expressed…

…two activities ofPrdx6are mutually exclusive…

…native states ofPrdx6at pH 7.0…

Show Full Abstract

Peroxiredoxin 6 (Prdx6), the ubiquitously expressed enzyme belonging to the family of peroxidases, namely, peroxiredoxins, exhibits a unique feature of functional compartmentalization within cells. Whereas, the enzyme localized in cytosol shows glutathione peroxidase activity, its lysosomal counterpart performs calcium independent phospholipase A2 (aiPLA2) activity. Like any true moonlighting protein, these two activities of Prdx6 are mutually exclusive of each other as a function of the pH of the cellular compartments. Differential substrate preference at different pH (i.e. peroxidised phospholipids at neutral pH and reduced phospholipids at acidic pH) is considered to be the reason for this behavior. To gain insight into the pH-induced structural-functional interplay we have systematically evaluated conformational variations, thermodynamic stability of the protein and quaternary state of the conformers at both pH 7.0 and 4.0. Our findings suggest that change in pH allows alterations in native states of Prdx6 at pH 7.0 and 4.0 such that the changes make the protein resistant to thermal denaturation at low pH.

Also flagged:major depressive disorderimmune dysregulationmetabolic syndromeinflammatory responseglycosylation-
Journal Article 2021-05-06 ✓ 1 Snippet Oommen AM, Cunningham S, O'Súilleabháin PS, Hughes BM, Joshi L.
In-Text Gene Mentions

…O -GlcNAcase) andB4GALT5(β-1,4-galactosyltransferase-5…

Show Full Abstract

In addition to the psychological depressive phenotype, major depressive disorder (MDD) patients are also associated with underlying immune dysregulation that correlates with metabolic syndrome prevalent in depressive patients. A robust integrative analysis of biological pathways underlying the dysregulated neural connectivity and systemic inflammatory response will provide implications in the development of effective strategies for the diagnosis, management and the alleviation of associated comorbidities. In the current study, focusing on MDD, we explored an integrative network analysis methodology to analyze transcriptomic data combined with the meta-analysis of biomarker data available throughout public databases and published scientific peer-reviewed articles. Detailed gene set enrichment analysis and complex protein-protein, gene regulatory and biochemical pathway analysis has been undertaken to identify the functional significance and potential biomarker utility of differentially regulated genes, proteins and metabolite markers. This integrative analysis method provides insights into the molecular mechanisms along with key glycosylation dysregulation underlying altered neutrophil-platelet activation and dysregulated neuronal survival maintenance and synaptic functioning. Highlighting the significant gap that exists in the current literature, the network analysis framework proposed reduces the impact of data gaps and permits the identification of key molecular signatures underlying complex disorders with multiple etiologies such as within MDD and presents multiple treatment options to address their molecular dysfunction.

Also flagged:C/EBPβMYBp300Transcription factor MYBacute myeloid leukemiaAML
Journal Article 2021-05-06 No Snippets Yusenko MV, Trentmann A, Casolari DA, Abdel Ghani L, Lenz M, Horn M, Dörner W, Klempnauer S, Mootz HD, Arteaga MF, Mikesch JH, D'Andrea RJ, Gonda TJ, Müller-Tidow C, Schmidt TJ, Klempnauer KH.
Show Full Abstract

Transcription factor MYB has recently emerged as a promising drug target for the treatment of acute myeloid leukemia (AML). Here, we have characterized a group of natural sesquiterpene lactones (STLs), previously shown to suppress MYB activity, for their potential to decrease AML cell proliferation. Unlike what was initially thought, these compounds inhibit MYB indirectly via its cooperation partner C/EBPβ. C/EBPβ-inhibitory STLs affect the expression of a large number of MYB-regulated genes, suggesting that the cooperation of MYB and C/EBPβ broadly shapes the transcriptional program of AML cells. We show that expression of GFI1, a direct MYB target gene, is controlled cooperatively by MYB, C/EBPβ, and co-activator p300, and is down-regulated by C/EBPβ-inhibitory STLs, exemplifying that they target the activity of composite MYB-C/EBPβ-p300 transcriptional modules. Ectopic expression of GFI1, a zinc-finger protein that is required for the maintenance of hematopoietic stem and progenitor cells, partially abrogated STL-induced myelomonocytic differentiation, implicating GFI1 as a relevant target of C/EBPβ-inhibitory STLs. Overall, our data identify C/EBPβ as a pro-leukemogenic factor in AML and suggest that targeting of C/EBPβ may have therapeutic potential against AML.

Also flagged:factor V Leidenhereditary disordersbreast cancertumorcancer
Journal Article 2021-05-06 ✓ 1 Snippet Scheuner MT, Douglas MP, Sales P, Ackerman SL, Phillips KA.
In-Text Gene Mentions

…factor V Leiden,HFEC282Y and H63D)…

Show Full Abstract

<h4>Purpose</h4>Germline testing laboratories have evolved over several decades. We describe laboratory business models and practices and explore their implications on germline testing availability and access.<h4>Methods</h4>We conducted semistructured interviews with key informants using purposive sampling. We interviewed 13 key informants representing 14 laboratories. We used triangulation and iterative data analysis to identify topics concerning laboratory business models and practices.<h4>Results</h4>We characterized laboratories as full-service (FSL), for-profit germline (PGL), and not-for-profit germline (NGL). Relying on existing payer contracts is a key characteristic of the FSL business models. FSLs focus on high-volume germline tests with evidence of clinical utility that have reimbursable codes. In comparison, a key business model characteristic of PGLs is direct patient billing facilitated by commodity-based pricing made possible by investors and industry partnerships. Client billing is a key business model characteristic of NGLs. Because many NGLs exist within academic settings, they are challenged by their inability to optimize laboratory processes and billing practices.<h4>Conclusion</h4>Continued availability of, and access to germline testing will depend on the financial success of laboratories; organizational characteristics of laboratories and payers; cultural factors, particularly consumer interest and trust; and societal factors, such as regulation and laws surrounding pricing and reimbursement.

Also flagged:nucleusPrader-Willi syndromeinflammatory responsesbraincancerbrain disorders
Journal Article 2021-05-06 ✓ 1 Snippet Huang WK, Wong SZH, Pather SR, Nguyen PTT, Zhang F, Zhang DY, Zhang Z, Lu L, Fang W, Chen L, Fernandes A, Su Y, Song H, Ming GL.
In-Text Gene Mentions

ABT1

Show Full Abstract

Human brain organoids represent remarkable platforms for recapitulating features of human brain development and diseases. Existing organoid models do not resolve fine brain subregions, such as different nuclei in the hypothalamus. We report the generation of arcuate organoids (ARCOs) from human induced pluripotent stem cells (iPSCs) to model the development of the human hypothalamic arcuate nucleus. Single-cell RNA sequencing of ARCOs revealed significant molecular heterogeneity underlying different arcuate cell types, and machine learning-aided analysis based on the neonatal human hypothalamus single-nucleus transcriptome further showed a human arcuate nucleus molecular signature. We also explored ARCOs generated from Prader-Willi syndrome (PWS) patient iPSCs. These organoids exhibit aberrant differentiation and transcriptomic dysregulation similar to postnatal hypothalamus of PWS patients, indicative of cellular differentiation deficits and exacerbated inflammatory responses. Thus, patient iPSC-derived ARCOs represent a promising experimental model for investigating nucleus-specific features and disease-relevant mechanisms during early human arcuate development.

Also flagged:Liver MetastasisColorectal Cancermalignant tumordeathproto-oncogenestumor
Journal Article 2021-05-06 No Snippets Zheng W, Wu F, Fu K, Sun G, Sun G, Li X, Jiang W, Cao H, Wang H, Tang W.
Show Full Abstract

Colorectal cancer is currently the third largest malignant tumor in the world, with high new cases and high mortality. Metastasis is one of the most common causes of death of colorectal cancer, of which liver metastasis is the most fatal. Since the beginning of the Human Genome Project in 2001, people have gradually recognized the 3 billion base pairs that make up the human genome, of which only about 1.5% of the nucleic acid sequences are used for protein coding, including proto-oncogenes and tumor suppressor genes. A large number of differences in the expression of proto-oncogenes and tumor suppressor genes have also been found in the study of colorectal cancer, which proves that they are also actively involved in the progression of colorectal cancer and promote the occurrence of liver metastasis. Except for 1.5% of the coding sequence, the rest of the nucleic acid sequence does not encode any protein, which is called non-coding RNA. With the deepening of research, genome sequences without protein coding potential that were originally considered "junk sequences" may have important biological functions. Many years of studies have found that a large number of abnormal expression of ncRNA in colorectal cancer liver metastasis, indicating that ncRNA plays an important role in it. To explore the role and mechanism of these coding sequences and non-coding RNA in liver metastasis of colorectal cancer is very important for the early diagnosis and treatment of liver metastasis of colorectal cancer. This article reviews the coding genes and ncRNA that have been found in the study of liver metastasis of colorectal cancer in recent years, as well as the mechanisms that have been identified or are still under study, as well as the clinical treatment of liver metastasis of colorectal cancer.

Also flagged:alcoholwound healingliver fibrosiscirrhosishepatocellular carcinomafibrosis
Journal Article 2021-05-06 No Snippets Acharya P, Chouhan K, Weiskirchen S, Weiskirchen R.
Show Full Abstract

The liver is a central organ in the human body, coordinating several key metabolic roles. The structure of the liver which consists of the distinctive arrangement of hepatocytes, hepatic sinusoids, the hepatic artery, portal vein and the central vein, is critical for its function. Due to its unique position in the human body, the liver interacts with components of circulation targeted for the rest of the body and in the process, it is exposed to a vast array of external agents such as dietary metabolites and compounds absorbed through the intestine, including alcohol and drugs, as well as pathogens. Some of these agents may result in injury to the cellular components of liver leading to the activation of the natural wound healing response of the body or fibrogenesis. Long-term injury to liver cells and consistent activation of the fibrogenic response can lead to liver fibrosis such as that seen in chronic alcoholics or clinically obese individuals. Unidentified fibrosis can evolve into more severe consequences over a period of time such as cirrhosis and hepatocellular carcinoma. It is well recognized now that in addition to external agents, genetic predisposition also plays a role in the development of liver fibrosis. An improved understanding of the cellular pathways of fibrosis can illuminate our understanding of this process, and uncover potential therapeutic targets. Here we summarized recent aspects in the understanding of relevant pathways, cellular and molecular drivers of hepatic fibrosis and discuss how this knowledge impact the therapy of respective disease.

Also flagged:Tumormetastatic melanomasmelanomaMalignant melanomaskin cancerscytotoxic T-lymphocyte antigen 4
Journal Article 2021-05-06 No Snippets Liu D, Yang X, Wu X.
Show Full Abstract

<h4>Background</h4>The tumor microenvironment (TME) involves infiltration of multiple immune cell subsets, which could influence the prognosis and clinical characteristics. The increasing evidence on the role of tumor-infiltrating lymphocytes (TILs) in primary and metastatic melanomas supports that the immune system is involved in the progression and outcomes of melanoma. However, the immune infiltration landscape in melanoma has not been systematically elucidated.<h4>Methods</h4>In this study, we used CIBERSORT and ESTIMATE algorithms to analyze immune infiltration pattern of 993 melanoma samples. Then we screened differential expression genes (DEGs) related to immune subtypes and survival. The immune cell infiltration (ICI) score was constructed by using principal-component analysis (PCA) based on immune signature genes from DGEs. Gene set enrichment analysis (GSEA) was applied to explore high and low ICI score related pathways. Finally, the predictive ability of ICI score was evaluated in survival prognosis and immunotherapy benefit.<h4>Result</h4>We identified three ICI clusters and three gene clusters associated with different immune subtypes and survival outcomes. Then the ICI score was constructed, and we found that high ICI score exhibited activated immune characteristics and better prognosis. High ICI score was significantly enriched in immune pathways and highly expressed immune signature genes. More importantly, we confirmed that melanoma patients with high ICI score had longer overall survival and rate of response to immunotherapy.<h4>Conclusion</h4>We presented a comprehensive immune infiltration landscape in melanoma. Our results will facilitate understanding of the melanoma tumor microenvironment and provide a new immune therapy strategy.

Also flagged:UbiquitinationBCL2localizationinfectionautophagydegradation
Journal Article 2021-05-06 No Snippets Castro-Gonzalez S, Simpson S, Shi Y, Chen Y, Benjamin J, Serra-Moreno R.
Show Full Abstract

Ubiquitination is a process that acts upon every step of the HIV replication cycle. The activity, subcellular localization, and stability of HIV dependency factors as well as negative modulators can be affected by ubiquitination. These modifications consequently have an impact on the progression and outcome of infection. Additionally, recent findings suggest new roles for ubiquitination in the interplay between HIV and the cellular environment, specifically in the interactions between HIV, autophagy and apoptosis. On one hand, autophagy is a defense mechanism against HIV that promotes the degradation of the viral protein Gag, likely through ubiquitination. Gag is an essential structural protein that drives virion assembly and release. Interestingly, the ubiquitination of Gag is vital for HIV replication. Hence, this post-translational modification in Gag represents a double-edged sword: necessary for virion biogenesis, but potentially detrimental under conditions of autophagy activation. On the other hand, HIV uses Nef to circumvent autophagy-mediated restriction by promoting the ubiquitination of the autophagy inhibitor BCL2 through Parkin/PRKN. Although the Nef-promoted ubiquitination of BCL2 occurs in both the endoplasmic reticulum (ER) and mitochondria, only ER-associated ubiquitinated BCL2 arrests the progression of autophagy. Importantly, both mitochondrial BCL2 and PRKN are tightly connected to mitochondrial function and apoptosis. Hence, by enhancing the PRKN-mediated ubiquitination of BCL2 at the mitochondria, HIV might promote apoptosis. Moreover, this effect of Nef might account for HIV-associated disorders. In this article, we outline our current knowledge and provide perspectives of how ubiquitination impacts the molecular interactions between HIV, autophagy and apoptosis.

Also flagged:GlycolysisPAMNUP155GOT2KDELR3PKM
Journal Article 2021-05-06 ✓ 1 Snippet Wang M, Jiang F, Wei K, Mao E, Yin G, Wu C.
In-Text Gene Mentions

…consumption of alcohol,hemochromatosis, or nonalcoholic fatty…

Show Full Abstract

<h4>Purpose</h4>As hepatocellular carcinoma (HCC) is a complex disease, it is hard to classify HCC with a specific biomarker. This study used data from TCGA to create a genetic signature for predicting the prognosis of HCC patients.<h4>Methods</h4>In a group of HCC patients (<i>n</i> = 424) from TCGA, mRNA profiling was carried out. To recognize gene sets that differed significantly between HCC and normal tissues, an enrichment study of genes was carried out. Cox relative hazard regression models have been used to identify genes that are significantly associated with overall survival. To test the function of a prognostic risk parameter, the following multivariate Cox regression analysis was used. The log-rank test and Kaplan-Meier survival estimates were used to test the significance of risk parameters for predictive prognoses.<h4>Results</h4>Eight genes have been identified as having a significant link to overall survival (PAM, NUP155, GOT2, KDELR3, PKM, NSDHL, ENO1, and SRD5A3). The 377 HCC patients were divided into eight-gene signature-based high/low-risk subgroups. The eight-gene signature's prognostic ability was unaffected by a number of factors.<h4>Conclusion</h4>To predict the survival of patients with HCC, an eight-gene signature associated with cellular glycolysis was then identified. The findings shed light on cellular glycolysis processes and the diagnosis of patients with low HCC prognoses.

Also flagged:Dentinogenesiscalcium-silicatedentin formationinflammatory responseCalcium silicateinflammatory responses
Journal Article 2021-05-06 No Snippets Andrei M, Vacaru RP, Coricovac A, Ilinca R, Didilescu AC, Demetrescu I.
Show Full Abstract

Dental pulp vitality is a desideratum for preserving the health and functionality of the tooth. In certain clinical situations that lead to pulp exposure, bioactive agents are used in direct pulp-capping procedures to stimulate the dentin-pulp complex and activate reparative dentinogenesis. Hydraulic calcium-silicate cements, derived from Portland cement, can induce the formation of a new dentin bridge at the interface between the biomaterial and the dental pulp. Odontoblasts are molecularly activated, and, if necessary, undifferentiated stem cells in the dental pulp can differentiate into odontoblasts. An extensive review of literature was conducted on MedLine/PubMed database to evaluate the histological outcomes of direct pulp capping with hydraulic calcium-silicate cements performed on animal models. Overall, irrespective of their physico-chemical properties and the molecular mechanisms involved in pulp healing, the effects of cements on tertiary dentin formation and pulp vitality preservation were positive. Histological examinations showed different degrees of dental pulp inflammatory response and complete/incomplete dentin bridge formation during the pulp healing process at different follow-up periods. Calcium silicate materials have the ability to induce reparative dentinogenesis when applied over exposed pulps, with different behaviors, as related to the animal model used, pulpal inflammatory responses, and quality of dentin bridges.

Also flagged:SYS1Shiga ToxinVero toxinglycosphingolipidglobotriaosylceramidedeath
Journal Article 2021-05-06 No Snippets Sakuma C, Sekizuka T, Kuroda M, Hanada K, Yamaji T.
Show Full Abstract

Shiga toxin (STx) or Vero toxin is a virulence factor produced by enterohemorrhagic <i>Escherichia coli</i>. The toxin binds to the glycosphingolipid globotriaosylceramide (Gb3) for its entry, and causes cell death by inhibiting ribosome function. Previously, we performed a loss-of-function screen in HeLa cells using a human CRISPR knockout (KO) library and identified various host genes required for STx-induced cell death. To determine whether this library targeted to the human genome is applicable to non-human primate cells and to identify previously unrecognized factors crucial for STx-induced cell death, we herein performed a similar screen in the African green monkey kidney-derived Vero C1008 subline. Many genes relevant to metabolic enzymes and membrane trafficking were enriched, although the number of enriched genes was less than that obtained in the screening for HeLa cells. Of note, several genes that had not been enriched in the previous screening were enriched: one of these genes was <i>SYS1</i>, which encodes a multi-spanning membrane protein in the Golgi apparatus. In <i>SYS1</i> KO Vero cells, expression of Gb3 and sphingomyelin was decreased, while that of glucosylceramide and lactosylceramide was increased. In addition, loss of <i>SYS1</i> inhibited the biosynthesis of protein glycans, deformed the Golgi apparatus, and perturbed the localization of <i>trans</i>-Golgi network protein (TGN) 46. These results indicate that the human CRISPR KO library is applicable to Vero cell lines, and SYS1 has a widespread effect on glycan biosynthesis via regulation of intra-Golgi and endosome-TGN retrograde transports.

Also flagged:CalciteHydroxyapatiteBiomineralizationmineralcrystalscalcium
Journal Article 2021-05-06 No Snippets Sorrentino A, Malucelli E, Rossi F, Cappadone C, Farruggia G, Moscheni C, Perez-Berna AJ, Conesa JJ, Colletti C, Roveri N, Pereiro E, Iotti S.
Show Full Abstract

Biomineralization is the process by which living organisms generate organized mineral crystals. In human cells, this phenomenon culminates with the formation of hydroxyapatite, which is a naturally occurring mineral form of calcium apatite. The mechanism that explains the genesis within the cell and the propagation of the mineral in the extracellular matrix still remains largely unexplained, and its characterization is highly controversial, especially in humans. In fact, up to now, biomineralization core knowledge has been provided by investigations on the advanced phases of this process. In this study, we characterize the contents of calcium depositions in human bone mesenchymal stem cells exposed to an osteogenic cocktail for 4 and 10 days using synchrotron-based cryo-soft-X-ray tomography and cryo-XANES microscopy. The reported results suggest crystalline calcite as a precursor of hydroxyapatite depositions within the cells in the biomineralization process. In particular, both calcite and hydroxyapatite were detected within the cell during the early phase of osteogenic differentiation. This striking finding may redefine most of the biomineralization models published so far, taking into account that they have been formulated using murine samples while studies in human cell lines are still scarce.

Also flagged:BiogenesisRNPmethylationadenineSNU13binding
Journal Article 2021-05-06 ✓ 1 Snippet Baldini L, Charpentier B, Labialle S.
In-Text Gene Mentions

…compaction by modulatingCondensinaccessibility [ 155…

Show Full Abstract

Box C/D small nucleolar RNAs (C/D snoRNAs) represent an ancient family of small non-coding RNAs that are classically viewed as housekeeping guides for the 2'-O-methylation of ribosomal RNA in Archaea and Eukaryotes. However, an extensive set of studies now argues that they are involved in mechanisms that go well beyond this function. Here, we present these pieces of evidence in light of the current comprehension of the molecular mechanisms that control C/D snoRNA expression and function. From this inventory emerges that an accurate description of these activities at a molecular level is required to let the snoRNA field enter in a second age of maturity.

Also flagged:Synthesisalkylarylisothiocyanatesisothiocyanateesters
Journal Article 2021-05-06 No Snippets Janczewski Ł, Kręgiel D, Kolesińska B.
Show Full Abstract

Thirty-three alkyl and aryl isothiocyanates, as well as isothiocyanate derivatives from esters of coded amino acids and from esters of unnatural amino acids (6-aminocaproic, 4-(aminomethyl)benzoic, and tranexamic acids), were synthesized with satisfactory or very good yields (25-97%). Synthesis was performed in a "one-pot", two-step procedure, in the presence of organic base (Et<sub>3</sub>N, DBU or NMM), and carbon disulfide via dithiocarbamates, with 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium toluene-4-sulfonate (DMT/NMM/TsO<sup>-</sup>) as a desulfurization reagent. For the synthesis of aliphatic and aromatic isothiocyanates, reactions were carried out in a microwave reactor, and selected alkyl isothiocyanates were also synthesized in aqueous medium with high yields (72-96%). Isothiocyanate derivatives of L- and D-amino acid methyl esters were synthesized, under conditions without microwave radiation assistance, with low racemization (er 99 > 1), and their absolute configuration was confirmed by circular dichroism. Isothiocyanate derivatives of natural and unnatural amino acids were evaluated for antibacterial activity on <i>E. coli</i> and <i>S. aureus</i> bacterial strains, where the most active was ITC <b>9e.</b>

Also flagged:NAFLDcardiovascular disordersC‐reactive proteinnonalcoholic fatty liver diseasehigh‐sensitivity C‐reactive proteinCRP
Journal Article 2021-05-06 ✓ 1 Snippet Soleimani D, Parisa Moosavian S, Zolfaghari H, Paknahad Z.
In-Text Gene Mentions

…stroke, heart failure,hemochromatosis, Wilson's disease, and…

Show Full Abstract

Based on the anti-inflammatory and antihypertensive properties of garlic, the current study was designed to evaluate the garlic powder effects on blood pressure and high-sensitivity C-reactive protein (hs-CRP) among Nonalcoholic Fatty Liver Disease patients (NAFLD). This randomized, double-blind, placebo-controlled trial study was conducted on 110 patients with NAFLD. The patients were randomly divided into 2 groups, receiving two tablets of either 400 mg garlic or placebo daily for 15 weeks. At baseline and the end of the study, blood pressure and hs-CRP were determined. Of 110 patients enrolled in the trial, 98 subjects were included in the final analysis. After the intervention, systolic blood pressures (SBP) (mean: -7.89; 95%CI:‒11.39 to -4.39 mm Hg), diastolic blood pressure (DBP) (mean: -5.38; 95%CI: -7.77 to -3 mm Hg), and Mean Arterial Pressure (MAP) (mean: -6:95%CI: -8.4 to -3.6 mm Hg) decreased significantly in the garlic group as compared to the placebo group. Also, the percentage of reduced hs-CRP was significantly higher in the intervention group compared with the control group (mean: -16.1; 95%CI: -32.7 to -0.53; <i>p</i> = .035). Moreover, a positive correlation was observed between the percentage change in hs-CRP and percentage changes in SBP (<i>r</i> = 0.221; <i>p</i> = .029), DBP (<i>r</i> = 0.166; <i>p</i> = .012), and MAP (<i>r</i> = 0.210; <i>p</i> = .038). Garlic supplementation can be a safe and potentially adjunct treatment to reduce blood pressure and the risk of cardiovascular disorders in patients with NAFLD.

Also flagged:kynurenic acidCAGhaemoglobinM22S103-hydroxykynurenine
Journal Article 2021-05-05 ✓ 1 Snippet Rodrigues FB, Byrne LM, Lowe AJ, Tortelli R, Heins M, Flik G, Johnson EB, De Vita E, Scahill RI, Giorgini F, Wild EJ.
In-Text Gene Mentions

…expansions in theHTTgene.…

Show Full Abstract

Converging lines of evidence from several models, and post-mortem human brain tissue studies, support the involvement of the kynurenine pathway (KP) in Huntington's disease (HD) pathogenesis. Quantifying KP metabolites in HD biofluids is desirable, both to study pathobiology and as a potential source of biomarkers to quantify pathway dysfunction and evaluate the biochemical impact of therapeutic interventions targeting its components. In a prospective single-site controlled cohort study with standardised collection of cerebrospinal fluid (CSF), blood, phenotypic and imaging data, we used high-performance liquid-chromatography to measure the levels of KP metabolites-tryptophan, kynurenine, kynurenic acid, 3-hydroxykynurenine, anthranilic acid and quinolinic acid-in CSF and plasma of 80 participants (20 healthy controls, 20 premanifest HD and 40 manifest HD). We investigated short-term stability, intergroup differences, associations with clinical and imaging measures and derived sample-size calculation for future studies. Overall, KP metabolites in CSF and plasma were stable over 6 weeks, displayed no significant group differences and were not associated with clinical or imaging measures. We conclude that the studied metabolites are readily and reliably quantifiable in both biofluids in controls and HD gene expansion carriers. However, we found little evidence to support a substantial derangement of the KP in HD, at least to the extent that it is reflected by the levels of the metabolites in patient-derived biofluids.

Also flagged:Peptidessodium tetraboratecarbonsynthesisTFA1001
Journal Article 2021-05-05 No Snippets Liu B, Beatty MA, Pappas CG, Liu K, Ottelé J, Otto S.
Show Full Abstract

Nature segregates fundamental tasks such as information storage/transmission and catalysis between two different compound classes (e.g. polynucleotides for replication and folded polyamides for catalysis). This division of labor is likely a product of evolution, raising the question of how simpler systems in which replicators and folded macromolecules co-exist may emerge in the transition from chemistry to biology. In synthetic systems, achieving co-existence of replicators and foldamers in a single molecular network remains an unsolved problem. Previous work on dynamic molecular networks has given rise to either self-replicating fibers or well-defined foldamer structures (or completely un-sorted complex systems). We report a system in which two cross-reactive dithiol (nucleobase- and peptide-based) building blocks self-sort into a replicator fiber and foldamer that both emerge spontaneously and co-exist. The self-sorting behavior remains prevalent across different building block ratios as two phases of emergence occur: replicator growth followed by foldamer formation. This is attributed to the autocatalytic formation of the replicator fiber, followed by enrichment of the system in the remaining building block, which is subsequently incorporated into a foldamer.

Also flagged:ironhereditary hemochromatosisHHProton-pumppolymaltosepantoprazole
Journal Article 2021-05-05 ✓ 1 Snippet Moris W, Verhaegh PLM, Verbeek J, Swinkels DW, Laarakkers CM, Masclee AAM, Koek GH, Deursen CTBMV.
In-Text Gene Mentions

…in patients withhemochromatosisand not in…

Show Full Abstract

Phlebotomies are performed in hereditary hemochromatosis (HH) to maintain normal iron concentrations. Proton-pump inhibitors (PPIs) can reduce the number of phlebotomies in patients with HH. However, in patients without HH, the iron concentrations do not appear to be compromised when using PPIs. Therefore, we aim to explain the differences in iron absorption between patients with and without HH. In 10 p.cysteine282tyrosine (p.C282Y) homozygous HH patients with normalized iron stores and 10 healthy control subjects (HCs), the iron parameters and hepcidin concentrations were determined before ingestion of a pharmacological dose of 50 mg iron [ferric iron (Fe<sup>3+</sup>)] polymaltose and hourly for 4 h afterward. This was repeated after 7 days of treatment with pantoprazole 40 mg once daily. Serum iron concentrations and transferrin saturation percentages dropped significantly during PPI use in the patients with HH, whereas no changes were observed in the HCs. Hepcidin concentrations were lower in the patients with HH compared with the HCs both before and during PPI use. In both groups, hepcidin levels did not significantly decrease during the treatment. Seven-day PPI use significantly reduces iron absorption in patients with HH but not in HCs. Changes in hepcidin concentrations could not explain these different PPI effects on iron absorption probably due to a small sample size.<b>NEW & NOTEWORTHY</b> This study confirms that lowering gastric acidity by proton pump inhibitors results in a reduction in iron absorption in patients with hemochromatosis and not in healthy control subjects. The presupposition that a decrease in hepcidin concentration in healthy control subjects in response to lowering gastric acidity can explain the difference in iron absorption between these groups could not be confirmed probably because of a small sample size.

Also flagged:Ribosomedegradationribosomesnucleotideamino acidspeptides
Journal Article 2021-05-05 ✓ 3 Snippets Morris C, Cluet D, Ricci EP.
In-Text Gene Mentions

…UPF1 recruitment toStau1in vitro indicates…

…UPF1 binding toStau1and its activation,…

…of UPF2 andStau1to bind UPF1…

Show Full Abstract

Eukaryotic gene expression is closely regulated by translation and turnover of mRNAs. Recent advances highlight the importance of translation in the control of mRNA degradation, both for aberrant and apparently normal mRNAs. During translation, the information contained in mRNAs is decoded by ribosomes, one codon at a time, and tRNAs, by specifically recognizing codons, translate the nucleotide code into amino acids. Such a decoding step does not process regularly, with various obstacles that can hinder ribosome progression, then leading to ribosome stalling or collisions. The progression of ribosomes is constantly monitored by the cell which has evolved several translation-dependent mRNA surveillance pathways, including nonsense-mediated decay (NMD), no-go decay (NGD), and non-stop decay (NSD), to degrade certain problematic mRNAs and the incomplete protein products. Recent progress in sequencing and ribosome profiling has made it possible to discover new mechanisms controlling ribosome dynamics, with numerous crosstalks between translation and mRNA decay. We discuss here various translation features critical for mRNA decay, with particular focus on current insights from the complexity of the genetic code and also the emerging role for the ribosome as a regulatory hub orchestrating mRNA decay, quality control, and stress signaling. Even if the interplay between mRNA translation and degradation is no longer to be demonstrated, a better understanding of their precise coordination is worthy of further investigation. This article is categorized under: RNA Turnover and Surveillance > Regulation of RNA Stability Translation > Translation Regulation RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes.

Also flagged:cognitionpsychiatric disordersbehavioralorganizationneuropsychiatric disordersaddiction
Journal Article 2021-05-05 ✓ 5 Snippets Klune CB, Jin B, DeNardo LA.
In-Text Gene Mentions

The magnitude of this innervation is dependent on the disrupted in colorectal cancer (DCC)/Netrin-1 axon guidance system and is vulnerable to disruption through early life drug exposure and psychiatric disease (Reynolds et al., 2018; Manitt et al., 2013; Reynolds et al., 2015).

Indeed, the rs2270954 polymorphism of the Dcc gene was found to be associated with schizophrenia (Grant et al., 2012).

As Cdh8, Cdh13, and Dcc/Netrin-1 have been linked to ASD, depression, and schizophrenia, investigating their role in wiring the healthy brain can provide important clues about how mPFC circuitry is perturbed in disease.

…to interact withDcc/Netrin-1 signaling to promote…

…the guidance cuesDcc/Netrin-1 regulate wiring of…

Show Full Abstract

The medial prefrontal cortex (mPFC) and its abundant connections with other brain regions play key roles in memory, cognition, decision making, social behaviors, and mood. Dysfunction in mPFC is implicated in psychiatric disorders in which these behaviors go awry. The prolonged maturation of mPFC likely enables complex behaviors to emerge, but also increases their vulnerability to disruption. Many foundational studies have characterized either mPFC synaptic or behavioral development without establishing connections between them. Here, we review this rich body of literature, aligning major events in mPFC development with the maturation of complex behaviors. We focus on emotional memory and cognitive flexibility, and highlight new work linking mPFC circuit disruption to alterations of these behaviors in disease models. We advance new hypotheses about the causal connections between mPFC synaptic development and behavioral maturation and propose research strategies to establish an integrated understanding of neural architecture and behavioral repertoires.

Also flagged:degradationaginglysosomeextracellularsynthesislysosomes
Journal Article 2021-05-05 No Snippets Yang C, Wang X.
Show Full Abstract

Lysosomes are degradation centers and signaling hubs in cells and play important roles in cellular homeostasis, development, and aging. Changes in lysosome function are essential to support cellular adaptation to multiple signals and stimuli. Therefore, lysosome biogenesis and activity are regulated by a wide variety of intra- and extracellular cues. Here, we summarize current knowledge of the regulatory mechanisms of lysosome biogenesis, including synthesis of lysosomal proteins and their delivery via the endosome-lysosome pathway, reformation of lysosomes from degradative vesicles, and transcriptional regulation of lysosomal genes. We survey the regulation of lysosome biogenesis in response to nutrient and nonnutrient signals, the cell cycle, stem cell quiescence, and cell fate determination. Finally, we discuss lysosome biogenesis and functions in the context of organismal development and aging.

Also flagged:colorectal adenomasCTGFYapulcerationcolorectal carcinomasTaz
Journal Article 2021-05-05 ✓ 5 Snippets Guillermin O, Angelis N, Sidor CM, Ridgway R, Baulies A, Kucharska A, Antas P, Rose MR, Cordero J, Sansom O, Li VSW, Thompson BJ.
In-Text Gene Mentions

…as Lgr5 andOlfm4(Bienz & Clevers,…

…such as Lgr5,Olfm4and Lyz —particularly…

…as Lgr5 andOlfm4are reduced in…

…as Lgr5 andOlfm4).…

…( Lgr5 ,Olfm4) or Paneth…

Show Full Abstract

Wnt signalling induces a gradient of stem/progenitor cell proliferation along the crypt-villus axis of the intestine, which becomes expanded during intestinal regeneration or tumour formation. The YAP transcriptional co-activator is known to be required for intestinal regeneration, but its mode of regulation remains controversial. Here we show that the YAP-TEAD transcription factor is a key downstream effector of Wnt signalling in the intestine. Loss of YAP activity by Yap/Taz conditional knockout results in sensitivity of crypt stem cells to apoptosis and reduced cell proliferation during regeneration. Gain of YAP activity by Lats1/2 conditional knockout is sufficient to drive a crypt hyperproliferation response. In particular, Wnt signalling acts transcriptionally to induce YAP and TEAD1/2/4 expression. YAP normally localises to the nucleus only in crypt base stem cells, but becomes nuclear in most intestinal epithelial cells during intestinal regeneration after irradiation, or during organoid growth, in a Src family kinase-dependent manner. YAP-driven crypt expansion during regeneration involves an elongation and flattening of the Wnt signalling gradient. Thus, Wnt and Src-YAP signals cooperate to drive intestinal regeneration.

Also flagged:gene expressionSox11axon growthbindingRNA binding proteinscell pluripotency
Journal Article 2021-05-05 ✓ 1 Snippet Ji S, Yang Z, Gozali L, Kenney T, Kocabas A, Jinsook Park C, Hynes M.
In-Text Gene Mentions

…as Nurr1 andDCC) at this…

Show Full Abstract

Mature mRNA molecules are expected to be comprised of a 5'UTR, a 3'UTR and a coding region (CDS). Unexpectedly, however, there have been multiple recent reports of widespread differential expression of mRNA 3'UTRs and their cognate coding regions (CDS), reflecting the expression of isolated 3'UTRs (i3'UTRs); these i3'UTRs can be highly expressed, often in reciprocal patterns to their cognate CDS. As with other long non-coding (lncRNAs), isolated 3'UTRs are likely to play an important role in gene regulation, but little is known about the contexts in which they are deployed. To illuminate the functions of i3'UTRs, here we carry out in vitro, in vivo and in silico analyses of differential 3'UTR/CDS mRNA ratio usage across tissues, development and cell state changes both for a select list of developmentally important genes as well as by unbiased transcriptome-wide analyses. Across two developmental paradigms we find a distinct switch from high i3'UTR expression for stem cell related genes in proliferating cells to high CDS for these genes in newly differentiated cells. Unbiased transcriptome analysis across multiple gene sets shows that regardless of tissue, genes with high 3'UTR to CDS ratios belong predominantly to gene ontology categories related to cell-type specific functions. In contrast, the gene ontology categories of genes with low 3'UTR to CDS ratios are similar across tissues and relate to common cellular functions. We further show that, at least for some genes, traditional transcriptional start site genomic elements correspond to identified RNAseq 3'UTR peak regions, suggesting that some i3'UTRs may be generated by de novo transcription. Our results provide critical information from which detailed hypotheses for individual i3'UTRs can be tested, with a common theme that i3'UTRs appear poised to regulate cell-specific gene expression and state.

Also flagged:cancercancersnon-small cell lung cancerNSCLCMalignant pleural mesotheliomaCTLA4
Journal Article 2021-05-05 ✓ 2 Snippets Gray SG.
In-Text Gene Mentions

Two of these BTN3A1 (CD277) and BTN3A3 (BTF3) are upregulated in MPM and high expression is associated with MPM OS (Table 5).

OX40 (TNFRSF4) and OX40L (TNFSF4) have been implicated in mesothelioma.

Show Full Abstract

<h4>Background</h4>The role of immunotherapy in cancer is now well-established, and therapeutic options such as checkpoint inhibitors are increasingly being approved in many cancers such as non-small cell lung cancer (NSCLC). Malignant pleural mesothelioma (MPM) is a rare orphan disease associated with prior exposure to asbestos, with a dismal prognosis. Evidence from clinical trials of checkpoint inhibitors in this rare disease, suggest that such therapies may play a role as a treatment option for a proportion of patients with this cancer.<h4>Main text</h4>While the majority of studies currently focus on the established checkpoint inhibitors (CTLA4 and PD1/PDL1), there are many other potential checkpoints that could also be targeted. In this review I provide a synopsis of current clinical trials of immunotherapies in MPM, explore potential candidate new avenues that may become future targets for immunotherapy and discuss aspects of immunotherapy that may affect the clinical outcomes of such therapies in this cancer.<h4>Conclusions</h4>The current situation regarding checkpoint inhibitors in the management of MPM whilst encouraging, despite impressive durable responses, immune checkpoint inhibitors do not provide a long-term benefit to the majority of patients with cancer. Additional studies are therefore required to further delineate and improve our understanding of both checkpoint inhibitors and the immune system in MPM. Moreover, many new potential checkpoints have yet to be studied for their therapeutic potential in MPM. All these plus the existing checkpoint inhibitors will require the development of new biomarkers for patient stratification, response and also for predicting or monitoring the emergence of resistance to these agents in MPM patients. Other potential therapeutic avenues such CAR-T therapy or treatments like oncolytic viruses or agents that target the interferon pathway designed to recruit more immune cells to the tumor also hold great promise in this hard to treat cancer.

Also flagged:myocardial infarctionWntMIwound healinginfarctionvWF
Journal Article 2021-05-05 ✓ 1 Snippet Zou B, Huang T, Wu D, Hu X, Xiao L, Wang C, Zhang H, Xiang J, Hu C, Wu Q, Wu T.
In-Text Gene Mentions

…lipoprotein coding geneZnfx1, is a long…

Show Full Abstract

Myocardial infarction (MI) is a big health threat in the world, and it is characterized by high morbidity and mortality. However, current treatments are not effective enough, and novel therapeutic strategies need to be explored. ZFAS1 has been proved to be involved in the regulation of MI, but the specific mechanism remains unclear. MI rats were constructed through left anterior descending artery ligation, and hypoxia cell model was also established. The proliferation, invasion, and migration of cells were detected via CCK8, traswell, and wound healing methods. Immunohistochemistry staining, western blotting, and qRT-PCR were used to detect the levels of molecules. Knockdown of ZFAS1 significantly increased the proliferation, migration, and invasion of cardiac fibroblasts. Knockdown of ZFAS1 remarkably improved cardiac function via decreasing infarction ratio and increasing vWF expression, left ventricular ejection fraction, and left ventricular fractional shortening compared with group MI. Knockdown of ZFAS1 also suppressed Wnt/β-catenin pathway <i>in vivo</i>. The inhibition of Wnt/β-catenin remarkably reversed the influence of shZFAS1 on cardiac function and cardiac fibroblasts viability. Therefore, Knockdown of ZFAS1 could improve the cardiac function of myocardial infarction rats via regulating Wnt/β-catenin signaling pathway. The present study might provide new thoughts for the prevention and treatment of MI damage.

Also flagged:transcription factorTranscription factorsTFKlf6neuriteNr5a2
Journal Article 2021-05-05 No Snippets Venkatesh I, Mehra V, Wang Z, Simpson MT, Eastwood E, Chakraborty A, Beine Z, Gross D, Cabahug M, Olson G, Blackmore MG.
Show Full Abstract

Transcription factors (TFs) act as powerful levers to regulate neural physiology and can be targeted to improve cellular responses to injury or disease. Because TFs often depend on cooperative activity, a major challenge is to identify and deploy optimal sets. Here we developed a bioinformatics pipeline, centered on TF co-occupancy of regulatory DNA, and used it to predict factors that potentiate the effects of pro-regenerative Klf6 in vitro. High content screens of neurite outgrowth identified cooperative activity by 12 candidates, and systematic testing in a mouse model of corticospinal tract (CST) damage substantiated three novel instances of pairwise cooperation. Combined Klf6 and Nr5a2 drove the strongest growth, and transcriptional profiling of CST neurons identified Klf6/Nr5a2-responsive gene networks involved in macromolecule biosynthesis and DNA repair. These data identify TF combinations that promote enhanced CST growth, clarify the transcriptional correlates, and provide a bioinformatics approach to detect TF cooperation.

Also flagged:localizationwatercitratebiotinriboflavinfolic acid
Journal Article 2021-05-05 No Snippets van Tatenhove-Pel RJ, de Groot DH, Bisseswar AS, Teusink B, Bachmann H.
Show Full Abstract

As natural selection acts on individual organisms the evolution of costly cooperation between microorganisms is an intriguing phenomenon. Introduction of spatial structure to privatize exchanged molecules can explain the evolution of cooperation. However, in many natural systems cells can also grow to low cell concentrations in the absence of these exchanged molecules, thus showing "cooperation-independent background growth". We here serially propagated a synthetic cross-feeding consortium of lactococci in the droplets of a water-in-oil emulsion, essentially mimicking group selection with varying founder population sizes. The results show that when the growth of cheaters completely depends on cooperators, cooperators outcompete cheaters. However, cheaters outcompete cooperators when they can independently grow to only ten percent of the consortium carrying capacity. This result is the consequence of a probabilistic effect, as low founder population sizes in droplets decrease the frequency of cooperator co-localization. Cooperator-enrichment can be recovered by increasing the founder population size in droplets to intermediate values. Together with mathematical modelling our results suggest that co-localization probabilities in a spatially structured environment leave a small window of opportunity for the evolution of cooperation between organisms that do not benefit from their cooperative trait when in isolation or form multispecies aggregates.

Also flagged:APT-1MCP 4SRCdefectsMCP 5CAB3
Journal Article 2021-05-05 ✓ 1 Snippet Cuveillier C, Boulan B, Ravanello C, Denarier E, Deloulme JC, Gory-Fauré S, Delphin C, Bosc C, Arnal I, Andrieux A.
In-Text Gene Mentions

HTT

Show Full Abstract

The development and function of the central nervous system rely on the microtubule (MT) and actin cytoskeletons and their respective effectors. Although the structural role of the cytoskeleton has long been acknowledged in neuronal morphology and activity, it was recently recognized to play the role of a signaling platform. Following this recognition, research into Microtubule Associated Proteins (MAPs) diversified. Indeed, historically, structural MAPs-including MAP1B, MAP2, Tau, and MAP6 (also known as STOP);-were identified and described as MT-binding and -stabilizing proteins. Extensive data obtained over the last 20 years indicated that these structural MAPs could also contribute to a variety of other molecular roles. Among multi-role MAPs, MAP6 provides a striking example illustrating the diverse molecular and cellular properties of MAPs and showing how their functional versatility contributes to the central nervous system. In this review, in addition to MAP6's effect on microtubules, we describe its impact on the actin cytoskeleton, on neuroreceptor homeostasis, and its involvement in signaling pathways governing neuron development and maturation. We also discuss its roles in synaptic plasticity, brain connectivity, and cognitive abilities, as well as the potential relationships between the integrated brain functions of MAP6 and its molecular activities. In parallel, the Collapsin Response Mediator Proteins (CRMPs) are presented as examples of how other proteins, not initially identified as MAPs, fall into the broader MAP family. These proteins bind MTs as well as exhibiting molecular and cellular properties very similar to MAP6. Finally, we briefly summarize the multiple similarities between other classical structural MAPs and MAP6 or CRMPs.In summary, this review revisits the molecular properties and the cellular and neuronal roles of the classical MAPs, broadening our definition of what constitutes a MAP.

Also flagged:Polr2aCell morphogenesisactinMBNLCell substrate junctionENS
Journal Article 2021-05-05 ✓ 1 Snippet González-Barriga A, Lallemant L, Dincã DM, Braz SO, Polvèche H, Magneron P, Pionneau C, Huguet-Lachon A, Claude JB, Chhuon C, Guerrera IC, Bourgeois CF, Auboeuf D, Gourdon G, Gomes-Pereira M.
In-Text Gene Mentions

…al., 2007 ),STAU1( Ravel-Chapuis et…

Show Full Abstract

Myotonic dystrophy type 1 (DM1) is a neuromuscular disorder caused by a non-coding CTG repeat expansion in the <i>DMPK</i> gene. This mutation generates a toxic CUG RNA that interferes with the RNA processing of target genes in multiple tissues. Despite debilitating neurological impairment, the pathophysiological cascade of molecular and cellular events in the central nervous system (CNS) has been less extensively characterized than the molecular pathogenesis of muscle/cardiac dysfunction. Particularly, the contribution of different cell types to DM1 brain disease is not clearly understood. We first used transcriptomics to compare the impact of expanded CUG RNA on the transcriptome of primary neurons, astrocytes and oligodendrocytes derived from DMSXL mice, a transgenic model of DM1. RNA sequencing revealed more frequent expression and splicing changes in glia than neuronal cells. In particular, primary DMSXL oligodendrocytes showed the highest number of transcripts differentially expressed, while DMSXL astrocytes displayed the most severe splicing dysregulation. Interestingly, the expression and splicing defects of DMSXL glia recreated molecular signatures suggestive of impaired cell differentiation: while DMSXL oligodendrocytes failed to upregulate a subset of genes that are naturally activated during the oligodendroglia differentiation, a significant proportion of missplicing events in DMSXL oligodendrocytes and astrocytes increased the expression of RNA isoforms typical of precursor cell stages. Together these data suggest that expanded CUG RNA in glial cells affects preferentially differentiation-regulated molecular events. This hypothesis was corroborated by gene ontology (GO) analyses, which revealed an enrichment for biological processes and cellular components with critical roles during cell differentiation. Finally, we combined exon ontology with phosphoproteomics and cell imaging to explore the functional impact of CUG-associated spliceopathy on downstream protein metabolism. Changes in phosphorylation, protein isoform expression and intracellular localization in DMSXL astrocytes demonstrate the far-reaching impact of the DM1 repeat expansion on cell metabolism. Our multi-omics approaches provide insight into the mechanisms of CUG RNA toxicity in the CNS with cell type resolution, and support the priority for future research on non-neuronal mechanisms and proteomic changes in DM1 brain disease.

Also flagged:methylationDiabetic Nephropathykidney diseasesdiabetes complicationsHistonemethylations
Journal Article 2021-05-05 ✓ 1 Snippet Shao BY, Zhang SF, Li HD, Meng XM, Chen HY.
In-Text Gene Mentions

CircWBSCR17 aggravates inflammation and fibrosis in high glucose-induced HK-2 cells via miR-185-5p/SOX6 axis (Li et al., 2020a).

Show Full Abstract

Diabetic nephropathy (DN) leads to high morbidity and disability. Inflammation plays a critical role in the pathogenesis of DN, which involves renal cells and immune cells, the microenvironment, as well as extrinsic factors, such as hyperglycemia, chemokines, cytokines, and growth factors. Epigenetic modifications usually regulate gene expression via DNA methylation, histone modification, and non-coding RNAs without altering the DNA sequence. During the past years, numerous studies have been published to reveal the mechanisms of epigenetic modifications that regulate inflammation in DN. This review aimed to summarize the latest evidence on the interplay of epigenetics and inflammation in DN, and highlight the potential targets for treatment and diagnosis of DN.

Also flagged:cancershepatocellular carcinomacholangiocarcinomaanxietyNeoplasmCancer
Journal Article 2021-05-05 ✓ 1 Snippet Graf J, Stengel A.
In-Text Gene Mentions

…various metabolic diseases (hemochromatosis, type 2 diabetes…

Show Full Abstract

<h4>Background</h4>Worldwide, hepatobiliary cancers are frequent diseases and often accompanied by a poor prognosis. These cancers, with hepatocellular carcinoma (HCC) and cholangiocarcinoma (CHC) being the most frequent, are often associated with a considerable amount of psychological burden such as anxiety, depressiveness, and reduced health-related quality of life (HRQOL) which may lead to psychiatric comorbidities. This systematic review gives an overview on psychological burden and on the effectiveness of psycho-oncological interventions for patients with HCC and CHC.<h4>Methods</h4>The databases PubMed, PubPsych, and PsycINFO were used and searched using the following combination of terms: (Neoplasm OR Cancer OR Tumor OR Carcinoma) AND (Psycho-Oncology OR Psychotherapy OR Psychiatr<sup>∗</sup>) AND (Liver OR Hepatic OR Hepatocellular OR Gallbladder OR Bile<sup>∗</sup>). Studies were eligible for inclusion if investigating patients affected with tumors of the liver (HCC/CHC) and using diagnostic instruments to assess mental health symptoms and research concerning specific psycho-oncological interventions. In total, 1027 studies were screened by one author with regard to title and abstracts. Afterward, the two authors of the paper discussed inclusion of possible articles.<h4>Results</h4>Twelve studies focusing on distress, anxiety, and depression symptoms as well as quality of life among patients with HCC/CHC and three studies on psycho-oncological interventions were included. Patients suffering from hepatobiliary cancers often experience considerable psychological burden. A quarter of patients suffer from depressive symptoms; anxiety is even more common among these patients with almost 40%. The HRQOL of those affected is reduced in almost all areas, suicide rates increased and the level of distress is considerably increased in one third of patients even in comparison to those with other kinds of cancer. By psycho-oncological intervention the prevalence of depressive symptoms and anxiety can be reduced, while the quality of life and also the survival rate of patients with hepatobiliary cancer can be increased.<h4>Discussion and conclusion</h4>Psychological burden is high in patients with hepatobiliary cancers as reflected in high levels of depressiveness and anxiety as well as reduced quality of life. The use of psycho-oncological interventions can reduce psychological burden and increase quality of life compared to patients receiving standard support only.<h4>Systematic review registration</h4>(prospero), identifier (CRD42021243192).

Also flagged:CAGHuntington's DiseaseHDautosomal dominant diseasecytosineadenine
Journal Article 2021-05-05 ✓ 5 Snippets Ferraldeschi M, Romano S, Giglio S, Romano C, Morena E, Mechelli R, Annibali V, Ubaldi M, Buscarinu MC, Umeton R, Sani G, Vecchione A, Salvetti M, Ristori G.
In-Text Gene Mentions

Huntington's disease (HD) is an autosomal dominant disease caused by a cytosine, adenine, and guanine (CAG) repeat expansion in the gene that encodes huntingtin (HTT).

…and the huntingtin (HTT) interactome.…

…regulation of theHTTinteractome by the…

…that encodes huntingtin (HTT).…

…CNS pathophysiology: mutantHTTwas quantified in…

Show Full Abstract

The momentum of gene therapy in Huntington's disease (HD) deserves biomarkers from easily accessible fluid. We planned a study to verify whether plasma miRNome may provide useful peripheral "reporter(s)" for the management of HD patients. We performed an exploratory microarray study of whole non-coding RNA profiles in plasma from nine patients with HD and 13 matched controls [eight healthy subjects (HS) and five psychiatric patients (PP) to minimize possible iatrogenic impact on the profile of non-coding RNAs]. We found an HD-specific signature: downregulation of hsa-miR-98 (fold change, -1.5, <i>p</i> = 0.0338 HD vs. HS, and fold change, 1.5, <i>p</i> = 0.0045 HD vs. PP) and upregulation of hsa-miR-323b-3p (fold change, 1.5, <i>p</i> = 0.0007 HD vs. HS, and fold change, 1.5, <i>p</i> = 0.0111 HD vs. PP). To validate this result in an independent cohort, we quantify by digital droplet PCR (ddPCR) the presence of the two microRNA in the plasma of 33 HD patients and 49 matched controls (25 HS and 24 PP patients). We were able to confirm that hsa-miR-323b-3p was upregulated in HD and premanifest HD vs. HS and PP: the median values (first-third quartile) were 4.1 (0.9-10.53) and 5.8 (1.9-10.70) vs. 0.69 (0.3-2.75) and 1.4 (0.78-2.70), respectively, <i>p</i> < 0.05. No significant difference was found for hsa-miR-98. To evaluate the biological plausibility of the hsa-miR-323b-3p as a component of the disease pathophysiology, we performed a bioinformatic analysis based on its targetome and the huntingtin (HTT) interactome. We found a statistically significant overconnectivity between the targetome of hsa-miR-323b-3p and the HTT interactome (<i>p</i> = 1.48e-08). Furthermore, there was a significant transcription regulation of the HTT interactome by the miR-323b-3p targetome (<i>p</i> = 0.02). The availability of handy, reproducible, and minimally invasive biomarkers coming from peripheral miRNome may be valuable to characterize the illness progression, to indicate new therapeutic targets, and to monitor the effect of disease-modifying treatments. Our data deserve further studies with larger sample size and longitudinal design.

Also flagged:Biguanidesynthesisnitrogenheterocyclesbiguanidesmetformin
Journal Article 2021-05-05 No Snippets Grytsai O, Ronco C, Benhida R.
Show Full Abstract

Biguanide is a unique chemical function, which has attracted much attention a century ago and is showing resurgent interest in recent years after a long period of dormancy. This class of compounds has found broad applications such as reaction catalysts, organic strong bases, ligands for metal complexation, or versatile starting materials in organic synthesis for the preparation of nitrogen-containing heterocycles. Moreover, biguanides demonstrate a wide range of biological activities and some representatives are worldwide known such as metformin, the first-line treatment against type II diabetes, or chlorhexidine, the gold standard disinfectant and antiseptic. Although scarcely represented, the number of "success stories" with biguanide-containing compounds highlights their value and their unexploited potential as future drugs in various therapeutic fields or as efficient metal ligands. This review provides an extensive and critical overview of the synthetic accesses to biguanide compounds, as well as their comparative advantages and limitations. It also underlines the need of developing new synthetic methodologies to reach a wider variety of biguanides and to overcome the underrepresentation of these compounds.

Also flagged:PolybutylcyanoacrylateStrontium ranelatebone formationstrontiuminflammatory responsemineralization
Journal Article 2021-05-05 No Snippets Chang LC, Chung CY, Chiu CH, Lin MH, Yang JT.
Show Full Abstract

<h4>Background</h4>Dental implants are commonly used for missing teeth, for which success depends heavily on the quality of the alveolar bone. The creation of an ideal implant site is a key component in shortening the treatment time, which remains clinically challenging. Strontium ranelate (Protos) is an anti-osteoporotic agent which has previously been used to promote bone formation, however the systemic use of Protos has been linked to serious cardiovascular and venous thromboembolic events, thus local delivery strategies may be better suited for this purpose. In this study, a biodegradable, and biocompatible nanocarrier "polybutylcyanoacrylate" (PBCA) loaded with strontium was constructed and its ability to promote bone formation was assessed.<h4>Methodology</h4>PBCA nanoparticles loaded with strontium (PBCA-Sr NPs) were synthesized using the emulsion polymerization method, and their physical properties (zeta potential, size and shape) and entrapment efficiency were characterized. Committed MSCs (osteoblasts) were derived from the differentiation of cultured rat mesenchymal stem cells (MSC), which were tested with the PBCA-Sr NPs for cytotoxicity, inflammatory response, bone formation and mineralization. Scanning electron microscopy was performed following a 7-day treatment of PBCA-Sr NPs on decellularized procaine mandibular bone blocks grafted with osteoblasts.<h4>Results</h4>Spherical PBCA-Sr NPs of 166.7 ± 2.3 nm, zeta potential of -1.15 ± 0.28 mV with a strontium loading efficiency of 90.04 ± 3.27% were constructed. The presence of strontium was confirmed by energy-dispersive X-ray spectroscopy. Rat committed MSCs incubated in PBCA-Sr NPs for 24 hrs showed viabilities in excess of 90% for concentrations of up to 250 ug/mL, the cellular expression of osteocalcin and alkaline phosphatase were 1.4 and 1.3 times higher than the untreated control, and significantly higher than those treated with strontium alone. Bone formation was evident following osteoblast engraftment on the decellularized procaine mandibular bone block with PBCA-Sr NPs, which appeared superior to those treated with strontium alone.<h4>Conclusion</h4>Treatment of committed MSCs with PBCA-Sr NPs showed higher expression of markers of bone formation when compared with strontium alone and which corresponded to greater degree of bone formation observed on the 3-dimensinal decellularized procaine mandibular bone block. Further quantitative analysis on the extent of new bone formation is warranted.

Also flagged:Deathestradiolprogesteronenecroptosisreceptor interacting protein kinases 1RIPK1
Journal Article 2021-05-05 No Snippets McEvoy MJ, Sinderewicz E, Creedon L, McAfee M, Jonczyk AW, Piotrowska-Tomala KK, Skarzynski DJ.
Show Full Abstract

In this paper, newly discovered mechanisms of atresia and cell death processes in bovine ovarian follicles are investigated. For this purpose the mRNA expression of receptor interacting protein kinases 1 and 3 (<i>RIPK1</i> and <i>RIPK3</i>) of the granulosa and theca cells derived from healthy and atretic follicles are studied. The follicles were assigned as either healthy or atretic based on the estradiol to progesterone ratio. A statistically significant difference was recorded for the mRNA expression of a <i>RIPK1</i> and <i>RIPK3</i> between granulosa cells from healthy and atretic follicles. To further investigate this result a systems biology approach was used. The genes playing roles in necroptosis, apoptosis and atresia were chosen and a network was created based on human genes annotated by the IMEx database in Cytoscape to identify hubs and bottle-necks. Moreover, correlation networks were built in the Cluepedia plug-in. The networks were created separately for terms describing apoptosis and programmed cell death. We demonstrate that necroptosis (RIPK-dependent cell death pathway) is an alternative mechanism responsible for death of bovine granulosa and theca cells. We conclude that both apoptosis and necroptosis occur in the granulosa cells of dominant follicles undergoing luteinisation and in the theca cells from newly selected follicles.

Also flagged:Gene ExpressionAgingtranslationalextracellularcytoskeletal proteinsinsulin
Journal Article 2021-05-05 No Snippets Myers MJ, Shaik F, Shaik F, Alway SE, Mohamed JS.
Show Full Abstract

SirT1 plays a crucial role in the regulation of some of the caloric restriction (CR) responsive biological pathways. Aging suppresses SirT1 gene expression in skeletal muscle, suggesting that aging may affect the role of CR in muscle. To determine the role of SirT1 in the regulation of CR regulated pathways in skeletal muscle, we performed high-throughput RNA sequencing using total RNA isolated from the skeletal muscles of young and aged wild-type (WT), SirT1 knockout (SirT1-KO), and SirT1 overexpression (SirT1-OE) mice fed to 20 wk ad libitum (AL) or 40% CR diet. Our data show that aging repressed the global gene expression profile, which was restored by CR via upregulating transcriptional and translational process-related pathways. CR inhibits pathways linked to the extracellular matrix and cytoskeletal proteins regardless of aging. Mitochondrial function and muscle contraction-related pathways are upregulated in aged SirT1 KO mice following CR. SirT1 OE did not affect whole-body energy expenditure or augment skeletal muscle insulin sensitivity associated pathways, regardless of aging or diet. Overall, our RNA-seq data showed that SirT1 and CR have different functions and activation of SirT1 by its activator or exercise may enhance SirT1 activity that, along with CR, likely have a better functional role in aging muscle.

Also flagged:Mastocytosismyeloid neoplasmSystemic mastocytosispathogenesismidostaurinkinase
Journal Article 2021-05-05 ✓ 1 Snippet Li Z.
In-Text Gene Mentions

The potent new inhibitor ripretinib (DCC-2618) broadly inhibits primary and drug-resistant KIT/PDGFRA mutants [75] and is currently being tested in clinical trials.

Show Full Abstract

Mastocytosis is a type of myeloid neoplasm characterized by the clonal, neoplastic proliferation of morphologically and immunophenotypically abnormal mast cells that infiltrate one or more organ systems. Systemic mastocytosis (SM) is a more aggressive variant of mastocytosis with extracutaneous involvement, which might be associated with multi-organ dysfunction or failure and shortened survival. Over 80% of patients with SM carry the <i>KIT</i> D816V mutation. However, the <i>KIT</i> D816V mutation serves as a weak oncogene and appears to be a late event in the pathogenesis of mastocytosis. The management of SM is highly individualized and was largely palliative for patients without a targeted form of therapy in past decades. Targeted therapy with midostaurin, a multiple kinase inhibitor that inhibits KIT, has demonstrated efficacy in patients with advanced SM. This led to the recent approval of midostaurin by the United States Food and Drug Administration and European Medicines Agency. However, the overall survival of patients treated with midostaurin remains unsatisfactory. The identification of genetic and epigenetic alterations and understanding their interactions and the molecular mechanisms involved in mastocytosis is necessary to develop rationally targeted therapeutic strategies. This review briefly summarizes recent developments in the understanding of SM pathogenesis and potential treatment strategies for patients with SM.

bioRxiv 2021-05-05 Preprint (No Snippets API) Yang K, Hua J, Etyemez S, Paez A, Prasad N, Ishizuka K, Sawa A, Kamath V.
Show Full Abstract

<h4>Background</h4> Olfactory dysfunction has been reproducibly reported in patients with psychosis, including first episode psychosis (FEP) patients. Consistently, structural abnormalities in the olfactory bulb (OB), a key region of the peripheral olfactory system, have also been reported in psychotic disorders. Meanwhile, air pollution and viral infections in the upper respiratory tract, including those of SARS-CoV-2, are reportedly risk factors for brain dysfunction and mental disorders. These risk factors can disturb the olfactory epithelium (OE) that is located adjacent to the OB and connected via direct neuronal projections. Nevertheless, it is unknown how a disturbance of the OE possibly affects the OB in the pathophysiological context of psychotic disorders. <h4>Methods</h4> We examined the volume of the OB in FEP patients and healthy controls from 3 Tesla magnetic resonance imaging and molecular expression profiles of olfactory neuronal cells (ONCs) enriched from freshly biopsied OE. <h4>Results</h4> We observed a reduction of the OB volume in FEP patients compared with healthy controls. We also observed a significant alteration in gene expression profiles in the ONCs from FEP patients, supporting the pathological changes in the OE. Among such molecular changes, immune-related molecules and pathways were underscored in association with the OB volume changes in FEP patients. <h4>Conclusions</h4> Our data support the OB and OE pathologies in FEP patients. Immune-related molecular changes in the OE can biologically link adverse factors in the nasal cavity, such as air pollution and viral infection, with the OB structural change, both of which have been reported for psychotic disorders.

Also flagged:cadherin-1diffuse gastric cancerhereditary diffuse gastric cancerHDGCCDH1diffuse-type autosomal dominant familial syndrome
Journal Article 2021-05-04 No Snippets Dang DNT, Nguyen HTT, Ngo HD, Tran BM, Vu AD, Dang HQ, Ta VT.
Show Full Abstract

<h4>Background</h4>Germline pathogenic variants in the cadherin-1 (CDH1) gene cause a predisposition to hereditary diffuse gastric cancer (HDGC). We report an HDGC case in Vietnam and identify a novel mutation in the CDH1 gene.<h4>Case presentation</h4>A 28-year-old Vietnamese man was diagnosed with HDGC and a novel mutation at c.639G>A. All exons of CDH1 were sequenced in his pedigree, which revealed the c.639G>A mutation in the proband, his father, and uncle. The patient refused treatment and died 4 months after diagnosis. Endoscopic surveillance of the father and the uncle showed structural abnormalities in the father.<h4>Conclusion</h4>In cases of HDGC, identification of the CDH1 gene mutation is very important for better counseling and more effective strategies to prevent the development of diseases, such as prophylactic gastrectomy for family members with genetic mutations.

Also flagged:adenosinePIWIcancersneurodegenerative diseasesageingnucleotides
Journal Article 2021-05-04 ✓ 1 Snippet Wang K, Wang T, Gao XQ, Chen XZ, Wang F, Zhou LY.
In-Text Gene Mentions

Affected the expression of TNFSF4 protein and played an important role in the development of bladder cancer

Show Full Abstract

PIWI-interacting RNAs (piRNAs) are recently discovered small non-coding RNAs consisting of 24-35 nucleotides, usually including a characteristic 5-terminal uridine and an adenosine at position 10. PIWI proteins can specifically bind to the unique structure of the 3' end of piRNAs. In the past, it was thought that piRNAs existed only in the reproductive system, but recently, it was reported that piRNAs are also expressed in several other human tissues with tissue specificity. Growing evidence shows that piRNAs and PIWI proteins are abnormally expressed in various diseases, including cancers, neurodegenerative diseases and ageing, and may be potential biomarkers and therapeutic targets. This review aims to discuss the current research status regarding piRNA biogenetic processes, functions, mechanisms and emerging roles in various diseases.

Also flagged:chromosomeE13chr4SOX9E14E15
Journal Article 2021-05-04 ✓ 5 Snippets Morcom L, Edwards TJ, Rider E, Jones-Davis D, Lim JW, Chen KS, Dean RJ, Bunt J, Ye Y, Gobius I, Suárez R, Mandelstam S, Sherr EH, Richards LJ.
In-Text Gene Mentions

For example, humans with pathogenic variants in the DRAXIN receptor, DCC, display a range of CC phenotypes and associated HC malformations even across family members carrying the same pathogenic variant (Jamuar et al., 2017; Marsh et al., 2017; Marsh et al., 2018; Vosberg et al., 2019).

In a companion study, we demonstrate that DCC and its chemoattractive ligand, NTN1, also regulate MZG morphology and migration to the IHF, and are therefore crucial for CC Morcom et al., 2021 and HC formation in mice, as well as in humans with DCC mutations (Morcom et al., 2021). That study demonstrated that DCC and NTN1 promoted the extension of radial MZG fibres along the IHF and the migration of MZG to the IHF surface for remodelling.

…axon guidance receptorDCCand is required…

…the DRAXIN receptor,DCC, are also associated…

…the DRAXIN receptor,DCC, display a…

Show Full Abstract

Corpus callosum dysgenesis (CCD) is a congenital disorder that incorporates either partial or complete absence of the largest cerebral commissure. Remodelling of the interhemispheric fissure (IHF) provides a substrate for callosal axons to cross between hemispheres, and its failure is the main cause of complete CCD. However, it is unclear whether defects in this process could give rise to the heterogeneity of expressivity and phenotypes seen in human cases of CCD. We identify incomplete IHF remodelling as the key structural correlate for the range of callosal abnormalities in inbred and outcrossed BTBR mouse strains, as well as in humans with partial CCD. We identify an eight base-pair deletion in <i>Draxin</i> and misregulated astroglial and leptomeningeal proliferation as genetic and cellular factors for variable IHF remodelling and CCD in BTBR strains. These findings support a model where genetic events determine corpus callosum structure by influencing leptomeningeal-astroglial interactions at the IHF.

Also flagged:SOCS1MAP1LC3AGCLCALOX15BACSF2SLC1A4
Journal Article 2021-05-04 ✓ 2 Snippets Wu ZH, Tang Y, Yu H, Li HD.
In-Text Gene Mentions

…(PD-1), CTLA4, LAG3,TNFSF4/14, TNFRSF4/8/9/14/18/25 , an…

…(PD-1), CTLA4, LAG3,TNFSF4/14, TNFRSF4/8/9/14/18/25, IDO…

Show Full Abstract

Breast cancer (BC) affects the breast tissue and is the second most common cause of mortalities among women. Ferroptosis is an iron-dependent cell death mode that is characterized by intracellular accumulation of reactive oxygen species (ROS). We constructed a prognostic multigene signature based on ferroptosis-associated differentially expressed genes (DEGs). Moreover, we comprehensively analyzed the role of ferroptosis-associated miRNAs, lncRNAs, and immune responses. A total of 259 ferroptosis-related genes were extracted. KEGG function analysis of these genes revealed that they were mainly enriched in the HIF-1 signaling pathway, NOD-like receptor signaling pathway, central carbon metabolism in cancer, and PPAR signaling pathway. Fifteen differentially expressed genes (ALOX15, ALOX15B, ANO6, BRD4, CISD1, DRD5, FLT3, G6PD, IFNG, NGB, NOS2, PROM2, SLC1A4, SLC38A1, and TP63) were selected as independent prognostic factors for BC patients. Moreover, T cell functions, including the CCR score, immune checkpoint, cytolytic activity, HLA, inflammation promotion, para-inflammation, T cell co-stimulation, T cell co-inhibition, and type II INF responses were significantly different between the low-risk and high-risk groups of the TCGA cohort. Immune checkpoints between the two groups revealed that the expressions of PDCD-1 (PD-1), CTLA4, LAG3, TNFSF4/14, TNFRSF4/8/9/14/18/25, and IDO1/2 among others were significantly different. A total of 1185 ferroptosis-related lncRNAs and 219 ferroptosis-related miRNAs were also included in this study. From the online database, we identified novel ferroptosis-related biomarkers for breast cancer prognosis. The findings of this study provide new insights into the development of new reliable and accurate cancer treatment options.

Also flagged:Col23a1Dkk2Grin2cZeb2Cdh8Prph
Journal Article 2021-05-04 ✓ 1 Snippet Dowsett GKC, Lam BYH, Tadross JA, Cimino I, Rimmington D, Coll AP, Polex-Wolf J, Knudsen LB, Pyke C, Yeo GSH.
In-Text Gene Mentions

…of Tenm2 andPlcl1, while cluster…

Show Full Abstract

<h4>Objective</h4>The area postrema (AP) and nucleus tractus solitarius (NTS) located in the hindbrain are key nuclei that sense and integrate peripheral nutritional signals and consequently regulate feeding behaviour. While single-cell transcriptomics have been used in mice to reveal the gene expression profile and heterogeneity of key hypothalamic populations, similar in-depth studies have not yet been performed in the hindbrain.<h4>Methods</h4>Using single-nucleus RNA sequencing, we provide a detailed survey of 16,034 cells within the AP and NTS of mice in the fed and fasted states.<h4>Results</h4>Of these, 8,910 were neurons that group into 30 clusters, with 4,289 from mice fed ad libitum and 4,621 from overnight fasted mice. A total of 7,124 nuclei were from non-neuronal cells, including oligodendrocytes, astrocytes, and microglia. Interestingly, we identified that the oligodendrocyte population was particularly transcriptionally sensitive to an overnight fast. The receptors GLP1R, GIPR, GFRAL, and CALCR, which bind GLP1, GIP, GDF15, and amylin, respectively, are all expressed in the hindbrain and are major targets for anti-obesity therapeutics. We characterise the transcriptomes of these four populations and show that their gene expression profiles are not dramatically altered by an overnight fast. Notably, we find that roughly half of cells that express GIPR are oligodendrocytes. Additionally, we profile POMC-expressing neurons within the hindbrain and demonstrate that 84% of POMC neurons express either PCSK1, PSCK2, or both, implying that melanocortin peptides are likely produced by these neurons.<h4>Conclusion</h4>We provide a detailed single-cell level characterisation of AP and NTS cells expressing receptors for key anti-obesity drugs that are either already approved for human use or in clinical trials. This resource will help delineate the mechanisms underlying the effectiveness of these compounds and also prove useful in the continued search for other novel therapeutic targets.

Also flagged:TNFAIP3STAT4BANK1BLKTakayasu arteritisTAK
Journal Article 2021-05-04 ✓ 5 Snippets Montúfar-Robles I, Soto ME, Jiménez-Morales S, Gamboa R, Huesca-Gómez C, Ramírez-Bello J.
In-Text Gene Mentions

Widely explored polymorphisms in non-HLA genes, including TNFAIP3, STAT4, TNFSF4, BANK1, and BLK have been consistently associated with both SLE and RA, but they have not been evaluated in TAK.<h4>Objective</h4>The aim of our study was to investigate whether TNFAIP3, STAT4, BANK1, BLK, and TNFSF4 polymorphisms are associated with susceptibility to TAK.<h4>Methods</h4>The TNFAIP3 rs2230926T/G and rs5029924C/T, STAT4 rs7574865G/T, BANK1 10516487G/A, BLK rs2736340T/C, rs13277113A/G, and TNFS4 rs2205960G/T polymorphisms were genotyped in 101 cases and 276 controls by using a TaqMan SNP genotyping assay.

Polymorphisms in TNFAIP3, but not in STAT4, BANK1, BLK, and TNFSF4, are associated with susceptibility to Takayasu arteritis.

…BANK1, BLK, andTNFSF4, are associated with…

…including TNFAIP3, STAT4,TNFSF4, BANK1, and BLK…

…BANK1, BLK, andTNFSF4polymorphisms are associated…

Show Full Abstract

<h4>Background</h4>Takayasu arteritis (TAK) is considered a rare disease characterized by nonspecific inflammation of the large arteries, especially the aorta and its major branches. Because TAK is an autoimmune disease (AD), it could share susceptibility loci with other pathologies such as systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA), among others. Widely explored polymorphisms in non-HLA genes, including TNFAIP3, STAT4, TNFSF4, BANK1, and BLK have been consistently associated with both SLE and RA, but they have not been evaluated in TAK.<h4>Objective</h4>The aim of our study was to investigate whether TNFAIP3, STAT4, BANK1, BLK, and TNFSF4 polymorphisms are associated with susceptibility to TAK.<h4>Methods</h4>The TNFAIP3 rs2230926T/G and rs5029924C/T, STAT4 rs7574865G/T, BANK1 10516487G/A, BLK rs2736340T/C, rs13277113A/G, and TNFS4 rs2205960G/T polymorphisms were genotyped in 101 cases and 276 controls by using a TaqMan SNP genotyping assay. An association analysis was performed.<h4>Results</h4>The TNFAIP3 rs2230926T/G and rs5029924C/T polymorphisms were in complete linkage disequilibrium and turned out to be risk factors for TAK (OR = 4.88, p = 0.0001). The STAT4, BANK1, BLK, and TNFSF4 polymorphisms were not associated with the disease.<h4>Conclusions</h4>This is the first study documenting an association of TNFAIP3 rs2230926T/G and rs5029924C/T with TAK. Our results provide new information on the genetic bases of TAK.

Also flagged:TCP1CCTcolorectal cancerCOADGene ExpressionChaperonin
Journal Article 2021-05-04 ✓ 3 Snippets Sun H, Wang Y, Jing HY, Yang XY, Shi XX, Zhang JH, Yu YX, Gao L, Wang XY, Li WH, Yu L.
In-Text Gene Mentions

…features (For example,DDX27, DDX56 ,…

…showed that theDDX27, DDX10, and DDX56…

…al. showed thatDDX27possessed an oncogenic…

Show Full Abstract

<h4>Aims</h4>Chaperonin-containing TCP1 subunit (CCT) 6A is an oncogenic 6th subunit of the CCT family. Nevertheless, not much is documented regarding its function in colorectal cancer (COAD). This investigation seeks to explore the role of <i>CCT6A</i> in the prognosis of COAD.<h4>Main methods</h4>Sequencing data from the Gene Expression Omnibus (GEO) and Cancer Genome Atlas database (TCGA) were employed to analyze the expression of <i>CCT6A</i> and its involvement in various regulatory networks behind COAD. Oncomine and Gene Expression Profiling Interactive Analysis (GEPIA) analyzed Levels of expression and survival rates, while GEPIA was used to uncover further the functional networks that involved <i>CCT6A</i>. Database for Annotation, Visualization, and Integrated Discovery (DAVID) tools were used to interpret Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathways. Evaluation of the expression levels of <i>CCT6A</i> in COAD samples was also verified via immunohistochemistry.<h4>Key findings</h4>We found that the expression of <i>CCT6A</i> is up-regulated in COAD. <i>CCT6A</i> correlated with poor prognosis and decreased immune infiltrates such as CD4<sup>+</sup> T cells, B cells, and dendritic cells. <i>CCT6A</i> is increased in COAD patients. <i>CCT6A</i> is associated with several gene networks related to the DDX family and mismatch repair pathways.<h4>Significance</h4>Our data showed that data mining was able to uncover data regarding levels of <i>CCT6A</i> and its involvement in genetic regulating pathways in COAD.

Also flagged:DementiaAmyotrophic Lateral SclerosisMADDBCHEsecreted phosphoprotein 1IL18RAP
Journal Article 2021-05-04 ✓ 5 Snippets Zhao Q, Zheng B, Feng P, Li X.
In-Text Gene Mentions

TNFSF4

SERPINC1

HFE

PTGIS

…genes (i.e., GRIN1,PTGIS, PTGES, ADRA1A, CDK5,…

Show Full Abstract

<h4>Background</h4>Butylphthalide (NBP), approved by the China National Medical Products Administration (NMPA) for the treatment of ischemic stroke (IS), showed pleiotropic potentials against central nervous system (CNS) diseases, including neuroprotection and cognitive deficits improvement. However, the effects and corresponding modes of action were not fully explored. This study was designed to investigate the potential of NBP against IS-associated CNS diseases based on network pharmacology (NP) and molecular docking (MD).<h4>Methods</h4>IS was inputted as the index disease to retrieve the "associated diseases" in DisGeNET. Three-database-based IS genes were obtained and integrated (DisGeNET, Malacards, and OMIM). Then, IS-associated genes were identified by combining these genes. Meanwhile, PubMed references and online databases were applied to identify NBP target genes. The IS-related disease-disease association (DDA) network and NBP-disease regulation network were constructed and analyzed in Cytoscape. <i>In silico</i> MD and references were used to validate the binding affinity of NBP with critical targets and the potential of NBP against certain IS-related CNS disease regulation.<h4>Results</h4>175 NBP target genes were obtained, while 312 IS-related disease genes were identified. 36 NBP target genes were predicted to be associated with IS-related CNS diseases, including Alzheimer's disease (AD), epilepsy, major depressive disorder (MDD), amyotrophic lateral sclerosis (ALS), and dementia. Six target genes (i.e., GRIN1, PTGIS, PTGES, ADRA1A, CDK5, and SULT1E1) indicating disease specificity index (DSI) >0.5 showed certain to good degree binding affinity with NBP, ranging from -9.2 to -6.7 kcal/mol. And the binding modes may be mainly related to hydrogen bonds and hydrophobic "bonds." Further literature validations inferred that these critical NBP targets had a tight association with AD, epilepsy, ALS, and depression.<h4>Conclusions</h4>Our study proposed a drug-target-disease integrated method to predict the drug repurposing potentials to associated diseases by application of NP and MD, which could be an attractive alternative to facilitate the development of CNS disease therapies. NBP may be promising and showed potentials to be repurposed for treatments for AD, epilepsy, ALS, and depression, and further investigations are warranted to be carefully designed and conducted.

Also flagged:alanineaspartate aminotransferasefatty liveruric acidIronALT
Journal Article 2021-05-04 ✓ 1 Snippet Tsutsumi N, Nishimata S, Shimura M, Kashiwagi Y, Kawashima H.
In-Text Gene Mentions

…iron deposition inhemochromatosis, iron is almost…

Show Full Abstract

<h4>Purpose</h4>Hepcidin levels have previously been reported to be correlated with liver damage. However, the association between hepcidin levels and liver fibrosis in children with fatty liver disease remains unclear. This study therefore aimed to investigate the pathophysiology of fibrosis in children with fatty liver disease and its association with hepcidin levels.<h4>Methods</h4>This retrospective case series included 12 boys aged 6-17 years who were diagnosed with nonalcoholic fatty liver disease (NAFLD) or nonalcoholic steatohepatitis (NASH) at the Tokyo Medical University Hospital. Sixteen liver biopsy samples from 12 subjects were analyzed. Serum hepcidin levels were assayed using enzyme-linked immunosorbent assay. Immunostaining for hepcidin was performed, and the samples were stratified by staining intensity.<h4>Results</h4>Serum hepcidin levels were higher in pediatric NAFLD/NASH patients than in controls. Conversely, a significant inverse correlation was observed between hepcidin immunostaining and Brunt grade scores and between hepcidin scores and gamma-glutamyltranspeptidase, hyaluronic acid, and leukocyte levels. We observed inverse correlations with a high correlation coefficient of >0.4 between hepcidin immunostaining and aspartate aminotransferase, alanine aminotransferase, total bile acid, and platelet count.<h4>Conclusion</h4>There was a significant inverse correlation between hepcidin immunoreactivity and fibrosis in pediatric NAFLD patients; however, serum hepcidin levels were significantly higher, suggesting that these patients experienced a reduction in the hepcidin-producing ability of the liver in response to iron levels, leading to subsequent fibrosis. Therefore, hepcidin levels can be used as markers to identify the progression of fibrosis in patients with NAFLD.

Also flagged:Alcoholic Fatty Liver DiseaseNon-alcoholic fatty liver diseaseNAFLDmetabolic syndromechronic kidney diseasealbumin
Journal Article 2021-05-04 ✓ 1 Snippet Abbate M, Mascaró CM, Montemayor S, Barbería-Latasa M, Casares M, Gómez C, Ugarriza L, Tejada S, Abete I, Zulet MÁ, Sureda A, Martínez JA, Tur JA.
In-Text Gene Mentions

…post renal hematuria;hemochromatosis; severe/nephrotic-range album…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) and metabolic syndrome (MetS) are associated with chronic kidney disease (CKD). Diet could play a predisposing role in the development of increased albuminuria in patients with NAFLD and MetS; however, published evidence is still limited. The aim of this cross-sectional analysis was to assess whether dietary fats are associated with changes in urinary albumin-to-creatinine ratio (UACR) in 146 patients aged 40-60-years with NAFLD and MetS. Dietary data were collected by food frequency questionnaire; UACR was measured in a single first morning void. Sources and types of dietary fats used in the analysis were total fat, fats from animal and vegetable sources, saturated, monounsaturated, polyunsaturated, and trans fats. One-way analysis of variance was performed to assess differences in dietary fats intakes across stages of UACR. The association between dietary fats and UACR was assessed by Pearson's correlation coefficient and multivariable linear regression. Patients with increased UACR showed a worse cardiometabolic profile and higher intakes of animal fat, as compared to patients with normal levels of albuminuria. Animal fat intake was associated with mean UACR, independent of potential covariates.

Also flagged:EstroneOximeSynthesissteroidaloximesestrane
Journal Article 2021-05-04 No Snippets Canário C, Matias M, Brito V, Santos AO, Falcão A, Silvestre S, Alves G.
Show Full Abstract

The interest in the introduction of the oxime group in molecules aiming to improve their biological effects is increasing. This work aimed to develop new steroidal oximes of the estrane series with potential antitumor interest. For this, several oximes were synthesized by reaction of hydroxylamine with the 17-ketone of estrone derivatives. Then, their cytotoxicity was evaluated in six cell lines. An estrogenicity assay, a cell cycle distribution analysis and a fluorescence microscopy study with Hoechst 3358 staining were performed with the most promising compound. In addition, molecular docking studies against estrogen receptor α, steroid sulfatase, 17β-hydroxysteroid dehydrogenase type 1 and β-tubulin were also accomplished. The 2-nitroestrone oxime showed higher cytotoxicity than the parent compound on MCF-7 cancer cells. Furthermore, the oximes bearing halogen groups in A-ring evidenced selectivity for HepaRG cells. Remarkably, the Δ<sup>9,11</sup>-estrone oxime was the most cytotoxic and arrested LNCaP cells in the G<sub>2</sub>/M phase. Fluorescence microscopy studies showed the presence of condensed DNA typical of prophase and condensed and fragmented nuclei characteristic of apoptosis. However, this oxime promoted the proliferation of T47-D cells. Interestingly, molecular docking studies estimated a strong interaction between Δ<sup>9,11</sup>-estrone oxime and estrogen receptor α and β-tubulin, which may account for the described effects.

Also flagged:CopperCalciumCalcium Phosphatehydroxyapatiteβ-tricalciummethicillin
Journal Article 2021-05-04 No Snippets Jacobs A, Renaudin G, Charbonnel N, Nedelec JM, Forestier C, Descamps S.
Show Full Abstract

Cytotoxicity and antibacterial properties associated with the dopant release of Cu-doped Biphasic Calcium Phosphate (BCP) powders, mainly composed of hydroxyapatite mixed with β-tricalcium phosphate powders, were investigated. Twelve BCP ceramics were synthesized at three different sintering temperatures (600 °C, 900 °C and 1200 °C) and four copper doping rates (<i>x</i> = 0.0, 0.05, 0.10 and 0.20, corresponding to the stoichiometric amount of copper in Ca<sub>10</sub>Cu<i><sub>x</sub></i>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2-2<i>x</i></sub>O<sub>2<i>x</i></sub>). Cytotoxicity assessments of Cu-doped BCP powders, using MTT assay with human-Mesenchymal Stem Cells (h-MSCs), indicated no cytotoxicity and the release of less than 12 ppm of copper into the biological medium. The antibacterial activity of the powders was determined against both Gram-positive (methicillin-sensitive (MS) and methicillin resistant (MR) <i>Staphylococcus aureus</i>) and Gram-negative (<i>Escherichia</i> coli and <i>Pseudomonas aeruginosa</i>) bacteria. The Cu-doped biomaterials exhibited a strong antibacterial activity against MSSA, MRSA and <i>E. coli</i>, releasing approximatively 2.5 ppm after 24 h, whereas 10 ppm were required to induce an antibacterial effect against <i>P. aeruginosa</i>. This study also demonstrated that the culture medium used during experiments can directly impact the antibacterial effect observed; only 4 ppm of Cu<sup>2+</sup> were effective for killing all the bacteria in a 1:500 diluted TS medium, whereas 20 ppm were necessary to achieve the same result in a rich, non-diluted standard marrow cell culture medium.

Also flagged:NFAT5Viral Infectionnuclear factor of activated T cells 5infectiongene expressionkinases
Journal Article 2021-05-04 ✓ 3 Snippets Zhao G, Aghakeshmiri S, Chen YT, Zhang HM, Yip F, Yang D.
In-Text Gene Mentions

Qin et al. revealed that NFAT5 serves as a tumour suppressor for HCC by downregulating the expression of DARS2, an oncogene that promotes the proliferation of HCC cells [64].

On the other hand, as discussed earlier, HBV infection inhibits NFAT5 expression through the miR-30e-5p/MAP4K4 signalling axis, leading to the upregulation of DARS2 and, in turn, the progression of hepatocarcinogenesis.

Since NFAT5 is a suppressor of the oncogene DARS2, this suppression promotes HCC tumorigenesis via DARS2 expression [64].

Show Full Abstract

The nuclear factor of activated T cells 5 (NFAT5) is well known for its sensitivity to cellular osmolarity changes, such as in the kidney medulla. Accumulated evidence indicates that NFAT5 is also a sensitive factor to stress signals caused by non-hypertonic stimuli such as heat shock, biomechanical stretch stress, ischaemia, infection, etc. These osmolality-related and -unrelated stimuli can induce NFAT5 upregulation, activation and nuclear accumulation, leading to its protective role against various detrimental effects. However, dysregulation of NFAT5 expression may cause pathological conditions in different tissues, leading to a variety of diseases. These protective or pathogenic effects of NFAT5 are dictated by the regulation of its target gene expression and activation of its signalling pathways. Recent studies have found a number of kinases that participate in the phosphorylation/activation of NFAT5 and related signal proteins. Thus, this review will focus on the NFAT5-mediated signal transduction pathways. As for the stimuli that upregulate NFAT5, in addition to the stresses caused by hyperosmotic and non-hyperosmotic environments, other factors such as miRNA, long non-coding RNA, epigenetic modification and viral infection also play an important role in regulating NFAT5 expression; thus, the discussion in this regard is another focus of this review. As the heart, unlike the kidneys, is not normally exposed to hypertonic environments, studies on NFAT5-mediated cardiovascular diseases are just emerging and rapidly progressing. Therefore, we have also added a review on the progress made in this field of research.

Also flagged:calciumsulphateInfectionbiofilm formationCalcium sulphatebiodegradation
Journal Article 2021-05-04 ✓ 1 Snippet Ene R, Nica M, Ene D, Cursaru A, Cirstoiu C.
In-Text Gene Mentions

…The natural form of calcium apatite, hydroxyapatite (Ca10[PO4]6[OH]2) presents with superior osteoconduction potential, stimulatory effect on angiogenesis and bone-binding capability.…

Show Full Abstract

Infection in orthopaedic and trauma surgery remains a destructive complication with particularly challenging diagnosis and treatment due to bacterial antibiotic resistance and biofilm formation.Along with surgical debridement and systemic antibiotics, an important type of adjuvant therapy is local antibiotic delivery, with the purpose of eliminating bacterial colonization and biofilm development.Calcium sulphate, as a synthetic absorbable biomaterial used for local antibiotic delivery, has experienced an increasing popularity during the last decade, with multiple promoted advantages such as predictable antibiotic elution kinetics, complete and quick biodegradation, good biocompatibility, and limited associated complications.A series of commercially available antibiotic-delivery systems based on calcium sulphate are under investigation and in clinical use, with different presentations, compositions, and application techniques.The current article presents the main available calcium-sulphate-based products and the existing data about the clinical and preclinical research results, stemming from their implementation as local antibiotic carriers for surgical site and implant-associated infections treatment and prevention. Cite this article: <i>EFORT Open Rev</i> 2021;6:297-304. DOI: 10.1302/2058-5241.6.200083.

Also flagged:PLCdecanoateMethoxy1,4-cyclohexadienesilicaKanamycin
Journal Article 2021-05-04 ✓ 1 Snippet Cloutier M, Prévost MJ, Lavoie S, Feroldi T, Piochon M, Groleau MC, Legault J, Villaume S, Crouzet J, Dorey S, Dìaz De Rienzo MA, Déziel E, Gauthier C.
In-Text Gene Mentions

DCC

Show Full Abstract

Rhamnolipids are a specific class of microbial surfactants, which hold great biotechnological and therapeutic potential. However, their exploitation at the industrial level is hampered because they are mainly produced by the opportunistic pathogen <i>Pseudomonas aeruginosa</i>. The non-human pathogenic bacterium <i>Pantoea ananatis</i> is an alternative producer of rhamnolipid-like metabolites containing glucose instead of rhamnose residues. Herein, we present the isolation, structural characterization, and total synthesis of ananatoside A, a 15-membered macrodilactone-containing glucolipid, and ananatoside B, its open-chain congener, from organic extracts of <i>P. ananatis</i>. Ananatoside A was synthesized through three alternative pathways involving either an intramolecular glycosylation, a chemical macrolactonization or a direct enzymatic transformation from ananatoside B. A series of diasteroisomerically pure (1→2), (1→3), and (1→4)-macrolactonized rhamnolipids were also synthesized through intramolecular glycosylation and their anomeric configurations as well as ring conformations were solved using molecular modeling in tandem with NMR studies. We show that ananatoside B is a more potent surfactant than its macrolide counterpart. We present evidence that macrolactonization of rhamnolipids enhances their cytotoxic and hemolytic potential, pointing towards a mechanism involving the formation of pores into the lipidic cell membrane. Lastly, we demonstrate that ananatoside A and ananatoside B as well as synthetic macrolactonized rhamnolipids can be perceived by the plant immune system, and that this sensing is more pronounced for a macrolide featuring a rhamnose moiety in its native <sup>1</sup> <i>C</i> <sub>4</sub> conformation. Altogether our results suggest that macrolactonization of glycolipids can dramatically interfere with their surfactant properties and biological activity.

Also flagged:tumorRaf kinasereceptor tyrosine kinasegrowth factor receptorsRaf kinase inhibitory proteinRKIP
Journal Article 2021-05-04 No Snippets Hu CT, Mandal JP, Wu WS.
Show Full Abstract

Targeted therapy aiming at the metastatic signal pathway, such as that triggered by receptor tyrosine kinase (RTK), for the prevention of tumor progression is promising. However, RTK-based targeted therapy frequently suffered from drug resistance due to the co-expression of multiple growth factor receptors that may raise compensatory secondary signaling and acquired mutations after treatment. One alternative strategy is to manipulate the common negative regulators of the RTK signaling. Among them, Raf kinase inhibitory protein (RKIP) is highlighted and focused on this review. RKIP can associate with Raf-1, thus suppressing the downstream mitogen-activated protein kinase (MAPK) cascade. RKIP also negatively regulates other metastatic signal molecules including NF-κB, STAT3, and NOTCH1. In general, RKIP achieves this task via associating and blocking the activity of the critical molecules on upstream of the aforementioned pathways. One novel RKIP-related signaling involves reactive oxygen species (ROS). In our recent report, we found that PKCδ-mediated ROS generation may interfere with the association of RKIP with heat shock protein 60 (HSP60)/MAPK complex via oxidation of HSP60 triggered by the tumor promoter 12-O-tetradecanoyl-phorbol-13-acetate. The departure of RKIP may impact the downstream MAPK in two aspects. One is to trigger the Mt→cytosol translocation of HSP60 coupled with MAPKs. The other is to change the conformation of HSP60, favoring more efficient activation of the associated MAPK by upstream kinases in cytosol. It is worthy of investigating whether various RTKs capable of generating ROS can drive metastatic signaling via affecting RKIP in the same manner.

Also flagged:LRP5mineralosteoporosispseudogliomaWntdickkopf WNT signaling pathway inhibitor 1
Journal Article 2021-05-03 ✓ 1 Snippet Caetano da Silva C, Ricquebourg M, Orcel P, Fabre S, Funck-Brentano T, Cohen-Solal M, Collet C.
In-Text Gene Mentions

…, malabsorption, hypogonadism,hemochromatosis, hyperthyroidism, hypercortis…

Show Full Abstract

<h4>Background</h4>Early-onset osteoporosis (EOOP) is defined by low bone mineral density (BMD), which increases the risk of fracture. Although the prevalence of osteoporosis at a young age is unknown, low BMD is highly linked to genetic background. Heterozygous pathogenic variants in low-density lipoprotein receptor-related protein 5 (LRP5) are associated with EOOP. This study aimed to investigate the genetic profile in patients with EOOP to better understand the variation in phenotype severity by using a targeted gene sequencing panel associated with bone fragility.<h4>Method and results</h4>We used a sequencing panel with 17 genes reported to be related to bone fragility for analysis of 68 patients with EOOP. We found a high positivity rate of EOOP with LRP5 variants (14 patients, 20.6%). The remaining 79.4% of patients with EOOP but without LRP5 variants showed variable disease severity, as observed in patients with at least one variant in this gene. One patient, with multiple fractures and spine L1-L4 BMD Z-score -2.9, carried a novel pathogenic homozygous variant, c.2918T>C, p.(Leu973Pro), without any pseudoglioma. In addition to carrying the LRP5 variant, 2 other patients carried a heterozygous variant in Wnt signaling pathway genes: dickkopf WNT signaling pathway inhibitor 1 (DKK1) [NM_012242.4: c.359G>T, p.(Arg120Leu)] and Wnt family member 3A (WNT3A) [NM_033131.3: c.377G>A, p. (Arg126His)]. As compared with single-variant LRP5 carriers, double-variant carriers had a significantly lower BMD Z-score (-4.1 ± 0.8) and higher mean number of fractures (6.0 ± 2.8 vs. 2.2 ± 1.9). Analysis of the family segregation suggests the inheritance of BMD trait.<h4>Conclusion</h4>Severe forms of EOOP may occur with carriage of 2 pathogenic variants in genes encoding regulators of the Wnt signaling pathway. Two-variant carriers of Wnt pathway genes had severe EOOP. Moreover, DKK1 and WNT3A genes should be included in next-generation sequence analyses of bone fragility.

Also flagged:Affective disordersneuropsychiatric disordersmood dysregulationssleepcognitionatrophy
Journal Article 2021-05-03 ✓ 5 Snippets Martins HC, Schratt G.
In-Text Gene Mentions

Therefore, dysregulations in miR-218 and DCC expression during adolescence, a critical period for stress-related disorders, may hinder mPFC wiring and glutamatergic neurotransmission in mood-related circuits that will increase the predisposition to develop affective disorders.

…guidance cue receptorDCC(deleted in colorectal…

…showing that increasedDCCexpression in PFC…

…essive-like behaviors, whereasDCCdeletion was protective…

…that during adolescenceDCCexpression in dopaminergic…

Show Full Abstract

Affective disorders are a group of neuropsychiatric disorders characterized by severe mood dysregulations accompanied by sleep, eating, cognitive, and attention disturbances, as well as recurring thoughts of suicide. Clinical studies consistently show that affective disorders are associated with reduced size of brain regions critical for mood and cognition, neuronal atrophy, and synaptic loss in these regions. However, the molecular mechanisms that mediate these changes and thereby increase the susceptibility to develop affective disorders remain poorly understood. MicroRNAs (miRNAs or miRs) are small regulatory RNAs that repress gene expression by binding to the 3'UTR of mRNAs. They have the ability to bind to hundreds of target mRNAs and to regulate entire gene networks and cellular pathways implicated in brain function and plasticity, many of them conserved in humans and other animals. In rodents, miRNAs regulate synaptic plasticity by controlling the morphology of dendrites and spines and the expression of neurotransmitter receptors. Furthermore, dysregulated miRNA expression is frequently observed in patients suffering from affective disorders. Together, multiple lines of evidence suggest a link between miRNA dysfunction and affective disorder pathology, providing a rationale to consider miRNAs as therapeutic tools or molecular biomarkers. This review aims to highlight the most recent and functionally relevant studies that contributed to a better understanding of miRNA function in the development and pathogenesis of affective disorders. We focused on in vivo functional studies, which demonstrate that miRNAs control higher brain functions, including mood and cognition, in rodents, and that their dysregulation causes disease-related behaviors.

Also flagged:CPEB3Nr3c1posttraumatic stress disordersynaptic plasticitycytoplasmicpolyadenylation element-binding protein 3
Journal Article 2021-05-03 ✓ 1 Snippet Lu WH, Chao HW, Lin PY, Lin SH, Liu TH, Chen HW, Huang YS.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Susceptibility or resilience to posttraumatic stress disorder (PTSD) depends on one's ability to appropriately adjust synaptic plasticity for coping with the traumatic experience. Activity-regulated mRNA translation synthesizes plasticity-related proteins to support long-term synaptic changes and memory. Hence, cytoplasmic polyadenylation element-binding protein 3-knockout (CPEB3-KO) mice, showing dysregulated translation-associated synaptic rigidity, may be susceptible to PTSD-like behavior. Here, using a context-dependent auditory fear conditioning and extinction paradigm, we found that CPEB3-KO mice exhibited traumatic intensity-dependent PTSD-like fear memory. A genome-wide screen of CPEB3-bound transcripts revealed that Nr3c1, encoding glucocorticoid receptor (GR), was translationally suppressed by CPEB3. Thus, CPEB3-KO neurons with elevated GR expression exhibited increased corticosterone-induced calcium influx and decreased mRNA and protein levels of brain-derived neurotrophic factor (Bdnf). Moreover, the reduced expression of BDNF was associated with increased GR level during fear extinction in CPEB3-KO hippocampi. Intracerebroventricular delivery of BDNF before extinction training mitigated spontaneous fear intrusion in CPEB3-KO mice during extinction recall. Analysis of two GEO datasets revealed decreased transcriptomic expression of CPEB3 but not NR3C1 in peripheral blood mononuclear cells of humans with PTSD. Collectively, this study reveals that CPEB3, as a potential PTSD-risk gene, downregulates Nr3c1 translation to maintain proper GR-BDNF signaling for fear extinction.

Also flagged:PHF7transcription factorsGata4Mef2cTbx5Hand2
Journal Article 2021-05-03 No Snippets Garry GA, Bezprozvannaya S, Chen K, Zhou H, Hashimoto H, Morales MG, Liu N, Bassel-Duby R, Olson EN.
Show Full Abstract

Direct cardiac reprogramming of fibroblasts to cardiomyocytes presents an attractive therapeutic strategy to restore cardiac function following injury. Cardiac reprogramming was initially achieved through overexpression of the transcription factors Gata4, Mef2c and Tbx5; later, Hand2 and Akt1 were found to further enhance this process<sup>1-5</sup>. Yet, staunch epigenetic barriers severely limit the ability of these cocktails to reprogramme adult fibroblasts<sup>6,7</sup>. We undertook a screen of mammalian gene regulatory factors to discover novel regulators of cardiac reprogramming in adult fibroblasts and identified the histone reader PHF7 as the most potent activating factor<sup>8</sup>. Mechanistically, PHF7 localizes to cardiac super enhancers in fibroblasts, and through cooperation with the SWI/SNF complex, it increases chromatin accessibility and transcription factor binding at these sites. Furthermore, PHF7 recruits cardiac transcription factors to activate a positive transcriptional autoregulatory circuit in reprogramming. Importantly, PHF7 achieves efficient reprogramming in the absence of Gata4. Here, we highlight the underexplored necessity of cardiac epigenetic readers, such as PHF7, in harnessing chromatin remodelling and transcriptional complexes to overcome critical barriers to direct cardiac reprogramming.

Also flagged:ironOAosteoarthritisiron influx transporterTfR1iron efflux transporter
Journal Article 2021-05-03 ✓ 2 Snippets Jing X, Du T, Li T, Yang X, Wang G, Liu X, Jiang Z, Cui X.
In-Text Gene Mentions

…mutations in theHFEgene.…

…al demonstrated thatHFE‐KO mice developed more…

Show Full Abstract

Iron overload is common in elderly people which is implicated in the disease progression of osteoarthritis (OA), however, how iron homeostasis is regulated during the onset and progression of OA and how it contributes to the pathological transition of articular chondrocytes remain unknown. In the present study, we developed an in vitro approach to investigate the roles of iron homeostasis and iron overload mediated oxidative stress in chondrocytes under an inflammatory environment. We found that pro-inflammatory cytokines could disrupt chondrocytes iron homeostasis via upregulating iron influx transporter TfR1 and downregulating iron efflux transporter FPN, thus leading to chondrocytes iron overload. Iron overload would promote the expression of chondrocytes catabolic markers, MMP3 and MMP13 expression. In addition, we found that oxidative stress and mitochondrial dysfunction played important roles in iron overload-induced cartilage degeneration, reducing iron concentration using iron chelator or antioxidant drugs could inhibit iron overload-induced OA-related catabolic markers and mitochondrial dysfunction. Our results suggest that pro-inflammatory cytokines could disrupt chondrocytes iron homeostasis and promote iron influx, iron overload-induced oxidative stress and mitochondrial dysfunction play important roles in iron overload-induced cartilage degeneration.

Also flagged:lung cancermelanomahepatocellular carcinomatumorgene expressionimmune response
Journal Article 2021-05-03 ✓ 1 Snippet Zhao F, Xu N, Yang J, Li B, Shi J, Zheng Y, Xu L.
In-Text Gene Mentions

…SPEG , andDNAH10mutations were significantly…

Show Full Abstract

Immune checkpoint inhibitors (ICI) prolong the survival for advanced/metastatic patients with lung cancer or melanoma; however, for hepatocellular carcinoma (HCC) patients, a durable response has not been reported. Herein, we used a total of 719 HCC patients with public genomic data to determine potential prognostic and immunogenic subtypes. The non-negative matrix factorization (NMF) method was applied to identify the immune classes and potential subtypes. The proportion of tumor infiltration immune cells was estimated using the CIBERSORT algorithm. Gene set enrichment analysis (GSEA) was utilized to calculate the dysregulated pathways. By using NMF analysis for the gene expression profile of the top immune genes, one HCC subtype with better survival (i.e., low-risk subtype) and another with worse survival (i.e., high-risk subtype) were identified in 3 HCC cohorts (all <i>P</i> < 0.05). Better immune cell infiltration, increased enrichment of immune signatures, higher expression of checkpoints, and elevated tumor mutation load (TML) were significantly enriched in the low-risk subtype (all <i>P</i> < 0.05). Higher mutation rates of immune response genes (e.g., <i>TP53</i> and <i>MUC16</i>) were also observed in the low-risk subtype (both <i>P</i> < 0.05). Discovery of the HCC low-risk subtype might provide clues for HCC prognosis and immunotherapy prediction.

Also flagged:ArsenicwaterLgr5gene expressionprogenitorcell differentiation
Journal Article 2021-05-03 ✓ 2 Snippets Jatko JT, Darling CL, Kellett MP, Bain LJ.
In-Text Gene Mentions

…protein expression ofOlfm4.…

Olfm4

Show Full Abstract

Arsenic is a global health concern that causes toxicity through ingestion of contaminated water and food. In vitro studies suggest that arsenic reduces stem and progenitor cell differentiation. Thus, this study determined if arsenic disrupted intestinal stem cell (ISC) differentiation, thereby altering the number, location, and/or function of intestinal epithelial cells. Adult male C57BL/6 mice were exposed to 0 or 100 ppb sodium arsenite (As<sup>III</sup>) through drinking water for 5 weeks. Duodenal sections were collected to assess changes in morphology, proliferation, and cell types. qPCR analysis revealed a 40% reduction in Lgr5 transcripts, an ISC marker, in the arsenic-exposed mice, although there were no changes in the protein expression of Olfm4. Secretory cell-specific transcript markers of Paneth (Defa1), Goblet (Tff3), and secretory transit amplifying (Math1) cells were reduced by 51%, 44%, and 30% respectively, in the arsenic-exposed mice, indicating significant impacts on the Wnt-dependent differentiation pathway. Further, protein levels of phosphorylated β-catenin were reduced in the arsenic-exposed mice, which increased the expression of Wnt-dependent transcripts CD44 and c-myc. PCA analysis, followed by MANOVA and regression analyses, revealed significant changes and correlations between Lgr5 and the transit amplifying (TA) cell markers Math1 and Hes1, which are in the secretory cell pathway. Similar comparisons between Math1 and Defa1 show that terminal differentiation into Paneth cells is also reduced in the arsenic-exposed mice. The data suggests that ISCs are not lost following arsenic exposure, but rather, specific Wnt-dependent progenitor cell formation and terminal differentiation in the small intestine is reduced.

Also flagged:MIR22HGtumorObesitybreast cancercancerreverse transcription
Journal Article 2021-05-03 No Snippets Choudhry H, Hassan MA, Al-Malki AL, Al-Sakkaf KA.
Show Full Abstract

Long non-coding RNAs (lncRNAs), a type of cellular RNA, play a critical regulatory role in several physiological developments and pathological processes, such as tumorigenesis and tumor progression. Obesity is a risk factor for a number of serious health conditions, including breast cancer (BC). However, the underlying mechanisms behind the association between obesity and increased BC incidence and mortality remain unclear. Several studies have reported changes in lncRNA expression due to obesity and BC, independently encouraging further investigation of the relationship between the two in connection with lncRNAs. The present study was designed to first screen for the expression of 29 selected lncRNAs that showed a link to cancer or obesity in the blood of a selected cohort of 6 obese and 6 non-obese patients with BC. The expression levels of significantly expressed lncRNAs, <i>AP001429.1, PCAT6, P5549, P19461</i> and <i>P3134</i>, were further investigated in a larger cohort of 69 patients with BC (36 obese and 33 non-obese), using reverse transcription-quantitative polymerase chain reaction. Results showed not only that <i>AP001429.1</i> remained significantly downregulated in the larger cohort (P=0.002), but also that it was associated with several clinicopathological characteristics, such as negative HER2 status, negative E-cadherin expression, negative vascular invasion, negative margin invasion and LCIS. These findings suggest that obesity may have a role in inhibiting <i>AP001429.1</i> expression, which may serve as a novel potential biomarker and therapeutic target for BC.

Also flagged:cancertumorimmune responseCD4CD8fh
Journal Article 2021-05-03 ✓ 2 Snippets Basu A, Ramamoorthi G, Albert G, Gallen C, Beyer A, Snyder C, Koski G, Disis ML, Czerniecki BJ, Kodumudi K.
In-Text Gene Mentions

A mouse model of melanoma showed presence of DCC in various organs, such as the lungs, skin and reproductive tract, and regulation of their non-proliferative status by TH1 immune cells (204).

TH1 cells can reduce proliferation and mediate dormancy in these disseminated cancer cells (DCC) via IFN-γ dependent STAT1 signaling pathway activation and anti-tumor immunity (113).

Show Full Abstract

Current success of immunotherapy in cancer has drawn attention to the subsets of T<sub>H</sub> cells in the tumor which are critical for activation of anti-tumor response either directly by themselves or by stimulating cytotoxic T cell activity. However, presence of immunosuppressive pro-tumorigenic T<sub>H</sub> subsets in the tumor milieu further contributes to the complexity of regulation of T<sub>H</sub> cell-mediated immune response. In this review, we present an overview of the multifaceted positive and negative effects of T<sub>H</sub> cells, with an emphasis on regulation of different T<sub>H</sub> cell subtypes by various immune cells, and how a delicate balance of contradictory signals can influence overall success of cancer immunotherapy. We focus on the regulatory network that encompasses dendritic cell-induced activation of CD4<sup>+</sup> T<sub>H</sub>1 cells and subsequent priming of CD8<sup>+</sup> cytotoxic T cells, along with intersecting anti-inflammatory and pro-tumorigenic T<sub>H</sub>2 cell activity. We further discuss how other tumor infiltrating immune cells such as immunostimulatory T<sub>H</sub>9 and T<sub>fh</sub> cells, immunosuppressive T<sub>reg</sub> cells, and the duality of T<sub>H</sub>17 function contribute to tip the balance of anti- vs pro-tumorigenic T<sub>H</sub> responses in the tumor. We highlight the developing knowledge of CD4<sup>+</sup> T<sub>H</sub>1 immune response against neoantigens/oncodrivers, impact of current immunotherapy strategies on CD4<sup>+</sup> T<sub>H</sub>1 immunity, and how opposing action of T<sub>H</sub> cell subtypes can be explored further to amplify immunotherapy success in patients. Understanding the nuances of CD4<sup>+</sup> T<sub>H</sub> cells regulation and the molecular framework undergirding the balancing act between anti- vs pro-tumorigenic T<sub>H</sub> subtypes is critical for rational designing of immunotherapies that can bypass therapeutic escape to maximize the potential of immunotherapy.

Also flagged:RAD51TNFSF15CCNA2GABARAPL1CancerTTK
Journal Article 2021-05-03 ✓ 3 Snippets Carino A, Graziosi L, Marchianò S, Biagioli M, Marino E, Sepe V, Zampella A, Distrutti E, Donini A, Fiorucci S.
In-Text Gene Mentions

PTGIS

Furthermore, the most upregulated genes specific for intestinal gastric cancer subset resulted OLFM4, involved in early gastric carcinogenesis and associated with prognostic significance in advanced stages (115), CDH17 and TFF3, specific markers of intestinal metaplasia gastric cancer patients (116), TRIM29, identified as oncogene in gastric cancer marker of lymph node metastasis (117, 118), and SYT8, a promising target for the detection, prediction, and treatment of peritoneal metastasis of gastric cancer (119).

…cancer subset resultedOLFM4, involved in early…

Show Full Abstract

Gastric cancer is the fifth most common malignancy but the third leading cause of cancer-associated mortality worldwide. Therapy for gastric cancer remain largely suboptimal making the identification of novel therapeutic targets an urgent medical need. In the present study we have carried out a high-throughput sequencing of transcriptome expression in patients with gastric cancers. Twenty-four patients, among a series of 53, who underwent an attempt of curative surgery for gastric cancers in a single center, were enrolled. Patients were sub-grouped according to their histopathology into diffuse and intestinal types, and the transcriptome of the two subgroups assessed by RNAseq analysis and compared to the normal gastric mucosa. The results of this investigation demonstrated that the two histopathology phenotypes express two different patterns of gene expression. A total of 2,064 transcripts were differentially expressed between neoplastic and non-neoplastic tissues: 772 were specific for the intestinal type and 407 for the diffuse type. Only 885 transcripts were simultaneously differentially expressed by both tumors. The per pathway analysis demonstrated an enrichment of extracellular matrix and immune dysfunction in the intestinal type including CXCR2, CXCR1, FPR2, CARD14, EFNA2, AQ9, TRIP13, KLK11 and GHRL. At the univariate analysis reduced levels AQP9 was found to be a negative predictor of 4 years survival. In the diffuse type low levels CXCR2 and high levels of CARD14 mRNA were negative predictors of 4 years survival. In summary, we have identified a group of genes differentially regulated in the intestinal and diffuse histotypes of gastric cancers with AQP9, CARD14 and CXCR2 impacting on patients' prognosis, although CXCR2 is the only factor independently impacting overall survival.

Also flagged:sulfatedpolysaccharidesviral infectionCOVID-19host cellspolyanions
Journal Article 2021-05-03 ✓ 3 Snippets Andrew M, Jayaraman G.
In-Text Gene Mentions

…Both antithrombin III (ATIII) and Heparin cofactor…

…of PS withantithrombin-IIIthat mediates the…

…heparin cofactor-II andantithrombin-IIIrespectively.…

Show Full Abstract

The viral infection caused by SARS-CoV-2 has increased the mortality rate and engaged several adverse effects on the affected individuals. Currently available antiviral drugs have found to be unsuccessful in the treatment of COVID-19 patients. The demand for efficient antiviral drugs has created a huge burden on physicians and health workers. Plasma therapy seems to be less accomplishable due to insufficient donors to donate plasma and low recovery rate from viral infection. Repurposing of antivirals has been evolved as a suitable strategy in the current treatment and preventive measures. The concept of drug repurposing represents new experimental approaches for effective therapeutic benefits. Besides, SARS-CoV-2 exhibits several complications such as lung damage, blood clot formation, respiratory illness and organ failures in most of the patients. Based on the accumulation of data, sulfated marine polysaccharides have exerted successful inhibition of virus entry, attachment and replication with known or unknown possible mechanisms against deadly animal and human viruses so far. Since the virus entry into the host cells is the key process, the prevention of such entry mechanism makes any antiviral strategy effective. Enveloped viruses are more sensitive to polyanions than non-enveloped viruses. Besides, the viral infection caused by RNA virus types embarks severe oxidative stress in the human body that leads to malfunction of tissues and organs. In this context, polysaccharides play a very significant role in providing shielding effect against the virus due to their polyanionic rich features and a molecular weight that hinders their reactive surface glycoproteins. Significantly the functional groups especially sulfate, sulfate pattern and addition, uronic acids, monosaccharides, glycosidic linkage and high molecular weight have greater influence in the antiviral activity. Moreover, they are very good antioxidants that can reduce the free radical generation and provokes intracellular antioxidant enzymes. Additionally, polysaccharides enable a host-virus immune response, activate phagocytosis and stimulate interferon systems. Therefore, polysaccharides can be used as candidate drugs, adjuvants in vaccines or combination with other antivirals, antioxidants and immune-activating nutritional supplements and antiviral materials in healthcare products to prevent SARS-CoV-2 infection.

Also flagged:Ovarian cancergynecologic malignancyplatinumcancercancersdeath
Journal Article 2021-05-03 No Snippets Ryu J, Thomas SN.
Show Full Abstract

Ovarian cancer is the most lethal gynecologic malignancy among women. Approximately 70-80% of patients with advanced ovarian cancer experience relapse within five years and develop platinum-resistance. The short life expectancy of patients with platinum-resistant or platinum-refractory disease underscores the need to develop new and more effective treatment strategies. Early detection is a critical step in mitigating the risk of disease progression from early to an advanced stage disease, and protein biomarkers have an integral role in this process. The best biological diagnostic tool for ovarian cancer will likely be a combination of biomarkers. Targeted proteomics methods, including mass spectrometry-based approaches, have emerged as robust methods that can address the chasm between initial biomarker discovery and the successful verification and validation of these biomarkers enabling their clinical translation due to the robust sensitivity, specificity, and reproducibility of these versatile methods. In this review, we provide background information on the fundamental principles of biomarkers and the need for improved treatment strategies in ovarian cancer. We also provide insight into the ways in which mass spectrometry-based targeted proteomics approaches can provide greatly needed solutions to many of the challenges related to ovarian cancer biomarker development.

Also flagged:anemiachitosanvinyl alcoholiron oxidewound healingsynthesis
Journal Article 2021-05-03 ✓ 1 Snippet Sathiyaseelan A, Saravanakumar K, Mariadoss AVA, Wang MH.
In-Text Gene Mentions

…Concurrently, iron overload (hemochromatosis), and chronic venous…

Show Full Abstract

Diabetic and anemia-associated diabetic wounds increase the considerable morbidity and mortality in people, as reported by clinical studies. However, no anemia-associated diabetic wound dressing materials have been developed until now. Hence, this study aimed to develop a nanocomposite scaffold composed of chitosan (CS), poly (vinyl alcohol) (PVA), and phytogenic iron oxide nanoparticles (FeO NPs), for accelerated anemia-associated diabetic wound healing. The aqueous leaves extract of <i>Pinus densiflora</i> (PD) was utilized for the synthesis of iron oxide nanoparticles (FeO NPs). TEM and elemental analysis confirmed smaller size PD-FeO NPs (<50 nm) synthesis with the combination of iron and oxide. In addition, in vitro biological studies displayed the moderate antioxidant, antidiabetic activities, and considerable antibacterial activity of PD-FeO NPs. Further, the different concentrations of PD-FeO NPs (0.01, 0.03, and 0.05%) incorporated CS/PVA nanocomposites sponges were developed by the freeze-drying method. The porous structured morphology and the presence of PD-FeO NPs were observed under FE-SEM. Among nanocomposite sponges, PD-FeO NPs (0.01%) incorporated CS/PVA sponges were further chosen for the in vitro wound-healing assay, based on the porous and water sorption nature. Furthermore, the in vitro wound-healing assay revealed that PD-FeO NPs (0.01%) incorporated CS/PVA has significantly increased the cell proliferation in HEK293 cells. In conclusion, the CS/PVA-PD-FeO NPs (0.01%) sponge would be recommended for diabetic wound dressing after a detailed in vivo evaluation.

Also flagged:Ribosomeprotein synthesisbrain disordersneurodegenerative diseasesneurodegenerative disordersHuntingtin
Journal Article 2021-05-03 ✓ 5 Snippets Subramaniam S.
In-Text Gene Mentions

Based on our recent study (Eshraghi et al., Nat Commun 12(1):1461; doi: 10.1038/s41467-021-21637-y), this short commentary will review the mechanistic understanding of Huntingtin (HTT)-mediated ribosome stalling indicating that central defects in protein synthesis in Huntington disease (HD) are orchestrated by jamming of ribosomes on mRNA transcripts.

HTT consists of 3144 amino acids (aa).

HTT, the gene responsible for HD, is CAG (codes for glutamine (Q)) expanded and encodes a 350-kd protein (Figure 1) that has a role in neuronal survival, vesicular trafficking, and transcription, as well as in immune cell functions.

HTT domain analysis reveals an unusual occurrence of 28–36 Huntington/Elongation/A subunit/Target-of-rapamycin (HEAT) repeats with a conserved amino acid sequence that is often found in protein synthesis assemblies, such as eIF4G, that bind to particular RNA- and protein-binding motifs.

…understanding of Huntingtin (HTT)-mediated ribosome stalling i…

Show Full Abstract

A ribosome typically moves at a particular rate on a given mRNA transcript to decode the nucleic acid information required to synthesize proteins. The speed and directionality of the ribosome movements during mRNA translation are determined by the mRNA sequence and structure and by various decoding factors. However, the molecular mechanisms of this remarkable movement during protein synthesis, or its relevance in brain disorders, remain unknown. Recent studies have indicated that defects in protein synthesis occur in various neurodegenerative diseases, but the mechanistic details are unclear. This is a major problem because identifying the factors that determine protein synthesis defects may offer new avenues for developing therapeutic remedies for currently incurable diseases like neurodegenerative disorders. Based on our recent study (Eshraghi <i>et al.</i>, Nat Commun 12(1):1461; doi: 10.1038/s41467-021-21637-y), this short commentary will review the mechanistic understanding of Huntingtin (HTT)-mediated ribosome stalling indicating that central defects in protein synthesis in Huntington disease (HD) are orchestrated by jamming of ribosomes on mRNA transcripts.

Also flagged:hyaluronanhydroxyapatitepolysaccharideextracellularchronic periodontitisPeriodontal disease
Journal Article 2021-05-03 No Snippets Bhowmik E, Rao DPC.
Show Full Abstract

<h4>Background</h4>Hyaluronan is a naturally occurring polysaccharide in the extracellular matrix of the connective tissue. It imparts antibacterial and osteogenic properties to the nano hydroxyapatite bone graft (NHA).<h4>Aim</h4>This study aims to evaluate the efficacy of hyaluronan-NHA (H-NHA) composite in the treatment of infrabony defects in chronic periodontitis patients.<h4>Materials and methods</h4>Eight systemically healthy chronic periodontitis patients with 32 graftable sites were included in the study. After flap reflection and debridement, the defect sites in the test quadrant were filled with H-NHA graft and those in the control quadrant were filled with NHA graft alone. Clinical parameters such as probing pocket depth (PPD) and clinical attachment level (CAL) were assessed at baseline and 3, 6, 9, and 12 months; bone probing depth (BPD) and radiographic parameters such as amount and percentage of defect depth reduction (DDR, PDDR) and change in alveolar crest level (ALR) were assessed at baseline and 6 and 12 months.<h4>Statistical analysis used</h4>Descriptive statistics, one-way analysis of variance, and Student's <i>t</i>-test were used for statistical analysis.<h4>Results</h4>At the end of 12 months, H-NHA group showed a greater reduction in PPD (5.06 ± 0.582 mm), BPD (4.22 ± 0.371 mm), and gain in CAL (4.00 ± 0.421 mm) as compared to the NHA group (3.21 ± 0.648 mm, 3.21 ± 0.047 mm, and 2.86 ± 0.127 mm, respectively). In addition, DDR, PDDR, and ALR were better in H-NHA group (1.92 ± 0.647 mm 48.22 ± 31.561 mm, and 1.22 ± 0.808 mm, respectively) as compared to the NHA group (1.14 ± 0.602 mm, 20.14 ± 25.349 mm, and 0.89 ± 0.626 mm, respectively). Statistically significant improvements in all the parameters were seen in the test sites when compared to control sites at 12 months.<h4>Conclusion</h4>H-NHA composite graft can be considered a promising periodontal regenerative material.

Also flagged:peptidemethioninepost-translational modificationlocalizationsSP3peptides
Journal Article 2021-05-03 No Snippets Rossouw SC, Bendou H, Blignaut RJ, Bell L, Rigby J, Christoffels A.
Show Full Abstract

To elucidate cancer pathogenesis and its mechanisms at the molecular level, the collecting and characterization of large individual patient tissue cohorts are required. Since most pathology institutes routinely preserve biopsy tissues by standardized methods of formalin fixation and paraffin embedment, these archived FFPE tissues are important collections of pathology material that include patient metadata, such as medical history and treatments. FFPE blocks can be stored under ambient conditions for decades, while retaining cellular morphology, due to modifications induced by formalin. However, the effect of long-term storage, at resource-limited institutions in developing countries, on extractable protein quantity/quality has not yet been investigated. In addition, the optimal sample preparation techniques required for accurate and reproducible results from label-free LC-MS/MS analysis across block ages remains unclear. This study investigated protein extraction efficiency of 1, 5, and 10-year old human colorectal carcinoma resection tissue and assessed three different gel-free protein purification methods for label-free LC-MS/MS analysis. A sample size of n = 17 patients per experimental group (with experiment power = 0.7 and <i>α</i> = 0.05, resulting in 70% confidence level) was selected. Data were evaluated in terms of protein concentration extracted, peptide/protein identifications, method reproducibility and efficiency, sample proteome integrity (due to storage time), as well as protein/peptide distribution according to biological processes, cellular components, and physicochemical properties. Data are available <i>via</i> ProteomeXchange with identifier PXD017198. The results indicate that the amount of protein extracted is significantly dependent on block age (<i>p</i> < 0.0001), with older blocks yielding less protein than newer blocks. Detergent removal plates were the most efficient and overall reproducible protein purification method with regard to number of peptide and protein identifications, followed by the MagReSyn<sup>®</sup> SP3/HILIC method (with on-bead enzymatic digestion), and lastly the acetone precipitation and formic acid resolubilization method. Overall, the results indicate that long-term storage of FFPE tissues (as measured by methionine oxidation) does not considerably interfere with retrospective proteomic analysis (<i>p</i> > 0.1). Block age mainly affects initial protein extraction yields and does not extensively impact on subsequent label-free LC-MS/MS analysis results.

Thiol-Mediated Uptake.

Also flagged:thioldisulfidesdisulfidesulfurthiosulfinatesdiselenolanes
Journal Article 2021-05-03 No Snippets Laurent Q, Martinent R, Lim B, Pham AT, Kato T, López-Andarias J, Sakai N, Matile S.
Show Full Abstract

This Perspective focuses on thiol-mediated uptake, that is, the entry of substrates into cells enabled by oligochalcogenides or mimics, often disulfides, and inhibited by thiol-reactive agents. A short chronology from the initial observations in 1990 until today is followed by a summary of cell-penetrating poly(disulfide)s (CPDs) and cyclic oligochalcogenides (COCs) as privileged scaffolds in thiol-mediated uptake and inhibitors of thiol-mediated uptake as potential antivirals. In the spirit of a Perspective, the main part brings together topics that possibly could help to explain how thiol-mediated uptake really works. Extreme sulfur chemistry mostly related to COCs and their mimics, cyclic disulfides, thiosulfinates/-onates, diselenolanes, benzopolysulfanes, but also arsenics and Michael acceptors, is viewed in the context of acidity, ring tension, exchange cascades, adaptive networks, exchange affinity columns, molecular walkers, ring-opening polymerizations, and templated polymerizations. Micellar pores (or lipid ion channels) are considered, from cell-penetrating peptides and natural antibiotics to voltage sensors, and a concise gallery of membrane proteins, as possible targets of thiol-mediated uptake, is provided, including CLIC1, a thiol-reactive chloride channel; TMEM16F, a Ca-activated scramblase; EGFR, the epithelial growth factor receptor; and protein-disulfide isomerase, known from HIV entry or the transferrin receptor, a top hit in proteomics and recently identified in the cellular entry of SARS-CoV-2.

Also flagged:Non-Alcoholic Fatty Liver DiseaseObesityNAFLDliver disordersnonalcoholic steatohepatitiscirrhosis
Journal Article 2021-05-03 ✓ 1 Snippet Irazusta F, Vidal F, Pineyro M, Pereda J.
In-Text Gene Mentions

…autoimmune hepatitis andhemochromatosis).…

Show Full Abstract

Abstract Background: Obesity is an increasing global health problem worldwide and Uruguay mirrors these trends. It leads to various complications that include non-alcoholic fatty liver disease (NAFLD). NAFLD is one of the most common liver disorders in industrialized countries with an estimated global prevalence of 25–30%. It is one of the main causes of liver transplant, for which is considered a global public health problem. It includes simple steatosis, and nonalcoholic steatohepatitis, that can progress to cirrhosis and hepatocellular carcinoma. Several studies have shown a close relationship between NAFLD and obesity, with a reported prevalence of up to 80% in these patients. The diagnosis of NAFLD requires demonstration of hepatic steatosis by imaging and exclusion of other causes (absence of significant alcohol consumption, hepatitis infection, autoimmune hepatitis and hemochromatosis). We aimed to determine whether obese patients are evaluated for NAFLD in our endocrinology outpatient clinic. Methods: We conducted a cross-sectional study among 130 obese adults attending our clinic from December 2019 to March 2020. Results: The mean age was 53.8 years (range 19–80) and 80% were women. The mean BMI was 35.9 kg/m2 ± 5.3. Obesity class I, II and III was present in 55%, 25% and 20% of patients, respectively. Type 2 diabetes (DM2), hypertension and dyslipidemia were found in 46.2%, 61.5% and 76.2% of patients, respectively. Abdominal ultrasound was not performed in 62% of patients. Abdominal ultrasound was performed significantly more often in diabetics compared to non-diabetics (48.3% vs. 38%, p=0.046). There was no significant association between obesity class and presence of ultrasound (p=0.20), or liver steatosis (LS) (p=0.58). Seventy-eight percent showed LS (56% mild, 31% moderate and 13% severe). The majority (87.7%) had liver enzymes measured. Patients with and without LS showed similar proportion of elevated enzymes (36% and 36.4%, respectively). The most frequent raised enzyme was gamma-glutamyl transferase, present in 82.9% of patients, and in similar proportion between patients with and without LS (30.8% and 36.4%, respectively). Elevated liver enzymes were found in 22.7%, 46.6% and 80% of mild, moderate and severe LS, respectively. There was significant association between LS grade and liver enzymes elevation (p<0.01). Secondary causes of LS were evaluated in 35.9% of patients, in all cases except one by the gastroenterology service. Half of the individuals had other causes of liver disease (alcoholism (28.6%), hepatitis B virus (28.6%) and methotrexate (28.6%) and prednisone (14.2%)treatment). Conclusion: NAFLD is a scantily evaluated disorder in our obese patients. In those evaluated we found a high frequency of LS, with almost 50% having moderate or severe disease. Further research is warranted to determine its prevalence and associated complications in our population.

Also flagged:Type 2 Diabetes MellitushyperglycemiainsulinsecretionGene Expressionexocytosis
Journal Article 2021-05-03 ✓ 2 Snippets Purohit P, Roy D, Modi A.
In-Text Gene Mentions

…MPO, LTF, CAMP,OLFM4, LCN2, and VCL…

OLFM4deletion has been…

Show Full Abstract

Abstract AbstractBackground: Type II diabetes mellitus (T2DM), characterized by fasting hyperglycemia and impaired insulin secretion and action, is a global health burden. Despite the advances in this field, the mechanism underlying T2DM is far from clear. Objective: The present study sheds light upon a systematic evaluation of the genes, pathways, and interaction networks underlying T2DM with the aid of bioinformatics. Methods: Two Gene Expression Omnibus microarray datasets: GSE148961 and GSE26168 were selected for this study. The common differentially expressed genes (DEG) were sorted by the cutoff |logFC|≥1.0 for the first dataset and |logFC|≥0.263 for the second. Gene Ontology (GO), functional enrichment, and protein-protein interaction (PPI) network were analyzed in Search Tool for the Retrieval of Interacting Genes (STRING). The MCODE and CytoHubba plugins in Cytoscape (v3.7.2) were used to identify gene clusters and top hub genes, respectively. Top 10 nodes were ranked in CytoHubba according to MCC, DMNC, MNC, Degree, and EPC methods, and genes common in at least 3 methods were selected as top nodes. Results: 88 common DEGs were identified by Venn diagram (http://bioinformatics.psb.ugent.be/cgi-bin/liste/Venn/calculate_venn.htpl). GO analysis had 91 significantly enriched biological processes, including regulated exocytosis, secretion, vesicle mediated transport, antibacterial humoral response, and neutrophil degranulation. 4 molecular functions- fibrinogen binding, fibronectin binding, lipopolysaccharide binding, and Extracellular matrix binding; and 38 cellular components, including secretory vesicle, endomembrane system, and adherens junction were significant. The PPI network was highly significant (p-value < 0.001) at medium confidence (0.400) with 88 nodes, 140 edges, and an average node degree of 3.18. The MCODE plugin revealed two clusters, the former with 14 nodes, 73 edges, and a score of 9.733, and the latter with 6 nodes, 14 edges, and a score of 4.000. 9 candidate genes: ELANE, DEFA4, BPI, MPO, LTF, CAMP, OLFM4, LCN2, and VCL were identified, amongst which ELANE, LCN2, and MPO are associated with T2DM pathogenesis, while BPI and LTF have protective effects. OLFM4 deletion has been observed to improve glucose tolerance in mice models. Conclusion: This study provides a comprehensive analysis of genes, pathways, and functions which may be pivotal in T2DM pathogenesis and may represent potential therapeutic targets.

Also flagged:Gonadal NeoplasiaTranscription Factortranscription factorsembryogenesisbindingarchitectural transcription factor
Journal Article 2021-05-03 No Snippets Chen Y, Racca J, Belgorosky A, Weiss M.
Show Full Abstract

Abstract The development of organisms is regulated by a fine-tuned gene-regulatory network, which is driven by transcription factors (TFs). In the embryogenesis, these TFs control diverse cell fates and final body plan. This is precisely regulated by a specific DNA-binding process and enhanceosome formation. A model is provided by testis determination in mammals, which is initiated by a Y-encoded architectural transcription factor, SRY. Mutations in SRY cause gonadal dysgenesis leading to various developmental defects. Such mutations cluster in SRY’s high mobility group (HMG) box, a sequence-specific DNA-binding domain shared by a conserved family of TFs. Here, we have characterized several mutations at the same position in HMG box, which are compatible with either male or female phenotypes as observed in an XY father and XY daughter, respectively. These mutations, at a function-unknown motif in the SRY HMG box, markedly disturb the specific DNA affinity. On transient transfection of human and rodent cell lines, the SRY variants exhibit decreased specific DNA-binding activity (relative to wild type) are associated with mis-formed enhanceosomes. The variants’ gene regulatory activities were reduced by 2-fold relative to wild-type SRY at similar levels of mRNA expression. When engineered mutations that functions to increase the DNA-binding specificity were deployed to SRY variants, the transcriptional activity was in association with restored occupancy of sex-specific enhancer elements in principal downstream gene Sox9. Our findings define a novel mechanism of impaired organogenesis, disturbed specific DNA-binding activity of a master transcription factor, leading to a developmental decision poised at the edge of ambiguity.

Also flagged:Adrenal Hypoplasia Congenitanuclear hormone receptorX-chromosomecancermethylationrestriction enzyme
Journal Article 2021-05-03 No Snippets Riedstra C, Tzagarakis-Foster C.
Show Full Abstract

Abstract Dosage-Sensitive Sex Reversal, Adrenal Hypoplasia Congenita, Critical Region on the X chromosome, gene 1 (DAX-1 or NR0B1) is an orphan nuclear hormone receptor implicated in Adrenal Hypoplasia Congenita (AHC) and Dosage Sensitive Sex Reversal (DSS). In both instances, DAX-1 plays a key role in growth and development by modulating hormone function. In DSS, mutations on the X-chromosome lead to duplication of the region containing DAX-1, resulting in sex reversal, and in AHC, mutations in the DAX-1 gene diminish development of adrenal tissue which leads to a reduction in adrenal hormone production. Expressed predominantly in tissues such as the testes, ovaries, breast, adrenal cortex, and lung, DAX-1 may serve as an indicator of aberrant growth. Here we hypothesize that DAX-1 is epigenetically regulated, specifically in cancer cells, thereby reducing its expression. We surveyed various human cancer cells in order to determine whether inhibiting DNA methylating enzymes released epigenetic control of the DAX-1 gene, resulting in an increase in expression. By implementing molecular techniques, such as bisulfite sequencing, we determined the precise methylation sites in the DAX-1 gene. Additionally, we carried out methylation specific restriction enzyme analysis to differentiate degrees of methylation between lung, breast, liver, cervical, and adrenal carcinoma cell lines. Following confirmation of the precise methylation sites, we utilized chromatin immunoprecipitation (ChIP) in order to identify the modifying proteins present on the DAX-1 CpG islands. In conjunction with these experimental techniques, we implemented a bioinformatics approach to analyze methylation in the promoter region of the DAX-1 gene across tissue sample data acquired from The Cancer Genome Atlas Program. The results of this research could lead to a translational application of understanding where this orphan NHR fits into the development and progression of cancer. As a quickly growing field, cancer epigenetics is a key player in the ongoing pursuit for identifying biomarkers that may be pertinent in future therapeutic applications.

Research Square 2021-05-03 Preprint (No Snippets API) Diamandis C, Seideman D, Adams JS, Honda R, Kaufmann M.
Show Full Abstract

H63D syndrome is a phenotype of a homozygous mutation of the HFE gene H63D, which is otherwise known to cause at most mild classical hemochromatosis. H63D syndrome leads to an iron overload in the body (especially in the brain, heart, liver, skin and male gonads) in the form of non-transferrin bound iron (NTBI) poisoning. Hallmark symptoms and causal factor for H63D syndrome is a mild hypotransferrinemia with transferrin saturation values >50%. H63D syndrome is an incurable multi-organ disease, leading to permanent disability. Our objective was to find out how many carriers of a homozygous H63D mutation develop H63D syndrome. For this purpose, we systematically evaluated the medical records of homozygous carriers of the mutation. We found the syndrome in about 10% of patients with a homozygous mutation. Since a homozygous mutation on the HFE gene H63D is relatively common, the results of our study suggest many undetected or misdiagnosed cases.

Authorea Preprints 2021-05-03 Preprint (No Snippets API) Diamandis DC, Seideman DD, Adams JS, PhD, Kaufmann DM, Davis A, MD.
Show Full Abstract

H63D syndrome is a unique phenotype (clinical picture) of a homozygous mutation of the HFE gene H63D, which is otherwise known to cause at most mild classical hemochromatosis. H63D syndrome is associated with iron overload in the body (especially in the brain, heart, liver, skin and male gonads), but in the form of non-transferrin bound iron (NTBI), not as ferritin. It is an incurable multi-organ disease, leading to permanent disability, which can only be influenced by early diagnosis and a very careful reduction of iron intake (under constant monitoring) as early as in childhood and youth. Our goal was to better highlight the characteristic symptoms of this rare disease to further reduce the risk of missing diagnosing this dangerous condition correctly, even on a primary care level.

Also flagged:Juvenile MyositisLupusgene expressionIFNpathogenesisSkin inflammation
Journal Article 2021-05-02 ✓ 1 Snippet Turnier JL, Pachman LM, Lowe L, Tsoi LC, Elhaj S, Menon R, Amoruso MC, Morgan GA, Gudjonsson JE, Berthier CC, Kahlenberg JM.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

<h4>Objective</h4>Skin inflammation heralds systemic disease in juvenile myositis, yet we lack an understanding of pathogenic mechanisms driving skin inflammation in this disease. We undertook this study to define cutaneous gene expression signatures in juvenile myositis and identify key genes and pathways that differentiate skin disease in juvenile myositis from childhood-onset systemic lupus erythematosus (SLE).<h4>Methods</h4>We used formalin-fixed paraffin-embedded skin biopsy samples from 15 patients with juvenile myositis (9 lesional, 6 nonlesional), 5 patients with childhood-onset SLE, and 8 controls to perform transcriptomic analysis and identify significantly differentially expressed genes (DEGs; q ≤ 5%) between patient groups. We used Ingenuity Pathway Analysis (IPA) to highlight enriched biologic pathways and validated DEGs by immunohistochemistry and quantitative real-time polymerase chain reaction.<h4>Results</h4>Comparison of lesional juvenile myositis to control samples revealed 221 DEGs, with the majority of up-regulated genes representing interferon (IFN)-stimulated genes. CXCL10, CXCL9, and IFI44L represented the top 3 DEGs (fold change 23.2, 13.3, and 13.0, respectively; q < 0.0001). IPA revealed IFN signaling as the top canonical pathway. When compared to childhood-onset SLE, lesional juvenile myositis skin shared a similar gene expression pattern, with only 28 unique DEGs, including FBLN2, CHKA, and SLURP1. Notably, patients with juvenile myositis who were positive for nuclear matrix protein 2 (NXP-2) autoantibodies exhibited the strongest IFN signature and also demonstrated the most extensive Mx-1 immunostaining, both in keratinocytes and perivascular regions.<h4>Conclusion</h4>Lesional juvenile myositis skin demonstrates a striking IFN signature similar to that previously reported in juvenile myositis muscle and peripheral blood. Further investigation into the association of a higher IFN score with NXP-2 autoantibodies may provide insight into disease endotypes and pathogenesis.

Also flagged:anthracyclineAnthracyclinescancertransportationmetabolismoxygen
Journal Article 2021-05-02 No Snippets Berkman AM, Hildebrandt MAT, Landstrom AP.
Show Full Abstract

Anthracyclines, chemotherapeutic agents that have contributed to significant improvements in cancer survival, also carry risk of both acute and chronic cardiotoxicity. This has led to significantly elevated risks of cardiac morbidity and mortality among cancer survivors treated with these agents. Certain treatment related, demographic, and medical factors increase an individual's risk of anthracycline induced cardiotoxicity; however, significant variability among those affected suggests that there is an underlying genetic predisposition to anthracycline induced cardiotoxicity. The current narrative review seeks to summarize the literature to date that has identified genetic variants associated with anthracycline induced cardiotoxicity. These include variants found in genes that encode proteins associated with anthracycline transportation and metabolism, those that encode proteins associated with the generation of reactive oxygen species, and those known to be associated with cardiac disease. While there is strong evidence that susceptibility to anthracycline induced cardiotoxicity has genetic underpinnings, the majority of work to date has been candidate gene analyses. Future work should focus on genome-wide analyses including genome-wide association and sequencing-based studies to confirm and expand these findings.

Also flagged:MRPL15epithelial ovarian cancerovarian cancerHE4MRPL36MRPS16
Journal Article 2021-05-02 ✓ 5 Snippets Xu H, Zou R, Li F, Liu J, Luan N, Wang S, Zhu L.
In-Text Gene Mentions

Among them, MRPL15,32 MRPL36,33 MRPL39,31 and MRPS3134, 35 have been confirmed by some studies to play a role in the occurrence and development of different cancers.

…(MRPL10, MRPL15, MRPL36,MRPL39, MRPS16, and MRPS31)…

…MRPL10, MRPL15, MRPL36,MRPL39, MRPS16, and MRPS31)…

…between MRPS16 andMRPL39( r =…

…, MRPL36 ,MRPL39, and MRPS16…

Show Full Abstract

<h4>Purpose</h4>To analyze the role of six human epididymis protein 4 (HE4)-related mitochondrial ribosomal proteins (MRPs) in ovarian cancer and selected MRPL15, which is most closely related to the tumorigenesis and prognosis of ovarian cancer, for further analyses.<h4>Methods</h4>Using STRING database and MCODE plugin in Cytoscape, six MRPs were identified among genes that are upregulated in response to HE4 overexpression in epithelial ovarian cancer cells. The Cancer Genome Atlas (TCGA) ovarian cancer, GTEX, Oncomine, and TISIDB were used to analyze the expression of the six MRPs. The prognostic impact and genetic variation of these six MRPs in ovarian cancer were evaluated using Kaplan-Meier Plotter and cBioPortal, respectively. MRPL15 was selected for immunohistochemistry and GEO verification. TCGA ovarian cancer data, gene set enrichment analysis, and Enrichr were used to explore the mechanism of MRPL15 in ovarian cancer. Finally, the relationship between MRPL15 expression and immune subtype, tumor-infiltrating lymphocytes, and immune regulatory factors was analyzed using TCGA ovarian cancer data and TISIDB.<h4>Results</h4>Six MRPs (MRPL10, MRPL15, MRPL36, MRPL39, MRPS16, and MRPS31) related to HE4 in ovarian cancer were selected. MRPL15 was highly expressed and amplified in ovarian cancer and was related to the poor prognosis of patients. Mechanism analysis indicated that MRPL15 plays a role in ovarian cancer through pathways such as the cell cycle, DNA repair, and mTOR 1 signaling. High expression of MRPL15 in ovarian cancer may be associated with its amplification and hypomethylation. Additionally, MRPL15 showed the lowest expression in C3 ovarian cancer and was correlated with proliferation of CD8<sup>+</sup> T cells and dendritic cells as well as TGFβR1 and IDO1 expression.<h4>Conclusion</h4>MRPL15 may be a prognostic indicator and therapeutic target for ovarian cancer. Because of its close correlation with HE4, this study provides insights into the mechanism of HE4 in ovarian cancer.

Also flagged:polyprolinecancerneurodegenerative diseasesviral infectionsprolinebinding
Journal Article 2021-05-02 ✓ 1 Snippet Mompeán M, Oroz J, Laurents DV.
In-Text Gene Mentions

In Huntington’s disease, toxic monomers and aggregates of the N‐terminal fragment of the huntingtin protein (Htt NTF) disrupt normal phase separation processes and induce necrosis and apoptosis [35].

Show Full Abstract

Biomolecular condensates are microdroplets that form inside cells and serve to selectively concentrate proteins, RNAs and other molecules for a variety of physiological functions, but can contribute to cancer, neurodegenerative diseases and viral infections. The formation of these condensates is driven by weak, transient interactions between molecules. These weak associations can operate at the level of whole protein domains, elements of secondary structure or even moieties composed of just a few atoms. Different types of condensates do not generally combine to form larger microdroplets, suggesting that each uses a distinct class of attractive interactions. Here, we address whether polyproline II (PPII) helices mediate condensate formation. By combining with PPII-binding elements such as GYF, WW, profilin, SH3 or OCRE domains, PPII helices help form lipid rafts, nuclear speckles, P-body-like neuronal granules, enhancer complexes and other condensates. The number of PPII helical tracts or tandem PPII-binding domains can strongly influence condensate stability. Many PPII helices have a low content of proline residues, which hinders their identification. Recently, we characterized the NMR spectral properties of a Gly-rich, Pro-poor protein composed of six PPII helices. Based on those results, we predicted that many Gly-rich segments may form PPII helices and interact with PPII-binding domains. This prediction is being tested and could join the palette of verified interactions contributing to biomolecular condensate formation.

Also flagged:Galectin-3myocardial fibrosisGal-3atrial fibrillationAFparoxysmal AF
Journal Article 2021-05-02 ✓ 2 Snippets Wang Q, Xu L, Dong Y, Fu Y, Pan Y, Luan Q, Liu Y, Liu Z, Yang X, Chen M, Gao Y.
In-Text Gene Mentions

Hence, they proposed that Gal-3 inhibition therapy may decrease the overall AF burden, increase the possibility of AF termination (self-termination or termination by AAD drugs or DCC) and prevent AF progression.

…AAD drugs orDCC) and prevent AF…

Show Full Abstract

<h4>Background</h4>Galectin-3 (Gal-3) is currently recognized as a promising biomarker for myocardial fibrosis. This study aimed to explore the potential association between plasma Gal-3 concentrations and atrial fibrillation (AF) progression in paroxysmal AF (PAF) patients METHODS: A total of 213 PAF patients were included for analysis in this study. All peripheral blood samples were prospectively collected and stored at -80℃ for subsequent Gal-3 quantification. The AF progression was defined as transformation from PAF to persistent AF (PsAF).<h4>Results</h4>A total of 51 PAF patients progressed to PsAF during a mean follow-up period of 674.44 ± 19.48 days. Patients with AF progression had significantly higher baseline plasma Gal-3 concentrations than those stayed in PAF status (13.52 ± 0.94 vs. 7.93 ± 0.37, p < 0.001). All PAF patients were divided into two subgroups based on the median value of plasma Gal-3 concentrations. Kaplan-Meier curve analysis showed a significantly higher AF progression rate in the higher plasma Gal-3 concentration group (log-rank test p < 0.001). In the Cox regression analysis, plasma Gal-3 concentration and left atrial diameter (LAD) were showed significantly associated with AF progression, even after adjustment of other potential confounding risk factors. Discrimination for AF progression with a simple model which consists of plasma Gal-3 concentration and LAD was modest with a C-statistic 0.72 (95%CI 0.64-0.80). Plasma Gal-3 concentration significantly improved the predictability by appropriately reclassifying several patients with progression (NRI = 28.3%, p = 0.003).<h4>Conclusion</h4>Elevated plasma Gal-3 concentration is significantly associated with AF progression from PAF to PsAF. Plasma Gal-3 concentration could be used for PAF progression risk stratification and guiding management for PAF patients.

Also flagged:AtaxiaVIIDementiaParkinsonismmemorycell morphogenesis involved in neuron differentiation
Journal Article 2021-05-02 ✓ 1 Snippet Chelban V, Breza M, Szaruga M, Vandrovcova J, Murphy D, Lee CJ, Alikhwan S, Bourinaris T, Vavougios G, Ilyas M, Halim SA, Al-Harrasi A, Kartanou C, Ronald C, Blumcke I, Alexoudi A, Gatzonis S, Stefanis L, Karadima G, Wood NW, Chávez-Gutiérrez L, Hardy J, Houlden H, Koutsis G.
In-Text Gene Mentions

…netrin 1 receptor (DCC), 42 , 43…

Show Full Abstract

<h4>Introduction</h4>We investigated the frequency, neuropathology, and phenotypic characteristics of spastic paraplegia (SP) that precedes dementia in presenilin 1 (<i>PSEN1</i>) related familial Alzheimer's disease (AD).<h4>Methods</h4>We performed whole exome sequencing (WES) in 60 probands with hereditary spastic paraplegia (HSP) phenotype that was negative for variants in known HSP-related genes. Where <i>PSEN1</i> mutation was identified, brain biopsy was performed. We investigated the link between HSP and AD with PSEN1 in silico pathway analysis and measured <i>in vivo</i> the stability of PSEN1 mutant γ-secretase.<h4>Results</h4>We identified a <i>PSEN1</i> variant (p.Thr291Pro) in an individual presenting with pure SP at 30 years of age. Three years later, SP was associated with severe, fast cognitive decline and amyloid deposition with diffuse cortical plaques on brain biopsy. Biochemical analysis of p.Thr291Pro <i>PSEN1</i> revealed that although the mutation does not alter active γ-secretase reconstitution, it destabilizes γ-secretase-amyloid precursor protein (APP)/amyloid beta (Aβn) interactions during proteolysis, enhancing the production of longer Aβ peptides. We then extended our analysis to all 226 <i>PSEN1</i> pathogenic variants reported and show that 7.5% were associated with pure SP onset followed by cognitive decline later in the disease. We found that <i>PSEN1</i> cases manifesting initially as SP have a later age of onset, are associated with mutations located beyond codon 200, and showed larger diffuse, cored plaques, amyloid-ring arteries, and severe CAA.<h4>Discussion</h4>We show that pure SP can precede dementia onset in <i>PSEN1-</i>related familial AD. We recommend <i>PSEN1</i> genetic testing in patients presenting with SP with no variants in known HSP-related genes, particularly when associated with a family history of cognitive decline.

Also flagged:Glutathione S-transferaseslung diseasesasthmachronic obstructive pulmonary diseaseinflammatory responsesCOPD
Journal Article 2021-05-02 ✓ 1 Snippet van de Wetering C, Elko E, Berg M, Schiffers CHJ, Stylianidis V, van den Berge M, Nawijn MC, Wouters EFM, Janssen-Heininger YMW, Reynaert NL.
In-Text Gene Mentions

Lastly, it has been shown that GSTP catalyzes the first step in the reduction of the sulfenylated peroxidatic cysteine of PRDX6 (1-cysPRX), a member of the peroxiredoxin family, by binding the sulfenic acid form of Cys47 and glutathionylating the active site cysteine [299,300].

Show Full Abstract

Our lungs are exposed daily to airborne pollutants, particulate matter, pathogens as well as lung allergens and irritants. Exposure to these substances can lead to inflammatory responses and may induce endogenous oxidant production, which can cause chronic inflammation, tissue damage and remodeling. Notably, the development of asthma and Chronic Obstructive Pulmonary Disease (COPD) is linked to the aforementioned irritants. Some inhaled foreign chemical compounds are rapidly absorbed and processed by phase I and II enzyme systems critical in the detoxification of xenobiotics including the glutathione-conjugating enzymes Glutathione S-transferases (GSTs). GSTs, and in particular genetic variants of GSTs that alter their activities, have been found to be implicated in the susceptibility to and progression of these lung diseases. Beyond their roles in phase II metabolism, evidence suggests that GSTs are also important mediators of normal lung growth. Therefore, the contribution of GSTs to the development of lung diseases in adults may already start in utero, and continues through infancy, childhood, and adult life. GSTs are also known to scavenge oxidants and affect signaling pathways by protein-protein interaction. Moreover, GSTs regulate reversible oxidative post-translational modifications of proteins, known as protein S-glutathionylation. Therefore, GSTs display an array of functions that impact the pathogenesis of asthma and COPD. In this review we will provide an overview of the specific functions of each class of mammalian cytosolic GSTs. This is followed by a comprehensive analysis of their expression profiles in the lung in healthy subjects, as well as alterations that have been described in (epithelial cells of) asthmatics and COPD patients. Particular emphasis is placed on the emerging evidence of the regulatory properties of GSTs beyond detoxification and their contribution to (un)healthy lungs throughout life. By providing a more thorough understanding, tailored therapeutic strategies can be designed to affect specific functions of particular GSTs.

Also flagged:Netrin-1PeptideDeathNetrindeleted colorectal carcinomafocal adhesion kinase
Journal Article 2021-05-02 ✓ 5 Snippets Liu L, Liu KJ, Cao JB, Yang J, Yu HL, He XX, He ZX, Zhu XJ.
In-Text Gene Mentions

cDNA sequences corresponding to the FN5 domain of DCC and amino acids 407–443 of Netrin-1 were constructed by ligation into the pGEX-5x-1 vector to produce GST fusion proteins.

Stereotaxic injection of the Netrin-1 protein into the ventricles reduces nerve cell death after subarachnoid hemorrhage through activation of DCC/APPL-1/AKT signaling [26].

To determine whether the activation of the FAK signaling pathway is DCC-dependent, we measured the extent of tyrosine phosphorylation of FAK induced by these peptides in DCC+/+ and DCC−/− neurons.

Truncated peptide E1 of Netrin-1 (residues 407–422) interacts with DCC to protect neurons from hemin-induced toxicity.

The GST-DCC fusion protein was purified with glutathione-SepharoseTM 4B beads (GE Healthcare, Little Chalfont, Buckinghamshire, UK) in accordance with the manufacturer’s protocol.

Show Full Abstract

It has been reported that Netrin-1 is involved in neuroprotection following injury to the central nervous system. However, the minimal functional domain of Netrin-1 which can preserve the neuroprotection but avoid the major side effects of Netrin remains elusive. Here, we investigated the neuroprotective effect of a peptide E1 derived from Netrin-1's EGF3 domain (residues 407-422). We found that it interacts with deleted colorectal carcinoma (DCC) to activate focal adhesion kinase phosphorylation exhibiting neuroprotection. The administration of the peptide E1 was able to improve functional recovery through reduced apoptosis in an experimental murine model of intracerebral hemorrhage (ICH). In summary, we reveal a functional sequence of Netrin-1 that is involved in the recovery process after ICH and identify a candidate peptide for the treatment of ICH.

Also flagged:IronObesityiron regulatory hormonemetabolismFerritinadipocytokines
Journal Article 2021-05-02 ✓ 1 Snippet Moore Heslin A, O'Donnell A, Buffini M, Nugent AP, Walton J, Flynn A, McNulty BA.
In-Text Gene Mentions

…in those withhemochromatosis, which is associated…

Show Full Abstract

Excessive adiposity is associated with several metabolic perturbations including disturbances in iron homeostasis. Increased systemic inflammation in obesity stimulates expression of the iron regulatory hormone hepcidin, which can result in a maldistribution of bodily iron, which may be implicated in metabolic dysfunction. This study aimed to investigate the effect of adiposity and any associated inflammation on iron homeostasis and the potential implications of dysregulated iron metabolism on metabolic health. Analyses are based on a subsample from the cross-sectional Irish National Adult Nutrition Survey (2008-2010) (<i>n</i> = 1120). Ferritin status and risk of iron overload were determined based on established WHO ferritin ranges. Participants were classed as having a healthy % body fat or as having overfat or obesity based on age- and gender-specific % body fat ranges as determined by bioelectrical impedance. Biomarkers of iron status were examined in association with measures of body composition, serum adipocytokines and markers of metabolic health. Excessive % body fat was significantly associated with increased serum hepcidin and ferritin and an increased prevalence of severe risk of iron overload amongst males independent of dietary iron intake. Elevated serum ferritin displayed significant positive associations with serum triglycerides and markers of glucose metabolism, with an increased but non-significant presentation of metabolic risk factors amongst participants with overfat and obesity at severe risk of iron overload. Increased adiposity is associated with dysregulations in iron homeostasis, presenting as increased serum hepcidin, elevated serum ferritin and an increased risk of iron overload, with potential implications in impairments in metabolic health.

Also flagged:G9aGLPhistone methyltransferaseAlzheimer's diseaseADmethyltransferase
Journal Article 2021-05-02 ✓ 1 Snippet Pawar S, Bellver-Sanchis A, Griñán-Ferré C.
In-Text Gene Mentions

…3 homeobox 2 (POU3F2), SATB homeobox 2…

Show Full Abstract

Growing evidence demonstrates the epigenetic modulation as a key event in Alzheimer's disease (AD) pathology. Furthermore, recent data suggests that the epigenetic regulation by the methyltransferase G9a is a crucial mechanism involved in learning and memory formation. Taking this into account, we hereby provide genomics data from pharmacological intervention with UNC0642, a potent and selective G9a/GLP in SAMP8 mice, a model of Alzheimer's disease (AD). We have generated novel RNA-seq and miRNA-seq data for three groups, healthy SAMR1, SAMP8 control and SAMP8 treated with UNC0642 (5 mg/Kg). Thus, the new data can be used to find miRNA regulation, and the mRNA's modified in AD under G9a/GLP inhibition.

Also flagged:cell deathtranslationSPFhowmetkey
Journal Article 2021-05-02 No Snippets Novick TK, Han D, Jacobs EA, Zonderman A, Evans MK, Crews DC.
Show Full Abstract

No abstract available.

Also flagged:Antithrombin IIIidiopathic pulmonary fibrosisnintedaniblung diseasetyrosine kinaseclotting
Journal Article 2021-05-01 ✓ 5 Snippets Bergantini L, d'Alessandro M, Cameli P, Carleo A, Landi C, Vietri L, Lanzarone N, Pieroni M, Sestini P, Bargagli E.
In-Text Gene Mentions

…of antithrombin III (ATIII) in IPF patients…

…protein expression ofATIII.<h4>Aims</h4>Here we used qua…

…to evaluate differentialATIIIconcentrations in IPF…

…the potential ofATIIIas a prognostic…

…h4>Methods</h4>Serum levels ofATIIIwere measured by…

Show Full Abstract

<h4>Background</h4>Idiopathic pulmonary fibrosis (IPF) is a progressive lung disease often managed with nintedanib, a tyrosine kinase inhibitor targeting several profibrotic pathways. Although clotting processes are involved in wound healing and repair in the lung, there are no data on the role of antithrombin III (ATIII) in IPF patients treated with nintedanib. A previous proteomic analysis of serum of IPF patients before and after 1 year of nintedanib treatment showed differential protein expression of ATIII.<h4>Aims</h4>Here we used quantitative methods to evaluate differential ATIII concentrations in IPF patients before and after 1 year of nintedanib treatment and to assess the potential of ATIII as a prognostic biomarker in IPF patients.<h4>Methods</h4>Serum levels of ATIII were measured by enzyme-linked immunosorbent assay in 14 IPF patients before and after 1 year of nintedanib treatment.<h4>Results</h4>A statistically significant inverse correlation was found between serum ATIII concentrations and pulmonary function test parameters in all patients at baseline and follow up. Baseline serum ATIII and bronchoalveolar lavage (BAL) neutrophils proved to be reliable predictors of poor prognosis. A baseline ATIII threshold of 126.5 μg/mL discriminated survivors from non-survivors.<h4>Conclusions</h4>After 12 months of antifibrotic treatment, IPF patients with high serum ATIII concentrations and high BAL neutrophil percentages had a poor prognosis and increased survival risk. The results of this preliminary study suggest that ATIII has potential as a biomarker of IPF severity and in predicting response to nintedanib therapy. As a marker, ATIII showed several advantages over BAL neutrophil percentage.

Also flagged:kinasecancerprotein kinaseskinasesepidermal growth factor receptorbinding
Journal Article 2021-05-01 No Snippets Kim P, Li H, Wang J, Zhao Z.
Show Full Abstract

More than 48 kinase inhibitors (KIs) have been approved by Food and Drug Administration. However, drug-resistance (DR) eventually occurs, and secondary mutations have been found in the previously targeted primary-mutated cancer cells. Cancer and drug research communities recognize the importance of the kinase domain (KD) mutations for kinasopathies. So far, a systematic investigation of kinase mutations on DR hotspots has not been done yet. In this study, we systematically investigated four types of representative mutation hotspots (gatekeeper, G-loop, αC-helix and A-loop) associated with DR in 538 human protein kinases using large-scale cancer data sets (TCGA, ICGC, COSMIC and GDSC). Our results revealed 358 kinases harboring 3318 mutations that covered 702 drug resistance hotspot residues. Among them, 197 kinases had multiple genetic variants on each residue. We further computationally assessed and validated the epidermal growth factor receptor mutations on protein structure and drug-binding efficacy. This is the first study to provide a landscape view of DR-associated mutation hotspots in kinase's secondary structures, and its knowledge will help the development of effective next-generation KIs for better precision medicine.

Also flagged:memorysixnucleotide-directed RNA polymerase subunit beta
Journal Article 2021-05-01 No Snippets Balvert M, Luo X, Luo X, Hauptfeld E, Schönhuth A, Dutilh BE.
Show Full Abstract

<h4>Motivation</h4>The microbes that live in an environment can be identified from the combined genomic material, also referred to as the metagenome. Sequencing a metagenome can result in large volumes of sequencing reads. A promising approach to reduce the size of metagenomic datasets is by clustering reads into groups based on their overlaps. Clustering reads are valuable to facilitate downstream analyses, including computationally intensive strain-aware assembly. As current read clustering approaches cannot handle the large datasets arising from high-throughput metagenome sequencing, a novel read clustering approach is needed. In this article, we propose OGRE, an Overlap Graph-based Read clustEring procedure for high-throughput sequencing data, with a focus on shotgun metagenomes.<h4>Results</h4>We show that for small datasets OGRE outperforms other read binners in terms of the number of species included in a cluster, also referred to as cluster purity, and the fraction of all reads that is placed in one of the clusters. Furthermore, OGRE is able to process metagenomic datasets that are too large for other read binners into clusters with high cluster purity.<h4>Conclusion</h4>OGRE is the only method that can successfully cluster reads in species-specific clusters for large metagenomic datasets without running into computation time- or memory issues.<h4>Availabilityand implementation</h4>Code is made available on Github (https://github.com/Marleen1/OGRE).<h4>Supplementary information</h4>Supplementary data are available at Bioinformatics online.

Also flagged:AgingMethylationHuman Immunodeficiency Virus Infectionhuman immunodeficiency virusHIV) infectionimmunosuppression
Journal Article 2021-05-01 ✓ 3 Snippets Yang CX, Schon E, Obeidat M, Kobor MS, McEwen L, MacIsaac J, Lin D, Novak RM, Hudson F, Klinker H, Dharan N, Horvath S, Bourbeau J, Tan W, Sin DD, Man SFP, Kunisaki K, Leung JM.
In-Text Gene Mentions

The top 5 DMPs corresponded to genes NLRC5, VRK2, B2M, and GPR6 and were highly enriched for cancer-related pathways.

…to genes NLRC5,VRK2, B2M, and GPR6…

VRK2

Show Full Abstract

<h4>Background</h4>Whether accelerated aging develops over the course of chronic human immunodeficiency virus (HIV) infection or can be observed before significant immunosuppression on is unknown. We studied DNA methylation in blood to estimate cellular aging in persons living with HIV (PLWH) before the initiation of antiretroviral therapy (ART).<h4>Methods</h4>A total of 378 ART-naive PLWH who had CD4 T-cell counts >500/µL and were enrolled in the Strategic Timing of Antiretroviral Therapy trial (Pulmonary Substudy) were compared with 34 HIV-negative controls. DNA methylation was performed using the Illumina MethylationEPIC BeadChip. Differentially methylated positions (DMPs) and differentially methylated regions (DMRs) in PLWH compared with controls were identified using a robust linear model. Methylation age was calculated using a previously described epigenetic clock.<h4>Results</h4>There were a total of 56 639 DMPs and 6103 DMRs at a false discovery rate of <0.1. The top 5 DMPs corresponded to genes NLRC5, VRK2, B2M, and GPR6 and were highly enriched for cancer-related pathways. PLWH had significantly higher methylation age than HIV-negative controls (P = .001), with black race, low CD4 and high CD8 T-cell counts, and duration of HIV being risk factors for age acceleration.<h4>Conclusions</h4>PLWH before the initiation of ART and with preserved immune status show evidence of advanced methylation aging.

Also flagged:brain diseasesrestriction enzymesfragile-X syndromeneuronal intranuclear inclusion diseaseoculopharyngodistal myopathymyotonic dystrophy type 1
Journal Article 2021-05-01 No Snippets Morishita S, Ichikawa K, Myers EW.
Show Full Abstract

<h4>Motivation</h4>Long tandem repeat expansions of more than 1000 nt have been suggested to be associated with diseases, but remain largely unexplored in individual human genomes because read lengths have been too short. However, new long-read sequencing technologies can produce single reads of 10 000 nt or more that can span such repeat expansions, although these long reads have high error rates, of 10-20%, which complicates the detection of repetitive elements. Moreover, most traditional algorithms for finding tandem repeats are designed to find short tandem repeats (<1000 nt) and cannot effectively handle the high error rate of long reads in a reasonable amount of time.<h4>Results</h4>Here, we report an efficient algorithm for solving this problem that takes advantage of the length of the repeat. Namely, a long tandem repeat has hundreds or thousands of approximate copies of the repeated unit, so despite the error rate, many short k-mers will be error-free in many copies of the unit. We exploited this characteristic to develop a method for first estimating regions that could contain a tandem repeat, by analyzing the k-mer frequency distributions of fixed-size windows across the target read, followed by an algorithm that assembles the k-mers of a putative region into the consensus repeat unit by greedily traversing a de Bruijn graph. Experimental results indicated that the proposed algorithm largely outperformed Tandem Repeats Finder, a widely used program for finding tandem repeats, in terms of sensitivity.<h4>Availability and implementation</h4>https://github.com/morisUtokyo/mTR.

Also flagged:histoneatrazinemethylationchromatinembryoSP1
Journal Article 2021-05-01 ✓ 3 Snippets Hao N, Xin H, Shi X, Xin J, Zhang H, Guo S, Wang Z, Hao C.
In-Text Gene Mentions

…, Cstf1 ,Mms22l, Ercc3 ,…

…‘gene expression’ (Abt1, Rps3 ,…

…and 2 (Cse1l, Ergic2 )…

Show Full Abstract

<h4>Motivation</h4>Exposure of mouse embryos to atrazine decreased histone tri-methylation at lysine 4 (H3K4me3) and increased expression of alternatively spliced RNA in the third generation. Specificity protein (SP) family motifs were enriched in the promoters of genes encoding differentially expressed alternative transcripts.<h4>Results</h4>H3K4me3 chromatin immunoprecipitation sequencing (ChIP-seq) of mouse sperm, preimplantation embryo development and male gonad primordial germ cells (PGCs) were analysed to identify the paternal reprogramming-escape H3K4me3 regions (RERs). In total, 251 RERs selected harbour H3K4me3 marks in sperm, with signals occurring in the paternal genome during early development and in male gonad PGCs, and 179 genes had RERs within 1 kb of transcription start sites (TSSs). These genes were significantly enriched in the gene ontology term 'RNA splicing', and SP1/SP2/SP3 motifs were enriched in RER-associated H3K4me3 peaks. Overall, the H3K4me3 marks within TSSs of RNA splicing genes survived two rounds of the epigenetic reprogramming process.<h4>Supplementary information</h4>Supplementary data are available at Bioinformatics online.

Also flagged:chronic lymphocytic leukemiaB-cell lymphomaRichter syndromeprotein tyrosine phosphatase receptorMAPKPTPRD
Journal Article 2021-05-01 ✓ 1 Snippet Klintman J, Appleby N, Stamatopoulos B, Ridout K, Eyre TA, Robbe P, Pascua LL, Knight SJL, Dreau H, Cabes M, Popitsch N, Ehinger M, Martín-Subero JI, Campo E, Månsson R, Rossi D, Taylor JC, Vavoulis DV, Schuh A.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

The transformation of chronic lymphocytic leukemia (CLL) to high-grade B-cell lymphoma is known as Richter syndrome (RS), a rare event with dismal prognosis. In this study, we conducted whole-genome sequencing (WGS) of paired circulating CLL (PB-CLL) and RS biopsies (tissue-RS) from 17 patients recruited into a clinical trial (CHOP-O). We found that tissue-RS was enriched for mutations in poor-risk CLL drivers and genes in the DNA damage response (DDR) pathway. In addition, we identified genomic aberrations not previously implicated in RS, including the protein tyrosine phosphatase receptor (PTPRD) and tumor necrosis factor receptor-associated factor 3 (TRAF3). In the noncoding genome, we discovered activation-induced cytidine deaminase-related and unrelated kataegis in tissue-RS affecting regulatory regions of key immune-regulatory genes. These include BTG2, CXCR4, NFATC1, PAX5, NOTCH-1, SLC44A5, FCRL3, SELL, TNIP2, and TRIM13. Furthermore, differences between the global mutation signatures of pairs of PB-CLL and tissue-RS samples implicate DDR as the dominant mechanism driving transformation. Pathway-based clonal deconvolution analysis showed that genes in the MAPK and DDR pathways demonstrate high clonal-expansion probability. Direct comparison of nodal-CLL and tissue-RS pairs from an independent cohort confirmed differential expression of the same pathways by RNA expression profiling. Our integrated analysis of WGS and RNA expression data significantly extends previous targeted approaches, which were limited by the lack of germline samples, and it facilitates the identification of novel genomic correlates implicated in RS transformation, which could be targeted therapeutically. Our results inform the future selection of investigative agents for a UK clinical platform study. This trial was registered at www.clinicaltrials.gov as #NCT03899337.

Also flagged:idiopathic hypogonadotropic hypogonadismIHHAXLCCDC141CHD7DMXL2
Journal Article 2021-05-01 ✓ 5 Snippets Zhang J, Tang SY, Zhu XB, Li P, Lu JQ, Cong JS, Wang LB, Zhang F, Li Z.
In-Text Gene Mentions

Notably, one reported and 10 novel variants in eight known IHH causative genes (AXL, CCDC141, CHD7, DMXL2, FGFR1, PNPLA6, POLR3A, and PROKR2), nine variants in nine recently reported candidate genes (DCAF17, DCC, EGF, IGSF10, NOTCH1, PDE3A, RELN, SLIT2, and TRAPPC9), and four variants in four novel candidate genes for IHH (CCDC88C, CDON, GADL1, and SPRED3) were identified in 77.8% (14/18) of IHH cases.

Of note, the same variant p. Arg1299Cys was previously reported in a patient affected with pituitary stalk interruption syndrome (PSIS) with an etiologic overlap of IHH, who carried a mutationinan IHH-causative gene, tachykinin receptor 3 (TACR3).24 Similarly, the CCDC88C-mutated case P05 in our study carried additional variants in DCC netrin 1 receptor (DCC)p.

…( DCAF17 ,DCC, EGF ,…

…additional variants inDCC netrin 1 receptornetrin 1 receptor…

…1 receptor (DCC)p. Gln91Arg, and…

Show Full Abstract

Dozens of genes are associated with idiopathic hypogonadotropic hypogonadism (IHH) and an oligogenic etiology has been suggested. However, the associated genes may account for only approximately 50% cases. In addition, a genomic systematic pedigree analysis is still lacking. Here, we conducted whole exome sequencing (WES) on 18 unrelated men affected by IHH and their corresponding parents. Notably, one reported and 10 novel variants in eight known IHH causative genes (AXL, CCDC141, CHD7, DMXL2, FGFR1, PNPLA6, POLR3A, and PROKR2), nine variants in nine recently reported candidate genes (DCAF17, DCC, EGF, IGSF10, NOTCH1, PDE3A, RELN, SLIT2, and TRAPPC9), and four variants in four novel candidate genes for IHH (CCDC88C, CDON, GADL1, and SPRED3) were identified in 77.8% (14/18) of IHH cases. Among them, eight (8/18, 44.4%) cases carried more than one variant in IHH-related genes, supporting the oligogenic model. Interestingly, we found that those variants tended to be maternally inherited (maternal with n = 17 vs paternal with n = 7; P = 0.028). Our further retrospective investigation of published reports replicated the maternal bias (maternal with n = 46 vs paternal with n = 28; P = 0.024). Our study extended a variant spectrum for IHH and provided the first evidence that women are probably more tolerant to variants of IHH-related genes than men.

Also flagged:kainic acidglycosylphosphatidylinositolGPI-anchored proteinsbiosynthesisPhosphatidylinositol glycanPIGA
Journal Article 2021-05-01 ✓ 1 Snippet Kandasamy LC, Tsukamoto M, Banov V, Tsetsegee S, Nagasawa Y, Kato M, Matsumoto N, Takeda J, Itohara S, Ogawa S, Young LJ, Zhang Q.
In-Text Gene Mentions

…LAMP, OBCAM, Neurotrimin,Kilon, ephrin-A, semaphoring-7A, gl…

Show Full Abstract

Posttranslational modification of a protein with glycosylphosphatidylinositol (GPI) is a conserved mechanism exists in all eukaryotes. Thus far, >150 human GPI-anchored proteins have been discovered and ~30 enzymes have been reported to be involved in the biosynthesis and maturation of mammalian GPI. Phosphatidylinositol glycan biosynthesis class A protein (PIGA) catalyzes the very first step of GPI anchor biosynthesis. Patients carrying a mutation of the PIGA gene usually suffer from inherited glycosylphosphatidylinositol deficiency (IGD) with intractable epilepsy and intellectual developmental disorder. We generated three mouse models with PIGA deficits specifically in telencephalon excitatory neurons (Ex-M-cko), inhibitory neurons (In-M-cko) or thalamic neurons (Th-H-cko), respectively. Both Ex-M-cko and In-M-cko mice showed impaired long-term fear memory and were more susceptible to kainic acid-induced seizures. In addition, In-M-cko demonstrated a severe limb-clasping phenotype. Hippocampal synapse changes were observed in Ex-M-cko mice. Our Piga conditional knockout mouse models provide powerful tools to understand the cell-type specific mechanisms underlying inherited GPI deficiency and to test different therapeutic modalities.

Also flagged:citalopramAPPamyloid betamitochondrialserotonindepression
Journal Article 2021-05-01 No Snippets Reddy AP, Yin X, Sawant N, Reddy PH.
Show Full Abstract

The purpose of this study is to study the neuroprotective role of selective serotonin reuptake inhibitor (SSRI), citalopram, against Alzheimer's disease (AD). Multiple SSRIs, including citalopram, are reported to treat patients with depression, anxiety and AD. However, their protective cellular mechanisms have not been studied completely. In the current study, we investigated the protective role of citalopram against impaired mitochondrial dynamics, defective mitochondrial biogenesis, defective mitophagy and synaptic dysfunction in immortalized mouse primary hippocampal cells (HT22) expressing mutant APP (SWI/IND) mutations. Using quantitative RT-PCR, immunoblotting, biochemical methods and transmission electron microscopy methods, we assessed mutant full-length APP/C-terminal fragments and Aβ levels and mRNA and protein levels of mitochondrial dynamics, biogenesis, mitophagy and synaptic genes in mAPP-HT22 cells and mAPP-HT22 cells treated with citalopram. Increased levels of mRNA levels of mitochondrial fission genes, decreased levels of fusion biogenesis, autophagy, mitophagy and synaptic genes were found in mAPP-HT22 cells relative to WT-HT22 cells. However, mAPP-HT22 cells treated with citalopram compared to mAPP-HT22 cells revealed reduced levels of the mitochondrial fission genes, increased fusion, biogenesis, autophagy, mitophagy and synaptic genes. Our protein data agree with mRNA levels. Transmission electron microscopy revealed significantly increased mitochondrial numbers and reduced mitochondrial length in mAPP-HT22 cells; these were reversed in citalopram-treated mAPP-HT22 cells. Cell survival rates were increased in citalopram-treated mAPP-HT22 relative to citalopram-untreated mAPP-HT22. Further, mAPP and C-terminal fragments werealso reduced in citalopram-treated cells. These findings suggest that citalopram reduces mutant APP and Aβ and mitochondrial toxicities and may have a protective role of mutant APP and Aβ-induced injuries in patients with depression, anxiety and AD.

Also flagged:IGF-IIGF-IIIGFBP-3insulin-like growth factorsIGFscognition
Journal Article 2021-05-01 ✓ 3 Snippets Salzmann A, James SN, Williams DM, Richards M, Cadar D, Schott JM, Coath W, Sudre CH, Chaturvedi N, Garfield V.
In-Text Gene Mentions

…age 53 andACE-IIIat age 69…

…with a lowerACE-IIIscore at age…

…age 69 (scoreACE-III89.48, 95% CI…

Show Full Abstract

<h4>Background</h4>The insulin/insulin-like signaling (IIS) pathways, including insulin-like growth factors (IGFs), vary with age. However, their association with late-life cognition and neuroimaging parameters is not well characterized.<h4>Methods</h4>Using data from the British 1946 birth cohort, we investigated associations of IGF-I, IGF-II and IGF binding protein 3 (IGFBP-3; measured at 53 and 60-64 years of age) with cognitive performance [word-learning test (WLT) and visual letter search (VLS) at 60-64 years and 69 years of age] and cognitive state [Addenbrooke's Cognitive Exam III (ACE-III) at 69-71 years of age], and in a proportion, quantified neuroimaging measures [whole brain volume (WBV), white matter hyperintensity volume (WMHV), hippocampal volume (HV)]. Regression models included adjustments for demographic, lifestyle, and health factors.<h4>Results</h4>Higher IGF-I and IGF-II at 53 years of age was associated with higher ACE-III scores [ß 0.07 95% confidence interval (CI) (0.02, 0.12); scoreACE-III 89.48 (88.86, 90.1), respectively). IGF-II at 53 years of age was additionally associated with higher WLT scores [scoreWLT 20 (19.35, 20.65)]. IGFBP-3 at 60 to 64 years of age was associated with favorable VLS score at 60 to 64 and 69 years of age [ß 0.07 (0.01, 0.12); ß 0.07 (0.02, 0.12), respectively], higher memory and cognitive state at 69 years of age [ß 0.07 (0.01, 0.12); ß 0.07 (0.01, 0.13), respectively], and reduced WMHV [ß -0.1 (-0.21, -0.00)]. IGF-I/IGFBP-3 at 60 to 64 years of was associated with lower VLS scores at 69 years of age [ß -0.08 (-0.15, -0.02)].<h4>Conclusions</h4>Increased measure in IIS parameters (IGF-I, IGF-II, and IGFBP-3) relate to better cognitive state in later life. There were apparent associations with specific cognitive domains (IGF-II relating to memory; IGFBP-3 relating to memory, processing speed, and WMHV; and IGF-I/IGFBP-3 molar ratio related to slower processing speed). IGFs and IGFBP-3 are associated with favorable cognitive function outcomes.

Also flagged:pneumoniaviral infectionsSARS-CoV-2 infectioncoronavirus disease 2019COVID-19angiotensin-converting enzyme 2
Journal Article 2021-05-01 No Snippets Yu J.
Show Full Abstract

The 2019-novel coronavirus (SARS-CoV-2) pneumonia epidemic is a thorny public health problem faced by health officials and a major cause of concern for health professionals. However, the currently used immortalized cell lines and animal models, though easy to manipulate, can not thoroughly simulate real viral activity due to a lack of target cells, species isolation, and insufficient adequate tissues and organs for clinical research. Organoid that emerges as an effective model and time-saving approach can simulate the viral life cycle <i>in vitro</i> and explore a therapeutic target for antiviral drug development. The 3D tissue cultures contain patient-specific stem cells in vitro to mimic the complexity of real tissue within the 3D microstructure that has the same functionality as the tissue of interest. It avoids the problems such as the distortion of genetic markers and animal ethics of using 2D cultures for animal testing and can be employed in studies of specific-organ viral infections to fully understand the physiopathological mechanism of SARS-CoV-2 infection for vaccine research and development.

Also flagged:hematopoiesiscytokinethrombopoietinThpocell cyclemitochondrial
Journal Article 2021-05-01 No Snippets Nakamura-Ishizu A, Chin DWL, Matsumura T, Tan DQ, Mochizuki-Kashio M, Jianwen D, Suda T.
Show Full Abstract

Hematopoietic stem cells (HSC) rarely divide, rest in quiescence, and proliferate only upon stress hematopoiesis. The cytokine thrombopoietin (Thpo) has been perplexingly described to induce quiescence and promote self-renewal divisions in HSCs. To clarify the contradictory effect of Thpo, we conducted a detailed analysis on conventional (Thpo-/-) and liver-specific (Thpofl/fl;AlbCre+/-) Thpo-deletion models. Thpo-/- HSCs exhibited profound loss of quiescence, impaired cell cycle progression, and increased apoptosis. Thpo-/- HSCs also exhibited diminished mitochondrial mass and impaired mitochondrial bioenergetics. Abnormal HSC phenotypes in Thpo-/- mice were reversible after HSC transplantation into wild-type recipients. Moreover, Thpo-/- HSCs acquired quiescence with extended administration of a Thpo receptor agonist, romiplostim, and were prone to subsequent stem cell exhaustion during competitive bone marrow transplantation. Thpofl/fl;AlbCre+/- HSCs exhibited similar stem cell phenotypes but to a lesser degree compared with Thpo-/- HSCs. HSCs that survive Thpo deficiency acquire quiescence in a dose-dependent manner through the modification of their metabolic state.

Also flagged:cytosolic large ribosomal subunitmetabolic processchromosomescytosolic ribosomeCyp4b1serine/threonine-protein phosphatase
Journal Article 2021-05-01 ✓ 4 Snippets Colella JP, Tigano A, Dudchenko O, Omer AD, Khan R, Bochkov ID, Aiden EL, MacManes MD.
In-Text Gene Mentions

PEBP1

DCC-interacting protein 13-beta

Two additional candidate genes, DCC-interacting protein 13-alpha and -beta (APPL1, APPL2), experienced significant selective sweeps in P. crinitus and are important in glucose regulation, insulin response, and fatty acid oxidation, potentially supporting the lipids-for-torpor hypothesis.

…additional candidate genes,DCC-interacting protein 13-alphaprotein 13-alpha and…

Show Full Abstract

Warming climate and increasing desertification urge the identification of genes involved in heat and dehydration tolerance to better inform and target biodiversity conservation efforts. Comparisons among extant desert-adapted species can highlight parallel or convergent patterns of genome evolution through the identification of shared signatures of selection. We generate a chromosome-level genome assembly for the canyon mouse (Peromyscus crinitus) and test for a signature of parallel evolution by comparing signatures of selective sweeps across population-level genomic resequencing data from another congeneric desert specialist (Peromyscus eremicus) and a widely distributed habitat generalist (Peromyscus maniculatus), that may be locally adapted to arid conditions. We identify few shared candidate loci involved in desert adaptation and do not find support for a shared pattern of parallel evolution. Instead, we hypothesize divergent molecular mechanisms of desert adaptation among deer mice, potentially tied to species-specific historical demography, which may limit or enhance adaptation. We identify a number of candidate loci experiencing selective sweeps in the P. crinitus genome that are implicated in osmoregulation (Trypsin, Prostasin) and metabolic tuning (Kallikrein, eIF2-alpha kinase GCN2, APPL1/2), which may be important for accommodating hot and dry environmental conditions.

Also flagged:cognitionDown syndromeintellectual disabilitychromosomebehaviouralgene expression
Journal Article 2021-05-01 ✓ 5 Snippets Duchon A, Del Mar Muniz Moreno M, Martin Lorenzo S, Silva de Souza MP, Chevalier C, Nalesso V, Meziane H, Loureiro de Sousa P, Noblet V, Armspach JP, Brault V, Herault Y.
In-Text Gene Mentions

This could have been due to the fact that this region seems to be under strong regulatory constraints, as on the borders two REST sites and a LaminB1 peak encompassing this region were found (UCSC browser), while Btg3 (BTG Anti-Proliferation Factor 3) and C21orf91 (Chromosome 21 open reading frame 91, also known as D16Ertd472e), and Mrpl39 (Mitochondrial Ribosomal Protein L39), Jam2 (Junctional Adhesion Molecule 2), Atp5J (ATP synthase peripheral stalk subunit F6), Gabpa (GA binding protein transcription factor subunit alpha) and App (amyloid beta precursor protein) were overexpressed in various DS models.

…containing genes betweenMrpl39and Zbtb21 (…

…homologous genes (Mrpl39, Jam2, Atp5j, Gabpa,…

…D16Ertd472e ), andMrpl39( Mitochondrial Ribosomal…

…located upstream ofMrpl39, or to…

Show Full Abstract

Down syndrome (DS) is the most common genetic form of intellectual disability caused by the presence of an additional copy of human chromosome 21 (Hsa21). To provide novel insights into genotype-phenotype correlations, we used standardized behavioural tests, magnetic resonance imaging and hippocampal gene expression to screen several DS mouse models for the mouse chromosome 16 region homologous to Hsa21. First, we unravelled several genetic interactions between different regions of chromosome 16 and how they contribute significantly to altering the outcome of the phenotypes in brain cognition, function and structure. Then, in-depth analysis of misregulated expressed genes involved in synaptic dysfunction highlighted six biological cascades centred around DYRK1A, GSK3β, NPY, SNARE, RHOA and NPAS4. Finally, we provide a novel vision of the existing altered gene-gene crosstalk and molecular mechanisms targeting specific hubs in DS models that should become central to better understanding of DS and improving the development of therapies.

Also flagged:chromosomesgene expressionreproductionspermatogenesischromatinimprinting
Journal Article 2021-05-01 ✓ 1 Snippet de la Filia AG, Mongue AJ, Dorrens J, Lemon H, Laetsch DR, Ross L.
In-Text Gene Mentions

…, mRpL38 ,mRpL39, mRpL43, and…

Show Full Abstract

Genetic conflict is considered a key driver in the evolution of reproductive systems with non-Mendelian inheritance, where parents do not contribute equally to the genetic makeup of their offspring. One of the most extraordinary examples of non-Mendelian inheritance is paternal genome elimination (PGE), a form of haplodiploidy which has evolved repeatedly across arthropods. Under PGE, males are diploid but only transmit maternally inherited chromosomes, while the paternally inherited homologues are excluded from sperm. This asymmetric inheritance is thought to have evolved through an evolutionary arms race between the paternal and maternal genomes over transmission to future generations. In several PGE clades, such as the mealybugs (Hemiptera: Pseudococcidae), paternal chromosomes are not only eliminated from sperm, but also heterochromatinized early in development and thought to remain inactive, which could result from genetic conflict between parental genomes. Here, we present a parent-of-origin allele-specific transcriptome analysis in male mealybugs showing that expression is globally biased toward the maternal genome. However, up to 70% of somatically expressed genes are to some degree paternally expressed, while paternal genome expression is much more restricted in the male reproductive tract, with only 20% of genes showing paternal contribution. We also show that parent-of-origin-specific gene expression patterns are remarkably similar across genotypes, and that genes with completely biparental expression show elevated rates of molecular evolution. Our results provide the clearest example yet of genome-wide genomic imprinting in insects and enhance our understanding of PGE, which will aid future empirical tests of evolutionary theory regarding the origin of this unusual reproductive strategy.

Also flagged:CHCHD10ALSendoplasmic reticulummitochondrialintermembrane spaceautosomal dominant amyotrophic lateral sclerosis
Journal Article 2021-05-01 ✓ 1 Snippet Straub IR, Weraarpachai W, Shoubridge EA.
In-Text Gene Mentions

SLC2A14

Show Full Abstract

Mutations in CHCHD10, coding for a mitochondrial intermembrane space protein, are a rare cause of autosomal dominant amyotrophic lateral sclerosis. Mutation-specific toxic gain of function or haploinsufficiency models have been proposed to explain pathogenicity. To decipher the metabolic dysfunction associated with the haploinsufficient p.R15L variant, we integrated transcriptomic, metabolomic and proteomic data sets in patient cells subjected to an energetic stress that forces the cells to rely on oxidative phosphorylation for ATP production. Patient cells had a complex I deficiency that resulted in an increased NADH/NAD+ ratio, diminished TCA cycle activity, a reorganization of one carbon metabolism and an increased AMP/ATP ratio leading to phosphorylation of AMPK and inhibition of mTORC1. These metabolic changes activated the unfolded protein response (UPR) in the ER through the IRE1/XBP1 pathway, upregulating downstream targets including ATF3, ATF4, CHOP and EGLN3, and two cytokine markers of mitochondrial disease, GDF15 and FGF21. Activation of the mitochondrial UPR was mediated through an upregulation of the transcription factors ATF4 and ATF5, leading to increased expression of mitochondrial proteases and heat shock proteins. There was a striking transcriptional up regulation of at least seven dual specific phosphatases, associated with an almost complete dephosphorylation of JNK isoforms, suggesting a concerted deactivation of MAP kinase pathways. This study demonstrates that loss of CHCHD10 function elicits an energy deficit that activates unique responses to nutrient stress in both the mitochondria and ER, which may contribute to the selective vulnerability of motor neurons.

Also flagged:chromatingene expressionstem cell differentiationtumorcytoplasmicmechanotransduction
Journal Article 2021-05-01 ✓ 1 Snippet Chowdhury F, Huang B, Wang N.
In-Text Gene Mentions

The RNA sequencing data have identified differentially expressed cell adhesion cluster in these soft melanoma tumor‐repopulating cells, which leads to the identification of highly specific and novel biomarkers like Col2a1, Ncam1, F11r, and Negr1 (Talluri et al., 2020).

Show Full Abstract

Increasing evidence demonstrates that mechanical forces, in addition to soluble molecules, impact cell and tissue functions in physiology and diseases. How living cells integrate mechanical signals to perform appropriate biological functions is an area of intense investigation. Here, we review the evidence of the central role of cytoskeletal prestress in mechanotransduction and mechanobiology. Elevating cytoskeletal prestress increases cell stiffness and reinforces cell stiffening, facilitates long-range cytoplasmic mechanotransduction via integrins, enables direct chromatin stretching and rapid gene expression, spurs embryonic development and stem cell differentiation, and boosts immune cell activation and killing of tumor cells whereas lowering cytoskeletal prestress maintains embryonic stem cell pluripotency, promotes tumorigenesis and metastasis of stem cell-like malignant tumor-repopulating cells, and elevates drug delivery efficiency of soft-tumor-cell-derived microparticles. The overwhelming evidence suggests that the cytoskeletal prestress is the governing principle and the cellular hallmark in mechanobiology. The application of mechanobiology to medicine (mechanomedicine) is rapidly emerging and may help advance human health and improve diagnostics, treatment, and therapeutics of diseases.

Also flagged:nucleotidereproductionnucleotideschromosomeBFRABCG4
Journal Article 2021-05-01 ✓ 1 Snippet Yin YH, Zhang XH, Wang XA, Li RH, Zhang YW, Shan XX, You XX, Huang XD, Wu AL, Wang M, Pan XF, Bian C, Jiang WS, Shi Q, Yang JX.
In-Text Gene Mentions

…, phf21a ,sox6, and smad6…

Show Full Abstract

The Dianchi golden-line barbel, <i>Sinocyclocheilus grahami</i> (Regan, 1904), is one of the "Four Famous Fishes" of Yunnan Province, China. Given its economic value, this species has been artificially bred successfully since 2007, with a nationally selected breed (" <i>S. grahami</i>, Bayou No. 1") certified in 2018. For the future utilization of this species, its growth rate, disease resistance, and wild adaptability need to be improved, which could be achieved with the help of molecular marker-assisted selection (MAS). In the current study, we constructed the first chromosome-level genome of <i>S. grahami</i>, assembled 48 pseudo-chromosomes, and obtained a genome assembly of 1.49 Gb. We also performed QTL-seq analysis of <i>S. grahami</i> using the highest and lowest bulks (i.e., largest and smallest size) in both a sibling and random population. We screened two quantitative trait loci (QTLs) (Chr3, 14.9-39.1 Mb and Chr17, 4.1-27.4 Mb) as the major growth-related locations. Several candidate genes (e.g., <i>map2k5</i>, <i>stat1</i>, <i>phf21a</i>, <i>sox6</i>, and <i>smad6</i>) were also identified, with functions related to growth, such as cell differentiation, neuronal development, skeletal muscle development, chondrogenesis, and immunity. These results built a solid foundation for in-depth MAS studies on the growth traits of <i>S. grahami</i>.

Also flagged:Gene expressiondiabetic kidney diseaseneuropathyeNOSdiabetic peripheral neuropathydiabetic complications
Journal Article 2021-05-01 ✓ 2 Snippets Eid SA, Hinder LM, Zhang H, Eksi R, Nair V, Eddy S, Eichinger F, Park M, Saha J, Berthier CC, Jagadish HV, Guan Y, Pennathur S, Hur J, Kretzler M, Feldman EL, Brosius FC.
In-Text Gene Mentions

neuronal growth regulator 1

Negr1

Show Full Abstract

Diabetic kidney disease (DKD) and diabetic peripheral neuropathy (DPN) are two common diabetic complications. However, their pathogenesis remains elusive and current therapies are only modestly effective. We evaluated genome-wide expression to identify pathways involved in DKD and DPN progression in db/db eNOS-/- mice receiving renin-angiotensin-aldosterone system (RAS)-blocking drugs to mimic the current standard of care for DKD patients. Diabetes and eNOS deletion worsened DKD, which improved with RAS treatment. Diabetes also induced DPN, which was not affected by eNOS deletion or RAS blockade. Given the multiple factors affecting DKD and the graded differences in disease severity across mouse groups, an automatic data analysis method, SOM, or self-organizing map was used to elucidate glomerular transcriptional changes associated with DKD, whereas pairwise bioinformatic analysis was used for DPN. These analyses revealed that enhanced gene expression in several pro-inflammatory networks and reduced expression of development genes correlated with worsening DKD. Although RAS treatment ameliorated the nephropathy phenotype, it did not alter the more abnormal gene expression changes in kidney. Moreover, RAS exacerbated expression of genes related to inflammation and oxidant generation in peripheral nerves. The graded increase in inflammatory gene expression and decrease in development gene expression with DKD progression underline the potentially important role of these pathways in DKD pathogenesis. Since RAS blockers worsened this gene expression pattern in both DKD and DPN, it may partly explain the inadequate therapeutic efficacy of such blockers.

Also flagged:COVID-19influenzamembraneWITHdementia
Journal Article 2021-05-01 No Snippets Robinson R, Stinson CK.
Show Full Abstract

<h4>Background</h4>Previous research on nurses during pandemics has focused on nurses working in one facility or type of unit; this study focuses on nurses caring for COVID-19 patients in a variety of units in different sites across the United States.<h4>Objective</h4>The aim of this study was to understand the experiences of registered nurses working with hospitalized COVID-19 patients.<h4>Methods</h4>This study used a hermeneutic phenomenology design. Semistructured interviews via telephone were conducted and then transcribed verbatim. Colaizzi's method of analysis was used. Data saturation was achieved with 14 participants.<h4>Results</h4>Three major themes were evident. They were "the human connection," "the nursing burden," and "coping." Subthemes were identified under each major theme.<h4>Discussion</h4>This study depicted nurses who are caring, empathetic, and resilient. They had many recommendations for fellow nurses, the public, and health care organizations.

Also flagged:FOXO1protein synthesispolyglutamineinsulininsulin like growth factorprotein degradation
Journal Article 2021-05-01 ✓ 5 Snippets Furtado GV, Yang J, Wu D, Papagiannopoulos CI, Terpstra HM, Kuiper EFE, Krauss S, Zhu WG, Kampinga HH, Bergink S.
In-Text Gene Mentions

…DDX18, IGF2BP3 andSTAU1.…

…were obtained using HA-HTTQ43 ( Fig.…

…in both solubleHA-HTT Q43Q43 protein and…

…of these proteins,STAU1, IGF2BP3, FUS, DDX18,…

…in mRNA ofSTAU1, IGF2BP3 and DDX41…

Show Full Abstract

FOXO1, a transcription factor downstream of the insulin/insulin like growth factor axis, has been linked to protein degradation. Elevated expression of FOXO orthologs can also prevent the aggregation of cytosine adenine guanine (CAG)-repeat disease causing polyglutamine (polyQ) proteins but whether FOXO1 targets mutant proteins for degradation is unclear. Here, we show that increased expression of FOXO1 prevents toxic polyQ aggregation in human cells while reducing FOXO1 levels has the opposite effect and accelerates it. Although FOXO1 indeed stimulates autophagy, its effect on polyQ aggregation is independent of autophagy, ubiquitin-proteasome system (UPS) mediated protein degradation and is not due to a change in mutant polyQ protein turnover. Instead, FOXO1 specifically downregulates protein synthesis rates from expanded pathogenic CAG repeat transcripts. FOXO1 orchestrates a change in the composition of proteins that occupy mutant expanded CAG transcripts, including the recruitment of IGF2BP3. This mRNA binding protein enables a FOXO1 driven decrease in pathogenic expanded CAG transcript- and protein levels, thereby reducing the initiation of amyloidogenesis. Our data thus demonstrate that FOXO1 not only preserves protein homeostasis at multiple levels, but also reduces the accumulation of aberrant RNA species that may co-contribute to the toxicity in CAG-repeat diseases.

Also flagged:pyruvate kinaseAnemiaβ-thalassemiaerythropoiesishemeα-globin
Journal Article 2021-05-01 ✓ 1 Snippet Matte A, Federti E, Kung C, Kosinski PA, Narayanaswamy R, Russo R, Federico G, Carlomagno F, Desbats MA, Salviati L, Leboeuf C, Valenti MT, Turrini F, Janin A, Yu S, Beneduce E, Ronseaux S, Iatcenko I, Dang L, Ganz T, Jung CL, Iolascon A, Brugnara C, De Franceschi L.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Anemia in β-thalassemia is related to ineffective erythropoiesis and reduced red cell survival. Excess free heme and accumulation of unpaired α-globin chains impose substantial oxidative stress on β-thalassemic erythroblasts and erythrocytes, impacting cell metabolism. We hypothesized that increased pyruvate kinase activity induced by mitapivat (AG-348) in the Hbbth3/+ mouse model for β-thalassemia would reduce chronic hemolysis and ineffective erythropoiesis through stimulation of red cell glycolytic metabolism. Oral mitapivat administration ameliorated ineffective erythropoiesis and anemia in Hbbth3/+ mice. Increased ATP, reduced reactive oxygen species production, and reduced markers of mitochondrial dysfunction associated with improved mitochondrial clearance suggested enhanced metabolism following mitapivat administration in β-thalassemia. The amelioration of responsiveness to erythropoietin resulted in reduced soluble erythroferrone, increased liver Hamp expression, and diminished liver iron overload. Mitapivat reduced duodenal Dmt1 expression potentially by activating the pyruvate kinase M2-HIF2α axis, representing a mechanism additional to Hamp in controlling iron absorption and preventing β-thalassemia-related liver iron overload. In ex vivo studies on erythroid precursors from patients with β-thalassemia, mitapivat enhanced erythropoiesis, promoted erythroid maturation, and decreased apoptosis. Overall, pyruvate kinase activation as a treatment modality for β-thalassemia in preclinical model systems had multiple beneficial effects in the erythropoietic compartment and beyond, providing a strong scientific basis for further clinical trials.

Also flagged:parturitiontranscription factorsgene expressionactivator protein 1progesterone receptorsoestrogen receptors
Journal Article 2021-05-01 No Snippets Khader N, Shchuka VM, Shynlova O, Mitchell JA.
Show Full Abstract

The onset of labour is a culmination of a series of highly coordinated and preparatory physiological events that take place throughout the gestational period. In order to produce the associated contractions needed for foetal delivery, smooth muscle cells in the muscular layer of the uterus (i.e. myometrium) undergo a transition from quiescent to contractile phenotypes. Here, we present the current understanding of the roles transcription factors play in critical labour-associated gene expression changes as part of the molecular mechanistic basis for this transition. Consideration is given to both transcription factors that have been well-studied in a myometrial context, i.e. activator protein 1, progesterone receptors, oestrogen receptors, and nuclear factor kappa B, as well as additional transcription factors whose gestational event-driving contributions have been demonstrated more recently. These transcription factors may form pregnancy- and labour-associated transcriptional regulatory networks in the myometrium to modulate the timing of labour onset. A more thorough understanding of the transcription factor-mediated, labour-promoting regulatory pathways holds promise for the development of new therapeutic treatments that can be used for the prevention of preterm labour in at-risk women.

Also flagged:agingcancerreverse transcriptaseTERTcatalytic activityribonucleoprotein
Journal Article 2021-05-01 No Snippets Zhai LT, Rety S, Chen WF, Song ZY, Auguin D, Sun B, Dou SX, Xi XG.
Show Full Abstract

Telomerase plays critical roles in cellular aging, in the emergence and/or development of cancer, and in the capacity for stem-cell renewal, consists of a catalytic telomerase reverse transcriptase (TERT) and a template-encoding RNA (TER). TERs from diverse organisms contain two conserved structural elements: the template-pseudoknot (T-PK) and a helical three-way junction (TWJ). Species-specific features of the structure and function of telomerase make obtaining a more in-depth understanding of the molecular mechanism of telomerase particularly important. Here, we report the first structural studies of N-terminally truncated TERTs from Candida albicans and Candida tropicalis in apo form and complexed with their respective TWJs in several conformations. We found that Candida TERT proteins perform only one round of telomere addition in the presence or absence of PK/TWJ and display standard reverse transcriptase activity. The C-terminal domain adopts at least two extreme conformations and undergoes conformational interconversion, which regulates the catalytic activity. Most importantly, we identified a conserved tertiary structural motif, called the U-motif, which interacts with the reverse transcriptase domain and is crucial for catalytic activity. Together these results shed new light on the structure and mechanics of fungal TERTs, which show common TERT characteristics, but also display species-specific features.

Also flagged:TJP1PTPN13HTRA1PARD3MLLT4LNX2
Journal Article 2021-05-01 No Snippets Caillet-Saguy C, Durbesson F, Rezelj VV, Gogl G, Tran QD, Twizere JC, Vignuzzi M, Vincentelli R, Wolff N.
Show Full Abstract

Small linear motifs targeting protein interacting domains called PSD-95/Dlg/ZO-1 (PDZ) have been identified at the C terminus of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) proteins E, 3a, and N. Using a high-throughput approach of affinity-profiling against the full human PDZome, we identified sixteen human PDZ binders of SARS-CoV-2 proteins E, 3A, and N showing significant interactions with dissociation constants values ranging from 3 to 82 μm. Six of them (TJP1, PTPN13, HTRA1, PARD3, MLLT4, LNX2) are also recognized by SARS-CoV while three (NHERF1, MAST2, RADIL) are specific to SARS-CoV-2 E protein. Most of these SARS-CoV-2 protein partners are involved in cellular junctions/polarity and could be also linked to evasion mechanisms of the immune responses during viral infection. Among the binders of the SARS-CoV-2 proteins E, 3a, or N, seven significantly affect viral replication under knock down gene expression in infected cells. This PDZ profiling identifying human proteins potentially targeted by SARS-CoV-2 can help to understand the multifactorial severity of COVID19 and to conceive effective anti-coronaviral agents for therapeutic purposes.

Also flagged:BiotinRpb4CAGElf1Spt4oligonucleotides
Journal Article 2021-05-01 ✓ 1 Snippet Xu J, Chong J, Wang D.
In-Text Gene Mentions

…proteins, such asHTTprotein ( 17…

Show Full Abstract

Transcription elongation can be affected by numerous types of obstacles, such as nucleosome, pausing sequences, DNA lesions and non-B-form DNA structures. Spt4/5 and Elf1 are conserved transcription elongation factors that promote RNA polymerase II (Pol II) bypass of nucleosome and pausing sequences. Importantly, genetic studies have shown that Spt4/5 plays essential roles in the transcription of expanded nucleotide repeat genes associated with inherited neurological diseases. Here, we investigate the function of Spt4/5 and Elf1 in the transcription elongation of CTG•CAG repeat using an in vitro reconstituted yeast transcription system. We found that Spt4/5 helps Pol II transcribe through the CTG•CAG tract duplex DNA, which is in good agreement with its canonical roles in stimulating transcription elongation. In sharp contrast, surprisingly, we revealed that Spt4/5 greatly inhibits Pol II transcriptional bypass of CTG and CAG slip-out structures. Furthermore, we demonstrated that transcription elongation factor Elf1 individually and cooperatively with Spt4/5 inhibits Pol II bypass of the slip-out structures. This study uncovers the important functional interplays between template DNA structures and the function of transcription elongation factors. This study also expands our understanding of the functions of Spt4/5 and Elf1 in transcriptional processing of trinucleotide repeat DNA.

Also flagged:Attention Deficit and Hyperactivity DisorderADHDdopamine carrier proteinDAT1dopamine receptor 5DRD5
Journal Article 2021-05-01 ✓ 2 Snippets Coskun S, Karadag M, Gokcen C, Oztuzcu S.
In-Text Gene Mentions

Some genes have been found associated with ADHD significantly such as dopamine D4 receptor gene (DRD4), dopamine D5 receptor gene (DRD5), dopamine transporter 1 (DAT1), serotonergic receptor (HTR1B), dopamine beta hydroxylase enzyme (DBH), serotonin transporter enzyme (5-HTT) and, synaptosomal-associated protein 25 (SNAP-25) genes [2].

…serotonin transporter enzyme (5-HTT) and, synaptosomal-associated…

Show Full Abstract

<h4>Objective</h4>Although attention deficit hyperactivity disorder (ADHD) is a disease with high genetic transition, our knowledge about the mechanism of the disease is limited. In this study, it was aimed to evaluate the levels of miR-132-3p and miR-942-5p that are associated with the dopamine carrier protein gene (DAT1) and dopamine receptor 5 (DRD5) genes, which have been shown to play a role in the development of ADHD.<h4>Methods</h4>According to the Diagnostic and Statistical Manual of Mental Disorders 5th edition, 50 children diagnosed with ADHD and 48 healthy controls were included in the study. Affective Disorders and Schizophrenia Interview Schedule-Now and Lifetime Version-Turkish Adaptation was used to evaluate ADHD and the diagnoses accompanying ADHD. Quantitative Real-Time Polymerase Chain Reaction was used to evaluate miR-132-3p and miR-942-5p expression levels.<h4>Results</h4>It was observed that miR-132-3p level (p = 0.001) was significantly higher with children with ADHD compared to the control group, and the level of miR-942-5p (p = 0.181) was higher in ADHD but did not reach statistically significant level.<h4>Conclusion</h4>In our study, we found that the increase in the miR-132-3p levels of children with ADHD may be a therapeutic target of the disease.

Also flagged:frontotemporal lobar degenerationmotor neuron diseaseC9orf72hexanucleotidefrontotemporal dementiaamyotrophic lateral sclerosis
Journal Article 2021-05-01 ✓ 1 Snippet DeJesus-Hernandez M, Aleff RA, Jackson JL, Finch NA, Baker MC, Gendron TF, Murray ME, McLaughlin IJ, Harting JR, Graff-Radford NR, Oskarsson B, Knopman DS, Josephs KA, Boeve BF, Petersen RC, Fryer JD, Petrucelli L, Dickson DW, Rademakers R, Ebbert MTW, Wieben ED, van Blitterswijk M.
In-Text Gene Mentions

…genes, such asHTTand TCF4 .…

Show Full Abstract

To examine the length of a hexanucleotide expansion in C9orf72, which represents the most frequent genetic cause of frontotemporal lobar degeneration and motor neuron disease, we employed a targeted amplification-free long-read sequencing technology: No-Amp sequencing. In our cross-sectional study, we assessed cerebellar tissue from 28 well-characterized C9orf72 expansion carriers. We obtained 3507 on-target circular consensus sequencing reads, of which 814 bridged the C9orf72 repeat expansion (23%). Importantly, we observed a significant correlation between expansion sizes obtained using No-Amp sequencing and Southern blotting (P = 5.0 × 10-4). Interestingly, we also detected a significant survival advantage for individuals with smaller expansions (P = 0.004). Additionally, we uncovered that smaller expansions were significantly associated with higher levels of C9orf72 transcripts containing intron 1b (P = 0.003), poly(GP) proteins (P = 1.3 × 10- 5), and poly(GA) proteins (P = 0.005). Thorough examination of the composition of the expansion revealed that its GC content was extremely high (median: 100%) and that it was mainly composed of GGGGCC repeats (median: 96%), suggesting that expanded C9orf72 repeats are quite pure. Taken together, our findings demonstrate that No-Amp sequencing is a powerful tool that enables the discovery of relevant clinicopathological associations, highlighting the important role played by the cerebellar size of the expanded repeat in C9orf72-linked diseases.

Also flagged:Gestational diabetes mellitusmetabolic disorderreproductioncell adhesioncell surfaceextracellular
Journal Article 2021-05-01 No Snippets Alur V, Raju V, Vastrad B, Tengli A, Tengli A, Vastrad C, Kotturshetti S.
Show Full Abstract

Gestational diabetes mellitus (GDM) is the metabolic disorder that appears during pregnancy. The current investigation aimed to identify central differentially expressed genes (DEGs) in GDM. The transcription profiling by array data (E-MTAB-6418) was obtained from the ArrayExpress database. The DEGs between GDM samples and non-GDM samples were analyzed. Functional enrichment analysis were performed using ToppGene. Then we constructed the protein-protein interaction (PPI) network of DEGs by the Search Tool for the Retrieval of Interacting Genes database (STRING) and module analysis was performed. Subsequently, we constructed the miRNA-hub gene network and TF-hub gene regulatory network. The validation of hub genes was performed through receiver operating characteristic curve (ROC). Finally, the candidate small molecules as potential drugs to treat GDM were predicted by using molecular docking. Through transcription profiling by array data, a total of 869 DEGs were detected including 439 up-regulated and 430 down-regulated genes. Functional enrichment analysis showed these DEGs were mainly enriched in reproduction, cell adhesion, cell surface interactions at the vascular wall and extracellular matrix organization. Ten genes, HSP90AA1, EGFR, RPS13, RBX1, PAK1, FYN, ABL1, SMAD3, STAT3 and PRKCA were associated with GDM, according to ROC analysis. Finally, the most significant small molecules were predicted based on molecular docking. This investigation identified hub genes, signal pathways and therapeutic agents, which might help us, enhance our understanding of the mechanisms of GDM and find some novel therapeutic agents for GDM.

Also flagged:Hepatocellular CarcinomaLeucine Aminopeptidase 3cancerscapsuleLAP3phosphoenolpyruvate carboxykinase
Journal Article 2021-05-01 ✓ 1 Snippet Kuhara K, Kitagawa T, Baron B, Tokuda K, Sakamoto K, Nagano H, Nakamura K, Kobayashi M, Nagayasu H, Kuramitsu Y.
In-Text Gene Mentions

PEBP1

Show Full Abstract

<h4>Background/aim</h4>Cancer is the most fatal disease worldwide whose most lethal characteristics are invasion and metastasis. Hepatocellular carcinoma (HCC) is one of the most fatal cancers worldwide. HCC often shows encapsulation, which is related to better prognosis. In this study, proteomic analysis of HCC tissues with and without encapsulation was performed, in order to elucidate the factors which play important roles in encapsulation.<h4>Materials and methods</h4>Five HCC tissues surrounded by a capsule and five HCC tissues which broke the capsule were obtained from patients diagnosed with HCC who underwent surgical liver resection. Protein samples from these tissues were separated by two-dimensional gel electrophoresis (2-DE), and the protein spots whose expression was different between encapsulated and non-encapsulated HCC tissues were identified through gel imaging analysis software. The selected protein spots were analyzed and identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS).<h4>Results</h4>Two-DE analysis showed 14 spots whose expression was different between encapsulated and non-encapsulated HCC tissues. Of these, 9 were up-regulated and 5 were down-regulated in HCC tissues without encapsulation. The validation by Western blot confirmed that leucine aminopeptidase 3 (LAP3) and phosphoenolpyruvate carboxykinase mitochondrial (PCK2) were up-regulated significantly in HCC tissues with a capsule, compared to HCC tissues that broke the capsule.<h4>Conclusion</h4>These findings suggest that LAP3 and PCK2 could be factors responsible for the maintenance of encapsulation in HCC tissues.

Also flagged:APOBECCOVID-19viral genomeApolipoprotein BPolypeptide-likenucleotides
Journal Article 2021-05-01 No Snippets De Maio N, Walker CR, Turakhia Y, Lanfear R, Corbett-Detig R, Goldman N.
Show Full Abstract

The COVID-19 pandemic has seen an unprecedented response from the sequencing community. Leveraging the sequence data from more than 140,000 SARS-CoV-2 genomes, we study mutation rates and selective pressures affecting the virus. Understanding the processes and effects of mutation and selection has profound implications for the study of viral evolution, for vaccine design, and for the tracking of viral spread. We highlight and address some common genome sequence analysis pitfalls that can lead to inaccurate inference of mutation rates and selection, such as ignoring skews in the genetic code, not accounting for recurrent mutations, and assuming evolutionary equilibrium. We find that two particular mutation rates, G →U and C →U, are similarly elevated and considerably higher than all other mutation rates, causing the majority of mutations in the SARS-CoV-2 genome, and are possibly the result of APOBEC and ROS activity. These mutations also tend to occur many times at the same genome positions along the global SARS-CoV-2 phylogeny (i.e., they are very homoplasic). We observe an effect of genomic context on mutation rates, but the effect of the context is overall limited. Although previous studies have suggested selection acting to decrease U content at synonymous sites, we bring forward evidence suggesting the opposite.

Also flagged:Gammap12SNX11SNX10SNXcdd
Journal Article 2021-05-01 ✓ 1 Snippet Vieira N, Rito T, Correia-Neves M, Sousa N.
In-Text Gene Mentions

HD is autosomal dominant inherited progressive brain condition that arises from the trinucleotide repeat expansion in the huntingtin gene (Htt), causing severe cognitive, emotional and motor impairments.

Show Full Abstract

Endocytosis is a fundamental process that controls protein/lipid composition of the plasma membrane, thereby shaping cellular metabolism, sensing, adhesion, signaling, and nutrient uptake. Endocytosis is essential for the cell to adapt to its surrounding environment, and a tight regulation of the endocytic mechanisms is required to maintain cell function and survival. This is particularly significant in the central nervous system (CNS), where composition of neuronal cell surface is crucial for synaptic functioning. In fact, distinct pathologies of the CNS are tightly linked to abnormal endolysosomal function, and several genome wide association analysis (GWAS) and biochemical studies have identified intracellular trafficking regulators as genetic risk factors for such pathologies. The sorting nexins (SNXs) are a family of proteins involved in protein trafficking regulation and signaling. SNXs dysregulation occurs in patients with Alzheimer's disease (AD), Down's syndrome (DS), schizophrenia, ataxia and epilepsy, among others, establishing clear roles for this protein family in pathology. Interestingly, restoration of SNXs levels has been shown to trigger synaptic plasticity recovery in a DS mouse model. This review encompasses an historical and evolutionary overview of SNXs protein family, focusing on its organization, phyla conservation, and evolution throughout the development of the nervous system during speciation. We will also survey SNXs molecular interactions and highlight how defects on SNXs underlie distinct pathologies of the CNS. Ultimately, we discuss possible strategies of intervention, surveying how our knowledge about the fundamental processes regulated by SNXs can be applied to the identification of novel therapeutic avenues for SNXs-related disorders.

Also flagged:cancerTNFSF15CTLA4PVRPDCD1SIGLEC10
Journal Article 2021-05-01 ✓ 3 Snippets Shi H, Yang Y.
In-Text Gene Mentions

BTN2A2

Correlation analysis showed that the expression of CD200, SIPRA, CD276, PDCD1LG2, and TNFSF15 was found significantly correlated with IGS, respectively (Figure 2A, Figure S4A), while the expression of BTN2A2, BTN3A1, CD160, CD200, CD276, and CEACAM1 was found significantly correlated with BGS, respectively (Figure 2B, Figure S4B).

…the expression ofBTN2A2, BTN3A1, CD160, CD200,…

Show Full Abstract

Immune checkpoint blockade (ICB) has become one of the most promising approaches to activating antitumor immunity. However, only a small subset of patients with breast cancer benefit from ICB treatment. To improve the therapeutic effect in the clinic, precision immunotherapy is proposed to accurately eliminate cancer stem cells that contribute to local recurrence or metastasis, but currently little is known about their immunological properties. In this study, breast cancer-specific datasets in The Cancer Genome Atlas were collected and analyzed by using multiple open-access web servers. We found that the immunophenotype of breast cancer was characterized by a hypoactive immune microenvironment and a low response to immune checkpoint blockade. The innate immune checkpoint CD200 and the adaptive immune checkpoint CD276, respectively, exhibited a strong correlation with basal/stem gene signature and invasiveness gene signature, both of which represent breast cancer stem cells. Wnt, TGF-β, and Hedgehog signaling, which are recognized as stemness-related pathways, showed a significant association with the expression of CD200 and CD276, suggesting cancer stem cell-specific immune checkpoints could be downregulated by inhibiting these pathways. Of note, levels of CD200 and CD276 expression were higher in TGF-β dominant breast cancer than in other immune types of breast cancer. We also identified gene signatures that represent Wnt, TGF-β, and Hedgehog signaling-related CD200 and CD276 expression in breast cancer stem cells. For the luminal A subtype, the patient group with a high level of these gene signatures plus a low infiltration of CD8<sup>+</sup> T cells, or dendritic cells, or M1 macrophages had poor overall survival. Our study suggested that CD200 and CD276 are candidate inhibitory immune checkpoints in breast cancer stem cells, which are potentially regulated by Wnt, TGF-β, and Hedgehog signaling. Synergistic inhibition of these stemness-related pathways may improve the efficacy of ICB treatment targeting breast cancer stem cells in precision immunotherapy.

Also flagged:ChiaWateraluminumJenepoxy-da
Journal Article 2021-05-01 No Snippets Hung WH, Teng YJ, Tseng CM, Nguyen HTT.
Show Full Abstract

In this study, we used a hot-pressing process to enhance the photocatalytic properties of TiO<sub>2</sub>/Fe<sub>2</sub>O<sub>3</sub> bimetallic oxide with a periodic patterned structure on the surface to increase photon absorption for photocatalysis in the oxygen evolution reaction for water splitting. The hot-pressed samples show that combining the two metal oxides improves the absorption band edge of the electrode at different wavelengths. The patterned structure obtained using the hot-pressing process successfully improves photon absorption, resulting in a two-fold enhancement compared with a flat surface electrode.

Also flagged:GABARAPL2actindefectsautophagyGABARAPL1ions
Journal Article 2021-05-01 ✓ 1 Snippet Carinci M, Testa B, Bordi M, Milletti G, Bonora M, Antonucci L, Ferraina C, Carro M, Kumar M, Ceglie D, Eck F, Nardacci R, le Guerroué F, Petrini S, Soriano ME, Caruana I, Doria V, Manifava M, Peron C, Lambrughi M, Tiranti V, Behrends C, Papaleo E, Pinton P, Giorgi C, Ktistakis NT, Locatelli F, Nazio F, Cecconi F.
In-Text Gene Mentions

…2016 ) and CUL3‐KLHL20(Liu et al,…

Show Full Abstract

The early secretory pathway and autophagy are two essential and evolutionarily conserved endomembrane processes that are finely interlinked. Although growing evidence suggests that intracellular trafficking is important for autophagosome biogenesis, the molecular regulatory network involved is still not fully defined. In this study, we demonstrate a crucial effect of the COPII vesicle-related protein TFG (Trk-fused gene) on ULK1 puncta number and localization during autophagy induction. This, in turn, affects formation of the isolation membrane, as well as the correct dynamics of association between LC3B and early ATG proteins, leading to the proper formation of both omegasomes and autophagosomes. Consistently, fibroblasts derived from a hereditary spastic paraparesis (HSP) patient carrying mutated TFG (R106C) show defects in both autophagy and ULK1 puncta accumulation. In addition, we demonstrate that TFG activity in autophagy depends on its interaction with the ATG8 protein LC3C through a canonical LIR motif, thereby favouring LC3C-ULK1 binding. Altogether, our results uncover a link between TFG and autophagy and identify TFG as a molecular scaffold linking the early secretion pathway to autophagy.

Also flagged:nonalcoholic fatty liver diseasepolyphenolsliver diseasesNAFLDalcoholfatty liver
Journal Article 2021-05-01 ✓ 1 Snippet Mokhtari E, Farhadnejad H, Salehi-Sahlabadi A, Najibi N, Azadi M, Teymoori F, Mirmiran P.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, virus infection, and…

Show Full Abstract

<h4>Background</h4>Spinach has high antioxidants and polyphenols and showed protective effects against liver diseases in experimental studies. We aimed to assess the association between dietary intake of spinach and odds of nonalcoholic fatty liver disease (NAFLD) in a case-control study among Iranian adults.<h4>Methods</h4>Totally 225 newly diagnosed NAFLD patients and 450 controls, aged 20-60 years, were recruited in this study. Participants' dietary intakes were collected using a valid and reliable 168-item semi-quantitative food frequency questionnaire (FFQ). The logistic regression test was used for assessing the association between total, raw, and boiled dietary spinach with the odds of NAFLD.<h4>Results</h4>The mean (SD) age and BMI of participants (53% male) were 38.1 (8.8) years and 26.8 (4.3) kg/m<sup>2</sup>, respectively. In the final adjusted model for potential confounders, the odds (95% CI) of NAFLD in individuals in the highest tertile of daily total and raw spinach intake was [0.36 (0.19-0.71), P_trend = 0.001] and [0.47 (0.24-0.89), P_trend = 0.008], respectively compared with those in the lowest tertile. Furthermore, in the adjusted analyses, an inverse association was observed between the highest yearly intake versus no raw spinach consumption and odds of NAFLD [(OR 0.41; 95% CI 0.18-0.96), P for trend = 0.013]. However, there was no significant association between higher boiled spinach intake and odds of NAFLD.<h4>Conclusions</h4>The present study found an inverse association between total and raw spinach intake with the odds of NAFLD.

Also flagged:PSRC1INSsodiumST7LTriglyceridesVIII
Journal Article 2021-05-01 ✓ 1 Snippet Hardy DS, Racette SB, Garvin JT, Gebrekristos HT, Mersha TB.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Associations have been observed among genetic variants, dietary patterns, and metabolic syndrome (MetS). A gap in knowledge is whether a genetic risk score (GRS) and dietary patterns interact to increase MetS risk among African Americans. We investigated whether MetS risk was influenced by interaction between a GRS and dietary patterns among Whites and African Americans. A secondary aim examined if molecular genetic clusterings differed by racial ancestry.<h4>Methods</h4>We used longitudinal data over 4-visits (1987-1998) that included 10,681 participants aged 45-64y at baseline from the Atherosclerosis Risk in Communities study (8451 Whites and 2230 African Americans). We constructed a simple-count GRS as the linear weighted sum of high-risk alleles (0, 1, 2) from cardiovascular disease polymorphisms from the genome-wide association studies catalog associated with MetS risk. Three dietary patterns were determined by factor analysis of food frequency questionnaire data: Western, healthy, and high-fat dairy. MetS was defined according to the 2016 National Cholesterol Education Program Adult Treatment Panel III criteria but used 2017 American Heart Association/American College of Cardiology criteria for elevated blood pressure. Analyses included generalized linear model risk ratios (RR), 95% confidence intervals (CI), and Bonferroni correction for multiple testing.<h4>Results</h4>The Western dietary pattern was associated with higher risk for MetS across increasing GRS tertiles among Whites (p < 0.017). The high-fat dairy pattern was protective against MetS, but its impact was most effective in the lowest GRS tertile in Whites (RR = 0.62; CI: 0.52-0.74) and African Americans (RR = 0.67; CI: 0.49-0.91). Among each racial group within GRS tertiles, the Western dietary pattern was associated with development and cycling of MetS status between visits, and the high-fat dairy pattern with being free from MetS (p < 0.017). The healthy dietary pattern was associated with higher risk of MetS among African Americans which may be explained by higher sucrose intake (p < 0.0001). Fewer genes, but more metabolic pathways for obesity, body fat distribution, and lipid and carbohydrate metabolism were identified in African Americans than Whites. Some polymorphisms were linked to the Western and high-fat dairy patterns.<h4>Conclusion</h4>The influence of dietary patterns on MetS risk appears to differ by genetic predisposition and racial ancestry.

Also flagged:neurodegenerative disordersgene expressionsynthesisPrion diseaseamyloid-ßtau
Journal Article 2021-05-01 No Snippets Khan I, Preeti K, Fernandes V, Khatri DK, Singh SB.
Show Full Abstract

Exploring the microRNAs and aptamers for their therapeutic role as biological drugs has expanded the horizon of its applicability against various human diseases, explicitly targeting the genetic materials. RNA-based therapeutics are widely being explored for the treatment and diagnosis of multiple diseases, including neurodegenerative disorders (NDD). Latter includes microRNA, aptamers, ribozymes, and small interfering RNAs (siRNAs), which control the gene expression mainly at the transcriptional strata. One RNA transcript translates into different protein types; hence, therapies targeted at the transcriptional sphere may have prominent and more extensive effects than alternative therapeutics. Unlike conventional gene therapy, RNAs, upon delivery, can either altogether abolish or alter the synthesis of the protein of interest, therefore, regulating their activities in a controlled and diverse manner. NDDs like Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, Prion disease, and others are characterized by deposition of misfolded protein such as amyloid-ß, tau, α-synuclein, huntingtin and prion proteins. Neuroinflammation, one of the perquisites for neurodegeneration, is induced during neurodegenerative pathogenesis. In this review, we discuss microRNAs and aptamers' role as two different RNA-based approaches for their unique ability to regulate protein production at the transcription level, hence offering many advantages over other biologicals. The microRNA acts either by alleviating the malfunctioning RNA expression or by working as a replacement to lost microRNA. On the contrary, aptamer act as a chemical antibody and forms an aptamer-target complex.

Also flagged:gait disorderneurological diseasesmovement disordersPDatypical parkinsonian syndromesessential tremor
Journal Article 2021-05-01 ✓ 1 Snippet Godani M, Lanza G, Trevisan L, Ferri R, Bella R.
In-Text Gene Mentions

HTT

Show Full Abstract

No abstract available.

Also flagged:Msh2GAPDHIlf3Arih1Dmc1Pachytene
Journal Article 2021-05-01 ✓ 1 Snippet Yin H, Kang Z, Zhang Y, Gong Y, Liu M, Xue Y, He W, Wang Y, Zhang S, Xu Q, Fu K, Zheng B, Xie J, Zhang J, Wang Y, Lin M, Zhang Y, Feng H, Xin C, Guan Y, Huang C, Guo X, Wang PJ, Baur JA, Zheng K, Sun Z, Ye L.
In-Text Gene Mentions

…of Sox5 ,Sox6and Sox30 increased…

Show Full Abstract

The transition from meiotic spermatocytes to postmeiotic haploid germ cells constitutes an essential step in spermatogenesis. The epigenomic regulatory mechanisms underlying this transition remain unclear. Here, we find a prominent transcriptomic switch from the late spermatocytes to the early round spermatids during the meiotic-to-postmeiotic transition, which is associated with robust histone acetylation changes across the genome. Among histone deacetylases (HDACs) and acetyltransferases, we find that HDAC3 is selectively expressed in the late meiotic and early haploid stages. Three independent mouse lines with the testis-specific knockout of HDAC3 show infertility and defects in meiotic exit with an arrest at the late stage of meiosis or early stage of round spermatids. Stage-specific RNA-seq and histone acetylation ChIP-seq analyses reveal that HDAC3 represses meiotic/spermatogonial genes and activates postmeiotic haploid gene programs during meiotic exit, with associated histone acetylation alterations. Unexpectedly, abolishing HDAC3 catalytic activity by missense mutations in the nuclear receptor corepressor (NCOR or SMRT) does not cause infertility, despite causing histone hyperacetylation as HDAC3 knockout, demonstrating that HDAC3 enzyme activity is not required for spermatogenesis. Motif analysis of the HDAC3 cistrome in the testes identified SOX30, which has a similar spatiotemporal expression pattern as HDAC3 during spermatogenesis. Depletion of SOX30 in the testes abolishes the genomic recruitment of the HDAC3 to the binding sites. Collectively, these results establish the SOX30/HDAC3 signaling as a key regulator of the transcriptional program in a deacetylase-independent manner during the meiotic-to-postmeiotic transition in spermatogenesis.

Also flagged:centronuclear myopathiestamoxifenoligonucleotidesdynamin 2DNM2amphiphysin 2
Journal Article 2021-05-01 ✓ 1 Snippet Djeddi S, Reiss D, Menuet A, Freismuth S, de Carvalho Neves J, Djerroud S, Massana-Muñoz X, Sosson AS, Kretz C, Raffelsberger W, Keime C, Dorchies OM, Thompson J, Laporte J.
In-Text Gene Mentions

Stau1

Show Full Abstract

Omics analyses are powerful methods to obtain an integrated view of complex biological processes, disease progression, or therapy efficiency. However, few studies have compared different disease forms and different therapy strategies to define the common molecular signatures representing the most significant implicated pathways. In this study, we used RNA sequencing and mass spectrometry to profile the transcriptomes and proteomes of mouse models for three forms of centronuclear myopathies (CNMs), untreated or treated with either a drug (tamoxifen), antisense oligonucleotides reducing the level of dynamin 2 (DNM2), or following modulation of DNM2 or amphiphysin 2 (BIN1) through genetic crosses. Unsupervised analysis and differential gene and protein expression were performed to retrieve CNM molecular signatures. Longitudinal studies before, at, and after disease onset highlighted potential disease causes and consequences. Main pathways in the common CNM disease signature include muscle contraction, regeneration and inflammation. The common therapy signature revealed novel potential therapeutic targets, including the calcium regulator sarcolipin. We identified several novel biomarkers validated in muscle and/or plasma through RNA quantification, western blotting, and enzyme-linked immunosorbent assay (ELISA) assays, including ANXA2 and IGFBP2. This study validates the concept of using multi-omics approaches to identify molecular signatures common to different disease forms and therapeutic strategies.

Also flagged:Smc5maintenance of chromosomeschromatincohesinSmc6SUMO ligase
Journal Article 2021-05-01 ✓ 1 Snippet Yu Y, Li S, Ser Z, Sanyal T, Choi K, Wan B, Kuang H, Sali A, Kentsis A, Patel DJ, Zhao X.
In-Text Gene Mentions

Condensin

Show Full Abstract

Structural maintenance of chromosomes (SMC) complexes are critical chromatin modulators. In eukaryotes, the cohesin and condensin SMC complexes organize chromatin, while the Smc5/6 complex directly regulates DNA replication and repair. The molecular basis for the distinct functions of Smc5/6 is poorly understood. Here, we report an integrative structural study of the budding yeast Smc5/6 holo-complex using electron microscopy, cross-linking mass spectrometry, and computational modeling. We show that the Smc5/6 complex possesses several unique features, while sharing some architectural characteristics with other SMC complexes. In contrast to arm-folded structures of cohesin and condensin, Smc5 and Smc6 arm regions do not fold back on themselves. Instead, these long filamentous regions interact with subunits uniquely acquired by the Smc5/6 complex, namely the Nse2 SUMO ligase and the Nse5/Nse6 subcomplex, with the latter also serving as a linchpin connecting distal parts of the complex. Our 3.0-Å resolution cryoelectron microscopy structure of the Nse5/Nse6 core further reveals a clasped-hand topology and a dimeric interface important for cell growth. Finally, we provide evidence that Nse5/Nse6 uses its SUMO-binding motifs to contribute to Nse2-mediated sumoylation. Collectively, our integrative study identifies distinct structural features of the Smc5/6 complex and functional cooperation among its coevolved unique subunits.

Also flagged:leucine-richDisabled homolog 2ionslocalizationmethionineESI
Journal Article 2021-05-01 No Snippets McBrearty N, Arzumanyan A, Bichenkov E, Merali S, Merali C, Feitelson M.
Show Full Abstract

Chronic infection with hepatitis B virus (HBV) is a major risk factor for the development of hepatocellular carcinoma (HCC). The HBV encoded oncoprotein, HBx, alters the expression of host genes and the activity of multiple signal transduction pathways that contribute to the pathogenesis of HCC by multiple mechanisms independent of HBV replication. However, it is not clear which pathways are the most relevant therapeutic targets in hepatocarcinogenesis. Short chain fatty acids (SCFAs) have strong anti-inflammatory and anti-neoplastic properties, suggesting that they may block the progression of chronic liver disease (CLD) to HCC, thereby identifying the mechanisms relevant to HCC development. This hypothesis was tested in HBx transgenic (HBxTg) mice fed SCFAs. Groups of HBxTg mice were fed with SCFAs or vehicle from 6 to 9 months of age and then assessed for dysplasia, and from 9 to 12 months of age and then assessed for HCC. Livers from 12 month old mice were then analyzed for changes in gene expression by mass spectrometry-based proteomics. SCFA-fed mice had significantly fewer dysplastic and HCC nodules compared to controls at 9 and 12 months, respectively. Pathway analysis of SCFA-fed mice showed down-regulation of signaling pathways altered by HBx in human CLD and HCC, including those involved in inflammation, phosphatidylinositol 3-kinase, epidermal growth factor, and Ras. SCFA treatment promoted increased expression of the tumor suppressor, disabled homolog 2 (DAB2). DAB2 depresses Ras pathway activity, which is constitutively activated by HBx. SCFAs also reduced cell viability in HBx-transfected cell lines in a dose-dependent manner while the viability of primary human hepatocytes was unaffected. These unique findings demonstrate that SCFAs delay the pathogenesis of CLD and development of HCC, and provide insight into some of the underlying mechanisms that are relevant to pathogenesis in that they are responsive to treatment.

Also flagged:pathogenesispolyglutamine (polyQ) diseasesNUDT16nucleotidesR6HD
Journal Article 2021-05-01 ✓ 1 Snippet Peng S, Guo P, Lin X, An Y, Sze KH, Lau MHY, Chen ZS, Wang Q, Li W, Sun JK, Ma SY, Chan TF, Lau KF, Ngo JCK, Kwan KM, Wong CH, Lam SL, Zimmerman SC, Tuccinardi T, Zuo Z, Au-Yeung HY, Chow HM, Chan HYE.
In-Text Gene Mentions

…transcripts and the polyQ-Httprotein, we next…

Show Full Abstract

DNA damage plays a central role in the cellular pathogenesis of polyglutamine (polyQ) diseases, including Huntington's disease (HD). In this study, we showed that the expression of untranslatable expanded CAG RNA per se induced the cellular DNA damage response pathway. By means of RNA sequencing (RNA-seq), we found that expression of the <i>Nudix hydrolase 16</i> (<i>NUDT16</i>) gene was down-regulated in mutant CAG RNA-expressing cells. The loss of NUDT16 function results in a misincorporation of damaging nucleotides into DNAs and leads to DNA damage. We showed that small CAG (sCAG) RNAs, species generated from expanded CAG transcripts, hybridize with CUG-containing <i>NUDT16</i> mRNA and form a CAG-CUG RNA heteroduplex, resulting in gene silencing of <i>NUDT16</i> and leading to the DNA damage and cellular apoptosis. These results were further validated using expanded CAG RNA-expressing mouse primary neurons and in vivo R6/2 HD transgenic mice. Moreover, we identified a bisamidinium compound, DB213, that interacts specifically with the major groove of the CAG RNA homoduplex and disfavors the CAG-CUG heteroduplex formation. This action subsequently mitigated RNA-induced silencing complex (RISC)-dependent <i>NUDT16</i> silencing in both in vitro cell and in vivo mouse disease models. After DB213 treatment, DNA damage, apoptosis, and locomotor defects were rescued in HD mice. This work establishes NUDT16 deficiency by CAG repeat RNAs as a pathogenic mechanism of polyQ diseases and as a potential therapeutic direction for HD and other polyQ diseases.

Also flagged:chronic hepatitis Bnonalcoholic fatty liver diseaseNAFLDaspartate aminotransferaseASTALT
Journal Article 2021-05-01 ✓ 1 Snippet Wang Q, Xie W, Liu L, Wang P, Pan CQ.
In-Text Gene Mentions

…steatosis, such ashemochromatosis, Gilbert Syndrome, Wilson…

Show Full Abstract

<h4>Abstract</h4>To compare the diagnostic utility of serum markers in nonalcoholic fatty liver disease (NAFLD) patients with chronic hepatitis B (CHB).This study enrolled 118 consecutive biopsy-proven NAFLD patients with or without CHB. Fibrosis scores of each marker were compared against histological fibrosis staging. Receiver operating characteristic curve (ROC) analysis helped assess the accuracy of each marker.In patients with both diseases, 12.96% (7/54) had advanced fibrosis on biopsy and aspartate aminotransferase (AST) to platelet ratio index was the best performing marker for predicting advanced fibrosis. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and area under the ROC (95% confidence interval) for AST to platelet ratio index (APRI) were 0%, 93.62%, 0%, 86.27%, and 0.676 (0.524-0.828), respectively. The markers ranked as follows from highest to lowest with respect to their accuracy: APRI; BARD; fibrosis-4; and AST to ALT ratio. In patients without CHB, fibrosis-4 was the best performing marker for predicting advanced fibrosis. The sensitivity, specificity, PPV, NPV, and area under the ROC (95% confidence interval) for fibrosis-4 were 77.78%, 85.45%, 46.67%, 95.92%, and 0.862 (0.745-0.978), respectively.Serum markers are less reliable in predicting advanced fibrosis in NAFLD patients with CHB; APRI is the most accurate predictor of the absence of advanced fibrosis.

Also flagged:topRUNX1acute myeloid leukemiaGNAI1IRF4ENAM
Journal Article 2021-05-01 No Snippets Chen Y, Chen S, Lu J, Yuan D, He L, Qin P, Tan H, Xu L.
Show Full Abstract

<h4>Background</h4>Runt-related transcription factor 1 (RUNX1) is one of the most frequently mutated genes in most of hematological malignancies, especially in acute myeloid leukemia. In the present study, we aimed to identify the key genes and microRNAs based on acute myeloid leukemia with RUNX1 mutation. The newly finding targeted genes and microRNA associated with RUNX1 may benefit to the clinical treatment in acute myeloid leukemia.<h4>Material/methods</h4>The gene and miRNA expression data sets relating to RUNX1 mutation and wild-type adult acute myeloid leukemia (AML) patients were downloaded from The Cancer Genome Atlas database. Differentially expressed miRNAs and differentially expressed genes (DEGs) were identified by edgeR of R platform. Gene ontology and the Kyoto Encyclopedia of Genes and Genomes enrichment analyses were performed by Metascape and Gene set enrichment analysis. The protein-protein interaction network and miRNA-mRNA regulatory network were performed by Search Tool for the Retrieval of Interacting Genes database and Cytoscape software.<h4>Results</h4>A total of 27 differentially expressed miRNAs (25 upregulated and 2 downregulated) and 561 DEGs (429 upregulated and 132 downregulated) were identified. Five miRNAs (miR-151b, miR-151a-5p, let-7a-2-3p, miR-363-3p, miR-20b-5p) had prognostic significance in AML. The gene ontology analysis showed that upregulated DEGs suggested significant enrichment in MHC class II protein complex, extracellular structure organization, blood vessel development, cell morphogenesis involved in differentiation, embryonic morphogenesis, regulation of cell adhesion, and so on. Similarly, the downregulated DEGs were mainly enriched in secretory granule lumen, extracellular structure organization. In the gene set enrichment analysis of Kyoto Encyclopedia of Genes and Genomes pathways, the RUNX1 mutation was associated with adherent junction, WNT signaling pathway, JAK-STAT signaling pathway, pathways in cancer, cell adhesion molecules CAMs, MAPK signaling pathway. Eleven genes (PPBP, APP, CCR5, HLA-DRB1, GNAI1, APLNR, P2RY14, C3AR1, HTR1F, CXCL12, GNG11) were simultaneously identified by hub gene analysis and module analysis. MicroRNA-363-3p may promote the development of RUNX1 mutation AML, targeting SPRYD4 and FNDC3B. In addition, the RUNX1 mutation rates in patient were obviously correlated with age, white blood cell, FAB type, risk(cyto), and risk(molecular) (P < .05).<h4>Conclusion</h4>Our findings have indicated that multiple genes and microRNAs may play a crucial role in RUNX1 mutation AML. MicroRNA-363-3p may promote the development of RUNX1 mutation AML by targeting SPRYD4 and FNDC3B.

Also flagged:Rifapentinepulmonary tuberculosisrifampinisoniazidpyrazinamideethambutol
Journal Article 2021-05-01 No Snippets Dorman SE, Nahid P, Kurbatova EV, Phillips PPJ, Bryant K, Dooley KE, Engle M, Goldberg SV, Phan HTT, Hakim J, Johnson JL, Lourens M, Martinson NA, Muzanyi G, Narunsky K, Nerette S, Nguyen NV, Pham TH, Pierre S, Purfield AE, Samaneka W, Savic RM, Sanne I, Scott NA, Shenje J, Sizemore E, Vernon A, Waja Z, Weiner M, Swindells S, Chaisson RE, AIDS Clinical Trials Group, Tuberculosis Trials Consortium.
Show Full Abstract

<h4>Background</h4>Rifapentine-based regimens have potent antimycobacterial activity that may allow for a shorter course in patients with drug-susceptible pulmonary tuberculosis.<h4>Methods</h4>In an open-label, phase 3, randomized, controlled trial involving persons with newly diagnosed pulmonary tuberculosis from 13 countries, we compared two 4-month rifapentine-based regimens with a standard 6-month regimen consisting of rifampin, isoniazid, pyrazinamide, and ethambutol (control) using a noninferiority margin of 6.6 percentage points. In one 4-month regimen, rifampin was replaced with rifapentine; in the other, rifampin was replaced with rifapentine and ethambutol with moxifloxacin. The primary efficacy outcome was survival free of tuberculosis at 12 months.<h4>Results</h4>Among 2516 participants who had undergone randomization, 2343 had a culture positive for <i>Mycobacterium tuberculosis</i> that was not resistant to isoniazid, rifampin, or fluoroquinolones (microbiologically eligible population; 768 in the control group, 791 in the rifapentine-moxifloxacin group, and 784 in the rifapentine group), of whom 194 were coinfected with human immunodeficiency virus and 1703 had cavitation on chest radiography. A total of 2234 participants could be assessed for the primary outcome (assessable population; 726 in the control group, 756 in the rifapentine-moxifloxacin group, and 752 in the rifapentine group). Rifapentine with moxifloxacin was noninferior to the control in the microbiologically eligible population (15.5% vs. 14.6% had an unfavorable outcome; difference, 1.0 percentage point; 95% confidence interval [CI], -2.6 to 4.5) and in the assessable population (11.6% vs. 9.6%; difference, 2.0 percentage points; 95% CI, -1.1 to 5.1). Noninferiority was shown in the secondary and sensitivity analyses. Rifapentine without moxifloxacin was not shown to be noninferior to the control in either population (17.7% vs. 14.6% with an unfavorable outcome in the microbiologically eligible population; difference, 3.0 percentage points [95% CI, -0.6 to 6.6]; and 14.2% vs. 9.6% in the assessable population; difference, 4.4 percentage points [95% CI, 1.2 to 7.7]). Adverse events of grade 3 or higher occurred during the on-treatment period in 19.3% of participants in the control group, 18.8% in the rifapentine-moxifloxacin group, and 14.3% in the rifapentine group.<h4>Conclusions</h4>The efficacy of a 4-month rifapentine-based regimen containing moxifloxacin was noninferior to the standard 6-month regimen in the treatment of tuberculosis. (Funded by the Centers for Disease Control and Prevention and others; Study 31/A5349 ClinicalTrials.gov number, NCT02410772.).

Also flagged:p53cyclin B1cardiac troponin Tchromatinsarcomeremetabolism
Journal Article 2021-05-01 ✓ 1 Snippet Pettinato AM, Yoo D, VanOudenhove J, Chen YS, Cohn R, Ladha FA, Yang X, Thakar K, Romano R, Legere N, Meredith E, Robson P, Regnier M, Cotney JL, Murry CE, Hinson JT.
In-Text Gene Mentions

…and proliferation, includingSOX6that has been…

Show Full Abstract

Human cardiac regeneration is limited by low cardiomyocyte replicative rates and progressive polyploidization by unclear mechanisms. To study this process, we engineer a human cardiomyocyte model to track replication and polyploidization using fluorescently tagged cyclin B1 and cardiac troponin T. Using time-lapse imaging, in vitro cardiomyocyte replication patterns recapitulate the progressive mononuclear polyploidization and replicative arrest observed in vivo. Single-cell transcriptomics and chromatin state analyses reveal that polyploidization is preceded by sarcomere assembly, enhanced oxidative metabolism, a DNA damage response, and p53 activation. CRISPR knockout screening reveals p53 as a driver of cell-cycle arrest and polyploidization. Inhibiting sarcomere function, or scavenging ROS, inhibits cell-cycle arrest and polyploidization. Finally, we show that cardiomyocyte engraftment in infarcted rat hearts is enhanced 4-fold by the increased proliferation of troponin-knockout cardiomyocytes. Thus, the sarcomere inhibits cell division through a DNA damage response that can be targeted to improve cardiomyocyte replacement strategies.

Also flagged:immune cell responsessteroid hormoneinterleukin-1 receptor type 4inflammatory responsesSLIT and NTRK-like protein 5SLPI
Journal Article 2021-05-01 ✓ 1 Snippet Stelzer IA, Ghaemi MS, Han X, Ando K, Hédou JJ, Feyaerts D, Peterson LS, Rumer KK, Tsai ES, Ganio EA, Gaudillière DK, Tsai AS, Choisy B, Gaigne LP, Verdonk F, Jacobsen D, Gavasso S, Traber GM, Ellenberger M, Stanley N, Becker M, Culos A, Fallahzadeh R, Wong RJ, Darmstadt GL, Druzin ML, Winn VD, Gibbs RS, Ling XB, Sylvester K, Carvalho B, Snyder MP, Shaw GM, Stevenson DK, Contrepois K, Angst MS, Aghaeepour N, Gaudillière B.
In-Text Gene Mentions

ATIII

Show Full Abstract

Estimating the time of delivery is of high clinical importance because pre- and postterm deviations are associated with complications for the mother and her offspring. However, current estimations are inaccurate. As pregnancy progresses toward labor, major transitions occur in fetomaternal immune, metabolic, and endocrine systems that culminate in birth. The comprehensive characterization of maternal biology that precedes labor is key to understanding these physiological transitions and identifying predictive biomarkers of delivery. Here, a longitudinal study was conducted in 63 women who went into labor spontaneously. More than 7000 plasma analytes and peripheral immune cell responses were analyzed using untargeted mass spectrometry, aptamer-based proteomic technology, and single-cell mass cytometry in serial blood samples collected during the last 100 days of pregnancy. The high-dimensional dataset was integrated into a multiomic model that predicted the time to spontaneous labor [<i>R</i> = 0.85, 95% confidence interval (CI) [0.79 to 0.89], <i>P</i> = 1.2 × 10<sup>-40</sup>, <i>N</i> = 53, training set; <i>R</i> = 0.81, 95% CI [0.61 to 0.91], <i>P</i> = 3.9 × 10<sup>-7</sup>, <i>N</i> = 10, independent test set]. Coordinated alterations in maternal metabolome, proteome, and immunome marked a molecular shift from pregnancy maintenance to prelabor biology 2 to 4 weeks before delivery. A surge in steroid hormone metabolites and interleukin-1 receptor type 4 that preceded labor coincided with a switch from immune activation to regulation of inflammatory responses. Our study lays the groundwork for developing blood-based methods for predicting the day of labor, anchored in mechanisms shared in preterm and term pregnancies.

Also flagged:synaptic transmissionHDHuntingtinhistone deacetylase 1neurological diseasePolr2a
Journal Article 2021-05-01 ✓ 5 Snippets Paraskevopoulou F, Parvizi P, Senger G, Tuncbag N, Rosenmund C, Yildirim F.
In-Text Gene Mentions

Here, we performed Patch-sequencing (Patch-seq) in an in vitro HD model to investigate the effects of mutant Huntingtin (Htt) on synaptic transmission and gene transcription in single striatal neurons.

In support of a pivotal role for epigenetic mechanisms in HD pathophysiology, we found that inhibiting histone deacetylase 1/3 activities rectified several functional and morphological deficits and alleviated the aberrant transcriptional profiles in mutant Htt neurons.

…of mutant Huntingtin (Htt) on synaptic transmission…

…deficiencies in mutantHttneurons.…

…profiles in mutantHttneurons.…

Show Full Abstract

Transcriptional dysregulation in Huntington's disease (HD) causes functional deficits in striatal neurons. Here, we performed Patch-sequencing (Patch-seq) in an in vitro HD model to investigate the effects of mutant Huntingtin (Htt) on synaptic transmission and gene transcription in single striatal neurons. We found that expression of mutant <i>Htt</i> decreased the synaptic output of striatal neurons in a cell autonomous fashion and identified a number of genes whose dysregulation was correlated with physiological deficiencies in mutant Htt neurons. In support of a pivotal role for epigenetic mechanisms in HD pathophysiology, we found that inhibiting histone deacetylase 1/3 activities rectified several functional and morphological deficits and alleviated the aberrant transcriptional profiles in mutant Htt neurons. With this study, we demonstrate that Patch-seq technology can be applied both to better understand molecular mechanisms underlying a complex neurological disease at the single-cell level and to provide a platform for screening for therapeutics for the disease.

Also flagged:Chromatinnucleusnucleosomesnucleosomebindingchromatin-binding proteins
Journal Article 2021-05-01 ✓ 1 Snippet Chen P, Li W, Li G.
In-Text Gene Mentions

…the binding oflinker histoneshistones or other…

Show Full Abstract

In eukaryotes, genomic DNA is packaged into chromatin in the nucleus. The accessibility of DNA is dependent on the chromatin structure and dynamics, which essentially control DNA-related processes, including transcription, DNA replication, and repair. All of the factors that affect the structure and dynamics of nucleosomes, the nucleosome-nucleosome interaction interfaces, and the binding of linker histones or other chromatin-binding proteins need to be considered to understand the organization and function of chromatin fibers. In this review, we provide a summary of recent progress on the structure of chromatin fibers in vitro and in the nucleus, highlight studies on the dynamic regulation of chromatin fibers, and discuss their related biological functions and abnormal organization in diseases.

Also flagged:PD-1malignant melanomaS100A9melanomanivolumabCD4
Journal Article 2021-05-01 ✓ 1 Snippet Rad Pour S, Pico de Coaña Y, Demorentin XM, Melief J, Thimma M, Wolodarski M, Gomez-Cabrero D, Hansson J, Kiessling R, Tegner J.
In-Text Gene Mentions

…FOSB, CORO1A, IL27RA,ECI2, SHKBP1, PRPF38A, PGPEP1,…

Show Full Abstract

<h4>Background</h4>While programmed cell death receptor 1 (PD-1) blockade treatment has revolutionized treatment of patients with melanoma, clinical outcomes are highly variable, and only a fraction of patients show durable responses. Therefore, there is a clear need for predictive biomarkers to select patients who will benefit from the treatment.<h4>Method</h4>To identify potential predictive markers for response to PD-1 checkpoint blockade immunotherapy, we conducted single-cell RNA sequencing analyses of peripheral blood mononuclear cells (PBMC) (n=8), as well as an in-depth immune monitoring study (n=20) by flow cytometry in patients with advanced melanoma undergoing treatment with nivolumab at Karolinska University Hospital. Blood samples were collected before the start of treatment and at the time of the second dose.<h4>Results</h4>Unbiased single-cell RNA sequencing of PBMC in patients with melanoma uncovered that a higher frequency of monocytes and a lower ratio of CD4+ T cells to monocyte were inversely associated with overall survival. Similarly, S100A9 expression in the monocytic subset was correlated inversely with overall survival. These results were confirmed by a flow cytometry-based analysis in an independent patient cohort.<h4>Conclusion</h4>Our results suggest that monocytic cell populations can critically determine the outcome of PD-1 blockade, particularly the subset expressing S100A9, which should be further explored as a possible predictive biomarker. Detailed knowledge of the biological role of S100A9+ monocytes is of high translational relevance.

Also flagged:organizationtransportationLMPOPwater
Journal Article 2021-05-01 ✓ 1 Snippet Vadivel SM, Sequeira AH, Sakkariyas RR, Boobalan K.
In-Text Gene Mentions

…also documented thatHFEwas positively related…

Show Full Abstract

This paper aims to study the determinants of the Lean Service System (LSS) on the Operational Performance (OP) of India's mail service in the National Sorting Hub (NSH), Mangaluru, Karnataka, the southern part of India. Measuring the OP in mail service is a big challenge in the postal service industry. Hence, we have conducted a survey, and 150 usable data has measured the impact of Lean Service Practices (LSP), Lean Workplace Environment Practices (LWEP), and Lean Social Practices (LSoP) on the OP. The results are analyzed from the partial least square based structural equation modelling (PLS-SEM) with the support of R programming. The analysis shows that there is positive and significant impact of LSP (<i>β</i> = 0.380, <i>p</i> < .05), followed by LWEP (<i>β</i> = 0.281, <i>p</i> < .05), and LSoP (<i>β</i> = 0.266, <i>p</i> < .05) on OP. The practical effect of the findings of LSS are effectively implemented for enhancing the OP of the business. This research addresses the appropriate empirical model to test LSS in India's postal service industry, which is scant in the existing literature. Moreover, this study helps India Post to review its policy so as to sustain the effectiveness of Lean Service (LS) implementation.

Also flagged:neurodegenerationbrain tumorsgliomasgliomasynapsereverse transcription
Journal Article 2021-05-01 No Snippets Lin H, Yang Y, Hou C, Huang Y, Zhou L, Zheng J, Lv G, Mao R, Chen S, Xu P, Zhou Y, Wang P, Zhou D.
Show Full Abstract

Synapse and synapse-associated proteins (SAPs) play critical roles in various neurodegeneration diseases and brain tumors. However, in lower-grade gliomas (LGG), SAPs have not been explored systematically. Herein, we are going to explore SAPs expression profile and its clinicopathological significance in LGG which can offer new insights to glioma therapy. In the present study, we integrate a list of SAPs that covered 231 proteins with synaptogenesis activity and post synapse formation. The LGG RNA-seq data were downloaded from GEO, TCGA and CGGA database. The prognosis associated SAPs in key modules of PPI (protein-protein interaction networks) was regarded as hub SAPs. Western blot, quantitative reverse transcription PCR (qRT-PCR) and immunochemistry results from HPA database were used to verify the expression of hub SAPs. There were 68 up-regulated SAPs and 44 down-regulated SAPs in LGG tissue compared with normal brain tissue. Data from function enrichment analysis revealed functions of differentially expressed SAPs in synapse organization and glutamatergic receptor pathway in LGGs. Survival analysis revealed that four SAPs, GRIK2, GABRD, GRID2 and ARC were correlate with the prognosis of LGG patients. Interestingly, we found that GABRD were up-regulated in LGG patients with seizures, indicating that SAPs may link to the pathogenesis of seizures in glioma patients. The four-SAPs signature was revealed as an independent prognostic factor in gliomas. Our study presented a novel strategy to assess the prognostic risks of LGGs, based on the expression of SAPs.

Also flagged:TRP1 secretionnucleomodulinubiquitin ligasehost cellorganization
Journal Article 2021-05-01 No Snippets Byerly CD, Patterson LL, McBride JW.
Show Full Abstract

Intracellular bacteria have evolved various strategies to evade host defense mechanisms. Remarkably, the obligately intracellular bacterium, Ehrlichia chaffeensis, hijacks host cell processes of the mononuclear phagocyte to evade host defenses through mechanisms executed in part by tandem repeat protein (TRP) effectors secreted by the type 1 secretion system. In the past decade, TRP120 has emerged as a model moonlighting effector, acting as a ligand mimetic, nucleomodulin and ubiquitin ligase. These defined functions illuminate the diverse roles TRP120 plays in exploiting and manipulating host cell processes, including cytoskeletal organization, vesicle trafficking, cell signaling, transcriptional regulation, post-translational modifications, autophagy and apoptosis. This review will focus on TRP effectors and their expanding roles in infection and provide perspective on Ehrlichia chaffeensis as an invaluable model organism for understanding infection strategies of obligately intracellular bacteria.

Also flagged:AgaroselumenogenesislumenRho-associated kinaseorganizationMEK
Journal Article 2021-05-01 No Snippets Schindler M, Siriwardena D, Kohler TN, Ellermann AL, Slatery E, Munger C, Hollfelder F, Boroviak TE.
Show Full Abstract

Human periimplantation development requires the transformation of the naive pluripotent epiblast into a polarized epithelium. Lumenogenesis plays a critical role in this process, as the epiblast undergoes rosette formation and lumen expansion to form the amniotic cavity. Here, we present a high-throughput in vitro model for epiblast morphogenesis. We established a microfluidic workflow to encapsulate human pluripotent stem cells (hPSCs) into monodisperse agarose microgels. Strikingly, hPSCs self-organized into polarized epiblast spheroids that could be maintained in self-renewing and differentiating conditions. Encapsulated primed hPSCs required Rho-associated kinase inhibition, in contrast to naive hPSCs. We applied microgel suspension culture to examine the lumen-forming capacity of hPSCs and reveal an increase in lumenogenesis during the naive-to-primed transition. Finally, we demonstrate the feasibility of co-encapsulating cell types across different lineages and species. Our work provides a foundation for stem cell-based embryo models to interrogate the critical components of human epiblast self-organization and morphogenesis.

Also flagged:Cas9ribonucleoproteinRNPrestriction factorSAMHD1HIV-1 infection
Journal Article 2021-05-01 No Snippets Hiatt J, Cavero DA, McGregor MJ, Zheng W, Budzik JM, Roth TL, Haas KM, Wu D, Rathore U, Meyer-Franke A, Bouzidi MS, Shifrut E, Lee Y, Kumar VE, Dang EV, Gordon DE, Wojcechowskyj JA, Hultquist JF, Fontaine KA, Pillai SK, Cox JS, Ernst JD, Krogan NJ, Marson A.
Show Full Abstract

Genome engineering of primary human cells with CRISPR-Cas9 has revolutionized experimental and therapeutic approaches to cell biology, but human myeloid-lineage cells have remained largely genetically intractable. We present a method for the delivery of CRISPR-Cas9 ribonucleoprotein (RNP) complexes by nucleofection directly into CD14<sup>+</sup> human monocytes purified from peripheral blood, leading to high rates of precise gene knockout. These cells can be efficiently differentiated into monocyte-derived macrophages or dendritic cells. This process yields genetically edited cells that retain transcript and protein markers of myeloid differentiation and phagocytic function. Genetic ablation of the restriction factor SAMHD1 increased HIV-1 infection >50-fold, demonstrating the power of this system for genotype-phenotype interrogation. This fast, flexible, and scalable platform can be used for genetic studies of human myeloid cells in immune signaling, inflammation, cancer immunology, host-pathogen interactions, and beyond, and could facilitate the development of myeloid cellular therapies.

Also flagged:ATP8A1lamellar bodieslysosome-relatedorganellesAT2cell homeostasis
Journal Article 2021-05-01 No Snippets Kook S, Wang P, Meng S, Jetter CS, Sucre JMS, Benjamin JT, Gokey JJ, Hanby HA, Jaume A, Goetzl L, Marks MS, Guttentag SH.
Show Full Abstract

Lamellar bodies (LBs) are lysosome-related organelles (LROs) of surfactant-producing alveolar type 2 (AT2) cells of the distal lung epithelium. Trafficking pathways to LBs have been understudied but are likely critical to AT2 cell homeostasis given associations between genetic defects of endosome to LRO trafficking and pulmonary fibrosis in Hermansky Pudlak syndrome (HPS). Our prior studies uncovered a role for AP-3, defective in HPS type 2, in trafficking Peroxiredoxin-6 to LBs. We now show that the P4-type ATPase ATP8A1 is sorted by AP-3 from early endosomes to LBs through recognition of a C-terminal dileucine-based signal. Disruption of the AP-3/ATP8A1 interaction causes ATP8A1 accumulation in early sorting and/or recycling endosomes, enhancing phosphatidylserine exposure on the cytosolic leaflet. This in turn promotes activation of Yes-activating protein, a transcriptional coactivator, augmenting cell migration and AT2 cell numbers. Together, these studies illuminate a mechanism whereby loss of AP-3-mediated trafficking contributes to a toxic gain-of-function that results in enhanced and sustained activation of a repair pathway associated with pulmonary fibrosis.

Also flagged:cancerB16membraneTween-80synthesisROI
Journal Article 2021-05-01 No Snippets Fan Y, Cui Y, Hao W, Chen M, Liu Q, Wang Y, Yang M, Li Z, Gong W, Song S, Yang Y, Gao C.
Show Full Abstract

Nanosuspensions, as a new drug delivery system for insoluble drugs, are only composed of a drug and a small amount of stabilizer, which is dispersed in an aqueous solution with high drug-loading, small particle size, high dispersion, and large specific surface area. It can significantly improve the dissolution, bioavailability, and efficacy of insoluble drugs. In this study, paclitaxel nanosuspensions ((PTX)NS) were prepared by an ultrasonic precipitation method, with the characteristics of simple preparation and easy repetition. With the help of a homologous targeting mechanism, a kind of glioma C6 cancer cell membrane (CCM)-coated (PTX)NS was developed and modified with <sup>D</sup>WSW peptide to obtain <sup>D</sup>WSW-CCM-(PTX)NS with the functions of BBB penetration and tumor targeting. The results showed that the cancer cell membrane could effectively camouflage the nanosuspensions so that it was not cleared by the immune system and could cross the blood-brain-barrier (BBB) and selectively target tumor tissues. Cell uptake experiments and <i>in vivo</i> imaging confirmed that the uptake of <sup>D</sup>WSW-CCM-(PTX)NS by tumor cells and the distribution in intracranial gliomas increased. Cytotoxicity test and <i>in vivo</i> anti-glioma studies showed that <sup>D</sup>WSW-CCM-(PTX)NS could significantly inhibit the growth of glioma cells and significantly prolong the survival time of glioma-bearing mice. Finally, the cancer cell membrane coating endowed the nanosuspensions with the biological properties of homologous adhesion and immune escape. This study provides an integrated solution for improving the targeting of nanosuspensions and demonstrates the encouraging potential of biomimetic nanosuspensions applicable to tumor therapy.

Also flagged:ossificationosteoblast differentiationbone formationdeathpolyunsaturated fatty acidsIB
Journal Article 2021-05-01 No Snippets Li B, Zhang YW, Liu X, Ma L, Yang JX.
Show Full Abstract

Intermuscular bones (IBs) are slender linear bones embedded in muscle, which ossify from tendons through a process of intramembranous ossification, and only exist in basal teleosts. IBs are essential for fish swimming, but they present a choking risk during human consumption, especially in children, which can lead to commercial risks that have a negative impact on the aquaculture of these fish. In this review, we discuss the morphogenesis and functions of IBs, including their underlying molecular mechanisms, as well as the advantages and disadvantages of different methods for IB studies and techniques for breeding and generating IB-free fish lines. This review reveals that the many key genes involved in tendon development, osteoblast differentiation, and bone formation, e.g., <i>scxa</i>, <i>msxC</i>, <i>sost</i>, <i>twist</i>, <i>bmps</i>, and <i>osterix</i>, also play roles in IB development. Thus, this paper provides useful information for the breeding of new fish strains without IBs via genome editing and artificial selection.

Also flagged:Fibroblast dedifferentiationPrrx1chondrogenesismetamorphosiscollagendevelopment
Journal Article 2021-05-01 ✓ 1 Snippet Lin TY, Gerber T, Taniguchi-Sugiura Y, Murawala P, Hermann S, Grosser L, Shibata E, Treutlein B, Tanaka EM.
In-Text Gene Mentions

…sox9, tgm2, loc115477099,sox6, pdgfrl, cox4i2, scrg1,…

Show Full Abstract

Limb regeneration, while observed lifelong in salamanders, is restricted in post-metamorphic Xenopus laevis frogs. Whether this loss is due to systemic factors or an intrinsic incapability of cells to form competent stem cells has been unclear. Here, we use genetic fate mapping to establish that connective tissue (CT) cells form the post-metamorphic frog blastema, as in the case of axolotls. Using heterochronic transplantation into the limb bud and single-cell transcriptomic profiling, we show that axolotl CT cells dedifferentiate and integrate to form lineages, including cartilage. In contrast, frog blastema CT cells do not fully re-express the limb bud progenitor program, even when transplanted into the limb bud. Correspondingly, transplanted cells contribute to extraskeletal CT, but not to the developing cartilage. Furthermore, using single-cell RNA-seq analysis we find that embryonic and adult frog cartilage differentiation programs are molecularly distinct. This work defines intrinsic restrictions in CT dedifferentiation as a limitation in adult regeneration.

Also flagged:SNECTCFgene expressionPLNTPMgenes expression
Journal Article 2021-05-01 ✓ 5 Snippets Yuan R, Zhang J, Wang Y, Zhu X, Hu S, Zeng J, Liang F, Tang Q, Chen Y, Chen L, Zhu W, Li M, Mo D.
In-Text Gene Mentions

…Significantly,Sox6and MATN2 play…

…which, we observedSox669 , 70…

…gene expression onSox6and MATN2 in…

…77 such asSox6interacted with more…

Sox6is another gene…

Show Full Abstract

Myofibres (primary and secondary myofibre) are the basic structure of muscle and the determinant of muscle mass. To explore the skeletal muscle developmental processes from primary myofibres to secondary myofibres in pigs, we conducted an integrative three-dimensional structure of genome and transcriptomic characterization of longissimus dorsi muscle of pig from primary myofibre formation stage [embryonic Day 35 (E35)] to secondary myofibre formation stage (E80). In the hierarchical genomic structure, we found that 11.43% of genome switched compartment A/B status, 14.53% of topologically associating domains are changed intradomain interactions (D-scores) and 2,730 genes with differential promoter-enhancer interactions and (or) enhancer activity from E35 to E80. The alterations of genome architecture were found to correlate with expression of genes that play significant roles in neuromuscular junction, embryonic morphogenesis, skeletal muscle development or metabolism, typically, NEFL, MuSK, SLN, Mef2D and GCK. Significantly, Sox6 and MATN2 play important roles in the process of primary to secondary myofibres formation and increase the regulatory potential score and genes expression in it. In brief, we reveal the genomic reorganization from E35 to E80 and construct genome-wide high-resolution interaction maps that provide a resource for studying long-range control of gene expression from E35 to E80.

Also flagged:Anthracyclineshematologic malignanciessolid tumorscardiomyopathyheart failuremitochondrial
Journal Article 2021-05-01 ✓ 1 Snippet Narezkina A, Narayan HK, Zemljic-Harpf AE.
In-Text Gene Mentions

HFE

Show Full Abstract

Anthracyclines are effective chemotherapeutic agents, commonly used in the treatment of a variety of hematologic malignancies and solid tumors. However, their use is associated with a significant risk of cardiovascular toxicities and may result in cardiomyopathy and heart failure. Cardiomyocyte toxicity occurs via multiple molecular mechanisms, including topoisomerase II-mediated DNA double-strand breaks and reactive oxygen species (ROS) formation via effects on the mitochondrial electron transport chain, NADPH oxidases (NOXs), and nitric oxide synthases (NOSs). Excess ROS may cause mitochondrial dysfunction, endoplasmic reticulum stress, calcium release, and DNA damage, which may result in cardiomyocyte dysfunction or cell death. These pathophysiologic mechanisms cause tissue-level manifestations, including characteristic histopathologic changes (myocyte vacuolization, myofibrillar loss, and cell death), atrophy and fibrosis, and organ-level manifestations including cardiac contractile dysfunction and vascular dysfunction. In addition, these mechanisms are relevant to current and emerging strategies to diagnose, prevent, and treat anthracycline-induced cardiomyopathy. This review details the established and emerging data regarding the molecular mechanisms of anthracycline-induced cardiovascular toxicity.

Understanding amphisomes.

Also flagged:organellesendosomesautophagosomeslysosomesdegradationRab GTPases
Journal Article 2021-05-01 No Snippets Ganesan D, Cai Q.
Show Full Abstract

Amphisomes are intermediate/hybrid organelles produced through the fusion of endosomes with autophagosomes within cells. Amphisome formation is an essential step during a sequential maturation process of autophagosomes before their ultimate fusion with lysosomes for cargo degradation. This process is highly regulated with multiple protein machineries, such as SNAREs, Rab GTPases, tethering complexes, and ESCRTs, are involved to facilitate autophagic flux to proceed. In neurons, autophagosomes are robustly generated in axonal terminals and then rapidly fuse with late endosomes to form amphisomes. This fusion event allows newly generated autophagosomes to gain retrograde transport motility and move toward the soma, where proteolytically active lysosomes are predominantly located. Amphisomes are not only the products of autophagosome maturation but also the intersection of the autophagy and endo-lysosomal pathways. Importantly, amphisomes can also participate in non-canonical functions, such as retrograde neurotrophic signaling or autophagy-based unconventional secretion by fusion with the plasma membrane. In this review, we provide an updated overview of the recent discoveries and advancements on the molecular and cellular mechanisms underlying amphisome biogenesis and the emerging roles of amphisomes. We discuss recent developments towards the understanding of amphisome regulation as well as the implications in the context of major neurodegenerative diseases, with a comparative focus on Alzheimer's disease and Parkinson's disease.

Also flagged:Oropharyngeal and Anogenital Cancersuterine cervical cancercancersHPV infectionsynthesisprostate cancers
Journal Article 2021-05-01 No Snippets Sasidharanpillai S, Ravishankar N, Kamath V, Bhat PV, Bhatt P, Arunkumar G.
Show Full Abstract

<h4>Objective</h4>The term ''Human Papillomavirus'' or ''HPV'' has become synonymous with uterine cervical cancer leading to feminisation of all the preventive measures, especially immunisation. Taking into consideration the rising number of HPV associated cancers among men in many developed countries and the risk of transmission to women, male HPV infection is a serious concern. A systematic review and meta-analysis of literature was performed to determine the global prevalence of HPV among men with oropharyngeal and anogenital cancers.<h4>Methods</h4>A systematic review and meta-analysis of literature was performed searching electronic databases for published articles in English between January 1984- April 2020 based on standard systematic review guidelines. The meta-analysis component was modified appropriately for the synthesis of prevalence study results. National Institutes of Health checklist for observational, cohort and cross-sectional studies was used to assess the quality of the studies selected after the abstract and content review. The meta-analysis was performed in STATA version 13.0 (College Station, Texas 77,845 USA) and the forest plots were constructed using metan package in STATA.<h4>Results</h4>Through the electronic search of databases, 3486 original articles were screened for eligibility. Fifty-eight articles were systematically reviewed and 42 articles were qualified for meta-analysis including 4,250 men with oropharyngeal, penile and prostate cancers. The pooled prevalence of HPV DNA in oropharyngeal cancers was 45% (95%CI 24.0%-66.0%). Meanwhile the pooled prevalence rates of 48% (CI 40.0%- 57.0%) and 19% (CI 10.0%-29.0%) were observed in penile and prostate cancers respectively. Even though, articles regarding HPV prevalence in anal cancers were systematically reviewed, none of the studies were qualified for meta-analysis.<h4>Conclusion</h4>Higher pooled prevalence of HPV DNA was observed among men with oropharyngeal and penile cancers. Multicentric molecular studies investigating the prevalence of HPV in prostate cancers have to be planned in future.

Also flagged:AfatinibEGFRNon-Small Cell Lung Cancerepidermal growth factor receptornon small cell lung cancerNSCLC
Journal Article 2021-05-01 No Snippets Vu TH, Nguyen HTT, Dao LK, Duong CK, Nguyen CV, Doan TT, Nguyen HTT, Hoang HH, Dinh DK, Le GV, Vu TT, Truong MC, Nguyen LT.
Show Full Abstract

<h4>Background</h4>We aimed to evaluate the effectiveness and tolerability of Afatinib as first-line treatment of advanced epidermal growth factor receptor (EGFR) mutant non small cell lung cancer (NSCLC) in a real-world setting.<h4>Patients and methods</h4>This is a retrospective study of Vietnamese patients  with advanced EGFR-mutant NSCLC treated with first-line afatinib at the National Cancer Hospital from 1st January 2018 to 31st October 2020. Patients' demographic, clinical and treatment data were captured. Objective response rate (ORR), disease control rate (DCR), time to treatment failure (TTF) and tolerability were evaluated. We used Kaplan-Meier curve and log-rank test for survival, and Cox regression model for multivariate analysis.<h4>Results</h4>A total of 44 patients were included. Common EGFR mutations (Del 19/L858R) were detected in 61% patients. Fifty percent of patients with uncommon mutations had compound mutations of G719X, L861Q and S768I. The ORR was 75% while DCR rate was 98%. The median TTF was 12.3 months (95% CI: 7.2-17.3); the mTTFs were 12.3 and 10.8 months for patients with common and uncommon mutations (p = 0.001), respectively, and 14.0 and 7.5 months for patients with Del 19 and L858R mutations (p = 0.067), respectively. Afatinib 30 mg once daily was the most common starting (77%) and maintenance (64%) doses. The mTTFs were 12.3 and 7.5 months for patients with 30 mg starting dose vs 40 mg dose (p = 0.256), respectively. Diarrhea, skin rash, paronychia and fatigue were observed in 32%, 30%, 25% and 9%, respectively. There was no grade 4 toxicity except three patients with grade 3 paronychia.<h4>Conclusions</h4>First-line afatinib is beneficial for Vietnamese patients with advanced EGFR-mutant NSCLC with a good response rate and prolonged TTF with manageable adverse event profile. Baseline brain metastasis status and starting doses do not significantly impact TTF.<br />.

Also flagged:Dlk1Dio3Systemic lupus erythematosusSLEautoimmune diseasemethylation
Journal Article 2021-05-01 No Snippets Dai R, Wang Z, Ahmed SA.
Show Full Abstract

Systemic lupus erythematosus (SLE) is a multifactorial autoimmune disease that afflicts multiple organs, especially kidneys and joints. In addition to genetic predisposition, it is now evident that DNA methylation and microRNAs (miRNAs), the two major epigenetic modifications, are critically involved in the pathogenesis of SLE. DNA methylation regulates promoter accessibility and gene expression at the transcriptional level by adding a methyl group to 5' cytosine within a CpG dinucleotide. Extensive evidence now supports the importance of DNA hypomethylation in SLE etiology. miRNAs are small, non-protein coding RNAs that play a critical role in the regulation of genome expression. Various studies have identified the signature lupus-related miRNAs and their functional contribution to lupus incidence and progression. In this review, the mutual interaction between DNA methylation and miRNAs regulation in SLE is discussed. Some lupus-associated miRNAs regulate DNA methylation status by targeting the DNA methylation enzymes or methylation pathway-related proteins. On the other hand, DNA hyper- and hypo-methylation are linked with dysregulated miRNAs expression in lupus. Further, we specifically discuss the genetic imprinting Dlk1-Dio3 miRNAs that are subjected to DNA methylation regulation and are dysregulated in several autoimmune diseases, including SLE.

Also flagged:extracellularmechanotransductionTAZRhoAcellRac1
Journal Article 2021-05-01 ✓ 1 Snippet Xu Z, Orkwis JA, Harris GM.
In-Text Gene Mentions

…proteins such asArfgef2, Arhgef2 ,…

Show Full Abstract

Schwann cells (SCs) are a highly plastic cell type capable of undergoing phenotypic changes following injury or disease. SCs are able to upregulate genes associated with nerve regeneration and ultimately achieve functional recovery. During the regeneration process, the extracellular matrix (ECM) and cell morphology play a cooperative, critical role in regulating SCs, and therefore highly impact nerve regeneration outcomes. However, the roles of the ECM and mechanotransduction relating to SC phenotype are largely unknown. Here, we describe the role that matrix stiffness and cell morphology play in SC phenotype specification via known mechanotransducers YAP/TAZ and RhoA. Using engineered microenvironments to precisely control ECM stiffness, cell shape, and cell spreading, we show that ECM stiffness and SC spreading downregulated SC regenerative associated proteins by the activation of RhoA and YAP/TAZ. Additionally, cell elongation promoted a distinct SC regenerative capacity by the upregulation of Rac1/MKK7/JNK, both necessary for the ECM and morphology changes found during nerve regeneration. These results confirm the role of ECM signaling in peripheral nerve regeneration as well as provide insight to the design of future biomaterials and cellular therapies for peripheral nerve regeneration.

Also flagged:gene expressionNF-KBPTENNFE2L1SOX8RNF2
Journal Article 2021-05-01 ✓ 2 Snippets Zhao QN, Wu W, Li CG, Bai Y, Zhu BL.
In-Text Gene Mentions

…NFE2L1, SOX8,SOX6and RNF2 (<i>P</i><0.05)…

…plasma NFE2L1, SOX8,SOX6and RNF2 gene…

Show Full Abstract

<b>Objective:</b> To screen and identify plasma differentially expressed genes and related signal pathway by human gene expression profile array and fluorescent quantitative PCR. <b>Methods:</b> From September 2018 to October 2019, 291 workers from a Mercury-in-glass thermometer factory in Jiangsu Province were selected for an occupational health examination, a total of 60 persons were divided into two groups: high and low mercury exposure groups (30 persons in each group) . Plasma total RNA samples from the high exposure group and the low exposure group (10 cases each) were detected by gene expression microarray, and differentially expressed genes (DEGs) with fold change >2 were selected. DEGs were submitted to David and Metascape for gene function clustering, pathway and protein interaction network analysis. Finally, fluorescence quantitative PCR was performed to verify the changes in the expression levels of key DEGs in the high exposure group and the low exposure group (another 20 cases in each group) . <b>Results:</b> A total of 269 DEGs, of which 203 up regulated and 66 down regulated were identified in the differential expression analysis of gene expression microarray. Bioinformatics analysis suggested that, DEGs were involved in forebrain development, glial cell fate determinants of GO biological process and PID NF-KB, PTEN signal pathway. NFE2L1, SOX8, SOX6 and RNF2 (<i>P</i><0.05) were confirmed down regulated in high level group by fluorescent quantitative PCR compared with the low level group (fold changes were 2.10, 11.52, 2.19, and 4.38 respectively) . <b>Conclusion:</b> The plasma NFE2L1, SOX8, SOX6 and RNF2 gene expressions are significantly altered in occupa tional high mercury exposure population. PTEN signaling pathway and fate of glia cells determines the biological process may be closely related to the body injury caused by mercury exposure.

Also flagged:Interleukin-1 receptorCalcium PyrophosphateCrystal Depositioncalciumpyrophosphatechondrocalcinosis
Journal Article 2021-05-01 ✓ 1 Snippet Altomare A, Corrado A, Maruotti N, Cici D, Cantatore FP.
In-Text Gene Mentions

…of Gitelman’s Syndrome),hemochromatosis(especially in those…

Show Full Abstract

Calcium Pyrophosphate Crystal Deposition (CPPD) disease is characterized by the deposition of calcium pyrophosphate crystals in the cartilage. In most cases, it can manifest as a subclinical condition named chondrocalcinosis, often revealed by joint x-ray examination. In other cases, deposition can cause flares of arthritis, known as acute CPP crystal arthritis. In the last few years, many pathogenic pathways have been discovered. Interleukin-1 (IL-1) plays a key role in the pathogenesis of CPPD disease, both as a mediator of inflammatory response to crystals and as a promoter of damage to articular cartilage. In this review, we investigated the role of IL-1R inhibitor, such as Anakinra, as an alternative to the various therapeutic strategies for CPPD disease, especially among patients resistant to traditional treatment with NSAIDs, corticosteroids and colchicine.

Also flagged:Fibroblast Growth FactorFibroblast growth factor 21metabolismFGF21metabolic diseasessecretion
Journal Article 2021-05-01 ✓ 1 Snippet Bayoumi A, Elsayed A, Han S, Petta S, Adams LA, Aller R, Khan A, García-Monzón C, Arias-Loste MT, Miele L, Latchoumanin O, Alenizi S, Gallego-Durán R, Fischer J, Berg T, Craxì A, Metwally M, Qiao L, Liddle C, Yki-Järvinen H, Bugianesi E, Romero-Gomez M, George J, Eslam M.
In-Text Gene Mentions

…and the cytokinesTNFSF4, TNFAIP8L3, C1QTNF1, NFKBIA,…

Show Full Abstract

Fibroblast growth factor 21 (FGF21) is a liver-derived hormone with pleiotropic beneficial effects on metabolism. Paradoxically, FGF21 levels are elevated in metabolic diseases. Interventions that restore metabolic homeostasis reduce FGF21. Whether abnormalities in FGF21 secretion or resistance in peripheral tissues is the initiating factor in altering FGF21 levels and function in humans is unknown. A genetic approach is used to help resolve this paradox. The authors demonstrate that the primary event in dysmetabolic phenotypes is the elevation of FGF21 secretion. The latter is regulated by translational reprogramming in a genotype- and context-dependent manner. To relate the findings to tissues outcomes, the minor (A) allele of rs838133 is shown to be associated with increased hepatic inflammation in patients with metabolic associated fatty liver disease. The results here highlight a dominant role for translation of the FGF21 protein to explain variations in blood levels that is at least partially inherited. These results provide a framework for translational reprogramming of FGF21 to treat metabolic diseases.

Also flagged:malignant tumorspathogenesislung cancertumorCBFA2T3STX3
Journal Article 2021-05-01 ✓ 1 Snippet Chen Y, Shen L, Chen B, Han X, Yu Y, Yuan X, Zhong L.
In-Text Gene Mentions

…, ASCC1 ,DARS2, IPO9 ,…

Show Full Abstract

<h4>Background</h4>Lung cancer is one of the most malignant tumors. However, neither the pathogenesis of lung cancer nor the prognosis markers are completely clear. The purpose of this study is to screen the diagnostic or prognostic markers of lung cancer.<h4>Methods</h4>TCGA and GEO datasets were used to analyze the relationship between lung cancer-related genes and lung cancer samples. Common differential genes were screened, and a univariate Cox regression analysis was used to screen survival related genes. A univariable Cox proportional hazards regression analysis was used to verify the genes and construct risk model. The key factors affecting the prognosis of lung cancer were determined by univariate and multivariate regression analyses. The ROC curve, AUC and the survival of each risk gene was analyzed. Finally, the biological functions of high- and low-risk patients were explored by GSEA and an immune-infiltration analysis.<h4>Results</h4>Based on the common differential genes, 13 genes significantly related to lung cancer survival were identified. Eight risk genes (<i>CBFA2T3</i>, <i>DENR</i>, <i>EGLN1</i>, <i>FUT2</i>, <i>FUT4</i>, <i>PCDH7</i>, <i>PHF14</i>, and <i>STX3</i>) were screened out. The results showed that risk status may be an independent prognostic factor, and the risk score predicted the prognosis of lung cancer. <i>CBFA2T3</i> and <i>STX3</i> are protective genes, while <i>DENR</i>, <i>EGLN1</i>, <i>FUT4</i> and <i>PCDH7</i> are dangerous genes. These 6 genes can be used as independent lung cancer prognosis markers. The corresponding biological functions of genes expressed in high-risk patients were mostly related to tumor proliferation and inflammatory infiltration. Neutrophil, CD8<sup>+</sup>T, Macrophage M0, Macrophage M1- and mDC-activated cells were high in high-risk status samples.<h4>Conclusions</h4><i>CBFA2T3</i>, <i>STX3</i>, <i>DENR</i>, <i>EGLN1</i>, <i>FUT4</i>, and <i>PCDH7</i> are important participants in the occurrence and development of lung cancer. High-risk patients display serious inflammatory infiltration. This study not only provides insight into the mechanism of occurrence and development of lung cancer, but also provides potential targets for targeted therapy of lung cancer.

Also flagged:ASTHCV infectionaspartate aminotransferaseinfectionliver diseasesliver disease
Journal Article 2021-05-01 ✓ 1 Snippet Xia H, Zhang Y, Zaongo SD, Liang J, Gong X, Hu Y, Ma P, Wang F.
In-Text Gene Mentions

…Wilson’s disease, orhemochromatosis); (V) had incomplete…

Show Full Abstract

<h4>Background</h4>This study compared the efficacy and tolerability of available direct-acting antiviral (DAA) regimens between individuals aged 60 years and older and younger patients in a real-life setting. Specifically, we aimed to provide evidence of the efficacy and safety of DAAs in the treatment of older adults in Tianjin, China.<h4>Methods</h4>In this retrospective observational cohort study, patients with chronic hepatitis C virus (HCV) were enrolled between April 2018 and December 2019 at 2 tertiary hospitals in Tianjin, China. We assessed the sustained virologic response (SVR) 12 weeks (SVR12) after DAA treatment, and adverse events in two groups using age stratification by comparing older adults (≥60 years) and younger adults (<60 years). Logistic regression analyses were performed to explore the risk factors associated with the SVR12.<h4>Results</h4>Of 1,106 patients, 440 (39.8%) were ≥60 years of age. The overall SVR12 rate was 97.8% in the entire cohort. In the older adult group, the SVR12 rate was 98.0% (431/440) compared to 97.7% (651/666) in the younger adult group. A multivariate analysis showed that (I) age was not predictive of SVR; and (II) the variables of treatment-experience [adjusted odds ratio (aOR) =27.53; 95% confidence interval (CI) =3.35-226.08; P=0.002] and aspartate aminotransferase (AST) (aOR =1.02; 95% CI =1.01-1.04; P=0.027) were independently associated with the SVR12 in the older adult group. All of the available DAA regimens were well-tolerated in older adult group.<h4>Conclusions</h4>Chinese older adults with chronic HCV infection showed a significantly higher percentage of fibrosis; however, the available different DAA regimens were safe, well-tolerated, and achieved high rates of SVR in all age subgroups. Our observations suggest that DAA treatment should not be withheld even from older patients suffering from chronic HCV.

Also flagged:head and neck cancerHead and neck squamous cell carcinomasHNSCCcancertumoursgene expression
Journal Article 2021-05-01 ✓ 1 Snippet Farah CS.
In-Text Gene Mentions

Mutations in several genes including TRPM3, KMT2D, ARID2, USP9X, and UNC13C appear to be specific to GB-SCC and seem be functionally involved in tumour suppression (49,57).

Show Full Abstract

Head and neck squamous cell carcinomas (HNSCC) arising from the oral cavity, pharynx, and larynx constitute the 6<sup>th</sup> most common human cancer. Human papillomavirus (HPV)-positive tumours are distinct from HPV-negative counterparts, with HPV status affording clear clinical utility, prognostic benefit and better treatment outcomes. In contrast to their HPV-positive counterparts, HPV-negative tumours are characterized by high mutational load and chromosomal aberrations, with varying copy number alteration (CNA) profiles. HNSCC are distinct tumours at the chromosomal, gene and expression levels, with additional insight gained from immune profiling. Based on mutational analyses, HNSCC are categorized as HPV-positive, HPV-negative CNA-silent, and HPV-negative CNA-high tumours. Furthermore, gene expression profiling segregates these tumours into atypical, classical, basal, and mesenchymal, with clear differences observed between tumours of the oral cavity, oropharynx, hypopharynx and larynx. Additional immune profiling further classifies tumours as either immune-active or immune-exhausted. The clinical utility and impact of these tumour molecular subtypes however remains to be determined. HNSCC harbor high levels of somatic mutations. They display loss at 3p and 18q and gain at 3q and 8q, with mutations in <i>CDKN2A, TP53, CCND1, EGFR, PIK3CA, PTEN, NOTCH1, NSD1, FAT1, AJUBA</i> and <i>KMT2D</i>. Important pathways include the p53 and RB pathways which are involved in cell cycle control and are frequently lost in HPV-negative tumours, the WNT-β-catenin pathway related to the mesenchymal subtype and smoking etiology, and the PI3K pathway which includes the most common genetic alteration in HPV-positive HNSCC. Understanding the mutational, genomic and transcriptomic landscape of HNSCC has leveraged better therapeutic approaches to manage this group of diseases, and it is hoped that additional insight into the molecular subtypes of HNSCC and its specific subsites will further drive improved strategies to stratify and treat patients with this debilitating disease.

Also flagged:Anemiabehavioral development disordershyperbilirubinemiairon deficit anemiaironiron deficiency
Journal Article 2021-05-01 No Snippets Güner S, Saydam BK.
Show Full Abstract

<h4>Background</h4>Anemia during infancy causes irreversible physical, cognitive, motor, and behavioral development disorders. This study aimed to determine the effect of delaying umbilical cord clamping time on certain parameters regarding anemia during the infancy.<h4>Methods</h4>This randomized controlled trial was conducted at a university hospital in west of Turkey (Dec 2017-Dec 2018). Overall, 110 participants were evaluated for the research, 65 participants were randomized after excluding those who did not meet the inclusion criteria (intervention=32, control=33). Randomly assigned to delayed clamping (1 min after delivery) or early clamping (in 15 sec after delivery), and followed up until 4 months postpartum. 48<sup>th</sup>-hour hematocrit, bilirubin values, need for phototherapy and hematocrit, hemoglobin values, diagnosis of anemia at the postnatal fourth month were compared between two groups. The data showing normal distribution were assessed using the parametric tests. The level of statistical significance was determined as <i>P</i><0.05.<h4>Results</h4>The 48<sup>th</sup>-hour hematocrit and bilirubin levels of the intervention group were significantly higher than the control (<i>P</i><0.01 and <i>P</i><0.05, respectively). No significant difference regarding the need for phototherapy due to postnatal hyperbilirubinemia was observed between the two groups (<i>P</i>>0.05). Means of the intervention group hematocrit and hemoglobin levels measured during anemia screening performed at the fourth month were found to be higher than those of the infants in the control group (<i>P</i><0.05 and <i>P</i><0.05, respectively).<h4>Conclusion</h4>Delaying umbilical cord clamping had a positive impact on the haematological parameters of infants. Clamping the cord at least one minute in birth can be performed to prevent the iron deficit anemia that could be seen during the first years of infants' lives.

Also flagged:Mouth Diseasefoot, and mouth diseaseHand, foot, and mouth diseaseinfectious diseasevesiclesencephalitis
Journal Article 2021-05-01 No Snippets Jia J, Kong F, Xin X, Liang J, Xin H, Dong L, Jiang F.
Show Full Abstract

<h4>Background</h4>In China, hand, foot, and mouth disease (HFMD) outbreaks have become an important issue recent years. We analyzed the epidemiological characteristics of HFMD outbreaks in Qingdao during 2009-2018, and provided evidences for prevention and control of the disease.<h4>Methods</h4>Data were analyzed by descriptive analysis and correlation analysis, and throat swabs were detected for enterovirus RNA using RT-PCR.<h4>Results</h4>Overall, 116 HFMD outbreaks were reported in Qingdao during 2009-2018, with the epidemic of the outbreaks exhibiting a decreasing tendency. The characteristics of outbreaks presented two patterns, including two-peak pattern and rural area to urban-rural fringe area to urban areas pattern. Male patients were predominant in these outbreaks. The location of the outbreaks changed from nursery to community. Non-EV71/CA16 enteroviruses were gradually becoming predominant enteroviruses serotypes. The durations of outbreaks were positively correlated with response times and the number of cases.<h4>Conclusion</h4>The epidemiological characteristics analysis of HFMD outbreaks could provide a scientific basis for the prevention and control the disease. Reporting and handling promptly are the keys to control epidemic outbreaks of HFMD.

Also flagged:thiazolephthalimidedeathcancersynthesisBAX
Journal Article 2021-05-01 No Snippets Tavallaei O, Heidarian M, Marzbany M, Aliabadi A.
Show Full Abstract

<h4>Objectives</h4>Cancer is the second important reason for death worldwide. In spite of advances in cancer treatment, however, survival of patients stays weak. Therefore, there is a critical need for advancement of new anticancer drugs. Regarding the hopeful biological activity of phthalimide derivatives, in this study, synthesis, cytotoxicity, and pro-apoptosis activity of eleven derivatives of thiazole bearing phthalimide structure were evaluated.<h4>Materials and methods</h4>First, target derivatives were synthesized. All synthesized compounds were characterized by spectroscopic methods. Cytotoxicity and pro-apoptosis activity of the synthesized compounds were evaluated in MDA-MB-468, PC-12, and MCF-7 cancer cell lines by MTT assay, caspase-3 activity, and TUNEL assay. Finally, expression of BAX, BCL-2, and FAS (as markers of apoptosis) was assessed by the RT-PCR procedure.<h4>Results</h4>Among the eleven compounds, <b>5b</b> (IC<sub>50</sub> = 0.2±0.01 µM) was found to be the most potent derivative against MCF-7 cells. Also, Compound <b>5k</b> and <b>5g</b> showed strong cytotoxic activity against MDA-MB-468 and PC-12 cells with IC<sub>50</sub> value of 0.6±0.04 µM and 0.43±0.06 µM, respectively. DNA fragmentation and activity of caspase-3 data suggest that cytotoxic activity of the compounds on cancer cells might be related to apoptosis. Also, RT-PCR of apoptosis markers indicated that these compounds induce apoptosis through the intrinsic pathway.<h4>Conclusion</h4>Our findings suggest that <i>para</i> chloro derivative (<b>5c</b>) may be a promising agent for treatment of cancer cells by the targeted intrinsic pathway of apoptosis and could be used as a drug candidate for <i>in vivo</i> assessment in the treatment of cancer.

Also flagged:HENickelpotassium dichromateparaphenylenediaminenickel sulfatecobalt chloride
Journal Article 2021-05-01 ✓ 5 Snippets Sahana S, Chethana SG, Kanthraj GR, Betkerur J.
In-Text Gene Mentions

…HE, FE, andHFEand to identify…

…affected group wasHFE(55.8%) followed by…

…and hand–foot eczema (HFE) manifest on exposure…

…causes hand–foot eczema (HFE).…

…3 ]HFEaffects social, occupational,…

Show Full Abstract

<h4>Background</h4>Hand eczema (HE), foot eczema (FE), and hand-foot eczema (HFE) manifest on exposure to various agents in day-to-day life or in occupations or both.<h4>Objectives</h4>The objectives of this study were to identify pattern of allergens causing HE, FE, and HFE and to identify multiple and concurrent contact allergies.<h4>Materials and methods</h4>A study was conducted from October 2013 to August 2015 which included 190 patients. Patch test was performed for 78.94% of patients (<i>n</i> = 150). The statistical tests used were descriptive, Cramer's V, and Chi-square tests.<h4>Results</h4>The most commonly affected group was HFE (55.8%) followed by HE (22.1%) and FE (22.1%). Allergens showed positivity either singly 56.3% (<i>n</i> = 67) or in combination 43.69% (<i>n</i> = 52). Nickel (41.79%) was the most common allergen in all the three groups followed by potassium dichromate. Late reactions (after day 7) were observed in 17.64% of patients (<i>n</i> = 21). Nickel was observed in 42.85% (<i>n</i> = 9) and paraphenylenediamine was observed in 28.57% of patients (<i>n</i> = 6) with <i>P</i> values of <0.001 and 0.050, respectively. Multiple contact allergies were seen in 44% of patients (<i>n</i> = 52). Concurrent reactions (55.8% [<i>n</i> = 29]), polysensitization (34.6% [<i>n</i> = 18]), and mixed reactions (9.6% [<i>n</i> = 5]) (<i>P</i> value of <0.001) were observed.<h4>Conclusion</h4>Significant multiple contact allergies including concurrent reactions with nickel sulfate, potassium dichromate, cobalt chloride, and polysensitization were observed. No significant differences in allergen pattern were observed in HE, FE, and HFE.<h4>Recommendation</h4>Day 7 reading is recommended in HFE.

Also flagged:Neurologic disordersserotoninmineralizationosteoblast differentiationneuromuscular disordersneurodegenerative disorders
Journal Article 2021-05-01 ✓ 4 Snippets Bera RN, Tripathi R, Bhattacharjee B, Singh AK, Kanojia S, Kumar V.
In-Text Gene Mentions

Serotonin also reduced the expression of osteoblast marker genes including Alpl (alkaline phosphatase), Sp7 (osterix), and Bglap (osteocalcin) and significantly inhibits β-tricalcium phosphate-induced bone regeneration.[39] Receptor activator of nuclear factor-kappa B ligand-induced osteoclast-like cells generally shows increased expression of serotonin receptor (5-HTT).

…of serotonin receptor (5-HTT).…

…an inhibitor of5-HTT, showed reduced osteoclast…

…a role for5-HTTin osteoclast function…

Show Full Abstract

Neurologic disorders impede oral hygiene measures and routine clinical follow-up, along with the various drugs used may jeopardise oral health and the peri- implant tissue health. A total of 7 studies were considered eligible for the current systematic review. The overall estimated effect was categorized as significant where <i>P</i> < 0.05. Funnel plot was used to assess the publication bias within the studies. Difference in means was used as principal summary measure. <i>P</i> value <0.05 was considered as statistically significant. 1069 implants survived in test group and 4677 implants survived in control group (odds ratio: 2.58, 95% CI: 1.93-3.43) indicating significant success in patient without any disorders or taking medications for these disorders. Subgroup analysis was done to check the implant survival rate in patients taking selective serotonin reuptake inhibitors (SSRI) compared with SSRI non-users. Subgroup analysis showed that SSRI non-users had higher implant survival rate than patients taking SSRI (odds ratio: 2.45, 95% CI: 1.82-3.31). Serotonin significantly inhibits bone mineralization and osteoblast differentiation. The presence of any form of neuropsychiatric or neuromuscular disorders precludes proper oral hygiene and may contribute towards implant failure.

Also flagged:reading disabilitiesDCDC2KIAA0319FOXP2SLC2A3ROBO1
Journal Article 2021-05-01 ✓ 1 Snippet Thomas T, Khalaf S, Grigorenko EL.
In-Text Gene Mentions

CCPG1

Show Full Abstract

The imaging genetics of specific reading disabilities (SRD) is an emerging field that aims to characterize the disabilities' neurobiological causes, including atypical brain structure and function and distinct genetic architecture. The present review aimed to summarize current imaging genetics studies of SRD, characterize the effect sizes of reported results by calculating Cohen's <i>d,</i> complete a Fisher's Combined Probability Test for genes featured in multiple studies, and determine areas for future research. Results demonstrate associations between SRD risk genes and reading network brain phenotypes. The Fisher's test revealed promising results for the genes <i>DCDC2, KIAA0319, FOXP2, SLC2A3,</i> and <i>ROBO1.</i> Future research should focus on exploratory approaches to identify previously undiscovered genes. Using comprehensive neuroimaging (e.g., functional and effective connectivity) and genetic (e.g., sequencing and epigenetic) techniques, and using larger samples, diverse stages of development, and longitudinal investigations, would help researchers understand the neurobiological correlates of SRD to improve early identification.

Also flagged:FerritinThalassemiabeta thalassemia majorerythropoiesisironbeta thalassemia
Journal Article 2021-05-01 ✓ 1 Snippet Rao GV, Preethi V, Daneswari V, Reddy V, Sivakalyan V, Garge R.
In-Text Gene Mentions

…also known ashemochromatosiswhich is one…

Show Full Abstract

<h4>Introduction</h4>Thalassemia is a genetically diverse group of disease which occurs due to an imbalance in the production of the alpha and beta chains with ensuring chronic hemolysis, ineffective erythropoiesis, and iron overload.<h4>Aim and objective</h4>The main aim of the study is to compare the salivary flow rate, pH, buffer capacity, total antioxidant capacity, and ferritin levels in children with beta thalassemia major and healthy children.<h4>Materials and methods</h4>The present study includes 40 children consisting of 20 beta thalassemia major and 20 healthy children. Unstimulated saliva was collected by the spitting method. The salivary flow rate, pH, buffer capacity, total antioxidant capacity, and ferritin levels were evaluated.<h4>Results</h4>Salivary ferritin levels were found to be higher in children with beta thalassemia major.<h4>Conclusion</h4>Iron overload is also known as hemochromatosis which is one of the complications of thalassemia.<h4>How to cite this article</h4>Rao GV, Preethi V, Daneswari V, <i>et al</i>. A Comparative Study of Salivary Flow Rate, pH, Buffer Capacity, Total Antioxidant Capacity, and Ferritin Levels in Children with Beta Thalassemia Major and Healthy Children. Int J Clin Pediatr Dent 2021;14(3):342-348.

Also flagged:steroidsteroidscholesteroldiosgeninlocalizationlysosome
Journal Article 2021-05-01 No Snippets Wang Z, Sun J, Li M, Luo T, Shen Y, Cao A, Sheng R.
Show Full Abstract

Using natural-based lipids to construct biocompatible, controllable and efficient nanocarriers and elucidating their structure-function relationships, was regarded as an important area for creating sustainable biomaterials. Herein, we utilized two natural steroids: cholesterol and diosgenin (bearing different hydrophobic tails) as the building blocks, to synthesize a series of natural steroid-based cationic random copolymers PMA6Chol-<i>r</i>-PDMAEMA and PMA6Dios-<i>r</i>-PDMAEMA <i>via</i> RAFT polymerization. The results demonstrated that the steroid-<i>r</i>-PDMAEMA copolymers could efficiently bind pDNA (N/P < 3.0) and then form near-spherical shape (142-449 nm) and positively-charged (+11.5 to +19.6 mV) nanoparticles. The <i>in vitro</i> cytotoxicity and gene transfection efficiency greatly depend on the steroid hydrophobic tail structures and steroid/PDMAEMA block ratios. Optimum transfection efficiency of the (Chol-P1/pDNA and Dios-P3/pDNA) nanoplexes could reach to 18.1-31.2% of the PEI-25K/pDNA complex. Moreover, all of the steroid-<i>r</i>-PDMAEMA/Cy3-pDNA nanoplexes have an obvious "lysosome localization" effect, indicating the steroid structures do not remarkably influence the intracellular localization behaviors of these nanoplexes.

ISEV2021 Abstract Book

Also flagged:lncRNA‐SEPslncRNAlncRNA‐SEPexoRNAsEVneurodegenerative diseases
Journal Article 2021-05-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.