Gene Literature Dashboard

Viewing August 2021 — 684 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← July 2021 September 2021 →
Also flagged:Divalent Metal TransportersDMT1SLC11A2ZIP8Solute carrier proteinsmembrane proteins
Journal Article 2021-08-31 ✓ 3 Snippets Pujol-Giménez J, Poirier M, Bühlmann S, Schuppisser C, Bhardwaj R, Awale M, Visini R, Javor S, Hediger MA, Reymond JL.
In-Text Gene Mentions

…transporter associated withhemochromatosisand for which…

…transporter associated withhemochromatosis, and the first…

…iron deficiency anaemia,hemochromatosis, β‐thalassemia, Parkinson's d…

Show Full Abstract

Solute carrier proteins (SLCs) are membrane proteins controlling fluxes across biological membranes and represent an emerging class of drug targets. Here we searched for inhibitors of divalent metal transporters in a library of 1,676 commercially available 3D-shaped fragment-like molecules from the generated database GDB-17, which lists all possible organic molecules up to 17 atoms of C, N, O, S and halogen following simple criteria for chemical stability and synthetic feasibility. While screening against DMT1 (SLC11A2), an iron transporter associated with hemochromatosis and for which only very few inhibitors are known, only yielded two weak inhibitors, our approach led to the discovery of the first inhibitor of ZIP8 (SLC39A8), a zinc transporter associated with manganese homeostasis and osteoarthritis but with no previously reported pharmacology, demonstrating that this target is druggable.

Also flagged:Paxillinbindingkindlin-3membranephospholipidphospholipids
Journal Article 2021-08-31 No Snippets Nguyen HTT, Xu Z, Shi X, Liu S, Schulte ML, White GC, Ma YQ.
Show Full Abstract

<h4>Background</h4>Kindlin-3 is essential for supporting the bidirectional signaling of integrin αIIbβ3 in platelets by bridging the crosstalk between integrin αIIbβ3 and the cytoplasmic signaling adaptors.<h4>Objective</h4>In this study, we identified a previously unrecognized paxillin binding site in the pleckstrin homology (PH) domain of kindlin-3 and verified its functional significance.<h4>Methods</h4>Structure-based approaches were employed to identify the paxillin binding site in the PH domain of kindlin-3. In addition, the bidirectional signaling of integrin αIIbβ3 were evaluated in both human and mouse platelets.<h4>Results</h4>In brief, we found that a β1-β2 loop in the PH domain of kindlin-3, an important part of the canonical membrane phospholipid binding pocket, was also involved in mediating paxillin interaction. Interestingly, the binding sites of paxillin and membrane phospholipids in the PH domain of kindlin-3 were mutually exclusive. Specific disruption of paxillin binding to the PH domain by point mutations inhibited platelet spreading on immobilized fibrinogen while having no inhibition on soluble fibrinogen binding to stimulated platelets. In addition, a membrane-permeable peptide derived from the β1-β2 loop in the PH domain of kindlin-3 was capable of inhibiting platelet spreading and clot retraction, but it had no effect on soluble fibrinogen binding to platelets and platelet aggregation. Treatment with this peptide significantly reduced thrombus formation in mice.<h4>Conclusion</h4>Taken together, these findings suggest that interaction between paxillin and the PH domain of kindlin-3 plays an important role in supporting integrin αIIbβ3 outside-in signaling in platelets, thus providing a novel antithrombotic target.

Also flagged:ETV4HOXB2dinucleotideZNF740NOTOtranscription factors
Journal Article 2021-08-31 ✓ 1 Snippet Chumpitaz-Diaz L, Samee MAH, Pollard KS.
In-Text Gene Mentions

…KLF16, ZBTB49, ZNF740,POU3F2, NKX3-1), our motifs…

Show Full Abstract

Sequence-specific transcription factors (TFs) recognize motifs of related nucleotide sequences at their DNA binding sites. Upon binding at these sites, TFs regulate critical molecular processes such as gene expression. It is widely assumed that a TF recognizes a single "canonical" motif, although recent studies have identified additional "non-canonical" motifs for some TFs. A comprehensive approach to identify non-canonical DNA binding motifs and the functional importance of those motifs' matches in the human genome is necessary for fully understanding the mechanisms of TF-regulated molecular processes in human cells. To address this need, we developed a statistical pipeline for in vitro HT-SELEX data that identifies and characterizes the distributions of non-canonical TF motifs in a stringent manner. Analyzing ~170 human TFs' HT-SELEX data, we found non-canonical motifs for 19 TFs (11%). These non-canonical motifs occur independently of the TFs' canonical motifs. Non-canonical motif occurrences in the human genome show similar evolutionary conservation to canonical motif occurrences, explain TF binding in locations without canonical motifs, and occur within gene promoters and epigenetically marked regulatory sequences in human cell lines and tissues. Our approach and collection of non-canonical motifs expand current understanding of functionally relevant DNA binding sites for human TFs.

Also flagged:neurodegenerative diseasepathogenesisgene expressionbehavioralTGF-betacytokine
Journal Article 2021-08-31 ✓ 2 Snippets Jiang X, Chen M, Song W, Lin GN.
In-Text Gene Mentions

Meanwhile, Huntington’s disease (HD) is a representative neurodegenerative disease, which is caused by a triplet (CAG) repeat elongation in huntingtin (HTT) gene on chromosome 4 that codes for polyglutamine in the huntingtin protein [10].

…elongation in huntingtin (HTT) gene on chromosome…

Show Full Abstract

<h4>Background</h4>Clinically, behavior, cognitive, and mental functions are affected during the neurodegenerative disease progression. To date, the molecular pathogenesis of these complex disease is still unclear. With the rapid development of sequencing technologies, it is possible to delicately decode the molecular mechanisms corresponding to different clinical phenotypes at the genome-wide transcriptomic level using computational methods. Our previous studies have shown that it is difficult to distinguish disease genes from non-disease genes. Therefore, to precisely explore the molecular pathogenesis under complex clinical phenotypes, it is better to identify biomarkers corresponding to different disease stages or clinical phenotypes. So, in this study, we designed a label propagation-based semi-supervised feature selection approach (LPFS) to prioritize disease-associated genes corresponding to different disease stages or clinical phenotypes.<h4>Methods</h4>In this study, we pioneering put label propagation clustering and feature selection into one framework and proposed label propagation-based semi-supervised feature selection approach. LPFS prioritizes disease genes related to different disease stages or phenotypes through the alternative iteration of label propagation clustering based on sample network and feature selection with gene expression profiles. Then the GO and KEGG pathway enrichment analysis were carried as well as the gene functional analysis to explore molecular mechanisms of specific disease phenotypes, thus to decode the changes in individual behavioral and mental characteristics during neurodegenerative disease progression.<h4>Results</h4>Large amounts of experiments were conducted to verify the performance of LPFS with Huntington's gene expression data. Experimental results shown that LPFS performs better in comparison with the-state-of-art methods. GO and KEGG enrichment analysis of key gene sets shown that TGF-beta signaling pathway, cytokine-cytokine receptor interaction, immune response, and inflammatory response were gradually affected during the Huntington's disease progression. In addition, we found that the expression of SLC4A11, ZFP474, AMBP, TOP2A, PBK, CCDC33, APSL, DLGAP5, and Al662270 changed seriously by the development of the disease.<h4>Conclusions</h4>In this study, we designed a label propagation-based semi-supervised feature selection model to precisely selected key genes of different disease phenotypes. We conducted experiments using the model with Huntington's disease mice gene expression data to decode the mechanisms of it. We found many cell types, including astrocyte, microglia, and GABAergic neuron, could be involved in the pathological process.

Also flagged:RaxNestinWnt5aShhIl6Bdnf
Journal Article 2021-08-31 ✓ 5 Snippets Bobbo VC, Engel DF, Jara CP, Mendes NF, Haddad-Tovolli R, Prado TP, Sidarta-Oliveira D, Morari J, Velloso LA, Araujo EP.
In-Text Gene Mentions

Sox6

In addition, when looking into putative differences in the neurogenic response to IL6 comparing obesity-prone (H) and obesity-resistant (L) mice (described in “In vivo protocol #2”), we found that ip IL6 promoted a significantly larger expression of Sox6 transcripts (Fig. 5D) and a trend for increase of doublecortin transcripts (Fig. 5E) in obesity-resistant mice.

…increased expressions ofSox6and Sox2 transcripts…

…larger expression ofSox6transcripts (Fig. 5…

…transcripts Sox2 andSox6.…

Show Full Abstract

<h4>Background</h4>Interleukin-6 (IL6) produced in the context of exercise acts in the hypothalamus reducing obesity-associated inflammation and restoring the control of food intake and energy expenditure. In the hippocampus, some of the beneficial actions of IL6 are attributed to its neurogenesis-inducing properties. However, in the hypothalamus, the putative neurogenic actions of IL6 have never been explored, and its potential to balance energy intake can be an approach to prevent or attenuate obesity.<h4>Methods</h4>Wild-type (WT) and IL6 knockout (KO) mice were employed to study the capacity of IL6 to induce neurogenesis. We used cell labeling with Bromodeoxyuridine (BrdU), immunofluorescence, and real-time PCR to determine the expression of markers of neurogenesis and neurotransmitters. We prepared hypothalamic neuroprogenitor cells from KO that were treated with IL6 in order to provide an ex vivo model to further characterizing the neurogenic actions of IL6 through differentiation assays. In addition, we analyzed single-cell RNA sequencing data and determined the expression of IL6 and IL6 receptor in specific cell types of the murine hypothalamus.<h4>Results</h4>IL6 expression in the hypothalamus is low and restricted to microglia and tanycytes, whereas IL6 receptor is expressed in microglia, ependymocytes, endothelial cells, and astrocytes. Exogenous IL6 reduces diet-induced obesity. In outbred mice, obesity-resistance is accompanied by increased expression of IL6 in the hypothalamus. IL6 induces neurogenesis-related gene expression in the hypothalamus and in neuroprogenitor cells, both from WT as well as from KO mice.<h4>Conclusion</h4>IL6 induces neurogenesis-related gene expression in the hypothalamus of WT mice. In KO mice, the neurogenic actions of IL6 are preserved; however, the appearance of new fully differentiated proopiomelanocortin (POMC) and neuropeptide Y (NPY) neurons is either delayed or disturbed.

Also flagged:primary tumorGFPllsVav2Rac1tal
Journal Article 2021-08-31 No Snippets Kalpana G, Figy C, Feng J, Tipton C, De Castro JN, Bach VN, Borile C, LaSalla A, Odeh HN, Yeung M, Garcia-Mata R, Yeung KC.
Show Full Abstract

Raf-1 kinase inhibitor protein was initially discovered as a physiological kinase inhibitor of the MAPK signaling pathway and was later shown to suppress cancer cell invasion and metastasis. Yet, the molecular mechanism through which RKIP executes its effects is not completely defined. RhoA has both a pro- and anti-metastatic cell-context dependent functions. Given that Rho GTPases primarily function on actin cytoskeleton dynamics and cell movement regulation, it is possible that one way RKIP hinders cancer cell invasion/metastasis is by targeting these proteins. Here we show that RKIP inhibits cancer cell invasion and metastasis by stimulating RhoA anti-tumorigenic functions. Mechanistically, RKIP activates RhoA in an Erk2 and GEF-H1 dependent manner to enhance E-cadherin membrane localization and inhibit CCL5 expression.

Also flagged:PHF10SWI/SNFmelanomaMYCcell cyclechromatin
Journal Article 2021-08-31 ✓ 1 Snippet Soshnikova NV, Tatarskiy EV, Tatarskiy VV, Klimenko NS, Shtil AA, Nikiforov MA, Georgieva SG.
In-Text Gene Mentions

…nscriptional co-regulators andchromatin modifiersmodifiers such as…

Show Full Abstract

The PBAF complex, a member of SWI/SNF family of chromatin remodelers, plays an essential role in transcriptional regulation. We revealed a disease progression associated elevation of PHF10 subunit of PBAF in clinical melanoma samples. In melanoma cell lines, PHF10 interacts with MYC and facilitates the recruitment of PBAF complex to target gene promoters, therefore, augmenting MYC transcriptional activation of genes involved in the cell cycle progression. Depletion of either PHF10 or MYC induced G1 accumulation and a senescence-like phenotype. Our data identify PHF10 as a pro-oncogenic mechanism and an essential novel link between chromatin remodeling and MYC-dependent gene transcription.

Also flagged:hepatocellular carcinomaAlbuminsodiumascitesgadoxetic acidAST
Journal Article 2021-08-31 ✓ 1 Snippet Öcal O, Peynircioglu B, Loewe C, van Delden O, Vandecaveye V, Gebauer B, Zech CJ, Sengel C, Bargellini I, Iezzi R, Benito A, Schütte K, Gasbarrini A, Gasbarrini A, Seidensticker R, Wildgruber M, Pech M, Malfertheiner P, Ricke J, Seidensticker M.
In-Text Gene Mentions

…42 (11.6%), andhemochromatosisin 11 (3.0%)…

Show Full Abstract

<h4>Objectives</h4>To evaluate the correlation between liver enhancement on hepatobiliary phase and liver function parameters in a multicenter, multivendor study.<h4>Methods</h4>A total of 359 patients who underwent gadoxetic acid-enhanced MRI using a standardized protocol with various scanners within a prospective multicenter phase II trial (SORAMIC) were evaluated. The correlation between liver enhancement on hepatobiliary phase normalized to the spleen (liver-to-spleen ratio, LSR) and biochemical laboratory parameters, clinical findings related to liver functions, liver function grading systems (Child-Pugh and Albumin-Bilirubin [ALBI]), and scanner characteristics were analyzed using uni- and multivariate analyses.<h4>Results</h4>There was a significant positive correlation between LSR and albumin (rho = 0.193; p < 0.001), platelet counts (rho = 0.148; p = 0.004), and sodium (rho = 0.161; p = 0.002); and a negative correlation between LSR and total bilirubin (rho = -0.215; p < 0.001) and AST (rho = -0.191; p < 0.001). Multivariate analysis confirmed independent significance for each of albumin (p = 0.022), total bilirubin (p = 0.045), AST (p = 0.031), platelet counts (p = 0.012), and sodium (p = 0.006). The presence of ascites (1.47 vs. 1.69, p < 0.001) and varices (1.55 vs. 1.69, p = 0.006) was related to significantly lower LSR. Similarly, patients with ALBI grade 1 had significantly higher LSR than patients with grade 2 (1.74 ± 0.447 vs. 1.56 ± 0.408, p < 0.001); and Child-Pugh A patients had a significantly higher LSR than Child-Pugh B (1.67 ± 0.44 vs. 1.49 ± 0.33, p = 0.021). Also, LSR was negatively correlated with MELD-Na scores (rho = -0.137; p = 0.013). However, one scanner brand was significantly associated with lower LSR (p < 0.001).<h4>Conclusions</h4>The liver enhancement on the hepatobiliary phase of gadoxetic acid-enhanced MRI is correlated with biomarkers of liver functions in a multicenter cohort. However, this correlation shows variations between scanner brands.<h4>Key points</h4>• The correlation between liver enhancement on the hepatobiliary phase of gadoxetic acid-enhanced MRI and liver function is consistent in a multicenter-multivendor cohort. • Signal intensity-based indices (liver-to-spleen ratio) can be used as an imaging biomarker of liver function. • However, absolute values might change between vendors.

Also flagged:gene expressionaxonsaction potentialsaxonmyelinextracellular
Journal Article 2021-08-31 No Snippets Tasdemir-Yilmaz OE, Druckenbrod NR, Olukoya OO, Dong W, Yung AR, Bastille I, Pazyra-Murphy MF, Sitko AA, Hale EB, Vigneau S, Gimelbrant AA, Kharchenko PV, Goodrich LV, Segal RA.
Show Full Abstract

The peripheral nervous system responds to a wide variety of sensory stimuli, a process that requires great neuronal diversity. These diverse neurons are closely associated with glial cells originating from the neural crest. However, the molecular nature and diversity among peripheral glia are not understood. Here, we used single-cell RNA sequencing to profile developing and mature glia from somatosensory dorsal root ganglia and auditory spiral ganglia. We found that glial precursors (GPs) in these two systems differ in their transcriptional profiles. Despite their unique features, somatosensory and auditory GPs undergo convergent differentiation to generate molecularly uniform myelinating and non-myelinating Schwann cells. By contrast, somatosensory and auditory satellite glial cells retain system-specific features. Lastly, we identified a glial signature gene set, providing new insights into commonalities among glia across the nervous system. This survey of gene expression in peripheral glia constitutes a resource for understanding functions of glia across different sensory modalities.

Also flagged:pathogenesisintestinal diseaseTJP1Wntspindlesspindle
Journal Article 2021-08-31 ✓ 1 Snippet Kuo WT, Zuo L, Odenwald MA, Madha S, Singh G, Gurniak CB, Abraham C, Turner JR.
In-Text Gene Mentions

Olfm4

Show Full Abstract

<h4>Backgrounds & aims</h4>Increased permeability is implicated in the pathogenesis of intestinal disease. In vitro and in vivo studies have linked down-regulation of the scaffolding protein ZO-1, encoded by the TJP1 gene, to increased tight junction permeability. This has not, however, been tested in vivo. Here, we assessed the contributions of ZO-1 to in vivo epithelial barrier function and mucosal homeostasis.<h4>Methods</h4>Public Gene Expression Omnibus data sets and biopsy specimens from patients with inflammatory bowel disease (IBD) and healthy control individuals were analyzed. Tjp1<sup>f/f</sup>;vil-Cre<sup>Tg</sup> mice with intestinal epithelial-specific ZO-1 knockout (ZO-1<sup>KO.IEC</sup>) mice and Tjp1<sup>f/f</sup> mice littermates without Cre expression were studied using chemical and immune-mediated models of disease as well as colonic stem cell cultures.<h4>Results</h4>ZO-1 transcript and protein expression were reduced in biopsy specimens from patients with IBD. Despite mildly increased intestinal permeability, ZO-1<sup>KO.IEC</sup> mice were healthy and did not develop spontaneous disease. ZO-1<sup>KO.IEC</sup> mice were, however, hypersensitive to mucosal insults and displayed defective repair. Furthermore, ZO-1-deficient colonic epithelia failed to up-regulate proliferation in response to damage in vivo or Wnt signaling in vitro. ZO-1 was associated with centrioles in interphase cells and mitotic spindle poles during division. In the absence of ZO-1, mitotic spindles failed to correctly orient, resulting in mitotic catastrophe and abortive proliferation. ZO-1 is, therefore, critical for up-regulation of epithelial proliferation and successful completion of mitosis.<h4>Conclusions</h4>ZO-1 makes critical, tight junction-independent contributions to Wnt signaling and mitotic spindle orientation. As a result, ZO-1 is essential for mucosal repair. We speculate that ZO-1 down-regulation may be one cause of ineffective mucosal healing in patients with IBD.

Also flagged:InsulininfectionsHealthcare-associated infectionsReproductionChromatinnucleus
Journal Article 2021-08-31 ✓ 5 Snippets Wu T, Nance J, Chu F, Fazzio TG.
In-Text Gene Mentions

…DDX24 (Abcam; ab70463),DDX27(Bethyl Laboratories; A302-216…

…(1:250), DDX24 (1:50),DDX27(1:250), FBRL (1:250),…

…antibodies: DDX18 (1:4000),DDX27(1:1000), DDX54 (1:500),…

…including DDX18, DDX21,DDX27, DDX54, which belong…

…and detected DDX18,DDX27, DDX54, with high…

Show Full Abstract

Chromatin-associated RNAs have diverse roles in the nucleus. However, their mechanisms of action are poorly understood, in part because of the inability to identify proteins that specifically associate with chromatin-bound RNAs. Here, we address this problem for a subset of chromatin-associated RNAs that form R-loops-RNA-DNA hybrid structures that include a displaced strand of ssDNA. R-loops generally form cotranscriptionally and have important roles in regulation of gene expression, immunoglobulin class switching, and other processes. However, unresolved R-loops can lead to DNA damage and chromosome instability. To identify factors that may bind and regulate R-loop accumulation or mediate R-loop-dependent functions, we used a comparative immunoprecipitation/MS approach, with and without RNA-protein crosslinking, to identify a stringent set of R-loop-binding proteins in mouse embryonic stem cells. We identified 364 R-loop-interacting proteins, which were highly enriched for proteins with predicted RNA-binding functions. We characterized several R-loop-interacting proteins of the DEAD-box family of RNA helicases and found that these proteins localize to the nucleolus and, to a lesser degree, the nucleus. Consistent with their localization patterns, we found that these helicases are required for rRNA processing and regulation of gene expression. Surprisingly, depletion of these helicases resulted in misregulation of highly overlapping sets of protein-coding genes, including many genes that function in differentiation and development. We conclude that R-loop-interacting DEAD-box helicases have nonredundant roles that are critical for maintaining the normal embryonic stem cell transcriptome.

Also flagged:Phospholipases A2Acute respiratory distress syndromeARDSpathogenesisphospholipases 2fatty acids
Journal Article 2021-08-31 No Snippets Kitsiouli E, Tenopoulou M, Papadopoulos S, Lekka ME.
Show Full Abstract

Acute respiratory distress syndrome (ARDS) is a multifactorial life-threatening lung injury, characterized by diffuse lung inflammation and increased alveolocapillary barrier permeability. The different stages of ARDS have distinctive biochemical and clinical profiles. Despite the progress of our understanding on ARDS pathobiology, the mechanisms underlying its pathogenesis are still obscure. Herein, we review the existing literature about the implications of phospholipases 2 (PLA2s), a large family of enzymes that catalyze the hydrolysis of fatty acids at the sn-2 position of glycerophospholipids, in ARDS-related pathology. We emphasize on the versatile way of participation of different PLA2s isoforms in the distinct ARDS subgroup phenotypes by either potentiating lung inflammation and damage or by preserving the normal lung. Current research supports that PLA2s are associated with the progression and the outcome of ARDS. We herein discuss the transcellular communication of PLA2s through secreted extracellular vesicles and suggest it as a new mechanism of PLA2s involvement in ARDS. Thus, the elucidation of the spatiotemporal features of PLA2s expression may give new insights and provide valuable information about the risk of an individual to develop ARDS or advance to more severe stages, and potentially identify PLA2 isoforms as biomarkers and target for pharmacological intervention.

Also flagged:Macrocyclic Receptorsreproductionbindingporphyrinreceptorsmacrocycle
Journal Article 2021-08-31 No Snippets Mamardashvili G, Mamardashvili N, Koifman O.
Show Full Abstract

Molecular recognition of host/guest molecules represents the basis of many biological processes and phenomena. Enzymatic catalysis and inhibition, immunological response, reproduction of genetic information, biological regulatory functions, the effects of drugs, and ion transfer-all these processes include the stage of structure recognition during complexation. The goal of this review is to solicit and publish the latest advances in the design and sensing and binding abilities of porphyrin-based heterotopic receptors with well-defined geometries, the recognition ability of which is realized due to ionic, <i>H</i>-bridge, charge transfer, hydrophobic, and hydrophilic interactions. The dissection of the considered low-energy processes at the molecular scale expands our capabilities in the development of effective systems for controlled recognition, selective delivery, and prolonged release of substrates of different natures (including drugs) to their sites of functioning.

Also flagged:Hereditary Hemorrhagic TelangiectasiaHHTautosomal dominant vascular dysplasiaepistaxismucocutaneous telangiectasesarteriovenous malformations
Journal Article 2021-08-31 No Snippets Pozo-Agundo A, Villaescusa N, Martorell-Marugán J, Soriano O, Leyva S, Jódar-Reyes AB, Botella LM, Carmona-Sáez P, Blanco FJ.
Show Full Abstract

Hereditary hemorrhagic telangiectasia (HHT) is a rare autosomal dominant vascular dysplasia characterized by epistaxis, mucocutaneous telangiectases, and arteriovenous malformations (AVM) in the visceral organs. The diagnosis of HHT is based on clinical Curaçao criteria, which show limited sensitivity in children and young patients. Here, we carried out a liquid biopsy by which we isolated total RNA from plasma exosome samples. A cohort of 15 HHT type 1 patients, 15 HHT type 2 patients, and 10 healthy relatives were analyzed. Upon gene expression data processing and normalization, a statistical analysis was performed to explore similarities in microRNA expression patterns among samples and detect differentially expressed microRNAs between HHT samples and the control group. We found a disease-associated molecular fingerprint of 35 miRNAs over-represented in HHT vs. controls, with eight being specific for HHT1 and 11 for HHT2; we also found 30 under-represented, including nine distinct for HHT1 and nine for HHT2. The analysis of the receiver operating characteristic (ROC) curves showed that eight miRNAs had good (AUC > 75%) or excellent (AUC > 90%) diagnosis value for HHT and even for type HHT1 and HHT2. In addition, we identified the cellular origin of these miRNAs among the cell types involved in the vascular malformations. Interestingly, we found that only some of them were incorporated into exosomes, which suggests a key functional role of these exosomal miRNAs in the pathophysiology of HHT.

Also flagged:Cancerdeathtumorlymphomagerm cell tumorstumors
Journal Article 2021-08-31 No Snippets Ramos A, Sadeghi S, Tabatabaeian H.
Show Full Abstract

With nearly 10 million deaths, cancer is the leading cause of mortality worldwide. Along with major key parameters that control cancer treatment management, such as diagnosis, resistance to the classical and new chemotherapeutic reagents continues to be a significant problem. Intrinsic or acquired chemoresistance leads to cancer recurrence in many cases that eventually causes failure in the successful treatment and death of cancer patients. Various determinants, including tumor heterogeneity and tumor microenvironment, could cause chemoresistance through a diverse range of mechanisms. In this review, we summarize the key determinants and the underlying mechanisms by which chemoresistance appears. We then describe which strategies have been implemented and studied to combat such a lethal phenomenon in the management of cancer treatment, with emphasis on the need to improve the early diagnosis of cancer complemented by combination therapy.

Also flagged:Mantle Cell Lymphomaimmune responsehematologic malignanciestumorcelltranslational
Journal Article 2021-08-31 ✓ 2 Snippets Kersy O, Salmon-Divon M, Shpilberg O, Hershkovitz-Rokah O.
In-Text Gene Mentions

Among them, SNHG12, FTX, SNHG5 and ZNFX1-AS1 were found to be associated with translation machinery via eIF4E-RNA-binding motifs (but not the cap-binding domain) in MCL tumor cells.

Another study has revealed the top eight eIF4E-enriched lncRNAs in MCL patient samples as compared with normal controls, including novel (NBPF8 and RP4-550H1.6) and known lncRNAs (ZNFX1-AS1, SNHG5, FTX, GAS5, CECR7 and SNHG12).

Show Full Abstract

B-lymphocytes are essential for an efficient immune response against a variety of pathogens. A large fraction of hematologic malignancies are of B-cell origin, suggesting that the development and activation of B cells must be tightly regulated. In recent years, differentially expressed non-coding RNAs have been identified in mantle cell lymphoma (MCL) tumor samples as opposed to their naive, normal B-cell compartment. These aberrantly expressed molecules, specifically microRNAs (miRNAs), circular RNAs (circRNAs) and long non-coding RNAs (lncRNAs), have a role in cellular growth and survival pathways in various biological models. Here, we provide an overview of current knowledge on the role of non-coding RNAs and their relevant targets in B-cell development, activation and malignant transformation, summarizing the current understanding of the role of aberrant expression of non-coding RNAs in MCL pathobiology with perspectives for clinical use.

Also flagged:SynthesisLactoseGalactoseCholic AcidChitosanliver cancer
Journal Article 2021-08-31 No Snippets Ding Y, Cui W, Vara Prasad CVNS, Wang B.
Show Full Abstract

Cholic acid and galactose or lactose dual conjugated chitosan derivatives were designed and synthesized as potential anti liver cancer drug carriers, their structures were characterized through proton NMR spectra, elemental analysis, size distribution, zeta potential, and scanning electron microscope image studies. The ability of the dual conjugates to enhance the aqueous solubility of the cancer drug sorafenib was evaluated. The entrapment efficiency (EE%) and drug content (DC%) of sorafenib in the inclusion complexes were measured. The chitosan dual conjugate with cholic acid and galactose was found to be best in enhancing the aqueous solubility of sorafenib. The solubility of sorafenib in water has increased from 1.7 µg/mL to 1900 µg/mL which is equal to 1117-fold increase in its solubility due to the inclusion complex with chitosan conjugate.

Also flagged:ZNF675ZNF398ZNF597ZNF197ZNF717ZNF585B
Journal Article 2021-08-31 ✓ 5 Snippets Yan D, Shen M, Du Z, Cao J, Tian Y, Zeng P, Tang Z.
In-Text Gene Mentions

ZNF644

Some studies have pointed out that the aberrant expression of ZNF644 may be a potential pathogenic factor for rheumatoid arthritis and strong myopia [45, 46].

…High expression ofZNF644and low expression…

…high expression ofZNF644and low expression…

…WhenZNF644was expressed at…

Show Full Abstract

Adjuvant radiotherapy is one of the main treatment methods for breast cancer, but its clinical benefit depends largely on the characteristics of the patient. This study aimed to explore the relationship between the expression of zinc finger (ZNF) gene family proteins and the radiosensitivity of breast cancer patients. Clinical and gene expression data on a total of 976 breast cancer samples were obtained from The Cancer Genome Atlas (TCGA) database. ZNF gene expression was dichotomized into groups with a higher or lower level than the median level of expression. Univariate and multivariate Cox regression analyses were used to evaluate the relationship between ZNF gene expression levels and radiosensitivity. The Molecular Taxonomy Data of the International Federation of Breast Cancer (METABRIC) database was used for validation. The results revealed that 4 ZNF genes were possible radiosensitivity markers. High expression of ZNF644 and low expression levels of the other 3 genes (ZNF341, ZNF541, and ZNF653) were related to the radiosensitivity of breast cancer. Hierarchical cluster, Cox, and CoxBoost analysis based on these 4 ZNF genes indicated that patients with a favorable 4-gene signature had better overall survival on radiotherapy. Thus, this 4-gene signature may have value for selecting those patients most likely to benefit from radiotherapy. ZNF gene clusters could act as radiosensitivity signatures for breast cancer patients and may be involved in determining the radiosensitivity of cancer.

Also flagged:Peroxiredoxin 1Oral Squamous Cell Carcinoma
Journal Article 2021-08-31 No Snippets Unknown Authors
Show Full Abstract

[This corrects the article DOI: 10.2147/CMAR.S319048.].

Also flagged:COVID-19 Infectioncoronavirus disease-19COVID-19severe acute respiratory syndromesudden strokecomplications
Journal Article 2021-08-31 ✓ 2 Snippets Pushparaj PN, Abdulkareem AA, Naseer MI.
In-Text Gene Mentions

Camptothecin potentially reversed 28 genes that were positively enriched in SARS-CoV-2 in NHBE cells, and the top 10 genes were COL6A2, CSE1L, TMEM135, PPA2, MNAT1, BNIP3L, DLGAP5, TMEM47, ARHGAP29, and OLA1.

…genes were COL6A2,CSE1L, TMEM135, PPA2, MNAT1,…

Show Full Abstract

SARS-CoV-2 is the causative agent for coronavirus disease-19 (COVID-19) and belongs to the family Coronaviridae that causes sickness varying from the common cold to more severe illnesses such as severe acute respiratory syndrome, sudden stroke, neurological complications (Neuro-COVID), multiple organ failure, and mortality in some patients. The gene expression profiles of COVID-19 infection models can be used to decipher potential therapeutics for COVID-19 and related pathologies, such as Neuro-COVID. Here, we used the raw RNA-seq reads (Single-End) in quadruplicates derived using Illumina Next Seq 500 from SARS-CoV-infected primary human bronchial epithelium (NHBE) and mock-treated NHBE cells obtained from the Gene Expression Omnibus (GEO) (GSE147507), and the quality control (QC) was evaluated using the CLC Genomics Workbench 20.0 (Qiagen, United States) before the RNA-seq analysis using BioJupies web tool and iPathwayGuide for gene ontologies (GO), pathways, upstream regulator genes, small molecules, and natural products. Additionally, single-cell transcriptomics data (GSE163005) of meta clusters of immune cells from the cerebrospinal fluid (CSF), such as T-cells/natural killer cells (NK) (TcMeta), dendritic cells (DCMeta), and monocytes/granulocyte (monoMeta) cell types for comparison, namely, Neuro-COVID versus idiopathic intracranial hypertension (IIH), were analyzed using iPathwayGuide. L1000 fireworks display (L1000FWD) and L1000 characteristic direction signature search engine (L1000 CDS<sup>2</sup>) web tools were used to uncover the small molecules that could potentially reverse the COVID-19 and Neuro-COVID-associated gene signatures. We uncovered small molecules such as camptothecin, importazole, and withaferin A, which can potentially reverse COVID-19 associated gene signatures. In addition, withaferin A, trichostatin A, narciclasine, camptothecin, and JQ1 have the potential to reverse Neuro-COVID gene signatures. Furthermore, the gene set enrichment analysis (GSEA) preranked method and Metascape web tool were used to decipher and annotate the gene signatures that were potentially reversed by these small molecules. In conclusion, our study unravels a rapid approach for applying next-generation knowledge discovery (NGKD) platforms to discover small molecules with therapeutic potential against COVID-19 and its related disease pathologies.

Also flagged:AutophagyMultiple SclerosisSilverMSchronic inflammatory diseasemyelin
Journal Article 2021-08-31 ✓ 1 Snippet Yang G, Van Kaer L.
In-Text Gene Mentions

Indeed, transcripts for 29 out of 78 ATGs analyzed in this study were significantly altered in MS patients, with 14 genes downregulated (including ATG16L2, ATG9A, FAS, GAA, HGS, and RAB24) and 15 genes upregulated (including ULK1, PIK3R1, BLC2, FOXO1, HTT, and RGS19) (20), suggesting the involvement of ATG gene products in MS pathogenesis.

Show Full Abstract

Multiple sclerosis (MS) is a chronic inflammatory disease of the central nervous system (CNS) in which the immune system damages the protective insulation surrounding nerve fibers that project from neurons. The pathological hallmark of MS is multiple areas of myelin loss accompanied by inflammation within the CNS, resulting in loss of cognitive function that ultimately leads to paralysis. Recent studies in MS have focused on autophagy, a cellular self-eating process, as a potential target for MS treatment. Here, we review the contribution of immune cell autophagy to the pathogenesis of experimental autoimmune encephalomyelitis (EAE), the prototypic animal model of MS. A better understanding of the role of autophagy in different immune cells to EAE might inform the development of novel therapeutic approaches in MS and other autoimmune and inflammatory diseases.

Also flagged:E2FGastric cancercancertranscription factorstumorpolymerase
Journal Article 2021-08-31 ✓ 2 Snippets Li S, Yang X, Li W, Chen Z, Chen Z.
In-Text Gene Mentions

In GC, upregulated E2F1 expression, targeting the TINCR/STAU1/CDKN2B signaling axis, was positively associated with poor prognosis due to its association with advanced stage and larger tumor size (39).

…pression, targeting the TINCR/STAU1/CDKN2B signaling axis, was…

Show Full Abstract

Gastric cancer (GC) is the second most common cancer and the third most frequent cause of cancer-related deaths in China. E2Fs are a family of transcription factors reported to be involved in the tumor progression of various cancer types; however, the roles of individual E2Fs are still not known exactly in tumor progression of GC. In this study, we examined the expression of E2Fs to investigate their roles in tumor progression in GC patients using multiple databases, including ONCOMINE, GEPIA2, Kaplan-Meier plotter, cBioPortal, Metascape, LinkedOmics, GeneMANIA, STRING and UCSC Xena. We also performed real-time polymerase chain reaction (RT-PCR) to validate the expression levels of individual E2Fs in several GC cell lines. Our results demonstrated that the mRNA levels of <i>E2F1/2/3/5/8</i> were significantly higher both in GC tissues and cell lines. The expression levels of <i>E2F1</i> and <i>E2F4</i> were correlated with poor overall survival (OS), decreased post-progression survival (PPS), and decreased progression-free survival (FP) in patients with GC. However, overexpression of <i>E2F2</i>, <i>E2F5</i>, <i>E2F7</i> and <i>E2F8</i> is significantly associated with disease-free survival and overall survival in patients with GC. In addition, higher <i>E2F3</i> and <i>E2F6</i> mRNA expression was found to increase GC patients' OS and PPS. 224 of 415 patients with STAD (54%) had gene mutations that were associated with longer disease-free survival (DFS) but not OS. Cell cycle pathway was closely associated with mRNA level of more than half of E2Fs (<i>E2F1/2/3/7/8</i>). There were close and complicated interactions among E2F family members. Finally, our results indicated the gene expressions of E2Fs had a positive relationship with its copy numbers. Taken together, <i>E2F1/2/3/5/8</i> can serve as biomarkers for GC patients with high prognostic value for OS of GC patients or therapeutic targets for GC.

Also flagged:ABCC1gliomatemozolomidetumorluciferaseATP binding cassette subfamily C member 1
Journal Article 2021-08-31 ✓ 1 Snippet Chen XR, Zhang YG, Wang Q.
In-Text Gene Mentions

…tumor suppressor geneSOX6( 12 ).…

Show Full Abstract

Chemotherapy combined with surgery is an important clinical treatment for glioma, but endogenous or acquired temozolomide (TMZ) resistance can lead to poor prognosis. microRNA (miR)-9-5p acts in biological function of glioma, but the drug resistance of miR-9-5p in glioma is under exploration. The study intended to test the molecular mechanism of miR-9-5p in glioma cells. MTT assay was applied to investigate the chemosensitivity enhancement of miR-9-5p on TMZ in glioma cells U87-TMZ and U251-TMZ, and <i>in vivo</i> experiments confirmed its role on tumor growth in nude mice. The results of double luciferase reporter gene assay, qRT-PCR and WB indicated that miR-9-5p directly targeted ABCC1 (ATP binding cassette subfamily C member 1) to reduce its expressions. MTT and flow cytometry indicated that elevation of miR-9-5p or down-regulation of ABCC1 could inhibit proliferation-induced apoptosis of drug-resistant cells, and the decrease of miR-9-5p could reverse the reduction of ABCC1 on proliferation-induced apoptosis of drug-resistant cells. In vivo experiments showed that miR-9-5p could promote the anti-tumor role of TMZ. To sum up, the increase of miR-9-5p directly targets ABCC1 and may make glioma cells sensitive to TMZ.

Also flagged:GlioblastomasGlioblastomatumorcancernucleotidesgliomagenesis
Journal Article 2021-08-31 No Snippets Wei J, Gilboa E, Calin GA, Heimberger AB.
Show Full Abstract

Glioblastomas are heterogeneous and have a poor prognosis. Glioblastoma cells interact with their neighbors to form a tumor-permissive and immunosuppressive microenvironment. Short noncoding RNAs are relevant mediators of the dynamic crosstalk among cancer, stromal, and immune cells in establishing the glioblastoma microenvironment. In addition to the ease of combinatorial strategies that are capable of multimodal modulation for both reversing immune suppression and enhancing antitumor immunity, their small size provides an opportunity to overcome the limitations of blood-brain-barrier (BBB) permeability. To enhance glioblastoma delivery, these RNAs have been conjugated with various molecules or packed within delivery vehicles for enhanced tissue-specific delivery and increased payload. Here, we focus on the role of RNA therapeutics by appraising which types of nucleotides are most effective in immune modulation, lead therapeutic candidates, and clarify how to optimize delivery of the therapeutic RNAs and their conjugates specifically to the glioblastoma microenvironment.

Also flagged:GliomaMetabolismtumourGlioblastomaGBMbrain tumour
Journal Article 2021-08-31 ✓ 1 Snippet Harland A, Liu X, Ghirardello M, Galan MC, Perks CM, Kurian KM.
In-Text Gene Mentions

demonstrated that neurodevelopmental transcription factors: sex determining region Y box 2 (SOX2), oligodendrocyte transcription factor (OLIG2), POU domain class 3 transcription factor 2 (POU3F2) and spalt like transcription factor 2 (SALL2) can be used to artificially reprogramme single cell primary glioblastoma cultures to a stem-like state, provides evidence for central nervous system (CNS) cell susceptibility to hierarchical reversal (35, 36).

Show Full Abstract

Glioma stem-like cells (GSCs) were first described as a population which may in part be resistant to traditional chemotherapeutic therapies and responsible for tumour regrowth. Knowledge of the underlying metabolic complexity governing GSC growth and function may point to potential differences between GSCs and the tumour bulk which could be harnessed clinically. There is an increasing interest in the direct/indirect targeting or reprogramming of GSC metabolism as a potential novel therapeutic approach in the adjuvant or recurrent setting to help overcome resistance which may be mediated by GSCs. In this review we will discuss stem-like models, interaction between metabolism and GSCs, and potential current and future strategies for overcoming GSC resistance.

Also flagged:Autophagyage-autophagy receptorsagingage-associated disordersorganelles
Journal Article 2021-08-31 No Snippets Papandreou ME, Tavernarakis N.
Show Full Abstract

Progressive accumulation of damaged cellular constituents contributes to age-related diseases. Autophagy is the main catabolic process, which recycles cellular material in a multitude of tissues and organs. Autophagy is activated upon nutrient deprivation, and oncogenic, heat or oxidative stress-induced stimuli to selectively degrade cell constituents and compartments. Specificity and accuracy of the autophagic process is maintained via the precision of interaction of autophagy receptors or adaptors and substrates by the intricate, stepwise orchestration of specialized integrating stimuli. Polymorphisms in genes regulating selective autophagy have been linked to aging and age-associated disorders. The involvement of autophagy perturbations in aging and disease indicates that pharmacological agents balancing autophagic flux may be beneficial, in these contexts. Here, we introduce the modes and mechanisms of selective autophagy, and survey recent experimental evidence of dysfunctional autophagy triggering severe pathology. We further highlight identified pharmacological targets that hold potential for developing therapeutic interventions to alleviate cellular autophagic cargo burden and associated pathologies.

Also flagged:5-Fluorouracilleucovorincolon cancermetastatic colon canceroxaliplatinirinotecan
Journal Article 2021-08-31 ✓ 1 Snippet Azwar S, Seow HF, Abdullah M, Faisal Jabar M, Mohtarrudin N.
In-Text Gene Mentions

It was shown that protocadherin-17 (PCDH17) silencing via promoter methylation does not only suppresses its role as a tumor-suppressor in inducing apoptosis, but also in inducing JNK-dependent autophagic cell death upon 5-FU treatment in colon cancer [83].

Show Full Abstract

5-Fluorouracil (5-FU) plus leucovorin (LV) remain as the mainstay standard adjuvant chemotherapy treatment for early stage colon cancer, and the preferred first-line option for metastatic colon cancer patients in combination with oxaliplatin in FOLFOX, or irinotecan in FOLFIRI regimens. Despite treatment success to a certain extent, the incidence of chemotherapy failure attributed to chemotherapy resistance is still reported in many patients. This resistance, which can be defined by tumor tolerance against chemotherapy, either intrinsic or acquired, is primarily driven by the dysregulation of various components in distinct pathways. In recent years, it has been established that the incidence of 5-FU resistance, akin to multidrug resistance, can be attributed to the alterations in drug transport, evasion of apoptosis, changes in the cell cycle and DNA-damage repair machinery, regulation of autophagy, epithelial-to-mesenchymal transition, cancer stem cell involvement, tumor microenvironment interactions, miRNA dysregulations, epigenetic alterations, as well as redox imbalances. Certain resistance mechanisms that are 5-FU-specific have also been ascertained to include the upregulation of thymidylate synthase, dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase, and the downregulation of thymidine phosphorylase. Indeed, the successful modulation of these mechanisms have been the game plan of numerous studies that had employed small molecule inhibitors, plant-based small molecules, and non-coding RNA regulators to effectively reverse 5-FU resistance in colon cancer cells. It is hoped that these studies would provide fundamental knowledge to further our understanding prior developing novel drugs in the near future that would synergistically work with 5-FU to potentiate its antitumor effects and improve the patient's overall survival.

Also flagged:tumorMalignant gliomasbrain tumorsgene expressiontumorsGliomas
Journal Article 2021-08-31 ✓ 4 Snippets Kaminska B, Ochocka N, Segit P.
In-Text Gene Mentions

Mesenchymal tumors with high expression of stemness markers (POU3F2, SOX2, SALL2, OLIG2) had significantly worse outcome than the proneural subtype tumors [11].

…stemness signature (POU3F2, SOX2 ,…

POU3F2( POU Class…

…stemness markers (POU3F2, SOX2 ,…

Show Full Abstract

Single-cell technologies allow precise identification of tumor composition at the single-cell level, providing high-resolution insights into the intratumoral heterogeneity and transcriptional activity of cells in the tumor microenvironment (TME) that previous approaches failed to capture. Malignant gliomas, the most common primary brain tumors in adults, are genetically heterogeneous and their TME consists of various stromal and immune cells playing an important role in tumor progression and responses to therapies. Previous gene expression or immunocytochemical studies of immune cells infiltrating TME of malignant gliomas failed to dissect their functional phenotypes. Single-cell RNA sequencing (scRNA-seq) and cytometry by time-of-flight (CyTOF) are powerful techniques allowing quantification of whole transcriptomes or >30 protein targets in individual cells. Both methods provide unprecedented resolution of TME. We summarize the findings from these studies and the current state of knowledge of a functional diversity of immune infiltrates in malignant gliomas with different genetic alterations. A precise definition of functional phenotypes of myeloid and lymphoid cells might be essential for designing effective immunotherapies. Single-cell omics studies have identified crucial cell subpopulations and signaling pathways that promote tumor progression, influence patient survival or make tumors vulnerable to immunotherapy. We anticipate that the widespread usage of single-cell omics would allow rational design of oncoimmunotherapeutics.

Also flagged:Autophagypathogenesiscancerocular disordersagingchronic illnesses
Journal Article 2021-08-30 ✓ 1 Snippet Klionsky DJ, Petroni G, Amaravadi RK, Baehrecke EH, Ballabio A, Boya P, Bravo-San Pedro JM, Cadwell K, Cecconi F, Choi AMK, Choi ME, Chu CT, Codogno P, Colombo MI, Cuervo AM, Deretic V, Dikic I, Elazar Z, Eskelinen EL, Fimia GM, Gewirtz DA, Green DR, Hansen M, Jäättelä M, Johansen T, Juhász G, Karantza V, Kraft C, Kroemer G, Ktistakis NT, Kumar S, Lopez-Otin C, Macleod KF, Madeo F, Martinez J, Meléndez A, Mizushima N, Münz C, Penninger JM, Perera RM, Piacentini M, Reggiori F, Rubinsztein DC, Ryan KM, Sadoshima J, Santambrogio L, Scorrano L, Simon HU, Simon AK, Simonsen A, Stolz A, Tavernarakis N, Tooze SA, Yoshimori T, Yuan J, Yue Z, Zhong Q, Galluzzi L, Pietrocola F.
In-Text Gene Mentions

The polyQ expansion in HTT (huntingtin) is the etiological driver of HD (Zheng et al, 2010), and the severity thereof is a direct function of polyQ length.

Show Full Abstract

Autophagy is a core molecular pathway for the preservation of cellular and organismal homeostasis. Pharmacological and genetic interventions impairing autophagy responses promote or aggravate disease in a plethora of experimental models. Consistently, mutations in autophagy-related processes cause severe human pathologies. Here, we review and discuss preclinical data linking autophagy dysfunction to the pathogenesis of major human disorders including cancer as well as cardiovascular, neurodegenerative, metabolic, pulmonary, renal, infectious, musculoskeletal, and ocular disorders.

Also flagged:Tenofovirnucleotidereverse transcriptaseAIDSphospholipidLipid
Journal Article 2021-08-30 No Snippets Pribut N, D'Erasmo M, Dasari M, Giesler KE, Iskandar S, Sharma SK, Bartsch PW, Raghuram A, Bushnev A, Hwang SS, Burton SL, Derdeyn CA, Basson AE, Liotta DC, Miller EJ.
Show Full Abstract

Tenofovir (TFV) is the cornerstone nucleotide reverse transcriptase inhibitor (NtRTI) in many combination antiretroviral therapies prescribed to patients living with HIV/AIDS. Due to poor cell permeability and oral bioavailability, TFV is administered as one of two FDA-approved prodrugs, both of which metabolize prematurely in the liver and/or plasma. This premature prodrug processing depletes significant fractions of each oral dose and causes toxicity in kidney, bone, and liver with chronic administration. Although TFV exalidex (TXL), a phospholipid-derived prodrug of TFV, was designed to address this issue, clinical pharmacokinetic studies indicated substantial hepatic extraction, redirecting clinical development of TXL toward HBV. To circumvent this metabolic liability, we synthesized and evaluated ω-functionalized TXL analogues with dramatically improved hepatic stability. This effort led to the identification of compounds <b>21</b> and <b>23</b>, which exhibited substantially longer <i>t</i><sub>1/2</sub> values than TXL in human liver microsomes, potent anti-HIV activity <i>in vitro</i>, and enhanced pharmacokinetic properties <i>in vivo</i>.

Also flagged:tumorcancercell proliferationtranslationalnucleotidenucleotides
Journal Article 2021-08-30 No Snippets Liu B, Xiang W, Liu J, Tang J, Wang J, Liu B, Long Z, Wang L, Yin G, Liu J.
Show Full Abstract

Antisense long non-coding RNAs (antisense lncRNAs), transcribed from the opposite strand of genes with either protein coding or non-coding function, were reported recently to play a crucial role in the process of tumor onset and development. Functionally, antisense lncRNAs either promote or suppress cancer cell proliferation, migration, invasion, and chemoradiosensitivity. Mechanistically, they exert their regulatory functions through epigenetic, transcriptional, post-transcriptional, and translational modulations. Simultaneously, because of nucleotide sequence complementarity, antisense lncRNAs have a special role on its corresponding sense gene. We highlight the functions and molecular mechanisms of antisense lncRNAs in cancer tumorigenesis and progression. We also discuss the potential of antisense lncRNAs to become cancer diagnostic biomarkers and targets for tumor treatment.

Also flagged:AddictionbehavioralchromatinD2PVnicotine
Journal Article 2021-08-30 No Snippets Srinivasan C, Phan BN, Lawler AJ, Ramamurthy E, Kleyman M, Brown AR, Kaplow IM, Wirthlin ME, Pfenning AR.
Show Full Abstract

Recent large genome-wide association studies have identified multiple confident risk loci linked to addiction-associated behavioral traits. Most genetic variants linked to addiction-associated traits lie in noncoding regions of the genome, likely disrupting <i>cis</i>-regulatory element (CRE) function. CREs tend to be highly cell type-specific and may contribute to the functional development of the neural circuits underlying addiction. Yet, a systematic approach for predicting the impact of risk variants on the CREs of specific cell populations is lacking. To dissect the cell types and brain regions underlying addiction-associated traits, we applied stratified linkage disequilibrium score regression to compare genome-wide association studies to genomic regions collected from human and mouse assays for open chromatin, which is associated with CRE activity. We found enrichment of addiction-associated variants in putative CREs marked by open chromatin in neuronal (NeuN<sup>+</sup>) nuclei collected from multiple prefrontal cortical areas and striatal regions known to play major roles in reward and addiction. To further dissect the cell type-specific basis of addiction-associated traits, we also identified enrichments in human orthologs of open chromatin regions of female and male mouse neuronal subtypes: cortical excitatory, D1, D2, and PV. Last, we developed machine learning models to predict mouse cell type-specific open chromatin, enabling us to further categorize human NeuN<sup>+</sup> open chromatin regions into cortical excitatory or striatal D1 and D2 neurons and predict the functional impact of addiction-associated genetic variants. Our results suggest that different neuronal subtypes within the reward system play distinct roles in the variety of traits that contribute to addiction.<b>SIGNIFICANCE STATEMENT</b> We combine statistical genetic and machine learning techniques to find that the predisposition to for nicotine, alcohol, and cannabis use behaviors can be partially explained by genetic variants in conserved regulatory elements within specific brain regions and neuronal subtypes of the reward system. Our computational framework can flexibly integrate open chromatin data across species to screen for putative causal variants in a cell type- and tissue-specific manner for numerous complex traits.

Also flagged:-valPhototransductionguca1atbx2a_valTPM
Journal Article 2021-08-30 ✓ 1 Snippet Ogawa Y, Corbo JC.
In-Text Gene Mentions

…cone genes (sox6and glis3 ).…

Show Full Abstract

Vertebrate photoreceptors are categorized into two broad classes, rods and cones, responsible for dim- and bright-light vision, respectively. While many molecular features that distinguish rods and cones are known, gene expression differences among cone subtypes remain poorly understood. Teleost fishes are renowned for the diversity of their photoreceptor systems. Here, we used single-cell RNA-seq to profile adult photoreceptors in zebrafish, a teleost. We found that in addition to the four canonical zebrafish cone types, there exist subpopulations of green and red cones (previously shown to be located in the ventral retina) that express red-shifted opsin paralogs (opn1mw4 or opn1lw1) as well as a unique combination of cone phototransduction genes. Furthermore, the expression of many paralogous phototransduction genes is partitioned among cone subtypes, analogous to the partitioning of the phototransduction paralogs between rods and cones seen across vertebrates. The partitioned cone-gene pairs arose via the teleost-specific whole-genome duplication or later clade-specific gene duplications. We also discovered that cone subtypes express distinct transcriptional regulators, including many factors not previously implicated in photoreceptor development or differentiation. Overall, our work suggests that partitioning of paralogous gene expression via the action of differentially expressed transcriptional regulators enables diversification of cone subtypes in teleosts.

Also flagged:ureaCGNhypertensioncoagulationPolyamideDiabetic nephropathy
Journal Article 2021-08-30 ✓ 3 Snippets Kim HJ, Seong EY, Lee W, Kim S, Ahn HS, Yeom J, Kim K, Kwon CH, Song SH.
In-Text Gene Mentions

Clusterin (CLU), FN1, glycerol, hyaluronan binding protein 2 (HABP2), insulin like growth factor 2 (IGF2), kininogen 1 (KNG1), l-glutamic acid, protein S (PROS1), serpin family C member 1 (SERPINC1), and serpin family F member 1 (SERPINF1) are involved in the growth of epithelial tissue-related processes, predicted to be activated in MCO compared to levels in the 1stst HF (activation z-score = 1.913).

…member 1 (SERPINC1), and serpin…

…), RBP4 ,SERPINC1, and SERPINF1…

Show Full Abstract

In this single-center prospective study of 20 patients receiving maintenance hemodialysis (HD), we compared the therapeutic effects of medium cut-off (MCO) and high flux (HF) dialyzers using metabolomics and proteomics. A consecutive dialyzer membrane was used for 15-week study periods: 1st HF dialyzer, MCO dialyzer, 2nd HF dialyzer, for 5 weeks respectively. <sup>1</sup>H-nuclear magnetic resonance was used to identify the metabolites and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to identify proteins. To compare the effects of the HF and MCO dialyzers, orthogonal projection to latent structure discriminant analysis (OPLS-DA) was performed. OPLS-DA showed that metabolite characteristics could be significantly classified by 1st HF and MCO dialyzers. The Pre-HD metabolites with variable importance in projection scores ≥ 1.0 in both 1st HF versus MCO and MCO versus 2nd HF were succinate, glutamate, and histidine. The pre-HD levels of succinate and histidine were significantly lower, while those of glutamate were significantly higher in MCO period than in the HF period. OPLS-DA of the proteome also substantially separated 1st HF and MCO periods. Plasma pre-HD levels of fibronectin 1 were significantly higher, and those of complement component 4B and retinol-binding protein 4 were significantly lower in MCO than in the 1st HF period. Interestingly, as per Ingenuity Pathway Analysis, an increase in epithelial cell proliferation and a decrease in endothelial cell apoptosis occurred during the MCO period. Overall, our results suggest that the use of MCO dialyzers results in characteristic metabolomics and proteomics profiles during HD compared with HF dialyzers, which might be related to oxidative stress, insulin resistance, complement-coagulation axis, inflammation, and nutrition.

Also flagged:DNA polymerase θHuntington's diseaseHDneurodegenerative diseasedementiachorea
Journal Article 2021-08-30 ✓ 1 Snippet Chan KY, Li X, Ortega J, Gu L, Li GM.
In-Text Gene Mentions

…the HD geneHTT.…

Show Full Abstract

Huntington's disease (HD), a neurodegenerative disease characterized by progressive dementia, psychiatric problems, and chorea, is known to be caused by CAG repeat expansions in the HD gene HTT. However, the mechanism of this pathology is not fully understood. The translesion DNA polymerase θ (Polθ) carries a large insertion sequence in its catalytic domain, which has been shown to allow DNA loop-outs in the primer strand. As a result of high levels of oxidative DNA damage in neural cells and Polθ's subsequent involvement in base excision repair of oxidative DNA damage, we hypothesized that Polθ contributes to CAG repeat expansion while repairing oxidative damage within HTT. Here, we performed Polθ-catalyzed in vitro DNA synthesis using various CAG•CTG repeat DNA substrates that are similar to base excision repair intermediates. We show that Polθ efficiently extends (CAG)<sub>n</sub>•(CTG)<sub>n</sub> hairpin primers, resulting in hairpin retention and repeat expansion. Polθ also triggers repeat expansions to pass the threshold for HD when the DNA template contains 35 repeats upward. Strikingly, Polθ depleted of the catalytic insertion fails to induce repeat expansions regardless of primers and templates used, indicating that the insertion sequence is responsible for Polθ's error-causing activity. In addition, the level of chromatin-bound Polθ in HD cells is significantly higher than in non-HD cells and exactly correlates with the degree of CAG repeat expansion, implying Polθ's involvement in triplet repeat instability. Therefore, we have identified Polθ as a potent factor that promotes CAG•CTG repeat expansions in HD and other neurodegenerative disorders.

Also flagged:Peroxiredoxin 6ischemic strokePTENPI3KAKTaxon
Journal Article 2021-08-30 ✓ 3 Snippets Tang B, Ni W, Zhou J, Ling Y, Niu D, Lu X, Chen T, Ramalingam M, Hu J.
In-Text Gene Mentions

…Peroxiredoxin 6 (PRDX6) was found in…

PRDX6could significantly inhibit…

…In conclusion,PRDX6secreted by Schwann-like…

Show Full Abstract

Schwann cells can promote the survival of damaged neurons and axon regeneration by secreting or releasing some proteins and factors which may provide effective strategies to the remedy for ischemic stroke. The models of middle cerebral artery occlusion and oxygen-glucose deprivation (OGD) were established. Peroxiredoxin 6 (PRDX6) was found in Schwann-like cell conditioned medium (SCLC-CM) by mass spectrometry. The rehabilitative performance of SCLC-CM on focal cerebral ischemia of rats and on OGD-induced PC12 cells were assessed. SCLC-CM significantly improved neurological recovery, reducing the infarct volume of rats after stroke. PRDX6 could significantly inhibit neuron apoptosis in the OGD injury by mediating oxidative stress and activating the PTEN/PI3K/AKT pathway. In conclusion, PRDX6 secreted by Schwann-like cell protects neuron against focal cerebral ischemia, SCLC-CM might be a new effective early intervention for ischemic stroke.

Also flagged:RPEginLDHlipidbehaviourdichloromethane
Journal Article 2021-08-30 No Snippets European Food Safety Authority (EFSA), Alvarez F, Arena M, Auteri D, Borroto J, Brancato A, Carrasco Cabrera L, Castoldi AF, Chiusolo A, Colagiorgi A, Colas M, Crivellente F, De Lentdecker C, Egsmose M, Fait G, Gouliarmou V, Ferilli F, Greco L, Ippolito A, Istace F, Jarrah S, Kardassi D, Kienzler A, Leuschner R, Lava R, Linguadoca A, Lythgo C, Magrans O, Mangas I, Miron I, Molnar T, Padovani L, Parra Morte JM, Pedersen R, Reich H, Santos M, Sharp R, Szentes C, Terron A, Tiramani M, Vagenende B, Villamar-Bouza L.
Show Full Abstract

The conclusions of the EFSA following the peer review of the initial risk assessments carried out by the competent authorities of the rapporteur Member State, Sweden, and co-rapporteur Member State, Italy, for the pesticide active substance bifenazate are reported. The context of the peer review was that required by Commission Implementing Regulation (EU) No 844/2012. The conclusions were reached on the basis of the evaluation of the representative uses of bifenazate as an acaricide on strawberry, fruiting vegetables (tomatoes, peppers, aubergines, cucumbers, courgettes, melons, watermelons), flowering and ornamental plants and nursery ornamentals and updated following the request to peer review the exposure and risk assessments for bifenazate. The reliable end points, appropriate for use in regulatory risk assessment, are presented. Missing information identified as being required by the regulatory framework is listed. Concerns are identified.

Also flagged:GnRHGonadotropin releasing hormonesexual reproductionaxonalneuronCongenital Hypogonadotropic Hypogonadism
Journal Article 2021-08-30 ✓ 1 Snippet Oleari R, Massa V, Cariboni A, Lettieri A.
In-Text Gene Mentions

Patients carrying DCC and NTN1 variants were affected by KS, obesity and ear abnormalities [229].

Show Full Abstract

Gonadotropin releasing hormone (GnRH) neurons are hypothalamic neuroendocrine cells that control sexual reproduction. During embryonic development, GnRH neurons migrate from the nose to the hypothalamus, where they receive inputs from several afferent neurons, following the axonal scaffold patterned by nasal nerves. Each step of GnRH neuron development depends on the orchestrated action of several molecules exerting specific biological functions. Mutations in genes encoding for these essential molecules may cause Congenital Hypogonadotropic Hypogonadism (CHH), a rare disorder characterized by GnRH deficiency, delayed puberty and infertility. Depending on their action in the GnRH neuronal system, CHH causative genes can be divided into neurodevelopmental and neuroendocrine genes. The CHH genetic complexity, combined with multiple inheritance patterns, results in an extreme phenotypic variability of CHH patients. In this review, we aim at providing a comprehensive and updated description of the genes thus far associated with CHH, by dissecting their biological relevance in the GnRH system and their functional relevance underlying CHH pathogenesis.

Also flagged:Peroxiredoxin 1TLR4PeroxiredoxinsovulationPRDX1ERK1
Journal Article 2021-08-30 No Snippets Park HJ, Kim B, Koo DB, Lee DS.
Show Full Abstract

Peroxiredoxins (PRDXs) are expressed in the ovary and during ovulation. PRDX1 activity related to the immuno-like response during ovulation is unknown. We investigated the roles of <i>Prdx1</i> on TLR4 and ERK1/2 signaling from the ovulated cumulus-oocyte complex (COC) using <i>Prdx1</i>-knockout (K/O) and wild-type (WT) mice. Ovulated COCs were collected 12 and 16 h after pregnant mare serum gonadotropin/hCG injection. PRDX1 protein expression and COC secretion factors (<i>Il-6</i>, <i>Tnfaip6</i>, and <i>Ptgs2</i>) increased 16 h after ovulated COCs of the WT mice were obtained. We treated the ovulated COCs in mice with LPS (0.5 μg/mL) or hyaluronidase (Hya) (10 units/mL) to induce TLR4 activity. Intracellular reactive oxygen species (ROS), cumulus cell apoptosis, PRDX1, TLR4/P38/ERK1/2 protein expression, and COC secretion factors' mRNA levels increased in LPS- and Hya-treated COCs. The ERK inhibitor (U0126) and <i>Prdx1</i> siRNA affected TLR4/ERK1/2 expression. The number and cumulus expansion of ovulated COCs by ROS were impaired in <i>Prdx1</i> K/O mice but not in WT ones. <i>Prdx1</i> gene deletion induced TLR4/P38/ERK1/2 expression and cumulus expansion genes. These results show the controlling roles of PRDX1 for TLR4/P38/ERK1/2 signaling activity in ovulated mice and the interlink of COCs with ovulation.

Also flagged:cancertumorbasementmembraneextracellularvesicles
Journal Article 2021-08-30 ✓ 1 Snippet Seibold T, Waldenmaier M, Seufferlein T, Eiseler T.
In-Text Gene Mentions

In cervical cancer (CeC), increased PD-L1 levels can also be traced back to the upregulation of miR-18a, which targets PTEN and SOX6 [137], whereas in HCC, miR-23a-3p induced elevated PD-L1 levels in macrophages [138].

Show Full Abstract

Cancer is a complex disease, driven by genetic defects and environmental cues. Systemic dissemination of cancer cells by metastasis is generally associated with poor prognosis and is responsible for more than 90% of cancer deaths. Metastasis is thought to follow a sequence of events, starting with loss of epithelial features, detachment of tumor cells, basement membrane breakdown, migration, intravasation and survival in the circulation. At suitable distant niches, tumor cells reattach, extravasate and establish themselves by proliferating and attracting vascularization to fuel metastatic growth. These processes are facilitated by extensive cross-communication of tumor cells with cells in the primary tumor microenvironment (TME) as well as at distant pre-metastatic niches. A vital part of this communication network are small extracellular vesicles (sEVs, exosomes) with a size of 30-150 nm. Tumor-derived sEVs educate recipient cells with bioactive cargos, such as proteins, and in particular, major nucleic acid classes, to drive tumor growth, cell motility, angiogenesis, immune evasion and formation of pre-metastatic niches. Circulating sEVs are also utilized as biomarker platforms for diagnosis and prognosis. This review discusses how tumor cells facilitate progression through the metastatic cascade by employing sEV-based communication and evaluates their role as biomarkers and vehicles for drug delivery.

Also flagged:Acute lymphoblastic leukemiaALLcancerIKZF1PAX5JAK2
Journal Article 2021-08-30 ✓ 1 Snippet Lühmann JL, Stelter M, Wolter M, Kater J, Lentes J, Bergmann AK, Schieck M, Göhring G, Möricke A, Cario G, Žaliová M, Schrappe M, Schlegelberger B, Stanulla M, Steinemann D.
In-Text Gene Mentions

…of the genesSLC9C2/KCTD3 was detected.…

Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most prevalent type of cancer occurring in children. ALL is characterized by structural and numeric genomic aberrations that strongly correlate with prognosis and clinical outcome. Usually, a combination of cyto- and molecular genetic methods (karyotyping, array-CGH, FISH, RT-PCR, RNA-Seq) is needed to identify all aberrations relevant for risk stratification. We investigated the feasibility of optical genome mapping (OGM), a DNA-based method, to detect these aberrations in an all-in-one approach. As proof of principle, twelve pediatric ALL samples were analyzed by OGM, and results were validated by comparing OGM data to results obtained from routine diagnostics. All genomic aberrations including translocations (e.g., dic(9;12)), aneuploidies (e.g., high hyperdiploidy) and copy number variations (e.g., <i>IKZF1</i>, <i>PAX5</i>) known from other techniques were also detected by OGM. Moreover, OGM was superior to well-established techniques for resolution of the more complex structure of a translocation t(12;21) and had a higher sensitivity for detection of copy number alterations. Importantly, a new and unknown gene fusion of <i>JAK2</i> and <i>NPAT</i> due to a translocation t(9;11) was detected. We demonstrate the feasibility of OGM to detect well-established as well as new putative prognostic markers in an all-in-one approach in ALL. We hope that these limited results will be confirmed with testing of more samples in the future.

Also flagged:hand-foot-and-mouth diseaserespiratoryGGTCKCRPand
Journal Article 2021-08-30 No Snippets Zhuo F, Yu M, Chen Q, Li N, Luo L, Hu M, Dong Q, Hong L, Zhang S, Tao Q.
Show Full Abstract

<h4>Objective</h4>To find risk markers and develop new clinical predictive models for the differential diagnosis of hand-foot-and-mouth disease (HFMD) with varying degrees of disease.<h4>Methods</h4>19766 children with HFMD and 64 clinical indexes were included in this study. The patients included in this study were divided into the mild patients' group (mild) with 12292 cases, severe patients' group (severe) with 6508 cases, and severe patients with respiratory failure group (severe-RF) with 966 cases. Single-factor analysis was carried out on 64 indexes collected from patients when they were admitted to the hospital, and the indexes with statistical differences were selected as the prediction factors. Binary multivariate logistic regression analysis was used to construct the prediction models and calculate the adjusted odds ratio (OR).<h4>Results</h4>SP, DP, NEUT#, NEUT%, RDW-SD, RDW-CV, GGT, CK/CK-MB, and Glu were risk markers in mild/severe, mild/severe-RF, and severe/severe-RF. Glu was a diagnostic marker for mild/severe-RF (AUROC = 0.80, 95% CI: 0.78-0.82); the predictive model constructed by temperature, SP, MOMO%, EO%, RDW-SD, GLB, CRP, Glu, BUN, and Cl could be used for the differential diagnosis of mild/severe (AUROC > 0.84); the predictive model constructed by SP, age, NEUT#, PCT, TBIL, GGT, Mb, <i>β</i>2MG, Glu, and Ca could be used for the differential diagnosis of severe/severe-RF (AUROC > 0.76).<h4>Conclusion</h4>By analyzing clinical indicators, we have found the risk markers of HFMD and established suitable predictive models.

Also flagged:Lung Squamous Cell CarcinomaGene ExpressionKRT6AIDO1LINC01871ADAM23
Journal Article 2021-08-30 ✓ 3 Snippets Du Y, Yuan S, Zhuang X, Zhang Q, Qiao T.
In-Text Gene Mentions

miR-1269a could function as an onco-miRNA in NSCLC and promote NSCLC growth via downregulating SOX6 [19].

…growth via downregulatingSOX6[ 19 ].…

SOX6suppresses the cell…

Show Full Abstract

<h4>Objectives</h4>Radiosensitivity Index (RSI) can predict intrinsic radiotherapy sensitivity. We analyzed multiomics characteristics in lung squamous cell carcinoma between high and low RSI groups, which may help understand the underlying molecular mechanism of radiosensitivity and guide optional treatment for patients in the future.<h4>Methods</h4>The Cancer Genome Atlas (TCGA) and the Gene Expression Omnibus (GEO) data were used to download clinical data, mRNA, microRNA, and lncRNA expression. Differential analyses, including mRNA, miRNA, lncRNA, and G.O. and KEGG, and GSVA analyses, were performed with R. Gene set enrichment analysis was done by GSEA. miRNA-differentially expressed gene network and ceRNA network were analyzed and graphed by the Cytoscape software.<h4>Results</h4>In TCGA data, 542 patients were obtained, including 171 in the low RSI group (LRSI) and 371 in the high RSI group (HRSI). In RNAseq, 558 significantly differentially expressed genes (DEGs) were obtained. KRT6A was the most significantly upregulated gene and IDO1 was the most significantly downregulated gene. In miRNAseq, miR-1269a was the most significantly upregulated. In lncRNAseq, LINC01871 was the most upregulated. A 66-pair interaction between differentially expressed genes and miRNAs and an 11-pair interaction between differential lncRNAs and miRNAs consisted of a ceRNA network, of which miR-184 and miR-490-3p were located in the center. In the GEO data, there were 40 DEGs. A total of 17 genes were founded in both databases, such as ADAM23, AHNAK2, BST2, COL11A1, CXCL13, FBN2, IFI27, IFI44L, MAGEA6, and PTGR1. GSVA analysis revealed 31 significant pathways. GSEA found 87 gene sets enriched in HRSI and 91 gene sets in LRSI. G.O. and KEGG of RNA expression levels revealed that these genes were most enriched in T cell activation and cytokine-cytokine receptor interaction.<h4>Conclusions</h4>Patients with lung squamous cell carcinoma have different multiomics characteristics between two groups. These differences may have an essential significance with radiotherapy effect.

Also flagged:vWFCoagulationCOVID-19coagulopathyTFPIprotein C
Journal Article 2021-08-30 ✓ 4 Snippets Al Otair H, AlSaleh K, AlQahtany FS, Al Ayed K, Al Ammar H, Al Mefgai N, Al Zeer F.
In-Text Gene Mentions

…protein C, S,ATIII, and D-dimer between…

…Staclot, Stachrom, StachromATIIISTA ® ,…

…proteins C, S,ATIIIbetween the two…

…(Pr C, S,ATIII) in COVID-19 patients…

Show Full Abstract

<h4>Background</h4>The coagulopathy of COVID-19 still awaits more clarification, and one approach that has not been investigated is to compare the hemostatic changes between COVID-19 and non-COVID-19 infected patients.<h4>Objective</h4>This study aims to study COVID-19 coagulopathy by measuring markers of endothelial injury and coagulation, including anticoagulants (TFPI, protein C, protein S, and AT) in COVID-19 patients and compare them with non-COVID-19 patients early in the course of the disease.<h4>Methodology</h4>This is an observational, prospective cross-sectional study comparing the levels of protein C, protein S, antithrombin (AT) III, clotting factor (F) VIII, von Willebrand factor (vWF) and coagulation screening tests (PT and a PTT), fibrinogen, D-dimer in COVID-19 patients admitted during the same time with non-COVID-19 infections. The demographic and clinical data of the patients were collected from electronic medical records during admission. Blood tests were extracted within 24 hours of admission for both groups.<h4>Results</h4>Fifty-four (66.7% males) consecutive COVID-19 patients and 24 (59% males) non-COVID-19 controls were enrolled in the study from October 2020 till December 2020. COVID-19 patients were significantly older than non-COVID-19 (57.7±14.2 vs 50±19.8 years, <i>p=</i>0.005). Fibrinogen level was significantly higher in COVID-19 patients compared to controls (5.9±1.48 vs 3.9±1.57, <i>p</i><0.001). There was no statistically significant difference in the level of FVIII, protein C, S, ATIII, and D-dimer between the two groups. The level of vWF Ag was statistically higher in COVID-19 patients (276.7±91.1 vs 184.7±89.4, <i>p</i>=0.0001). There was significant thrombocytopenia and lymphopenia among COVID-19 patients. Inflammatory markers, CRP, ferritin, and LDH, were increased in COVID-19 patients compared to non-COVID-19, but the difference was not statistically significant. High fibrinogen and vWF AG levels were the two independent variables found in COVID-19 patients.<h4>Conclusion</h4>The level of vWF Ag is increased early in the course of COVID-19 infection. This can be used as a biomarker for endothelial injury, which is peculiar to COVID-19 infection.

Also flagged:CisplatinAKT2CX3CR1Glycerolipid MetabolismBIRC3Beta-Alanine Metabolism
Journal Article 2021-08-30 ✓ 1 Snippet Madhok A, Bhat SA, Philip CS, Sureshbabu SK, Chiplunkar S, Galande S.
In-Text Gene Mentions

…members BTN3A1 andBTN2A1play crucial roles…

Show Full Abstract

Gamma delta (γδ) T cells, especially the Vγ9Vδ2 subtype, have been implicated in cancer therapy and thus have earned the spotlight in the past decade. Although one of the most important properties of γδ T cells is their activation by phosphoantigens, which are intermediates of the Mevalonate and Rohmer pathway of isoprenoid biosynthesis, such as IPP and HDMAPP, respectively, the global effects of such treatments on Vγ9Vδ2 T cells remain elusive. Here, we used the high-throughput transcriptomics approach to elucidate the transcriptional changes in human Vγ9Vδ2 T cells upon HDMAPP, IPP, and anti-CD3 treatments in combination with interleukin 2 (IL2) cytokine stimulation. These activation treatments exhibited a dramatic surge in transcription with distinctly enriched pathways. We further assessed the transcriptional dynamics upon inhibition of Notch signaling coupled with activation treatments. We observed that the metabolic processes are most affected upon Notch inhibition <i>via</i> GSI-X. The key effector genes involved in gamma-delta cytotoxic function were downregulated upon Notch blockade even in combination with activation treatment, suggesting a transcriptional crosstalk between T-cell receptor (TCR) signaling and Notch signaling in Vγ9Vδ2 T cells. Collectively, we demonstrate the effect of the activation of TCR signaling by phosphoantigens or anti-CD3 on the transcriptional status of Vγ9Vδ2 T cells along with IL2 stimulation. We further show that the blockade of Notch signaling antagonistically affects this activation.

Also flagged:regulation ofgene expressionneurological disorderschromatinX-chromosomepathogenesis
Journal Article 2021-08-30 No Snippets Zhou S, Yu X, Wang M, Meng Y, Song D, Yang H, Wang D, Bi J, Xu S.
Show Full Abstract

Emerging evidence addresses the link between the aberrant epigenetic regulation of gene expression and numerous diseases including neurological disorders, such as Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD). LncRNAs, a class of ncRNAs, have length of 200 nt or more, some of which crucially regulate a variety of biological processes such as epigenetic-mediated chromatin remodeling, mRNA stability, X-chromosome inactivation and imprinting. Aberrant regulation of the lncRNAs contributes to pathogenesis of many diseases, such as the neurological disorders at the transcriptional and post-transcriptional levels. In this review, we highlight the latest research progress on the contributions of some lncRNAs to the pathogenesis of neurodegenerative diseases <i>via</i> varied mechanisms, such as autophagy regulation, Aβ deposition, neuroinflammation, Tau phosphorylation and α-synuclein aggregation. Meanwhile, we also address the potential challenges on the lncRNAs-mediated epigenetic study to further understand the molecular mechanism of the neurodegenerative diseases.

Also flagged:adenomacarcinomacanceroxygenphosphorylationglucose
Journal Article 2021-08-30 ✓ 1 Snippet Abi Zamer B, Abumustafa W, Hamad M, Maghazachi AA, Muhammad JS.
In-Text Gene Mentions

Also, the LOH of chromosome 18q causes the deletion of tumor suppresser genes such as DCC, SMAD2, and SMAD4, the mutation of which leads to the upregulation of enzymes involved in the glycolysis pathway, such as PKM2, HK2, and GLUT1 [29], as an early event in premalignant colonic mucosa and CRC progression [41].

Show Full Abstract

Colorectal cancer (CRC) development is a gradual process defined by the accumulation of numerous genetic mutations and epigenetic alterations leading to the adenoma-carcinoma sequence. Despite significant advances in the diagnosis and treatment of CRC, it continues to be a leading cause of cancer-related deaths worldwide. Even in the presence of oxygen, CRC cells bypass oxidative phosphorylation to produce metabolites that enable them to proliferate and survive-a phenomenon known as the "Warburg effect". Understanding the complex glucose metabolism in CRC cells may support the development of new diagnostic and therapeutic approaches. Here we discuss the most recent findings on genetic mutations and epigenetic modulations that may positively or negatively regulate the Warburg effect in CRC cells. We focus on the non-coding RNA (ncRNA)-based epigenetics, and we present a perspective on the therapeutic relevance of critical molecules and ncRNAs mediating the Warburg effect in CRC cells. All the relevant studies were identified and assessed according to the genes and enzymes mediating the Warburg effect. The findings summarized in this review should provide a better understanding of the relevance of genetic mutations and the ncRNA-based epigenetic alterations to CRC pathogenesis to help overcome chemoresistance.

Also flagged:cancerPD-1PD-L1CTLA4antibodysuppressor of cytokine
Journal Article 2021-08-30 No Snippets Kumar S, Sarthi P, Mani I, Ashraf MU, Kang MH, Kumar V, Bae YS.
Show Full Abstract

Cellular immunotherapy has recently emerged as a fourth pillar in cancer treatment co-joining surgery, chemotherapy and radiotherapy. Where, the discovery of immune checkpoint blockage or inhibition (ICB/ICI), anti-PD-1/PD-L1 and anti-CTLA4-based, therapy has revolutionized the class of cancer treatment at a different level. However, some cancer patients escape this immune surveillance mechanism and become resistant to ICB-therapy. Therefore, a more advanced or an alternative treatment is required urgently. Despite the functional importance of epitranscriptomics in diverse clinico-biological practices, its role in improving the efficacy of ICB therapeutics has been limited. Consequently, our study encapsulates the evidence, as a possible strategy, to improve the efficacy of ICB-therapy by co-targeting molecular checkpoints especially N<sup>6</sup>A-modification machineries which can be reformed into RNA modifying drugs (RMD). Here, we have explained the mechanism of individual RNA-modifiers (editor/writer, eraser/remover, and effector/reader) in overcoming the issues associated with high-dose antibody toxicities and drug-resistance. Moreover, we have shed light on the importance of suppressor of cytokine signaling (SOCS/CISH) and microRNAs in improving the efficacy of ICB-therapy, with brief insight on the current monoclonal antibodies undergoing clinical trials or already approved against several solid tumor and metastatic cancers. We anticipate our investigation will encourage researchers and clinicians to further strengthen the efficacy of ICB-therapeutics by considering the importance of epitranscriptomics as a personalized medicine.

Also flagged:infectionscancerFungal infectionssystemic infectionscryptococcosisaspergillosis
Journal Article 2021-08-30 No Snippets Butassi E, Svetaz L, Carpinella MC, Efferth T, Zacchino S.
Show Full Abstract

The development of new antifungal agents that target biofilms is an urgent need. Natural products, mainly from the plant kingdom, represent an invaluable source of these entities. The present review provides an update (2017-May 2021) on the available information on essential oils, propolis, extracts from plants, algae, lichens and microorganisms, compounds from different natural sources and nanosystems containing natural products with the capacity to in vitro or in vivo modulate fungal biofilms. The search yielded 42 articles; seven involved essential oils, two Brazilian propolis, six plant extracts and one of each, extracts from lichens and algae/cyanobacteria. Twenty articles deal with the antibiofilm effect of pure natural compounds, with 10 of them including studies of the mechanism of action and five dealing with natural compounds included in nanosystems. Thirty-seven manuscripts evaluated <i>Candida</i> spp. biofilms and two tested <i>Fusarium</i> and <i>Cryptococcus</i> spp. Only one manuscript involved <i>Aspergillus fumigatus</i>. From the data presented here, it is clear that the search of natural products with activity against fungal biofilms has been a highly active area of research in recent years. However, it also reveals the necessity of deepening the studies by (i) evaluating the effect of natural products on biofilms formed by the newly emerged and worrisome health-care associated fungi, <i>C. auris</i>, as well as on other non-<i>albicans Candida</i> spp., <i>Cryptococcus</i> sp. and filamentous fungi; (ii) elucidating the mechanisms of action of the most active natural products; (iii) increasing the in vivo testing.

Also flagged:organizationBSAIRFBF
Journal Article 2021-08-30 No Snippets Yan X, Xu Y, Jia M.
Show Full Abstract

The fuzzy-entropy-based complexity metric approach has achieved fruitful results in bearing fault diagnosis. However, traditional hierarchical fuzzy entropy (HFE) and multiscale fuzzy entropy (MFE) only excavate bearing fault information on different levels or scales, but do not consider bearing fault information on both multiple layers and multiple scales at the same time, thus easily resulting in incomplete fault information extraction and low-rise identification accuracy. Besides, the key parameters of most existing entropy-based complexity metric methods are selected based on specialist experience, which indicates that they lack self-adaptation. To address these problems, this paper proposes a new intelligent bearing fault diagnosis method based on self-adaptive hierarchical multiscale fuzzy entropy. On the one hand, by integrating the merits of HFE and MFE, a novel complexity metric method, named hierarchical multiscale fuzzy entropy (HMFE), is presented to extract a multidimensional feature matrix of the original bearing vibration signal, where the important parameters of HMFE are automatically determined by using the bird swarm algorithm (BSA). On the other hand, a nonlinear feature matrix classifier with strong robustness, known as support matrix machine (SMM), is introduced for learning the discriminant fault information directly from the extracted multidimensional feature matrix and automatically identifying different bearing health conditions. Two experimental results on bearing fault diagnosis show that the proposed method can obtain average identification accuracies of 99.92% and 99.83%, respectively, which are higher those of several representative entropies reported by this paper. Moreover, in the two experiments, the standard deviations of identification accuracy of the proposed method were, respectively, 0.1687 and 0.2705, which are also greater than those of the comparison methods mentioned in this paper. The effectiveness and superiority of the proposed method are verified by the experimental results.

Also flagged:GCCblastdiamondebiHexaRRBP1
Journal Article 2021-08-30 ✓ 1 Snippet Yang X, Liu G, Wang Q, Gao X, Xia T, Zhao C, Dou H, Zhang H.
In-Text Gene Mentions

…, FGB ,SERPINC1, SERPINE1, and…

Show Full Abstract

The silver fox and blue fox are economically important fur species and were domesticated by humans from their wild counterparts, the arctic fox and red fox, respectively. Farmed foxes show obvious differences from their wild counterparts, including differences in physiology, body size, energy metabolism, and immunity. However, the molecular mechanisms underlying these differences are presently unclear. In this study, we built transcriptome libraries from multiple pooled tissues for each species of farmed fox, used RNA-seq to obtain a comprehensive dataset, and performed selection analysis and sequence-level analyses of orthologous genes to identify the genes that may be influenced by human domestication. More than 153.3, 248.0, 81.6, and 65.8 million clean reads were obtained and assembled into a total of 118,577, 401,520, 79,900, and 186,988 unigenes with an average length range from 521 to 667 bp for AF, BF, RF, and SF, respectively. Selective pressure analysis showed that 11 and 14 positively selected genes were identified, respectively, in the two groups (AF vs. BF and RF vs. SF). Several of these genes were associated with natural immunity (<i>CFI</i> and <i>LRRFIP1</i>), protein synthesis (<i>GOLGA4</i>, <i>CEP19</i> and <i>SLC35A2</i>), and DNA damage repair (<i>MDC1</i>). Further functional enrichment analyses demonstrated that two positively selected genes (<i>ACO1</i> and <i>ACAD10</i>) were involved in metabolic process (GO:0008152, <i>p</i>-value = .032), representing a significant enrichment. Sequence analysis of 117 orthologous genes shared by the two groups showed that the <i>LEMD2</i>, <i>RRBP1,</i> and <i>IGBP1</i> genes might be affected by artificial selection in farmed foxes, with mutation sites located within sequences that are otherwise highly conserved across most mammals. Our results provide a valuable transcriptomic resource for future genetic studies and improvement in the assisted breeding of foxes and other farmed animals.

Also flagged:diphenylalanineethylenediaminesuccinic acidterephthalaldehydedipeptidedipeptides
Journal Article 2021-08-30 No Snippets Arul A, Rana P, Das K, Pan I, Mandal D, Stewart A, Maity B, Ghosh S, Das P.
Show Full Abstract

Self-assembly of molecular building blocks is a simple and useful approach to generate supramolecular structures with varied morphologies and functions. By studying the chemical properties of the building blocks and tuning the parameters of their self-assembly process, the resultant supramolecular assemblies can be optimized for the required downstream applications. To this end, in the present study we have designed and synthesized three different molecular building blocks composed of two diphenylalanine (FF) units connected to each other through three different linkers: ethylenediamine, succinic acid, or terephthalaldehyde. Under identical conditions, all the three building blocks self-assemble into supramolecular architectures with distinct morphologies. However, by varying the polarity of the self-assembly medium, the nature of the non-covalent interactions changes in such a way as to generate additional self-assembled structures unique to each building block. Utilizing microscopic and spectroscopic techniques, we characterized the morphological variety generated by each building block/linker combination. These data represent the first report analysing the diversity of nanostructures that can be generated from identical dipeptide-based molecular backbones simply by varying the chemical linker. We also demonstrate that the spherical assemblies and nanorod structures fabricated from these dipeptide/linker pairs can act as drug delivery systems. More specifically, the spherical assembly generated by two FF dipeptides linked <i>via</i> ethylenediamine and nanorods fabricated from terephthalaldehyde linked FF dipeptides were able to encapsulate the cancer chemotherapeutic agent doxorubicin (DOX) and chaperone the drug into cells. Thus, these supramolecular assemblies represent a new platform for the development of efficient and effective intracellular drug delivery systems.

Research Square 2021-08-30 Preprint (No Snippets API) Li J, Shi H, Liu X, Wang Y, Wang H, Pan B.
Show Full Abstract

I. <h4>Background:</h4> Peroxiredoxin 6 (Prdx6) is widely expressed in mammalian tissues. Our previous study demonstrated that Prdx6 was expressed in human epididymis and spermatozoa, and the protective role of Prdx6 in human spermatozoa was also reported. In this study, we demonstrate the potential role and mechanism of Prdx6 in human epididymis epithelial cells (HEECs). II. <h4>Methods and Results:</h4> Western blotting was used to measure expression levels of key proteins in the JAK / STAT signaling pathway. Digital gene expression analysis (DGE) was used to identify gene expression patterns in control HECs and in HECs after Prdx6-RNA interference (P6-RNAi). The DGE analysis identified 589 up-regulated and 314 down-regulated genes (including Prdx6) in Prdx6-RNAi (P6-RNAi) HEECs. Thirteen significantly different pathways were identified between the two groups, with the majority different expressed genes belonging to the CCL, CXCL, IL , and IFIT families. In particular, the expression levels of IL6, IL6ST, and eighteen IFN related genes were significantly increased in the condition of the down-regulated expression of Prdx6 . Compared to control HEECs, the expression levels of JAK1, STAT1, phosphorylated JAK1 and STAT1 were significantly increased, while the expression levels of SOCS3 was significantly decreased in P6-RNAi HEECs. The Malondialdehyde (MDA) level and total antioxidant capacity in P6-RNAi HEECs were significantly increased and decreased compared to that of control, respectively. III. <h4>Conclusions:</h4> We speculated that knockdown of Prdx6 resulted in higher levels of ROS in HEECs, which in turn, activated the JAK1 / STAT1 signaling pathway induced by IL-6 receptor and IFN .

Research Square 2021-08-30 Preprint (No Snippets API) Yanqun C, Susu W, Yifan J, Xiao P, Caiqin L.
Show Full Abstract

<title>Abstract</title> <p><bold>Background</bold> Gastric cancer is one of the most common malignant tumors, and it ranks third in global cancer-related mortality. At present, there is still no optimal treatment for gastric cancer, which makes it important to identify new therapeutic targets. This research aims to identify new targeted treatments for gastric adenocarcinoma by constructing a ferroptosis-related lncRNA prognostic feature model.<bold>Methods</bold>The gene expression profile and clinical data of gastric adenocarcinoma patients were downloaded from TCGA database. FerrDb database was used to determine the expression of iron death related genes. We used R software to clean the TCAG gastric adenocarcinoma gene expression cohort and screen iron death related differential genes and lncrna, and then carried out go and KEGG functional enrichment analysis of the related differential genes. The potential prognostic markers and immune infiltration characteristics were determined by constructing prognostic model and multivariate validation of lncRNA related to ferroptosis prognosis. Finally, the characteristics of immune infiltration were determined by immune correlation analysis.<bold>Results</bold>We identified 26 ferroptosis-related lncRNA with independent prognostic value. Kaplan-Meier analysis identified high-risk lncRNA associated with poor prognosis of STAD. The risk scoring model constructed by AC115619.1, AC005165.1, LINC01614, AC002451.1 was better than traditional clinicopathological features. The 1, 3, and 5-year survival rates of STAD patients were predicted by the nomogram. GSEA reveals the oxidative respiration and tumor-related pathways in different risk groups. Immune analysis found significant differences in the expression of immune checkpoint-related genes TNFSF9, TNFSF4 and PDCD1LG2 between the two groups of patients. Meanwhile, there were significant differences in APC co stimulation, CCR and checkpoint between the two groups.<bold>Conclusion</bold>Based on the prognostic characteristics of ferroptosis-related lncRNA, we identified the potential ferroptosis-related lncRNA and immune infiltration characteristics in gastric adenocarcinoma, which will help provide new targeted treatments for gastric adenocarcinoma.</p>

Also flagged:depressionthiopurinesvisionwarfarinsimvastatinSLCO1B1
Journal Article 2021-08-29 No Snippets Wake DT, Smith DM, Kazi S, Dunnenberger HM.
Show Full Abstract

Clinical decision support (CDS) is an essential part of any pharmacogenomics (PGx) implementation. Increasingly, institutions have implemented CDS tools in the clinical setting to bring PGx data into patient care, and several have published their experiences with these implementations. However, barriers remain that limit the ability of some programs to create CDS tools to fit their PGx needs. Therefore, the purpose of this review is to summarize the types, functions, and limitations of PGx CDS currently in practice. Then, we provide an approachable step-by-step how-to guide with a case example to help implementers bring PGx to the front lines of care regardless of their setting. Particular focus is paid to the five "rights" of CDS as a core around designing PGx CDS tools. Finally, we conclude with a discussion of opportunities and areas of growth for PGx CDS.

Also flagged:polyacrylamideTelcholysine biosynthesisBL21ThrA
Journal Article 2021-08-29 ✓ 1 Snippet Isogai S, Takagi H.
In-Text Gene Mentions

…the third AK,AK-III, is the lysC…

Show Full Abstract

Lysine, a nutritionally important amino acid, is involved in adaptation and tolerance to environmental stresses in various organisms. Previous studies reported that lysine accumulation occurs in response to stress and that lysine supplementation enhances stress tolerance; however, the effect of lysine biosynthesis enhancement on stress tolerance has yet to be elucidated. In this study, we confirmed that lysine supplementation to the culture medium increased intracellular lysine content and improved cell growth of Escherichia coli at high temperature (42.5 °C). Lysine-overproducing strains were then isolated from the lysine analogue S-adenosylmethionine-resistant mutants by conventional mutagenesis and exhibited higher tolerance to high-temperature stress than the wild-type strain. We identified novel amino acid substitutions Gly474Asp and Cys554Tyr on ThrA, a bifunctional aspartate kinase/homoserine dehydrogenase (AK/HSDH), in the lysine-overproducing mutants. Interestingly, the Gly474Asp and Cys554Tyr variants of ThrA induced lysine accumulation and conferred high-temperature stress tolerance to E. coli cells. Enzymatic analysis revealed that the Gly474Asp substitution in ThrA reduced HSDH activity, suggesting that the intracellular level of aspartate semialdehyde, which is a substrate for HSDH and an intermediate for lysine biosynthesis, is elevated by the loss of HSDH activity and converted to lysine in E. coli. The present study demonstrated that both lysine supplementation and lysine biosynthesis enhancement improved the high-temperature stress tolerance of E. coli cells. Our findings suggest that lysine-overproducing strains have the potential as stress-tolerant microorganisms and can be applied to robust host cells for microbial production of useful compounds. KEY POINTS: • Lysine supplementation improved the growth of E. coli cells at high temperature. • The G474D and C554Y variant ThrA increased lysine productivity in E. coli cells. • The G474D substitution in ThrA reduced homoserine dehydrogenase activity. • E. coli cells that overproduce lysine exhibited high-temperature stress tolerance.

Also flagged:angiogenesisextracellularcollagendextranvinyl sulfoneoxygen
Journal Article 2021-08-29 No Snippets Wang WY, Kent RN, Huang SA, Jarman EH, Shikanov EH, Davidson CD, Hiraki HL, Lin D, Wall MA, Matera DL, Shin JW, Polacheck WJ, Shikanov A, Baker BM.
Show Full Abstract

Vascularization of large, diffusion-hindered biomaterial implants requires an understanding of how extracellular matrix (ECM) properties regulate angiogenesis. Sundry biomaterials assessed across many disparate angiogenesis assays have highlighted ECM determinants that influence this complex multicellular process. However, the abundance of material platforms, each with unique parameters to model endothelial cell (EC) sprouting presents additional challenges of interpretation and comparison between studies. In this work we directly compared the angiogenic potential of commonly utilized natural (collagen and fibrin) and synthetic dextran vinyl sulfone (DexVS) hydrogels in a multiplexed angiogenesis-on-a-chip platform. Modulating matrix density of collagen and fibrin hydrogels confirmed prior findings that increases in matrix density correspond to increased EC invasion as connected, multicellular sprouts, but with decreased invasion speeds. Angiogenesis in synthetic DexVS hydrogels, however, resulted in fewer multicellular sprouts. Characterizing hydrogel Young's modulus and permeability (a measure of matrix porosity), we identified matrix permeability to significantly correlate with EC invasion depth and sprout diameter. Although microporous collagen and fibrin hydrogels produced lumenized sprouts in vitro, they rapidly resorbed post-implantation into the murine epididymal fat pad. In contrast, DexVS hydrogels proved comparatively stable. To enhance angiogenesis within DexVS hydrogels, we incorporated sacrificial microgels to generate cell-scale pores throughout the hydrogel. Microporous DexVS hydrogels resulted in lumenized sprouts in vitro and enhanced cell invasion in vivo. Towards the design of vascularized biomaterials for long-term regenerative therapies, this work suggests that synthetic biomaterials offer improved size and shape control following implantation and that tuning matrix porosity may better support host angiogenesis. STATEMENT OF SIGNIFICANCE: Understanding how extracellular matrix properties govern angiogenesis will inform biomaterial design for engineering vascularized implantable grafts. Here, we utilized a multiplexed angiogenesis-on-a-chip platform to compare the angiogenic potential of natural (collagen and fibrin) and synthetic dextran vinyl sulfone (DexVS) hydrogels. Characterization of matrix properties and sprout morphometrics across these materials points to matrix porosity as a critical regulator of sprout invasion speed and diameter, supported by the observation that nanoporous DexVS hydrogels yielded endothelial cell sprouts that were not perfusable. To enhance angiogenesis into synthetic hydrogels, we incorporated sacrificial microgels to generate microporosity. We find that microporosity increased sprout diameter in vitro and cell invasion in vivo. This work establishes a composite materials approach to enhance the vascularization of synthetic hydrogels.

Also flagged:MNaseDigestionLinker histonesnucleosomeschromatinnucleosome
Journal Article 2021-08-29 ✓ 5 Snippets Shen CH, Allan J.
In-Text Gene Mentions

…H1linker histoneshistones are developmentally…

…Finally, how dolinker histoneshistones direct the…

…erythrocyte core histones,linker histoneshistones H1/H5 and…

…globular domain oflinker histoneshistones to nucleosomes…

…to further understandlinker histoneshistones’ dynamic interaction…

Show Full Abstract

The compact nucleosomal structure limits DNA accessibility and regulates DNA-dependent cellular activities. Linker histones bind to nucleosomes and compact nucleosomal arrays into a higher-order chromatin structure. Recent developments in high throughput technologies and structural computational studies provide nucleosome positioning at a high resolution and contribute to the information of linker histone location within a chromatosome. However, the precise linker histone location within the chromatin fibre remains unclear. Using monomer extension, we mapped core particle and chromatosomal positions over a core histone-reconstituted, 1.5 kb stretch of DNA from the chicken adult β-globin gene, after titration with linker histones and linker histone globular domains. Our results show that, although linker histone globular domains and linker histones display a wide variation in their binding affinity for different positioned nucleosomes, they do not alter nucleosome positions or generate new nucleosome positions. Furthermore, the extra ~20 bp of DNA protected in a chromatosome is usually symmetrically distributed at each end of the core particle, suggesting linker histones or linker histone globular domains are located close to the nucleosomal dyad axis.

Also flagged:Methylationcitrullinated proteinantibodiesrheumatoid arthritisRAmethylated cytosines
Journal Article 2021-08-29 No Snippets Zeng Y, Zhao K, Oros Klein K, Shao X, Fritzler MJ, Hudson M, Colmegna I, Pastinen T, Bernatsky S, Greenwood CMT.
Show Full Abstract

High levels of anti-citrullinated protein antibodies (ACPA) are often observed prior to a diagnosis of rheumatoid arthritis (RA). We undertook a replication study to confirm CpG sites showing evidence of differential methylation in subjects positive vs. negative for ACPA, in a new subset of 112 individuals sampled from the population cohort and biobank CARTaGENE in Quebec, Canada. Targeted custom capture bisulfite sequencing was conducted at approximately 5.3 million CpGs located in regulatory or hypomethylated regions from whole blood; library and protocol improvements had been instituted between the original and this replication study, enabling better coverage and additional identification of differentially methylated regions (DMRs). Using binomial regression models, we identified 19,472 ACPA-associated differentially methylated cytosines (DMCs), of which 430 overlapped with the 1909 DMCs reported by the original study; 814 DMRs of relevance were clustered by grouping adjacent DMCs into regions. Furthermore, we performed an additional integrative analysis by looking at the DMRs that overlap with RA related loci published in the GWAS Catalog, and protein-coding genes associated with these DMRs were enriched in the biological process of cell adhesion and involved in immune-related pathways.

medRxiv 2021-08-29 Preprint (No Snippets API) Lancaster HS, Dinu V, Arora A, Li J, Gruen JR.
Show Full Abstract

<h4>Purpose</h4> Reading ability is a complex skill utilizing multiple proficiencies and that develops through interactions between genetic and environmental factors. This study presents an alternative analytic pipeline to identify key genetic and demographic contributors to reading ability. <h4>Methods</h4> We analyzed data from the Avon Longitudinal Study of Parents and Children (ALSPAC; N = 3 232) using a multi-step analytical pipeline. To reduce measurement error, we generated a latent reading ability score. We selected single nucleotide polymorphisms (SNPs) based on existing literature and genome-wide association studies (GWAS). We applied elastic net regression to identify informative predictors in two models, a SNP-only model and a SNP-plus demographic, environmental, and behavioral variables model. We compared the SNP-based heritability estimates and R 2 from the fitted models. We also performed pathway enrichment analysis on the informative SNPs. <h4>Results</h4> The traditional GWAS identified one genome-wide significant SNP on chromosome X and produced a moderate heritability estimate of .23 (SE = 0.07). We included 148 SNPs in the elastic net models. The SNP-only model identified 61 informative SNPs (R 2 = .12), whereas the SNP-plus model identified 96 informative SNPs (R 2 = .32). The SNP-plus model also showed that several behavioral characteristics positively predicted latent reading ability. Enrichment analysis revealed overrepresentation of several biological pathways among the informative SNPs. <h4>Conclusions</h4> This study shows that our analytic pipeline can identify important genetic and demographic predictors of reading ability, providing a powerful alternative to traditional methods and contributing to a deeper understanding of the factors that drive reading development.

bioRxiv 2021-08-29 Preprint (No Snippets API) Tran DH, Tran HT, Pham TNM, Phung HTT.
Show Full Abstract

Foodborne illness undermines human health by causing fever, stomachache and even lethality. Among foodborne bacterial pathogens, Staphylococcus aureus and Pseudomonas aeruginosa are of extraordinary significance which drive reasons of food and beverage poisoning in numerous cases. Today, PCR has been widely used to examine the presence of different foodborne pathogens. However, PCR requires specialized equipment and skillful personnel which limit its application in the field. Recently, there is an emerging of isothermal PCR methods in which the reactions occur at low and constant temperature, allowing their application in restricted-resource settings. In this work, multiplex Recombinase Polymerase Amplification (RPA) was used to simultaneously detect S. aureus and P. aeruginosa with high sensitivity and specificity. The limit detection of multiplex RPA was 10 and 30 fg/reaction of genomic DNAs of S. aureus and P. aeruginosa , respectively. Besides, the reaction time was reduced to only 25 minutes with a low incubation temperature of 39 °C. Markedly, multiplex RPA reactions succeeded to directly detect as low as 1 and 5 CFU/reaction of S. aureus and P. aeruginosa cells, respectively without the requirement of extracting DNA genome. Moreover, the multiplex RPA reliably detected the two foodborne bacteria in milk, fruit juice and bottled water samples. In general, the direct multiplex RPA described in this study is a rapid, simple, sensitive and efficient alternative tool that could be used to detect the presence of S. aureus and P. aeruginosa without the necessity of costly devices and high-trained staff.

Also flagged:GFAPPSD95ApolipoproteinAPOEsynaptophysinendosome
Journal Article 2021-08-28 ✓ 1 Snippet Zhao J, Lu W, Ren Y, Fu Y, Martens YA, Shue F, Davis MD, Wang X, Chen K, Li F, Liu CC, Graff-Radford NR, Wszolek ZK, Younkin SG, Brafman DA, Ertekin-Taner N, Asmann YW, Dickson DW, Xu Z, Pan M, Han X, Kanekiyo T, Bu G.
In-Text Gene Mentions

…, MAGEL2 ,VSIG10, and MRPL17…

Show Full Abstract

APOE4 is a strong genetic risk factor for Alzheimer's disease and Dementia with Lewy bodies; however, how its expression impacts pathogenic pathways in a human-relevant system is not clear. Here using human iPSC-derived cerebral organoid models, we find that APOE deletion increases α-synuclein (αSyn) accumulation accompanied with synaptic loss, reduction of GBA levels, lipid droplet accumulation and dysregulation of intracellular organelles. These phenotypes are partially rescued by exogenous apoE2 and apoE3, but not apoE4. Lipidomics analysis detects the increased fatty acid utilization and cholesterol ester accumulation in apoE-deficient cerebral organoids. Furthermore, APOE4 cerebral organoids have increased αSyn accumulation compared to those with APOE3. Carrying APOE4 also increases apoE association with Lewy bodies in postmortem brains from patients with Lewy body disease. Our findings reveal the predominant role of apoE in lipid metabolism and αSyn pathology in iPSC-derived cerebral organoids, providing mechanistic insights into how APOE4 drives the risk for synucleinopathies.

Also flagged:hydroxyapatitemineralcalcium phosphatessodiummagnesiumpotassium
Journal Article 2021-08-28 No Snippets Prado JPDS, Yamamura H, Magri AMP, Ruiz PLM, Prado JLDS, Rennó ACM, Ribeiro DA, Granito RN.
Show Full Abstract

The aim of this study was to evaluate biocompatibility of hydroxyapatite (HAP) from fish waste using in vitro and in vivo assays. Fish samples (whitemouth croaker - Micropogonias furnieri) from the biowaste was used as HAP source. Pre-osteoblastic MC3T3-E1 cells were used in vitro study. In addition, bone defects were artificially created in rat calvaria and filled with HAP in vivo. The results demonstrated that HAP reduced cytotoxicity in pre-osteoblast cells after 3 and 6 days following HAP exposure. DNA concentration was lower in the HAP group after 6 days. Quantitative RT-PCR did not show any significant differences (p > 0.05) between groups. In vivo study revealed that bone defects filled with HAP pointed out moderate chronic inflammatory cells with slight proliferation of blood vessels after 7 and 15 days. Chronic inflammatory infiltrate was absent after 30 days of HAP exposure. There was also a decrease in the amount of biomaterial, being followed by newly formed bone tissue. All experimental groups also demonstrated strong RUNX-2 immoexpression in the granulation tissue as well as in cells in close contact with biomaterial. The number of osteoblasts inside the defect area was lower in the HAP group when compared to control group after 7 days post-implantation. Similarly, the osteoblast surface as well as the percentage of bone surface was higher in control group when compared with HAP group after 7 days post-implantation. Taken together, HAP from fish waste is a promising possibility that should be explored more carefully by tissue-engineering or biotechnology.

Also flagged:respRTIinclCancerprowarts
Journal Article 2021-08-28 No Snippets Diks ME, Hiligsmann M, van der Putten IM.
Show Full Abstract

<h4>Background</h4>Choice-based experiments have been increasingly used to elicit preferences for vaccines and vaccination programs. This study aims to systematically identify and examine choice-based experiments assessing (differences in) vaccine preferences of vaccinees, representatives and health advisors.<h4>Methods</h4>Five electronic databases were searched on choice-based conjoint analysis studies or discrete choice experiments capturing vaccine preferences of children, adolescents, parents, adults and healthcare professionals for attributes of vaccines or vaccine settings up to September 2020. Data was extracted using a standardized form covering all important aspects of choice experiments. A quality assessment was used to assess the validity of studies. Attributes were categorized into outcome, process, cost and other. The importance of attributes was assessed by the frequency of reporting and statistical significance. Results were compared between high-quality studies and lower-quality studies.<h4>Results</h4>A total of 42 studies were included, with the majority conducted in high-income countries after 2010 (resp. n = 34 and n = 37). Preferences of representatives were studied in nearly half of the studies (47.6%), followed by vaccinees (35.7%) and health advisors (9.5%). Sixteen high-quality studies passed the quality assessment. Outcome- and cost- related attributes such as vaccine effectiveness, vaccine risk, cost and protection duration were most often statistically significant across both target groups, with vaccine effectiveness being the most important. Risks associated with vaccination, such as side effects, were more often statistically significant in studies targeting vaccinees, while cost-related attributes were more often statistically significant in studies of representatives. Process-related attributes such as vaccine accessibility and time were least important across both target groups.<h4>Conclusion</h4>To our knowledge, this is the first systematic review in which vaccine preferences of different target groups were assessed and compared. The same attributes were most important for vaccine decisions of vaccinees and representatives, with only minor differences in level of evidence for vaccine risk and cost. Future research on vaccine preferences of health advisors and/or among target groups in low-resource settings would give insight into the generalizability of current findings.

Also flagged:nuclear factor-κBrheumatoid arthritisNF-κBRANFKBIETNIP1
Journal Article 2021-08-28 ✓ 2 Snippets Zeng Z, Sun QQ, Zhang W, Wen QW, Wang TH, Qin W, Xiao DM, Zhang Z, Huang H, Mo YJ, Wu XD, Cen H.
In-Text Gene Mentions

…UBE2L3 rs5754217 andTNFSF4rs2205960 (RERI =…

…BLK rs13277113 andTNFSF4rs2205960 (p =…

Show Full Abstract

<h4>Objective</h4>This study was performed to replicate the associations of genetic polymorphisms within nuclear factor-κB (NF-κB) signaling pathway genes with rheumatoid arthritis (RA), and to further examine genetic interactions in a Chinese population.<h4>Methods</h4>A total of eleven single-nucleotide polymorphisms (SNPs) were genotyped in 594 RA patients and 604 healthy controls.<h4>Results</h4>Genetic association analysis revealed that NFKBIE rs2233434, TNIP1 rs10036748 and BLK rs13277113 were significantly associated with RA, cyclic citrullinated peptide (CCP)-positive RA and rheumatoid factor (RF)-positive RA, and TNFAIP3 rs2230926 was significantly associated with CCP-positive RA. Significant additive interaction was observed between NFKB1 rs28362491 and IKBKE rs12142086 (RERI = 0.76, 95% CI 0.13-1.38; AP = 0.57, 95% CI 0.11-1.03), NFKBIE rs2233434 and BLK rs13277113 (RERI = 1.41, 95% CI 0.88-1.94; AP = 0.85, 95% CI 0.50-1.20), NFKBIL rs2071592 and TNIP1 rs10036748 (RERI = 0.59, 95% CI 0.17-1.02; AP = 0.46, 95% CI 0.05-0.87), UBE2L3 rs5754217 and TNFSF4 rs2205960 (RERI = 0.50, 95% CI 0.16-0.84; AP = 0.57, 95% CI 0.09-1.05). Significant multiplicative interaction was detected between BLK rs13277113 and UBE2L3 rs5754217 (p = 0.02), BLK rs13277113 and TNFSF4 rs2205960 (p = 0.03).<h4>Conclusions</h4>Our results lent further support to the role of NF-κB signaling pathway in the pathogenesis of RA from a genetic perspective.

Also flagged:obesityKsr2G2e3Asnsd1Srpk2Dpp8
Journal Article 2021-08-28 ✓ 3 Snippets Powell DR, Revelli JP, Doree DD, DaCosta CM, Desai U, Shadoan MK, Rodriguez L, Mullens M, Yang QM, Ding ZM, Kirkpatrick LL, Vogel P, Zambrowicz B, Sands AT, Platt KA, Hansen GM, Brommage R.
In-Text Gene Mentions

For the 7 enzymes in this category, obesity of KO mice from published St3gal2, Glrx2, Hdac6 and Prdx6 KO lines agrees with our data.153–157 Obesity of KO mice from published Gpx7 and Adamts18 KO lines158,159 is consistent with our data and with GWAS data linking obesity to GPX7158 and to ADAMTS18 which is closely associated with a BMI cluster (Table 6), but not with the absence of obesity in independent Gpx7 and Adamts18 KO lines studied in the IMPC HTS.

…Ncoa1, Nr4a1, Pecr,Prdx6, Prmt7, Ptp4a1, Rgs10,…

…Glrx2, Hdac6 andPrdx6KO lines agrees…

Show Full Abstract

<h4>Purpose</h4>Obesity is a major public health problem. Understanding which genes contribute to obesity may better predict individual risk and allow development of new therapies. Because obesity of a mouse gene knockout (KO) line predicts an association of the orthologous human gene with obesity, we reviewed data from the Lexicon Genome5000<sup>TM</sup> high throughput phenotypic screen (HTS) of mouse gene KOs to identify KO lines with high body fat.<h4>Materials and methods</h4>KO lines were generated using homologous recombination or gene trapping technologies. HTS body composition analyses were performed on adult wild-type and homozygous KO littermate mice from 3758 druggable mouse genes having a human ortholog. Body composition was measured by either DXA or QMR on chow-fed cohorts from all 3758 KO lines and was measured by QMR on independent high fat diet-fed cohorts from 2488 of these KO lines. Where possible, comparisons were made to HTS data from the International Mouse Phenotyping Consortium (IMPC).<h4>Results</h4>Body fat data are presented for 75 KO lines. Of 46 KO lines where independent external published and/or IMPC KO lines are reported as obese, 43 had increased body fat. For the remaining 29 novel high body fat KO lines, <i>Ksr2</i> and <i>G2e3</i> are supported by data from additional independent KO cohorts, 6 (<i>Asnsd1, Srpk2, Dpp8, Cxxc4, Tenm3</i> and <i>Kiss1</i>) are supported by data from additional internal cohorts, and the remaining 21 including <i>Tle4, Ak5, Ntm, Tusc3, Ankk1, Mfap3l, Prok2</i> and <i>Prokr2</i> were studied with HTS cohorts only.<h4>Conclusion</h4>These data support the finding of high body fat in 43 independent external published and/or IMPC KO lines. A novel obese phenotype was identified in 29 additional KO lines, with 27 still lacking the external confirmation now provided for <i>Ksr2</i> and <i>G2e3</i> KO mice. Undoubtedly, many mammalian obesity genes remain to be identified and characterized.

Also flagged:MetathesisCarbenesynthesisN-heterocyclic carbene-)benzoic acids
Journal Article 2021-08-28 No Snippets Czarnocki S, Monsigny L, Sienkiewicz M, Kajetanowicz A, Grela K.
Show Full Abstract

A modular and flexible strategy towards the synthesis of N-heterocyclic carbene (NHC) ligands bearing Brønsted base tags has been proposed and then adopted in the preparation of two tagged NHC ligands bearing rests of isonicotinic and 4-(dimethylamino)benzoic acids. Such tagged NHC ligands represent an attractive starting point for the synthesis of olefin metathesis ruthenium catalysts tagged in non-dissociating ligands. The influence of the Brønsted basic tags on the activity of such obtained olefin metathesis catalysts has been studied.

Also flagged:osteoporosiscancerbone disorderslocomotioncalciumbone formation
Journal Article 2021-08-28 No Snippets Pedrero SG, Llamas-Sillero P, Serrano-López J.
Show Full Abstract

Millions of patients suffer yearly from bone fractures and disorders such as osteoporosis or cancer, which constitute the most common causes of severe long-term pain and physical disabilities. The intrinsic capacity of bone to repair the damaged bone allows normal healing of most small bone injuries. However, larger bone defects or more complex diseases require additional stimulation to fully heal. In this context, the traditional routes to address bone disorders present several associated drawbacks concerning their efficacy and cost-effectiveness. Thus, alternative therapies become necessary to overcome these limitations. In recent decades, bone tissue engineering has emerged as a promising interdisciplinary strategy to mimic environments specifically designed to facilitate bone tissue regeneration. Approaches developed to date aim at three essential factors: osteoconductive scaffolds, osteoinduction through growth factors, and cells with osteogenic capability. This review addresses the biological basis of bone and its remodeling process, providing an overview of the bone tissue engineering strategies developed to date and describing the mechanisms that underlie cell-biomaterial interactions.

Also flagged:HydroxyapatiteSynthesispolyvinyl alcoholhyaluronic acidcalciumHydrogels
Journal Article 2021-08-28 No Snippets Chocholata P, Kulda V, Dvorakova J, Supova M, Zaloudkova M, Babuska V.
Show Full Abstract

Bone tissue engineering tries to simulate natural behavior of hard tissues. This study aimed to produce scaffolds based on polyvinyl alcohol (PVA) and hyaluronic acid (HA) with hydroxyapatite (HAp) incorporated in two different ways, by in situ synthesis and physical mixing of pre-prepared HAp. In situ synthesis resulted in calcium deficient form of HAp with lower crystallinity. The proliferation of human osteoblast-like cells MG-63 proved to be better in the scaffolds with in situ synthesized HAp compared to those with physically mixed pre-prepared HAp. For scaffolds with PVA/HA/HAp ratio 3:1:2, there was significantly higher initial adhesion (<i>p</i> = 0.0440), as well as the proliferation in the following days (<i>p</i> < 0.001). It seemed to be advantageous improve the properties of the scaffold by in situ synthesizing of HAp directly in the organic matrix.

Also flagged:ApoptosistumorcancerBcl-2Inhibitors of ApoptosisIAP
Journal Article 2021-08-28 ✓ 2 Snippets Neophytou CM, Trougakos IP, Erin N, Papageorgis P.
In-Text Gene Mentions

Netrin-1 is a multifunctional secreted glycoprotein upregulated in various cancers, such as gastric and lung, and may inhibit apoptosis induced by the dependence receptors DCC and UNC5H [211,212].

…the dependence receptorsDCCand UNC5H […

Show Full Abstract

The ability of tumor cells to evade apoptosis is established as one of the hallmarks of cancer. The deregulation of apoptotic pathways conveys a survival advantage enabling cancer cells to develop multi-drug resistance (MDR), a complex tumor phenotype referring to concurrent resistance toward agents with different function and/or structure. Proteins implicated in the intrinsic pathway of apoptosis, including the Bcl-2 superfamily and Inhibitors of Apoptosis (IAP) family members, as well as their regulator, tumor suppressor p53, have been implicated in the development of MDR in many cancer types. The PI<sub>3</sub>K/AKT pathway is pivotal in promoting survival and proliferation and is often overactive in MDR tumors. In addition, the tumor microenvironment, particularly factors secreted by cancer-associated fibroblasts, can inhibit apoptosis in cancer cells and reduce the effectiveness of different anti-cancer drugs. In this review, we describe the main alterations that occur in apoptosis-and related pathways to promote MDR. We also summarize the main therapeutic approaches against resistant tumors, including agents targeting Bcl-2 family members, small molecule inhibitors against IAPs or AKT and agents of natural origin that may be used as monotherapy or in combination with conventional therapeutics. Finally, we highlight the potential of therapeutic exploitation of epigenetic modifications to reverse the MDR phenotype.

Also flagged:cysteinesecPhosphoinositidemembraneamino acidFluor
Journal Article 2021-08-28 ✓ 1 Snippet Mahata T, Sengar AS, Basak M, Das K, Pramanick A, Verma SK, Singh PK, Biswas S, Sarkar S, Saha S, Chatterjee S, Das M, Stewart A, Maity B.
In-Text Gene Mentions

…Wilson disease orhemochromatosis, (v) excessive alcohol…

Show Full Abstract

The pathophysiological mechanism(s) driving non-alcoholic fatty liver disease, the most prevalent chronic liver disease globally, have yet to be fully elucidated. Here, we identify regulator of G protein signaling 6 (RGS6), up-regulated in the livers of NAFLD patients, as a critical mediator of hepatic steatosis, fibrosis, inflammation, and cell death. Human patients with high hepatic RGS6 expression exhibited a corresponding high inflammatory burden, pronounced insulin resistance, and poor liver function. In mice, liver-specific RGS6 knockdown largely ameliorated high fat diet (HFD)-driven oxidative stress, fibrotic remodeling, inflammation, lipid deposition and cell death. RGS6 depletion allowed for maintenance of mitochondrial integrity restoring redox balance, improving fatty acid oxidation, and preventing loss of insulin receptor sensitivity in hepatocytes. RGS6 is both induced by ROS and increases ROS generation acting as a key amplification node to exacerbate oxidative stress. In liver, RGS6 forms a direct complex with ATM kinase supported by key aspartate residues in the RGS domain and is both necessary and sufficient to drive hyperlipidemia-dependent ATM phosphorylation. pATM and markers of DNA damage (γH2AX) were also elevated in livers from NAFLD patients particularly in samples with high RGS6 protein content. Unsurprisingly, RGS6 knockdown prevented ATM phosphorylation in livers from HFD-fed mice. Further, RGS6 mutants lacking the capacity for ATM binding fail to facilitate palmitic acid-dependent hepatocyte apoptosis underscoring the importance of the RGS6-ATM complex in hyperlipidemia-dependent cell death. Inhibition of RGS6, then, may provide a viable means to prevent or reverse liver damage by mitigating oxidative liver damage.

Also flagged:Amino AcidMetabolismGene Expressionmaternal undernutritiongestationamino acids
Journal Article 2021-08-28 ✓ 2 Snippets Muroya S, Zhang Y, Kinoshita A, Otomaru K, Oshima K, Gotoh Y, Oshima I, Sano M, Roh S, Oe M, Ojima K, Gotoh T.
In-Text Gene Mentions

…olfactomedin 4 (OLFM4), nuclear receptor…

…, SDCBP ,OLFM4, NR2E3 ,…

Show Full Abstract

To elucidate the mechanisms underlying maternal undernutrition (MUN)-induced fetal skeletal muscle growth impairment in cattle, the <i>longissimus thoracis</i> muscle of Japanese Black fetal calves at 8.5 months in utero was analyzed by an integrative approach with metabolomics and transcriptomics. The pregnant cows were fed on 60% (low-nutrition, LN) or 120% (high-nutrition, HN) of their overall nutritional requirement during gestation. MUN markedly decreased the bodyweight and muscle weight of the fetus. The levels of amino acids (AAs) and arginine-related metabolites including glutamine, gamma-aminobutyric acid (GABA), and putrescine were higher in the LN group than those in the HN group. Metabolite set enrichment analysis revealed that the highly different metabolites were associated with the metabolic pathways of pyrimidine, glutathione, and AAs such as arginine and glutamate, suggesting that MUN resulted in AA accumulation rather than protein accumulation. The mRNA expression levels of energy metabolism-associated genes, such as <i>PRKAA1</i>, <i>ANGPTL4</i>, <i>APLNR</i>, <i>CPT1B</i>, <i>NOS2</i>, <i>NOS3</i>, <i>UCP2</i>, and glycolytic genes were lower in the LN group than in the HN group. The gene ontology/pathway analysis revealed that the downregulated genes in the LN group were associated with glucose metabolism, angiogenesis, HIF-1 signaling, PI3K-Akt signaling, pentose phosphate, and insulin signaling pathways. Thus, MUN altered the levels of AAs and expression of genes associated with energy expenditure, glucose homeostasis, and angiogenesis in the fetal muscle.

Also flagged:Wilson diseaseWDexcretioncopperceruloplasminATP7B
Journal Article 2021-08-28 ✓ 1 Snippet Sánchez-Monteagudo A, Ripollés E, Berenguer M, Espinós C.
In-Text Gene Mentions

HFE, a gene associated with hemochromatosis, regulates endocytotic iron uptake in enterocytes: HFE competes with transferrin (Tf), a plasma iron transporter, to bind its receptor, TfR.

Show Full Abstract

Wilson disease (WD) is a rare disorder caused by mutations in <i>ATP7B</i>, which leads to the defective biliary excretion of copper. The subsequent gradual accumulation of copper in different organs produces an extremely variable clinical picture, which comprises hepatic, neurological psychiatric, ophthalmological, and other disturbances. WD has a specific treatment, so that early diagnosis is crucial to avoid disease progression and its devastating consequences. The clinical diagnosis is based on the Leipzig score, which considers clinical, histological, biochemical, and genetic data. However, even patients with an initial WD diagnosis based on a high Leipzig score may harbor other conditions that mimic the WD's phenotype (Wilson-like). Many patients are diagnosed using current available methods, but others remain in an uncertain area because of bordering ceruloplasmin levels, inconclusive genetic findings and unclear phenotypes. Currently, the available biomarkers for WD are ceruloplasmin and copper in the liver or in 24 h urine, but they are not solid enough. Therefore, the characterization of biomarkers that allow us to anticipate the evolution of the disease and the monitoring of new drugs is essential to improve its diagnosis and prognosis.

Also flagged:Betulinic AcidSynthesisCell-Cycletriterpenecanceramino
Journal Article 2021-08-28 No Snippets Kodr D, Stanková J, Rumlová M, Džubák P, Řehulka J, Zimmermann T, Křížová I, Gurská S, Hajdúch M, Drašar PB, Jurášek M.
Show Full Abstract

Betulinic acid (BA) is a potent triterpene, which has shown promising potential in cancer and HIV-1 treatment. Here, we report a synthesis and biological evaluation of 17 new compounds, including BODIPY labelled analogues derived from BA. The analogues terminated by amino moiety showed increased cytotoxicity (e.g., BA had on CCRF-CEM IC<sub>50</sub> > 50 μM, amine <b>3</b> IC<sub>50</sub> 0.21 and amine <b>14</b> IC<sub>50</sub> 0.29). The cell-cycle arrest was evaluated and did not show general features for all the tested compounds. A fluorescence microscopy study of six derivatives revealed that only <b>4</b> and <b>6</b> were detected in living cells. These compounds were colocalized with the endoplasmic reticulum and mitochondria, indicating possible targets in these organelles. The study of anti-HIV-1 activity showed that <b>8</b>, <b>10</b>, <b>16</b>, <b>17</b> and <b>18</b> have had IC<sub>50i</sub> > 10 μM. Only completely processed p24 CA was identified in the viruses formed in the presence of compounds <b>4</b> and <b>12</b>. In the cases of <b>2</b>, <b>8</b>, <b>9</b>, <b>10</b>, <b>16</b>, <b>17</b> and <b>18</b>, we identified not fully processed p24 CA and p25 CA-SP1 protein. This observation suggests a similar mechanism of inhibition as described for bevirimat.

Also flagged:reproductionPTGS2PLA2G4Amatingautosomechromosome
Journal Article 2021-08-28 No Snippets Bernini F, Bagnato A, Marelli SP, Zaniboni L, Cerolini S, Strillacci MG.
Show Full Abstract

Italian autochthonous turkey breeds are an important reservoir of genetic biodiversity that should be maintained with an in vivo approach. The aim of this study, part of the TuBAvI national project on biodiversity, was to use run of homozygosity (ROH), together with others statistical approaches (e.g., Wright's F-statistics, principal component analysis, ADMIXTURE analysis), to investigate the genomic diversity in several heritage turkey breeds. We performed a genome-wide characterization of ROH-rich regions in seven autochthonous turkey breeds, i.e., Brianzolo (Brzl), Bronzato Comune Italiano (BrCI), Bronzato dei Colli Euganei (CoEu), Parma e Piacenza (PrPc), Nero d'Italia (NeIt), Ermellinato di Rovigo (ErRo) and Romagnolo (Roma). ROHs were detected based on a 650K SNP genotyping. ROH_islands were identified as homozygous ROH regions shared by at least 75% of birds (within breed). Annotation of genes was performed with DAVID. The admixture analyses revealed that six breeds are unique populations while the Roma breed consists in an admixture of founder populations. Effective population size estimated on genomic data shows a numeric contraction. ROH_islands harbour genes that may be interesting for target selection in commercial populations also. Among them the <i>PTGS2</i> and <i>PLA2G4A</i> genes on chr10 were related to reproduction efficiency. This is the first study mapping genetic variation in autochthonous turkey populations. Breeds were genetically different among them, with the Roma breed proving to be a mixture of the other breeds. The ROH_islands identified harboured genes peculiar to the selection that occurred in heritage breeds. Finally, this study releases previously undisclosed information on existing genetic variation in the turkey species.

Also flagged:vesiclescancerextracellularlipidmembraneapoptotic bodies
Journal Article 2021-08-28 ✓ 1 Snippet Thakur A, Parra DC, Motallebnejad P, Brocchi M, Chen HJ.
In-Text Gene Mentions

Recent studies of serum exosomes from patients with HCC identified 10 differentially expressed proteins (DEPs), namely VWF, TGFB1, LGALS3BP, SERPINC1, HPX, HP, HBA1, FGA, FGG and FGB.

Show Full Abstract

Cancer is a deadly disease that is globally and consistently one of the leading causes of mortality every year. Despite the availability of chemotherapy, radiotherapy, immunotherapy, and surgery, a cure for cancer has not been attained. Recently, exosomes have gained significant attention due to the therapeutic potential of their various components including proteins, lipids, nucleic acids, miRNAs, and lncRNAs. Exosomes constitute a set of tiny extracellular vesicles with an approximate diameter of 30-100 nm. They are released from different cells and are present in biofluids including blood, cerebrospinal fluid (CSF), and urine. They perform crucial multifaceted functions in the malignant progression of cancer via autocrine, paracrine, and endocrine communications. The ability of exosomes to carry different cargoes including drug and molecular information to recipient cells make them a novel tool for cancer therapeutics. In this review, we discuss the major components of exosomes and their role in cancer progression. We also review important literature about the potential role of exosomes as vaccines and delivery carriers in the context of cancer therapeutics.

Also flagged:Diabetic mellituschronic metabolic diseasedeathdiabetic cardiomyopathyheart failurepyroptosis
Journal Article 2021-08-28 No Snippets Wei J, Zhao Y, Liang H, Du W, Wang L.
Show Full Abstract

Diabetic mellitus (DM) is a common degenerative chronic metabolic disease often accompanied by severe cardiovascular complications (DCCs) as major causes of death in diabetic patients with diabetic cardiomyopathy (DCM) as the most common DCC. The metabolic disturbance in DCM generates the conditions/substrates and inducers/triggers and activates the signaling molecules and death executioners leading to cardiomyocyte death which accelerates the development of DCM and the degeneration of DCM to heart failure. Various forms of programmed active cell death including apoptosis, pyroptosis, autophagic cell death, autosis, necroptosis, ferroptosis and entosis have been identified and characterized in many types of cardiac disease. Evidence has also been obtained for the presence of multiple forms of cell death in DCM. Most importantly, published animal experiments have demonstrated that suppression of cardiomyocyte death of any forms yields tremendous protective effects on DCM. Herein, we provide the most updated data on the subject of cell death in DCM, critical analysis of published results focusing on the pathophysiological roles of cell death, and pertinent perspectives of future studies.

Also flagged:Peripartum cardiomyopathyleft ventricular systolic dysfunctioncardiac failuredeathsdilated cardiomyopathyeclampsia
Journal Article 2021-08-27 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…rs (SFPQ-NTRK1, C1orf54-NTRK1, SOX6-NTRK2). …

Show Full Abstract

No abstract available.

Also flagged:mitochondrial1Multiple Mitochondrial Dysfunctions SyndromeMMDS1NFU1iron-sulfur clusters
Journal Article 2021-08-27 No Snippets Kropp PA, Wu J, Reidy M, Shrestha S, Rhodehouse K, Rogers P, Sack MN, Golden A.
Show Full Abstract

Multiple Mitochondrial Dysfunctions Syndrome 1 (MMDS1) is a rare, autosomal recessive disorder caused by mutations in the NFU1 gene. NFU1 is responsible for delivery of iron-sulfur clusters (ISCs) to recipient proteins which require these metallic cofactors for their function. Pathogenic variants of NFU1 lead to dysfunction of its target proteins within mitochondria. To date, 20 NFU1 variants have been reported and the unique contributions of each variant to MMDS1 pathogenesis is unknown. Given that over half of MMDS1 individuals are compound heterozygous for different NFU1 variants, it is valuable to investigate individual variants in an isogenic background. In order to understand the shared and unique phenotypes of NFU1 variants, we used CRISPR/Cas9 gene editing to recreate exact patient variants of NFU1 in the orthologous gene, nfu-1 (formerly lpd-8), in C. elegans. Five mutant C. elegans alleles focused on the presumptive iron-sulfur cluster interaction domain were generated and analyzed for mitochondrial phenotypes including respiratory dysfunction and oxidative stress. Phenotypes were variable between the mutant nfu-1 alleles and generally presented as an allelic series indicating that not all variants have lost complete function. Furthermore, reactive iron within mitochondria was evident in some, but not all, nfu-1 mutants indicating that iron dyshomeostasis may contribute to disease pathogenesis in some MMDS1 individuals.

Also flagged:odorant receptorsmembraneaxonsaxonorganizationaxonal
Journal Article 2021-08-27 ✓ 5 Snippets Francia S, Lodovichi C.
In-Text Gene Mentions

…hanolamine binding protein-1 (PEBP1)…

…binding protein 1 (PEBP1) was identified, by…

PEBP1is a small…

PEBP1is the precursor…

…and rat OB,PEBP1is expressed mostly…

Show Full Abstract

In the olfactory system, odorant receptors (ORs) expressed at the cell membrane of olfactory sensory neurons detect odorants and direct sensory axons toward precise target locations in the brain, reflected in the presence of olfactory sensory maps. This dual role of ORs is corroborated by their subcellular expression both in cilia, where they bind odorants, and at axon terminals, a location suitable for axon guidance cues. Here, we provide an overview and discuss previous work on the role of ORs in establishing the topographic organization of the olfactory system and recent findings on the mechanisms of activation and function of axonal ORs.

Also flagged:CAIXNFS1xCTtumorredox homeostasisiron-sulfur cluster enzyme
Journal Article 2021-08-27 No Snippets Chafe SC, Vizeacoumar FS, Venkateswaran G, Nemirovsky O, Awrey S, Brown WS, McDonald PC, Carta F, Metcalfe A, Karasinska JM, Huang L, Muthuswamy SK, Schaeffer DF, Renouf DJ, Supuran CT, Vizeacoumar FJ, Dedhar S.
Show Full Abstract

The metabolic mechanisms involved in the survival of tumor cells within the hypoxic niche remain unclear. We carried out a synthetic lethal CRISPR screen to identify survival mechanisms governed by the tumor hypoxia-induced pH regulator carbonic anhydrase IX (CAIX). We identified a redox homeostasis network containing the iron-sulfur cluster enzyme, NFS1. Depletion of NFS1 or blocking cyst(e)ine availability by inhibiting xCT, while targeting CAIX, enhanced ferroptosis and significantly inhibited tumor growth. Suppression of CAIX activity acidified intracellular pH, increased cellular reactive oxygen species accumulation, and induced susceptibility to alterations in iron homeostasis. Mechanistically, inhibiting bicarbonate production by CAIX or sodium-driven bicarbonate transport, while targeting xCT, decreased adenosine 5'-monophosphate-activated protein kinase activation and increased acetyl-coenzyme A carboxylase 1 activation. Thus, an alkaline intracellular pH plays a critical role in suppressing ferroptosis, a finding that may lead to the development of innovative therapeutic strategies for solid tumors to overcome hypoxia- and acidosis-mediated tumor progression and therapeutic resistance.

Also flagged:PAD4Fibrinogenfibrinogen alpha chainPAD2citrullinePAD
Journal Article 2021-08-27 ✓ 2 Snippets Poulsen TBG, Damgaard D, Jørgensen MM, Senolt L, Blackburn JM, Nielsen CH, Stensballe A.
In-Text Gene Mentions

…Staufen homolog 1 (STAU1; 20.0-fold increase), and…

…CASS4, SH3GL1, andSTAU1.…

Show Full Abstract

The presence or absence of autoantibodies against citrullinated proteins (ACPAs) distinguishes two main groups of rheumatoid arthritis (RA) patients with different etiologies, prognoses, disease severities, and, presumably, disease pathogenesis. The heterogeneous responses of RA patients to various biologics, even among ACPA-positive patients, emphasize the need for further stratification of the patients. We used high-density protein array technology for fingerprinting of ACPA reactivity. Identification of the proteome recognized by ACPAs may be a step to stratify RA patients according to immune reactivity. Pooled plasma samples from 10 anti-CCP-negative and 15 anti-CCP-positive RA patients were assessed for ACPA content using a modified protein microarray containing 1631 different natively folded proteins citrullinated in situ by protein arginine deiminases (PADs) 2 and PAD4. IgG antibodies from anti-CCP-positive RA plasma showed high-intensity binding to 87 proteins citrullinated by PAD2 and 99 proteins citrullinated by PAD4 without binding significantly to the corresponding native proteins. Curiously, the binding of IgG antibodies in anti-CCP-negative plasma was also enhanced by PAD2- and PAD4-mediated citrullination of 29 and 26 proteins, respectively. For only four proteins, significantly more ACPA binding occurred after citrullination with PAD2 compared to citrullination with PAD4, while the opposite was true for one protein. We demonstrate that PAD2 and PAD4 are equally efficient in generating citrullinated autoantigens recognized by ACPAs. Patterns of proteins recognized by ACPAs may serve as a future diagnostic tool for further subtyping of RA patients.

Also flagged:calciumMelanocortinspeptidehormonesenergy homeostasispigmentation
Journal Article 2021-08-27 ✓ 1 Snippet Ma S, Chen Y, Dai A, Yin W, Guo J, Yang D, Zhou F, Jiang Y, Wang MW, Xu HE.
In-Text Gene Mentions

GPR52

Show Full Abstract

Melanocortins are peptide hormones critical for the regulation of stress response, energy homeostasis, inflammation, and skin pigmentation. Their functions are mediated by five G protein-coupled receptors (MC1R-MC5R), predominately through the stimulatory G protein (Gs). MC1R, the founding member of melanocortin receptors, is mainly expressed in melanocytes and is involved in melanogenesis. Dysfunction of MC1R is associated with the development of melanoma and skin cancer. Here we present three cryo-electron microscopy structures of the MC1R-Gs complexes bound to endogenous hormone α-MSH, a marketed drug afamelanotide, and a synthetic agonist SHU9119. These structures reveal the orthosteric binding pocket for the conserved HFRW motif among melanocortins and the crucial role of calcium ion in ligand binding. They also demonstrate the basis of differential activities among different ligands. In addition, unexpected interactions between MC1R and the Gβ subunit were discovered from these structures. Together, our results elucidate a conserved mechanism of calcium-mediated ligand recognition, a specific mode of G protein coupling, and a universal activation pathway of melanocortin receptors.

Also flagged:C1RC1SSEPP1Complement component C9APOBIg kappa chain V-I region Ni
Journal Article 2021-08-27 No Snippets Romero-Gavilán F, Cerqueira A, Anitua E, Tejero R, García-Arnáez I, Martinez-Ramos C, Ozturan S, Izquierdo R, Azkargorta M, Elortza F, Gurruchaga M, Goñi I, Suay J.
Show Full Abstract

Calcium ions are used in the development of biomaterials for the promotion of coagulation, bone regeneration, and implant osseointegration. Upon implantation, the time-dependent release of calcium ions from titanium implant surfaces modifies the physicochemical characteristics at the implant-tissue interface and thus, the biological responses. The aim of this study is to examine how the dynamics of protein adsorption on these surfaces change over time. Titanium discs with and without Ca were incubated with human serum for 2 min, 180 min, and 960 min. The layer of proteins attached to the surface was characterised using nLC-MS/MS. The adsorption kinetics was different between materials, revealing an increased adsorption of proteins associated with coagulation and immune responses prior to Ca release. Implant-blood contact experiments confirmed the strong coagulatory effect for Ca surfaces. We employed primary human alveolar osteoblasts and THP-1 monocytes to study the osteogenic and inflammatory responses. In agreement with the proteomic results, Ca-enriched surfaces showed a significant initial inflammation that disappeared once the calcium was released. The distinct protein adsorption/desorption dynamics found in this work demonstrated to be useful to explain the differential biological responses between the titanium and Ca-ion modified implant surfaces.

Also flagged:atherosclerosiscarotid atherosclerosisyouVIPEP1RPE
Journal Article 2021-08-27 ✓ 1 Snippet Sripathi SR, Hu MW, Turaga RC, Mertz J, Liu MM, Wan J, Maruotti J, Wahlin KJ, Berlinicke CA, Qian J, Zack DJ.
In-Text Gene Mentions

…visual cycle (OTX2,SOX6, and SOX9), cell…

Show Full Abstract

Stress and injury to the retinal pigment epithelium (RPE) often lead to dedifferentiation and epithelial-to-mesenchymal transition (EMT). These processes have been implicated in several retinal diseases, including proliferative vitreoretinopathy, diabetic retinopathy, and age-related macular degeneration. Despite the importance of RPE-EMT and the large body of data characterizing malignancy-related EMT, comprehensive proteomic studies to define the protein changes and pathways underlying RPE-EMT have not been reported. This study sought to investigate the temporal protein expression changes that occur in a human-induced pluripotent stem cell-based RPE-EMT model. We utilized multiplexed isobaric tandem mass tag labeling followed by high-resolution tandem MS for precise and in-depth quantification of the RPE-EMT proteome. We have identified and quantified 7937 protein groups in our tandem mass tag-based MS analysis. We observed a total of 532 proteins that are differentially regulated during RPE-EMT. Furthermore, we integrated our proteomic data with prior transcriptomic (RNA-Seq) data to provide additional insights into RPE-EMT mechanisms. To validate these results, we have performed a label-free single-shot data-independent acquisition MS study. Our integrated analysis indicates both the commonality and uniqueness of RPE-EMT compared with malignancy-associated EMT. Our comparative analysis also revealed that multiple age-related macular degeneration-associated risk factors are differentially regulated during RPE-EMT. Together, our integrated dataset provides a comprehensive RPE-EMT atlas and resource for understanding the molecular signaling events and associated biological pathways that underlie RPE-EMT onset. This resource has already facilitated the identification of chemical modulators that could inhibit RPE-EMT, and it will hopefully aid in ongoing efforts to develop EMT inhibition as an approach for the treatment of retinal disease.

Also flagged:Infectionsinfectionbacteremiafungemiameningitisdeath
Journal Article 2021-08-27 No Snippets Shane AL, Hansen NI, Moallem M, Wyckoff MH, Sánchez PJ, Stoll BJ, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To assess the burden of invasive infection following surgery (surgery-associated infections [SAI]) among infants born extremely premature.<h4>Study design</h4>This was an observational, prospective study of infants born at gestational age 22-28 weeks hospitalized for >3 days, between April 1, 2011, to March 31, 2015, in academic centers of the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network. SAI was defined by culture-confirmed bacteremia, fungemia, or meningitis ≤14 days following a surgical procedure.<h4>Results</h4>Of 6573 infants, 1154 (18%) who underwent surgery were of lower gestational age (mean [SD]: 25.5 [1.6] vs 26.2 [1.6], P < .001), lower birth weight (803 [220] vs 886 [244], P < .001), and more likely to have a major birth defect (10% vs 3%, P < .001); 64% had 1 surgery (range 1-10 per infant). Most underwent gastrointestinal procedures (873, 76%) followed by central nervous system procedures (150, 13%). Eighty-five (7%) infants had 90 SAIs (78 bacteremia, 5 fungemia, 1 bacteremia and meningitis, 6 meningitis alone). Coagulase-negative staphylococci were isolated in 36 (40%) SAI and were isolated with another organism in 5 episodes. Risk of SAI or death ≤14 days after surgery was greater after gastrointestinal compared with central nervous system procedures (16% vs 7%, adjusted relative risk [95% CI]: 1.95 [1.15-3.29], P = .01). Death ≤14 days after surgery occurred in 141 of the 1154 infants; 128 deaths occurred after gastrointestinal surgeries.<h4>Conclusions</h4>Surgical procedures were associated with bacteremia, fungemia, or meningitis in 7% of infants. The epidemiology of invasive postoperative infections as described in this report may inform the selection of empiric antimicrobial therapy and postoperative preventive care.

Also flagged:cancertumorkinaseCMLBCRABL
Journal Article 2021-08-27 No Snippets Yesilkanal AE, Johnson GL, Ramos AF, Rosner MR.
Show Full Abstract

Targeted strategies against specific driver molecules of cancer have brought about many advances in cancer treatment since the early success of the first small-molecule inhibitor Gleevec. Today, there are a multitude of targeted therapies approved by the Food and Drug Administration for the treatment of cancer. However, the initial efficacy of virtually every targeted treatment is often reversed by tumor resistance to the inhibitor through acquisition of new mutations in the target molecule, or reprogramming of the epigenome, transcriptome, or kinome of the tumor cells. At the core of this clinical problem lies the assumption that targeted treatments will only be efficacious if the inhibitors are used at their maximum tolerated doses. Such aggressive regimens create strong selective pressure on the evolutionary progression of the tumor, resulting in resistant cells. High-dose single agent treatments activate alternative mechanisms that bypass the inhibitor, while high-dose combinatorial treatments suffer from increased toxicity resulting in treatment cessation. Although there is an arsenal of targeted agents being tested clinically and preclinically, identifying the most effective combination treatment plan remains a challenge. In this review, we discuss novel targeted strategies with an emphasis on the recent cross-disciplinary studies demonstrating that it is possible to achieve antitumor efficacy without increasing toxicity by adopting low-dose multitarget approaches to treatment of cancer and metastasis.

Also flagged:AIDSgraft-versus-host diseaseGVHDinfectionleukemiamyeloma
Journal Article 2021-08-27 No Snippets Heslop HE, Stadtmauer EA, Levine JE, Ballen KK, Chen YB, DeZern AE, Eapen M, Hamadani M, Hamilton BK, Hari P, Jones RJ, Logan BR, Kean LS, Leifer ES, Locke FL, Maziarz RT, Nemecek ER, Pasquini M, Phelan R, Riches ML, Shaw BE, Walters MC, Foley A, Devine SM, Horowitz MM.
Show Full Abstract

In 2021 the BMT CTN held the 4th State of the Science Symposium where the deliberations of 11 committees concerning major topics pertinent to a particular disease, modality, or complication of transplant, as well as two committees to consider clinical trial design and inclusion, diversity, and access as cross-cutting themes were reviewed. This article summarizes the individual committee reports and their recommendations on the highest priority questions in hematopoietic stem cell transplant and cell therapy to address in multicenter trials.

Also flagged:renal fibrosisinflammatory responseTGF-β1IL-1βTNF-αluciferase
Journal Article 2021-08-27 ✓ 5 Snippets Xia WP, Chen X, Ru F, He Y, Liu PH, Gan Y, Zhang B, Li Y, Dai GY, Jiang ZX, Chen Z.
In-Text Gene Mentions

Similarly, knockdown of XIST in vivo inhibited apoptosis, inflammation and fibrosis in kidneys of UUO mice via miR-19b-mediated downregulation of SOX6.<h4>Discussion</h4>These results provided evidence that knockdown of XIST inhibited apoptosis and inflammation of renal fibrosis via miR-19b-mediated downregulation of SOX6.

Here we showed that lncRNA XIST/ miR-19b / SOX6 signal axis regulated apoptosis and inflammation of renal fibrosis.<h4>Methods</h4>HK-2 cells were treated with TGF-β1 to construct cell fibrosis model, and UUO surgery was performed to construct mouse renal fibrosis model.

Knockdown of lncRNA XIST inhibited apoptosis and inflammation in renal fibrosis via microRNA-19b-mediated downregulation of SOX6.

…19b-mediated downregulation ofSOX6.…

…XIST/ miR-19b /SOX6signal axis regulated…

Show Full Abstract

<h4>Background</h4>Kidney damage often develops into renal fibrosis. Apoptosis and inflammatory response are the main factors driving the process of renal fibrosis. Here we showed that lncRNA XIST/ miR-19b / SOX6 signal axis regulated apoptosis and inflammation of renal fibrosis.<h4>Methods</h4>HK-2 cells were treated with TGF-β1 to construct cell fibrosis model, and UUO surgery was performed to construct mouse renal fibrosis model. The expression of XIST, miR-19b and SOX6 were examined by qPCR. And levels of fibrosis-related proteins were detected by western blotting. Levels of IL-1β and TNF-α were assessed by qPCR and ELISA, respectively. Renal pathology and fibrosis were evaluated by HE and Masson staining. Flow cytometry and TUNEL staining were employed to evaluate cell apoptosis in cell fibrosis model and mouse renal fibrosis model, respectively. Besides, dual luciferase reporter assay was employed to verify whether XIST had a binding site to miR-19b, and whether miR-19b had a binding site to SOX6.<h4>Results</h4>Here we showed that XIST and SOX6 were upregulated in both HK-2 cells treatment of TGF-β1 and kidneys of UUO mice, while miR-19b was downregulated. Dual luciferase reporter assay displayed that XIST directly bound to miR-19b, and SOX6 was the target of miR-19b. Knockdown of XIST inhibited apoptosis, inflammation and fibrosis in HK-2 cells treatment of TGF-β1 via miR-19b-mediated downregulation of SOX6, while inhibition of miR-19b reversed the effect. Similarly, knockdown of XIST in vivo inhibited apoptosis, inflammation and fibrosis in kidneys of UUO mice via miR-19b-mediated downregulation of SOX6.<h4>Discussion</h4>These results provided evidence that knockdown of XIST inhibited apoptosis and inflammation of renal fibrosis via miR-19b-mediated downregulation of SOX6.

Also flagged:polysaccharidesglycosaminoglycansheparinmicrobial infectioncarbohydratesGlycosaminoglycan Polysaccharides
Journal Article 2021-08-27 ✓ 1 Snippet Palhares LCGF, London JA, Kozlowski AM, Esposito E, Chavante SF, Ni M, Yates EA.
In-Text Gene Mentions

…I), galactosyltransferase II (GalT-II), and glucuronyltransferase I…

Show Full Abstract

The linear anionic class of polysaccharides, glycosaminoglycans (GAGs), are critical throughout the animal kingdom for developmental processes and the maintenance of healthy tissues. They are also of interest as a means of influencing biochemical processes. One member of the GAG family, heparin, is exploited globally as a major anticoagulant pharmaceutical and there is a growing interest in the potential of other GAGs for diverse applications ranging from skin care to the treatment of neurodegenerative conditions, and from the treatment and prevention of microbial infection to biotechnology. To realize the potential of GAGs, however, it is necessary to develop effective tools that are able to exploit the chemical manipulations to which GAGs are susceptible. Here, the current knowledge concerning the chemical modification of GAGs, one of the principal approaches for the study of the structure-function relationships in these molecules, is reviewed. Some additional methods that were applied successfully to the analysis and/or processing of other carbohydrates, but which could be suitable in GAG chemistry, are also discussed.

Also flagged:HydroxyapatiteCalcium phosphateapatitefluoridemembranedental caries
Journal Article 2021-08-27 No Snippets Chen L, Al-Bayatee S, Khurshid Z, Shavandi A, Brunton P, Ratnayake J.
Show Full Abstract

Calcium phosphate compounds form the inorganic phases of our mineralised tissues such as bone and teeth, playing an important role in hard tissue engineering and regenerative medicine. In dentistry and oral care products, hydroxyapatite (HA) is a stable and biocompatible calcium phosphate with low solubility being used for various applications such as tooth remineralisation, reduction of tooth sensitivity, oral biofilm control, and tooth whitening. Clinical data on these products is limited with varied results; additionally, the effectiveness of these apatite compounds versus fluoride, which has conventionally been used in toothpaste, has not been established. Therefore, this review critically evaluates current research on HA oral care, and discusses the role and mechanism of HA in remineralisation of both enamel and dentine and for suppressing dentine sensitivity. Furthermore, we position HA's role in biofilm management and highlight the role of HA in dental applications by summarising the recent achievement and providing an overview of commercialised HA dental products. The review also indicates the existing limitations and provides direction for future research and commercialisation of apatite-based oral care products.

Also flagged:AcetylcholinesteraseNeurodegenerative DiseasesAChEpathogenesisinflammatory responsehydrolases
Journal Article 2021-08-27 No Snippets Walczak-Nowicka ŁJ, Herbet M.
Show Full Abstract

Acetylcholinesterase (AChE) plays an important role in the pathogenesis of neurodegenerative diseases by influencing the inflammatory response, apoptosis, oxidative stress and aggregation of pathological proteins. There is a search for new compounds that can prevent the occurrence of neurodegenerative diseases and slow down their course. The aim of this review is to present the role of AChE in the pathomechanism of neurodegenerative diseases. In addition, this review aims to reveal the benefits of using AChE inhibitors to treat these diseases. The selected new AChE inhibitors were also assessed in terms of their potential use in the described disease entities. Designing and searching for new drugs targeting AChE may in the future allow the discovery of therapies that will be effective in the treatment of neurodegenerative diseases.

Also flagged:Psychiatric DisordersBipolar disorderschizophreniabehaviorallithiumvalproic acid
Journal Article 2021-08-27 ✓ 2 Snippets Nayak R, Rosh I, Kustanovich I, Stern S.
In-Text Gene Mentions

Another schizophrenia GWAS study conducted by Potkin et al. in 2009 with 64 schizophrenia and 74 control subjects identified six genes (ROBO1-ROBO2, TNIK, CTXN3-SLC12A2, POU3F2, TRAF, and GPC1) significantly involved (p-value < 10−6) in forebrain development and the stress response pathway in schizophrenia [78].

⭐ same-sentence co-mention

DARS2 and CSE1L loci were identified to be significantly associated with schizophrenia [88].

Show Full Abstract

Bipolar disorder (BD) and schizophrenia are psychiatric disorders that manifest unusual mental, behavioral, and emotional patterns leading to suffering and disability. These disorders span heterogeneous conditions with variable heredity and elusive pathophysiology. Mood stabilizers such as lithium and valproic acid (VPA) have been shown to be effective in BD and, to some extent in schizophrenia. This review highlights the efficacy of lithium and VPA treatment in several randomized, controlled human trials conducted in patients suffering from BD and schizophrenia. Furthermore, we also address the importance of using induced pluripotent stem cells (iPSCs) as a disease model for mirroring the disease's phenotypes. In BD, iPSC-derived neurons enabled finding an endophenotype of hyperexcitability with increased hyperpolarizations. Some of the disease phenotypes were significantly alleviated by lithium treatment. VPA studies have also reported rescuing the Wnt/β-catenin pathway and reducing activity. Another significant contribution of iPSC models can be attributed to studying the molecular etiologies of schizophrenia such as abnormal differentiation of patient-derived neural stem cells, decreased neuronal connectivity and neurite number, impaired synaptic function, and altered gene expression patterns. Overall, despite significant advances using these novel models, much more work remains to fully understand the mechanisms by which these disorders affect the patients' brains.

Also flagged:litPYGLFKBP10intracranial tumorgliomabrain tumors
Journal Article 2021-08-27 ✓ 2 Snippets Zhong H, Liu S, Cao F, Zhao Y, Zhou J, Tang F, Peng Z, Li Y, Xu S, Wang C, Yang G, Li ZQ.
In-Text Gene Mentions

For instance, IS1 showed significant upregulation of CD244, CD27, CD274, CD276, CD28, CD40, CD44, CD48, CD70, CD80, CTLA4, HAVCR2, ICOSLG, IDO1, LAG3, LAIR1, LGals9, NRP1, PDCD1LG2, TNFRSF14, TNFRSF18, TNFRSF4, TNFSF14, and TNFSF4 across the two databases, while these genes were down-expressed separately in the IS2 and IS3 tumors.

…TNFRSF4, TNFSF14, andTNFSF4across the two…

Show Full Abstract

<h4>Background</h4>Nowadays, researchers are leveraging the mRNA-based vaccine technology used to develop personalized immunotherapy for cancer. However, its application against glioma is still in its infancy. In this study, the applicable candidates were excavated for mRNA vaccine treatment in the perspective of immune regulation, and suitable glioma recipients with corresponding immune subtypes were further investigated.<h4>Methods</h4>The RNA-seq data and clinical information of 702 and 325 patients were recruited from TCGA and CGGA, separately. The genetic alteration profile was visualized and compared by cBioPortal. Then, we explored prognostic outcomes and immune correlations of the selected antigens to validate their clinical relevance. The prognostic index was measured <i>via</i> GEPIA2, and infiltration of antigen-presenting cells (APCs) was calculated and visualized by TIMER. Based on immune-related gene expression, immune subtypes of glioma were identified using consensus clustering analysis. Moreover, the immune landscape was visualized by graph learning-based dimensionality reduction analysis.<h4>Results</h4>Four glioma antigens, namely ANXA5, FKBP10, MSN, and PYGL, associated with superior prognoses and infiltration of APCs were selected. Three immune subtypes IS1-IS3 were identified, which fundamentally differed in molecular, cellular, and clinical signatures. Patients in subtypes IS2 and IS3 carried immunologically cold phenotypes, whereas those in IS1 carried immunologically hot phenotype. Particularly, patients in subtypes IS3 and IS2 demonstrated better outcomes than that in IS1. Expression profiles of immune checkpoints and immunogenic cell death (ICD) modulators showed a difference among IS1-IS3 tumors. Ultimately, the immune landscape of glioma elucidated considerable heterogeneity not only between individual patients but also within the same immune subtype.<h4>Conclusions</h4>ANXA5, FKBP10, MSN, and PYGL are identified as potential antigens for anti-glioma mRNA vaccine production, specifically for patients in immune subtypes 2 and 3. In summary, this study may shed new light on the promising approaches of immunotherapy, such as devising mRNA vaccination tailored to applicable glioma recipients.

Also flagged:graft-versus-host diseaseGVHDtumortissue homeostasisinterleukin-22IL-22
Journal Article 2021-08-27 No Snippets Ara T, Hashimoto D.
Show Full Abstract

Prophylaxis for and treatment of graft-versus-host disease (GVHD) are essential for successful allogeneic hematopoietic stem cell transplantation (allo-SCT) and mainly consist of immunosuppressants such as calcineurin inhibitors. However, profound immunosuppression can lead to tumor relapse and infectious complications, which emphasizes the necessity of developing novel management strategies for GVHD. Emerging evidence has revealed that tissue-specific mechanisms maintaining tissue homeostasis and promoting tissue tolerance to combat GVHD are damaged after allo-SCT, resulting in exacerbation and treatment refractoriness of GVHD. In the gastrointestinal tract, epithelial regeneration derived from intestinal stem cells (ISCs), a microenvironment that maintains healthy gut microbiota, and physical and chemical mucosal barrier functions against pathogens are damaged by conditioning regimens and/or GVHD. The administration of growth factors for cells that maintain intestinal homeostasis, such as interleukin-22 (IL-22) for ISCs, R-spondin 1 (R-Spo1) for ISCs and Paneth cells, and interleukin-25 (IL-25) for goblet cells, mitigates murine GVHD. In this review, we summarize recent advances in the understanding of GVHD-induced tissue damage and emerging strategies for the management of GVHD.

Also flagged:AIFM3HSH2DCLSTN2PCSK5PTPN6DCHS1
Journal Article 2021-08-27 ✓ 5 Snippets Dong B, Liang J, Li D, Song W, Zhao S, Ma Y, Song J, Zhu M, Yang T.
In-Text Gene Mentions

PTGIS

The MethHc database show that PTGIS has a high level of DNA methylation in BLCA.

The expression profiles of the signature genes showed that tumors with higher risk scores tended to exhibit elevated PCSK5, DCHS1, CLSTN2, PTGIS, and FLRT2 levels, while those with lower risk scores tended to exhibit elevated AIFM3, PTPN6, and HSH2D levels (Figure 4C).

The results indicated that AIFM3, HSH2D, and PTPN6 were significantly up-regulated, while DCHS1, PTGIS, FLRT2, PCSK5, and CLSTN2 were significantly down-regulated in tumor samples compared with normal samples (Figure 3E).

PTGIS is a HIF-1α target gene that plays a primary regulatory role in hypoxic tumor progression by activating the transcription of various oncogenes (Lu et al., 2018).

Show Full Abstract

<b>Background</b>: Bladder cancer (BLCA) ranks 10th in incidence among malignant tumors and 6th in incidence among malignant tumors in males. With the application of immune therapy, the overall survival (OS) rate of BLCA patients has greatly improved, but the 5-year survival rate of BLCA patients is still low. Furthermore, not every BLCA patient benefits from immunotherapy, and there are a limited number of biomarkers for predicting the immunotherapy response. Therefore, novel biomarkers for predicting the immunotherapy response and prognosis of BLCA are urgently needed. <b>Methods</b>: The RNA sequencing (RNA-seq) data, clinical data and gene annotation files for The Cancer Genome Atlas (TCGA) BLCA cohort were extracted from the University of California, Santa Cruz (UCSC) Xena Browser. The BLCA datasets GSE31684 and GSE32894 from the Gene Expression Omnibus (GEO) database were extracted for external validation. Immune-related genes were extracted from InnateDB. Significant differentially expressed genes (DEGs) were identified using the R package "limma," and Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis for the DEGs were performed using R package "clusterProfiler." Least absolute shrinkage and selection operator (LASSO) regression analysis were used to construct the signature model. The infiltration level of each immune cell type was estimated using the single-sample gene set enrichment analysis (ssGSEA) algorithm. The performance of the model was evaluated with receiver operating characteristic (ROC) curves and calibration curves. <b>Results</b>: In total, 1,040 immune-related DEGs were identified, and eight signature genes were selected to construct a model using LASSO regression analysis. The risk score of BLCA patients based on the signature model was negatively correlated with OS and the immunotherapy response. The ROC curve for OS revealed that the model had good accuracy. The calibration curve showed good agreement between the predictions and actual observations. <b>Conclusions</b>: Herein, we constructed an immune-related eight-gene signature that could be a potential biomarker to predict the immunotherapy response and prognosis of BLCA patients.

Also flagged:Lung adenocarcinomaLUADmalignant tumorsTFELK4BDP1
Journal Article 2021-08-27 ✓ 3 Snippets Zhou W, Bai C, Long C, Hu L, Zheng Y.
In-Text Gene Mentions

(A) The expression patterns of one TF hubs (ZBTB37) and three lncRNA hubs (CTD-2600H12, NPTN-IT1, and RP11-173A16) with the highest degrees in TCGA LUAD cohorts.

(B) Three hub genes (RP11-173A16, RP11-516C1, and ZBTB37) were selected to detect their expression in different stages of lung adenocarcinoma.

…RP11-173A16 and TFZBTB37.…

Show Full Abstract

Lung adenocarcinoma (LUAD) is one type of the malignant tumors with high morbidity and mortality. The molecular mechanism of LUAD is still unclear. Studies demonstrate that lncRNAs play crucial roles in LUAD tumorigenesis and can be used as prognosis biomarkers. Thus, in this study, to identify more robust biomarkers of LUAD, we firstly constructed LUAD-related lncRNA-TF network and performed topological analyses for the network. Results showed that the network was a scale-free network, and some hub genes with high clinical values were identified, such as lncRNA RP11-173A16 and TF ZBTB37. Module analysis on the network revealed one close lncRNA module, which had good prognosis performance in LUAD. Furthermore, through integrating ceRNAs strategy and TF regulatory information, we identified some lncRNA-TF positive feedback loops. Prognostic analysis revealed that ELK4- and BDP1-related feedback loops were significant. Secondly, we constructed the lncRNA-m6A regulator network by merging all the high correlated lncRNA-m6A regulator pairs. Based on the network analysis results, some key m6A-related lncRNAs were identified, such as MIR497HG, FENDRR, and RP1-199J3. We also investigated the relationships between these lncRNAs and immune cell infiltration. Results showed that these m6A-related lncRNAs were high correlated with tumor immunity. All these results provide a new perspective for the diagnostic biomarker and therapeutic target identification of LUAD.

Also flagged:Liver Diseasefatty livernonalcoholic fatty liver diseaseNAFLDfattychronic liver disease
Journal Article 2021-08-27 ✓ 1 Snippet Chao HC, Lin HY.
In-Text Gene Mentions

…(chronic viral hepatitis,hemochromatosis, infiltrative diseases, autoi…

Show Full Abstract

<b>Background:</b> Information of the relationships between body mass parameters and the severity of fatty liver is deficient in pediatric nonalcoholic fatty liver disease (NAFLD). <b>Methods:</b> The relationships between body mass parameters (waist circumference [WC], body mass index [BMI], and abdominal subcutaneous fat thickness [ASFT]) and the severity of fatty liver were prospectively evaluated in pediatric patients who are overweight or obese, suffering from NAFLD. Ultrasonography was performed to assess fatty liver and its severity on a three-grade scale (low-grade fatty liver [LGFL], grade 1 or 2; high-grade fatty liver [HGFL], grade 3). <b>Results:</b> A total of 110 subjects (55 LGFL and 55 HGFL) aged 6.2-17.9 years were included. The WC, BMI, and ASFT values were significantly higher in the HGFL group compared to those in the LGFL group (<i>p</i> = 0.00004, 0.01, and 0.04, respectively). WC had the greatest power to predict HGFL under receiver-operating characteristic curve analyses and was positively correlated with the severity of fatty liver in subjects aged 6-12-year old and 13-17-year old (<i>p</i> = 0.007, and 0.0039, respectively). ASFT showed a positive correlation with the severity of fatty liver in subjects aged 13-17-year old (<i>p</i> = 0.04). <b>Conclusions:</b> WC, BMI, and ASFT are predictive of severe NAFLD among children who are overweight and obese; particularly, WC has the most predictive accuracy. Among the parameters, WC and ASFT are predictive in specific age groups.

Also flagged:MitochondriaNeurodegenerative Diseasesmetabolismmitochondrialpathogenesisamyotrophic lateral sclerosis
Journal Article 2021-08-27 No Snippets Xu S, Zhang X, Liu C, Liu Q, Chai H, Luo Y, Li S.
Show Full Abstract

Mitochondria, the centers of energy metabolism, have been shown to participate in epigenetic regulation of neurodegenerative diseases. Epigenetic modification of nuclear genes encoding mitochondrial proteins has an impact on mitochondria homeostasis, including mitochondrial biogenesis, and quality, which plays role in the pathogenesis of neurodegenerative diseases like Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. On the other hand, intermediate metabolites regulated by mitochondria such as acetyl-CoA and NAD<sup>+</sup>, in turn, may regulate nuclear epigenome as the substrate for acetylation and a cofactor of deacetylation, respectively. Thus, mitochondria are involved in epigenetic regulation through bidirectional communication between mitochondria and nuclear, which may provide a new strategy for neurodegenerative diseases treatment. In addition, emerging evidence has suggested that the abnormal modification of mitochondria DNA contributes to disease development through mitochondria dysfunction. In this review, we provide an overview of how mitochondria are involved in epigenetic regulation and discuss the mechanisms of mitochondria in regulation of neurodegenerative diseases from epigenetic perspective.

Also flagged:protonsppmCH2PEGMannosamineMannose
Journal Article 2021-08-27 No Snippets Zambito G, Deng S, Haeck J, Gaspar N, Himmelreich U, Censi R, Löwik C, Di Martino P, Mezzanotte L.
Show Full Abstract

Tumor-associated macrophages (TAMs) promote cancer growth and metastasis, but their role in tumor development needs to be fully understood due to the dynamic changes of tumor microenvironment (TME). Here, we report an approach to visualize TAMs by optical imaging and by Fluorine-19 (<sup>19</sup>F) magnetic resonance imaging (MRI) that is largely applied to track immune cells <i>in vivo</i>. TAMs are targeted with PLGA-PEG-mannose nanoparticles (NPs) encapsulating perfluoro-15-crown-5-ether (PFCE) as MRI contrast agent. These particles are preferentially recognized and phagocytized by TAMs that overexpress the mannose receptor (MRC1/CD206). The PLGA-PEG-mannose NPs are not toxic and they were up-taken by macrophages as confirmed by <i>in vitro</i> confocal microscopy. At 48 h after intravenous injection of PLGA-PEG-mannose NPs, 4T1 xenograft mice were imaged and fluorine-19 nuclear magnetic resonance confirmed nanoparticle retention at the tumor site. Because of the lack of <sup>19</sup>F background in the body, observed <sup>19</sup>F signals are robust and exhibit an excellent degree of specificity. <i>In vivo</i> imaging of TAMs in the TME by <sup>19</sup>F MRI opens the possibility for detection of cancer at earlier stage and for prompt therapeutic interventions in solid tumors.

Also flagged:CalciumMedulloblastomacancercell proliferationcalcium-regulating proteinscancers
Journal Article 2021-08-27 No Snippets Maklad A, Sedeeq M, Milevskiy MJG, Azimi I.
Show Full Abstract

Dysregulation in calcium signalling is implicated in several cancer-associated processes, including cell proliferation, migration, invasion and therapy resistance. Modulators of specific calcium-regulating proteins have been proposed as promising future therapeutic agents for some cancers. Alterations in calcium signalling have been extensively studied in some cancers; however, this area of research is highly underexplored in medulloblastoma (MB), the most common paediatric malignant brain tumour. Current MB treatment modalities are not completely effective and can result in several long-lasting mental complications. Hence, new treatment strategies are needed. In this study, we sought to probe the landscape of calcium signalling regulators to uncover those most likely to be involved in MB tumours. We investigated the expression of calcium signalling regulator genes in MB patients using publicly available datasets. We stratified the expression level of these genes with MB molecular subgroups, tumour metastasis and patient survival to uncover correlations with clinical features. Of particular interest was CACNA1 genes, in which we were able to show a developmentally-driven change in expression within the cerebellum, MB's tissue of origin, highlighting a potential influence on tumour incidence. This study lays a platform for future investigations into molecular regulators of calcium signalling in MB formation and progression.

Also flagged:signaling transductionlipidmetabolismFGF4ANGPT4PLA2G4A
Journal Article 2021-08-27 No Snippets Du L, Duan X, An B, Chang T, Liang M, Xu L, Zhang L, Li J, E G, Gao H.
Show Full Abstract

Body weight (BW) is an important longitudinal trait that directly described the growth gain of bovine in production. However, previous genome-wide association study (GWAS) mainly focused on the single-record traits, with less attention paid to longitudinal traits. Compared with traditional GWAS models, the association studies based on the random regression model (GWAS-RRM) have better performance in the control of the false positive rate through considering time-stage effects. In this study, the BW trait data were collected from 808 Chinese Simmental beef cattle aged 0, 6, 12, and 18 months, then we performed a GWAS-RRM to fit the time-varied SNP effect. The results showed a total of 37 significant SNPs were associated with BW. Gene functional annotation and enrichment analysis indicated <i>FGF4</i>, <i>ANGPT4</i>, <i>PLA2G4A</i>, and <i>ITGA5</i> were promising candidate genes for BW. Moreover, these genes were significantly enriched in the signaling transduction pathway and lipid metabolism. These findings will provide prior molecular information for bovine gene-based selection, as well as facilitate the extensive application of GWAS-RRM in domestic animals.

Also flagged:Autism Spectrum Disorderneurodevelopmental disordersbehavioralCas9neurodevelopment disordersdevelopmental delays
Journal Article 2021-08-27 No Snippets Gill PS, Clothier JL, Veerapandiyan A, Dweep H, Porter-Gill PA, Schaefer GB.
Show Full Abstract

Autism Spectrum Disorder (ASD) comprises a heterogeneous group of neurodevelopmental disorders with a strong heritable genetic component. At present, ASD is diagnosed solely by behavioral criteria. Advances in genomic analysis have contributed to numerous candidate genes for the risk of ASD, where rare mutations and s common variants contribute to its susceptibility. Moreover, studies show rare de novo variants, copy number variation and single nucleotide polymorphisms (SNPs) also impact neurodevelopment signaling. Exploration of rare and common variants involved in common dysregulated pathways can provide new diagnostic and therapeutic strategies for ASD. Contributions of current innovative molecular strategies to understand etiology of ASD will be explored which are focused on whole exome sequencing (WES), whole genome sequencing (WGS), microRNA, long non-coding RNAs and CRISPR/Cas9 models. Some promising areas of pharmacogenomic and endophenotype directed therapies as novel personalized treatment and prevention will be discussed.

Also flagged:MetabolismOsteoporosisgene expressionVEGFAFGF2RANKL
Journal Article 2021-08-27 No Snippets Kydonaki EK, Freitas L, Fonseca BM, Reguengo H, Raposo Simón C, Bastos AR, Fernandes EM, Canadas RF, Oliveira JM, Correlo VM, Reis RL, Vliora M, Gkiata P, Koutedakis Y, Ntina G, Pinto R, Carrillo AE, Marques F, Amorim T.
Show Full Abstract

Osteoporosis is characterized by bone loss. The present study aims to investigate the effects of bovine colostrum (BC) on bone metabolism using ovariectomized (OVX) and orchidectomized (ORX) rat models. Twenty-seven-week-old Wistar Han rats were randomly assigned as: (1) placebo control, (2) BC supplementation dose 1 (BC1: 0.5 g/day/OVX, 1 g/day/ORX), (3) BC supplementation dose 2 (BC2: 1 g/day/OVX, 1.5 g/day/ORX) and (4) BC supplementation dose 3 (BC3: 1.5 g/day/OVX, 2 g/day/ORX). Bone microarchitecture, strength, gene expression of VEGFA, FGF2, RANKL, RANK and OPG, and bone resorption/formation markers were assessed after four months of BC supplementation. Compared to the placebo, OVX rats in the BC1 group exhibited significantly higher cortical bone mineral content and trabecular bone mineral content (<i>p</i> < 0.01), while OVX rats in the BC3 group showed significantly higher trabecular bone mineral content (<i>p</i> < 0.05). ORX rats receiving BC dose 2 demonstrated significantly higher levels of trabecular bone mineral content (<i>p</i> < 0.05). Serum osteocalcin in the ORX was pointedly higher in all BC supplementation groups than the placebo (BC1: <i>p</i> < 0.05; BC2, BC3: <i>p</i> < 0.001). Higher doses of BC induced significantly higher relative mRNA expression of OPG, VEGFA, FGF2 and RANKL (<i>p</i> < 0.05). BC supplementation improves bone metabolism of OVX and ORX rats, which might be associated with the activation of the VEGFA, FGF2 and RANKL/RANK/OPG pathways.

Also flagged:MSX2tumororal squamous cell carcinomasOral squamous cell carcinomaOSCCSOX2
Journal Article 2021-08-26 ✓ 1 Snippet Keyimu R, Tuerdi M, Zhao Z, Zhao Z.
In-Text Gene Mentions

VRK2 kinase

Show Full Abstract

Oral squamous cell carcinoma (OSCC) is the sixth malignancy in the world with high incidence. The MSX2 (muscle segment homeobox 2)-Sry-related high-mobility box 2 (SOX2) signaling pathway plays a significant role in maintaining cancer stem cells, which are the origin of malignancy, leading to unfavorable outcomes in several carcinomas. This study aims to elucidate the mechanisms through which the MSX2-SOX2 pathway controls the cancer stem cell-like characterization in OSCC. The results showed that MSX2 was remarkably downregulated in OSCC and that the MSX2 expression level was related to unfavorable outcomes in patients with OSCC. Meanwhile, the MSX2 expression level was lower in the CD44<sup>+</sup>/CD24<sup>-</sup> population than in the other populations of OSCC cells. The OSCC2 cells exhibited decreased percentage of CD44<sup>+</sup>/CD24<sup>-</sup> cells, owing to MSX2 overexpression but increased owing to MSX2 knockdown. Moreover, a negative correlation was observed between MSX2 expression and is SOX2 transcriptional levels in different populations within the OSCC cell lines. Regarding the loss and gain of function, cancer stem cell phenotypes such as tumor globular formation, CD44<sup>+</sup> subpopulation cells, and stem cell-associated gene expression were enhanced by MSX2 knockdown in OSCC CD44<sup>+</sup>/CD24<sup>-</sup> cells but decreased by MSX2 overexpression in other OSCC populations. However, these events were counteracted by the co-knockdown or SOX2 overexpression. Cells with MSX2 overexpression or knockdown formed smaller or bigger cancers <i>in vivo</i>, thereby showing a lower or a higher tumor incidence, respectively. Thus, our results confirm that MSX2 has a tumor suppression effect on the cancer stem cell phenotypes of OSCC and indicate that the MSX2-SOX2 signaling pathway could be a useful target for OSCC treatment.

Also flagged:chronic hepatitis B virus infectionviral hepatitis BChronicHBV infectionpolymeraseInfection
Journal Article 2021-08-26 ✓ 1 Snippet Hefzy EM, Hassuna NA, Shaker OG, Masoud M, Abelhameed TA, Ahmed TI, Hemeda NF, Abdelhakeem MA, Mahmoud RH.
In-Text Gene Mentions

…non-alcoholic steatohepatitis,hemochromatosis, toxic hepatitis, Wilson’s…

Show Full Abstract

Genetic variants in microRNAs (miRNAs) can alter the miRNAs expression and/or function, accordingly, affecting the related biological pathways and disease risk. Dysregulation of miR-155 and miR-146a expression levels has been well-described in viral hepatitis B (HBV). In the current study, we aimed to assess rs767649 T/A and rs57095329 A/G polymorphisms in miR-155, and miR-146a genes, respectively, as risk factors for Chronic HBV (CHBV) in the Egyptian population. Also, we aimed to do in silico analysis to investigate the molecules that primarily target these miRNAs. One hundred patients diagnosed as CHBV and one hundred age and sex-matched controls with evidence of past HBV infection were genotyped for miR-155 (rs767649) and miR-146a (rs57095329) using real-time polymerase chain reaction. The rs767649 AT and AA genotypes in CHBV patients confer four folds and ten folds risk respectively, as compared to control subjects [(AOR = 4.245 (95%CI 2.009-8.970), p<0.0001) and AOR = 10.583 (95%CI 4.012-27.919), p<0.0001, respectively)]. The rs767649 A allele was associated with an increased risk of developing CHBV (AOR = 2.777 (95%CI 1.847-4.175), p<0.0001). There was a significant difference in the frequency of rs57095329 AG and GG genotypes in CHBV patients compared to controls. AG and GG genotypes showed an increase in the risk of developing CHBV by about three and six folds respectively [AOR = 2.610 (95%CI 1.362-5.000), p = 0.004] and [AOR = 5.604 (95%CI 2.157-14.563), p<0.0001].We concluded that rs57095329 and rs767649 SNPs can act as potential risk factors for the development of CHBV in the Egyptian population.

Also flagged:amikacininfectionsMS2clarithromycinASMPhD2
Journal Article 2021-08-26 ✓ 2 Snippets Bronson RA, Gupta C, Manson AL, Nguyen JA, Bahadirli-Talbott A, Parrish NM, Earl AM, Cohen KA.
In-Text Gene Mentions

DCC

…the largest knownDCC.…

Show Full Abstract

Mycobacterium abscessus (MAB) is an emerging pathogen that leads to chronic lung infections. To date, the global population structure of non-cystic fibrosis (CF) MAB and evolutionary patterns of drug resistance emergence have not been investigated. Here we construct a global dataset of 1,279 MAB whole genomes from CF or non-CF patients. We utilize whole genome analysis to assess relatedness, phylogeography, and drug resistance evolution. MAB isolates from CF and non-CF hosts are interspersed throughout the phylogeny, such that the majority of dominant circulating clones include isolates from both populations, indicating that global spread of MAB clones is not sequestered to CF contexts. We identify a large clade of M. abscessus harboring the erm(41) T28C mutation, predicted to confer macrolide susceptibility in this otherwise macrolide-resistant species. Identification of multiple evolutionary events within this clade, consistent with regain of wild type, intrinsic macrolide resistance, underscores the critical importance of macrolides in MAB.

Also flagged:to self-regulationbehavioralopioid use disorderHIV infectionsaddictionrelated
Journal Article 2021-08-26 ✓ 3 Snippets Karlsson Linnér R, Mallard TT, Barr PB, Sanchez-Roige S, Madole JW, Driver MN, Poore HE, de Vlaming R, Grotzinger AD, Tielbeek JJ, Johnson EC, Liu M, Rosenthal SB, Ideker T, Zhou H, Kember RL, Pasman JA, Verweij KJH, Liu DJ, Vrieze S, COGA Collaborators, Kranzler HR, Gelernter J, Harris KM, Tucker-Drob EM, Waldman ID, Palmer AA, Harden KP, Koellinger PD, Dick DM.
In-Text Gene Mentions

Other genes among the 34 have previously been identified in GWAS of behavioral or psychiatric traits: Cell Adhesion Molecule 2 (CADM2, previously identified in GWAS related to self-regulation, including drug use and risk tolerance17,33), Zic Family Member 4 (ZIC4, associated with brain volume34), Gamma-Aminobutyric Acid Type A Receptor Subunit Alpha 2 (GABRA2; the site of action for alcohol and benzodiazepines, extensively studied in relation to alcohol dependence35,36, and candidate gene for psychiatric disorders37,38), NEGR1 (neuronal growth regulator 1, associated with intelligence and educational attainment39,40), and Paired Basic Amino Acid Cleaving Enzyme (FURIN, associated with schizophrenia, risk tolerance, and vulnerability to psychiatric disorders19,41).

…, 38 ),NEGR1(neuronal growth regulator…

…38 ), NEGR1 (neuronal growth regulator 1growth regulator 1,…

Show Full Abstract

Behaviors and disorders related to self-regulation, such as substance use, antisocial behavior and attention-deficit/hyperactivity disorder, are collectively referred to as externalizing and have shared genetic liability. We applied a multivariate approach that leverages genetic correlations among externalizing traits for genome-wide association analyses. By pooling data from ~1.5 million people, our approach is statistically more powerful than single-trait analyses and identifies more than 500 genetic loci. The loci were enriched for genes expressed in the brain and related to nervous system development. A polygenic score constructed from our results predicts a range of behavioral and medical outcomes that were not part of genome-wide analyses, including traits that until now lacked well-performing polygenic scores, such as opioid use disorder, suicide, HIV infections, criminal convictions and unemployment. Our findings are consistent with the idea that persistent difficulties in self-regulation can be conceptualized as a neurodevelopmental trait with complex and far-reaching social and health correlates.

Also flagged:Huntington diseaseHDneurodegenerative disordermyelintranscription factormyelin regulating factor
Journal Article 2021-08-26 ✓ 5 Snippets Gabery S, Kwa JE, Cheong RY, Baldo B, Ferrari Bardile C, Tan B, McLean C, Georgiou-Karistianis N, Poudel GR, Halliday G, Pouladi MA, Petersén Å.
In-Text Gene Mentions

Huntington disease (HD) is a fatal autosomal dominant disorder caused by an expanded CAG repeat in the huntingtin (HTT) gene.

Huntington disease (HD) is a fatal neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin (HTT) gene.

These results are consistent with our recent findings in the BACHD mouse model of HD in which these genes were implicated in mutant HTT-mediated defects in oligodendroglia [14].

These observations are consistent with studies showing a direct effect of mutant HTT on PRC2 activity and point to a broader role for PRC2 in HD [33, 47].

Mechanistically, laquinimod was shown to improve myelination by influencing the post-translational modification of MRF in a manner that mitigated its inhibition by mutant HTT, thereby improving its myelin-promoting transcriptional activity [61].

Show Full Abstract

Huntington disease (HD) is a fatal neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin (HTT) gene. The typical motor symptoms have been associated with basal ganglia pathology. However, psychiatric and cognitive symptoms often precede the motor component and may be due to changes in the limbic system. Recent work has indicated pathology in the hypothalamus in HD but other parts of the limbic system have not been extensively studied. Emerging evidence suggests that changes in HD also include white matter pathology. Here we investigated if the main white matter tract of the limbic system, the fornix, is affected in HD. We demonstrate that the fornix is 34% smaller already in prodromal HD and 41% smaller in manifest HD compared to controls using volumetric analyses of MRI of the IMAGE-HD study. In post-mortem fornix tissue from HD cases, we confirm the smaller fornix volume in HD which is accompanied by signs of myelin breakdown and reduced levels of the transcription factor myelin regulating factor but detect no loss of oligodendrocytes. Further analyses using RNA-sequencing demonstrate downregulation of oligodendrocyte identity markers in the fornix of HD cases. Analysis of differentially expressed genes based on transcription-factor/target-gene interactions also revealed enrichment for binding sites of SUZ12 and EZH2, components of the Polycomb Repressive Complex 2, as well as RE1 Regulation Transcription Factor. Taken together, our data show that there is early white matter pathology of the fornix in the limbic system in HD likely due to a combination of reduction in oligodendrocyte genes and myelin break down.

Also flagged:osteoarthritisdegenerative diseasecartilage degenerationinflammationcapsulegene expression
Journal Article 2021-08-26 No Snippets Boer CG, Hatzikotoulas K, Southam L, Stefánsdóttir L, Zhang Y, Coutinho de Almeida R, Wu TT, Zheng J, Hartley A, Teder-Laving M, Skogholt AH, Terao C, Zengini E, Alexiadis G, Barysenka A, Bjornsdottir G, Gabrielsen ME, Gilly A, Ingvarsson T, Johnsen MB, Jonsson H, Kloppenburg M, Luetge A, Lund SH, Mägi R, Mangino M, Nelissen RRGHH, Shivakumar M, Steinberg J, Takuwa H, Thomas LF, Tuerlings M, arcOGEN Consortium, HUNT All-In Pain, ARGO Consortium, Regeneron Genetics Center, Babis GC, Cheung JPY, Kang JH, Kraft P, Lietman SA, Samartzis D, Slagboom PE, Stefansson K, Thorsteinsdottir U, Tobias JH, Uitterlinden AG, Winsvold B, Zwart JA, Davey Smith G, Sham PC, Thorleifsson G, Gaunt TR, Morris AP, Valdes AM, Tsezou A, Cheah KSE, Ikegawa S, Hveem K, Esko T, Wilkinson JM, Meulenbelt I, Lee MTM, van Meurs JBJ, Styrkársdóttir U, Zeggini E.
Show Full Abstract

Osteoarthritis affects over 300 million people worldwide. Here, we conduct a genome-wide association study meta-analysis across 826,690 individuals (177,517 with osteoarthritis) and identify 100 independently associated risk variants across 11 osteoarthritis phenotypes, 52 of which have not been associated with the disease before. We report thumb and spine osteoarthritis risk variants and identify differences in genetic effects between weight-bearing and non-weight-bearing joints. We identify sex-specific and early age-at-onset osteoarthritis risk loci. We integrate functional genomics data from primary patient tissues (including articular cartilage, subchondral bone, and osteophytic cartilage) and identify high-confidence effector genes. We provide evidence for genetic correlation with phenotypes related to pain, the main disease symptom, and identify likely causal genes linked to neuronal processes. Our results provide insights into key molecular players in disease processes and highlight attractive drug targets to accelerate translation.

Also flagged:COVID-19mucormycosissteroidssepsiscorticosteroiddiabetes
Journal Article 2021-08-26 ✓ 1 Snippet Dilek A, Ozaras R, Ozkaya S, Sunbul M, Sen EI, Leblebicioglu H.
In-Text Gene Mentions

…iron overload orhemochromatosis, deferoxamine therapy, severe…

Show Full Abstract

<h4>Background</h4>Increasing number of patients with COVID-19-associated mucormycosis have been reported, especially from India recently. We have described a patient with COVID-19-associated mucormycosis and, searched and analyzed current medical literature to delineate the characteristics of COVID-19-associated mucormycosis.<h4>Method</h4>We reported a patient developed mucormycosis during post-COVID period. We searched literature to describe the incidence, clinical features, and outcomes of COVID-19-associated mucormycosis. Demographic features, risk factors, clinical features, diagnostic methods, treatment and outcome were analyzed.<h4>Results</h4>We describe a 54-year-old male, hospitalized due to severe COVID-19 pneumonia. He was given long-term, high doses of systemic steroids. He developed maxillo-fascial mucormycosis and died of sepsis. Our literature search found 30 publications describing 100 patients including present case report. The majority (n = 68) were reported from India. 76% were male. The most commonly seen risk factors were corticosteroid use (90.5%), diabetes (79%), and hypertension (34%). Also, excessive use of broad-spectrum antibiotics were noted in cases. Most frequent involvements were rhino-orbital (50%), followed by rhino-sinusal (17%), and rhino-orbito-cerebral (15%). Death was reported as 33 out of 99 patients (33,3%).<h4>Conclusions</h4>Steroid use, diabetes, environmental conditions, excessive use of antibiotics, and hypoxia are main risk factors. Despite medical and surgical treatment, mortality rate is high. A multidisciplinary approach is essential to improve the conditions facilitating the emergence of COVID-19-associated mucormycosis.

Also flagged:peptideion channelsbindingvoltage-gated potassium channeldisulfidechannel
Journal Article 2021-08-26 No Snippets Sanches K, Wai DCC, Norton RS.
Show Full Abstract

Peptide toxins are potent and often exquisitely selective probes of the structure and function of ion channels and receptors, and are therefore of significant interest to the pharmaceutical and biotech industries as both pharmacological tools and therapeutic leads. The three-dimensional structures of peptide toxins are essential as a basis for understanding their structure-activity relationships and their binding to target receptors, as well as in guiding the design of analogues with modified potency and/or selectivity for key targets. NMR spectroscopy has played a key role in elucidating the structures of peptide toxins and probing their structure-function relationships. In this article, we highlight the additional important contribution of NMR to characterising the dynamics of peptide toxins. We also compare the information available from NMR measurements with that afforded by molecular dynamics simulations. We describe several examples of the importance of dynamics measurements over a range of timescales for understanding the structure-function relationships of peptide toxins and their receptor engagement. Peptide toxins that inhibit the voltage-gated potassium channel K<sub>V</sub>1.3 with pM affinities display different degrees of conformational flexibility, even though they contain multiple disulfide bonds, and this flexibility can affect the relative orientation of residues that have been shown to be critical for channel binding. Information on the dynamic properties of peptide toxins is important in the design of analogues or mimetics where receptor-bound structures are not available.

Also flagged:Magnesiumphosphatebone remodelingmagnesium phosphatemagnesium calcium phosphatemagnesium ions
Journal Article 2021-08-26 No Snippets Kazakova G, Safronova T, Golubchikov D, Shevtsova O, Rau JV.
Show Full Abstract

Materials based on Mg<sup>2+</sup>-containing phosphates are gaining great relevance in the field of bone tissue repair via regenerative medicine methods. Magnesium ions, together with condensed phosphate ions, play substantial roles in the process of bone remodeling, affecting the early stage of bone regeneration through active participation in the process of osteosynthesis. In this paper we provide a comprehensive overview of the usage of biomaterials based on magnesium phosphate and magnesium calcium phosphate in bone reconstruction. We consider the role of magnesium ions in angiogenesis, which is an important process associated with osteogenesis. Finally, we summarize the biological properties of calcium magnesium phosphates for regeneration of bone.

Also flagged:LithiumHydroxyapatiteinfectionapatitecalcium phosphateosteogenesis
Journal Article 2021-08-26 No Snippets Keikhosravani P, Maleki-Ghaleh H, Kahaie Khosrowshahi A, Bodaghi M, Dargahi Z, Kavanlouei M, Khademi-Azandehi P, Fallah A, Beygi-Khosrowshahi Y, Siadati MH.
Show Full Abstract

The material for bone scaffold replacement should be biocompatible and antibacterial to prevent scaffold-associated infection. We biofunctionalized the hydroxyapatite (HA) properties by doping it with lithium (Li). The HA and 4 Li-doped HA (0.5, 1.0, 2.0, 4.0 wt.%) samples were investigated to find the most suitable Li content for both aspects. The synthesized nanoparticles, by the mechanical alloying method, were cold-pressed uniaxially and then sintered for 2 h at 1250 °C. Characterization using field-emission scanning electron microscopy (FE-SEM) revealed particle sizes in the range of 60 to 120 nm. The XRD analysis proved the formation of HA and Li-doped HA nanoparticles with crystal sizes ranging from 59 to 89 nm. The bioactivity of samples was investigated in simulated body fluid (SBF), and the growth of apatite formed on surfaces was evaluated using SEM and EDS. Cellular behavior was estimated by MG63 osteoblast-like cells. The results of apatite growth and cell analysis showed that 1.0 wt.% Li doping was optimal to maximize the bioactivity of HA. Antibacterial characteristics against Escherichia coli (<i>E. coli</i>) and Staphylococcus aureus (<i>S. aureus</i>) were performed by colony-forming unit (CFU) tests. The results showed that Li in the structure of HA increases its antibacterial properties. HA biofunctionalized by Li doping can be considered a suitable option for the fabrication of bone scaffolds due to its antibacterial and unique bioactivity properties.

Also flagged:CRISPR/Casgene expressionneurodegenerative diseasesPDneurological disordermovement disorders
Journal Article 2021-08-26 No Snippets Arango D, Bittar A, Esmeral NP, Ocasión C, Muñoz-Camargo C, Cruz JC, Reyes LH, Bloch NI.
Show Full Abstract

CRISPR is a simple and cost-efficient gene-editing technique that has become increasingly popular over the last decades. Various CRISPR/Cas-based applications have been developed to introduce changes in the genome and alter gene expression in diverse systems and tissues. These novel gene-editing techniques are particularly promising for investigating and treating neurodegenerative diseases, including Parkinson's disease, for which we currently lack efficient disease-modifying treatment options. Gene therapy could thus provide treatment alternatives, revolutionizing our ability to treat this disease. Here, we review our current knowledge on the genetic basis of Parkinson's disease to highlight the main biological pathways that become disrupted in Parkinson's disease and their potential as gene therapy targets. Next, we perform a comprehensive review of novel delivery vehicles available for gene-editing applications, critical for their successful application in both innovative research and potential therapies. Finally, we review the latest developments in CRISPR-based applications and gene therapies to understand and treat Parkinson's disease. We carefully examine their advantages and shortcomings for diverse gene-editing applications in the brain, highlighting promising avenues for future research.

Also flagged:non-small cell lung cancerNSCLC-tumorsgene expressionCD27
Journal Article 2021-08-26 ✓ 5 Snippets Ye Q, Singh S, Qian PR, Guo NL.
In-Text Gene Mentions

The identified NSCLC proliferation genes (COPA, CSE1L, EIF2B3, LSM3, MCM5, PMPCB, POLR1B, POLR2F, PSMC3, PSMD11, RPL32, RPS18, and SNRPE) had a significant impact on 100% of NSCLC cell lines in CRISPR-Cas9 and RNAi assays.

From the list of the layer 2 candidate genes, 13 genes (COPA, CSE1L, EIF2B3, LSM3, MCM5, PMPCB, POLR1B, POLR2F, PSMC3, PSMD11, RPL32, RPS18, and SNRPE) had a significant dependency score in 100% of the tested NSCLC cell lines in both CRISPR-Cas9 (n = 78) and RNAi assays (n = 92), defined as layer 2 proliferation genes.

A total of 13 genes (COPA, CSE1L, EIF2B3, LSM3, MCM5, PMPCB, POLR1B, POLR2F, PSMC3, PSMD11, RPL32, RPS18, and SNRPE) had a significant impact on proliferation in 100% of the NSCLC cell lines in both CRISPR-Cas9 (n = 78) and RNA interference (RNAi) assays (n = 92).

CSE1L promotes the nuclear accumulation of transcriptional coactivator TAZ and enhances invasiveness and malignancy in human lung cancer and glioblastoma cells [123].

…( COPA ,CSE1L, EIF2B3 ,…

Show Full Abstract

To date, there are no prognostic/predictive biomarkers to select chemotherapy, immunotherapy, and radiotherapy in individual non-small cell lung cancer (NSCLC) patients. Major immune-checkpoint inhibitors (ICIs) have more DNA copy number variations (CNV) than mutations in The Cancer Genome Atlas (TCGA) NSCLC tumors. Nevertheless, CNV-mediated dysregulated gene expression in NSCLC is not well understood. Integrated CNV and transcriptional profiles in NSCLC tumors (<i>n</i> = 371) were analyzed using Boolean implication networks for the identification of a multi-omics <i>CD27</i>, <i>PD1</i>, and <i>PDL1</i> network, containing novel prognostic genes and proliferation genes. A 5-gene (<i>EIF2AK3</i>, <i>F2RL3</i>, <i>FOSL1</i>, <i>SLC25A26</i>, and <i>SPP1)</i> prognostic model was developed and validated for patient stratification (<i>p</i> < 0.02, Kaplan-Meier analyses) in NSCLC tumors (<i>n</i> = 1163). A total of 13 genes (<i>COPA</i>, <i>CSE1L</i>, <i>EIF2B3</i>, <i>LSM3</i>, <i>MCM5</i>, <i>PMPCB</i>, <i>POLR1B</i>, <i>POLR2F</i>, <i>PSMC3</i>, <i>PSMD11</i>, <i>RPL32</i>, <i>RPS18</i>, and <i>SNRPE</i>) had a significant impact on proliferation in 100% of the NSCLC cell lines in both CRISPR-Cas9 (<i>n</i> = 78) and RNA interference (RNAi) assays (<i>n</i> = 92). Multiple identified genes were associated with chemoresponse and radiotherapy response in NSCLC cell lines (<i>n</i> = 117) and patient tumors (<i>n</i> = 966). Repurposing drugs were discovered based on this immune-omics network to improve NSCLC treatment.

Also flagged:tumorsgastro-esophageal reflux diseaseBEEsophageal AdenocarcinomaCancer of the esophagusadenocarcinoma
Journal Article 2021-08-26 No Snippets Hoppe S, Jonas C, Wenzel MC, Velazquez Camacho O, Arolt C, Zhao Y, Büttner R, Quaas A, Plum PS, Hillmer AM.
Show Full Abstract

Esophageal adenocarcinoma (EAC) is a deadly disease with limited options for targeted therapy. With the help of next-generation sequencing studies over the last decade, we gained an understanding of the genomic architecture of EAC. The tumor suppressor gene <i>TP53</i> is mutated in 70 to 80% of tumors followed by genomic alterations in <i>CDKN2A</i>, <i>KRAS</i>, <i>ERBB2</i>, <i>ARID1A</i>, <i>SMAD4</i> and a long tail of less frequently mutated genes. EAC is characterized by a high burden of point mutations and genomic rearrangements, resulting in amplifications and deletions of genomic regions. The genomic complexity is likely hampering the efficacy of targeted therapies. Barrett's esophagus (BE), a metaplastic response of the esophagus to gastro-esophageal reflux disease, is the main risk factor for the development of EAC. Almost all EACs are derived from BE. The sequence from BE to EAC provides an opportunity to study the genomic evolution towards EAC. While the overlap of point mutations between BE and EAC within the same patient is, at times, surprisingly low, there is a correlation between the complexity of the genomic copy number profile and the development of EAC. Transcriptomic analyses separated EAC into a basal and a classical subtype, with the basal subtype showing a higher level of resistance to chemotherapy. In this review, we provide an overview of the current knowledge of the genomic and transcriptomic characteristics of EAC and their relevance for the development of the disease and patient care.

Also flagged:AntibodyCOVID-19Solid Tumorimmune responsesspike protein-19
Journal Article 2021-08-26 ✓ 1 Snippet Singer J, Le NS, Mattes D, Klamminger V, Hackner K, Kolinsky N, Scherb M, Errhalt P, Kreye G, Pecherstorfer M, Vallet S, Podar K.
In-Text Gene Mentions

…(i.e., aplastic anemia,hemochromatosis) disorders did not…

Show Full Abstract

Vaccination is the primary public health strategy to cope with the COVID-19 pandemic. Although solid tumor and hematologic patients are at higher risk of serious COVID-19-related complications, data on immune responses to COVID-19 vaccines in this patient cohort are particularly scarce. The present study, therefore, aimed at the standardized determination of anti-SARS-CoV-2 spike protein antibody titers among non-vaccinated versus vaccinated solid tumor and hematologic patients who are under clinical observation or under treatment at the University Hospital Krems. Standardized anti-SARS-CoV-2 S antibody titers of a total of 441 patients were retrospectively analyzed. Our results show that antibody titers against the SARS-CoV-2 spike protein are significantly higher in solid tumor versus hematologic patients. While SARS-CoV-2 antibody titers were equal among sexes, an age-dependent decrease was observed. Of note, our studies additionally show that complete vaccination represents a valuable predictor for high anti-SARS-CoV-2 antibody responses in solid tumor and hematologic patients. In summary, to date, this is one of the largest studies to comprehensively evaluate the impact of various COVID-19 vaccines on anti-SARS-CoV-2 S antibody production in solid tumor and hematologic patients. Our findings aim to support future vaccination strategies in these highly vulnerable patients, including vaccination booster programs and alternative protective approaches.

Also flagged:agingoxygenmechanistic target of rapamycin complex 1mTORC1haematopoiesisdeath
Journal Article 2021-08-26 ✓ 2 Snippets Kadharusman MM, Antarianto RD, Hardiany NS.
In-Text Gene Mentions

…on olfactomedin 4 (Olfm4) levels, a marker…

…35% increase inOlfm4+ primitive intestinal progeni…

Show Full Abstract

Calorie restriction (CR) prolongs lifespan in various species and also minimises pathologies caused by aging. One of the characteristics seen in age-related pathologies is stem cell exhaustion. Here, we review the various impacts of CR on mammalian health mediated through stem cell potency in various tissues. This study comprised of a literature search through NCBI, Science Direct, Google Scholar and PubMed, focusing on the impact of CR on pluripotency. In the skeletal muscle, CR acts as an anti-inflammatory agent and increases the presence of satellite cells endogenously to improve regeneration, thus causing a metabolic shift to oxidation to meet oxygen demand. In the intestinal epithelium, CR suppresses the mechanistic target of rapamycin complex 1 (mTORC1) signalling in Paneth cells to shift the stem cell equilibrium towards self-renewal at the cost of differentiation. In haematopoiesis, CR prevents deterioration or maintains the function of haematopoietic stem cells (HSCs) depending on the genetic variation of the mice. In skin and hair follicles, CR increases the thickness of the epidermis and hair growth and improves hair retention through stem cells. CR mediates the proliferation and self-renewal of stem cells in various tissues, thus increasing its regenerative ability.

Also flagged:Johne's Diseaseparatuberculosischronic enteritisCrohn's diseaseinflammatory bowel diseasepathogenesis
Journal Article 2021-08-26 No Snippets Mallikarjunappa S, Brito LF, Pant SD, Schenkel FS, Meade KG, Karrow NA.
Show Full Abstract

Johne's disease (JD), also known as paratuberculosis, is a severe production-limiting disease with significant economic and welfare implications for the global cattle industry. Caused by infection with <i>Mycobacterium avium</i> subspecies <i>paratuberculosis</i> (MAP), JD manifests as chronic enteritis in infected cattle. In addition to the economic losses and animal welfare issues associated with JD, MAP has attracted public health concerns with potential association with Crohn's disease, a human inflammatory bowel disease. The lack of effective treatment options, such as a vaccine, has hampered JD control resulting in its increasing global prevalence. The disease was first reported in 1895, but in recognition of its growing economic impact, extensive recent research facilitated by a revolution in technological approaches has led to significantly enhanced understanding of the immunological, genetic, and pathogen factors influencing disease pathogenesis. This knowledge has been derived from a variety of diverse models to elucidate host-pathogen interactions including <i>in vivo</i> and <i>in vitro</i> experimental infection models, studies measuring immune parameters in naturally-infected animals, and by studies conducted at the population level to enable the estimation of genetic parameters, and the identification of genetic markers and quantitative trait loci (QTL) putatively associated with susceptibility or resistance to JD. The main objectives of this review are to summarize these recent developments from an immunogenetics perspective and attempt to extract the principal and common findings emerging from this wealth of recent information. Based on these analyses, and in light of emerging technologies such as gene-editing, we conclude by discussing potential future avenues for effectively mitigating JD in cattle.

Also flagged:RetinoblastomaRBocular tumorintellectual disabilityIDdevelopmental delay
Journal Article 2021-08-26 ✓ 3 Snippets Privitera F, Calonaci A, Doddato G, Papa FT, Baldassarri M, Pinto AM, Mari F, Longo I, Caini M, Galimberti D, Hadjistilianou T, De Francesco S, Renieri A, Ariani F.
In-Text Gene Mentions

…PCDH8 , andPCDH17) .…

…(protocadherin 8), andPCDH17(protocadherin 17).…

…PCDH8 , andPCDH17in ID and…

Show Full Abstract

Retinoblastoma (RB) is an ocular tumor of the pediatric age caused by biallelic inactivation of the <i>RB1</i> gene (13q14). About 10% of cases are due to gross-sized molecular deletions. The deletions can involve the surrounding genes delineating a contiguous gene syndrome characterized by RB, developmental anomalies, and peculiar facial dysmorphisms. Overlapping deletions previously found by traditional and/or molecular cytogenetic analysis allowed to define some critical regions for intellectual disability (ID) and multiple congenital anomalies, with key candidate genes. In the present study, using array-CGH, we characterized seven new patients with interstitial 13q deletion involving <i>RB1</i>. Among these cases, three patients with medium or large 13q deletions did not present psychomotor delay. This allowed defining a minimal critical region for ID that excludes the previously suggested candidate genes (<i>HTR2A</i>, <i>NUFIP1</i>, <i>PCDH8</i>, and <i>PCDH17)</i>. The region contains 36 genes including <i>NBEA</i>, which emerged as the candidate gene associated with developmental delay. In addition, <i>MAB21L1</i>, <i>DCLK1</i>, <i>EXOSC8</i>, and <i>SPART</i> haploinsufficiency might contribute to the observed impaired neurodevelopmental phenotype. In conclusion, this study adds important novelties to the 13q deletion syndrome, although further studies are needed to better characterize the contribution of different genes and to understand how the haploinsufficiency of this region can determine ID.

Also flagged:Iron Deficiencyinsulin resistanceIRhigh-sensitivity C-reactive proteinCRPobesity
Journal Article 2021-08-26 ✓ 1 Snippet Slywitch E, Savalli C, Duarte ACG, Escrivão MAMS.
In-Text Gene Mentions

…inflammatory bowel disease,hemochromatosis, cancer with possible…

Show Full Abstract

The objective of this study was to evaluate the serum levels of ferritin and the prevalence of iron deficiency in vegan and omnivorous individuals by taking into account the presence of elements that cause an elevation of ferritin levels, such as increased homeostatic model assessment of insulin resistance (HOMA-IR), body mass index (BMI), and high-sensitivity C-reactive protein (hs-CRP) values. The parameters were evaluated in 1340 individuals, i.e., 422 men and 225 women who do not menstruate and 693 women who do menstruate, based on omnivorous or vegetarian eating habits. The progressive increase in BMI, HOMA-IR, and inflammation caused an elevation in ferritin concentration, regardless of the eating habits in the groups studied. In the overall sample, omnivores had a higher prevalence of obesity, higher ferritin levels, and a lower prevalence of iron deficiency (ferritin < 30 ng/mL). However, after the exclusion of individuals with inflammation (with overweight/obesity and elevated hs-CRP levels), the actual iron deficiency was assessed and was not higher among vegetarians, except in women with regular menstrual cycles. Our data show that nutritional status and inflammation levels affect ferritin levels and may interfere with the correct diagnosis of iron deficiency in both vegetarian and omnivorous individuals. Compared to vegetarians, women who do not menstruate and men had the same prevalence of iron deficiency when following an omnivorous diet.

Also flagged:CoagulationCOVID-19Acute Respiratory Distress SyndromeARDScytokinecoagulopathy
Journal Article 2021-08-26 ✓ 1 Snippet Sehgal T, Gupta N, Kohli S, Khurana A, Dass J, Diwan S, A J M, Khan M, Aggarwal M, Subramanian A.
In-Text Gene Mentions

…Antithrombin (STA® ChromATIII).…

Show Full Abstract

Background Acute respiratory distress syndrome (ARDS) is a frequent complication of COVID-19 and is associated with a component of thrombo-inflammation and cytokine storm. COVID-19 also affects the hemostatic system causing multiple coagulation abnormalities that is a cause of concern and needs to be addressed.  Objective We aimed to assess coagulation parameters of COVID-19 patients and identify whether they could be used as potential prognostic biomarkers to predict ARDS and immediate outcomes. Methods This was a prospective study done on 68 patients at four serial time points. Patients between 18-85 years admitted to the hospital as in-patients and ICU with a confirmed diagnosis of COVID-19 by RT-PCR were included. Exclusion criteria included pregnancy, patients below and above the mentioned age, previously known coagulopathy, systemic anticoagulants or anti-platelet therapy or vitamin K antagonists and moribund patients. Patients were divided into three categories based on SOFA score at admission, presence (group 1) or absence (group 2) of ARDS and outcome (dead or alive). Routine and specialized coagulation tests were performed on patients' platelet-poor plasma at the time of study inclusion (day 0), days 3, 7 and at discharge on STAR Max®3 (Diagnostica Stago France) automated coagulation analyzer and included prothrombin time (PT), international normalized ratio (INR) (STA® -NeoPTimal), activated partial thromboplastin time (APTT) (STA® -Cephascreen), fibrinogen (STA® Liquid Fib), D-dimer (STA® LiatestD- Dimer), Protein C (STA Stachrom® Protein C), Protein S (STA® Latest Free Protein S) and Antithrombin (STA® Chrom ATIII). ELISA did testing for tissue plasminogen activator (Asserachrom® tPA) as per the manufacturer's protocol. Results Sixty-eight patients, including 43 (63%) males and 25 (37%) females, with a median age of 48 years (IQR 20-85), were recruited in this study. The incidence of ARDS was 34%, with a mortality of 13%. History of contact with a COVID-19 case was present in 71% (48/68) of the patients. Fever was the most common presenting symptom in 84% (57/68) of the patients. The most common comorbidities were hypertension and diabetes mellitus (DM) in 22% (15/68) and 21% (14/68) of the patients. DM (p=0.07) and chronic obstructive pulmonary disease (COPD) (p=0.03) were significantly associated with ARDS. DM (p=0.02), hypertension (p=0.01), and COPD (p=0.02) were also significantly associated with mortality. APTT was markedly prolonged among non-survivors at day 0 (D0) and D7 (p=0.03, p=0.02). D-Dimer was elevated in 38/68 (56%) patients at D0. D-Dimer levels were significantly higher in non-survivors (p<0.001), in ARDS patients (p=0.001) and patients with higher SOFA scores (p=0.001). ROC curve showed that D-dimer cut-off > 2.13 (AUC of 0.86) and >0.85 (AUC of 0.74) predicts mortality and ARDS, respectively. Among the natural anticoagulants, protein C was significantly associated with a high SOFA score at D0 and D3 (p=0.04).  Conclusion Diabetes mellitus, hypertension and COPD were associated with poor outcomes. D-dimer levels must be monitored in COVID patients due to their association with ARDS and mortality. We observed that the levels of natural anticoagulants fell during the illness, making them prone to coagulopathies; however, none were seen in this study. Elevated tPA levels were also found in our patients; fibrinolytic therapy may benefit COVID-19 patients suffering from ARDS.

Also flagged:Artesunatemefloquineartemisininmalariaantibodysulfadoxine
Journal Article 2021-08-26 No Snippets Qian J, Wang M, Zhang M, Feng R, Zhang J, Ye C, Wang B, Cui L.
Show Full Abstract

Artesunate-mefloquine is one of the commonly-used artemisinin-based combination therapies (ACTs). Given the significance of drug quality in the management of malaria cases, the objective of this study was to develop antibody-based assays as the point-of-care (POC) tests for monitoring the quality of this ACT. Using mefloquine conjugated to a carrier protein as the immunogen, we selected a specific monoclonal antibody (mAb) against mefloquine with no cross-reactivity to other antimalarial drugs. Using this mAb, we developed a direct competitive enzyme-linked immunosorbent assay (dcELISA) and a lateral flow immunoassay (LFIA) to measure the mefloquine contents. The dcELISA for mefloquine showed a 50% inhibitory concentration (IC<sub>50</sub>) and a working range of 2.79 ng/mL and 0.58-16.37 ng/mL, respectively. With the aid of a portable optical scanner, the LFIA had a working range of 0.15-2.67 µg/mL for mefloquine. When used to measure mefloquine contents in commercial drugs, the dcELISA and LFIA results were compatible with those determined using high-performance liquid chromatography. Using the same LFIA format, we developed a combination LFIA, which correctly estimated the artesunate and mefloquine contents in commercial ACTs. Therefore, both LFIAs could be used as POC devices for rapid quality control of artesunate and mefloquine in ACTs.

Also flagged:poly-amido-saccharidesclotting disordervenous thrombosissynthesissulfatedamido-saccharides
Journal Article 2021-08-26 ✓ 1 Snippet Varghese M, Rokosh RS, Haller CA, Chin SL, Chen J, Dai E, Xiao R, Chaikof EL, Grinstaff MW.
In-Text Gene Mentions

…we assessed theantithrombin-III(AT-III) dependent inhibition…

Show Full Abstract

Anticoagulant therapeutics are a mainstay of modern surgery and of clotting disorder management such as venous thrombosis, yet performance and supply limitations exist for the most widely used agent - heparin. Herein we report the first synthesis, characterization, and performance of sulfated poly-amido-saccharides (sulPASs) as heparin mimetics. sulPASs inhibit the intrinsic pathway of coagulation, specifically FXa and FXIa, as revealed by <i>ex vivo</i> human plasma clotting assays and serine protease inhibition assays. sulPASs activity positively correlates with molecular weight and degree of sulfation. Importantly, sulPASs are not degraded by heparanases and are non-hemolytic. In addition, their activity is reversed by protamine sulfate, unlike small molecule anticoagulants. In an <i>in vivo</i> murine model, sulPASs extend clotting time in a dose dependent manner with bleeding risk comparable to heparin. These findings support continued development of synthetic anticoagulants to address the clinical risks and shortages associated with heparin.

Also flagged:COVID-19-19behavioralARCH
Journal Article 2021-08-26 No Snippets Park BJ.
Show Full Abstract

This paper contributes to the literature on the coronavirus (COVID-19) pandemic impacts on the Bitcoin futures (BTCF) market and to the ongoing consideration of the dynamic relationship between volatility (or returns) and trading behavior variables, such as volume and open interest as a proxy for belief dispersion. This paper focuses on the role of the unprecedented market stress induced by the COVID-19 pandemic in the interrelations among the variables. Accordingly, this paper proposes a structural change (SC)-VAR-MGARCH model and finds the COVID-19 pandemic has initiated a significant regime change. Furthermore, the relationship between the variables in the pre-pandemic regime is notably unclear, whereas an increase in belief dispersion in the pandemic regime due to market stress reduces BTCF returns but raises trading volume and volatility evidently. The outcomes in the pandemic regime are remarkably consistent with the difference of opinions model, though existing evidence on the dynamic relations is ambiguous. Moreover, the outcomes support our hypothesis that, in addition to information flows, market stress causing traders' behavioral biases should be considered as one of the crucial factors of tremendous price variability.

Also flagged:renal agenesisRAaplasiaBilateral renal agenesiscongenital anomalies of the kidney and urogenital tractCAKUT
Journal Article 2021-08-26 No Snippets Kalantari S, Filges I.
Show Full Abstract

Uni- or bilateral renal agenesis (RA) is a commonly occurring major congenital anomaly impacting fetal and neonatal outcomes. Since the etiology is highly heterogeneous, our aim was to provide a logically structured approach by highlighting the genes in which variants have been identified to be associated with RA and to define the pathways involved in this type of abnormal kidney development. We used Phenolyzer to collect a list of all the genes known as causative for RA. Using ClueGO gene enrichment analysis, we classified the relationship between these genes and the biological processes defined by gene ontology. We identified 287 genes and 69 groups of enriched biological processes. About 50% included pathways directly related to the development of urogenital organ tissues. Several ciliary, axis specification, hindgut development, and endocrine pathways were enriched, which may relate to different clinical presentations of RA. Our gene ontology enrichment analysis shows that genes representing distinct biological pathways are significantly enriched. This knowledge will lead to an improved molecular diagnosis in clinical care when applying genome-wide sequencing approaches. The findings will also allow to further study the biological pathways involved in RA and to identify novel candidate genes and pathways.

Also flagged:RAScancerscancerautophagymacropinocytosisglutamine
Journal Article 2021-08-26 No Snippets DeLiberty JM, Robb R, Gates CE, Bryant KL.
Show Full Abstract

RAS mutations are among the most frequent oncogenic drivers observed in human cancers. With a lack of available treatment options, RAS-mutant cancers account for many of the deadliest cancers in the United States. Recent studies established that altered metabolic requirements are a hallmark of cancer, and many of these alterations are driven by aberrant RAS signaling. Specifically, RAS-driven cancers are characterized by upregulated glycolysis, the differential channeling of glycolytic intermediates, upregulated nutrient scavenging pathways such as autophagy and macropinocytosis, and altered glutamine utilization and mitochondrial function. This unique metabolic landscape promotes tumorigenesis, proliferation, survival in nutrient deficient environments and confers resistance to conventional cytotoxic and targeted therapies. Emerging work demonstrates how these dependencies can be therapeutically exploited in vitro and in vivo with many metabolic inhibitors currently in clinical trials. This review aims to outline the unique metabolic requirements induced by aberrant RAS signaling and how these altered dependencies present opportunities for therapeutic intervention.

bioRxiv 2021-08-26 Preprint (No Snippets API) Mahadik SS, Lundquist EA.
Show Full Abstract

UNC-6/Netrin is a secreted conserved guidance cue that regulates dorsal-ventral axon guidance of C. elegans and in the vertebral spinal cord. In the polarity/protrusion model of VD growth cone guidance away from ventrally-expressed UNC-6 (repulsion), UNC-6 first polarizes the growth cone via the UNC-5 receptor such that filopodial protrusions are biased dorsally. UNC-6 then regulates a balance of protrusion in the growth cone based upon this polarity. UNC-5 inhibits protrusion ventrally, and the UNC-6 receptor UNC-40/DCC stimulates protrusion dorsally, resulting in net dorsal growth cone outgrowth. UNC-5 inhibits protrusion through the flavin monooxygenases FMO-1, 4, and 5 and possible actin destabilization, and inhibits pro-protrusive microtubule entry into the growth cone utilizing UNC-33/CRMP. The PH/MyTH4/FERM myosin-like protein was previously shown to act with UNC-5 in VD axon guidance utilizing axon guidance endpoint analysis. Here, we analyzed the effects of MAX-1 on VD growth cone morphology during outgrowth. We found that max-1 mutant growth cones were smaller and less protrusive than wild-type, the opposite of the unc-5 mutant phenotype. Furthermore, genetic interactions suggest that MAX-1 might normally inhibit UNC-5 activity, such that in a max-1 mutant growth cone, UNC-5 is overactive. Our results, combined with previous studies suggesting that MAX-1 might regulate UNC-5 levels in the cell or plasma membrane localization, suggest that MAX-1 attenuates UNC-5 signaling by regulating UNC-5 stability or trafficking. In summary, in the context of growth cone protrusion, MAX-1 inhibits UNC-5, demonstrating the mechanistic insight that can be gained by analyzing growth cones during outgrowth in addition to axon guidance endpoint analysis.

Also flagged:nuclear porechromatingene expressionorganizationneurogenesisneurological disorders
Journal Article 2021-08-25 No Snippets Colussi C, Grassi C.
Show Full Abstract

Nucleoporins (Nups) are components of the nuclear pore complex that, besides regulating nucleus-cytoplasmic transport, emerged as a hub for chromatin interaction and gene expression modulation. Specifically, Nups act in a dynamic manner both at specific gene level and in the topological organization of chromatin domains. As such, they play a fundamental role during development and determination of stemness/differentiation balance in stem cells. An increasing number of reports indicate the implication of Nups in many central nervous system functions with great impact on neurogenesis, neurophysiology, and neurological disorders. Nevertheless, the role of Nup-mediated epigenetic regulation in embryonic and adult neural stem cells (NSCs) is a field largely unexplored and the comprehension of their mechanisms of action is only beginning to be unveiled. After a brief overview of epigenetic mechanisms, we will present and discuss the emerging role of Nups as new effectors of neuroepigenetics and as dynamic platform for chromatin function with specific reference to the biology of NSCs.

Selective autophagy.

Also flagged:autophagyautophagosomesorganellesubiquitinproteasomedegradation
Journal Article 2021-08-25 No Snippets Faruk MO, Ichimura Y, Komatsu M.
Show Full Abstract

While starvation-induced autophagy is thought to randomly degrade cellular components, under certain circumstances autophagy selectively recognizes, sequesters, and degrades specific targets via autophagosomes. This process is called selective autophagy, and it contributes to cellular homeostasis by degrading specific soluble proteins, supramolecular complexes, liquid-liquid phase-separated droplets, abnormal or excess organelles, and pathogenic invasive bacteria. This means that autophagy, like the ubiquitin-proteasome system, strictly regulates diverse cellular functions through its selectivity. In this short review, we focus on the mechanism of "selective" autophagy, which is rapidly being elucidated.

Also flagged:e64HPOdefectsTWIST1INSchromosomes
Journal Article 2021-08-25 ✓ 4 Snippets Hyder Z, Calpena E, Pei Y, Tooze RS, Brittain H, Twigg SRF, Cilliers D, Morton JEV, McCann E, Weber A, Wilson LC, Douglas AGL, McGowan R, Need A, Bond A, Tavares ALT, Thomas ERA, Genomics England Research Consortium, Hill SL, Deans ZC, Boardman-Pretty F, Caulfield M, Scott RH, Wilkie AOM.
In-Text Gene Mentions

SOX6

…All genes exceptSOX6(which we distinguish…

…, PTCH1 ,SOX6, TRAF7 )…

…SMAD6 18 ,SOX628 and ERF…

Show Full Abstract

<h4>Purpose</h4>Genome sequencing (GS) for diagnosis of rare genetic disease is being introduced into the clinic, but the complexity of the data poses challenges for developing pipelines with high diagnostic sensitivity. We evaluated the performance of the Genomics England 100,000 Genomes Project (100kGP) panel-based pipelines, using craniosynostosis as a test disease.<h4>Methods</h4>GS data from 114 probands with craniosynostosis and their relatives (314 samples), negative on routine genetic testing, were scrutinized by a specialized research team, and diagnoses compared with those made by 100kGP.<h4>Results</h4>Sixteen likely pathogenic/pathogenic variants were identified by 100kGP. Eighteen additional likely pathogenic/pathogenic variants were identified by the research team, indicating that for craniosynostosis, 100kGP panels had a diagnostic sensitivity of only 47%. Measures that could have augmented diagnoses were improved calling of existing panel genes (+18% sensitivity), review of updated panels (+12%), comprehensive analysis of de novo small variants (+29%), and copy-number/structural variants (+9%). Recent NHS England recommendations that partially incorporate these measures should achieve 85% overall sensitivity (+38%).<h4>Conclusion</h4>GS identified likely pathogenic/pathogenic variants in 29.8% of previously undiagnosed patients with craniosynostosis. This demonstrates the value of research analysis and the importance of continually improving algorithms to maximize the potential of clinical GS.

Also flagged:organizationtissue homeostasisdevelopmental disordersagingsecretionmucin
Journal Article 2021-08-25 No Snippets Capdevila C, Trifas M, Miller J, Anderson T, Sims PA, Yan KS.
Show Full Abstract

Knowledge of the development and hierarchical organization of tissues is key to understanding how they are perturbed in injury and disease, as well as how they may be therapeutically manipulated to restore homeostasis. The rapidly regenerating intestinal epithelium harbors diverse cell types and their lineage relationships have been studied using numerous approaches, from classical label-retaining and genetic lineage tracing methods to novel transcriptome-based annotations. Here, we describe the developmental trajectories that dictate differentiation and lineage specification in the intestinal epithelium. We focus on the most recent single-cell RNA-sequencing (scRNA-seq)-based strategies for understanding intestinal epithelial cell lineage relationships, underscoring how they have refined our view of the development of this tissue and highlighting their advantages and limitations. We emphasize how these technologies have been applied to understand the dynamics of intestinal epithelial cells in homeostatic and injury-induced regeneration models.

Also flagged:geriatric syndromecardiovascular diseaseHLAdepressionneuroticismageing
Journal Article 2021-08-25 ✓ 3 Snippets Atkins JL, Jylhävä J, Pedersen NL, Magnusson PK, Lu Y, Wang Y, Hägg S, Melzer D, Williams DM, Pilling LC.
In-Text Gene Mentions

The main genes associated with several of the lead SNPs are linked directly to neuronal function, including ANK3 (Ankyrin 3) which is a scaffold protein involved in neurotransmission with links to bipolar disorder and Alzheimer's disease (Hori et al., 2014) (Franceschi et al., 2018), NLGN1 (Neuroligin 1), a synapse cell‐surface protein implicated in autism spectrum disorder (Bottos et al., 2011), HTT (Huntingtin), linked to Huntington's disease and may have a role in vesicle formation in autophagy, and SYT14 (Synaptotagmin 14), which mediates membrane trafficking in synaptic transmission, and mutations in this gene cause spinocerebellar ataxia(Doi et al., 2011).

…rs82334 (nearest geneHTT) .…

…al., 2011 ),HTT(Huntingtin), linked to…

Show Full Abstract

Frailty is a common geriatric syndrome and strongly associated with disability, mortality and hospitalization. Frailty is commonly measured using the frailty index (FI), based on the accumulation of a number of health deficits during the life course. The mechanisms underlying FI are multifactorial and not well understood, but a genetic basis has been suggested with heritability estimates between 30 and 45%. Understanding the genetic determinants and biological mechanisms underpinning FI may help to delay or even prevent frailty. We performed a genome-wide association study (GWAS) meta-analysis of a frailty index in European descent UK Biobank participants (n = 164,610, 60-70 years) and Swedish TwinGene participants (n = 10,616, 41-87 years). FI calculation was based on 49 or 44 self-reported items on symptoms, disabilities and diagnosed diseases for UK Biobank and TwinGene, respectively. 14 loci were associated with the FI (p < 5*10<sup>-8</sup> ). Many FI-associated loci have established associations with traits such as body mass index, cardiovascular disease, smoking, HLA proteins, depression and neuroticism; however, one appears to be novel. The estimated single nucleotide polymorphism (SNP) heritability of the FI was 11% (0.11, SE 0.005). In enrichment analysis, genes expressed in the frontal cortex and hippocampus were significantly downregulated (adjusted p < 0.05). We also used Mendelian randomization to identify modifiable traits and exposures that may affect frailty risk, with a higher educational attainment genetic risk score being associated with a lower degree of frailty. Risk of frailty is influenced by many genetic factors, including well-known disease risk factors and mental health, with particular emphasis on pathways in the brain.

Also flagged:gene expressionneurodegenerative diseasechronic complex diseaseschronic diseasespathogenesisHD
Journal Article 2021-08-25 ✓ 2 Snippets Jiang X, Pan W, Chen M, Wang W, Song W, Lin GN.
In-Text Gene Mentions

Huntington’s disease (HD) is a representative neurodegenerative disease, caused by excessive triplet (CAG) repeat located in huntingtin (HTT) gene on chromosome 4 that codes for polyglutamine in the huntingtin protein [1].

…located in huntingtin (HTT) gene on chromosome…

Show Full Abstract

<h4>Background</h4>Huntington's disease is a kind of chronic progressive neurodegenerative disease with complex pathogenic mechanisms. To data, the pathogenesis of Huntington's disease is still not fully understood, and there has been no effective treatment. The rapid development of high-throughput sequencing technologies makes it possible to explore the molecular mechanisms at the transcriptome level. Our previous studies on Huntington's disease have shown that it is difficult to distinguish disease-associated genes from non-disease genes. Meanwhile, recent progress in bio-medicine shows that the molecular origin of chronic complex diseases may not exist in the diseased tissue, and differentially expressed genes between different tissues may be helpful to reveal the molecular origin of chronic diseases. Therefore, developing integrative analysis computational methods for the multi-tissues gene expression data, exploring the relationship between differentially expressed genes in different tissues and the disease, can greatly accelerate the molecular discovery process.<h4>Methods</h4>For analysis of the intra- and inter- tissues' differentially expressed genes, we designed an integrative enrichment analysis method based on an artificial neuron (IEAAN). Firstly, we calculated the differential expression scores of genes which are seen as features of the corresponding gene, using fold-change approach with intra- and inter- tissues' gene expression data. Then, we weighted sum all the differential expression scores through a sigmoid function to get differential expression enrichment score. Finally, we ranked the genes according to the enrichment score. Top ranking genes are supposed to be the potential disease-associated genes.<h4>Results</h4>In this study, we conducted large amounts of experiments to analyze the differentially expressed genes of intra- and inter- tissues. Experimental results showed that genes differentially expressed between different tissues are more likely to be Huntington's disease-associated genes. Five disease-associated genes were selected out in this study, two of which have been reported to be implicated in Huntington's disease.<h4>Conclusions</h4>We proposed a novel integrative enrichment analysis method based on artificial neuron (IEAAN), which displays better prediction precision of disease-associated genes in comparison with the state-of-the-art statistical-based methods. Our comprehensive evaluation suggests that genes differentially expressed between striatum and liver tissues of health individuals are more likely to be Huntington's disease-associated genes.

Also flagged:MCPATACTNFATF3Bach2Fra1
Journal Article 2021-08-25 No Snippets Ge X, Frank-Bertoncelj M, Klein K, McGovern A, Kuret T, Houtman M, Burja B, Micheroli R, Shi C, Marks M, Filer A, Buckley CD, Orozco G, Distler O, Morris AP, Martin P, Eyre S, Ospelt C.
Show Full Abstract

<h4>Background</h4>Genome-wide association studies have reported more than 100 risk loci for rheumatoid arthritis (RA). These loci are shown to be enriched in immune cell-specific enhancers, but the analysis so far has excluded stromal cells, such as synovial fibroblasts (FLS), despite their crucial involvement in the pathogenesis of RA. Here we integrate DNA architecture, 3D chromatin interactions, DNA accessibility, and gene expression in FLS, B cells, and T cells with genetic fine mapping of RA loci.<h4>Results</h4>We identify putative causal variants, enhancers, genes, and cell types for 30-60% of RA loci and demonstrate that FLS account for up to 24% of RA heritability. TNF stimulation of FLS alters the organization of topologically associating domains, chromatin state, and the expression of putative causal genes such as TNFAIP3 and IFNAR1. Several putative causal genes constitute RA-relevant functional networks in FLS with roles in cellular proliferation and activation. Finally, we demonstrate that risk variants can have joint-specific effects on target gene expression in RA FLS, which may contribute to the development of the characteristic pattern of joint involvement in RA.<h4>Conclusion</h4>Overall, our research provides the first direct evidence for a causal role of FLS in the genetic susceptibility for RA accounting for up to a quarter of RA heritability.

Also flagged:CSF1RTenosynovial Giant Cell Tumorsinflammatory diseasesColony-stimulating factor 1 receptorcancerangiogenesis
Journal Article 2021-08-25 No Snippets Smith BD, Kaufman MD, Wise SC, Ahn YM, Caldwell TM, Leary CB, Lu WP, Tan G, Vogeti L, Vogeti S, Wilky BA, Davis LE, Sharma M, Ruiz-Soto R, Flynn DL.
Show Full Abstract

Macrophages can be co-opted to contribute to neoplastic, neurologic, and inflammatory diseases. Colony-stimulating factor 1 receptor (CSF1R)-dependent macrophages and other inflammatory cells can suppress the adaptive immune system in cancer and contribute to angiogenesis, tumor growth, and metastasis. CSF1R-expressing osteoclasts mediate bone degradation in osteolytic cancers and cancers that metastasize to bone. In the rare disease tenosynovial giant cell tumor (TGCT), aberrant CSF1 expression and production driven by a gene translocation leads to the recruitment and growth of tumors formed by CSF1R-dependent inflammatory cells. Small molecules and antibodies targeting the CSF1/CSF1R axis have shown promise in the treatment of TGCT and cancer, with pexidartinib recently receiving FDA approval for treatment of TGCT. Many small-molecule kinase inhibitors of CSF1R also inhibit the closely related kinases KIT, PDGFRA, PDGFRB, and FLT3, thus CSF1R suppression may be limited by off-target activity and associated adverse events. Vimseltinib (DCC-3014) is an oral, switch control tyrosine kinase inhibitor specifically designed to selectively and potently inhibit CSF1R by exploiting unique features of the switch control region that regulates kinase conformational activation. In preclinical studies, vimseltinib durably suppressed CSF1R activity <i>in vitro</i> and <i>in vivo</i>, depleted macrophages and other CSF1R-dependent cells, and resulted in inhibition of tumor growth and bone degradation in mouse cancer models. Translationally, in a phase I clinical study, vimseltinib treatment led to modulation of biomarkers of CSF1R inhibition and reduction in tumor burden in TGCT patients.

Also flagged:Thrombotic diseasesplatelet aggregationjusticidin DF2MMP9CXCL12
Journal Article 2021-08-25 No Snippets Hong Z, Zhang T, Zhang Y, Xie Z, Lu Y, Yao Y, Yang Y, Wu H, Liu B.
Show Full Abstract

Thrombotic diseases seriously threaten human life. Justicia, as a common Chinese medicine, is usually used for anti-inflammatory treatment, and further studies have found that it has an inhibitory effect on platelet aggregation. Therefore, it can be inferred that Justicia can be used as a therapeutic drug for thrombosis. This work aims to reveal the pharmacological mechanism of the anti-thrombotic effect of Justicia through network pharmacology combined with wet experimental verification. During the analysis, 461 compound targets were predicted from various databases and 881 thrombus-related targets were collected. Then, herb-compound-target network and protein-protein interaction network of disease and prediction targets were constructed and cluster analysis was applied to further explore the connection between the targets. In addition, Gene Ontology (GO) and pathway (KEGG) enrichment were used to further determine the association between target proteins and diseases. Finally, the expression of hub target proteins of the core component and the anti-thrombotic effect of Justicia's core compounds were verified by experiments. In conclusion, the core bioactive components, especially justicidin D, can reduce thrombosis by regulating F2, MMP9, CXCL12, MET, RAC1, PDE5A, and ABCB1. The combination of network pharmacology and the experimental research strategies proposed in this paper provides a comprehensive method for systematically exploring the therapeutic mechanism of multi-component medicine.

Also flagged:osteoporosiscell differentiationactivationhistoneSoxTrio
Journal Article 2021-08-25 ✓ 2 Snippets Truong VA, Lin YH, Nguyen NTK, Hsu MN, Pham NN, Chang YH, Chang CW, Shen CC, Lee HS, Lai PL, Parfyonova YV, Menshikov M, Wu JC, Chang YH, Hu YC.
In-Text Gene Mentions

…( Sox5 ,Sox6, Sox9 )…

Sox6

Show Full Abstract

Calvarial bone healing is challenging, especially for individuals with osteoporosis because stem cells from osteoporotic patients are highly prone to adipogenic differentiation. Based on previous findings that chondrogenic induction of adipose-derived stem cells (ASCs) can augment calvarial bone healing, we hypothesized that activating chondroinductive Sox Trio genes (Sox5, Sox6, Sox9) and repressing adipoinductive genes (C/ebp-α, Ppar-γ) in osteoporotic ASCs can reprogram cell differentiation and improve calvarial bone healing after implantation. However, simultaneous gene activation and repression in ASCs is difficult. To tackle this problem, we built a CRISPR-BiD system for bi-directional gene regulation. Specifically, we built a CRISPR-AceTran system that exploited both histone acetylation and transcription activation for synergistic Sox Trio activation. We also developed a CRISPR interference (CRISPRi) system that exploited DNA methylation for repression of adipoinductive genes. We combined CRISPR-AceTran and CRISPRi to form the CRISPR-BiD system, which harnessed three mechanisms (transcription activation, histone acetylation, and DNA methylation). After delivery into osteoporotic rat ASCs, CRISPR-BiD significantly enhanced chondrogenesis and in vitro cartilage formation. Implantation of the engineered osteoporotic ASCs into critical-sized calvarial bone defects significantly improved bone healing in osteoporotic rats. These results implicated the potential of the CRISPR-BiD system for bi-directional regulation of cell fate and regenerative medicine.

Also flagged:Acute lymphoblastic leukemiaALLcancerdeathIKZF1Ph
Journal Article 2021-08-25 ✓ 1 Snippet Iacobucci I, Kimura S, Mullighan CG.
In-Text Gene Mentions

…rearrangements, PICALM -MLLT10, SET -…

Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most successful paradigm of how risk-adapted therapy and detailed understanding of the genetic alterations driving leukemogenesis and therapeutic response may dramatically improve treatment outcomes, with cure rates now exceeding 90% in children. However, ALL still represents a leading cause of cancer-related death in the young, and the outcome for older adolescents and young adults with ALL remains poor. In the past decade, next generation sequencing has enabled critical advances in our understanding of leukemogenesis. These include the identification of risk-associated ALL subtypes (e.g., those with rearrangements of <i>MEF2D</i>, <i>DUX4</i>, <i>NUTM1</i>, <i>ZNF384</i> and <i>BCL11B</i>; the PAX5 P80R and IKZF1 N159Y mutations; and genomic phenocopies such as Ph-like ALL) and the genomic basis of disease evolution. These advances have been complemented by the development of novel therapeutic approaches, including those that are of mutation-specific, such as tyrosine kinase inhibitors, and those that are mutation-agnostic, including antibody and cellular immunotherapies, and protein degradation strategies such as proteolysis-targeting chimeras. Herein, we review the genetic taxonomy of ALL with a focus on clinical implications and the implementation of genomic diagnostic approaches.

Also flagged:acute myocardial infarctionheart failuredeathCircularcell proliferationoxygen
Journal Article 2021-08-25 No Snippets Schweiger V, Hasimbegovic E, Kastner N, Spannbauer A, Traxler D, Gyöngyösi M, Mester-Tonczar J.
Show Full Abstract

Although advances in rapid revascularization strategies following acute myocardial infarction (AMI) have led to improved short and long-term outcomes, the associated loss of cardiomyocytes and the subsequent remodeling result in an impaired ventricular function that can lead to heart failure or death. The poor regenerative capacity of the myocardium and the current lack of effective regenerative therapies have driven stem cell research in search of a possible solution. One approach involves the delivery of stem cells to the site of injury in order to stimulate repair response. Although animal studies initially delivered promising results, the application of similar techniques in humans has been hampered by poor target site retention and oncogenic considerations. In response, several alternative strategies, including the use of non-coding RNAs (ncRNAs), have been introduced with the aim of activating and regulating stem cells or inducing stem cell status in resident cells. Circular RNAs (circRNAs) and microRNAs (miRNAs) are ncRNAs with pivotal functions in cell proliferation and differentiation, whose role in stem cell regulation and potential significance for the field of cardiac regeneration is the primary focus of this review. We also address the general advantages of ncRNAs as promising drivers of cardiac regeneration and potent stem cell regulators.

Also flagged:ATG101DegradationHUWE1UbiquitinationAutophagyprotein kinase Unc-51-like kinase 1
Journal Article 2021-08-25 ✓ 2 Snippets Lee J, Kim J, Shin J, Kang Y, Choi J, Cheong H.
In-Text Gene Mentions

…protein p32, and Cul3-KLHL20ubiquitin ligase.…

…For instance, the Cul3-KLHL20complex ubiquitinates phosphor…

Show Full Abstract

Autophagy is a critical cytoprotective mechanism against stress, which is initiated by the protein kinase Unc-51-like kinase 1 (ULK1) complex. Autophagy plays a role in both inhibiting the progression of diseases and facilitating pathogenesis, so it is critical to elucidate the mechanisms regulating individual components of the autophagy machinery under various conditions. Here, we examined whether ULK1 complex component autophagy-related protein 101 (ATG101) is downregulated via ubiquitination, and whether this in turn suppresses autophagy activity in cancer cells. Knockout of ATG101 in cancer cells using CRISPR resulted in severe growth retardation and lower survival under nutrient starvation. Transfection of mutant ATG101 revealed that the C-terminal region is a key domain of ubiquitination, while co-immunoprecipitation and knockdown experiments revealed that HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1(HUWE1) is a major E3 ubiquitin ligase targeting ATG101. Protein levels of ATG101 was more stable and the related-autophagy activity was higher in HUWE1-depleted cancer cells compared to wild type (WT) controls, indicating that HUWE1-mediated ubiquitination promotes ATG101 degradation. Moreover, enhanced autophagy in HUWE1-depleted cancer cells was reversed by siRNA-mediated ATG101 knockdown. Stable ATG101 level in HUWE1-depleted cells was a strong driver of autophagosome formation similar to upregulation of the known HUWE1 substrate WD repeat domain, phosphoinositide interacting 2 (WIPI2). Cellular survival rates were higher in HUWE1-knockdown cancer cells compared to controls, while concomitant siRNA-mediated ATG101 knockdown tends to increase apoptosis rate. Collectively, these results suggest that HUWE1 normally serves to suppress autophagy by ubiquitinating and triggering degradation of ATG101 and WIPI2, which in turn represses the survival of cancer cells. Accordingly, ATG101-mediated autophagy may play a critical role in overcoming metabolic stress, thereby contributing to the growth, survival, and treatment resistance of certain cancers.

Also flagged:SphingolipidBenzo[a]pyreneSphingolipidsglycosphingolipidseicosanoidscancer
Journal Article 2021-08-25 ✓ 1 Snippet Machala M, Slavík J, Kováč O, Procházková J, Pěnčíková K, Pařenicová M, Straková N, Kotouček J, Kulich P, Mollerup S, Vondráček J, Hýžďalová M.
In-Text Gene Mentions

…and LacCer synthaseB4GALT5, as well as…

Show Full Abstract

Sphingolipids (SLs), glycosphingolipids (GSLs), and eicosanoids are bioactive lipids, which play important roles in the etiology of various diseases, including cancer. However, their content and roles in cancer cells, and in particular in the exosomes derived from tumor cells, remain insufficiently characterized. In this study, we evaluated alterations of SL and GSL levels in transformed cells and their exosomes, using comparative HPLC-MS/MS analysis of parental human bronchial epithelial cells HBEC-12KT and their derivative, benzo[a]pyrene-transformed HBEC-12KT-B1 cells with the acquired mesenchymal phenotype. We examined in parallel SL/GSL contents in the exosomes released from both cell lines. We found significant alterations of the SL/GSL profile in the transformed cell line, which corresponded well with alterations of the SL/GSL profile in exosomes derived from these cells. This suggested that a majority of SLs and GSLs were transported by exosomes in the same relative pattern as in the cells of origin. The only exceptions included decreased contents of sphingosin, sphingosin-1-phosphate, and lactosylceramide in exosomes derived from the transformed cells, as compared with the exosomes derived from the parental cell line. Importantly, we found increased levels of ceramide phosphate, globoside Gb3, and ganglioside GD3 in the exosomes derived from the transformed cells. These positive modulators of epithelial-mesenchymal transition and other pro-carcinogenic processes might thus also contribute to cancer progression in recipient cells. In addition, the transformed HBEC-12KT-B1 cells also produced increased amounts of eicosanoids, in particular prostaglandin E2. Taken together, the exosomes derived from the transformed cells with specifically upregulated SL and GSL species, and increased levels of eicosanoids, might contribute to changes within the cancer microenvironment and in recipient cells, which could in turn participate in cancer development. Future studies should address specific roles of individual SL and GSL species identified in the present study.

Also flagged:oxygenangiogenesistumorvascular disorderstranscription factorshypoxia inducible factors
Journal Article 2021-08-25 No Snippets Rodriguez D, Watts D, Gaete D, Sormendi S, Wielockx B.
Show Full Abstract

Every cell in the body requires oxygen for its functioning, in virtually every animal, and a tightly regulated system that balances oxygen supply and demand is therefore fundamental. The vascular network is one of the first systems to sense oxygen, and deprived oxygen (hypoxia) conditions automatically lead to a cascade of cellular signals that serve to circumvent the negative effects of hypoxia, such as angiogenesis associated with inflammation, tumor development, or vascular disorders. This vascular signaling is driven by central transcription factors, namely the hypoxia inducible factors (HIFs), which determine the expression of a growing number of genes in endothelial cells and pericytes. HIF functions are tightly regulated by oxygen sensors known as the HIF-prolyl hydroxylase domain proteins (PHDs), which are enzymes that hydroxylate HIFs for eventual proteasomal degradation. HIFs, as well as PHDs, represent attractive therapeutic targets under various pathological settings, including those involving vascular (dys)function. We focus on the characteristics and mechanisms by which vascular cells respond to hypoxia under a variety of conditions.

Also flagged:FBXW7Neurodegenerationubiquitinproteasomeprotein degradationhomeostasis
Journal Article 2021-08-25 ✓ 1 Snippet Yang Y, Zhou X, Liu X, Song R, Gao Y, Wang S.
In-Text Gene Mentions

Huntington’s disease (HD) is an inherited autosomal dominant neurodegenerative disorder caused by accumulated mutant Huntingtin (Htt) protein with a poly-glutamine expansion (encoded by CAG trinucleotide repeat) (Ross and Tabrizi, 2011).

Show Full Abstract

The ubiquitin-proteasome system (UPS) mediated protein degradation is crucial to maintain quantitive and functional homeostasis of diverse proteins. Balanced cellular protein homeostasis controlled by UPS is fundamental to normal neurological functions while impairment of UPS can also lead to some neurodevelopmental and neurodegenerative disorders. Functioning as the substrate recognition component of the SCF-type E3 ubiquitin ligase, FBXW7 is essential to multiple aspects of cellular processes via targeting a wide range of substrates for proteasome-mediated degradation. Accumulated evidence shows that FBXW7 is fundamental to neurological functions and especially implicated in neurodevelopment and the nosogenesis of neurodegeneration. In this review, we describe general features of FBXW7 gene and proteins, and mainly present recent findings that highlight the vital roles and molecular mechanisms of FBXW7 in neurodevelopment such as neurogenesis, myelination and cerebral vasculogenesis and in the pathogenesis of some typical neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and Huntington's disease. Additionally, we also provide a prospect on focusing FBXW7 as a potential therapeutic target to rescue neurodevelopmental and neurodegenerative impairment.

Also flagged:regulation ofgene expressionmuscle diseasesmyopathieslipidglucose
Journal Article 2021-08-25 No Snippets Reed KM, Mendoza KM, Abrahante JE, Velleman SG, Strasburg GM.
Show Full Abstract

Precise regulation of gene expression is critical for normal muscle growth and development. Changes in gene expression patterns caused by external stressors such as temperature can have dramatic effects including altered cellular structure and function. Understanding the cellular mechanisms that underlie muscle growth and development and how these are altered by external stressors are crucial in maintaining and improving meat quality. This study investigated circular RNAs (circRNAs) as an emerging aspect of gene regulation. We used data mining to identify circRNAs and characterize their expression profiles within RNAseq data collected from thermally challenged turkey poults of the RBC2 and F-lines. From sequences of 28 paired-end libraries, 8924 unique circRNAs were predicted of which 1629 were common to all treatment groups. Expression analysis identified significant differentially expressed circRNAs (DECs) in comparisons between thermal treatments (41 DECs) and between genetic lines (117 DECs). No intersection was observed between the DECs and differentially expressed gene transcripts indicating that the DECs are not simply the result of expression changes in the parental genes. Comparative analyses based on the chicken microRNA (miRNA) database suggest potential interactions between turkey circRNAs and miRNAs. Additional studies are needed to reveal the functional significance of the predicted circRNAs and their role in muscle development in response to thermal challenge. The DECs identified in this study provide an important framework for future investigation.

Also flagged:dementianeurocognitive disordersAlzheimer's diseaseLewy bodyfrontotemporal dementiasecondary
Journal Article 2021-08-25 No Snippets Tsolaki M, Tsatali M, Gkioka M, Poptsi E, Tsolaki A, Papaliagkas V, Tabakis IM, Lazarou I, Makri M, Kazis D, Papagiannopoulos S, Kiryttopoulos A, Koutsouraki E, Tegos T.
Show Full Abstract

<b>Background:</b> This review describes the diagnostic and interventional procedures conducted in two university memory clinics (established network of G. Papanikolaou Hospital: 1988-2017 and AHEPA hospital: 2017-today) and 2 day care centers (established network of DCCs: 2005-today) in North Greece and their contribution in the scientific field of dementia. The aims of this work are (1) to provide a diagnosis and treatment protocol established in the network of memory clinics and DCCs and (2) to present further research conducted in the aforementioned network during the last 30 years of clinical practice. <b>Methods:</b> The guidelines to set a protocol demand a series of actions as follows: (1) set the diagnosis criteria, neuropsychological assessment, laboratory examinations, and examination of neurophysiological, neuroimaging, cerebrospinal fluid, blood, and genetic markers; and (2) apply non-pharmacological interventions according to the needs and specialized psychosocial interventions of the patient to the caregivers of the patient. <b>Results:</b> In addition to the guidelines followed in memory clinics at the 1st and 3rd Department of Neurology and two DCCs, a database of patients, educational programs, and further participation in international research programs, including clinical trials, make our contribution in the dementia field strong. <b>Conclusion:</b> In the current paper, we provide useful guidelines on how major and minor neurocognitive disorders are being treated in Thessaloniki, Greece, describing successful practices which have been adapted in the last 30 years.

Also flagged:cancerLunHEKHELGFPDTD
Journal Article 2021-08-25 No Snippets Ravula V, Lo YL, Wang LF, Patri SV.
Show Full Abstract

Cationic gemini lipopeptides are a relatively new class of amphiphilic compounds to be used for gene delivery. Through the possibility of incorporating short peptides with cell-penetrating functionalities, these lipopeptides may be advantageous over traditional cationic lipids. Herein, we report the design, synthesis, and application of a novel cationic gemini lipopeptide for gene delivery. An ultrashort peptide, containing four amino acids, arginine-cysteine-cysteine-arginine, serves as a cationic head group, and two α-tocopherol moieties act as hydrophobic anchoring groups. The new lipopeptide (ATTA) is incorporated into the conventional liposomes, containing 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) and 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), at different molar ratios. The formulated liposomes are characterized and screened for better transfection efficiency. Transfection activity in multiple human cell lines from cancerous and noncancerous origins indicates that the inclusion of an optimal ratio of ATTA in the liposomes substantially enhances the transfection efficiency, superior to that of a traditional liposome, DOTAP-DOPE. Cytotoxicity of ATTA-containing formulations against multiple cell lines indicates potentially distinct activity between cancer and noncancer cell lines. Furthermore, lipoplexes of the ATTA-containing formulations with anticancer therapeutic gene, plasmid encoding tumor necrosis factor-related apoptosis-inducing ligand (pTRAIL), induce obviously more cytotoxicity than conventional formulations. The results indicate that arginine-rich cationic lipopeptide appears to be a promising ingredient in gene delivery vector formulations to enhance transfection efficiency and cell-selective cytotoxicity.

Also flagged:Scaffold attachment factor B1degradationnuclear matrix protein Scaffold Attachment Factor B1prostate cancerPCaandrogen receptor
Journal Article 2021-08-25 No Snippets Yang JS, Qian C, You S, Rotinen M, Posadas EM, Freedland SJ, Di Vizio D, Kim J, Freeman MR.
Show Full Abstract

The nuclear matrix protein Scaffold Attachment Factor B1 (SAFB1, <i>SAFB</i>) can act in prostate cancer (PCa) as an androgen receptor (AR) co-repressor that functions through epigenetic silencing of AR targets, such as prostate specific antigen (PSA, <i>KLK3</i>). Genomic profiling of SAFB1-silenced PCa cells indicated that SAFB1 may play a role in modulating intracrine androgen levels through the regulation of UDP-glucuronosyltransferase (UGT) genes, which inactivate steroid hormones. Gene silencing of SAFB1 resulted in increased levels of free dihydrotesterosterone (DHT), and increased resistance to the AR inhibitor enzalutamide. SAFB1 silencing suppressed expression of the UDP-glucuronosyltransferase family 2 member B15 gene (<i>UGT2B15</i>) and the closely related UGT2B17 gene, which encode proteins that irreversibly inactivate testosterone (T) and DHT. Analysis of human data indicated that genomic loss at the SAFB locus, or down-regulation of expression of the SAFB gene, is associated with aggressive PCa. These findings identify SAFB1 as an important regulator of androgen catabolism in PCa and suggest that loss or inactivation of this protein may promote AR activity by retention of active androgen in tumor cells.

Also flagged:IronMitochondrialMitochondriahemebiosynthesisHomeostasis
Journal Article 2021-08-25 ✓ 1 Snippet Dietz JV, Fox JL, Khalimonchuk O.
In-Text Gene Mentions

…overload, such ashemochromatosisand iron-loading anemias—thala…

Show Full Abstract

Cellular iron homeostasis and mitochondrial iron homeostasis are interdependent. Mitochondria must import iron to form iron-sulfur clusters and heme, and to incorporate these cofactors along with iron ions into mitochondrial proteins that support essential functions, including cellular respiration. In turn, mitochondria supply the cell with heme and enable the biogenesis of cytosolic and nuclear proteins containing iron-sulfur clusters. Impairment in cellular or mitochondrial iron homeostasis is deleterious and can result in numerous human diseases. Due to its reactivity, iron is stored and trafficked through the body, intracellularly, and within mitochondria via carefully orchestrated processes. Here, we focus on describing the processes of and components involved in mitochondrial iron trafficking and storage, as well as mitochondrial iron-sulfur cluster biogenesis and heme biosynthesis. Recent findings and the most pressing topics for future research are highlighted.

Also flagged:Dual-Specificity Phosphatase 1DUSP1HomeostasisStress-activated protein kinasessensorineural hearing lossdeath
Journal Article 2021-08-25 ✓ 1 Snippet Bermúdez-Muñoz JM, Celaya AM, García-Mato Á, Muñoz-Espín D, Rodríguez-de la Rosa L, Serrano M, Varela-Nieto I.
In-Text Gene Mentions

…, Sod2 andPrdx6levels were higher…

Show Full Abstract

Stress-activated protein kinases (SAPK) are associated with sensorineural hearing loss (SNHL) of multiple etiologies. Their activity is tightly regulated by dual-specificity phosphatase 1 (DUSP1), whose loss of function leads to sustained SAPK activation. <i>Dusp1</i> gene knockout in mice accelerates SNHL progression and triggers inflammation, redox imbalance and hair cell (HC) death. To better understand the link between inflammation and redox imbalance, we analyzed the cochlear transcriptome in <i>Dusp1</i><sup>-/-</sup> mice. RNA sequencing analysis (GSE176114) indicated that <i>Dusp1</i><sup>-/-</sup> cochleae can be defined by a distinct profile of key cellular expression programs, including genes of the inflammatory response and glutathione (GSH) metabolism. To dissociate the two components, we treated <i>Dusp1</i><sup>-/-</sup> mice with N-acetylcysteine, and hearing was followed-up longitudinally by auditory brainstem response recordings. A combination of immunofluorescence, Western blotting, enzymatic activity, GSH levels measurements and RT-qPCR techniques were used. N-acetylcysteine treatment delayed the onset of SNHL and mitigated cochlear damage, with fewer TUNEL<sup>+</sup> HC and lower numbers of spiral ganglion neurons with p-H2AX foci. N-acetylcysteine not only improved the redox balance in <i>Dusp1</i><sup>-/-</sup> mice but also inhibited cytokine production and reduced macrophage recruitment. Our data point to a critical role for DUSP1 in controlling the cross-talk between oxidative stress and inflammation.

Also flagged:Serotonin TransportermatinganxietyAttachmentSLC6A4serotonin
Journal Article 2021-08-25 ✓ 2 Snippets Bonassi A, Cataldo I, Gabrieli G, Lepri B, Esposito G.
In-Text Gene Mentions

The S-allele variation has been found to be associated with decreased 5-HTT expression, hence with lower serotonin re-uptake compared to the L-allele variation [23,25].

…associated with decreased5-HTTexpression, hence with…

Show Full Abstract

Humans are evolutionary-driven to adult mating and conceive social expectations on the quality of their affiliations. The genetic susceptibility to adverse environments in critical periods can alter close relationships. The current research investigates how the promoter region of the Serotonin Transporter Gene (5-HTTLPR) and perceived caregiving behavior in childhood could influence the social expectations on close adult relationships. For this purpose, 5-HTTLPR data was collected from the buccal mucosa of 65 Italian individuals (33 males). The participants filled (a) the Parental Bonding Instrument (PBI) to provide the levels of care and overprotection from mother and father, and (b) the Experience in Close Relationships-Revised (ECR-R) to report the social expectations on the intimate relationship assessed in terms of anxiety and avoidance from the partner. An interaction effect between 5-HTTLPR and PBI dimensions on the ECR-R scores was hypothesized. Results confirmed that the interplay between the genetic groups and history of maternal overprotection predicted avoidance experienced in romantic relationships in adulthood. Moreover, both adult anxiety and avoidance felt in an intimate relationship were found to covary as a function of maternal overprotection. The present work proposes further evidence of the genetic and parental mechanisms regulating social expectations involved in close relationships.

Also flagged:Osteoarticular DisordersType 1 hereditary hemochromatosisHHironarthropathyosteoporosis
Journal Article 2021-08-25 ✓ 5 Snippets Banaszkiewicz K, Sikorska K, Panas D, Sworczak K.
In-Text Gene Mentions

Most often, HH develops in homozygous carriers of the HFE C282Y gene mutation in which, as a result of a point nucleotide change (845G > A), tyrosine is substituted for cysteine in the HFE protein chain, which leads to the loss of its function and consequently to hepcidin deficiency.

Iron homeostasis disorders develop as a result of HFE gene mutations, which are associated with hepcidin arthropathy or osteoporosis and may cause permanent disability in HH patients despite a properly conducted treatment with phlebotomies.

…in Patients withHFE-Hemochromatosis: A Single-Cen…

…Patients with HFE -Hemochromatosis: A Single-Center Study…

…a result ofHFEgene mutations, which…

Show Full Abstract

Type 1 hereditary hemochromatosis (HH) is an autosomal, recessive genetic entity with systemic iron overload. Iron homeostasis disorders develop as a result of <i>HFE</i> gene mutations, which are associated with hepcidin arthropathy or osteoporosis and may cause permanent disability in HH patients despite a properly conducted treatment with phlebotomies. In this study, selected parameters of calcium and phosphate metabolism were analyzed in combination with the assessment of bone mineral density (BMD) disorders in patients from northern Poland with clinically overt <i>HFE</i>-HH. BMD was determined by a dual-energy X-ray absorptiometry (DXA) test with the use of the trabecular bone score (TBS) function. The study included 29 HH patients (mean age = 53.14 years) who were compared with 20 healthy volunteers. A significantly lower TBS parameter and serum 25-OH-D3 concentration, a higher concentration of intact parathormone and more a frequent occurrence of joint pain were found in HH patients compared with the control group. In HH patients, the diagnosis of liver cirrhosis was associated with lower serum 25-OH-D3 and osteocalcin concentrations. In HH, DXA with the TBS option is a valuable tool in the early assessment of the bone microarchitecture and fracture risk. A supplementation of vitamin D, monitoring its concentration, should be considered especially in HH patients with liver damage and liver cirrhosis.

Also flagged:chronic periodontitisacute phase proteinAPPchronic infectionsironpro-inflammatory cytokines
Journal Article 2021-08-25 ✓ 1 Snippet Faramarzi M, Shirmohammadi A, Khorramdel A, Sadighi M, Bargahi E.
In-Text Gene Mentions

…iron deficiency anemia,hemochromatosis, diabetes, etc.)…

Show Full Abstract

<b>Background.</b> Ferritin is a positive acute phase protein (APP) in inflammation and chronic infections, including chronic periodontitis. Two key factors that can regulate ferritin expression are iron and pro-inflammatory cytokines. Serum ferritin levels increase after menopause, affecting women's health. This study aimed to evaluate serum ferritin levels in postmenopausal women upon undertaking non-surgical periodontal treatment. <b>Methods.</b> In this cross-sectional study, blood samples of 38 postmenopausal women with chronic periodontitis were collected before any treatment. The serum ferritin levels and periodontal parameters, probing depth (PD), clinical attachment level (CAL), and gingival index (GI) were recorded at baseline and three months after non-surgical periodontal therapy. Wilcoxon test was used to compare serum ferritin levels before and after treatment. T-test was used for comparison of periodontal parameters, with a <i>P</i> value of ≤0.05 considered significant. <b>Results.</b> A decrease was observed in the serum ferritin level (from 108.55 mcg/L to 98.28 mcg/L) after treatment compared to baseline (<i>P</i> < 0.001). Also, significant improvements in periodontal parameters were observed compared to the baseline (<i>P</i> < 0.001). <b>Conclusion.</b> Based on the results, it can be concluded that non-surgical periodontal treatment significantly reduces serum ferritin levels in postmenopausal women with chronic periodontitis.

Also flagged:localizationinfectious diseasescancerscysteinefatty acylpalmitoyl acyltransferase
Journal Article 2021-08-25 ✓ 1 Snippet Hu L, Tao Z, Wu X.
In-Text Gene Mentions

…ZDHHC13 could palmitoylateHTT, as well as…

Show Full Abstract

Posttranslational <i>S</i>-fatty acylation (or <i>S</i>-palmitoylation) modulates protein localization and functions, and has been implicated in neurological, metabolic, and infectious diseases, and cancers. Auto-<i>S</i>-fatty acylation involves reactive cysteine residues in the proteins which directly react with fatty acyl-CoA through thioester transfer reactions, and is the first step in some palmitoyl acyltransferase (PAT)-mediated catalysis reactions. In addition, many structural proteins, transcription factors and adaptor proteins might possess such "enzyme-like" activities and undergo auto-<i>S</i>-fatty acylation upon fatty acyl-CoA binding. Auto-<i>S</i>-fatty acylated proteins represent a new class of potential drug targets, which often harbor lipid-binding hydrophobic pockets and reactive cysteine residues, providing potential binding sites for covalent and non-covalent modulators. Therefore, targeting auto-<i>S</i>-fatty acylation could be a promising avenue to pharmacologically intervene in important cellular signaling pathways. Here, we summarize the recent progress in understanding the regulation and functions of auto-<i>S</i>-fatty acylation in cell signaling and diseases. We highlight the druggability of auto-<i>S</i>-fatty acylated proteins, including PATs and other proteins, with potential <i>in silico</i> and rationalized drug design approaches. We also highlight structural analysis and examples of currently known small molecules targeting auto-<i>S</i>-fatty acylation, to gain insights into targeting this class of proteins, and to expand the "druggable" proteome.

Also flagged:terminal deoxynucleotidyl transferasenucleotidespolynucleotidenucleasenanostructuresdegradation
Journal Article 2021-08-24 No Snippets Yang Y, Lu Q, Huang CM, Qian H, Zhang Y, Deshpande S, Arya G, Ke Y, Zauscher S.
Show Full Abstract

Combining surface-initiated, TdT (terminal deoxynucleotidyl transferase) catalyzed enzymatic polymerization (SI-TcEP) with precisely engineered DNA origami nanostructures (DONs) presents an innovative pathway for the generation of stable, polynucleotide brush-functionalized DNA nanostructures. We demonstrate that SI-TcEP can site-specifically pattern DONs with brushes containing both natural and non-natural nucleotides. The brush functionalization can be precisely controlled in terms of the location of initiation sites on the origami core and the brush height and composition. Coarse-grained simulations predict the conformation of the brush-functionalized DONs that agree well with the experimentally observed morphologies. We find that polynucleotide brush-functionalization increases the nuclease resistance of DONs significantly, and that this stability can be spatially programmed through the site-specific growth of polynucleotide brushes. The ability to site-specifically decorate DONs with brushes of natural and non-natural nucleotides provides access to a large range of functionalized DON architectures that would allow for further supramolecular assembly, and for potential applications in smart nanoscale delivery systems.

Also flagged:erythropoiesisironmetabolismHepcidiniron deficiencyEPO
Journal Article 2021-08-24 No Snippets Pirotte M, Fillet M, Seidel L, Jaspers A, Baron F, Beguin Y.
Show Full Abstract

Hematopoietic cell transplantation (HCT) brings important alterations in erythropoiesis and iron metabolism. Hepcidin, which regulates iron metabolism, increases in iron overload or inflammation and decreases with iron deficiency or activated erythropoiesis. Erythroferrone (ERFE) is the erythroid regulator of hepcidin. We investigated erythropoiesis and iron metabolism after allogeneic HCT in 70 patients randomized between erythropoietin (EPO) treatment or no EPO, by serially measuring hepcidin, ERFE, CRP (inflammation), soluble transferrin receptor (sTfR, erythropoiesis), serum iron and transferrin saturation (Tsat; iron for erythropoiesis) and ferritin (iron stores). We identified biological and clinical factors associated with serum hepcidin and ERFE levels. Serum ERFE correlated overall with sTfR and reticulocytes and inversely with hepcidin. Erythroferrone paralleled sTfR levels, dropping during conditioning and recovering with engraftment. Inversely, hepcidin peaked after conditioning and decreased during engraftment. Erythroferrone and hepcidin were not significantly different with or without EPO. Multivariate analyses showed that the major determinant of ERFE was erythropoiesis (sTfR, reticulocytes or serum Epo). Pretransplant hepcidin was associated with previous RBC transfusions and ferritin. After transplantation, the major determinants of hepcidin were iron status (ferritin at all time points and Tsat at day 56) and erythropoiesis (sTfR or reticulocytes or ERFE), while the impact of inflammation was less clear and clinical parameters had no detectable influence. Hepcidin remained significantly higher in patients with high compared to low pretransplant ferritin. After allogeneic HCT with or without EPO therapy, significant alterations of hepcidin occur between pretransplant and day 180, in correlation with iron status and inversely with erythroid ERFE.

Also flagged:2,3-dichloronitrobenzenecarbonnitrogen2,3-dichloronitrobenzene dioxygenase,4-dichlorocatechol23DCNB dioxygenase
Journal Article 2021-08-24 No Snippets Li T, Gao YZ, Xu J, Zhang ST, Guo Y, Spain JC, Zhou NY.
Show Full Abstract

<i>Diaphorobacter</i> sp. strain JS3051 utilizes 2,3-dichloronitrobenzene (23DCNB), a toxic anthropogenic compound, as the sole carbon, nitrogen, and energy source for growth, but the metabolic pathway and its origins are unknown. Here, we establish that a gene cluster (<i>dcb</i>), encoding a Nag-like dioxygenase, is responsible for the initial oxidation of the 23DCNB molecule. The 2,3-dichloronitrobenzene dioxygenase system (DcbAaAbAcAd) catalyzes conversion of 23DCNB to 3,4-dichlorocatechol (34DCC). Site-directed mutagenesis studies indicated that residue 204 of DcbAc is crucial for the substrate specificity of 23DCNB dioxygenase. The presence of glutamic acid at position 204 of 23DCNB dioxygenase is unique among Nag-like dioxygenases. Genetic, biochemical, and structural evidence indicate that the 23DCNB dioxygenase is more closely related to 2-nitrotoluene dioxygenase from <i>Acidovorax</i> sp. strain JS42 than to the 34DCNB dioxygenase from <i>Diaphorobacter</i> sp. strain JS3050, which was isolated from the same site as strain JS3051. A gene cluster (<i>dcc</i>) encoding the enzymes for 34DCC catabolism, homologous to a <i>clc</i> operon in Pseudomonas knackmussii strain B13, is also on the chromosome at a distance of 2.5 Mb from the <i>dcb</i> genes. Heterologously expressed DccA catalyzed ring cleavage of 34DCC with high affinity and catalytic efficiency. This work not only establishes the molecular mechanism for 23DCNB mineralization, but also enhances the understanding of the recent evolution of the catabolic pathways for nitroarenes. <b>IMPORTANCE</b> Because anthropogenic nitroaromatic compounds have entered the biosphere relatively recently, exploration of the recently evolved catabolic pathways can provide clues for adaptive evolutionary mechanisms in bacteria. The concept that nitroarene dioxygenases shared a common ancestor with naphthalene dioxygenase is well established. But their phylogeny and how they evolved in response to novel nitroaromatic compounds are largely unknown. Elucidation of the molecular basis for 23DCNB degradation revealed that the catabolic pathways of two DCNB isomers in different isolates from the same site were derived from different recent origins. Integrating structural models of catalytic subunits and enzymatic activities data provided new insight about how recently modified enzymes were selected depending on the structure of new substrates. This study enhances understanding and prediction of adaptive evolution of catabolic pathways in bacteria in response to new chemicals.

Also flagged:16S rRNA16 s rRNAcalcium oxalate kidney stoneskidney stonekidney stonesNephrolithiasis
Journal Article 2021-08-24 No Snippets Xiang L, Jin X, Liu Y, Ma Y, Jian Z, Wei Z, Li H, Li Y, Wang K.
Show Full Abstract

<h4>Purpose</h4>To predict the occurrence of calcium oxalate kidney stones based on clinical and gut microbiota characteristics.<h4>Methods</h4>Gut microbiota and clinical data from 180 subjects (120 for training set and 60 for validation) attending the West China Hospital (WCH) were collected between June 2018 and January 2021. Based on the gut microbiota and clinical data from 120 subjects (66 non-kidney stone individuals and 54 kidney stone patients), we evaluated eight machine learning methods to predict the occurrence of calcium oxalate kidney stones.<h4>Results</h4>With fivefold cross-validation, the random forest method produced the best area under the curve (AUC) of 0.94. We further applied random forest to an independent validation dataset with 60 samples (34 non-kidney stone individuals and 26 kidney stone patients), which yielded an AUC of 0.88.<h4>Conclusion</h4>Our results demonstrated that clinical data combined with gut microbiota characteristics may help predict the occurrence of kidney stones.

Also flagged:KLF6cell migrationtumorZBED3breast cancerKruppel like factor 6
Journal Article 2021-08-24 ✓ 2 Snippets Fu A, Yu Z, Zhang E, Song J.
In-Text Gene Mentions

LncRNA MIR503HG upregulation represses miR‐103 to enhance OLFM4 expression, retarding the malignant development of BC cells.32

…miR‐103 to enhanceOLFM4expression, retarding the…

Show Full Abstract

Breast cancer (BC) is the most commonly occurring malignancy in women. This study aimed to investigate the functions of the long noncoding RNA ZBED3-AS1 (ZBED3-AS1) in BC and its molecular mechanisms. qRT-PCR was conducted to access the expression of ZBED3-AS1, microRNA-513a-5p (miR-513a-5p), and Kruppel like factor 6 (KLF6) in BC. Additionally, BC cell viability and proliferative capacity were measured by MTT and 5-Ethynyl-20-deoxyuridine (EdU) assays. A transwell assay was used for evaluating BC cell migration and invasion. The interactions among ZBED3-AS1, miR-513a-5p, and KLF6 in BC were confirmed by dual-luciferase reporter assay. Furthermore, feedback approaches were performed to determine whether ZBED3-AS1 influences BC cell behaviors by regulating the miR-513a-5p/KLF6 axis. The murine xenograft model was established to assess the effect of ZBED3-AS1 on tumor growth. The expression of ZBED3-AS1 and KLF6 was reduced, while miR-513a-5p expression was elevated in BC. ZBED3-AS1 elevation attenuated the malignant behaviors of BC cells, including viability, proliferative capacity, migration, and invasion. Mechanical experiments revealed that ZBED3-AS1 targeted miR-513a-5p, and miR-513a-5p targeted KLF6 in BC. Feedback approaches validated that miR-513a-5p overexpression or KLF6 depletion reversed the inhibitory effects of ZBED3-AS1 upregulation on viability, proliferative capacity, migration, and invasion of BC cells. Furthermore, ZBED3-AS1 elevation attenuated the tumor growth in the murine xenograft model. ZBED3-AS1 hindered the malignant development of BC cells by regulating the miR-513a-5p/KLF6 axis, providing a novel therapeutic target in BC.

Also flagged:CRCangiotensinyoureninaddColon adenocarcinoma
Journal Article 2021-08-24 ✓ 3 Snippets Munro MJ, Peng L, Wickremesekera SK, Tan ST.
In-Text Gene Mentions

…Angiotensin III (ATIII) is the result…

…by cleavage ofATIIIby aminopeptidase N.…

…Both ATII andATIIIact on angiotensin…

Show Full Abstract

The cancer stem cell (CSC) concept proposes that cancer recurrence and metastasis are driven by CSCs. In this study, we investigated whether cells from colon adenocarcinoma (CA) with a CSC-like phenotype express renin-angiotensin system (RAS) components, and the effect of RAS inhibitors on CA-derived primary cell lines. Expression of RAS components was interrogated using immunohistochemical and immunofluorescence staining in 6 low-grade CA (LGCA) and 6 high-grade CA (HGCA) tissue samples and patient-matched normal colon samples. Primary cell lines derived from 4 HGCA tissues were treated with RAS inhibitors to investigate their effect on cellular metabolism, tumorsphere formation and transcription of pluripotency genes. Immunohistochemical and immunofluorescence staining showed expression of AT2R, ACE2, PRR, and cathepsins B and D by cells expressing pluripotency markers. β-blockers and AT2R antagonists reduced cellular metabolism, pluripotency marker expression, and tumorsphere-forming capacity of CA-derived primary cell lines. This study suggests that the RAS is active in CSC-like cells in CA, and further investigation is warranted to determine whether RAS inhibition is a viable method of targeting CSCs.

Also flagged:neurodegenerative disordersCREB1BDNFIFNγimmune responsesgene expression
Journal Article 2021-08-24 ✓ 1 Snippet Haghani A, Feinberg JI, Lewis KC, Ladd-Acosta C, Johnson RG, Jaffe AE, Sioutas C, Finch CE, Campbell DB, Morgan TE, Volk HE.
In-Text Gene Mentions

…included Wfdc6b andSuds3(Fig. 1 B,…

Show Full Abstract

<h4>Background</h4>Prenatal exposure to air pollutants is associated with increased risk for neurodevelopmental and neurodegenerative disorders. However, few studies have identified transcriptional changes related to air pollutant exposure.<h4>Methods</h4>RNA sequencing was used to examine transcriptomic changes in blood and cerebral cortex of three male and three female mouse neonates prenatally exposed to traffic-related nano-sized particulate matter (nPM) compared to three male and three female mouse neonates prenatally exposed to control filter air.<h4>Results</h4>We identified 19 nPM-associated differentially expressed genes (nPM-DEGs) in blood and 124 nPM-DEGs in cerebral cortex. The cerebral cortex transcriptional responses to nPM suggested neuroinflammation involvement, including CREB1, BDNF, and IFNγ genes. Both blood and brain tissues showed nPM transcriptional changes related to DNA damage, oxidative stress, and immune responses. Three blood nPM-DEGs showed a canonical correlation of 0.98 with 14 nPM-DEGS in the cerebral cortex, suggesting a convergence of gene expression changes in blood and cerebral cortex. Exploratory sex-stratified analyses suggested a higher number of nPM-DEGs in female cerebral cortex than male cerebral cortex. The sex-stratified analyses identified 2 nPM-DEGs (Rgl2 and Gm37534) shared between blood and cerebral cortex in a sex-dependent manner.<h4>Conclusions</h4>Our findings suggest that prenatal nPM exposure induces transcriptional changes in the cerebral cortex, some of which are also observed in blood. Further research is needed to replicate nPM-induced transcriptional changes with additional biologically relevant time points for brain development.

Also flagged:Cancermetastatic diseasesolid cancerhematological malignanciesmultiple myelomaleukemia
Journal Article 2021-08-24 ✓ 1 Snippet Aguirre-Ghiso JA.
In-Text Gene Mentions

DCC

Show Full Abstract

The paradigm of metastasis has been significantly remodeled by the incorporation of cancer dormancy as a mechanism to explain long-term remission intervals followed by relapse. There is overall consensus on the potential impact of better understanding dormancy. Key cancer-cell autonomous and microenvironmental mechanisms might explain this biology and, in turn, the timing of metastasis. However, the approach and feasibility to apply this biology to clinical trials has been controversial. The discussion here provides insight into how these controversies are being resolved by the development of active clinical trials, thus bringing to reality opportunities to target cancer dormancy.

Also flagged:Huntington Diseaseneurologic disordersbehavioralneurodegenerative disorderHDcognitive impairment
Journal Article 2021-08-24 ✓ 1 Snippet Woodard CL, Sepers MD, Raymond LA.
In-Text Gene Mentions

HTT

Show Full Abstract

The effective development of novel therapies in mouse models of neurologic disorders relies on behavioral assessments that provide accurate read-outs of neuronal dysfunction and/or degeneration. We designed an automated behavioral testing system (PiPaw), which integrates an operant lever-pulling task directly into the mouse home cage. This task is accessible to group-housed mice 24 h per day, enabling high-throughput longitudinal analysis of forelimb motor learning. Moreover, this design eliminates the need for exposure to novel environments and minimizes experimenter interaction, significantly reducing two of the largest stressors associated with animal behavior. Male mice improved their performance of this task over 1 week of testing by reducing intertrial variability of reward-related kinematic parameters (pull amplitude or peak velocity). In addition, mice displayed short-term improvements in reward rate, and a concomitant decrease in movement variability, over the course of brief bouts of task engagement. We used this system to assess motor learning in mouse models of the inherited neurodegenerative disorder, Huntington disease (HD). Despite having no baseline differences in task performance, male <i>Q175-FDN</i> HD mice were unable to modulate the variability of their movements to increase reward on either short or long timescales. Task training was associated with a decrease in the amplitude of spontaneous excitatory activity recorded from striatal medium spiny neurons in the hemisphere contralateral to the trained forelimb in WT mice; however, no such changes were observed in <i>Q175-FDN</i> mice. This behavioral screening platform should prove useful for preclinical drug trials toward improved treatments in HD and other neurologic disorders.<b>SIGNIFICANCE STATEMENT</b> In order to develop effective therapies for neurologic disorders, such as Huntington disease (HD), it is important to be able to accurately and reliably assess the behavior of mouse models of these conditions. Moreover, these behavioral assessments should provide an accurate readout of underlying neuronal dysfunction and/or degeneration. In this paper, we used an automated behavioral testing system to assess motor learning in mice within their home cage. Using this system, we were able to study motor abnormalities in HD mice with an unprecedented level of detail, and identified a specific behavioral deficit associated with an underlying impairment in striatal neuronal plasticity. These results validate the usefulness of this system for assessing behavior in mouse models of HD and other neurologic disorders.

Also flagged:cancerHRPPy230metastatic tumorsmelanomayou
Journal Article 2021-08-24 ✓ 3 Snippets Liu W, Chakraborty B, Safi R, Kazmin D, Chang CY, McDonnell DP.
In-Text Gene Mentions

Pebp1

PEBP1

…Lpcat3 , andPebp1) (Fig. 4c…

Show Full Abstract

Hypercholesterolemia and dyslipidemia are associated with an increased risk for many cancer types and with poor outcomes in patients with established disease. Whereas the mechanisms by which this occurs are multifactorial we determine that chronic exposure of cells to 27-hydroxycholesterol (27HC), an abundant circulating cholesterol metabolite, selects for cells that exhibit increased cellular uptake and/or lipid biosynthesis. These cells exhibit substantially increased tumorigenic and metastatic capacity. Notably, the metabolic stress imposed upon cells by the accumulated lipids requires sustained expression of GPX4, a negative regulator of ferroptotic cell death. We show that resistance to ferroptosis is a feature of metastatic cells and further demonstrate that GPX4 knockdown attenuates the enhanced tumorigenic and metastatic activity of 27HC resistant cells. These findings highlight the general importance of ferroptosis in tumor growth and metastasis and suggest that dyslipidemia/hypercholesterolemia impacts cancer pathogenesis by selecting for cells that are resistant to ferroptotic cell death.

Also flagged:DiamondBehaviorCanceranxietyDanaDepression
Journal Article 2021-08-24 ✓ 1 Snippet Christensen KD, Schonman EF, Robinson JO, Roberts JS, Diamond PM, Lee KB, Green RC, McGuire AL.
In-Text Gene Mentions

…variants associated withhemochromatosiswho had been…

Show Full Abstract

Many expect genome sequencing (GS) to become routine in patient care and preventive medicine, but uncertainties remain about its ability to motivate participants to improve health behaviors and the psychological impact of disclosing results. In a pilot trial with exploratory analyses, we randomized 100 apparently healthy, primary-care participants and 100 cardiology participants to receive a review of their family histories of disease, either alone or in addition to GS analyses. GS results included polygenic risk information for eight cardiometabolic conditions. Overall, no differences were observed between the percentage of participants in the GS and control arms, who reported changes to health behaviors such as diet and exercise at 6 months post disclosure (48% vs. 36%, respectively, p = 0.104). In the GS arm, however, the odds of reporting a behavior change increased by 52% per high-risk polygenic prediction (p = 0.032). Mean anxiety and depression scores for GS and control arms had confidence intervals within equivalence margins of ±1.5. Mediation analyses suggested an indirect impact of GS on health behaviors by causing positive psychological responses (p ≤ 0.001). Findings suggest that GS did not distress participants. Future research on GS in more diverse populations is needed to confirm that it does not raise risks for psychological harms and to confirm the ability of polygenic risk predictions to motivate preventive behaviors.

Also flagged:HSPL27DNAJB5DNAJB6DNAJB3DNAJB4DNAJB9
Journal Article 2021-08-24 ✓ 2 Snippets Huusko JM, Tiensuu H, Haapalainen AM, Pasanen A, Tissarinen P, Karjalainen MK, Zhang G, Christensen K, Ryckman KK, Jacobsson B, Murray JC, Kingsmore SF, Hallman M, Muglia LJ, Rämet M.
In-Text Gene Mentions

DNAJC1

…( DNAJA1 ,DNAJC1, DNAJC2 ,…

Show Full Abstract

Heat shock proteins are involved in the response to stress including activation of the immune response. Elevated circulating heat shock proteins are associated with spontaneous preterm birth (SPTB). Intracellular heat shock proteins act as multifunctional molecular chaperones that regulate activity of nuclear hormone receptors. Since SPTB has a significant genetic predisposition, our objective was to identify genetic and transcriptomic evidence of heat shock proteins and nuclear hormone receptors that may affect risk for SPTB. We investigated all 97 genes encoding members of the heat shock protein families and all 49 genes encoding nuclear hormone receptors for their potential role in SPTB susceptibility. We used multiple genetic and genomic datasets including genome-wide association studies (GWASs), whole-exome sequencing (WES), and placental transcriptomics to identify SPTB predisposing factors from the mother, infant, and placenta. There were multiple associations of heat shock protein and nuclear hormone receptor genes with SPTB. Several orthogonal datasets supported roles for SEC63, HSPA1L, SACS, RORA, and AR in susceptibility to SPTB. We propose that suppression of specific heat shock proteins promotes maintenance of pregnancy, whereas activation of specific heat shock protein mediated signaling may disturb maternal-fetal tolerance and promote labor.

Also flagged:PPIP5K2GK2TMEM38ABCHEAOC2DNAJB9
Journal Article 2021-08-24 ✓ 5 Snippets Lim G, Lim CJ, Lee JH, Lee BH, Ryu JY, Oh KS.
In-Text Gene Mentions

SERPINC1

CACNA1E

DNAH10

PLCL1

…protein 1 (PLCL1), and androgen…

Show Full Abstract

Drug repositioning research using transcriptome data has recently attracted attention. In this study, we attempted to identify new target proteins of the urotensin-II receptor antagonist, KR-37524 (4-(3-bromo-4-(piperidin-4-yloxy)benzyl)-N-(3-(dimethylamino)phenyl)piperazine-1-carboxamide dihydrochloride), using a transcriptome-based drug repositioning approach. To do this, we obtained KR-37524-induced gene expression profile changes in four cell lines (A375, A549, MCF7, and PC3), and compared them with the approved drug-induced gene expression profile changes available in the LINCS L1000 database to identify approved drugs with similar gene expression profile changes. Here, the similarity between the two gene expression profile changes was calculated using the connectivity score. We then selected proteins that are known targets of the top three approved drugs with the highest connectivity score in each cell line (12 drugs in total) as potential targets of KR-37524. Seven potential target proteins were experimentally confirmed using an in vitro binding assay. Through this analysis, we identified that neurologically regulated serotonin transporter proteins are new target proteins of KR-37524. These results indicate that the transcriptome-based drug repositioning approach can be used to identify new target proteins of a given compound, and we provide a standalone software developed in this study that will serve as a useful tool for drug repositioning.

Also flagged:neurodegenerative diseasesgene expressioncell developmentpost-translational modificationsembryogenesisamino acid
Journal Article 2021-08-24 ✓ 1 Snippet Fassler JS, Skuodas S, Weeks DL, Phillips BT.
In-Text Gene Mentions

Htt

Show Full Abstract

Protein aggregation is a feature of numerous neurodegenerative diseases. However, regulated, often reversible, formation of protein aggregates, also known as condensates, helps control a wide range of cellular activities including stress response, gene expression, memory, cell development and differentiation. This review presents examples of aggregates found in biological systems, how they are used, and cellular strategies that control aggregation and disaggregation. We include features of the aggregating proteins themselves, environmental factors, co-aggregates, post-translational modifications and well-known aggregation-directed activities that influence their formation, material state, stability and dissolution. We highlight the emerging roles of biomolecular condensates in early animal development, and disaggregation processing proteins that have recently been shown to play key roles in gametogenesis and embryogenesis.

Also flagged:keratitismicrobial keratitisvisionglaucomaocular hypertensionDescemetocele
Journal Article 2021-08-24 No Snippets Nguyen HT, Pham ND, Mai TQ, Do HTT, Nguyen DTN, McCluskey P, Pham TV.
Show Full Abstract

<h4>Purpose</h4>To evaluate the result of tectonic deep anterior lamellar keratoplasty (DALK) for keratitis with perforation and descemetocele.<h4>Patients and methods</h4>A prospective clinical study of 36 patients (36 eyes) treated with tectonic DALK for corneal perforation or descemetocele from microbial keratitis managed at the Vietnam National Eye Hospital over a two-year period. The surgical technique was manual lamellar dissection. The grafts were harvested from the anterior corneal cap of pre-cut donor tissues used for DSAEK or donor corneas with a low endothelial cell count.<h4>Results</h4>A mean age was 55.36 ± 13.98 years (ranged from 25 to 75 years). Female gender represented 52%. causative agents were herpes simplex virus (58.3%), bacteria (22.2%), fungi (13.9%) and microsporidia (5.6%). There were 24 eyes with descemetocele (66.7%) and 12 with perforation (33.3%). There were 33 successful cases (91.7%) and 3 failed cases (8.3%). Best corrected visual acuity (BCVA) improved in 28 eyes (84.8%). The range of post-operative BCVA was from hand motions to 20/70. Eleven eyes (33.3%) attained vision 20/200 and higher. Clear graft was obtained in 15 eyes (45.5%), while mild or severe graft opacity was observed in 14 eyes (42.4%), and 4 eyes (12.1%), respectively. Surgical complications included descemet rupture (20.8%), pseudo anterior chamber (41.6%), persistent corneal epithelial defects (8.3%), reinfection (11.1%), glaucoma or ocular hypertension (5.6%) and cataract (8.3%).<h4>Conclusion</h4>The study demonstrates that DALK is an effective procedure to treat corneal descemetocele, especially when an urgent penetrating keratoplasty (PKP) cannot be performed.

Also flagged:P-SelectinTumormethylestersP-selectinWater
Journal Article 2021-08-24 No Snippets Feng Q, Wang M, Muhtar E, Wang Y, Zhu H.
Show Full Abstract

<h4>Purpose</h4>To assess whether the newly designed small-molecule oral P-selectin inhibitor 3<i>S</i>-1,2,3,4-tetrahydro-β-carboline-3-methyl aspartyl ester (THCMA) as a nanomedicine enhances antithrombosis, anti-inflammation, and antitumor activity more than the clinical trial drug PSI-697.<h4>Methods</h4>THCMA was designed as an amphiphile containing pharmacophores of PSI-697. Its nanofeatures were explored with TEM, SEM, Tyndall effect, ζ-potential, FT-ICR-MS, and NOESY 2D <sup>1</sup>H NMR. The P-selectin inhibitory effect of THCMA was demonstrated with molecular docking, ultraviolet (UV) spectra, and competitive ELISA. In vivo and in vitro assays - anti-arterial thrombosis, anti-venous thrombosis, anti-inflammation, antitumor growth, anti-platelet aggregation, rat-tail bleeding time, anticoagulation index, soluble P-selectin (sP-selectin) expression, and serum TNFα expression - were performed to explore bioactivity and potential mechanisms. Water solubility of THCMA was measured using UV-absorption spectra.<h4>Results</h4>THCMA self-assembled into nanorings of approximately 100 nm in diameter. Its water solubility was about 1,030-fold that of PSI-697. THCMA exhibited more potent P-selectin inhibitory effect than PSI-697. The oral efficacy of THCMA was 100-fold that of PSI-697 in inhibiting arterial and venous thrombosis and tenfold in inhibiting inflammation. THCMA inhibited thrombosis at a dose that produces no coagulation disorders and no bleeding risk. THCMA exhibited enhanced antitumor activity over PSI-697 without systemic chemotherapy toxicity. THCMA significantly inhibited platelet aggregation in vitro and downregulated the expression levels of serum sP-selectin and TNFα in vivo.<h4>Conclusion</h4>A new small-molecule P-selectin inhibitor, THCMA, has been successfully designed as a nanomedicine with largely enhanced oral efficacy compared to the clinical trial drug PSI-697, and thus might be developed for the oral treatment of arterial thrombosis, venous thrombosis, inflammation, and cancer-associated thrombosis.

Also flagged:Head and Neck Squamous Cell CarcinomatumorHNSCCGene ExpressionITGB4malignant neoplasm
Journal Article 2021-08-24 No Snippets Chen Y, Liu M, Jin H, Peng B, Dai L, Wang S, Xing H, Wang B, Wu Z.
Show Full Abstract

<h4>Background</h4>MicroRNA-1-3p (miR-1-3p) exerts significant regulation in various tumor cells, but its molecular mechanisms in head and neck squamous cell carcinoma (HNSCC) are still ill defined. This study is aimed at detecting the expression of miR-1-3p in HNSCC and at determining its significant regulatory pathways.<h4>Methods</h4>Data were obtained from the Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), Oncomine, ArrayExpress, Sequence Read Archive (SRA) databases, and additional literature. Expression values of miR-1-3p in HNSCC were analyzed comprehensively. The R language software was employed to screen differentially expressed genes, and bioinformatics assessment was performed. One sequence dataset (HNSCC: <i>n</i> = 484; noncancer: <i>n</i> = 44) and 18 chip datasets (HNSCC: <i>n</i> = 656; noncancer: <i>n</i> = 199) were obtained.<h4>Results</h4>The expression of miR-1-3p in HNSCC was visibly decreased in compare with noncancerous tissues. There were distinct differences in tumor state (<i>P</i> = 0.0417), pathological stage (<i>P</i> = 0.0058), and T stage (<i>P</i> = 0.0044). Comprehensive analysis of sequence and chip data also indicated that miR-1-3p was lowly expressed in HNSCC. The diagnostic performance of miR-1-3p in HNSCC is reflected in the sensitivity and specificity of the collection, etc. Bioinformatics analysis showed the possible biological process, cellular component, molecular function, and KEGG pathways of miR-1-3p in HNSCC. And <i>ITGB4</i> was a possible target of miR-1-3p.<h4>Conclusions</h4>miR-1-3p's low expression may facilitate tumorigenesis and evolution in HNSCC through signaling pathways. <i>ITGB4</i> may be a key gene in targeting pathways but still needs verification through in vitro experiments.

Also flagged:youbehavioraldepressioncoronavirus disease 2019COVID-19
Journal Article 2021-08-24 No Snippets Zhang P, Piao Y, Chen Y, Ren J, Zhang L, Qiu B, Wei Z, Zhang X.
Show Full Abstract

According to the cognitive model of depression, memory bias, interpretation bias, and attention bias are associated with the development and maintenance of depression. Here, we present a protocol for investigating whether and how the novel coronavirus disease 2019 (COVID-19) pandemic may affect the relationship between current cognitive biases and future depression severity in a population with non-clinical depression. This protocol can also be used in other contexts, including cognitive bias-related studies and depression-related functional magnetic resonance imaging (fMRI) studies. For complete details on the use and execution of this protocol, please refer to Zhang et al. (2021).

Also flagged:ADRNA binding proteinsRBPage-neurodegenerative disorderage-related dementia
Journal Article 2021-08-24 No Snippets Rybak-Wolf A, Plass M.
Show Full Abstract

Alzheimer's disease (AD) is the most common age-related neurodegenerative disorder that heavily burdens healthcare systems worldwide. There is a significant requirement to understand the still unknown molecular mechanisms underlying AD. Current evidence shows that two of the major features of AD are transcriptome dysregulation and altered function of RNA binding proteins (RBPs), both of which lead to changes in the expression of different RNA species, including microRNAs (miRNAs), circular RNAs (circRNAs), long non-coding RNAs (lncRNAs), and messenger RNAs (mRNAs). In this review, we will conduct a comprehensive overview of how RNA dynamics are altered in AD and how this leads to the differential expression of both short and long RNA species. We will describe how RBP expression and function are altered in AD and how this impacts the expression of different RNA species. Furthermore, we will also show how changes in the abundance of specific RNA species are linked to the pathology of AD.

Also flagged:biosynthesisgene expressionshomoserine lactoneamidelactoneheterocyclic compounds
Journal Article 2021-08-24 No Snippets Zhang Q, Li S, Hachicha M, Boukraa M, Soulère L, Efrit ML, Queneau Y.
Show Full Abstract

<i>N</i>-acyl homoserine lactones (AHLs) are small signaling molecules used by many Gram-negative bacteria for coordinating their behavior as a function of their population density. This process, based on the biosynthesis and the sensing of such molecular signals, and referred to as Quorum Sensing (QS), regulates various gene expressions, including growth, virulence, biofilms formation, and toxin production. Considering the role of QS in bacterial pathogenicity, its modulation appears as a possible complementary approach in antibacterial strategies. Analogues and mimics of AHLs are therefore biologically relevant targets, including several families in which heterocyclic chemistry provides a strategic contribution in the molecular design and the synthetic approach. AHLs consist of three main sections, the homoserine lactone ring, the central amide group, and the side chain, which can vary in length and level of oxygenation. The purpose of this review is to summarize the contribution of heterocyclic chemistry in the design of AHLs analogues, insisting on the way heterocyclic building blocks can serve as replacements of the lactone moiety, as a bioisostere for the amide group, or as an additional pattern appended to the side chain. A few non-AHL-related heterocyclic compounds with AHL-like QS activity are also mentioned.

Also flagged:CancerCD80CD81IFNAQP5FCGR1A
Journal Article 2021-08-24 No Snippets Mariottoni P, Jiang SW, Prestwood CA, Jain V, Suwanpradid J, Whitley MJ, Coates M, Brown DA, Erdmann D, Corcoran DL, Gregory SG, Jaleel T, Zhang JY, Harris-Tryon TA, MacLeod AS.
Show Full Abstract

Hidradenitis suppurativa (HS) is a chronic inflammatory skin disease characterized by recurrent abscesses, nodules, and sinus tracts in areas of high hair follicle and sweat gland density. These sinus tracts can present with purulent drainage and scar formation. Dysregulation of multiple immune pathways drives the complexity of HS pathogenesis and may account for the heterogeneity of treatment response in HS patients. Using transcriptomic approaches, including single-cell sequencing and protein analysis, we here characterize the innate inflammatory landscape of HS lesions. We identified a shared upregulation of genes involved in interferon (IFN) and antimicrobial defense signaling through transcriptomic overlap analysis of differentially expressed genes (DEGs) in datasets from HS skin, diabetic foot ulcers (DFUs), and the inflammatory stage of normal healing wounds. Overlap analysis between HS- and DFU-specific DEGs revealed an enrichment of gene signatures associated with monocyte/macrophage functions. Single-cell RNA sequencing further revealed monocytes/macrophages with polarization toward a pro-inflammatory M1-like phenotype and increased effector function, including antiviral immunity, phagocytosis, respiratory burst, and antibody-dependent cellular cytotoxicity. Specifically, we identified the STAT1/IFN-signaling axis and the associated IFN-stimulated genes as central players in monocyte/macrophage dysregulation. Our data indicate that monocytes/macrophages are a potential pivotal player in HS pathogenesis and their pathways may serve as therapeutic targets and biomarkers in HS treatment.

Also flagged:gene expressionGenNotch1Nos3β-cateninTop 1
Journal Article 2021-08-24 No Snippets Matos-Nieves A, Manivannan S, Majumdar U, McBride KL, White P, Garg V.
Show Full Abstract

Congenital heart disease (CHD) is the most common type of birth defect, affecting ~1% of all live births. Malformations of the cardiac outflow tract (OFT) account for ~30% of all CHD and include a range of CHDs from bicuspid aortic valve (BAV) to tetralogy of Fallot (TOF). We hypothesized that transcriptomic profiling of a mouse model of CHD would highlight disease-contributing genes implicated in congenital cardiac malformations in humans. To test this hypothesis, we utilized global transcriptional profiling differences from a mouse model of OFT malformations to prioritize damaging, <i>de novo</i> variants identified from exome sequencing datasets from published cohorts of CHD patients. <i>Notch1</i> <sup>+/-</sup> <i>; Nos3</i> <sup>-/-</sup> mice display a spectrum of cardiac OFT malformations ranging from BAV, semilunar valve (SLV) stenosis to TOF. Global transcriptional profiling of the E13.5 <i>Notch1</i> <sup>+/-</sup> <i>; Nos3</i> <sup>-/-</sup> mutant mouse OFTs and wildtype controls was performed by RNA sequencing (RNA-Seq). Analysis of the RNA-Seq dataset demonstrated genes belonging to the <i>Hif1α</i>, <i>Tgf-β</i>, <i>Hippo</i>, and <i>Wnt</i> signaling pathways were differentially expressed in the mutant OFT. Mouse to human comparative analysis was then performed to determine if patients with TOF and SLV stenosis display an increased burden of damaging, genetic variants in gene homologs that were dysregulated in <i>Notch1</i> <sup>+/-</sup> <i>; Nos3</i> <sup>-/-</sup> OFT. We found an enrichment of <i>de novo</i> variants in the TOF population among the 1,352 significantly differentially expressed genes in <i>Notch1</i> <sup>+/-</sup> <i>; Nos3</i> <sup>-/-</sup> mouse OFT but not the SLV population. This association was not significant when comparing only highly expressed genes in the murine OFT to <i>de novo</i> variants in the TOF population. These results suggest that transcriptomic datasets generated from the appropriate temporal, anatomic and cellular tissues from murine models of CHD may provide a novel approach for the prioritization of disease-contributing genes in patients with CHD.

Also flagged:immunodeficientmeltprotaminellstopCD34
Journal Article 2021-08-24 No Snippets Kawaguchi K, Komoda K, Mikawa R, Asai A, Sugimoto M.
Show Full Abstract

Cellular senescence acts as a potent tumor-suppression mechanism in mammals; however, it also promotes tumor progression in a non-cell-autonomous manner. We provided insights into the mechanism underlying senescence-dependent metastatic cancer development. The elimination of senescent cells suppressed the lung metastasis of melanoma cells. Using an antibody array screening of humoral factor(s) that depend on cellular senescence, we identified soluble E-cadherin (seCad) as a potential mediator of the senescence-induced melanoma metastasis. seCad enhanced the invasive activity of melanoma cells both <i>in vitro</i> and <i>in vivo</i>, and gene expression profiling revealed that seCad induced genes associated with poor prognosis in patients with melanoma. An analysis of sera from patients revealed that serum seCad is associated with distant metastasis. Our data suggest that senescent cells promote metastatic lung cancer through seCad, and that seCad may be a potential diagnostic marker as well as a therapeutic target for metastatic lung cancer.

Also flagged:SialylationCancertumorsOpalNcr1NBP2
Journal Article 2021-08-24 ✓ 1 Snippet Hung TH, Hung JT, Wu CE, Huang Y, Lee CW, Yeh CT, Chung YH, Lo FY, Lai LC, Tung JK, Yu J, Yeh CN, Yu AL.
In-Text Gene Mentions

Advances in sequencing technology and increasing accessibility to tumor profiling in recent years have led to the identification of several potential biomarkers for ICC, including KRAS (proto‐oncogene GTPase), PIK3CA (phosphatidylinositol‐4,5‐bisphosphate 3‐kinase catalytic subunit α), TP53 (tumor protein p53), isocitrate dehydrogenase 1 (IDH1), fibroblast growth factor receptor 2 (FGFR2), neurotrophic receptor tyrosine kinase (NTRK), and ERBB2 (Erb‐B2 receptor tyrosine kinase 2), as putative targets for personalized therapy.(4) In particular, two targeted agents, larotrectinib and pemigatinib, have been approved by the Food and Drug Administration for patients with cancers containing NTRK and FGFR2 fusion genes, respectively.(5) However, FGFR2 rearrangements occur in less than 20% of ICC cases,(6) and only 1 of 28 samples harbors the RABGAP1L‐NTRK1 gene fusion,(7) making FGFR2 and NTRK inhibitors clinically relevant only for a relatively small subset of patients.

Show Full Abstract

Recent studies support the development of cancer therapeutics to target Globo H-ceramide, the most prevalent tumor-associated carbohydrate antigen in epithelial cancers. Herein, we evaluated the expression of Globo H and its prognostic significance in intrahepatic cholangiocarcinoma (ICC) and conducted preclinical studies to assess the antitumor activity of Globo H-specific antibody in thioacetamide (TAA)-induced ICC in rats. Globo H-ceramide in tumor specimens was detected by immunohistochemistry (IHC) and mass spectrometry. Antitumor efficacy of anti-Globo H mAbVK9 was evaluated in TAA-induced ICC in rat. Natural killer (NK) cells and their related genes were analyzed by IHC and quantitative real-time polymerase chain reaction. Data mining revealed that B3GALT5 and FUT2, the key enzymes for Globo H biosynthesis, were significantly up-regulated in human ICC. In addition, Globo H expression was detected in 41% (63 of 155) of ICC tumor specimens by IHC staining, and validated by mass spectrometric analysis of two IHC-positive tumors. Patients with Globo H positive tumors had significantly shorter relapse-free survival (RFS) and overall survival (P = 0.0003 and P = 0.002, respectively). Multivariable Cox regression analysis identified Globo H expression as an independent unfavorable predictor for RFS (hazard ratio: 1.66, 95% confidence interval: 1.08-2.36, P = 0.02) in ICC. Furthermore, gradual emergence of Globo H in liver tissues over 6 months in TAA-treated rats recapitulated the multistage progression of ICC in vivo. Importantly, administration of anti-Globo H mAbVK9 in rats bearing TAA-induced ICC significantly suppressed tumor growth with increased NK cells in the tumor microenvironment. Conclusion: Globo H is a theranostic marker in ICC.

Also flagged:Systemic Sclerosisgene expressionwound healingimmunologicalautoimmune diseasepathogenesis
Journal Article 2021-08-24 No Snippets Rusek M, Krasowska D.
Show Full Abstract

Epigenetic factors are heritable and ultimately play a role in modulating gene expression and, thus, in regulating cell functions. Non-coding RNAs have growing recognition as novel biomarkers and crucial regulators of pathological conditions in humans. Their characteristic feature is being transcribed in a tissue-specific pattern. Now, there is emerging evidence that lncRNAs have been identified to be involved in the differentiation of human skin, wound healing, fibrosis, inflammation, and immunological response. Systemic sclerosis (SSc) is a heterogeneous autoimmune disease characterized by fibrosis, vascular abnormalities, and immune system activation. The pathogenesis remains elusive, but clinical manifestations reveal autoimmunity with the presence of specific autoantibodies, activation of innate and adaptive immunity, vascular changes, and active deposition of extracellular matrix components leading to fibrosis. The use of multi-omics studies, including NGS, RNA-seq, or GWAS, has proposed that the non-coding genome may be a significant player in its pathogenesis. Moreover, it may unravel new therapeutic targets in the future. The aim of this review is to show the pathogenic role of long non-coding RNAs in systemic sclerosis. Investigation of these transcripts' functions has the potential to elucidate the molecular pathology of SSc and provide new opportunities for drug-targeted therapy for this disorder.

Also flagged:Inflammatory Disordersneurological diseasesneuromuscular diseasesneuromuscular disordersamyotrophic lateral sclerosisALS
Journal Article 2021-08-24 ✓ 1 Snippet Krause K, Wulf M, Sommer P, Barkovits K, Vorgerd M, Marcus K, Eggers B.
In-Text Gene Mentions

Interestingly, CXCL8, IL-7 and IL-12 exhibited elevated levels in ALS compared to OND in the study reported by Tateishi et al., therefore the relation between HFE variants remains unclear.

Show Full Abstract

Cerebrospinal fluid (CSF) diagnostics has emerged as a valid tool for a variety of neurological diseases. However, CSF diagnostics has been playing a subordinate role in the diagnosis of many neurological conditions. Thus, in the multitude of neuromuscular diseases in which motor neurons are affected, a CSF sample is rarely taken routinely. However, CSF diagnostics has the potential to specify the diagnosis and monitor the treatment of neuromuscular disorders. In this review, we therefore focused on a variety of neuromuscular diseases, among them amyotrophic lateral sclerosis (ALS), peripheral neuropathies, and spinal muscular atrophy (SMA), for which CSF diagnostics has emerged as a promising option for determining the disease itself and its progression. We focus on potentially valuable biomarkers among different disorders, such as neurofilaments, cytokines, other proteins, and lipids to determine their suitability, differentiating between different neurological disorders and their potential to determine early disease onset, disease progression, and treatment outcome. We further recommend novel approaches, e.g., the use of mass spectrometry as a promising alternative techniques to standard ELISA assays, potentially enhancing biomarker significance in clinical applications.

Also flagged:Chromosomecolorectal cancercancertyrosine kinaseapparatusmicrotubules
Journal Article 2021-08-24 No Snippets Voutsadakis IA.
Show Full Abstract

<i>Background and objectives</i>: The chromosome locus 20q11.21 is a commonly amplified locus in colorectal cancer, with a prevalence of 8% to 9%. Several candidate cancer-associated genes are transcribed from the locus. The therapeutic implications of the amplification in colorectal cancer remain unclear. <i>Materials and Methods</i>: Preclinical cell line models of colorectal cancer included in the Cancer Cell Line Encyclopedia (CCLE) collection were examined for the presence of amplifications in 20q11.21 genes. Correlations of the presence of 20q11.21 amplifications with gene essentialities and drug sensitivities were surveyed on salient databases for determination of therapeutic leads. <i>Results</i>: A significant subset of colorectal cancer cell lines in the CCLE (12 of 63 cell lines, 19%) bear amplifications of genes located at 20q11.21. Cancer-associated genes of the locus include <i>ASXL1</i>, <i>DNMT3B</i>, <i>BCL2L1</i>, <i>TPX2</i>, <i>KIF3B</i> and <i>POFUT1</i>. These genes are all amplified in the 12 cell lines, but they are variably over-expressed at the mRNA level, compared to non-amplified lines. 20q11.21 amplified cell lines are sensitive to various tyrosine kinase inhibitors and are resistant to chemotherapy drugs targeting the mitotic apparatus and microtubules. CRISPR and RNAi dependencies screening revealed, besides the β-catenin and <i>KRAS</i> genes, a few recurrent gene dependencies in more than one cell line, including <i>YAP1</i> and <i>JUP</i>. <i>Conclusions</i>: Cell line models of colorectal cancer with 20q11.21 gene amplifications display dependencies on the presence of specific genes and resistance or sensitivity to specific drugs and drug categories. Observations from in vitro models may form the basis for clinical drug development in this subtype of colorectal cancer. Genetic lesions conferring synthetic lethality to certain drugs or categories of drugs could be discovered with this approach.

Also flagged:Dll1Wnt3beta-cateninDll4Wnt6renal interstitial fibrosis
Journal Article 2021-08-23 ✓ 5 Snippets Kaji I, Roland JT, Rathan-Kumar S, Engevik AC, Burman A, Goldstein AE, Watanabe M, Goldenring JR.
In-Text Gene Mentions

…1:4000, 20085, ImmunoStar),OLFM4(rabbit monoclonal, 1:200,…

…olfactomedin 4 (Olfm4) ( 7…

…we stained forOLFM4and MCT1 in…

…Intense signals forOLFM4were limited to…

…intestine, while theOLFM4-expressing crypt region was…

Show Full Abstract

Functional loss of myosin Vb (MYO5B) induces a variety of deficits in intestinal epithelial cell function and causes a congenital diarrheal disorder, microvillus inclusion disease (MVID). The impact of MYO5B loss on differentiated cell lineage choice has not been investigated. We quantified the populations of differentiated epithelial cells in tamoxifen-induced, epithelial cell-specific MYO5B-knockout (VilCreERT2 Myo5bfl/fl) mice utilizing digital image analysis. Consistent with our RNA-sequencing data, MYO5B loss induced a reduction in tuft cells in vivo and in organoid cultures. Paneth cells were significantly increased by MYO5B deficiency along with expansion of the progenitor cell zone. We further investigated the effect of lysophosphatidic acid (LPA) signaling on epithelial cell differentiation. Intraperitoneal LPA significantly increased tuft cell populations in both control and MYO5B-knockout mice. Transcripts for Wnt ligands were significantly downregulated by MYO5B loss in intestinal epithelial cells, whereas Notch signaling molecules were unchanged. Additionally, treatment with the Notch inhibitor dibenzazepine (DBZ) restored the populations of secretory cells, suggesting that the Notch pathway is maintained in MYO5B-deficient intestine. MYO5B loss likely impairs progenitor cell differentiation in the small intestine in vivo and in vitro, partially mediated by Wnt/Notch imbalance. Notch inhibition and/or LPA treatment may represent an effective therapeutic approach for treatment of MVID.

Also flagged:TMPRSS2S3BACE2S3AHIV infectioninterferon
Journal Article 2021-08-23 ✓ 2 Snippets Fardoos R, Asowata OE, Herbert N, Nyquist SK, Zungu Y, Singh A, Ngoepe A, Mbano IM, Mthabela N, Ramjit D, Karim F, Kuhn W, Madela FG, Manzini VT, Anderson F, Berger B, Pers TH, Shalek AK, Leslie A, Kløverpris HN.
In-Text Gene Mentions

Using a Monocle single-cell trajectory analysis, we uncovered a clear potential differentiation trajectory from “intestinal stem cell–like” cells (LGR5, CD44, EPHB2), through transit amplifying cells (OLFM4) and Paneth cells (DEFA5, DEFA6), to the dominant absorptive enterocyte clusters (APOA1, APOA4) enriched for putative SARS-CoV-2–susceptible cells (Supplemental Figure 4), suggesting that terminal differentiated cells are likely to be the most susceptible to infection.

…amplifying cells (OLFM4) and Paneth…

Show Full Abstract

SARS-CoV-2 infects epithelial cells of the human gastrointestinal (GI) tract and causes related symptoms. HIV infection impairs gut homeostasis and is associated with an increased risk of COVID-19 fatality. To investigate the potential link between these observations, we analyzed single-cell transcriptional profiles and SARS-CoV-2 entry receptor expression across lymphoid and mucosal human tissue from chronically HIV-infected individuals and uninfected controls. Absorptive gut enterocytes displayed the highest coexpression of SARS-CoV-2 receptors ACE2, TMPRSS2, and TMPRSS4, of which ACE2 expression was associated with canonical interferon response and antiviral genes. Chronic treated HIV infection was associated with a clear antiviral response in gut enterocytes and, unexpectedly, with a substantial reduction of ACE2 and TMPRSS2 target cells. Gut tissue from SARS-CoV-2-infected individuals, however, showed abundant SARS-CoV-2 nucleocapsid protein in both the large and small intestine, including an HIV-coinfected individual. Thus, upregulation of antiviral response genes and downregulation of ACE2 and TMPRSS2 in the GI tract of HIV-infected individuals does not prevent SARS-CoV-2 infection in this compartment. The impact of these HIV-associated intestinal mucosal changes on SARS-CoV-2 infection dynamics, disease severity, and vaccine responses remains unclear and requires further investigation.

Also flagged:Msh2Bcdin3dPtpn2Cox11Tbr1Ppil3
Journal Article 2021-08-23 ✓ 3 Snippets De Rosa MC, Glover HJ, Stratigopoulos G, LeDuc CA, Su Q, Shen Y, Sleeman MW, Chung WK, Leibel RL, Altarejos JY, Doege CA.
In-Text Gene Mentions

Cacna1e

Some of the genes present in these modules have been functionally associated with obesity, including Irs1 (105), Sdccag8 (106, 107), Negr1 (108–111), Ksr2 (112, 113), Tlr4 (114, 115), and Sh2b1 (116, 117).

…, 107 ),Negr1( 108 –…

Show Full Abstract

Energy balance is controlled by interconnected brain regions in the hypothalamus, brainstem, cortex, and limbic system. Gene expression signatures of these regions can help elucidate the pathophysiology underlying obesity. RNA sequencing was conducted on P56 C57BL/6NTac male mice and E14.5 C57BL/6NTac embryo punch biopsies in 16 obesity-relevant brain regions. The expression of 190 known obesity-associated genes (monogenic, rare, and low-frequency coding variants; GWAS; syndromic) was analyzed in each anatomical region. Genes associated with these genetic categories of obesity had localized expression patterns across brain regions. Known monogenic obesity causal genes were highly enriched in the arcuate nucleus of the hypothalamus and developing hypothalamus. The obesity-associated genes clustered into distinct "modules" of similar expression profile, and these were distinct from expression modules formed by similar analysis with genes known to be associated with other disease phenotypes (type 1 and type 2 diabetes, autism, breast cancer) in the same energy balance-relevant brain regions.

Also flagged:leptinAlzheimer's diseaseADsleepBMAL1PER2
Journal Article 2021-08-23 No Snippets Clement A, Pedersen MM, Stensballe A, Wiborg O, Asuni AA.
Show Full Abstract

Neuropsychiatric disturbances (NPDs) are considered hallmarks of Alzheimer's disease (AD). Nevertheless, treatment of these symptoms has proven difficult and development of safe and effective treatment options is hampered by the limited understanding of the underlying pathophysiology. Thus, robust preclinical models are needed to increase knowledge of NPDs in AD and develop testable hypotheses and novel treatment options. Abnormal activity of the hypothalamic-pituitary-adrenal (HPA) axis is implicated in many psychiatric symptoms and might contribute to both AD and NPDs development and progression. We aimed to establish a mechanistic preclinical model of NPD-like behavior in the APPPS1 mouse model of AD and wildtype (WT) littermates. In APPPS1 and WT mice, we found that chronic stress increased anxiety-like behavior and altered diurnal locomotor activity suggestive of sleep disturbances. Also, chronic stress activated the HPA axis, which, in WT mice, remained heightened for additional 3 weeks. Chronic stress caused irregular expression of circadian regulatory clock genes (BMAL1, PER2, CRY1 and CRY2) in both APPPS1 and WT mice. Interestingly, APPPS1 and WT mice responded differently to chronic stress in terms of expression of serotonergic markers (5-HT<sub>1A</sub> receptor and MAOA) and inflammatory genes (IL-6, STAT3 and ADMA17). These findings indicate that, although the behavioral response to chronic stress might be similar, the neurobiochemical response was different in APPPS1 mice, which is an important insight in the efforts to develop safe and effective treatments options for NPDs in AD patients. Further work is needed to substantiate these findings.

Also flagged:runkeyyouhappyhowcolony-stimulating factor 1 receptor
Journal Article 2021-08-23 ✓ 1 Snippet Hohsfield LA, Najafi AR, Ghorbanian Y, Soni N, Crapser J, Figueroa Velez DX, Jiang S, Royer SE, Kim SJ, Henningfield CM, Anderson A, Gandhi SP, Mortazavi A, Inlay MA, Green KN.
In-Text Gene Mentions

…Zfp51, Thumpd1, Prmt5,Taok3, Psmd11, Tox, Stat3…

Show Full Abstract

Microglia, the brain's resident myeloid cells, play central roles in brain defense, homeostasis, and disease. Using a prolonged colony-stimulating factor 1 receptor inhibitor (CSF1Ri) approach, we report an unprecedented level of microglial depletion and establish a model system that achieves an empty microglial niche in the adult brain. We identify a myeloid cell that migrates from the subventricular zone and associated white matter areas. Following CSF1Ri, these amoeboid cells migrate radially and tangentially in a dynamic wave filling the brain in a distinct pattern, to replace the microglial-depleted brain. These repopulating cells are enriched in disease-associated microglia genes and exhibit similar phenotypic and transcriptional profiles to white-matter-associated microglia. Our findings shed light on the overlapping and distinct functional complexity and diversity of myeloid cells of the CNS and provide new insight into repopulating microglia function and dynamics in the mouse brain.

Also flagged:nucleusbehaviouralobesityleptininsulinghrelin
Journal Article 2021-08-23 ✓ 1 Snippet Freeman AK, Glendining KA, Jasoni CL.
In-Text Gene Mentions

…of genes encodingDcc/Netrin-1, Robo1/Slit1 and Fzd…

Show Full Abstract

The arcuate nucleus of the hypothalamus is central in the regulation of body weight homeostasis through its ability to sense peripheral metabolic signals and relay them, through neural circuits, to other brain areas, ultimately affecting physiological and behavioural changes. The early postnatal development of these neural circuits is critical for normal body weight homeostasis, such that perturbations during this critical period can lead to obesity. The role for peripheral regulators of body weight homeostasis, including leptin, insulin and ghrelin, in this postnatal development is well described, yet some of the fundamental processes underpinning axonal and dendritic growth remain unclear. Here, we hypothesised that molecules known to regulate axonal and dendritic growth processes in other areas of the developing brain would be expressed in the postnatal arcuate nucleus and/or target nuclei where they would function to mediate the development of this circuitry. Using state-of-the-art RNAscope<sup>®</sup> technology, we have revealed the expression patterns of genes encoding Dcc/Netrin-1, Robo1/Slit1 and Fzd5/Wnt5a receptor/ligand pairs in the early postnatal mouse hypothalamus. We found that individual genes had unique expression patterns across developmental time in the arcuate nucleus, paraventricular nucleus of the hypothalamus, ventromedial nucleus of the hypothalamus, dorsomedial nucleus of the hypothalamus, median eminence and, somewhat unexpectedly, the third ventricle epithelium. These observations indicate a number of new molecular players in the development of neural circuits regulating body weight homeostasis, as well as novel molecular markers of tanycyte heterogeneity.

Also flagged:HuntingtinPolyglutamineprionHsp104polyprolineprions
Journal Article 2021-08-23 ✓ 1 Snippet Wayne NJ, Dembny KE, Pease T, Saba F, Zhao X, Masison DC, Greene LE.
In-Text Gene Mentions

Htt

Show Full Abstract

The aggregation of huntingtin fragments with expanded polyglutamine repeat regions (HttpolyQ) that cause Huntington's disease depends on the presence of a prion with an amyloid conformation in yeast. As a result of this relationship, HttpolyQ aggregation indirectly depends on Hsp104 due to its essential role in prion propagation. We find that HttQ103 aggregation is directly affected by Hsp104 with and without the presence of [<i>RNQ<sup>+</sup></i>] and [<i>PSI<sup>+</sup></i>] prions. When we inactivate Hsp104 in the presence of prion, yeast cells have only one or a few large HttQ103 aggregates rather than numerous smaller aggregates. When we inactivate Hsp104 in the absence of prion, there is no significant aggregation of HttQ103, whereas with active Hsp104, HttQ103 aggregates accumulate slowly due to the severing of spontaneously nucleated aggregates by Hsp104. We do not observe either effect with HttQ103P, which has a polyproline-rich region downstream of the polyglutamine region, because HttQ103P does not spontaneously nucleate and Hsp104 does not efficiently sever the prion-nucleated HttQ103P aggregates. Therefore, the only role of Hsp104 in HttQ103P aggregation is to propagate yeast prion. In conclusion, because Hsp104 efficiently severs the HttQ103 aggregates but not HttQ103P aggregates, it has a marked effect on the aggregation of HttQ103 but not HttQ103P.

Also flagged:SEC61transloconmycolactoneEIF2S1immunosuppressionBuruli ulcer
Journal Article 2021-08-23 ✓ 1 Snippet Hall BS, Dos Santos SJ, Hsieh LT, Manifava M, Ruf MT, Pluschke G, Ktistakis N, Simmonds RE.
In-Text Gene Mentions

…the ER proteinCCPG1(cell cycle progression…

Show Full Abstract

The <i>Mycobacterium ulcerans</i> exotoxin, mycolactone, is responsible for the immunosuppression and tissue necrosis that characterizes Buruli ulcer. Mycolactone inhibits SEC61-dependent co-translational translocation of proteins into the endoplasmic reticulum and the resultant cytosolic translation triggers degradation of mislocalized proteins by the ubiquitin-proteasome system. Inhibition of SEC61 by mycolactone also activates multiple EIF2S1/eIF2α kinases in the integrated stress response (ISR). Here we show mycolactone increased canonical markers of selective macroautophagy/autophagy LC3B-II, ubiquitin and SQSTM1/p62 in diverse disease-relevant primary cells and cell lines. Increased formation of puncta positive for the early autophagy markers WIPI2, RB1CC1/FIP200 and ATG16L1 indicates increased initiation of autophagy. The mycolactone response was SEC61A1-dependent and involved a pathway that required RB1CC1 but not ULK. Deletion of <i>Sqstm1</i> reduced cell survival in the presence of mycolactone, suggesting this response protects against the increased cytosolic protein burden caused by the toxin. However, reconstitution of baseline SQSTM1 expression in cells lacking all autophagy receptor proteins could not rescue viability. Translational regulation by EIF2S1 in the ISR plays a key role in the autophagic response to mycolactone. Mycolactone-dependent induction of SQSTM1 was reduced in <i>eif2ak3<sup>-/-</sup>/perk</i><sup>-/-</sup> cells while the p-EIF2S1 antagonist ISRIB reversed the upregulation of SQSTM1 and reduced RB1CC1, WIPI2 and LC3B puncta formation. Increased SQSTM1 staining could be seen in Buruli ulcer patient skin biopsy samples, reinforcing genetic data that suggests autophagy is relevant to disease pathology. Since selective autophagy and the ISR are both implicated in neurodegeneration, cancer and inflammation, the pathway uncovered here may have a broad relevance to human disease.<b>Abbreviations:</b> ATF4: activating transcription factor 4; ATG: autophagy related; BAF: bafilomycin A<sub>1</sub>; ATG16L1: autophagy related 16 like 1; BU: Buruli ulcer; CQ: chloroquine; EIF2AK3: eukaryotic translation initiation factor 2 alpha kinase 3; CALCOCO2: calcium binding and coiled-coil domain 2; DMSO: dimethyl sulfoxide; EIF2S1: eukaryotic translation initiation factor 2 subunit alpha; ER: endoplasmic reticulum; GFP: green fluorescent protein; HDMEC: human dermal microvascular endothelial cells; HFFF: human fetal foreskin fibroblasts; ISR: integrated stress response; ISRIB: integrated stress response inhibitor; MAP1LC3B/LC3B: microtubule associated protein 1 light chain 3 beta; MEF: mouse embryonic fibroblast; Myco: mycolactone; NBR1: NBR1 autophagy cargo receptor; NFE2L2: nuclear factor, erythroid 2 like 2; OPTN: optineurin; PFA: paraformaldehyde; PtdIns3P: phosphatidylinositol-3-phosphate; RB1CC1: RB1-inducible coiled coil 1; SQSTM1: sequestosome 1; TAX1BP1: Tax1 binding protein 1; ULK: unc-51 like autophagy activating kinase; UPS: ubiquitin-proteasome system; WIPI: WD repeat domain, phosphoinositide interacting; WT: wild type.

Also flagged:Peroxiredoxin 6Fertilizationembryo developmentlumen
Journal Article 2021-08-23 ✓ 5 Snippets Popli P, Shukla V, Kaushal JB, Kumar R, Gupta K, Dwivedi A.
In-Text Gene Mentions

…protein, Peroxiredoxin 6 (PRDX6), and evaluated its…

…The expression ofPRDX6was significantly higher…

…embryos recovered fromPRDX6siRNA-transfected oviductal ho…

…in animals receivingPRDX6siRNA in their…

…EC) co-culture, siRNA-mediatedPRDX6silencing attenuated the…

Show Full Abstract

The oviduct is a site for early reproductive events including gamete maturation, fertilization, and early embryo development. Secretory cells lining the oviduct lumen synthesize and secrete proteins that interact with gametes and developing embryos. Although previous studies have identified some of the secretory proteins in the oviduct, however, knowledge and their precise specific functions in the oviduct are poorly understood. In this study, by using proteomic approach, we identified a secretory protein, Peroxiredoxin 6 (PRDX6), and evaluated its role in mediating early pregnancy events, fertilization, and embryo development in rabbit oviduct. The expression of PRDX6 was significantly higher in ampulla and isthmus sections of the oviduct in mated animal groups compared to non-mated controls. Furthermore, significant reduction in number of embryos recovered from PRDX6 siRNA-transfected oviductal horn was observed compared to the control contralateral horn. Moreover, in animals receiving PRDX6 siRNA in their oviductal horn, the number of implanted blastocysts was significantly less in the uterus as observed on day 9 post-coital (p.c.). Further, during embryo-rabbit oviduct epithelial cell (ROEC) co-culture, siRNA-mediated PRDX6 silencing attenuated the early embryonic development. Mechanistically, increased levels of ROS and expression of oxidative stress- and inflammation-related proteins were found in PRDX6 siRNA-treated ROEC cells as compared to control cells, implicating that ablation of PRDX6 in the oviduct creates a stress-induced micro-environment detrimental to early embryonic development in oviduct. Taken together, our data suggest that PRDX6 maintains an optimal micro-environment conducive to successful embryo development and can be considered as a candidate to evaluate its therapeutic potential in IVF strategies.

Also flagged:actinCell proliferationagingprotein βcell adhesionFSTL3
Journal Article 2021-08-23 ✓ 1 Snippet Dai ZT, Xiang Y, Zhang XY, Zong QB, Wu QF, Huang Y, Shen C, Li JP, Ponnambalam S, Liao XH.
In-Text Gene Mentions

…tor alongside olfactomedin-4 (OLFM4) and fibroblast growth…

Show Full Abstract

Cancer development and progression can be regulated by the levels of endogenous factors. Gastric cancer is an aggressive disease state with poor patient prognosis, needing the development of new diagnostics and therapeutic strategies. We investigated the close association between follistatin-like 3 (FSTL3) and different cancers, and focused on its role in gastric cancer cell function. Using cancer bioinformatics, we found that FSTL3 expression is elevated in a large majority of the 33 cancers we analyzed in publicly available cancer databases. Elevated levels of FSTL3 is associated with poor patient prognosis in gastric cancer. In a comparison of normal gastric epithelial cells and gastric cancer cell lines, FSTL3 expression was consistently elevated in gastric cancer cells. Overexpression of FSTL3 promoted gastric cancer cell viability, proliferation and migration. Conversely, FSTL3 knockdown inhibits these cellular processes. Using bioinformatics, we found that the <i>FSTL3</i> mRNA has a potential binding site in the 3'-UTR for a small microRNA, miR-486-5p. Further bioinformatics revealed significant negative correlation between FSTL3 and miR-486-5p levels. Using luciferase reporter constructs, we provide evidence that the 3'UTR from the <i>FSTL3</i> mRNA can confer downregulation in the presence of miR-486-5p. These studies lead us to conclude that FSTL3 has oncogenic properties and increased expression of this gene product promotes gastric cancer development and progression.

Also flagged:doxorubicintumorcancercell cycleDNA topoisomerase IItumors
Journal Article 2021-08-23 ✓ 5 Snippets Khalili-Tanha G, Moghbeli M.
In-Text Gene Mentions

BANCR downregulation inhibits tumor progression and promotes the sensitivity of CRC cells to DOX by modulating the miR-203/CSE1L axis [191].

…romosomal segregation 1-like (CSE1L) plays a critical…

…BANCR andCSE1Loverexpressions have been…

…been found betweenCSE1Land BANCR expressions…

…BANCR increasesCSE1Lexpression through miR-203…

Show Full Abstract

Resistance against conventional chemotherapeutic agents is one of the main reasons for tumor relapse and poor clinical outcomes in cancer patients. Various mechanisms are associated with drug resistance, including drug efflux, cell cycle, DNA repair and apoptosis. Doxorubicin (DOX) is a widely used first-line anti-cancer drug that functions as a DNA topoisomerase II inhibitor. However, DOX resistance has emerged as a large hurdle in efficient tumor therapy. Furthermore, despite its wide clinical application, DOX is a double-edged sword: it can damage normal tissues and affect the quality of patients' lives during and after treatment. It is essential to clarify the molecular basis of DOX resistance to support the development of novel therapeutic modalities with fewer and/or lower-impact side effects in cancer patients. Long non-coding RNAs (lncRNAs) have critical roles in the drug resistance of various tumors. In this review, we summarize the state of knowledge on all the lncRNAs associated with DOX resistance. The majority are involved in promoting DOX resistance. This review paves the way to introducing an lncRNA panel marker for the prediction of the DOX response and clinical outcomes for cancer patients.

Also flagged:Microtubule-associated protein tauneurodegenerative diseasestauopathiestautauopathyAD
Journal Article 2021-08-23 No Snippets Chung DC, Roemer S, Petrucelli L, Dickson DW.
Show Full Abstract

Microtubule-associated protein tau is abnormally aggregated in neuronal and glial cells in a range of neurodegenerative diseases that are collectively referred to as tauopathies. Multiple studies have suggested that pathological tau species may act as a seed that promotes aggregation of endogenous tau in naïve cells and contributes to propagation of tau pathology. While they share pathological tau aggregation as a common feature, tauopathies are distinct from one another with respect to predominant tau isoforms that accumulate and the selective vulnerability of brain regions and cell types that have tau inclusions. For instance, primary tauopathies present with glial tau pathology, while it is mostly neuronal in Alzheimer's disease (AD). Also, morphologies of tau inclusions can greatly vary even within the same cell type, suggesting distinct mechanisms or distinct tau conformers in each tauopathy. Neuropathological heterogeneity across tauopathies challenges our understanding of pathophysiology behind tau seeding and aggregation, as well as our efforts to develop effective therapeutic strategies for AD and other tauopathies. In this review, we describe diverse neuropathological features of tau inclusions in neurodegenerative tauopathies and discuss what has been learned from experimental studies with mouse models, advanced transcriptomics, and cryo-electron microscopy (cryo-EM) on the biology underlying cell type-specific tau pathology.

Also flagged:ArxethanolNkx2.1gene expressionmethylationDlx1
Journal Article 2021-08-23 ✓ 4 Snippets Legault LM, Doiron K, Breton-Larrivée M, Langford-Avelar A, Lemieux A, Caron M, Jerome-Majewska LA, Sinnett D, McGraw S.
In-Text Gene Mentions

Sox6

…factors such asSox6(DMR in gene…

…expression alteration (Sox6; males and…

…Nkx6, Vwc2 ,Sox6).…

Show Full Abstract

<h4>Background</h4>Prenatal alcohol exposure is recognized for altering DNA methylation profiles of brain cells during development, and to be part of the molecular basis underpinning Fetal Alcohol Spectrum Disorder (FASD) etiology.  However, we have negligible information on the effects of alcohol exposure during pre-implantation, the early embryonic window marked with dynamic DNA methylation reprogramming, and on how this may rewire the brain developmental program.<h4>Results</h4>Using a pre-clinical in vivo mouse model, we show that a binge-like alcohol exposure during pre-implantation at the 8-cell stage leads to surge in morphological brain defects and adverse developmental outcomes during fetal life. Genome-wide DNA methylation analyses of fetal forebrains uncovered sex-specific alterations, including partial loss of DNA methylation maintenance at imprinting control regions, and abnormal de novo DNA methylation profiles in various biological pathways (e.g., neural/brain development).<h4>Conclusion</h4>These findings support that alcohol-induced DNA methylation programming deviations during pre-implantation could contribute to the manifestation of neurodevelopmental phenotypes associated with FASD.

Also flagged:response to hypoxiaHIF-1S1BXPCions2-hydroxyglutarate
Journal Article 2021-08-23 No Snippets Ciminera AK, Shuck SC, Termini J.
Show Full Abstract

We investigated potential mechanisms by which elevated glucose may promote genomic instability. Gene expression studies, protein measurements, mass spectroscopic analyses, and functional assays revealed that elevated glucose inhibited the nucleotide excision repair (NER) pathway, promoted DNA strand breaks, and increased levels of the DNA glycation adduct <i>N</i> <sup><i>2</i></sup> -(1-carboxyethyl)-2'-deoxyguanosine (CEdG). Glycation stress in NER-competent cells yielded single-strand breaks accompanied by ATR activation, γH2AX induction, and enhanced non-homologous end-joining and homology-directed repair. In NER-deficient cells, glycation stress activated ATM/ATR/H2AX, consistent with double-strand break formation. Elevated glucose inhibited DNA repair by attenuating hypoxia-inducible factor-1α-mediated transcription of NER genes via enhanced 2-ketoglutarate-dependent prolyl hydroxylase (PHD) activity. PHD inhibition enhanced transcription of NER genes and facilitated CEdG repair. These results are consistent with a role for hyperglycemia in promoting genomic instability as a potential mechanism for increasing cancer risk in metabolic disease. Because of the pleiotropic functions of many NER genes beyond DNA repair, these results may have broader implications for cellular pathophysiology.

Also flagged:liver canceragingHCCRFSADAM15PTPRC
Journal Article 2021-08-23 ✓ 3 Snippets Xu JH, Guan YJ, Zhang YC, Qiu ZD, Zhou Y, Chen C, Yu J, Wang WX.
In-Text Gene Mentions

TNFSF4

…PTPRC, CD28, ICOS,TNFSF4and JAK2 expression…

…CD80, LDHA, TNFRSF4,TNFSF4and YTHDF1 showed…

Show Full Abstract

ADAM15 is highly expressed in malignant tumors and is correlated with tumor progression. However, the role of ADAM15 in hepatocellular carcinoma (HCC) remains unclear. In the study, our results indicated that ADAM15 was highly expressed in HCC tissues and cells compared with corresponding tissues and liver cells. Overexpression of ADAM15 was linked to poor prognosis, and was an independent risk factor for HCC prognosis. Besides, analysis of immune infiltration indicated that ADAM15 expression was related to tumor infiltrating lymphocytes based on the TIMER, TISIDB and GEPIA databases. Many immune checkpoint gene expression was associated with ADAM15 expression. Functional enrichment analyses indicated that apoptosis, cell adhesion was enriched. ADAM15 knockdown promoted apoptosis and suppressed proliferation, migration and invasion of liver cancer cells. The findings of western blot showed that ADAM15 knockdown reduced the expression of Bcl-2, Vimentin, N-Cadherin and Snail, and elevated the expression of Bax, E-cadherin and ZO-1. However, overexpression of ADAM15 had the opposite results. Collectively, our findings demonstrated that ADAM15 was connected with poor prognosis of HCC patients, and could be considered as a potential biomarker for the diagnosis and treatment of HCC.

Also flagged:folic acidNucleotidegene expressionCHMP1Atranscription factor bindingtop
Journal Article 2021-08-23 ✓ 1 Snippet Guan Y, Liang X, Ma Z, Hu H, Liu H, Miao Z, Linkermann A, Hellwege JN, Voight BF, Susztak K.
In-Text Gene Mentions

…disease 45 ,hemochromatosis46 , and…

Show Full Abstract

Genome-wide association studies (GWAS) have identified loci for kidney disease, but the causal variants, genes, and pathways remain unknown. Here we identify two kidney disease genes Dipeptidase 1 (DPEP1) and Charged Multivesicular Body Protein 1 A (CHMP1A) via the triangulation of kidney function GWAS, human kidney expression, and methylation quantitative trait loci. Using single-cell chromatin accessibility and genome editing, we fine map the region that controls the expression of both genes. Mouse genetic models demonstrate the causal roles of both genes in kidney disease. Cellular studies indicate that both Dpep1 and Chmp1a are important regulators of a single pathway, ferroptosis and lead to kidney disease development via altering cellular iron trafficking.

Also flagged:SynapsinSegmentationrunpeptidesPhosphorylationcell bodies
Journal Article 2021-08-23 ✓ 1 Snippet Cheng C, Reis SA, Adams ET, Fass DM, Angus SP, Stuhlmiller TJ, Richardson J, Olafson H, Wang ET, Patnaik D, Beauchamp RL, Feldman DA, Silva MC, Sur M, Johnson GL, Ramesh V, Miller BL, Temple S, Kosik KS, Dickerson BC, Haggarty SJ.
In-Text Gene Mentions

…layers II-III ( BRN2/POU3F2).…

Show Full Abstract

Mutations in MAPT (microtubule-associated protein tau) cause frontotemporal dementia (FTD). MAPT mutations are associated with abnormal tau phosphorylation levels and accumulation of misfolded tau protein that can propagate between neurons ultimately leading to cell death (tauopathy). Recently, a p.A152T tau variant was identified as a risk factor for FTD, Alzheimer's disease, and synucleinopathies. Here we used induced pluripotent stem cells (iPSC) from a patient carrying this p.A152T variant to create a robust, functional cellular assay system for probing pathophysiological tau accumulation and phosphorylation. Using stably transduced iPSC-derived neural progenitor cells engineered to enable inducible expression of the pro-neural transcription factor Neurogenin 2 (Ngn2), we generated disease-relevant, cortical-like glutamatergic neurons in a scalable, high-throughput screening compatible format. Utilizing automated confocal microscopy, and an advanced image-processing pipeline optimized for analysis of morphologically complex human neuronal cultures, we report quantitative, subcellular localization-specific effects of multiple kinase inhibitors on tau, including ones under clinical investigation not previously reported to affect tau phosphorylation. These results demonstrate the potential for using patient iPSC-derived ex vivo models of tauopathy as genetically accurate, disease-relevant systems to probe tau biochemistry and support the discovery of novel therapeutics for tauopathies.

Also flagged:SLIRPautosomal recessive mitochondrial encephalomyopathycomplex Imitochondrial encephalomyopathycomplex IVRNA-binding protein
Journal Article 2021-08-23 ✓ 2 Snippets Guo L, Engelen BPH, Hemel IMGM, de Coo IFM, Vreeburg M, Sallevelt SCEH, Hellebrekers DMEI, Jacobs EH, Sadeghi-Niaraki F, van Tienen FHJ, Smeets HJM, Gerards M.
In-Text Gene Mentions

FBXL4

F-box and leucine-rich repeat 4

Show Full Abstract

In a Dutch non-consanguineous patient having mitochondrial encephalomyopathy with complex I and complex IV deficiency, whole exome sequencing revealed two compound heterozygous variants in SLIRP. SLIRP gene encodes a stem-loop RNA-binding protein that regulates mitochondrial RNA expression and oxidative phosphorylation (OXPHOS). A frameshift and a deep-intronic splicing variant reduced the amount of functional wild-type SLIRP RNA to 5%. Consequently, in patient fibroblasts, MT-ND1, MT-ND6, and MT-CO1 expression was reduced. Lentiviral transduction of wild-type SLIRP cDNA in patient fibroblasts increased MT-ND1, MT-ND6, and MT-CO1 expression (2.5-7.2-fold), whereas mutant cDNAs did not. A fourfold decrease of citrate synthase versus total protein ratio in patient fibroblasts indicated that the resulting reduced mitochondrial mass caused the OXPHOS deficiency. Transduction with wild-type SLIRP cDNA led to a 2.4-fold increase of this ratio and partly restored OXPHOS activity. This confirmed causality of the SLIRP variants. In conclusion, we report SLIRP variants as a novel cause of mitochondrial encephalomyopathy with OXPHOS deficiency.

Also flagged:obesitybehaviouralcarbohydrateAgingcoronary artery diseasemetabolic diseases
Journal Article 2021-08-23 No Snippets Merino J, Dashti HS, Sarnowski C, Lane JM, Todorov PV, Udler MS, Song Y, Wang H, Kim J, Tucker C, Campbell J, Tanaka T, Chu AY, Tsai L, Pers TH, Chasman DI, Rutter MK, Dupuis J, Florez JC, Saxena R.
Show Full Abstract

Dietary intake is a major contributor to the global obesity epidemic and represents a complex behavioural phenotype that is partially affected by innate biological differences. Here, we present a multivariate genome-wide association analysis of overall variation in dietary intake to account for the correlation between dietary carbohydrate, fat and protein in 282,271 participants of European ancestry from the UK Biobank (n = 191,157) and Cohorts for Heart and Aging Research in Genomic Epidemiology Consortium (n = 91,114), and identify 26 distinct genome-wide significant loci. Dietary intake signals map exclusively to specific brain regions and are enriched for genes expressed in specialized subtypes of GABAergic, dopaminergic and glutamatergic neurons. We identified two main clusters of genetic variants for overall variation in dietary intake that were differently associated with obesity and coronary artery disease. These results enhance the biological understanding of interindividual differences in dietary intake by highlighting neural mechanisms, supporting functional follow-up experiments and possibly providing new avenues for the prevention and treatment of prevalent complex metabolic diseases.

Also flagged:neurological diseasescalciumextracellularRett syndromepifithrin-αbrain development
Journal Article 2021-08-23 ✓ 1 Snippet Samarasinghe RA, Miranda OA, Buth JE, Mitchell S, Ferando I, Watanabe M, Allison TF, Kurdian A, Fotion NN, Gandal MJ, Golshani P, Plath K, Lowry WE, Parent JM, Mody I, Novitch BG.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Brain organoids represent a powerful tool for studying human neurological diseases, particularly those that affect brain growth and structure. However, many diseases manifest with clear evidence of physiological and network abnormality in the absence of anatomical changes, raising the question of whether organoids possess sufficient neural network complexity to model these conditions. Here, we explore the network-level functions of brain organoids using calcium sensor imaging and extracellular recording approaches that together reveal the existence of complex network dynamics reminiscent of intact brain preparations. We demonstrate highly abnormal and epileptiform-like activity in organoids derived from induced pluripotent stem cells from individuals with Rett syndrome, accompanied by transcriptomic differences revealed by single-cell analyses. We also rescue key physiological activities with an unconventional neuroregulatory drug, pifithrin-α. Together, these findings provide an essential foundation for the utilization of brain organoids to study intact and disordered human brain network formation and illustrate their utility in therapeutic discovery.

Also flagged:acute myocardial infarctionautophagyTFEB
Journal Article 2021-08-23 ✓ 2 Snippets Wang B, Cao C, Han D, Bai J, Guo J, Guo Q, Li D, Zhang J, Zhang Z, Wang Y, Tang J, Shen D, Zhang J.
In-Text Gene Mentions

…revealed that theSOX6and TFEB genes…

…autophagy through targetingSOX6and TFEB, respectively.…

Show Full Abstract

Plasma exosomes derived from healthy people have been shown to be beneficial in terms of protecting against ischemia-reperfusion injury or acute myocardial infarction (AMI). However, a pathological condition may severely affect the constitution and biological activity of exosomes. In our study, we isolated plasma exosomes from healthy volunteers and convalescent AMI patients (3-7 d after onset). Compared to exosomes from healthy controls (Nor-Exo), exosomes from convalescent AMI patients (AMI-Exo) exhibited an impaired ability to repair damaged cardiomyocytes both in vitro and in vivo. miRNA sequencing and PCR analysis indicated that miR-342-3p was significantly downregulated in AMI-Exo. Moreover, miR-342-3p alleviated H<sub>2</sub>O<sub>2</sub>-induced injury and reduced apoptosis and autophagy in H9c2 cardiomyocytes, while in vivo restoration of miR-342-3p expression enhanced the reparative function of AMI-Exo. Further mechanistic studies revealed that the SOX6 and TFEB genes were two direct and functional targets of miR-342-3p. Taken together, during the early convalescent phase after AMI, dysregulated miR-342-3p in plasma exosomes might be responsible for their impaired cardioprotective potential. miR-342-3p contributed to exosome-mediated heart repair by inhibiting cardiomyocyte apoptosis and autophagy through targeting SOX6 and TFEB, respectively. Our work provided novel insights on the role of plasma exosomes in the natural process of cardiac repair after AMI and suggestions for therapy development.

Also flagged:Yes-associated proteinTAZcell growthcancertumorstranscription factors
Journal Article 2021-08-23 ✓ 2 Snippets Lopez-Hernandez A, Sberna S, Campaner S.
In-Text Gene Mentions

…canonical YAP targets (neuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1), matrix metalloproteinase 1…

Show Full Abstract

Yes-associated protein (YAP) and TAZ are transcriptional cofactors that sit at the crossroad of several signaling pathways involved in cell growth and differentiation. As such, they play essential functions during embryonic development, regeneration, and, once deregulated, in cancer progression. In this review, we will revise the current literature and provide an overview of how YAP/TAZ control transcription. We will focus on data concerning the modulation of the basal transcriptional machinery, their ability to epigenetically remodel the enhancer-promoter landscape, and the mechanisms used to integrate transcriptional cues from multiple pathways. This reveals how YAP/TAZ activation in cancer cells leads to extensive transcriptional control that spans several hallmarks of cancer. The definition of the molecular mechanism of transcriptional control and the identification of the pathways regulated by YAP/TAZ may provide therapeutic opportunities for the effective treatment of YAP/TAZ-driven tumors.

Also flagged:Sry-related HMG BOXSOXtranscription factorscancercancerscell cycle
Journal Article 2021-08-23 ✓ 2 Snippets Seok J, Gil M, Dayem AA, Saha SK, Cho SG.
In-Text Gene Mentions

…confidence included TP53,POU3F2, POU3F3, TCF7, TCF7L1,…

…KRAS, GATA3, TERT,POU3F2, POU3F3, SOX3, and…

Show Full Abstract

The Sry-related HMG BOX (SOX) gene family encodes transcription factors containing highly conserved high-mobility group domains that bind to the minor groove in DNA. Although some SOX genes are known to be associated with tumorigenesis and cancer progression, their expression and prognostic value have not been systematically studied. We performed multi-omic analysis to investigate the expression of SOX genes in human cancers. Expression and phylogenetic tree analyses of the SOX gene family revealed that the expression of three closely related SOX members, <i>SOX4</i>, <i>SOX11</i>, and <i>SOX12</i>, was increased in multiple cancers. Expression, mutation, and alteration of the three SOX members were evaluated using the Oncomine and cBioPortal databases, and the correlation between these genes and clinical outcomes in various cancers was examined using the Kaplan-Meier, PrognoScan, and R2 database analyses. The genes commonly correlated with the three SOX members were categorized in key pathways related to the cell cycle, mitosis, immune system, and cancer progression in liver cancer and sarcoma. Additionally, functional protein partners with three SOX proteins and their probable signaling pathways were explored using the STRING database. This study suggests the prognostic value of the expression of three SOX genes and their associated pathways in various human cancers.

Also flagged:Cell CycleTrp53transcription factorNfe2l2Nrf2Nox1
Journal Article 2021-08-23 ✓ 1 Snippet Kumar A, Tahimic CGT, Almeida EAC, Globus RK.
In-Text Gene Mentions

…, Cat ,Prdx6, Gsr ,…

Show Full Abstract

Spaceflight causes cardiovascular changes due to microgravity-induced redistribution of body fluids and musculoskeletal unloading. Cardiac deconditioning and atrophy on Earth are associated with altered <i>Trp53</i> and oxidative stress-related pathways, but the effects of spaceflight on cardiac changes at the molecular level are less understood. We tested the hypothesis that spaceflight alters the expression of key genes related to stress response pathways, which may contribute to cardiovascular deconditioning during extended spaceflight. Mice were exposed to spaceflight for 15 days or maintained on Earth (ground control). Ventricle tissue was harvested starting ~3 h post-landing. We measured expression of select genes implicated in oxidative stress pathways and <i>Trp53</i> signaling by quantitative PCR. Cardiac expression levels of 37 of 168 genes tested were altered after spaceflight. Spaceflight downregulated transcription factor, <i>Nfe2l2 (Nrf2)</i>, upregulated <i>Nox1</i> and downregulated <i>Ptgs2</i>, suggesting a persistent increase in oxidative stress-related target genes. Spaceflight also substantially upregulated <i>Cdkn1a</i> (<i>p21</i>) and cell cycle/apoptosis-related gene <i>Myc</i>, and downregulated the inflammatory response gene <i>Tnf</i>. There were no changes in apoptosis-related genes such as <i>Trp53</i>. Spaceflight altered the expression of genes regulating redox balance, cell cycle and senescence in cardiac tissue of mice. Thus, spaceflight may contribute to cardiac dysfunction due to oxidative stress.

Also flagged:2,2,6,6-tetramethyl-1-piperidinyloxymethylairionssynthesisenals
Journal Article 2021-08-23 No Snippets Wang QN, Liu X, Wang K, Liu Y, Lu SM, Li C.
Show Full Abstract

<i>p</i>-Methyl benzaldehyde (<i>p</i>-MBA) is a class of key chemical intermediates of pharmaceuticals. Conventional industrial processes for <i>p</i>-MBA production involve the consecutive photochlorination, amination, and acid hydrolysis of petroleum-derived <i>p</i>-xylene, while producing vast pollutants and waste water. Herein, we report a direct, green route for selective synthesis of <i>p</i>-MBA from acetaldehyde using a diphenyl prolinol trimethylsilyl ether catalyst. The optimized <i>p</i>-MBA selectivity is up to 90% at an acetaldehyde conversion as high as 99.8%. Intermediate structure and <sup>18</sup>O-isotope data revealed that the conversion of acetaldehyde to <i>p</i>-methylcyclohexadienal intermediates proceeds in an enamine-iminium intermediate mechanism. Then, controlled experiments and D-isotope results indicated that the dehydrogenation of <i>p</i>-methylcyclohexadienal to <i>p</i>-MBA and H<sub>2</sub> is catalyzed by the same amines through an iminium intermediate. This is an example that metal-free amines catalyze the dehydrogenation (releasing H<sub>2</sub>), rather than using metals or stoichiometric oxidants.

Also flagged:NF-E2-Related Factor 2Nrf2Radiation-induced skin injurycancerNuclear factor erythroid 2-related factor 2oxygen
Journal Article 2021-08-23 ✓ 1 Snippet Xue J, Yu C, Tang Y, Mo W, Tang Z, Sheng W, Jiao Y, Zhu W, Cao J.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6) reduced ROS levels…

Show Full Abstract

Radiation-induced skin injury (RISI) commonly occur in cancer patients who received radiotherapy and is one of the first clinical symptoms after suffering from nuclear exposure. Oxidative damage is the major causes of RISI. Nuclear factor erythroid 2-related factor 2 (Nrf2) is considered as a key mediator of the cellular antioxidant response. However, whether Nrf2 can alleviate RISI after high-dose irradiation remains unknown. In this study, we demonstrated that Nrf2-deficient (<i>Nrf2</i> <sup>-/-</sup>) mice were susceptible to high-dose irradiation and adenovirus-mediated overexpression of Nrf2 (ad-Nrf2) protected against radiation in skin cells. Overexpression of Nrf2 attenuated the severity of skin injury after high-dose electron beam irradiation. To uncover the mechanisms of Nrf2 involved in RISI, mRNA sequencing technology was performed to analyze the mRNA expression profiles of Ad-Nrf2 skin cells following radiation. The results revealed that a total of 127 genes were significantly changed, 55 genes were upregulated, and 72 genes were downregulated after Nrf2 overexpression. GSEA showed that Nrf2 was associated with positive regulation of genes involved in the reactive oxygen species pathway after radiation. Taken together, this study illustrated the role of Nrf2 in RISI and provided potentially strategies for ameliorating RISI.

Also flagged:TSG-6extracellulartohyaluronanT helper type 2 cytokinesatopic dermatitis
Journal Article 2021-08-23 No Snippets Evrard C, Faway E, De Vuyst E, Svensek O, De Glas V, Bergerat D, Salmon M, De Backer O, Flamion B, Le-Buanec H, Lambert de Rouvroit C, Poumay Y.
Show Full Abstract

TSG-6 is a soluble protein secreted in the extracellular matrix by various cell types in response to inflammatory stimuli. TSG-6 interacts with extracellular matrix molecules, particularly hyaluronan (HA), and promotes cutaneous wound closure in mice. Between epidermal cells, the discrete extracellular matrix contains HA and a tiny amount of TSG-6. However, challenges imposed to keratinocytes in reconstructed human epidermis revealed strong induction of TSG-6 expression, after exposure to T helper type 2 cytokines to recapitulate the atopic dermatitis phenotype or after fungal infection that causes secretion of cytokines and antimicrobial peptides. After both types of challenge, enhanced release of TSG-6 happens simultaneously with increased HA production. TSG-6 deficiency in N/TERT keratinocytes was created by inactivating <i>TNFAIP6</i> using CRISPR/Cas9. Some <i>TSG-6</i> <sup>-/-</sup> keratinocytes analyzed through scratch assays tend to migrate more slowly but produce reconstructed human epidermis that exhibits normal morphology and differentiation. Few significant alterations were noticed by transcriptomic analysis. Nevertheless, reduced HA content in <i>TSG-6</i> <sup>-/-</sup> reconstructed human epidermis was observed, along with enhanced HA release into the culture medium, and this phenotype was even more pronounced after the challenging conditions. Reintroduction of cells producing TSG-6 in reconstructed human epidermis reduced HA leakage. Our results show a role for TSG-6 in sequestering HA between epidermal cells in response to inflammation.

Advances in sports genomics.

Also flagged:organizationMYBPC3NFIAPPARAPPARGC1AACTN3
Journal Article 2021-08-23 No Snippets Ahmetov II, Hall ECR, Semenova EA, Pranckevičienė E, Ginevičienė V.
Show Full Abstract

Sports genomics is the scientific discipline that focuses on the organization and function of the genome in elite athletes, and aims to develop molecular methods for talent identification, personalized exercise training, nutritional need and prevention of exercise-related diseases. It postulates that both genetic and environmental factors play a key role in athletic performance and related phenotypes. This update on the panel of genetic markers (DNA polymorphisms) associated with athlete status and soft-tissue injuries covers advances in research reported in recent years, including one whole genome sequencing (WGS) and four genome-wide association (GWAS) studies, as well as findings from collaborative projects and meta-analyses. At end of 2020, the total number of DNA polymorphisms associated with athlete status was 220, of which 97 markers have been found significant in at least two studies (35 endurance-related, 24 power-related, and 38 strength-related). Furthermore, 29 genetic markers have been linked to soft-tissue injuries in at least two studies. The most promising genetic markers include HFE rs1799945, MYBPC3 rs1052373, NFIA-AS2 rs1572312, PPARA rs4253778, and PPARGC1A rs8192678 for endurance; ACTN3 rs1815739, AMPD1 rs17602729, CPNE5 rs3213537, CKM rs8111989, and NOS3 rs2070744 for power; LRPPRC rs10186876, MMS22L rs9320823, PHACTR1 rs6905419, and PPARG rs1801282 for strength; and COL1A1 rs1800012, COL5A1 rs12722, COL12A1 rs970547, MMP1 rs1799750, MMP3 rs679620, and TIMP2 rs4789932 for soft-tissue injuries. It should be appreciated, however, that hundreds and even thousands of DNA polymorphisms are needed for the prediction of athletic performance and injury risk.

Also flagged:SynthesismetASheart failure with preservedcarpal tunnel syndromeleft ventricular hypertrophy
Journal Article 2021-08-22 No Snippets Tini G, Sessarego E, Benenati S, Vianello PF, Musumeci B, Autore C, Canepa M.
Show Full Abstract

<h4>Background</h4>Transthyretin-related cardiac amyloidosis (TTR-CA) is thought to be particularly common in specific at-risk conditions, including aortic stenosis (AS), heart failure with preserved ejection fraction (HFpEF), carpal tunnel syndrome (CTS) and left ventricular hypertrophy or hypertrophic cardiomyopathy (LVH/HCM).<h4>Methods</h4>We performed a systematic revision of the literature, including only prospective studies performing TTR-CA screening with bone scintigraphy in the above-mentioned conditions. Assessment of other forms of CA was also evaluated. For selected items, pooled estimates of proportions or means were obtained using a meta-analytic approach.<h4>Results</h4>Nine studies (3 AS, 2 HFpEF, 2 CTS and 2 LVH/HCM) accounting for 1375 screened patients were included. One hundred fifty-six (11.3%) TTR-CA patients were identified (11.4% in AS, 14.8% in HFpEF, 2.6% in CTS and 12.9% in LVH/HCM). Exclusion of other forms of CA and use of genetic testing was overall puzzled. Age at TTR-CA recognition was significantly older than that of the overall screened population in AS (86 vs. 83 years, p = .04), LVH/HCM (75 vs. 63, p < .01) and CTS (82 vs. 71), but not in HFpEF (83 vs. 79, p = .35). In terms of comorbidities, hypertension, diabetes and atrial fibrillation were highly prevalent in TTR-CA-diagnosed patients, as well as in those with an implanted pacemaker.<h4>Conclusions</h4>Screening with bone scintigraphy found an 11-15% TTR-CA prevalence in patients with AS, HFpEF and LVH/HCM. AS and HFpEF patients were typically older than 80 years at TTR-CA diagnosis and frequently accompanied by comorbidities. Several studies showed limitations in the application of recommended TTR-CA diagnostic algorithm, which should be addressed in future prospective studies.

Also flagged:HydromethylthionineFrontotemporal DementiaTautauopathiesbehaviouralmitochondrial
Journal Article 2021-08-22 ✓ 5 Snippets Schwab K, Melis V, Harrington CR, Wischik CM, Magbagbeolu M, Theuring F, Riedel G.
In-Text Gene Mentions

2-DE: two-dimensional gel electrophoresis; 4E-BP1: eukaryotic translation initiation factor 4E-binding protein 1; AD: Alzheimer’s disease; ADORA2A: adenosine A2a receptor; AGRP: agouti-related protein; AKT: protein kinase B; AKT1: RAC-alpha serine/threonine-protein kinase; APP: amyloid precursor protein; ARX: homeobox protein ARX; BDNF: brain-derived neurotrophic factor; CaMKII: Ca2+/calmodulin-dependent protein kinase II; CDK5: cyclin-dependent kinase 5; CDK5R1: cyclin-dependent kinase 5 regulatory subunit 1; E2F1: E2F transcription factor 1; EIF2: eukaryotic initiation factor 2; EIF2B2: eukaryotic translation initiation factor 2B subunit beta; ERK5: extracellular signal regulated kinase 5; ETC: electron transport chain; FAK: focal adhesion kinase; FMR1: synaptic functional regulator FMR1; FTD: frontotemporal dementia; FTDP-17: frontotemporal dementia with parkinsonism linked to chromosome 17; GSK-3: glycogen synthase kinase 3; HSF1: heat shock factor protein 1; htau40: human tau with 441 amino acids; HTT: huntingtin; IEF: isoelectric focusing; IGF-1: insulin-like growth factor 1; IPA: Ingenuity Pathway Analysis; LMTM, N,N,N’,N’-tetramethyl-10H-phenothiazine-3,7-diaminium bis(methanesulfonate); MARK2: serine/threonine-protein kinase MARK2; MKNK1: MAP kinase-interacting serine/threonine-protein kinase 1; MS: mass spectrometry; MT: methylthioninium, MTC: methylthioninium chloride; MTOR: serine/threonine-protein kinase mTOR; MYO5A: unconventional myosin-Va; NOS2: nitric oxide synthase, inducible; NRF2: nuclear factor (erythroid-derived 2)-like 2; P70S6K: ribosomal protein S6 kinase beta-1; PARK2: E3 ubiquitin-protein ligase parkin; PHF, paired helical filament; PPAR: peroxisome proliferator-activated receptors; PSD95: postsynaptic density protein 95; PSEN1: presenilin-1; PTM: post-translational modification; RAC: Rho GTPase family; RTN4: reticulon-4; SEPT5: septin-5; SLC18A3: vesicular acetylcholine transporter; SNAP25: synaptosomal-associated protein 25; SNCA: alpha-synuclein; PI3K: phosphatidylinositol-4,5-bisphosphate 3-kinase; PKC: protein kinase C; PLCB4: 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-4; SOD1: superoxide dismutase [Cu-Zn]; tau (or MAPT): microtubule-associated protein tau; TrkB: tropomyosin receptor kinase B; VAMP2: vesicle-associated membrane protein 2; VDAC, voltage-dependent anion channel; YWHAG: 14-3-3 protein gamma; ZNF746: zinc finger protein 746.

…VDAC1, SODM andPRDX6became more acidic,…

…Both SODM andPRDX6are important scavengers…

…(SODM) and peroxiredoxin-6 (PRDX6) as they were…

…441 amino acids;HTT: huntingtin; IEF: isoelectric…

Show Full Abstract

Abnormal aggregation of tau is the pathological hallmark of tauopathies including frontotemporal dementia (FTD). We have generated tau-transgenic mice that express the aggregation-prone P301S human tau (line 66). These mice present with early-onset, high tau load in brain and FTD-like behavioural deficiencies. Several of these behavioural phenotypes and tau pathology are reversed by treatment with hydromethylthionine but key pathways underlying these corrections remain elusive. In two proteomic experiments, line 66 mice were compared with wild-type mice and then vehicle and hydromethylthionine treatments of line 66 mice were compared. The brain proteome was investigated using two-dimensional electrophoresis and mass spectrometry to identify protein networks and pathways that were altered due to tau overexpression or modified by hydromethylthionine treatment. Overexpression of mutant tau induced metabolic/mitochondrial dysfunction, changes in synaptic transmission and in stress responses, and these functions were recovered by hydromethylthionine. Other pathways, such as NRF2, oxidative phosphorylation and protein ubiquitination were activated by hydromethylthionine, presumably independent of its function as a tau aggregation inhibitor. Our results suggest that hydromethylthionine recovers cellular activity in both a tau-dependent and a tau-independent fashion that could lead to a wide-spread improvement of homeostatic function in the FTD brain.

Also flagged:nucleuselectrongrapheneNETRETcarbon nanotube
Journal Article 2021-08-22 No Snippets Oane M, Mahmood MA, Popescu AC.
Show Full Abstract

Heat equations can estimate the thermal distribution and phase transformation in real-time based on the operating conditions and material properties. Such wonderful features have enabled heat equations in various fields, including laser and electron beam processing. The integral transform technique (ITT) is a powerful general-purpose semi-analytical/numerical method that transforms partial differential equations into a coupled system of ordinary differential equations. Under this category, Fourier and non-Fourier heat equations can be implemented on both equilibrium and non-equilibrium thermo-dynamical processes, including a wide range of processes such as the Two-Temperature Model, ultra-fast laser irradiation, and biological processes. This review article focuses on heat equation models, including Fourier and non-Fourier heat equations. A comparison between Fourier and non-Fourier heat equations and their generalized solutions have been discussed. Various components of heat equations and their implementation in multiple processes have been illustrated. Besides, literature has been collected based on ITT implementation in various materials. Furthermore, a future outlook has been provided for Fourier and non-Fourier heat equations. It was found that the Fourier heat equation is simple to use but involves infinite speed heat propagation in comparison to the non-Fourier heat equation and can be linked with the Two-Temperature Model in a natural way. On the other hand, the non-Fourier heat equation is complex and involves various unknowns compared to the Fourier heat equation. Fourier and Non-Fourier heat equations have proved their reliability in the case of laser-metallic materials, electron beam-biological and -inorganic materials, laser-semiconducting materials, and laser-graphene material interactions. It has been identified that the material properties, electron-phonon relaxation time, and Eigen Values play an essential role in defining the precise results of Fourier and non-Fourier heat equations. In the case of laser-graphene interaction, a restriction has been identified from ITT. When computations are carried out for attosecond pulse durations, the laser wavelength approaches the nucleus-first electron separation distance, resulting in meaningless results.

Also flagged:vernal keratoconjunctivitiseosinophilic inflammationcytokineConjunctivitisinfectionimmunity
Journal Article 2021-08-21 No Snippets Leonardi A, Rosani U, Cavarzeran F, Daull P, Garrigue JS, Paola B.
Show Full Abstract

No abstract available.

Also flagged:COVID-19coronavirus disease 2019oxygendiabetes mellituscoronavirus diseaseinfection
Journal Article 2021-08-21 ✓ 1 Snippet Ninomiya T, Otsubo K, Hoshino T, Shimokawa M, Nakazawa M, Sato Y, Mikumo H, Kawakami S, Mizusaki S, Mori Y, Arimura H, Tsuchiya-Kawano Y, Inoue K, Uchida Y, Nakanishi Y.
In-Text Gene Mentions

…overload disorders, includinghemochromatosisand hemosiderosis, which…

Show Full Abstract

<h4>Background</h4>Although the risk factors for coronavirus disease 2019 (COVID-19) mortality have been identified, there is limited information about the risk factors for disease progression after hospitalization among Japanese patients with COVID-19 exhibiting no or mild symptoms.<h4>Methods</h4>All 302 consecutive patients who were admitted to our institutions and diagnosed with COVID-19 between March and December 2020 were retrospectively assessed. Ultimately, 210 adult patients exhibiting no or mild symptoms on admission were included in the analysis. They were categorized into the stable (no oxygen needed) and worsened (oxygen needed) groups, and their characteristics and laboratory data were compared.<h4>Results</h4>Among 210 patients, 49 progressed to a severe disease stage, whereas 161 did not. The mean patient age was 52.14 years, and 126 (60.0%) patients were male. The mean body mass index (BMI) was 23.0 kg/m<sup>2</sup>, and 71 patients were overweight (BMI ≥ 25 kg/m<sup>2</sup>). Multivariate logistic analysis showed that old age, overweight, diabetes mellitus (DM), and high serum ferritin levels were independent risk factors for disease progression.<h4>Conclusions</h4>Clinicians should closely observe patients with COVID-19, especially those with risk factors such as old age, overweight, DM, and high serum ferritin levels, regardless of whether they have no or mild symptoms.

Also flagged:inclSARSairCOVID-19infectionnucleotide
Journal Article 2021-08-21 No Snippets Kelly D, Bambury N, Boland M.
Show Full Abstract

International air travel has been highlighted as a concern since the beginning of the COVID-19 pandemic with respect to importation of cases. We summarise the available evidence for in-flight transmission of wild type SARS-CoV-2 during 2020, and for imported COVID-19 clusters to cause outbreaks. This paper provides a data baseline prior to the emergence of new mutations causing SARS-CoV-2 variants of concern, whose characteristics may increase the potential risk of in-flight transmission and imported outbreaks. The evidence on in-flight transmission of wild-type SARS-CoV-2 is limited, and is described in a small number of published reports. Most of the available evidence pertains to the early phase of the COVID-19 pandemic, during a period without non-pharmaceutical interventions such as distancing and in-flight mask wearing. There is considerable potential for outbreaks of COVID-19 from imported cases or clusters when public health guidance around quarantine of travellers and self-isolation of cases is not adhered to. Risks can be mitigated by measures such as: avoiding non-essential travel, targeted testing and quarantine of travellers from high incidence regions or regions of concern, managed quarantine processes, and protocols for rapid investigation and control of transmission from a possible variant of concern. Measures should be dynamically assessed and proportionate to the level of risk.

Also flagged:Secretory granulesagingsucroseSynaptic vesiclessynaptic vesicleMPP
Journal Article 2021-08-21 ✓ 3 Snippets Wen G, Pang H, Wu X, Jiang E, Zhang X, Zhan X.
In-Text Gene Mentions
⭐ same-sentence co-mention

Finally, the expressions of several newly identified neurotransmitters and neurological disease-related proteins also altered significantly, including hippocampal cholinergic neurostimulating peptide (PEBP1), fibroblast growth factor (FGF1), thymopoietin (THBS1), the amyloid-beta (Aβ) A4 precursor protein-binding family B member 1 (APBB1) and apolipoprotein E (APOE) in AD [33–36], Huntingtin protein (HTT) in HD [37], along with the protease inhibitor cystatin C is in epilepsy [38].

…gic neurostimulating peptide (PEBP1), fibroblast growth factor…

…], Huntingtin protein (HTT) in HD […

Show Full Abstract

Parkinson's disease (PD) is an aging disorder related to vesicle transport dysfunctions and neurotransmitter secretion. Secretory granules (SGs) are large dense-core vesicles for the biosynthesis of neuropeptides and hormones. At present, the involvement of SGs impairment in PD remains unclear. In the current study, we found that the number of SGs in tyrosine hydroxylase-positive neurons and the marker proteins secretogranin III (Scg3) significantly decreased in the substantia nigra and striatum regions of 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP) exposed mice. Proteomic study of SGs purified from the dopaminergic SH-sy5Y cells under 1-methyl-4-phenylpyridinium (MPP+) treatments (ProteomeXchange PXD023937) identified 536 significantly differentially expressed proteins. The result indicated that disabled lysosome and peroxisome, lipid and energy metabolism disorders are three characteristic features. Protein-protein interaction analysis of 56 secretory proteins and 140 secreted proteins suggested that the peptide processing mediated by chromogranin/secretogranin in SGs was remarkably compromised, accompanied by decreased candidate proteins and peptides neurosecretory protein (VGF), neuropeptide Y, apolipoprotein E, and an increased level of proenkephalin. The current study provided an extensive proteinogram of SGs in PD. It is helpful to understand the molecular mechanisms in the disease.

Also flagged:Siliconeamideaminomethylsiloxanecarboxylicthiol
Journal Article 2021-08-21 No Snippets Kulawik-Pióro A, Drabczyk AK, Kruk J, Wróblewska M, Winnicka K, Tchórzewska J.
Show Full Abstract

This work investigates the possibility of using thiolated silicone oils as new components in protective creams and their impact on the efficacy of these products. Thiolated silicone oils were synthesized by amide bond formation between primary amino groups of poly17dimethylsiloxane-co-(3-aminopropyl)-methylsiloxane] and carboxylic groups of thiol ligand (3-mercaptopropionic acid) with carbodiimide as a coupling agent. To evaluate and compare the properties of these kinds of thiomers, three different emulsion o/w types were obtained. Emulsion E1 contained methyl silicone oil, E2 poly[dimethylsiloxane-co-(3-aminopropyl)-methylsiloxane], and E3 thiolated silicone oil (silicone-MPA), respectively. Physicochemical properties, including pH, conductivity, droplet size distribution, viscosity, and stability, were assessed. The efficacy of barrier creams in the prevention of occupational skin diseases depends on their mechanical and rheological properties. Thus, the method which imitates the spreadability conditions on the skin and how structure reconstruction takes places was performed. We also investigated textural profile, bioadhesion, protection against water and detergents, and water vapor permeability. Emulsion E3 was characterized by beneficial occlusion, spreadability, and adhesion properties. These features with prolonged residence time on the skin can make designed barrier creams more preferable for consumers.

Also flagged:CyclodextrinsglucosebindingSynthesiscyclicoligosaccharides
Journal Article 2021-08-21 No Snippets Kasal P, Jindřich J.
Show Full Abstract

Cyclodextrins are well known supramolecular hosts used in a wide range of applications. Monosubstitution of native cyclodextrins in the position C-6 of a glucose unit represents the simplest method how to achieve covalent binding of a well-defined host unit into the more complicated systems. These derivatives are relatively easy to prepare; that is why the number of publications describing their preparations exceeds 1400, and the reported synthetic methods are often very similar. Nevertheless, it might be very demanding to decide which of the published methods is the best one for the intended purpose. In the review, we aim to present only the most useful and well-described methods for preparing different types of mono-6-substituted derivatives. We also discuss the common problems encountered during their syntheses and suggest their optimal solutions.

Also flagged:CalmodulinHuntingtinmCaMcalciumglutamine
Journal Article 2021-08-21 ✓ 5 Snippets Moldovean SN, Chiş V.
In-Text Gene Mentions

The disruption of mutant HTT–CaM interaction mechanisms, by using our proposed 9P(EM) mutant model, might also represent a potential therapeutic target against HD.

Menzies et al. have demonstrated in Drosophila HD models that the inhibition of this cysteine protease called calpain has a positive effect on m-HTT’s aggregation and toxicity prevention [27].

…in the extendedHTTsequence [ 4…

…of the wild-typeHTTproteins [ 15…

…been shown thatm-HTTand calmodulin, a…

Show Full Abstract

Mutant huntingtin (m-HTT) proteins and calmodulin (CaM) co-localize in the cerebral cortex with significant effects on the intracellular calcium levels by altering the specific calcium-mediated signals. Furthermore, the mutant huntingtin proteins show great affinity for CaM that can lead to a further stabilization of the mutant huntingtin aggregates. In this context, the present study focuses on describing the interactions between CaM and two huntingtin mutants from a biophysical point of view, by using classical Molecular Dynamics techniques. The huntingtin models consist of a wild-type structure, one mutant with 45 glutamine residues and the second mutant with nine additional key-point mutations from glutamine residues into proline residues (9P(EM) model). Our docking scores and binding free energy calculations show higher binding affinities of all HTT models for the C-lobe end of the CaM protein. In terms of dynamic evolution, the 9P(EM) model triggered great structural changes into the CaM protein's structure and shows the highest fluctuation rates due to its structural transitions at the helical level from α-helices to turns and random coils. Moreover, our proposed 9P(EM) model suggests much lower interaction energies when compared to the 45Qs-HTT mutant model, this finding being in good agreement with the 9P(EM)'s antagonistic effect hypothesis on highly toxic protein-protein interactions.

Also flagged:Flashdiethyl etherbenzyl bromide4-methylbenzyl alcoholpolycarbonatesguanidinium
Journal Article 2021-08-21 ✓ 1 Snippet Tay J, Zhao Y, Hedrick JL, Yang YY.
In-Text Gene Mentions

DCC

Show Full Abstract

<b>Rationale:</b> Use of traditional anticancer chemotherapeutics has been hindered by the multifactorial nature of multi-drug resistance (MDR) development and metastasis. Recently, cationic polycarbonates were reported as novel unconventional anticancer agents that mitigated MDR and inhibited metastasis. The aim of this study is to explore structure-anticancer activity relationship. Specifically, a series of cationic guanidinium-based random copolymers of varying hydrophobicity was synthesized with a narrow polydispersity (Ð = 1.12-1.27) <i>via</i> organocatalytic ring-opening polymerization (OROP) of functional cyclic carbonate monomers, and evaluated for anticancer activity, killing kinetics, degradability and functional mechanism. <b>Methods:</b> Linear, branched and aromatic hydrophobic side chain units, such as ethyl, benzyl, butyl, isobutyl and hexyl moieties were explored as comonomer units for modulating anticancer activity. As hydrophobicity/hydrophilicity balance of the polymers determines their anticancer efficacy, the feed ratio between the two monomers was varied to tune their hydrophobicity. <b>Results:</b> Notably, incorporating the hexyl moiety greatly enhanced anticancer efficiency and killing kinetics on cancer cells. Degradation studies showed that the polymers degraded completely within 4-6 days. Flow cytometry and lactate dehydrogenase (LDH) release analyses demonstrated that anticancer mechanism of the copolymers containing a hydrophobic co-monomer was concentration dependent, apoptosis at IC<sub>50</sub>, and both apoptosis and necrosis at 2 × IC<sub>50</sub>. In contrast, the homopolymer without a hydrophobic comonomer killed cancer cells predominantly <i>via</i> apoptotic mechanism. <b>Conclusion:</b> The hydrophobicity of the polymers played an important role in anticancer efficacy, killing kinetics and anticancer mechanism. This study provides valuable insights into designing novel anticancer agents utilizing polymers.

Also flagged:pathogenesistranslationalfertilizationcell nuclearPDmetabolism
Journal Article 2021-08-21 No Snippets Huang M, Yang J, Li P, Chen Y.
Show Full Abstract

Animal models of human diseases are vital in better understanding the mechanism of pathogenesis and essential for evaluating and validating potential therapeutic interventions. As close relatives of humans, nonhuman primates (NHPs) play an increasingly indispensable role in advancing translational medicine research. In this review, we summarized the progress of NHP models generated by embryo engineering, analyzed their unique advantages in mimicking clinical patients, and discussed the remaining gap between basic research of NHP models to translational medicine.

Also flagged:CalciumCoronary Artery Diseaseatherosclerotic cardiovascular diseaseASCVDtroponin Idobutamine
Journal Article 2021-08-21 ✓ 1 Snippet Bhatti S, Lizaola-Mayo B, Al-Shoha M, Garcia-Saenz-de-Sicilia M, Habash F, Ayoub K, Karr M, Ahmed Z, Borja-Cacho D, Duarte-Rojo A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>End-stage liver disease (ESLD) is not considered a risk factor for atherosclerotic cardiovascular disease (ASCVD). However, lifestyle characteristics commonly associated with increased ASCVD risk are highly prevalent in ESLD. Emerging literature shows a high burden of asymptomatic coronary artery disease (CAD) in patients with ESLD and a high ASCVD risk in liver transplantation (LT) recipients. Coronary artery calcium score (CAC) is a noninvasive test providing reliable CAD risk stratification. We implemented an LT evaluation protocol with CAC playing a central role in triaging and determining the need for further CAD assessment. Here, we inform our results from this early experience.<h4>Methods</h4>Patients with ESLD referred for LT evaluation were prospectively studied. We compared accuracy of CAC against that of CAD risk factors/scores, troponin I, dobutamine stress echocardiogram (DSE), and single-photon emission computed tomography (SPECT) to detect coronary stenosis ≥70 (CAD ≥ 70) per left heart catheterization (LHC). Thirty-day post-LT cardiac outcomes were also analyzed.<h4>Results</h4>One hundred twenty-four of 148 (84%) patients underwent CAC, 106 (72%) DSE/SPECT, and 50 (34%) LHC. CAC ≥ 400 was found in 35 (28%), 100 to 399 in 17 (14%), and <100 in 72 (58%). LHC identified CAD ≥ 70% in 8 of 29 (28%), 2 of 9 (22%), and 0 of 4, respectively. Two acute coronary syndromes occurred after LT in a patient with CAC 811 (CAD < 70%), and one with CAC 347 (CAD ≥ 70%). No patients with CAC < 100 presented with acute coronary syndrome after LT. When using CAD ≥ 70% as primary endpoint of LT evaluation, CAC ≥ 346 was the only test showing predictive usefulness (negative predictive value 100%).<h4>Conclusions</h4>CAC is a promising tool to guide CAD risk stratification and need for LHC during LT evaluation. Patients with a CAC < 100 can safely undergo LT without the need for LHC or cardiac stress testing, whereas a CAC < 346 accurately rules out significant CAD stenosis (≥70%) on LHC, outperforming other CAD risk-stratification strategies.

Also flagged:acylsulfonamidestuberculosisCell Wallbiosynthesischolesterolmetabolism
Journal Article 2021-08-20 No Snippets Khonde LP, Müller R, Boyle GA, Reddy V, Nchinda AT, Eyermann CJ, Fienberg S, Singh V, Myrick A, Abay E, Njoroge M, Lawrence N, Su Q, Myers TG, Boshoff HIM, Barry CE, Sirgel FA, van Helden PD, Massoudi LM, Robertson GT, Lenaerts AJ, Basarab GS, Ghorpade SR, Chibale K, Chibale K.
Show Full Abstract

Phenotypic whole cell high-throughput screening of a ∼150,000 diverse set of compounds against <i>Mycobacterium tuberculosis</i> (Mtb) in cholesterol-containing media identified 1,3-diarylpyrazolyl-acylsulfonamide <b>1</b> as a moderately active hit. Structure-activity relationship (SAR) studies demonstrated a clear scope to improve whole cell potency to MIC values of <0.5 μM, and a plausible pharmacophore model was developed to describe the chemical space of active compounds. Compounds are bactericidal <i>in vitro</i> against replicating Mtb and retained activity against multidrug-resistant clinical isolates. Initial biology triage assays indicated cell wall biosynthesis as a plausible mode-of-action for the series. However, no cross-resistance with known cell wall targets such as MmpL3, DprE1, InhA, and EthA was detected, suggesting a potentially novel mode-of-action or inhibition. The <i>in vitro</i> and <i>in vivo</i> drug metabolism and pharmacokinetics profiles of several active compounds from the series were established leading to the identification of a compound for <i>in vivo</i> efficacy proof-of-concept studies.

Also flagged:keyyouhowspike proteinreceptorbinding
Journal Article 2021-08-20 ✓ 1 Snippet Tian F, Tong B, Sun L, Shi S, Zheng B, Wang Z, Dong X, Zheng P.
In-Text Gene Mentions

…uses, gamma-coronaviruses, anddelta-coronaviruses( Zumla et…

Show Full Abstract

SARS-CoV-2 has been spreading around the world for the past year. Recently, several variants such as B.1.1.7 (alpha), B.1.351 (beta), and P.1 (gamma), which share a key mutation N501Y on the receptor-binding domain (RBD), appear to be more infectious to humans. To understand the underlying mechanism, we used a cell surface-binding assay, a kinetics study, a single-molecule technique, and a computational method to investigate the interaction between these RBD (mutations) and ACE2. Remarkably, RBD with the N501Y mutation exhibited a considerably stronger interaction, with a faster association rate and a slower dissociation rate. Atomic force microscopy (AFM)-based single-molecule force microscopy (SMFS) consistently quantified the interaction strength of RBD with the mutation as having increased binding probability and requiring increased unbinding force. Molecular dynamics simulations of RBD-ACE2 complexes indicated that the N501Y mutation introduced additional π-π and π-cation interactions that could explain the changes observed by force microscopy. Taken together, these results suggest that the reinforced RBD-ACE2 interaction that results from the N501Y mutation in the RBD should play an essential role in the higher rate of transmission of SARS-CoV-2 variants, and that future mutations in the RBD of the virus should be under surveillance.

Also flagged:Phenylneurodegenerative diseasesmitochondrialcycloalkylcyclopropylsulfur
Journal Article 2021-08-20 No Snippets Dang X, Williams SB, Devanathan S, Franco A, Fu L, Bernstein PR, Walters D, Dorn GW.
Show Full Abstract

Mitochondrial fragmentation from defective fusion or unopposed fission contributes to many neurodegenerative diseases. Small molecule mitofusin activators reverse mitochondrial fragmentation <i>in vitro</i>, promising a novel therapeutic approach. The first-in-class mitofusin activator, <b>2</b>, has a short plasma <i>t</i><sub>1/2</sub> and limited neurological system bioavailability, conferring "burst activation". Here, pharmacophore-based rational redesign generated analogues of <b>2</b> incorporating cycloalkyl linker groups. A cyclopropyl-containing linker, <b>5</b>, improved plasma and brain <i>t</i><sub>1/2</sub>, increased nervous system bioavailability, and prolonged neuron pharmacodynamic effects. Functional and single-crystal X-ray diffraction studies of stereoisomeric analogues of <b>5</b> containing sulfur as a "heavy atom", <b>14A</b> and <b>14B</b>, showed that <b>5</b> biological activity resides in the <i>trans-</i>R/R configuration, <b>5B</b>. Structural analysis revealed stereoselective interactions of <b>5</b> associated with its mimicry of MFN2 Val372, Met376, and His380 side chains. Modification of murine ALS phenotypes <i>in vitro</i> and <i>in vivo</i> supports advancement of <b>5B</b> for neurological conditions that may benefit from sustained mitofusin activation.

Also flagged:ClaresynthesisBMAL1washcell growthHC11
Journal Article 2021-08-20 ✓ 2 Snippets Casey T, Suarez-Trujillo A, Cummings S, Huff K, Crodian J, Bhide K, Aduwari C, Teeple K, Shamay A, Mabjeesh SJ, San Miguel P, Thimmapuram J, Plaut K.
In-Text Gene Mentions

…step of glycolysis,Prdx6, which encodes…

…include Sox1 andSox6[ 34 ]…

Show Full Abstract

The role the mammary epithelial circadian clock plays in gland development and lactation is unknown. We hypothesized that mammary epithelial clocks function to regulate mammogenesis and lactogenesis, and propose the core clock transcription factor BMAL1:CLOCK regulates genes that control mammary epithelial development and milk synthesis. Our objective was to identify transcriptional targets of BMAL1 in undifferentiated (UNDIFF) and lactogen differentiated (DIFF) mammary epithelial cells (HC11) using ChIP-seq. Ensembl gene IDs with the nearest transcriptional start site to ChIP-seq peaks were explored as potential targets, and represented 846 protein coding genes common to UNDIFF and DIFF cells and 2773 unique to DIFF samples. Genes with overlapping peaks between samples (1343) enriched cell-cell adhesion, membrane transporters and lipid metabolism categories. To functionally verify targets, an HC11 line with Bmal1 gene knocked out (BMAL1-KO) using CRISPR-CAS was created. BMAL1-KO cultures had lower cell densities over an eight-day growth curve, which was associated with increased (p<0.05) levels of reactive oxygen species and lower expression of superoxide dismutase 3 (Sod3). RT-qPCR analysis also found lower expression of the putative targets, prolactin receptor (Prlr), Ppara, and beta-casein (Csn2). Findings support our hypothesis and highlight potential importance of clock in mammary development and substrate transport.

Also flagged:Agingcancercardiovascular diseasediabetesosteoarthritismTOR
Journal Article 2021-08-20 No Snippets Zhao Y, Seluanov A, Gorbunova V.
Show Full Abstract

Aging is a major risk factor for multiple diseases. Understanding the underlying mechanisms of aging would help to delay and prevent age-associated diseases. Short-lived model organisms have been extensively used to study the mechanisms of aging. However, these short-lived species may be missing the longevity mechanisms that are needed to extend the lifespan of an already long-lived species such as humans. Unconventional long-lived animal species are an excellent resource to uncover novel mechanisms of longevity and disease resistance. Here, we review mechanisms that evolved in nonmodel vertebrate species to counteract age-associated diseases. Some antiaging mechanisms are conserved across species; however, various nonmodel species also evolved unique mechanisms to delay aging and prevent disease. This variety of antiaging mechanisms has evolved due to the remarkably diverse habitats and behaviors of these species. We propose that exploring a wider range of unconventional vertebrates will provide important resources to study antiaging mechanisms that are potentially applicable to humans.

Also flagged:GAPDHPhosphoenolpyruvatesteatosisp53mannitolglucose
Journal Article 2021-08-20 ✓ 1 Snippet Gonzalez-Rellan MJ, Fondevila MF, Fernandez U, Rodríguez A, Varela-Rey M, Veyrat-Durebex C, Seoane S, Bernardo G, Lopitz-Otsoa F, Fernández-Ramos D, Bilbao J, Iglesias C, Novoa E, Ameneiro C, Senra A, Beiroa D, Cuñarro J, Dp Chantada-Vazquez M, Garcia-Vence M, Bravo SB, Da Silva Lima N, Porteiro B, Carneiro C, Vidal A, Tovar S, Müller TD, Ferno J, Guallar D, Fidalgo M, Sabio G, Herzig S, Yang WH, Cho JW, Martinez-Chantar ML, Perez-Fernandez R, López M, Dieguez C, Mato JM, Millet O, Coppari R, Woodhoo A, Fruhbeck G, Nogueiras R.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, Wilson’s disease, or…

Show Full Abstract

p53 regulates several signaling pathways to maintain the metabolic homeostasis of cells and modulates the cellular response to stress. Deficiency or excess of nutrients causes cellular metabolic stress, and we hypothesized that p53 could be linked to glucose maintenance. We show here that upon starvation hepatic p53 is stabilized by O-GlcNAcylation and plays an essential role in the physiological regulation of glucose homeostasis. More specifically, p53 binds to PCK1 promoter and regulates its transcriptional activation, thereby controlling hepatic glucose production. Mice lacking p53 in the liver show a reduced gluconeogenic response during calorie restriction. Glucagon, adrenaline and glucocorticoids augment protein levels of p53, and administration of these hormones to p53 deficient human hepatocytes and to liver-specific p53 deficient mice fails to increase glucose levels. Moreover, insulin decreases p53 levels, and over-expression of p53 impairs insulin sensitivity. Finally, protein levels of p53, as well as genes responsible of O-GlcNAcylation are elevated in the liver of type 2 diabetic patients and positively correlate with glucose and HOMA-IR. Overall these results indicate that the O-GlcNAcylation of p53 plays an unsuspected key role regulating in vivo glucose homeostasis.

Also flagged:P2Y1 receptorprostate cancercancerpurinergic G-protein coupled receptorP2Y1Rindoline
Journal Article 2021-08-20 No Snippets Le HTT, Murugesan A, Ramesh T, Yli-Harja O, Konda Mani S, Kandhavelu M.
Show Full Abstract

Prostate cancer is a heterogeneous, slow growing asymptomatic cancer that predominantly affects man. A purinergic G-protein coupled receptor, P2Y1R, is targeted for its therapeutic value since it plays a crucial role in many key molecular events of cancer progression and invasion. Our previous study demonstrated that indoline derivative, 1 ((1-(2-Hydroxy-5-nitrophenyl) (4-hydroxyphenyl) methyl)indoline-4‑carbonitrile; HIC), stimulates prostate cancer cell (PCa) growth inhibition via P2Y1R. However, the mode of interaction of P2Y1R with HIC involved in this process remains unclear. Here, we have reported the molecular interactions of HIC with P2Y1R. Molecular dynamics simulation was performed that revealed the stable specific binding of the protein-ligand complex. In vitro analysis has shown increased apoptosis of PCa-cells, PC3, and DU145, upon specific interaction of P2Y1R-HIC. This was further validated using siRNA analysis that showed a higher percentage of apoptotic cells in PCa-cells transfected with P2Y-siRNA-MRS2365 than P2Y-siRNA-HIC treatment. Decreased mitochondrial membrane potential (MMP) activity and reduced glutathione (GSH) level show their role in P2Y1R-HIC mediated apoptosis. These in silico and in vitro results confirmed that HIC could induce mitochondrial apoptotic signaling through the P2Y1R activation. Thus, HIC being a potential ligand upon interaction with P2Y1R might have therapeutic value for the treatment of prostate cancer.

Also flagged:xenoestrogenszearalenoneenterolactoneENLautophagyendoplasmic reticulum
Journal Article 2021-08-20 No Snippets Silva IP, Brito DCC, Silva TES, Silva RF, Guedes MIF, Silva JYG, Rodrigues APR, Santos RR, Figueiredo JR.
Show Full Abstract

The aim of this study was to evaluate the effect of 1 μmol/L zearalenone (ZEN) and 1 μmol/L enterolactone (ENL), alone or in combination, on the survival and morphology of in vitro cultured ovarian preantral follicles. Ovaries from 10 sheep were collected at a local abattoir and fragmented, and the ovarian pieces were submitted to in vitro culture for 3 days in the presence or absence of the test compounds. The morphology of primordial and primary follicles was impaired by ZEN, whereas that of cultured secondary follicles was improved by ENL. However, the combination of ENL with ZEN impaired the quality of primary and secondary follicles. Both ZEN and ENL induced apoptosis, but only ZEN was responsible for oocyte autophagy. None of these xenoestrogens affected endoplasmic reticulum stress as observed by the unaltered expression of ERP29. Differently from ZEN, ENL increased the expression of the efflux transporter ABCG2. In conclusion, although ENL can counteract the negative effects of ZEN on primordial and primary follicles, this positive effect is not similar to that observed in ovarian tissue cultures in the presence of ENL alone.

Also flagged:asthmaautismbehavioralketamineorganizationcognition
Journal Article 2021-08-20 ✓ 1 Snippet Capitanio JP.
In-Text Gene Mentions

One gene codes for the serotonin transporter (5-HTT), the molecule responsible for reuptake of serotonin from the synaptic cleft following its release.

Show Full Abstract

Animals vary on intrinsic characteristics such as temperament and stress responsiveness, and this information can be useful to experimentalists for identifying more homogeneous subsets of animals that show consistency in risk for a particular research outcome. Such information can also be useful for balancing experimental groups, ensuring animals within an experiment have similar characteristics. In this review, we describe the BioBehavioral Assessment Program at the California National Primate Research Center, which, since its inception in 2001, has been providing quantitative information on intrinsic characteristics to scientists for subject selection and balancing, and to colony management staff for management purposes. We describe the program and review studies relating to asthma, autism, behavioral inhibition, etc., where the BBA Program was used to select animals. We also review our work, showing that factors such as rearing, ketamine exposure, and prenatal experience can affect biobehavioral organization in ways that some investigators might want to control for in their studies. Attention to intrinsic characteristics of subject populations is consistent with the growing interest in precision medicine and can lead to a reduction in animal numbers, savings in time and money for investigators, and reduced distress for the animals.

Also flagged:Glucose TransporterscancerMetabolismglucoseGLUT1GLUT3
Journal Article 2021-08-20 No Snippets Pliszka M, Szablewski L.
Show Full Abstract

Tumor growth causes cancer cells to become hypoxic. A hypoxic condition is a hallmark of cancer. Metabolism of cancer cells differs from metabolism of normal cells. Cancer cells prefer the process of glycolysis as a source of ATP. Process of glycolysis generates only two molecules of ATP per one molecule of glucose, whereas the complete oxidative breakdown of one molecule of glucose yields 36 molecules of ATP. Therefore, cancer cells need more molecules of glucose in comparison with normal cells. Increased uptake of glucose by these cells is due to overexpression of glucose transporters, especially GLUT1 and GLUT3, that are hypoxia responsive, as well as other glucose transport proteins. Increased expression of these carrier proteins may be used in anticancer therapy. This phenomenon is used in diagnostic techniques such as FDG-PET. It is also suggested, and there are observations, that therapeutic inhibition of glucose transporters may be a method in treatment of cancer patients. On the other hand, there are described cases, in which upregulation of glucose transporters, as, for example, NIS, which is used in radioiodine therapy, can help patients with cancer. The aim of this review is the presentation of possibilities, and how glucose transporters can be used in anticancer therapy.

Also flagged:Tumourcolorectal cancercarcinomasgene expressionmetastatic diseasetumours
Journal Article 2021-08-20 No Snippets Lastraioli E, Ruffinatti FA, Di Costanzo F, Sala C, Munaron L, Arcangeli A.
Show Full Abstract

Because of its high incidence and poor prognosis, colorectal cancer (CRC) represents an important health issue in several countries. As with other carcinomas, the so-called tumour microenvironment (TME) has been shown to play key roles in CRC progression and related therapeutical outcomes, even though a deeper understanding of the underlying molecular mechanisms is needed to devise new treatment strategies. For some years now, omics technologies and consolidated bioinformatics pipelines have allowed scientists to access large amounts of biologically relevant information, even when starting from small tissue samples; thus, in order to shed new light upon the role of the TME in CRC, we compared the gene expression profiles of 6 independent tumour tissues (all progressed towards metastatic disease) to the expression profile of the surrounding stromata. To do this, paraffin-embedded whole tissues were first microdissected to obtain samples enriched with tumour and stromal cells, respectively. Afterwards, RNA was extracted and analysed using a microarray-based approach. A thorough bioinformatics analysis was then carried out to identify transcripts differentially expressed between the two groups and possibly enriched functional terms. Overall, 193 genes were found to be significantly downregulated in tumours compared to the paired stromata. The functional analysis of the downregulated gene list revealed three principal macro areas of interest: the extracellular matrix, cell migration, and angiogenesis. Conversely, among the upregulated genes, the main alterations detected by the functional annotation were related to the ribosomal proteins (rProteins) of both the large (60S) and small (40S) subunits of the cytosolic ribosomes. Subsequent gene set enrichment analysis (GSEA) confirmed the massive overexpression of most cytosolic-but not mitochondrial-ribosome rProteins.

Also flagged:CancernucleoluscancersmTORtumourimmune responses
Journal Article 2021-08-20 No Snippets van der Werf J, Chin CV, Fleming NI.
Show Full Abstract

Small nucleolar RNA (snoRNA) were one of our earliest recognised classes of non-coding RNA, but were largely ignored by cancer investigators due to an assumption that their activities were confined to the nucleolus. However, as full genome sequences have become available, many new snoRNA genes have been identified, and multiple studies have shown their functions to be diverse. The consensus now is that many snoRNA are dysregulated in cancers, are differentially expressed between cancer types, stages and metastases, and they can actively modify disease progression. In addition, the regulation of the snoRNA class is dominated by the cancer-supporting mTOR signalling pathway, and they may have particular significance to immune cell function and anti-tumour immune responses. Given the recent advent of therapeutics that can target RNA molecules, snoRNA have robust potential as drug targets, either solely or in the context of immunotherapies.

Also flagged:breast cancergene expressionreceptor tyrosine-protein kinase erbB-2HER2hormone-receptorestrogen-receptor
Journal Article 2021-08-20 No Snippets Fuso P, Di Salvatore M, Santonocito C, Guarino D, Autilio C, Mulè A, Arciuolo D, Rinninella A, Mignone F, Ramundo M, Di Stefano B, Orlandi A, Capoluongo E, Nicolotti N, Franceschini G, Sanchez AM, Tortora G, Scambia G, Barone C, Cassano A.
Show Full Abstract

<h4>Background</h4>The aim of this study is to identify miRNAs able to predict the outcomes in breast cancer patients after neoadjuvant chemotherapy (NAC).<h4>Patients and methods</h4>We retrospectively analyzed 24 patients receiving NAC and not reaching pathologic complete response (pCR). miRNAs were analyzed using an Illumina Next-Generation-Sequencing (NGS) system.<h4>Results</h4>Event-free survival (EFS) and overall survival (OS) were significantly higher in patients with up-regulation of let-7a-5p (EFS <i>p</i> = 0.006; OS <i>p</i> = 0.0001), mirR-100-5p (EFS s <i>p</i> = 0.01; OS <i>p</i> = 0.03), miR-101-3p (EFS <i>p</i> = 0.05; OS <i>p</i> = 0.01), and miR-199a-3p (EFS <i>p</i> = 0.02; OS <i>p</i> = 0.01) in post-NAC samples, independently from breast cancer subtypes. At multivariate analysis, only let-7a-5p was significantly associated with EFS (<i>p</i> = 0.009) and OS (<i>p</i> = 0.0008).<h4>Conclusion</h4>Up-regulation of the above miRNAs could represent biomarkers in breast cancer.

Also flagged:Pumilio2RNA-binding proteinsCellular growthcancerPum2basic fibroblast growth factor
Journal Article 2021-08-20 No Snippets Schieweck R, Schöneweiss EC, Harner M, Rieger D, Illig C, Saccà B, Popper B, Kiebler MA.
Show Full Abstract

RNA-binding proteins (RBPs) are essential regulators controlling both the cellular transcriptome and translatome. These processes enable cellular plasticity, an important prerequisite for growth. Cellular growth is a complex, tightly controlled process. Using cancer cells as model, we looked for RBPs displaying strong expression in published transcriptome datasets. Interestingly, we found the Pumilio (Pum) protein family to be highly expressed in all these cells. Moreover, we observed that Pum2 is regulated by basic fibroblast growth factor (bFGF). bFGF selectively enhances protein levels of Pum2 and the eukaryotic initiation factor 4E (eIF4E). Exploiting atomic force microscopy and in vitro pulldown assays, we show that Pum2 selects for <i>eIF4E</i> mRNA binding. Loss of Pum2 reduces eIF4E translation. Accordingly, depletion of Pum2 led to decreased soma size and dendritic branching of mature neurons, which was accompanied by a reduction in essential growth factors. In conclusion, we identify Pum2 as an important growth factor for mature neurons. Consequently, it is tempting to speculate that Pum2 may promote cancer growth.

Also flagged:5-HT ReceptorsSerotoninsleepdepressionsynapsesSERT
Journal Article 2021-08-20 No Snippets Ślifirski G, Król M, Turło J.
Show Full Abstract

Serotonin modulates several physiological and cognitive pathways throughout the human body that affect emotions, memory, sleep, and thermal regulation. The complex nature of the serotonergic system and interactions with other neurochemical systems indicate that the development of depression may be mediated by various pathomechanisms, the common denominator of which is undoubtedly the disturbed transmission in central 5-HT synapses. Therefore, the deliberate pharmacological modulation of serotonergic transmission in the brain seems to be one of the most appropriate strategies for the search for new antidepressants. As discussed in this review, the serotonergic system offers great potential for the development of new antidepressant therapies based on the combination of SERT inhibition with different pharmacological activity towards the 5-HT system. The aim of this article is to summarize the search for new antidepressants in recent years, focusing primarily on the possibility of benefiting from interactions with various 5-HT receptors in the pharmacotherapy of depression.

Also flagged:S24RF3influenzaTranscription FactorsTumorcancer
Journal Article 2021-08-20 ✓ 1 Snippet Liu L, Zhao Q, Zhao Q, Cheng C, Yi J, Sun H, Wang Q, Quan W, Xue Y, Sun L, Cong X, Zhang Y.
In-Text Gene Mentions

…NBPF15 (92%), andLRRIQ3(75%).…

Show Full Abstract

Tumor-infiltrating immune cells shape the tumor microenvironment and are closely related to clinical outcomes. Several transcription factors (TFs) have also been reported to regulate the antitumor activity and immune cell infiltration. This study aimed to quantify the populations of different immune cells infiltrated in tumor samples based on the bulk RNA sequencing data obtained from 50 cancer patients using the CIBERSORT and the EPIC algorithm. Weighted gene coexpression network analysis (WGCNA) identified eigengene modules strongly associated with tumorigenesis and the activation of CD4+ memory T cells, dendritic cells, and macrophages. TF genes <i>FOXM1</i>, <i>MYBL2</i>, <i>TAL1</i>, and <i>ERG</i> are central in the subnetworks of the eigengene modules associated with immune-related genes. The analysis of The Cancer Genome Atlas (TCGA) cancer data confirmed these findings and further showed that the expression of these potential TF genes regulating immune infiltration, and the immune-related genes that they regulated, was associated with the survival of patients within multiple cancers. Exome-seq was performed on 24 paired samples that also had RNA-seq data. The expression quantitative trait loci (eQTL) analysis showed that mutations were significantly more frequent in the regions flanking the TF genes compared with those of non-TF genes, suggesting a driver role of these TF genes regulating immune infiltration. Taken together, this study presented a practical method for identifying genes that regulate immune infiltration. These genes could be potential biomarkers for cancer prognosis and possible therapeutic targets.

Also flagged:BDNFFosEgr1SncaPtgs2Npas4
Journal Article 2021-08-20 ✓ 2 Snippets Chen X, Chen X, Xie H, Wang X, Zheng Z, Jin S.
In-Text Gene Mentions

As a novel oncogene, CIRBP has been shown to increase the expression of HIF-1α by binding to the 3′-UTR of its mRNA, which suppresses the expression of prostaglandin I synthase (PTGIS) and regulates tumor progression (Lu et al., 2018).

…prostaglandin I synthase (PTGIS) and regulates tumor…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignancies worldwide with very limited treatment options. Cold-inducible RNA binding protein (CIRBP) plays promoting roles in several types of cancers, but its function remains unclear in PDAC. Here, we found that the expression of CIRBP was upregulated in PDAC tumor tissues and was significantly associated with poor prognosis. Knockdown of CIRBP in PANC-1 and SW1990 cells inhibited proliferation, migration and invasion <i>in vitro</i> and suppressed tumor growth <i>in vivo</i>. Moreover, CIRBP knockdown enhanced the antitumour effects of gemcitabine treatment in PANC-1 and SW1990 cells, whereas CIRBP overexpression exerted the opposite effects. Mechanistically, CIRBP promoted PDAC malignancy and chemoresistance via upregulation of dual-specificity tyrosine-Y-phosphorylation regulated kinase 1B (DYRK1B). Indeed, knockdown of CIRBP sensitized pancreatic tumors to gemcitabine treatment by diminishing DYRK1B expression and increasing the ratio of ERK/p38 activity. Our findings suggest that CIRBP overexpression facilitates PDAC progression and gemcitabine resistance by upregulating DYRK1B expression and inhibiting the ERK/p38 signaling pathway, highlighting CIRBP as a potential new therapeutic target for PDAC.

Also flagged:Mettl3waternitrocellulosepolyacrylamidemembranesSinefungin
Journal Article 2021-08-20 ✓ 3 Snippets Dos Santos Guilherme M, Tsoutsouli T, Todorov H, Teifel S, Nguyen VTT, Gerber S, Endres K.
In-Text Gene Mentions

Especially in dominant female mice compared to their submissive counterparts, genes involved in modulating fear response and anxiety (e.g., Cacna1e, Nlg2, Tnr, Grin2a, and Grin2b) were up-regulated.

…alpha 1E gene (Cacna1e), the glycoprotein tenascin-R…

…and anxiety (e.g.,Cacna1e, Nlg2, Tnr, Grin2a,…

Show Full Abstract

Appropriately responding to stressful events is essential for maintaining health and well-being of any organism. Concerning social stress, the response is not always as straightforward as reacting to physical stressors, e.g., extreme heat, and thus has to be balanced subtly. Particularly, regulatory mechanisms contributing to gaining resilience in the face of mild social stress are not fully deciphered yet. We employed an intrinsic social hierarchy stress paradigm in mice of both sexes to identify critical factors for potential coping strategies. While global transcriptomic changes could not be observed in male mice, several genes previously reported to be involved in synaptic plasticity, learning, and anxiety-like behavior were differentially regulated in female mice. Moreover, changes in N<sup>6</sup>-methyladenosine (m<sup>6</sup>A)-modification of mRNA occurred associated with corticosterone level in both sexes with, e.g., increased global amount in submissive female mice. In accordance with this, METTL14 and WTAP, subunits of the methyltransferase complex, showed elevated levels in submissive female mice. N<sup>6</sup>-adenosyl-methylation is the most prominent type of mRNA methylation and plays a crucial role in processes such as metabolism, but also response to physical stress. Our findings underpin its essential role by also providing a link to social stress evoked by hierarchy building within same-sex groups. As recently, search for small molecule modifiers for the respective class of RNA modifying enzymes has started, this might even lead to new therapeutic approaches against stress disorders.

Also flagged:MLMmemoryCDSDaCSIterm
Journal Article 2021-08-20 No Snippets Duan Y, El Ghoul S, Guedhami O, Li H, Li X.
Show Full Abstract

Using 1,584 listed banks from 64 countries during the COVID-19 pandemic, we conduct the first broad-based international study of the effect of the pandemic on bank systemic risk. We find the pandemic has increased systemic risk across countries. The effect operates through government policy response and bank default risk channels. Additional analysis suggests that the adverse effect on systemic stability is more pronounced for large, highly leveraged, riskier, high loan-to-asset, undercapitalized, and low network centrality banks. However, this effect is moderated by formal bank regulation (e.g., deposit insurance), ownership structure (e.g., foreign and government ownership), and informal institutions (e.g., culture and trust).

Also flagged:ethanolchitosanCarbonwaterIonsFe3+
Journal Article 2021-08-20 No Snippets Crooke SN, Goergen KM, Ovsyannikova IG, Kennedy RB.
Show Full Abstract

<b>Introduction:</b> Each year, a disproportionate number of the total seasonal influenza-related hospitalizations (90%) and deaths (70%) occur among adults who are >65 years old. Inflammasome activation has been shown to be important for protection against influenza infection in animal models but has not yet been demonstrated in humans. We hypothesized that age-related dysfunction (immunosenescence) of the inflammasome may be associated with poor influenza-vaccine response among older adults. <b>Methods:</b> A cohort of younger (18-40 years of age) and older (≥65 years of age) adults was recruited prior to the 2014-2015 influenza season. We measured hemagglutination inhibition (HAI) titers in serum before and 28 days after receipt of the seasonal inactivated influenza vaccine. Inflammasome-related gene expression and protein secretion were quantified in monocyte-derived macrophages following stimulation with influenza A/H1N1 virus. <b>Results:</b> Younger adults exhibited higher HAI titers compared to older adults following vaccination, although inflammasome-related protein secretion in response to influenza stimulation was similar between the age groups. Expression of <i>P2RX7</i> following influenza stimulation was lower among older adults. Interestingly, <i>CFLAR</i> expression was significantly higher among females (<i>p</i> = 2.42 × 10<sup>-5</sup>) following influenza stimulation and this gene may play an important role in the development of higher HAI antibody titers among older females. <b>Conclusion:</b> Inflammasome activation in response to influenza vaccination appears to be maintained in monocyte-derived macrophages from older adults and does not explain the poor influenza vaccine responses generally observed among this age group.

bioRxiv 2021-08-20 Preprint (No Snippets API) Subramaniam S, Hekman RM, Jayaraman A, O’Connell AK, Montanaro P, Blum B, Kenney D, Ericsson M, Ravid K, Crossland NA, Emili A, Douam F, Bosmann M.
Show Full Abstract

Coronavirus disease-2019 (COVID-19) provokes a hypercoagulable state with increased incidence of thromboembolism and mortality. Platelets are major effectors of thrombosis and hemostasis. Suitable animal models are needed to better understand COVID-19-associated coagulopathy (CAC) and underlying platelet phenotypes. Here, we assessed K18-hACE2 mice undergoing a standardized SARS-CoV-2 infection protocol to study dynamic platelet responses via mass spectrometry-based proteomics. In total, we found significant changes in >1,200 proteins. Strikingly, protein alterations occurred rapidly by 2 days post-infection (dpi) and preceded outward clinical signs of severe disease. Pathway enrichment analysis of 2dpi platelet proteomes revealed that SARS-CoV-2 infection upregulated complement-coagulation networks (F2, F12, CFH, CD55/CD59), platelet activation-adhesion-degranulation proteins (PF4, SELP, PECAM1, HRG, PLG, vWF), and chemokines (CCL8, CXCL5, CXCL12). When mice started to lose weight at 4dpi, pattern recognition receptor signaling (RIG-I/MDA5, CASP8, MAPK3), and interferon pathways (IFIT1/IFIT3, STAT1) were predominant. Interestingly, SARS-CoV-2 spike protein in the lungs was observed by immunohistochemistry, but in platelets was undetected by proteomics. Similar to patients, K18-hACE2 mice during SARS-CoV-2 infection developed progressive lymphohistiocytic interstitial pneumonia with platelet aggregates in the lungs and kidneys. In conclusion, this model recapitulates activation of coagulation, complement, and interferon responses in circulating platelets, providing valuable insight into platelet pathology during COVID-19. <h4>Key Points</h4> SARS-CoV-2-infected humanized ACE2 mice recapitulate platelet reprogramming towards activation-degranulation-aggregation. Complement/coagulation pathways are dominant in platelets at 2 days post-infection (dpi), while interferon signaling is dominant at 4dpi.

Research Square 2021-08-20 Preprint (No Snippets API) Desquilles L, Cano L, Ghukasyan G, Landreau C, Corlu A, Clément B, Turlin B, Désert R, Musso O.
Show Full Abstract

Angiotensin-converting enzyme 2 (ACE2) is the receptor of the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) causing Coronavirus disease 2019 (COVID-19).Transmembrane serine protease 2 (TMPRSS2) is a coreceptor.Abnormal hepatic function in COVID-19 suggests specific or bystander liver disease.Because liver cancer cells express the ACE2viral receptor, they arewidely usedas models of SARS-CoV-2 infection in vitro. Therefore, the purpose of this study was to analyze ACE2 and TMPRSS2 expression and localization in human liver cancers and in non-tumor livers.We studied ACE2 and TMPRSS2 in two transcriptomic datasets totaling 1503 liver cancersand 47 non-tumor samplesand in tissue microarrays including 41 HCCs and five non-tumor samples by multiplex high-resolution confocal immunohistochemistryand quantitative image analysis.In liver cancers, wedetectedACE2 and TMPRSS2 at the biliary pole of tumor hepatocytes. In non-tumor livers, we identifiedACE2 in hepatocyte’s bile canaliculi, biliary epithelium,sinusoidal and capillary endothelial cells.Tumors carrying mutated β-catenin showed ACE2 DNA hypomethylation and higher mRNA and protein expression, consistently with predicted β-catenin response sites in the ACE2 promoter.Finally, ACE2 and TMPRSS2 co-expression networkshighlightedhepatocyte-specific functions, oxidative stress and inflammation, suggesting a link between inflammation, ACE2 dysfunction and metabolic breakdown.

Also flagged:neurodegenerative disordersautophagygenetic diseaseneurodevelopmental disordermyopathymultisystem disorders
Journal Article 2021-08-19 ✓ 1 Snippet Deneubourg C, Ramm M, Smith LJ, Baron O, Singh K, Byrne SC, Duchen MR, Gautel M, Eskelinen EL, Fanto M, Jungbluth H.
In-Text Gene Mentions

In addition to these basic considerations and in a more clinical context, autophagy has been associated with adult-onset neurodegenerative disorders in several ways (for review [148],), nonspecifically through its complex interactions with the potentially toxic protein aggregates implicated in these conditions, and, specifically, through primary genetic mutations directly or indirectly affecting components of the autophagy machinery (summarized in Table S1): Autophagy plays a role, for example, in the removal of SNCA (synuclein alpha) in PD [149,150], misfolded proteins in ALS [52,151], mutant HTT (huntingtin; mHTT) in Huntington disease (HD) [114,152] and intracellular MAPT/TAU tangles in Alzheimer disease (AD) [153,154], but at the same time these targets of autophagic digestions may impair normal autophagic flux and functioning through their inherent toxicity.

Show Full Abstract

Primary dysfunction of autophagy due to Mendelian defects affecting core components of the autophagy machinery or closely related proteins have recently emerged as an important cause of genetic disease. This novel group of human disorders may present throughout life and comprises severe early-onset neurodevelopmental and more common adult-onset neurodegenerative disorders. Early-onset (or congenital) disorders of autophagy often share a recognizable "clinical signature," including variable combinations of neurological, neuromuscular and multisystem manifestations. Structural CNS abnormalities, cerebellar involvement, spasticity and peripheral nerve pathology are prominent neurological features, indicating a specific vulnerability of certain neuronal populations to autophagic disturbance. A typically biphasic disease course of late-onset neurodegeneration occurring on the background of a neurodevelopmental disorder further supports a role of autophagy in both neuronal development and maintenance. Additionally, an associated myopathy has been characterized in several conditions. The differential diagnosis comprises a wide range of other multisystem disorders, including mitochondrial, glycogen and lysosomal storage disorders, as well as ciliopathies, glycosylation and vesicular trafficking defects. The clinical overlap between the congenital disorders of autophagy and these conditions reflects the multiple roles of the proteins and/or emerging molecular connections between the pathways implicated and suggests an exciting area for future research. Therapy development for congenital disorders of autophagy is still in its infancy but may result in the identification of molecules that target autophagy more specifically than currently available compounds. The close connection with adult-onset neurodegenerative disorders highlights the relevance of research into rare early-onset neurodevelopmental conditions for much more common, age-related human diseases.<b>Abbreviations:</b> AC: anterior commissure; AD: Alzheimer disease; ALR: autophagic lysosomal reformation; ALS: amyotrophic lateral sclerosis; AMBRA1: autophagy and beclin 1 regulator 1; AMPK: AMP-activated protein kinase; ASD: autism spectrum disorder; ATG: autophagy related; BIN1: bridging integrator 1; BPAN: beta-propeller protein associated neurodegeneration; CC: corpus callosum; CHMP2B: charged multivesicular body protein 2B; CHS: Chediak-Higashi syndrome; CMA: chaperone-mediated autophagy; CMT: Charcot-Marie-Tooth disease; CNM: centronuclear myopathy; CNS: central nervous system; DNM2: dynamin 2; DPR: dipeptide repeat protein; DVL3: disheveled segment polarity protein 3; EPG5: ectopic P-granules autophagy protein 5 homolog; ER: endoplasmic reticulum; ESCRT: homotypic fusion and protein sorting complex; FIG4: FIG4 phosphoinositide 5-phosphatase; FTD: frontotemporal dementia; GBA: glucocerebrosidase; GD: Gaucher disease; GRN: progranulin; GSD: glycogen storage disorder; HC: hippocampal commissure; HD: Huntington disease; HOPS: homotypic fusion and protein sorting complex; HSPP: hereditary spastic paraparesis; LAMP2A: lysosomal associated membrane protein 2A; MEAX: X-linked myopathy with excessive autophagy; mHTT: mutant huntingtin; MSS: Marinesco-Sjoegren syndrome; MTM1: myotubularin 1; MTOR: mechanistic target of rapamycin kinase; NBIA: neurodegeneration with brain iron accumulation; NCL: neuronal ceroid lipofuscinosis; NPC1: Niemann-Pick disease type 1; PD: Parkinson disease; PtdIns3P: phosphatidylinositol-3-phosphate; RAB3GAP1: RAB3 GTPase activating protein catalytic subunit 1; RAB3GAP2: RAB3 GTPase activating non-catalytic protein subunit 2; RB1: RB1-inducible coiled-coil protein 1; RHEB: ras homolog, mTORC1 binding; SCAR20: SNX14-related ataxia; SENDA: static encephalopathy of childhood with neurodegeneration in adulthood; SNX14: sorting nexin 14; SPG11: SPG11 vesicle trafficking associated, spatacsin; SQSTM1: sequestosome 1; TBC1D20: TBC1 domain family member 20; TECPR2: tectonin beta-propeller repeat containing 2; TSC1: TSC complex subunit 1; TSC2: TSC complex subunit 2; UBQLN2: ubiquilin 2; VCP: valosin-containing protein; VMA21: vacuolar ATPase assembly factor VMA21; WDFY3/ALFY: WD repeat and FYVE domain containing protein 3; WDR45: WD repeat domain 45; WDR47: WD repeat domain 47; WMS: Warburg Micro syndrome; XLMTM: X-linked myotubular myopathy; ZFYVE26: zinc finger FYVE-type containing 26.

Also flagged:ZBTB20transcription factorzinc finger and BTB domain-containing protein 20AstrogliogenesisGFAPPrimrose syndrome
Journal Article 2021-08-19 ✓ 1 Snippet Medeiros de Araújo JA, Barão S, Mateos-White I, Espinosa A, Costa MR, Gil-Sanz C, Müller U.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Neocortical progenitor cells generate subtypes of excitatory projection neurons in sequential order followed by the generation of astrocytes. The transcription factor zinc finger and BTB domain-containing protein 20 (ZBTB20) has been implicated in regulation of cell specification during neocortical development. Here, we show that ZBTB20 instructs the generation of a subset of callosal projections neurons in cortical layers II/III in mouse. Conditional deletion of Zbtb20 in cortical progenitors, and to a lesser degree in differentiating neurons, leads to an increase in the number of layer IV neurons at the expense of layer II/III neurons. Astrogliogenesis is also affected in the mutants with an increase in the number of a specific subset of astrocytes expressing GFAP. Astrogliogenesis is more severely disrupted by a ZBTB20 protein containing dominant mutations linked to Primrose syndrome, suggesting that ZBTB20 acts in concert with other ZBTB proteins that were also affected by the dominant-negative protein to instruct astrogliogenesis. Overall, our data suggest that ZBTB20 acts both in progenitors and in postmitotic cells to regulate cell fate specification in the mammalian neocortex.

Also flagged:Parkinson's diseasePDbindinghistoneshistone H3albumin
Journal Article 2021-08-19 ✓ 1 Snippet Jos S, Gogoi H, Prasad TK, Hurakadli MA, Kamariah N, Padmanabhan B, Padavattan S.
In-Text Gene Mentions

linker histones

Show Full Abstract

α-Synuclein (αS) plays a key role in Parkinson's disease (PD). The αS nuclear role, its binding affinity and specificity to histones and dsDNA remains unknown. Here, we have measured the binding affinity ( Kd ) between αS wild-type (wt) and PD-specific αS S129-phosphorylation mimicking (S129E) mutant with full-length and flexible tail truncated individual core histones (H2a, H2b, H3, and H4), linker histone (H1), and carried out αS-dsDNA interaction studies. This study revealed that αS(wt) interacts specifically with N-terminal flexible tails of histone H3, H4, and flexible tails of H1. The αS(S129E) mutant recognizes histones similar to αS(wt) but binds with higher affinity. Intriguingly, αS(S129E) showed a binding affinity for control proteins (bovine serum albumin and lysozyme), while no interaction was seen for αS(wt). Based on our above observation, we contemplate that the physio-chemical properties of αS with S129-phosphorylation has changed compared to αS(wt), resulting in interaction for other proteins, which is the basis for Lewy body formation. Besides, this study showed αS binding to dsDNA is weak and nonspecific. Overall, αS specificity for histone binding suggests that its nuclear role is possibly driven through histone interaction.

Also flagged:cancerCell cycleOxaliplatinKRT19localizationMAPK
Journal Article 2021-08-19 ✓ 5 Snippets Uhlitz F, Bischoff P, Peidli S, Sieber A, Trinks A, Lüthen M, Obermayer B, Blanc E, Ruchiy Y, Sell T, Mamlouk S, Arsie R, Wei TT, Klotz-Noack K, Schwarz RF, Sawitzki B, Kamphues C, Beule D, Landthaler M, Sers C, Horst D, Blüthgen N, Morkel M.
In-Text Gene Mentions

OLFM4

Individual stem cell markers such as OLFM4 or CD44 varied in expression between the stem/TA‐cell‐like and TC1‐4 clusters and were also found overexpressed in clusters of colorectal polyp and cancer cell of another study (preprint: Becker et al, 2021).

Immunofluorescence analysis for OLFM4, MKI67, FABP1, and TFF3 in normal and tumor tissue.

Immunofluorescent staining of primary CRC sections with antibodies directed against the stem cell marker OLFM4, the proliferation marker KI67, and the differentiation markers TFF3 and FABP1 revealed cell heterogeneity, but not how cancer cells in the tissue are related to each other (Fig EV4).

All sections are from patient P009, except the EPCAM/OLFM4 co‐staining that was done on tumor tissue of P016.

Show Full Abstract

In colorectal cancer, oncogenic mutations transform a hierarchically organized and homeostatic epithelium into invasive cancer tissue lacking visible organization. We sought to define transcriptional states of colorectal cancer cells and signals controlling their development by performing single-cell transcriptome analysis of tumors and matched non-cancerous tissues of twelve colorectal cancer patients. We defined patient-overarching colorectal cancer cell clusters characterized by differential activities of oncogenic signaling pathways such as mitogen-activated protein kinase and oncogenic traits such as replication stress. RNA metabolic labeling and assessment of RNA velocity in patient-derived organoids revealed developmental trajectories of colorectal cancer cells organized along a mitogen-activated protein kinase activity gradient. This was in contrast to normal colon organoid cells developing along graded Wnt activity. Experimental targeting of EGFR-BRAF-MEK in cancer organoids affected signaling and gene expression contingent on predictive KRAS/BRAF mutations and induced cell plasticity overriding default developmental trajectories. Our results highlight directional cancer cell development as a driver of non-genetic cancer cell heterogeneity and re-routing of trajectories as a response to targeted therapy.

Also flagged:chaperonesluciferaseproteostasisagingtauopathyhomeostasis
Journal Article 2021-08-19 ✓ 2 Snippets Blumenstock S, Schulz-Trieglaff EK, Voelkl K, Bolender AL, Lapios P, Lindner J, Hipp MS, Hartl FU, Klein R, Dudanova I.
In-Text Gene Mentions

…‐Q97‐mCherry, HTT‐Q25‐mCherry)HTT‐exon1 constructs are similar…

…under the humanHTTpromoter (Mangiarini et…

Show Full Abstract

The cellular protein quality control machinery is important for preventing protein misfolding and aggregation. Declining protein homeostasis (proteostasis) is believed to play a crucial role in age-related neurodegenerative disorders. However, how neuronal proteostasis capacity changes in different diseases is not yet sufficiently understood, and progress in this area has been hampered by the lack of tools to monitor proteostasis in mammalian models. Here, we have developed reporter mice for in vivo analysis of neuronal proteostasis. The mice express EGFP-fused firefly luciferase (Fluc-EGFP), a conformationally unstable protein that requires chaperones for proper folding, and that reacts to proteotoxic stress by formation of intracellular Fluc-EGFP foci and by reduced luciferase activity. Using these mice, we provide evidence for proteostasis decline in the aging brain. Moreover, we find a marked reaction of the Fluc-EGFP sensor in a mouse model of tauopathy, but not in mouse models of Huntington's disease. Mechanistic investigations in primary neuronal cultures demonstrate that different types of protein aggregates have distinct effects on the cellular protein quality control. Thus, Fluc-EGFP reporter mice enable new insights into proteostasis alterations in different diseases.

Also flagged:Niemann-Pick C DiseaseNiemann-Pick type Clysosomal storage disorderNPC1pathogenesisneurodegenerative disorders
Journal Article 2021-08-19 ✓ 1 Snippet Han S, Ren M, Kuang T, Pang M, Guan D, Liu Y, Wang Y, Zhang W, Ye Z.
In-Text Gene Mentions

…(Trem2, D430036J16Rik, Rian,Prdx6, and Eps8l2) and…

Show Full Abstract

Niemann-Pick type C (NP-C) disease is a neurodegenerative lysosomal storage disorder primarily caused by mutations in NPC1. However, its pathogenesis remains poorly understood. While mounting evidence has demonstrated the involvement of long noncoding RNAs (lncRNAs) in the pathogenesis of neurodegenerative disorders, the lncRNA expression profile in NP-C has not been determined. Here, we used RNA-seq analysis to determine lncRNA and mRNA expression profiles of the cerebella of NPC1<sup>-/-</sup> mice. We found that 272 lncRNAs and 856 mRNAs were significantly dysregulated in NPC1<sup>-/-</sup> mice relative to controls (≥ 2.0-fold, p < 0.05). Quantitative real-time PCR (qRT-PCR) was utilized to validate the expression of selected lncRNAs and mRNAs. Next, a lncRNA-mRNA coexpression network was employed to examine the potential roles of the differentially expressed (DE) lncRNAs. Functional analysis revealed that mRNAs coexpressed with lncRNAs are mainly linked to immune system-related processes and neuroinflammation. Moreover, knockdown of the lncRNA H19 ameliorated changes in ROS levels and cell viability and suppressed the lipopolysaccharide (LPS)-induced inflammatory response in vitro. Our findings indicate that dysregulated lncRNA expression patterns are associated with NP-C pathogenesis and offer insight into the development of novel therapeutics based on lncRNAs.

Also flagged:breast cancerimmunoglobulintransmembrane proteinslymphocyte activationautoimmune diseasescancers
Journal Article 2021-08-19 ✓ 2 Snippets Ren H, Li S, Liu X, Li W, Hao J, Zhao N.
In-Text Gene Mentions
⭐ same-sentence co-mention

…prognostic value ofBTN2A1, BTN3A1, BTN3A2, BTN3A3,…

⭐ same-sentence co-mention

…BTN2A1, BTN3A1, BTN3A2,BTN3A3, BTNL2, BTNL9, ERMAP,…

Show Full Abstract

Butyrophilins (BTNs) belong to the immunoglobulin superfamily of transmembrane proteins and play a role in the regulation of lymphocyte activation, several autoimmune diseases, and the progression of human cancers. However, the associated clinicopathologic characteristics and prognostic value of BTNs in breast cancer remain unknown. This study aimed to discover potential key related BTN genes and signaling pathways in breast cancer, which could provide new insights for immune-based strategies. In the present study, the mRNA expression level and prognostic value of BTN2A1, BTN3A1, BTN3A2, BTN3A3, BTNL2, BTNL9, ERMAP, and MOG were measured. Up-regulation of these genes was significantly correlated with improved overall and relapse-free survival. We then analyzed the prognostic outcomes of breast cancer subtypes, genetic alterations, interaction networks, and the functional enrichment of eight BTN family genes. Our results showed that these eight genes played essential roles in tumor progression. Furthermore, an immune infiltration analysis indicated that most candidate BTN family members were associated with intratumoral immune cell infiltration, especially that of γδ T cells. Finally, gene set enrichment analysis for a single hub gene revealed that each BTN gene played a vital role in tumor progression through immune signaling pathways. These findings provided new insights into breast cancer pathogenesis and identified eight potential biomarkers for breast cancer.

Also flagged:pathogenesisneurodegenerative diseasesHuntingtinHDinherited diseasesgenetic diseases
Journal Article 2021-08-19 ✓ 5 Snippets Tung CW, Huang PY, Chan SC, Cheng PH, Yang SH.
In-Text Gene Mentions

Most importantly, there is a critical expansion of CAG trinucleotide repeats in the exon 1 region of HTT gene, and patients carrying mutant HTT (mHTT) with more than 36 CAG repeats will develop the symptoms of HD gradually.

Additionally, HD is a monogenic disease, and the disease-causing gene, Huntingtin (HTT; also known as IT15), was first identified in 1993 [2].

In HD, AAV-miRNAs against mutant HTT have also been examined in different in vivo models, and shown different beneficial effects on molecular or neuropathological phenotypes [96–98].

…gene, Huntingtin (HTT; also known…

…ThisHTTgene is located…

Show Full Abstract

Huntington's disease (HD) is one of neurodegenerative diseases, and is defined as a monogenetic disease due to the mutation of Huntingtin gene. This disease affects several cellular functions in neurons, and further influences motor and cognitive ability, leading to the suffering of devastating symptoms in HD patients. MicroRNA (miRNA) is a non-coding RNA, and is responsible for gene regulation at post-transcriptional levels in cells. Since one miRNA targets to several downstream genes, it may regulate different pathways simultaneously. As a result, it raises a potential therapy for different diseases using miRNAs, especially for inherited diseases. In this review, we will not only introduce the update information of HD and miRNA, but also discuss the development of potential miRNA-based therapy in HD. With the understanding toward the progression of miRNA studies in HD, we anticipate it may provide an insight to treat this devastating disease, even applying to other genetic diseases.

Also flagged:gsrDementiatranslationsynthesisPPILewy body
Journal Article 2021-08-19 ✓ 1 Snippet Booi L, Wheatley A, Brunskill G, Banerjee S, Manthorpe J, Robinson L, Bamford C.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Introduction</h4>Growing numbers of interventions are being developed to support people and families living with dementia, but the extent to which they address the areas of most importance to the intended recipients is unclear. This qualitative review will synthesise outcomes identified as important from the perspectives of people living with dementia and their care partners, both for themselves and each other.<h4>Methods and analysis</h4>The review will employ thematic synthesis methodology. Studies from 1990 or later will be eligible if they include qualitative data on the views of people living with dementia or their care partners on valued outcomes or the lived experience of dementia. Databases to be searched include MEDLINE, Cumulative Index to Nursing and Allied Health Literature (CINAHL), PsycInfo and Social Sciences Premium Collection, in addition to systematically gathered grey literature. Rayyan QCRI software will be used to manage the screening processes, and NVivo software will be used to manage data extraction and analysis. The review will also critically evaluate the extent to which international recommendations address the areas of importance to people living with dementia and their families. The findings will be of relevance to researchers, policy makers and providers and commissioners of dementia services. The protocol is written in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses Protocols guidelines.<h4>Ethics and dissemination</h4>As the methodology of this study consists of collecting data from publicly available articles, it does not require ethical approval. We will share the results through conference presentations and an open-access publication in a peer-reviewed journal. Our mixed stakeholder involvement group will advise on dissemination to non-academic audiences.<h4>Prospero registration number</h4>CRD42020219274.

Also flagged:osteoarthritisdegradationextracellularMMP13angiogenesisimmune responses
Journal Article 2021-08-19 No Snippets Bedingfield SK, Colazo JM, Yu F, Liu DD, Jackson MA, Himmel LE, Cho H, Crofford LJ, Hasty KA, Duvall CL.
Show Full Abstract

The progression of osteoarthritis is associated with inflammation triggered by the enzymatic degradation of extracellular matrix in injured cartilage. Here we show that a locally injected depot of nanoparticles functionalized with an antibody targeting type II collagen and carrying small interfering RNA targeting the matrix metalloproteinase 13 gene (Mmp13), which breaks down type II collagen, substantially reduced the expression of MMP13 and protected cartilage integrity and overall joint structure in acute and severe mouse models of post-traumatic osteoarthritis. MMP13 inhibition suppressed clusters of genes associated with tissue restructuring, angiogenesis, innate immune responses and proteolysis. We also show that intra-articular injections of the nanoparticles led to greater reductions in disease progression than either a single injection or weekly injections of the steroid methylprednisolone. Sustained drug retention by targeting collagen in the damaged extracellular matrix of osteoarthritic cartilage may also be an effective strategy for the treatment of osteoarthritis with other disease-modifying drugs.

Also flagged:fragile X syndromeneurogenesisfragile X mental retardation proteinFMRPRNA-binding proteingene expression
Journal Article 2021-08-19 ✓ 3 Snippets Kang Y, Zhou Y, Li Y, Han Y, Xu J, Niu W, Li Z, Liu S, Feng H, Huang W, Duan R, Xu T, Raj N, Zhang F, Dou J, Xu C, Wu H, Bassell GJ, Warren ST, Allen EG, Jin P, Wen Z.
In-Text Gene Mentions

The markers for deeper layers (POU3F2, SATB2, and BCL11B) were increased in FXS (Supplementary Table 2), suggesting a change in layer predominance toward deeper layers in FXS organoids.

…layer (I:RELN, II:CUX1, III:POU3F2, IV:SATB2, V:BCL11B [also…

…for deeper layers (POU3F2, SATB2, and BCL11B)…

Show Full Abstract

Fragile X syndrome (FXS) is caused by the loss of fragile X mental retardation protein (FMRP), an RNA-binding protein that can regulate the translation of specific mRNAs. In this study, we developed an FXS human forebrain organoid model and observed that the loss of FMRP led to dysregulated neurogenesis, neuronal maturation and neuronal excitability. Bulk and single-cell gene expression analyses of FXS forebrain organoids revealed that the loss of FMRP altered gene expression in a cell-type-specific manner. The developmental deficits in FXS forebrain organoids could be rescued by inhibiting the phosphoinositide 3-kinase pathway but not the metabotropic glutamate pathway disrupted in the FXS mouse model. We identified a large number of human-specific mRNAs bound by FMRP. One of these human-specific FMRP targets, CHD2, contributed to the altered gene expression in FXS organoids. Collectively, our study revealed molecular, cellular and electrophysiological abnormalities associated with the loss of FMRP during human brain development.

Also flagged:NPAS4nucleuschromatin-behavioralAVP
Journal Article 2021-08-19 No Snippets Xu P, Berto S, Kulkarni A, Jeong B, Joseph C, Cox KH, Greenberg ME, Kim TK, Konopka G, Takahashi JS.
Show Full Abstract

The suprachiasmatic nucleus (SCN) is the master circadian pacemaker in mammals and is entrained by environmental light. However, the molecular basis of the response of the SCN to light is not fully understood. We used RNA/chromatin immunoprecipitation/single-nucleus sequencing with circadian behavioral assays to identify mouse SCN cell types and explore their responses to light. We identified three peptidergic cell types that responded to light in the SCN: arginine vasopressin (AVP), vasoactive intestinal peptide (VIP), and cholecystokinin (CCK). In each cell type, light-responsive subgroups were enriched for expression of neuronal Per-Arnt-Sim (PAS) domain protein 4 (NPAS4) target genes. Further, mice lacking Npas4 had a longer circadian period under constant conditions, a damped phase response curve to light, and reduced light-induced gene expression in the SCN. Our data indicate that NPAS4 is necessary for normal transcriptional responses to light in the SCN and critical for photic phase-shifting of circadian behavior.

Also flagged:malignancyHemochromatosisdefectliver diseaseliver cancer
Journal Article 2021-08-19 ✓ 4 Snippets Olynyk JK, Ramm GA.
In-Text Gene Mentions

…SK OF LIVER CANCER IN HFE-HEMOCHROMATOSIS. …

…63D variants in the HFE gene (JAMA 2020;324…

…linical penetrance of HFE Hemochromatosis. …

… commonest cause of HFE Hemochromatosis is …

Show Full Abstract

No abstract available.

Also flagged:SynthesisCOVID-19Benzimidazolepyrazolepneumoniaproton pump
Journal Article 2021-08-19 No Snippets Marinescu M.
Show Full Abstract

The synthesis of new compounds with antimicrobial and antiviral properties is a central objective today in the context of the COVID-19 pandemic. Benzimidazole and pyrazole compounds have remarkable biological properties, such as antimicrobial, antiviral, antitumor, analgesic, anti-inflammatory, anti-Alzheimer's, antiulcer, antidiabetic. Moreover, recent literature mentions the syntheses and antimicrobial properties of some benzimidazole-pyrazole hybrids, as well as other biological properties thereof. In this review, we aim to review the methods of synthesis of these hybrids, the antimicrobial activities of the compounds, their correlation with various groups present on the molecule, as well as their pharmaceutical properties.

Also flagged:Hepatic Steatosisnonalcoholic fatty liver diseaseNAFLDCAPliver diseasevisceral obesity
Journal Article 2021-08-19 ✓ 1 Snippet Chung GE, Park HE, Kim MJ, Kwak MS, Yang JI, Chung SJ, Yim JY, Yoon JW.
In-Text Gene Mentions

…diseases such ashemochromatosis, autoimmune hepatitis, Wilson…

Show Full Abstract

<h4>Background</h4>An association between low muscle mass and nonalcoholic fatty liver disease (NAFLD) has been suggested. We investigated this relationship using controlled attenuation parameter (CAP).<h4>Methods</h4>A retrospective cohort of subjects had liver FibroScan<sup>®</sup> (Echosens, Paris, France) and bioelectrical impedance analyses during health screening exams. Low muscle mass was defined based on appendicular skeletal muscle mass/body weight ratios of one (class I) or two (class II) standard deviations below the sex-specific mean for healthy young adults.<h4>Results</h4>Among 960 subjects (58.1 years; 67.4% male), 344 (45.8%, class I) and 110 (11.5%, class II) had low muscle mass. After adjusting for traditional metabolic risk factors, hepatic steatosis, defined as a CAP ≥ 248 dB/m, was associated with low muscle mass (class I, odds ratio (OR): 1.96, 95% confidence interval (CI): 1.38-2.78; class II, OR: 3.33, 95% CI: 1.77-6.26). A dose-dependent association between the grade of steatosis and low muscle mass was also found (class I, OR: 1.88, for CAP ≥ 248, <302; OR: 2.19, in CAP ≥ 302; class II, OR: 2.33, for CAP ≥ 248, <302; OR: 6.17, in CAP ≥ 302). High liver stiffness was also significantly associated with an increased risk of low muscle mass (class I, OR: 1.97, 95% CI: 1.31-2.95; class II, OR: 2.96, 95% CI: 1.51-5.78).<h4>Conclusion</h4>Hepatic steatosis is independently associated with low muscle mass in a dose-dependent manner. The association between hepatic steatosis and low muscle mass suggests that particular attention should be given to subjects with NAFLD for an adequate assessment of muscle mass.

Also flagged:Transferrin ReceptorcancerbindingtumordeoxynucleotidesTfR
Journal Article 2021-08-19 ✓ 1 Snippet Zhang N, Bing T, Shen L, Feng L, Liu X, Shangguan D.
In-Text Gene Mentions

…itary hemochromatosis factor (HFE) [ 4 ].…

Show Full Abstract

General cancer-targeted ligands that can deliver drugs to cells have been given considerable attention. In this paper, a high-affinity DNA aptamer (HG1) generally binding to human tumor cells was evolved by cell-SELEX, and was further optimized to have 35 deoxynucleotides (HG1-9). Aptamer HG1-9 could be taken up by live cells, and its target protein on a cell was identified to be human transferrin receptor (TfR). As a man-made ligand of TfR, aptamer HG1-9 was demonstrated to bind at the same site of human TfR as transferrin with comparable binding affinity, and was proved to cross the epithelium barrier through transferrin receptor-mediated transcytosis. These results suggest that aptamer HG1-9 holds potential as a promising ligand to develop general cancer-targeted diagnostics and therapeutics.

Also flagged:skeletal muscle diseasedystrophinopathiescardiomyopathydeathdystrophin-associated cardiomyopathy
Journal Article 2021-08-19 No Snippets Gowran A, Brioschi M, Rovina D, Chiesa M, Piacentini L, Mallia S, Banfi C, Pompilio G, Santoro R.
Show Full Abstract

Despite major progress in treating skeletal muscle disease associated with dystrophinopathies, cardiomyopathy is emerging as a major cause of death in people carrying dystrophin gene mutations that remain without a targeted cure even with new treatment directions and advances in modelling abilities. The reasons for the stunted progress in ameliorating dystrophin-associated cardiomyopathy (DAC) can be explained by the difficulties in detecting pathophysiological mechanisms which can also be efficiently targeted within the heart in the widest patient population. New perspectives are clearly required to effectively address the unanswered questions concerning the identification of authentic and effectual readouts of DAC occurrence and severity. A potential way forward to achieve further therapy breakthroughs lies in combining multiomic analysis with advanced preclinical precision models. This review presents the fundamental discoveries made using relevant models of DAC and how omics approaches have been incorporated to date.

Also flagged:Enolaseextracellularinfectionantibodyimmune responseGlycoprotein
Journal Article 2021-08-19 No Snippets Magez S, Li Z, Nguyen HTT, Pinto Torres JE, Van Wielendaele P, Radwanska M, Began J, Zoll S, Sterckx YG.
Show Full Abstract

Salivarian trypanosomes comprise a group of extracellular anthroponotic and zoonotic parasites. The only sustainable method for global control of these infection is through vaccination of livestock animals. Despite multiple reports describing promising laboratory results, no single field-applicable solution has been successful so far. Conventionally, vaccine research focusses mostly on exposed immunogenic antigens, or the structural molecular knowledge of surface exposed invariant immunogens. Unfortunately, extracellular parasites (or parasites with extracellular life stages) have devised efficient defense systems against host antibody attacks, so they can deal with the mammalian humoral immune response. In the case of trypanosomes, it appears that these mechanisms have been perfected, leading to vaccine failure in natural hosts. Here, we provide two examples of potential vaccine candidates that, despite being immunogenic and accessible to the immune system, failed to induce a functionally protective memory response. First, trypanosomal enolase was tested as a vaccine candidate, as it was recently characterized as a highly conserved enzyme that is readily recognized during infection by the host antibody response. Secondly, we re-addressed a vaccine approach towards the Invariant Surface Glycoprotein ISG75, and showed that despite being highly immunogenic, trypanosomes can avoid anti-ISG75 mediated parasitemia control.

Also flagged:sleepaskyousleepsnapCritically
Journal Article 2021-08-19 No Snippets Perry MA, Dawkins-Henry OS, Awojoodu RE, Blumenthal J, Asaro LA, Wypij D, Kudchadkar SR, Zuppa AF, Curley MAQ.
Show Full Abstract

Often, pediatric intensive care environments are not conducive to healing the sick. Critically ill children experience disruptions in their circadian rhythms, which can contribute to delayed recovery and poor outcomes. We aim to test the hypothesis that children managed via <i>RESTORE Resilience (</i>R<sup>2</sup>), a nurse-implemented chronotherapeutic bundle, will experience restorative circadian rhythms compared to children receiving usual care. In this two-phased, prospective cohort study, two separate pediatric intensive care units in the United Sates will enroll a total of 20 baseline subjects followed by 40 intervention subjects, 6 months to less than 18 years of age, requiring invasive mechanical ventilation. During the intervention phase, we will implement the R<sup>2</sup> bundle, which includes: (1) a focused effort to replicate the child's pre-hospitalization daily routine, (2) cycled day-night lighting and sound modulation, (3) minimal yet effective sedation (<i>RESTORE</i>), (4) nighttime fasting with bolus enteral daytime feedings, (5) early progressive mobility (<i>PICU Up</i>!), (6) continuity in nursing care, and (7) parent diaries. Our primary outcome is circadian activity ratio post-extubation. We hypothesize that children receiving R<sup>2</sup> will experience restored circadian rhythms as evidenced by decreased nighttime activity while in the PICU. Our exploratory outcomes include salivary melatonin levels; electroencephalogram (EEG) slow-wave activity; R<sup>2</sup> feasibility, adherence, and system barriers; levels of patient comfort; exposure to sedative medications; time to physiological stability; and parent perception of being well cared for. This paper describes the design, rationale, and implementation of R<sup>2</sup>.<h4>Clinicaltrialsgov identifier</h4>NCT04695392.

Also flagged:Phytic acidphosphorusPhytaseinositolacid phytasecalcium
Journal Article 2021-08-19 No Snippets Zhao T, Yong X, Zhao Z, Dolce V, Li Y, Curcio R.
Show Full Abstract

Phytic acid is abundant in seeds, roots and stems of plants, it acts as an anti-nutrient in food and feed industry, since it affects the absorption of nutrients by humans and monogastric animals. Furthermore, phosphorus produced through its decomposition by microorganisms can cause environmental pollution. Phytase degrades phytic acid generating precursors of inositol that can be used in clinical practice; in addition, phytase treatment can minimize the anti-nutritional effect of phytic acid. The use of phytase synthesized from Bacillus is more advantageous due to its high activity. Additionally, its good heat resistance under neutral conditions greatly fills the gap of commercial utilization of acid phytase. In this review, we summarize the latest research results on <i>Bacillus</i> phytase, including its physiological and biochemical characteristics, molecular structure information, calcium effects on its catalytic activity and stability, its catalytic mechanism and molecular modification.

Also flagged:methylationguanineMPPED2brain developmentribonucleotidebinding
Journal Article 2021-08-19 ✓ 3 Snippets Ramirez K, Fernández R, Collet S, Kiyar M, Delgado-Zayas E, Gómez-Gil E, Van Den Eynde T, T'Sjoen G, Guillamon A, Mueller SC, Pásaro E.
In-Text Gene Mentions

…ARL6IP1, GRASP, NCOA6,ABT1, and C17orf79…

…NCOA6 , andABT1).…

…by the geneABT1is likely to…

Show Full Abstract

<h4>Introduction</h4>The main objective was to carry out a global DNA methylation analysis in a population with gender incongruence before gender-affirming hormone treatment (GAHT), in comparison to a cisgender population.<h4>Methods</h4>A global CpG (cytosine-phosphate-guanine) methylation analysis was performed on blood from 16 transgender people before GAHT vs. 16 cisgender people using the Illumina© Infinium Human Methylation 850k BeadChip, after bisulfite conversion. Changes in the DNA methylome in cisgender vs. transgender populations were analyzed with the Partek<sup>®</sup> Genomics Suite program by a 2-way ANOVA test comparing populations by group and their sex assigned at birth.<h4>Results</h4>The principal components analysis (PCA) showed that both populations (cis and trans) differ in the degree of global CpG methylation prior to GAHT. The 2-way ANOVA test showed 71,515 CpGs that passed the criterion FDR <i>p</i> < 0.05. Subsequently, in male assigned at birth population we found 87 CpGs that passed both criteria (FDR <i>p</i> < 0.05; fold change ≥ ± 2) of which 22 were located in islands. The most significant CpGs were related to genes: <i>WDR45B, SLC6A20, NHLH1, PLEKHA5, UBALD1, SLC37A1, ARL6IP1, GRASP</i>, and <i>NCOA6</i>. Regarding the female assigned at birth populations, we found 2 CpGs that passed both criteria (FDR <i>p</i> < 0.05; fold change ≥ ± 2), but none were located in islands. One of these CpGs, related to the MPPED2 gene, is shared by both, trans men and trans women. The enrichment analysis showed that these genes are involved in functions such as negative regulation of gene expression (GO:0010629), central nervous system development (GO:0007417), brain development (GO:0007420), ribonucleotide binding (GO:0032553), and RNA binding (GO:0003723), among others.<h4>Strengths and limitations</h4>It is the first time that a global CpG methylation analysis has been carried out in a population with gender incongruence before GAHT. A prospective study before/during GAHT would provide a better understanding of the influence of epigenetics in this process.<h4>Conclusion</h4>The main finding of this study is that the cis and trans populations have different global CpG methylation profiles prior to GAHT. Therefore, our results suggest that epigenetics may be involved in the etiology of gender incongruence.

Journal Article 2021-08-19 ✓ 1 Snippet Silva R, Clemente FM, González-Fernández FT, Bernardo A, Ardigò LP.
In-Text Gene Mentions

…HML, Sprint, ACC,DCC, CR-10, and sRPE)…

Show Full Abstract

<b>Purpose:</b> The aim of this study was 2-fold: (1) to analyze variations of short-duration maximal jumping performance in players exposed to a match and those who were not and (2) to analyze the relationships between changes in the short-duration maximal jumping performance and different accumulated training load and match demands measures. <b>Methods:</b> Twenty-four professional soccer players (age: 20.3 ± 1.7 years) were monitored daily for their training load and match demands over 6 weeks. In addition, they performed a weekly short-duration maximal jumping performance test (72 h after the last match). <b>Results:</b> Negative moderate correlations were found between percentage of change of countermovement jump (CMJ) height and Acummulated training load (ATL) of total distance (TD), high metabolic load (HML), accelerations (ACC), and decelerations (DEC) (<i>r</i> = -0.38, <i>p</i> = 0.004; <i>r</i> = -0.33, <i>p</i> = 0.013; <i>r</i> = -0.39, <i>p</i> = 0.003; and <i>r</i> = -0.30, <i>p</i> = 0.026). No correlations were found for match load (ML). TD, HML, ACC, and DCC (<i>r</i> = 0.27, <i>r</i> = 0.25, <i>r</i> = 0.31, and <i>r</i> = 0.22, respectively) were used to predict the percentage of change of CMJ height. <b>Conclusion:</b> Match participation has negative effects on CMJ performance. The ATL of HML, ACC, DCC, and TD have a significant influence on both CMJ measures changes. Also, the ATL values of those metrics are the best predictors of the percentage changes of CMJ performance.

Also flagged:Pulmonary arterial hypertensionright heart failureCD4CD25FOXP3pulmonary hypertension
Journal Article 2021-08-19 No Snippets Tian W, Jiang SY, Jiang X, Tamosiuniene R, Kim D, Guan T, Arsalane S, Pasupneti S, Voelkel NF, Tang Q, Nicolls MR.
Show Full Abstract

Pulmonary arterial hypertension (PAH) is a chronic, incurable condition characterized by pulmonary vascular remodeling, perivascular inflammation, and right heart failure. Regulatory T cells (Tregs) stave off autoimmunity, and there is increasing evidence for their compromised activity in the inflammatory milieu of PAH. Abnormal Treg function is strongly correlated with a predisposition to PAH in animals and patients. Athymic Treg-depleted rats treated with SU5416, an agent causing pulmonary vascular injury, develop PAH, which is prevented by infusing missing CD4<sup>+</sup>CD25<sup>high</sup>FOXP3<sup>+</sup> Tregs. Abnormal Treg activity may also explain why PAH disproportionately affects women more than men. This mini review focuses on the role of Tregs in PAH with a special view to sexual dimorphism and the future promise of Treg therapy.

Also flagged:PCaTP53BIRC5prostate cancerimmunecell proliferation
Journal Article 2021-08-19 ✓ 2 Snippets Fu M, Wang Q, Wang H, Dai Y, Wang J, Kang W, Cui Z, Jin X.
In-Text Gene Mentions

…ZFP36, AZGP1, andOLFM4were significant downregulated…

…ZFP36, AZGP1, andOLFM4showed low expression…

Show Full Abstract

<h4>Background</h4>Prostate cancer (PCa) is an immune-responsive disease. The current study sought to explore a robust immune-related prognostic gene signature for PCa.<h4>Methods</h4>Data were retrieved from the tumor Genome Atlas (TCGA) database and GSE46602 database for performing the least absolute shrinkage and selection operator (LASSO) cox regression model analysis. Immune related genes (IRGs) data were retrieved from ImmPort database.<h4>Results</h4>The weighted gene co-expression network analysis (WGCNA) showed that nine functional modules are correlated with the biochemical recurrence of PCa, including 259 IRGs. Univariate regression analysis and survival analysis identified 35 IRGs correlated with the prognosis of PCa. LASSO Cox regression model analysis was used to construct a risk prognosis model comprising 18 IRGs. Multivariate regression analysis showed that risk score was an independent predictor of the prognosis of PCa. A nomogram comprising a combination of this model and other clinical features showed good prediction accuracy in predicting the prognosis of PCa. Further analysis showed that different risk groups harbored different gene mutations, differential transcriptome expression and different immune infiltration levels. Patients in the high-risk group exhibited more gene mutations compared with those in the low-risk group. Patients in the high-risk groups showed high-frequency mutations in TP53. Immune infiltration analysis showed that M2 macrophages were significantly enriched in the high-risk group implying that it affected prognosis of PCa patients. In addition, immunostimulatory genes were differentially expressed in the high-risk group compared with the low-risk group. BIRC5, as an immune-related gene in the prediction model, was up-regulated in 87.5% of prostate cancer tissues. Knockdown of BIRC5 can inhibit cell proliferation and migration.<h4>Conclusion</h4>In summary, a risk prognosis model based on IGRs was developed. A nomogram comprising a combination of this model and other clinical features showed good accuracy in predicting the prognosis of PCa. This model provides a basis for personalized treatment of PCa and can help clinicians in making effective treatment decisions.

Also flagged:CancerAcPporpancreatic cancer90thtubular adenocarcinoma
Journal Article 2021-08-19 ✓ 1 Snippet Takahashi R, Ishizawa T, Sato M, Inagaki Y, Takanka M, Kuriki Y, Kamiya M, Ushiku T, Urano Y, Hasegawa K.
In-Text Gene Mentions

…units; D4943, Sigma-Aldrich),DPP-VIII(1.0 µg; ab162872,…

Show Full Abstract

<h4>Introduction</h4>Radical resection is the only curative treatment for pancreatic cancer, which is a life-threatening disease. However, it is often not easy to accurately identify the extent of the tumor before and during surgery. Here we describe the development of a novel method to detect pancreatic tumors using a tumor-specific enzyme-activatable fluorescence probe.<h4>Methods</h4>Tumor and non-tumor lysate or small specimen collected from the resected specimen were selected to serve as the most appropriate fluorescence probe to distinguish cancer tissues from noncancerous tissues. The selected probe was sprayed onto the cut surface of the resected specimen of cancer tissue to acquire a fluorescence image. Next, we evaluated the ability of the probe to detect the tumor and calculated the tumor-to-background ratio (TBR) by comparing the fluorescence image with the pathological extent of the tumor. Finally, we searched for a tumor-specific enzyme that optimally activates the selected probe.<h4>Results</h4>Using a library comprising 309 unique fluorescence probes, we selected GP-HMRG as the most appropriate activatable fluorescence probe. We obtained eight fluorescence images of resected specimens, among which four approximated the pathological findings of the tumor, which achieved the highest TBR. Finally, dipeptidyl-peptidase IV (DPP-IV) or a DPP-IV-like enzyme was identified as the target enzyme.<h4>Conclusion</h4>This novel method may enable rapid and real-time visualization of pancreatic cancer through the enzymatic activities of cancer tissues.

Also flagged:Myotonic dystrophy type 1neuromuscular diseasemyogenesisextracellularPOSTNantibody
Journal Article 2021-08-19 ✓ 5 Snippets Shen X, Liu Z, Wang C, Xu F, Zhang J, Li M, Lei Y, Wang A, Bi C, Zhu G.
In-Text Gene Mentions

Table 1 showed the top 20 level-changed genes in the DM1 group. To our best knowledge, none of these genes were reported to function in DM1 before. Four genes (Lgr5, Gdf5, Myh8, and Unc13c) were known to regulate skeletal muscle myogenesis and homeostasis: Lgr5 is a marker for a group of activated satellite cells for muscle regeneration (Leung et al., 2020); Gdf5 was found to promote myogenesis process in sciatic denervation mouse model (Traore et al., 2019); Myh8, encoding embryonic and neonatal type MHCs, are transient elevated following muscle injury (Schiaffino et al., 2015; Yoshimoto et al., 2020); Unc13c facilitates myogenesis process, whose expression is repressed by TNF-α (Meyer et al., 2015). Particularly, there were four genes (Gm45062, Gm49948, Gm47308, and Gm 43488) upregulated in DM1, whose official gene symbols, however, had not been assigned yet. These top-altered genes deserved further investigations in the future, as their functions were mostly unclear in skeletal muscle and DM1. GO analysis showed that skeletal muscle-related processes and structures were repressed in DM1. These results confirmed the myogenesis defects in DM1 myoblast cells. Moreover, we found that Postn was the most significantly altered gene in the DM1 group, with log2(fold change) = 2.86 and adjusted P-value = 1.79E−178. The upregulation of DM1 was confirmed by western blots and RT-qPCR. Through analyzing the datasets from the GEO database, we also discovered that the expression of Postn was enhanced in skeletal muscle and myoblasts of DM1 patients. MBNL1 is sequestered by the toxic RNA in DM1, which results in the downregulation of active MBNL1 in cells. We here found that inhibiting Mbnl1 using shRNA significantly upregulated the intracellular and secreted POSTN, which suggested a correlation between Mbnl1 and Postn. This finding was consistent with the RNA-seq data from a recent study that showed upregulations of Postn in DM1 mice models (HSALR20b and Mbnl3/4KO mice) (Tanner et al., 2021). These results imply a potential regulatory role of Postn in DM1 pathogenesis. Previous studies have indicated that Postn could serve as serum biomarkers for many diseases, including cancer (Dong et al., 2018a,b), rhinosinusitis (Ninomiya et al., 2018), and asthma (Hachim et al., 2020). Based on the upregulations of Postn in the DM1 myoblast cell model and the skeletal muscle and myoblasts from DM1 patients, we thought Postn might be used as a biomarker for DM1, which, however, needed further verifications of the expressions of Postn in the serum of DM1 patients.

Table 1 shows the top 20 level-changed genes in the DM1 group. Pdha2, Pcdhga9, Lgr5, Rarb, Trhde, Postn, Sema5b, Tspan8, and Sectm1a were significantly upregulated, while miR-686, Pagr1a, Gdf5, Myh8, Slc25a23, Unc13c, and Fras1 were significantly downregulated. Postn was the most significantly altered gene, with log2(fold change) = 2.86 and adjusted P-value = 1.79E−178. We then performed GO and KEGG analyses on all DEGs. The GO results showed that all striated muscle-related biological processes (BP), cellular components (CC), and molecular functions (MF) were inhibited (Figure 2D). The KEGG results showed that striated muscle-related pathways (Jak-STAT signaling, insulin signaling, and insulin resistance) were significantly repressed. Surprisingly, some components of the Wnt signaling pathway were upregulated but some other components were downregulated (Figure 2E). In summary, Postn was the most significantly upregulated gene in the DM1 group, implying that Postn might be associated with DM1 pathogenesis.

…, Slc25a23 ,Unc13c, and Fras1…

…Myh8 , andUnc13c) were known…

…al., 2020 );Unc13cfacilitates myogenesis process…

Show Full Abstract

Myotonic dystrophy type 1 (DM1) is an inherited neuromuscular disease caused by expanded CTG repeats in the 3' untranslated region (3'UTR) of the <i>DMPK</i> gene. The myogenesis process is defective in DM1, which is closely associated with progressive muscle weakness and wasting. Despite many proposed explanations for the myogenesis defects in DM1, the underlying mechanism and the involvement of the extracellular microenvironment remained unknown. Here, we constructed a DM1 myoblast cell model and reproduced the myogenesis defects. By RNA sequencing (RNA-seq), we discovered that periostin (<i>Postn</i>) was the most significantly upregulated gene in DM1 myogenesis compared with normal controls. This difference in <i>Postn</i> was confirmed by real-time quantitative PCR (RT-qPCR) and western blotting. Moreover, <i>Postn</i> was found to be significantly upregulated in skeletal muscle and myoblasts of DM1 patients. Next, we knocked down <i>Postn</i> using a short hairpin RNA (shRNA) in DM1 myoblast cells and found that the myogenesis defects in the DM1 group were successfully rescued, as evidenced by increases in the myotube area, the fusion index, and the expression of myogenesis regulatory genes. Similarly, <i>Postn</i> knockdown in normal myoblast cells enhanced myogenesis. As POSTN is a secreted protein, we treated the DM1 myoblast cells with a POSTN-neutralizing antibody and found that DM1 myogenesis defects were successfully rescued by POSTN neutralization. We also tested the myogenic ability of myoblasts in the skeletal muscle injury mouse model and found that <i>Postn</i> knockdown improved the myogenic ability of DM1 myoblasts. The activity of the TGF-β/Smad3 pathway was upregulated during DM1 myogenesis but repressed when inhibiting <i>Postn</i> with a <i>Postn</i> shRNA or a POSTN-neutralizing antibody, which suggested that the TGF-β/Smad3 pathway might mediate the function of <i>Postn</i> in DM1 myogenesis. These results suggest that <i>Postn</i> is a potential therapeutical target for the treatment of myogenesis defects in DM1.

Also flagged:clear cell renal cell carcinomaccRCCrenal carcinomaoncogenestumorKidney cancer
Journal Article 2021-08-19 ✓ 2 Snippets Chao X, Wang P, Ma X, Li Z, Xia Y, Guo Y, Ge L, Tian L, Zheng H, Du Y, Li J, Zuo Z, Xie L, Guo X.
In-Text Gene Mentions

ccRCC, clear cell renal cell carcinoma; lncRNA, long non-coding RNA; ceRNA, competing endogenous RNA; ncRNA, non-coding RNA; HOTAIR, HOX transcript antisense gene RNA; lincRNA, long intergenic non-coding RNA; SNP, single-nucleotide polymorphism; miRNA, microRNA; ZFAS1, ZNFX1 antisense RNA 1; MIAT, Myocardial infarction associated transcript; ADAMTS9-AS2, ADAMTS9 antisense RNA 2; LUCAT1, Lung cancer associated transcript 1; MALAT1, Metastasis associated lung adenocarcinoma transcript 1; HOXA11-AS, HOXA11 antisense RNA; PVT1, Plasmacytoma variant translocation 1; MEG3, Maternally expressed 3; CASC19, Cancer susceptibility 19; SNHG5, Small nucleolar RNA host gene 5; HCP5, HLA complex P5; PCAT1, Prostate cancer associated transcript 1; MSC-AS1, MSC antisense RNA 1; TTN-AS1, TTN antisense RNA 1; DARS-AS1, DARS1 antisense RNA 1; ZEB2, Zinc finger E-box binding homeobox 2; ACVR2B, activin A receptor type 2B; ST8SIA4, ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4; HIF-1α, hypoxia-inducible factor 1 subunit alpha; YAP, Yes1 associated transcriptional regulator; ZEB1, Zinc finger E-box binding homeobox 1; EMT, epithelial to mesenchymal transition; RASL11B, RAS like family 11 member B; BANCR, BRAF-activated non-protein coding RNA; GAS5, Growth arrest specific 5; TCL6, T cell leukemia/lymphoma 6; FOXO1, Forkhead box O1; SOX5, SRY-box transcription factor 5; OS, overall survival; DFS, disease-free survival.

…miRNA, microRNA; ZFAS1,ZNFX1antisense RNA 1;…

Show Full Abstract

Clear cell renal cell carcinoma (ccRCC) is the most common histological type of renal carcinoma and has a high recurrence rate and poor outcome. Accurate patient risk stratification based on genetic markers can help to identify the high-risk patient for early and further treatments and would promote patient survival. Long non-coding RNAs (lncRNAs) have attracted widespread attention as biomarkers for early diagnosis, treatment, and prognosis because of their high specificity and sensitivity. Here, we performed a systematic search in NCBI PubMed and found 44 lncRNAs as oncogenes, 18 lncRNAs as tumor suppressors, 199 lncRNAs as diagnostic biomarkers, 62 lncRNAs as prognostic biomarkers, and 3 lncRNAs as predictive biomarkers for ccRCC. We also comprehensively discuss the biological functions and molecular regulatory mechanisms of lncRNAs in ccRCC. Overall, the present study is a systemic analysis to assess the expression and clinical value of lncRNAs in ccRCC, and lncRNAs hold promise to be diagnostic, prognostic, and predictive biomarkers.

Also flagged:breast cancermalignant tumorcancerdeathestrogen receptorER
Journal Article 2021-08-19 No Snippets Jin H, Du W, Huang W, Yan J, Tang Q, Chen Y, Zou Z.
Show Full Abstract

Breast cancer is a malignant tumor that has a high mortality rate and mostly occurs in women. Although significant progress has been made in the implementation of personalized treatment strategies for molecular subtypes in breast cancer, the therapeutic response is often not satisfactory. Studies have reported that long non-coding RNAs (lncRNAs) are abnormally expressed in breast cancer and closely related to the occurrence and development of breast cancer. In addition, the high tissue and cell-type specificity makes lncRNAs particularly attractive as diagnostic biomarkers, prognostic factors, and specific therapeutic targets. Therefore, an in-depth understanding of the regulatory mechanisms of lncRNAs in breast cancer is essential for developing new treatment strategies. In this review, we systematically elucidate the general characteristics, potential mechanisms, and targeted therapy of lncRNAs and discuss the emerging functions of lncRNAs in breast cancer. Additionally, we also highlight the advantages and challenges of using lncRNAs as biomarkers for diagnosis or therapeutic targets for drug resistance in breast cancer and present future perspectives in clinical practice.

Also flagged:AC8AC7AC1AC4AC5AC2
Journal Article 2021-08-19 No Snippets Khan AA, Khattak MNK, Parambath D, El-Serafi AT.
Show Full Abstract

Our previous study revealed that the treatment of 5-aza-2-deoxycytidine (5-aza) inhibited while treatment of suberoylanilide hydroxamic acid (SAHA) enhanced the adipogenic differentiation of MG-63 cells. In this study, we examined the transcriptomic profiles of the derived adipocyte-like cells from MG-63 cells in the presence of 5-aza (Treatment 1) and SAHA (Treatment 2). Genome wide expression analysis showed high within sample variability for the adipocytes derived with 5-aza versus vehicle. Additionally, the expression profile of 5-aza derived cells was separated from the other sample groups. Differential analysis on the pairwise comparison of 5-aza versus control and SAHA versus 5-aza identified 1290 and 1086 differentially expressed (DE) genes, respectively. Furthermore, some overlap was observed between the up and down-regulated DE genes of 5-aza versus control and SAHA versus control (jaccard score 0.3) as well as between the differentially regulated genes of 5-aza versus control and 5-aza versus SAHA (jaccard score 0.29). A total of 73 transcription factors (TFs) were differentially expressed across all the pair wise comparisons with some overlap between the under and over expressed TFs of 5-aza versus control and 5-aza versus SAHA (jaccard score 0.29). Unsupervised clustering of TFs showed that the samples within the group are consistent in expression and the samples cluster in accordance with the group. Several GO terms related to enhanced adipogenesis such as neutral lipid biosynthetic process, lipid metabolic processes, cellular amide metabolic processes and cellular carbohydrate metabolic processes were enriched in the down regulated genes of 5-aza derived adipocytes versus control, indicating 5-aza inhibit the adipogenic differentiation of MG-63 cells. GSEA analysis on selected gene sets of MAPK and PI3K signaling pathway in MSigDB identified the pathways were up-regulated in 5-aza versus control. This study revealed that inhibition of MG-63 adipogenesis due to 5-aza treatment is associated with large transcriptomics changes and further research is needed to unravel the roles of these genes in the adipogenesis.

Also flagged:bindingSNAP1coronavirus disease 2019COVID-19spike glycoproteinspike protein
Journal Article 2021-08-18 ✓ 1 Snippet Kacherovsky N, Yang LF, Dang HV, Cheng EL, Cardle II, Walls AC, McCallum M, Sellers DL, DiMaio F, Salipante SJ, Corti D, Veesler D, Pun SH.
In-Text Gene Mentions

DCC

Show Full Abstract

The coronavirus disease 2019 (COVID-19) pandemic has devastated families and disrupted healthcare, economies and societies across the globe. Molecular recognition agents that are specific for distinct viral proteins are critical components for rapid diagnostics and targeted therapeutics. In this work, we demonstrate the selection of novel DNA aptamers that bind to the SARS-CoV-2 spike glycoprotein with high specificity and affinity (<80 nM). Through binding assays and high resolution cryo-EM, we demonstrate that SNAP1 (SARS-CoV-2 spike protein N-terminal domain-binding aptamer 1) binds to the S N-terminal domain. We applied SNAP1 in lateral flow assays (LFAs) and ELISAs to detect UV-inactivated SARS-CoV-2 at concentrations as low as 5×10<sup>5</sup>  copies mL<sup>-1</sup> . SNAP1 is therefore a promising molecular tool for SARS-CoV-2 diagnostics.

Also flagged:MSH3MSH2Jervell and Lange-Nielsen syndromeSDHDSDHCMITF
Journal Article 2021-08-18 ✓ 5 Snippets Haverfield EV, Esplin ED, Aguilar SJ, Hatchell KE, Ormond KE, Hanson-Kahn A, Atwal PS, Macklin-Mantia S, Hines S, Sak CW, Tucker S, Bleyl SB, Hulick PJ, Gordon OK, Velsher L, Gu JYJ, Weissman SM, Kruisselbrink T, Abel C, Kettles M, Slavotinek A, Mendelsohn BA, Green RC, Aradhya S, Nussbaum RL.
In-Text Gene Mentions

SERPINC1

HFE

Six hundred eight (37.6%) of the 1619 individuals with positive results had variants in genes associated with cardiovascular disorders, with most reportable variants in F5, F2, LDLR, MYBPC3, MYH7, APOB, SERPINC1, and PKP2 (Additional file 2: Table S2).

…Examples include homozygousHFEp.Cys282Tyr or p.His63Asp…

…or biallelic forHFEand SERPINA1 pathogenic…

Show Full Abstract

<h4>Background</h4>The use of proactive genetic screening for disease prevention and early detection is not yet widespread. Professional practice guidelines from the American College of Medical Genetics and Genomics (ACMG) have encouraged reporting pathogenic variants that confer personal risk for actionable monogenic hereditary disorders, but only as secondary findings from exome or genome sequencing. The Centers for Disease Control and Prevention (CDC) recognizes the potential public health impact of three Tier 1 actionable disorders. Here, we report results of a large multi-center cohort study to determine the yield and potential value of screening healthy individuals for variants associated with a broad range of actionable monogenic disorders, outside the context of secondary findings.<h4>Methods</h4>Eligible adults were offered a proactive genetic screening test by health care providers in a variety of clinical settings. The screening panel based on next-generation sequencing contained up to 147 genes associated with monogenic disorders within cancer, cardiovascular, and other important clinical areas. Sequence and intragenic copy number variants classified as pathogenic, likely pathogenic, pathogenic (low penetrance), or increased risk allele were considered clinically significant and reported. Results were analyzed by clinical area and severity/burden of disease using chi-square tests without Yates' correction.<h4>Results</h4>Among 10,478 unrelated adults screened, 1619 (15.5%) had results indicating personal risk for an actionable monogenic disorder. In contrast, only 3.1 to 5.2% had clinically reportable variants in genes suggested by the ACMG version 2 secondary findings list to be examined during exome or genome sequencing, and 2% had reportable variants related to CDC Tier 1 conditions. Among patients, 649 (6.2%) were positive for a genotype associated with a disease of high severity/burden, including hereditary cancer syndromes, cardiovascular disorders, or malignant hyperthermia susceptibility.<h4>Conclusions</h4>This is one of the first real-world examples of specialists and primary care providers using genetic screening with a multi-gene panel to identify health risks in their patients. Nearly one in six individuals screened for variants associated with actionable monogenic disorders had clinically significant results. These findings provide a foundation for further studies to assess the role of genetic screening as part of regular medical care.

Also flagged:chromosomekeyyouziphowLinker histone H1.8
Journal Article 2021-08-18 ✓ 4 Snippets Choppakatla P, Dekker B, Cutts EE, Vannini A, Dekker J, Funabiki H.
In-Text Gene Mentions

Condensin-dependent loop extrusion in…

…conserved in eukaryotes,linker histoneshistones are much…

Condensinsand topo II…

Condensinbinding is similarly…

Show Full Abstract

DNA loop extrusion by condensins and decatenation by DNA topoisomerase II (topo II) are thought to drive mitotic chromosome compaction and individualization. Here, we reveal that the linker histone H1.8 antagonizes condensins and topo II to shape mitotic chromosome organization. In vitro chromatin reconstitution experiments demonstrate that H1.8 inhibits binding of condensins and topo II to nucleosome arrays. Accordingly, H1.8 depletion in <i>Xenopus</i> egg extracts increased condensins and topo II levels on mitotic chromatin. Chromosome morphology and Hi-C analyses suggest that H1.8 depletion makes chromosomes thinner and longer through shortening the average loop size and reducing the DNA amount in each layer of mitotic loops. Furthermore, excess loading of condensins and topo II to chromosomes by H1.8 depletion causes hyper-chromosome individualization and dispersion. We propose that condensins and topo II are essential for chromosome individualization, but their functions are tuned by the linker histone to keep chromosomes together until anaphase.

Also flagged:zinctricalcium phosphatehydroxyapatitebone deficienciesosteoporosisinfection
Journal Article 2021-08-18 No Snippets Fadeeva IV, Goldberg MA, Preobrazhensky II, Mamin GV, Davidova GA, Agafonova NV, Fosca M, Russo F, Barinov SM, Cavalu S, Rau JV.
Show Full Abstract

For bone replacement materials, osteoconductive, osteoinductive, and osteogenic properties are desired. The bacterial resistance and the need for new antibacterial strategies stand among the most challenging tasks of the modern medicine. In this work, brushite cements based on powders of Zinc (Zn) (1.4 wt%) substituted tricalcium phosphate (β-TCP) and non-substituted β-TCP were prepared and investigated. Their initial and final phase composition, time of setting, morphology, pH evolution, and compressive strength are reported. After soaking for 60 days in physiological solution, the cements transformed into a mixture of brushite and hydroxyapatite. Antibacterial activity of the cements against Enterococcus faecium, Escherichia coli, and Pseudomonas aeruginosa bacteria strains was attested. The absence of cytotoxicity of cements was proved for murine fibroblast NCTC L929 cells. Moreover, the cell viability on the β-TCP cement containing Zn<sup>2+</sup> ions was 10% higher compared to the β-TCP cement without zinc. The developed cements are perspective for applications in orthopedics and traumatology.

Also flagged:Glyceraldehyde-3-Phosphate DehydrogenaseDegradationHuntingtinneurodegenerative disordersAutophagyglycolytic enzyme
Journal Article 2021-08-18 ✓ 1 Snippet Chaudhary S, Dhiman A, Dilawari R, Chaubey GK, Talukdar S, Modanwal R, Patidar A, Malhotra H, Raje CI, Raje M.
In-Text Gene Mentions

…route as mutantHttbinds with high…

Show Full Abstract

Protein aggregate accumulation is a pathological hallmark of several neurodegenerative disorders. Autophagy is critical for clearance of aggregate-prone proteins. In this study, we identify a novel role of the multifunctional glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in clearance of intracellular protein aggregates. Previously, it has been reported that though clearance of wild-type huntingtin protein is mediated by chaperone-mediated autophagy (CMA), however, degradation of mutant huntingtin (mHtt with numerous poly Q repeats) remains impaired by this route as mutant Htt binds with high affinity to Hsc70 and LAMP-2A. This delays delivery of misfolded protein to lysosomes and results in accumulation of intracellular aggregates which are degraded only by macroautophagy. Earlier investigations also suggest that mHtt causes inactivation of mTOR signaling, causing upregulation of autophagy. GAPDH had earlier been reported to interact with mHtt resulting in cellular toxicity. Utilizing a cell culture model of mHtt aggregates coupled with modulation of GAPDH expression, we analyzed the formation of intracellular aggregates and correlated this with autophagy induction. We observed that GAPDH knockdown cells transfected with N-terminal mutant huntingtin (103 poly Q residues) aggregate-prone protein exhibit diminished autophagy. GAPDH was found to regulate autophagy via the mTOR pathway. Significantly more and larger-sized huntingtin protein aggregates were observed in GAPDH knockdown cells compared to empty vector-transfected control cells. This correlated with the observed decrease in autophagy. Overexpression of GAPDH had a protective effect on cells resulting in a decreased load of aggregates. Our results demonstrate that GAPDH assists in the clearance of protein aggregates by autophagy induction. These findings provide a new insight in understanding the mechanism of mutant huntingtin aggregate clearance. By studying the molecular mechanism of protein aggregate clearance via GAPDH, we hope to provide a new approach in targeting and understanding several neurodegenerative disorders.

Also flagged:CPAPICPPDIadrenalinemetDMC
Journal Article 2021-08-18 ✓ 1 Snippet Rozemeijer S, de Grooth HJ, Elbers PWG, Girbes ARJ, den Uil CA, Dubois EA, Wils EJ, Rettig TCD, van Zanten ARH, Vink R, van den Bogaard B, Bosman RJ, Oudemans-van Straaten HM, de Man AME.
In-Text Gene Mentions

…patients with knownhemochromatosiswill be excluded…

Show Full Abstract

<h4>Background</h4>High-dose intravenous vitamin C directly scavenges and decreases the production of harmful reactive oxygen species (ROS) generated during ischemia/reperfusion after a cardiac arrest. The aim of this study is to investigate whether short-term treatment with a supplementary or very high-dose intravenous vitamin C reduces organ failure in post-cardiac arrest patients.<h4>Methods</h4>This is a double-blind, multi-center, randomized placebo-controlled trial conducted in 7 intensive care units (ICUs) in The Netherlands. A total of 270 patients with cardiac arrest and return of spontaneous circulation will be randomly assigned to three groups of 90 patients (1:1:1 ratio, stratified by site and age). Patients will intravenously receive a placebo, a supplementation dose of 3 g of vitamin C or a pharmacological dose of 10 g of vitamin C per day for 96 h. The primary endpoint is organ failure at 96 h as measured by the Resuscitation-Sequential Organ Failure Assessment (R-SOFA) score at 96 h minus the baseline score (delta R-SOFA). Secondary endpoints are a neurological outcome, mortality, length of ICU and hospital stay, myocardial injury, vasopressor support, lung injury score, ventilator-free days, renal function, ICU-acquired weakness, delirium, oxidative stress parameters, and plasma vitamin C concentrations.<h4>Discussion</h4>Vitamin C supplementation is safe and preclinical studies have shown beneficial effects of high-dose IV vitamin C in cardiac arrest models. This is the first RCT to assess the clinical effect of intravenous vitamin C on organ dysfunction in critically ill patients after cardiac arrest.<h4>Trial registration</h4>ClinicalTrials.gov NCT03509662. Registered on April 26, 2018. https://clinicaltrials.gov/ct2/show/NCT03509662 European Clinical Trials Database (EudraCT): 2017-004318-25. Registered on June 8, 2018. https://www.clinicaltrialsregister.eu/ctr-search/trial/2017-004318-25/NL.

Also flagged:RAB11EMSYnucleotide binding protein likeinhibitor of Bruton tyrosine kinaseprolyl aminopeptidase 1CCR4-NOT transcription complex subunit 6 like
Journal Article 2021-08-18 ✓ 2 Snippets Tang HM, Cheung PCK.
In-Text Gene Mentions

…homeostatic iron regulator (HFE) to display over…

…homeostatic iron regulator (HFE) was upregulated at…

Show Full Abstract

Gallic acid is a natural phenolic compound that displays anti-cancer properties in clinically relevant cell culture and rodent models. To date, the molecular mechanism governing the gallic acid-induced cancer cell death process is largely unclear, thus hindering development of novel therapeutics. Therefore, we performed time-course RNA-sequencing to reveal the gene expression profiles at the early (2nd hour), middle (4th and 6th hour), and late (9th hour) stages of the gallic acid-induced cell death process in HeLa cells. By Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, we found significant changes in transcription of the genes in different types of cell death pathways. This involved the ferroptotic cell death pathway at the early stage, apoptotic pathway at the middle stage, and necroptotic pathway at the late stage. Metabolic pathways were identified at all the stages, indicating that this is an active cell death process. Interestingly, the initiation and execution of gallic acid-induced cell death were mediated by multiple biological processes, including iron and amino acid metabolism, and the biosynthesis of glutathione, as targeting on these pathways suppressed cell death. In summary, our work provides a dataset with differentially expressed genes across different stages of cell death process during the gallic acid induction, which is important for further study on the control of this cell death mechanism.

Also flagged:nitrateDDKwaternitrogendenitrificationmethemoglobinemia
Journal Article 2021-08-18 No Snippets Cui Y, Wang J, Hao S.
Show Full Abstract

Nitrate (NO<sub>3</sub><sup>-</sup>) pollution is a serious global problem, and the quantitative analysis of its sources contributions is essential for devising effective water-related environmental-protection policies. The Shengjin Lake basin, located in the middle to lower reaches of the Yangtze River in China was selected as the research area in our study. We first grouped 29 surface water samples and 33 groundwater samples using cluster analysis, and then analyzed potential nitrate sources for each dataset of δ<sup>15</sup>N-NO<sub>3</sub><sup>-</sup> and δ<sup>18</sup>O-NO<sub>3</sub><sup>-</sup> isotope values by applying a Bayesian isotope-mixing model. Our results show that the nitrogen pollution in the surface-ground water in the study area seriously exceeded to class V of the Environmental Quality Standard of Surface Water of China. The NO<sub>3</sub><sup>-</sup> in surface water from the mid-upper reaches of the drainage basin mainly originates from soil nitrogen (SN) and chemical fertilizer (CF), with contribution rates of 48% and 32%, respectively, and the NO<sub>3</sub><sup>-</sup> in downstream areas mainly originates from CF and manure and sewage (MS), with contribution rates of 48% and 33%, respectively. For the groundwater samples, NO<sub>3</sub><sup>-</sup> mainly originates from MS, CF, and SN in the mid-upper reaches of the drainage basin and the northside of Dadukou near the Yangtze River, with contribution rates of 34%, 31%, and 29%, respectively, whereas NO<sub>3</sub><sup>-</sup> in the lower reaches and the middle part of Dadukou mainly originates from MS, with a contribution rate of 83%. The nitrogen conversion of surface water in lakes and in the mid-upper reaches is mainly affected by water mixing, while the groundwater and surface water in the lower plains are mainly affected by denitrification. The method proposed in this study can expand the ideas for tracking nitrate pollution in areas with complex terrain, and the relevant conclusions can provide a theoretical basis for surface and groundwater pollution control in the hilly basin of Yangtze River.

Also flagged:16 S RNA-encodingcDNAretinal diseaseretinal diseasesage-related macular degenerationdiabetic retinopathy
Journal Article 2021-08-18 ✓ 3 Snippets Dao D, Xie B, Nadeem U, Xiao J, Movahedan A, D'Souza M, Leone V, Hariprasad SM, Chang EB, Sulakhe D, Skondra D.
In-Text Gene Mentions

Proteomics analysis has identified multiple proteins in the serpin family including both Serpinc1 and Serpinf2 as potential serum biomarkers of retinal inflammation in diabetic retinopathy [63].

Serpinc1and Serpinf2 are…

…family including bothSerpinc1and Serpinf2 as…

Show Full Abstract

The relationship between retinal disease, diet, and the gut microbiome has shown increasing importance over recent years. In particular, high-fat diets (HFDs) are associated with development and progression of several retinal diseases, including age-related macular degeneration (AMD) and diabetic retinopathy. However, the complex, overlapping interactions between diet, gut microbiome, and retinal homeostasis are poorly understood. Using high-throughput RNA-sequencing (RNA-seq) of whole retinas, we compare the retinal transcriptome from germ-free (GF) mice on a regular diet (ND) and HFD to investigate transcriptomic changes without influence of gut microbiome. After correction of raw data, 53 differentially expressed genes (DEGs) were identified, of which 19 were upregulated and 34 were downregulated in GF-HFD mice. Key genes involved in retinal inflammation, angiogenesis, and RPE function were identified. Enrichment analysis revealed that the top 3 biological processes affected were regulation of blood vessel diameter, inflammatory response, and negative regulation of endopeptidase. Molecular functions altered include endopeptidase inhibitor activity, protease binding, and cysteine-type endopeptidase inhibitor activity. Human and mouse pathway analysis revealed that the complement and coagulation cascades are significantly affected by HFD. This study demonstrates novel data that diet can directly modulate the retinal transcriptome independently of the gut microbiome.

Also flagged:ubiquitinproteasometranslationalisopeptideneurodegenerative diseaseembryogenesis
Journal Article 2021-08-18 ✓ 5 Snippets Kane EI, Waters KL, Spratt DE.
In-Text Gene Mentions

…ranslated huntingtin protein (Htt).…

…trinucleotide repeats withinHttare typically 10–35…

…repeats that alterHttlocalization and accumulation…

…The function ofHttremains experimentally unclear…

…During embryogenesis,Httlevels are evenly…

Show Full Abstract

Neurodegeneration has been predominantly recognized as neuronal breakdown induced by the accumulation of aggregated and/or misfolded proteins and remains a preliminary factor in age-dependent disease. Recently, critical regulating molecular mechanisms and cellular pathways have been shown to induce neurodegeneration long before aggregate accumulation could occur. Although this opens the possibility of identifying biomarkers for early onset diagnosis, many of these pathways vary in their modes of dysfunction while presenting similar clinical phenotypes. With selectivity remaining difficult, it is promising that these neuroprotective pathways are regulated through the ubiquitin-proteasome system (UPS). This essential post-translational modification (PTM) involves the specific attachment of ubiquitin onto a substrate, specifically marking the ubiquitin-tagged protein for its intracellular fate based upon the site of attachment, the ubiquitin chain type built, and isopeptide linkages between different ubiquitin moieties. This review highlights both the direct and indirect impact ubiquitylation has in oxidative stress response and neuroprotection, and how irregularities in these intricate processes lead towards the onset of neurodegenerative disease (NDD).

Also flagged:Calciumcell growthorganellesautophagydeathTRP/Orai
Journal Article 2021-08-18 ✓ 5 Snippets Sukumaran P, Nascimento Da Conceicao V, Sun Y, Ahamad N, Saraiva LR, Selvaraj S, Singh BB.
In-Text Gene Mentions

There are many lines of evidence connecting the autophagy and calcium signaling and mutant htt clearance in HD.

The pharmacological inhibition of the mammalian target of rapamycin (mTOR) by rapamycin induces the mutant htt clearance and decreases the level of soluble proteins and aggregates and cell death in the in vitro HD model [159].

HD is a neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene, resulting in the formation and aggregation of an abnormally long polyglutamine, leading to motor dysfunction, behavioral disturbances and cognitive dysfunction [158].

Shibata et al. showed that the intracellular accumulation of mutant htt is highly sensitive to beclin 1 level, and the overexpression of beclin 1 significantly reduced the mutant htt accumulation in HD cell models [161].

Moreover, beclin 1 is recruited to cytoplasmic Htt-N-terminal product aggregates in HD mouse brain and the striatal samples of HD patients.

Show Full Abstract

Calcium (Ca<sup>2+</sup>) functions as a second messenger that is critical in regulating fundamental physiological functions such as cell growth/development, cell survival, neuronal development and/or the maintenance of cellular functions. The coordination among various proteins/pumps/Ca<sup>2+</sup> channels and Ca<sup>2+</sup> storage in various organelles is critical in maintaining cytosolic Ca<sup>2+</sup> levels that provide the spatial resolution needed for cellular homeostasis. An important regulatory aspect of Ca<sup>2+</sup> homeostasis is a store operated Ca<sup>2+</sup> entry (SOCE) mechanism that is activated by the depletion of Ca<sup>2+</sup> from internal ER stores and has gained much attention for influencing functions in both excitable and non-excitable cells. Ca<sup>2+</sup> has been shown to regulate opposing functions such as autophagy, that promote cell survival; on the other hand, Ca<sup>2+</sup> also regulates programmed cell death processes such as apoptosis. The functional significance of the TRP/Orai channels has been elaborately studied; however, information on how they can modulate opposing functions and modulate function in excitable and non-excitable cells is limited. Importantly, perturbations in SOCE have been implicated in a spectrum of pathological neurodegenerative conditions. The critical role of autophagy machinery in the pathogenesis of neurodegenerative diseases such as Alzheimer's, Parkinson's, and Huntington's diseases, would presumably unveil avenues for plausible therapeutic interventions for these diseases. We thus review the role of SOCE-regulated Ca<sup>2+</sup> signaling in modulating these diverse functions in stem cell, immune regulation and neuromodulation.

Also flagged:Type 2 Diabetestype 2 diabetes mellitusSHBGTFPRG4APOA4
Journal Article 2021-08-18 ✓ 2 Snippets Iqbal Z, Fachim HA, Gibson JM, Baricevic-Jones I, Campbell AE, Geary B, Donn RP, Hamarashid D, Syed A, Whetton AD, Soran H, Heald AH.
In-Text Gene Mentions

…biggest FE were:Antithrombin-III(SERPINC1), Plasma protease…

…FE were: Antithrombin-III (SERPINC1), Plasma protease C1…

Show Full Abstract

Bariatric surgery (BS) results in metabolic pathway recalibration. We have identified potential biomarkers in plasma of people achieving type 2 diabetes mellitus (T2DM) remission after BS. Longitudinal analysis was performed on plasma from 10 individuals following Roux-en-Y gastric bypass (<i>n</i> = 7) or sleeve gastrectomy (<i>n</i> = 3). Sequential window acquisition of all theoretical fragment ion spectra mass spectrometry (SWATH-MS) was done on samples taken at 4 months before (baseline) and 6 and 12 months after BS. Four hundred sixty-seven proteins were quantified by SWATH-MS. Principal component analysis resolved samples from distinct time points after selection of key discriminatory proteins: 25 proteins were differentially expressed between baseline and 6 months post-surgery; 39 proteins between baseline and 12 months. Eight proteins (SHBG, TF, PRG4, APOA4, LRG1, HSPA4, EPHX2 and PGLYRP) were significantly different to baseline at both 6 and 12 months post-surgery. The panel of proteins identified as consistently different included peptides related to insulin sensitivity (SHBG increase), systemic inflammation (TF and HSPA4-both decreased) and lipid metabolism (APOA4 decreased). We found significant changes in the proteome for eight proteins at 6- and 12-months post-BS, and several of these are key components in metabolic and inflammatory pathways. These may represent potential biomarkers of remission of T2DM.

Also flagged:cancermajor histocompatibility complexnitrogenbisphosphonatesreceptorbutyrophilin subfamily 3 member A1
Journal Article 2021-08-18 ✓ 5 Snippets Miyashita M, Shimizu T, Ashihara E, Ukimura O.
In-Text Gene Mentions

Anti-BTN2A monoclonal antibodies (mAbs) inhibit BTN2A1 biding to the γδ TCR and modulate γδ T cell killing of cancer cells [21].

Recent studies show that BTN2A1, which binds directly to the TCRs via germline-encoded regions of Vγ9, is also essential to BTN3A-mediated γδ T cell cytotoxicity and BTN2A1 expression at the plasma membrane of cancer cells correlated with γδ T cell cytotoxicity [20,21].

…studies show thatBTN2A1, which binds directly…

…cell cytotoxicity andBTN2A1expression at the…

BTN2A1interacts with BTN3A1,…

Show Full Abstract

Human γδ T cells show potent cytotoxicity against various types of cancer cells in a major histocompatibility complex unrestricted manner. Phosphoantigens and nitrogen-containing bisphosphonates (N-bis) stimulate γδ T cells via interaction between the γδ T cell receptor (TCR) and butyrophilin subfamily 3 member A1 (BTN3A1) expressed on target cells. γδ T cell immunotherapy is classified as either in vivo or ex vivo according to the method of activation. Immunotherapy with activated γδ T cells is well tolerated; however, the clinical benefits are unsatisfactory. Therefore, the antitumor effects need to be increased. Administration of γδ T cells into local cavities might improve antitumor effects by increasing the effector-to-target cell ratio. Some anticancer and molecularly targeted agents increase the cytotoxicity of γδ T cells via mechanisms involving natural killer group 2 member D (NKG2D)-mediated recognition of target cells. Both the tumor microenvironment and cancer stem cells exert immunosuppressive effects via mechanisms that include inhibitory immune checkpoint molecules. Therefore, co-immunotherapy with γδ T cells plus immune checkpoint inhibitors is a strategy that may improve cytotoxicity. The use of a bispecific antibody and chimeric antigen receptor might be effective to overcome current therapeutic limitations. Such strategies should be tested in a clinical research setting.

Also flagged:Transglutaminase 6HuntingtinHuntington Diseasetransglutaminasescalciumposttranslational modifications
Journal Article 2021-08-18 ✓ 5 Snippets Schulze-Krebs A, Canneva F, Stemick J, Plank AC, Harrer J, Bates GP, Aeschlimann D, Steffan JS, von Hörsten S.
In-Text Gene Mentions

Huntington disease (HD) is an autosomal dominant disorder caused by the expansion of a CAG repeat stretch located at the N-terminus of the protein huntingtin (HTT) [1].

…the protein huntingtin (HTT) [ 1 ].…

…peptide (Aβ) and (m)HTTare theoretically excellent…

…of the endogenousHTTrat promoter, were…

…truncated 1962 bpHttfragment with 51…

Show Full Abstract

Mammalian transglutaminases (TGs) catalyze calcium-dependent irreversible posttranslational modifications of proteins and their enzymatic activities contribute to the pathogenesis of several human neurodegenerative diseases. Although different transglutaminases are found in many different tissues, the TG6 isoform is mostly expressed in the CNS. The present study was embarked on/undertaken to investigate expression, distribution and activity of transglutaminases in Huntington disease transgenic rodent models, with a focus on analyzing the involvement of TG6 in the age- and genotype-specific pathological features relating to disease progression in HD transgenic mice and a tgHD transgenic rat model using biochemical, histological and functional assays. Our results demonstrate the physical interaction between TG6 and (mutant) huntingtin by co-immunoprecipitation analysis and the contribution of its enzymatic activity for the total aggregate load in SH-SY5Y cells. In addition, we identify that TG6 expression and activity are especially abundant in the olfactory tubercle and piriform cortex, the regions displaying the highest amount of mHTT aggregates in transgenic rodent models of HD. Furthermore, mHTT aggregates were colocalized within TG6-positive cells. These findings point towards a role of TG6 in disease pathogenesis via mHTT aggregate formation.

Also flagged:Cell cycleOsteoclast differentiationp53cytokine receptorLPSbiosynthesis
Journal Article 2021-08-18 No Snippets Qiburi Q, Temuqile T, Baigude H.
Show Full Abstract

The activated microglia contribute to stroke-induced neuroinflammation by upregulating the expression of a pleura of genes that are characterized as either proinflammatory or anti-inflammatory. The natural products alantolactone (Ala) and dehydrodiisoeugenol (Deh) found in <i>Inula helenium</i> L. and <i>Myristica fragrans</i> Houtt., respectively, are regularly used in traditional herb medicine, which play anti-inflammatory and antioxidant roles via regulation of canonical pathways such as nuclear factor kappa B (NF-<i>κ</i>B) in microglia and microphages. To illustrate the full spectra of gene expression alteration in microglia treated with Ala, Deh, and the mixture of Ala and Deh (denoted as Mix), we performed RNA-seq analysis of total RNA extracted from lipopolysaccharide- (LPS-) treated microglia subsequently exposed to Ala, Deh, and Mix. While both chemicals regulated the gene expression that facilitates an anti-inflammatory polarization, the mixture exerted some distinctive synergic regulatory effect, which differed from either of the chemicals alone. Our data provide important evidence for further research on the therapeutic mechanism of traditional medicine including Eerdun Wurile (EW).

Also flagged:BrightWatercopperExtracellularRNOnanoparticles
Journal Article 2021-08-18 ✓ 2 Snippets Ren Z, Liu Z, Ma S, Yue J, Yang J, Wang R, Gao Y, Guo Y.
In-Text Gene Mentions
⭐ same-sentence co-mention

…of UBE2V1 (includingSTAU1, STRINC3, ARFGEF2, TTPAL,…

⭐ same-sentence co-mention

…(including STAU1, STRINC3,ARFGEF2, TTPAL, and TOP1…

Show Full Abstract

The majority of cervical cancer (CC) patients are caused by the high-risk human papillomavirus (HPV) infection Although they are preventable and controllable, the mortality rate is still high. It is essential to identify the biomarkers for early screening and diagnosis of CC to improve the prognosis of patients with CC. The conjugating enzyme 2 (E2) family members are the key components of ubiquitin protease system. However, the role of E2 family in CC remains unclear. We aimed to investigate the role of <i>UBE2V1</i>, a ubiquitin binding E2 enzyme variant protein (ube2v) without conserved cysteine residues required for E2s catalytic activity in CC. In this study, we first studied the expression of <i>UBE2V1</i> in CC by real time quantitative PCR (RT-qPCR), and then, the clinical information of 191 CC patients in TCGA database was retrieved to explore the relationship between the expression of <i>UBE2V1</i> and the occurrence and development of CC by examining the translational profile and methylation, the high expression of <i>UBE2V1</i> was well correlated to the poor prognosis of patients, indicating that <i>UBE2V1</i> is an independent risk factor for the prognosis of CC patients. The expression of <i>UBE2V1</i> was also correlated with clinical stages, tumor grades and TNM stages of CC. In addition, the expression of <i>UBE2V1</i> was slightly negatively correlated with the methylation at the multiple methylation sites. our study revealed the relationship between <i>UBE2V1</i> and the occurrence and development of CC from the level of transcriptional profile and DNA methylation. <i>UBE2V1</i> is a novel candidate biomarker for the diagnosis, screening and prognosis of CC.

Also flagged:Flashetherdiethyl etherisopropanollactatephenol
Journal Article 2021-08-18 ✓ 1 Snippet Xavier T, Condon S, Pichon C, Le Gall E, Presset M.
In-Text Gene Mentions

DCC

Show Full Abstract

The use of mono-substituted malonic acid half oxyesters (SMAHOs) has been hampered by the sporadic references describing their preparation. An evaluation of different approaches has been achieved, allowing to define the best strategies to introduce diversity on both the malonic position and the ester function. A classical alkylation step of a malonate by an alkyl halide followed by a monosaponification gave access to reagents bearing different substituents at the malonic position, including functionalized derivatives. On the other hand, the development of a monoesterification step of a substituted malonic acid derivative proved to be the best entry for diversity at the ester function, rather than the use of an intermediate Meldrum acid. Both these transformations are characterized by their simplicity and efficiency, allowing a straightforward access to SMAHOs from cheap starting materials.

Also flagged:HDHuntington's diseaseorganizationautosomally-neurodegenerative disorderneurodegenerative disease
Journal Article 2021-08-18 ✓ 3 Snippets Sathe S, Ware J, Levey J, Neacy E, Blumenstein R, Noble S, Mühlbäck A, Rosser A, Landwehrmeyer GB, Sampaio C.
In-Text Gene Mentions

HD is a rare, adult-onset, autosomally-dominant neurodegenerative disorder caused by the dynamic expansion of a polymorphic CAG repeat in exon 1 of the huntingtin (HTT) gene that encodes the mutant huntingtin (HTT) protein (2), with an estimated prevalence of 5–17 individuals per 100,000 (3, 4).

…the huntingtin (HTT) gene that…

…the mutant huntingtin (HTT) protein ( 2…

Show Full Abstract

Established in July 2012, Enroll-HD is both an integrated clinical research platform and a worldwide observational study designed to meet the clinical research requirements necessary to develop therapeutics for Huntington's disease (HD). The platform offers participants a low-burden entry into HD research, providing a large, well-characterized, research-engaged cohort with associated clinical data and biosamples that facilitates recruitment into interventional trials and other research studies. Additional studies that use Enroll-HD data and/or biosamples are built into the platform to further research on biomarkers and outcome measures. Enroll-HD is now operating worldwide in 21 countries at 159 clinical sites across four continents-Europe, North America, Latin America, and Australasia-and has recruited almost 25,000 participants, generating a large, rich clinical database with associated biosamples to expedite HD research; any researcher at a verifiable research organization can access the clinical datasets and biosamples from Enroll-HD and nested studies. Important operational features of Enroll-HD include a strong emphasis on standardization, data quality, and protecting participant identity, a single worldwide study protocol, a flexible EDC system capable of integrating multiple studies, a comprehensive monitoring infrastructure, an online portal to train and certify site personnel, and standardized study documents including informed consent forms and contractual agreements.

Also flagged:influenzainfectionNK1.1BLMFACShyperthyrotropinemia
Journal Article 2021-08-18 No Snippets Chiesa AE, Tellechea ML.
Show Full Abstract

The purpose of this paper was to systematically summarize the published literature on neonatal isolated hyperthyrotropinemia (HTT), with a focus on prevalence, L-T4 management, re-evaluation of thyroid function during infancy or childhood, etiology including genetic variation, thyroid imaging tests, and developmental outcome. Electronic and manual searches were conducted for relevant publications, and a total of 46 articles were included in this systematic review. The overall prevalence of neonatal HTT was estimated at 0.06%. The occurrence of abnormal imaging tests was found to be higher in the persistent than in the transient condition. A continuous spectrum of thyroid impairment severity can occur because of genetic factors, environmental factors, or a combination of the two. Excessive or insufficient iodine levels were found in 46% and 16% of infants, respectively. Thirty-five different genetic variants have been found in three genes in 37 patients with neonatal HTT of different ethnic backgrounds extracted from studies with variable design. In general, genetic variants reported in the <i>TSHR</i> gene, the most auspicious candidate gene for HTT, may explain the phenotype of the patients. Many practitioners elect to treat infants with HTT to prevent any possible adverse developmental effects. Most patients with thyroid abnormalities and/or carrying monoallelic or biallelic genetic variants have received L-T4 treatment. For all those neonates on treatment with L-T4, it is essential to ensure follow-up until 2 or 3 years of age and to conduct medically supervised trial-off therapy when warranted. TSH levels were found to be elevated following cessation of therapy in 44% of children. Withdrawal of treatment was judged as unsuccessful, and medication was restarted, in 78% of cases. Finally, data extracted from nine studies showed that none of the 94 included patients proved to have a poor developmental outcome (0/94). Among subjects presenting with normal cognitive performance, 82% of cases have received L-T4 therapy. Until now, the precise neurodevelopmental risks posed by mild disease remain uncertain.

Also flagged:Inflammatory Bowel DiseasesInflammatory bowel diseasechronic disordersulcerative colitispathogenesisTP63
Journal Article 2021-08-18 ✓ 5 Snippets Maden SF, Acuner SE.
In-Text Gene Mentions

These CD-specific hub nodes and their disease relation can be listed as APP in Alzheimer’s disease (Neha et al., 2008), HTT in Huntington’s disease (HD) (Warby et al., 2011), and VHL as a tumor suppressor gene (Kim, 2004).

OLFM4 secreted by human intestinal epithelial cells is upregulated in the inflamed mucosa of IBD patients; however, its functional role in IBD has remained uncertain (Kuno et al., 2021).

OLFM4secreted by human…

HTTand VHL hub…

…al., 2008 ),HTTin Huntington’s disease…

Show Full Abstract

Inflammatory bowel disease (IBD) is the common name for chronic disorders associated with the inflammation of the gastrointestinal tract. IBD is triggered by environmental factors in genetically susceptible individuals and has a significant number of incidences worldwide. Crohn's disease (CD) and ulcerative colitis (UC) are the two distinct types of IBD. While involvement in ulcerative colitis is limited to the colon, Crohn's disease may involve the whole gastrointestinal tract. Although these two disorders differ in macroscopic inflammation patterns, they share various molecular pathogenesis, yet the diagnosis can remain unclear, and it is important to reveal their molecular signatures in the network level. Improved molecular understanding may reveal disease type-specific and even individual-specific targets. To this aim, we determine the subnetworks specific to UC and CD by mapping transcriptome data to protein-protein interaction (PPI) networks using two different approaches [KeyPathwayMiner (KPM) and stringApp] and perform the functional enrichment analysis of the resulting disease type-specific subnetworks. TP63 was identified as the hub gene in the UC-specific subnet and p63 tumor protein, being in the same family as p53 and p73, has been studied in literature for the risk associated with colorectal cancer and IBD. APP was identified as the hub gene in the CD-specific subnet, and it has an important role in the pathogenesis of Alzheimer's disease (AD). This relation suggests that some similar genetic factors may be effective in both AD and CD. Last, in order to understand the biological meaning of these disease-specific subnets, they were functionally enriched. It is important to note that chemokines-special types of cytokines-and antibacterial response are important in UC-specific subnets, whereas cytokines and antimicrobial responses as well as cancer-related pathways are important in CD-specific subnets. Overall, these findings reveal the differences between IBD subtypes at the molecular level and can facilitate diagnosis for UC and CD as well as provide potential molecular targets that are specific to disease subtypes.

Also flagged:cellular divisionsexual reproductionsynapsisinfertilityprophasechromosomes
Journal Article 2021-08-18 No Snippets Peng Y, Qiao H.
Show Full Abstract

Meiosis is a cellular division process that produces gametes for sexual reproduction. Disruption of complex events throughout meiosis, such as synapsis and homologous recombination, can lead to infertility and aneuploidy. To reveal the molecular mechanisms of these events, transcriptome studies of specific substages must be conducted. However, conventional methods, such as bulk RNA-seq and RT-qPCR, are not able to detect the transcriptional variations effectively and precisely, especially for identifying cell types and stages with subtle differences. In recent years, mammalian meiotic transcriptomes have been intensively studied at the single-cell level by using single-cell RNA-seq (scRNA-seq) approaches, especially through two widely used platforms, Smart-seq2 and Drop-seq. The scRNA-seq protocols along with their downstream analysis enable researchers to accurately identify cell heterogeneities and investigate meiotic transcriptomes at a higher resolution. In this review, we compared bulk RNA-seq and scRNA-seq to show the advantages of the scRNA-seq in meiosis studies; meanwhile, we also pointed out the challenges and limitations of the scRNA-seq. We listed recent findings from mammalian meiosis (male and female) studies where scRNA-seq applied. Next, we summarized the scRNA-seq analysis methods and the meiotic marker genes from spermatocytes and oocytes. Specifically, we emphasized the different features of the two scRNA-seq protocols (Smart-seq2 and Drop-seq) in the context of meiosis studies and discussed their strengths and weaknesses in terms of different research purposes. Finally, we discussed the future applications of scRNA-seq in the meiosis field.

Also flagged:Hepatocellular Carcinomacancertumorcardiac failurekarcinomachronic viral hepatitis
Journal Article 2021-08-18 ✓ 1 Snippet Gunasekaran AK, Malviya A, Ete T, Mishra A, Barman B, Jamil M, Lynser D.
In-Text Gene Mentions

…like Wilson’s disease,hemochromatosisor alpha1-antitrypsin deficien…

Show Full Abstract

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer and cancer related deaths worldwide. Metastasis of HCC into the cardiac cavity is mostly caused by direct tumor thrombus invasion through the major hepatic veins and of vena cava inferior with continuous extension into the right cardiac cavity. Right heart metastasis without invasion of inferior vena cava (IVC), which may be caused by haematogenous spread of cancer cells, is rarely reported. We report a case of HCC with IVC and right atrium (RA) thrombus in a patient who presented to us with decompensated cardiac failure. Strikingly, the patient was young and with negative serum HBsAg, and anti-HCV results. Our case highlights a rare presentation of metastatic intracardiac tumor thrombus involving the RA in advanced HCC without any symptoms of cardiac failure, and henceforth, the role of screening echocardiography for all patients with advanced HCC especially with vena caval involvement to rule out intracardiac thrombus.

Also flagged:cancerANPArtemisininsesquiterpene lactoneperoxidesmalaria
Journal Article 2021-08-18 No Snippets Bhukta S, Gopinath P, Dandela R.
Show Full Abstract

In recent years, there has been a strong demand worldwide for the identification and development of potential anticancer drugs based on natural products. Natural products have been explored for their diverse biological and therapeutic applications from ancient time. In order to enhance the efficacy and selectivity and to minimize the undesired side effects of anti cancer natural products (ANPs), it is essential to understand their target proteins and their mechanistic pathway. Chemical proteomics is one of the most powerful tools to connect ANP target identification and quantification where labeling and non-labeling based approaches have been used. Herein, we have discussed the various strategies to systemically develop selective ANP based chemical probes to characterise their specific and non-specific target proteins using a chemical proteomic approach in various cancer cell lysates.

Also flagged:Heparansulfateheparinsulfotransferasesugar2-O-sulfotransferase
Journal Article 2021-08-18 No Snippets Gesteira TF, Marforio TD, Mueller JW, Calvaresi M, Coulson-Thomas VJ.
Show Full Abstract

Heparan sulfate (HS) and heparin contain imprinted "sulfation codes", which dictate their diverse physiological and pathological functions. A group of orchestrated biosynthetic enzymes cooperate in polymerizing and modifying HS chains. The biotechnological development of enzymes that can recreate this sulfation pattern on synthetic heparin is challenging, primarily due to the paucity of quantitative data for sulfotransferase enzymes. Herein, we identified critical structural characteristics that determine substrate specificity and shed light on the catalytic mechanism of sugar sulfation of two HS sulfotransferases, 2-O-sulfotransferase (HS2ST) and 6-O-sulfotransferase (HS6ST). Two sets of molecular clamps in HS2ST recognize appropriate substrates; these clamps flank the acceptor binding site on opposite sides. The hexuronic epimers, and not their puckers, have a critical influence on HS2ST selectivity. In contrast, HS6ST recognizes a broader range of substrates. This promiscuity is granted by a conserved tryptophan residue, W210, that positions the acceptor within the active site for catalysis by means of strong electrostatic interactions. Lysines K131 and K132 act in concert with a second tryptophan, W153, shedding water molecules from within the active site, thus providing HS6ST with a binding preference toward 2-O-sulfated substrates. QM/MM calculations provided valuable mechanistic insights into the catalytic process, identifying that the sulfation of both HS2ST and HS6ST follows a SN2-like mechanism. When they are taken together, our findings reveal the molecular basis of how these enzymes recognize different substrates and catalyze sugar sulfation, enabling the generation of enzymes that could create specific heparin epitopes.

Also flagged:ADglial fibrillary acidic proteinGFAPtranscription factorIL6MAPK1
Journal Article 2021-08-17 ✓ 2 Snippets Viejo L, Noori A, Merrill E, Das S, Hyman BT, Serrano-Pozo A.
In-Text Gene Mentions

…MT1A/2A, NFE2L2, NOS1/2/3,PRDX6and SOD1/2), lipid…

…]; peroxiredoxin‐6 (PRDX6) [ 90…

Show Full Abstract

<h4>Aims</h4>Reactive astrocytes in Alzheimer's disease (AD) have traditionally been demonstrated by increased glial fibrillary acidic protein (GFAP) immunoreactivity; however, astrocyte reaction is a complex and heterogeneous phenomenon involving multiple astrocyte functions beyond cytoskeletal remodelling. To better understand astrocyte reaction in AD, we conducted a systematic review of astrocyte immunohistochemical studies in post-mortem AD brains followed by bioinformatics analyses on the extracted reactive astrocyte markers.<h4>Methods</h4>NCBI PubMed, APA PsycInfo and WoS-SCIE databases were interrogated for original English research articles with the search terms 'Alzheimer's disease' AND 'astrocytes.' Bioinformatics analyses included protein-protein interaction network analysis, pathway enrichment, and transcription factor enrichment, as well as comparison with public human -omics datasets.<h4>Results</h4>A total of 306 articles meeting eligibility criteria rendered 196 proteins, most of which were reported to be upregulated in AD vs control brains. Besides cytoskeletal remodelling (e.g., GFAP), bioinformatics analyses revealed a wide range of functional alterations including neuroinflammation (e.g., IL6, MAPK1/3/8 and TNF), oxidative stress and antioxidant defence (e.g., MT1A/2A, NFE2L2, NOS1/2/3, PRDX6 and SOD1/2), lipid metabolism (e.g., APOE, CLU and LRP1), proteostasis (e.g., cathepsins, CRYAB and HSPB1/2/6/8), extracellular matrix organisation (e.g., CD44, MMP1/3 and SERPINA3), and neurotransmission (e.g., CHRNA7, GABA, GLUL, GRM5, MAOB and SLC1A2), among others. CTCF and ESR1 emerged as potential transcription factors driving these changes. Comparison with published -omics datasets validated our results, demonstrating a significant overlap with reported transcriptomic and proteomic changes in AD brains and/or CSF.<h4>Conclusions</h4>Our systematic review of the neuropathological literature reveals the complexity of AD reactive astrogliosis. We have shared these findings as an online resource available at www.astrocyteatlas.org.

Also flagged:nanostructuresNucleic acidsbindingimmunorecognitiongene silencingorganization
Journal Article 2021-08-17 No Snippets Chandler M, Minevich B, Roark B, Viard M, Johnson MB, Rizvi MH, Deaton TA, Kozlov S, Panigaj M, Tracy JB, Yingling YG, Gang O, Afonin KA.
Show Full Abstract

Precise control over the assembly of biocompatible three-dimensional (3D) nanostructures would allow for programmed interactions within the cellular environment. Nucleic acids can be used as programmable crosslinkers to direct the assembly of quantum dots (QDs) and tuned to demonstrate different interparticle binding strategies. Morphologies of self-assembled QDs are evaluated via gel electrophoresis, transmission electron microscopy, small-angle X-ray scattering, and dissipative particle dynamics simulations, with all results being in good agreement. The controlled assembly of 3D QD organizations is demonstrated in cells via the colocalized emission of multiple assembled QDs, and their immunorecognition is assessed via enzyme-linked immunosorbent assays. RNA interference inducers are also embedded into the interparticle binding strategy to be released in human cells only upon QD assembly, which is demonstrated by specific gene silencing. The programmability and intracellular activity of QD assemblies offer a strategy for nucleic acids to imbue the structure and therapeutic function into the formation of complex networks of nanostructures, while the photoluminescent properties of the material allow for optical tracking in cells in vitro.

Also flagged:PSRORCSAMD11CASTInfectious Diseases
Journal Article 2021-08-17 ✓ 1 Snippet Mullaert J, Bouaziz M, Seeleuthner Y, Bigio B, Casanova JL, Alcaïs A, Abel L, Cobat A.
In-Text Gene Mentions

RABGAP1L

Show Full Abstract

Many methods for rare variant association studies require permutations to assess the significance of tests. Standard permutations assume that all individuals are exchangeable and do not take population stratification (PS), a known confounding factor in genetic studies, into account. We propose a novel strategy, LocPerm, in which individual phenotypes are permuted only with their closest ancestry-based neighbors. We performed a simulation study, focusing on small samples, to evaluate and compare LocPerm with standard permutations and classical adjustment on first principal components. Under the null hypothesis, LocPerm was the only method providing an acceptable type I error, regardless of sample size and level of stratification. The power of LocPerm was similar to that of standard permutation in the absence of PS, and remained stable in different PS scenarios. We conclude that LocPerm is a method of choice for taking PS and/or small sample size into account in rare variant association studies.

Also flagged:GSCRab11HubfzocupHis2Av
Journal Article 2021-08-17 ✓ 5 Snippets Witt E, Shao Z, Hu C, Krause HM, Zhao L.
In-Text Gene Mentions

DCC

…dosage compensation complex (DCC) (including the Male…

…RNA-FISH ofDCCtranscripts in Drosophila…

…TheDCCis thought to…

…components of theDCCin early germ…

Show Full Abstract

Dosage compensation equalizes X-linked expression between XY males and XX females. In male fruit flies, expression levels of the X-chromosome are increased approximately two-fold to compensate for their single X chromosome. In testis, dosage compensation is thought to cease during meiosis; however, the timing and degree of the resulting transcriptional suppression is difficult to separate from global meiotic downregulation of each chromosome. To address this, we analyzed testis single-cell RNA-sequencing (scRNA-seq) data from two Drosophila melanogaster strains. We found evidence that the X chromosome is equally transcriptionally active as autosomes in somatic and pre-meiotic cells, and less transcriptionally active than autosomes in meiotic and post-meiotic cells. In cells experiencing dosage compensation, close proximity to MSL (male-specific lethal) chromatin entry sites (CES) correlates with increased X chromosome transcription. We found low or undetectable levels of germline expression of most msl genes, mle, roX1 and roX2 via scRNA-seq and RNA-FISH, and no evidence of germline nuclear roX1/2 localization. Our results suggest that, although dosage compensation occurs in somatic and pre-meiotic germ cells in Drosophila testis, there might be non-canonical factors involved in the dosage compensation mechanism. The single-cell expression patterns and enrichment statistics of detected genes can be explored interactively in our database: https://zhao.labapps.rockefeller.edu/gene-expr/.

Also flagged:GCN5ADA2KATPTPGFPBPTF
Journal Article 2021-08-17 ✓ 1 Snippet Miao J, Wang C, Lucky AB, Liang X, Min H, Adapa SR, Jiang R, Kim K, Cui L.
In-Text Gene Mentions

…Further, ahistone assemblyassembly protein PfNAPS…

Show Full Abstract

The histone acetyltransferase GCN5-associated SAGA complex is evolutionarily conserved from yeast to human and functions as a general transcription co-activator in global gene regulation. In this study, we identified a divergent GCN5 complex in Plasmodium falciparum, which contains two plant homeodomain (PHD) proteins (PfPHD1 and PfPHD2) and a plant apetela2 (AP2)-domain transcription factor (PfAP2-LT). To dissect the functions of the PfGCN5 complex, we generated parasite lines with either the bromodomain in PfGCN5 or the PHD domain in PfPHD1 deleted. The two deletion mutants closely phenocopied each other, exhibiting significantly reduced merozoite invasion of erythrocytes and elevated sexual conversion. These domain deletions caused dramatic decreases not only in histone H3K9 acetylation but also in H3K4 trimethylation, indicating synergistic crosstalk between the two euchromatin marks. Domain deletion in either PfGCN5 or PfPHD1 profoundly disturbed the global transcription pattern, causing altered expression of more than 60% of the genes. At the schizont stage, these domain deletions were linked to specific down-regulation of merozoite genes involved in erythrocyte invasion, many of which contain the AP2-LT binding motif and are also regulated by AP2-I and BDP1, suggesting targeted recruitment of the PfGCN5 complex to the invasion genes by these specific factors. Conversely, at the ring stage, PfGCN5 or PfPHD1 domain deletions disrupted the mutually exclusive expression pattern of the entire var gene family, which encodes the virulent factor PfEMP1. Correlation analysis between the chromatin state and alteration of gene expression demonstrated that up- and down-regulated genes in these mutants are highly correlated with the silent and active chromatin states in the wild-type parasite, respectively. Collectively, the PfGCN5 complex represents a novel HAT complex with a unique subunit composition including an AP2 transcription factor, which signifies a new paradigm for targeting the co-activator complex to regulate general and parasite-specific cellular processes in this low-branching parasitic protist.

Also flagged:Ovarian cancerOCmalignant tumorsoncogenestumorgene expression
Journal Article 2021-08-17 No Snippets Xie W, Sun H, Li X, Lin F, Wang Z, Wang X.
Show Full Abstract

Ovarian cancer (OC) is one of the most common malignant tumors in women. OC is associated with the activation of oncogenes, the inactivation of tumor suppressor genes, and the activation of abnormal cell signaling pathways. Moreover, epigenetic processes have been found to play an important role in OC tumorigenesis. Epigenetic processes do not change DNA sequences but regulate gene expression through DNA methylation, histone modification, and non-coding RNA. This review comprehensively considers the importance of epigenetics in OC, with a focus on microRNA and long non-coding RNA. These types of RNA are promising molecular markers and therapeutic targets that may support precision medicine in OC. DNA methylation inhibitors and histone deacetylase inhibitors may be useful for such targeting, with a possible novel approach combining these two therapies. Currently, the clinical application of such epigenetic approaches is limited by multiple obstacles, including the heterogeneity of OC, insufficient sample sizes in reported studies, and non-optimized methods for detecting potential tumor markers. Nonetheless, the application of epigenetic approaches to OC patient diagnosis, treatment, and prognosis is a promising area for future clinical investigation.

Also flagged:Cancersolid tumorsLung TumorIminodiacetic acidbenzyltop
Journal Article 2021-08-17 ✓ 3 Snippets Genshaft AS, Ziegler CGK, Tzouanas CN, Mead BE, Jaeger AM, Navia AW, King RP, Mana MD, Huang S, Mitsialis V, Snapper SB, Yilmaz ÖH, Jacks T, Van Humbeck JF, Shalek AK.
In-Text Gene Mentions

Calcein NVOC+ cells were also significantly enriched for stem-like populations (e.g., expression of stem cell markers like OLFM4 and LRIG1; markers like GSTM3 known to be crypt-localized)29, while the bulk organoid exhibited higher proportions of cycling transit-amplifying cells, immature enterocytes, and mature enterocytes.

…marker genes likeOLFM4and LRIG1 (Fig.…

…cell markers likeOLFM4and LRIG1 ;…

Show Full Abstract

A cell's phenotype and function are influenced by dynamic interactions with its microenvironment. To examine cellular spatiotemporal activity, we developed SPACECAT-Spatially PhotoActivatable Color Encoded Cell Address Tags-to annotate, track, and isolate cells while preserving viability. In SPACECAT, samples are stained with photocaged fluorescent molecules, and cells are labeled by uncaging those molecules with user-patterned near-UV light. SPACECAT offers single-cell precision and temporal stability across diverse cell and tissue types. Illustratively, we target crypt-like regions in patient-derived intestinal organoids to enrich for stem-like and actively mitotic cells, matching literature expectations. Moreover, we apply SPACECAT to ex vivo tissue sections from four healthy organs and an autochthonous lung tumor model. Lastly, we provide a computational framework to identify spatially-biased transcriptome patterns and enriched phenotypes. This minimally perturbative and broadly applicable method links cellular spatiotemporal and/or behavioral phenotypes with diverse downstream assays, enabling insights into the connections between tissue microenvironments and (dys)function.

Also flagged:chromosomeCALCRMGST1nucleotideDGAT1GHR
Journal Article 2021-08-17 ✓ 1 Snippet Cheruiyot EK, Haile-Mariam M, Cocks BG, MacLeod IM, Xiang R, Pryce JE.
In-Text Gene Mentions

…PDHA2, UGP2, MDH1,PRDX6, NDUFA13 ) within…

Show Full Abstract

While understanding the genetic basis of heat tolerance is crucial in the context of global warming's effect on humans, livestock, and wildlife, the specific genetic variants and biological features that confer thermotolerance in animals are still not well characterized. We used dairy cows as a model to study heat tolerance because they are lactating, and therefore often prone to thermal stress. The data comprised almost 0.5 million milk records (milk, fat, and proteins) of 29,107 Australian Holsteins, each having around 15 million imputed sequence variants. Dairy animals often reduce their milk production when temperature and humidity rise; thus, the phenotypes used to measure an individual's heat tolerance were defined as the rate of milk production decline (slope traits) with a rising temperature-humidity index. With these slope traits, we performed a genome-wide association study (GWAS) using different approaches, including conditional analyses, to correct for the relationship between heat tolerance and level of milk production. The results revealed multiple novel loci for heat tolerance, including 61 potential functional variants at sites highly conserved across 100 vertebrate species. Moreover, it was interesting that specific candidate variants and genes are related to the neuronal system (ITPR1, ITPR2, and GRIA4) and neuroactive ligand-receptor interaction functions for heat tolerance (NPFFR2, CALCR, and GHR), providing a novel insight that can help to develop genetic and management approaches to combat heat stress.

Also flagged:Lgr5cDNAscRNA-sequencingFritzbiosynthesisRasa1
Journal Article 2021-08-17 ✓ 1 Snippet Lu J, Krepelova A, Rasa SMM, Annunziata F, Husak O, Adam L, Nunna S, Neri F.
In-Text Gene Mentions

…markers (Lgr5 andOlfm4) and we found…

Show Full Abstract

Organoids culture provides unique opportunities to study human diseases and to complement animal models. Several organs and tissues can be in vitro cultured in 3D structures resembling in vivo tissue organization. Organoids culture contains most of the cell types of the original tissue and are maintained by growth factors mimicking the in vivo state. However, the system is yet not fully understood, and specific in vivo features especially those driven by cell-extrinsic factors may be lost in culture. Here we show a comprehensive transcriptome-wide characterization of mouse gut organoids derived from different intestinal compartments and from mice of different gender and age. RNA-seq analysis showed that the in vitro culture strongly influences the global transcriptome of the intestinal epithelial cells (~ 60% of the total variance). Several compartment-, age- and gender-related transcriptome features are lost after culturing indicating that they are driven by niche or systemic factors. However, certain intrinsic transcriptional programs, for example, some compartment-related features and a minority of gender- and aging- related features are maintained in vitro which suggested possibilities for these features to be studied in this system. Moreover, our study provides knowledge about the cell-extrinsic or cell-intrinsic origin of intestinal epithelial transcriptional programs. We anticipated that our characterization of this in vitro system is an important reference for scientists and clinicians using intestinal organoids as a research model.

Also flagged:CancerTumorsgene expressiontumorgenetic diseaseoxygen
Journal Article 2021-08-17 No Snippets Li Y, Jin J, Bai F.
Show Full Abstract

Tumors are complex ecosystems in which heterogeneous cancer cells interact with their microenvironment composed of diverse immune, endothelial, and stromal cells. Cancer biology had been studied using bulk genomic and gene expression profiling, which however mask the cellular diversity and average the variability among individual molecular programs. Recent advances in single-cell transcriptomic sequencing have enabled a detailed dissection of tumor ecosystems and promoted our understanding of tumorigenesis at single-cell resolution. In the present review, we discuss the main topics of recent cancer studies that have implemented single-cell RNA sequencing (scRNA-seq). To study cancer cells, scRNA-seq has provided novel insights into the cancer stem-cell model, treatment resistance, and cancer metastasis. To study the tumor microenvironment, scRNA-seq has portrayed the diverse cell types and complex cellular states of both immune and non-immune cells interacting with cancer cells, with the promise to discover novel targets for future immunotherapy.

Also flagged:substance use disordersalcoholMECP2substance usesubstance addictionaddiction
Journal Article 2021-08-17 No Snippets Veerappa A, Pendyala G, Guda C.
Show Full Abstract

Substance use disorders (SUDs) are a group of neuropsychiatric conditions manifesting due to excessive dependence on potential drugs of abuse such as psychostimulants, opioids including prescription opioids, alcohol, inhalants, etc. Experimental studies have generated enormous data in the area of SUDs, but outcomes from such data have remained largely fragmented. In this review, we attempt to coalesce these data points providing an important first step towards our understanding of the etiology of SUDs. We propose and describe a 'core addictome' pathway that behaves central to all SUDs. Besides, we also have made some notable observations paving way for several hypotheses; MECP2 behaves as a master switch during substance use; five distinct gene clusters were identified based on respective substance addiction; a central cluster of genes serves as a hub of the addiction pathway connecting all other substance addiction clusters. In addition to describing these findings, we have emphasized the importance of some candidate genes that are of substantial interest for further investigation and serve as high-value targets for translational efforts.

Also flagged:WntmembraneMAMDC4lysosomeLGR5TCF
Journal Article 2021-08-17 ✓ 2 Snippets Wu MH, Padilla-Rodriguez M, Blum I, Camenisch A, Figliuolo da Paz V, Ollerton M, Muller J, Momtaz S, Mitchell SAT, Kiela P, Thorne C, Wilson JM, Cox CM.
In-Text Gene Mentions

…markers LGR5 andOLFM4, indicating that it…

OLFM4

Show Full Abstract

During postnatal intestinal development, the intestinal epithelium is highly proliferative, and this proliferation is regulated by signaling in the intervillous and crypt regions. This signaling is primarily mediated by Wnt, and requires membrane trafficking. However, the mechanisms by which membrane trafficking regulates signaling during this developmental phase are largely unknown. Endotubin (EDTB, MAMDC4) is an endosomal protein that is highly expressed in the apical endocytic complex (AEC) of villus enterocytes during fetal and postnatal development, and knockout of EDTB results in defective formation of the AEC and giant lysosome. Further, knockout of EDTB in cell lines results in decreased proliferation. However, the role of EDTB in proliferation during the development of the intestine is unknown. Using Villin-CreERT2 in EDTB<sup>fl/fl</sup> mice, we deleted EDTB in the intestine in the early postnatal period, or in enteroids in vitro after isolation of intervillous cells. Loss of EDTB results in decreased proliferation in the developing intestinal epithelium and decreased ability to form enteroids. EDTB is present in cells that contain the stem cell markers LGR5 and OLFM4, indicating that it is expressed in the proliferative compartment. Further, using immunoblot analysis and TCF/LEF-GFP mice as a reporter of Wnt activity, we find that knockout of EDTB results in decreased Wnt signaling. Our results show that EDTB is essential for normal proliferation during the early stages of intestinal development and suggest that this effect is through modulation of Wnt signaling.

Also flagged:BDNFnucleusmGluR2brain-derived neurotrophic factorHDmetabotropic glutamate receptor
Journal Article 2021-08-17 No Snippets Wang H, Del Mar N, Deng Y, Reiner A.
Show Full Abstract

We have found that daily subcutaneous injection with a maximum tolerated dose of the mGluR2/3 agonist LY379268 (20 mg/kg) beginning at 4 weeks of age dramatically improves the motor, neuronal and neurochemical phenotype in R6/2 mice, a rapidly progressing transgenic model of Huntington's disease (HD). We also previously showed that the benefit of daily LY379268 in R6/2 mice was associated with increases in corticostriatal brain-derived neurotrophic factor (BDNF), and in particular was associated with a reduction in enkephalinergic striatal projection neuron loss. In the present study, we show that daily LY379268 also rescues expression of BDNF by neurons of the thalamic parafascicular nucleus in R6/2 mice, which projects prominently to the striatum, and this increase too is linked to the rescue of enkephalinergic striatal neurons. Thus, LY379268 may protect enkephalinergic striatal projection neurons from loss by boosting BDNF production and delivery via both the corticostriatal and thalamostriatal projection systems. These results suggest that chronic treatment with mGluR2/3 agonists may represent an approach for slowing enkephalinergic neuron loss in HD, and perhaps progression in general.

Also flagged:vasoconstrictiondeathright heart failurepathogenesisPulmonary Arterial HypertensionPulmonary hypertension
Journal Article 2021-08-17 ✓ 1 Snippet Zolty R.
In-Text Gene Mentions

Data have described elevated expression of the 5HT transporter (5-HTT) in the PASMCs.346,347 Mutation in the 5HTT and/or 5-HT receptors in the platelets and lung tissues from PAH patients has also been demonstrated.346

Show Full Abstract

Pulmonary arterial hypertension (PAH) is a progressive and devastating disease characterized by pulmonary artery vasoconstriction and vascular remodeling leading to vascular rarefaction with elevation of pulmonary arterial pressures and pulmonary vascular resistance. Often PAH will cause death from right heart failure. Current PAH-targeted therapies improve functional capacity, pulmonary hemodynamics and reduce hospitalization. Nevertheless, today PAH still remains incurable and is often refractory to medical therapy, underscoring the need for further research. Over the last three decades, PAH has evolved from a disease of unknown pathogenesis devoid of effective therapy to a condition whose cellular, genetic and molecular underpinnings are unfolding. This article provides an update on current knowledge and summarizes the progression in recent advances in pharmacological therapy in PAH.

Also flagged:Gene Expressionmethylationpesticide poisoningchronic-degenerative diseasestumorsneurological disorders
Journal Article 2021-08-17 No Snippets Giambò F, Leone GM, Gattuso G, Rizzo R, Cosentino A, Cinà D, Teodoro M, Costa C, Tsatsakis A, Fenga C, Falzone L.
Show Full Abstract

Environmental or occupational exposure to pesticides is considered one of the main risk factors for the development of various diseases. Behind the development of pesticide-associated pathologies, there are both genetic and epigenetic alterations, where these latter are mainly represented by the alteration in the expression levels of microRNAs and by the change in the methylation status of the DNA. At present, no studies have comprehensively evaluated the genetic and epigenetic alterations induced by pesticides; therefore, the aim of the present study was to identify modifications in gene miRNA expression and DNA methylation useful for the prediction of pesticide exposure. For this purpose, an integrated analysis of gene expression, microRNA expression, and DNA methylation datasets obtained from the GEO DataSets database was performed to identify putative genes, microRNAs, and DNA methylation hotspots associated with pesticide exposure and responsible for the development of different diseases. In addition, DIANA-miRPath, STRING, and GO Panther prediction tools were used to establish the functional role of the putative biomarkers identified. The results obtained demonstrated that pesticides can modulate the expression levels of different genes and induce different epigenetic alterations in the expression levels of miRNAs and in the modulation of DNA methylation status.

Also flagged:Proteaseneuropeptidelight-chain proteasebotulinum neurotoxin ALCAPirt
Journal Article 2021-08-17 ✓ 3 Snippets Wang W, Kong M, Dou Y, Xue S, Liu Y, Zhang Y, Chen W, Li Y, Dai X, Meng J, Wang J.
In-Text Gene Mentions

…Y receptor Y2;GPR52, G protein-coupled receptor…

…receptor Y2; GPR52,G protein-coupled receptor 52protein-coupled receptor 52;…

…, HTR3A ,GPR52, GM2808 ,…

Show Full Abstract

Chronic pain is a leading health and socioeconomic problem and an unmet need exists for long-lasting analgesics. SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) are required for neuropeptide release and noxious signal transducer surface trafficking, thus, selective expression of the SNARE-cleaving light-chain protease of botulinum neurotoxin A (LCA) in peripheral sensory neurons could alleviate chronic pain. However, a safety concern to this approach is the lack of a sensory neuronal promoter to prevent the expression of LCA in the central nervous system. Towards this, we exploit the unique characteristics of Pirt (phosphoinositide-interacting regulator of TRP), which is expressed in peripheral nociceptive neurons. For the first time, we identified a Pirt promoter element and cloned it into a lentiviral vector driving transgene expression selectively in peripheral sensory neurons. Pirt promoter driven-LCA expression yielded rapid and concentration-dependent cleavage of SNAP-25 in cultured sensory neurons. Moreover, the transcripts of pain-related genes (<i>TAC1, tachykinin precursor 1;</i>&nbsp;<i>CALCB, calcitonin gene-related peptide 2; HTR3A, 5-hydroxytryptamine receptor 3A;</i>&nbsp;<i>NPY2R, neuropeptide Y receptor Y2;</i>&nbsp;<i>GPR52, G protein-coupled receptor 52;</i>&nbsp;<i>SCN9A, sodium voltage-gated channel alpha subunit 9;</i>&nbsp;<i>TRPV1</i> and <i>TRPA1, transient receptor potential cation channel subfamily V member 1</i> and <i>subfamily A member 1)</i> in pro-inflammatory cytokines stimulated sensory neurons were downregulated by viral mediated expression of LCA. Furthermore, viral expression of LCA yielded long-lasting inhibition of pain mediator release. Thus, we show that the engineered Pirt-LCA virus may provide a novel means for long lasting pain relief.

Also flagged:non-alcoholic fatty liver diseaseNAFLDliver diseasemitochondrialRNAse Pcirrhosis
Journal Article 2021-08-17 ✓ 1 Snippet Chrysavgis L, Papatheodoridi A, Cholongitas E, Koutsilieris M, Papatheodoridis G, Chatzigeorgiou A.
In-Text Gene Mentions

…Wilson’s disease ofhemochromatosisand did not…

Show Full Abstract

The pathogenetic mechanisms involved in the progression of non-alcoholic fatty liver disease (NAFLD) have not been completely elucidated, while the significance of circulating cell-free DNA (cf-DNA) species has been rarely evaluated in NAFLD. Herein, we assessed the serum levels of cf-DNA species in NAFLD patients and investigated their potential associations with patients' characteristics and severity of liver disease. Forty-nine adult patients with NAFLD of any stage were included in this cohort study. Cf-DNA was isolated from patients' sera and the levels of several distinct cf-DNA species including total cf-DNA, gene-coding cf-DNA, Alu repeat sequences, mitochondrial DNA copies and 5-methyl-2'-deoxycytidine were determined. Cirrhotic compared to non-cirrhotic patients had significantly lower serum levels of cf-DNA and RNAse P coding DNA as well as higher expression of 5-methyl-2'-deoxycytidine. After adjustment for the significant clinico-epidemiological factors, lower serum levels of cf-DNA or RNAse P were independently associated with the presence of cirrhosis. Serum levels of total and gene-coding DNA are associated with the presence of cirrhosis in NAFLD patients regardless of clinical or epidemiological parameters and may therefore be used as a screening tool for NAFLD progression.

Also flagged:neurodegenerative disorderscancerchromatinreplication forkChro-Matesbinding
Journal Article 2021-08-17 ✓ 1 Snippet Uruci S, Lo CSY, Wheeler D, Taneja N.
In-Text Gene Mentions

…chromatin remodelers orchromatin modifiersmodifiers that have…

Show Full Abstract

Since their discovery, R-loops have been associated with both physiological and pathological functions that are conserved across species. R-loops are a source of replication stress and genome instability, as seen in neurodegenerative disorders and cancer. In response, cells have evolved pathways to prevent R-loop accumulation as well as to resolve them. A growing body of evidence correlates R-loop accumulation with changes in the epigenetic landscape. However, the role of chromatin modification and remodeling in R-loops homeostasis remains unclear. This review covers various mechanisms precluding R-loop accumulation and highlights the role of chromatin modifiers and remodelers in facilitating timely R-loop resolution. We also discuss the enigmatic role of RNA:DNA hybrids in facilitating DNA repair, epigenetic landscape and the potential role of replication fork preservation pathways, active fork stability and stalled fork protection pathways, in avoiding replication-transcription conflicts. Finally, we discuss the potential role of several Chro-Mates (chromatin modifiers and remodelers) in the likely differentiation between persistent/detrimental R-loops and transient/benign R-loops that assist in various physiological processes relevant for therapeutic interventions.

Also flagged:alkylcyclodextrinnaphthalenedimideamineglutamic acidNDI 1
Journal Article 2021-08-17 No Snippets Roy Chowdhury S, Nandi SK, Mondal S, Kumar S, Haldar D.
Show Full Abstract

Supramolecular polymer formed by non-covalent interactions between complementary building blocks entraps solvents and develops supramolecular polymer gel. A supramolecular polymer gel was prepared by the heating-cooling cycle of <i>β</i>-cyclodextrin (<i>β</i>-CD) and naphthalenedimide (NDI) solution in N,N-dimethylformamide (DMF). The host-guest inclusion complex of <i>β</i>-CD and NDI <b>1</b> containing dodecyl amine forms the supramolecular polymer and gel in DMF. However, <i>β</i>-CD and NDI <b>2,</b> having glutamic acid, fail to form the supramolecular polymer and gel under the same condition. X-ray crystallography shows that the alkyl chains of NDI <b>1</b> are complementary to the hydrophobic cavity of the two <i>β</i>-CD units. From rheology, the storage modulus was approximately 1.5 orders of magnitude larger than the loss modulus, which indicates the physical crosslink and elastic nature of the thermo-responsive gel. FE-SEM images of the supramolecular polymer gel exhibit flake-like morphology and a dense flake network. The flakes developed from the assembly of smaller rods. Photophysical studies show that the host-guest complex formation and gelation have significantly enhanced emission intensity with a new hump at 550 nm. Upon excitation by a 366 nm UV-light, NDI <b>1</b> and <i>β</i>-CD gel in DMF shows white light emission. The gel has the potential for the fabrication of organic electronic devices.

Also flagged:T4Aamino acidSLC6A4ChromosomeMetal bindinglysine
Journal Article 2021-08-17 ✓ 1 Snippet Hasan MA, Hakim FT, Islam Shovon MT, Islam MM, Islam MS, Islam MA.
In-Text Gene Mentions

…droxy Tryptamine Transporter (5-HTT), encodes by a…

Show Full Abstract

Genetic polymorphism of the <i>SLC6A4</i> gene is associated with several behavioral disorders, including depression. Since studying the total nonsynonymous single nucleotide polymorphisms (nsSNPs) of the <i>SLC6A4</i> gene at the population level is a difficult task, we aim to utilize <i>in silico</i> approach to detect the most deleterious nsSNPs of the <i>SLC6A4</i> gene. In our study, 7 computational tools were used in the initial stage, including SIFT, Polyphen-2, PROVEAN, SNAP2, PhD-SNP, PANTHER, and SNPs&GO to find out the most damaging nsSNPs. In the second phase, we performed structural, functional, and stability analysis of <i>SLC6A4</i> protein by popular computation tools, including I-Mutant 2.0 and MutPred2. Also, the ConSurf server was utilized to find the conserved region of the <i>SLC6A4</i> protein to determine the relationship between these conserved regions with high-risk nsSNPs. Based on these analyses, 5 high-risk mutations of the <i>SLC6A4</i> protein were selected. Then, we carried out comparative modeling by using the Robetta server and aligned the mutant protein model with the native protein structure. Later, we performed the post-translational modification and functional domain analysis of the <i>SLC6A4</i> protein. This study concludes that Arginine → Tryptophan at position 79 and Arginine → Cysteine at position 104 are the two significant mutations in <i>SLC6A4</i> protein which might play an essential role in causing diseases. Future studies should take these high-risk nsSNPs (rs1221448303, rs200953188) into consideration while exploring diseases related to the <i>SLC6A4</i> gene. Besides, our research is the first-ever comprehensive <i>in silico</i> investigation of the <i>SLC6A4</i> gene. Thus, the findings of this study could be beneficial for developing precision medicines against diseases caused by <i>SLC6A4</i> malfunction. Furthermore, extensive wet-lab research and experiments on various model organisms might be helpful to investigate the precise role of these damaging nsSNPs of the <i>SLC6A4</i> gene.

Also flagged:BDNFFosEgr1SncaPtgs2Npas4
Journal Article 2021-08-17 No Snippets Micheli L, Creanza TM, Ceccarelli M, D'Andrea G, Giacovazzo G, Ancona N, Coccurello R, Scardigli R, Tirone F.
Show Full Abstract

The dentate gyrus of the hippocampus and the subventricular zone are neurogenic niches where neural stem and progenitor cells replicate throughout life to generate new neurons. The <i>Btg1</i> gene maintains the stem cells of the neurogenic niches in quiescence. The deletion of <i>Btg1</i> leads to an early transient increase of stem/progenitor cells division, followed, however, by a decrease during adulthood of their proliferative capability, accompanied by apoptosis. Since a physiological decrease of neurogenesis occurs during aging, the <i>Btg1</i> knockout mouse may represent a model of neural aging. We have previously observed that the defective neurogenesis of the <i>Btg1</i> knockout model is rescued by the powerful neurogenic stimulus of physical exercise (running). To identify genes responsible for stem and progenitor cells maintenance, we sought here to find genes underlying this premature neural aging, and whose deregulated expression could be rescued by running. Through RNA sequencing we analyzed the transcriptomic profiles of the dentate gyrus isolated from <i>Btg1</i> wild-type or <i>Btg1</i> knockout adult (2-month-old) mice submitted to physical exercise or sedentary. In <i>Btg1</i> knockout mice, 545 genes were deregulated, relative to wild-type, while 2081 genes were deregulated by running. We identified 42 genes whose expression was not only down-regulated in the dentate gyrus of <i>Btg1</i> knockout, but was also counter-regulated to control levels by running in <i>Btg1</i> knockout mice, vs. sedentary. Among these 42 counter-regulated genes, <i>alpha-synuclein</i> (<i>Snca</i>), <i>Fos</i>, <i>Arc</i> and <i>Npas4</i> showed significantly greater differential regulation. These genes control neural proliferation, apoptosis, plasticity and memory and are involved in aging. In particular, Snca expression decreases during aging. We tested, therefore, whether an Snca-expressing lentivirus, by rescuing the defective Snca levels in the dentate gyrus of <i>Btg1</i> knockout mice, could also reverse the aging phenotype, in particular the defective neurogenesis. We found that the exogenous expression of Snca reversed the <i>Btg1</i> knockout-dependent decrease of stem cell proliferation as well as the increase of progenitor cell apoptosis. This indicates that Snca has a functional role in the process of neural aging observed in this model, and also suggests that Snca acts as a positive regulator of stem cell maintenance.

Also flagged:Head and Neck Canceroral cancertumorgene expressionprotein kinasesATPase
Journal Article 2021-08-17 No Snippets Jawa Y, Yadav P, Gupta S, Mathan SV, Pandey J, Saxena AK, Kateriya S, Tiku AB, Mondal N, Bhattacharya J, Ahmad S, Chaturvedi R, Tyagi RK, Tandon V, Singh RP.
Show Full Abstract

Head and neck cancer (HNC) is among the ten leading malignancies worldwide, with India solely contributing one-third of global oral cancer cases. The current focus of all cutting-edge strategies against this global malignancy are directed towards the heterogeneous tumor microenvironment that obstructs most treatment blueprints. Subsequent to the portrayal of established information, the review details the application of single cell technology, organoids and spheroid technology in relevance to head and neck cancer and the tumor microenvironment acknowledging the resistance pattern of the heterogeneous cell population in HNC. Bioinformatic tools are used for study of differentially expressed genes and further omics data analysis. However, these tools have several challenges and limitations when analyzing single-cell gene expression data that are discussed briefly. The review further examines the omics of HNC, through comprehensive analyses of genomics, transcriptomics, proteomics, metabolomics, and epigenomics profiles. Patterns of alterations vary between patients, thus heterogeneity and molecular alterations between patients have driven the clinical significance of molecular targeted therapies. The analyses of potential molecular targets in HNC are discussed with connotation to the alteration of key pathways in HNC followed by a comprehensive study of protein kinases as novel drug targets including its ATPase and additional binding pockets, non-catalytic domains and single residues. We herein review, the therapeutic agents targeting the potential biomarkers in light of new molecular targeted therapies. In the final analysis, this review suggests that the development of improved target-specific personalized therapies can combat HNC's global plight.

Also flagged:COSALTtumorsS11TumorS15
Journal Article 2021-08-16 No Snippets Chen Y, Fang L, Zhou W, Chang J, Zhang X, He C, Chen C, Yan R, Yan Y, Lu Y, Xu C, Xiang G.
Show Full Abstract

<h4>Background</h4>Hypoxic tumor microenvironment (TME) promotes tumor metastasis and drug resistance, leading to low efficiency of cancer chemotherapy. The development of targeted agents or multi-target therapies regulating hypoxic microenvironment is an important approach to overcome drug resistance and metastasis.<h4>Methods</h4>In this study, chitosan oligosaccharide (COS)-coated and sialic acid (SA) receptor-targeted nano-micelles were prepared using film dispersion method to co-deliver cisplatin (CDDP) and nitric oxide (NO) (denoted as CTP/CDDP). In addition, we explored the mechanisms by which NO reversed CDDP resistance as well as enhanced anti-metastatic efficacy in hypoxic cancer cells.<h4>Results</h4>Because of the different affinities of COS and SA to phenylboronic acid (PBA) under different pH regimes, CTP/CDDP micelles with intelligent targeting property increased cellular uptake of CDDP and enhanced cytotoxicity to tumors, but reduced systemic toxicity to normal organs or tissues. In addition, CTP/CDDP showed stimulus-responsive release in TME. In terms of anti-tumor mechanism, CTP/CDDP reduced CDDP efflux and inhibited epithelial-mesenchymal transition (EMT) process of tumor by down-regulating hypoxia-inducible factor-1α (HIF-1α), glutathione (GSH), multidrug resistance-associated protein 2 (MRP2) and matrix metalloproteinase 9 (MMP9) expression, thus reversing drug resistance and metastasis of hypoxic tumor cells.<h4>Conclusions</h4>The designed micelles significantly enhanced anti-tumor effects both in vitro and in vivo. These results suggested that CTP/CDDP represented a promising strategy to treat resistance and metastatic tumors.

Also flagged:OAS3peptidesPhosphorylationSCAF4digestionCMAP
Journal Article 2021-08-16 ✓ 1 Snippet Liu W, Xie L, He YH, Wu ZY, Liu LX, Bai XF, Deng DX, Xu XE, Liao LD, Lin W, Heng JH, Xu X, Peng L, Huang QF, Li CY, Zhang ZD, Wang W, Zhang GR, Gao X, Wang SH, Li CQ, Xu LY, Liu W, Li EM.
In-Text Gene Mentions

…genes such asBTN2A1(3.4%), RHOA (2.3%),…

Show Full Abstract

Esophageal cancer (EC) is a type of aggressive cancer without clinically relevant molecular subtypes, hindering the development of effective strategies for treatment. To define molecular subtypes of EC, we perform mass spectrometry-based proteomic and phosphoproteomics profiling of EC tumors and adjacent non-tumor tissues, revealing a catalog of proteins and phosphosites that are dysregulated in ECs. The EC cohort is stratified into two molecular subtypes-S1 and S2-based on proteomic analysis, with the S2 subtype characterized by the upregulation of spliceosomal and ribosomal proteins, and being more aggressive. Moreover, we identify a subtype signature composed of ELOA and SCAF4, and construct a subtype diagnostic and prognostic model. Potential drugs are predicted for treating patients of S2 subtype, and three candidate drugs are validated to inhibit EC. Taken together, our proteomic analysis define molecular subtypes of EC, thus providing a potential therapeutic outlook for improving disease outcomes in patients with EC.

Also flagged:AP3M1TMEM14BPPM1ACX3CR1TFDP1TNFRSF8
Journal Article 2021-08-16 ✓ 4 Snippets Antiga LG, Sibbens L, Abakkouy Y, Decorte R, Van Den Bogaert W, Van de Voorde W, Bekaert B.
In-Text Gene Mentions

TAOK3

…, ABCB8 andTAOK3) also showed…

…, GBF1 ,TAOK3) clustered together…

TAOK3encodes for a…

Show Full Abstract

RNA analysis of post-mortem tissues, or thanatotranscriptomics, has become a topic of interest in forensic science due to the essential information it can provide in forensic investigations. Several studies have previously investigated the effect of death on gene transcription, but it has never been conducted with samples of the same individual. For the first time, a longitudinal mRNA expression analysis study was performed with post-mortem human blood samples from individuals with a known time of death. The results reveal that, after death, two clearly differentiated groups of up- and down-regulated genes can be detected. Pathway analysis suggests active processes that promote cell survival and DNA damage repair, rather than passive degradation, are the source of early post-mortem changes of gene expression in blood. In addition, a generalized linear model with an elastic net restriction predicted post-mortem interval with a root mean square error of 4.75 h. In conclusion, we demonstrate that post-mortem gene expression data can be used as biomarkers to estimate the post-mortem interval though further validation using independent sample sets is required before use in forensic casework.

Also flagged:FGFR4GLNTRP 7cancerfibroblast growth factor receptorFGFR
Journal Article 2021-08-16 No Snippets Dehghanian F, Alavi S.
Show Full Abstract

In recent years, many strategies have been used to overcome the fibroblast growth factor receptor (FGFR) tyrosine kinase inhibitors (TKIs) resistance caused by different mutations. LY2874455 (or 6LF) is a pan-FGFR inhibitor which is identified as the most efficient TKI for all resistant mutations in FGFRs. Here, we perform a comparative dynamics study of wild type (WT) and the FGFR4 V550L mutant for better understanding of the 6LF inhibition mechanism. Our results confirm that the pan-FGFR inhibitor 6LF can bind efficiently to both WT and V550L FGFR4. Moreover, the communication network analysis indicates that in apo-WT FGFR4, αD-αE loop behaves like a switch between open and close states of the substrate-binding pocket in searching of its ligand. In contrast, V550L mutation induces the active conformation of the FGFR4 substrate-binding pocket through disruption of αD-αE loop and αG helix anti-correlation. Interestingly, 6LF binding causes the rigidity of hinge and αD helix regions, which results in overcoming V550L induced resistance. Collectively, the results of this study would be informative for designing more efficient TKIs for more effective targeting of the FGFR signaling pathway.

Also flagged:erg6actinlackdefectscytokinesisautophagy
Journal Article 2021-08-16 ✓ 5 Snippets Pei S, Swayne TC, Morris JF, Emtage L.
In-Text Gene Mentions

HTT

Htt

…protein using GFP-fusedHttfrom the constitutive…

…8 ; otherHttconstructs were constructed…

…Briefly, theHtt-GFP sequences were amplified…

Show Full Abstract

The processes underlying formation and growth of unfolded protein inclusions are relevant to neurodegenerative diseases but poorly characterized in living cells. In S. cerevisiae, inclusions formed by mutant huntingtin (mHtt) have some characteristics of biomolecular condensates but the physical nature and growth mechanisms of inclusion bodies remain unclear. We have probed the relationship between concentration and inclusion growth in vivo and find that growth of mHtt inclusions in living cells is triggered at a cytoplasmic threshold concentration, while reduction in cytoplasmic mHtt causes inclusions to shrink. The growth rate is consistent with incorporation of new material through collision and coalescence. A small remnant of the inclusion is relatively long-lasting, suggesting that it contains a core that is structurally distinct, and which may serve to nucleate it. These observations support a model in which aggregative particles are incorporated by random collision into a phase-separated condensate composed of a particle-rich mixture.

Also flagged:prostate cancerARandrogencastrationenzalutamidebicalutamide
Journal Article 2021-08-16 ✓ 1 Snippet Haffner MC, Bhamidipati A, Tsai HK, Esopi DM, Vaghasia AM, Low JY, Patel RA, Guner G, Pham MT, Castagna N, Hicks J, Wyhs N, Aebersold R, De Marzo AM, Nelson WG, Guo T, Yegnasubramanian S.
In-Text Gene Mentions

ABT1

Show Full Abstract

<h4>Background</h4>Resistance to androgen deprivation therapies is a major driver of mortality in advanced prostate cancer. Therefore, there is a need to develop new preclinical models that allow the investigation of resistance mechanisms and the assessment of drugs for the treatment of castration-resistant prostate cancer.<h4>Methods</h4>We generated two novel cell line models (LAPC4-CR and VCaP-CR) which were derived by passaging LAPC4 and VCaP cells in vivo and in vitro under castrate conditions. We performed detailed transcriptomic (RNA-seq) and proteomic analyses (SWATH-MS) to delineate expression differences between castration-sensitive and castration-resistant cell lines. Furthermore, we characterized the in vivo and in vitro growth characteristics of these novel cell line models.<h4>Results</h4>The two cell line derivatives LAPC4-CR and VCaP-CR showed castration-resistant growth in vitro and in vivo which was only minimally inhibited by AR antagonists, enzalutamide, and bicalutamide. High-dose androgen treatment resulted in significant growth arrest of VCaP-CR but not in LAPC4-CR cells. Both cell lines maintained AR expression, but exhibited distinct expression changes on the mRNA and protein level. Integrated analyses including data from LNCaP and the previously described castration-resistant LNCaP-abl cells revealed an expression signature of castration resistance.<h4>Conclusions</h4>The two novel cell line models LAPC4-CR and VCaP-CR and their comprehensive characterization on the RNA and protein level represent important resources to study the molecular mechanisms of castration resistance.

Also flagged:acute leukemialeukemiagene expressionacute myeloid leukemiaAMLcell cycle
Journal Article 2021-08-16 ✓ 1 Snippet Zhang Y, Liu D, Li F, Zhao Z, Liu X, Gao D, Zhang Y, Li H.
In-Text Gene Mentions

…HSPE1, PA2G4, SNAP23P,DARS2, MIS18A, and HPRT1)…

Show Full Abstract

Traditional methods to understand leukemia stem cell (LSC)'s biological characteristics include constructing LSC-like cells and mouse models by transgenic or knock-in methods. However, there are some potential pitfalls in using this method, such as retroviral insertion mutagenesis, non-physiological level gene expression, non-physiological expansion, and difficulty to construct. The mRNAsi index for each sample of the Cancer Genome Atlas (TCGA) could avoid these potential pitfalls by machine learning. In this work, we aimed to construct a network of LSC genes utilizing the mRNAsi. First, mRNAsi value was analyzed with expressions distributions, survival analysis, age, and gender in acute myeloid leukemia (AML) samples. Then, we used the weighted gene co-expression network analysis (WGCNA) to construct modules of stemness genes. The correlation of the LSC genes transcription and interplay among LSC proteins was analyzed. We performed functional and pathway enrichment analysis to annotate stemness genes. Survival analysis further identified prognostic biomarkers by clinical data of TCGA and the Gene Expression Omnibus (GEO) database. We found that the result of mRNAsi overall survival is not significant, which may be due to the heterogeneity of AML in the stage of myeloid differentiation, French-American-British (FAB) classification systems. Enrichment analysis indicated that the stemness genes were biologically clustered as a group and mainly associated with cell cycle and mitosis. Moreover, 10 key genes (SNRNP40, RFC4, RFC5, CDC6, HSPE1, PA2G4, SNAP23P, DARS2, MIS18A, and HPRT1) were screened by survival analysis with the data from TCGA and GEO. Among them, RFC4 and RFC5 were the distinguished biomarkers for their double-validated prognostic value in both databases. Additionally, the expression of RFC4 and RFC5 had the same trend as mRNAsi score in FAB subtypes. In conclusion, our result demonstrated that mRNAsi based LSC-related genes were found to have strong interactions as a cluster. These genes, especially RFC4 and RFC5, could be the therapeutic targets for inhibiting the stemness characteristics of AML. This work is also a comprehensive pipeline for future cancer stem cell studies.

Also flagged:Childhood CancersCancerdeathpediatric cancersoncoproteinssarcomas
Journal Article 2021-08-16 No Snippets Angione SDA, Akalu AY, Gartrell J, Fletcher EP, Burckart GJ, Reaman GH, Leong R, Stewart CF.
Show Full Abstract

Cancer remains the leading cause of death from disease in children. Historically, in contrast to their adult counterparts, the causes of pediatric malignancies have remained largely unknown, with most pediatric cancers displaying low mutational burdens. Research related to molecular genetics in pediatric cancers is advancing our understanding of potential drivers of tumorigenesis and opening new opportunities for targeted therapies. One such area is fusion oncoproteins, which are a product of chromosomal rearrangements resulting in the fusion of different genes. They have been identified as oncogenic drivers in several sarcomas and leukemias. Continued advancement in the understanding of the biology of fusion oncoproteins will contribute to the discovery and development of new therapies for childhood cancers. Here we review the current scientific knowledge on fusion oncoproteins, focusing on pediatric sarcomas and hematologic cancers, and highlight the challenges and current efforts in developing drugs to target fusion oncoproteins.

Also flagged:antibodyred blood cell antigenhematopoietic malignant tumorshematopoiesispolymerasecyclo-olefin
Journal Article 2021-08-16 No Snippets Chen DP, Chen C, Wu PY, Lin YH, Lin WT, Yan YL.
Show Full Abstract

B<sub>3</sub> is the most common subtype of blood group B in the Taiwanese population, and most of the B<sub>3</sub> individuals in the Taiwanese population have the IVS3 + 5 G > A (rs55852701) gene variation. Additionally, a typical mixed field agglutination is observed when the B<sub>3</sub> subtype is tested with anti-B antibody or anti-AB antibody. The molecular biology of the gene variation in the B<sub>3</sub> subtype has been identified, however, the mechanism of the mixed field agglutination caused by the type B<sub>3</sub> blood samples is still unclear. Therefore, the purpose of this study was to understand the reason for the mixed field agglutination caused by B<sub>3</sub>. A micro-droplet platform was used to observe the agglutination of type B and type B<sub>3</sub> blood samples in different blood sample concentrations, antibody concentrations, and at reaction times. We found that the agglutination reaction in every droplet slowed down with an increase in the dilution ratio of blood sample and antibody, whether type B blood or type B<sub>3</sub> blood was used. However, as the reaction time increased, the complete agglutination in the droplet was seen in type B blood, while the mixed field agglutination still occurred in B<sub>3</sub> within 1 min. In addition, the degree of agglutination was similar in each droplet, which showed high reproducibility. As a result, we inferred that there are two types of cells in the B<sub>3</sub> subtype that simultaneously create a mixed field agglutination, rather than each red blood cell carrying a small amount of antigen, resulting in less agglutination.

Also flagged:capsaicinpsychological diseasesnucleuscomplex regional pain syndromewaterethanol
Journal Article 2021-08-16 ✓ 1 Snippet Shin DA, Chang MC.
In-Text Gene Mentions

…the 5-HT transporter (5-HTT) and perception of…

Show Full Abstract

The thermal grill illusion (TGI) is a paradoxical perception of burning heat and pain resulting from the simultaneous application of interlaced warm and cold stimuli to the skin. The TGI is considered a type of chronic centralized pain and has been used to apply nociceptive stimuli without inflicting harm to human participants in the study of pain mechanisms. In addition, the TGI is an interesting phenomenon for researchers, and various topics related to the TGI have been investigated in several studies, which we will review here. According to previous studies, the TGI is generated by supraspinal interactions. To evoke the TGI, cold and warm cutaneous stimuli should be applied within the same dermatome or across dermatomes corresponding to adjacent spinal segments, and a significant difference between cold and warm temperatures is necessary. In addition, due the presence of chronic pain, genetic factors, and sexual differences, the intensity of the TGI can differ. In addition, cold noxious stimulation, topical capsaicin, analgesics, self-touch, and the presence of psychological diseases can decrease the intensity of the TGI. Because the TGI corresponds to chronic centralized pain, we believe that the findings of previous studies can be applied to future studies to identify chronic pain mechanisms and clinical practice for pain management.

Also flagged:AutophagyCancerCordycepinadenosineadenosine A3 receptorepidermal growth factor receptor
Journal Article 2021-08-16 No Snippets Chen YY, Chen CH, Lin WC, Tung CW, Chen YC, Yang SH, Huang BM, Chen RJ.
Show Full Abstract

Cordycepin is an adenosine derivative isolated from <i>Cordyceps sinensis</i>, which has been used as an herbal complementary and alternative medicine with various biological activities. The general anti-cancer mechanisms of cordycepin are regulated by the adenosine A3 receptor, epidermal growth factor receptor (EGFR), mitogen-activated protein kinases (MAPKs), and glycogen synthase kinase (GSK)-3β, leading to cell cycle arrest or apoptosis. Notably, cordycepin also induces autophagy to trigger cell death, inhibits tumor metastasis, and modulates the immune system. Since the dysregulation of autophagy is associated with cancers and neuron, immune, and kidney diseases, cordycepin is considered an alternative treatment because of the involvement of cordycepin in autophagic signaling. However, the profound mechanism of autophagy induction by cordycepin has never been reviewed in detail. Therefore, in this article, we reviewed the anti-cancer and health-promoting effects of cordycepin in the neurons, kidneys, and the immune system through diverse mechanisms, including autophagy induction. We also suggest that formulation changes for cordycepin could enhance its bioactivity and bioavailability and lower its toxicity for future applications. A comprehensive understanding of the autophagy mechanism would provide novel mechanistic insight into the anti-cancer and health-promoting effects of cordycepin.

Also flagged:Peroxiredoxin-6cerebral ischemiaoxygenglucosevitamin Emitochondria
Journal Article 2021-08-16 ✓ 1 Snippet Turovsky EA, Varlamova EG, Varlamova EG, Plotnikov EY.
In-Text Gene Mentions

…mutPrx-6 (mutant variantPrdx6-C47S, kindly provided by…

Show Full Abstract

Ischemia-like conditions reflect almost the entire spectrum of events that occur during cerebral ischemia, including the induction of oxidative stress, Ca<sup>2+</sup> overload, glutamate excitotoxicity, and activation of necrosis and apoptosis in brain cells. Mechanisms for the protective effects of the antioxidant enzyme peroxiredoxin-6 (Prx-6) on hippocampal cells during oxygen-glucose deprivation/reoxygenation (OGD/R) were investigated. Using the methods of fluorescence microscopy, inhibitory analysis, vitality tests and PCR, it was shown that 24-h incubation of mixed hippocampal cell cultures with Prx-6 does not affect the generation of a reversible phase of a OGD-induced rise in Ca<sup>2+</sup> ions in cytosol ([Ca<sup>2+</sup>]<sub>i</sub>), but inhibits a global increase in [Ca<sup>2+</sup>]<sub>i</sub> in astrocytes completely and in neurons by 70%. In addition, after 40 min of OGD, cell necrosis is suppressed, especially in the astrocyte population. This effect is associated with the complex action of Prx-6 on neuroglial networks. As an antioxidant, Prx-6 has a more pronounced and astrocyte-directed effect, compared to the exogenous antioxidant vitamin E (Vit E). Prx-6 inhibits ROS production in mitochondria by increasing the antioxidant capacity of cells and altering the expression of genes encoding redox status proteins. Due to the close bond between [Ca<sup>2+</sup>]<sub>i</sub> and intracellular ROS, this effect of Prx-6 is one of its protective mechanisms. Moreover, Prx-6 effectively suppresses not only necrosis, but also apoptosis during OGD and reoxygenation. Incubation with Prx-6 leads to activation of the basic expression of genes encoding protective kinases-PI3K, CaMKII, PKC, anti-apoptotic proteins-Stat3 and Bcl-2, while inhibiting the expression of signaling kinases and factors involved in apoptosis activation-Ikk, Src, NF-κb, Caspase-3, p53, Fas, etc. This effect on the basic expression of the genome leads to the cell preconditions, which is expressed in the inhibition of caspase-3 during OGD/reoxygenation. A significant effect of Prx-6 is directed on suppression of the level of pro-inflammatory cytokine IL-1β and factor TNFα, as well as genes encoding NMDA- and kainate receptor subunits, which was established for the first time for this antioxidant enzyme. The protective effect of Prx-6 is due to its antioxidant properties, since mutant Prx-6 (mutPrx-6, Prx6-C47S) leads to polar opposite effects, contributing to oxidative stress, activation of apoptosis and cell death through receptor action on TLR4.

Also flagged:aspartamidePoly(aspartamideamino acidsynthesiscarbondegradation
Journal Article 2021-08-16 No Snippets Zhang G, Yi H, Bao C.
Show Full Abstract

Poly(aspartamide) derivatives, one kind of amino acid-based polymers with excellent biocompatibility and biodegradability, meet the key requirements for application in various areas of biomedicine. Poly(aspartamide) derivatives with stimuli-responsiveness can usually respond to external stimuli to change their chemical or physical properties. Using external stimuli such as temperature and pH as switches, these smart poly(aspartamide) derivatives can be used for convenient drug loading and controlled release. Here, we review the synthesis strategies for preparing these stimuli-responsive poly(aspartamide) derivatives and the latest developments in their applications as drug carriers.

Also flagged:Tumor Cell KillingCD3bindingantibodieshematologic malignanciessolid tumor
Journal Article 2021-08-16 ✓ 1 Snippet Warwas KM, Meyer M, Gonçalves M, Moldenhauer G, Bulbuc N, Knabe S, Luckner-Minden C, Ziegelmeier C, Heussel CP, Zörnig I, Jäger D, Momburg F.
In-Text Gene Mentions

…4-1BBL (TNFSF9), OX40L (TNFSF4), CD70 (TNFSF7), and…

Show Full Abstract

Although T cell-recruiting CD3-binding bispecific antibodies (BiMAb) have been proven to be clinically effective for hematologic malignancies, the success of BiMAb targeting solid tumor-associated antigens (TAA) in carcinomas so far remains poor. We reasoned that provision of co-stimulatory BiMAb in combination with αTAA-αCD3 BiMAb would boost T cell activation and proliferative capacity, and thereby facilitate the targeting of weakly or heterogeneously expressed tumor antigens. Various αTAA-αCD3 and αTAA-αCD28 BiMAb in a tetravalent IgG1-Fc based format have been analyzed, targeting multiple breast cancer antigens including HER2, EGFR, CEA, and EpCAM. Moreover, bifunctional fusion proteins of αTAA-tumor necrosis factor ligand (TNFL) superfamily members including 4-1BBL, OX40L, CD70 and TL1A have been tested. The functional activity of BiMAb was assessed using co-cultures of tumor cell lines and purified T cells in monolayer and tumor spheroid models. Only in the presence of tumor cells, αTAA-αCD3 BiMAb activated T cells and induced cytotoxicity <i>in vitro</i>, indicating a strict dependence on cross-linking. Combination treatment of αTAA-αCD3 BiMAb and co-stimulatory αTAA-αCD28 or αTAA-TNFL fusion proteins drastically enhanced T cell activation in terms of proliferation, activation marker expression, cytokine secretion and tumor cytotoxicity. Furthermore, BiMAb providing co-stimulation were shown to reduce the minimally required dose to achieve T cell activation by at least tenfold. Immuno-suppressive effects of TGF-β and IL-10 on T cell activation and memory cell formation could be overcome by co-stimulation. BiMAb-mediated co-stimulation was further augmented by immune checkpoint-inhibiting antibodies. Effective co-stimulation could be achieved by targeting a second breast cancer antigen, or by targeting fibroblast activation protein (FAP) expressed on another target cell. In tumor spheroids derived from pleural effusions of breast cancer patients, co-stimulatory BiMAb were essential for the activation tumor-infiltrating lymphocytes and cytotoxic anti-tumor responses against breast cancer cells. Taken together we showed that co-stimulation significantly potentiated the tumoricidal activity of T cell-activating BiMAb while preserving the dependence on TAA recognition. This approach could provide for a more localized activation of the immune system with higher efficacy and reduced peripheral toxicities.

Also flagged:prostate cancerCancerGene ExpressionGSECostimulatory Moleculeimmune responses
Journal Article 2021-08-16 No Snippets Ge S, Hua X, Chen J, Xiao H, Zhang L, Zhou J, Liang C, Tai S.
Show Full Abstract

Costimulatory molecules have been proven to enhance antitumor immune responses, but their roles in prostate cancer (PCa) remain unexplored. In this study, we aimed to explore the gene expression profiles of costimulatory molecule genes in PCa and construct a prognostic signature to improve treatment decision making and clinical outcomes. Five prognosis-related costimulatory molecule genes (RELT, TNFRSF25, EDA2R, TNFSF18, and TNFSF10) were identified, and a prognostic signature was constructed based on these five genes. This signature was an independent prognostic factor according to multivariate Cox regression analysis; it could stratify PCa patients into two subgroups with different prognoses and was highly associated with clinical features. The prognostic significance of the signature was well validated in four different independent external datasets. Moreover, patients identified as high risk based on our prognostic signature exhibited a high mutation frequency, a high level of immune cell infiltration and an immunosuppressive microenvironment. Therefore, our signature could provide clinicians with prognosis predictions and help guide treatment for PCa patients.

Also flagged:calcium channelthiazideACEmyocardial infarctionstrokedeath
Journal Article 2021-08-15 ✓ 1 Snippet McDonough CW, Warren HR, Jack JR, Motsinger-Reif AA, Armstrong ND, Bis JC, House JS, Singh S, El Rouby NM, Gong Y, Mychaleckyj JC, Rotroff DM, Benavente OR, Caulfield MJ, Doria A, Pepine CJ, Psaty BM, Glorioso V, Glorioso N, Hiltunen TP, Kontula KK, Arnett DK, Buse JB, Irvin MR, Johnson JA, Munroe PB, Wagner MJ, Cooper-DeHoff RM.
In-Text Gene Mentions

LRRC7

Show Full Abstract

We sought to identify genome-wide variants influencing antihypertensive drug response and adverse cardiovascular outcomes, utilizing data from four randomized controlled trials in the International Consortium for Antihypertensive Pharmacogenomics Studies (ICAPS). Genome-wide antihypertensive drug-single nucleotide polymorphism (SNP) interaction tests for four drug classes (β-blockers, n = 9,195; calcium channel blockers (CCBs), n = 10,511; thiazide/thiazide-like diuretics, n = 3,516; ACE-inhibitors/ARBs, n = 2,559) and cardiovascular outcomes (incident myocardial infarction, stroke, or death) were analyzed among patients with hypertension of European ancestry. Top SNPs from the meta-analyses were tested for replication of cardiovascular outcomes in an independent Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) study (n = 21,267), blood pressure (BP) response in independent ICAPS studies (n = 1,552), and ethnic validation in African Americans from the Genetics of Hypertension Associated Treatment study (GenHAT; n = 5,115). One signal reached genome-wide significance in the β-blocker-SNP interaction analysis (rs139945292, Interaction P = 1.56 × 10<sup>-8</sup> ). rs139945292 was validated through BP response to β-blockers, with the T-allele associated with less BP reduction (systolic BP response P = 6 × 10<sup>-4</sup> , Beta = 3.09, diastolic BP response P = 5 × 10<sup>-3</sup> , Beta = 1.53). The T-allele was also associated with increased adverse cardiovascular risk within the β-blocker treated patients' subgroup (P = 2.35 × 10<sup>-4</sup> , odds ratio = 1.57, 95% confidence interval = 1.23-1.99). The locus showed nominal replication in CHARGE, and consistent directional trends in β-blocker treated African Americans. rs139945292 is an expression quantitative trait locus for the 50 kb upstream gene NTM (neurotrimin). No SNPs attained genome-wide significance for any other drugs classes. Top SNPs were located near CALB1 (CCB), FLJ367777 (ACE-inhibitor), and CES5AP1 (thiazide). The NTM region is associated with increased risk for adverse cardiovascular outcomes and less BP reduction in β-blocker treated patients. Further investigation into this region is warranted.

Also flagged:Cadmiummitochondrialmembraneenzyme activitiescatalaseCAT
Journal Article 2021-08-15 ✓ 1 Snippet Li X, Zheng Y, Zhang G, Wang R, Jiang J, Zhao H.
In-Text Gene Mentions

…transcription factor 6 (SOX6), were down-regulated by…

Show Full Abstract

The anthropogenic-induced cadmium (Cd) pollution poses great threats to human health and wildlife survival. Birds also suffer from Cd contamination and Cd exerts negative impacts on multiple organs in birds. However, its toxic effects on cardiac organ of birds are still unclear. In this study, one-week old male Japanese quails were exposed to 15, 30, 60 and 75 mg/kg Cd for 5 weeks when birds in control group reached sex maturity. The results showed that Cd could cause microstructural damages including congestion and myocardial fiberolysis. Ultrastructural analysis also showed myocardial muscle fiber disarrangement and rupture as well as mitochondrial swelling, vacuolation and membrane lysis in Cd concentration groups. Moreover, Cd induced oxidative stress in the heart by decreasing antioxidant enzyme activities of catalase (CAT), glutathione peroxidase (GPX), total antioxidant capacity (T-AOC), superoxide dismutase (SOD) while increasing oxidative biomarkers such as malondialdehyde (MDA), inducible nitric oxide synthase (iNOS), and content of nitric oxide (NO). In addition, mRNA expression levels of genes involved in muscle fiber formation signaling pathway such as Follistatin (FST), paired box 3 (PAX3), myogenic differentiation 1 (MYoD1) and SRY-box transcription factor 6 (SOX6), were down-regulated by Cd exposure. Furthermore, PI3K/Akt/mTOR signaling pathway were disrupted by Cd exposure implying energy supply deficiency in the heart. We concluded that Cd caused cardiac dysfunction by inducing heart underdevelopment, histopathological injury, oxidative stress and myocardial muscle fiber formation disruption.

Also flagged:Melanomagene expressionalginatetumorEGR1cancer
Journal Article 2021-08-15 ✓ 3 Snippets Kappelmann-Fenzl M, Schmidt SK, Fischer S, Schmid R, Lämmerhirt L, Fischer L, Schrüfer S, Thievessen I, Schubert DW, Matthies A, Detsch R, Boccaccini AR, Arkudas A, Kengelbach-Weigand A, Bosserhoff AK.
In-Text Gene Mentions

…3 homeobox 2 (POU3F2) were linked to…

…with MITF andPOU3F2(Brn2) binding site,…

…52 ]), whereasPOU3F2target genes (Brn2)…

Show Full Abstract

Alginate hydrogels have been used as a biomaterial for 3D culturing for several years. Here, gene expression patterns in melanoma cells cultivated in 3D alginate are compared to 2D cultures. It is well-known that 2D cell culture is not resembling the complex in vivo situation well. However, the use of very intricate 3D models does not allow performing high-throughput screening and analysis is highly complex. 3D cell culture strategies in hydrogels will better mimic the in vivo situation while they maintain feasibility for large-scale analysis. As alginate is an easy-to-use material and due to its favorable properties, it is commonly applied as a bioink component in the growing field of cell encapsulation and biofabrication. Yet, only a little information about the transcriptome in 3D cultures in hydrogels like alginate is available. In this study, changes in the transcriptome based on RNA-Seq data by cultivating melanoma cells in 3D alginate are analyzed and reveal marked changes compared to cells cultured on usual 2D tissue culture plastic. Deregulated genes represent valuable cues to signaling pathways and molecules affected by the culture method. Using this as a model system for tumor cell plasticity and heterogeneity, EGR1 is determined to play an important role in melanoma progression.

Also flagged:ironbone marrow failure syndromehematological malignancybone marrow failure syndromessubclinical hypothyroidismanemias
Journal Article 2021-08-15 ✓ 1 Snippet Das S, Misra A, Kashyap A, Meena S, Singh A, Aggarwal KC.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Pediatric patients with hematological malignancy and bone marrow failure syndrome receive multiple transfusions before diagnosis and treatment. Iron overload leads to damage to vital organs like the heart, liver, thyroid, Gonads, Pancreas.<h4>Materials and methods</h4>A prospective study was done from June 2017-December 2019 in a tertiary care pediatric hematology oncology unit in northern India on children diagnosed with hematological malignancy and bone marrow failure syndromes receiving packed cell transfusion. After due ethical considerations and patient consent, the details were documented in predesigned proforma. All cases were planned to be investigated with Liver function test, Thyroid function test, Serum ferritin level, 2 D Echocardiography, Ultrasonography of abdomen, and MRI of the abdomen at admission and six months of enrollment.<h4>Results</h4>Out of 58 cases enrolled, ferritin levels were high in 65% of subjects at the start of treatment and 76% at the endpoint. Mean ferritin level was 725 ng/ml at baseline and 1268 ng/ml end of 6 month follow up period. Fifty-seven percent had a ferritin level above 1000 ng/ml, which correlated to basal ferritin level (<i>P</i>-value 0.005). The final ferritin level correlated strongly with the final number of packed cell transfusions (<i>P</i>-value 0.0002). Functional derangement of the liver was evident biochemically in 13.7% before starting treatment and 31.8% at six months follow-up period. Echocardiography detected diastolic dysfunction in 2% of patients at baseline before starting treatment and increased to 22% in 6 months follow-up period. The percentage of subclinical hypothyroidism increased from 22.8% to 48.8% during treatment.<h4>Conclusion</h4>Like transfusion-dependent anemias, children with hematological malignancy and bone marrow failure syndrome on chronic transfusion are at risk of transfusion-related iron overload and organ damage.

Also flagged:IronIRIDATMPRSS6Matriptase2MT2BMP6
Journal Article 2021-08-14 ✓ 2 Snippets Asperti M, Brilli E, Denardo A, Gryzik M, Pagani F, Busti F, Tarantino G, Arosio P, Girelli D, Poli M.
In-Text Gene Mentions

…iron regulator protein (HFE) and transferrin receptor…

…HJV KO orHFEKO mice.…

Show Full Abstract

Iron-refractory iron deficiency anemia (IRIDA) is an autosomal recessive disorder caused by genetic mutations on TMPRSS6 gene which encodes Matriptase2 (MT2). An altered MT2 cannot appropriately suppress hepatic BMP6/SMAD signaling in case of low iron, hence hepcidin excess blocks dietary iron absorption, leading to a form of anemia resistant to oral iron supplementation. In this study, using the IRIDA mouse model Mask, we characterized homozygous (msk/msk) compared to asymptomatic heterozygous (msk/wt) mice, assessing the major parameters of iron status in different organs, at different ages in both sexes. The effect of carbonyl iron diet was analyzed as control iron supplementation being used for many studies in mice. It resulted effective in both anemic control and msk/msk mice, as expected, even if there is no information about its mechanism of absorption. Then, we mainly compared two forms of oral iron supplement, largely used for humans: ferrous sulfate and Sucrosomial iron. In anemic control mice, the two oral formulations corrected hemoglobin levels from 11.40 ± 0.60 to 15.38 ± 1.71 g/dl in 2-4 weeks. Interestingly, in msk/msk mice, ferrous sulfate did not increase hemoglobin likely due to ferroportin/hepcidin-dependent absorption, whereas Sucrosomial iron increased it from 11.50 ± 0.60 to 13.53 ± 0.64 g/dl mainly in the first week followed by a minor increase at 4 weeks with a stable level of 13.30 ± 0.80 g/dl, probably because of alternative absorption. Thus, Sucrosomial iron, already used in other conditions of iron deficiency, may represent a promising option for oral iron supplementation in IRIDA patients.

Also flagged:patent ductus arteriosusDAoxygenprostaglandinsductus arteriosuscongenital heart disease
Journal Article 2021-08-14 ✓ 1 Snippet Yarboro MT, Gopal SH, Su RL, Morgan TM, Reese J.
In-Text Gene Mentions

FBXL4‐related mtDNA depletion syndrome

Show Full Abstract

The ductus arteriosus (DA) is a unique fetal vascular shunt, which allows blood to bypass the developing lungs in utero. After birth, changes in complex signaling pathways lead to constriction and permanent closure of the DA. The persistent patency of the DA (PDA) is a common disorder in preterm infants, yet the underlying causes of PDA are not fully defined. Although limits on the availability of human DA tissues prevent comprehensive studies on the mechanisms of DA function, mouse models have been developed that reveal critical pathways in DA regulation. Over 20 different transgenic models of PDA in mice have been described, with implications for human DA biology. Similarly, we enumerate 224 human single-gene syndromes that are associated with PDA, including a small subset that consistently feature PDA as a prominent phenotype. Comparison and functional analyses of these genes provide insight into DA development and identify key regulatory pathways that may serve as potential therapeutic targets for the management of PDA.

Also flagged:SCA2neurodegenerative diseaseATXN2caspase 3RNA binding proteinsdeath
Journal Article 2021-08-14 ✓ 2 Snippets Li PP, Moulick R, Feng H, Sun X, Arbez N, Jin J, Marque LO, Hedglen E, Chan HYE, Ross CA, Pulst SM, Margolis RL, Woodson S, Rudnicki DD.
In-Text Gene Mentions

Studies from multiple laboratories, including ours, support the idea that RNA neurotoxicity contributes to HD27, 28, 29, 48 We confirmed that TBL3 interacts in vitro with expanded CAG repeats flanked with either ATXN2‐ or HTT‐specific sequence (Fig. 3B), but not with expanded CUG repeats flanked with either antisense ATXN2 (ATXN2‐AS42), antisense HTT (HTT‐AS; expressed on HD locus),41 or junctophilin‐3 (JPH3) flanking sequence29 (Fig. 3B).

HTT

Show Full Abstract

<h4>Background</h4>Spinocerebellar ataxia type 2 (SCA2) is a neurodegenerative disease caused by expansion of a CAG repeat in Ataxin-2 (ATXN2) gene. The mutant ATXN2 protein with a polyglutamine tract is known to be toxic and contributes to the SCA2 pathogenesis.<h4>Objective</h4>Here, we tested the hypothesis that the mutant ATXN2 transcript with an expanded CAG repeat (expATXN2) is also toxic and contributes to SCA2 pathogenesis.<h4>Methods</h4>The toxic effect of expATXN2 transcripts on SK-N-MC neuroblastoma cells and primary mouse cortical neurons was evaluated by caspase 3/7 activity and nuclear condensation assay, respectively. RNA immunoprecipitation assay was performed to identify RNA binding proteins (RBPs) that bind to expATXN2 RNA. Quantitative PCR was used to examine if ribosomal RNA (rRNA) processing is disrupted in SCA2 and Huntington's disease (HD) human brain tissue.<h4>Results</h4>expATXN2 RNA induces neuronal cell death, and aberrantly interacts with RBPs involved in RNA metabolism. One of the RBPs, transducin β-like protein 3 (TBL3), involved in rRNA processing, binds to both expATXN2 and expanded huntingtin (expHTT) RNA in vitro. rRNA processing is disrupted in both SCA2 and HD human brain tissue.<h4>Conclusion</h4>These findings provide the first evidence of a contributory role of expATXN2 transcripts in SCA2 pathogenesis, and further support the role of expHTT transcripts in HD pathogenesis. The disruption of rRNA processing, mediated by aberrant interaction of RBPs with expATXN2 and expHTT transcripts, suggest a point of convergence in the pathogeneses of repeat expansion diseases with potential therapeutic implications. © 2021 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

Also flagged:COL27A1INIPLILRA5SLC30A1CCDC26FAM163A
Journal Article 2021-08-14 ✓ 5 Snippets Cardosa SR, Ogunkolade BW, Lowe R, Savage E, Mein CA, Boucher BJ, Hitman GA.
In-Text Gene Mentions

ANKRD45

NEGR1

RABGAP1L

Eighteen of those genes have reported associations with T2D and obesity in humans; of these genes there was most marked evidence for CLEC10A, MAPK8IP1, NEGR1, NQ01 and INHBE genes.

…, MAPK8IP1 ,NEGR1, NQ01 and…

Show Full Abstract

<h4>Background</h4>Betel-nut consumption is the fourth most common addictive habit globally and there is good evidence linking the habit to obesity, type 2 diabetes (T2D) and the metabolic syndrome. The aim of our pilot study was to identify gene expression relevant to obesity, T2D and the metabolic syndrome using a genome-wide transcriptomic approach in a human monocyte cell line incubated with arecoline and its nitrosated products.<h4>Results</h4>The THP1 monocyte cell line was incubated separately with arecoline and 3-methylnitrosaminopropionaldehyde (MNPA) in triplicate for 24 h and pooled cDNA indexed paired-end libraries were sequenced (Illumina NextSeq 500). After incubation with arecoline and MNPA, 15 and 39 genes respectively had significant changes in their expression (q < 0.05, log fold change 1.5). Eighteen of those genes have reported associations with T2D and obesity in humans; of these genes there was most marked evidence for CLEC10A, MAPK8IP1, NEGR1, NQ01 and INHBE genes.<h4>Conclusions</h4>Our preliminary studies have identified a large number of genes relevant to obesity, T2D and metabolic syndrome whose expression was changed significantly in human TPH1 cells following incubation with betel-nut derived arecoline or with MNPA. These findings require validation by further cell-based work and investigation amongst betel-chewing communities.

Also flagged:obsessive-compulsive disorderN-acetyl aspartatecholinemyo-inositolcreatineDrug-Naive Obsessive-Compulsive Disorder
Journal Article 2021-08-14 ✓ 2 Snippets Yue J, Zhong S, Luo A, Lai S, He T, Luo Y, Wang Y, Zhang Y, Shen S, Huang H, Wen S, Jia Y.
In-Text Gene Mentions

…aindications, achromatopsia orhemochromatosis, those who received…

…and achromatopsia orhemochromatosis.…

Show Full Abstract

<h4>Purpose</h4>This study aimed to investigate the mechanism of working memory (WM) impairment in drug-naive obsessive-compulsive disorder (OCD) by using neuropsychological tests and proton magnetic resonance spectroscopy (<sup>1</sup>H-MRS).<h4>Patients and methods</h4>A total of 55 patients with drug-naive OCD and 55 healthy controls (HCs) were recruited for this study. The working memory (WM) was evaluated using the digit span test (DST), visual space memory test (VSMT), and the 2-back task and stroop color word test (SCWT). The bilateral metabolite levels of the prefrontal cortex (PFC) were evaluated by 1H-MRS, then determined the ratios of N-acetyl aspartate (NAA), choline-containing compounds (Cho), and myo-inositol (MI) to creatine (Cr). The independent sample <i>t</i>-test was used to analyse the differences in WM performance and neurometabolite ratios. Multivariate linear regression analysis was performed to screen the influential factors of WM, with an introduction level of 0.05 and a rejection level of 0.10.<h4>Results</h4>1) Patients with OCD performed significantly worse on DST (score), VSMT (score), 2-back task (accuracy rate), SCWT (execution time) when compared with HCs. 2) NAA/Cr and Cho/Cr in the left PFC (lPFC) and MI/Cr ratios in the bilateral PFC of OCD patients were significantly lower when compared to HCs. 3) For OCD patients, the NAA/Cr ratio in the lPFC was negatively correlated with the score of DST (forwards), the Cho/Cr ratio in the lPFC was positively correlated with the accuracy rate of 2-back task, and the MI/Cr ratio in the right PFC (rPFC) was positively correlated with the score of DST (forwards) and the accuracy rate of VSMT. We also found that the compulsive symptoms showed a positive correlation with MI/Cr ratio of the rPFC.<h4>Conclusion</h4>Drug-naive OCD patients have demonstrated WM impairments, including phonological loop, visual-spatial sketchpad and central executive system, and the WM impairments might be associated with hypometabolism in the PFC, especially the lPFC.

Also flagged:IL-1βnuclear factorTripartite motif protein 38osteoarthritisNF-κB
Journal Article 2021-08-14 ✓ 5 Snippets Hu S, Li Y, Wang B, Peng K.
In-Text Gene Mentions

However, the relevance of TRIM38 in osteoarthritis is not yet known.

In this work, we aimed to explore any possible effects of TRIM38 on interleukin-1β (IL-1β)-stimulated chondrocytes, an in vitro cellular model of osteoarthritis.

Our work indicates a potential role of TRIM38 in osteoarthritis and proposes it as a new therapeutic target for osteoarthritis.

TRIM38protects chondrocytes from…

…motif protein 38 (TRIM38) has been documented…

Show Full Abstract

Tripartite motif protein 38 (TRIM38) has been documented as a vital modulator of inflammation. However, the relevance of TRIM38 in osteoarthritis is not yet known. In this work, we aimed to explore any possible effects of TRIM38 on interleukin-1β (IL-1β)-stimulated chondrocytes, an in vitro cellular model of osteoarthritis. Analyzing our data showed significant decreases in the levels of TRIM38 in chondrocytes following IL-1β stimulation. Gain-of-function studies revealed that overexpression of TRIM38 markedly increased the viability of IL-1β-stimulated chondrocytes while decreasing their rate of apoptosis and degeneration. Conversely, depletion of TRIM38 enhanced the sensitivity of chondrocytes to IL-1β-induced injury. Further research demonstrated that TRIM38 was capable of inhibiting IL-1β-induced activation of nuclear factor (NF)-κB signaling. Reactivation of NF-κB markedly reversed TRIM38-overexpression-mediated effects, while inhibition of NF-κB significantly abolished TRIM38-depletion-induced effects in IL-1β-stimulated chondrocytes. In summary, the findings of this work suggest that TRIM38 is capable of ameliorating IL-1β-induced apoptosis and degeneration of chondrocytes via suppression of NF-κB signaling. Our work indicates a potential role of TRIM38 in osteoarthritis and proposes it as a new therapeutic target for osteoarthritis.

Also flagged:cancerdeathgene expressionliver cancerHepatocellular Carcinomanucleotides
Journal Article 2021-08-14 ✓ 3 Snippets Zhou X, Dou M, Liu Z, Jiao D, Li Z, Chen J, Li J, Yao Y, Li L, Li Y, Han X.
In-Text Gene Mentions

The results showed that 14 (H2AFZ, HNRNPA1, RAN, SNRPD1, H2AFX, NASP, PPIA, CSNK1D, NAP1L1, DARS2, FARSB, SMARCC1, TPM3, and ZCCHC17) of the 15 DEmRNAs were considered to be important prognostic factors (Figure 4(d)) and the high expression of these genes was associated with poor prognosis in patients with HCC.

Finally, the survival analysis of these 15 hub mRNAs showed that the high expression of 14 hub mRNAs (H2AFZ, HNRNPA1, RAN, SNRPD1, H2AFX, NASP, PPIA, CSNK1D, NAP1L1, DARS2, FARSB, SMARCC1, TPM3, and ZCCHC17) was related to the poor prognosis of patients with HCC.

…PPIA, CSNK1D, NAP1L1,DARS2, FARSB, SMARCC1, TPM3,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) remains an important cause of cancer death. The molecular mechanism of hepatocarcinogenesis and prognostic factors of HCC have not been completely uncovered.<h4>Methods</h4>In this study, we screened out differentially expressed lncRNAs (DE lncRNAs), miRNAs (DE miRNAs), and mRNAs (DE mRNAs) by comparing the gene expression of HCC and normal tissue in The Cancer Genome Atlas (TCGA) database. DE mRNAs were used to perform Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Then, the miRNA and lncRNA/mRNA modules that were most closely related to the survival time of patients with HCC were screened to construct a competitive endogenous RNA (ceRNA) network by weighted gene coexpression network analysis (WGCNA). Moreover, univariable Cox regression and Kaplan-Meier curve analyses of DE lncRNAs and DE mRNAs were conducted. Finally, the lasso-penalized Cox regression analysis and nomogram model were used to establish a new risk scoring system and predict the prognosis of patients with liver cancer. The expression of survival-related DE lncRNAs was verified by qRT-PCR.<h4>Results</h4>A total of 1896 DEmRNAs, 330 DElncRNAs, and 76 DEmiRNAs were identified in HCC and normal tissue samples. Then, the turquoise miRNA and turquoise lncRNA/mRNA modules that were most closely related to the survival time of patients with HCC were screened to construct a ceRNA network by WGCNA. In this ceRNA network, there were 566 lncRNA-miRNA-mRNA regulatory pairs, including 30 upregulated lncRNAs, 16 downregulated miRNAs, and 75 upregulated mRNAs. Moreover, we screened out 19 lncRNAs and 14 hub mRNAs related to prognosis from this ceRNA network by univariable Cox regression and Kaplan-Meier curve analyses. Finally, a new risk scoring system was established by selecting the optimal risk lncRNAs from the 19 prognosis-related lncRNAs through lasso-penalized Cox regression analysis. In addition, we established a nomogram model consisting of independent prognostic factors to predict the survival rate of HCC patients. Finally, the correlation between the risk score and immune cell infiltration and gene set enrichment analysis were determined.<h4>Conclusions</h4>In conclusion, the results may provide potential biomarkers or therapeutic targets for HCC and the establishment of the new risk scoring system and nomogram model provides the new perspective for predicting the prognosis of HCC.

Also flagged:Bone Cancercancerdepressionnuclear factor kappa BNF-κBmetastatic cancers
Journal Article 2021-08-14 No Snippets Wu S, Chen X, Huang F, Lin M, Chen P, Wan H, Gao F, Zheng T, Zheng X.
Show Full Abstract

Bone cancer pain (BCP)-depression comorbidity has become a complex clinical problem during cancer treatment; however, its underlying molecular mechanisms have not been clarified. Several long noncoding RNAs (lncRNAs) have been demonstrated to be promising therapeutic targets in depression, but research on the role of lncRNAs in BCP-depression comorbidity has been limited. Therefore, high-throughput RNA sequencing was performed to detect differentially expressed profiles in the amygdala of a BCP-depression rat model in this study. We detected 330 differentially expressed mRNAs (DEmRNAs) and 78 differentially expressed lncRNAs (DElncRNAs) in the BCP-depression comorbidity model and then verified the expression of six DEmRNAs and six DElncRNAs with the greatest degrees of difference by RT-qPCR. Furthermore, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that differentially expressed genes were strongly enriched in inflammatory and immunologic systemic responses. Then the nuclear factor kappa B (NF-κB) signaling pathway and the Th17 differentiation pathway showed significant differences, as determined by Western blot analysis. Finally, we constructed a protein-protein interaction (PPI) network to explore the potential regulatory mechanism of DEmRNAs. In conclusion, our study reveals a new resource for the understanding of dysregulated lncRNAs and mRNAs in BCP-depression comorbidity and provides novel potential therapeutic targets for further approaches.

Also flagged:atherosclerosis-hydroxybenzoic acidalcoholhydroxyacidα-tocopherol
Journal Article 2021-08-14 No Snippets Tzara A, Lambrinidis G, Kourounakis A.
Show Full Abstract

Oxidative stress and inflammation are two conditions that coexist in many multifactorial diseases such as atherosclerosis and neurodegeneration. Thus, the design of multifunctional compounds that can concurrently tackle two or more therapeutic targets is an appealing approach. In this study, the basic NSAID structure was fused with the antioxidant moieties 3,5-di-tert-butyl-4-hydroxybenzoic acid (BHB), its reduced alcohol 3,5-di-tert-butyl- 4-hydroxybenzyl alcohol (BHBA), or 6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox), a hydrophilic analogue of α-tocopherol. Machine learning algorithms were utilized to validate the potential dual effect (anti-inflammatory and antioxidant) of the designed analogues. Derivatives <b>1</b>-<b>17</b> were synthesized by known esterification methods, with good to excellent yields, and were pharmacologically evaluated both in vitro and in vivo for their antioxidant and anti-inflammatory activity, whereas selected compounds were also tested in an in vivo hyperlipidemia protocol. Furthermore, the activity/binding affinity of the new compounds for lipoxygenase-3 (LOX-3) was studied not only in vitro but also via molecular docking simulations. Experimental results demonstrated that the antioxidant and anti-inflammatory activities of the new fused molecules were increased compared to the parent molecules, while molecular docking simulations validated the improved activity and revealed the binding mode of the most potent inhibitors. The purpose of their design was justified by providing a potentially safer and more efficient therapeutic approach for multifactorial diseases.

Also flagged:oxytocinOrexinvasopressinMCHHuntington diseaseHD
Journal Article 2021-08-14 ✓ 3 Snippets Henningsen JB, Soylu-Kucharz R, Björkqvist M, Petersén Å.
In-Text Gene Mentions

Early studies showed that the transgenic R6/1 and the R6/2 mouse models of HD, which express a short fragment of mutant HTT, displayed resistance to intrastriatal injection of QA [5, 6, 7].

Huntington disease (HD) is a fatal neurodegenerative movement disorder caused by an expanded CAG repeat in the huntingtin gene (HTT).

…the huntingtin gene (HTT).…

Show Full Abstract

Huntington disease (HD) is a fatal neurodegenerative movement disorder caused by an expanded CAG repeat in the huntingtin gene (HTT). The mutant huntingtin protein is ubiquitously expressed, but only certain brain regions are affected. The hypothalamus has emerged as an important area of pathology with selective loss of neurons expressing the neuropeptides orexin (hypocretin), oxytocin and vasopressin in human postmortem HD tissue. Hypothalamic changes in HD may have implications for early disease manifestations affecting the regulation of sleep, emotions and metabolism. The underlying mechanisms of selective vulnerability of certain neurons in HD are not fully understood, but excitotoxicity has been proposed to play a role. Further understanding of mechanisms rendering neurons sensitive to mutant huntingtin may reveal novel targets for therapeutic interventions. In the present study, we wanted to examine whether transgenic HD mice display altered sensitivity to excitotoxicity in the hypothalamus. We first assessed effects of hypothalamic injections of the excitotoxin quinolinic acid (QA) into wild-type (WT) mice. We show that neuronal populations expressing melanin-concentrating hormone (MCH) and cocaine and amphetamine-regulated transcript (CART) display a dose-dependent sensitivity to QA. In contrast, neuronal populations expressing orexin, oxytocin, vasopressin as well as tyrosine hydroxylase in the A13 area are resistant to QA-induced toxicity. We demonstrate that the R6/2 transgenic mouse model expressing a short fragment of mutant HTT displays hypothalamic neuropathology with discrete loss of the neuronal populations expressing orexin, MCH, CART, and orexin at 12 weeks of age. The BACHD mouse model expressing full-length mutant HTT does not display any hypothalamic neuropathology at 2 months of age. There was no effect of hypothalamic injections of QA on the neuronal populations expressing orexin, MCH, CART or oxytocin in neither HD mouse model. In conclusion, we find no support for a role of excitotoxicity in the loss of hypothalamic neuronal populations in HD.

Also flagged:iron deficiency anemiaHemoglobinoxytocinAnemiarespiratory distress syndromehyperbilirubinemia
Journal Article 2021-08-14 ✓ 1 Snippet Katariya D, Swain D, Singh S, Satapathy A.
In-Text Gene Mentions

In a previous study, DCC was found to be a reason underlying the increased incidence of postpartum hemorrhage [2]; however, much evidence indicates that DCC is not associated with maternal outcomes in terms of postpartum hemorrhage, oxytocin use, and duration of the third stage of labor [9,12,21-24].

Show Full Abstract

Background and objective Delayed cord clamping (DCC) has proven to be an ideal approach to reduce iron deficiency anemia; however, different timings of DCC relative to the birth outcome lead to conflicting results. The present study was conducted to determine the effects of different timings of DCC on the maternal and neonatal outcomes in normal vaginal deliveries at term. Methods This was an interventional study on neonates born at term without complications to mothers with uneventful pregnancies in the labor unit of a district hospital in Odisha, India. A total of 147 women were randomized to three intervention groups: DCC at one minute, DCC at two minutes, and DCC at three minutes. Hemoglobin and bilirubin levels, maternal blood loss, the timing of the third stage of labor, oxytocin use, and birth weight of the neonates were measured as the outcomes of different timings of DCC. Results At 24-48 hours of age, hemoglobin and bilirubin levels of the neonates were significantly higher with DCC at three minutes compared to DCC at one and two minutes. However, there were no significant differences among the three groups in terms of the need for phototherapy. The duration of the third stage of labor was significantly longer with DCC at three minutes. Maternal blood loss, oxytocin use, and birth weight of the neonates were not significantly associated with the timing of DCC. Conclusion Based on our findings, waiting to clamp the umbilical cord until three minutes can effectively reduce the incidence of iron deficiency anemia in newborns.

Also flagged:Vav2Netrin-1 receptoraxonaxonsaxonal growth conescytoskeleton
Journal Article 2021-08-13 No Snippets Tsou YS, Wang CY, Chang MY, Hsu TI, Wu MT, Wu YH, Tsai WL, Chuang JY, Kao TJ.
Show Full Abstract

<h4>Background</h4>Proper guidance of neuronal axons to their targets is required to assemble neural circuits during the development of the nervous system. However, the mechanism by which the guidance of axonal growth cones is regulated by specific intermediaries activated by receptor signaling pathways to mediate cytoskeleton dynamics is unclear. Vav protein members have been proposed to mediate this process, prompting us to investigate their role in the limb selection of the axon trajectory of spinal lateral motor column (LMC) neurons.<h4>Results</h4>We found Vav2 and Vav3 expression in LMC neurons when motor axons grew into the limb. Vav2, but not Vav3, loss-of-function perturbed LMC pathfinding, while Vav2 gain-of-function exhibited the opposite effects, demonstrating that Vav2 plays an important role in motor axon growth. Vav2 knockdown also attenuated the redirectional phenotype of LMC axons induced by Dcc, but not EphA4, in vivo and lateral LMC neurite growth preference to Netrin-1 in vitro. This study showed that Vav2 knockdown and ectopic nonphosphorylable Vav2 mutant expression abolished the Src-induced stronger growth preference of lateral LMC neurites to Netrin-1, suggesting that Vav2 is downstream of Src in this context.<h4>Conclusions</h4>Vav2 is essential for Netrin-1-regulated LMC motor axon pathfinding through Src interaction.

Also flagged:GCKdiabetes mellitusβ-thalassemiaPKD1cystic kidney diseasecataracts
Journal Article 2021-08-13 ✓ 1 Snippet Schiabor Barrett KM, Bolze A, Ni Y, White S, Isaksson M, Sharma L, Levin E, Lee W, Grzymski JJ, Lu JT, Washington NL, Cirulli ET.
In-Text Gene Mentions

…Medical records indicatedhemochromatosisin 1.6% of…

Show Full Abstract

<h4>Purpose</h4>To identify conditions that are candidates for population genetic screening based on population prevalence, penetrance of rare variants, and actionability.<h4>Methods</h4>We analyzed exome and medical record data from >220,000 participants across two large population health cohorts with different demographics. We performed a gene-based collapsing analysis of rare variants to identify genes significantly associated with disease status.<h4>Results</h4>We identify 74 statistically significant gene-disease associations across 27 genes. Seven of these conditions have a positive predictive value (PPV) of at least 30% in both cohorts. Three are already used in population screening programs (BRCA1, BRCA2, LDLR), and we also identify four new candidates for population screening: GCK with diabetes mellitus, HBB with β-thalassemia minor and intermedia, PKD1 with cystic kidney disease, and MIP with cataracts. Importantly, the associations are actionable in that early genetic screening of each of these conditions is expected to improve outcomes.<h4>Conclusion</h4>We identify seven genetic conditions where rare variation appears appropriate to assess in population screening, four of which are not yet used in screening programs. The addition of GCK, HBB, PKD1, and MIP rare variants into genetic screening programs would reach an additional 0.21% of participants with actionable disease risk, depending on the population.

Also flagged:diffuse-type gastric cancerCdh1Trp53nucleotidegastric cancerscancer
Journal Article 2021-08-13 ✓ 2 Snippets Zhang M, Sugita I, Komura D, Katoh H, Shimada S, Inazawa J, Tanaka S, Ishikawa S.
In-Text Gene Mentions

SV breakpoints were also identified in seven other orthologs of human CFS genes: Immp2l, Negr1, Naaladl2, Ccser1, Prkn, Lsamp, and Gpc6. Seven of eight mice exhibited at least one SV in the human CFS gene ortholog; similar to human cancers, deletion and duplication were the dominant alterations in these genes [53].

…genes: Immp2l ,Negr1, Naaladl2 ,…

Show Full Abstract

<h4>Background</h4>There is a need for a model of diffuse-type gastric cancer that captures the features of the disease, facilitates the study of its mechanisms, and aids the development of potential therapies. One such model may be Cdh1 and Trp53 double conditional knockout (DCKO) mice, which have histopathological features similar to those of human diffuse-type gastric cancer. However, a genomic profile of this mouse model has yet to be completed.<h4>Methods</h4>Whole-genome sequences of tumors from eight DCKO mice were analyzed and their molecular features were compared with those of human gastric adenocarcinoma.<h4>Results</h4>DCKO mice gastric cancers harbored single nucleotide variations and indel patterns comparable to those of human genomically stable gastric cancers, whereas their copy number variation fraction and ploidy were more similar to human chromosomal instability gastric cancers (perhaps due to Trp53 knockout). Copy number variations dominated changes in cancer-related genes in DCKO mice, with typical high-level amplifications observed for oncogenic drivers, e.g., Myc, Ccnd1, and Cdks, as well as gastrointestinal transcription factors, e.g., Gata4, Foxa1, and Sox9. Interestingly, frequent alterations in gastrointestinal transcription factors in DCKO mice indicated their potential role in tumorigenesis. Furthermore, mouse gastric cancer had a reproducible but smaller number of mutational signatures than human gastric cancer, including the potentially acid-related signature 17, indicating shared tumorigenic etiologies in humans and mice.<h4>Conclusions</h4>Cdh1/Trp53 DCKO mice have similar genomic features to those found in human gastric cancer; hence, this is a suitable model for further studies of diffuse-type gastric cancer mechanisms and therapies.

Also flagged:methylationAHICD4APOBEC3APDE4BUSP
Journal Article 2021-08-13 ✓ 1 Snippet Corley MJ, Sacdalan C, Pang APS, Chomchey N, Ratnaratorn N, Valcour V, Kroon E, Cho KS, Belden AC, Colby D, Robb M, Hsu D, Spudich S, Paul R, Vasan S, Ndhlovu LC, SEARCH010/RV254 and SEARCH013/RV304 study groups.
In-Text Gene Mentions

…05295594), HDAC4 (cg26673264),RABGAP1L(cg26531432), TET1 (cg08720255…

Show Full Abstract

HIV-1 disrupts the host epigenetic landscape with consequences for disease pathogenesis, viral persistence, and HIV-associated comorbidities. Here, we examined how soon after infection HIV-associated epigenetic changes may occur in blood and whether early initiation of antiretroviral therapy (ART) impacts epigenetic modifications. We profiled longitudinal genome-wide DNA methylation in monocytes and CD4+ T lymphocytes from 22 participants in the RV254/SEARCH010 acute HIV infection (AHI) cohort that diagnoses infection within weeks after estimated exposure and immediately initiates ART. We identified monocytes harbored 22,697 differentially methylated CpGs associated with AHI compared to 294 in CD4+ T lymphocytes. ART minimally restored less than 1% of these changes in monocytes and had no effect upon T cells. Monocyte DNA methylation patterns associated with viral load, CD4 count, CD4/CD8 ratio, and longitudinal clinical phenotypes. Our findings suggest HIV-1 rapidly embeds an epigenetic memory not mitigated by ART and support determining epigenetic signatures in precision HIV medicine. Trial Registration: NCT00782808 and NCT00796146.

Also flagged:termkeyhowhemorrhageCreatinineUrinary tract infection
Journal Article 2021-08-13 No Snippets Luong CQ, Ngo HM, Hoang HB, Pham DT, Nguyen TA, Tran TA, Nguyen DN, Do SN, Nguyen MH, Vu HD, Vuong HTT, Mai TD, Nguyen AQ, Le KH, Dao PV, Tran TH, Vu LD, Nguyen LQ, Pham TQ, Dong HV, Nguyen HT, Nguyen CV, Nguyen AD.
Show Full Abstract

<h4>Background</h4>The prevalence of risk factors for poor outcomes from aneurysmal subarachnoid hemorrhage (SAH) varies widely and has not been fully elucidated to date in Vietnam. Understanding the risk and prognosis of aneurysmal SAH is important to reduce poor outcomes in Vietnam. The aim of this study, therefore, was to investigate the rate of poor outcome at 90 days of ictus and associated factors from aneurysmal SAH in the country.<h4>Methods</h4>We performed a multicenter prospective cohort study of patients (≥18 years) presenting with aneurysmal SAH to three central hospitals in Hanoi, Vietnam, from August 2019 to August 2020. We collected data on the characteristics, management, and outcomes of patients with aneurysmal SAH and compared these data between good (defined as modified Rankin Scale (mRS) of 0 to 3) and poor (mRS, 4-6) outcomes at 90 days of ictus. We assessed factors associated with poor outcomes using logistic regression analysis.<h4>Results</h4>Of 168 patients with aneurysmal SAH, 77/168 (45.8%) were men, and the median age was 57 years (IQR: 48-67). Up to 57/168 (33.9%) of these patients had poor outcomes at 90 days of ictus. Most patients underwent sudden-onset and severe headache (87.5%; 147/168) and were transferred from local to participating central hospitals (80.4%, 135/168), over half (57.1%, 92/161) of whom arrived in central hospitals after 24 hours of ictus, and the initial median World Federation of Neurological Surgeons (WFNS) grading score was 2 (IQR: 1-4). Nearly half of the patients (47.0%; 79/168) were treated with endovascular coiling, 37.5% (63/168) were treated with surgical clipping, the remaining patients (15.5%; 26/168) did not receive aneurysm repair, and late rebleeding and delayed cerebral ischemia (DCI) occurred in 6.1% (10/164) and 10.4% (17/163) of patients, respectively. An initial WFNS grade of IV (odds ratio, OR: 15.285; 95% confidence interval, CI: 3.096-75.466) and a grade of V (OR: 162.965; 95% CI: 9.975-2662.318) were independently associated with poor outcomes. Additionally, both endovascular coiling (OR: 0.033; 95% CI: 0.005-0.235) and surgical clipping (OR: 0.046; 95% CI: 0.006-0.370) were inversely and independently associated with poor outcome. Late rebleeding (OR: 97.624; 95% CI: 5.653-1686.010) and DCI (OR: 15.209; 95% CI: 2.321-99.673) were also independently associated with poor outcome.<h4>Conclusions</h4>Improvements are needed in the management of aneurysmal SAH in Vietnam, such as increasing the number of aneurysm repairs, performing earlier aneurysm treatment by surgical clipping or endovascular coiling, and improving both aneurysm repairs and neurocritical care.

Also flagged:MethylbinThiolFluorineproRLG
Journal Article 2021-08-13 ✓ 1 Snippet Bennett S, Szczypiński FT, Turcani L, Briggs ME, Greenaway RL, Jelfs KE.
In-Text Gene Mentions

…to undergo commonDCCreactions, frequently used…

Show Full Abstract

Computation is increasingly being used to try to accelerate the discovery of new materials. One specific example of this is porous molecular materials, specifically porous organic cages, where the porosity of the materials predominantly comes from the internal cavities of the molecules themselves. The computational discovery of novel structures with useful properties is currently hindered by the difficulty in transitioning from a computational prediction to synthetic realization. Attempts at experimental validation are often time-consuming, expensive, and frequently, the key bottleneck of material discovery. In this work, we developed a computational screening workflow for porous molecules that includes consideration of the synthetic difficulty of material precursors, aimed at easing the transition between computational prediction and experimental realization. We trained a machine learning model by first collecting data on 12,553 molecules categorized either as "easy-to-synthesize" or "difficult-to-synthesize" by expert chemists with years of experience in organic synthesis. We used an approach to address the class imbalance present in our data set, producing a binary classifier able to categorize easy-to-synthesize molecules with few false positives. We then used our model during computational screening for porous organic molecules to bias toward precursors whose easier synthesis requirements would make them promising candidates for experimental realization and material development. We found that even by limiting precursors to those that are easier-to-synthesize, we are still able to identify cages with favorable, and even some rare, properties.

Also flagged:Leukocytoclastic vasculitisIL12BIL12RB1MSMDvasculitislymphadenitis
Journal Article 2021-08-13 ✓ 2 Snippets Sharifinejad N, Mahdaviani SA, Jamee M, Daneshmandi Z, Moniri A, Marjani M, Tabarsi P, Farnia P, Rekabi M, Fallahi M, Hashemimoghaddam SA, Mohkam M, Bustamante J, Casanova JL, Mansouri D, Velayati AA.
In-Text Gene Mentions

Seventeen gene mutations are involved in MSMD (IL12B, IL12RB1, IL12RB2, IL23R, JAK1, RORC, ISG15, TYK2, IRF8, SPPL2A, CYBB, IFNGR1, IFNGR2, STAT1, NEMO, TBX21, and ZNFX1) [2, 5–7].

…NEMO, TBX21, andZNFX1) [ 2…

Show Full Abstract

<h4>Background</h4>Mendelian susceptibility to mycobacterial disease (MSMD) is an inborn error of immunity, resulting in susceptibility to weakly virulent mycobacteria and other intramacrophagic pathogens. Rheumatologic manifestations and vasculitis are considered rare manifestations in MSMD patients.<h4>Case presentation</h4>In this study, we reported a 20-year-old female who was presented with recurrent lymphadenitis following bacillus Calmette-Guérin (BCG) vaccination and a history of recurrent disseminated rash diagnosed as leukocytoclastic vasculitis (LCV). A slight reduction in lymphocyte subsets including CD4+, CD19+, and CD 16 + 56 T-cell count, as well as an elevation in immunoglobulins level (IgG, IgA, IgM, IgE), were observed in the patient. Whole exome sequencing revealed a homozygous Indel-frameshift mutation, c.527_528delCT (p. S176Cfs*12), at the exon 5 of the IL12B gene. She experienced symptom resolution after treatment with anti-mycobacterial agents and subcutaneous IFN-γ. We conducted a manual literature search for MSMD patients reported with vasculitis in PubMed, Web of Science, and Scopus databases. A total of 18 MSMD patients were found to be affected by a variety of vasculitis phenotypes mainly including LCV and Henoch-Schönlein purpura (HSP) with often skin involvement. Patients were all involved with vasculitis at the median age of 6.8 (2.6-7.7) years, nearly 6.1 years after the initial presentations. Sixteen patients (88.9%) had IL12RB1 defects and concurrent Salmonella infection was reported in 15 (88.2%) patients.<h4>Conclusion</h4>The lack of IL-12 and IL-23 signaling/activity/function and salmonella infection may be triggering factors for the development of leukocytoclastic vasculitis. IL12B or IL12RB1 deficiency and salmonellosis should be considered in MSMD patients with vasculitis.

Also flagged:BlasttriSPECCSTBchr4TATC
Journal Article 2021-08-13 ✓ 1 Snippet Chiu R, Rajan-Babu IS, Friedman JM, Birol I.
In-Text Gene Mentions

…four STR loci:HTT, FMR1 ,…

Show Full Abstract

Tandem repeat (TR) expansion is the underlying cause of over 40 neurological disorders. Long-read sequencing offers an exciting avenue over conventional technologies for detecting TR expansions. Here, we present Straglr, a robust software tool for both targeted genotyping and novel expansion detection from long-read alignments. We benchmark Straglr using various simulations, targeted genotyping data of cell lines carrying expansions of known diseases, and whole genome sequencing data with chromosome-scale assembly. Our results suggest that Straglr may be useful for investigating disease-associated TR expansions using long-read sequencing.

Also flagged:methylationAgingneurodegenerationneurodegenerative diseasesneurodegenerative disorderscardiovascular diseases
Journal Article 2021-08-13 ✓ 1 Snippet Xu M, Zhu J, Liu XD, Luo MY, Xu NJ.
In-Text Gene Mentions

Huntington's disease (HD) is another common neurodegenerative condition with motor deficits, which is associated with mutations of the expanded cytosine-adenine-guanine (CAG) repeats in the huntingtin (HTT) gene.

Show Full Abstract

The epigenetic clock is defined by the DNA methylation (DNAm) level and has been extensively applied to distinguish biological age from chronological age. Aging-related neurodegeneration is associated with epigenetic alteration, which determines the status of diseases. In recent years, extensive research has shown that physical exercise (PE) can affect the DNAm level, implying a reversal of the epigenetic clock in neurodegeneration. PE also regulates brain plasticity, neuroinflammation, and molecular signaling cascades associated with epigenetics. This review summarizes the effects of PE on neurodegenerative diseases via both general and disease-specific DNAm mechanisms, and discusses epigenetic modifications that alleviate the pathological symptoms of these diseases. This may lead to probing of the underpinnings of neurodegenerative disorders and provide valuable therapeutic references for cognitive and motor dysfunction.

Also flagged:autophagy-initiatingTBK1NDP52Unc-51-like kinaseTANK-binding kinase 1Nuclear dot protein 52
Journal Article 2021-08-13 ✓ 5 Snippets Fu T, Zhang M, Zhou Z, Wu P, Peng C, Wang Y, Gong X, Li Y, Wang Y, Xu X, Li M, Shen L, Pan L.
In-Text Gene Mentions

…protein 1 (FUNDC1),Cell cycle progression protein 1cycle progression protein…

…progression protein 1 (CCPG1), Reticulophagy regulator 1…

…processes, including theCCPG1-mediated ER-phagy ( 20…

…the autophagy receptorsCCPG1and P62 can…

…with autophagy receptorsCCPG1and Optineurin can…

Show Full Abstract

The recruitment of Unc-51-like kinase and TANK-binding kinase 1 complexes is essential for Nuclear dot protein 52-mediated selective autophagy and relies on the specific association of NDP52, RB1-inducible coiled-coil protein 1, and Nak-associated protein 1 (5-azacytidine-induced protein 2, AZI2). However, the underlying molecular mechanism remains elusive. Here, we find that except for the NDP52 SKIP carboxyl homology (SKICH)/RB1CC1 coiled-coil interaction, the LC3-interacting region of NDP52 can directly interact with the RB1CC1 Claw domain, as that of NAP1 FIP200-binding region (FIR). The determined crystal structures of NDP52 SKICH/RB1CC1 complex, NAP1 FIR/RB1CC1 complex, and the related NAP1 FIR/Gamma-aminobutyric acid receptor-associated protein complex not only elucidate the molecular bases underpinning the interactions of RB1CC1 with NDP52 and NAP1 but also reveal that RB1CC1 Claw and Autophagy-related protein 8 family proteins are competitive in binding to NAP1 and NDP52. Overall, our findings provide mechanistic insights into the interactions of NDP52, NAP1 with RB1CC1 and ATG8 family proteins.

Also flagged:dsDNA = doubleNeurodegenerative Diseasesneurodegenerative disordersepigenetic modificationsgene expressionbinding
Journal Article 2021-08-13 ✓ 1 Snippet Su Y, Fan L, Shi C, Wang T, Zheng H, Luo H, Zhang S, Hu Z, Fan Y, Dong Y, Yang J, Mao C, Xu Y.
In-Text Gene Mentions

To this end, the CRISPR/Cas9 system paired with SMRT sequencing has been used, followed by a mapping-independent algorithm to analyze and visualize the repeat sequence in clinically relevant HD samples.34 In addition to HTT, researchers have evaluated the multiplexing efficiency of additional targets involving FMR1, ATXN10, and chromosome 9's open reading frame 72 (C9ORF72), causing FXS, SCA10, amyotrophic lateral sclerosis, and frontotemporal dementia (ALS/FTD), respectively.34 These support the feasibility of No-Amp targeted sequencing in multiplexing of different targets in the same run.

Show Full Abstract

Neurodegenerative diseases exhibit chronic progressive lesions in the central and peripheral nervous systems with unclear causes. The search for pathogenic mutations in human neurodegenerative diseases has benefited from massively parallel short-read sequencers. However, genomic regions, including repetitive elements, especially with high/low GC content, are far beyond the capability of conventional approaches. Recently, long-read single-molecule DNA sequencing technologies have emerged and enabled researchers to study genomes, transcriptomes, and metagenomes at unprecedented resolutions. The identification of novel mutations in unresolved neurodegenerative disorders, the characterization of causative repeat expansions, and the direct detection of epigenetic modifications on naive DNA by virtue of long-read sequencers will further expand our understanding of neurodegenerative diseases. In this article, we review and compare 2 prevailing long-read sequencing technologies, Pacific Biosciences and Oxford Nanopore Technologies, and discuss their applications in neurodegenerative diseases.

Also flagged:GBADementiaintracerebral hemorrhageOPTNUBQLN2Creutzfeldt-Jakob Disease
Journal Article 2021-08-13 ✓ 5 Snippets Jiao B, Liu H, Guo L, Xiao X, Liao X, Zhou Y, Weng L, Zhou L, Wang X, Jiang Y, Yang Q, Zhu Y, Zhou L, Zhang W, Wang J, Yan X, Li J, Tang B, Shen L.
In-Text Gene Mentions

HTT

…in C9orf72 andHTT.…

…SIGMAR1 , andHTT, attempting to…

…SIGMAR1 , andHTT, summarized in…

…TBK1 , andHTT49 – 52…

Show Full Abstract

Neurodegenerative dementias are a group of diseases with highly heterogeneous pathology and complicated etiology. There exist potential genetic component overlaps between different neurodegenerative dementias. Here, 1795 patients with neurodegenerative dementias from South China were enrolled, including 1592 with Alzheimer's disease (AD), 110 with frontotemporal dementia (FTD), and 93 with dementia with Lewy bodies (DLB). Genes targeted sequencing analysis were performed. According to the American College of Medical Genetics (ACMG) guidelines, 39 pathogenic/likely pathogenic (P/LP) variants were identified in 47 unrelated patients in 14 different genes, including PSEN1, PSEN2, APP, MAPT, GRN, CHCHD10, TBK1, VCP, HTRA1, OPTN, SQSTM1, SIGMAR1, and abnormal repeat expansions in C9orf72 and HTT. Overall, 33.3% (13/39) of the variants were novel, the identified P/LP variants were seen in 2.2% (35/1592) and 10.9% (12/110) of AD and FTD cases, respectively. The overall molecular diagnostic rate was 2.6%. Among them, PSEN1 was the most frequently mutated gene (46.8%, 22/47), followed by PSEN2 and APP. Additionally, the age at onset of patients with P/LP variants (51.4 years), ranging from 30 to 83 years, was ~10 years earlier than those without P/LP variants (p < 0.05). This study sheds insight into the genetic spectrum and clinical manifestations of neurodegenerative dementias in South China, further expands the existing repertoire of P/LP variants involved in known dementia-associated genes. It provides a new perspective for basic research on genetic pathogenesis and novel guiding for clinical practice of neurodegenerative dementia.

Also flagged:Phosphorustumoroxygenhydroxylblackfullerene
Journal Article 2021-08-13 No Snippets Liu Y, Li Z, Fan F, Zhu X, Jia L, Chen M, Du P, Yang L, Yang S.
Show Full Abstract

Sonodynamic therapy (SDT) triggered by ultrasound represents an emerging tumor therapy approach with minimally invasive treatment featuring nontoxicity and deep tissue-penetration, and its efficacy sensitively depends on the sonosensitizer which determines the generation of reactive oxygen species (ROS). Herein, for the first time covalently functionalized few-layer black phosphorus nanosheets (BPNSs) are applied as novel sonosensitizers in SDT, achieving not only boosted SDT efficacy but also inhibited cytotoxicity relative to the pristine BPNSs. Three different covalently functionalized-BPNSs are synthesized, including the first fullerene-functionalized BPNSs with C<sub>60</sub> covalently bonded onto the surface of BPNSs (abbreviated as C<sub>60</sub> -s-BP), surface-functionalized BPNSs by benzoic acid (abbreviated as BA-s-BP), and edge-functionalized BPNSs by C<sub>60</sub> (abbreviated as C<sub>60</sub> -e-BP), and the role of covalent functionalization pattern of BPNSs on its SDT efficacy is systematically investigated. Except C<sub>60</sub> -e-BP, both surface-functionalized BPNSs (C<sub>60</sub> -s-BP, BA-s-BP) exhibit higher SDT efficacies than the pristine BPNSs, while the highest SDT efficacy is achieved for BA-s-BP due to its strongest capability of generating the hydroxyl (·OH) radicals, which act as the dominant ROS to kill the tumor cells.

Also flagged:CNSTNME7HSPBAP1ERMNCLPTM1SPATA7
Journal Article 2021-08-13 ✓ 1 Snippet Qi YA, Maity TK, Cultraro CM, Misra V, Zhang X, Ade C, Gao S, Milewski D, Nguyen KD, Ebrahimabadi MH, Hanada KI, Khan J, Sahinalp C, Yang JC, Guha U.
In-Text Gene Mentions

…PVT1, Lnc-SYT2-4, andRC3H1-It1, were truly HLA-A∗02…

Show Full Abstract

Immune checkpoint inhibitors and adoptive lymphocyte transfer-based therapies have shown great therapeutic potential in cancers with high tumor mutational burden (TMB), such as melanoma, but not in cancers with low TMB, such as mutant epidermal growth factor receptor (EGFR)-driven lung adenocarcinoma. Precision immunotherapy is an unmet need for most cancers, particularly for cancers that respond inadequately to immune checkpoint inhibitors. Here, we employed large-scale MS-based proteogenomic profiling to identify potential immunogenic human leukocyte antigen (HLA) class I-presented peptides in melanoma and EGFR-mutant lung adenocarcinoma. Similar numbers of peptides were identified from both tumor types. Cell line and patient-specific databases (DBs) were constructed using variants identified from whole-exome sequencing. A de novo search algorithm was used to interrogate the HLA class I immunopeptidome MS data. We identified 12 variant peptides and several classes of tumor-associated antigen-derived peptides. We constructed a cancer germ line (CG) antigen DB with 285 antigens. This allowed us to identify 40 class I-presented CG antigen-derived peptides. The class I immunopeptidome comprised more than 1000 post-translationally modified (PTM) peptides representing 58 different PTMs, underscoring the critical role PTMs may play in HLA binding. Finally, leveraging de novo search algorithm and an annotated long noncoding RNA (lncRNA) DB, we developed a novel lncRNA-encoded peptide discovery pipeline to identify 44 lncRNA-derived peptides that are presented by class I. We validated tandem MS spectra of select variant, CG antigen, and lncRNA-derived peptides using synthetic peptides and performed HLA class I-binding assays to demonstrate binding to class I proteins. In summary, we provide direct evidence of HLA class I presentation of a large number of variant and tumor-associated peptides in both low and high TMB cancer. These results can potentially be useful for precision immunotherapies, such as vaccine or adoptive cell therapies in melanoma and EGFR-mutant lung cancers.

Also flagged:HistoneChromatinnucleosomesresponse tocancernucleoprotein
Journal Article 2021-08-13 No Snippets Mohan C, Das C, Tyler J.
Show Full Abstract

Our nuclear genomes are complexed with histone proteins to form nucleosomes, the repeating units of chromatin which function to package and limit unscheduled access to the genome. In response to helix-distorting DNA lesions and DNA double-strand breaks, chromatin is disassembled around the DNA lesion to facilitate DNA repair and it is reassembled after repair is complete to reestablish the epigenetic landscape and regulating access to the genome. DNA damage also triggers decondensation of the local chromatin structure, incorporation of histone variants and dramatic transient increases in chromatin mobility to facilitate the homology search during homologous recombination. Here we review the current state of knowledge of these changes in histone and chromatin dynamics in response to DNA damage, the molecular mechanisms mediating these dynamics, as well as their functional contributions to the maintenance of genome integrity to prevent human diseases including cancer.

Also flagged:Multiple Myelomahistone acetyltransferaseshistone methyltransferaseslysine demethylaseshistonemethylation
Journal Article 2021-08-13 ✓ 3 Snippets Schütt J, Nägler T, Schenk T, Brioli A.
In-Text Gene Mentions

Overall, the more frequently hypermethylated genes in MM are PTGS2 (100%), SFN (100%), CDKN2B (90.2%), CDH1 (88.2%), ESR1 (72.5%), HIC1 (70.5%), CCND2 (62.7%), DCC (45.1%) and TGFβR2 (39.2%), whereas RARβ (16.6%), MGMT (12.5%), AIM1 (12.5%), CDKN2A (8.3%), SOCS-1 (8.3%), CCNA1 (8.3%) and THBS1 (4.1%) are rarely found to be hypermethylated [58].

…(70.5%), CCND2 (62.7%),DCC(45.1%) and TGFβR2…

…Patients withDCCand TGFbR2 hypermethylation…

Show Full Abstract

Multiple Myeloma (MM) is a malignancy of plasma cells infiltrating the bone marrow (BM). Many studies have demonstrated the crucial involvement of bone marrow stromal cells in MM progression and drug resistance. Together with the BM microenvironment (BMME), epigenetics also plays a crucial role in MM development. A variety of epigenetic regulators, including histone acetyltransferases (HATs), histone methyltransferases (HMTs) and lysine demethylases (KDMs), are altered in MM, contributing to the disease progression and prognosis. In addition to histone modifications, DNA methylation also plays a crucial role. Among others, aberrant epigenetics involves processes associated with the BMME, like bone homeostasis, ECM remodeling or the development of treatment resistance. In this review, we will highlight the importance of the interplay of MM cells with the BMME in the development of treatment resistance. Additionally, we will focus on the epigenetic aberrations in MM and their role in disease evolution, interaction with the BMME, disease progression and development of drug resistance. We will also briefly touch on the epigenetic treatments currently available or currently under investigation to overcome BMME-driven treatment resistance.

Also flagged:p53tumormethylationhistone modificationsTP53histones
Journal Article 2021-08-13 ✓ 2 Snippets Tomicic MT, Dawood M, Efferth T.
In-Text Gene Mentions

In addition to mutations in TP53, other driver mutations in colorectal cancer (CRC) are found in genes of the WNT signaling pathway (e.g., APC and CTNNB1), TGF-β, DCC, SMAD, KRAS, RAF, BRAF, PI3K, PTEN as well as in the DNA mismatch repair genes hMSH3 and hMSH6, beyond other mutations [23].

…), TGF-β ,DCC, SMAD ,…

Show Full Abstract

Colorectal cancer (CRC) belongs to the most common tumor types, and half of all CRC harbor missense mutations in the <i>TP53</i> tumor suppressor gene. In addition to genetically caused loss of function of p53, epigenetic alterations (DNA methylation, histone modifications, micro-RNAs) contribute to CRC development. In this review, we focused on epigenetic alterations related to the entire p53 signaling pathway upstream and downstream of p53. Methylation of genes which activate p53 function has been reported, and methylation of <i>APC</i> and <i>MGMT</i> was associated with increased mutation rates of <i>TP53</i>. The micro-RNA 34a activates <i>TP53</i> and was methylated in CRC. Proteins that regulate TP53 DNA methylation, mutations, and acetylation of TP53-related histones were methylated in CRC. P53 regulates the activity of numerous downstream proteins. Even if <i>TP53</i> is not mutated, the function of wildtype p53 may be compromised if corresponding downstream genes are epigenetically inactivated. Thus, the role of p53 for CRC development, therapy response, and survival prognosis of patients may be much more eminent than previously estimated. Therefore, we propose that novel diagnostic devices measuring the entirety of genetic and epigenetic changes in the "p53 signalome" have the potential to improve the predictive and prognostic power in CRC diagnostics and management.

Also flagged:unnaturalpolyphenolsironsortase Ad -lyxose-ribose
Journal Article 2021-08-13 No Snippets Hricovíniová Z, Mascaretti Š, Hricovíniová J, Čížek A, Jampílek J.
Show Full Abstract

Nature has been a source of inspiration for the development of new pharmaceutically active agents. A series of new unnatural gallotannins (GTs), derived from d-lyxose, d-ribose, l-rhamnose, d-mannose, and d-fructose have been designed and synthesized in order to study the protective and antimicrobial effects of synthetic polyphenols that are structurally related to plant-derived products. The structures of the new compounds were confirmed by various spectroscopic methods. Apart from spectral analysis, the antioxidant activity was evaluated by 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging and iron reducing power (FRAP) assays. Antibacterial activity of compounds was tested in vitro against <i>Staphylococcus aureus</i> ATCC 29213, <i>Enterococcus faecalis</i> ATCC 29212 (reference and control strains), three methicillin-resistant isolates of <i>S. aureus</i>, and three isolates of vancomycin-resistant <i>E. faecalis</i>. For screening of antimycobacterial effect, a virulent isolate of <i>Mycobacterium tuberculosis</i> and two non-tuberculous mycobacteria were used. Furthermore, antibiofilm activity of structurally different GTs against <i>S. aureus</i>, and their ability to inhibit sortase A, were inspected. Experimental data revealed that the studied GTs are excellent antioxidants and radical-scavenging agents. The compounds exhibited only a moderate antibacterial effect against Gram-positive pathogens <i>S. aureus</i> and <i>E. faecalis</i> and were practically inactive against mycobacteria. However, they were efficient inhibitors and disruptors of <i>S. aureus</i> biofilms in sub-MIC concentrations, and interacted with the quorum-sensing system in <i>Chromobacterium</i><i>violaceum</i>. Overall, these findings suggest that synthetic GTs could be considered as promising candidates for pharmacological, biomedical, consumer products, and for food industry applications.

Also flagged:togene-expressionCYP2B6CYP3A7CYP3A5CYP1A1
Journal Article 2021-08-13 ✓ 2 Snippets Idda ML, Campesi I, Fiorito G, Vecchietti A, Urru SAM, Solinas MG, Franconi F, Floris M.
In-Text Gene Mentions

…prostaglandin I2 synthase (PTGIS).…

…ADH1B andPTGISare drug targets,…

Show Full Abstract

Individual response to drugs is highly variable and largely influenced by genetic variants and gene-expression profiles. In addition, it has been shown that response to drugs is strongly sex-dependent, both in terms of efficacy and toxicity. To expand current knowledge on sex differences in the expression of genes relevant for drug response, we generated a catalogue of differentially expressed human transcripts encoded by 289 genes in 41 human tissues from 838 adult individuals of the Genotype-Tissue Expression project (GTEx, v8 release) and focused our analysis on relevant transcripts implicated in drug response. We detected significant sex-differentiated expression of 99 transcripts encoded by 59 genes in the tissues most relevant for human pharmacology (liver, lung, kidney, small intestine terminal ileum, skin not sun-exposed, and whole blood). Among them, as expected, we confirmed significant differences in the expression of transcripts encoded by the cytochromes in the liver, CYP2B6, CYP3A7, CYP3A5, and CYP1A1. Our systematic investigation on differences between male and female in the expression of drug response-related genes, reinforce the need to overcome the sex bias of clinical trials.

Also flagged:infectionsevere complex immunodeficiencySCIDrotavirus infectionVP6polymerase
Journal Article 2021-08-13 No Snippets Chae SJ, Cho SR, Choi W, Han MG, Lee DY.
Show Full Abstract

The rotavirus vaccine is a live vaccine, and there is a possibility of infection by the virus strain used in the vaccine. We investigated the process of determining whether an infection was caused by the vaccine strain in a severe complex immunodeficiency (SCID) patient with rotavirus infection. The patient was vaccinated with RotaTeq prior to being diagnosed with SCID. The testing process was conducted in the following order: confirming rotavirus infection, determining its genotype, and confirming the vaccine strain. Rotavirus infection was confirmed through enzyme immunoassay and VP6 gene detection. G1 and P[8] were identified by multiplex polymerase chain reaction for the genotype, and G3 was further identified using a single primer. By detecting the fingerprint gene (WC3) of RotaTeq, it was confirmed that the detected virus was the vaccine strain. Genotypes G1 and P[8] were identified, and the infection was suspected of having been caused by rotavirus G1P[8]. G1P[8] is the most commonly detected genotype worldwide and is not included in the recombinant strains used in vaccines. Therefore, the infection was confirmed to have been caused by the vaccine strain by analyzing the genetic relationship between VP4 and VP7. Rotavirus infection by the vaccine strain can be identified through genotyping and fingerprint gene detection. However, genetic linkage analysis will also help to identify vaccine strains.

Also flagged:otosclerosisHearinginner ear diseasesenlargedesterase DLoss
Journal Article 2021-08-13 No Snippets Schmitt HA, Pich A, Prenzler NK, Lenarz T, Harre J, Staecker H, Durisin M, Warnecke A.
Show Full Abstract

Despite a vast amount of data generated by proteomic analysis on cochlear fluid, novel clinically applicable biomarkers of inner ear diseases have not been identified hitherto. The aim of the present study was to analyze the proteome of human perilymph from cochlear implant patients, thereby identifying putative changes of the composition of the cochlear fluid perilymph due to specific diseases. Sampling of human perilymph was performed during cochlear implantation from patients with clinically or radiologically defined inner ear diseases like enlarged vestibular aqueduct (EVA; <i>n</i> = 14), otosclerosis (<i>n</i> = 10), and Ménière's disease (<i>n</i> = 12). Individual proteins were identified by a shotgun proteomics approach and data-dependent acquisition, thereby revealing 895 different proteins in all samples. Based on quantification values, a disease-specific protein distribution in the perilymph was demonstrated. The proteins short-chain dehydrogenase/reductase family 9C member 7 and esterase D were detected in nearly all samples of Ménière's disease patients, but not in samples of patients suffering from EVA and otosclerosis. The presence of both proteins in the inner ear tissue of adult mice and neonatal rats was validated by immunohistochemistry. Whether these proteins have the potential for a biomarker in the perilymph of Ménière's disease patients remains to be elucidated.

Also flagged:deathfrontotemporal lobar dementianeurodegenerative diseasespathogenesisADPD
Journal Article 2021-08-13 ✓ 2 Snippets Azam S, Haque ME, Balakrishnan R, Kim IS, Choi DK.
In-Text Gene Mentions

A gradual increase in coding for the amino acid glutamine (CAG) and the expression of a mutant form of the huntingtin (HTT) protein (mHTT) have been reported as the key genetic features of HD pathogenesis.

Although HTT is typically abundantly expressed in neurons, during advanced stages of HD, the protein has been detected in B and T cells, monocytes, and macrophages (Li and Li, 2011).

Show Full Abstract

Ageing is an inevitable event in the lifecycle of all organisms, characterized by progressive physiological deterioration and increased vulnerability to death. Ageing has also been described as the primary risk factor of most neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and frontotemporal lobar dementia (FTD). These neurodegenerative diseases occur more prevalently in the aged populations. Few effective treatments have been identified to treat these epidemic neurological crises. Neurodegenerative diseases are associated with enormous socioeconomic and personal costs. Here, the pathogenesis of AD, PD, and other neurodegenerative diseases has been presented, including a summary of their known associations with the biological hallmarks of ageing: genomic instability, telomere attrition, epigenetic alterations, loss of proteostasis, mitochondrial dysfunction, cellular senescence, deregulated nutrient sensing, stem cell exhaustion, and altered intercellular communications. Understanding the central biological mechanisms that underlie ageing is important for identifying novel therapeutic targets for neurodegenerative diseases. Potential therapeutic strategies, including the use of NAD<sup>+</sup> precursors, mitophagy inducers, and inhibitors of cellular senescence, has also been discussed.

Also flagged:Ferroptosisirondeathdegenerative diseaseslipidglutathione
Journal Article 2021-08-13 ✓ 1 Snippet Wang X, Wang Y, Li Z, Qin J, Wang P.
In-Text Gene Mentions

Doll et al. (2017) have uncovered acyl-CoA synthetase long-chain family member 4 (ACSL4) as a crucial player in ferroptosis execution. Moreover, the ACSL4 expression is indicative of ferroptosis confirmed by several studies (Doll et al., 2017; Bersuker et al., 2019; Zou et al.,2020a,b). ACSL4 is responsible for the esterification of CoA to long-chain PUFAs, a key step involved in ferroptosis (Doll et al., 2017). Arachidonic acid has been indicated to promote ACSL4 ubiquitination and proteasomal degradation (Kan et al., 2014). Further investigation found that p115, the vesicular trafficking protein, may be involved in regulation of ACSL4 degradation. However, the specific E3 ubiquitin ligases and DUBs for ACSL4 remained to be elucidated (Sen et al., 2020). The oxygenation of PUFAs by ALOX15 has been found involved in ferroptosis execution (Li et al., 2018). Wenzel et al. have discovered that phosphatidylethanolamine-binding protein 1 (PEBP1), a scaffold protein inhibitor of protein kinase cascades, complexes with ALOX15 and changes its substrate competence to generate hydroperoxy-PE to promote ferroptosis (Wenzel et al., 2017).

Show Full Abstract

Ferroptosis is an iron-dependent form of programmed cell death, which plays crucial roles in tumorigenesis, ischemia-reperfusion injury and various human degenerative diseases. Ferroptosis is characterized by aberrant iron and lipid metabolisms. Mechanistically, excess of catalytic iron is capable of triggering lipid peroxidation followed by Fenton reaction to induce ferroptosis. The induction of ferroptosis can be inhibited by sufficient glutathione (GSH) synthesis via system Xc<sup>-</sup> transporter-mediated cystine uptake. Therefore, induction of ferroptosis by inhibition of cystine uptake or dampening of GSH synthesis has been considered as a novel strategy for cancer therapy, while reversal of ferroptotic effect is able to delay progression of diverse disorders, such as cardiopathy, steatohepatitis, and acute kidney injury. The ubiquitin (Ub)-proteasome pathway (UPP) dominates the majority of intracellular protein degradation by coupling Ub molecules to the lysine residues of protein substrate, which is subsequently recognized by the 26S proteasome for degradation. Ubiquitination is crucially involved in a variety of physiological and pathological processes. Modulation of ubiquitination system has been exhibited to be a potential strategy for cancer treatment. Currently, more and more emerged evidence has demonstrated that ubiquitous modification is involved in ferroptosis and dominates the vulnerability to ferroptosis in multiple types of cancer. In this review, we will summarize the current findings of ferroptosis surrounding the viewpoint of ubiquitination regulation. Furthermore, we also highlight the potential effect of ubiquitination modulation on the perspective of ferroptosis-targeted cancer therapy.

Also flagged:PdpnactinGAPDHdedifferentiationBrafpodoplanin
Journal Article 2021-08-13 ✓ 5 Snippets de Winde CM, George SL, Crosas-Molist E, Hari-Gupta Y, Arp AB, Benjamin AC, Millward LJ, Makris S, Carver A, Imperatore V, Martínez VG, Sanz-Moreno V, Acton SE.
In-Text Gene Mentions

Pou3f2

Overall, these data provide evidence that high podoplanin expression is linked with a more dedifferentiated and invasive subset of melanoma, and expression of a key melanoma regulator, Pou3f2/Brn2, is directly sensitive to podoplanin expression.

Podoplanin expression is increased in a subset of dedifferentiated human melanoma, and in vitro is sufficient to upregulate melanoma-associated marker Pou3f2/Brn2.

Transcription of melanocyte-associated markers required for pigmentation, Mlana, and Tyr (Hsiao and Fisher, 2014) are also downregulated in PDPN+ B16F10 mouse melanoma cell line compared to PDPN KO controls, whereas the melanoma-associated genes Mitf and Pou3f2 are upregulated (Figure 5E).

Pou3f2 encodes the transcription factor Brn2, a major regulator of melanoma phenotype switching, and is directly linked with dedifferentiation and acquisition of motility (Pinner et al., 2009; Fane et al., 2019).

Show Full Abstract

Melanoma is an aggressive skin cancer developing from melanocytes, frequently resulting in metastatic disease. Melanoma cells utilize amoeboid migration as mode of local invasion. Amoeboid invasion is characterized by rounded cell morphology and high actomyosin contractility driven by Rho GTPase signalling. Migrastatic drugs targeting actin polymerization and contractility are therefore a promising treatment option for metastatic melanoma. To predict amoeboid invasion and metastatic potential, biomarkers functionally linked to contractility pathways are needed. The glycoprotein podoplanin drives actomyosin contractility in lymphoid fibroblasts and is overexpressed in many cancers. We show that podoplanin enhances amoeboid invasion in melanoma. Podoplanin expression in murine melanoma drives rounded cell morphology, increasing motility, and invasion <i>in vivo</i>. Podoplanin expression is increased in a subset of dedifferentiated human melanoma, and <i>in vitro</i> is sufficient to upregulate melanoma-associated marker <i>Pou3f2</i>/Brn2. Together, our data define podoplanin as a functional biomarker for dedifferentiated invasive melanoma and a promising migrastatic therapeutic target.

Also flagged:Transcription FactorTranscription factor EBTFEBmicrophthalmia-associated transcription factortranscription factor ETFE
Journal Article 2021-08-13 ✓ 1 Snippet Zhu SY, Yao RQ, Li YX, Zhao PY, Ren C, Du XH, Yao YM.
In-Text Gene Mentions

One of the evident pathological features of neurodegenerative diseases is the accumulation of abnormal proteins, such as α-synuclein in Parkinson disease (PD), amyloid β (Aβ) and tau in Alzheimer disease (AD), huntingtin (HTT) in Huntington disease, polyglutamine-expanded androgen receptor (polyQ-AR) in X-linked spinal and bulbar muscular atrophy (SBMA), and mutant superoxide dismutase 1 (SOD1) in amyotrophic lateral sclerosis (ALS).

Show Full Abstract

Transcription factor EB (TFEB) is a member of the microphthalmia-associated transcription factor/transcription factor E (MiTF/TFE) family and critically involved in the maintenance of structural integrity and functional balance of multiple cells. In this review, we described the effects of post-transcriptional modifications, including phosphorylation, acetylation, SUMOylation, and ubiquitination, on the subcellular localization and activation of TFEB. The activated TFEB enters into the nucleus and induces the expressions of targeted genes. We then presented the role of TFEB in the biosynthesis of multiple organelles, completion of lysosome-autophagy pathway, metabolism regulation, immune, and inflammatory responses. This review compiles existing knowledge in the understanding of TFEB regulation and function, covering its essential role in response to cellular stress. We further elaborated the involvement of TFEB dysregulation in the pathophysiological process of various diseases, such as the catabolic hyperactivity in tumors, the accumulation of abnormal aggregates in neurodegenerative diseases, and the aberrant host responses in inflammatory diseases. In this review, multiple drugs have also been introduced, which enable regulating the translocation and activation of TFEB, showing beneficial effects in mitigating various disease models. Therefore, TFEB might serve as a potential therapeutic target for human diseases. The limitation of this review is that the mechanism of TFEB-related human diseases mainly focuses on its association with lysosome and autophagy, which needs deep description of other mechanism in diseases progression after getting more advanced information.

Also flagged:restriction enzymepolyglutaminerestriction enzymesmethylnitronitroguanidine
Journal Article 2021-08-13 ✓ 3 Snippets Williams FN, Wu Y, Scaglione KM.
In-Text Gene Mentions

(A) The Pyr56-mHttQ103-GFP fusion protein is composed of the UMP synthase Pyr56, Htt exon 1 containing a tract of 103 glutamines, and a GFP reporter express by the PTX(act15/pyr56-mHtt-GFP) plasmid.

To develop the PTX(act15/pyr56-mHtt-GFP) plasmid, Htt exon 1 with 103 glutamines (sourced from Addgene plasmid #1385, the pYES2/103Q plasmid deposited by Michael Sherman) was first cloned into pTxGFP using KpnI and XbaI (Levi et al., 2000; Santarriaga et al., 2015).

…act15/pyr56-mHtt-GFP) plasmid,Httexon 1 with…

Show Full Abstract

The cellular slime mold <i>Dictyostelium discoideum</i> is a powerful model organism that can be utilized to investigate human health and disease. One particular strength of <i>Dictyostelium</i> is that it can be utilized for high throughput genetic screens. For many phenotypes, one limitation of utilizing <i>Dictyostelium</i> is that screening can be an arduous and time-consuming process, limiting the genomic depth one can cover. Previously, we utilized a restriction enzyme-mediated integration screen to identify suppressors of polyglutamine aggregation in <i>Dictyostelium</i>. However, due to the time required to perform the screen, we only obtained ∼4% genome coverage. Here we have developed an efficient screening pipeline that couples chemical mutagenesis with the 5-fluoroorotic acid counterselection system to enrich for mutations in genes of interest. Here we describe this new screening methodology and highlight how it can be utilized for other biological systems.

Also flagged:breast cancerglucosecancerlipiddiazolamino
Journal Article 2021-08-13 No Snippets Ha B, Kim TJ, Moon E, Giaccia AJ, Pratx G.
Show Full Abstract

Flow-based cytometry methods are widely used to analyze heterogeneous cell populations. However, their use for small molecule studies remains limited due to bulky fluorescent labels that often interfere with biochemical activity in cells. In contrast, radiotracers require minimal modification of their target molecules and can track biochemical processes with negligible interference and high specificity. Here, we introduce flow radiocytometry (FRCM) that broadens the scope of current cytometry methods to include beta-emitting radiotracers as probes for single cell studies. FRCM uses droplet microfluidics and radiofluorogenesis to translate the radioactivity of single cells into a fluorescent signal that is then read out using a high-throughput optofluidic device. As a proof of concept, we quantitated [<sup>18</sup>F]fluorodeoxyglucose radiotracer uptake in single human breast cancer cells and successfully assessed the metabolic flux of glucose and its heterogeneity at the cellular level. We believe FRCM has potential applications ranging from analytical assays for cancer and other diseases to development of small-molecule drugs.

Also flagged:ABHD6α/β-hydrolase domain containing 6behaviorallocomotionHDneurodegenerative disease
Journal Article 2021-08-13 ✓ 1 Snippet Cao JK, Viray K, Shin M, Hsu KL, Mackie K, Westenbroek R, Stella N.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's Disease is associated with motor behavior deficits that are lessened by few therapeutic options. This preliminary study tested if pharmacological inhibition of α/β-hydrolase domain containing 6 (<b>ABHD6</b>), a multifunctional enzyme expressed in the striatum, rescues behavioral deficits in HdhQ200/200 mice. Previous work has shown that this model exhibits a reduction in spontaneous locomotion and motor coordination at 8 and 10 months of age, with a more severe phenotype in female mice. Semi-quantitative immunohistochemistry analysis indicated no change in striatal ABHD6 expression at 8 months of age, but a 40% reduction by 10 months in female HdhQ200/200 mice compared to female wild-type (<b>WT</b>) littermates. At 8 months of age, acute ABHD6 inhibition rescued motor coordination deficits in female HdhQ200/200 mice without affecting WT performance. ABHD6 inhibition did not impact spontaneous locomotion, grip strength, or overall weight in either group, showing that effects were specific to motor coordination. At 10 months of age, semi-chronic ABHD6 inhibition by osmotic pump delivery also rescued motor coordination deficits in female HdhQ200/200 mice without affecting female WT littermates. Our preliminary study suggests that ABHD6 inhibition improves motor performance in female HdhQ200/200 mice.

Also flagged:antithrombin IIImajor depressive disorderdepression
Journal Article 2021-08-13 ✓ 5 Snippets Song R, Shi Y.
In-Text Gene Mentions

…increased antithrombin III (ATIII) in patients with…

…disorder (MDD), supportingATIIIas a potential…

…the alteration ofATIIIafter occipital repetitive…

…After treatment, decreasedATIIIwere detected in…

…the reduction inATIIIin the individualized…

Show Full Abstract

<h4>Introduction</h4> Previous study has identified increased antithrombin III (ATIII) in patients with major depressive disorder (MDD), supporting ATIII as a potential biomarker for depression diagnosis. <h4>Objectives</h4> This study aimed to reveal the alteration of ATIII after occipital repetitive transcranial magnetic stimulation (rTMS), and illuminate its power to evaluate and predict the curative effects in MDD treatment. <h4>Methods</h4> A total of 90 MDD patients were recruited and further intervened with rTMS in occipital for individualized, standard or sham treatment for five days. Those of 74 patients underwent entire detection, including clinical assessments, blood collection and protein measurement. <h4>Results</h4> After treatment, decreased ATIII were detected in both the individualized and the standard group (p=0.000 and 0.001, respectively) instead of the sham one. Especially, the reduction in ATIII in the individualized group was associated with improvements in several neuropsychological assessments. Besides, ATIII at baseline in the standard group and after the individualized rTMS showed high performance to evaluate or predict the response to the 5-day treatment (AUC=0.771, 95%CI, 0.571-0.971; AUC=0.875, 95%CI, 0.714-1.000, respectively) and the remission in follow-up (AUC=0.736, 95%CI, 0.529-0.943; AUC=0.828, 95%CI, 0.656-1.000, respectively). Furthermore, both baseline ATIII and change in ATIII involved in the prediction of 24-item Hamilton Depression Rating Scale in the follow-up study with significant predictive values (p=0.0240 and 0.0233, respectively). <h4>Conclusions</h4> This study detected a reduction in ATIII after occipital rTMS, further revealed the relationships between change in ATIII and therapeutic response, and ultimately provided evidence for the potential of ATIII as a biomarker for the evaluation and prediction of antidepressive effect. <h4>Disclosure</h4> No significant relationships.

Also flagged:psychopathypersonality disorderAnti-social personality disorderMonoamine Oxidase-AMAO-Achromosome
Journal Article 2021-08-13 ✓ 1 Snippet Lemos M, Queirós T.
In-Text Gene Mentions

…factors involve the5-HTTgene, dopamine receptor…

Show Full Abstract

<h4>Introduction</h4> Psychopathy is a personality disorder characterized by lack of empathy, grandiosity, an impulsive lifestyle and antisociality. Anti-social personality disorder (ASPD) and psychopathy are distinct concepts presenting different criteria. Most people with a diagnosis of psychopathy also meet criteria for ASPD while the reverse is not true. Along the years there has been an increasing interest in investigating genetic and neurobiological factors. <h4>Objectives</h4> To analyze the neurobiological factors involved in psychopathy and anti-social personality disorder according to the scientific knowledge available. <h4>Methods</h4> Review of scientific literature via PubMed search, using the terms “anti-social personality disorder”, “biology or etiology or pathophysiology and psychopathy”. <h4>Results</h4> The strongest evidence base for a genetic pathway is associated with the low-expression variant of the Monoamine Oxidase-A (MAO-A) which is linked to the X chromosome. Other genetic factors involve the 5-HTT gene, dopamine receptor genes (DRD4 and DRD2) and genetic polimorfisms at SNAP25 t-snare protein, OXT gene and the CNR1 and FAAH cannabinoid receptor gene. Structural differences in the brain have been noticed such as reduced gray matter volume in the orbitofrontal cortex, gray matter volume reductions in the mid-anterior insula and left anterior temporal cortex, subtle reductions in gray matter volume across several paralimbic and limbic areas. <h4>Conclusions</h4> There is considerable evidence regarding various possible underlying neurobiological processes in psychopathy although it is insufficient to suggest a single biological etiology and environmental influences cannot be excluded from a complete understanding of this disorder. The neurobiological correlates found hold promise for new research and treatment.

bioRxiv 2021-08-13 Preprint (No Snippets API) Chen D, Ou Z, Zhu J, Ding P, Wang H, Luo L, Ding X, Lan T, Wu W, Yuan Y, Wu W, Qiu J, Zhu Y, Jia Y, Wei Y, Qin Q, Li R, Sun C, Zhao W, Lv Z, Pu M, Yang S, Chang A, Wei X, Chen F, Yang T, Wei Z, Yang F, Li Y, Hua Y, Liu H.
Show Full Abstract

The outbreak of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) issued a significant and urgent threat to global health. The exact animal origin of SARS-CoV-2 remains obscure and understanding its host range is vital for preventing interspecies transmission. Previously, we have assessed the target cell profiles of SARS-CoV-2 in pets, livestock, poultry and wild animals. Herein, we expand this investigation to a wider range of animal species and viruses to provide a comprehensive source for large-scale screening of potential virus hosts. Single cell atlas for several mammalian species (alpaca, hamster, hedgehog, chinchilla etc.), as well as comparative atlas for lung, brain and peripheral blood mononuclear cells (PBMC) for various lineages of animals were constructed, from which we systemically analyzed the virus entry factors for 113 viruses over 20 species from mammalians, birds, reptiles, amphibians and invertebrates. Conserved cellular connectomes and regulomes were also identified, revealing the fundamental cell-cell and gene-gene cross-talks between these species. Overall, our study could help identify the potential host range and tissue tropism of SARS-CoV-2 and a diverse set of viruses and reveal the host-virus co-evolution footprints.

bioRxiv 2021-08-13 Preprint (No Snippets API) Chongtham A, Yoo JH, Chin TM, Akingbesote ND, Huda A, Khoshnan A.
Show Full Abstract

Changes in the composition of gut microbiota are implicated in the pathogenesis of several neurodegenerative disorders. Here, we investigated whether gut bacteria affect the progression of Huntington’s disease (HD) in transgenic Drosophila melanogaster (fruit fly) models expressing human full-length or N-terminal fragments of mutant huntingtin (HTT) protein, here referred to as HD flies. We find that elimination of commensal gut bacteria by antibiotics reduces the aggregation of amyloidogenic N-terminal fragments of HTT and delays the development of motor defects. Conversely, colonization of HD flies with Escherichia coli ( E. coli ), a known pathobiont of human gut with links to neurodegeneration, accelerates HTT aggregation, aggravates immobility and shortens lifespan. Similar to antibiotics, treatment of HD flies with small compounds such as luteolin, a flavone, or crocin a beta-carotenoid, ameliorates disease phenotypes and promotes survival. Crocin prevents colonization of E. coli in the gut and alters the abundance of commensal bacteria, which may be linked to its protective effects. The opposing effects of E. coli and crocin on HTT aggregation, motor defects and survival in transgenic Drosophila models support the involvement of gut-brain networks in the pathogenesis of HD.

Also flagged:thrombophiliaBudapest 3Atresia ofvenous thrombosisidiopathic venous thrombosisantithrombin deficiency
Journal Article 2021-08-12 ✓ 3 Snippets de la Morena-Barrio ME, Gindele R, Bravo-Pérez C, Ilonczai P, Zuazu I, Speker M, Oláh Z, Rodríguez-Sevilla JJ, Entrena L, Infante MS, de la Morena-Barrio B, García JM, Schlammadinger Á, Cifuentes-Riquelme R, Mora-Casado A, Miñano A, Padilla J, Vicente V, Corral J, Bereczky Z.
In-Text Gene Mentions

The identification of IVC atresia in a case with early idiopathic venous thrombosis and antithrombin deficiency caused by the homozygous SERPINC1 c.391C > T variant (p.Leu131Phe; antithrombin Budapest 3) encouraged us to evaluate the role of this severe thrombophilia in this vascular abnormality.

…by the homozygousSERPINC1c.391C > T…

…system atresia withSERPINC1.…

Show Full Abstract

Atresia of inferior vena cava (IVC) is a rare congenital malformation associated with high risk of venous thrombosis that still has unknown etiology, although intrauterine IVC thrombosis has been suggested to be involved. The identification of IVC atresia in a case with early idiopathic venous thrombosis and antithrombin deficiency caused by the homozygous SERPINC1 c.391C > T variant (p.Leu131Phe; antithrombin Budapest 3) encouraged us to evaluate the role of this severe thrombophilia in this vascular abnormality. We have done a cross-sectional study in previously identified cohorts of patients homozygous for the Budapest 3 variant (N = 61) selected from 1118 patients with congenital antithrombin deficiency identified in two different populations: Spain (N = 692) and Hungary (N = 426). Image analysis included computed tomography and phlebography. Atresia of the IVC system was observed in 17/24 cases (70.8%, 95% confidence interval [CI]: 48.9%-87.3%) homozygous for antithrombin Budapest 3 with available computed tomography (5/8 and 12/16 in the Spanish and Hungarian cohorts, respectively), 16 had an absence of infrarenal IVC and one had atresia of the left common iliac vein. All cases with vascular defects had compensatory mechanisms, azygos-hemiazygos continuation or double IVC, and seven also had other congenital anomalies. Short tandem repeat analysis supported the specific association of the IVC system atresia with SERPINC1. We show the first evidence of the association of a severe thrombophilia with IVC system atresia, supporting the possibility that a thrombosis in the developing fetal vessels is the reason for this anomaly. Our hypothesis-generating results encourage further studies to investigate severe thrombophilic states in patients with atresia of IVC.

Also flagged:synthesistumourbindinghydroxyapatitenucleolincancer
Journal Article 2021-08-12 No Snippets Zhang W, Zhou R, Yang Y, Peng S, Xiao D, Kong T, Cai X, Zhu B.
Show Full Abstract

<h4>Objectives</h4>The nano-hydroxyapatite (nHAp) is widely used to develop imaging probes and drug carriers due to its excellent bioactivity and biocompatibility. However, traditional methods usually need cumbersome and stringent conditions such as high temperature and post-modification to prepare the functionalized nHAp, which do not benefit the particles to enter cells due to the increased particle size. Herein, a biomimetic synthesis strategy was explored to achieve the AS1411-targeted tumour dual-model bioimaging using DNA aptamer AS1411 as a template. Then, the imaging properties and the biocompatibility of the synthesized AS-nFAp:Gd/Tb were further investigated.<h4>Materials and methods</h4>The AS-nFAp:Gd/Tb was prepared under mild conditions through a one-pot procedure with AS1411 as a template. Besides, the anticancer drug DOX was loaded to AS-nFAp:Gd/Tb so as to achieve the establishment of a multifunctional nano-probe that integrated the tumour diagnosis and treatment. The AS-nFAp:Gd/Tb was characterized by transmission electron microscopy (TEM), energy disperse X-ray Spectroscopy (EDS) mapping, X-ray photoelectron spectroscopy (XPS) spectrum, X-ray diffraction (XRD), fourier-transformed infrared (FTIR) spectroscopy, capillary electrophoresis analyses, zeta potential and particle sizes. The in vitro magnetic resonance imaging (MRI) and fluorescence imaging were performed on an MRI system and a confocal laser scanning microscope, respectively. The potential of the prepared multifunctional nHAp for a targeted tumour therapy was investigated by a CCK-8 kit. And the animal experiments were conducted on the basis of the guidelines approved by the Animal Care and Use Committee of Sichuan University, China.<h4>Results</h4>In the presence of AS1411, the as-prepared AS-nFAp:Gd/Tb presented a needle-like morphology with good monodispersity and improved imaging performance. Furthermore, due to the specific binding between AS1411 and nucleolin up-expressed in cancer cells, the AS-nFAp:Gd/Tb possessed excellent AS1411-targeted fluorescence and MRI imaging properties. Moreover, after loading chemotherapy drug DOX, in vitro and in vivo studies showed that DOX@AS-nFAp:Gd/Tb could effectively deliver DOX to tumour tissues and exert a highly effective tumour inhibition without systemic toxicity compared with pure DOX.<h4>Conclusions</h4>The results indicated that the prepared multifunctional nHAp synthesized by a novel biomimetic strategy had outstanding capabilities of recognition and treatment for the tumour and had good biocompatibility; hence, it might have a potential clinical application in the future.

Also flagged:cleft palatemajor histocompatibility complex class 1cleft lipchromosomeASB18ANKEF1
Journal Article 2021-08-12 No Snippets Gowans LJJ, Comnick CL, Mossey PA, Eshete MA, Adeyemo WL, Naicker T, Awotoye WA, Petrin A, Adeleke C, Donkor P, Busch TD, James O, Ogunlewe MO, Li M, Olotu J, Hassan M, Adeniyan OA, Obiri-Yeboah S, Arthur FKN, Agbenorku P, Oti AA, Olatosi O, Adamson OO, Fashina AA, Zeng E, Marazita ML, Adeyemo AA, Murray JC, Butali A.
Show Full Abstract

<h4>Objective</h4>Nonsyndromic cleft lip and/or cleft palate (NSCL/P) have multifactorial etiology where genetic factors, gene-environment interactions, stochastic factors, gene-gene interactions, and parent-of-origin effects (POEs) play cardinal roles. POEs arise when the parental origin of alleles differentially impacts the phenotype of the offspring. The aim of this study was to identify POEs that can increase risk for NSCL/P in humans using a genome-wide dataset.<h4>Methods</h4>The samples (174 case-parent trios from Ghana, Ethiopia, and Nigeria) included in this study were from the African only genome wide association studies (GWAS) that was published in 2019. Genotyping of individual DNA using over 2 million multiethnic and African ancestry-specific single-nucleotide polymorphisms from the Illumina Multi-Ethnic Genotyping Array v2 15070954 A2 (genome build GRCh37/hg19) was done at the Center for Inherited Diseases Research. After quality control checks, PLINK was employed to carry out POE analysis employing the pooled subphenotypes of NSCL/P.<h4>Results</h4>We observed possible hints of POEs at a cluster of genes at a 1 mega base pair window at the major histocompatibility complex class 1 locus on chromosome 6, as well as at other loci encompassing candidate genes such as <i>ASB18</i>, <i>ANKEF1</i>, <i>AGAP1</i>, <i>GABRD</i>, <i>HHAT</i>, <i>CCT7</i>, <i>DNMT3A</i>, <i>EPHA7</i>, <i>FOXO3</i>, lncRNAs, microRNA, antisense RNAs, <i>ZNRD1</i>, <i>ZFAT</i>, and <i>ZBTB16</i>.<h4>Conclusion</h4>Findings from our study suggest that some loci may increase the risk for NSCL/P through POEs. Additional studies are required to confirm these suggestive loci in NSCL/P etiology.

Also flagged:TRIM44SQSTM1p62ubiquitinproteasomemacroautophagy
Journal Article 2021-08-12 ✓ 5 Snippets Lyu L, Chen Z, McCarty N.
In-Text Gene Mentions

Abbreviations: 3-MA: 3-methyladenine; ACTB: actin beta; ATG5: autophagy related 5; BB: B-box domain; BECN1: beclin1; BM: bone marrow; CC: coiled-coil domain; CFTR: cystic fibrosis transmembrane conductance regulator; CON: control; CQ: chloroquine; DOX: doxycycline; DSP: dithiobis(succinimidly propionate); ER: endoplasmic reticulum; FI: fluorescence intensity; FL: full length; HIF1A/HIF-1#x3B1;: hypoxia inducible factor 1 subunit alpha; HSC: hematopoietic stem cells; HTT: huntingtin; KD: knockdown; KD-CON: knockdown construct control; MM: multiple myeloma; MTOR: mechanistic target of rapamycin kinase; NP-40: nonidet P-40; NFE2L2/NRF2: nuclear factor, erythroid 2 like 2; OE: overexpression; OE-CON: overexpression construct control; PARP: poly (ADP-ribose) polymerase; SDS: sodium dodecyl sulfate; SQSTM1/p62: sequestosome 1; Tet-on: tetracycline; TRIM44: tripartite motif containing 44; UPS: ubiquitin-proteasome system; ZF: zinc-finger

Protein aggregates were induced in A549 adenocarcinoma, HeLa and N2A neuroblastoma cells using CFTRΔF508, MAPT/TauP301L and HTT (huntingtin) Q94 plasmids, respectively.

…Moreover, MAPT andHTTappear to be…

…target MAPT andHTTfor degradation […

…TRIM44-mediated MAPT andHTTaggregates clearance could…

Show Full Abstract

Until recently, the ubiquitin-proteasome system (UPS) and macroautophagy/autophagy were considered to be two independent systems that target proteins for degradation by proteasomes or via lysosomes, respectively. Here, we report that TRIM44 (tripartite motif containing 44) is a novel link that connects the UPS system with the autophagy degradation pathway. Suppressing the UPS degradation pathway leads to TRIM44 upregulation, which further promotes aggregated protein clearance through the binding of K48 ubiquitin chains on proteins. TRIM44 expression activates autophagy via promoting SQSTM1/p62 oligomerization, which rapidly increases the rate of aggregate protein removal. Overall, our data reveal that TRIM44 is a newly identified link between the UPS system and the autophagy pathway. Delineating the cross-talk between these two degradation pathways may reveal new mechanisms of targeting aggregate-prone diseases, such as cancer and neurodegenerative disease.<b>Abbreviations</b>: 3-MA: 3-methyladenine; ACTB: actin beta; ATG5: autophagy related 5; BB: B-box domain; BECN1: beclin1; BM: bone marrow; CC: coiled-coil domain; CFTR: cystic fibrosis transmembrane conductance regulator; CON: control; CQ: chloroquine; DOX: doxycycline; DSP: dithiobis(succinimidly propionate); ER: endoplasmic reticulum; FI: fluorescence intensity; FL: full length; HIF1A/HIF-1#x3B1;: hypoxia inducible factor 1 subunit alpha; HSC: hematopoietic stem cells; HTT: huntingtin; KD: knockdown; KD-CON: knockdown construct control; MM: multiple myeloma; MTOR: mechanistic target of rapamycin kinase; NP-40: nonidet P-40; NFE2L2/NRF2: nuclear factor, erythroid 2 like 2; OE: overexpression; OE-CON: overexpression construct control; PARP: poly (ADP-ribose) polymerase; SDS: sodium dodecyl sulfate; SQSTM1/p62: sequestosome 1; Tet-on: tetracycline; TRIM44: tripartite motif containing 44; UPS: ubiquitin-proteasome system; ZF: zinc-finger.

Also flagged:AMPKULK1PIKFYVEautophagosomesglucosemacroautophagy
Journal Article 2021-08-12 No Snippets Karabiyik C, Rubinsztein DC.
Show Full Abstract

The induction of macroautophagy/autophagy upon glucose deprivation can occur independently of the PIK3C3/VPS34 complex. Recently, we described a non-canonical signaling pathway involving the kinases AMPK, ULK1 and PIKFYVE that are induced during glucose starvation, leading to the formation of PtdIns5P-containing autophagosomes, resulting in increased autophagy flux and clearance of autophagy substrates. In this cascade, the activation of AMPK leads to ULK1 phosphorylation. ULK1 then phosphorylates PIKFYVE at S1548, leading to its activation and increased PtdIns5P formation, which enables the recruitment of machinery required for autophagosome biogenesis.

Also flagged:Dyskinesiaofgene expressionmethylationneurological diseasesneurodegenerative diseases
Journal Article 2021-08-12 No Snippets Qi Z, Li J, Li M, Du X, Zhang L, Wang S, Xu B, Liu W, Xu Z, Deng Y.
Show Full Abstract

Epigenetics play an essential role in the occurrence and improvement of many diseases. Evidence shows that epigenetic modifications are crucial to the regulation of gene expression. DNA methylation is closely linked to embryonic development in mammalian. In recent years, epigenetic drugs have shown unexpected therapeutic effects on neurological diseases, leading to the study of the epigenetic mechanism in neurodegenerative diseases. Unlike genetics, epigenetics modify the genome without changing the DNA sequence. Research shows that epigenetics is involved in all aspects of neurodegenerative diseases. The study of epigenetic will provide valuable insights into the molecular mechanism of neurodegenerative diseases, which may lead to new treatments and diagnoses. This article reviews the role of epigenetic modifications neurodegenerative diseases with dyskinesia, and discusses the therapeutic potential of epigenetic drugs in neurodegenerative diseases.

Also flagged:ABCD1bioluminescenceX-linked adrenoleukodystrophyX-ALDorganelleALDH3A2
Journal Article 2021-08-12 ✓ 1 Snippet Lotz-Havla AS, Woidy M, Guder P, Friedel CC, Klingbeil JM, Bulau AM, Schultze A, Dahmen I, Noll-Puchta H, Kemp S, Erdmann R, Zimmer R, Muntau AC, Gersting SW.
In-Text Gene Mentions

…(with ALDH3A2, DAO,ECI2, FAR1, PEX10, PEX13,…

Show Full Abstract

Mapping the network of proteins provides a powerful means to investigate the function of disease genes and to unravel the molecular basis of phenotypes. We present an automated informatics-aided and bioluminescence resonance energy transfer-based approach (iBRET) enabling high-confidence detection of protein-protein interactions in living mammalian cells. A screen of the ABCD1 protein, which is affected in X-linked adrenoleukodystrophy (X-ALD), against an organelle library of peroxisomal proteins demonstrated applicability of iBRET for large-scale experiments. We identified novel protein-protein interactions for ABCD1 (with ALDH3A2, DAO, ECI2, FAR1, PEX10, PEX13, PEX5, PXMP2, and PIPOX), mapped its position within the peroxisomal protein-protein interaction network, and determined that pathogenic missense variants in <i>ABCD1</i> alter the interaction with selected binding partners. These findings provide mechanistic insights into pathophysiology of X-ALD and may foster the identification of new disease modifiers.

Also flagged:methylationchronic diseasesnon-communicable diseasesalcoholmethylcytosine
Journal Article 2021-08-12 No Snippets Fujii R, Sato S, Tsuboi Y, Cardenas A, Suzuki K.
Show Full Abstract

DNA methylation (DNAm) is one of the most studied epigenetic modifications. DNAm has emerged as a key biological mechanism and biomarkers to test associations between environmental exposure and outcomes in epidemiological studies. Although previous studies have focused on associations between DNAm and either exposure/outcomes, it is useful to test for mediation of the association between exposure and outcome by DNAm. The purpose of this scoping review is to introduce the methodological essence of statistical mediation analysis and to examine emerging epidemiological research applying mediation analyses. We conducted this scoping review for published peer-reviewed journals on this topic using online databases (PubMed, Scopus, Cochrane, and CINAHL) ending in December 2020. We extracted a total of 219 articles by initial screening. After reviewing titles, abstracts, and full texts, a total of 69 articles were eligible for this review. The breakdown of studies assigned to each category was 13 for smoking (18.8%), 8 for dietary intake and famine (11.6%), 6 for other lifestyle factors (8.7%), 8 for clinical endpoints (11.6%), 22 for environmental chemical exposures (31.9%), 2 for socioeconomic status (SES) (2.9%), and 10 for genetic factors and race (14.5%). In this review, we provide an exposure-wide summary for the mediation analysis using DNAm levels. However, we found heterogenous methods and interpretations in mediation analysis with typical issues such as different cell compositions and tissue-specificity. Further accumulation of evidence with diverse exposures, populations and with rigorous methodology will be expected to provide further insight in the role of DNAm in disease susceptibility.

Also flagged:posttranslational modificationsADtaumembranelipidmetabolism
Journal Article 2021-08-12 No Snippets Bai B, Vanderwall D, Li Y, Wang X, Poudel S, Wang H, Dey KK, Chen PC, Yang K, Peng J.
Show Full Abstract

Mass spectrometry-based proteomics empowers deep profiling of proteome and protein posttranslational modifications (PTMs) in Alzheimer's disease (AD). Here we review the advances and limitations in historic and recent AD proteomic research. Complementary to genetic mapping, proteomic studies not only validate canonical amyloid and tau pathways, but also uncover novel components in broad protein networks, such as RNA splicing, development, immunity, membrane transport, lipid metabolism, synaptic function, and mitochondrial activity. Meta-analysis of seven deep datasets reveals 2,698 differentially expressed (DE) proteins in the landscape of AD brain proteome (n = 12,017 proteins/genes), covering 35 reported AD genes and risk loci. The DE proteins contain cellular markers enriched in neurons, microglia, astrocytes, oligodendrocytes, and epithelial cells, supporting the involvement of diverse cell types in AD pathology. We discuss the hypothesized protective or detrimental roles of selected DE proteins, emphasizing top proteins in "amyloidome" (all biomolecules in amyloid plaques) and disease progression. Comprehensive PTM analysis represents another layer of molecular events in AD. In particular, tau PTMs are correlated with disease stages and indicate the heterogeneity of individual AD patients. Moreover, the unprecedented proteomic coverage of biofluids, such as cerebrospinal fluid and serum, procures novel putative AD biomarkers through meta-analysis. Thus, proteomics-driven systems biology presents a new frontier to link genotype, proteotype, and phenotype, accelerating the development of improved AD models and treatment strategies.

Also flagged:runanxietyissSymptom Clustersfithow
Journal Article 2021-08-12 No Snippets Currow DC, Chang S, Ferreira D, Eckert DJ, Gonzalez-Chica D, Stocks N, Ekström MP.
Show Full Abstract

<h4>Objectives</h4>This study aimed to explore the relationship (presence and severity) between chronic breathlessness and sleep problems, independently of diagnoses and health service contact by surveying a large, representative sample of the general population.<h4>Setting</h4>Analysis of the 2017 South Australian Health Omnibus Survey, an annual, cross-sectional, face-to-face, multistage, clustered area systematic sampling survey carried out in Spring 2017.Chronic breathlessness was self-reported using the ordinal modified Medical Research Council (mMRC; scores 0 (none) to 4 (housebound)) where breathlessness has been present for more than 3 of the previous 6 months. 'Sleep problems-ever' and 'sleep problem-current' were assessed dichotomously. Regression models were adjusted for age; sex and body mass index (BMI).<h4>Results</h4>2900 responses were available (mean age 48.2 years (SD=18.6); 51% were female; mean BMI 27. 1 (SD=5.9)). Prevalence was: 2.7% (n=78) sleep problems-past; 6.8% (n=198) sleep problems-current and breathlessness (mMRC 1-4) was 8.8% (n=254). Respondents with sleep problemspast were more likely to be breathless, older with a higher BMI and sleep problems-present also included a higher likelihood of being female.After adjusting for age, sex and BMI, respondents with chronic breathlessness had 1.9 (95% CI=1.0 to 3.5) times the odds of sleep problems-past and sleep problems-current (adjusted OR=2.3; 95% CI=1.6 to 3.3).<h4>Conclusions</h4>There is a strong association between the two prevalent conditions. Future work will seek to understand if there is a causal relationship using validated sleep assessment tools and whether better managing one condition improves the other.

Also flagged:methylationhead and neck cancervalproic acidhistonestumorhead and neck squamous cell carcinoma
Journal Article 2021-08-12 ✓ 5 Snippets Gama RR, Arantes LMRB, Sorroche BP, De Marchi P, Melendez ME, Carvalho RS, de Lima MA, Vettore AL, Carvalho AL.
In-Text Gene Mentions

Although patients without neoplasia were selected, aberrant methylation of the CCNA1, DAPK, DCC and MGMT genes was present in the pretreatment oral rinse samples in all participants of both groups, an epigenetic event that is the target of action of valproic acid.

In the present study, the finding of a change in the methylation pattern of the DCC gene and the tendency of valproic acid to demethylate most of the selected genes and to acetylate H3 histones may enable the realization of new clinical trials for which the outcome is survival and the incidence of second primary tumors for chemopreventive purposes.

In this study, the methylation status of CCNA1, CDKN2A, DAPK, DCC and MGMT was evaluated to verify whether their methylation profile was altered when patients were treated with valproic acid.

These reports aligned with the results of the current study suggest that DCC is a tumor suppressor gene that is epigenetically inactivated by hypermethylation of its promoter region in most patients with HNSCC and that its methylation signal could be reversed by the action of drugs with epigenetic action, such as valproic acid.

Rettori et al.20 observed persistent hypermethylation of the DCC gene in the oral rinse collected at two posttreatment sessions and hypothesized that perhaps this hypermethylated state in the follow-up was related to physiological changes, such as chronic inflammation, widely dispersed in the mucosa of the upper aerodigestive tract in the population of patients with a history of HNSCC, in line with the theory of field cancerization25.

Show Full Abstract

Evaluate the biological action of valproic acid in the acetylation of histones and in the methylation of tumor suppressor genes via oral rinse in patients with a previous history of head and neck squamous cell carcinoma (HNSCC). Forty-two active or former smokers were included in this randomized, double-blind, placebo-controlled trial. Oral rinse samples were collected prior to treatment with valproic acid or placebo and after 90 days of treatment. The methylation status of five tumor suppressor genes and histone acetylation were evaluated by pyrosequencing and ELISA techniques, respectively. Differences between the 90-day and baseline oral rinse acetylation and methylation results were analyzed by comparing groups. Thirty-four patients were considered for analysis. The mean percentage adherence in the valproic and placebo groups was 93.4 and 93.0, respectively (p = 0.718). There was no statistically significant difference between groups when comparing the medians of the histone acetylation ratio and the methylation ratio for most of the studied genes. A significant reduction in the DCC methylation pattern was observed in the valproic group (p = 0.023). The use of valproic acid was safe and accompanied by good therapeutic adherence. DCC methylation was lower in the valproic acid group than in the placebo group.

Also flagged:coronary artery diseaseDUSP13KCNJ11CD300LFRAB37SLCO1B1
Journal Article 2021-08-12 ✓ 1 Snippet Hariharan P, Dupuis J.
In-Text Gene Mentions

…ZC3HC1, LPL, LIPA,CCDC92, KIAA1462, LOX, ARHGEF26,…

Show Full Abstract

Coronary artery disease (CAD) genome-wide association studies typically focus on single nucleotide variants (SNVs), and many potentially associated SNVs fail to reach the GWAS significance threshold. We performed gene and pathway-based association (GBA) tests on publicly available Coronary ARtery DIsease Genome wide Replication and Meta-analysis consortium Exome (n = 120,575) and multi ancestry pan UK Biobank study (n = 442,574) summary data using versatile gene-based association study (VEGAS2) and Multi-marker analysis of genomic annotation (MAGMA) to identify novel genes and pathways associated with CAD. We included only exonic SNVs and excluded regulatory regions. VEGAS2 and MAGMA ranked genes and pathways based on aggregated SNV test statistics. We used Bonferroni corrected gene and pathway significance threshold at 3.0 × 10<sup>-6</sup> and 1.0 × 10<sup>-5</sup>, respectively. We also report the top one percent of ranked genes and pathways. We identified 17 top enriched genes with four genes (PCSK9, FAM177, LPL, ARGEF26), reaching statistical significance (p ≤ 3.0 × 10<sup>-6</sup>) using both GBA tests in two GWAS studies. In addition, our analyses identified ten genes (DUSP13, KCNJ11, CD300LF/RAB37, SLCO1B1, LRRFIP1, QSER1, UBR2, MOB3C, MST1R, and ABCC8) with previously unreported associations with CAD, although none of the single SNV associations within the genes were genome-wide significant. Among the top 1% non-lipid pathways, we detected pathways regulating coagulation, inflammation, neuronal aging, and wound healing.

Also flagged:Huntington diseaseHDneurodegenerative disorderpolyglutaminepost-translational modificationspathogenesis
Journal Article 2021-08-12 ✓ 5 Snippets Lemarié FL, Caron NS, Sanders SS, Schmidt ME, Nguyen YTN, Ko S, Xu X, Pouladi MA, Martin DDO, Hayden MR.
In-Text Gene Mentions

…expansion in theHTTgene that codes…

…in the huntingtin (HTT) protein.…

HTTis subject to…

…sites within mutantHTT(mHTT) in HD…

…key role ofHTTPTMs in the…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG expansion in the HTT gene that codes for an elongated polyglutamine tract in the huntingtin (HTT) protein. HTT is subject to multiple post-translational modifications (PTMs) that regulate its cellular function. Mutating specific PTM sites within mutant HTT (mHTT) in HD mouse models can modulate disease phenotypes, highlighting the key role of HTT PTMs in the pathogenesis of HD. These findings have led to increased interest in developing small molecules to modulate HTT PTMs in order to decrease mHTT toxicity. However, the therapeutic efficacy of pharmacological modulation of HTT PTMs in preclinical HD models remains largely unknown. HTT is palmitoylated at cysteine 214 by the huntingtin-interacting protein 14 (HIP14 or ZDHHC17) and 14-like (HIP14L or ZDHHC13) acyltransferases. Here, we assessed if HTT palmitoylation should be regarded as a therapeutic target to treat HD by (1) investigating palmitoylation dysregulation in rodent and human HD model systems, (2) measuring the impact of mHTT-lowering therapy on brain palmitoylation, and (3) evaluating if HTT palmitoylation can be pharmacologically modulated. We show that palmitoylation of mHTT and some HIP14/HIP14L-substrates is decreased early in multiple HD mouse models, and that mHTT palmitoylation decreases further with aging. Lowering mHTT in the brain of YAC128 mice is not sufficient to rescue aberrant palmitoylation. However, we demonstrate that mHTT palmitoylation can be normalized in COS-7 cells, in YAC128 cortico-striatal primary neurons and HD patient-derived lymphoblasts using an acyl-protein thioesterase (APT) inhibitor. Moreover, we show that modulating palmitoylation reduces mHTT aggregation and mHTT-induced cytotoxicity in COS-7 cells and YAC128 neurons.

Also flagged:HAP40Huntington diseasehuntingtin-associated protein 40HD
Journal Article 2021-08-12 ✓ 5 Snippets Huang B, Seefelder M, Buck E, Engler T, Lindenberg KS, Klein F, Landwehrmeyer GB, Kochanek S.
In-Text Gene Mentions

…interactor of huntingtin (HTT).…

…the interaction withHTTresulting in an…

…when bound toHTT.…

…with decreased solubleHTTlevels in these…

…of coevolution betweenHTTand HAP40 and…

Show Full Abstract

The huntingtin-associated protein 40 (HAP40) is an abundant interactor of huntingtin (HTT). In complexes of these proteins, HAP40 tightly binds to HTT in a cleft formed by two larger domains rich in HEAT repeats, and a smaller bridge domain connecting the two. We show that HAP40 steady-state protein levels are directly dependent on HTT (both normal and mutant HTT) and that HAP40 is strongly stabilized by the interaction with HTT resulting in an at least 5-fold increase in HAP40's half-life when bound to HTT. Cellular HAP40 protein levels were reduced in primary fibroblasts and lymphoblasts of Huntington Disease (HD) patients and in brain tissue of a full-length HTT mouse model of HD, concomitant with decreased soluble HTT levels in these cell types. This data and our previous demonstration of coevolution between HTT and HAP40 and evolutionary conservation of their interaction suggest that HAP40 is an obligate interaction partner of HTT. Our observation of reduced HAP40 levels in HD invites further studies, whether HAP40 loss-of-function contributes to the pathophysiology of HD.

Also flagged:iron overload disorderHHHemochromatosis Type 2Ferroportin DiseaseHereditary hemochromatosisIron
Journal Article 2021-08-12 ✓ 5 Snippets Kowdley DS, Kowdley KV.
In-Text Gene Mentions

Type 2A hereditary hemochromatosis is caused by mutations in HJV, located on chromosome 1q which encodes hemojuvelin (HJV), which is expressed in the same tissues as hepcidin.48 The median age of presentation for Type 2A is 25 years, and while Type 1 hemochromatosis shows a male predominance, HH Type 2A affects sexes equally.2 Type 2A HH has a distinct set of clinical symptoms compared to Type 1 HH, and characteristically includes iron overload, hypogonadotropic hypogonadism, diabetes and most significantly, cardiomyopathy.49 Type 2A HH may also result in amenorrhea in women, further increasing body iron stores.50 If untreated, cardiomyopathy is a frequent cause of death among JH probands.51,52 Based on family members of one lineage, it was suggested that clinical penetrance of HJV mutations is higher than mutations in HFE. 50 The earliest age at which patients present with symptoms of iron overload associated with HJV mutations was age 4 in an African American patient with the homozygous nonsense mutation p.R54X.53

The first form of Type 4B HH was discovered by RFLP analysis of Thai and Vietnamese patients by an autosomal dominant mutation p.C326Y creating a resistant FPN with no effect on protein localization.79 The cysteine residue at position 326 is involved in a disulfide interaction between hepcidin and FPN, and any change in the cysteine at position 326 of FPN results in minimal hepcidin internalization.80,81 An Australian proband with cirrhosis and parenchymal iron overload onset was identified with relatively early onset of disease at 32 years old, with a change in the asparagine residue to aspartic acid at position 144.82 A splice mutation in SLC40A1 was detected by PCR analysis of HFE, HJV, HAMP, TFR2 compared against a cDNA library in a middle-aged Chinese woman with unexplained iron overload.83

The most frequent form of hereditary hemochromatosis is one of the most common genetic disorders among Caucasians, with a homozygote frequency of approximately 1 in 250 individuals of Northern European descent.9,10 Type 1 or classical hereditary hemochromatosis, is due to mutations in HFE, the gene encoding the HFE protein.11 Patients with HFE-associated HH may be asymptomatic; chronic fatigue and arthropathy may be early signs.3 The most common HFE mutation is a guanine to alanine substitution at position 845 of the HFE gene, resulting in a cysteine to tyrosine change (p.C282Y).11 This mutation is inherited in an autosomal recessive pattern, and p.C282Y heterozygotes generally do not express the hemochromatosis phenotype.12 Clinical penetrance of p.C282Y hereditary hemochromatosis may be as low as 2%, and is influenced by other factors leading to iron overload such as excess alcohol intake or chronic hepatitis C13.

Clinical features of HAMP hemochromatosis are similar to those of Type 2A HH.13HAMP mutations are relatively rare and heterozygosity in HAMP can be observed as a modifier of the p.C282Y HFE phenotype.59 Microsatellite analysis of chromosome 19q13 in two individuals of Italian and Greek descent with juvenile hemochromatosis (JH) but with no HJV mutations revealed two HAMP mutations: a frameshift mutation resulting from a guanine deletion at position 3 of HAMP (93delG) and a cytosine to guanine transversion resulting in a nonsense mutation (p.R56X).60 This led HAMP-associated HH to be classified as a subtype of JH.

A homozygous deletion in exon 16 of TFR2 resulting in deletion of amino acids 594–597 was found in a proband of Northern Italian descent with known iron overload, and intrafamilial haplotyping of affected siblings detected early-onset HH phenotype.69 Three potential mutations of TFR2 were proposed in a Scottish man in 2006, including p.R396X, and p.G792R, but could not be directly attributed to the observed HH phenotype.70 Despite the relative rarity of HH in Asian populations, WES of TFR2 in a Taiwanese woman found a mutation of guanosine to adenosine in exon 11 (p.R481H) resulting in extreme iron overload and diabetes mellitus.71 The first described change in TFR2 mRNA levels was a splice site mutation resulting in skipping of exon 4 in TFR2 reported in a woman of Southern Italian descent.73 In a study of four unrelated Spanish patients with HH symptoms and no mutations in HFE, HJV, HAMP and SLC40A1, homozygous mutations in TFR2 were discovered, including a missense mutation p.G792R, and nonsense mutations p.Q306X and p.Q672X.68

Show Full Abstract

Hereditary hemochromatosis (HH) is an inherited iron overload disorder due to a deficiency of hepcidin, or a failure of hepcidin to degrade ferroportin. The most common form of HH, Type 1 HH, is most commonly due to a homozygous C282Y mutation in HFE and is relatively well understood in significance and action; however, other rare forms of HH (Types 2-4) exist and are more difficult to identify and diagnose in clinical practice. In this review, we describe the clinical characteristics of HH Type 2-4 and the mutation patterns that have been described in these conditions. We also review the different methods for genetic testing available in clinical practice and a pragmatic approach to the patient with suspected non-HFE HH.

Also flagged:Bone CancercancertumorsarcomasBone sarcomasosteosarcoma
Journal Article 2021-08-12 No Snippets Fischetti T, Di Pompo G, Baldini N, Avnet S, Graziani G.
Show Full Abstract

Bone cancer, both primary and metastatic, is characterized by a low survival rate. Currently, available models lack in mimicking the complexity of bone, of cancer, and of their microenvironment, leading to poor predictivity. Three-dimensional technologies can help address this need, by developing predictive models that can recapitulate the conditions for cancer development and progression. Among the existing tools to obtain suitable 3D models of bone cancer, 3D printing and bioprinting appear very promising, as they enable combining cells, biomolecules, and biomaterials into organized and complex structures that can reproduce the main characteristic of bone. The challenge is to recapitulate a bone-like microenvironment for analysis of stromal-cancer cell interactions and biological mechanics leading to tumor progression. In this review, existing approaches to obtain in vitro 3D-printed and -bioprinted bone models are discussed, with a focus on the role of biomaterials selection in determining the behavior of the models and its degree of customization. To obtain a reliable 3D bone model, the evaluation of different polymeric matrices and the inclusion of ceramic fillers is of paramount importance, as they help reproduce the behavior of both normal and cancer cells in the bone microenvironment. Open challenges and future perspectives are discussed to solve existing shortcomings and to pave the way for potential development strategies.

Also flagged:primary progressive aphasiashort-termdementia syndromesshort-term memoryADlv-
Journal Article 2021-08-12 ✓ 2 Snippets Foxe D, Cheung SC, Cordato NJ, Burrell JR, Ahmed RM, Taylor-Rubin C, Irish M, Piguet O.
In-Text Gene Mentions

…67/100 on theACE-IIIwhich was well…

…68/100 on theACE-III, which was well…

Show Full Abstract

Impaired verbal 'phonological' short-term memory is considered a cardinal feature of the logopenic variant of primary progressive aphasia (lv-PPA) and is assumed to underpin most of the language deficits in this syndrome. Clinically, examination of verbal short-term memory in individuals presenting with PPA is common practice and serves two objectives: (i) to help understand the possible mechanisms underlying the patient's language profile and (ii) to help differentiate lv-PPA from other PPA variants or from other dementia syndromes. Distinction between lv-PPA and the non-fluent variant of PPA (nfv-PPA), however, can be especially challenging due to overlapping language profiles and comparable psychometric performances on verbal short-term memory tests. Here, we present case vignettes of the three PPA variants (lv-PPA, nfv-PPA, and the semantic variant (sv-PPA)) and typical Alzheimer's disease (AD). These vignettes provide a detailed description of the short-term and working memory profiles typically found in these patients and highlight how speech output and language comprehension deficits across the PPA variants differentially interfere with verbal memory performance. We demonstrate that a combination of verbal short-term and working memory measures provides crucial information regarding the cognitive mechanisms underlying language disturbances in PPA. In addition, we propose that analogous visuospatial span tasks are essential for the assessment of PPA as they measure memory capacity without language contamination.

Also flagged:COVID-19neovascular age-related macular degenerationNeovascular AMDNeovascular age related macular degenerationchoroidal neovascularizationVEGF
Journal Article 2021-08-12 ✓ 1 Snippet Valverde-Megías A, Rego-Lorca D, Fernández-Vigo JI, Murciano-Cespedosa A, Megías-Fresno A, García-Feijoo J.
In-Text Gene Mentions

…known as aneurysmaltype 1 neovascularization1 neovascularization).…

Show Full Abstract

This is a retrospective single-center study of patients with neovascular age-related macular degeneration whose follow-up was delayed due to COVID-19 pandemic with at least three months between visits in Madrid, Spain. The purpose of the study was to evaluate best corrected visual acuity (BCVA) changes and try to identify features in optical coherence tomography (OCT) that could be related to more profound visual loss. It included 270 eyes. The two last visits before lockdown were used for comparison with the visit after lockdown. BCVA changed from 60.2 ± 18.2 to 55.9 ± 20.5 ETDRS letters. 29% of the eyes lost more than 5 letters. OCT was active in 67% of eyes before lockdown and in 80.4% after lockdown. Multiple lineal analysis showed that patients whose OCT before lockdown presented with a combination of intra and subretinal fluid were more likely to suffer a greater visual loss (<i>p</i> = 0.002). These patients should be encouraged to not miss any visits in case a new lockdown is imposed.

Also flagged:CholangiocarcinomaCCcancertumorstranslationalgastrointestinal cancers
Journal Article 2021-08-12 No Snippets Maier CF, Zhu L, Nanduri LK, Kühn D, Kochall S, Thepkaysone ML, William D, Grützmann K, Klink B, Betge J, Weitz J, Rahbari NN, Reißfelder C, Schölch S.
Show Full Abstract

Cholangiocarcinoma (CC) is an aggressive malignancy with an inferior prognosis due to limited systemic treatment options. As preclinical models such as CC cell lines are extremely rare, this manuscript reports a protocol of cholangiocarcinoma patient-derived organoid culture as well as a protocol for the transition of 3D organoid lines to 2D cell lines. Tissue samples of non-cancer bile duct and cholangiocarcinoma were obtained during surgical resection. Organoid lines were generated following a standardized protocol. 2D cell lines were generated from established organoid lines following a novel protocol. Subcutaneous and orthotopic patient-derived xenografts were generated from CC organoid lines, histologically examined, and treated using standard CC protocols. Therapeutic responses of organoids and 2D cell lines were examined using standard CC agents. Next-generation exome and RNA sequencing was performed on primary tumors and CC organoid lines. Patient-derived organoids closely recapitulated the original features of the primary tumors on multiple levels. Treatment experiments demonstrated that patient-derived organoids of cholangiocarcinoma and organoid-derived xenografts can be used for the evaluation of novel treatments and may therefore be used in personalized oncology approaches. In summary, this study establishes cholangiocarcinoma organoids and organoid-derived cell lines, thus expanding translational research resources of cholangiocarcinoma.

Also flagged:exocytosisNPFactinprofilinsCancerRARα
Journal Article 2021-08-12 ✓ 2 Snippets Murk K, Ornaghi M, Schiweck J.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant, progressive neurodegenerative disease caused by an expanded CAG repeat/polyglutamine (polyQ) tract beyond 35 repeats within the first exon of the huntingtin (HTT) gene.

…the huntingtin (HTT) gene.…

Show Full Abstract

Profilins are small actin binding proteins, which are structurally conserved throughout evolution. They are probably best known to promote and direct actin polymerization. However, they also participate in numerous cell biological processes beyond the roles typically ascribed to the actin cytoskeleton. Moreover, most complex organisms express several profilin isoforms. Their cellular functions are far from being understood, whereas a growing number of publications indicate that profilin isoforms are involved in the pathogenesis of various diseases. In this review, we will provide an overview of the profilin family and "typical" profilin properties including the control of actin dynamics. We will then discuss the profilin isoforms of higher animals in detail. In terms of cellular functions, we will focus on the role of Profilin 1 (PFN1) and Profilin 2a (PFN2a), which are co-expressed in the central nervous system. Finally, we will discuss recent findings that link PFN1 and PFN2a to neurological diseases, such as amyotrophic lateral sclerosis (ALS), Fragile X syndrome (FXS), Huntington's disease and spinal muscular atrophy (SMA).

Also flagged:Diuronphenylureacarbondegradationhydrolasesmetabolism
Journal Article 2021-08-12 No Snippets Li J, Zhang W, Lin Z, Huang Y, Bhatt P, Chen S.
Show Full Abstract

Diuron (DUR) is a phenylurea herbicide widely used for the effective control of most annual and perennial weeds in farming areas. The extensive use of DUR has led to its widespread presence in soil, sediment, and aquatic environments, which poses a threat to non-target crops, animals, humans, and ecosystems. Therefore, the removal of DUR from contaminated environments has been a hot topic for researchers in recent decades. Bioremediation seldom leaves harmful intermediate metabolites and is emerging as the most effective and eco-friendly strategy for removing DUR from the environment. Microorganisms, such as bacteria, fungi, and actinomycetes, can use DUR as their sole source of carbon. Some of them have been isolated, including organisms from the bacterial genera <i>Arthrobacter</i>, <i>Bacillus</i>, <i>Vagococcus</i>, <i>Burkholderia</i>, <i>Micrococcus</i>, <i>Stenotrophomonas</i>, and <i>Pseudomonas</i> and fungal genera <i>Aspergillus</i>, <i>Pycnoporus</i>, <i>Pluteus</i>, <i>Trametes</i>, <i>Neurospora</i>, <i>Cunninghamella</i>, and <i>Mortierella.</i> A number of studies have investigated the toxicity and fate of DUR, its degradation pathways and metabolites, and DUR-degrading hydrolases and related genes. However, few reviews have focused on the microbial degradation and biochemical mechanisms of DUR. The common microbial degradation pathway for DUR is <i>via</i> transformation to 3,4-dichloroaniline, which is then metabolized through two different metabolic pathways: dehalogenation and hydroxylation, the products of which are further degraded <i>via</i> cooperative metabolism. Microbial degradation hydrolases, including PuhA, PuhB, LibA, HylA, Phh, Mhh, and LahB, provide new knowledge about the underlying pathways governing DUR metabolism. The present review summarizes the state-of-the-art knowledge regarding (1) the environmental occurrence and toxicity of DUR, (2) newly isolated and identified DUR-degrading microbes and their enzymes/genes, and (3) the bioremediation of DUR in soil and water environments. This review further updates the recent knowledge on bioremediation strategies with a focus on the metabolic pathways and molecular mechanisms involved in the bioremediation of DUR.

Also flagged:ttdglnHDNase IosmYrhlBilvG
Journal Article 2021-08-12 ✓ 5 Snippets Kasho K, Oshima T, Chumsakul O, Nakamura K, Fukamachi K, Katayama T.
In-Text Gene Mentions

…DARS1 , andDARS2, which are…

…DARS1 andDARS2share three highly…

…to DARS1 ,DARS2requires two activator…

DARS2–IHF binding is…

…datA , andDARS2are regulated such…

Show Full Abstract

The structure and function of bacterial chromosomes are dynamically regulated by a wide variety of nucleoid-associated proteins (NAPs) and DNA superstructures, such as DNA supercoiling. In <i>Escherichia coli</i>, integration host factor (IHF), a NAP, binds to specific transcription promoters and regulatory DNA elements of DNA replication such as the replication origin <i>oriC</i>: binding to these elements depends on the cell cycle but underlying mechanisms are unknown. In this study, we combined GeF-seq (genome footprinting with high-throughput sequencing) with synchronization of the <i>E. coli</i> cell cycle to determine the genome-wide, cell cycle-dependent binding of IHF with base-pair resolution. The GeF-seq results in this study were qualified enough to analyze genomic IHF binding sites (e.g., <i>oriC</i> and the transcriptional promoters of <i>ilvG</i> and <i>osmY</i>) except some of the known sites. Unexpectedly, we found that before replication initiation, <i>oriC</i> was a predominant site for stable IHF binding, whereas all other loci exhibited reduced IHF binding. To reveal the specific mechanism of stable <i>oriC-</i>IHF binding, we inserted a truncated <i>oriC</i> sequence in the <i>terC</i> (replication terminus) locus of the genome. Before replication initiation, stable IHF binding was detected even at this additional <i>oriC</i> site, dependent on the specific DnaA-binding sequence DnaA box R1 within the site. DnaA oligomers formed on <i>oriC</i> might protect the <i>oriC</i>-IHF complex from IHF dissociation. After replication initiation, IHF rapidly dissociated from <i>oriC</i>, and IHF binding to other sites was sustained or stimulated. In addition, we identified a novel locus associated with cell cycle-dependent IHF binding. These findings provide mechanistic insight into IHF binding and dissociation in the genome.

Also flagged:alanineICOSaspartate aminotransferaseinfectionALTAST
Journal Article 2021-08-12 ✓ 1 Snippet Xie S, Wei H, Peng A, Xie A, Li J, Fang C, Shi F, Yang Q, Huang H, Xie H, Pan X, Tian X, Huang J.
In-Text Gene Mentions

…factors, such asTNFSF4, TNFSF11, TNFSF14, and…

Show Full Abstract

<h4>Background</h4>Th cells (helper T cells) have multiple functions in <i>Schistosoma japonicum</i> (<i>S. japonicum</i>) infection. Inducible co-stimulator (ICOS) is induced and expressed in activated T lymphocytes, which enhances the development of B cells and antibody production through the ICOS/ICOSL pathway. It remains unclear about the role and possible regulating mechanism of ICOS<sup>+</sup> Th cells in the spleen of <i>S. japonicum</i>-infected C57BL/6 mice.<h4>Methods</h4>C57BL/6 mice were infected with cercariae of <i>S. japonicum</i> through the abdomen. The expression of ICOS, activation markers, and the cytokine production on CD4<sup>+</sup> ICOS<sup>+</sup> Th cells were detected by flow cytometry (FCM) and quantitative real-time PCR (qRT-PCR). Moreover, the differentially expressed gene data of ICOS<sup>+</sup> and ICOS<sup>-</sup> Th cells from the spleen of infected mice were obtained by mRNA sequencing. Besides, Western blot and chromatin immunoprecipitation (ChIP) were used to explore the role of Ikzf2 on ICOS expression.<h4>Results</h4>After <i>S. japonicum</i> infection, the expression of ICOS molecules gradually increased in splenic lymphocytes, especially in Th cells (<i>P</i> < 0.01). Compared with ICOS<sup>-</sup> Th cells, more ICOS<sup>+</sup> Th cells expressed CD69, CD25, CXCR5, and CD40L (<i>P</i> < 0.05), while less of them expressed CD62L (<i>P</i> < 0.05). Also, ICOS<sup>+</sup> Th cells expressed more cytokines, such as IFN-γ, IL-4, IL-10, IL-2, and IL-21 (<i>P</i> < 0.05). RNA sequencing results showed that many transcription factors were increased significantly in ICOS<sup>+</sup> Th cells, especially Ikzf2 (<i>P</i> < 0.05). And then, the expression of Ikzf2 was verified to be significantly increased and mainly located in the nuclear of ICOS<sup>+</sup> Th cells. Finally, ChIP experiments and dual-luciferase reporter assay confirmed that Ikzf2 could directly bind to the ICOS promoter in Th cells.<h4>Conclusion</h4>In this study, ICOS<sup>+</sup> Th cells were found to play an important role in <i>S. japonicum</i> infection to induce immune response in the spleen of C57BL/6 mice. Additionally, Ikzf2 was found to be one important transcription factor that could regulate the expression of ICOS in the spleen of <i>S. japonicum</i>-infected C57BL/6 mice.

Also flagged:peptidesribosomeMTLNLINC00116nucleotidespiwi
Journal Article 2021-08-12 ✓ 1 Snippet Zaheed O, Kiniry SJ, Baranov PV, Dean K.
In-Text Gene Mentions

…the protein codingZNFX1gene.…

Show Full Abstract

Detection of translation in so-called non-coding RNA provides an opportunity for identification of novel bioactive peptides and microproteins. The main methods used for these purposes are ribosome profiling and mass spectrometry. A number of publicly available datasets already exist for a substantial number of different cell types grown under various conditions, and public data mining is an attractive strategy for identification of translation in non-coding RNAs. Since the analysis of publicly available data requires intensive data processing, several data resources have been created recently for exploring processed publicly available data, such as OpenProt, GWIPS-viz, and Trips-Viz. In this work we provide a detailed demonstration of how to use the latter two tools for exploring experimental evidence for translation of RNAs hitherto classified as non-coding. For this purpose, we use a set of transcripts with substantially different patterns of ribosome footprint distributions. We discuss how certain features of these patterns can be used as evidence for or against genuine translation. During our analysis we concluded that the <i>MTLN</i> mRNA, previously misannotated as lncRNA <i>LINC00116</i>, likely encodes only a short proteoform expressed from shorter RNA transcript variants.

Also flagged:Alcoholic Liver Cirrhosisgenetic disordercopperliver cirrhosisfulminant liver failurechronic hepatitis
Journal Article 2021-08-12 ✓ 1 Snippet Omeish H, Hajjaj N, Abdulelah M, Bader H.
In-Text Gene Mentions

…diseases such ashemochromatosisand WD, as…

Show Full Abstract

Wilson's disease (WD), a rare genetic disorder characterized by copper accumulation, leads to a spectrum of hepatic dysfunction including liver cirrhosis, fulminant liver failure, and chronic hepatitis. Its manifestations could involve musculoskeletal, hematologic, neuropsychiatric, or renal systems. We present the case of a 27-year-old female with a past medical history of alcohol use disorder who presented with acute confusion, worsening abdominal distension, bilateral lower limb edema, and jaundice.The initial presentation was concerning for acute alcoholic hepatitis and decompensated alcoholic cirrhosis attributed to ongoing heavy alcohol consumption. However, due to the patient's young age, the severity of presentation, and the pattern of liver enzyme elevation, further workup was conducted to rule out concurrent pathologies. Viral, autoimmune, and metabolic workups were unrevealing. Subsequently, low ceruloplasmin levels and elevated urinary copper levels led to a diagnosis of WD with concomitant alcoholic liver disease. The coexistence of WD and alcohol-associated liver disease (ALD) has not been well described in the literature. Laboratory testing including alkaline phosphatase (ALP), bilirubin, and serum aminotransferases provides the most rapid and accurate method for diagnosing ALD due to WD, given that the conventional screening tests such as ceruloplasmin are less sensitive and specific in identifying patients with acute liver disease secondary to WD.

Also flagged:Autophagyorganelleslysosomedegradationagingneurodegenerative diseases
Journal Article 2021-08-12 No Snippets Aman Y, Schmauck-Medina T, Hansen M, Morimoto RI, Simon AK, Bjedov I, Palikaras K, Simonsen A, Johansen T, Tavernarakis N, Rubinsztein DC, Partridge L, Kroemer G, Labbadia J, Fang EF.
Show Full Abstract

Autophagy is a fundamental cellular process that eliminates molecules and subcellular elements, including nucleic acids, proteins, lipids and organelles, via lysosome-mediated degradation to promote homeostasis, differentiation, development and survival. While autophagy is intimately linked to health, the intricate relationship among autophagy, aging and disease remains unclear. This Review examines several emerging features of autophagy and postulates how they may be linked to aging as well as to the development and progression of disease. In addition, we discuss current preclinical evidence arguing for the use of autophagy modulators as suppressors of age-related pathologies such as neurodegenerative diseases. Finally, we highlight key questions and propose novel research avenues that will likely reveal new links between autophagy and the hallmarks of aging. Understanding the precise interplay between autophagy and the risk of age-related pathologies across organisms will eventually facilitate the development of clinical applications that promote long-term health.

Also flagged:waterinfectionsrespiratory illnessesisopropyl alcoholsiliconepolystyrene
Journal Article 2021-08-11 No Snippets Lee UN, van Neel TL, Lim FY, Khor JW, He J, Vaddi RS, Ong AQW, Tang A, Berthier J, Meschke JS, Novosselov IV, Theberge AB, Berthier E.
Show Full Abstract

Aerosols dispersed and transmitted through the air (e.g., particulate matter pollution and bioaerosols) are ubiquitous and one of the leading causes of adverse health effects and disease transmission. A variety of sampling methods (e.g., filters, cyclones, and impactors) have been developed to assess personal exposures. However, a gap still remains in the accessibility and ease-of-use of these technologies for people without experience or training in collecting airborne samples. Additionally, wet scrubbers (large non-portable industrial systems) utilize liquid sprays to remove aerosols from the air; the goal is to "scrub" (i.e., clean) the exhaust of industrial smokestacks, not collect the aerosols for analysis. Inspired by wet scrubbers, we developed a device fundamentally different from existing portable air samplers by using aerosolized microdroplets to capture aerosols in personal spaces (e.g., homes, offices, and schools). Our aerosol-sampling device is the size of a small teapot, can be operated without specialized training, and features a winding flow path in a supersaturated relative humidity environment, enabling droplet growth. The integrated open mesofluidic channels shuttle coalesced droplets to a collection chamber for subsequent sample analysis. Here, we present the experimental demonstration of aerosol capture in water droplets. An iterative study optimized the non-linear flow manipulating baffles and enabled an 83% retention of the aerosolized microdroplets in the confined volume of our device. As a proof-of-concept for aerosol capture into a liquid medium, 0.5-3 μm model particles were used to evaluate aerosol capture efficiency. Finally, we demonstrate that the device can capture and keep a bioaerosol (bacteriophage MS2) viable for downstream analysis.

Also flagged:triglyceridesadiponectinhepatitis Cinfectionmetabolisminsulin resistance
Journal Article 2021-08-11 ✓ 1 Snippet Chang ML, Hu JH, Pao LH, Lin MS, Kuo CJ, Chen SC, Fan CM, Chang MY, Chien RN.
In-Text Gene Mentions

…hepatitis B infection,hemochromatosis, primary biliary cholangitis,…

Show Full Abstract

<h4>Background</h4>Both hepatitis C virus (HCV) infection and adiponectin are critically involved in metabolism. The reversal and associations of altering adiponectin levels after sustained virological responses (SVRs) following direct-acting antivirals (DAA) in HCV-infected patients remained elusive.<h4>Methods</h4>A joint study was conducted in a prospective cohort of 427 HCV-infected patients and a line of HCV core transgenic mice.<h4>Results</h4>Of 427, 358 had completed a course of DAA therapy and 353 had SVRs. At baseline, male sex (95% CI β: - 1.44 to - 0.417), estimated glomerular filtration rate (eGFR) (- 0.025 to - 0.008), triglycerides (- 0.015 to - 0.005), and fibrosis-4 levels (0.08-0.297) were associated with adiponectin levels; BMI (0.029-0.327) and triglycerides levels (0.01-0.03) were associated with homeostatic model assessment for insulin resistance (HOMA-IR) in HCV-infected patients. At 24-week post-therapy, in SVR patients, male sex (- 1.89 to - 0.5) and eGFR (- 0.02 to - 0.001) levels were associated with adiponectin levels, levels of BMI (0.094-0.335) and alanine transaminase (0.018-0.078) were associated with HOMA-IR; compared with baseline levels, adiponectin levels decreased (6.53 ± 2.77 vs. 5.45 ± 2.56 μg/mL, p < 0.001). In 12-month-old HCV core transgenic mice with hepatic steatosis, triglyceride levels (0.021-0.111) were associated with adiponectin levels, and hepatic adipopnectin expression was comparable with that of control mice.<h4>Conclusions</h4>Triglycerides and hepatic fibrosis are associated with HCV-specific alteration of adiponectin levels, and adiponectin may affect insulin sensitivity through triglycerides during HCV infection. In DAA-treated patients, after SVR, adiponectin levels decreased and the linking function of triglycerides between adiponectin and insulin sensitivity vanished. Moreover, HCV core with hepatic steatosis might affect extrahepatic adiponectin expression through triglycerides.

Also flagged:MitophagymitochondrialysosomesagingStem cell senescencemitochondrial
Journal Article 2021-08-11 No Snippets Lin Q, Chen J, Gu L, Dan X, Zhang C, Yang Y.
Show Full Abstract

Mitophagy is a specific autophagic phenomenon in which damaged or redundant mitochondria are selectively cleared by autophagic lysosomes. A decrease in mitophagy can accelerate the aging process. Mitophagy is related to health and longevity and is the key to protecting stem cells from metabolic stress damage. Mitophagy decreases the metabolic level of stem cells by clearing active mitochondria, so mitophagy is becoming increasingly necessary to maintain the regenerative capacity of old stem cells. Stem cell senescence is the core problem of tissue aging, and tissue aging occurs not only in stem cells but also in transport amplifying cell chambers and the stem cell environment. The loss of the autophagic ability of stem cells can cause the accumulation of mitochondria and the activation of the metabolic state as well as damage the self-renewal ability and regeneration potential of stem cells. However, the claim remains controversial. Mitophagy is an important survival strategy against nutrient deficiency and starvation, and mitochondrial function and integrity may affect the viability, proliferation and differentiation potential, and longevity of normal stem cells. Mitophagy can affect the health and longevity of the human body, so the number of studies in this field has increased, but the mechanism by which mitophagy participates in stem cell development is still not fully understood. This review describes the potential significance of mitophagy in stem cell developmental processes, such as self-renewal, differentiation and aging. Through this work, we discovered the role and mechanism of mitophagy in different types of stem cells, identified novel targets for killing cancer stem cells and curing cancer, and provided new insights for future research in this field.

Also flagged:MesothelinChimeric Antigen ReceptorMSLNacute myeloid leukemiaAMLhematopoiesis
Journal Article 2021-08-11 No Snippets Le Q, Castro S, Tang T, Loeb AM, Hylkema T, McKay CN, Perkins L, Srivastava S, Call L, Smith J, Leonti A, Ries R, Pardo L, Loken MR, Correnti C, Fiorenza S, Turtle CJ, Riddell S, Tarlock K, Meshinchi S.
Show Full Abstract

<h4>Purpose</h4>We previously identified mesothelin (MSLN) as highly expressed in a significant fraction of acute myeloid leukemia (AML) but entirely silent in normal hematopoiesis, providing a promising antigen for immunotherapeutic targeting that avoids hematopoietic toxicity. Given that T cells genetically modified to express chimeric antigen receptors (CAR) are effective at eradicating relapsed/refractory acute lymphocytic leukemia, we developed MSLN-directed CAR T cells for preclinical evaluation in AML.<h4>Experimental design</h4>The variable light (VL) and heavy (VH) sequences from the MSLN-targeting SS1P immunotoxin were used to construct the single-chain variable fragment of the standard CAR containing 41-BB costimulatory and CD3Zeta stimulatory domains. The preclinical efficacy of MSLN CAR T cells was evaluated against AML cell lines and patient samples expressing various levels of MSLN <i>in vitro</i> and <i>in vivo</i>.<h4>Results</h4>We demonstrate that MSLN is expressed on the cell surface of AML blasts and leukemic stem cell-enriched CD34<sup>+</sup>CD38<sup>-</sup> subset, but not on normal hematopoietic stem and progenitor cells (HSPC). We further establish that MSLN CAR T cells are highly effective in eliminating MSLN-positive AML cells in cell line- and patient-derived xenograft models. Importantly, MSLN CAR T cells can target and eradicate CD34<sup>+</sup>CD38<sup>-</sup> cells without impacting the viability of normal HSPCs. Finally, we show that CAR T-cell functionality can be improved by inhibition of the ADAM17 metalloprotease that promotes shedding of MSLN.<h4>Conclusions</h4>These findings demonstrate that MSLN is a viable target for CAR T-cell therapy in AML and that inhibiting MSLN shedding is a promising approach to improve CAR T-cell efficacy.

Also flagged:necroptosispyroptosisdeathcancerprogrammed cell deathferroptosis
Journal Article 2021-08-11 No Snippets Liu Y, Chen Q, Zhu Y, Wang T, Ye L, Han L, Yao Z, Yang Z.
Show Full Abstract

Distant metastasis is the main cause of death for cancer patients. Recently, the newly discovered programmed cell death includes necroptosis, pyroptosis, and ferroptosis, which possesses an important role in the process of tumor metastasis. At the same time, it is widely reported that non-coding RNA precisely regulates programmed death and tumor metastasis. In the present review, we summarize the function and role of necroptosis, pyrolysis, and ferroptosis involving in cancer metastasis, as well as the regulatory factors, including non-coding RNAs, of necroptosis, pyroptosis, and ferroptosis in the process of tumor metastasis.

Also flagged:Neurodegenerative diseasesα-synucleinPDamyloid-βtauAD
Journal Article 2021-08-11 ✓ 2 Snippets Wang H, Yang F, Zhang S, Xin R, Sun Y.
In-Text Gene Mentions

The misfolding and aggregation of specific proteins inside or outside cells are the major shared histopathological hallmarks of neurodegenerative diseases2; examples include misfolded α-synuclein deposits in Parkinson’s disease (PD), amyloid-β (Aβ) aggregates, and neurofibrillary tangles are formed from hyperphosphorylated tau in Alzheimer’s disease (AD)3, mutated huntingtin (HTT) in Huntington disease4, and TAR DNA-binding protein 43 (TDP-43) in amyotrophic lateral sclerosis (ALS)5.

…, mutated huntingtin (HTT) in Huntington disease…

Show Full Abstract

Neurodegenerative diseases are characterized by neuronal impairment and loss of function, and with the major shared histopathological hallmarks of misfolding and aggregation of specific proteins inside or outside cells. Some genetic and environmental factors contribute to the promotion of the development and progression of neurodegenerative diseases. Currently, there are no effective treatments for neurodegenerative diseases. It has been revealed that bidirectional communication exists between the brain and the gut. The gut microbiota is a changeable and experience-dependent ecosystem and can be modified by genetic and environmental factors. The gut microbiota provides potential therapeutic targets that can be regulated as new interventions for neurodegenerative diseases. In this review, we discuss genetic and environmental risk factors for neurodegenerative diseases, summarize the communication among the components of the microbiota-gut-brain axis, and discuss the treatment strategy of fecal microbiota transplantation (FMT). FMT is a promising treatment for neurodegenerative diseases, and restoration of the gut microbiota to a premorbid state is a novel goal for prevention and treatment strategies.

Also flagged:UNC5BNetrin-1 receptortumorangiogenesisNetrin-1binding
Journal Article 2021-08-11 ✓ 4 Snippets Pradella D, Deflorian G, Pezzotta A, Di Matteo A, Belloni E, Campolungo D, Paradisi A, Bugatti M, Vermi W, Campioni M, Chiapparino A, Scietti L, Forneris F, Giampietro C, Volf N, Rehman M, Zacchigna S, Paronetto MP, Pistocchi A, Eichmann A, Mehlen P, Ghigna C.
In-Text Gene Mentions

…UNC5 family), aDCC-binding motif-containing doma…

…receptors, such asDCCand Neogenin 78…

…the case ofDCC, NOVA2 promotes…

…hitectural switch in Netrin-1/DCCreceptor assembly 78…

Show Full Abstract

The Netrin-1 receptor UNC5B is an axon guidance regulator that is also expressed in endothelial cells (ECs), where it finely controls developmental and tumor angiogenesis. In the absence of Netrin-1, UNC5B induces apoptosis that is blocked upon Netrin-1 binding. Here, we identify an UNC5B splicing isoform (called UNC5B-Δ8) expressed exclusively by ECs and generated through exon skipping by NOVA2, an alternative splicing factor regulating vascular development. We show that UNC5B-Δ8 is a constitutively pro-apoptotic splicing isoform insensitive to Netrin-1 and required for specific blood vessel development in an apoptosis-dependent manner. Like NOVA2, UNC5B-Δ8 is aberrantly expressed in colon cancer vasculature where its expression correlates with tumor angiogenesis and poor patient outcome. Collectively, our data identify a mechanism controlling UNC5B's necessary apoptotic function in ECs and suggest that the NOVA2/UNC5B circuit represents a post-transcriptional pathway regulating angiogenesis.

Also flagged:SNEIQGAP3aldehyde dehydrogenase 1phenol redMg2+nuclei
Journal Article 2021-08-11 ✓ 2 Snippets Khatun M, Meltsov A, Lavogina D, Loid M, Kask K, Arffman RK, Rossi HR, Lättekivi F, Jääger K, Krjutškov K, Rinken A, Salumets A, Piltonen TT.
In-Text Gene Mentions

TNFSF4

…, MMP10 ,TNFSF4) .…

Show Full Abstract

Hyperandrogenic women with PCOS show disrupted decidualization (DE) and placentation. Dihydrotestosterone (DHT) is reported to enhance DE in non-PCOS endometrial stromal cells (eSC<sub>Ctrl</sub>); however, this has not been assessed in PCOS cells (eSC<sub>PCOS</sub>). Therefore, we studied the transcriptome profile of non-decidualized (non-DE) and DE eSCs from women with PCOS and Ctrl in response to short-term estradiol (E2) and/or progesterone (P4) exposure with/without (±) DHT. The non-DE eSCs were subjected to E2 ± DHT treatment, whereas the DE (0.5 mM 8-Br-cAMP, 96 h) eSCs were post-treated with E2 and P4 ± DHT, and RNA-sequenced. Validation was performed by immunofluorescence and immunohistochemistry. The results showed that, regardless of treatment, the PCOS and Ctrl samples clustered separately. The comparison of DE vs. non-DE eSC<sub>PCOS</sub> without DHT revealed PCOS-specific differentially expressed genes (DEGs) involved in mitochondrial function and progesterone signaling. When further adding DHT, we detected altered responses for lysophosphatidic acid (LPA), inflammation, and androgen signaling. Overall, the results highlight an underlying defect in decidualized eSC<sub>PCOS</sub>, present with or without DHT exposure, and possibly linked to the altered pregnancy outcomes. We also report novel factors which elucidate the mechanisms of endometrial dysfunction in PCOS.

Also flagged:cell receptorsinfectionhydroxymethylpyrophosphateB7
Journal Article 2021-08-11 ✓ 4 Snippets Alice AF, Kramer G, Bambina S, Bahjat KS, Gough MJ, Crittenden MR.
In-Text Gene Mentions

…(BTN) 3A1 andBTN2A1.…

…recently, butyrophilin 2A1 (BTN2A1) was identified as…

BTN2A1associates with BTN3A1…

…genes BTN3A1 andBTN2A1, and the…

Show Full Abstract

Gamma-delta (γδ) T cells express T cell receptors (TCR) that are preconfigured to recognize signs of pathogen infection. In primates, γδ T cells expressing the Vγ9Vδ2 TCR innately recognize (E)-4-hydroxy-3-methyl-but- 2-enyl pyrophosphate (HMBPP), a product of the 2-C-methyl-D-erythritol 4- phosphate (MEP) pathway in bacteria that is presented in infected cells via interaction with members of the B7 family of costimulatory molecules butyrophilin (BTN) 3A1 and BTN2A1. In humans, Listeria monocytogenes (Lm) vaccine platforms have the potential to generate potent Vγ9Vδ2 T cell recognition. To evaluate the activation of Vγ9Vδ2 T cells by Lm-infected human monocyte-derived dendritic cells (Mo-DC) we engineered Lm strains that lack components of the MEP pathway. Direct infection of Mo-DC with these bacteria were unchanged in their ability to activate CD107a expression in Vγ9Vδ2 T cells despite an inability to synthesize HMBPP. Importantly, functional BTN3A1 was essential for this activation. Unexpectedly, we found that cytoplasmic entry of Lm into human dendritic cells resulted in upregulation of cholesterol metabolism in these cells, and the effect of pathway regulatory drugs suggest this occurs via increased synthesis of the alternative endogenous Vγ9Vδ2 ligand isoprenyl pyrophosphate (IPP) and/or its isomer dimethylallyl pyrophosphate (DMAPP). Thus, following direct infection, host pathways regulated by cytoplasmic entry of Lm can trigger Vγ9Vδ2 T cell recognition of infected cells without production of the unique bacterial ligand HMBPP.

Also flagged:SET Domain Bifurcated Histone Lysine Methyltransferase 1SETDB1Histonelysinechromatingene expression
Journal Article 2021-08-11 ✓ 5 Snippets Markouli M, Strepkos D, Piperi C.
In-Text Gene Mentions

SET Domain Bifurcated Histone Lysine Methyltransferase 1; SETDB1, Suppressor of Variegation 3-9; SUV39, Protein lysine methyltransferases; PKMTs, Enhancer of Zeste; EZ, H3 lysine 9; H3K9, ETS-related gene; ERG, Methyl-CpG-binding domain; MBD, Histone Deacetylase 1⁄2; HDAC1/2, Kruppel-associated box-Zinc Finger Proteins-KRAB-Associated Protein-1; KRAB–ZFP–KAP-1, DNA Methyltransferase 3; DNMT3, Nuclear export signals; NES, Nuclear localization signals; NLS, Ubiquitin-Conjugating Enzyme E2; UBE2E, S-adenosylmethionine; SAM, homolog of murine ATFa-associated modulator; hAM, Heterochromatin protein 1; HP1, Chromosome Region Maintenance 1; CRM1, Specificity Protein 1; SP1, Specificity Protein 3; SP3, Chromatin assembly factor-1; CAF-1, human silencing hub; HUSH, Polycomb Repressive Complex 2; PRC2, Histone 3 Lysine 27; H3K27, Protein Kinase B; Akt, Inositol trisphosphate; IP3, Endogenous Retroviruses; ERVs, Retroelement Silencing Factor 1; RESF1, T helper 2; Th2, Extracellular Signal-Regulated Kinase; ERK, T-Cell Receptor; TCR, Endogenous Retrovirus-Related Mammalian-Apparent LTR-Retrotransposons; ERVL-MaLR, Interleukin 1 Receptor Accessory Protein-Like 1; IL1RAPL1, Toll-Like Receptor 4; TLR4, Nuclear Factor Kappa Beta; NF-κB, lipo-polysaccharide; LPS, Death Domain-Associated Protein; Daxx, Small Ubiquitin-Like Modifier 1; SUMO-1, Speckled 100 KDa; Sp100, CREB Binding Protein; CBP, Glial Fibrillary Acidic Protein; GFAP, SRY Box transcription factor 9; Sox9, Ras association domain family 1 isoform A; RASSF1A, E-Cadherin; CDH1, P14 alternate reading frame; P14ARF, Metalloproteinase inhibitor 3; TIMP3, Retinoblastoma protein; Rb, Small interfering RNAs; siRNAs, 3’-deazaneplanocin A; DZNep, paclitaxel; PTX, Blood–Brain Barrier; BBB, Non-Small Cell Lung Cancers; NSCLC, SETDB1-derived circular RNA; circSETDB1, Wingless-related integration site; WNT, Malignant Pleural Mesotheliomas; MPM, breast cancer; BC, Internal Ribosome Entry Segment; IRES, Cyclin D1; CCND1, BC type 1 susceptibility protein; BRCA1, alternative lengthening of telomeres; ALT, Mothers against decapentaplegic homolog 7; SMAD7, transforming growth factor beta; TGF-β, epithelial mesenchymal transition; EMT, Hox antisense intergenic RNA; HOTAIR, Long Non-Coding RNA; lncRNA, Apolipoprotein E; APOE, Homeobox A; HoxA, Signal Transducer and Activator of Transcription 1; STAT1, CCND1/Cyclin-dependent kinase 6; CCND1/CDK6, Hepatocellular Carcinoma; HCC, Pancreatic Ductal Adenocarcinoma; PDA, Ovarian serous cancer; SOC, Prostate cancer; PC, URI; Unconventional Pre-folding RPB5 Interactor protein, Thrombospondin 1; THBS1, DOPAchrome tautomerase; DCT, Sineo-culis homeobox homolog 1; Six1, Dedicator of Cytokinesis 1; Dock1, Acute Promyelocytic Leukemia; APL, Polymerase associated factor; PAF1, arsenic trioxide; As2O3, Glutamate Ionotropic Receptor Kainate Type Subunit 2; GRIK2, inflammatory bowel disease; IBD, brain-derived neurotrophic factor; BDNF, N-methyl D-aspartate receptor subtype 2B; NR2B/Grin2b, frontotemporal dementia; FTD, Amyotrophic Lateral Sclerosis; ALS, Brain-derived neurotrophic factor; BDNF, intellectual disability; ID, autism spectrum disorder; ASD, fetal alcohol spectrum disorder; FASD, Huntington’s disease; HD, Huntingtin; HTT, Kinesin heavy chain isoform 5A; KIF5A, Vesicle-associated membrane protein 2; VAMP2, Dihydropyrimidinase-related protein 2; DPYSL2, arrestin beta-2; ARRB2, activity-regulated cy-toskeleton-associated protein; ARC, Zinc finger FYVE domain containing 27; ZFYVE27, Protein kinase C zeta; PRKCZ), Poly (ADP-ribose) polymerase 1; PARP1, early growth response protein 1; EGR1, Enhancer Of Zeste Homolog 1; EZH1 and Polyhy-droxybutyrate; PHB, Sphingosine kinase 1; SPHK1, protein inhibitor of activated STAT protein gamma; PIAS4, RNA polymerase II subunit A; POLR2A, Subfamily A, Member 4; SMARCA4, DEAD-box helicase 20; DDX20, DNA topoisomerase II alpha; TOP2A, Telomerase reverse transcriptase; TERT, Nuclear factor 1 C-type; NFIC, Scaffold attachment factor B; SAFB, Hexamethylene Bis-Acetamide-Inducible Protein 1; HEXIM1, HDAC inhibitors; HDACi, Methyl-CpG-binding Protein 2; MECP2, Small Nucleolar RNA 116; SNORD116, Small Nuclear Ribonucleoprotein Polypeptide N; SNRP, poly-ADP ribose polymerase; PARP, ventricular septal defect; VSD, double outlet right ventricle; DORV.

Interestingly, genetic variations of ATF7IP seem to correlate with HD’s age of onset [140], adding ATF7IP to the list of potential targets for reducing H3K9me3 levels upregulated by the mutant HTT [141].

…shown that Huntingtin (HTT) binds to ATF7IP,…

…whereas loss ofHTTupregulates H3K9me3 marks…

…cystamine, which decreasesHttaggregates and mithramycin,…

Show Full Abstract

The SET Domain Bifurcated Histone Lysine Methyltransferase 1 (SETDB1) is a prominent member of the Suppressor of Variegation 3-9 (SUV39)-related protein lysine methyltransferases (PKMTs), comprising three isoforms that differ in length and domain composition. SETDB1 is widely expressed in human tissues, methylating Histone 3 lysine 9 (H3K9) residues, promoting chromatin compaction and exerting negative regulation on gene expression. SETDB1 has a central role in normal physiology and nervous system development, having been implicated in the regulation of cell cycle progression, inactivation of the X chromosome, immune cells function, expression of retroelements and formation of promyelocytic leukemia (PML) nuclear bodies (NB). SETDB1 has been frequently deregulated in carcinogenesis, being implicated in the pathogenesis of gliomas, melanomas, as well as in lung, breast, gastrointestinal and ovarian tumors, where it mainly exerts an oncogenic role. Aberrant activity of SETDB1 has also been implicated in several neuropsychiatric, cardiovascular and gastrointestinal diseases, including schizophrenia, Huntington's disease, congenital heart defects and inflammatory bowel disease. Herein, we provide an update on the unique structural and biochemical features of SETDB1 that contribute to its regulation, as well as its molecular and cellular impact in normal physiology and disease with potential therapeutic options.

Also flagged:DextranSulfateUlcerative colitisinflammatory bowel disorderdextran sulfate sodiuminflammatory response
Journal Article 2021-08-11 No Snippets Li R, Cheng L, Wang Q, Zhou L.
Show Full Abstract

Ulcerative colitis (UC) is a complex inflammatory bowel disorder that can induce colonic and rectal dysfunction. Mesalazine, a first-line medicine, is routinely prescribed for UC treatment. However, the pharmacological targets of mesalazine against UC are not detailed in current publications. In the current study, a transcriptomics strategy was applied to reveal the therapeutic targets and molecular mechanisms of mesalazine for treating dextran sulfate sodium (DSS)-induced UC in mice. Compared with the UC group, a total of 1,663 differentially expressed genes were identified in mesalazine-treated mice, of which 262 were upregulated and 1,401 were downregulated. GO and KEGG enrichment analyses indicated that the protective actions of mesalazine for treating UC were related to the functional regulation of immune inflammatory response, such as the regulation of T cells, white blood cells, and cytokine receptor pathways. In addition, ingenuity pathway analysis of the gene network further revealed the inhibitory action of mesalazine on C-C motif chemokine ligands (CCL11 and CCL21) and C-X-C motif chemokine ligands (CXCL3 and CXCR2). Taken together, the current transcriptomic findings revealed anti-UC pharmacological targets, including the newly discovered biotargets CCL11, CCL21, CXCL3, and CXCR2, of mesalazine against DSS-induced intestinal inflammation.

Also flagged:HearingSensorineural hearing lossNeurological disordersLossADPD
Journal Article 2021-08-11 ✓ 5 Snippets Li S, Cheng C, Lu L, Ma X, Zhang X, Li A, Chen J, Qian X, Gao X.
In-Text Gene Mentions

Lin et al. (2011b) found that R6/2-HD mice exhibited approximately 10 dB elevation of ABR thresholds at 2 months of age before the presentation of motor deficits. After 3 weeks, the motor defects became apparent, and a 30 dB threshold shift for click stimuli and a 15 dB threshold shift for tone bursts at all frequencies were also observed. In addition, they found no difference in ABR latency and peak intervals between R6/2-HD mice and wild type mice (Lin et al., 2011b). As described in Wang’s research, R6/2-HD mice exhibited increased distortion product otoacoustic emission and ABR thresholds at 2–3 months of age. Furthermore, the relative expression of prestin was reduced in OHCs, which was reported to be responsible for dysfunction in hearing sensitivity and frequency selectivity. Cochlear SGN reduction and hair cell loss (especially OHCs) were observed histologically after that (Wang and Wu, 2015), suggesting that mHtt pathology in the central and peripheral auditory system contributed to the presence of hearing impairments in HD. Hdh(CAG)150 mice are knock-in mice that carry 150 CAG repeats on the Htt locus, of which mHtt aggregation in the nervous system and HD-related characteristics initiate at approximately 10 months of age. In Hdh(CAG)150 mice, thresholds measured by click and tone bursts ABR analysis at 15 months of age revealed that approximately 20 dB thresholds were increased for click and tone bursts at frequencies of 4 and 8 kHz. No differences were observed at frequencies of 16 and 32 kHz because wild type mice developed presbycusis at 15 months of age (Lin et al., 2011b). Moreover, aggregated mHtt and continuing loss of brain-type creatine kinase (CKB), which was previously reported to decline in HD patients, were both obtained in the organ of Corti and the spiral ganglion in both mouse models (Perluigi et al., 2005; Sorolla et al., 2008; Kim et al., 2010; Lin et al., 2011b). Aggregation of mHtt is thought to affect many transcriptional factors and induce mitochondrial dysfunction, which directly leads to the release of cytochrome C and oxidative stress (Kim and Kim, 2014). CKB, a cytosolic enzyme, can regenerate ATP by reversibly transferring high-energy phosphate from phosphocreatine (PCr) to ADP (Jacobus and Lehninger, 1973; Wallimann et al., 1992; Wyss and Kaddurah-Daouk, 2000). CKB also localizes in cochlear hair cells and ligaments and is critical for hearing function (Spicer and Schulte, 1992; Spicer et al., 1997). CKB-knockout mice presented with high-tone hearing loss that can be restored by dietary creatine supplements (Shin et al., 2007; Lin et al., 2011c). These studies suggest that CKB dysregulation may be associated with HD-related auditory dysfunction, synergistic with mHtt (Figure 2).

Aggregated mutant huntingtin (mHtt) is the most classic cellular pathological characteristic of HD; extra amplificated CAG repeats in exon 1 of huntingtin lead to polyglutamine (polyQ) extension at the N-terminal of Htt protein, and mutant Htt accumulates to cause neuronal loss (Figure 2; Macdonald et al., 1993; Mangiarini et al., 1996; Ha and Fung, 2012).

…the N-terminal ofHttprotein, and mutant…

…protein, and mutantHttaccumulates to cause…

…repeats on theHttlocus, of which…

Show Full Abstract

Sensorineural hearing loss (SNHL) affects approximately 466 million people worldwide, which is projected to reach 900 million by 2050. Its histological characteristics are lesions in cochlear hair cells, supporting cells, and auditory nerve endings. Neurological disorders cover a wide range of diseases affecting the nervous system, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), autism spectrum disorder (ASD), etc. Many studies have revealed that neurological disorders manifest with hearing loss, in addition to typical nervous symptoms. The prevalence, manifestations, and neuropathological mechanisms underlying vary among different diseases. In this review, we discuss the relevant literature, from clinical trials to research mice models, to provide an overview of auditory dysfunctions in the most common neurological disorders, particularly those associated with hearing loss, and to explain their underlying pathological and molecular mechanisms.

Also flagged:cancerCCKRHOAdigestive tract cancerRhosmall GTPases
Journal Article 2021-08-11 No Snippets Ikari N, Serizawa A, Tanji E, Yamamoto M, Furukawa T.
Show Full Abstract

The ras homolog family member A (<i>RHOA</i>) gene encodes a member of the Rho family of small GTPases and is known to function in reorganization of the actin cytoskeleton, which is associated with regulation of cell shape, attachment and motility. <i>RHOA</i> has been found to be recurrently mutated in gastrointestinal cancer; however, the functional significance of the mutated RHOA protein in digestive tract cancers remains to be uncovered. The aim of the present study was to understand the role of mutant <i>RHOA</i> in the proliferation and transcriptome of digestive tract cancer cells. Mutations of <i>RHOA</i> in one esophageal cancer cell line, OE19, eight gastric cancer cell lines, namely, AGS, GCIY, HGC-27, KATO III, MKN1, MKN45, SNU16 and SNU719, as well as two colon cancer cell lines, CCK-81 and SW948, were determined using Sanger sequencing. The results uncovered several mutations, including p.Arg5Gln and p.Tyr42Cys in CCK-81, p.Arg5Trp and p.Phe39Leu in SNU16, p.Gly17Glu in SW948, p.Tyr42Ser in OE19, p.Ala61Val in SNU719, p.Glu64del in AGS. Wild-type RHOA was identified in GCIY, HGC-27, KATO III, MKN1 and MKN45. Knockdown of <i>RHOA</i> using small interfering RNA attenuated the <i>in vitro</i> proliferation in the three-dimensional culture systems of GCIY, MKN1, OE19 and SW948, whereas no apparent changes were seen in CCK-81, HGC-27 and SNU719. Transcriptome analysis revealed that downregulation of the long non-coding RNA (<i>lnc)-DERA-1</i> was observed in all tested cell lines following <i>RHOA</i> knockdown in the <i>RHOA</i>-mutated cell lines. Gene Ontology analysis showed that the genes associated with small molecule metabolic process, oxidation-reduction processes, protein kinase activity, transport, and cell junction were commonly downregulated in cells whose proliferation was attenuated by the knockdown of <i>RHOA</i>. These results suggested that certain <i>RHOA</i> mutations may result in upregulation of <i>lnc-DERA-1</i> and genes associated with cellular metabolism and proliferation in digestive tract cancers.

Also flagged:alanineaspartate aminotransferasecirrhosisALTdiabetesFIB
Journal Article 2021-08-11 ✓ 1 Snippet Syed T, Chadha N, Kumar D, Gupta G, Sterling RK.
In-Text Gene Mentions

…deficiency, Wilson disease,hemochromatosis, primary sclerosing cholangit…

Show Full Abstract

<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) has an increased prevalence in end-stage renal disease (ESRD) due to similar risk factors. The aim of this study was to assess non-invasive testing including transient elastography (TE) for liver stiffness (LS), controlled attenuated parameter (CAP) for steatosis, Fibrosis-4 (FIB-4) score, aspartate aminotransferase (AST) to platelet ratio index (APRI) and NAFLD fibrosis score (NFS), for evaluation of NAFLD along with advanced fibrosis (AF) in patients with ESRD undergoing renal transplant evaluation.<h4>Methods</h4>Data were retrospectively collected within 12 weeks of TE. Primary outcomes were AF, defined by LS ≥ 9 kPa compared to APRI > 1.5, FIB-4 > 2.67, and NFS of 0.675, and ≥ 5% steatosis by CAP ≥ 263 dB/m compared to liver histology when available.<h4>Results</h4>A total of 171 patients were evaluated: mean age 56, 65% male, 36% obese, 47% had diabetes, 96% hypertension, and 56% dyslipidemia. Mean LS was 6.5 kPa with 21% having AF. Mean CAP was 232 dB/m, with 25% having steatosis. Those with AF were older with higher NFS. Those with steatosis were obese and had diabetes without higher LS or fibrosis scores. Only NFS was associated with LS ≥ 9 kPa. In those with liver histology, AF was associated with LS ≥ 9 kPa but not with APRI, FIB-4, or NFS.<h4>Conclusions</h4>Despite normal liver enzymes, non-invasive assessment via TE in ESRD patients exhibited high prevalence of AF and steatosis not detected by APRI or FIB-4 scores. This high prevalence was secondary to the common risk factors such as obesity and diabetes, among patients with NAFLD and ESRD.

Also flagged:NAFLDNASHcirrhosisGene‐Expressiongeneshousekeeping genes
Journal Article 2021-08-11 No Snippets Subudhi S, Drescher HK, Dichtel LE, Bartsch LM, Chung RT, Hutter MM, Gee DW, Meireles OR, Witkowski ER, Gelrud L, Masia R, Osganian SA, Gustafson JL, Rwema S, Bredella MA, Bhatia SN, Warren A, Miller KK, Lauer GM, Corey KE.
Show Full Abstract

Approaches to manage nonalcoholic fatty liver disease (NAFLD) are limited by an incomplete understanding of disease pathogenesis. The aim of this study was to identify hepatic gene-expression patterns associated with different patterns of liver injury in a high-risk cohort of adults with obesity. Using the NanoString Technologies (Seattle, WA) nCounter assay, we quantified expression of 795 genes, hypothesized to be involved in hepatic fibrosis, inflammation, and steatosis, in liver tissue from 318 adults with obesity. Liver specimens were categorized into four distinct NAFLD phenotypes: normal liver histology (NLH), steatosis only (steatosis), nonalcoholic steatohepatitis without fibrosis (NASH F0), and NASH with fibrosis stage 1-4 (NASH F1-F4). One hundred twenty-five genes were significantly increasing or decreasing as NAFLD pathology progressed. Compared with NLH, NASH F0 was characterized by increased inflammatory gene expression, such as gamma-interferon-inducible lysosomal thiol reductase (IFI30) and chemokine (C-X-C motif) ligand 9 (CXCL9), while complement and coagulation related genes, such as C9 and complement component 4 binding protein beta (C4BPB), were reduced. In the presence of NASH F1-F4, extracellular matrix degrading proteinases and profibrotic/scar deposition genes, such as collagens and transforming growth factor beta 1 (TGFB1), were simultaneously increased, suggesting a dynamic state of tissue remodeling. Conclusion: In adults with obesity, distinct states of NAFLD are associated with intrahepatic perturbations in genes related to inflammation, complement and coagulation pathways, and tissue remodeling. These data provide insights into the dynamic pathogenesis of NAFLD in high-risk individuals.

Also flagged:LeukoencephalopathyLactateaspartyl tRNA synthaseLBSLmitochondrialwater
Journal Article 2021-08-11 ✓ 5 Snippets Li JL, Lee NC, Chen PS, Lee GH, Wu RM.
In-Text Gene Mentions

DARS2 is responsible for conjugation of aspartate to the cognate tRNA.

Leukoencephalopathy with Brainstem and Spinal Cord Involvement and Lactate Elevation: A Novel DARS2 Mutation and Intra‐Familial Heterogeneity

DARS2 encodes mitochondrial aspartyl‐tRNA synthetase, which conjugates aspartate to the cognate tRNA in the mitochondria.

…Elevation: A NovelDARS2Mutation and Intra‐Familial…

DARS2, which encodes…

Show Full Abstract

<h4>Background</h4>Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) is characterized by slowly progressive spastic gait, cerebellar symptoms, and posterior cord dysfunction. <i>DARS2</i>, which encodes mitochondrial aspartyl tRNA synthase, is associated with the rare disease.<h4>Cases</h4>The proband had gait disturbance since age 56, while her younger brother had the gait problem since his 20s and needed cane-assistance at age 45. Both cases showed typical demyelinating features of LBSL on the magnetic resonance imaging (MRI) involving the periventricular white matter, brainstem, cerebellum and spinal cord. Sequencing of both cases showed compound heterozygous mutations: c.228-16C>A and c.508C>T in <i>DARS2</i>. The c.228-16C>A is a common mutation in splicing site of intron 2, which causes alternative splicing defect of exon 3, while the c.508C>T at the exon 6 is novel. Our patients are unique in the relative late onset and the apparent difference in disease progression.<h4>Literature review</h4>Literatures from PubMed were reviewed. Five families showed intra-familial heterogeneity on age at onset or clinical severity.<h4>Conclusion</h4>We identified a family of LBSL with compound heterozygous mutations, and c.508C>T at the exon 6 is a novel one. Clinical heterogeneity was observed in the family and other literatures. Further research for underlying mechanism is required.

Research Square 2021-08-11 Preprint (No Snippets API) Pucci F, Annoni F, Santos RASd, Taccone FS, Rooman M.
Show Full Abstract

<title>Abstract</title> <p>The renin-angiotensin system (RAS) plays a pivotal role in a wide series of physiological processes. One of its key components, the angiotensin-converting enzyme 2, has been identified as the entry point of the SARS-CoV-2 virus into the host cells, so many studies have been devoted to study RAS dysregulation in COVID-19. Here we discuss the alterations of the regulatory RAS axes due to SARS-CoV-2 infection on the basis of a series of recent clinical and experimental analyzes, which, for example, quantify the levels and activity of RAS components, in order to disentangle the links between the impaired RAS functioning and the pathophysiological characteristics of COVID-19. Finally, we discussed the effects of some RAS-targeting drugs, and how they could potentially contribute to restore the normal RAS functionality and minimize COVID-19 severity.</p>

Research Square 2021-08-11 Preprint (No Snippets API) Rodriguez-Ortiz A, Montoya-Villegas JC, García-Vallejo F, Mina-Paz Y.
Show Full Abstract

<h4>Background: </h4> DNA methylation and histone posttranslational modifications are epigenetics processes which contribute to neurophenotype of Down Syndrome (DS). Previous reports present strong evidence that nonhistone High mobility group N proteins (HMGN) are epigenetic regulators. They play important functions in several process to maintain the brain homeostasis. We aimed to analyze the differential expression of five human HMGN genes along some brain structures and age ranks from DS postmorten brain samples. <h4>Method: </h4> ology: We performed a computational analysis of human HMGN expression from a DNA microarray experiment data (GEO database ID GSE59630). Using the transformed log2 data, we analyzed the differential expression of five HMGN genes in several brain areas associated with cognition in patients with DS. Moreover, using information from several genome databases, we explore the coexpression and protein interactions with the histones of nucleosome core particle and linker H1 histone. <h4>Results: </h4>: We registered that HMGN1 and HMGN5 were significantly overexpressed in hippocampus and areas of prefrontal cortex including DFC, OFC and VFC of DS patients. Age ranks comparisons between euploid control and DS individuals showed that HMGN2 and HMGN4 were overexpressed in the DS brain of 16 to 22 weeks of gestation. From BioGRID database we registered high interaction scores of HMGN2 and HMGN4 with Hist1H1A and Hist1H2BA, Hist2AG, and Hist1H3A respectively. <h4>Conclusions: </h4>: Overall our results give strong evidence to propose that DS would be an epigenetics-based aneuploidy. Remodeling the brain chromatin by HMGN1 and HMGN5 would essential pathway in the modification of brain homeostasis in DS.

Also flagged:AntibodyNew World Hemorrhagic FeverTransferrin Receptor 1hemorrhagic feversglycoproteinsGP
Journal Article 2021-08-10 No Snippets Ferrero S, Flores MD, Short C, Vazquez CA, Clark LE, Ziegenbein J, Zink S, Fuentes D, Payes C, Batto MV, Collazo M, García CC, Abraham J, Cordo SM, Rodriguez JA, Helguera G.
Show Full Abstract

Pathogenic clade B New World mammarenaviruses (NWM) can cause Argentine, Venezuelan, Brazilian, and Bolivian hemorrhagic fevers. Sequence variability among NWM glycoproteins (GP) poses a challenge to the development of broadly neutralizing therapeutics against the entire clade of viruses. However, blockade of their shared binding site on the apical domain of human transferrin receptor 1 (hTfR1/CD71) presents an opportunity for the development of effective and broadly neutralizing therapeutics. Here, we demonstrate that the murine monoclonal antibody OKT9, which targets the apical domain of hTfR1, can sterically block cellular entry by viral particles presenting clade B NWM glycoproteins (GP1-GP2). OKT9 blockade is also effective against viral particles pseudotyped with glycoproteins of a recently identified pathogenic Sabia-like virus. With nanomolar affinity for hTfR1, the OKT9 antigen binding fragment (OKT9-Fab) sterically blocks clade B NWM-GP1s and reduces infectivity of an attenuated strain of Junin virus. Binding of OKT9 to the hTfR1 ectodomain in its soluble, dimeric state produces stable assemblies that are observable by negative-stain electron microscopy. A model of the OKT9-sTfR1 complex, informed by the known crystallographic structure of sTfR1 and a newly determined structure of the OKT9 antigen binding fragment (Fab), suggests that OKT9 and the Machupo virus GP1 share a binding site on the hTfR1 apical domain. The structural basis for this interaction presents a framework for the design and development of high-affinity, broadly acting agents targeting clade B NWMs. <b>IMPORTANCE</b> Pathogenic clade B NWMs cause grave infectious diseases, the South American hemorrhagic fevers. Their etiological agents are Junin (JUNV), Guanarito (GTOV), Sabiá (SABV), Machupo (MACV), Chapare (CHAV), and a new Sabiá-like (SABV-L) virus recently identified in Brazil. These are priority A pathogens due to their high infectivity and mortality, their potential for person-to-person transmission, and the limited availability of effective therapeutics and vaccines to curb their effects. While low homology between surface glycoproteins of NWMs foils efforts to develop broadly neutralizing therapies targeting NWMs, this work provides structural evidence that OKT9, a monoclonal antibody targeting a single NWM glycoprotein binding site on hTfR1, can efficiently prevent their entry into cells.

Also flagged:OligodendrogliomaastrogliomaAnaplastic oligodendrogliomaIDHGlioblastomaDCA
Journal Article 2021-08-10 ✓ 1 Snippet Xiao M, Du C, Zhang C, Zhang X, Li S, Zhang D, Jia W.
In-Text Gene Mentions

…These genes includedDNAH10, DNAH11 ,…

Show Full Abstract

Glioma is the most common malignancy of the nervous system with high rates of recurrence and mortality, even after surgery. The 5-year survival rate is only about 5%. NEK8 is involved in multiple biological processes in a variety of cancers; however, its role in glioma is still not clear. In the current study, we evaluated the prognostic value of NEK8, as well as its role in the pathogenesis of glioma. Using a bioinformatics approach and RNA-seq data from public databases, we found that NEK8 expression is elevated in glioma tissues; we further verified this result by RT-PCR, Western blotting and immunochemistry using clinical samples. Functional enrichment analyses of genes with correlated expression indicated that elevated NEK8 expression is associated with increased immune cell infiltration in glioma and may affect the tumour microenvironment via the regulation of DNA damage/repair. Survival analyses revealed that high levels of NEK8 are associated with a poorer prognosis; higher WHO grade, IDH status, 1p/19q codeletion, age and NEK8 were identified as an independent prognostic factor. These findings support the crucial role of NEK8 in the progression of glioma via effects on immune cell infiltration and suggest that it is a new prognostic biomarker.

Also flagged:serotonin transportercortisolpsychological stress5-HTTLPRbindingglucocorticoid receptors
Journal Article 2021-08-10 ✓ 2 Snippets Kuhn L, Noack H, Skoluda N, Wagels L, Röhr AK, Schulte C, Eisenkolb S, Nieratschker V, Derntl B, Habel U.
In-Text Gene Mentions

…gene ( SLC6A4,5-HTT) gained much…

…rs25531 within the 5-HTTgene.…

Show Full Abstract

The experience of stress is related to individual wellbeing and vulnerability to psychopathology. Therefore, understanding the determinants of individual differences in stress reactivity is of great concern from a clinical perspective. The functional promotor polymorphism of the serotonin transporter gene (5-HTTLPR/rs25531) is such a factor, which has been linked to the acute stress response as well as the adverse effect of life stressors. In the present study, we compared the impact of two different stress induction protocols (Maastricht Acute Stress Test and ScanSTRESS) and the respective control conditions on affective ratings, salivary cortisol levels and cognitive performance. To this end, 156 healthy young males were tested and genotyped for the 5-HTTLPR/rs25531 polymorphism. While combined physiological and psychological stress in the MAST led to a greater cortisol increase compared to control conditions as well as the psychosocial ScanSTRESS, subjective stress ratings were highest in the ScanSTRESS condition. Stress induction in general affected working memory capacity but not response inhibition. Subjective stress was also influenced by 5-HTTLPR/rs25531 genotype with the high expression group showing lower stress ratings than lower expression groups. In line with previous research, we identified the low expression variant of the serotonin transporter gene as a risk factor for increased stress reactivity. While some dimensions of the human stress response may be stressor specific, cognitive outcomes such as working memory performance are influenced by stress in general. Different pathways of stress processing and possible underlying mechanisms are discussed.

Also flagged:actinhsp9060 kDa heat shock protein, mitochondrialParvalbumin, thymic CPV3Hemoglobin subunit betapolypeptide
Journal Article 2021-08-10 ✓ 1 Snippet Borawska-Dziadkiewicz J, Darewicz M, Tarczyńska AS.
In-Text Gene Mentions

…DPP-IV inhibitor, rarelyDPP-IIIinhibitor, renin inhibitor,…

Show Full Abstract

Apart from the classical (experimental) methods, biologically active peptides can be studied via bioinformatics approach, also known as in silico analysis. This study aimed to verify the following research hypothesis: ACE inhibitors and antioxidant peptides can be released from salmon and carp proteins during simulated in silico human-like gastrointestinal digestion. The potential to release biopeptides was evaluated using the BIOPEP-UWM quantitative criteria including the profile of biological activity, frequency of the occurrence (A)/release (AE) of fragments with an ACE inhibitory or antioxidant activity by selected enzymes, and relative frequency of release of bioactive fragments with a given activity by selected enzymes (W). Salmon collagen and myofibrillar proteins of carp turned out to be the best potential source of the searched peptides-ACE inhibitors and antioxidant peptides. Nonetheless, after digestion, the highest numbers of ACE inhibitors and antioxidant peptides were potentially released from the myofibrillar proteins of salmon and carp. Peptide Ranker Score, Pepsite2, and ADMETlab platform were applied to evaluate peptides' bioactivity potential, their safety and drug-like properties. Among the 63 sequences obtained after the simulated digestion of salmon and carp proteins, 30 were considered potential biopeptides. The amino acid sequences of ACE-inhibiting and antioxidant peptides were predominated by P, G, F, W, R, and L. The predicted high probability of absorption of most analyzed peptides and their low toxicity should be considered as their advantage.

Also flagged:HGH1colorectal cancercell proliferationcancersusceptibility 21gene expression
Journal Article 2021-08-10 ✓ 2 Snippets Zhang C, E J, Yu E.
In-Text Gene Mentions

CSE1L

ZNFX1

Show Full Abstract

Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Long non-coding RNAs (lncRNAs) have been increasingly reported to serve vital parts in malignancies including CRC. Although cancer susceptibility 21 (CASC21) has been uncovered to play a part in CRC, its mechanism still needs further explanation. Thus, our study aimed to further explore the influence and mechanism of CASC21 in CRC progression. Quantitative real-time RT-PCR and western blot were performed to detect gene expression; a series of functional assays were performed to investigate the effect of CASC21 on CRC cells; <i>in vivo</i> tumour growth was evaluated via the nude mice xenograft model. The results revealed that CASC21 facilitated CRC cell proliferation, migration, epithelial-mesenchymal transition (EMT) and stemness. In addition, CASC21 was co-expressed with and bound to transcription factor POU5F1B (POU class 5 homeobox 1B). CASC21 recruited POU5F1B to HGH1 promoter to activate the transcription of HGH1 homolog. Also, CASC21 served as a competitive endogenous RNA (ceRNA) to up-regulate HGH1 via endogenously sponging miR-485-5p. Moreover, HGH1 overexpression counteracted the suppression of CASC21 deficiency on CRC tumour growth. In summary, our study indicated that CASC21 enhanced the expression of HGH1 to promote the malignancy of CRC by recruiting POU5F1B and sponging miR-485-5p, suggesting a key role of CASC21 in CRC progression.

Also flagged:NELL2neural EGFL like 2KITLGKIT ligandGHRHRGrowth hormone releasing hormone receptor
Journal Article 2021-08-10 No Snippets Zhao X, Nie C, Zhang J, Li X, Zhu T, Guan Z, Chen Y, Wang L, Lv XZ, Yang W, Jia Y, Ning Z, Li H, Qu C, Wang H, Qu L.
Show Full Abstract

<h4>Background</h4>Since the domestication of chicken, various breeds have been developed for food production, entertainment, and so on. Compared to indigenous chicken breeds which generally do not show elite production performance, commercial breeds or lines are selected intensely for meat or egg production. In the present study, in order to understand the molecular mechanisms underlying the dramatic differences of egg number between commercial egg-type chickens and indigenous chickens, we performed a genome-wide association study (GWAS) in a mixed linear model.<h4>Results</h4>We obtained 148 single nucleotide polymorphisms (SNPs) associated with egg number traits (57 significantly, 91 suggestively). Among them, 4 SNPs overlapped with previously reported quantitative trait loci (QTL), including 2 for egg production and 2 for reproductive traits. Furthermore, we identified 32 candidate genes based on the function of the screened genes. These genes were found to be mainly involved in regulating hormones, playing a role in the formation, growth, and development of follicles, and in the development of the reproductive system. Some genes such as NELL2 (neural EGFL like 2), KITLG (KIT ligand), GHRHR (Growth hormone releasing hormone receptor), NCOA1 (Nuclear receptor coactivator 1), ITPR1 (inositol 1, 4, 5-trisphosphate receptor type 1), GAMT (guanidinoacetate N-methyltransferase), and CAMK4 (calcium/calmodulin-dependent protein kinase IV) deserve our attention and further study since they have been reported to be closely related to egg production, egg number and reproductive traits. In addition, the most significant genomic region obtained in this study was located at 48.61-48.84 Mb on GGA5. In this region, we have repeatedly identified four genes, in which YY1 (YY1 transcription factor) and WDR25 (WD repeat domain 25) have been shown to be related to oocytes and reproductive tissues, respectively, which implies that this region may be a candidate region underlying egg number traits.<h4>Conclusion</h4>Our study utilized the genomic information from various chicken breeds or populations differed in the average annual egg number to understand the molecular genetic mechanisms involved in egg number traits. We identified a series of SNPs, candidate genes, or genomic regions that associated with egg number, which could help us in developing the egg production trait in chickens.

Also flagged:caspase-3GAPDHFLPCancerAdenocarcinomaPRPF8
Journal Article 2021-08-10 ✓ 5 Snippets Maurizy C, Abeza C, Lemmers B, Gabola M, Longobardi C, Pinet V, Ferrand M, Paul C, Bremond J, Langa F, Gerbe F, Jay P, Verheggen C, Tinari N, Helmlinger D, Lattanzio R, Bertrand E, Hahne M, Pradet-Balade B.
In-Text Gene Mentions

Olfm4

Olfm4 staining was similar between control and VilCreERT2; Rpap3flox/flox mice from day 4 to day 6 after tamoxifen injection.

…istochemistry (Rpb1, Lysozyme,Olfm4, Pih1d1), tissue slides…

…performed immunostaining forOlfm4, a trans-membrane protein…

Olfm4staining was similar…

Show Full Abstract

The R2TP chaperone cooperates with HSP90 to integrate newly synthesized proteins into multi-subunit complexes, yet its role in tissue homeostasis is unknown. Here, we generated conditional, inducible knock-out mice for Rpap3 to inactivate this core component of R2TP in the intestinal epithelium. In adult mice, Rpap3 invalidation caused destruction of the small intestinal epithelium and death within 10 days. Levels of R2TP substrates decreased, with strong effects on mTOR, ATM and ATR. Proliferative stem cells and progenitors deficient for Rpap3 failed to import RNA polymerase II into the nucleus and they induced p53, cell cycle arrest and apoptosis. Post-mitotic, differentiated cells did not display these alterations, suggesting that R2TP clients are preferentially built in actively proliferating cells. In addition, high RPAP3 levels in colorectal tumors from patients correlate with bad prognosis. Here, we show that, in the intestine, the R2TP chaperone plays essential roles in normal and tumoral proliferation.

Also flagged:Fibrosisextracellulardeathcell adhesionaginginfections
Journal Article 2021-08-10 No Snippets Gomes RN, Manuel F, Nascimento DS.
Show Full Abstract

Fibrosis is a pathologic process characterized by the replacement of parenchymal tissue by large amounts of extracellular matrix, which may lead to organ dysfunction and even death. Fibroblasts are classically associated to fibrosis and tissue repair, and seldom to regeneration. However, accumulating evidence supports a pro-regenerative role of fibroblasts in different organs. While some organs rely on fibroblasts for maintaining stem cell niches, others depend on fibroblast activity, particularly on secreted molecules that promote cell adhesion, migration, and proliferation, to guide the regenerative process. Herein we provide an up-to-date overview of fibroblast-derived regenerative signaling across different organs and discuss how this capacity may become compromised with aging. We further introduce a new paradigm for regenerative therapies based on reverting adult fibroblasts to a fetal/neonatal-like phenotype.

Also flagged:peroxisome proliferator-activated receptor αmetabolismPPARαligand-activated nuclear receptorlipidhypertrophy
Journal Article 2021-08-10 ✓ 1 Snippet Wang X, Zhu XX, Jiao SY, Qi D, Yu BQ, Xie GM, Liu Y, Song YT, Xu Q, Xu QB, Gonzalez FJ, Du J, Wang XM, Qu AJ.
In-Text Gene Mentions

Eci2

Show Full Abstract

Peroxisome proliferator-activated receptor α (PPARα), a ligand-activated nuclear receptor critical for systemic lipid homeostasis, has been shown closely related to cardiac remodeling. However, the roles of cardiomyocyte PPARα in pressure overload-induced cardiac remodeling remains unclear because of lacking a cardiomyocyte-specific Ppara-deficient (Ppara<sup>ΔCM</sup>) mouse model. This study aimed to determine the specific role of cardiomyocyte PPARα in transverse aortic constriction (TAC)-induced cardiac remodeling using an inducible Ppara<sup>ΔCM</sup> mouse model. Ppara<sup>ΔCM</sup> and Ppara<sup>fl/fl</sup> mice were randomly subjected to sham or TAC for 2 weeks. Cardiomyocyte PPARα deficiency accelerated TAC-induced cardiac hypertrophy and fibrosis. Transcriptome analysis showed that genes related to fatty acid metabolism were dramatically downregulated, but genes critical for glycolysis were markedly upregulated in Ppara<sup>ΔCM</sup> hearts. Moreover, the hypertrophy-related genes, including genes involved in extracellular matrix (ECM) remodeling, cell adhesion, and cell migration, were upregulated in hypertrophic Ppara<sup>ΔCM</sup> hearts. Western blot analyses demonstrated an increased HIF1α protein level in hypertrophic Ppara<sup>ΔCM</sup> hearts. PET/CT analyses showed an enhanced glucose uptake in hypertrophic Ppara<sup>ΔCM</sup> hearts. Bioenergetic analyses further revealed that both basal and maximal oxygen consumption rates and ATP production were significantly increased in hypertrophic Ppara<sup>fl/fl</sup> hearts; however, these increases were markedly blunted in Ppara<sup>ΔCM</sup> hearts. In contrast, hypertrophic Ppara<sup>ΔCM</sup> hearts exhibited enhanced extracellular acidification rate (ECAR) capacity, as reflected by increased basal ECAR and glycolysis but decreased glycolytic reserve. These results suggest that cardiomyocyte PPARα is crucial for the homeostasis of both energy metabolism and ECM during TAC-induced cardiac remodeling, thus providing new insights into potential therapeutics of cardiac remodeling-related diseases.

Also flagged:Spinocerebellar ataxiashereditary degenerative diseases of thecerebellar ataxiapathogenesisneurological disordersbehavioral
Journal Article 2021-08-10 No Snippets Cendelin J, Cvetanovic M, Gandelman M, Hirai H, Orr HT, Pulst SM, Strupp M, Tichanek F, Tuma J, Manto M.
Show Full Abstract

Spinocerebellar ataxias (SCAs) represent a large group of hereditary degenerative diseases of the nervous system, in particular the cerebellum, and other systems that manifest with a variety of progressive motor, cognitive, and behavioral deficits with the leading symptom of cerebellar ataxia. SCAs often lead to severe impairments of the patient's functioning, quality of life, and life expectancy. For SCAs, there are no proven effective pharmacotherapies that improve the symptoms or substantially delay disease progress, i.e., disease-modifying therapies. To study SCA pathogenesis and potential therapies, animal models have been widely used and are an essential part of pre-clinical research. They mainly include mice, but also other vertebrates and invertebrates. Each animal model has its strengths and weaknesses arising from model animal species, type of genetic manipulation, and similarity to human diseases. The types of murine and non-murine models of SCAs, their contribution to the investigation of SCA pathogenesis, pathological phenotype, and therapeutic approaches including their advantages and disadvantages are reviewed in this paper. There is a consensus among the panel of experts that (1) animal models represent valuable tools to improve our understanding of SCAs and discover and assess novel therapies for this group of neurological disorders characterized by diverse mechanisms and differential degenerative progressions, (2) thorough phenotypic assessment of individual animal models is required for studies addressing therapeutic approaches, (3) comparative studies are needed to bring pre-clinical research closer to clinical trials, and (4) mouse models complement cellular and invertebrate models which remain limited in terms of clinical translation for complex neurological disorders such as SCAs.

Also flagged:Cardiovascular DiseaseDeathkidney diseasesudden cardiac deathdiabetes mellituschronic kidney disease
Journal Article 2021-08-10 No Snippets Schwantes-An TH, Vatta M, Abreu M, Wetherill L, Edenberg HJ, Foroud TM, Chertow GM, Moe SM.
Show Full Abstract

<h4>Introduction</h4>Patients with chronic kidney disease experience high rates of cardiovascular mortality and morbidity. When kidney disease progresses to the need for dialysis, sudden cardiac death (SCD) accounts for 25-35% of all cardiovascular deaths. The objective was to determine if rare genetic variants known to be associated with cardiovascular death in the general population are associated with SCD in patients undergoing hemodialysis.<h4>Methods</h4>We performed a case-control study comparing 126 (37 African American [AfAn] and 89 European ancestry [EA]) SCD subjects and 107 controls (34 AfAn and 73 EA), matched for age, sex, self-reported race, dialysis duration (<2, 2-5 and >5 years), and the presence or absence of diabetes mellitus. To target the coding regions of genes previously reported to be associated with 15 inherited cardiac conditions (ICCs), we used the TruSight Cardio Kit (Illumina, San Diego, CA, USA) to capture the genetic regions of interest. In all, the kit targets 572-kb regions that include the protein-coding regions and 40-bp 5' and 3' end-flanking regions of 174 genes associated with the 15 ICCs. Using the sequence data, burden tests were conducted to identify genes with an increased number of variants among SCD cases compared to matched controls.<h4>Results</h4>Eleven genes were associated with SCD, but after correction for multiple testing, none of the 174 genes were identified as having more variants in the SCD cases than the matched controls, including previously identified genes. Secondary burden tests grouping variants based on diseases and gene function did not produce statistically significant associations.<h4>Discussion/conclusions</h4>We found no associations between genes known to be associated with ICCs and SCD in our sample of patients undergoing hemodialysis. This suggests that genetic causes are unlikely to be a major pathogenic factor in SCD in hemodialysis patients, although our sample size limits definitive conclusions.

Also flagged:IronDeferoxamineIschemic StrokestrokeFerroptosisdeath
Journal Article 2021-08-10 ✓ 1 Snippet Millán M, DeGregorio-Rocasolano N, Pérez de la Ossa N, Reverté S, Costa J, Giner P, Silva Y, Sobrino T, Rodríguez-Yáñez M, Nombela F, Campos F, Serena J, Vivancos J, Martí-Sistac O, Cortés J, Dávalos A, Gasull T.
In-Text Gene Mentions

…reported for healthy non-hemochromatosisindividuals [ 30…

Show Full Abstract

A role of iron as a target to prevent stroke-induced neurodegeneration has been recently revisited due to new evidence showing that ferroptosis inhibitors are protective in experimental ischemic stroke and might be therapeutic in other neurodegenerative brain pathologies. Ferroptosis is a new form of programmed cell death attributed to an overwhelming lipidic peroxidation due to excessive free iron and reactive oxygen species (ROS). This study aims to evaluate the safety and tolerability and to explore the therapeutic efficacy of the iron chelator and antioxidant deferoxamine mesylate (DFO) in ischemic stroke patients. Administration of placebo or a single DFO bolus followed by a 72 h continuous infusion of three escalating doses was initiated during the tPA infusion, and the impact on blood transferrin iron was determined. Primary endpoint was safety and tolerability, and secondary endpoint was good clinical outcome (clinicalTrials.gov NCT00777140). DFO was found safe as adverse effects were not different between placebo and DFO arms. DFO (40-60 mg/Kg/day) reduced the iron saturation of blood transferrin. A trend to efficacy was observed in patients with moderate-severe ischemic stroke (NIHSS > 7) treated with DFO 40-60 mg/Kg/day. A good outcome was observed at day 90 in 31% of placebo vs. 50-58% of the 40-60 mg/Kg/day DFO-treated patients.

Also flagged:Glaucomaeye diseasesof theoptic nervevisiondeath
Journal Article 2021-08-10 No Snippets Fernández-Vega Cueto A, Álvarez L, García M, Álvarez-Barrios A, Artime E, Fernández-Vega Cueto L, Coca-Prados M, González-Iglesias H.
Show Full Abstract

Glaucoma is an insidious group of eye diseases causing degeneration of the optic nerve, progressive loss of vision, and irreversible blindness. The number of people affected by glaucoma is estimated at 80 million in 2021, with 3.5% prevalence in people aged 40-80. The main biomarker and risk factor for the onset and progression of glaucoma is the elevation of intraocular pressure. However, when glaucoma is diagnosed, the level of retinal ganglion cell death usually amounts to 30-40%; hence, the urgent need for its early diagnosis. Molecular biomarkers of glaucoma, from proteins to metabolites, may be helpful as indicators of pathogenic processes observed during the disease's onset. The discovery of human glaucoma biomarkers is hampered by major limitations, including whether medications are influencing the expression of molecules in bodily fluids, or whether tests to validate glaucoma biomarker candidates should include human subjects with different types and stages of the disease, as well as patients with other ocular and neurodegenerative diseases. Moreover, the proper selection of the biofluid or tissue, as well as the analytical platform, should be mandatory. In this review, we have summarized current knowledge concerning proteomics- and metabolomics-based glaucoma biomarkers, with specificity to human eye tissue and fluid, as well the analytical approach and the main results obtained. The complex data published to date, which include at least 458 different molecules altered in human glaucoma, merit a new, integrative approach allowing for future diagnostic tests based on the absolute quantification of local and/or systemic biomarkers of glaucoma.

Also flagged:Multiple Mitochondrial Dysfunction Syndromesironsulfurphosphorylationlipoic acidsynthesis
Journal Article 2021-08-10 No Snippets Lebigot E, Schiff M, Golinelli-Cohen MP.
Show Full Abstract

Mitochondrial proteins carrying iron-sulfur (Fe-S) clusters are involved in essential cellular pathways such as oxidative phosphorylation, lipoic acid synthesis, and iron metabolism. NFU1, BOLA3, IBA57, ISCA2, and ISCA1 are involved in the last steps of the maturation of mitochondrial [4Fe-4S]-containing proteins. Since 2011, mutations in their genes leading to five multiple mitochondrial dysfunction syndromes (MMDS types 1 to 5) were reported. The aim of this systematic review is to describe all reported MMDS-patients. Their clinical, biological, and radiological data and associated genotype will be compared to each other. Despite certain specific clinical elements such as pulmonary hypertension or dilated cardiomyopathy in MMDS type 1 or 2, respectively, nearly all of the patients with MMDS presented with severe and early onset leukoencephalopathy. Diagnosis could be suggested by high lactate, pyruvate, and glycine levels in body fluids. Genetic analysis including large gene panels (Next Generation Sequencing) or whole exome sequencing is needed to confirm diagnosis.

Also flagged:Gallbladder cancercancerbiliary tract system cancertranscription factorspathogenesisepithelial-mesenchymal transition
Journal Article 2021-08-10 ✓ 1 Snippet Roy N, Kshattry M, Mandal S, Jolly MK, Bhattacharyya DK, Barah P.
In-Text Gene Mentions

…ABCB1, ABCB4 andDCCwith GBC risk…

Show Full Abstract

Gallbladder cancer (GBC) has a lower incidence rate among the population relative to other cancer types but is a major contributor to the total number of biliary tract system cancer cases. GBC is distinguished from other malignancies by its high mortality, marked geographical variation and poor prognosis. To date no systemic targeted therapy is available for GBC. The main objective of this study is to determine the molecular signatures correlated with GBC development using integrative systems level approaches. We performed analysis of publicly available transcriptomic data to identify differentially regulated genes and pathways. Differential co-expression network analysis and transcriptional regulatory network analysis was performed to identify hub genes and hub transcription factors (TFs) associated with GBC pathogenesis and progression. Subsequently, we assessed the epithelial-mesenchymal transition (EMT) status of the hub genes using a combination of three scoring methods. The identified hub genes including, CDC6, MAPK15, CCNB2, BIRC7, L3MBTL1 were found to be regulators of cell cycle components which suggested their potential role in GBC pathogenesis and progression.

Also flagged:AutophagyChloroquineLeukemiadegradationcanceracute myeloid leukemia
Journal Article 2021-08-10 No Snippets Grønningsæter IS, Reikvam H, Aasebø E, Bartaula-Brevik S, Hernandez-Valladares M, Selheim F, Berven FS, Tvedt TH, Bruserud Ø, Hatfield KJ.
Show Full Abstract

Autophagy is a highly conserved cellular degradation process that prevents cell damage and promotes cell survival, and clinical efforts have exploited autophagy inhibition as a therapeutic strategy in cancer. Chloroquine is a well-known antimalarial agent that inhibits late-stage autophagy. We evaluated the effects of chloroquine on cell viability and proliferation of acute myeloid leukemia acute myeloid leukemia (AML) cells derived from 81 AML patients. Our results show that chloroquine decreased AML cell viability and proliferation for the majority of patients. Furthermore, a subgroup of AML patients showed a greater susceptibility to chloroquine, and using hierarchical cluster analysis, we identified 99 genes upregulated in this patient subgroup, including several genes related to leukemogenesis. The combination of chloroquine with low-dose cytarabine had an additive inhibitory effect on AML cell proliferation. Finally, a minority of patients showed increased extracellular constitutive mediator release in the presence of chloroquine, which was associated with strong antiproliferative effects of chloroquine as well as cytarabine. We conclude that chloroquine has antileukemic activity and should be further explored as a therapeutic drug against AML in combination with other cytotoxic or metabolic drugs; however, due to the patient heterogeneity, chloroquine therapy will probably be effective only for selected patients.

Also flagged:Lipoic AcidOligoethyleneiminetumordisulfidecervical carcinomacell cycle arrest
Journal Article 2021-08-10 No Snippets Huang Y, Wang L, Chen Y, Han H, Li Q.
Show Full Abstract

MiR-34a, an important tumor suppressor, has been demonstrated to possess great potential in tumor gene therapy. To achieve the upregulation of miR-34a expression level, an oligoethyleneimine (OEI) derivative was constructed and employed as the carrier through the modification with lipoic acid (LA), namely LA-OEI. In contrast to OEI, the derivative LA-OEI exhibited superior transfection efficiency measured by confocal laser scanning microscopy and flow cytometry, owing to rapid cargo release in the disulfide bond-based reduction sensitive pattern. The anti-proliferation and anti-migration effects were tested after the miR-34a transfection to evaluate the anti-tumor response, using human cervical carcinoma cell line HeLa as a model. The delivery of LA-OEI/miR-34a nanoparticles could achieve obvious anti-proliferative effect caused by the induction of cell apoptosis and cell cycle arrest at G1 phase. In addition, it could inhibit the migration of tumor cells via the downregulation of MMP-9 and Notch-1 level. Overall, the LA-OEI-mediated miR-34a delivery was potential to be used as an effective way in the tumor gene therapy.

Also flagged:MuscleCell DifferentiationMyotonic dystrophy type 1gene expressionDystrophyType 1
Journal Article 2021-08-10 ✓ 2 Snippets Todorow V, Hintze S, Kerr ARW, Hehr A, Schoser B, Meinke P.
In-Text Gene Mentions

Consistently, more splicing factors have been identified to regulate alternative splicing events in DM1, among them STAU1 and HNRNPA1 [51,52].

…DM1, among themSTAU1and HNRNPA1 […

Show Full Abstract

Myotonic dystrophy type 1 (DM1) is caused by CTG-repeat expansions leading to a complex pathology with a multisystemic phenotype that primarily affects the muscles and brain. Despite a multitude of information, especially on the alternative splicing of several genes involved in the pathology, information about additional factors contributing to the disease development is still lacking. We performed RNAseq and gene expression analyses on proliferating primary human myoblasts and differentiated myotubes. GO-term analysis indicates that in myoblasts and myotubes, different molecular pathologies are involved in the development of the muscular phenotype. Gene set enrichment for splicing reveals the likelihood of whole, differentiation stage specific, splicing complexes that are misregulated in DM1. These data add complexity to the alternative splicing phenotype and we predict that it will be of high importance for therapeutic interventions to target not only mature muscle, but also satellite cells.

Also flagged:S100 calcium binding protein A1High mobility group protein B2Hemoglobin subunit alphaprotein 2leucinedelta
Journal Article 2021-08-10 ✓ 1 Snippet Karami Fath M, Jahangiri A, Ganji M, Sefid F, Payandeh Z, Hashemi ZS, Pourzardosht N, Hessami A, Mard-Soltani M, Zakeri A, Rahbar MR, Khalili S.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

Autoimmune diseases (ADs) could occur due to infectious diseases and vaccination programs. Since millions of people are expected to be infected with SARS-CoV-2 and vaccinated against it, autoimmune consequences seem inevitable. Therefore, we have investigated the whole proteome of the SARS-CoV-2 for its ability to trigger ADs. In this regard, the entire proteome of the SARS-CoV-2 was chopped into more than 48000 peptides. The produced peptides were searched against the entire human proteome to find shared peptides with similar experimentally confirmed T-cell and B-cell epitopes. The obtained peptides were checked for their ability to bind to HLA molecules. The possible population coverage was calculated for the most potent peptides. The obtained results indicated that the SARS-CoV-2 and human proteomes share 23 peptides originated from ORF1ab polyprotein, nonstructural protein NS7a, Surface glycoprotein, and Envelope protein of SARS-CoV-2. Among these peptides, 21 peptides had experimentally confirmed equivalent epitopes. Amongst, only nine peptides were predicted to bind to HLAs with known global allele frequency data, and three peptides were able to bind to experimentally confirmed HLAs of equivalent epitopes. Given the HLAs which have already been reported to be associated with ADs, the ESGLKTIL, RYPANSIV, NVAITRAK, and RRARSVAS were determined to be the most harmful peptides of the SARS-CoV-2 proteome. It would be expected that the COVID-19 pandemic and the vaccination against this pathogen could significantly increase the ADs incidences, especially in populations harboring HLA-B*08:01, HLA-A*024:02, HLA-A*11:01 and HLA-B*27:05. The Southeast Asia, East Asia, and Oceania are at higher risk of AD development.

Also flagged:COVID-19community-acquired pneumoniasecondary pulmonary tuberculosisCoronavirus disease 2019deathpolymerase
Journal Article 2021-08-10 No Snippets Wang SH, Satapathy SC, Anderson D, Chen SX, Zhang YD.
Show Full Abstract

<b>Aim:</b> Coronavirus disease 2019 (COVID-19) is a form of disease triggered by a new strain of coronavirus. This paper proposes a novel model termed "deep fractional max pooling neural network (DFMPNN)" to diagnose COVID-19 more efficiently. <b>Methods:</b> This 12-layer DFMPNN replaces max pooling (MP) and average pooling (AP) in ordinary neural networks with the help of a novel pooling method called "fractional max-pooling" (FMP). In addition, multiple-way data augmentation (DA) is employed to reduce overfitting. Model averaging (MA) is used to reduce randomness. <b>Results:</b> We ran our algorithm on a four-category dataset that contained COVID-19, community-acquired pneumonia, secondary pulmonary tuberculosis (SPT), and healthy control (HC). The 10 runs on the test set show that the micro-averaged F1 (MAF) score of our DFMPNN is 95.88%. <b>Discussions:</b> This proposed DFMPNN is superior to 10 state-of-the-art models. Besides, FMP outperforms traditional MP, AP, and L2-norm pooling (L2P).

Also flagged:Ferroptosisdeathmyocardial infarctionstrokeacute kidney injuryiron
Journal Article 2021-08-10 No Snippets Chen Y, Fan H, Wang S, Tang G, Zhai C, Shen L.
Show Full Abstract

Ischemia-reperfusion (I/R) injury is a major cause of cell death and organ damage in numerous pathologies, including myocardial infarction, stroke, and acute kidney injury. Current treatment methods for I/R injury are limited. Ferroptosis, which is a newly uncovered type of regulated cell death characterized by iron overload and lipid peroxidation accumulation, has been investigated in various diseases. There is increasing evidence of a close association between ferroptosis and I/R injury, with ferroptosis frequently identified as a new therapeutic target for the management of I/R injury. This review summarizes the current status of ferroptosis and discusses its relationship with I/R injury, as well as potential treatment strategies targeting it.

Also flagged:IL-6FOSBJUNBMAPK15MAP3K12CXCL8
Journal Article 2021-08-10 ✓ 1 Snippet Wu Q, Cui D, Chao X, Chen P, Liu J, Wang Y, Su T, Li M, Xu R, Zhu Y, Zhang Y.
In-Text Gene Mentions

…genes were GBA3,POU3F2, CFAP69, MASP2, ND5,…

Show Full Abstract

Enterotoxigenic <i>Escherichia coli</i> (ETEC) is an important cause of post-weaning diarrhea (PWD) worldwide, resulting in huge economic losses to the swine industry worldwide. In this study, to understand the pathogenesis, the transcriptomic analysis was performed to explore the biological processes (BP) in porcine intestinal epithelial J2 cells infected with an emerging ETEC strain isolated from weaned pigs with diarrhea. Under the criteria of |fold change| (FC) ≥ 2 and <i>P</i> < 0.05 with false discovery rate < 0.05, a total of 131 referenced and 19 novel differentially expressed genes (DEGs) were identified after ETEC infection, including 96 upregulated DEGs and 54 downregulated DEGs. The Gene Ontology (GO) analysis of DEGs showed that ETEC evoked BP specifically involved in response to lipopolysaccharide (LPS) and negative regulation of intracellular signal transduction. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that immune response-related pathways were mainly enriched in J2 cells after ETEC infection, in which tumor necrosis factor (TNF), interleukin 17, and mitogen-activated protein kinase (MAPK) signaling pathways possessed the highest rich factor, followed by nucleotide-binding and oligomerization domain-like receptor (NLRs), C-type lectin receptor (CLR), cytokine-cytokine receptor interaction, and Toll-like receptor (TLR), and nuclear factor kappa-B (NF-κB) signaling pathways. Furthermore, 30 of 131 referenced DEGs, especially the nuclear transcription factor AP-1 and NF-κB, participate in the immune response to infection through an integral signal cascade and can be target molecules for prevention and control of enteric ETEC infection by probiotic <i>Lactobacillus reuteri</i>. Our data provide a comprehensive insight into the immune response of porcine intestinal epithelial cells (IECs) to ETEC infection and advance the identification of targets for prevention and control of ETEC-related PWD.

Also flagged:Nucleocapsid ProteinsinclSARSinfectionsynthesisAbo
Journal Article 2021-08-10 ✓ 2 Snippets Dong Q, Liu M, Chen B, Zhao Z, Chen T, Wang C, Zhuang S, Li Y, Wang Y, Ai L, Liu Y, Liang H, Qi L, Gu Y.
In-Text Gene Mentions

Among the 41 resistant and 130 sensitive genes, PRRC2A, USP34, and DNAH10 overlapped, which was not contrary to our hypothesis because mutations of these three genes mediate the response to PARPis in different cancer types.

…USP34 , andDNAH10overlapped, which was…

Show Full Abstract

Poly (ADPribose) polymerase inhibitors (PARPis) are clinically approved drugs designed according to the concept of synthetic lethality (SL) interaction. It is crucial to expand the scale of patients who can benefit from PARPis, and overcome drug resistance associated with it. Genetic interactions (GIs) include SL and synthetic viability (SV) that participate in drug response in cancer cells. Based on the hypothesis that mutated genes with SL or SV interactions with PARP1/2/3 are potential sensitive or resistant PARPis biomarkers, respectively, we developed a novel computational method to identify them. We analyzed fitness variation of cell lines to identify PARP1/2/3-related GIs according to CRISPR/Cas9 and RNA interference functional screens. Potential resistant/sensitive mutated genes were identified using pharmacogenomic datasets. We identified 41 candidate resistant and 130 candidate sensitive PARPi-response related genes, and observed that <i>EGFR</i> with gain-of-function mutation induced PARPi resistance, and predicted a combination therapy with PARP inhibitor (veliparib) and EGFR inhibitor (erlotinib) for lung cancer. We also revealed that a resistant gene set (<i>TNN</i>, <i>PLEC</i>, and <i>TRIP12</i>) in lower grade glioma and a sensitive gene set (<i>BRCA2</i>, <i>TOP3A</i>, and <i>ASCC3</i>) in ovarian cancer, which were associated with prognosis. Thus, cancer genome-derived GIs provide new insights for identifying PARPi biomarkers and a new avenue for precision therapeutics.

Also flagged:CamptothecinCurcumincancersage-related disordersReverse TranscriptaseAugustamine
Journal Article 2021-08-10 No Snippets Rowaiye AB, Mendes YJT, Olofinsae SA, Oche JB, Oladipo OH, Okpalefe OA, Ogidigo JO.
Show Full Abstract

<h4>Objectives</h4>The Human Telomerase enzyme has become a drug target in the treatment of cancers and age-related disorders. This study aims to identify potential natural inhibitors of the Human Telomerase from compounds derived from edible African plants.<h4>Materials and methods</h4>A library of 1,126 natural compounds was molecularly docked against the Telomerase Reverse Transcriptase (PDB ID: 5ugw), the catalytic subunit of the target protein. Curcumin, a known Telomerase inhibitor was used as the standard. The front-runner compounds were screened for bioavailability, pharmacokinetic properties, and bioactivity using the SWISSADME, PKCSM, and Molinspiration webservers respectively. The molecular dynamic simulation and analyses of the apo and holo proteins were performed by the Galaxy supercomputing webserver.<h4>Results</h4>The results of the molecular docking and virtual screening reveal Augustamine and Camptothecin as lead compounds. Augustamine has better drug-likeness and pharmacokinetic properties while Camptothecin showed better bioactivity and stronger binding affinity (-8.2 kcal/mol) with the target. The holo structure formed by Camptothecin showed greater inhibitory activity against the target with a total RMSF of 169.853, B-Factor of 20.164, and 108 anti-correlating residues.<h4>Conclusion</h4>Though they both act at the same binding site, Camptothecin induces greater Telomerase inhibition and better molecular stability than the standard, Curcumin. Further tests are required to investigate the inhibitory activities of the lead compounds.

Also flagged:colorectal cancercancerargininosuccinate synthase 1pathogenesisreverse transcriptionvasohibin 1
Journal Article 2021-08-10 ✓ 2 Snippets Xiong HL, Zhong XH, Guo XH, Liao HJ, Yuan X.
In-Text Gene Mentions

miR-1269a also promoted NSCLC by regulating SOX6(31).

…NSCLC by regulatingSOX6( 31 ).…

Show Full Abstract

Colorectal cancer (CRC), the third most common cancer worldwide, poses a threat to human life. However, its underlying mechanism is unclear and no satisfactory treatment is available. The present study aimed to investigate the role of circular RNA argininosuccinate synthase 1 (circASS1) in CRC cells and tissues to identify the potential mechanism underlying the pathogenesis of CRC. The expression of circASS1 in CRC cells and tissues was determined by reverse transcription-quantitative PCR. Following circASS1 overexpression in HT29 cells, cell viability, colony formation and apoptosis were measured using MTT, colony formation and TUNEL assays, respectively. Cell invasion and migration were also assessed. After confirming the associations among circASS1, microRNA (miR)-1269a and vasohibin 1 (VASH1), the characteristics of the HT29 cell line were assessed by performing the aforementioned assays. circASS1 expression was decreased in CRC cells and tissues, and circASS1 overexpression suppressed CRC cell proliferation, invasion and migration. circASS1 adsorbed miR-1269a and regulated its expression, and VASH1 was a target protein of miR-1269a. circASS1 overexpression decreased cell proliferation, invasion and migration, but enhanced cell apoptosis in HT29 cells, which was reversed by co-transfection with miR-1269a mimic or short hairpin RNA-VASH1. In conclusion, circASS1 overexpression inhibited CRC cell proliferation, invasion and migration by regulating miR-1269a/VASH1, which indicated a potential molecular mechanism underlying the pathogenesis of CRC.

Also flagged:ClarecysteineSNAP-βamino acidA2ARDDM
Journal Article 2021-08-10 No Snippets Martins JP, Figueiredo P, Wang S, Espo E, Celi E, Martins B, Kemell M, Moslova K, Mäkilä E, Salonen J, Kostiainen MA, Celia C, Cerullo V, Viitala T, Sarmento B, Hirvonen J, Santos HA.
Show Full Abstract

Oral insulin delivery could change the life of millions of diabetic patients as an effective, safe, easy-to-use, and affordable alternative to insulin injections, known by an inherently thwarted patient compliance. Here, we designed a multistage nanoparticle (NP) system capable of circumventing the biological barriers that lead to poor drug absorption and bioavailability after oral administration. The nanosystem consists of an insulin-loaded porous silicon NP encapsulated into a pH-responsive lignin matrix, and surface-functionalized with the Fc fragment of immunoglobulin G, which acts as a targeting ligand for the neonatal Fc receptor (FcRn). The developed NPs presented small size (211 ± 1 nm) and narrow size distribution. The NPs remained intact in stomach and intestinal pH conditions, releasing the drug exclusively at pH 7.4, which mimics blood circulation. This formulation showed to be highly cytocompatible, and surface plasmon resonance studies demonstrated that FcRn-targeted NPs present higher capacity to interact and being internalized by the Caco-2 cells, which express FcRn, as demonstrated by Western blot. Ultimately, <i>in vitro</i> permeability studies showed that Fc-functionalized NPs induced an increase in the amount of insulin that permeated across a Caco-2/HT29-MTX co-culture model, showing apparent permeability coefficients (<i>P</i> <sub><i>app</i></sub> ) of 2.37 × 10<sup>-6</sup> cm/s, over the 1.66 × 10<sup>-6</sup> cm/s observed for their non-functionalized counterparts. Overall, these results demonstrate the potential of these NPs for oral delivery of anti-diabetic drugs.

Also flagged:GlioblastomaGBMbrain tumorstemozolomidegene expressiontumor
Journal Article 2021-08-10 No Snippets Sharma RK, Calderon C, Vivas-Mejia PE.
Show Full Abstract

Glioblastoma (GBM) is the most malignant form of all primary brain tumors, and it is responsible for around 200,000 deaths each year worldwide. The standard therapy for GBM treatment includes surgical resection followed by temozolomide-based chemotherapy and/or radiotherapy. With this treatment, the median survival rate of GBM patients is only 15 months after its initial diagnosis. Therefore, novel and better treatment modalities for GBM treatment are urgently needed. Mounting evidence indicates that non-coding RNAs (ncRNAs) have critical roles as regulators of gene expression. Long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) are among the most studied ncRNAs in health and disease. Dysregulation of ncRNAs is observed in virtually all tumor types, including GBMs. Several dysregulated miRNAs and lncRNAs have been identified in GBM cell lines and GBM tumor samples. Some of them have been proposed as diagnostic and prognostic markers, and as targets for GBM treatment. Most ncRNA-based therapies use oligonucleotide RNA molecules which are normally of short life in circulation. Nanoparticles (NPs) have been designed to increase the half-life of oligonucleotide RNAs. An additional challenge faced not only by RNA oligonucleotides but for therapies designed for brain-related conditions, is the presence of the blood-brain barrier (BBB). The BBB is the anatomical barrier that protects the brain from undesirable agents. Although some NPs have been derivatized at their surface to cross the BBB, optimal NPs to deliver oligonucleotide RNA into GBM cells in the brain are currently unavailable. In this review, we describe first the current treatments for GBM therapy. Next, we discuss the most relevant miRNAs and lncRNAs suggested as targets for GBM therapy. Then, we compare the current drug delivery systems (nanocarriers/NPs) for RNA oligonucleotide delivery, the challenges faced to send drugs through the BBB, and the strategies to overcome this barrier. Finally, we categorize the critical points where research should be the focus in order to design optimal NPs for drug delivery into the brain; and thus move the Oligonucleotide RNA-based therapies from the bench to the clinical setting.

Also flagged:TriarginineGangliosidesmembranesgangliosidepeptidemembrane
Journal Article 2021-08-10 No Snippets Matsuura K, Hisamoto K, Tanaka T, Sakamoto R, Okazaki M, Inaba H.
Show Full Abstract

Gangliosides play pivotal biological roles in the animal cell membranes, and it is vital to develop fluorescent probes for imaging them. To date, various artificial receptors for ganglioside imaging have been developed; however, turn-on fluorescence imaging for gangliosides with high contrast has not been achieved. We developed a simple fluorescent probe on the basis of a dansyl triarginine peptide for turn-on ganglioside imaging on the liposome membrane. The probe bound to monosialyl gangliosides and other anionic lipids with association constants was 10<sup>5</sup> M<sup>-1</sup>, which enhanced from 6-fold to 7-fold the fluorescence intensity. Upon binding to monosialyl ganglioside-containing giant liposomes, the turn-on probe selectively enhanced the fluorescence intensity compared with the other anionic lipids. This simple peptide probe for turn-on fluorescence imaging of gangliosides would provide a novel molecular tool for chemical biology.

Also flagged:AMPKULK1PIKFYVEautophagymacroautophagyglucose
Journal Article 2021-08-09 No Snippets Yang Y, Klionsky DJ.
Show Full Abstract

Glucose deprivation induces macroautophagy/autophagy primarily through AMPK activation. However, little is known about the exact mechanism of this signaling. A recent study from Dr. David C. Rubinsztein's lab showed that ULK1 is activated by AMPK upon glucose starvation, resulting in the phosphorylation of the lipid kinase PIKFYVE on S1548. The activated PIKFYVE consequently enhances the formation of phosphatidylinositol-5-phosphate (PtdIns5P)-containing autophagosomes, and therefore drives autophagy upregulation. The novel discovery of how ULK1 regulates the non-canonical autophagy signaling (PtdIns5P-dependent autophagy), not only expands our knowledge of autophagy, but also sheds light on therapeutic strategies for curing human disorders, where glucose-induced starvation can play an important role.

Also flagged:Netrinaxon
Journal Article 2021-08-09 ✓ 1 Snippet Basu A, Behera S, Bhardwaj S, Dey S, Ghosh-Roy A.
In-Text Gene Mentions

…rection: Regulation of UNC-40/DCCand UNC-6/Netrin by…

Show Full Abstract

No abstract available.

Also flagged:fluorohydroxyapatitestrontiumtitaniumCalcium phosphatecalciumalkaline phosphatase
Journal Article 2021-08-09 No Snippets Moloodi A, Toraby H, Kahrobaee S, Razavi MK, Salehi A.
Show Full Abstract

Titanium and its alloys are considered as appropriate replacements for the irreparable bone. Calcium phosphate coatings are widely used to improve the osteoinduction and osseointegration ability of titanium alloys. To further improve the performance of the calcium phosphate-coated implants, strontium (Sr) was introduced to partially replace the calcium ions. In this study, the effect of Sr ion addition on the fluorohydroxyapatite (FHA)-coated Ti6Al4V alloy was investigated and all the coatings were treated under hydrothermal condition. X-ray diffraction (XRD) and scanning electron microscopy (SEM) were used to investigate the phases and microstructures, respectively. Shear tests were done to evaluate the bond strength of the coating layer. MTT, adhesion, and alkaline phosphatase tests were performed to evaluate the biocompatibility and osteogenic behavior of the samples. Results showed that the average crystallite size for the strontium-doped FHA samples was 48 nm and the bond strength had increased 13.15% in comparison with FHA-coated samples. Analysis of variance showed p value for all MTT tests at more than 0.322 and there was not any evidence of cell death after 7 days. The results of the ALP test showed that the increase of the cell activity in Sr samples from day 7 to 14 is three times higher than the FHA ones.

Also flagged:Huntington DiseasemethylationATN1Friedreich Ataxiamuscular atrophymyotonic dystrophy 1
Journal Article 2021-08-09 ✓ 5 Snippets Rajan-Babu IS, Peng JJ, Chiu R, IMAGINE Study, CAUSES Study, Li C, Mohajeri A, Dolzhenko E, Eberle MA, Birol I, Friedman JM.
In-Text Gene Mentions

HTT

Using our approach, we were able to confirm the presence of a clinically validated DMPK full-mutation in the ES data of a proband and his mother with DM1, inherited HTT and AR full-mutations in two families, and also the presence of an FXN normal/full-mutation in a father using clinical PCR and capillary electrophoresis.

…FXN , orHTT) and simulated…

…, FXN ,HTT, JPH3 ,…

…FXN , and/orHTTloci.…

Show Full Abstract

<h4>Background</h4>Screening for short tandem repeat (STR) expansions in next-generation sequencing data can enable diagnosis, optimal clinical management/treatment, and accurate genetic counseling of patients with repeat expansion disorders. We aimed to develop an efficient computational workflow for reliable detection of STR expansions in next-generation sequencing data and demonstrate its clinical utility.<h4>Methods</h4>We characterized the performance of eight STR analysis methods (lobSTR, HipSTR, RepeatSeq, ExpansionHunter, TREDPARSE, GangSTR, STRetch, and exSTRa) on next-generation sequencing datasets of samples with known disease-causing full-mutation STR expansions and genomes simulated to harbor repeat expansions at selected loci and optimized their sensitivity. We then used a machine learning decision tree classifier to identify an optimal combination of methods for full-mutation detection. In Burrows-Wheeler Aligner (BWA)-aligned genomes, the ensemble approach of using ExpansionHunter, STRetch, and exSTRa performed the best (precision = 82%, recall = 100%, F1-score = 90%). We applied this pipeline to screen 301 families of children with suspected genetic disorders.<h4>Results</h4>We identified 10 individuals with full-mutations in the AR, ATXN1, ATXN8, DMPK, FXN, or HTT disease STR locus in the analyzed families. Additional candidates identified in our analysis include two probands with borderline ATXN2 expansions between the established repeat size range for reduced-penetrance and full-penetrance full-mutation and seven individuals with FMR1 CGG repeats in the intermediate/premutation repeat size range. In 67 probands with a prior negative clinical PCR test for the FMR1, FXN, or DMPK disease STR locus, or the spinocerebellar ataxia disease STR panel, our pipeline did not falsely identify aberrant expansion. We performed clinical PCR tests on seven (out of 10) full-mutation samples identified by our pipeline and confirmed the expansion status in all, showing absolute concordance between our bioinformatics and molecular findings.<h4>Conclusions</h4>We have successfully demonstrated the application of a well-optimized bioinformatics pipeline that promotes the utility of genome-wide sequencing as a first-tier screening test to detect expansions of known disease STRs. Interrogating clinical next-generation sequencing data for pathogenic STR expansions using our ensemble pipeline can improve diagnostic yield and enhance clinical outcomes for patients with repeat expansion disorders.

Also flagged:lackCancerDanahowGFPASI
Journal Article 2021-08-09 ✓ 3 Snippets Vichas A, Riley AK, Nkinsi NT, Kamlapurkar S, Parrish PCR, Lo A, Duke F, Chen J, Fung I, Watson J, Rees M, Gabel AM, Thomas JD, Bradley RK, Lee JK, Hatch EM, Baine MK, Rekhtman N, Ladanyi M, Piccioni F, Berger AH.
In-Text Gene Mentions

For analysis of individual Hippo pathway genes in RIT1 altered samples, we included the following genes as Hippo pathway genes: AMOTL1, NF2, STK4, STK38L MAP4K5, TAOK3, SAV1. To determine the portion of RIT1 altered tumors with low expression of any one Hippo pathway gene, low expression was defined as >1 standard deviation lower than the mean expression of the 230-sample dataset.

…STK38L MAP4K5 ,TAOK3, SAV1 .…

…, SAV1 ,TAOK3, MAP4K5 ,…

Show Full Abstract

CRISPR-based cancer dependency maps are accelerating advances in cancer precision medicine, but adequate functional maps are limited to the most common oncogenes. To identify opportunities for therapeutic intervention in other rarer subsets of cancer, we investigate the oncogene-specific dependencies conferred by the lung cancer oncogene, RIT1. Here, genome-wide CRISPR screening in KRAS, EGFR, and RIT1-mutant isogenic lung cancer cells identifies shared and unique vulnerabilities of each oncogene. Combining this genetic data with small-molecule sensitivity profiling, we identify a unique vulnerability of RIT1-mutant cells to loss of spindle assembly checkpoint regulators. Oncogenic RIT1<sup>M90I</sup> weakens the spindle assembly checkpoint and perturbs mitotic timing, resulting in sensitivity to Aurora A inhibition. In addition, we observe synergy between mutant RIT1 and activation of YAP1 in multiple models and frequent nuclear overexpression of YAP1 in human primary RIT1-mutant lung tumors. These results provide a genome-wide atlas of oncogenic RIT1 functional interactions and identify components of the RAS pathway, spindle assembly checkpoint, and Hippo/YAP1 network as candidate therapeutic targets in RIT1-mutant lung cancer.

Also flagged:Amino AcidFARP2LRRC34cancerscancerbreast cancer
Journal Article 2021-08-09 No Snippets Khoruddin NA, Noorizhab MN, Teh LK, Mohd Yusof FZ, Salleh MZ.
Show Full Abstract

Single-nucleotide polymorphisms (SNPs) are the most common genetic variations for various complex human diseases, including cancers. Genome-wide association studies (GWAS) have identified numerous SNPs that increase cancer risks, such as breast cancer, colorectal cancer, and leukemia. These SNPs were cataloged for scientific use. However, GWAS are often conducted on certain populations in which the Orang Asli and Malays were not included. Therefore, we have developed a bioinformatic pipeline to mine the whole-genome sequence databases of the Orang Asli and Malays to determine the presence of pathogenic SNPs that might increase the risks of cancers among them. Five different in silico tools, SIFT, PROVEAN, Poly-Phen-2, Condel, and PANTHER, were used to predict and assess the functional impacts of the SNPs. Out of the 80 cancer-related nsSNPs from the GWAS dataset, 52 nsSNPs were found among the Orang Asli and Malays. They were further analyzed using the bioinformatic pipeline to identify the pathogenic variants. Three nsSNPs; rs1126809 (TYR), rs10936600 (LRRC34), and rs757978 (FARP2), were found as the most damaging cancer pathogenic variants. These mutations alter the protein interface and change the allosteric sites of the respective proteins. As TYR, LRRC34, and FARP2 genes play important roles in numerous cellular processes such as cell proliferation, differentiation, growth, and cell survival; therefore, any impairment on the protein function could be involved in the development of cancer. rs1126809, rs10936600, and rs757978 are the important pathogenic variants that increase the risks of cancers among the Orang Asli and Malays. The roles and impacts of these variants in cancers will require further investigations using in vitro cancer models.

Also flagged:cell-surfaceCD82PRRX1type II collagenopathyCOL2A1HA
Journal Article 2021-08-09 ✓ 3 Snippets Yamada D, Nakamura M, Takao T, Takihira S, Yoshida A, Kawai S, Miura A, Ming L, Yoshitomi H, Gozu M, Okamoto K, Hojo H, Kusaka N, Iwai R, Nakata E, Ozaki T, Toguchida J, Takarada T.
In-Text Gene Mentions

…genes SOX5 ,SOX6, SOX9 ,…

…( SOX5 ,SOX6, SOX9 ,…

…of SOX5 ,SOX6, SOX9 and…

Show Full Abstract

Current protocols for the differentiation of human pluripotent stem cells (hPSCs) into chondrocytes do not allow for the expansion of intermediate progenitors so as to prospectively assess their chondrogenic potential. Here we report a protocol that leverages PRRX1-tdTomato reporter hPSCs for the selective induction of expandable and ontogenetically defined PRRX1<sup>+</sup> limb-bud-like mesenchymal cells under defined xeno-free conditions, and the prospective assessment of the cells' chondrogenic potential via the cell-surface markers CD90, CD140B and CD82. The cells, which proliferated stably and exhibited the potential to undergo chondrogenic differentiation, formed hyaline cartilaginous-like tissue commensurate to their PRRX1-expression levels. Moreover, we show that limb-bud-like mesenchymal cells derived from patient-derived induced hPSCs can be used to identify therapeutic candidates for type II collagenopathy and we developed a method to generate uniformly sized hyaline cartilaginous-like particles by plating the cells on culture dishes coated with spots of a zwitterionic polymer. PRRX1<sup>+</sup> limb-bud-like mesenchymal cells could facilitate the mass production of chondrocytes and cartilaginous tissues for applications in drug screening and tissue engineering.

Also flagged:chromosomeZinc Finger NFX1-Type Containing 1antisense RNAosteoarthritisepilepsyrheumatoid arthritis
Journal Article 2021-08-09 ✓ 1 Snippet Ghafouri-Fard S, Kamali MJ, Abak A, Shoorei H, Taheri M.
In-Text Gene Mentions

…NFX1-Type Containing 1 (ZNFX1) antisense RNA 1…

Show Full Abstract

Residing on chromosome 20q13.13, Zinc Finger NFX1-Type Containing 1 (ZNFX1) antisense RNA 1 (ZFAS1) is a transcript which has been primarily recognized as a modulator of differentiation of alveolar and epithelial cell in the mammary gland. This long non-coding RNA (lncRNA) partakes in the molecular cascades leading to several non-neoplastic conditions such as osteoarthritis, epilepsy, rheumatoid arthritis, atherosclerosis, pulmonary fibrosis, myocardial infarction, and cardiac dysfunction. More importantly, ZFAS1 is considered as an oncogene in almost all types of cancers. Using expression amounts of ZFAS1, it is possible to forecast the clinical outcome of patients with different neoplasms such as colorectal cancer, gastric cancer, cholangiocarcinoma, hepatoblastoma, and other types of cancer. We describe the role of ZFAS1 in the development of neoplastic and non-neoplastic disorders.

Also flagged:localizationaxonsdendritesneurogenesisaxonsynaptogenesis
Journal Article 2021-08-09 No Snippets Agrawal M, Welshhans K.
Show Full Abstract

In the past two decades, significant progress has been made in our understanding of mRNA localization and translation at distal sites in axons and dendrites. The existing literature shows that local translation is regulated in a temporally and spatially restricted manner and is critical throughout embryonic and post-embryonic life. Here, recent key findings about mRNA localization and local translation across the various stages of neural development, including neurogenesis, axon development, and synaptogenesis, are reviewed. In the early stages of development, mRNAs are localized and locally translated in the endfeet of radial glial cells, but much is still unexplored about their functional significance. Recent <i>in vitro</i> and <i>in vivo</i> studies have provided new information about the specific mechanisms regulating local translation during axon development, including growth cone guidance and axon branching. Later in development, localization and translation of mRNAs help mediate the major structural and functional changes that occur in the axon during synaptogenesis. Clinically, changes in local translation across all stages of neural development have important implications for understanding the etiology of several neurological disorders. Herein, local translation and mechanisms regulating this process across developmental stages are compared and discussed in the context of function and dysfunction.

Also flagged:Lung AdenocarcinomaferroptosisLUADcell cyclemetabolismcancer
Journal Article 2021-08-09 ✓ 5 Snippets Ren Z, Hu M, Wang Z, Ge J, Zhou X, Zhang G, Zheng H.
In-Text Gene Mentions

In this study, we constructed a 15-gene prognostic signature predicting overall survival based on ferroptosis-related genes (ferroptosis driver genes VDAC2, GLS2, FLT3, TLR4, PHKG2, phosphogluconate dehydrogenase (PGD), PANX1, KRAS, PEBP1, ALOX15, and ALOX12B, and suppressor genes ACSL3, CISD1, FANCD2, and SLC3A2) in The Cancer Genome Atlas (TCGA)-LUAD cohort.

…, KRAS ,PEBP1, ALOX15 ,…

…, PHKG2 ,PEBP1, GLS2 ,…

…0.118 PANX1 -0.358PEBP1+ 0.010 PGD…

…, PANX1 ,PEBP1, ACSL3 ,…

Show Full Abstract

It is reported that ferroptosis has close relation with tumorigenesis and drug resistance. However, the clinical significance of ferroptosis in lung adenocarcinoma (LUAD) remains elusive, and the potential targets for ferroptosis-based treatment are limited. In this study, we constructed a 15-gene prognostic signature predicting overall survival based on ferroptosis-related genes (ferroptosis driver genes <i>VDAC2</i>, <i>GLS2</i>, <i>FLT3</i>, <i>TLR4</i>, <i>PHKG2</i>, phosphogluconate dehydrogenase (<i>PGD</i>), <i>PANX1</i>, <i>KRAS</i>, <i>PEBP1</i>, <i>ALOX15</i>, and <i>ALOX12B</i>, and suppressor genes <i>ACSL3</i>, <i>CISD1</i>, <i>FANCD2</i>, and <i>SLC3A2</i>) in The Cancer Genome Atlas (TCGA)-LUAD cohort. The signature's predictive ability was validated in the GSE68465 and GSE72094 cohorts by survival analysis and independent prognostic analysis with clinical features. Nomograms were provided for clinical reference. Functional analysis revealed that ferroptosis was closely related to cell cycle, cell metabolism, and immune pathways. Pan-cancer analysis comprehensively analyzed these 15 genes in 33 cancer types, indicating that the heterogeneity of 15 genes was evident across different cancer types. Besides, these genes were critical regulators modulating drug resistance, tumor microenvironment infiltration, and cancer stemness. Then, we screened 10 genes (<i>TLR4</i>, <i>PHKG2</i>, <i>PEBP1</i>, <i>GLS2</i>, <i>FLT3</i>, <i>ALOX15</i>, <i>ACSL3</i>, <i>CISD1</i>, <i>FANCD2</i>, and <i>SLC3A2</i>) as potential targets for further research because their biological functions in ferroptosis were consistent with their prognostic significance. Somatic mutation and copy number variation analysis revealed that the alteration rates of <i>KRAS</i>, <i>PGD</i>, and <i>ALOX15</i> were more than 1% and significantly associated with overall survival in LUAD. Moreover, the expression of <i>KRAS</i> and <i>PGD</i> was positively related to tumor mutation burden, indicating that <i>KRAS</i> and <i>PGD</i> could serve as novel biomarkers for predicting immunotherapy response rate. Our study identified and validated a ferroptosis-related gene signature for LUAD, provided a 10-gene set for future research, and screened <i>KRAS</i> and <i>PGD</i> as potential novel immunotherapy biomarkers.

Also flagged:Head and Neck Squamous Cell CarcinomaHNSCCcancerscancerGene ExpressionTNFRSF12A
Journal Article 2021-08-09 No Snippets Aye L, Song X, Yang J, Hu L, Sun X, Zhou J, Liu Q, Yu H, Wang D.
Show Full Abstract

<h4>Background</h4>Head and neck squamous cell carcinoma (HNSCC) is one of the most common malignancies worldwide. Checkpoint blockade immunotherapy has made tremendous progress in the treatment of a variety of cancers in recent years. Costimulatory molecules constitute the foundation of cancer immunotherapies and are deemed to be promising targets for cancer treatment. This study attempted to evaluate the potential value of costimulatory molecule genes (CMGs) in HNSCC.<h4>Materials and methods</h4>Based on The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) dataset, we identified the prognostic value of CMGs in HNSCC. Subsequently, CMGs-based signature (CMS) to predict overall survival of HNSCC patients was established and validated. The differences of downstream pathways, clinical outcomes, immune cell infiltration, and predictive immunotherapy responses between different CMS subgroups were investigated via bioinformatic algorithms. We also explored the biological functions of TNFRSF12A, one risk factor of CMS, by <i>in vitro</i> experiments.<h4>Results</h4>Among CMGs, 22 genes were related to prognosis based on clinical survival time in HNSCC. Nine prognosis-related CMGs were selected to establish CMS. CMS was an independent risk factor and could indicate the survival of HNSCC patients, the component of tumor-infiltrating lymphocytes, and the immunotherapy response rate. Functional enrichment analysis confirmed that CMS might involve immune-relevant processes. Additionally, TNFRSF12A was related to poor prognosis and enhanced malignant phenotype of HNSCC.<h4>Conclusion</h4>Collectively, CMS could accurately indicate prognosis, evaluate the tumor immune microenvironment, and predict possible immunotherapy outcomes for HNSCC patients.

Also flagged:Hereditary NeuropathiesDisorders of the peripheral nervesacquired neuropathiestoxic neuropathyneuropathieshereditary neuropathy
Journal Article 2021-08-09 No Snippets Korinthenberg R, Trollmann R, Plecko B, Stettner GM, Blankenburg M, Weis J, Schoser B, Müller-Felber W, Lochbuehler N, Hahn G, Rudnik-Schöneborn S.
Show Full Abstract

Disorders of the peripheral nerves can be caused by a broad spectrum of acquired or hereditary aetiologies. The objective of these practice guidelines is to provide the reader with information about the differential diagnostic workup for a target-oriented diagnosis. Following an initiative of the German-speaking Society of Neuropaediatrics, delegates from 10 German societies dedicated to neuroscience worked in close co-operation to write this guideline. Applying the Delphi methodology, the authors carried out a formal consensus process to develop practice recommendations. These covered the important diagnostic steps both for acquired neuropathies (traumatic, infectious, inflammatory) and the spectrum of hereditary Charcot-Marie-Tooth (CMT) diseases. Some of our most important recommendations are that: (i) The indication for further diagnostics must be based on the patient's history and clinical findings; (ii) Potential toxic neuropathy also has to be considered; (iii) For focal and regional neuropathies of unknown aetiology, nerve sonography and MRI should be performed; and (iv) For demyelinated hereditary neuropathy, genetic diagnostics should first address PMP22 gene deletion: once that has been excluded, massive parallel sequencing including an analysis of relevant CMT-genes should be performed. This article contains a short version of the guidelines. The full-length text (in German) can be found at the Website of the "Arbeitsgemeinschaft der Wissenschftlichen Medizinischen Fachgesellschaften e.V. (AWMF), Germany.

Also flagged:metabolismnitrogenHIF-1αADAM17ARG2MMP3
Journal Article 2021-08-09 No Snippets Ayalew W, Chu M, Liang C, Wu X, Yan P.
Show Full Abstract

Living at a high altitude involves many environmental challenges. The combined effects of hypoxia and cold stress impose severe physiological challenges on endothermic animals. The yak is integral to the livelihood of the people occupying the vast, inhospitable Qinghai-Tibetan plateau and the surrounding mountainous region. Due to long-term selection, the yak exhibits stable and unique genetic characteristics which enable physiological, biochemical, and morphological adaptations to a high altitude. Thus, the yak is a representative model for mammalian plateau-adaptability studies. Understanding coping mechanisms provides unique insights into adaptive evolution, thus informing the breeding of domestic yaks. This review provides an overview of genetic adaptations in <i>Bos grunniens</i> to high-altitude environmental stress. Combined genomics and theoretical advances have informed the genetic basis of high-altitude adaptations.

Also flagged:Alpha-Synucleinneurodegenerative diseasehyposmiadepressioncognitive declinedysautonomia
Journal Article 2021-08-09 ✓ 1 Snippet Magistrelli L, Contaldi E, Comi C.
In-Text Gene Mentions

HD is caused by a trinucleotide expansion in huntingtin (HTT) gene.

Show Full Abstract

Parkinson's disease (PD) is a common and progressive neurodegenerative disease, caused by the loss of dopaminergic neurons in the substantia nigra pars compacta in the midbrain, which is clinically characterized by a constellation of motor and non-motor manifestations. The latter include hyposmia, constipation, depression, pain and, in later stages, cognitive decline and dysautonomia. The main pathological features of PD are neuronal loss and consequent accumulation of Lewy bodies (LB) in the surviving neurons. Alpha-synuclein (α-syn) is the main component of LB, and α-syn aggregation and accumulation perpetuate neuronal degeneration. Mutations in the α-syn gene (<i>SNCA</i>) were the first genetic cause of PD to be identified. Generally, patients carrying <i>SNCA</i> mutations present early-onset parkinsonism with severe and early non-motor symptoms, including cognitive decline. Several <i>SNCA</i> polymorphisms were also identified, and some of them showed association with non-motor manifestations. The functional role of these polymorphisms is only partially understood. In this review we explore the contribution of <i>SNCA</i> and its product, α-syn, in predisposing to the non-motor manifestations of PD.

Also flagged:NAFLDHepatocarcinomaHepatocellular carcinomacancercirrhosisnon-alcoholic fatty liver disease
Journal Article 2021-08-09 ✓ 1 Snippet Michelotti A, de Scordilli M, Palmero L, Guardascione M, Masala M, Roncato R, Foltran L, Ongaro E, Puglisi F.
In-Text Gene Mentions

…metabolic diseases likehemochromatosis, characterized by the…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the seventh most common cancer worldwide and the second leading cause of cancer-related mortality. HCC typically arises within a cirrhotic liver, but in about 20% of cases occurs in absence of cirrhosis. Among non-cirrhotic risk factors, non-alcoholic fatty liver disease (NAFLD) currently represents the most important emerging cause of HCC in developed countries. It has been estimated that annual incidence of HCC among patients with non-cirrhotic NAFLD is approximately 0.1-1.3 per 1000 patients/year and ranges from 0.5% to 2.6% among patients with non-alcoholic steatohepatitis (NASH) cirrhosis. However, only a few clinical trials enrolling HCC patients actually distinguished NAFLD/NASH-related cases from other non-cirrhotic causes and therefore evidence is still lacking in this subset of patients. This review aims to describe the biology underpinning NAFLD development, to investigate the main molecular pathways involved in its progression to NASH and HCC and to describe how different pathogenetic mechanisms underlying the onset of HCC can have an impact in clinical practice. We hereby also provide an overview of current HCC treatment options, with a particular focus on the available data on NAFLD-related cases in practice-changing clinical trials.

Also flagged:Tylosinmacrolideenteric infectionsallergiesantibodiesBSA
Journal Article 2021-08-09 ✓ 1 Snippet Wang Y, Yang JY, He Y, Li L, Huang JX, Tian YX, Wang H, Xu ZL, Shen YD.
In-Text Gene Mentions

Tylosin, tilmicosin, benfloxacin, enrofloxacin, azithromycin, acetylspiramycin, roxithromycin, clinfloxacin, pefloxacin, furazolidone, spiramycin, furandanone hydrochloride, and furantoin were purchased from Aladdin Reagent (Shanghai, China) Co., Ltd. Abamectin, erythromycin, florfenicol, and chloramphenicol were purchased from Energy Chemical Reagent (Shanghai, China) Co., Ltd. Florfenicolamide was purchased from Shanghai Macklin Biochemical Co. Ltd. Dimethylsulfoxide, 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) (EDC), N-Hydroxysuccinimide (NHS), dicyclohexylcarbodiimide (DCC), bovine serum albumin (BSA), ovalbumin (OVA), Freund’s adjuvant (complete and incomplete), goat anti-mouse Immunoglobulin G (IgG), Casein, Trehalose, 2-(N-morpholine) ethanesulfonic acid monohydrate (MES), Tris, Proclin-300, Polyvinylpyrrolidone (PVP) and Tween-20 were purchased from Sigma-Aldrich (St.

Show Full Abstract

Tylosin and tilmicosin (T&T) residues in livestock products have received extensive attention from consumers. Time-resolved fluorescence immunochromatographic assay (TRFICA), as a fast, efficient and sensitive immunoassay method, has played an increasingly important role in the food safety field. Therefore, herein a quantitative and visual TRFICA was established for simultaneously detecting T&T in milk in a group-screening manner. Under the optimal conditions, the standard curve range of developed TRFICA based on the T&T was 1.87~7.47 ng/mL, and the half-maximal inhibition concentrations (IC<sub>50</sub>) were 4.06 ng/mL and 3.74 ng/mL, respectively. The limits of detection (LOD) of the TRFICA method were from 1.72 ng/mL to 1.39 ng/mL, and the visual cut-off values were 31.25 ng/mL and 62.50 ng/mL for T&T in milk, respectively. Moreover, the stability experiments showed that the strips could be stored at 4 °C for more than 6 months, the total detection time was less than 13 min, and the cross-reactivities (CRs) with related compounds were less than 0.1%, which concluded that the developed TRFICA method could be used in real milk sample detection.

Also flagged:GAPDHpathogenesisneurodegenerative diseasesHuntington's diseaseHDpolyglutamine
Journal Article 2021-08-08 ✓ 4 Snippets Dong X, Cong S.
In-Text Gene Mentions

(A) HD PC12 cell line driven by the doxycycline‐dependent Tet‐On promoter to stably express the first exon fragment of HTT fused to GFP, containing either 23 (normal) or 74 (mutant) glutamine fragment (N‐htt‐Q23 or N‐htt‐Q74, respectively).

Huntington's disease (HD) is an inherited, progressive and fatal neurodegenerative disease (NDD) caused by a CAG trinucleotide expansion in exon 1 of the huntingtin gene (HTT).1

…huntingtin gene (HTT).…

…of the mutantHtt(mHtt) protein, and…

Show Full Abstract

Emerging studies have suggested that dysregulated long non-coding RNAs (lncRNAs) are associated with the pathogenesis of neurodegenerative diseases (NDD) including Huntington's disease (HD); however, the pathophysiological mechanism by which lncRNA dysregulation participates in HD remains to be elucidated. Here, we aim to analyse the expression of lncRNA-DNM3OS and identify the possible DNM3OS/miR-196b-5p/GAPDH pathway. PC12 cells induced by rat pheochromocytoma expressing HD gene exon 1 fragment with either 23 or 74 polyglutamine repeats fused to the green fluorescent protein (GFP) were cultured. Our results show that GAPDH and DNM3OS were upregulated in HD PC12 cells, downregulation of which lead to inhibition of aggregate formation accompanied by a decreased apoptosis rate and increased relative ROS levels and cell viability. Moreover, upregulated DNM3OS decreased the expression of miR-196b-5p by sponging, and GAPDH was a direct target of miR-196b-5p, playing an important pathogenic role in the formation of aggregates in the HD cell model. Our study uncovers a novel DNM3OS/miR-196b-5p/GAPDH pathway involved in the molecular pathogenesis of HD, which may offer a potential therapeutic strategy for HD.

Also flagged:OX40Lautoimmune diseasesautoimmunity disorderspathogenesisrheumatoid arthritisRA
Journal Article 2021-08-08 No Snippets Fu Y, Wang L, Liu W, Yang L, Li L, Wang L, Sun X, Zhang ZR, Lin Q, Zhang L.
Show Full Abstract

Current clinical agents for autoimmunity disorders treatment often cause substantial adverse effects and safety concerns, owing to non-specific immune modulation. Due to the prominent contribution of effector T cells in pathogenesis of rheumatoid arthritis (RA) and inflammatory bowel disease (IBD), and preferential location of co-stimulatory receptor-ligand pair OX40-OX40L at the inflamed sites, selectively targeting autoaggressive T cells by blockade OX40-OX40L, might represent an alternative strategy. Herein, we developed a new strategy to antagonize OX40-OX40L interaction by engineering a cell membrane derived nanovesicles (NVs) expressing OX40 receptors (OX40 NVs), and explored their potential for autoimmune disorders therapy. OX40 NVs showed specific binding capability to inflamed HUVECs in vitro, it also possessed distinct arthritic-targeting capacity in RA inflamed joints, and preferential accumulation in IBD inflamed colon. OX40 NVs efficiently suppressed the progression of both RA and IBD diseases through reducing CD4<sup>+</sup>OX40<sup>+</sup> T cells population, and proinflammatory cytokines (i.e., TNF-α and IL-1β), while reinforcing Tregs immune-suppressive effect, with superior therapeutic efficacy than anti-OX40L. Additionally, dexamethasone (DEX) loading can further enhance the potential of OX40 NVs for RA treatment. Owing to their preferential localization to inflamed sites, and potent immune-suppression ability, targeting OX40-OX40L blockade by OX40 NVs for autoimmune therapy is highly promising.

Also flagged:ITGB8colorectal cancerfocal adhesioncell proliferationtumorphosphorylation
Journal Article 2021-08-08 ✓ 1 Snippet Lin X, Zhuang S, Chen X, Du J, Zhong L, Ding J, Wang L, Yi J, Hu G, Tang G, Luo X, Liu W, Ye F.
In-Text Gene Mentions

…HOXD-AS1, SATB2-AS1, andZNFX1-AS1.…

Show Full Abstract

Long non-coding RNAs (lncRNAs) play critical roles in tumorigenesis and progression of colorectal cancer (CRC). However, functions of most lncRNAs in CRC and their molecular mechanisms remain uncharacterized. Here we found that lncRNA ITGB8-AS1 was highly expressed in CRC. Knockdown of ITGB8-AS1 suppressed cell proliferation, colony formation, and tumor growth in CRC, suggesting oncogenic roles of ITGB8-AS1. Transcriptomic analysis followed by KEGG analysis revealed that focal adhesion signaling was the most significantly enriched pathway for genes positively regulated by ITGB8-AS1. Consistently, knockdown of ITGB8-AS1 attenuated the phosphorylation of SRC, ERK, and p38 MAPK. Mechanistically, ITGB8-AS1 could sponge miR-33b-5p and let-7c-5p/let-7d-5p to regulate the expression of integrin family genes ITGA3 and ITGB3, respectively, in the cytosol of cells. Targeting ITGB8-AS1 using antisense oligonucleotide (ASO) markedly reduced cell proliferation and tumor growth in CRC, indicating the therapeutic potential of ITGB8-AS1 in CRC. Furthermore, ITGB8-AS1 was easily detected in plasma of CRC patients, which was positively correlated with differentiation and TNM stage, as well as plasma levels of ITGA3 and ITGB3. In conclusion, ITGB8-AS1 functions as a competing endogenous RNA (ceRNA) to regulate cell proliferation and tumor growth of CRC via regulating focal adhesion signaling. Targeting ITGB8-AS1 is effective in suppressing CRC cell growth and tumor growth. Elevated plasma levels of ITGB8-AS1 were detected in advanced-stage CRC. Thus, ITGB8-AS1 could serve as a potential therapeutic target and circulating biomarker in CRC.

Also flagged:COVID-19SevereinfectionCoV-2 infectionCorona Virus DiseaseSex hormones
Journal Article 2021-08-08 ✓ 1 Snippet Shah SB.
In-Text Gene Mentions

…thological disorders includinghemochromatosis, and iron loading…

Show Full Abstract

SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2) infection is a global medical challenge. Experience based medicines and therapies are being attempted and vaccines are being developed. SARS-CoV-2 exhibits varied patterns of infection and clinical presentations with varied disease outcomes. These attributes are strongly suggestive of some variables that differ among individuals and that affect the course of SARS-CoV-2 infection and symptoms of COVID-19 (Corona Virus Disease of 2019). Sex hormones vary with ageing, between the sexes, among individuals and populations. Sex hormones are known to play a role in immunity and infections. Progesterone is a critical host factor to promote faster recovery following Influenza A virus infection. Anti-inflammatory effects of progesterone are noted. In part 1 of the current study the regulatory role of progesterone for SARS-CoV-2 infection and COVID-19 is analyzed. The role of progesterone at different stages of the SARS CoV-2 infection is investigated with respect to two types of immunity status: immune regulation and immune dysregulation. Progesterone could have various alleviating impacts from SARS-CoV-2 entry till recovery: reversing of hypoxia, stabilizing of blood pressure, controlling thrombosis, balancing electrolytes, reducing the viral load, regulation of immune responses, damage repair, and clearance of debris among others. The present research adds to the available evidence by providing a comprehensive and thorough evaluation of the regulatory role of progesterone in SARS COV-2 infection, COVID-19 pathogenesis, and immune dysregulation. The available evidence has implications for upcoming studies about pathophysiology of COVID-19, as well as the roles of progesterone and other hormones in other infectious diseases.

Also flagged:lipidnitroalkene fatty acidsnitrogenunsaturated fatty acidsdegradationcytoplasmic
Journal Article 2021-08-08 No Snippets Zatloukalová M, Jedinák L, Riman D, Franková J, Novák D, Cytryniak A, Nazaruk E, Bilewicz R, Vrba J, Papoušková B, Kabeláč M, Vacek J.
Show Full Abstract

Lipid nitroalkenes - nitro-fatty acids (NO<sub>2</sub>-FAs) are formed in vivo via the interaction of reactive nitrogen species with unsaturated fatty acids. The resulting electrophilic NO<sub>2</sub>-FAs play an important role in redox homeostasis and cellular stress response. This study investigated the physicochemical properties and reactivity of two NO<sub>2</sub>-FAs: 9/10-nitrooleic acid (1) and its newly prepared 1-monoacyl ester, (E)-2,3-hydroxypropyl 9/10-nitrooctadec-9-enoate (2), both synthesized by a direct radical nitration approach. Compounds 1 and 2 were investigated in an aqueous medium and after incorporation into lipid nanoparticles prepared from 1-monoolein, cubosomes 1@CUB and 2@CUB. Using an electrochemical analysis and LC-MS, free 1 and 2 were found to be unstable under acidic conditions, and their degradation occurred in an aqueous environment within a few minutes or hours. This degradation was associated with the production of the NO radical, as confirmed by fluorescence assay. In contrast, preparations 1@CUB and 2@CUB exhibited a significant increase in the stability of the loaded 1 and 2 up to several days to weeks. In addition to experimental data, density functional theory-based calculation results on the electronic structure and structural variability (open and closed configuration) of 1 and 2 were obtained. Finally, experiments with a human HaCaT keratinocyte cell line demonstrated the ability of 1@CUB and 2@CUB to penetrate through the cytoplasmic membrane and modulate cellular pathways, which was exemplified by the Keap1 protein level monitoring. Free 1 and 2 and the cubosomes prepared from them showed cytotoxic effect on HaCaT cells with IC<sub>50</sub> values ranging from 1 to 8 μM after 24 h. The further development of cubosomal preparations with embedded electrophilic NO<sub>2</sub>-FAs may not only contribute to the field of fundamental research, but also to their application using an optimized lipid delivery vehicle.

Also flagged:retrotransposonschromosomereproductiongene expressionwaterinfection
Journal Article 2021-08-08 No Snippets Wanner NM, Faulk C.
Show Full Abstract

Transposable element sequences are usually vertically inherited but have also spread across taxa via horizontal transfer. Previous investigations of ancient horizontal transfer of transposons have compared consensus sequences, but this method resists detection of recent single or low copy number transfer events. The relationship between humans and domesticated animals represents an opportunity for potential horizontal transfer due to the consistent shared proximity and exposure to parasitic insects, which have been identified as plausible transfer vectors. The relatively short period of extended human-animal contact (tens of thousands of years or less) makes horizontal transfer of transposons between them unlikely. However, the availability of high-quality reference genomes allows individual element comparisons to detect low copy number events. Using pairwise all-versus-all megablast searches of the complete suite of retrotransposons of thirteen domestic animals against human, we searched a total of 27,949,823 individual TEs. Based on manual comparisons of stringently filtered BLAST search results for evidence of vertical inheritance, no plausible instances of HTT were identified. These results indicate that significant recent HTT between humans and domesticated animals has not occurred despite the close proximity, either due to the short timescale, inhospitable recipient genomes, a failure of vector activity, or other factors.

Also flagged:brain tumorscancerdeathbrain tumormedulloblastomapilocytic astrocytoma
Journal Article 2021-08-08 ✓ 1 Snippet Chen S, Deng X, Sheng H, Rong Y, Zheng Y, Zhang Y, Lin J.
In-Text Gene Mentions

lncRNA Gm15577 was found to be specifically expressed in the mouse cerebellum in a developmentally regulated manner by targeting Negr1, which had a distinct expression pattern in MB patients from normal patients.

Show Full Abstract

Brain tumors are common solid pediatric malignancies and the main reason for cancer-related death in the pediatric setting. Recently, evidence has revealed that noncoding RNAs (ncRNAs), including microRNAs (miRNAs), long ncRNAs (lncRNAs), and circular RNAs (circRNAs), play a critical role in brain tumor development and progression. Therefore, in this review article, we describe the functions and molecular mechanisms of ncRNAs in multiple types of cancer, including medulloblastoma, pilocytic astrocytoma, ependymoma, atypical teratoid/rhabdoid tumor, glioblastoma, diffuse intrinsic pontine glioma, and craniopharyngioma. We also mention the limitations of using ncRNAs as therapeutic targets because of the nonspecificity of ncRNA targets and the delivery methods of ncRNAs. Due to the critical role of ncRNAs in brain oncogenesis, targeting aberrantly expressed ncRNAs might be an effective strategy to improve the outcomes of pediatric patients with brain tumors.

Also flagged:Hepatocellular carcinomadeathfatty liverDiabetesALThyperlipidemia
Journal Article 2021-08-08 ✓ 2 Snippets Shababi M, Smith CE, Ricardez Hernandez SM, Marquez J, Al Rawi Z, Villalón E, Farris KD, Garro-Kacher MO, Lorson CL.
In-Text Gene Mentions

…also interacts with Reptin/Pontin and activator of basal transcription 1and activator of…

…basal transcription 1 (ABT1), which has an…

Show Full Abstract

Spinal muscular atrophy with respiratory distress type 1 (SMARD1) is an autosomal recessive disorder that develops in infancy and arises from mutation of the immunoglobulin helicase μ-binding protein 2 (<i>IGHMBP2</i>) gene. Whereas IGHMBP2 is ubiquitously expressed, loss or reduction of function leads to alpha motor neuron loss and skeletal muscle atrophy. We previously developed a gene therapy strategy for SMARD1 using a single-stranded AAV9-<i>IGHMBP2</i> vector and compared two different delivery methods in a validated SMARD1 mouse model. An important question in the field relates to the temporal requirements for this or any potential treatment. To examine the therapeutic window, we utilized our recently developed SMARD1 model, FVB/NJ-<i>Ighmpb2</i> <sup><i>nmd-2J</i></sup> , to deliver AAV9-<i>IGHMBP2</i> at four different time points starting at post-natal day 2 (P2) through P8. At each time point, significant improvements were observed in survival, weight gain, and motor function. Similarly, treatment improved important hallmarks of disease, including motor unit pathology. Whereas improvements were more pronounced in the early-treatment groups, even the later-treatment groups displayed significant phenotypic improvements. This work suggests that an effective gene therapy strategy could provide benefits to pre-symptomatic and early-symptomatic individuals, thereby expanding the potential therapeutic window for SMARD1.

Also flagged:hepatocellular carcinomaHCCfitaddhypertensionask
Journal Article 2021-08-08 ✓ 1 Snippet Åström H, Ndegwa N, Hagström H.
In-Text Gene Mentions

…“Other” (Wilson's disease,hemochromatosis, porphyria, alpha-antitrypsin…

Show Full Abstract

<h4>Background & aims</h4>The Toronto hepatocellular carcinoma (HCC) risk index (THRI) is a predictive model to determine the risk of HCC in patients with cirrhosis. This study aimed to externally validate the THRI in a Swedish setting to investigate whether it could identify patients not requiring HCC surveillance.<h4>Methods</h4>From 2004-2017, 2,491 patients with cirrhosis at the Karolinska University Hospital were evaluated. Patients were classified into low-, intermediate- and high-risk groups for future HCC according to the THRI. Harrell's C-index, calibration-in-the-large, calibration slope and goodness-of-fit estimates were calculated to assess model discrimination and calibration. Cox proportional hazards regression was used to determine the risk of HCC.<h4>Results</h4>Most patients were male (n = 1,638, 66%). The most common etiologies of cirrhosis were steatohepatitis (n = 1,182, 48%) followed by viral hepatitis (n = 987, 40%). In all, 131 patients (5.3%) were designated as low risk for HCC. Harrell's C-index was 0.69. Calibration-in-the-large (0.11), calibration slope (1.24, not different from 1, <i>p</i> = 0.66) and goodness-of-fit showed good model calibration. Patients in the high-risk group had a 7.1-fold (95% CI 2.9-17.2) higher risk of HCC and patients in the intermediate-risk group had a 2.5-fold (95% CI 1.0-6.3) higher risk compared to the low-risk group.<h4>Conclusions</h4>In a Swedish setting, the THRI could differentiate between low- and high-risk of HCC development. However, because the low-risk group was relatively small (5.3%), the clinical applicability of the THRI could be limited.<h4>Lay summary</h4>The Toronto hepatocellular carcinoma (HCC) risk index (THRI) is a novel prediction model used to stratify patients with cirrhosis based on future risk of HCC. In this study, the THRI was validated in an external cohort using the TRIPOD guidance. Few patients were identified as low-risk, and the THRI had a modest discriminative ability, limiting its clinical applicability.

Also flagged:Fatty acidpolycyclic aromatic hydrocarbonpalmitic and oleic acidspalmiticochratoxin Azearalenone
Journal Article 2021-08-08 No Snippets Bartkiene E, Bartkevics V, Berzina Z, Klementaviciute J, Sidlauskiene S, Isariene A, Zeimiene V, Lele V, Mozuriene E.
Show Full Abstract

The aim of this study was to analyze the fatty acid (FA) profiles and mycotoxin and polycyclic aromatic hydrocarbon (PAH) concentrations in sea buckthorn (SB1, SB2), flaxseed (FL3, FL4, FL5), hempseed (HE6, HE7, HE8), camelina (CA9, CA10), and mustard (MU11) edible oils, prepared by artisans' by artisanal at small-scale agricultural companies in Lithuania. The dominant FAs were palmitic and oleic acids in SB; palmitic, stearic, oleic, linoleic, and α-linolenic acids in FL; palmitic, stearic, oleic, linoleic, and α-linolenic acids in HE; palmitic, oleic, linoleic, α-linolenic, eicosenoic, and erucic acids in CA; and oleic, linoleic, α-linolenic, eicosenoic, and erucic acids in MU. In SB2 oil samples, T-2 toxin and zearalenone concentrations higher than 1.0 µg/kg were found (1.7 and 3.0 µg/kg, respectively). In sample FL4, an ochratoxin A concentration higher than 1.0 µg/kg was established (1.2 µg/kg); also, in HE8 samples, 2.0 µg/kg of zearalenone was found. None of the tested edible oils exceeded the limits for PAH concentration. Finally, because of the special place of edible oils in the human diet, not only should their contamination with mycotoxins and PAHs be controlled but also their FA profile, as an important safety characteristic, must be taken into consideration to ensure higher safety standards.

bioRxiv 2021-08-08 Preprint (No Snippets API) Zohar K, Lezmi E, Eliyahu T, Linial M.
Show Full Abstract

A hallmark of the aging brain is the robust inflammation mediated by microglial activation. Neuroinflammation resulting from the induction of oxidative stress in neurodegenerative diseases and following brain injury. Chronic treatment of aging rats by ladostigil, a compound with antioxidant and anti-inflammatory function, prevented microglial activation and learning deficits. In this study, we investigate the effect of ladostigil on neuronal-like SH-SY5Y cells. We show that SH-SY5Y cells exposed to acute (by H 2 O 2 ) or chronic oxidative stress (by Sin1, 3-morpholinosydnonimine) induced apoptotic cell death. However, in the presence of ladostigil, the decline in cell viability and the oxidative levels were partially reversed. RNA-seq analysis showed that chronic oxidation by Sin1 resulted in coordinated suppression of endoplasmic reticulum (ER) quality control and ER stress response gene sets. Chronic oxidative stress impacted ER proteostasis and induced the expression of numerous lncRNAs. Pre-incubation with ladostigil before exposing SH-SY5Y cells to Sin1 induced Clk1 (Cdc2-like kinase 1) which was implicated in psychophysiological stress in mice and Alzheimer disease. Ladostigil also suppressed the expression of Ccpg1 (Cell cycle progression 1) and Synj1 (Synaptojanin 1) that function in ER-autophagy and endocytic pathways. We postulate that ladostigil alleviated cell damage by oxidation and ER stress. Therefore, it may attenuate neurotoxicity and cell death that accompany chronic stress conditions in the aging brain.

Authorea Preprints 2021-08-08 Preprint (No Snippets API) Radwan A, Othman I.
Show Full Abstract

A 59-year-old male was diagnosed with JAK2-positive Polycythemia Vera. Subsequently, further lab testing revealed elevated ferritin and iron saturation. Genetic testing for HFE gene mutation screen revealed that the patient was positive for heterozygous C282Y mutation. The patient was ultimately diagnosed with both Polycythemia Vera and Hereditary Hemochromatosis.

Also flagged:lung cancerTBC1D23NSCLCcell cycleRAB11Atumour
Journal Article 2021-08-07 ✓ 5 Snippets Zhang Y, Su H, Wudu M, Ren H, Xu Y, Zhang Q, Jiang J, Wang Q, Jiang X, Zhang B, Liu Z, Zou Z, Qiu X.
In-Text Gene Mentions

…member of the TBC/RABGAPfamily, is widely…

…The TBC/RABGAPfamily of proteins…

…RAB GTPase activation (RABGAP).…

…residues needed forRABGAPfunction.…

…TBC1D23 had noRABGAPfunction, but this…

Show Full Abstract

Non-small-cell lung cancer (NSCLC) accounts for approximately 80% of lung cancer cases. TBC1D23, a member of the TBC/RABGAP family, is widely expressed in human tissues; however, its role in NSCLC is currently unknown. Immunohistochemical analysis was conducted on 173 paraffin-embedded lung tissue sections from patients with NSCLC from 2014 to 2018 at the First Affiliated Hospital of China Medical University. MTT, colony formation assay, cell cycle assay, scratch assay, transwell assay, Western blotting and real-time PCR were employed on multiple NSCLC cell lines modified to knock down or overexpress TBC1D23/RAB11A. Immunoprecipitation, immunoprecipitation-mass spectrometry, immunofluorescence and flow cytometry were performed to explore the interaction between TBC1D23 and RAB11A and TBC1D23 involvement in the interaction between RAB11A and β1 integrin in the para-nucleus. TBC1D23 was correlated with tumour size, differentiation degree, metastasis, TNM stage and poor prognosis. TBC1D23 was involved in the interaction between RAB11A and β1 integrin in the para-nucleus, thus activating the β1 integrin/FAK/ERK signalling pathway to promote NSCLC. Furthermore, TBC1D23 promoted NSCLC progression by inducing cell proliferation, migration and invasion. This study indicated the relationship between TBC1D23 expression and the adverse clinicopathological characteristics of patients with NSCLC, suggesting that TBC1D23 may be an important target for NSCLC treatment.

Also flagged:host cellsgerm cell differentiationhost genomereverse transcriptionretrotranspositionretrotransposons
Journal Article 2021-08-07 No Snippets Hsu PS, Yu SH, Tsai YT, Chang JY, Tsai LK, Ye CH, Song NY, Yau LC, Lin SP.
Show Full Abstract

Transposable elements (TEs) initially attracted attention because they comprise a major portion of the genomic sequences in plants and animals. TEs may jump around the genome and disrupt both coding genes as well as regulatory sequences to cause disease. Host cells have therefore evolved various epigenetic and functional RNA-mediated mechanisms to mitigate the disruption of genomic integrity by TEs. TE associated sequences therefore acquire the tendencies of attracting various epigenetic modifiers to induce epigenetic alterations that may spread to the neighboring genes. In addition to posting threats for (epi)genome integrity, emerging evidence suggested the physiological importance of endogenous TEs either as cis-acting control elements for controlling gene regulation or as TE-containing functional transcripts that modulate the transcriptome of the host cells. Recent advances in long-reads sequence analysis technologies, bioinformatics and genetic editing tools have enabled the profiling, precise annotation and functional characterization of TEs despite their challenging repetitive nature. The importance of specific TEs in preimplantation embryonic development, germ cell differentiation and meiosis, cell fate determination and in driving species specific differences in mammals will be discussed.

Also flagged:maternal diseaseshypertensionneonatal hypertensioninsulindobutaminemilrinone
Journal Article 2021-08-07 No Snippets Rabe H, Bhatt-Mehta V, Bremner SA, Ahluwalia A, Mcfarlane R, Baygani S, Batton B, Klein A, Ergenekon E, Koplowitz LP, Dempsey E, Apele-Freimane D, Iwami H, Dionne JM, International Neonatal Consortium.
Show Full Abstract

<h4>Objective</h4>A comprehensive understanding of the factors contributing to perinatal blood pressure is vital to ensure optimal postnatal hemodynamic support. The objective of this study was to review existing literature on maternal and perinatal factors influencing blood pressure in neonates up to 3 months corrected age.<h4>Methods</h4>A systematic search of published literature in OVID Medline, OVID Embase and the COCHRANE library identified publications relating to maternal factors affecting blood pressure of neonates up to corrected age of 3 months. Summary data were extracted and compared (PROSPERO CRD42018092886).<h4>Results</h4>Of the 3683 non-duplicate publications identified, 44 were eligible for inclusion in this review. Topics elicited were sociodemographic factors, maternal health status, medications, smoking during pregnancy, and cord management at birth. Limited data were available for each factor. Results regarding the impact of these factors on neonatal blood pressure were inconsistent across studies.<h4>Conclusions</h4>There is insufficient evidence to draw definitive conclusions regarding the impact of various maternal and perinatal factors on neonatal blood pressure. Future investigations of neonatal cardiovascular therapies should account for these factors in their study design. Similarly, studies on maternal diseases and perinatal interventions should include neonatal blood pressure as part of their primary or secondary analyses.

Also flagged:extracellularvesiclesbrain diseasescentral nervous system diseasesBrain neurological disorderdeath
Journal Article 2021-08-07 ✓ 4 Snippets Shetgaonkar GG, Marques SM, DCruz CEM, Vibhavari RJA, Kumar L, Shirodkar RK.
In-Text Gene Mentions

It was demonstrated that exosomes with the H63D human homeostatic iron regulator (HFE) variant of the HFE gene can promote a more angiogenic situation in WT HFE cells along with increased cancer cells [167].

…homeostatic iron regulator (HFE) variant of the…

…variant of theHFEgene can promote…

…situation in WTHFEcells along with…

Show Full Abstract

Exosomes are extracellular vesicles with the diameter ranging from 50 to 100 nm and are found in different body fluids such as blood, cerebrospinal fluid (CSF), urine and saliva. Like in case of various diseases, based on the parent cells, the content of exosomes (protein, mRNA, miRNA, DNA, lipids and metabolites) varies and thus can be utilized as potential biomarker for diagnosis and prognosis of the brain diseases. Furthermore, utilizing the natural potential exosomes to cross the blood-brain barrier and by specifically decorating it with the ligand as per the desired brain sites therapeutics can be delivered to brain parenchyma. This review article conveys the importance of exosomes and their use in the treatment and diagnosis of brain/central nervous system diseases.

Also flagged:CalciumCACNA1Cpore-formingcardiac disordersatrial fibrillationlong QT syndrome
Journal Article 2021-08-07 No Snippets Tarnovskaya SI, Kostareva AA, Zhorov BS.
Show Full Abstract

(1) Background: Defects in gene CACNA1C, which encodes the pore-forming subunit of the human Cav1.2 channel (hCav1.2), are associated with cardiac disorders such as atrial fibrillation, long QT syndrome, conduction disorders, cardiomyopathies, and congenital heart defects. Clinical manifestations are known only for 12% of CACNA1C missense variants, which are listed in public databases. Bioinformatics approaches can be used to predict the pathogenic/likely pathogenic status for variants of uncertain clinical significance. Choosing a bioinformatics tool and pathogenicity threshold that are optimal for specific protein families increases the reliability of such predictions. (2) Methods and Results: We used databases ClinVar, Humsavar, gnomAD, and Ensembl to compose a dataset of pathogenic/likely pathogenic and benign variants of hCav1.2 and its 20 paralogues: voltage-gated sodium and calcium channels. We further tested the performance of sixteen in silico tools in predicting pathogenic variants. ClinPred demonstrated the best performance, followed by REVEL and MCap. In the subset of 309 uncharacterized variants of hCav1.2, ClinPred predicted the pathogenicity for 188 variants. Among these, 36 variants were also categorized as pathogenic/likely pathogenic in at least one paralogue of hCav1.2. (3) Conclusions: The bioinformatics tool ClinPred and the paralogue annotation method consensually predicted the pathogenic/likely pathogenic status for 36 uncharacterized variants of hCav1.2. An analogous approach can be used to classify missense variants of other calcium channels and novel variants of hCav1.2.

Also flagged:LipopolysaccharidesTubular Adenomaadenomacarcinomadextran sulfate sodiumtumor
Journal Article 2021-08-07 ✓ 1 Snippet Lu JW, Sun Y, Fong PA, Lin LI, Liu D, Gong Z.
In-Text Gene Mentions

…KRAS, TP53, andDCCwere proposed as…

Show Full Abstract

Intestinal carcinogenesis is a multistep process that begins with epithelial hyperplasia, followed by a transition to an adenoma and then to a carcinoma. Many etiological factors, including <i>KRAS</i> mutations and inflammation, have been implicated in oncogenesis. However, the potential synergistic effects between <i>KRAS</i> mutations and inflammation as well as the potential mechanisms by which they promote intestinal carcinogenesis remain unclear. Thus, the objective of this study was to investigate the synergistic effects of <i>kras<sup>V</sup></i><sup>12</sup>, lipopolysaccharides (LPS), and/or dextran sulfate sodium (DSS) on inflammation, tumor progression, and intestinal disorders using transgenic adults and larvae of zebrafish. Histopathology and pathological staining were used to examine the intestines of <i>kras<sup>V</sup></i><sup>12</sup> transgenic zebrafish treated with LPS and/or DSS. LPS and/or DSS treatment enhanced intestinal inflammation in <i>kras<sup>V</sup></i><sup>12</sup> transgenic larvae with concomitant increases in the number of neutrophils and macrophages in the intestines. The expression of <i>kras<sup>V</sup></i><sup>12</sup>, combined with LPS treatment, also enhanced epithelial hyperplasia and tubular adenoma, demonstrated by histopathological examinations and by increases in cell apoptosis, cell proliferation, and downstream signaling of phosphorylated AKT serine/threonine kinase 1 (AKT), extracellular-signal-regulated kinase (ERK), and histone. We also found that <i>kras<sup>V</sup></i><sup>12</sup> expression, combined with LPS treatment, significantly enhanced changes in intestinal morphology, specifically (1) decreases in goblet cell number, goblet cell size, villi height, and intervilli space, as well as (2) increases in villi width and smooth muscle thickness. Moreover, <i>kras<sup>V</sup></i><sup>12</sup> transgenic larvae cotreated with DSS and LPS exhibited exacerbated intestinal inflammation. Cotreatment with DSS and LPS in <i>kras<sup>V</sup></i><sup>12</sup>-expressing transgenic adult zebrafish also enhanced epithelial hyperplasia and tubular adenoma, compared with wild-type fish that received the same cotreatment. In conclusion, our data suggest that <i>kras<sup>V</sup></i><sup>12</sup> expression, combined with LPS and/or DSS treatment, can enhance intestinal tumor progression by activating the phosphatidylinositol-3-kinase (PI3K)/AKT signaling pathway and may provide a valuable in vivo platform to investigate tumor initiation and antitumor drugs for gastrointestinal cancers.

Also flagged:non-alcoholic fatty liver diseaseNAFLDBrain-derived neurotrophic factorBDNFChronic Liver Diseasenon-alcoholic steatohepatitis
Journal Article 2021-08-07 ✓ 1 Snippet Hashida R, Nakano D, Yamamura S, Kawaguchi T, Tsutsumi T, Matsuse H, Takahashi H, Gerber L, Younossi ZM, Torimura T.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosis.…

Show Full Abstract

Reduction in activity links to the development and progression of non-alcoholic fatty liver disease (NAFLD). Brain-derived neurotrophic factor (BDNF) is known to regulate an activity. We aimed to investigate the association between reduction in activity and BDNF in patients with NAFLD using data-mining analysis. We enrolled 48 NAFLD patients. Patients were classified into reduced (<i>n</i> = 21) or normal activity groups (<i>n</i> = 27) based on the activity score of the Chronic Liver Disease Questionnaire-NAFLD/non-alcoholic steatohepatitis. Circulating BDNF levels were measured using an enzyme-linked immunoassay. Factors associated with reduced activity were analyzed using decision-tree and random forest analyses. A reduction in activity was seen in 43.8% of patients. Hemoglobin A1c and BDNF were identified as negative independent factors for reduced activity (hemoglobin A1c, OR 0.012, <i>p</i> = 0.012; BDNF, OR 0.041, <i>p</i> = 0.039). Decision-tree analysis showed that "BDNF levels ≥ 19.1 ng/mL" was the most important classifier for reduced activity. In random forest analysis, serum BDNF level was the highest-ranked variable for distinguishing between the reduced and normal activity groups (158 valuable importance). Reduced activity was commonly seen in patients with NAFLD. Data-mining analyses revealed that BNDF was the most important independent factor corresponding with the reduction in activity. BDNF may be an important target for the prevention and treatment of NAFLD.

Also flagged:core histonescore histoneNAP1bindinghistoneDNA-Binding Proteins
Journal Article 2021-08-07 ✓ 5 Snippets Fabian R, Gaire S, Tyson C, Adhikari R, Pegg I, Sarkar A.
In-Text Gene Mentions

…core histones (withoutlinker histoneshistones) purified using…

…core histones (withoutlinker histoneshistones), the histones…

…core histones (nolinker histoneshistones), and the…

…core histones (withoutlinker histoneshistones), and the…

…core histones (withoutlinker histoneshistones), and NAP1.…

Show Full Abstract

We report data from single molecule studies on the interaction between single DNA molecules and core histones using custom-designed horizontal magnetic tweezers. The DNA-core histone complexes were formed using λ-DNA tethers, core histones, and NAP1 and were exposed to forces ranging from ~2 pN to ~74 pN. During the assembly events, we observed the length of the DNA decrease in approximate integer multiples of ~50 nm, suggesting the binding of the histone octamers to the DNA tether. During the mechanically induced disassembly events, we observed disruption lengths in approximate integer multiples of ~50 nm, suggesting the unbinding of one or more octamers from the DNA tether. We also observed histone octamer unbinding events at forces as low as ~2 pN. Our horizontal magnetic tweezers yielded high-resolution, low-noise data on force-mediated DNA-core histone assembly and disassembly processes.

Also flagged:Gene ExpressionMetal nanoparticlescoppersilvermetalsNanometals
Journal Article 2021-08-07 ✓ 1 Snippet Kulasza M, Skuza L.
In-Text Gene Mentions

…Down-regulated genes includedzinc-finger BED domain-containing protein 1BED domain-containing protein…

Show Full Abstract

Metal nanoparticles are used in various branches of industry due to their physicochemical properties. However, with intensive use, most of the waste and by-products from industries and household items, and from weathering of products containing nanoparticles, end up in the waters. These pollutants pose a risk to aquatic organisms, one of which is a change in the expression of various genes. Most of the data that focus on metal nanoparticles and their effects on aquatic organisms are about copper and silver nanoparticles, which is due to their popularity in general industry, but information about other nanoparticulate metals can also be found. This review aims to evaluate gene expression patterns in aquatic organisms by metal nanoparticles, specifying details about the transcription changes of singular genes and, if possible, comparing the changes in the expression of the same genes in different organisms. To achieve this goal, available publications tackling this problem are studied and summarized. Nanometals were found to have a modulatory effect on gene expression in different aquatic organisms. Data show both up-regulation and down-regulation of genes. Nano silver, nano copper, and nano zinc show a regulatory effect on genes involved in inflammation and apoptosis, cell cycle regulation and ROS defense as well as in general stress response and have a negative effect on the expression of genes involved in development. Nano gold, nano titanium, nano zinc, and nano iron tend to elevate the transcripts of genes involved in response to ROS, but also pro-apoptotic genes and down-regulate DNA repair-involved genes and anti-apoptotic-involved genes. Nano selenium showed a rare effect that is protective against harmful effects of other nanoparticles, but also induced up-regulation of stress response genes. This review focuses only on the effects of metal nanoparticles on the expression of various genes of aquatic organisms from different taxonomic groups.

Also flagged:DSCAMDown syndromelocomotionaxonaldeathsynaptogenesis
Journal Article 2021-08-07 No Snippets Lemieux M, Thiry L, Laflamme OD, Bretzner F.
Show Full Abstract

Locomotion results in an alternance of flexor and extensor muscles between left and right limbs generated by motoneurons that are controlled by the spinal interneuronal circuit. This spinal locomotor circuit is modulated by sensory afferents, which relay proprioceptive and cutaneous inputs that inform the spatial position of limbs in space and potential contacts with our environment respectively, but also by supraspinal descending commands of the brain that allow us to navigate in complex environments, avoid obstacles, chase prey, or flee predators. Although signaling pathways are important in the establishment and maintenance of motor circuits, the role of DSCAM, a cell adherence molecule associated with Down syndrome, has only recently been investigated in the context of motor control and locomotion in the rodent. DSCAM is known to be involved in lamination and delamination, synaptic targeting, axonal guidance, dendritic and cell tiling, axonal fasciculation and branching, programmed cell death, and synaptogenesis, all of which can impact the establishment of motor circuits during development, but also their maintenance through adulthood. We discuss herein how DSCAM is important for proper motor coordination, especially for breathing and locomotion.

Also flagged:Immune ResponseNeurodegenerationmitochondrionMitochondriacellnucleus
Journal Article 2021-08-07 No Snippets Luna-Sánchez M, Bianchi P, Quintana A.
Show Full Abstract

Symbiosis between the mitochondrion and the ancestor of the eukaryotic cell allowed cellular complexity and supported life. Mitochondria have specialized in many key functions ensuring cell homeostasis and survival. Thus, proper communication between mitochondria and cell nucleus is paramount for cellular health. However, due to their archaebacterial origin, mitochondria possess a high immunogenic potential. Indeed, mitochondria have been identified as an intracellular source of molecules that can elicit cellular responses to pathogens. Compromised mitochondrial integrity leads to release of mitochondrial content into the cytosol, which triggers an unwanted cellular immune response. Mitochondrial nucleic acids (mtDNA and mtRNA) can interact with the same cytoplasmic sensors that are specialized in recognizing genetic material from pathogens. High-energy demanding cells, such as neurons, are highly affected by deficits in mitochondrial function. Notably, mitochondrial dysfunction, neurodegeneration, and chronic inflammation are concurrent events in many severe debilitating disorders. Interestingly in this context of pathology, increasing number of studies have detected immune-activating mtDNA and mtRNA that induce an aberrant production of pro-inflammatory cytokines and interferon effectors. Thus, this review provides new insights on mitochondria-driven inflammation as a potential therapeutic target for neurodegenerative and primary mitochondrial diseases.

Also flagged:Curcuminhypersensitivitypathogenesisacetaminophenopioidsteroids
Journal Article 2021-08-07 ✓ 1 Snippet Hasriadi, Dasuni Wasana PW, Vajragupta O, Rojsitthisak P, Towiwat P.
In-Text Gene Mentions

Moreover, an extended study in hydrogen peroxide-stimulated primary astroglial and human astrocytes-spinal cord cells revealed that curcumin consistently decreased intracellular ROS, GFAP, prdx6 and TNF-α production and substantially inhibited NF-κβ signaling and its nuclear translocation [73,74].

Show Full Abstract

Chronic pain is a persistent and unremitting condition that has immense effects on patients' quality of life. Studies have shown that neuroinflammation is associated with the induction and progression of chronic pain. The activation of microglia and astrocytes is the major hallmark of spinal neuroinflammation leading to neuronal excitability in the projection neurons. Excessive activation of microglia and astrocytes is one of the major contributing factors to the exacerbation of pain. However, the current chronic pain treatments, mainly by targeting the neuronal cells, remain ineffective and unable to meet the patients' needs. Curcumin, a natural plant product found in the Curcuma genus, improves chronic pain by diminishing the release of inflammatory mediators from the spinal glia. This review details the role of curcumin in microglia and astrocytes both in vitro and in vivo and how it improves pain. We also describe the mechanism of curcumin by highlighting the major glia-mediated cascades in pain. Moreover, the role of curcumin on inflammasome and epigenetic regulation is discussed. Furthermore, we discuss the strategies used to improve the efficacy of curcumin. This review illustrates that curcumin modulating microglia and astrocytes could assure the treatment of chronic pain by suppressing spinal neuroinflammation.

Also flagged:DPM2MYD88CKAP4SDHCRPSAPPM1G
Journal Article 2021-08-06 ✓ 5 Snippets Li S, Ma J, Zheng A, Song X, Chen S, Jin F.
In-Text Gene Mentions

DDX27

Furthermore, we found that DDX27 expression (p = 0.017), tumor size (p = 0.0004), lymph node status (p < 0.0001), histological grade (p = 0.0004) and TNM stage (p < 0.0001) were in connection with worse OS in univariate Cox regression, and multivariate analysis showed the independent factors contained tumor size (p = 0.032), lymph node status (p = 0.013) and histological grade (p = 0.015) (Table 2).

According to our research, the expression level of DDX27 had a closely association with larger tumor, positive lymph nodes, higher histological grade, later TNM stage and a worse prognosis.

Analysis based on TCGA-BRCA database showed that DDX27 was significantly high expressed in cancer whether it's a paired analysis or not (p < 0.0001, Fig. 1a, b).

DDX27 had been confirmed to promote the development and metastasis in hepatocellular carcinoma and gastrointestinal cancer with poor prognosis [11–13].

Show Full Abstract

<h4>Background</h4>Although the rapid development of diagnosis and treatment has improved prognosis in early breast cancer, challenges from different therapeutic response remain due to breast cancer heterogeneity. DEAD-box helicase 27 (DDX27) had been proved to influence ribosome biogenesis and identified as a promoter in gastric and colorectal cancer associated with stem cell-like properties, while the impact of DDX27 on breast cancer prognosis and biological functions is unclear. We aimed to explore the influence of DDX27 on stem cell-like properties and prognosis in breast cancer.<h4>Methods</h4>The expression of DDX27 was evaluated in 24 pairs of fresh breast cancer and normal tissue by western blot. We conducted Immunohistochemical (IHC) staining in paraffin sections of 165 breast cancer patients to analyze the expression of DDX27 and its correlation to stemness biomarker. The Cancer Genome Atlas-Breast Cancer (TCGA-BRCA) database and the Clinical Proteomic Tumor Analysis Consortium (CPTAC) database were used to analyze the expression of DDX27 in breast cancer. Kaplan-Meier survival analysis were used to investigate the implication of DDX27 on breast cancer prognosis. Western blot, CCK-8 assay, Transwell assay and wound-healing assay were carried out to clarify the regulation of DDX27 on stem cell-like properties in breast cancer cells. Gene Set Enrichment Analysis (GSEA) was performed to analyze the potential molecular mechanisms of DDX27 in breast cancer.<h4>Results</h4>DDX27 was significantly high expressed in breast cancer compared with normal tissue. High expression of DDX27 was related to larger tumor size (p = 0.0005), positive lymph nodes (p = 0.0008), higher histological grade (p = 0.0040), higher ki-67 (p = 0.0063) and later TNM stage (p < 0.0001). Patients with high DDX27 expression turned out a worse prognosis on overall survival (OS, p = 0.0087) and disease-free survival (DFS, p = 0.0235). Overexpression of DDX27 could enhance the expression of biomarkers related to stemness and promote stem cell-like activities such as proliferation and migration in breast cancer cells.<h4>Conclusion</h4>DDX27 can enhance stem cell-like properties and cause poor prognosis in breast cancer, also may be expected to become a potential biomarker for breast cancer therapy.

Also flagged:IL-6GAPDHTRIM56PKCδTRIM10localization
Journal Article 2021-08-06 ✓ 4 Snippets Wang X, Zhang H, Shao Z, Zhuang W, Sui C, Liu F, Chen X, Hou J, Kong L, Liu H, Zheng Y, Liu B, Chen T, Zhang L, Jia X, Gao C.
In-Text Gene Mentions

TRIM38

…33 TRIM31, 34TRIM38, 35 TRIM39, 36…

…for TRIM14, TRIM27,TRIM38, TRIM39, and TRIM65…

…for TRIM14, TRIM27,TRIM38, TRIM39, and TRIM65.…

Show Full Abstract

Spleen tyrosine kinase (SYK) is a non-receptor tyrosine kinase, which plays an essential role in both innate and adaptive immunity. However, the key molecular mechanisms that regulate SYK activity are poorly understood. Here we identified the E3 ligase TRIM31 as a crucial regulator of SYK activation. We found that TRIM31 interacted with SYK and catalyzed K27-linked polyubiquitination at Lys375 and Lys517 of SYK. This K27-linked polyubiquitination of SYK promoted its plasma membrane translocation and binding with the C-type lectin receptors (CLRs), and also prevented the interaction with the phosphatase SHP-1. Therefore, deficiency of Trim31 in bone marrow-derived dendritic cells (BMDCs) and macrophages (BMDMs) dampened SYK-mediated signaling and inhibited the secretion of proinflammatory cytokines and chemokines against the fungal pathogen Candida albicans infection. Trim31<sup>-/-</sup> mice were also more sensitive to C. albicans systemic infection than Trim31<sup>+/+</sup> mice and exhibited reduced Th1 and Th17 responses. Overall, our study uncovered the pivotal role of TRIM31-mediated K27-linked polyubiquitination on SYK activation and highlighted the significance of TRIM31 in anti-C. albicans immunity.

Also flagged:LINC00467testicular germ cell tumorTGCTAKT3AKTphosphorylation
Journal Article 2021-08-06 ✓ 1 Snippet Bo H, Zhu F, Liu Z, Deng Q, Liu G, Li R, Zhu W, Tan Y, Liu G, Fan J, Fan L.
In-Text Gene Mentions

…positively correlated withTNFSF4, TNFRSF9, CD70, and…

Show Full Abstract

Long noncoding RNAs (lncRNAs) are involved in various physiological and pathological processes. However, the role of lncRNAs in testicular germ cell tumor (TGCT) has been rarely reported. Our purpose is to comprehensively survey the expression and function of lncRNAs in TGCT. In this study, we used RNA sequencing to construct the lncRNA expression profiles of 13 TGCT tissues and 4 paraneoplastic tissues to explore the function of lncRNAs in TGCT. The bioinformatics analysis showed that many lncRNAs are differentially expressed in TGCT. GO and KEGG enrichment analyses revealed that the differentially expressed lncRNAs participated in various biological processes associated with tumorigenesis in cis and trans manners. Further, we found that the expression of LINC00467 was positively correlated with the poor prognosis and pathological grade of TGCT using WGCNA analysis and GEPIA database data mining. In vitro experiments revealed that LNC00467 could promote the migration and invasion of TGCT cells by regulating the expression of AKT3 and influencing total AKT phosphorylation. Further analysis of TCGA data revealed that the expression was negatively correlated with the infiltration of immune cells and the response to PD1 immunotherapy. In summary, this study is the first to construct the expression profile of lncRNAs in TGCT. It is also the first study to identify the metastasis-promoting role of LNC00467, which can be used as a potential predictor of TGCT prognosis and immunotherapeutic response to provide a clinical reference for the treatment and diagnosis of TGCT metastasis.

Also flagged:ETV6PAX5Cancerclonal evolutionsidchromosomes
Journal Article 2021-08-06 ✓ 5 Snippets Sayyab S, Lundmark A, Larsson M, Ringnér M, Nystedt S, Marincevic-Zuniga Y, Tamm KP, Abrahamsson J, Fogelstrand L, Heyman M, Norén-Nyström U, Lönnerholm G, Harila-Saari A, Berglund EC, Nordlund J, Syvänen AC.
In-Text Gene Mentions

CACNA1E

Moreover, more than 2% of ~ 5000 samples from patients with haematopoietic and lymphoid cancers included in the COSMIC Release v94 database carried coding mutations in MYO9A, PALM2-AKAP2, MSI2 or CACNA1E (range 121–202 mutated samples per gene) (Supplementary Table S4).

…of ZNF648 andCACNA1E, respectively (Fig.…

…The relevance ofCACNA1Ewas in our…

…PALM2-AKAP2, MSI2 orCACNA1E(range 121–202 mutated…

Show Full Abstract

The mechanisms driving clonal heterogeneity and evolution in relapsed pediatric acute lymphoblastic leukemia (ALL) are not fully understood. We performed whole genome sequencing of samples collected at diagnosis, relapse(s) and remission from 29 Nordic patients. Somatic point mutations and large-scale structural variants were called using individually matched remission samples as controls, and allelic expression of the mutations was assessed in ALL cells using RNA-sequencing. We observed an increased burden of somatic mutations at relapse, compared to diagnosis, and at second relapse compared to first relapse. In addition to 29 known ALL driver genes, of which nine genes carried recurrent protein-coding mutations in our sample set, we identified putative non-protein coding mutations in regulatory regions of seven additional genes that have not previously been described in ALL. Cluster analysis of hundreds of somatic mutations per sample revealed three distinct evolutionary trajectories during ALL progression from diagnosis to relapse. The evolutionary trajectories provide insight into the mutational mechanisms leading relapse in ALL and could offer biomarkers for improved risk prediction in individual patients.

Also flagged:colorectal cancerironregulatorcolorectal carcinomapolymerasecancer
Journal Article 2021-08-06 ✓ 5 Snippets Kodagoda Gamage SM, Islam F, Cheng T, Aktar S, Lu CT, Ranaweera CD, Lee KTW, Dissabandara L, Gopalan V, Lam AK.
In-Text Gene Mentions

The study aimed to screen mutation of human homeostatic iron regulator (HFE) in colorectal carcinoma (CRC) and detect their associations with clinicopathological parameters.

Expression of HFE was determined by quantitative polymerase chain reaction in matched CRC and non neoplastic colorectal mucosal tissue of 76 patients.

Hence HFE mutations are common in CRC and are associated with clinicopathological parameters, implying the potential clinical significance of HFE mutations in colorectal carcinogenesis.

Approximately 60% of CRC showed low HFE expression.

HFEvariants in colorectal…

Show Full Abstract

The study aimed to screen mutation of human homeostatic iron regulator (HFE) in colorectal carcinoma (CRC) and detect their associations with clinicopathological parameters. Expression of HFE was determined by quantitative polymerase chain reaction in matched CRC and non neoplastic colorectal mucosal tissue of 76 patients. Genomic DNA extracted were subjected to high high-resolution melt curve analysis and Sanger sequencing to detect mutations in HFE. The associations of the identified mutations with a variety of clinical features were determined. Approximately 60% of CRC showed low HFE expression. Of the ten 10 mutations identified in exons 2 and 4, c.187C>G (H63D), c845G>A (C282Y), c.193A>T (S65C), g.3828T>C, g.5795T>C, and g.5728G>A were known mutations. Four novel mutations were discovered; : c.184G>A, c.220T>G, c.322A>C, and c.324T>C. Heterozygous H63D and C282Y mutations were seen in 71% and 49% of cancer tissue, respectively. Tumour site (p = 0.048) and gender (p = 0.039) were significantly associated with H63D and C282Y mutation status, respectively. Local spread of cancer was significantly associated with C282Y mutations in CRC cancer and adjacent non-neoplastic tissue (p = 0.029 & and p = 0.004, respectively). There was a statistically significant association between H63D and C282Y negativity in matched non-neoplastic colorectal mucosa tissue and pathological staging of cancer (p = 0.047 & and p = 0.001, respectively). Patients with H63D and C282Y mutations in cancer tissue tend to have higher survival rates. Hence HFE mutations are common in CRC and are associated with clinicopathological parameters, implying the potential clinical significance of HFE mutations in colorectal carcinogenesis.

Also flagged:rattrisiliconemyocardial ischemiaSunPEG
Journal Article 2021-08-06 ✓ 1 Snippet Yoshizaki Y, Takai H, Mayumi N, Fujiwara S, Kuzuya A, Ohya Y.
In-Text Gene Mentions

DCC

Show Full Abstract

Adipose-derived stem cell (AdSC) has been attracting attention as a convenient stem cell source. Not only AdSC can differentiate into various tissue cells, but it can also accelerate cell proliferation, anti-inflammation, and angiogenesis by secreting paracrine factors. Studies have demonstrated AdSC treatment of ischemic heart. However, an improvement in the remaining live AdSCs administered at the injected site while maintaining paracrine factor secretion is desired to achieve effective regenerative medicine. We previously reported the ABA-type tri-block copolymer of poly(ɛ-caprolactone-<i>co</i>-glycolic acid) and poly(ethylene glycol) (tri-PCG), exhibiting temperature-responsive sol-to-gel transition as biodegradable injectable polymer (IP) systems. Moreover, we recently reported that the biodegradable temperature-triggered chemically cross-linked gelation systems exhibited longer gel state durations using tri-PCG attaching acryloyl groups and a polythiol derivative. In this study, we explored this IP-mediated AdSC delivery system. We investigated the cell viability, mRNA expression, and cytokine secretion of AdSCs cultured in the physical or chemical IP hydrogels. Both of these IP hydrogels retained a certain number of viable cells, and RT-PCR and ELISA analyses revealed that mRNA expression and secretion of vascular endothelial growth factor of the AdSCs cultured in the chemical hydrogel were higher than the physical hydrogel. Moreover, AdSCs injected with the chemical hydrogel into ischemic heart model mice showed longer retention of the cells at the injected site and recovery from the ischemic condition. The results mean that the IP system is a promising candidate for a stem cell delivery system that exhibits the recovery of cardiac function for myocardial infarction treatment.

Also flagged:Neurodegenerative disordersbrain developmentneurodegenerative diseaseAlzheimerParkinson diseasesfrontotemporal dementia
Journal Article 2021-08-06 ✓ 5 Snippets Schor NF, Bianchi DW.
In-Text Gene Mentions

Huntington disease is caused by expanded CAG repeats of the HTT gene, which codes for the protein huntingtin.

One such model, R6/2 mice, exhibits increased vascular branching and pericyte activation in the striatum followed by the cortex, much the same as that seen in postmortem brains of patients with Huntington disease.44,45 This mouse line is transgenic for the 5’ end of the human HTT gene, carrying over 100 CAG repeats.46

…repeats of theHTTgene, which codes…

…of the humanHTTgene, carrying over…

…and knockout ofHTTlead to a…

Show Full Abstract

Neurodegenerative disorders are characterized by neuronal loss, usually in late life. But recently, abnormalities of proteins implicated in neurodegenerative disorders have been identified in disorders of childhood, raising the possibility that clues to susceptibility to and prevention of neurodegenerative disorders may be identifiable before symptoms of disease arise. This review leverages these new and evolving findings to test our hypothesis, first proposed in 2010, that proteins implicated in neurodegenerative disorders play important roles in brain development by examining evidence in the peer-reviewed literature published in the past five years for the relevance of these proteins in normal and disease-associated brain development.

Also flagged:Ochratoxin Acarboxylaminogreen fluorescence proteinNanosensprotein synthesis
Journal Article 2021-08-06 No Snippets Su B, Zhang Z, Sun Z, Tang Z, Xie X, Chen Q, Cao H, Yu X, Xu Y, Liu X, Hammock BD.
Show Full Abstract

Ochratoxin A (OTA) contamination in food is a serious threat to public health. There is an urgent need for development of rapid and sensitive methods for OTA detection, to minimize consumer exposure to OTA. In this study, we constructed two OTA-specific fluonanobodies (FluoNbs), with a nanobody fused at the carboxyl-terminal (SGFP-Nb) or the amino-terminal (Nb-SGFP) of superfolder green fluorescence protein. SGFP-Nb, which displayed better fluorescence performance, was selected as the tracer for OTA, to develop a FluoNb-based nanosensor (FN-Nanosens) via the fluorescence resonance energy transfer, where the SGFP-Nb served as the donor and the chemical conjugates of OTA-quantum dots served as the acceptor. After optimization, FN-Nanosens showed a limit of detection of 5 pg/mL, with a linear detection range of 5-5000 pg/mL. FN-Nanosens was found to be highly selective for OTA and showed good accuracy and repeatability in recovery experiments using cereals with various complex matrix environments. Moreover, the contents of OTA in real samples measured using FN-Nanosens correlated well with those from the liquid chromatography with tandem mass spectrometry. Therefore, this work illustrated that the FluoNb is an ideal immunosensing tool and that FN-Nanosens is reliable for rapid detection of OTA in cereals with ultrahigh sensitivity.

Also flagged:nucleotidesneurodegenerative disordersHDneurodegenerative disorderHuntingtinchromosome
Journal Article 2021-08-06 ✓ 5 Snippets Dong X, Cong S.
In-Text Gene Mentions

Jayadev et al. (2013) and Juzwik et al. (2019) identified miR-146a as a negative regulator of the monocyte proinflammatory response. Ghose et al. (2011) found that miR-146a expression was decreased in STHdh (Q111)/Hdh (Q111) cells, and the low expression was due to the low activity of the p65 subunit of NF-κB (RelA/NF-κB). The miR-146a can also target human and mouse Htt gene. Sinha et al. (2011) suggested that this regulatory relationship might provide a new mechanism for the modulation of HD. In addition, decreased miR-146a expression can increase the expression of CHEK1 and CCNA2, which may rescue the cell cycle and apoptotic abnormalities in STHdh (Q111)/Hdh (Q111) cells. The miR-146a may also target Tata binding protein (TBP), and dysregulated miR-146a may contribute to HD pathogenesis by targeting TBP (Sinha et al., 2010). Das and Bhattacharyya (2015) suggested that heat shock factor 1 (HSF1) could regulate miR-146a and suppress mHTT aggregates in HD cells. Therefore, miR-146a may be involved in the pathogenesis of HD through a variety of mechanisms, and thus, regulating the expression of miR-146a may be a potential approach to treat HD through a variety of pathways (Das et al., 2015).

Kozlowska et al. (2013) confirmed an interaction between miR-214 and the 3′-UTR of Htt. While wtHtt did not affect miR-214 or β-catenin expression, mHtt mediated β-catenin downregulation by upregulating miR-214 (Ghatak and Raha, 2018). HSF1-regulated miR-214 expression can suppress mHTT aggregation in an HD cell model (Das and Bhattacharyya, 2015). Bucha et al. (2015) showed that increased miR-214 expression in HD cells could target mitofusin2 (MFN2), thereby altering mitochondrial morphology and deregulating the cell cycle.

Sinha et al. (2012) showed that 54 miRNAs were differentially expressed in the postmortem brains of patients with HD, which included 30 miRNAs with high expression and 24 miRNAs with low expression. Among these differentially expressed miRNAs, 26 were regulated by the REST, TP53, and E2F1 transcription factors (Sinha et al., 2012). Moreover, Johnson and Buckley (2009) found that some critical neuronal miRNAs (e.g., miR-9, miR-124, and miR-132) were downregulated in the brains of HD patients and mouse models, potentially disrupting mRNA regulation and neuronal function. By using miRNA microarray analysis, Lee et al. (2007) showed full expression profiles of miRNAs in three HD mouse models. The R6/2 HD transgenic mice expressed the N-terminal exon 1 of a human mHtt (Ehrnhoefer et al., 2009), while the YAC128 transgenic mice expressed a full-length mHtt that replicated the one found in patients with HD. The authors showed that nine miRNAs (miR-22, miR-29c, miR-128, miR-132, miR-138, miR-218, miR-222, miR-344, and miR-674∗) were downregulated in YAC128 and R6/2. Chronic 3- nitropropionic acid (3NP) administration inhibits mitochondrial succinate Ca2+ homeostasis and dehydrogenase complex II, which induces striatal neurodegeneration due to mitochondrial dysfunction. In the 3NP-induced rat model of HD, the miRNA profile did not overlap with that of the transgenic mice, which may because mHtt modulated some aspect of the HTT activity in extra-mitochondrial energy metabolism rather than causing a direct impact on the mitochondrion (Lee et al., 2007). Accordingly, mHTT seems to compromise both the level and function of miRNAs. The mechanism by which mHTT alters miRNA biogenesis warrants future studies. HD is characterized by selective neuronal vulnerability, and neurons in the striatum and deep layer cortical neurons are the most vulnerable to degeneration; in contrast, neurons in other areas of the brain (such as the cerebellum) are relatively resistant to cell death induced by mHTT (Vonsattel and Difiglia, 1998). By analyzing the expression of miRNAs in the different regions of the brain of HD model mice with increasing CAG length in the endogenous Htt, Langfelder et al. (2018) found that the differential expression of miRNAs was most apparent in the striatum (159 differentially expressed miRNAs) followed by the cerebellum (102 differentially expressed miRNAs), hippocampus (51 differentially expressed miRNAs), and cerebral cortex (45 differentially expressed miRNAs). They further showed that miR-212, miR-132, miR-128, and miR-218 might be significantly associated with Htt CAG repeat expansion, thus suggesting that these miRNAs may be involved in the differential sensitivity to CAG length expansion (Langfelder et al., 2018).

HD is related to the unstable expansion of CAG triplet repeats in exon 1 of Htt. The normal Htt allele contains 6–35 CAG triplet repeats.

Rescue the abnormalities of HD in cell cycle and apoptosis, regulates HTT and TBP expression in cell culture

Show Full Abstract

MicroRNA (miRNA) is a non-coding single-stranded small molecule of approximately 21 nucleotides. It degrades or inhibits the translation of RNA by targeting the 3'-UTR. The miRNA plays an important role in the growth, development, differentiation, and functional execution of the nervous system. Dysregulated miRNA expression has been associated with several pathological processes of neurodegenerative disorders, including Huntington's disease (HD). Recent studies have suggested promising roles of miRNAs as biomarkers and potential therapeutic targets for HD. Here, we review the emerging role of dysregulated miRNAs in HD and describe general biology of miRNAs, their pathophysiological implications, and their potential roles as biomarkers and therapeutic agents.

Also flagged:sublimatelyricsyouhisPI3KPhosphatidylinositol 3-kinase
Journal Article 2021-08-06 ✓ 1 Snippet Zheng H, Liu H, Xu Q, Wang W, Li L, Ye G, Wen X, Chen F, Yu Y.
In-Text Gene Mentions

Tumor suppressor gene PTENsuppressor gene PTEN…

Show Full Abstract

Phosphatidylinositol 3-kinase (PI3K) signaling plays a central role in various biological processes, and its abnormality leads to a broad spectrum of human diseases, such as cancer, fibrosis, and immunological disorders. However, the mechanisms by which PI3K signaling regulates the behavior of stem cells during regeneration are poorly understood. Planarian flatworms possess abundant adult stem cells (called neoblasts) allowing them to develop remarkable regenerative capabilities, thus the animals represent an ideal model for studying stem cells and regenerative medicine <i>in vivo</i>. In this study, the spatiotemporal expression pattern of <i>Djpi3k</i>, a PI3K ortholog in the planarian <i>Dugesia japonica</i>, was investigated and suggests its potential role in wound response and tissue regeneration. A loss-of-function study was conducted using small molecules and RNA interference technique, providing evidence that PI3K signaling is required for blastema regrowth and cilia maintenance during planarian regeneration and homeostasis. Interestingly, the mitotic and apoptotic responses to amputation are substantially abated in PI3K inhibitor-treated regenerating animals, while knockdown of <i>Djpi3k</i> alleviates the mitotic response and postpones the peak of apoptotic cell death, which may contribute to the varying degrees of regenerative defects induced by the pharmacological and genetic approaches. These observations reveal novel roles for PI3K signaling in the regulation of the cellular responses to amputation during planarian regeneration and provide insights for investigating the disease-related genes in the regeneration-competent organism <i>in vivo</i>.

Also flagged:RampACGEADlocked nucleic acidsssAPA
Journal Article 2021-08-06 No Snippets Zhou D, Fan J, Liu Z, Tang R, Wang X, Bo H, Zhu F, Zhao X, Huang Z, Xing L, Tao K, Zhang H, Nie H, Zhang H, Zhu W, He Z, Fan L.
Show Full Abstract

Spermatogonial stem cells (SSCs) are the initial cells for the spermatogenesis. Although much progress has been made on uncovering a number of modulators for the SSC fate decisions in rodents, the genes mediating human SSCs remain largely unclear. Here we report, for the first time, that TCF3, a member of the basic helix-loop-helix family of transcriptional modulator proteins, can stimulate proliferation and suppress the apoptosis of human SSCs through targeting podocalyxin-like protein (PODXL). TCF3 was expressed primarily in GFRA1-positive spermatogonia, and EGF (epidermal growth factor) elevated TCF3 expression level. Notably, TCF3 enhanced the growth and DNA synthesis of human SSCs, whereas it repressed the apoptosis of human SSCs. RNA sequencing and chromatin immunoprecipitation (ChIP) assays revealed that TCF3 protein regulated the transcription of several genes, including <i>WNT2B</i>, <i>TGFB3</i>, <i>CCN4</i>, <i>MEGF6</i>, and <i>PODXL</i>, while PODXL silencing compromised the stem cell activity of SSCs. Moreover, the level of TCF3 protein was remarkably lower in patients with spermatogenesis failure when compared to individuals with obstructive azoospermia with normal spermatogenesis. Collectively, these results implicate that TCF3 modulates human SSC proliferation and apoptosis through PODXL. This study is of great significance since it would provide a novel molecular mechanism underlying the fate determinations of human SSCs and it could offer new targets for gene therapy of male infertility.

Also flagged:A34RPC1HNRNPA3PAIP1KPNA4Glioma
Journal Article 2021-08-06 No Snippets He Y, Chen Y, Tong Y, Long W, Liu Q.
Show Full Abstract

<h4>Background</h4>Glioma is the most common brain neoplasm with a poor prognosis. Circular RNA (circRNA) and their associated competing endogenous RNA (ceRNA) network play critical roles in the pathogenesis of glioma. However, the alteration of the circRNA-miRNA-mRNA regulatory network and its correlation with glioma therapy haven't been systematically analyzed.<h4>Methods</h4>With GEO, GEPIA2, circBank, CSCD, CircInteractome, mirWalk 2.0, and mirDIP 4.1, we constructed a circRNA-miRNA-mRNA network in glioma. LASSO regression and multivariate Cox regression analysis established a hub mRNA signature to assess the prognosis. GSVA was used to estimate the immune infiltration level. Potential anti-glioma drugs were forecasted using the cMap database and evaluated with GSEA using GEO data.<h4>Results</h4>A ceRNA network of seven circRNAs (hsa_circ_0030788/0034182/0000227/ 0018086/0000229/0036592/0002765), 15 miRNAs(hsa-miR-1200/1205/1248/ 1303/3925-5p/5693/581/586/599/607/640/647/6867-5p/767-3p/935), and 46 mRNAs (including 11 hub genes of ARHGAP11A, DRP2, HNRNPA3, IGFBP5, IP6K2, KLF10, KPNA4, NRP2, PAIP1, RCN1, and SEMA5A) was constructed. Functional enrichment showed they influenced majority of the hallmarks of tumors. Eleven hub genes were proven to be decent prognostic signatures for glioma in both TCGA and CGGA datasets. Forty-six LASSO regression significant genes were closely related to immune infiltration. Finally, five compounds (fulvestrant, tanespimycin, mifepristone, tretinoin, and harman) were predicted as potential treatments for glioma. Among them, mifepristone and tretinoin were proven to inhibit the cell cycle and DNA repair in glioma.<h4>Conclusion</h4>This study highlights the potential pathogenesis of the circRNA-miRNA-mRNA regulatory network and identifies novel therapeutic options for glioma.

Also flagged:liver fibrosisdeathGene Expressionextracellularcell surfaceimmune response
Journal Article 2021-08-06 ✓ 1 Snippet Tai Y, Zhao C, Gao J, Lan T, Tong H.
In-Text Gene Mentions

…, PFKFB3 ,PTGIS, SLA and…

Show Full Abstract

<h4>Background</h4>Liver cirrhosis is one of the leading causes of death worldwide. MicroRNAs (miRNAs) can regulate liver fibrosis, but the underlying mechanisms are not fully understood, and the interactions between miRNAs and mRNAs are not clearly elucidated.<h4>Methods</h4>miRNA and mRNA expression arrays of cirrhotic samples and control samples were acquired from the Gene Expression Omnibus database. miRNA-mRNA integrated analysis, functional enrichment analysis and protein-protein interaction (PPI) network construction were performed to identify differentially expressed miRNAs (DEMs) and mRNAs (DEGs), miRNA-mRNA interaction networks, enriched pathways and hub genes. Finally, the results were validated with <i>in vitro</i> cell models.<h4>Results</h4>By bioinformatics analysis, we identified 13 DEMs between cirrhotic samples and control samples. Among these DEMs, six upregulated (hsa-miR-146b-5p, hsa-miR-150-5p, hsa-miR-224-3p, hsa-miR-3135b, hsa-miR-3195, and hsa-miR-4725-3p) and seven downregulated (hsa-miR-1234-3p, hsa-miR-30b-3p, hsa-miR-3162-3p, hsa-miR-548aj-3p, hsa-miR-548x-3p, hsa-miR-548z, and hsa-miR-890) miRNAs were further validated in activated LX2 cells. miRNA-mRNA interaction networks revealed a total of 361 miRNA-mRNA pairs between 13 miRNAs and 245 corresponding target genes. Moreover, PPI network analysis revealed the top 20 hub genes, including <i>COL1A1</i>, <i>FBN1</i> and <i>TIMP3,</i> which were involved in extracellular matrix (ECM) organization; <i>CCL5</i>, <i>CXCL9</i>, <i>CXCL12</i>, <i>LCK</i> and <i>CD24</i>, which participated in the immune response; and <i>CDH1</i>, <i>PECAM1</i>, <i>SELL</i> and <i>CAV1,</i> which regulated cell adhesion. Functional enrichment analysis of all DEGs as well as hub genes showed similar results, as ECM-associated pathways, cell surface interaction and adhesion, and immune response were significantly enriched in both analyses.<h4>Conclusions</h4>We identified 13 differentially expressed miRNAs as potential biomarkers of liver cirrhosis. Moreover, we identified 361 regulatory pairs of miRNA-mRNA and 20 hub genes in liver cirrhosis, most of which were involved in collagen and ECM components, immune response, and cell adhesion. These results would provide novel mechanistic insights into the pathogenesis of liver cirrhosis and identify candidate targets for its treatment.

Also flagged:ferroptosislung adenocarcinomaLUADGene ExpressionLung cancerdeath
Journal Article 2021-08-06 ✓ 2 Snippets Cai J, Li C, Li H, Wang X, Zhou Y.
In-Text Gene Mentions

ALOX15 is involved in ferroptosis through multiple pathways (Stoyanovsky et al., 2019), including regulating the activation of Ras selective lethal small molecular 3 (RSL3) (Probst et al., 2017), reducing the activation of glutathione (GSH), and forming a complex with phosphatidylethanolamine binding protein 1(PEBP1) (Wenzel et al., 2017).

…thanolamine binding protein 1(PEBP1) ( Wenzel et…

Show Full Abstract

<h4>Objective</h4>Lung cancer is the most common malignancy worldwide and exhibits both high morbidity and mortality. In recent years, scientists have made substantial breakthroughs in the early diagnosis and treatment of lung adenocarcinoma (LUAD), however, patient prognosis still shows vast individual differences. In this study, bioinformatics methods were used to identify and analyze ferroptosis-related genes to establish an effective signature for predicting prognosis in LUAD patients.<h4>Methods</h4>The gene expression profiles of LUAD patients with complete clinical and follow-up information were downloaded from two public databases, univariate Cox regression and multivariate Cox regression analysis were used to obtain ferroptosis-related genes for constructing the prognos tic risk model, AUC and calibration plot were used to evaluate the predictive accuracy of the FRGS and nomogram.<h4>Results</h4>A total of 74 ferroptosis-related differentially expressed genes (DEGs) were identi fied between LUAD and normal tissues from The Cancer Genome Atlas (TCGA) database. A five-gene panel for prediction of LUAD prognosis was established by multivariate regression and was verified using the GSE68465 cohort from the Gene Expression Omnibus (GEO) database. Patients were divided into two different risk groups according to the median risk score of the five genes. Based on Kaplan-Meier (KM) analysi, the OS rate of the high-risk group was markedly worse than that of the low-risk group. We also found that risk score was an independent prognostic indicator. The receiver operating characteristic ROC curve showed that the proposed model had good prediction ability. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional analyses indicated that risk score was prominently enriched in ferroptosis processes. Moreover, at the score of immune-associated gene sets, significant differences were found between the two risk groups.<h4>Conclusions</h4>This study demonstrated that ferroptosis-related gene signatures can be used as a potential predictor for the prognosis of LUAD, thus providing a novel strategy for individualized treatment in LUAD patients.

Also flagged:Down Syndromegenetic disordersdevelopmental delaysintellectual disabilitieschromosomedevelopmental intellectual disabilities
Journal Article 2021-08-06 ✓ 1 Snippet Li Y, Xing Z, Yu T, Pao A, Daadi M, Yu YE.
In-Text Gene Mentions

…genomic region betweenMrpl39and the telomere…

Show Full Abstract

Down syndrome (DS) is one of the most complex genetic disorders in humans and a leading genetic cause of developmental delays and intellectual disabilities. The mouse remains an essential model organism in DS research because human chromosome 21 (Hsa21) is orthologously conserved with three regions in the mouse genome. Recent studies have revealed complex interactions among different triplicated genomic regions and Hsa21 gene orthologs that underlie major DS phenotypes. Because we do not know conclusively which triplicated genes are indispensable in such interactions for a specific phenotype, it is desirable that all evolutionarily conserved Hsa21 gene orthologs are triplicated in a complete model. For this reason, the Dp(10)1Yey/+;Dp(16)1Yey/+;Dp(17)1Yey/+ mouse is the most complete model of DS to reflect gene dosage effects because it is the only mutant triplicated for all Hsa21 orthologous regions. Recently, several groups have expressed concerns that efforts needed to generate the triple compound model would be so overwhelming that it may be impractical to take advantage of its unique strength. To alleviate these concerns, we developed a strategy to drastically improve the efficiency of generating the triple compound model with the aid of a targeted coat color, and the results confirmed that the mutant mice generated via this approach exhibited cognitive deficits.

Also flagged:Integral Membrane Protein 2AHedgehogHhPTCH1ITM2Aautophagy
Journal Article 2021-08-06 ✓ 3 Snippets Morales-Alcala CC, Georgiou IC, Timmis AJ, Riobo-Del Galdo NA.
In-Text Gene Mentions

…with NUP93 andCSE1Lcould be involved…

…(a nucleoporin) andCSE1L(exportin) might regulate…

CSE1Lmediates the re-export…

Show Full Abstract

The Hedgehog (Hh) receptor PTCH1 and the integral membrane protein 2A (ITM2A) inhibit autophagy by reducing autolysosome formation. In this study, we demonstrate that ITM2A physically interacts with PTCH1; however, the two proteins inhibit autophagic flux independently, since silencing of ITM2A did not prevent the accumulation of LC3BII and p62 in PTCH1-overexpressing cells, suggesting that they provide alternative modes to limit autophagy. Knockdown of ITM2A potentiated PTCH1-induced autophagic flux blockade and increased PTCH1 expression, while ITM2A overexpression reduced PTCH1 protein levels, indicating that it is a negative regulator of PTCH1 non-canonical signalling. Our study also revealed that endogenous ITM2A is necessary for timely induction of myogenic differentiation markers in C2C12 cells since partial knockdown delays the timing of differentiation. We also found that basal autophagic flux decreases during myogenic differentiation at the same time that ITM2A expression increases. Given that canonical Hh signalling prevents myogenic differentiation, we investigated the effect of ITM2A on canonical Hh signalling using GLI-luciferase assays. Our findings demonstrate that ITM2A is a strong negative regulator of GLI transcriptional activity and of GLI1 stability. In summary, ITM2A negatively regulates canonical and non-canonical Hh signalling.

Also flagged:glucoseinsulinglucagonsomatostatinsecretory granulesexocytosis
Journal Article 2021-08-06 ✓ 1 Snippet Tuluc P, Theiner T, Jacobo-Piqueras N, Geisler SM.
In-Text Gene Mentions

Despite the observation that CaV2.3 channels have a marginal contribution to β-cell functions in humans, several polymorphisms in CACNA1E gene encoding for CaV2.3-α1E subunit have been reported to associate with an increased incidence of T2DM [106,107].

Show Full Abstract

The pancreatic islets of Langerhans secrete several hormones critical for glucose homeostasis. The β-cells, the major cellular component of the pancreatic islets, secrete insulin, the only hormone capable of lowering the plasma glucose concentration. The counter-regulatory hormone glucagon is secreted by the α-cells while δ-cells secrete somatostatin that via paracrine mechanisms regulates the α- and β-cell activity. These three peptide hormones are packed into secretory granules that are released through exocytosis following a local increase in intracellular Ca<sup>2+</sup> concentration. The high voltage-gated Ca<sup>2+</sup> channels (HVCCs) occupy a central role in pancreatic hormone release both as a source of Ca<sup>2+</sup> required for excitation-secretion coupling as well as a scaffold for the release machinery. HVCCs are multi-protein complexes composed of the main pore-forming transmembrane α<sub>1</sub> and the auxiliary intracellular β, extracellular α<sub>2</sub>δ, and transmembrane γ subunits. Here, we review the current understanding regarding the role of all HVCC subunits expressed in pancreatic β-cell on electrical activity, excitation-secretion coupling, and β-cell mass. The evidence we review was obtained from many seminal studies employing pharmacological approaches as well as genetically modified mouse models. The significance for diabetes in humans is discussed in the context of genetic variations in the genes encoding for the HVCC subunits.

Also flagged:Calcium PhosphatehydroxyapatitemineralstrontiummagnesiumCalcium carbonate
Journal Article 2021-08-06 No Snippets Bauer L, Antunović M, Gallego-Ferrer G, Ivanković M, Ivanković H.
Show Full Abstract

Ionic substitutions within the hydroxyapatite lattice are a widely used approach to mimic the chemical composition of the bone mineral. In this work, Sr-substituted and Mg- and Sr-co-substituted calcium phosphate (CaP) scaffolds, with various levels of strontium and magnesium substitution, were prepared using the hydrothermal method at 200 °C. Calcium carbonate skeletons of cuttlefish bone, ammonium dihydrogenphosphate (NH<sub>4</sub>H<sub>2</sub>PO<sub>4</sub>), strontium nitrate (Sr(NO<sub>3</sub>)<sub>2</sub>), and magnesium perchlorate (Mg(ClO<sub>4</sub>)<sub>2</sub>) were used as reagents. Materials were characterized by means of X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Whole powder pattern decomposition refinements of XRD data indicated that increased magnesium content in the Mg- and Sr-co-substituted scaffolds was related to an increased proportion of the whitlockite (WH) phase in the biphasic hydroxyapatite (HAp)/WH scaffolds. In addition, refinements indicate that Sr<sup>2+</sup> ions have replaced Ca<sup>2+</sup> sites in the WH phase. Furthermore, PCL-coated Mg-substituted and Sr- and Mg-co-substituted scaffolds, with the HAp:WH wt. ratio of 90:10 were prepared by vacuum impregnation. Results of compression tests showed a positive impact of the WH phase and PCL coating on the mechanical properties of scaffolds. Human mesenchymal stem cells (hMSCs) were cultured on composite scaffolds in an osteogenic medium for 21 days. Immunohistochemical staining showed that Mg-Sr-CaP/PCL scaffold exhibited higher expression of collagen type I than the Mg-CaP/PCL scaffold, indicating the positive effect of Sr<sup>2+</sup> ions on the differentiation of hMSCs, in concordance with histology results. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis confirmed an early stage of osteogenic differentiation.

Also flagged:watertissuepolymersdegradationobesitybone formation
Journal Article 2021-08-06 No Snippets Sharma S, Sudhakara P, Singh J, Ilyas RA, Asyraf MRM, Razman MR.
Show Full Abstract

In the determination of the bioavailability of drugs administered orally, the drugs' solubility and permeability play a crucial role. For absorption of drug molecules and production of a pharmacological response, solubility is an important parameter that defines the concentration of the drug in systemic circulation. It is a challenging task to improve the oral bioavailability of drugs that have poor water solubility. Most drug molecules are either poorly soluble or insoluble in aqueous environments. Polymer nanocomposites are combinations of two or more different materials that possess unique characteristics and are fused together with sufficient energy in such a manner that the resultant material will have the best properties of both materials. These polymeric materials (biodegradable and other naturally bioactive polymers) are comprised of nanosized particles in a composition of other materials. A systematic search was carried out on Web of Science and SCOPUS using different keywords, and 485 records were found. After the screening and eligibility process, 88 journal articles were found to be eligible, and hence selected to be reviewed and analyzed. Biocompatible and biodegradable materials have emerged in the manufacture of therapeutic and pharmacologic devices, such as impermanent implantation and 3D scaffolds for tissue regeneration and biomedical applications. Substantial effort has been made in the usage of bio-based polymers for potential pharmacologic and biomedical purposes, including targeted deliveries and drug carriers for regulated drug release. These implementations necessitate unique physicochemical and pharmacokinetic, microbiological, metabolic, and degradation characteristics of the materials in order to provide prolific therapeutic treatments. As a result, a broadly diverse spectrum of natural or artificially synthesized polymers capable of enzymatic hydrolysis, hydrolyzing, or enzyme decomposition are being explored for biomedical purposes. This summary examines the contemporary status of biodegradable naturally and synthetically derived polymers for biomedical fields, such as tissue engineering, regenerative medicine, bioengineering, targeted drug discovery and delivery, implantation, and wound repair and healing. This review presents an insight into a number of the commonly used tissue engineering applications, including drug delivery carrier systems, demonstrated in the recent findings. Due to the inherent remarkable properties of biodegradable and bioactive polymers, such as their antimicrobial, antitumor, anti-inflammatory, and anticancer activities, certain materials have gained significant interest in recent years. These systems are also actively being researched to improve therapeutic activity and mitigate adverse consequences. In this article, we also present the main drug delivery systems reported in the literature and the main methods available to impregnate the polymeric scaffolds with drugs, their properties, and their respective benefits for tissue engineering.

Also flagged:caveolin-1tumorswatertenacetonitrilenanoparticle
Journal Article 2021-08-06 ✓ 1 Snippet Robb R, Kuo JC, Liu Y, Corrales-Guerrero S, Cui T, Hegazi A, Nagy G, Lee RJ, Williams TM.
In-Text Gene Mentions

DCC

Show Full Abstract

In recent years, human serum albumin (HSA) has been characterized as an ideal drug carrier in the cancer arena. Caveolin-1 (Cav-1) has been established as the principal structural protein of caveolae and, thus, critical for caveolae-mediated endocytosis. Cav-1 has been shown to be overexpressed in cancers of the lung and pancreas, among others. We found that Cav-1 expression plays a critical role in both HSA uptake and response to albumin-based chemotherapies. As such, developing a novel albumin-based chemotherapy that is more selective for tumors with high Cav-1 expression or high levels of caveolar-endocytosis could have significant implications in biomarker-directed therapy. Herein, we present the development of a novel and effective HSA-SN-38 conjugate (SSH20). We find that SSH20 uptake decreases significantly by immunofluorescence assays and western blotting after silencing of Cav-1 expression through RNA interference. Decreased drug sensitivity occurs in Cav-1-depleted cells using cytotoxicity assays. Importantly, we find significantly reduced sensitivity to SSH20 in Cav-1-silenced tumors compared to Cav-1-expressing tumors <i>in vivo</i>. Notably, we show that SSH20 is significantly more potent than irinotecan <i>in vitro</i> and <i>in vivo</i>. Together, we have developed a novel HSA-conjugated chemotherapy that is potent, effective, safe, and demonstrates improved efficacy in high Cav-1-expressing tumors.

Also flagged:colorectal cancercolorectal adenomascolorectal diverticulitisdiverticulitiscancercolorectal disease
Journal Article 2021-08-05 No Snippets Stang A, Weilert H, Lipp MJ, Oldhafer KJ, Hoheisel JD, Zhang C, Bauer AS.
Show Full Abstract

Association studies have linked alterations of blood-derived microRNAs (miRNAs) with colorectal cancer (CRC). Here, we performed a microarray-based comparison of the profiles of 2549 miRNAs in 80 blood samples from healthy donors and patients with colorectal adenomas, colorectal diverticulitis and CRC at different stages. Confirmation by quantitative real-time PCR (RT-PCR) was complemented by validation of identified molecules in another 36 blood samples. No variations in miRNA levels were observed in samples from patients with colorectal adenomas and diverticulitis or from healthy donors. However, there were 179 CRC-associated miRNAs of differential abundance compared to healthy controls. Only three - miR-1225-5p, miR-1207-5p and miR-4459 - exhibited increased levels at all CRC stages. Most deregulated miRNAs (128/179, 71%) specifically predicted metastatic CRC. Pathway analysis found several cancer-related pathways to which the miRNAs contribute in various ways. In conclusion, miRNA levels in blood vary throughout CRC progression and affect cellular functions relevant to haematogenous CRC progression and dissemination. The identified biomarker and therapeutic candidates require further confirmation of their clinical relevance.

Also flagged:Neurodegenerative movement disordersParkinson's diseasemultiple system atrophyprogressive supranuclear palsyHuntington's diseaseageing
Journal Article 2021-08-05 ✓ 2 Snippets Murthy M, Cheng YY, Holton JL, Bettencourt C.
In-Text Gene Mentions

HD is an autosomal dominant, fatal disease, caused by an aberrant CAG trinucleotide repeat expansion (>36) in the huntingtin (HTT) gene [101, 102].

…exon 1 ofHTTas the most…

Show Full Abstract

Neurodegenerative movement disorders (NMDs) are age-dependent disorders that are characterised by the degeneration and loss of neurons, typically accompanied by pathological accumulation of different protein aggregates in the brain, which lead to motor symptoms. NMDs include Parkinson's disease, multiple system atrophy, progressive supranuclear palsy, and Huntington's disease, among others. Epigenetic modifications are responsible for functional gene regulation during development, adult life and ageing and have progressively been implicated in complex diseases such as cancer and more recently in neurodegenerative diseases, such as NMDs. DNA methylation is by far the most widely studied epigenetic modification and consists of the reversible addition of a methyl group to the DNA without changing the DNA sequence. Although this research field is still in its infancy in relation to NMDs, an increasing number of studies point towards a role for DNA methylation in disease processes. This review addresses recent advances in epigenetic and epigenomic research in NMDs, with a focus on human brain DNA methylation studies. We discuss the current understanding of the DNA methylation changes underlying these disorders, the potential for use of these DNA modifications in peripheral tissues as biomarkers in early disease detection, classification and progression as well as a promising role in future disease management and therapy.

Also flagged:acute strokestrokemiddle cerebral arteryGene expressionion channelssignal transduction
Journal Article 2021-08-05 ✓ 1 Snippet Wu QJ, Sun X, Teves L, Mayor D, Tymianski M.
In-Text Gene Mentions

Gpr52

Show Full Abstract

Neuroprotection in acute stroke has not been successfully translated from animals to humans. Animal research on promising agents continues largely in rats and mice which are commonly available to researchers. However, controversies continue on the most suitable species to model the human situation. Generally, putative agents seem less effective in mice as compared with rats. We hypothesized that this may be due to inter-species differences in stroke response and that this might be manifest at a genetic level. Here we used whole-genome microarrays to examine the differential gene regulation in the ischemic penumbra of mice and rats at 2 and 6 h after permanent middle cerebral artery occlusion (pMCAO; Raw microarray CEL data files are available in the GEO database with an accession number GSE163654). Differentially expressed genes (adj. p ≤ 0.05) were organized by hierarchical clustering, correlation plots, Venn diagrams and pathway analyses in each species and at each time-point. Emphasis was placed on genes already known to be associated with stroke, including validation by RT-PCR. Gene expression patterns in the ischemic penumbra differed strikingly between the species at both 2 h and 6 h. Nearly 90% of significantly regulated genes and most pathways modulated by ischemia differed between mice and rats. These differences were evident globally, among stroke-associated genes, immediate early genes, genes implicated in stress response, inflammation, neuroprotection, ion channels, and signal transduction. The findings of this study may have significant implications for the choice of species for screening putative stroke therapies.

Also flagged:androgen receptorARTier 1 ARluciferasebioluminescenceandrogen
Journal Article 2021-08-05 No Snippets Xu T, Gilliam M, Sayler G, Ripp S, Close D.
Show Full Abstract

Due to the public health concerns of endocrine-disrupting chemicals, there is an increasing demand to develop improved high-throughput detection assays for enhanced exposure control and risk assessment. A substrate-free, autobioluminescent HEK293<sub>ARE/Gal4-Lux</sub> assay was developed to screen compounds for their ability to induce androgen receptor (AR)-mediated transcriptional activation. The assay was validated against a group of 40 recommended chemicals and achieved an overall 87.5% accuracy in qualitatively classifying positive and negative AR agonists. The HEK293<sub>ARE/Gal4-Lux</sub> assay was demonstrated as a suitable tool for Tier 1 AR agonist screening. By eliminating exogenous substrate, this assay provided a significant advantage over traditional reporter assays by enabling higher-throughput screening with reduced testing costs while maintaining detection accuracy.

Also flagged:HuntingtinADHuntington's diseaseHDbenzopyrimidine
Journal Article 2021-08-05 No Snippets Liu L, Johnson PD, Prime ME, Khetarpal V, Lee MR, Brown CJ, Chen X, Clark-Frew D, Coe S, Conlon M, Davis R, Ensor S, Esposito S, Moren AF, Gai X, Green S, Greenaway C, Haber J, Halldin C, Hayes S, Herbst T, Herrmann F, Heßmann M, Hsai MM, Kotey A, Mangette JE, Mills MR, Monteagudo E, Nag S, Nibbio M, Orsatti L, Schaertl S, Scheich C, Sproston J, Stepanov V, Varnäs K, Varrone A, Wityak J, Mrzljak L, Munoz-Sanjuan I, Bard JA, Dominguez C.
Show Full Abstract

The expanded polyglutamine-containing mutant huntingtin (mHTT) protein is implicated in neuronal degeneration of medium spiny neurons in Huntington's disease (HD) for which multiple therapeutic approaches are currently being evaluated to eliminate or reduce mHTT. Development of effective and orthogonal biomarkers will ensure accurate assessment of the safety and efficacy of pharmacologic interventions. We have identified and optimized a class of ligands that bind to oligomerized/aggregated mHTT, which is a hallmark in the HD postmortem brain. These ligands are potentially useful imaging biomarkers for HD therapeutic development in both preclinical and clinical settings. We describe here the optimization of the benzo[4,5]imidazo[1,2-<i>a</i>]pyrimidine series that show selective binding to mHTT aggregates over Aβ- and/or tau-aggregates associated with Alzheimer's disease pathology. Compound [<sup>11</sup>C]-<b>2</b> was selected as a clinical candidate based on its high free fraction in the brain, specific binding in the HD mouse model, and rapid brain uptake/washout in nonhuman primate positron emission tomography imaging studies.

Also flagged:OAS1lackCancertumorsregulation of keratinocyte proliferationa type 2
Journal Article 2021-08-05 ✓ 2 Snippets Nita A, Matsumoto A, Tang R, Shiraishi C, Ichihara K, Saito D, Suyama M, Yasuda T, Tsuji G, Furue M, Katayama B, Ozawa T, Murata T, Dainichi T, Kabashima K, Hatano A, Matsumoto M, Nakayama KI.
In-Text Gene Mentions

…to the proteinSTAU1as well as…

…stabilized by the TINCR-STAU1complex.…

Show Full Abstract

Although long noncoding RNAs (lncRNAs) are transcripts that do not encode proteins by definition, some lncRNAs actually contain small open reading frames that are translated. TINCR (terminal differentiation-induced ncRNA) has been recognized as a lncRNA that contributes to keratinocyte differentiation. However, we here show that TINCR encodes a ubiquitin-like protein that is well conserved among species and whose expression was confirmed by the generation of mice harboring a FLAG epitope tag sequence in the endogenous open reading frame as well as by targeted proteomics. Forced expression of this protein promoted cell cycle progression in normal human epidermal keratinocytes, and mice lacking this protein manifested a delay in skin wound healing associated with attenuated cell cycle progression in keratinocytes. We termed this protein TINCR-encoded ubiquitin-like protein (TUBL), and our results reveal a role for TINCR in the regulation of keratinocyte proliferation and skin regeneration that is dependent on TUBL.

Also flagged:ChromosomeFRMD5ANKS4BSTAB2SOS1PPIP5K1
Journal Article 2021-08-05 ✓ 5 Snippets Yougbaré B, Soudré A, Ouédraogo D, Zoma BL, Tapsoba ASR, Sanou M, Ouédraogo-Koné S, Burger PA, Wurzinger M, Khayatzadeh N, Tamboura HH, Mwai OA, Traoré A, Sölkner J, Mészáros G.
In-Text Gene Mentions

GPR52

RABGAP1L

NEGR1

ARFGEF2

CSE1L

Show Full Abstract

In this study, single-SNP GWAS analyses were conducted to find regions affecting tolerance against trypanosomosis and morphometrics traits in purebred and crossbred Baoulé cattle of Burkina Faso. The trypanosomosis status (positive and negative) and a wide set of morphological traits were recorded for purebred Baoulé and crossbred Zebu x Baoulé cattle, and genotyped with the Illumina Bovine SNP50 BeadChip. After quality control, 36,203 SNPs and 619 animals including 343 purebred Baoulé and 279 crossbreds were used for the GWAS analyses. Several important genes were found that can influence morphological parameters. Although there were no genes identified with a reported strong connection to size traits, many of them were previously identified in various growth-related studies. A re-occurring theme for the genes residing in the regions identified by the most significant SNPs was pleiotropic effect on growth of the body and the cardiovascular system. Regarding trypanosomosis tolerance, two potentially important regions were identified in purebred Baoulé on chromosomes 16 and 24, containing the CFH, CRBN, TRNT1 and, IL5RA genes, and one additional genomic region in Baoulé, x Zebu crossbreds on chromosome 5, containing MGAT4C and NTS. Almost all of these regions and genes were previously related to the trait of interest, while the CRBN gene was to our knowledge presented in the context of trypanosomiasis tolerance for the first time.

Also flagged:PeptidesisoleucineDPP-IV1241leucineppm
Journal Article 2021-08-05 ✓ 2 Snippets Samaei SP, Martini S, Tagliazucchi D, Gianotti A, Babini E.
In-Text Gene Mentions

…as DPP-IV andDPP-IIIinhibitory activities.…

…and dipeptidyl peptidase-III (DPP-III) inhibitory activities, gluco…

Show Full Abstract

Proteins from hemp bran (HPB), a byproduct of the hemp seed food-processing chain, were chemically extracted, hydrolyzed by Alcalase, and separated by membrane ultrafiltration into four fractions (MW <1, 1-3, 3-5, and >5 kDa). The antioxidant and antihypertensive properties of the initial extract and the fractions were evaluated by <i>in vitro</i> assays for their ability to scavenge radical species, bind with metal ions, reduce ferric ions, and inhibit angiotensin-converting enzyme (ACE) activity. Bioactive peptides were identified by high-resolution mass spectrometry and sequence comparison with BIOPEP and BioPep DB databases. The hydrolysate was strongly antioxidant and ACE-inhibiting; the most bioactive peptides were further concentrated by ultrafiltration. Of the 239 peptides identified, 47 (12 antioxidant and 35 ACE-inhibitory) exhibited structural features correlated with the specific bioactivity. These results highlight the promise of hydrolysate and size-based HPB fractions as natural functional ingredients for the food or pharmaceutical industry.

Also flagged:Erythromelalgiachannelopathysodium channelbehaviouralcircadian rhythmerythema
Journal Article 2021-08-05 ✓ 1 Snippet Lam CM, Zayed H, Sayed D.
In-Text Gene Mentions

type 1 erythromelalgia

Show Full Abstract

Erythromelalgia is a rare hereditary channelopathy affecting the Nav1.7 sodium channel. Patients afflicted with this condition suffer from pain in their hands and feet, with vasomotor changes including flushing and redness to the distal upper and lower extremities. Current treatment modalities for this condition include pharmacological therapies (neuropathic medications), behavioural interventions, lumbar epidural infusions with local anaesthetics and sympathetic nerve blocks. Despite these treatments, many patients may have refractory pain. In these situations, there may be a role for dorsal column spinal cord stimulation for management of their pain. Here, we present the case of a 21-year-old man with 9-year history of refractory erythromelalgia successfully treated with paresthesia-free dorsal column spinal cord stimulation.

Also flagged:autismschizophreniatopE.1autism spectrum disorderneurodevelopmental disorder
Journal Article 2021-08-05 ✓ 1 Snippet Golovina E, Fadason T, Lints TJ, Walker C, Vickers MH, O'Sullivan JM.
In-Text Gene Mentions

…butyrophilin alleles (i.e.BTN2A2and BTN3A1 in…

Show Full Abstract

Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by significant and complex genetic etiology. GWAS studies have identified genetic variants associated with ASD, but the functional impacts of these variants remain unknown. Here, we integrated four distinct levels of biological information (GWAS, eQTL, spatial genome organization and protein-protein interactions) to identify potential regulatory impacts of ASD-associated SNPs (p < 5 × 10<sup>-8</sup>) on biological pathways within fetal and adult cortical tissues. We found 80 and 58 SNPs that mark regulatory regions (i.e. expression quantitative trait loci or eQTLs) in the fetal and adult cortex, respectively. These eQTLs were also linked to other psychiatric disorders (e.g. schizophrenia, ADHD, bipolar disorder). Functional annotation of ASD-associated eQTLs revealed that they are involved in diverse regulatory processes. In particular, we found significant enrichment of eQTLs within regions repressed by Polycomb proteins in the fetal cortex compared to the adult cortex. Furthermore, we constructed fetal and adult cortex-specific protein-protein interaction networks and identified that ASD-associated regulatory SNPs impact on immune pathways, fatty acid metabolism, ribosome biogenesis, aminoacyl-tRNA biosynthesis and spliceosome in the fetal cortex. By contrast, in the adult cortex they largely affect immune pathways. Overall, our findings highlight potential regulatory mechanisms and pathways important for the etiology of ASD in early brain development and adulthood. This approach, in combination with clinical studies on ASD, will contribute to individualized mechanistic understanding of ASD development.

Also flagged:M2BPhyaluronic acidhypertensionFIB4agglutininAutoimmune hepatitis
Journal Article 2021-08-05 ✓ 1 Snippet Arai T, Atsukawa M, Tsubota A, Kato K, Abe H, Ono H, Kawano T, Yoshida Y, Tanabe T, Okubo T, Hayama K, Nakagawa-Iwashita A, Itokawa N, Kondo C, Kaneko K, Emoto N, Nagao M, Inagaki K, Fukuda I, Sugihara H, Iwakiri K.
In-Text Gene Mentions

…Wilson disease, orhemochromatosis; and (3) secondary…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is related to subclinical atherosclerosis. However, whether the severity of the disease (or which histopathological component) is associated with subclinical atherosclerosis remains controversial. This study aimed to investigate the association between the histopathological severity of NAFLD and carotid intima-media thickness (CIMT) in Japanese patients with liver biopsy-proven NAFLD. Maximum-CIMT (max-CIMT) was measured as an index of carotid atherosclerosis in 195 biopsy-proven NAFLD patients. A significant association was observed between the severity of fibrosis (but not steatosis, inflammation, and ballooning) and max-CIMT. Older age, male gender, hypertension, and advanced fibrosis were independently linked to max-CIMT ≥ 1.2 mm. The prevalence of max-CIMT ≥ 1.2 mm was significantly higher in the advanced fibrosis group than in the non-advanced fibrosis group (75.4% versus 44.0%; p < 0.01). Non-invasive liver fibrosis markers and scoring systems, including fibrosis-4 index, NAFLD fibrosis score, hyaluronic acid, and Wisteria floribunda agglutinin positive Mac-2-binding protein, demonstrated that the diagnostic performance for max-CIMT ≥ 1.2 mm was similar to that of biopsy-based fibrosis staging. In conclusion, advanced fibrosis is significantly and independently associated with high-risk CIMT. Non-invasive fibrosis markers and scoring systems could help estimate the risk of atherosclerosis progression in patients with NAFLD.

Also flagged:ADatopic dermatitisCRTH2GATA3IL13RORC
Journal Article 2021-08-05 ✓ 1 Snippet Alkon N, Bauer WM, Krausgruber T, Goh I, Griss J, Nguyen V, Reininger B, Bangert C, Staud C, Brunner PM, Bock C, Haniffa M, Stingl G.
In-Text Gene Mentions

…, IL2, andTNFSF4, whereas those…

Show Full Abstract

<h4>Background</h4>Although ample knowledge exists about phenotype and function of cutaneous T lymphocytes, much less is known about the lymphocytic components of the skin's innate immune system.<h4>Objective</h4>To better understand the biologic role of cutaneous innate lymphoid cells (ILCs), we investigated their phenotypic and molecular features under physiologic (normal human skin [NHS]) and pathologic (lesional skin of patients with atopic dermatitis [AD]) conditions.<h4>Methods</h4>Skin punch biopsies and reduction sheets as well as blood specimens were obtained from either patients with AD or healthy individuals. Cell and/or tissue samples were analyzed by flow cytometry, immunohistochemistry, and single-cell RNA sequencing or subjected to in vitro/ex vivo culture.<h4>Results</h4>Notwithstanding substantial quantitative differences between NHS and AD skin, we found that the vast majority of cutaneous ILCs belong to the CRTH2<sup>+</sup> subset and reside in the upper skin layers. Single-cell RNA sequencing of cutaneous ILC-enriched cell samples confirmed the predominance of biologically heterogeneous group 2 ILCs and, for the first time, demonstrated considerable ILC lineage infidelity (coexpression of genes typical of either type 2 [GATA3 and IL13] or type 3/17 [RORC, IL22, and IL26] immunity within individual cells) in lesional AD skin, and to a much lesser extent, in NHS. Similar events were demonstrated in ILCs from skin explant cultures and in vitro expanded ILCs from the peripheral blood.<h4>Conclusion</h4>These findings support the concept that instead of being a stable entity with well-defined components, the skin immune system consists of a network of highly flexible cellular players that are capable of adjusting their function to the needs and challenges of the environment.

Also flagged:OstholecoumarinsynthesisCoumarinsfuranocoumarinsdihydrofuranocoumarins
Journal Article 2021-08-05 No Snippets Sun M, Sun M, Zhang J.
Show Full Abstract

Osthole, also known as osthol, is a coumarin derivative found in several medicinal plants such as <i>Cnidium monnieri</i> and <i>Angelica pubescens</i>. It can be obtained <i>via</i> extraction and separation from plants or total synthesis. Plenty of experiments have suggested that osthole exhibited multiple biological activities covering antitumor, anti-inflammatory, neuroprotective, osteogenic, cardiovascular protective, antimicrobial, and antiparasitic activities. In addition, there has been some research done on the optimization and modification of osthole. This article summarizes the comprehensive information regarding the sources and modification progress of osthole. It also introduces the up-to-date biological activities of osthole, which could be of great value for its use in future research.

Also flagged:Major Depressive DisordersBipolar Disorderageingtransporterscancertumor
Journal Article 2021-08-05 No Snippets Borro M, Gentile G, Preissner SH, Pomes LM, Gohlke BO, Del Casale A, Eckert A, Marchetti P, Preissner S, Preissner R, Simmaco M.
Show Full Abstract

<h4>Purpose</h4>Inefficacy and safety concerns are main medications' problems, especially in the case of poly-therapies, when drug-drug interactions may alter the expected drug disposition. Ongoing efforts are aimed to establish drug selection processes aimed to preemptive evaluation of a plethora of factors affecting patient's specific drug response, including pharmacogenomic markers, in order to minimize prescription of improper medications. In previous years, we established at the University Hospital Sant'Andrea of Rome, Italy, a Precision Medicine Service based on a multi-disciplinary experts' team. The team is in charge to produce a drug therapy counselling report, including pharmacogenomic, pharmacokinetic and pharmacodynamic considerations. In this study, we aimed to evaluate the performance of this established "manual" process of therapy selection with a novel bioinformatic tool, the Drug-PIN system.<h4>Patients and methods</h4>A total of 200 patients diagnosed with Major Depressive Disorders or a depressive episode in Bipolar Disorder, with at least three previous failed treatments, who underwent pharmacogenomic profiling and therapy counselling in the Sant'Andrea Hospital from 2017 to 2020. The baseline poly-therapy of these patients was re-evaluated and optimized by Drug-PIN. Results of the Drug-PIN poly-therapy evaluation/optimization were compared with the results of the original poly-therapy evaluation/optimization by therapy counselling. To compare the results between the two processes, the risk associated with each poly-therapy was classified as low, moderate, or high.<h4>Results</h4>The number of baseline poly-therapies classified in low-, moderate- or high-risk did not change significantly between manual system or Drug-PIN system. As the counselling process, also the Drug-PIN system produces a significant decrease in the predicted treatment-associated risk.<h4>Conclusion</h4>Drug-PIN substantially replicates the output of the counselling process, allowing a substantial reduction in the time needed for therapy evaluation. Availability of an effective bioinformatic tool for proper drug selection is expected to exponentially increase the actuation of targeted therapy strategies.

Also flagged:FAM134BER-phagyintervertebral disc degenerationnucleusNP-
Journal Article 2021-08-05 ✓ 3 Snippets Luo R, Li S, Li G, Lu S, Zhang W, Liu H, Lei J, Ma L, Ke W, Liao Z, Wang B, Song Y, Wang K, Zhang Y, Yang C.
In-Text Gene Mentions

…SEC62 (SEC62 homolog),CCPG1(cell-cycle progression gene…

…FAM134B, RTN3L, SEC62,CCPG1, ATL3, and TEX264,…

CCPG1:…

Show Full Abstract

Previous studies have established the pathogenic role of advanced glycation end products (AGEs) accumulation in intervertebral disc degeneration (IDD). Emerging evidence indicates that ER-phagy serves as a crucial cellular adaptive mechanism during stress conditions. This study is aimed at investigating the role of FAM134B-mediated ER-phagy in human nucleus pulposus (NP) cells upon AGEs treatment and exploring its regulatory mechanisms. We observed that AGEs treatment resulted in significantly increased apoptosis, senescence, and ROS accumulation in human NP cells; meanwhile, the enhanced apoptosis and senescence by AGEs treatment could be partially alleviated with the classic ROS scavenger NAC administration. Furthermore, we confirmed that FAM134B-mediated ER-phagy was activated under AGEs stimulation via ROS pathway. Importantly, it was also found that FAM134B overexpression could efficiently relieve intracellular ROS accumulation, apoptosis, and senescence upon AGEs treatment; conversely, FAM134B knockdown markedly resulted in opposite effects. In conclusion, our data demonstrate that FAM134B-mediated ER-phagy plays a vital role in AGEs-induced apoptosis and senescence through modulating cellular ROS accumulation, and targeting FAM134B-mediated ER-phagy could be a promising therapeutic strategy for IDD treatment.

Also flagged:Cell CycleOvarian CancerCADM1OCluciferasecell proliferation
Journal Article 2021-08-05 ✓ 1 Snippet Li C, Wang Y, Wang H, Wang B, Wang Y, Li N, Qin Y, Wang Y.
In-Text Gene Mentions

…the target geneOLFM4, thereby slowing the…

Show Full Abstract

<h4>Objective</h4>To explore the role and possible underlying mechanism of miR-486 in ovarian cancer (OC) cells.<h4>Methods</h4>The expression of miR-486 and CADM1 was detected by qRT-PCR in OC tissues and adjacent nontumor tissues and OC cell lines. The dual-luciferase reporter gene system was used to determine the targeting relationship between miR-486 and CADM1. CCK-8, colony formation assay, Transwell, and flow cytometry were performed to detect cell proliferation, cell invasion, cell cycle progression, and the apoptotic cell death, respectively. Western blot was carried out to detect the expression of CADM1 protein and the proteins associated with cell cycle progression.<h4>Results</h4>miR-486 was significantly upregulated in OC tissues and cells, while CADM1 expression was significantly downregulated. Dual-luciferase reporter assays further confirmed that CADM1 was a target gene of miR-486. Interference with miR-486 could inhibit the proliferation and invasion and promoted the apoptosis of SKOV3 cells. Knocking down both miR-486 and CADM1 significantly increased the SKOV3 cell proliferation, invasion, and the number of cells transitioning from the G0/G1 phase into the S phase of cell cycle and reduced the cellular apoptosis. Western blot analysis revealed that the expression of cell cycle progression-related proteins (CyclinD1, CyclinE, and CDK6) was significantly reduced, and the p21 expression was increased when interfering with both miR-486 and CADM1 expression.<h4>Conclusion</h4>Our results suggested that miR-486 could act as a tumor promoter by targeting CADM1 and be a potential therapeutic target for the treatment of OC.

Also flagged:GPCRwaternitrogenbindingDNasecell walls
Journal Article 2021-08-05 No Snippets Fu W, Dohai B, El Assal DC, Daakour S, Alzahmi A, Nelson DR, Jaiswal A, Mystikou A, Sultana M, Weston J, Salehi-Ashtiani K.
Show Full Abstract

Diatoms are a major group of microalgae that initiate biofouling by surface colonization of human-made underwater structures; however, the involved regulatory pathways remain uncharacterized. Here, we describe a protocol for identifying and validating regulatory genes involved in the morphology shift of the model diatom species <i>Phaeodactylum tricornutum</i> during surface colonization. We also provide a workflow for characterizing biofouling transformants. By using this protocol, gene targets such as <i>GPCR</i> signaling genes could be identified and manipulated to turn off diatom biofouling. For complete information on the generation and use of this protocol, please refer to Fu et al. (2020).

Also flagged:Oxide DeficiencyMitochondrial DisordersMitochondrial diseasesmitochondriaoxide (NO) deficiencyarginine
Journal Article 2021-08-05 No Snippets Almannai M, El-Hattab AW.
Show Full Abstract

Mitochondrial diseases represent a growing list of clinically heterogeneous disorders that are associated with dysfunctional mitochondria and multisystemic manifestations. In spite of a better understanding of the underlying pathophysiological basis of mitochondrial disorders, treatment options remain limited. Over the past two decades, there is growing evidence that patients with mitochondrial disorders have nitric oxide (NO) deficiency due to the limited availability of NO substrates, arginine and citrulline; decreased activity of nitric oxide synthase (NOS); and NO sequestration. Studies evaluating the use of arginine in patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) presenting with stroke-like episodes showed symptomatic improvement after acute administration as well as a reduction in the frequency and severity of stroke-like episodes following chronic use. Citrulline, another NO precursor, was shown through stable isotope studies to result in a greater increase in NO synthesis. Recent studies showed a positive response of arginine and citrulline in other mitochondrial disorders besides MELAS. Randomized-controlled studies with a larger number of patients are warranted to better understand the role of NO deficiency in mitochondrial disorders and the efficacy of NO precursors as treatment modalities in these disorders.

Also flagged:transcription factorAutism Spectrum DisordersFoxp2matingaggressionbehavioral
Journal Article 2021-08-05 No Snippets Herrero MJ, Wang L, Hernandez-Pineda D, Banerjee P, Matos HY, Goodrich M, Panigrahi A, Smith NA, Corbin JG.
Show Full Abstract

In humans, mutations in the transcription factor encoding gene, <i>FOXP2</i>, are associated with language and Autism Spectrum Disorders (ASD), the latter characterized by deficits in social interactions. However, little is known regarding the function of <i>Foxp2</i> in male or female social behavior. Our previous studies in mice revealed high expression of Foxp2 within the medial subnucleus of the amygdala (MeA), a limbic brain region highly implicated in innate social behaviors such as mating, aggression, and parental care. Here, using a comprehensive panel of behavioral tests in male and female <i>Foxp2</i> <sup>+/-</sup> heterozygous mice, we investigated the role <i>Foxp2</i> plays in MeA-linked innate social behaviors. We reveal significant deficits in olfactory processing, social interaction, mating, aggressive, and parental behaviors. Interestingly, some of these deficits are displayed in a sex-specific manner. To examine the consequences of <i>Foxp2</i> loss of function specifically in the MeA, we conducted a proteomic analysis of microdissected MeA tissue. This analyses revealed putative sex differences expression of a host of proteins implicated in neuronal communication, connectivity, and dopamine signaling. Consistent with this, we discovered that MeA <i>Foxp2</i>-lineage cells were responsive to dopamine with differences between males and females. Thus, our findings reveal a central and sex-specific role for <i>Foxp2</i> in social behavior and MeA function.

Also flagged:SEinfectionsecretionmetabolismtype III secretionsystemic infection
Journal Article 2021-08-05 No Snippets Zhang Y, Song L, Hou L, Cao Z, Vongsangnak W, Zhu G, Xu Q, Chen G.
Show Full Abstract

<i>Salmonella</i> enteritidis (SE) is a pathogen that can readily infect ovarian tissues and colonize the granulosa cell layer such that it can be transmitted via eggs from infected poultry to humans in whom it can cause food poisoning. Ducks are an important egg-laying species that are susceptible to SE infection, yet the host-pathogen interactions between SE and ducks have not been thoroughly studied to date. Herein, we performed dual RNA-sequencing analyses of these two organisms in a time-resolved infection model of duck granulosa cells (dGCs) by SE. In total, 10,510 genes were significantly differentially expressed in host dGCs, and 265 genes were differentially expressed in SE over the course of infection. These differentially expressed genes (DEGs) of dGCs were enriched in the cytokine-cytokine receptor interaction pathway via KEGG analyses, and the DEGs in SE were enriched in the two-component system, bacterial secretion system, and metabolism of pathogen factors pathways as determined. A subsequent weighted gene co-expression network analysis revealed that the cytokine-cytokine receptor interaction pathway is mostly enriched at 6 h post-infection (hpi). Moreover, a number of pathogenic factors identified in the pathogen-host interaction database (PHI-base) are upregulated in SE, including genes encoding the pathogenicity island/component, type III secretion, and regulators of systemic infection. Furthermore, an intracellular network associated with the regulation of SE infection in ducks was constructed, and 16 cytokine response-related dGCs DEGs (including <i>IL15</i>, <i>CD40</i>, and <i>CCR7</i>) and 17 pathogenesis-related factors (including <i>sseL</i>, <i>ompR</i>, and <i>fliC</i>) were identified, respectively. Overall, these results not only offer new insights into the mechanisms underlying host-pathogen interactions between SE and ducks, but they may also aid in the selection of potential targets for antimicrobial drug development.

Also flagged:neurodegenerative diseasesADproteinopathyextracellulartauAutophagy
Journal Article 2021-08-05 ✓ 2 Snippets Dow CT.
In-Text Gene Mentions

For AD, the proteins are amyloid and tau; for PD, synuclein; for HD, Htt; and for ALS, TDP-43 (1).

…synuclein; for HD,Htt; and for ALS,…

Show Full Abstract

This article prosecutes a case against the zoonotic pathogen <i>Mycobacterium avium</i> ss. <i>paratuberculosis</i> (MAP) as a precipitant of Alzheimer's disease (AD). Like the other major neurodegenerative diseases AD is, at its core, a proteinopathy. Aggregated extracellular amyloid protein plaques and intracellular tau protein tangles are the recognized protein pathologies of AD. Autophagy is the cellular housekeeping process that manages protein quality control and recycling, cellular metabolism, and pathogen elimination. Impaired autophagy and cerebral insulin resistance are invariant features of AD. With a backdrop of age-related low-grade inflammation (inflammaging) and heightened immune risk (immunosenescence), infection with MAP subverts glucose metabolism and further exhausts an already exhausted autophagic capacity. Increasingly, a variety of agents have been found to favorably impact AD; they are agents that promote autophagy and reduce insulin resistance. The potpourri of these therapeutic agents: mTOR inhibitors, SIRT1 activators and vaccines are seemingly random until one recognizes that all these agents also suppress intracellular mycobacterial infection. The zoonotic mycobacterial MAP causes a common fatal enteritis in ruminant animals. Humans are exposed to MAP from contaminated food products and from the environment. The enteritis in animals is called paratuberculosis or Johne's disease; in humans, it is the putative cause of Crohn's disease. Beyond Crohn's, MAP is associated with an increasing number of inflammatory and autoimmune diseases: sarcoidosis, Blau syndrome, autoimmune diabetes, autoimmune thyroiditis, multiple sclerosis, and rheumatoid arthritis. Moreover, MAP has been associated with Parkinson's disease. India is one county that has extensively studied the human bio-load of MAP; 30% of more than 28,000 tested individuals were found to harbor, or to have harbored, MAP. This article asserts an unfolding realization that MAP infection of humans 1) is widespread in its presence, 2) is wide-ranging in its zoonosis and 3) provides a plausible link connecting MAP to AD.

Also flagged:Hirschsprung DiseaseHSCRintestinal obstructioncongenital diseaseRETEDNRB
Journal Article 2021-08-05 No Snippets Karim A, Tang CS, Tam PK.
Show Full Abstract

Hirschsprung disease (HSCR) is the leading cause of neonatal functional intestinal obstruction. It is a rare congenital disease with an incidence of one in 3,500-5,000 live births. HSCR is characterized by the absence of enteric ganglia in the distal colon, plausibly due to genetic defects perturbing the normal migration, proliferation, differentiation, and/or survival of the enteric neural crest cells as well as impaired interaction with the enteric progenitor cell niche. Early linkage analyses in Mendelian and syndromic forms of HSCR uncovered variants with large effects in major HSCR genes including <i>RET, EDNRB</i>, and their interacting partners in the same biological pathways. With the advances in genome-wide genotyping and next-generation sequencing technologies, there has been a remarkable progress in understanding of the genetic basis of HSCR in the past few years, with common and rare variants with small to moderate effects being uncovered. The discovery of new HSCR genes such as neuregulin and <i>BACE2</i> as well as the deeper understanding of the roles and mechanisms of known HSCR genes provided solid evidence that many HSCR cases are in the form of complex polygenic/oligogenic disorder where rare variants act in the sensitized background of HSCR-associated common variants. This review summarizes the roadmap of genetic discoveries of HSCR from the earlier family-based linkage analyses to the recent population-based genome-wide analyses coupled with functional genomics, and how these discoveries facilitated our understanding of the genetic architecture of this complex disease and provide the foundation of clinical translation for precision and stratified medicine.

Also flagged:IronFerritinSodium IodateAge Related Macular DegenerationlocalizationSynthesis
Journal Article 2021-08-05 ✓ 1 Snippet Ashok A, Chaudhary S, Wise AS, Rana NA, McDonald D, Kritikos AE, Lindner E, Singh N.
In-Text Gene Mentions

…Inhemochromatosisand aceruloplasminemia, heredi…

Show Full Abstract

To evaluate the role of iron in sodium iodate (NaIO<sub>3</sub>)-induced model of age-related macular degeneration (AMD) in ARPE-19 cells in-vitro and in mouse models in-vivo. ARPE-19 cells, a human retinal pigment epithelial cell line, was exposed to 10 mM NaIO<sub>3</sub> for 24 h, and the expression and localization of major iron modulating proteins was evaluated by Western blotting (WB) and immunostaining. Synthesis and maturation of cathepsin-D (cat-D), a lysosomal enzyme, was evaluated by quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) and WB, respectively. For in-vivo studies, C57BL/6 mice were injected with 40 mg/kg mouse body weight of NaIO<sub>3</sub> intraperitoneally, and their retina was evaluated after 3 weeks as above. NaIO<sub>3</sub> induced a 10-fold increase in ferritin in ARPE-19 cells, which co-localized with LC3II, an autophagosomal marker, and LAMP-1, a lysosomal marker. A similar increase in ferritin was noted in retinal lysates and retinal sections of NaIO<sub>3</sub>-injected mice by WB and immunostaining. Impaired synthesis and maturation of cat-D was also noted. Accumulated ferritin was loaded with iron, and released from retinal pigmented epithelial (RPE) cells in Perls' and LAMP-1 positive vesicles. NaIO<sub>3</sub> impairs lysosomal degradation of ferritin by decreasing the transcription and maturation of cat-D in RPE cells. Iron-loaded ferritin accumulates in lysosomes and is released in lysosomal membrane-enclosed vesicles to the extracellular milieu. Accumulation of ferritin in RPE cells and fusion of ferritin-containing vesicles with adjacent photoreceptor cells is likely to create an iron overload, compromising their viability. Moreover, reduced activity of cat-D is likely to promote accumulation of other cellular debris in lysosomal vesicles, contributing to AMD-like pathology.

Also flagged:Autophagy Receptorsp62NBR1TOLLIPTax1-binding protein 1TAX1BP1
Journal Article 2021-08-05 No Snippets Chen W, Shen T, Wang L, Lu K.
Show Full Abstract

The selective targeting and disposal of solid protein aggregates are essential for cells to maintain protein homoeostasis. Autophagy receptors including p62, NBR1, Cue5/TOLLIP (CUET), and Tax1-binding protein 1 (TAX1BP1) proteins function in selective autophagy by targeting ubiquitinated aggregates through ubiquitin-binding domains. Here, we summarize previous beliefs and recent findings on selective receptors in aggregate autophagy. Since there are many reviews on selective autophagy receptors, we focus on their oligomerization, which enables receptors to function as pathway determinants and promotes phase separation.

Also flagged:mitochondrialmyopathylactic acidosissideroblastic anemiaMLASAmitochondrial myopathy
Journal Article 2021-08-05 ✓ 1 Snippet Carreño-Gago L, Juárez-Flores DL, Grau JM, Ramón J, Lozano E, Vila-Julià F, Martí R, Garrabou G, Garcia-Arumí E.
In-Text Gene Mentions

…, DNA2 ,FBXL4, MGME1 ,…

Show Full Abstract

Pathogenic variants in the mitochondrial tyrosyl-tRNA synthetase gene (<i>YARS2</i>) were associated with myopathy, lactic acidosis, and sideroblastic anemia (MLASA). However, patients can present mitochondrial myopathy, with exercise intolerance and muscle weakness, leading from mild to lethal phenotypes. Genes implicated in mtDNA replication were studied by Next Generation Sequencing (NGS) and whole exome sequence with the TruSeq Rapid Exome kit (Illumina, San Diego, CA, USA). Mitochondrial protein translation was studied following the Sasarman and Shoubridge protocol and oxygen consumption rates with Agilent Seahorse XF24 Analyzer Mitostress Test, (Agilent, Santa Clara, CA, USA). We report two siblings with two novel compound heterozygous pathogenic variants in <i>YARS2</i> gene: a single nucleotide deletion in exon 1, c.314delG (p.(Gly105Alafs*4)), which creates a premature stop codon in the amino acid 109, and a single nucleotide change in exon 5 c.1391T>C (p.(Ile464Thr)), that cause a missense variant in amino acid 464. We demonstrate the pathogenicity of these new variants associated with reduced <i>YARS2</i> mRNA transcript, reduced mitochondrial protein translation and dysfunctional organelle function. These pathogenic variants are responsible for late onset MLASA, herein accompanied by pancreatic insufficiency, observed in both brothers, clinically considered as Pearson's syndrome. Molecular study of <i>YARS2</i> gene should be considered in patients presenting Pearson's syndrome characteristics and MLASA related phenotypes.

Also flagged:Albuminfatty acidsoxygencell growthendoplasmic reticulumGolgi bodies
Journal Article 2021-08-05 ✓ 1 Snippet Mishra V, Heath RJ.
In-Text Gene Mentions

…alpha-1-acid glycoprotein 1,antithrombin-III, fibrinogen alpha chain,…

Show Full Abstract

Serum albumin physically interacts with fatty acids, small molecules, metal ions, and several other proteins. Binding with a plethora of bioactive substances makes it a critical transport molecule. Albumin also scavenges the reactive oxygen species that are harmful to cell survival. These properties make albumin an excellent choice to promote cell growth and maintain a variety of eukaryotic cells under in vitro culture environment. Furthermore, purified recombinant human serum albumin is mostly free from impurities and modifications, providing a perfect choice as an additive in cell and tissue culture media while avoiding any regulatory constraints. This review discusses key features of human serum albumin implicated in cell growth and survival under in vitro conditions.

Also flagged:Huntingtinautosomal-dominant brain disorderpolyglutamineinsulinHDautophagy
Journal Article 2021-08-05 ✓ 5 Snippets Chang CC, Tsou SH, Chen WJ, Ho YJ, Hung HC, Liu GY, Singh SK, Li HH, Lin CL.
In-Text Gene Mentions

Since the cause of HD is the mutation of Htt gene, it is difficult to develop effective strategies for complete success in therapy for HD.

According to molecular pathology, the cause of HD is due to the mutation of a protein called huntingtin (Htt), which contains a sequence with an expansion of CAG repeats.

In most cases, symptoms appear after early adulthood, implying that the mutation of Htt is only one of the factors that induce HD symptoms, and there are other factors that may also contribute to the pathogenesis.

To establish a cellular model for HD and evaluate the neurotoxic effects of poly-Q mutant huntingtin (mHtt), the human SK-N-MC neuronal cells were transfected with vectors encoding normal Htt (Htt-Q23) or mHtt (Htt-Q74) as previously described [8].

…protein called huntingtin (Htt), which contains a…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant brain disorder caused by mutant huntingtin (mHtt). Although the detailed mechanisms remain unclear, the mutational expansion of polyglutamine in mHtt is proposed to induce protein aggregates and neuronal toxicity. Previous studies have shown that the decreased insulin sensitivity is closely related to mHtt-associated impairments in HD patients. However, how mHtt interferes with insulin signaling in neurons is still unknown. In the present study, we used a HD cell model to demonstrate that the miR-302 cluster, an embryonic stem cell-specific polycistronic miRNA, is significantly downregulated in mHtt-Q74-overexpressing neuronal cells. On the contrary, restoration of miR-302 cluster was shown to attenuate mHtt-induced cytotoxicity by improving insulin sensitivity, leading to a reduction of mHtt aggregates through the enhancement of autophagy. In addition, miR-302 also promoted mitophagy and stimulated Sirt1/AMPK-PGC1α pathway thereby preserving mitochondrial function. Taken together, these results highlight the potential role of miR-302 cluster in neuronal cells, and provide a novel mechanism for mHtt-impaired insulin signaling in the pathogenesis of HD.

Also flagged:ASCL1NKX2-1PROX1small-cell lung cancerSCLCLTF
Journal Article 2021-08-05 ✓ 2 Snippets Pozo K, Kollipara RK, Kelenis DP, Rodarte KE, Ullrich MS, Zhang X, Minna JD, Johnson JE.
In-Text Gene Mentions

Here, MLLT10 and SRSF2 were identified across all three subtypes, MYC specifically in SCLC-N, and MDM4, IDH2, and HOXC11 specifically in SCLC-P.

…Here,MLLT10and SRSF2 were…

Show Full Abstract

Lineage-defining transcription factors (LTFs) play key roles in small-cell lung cancer (SCLC) pathophysiology. Delineating the LTF-regulated genes operative in SCLC could provide a road map to identify SCLC dependencies. We integrated chromatin landscape and transcriptome analyses of patient-derived SCLC preclinical models to identify super-enhancers (SEs) and their associated genes in the ASCL1-, NEUROD1-, and POU2F3-high SCLC subtypes. We find SE signatures predict LTF-based classification of SCLC, and the SE-associated genes are enriched with those defined as common essential genes in DepMap. In addition, in ASCL1-high SCLC, we show ASCL1 complexes with NKX2-1 and PROX1 to co-regulate genes functioning in NOTCH signaling, catecholamine biosynthesis, and cell-cycle processes. Depletion of ASCL1 demonstrates it is a key dependency factor in preclinical SCLC models and directly regulates multiple DepMap-defined essential genes. We provide LTF/SE-based subtype-specific gene sets for SCLC for further therapeutic investigation.

Also flagged:15-lipoxygenase-2h15-LOX-2ALOX15Batherosclerosiscystic fibrosisferroptosis
Journal Article 2021-08-05 ✓ 1 Snippet Tsai WC, Gilbert NC, Ohler A, Armstrong M, Perry S, Kalyanaraman C, Yasgar A, Rai G, Simeonov A, Jadhav A, Standley M, Lee HW, Crews P, Iavarone AT, Jacobson MP, Neau DB, Offenbacher AR, Newcomer M, Holman TR.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Human epithelial 15-lipoxygenase-2 (h15-LOX-2, ALOX15B) is expressed in many tissues and has been implicated in atherosclerosis, cystic fibrosis and ferroptosis. However, there are few reported potent/selective inhibitors that are active ex vivo. In the current work, we report newly discovered molecules that are more potent and structurally distinct from our previous inhibitors, MLS000545091 and MLS000536924 (Jameson et al, PLoS One, 2014, 9, e104094), in that they contain a central imidazole ring, which is substituted at the 1-position with a phenyl moiety and with a benzylthio moiety at the 2-position. The initial three molecules were mixed-type, non-reductive inhibitors, with IC<sub>50</sub> values of 0.34 ± 0.05 μM for MLS000327069, 0.53 ± 0.04 μM for MLS000327186 and 0.87 ± 0.06 μM for MLS000327206 and greater than 50-fold selectivity versus h5-LOX, h12-LOX, h15-LOX-1, COX-1 and COX-2. A small set of focused analogs was synthesized to demonstrate the validity of the hits. In addition, a binding model was developed for the three imidazole inhibitors based on computational docking and a co-structure of h15-LOX-2 with MLS000536924. Hydrogen/deuterium exchange (HDX) results indicate a similar binding mode between MLS000536924 and MLS000327069, however, the latter restricts protein motion of helix-α2 more, consistent with its greater potency. Given these results, we designed, docked, and synthesized novel inhibitors of the imidazole scaffold and confirmed our binding mode hypothesis. Importantly, four of the five inhibitors mentioned above are active in an h15-LOX-2/HEK293 cell assay and thus they could be important tool compounds in gaining a better understanding of h15-LOX-2's role in human biology. As such, a suite of similar pharmacophores that target h15-LOX-2 both in vitro and ex vivo are presented in the hope of developing them as therapeutic agents.

Also flagged:COVID-19-19silvergoldcoronavirus diseaseinfection
Journal Article 2021-08-05 ✓ 1 Snippet Belhassine O, Karamti C.
In-Text Gene Mentions

DCC-GARCH model…

Show Full Abstract

This paper aims to investigate the COVID-19 pandemic impacts on the interconnectedness between the Chinese stock market and major financial and commodity markets-gold, silver, Bitcoin, WTI, S&P 500, and Euro STOXX 50-and analyze the portfolio design implications. Using daily data from 2018 to 2021, we first apply the wavelet power spectrum (WPS) to visualize volatility shifts. In contrast to previous research, we empirically identify the precise COVID-19 outbreak dates for each market using the Perron (1997) breakpoint test. Finally, we employ the bivariate DCC-GARCH model to analyze the connectedness between markets. The findings reveal that the COVID-19 pandemic caused volatility shifts of different intensities for all of the studied markets. Moreover, each return series exhibits one break date, which is specific to each market and corresponds to a distinct COVID-19-related event. Correlations, hedge ratios, and optimal portfolio weights changed significantly after the COVID-19 outbreak. There is evidence of contagion effects between the Chinese stock market and S&P 500, Euro STOXX 50, gold, and silver. Interestingly, the latter two assets lost their safe haven property with SSE. However, WTI and Bitcoin act as safe havens against SSE risks.

Also flagged:Phenalenylsbindingpolycyclic aromatic hydrocarbonsphenalenylcationelectrons
Journal Article 2021-08-05 No Snippets Cui ZH, Wang MH, Lischka H, Kertesz M.
Show Full Abstract

Phenalenyls (PLYs) are important synthons in many functional and electronic materials, which often display favorable molecule-to-molecule overlap for electron or hole transport. They also serve as a prototype for π-stacking pancake bonding based on two-electron multicenter bonding (2e/mc). Unexpected near-doubling of the binding energy is obtained for the positively charged PLY<sub>2</sub> <sup>+</sup> dimer with an effect similar to that seen for the positively charged olympicenyl (OPY) radical dimer. This charge effect is reversed for the perfluorinated (PF) dimers, and the negatively charged perfluorinated (PF) dimers PF-PLY<sub>2</sub> <sup>-</sup> and PF-OPY<sub>2</sub> <sup>-</sup> become strongly bound. Long-range interactions reflect these differences. Also surprising is that in this case the pancake bonding corresponds to single-electron (1e/mc) or a three-electron (3e/mc) multicenter bonding in contrast to the 2e/mc bonding that occurs for the neutral radical dimers. The strong preference for a large intermolecular overlap is maintained in these charged dimers. Importantly, the preference for π-bonding in the charged dimers compared to σ-bonding is strongly enhanced relative to the neutral PLY dimers.

Also flagged:COVID-19-19metalsARCHinfection
Journal Article 2021-08-05 No Snippets Chemkha R, BenSaïda A, Ghorbel A, Tayachi T.
Show Full Abstract

The COVID-19 pandemic has caused an unprecedented human and health crisis. The measures taken to contain the damage caused a global economic slowdown. Investors face liquidity pressures resulting from the general downturn in the financial markets, and might change their risk appetite. This paper reassesses the safe haven property of gold as a traditional asset, and Bitcoin which is gradually imposing itself as a new class of asset with unique characteristics. The empirical results, applied on major world stock market indices and currencies, and based on the multivariate asymmetric dynamic conditional correlation model, show the effectiveness of Bitcoin and gold as hedging assets in reducing the risk of international portfolios. Moreover, the analysis provides evidence that during the COVID-19 pandemic, gold is a weak safe haven for the considered assets, while Bitcoin cannot provide shelter due to its increased variability.

medRxiv 2021-08-05 Preprint (No Snippets API) Son S, Lyden A, Shu J, Stephens SI, Fozouni P, Knott GJ, Smock DCJ, Liu TY, Boehm D, Simoneau C, Kumar GR, Doudna JA, Ott M, Fletcher DA.
Show Full Abstract

<h4>SUMMARY</h4> Rapid and sensitive quantification of RNA is critical for detecting infectious diseases and identifying disease biomarkers. Recent direct detection assays based on CRISPR-Cas13a 1–4 avoid reverse transcription and DNA amplification required of gold-standard PCR assays 5 , but these assays have not yet achieved the sensitivity of PCR and are not easily multiplexed to detect multiple viruses or variants. Here we show that Cas13a acting on single target RNAs loaded into droplets exhibits stochastic nuclease activity that can be used to enable sensitive, rapid, and multiplexed virus quantification. Using SARS-CoV-2 RNA as the target and combinations of CRISPR RNA (crRNA) that recognize different parts of the viral genome, we demonstrate that reactions confined to small volumes can rapidly achieve PCR-level sensitivity. By tracking nuclease activity within individual droplets over time, we find that Cas13a exhibits rich kinetic behavior that depends on both the target RNA and crRNA. We demonstrate that these kinetic signatures can be harnessed to differentiate between different human coronavirus species as well as SARS-CoV-2 variants within a single droplet. The combination of high sensitivity, short reaction times, and multiplexing makes this droplet-based Cas13a assay with kinetic barcoding a promising strategy for direct RNA identification and quantification.

SSRN 2021-08-05 Preprint (No Snippets API) Tiwari AK, Abakah EJA, Gabauer D, Dwumfour RA.
Show Full Abstract

This study has been inspired by the emergence of socially responsible investment practices in mainstream investment activity wherein it examines the transmission of return patterns between green bonds, carbon prices, and renewable energy stocks using daily data spanning from 1st January 2013 to 22nd September 2020. In this study, our dataset comprises the price indices of S&P Green Bond, Solactive Global Solar, Solactive Global Wind, S&P Global Clean Energy and Carbon. We employ the TVP-VAR approach to investigate the return spillovers and connectedness, and various portfolio techniques including minimum variance portfolio, minimum correlation portfolio and the recently developed minimum connectedness portfolio to test portfolio performance. Additionally, a LASSO dynamic connectedness model is used for robustness purposes. The empirical results from the TVP VAR indicate that the dynamic total connectedness across the assets is heterogeneous over time and economic event dependent. Moreover, our findings suggest clean energy dominates all other markets and is seen to be the main net transmitter of shocks in the entire network with Green Bonds and Solactive Global Wind emerging to be the major recipients of shocks in the system. Based on the hedging effectiveness, we show that bivariate and multivariate portfolios significantly reduce the risk of investing in a single asset except for Green Bonds. Finally, the minimum connectedness portfolio reaches the highest Sharpe ratio implying that information concerning the return transmission process is helpful for portfolio creation. The same pattern has been observed during the COVID-19 pandemic period.

Also flagged:SynthesisAminotriazolesFactor XIIathrombinserine proteasescoagulation
Journal Article 2021-08-04 No Snippets Platte S, Korff M, Imberg L, Balicioglu I, Erbacher C, Will JM, Daniliuc CG, Karst U, Kalinin DV.
Show Full Abstract

Herein we report a microscale parallel synthetic approach allowing for rapid access to libraries of N-acylated aminotriazoles and screening of their inhibitory activity against factor XIIa (FXIIa) and thrombin, which are targets for antithrombotic drugs. This approach, in combination with post-screening structure optimization, yielded a potent 7 nM inhibitor of FXIIa and a 25 nM thrombin inhibitor; both compounds showed no inhibition of the other tested serine proteases. Selected N-acylated aminotriazoles exhibited anticoagulant properties in vitro influencing the intrinsic blood coagulation pathway, but not extrinsic coagulation. Mechanistic studies of FXIIa inhibition suggested that synthesized N-acylated aminotriazoles are covalent inhibitors of FXIIa. These synthesized compounds may serve as a promising starting point for the development of novel antithrombotic drugs.

Also flagged:BTN3A1cancersmembrane proteinextracellularimmunoglobulinimmune response
Journal Article 2021-08-04 ✓ 2 Snippets Liang F, Zhang C, Guo H, Gao SH, Yang FY, Zhou GB, Wang GZ.
In-Text Gene Mentions

…IPP, KPNA7, IL1F10,BTN3A3, KPNA6, FOXP1, MUC3A,…

…BTN3A2,BTN3A3, FOXP1, and IL1F10,…

Show Full Abstract

Butyrophilin 3A1 (BTN3A1), a major histocompatibility complex-associated gene that encodes a membrane protein with two extracellular immunoglobulin domains and an intracellular B30.2 domain, is critical in T-cell activation and adaptive immune response. Here, the expression of BTN3A1 in cancers was analyzed in eight databases comprising 86 733 patients of 33 cancers, and the findings were validated in patient samples and cell models. We showed that BTN3A1 was expressed in most cancers, and its expression level was strongly correlated with clinical outcome of 13 cancers. Mutations of BTN3A1 were detected, and the mutations were distributed throughout the entire gene. Gene set enrichment analysis showed that BTN3A1 co-expression genes and interacting proteins were enriched in immune regulation-related pathways. BTN3A1 was associated with tumor-infiltrating immune cells and was co-expressed with multiple immune checkpoints in patients with breast cancer (BRCA) and non-small cell lung cancer (NSCLC). We reported that BTN3A1 was downregulated in 46 of 65 (70.8%) NSCLCs, and its expression level was inversely associated with clinical outcome of the patients. BTN3A1 in tumor samples was lower than in counterpart normal tissues in 31 of 38 (81.6%) BRCAs. Bioinformatics analyses showed that BTN3A1 could be a target gene of transcription factor Spi-1 proto-oncogene (SPI1), and our 'wet' experiments showed that ectopic expression of SPI1 upregulated, whereas silencing of SPI1 downregulated, BTN3A1 expression in cells. These results suggest that BTN3A1 may function as a tumor suppressor and may serve as a potential prognostic biomarker in NSCLCs and BRCAs.

Also flagged:histone H1chromatinorganizationH1transcription factorsnucleus
Journal Article 2021-08-04 ✓ 1 Snippet Saha A, Dalal Y.
In-Text Gene Mentions

…H1s or thelinker histoneshistones are a…

Show Full Abstract

Histone H1s or the linker histones are a family of dynamic chromatin compacting proteins that are essential for higher-order chromatin organization. These highly positively charged proteins were previously thought to function solely as repressors of transcription. However, over the last decade, there is a growing interest in understanding this multi-protein family, finding that not all variants act as repressors. Indeed, the H1 family members appear to have distinct affinities for chromatin and may potentially affect distinct functions. This would suggest a more nuanced contribution of H1 to chromatin organization. The advent of new technologies to probe H1 dynamics <i>in vivo</i>, combined with powerful computational biology, and <i>in vitro</i> imaging tools have greatly enhanced our knowledge of the mechanisms by which H1 interacts with chromatin. This family of proteins can be metaphorically compared to the Golden Snitch from the Harry Potter series, buzzing on and off several regions of the chromatin, in combat with competing transcription factors and chromatin remodellers, thereby critical to the epigenetic endgame on short and long temporal scales in the life of the nucleus. Here, we summarize recent efforts spanning structural, computational, genomic and genetic experiments which examine the linker histone as an unseen architect of chromatin fibre in normal and diseased cells and explore unanswered fundamental questions in the field.

Also flagged:ValentinoMS4A10MS4A18memoryMS4A14MS4A15
Journal Article 2021-08-04 No Snippets Silva-Gomes R, Mapelli SN, Boutet MA, Mattiola I, Sironi M, Grizzi F, Colombo F, Supino D, Carnevale S, Pasqualini F, Stravalaci M, Porte R, Gianatti A, Pitzalis C, Locati M, Oliveira MJ, Bottazzi B, Mantovani A.
Show Full Abstract

The MS4A gene family encodes 18 tetraspanin-like proteins, most of which with unknown function. MS4A1 (CD20), MS4A2 (FcεRIβ), MS4A3 (HTm4), and MS4A4A play important roles in immunity, whereas expression and function of other members of the family are unknown. The present investigation was designed to obtain an expression fingerprint of MS4A family members, using bioinformatics analysis of public databases, RT-PCR, and protein analysis when possible. MS4A3, MS4A4A, MS4A4E, MS4A6A, MS4A7, and MS4A14 were expressed by myeloid cells. MS4A6A and MS4A14 were expressed in circulating monocytes and decreased during monocyte-to-Mϕ differentiation in parallel with an increase in MS4A4A expression. Analysis of gene expression regulation revealed a strong induction of MS4A4A, MS4A6A, MS4A7, and MS4A4E by glucocorticoid hormones. Consistently with in vitro findings, MS4A4A and MS4A7 were expressed in tissue Mϕs from COVID-19 and rheumatoid arthritis patients. Interestingly, MS4A3, selectively expressed in myeloid precursors, was found to be a marker of immature circulating neutrophils, a cellular population associated to COVID-19 severe disease. The results reported here show that members of the MS4A family are differentially expressed and regulated during myelomonocytic differentiation, and call for assessment of their functional role and value as therapeutic targets.

Also flagged:Protein SynthesisHuntington's DiseasepathogenesisHDATF4GADD34
Journal Article 2021-08-04 ✓ 1 Snippet Xu H, Bensalel J, Capobianco E, Lu ML, Wei J.
In-Text Gene Mentions

Htt

Show Full Abstract

Neurons are susceptible to different cellular stresses and this vulnerability has been implicated in the pathogenesis of Huntington's disease (HD). Accumulating evidence suggest that acute or chronic stress, depending on its duration and severity, can cause irreversible cellular damages to HD neurons, which contributes to neurodegeneration. In contrast, how normal and HD neurons respond during the resolution of a cellular stress remain less explored. In this study, we challenged normal and HD cells with a low-level acute ER stress and examined the molecular and cellular responses after stress removal. Using both striatal cell lines and primary neurons, we first showed the temporal activation of p-eIF2α-ATF4-GADD34 pathway in response to the acute ER stress and during recovery between normal and HD cells. HD cells were more vulnerable to cell death during stress recovery and were associated with increased number of apoptotic/necrotic cells and decreased cell proliferation. This is also supported by the Gene Ontology analysis from the RNA-seq data which indicated that "apoptosis-related Biological Processes" were more enriched in HD cells during stress recovery. We further showed that HD cells were defective in restoring global protein synthesis during stress recovery and promoting protein synthesis by an integrated stress response inhibitor, ISRIB, could attenuate cell death in HD cells. Together, these data suggest that normal and HD cells undergo distinct mechanisms of transcriptional reprogramming, leading to different cell fate decisions during the stress recovery.

Also flagged:MuscarineautophagyCancersilicabenzophenoneiodine
Journal Article 2021-08-04 No Snippets Gryzło B, Zaręba P, Malawska K, Mazur G, Rapacz A, Ła Tka K, Höfner GC, Latacz G, Bajda M, Sałat K, Wanner KT, Malawska B, Kulig K.
Show Full Abstract

Neuropathic pain resistance to pharmacotherapy has encouraged researchers to develop effective therapies for its treatment. γ-Aminobutyric acid (GABA) transporters 1 and 4 (mGAT1 and mGAT4) have been increasingly recognized as promising drug targets for neuropathic pain (NP) associated with imbalances in inhibitory neurotransmission. In this context, we designed and synthesized new functionalized amino acids as inhibitors of GABA uptake and assessed their activities toward all four mouse GAT subtypes (mGAT1-4). According to the obtained results, compounds 2<i>RS</i>,4<i>RS</i>-<b>39c</b> (pIC<sub>50</sub> (mGAT4) = 5.36), <b>50a</b> (pIC<sub>50</sub> (mGAT2) = 5.43), and <b>56a</b> (with moderate subtype selectivity that favored mGAT4, pIC<sub>50</sub> (mGAT4) = 5.04) were of particular interest and were therefore evaluated for their cytotoxic and hepatotoxic effects. In a set of <i>in vivo</i> experiments, both compounds <b>50a</b> and <b>56a</b> showed antinociceptive properties in three rodent models of NP, namely, chemotherapy-induced neuropathic pain models (the oxaliplatin model and the paclitaxel model) and the diabetic neuropathic pain model induced by streptozotocin; however compound <b>56a</b> demonstrated predominant activity. Since impaired motor coordination is also observed in neuropathic pain conditions, we have pointed out that none of the test compounds induced motor deficits in the rotarod test.

Also flagged:cyr61CTGFBIRC5sstumorHDAC4
Journal Article 2021-08-04 No Snippets Dimitrakopoulos C, Hindupur SK, Colombi M, Liko D, Ng CKY, Piscuoglio S, Behr J, Moore AL, Singer J, Ruscheweyh HJ, Matter MS, Mossmann D, Terracciano LM, Hall MN, Beerenwinkel N.
Show Full Abstract

<h4>Background</h4>Genetic aberrations in hepatocellular carcinoma (HCC) are well known, but the functional consequences of such aberrations remain poorly understood.<h4>Results</h4>Here, we explored the effect of defined genetic changes on the transcriptome, proteome and phosphoproteome in twelve tumors from an mTOR-driven hepatocellular carcinoma mouse model. Using Network-based Integration of multi-omiCS data (NetICS), we detected 74 'mediators' that relay via molecular interactions the effects of genetic and miRNA expression changes. The detected mediators account for the effects of oncogenic mTOR signaling on the transcriptome, proteome and phosphoproteome. We confirmed the dysregulation of the mediators YAP1, GRB2, SIRT1, HDAC4 and LIS1 in human HCC.<h4>Conclusions</h4>This study suggests that targeting pathways such as YAP1 or GRB2 signaling and pathways regulating global histone acetylation could be beneficial in treating HCC with hyperactive mTOR signaling.

Also flagged:Thymoquinonehydroxyapatitealginatemesenchymal stem cell differentiationpolyurethanedegradation
Journal Article 2021-08-04 No Snippets Rahmani-Moghadam E, Talaei-Khozani T, Zarrin V, Vojdani Z.
Show Full Abstract

<h4>Background</h4>Phytochemical agents such as thymoquinone (TQ) have osteogenic property. This study aimed to investigate the synergic impact of TQ and hydroxyapatite on mesenchymal stem cell differentiation. Alginate was also used as drug vehicle.<h4>Methods</h4>HA scaffolds were fabricated by casting into polyurethane foam and sintering at 800 °C, and then, 1250 °C and impregnated by TQ containing alginate. The adipose-derived stem cells were aliquoted into 4 groups: control, osteogenic induced-, TQ and osteogenic induced- and TQ-treated cultures. Adipose derived-mesenchymal stem cells were mixed with alginate and loaded into the scaffolds RESULTS: The results showed that impregnation of HA scaffold with alginate decelerated the degradation rate and reinforced the mechanical strength. TQ loading in alginate/HA had no significant influence on physical and mechanical properties. Real-time RT-PCR showed significant elevation in collagen, osteopontin, and osteocalcin expression at early phase of differentiation. TQ also led to an increase in alkaline phosphatase activity. At long term, TQ administration had no impact on calcium deposition and proliferation rate as well as bone-marker expression.<h4>Conclusion</h4>TQ accelerates the differentiation of the stem cells into the osteoblasts, without changing the physical and mechanical properties of the scaffolds. TQ also showed a synergic influence on differentiation potential of mesenchymal stem cells.

Also flagged:Plastin-3pancreatic adenocarcinomaactin-binding proteinpancreatic ductal adenocarcinomadiffuse large B-cell lymphomaDLBCL
Journal Article 2021-08-04 No Snippets Xiong F, Wu GH, Wang B, Chen YJ.
Show Full Abstract

<h4>Background</h4>Altered Plastin-3 (PLS3; an actin-binding protein) expression was associated with human carcinogenesis, including pancreatic ductal adenocarcinoma (PDA). This study first assessed differentially expressed genes (DEGs) and then bioinformatically and experimentally confirmed PLS3 to be able to predict PDA prognosis and distinguish PDA from diffuse large B-cell lymphoma.<h4>Methods</h4>This study screened multiple online databases and revealed DEGs among PDA, normal pancreas, diffuse large B-cell lymphoma (DLBCL), and normal lymph node tissues and then focused on PLS3. These DEGs were analyzed for Gene Ontology (GO) terms, Kaplan-Meier curves, and the log-rank test to characterize their association with PDA prognosis. The receiver operating characteristic curve (ROC) was plotted, and Spearman's tests were performed. Differential PLS3 expression in different tissue specimens (n = 30) was evaluated by reverse transcription quantitative polymerase chain reaction (RT-qPCR).<h4>Results</h4>There were a great number of DEGs between PDA and lymph node, between PDA and DLBCL, and between PDA and normal pancreatic tissues. Five DEGs (NET1, KCNK1, MAL2, PLS1, and PLS3) were associated with poor overall survival of PDA patients, but only PLS3 was further verified by the R2 and ICGC datasets. The ROC analysis showed a high PLS3 AUC (area under the curve) value for PDA diagnosis, while PLS3 was able to distinguish PDA from DLBCL. The results of Spearman's analysis showed that PLS3 expression was associated with levels of KRT7, SPP1, and SPARC. Differential PLS3 expression in different tissue specimens was further validated by RT-qPCR.<h4>Conclusions</h4>Altered PLS3 expression was useful in diagnosis and prognosis of PDA as well as to distinguish PDA from DLBCL.

Also flagged:hematopoiesiscoronavirus disease 2019COVID-19lymphopeniamyelopoiesisG1 phase
Journal Article 2021-08-04 ✓ 1 Snippet Wang X, Wen Y, Xie X, Liu Y, Tan X, Cai Q, Zhang Y, Cheng L, Xu G, Zhang S, Wang H, Wei L, Tang X, Qi F, Zhao J, Yuan J, Liu L, Zhu P, Ginhoux F, Zhang S, Cheng T, Zhang Z.
In-Text Gene Mentions

…SERPINB1, SMIM24, SPINK2,TAOK3, TFPI , and…

Show Full Abstract

Severe coronavirus disease 2019 (COVID-19) is often indicated by lymphopenia and increased myelopoiesis; however, the underlying mechanism is still unclear, especially the alteration of hematopoiesis. It is important to explore to what extent and how hematopoietic stem cells contribute to the impairment of peripheral lymphoid and myeloid compartments in COVID-19 patients. In this study, we used single-cell RNA sequencing to assess bone marrow mononuclear cells from COVID-19 patients with peripheral blood mononuclear cells as control. The results showed that the hematopoietic stem cells in these patients were mainly in the G1 phase and prone to apoptosis, with immune activation and anti-viral responses. Importantly, a significant accumulation of immature myeloid progenitors and a dramatic reduction of lymphoid progenitors in severe cases were identified, along with the up-regulation of transcription factors (such as SPI1, LMO4, ETS2, FLI1, and GATA2) that are important for the hematopoietic stem cell or multipotent progenitor to differentiate into downstream progenitors. Our results indicate a dysregulated hematopoiesis in patients with severe COVID-19.

Also flagged:olefinsPhosphorusalkenesaldehydesTS 1PNP
Journal Article 2021-08-04 No Snippets Gao P, Liang G, Ru T, Liu X, Qi H, Wang A, Chen FE.
Show Full Abstract

Single-atom Rh catalysts present superior activity relative to homogeneous catalyst in olefins hydroformylation, yet with limited success in regioselectivity control. In the present work, we develop a phosphorus coordinated Rh<sub>1</sub> single-atom catalyst with nanodiamond as support. Benefiting from this unique structure, the catalyst exhibits excellent activity and regioselectivity in hydroformylation of arylethylenes with wide substrate generality, i.e., with high conversion (>99%) and high regioselectivity (>90%), which is comparable with the homogeneous counterparts. The coordination interaction between Rh<sub>1</sub> and surface phosphorus species is clarified by <sup>31</sup>P solid-state NMR and X-ray absorption spectroscopy (XAS). Rh single atoms are firmly anchored over nanodiamond through Rh-P bonds, guaranteeing good stability in the hydroformation of styrene even after six runs. Finally, by using this catalyst, two kinds of pharmaceutical molecules, Ibuprofen and Fendiline, are synthesized efficiently with high yields, demonstrating a new prospect of single-atom catalyst in pharmaceutical synthesis.

Also flagged:pulmonary arterial hypertensioncationic channelscationic channelconnective tissue diseasecongenital heart diseaseK + channels
Journal Article 2021-08-04 No Snippets Perez-Vizcaino F, Cogolludo A, Mondejar-Parreño G.
Show Full Abstract

The dysregulation of K<sup>+</sup> channels is a hallmark of pulmonary arterial hypertension (PAH). Herein, the channelome was analyzed in lungs of patients with PAH in a public transcriptomic database. Sixty six (46%) mRNA encoding cationic channels were dysregulated in PAH with most of them downregulated (83%). The principal component analysis indicated that dysregulated cationic channel expression is a signature of the disease. Changes were very similar in idiopathic, connective tissue disease and congenital heart disease associated PAH. This analysis 1) is in agreement with the widely recognized pathophysiological role of TASK1 and K<sub>V</sub>1.5, 2) supports previous preliminary reports pointing to the dysregulation of several K<sup>+</sup> channels including the downregulation of K<sub>V</sub>1.1, K<sub>V</sub>1.4, K<sub>V</sub>1.6, K<sub>V</sub>7.1, K<sub>V</sub>7.4, K<sub>V</sub>9.3 and TWIK2 and the upregulation of K<sub>Ca</sub>1.1 and 3) points to other cationic channels dysregulated such as Kv7.3, TALK2, Ca<sub>V</sub>1 and TRPV4 which might play a pathophysiological role in PAH. The significance of other changes found in Na<sup>+</sup> and TRP channels remains to be investigated.

Also flagged:TristetraprolinGastric Metaplasiaautoimmune diseasescancergastritisadenocarcinoma
Journal Article 2021-08-04 ✓ 2 Snippets Busada JT, Khadka S, Peterson KN, Druffner SR, Stumpo DJ, Zhou L, Oakley RH, Cidlowski JA, Blackshear PJ.
In-Text Gene Mentions

…entific) Cftr (Mm00445197_m1),Olfm4(Mm01320260_m1), Wfdc2 (Mm0050…

…Wfdc2 , andOlfm4.…

Show Full Abstract

<h4>Background & aims</h4>Aberrant immune activation is associated with numerous inflammatory and autoimmune diseases and contributes to cancer development and progression. Within the stomach, inflammation drives a well-established sequence from gastritis to metaplasia, eventually resulting in adenocarcinoma. Unfortunately, the processes that regulate gastric inflammation and prevent carcinogenesis remain unknown. Tristetraprolin (TTP) is an RNA-binding protein that promotes the turnover of numerous proinflammatory and oncogenic messenger RNAs. Here, we assess the role of TTP in regulating gastric inflammation and spasmolytic polypeptide-expressing metaplasia (SPEM) development.<h4>Methods</h4>We used a TTP-overexpressing model, the TTPΔadenylate-uridylate rich element mouse, to examine whether TTP can protect the stomach from adrenalectomy (ADX)-induced gastric inflammation and SPEM.<h4>Results</h4>We found that TTPΔadenylate-uridylate rich element mice were completely protected from ADX-induced gastric inflammation and SPEM. RNA sequencing 5 days after ADX showed that TTP overexpression suppressed the expression of genes associated with the innate immune response. Importantly, TTP overexpression did not protect from high-dose-tamoxifen-induced SPEM development, suggesting that protection in the ADX model is achieved primarily by suppressing inflammation. Finally, we show that protection from gastric inflammation was only partially due to the suppression of Tnf, a well-known TTP target.<h4>Conclusions</h4>Our results show that TTP exerts broad anti-inflammatory effects in the stomach and suggest that therapies that increase TTP expression may be effective treatments of proneoplastic gastric inflammation. Transcript profiling: GSE164349.

Also flagged:Neurodegenerative DiseasesPathogenesisamyotrophic lateral sclerosisALSnucleotidesneurological diseases
Journal Article 2021-08-04 ✓ 1 Snippet Zhang M, He P, Bian Z.
In-Text Gene Mentions

In the HD cell model, HTTAS overexpression has been found to decrease HTT transcription levels; however, siRNA knockdown of HTTAS v1 increases HTT transcription levels.

Show Full Abstract

Neurodegenerative diseases (NDDs), including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS), are progressive and ultimately fatal. NDD onset is influenced by several factors including heredity and environmental cues. Long noncoding RNAs (lncRNAs) are a class of noncoding RNA molecules with: (i) lengths greater than 200 nucleotides, (ii) diverse biological functions, and (iii) highly conserved structures. They directly interact with molecules such as proteins and microRNAs and subsequently regulate the expression of their targets at the genetic, transcriptional, and post-transcriptional levels. Emerging studies indicate the important roles of lncRNAs in the progression of neurological diseases including NDDs. Additionally, improvements in detection technologies have enabled quantitative lncRNA detection and application to circulating fluids in clinical settings. Here, we review current research on lncRNAs in animal models and patients with NDDs. We also discuss the potential applicability of circulating lncRNAs as biomarkers in NDD diagnostics and prognostics. In the future, a better understanding of the roles of lncRNAs in NDDs will be essential to exploit these new therapeutic targets and improve noninvasive diagnostic methods for diseases.

Also flagged:Lipidmetabolismatherosclerosismyocardial infarctionMIobesity
Journal Article 2021-08-04 ✓ 1 Snippet Huang SF, Peng XF, Jiang L, Hu CY, Ye WC.
In-Text Gene Mentions

Moreover, six lncRNAs, ZFAS1 (ZNFX1 antisense RNA 1), LOC100506730, LOC100506691, DOCK9-AS2, RP11-6I2.3, and LOC100130219, were confirmed as potential novel therapeutic and prognostic targets for atherosclerosis (Wang et al., 2019).

Show Full Abstract

Lipid metabolism is an essential biological process involved in nutrient adjustment, hormone regulation, and lipid homeostasis. An irregular lifestyle and long-term nutrient overload can cause lipid-related diseases, including atherosclerosis, myocardial infarction (MI), obesity, and fatty liver diseases. Thus, novel tools for efficient diagnosis and treatment of dysfunctional lipid metabolism are urgently required. Furthermore, it is known that lncRNAs based regulation like sponging microRNAs (miRNAs) or serving as a reservoir for microRNAs play an essential role in the progression of lipid-related diseases. Accordingly, a better understanding of the regulatory roles of lncRNAs in lipid-related diseases would provide the basis for identifying potential biomarkers and therapeutic targets for lipid-related diseases. This review highlighted the latest advances on the potential biomarkers of lncRNAs in lipid-related diseases and summarised current knowledge on dysregulated lncRNAs and their potential molecular mechanisms. We have also provided novel insights into the underlying mechanisms of lncRNAs which might serve as potential biomarkers and therapeutic targets for lipid-related diseases. The information presented here may be useful for designing future studies and advancing investigations of lncRNAs as biomarkers for diagnosis, prognosis, and therapy of lipid-related diseases.

Also flagged:B7immunoregulatorsautoimmune diseasesreceptor activator of nuclear factor κ-B ligandRANKLNfatc1
Journal Article 2021-08-04 ✓ 5 Snippets Frech M, Schuster G, Andes FT, Schett G, Zaiss MM, Sarter K.
In-Text Gene Mentions

Another indication that Btn2a2 could play a role in bone homeostasis comes from measurements of Btn2a2 levels in sera of RA patients as well as from mice with a collagen-induced arthritis (CIA), in which the levels of Btn2a2 were significantly reduced in RA patients and CIA mice compared to normal healthy controls (Figures 4F, G), indicating that Btn2a2 is involved in diseases in which bone homeostasis is affected.

Moreover, in rheumatoid arthritis patients and experimental arthritis, we detected significantly decreased serum levels of the secreted soluble Btn2a2 protein.

…specific butyrophilin, namelyBtn2a2, as we have…

…recently shown thatBtn2a2is expressed on…

…that expression ofBtn2a2on monocytes and…

Show Full Abstract

Butyrophilins, which are members of the extended B7 family of immunoregulators structurally related to the B7 family, have diverse functions on immune cells as co-stimulatory and co-inhibitory molecules. Despite recent advances in the understanding on butyrophilins' role on adaptive immune cells during infectious or autoimmune diseases, nothing is known about their role in bone homeostasis. Here, we analyzed the role of one specific butyrophilin, namely Btn2a2, as we have recently shown that Btn2a2 is expressed on the monocyte/macrophage lineage that also gives rise to bone degrading osteoclasts. We found that expression of Btn2a2 on monocytes and pre-osteoclasts is upregulated by the receptor activator of nuclear factor κ-B ligand (RANKL), an essential protein required for osteoclast formation. Interestingly, in Btn2a2-deficient osteoclasts, typical osteoclast marker genes (Nfatc1, cathepsin K, TRAP, and RANK) were downregulated following RANKL stimulation. <i>In vitro</i> osteoclast assays resulted in decreased TRAP positive osteoclast numbers in Btn2a2-deficient cells. However, Btn2a2-deficient osteoclasts revealed abnormal fusion processes shown by their increased size. <i>In vivo</i> steady state µCT and histological analysis of bone architecture in complete Btn2a2-deficient mice showed differences in bone parameters further highlighting the fine-tuning effect of BTN2a2. Moreover, in rheumatoid arthritis patients and experimental arthritis, we detected significantly decreased serum levels of the secreted soluble Btn2a2 protein. Taken together, we identified the involvement of the immunomodulatory molecule Btn2a2 in osteoclast differentiation with potential future implications in basic and translational osteoimmunology.

Also flagged:malignant tumorsliver metastasissignal transductioncolorectal primary cancergene expressionIGFBP
Journal Article 2021-08-04 ✓ 5 Snippets Zhang T, Yuan K, Wang Y, Xu M, Cai S, Chen C, Ma J.
In-Text Gene Mentions

…, FGA ,SERPINC1, F2 and…

…, FGA ,SERPINC1, F2 ,…

…PLG, SERPINA5, ITIH2,SERPINC1, FGA, F2 and…

…C4BPA, F5, FGA,SERPINC1, F2, PLG, SERPINA5,…

…, ITIH2 ,SERPINC1, FGA ,…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC), one of the most common malignant tumors worldwide, has a high mortality rate, especially for patients with CRC liver metastasis (CLM). However, CLM pathogenesis remains unclear.<h4>Methods</h4>We integrated multiple cohort datasets and databases to clarify and verify potential key candidate biomarkers and signal transduction pathways in CLM. GEO2R, DAVID 6.8, ImageGP, STRING, UALCAN, ONCOMINE, THE HUMAN PROTEIN ATLAS, GEPIA 2.0, cBioPortal, TIMER 2.0, DRUGSURV, CRN, GSEA 4.0.3, FUNRICH 3.1.3 and R 4.0.3 were utilized in this study.<h4>Results</h4>Sixty-three pairs of matched colorectal primary cancer and liver metastatic gene expression profiles were screened from three gene expression profiles (GSE6988, GSE14297 and GSE81558). Thirty-one up-regulated genes and four down-regulated genes were identified from these three gene expression profiles and verified by another gene expression profiles (GSE 49355) and TCGA database. Two pathways (IGFBP-IGF signaling pathway and complement-coagulation cascade), eighteen key differentially expressed genes (DEGs), six hub genes (<i>SPARCL1</i>, <i>CDH2</i>, <i>CP</i>, <i>HP</i>, <i>TF</i> and <i>SERPINA5</i>) and two biomarkers (<i>CDH2</i> and <i>SPARCL1</i>) with significantly prognostic values were screened by multi-omics data analysis and verified by Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA) cohort.<h4>Conclusions</h4>In this study, we identified a robust set of potential candidate biomarkers in CLM, which would provide potential value for early diagnosis and prognosis, and would promote molecular targeting therapy for CRC and CLM.

Also flagged:Coagulationpartial thromboplastinvWFfibrinogenFXIcoagulopathies
Journal Article 2021-08-04 ✓ 2 Snippets Spada E, Perego R, Baggiani L, Proverbio D.
In-Text Gene Mentions

…factor antithrombin III (ATIII), adhesive proteins fibrinoge…

ATIIImedian values did…

Show Full Abstract

Leukoreduction of blood products is a technique used to prevent leukocyte-induced transfusion reactions and is extensively used in human, but rarely in veterinary patients. The concentration of some coagulation proteins can be affected by the processing steps used for the preparation of leuko-reduced plasma units. In this study, we assessed the effect of leukoreduction on coagulation activity of canine plasma collected for transfusion. Ten plasma units, five obtained from non-leuko-reduced (non-LR) whole blood (WB) units and five from leuko-reduced (LR) WB units were evaluated. Prothrombin time (PT), activated partial thromboplastin time (aPTT), coagulation factor activities of factors (F) V, VIII, X, XI, and von Willebrand (vWF), fibrinogen and D-dimers content were assessed at collection (baseline value, D0) and after 7 days of frozen storage at -18 °C (D7). Compared to non-LR plasma units, LR units showed a statistically significant prolonged aPTT and reduced FXI activity. Filtration had no significant effect on the other factors and parameters evaluated. Filtration-dependent changes appear to have no impact on the therapeutic quality of plasma obtained from leuko-reduced whole blood, other than for FXI activity. Further studies on a larger sample size comparing the same unit before and after leukoreduction are needed to confirm these findings.

Also flagged:SumoylationagingtransductioncataractHAPrdx6K
Journal Article 2021-08-04 ✓ 5 Snippets Chhunchha B, Kubo E, Kompella UB, Singh DP, Singh DP.
In-Text Gene Mentions

We also have identified lysine (K) 122 and K142 as the major Sumo1 binding sites in Prdx6 protein, and the Sumoylation-deficient Prdx6K122/142R gained the stability and enzymatic activities with increased cytoprotection [10,11,14].

…gineered Sumoylation-DeficientPrdx6Mutant Protein-Loaded Nanopart…

…ivery of Sumoylation-deficientPrdx6-NPs provided a greater…

…TAT-HA-Prdx6analog-NPs released bioactive…

… Sumoylation-deficient TAT-HA-Prdx6-NPs provided 35% more…

Show Full Abstract

Aberrant Sumoylation-mediated protein dysfunction is involved in a variety of oxidative and aging pathologies. We previously reported that Sumoylation-deficient Prdx6K<sup>(lysine)122/142R(Arginine)</sup> linked to the TAT-transduction domain gained stability and protective efficacy. In the present study, we formulated wild-type TAT-HA-Prdx6<i><sup>WT</sup></i> and Sumoylation-deficient Prdx6-loaded poly-lactic-co-glycolic acid (PLGA) nanoparticles (NPs) to further enhance stability, protective activities, and sustained delivery. We found that in vitro and subconjuctival delivery of Sumoylation-deficient Prdx6-NPs provided a greater protection of lens epithelial cells (LECs) derived from human and <i>Prdx6<sup>-/-</sup></i>-deficient mouse lenses against oxidative stress, and it also delayed the lens opacity in Shumiya cataract rats (SCRs) than TAT-HA-Prdx6<i><sup>WT</sup></i>-NPs. The encapsulation efficiencies of TAT-HA-Prdx6-NPs were ≈56%-62%. Dynamic light scattering (DLS) and atomic force microscopy (AFM) analyses showed that the NPs were spherical, with a size of 50-250 nm and a negative zeta potential (≈23 mV). TAT-HA-Prdx6 analog-NPs released bioactive TAT-HA-Prdx6 (6%-7%) within 24 h. Sumoylation-deficient TAT-HA-Prdx6-NPs provided 35% more protection by reducing the oxidative load of LECs exposed to H<sub>2</sub>O<sub>2</sub> compared to TAT-HA-Prdx6<i><sup>WT</sup></i>-NPs. A subconjuctival delivery of TAT-HA-Prdx6 analog-NPs demonstrated that released TAT-HA-Prdx6<i><sup>K122/142R</sup></i> could reduce lens opacity by ≈60% in SCRs. Collectively, our results demonstrate for the first time that the subconjuctival delivery of Sumoylation-deficient Prdx6-NPs is efficiently cytoprotective and provide a proof of concept for potential use to delay cataract and oxidative-related pathobiology in general.

Also flagged:Tumorgene expressiondoxycyclinechromosometumorspolycomb repressive complex
Journal Article 2021-08-04 ✓ 5 Snippets Kim SH, Kim B, Kim JH, Kim DH, Lee SH, Lee DS, Lee HJ.
In-Text Gene Mentions

SOX6 directly activates transcription of aggrecan (Acan) [39] and expression of MMP12 in cancer tissue [40].

Indeed, SOX6 has been described as a tumor suppressor gene in various cancers [38].

SOX6 mediates p53 stabilization and has tumor inhibitory activities in vitro and in vivo [37].

…, Sox5 ,Sox6, COl1A1 ,…

…, MMP13 ,Sox6, COl1A1 ,…

Show Full Abstract

Canines are useful in mammalian preclinical studies because they are larger than rodents and share many diseases with humans. Canine fetal fibroblast cells (CFFs) are an easily accessible source of somatic cells. However, they are easily driven to senescence and become unusable with continuous in vitro culture. Therefore, to overcome these deficiencies, we investigated whether tetracycline-inducible L-<i>myc</i> gene expression promotes self-renewal activity and tumorigenicity in the production of induced conditional self-renewing fibroblast cells (iCSFCs). Here, we describe the characterization of a new iCSFC line immortalized by transduction with L-<i>myc</i> that displays in vitro self-renewal ability without tumorigenic capacity. We established conditionally inducible self-renewing fibroblast cells by transducing CFF-3 cells with L-<i>myc</i> under the tetracycline-inducible gene expression system. In the absence of doxycycline, the cells did not express L-<i>myc</i> or undergo self-renewal. The iCSFCs had a fibroblast-like morphology, normal chromosome pattern, and expressed fibroblast-specific genes and markers. However, the iCSFCs did not form tumors in a soft agar colony-forming assay. We observed higher expression of three ES modules (core pluripotency genes, polycomb repressive complex genes (PRC), and MYC-related genes) in the iCSFCs than in the CFF-3 cells; in particular, the core pluripotency genes (OCT4, SOX2, and NANOG) were markedly up-regulated compared with the PRC and MYC module genes. These results demonstrated that, in canine fetal fibroblasts, L-<i>myc</i> tetracycline-inducible promoter-driven gene expression induces self-renewal capacity but not tumor formation. This study suggests that L-<i>myc</i> gene-induced conditional self-renewing fibroblast cells can be used as an in vitro tool in a variety of biomedical studies related to drug screening.

Also flagged:TumourPulmonaryEnteric AdenocarcinomaPulmonary enteric adenocarcinomalung adenocarcinomalung tumour
Journal Article 2021-08-04 ✓ 1 Snippet Smyth RJ, Thomas V, Fay J, Ryan R, Nicholson S, Morgan RK, Grogan L, Breathnach O, Morris PG, Toomey S, Hennessy BT, Furney SJ.
In-Text Gene Mentions

…CR_2 displaysDCC, FBXW7 ,…

Show Full Abstract

Pulmonary enteric adenocarcinoma (PEAC) is a rare variant of lung adenocarcinoma first described in the early 1990s in a lung tumour with overlapping lung and small intestine features. It is a rare tumour with fewer than 300 cases described in the published literature and was only formally classified in 2011. Given these characteristics the diagnosis is challenging, but even more so in a patient with prior gastrointestinal malignancy. A 68-year-old Caucasian female presented with a cough and was found to have a right upper lobe mass. Her history was significant for a pT3N1 colon adenocarcinoma. The resected lung tumour showed invasive lung adenocarcinoma but also features of colorectal origin. Immuno-stains were strongly and diffusely positive for lung and enteric markers. Multi-region, whole-exome sequencing of the mass and archival tissue from the prior colorectal cancer showed distinct genomic signatures with higher mutational burden in the PEAC and very minimal overlap in mutations between the two tumours. This case highlights the challenge of diagnosing rare lung tumours, but more specifically PEAC in a patient with prior gastro-intestinal cancer. Our use of multi-region, next-generation sequencing revealed distinct genomic signatures between the two tumours further supporting our diagnosis, and evidence of PEAC intra-tumour heterogeneity.

Also flagged:Photoreceptorstranslationalvisionphototransductionrhodopsinopsins
Journal Article 2021-08-04 No Snippets Zhao M, Peng GH.
Show Full Abstract

Photoreceptors are critical components of the retina and play a role in the first step of the conversion of light to electric signals. With the discovery of the intrinsically photosensitive retinal ganglion cells, which regulate non-image-forming visual processes, our knowledge of the photosensitive cell family in the retina has deepened. Photoreceptor development is regulated by specific genes and proteins and involves a series of molecular processes including DNA transcription, post-transcriptional modification, protein translation, and post-translational modification. Single-cell sequencing is a promising technology for the study of photoreceptor development. This review presents an overview of the types of human photoreceptors, summarizes recent discoveries in the regulatory mechanisms underlying their development at single-cell resolution, and outlines the prospects in this field.

Also flagged:neurodegenerative disorderHDcognitive deficitsgenetic disorderautophagycognitive impairment
Journal Article 2021-08-04 ✓ 5 Snippets Kim A, Lalonde K, Truesdell A, Gomes Welter P, Brocardo PS, Rosenstock TR, Gil-Mohapel J.
In-Text Gene Mentions

HTT is known to be a crucial regulator of BDNF transcription [106], and pathologic CAG expansions in the HD gene result in a reduction in BDNF function in HD, possibly because mHTT impairs both the transcription and the cortico-striatal transport of this neurotrophin, thus contributing to striatal neurodegeneration [29].

For example, SIRT2 inhibition was shown to decrease mutant huntingtin toxicity by reducing HTT aggregation in a striatal neuronal model of HD [367].

This model uses the mouse prion promoter to drive the expression of a cDNA coding a truncated fragment of the HTT gene that expresses the first 171 amino acids in the N-terminal region of the protein, along with 82 CAG repeats.

More recently, injection of an adeno-associated viral vector expressing a microRNA targeting human HTT (AAV5-miHTT) into zQ175 knock-in HD mice resulted in reduced HTT aggregation in the striatum and cortex.

The YAC128 line uses a yeast artificial chromosome (YAC) to express the entire human HTT gene with 128 glutamines encoded by CAG and CAA repeats [143].

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG expansion in the HD gene. The disease is characterized by neurodegeneration, particularly in the striatum and cortex. The first symptoms usually appear in mid-life and include cognitive deficits and motor disturbances that progress over time. Despite being a genetic disorder with a known cause, several mechanisms are thought to contribute to neurodegeneration in HD, and numerous pre-clinical and clinical studies have been conducted and are currently underway to test the efficacy of therapeutic approaches targeting some of these mechanisms with varying degrees of success. Although current clinical trials may lead to the identification or refinement of treatments that are likely to improve the quality of life of those living with HD, major efforts continue to be invested at the pre-clinical level, with numerous studies testing novel approaches that show promise as disease-modifying strategies. This review offers a detailed overview of the currently approved treatment options for HD and the clinical trials for this neurodegenerative disorder that are underway and concludes by discussing potential disease-modifying treatments that have shown promise in pre-clinical studies, including increasing neurotropic support, modulating autophagy, epigenetic and genetic manipulations, and the use of nanocarriers and stem cells.

Also flagged:ChromatinNeurological Disordersgene expressionhistoneCas9AD
Journal Article 2021-08-04 ✓ 1 Snippet Janowski M, Milewska M, Zare P, Pękowska A.
In-Text Gene Mentions

HD is caused by an expanded polyglutamine repeat sequence in the huntingtin protein (HTT).

Show Full Abstract

Neurological disorders (NDs) comprise a heterogeneous group of conditions that affect the function of the nervous system. Often incurable, NDs have profound and detrimental consequences on the affected individuals' lives. NDs have complex etiologies but commonly feature altered gene expression and dysfunctions of the essential chromatin-modifying factors. Hence, compounds that target DNA and histone modification pathways, the so-called epidrugs, constitute promising tools to treat NDs. Yet, targeting the entire epigenome might reveal insufficient to modify a chosen gene expression or even unnecessary and detrimental to the patients' health. New technologies hold a promise to expand the clinical toolkit in the fight against NDs. (Epi)genome engineering using designer nucleases, including CRISPR-Cas9 and TALENs, can potentially help restore the correct gene expression patterns by targeting a defined gene or pathway, both genetically and epigenetically, with minimal off-target activity. Here, we review the implication of epigenetic machinery in NDs. We outline syndromes caused by mutations in chromatin-modifying enzymes and discuss the functional consequences of mutations in regulatory DNA in NDs. We review the approaches that allow modifying the (epi)genome, including tools based on TALENs and CRISPR-Cas9 technologies, and we highlight how these new strategies could potentially change clinical practices in the treatment of NDs.

Also flagged:SNAI2transforming growth factor-β1epithelial-mesenchymal transitionembryogenesiswound healingcancer
Journal Article 2021-08-04 ✓ 1 Snippet Miyake Y, Nagaoka Y, Okamura K, Takeishi Y, Tamaoki S, Hatta M.
In-Text Gene Mentions

…protein P) andOLFM4(olfactomedin 4) were…

Show Full Abstract

Epithelial-mesenchymal transition (EMT) is a cellular process in which epithelial cells lose their epithelial traits and shift to the mesenchymal phenotype, and is associated with various biological events, such as embryogenesis, wound healing and cancer progression. The transcriptional program that promotes phenotype switching is dynamically controlled by transcription factors during EMT, including Snail (SNAI1), twist family bHLH transcription factor (TWIST) and zinc finger E-box binding homeobox 1 (ZEB1). The present study aimed to investigate the molecular mechanisms underlying EMT in squamous epithelial cells. Western blot analysis and immunocytochemical staining identified Slug (SNAI2) as a transcription factor that is induced during transforming growth factor (TGF)-β1-mediated EMT in the human keratinocyte cell line HaCaT. The effect of SNAI2 overexpression and knockdown on the phenotypic characteristics of HaCaT cells was evaluated. Filamentous actin staining and western blot analysis revealed that the overexpression of SNAI2 did not induce the observed EMT-related phenotypic changes. In addition, SNAI2 knockdown demonstrated almost no impact on the EMT phenotypes induced by TGF-β1. Notably, DNA microarray analysis followed by comprehensive bioinformatics analysis revealed that the differentially expressed genes upregulated by TGF-β1 were significantly enriched in cell adhesion and extracellular matrix binding, whereas the genes downregulated in response to TGF-β1 were significantly enriched in the cell cycle. No enriched gene ontology term and biological pathways were identified in the differentially expressed gene sets of SNAI2-overexpressing cells. In addition, the candidates for master transcription factors regulating the TGF-β1-induced EMT were identified using transcription factor enrichment analysis. In conclusion, the results of study demonstrated that SNAI2 does not play an essential role in the EMT of HaCaT cells and identified candidate transcription factors that may be involved in EMT-related gene expression induced by TGF-β1. These findings may enhance the understanding of molecular events in EMT and contribute to the development of a novel therapeutic approach against EMT in cancers and wound healing.

Also flagged:Chlorhexidinefluoridesodiumperiodontal diseasesdental decayperiodontal disease
Journal Article 2021-08-04 No Snippets Shahi AK, Kumar P, Shetty D, Jain A, Sharma P, Raza M.
Show Full Abstract

<h4>Aim</h4>To evaluate and compare the efficacy of Ozonated Olive Oil Gel, Chlorhexidine gel, and Amflor (Fluoridated) mouthwash on reducing the count of Streptococcus mutans and Lactobacillus in patients undergoing fixed orthodontic therapy evaluated at different time intervals.<h4>Methods</h4>Sixty patients undergoing orthodontic treatment were randomly divided into three groups (<i>n</i> = 20) based on antimicrobial agents used (Group 1: Ozonated olive oil gel; Group 2: Chlorhexidine gel; Group 3: Fluoridated mouthwash). Elastomeric modules from brackets were collected at T<sub>0</sub> (Fresh samples) and T<sub>1</sub> (2<sup>nd</sup> week) and T<sub>2</sub> (4<sup>th</sup> week) for assessment of the microbial growth. These collected modules were cultured and evaluated for the presence of Streptococcus Mutans and Lactobacilli and numbers of colonies were counted at each interval. Data obtained was subjected to statistical analysis using SPSS software (Version 20.0). Level of significance was kept at 5%. Intra-group and inter-group comparison between pretreatment, 2<sup>nd</sup> week and 4<sup>th</sup> week was done for each group using Wilcoxon signed rank test and Mann-Whitney U test.<h4>Results</h4>There was presence of Streptococcus Mutans and Lactobacilli during orthodontic treatment which progressively increased from T<sub>o</sub> to T<sub>1</sub> and then declined from T<sub>1</sub> to T<sub>2.</sub> The colony counts were maximum for Fluoridated mouthwash and least for Chlorhexidine and the results were statistically significant (<i>P</i> < 0.05).<h4>Conclusion</h4>All three antimicrobial agents used were effective against Streptococcus mutans and Lactobacillus. Chlorhexidine proved to be more efficacious whereas Fluoridated mouthwash proved to be least effective against both Streptococcus mutans and Lactobacillus bacteria.

Also flagged:Chronicinfectioncardiovascular diseaseCVDsofosbuvirdaclatasvir
Journal Article 2021-08-04 ✓ 1 Snippet Freekh DA, Helmy MW, Said M, El-Khodary NM.
In-Text Gene Mentions

…cholestasis, Wilson disease,hemochromatosis, metabolic disease, patients…

Show Full Abstract

Chronic hepatitis C virus (HCV) infection is correlated with cerebrovascular and cardiovascular disease (CVD). This study aimed to assess the effect of treatment with DAAs on vascular endothelial function in cirrhotic and non-cirrhotic HCV infected patients without any CVD risk factors. Fifty chronic HCV genotype 4 infected patients, without cardiovascular risks who have been listed to receive sofosbuvir/daclatasvir with ribavirin combination as triple therapy for 3 months were prospectively recruited. Endothelial dysfunction markers as soluble vascular cell adhesion molecule-1 (sVCAM-1) and Von willebrand factor (vWf) and inflammation marker (IL6) were estimated at baseline and 3 months post the end of therapy (SVR). All patients achieved SVR. VCAM1 level was significantly improved after HCV clearance with DAA in cirrhotic HCV patients (P = 0.002) compared to patients with mild liver fibrosis (P = 0.006). Levels of vWF also decreased significantly in cirrhosis and non-cirrhosis groups after SVR (P < 0.001 and P = 0.011, respectively). Systemic inflammatory marker (IL6) showed significant decrease in cirrhotic patients (P = 0.001). While, IL6 level did not change significantly in non-cirrhotic group (P = 0.061). Also at SVR, noninvasive liver fibrosis indices have been reduced significantly in the two groups (P < 0.001). HCV clearance by new DAA treatment improves the vascular endothelial dysfunction in Egyptian HCV infected patients with different levels of liver fibrosis and with no risk factors for endothelial dysfunction or CVD.

This Week in The Journal

Also flagged:Axonsextracellular matrixbasement membraneneuronal migrationgrowth conesactin
Journal Article 2021-08-04 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

bioRxiv 2021-08-04 Preprint (No Snippets API) Wang JY, Roehrl MW, Roehrl VB, Roehrl MH.
Show Full Abstract

Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer. The autoantigen-ome is significantly associated with various processes in viral infections, such as translation, protein processing, and vesicle transport. Interestingly, the coding genes of autoAgs predominantly contain multiple exons with many possible alternative splicing variants, short transcripts, and short UTR lengths. These observations and the finding that numerous autoAgs involved in RNA-splicing showed altered expression in viral infections suggest that viruses exploit alternative splicing to reprogram host cell machinery to ensure viral replication and survival. While each cell type gives rise to a unique pool of autoAgs, 39 common autoAgs associated with cell stress and apoptosis were identified from all six cell types, with several being known markers of systemic autoimmune diseases. In particular, the common autoAg UBA1 that catalyzes the first step in ubiquitination is encoded by an X-chromosome escape gene. Given its essential function in apoptotic cell clearance and that X-inactivation escape tends to increase with aging, UBA1 dysfunction can therefore predispose aging women to autoimmune disorders. In summary, we propose a model of how viral infections lead to extensive molecular alterations and host cell death, autoimmune responses facilitated by autoAg-DS complexes, and ultimately autoimmune diseases. Overall, this master autoantigen-ome provides a molecular guide for investigating the myriad of autoimmune sequalae to COVID-19 and clues to the rare but reported adverse effects of the currently available COVID vaccines.

Research Square 2021-08-04 Preprint (No Snippets API) Dam PT, Hoang VT, Bui HTH, Hang LM, Hoang DM, Nguyen HP, Thi LH, Thanh HTT, Nguyen X, Liem NT.
Show Full Abstract

<title>Abstract</title> <p><bold>Background:</bold> We have observed an increased expression of negative markers in some clinical-grade, xeno- and serum-free cultured adipose-derived mesenchymal stem/stromal cell (ADMSC) samples. It gave rise to concern that xeno- and serum-free conditions might have unexpected effects on human ADMSCs. This study aims to test this hypothesis for two xeno- and serum-free media, PowerStem MSC1 media (PS) and StemMACS MSC Expansion Media (SM), that support the <italic>in vitro</italic> expansion of ADMSCs.<bold>Methods:</bold> We investigated the expression of negative markers in 42 clinical-grade ADMSC samples expanded in PS. Next, we cultured ADMSCs from seven donors in PS and SM and examined their growth and colony-forming ability, surface marker expression, differentiation, cell cycle and senescence, as well as genetic stability of two passages representing an early and late passage for therapeutic MSCs.<bold>Results:</bold> 15 of 42 clinical-grade PS-expanded ADMSC samples showed an increased expression of negative markers ranging from 2.73% to 34.24%, which positively correlated with the age of donors. This rise of negative markers was related to an upregulation of Human Leukocyte Antigen – DR (HLA-DR). In addition, the PS-cultured cells presented decreased growth ability, lower frequencies of cells in S/G2/M phases, and increased ß-galactosidase activity in passage 7 suggesting their senescent feature compared to those grown in SM. Although MSCs of both PS and SM cultures were capable of multilineage differentiation, the PS-cultured cells demonstrated chromosomal abnormalities in passage 7 compared to the normal karyotype of their SM counterparts.<bold>Conclusions:</bold> These findings suggest that the SM media is more suitable for the expansion of therapeutic ADMSCs than PS. The study also hints a change of ADMSC features at more advanced passages and with increased donor’s age. Thus, it emphasizes the necessity to cover these aspects in the quality control of therapeutic MSC products.</p>

Also flagged:ethersilicaIronracemic mixturespyrrolidinepyrrole
Journal Article 2021-08-03 No Snippets Yildirim O, Grigalunas M, Brieger L, Strohmann C, Antonchick AP, Waldmann H.
Show Full Abstract

In dynamic covalent chemistry, reactions follow a thermodynamically controlled pathway through equilibria. Reversible covalent-bond formation and breaking in a dynamic process enables the interconversion of products formed under kinetic control to thermodynamically more stable isomers. Notably, enantioselective catalysis of dynamic transformations has not been reported and applied in complex molecule synthesis. We describe the discovery of dynamic covalent enantioselective metal-complex-catalyzed 1,3-dipolar cycloaddition reactions. We have developed a stereodivergent tandem synthesis of structurally and stereochemically complex molecules that generates eight stereocenters with high diastereo- and enantioselectivity through asymmetric reversible bond formation in a dynamic process in two consecutive Ag-catalyzed 1,3-dipolar cycloadditions of azomethine ylides with electron-poor olefins. Time-dependent reversible dynamic covalent-bond formation gives enantiodivergent and diastereodivergent access to structurally complex double cycloadducts with high selectivity from a common set of reagents.

Also flagged:cancerpancreatic ductal adenocarcinomaPDACextracellularpathogenesispancreatic cancer
Journal Article 2021-08-03 No Snippets Tan M, Brusgaard K, Gerdes AM, Mortensen MB, Detlefsen S, Schaffalitzky de Muckadell OB, Joergensen MT.
Show Full Abstract

First-degree relatives (FDRs) of familial pancreatic cancer (FPC) patients have increased risk of developing pancreatic ductal adenocarcinoma (PDAC). Investigating and understanding the genetic basis for PDAC susceptibility in FPC predisposed families may contribute toward future risk-assessment and management of high-risk individuals. Using a Danish cohort of 27 FPC families, we performed whole-genome sequencing of 61 FDRs of FPC patients focusing on rare genetic variants that may contribute to familial aggregation of PDAC. Statistical analysis was performed using the gnomAD database as external controls. Through analysis of heterozygous premature truncating variants (PTV), we identified cancer-related genes and cancer-driver genes harboring multiple germline mutations. Association analysis detected 20 significant genes with false discovery rate, q < 0.05 including: PALD1, LRP1B, COL4A2, CYLC2, ZFYVE9, BRD3, AHDC1, etc. Functional annotation showed that the significant genes were enriched by gene clusters encoding for extracellular matrix and associated proteins. PTV genes were over-represented by functions related to transport of small molecules, innate immune system, ion channel transport, and stimuli-sensing channels. In conclusion, FDRs of FPC patients carry rare germline variants related to cancer pathogenesis that may contribute to increased susceptibility to PDAC. The identified variants may potentially be useful for risk prediction of high-risk individuals in predisposed families.

Also flagged:Netrin 1extracellularmatrix proteindigestionmetabolismcell proliferation
Journal Article 2021-08-03 ✓ 1 Snippet Moya-Torres A, Gupta M, Heide F, Krahn N, Legare S, Nikodemus D, Imhof T, Meier M, Koch M, Stetefeld J.
In-Text Gene Mentions

…in colorectal cancer (DCC) (Xu et al.…

Show Full Abstract

The production of recombinant proteins for functional and biophysical studies, especially in the field of structural determination, still represents a challenge as high quality and quantities are needed to adequately perform experiments. This is in part solved by optimizing protein constructs and expression conditions to maximize the yields in regular flask expression systems. Still, work flow and effort can be substantial with no guarantee to obtain improvements. This study presents a combination of workflows that can be used to dramatically increase protein production and improve processing results, specifically for the extracellular matrix protein Netrin-1. This proteoglycan is an axon guidance cue which interacts with various receptors to initiate downstream signaling cascades affecting cell differentiation, proliferation, metabolism, and survival. We were able to produce large glycoprotein quantities in mammalian cells, which were engineered for protein overexpression and secretion into the media using the controlled environment provided by a hollow fiber bioreactor. Close monitoring of the internal bioreactor conditions allowed for stable production over an extended period of time. In addition to this, Netrin-1 concentrations were monitored in expression media through biolayer interferometry which allowed us to increase Netrin-1 media concentrations tenfold over our current flask systems while preserving excellent protein quality and in solution behavior. Our particular combination of genetic engineering, cell culture system, protein purification, and biophysical characterization permitted us to establish an efficient and continuous production of high-quality protein suitable for structural biology studies that can be translated to various biological systems. KEY POINTS: • Hollow fiber bioreactor produces substantial yields of homogenous Netrin-1 • Biolayer interferometry allows target protein quantitation in expression media • High production yields in the bioreactor do not impair Netrin-1 proteoglycan quality.

Also flagged:zip-2peptidesagingSrysucrosepronase
Journal Article 2021-08-03 No Snippets Cao D.
Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) play diverse roles in different biological and physiological environments and are always expressed in a tissue-specific manner. Especially, circRNAs are enriched in the brain tissues of almost all investigated species, including humans, mice, Drosophila, etc. Although circRNAs were found in C. elegans, the neuron-specific circRNA data is not available yet. Exon-skipping is found to be correlated to circRNA formation, but the mechanisms that link them together are not clear.<h4>Results</h4>Here, through large-scale neuron isolation from the first larval (L1) stage of C. elegans followed by RNA sequencing with ribosomal RNA depletion, the neuronal circRNA data in C. elegans were obtained. Hundreds of novel circRNAs were annotated with high accuracy. circRNAs were highly expressed in the neurons of C. elegans and were positively correlated to the levels of their cognate linear mRNAs. Disruption of reverse complementary match (RCM) sequences in circRNA flanking introns effectively abolished circRNA formation. In the zip-2 gene, deletion of either upstream or downstream RCMs almost eliminated the production of both the circular and the skipped transcript. Interestingly, the 13-nt RCM in zip-2 is highly conserved across five nematode ortholog genes, which show conserved exon-skipping patterns. Finally, through in vivo one-by-one mutagenesis of all the splicing sites and branch points required for exon-skipping and back-splicing in the zip-2 gene, I showed that back-splicing still happened without exon-skipping, and vice versa.<h4>Conclusions</h4>Through protocol optimization, total RNA obtained from sorted neurons is increased to hundreds of nanograms. circRNAs highly expressed in the neurons of C. elegans are more likely to be derived from genes also highly expressed in the neurons. RCMs are abundant in circRNA flanking introns, and RCM-deletion is an efficient way to knockout circRNAs. More importantly, these RCMs are not only required for back-splicing but also promote the skipping of exon(s) to be circularized. Finally, RCMs in circRNA flanking introns can directly promote both exon-skipping and back-splicing, providing a new explanation for the correlation between them.

Also flagged:FAM19A5atherosclerosischemokine (C-C motif)-likeA5adipokinemetabolic disorders
Journal Article 2021-08-03 ✓ 1 Snippet Yari FA, Shabani P, Karami S, Sarmadi N, Poustchi H, Bandegi AR.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, Wilson’s disease.…

Show Full Abstract

<h4>Background</h4>Family with sequence similarity 19 (chemokine (C-C motif)-like) member A5 (FAM19A5) is a newly identified adipokine. There is a limited number of studies linking FAM19A5 to metabolic disorders. In the current study, we aimed to explore if FAM19A5 is associated with nonalcoholic fatty liver disease (NAFLD). We also sought to determine the possibility of FAM19A5 association with subclinical atherosclerosis in NAFLD patients.<h4>Methods</h4>A total of 69 subjects including 37 NAFLD and 32 control subjects were included in this cross-sectional study. Plasma concentration of FAM19A5 was measured with the ELISA method. Carotid artery intima-media thickness (cIMT) was assessed by the ultrasonography.<h4>Results</h4>Plasma concentration of FAM19A5 in patients with NAFLD was significantly lower in NAFLD patients than controls. Moreover, we observed significant negative correlations between plasma level of FAM19A5 and body mass index (BMI), visceral fat, alanine amino transferase (ALT), aspartate amino transferase (AST), liver stiffness (LS), and cIMT. Following stepwise multiple linear regression analysis, ALT and cIMT were the only determinants of FAM19A5 level.<h4>Conclusions</h4>This is the first report to describe association of circulating FAM19A5 levels with NAFLD. Our findings provide further evidence showing relation of FAM19A5 with the risk of atherosclerosis. However, more studies are necessary to unravel the contribution of lower FAM19A5 levels to the NAFLD pathogenesis and the higher risk of atherosclerosis in these patients.

Also flagged:cardiac hypertrophyinflammatory cytokineheart failurepathological myocardial hypertrophycalciumangiogenesis
Journal Article 2021-08-03 No Snippets Su W, Huo Q, Wu H, Wang L, Ding X, Liang L, Zhou L, Zhao Y, Dan J, Zhang H.
Show Full Abstract

Cardiac hypertrophy, characterized by the enlargement of cardiomyocytes, is initially an adaptive response to physiological and pathological stimuli. Decompensated cardiac hypertrophy is related to fibrosis, inflammatory cytokine, maladaptive remodeling, and heart failure. Although pathological myocardial hypertrophy is the main cause of hypertrophy-related morbidity and mortality, our understanding of its mechanism is still poor. Long noncoding RNAs (lncRNAs) are noncoding RNAs that regulate various physiological and pathological processes through multiple molecular mechanisms. Recently, accumulating evidence has indicated that lncRNA-H19 is a potent regulator of the progression of cardiac hypertrophy. For the first time, this review summarizes the current studies about the role of lncRNA-H19 in cardiac hypertrophy, including its pathophysiological processes and underlying pathological mechanism, including calcium regulation, fibrosis, apoptosis, angiogenesis, inflammation, and methylation. The context within which lncRNA-H19 might be developed as a target for cardiac hypertrophy treatment is then discussed to gain better insight into the possible biological functions of lncRNA-H19 in cardiac hypertrophy.

Also flagged:neuropeptide YNPYneuropeptidesbrain-derived trophic factorBDNFangiogenesis
Journal Article 2021-08-03 No Snippets Zhang Y, Liu CY, Chen WC, Shi YC, Wang CM, Lin S, He HF.
Show Full Abstract

Neuropeptide Y (NPY), one of the most abundant neuropeptides in the body, is widely expressed in the central and peripheral nervous systems and acts on the cardiovascular, digestive, endocrine, and nervous systems. NPY affects the nutritional and inflammatory microenvironments through its interaction with immune cells, brain-derived trophic factor (BDNF), and angiogenesis promotion to maintain body homeostasis. Additionally, NPY has great potential for therapeutic applications against various diseases, especially as an adjuvant therapy for stem cells. In this review, we discuss the research progress regarding NPY, as well as the current evidence for the regulation of NPY in each microenvironment, and provide prospects for further research on related diseases.

Also flagged:interferoninfectionpathogenesisco-infectionCOVID-19gene expression
Journal Article 2021-08-03 No Snippets Rouchka EC, Chariker JH, Alejandro B, Adcock RS, Singhal R, Ramirez J, Palmer KE, Lasnik AB, Carrico R, Arnold FW, Furmanek S, Zhang M, Wolf LA, Waigel S, Zacharias W, Bordon J, Chung D.
Show Full Abstract

Key elements for viral pathogenesis include viral strains, viral load, co-infection, and host responses. Several studies analyzing these factors in the function of disease severity of have been published; however, no studies have shown how all of these factors interplay within a defined cohort. To address this important question, we sought to understand how these four key components interplay in a cohort of COVID-19 patients. We determined the viral loads and gene expression using high throughput sequencing and various virological methods. We found that viral loads in the upper respiratory tract in COVID-19 patients at an early phase of infection vary widely. While the majority of nasopharyngeal (NP) samples have a viral load lower than the limit of detection of infectious viruses, there are samples with an extraordinary amount of SARS-CoV-2 RNA and a high viral titer. No specific viral factors were identified that are associated with high viral loads. Host gene expression analysis showed that viral loads were strongly correlated with cellular antiviral responses. Interestingly, however, COVID-19 patients who experience mild symptoms have a higher viral load than those with severe complications, indicating that naso-pharyngeal viral load may not be a key factor of the clinical outcomes of COVID-19. The metagenomics analysis revealed that the microflora in the upper respiratory tract of COVID-19 patients with high viral loads were dominated by SARS-CoV-2, with a high degree of dysbiosis. Finally, we found a strong inverse correlation between upregulation of interferon responses and disease severity. Overall our study suggests that a high viral load in the upper respiratory tract may not be a critical factor for severe symptoms; rather, dampened antiviral responses may be a critical factor for a severe outcome from the infection.

Also flagged:Netrin-1osteoarthritisOAaxon-TMJ OAtemporomandibular joint disorders
Journal Article 2021-08-03 ✓ 4 Snippets Xiao M, Hu Z, Jiang H, Li C, Guo H, Fang W, Long X.
In-Text Gene Mentions

…USA) and theDCCrabbit polyclonal antibody…

…the other receptorDCCshowed no expression…

…receptors Unc5B andDCC24 .…

…TheDCC-dependent ERK1/2-eNOS feed-fo…

Show Full Abstract

Subchondral bone degeneration is the main pathological change during temporomandibular joint (TMJ) osteoarthritis (OA) development. Netrin-1, an axon-guiding factor, might play roles in OA development and pain. The purpose of this study was to investigate the expression of Netrin-1 in TMJ OA and its possible role in the progression of TMJ OA and pain. The synovial fluids of temporomandibular joint disorders (TMDs) patients were collected for Netrin-1 by enzyme linked immunosorbent assay (ELISA). TMJ OA model was built by MIA joint injection, and then the von Frey test, hematoxylin & eosin (H&E) staining, toluidine blue (TB) staining, immunohistochemical (IHC) staining and micro-CT were performed. After induction of osteoclast differentiation of raw264.7 cells, immunofluorescence (IF) was used to detect the Netrin-1 and its receptors on osteoclast membrane. The concentration of Netrin-1 increased in the synovial fluid of TMJ OA patients. After MIA injection to TMJ, the head withdrawal threshold (HWT) was significantly decreased. Microscopically, the structural disorder of subchondral bone was the most obvious at the 2nd week after MIA injection. In addition, Netrin-1 expression increased in the subchondral bone at the 2nd week after MIA injection. In vitro, the expressions of Netrin-1 and its receptor Unc5B were upregulated on the osteoclast membrane. Netrin-1 might be an important regulator during bone degeneration and pain in the process of TMJ OA.

Also flagged:Thioesterasesteatosislipoproteinfatty acidgene expressionacyl
Journal Article 2021-08-03 ✓ 1 Snippet Cholico GN, Fling RR, Zacharewski NA, Fader KA, Nault R, Zacharewski TR.
In-Text Gene Mentions

…Eci1,Eci2and peroxisomal Decr2…

Show Full Abstract

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), a persistent environmental contaminant, induces steatosis by increasing hepatic uptake of dietary and mobilized peripheral fats, inhibiting lipoprotein export, and repressing β-oxidation. In this study, the mechanism of β-oxidation inhibition was investigated by testing the hypothesis that TCDD dose-dependently repressed straight-chain fatty acid oxidation gene expression in mice following oral gavage every 4 days for 28 days. Untargeted metabolomic analysis revealed a dose-dependent decrease in hepatic acyl-CoA levels, while octenoyl-CoA and dicarboxylic acid levels increased. TCDD also dose-dependently repressed the hepatic gene expression associated with triacylglycerol and cholesterol ester hydrolysis, fatty acid binding proteins, fatty acid activation, and 3-ketoacyl-CoA thiolysis while inducing acyl-CoA hydrolysis. Moreover, octenoyl-CoA blocked the hydration of crotonyl-CoA suggesting short chain enoyl-CoA hydratase (ECHS1) activity was inhibited. Collectively, the integration of metabolomics and RNA-seq data suggested TCDD induced a futile cycle of fatty acid activation and acyl-CoA hydrolysis resulting in incomplete β-oxidation, and the accumulation octenoyl-CoA levels that inhibited the activity of short chain enoyl-CoA hydratase (ECHS1).

Also flagged:STAU2double-stranded RNA-binding proteinchromosomeorganizationlocalizationneurogenesis
Journal Article 2021-08-03 ✓ 1 Snippet Chowdhury R, Wang Y, Campbell M, Goderie SK, Doyle F, Tenenbaum SA, Kusek G, Kiehl TR, Ansari SA, Boles NC, Temple S.
In-Text Gene Mentions

Stau1

Show Full Abstract

STAU2 is a double-stranded RNA-binding protein enriched in the nervous system. During asymmetric divisions in the developing mouse cortex, STAU2 preferentially distributes into the intermediate progenitor cell (IPC), delivering RNA molecules that can impact IPC behavior. Corticogenesis occurs on a precise time schedule, raising the hypothesis that the cargo STAU2 delivers into IPCs changes over time. To test this, we combine RNA-immunoprecipitation with sequencing (RIP-seq) over four stages of mouse cortical development, generating a comprehensive cargo profile for STAU2. A subset of the cargo was 'stable', present at all stages, and involved in chromosome organization, macromolecule localization, translation and DNA repair. Another subset was 'dynamic', changing with cortical stage, and involved in neurogenesis, cell projection organization, neurite outgrowth, and included cortical layer markers. Notably, the dynamic STAU2 cargo included determinants of IPC versus neuronal fates and genes contributing to abnormal corticogenesis. Knockdown of one STAU2 target, Taf13, previously linked to microcephaly and impaired myelination, reduced oligodendrogenesis in vitro. We conclude that STAU2 contributes to the timing of corticogenesis by binding and delivering complex and temporally regulated RNA cargo into IPCs.

Also flagged:chromosomecell cycle checkpointsinitiator proteinDnaAcell cycleprotein synthesis
Journal Article 2021-08-03 ✓ 4 Snippets Charbon G, Frimodt-Møller J, Løbner-Olesen A.
In-Text Gene Mentions

…Sequences DARS1 andDARS2serves to increase…

…for DDAH andDARS2.…

…Rejuvenation atDARS2rejuvenation is also…

…which RIDA andDARS2are inactive, DnaA…

Show Full Abstract

Most organisms possess several cell cycle checkpoints to preserve genome stability in periods of stress. Upon starvation, the absence of chromosomal duplication in the bacterium Escherichia coli is ensured by holding off commencement of replication. During normal growth, accumulation of the initiator protein DnaA along with cell cycle changes in its activity, ensure that DNA replication starts only once per cell cycle. Upon nutrient starvation, the prevailing model is that an arrest in DnaA protein synthesis is responsible for the absence of initiation. Recent indications now suggest that DnaA degradation may also play a role. Here we comment on the implications of this potential new layer of regulation.

Also flagged:NEUROG3transcription factorinsulindiabetesislet cell developmentHA
Journal Article 2021-08-03 ✓ 1 Snippet Schreiber V, Mercier R, Jiménez S, Ye T, García-Sánchez E, Klein A, Meunier A, Ghimire S, Birck C, Jost B, de Lichtenberg KH, Honoré C, Serup P, Gradwohl G.
In-Text Gene Mentions

…(e.g., CACNA1A, CACNA1C,CACNA1E, CACNA2D1, CACNB2 )…

Show Full Abstract

<h4>Objective</h4>Mice lacking the bHLH transcription factor (TF) Neurog3 do not form pancreatic islet cells, including insulin-secreting beta cells, the absence of which leads to diabetes. In humans, homozygous mutations of NEUROG3 manifest with neonatal or childhood diabetes. Despite this critical role in islet cell development, the precise function of and downstream genetic programs regulated directly by NEUROG3 remain elusive. Therefore, we mapped genome-wide NEUROG3 occupancy in human induced pluripotent stem cell (hiPSC)-derived endocrine progenitors and determined NEUROG3 dependency of associated genes to uncover direct targets.<h4>Methods</h4>We generated a novel hiPSC line (NEUROG3-HA-P2A-Venus) where NEUROG3 is HA-tagged and fused to a self-cleaving fluorescent VENUS reporter. We used the CUT&RUN technique to map NEUROG3 occupancy and epigenetic marks in pancreatic endocrine progenitors (PEP) that were differentiated from this hiPSC line. We integrated NEUROG3 occupancy data with chromatin status and gene expression in PEPs as well as their NEUROG3-dependence. In addition, we investigated whether NEUROG3 binds type 2 diabetes mellitus (T2DM)-associated variants at the PEP stage.<h4>Results</h4>CUT&RUN revealed a total of 863 NEUROG3 binding sites assigned to 1263 unique genes. NEUROG3 occupancy was found at promoters as well as at distant cis-regulatory elements that frequently overlapped within PEP active enhancers. De novo motif analyses defined a NEUROG3 consensus binding motif and suggested potential co-regulation of NEUROG3 target genes by FOXA or RFX transcription factors. We found that 22% of the genes downregulated in NEUROG3<sup>-/-</sup> PEPs, and 10% of genes enriched in NEUROG3-Venus positive endocrine cells were bound by NEUROG3 and thus likely to be directly regulated. NEUROG3 binds to 138 transcription factor genes, some with important roles in islet cell development or function, such as NEUROD1, PAX4, NKX2-2, SOX4, MLXIPL, LMX1B, RFX3, and NEUROG3 itself, and many others with unknown islet function. Unexpectedly, we uncovered that NEUROG3 targets genes critical for insulin secretion in beta cells (e.g., GCK, ABCC8/KCNJ11, CACNA1A, CHGA, SCG2, SLC30A8, and PCSK1). Thus, analysis of NEUROG3 occupancy suggests that the transient expression of NEUROG3 not only promotes islet destiny in uncommitted pancreatic progenitors, but could also initiate endocrine programs essential for beta cell function. Lastly, we identified eight T2DM risk SNPs within NEUROG3-bound regions.<h4>Conclusion</h4>Mapping NEUROG3 genome occupancy in PEPs uncovered unexpectedly broad, direct control of the endocrine genes, raising novel hypotheses on how this master regulator controls islet and beta cell differentiation.

Also flagged:Mitochondrialphosphorylationmitochondriametabolismbrain disordersBioenergetics
Journal Article 2021-08-03 No Snippets Zanfardino P, Doccini S, Santorelli FM, Petruzzella V.
Show Full Abstract

Oxidative phosphorylation (OxPhos) is the basic function of mitochondria, although the landscape of mitochondrial functions is continuously growing to include more aspects of cellular homeostasis. Thanks to the application of -<i>omics</i> technologies to the study of the OxPhos system, novel features emerge from the cataloging of novel proteins as mitochondrial thus adding details to the mitochondrial proteome and defining novel metabolic cellular interrelations, especially in the human brain. We focussed on the diversity of bioenergetics demand and different aspects of mitochondrial structure, functions, and dysfunction in the brain. Definition such as '<i>mitoexome</i>', '<i>mitoproteome</i>' and '<i>mitointeractome</i>' have entered the field of 'mitochondrial medicine'. In this context, we reviewed several genetic defects that hamper the last step of aerobic metabolism, mostly involving the nervous tissue as one of the most prominent energy-dependent tissues and, as consequence, as a primary target of mitochondrial dysfunction. The dual genetic origin of the OxPhos complexes is one of the reasons for the complexity of the genotype-phenotype correlation when facing human diseases associated with mitochondrial defects. Such complexity clinically manifests with extremely heterogeneous symptoms, ranging from organ-specific to multisystemic dysfunction with different clinical courses. Finally, we briefly discuss the future directions of the multi-omics study of human brain disorders.

Also flagged:axonsgrowth conecytoskeletonaxonneurodegenerative diseasesextracellular
Journal Article 2021-08-03 ✓ 3 Snippets Domínguez-Romero ME, Slater PG.
In-Text Gene Mentions

…205 ], whileDCCand UNC5B mRNA…

…the up-regulation ofDCCin the plasma…

…the Netrin receptorDCC, changing its location…

Show Full Abstract

During neuronal development and regeneration axons extend a cytoskeletal-rich structure known as the growth cone, which detects and integrates signals to reach its final destination. The guidance cues "signals" bind their receptors, activating signaling cascades that result in the regulation of the growth cone cytoskeleton, defining growth cone advance, pausing, turning, or collapse. Even though much is known about guidance cues and their isolated mechanisms during nervous system development, there is still a gap in the understanding of the crosstalk between them, and about what happens after nervous system injuries. After neuronal injuries in mammals, only axons in the peripheral nervous system are able to regenerate, while the ones from the central nervous system fail to do so. Therefore, untangling the guidance cues mechanisms, as well as their behavior and characterization after axotomy and regeneration, are of special interest for understanding and treating neuronal injuries. In this review, we present findings on growth cone guidance and canonical guidance cues mechanisms, followed by a description and comparison of growth cone pathfinding mechanisms after axotomy, in regenerative and non-regenerative animal models.

Also flagged:5-MethylcytosineOvarian Cancermethylationcancers-methylcytosineserous ovarian cancer
Journal Article 2021-08-03 No Snippets Meng L, Zhang Q, Huang X, Huang X.
Show Full Abstract

<h4>Background</h4>Accumulating evidence has indicated that methylation status is closely related to tumourigenesis and a few aggressive features of diverse cancers. However, as an important methylation regulation modification, the distribution of 5-methylcytosine (m5C) in high-grade serous ovarian cancer (HGSOC) remains unclear.<h4>Materials and methods</h4>We collected three pairs of human HGSOC tissues and adjacent non-tumour tissues to analyse the transcriptome-wide m5C methylation of messenger RNAs (mRNAs) by methylated RNA immunoprecipitation sequencing. Gene ontology (GO) enrichment analysis and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis were performed to eExplore the potential biological functions of these genes and important cancer pathways. We used immunohistochemistry to analyse the expression of the m5C modification regulatory gene MAP2K3 in 80 HGSOC tissue samples, and their associations with clinical parameters were analyzed using the Spearman-rho test. Univariate and multivariate Cox regression analyses were performed to identify potential prognostic factors. Kaplan-Meier analysis was performed to analyze overall survival.<h4>Results</h4>We identified 2050 dysregulated m5C peaks, 1767 of which were significantly upregulated, while 283 were significantly downregulated. GO enrichment analysis showed that genes altered by the m5C peak played a key role in system development, transporter complex, and transporter activity. KEGG pathway analysis revealed that these genes were enriched in some important pathways in cancer regulation, such as inflammatory mediator regulation of the TRP channels pathway, Wnt signalling pathway, and focal adhesion pathways. In addition, through joint analysis of MeRIP-seq and RNA-seq data, we identified 125 differentially methylated m5C peaks and synchronous differentially expressed genes. These genes play key roles in cell growth, maintenance, plasma membranes, and cell adhesion molecule activity. Immunohistochemical staining results showed that high expression of MAP2K3 was significantly correlated with CA125 level (p < 0.001), tumour size (p = 0.001), lymph node metastasis (p = 0.008), depth of myometrial invasion (p < 0.001), and FIGO stage (p < 0.001), indicating a poor prognosis.<h4>Conclusion</h4>Our results reveal the different distribution patterns of m5C in HGSOC and adjacent tissues and the possible involvement of m5C in HGSOC cell functions. Our study provides new insights into the epi-transcriptomic dysregulation of m5C in the tumourigenesis of HGSOC.

Also flagged:developmental encephalopathyNMDARsglycinebindingGluN1GluN2A
Journal Article 2021-08-03 ✓ 1 Snippet Zhang J, Tang W, Bhatia NK, Xu Y, Paudyal N, Liu D, Kim S, Song R, XiangWei W, Shaulsky G, Myers SJ, Dobyns W, Jayaraman V, Traynelis SF, Yuan H, Bozarth X.
In-Text Gene Mentions

…family history ofhemochromatosis.…

Show Full Abstract

<i>N</i>-Methyl-D-aspartate receptors (NMDARs) are highly expressed in brain and play important roles in neurodevelopment and various neuropathologic conditions. Here, we describe a new phenotype in an individual associated with a novel <i>de novo</i> deleterious variant in <i>GRIN1</i> (c.1595C>A, p.Pro532His). The clinical phenotype is characterized with developmental encephalopathy, striking stimulus-sensitive myoclonus, and frontal lobe and frontal white matter hypoplasia, with no apparent seizures detected. NMDARs that contained the P532H within the glycine-binding domain of GluN1 with either the GluN2A or GluN2B subunits were evaluated for changes in their pharmacological and biophysical properties, which surprisingly revealed only modest changes in glycine potency but a significant decrease in glutamate potency, an increase in sensitivity to endogenous zinc inhibition, a decrease in response to maximally effective concentrations of agonists, a shortened synaptic-like response time course, a decreased channel open probability, and a reduced receptor cell surface expression. Molecule dynamics simulations suggested that the variant can lead to additional interactions across the dimer interface in the agonist-binding domains, resulting in a more open GluN2 agonist-binding domain cleft, which was also confirmed by single-molecule fluorescence resonance energy transfer measurements. Based on the functional deficits identified, several positive modulators were evaluated to explore potential rescue pharmacology.

Also flagged:Cyclodextrinsanionscyclodextrin glucanotransferasecyclodextrinbindingsalts
Journal Article 2021-08-03 No Snippets Erichsen A, Larsen D, Beeren SR.
Show Full Abstract

We demonstrate how different anions from across the Hofmeister series can influence the behavior of enzyme-mediated dynamic combinatorial libraries of cyclodextrins (CDs). Using cyclodextrin glucanotransferase to catalyze reversible transglycosylation, dynamic mixtures of interconverting cyclodextrins can be formed wherein the relative concentrations of α-CD, β-CD and γ-CD is determined by their intrinsic stabilities and any stabilizing influences of added template (guest) molecules. Here, we find that addition of high concentrations of kosmotropic anions can be used to enhance the effects of added hydrophobic templates, while chaotropic anions can themselves act as templates, causing predictable and significant changes in the cyclodextrin composition due to weak, but specific, binding interactions with α-CD.

Also flagged:intestinal diseasestumorcancerbiomoleculedigestionexcretion
Journal Article 2021-08-03 ✓ 1 Snippet Zhang MM, Yang KL, Cui YC, Zhou YS, Zhang HR, Wang Q, Ye YJ, Wang S, Jiang KW.
In-Text Gene Mentions

…the ISC markerOLFM4was expressed at…

Show Full Abstract

Currently, research on intestinal diseases is mainly based on animal models and cell lines in monolayers. However, these models have drawbacks that limit scientific advances in this field. Three-dimensional (3D) culture systems named organoids are emerging as a reliable research tool for recapitulating the human intestinal epithelium and represent a unique platform for patient-specific drug testing. Intestinal organoids (IOs) are crypt-villus structures that can be derived from adult intestinal stem cells (ISCs), embryonic stem cells (ESCs), or induced pluripotent stem cells (iPSCs) and have the potential to serve as a platform for individualized medicine and research. However, this emerging field has not been bibliometric summarized to date. Here, we performed a bibliometric analysis of the Web of Science Core Collection (WoSCC) database to evaluate 5,379 publications concerning the use of organoids; the studies were divided into four clusters associated with the current situation and future directions for the application of IOs. Based on the results of our bibliometric analysis of IO applications, we systematically summarized the latest advances and analyzed the limitations and prospects.

Also flagged:FrizzledWntneurogenesisaxon guidancesynapselocalisation
Journal Article 2021-08-03 No Snippets Pascual-Vargas P, Salinas PC.
Show Full Abstract

The Wnt pathway is a key signalling cascade that regulates the formation and function of neuronal circuits. The main receptors for Wnts are Frizzled (Fzd) that mediate diverse functions such as neurogenesis, axon guidance, dendritogenesis, synapse formation, and synaptic plasticity. These processes are crucial for the assembly of functional neuronal circuits required for diverse functions ranging from sensory and motor tasks to cognitive performance. Indeed, aberrant Wnt-Fzd signalling has been associated with synaptic defects during development and in neurodegenerative conditions such as Alzheimer's disease. New studies suggest that the localisation and stability of Fzd receptors play a crucial role in determining Wnt function. Post-translational modifications (PTMs) of Fzd are emerging as an important mechanism that regulates these Wnt receptors. However, only phosphorylation and glycosylation have been described to modulate Fzd function in the central nervous system (CNS). In this review, we discuss the function of Fzd in neuronal circuit connectivity and how PTMs contribute to their function. We also discuss other PTMs, not yet described in the CNS, and how they might modulate the function of Fzd in neuronal connectivity. PTMs could modulate Fzd function by affecting Fzd localisation and stability at the plasma membrane resulting in local effects of Wnt signalling, a feature particularly important in polarised cells such as neurons. Our review highlights the importance of further studies into the role of PTMs on Fzd receptors in the context of neuronal connectivity.

Also flagged:TumorGNRHMAPKECMSTATMYC
Journal Article 2021-08-03 ✓ 3 Snippets Yue T, Zuo S, Zhu J, Guo S, Huang Z, Li J, Wang X, Liu Y, Chen S, Wang P.
In-Text Gene Mentions

In Figure 5A, ABCA8, LUM, SPARC, LRRC32, RBMS3, ZNF521, SHC4, and PLCL1 were independent prognostic factors for STAD patients (P < 0.05).

…SHC4, HEG1, andPLCL1between STAD and…

…ZNF521, SHC4, andPLCL1were independent prognostic…

Show Full Abstract

<h4>Background</h4>Globally, stomach adenocarcinoma (STAD)'s high morbidity and mortality should arouse our urgent attention. How long can STAD patients survive after surgery and whether novel immunotherapy is effective are questions that our clinicians cannot escape.<h4>Methods</h4>Various R packages, GSEA software, Metascape, STRING, Cytoscape, Venn diagram, TIMER2.0 website, TCGA, and GEO databases were used in our study.<h4>Results</h4>In the TCGA and GEO, macrophage abundance of STAD tissues was significantly higher than that of adjacent tissues and was an independent prognostic factor, significantly related to the overall survival (OS) of STAD patients. Between the high- and low- macrophage abundance, we conducted differential expression, univariate and multivariate Cox analysis, and obtained 12 candidate genes, and finally constructed a 3-gene signature. Both low macrophage abundance group and group D had higher TMB and PD-L1 expression. Furthermore, top 5 common gene-mutated STAD tissues had lower macrophage abundance. Macrophage abundance and 3 key genes expression were also lower in the Epstein-Barr Virus (EBV) and HM-indel STAD subtypes and significantly correlated with the tumor microenvironment score. The functional enrichment and ssGSEA revealed 2 signatures were similar and closely related to BOQUEST_STEM_CELL_UP, including genes up-regulated in proliferative stromal stem cells. Hsa-miR-335-5p simultaneously regulated 3 key genes and significantly related to the expression of PD-L1, CD8A and PDCD1.<h4>Conclusion</h4>macrophage abundance and 3-gene signature could simultaneously predict the OS and immunotherapy efficacy, and both 2 signatures had remarkable similarities. Hsa-miR-335-5p and BOQUEST_STEM_CELL_UP might be novel immunotherapy targets.

Also flagged:Peroxiredoxinspathogenesiscardiovascular diseaseCVDoxygensuperoxide dismutases
Journal Article 2021-08-03 ✓ 1 Snippet Jeong SJ, Park JG, Oh GT.
In-Text Gene Mentions

The overexpression of Prdx6 in ECs prevents AngII-induced inflammation, OS, and endothelial dysfunction via inactivation of the p38 MAPK and c-Jun N-terminal kinase pathways [122].

Show Full Abstract

Increased oxidative stress (OS) is considered a common etiology in the pathogenesis of cardiovascular disease (CVD). Therefore, the precise regulation of reactive oxygen species (ROS) in cardiovascular cells is essential to maintain normal physiological functions. Numerous regulators of cellular homeostasis are reportedly influenced by ROS. Hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>), as an endogenous ROS in aerobic cells, is a toxic substance that can induce OS. However, many studies conducted over the past two decades have provided substantial evidence that H<sub>2</sub>O<sub>2</sub> acts as a diffusible intracellular signaling messenger. Antioxidant enzymes, including superoxide dismutases, catalase, glutathione peroxidases, and peroxiredoxins (Prdxs), maintain the balance of ROS levels against augmentation of ROS production during the pathogenesis of CVD. Especially, Prdxs are regulatory sensors of transduced intracellular signals. The intracellular abundance of Prdxs that specifically react with H<sub>2</sub>O<sub>2</sub> act as regulatory proteins. In this review, we focus on the role of Prdxs in the regulation of ROS-induced pathological changes in the development of CVD.

Also flagged:tumorhepatocellular carcinomacirrhosiscytoplasmtumorscapsule
Journal Article 2021-08-03 ✓ 1 Snippet Wong M, Kim JT, Cox B, Larson BK, Kim S, Waters KM, Vail E, Guindi M.
In-Text Gene Mentions

…(n = 2),hemochromatosis(n = 1)…

Show Full Abstract

While researchers know that tumor mutational burden (TMB) is low in hepatocellular carcinoma (HCC), prior studies have not investigated TMB in cirrhosis, small early HCC and progressed HCC. HCC (n = 18) and cirrhosis (n = 6) cases were identified. TMB was determined by a 1.7 megabase, 409-gene next-generation sequencing panel. TMB values were defined as the number of nonsynonymous variants per megabase of sequence. There was no significant difference between cirrhosis versus small early HCC or between cohorts when stratified by size, early versus progressed, differentiation or morphology. There was a significant difference between cirrhosis and small early HCC versus progressed HCC (p = 0.045), suggesting TMB may be related to HCC progression. TMB similarities in small early HCC and background cirrhosis suggest TMB is not a useful tool for diagnosing small early HCC. Additional study is needed to address TMB in histological and molecular subsets of HCC.

bioRxiv 2021-08-03 Preprint (No Snippets API) Hurlburt NK, Homad LJ, Sinha I, Jennewein MF, MacCamy AJ, Wan Y, Boonyaratanakornkit J, Sholukh AM, Zhou P, Burton DR, Andrabi R, Stamatatos L, Pancera M, McGuire AT.
Show Full Abstract

Three highly pathogenic betacoronaviruses have crossed the species barrier and established human-to-human transmission causing significant morbidity and mortality in the past 20 years. The most current and widespread of these is SARS-CoV-2. The identification of CoVs with zoonotic potential in animal reservoirs suggests that additional outbreaks are likely to occur. Evidence suggests that neutralizing antibodies are important for protection against infection with CoVs. Monoclonal antibodies targeting conserved neutralizing epitopes on diverse CoVs can form the basis for prophylaxis and therapeutic treatments and enable the design of vaccines aimed at providing pan-coronavirus protection. To this end, we previously identified a neutralizing monoclonal antibody, CV3-25 that binds to the SARS-CoV-2 fusion machinery, neutralizes the SARS-CoV-2 Beta variant comparably to the ancestral Wuhan Hu-1 strain, cross neutralizes SARS-CoV-1 and displays cross reactive binding to recombinant proteins derived from the spike-ectodomains of HCoV-OC43 and HCoV-HKU1. Here, we show that the neutralizing activity of CV3-25 is also maintained against the Alpha, Delta and Gamma variants of concern as well as a SARS-CoV-like bat coronavirus with zoonotic potential by binding to a conserved linear peptide in the stem-helix region on sarbecovirus spikes. A 1.74Å crystal structure of a CV3-25/peptide complex demonstrates that CV3-25 binds to the base of the stem helix at the HR2 boundary to an epitope that is distinct from other stem-helix directed neutralizing mAbs. Thus, CV3-25 defines a novel site of sarbecovirus vulnerability that will inform pan-CoV vaccine development.

Also flagged:leukemiaMLLRNA polymerase IIp300CBPhistone
Journal Article 2021-08-02 No Snippets Yokoyama A.
Show Full Abstract

Homeostasis of the hematopoietic system is achieved in a hierarchy, with hematopoietic stem cells at the pinnacle. Because only hematopoietic stem cells (HSCs) can self-renew, the size of the hematopoietic system is strictly controlled. In hematopoietic reconstitution experiments, 1 HSC can reconstitute the entire hematopoietic system, whereas 50 multipotent progenitors cannot. This indicates that only HSCs self-renew, whereas non-HSC hematopoietic progenitors are programmed to differentiate or senesce. Oncogenic mutations of the mixed lineage leukemia gene (MLL) overcome this "programmed differentiation" by conferring the self-renewing ability to non-HSC hematopoietic progenitors. In leukemia, mutated MLL proteins constitutively activate a broad range of previously transcribed CpG-rich promoters by an MLL-mediated transcriptional activation system. This system promotes self-renewal by replicating an expression profile similar to that of the mother cell in its daughter cells. In this transcriptional activation system, MLL binds to unmethylated CpG-rich promoters and recruits RNA polymerase II. MLL recruits p300/CBP through its transcriptional activation domain, which acetylates histone H3 at lysines 9, 18, and 27. The AF4 family/ENL family/P-TEFb complex (AEP) binds to acetylated H3K9/18/27 to activate transcription. Gene rearrangements of MLL with AEP- or CBP/p300-complex components generate constitutively active transcriptional machinery of this transcriptional activation system, which causes aberrant self-renewal of leukemia stem cells. Inhibitors of the components of this system effectively decrease their leukemogenic potential.

Also flagged:GSK3αAT8GAPDHBACESunSYN1
Journal Article 2021-08-02 ✓ 2 Snippets Chen X, Sun G, Tian E, Zhang M, Davtyan H, Beach TG, Reiman EM, Blurton-Jones M, Holtzman DM, Shi Y.
In-Text Gene Mentions

…repeat‐containing protein 7 (LRRC7), and leucine‐rich repeat…

…1 (NEAT1), peroxiredoxin‐6 (PRDX6), NACHT, LRR, and…

Show Full Abstract

Alzheimer's disease (AD) is a progressive neurodegenerative disease with no cure. Huge efforts have been made to develop anti-AD drugs in the past decades. However, all drug development programs for disease-modifying therapies have failed. Possible reasons for the high failure rate include incomplete understanding of complex pathophysiology of AD, especially sporadic AD (sAD), and species difference between humans and animal models used in preclinical studies. In this study, sAD is modeled using human induced pluripotent stem cell (hiPSC)-derived 3D brain organoids. Because the blood-brain barrier (BBB) leakage is a well-known risk factor for AD, brain organoids are exposed to human serum to mimic the serum exposure consequence of BBB breakdown in AD patient brains. The serum-exposed brain organoids are able to recapitulate AD-like pathologies, including increased amyloid beta (Aβ) aggregates and phosphorylated microtubule-associated tau protein (p-Tau) level, synaptic loss, and impaired neural network. Serum exposure increases Aβ and p-Tau levels through inducing beta-secretase 1 (BACE) and glycogen synthase kinase-3 alpha / beta (GSK3α/β) levels, respectively. In addition, single-cell transcriptomic analysis of brain organoids reveals that serum exposure reduced synaptic function in both neurons and astrocytes and induced immune response in astrocytes. The human brain organoid-based sAD model established in this study can provide a powerful platform for both mechanistic study and therapeutic development in the future.

Also flagged:insulinironinsulin resistancemitochondrialexporterFpn
Journal Article 2021-08-02 ✓ 1 Snippet Winn NC, Wolf EM, Cottam MA, Bhanot M, Hasty AH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Tissue iron overload is associated with insulin resistance and mitochondrial dysfunction in rodents and humans; however, the mechanisms or cell types that mediate this phenotype are not completely understood. Macrophages (Mɸs) are known to contribute to iron handling; thus, we hypothesized that perturbed iron handling by Mɸs impairs mitochondrial energetics and evokes systemic insulin resistance in mice. Male and female mice with myeloid-targeted (LysMCre) deletion of the canonical iron exporter, ferroportin (Fpn, encoded by <i>Slc40a1</i>), floxed littermates, and C57BL/6J wild-type mice were used to test our hypotheses. Myeloid-targeted deletion of Fpn evoked multitissue iron accumulation and reduced mitochondrial respiration in bone marrow-derived Mɸs, liver leukocytes, and Mɸ-enriched populations from adipose tissue (AT). In addition, a single bolus of exogenous iron administered to C57BL/6J mice phenocopied the loss of Fpn, resulting in a reduction in maximal and mitochondrial reserve capacity in Mɸ-enriched cellular fractions from liver and AT. In vivo exogenous iron chelation restored mitochondrial reserve capacity in liver leukocytes from Fpn LysMCre mice, but had no effect in AT myeloid populations. However, despite the impairments in mitochondrial respiration, neither loss of myeloid-specific Fpn nor exogenous iron overload perturbed glucose homeostasis or systemic insulin action in lean or obese mice, whereas aging coupled with lifelong loss of Fpn unmasked glucose intolerance. Together these data demonstrate that iron handling is critical for the maintenance of macrophage mitochondrial function, but perturbing myeloid iron flux via the loss of Fpn action is not sufficient to evoke systemic insulin resistance in young adult mice. These findings also suggest that if Mɸs are capable of storing iron properly, they have a pronounced ability to withstand iron excess without evoking overt collateral damage and associated insulin resistance that may be age dependent.<b>NEW & NOTEWORTHY</b> We used myeloid-specific knockout of ferroportin to determine whether macrophage iron enrichment alters systemic metabolism. We found that macrophages in several tissues showed mitochondrial defects such as a reduction in mitochondrial reserve capacity. However, insulin action in the mice was preserved. These findings also suggest that Mɸs have a pronounced ability to withstand iron excess without evoking overt collateral damage and associated insulin resistance, which appears to be age dependent.

Also flagged:GABARAPL1AHLRHDVinculinaminodoxycycline
Journal Article 2021-08-02 ✓ 1 Snippet Reggio A, Buonomo V, Berkane R, Bhaskara RM, Tellechea M, Peluso I, Polishchuk E, Di Lorenzo G, Cirillo C, Esposito M, Hussain A, Huebner AK, Hübner CA, Settembre C, Hummer G, Grumati P, Stolz A.
In-Text Gene Mentions

…FAM134B, SEC62, RTN3,CCPG1, ATL3, and TEX264…

Show Full Abstract

Degradation of the endoplasmic reticulum (ER) via selective autophagy (ER-phagy) is vital for cellular homeostasis. We identify FAM134A/RETREG2 and FAM134C/RETREG3 as ER-phagy receptors, which predominantly exist in an inactive state under basal conditions. Upon autophagy induction and ER stress signal, they can induce significant ER fragmentation and subsequent lysosomal degradation. FAM134A, FAM134B/RETREG1, and FAM134C are essential for maintaining ER morphology in a LC3-interacting region (LIR)-dependent manner. Overexpression of any FAM134 paralogue has the capacity to significantly augment the general ER-phagy flux upon starvation or ER-stress. Global proteomic analysis of FAM134 overexpressing and knockout cell lines reveals several protein clusters that are distinctly regulated by each of the FAM134 paralogues as well as a cluster of commonly regulated ER-resident proteins. Utilizing pro-Collagen I, as a shared ER-phagy substrate, we observe that FAM134A acts in a LIR-independent manner and compensates for the loss of FAM134B and FAM134C, respectively. FAM134C instead is unable to compensate for the loss of its paralogues. Taken together, our data show that FAM134 paralogues contribute to common and unique ER-phagy pathways.

Also flagged:ironcognitive impairmentcognitionAFdementiamild cognitive impairment
Journal Article 2021-08-02 ✓ 2 Snippets Gong Z, Song W, Gu M, Zhou X, Tian C.
In-Text Gene Mentions

…regulating genes likeHFEhave significant clinical…

…impairment assessed byhemochromatosisC282Y genotype […

Show Full Abstract

Epidemiological evidence on peripheral iron and cognitive impairment in older adults is sparse and limited. Results on serum iron and cognitive impairment in older adults from the National Health and Nutrition Examination Survey have not been reported. Data on serum iron and cognitive impairment from individuals ≥ 60 years of age were obtained from the 2011-2014 NHANES (N = 3,131). Serum iron concentrations were determined with DcX800 method. Cognitive impairment was assessed with four cognitive tests: the Digit Symbol Substitution Test (DSST), the Animal Fluency (AF), the Consortium to Establish a Registry for Alzheimer's Disease Delayed Recall (CERAD-DR) and Word Learning (CERAD-WL) tests. Logistic regression and restricted cubic splines were adopted to explore the dose-response relationship between serum iron concentrations and cognitive impairment. Comparing the highest to lowest tertile of serum iron concentrations, the multivariate-adjusted odds ratios of scoring low on the DSST were 0.70 (0.49-1.00), 0.88 (0.65-1.20) for CERAD-WL, 0.65 (0.48-0.88) for CERAD-DR, and 0.78 (0.53-1.15) for AF. Stratified analyses by sex showed that the above-mentioned associations were mainly found in men; however, the interaction with sex was not significant. Dose-response analysis showed that relationships between serum iron and cognitive impairment evaluated by DSST and CERAD-DR were linear, respectively.

Also flagged:acute lymphoblastic leukemiaALLhematological neoplasmpairingGene expressionCDKN2A
Journal Article 2021-08-02 ✓ 5 Snippets Walter W, Shahswar R, Stengel A, Meggendorfer M, Kern W, Haferlach T, Haferlach C.
In-Text Gene Mentions

In addition, WTS detected three other known fusion partners of KMT2A (MLLT10, MLLT1, and USP2), each in a different case, but missed one KMT2A-EPS15 fusion, assigning 76/211 BCP-ALL samples to their respective subgroups.

Known fusion transcripts in the T-ALL cohort mainly involved MLLT10 (n = 3) and genes encoding for proteins of the nuclear pore complex (n = 5).

…partners of KMT2A (MLLT10, MLLT1 ,…

…the KMT2A -MLLT10fusion transcript and…

…cohort mainly involvedMLLT10(n = 3)…

Show Full Abstract

<h4>Background</h4>Considering the clinical and genetic characteristics, acute lymphoblastic leukemia (ALL) is a rather heterogeneous hematological neoplasm for which current standard diagnostics require various analyses encompassing morphology, immunophenotyping, cytogenetics, and molecular analysis of gene fusions and mutations. Hence, it would be desirable to rely on a technique and an analytical workflow that allows the simultaneous analysis and identification of all the genetic alterations in a single approach. Moreover, based on the results with standard methods, a significant amount of patients have no established abnormalities and hence, cannot further be stratified.<h4>Methods</h4>We performed WTS and WGS in 279 acute lymphoblastic leukemia (ALL) patients (B-cell: n = 211; T-cell: n = 68) to assess the accuracy of WTS, to detect relevant genetic markers, and to classify ALL patients.<h4>Results</h4>DNA and RNA-based genotyping was used to ensure correct WTS-WGS pairing. Gene expression analysis reliably assigned samples to the B Cell Precursor (BCP)-ALL or the T-ALL group. Subclassification of BCP-ALL samples was done progressively, assessing first the presence of chromosomal rearrangements by the means of fusion detection. Compared to the standard methods, 97% of the recurrent risk-stratifying fusions could be identified by WTS, assigning 76 samples to their respective entities. Additionally, read-through fusions (indicative of CDKN2A and RB1 gene deletions) were recurrently detected in the cohort along with 57 putative novel fusions, with yet untouched diagnostic potentials. Next, copy number variations were inferred from WTS data to identify relevant ploidy groups, classifying an additional of 31 samples. Lastly, gene expression profiling detected a BCR-ABL1-like signature in 27% of the remaining samples.<h4>Conclusion</h4>As a single assay, WTS allowed a precise genetic classification for the majority of BCP-ALL patients, and is superior to conventional methods in the cases which lack entity defining genetic abnormalities.

Also flagged:SPCEWSR1FLI1tumorsEwingEwing sarcoma
Journal Article 2021-08-02 ✓ 1 Snippet Sole A, Grossetête S, Heintzé M, Babin L, Zaïdi S, Revy P, Renouf B, De Cian A, Giovannangeli C, Pierre-Eugène C, Janoueix-Lerosey I, Couronné L, Kaltenbach S, Tomishima M, Jasin M, Grünewald TGP, Delattre O, Surdez D, Brunet E.
In-Text Gene Mentions

SOX6

Show Full Abstract

Ewing sarcoma is characterized by pathognomonic translocations, most frequently fusing <i>EWSR1</i> with <i>FLI1</i>. An estimated 30% of Ewing sarcoma tumors also display genetic alterations in <i>STAG2</i>, <i>TP53</i>, or <i>CDKN2A</i> (<i>SPC</i>). Numerous attempts to develop relevant Ewing sarcoma models from primary human cells have been unsuccessful in faithfully recapitulating the phenotypic, transcriptomic, and epigenetic features of Ewing sarcoma. In this study, by engineering the t(11;22)(q24;q12) translocation together with a combination of SPC mutations, we generated a wide collection of immortalized cells (EWIma cells) tolerating EWSR1-FLI1 expression from primary mesenchymal stem cells (MSC) derived from a patient with Ewing sarcoma. Within this model, <i>SPC</i> alterations strongly favored Ewing sarcoma oncogenicity. Xenograft experiments with independent EWIma cells induced tumors and metastases in mice, which displayed <i>bona fide</i> features of Ewing sarcoma. EWIma cells presented balanced but also more complex translocation profiles mimicking chromoplexy, which is frequently observed in Ewing sarcoma and other cancers. Collectively, these results demonstrate that bone marrow-derived MSCs are a source of origin for Ewing sarcoma and also provide original experimental models to investigate Ewing sarcomagenesis. SIGNIFICANCE: These findings demonstrate that Ewing sarcoma can originate from human bone-marrow-derived mesenchymal stem cells and that recurrent mutations support EWSR1-FLI1 translocation-mediated transformation.

Also flagged:AD-3AD-2Progressive dementiaAD-1memoryCBL
Journal Article 2021-08-02 ✓ 5 Snippets Lovergne L, Ghosh D, Schuck R, Polyzos AA, Chen AD, Martin MC, Barnard ES, Brown JB, McMurray CT.
In-Text Gene Mentions

htt

Although the astrocyte cell lines from WT and HD animals retained expression of the huntingtin (htt) or mhtt protein, respectively (Fig. 3f, shown are CBL and STR: Supplementary Fig. 1c), there were no physical cues to classify these cells as normal or disease.

…used were mouse anti-Htt(Millipore #MAB-2166)(htt), mo…

…nti-Htt (Millipore #MAB-2166)(htt), mouse anti-polyQ (DSHB…

…of the huntingtin (htt) or mhtt protein,…

Show Full Abstract

Although some neurodegenerative diseases can be identified by behavioral characteristics relatively late in disease progression, we currently lack methods to predict who has developed disease before the onset of symptoms, when onset will occur, or the outcome of therapeutics. New biomarkers are needed. Here we describe spectral phenotyping, a new kind of biomarker that makes disease predictions based on chemical rather than biological endpoints in cells. Spectral phenotyping uses Fourier Transform Infrared (FTIR) spectromicroscopy to produce an absorbance signature as a rapid physiological indicator of disease state. FTIR spectromicroscopy has over the past been used in differential diagnoses of manifest disease. Here, we report that the unique FTIR chemical signature accurately predicts disease class in mouse with high probability in the absence of brain pathology. In human cells, the FTIR biomarker accurately predicts neurodegenerative disease class using fibroblasts as surrogate cells.

Also flagged:nucleocytoplasmic transportSUB1GFPSRSF1importin-13His6
Journal Article 2021-08-02 ✓ 3 Snippets Kimura M, Imai K, Morinaka Y, Hosono-Sakuma Y, Horton P, Imamoto N.
In-Text Gene Mentions

…helicases DDX5 andDDX27(Supplementary Table S3…

…DDX5 andDDX27are a homologous…

…Thus, DDX5 andDDX27are likely to…

Show Full Abstract

Importin-(Imp)β family nucleocytoplasmic transport receptors (NTRs) are supposed to bind to their cargoes through interaction between a confined interface on an NTR and a nuclear localization or export signal (NLS/NES) on a cargo. Although consensus NLS/NES sequence motifs have been defined for cargoes of some NTRs, many experimentally identified cargoes of those NTRs lack those motifs, and consensus NLSs/NESs have been reported for only a few NTRs. Crystal structures of NTR-cargo complexes have exemplified 3D structure-dependent binding of cargoes lacking a consensus NLS/NES to different sites on an NTR. Since only a limited number of NTR-cargo interactions have been studied, whether most cargoes lacking a consensus NLS/NES bind to the same confined interface or to various sites on an NTR is still unclear. Addressing this issue, we generated four mutants of transportin-(Trn)SR, of which many cargoes lack a consensus NLS, and eight mutants of Imp13, where no consensus NLS has been defined, and we analyzed their binding to as many as 40 cargo candidates that we previously identified by a nuclear import reaction-based method. The cargoes bind differently to the NTR mutants, suggesting that positions on an NTR contribute differently to the binding of respective cargoes.

Also flagged:Crohn's diseaseDDSMalabsorptionTrisomypeptideC31
Journal Article 2021-08-02 No Snippets Hernández-Olivos R, Muñoz M, Núñez E, Camargo-Ayala PA, Garcia-Huidobro J, Pereira A, Nachtigall FM, Santos LS, Rivera C.
Show Full Abstract

There are currently no preventative options for recurrent aphthous stomatitis, and the only available treatments are palliative. This is partly due to a poor understanding of its etiopathogenesis. In this case-control study, we characterized the salivary proteome of patients with recurrent aphthous stomatitis in the presence and absence of lesions. Through mass spectrometry-based proteomics and bioinformatics tools, we identified that the presence of oral ulcers is associated with several specific biological processes, including the metabolic pathways of vitamin B9, B12, nitrogen, selenium, and the bacterium Neisseria meningitidis. These changes occurred only in the presence of clinically visible lesions, and there were no relevant differences between patients in anatomical regions unaffected by ulcers. Additionally, using western blot and ELISA assays, we verified that carbonic anhydrase 1 (CA1) and hemoglobin subunit beta (HBB) proteins are highly expressed during the ulcerative and remission phases of recurrent aphthous stomatitis. Our results cumulatively support saliva as an indicator of the pathophysiological changes, which occur during the clinical course of lesions. From a clinical perspective, we suggest that recurrent aphthous stomatitis is a condition triggered by temporary biological changes in people with lesions.

Also flagged:ProlylProlineHIF-2αPI3KThrSARS
Journal Article 2021-08-02 ✓ 1 Snippet Cordero-Espinoza L, Dowbaj AM, Kohler TN, Strauss B, Sarlidou O, Belenguer G, Pacini C, Martins NP, Dobie R, Wilson-Kanamori JR, Butler R, Prior N, Serup P, Jug F, Henderson NC, Hollfelder F, Huch M.
In-Text Gene Mentions

HFE

Show Full Abstract

In the liver, ductal cells rarely proliferate during homeostasis but do so transiently after tissue injury. These cells can be expanded as organoids that recapitulate several of the cell-autonomous mechanisms of regeneration but lack the stromal interactions of the native tissue. Here, using organoid co-cultures that recapitulate the ductal-to-mesenchymal cell architecture of the portal tract, we demonstrate that a subpopulation of mouse periportal mesenchymal cells exerts dual control on proliferation of the epithelium. Ductal cell proliferation is either induced and sustained or, conversely, completely abolished, depending on the number of direct mesenchymal cell contacts, through a mechanism mediated, at least in part, by Notch signaling. Our findings expand the concept of the cellular niche in epithelial tissues, whereby not only soluble factors but also cell-cell contacts are the key regulatory cues involved in the control of cellular behaviors, suggesting a critical role for cell-cell contacts during regeneration.

Also flagged:CXCR6tumorstumorchemokine receptorCXCL16immune responses
Journal Article 2021-08-02 ✓ 1 Snippet Di Pilato M, Kfuri-Rubens R, Pruessmann JN, Ozga AJ, Messemaker M, Cadilha BL, Sivakumar R, Cianciaruso C, Warner RD, Marangoni F, Carrizosa E, Lesch S, Billingsley J, Perez-Ramos D, Zavala F, Rheinbay E, Luster AD, Gerner MY, Kobold S, Pittet MJ, Mempel TR.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Cytotoxic T lymphocyte (CTL) responses against tumors are maintained by stem-like memory cells that self-renew but also give rise to effector-like cells. The latter gradually lose their anti-tumor activity and acquire an epigenetically fixed, hypofunctional state, leading to tumor tolerance. Here, we show that the conversion of stem-like into effector-like CTLs involves a major chemotactic reprogramming that includes the upregulation of chemokine receptor CXCR6. This receptor positions effector-like CTLs in a discrete perivascular niche of the tumor stroma that is densely occupied by CCR7<sup>+</sup> dendritic cells (DCs) expressing the CXCR6 ligand CXCL16. CCR7<sup>+</sup> DCs also express and trans-present the survival cytokine interleukin-15 (IL-15). CXCR6 expression and IL-15 trans-presentation are critical for the survival and local expansion of effector-like CTLs in the tumor microenvironment to maximize their anti-tumor activity before progressing to irreversible dysfunction. These observations reveal a cellular and molecular checkpoint that determines the magnitude and outcome of anti-tumor immune responses.

Also flagged:adhesive capsulitisACgene expressiondiabetes mellitusdiabetescapsule
Journal Article 2021-08-02 No Snippets Gordon JA, Farooqi AS, Rabut E, Huffman GR, Schug J, Kelly JD, Dodge GR.
Show Full Abstract

<h4>Background</h4>Diabetic patients have a greater incidence of adhesive capsulitis (AC) and a more protracted disease course than patients with idiopathic AC. The purpose of this study was to compare gene expression differences between AC with diabetes mellitus and AC without diabetes mellitus.<h4>Methods</h4>Shoulder capsule samples were prospectively obtained from diabetic or nondiabetic patients who presented with shoulder dysfunction and underwent arthroscopy (N = 16). Shoulder samples of AC with and without diabetes (n = 8) were compared with normal shoulder samples with and without diabetes as the control group (n = 8). Shoulder capsule samples were subjected to whole-transcriptome RNA sequencing, and differential expression was analyzed with EdgeR. Only genes with a false discovery rate < 5% were included for further functional enrichment analysis.<h4>Results</h4>The sample population had a mean age of 47 years (range, 24-62 years), and the mean hemoglobin A<sub>1c</sub> level for nondiabetic and diabetic patients was 5.18% and 8.71%, respectively. RNA-sequencing analysis revealed that 66 genes were differentially expressed between diabetic patients and nondiabetic patients with AC whereas only 3 genes were differentially expressed when control patients with and without diabetes were compared. Furthermore, 286 genes were differentially expressed in idiopathic AC patients, and 61 genes were differentially expressed in diabetic AC patients. On gene clustering analysis, idiopathic AC was enriched with multiple structural and muscle-related pathways, such as muscle filament sliding, whereas diabetic AC included a greater number of hormonal and inflammatory signaling pathways, such as cellular response to corticotropin-releasing factor.<h4>Conclusions</h4>Whole-transcriptome expression profiles demonstrate a fundamentally different underlying pathophysiology when comparing diabetic AC with idiopathic AC, suggesting that these conditions are distinct clinical entities. The new genes expressed explain the differences in the disease course and suggest new therapeutic targets that may lead to different treatment paradigms in these 2 subsets.

Also flagged:Neurodegenerative diseasesAgingADPDHDcognitive impairment
Journal Article 2021-08-02 ✓ 1 Snippet Baloni P, Funk CC, Readhead B, Price ND.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Neurodegenerative diseases (NDDs) encompass a wide range of conditions that arise owing to progressive degeneration and the ultimate loss of nerve cells in the brain and peripheral nervous system. NDDs such as Alzheimer's, Parkinson's, and Huntington's diseases negatively impact both length and quality of life, due to lack of effective disease-modifying treatments. Herein, we review the use of genome-scale metabolic models, network-based approaches, and integration with multiomics data to identify key biological processes that characterize NDDs. We describe powerful systems biology approaches for modeling NDD pathophysiology by leveraging in silico models that are informed by patient-derived multiomics data. These approaches can enable mechanistic insights into NDD-specific metabolic dysregulations that can be leveraged to identify potential metabolic markers of disease and predisease states.

Also flagged:ACCadrenal tumorstumorsHNRNPA1C8ACHMP6
Journal Article 2021-08-02 No Snippets Jang HN, Moon SJ, Jung KC, Kim SW, Kim H, Han D, Kim JH.
Show Full Abstract

Adrenal cortical carcinoma (ACC) is an extremely rare disease with a variable prognosis. Current prognostic markers have limitations in identifying patients with a poor prognosis. Herein, we aimed to investigate the prognostic protein biomarkers of ACC using mass-spectrometry-based proteomics. We performed the liquid chromatography-tandem mass spectrometry (LC-MS/MS) using formalin-fixed paraffin-embedded (FFPE) tissues of 45 adrenal tumors. Then, we selected 117 differentially expressed proteins (DEPs) among tumors with different stages using the machine learning algorithm. Next, we conducted a survival analysis to assess whether the levels of DEPs were related to survival. Among 117 DEPs, HNRNPA1, C8A, CHMP6, LTBP4, SPR, NCEH1, MRPS23, POLDIP2, and WBSCR16 were significantly correlated with the survival of ACC. In age- and stage-adjusted Cox proportional hazard regression models, only HNRNPA1, LTBP4, MRPS23, POLDIP2, and WBSCR16 expression remained significant. These five proteins were also validated in TCGA data as the prognostic biomarkers. In this study, we found that HNRNPA1, LTBP4, MRPS23, POLDIP2, and WBSCR16 were protein biomarkers for predicting the prognosis of ACC.

Also flagged:Diabetic RetinopathytoinsulinglucoseangiogenesisVEGF
Journal Article 2021-08-02 No Snippets Yuan M, He Q, Long Z, Zhu X, Xiang W, Wu Y, Lin S.
Show Full Abstract

<h4>Objective</h4>To explore the pharmacological mechanism of Liuwei Dihuang decoction (LDD) for diabetic retinopathy (DR).<h4>Methods</h4>The potential targets of LDD were predicted by PharmMapper. GeneCards and other databases were used to collect DR genes. Cytoscape was used to construct and analyze network DR and LDD's network, and DAVID was used for Gene Ontology (GO) and pathway enrichment analysis. Finally, animal experiments were carried out to verify the results of systematic pharmacology.<h4>Results</h4>Five networks were constructed and analyzed: (1) diabetic retinopathy genes' PPI network; (2) compound-compound target network of LDD; (3) LDD-DR PPI network; (4) compound-known target network of LDD; (5) LDD known target-DR PPI network. Several DR and treatment-related targets, clusters, signaling pathways, and biological processes were found. Animal experiments found that LDD can improve the histopathological changes of the retina. LDD can also increase erythrocyte filtration rate and decrease the platelet adhesion rate (<i>P</i> < 0.05) and decrease MDA and TXB2 (<i>P</i> < 0.05). Compared with the model group, the retinal VEGF and HIF-1<i>α</i> expression in the LDD group decreased significantly (<i>P</i> < 0.05).<h4>Conclusion</h4>The therapeutic effect of LDD on DR may be achieved by interfering with the biological processes (such as response to insulin, glucose homeostasis, and regulation of angiogenesis) and signaling pathways (such as insulin, VEGF, HIF-1, and ErbB signaling pathway) related to the development of DR that was found in this research.

Also flagged:neurodegenerative diseasesCNS diseasesPDADHDamyotrophic lateral sclerosis
Journal Article 2021-08-02 No Snippets Wang Y, Zhang X, Chen F, Song N, Xie J.
Show Full Abstract

Partly because of extensions in lifespan, the incidence of neurodegenerative diseases is increasing, while there is no effective approach to slow or prevent neuronal degeneration. As we all know, neurons cannot self-regenerate and may not be replaced once being damaged or degenerated in human brain. Astrocytes are widely distributed in the central nervous system (CNS) and proliferate once CNS injury or neurodegeneration occur. Actually, direct reprogramming astrocytes into functional neurons has been attracting more and more attention in recent years. Human astrocytes can be successfully converted into neurons <i>in vitro</i>. Notably, <i>in vivo</i> direct reprogramming of astrocytes into functional neurons were achieved in the adult mouse and non-human primate brains. In this review, we briefly summarized <i>in vivo</i> direct reprogramming of astrocytes into functional neurons as regenerative strategies for CNS diseases, mainly focusing on neurodegenerative diseases such as Parkinson's disease (PD), Alzheimer's disease (AD), and Huntington's disease (HD). We highlight and outline the advantages and challenges of direct neuronal reprogramming from astrocytes <i>in vivo</i> for future neuroregenerative medicine.

Also flagged:Circulationdeathbrain developmentinfectionoxygenbrain injury
Journal Article 2021-08-02 No Snippets Eiby YA, Lingwood BE, Wright IMR.
Show Full Abstract

Preterm infants are at high risk of death and disability resulting from brain injury. Impaired cardiovascular function leading to poor cerebral oxygenation is a significant contributor to these adverse outcomes, but current therapeutic approaches have failed to improve outcome. We have re-examined existing evidence regarding hypovolemia and have concluded that in the preterm infant loss of plasma from the circulation results in hypovolemia; and that this is a significant driver of cardiovascular instability and thus poor cerebral oxygenation. High capillary permeability, altered hydrostatic and oncotic pressure gradients, and reduced lymphatic return all combine to increase net loss of plasma from the circulation at the capillary. Evidence is presented that early hypovolemia occurs in preterm infants, and that capillary permeability and pressure gradients all change in a way that promotes rapid plasma loss at the capillary. Impaired lymph flow, inflammation and some current treatment strategies may further exacerbate this plasma loss. A framework for testing this hypothesis is presented. Understanding these mechanisms opens the way to novel treatment strategies to support cardiovascular function and cerebral oxygenation, to replace current therapies, which have been shown not to change outcomes.

Also flagged:autophagyCancercyclin D1pancreatic cancerMelanomacarcinoma
Journal Article 2021-08-02 ✓ 1 Snippet Hussen BM, Azimi T, Abak A, Hidayat HJ, Taheri M, Ghafouri-Fard S.
In-Text Gene Mentions

CSE1L

Show Full Abstract

Being located in a gene desert region on 9q21.11-q21.12, BRAF-activated non-protein coding RNA (BANCR) is an lncRNA with 693 bp length. It has been discovered in 2012 in a research aimed at assessment of gene expression in the melanocytes in association with <i>BRAF</i> mutation. Increasing numbers of studies have determined its importance in the tumorigenesis through affecting cell proliferation, migration, invasion, apoptosis, and epithelial to mesenchymal transition. BANCR exerts its effects via modulating some tumor-related signaling pathways particularly MAPK and other regulatory mechanisms such as sponging miRNAs. BANCR has been up-regulated in endometrial, gastric, breast, melanoma, and retinoblastoma. Conversely, it has been down-regulated in some other cancers such as those originated from lung, bladder, and renal tissues. In some cancer types such as colorectal cancer, hepatocellular carcinoma and papillary thyroid carcinoma, there is no agreement about BANCR expression, necessitating the importance of additional functional studies in these tissues. In the present manuscript, we review the investigations related to BANCR expression changes in cancerous cell lines, clinical samples, and animal models of cancer. We also discuss the outcome of its deregulation in cancer progression, prognosis, and the underlying mechanisms of these observations.

Also flagged:Chondroitinsulfateglycosaminoglycanproteoglycansaxonalbrain trauma
Journal Article 2021-08-02 No Snippets Hayes AJ, Melrose J.
Show Full Abstract

Chondroitin sulfate (CS) is the most abundant and widely distributed glycosaminoglycan (GAG) in the human body. As a component of proteoglycans (PGs) it has numerous roles in matrix stabilization and cellular regulation. This chapter highlights the roles of CS and CS-PGs in the central and peripheral nervous systems (CNS/PNS). CS has specific cell regulatory roles that control tissue function and homeostasis. The CNS/PNS contains a diverse range of CS-PGs which direct the development of embryonic neural axonal networks, and the responses of neural cell populations in mature tissues to traumatic injury. Following brain trauma and spinal cord injury, a stabilizing CS-PG-rich scar tissue is laid down at the defect site to protect neural tissues, which are amongst the softest tissues of the human body. Unfortunately, the CS concentrated in gliotic scars also inhibits neural outgrowth and functional recovery. CS has well known inhibitory properties over neural behavior, and animal models of CNS/PNS injury have demonstrated that selective degradation of CS using chondroitinase improves neuronal functional recovery. CS-PGs are present diffusely in the CNS but also form denser regions of extracellular matrix termed perineuronal nets which surround neurons. Hyaluronan is immobilized in hyalectan CS-PG aggregates in these perineural structures, which provide neural protection, synapse, and neural plasticity, and have roles in memory and cognitive learning. Despite the generally inhibitory cues delivered by CS-A and CS-C, some CS-PGs containing highly charged CS disaccharides (CS-D, CS-E) or dermatan sulfate (DS) disaccharides that promote neural outgrowth and functional recovery. CS/DS thus has varied cell regulatory properties and structural ECM supportive roles in the CNS/PNS depending on the glycoform present and its location in tissue niches and specific cellular contexts. Studies on the fruit fly, <i>Drosophila melanogaster</i> and the nematode <i>Caenorhabditis elegans</i> have provided insightful information on neural interconnectivity and the role of the ECM and its PGs in neural development and in tissue morphogenesis in a whole organism environment.

Also flagged:EZH2EZH1EHMT2ADAMTSL1ZSWIM5infections
Journal Article 2021-08-02 ✓ 5 Snippets Kiser JN, Neibergs HL.
In-Text Gene Mentions

CA10

Like CA10, DISC1 has ties to both pulmonary disease and viral infections (50, 51).

Four additional positional candidate genes, carbonic anhydrase 10 (CA10), CWC22 spliceosome-associated protein (CWC22), DISC1 scaffold protein (DISC1), and nitric oxide synthase 1 adaptor protein (NOS1AP), have roles in pulmonary dysfunction, viral infections, or both.

…gene including AKAP9,CA10, CWC22, DISC1, LOC104969525,…

…anhydrase 10 (CA10), CWC22 spliceosome-associate…

Show Full Abstract

Bovine coronavirus (BCoV) is associated with respiratory and enteric infections in both dairy and beef cattle worldwide. It is also one of a complex of pathogens associated with bovine respiratory disease (BRD), which affects millions of cattle annually. The objectives of this study were to identify loci and heritability estimates associated with BCoV infection and BRD in dairy calves and feedlot cattle. Dairy calves from California (<i>n</i> = 1,938) and New Mexico (<i>n</i> = 647) and feedlot cattle from Colorado (<i>n</i> = 915) and Washington (<i>n</i> = 934) were tested for the presence of BCoV when classified as BRD cases or controls following the McGuirk scoring system. Two comparisons associated with BCoV were investigated: (1) cattle positive for BCoV (BCoV<sup>+</sup>) were compared to cattle negative for BCoV (BCoV<sup>-</sup>) and (2) cattle positive for BCoV and affected with BRD (BCoV<sup>+</sup>BRD<sup>+</sup>) were compared to cattle negative for BCoV and BRD (BCoV<sup>-</sup>BRD<sup>-</sup>). The Illumina BovineHD BeadChip was used for genotyping, and genome-wide association analyses (GWAA) were performed using EMMAX (efficient mixed-model association eXpedited). The GWAA for BCoV<sup>+</sup> identified 51 loci (<i>p</i> < 1 × 10<sup>-5</sup>; 24 feedlot, 16 dairy, 11 combined) associated with infection with BCoV. Three loci were associated with BCoV<sup>+</sup> across populations. Heritability estimates for BCoV<sup>+</sup> were 0.01 for dairy, 0.11 for feedlot cattle, and 0.03 for the combined population. For BCoV<sup>+</sup>BRD<sup>+</sup>, 80 loci (<i>p</i> < 1 × 10<sup>-5</sup>; 26 feedlot, 25 dairy, 29 combined) were associated including 14 loci across populations. Heritability estimates for BCoV<sup>+</sup>BRD<sup>+</sup> were 0.003 for dairy, 0.44 for feedlot cattle, and 0.07 for the combined population. Several positional candidate genes associated with BCoV and BRD in this study have been associated with other coronaviruses and respiratory infections in humans and mice. These results suggest that selection may reduce susceptibility to BCoV infection and BRD in cattle.

Also flagged:GlycycoumarinAcetaminophenautophagyendoplasmic reticulumER-phagyliver injury
Journal Article 2021-08-02 ✓ 1 Snippet Yan M, Wang Z, Xia T, Jin S, Liu Y, Hu H, Chang Q.
In-Text Gene Mentions

…of RTN3 (RTN3L),CCPG1, SEC62, ATL3 and…

Show Full Abstract

Acetaminophen (APA)-induced hepatotoxicity is coupled with the activation of autophagy. We sought to determine whether selective autophagy of the endoplasmic reticulum (ER), termed ER-phagy, is involved in APA hepatotoxicity and to explore its potential as a therapeutic target for APA-induced liver injury (AILI). APA (300 or 600 mg/kg) was administered to male C57BL/6N mice, with and without rapamycin, glycycoumarin (GCM) and <i>N</i>-acetylcysteine (NAC). The results demonstrated that ER-phagy accompanied with ER stress was activated after APA overdose. The dynamic changes of LC3 and TEX264 revealed that ER-phagy was induced as early as 6 h and peaked at 24 h following the APA injection. A delayed treatment with GCM, but not rapamycin, considerably attenuated a liver injury and, consequently, reduced its mortality. This is probably due to the inhibition of ER stress and the acceleration of liver regeneration via enhanced ER-phagy. Unlike the impaired hepatocyte proliferation and more severe liver injury in mice that received prolonged treatment with NAC, liver recovery is facilitated by repeated treatment with GCM. These findings suggest that TEX264-mediated ER-phagy is a compensatory mechanism against ER stress provoked by an APA overdose. A delayed and prolonged treatment with GCM enhances ER-phagy, thus serving as a potential therapeutic approach for patients presenting at the late stage of AILI.

Also flagged:Multiple MyelomaGene Expressionblood cancerplasma cell dyscrasiaGammopathypathogenesis
Journal Article 2021-08-02 ✓ 1 Snippet Awada H, Thapa B, Awada H, Dong J, Gurnari C, Hari P, Dhakal B.
In-Text Gene Mentions

…genes, such aslinker histoneshistones ( HIST1H1B…

Show Full Abstract

Multiple myeloma (MM) is a blood cancer characterized by the accumulation of malignant monoclonal plasma cells in the bone marrow. It develops through a series of premalignant plasma cell dyscrasia stages, most notable of which is the Monoclonal Gammopathy of Undetermined Significance (MGUS). Significant advances have been achieved in uncovering the genomic aberrancies underlying the pathogenesis of MGUS-MM. In this review, we discuss in-depth the genomic evolution of MM and focus on the prognostic implications of the accompanied molecular and cytogenetic aberrations. We also dive into the latest investigatory techniques used for the diagnoses and risk stratification of MM patients.

Also flagged:Canceroncogenestumorchromatinnucleosomeshistone
Journal Article 2021-08-02 No Snippets Lange M, Begolli R, Giakountis A.
Show Full Abstract

The cancer genome is characterized by extensive variability, in the form of Single Nucleotide Polymorphisms (SNPs) or structural variations such as Copy Number Alterations (CNAs) across wider genomic areas. At the molecular level, most SNPs and/or CNAs reside in non-coding sequences, ultimately affecting the regulation of oncogenes and/or tumor-suppressors in a cancer-specific manner. Notably, inherited non-coding variants can predispose for cancer decades prior to disease onset. Furthermore, accumulation of additional non-coding driver mutations during progression of the disease, gives rise to genomic instability, acting as the driving force of neoplastic development and malignant evolution. Therefore, detection and characterization of such mutations can improve risk assessment for healthy carriers and expand the diagnostic and therapeutic toolbox for the patient. This review focuses on functional variants that reside in transcribed or not transcribed non-coding regions of the cancer genome and presents a collection of appropriate state-of-the-art methodologies to study them.

Also flagged:Triptolidepancreatic cancerwaterlactobionic acidtumorsesterase
Journal Article 2021-08-02 No Snippets Sui B, Cheng C, Shi S, Wang M, Xu P.
Show Full Abstract

Triptolide (TPL) is a small molecule isolated from a traditional Chinese herb Tripterygium wilfordii Hook F and shows excellent anticancer effect for pancreatic cancer cells. However, the poor water solubility and severe liver toxicity of TPL hindered its clinical application. In this study, TPL was covalently conjugated to a polymer and entrapped inside the core of the TPL nanogel (nTPL) to protect it from premature leakage during blood circulation. With the help of lactobionic acid (LBA), nTPL-LBA could selectively target the tumors in an orthotopic pancreatic cancer mouse model. TPL could be subsequently released intracellularly in its original form due to the presence of elevated intracellular esterase and GSH, and eventually kills cancer cells. nTPL-LBA treatment reduced tumor burden by 99% while not introducing TPL associated liver and kidney toxicities. Most importantly, more than half of the nTPL-LBA treated animals were tumor-free, suggesting that nTPL-LBA is an effective approach in eradicating pancreatic cancer.

Also flagged:COVID-19visionCHF-19EthereumGBP
Journal Article 2021-08-02 No Snippets Aharon DY, Umar Z, Vo XV.
Show Full Abstract

This study examines the connectedness between the US yield curve components (i.e., level, slope, and curvature), exchange rates, and the historical volatility of the exchange rates of the main safe-haven fiat currencies (Canada, Switzerland, EURO, Japan, and the UK) and the leading cryptocurrency, the Bitcoin. Results of the static analysis show that the level and slope of the yield curve are net transmitters of shocks to both the exchange rate and its volatility. The exchange rate of the Euro and the volatility of the Euro and the Canadian dollar exchange rate are net transmitters of shocks. Meanwhile, the curvature of the yield curve and the Japanese Yen, Swiss Franc, and British Pound act mainly as net receivers. Our static connectedness analysis shows that Bitcoin is mainly independent of shocks from the yield curve's level, slope, and curvature, and from any main currency investigated. These findings hint that Bitcoin might provide hedging benefits. However, similar to the static analysis, our dynamic analysis shows that during different periods and particularly in stressful times, Bitcoin is far from being isolated from other currencies or the yield curve components. The dynamic analysis allows us to observe Bitcoin's connectedness in times of stress. Evidence supporting this contention is the substantially increased connectedness due to policy shocks, political uncertainty, and systemic crisis, implying no empirical support for Bitcoin's safe-haven property during stress times. The increased connectedness in the dynamic analysis compared with the static approach implies that in normal times and especially in stressful times, Bitcoin has the property of a diversifier. The results may have important implications for investors and policymakers regarding their risk monitoring and their assets allocation and investment strategies.

Also flagged:ironlithiumelectronsyttriumyttrium irongadolinium gallium
Journal Article 2021-08-02 No Snippets Wang H, Braun A, Cramer SP, Gee LB, Yoda Y.
Show Full Abstract

Nuclear resonant vibrational spectroscopy (NRVS) is a synchrotron radiation (SR)-based nuclear inelastic scattering spectroscopy that measures the phonons (i.e., vibrational modes) associated with the nuclear transition. It has distinct advantages over traditional vibration spectroscopy and has wide applications in physics, chemistry, bioinorganic chemistry, materials sciences, and geology, as well as many other research areas. In this article, we present a scientific and figurative description of this yet modern tool for the potential users in various research fields in the future. In addition to short discussions on its development history, principles, and other theoretical issues, the focus of this article is on the experimental aspects, such as the instruments, the practical measurement issues, the data process, and a few examples of its applications. The article concludes with introduction to non-<sup>57</sup>Fe NRVS and an outlook on the impact from the future upgrade of SR rings.

Also flagged:glucoserespiratory failureanaphylaxisacute kidney injurythrombocytopeniahypoglycemia
Journal Article 2021-08-01 No Snippets Carayon P, Wetterneck TB, Cartmill R, Blosky MA, Brown R, Hoonakker P, Kim R, Kukreja S, Johnson M, Paris BL, Wood KE, Walker JM.
Show Full Abstract

<h4>Objective</h4>The aim of the study was to assess the impact of Electronic Health Record (EHR) implementation on medication safety in two intensive care units (ICUs).<h4>Methods</h4>Using a prospective pre-post design, we assessed 1254 consecutive admissions to two ICUs before and after an EHR implementation. Each medication event was evaluated with regard to medication error (error type, medication-management stage) and impact on patient (severity of potential or actual harm).<h4>Results</h4>We identified 4063 medication-related events either pre-implementation (2074 events) or post-implementation (1989 events). Although the overall potential for harm due to medication errors decreased post-implementation only 2 of the 3 error rates were significantly lower post-implementation. After EHR implementation, we observed reductions in rates of medication errors per admission at the stages of transcription (0.13-0, P < 0.001), dispensing (0.49-0.16, P < 0.001), and administration (0.83-0.56, P = 0.011). Within the ordering stage, 4 error types decreased post-implementation (orders with omitted information, error-prone abbreviations, illegible orders, failure to renew orders) and 4 error types increased post-implementation (orders of wrong drug, orders containing a wrong start or stop time, duplicate orders, orders with inappropriate or wrong information). Within the administration stage, we observed a reduction of late administrations and increases in omitted administrations and incorrect documentation.<h4>Conclusions</h4>Electronic Health Record implementation in two ICUs was associated with both improvement and worsening in rates of specific error types. Further safety improvements require a nuanced understanding of how various error types are influenced by the technology and the sociotechnical work system of the technology implementation. Recommendations based on human factors engineering principles are provided for reducing medication errors.

Also flagged:Neurodegenerative diseasesmitochondrialamyotrophic lateral sclerosisADPDHD
Journal Article 2021-08-01 ✓ 1 Snippet Onyango IG, Bennett JP, Stokin GB.
In-Text Gene Mentions

In HD, cells transfected with mutant HTT protein fragments showed elevated DNA damage and ATM activation (Giuliano et al., 2003; Illuzzi et al., 2009), and increased gH2AX was also found in fibro blasts from HD patients (Giuliano et al., 2003) and in HD mouse and patient striatal neurons (Enokido et al., 2010).

Show Full Abstract

Neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis are a heterogeneous group of debilitating disorders with multifactorial etiologies and pathogeneses that manifest distinct molecular mechanisms and clinical manifestations with abnormal protein dynamics and impaired bioenergetics. Mitochondrial dysfunction is emerging as an important feature in the etiopathogenesis of these age-related neurodegenerative diseases. The prevalence and incidence of these diseases is on the rise with the increasing global population and average lifespan. Although many therapeutic approaches have been tested, there are currently no effective treatment routes for the prevention or cure of these diseases. We present the current status of our knowledge and understanding of the involvement of mitochondrial dysfunction in these diseases and highlight recent advances in novel therapeutic strategies targeting neuronal bioenergetics as potential approach for treating these diseases.

Also flagged:insulin-like growth factor 2
Journal Article 2021-08-01 ✓ 1 Snippet Troncoso-Escudero P, Hetz C, Vidal RL.
In-Text Gene Mentions

HD is associated with an expansion of CAG repeat sequence in the huntingtin gene (Htt).

Show Full Abstract

No abstract available.

Also flagged:HeparinMembraneclottingdeathcompartment syndromealbumin
Journal Article 2021-08-01 ✓ 1 Snippet Raghunathan V, Liu P, Kohs TCL, Amirsoltani R, Oakes M, McCarty OJT, Olson SR, Zonies D, Shatzel JJ.
In-Text Gene Mentions

ATIII

Show Full Abstract

Extracorporeal membrane oxygenation (ECMO) protocols generally require systemic anticoagulation with heparin to prevent circuit thrombosis. The prevalence, risk factors, and outcomes of heparin resistance in this setting are ill-defined. To better understand the prevalence and clinical consequences of heparin resistance in this population, we conducted a retrospective analysis of all patients treated with ECMO at a single academic medical center between 2016 and 2019. Univariate and multivariate analyses were used to evaluate predictors and outcomes of heparin resistance. Of 67 patients in our study, 50.7% met the threshold for heparin resistance for at least 1 day, which was managed in all cases with increases in heparin dose. Patients with heparin resistance were more likely to be male (82.4% vs. 48.5%, p = 0.005) and to have a higher mean platelet count (132 vs. 104 × 103/mL, p = 0.027) compared with those without heparin resistance. Multivariate logistic regression found no significant association between the development of heparin resistance and rates of thrombosis, hemorrhage, or overall survival. Additional prospective studies are required to clarify the clinical implications of heparin resistance in this population.

Also flagged:neurological diseasesspinal muscular atrophyneuronal ceroid lipofuscinosiscancerautismmuscular dystrophies
Journal Article 2021-08-01 ✓ 5 Snippets Elorza A, Márquez Y, Cabrera JR, Sánchez-Trincado JL, Santos-Galindo M, Hernández IH, Picó S, Díaz-Hernández JI, García-Escudero R, Irimia M, Lucas JJ.
In-Text Gene Mentions

Huntington’s disease is caused by a polyglutamine (polyQ)-encoding CAG repeat expansion in the huntingtin (HTT) gene.17

These mice are a heterozygous knock-in Huntington’s disease model with the CAG expansion in the endogenous Htt gene to resemble the human Huntington’s disease mutation better, but it does not develop an overt motor phenotype within the maximal (∼2.5 years) lifespan of a mouse and it is thus considered a model of pre-manifest Huntington’s disease.26

Regarding specific genes whose mis-splicing detected through RT-PCR had previously been related to Huntington’s disease pathogenesis (e.g. MAPT,12CREB1,15TAF1,50 and HTT itself14), in our RNA-seq analysis we confirmed: the increased inclusion of MAPT exon 10, a CREB1 intron retention, and the altered usage of the alternative 3′ splicing signal of TAF1 exon 5 that favours the long (+63 nt) version of this exon.

…the huntingtin (HTT) gene.…

…intron in theHTTgene giving rise…

Show Full Abstract

Correction of mis-splicing events is a growing therapeutic approach for neurological diseases such as spinal muscular atrophy or neuronal ceroid lipofuscinosis 7, which are caused by splicing-affecting mutations. Mis-spliced effector genes that do not harbour mutations are also good candidate therapeutic targets in diseases with more complex aetiologies such as cancer, autism, muscular dystrophies or neurodegenerative diseases. Next-generation RNA sequencing (RNA-seq) has boosted investigation of global mis-splicing in diseased tissue to identify such key pathogenic mis-spliced genes. Nevertheless, while analysis of tumour or dystrophic muscle biopsies can be informative on early stage pathogenic mis-splicing, for neurodegenerative diseases, these analyses are intrinsically hampered by neuronal loss and neuroinflammation in post-mortem brains. To infer splicing alterations relevant to Huntington's disease pathogenesis, here we performed intersect-RNA-seq analyses of human post-mortem striatal tissue and of an early symptomatic mouse model in which neuronal loss and gliosis are not yet present. Together with a human/mouse parallel motif scan analysis, this approach allowed us to identify the shared mis-splicing signature triggered by the Huntington's disease-causing mutation in both species and to infer upstream deregulated splicing factors. Moreover, we identified a plethora of downstream neurodegeneration-linked mis-spliced effector genes that-together with the deregulated splicing factors-become new possible therapeutic targets. In summary, here we report pathogenic global mis-splicing in Huntington's disease striatum captured by our new intersect-RNA-seq approach that can be readily applied to other neurodegenerative diseases for which bona fide animal models are available.

Also flagged:NeogeninNEO1transmembrane proteinHJVBMP coreceptoriron
Journal Article 2021-08-01 ✓ 1 Snippet Enns CA, Jue S, Zhang AS.
In-Text Gene Mentions

HFE

Show Full Abstract

Neogenin (NEO1) is a ubiquitously expressed multifunctional transmembrane protein. It interacts with hemojuvelin (HJV), a BMP coreceptor that plays a pivotal role in hepatic hepcidin expression. Earlier studies suggest that the function of HJV relies on its interaction with NEO1. However, the role of NEO1 in iron homeostasis remains controversial because of the lack of an appropriate animal model. Here, we generated a hepatocyte-specific Neo1 knockout (Neo1fl/fl;Alb-Cre+) mouse model that circumvented the developmental and lethality issues of the global Neo1 mutant. Results show that ablation of hepatocyte Neo1 decreased hepcidin expression and caused iron overload. This iron overload did not result from altered iron utilization by erythropoiesis. Replacement studies revealed that expression of the Neo1L1046E mutant that does not interact with Hjv, was unable to correct the decreased hepcidin expression and high serum iron in Neo1fl/fl;Alb-Cre+ mice. In Hjv-/- mice, expression of HjvA183R mutant that has reduced interaction with Neo1, also displayed a blunted induction of hepcidin expression. These observations indicate that Neo1-Hjv interaction is essential for hepcidin expression. Further analyses suggest that the Hjv binding triggered the cleavage of the Neo1 cytoplasmic domain by a protease, which resulted in accumulation of truncated Neo1 on the plasma membrane. Additional studies did not support that Neo1 functions by inhibiting Hjv shedding as previously proposed. Together, our data favor a model in which Neo1 interaction with Hjv leads to accumulation of cleaved Neo1 on the plasma membrane, where Neo1 acts as a scaffold to induce the Bmp signaling and hepcidin expression.

Also flagged:HDAC1breast cancerHistone deacetylaseHDACcancertumors
Journal Article 2021-08-01 ✓ 1 Snippet Zhang Y, Nalawansha DA, Herath KE, Andrade R, Pflum MKH.
In-Text Gene Mentions

SUDS3

Show Full Abstract

Histone deacetylase (HDAC) proteins, which regulate the acetylation state of proteins, are the targets of multiple clinical drugs for cancer treatment. Due to the heterogeneity of tumors, HDAC proteins play different roles in the progression of various cancer types. For example, MDA-MB-468 and MDA-MB-231 cells are both triple negative breast cancer cells but belong to different subtypes that display different response to HDAC inhibitor drugs. To investigate the role of HDAC proteins in breast cancer, the substrate and associated proteins of HDAC1 in MDA-MB-231, MDA-MB-468, and a normal breast epithelial cell line, MCF10A, were analyzed using substrate trapping mutants and proteomics-based mass spectrometry. All three cell lines demonstrated nonoverlapping substrate protein profiles. While both normal MCF10A and cancerous MDA-MB-468 cell lines contained similar HDAC1 associated proteins, including proteins associated with epigenetic and RNA processing mechanisms, the HDAC1 associated protein profile of MDA-MB-231 cells was devoid of expected epigenetic proteins. The variable associated protein profiles of MDA-MB-231 and MDA-MB-468 suggest that HDAC1 plays distinct roles in breast cancer cell biology, which might affect cancer aggressiveness and HDAC inhibitor sensitivity.

Also flagged:Rnf128TP53LysWsb2CRL4Amfr
Journal Article 2021-08-01 ✓ 2 Snippets Jiang L, Wang J, Wang K, Wang H, Wu Q, Yang C, Yu Y, Ni P, Zhong Y, Song Z, Xie E, Hu R, Min J, Wang F.
In-Text Gene Mentions

In duodenal enterocytes, transcription of the Fpn gene, which encodes ferroportin, is regulated by iron and hypoxia to increase the absorption of dietary iron during iron deficiency and anemia.8,54 In this respect, it is somewhat surprising that all isoforms of the Fpn transcript are unaffected in the duodenal enterocytes of HID-fed Tet1−/− mice, given the presence of alternative transcriptional regulation for Fpn in the duodenum in the iron-deficient anemia and hypoxia.55,56 Nevertheless, under systemic iron-overload conditions, duodenal Fpn mRNA levels were reportedly unaffected in Hfe knockout mice, patients with hereditary hemochromatosis, and individuals with secondary iron overload,57-60 suggesting that a nontranscriptional mechanism may regulate FPN in our Tet1−/− mice.

…reportedly unaffected inHfeknockout mice, patients…

Show Full Abstract

Ferroportin (FPN), the body's sole iron exporter, is essential for maintaining systemic iron homeostasis. In response to either increased iron or inflammation, hepatocyte-secreted hepcidin binds to FPN, inducing its internalization and subsequent degradation. However, the E3 ubiquitin ligase that underlies FPN degradation has not been identified. Here, we report the identification and characterization of a novel mechanism involving the RNF217-mediated degradation of FPN. A combination of 2 different E3 screens revealed that the Rnf217 gene is a target of Tet1, mediating the ubiquitination and subsequent degradation of FPN. Interestingly, loss of Tet1 expression causes an accumulation of FPN and an impaired response to iron overload, manifested by increased iron accumulation in the liver together with decreased iron in the spleen and duodenum. Moreover, we found that the degradation and ubiquitination of FPN could be attenuated by mutating RNF217. Finally, using 2 conditional knockout mouse lines, we found that knocking out Rnf217 in macrophages increases splenic iron export by stabilizing FPN, whereas knocking out Rnf217 in intestinal cells appears to increase iron absorption. These findings suggest that the Tet1-RNF217-FPN axis regulates iron homeostasis, revealing new therapeutic targets for FPN-related diseases.

Also flagged:Obesityirontransferrin receptorsTfRC-reactive proteinHepcidin
Journal Article 2021-08-01 ✓ 1 Snippet Jones AD, Shi Z, Lambrecht NJ, Jiang Y, Wang J, Burmeister M, Li M, Lozoff B.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Overweight or obesity among pregnant women may compromise maternal and neonatal iron status by upregulating hepcidin.<h4>Objectives</h4>This study determined the association of 1) maternal and neonatal iron status with maternal and neonatal hepcidin concentrations, and 2) maternal prepregnancy weight status with maternal and neonatal hepcidin concentrations.<h4>Methods</h4>We examined hematologic data from 405 pregnant women and their infants from the placebo treatment group of a pregnancy iron supplementation trial in rural China. We measured hepcidin, serum ferritin (SF), soluble transferrin receptor (sTfR), and high-sensitivity C-reactive protein in maternal blood samples at mid-pregnancy and in cord blood at delivery. We used regression analysis to examine the association of maternal prepregnancy overweight or obese status with maternal hepcidin concentration in mid-pregnancy and cord hepcidin concentrations. We also used path analysis to examine mediation of the association of maternal prepregnancy overweight or obese status with maternal iron status by maternal hepcidin, as well as with neonatal hepcidin by neonatal iron status.<h4>Results</h4>Maternal iron status was positively correlated with maternal hepcidin at mid-pregnancy (SF: r = 0.63, P < 0.001; sTfR: r = -0.37, P < 0.001). Neonatal iron status was also positively correlated with cord hepcidin (SF: r = 0.61, P < 0.001; sTfR: r = -0.39, P < 0.001). In multiple linear regression models, maternal prepregnancy overweight or obese status was not associated with maternal hepcidin at mid-pregnancy but was associated with lower cord hepcidin (coefficient = -0.21, P = 0.004). Using path analysis, we observed a significant indirect effect of maternal prepregnancy overweight or obese status on cord hepcidin, mediated by neonatal iron status.<h4>Conclusions</h4>In both pregnant women and neonates, hepcidin was responsive to iron status. Maternal prepregnancy overweight status, with or without including obese women, was associated with lower cord blood hepcidin, likely driven by lower iron status among the neonates of these mothers.

Also flagged:heparan sulfatePunctinjunctionsproteoglycansorganizationsynapses
Journal Article 2021-08-01 ✓ 1 Snippet Cizeron M, Granger L, Bülow HE, Bessereau JL.
In-Text Gene Mentions

DCC

Show Full Abstract

Heparan sulfate (HS) proteoglycans contribute to the structural organization of various neurochemical synapses. Depending on the system, their role involves either the core protein or the glycosaminoglycan chains. These linear sugar chains are extensively modified by HS modification enzymes, resulting in highly diverse molecules. Specific modifications of glycosaminoglycan chains may thus contribute to a sugar code involved in synapse specificity. Caenorhabditis elegans is particularly useful to address this question because of the low level of genomic redundancy of these enzymes, as opposed to mammals. Here, we systematically mutated the genes encoding HS modification enzymes in C. elegans and analyzed their impact on excitatory and inhibitory neuromuscular junctions (NMJs). Using single chain antibodies that recognize different HS modification patterns, we show in vivo that these two HS epitopes are carried by the SDN-1 core protein, the unique C. elegans syndecan ortholog, at NMJs. Intriguingly, these antibodies differentially bind to excitatory and inhibitory synapses, implying unique HS modification patterns at different NMJs. Moreover, while most enzymes are individually dispensable for proper organization of NMJs, we show that 3-O-sulfation of SDN-1 is required to maintain wild-type levels of the extracellular matrix protein MADD-4/Punctin, a central synaptic organizer that defines the identity of excitatory and inhibitory synaptic domains at the plasma membrane of muscle cells.

Also flagged:Ataxin-2ATXN2SCA2neurological diseasesmotor neuron diseasespinocerebellar ataxia 3
Journal Article 2021-08-01 ✓ 1 Snippet Laffita-Mesa JM, Laffita-Mesa JM, Paucar M, Svenningsson P.
In-Text Gene Mentions

Bañez- et al., 2012 provide evidence involving HTT CAG repeats interfering with cell viability at the RNA level. Pathological CAG repeats ≥40 units induced neuronal cell death and increased levels of small CAG-repeated RNAs (sCAGs) of ≈21 nucleotides in a Dicer-dependent manner [65]. Furthermore, the severity of the toxic effect of HTT mRNA and sCAG generation correlated with CAG expansion length. Likewise, Creus–Muncunill et al., 2021 demonstrated that sRNA produced in the putamen of HD patients are sufficient to recapitulate HD pathophysiology in vivo[66].

Show Full Abstract

<h4>Purpose of review</h4>To provide an update on the role of Ataxin-2 gene (ATXN2) in health and neurological diseases.<h4>Recent findings</h4>There is a growing complexity emerging on the role of ATXN2 and its variants in association with SCA2 and several other neurological diseases. Polymorphisms and intermediate alleles in ATXN2 establish this gene as a powerful modulator of neurological diseases including lethal neurodegenerative conditions such as motor neuron disease, spinocerebellar ataxia 3 (SCA3), and peripheral nerve disease such as familial amyloidosis polyneuropathy. This role is in fact far wider than the previously described for polymorphism in the prion protein (PRNP) gene. Positive data from antisense oligo therapy in a murine model of SCA2 suggest that similar approaches may be feasible in humans SCA2 patients.<h4>Summary</h4>ATXN2 is one of the few genes where a single gene causes several diseases and/or modifies several and disparate neurological disorders. Hence, understanding mutagenesis, genetic variants, and biological functions will help managing SCA2, and several human diseases connected with dysfunctional pathways in the brain, innate immunity, autophagy, cellular, lipid, and RNA metabolism.

Also flagged:AUTS2Metabolismintellectual disabilityepilepsysomatic disordersbinding
Journal Article 2021-08-01 No Snippets Castanza AS, Ramirez S, Tripathi PP, Daza RAM, Kalume FK, Ramirez JM, Hevner RF.
Show Full Abstract

Human AUTS2 mutations are linked to a syndrome of intellectual disability, autistic features, epilepsy, and other neurological and somatic disorders. Although it is known that this unique gene is highly expressed in developing cerebral cortex, the molecular and developmental functions of AUTS2 protein remain unclear. Using proteomics methods to identify AUTS2 binding partners in neonatal mouse cerebral cortex, we found that AUTS2 associates with multiple proteins that regulate RNA transcription, splicing, localization, and stability. Furthermore, AUTS2-containing protein complexes isolated from cortical tissue bound specific RNA transcripts in RNA immunoprecipitation and sequencing assays. Deletion of all major functional isoforms of AUTS2 (full-length and C-terminal) by conditional excision of exon 15 caused breathing abnormalities and neonatal lethality when Auts2 was inactivated throughout the developing brain. Mice with limited inactivation of Auts2 in cerebral cortex survived but displayed abnormalities of cerebral cortex structure and function, including dentate gyrus hypoplasia with agenesis of hilar mossy neurons, and abnormal spiking activity on EEG. Also, RNA transcripts that normally associate with AUTS2 were dysregulated in mutant mice. Together, these findings indicate that AUTS2 regulates RNA metabolism and is essential for development of cerebral cortex, as well as subcortical breathing centers.

Also flagged:TIPARPPARP7aryl hydrocarbon receptorAHRmono-ADP-ribosyltransferasecatalytic activity
Journal Article 2021-08-01 No Snippets Hutin D, Long AS, Sugamori K, Shao P, Singh SK, Rasmussen M, Olafsen NE, Pettersen S, Grimaldi G, Grant DM, Matthews J.
Show Full Abstract

2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible poly-adenosine diphosphate (ADP)-ribose polymerase (TIPARP/PARP7), an aryl hydrocarbon receptor (AHR) target gene and mono-ADP-ribosyltransferase, acts as part of a negative feedback loop to repress AHR signaling. This process is prevented by a single H532A mutation in TIPARP that destroys its catalytic activity. We hypothesized that the loss of TIPARP catalytic activity would increase sensitivity to TCDD-induced toxicity in vivo. To test this, we created a catalytically deficient mouse line (TiparpH532A) by introducing a single H532A mutation in TIPARP. Treatment of mouse embryonic fibroblasts or hepatocytes isolated from TiparpH532A mice confirmed the increased TCDD-induced expression of the AHR target genes Cyp1a1, Cyp1b1, and Tiparp. TiparpH532A mice given a single injection of 10 µg/kg TCDD, a nonlethal dose in Tiparp+/+ mice, did not survive beyond day 10. All Tiparp+/+ mice survived the 30-day treatment. TCDD-treated TiparpH532A mice displayed increased expression of AHR target genes, increased steatohepatitis and hepatotoxicity. Hepatic RNA-sequencing revealed 7-fold more differentially expressed genes in TiparpH532A mice than in Tiparp+/+ mice (4542 vs 647 genes) 6 days after TCDD treatment. Differentially expressed genes included genes involved in xenobiotic metabolism, lipid homeostasis and inflammation. Taken together, these data further support TIPARP as a critical negative regulator of AHR activity and show that loss of its catalytic activity is sufficient to increase sensitivity to TCDD-induced steatohepatitis and lethality. Since TIPARP inhibition has recently emerged as a potential anticancer therapy, the impact on AHR signaling, TCDD and polycyclic aromatic hydrocarbon toxicity will need to be carefully considered under conditions of therapeutic TIPARP inhibition.

Also flagged:Parkinson's diseaseMTNR1BCCL25GBAODF1CXCL11
Journal Article 2021-08-01 No Snippets Xu DD, Li GQ, Wu ZS, Liu XQ, Yang XX, Wang JH.
Show Full Abstract

Glucocerebrosidase (GBA) mutations occur frequently in Parkinson's disease (PD) patients. This study aims to identify potential crucial genes and pathways associated with GBA mutations in patients with PD and to further analyze new molecular mechanisms related to the occurrence of gene mutations from the perspective of bioinformatics. Gene expression profiles of datasets GSE53424 and GSE99142 were acquired from the Gene Expression Ominibus database. Differentially expressed genes (DEGs) were detected, using the 'limma' package in R, comparing IDI-PD 1 (idiopathic PD patients) and GBA-PD 1 [PD patients with heterozygous GBA mutations (GBA N370S)] group samples. The functions of top modules were assessed using the DAVID, whereas gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed. Protein-protein interaction networks were assembled with Cytoscape software and separated into subnetworks using the Molecular Complex Detection Algorithm. Data from GSE53424 and GSE99142 were also extracted to verify our findings. There were 283 DEGs identified in PD patients heterozygous for GBA mutations. Module analysis revealed that GBA mutations in PD patients were associated with significant pathways, including Calcium signaling pathway, Rap1 signaling pathway and Cytokine-cytokine receptor interaction. Hub genes of the two modules were corticotropin-releasing hormone (CRH) and Melatonin receptor 1B (MTNR1B). The expression of CRH was downregulated, whereas that of MTNR1B was upregulated in PD patients with GBA mutations. The expression of CRH and MTNR1B has diagnostic value for PD patients with heterozygous GBA mutations. Novel DEGs and pathways identified herein might provide new insights into the underlying molecular mechanisms of heterozygous GBA mutations in PD patients.

Also flagged:phytasecalciumphosphorusgestationTitanium dioxidemineral
Journal Article 2021-08-01 No Snippets Zhai H, Cowieson AJ, Pappenberger G, Zhang J, Wu J.
Show Full Abstract

The objective of this study was to measure apparent total tract digestibility (ATTD) of Ca and P as well as reproductive performance in late gestation and lactating sows supplemented with a novel phytase and to compare the response to phytase supplementation between late gestation and lactating sows. A total of 45 late gestation sows and 45 lactating sows were used in experiments 1 and 2, respectively, in a completely randomized design. The sows were provided with a control diet or the control diet supplemented with 187.5 or 375 FYT phytase/kg feed for 10 days. The diets were prepared according to the formulas in use for production but without any inorganic P supplement. Titanium dioxide was included at 3 g/kg feed as an indigestible marker. Each dietary treatment was replicated with 15 sows individually housed in farrowing stalls. The sows were allowed to adapt to the experimental diets for 5 days before a 5-d fecal collection by grab sampling, and the performance of the sows and their litters were measured until weaning. The results showed that the ATTD of Ca increased linearly (P < 0.001), while the ATTD of P increased both linearly and quadratically (P < 0.01) with increasing supplementation of phytase in both late gestation and lactating sows. There was no significant effect of phytase on the ATTD of dry matter, crude protein, and gross energy, and the performance of the sows and their progenies. The phytase added at 187.5 and 375 FYT/kg feed released 0.07% and 0.10% digested P, respectively, in late gestation sows, which compared with 0.09% and 0.12% digested P in lactating sows. In conclusion, a novel phytase at 187.5-375 FYT/kg feed could release 0.07-0.12% digestible P for sows. It appeared that using the P digestibility values of feed ingredients listed by NRC to formulate a diet for sows might overestimate dietary P supply and a greater response to phytase supplementation could be expected in lactating sows than in late gestation sows.

Also flagged:viral genomesreproductionextracellularvesiclesmembraneretrotransposons
Journal Article 2021-08-01 No Snippets Loiseau V, Peccoud J, Bouzar C, Guillier S, Fan J, Gueli Alletti G, Meignin C, Herniou EA, Federici BA, Wennmann JT, Jehle JA, Cordaux R, Gilbert C.
Show Full Abstract

The mechanisms by which transposable elements (TEs) can be horizontally transferred between animals are unknown, but viruses are possible candidate vectors. Here, we surveyed the presence of host-derived TEs in viral genomes in 35 deep sequencing data sets produced from 11 host-virus systems, encompassing nine arthropod host species (five lepidopterans, two dipterans, and two crustaceans) and six different double-stranded (ds) DNA viruses (four baculoviruses and two iridoviruses). We found evidence of viral-borne TEs in 14 data sets, with frequencies of viral genomes carrying a TE ranging from 0.01% to 26.33% for baculoviruses and from 0.45% to 7.36% for iridoviruses. The analysis of viral populations separated by a single replication cycle revealed that viral-borne TEs originating from an initial host species can be retrieved after viral replication in another host species, sometimes at higher frequencies. Furthermore, we detected a strong increase in the number of integrations in a viral population for a TE absent from the hosts' genomes, indicating that this TE has undergone intense transposition within the viral population. Finally, we provide evidence that many TEs found integrated in viral genomes (15/41) have been horizontally transferred in insects. Altogether, our results indicate that multiple large dsDNA viruses have the capacity to shuttle TEs in insects and they underline the potential of viruses to act as vectors of horizontal transfer of TEs. Furthermore, the finding that TEs can transpose between viral genomes of a viral species sets viruses as possible new niches in which TEs can persist and evolve.

Also flagged:DNA endonucleasesnucleaseCas9Cas12aCasmetabolism
Journal Article 2021-08-01 No Snippets Poggi L, Emmenegger L, Descorps-Declère S, Dumas B, Richard GF.
Show Full Abstract

Microsatellite expansions are the cause of >20 neurological or developmental human disorders. Shortening expanded repeats using specific DNA endonucleases may be envisioned as a gene editing approach. Here, we measured the efficacy of several CRISPR-Cas nucleases to induce recombination within disease-related microsatellites, in Saccharomyces cerevisiae. Broad variations in nuclease performances were detected on all repeat tracts. Wild-type Streptococcus pyogenes Cas9 (SpCas9) was more efficient than Staphylococcus aureus Cas9 on all repeats tested, except (CAG)33. Cas12a (Cpf1) was the most efficient on GAA trinucleotide repeats, whereas GC-rich repeats were more efficiently cut by SpCas9. The main genetic factor underlying Cas efficacy was the propensity of the recognition part of the sgRNA to form a stable secondary structure, independently of its structural part. This suggests that such structures form in vivo and interfere with sgRNA metabolism. The yeast genome contains 221 natural CAG/CTG and GAA/CTT trinucleotide repeats. Deep sequencing after nuclease induction identified three of them as carrying statistically significant low frequency mutations, corresponding to SpCas9 off-target double-strand breaks.

Also flagged:cancerneurodegenerative diseasestumourneurodegenerative diseasepeptideresponse to
Journal Article 2021-08-01 No Snippets Tateishi-Karimata H, Sugimoto N.
Show Full Abstract

Cancer and neurodegenerative diseases are caused by genetic and environmental factors. Expression of tumour suppressor genes is suppressed by mutations or epigenetic silencing, whereas for neurodegenerative disease-related genes, nucleic acid-based effects may be presented through loss of protein function due to erroneous protein sequences or gain of toxic function from extended repeat transcripts or toxic peptide production. These diseases are triggered by damaged genes and proteins due to lifestyle and exposure to radiation. Recent studies have indicated that transient, non-canonical structural changes in nucleic acids in response to the environment can regulate the expression of disease-related genes. Non-canonical structures are involved in many cellular functions, such as regulation of gene expression through transcription and translation, epigenetic regulation of chromatin, and DNA recombination. Transcripts generated from repeat sequences of neurodegenerative disease-related genes form non-canonical structures that are involved in protein transport and toxic aggregate formation. Intracellular phase separation promotes transcription and protein assembly, which are controlled by the nucleic acid structure and can influence cancer and neurodegenerative disease progression. These findings may aid in elucidating the underlying disease mechanisms. Here, we review the influence of non-canonical nucleic acid structures in disease-related genes on disease onset and progression.

Also flagged:dendrimerG-CSFAFMconjugationgranulocyte colony‐stimulating factorglycoprotein
Journal Article 2021-08-01 No Snippets Mousavi Motlagh SS, Seyedhamzeh M, Ahangari Cohan R, Shafiee Ardestani M, Vaziri B, Azadmanesh K, Saberi S, Masoumi V.
Show Full Abstract

The most crucial role of granulocyte colony-stimulating factor (G-CSF) in the body is to increase the strength of immune system. In recent years, research on the use of nanoparticles in pharmaceuticals has been considered, most of which have been for drug-loading purposes. In this study, a novel G-CSF conjugated dendrimer was synthesized and characterized using different techniques. In vitro cytotoxicity was assessed on A549 and L929 cells, while abnormal toxicity was studied in mice. In vitro and in vivo biological activities were assessed in NFS60 cells and rats, respectively. In addition, in vivo distribution, plasma half-life, and histopathological effect were studied in rat. The characterization tests confirmed the successful conjugation. There was no difference between G-CSF cytotoxicity before and after conjugation, and no difference with the control group. No mice showed abnormal toxicity. Although in vitro biological activity revealed both conjugated and free G-CSF promote proliferation cells, biological activity decreased significantly after conjugation about one-third of the unconjugated form. Nonetheless, in vivo biological activity of conjugated G-CSF increased by more than 2.5-fold relative to the unconjugated form, totally. Fortunately, no histopathologic adverse effect was observed in vital rat tissues. Also, in vivo distribution of the conjugate was similar to the native protein with an enhanced terminal half-life. Our data revealed that G-CSF conjugated dendrimer could be considered as a candidate to improve the in vivo biological activity of G-CSF. Moreover, multivalent capability of the dendrimer may be used for other new potentials of G-CSF in future perspectives.

Also flagged:extracellularproteoglycanCollagen-ICollagen-IIorganizationhormone
Journal Article 2021-08-01 No Snippets Tsinman TK, Jiang X, Han L, Koyama E, Koyama E, Mauck RL, Dyment NA.
Show Full Abstract

The incredible mechanical strength and durability of mature fibrous tissues and their extremely limited turnover and regenerative capacity underscores the importance of proper matrix assembly during early postnatal growth. In tissues with composite extracellular matrix (ECM) structures, such as the adult knee meniscus, fibrous (Collagen-I rich), and cartilaginous (Collagen-II, proteoglycan-rich) matrix components are regionally segregated to the outer and inner portions of the tissue, respectively. While this spatial variation in composition is appreciated to be functionally important for resisting complex mechanical loads associated with gait, the establishment of these specialized zones is poorly understood. To address this issue, the following study tracked the growth of the murine meniscus from its embryonic formation through its first month of growth, encompassing the critical time-window during which animals begin to ambulate and weight bear. Using histological analysis, region specific high-throughput qPCR, and Col-1, and Col-2 fluorescent reporter mice, we found that matrix and cellular features defining specific tissue zones were already present at birth, before continuous weight-bearing had occurred. These differences in meniscus zones were further refined with postnatal growth and maturation, resulting in specialization of mature tissue regions. Taken together, this work establishes a detailed timeline of the concurrent spatiotemporal changes that occur at both the cellular and matrix level throughout meniscus maturation. The findings of this study provide a framework for investigating the reciprocal feedback between cells and their evolving microenvironments during assembly of a mechanically robust fibrocartilage tissue, thus providing insight into mechanisms of tissue degeneration and effective regenerative strategies.

Also flagged:damage responsetumorcancerATRATMCHK1
Journal Article 2021-08-01 ✓ 1 Snippet Wang C, Tang M, Chen Z, Nie L, Li S, Xiong Y, Szymonowicz KA, Park JM, Zhang H, Feng X, Huang M, Su D, Hart T, Chen J.
In-Text Gene Mentions

…protein [CtIP] andMMS22L).…

Show Full Abstract

Because of essential roles of DNA damage response (DDR) in the maintenance of genomic integrity, cellular homeostasis, and tumor suppression, targeting DDR has become a promising therapeutic strategy for cancer treatment. However, the benefits of cancer therapy targeting DDR are limited mainly due to the lack of predictive biomarkers. To address this challenge, we performed CRISPR screens to search for genetic vulnerabilities that affect cells' response to DDR inhibition. By undertaking CRISPR screens with inhibitors targeting key DDR mediators, i.e. ATR, ATM, DNAPK and CHK1, we obtained a global and unbiased view of genetic interactions with DDR inhibition. Specifically, we identified YWHAE loss as a key determinant of sensitivity to CHK1 inhibition. We showed that KLHL15 loss protects cells from DNA damage induced by ATM inhibition. Moreover, we validated that APEX1 loss sensitizes cells to DNAPK inhibition. Additionally, we compared the synergistic effects of combining different DDR inhibitors and found that an ATM inhibitor plus a PARP inhibitor induced dramatic levels of cell death, probably through promoting apoptosis. Our results enhance the understanding of DDR pathways and will facilitate the use of DDR-targeting agents in cancer therapy.

Also flagged:Cas9chromatinCell division-relatedcell proliferationangiogenesistube formation
Journal Article 2021-08-01 No Snippets Mushimiyimana I, Niskanen H, Beter M, Laakkonen JP, Kaikkonen MU, Ylä-Herttuala S, Laham-Karam N.
Show Full Abstract

Super-enhancers are clusters of enhancers associated with cell lineage. They can be powerful gene-regulators and may be useful in cell-type specific viral-vector development. Here, we have screened for endothelial super-enhancers and identified an enhancer from within a cluster that conferred 5-70-fold increase in transgene expression. Importantly, CRISPR/Cas9 deletion of enhancers demonstrated regulation of ADAMTS18, corresponding to evidence of chromatin contacts between these genomic regions. Cell division-related pathways were primarily affected by the enhancer deletions, which correlated with significant reduction in cell proliferation. Furthermore, we observed changes in angiogenesis-related genes consistent with the endothelial specificity of this SE. Indeed, deletion of the enhancers affected tube formation, resulting in reduced or shortened sprouts. The super-enhancer angiogenic role is at least partly due to its regulation of ADAMTS18, as siRNA knockdown of ADAMTS18 resulted in significantly shortened endothelial sprouts. Hence, functional characterization of a novel endothelial super-enhancer has revealed substantial downstream effects from single enhancer deletions and led to the discovery of the cis-target gene ADAMTS18 and its role in endothelial function.

Also flagged:antibodiesimmune responseB cell lymphomaHER2breast cancerCD16
Journal Article 2021-08-01 ✓ 1 Snippet Kang E, Kadoch C, Rubenstein JL, Lanier LL, Wells JA.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Therapies that boost the antitumor immune response have shown a great deal of success. Although most of these therapies have focused on enhancing T cell functions, there is a growing interest in developing therapies that can target other immune cell subsets. Like T cells, natural killer (NK) cells are cytotoxic effector cells that play a key role in the antitumor response. To advance the development of NK-based therapies, we developed a functional screen to rapidly identify antibodies that can activate NK cells. We displayed antibodies on a mammalian target cell line and probed their ability to stimulate NK cell-mediated cytotoxicity. From this screen, we identified five antibodies that bound with high affinity to NK cells and stimulated NK cell-mediated cytotoxicity and interferon-γ (IFN-γ) secretion. We demonstrate that these antibodies can be further developed into bispecific antibodies to redirect NK cell-mediated cytotoxicity toward CD20+ B cell lymphoma cells and HER2+ breast cancer cells. While antibodies to two of the receptors, CD16 and NCR1, have previously been targeted as bispecific antibodies to redirect NK cell-mediated cytotoxicity, we demonstrate that bispecific antibodies targeting NCR3 can also potently activate NK cells. These results show that this screen can be used to directly identify antibodies that can enhance antitumor immune responses.

Also flagged:TFCEsadtopcitalopramcapsulequetiapine
Journal Article 2021-08-01 ✓ 2 Snippets Williams RJ, Brown EC, Clark DL, Pike GB, Ramasubbu R.
In-Text Gene Mentions

Quetiapine has no effect on 5‐HTT, and its antidepressant effect is partly mediated through the direct inhibition of postsynaptic 5‐HT2A receptors and activation of 5‐HT1A serotonin receptors (Bauer et al., 2009).

Citalopram has an affinity for 5‐HTT, blocking serotonin reuptake and increasing its availability (Selvaraj et al., 2018).

Show Full Abstract

<h4>Introduction</h4>Pre-treatment blood oxygenation level-dependent (BOLD) functional magnetic resonance imaging (fMRI) has been used for the early identification of patients with major depressive disorder (MDD) who later respond or fail to respond to medication. However, BOLD responses early after treatment initiation may offer insight into early neural changes associated with later clinical response. The present study evaluated both pre-treatment and early post-treatment fMRI responses to an emotion processing task, to further our understanding of neural changes associated with a successful response to pharmacological intervention.<h4>Methods</h4>MDD patients who responded (n = 22) and failed to respond (n = 12) after 8 weeks of treatment with either citalopram or quetiapine extended release, and healthy controls (n = 18) underwent two fMRI scans, baseline (pre-treatment), and early post-treatment (one week after treatment commencement). Participants completed an emotional face matching task at both scans.<h4>Results</h4>Using threshold-free cluster enhancement (TFCE) and non-parametric permutation testing, fMRI activation maps showed that after one week of treatment, responders demonstrated increased activation in the left parietal lobule, precentral gyrus, and bilateral insula (all P < 0.05 threshold-free cluster enhancement (TFCE) family-wise error-corrected) to negative facial expressions. Non-responders showed some small increases in the precentral gyrus, while controls showed no differences between scans. Compared to non-responders, responders showed some increased activation in the superior parietal lobule and middle temporal gyrus at the post-treatment scan. There were no group differences between responders, non-responders, and controls at baseline.<h4>Conclusions</h4>One week after treatment commencement, BOLD signal changes in the parietal lobules, insula, and middle temporal gyrus were related to clinical response to pharmacological treatment.

Also flagged:acute lymphoblastic leukaemiaALLpolymeraseimmunoglobulinT‐cell receptorTR
Journal Article 2021-08-01 ✓ 1 Snippet Kuiper RP, Hoogeveen PG, Bladergroen R, van Dijk F, Sonneveld E, van Leeuwen FN, Boer J, Sergeeva I, Feitsma H, den Boer ML, van der Velden VHJ.
In-Text Gene Mentions

…, DDX3X ‐MLLT10) , and IGH‐…

Show Full Abstract

Minimal residual disease (MRD) diagnostics are implemented in most clinical protocols for patients with acute lymphoblastic leukaemia (ALL) and are mostly performed using rearranged immunoglobulin (IG) and/or T-cell receptor (TR) gene rearrangements as molecular polymerase chain reaction targets. Unfortunately, in 5-10% of patients no or no sensitive IG/TR targets are available, and patients therefore cannot be stratified appropriately. In the present study, we used fusion genes and genomic deletions as alternative MRD targets in these patients, which retrospectively revealed appropriate MDR stratification in 79% of patients with no (sensitive) IG/TR target, and a different risk group stratification in more than half of the cases.

Also flagged:EPCAMLynch syndromeGREM1polyposisinsulinsulfonylureas
Journal Article 2021-08-01 ✓ 1 Snippet Miller DT, Lee K, Chung WK, Gordon AS, Herman GE, Klein TE, Stewart DR, Amendola LM, Adelman K, Bale SJ, Gollob MH, Harrison SM, Hershberger RE, McKelvey K, Richards CS, Vlangos CN, Watson MS, Martin CL, ACMG Secondary Findings Working Group.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

No abstract available.

Also flagged:Cholangiocarcinomabiliary malignant tumorcancerpathogenesisIL-6STAT3
Journal Article 2021-08-01 ✓ 5 Snippets Ye H, Chen T, Zeng Z, He B, Yang Q, Pan Q, Chen Y, Wang W.
In-Text Gene Mentions

(C) The qRT-PCR showing the expression levels of METTL3, METTL14, CD133, CTNNB1, and SOX6 in METTL3 or METTL14-silenced CCAs.

(G) Immunoblots showing the expression levels of CTNNB1 and SOX6 in si-IGF2BP2 CCA cells.

Furthermore, our study screened a set of cancer cell genes in different stemness-related signaling pathways, including CTNNB1, SOX6, and CD133 in CCA, to show that stemness genes were targeted by m6A modification.

(F) The qRT-PCR showing the expression levels of IGF2BP2, CTNNB1, and SOX6 in IGF2BP2-downregulated CCA cells.

…such as SOX4,SOX6, and CTNNB1, was…

Show Full Abstract

<h4>Objective</h4>Investigation of the regulatory mechanisms of cell stemness in cholangiocarcinoma (CCA) is essential for developing effective therapies to improve patient outcomes. The purpose of this study was to investigate the function and regulatory mechanism of m6A modifications in CCA cell stemness.<h4>Methods</h4>Interleukin 6 (IL-6) treatment was used to induce an inflammatory response, and loss-of-function studies were conducted using mammosphere culture assays. Chromatin immunoprecipitation, polysome profiling, and methylated RNA immunoprecipitation analyses were used to identify signaling pathways. The <i>in vitro</i> findings were verified in a mice model.<h4>Results</h4>We first identified that m6A writers were highly expressed in CCAs and further showed that STAT3 directly bound to the gene loci of m6A writers, showing that IL-6/STAT3 signaling regulated expressions of m6A writers. Downregulating m6A writers prevented cell proliferation and migration <i>in vitro</i> and suppressed CCA tumorigenesis <i>in vivo</i>. Notably, the knockdown of m6A writers inhibited CCA cell stemness that was triggered by IL-6 treatment. Mechanistically, IGF2BP2 was bound to CTNNB1 transcripts, significantly enhancing their stability and translation, and conferring stem-like properties. Finally, we confirmed that the combination of m6A writers, IGF2BP2, and CTNNB1 distinguished CCA tissues from normal tissues.<h4>Conclusions</h4>Overall, this study showed that the IL-6-triggered inflammatory response facilitated the expressions of m6A writers and cell stemness in an m6A-IGF2BP2-dependent manner. Furthermore, the study showed that m6A modification was a targetable mediator of the response to inflammation factor exposure, was a potential diagnostic biomarker for CCA, and was critical to the progression of CCA.

Also flagged:SUMO proteaseof chromosomescohesinsister chromatidchromosomeScc1
Journal Article 2021-08-01 ✓ 1 Snippet Psakhye I, Branzei D.
In-Text Gene Mentions

Condensinand Smc5/6 complex…

Show Full Abstract

Structural maintenance of chromosomes (SMCs) complexes, cohesin, condensin, and Smc5/6, are essential for viability and participate in multiple processes, including sister chromatid cohesion, chromosome condensation, and DNA repair. Here we show that SUMO chains target all three SMC complexes and are antagonized by the SUMO protease Ulp2 to prevent their turnover. We uncover that the essential role of the cohesin-associated subunit Pds5 is to counteract SUMO chains jointly with Ulp2. Importantly, fusion of Ulp2 to kleisin Scc1 supports viability of PDS5 null cells and protects cohesin from proteasomal degradation mediated by the SUMO-targeted ubiquitin ligase Slx5/Slx8. The lethality of PDS5-deleted cells can also be bypassed by simultaneous loss of the proliferating cell nuclear antigen (PCNA) unloader, Elg1, and the cohesin releaser, Wpl1, but only when Ulp2 is functional. Condensin and Smc5/6 complex are similarly guarded by Ulp2 against unscheduled SUMO chain assembly, which we propose to time the availability of SMC complexes on chromatin.

Also flagged:LSCCcancerdeathNSD3FGFR1tumors
Journal Article 2021-08-01 No Snippets Satpathy S, Krug K, Jean Beltran PM, Savage SR, Petralia F, Kumar-Sinha C, Dou Y, Reva B, Kane MH, Avanessian SC, Vasaikar SV, Krek A, Lei JT, Jaehnig EJ, Omelchenko T, Geffen Y, Bergstrom EJ, Stathias V, Christianson KE, Heiman DI, Cieslik MP, Cao S, Song X, Ji J, Liu W, Li K, Wen B, Li Y, Gümüş ZH, Selvan ME, Soundararajan R, Visal TH, Raso MG, Parra ER, Babur Ö, Vats P, Anand S, Schraink T, Cornwell M, Rodrigues FM, Zhu H, Mo CK, Zhang Y, da Veiga Leprevost F, Huang C, Chinnaiyan AM, Wyczalkowski MA, Omenn GS, Newton CJ, Schurer S, Ruggles KV, Fenyö D, Jewell SD, Thiagarajan M, Mesri M, Rodriguez H, Mani SA, Udeshi ND, Getz G, Suh J, Li QK, Hostetter G, Paik PK, Dhanasekaran SM, Govindan R, Ding L, Robles AI, Clauser KR, Nesvizhskii AI, Wang P, Carr SA, Zhang B, Mani DR, Gillette MA, Clinical Proteomic Tumor Analysis Consortium.
Show Full Abstract

Lung squamous cell carcinoma (LSCC) remains a leading cause of cancer death with few therapeutic options. We characterized the proteogenomic landscape of LSCC, providing a deeper exposition of LSCC biology with potential therapeutic implications. We identify NSD3 as an alternative driver in FGFR1-amplified tumors and low-p63 tumors overexpressing the therapeutic target survivin. SOX2 is considered undruggable, but our analyses provide rationale for exploring chromatin modifiers such as LSD1 and EZH2 to target SOX2-overexpressing tumors. Our data support complex regulation of metabolic pathways by crosstalk between post-translational modifications including ubiquitylation. Numerous immune-related proteogenomic observations suggest directions for further investigation. Proteogenomic dissection of CDKN2A mutations argue for more nuanced assessment of RB1 protein expression and phosphorylation before declaring CDK4/6 inhibition unsuccessful. Finally, triangulation between LSCC, LUAD, and HNSCC identified both unique and common therapeutic vulnerabilities. These observations and proteogenomics data resources may guide research into the biology and treatment of LSCC.

Also flagged:hepatocellular carcinomacirrhosisliver fibrosisliver tumorliver tumorsFibrosis
Journal Article 2021-08-01 ✓ 1 Snippet Uehara T, Pogribny IP, Rusyn I.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Human hepatocellular carcinoma (HCC) develops most often as a complication of fibrosis or cirrhosis. Although most human studies of HCC provide crucial insights into the molecular signatures of HCC, they seldom address its etiology. Mouse models provide essential tools for investigating the pathogenesis of HCC, but the majority of rodent cancer models do not feature liver fibrosis. Detailed here is a protocol for an experimental mouse model of HCC that arises in association with advanced liver fibrosis. The disease model is induced by a single injection of N-nitrosodiethylamine (DEN) at 2 weeks of age followed by repeated administration of carbon tetrachloride (CCl<sub>4</sub> ) from 8 weeks of age for up to 14 consecutive weeks. A dramatic potentiation of liver tumor incidence is observed following administration of DEN and CCl<sub>4</sub> , with 100% of mice developing liver tumors at 5 months of age. This model has been employed for studying the molecular mechanisms of fibrogenesis and HCC development, as well as for cancer hazard/chemotherapy testing of drug candidates. © 2021 Wiley Periodicals LLC. Basic Protocol: The DEN and CCl<sub>4</sub> -induced mouse model of fibrosis and inflammation-associated hepatocellular carcinoma.

Also flagged:intervertebral disc degenerationSuraminAfrican sleeping sicknessIL-1βmitogen-activated protein kinaseMAPK
Journal Article 2021-08-01 ✓ 5 Snippets Liu ZM, Lu CC, Shen PC, Chou SH, Shih CL, Chen JC, Tien YC.
In-Text Gene Mentions

No changes were observed in the mRNA levels of Col2a1, Sox5, Sox6, and Sox9 following suramin treatment in NP cells exposed to IL-1β (Figure 2 and Figure 3a).

…erse (AGCTGAAGCCTGGAGGAAGGAG);sox6, forward (CAGCCCTGTCAGTCTGCCT…

…Factor 5 (Sox5),Sox6, Sox9, MMP-3, MMP-13,…

…aggrecan, Col10a1, Sox5,Sox6, and Sox9 were…

…(SD 0.01) fold;Sox6, control vs IL-1β-treated:…

Show Full Abstract

<h4>Aims</h4>Interleukin (IL)-1β is one of the major pathogenic regulators during the pathological development of intervertebral disc degeneration (IDD). However, effective treatment options for IDD are limited. Suramin is used to treat African sleeping sickness. This study aimed to investigate the pharmacological effects of suramin on mitigating IDD and to characterize the underlying mechanism.<h4>Methods</h4>Porcine nucleus pulposus (NP) cells were treated with vehicle, 10 ng/ml IL-1β, 10 μM suramin, or 10 μM suramin plus IL-1β. The expression levels of catabolic and anabolic proteins, proinflammatory cytokines, mitogen-activated protein kinase (MAPK), and nuclear factor (NF)-κB-related signalling molecules were assessed by Western blotting, quantitative real-time polymerase chain reaction (qRT-PCR), and immunofluorescence analysis. Flow cytometry was applied to detect apoptotic cells. The ex vivo effects of suramin were examined using IDD organ culture and differentiation was analyzed by Safranin O-Fast green and Alcian blue staining.<h4>Results</h4>Suramin inhibited IL-1β-induced apoptosis, downregulated matrix metalloproteinase (MMP)-3, MMP-13, a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS)-4, and ADAMTS-5, and upregulated collagen 2A (Col2a1) and aggrecan in IL-1β-treated NP cells. IL-1β-induced inflammation, assessed by IL-1β, IL-8, and tumour necrosis factor α (TNF-α) upregulation, was alleviated by suramin treatment. Suramin suppressed IL-1β-mediated proteoglycan depletion and the induction of MMP-3, ADAMTS-4, and pro-inflammatory gene expression in ex vivo experiments.<h4>Conclusion</h4>Suramin administration represents a novel and effectively therapeutic approach, which could potentially alleviate IDD by reducing extracellular matrix (ECM) deposition and inhibiting apoptosis and inflammatory responses in the NP cells. Cite this article: <i>Bone Joint Res</i> 2021;10(8):498-513.

Also flagged:Tgfb2BrafCacna2d3B-RafNrasItga4
Journal Article 2021-08-01 No Snippets Liu Y, Lehar A, Rydzik R, Chandok H, Lee YS, Youngstrom DW, George J, Matzuk MM, Germain-Lee EL, Lee SJ.
Show Full Abstract

Skeletal muscle and bone homeostasis are regulated by members of the myostatin/GDF-11/activin branch of the transforming growth factor-β superfamily, which share many regulatory components, including inhibitory extracellular binding proteins and receptors that mediate signaling. Here, we present the results of genetic studies demonstrating a critical role for the binding protein follistatin (FST) in regulating both skeletal muscle and bone. Using an allelic series corresponding to varying expression levels of endogenous <i>Fst</i>, we show that FST acts in an exquisitely dose-dependent manner to regulate both muscle mass and bone density. Moreover, by employing a genetic strategy to target <i>Fst</i> expression only in the posterior (caudal) region of the animal, we show that the effects of <i>Fst</i> loss are mostly restricted to the posterior region, implying that locally produced FST plays a much more important role than circulating FST with respect to regulation of muscle and bone. Finally, we show that targeting receptors for these ligands specifically in osteoblasts leads to dramatic increases in bone mass, with trabecular bone volume fraction being increased by 12- to 13-fold and bone mineral density being increased by 8- to 9-fold in humeri, femurs, and lumbar vertebrae. These findings demonstrate that bone, like muscle, has an enormous inherent capacity for growth that is normally kept in check by this signaling system and suggest that the extent to which this regulatory mechanism may be used throughout the body to regulate tissue mass may be more significant than previously appreciated.

Also flagged:axonaxon guidance moleculesgrowth conesbehavioralaxonsextracellular
Journal Article 2021-08-01 ✓ 2 Snippets Jeong S.
In-Text Gene Mentions

Netrins can mediate attractive axon guidance through their cognate receptors, such as Frazzled in Drosophila, UNC-40 in C. elegans, and DCC (Deleted in Colorectal Carcinomas) in vertebrates (Chan et al., 1996; Keino-Masu et al., 1996; Kolodziej et al., 1996).

…elegans , andDCC(Deleted in Colorectal…

Show Full Abstract

Decoding the molecular mechanisms underlying axon guidance is key to precise understanding of how complex neural circuits form during neural development. Although substantial progress has been made over the last three decades in identifying numerous axon guidance molecules and their functional roles, little is known about how these guidance molecules collaborate to steer growth cones to their correct targets. Recent studies in <i>Drosophila</i> point to the importance of the combinatorial action of guidance molecules, and further show that selective fasciculation and defasciculation at specific choice points serve as a fundamental strategy for motor axon guidance. Here, I discuss how attractive and repulsive guidance cues cooperate to ensure the recognition of specific choice points that are inextricably linked to selective fasciculation and defasciculation, and correct pathfinding decision-making.

Also flagged:infertilityinfectionpelvic inflammatory diseaseDeoxyribonucleic acidmessenger ribonucleic acidendometrial infection
Journal Article 2021-08-01 No Snippets Zheng X, Zhong W, O'Connell CM, Liu Y, Haggerty CL, Geisler WM, Anyalechi GE, Kirkcaldy RD, Wiesenfeld HC, Hillier SL, Steinkampf MP, Hammond KR, Fine J, Li Y, Darville T.
Show Full Abstract

<h4>Background</h4>Chlamydia trachomatis (Ct) infection ascending to the upper genital tract can cause infertility. Direct association of genetic variants as contributors is challenging because infertility may not be diagnosed until years after infection. Investigating the intermediate trait of ascension bridges this gap.<h4>Methods</h4>We identified infertility genome-wide association study (GWAS) loci using deoxyribonucleic acid from Ct-seropositive cisgender women in a tubal factor infertility study and Ct-infected cisgender women from a longitudinal pelvic inflammatory disease cohort with known fertility status. Deoxyribonucleic acid and blood messenger ribonucleic acid from 2 additional female cohorts with active Ct infection and known endometrial infection status were used to investigate the impact of infertility single-nucleotide polymorphisms (SNPs) on Ct ascension. A statistical mediation test examined whether multiple infertility SNPs jointly influenced ascension risk by modulating expression of mediator genes.<h4>Results</h4>We identified 112 candidate infertility GWAS loci, and 31 associated with Ct ascension. The SNPs altered chlamydial ascension by modulating expression of 40 mediator genes. Mediator genes identified are involved in innate immune responses including type I interferon production, T-cell function, fibrosis, female reproductive tract health, and protein synthesis and degradation.<h4>Conclusions</h4>We identified Ct-related infertility loci and their potential functional effects on Ct ascension.

Also flagged:Cyclin Fliver cancercancerhepatocellular carcinomaCCNFGene Expression
Journal Article 2021-08-01 ✓ 1 Snippet Zelong Y, Han Y, Ting G, Yifei W, Kun H, Haoran H, Yong C.
In-Text Gene Mentions

…UBE2S, SKP2, CUL1,FBXL4, CDC20, FBXL7, and…

Show Full Abstract

<h4>Background</h4>Cyclin F (CCNF) dysfunction has been implicated in various forms of cancer, offering a new avenue for understanding the pathogenic mechanisms underlying hepatocellular carcinoma (HCC). We aimed to evaluate the role of CCNF in HCC using publicly available data from The Cancer Genome Atlas (TCGA).<h4>Method</h4>We used TCGA data and Gene Expression Omnibus (GEO) data to analyze the differential expression of CCNF between tumor and adjacent tissues and the relationship between CCNF and clinical characteristics. We compared prognosis of patients with HCC with high and low CCNF expression and constructed receiver operating characteristic (ROC) curves. In addition, we also explored the types of gene mutations in relevant groups and conducted Gene Set Enrichment Analysis (GSEA).<h4>Results</h4>The expression of CCNF in liver cancer tissues was significantly increased compared with that in adjacent tissues, and patients with high CCNF expression had a worse prognosis than those with low CCNF expression. Patients with high CCNF expression also had more somatic mutations. High expression of CCNF hampers the prognosis independently. The GSEA showed that the "http://www.gsea-msigdb.org/gsea/msigdb/cards/BIOCARTA_WNT_PATHWAY" Wnt pathway, "http://www.gsea-msigdb.org/gsea/msigdb/cards/BIOCARTA_P53_PATHWAY" P53 pathway, "http://www.gsea-msigdb.org/gsea/msigdb/cards/HALLMARK_PI3K_AKT_MTOR_SIGNALING" PI3K/Akt/mTOR pathway, "http://www.gsea-msigdb.org/gsea/msigdb/cards/HALLMARK_NOTCH_SIGNALING" Notch pathway were enriched in patients with the high CCNF expression phenotype.<h4>Conclusion</h4>High CCNF expression can be seen as an independent risk factor for poor survival in HCC. Its expression may serve as a target for the diagnosis and treatment of liver cancer.

Also flagged:acute myeloid leukemiaironAMLcancermetabolismanemia of inflammation
Journal Article 2021-08-01 ✓ 2 Snippets Lopes M, Duarte TL, Teles MJ, Mosteo L, Chacim S, Aguiar E, Pereira-Reis J, Oliveira M, Silva AMN, Gonçalves N, Martins G, Kong IY, Zethoven M, Vervoort S, Martins S, Quintela M, Hawkins ED, Trigo F, Guimarães JT, Mariz JM, Porto G, Duarte D.
In-Text Gene Mentions

Hfe

hemochromatosis

Show Full Abstract

Acute myeloid leukemia (AML) is a heterogeneous disease with poor prognosis and limited treatment strategies. Determining the role of cell-extrinsic regulators of leukemic cells is vital to gain clinical insights into the biology of AML. Iron is a key extrinsic regulator of cancer, but its systemic regulation remains poorly explored in AML. To address this question, we studied iron metabolism in patients with AML at diagnosis and explored the mechanisms involved using the syngeneic MLL-AF9-induced AML mouse model. We found that AML is a disorder with a unique iron profile, not associated with inflammation or transfusion, characterized by high ferritin, low transferrin, high transferrin saturation (TSAT), and high hepcidin. The increased TSAT in particular, contrasts with observations in other cancer types and in anemia of inflammation. Using the MLL-AF9 mouse model of AML, we demonstrated that the AML-induced loss of erythroblasts is responsible for iron redistribution and increased TSAT. We also show that AML progression is delayed in mouse models of systemic iron overload and that elevated TSAT at diagnosis is independently associated with increased overall survival in AML. We suggest that TSAT may be a relevant prognostic marker in AML.

Also flagged:Vcam1Respiratory chaindefectsCxcl12ribonucleoproteincre
Journal Article 2021-08-01 ✓ 2 Snippets Shi Y, Liao X, Long JY, Yao L, Chen J, Yin B, Lou F, He G, Ye L, Qin L, Long F.
In-Text Gene Mentions

Sox6

…including Sox9, Sox5,Sox6, Col2a1, and Acan…

Show Full Abstract

Teriparatide is the most widely prescribed bone anabolic drug in the world, but its cellular targets remain incompletely defined. The Gli1<sup>+</sup> metaphyseal mesenchymal progenitors (MMPs) are a main source for osteoblasts in postnatal growing mice, but their potential response to teriparatide is unknown. Here, by lineage tracing, we show that teriparatide stimulates both proliferation and osteoblast differentiation of MMPs. Single-cell RNA sequencing reveals heterogeneity among MMPs, including an unexpected chondrocyte-like osteoprogenitor (COP). COP expresses the highest level of Hedgehog (Hh) target genes and the insulin-like growth factor 1 receptor (Igf1r) among all cell clusters. COP also expresses Pth1r and further upregulates Igf1r upon teriparatide treatment. Inhibition of Hh signaling or deletion of Igf1r from MMPs diminishes the proliferative and osteogenic effects of teriparatide. The study therefore identifies COP as a teriparatide target wherein Hh and insulin-like growth factor (Igf) signaling are critical for the osteoanabolic response in growing mice.

Also flagged:neurodegenerative diseaseslipopolysaccharideadenosylcobalaminsynthesismitochondrialα-syn
Journal Article 2021-08-01 No Snippets Wang C, Lau CY, Ma F, Zheng C.
Show Full Abstract

Growing evidence indicates that gut microbiota play a critical role in regulating the progression of neurodegenerative diseases such as Parkinson's disease. The molecular mechanism underlying such microbe-host interaction is unclear. In this study, by feeding <i>Caenorhabditis elegans</i> expressing human α-syn with <i>Escherichia coli</i> knockout mutants, we conducted a genome-wide screen to identify bacterial genes that promote host neurodegeneration. The screen yielded 38 genes that fall into several genetic pathways including curli formation, lipopolysaccharide assembly, and adenosylcobalamin synthesis among others. We then focused on the curli amyloid fibril and found that genetically deleting or pharmacologically inhibiting the curli major subunit CsgA in <i>E. coli</i> reduced α-syn-induced neuronal death, restored mitochondrial health, and improved neuronal functions. CsgA secreted by the bacteria colocalized with α-syn inside neurons and promoted α-syn aggregation through cross-seeding. Similarly, curli also promoted neurodegeneration in <i>C. elegans</i> models of Alzheimer's disease, amyotrophic lateral sclerosis, and Huntington's disease and in human neuroblastoma cells.

Also flagged:Toll-like receptor 3TLR3TLRchemokinesTRIFviral diseases
Journal Article 2021-08-01 No Snippets Chen Y, Lin J, Zhao Y, Ma X, Yi H.
Show Full Abstract

Toll-like receptor 3 (TLR3) is a member of the TLR family, mediating the transcriptional induction of type I interferons (IFNs), proinflammatory cytokines, and chemokines, thereby collectively establishing an antiviral host response. Studies have shown that unlike other TLR family members, TLR3 is the only RNA sensor that is utterly dependent on the Toll-interleukin-1 receptor (TIR)‍-domain-containing adaptor-inducing IFN-‍β (TRIF). However, the details of how the TLR3-TRIF signaling pathway works in an antiviral response and how it is regulated are unclear. In this review, we focus on recent advances in understanding the antiviral mechanism of the TRIF pathway and describe the essential characteristics of TLR3 and its antiviral effects. Advancing our understanding of TLR3 may contribute to disease diagnosis and could foster the development of novel treatments for viral diseases.

Also flagged:estparaSARStranslationdosGMT
Journal Article 2021-08-01 ✓ 1 Snippet Desch K, Langer JD, Schuman EM.
In-Text Gene Mentions

…(Grip1, Sh3kbp1, orLrrc7).…

Show Full Abstract

Homeostatic synaptic scaling allows for bi-directional adjustment of the strength of synaptic connections in response to changes in their input. Protein phosphorylation modulates many neuronal processes, but it has not been studied on a global scale during synaptic scaling. Here, we use liquid chromatography-tandem mass spectrometry (LC-MS/MS) analyses to measure changes in the phosphoproteome in response to up- or down-scaling in cultured cortical neurons over minutes to 24 h. Of ~45,000 phosphorylation events, ~3,300 (associated with 1,285 phosphoproteins) are regulated by homeostatic scaling. Activity-sensitive phosphoproteins are predominantly located at synapses and involved in cytoskeletal reorganization. We identify many early phosphorylation events that could serve as sensors for the activity offset as well as late and/or persistent phosphoregulation that could represent effector mechanisms driving the homeostatic response. Much of the persistent phosphorylation is reciprocally regulated by up- or down-scaling, suggesting that mechanisms underlying these two poles of synaptic regulation make use of a common signaling axis.

Also flagged:Ironmetabolismobesitytype 2 diabetesmetabolic diseasesglycolipid
Journal Article 2021-08-01 ✓ 2 Snippets Ma W, Jia L, Xiong Q, Du H.
In-Text Gene Mentions

Increased tissue iron levels are strongly linked to NAFLD in human hereditary hemochromatosis (HH), an autosomal recessive disease in which the body stores too much iron that usually presents with mutations in the HFE gene [24].

…mutations in theHFEgene [ 24…

Show Full Abstract

Dysregulation in iron metabolism is associated with obesity, type 2 diabetes, and other metabolic diseases, whereas the underlying mechanisms of imbalanced glycolipid metabolism are still obscure. Here, we demonstrated that iron overload protected mice from obesity both with normal diets (ND) or high-fat diets (HFD). In iron-overload mice, the body fat was significantly decreased, especially when fed with HFD, excessive iron mice gained 15% less weight than those without iron supplements. Moreover, glucose tolerance and insulin sensitivity were all significantly reduced, and hepatic steatosis was prevented. Furthermore, these mice show a considerable decrease in lipogenesis and lipidoses of the liver. Compared with control groups, iron treated groups showed a 79% decrease in the protein level of Perilipin-2 (PLIN2), a protein marker for lipid droplets. These results were consistent with their substantial decrease in adiposity. RNA-seq and signaling pathway analyses showed that iron overload caused ferroptosis in the liver of mice with a decrease in GPX4 expression and an increase in Ptgs2 expression, resulting in a high level of lipid peroxidation. Overall, this study reveals the protective function of iron overload in obesity by triggering the imbalance of glucolipid metabolism in the liver and highlights the crucial role of ferroptosis in regulating lipid accumulation.

Also flagged:manganese transporterSLC30A10hypoxia-inducible factorsManganeseparkinsonismmetals
Journal Article 2021-08-01 ✓ 1 Snippet Liu C, Jursa T, Aschner M, Smith DR, Mukhopadhyay S.
In-Text Gene Mentions

Hfe

Show Full Abstract

Manganese (Mn) is an essential metal that induces incurable parkinsonism at elevated levels. However, unlike other essential metals, mechanisms that regulate mammalian Mn homeostasis are poorly understood, which has limited therapeutic development. Here, we discovered that the exposure of mice to a translationally relevant oral Mn regimen up-regulated expression of SLC30A10, a critical Mn efflux transporter, in the liver and intestines. Mechanistic studies in cell culture, including primary human hepatocytes, revealed that 1) elevated Mn transcriptionally up-regulated SLC30A10, 2) a hypoxia response element in the <i>SLC30A10</i> promoter was necessary, 3) the transcriptional activities of hypoxia-inducible factor (HIF) 1 or HIF2 were required and sufficient for the SLC30A10 response, 4) elevated Mn activated HIF1/HIF2 by blocking the prolyl hydroxylation of HIF proteins necessary for their degradation, and 5) blocking the Mn-induced up-regulation of SLC30A10 increased intracellular Mn levels and enhanced Mn toxicity. Finally, prolyl hydroxylase inhibitors that stabilize HIF proteins and are in advanced clinical trials for other diseases reduced intracellular Mn levels and afforded cellular protection against Mn toxicity and also ameliorated the in vivo Mn-induced neuromotor deficits in mice. These findings define a fundamental homeostatic protective response to Mn toxicity-elevated Mn levels activate HIF1 and HIF2 to up-regulate SLC30A10, which in turn reduces cellular and organismal Mn levels, and further indicate that it may be possible to repurpose prolyl hydroxylase inhibitors for the management of Mn neurotoxicity.

Also flagged:TLR7STAT3tumorcancerimmune responsepeptide
Journal Article 2021-08-01 ✓ 2 Snippets Zhang L, Huang J, Chen X, Pan C, He Y, Su R, Guo D, Yin S, Wang S, Zhou L, Chen J, Zheng S, Qiao Y.
In-Text Gene Mentions

…eligible mutant peptides:Htt(2375-2383) (ISLARLPLV →…

…antigens form mutatedHtt, Lifr, and Smarcal1,…

Show Full Abstract

<h4>Background</h4>Cancer vaccines are a promising strategy for cancer immunotherapy. Cancer vaccines elicits a specific cytotoxic immune response to tumor antigens. However, the efficacy of traditional peptide-based cancer vaccines is limited due to the inefficient delivery of antigens and adjuvants to dendritic cells (DCs). Therefore, it is necessary to develop a novel rationally designed cancer vaccine to maximize its desired effects.<h4>Methods</h4>A <u>S</u>elf-assembling <u>V</u>ehicle-free <u>M</u>ulti-component <u>A</u>ntitumor nano<u>V</u>accine (SVMAV) was constructed by using an unsaturated fatty acid docosahexaenoic acid (DHA)-conjugated antigen and R848 (a Toll-like receptor 7/8 agonist) to encapsulate stattic (a signal transducer and activator of transcription 3 inhibitor). The characteristics of SVMAV were investigated. The ability of SVMAV to promote DC functions was examined by in vitro analysis. The antitumor effects of SVMAV and its combination with antiprogrammed cell death protein 1 antibody (aPD-1) were also investigated in vivo. The potential application of SVMAV for neoantigen-targeted, personalized cancer vaccines was examined in an orthotopic hepatocellular carcinoma model.<h4>Results</h4>The obtained SVMAV efficiently migrated into lymph nodes and primed CD8<sup>+</sup> T cells for exert neoantigen-specific killing by promoting the antigen uptake by DCs, stimulating DC maturation, and enhancing antigen cross-presentation, due to the simultaneous delivery of the antigen, R848 and stattic. SVMAV could not only yield a robust antitumor effect for primary melanoma allografts, but also exert a protective effect for lung metastases. Moreover, combination treatment of SVMAV and aPD-1 exerted synergistic antitumor activity and extended the survival duration of melanoma-bearing mice. Notably, a cell line-specific neoantigen-based SVMAV was designed according to predicted neoantigens for Hepa1-6 cells to examine the potential application of SVMAV for personalized cancer vaccine. Encouragingly, neoantigen-specific SVMAV achieved stronger antitumor activity than aPD-1 in an orthotopic hepatocellular cancer model established with Hepa1-6 cells.<h4>Conclusions</h4>In summary, this study offers an efficient codelivery platform for neoantigens and immunoregulatory compounds to enhance immune responses during cancer immune therapy.

Also flagged:primary open-angle glaucomaocular hypertensionGlaucomaocular diseasesmyopiaectatic corneal diseases
Journal Article 2021-08-01 No Snippets Xu Y, Ye Y, Chong IT, Chen Z, Xu J, Yang Y, Yu K, Lam DCC, Yu M.
Show Full Abstract

<h4>Purpose</h4>To evaluate the ability of the new in vivo corneal indentation device (CID) to measure corneal biomechanical properties.<h4>Methods and results</h4>In total, 186 eyes from 46 healthy subjects, 107 patients with primary open-angle glaucoma, and 33 patients with ocular hypertension were enrolled in a cross-sectional study. Measurements were performed using corneal visualization Scheimpflug technology (Corvis ST) and the CID. The deformation amplitude (DA), inward applanation time, inward applanation velocity (A1V), outward applanation time (A2T), outward applanation velocity (A2V), highest concavity time, DA ratio, max inverse radius (MIR), integrated radius, and stiffness parameter A1 were included as Corvis ST parameters, and stiffness and modulus were included as CID parameters. Associations between the Corvis ST and CID parameters and correlations between central corneal thickness and corneal biomechanical parameters were analyzed. The stiffness was significantly correlated with all the Corvis ST parameters (P < 0.05). The modulus was significantly correlated with the DA, A1V, A2T, A2V, highest concavity time, and MIR (P < 0.05). The DA, inward applanation time, A1V, A2T, A2V, DA ratio, MIR, integrated radius, and stiffness parameter A1 values and both CID-derived values were significantly correlated with central corneal thickness (P < 0.05).<h4>Conclusions</h4>Parameters derived from the CID and Corvis ST demonstrated agreement in the measurement of corneal biomechanical properties. The stiffness and modulus can characterize in vivo corneal biomechanical properties.<h4>Translational relevance</h4>Agreeing with the Corvis ST regarding the assessment of corneal biomechanical properties, the CID can be a novel clinical tool for biomechanical evaluation of the cornea.

Also flagged:MSH3localizationGFPFANCD2Huntington's diseasePMS2
Journal Article 2021-08-01 ✓ 3 Snippets Goold R, Hamilton J, Menneteau T, Flower M, Bunting EL, Aldous SG, Porro A, Vicente JR, Allen ND, Wilkinson H, Bates GP, Sartori AA, Thalassinos K, Balmus G, Tabrizi SJ.
In-Text Gene Mentions

HTT

Huntington’s disease (HD) is a monogenic neurodegenerative condition arising due to inheritance of ≥36 CAG repeats in exon 1 of the huntingtin (HTT) gene.

…the huntingtin (HTT) gene.…

Show Full Abstract

CAG repeat expansion in the HTT gene drives Huntington's disease (HD) pathogenesis and is modulated by DNA damage repair pathways. In this context, the interaction between FAN1, a DNA-structure-specific nuclease, and MLH1, member of the DNA mismatch repair pathway (MMR), is not defined. Here, we identify a highly conserved SPYF motif at the N terminus of FAN1 that binds to MLH1. Our data support a model where FAN1 has two distinct functions to stabilize CAG repeats. On one hand, it binds MLH1 to restrict its recruitment by MSH3, thus inhibiting the assembly of a functional MMR complex that would otherwise promote CAG repeat expansion. On the other hand, it promotes accurate repair via its nuclease activity. These data highlight a potential avenue for HD therapeutics in attenuating somatic expansion.

Also flagged:hepatitis B e antigenchronic hepatitis Bcarotid atherosclerosisatherosclerosischronic hepatitis Chepatitis B virus infection
Journal Article 2021-08-01 ✓ 1 Snippet Riveiro-Barciela M, Marcos-Fosch C, Martinez-Valle F, Bronte F, Orozco O, Sanz-Pérez I, Torres D, Salcedo MT, Petta S, Esteban R, Craxi A, Buti M.
In-Text Gene Mentions

…hepatitis, Wilson’s disease,hemochromatosis, α1-antitriypsin deficiency).…

Show Full Abstract

<h4>Background</h4>There is an increased risk of atherosclerosis in patients with chronic hepatitis C or human immunodeficiency virus, but there is scarce data on hepatitis B virus infection. The hypothesis of this study is that hepatitis B virus infection increases the risk of carotid plaques and subclinical atherosclerosis in naïve hepatitis B e antigen (HBeAg) negative subjects.<h4>Aim</h4>To assess the rate of carotid plaques and subclinical atherosclerosis in naïve HBeAg negative subjects in comparison with a cohort of healthy controls.<h4>Methods</h4>Prospective case-control collaborative study conducted in two tertiary hospitals. Four hundred and two subjects prospectively recruited at the outpatient clinic were included from May 2016 to April 2017: 201 naïve HBeAg-negative hepatitis B virus-infected [49 chronic hepatitis B (CHB) and 152 inactive carriers(ICs)] and 201 healthy controls. Anthropomorphic and metabolic measures, liver stiffness and carotid Doppler ultrasound were performed. Subclinical atherosclerosis was established on an intima-media thickness increase of ≥1.2 mm and/or the presence of carotid plaques. Normally distributed quantitative variables were compared with the Student <i>t</i> test and those with a non-normal distribution with the Mann-Whitney <i>U</i> test. Categorical variables were compared between groups using the <i>χ</i> <sup>2</sup> or Fisher exact test.<h4>Results</h4>Carotid plaques were found more often in CHB (32.7%) than ICs (17.1%) or controls (18.4%) (<i>P</i> = 0.048). Subclinical atherosclerosis was also increased in CHB (40.8%) <i>vs</i>ICs (19.1%) or controls (19.4%) (<i>P</i> = 0.003). No differences in the risk of atherosclerosis were observed between controls and ICs. The factors independently associated with the presence of carotid plaques were age [odds ratio(OR) 1.43, <i>P</i> < 0.001] and CHB (OR 1.18, <i>P</i> = 0.004) and for subclinical atherosclerosis, age (OR 1.45, <i>P</i> < 0.001), CHB (OR 1.23, <i>P</i> < 0.001) and diabetes (OR 1.13, <i>P</i> = 0.028). In the subset of young subjects (< 50 years), carotid plaques (12.5% <i>vs</i> 1.1%, <i>P</i> = 0.027) and subclinical atherosclerosis (12.5% <i>vs</i> 2.2%, <i>P</i> = 0.058) were more frequent among CHB than ICs.<h4>Conclusion</h4>Untreated HBeAg-negative CHB is an independent risk factor for carotid plaques and subclinical atherosclerosis, while ICs present a similar risk to controls.

Also flagged:lung adenocarcinomaLUADimmune responsecell differentiationleukocyte migrationNF-kB
Journal Article 2021-08-01 ✓ 1 Snippet Chen C, Guo Q, Tang Y, Qu W, Zuo J, Ke X, Song Y.
In-Text Gene Mentions

…TNFRSF9 , andTNFSF4( Figure S2B…

Show Full Abstract

<h4>Background</h4>Brain metastasis was one of the factors leading to the poor long-term prognosis of patients with lung adenocarcinoma (LUAD).<h4>Methods</h4>The expression levels of immune genes in LUAD and LUAD brain metastases tissues were analyzed in GSE161116 dataset using the GEO2R, and the levels of differential immune genes in normal lung and LUAD tissues were verified. The biological functions and signaling mechanisms of the differential immune genes were explored via Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analysis. Cox regression analysis was used to screen the prognostic factors of LUAD patients, and a risk model was constructed. The role of the model was checked in the development of LUAD via receiver operating characteristic analysis, gene set enrichment analysis, and Cox regression analysis.<h4>Results</h4>Differentially expressed genes (DEGs) in brain metastasis were involved in the adaptive immune response, B cell differentiation, leukocyte migration, NF-kB signaling pathway, among others. The expression levels of <i>TNFRSF11A, MS4A2, IL11, CAMP, MS4A1</i>, and <i>F2RL1</i> were independent factors affecting the poor prognosis of LUAD patients via Cox regression analysis and Akaike information criterion. In the constructed risk model, the overall survival of LUAD patients in the high-risk group was poor. The risk model was significantly related to the gender, clinical stage, T stage, lymph node metastasis, and survival status of LUAD patients. In addition, the risk model score was an independent risk factor that affected the poor prognosis of LUAD patients. <i>TNFRSF11A, CAMP, F2RL1, IL11, MS4A1</i>, and <i>MS4A2</i> of the risk factors had diagnostic significance in LUAD brain metastasis and LUAD. The risk model participated in cytokinetic process, cell cycle, citrate cycle TCA cycle, etc. The risk model score was correlated with the levels of B cells memory, mast cells resting, macrophages M0, mast cells activated, neutrophils, eosinophils, T cells gamma delta, and immune cell markers.<h4>Conclusions</h4>The risk model based on the LUAD brain metastasis immune factors <i>TNFRSF11A, MS4A2, IL11, CAMP, MS4A1</i>, and <i>F2RL1</i> was related to the diagnosis, poor prognosis, and immune infiltrating cells of LUAD patients, and is expected to provide a reference for the development of treatment strategies for LUAD patients.

Also flagged:esophageal adenocarcinomaBEcancergastroesophageal reflux diseaseGERDBarrett
Journal Article 2021-08-01 No Snippets Mittal SK, Abdo J, Adrien MP, Bayu BA, Kline JR, Sullivan MM, Agrawal DK.
Show Full Abstract

<h4>Objective</h4>Barrett's esophagus (BE) is the only known precursor to esophageal adenocarcinoma (EAC), which has one of the lowest 5-year survival rates in oncology. The reasons for poor survival are twofold: the large majority of diagnoses are in advanced stages (~80%) and limited treatment options, with a deficit of biology-guided therapies. As a rapidly growing public health concern with poor prognosis, research into the molecular progression for BE and novel therapeutics for EAC currently has high clinical utility. Review of the literature reveals that innovative analysis of metaplastic progression from BE to EAC at a molecular level can shed light on the underlying transformative probabilities of BE into malignant pathologies and may impact current of future therapeutic modalities for management of these diseases.<h4>Background</h4>EAC is the fastest increasing cancer in the United States with a 600% increase over the past 25 years. This cancer arises from dysplastic tissue of BE, a complication of gastroesophageal reflux disease (GERD). Chronic acid and bile reflux in the distal esophagus initiates a metaplastic conversion of normal squamous epithelium to premalignant intestinalized columnar epithelium. Patients with BE have a 125-fold higher risk of cancer compared to the general population.<h4>Methods</h4>We critically reviewed the current status of BE monitoring, and subsequent therapeutic strategies being used in patients who have progressed to cancer. Also, new diagnostic tools and therapeutic candidates for BE-related EAC are discussed. Highly-targeted searches of databases containing recent original peer-reviewed papers were utilized for this review.<h4>Conclusions</h4>Novel and well-described biomarkers analyzed in the patient's diseased tissue will provide for more powerful diagnostics, but also possess the potential to develop strategies for personalized management and identify targets for intervention to either cease disease progression or treat BE and/or EAC. Since millions of Americans develop BE without progressing to cancer, there is a critical need to identify the small percentage of Barrett's patients who possess hallmarks of disease progression or carcinogenesis with novel screening techniques. Incorporation of such tools into standard screening protocols for BE surveillance and/or therapy would be critical to detect malignant transformations before clinically obvious cancer ever develops.

Also flagged:pathogenesiscoronary artery diseaseGene ExpressionbindingPI3KAkt
Journal Article 2021-08-01 ✓ 1 Snippet Zuo J, Xu M, Wang D, Bai W, Li G.
In-Text Gene Mentions

…expression levels ofPCDH17and ROCK1 ,…

Show Full Abstract

<h4>Background</h4>The present study aimed to construct a network of competitive endogenous RNAs (ceRNAs) related to the pathogenesis of coronary artery disease (CAD), to provide a novel rationale for CAD treatment.<h4>Methods</h4>Bioinformatics methods were applied to screen for differentially expressed long non-coding RNAs (DElncRNAs), microRNAs (DEmiRNAs), and mRNAs (DEmRNAs) from the GSE68506, GSE59421, and GSE20129 datasets of the Gene Expression Omnibus (GEO) database. The miRcode database was used to predict lncRNA-binding miRNAs. The miRTarBase, miRDB, and TargetScan databases were used to predict the target genes of these miRNAs. An mRNA-miRNA-lncRNA ceRNA network of CAD was established.<h4>Results</h4>Between the CAD and normal control groups there were 264 DElncRNAs, 106 DEmiRNAs, and 1,879 DEmRNAs. We screened these differentially expressed gens (DEGs) respectively. There were 21 DElncRNAs, 13 DEmiRNAs, and 143 DEmRNAs in the ceRNA network by using Cytoscape application. The DEmRNAs were involved in the <i>PI3K-Akt</i> signaling pathway and the <i>NF-κB</i> signaling pathway. The key genes in the protein-protein interaction (PPI) network were <i>HSP90AA1</i>, <i>CDKN1A</i>, <i>MCL1</i>, <i>MDM2</i>, <i>MAPK1</i>, <i>ABL1</i>, <i>LYN</i>, <i>CRK</i>, <i>CDK9</i>, and <i>FAS</i>.<h4>Conclusions</h4>The ceRNA network constructed in this study identified new candidate molecules for the treatment of CAD, providing some more comprehensive and higher-quality choices for the target treatment of CAD.

Also flagged:non-small cell lung cancerNSCLCpathogenesisSOCS6reverse transcriptiondeoxyuridine
Journal Article 2021-08-01 ✓ 5 Snippets Ye Y, Wu X, Long F, Yue W, Wu D, Xie Y.
In-Text Gene Mentions

(E) Circ_0015278 and KLHL20 messenger RNA were examined after actinomycin D treatment at 0, 6, 8, 12, 18, and 24 hours (n=3).

Circ_0015278 was stable in response to actinomycin D treatment and its half-life was over 24 hours, but the half-life of linear KLHL20 messenger RNA (mRNA) was less than 12 hours (Figure 1E).

…of circ_0015278 andKLHL20were analyzed with…

…half-life of linearKLHL20messenger RNA (mRNA)…

…® treatment, butKLHL20mRNA was degraded,…

Show Full Abstract

<h4>Background</h4>Non-small cell lung cancer (NSCLC) is one of the most lethal malignancies worldwide. Deepening understanding of the pathogenesis of NSCLC is quite important for its treatment. Circular (circ) RNA_0015278 has been found to be downregulated in NSCLC, but its role in NSCLC and the underlying regulatory mechanism is unknown.<h4>Methods</h4>Circ_0015278, microRNA (miR)-1278 and SOCS6 were analyzed with real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) or western blot. Cell Counting Kit-8 (CCK-8) and 5-ethynyl-2'-deoxyuridine (EdU) staining were used to evaluate cell proliferation. The colony forming capacity and invasion of NSCLC cells were assessed with colony formation and transwell assays, respectively. The interaction among circ_0015278, miR-1278, and SOCS6 was evaluated using luciferase, receptor interacting protein (RIP), and RNA-pull down assays. Cell apoptosis was analyzed using flow cytometry. A subcutaneous NSCLC xenograft mouse model was established for evaluating circ_0015278-mediated effects on the growth of NSCLC <i>in vivo</i>.<h4>Results</h4>Circ_0015278 was downregulated in NSCLC tissues and cells, and its reduced expression indicated poor prognosis. Overexpression of circ_0015278 restrained the proliferation, colony formation, invasion, and epithelial-mesenchymal transition (EMT) of NSCLC cells and induced NSCLC cell apoptosis. Moreover, overexpression of circ_0015278 inhibited the growth of NSCLC <i>in vivo</i>. Mechanically, circ_0015278 acted as an miR-1278 sponge to reduce its quantity, and miR-1278 targeted SOCS6 to inhibit its expression in NSCLC cells. Circ_0015278 promoted SOCS6 expression by sponging miR-1,278 in NSCLC cells. Overexpression of circ_0015278 attenuated the malignant phenotypes of NSCLC through sponging miR-1278 and consequently promoting SOCS6 expression.<h4>Conclusions</h4>We demonstrated for the first time that circ_0015278 attenuated the progression of NSCLC via targeting the miR-1278/SOCS6 axis, which provides potential diagnostic biomarkers and therapeutic targets.

Also flagged:hepatocellular carcinomatumorLiver fibrosispathogenesismalignant tumorsliver cancer
Journal Article 2021-08-01 ✓ 1 Snippet Lin E, Zou B, Zeng G, Cai C, Li P, Chen J, Li D, Zhang B, Li J.
In-Text Gene Mentions

…>30%, and earlyhemochromatosis, among others (…

Show Full Abstract

<h4>Background</h4>The pathogenesis of non-cirrhotic hepatocellular carcinoma (HCC) with a high recurrence remains controversial, while microvascular invasion (MVI) is highly suggestive of tumor recurrence. This study aimed to investigate the effects of liver fibrosis on MVI and prognosis in HCC.<h4>Methods</h4>Based on the data of HCC in the Surveillance, Epidemiology, and End Results (SEER) database [2004-2015], multivariate logistic regression was used for correlation analysis. Survival was analyzed by Log-Rank test and Cox regression, and decision curve analysis and receiver operating characteristic curves were established to evaluate alternative diagnostic and prognostic strategies.<h4>Results</h4>The study included 1,492 patients with MVI (17.8%) or without MVI (82.2%) for HCC with a solitary nodule. Liver fibrosis was significantly correlated with the occurrence of MVI, and the risk of MVI in patients with a fibrosis score F5-6 was lower than in those with a score of F0-4 (OR =0.651, 95% CI: 0.492-0.860). Combining liver fibrosis could improve the prediction performance of MVI risk models, but liver fibrosis was less associated with survival outcomes in comparison with other tumor characteristics.<h4>Conclusions</h4>Lower liver fibrosis correlated with a higher risk of MVI in HCC with a solitary nodule and was a good indicator for improving the performance of MVI risk models. However, it was not a prognostic sensitive indicator.

Also flagged:mental illnesspanic attacksPDquercetinβ-sitosterolbenzyl
Journal Article 2021-08-01 ✓ 1 Snippet Zhao R, Liu P, Song A, Liu J, Chu Q, Liu Y, Jiang Y, Dong C, Shi H, Yan Z.
In-Text Gene Mentions

5-HTTis a transmembrane…

Show Full Abstract

<h4>Background</h4>Panic disorder (PD) is a kind of mental illness characterized by the symptom of recurring panic attacks. Qiangzhifang (QZF) is a novel decoction developed by Professor Zhaojun Yan based on a unique system of syndrome differentiation and clinical experience. It has achieved remarkable results after long-term clinical practice, but its mechanism of action is still unclear. This study aims to use network pharmacology and molecular docking to explore the mechanism of QZF in the treatment of PD.<h4>Methods</h4>We used the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP), a literature search, and Encyclopedia of Traditional Chinese Medicine (ETCM) to find active ingredients and targets of QZF. We searched for PD targets in GeneCards, Online Mendelian Inheritance in Man (OMIM), the Comparative Toxicogenomics Database (CTD), and DrugBank. We established a PD target database, constructed a protein-protein interaction (PPI) network, and performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis in order to screen possible pathways of action and analyze the mechanism.<h4>Results</h4>This study identified 84 effective components of QZF, 691 potential targets, 357 PD targets, and 97 intersectional targets. Enrichment analysis using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) showed that QZF was associated with 118 biological processes (BPs), 18 cellular components (CCs), 35 molecular functions (MFs) [false discovery rate (FDR) <0.01], and 62 pathways (FDR <0.01). QZF mainly acts on its targets <i>AKT1, FOS</i>, and <i>APP</i> through active ingredients such as quercetin, β-sitosterol, 4-(4'-hydroxybenzyloxy)benzyl methyl ether, harmine, 1,7-dimethoxyxanthone, and 1-hydroxy-3,7-dimethoxyxanthone to regulate serotonin, gamma-aminobutyric acid (GABA), cyclic adenosine monophosphate (cAMP), and other signal pathways to treat PD.<h4>Conclusions</h4>Through network pharmacology and molecular docking technology, we predicted the possible mechanism of QZF in the treatment of PD, revealed the interaction targets and potential value of QZF, and provided a basis for its clinical application.

Also flagged:infectionhepatocellular cancerHCV infectioncirrhosisinterferonliver disease
Journal Article 2021-08-01 ✓ 1 Snippet Nguyen N, Patel K, Uhelski AC, Waters B, Weir A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Chronic hepatitis C virus (HCV) infection is a common risk factor for hepatocellular cancer (HCC). Patients with HCV infection are at a higher risk of developing HCC because the virus induces fibrosis in the liver, which may lead to cirrhosis. Early treatment of HCV and achieving a sustained virologic response (SVR) may lead to decreased incidence and mortality associated with HCC.<h4>Methods</h4>We performed a retrospective review of patients at the Memphis Veterans Affairs Medical Center (VAMC) in Tennessee from November 2008 to March 2019 to determine whether treatment of HCV infection makes a difference in overall survival (OS) among patients who develop HCC. Patients were treated with an interferon-based regimen or direct-acting antiviral agents (DAAs). Among the patients with HCV infection who were treated, we identified those who did achieve or did not achieve SVR.<h4>Results</h4>We identified 111 patients with HCV and HCC; 68 were treated for HCV infection. Forty-eight patients received DAA and 20 patients received an interferon-based regimen and 51 achieved SVR. In a multivariate analysis accounting for severity of liver disease, treated patients had an improved 5-year OS rate, median 1338 days (95% CI, 966-3202) when compared with untreated patients whose median OS was 452 days (95% CI, 242-853) (<i>P</i> = .0005). The treatment group had a longer median progression-free survival (PFS) than did the nontreatment group (460 days [95% CI, 294-726] vs 286 days [95% CI, 205-405], <i>P</i> = .04). Patients with SVR had an increased 5-year OS compared with patients without SVR (median 1973 days [95% CI, 1222-NA] vs 470 days [95% CI, 242-853], <i>P</i> < .001). HCV treatment type (interferon vs DAA) was not found to be associated with either OS or PFS, regardless of time period. Advanced liver disease stage as characterized by a high model for end-stage liver disease (MELD) score (> 10) or high Child-Pugh score (B or C) was associated with worse survival outcome.<h4>Conclusions</h4>A retrospective analysis of patients with HCV infection and HCC confirms that treatment of HCV infection leads to OS benefit among patients with HCC. We further demonstrate that patients with HCV infection who achieve SVR have an OS benefit over patients unable to achieve SVR. The type of treatment, DAA vs an interferon-based regimen, did not show a significant survival benefit.

Also flagged:Semastreptavidin3A3MBPvinculinphalloidin
Journal Article 2021-08-01 No Snippets Nitzan A, Corredor-Sanchez M, Galron R, Nahary L, Safrin M, Bruzel M, Moure A, Bonet R, Pérez Y, Bujons J, Vallejo-Yague E, Sacks H, Burnet M, Alfonso I, Messeguer A, Benhar I, Barzilai A, Solomon AS.
Show Full Abstract

<h4>Purpose</h4>Semaphorin 3A (Sema-3A) is a secreted protein that deflects axons from inappropriate regions and induces neuronal cell death. Intravitreal application of polyclonal antibodies against Sema-3A prevents loss of retinal ganglion cells ensuing from axotomy of optic nerves. This suggested a therapeutic approach for neuroprotection via inhibition of the Sema-3A pathway.<h4>Methods</h4>To develop potent and specific Sema-3A antagonists, we isolated monoclonal anti-Sema-3A antibodies from a human antibody phage display library and optimized low-molecular weight Sema-3A signaling inhibitors. The best inhibitors were identified using in vitro scratch assays and semiquantitative repulsion assays.<h4>Results</h4>A therapeutic approach for neuroprotection must have a long duration of action. Therefore, antibodies and low-molecular weight inhibitors were formulated in extruded implants to allow controlled and prolonged release. Following release from the implants, Sema-3A inhibitors antagonized Sema-3A effects in scratch and repulsion assays and protected retinal ganglion cells in animal models of optic nerve injury, retinal ischemia, and glaucoma.<h4>Conclusions and translational relevance</h4>Collectively, our findings indicate that the identified Sema-3A inhibitors should be further evaluated as therapeutic candidates for the treatment of Sema-3A-driven central nervous system degenerative processes.

bioRxiv 2021-08-01 Preprint (No Snippets API) Schimke LF, Marques AH, Baiocchi GC, de Souza Prado CA, Fonseca DLM, Freire PP, Plaça DR, Filgueiras IS, Salgado RC, Jansen-Marques G, Oliveira AER, Peron JPS, Cabral-Miranda G, Barbuto JAM, Camara NOS, Calich VLG, Ochs HD, Condino-Neto A, Overmyer KA, Coon JJ, Balnis J, Jaitovich A, Schulte-Schrepping J, Ulas T, Schultze JL, Nakaya HI, Jurisica I, Jurisica I, Cabral-Marques O.
Show Full Abstract

Severe COVID-19 patients present a clinical and laboratory overlap with other hyperinflammatory conditions such as hemophagocytic lymphohistiocytosis (HLH). However, the underlying mechanisms of these conditions remain to be explored. Here, we investigated the transcriptome of 1596 individuals, including patients with COVID-19 in comparison to healthy controls, other acute inflammatory states (HLH, multisystem inflammatory syndrome in children [MIS-C], Kawasaky disease [KD]), and different respiratory infections (seasonal coronavirus, influenza, bacterial pneumonia). We observed that COVID-19 and HLH share immunological pathways (cytokine/chemokine signaling and neutrophil-mediated immune responses), including gene signatures that stratify COVID-19 patients admitted to the intensive care unit (ICU) and COVID-19_nonICU patients. Of note, among the common differentially expressed genes (DEG), there is a cluster of neutrophil-associated genes that reflects a generalized hyperinflamatory state since it is also dysregulated in patients with KD and bacterial pneumonia. These genes are dysregulated at protein level across several COVID-19 studies and form an interconnected network with differentially expressed plasma proteins that point to neutrophil hyperactivation in COVID-19 patients admitted to the intensive care unit. scRNAseq analysis indicated that these genes are specifically upregulated across different leukocyte populations, including lymphocyte subsets and immature neutrophils. Artificial intelligence modeling confirmed the strong association of these genes with COVID-19 severity. Thus, our work indicates putative therapeutic pathways for intervention.