Gene Literature Dashboard

Viewing July 2022 — 751 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← June 2022 August 2022 →
Also flagged:TRIM18viral myocarditismyocarditispneumoniaencephalitisacids
Journal Article 2022-07-31 ✓ 1 Snippet Fang M, Zhang A, Du Y, Lu W, Wang J, Minze LJ, Cox TC, Li XC, Xing J, Zhang Z.
In-Text Gene Mentions

…On contrast,TRIM38is shown to…

Show Full Abstract

<h4>Background</h4>Infections by viruses including severe acute respiratory syndrome coronavirus 2 could cause organ inflammations such as myocarditis, pneumonia and encephalitis. Innate immunity to viral nucleic acids mediates antiviral immunity as well as inflammatory organ injury. However, the innate immune mechanisms that control viral induced organ inflammations are unclear.<h4>Methods</h4>To understand the role of the E3 ligase TRIM18 in controlling viral myocarditis and organ inflammation, wild-type and Trim18 knockout mice were infected with coxsackievirus B3 for inducing viral myocarditis, influenza A virus PR8 strain and human adenovirus for inducing viral pneumonia, and herpes simplex virus type I for inducing herpes simplex encephalitis. Mice survivals were monitored, and heart, lung and brain were harvested for histology and immunohistochemistry analysis. Real-time PCR, co-immunoprecipitation, immunoblot, enzyme-linked immunosorbent assay, luciferase assay, flow cytometry, over-expression and knockdown techniques were used to understand the molecular mechanisms of TRIM18 in regulating type I interferon (IFN) production after virus infection in this study.<h4>Results</h4>We find that knockdown or deletion of TRIM18 in human or mouse macrophages enhances production of type I IFN in response to double strand (ds) RNA and dsDNA or RNA and DNA virus infection. Importantly, deletion of TRIM18 protects mice from viral myocarditis, viral pneumonia, and herpes simplex encephalitis due to enhanced type I IFN production in vivo. Mechanistically, we show that TRIM18 recruits protein phosphatase 1A (PPM1A) to dephosphorylate TANK binding kinase 1 (TBK1), which inactivates TBK1 to block TBK1 from interacting with its upstream adaptors, mitochondrial antiviral signaling (MAVS) and stimulator of interferon genes (STING), thereby dampening antiviral signaling during viral infections. Moreover, TRIM18 stabilizes PPM1A by inducing K63-linked ubiquitination of PPM1A.<h4>Conclusions</h4>Our results indicate that TRIM18 serves as a negative regulator of viral myocarditis, lung inflammation and brain damage by downregulating innate immune activation induced by both RNA and DNA viruses. Our data reveal that TRIM18 is a critical regulator of innate immunity in viral induced diseases, thereby identifying a potential therapeutic target for treatment.

Also flagged:B-cell lymphomaB cell lymphomascBCLbindingmethylationhypermethylation
Journal Article 2022-07-31 ✓ 1 Snippet Chu S, Avery A, Yoshimoto J, Bryan JN.
In-Text Gene Mentions

PCDH17

Show Full Abstract

Few recurrent DNA mutations are seen in aggressive canine B cell lymphomas (cBCL), suggesting other frequent drivers. The methylated island recovery assay (MIRA-seq) or methylated CpG-binding domain sequencing (MBD-seq) was used to define the genome-wide methylation profiles in aggressive cBCL in Golden Retrievers to determine if cBCL can be better defined by epigenetic changes than by DNA mutations. DNA hypermethylation patterns were relatively homogenous within cBCL samples in Golden Retrievers, in different breeds and in geographical regions. Aberrant hypermethylation is thus suspected to be a central and early event in cBCL lymphomagenesis. Distinct subgroups within cBCL in Golden Retrievers were not identified with DNA methylation profiles. In comparison, the methylome profile of human DLBCL (hDLBCL) is relatively heterogeneous. Only moderate similarity between hDLBCL and cBCL was seen and cBCL likely cannot be accurately classified into the subtypes seen in hDLBCL. Genes with hypermethylated regions in the promoter-TSS-first exon of cBCL compared to normal B cells often also had additional hyper- and hypomethylated regions distributed throughout the gene suggesting non-randomized repeat targeting of key genes by epigenetic mechanisms. The prevalence of hypermethylation in transcription factor families in aggressive cBCL may represent a fundamental step in lymphomagenesis.

Also flagged:cancermucoepidermoid carcinomaHead and Neck Cancergene expressionIFN-γlipid
Journal Article 2022-07-31 ✓ 1 Snippet Kang H, Seo MK, Park B, Yoon SO, Koh YW, Kim D, Kim S.
In-Text Gene Mentions

…variations (CNVs) inDCC, SMAD4 , and…

Show Full Abstract

<h4>Introduction</h4>Characterizing the tumor microenvironment (TME) and immune landscape of cancer has been a promising step towards discovering new therapeutic biomarkers and guiding precision medicine; however, its application in mucoepidermoid carcinoma (MEC) has been sparse. Here, we conducted a comprehensive study to understand the properties of the TME and immune profiles of MEC.<h4>Method</h4>20 patients with MEC were collected from Yonsei Head and Neck Cancer Centre, Yonsei University, South Korea. Total RNA sequencing was conducted to determine gene expression profiles. Bioinformatic and immunoinformatic analyses were applied to characterize the TME and identify immunophenotypic subgroups, and to investigate the molecular features that explain the distinct phenotypes.<h4>Results</h4>The MEC samples were subdivided into two groups, immune hot and immune cold, based on the heterogenous immune cell-infiltration and activation level. The immune-hot subgroup exhibited a higher level of immune activity, including T cell infiltration, cytolytic score, IFN-γ, antigen-presenting machinery, and immune modulator genes. Further characterizing molecular features of two subgroups, downregulation of lipid metabolic regulators, including MLXIPL and FASN, and the migration of chemokines and leukocytes were observed, respectively. And, Group-specific expression of immune checkpoint molecules, such as TIGIT, PD-L2, and CTLA-4, was observed in the immune-hot group, which can be exploited as a potential immunotherapeutic biomarker.<h4>Conclusions</h4>Immunophenotypically heterogeneous MEC subgroups analysis has shown distinctive molecular characteristics and provided potential treatment options. These findings yield new insights into TME of MEC and may help next step to study this uncharted cancer.

Also flagged:calciumosteogenesisossificationmetabolismbone formationBone tissue remodeling
Journal Article 2022-07-31 No Snippets Wawrzyniak A, Balawender K.
Show Full Abstract

As an essential component of the skeleton, bone tissue provides solid support for the body and protects vital organs. Bone tissue is a reservoir of calcium, phosphate, and other ions that can be released or stored in a controlled manner to provide constant concentration in body fluids. Normally, bone development or osteogenesis occurs through two ossification processes (intra-articular and intra-chondral), but the first produces woven bone, which is quickly replaced by stronger lamellar bone. Contrary to commonly held misconceptions, bone is a relatively dynamic organ that undergoes significant turnover compared to other organs in the body. Bone metabolism is a dynamic process that involves simultaneous bone formation and resorption, controlled by numerous factors. Bone metabolism comprises the key actions. Skeletal mass, structure, and quality are accrued and maintained throughout life, and the anabolic and catabolic actions are mostly balanced due to the tight regulation of the activity of osteoblasts and osteoclasts. This activity is also provided by circulating hormones and cytokines. Bone tissue remodeling processes are regulated by various biologically active substances secreted by bone tissue cells, namely RANK, RANKL, MMP-1, MMP-9, or type 1 collagen. Bone-derived factors (BDF) influence bone function and metabolism, and pathophysiological conditions lead to bone dysfunction. This work aims to analyze and evaluate the current literature on various local and systemic factors or immune system interactions that can affect bone metabolism and its impairments.

Also flagged:RNA-Binding ProteinsGene ExpressionAHNAKMAP1BLAMA2P4HB
Journal Article 2022-07-31 ✓ 3 Snippets Gu L, Chen Y, Li X, Mei Y, Zhou J, Ma J, Zhang M, Hou T, He D, Zeng J.
In-Text Gene Mentions

Studies found that MTG1, CTU1, and PPARGC1B gene expressions were related to optimistic prognoses in patients with BC, whereas high RBMS3, DARS2, ENOX1, IGF2BP2, ZNF106, CTIF, and NOVA1 gene expressions were related to pessimistic prognoses [15].

…including CTIF, CTU1,DARS2, ENOX1, IGF2BP2, LIN28A,…

…whereas high RBMS3,DARS2, ENOX1, IGF2BP2, ZNF106,…

Show Full Abstract

RBPs in the development and progression of BC remains unclear. Here, we elucidated the role of RBPs in predicting the survival of patients with BC. Clinical information and RNA sequencing data of the training and validation cohorts were downloaded from the Cancer Genome Atlas and Gene Expression Omnibus databases, respectively. Survival-related differentially expressed RBPs were identified using Cox regression analyses. A total of 113 upregulated and 54 downregulated RBPs were observed, with six showing prognostic values (AHNAK, MAP1B, LAMA2, P4HB, FASN, and GSDMB). In both the GSE32548 and GSE31684 datasets, patients with low-risk scores in survival-related six RBPs-based prognostic model showed longer overall survival than those with high-risk scores. AHNAK, MAP1B, P4HB, and FASN expression were significantly upregulated in both BC tissues and cell lines. BC tissues from high-risk group showed higher proportions of naive CD4+ T cells, M0 and M2 macrophages, and neutrophils and lower proportions of plasma cells, CD8+ T cells, and T-cell follicular helper compared to low-risk group. AHNAK knockdown significantly inhibited the proliferation, invasion, and migration of BC cells in vitro and inhibited the growth of subcutaneous tumors in vivo. We thus developed and functionally validated a novel six RBPs-based prognostic model for BC.

Also flagged:TryptophanMetabolismDepressionanhedoniasleepamino acid
Journal Article 2022-07-31 No Snippets Correia AS, Vale N.
Show Full Abstract

Depression is a common and serious disorder, characterized by symptoms like anhedonia, lack of energy, sad mood, low appetite, and sleep disturbances. This disease is very complex and not totally elucidated, in which diverse molecular and biological mechanisms are involved, such as neuroinflammation. There is a high need for the development of new therapies and gaining new insights into this disease is urgent. One important player in depression is the amino acid tryptophan. This amino acid can be metabolized in two important pathways in the context of depression: the serotonin and kynurenine pathways. These metabolic pathways of tryptophan are crucial in several processes that are linked with depression. Indeed, the maintenance of the balance of serotonin and kynurenine pathways is critical for the human physiological homeostasis. Thus, this narrative review aims to explore tryptophan metabolism (particularly in the serotonin and kynurenine pathways) in depression, starting with a global overview about these topics and ending with the focus on these pathways in neuroinflammation, stress, microbiota, and brain-derived neurotrophic factor regulation in this disease. Taken together, this information aims to clarify the metabolism of tryptophan in depression, particularly the serotonin and kynurenine pathways.

Also flagged:Azobenzenebiopolymerschitosanmitochondrialmetabolismtrypan blue
Journal Article 2022-07-31 No Snippets Londoño-Berrío M, Pérez-Buitrago S, Ortiz-Trujillo IC, Hoyos-Palacio LM, Orozco LY, López L, Zárate-Triviño DG, Capobianco JA, Mena-Giraldo P.
Show Full Abstract

Drug nanoencapsulation increases the availability, pharmacokinetics, and concentration efficiency for therapeutic regimes. Azobenzene light-responsive molecules experience a hydrophobicity change from a polar to an apolar tendency by <i>trans-cis</i> photoisomerization upon UV irradiation. Polymeric photoresponse nanoparticles (PPNPs) based on azobenzene compounds and biopolymers such as chitosan derivatives show prospects of photodelivering drugs into cells with accelerated kinetics, enhancing their therapeutic effect. PPNP biocompatibility studies detect the safe concentrations for their administration and reduce the chance of side effects, improving the effectiveness of a potential treatment. Here, we report on a PPNP biocompatibility evaluation of viability and the first genotoxicity study of azobenzene-based PPNPs. Cell line models from human ventricular cardiomyocytes (RL14), as well as mouse fibroblasts (NIH3T3) as proof of concept, were exposed to different concentrations of azobenzene-based PPNPs and their precursors to evaluate the consequences on mitochondrial metabolism (MTT assay), the number of viable cells (trypan blue exclusion test), and deoxyribonucleic acid (DNA) damage (comet assay). Lethal concentrations of 50 (LC50) of the PPNPs and their precursors were higher than the required drug release and synthesis concentrations. The PPNPs affected the cell membrane at concentrations higher than 2 mg/mL, and lower concentrations exhibited lesser damage to cellular genetic material. An azobenzene derivative functionalized with a biopolymer to assemble PPNPs demonstrated biocompatibility with the evaluated cell lines. The PPNPs encapsulated Nile red and dofetilide separately as model and antiarrhythmic drugs, respectively, and delivered upon UV irradiation, proving the phototriggered drug release concept. Biocompatible PPNPs are a promising technology for fast drug release with high cell interaction opening new opportunities for azobenzene biomedical applications.

Also flagged:StrontiumApatiteboronbone formationApical periodontitisinflammatory disease
Journal Article 2022-07-31 No Snippets Oztekin F, Gurgenc T, Dundar S, Ozercan IH, Yildirim TT, Eskibaglar M, Ozcan EC, Macit CK.
Show Full Abstract

In the present study, the structural, morphological, and in vivo biocompatibility of un-doped and boron (B)-doped strontium apatite (SrAp) nanoparticles were investigated. Biomaterials were fabricated using the hydrothermal process. The structural and morphological characterizations of the fabricated nanoparticles were performed by XRD, FT-IR, FE-SEM, and EDX. Their biocompatibility was investigated by placing them in defects in rat tibiae in vivo. The un-doped and B-doped SrAp nanoparticles were successfully fabricated. The produced nanoparticles were in the shape of nano-rods, and the dimensions of the nano-rods decreased as the B ratio increased. It was observed that the structural and morphological properties of strontium apatite nanoparticles were affected by the contribution of B. A stoichiometric Sr/P ratio of 1.67 was reached in the 5% B-doped sample (1.68). The average crystallite sizes were 34.94 nm, 39.70 nm, 44.93 nm, and 48.23 nm in un-doped, 1% B-doped, 5% B-doped, and 10% B-doped samples, respectively. The results of the in vivo experiment revealed that the new bone formation and osteoblast density were higher in the groups with SrAp nanoparticles doped with different concentrations of B than in the control group, in which the open defects were untreated. It was observed that this biocompatibility and the new bone formation were especially elevated in the B groups, which added high levels of strontium were added. The osteoblast density was higher in the group in which the strontium element was placed in the opened bone defect compared with the control group. However, although new bone formation was slightly higher in the strontium group than in the control group, the difference was not statistically significant. Furthermore, the strontium group had the highest amount of fibrotic tissue formation. The produced nanoparticles can be used in dental and orthopedic applications as biomaterials.

Also flagged:FerroptosisCancerdeathtumorironlipid
Journal Article 2022-07-31 ✓ 2 Snippets Chen H, Wang C, Liu Z, He X, Tang W, He L, Feng Y, Liu D, Yin Y, Li T.
In-Text Gene Mentions

glutamine; GLS, glutaminase; Glu, glutamate; Gly, glycine; GPNA, L-g-glutamyl-p-nitroanilide; GPX4, glutathione peroxidase 4; GSH, glutathione; GSSG, glutathione-S-S-glutathione; G6PD, glucose-6-phosphate dehydrogenase; 15-HpETE-PE, 15-hydroperoxy-eicosa-tetra-enoyl-phosphatidylethanolamine; IMCA, 2-imino-6-methoxy-2H-chromene-3-carbothioamide; Lip-1, Liproxstatin-1; LOX, Lipoxygenase; LPCAT3, Lysophosphatidylcholine acyl-transferase 3; LIP, labile iron pool; NAAs, neutral amino acids; NCOA4, nuclear receptor coactivator 4; NDGA, nordihydroguaiaretic acid; Nedd4, Neuronal precursor cell-expressed developmentally downregulated 4; PE, phosphatidylethanolamine; PEBP1, Phosphatidylethanolamine binding protein 1; PepA-Me, Pepstatin A-methyl ester; PGD, phosphoglycerate dehydrogenase; PPAR-γ, Peroxisome proliferator-activated receptor gamma; ROS, reactive oxygen species; RPL8, Ribosomal protein L8; RSL3, RAS-selective lethal small molecule 3; SSZ, sulfasalazine; STEAP3, six transmembrane epithelial antigens of the prostate 3; TAM, tumor-associated macrophages; TfR1, transferrin receptor 1; TTC35, Tetratricopeptide repeat domain 35; TZDs, Thiazolidinediones; VDAC2, Voltage-dependent anion channel 2; VDAC3, Voltage-dependent anion channel 3; α-ketoglutarate (α-KG); β-ME, β-mercaptoethanol.

… PE, phosphatidylethanolamine;PEBP1, Phosphatidylethanolamine bin…

Show Full Abstract

Ferroptosis, a new type of non-apoptotic cell death modality, is different from other modes of cell death and has been primarily found in tumor cells. Previous studies have reported that ferroptosis can be triggered by specific modulators (e.g., drugs, nutrients, and iron chelators), leading to increased intracellular lipid reactive oxygen species (ROS) accumulation and iron overload. Recent reports have shown that ferroptosis at the cellular and organism levels can prevent an inflammatory storm and cancer development. Emerging evidence suggests potential mechanisms (e.g., system Xc-, glutathione peroxidase 4 (GPX4), lipid peroxidation, glutathione (GSH), and iron chelators) are involved in ferroptosis, which may mediate biological processes such as oxidative stress and iron overload to treat cancer. To date, there are at least three pathways that mediate ferroptosis in cancer cells: system Xc-/GSH/GPX4, FSP1/CoQ10/NAD(P)H, and ATG5/ATG7/NCOA4. Here, we summarize recent advances in the occurrence and development of ferroptosis in the context of cancer, the associations between ferroptosis and various modulators, and the potential mechanisms and therapeutic strategies targeting ferroptosis for the treatment of cancer.

Also flagged:chronic liver diseasescytoplasmicviral genometranslation initiationhepatomaliver disease
Journal Article 2022-07-31 ✓ 1 Snippet Vrazas V, Moustafa S, Makridakis M, Karakasiliotis I, Vlahou A, Mavromara P, Katsani KR.
In-Text Gene Mentions

…mRNA processing, RBM28,DDX27, and MRTO4, were…

Show Full Abstract

Hepatitis C virus is the major cause of chronic liver diseases and the only cytoplasmic RNA virus known to be oncogenic in humans. The viral genome gives rise to ten mature proteins and to additional proteins, which are the products of alternative translation initiation mechanisms. A protein-known as ARFP (alternative reading frame protein) or Core+1 protein-is synthesized by an open reading frame overlapping the HCV Core coding region in the (+1) frame of genotype 1a. Almost 20 years after its discovery, we still know little of the biological role of the ARFP/Core+1 protein. Here, our differential proteomic analysis of stable hepatoma cell lines expressing the Core+1/Long isoform of HCV-1a relates the expression of the Core+1/Long isoform with the progression of the pathology of HCV liver disease to cancer.

Also flagged:aortic valve endocarditisabscesspositronpolymeraseProsthetic valve infective endocarditisaortic root abscess
Journal Article 2022-07-31 No Snippets Bui STT, Duong HD, Vu TT, Phan NT, Nguyen AV, Mai SH, Nguyen HTT.
Show Full Abstract

<h4>Introduction</h4>Prosthetic valve infective endocarditis (PVE) is a diagnostic challenge even in the era of multimodality cardiovascular imaging.<h4>Case presentation</h4>The patient was a 67-year-old male with a three-year history of bioprosthetic aortic valve replacement who presented with persistent fever and negative blood cultures. The initial transthoracic echocardiography revealed a thickened aortic root. An abscess formation was visualized upon subsequent three-dimensional transesophageal echocardiography and positron emission tomography/computerized tomography (PET/CT). The patient underwent an urgent necrotic tissue debridement and a redo Bentall surgery. The real-time polymerase chain reaction of excised tissues was positive for <i>Streptococcus</i>.<h4>Clinical discussion</h4>The diagnosis of PVE and its complications requires the integration of clinical, microbiological, and serial imaging data. Although advanced imaging modalities like PET/CT allow a timely diagnosis and management, their routine use in resource-limited scenarios is difficult.<h4>Conclusion</h4>Multimodality cardiovascular imaging plays an important role in the diagnosis of PVE. Serial echocardiographic and clinical assessments are possible alternatives when the access to advanced cardiovascular imaging modalities is limited.

bioRxiv 2022-07-31 Preprint (No Snippets API) Reyes-Ortiz AM, Abud EM, Burns MS, Wu J, Hernandez SJ, Geller N, Wang KQ, Schulz C, Miramontes R, Lau A, Michael N, Miyoshi E, Blurton-Jones M, Van Vactor D, Reidling JC, Swarup V, Poon WW, Lim RG, Thompson LM.
Show Full Abstract

<h4>Summary</h4> Huntington’s disease (HD) is a neurodegenerative disease caused by an expanded CAG repeat within the Huntingtin ( HTT ) gene having dysregulated cellular homeostasis in the central nervous system, particularly in the striatum and cortex. Astrocytes establish and maintain neuronal functions through the secretion of soluble factors and physical interactions with other neurovascular unit cell types. Under pathological conditions, astrocytes can become reactive, causing cell state transitions that affect brain function. To investigate transitions between cellular states in unaffected and HD astrocytes at high resolution, single-nuclei RNA-sequencing (snRNA-seq) was performed on human HD patient induced pluripotent stem cell (iPSC)-derived astrocytes and on striatal and cortical tissue from a rapidly progressing HD mouse model (R6/2). Analysis of HD human and mouse astrocytes revealed both models have alterations in morphology, glutamate uptake, and dysregulation of astrocyte identity and maturation, whereas dysregulated actin-mediated signaling was unique to human iPSC-derived astrocytes. Representative proteins showed altered levels by Western. In both species, HD transcriptional changes reveal potential astrocyte maturation deficits that were potentially driven by astrogliogenesis transcription factors, including ATF3 and NFIA. When perturbed in a drosophila model of HD, knockdown of NFIA in glia rescued the climbing deficit. These data further support the hypothesis that mutant HTT induces dysregulated astrocyte cell states resulting in dysfunctional astrocytic properties, suggests that some of these states are cell autonomous and maybe unique to human HD, and implicate ATF3 and maturation deficits in HD pathogenesis.

Also flagged:Coronavirus disease 2019COVID-19coronavirus infectionsacute respiratory distress syndromeARDSmultiorgan failure
Journal Article 2022-07-30 ✓ 1 Snippet Zamani Rarani F, Zamani Rarani M, Hamblin MR, Rashidi B, Hashemian SMR, Mirzaei H.
In-Text Gene Mentions

…for gamma- anddelta-coronaviruses[ 8 –…

Show Full Abstract

The pandemic outbreak of coronavirus disease 2019 (COVID-19) has created health challenges in all parts of the world. Understanding the entry mechanism of this virus into host cells is essential for effective treatment of COVID-19 disease. This virus can bind to various cell surface molecules or receptors, such as angiotensin-converting enzyme 2 (ACE2), to gain cell entry. Respiratory failure and pulmonary edema are the most important causes of mortality from COVID-19 infections. Cytokines, especially proinflammatory cytokines, are the main mediators of these complications. For normal respiratory function, a healthy air-blood barrier and sufficient blood flow to the lungs are required. In this review, we first discuss airway epithelial cells, airway stem cells, and the expression of COVID-19 receptors in the airway epithelium. Then, we discuss the suggested molecular mechanisms of endothelial dysfunction and blood vessel damage in COVID-19. Coagulopathy can be caused by platelet activation leading to clots, which restrict blood flow to the lungs and lead to respiratory failure. Finally, we present an overview of the effects of immune and non-immune cells and cytokines in COVID-19-related respiratory failure.

Also flagged:Metabolismtumorgastric cancerdeathoxygenlactic acid
Journal Article 2022-07-30 ✓ 1 Snippet Huo J, Guan J, Li Y.
In-Text Gene Mentions

…high expression ofPTGIScould promote the…

Show Full Abstract

<h4>Background</h4>Stromal cells play an important role in the process of tumor progression, but the relationship between stromal cells and metabolic reprogramming is not very clear in gastric cancer (GC).<h4>Methods</h4>Metabolism-related genes associated with stromal cells were identified in The Cancer Genome Atlas (TCGA) and GSE84437 datasets, and the two datasets with 804 GC patients were integrated into a training cohort to establish the prognostic signature. Univariate Cox regression analysis was used to screen for prognosis-related genes. A risk score was constructed by LASSO regression analysis combined with multivariate Cox regression analysis. The patients were classified into groups with high and low risk according to the median value. Two independent cohorts, GSE62254 (n = 300) and GSE15459 (n = 191), were used to externally verify the risk score performance. The CIBERSORT method was applied to quantify the immune cell infiltration of all included samples.<h4>Results</h4>A risk score consisting of 24 metabolic genes showed good performance in predicting the overall survival (OS) of GC patients in both the training (TCGA and GSE84437) and testing cohorts (GSE62254 and GSE15459). As the risk score increased, the patients' risk of death increased. The risk score was an independent prognostic indicator in both the training and testing cohorts suggested by the univariate and multivariate Cox regression analyses. The patients were clustered into four subtypes according to the quantification of 22 kinds of immune cell infiltration (ICI). The proportion of ICI Cluster C with the best prognosis in the low-risk group was approximately twice as high as that in the high-risk group, and the risk score of ICI Cluster C was significantly lower than that of the other three subtypes.<h4>Conclusion</h4>Our study proposed the first scheme for prognostic risk classification of GC from the perspective of tumor stromal cells and metabolic reprogramming, which may contribute to the development of therapeutic strategies for GC.

Also flagged:malariainfectionmixedHRP-2methanolhistidine-rich protein 2
Journal Article 2022-07-30 No Snippets Komaki-Yasuda K, Kutsuna S, Kawaguchi M, Kamei M, Uchihashi K, Nakamura K, Nakamoto T, Ohmagari N, Kano S.
Show Full Abstract

<h4>Background</h4>The automated haematology analyzer XN-31 prototype (XN-31p) is a new flow cytometry-based device developed to measure the number and the ratio of malaria-infected red blood cells (MI-RBC) with a complete blood count (CBC). The XN-31p can provide results in about one minute and also can simultaneously provide information on the malaria parasite (Plasmodium) species. In this study, clinical testing of the XN-31p was performed using blood samples from patients with imported malaria in Japan.<h4>Methods</h4>Blood samples were collected from 80 patients who visited the hospital of the National Center for Global Health and Medicine, Tokyo, Japan, for malaria diagnosis from January 2017 to January 2019. The test results by the XN-31p were compared with those by other standard methods, such as microscopic observation, rapid diagnostic tests and the nested PCR.<h4>Results</h4>Thirty-three patients were diagnosed by the nested PCR as being malaria positive (28 Plasmodium falciparum, 2 Plasmodium vivax, 1 Plasmodium knowlesi, 1 mixed infection of P. falciparum and Plasmodium malariae, and 1 mixed infection of P. falciparum and Plasmodium ovale), and the other 47 were negative. The XN-31p detected 32 patients as "MI-RBC positive", which almost matched the results by the nested PCR and, in fact, completely matched with the microscopic observations. The ratio of RBCs infected with malaria parasites as determined by the XN-31p showed a high correlation coefficient of more than 0.99 with the parasitaemia counted under microscopic observation. The XN-31p can analyse the size and nucleic acid contents of each cell, and the results were visualized on a two-dimensional cytogram termed the "M scattergram". Information on species and developmental stages of the parasites could also be predicted from the patterns visualized in the M scattergrams. The XN-31p showed a positive coincidence rate of 0.848 with the nested PCR in discriminating P. falciparum from the other species.<h4>Conclusions</h4>The XN-31p could rapidly provide instructive information on the ratio of MI-RBC and the infecting Plasmodium species. It was regarded to be of great help for the clinical diagnosis of malaria.

Also flagged:nucleotidenucleotidesretrotranspositionhereditary non-polyposis colorectal cancersmovement disordersepilepsies
Journal Article 2022-07-30 ✓ 1 Snippet Fearnley LG, Bennett MF, Bahlo M.
In-Text Gene Mentions

…expansion in theCA10gene, and an…

Show Full Abstract

Bioinformatic methods for detecting short tandem repeat expansions in short-read sequencing have identified new repeat expansions in humans, but require alignment information to identify repetitive motif enrichment at genomic locations. We present superSTR, an ultrafast method that does not require alignment. superSTR is used to process whole-genome and whole-exome sequencing data, and perform the first STR analysis of the UK Biobank, efficiently screening and identifying known and potential disease-associated STRs in the exomes of 49,953 biobank participants. We demonstrate the first bioinformatic screening of RNA sequencing data to detect repeat expansions in humans and mouse models of ataxia and dystrophy.

Also flagged:coronavirus diseaseCOVID-19pneumoniaimmune responsescoagulopathyPulmonary Intravascular Coagulopathy
Journal Article 2022-07-30 ✓ 1 Snippet Amini S, Rezabakhsh A, Hashemi J, Saghafi F, Azizi H, Sureda A, Habtemariam S, Khayat Kashani HR, Hesari Z, Sahebnasagh A.
In-Text Gene Mentions

…(NF-κB), signal transduceractivation, and activator of transcription 3and activator of…

Show Full Abstract

<h4>Background</h4>In late 2019, the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) which is responsible for coronavirus disease (COVID-19), was identified as the new pathogen to lead pneumonia in Wuhan, China, which has spread all over the world and developed into a pandemic. Despite the over 1 year of pandemic, due to the lack of an effective treatment plan, the morbidity and mortality of COVID-19 remains high. Efforts are underway to find the optimal management for this viral disease.<h4>Main body</h4>SARS-CoV-2 could simultaneously affect multiple organs with variable degrees of severity, from mild to critical disease. Overproduction of pro-inflammatory mediators, exacerbated cellular and humoral immune responses, and coagulopathy such as Pulmonary Intravascular Coagulopathy (PIC) contributes to cell injuries. Considering the pathophysiology of the disease and multiple microthrombi developments in COVID-19, thrombolytic medications seem to play a role in the management of the disease. Beyond the anticoagulation, the exact role of thrombolytic medications in the management of patients with COVID-19-associated acute respiratory distress syndrome (ARDS) is not explicit. This review focuses on current progress in underlying mechanisms of COVID-19-associated pulmonary intravascular coagulopathy, the historical use of thrombolytic drugs in the management of ARDS, and pharmacotherapy considerations of thrombolytic therapy, their possible benefits, and pitfalls in COVID-19-associated ARDS.<h4>Conclusions</h4>Inhaled or intravenous administration of thrombolytics appears to be a salvage therapy for severe ARDS associated with COVID-19 by prompt attenuation of lung injury. Considering the pathogenesis of COVID-19-related ARDS and mechanism of action of thrombolytic agents, thrombolytics appear attractive options in stable patients without contraindications.

Also flagged:copolyestercopolyesters,5-diethoxyterephthalic acid,7terephthalic acidhydroquinone
Journal Article 2022-07-30 No Snippets Park S, Na Y, Kim AY, Kwac LK, Kim HG, Chang JH.
Show Full Abstract

A series of thermotropic liquid crystal copolyesters (Co-TLCPs) was prepared by melt polymerization using 2,5-diethoxyterephthalic acid (DTA), 2,7-dihydroxynaphthalene (DHN), and p-hydroxybenzoic acid (HBA) monomers, where the HBA content was varied (0-5 mol). At 3 mol HBA, the Co-TLCPs formed nematic mesophases, while below this concentration, the liquid crystalline phase did not appear. The Co-TLCP sample with 3 mol HBA was subjected to melt spinning and heat-treated under various conditions (temperature and time) to investigate their effect on the thermo-mechanical properties and degree of crystallinity. The objective was to determine the critical heat treatment condition that can maximize the properties of the spun Co-TLCP fibers. The microstructure of the heat-treated fiber was investigated using scanning electron microscopy, and the optimal annealing conditions were confirmed based on the morphology of the fiber, which exhibited a skin-core structure owing to the varying heat and pressure conditions applied during spinning.

Also flagged:TRPV1resiniferatoxinsmall-fiber sensory neuropathypostherpetic neuralgiaNRNeuropathic Pain
Journal Article 2022-07-30 ✓ 1 Snippet Wu C, Liu Y, Wan K, Lan Y, Jia M, Lin L, Gao S, Chen K, Yang J, Pan HL, Li M, Mao H.
In-Text Gene Mentions

…VEGF, calpain, netrin-1,DCC, TRPV1, NGF, sema3a,…

Show Full Abstract

<h4>Purpose</h4>The ultrapotent transient receptor potential vanilloid 1 (TRPV1) agonist resiniferatoxin (RTX) induces small-fiber sensory neuropathy, which has been widely used model of postherpetic neuralgia to study mechanisms of neuropathic pain and new analgesics. The long non-coding RNA (lncRNA) and mRNA expression profiles in spinal dorsal horn tissues of rats six weeks after RTX injection to identify new RNAs related to neuropathic pain.<h4>Methods</h4>Microarray technology was applied to determine lncRNA expressions in spinal dorsal horn samples of adult rats 6 weeks after treatment with RTX or vehicle. The lncNA/mRNA co-expression network was constructed, and differential expression patterns of lncRNA and mRNA in RTX-treated rats were identified. Differential expressions of lncRNAs and mRNAs between RTX-treated samples and control samples were examined by RT-qPCR.<h4>Results</h4>Microarray analyses showed that 745 mRNA and 139 lncRNAs were upregulated, whereas 590 mRNA and 140 lncRNAs were downregulated in spinal dorsal horn tissues after RTX exposure. TargetScan was used to predict mRNA targets for these lncRNAs, which showed that the transcripts with multiple predicted target sites were related to neurologically important pathways. In addition, differential expressions of lncRNA (ENSRNOG00000022535, ENSRNOG00000042027, NR_027478, NR_030675) and Apobec3b mRNA in spinal cord tissue samples were validated, which confirmed the microarray data. The association between NR_030675 and Apobec3b levels was confirmed, which may be related to neuropathic pain.<h4>Conclusion</h4>Our study reveals lncRNA and mRNA of molecule targets that are enriched in the spinal cord dorsal horn and provides new information for further investigation on the mechanisms and therapeutics of neuropathic pain.

Also flagged:Transmembrane Proteinmembrane proteinANTXR1LRP6XAV939binding
Journal Article 2022-07-30 ✓ 5 Snippets Jin T, Zhang Z, Han Y, Li D, Liu J, Jiang M, Zhu J, Kurita R, Nakamura Y, Hu F, Xu Y, Fang X, Huang S, Sun Z.
In-Text Gene Mentions

…region of theSOX6gene to c-Jun…

SOX6protein expression was…

…the transcription ofSOX6, thereby silencing γ…

…such as BCL11A,SOX6, KLF1, and ZBTB7A,…

…promoter regions ofSOX6, EIF2AK ,…

Show Full Abstract

Reactivation of fetal hemoglobin (HbF, <i>α</i>2<i>γ</i>2) alleviates clinical symptoms in patients with <i>β</i>-thalassemia and sickle cell disease, although the regulatory mechanisms of <i>γ</i>-globin expression have not yet been fully elucidated. Recent studies found that interfering with the expression of the membrane protein ANTXR1 gene upregulated <i>γ</i>-globin levels. However, the exact mechanism by which ANTXR1 regulates <i>γ</i>-globin levels remains unclear. Our study showed that overexpression and knockdown of ANTXR1 in K562, cord blood CD34<sup>+</sup>, and HUDEP-2 cells decreased and increased <i>γ</i>-globin expression, respectively. ANTXR1 regulates the reactivation of fetal hemoglobin (HbF, <i>α</i>2<i>γ</i>2) in K562, cord blood CD34<sup>+</sup>, and adult peripheral blood CD34<sup>+</sup> cells through interaction with LRP6 to promote the nuclear entry of <i>β</i>-catenin and activate the Wnt/<i>β</i>-catenin signaling pathway. The overexpression or knockdown of ANTXR1 on <i>γ</i>-globin and Wnt/<i>β</i>-catenin signaling in K562 cells was reversed by the inhibitor XAV939 and the activator LiCl, respectively, where XAV939 inhibits the transcription of <i>β</i>-catenin in the Wnt pathway, but LiCl inhibits GSK3-<i>β</i>. We also showed that the binding ability of the rank4 site in the transcriptional regulatory region of the SOX6 gene to c-Jun was significantly increased after overexpression of ANTXR1 in K562 cells. SOX6 protein expression was increased significantly after overexpression of the c-Jun gene, indicating that the transcription factor c-Jun initiated the transcription of SOX6, thereby silencing <i>γ</i>-globin. Our findings may provide a new intervention target for the treatment of <i>β</i>-hemoglobinopathies.

Also flagged:action potentialsneurological disordersinjuriesinflammatory responseextracellulargene expression
Journal Article 2022-07-30 No Snippets Song S, Regan B, Ereifej ES, Chan ER, Capadona JR.
Show Full Abstract

Intracortical microelectrodes are a critical component of brain-machine interface (BMI) systems. The recording performance of intracortical microelectrodes used for both basic neuroscience research and clinical applications of BMIs decreases over time, limiting the utility of the devices. The neuroinflammatory response to the microelectrode has been identified as a significant contributing factor to its performance. Traditionally, pathological assessment has been limited to a dozen or so known neuroinflammatory proteins, and only a few groups have begun to explore changes in gene expression following microelectrode implantation. Our initial characterization of gene expression profiles of the neuroinflammatory response to mice implanted with non-functional intracortical probes revealed many upregulated genes that could inform future therapeutic targets. Emphasis was placed on the most significant gene expression changes and genes involved in multiple innate immune sets, including <i>Cd14</i>, <i>C3</i>, <i>Itgam</i>, and <i>Irak4.</i> In previous studies, inhibition of Cluster of Differentiation 14 (<i>Cd14</i>) improved microelectrode performance for up to two weeks after electrode implantation, suggesting CD14 can be explored as a potential therapeutic target. However, all measures of improvements in signal quality and electrode performance lost statistical significance after two weeks. Therefore, the current study investigated the expression of genes in the neuroinflammatory pathway at the tissue-microelectrode interface in <i>Cd14</i><sup>-/-</sup> mice to understand better how <i>Cd14</i> inhibition was connected to temporary improvements in recording quality over the initial 2-weeks post-surgery, allowing for the identification of potential co-therapeutic targets that may work synergistically with or after CD14 inhibition to improve microelectrode performance.

Also flagged:Extracellular Vesiclesgynecologicalovarian cancerextracellularvesiclescystadenoma
Journal Article 2022-07-30 ✓ 1 Snippet Lai H, Guo Y, Tian L, Wu L, Li X, Yang Z, Chen S, Ren Y, He S, He W, Yang G.
In-Text Gene Mentions

…FGG, FGL1, C9,OLFM4, ITIH3, MUC16, HBD,…

Show Full Abstract

Although ovarian cancer, a gynecological malignancy, has the highest fatality rate, it still lacks highly specific biomarkers, and the differential diagnosis of ovarian masses remains difficult to determine for gynecologists. Our study aimed to obtain ovarian cancer-specific protein candidates from the circulating small extracellular vesicles (sEVs) and develop a protein panel for ovarian cancer screening and differential diagnosis of ovarian masses. In our study, sEVs derived from the serum of healthy controls and patients with cystadenoma and ovarian cancer were investigated to obtain a cancer-specific proteomic profile. In a discovery cohort, 1119 proteins were identified, and significant differences in the protein profiles of EVs were observed among groups. Then, 23 differentially expressed proteins were assessed using the parallel reaction monitoring in a validation cohort. Through univariate and multivariate logistic regression analyses, a novel model comprising three proteins (fibrinogen gamma gene (FGG), mucin 16 (MUC16), and apolipoprotein (APOA4)) was established to screen patients with ovarian cancer. This model exhibited an area under the receiver operating characteristic curve (AUC) of 0.936 (95% CI, 0.888-0.984) with 92.0% sensitivity and 82.9% specificity. Another panel comprising serum CA125, sEV-APOA4, and sEV-CD5L showed excellent performance (AUC 0.945 (95% CI, 0.890-1.000), sensitivity of 88.0%, specificity of 93.3%, and accuracy of 89.2%) to distinguish malignancy from benign ovarian masses. Altogether, our study provided a proteomic signature of circulating sEVs in ovarian cancer. The diagnostic proteomic panel may complement current clinical diagnostic measures for screening ovarian cancer in the general population and the differential diagnosis of ovarian masses.

Also flagged:Ion channelspore-forming proteinsmembraneextracellularVoltage-gated ion channelsaction potentials
Journal Article 2022-07-30 No Snippets Luis E, Anaya-Hernández A, León-Sánchez P, Durán-Pastén ML.
Show Full Abstract

Carcinogenesis is a multistage process involving the dysregulation of multiple genes, proteins, and pathways that make any normal cell acquire a cancer cell phenotype. Therefore, it is no surprise that numerous ion channels could be involved in this process. Since their discovery and subsequent cloning, ion channels have been established as therapeutic targets in excitable cell pathologies (e.g., cardiac arrhythmias or epilepsy); however, their involvement in non-excitable cell pathologies is relatively recent. Among all ion channels, the voltage-gated potassium channels Kv10.1 have been established as a promising target in cancer treatment due to their high expression in tumoral tissues compared to low levels in healthy tissues.

Also flagged:Bone diseasesbisphosphonatesalendronaterisedronateibandronatezoledronic acid
Journal Article 2022-07-30 No Snippets Okagu IU, Ezeorba TPC, Aguchem RN, Ohanenye IC, Aham EC, Okafor SN, Bollati C, Lammi C.
Show Full Abstract

The drugs used for treating bone diseases (BDs), at present, elicit hazardous side effects that include certain types of cancers and strokes, hence the ongoing quest for the discovery of alternatives with little or no side effects. Natural products (NPs), mainly of plant origin, have shown compelling promise in the treatments of BDs, with little or no side effects. However, the paucity in knowledge of the mechanisms behind their activities on bone remodeling has remained a hindrance to NPs' adoption. This review discusses the pathological development of some BDs, the NP-targeted components, and the actions exerted on bone remodeling signaling pathways (e.g., Receptor Activator of Nuclear Factor κ B-ligand (RANKL)/monocyte/macrophage colony-stimulating factor (M-CSF)/osteoprotegerin (OPG), mitogen-activated protein kinase (MAPK)s/c-Jun N-terminal kinase (JNK)/nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), Kelch-like ECH-associated protein 1 (Keap-1)/nuclear factor erythroid 2-related factor 2 (Nrf2)/Heme Oxygenase-1 (HO-1), Bone Morphogenetic Protein 2 (BMP2)-Wnt/β-catenin, PhosphatidylInositol 3-Kinase (PI3K)/protein kinase B (Akt)/Glycogen Synthase Kinase 3 Beta (GSK3β), and other signaling pathways). Although majority of the studies on the osteoprotective properties of NPs against BDs were conducted <i>ex vivo</i> and mostly on animals, the use of NPs for treating human BDs and the prospects for future development remain promising.

Also flagged:Interleukin-8MastitisIL-8IgGphagocytosisiodide
Journal Article 2022-07-30 No Snippets Peixoto PMG, Cunha LL, Barbosa L, Coelho W, Podico G, Bicalho RC, Canisso IF, Lima FS.
Show Full Abstract

Mastitis is one of the main contributors to antimicrobial resistance in livestock, so alternative therapies are being investigated to address it. The present study assessed the capability of recombinant bovine interleukin-8 (rbIL-8) to improve neutrophil function in the mammary gland and resolve chronic high somatic cell count (SCC) in Holstein cows. Multiparous cows (n = 8) with more than 300,000 SCC per mL were allocated to one of two intramammary infusions: saline (10 mL of saline solution) or rbIL-8 (1.57 mg/mL of recombinant bovine IL-8 diluted in 9 mL of saline). In addition, there was an untreated control group (n = 2, SCC < 300,000 SCC/mL). Milk samples were collected post-treatment at 0, 4, 8, 12, 24, 48, and 144 h to quantify milk SCC, haptoglobin, and IgG concentrations. Neutrophil’s phagocytosis in milk and blood was evaluated via flow cytometry at 0, 24, and 48 h. The log of SCC did not differ between the infused groups (p = 0.369). Neutrophils presented a similar log of cells with high fluorescence for propidium-iodide (PI) and dihydrorhodamine (DHR) in milk (p = 0.412) and blood samples (p = 0.766) in both infused groups. Intramammary infusion of 1.57 mg/mL of rbIL-8 did not improve neutrophils response and failed to resolve chronic high SCC.

Also flagged:morphinecell adhesion moleculelong-term depressioncell adhesion moleculeslong-termbehavioral disorders
Journal Article 2022-07-30 ✓ 5 Snippets Rymut HE, Rund LA, Southey BR, Johnson RW, Sweedler JV, Rodriguez-Zas SL.
In-Text Gene Mentions

…( NCAM2 ),neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1), neurofascin (…

…( L1CAM ),NEGR1, NEGR1 ,…

…), NEGR1 ,NEGR1, neurexin-3-α (…

…, NCAM2 ,NEGR1, NFASC ,…

Show Full Abstract

The influence of proinflammatory challenges, such as maternal immune activation (MIA) or postnatal exposure to drugs of abuse, on brain molecular pathways has been reported. On the other hand, the simultaneous effects of MIA and drugs of abuse have been less studied and sometimes offered inconsistent results. The effects of morphine exposure on a pig model of viral-elicited MIA were characterized in the prefrontal cortex of males and females using RNA-sequencing and gene network analysis. Interacting and main effects of morphine, MIA, and sex were detected in approximately 2000 genes (false discovery rate-adjusted p-value < 0.05). Among the enriched molecular categories (false discovery rate-adjusted p-value < 0.05 and −1.5 > normalized enrichment score > 1.5) were the cell adhesion molecule pathways associated with inflammation and neuronal development and the long-term depression pathway associated with synaptic strength. Gene networks that integrate gene connectivity and expression profiles displayed the impact of morphine-by-MIA interaction effects on the pathways. The cell adhesion molecules and long-term depression networks presented an antagonistic effect between morphine and MIA. The differential expression between the double-challenged group and the baseline saline-treated Controls was less extreme than the individual challenges. The previous findings advance the knowledge about the effects of prenatal MIA and postnatal morphine exposure on the prefrontal cortex pathways.

Also flagged:LipidCurcuminResveratrolLinolenic acidpolyunsaturated fatty acidskin-related disorders
Journal Article 2022-07-30 No Snippets Cassano R, Serini S, Curcio F, Trombino S, Calviello G.
Show Full Abstract

Linolenic acid (LNA) is the most highly consumed polyunsaturated fatty acid found in the human diet. It possesses anti-inflammatory effects and the ability to reverse skin-related disorders related to its deficiency. The purpose of this work was to encapsulate LNA in solid lipid nanoparticles (SLNs) based on curcumin, resveratrol and capsaicin for the treatment of atopic dermatitis. These compounds were first esterified with oleic acid to obtain two moonoleate and one oleate ester, then they were used for SLN matrix realization through the emulsification method. The intermediates of the esterification reaction were characterized by FT-IR and <sup>1</sup>N-MR analysis. SLNs were characterized by dimensional analysis and encapsulation efficiency. Skin permeation studies, antioxidant and anti-inflammatory activities were evaluated. LNA was released over 24 h from nanoparticles, and resveratrol monooleate-filled SLNs exhibited a good antioxidant activity. The curcumin-based SLNs loaded or not with LNA did not induce significant cytotoxicity in NCTC 2544 and THP-1 cells. Moreover, these SLNs loaded with LNA inhibited the production of IL-6 in NCTC 2544 cells. Overall, our data demonstrate that the synthesized SLNs could represent an efficacious way to deliver LNA to skin cells and to preserve the anti-inflammatory properties of LNA for the topical adjuvant treatment of atopic dermatitis.

Also flagged:PeptideSynthesispeptidesdipeptidesaminoacyl
Journal Article 2022-07-30 No Snippets Haji Abbasi Somehsaraie M, Fathi Vavsari V, Kamangar M, Balalaie S.
Show Full Abstract

In recent decades, a growing interest has been observed among pharmaceutical companies in producing and selling 80 FDA-approved therapeutic peptides. However, there are many drawbacks to peptide synthesis at the academic and industrial scales, involving the use of large amounts of highly hazardous coupling reagents and solvents. This review focuses on hideous and observant wastes produced before, during, and after peptide synthesis and proposes some solutions to reduce them.

Also flagged:chronic disabling diseasescalciumammoniumphosphorusCreatininesarcosine
Journal Article 2022-07-29 No Snippets Campos-Obando N, Bosman A, Kavousi M, Medina-Gomez C, van der Eerden BCJ, Bos D, Franco OH, Uitterlinden AG, Zillikens MC.
Show Full Abstract

Background Hyperphosphatemia has been associated with coronary artery calcification (CAC) mostly in chronic kidney disease, but the association between phosphate levels within the normal phosphate range and CAC is unclear. Our objectives were to evaluate associations between phosphate levels and CAC among men and women from the general population and assess causality through Mendelian randomization. Methods and Results CAC, measured by electron-beam computed tomography, and serum phosphate levels were assessed in 1889 individuals from the RS (Rotterdam Study). Phenotypic associations were tested through linear models adjusted for age, body mass index, blood pressure, smoking, prevalent cardiovascular disease and diabetes, 25-hydroxyvitamin D, total calcium, C-reactive protein, glucose, and total cholesterol : high-density lipoprotein cholesterol ratio. Mendelian randomization was implemented through an allele score including 8 phosphate-related single-nucleotide polymorphisms. In phenotypic analyses, serum phosphate (per 1 SD) was associated with CAC with evidence for sex interaction (<i>P</i><sub>interaction</sub>=0.003) (men β, 0.44 [95% CI, 0.30-0.59]; <i>P</i>=3×10<sup>-9</sup>; n=878; women β, 0.24 [95% CI, 0.08-0.40]; <i>P</i>=0.003; n=1011). Exclusion of hyperphosphatemia, chronic kidney disease (estimated glomerular filtration rate <60 mL/min per 1.73 m<sup>2</sup>) and prevalent cardiovascular disease yielded similar results. In Mendelian randomization analyses, <i>instrumented</i> phosphate was associated with CAC (total population β, 0.93 [95% CI: 0.07-1.79]; <i>P</i>=0.034; n=1693), even after exclusion of hyperphosphatemia, chronic kidney disease and prevalent cardiovascular disease (total population β, 1.23 [95% CI, 0.17-2.28]; <i>P</i>=0.023; n=1224). Conclusions Serum phosphate was associated with CAC in the general population with stronger effects in men. Mendelian randomization findings support a causal relation, also for serum phosphate and CAC in subjects <i>without</i> hyperphosphatemia, chronic kidney disease, and cardiovascular disease. Further research into underlying mechanisms of this association and sex differences is needed.

Also flagged:Covid-19Chronic liver diseaseinfectionsoxygenpulmonary diseaseobesity
Journal Article 2022-07-29 ✓ 2 Snippets Ferreira AI, Sarmento MH, Cotter J.
In-Text Gene Mentions

…liver disease (ALD),hemochromatosis, alpha-1 antitrypsin deficien…

…with hereditary namelyhemochromatosisand alpha-1 antitrypsin…

Show Full Abstract

Chronic liver disease is associated with immune system dysfunction, which can lead to a greater risk of infections. Our goal was to assess the impact of chronic liver disease in Covid-19 outcome in hospitalized patients and to identify predictors of the infection's severity. A retrospective case-control study of adult patients hospitalized in Hospital da Senhora da Oliveira-Guimarães, between March 15th 2020 and March 15th 2021, was performed. Demographic factors, clinical and biochemical data were analyzed, as well as the need for oxygen therapy, non-invasive or mechanical ventilation, admission in the intensive care unit and mortality. A total of 336 patients were included, 168 with and 168 without chronic liver disease, with similar comorbidities and pulmonary involvement. Patients with chronic liver disease had a lower percentage of need for oxygen therapy. Regardless of the presence of chronic liver disease, older age, a previously diagnosed pulmonary disease or cardiac condition and more than 25% pulmonary involvement were associated with increased mortality. The need for non-invasive ventilation was higher if the patient was obese, had a previously diagnosed pulmonary disease or had a higher percentage of lung parenchyma involvement. The need for admission in the intensive care unit was associated with obesity and a greater than 25% pulmonary involvement. Chronic liver disease had no impact on Covid-19 severity. Regardless of the presence of chronic liver disease, obesity had an important role in all outcomes except mortality. A higher percentage of lung parenchyma involvement was associated with worst outcomes.

Also flagged:HepcidinIroniron-regulatory hormoneanemiaserythropoiesisrestrictive anemias
Journal Article 2022-07-29 ✓ 1 Snippet Nemeth E, Ganz T.
In-Text Gene Mentions

…iron overload inhemochromatosisand anemias with…

Show Full Abstract

Hepcidin, the iron-regulatory hormone, determines plasma iron concentrations and total body iron content. Hepcidin, secreted by hepatocytes, functions by controlling the activity of the cellular iron exporter ferroportin, which delivers iron to plasma from intestinal iron absorption and from iron stores. Hepcidin concentration in plasma is increased by iron loading and inflammation and is suppressed by erythropoietic stimulation and during pregnancy. Hepcidin deficiency causes iron overload in hemochromatosis and anemias with ineffective erythropoiesis. Hepcidin excess causes iron-restrictive anemias including anemia of inflammation. The development of hepcidin diagnostics and therapeutic agonists and antagonists should improve the treatment of iron disorders.

Also flagged:endothelial dysfunctionBDNFchronic kidney diseasevascular endothelial dysfunctionbrain-derived neurotrophic factorendothelial nitric oxide synthase
Journal Article 2022-07-29 ✓ 2 Snippets Su H, Liu B, Chen H, Zhang T, Huang T, Liu Y, Wang C, Ma Q, Wang Q, Lv Z, Wang R.
In-Text Gene Mentions

…a recruiter ofpolycomb repressiverepressive complex (PRC)…

…proteins such asSTAU1to prevent degradation…

Show Full Abstract

Endothelial dysfunction is common in patients with chronic kidney disease (CKD), but the mechanism is unknown. In this study, we found that the circulating ANRIL level was increased and correlated with vascular endothelial dysfunction in patients with CKD, also negatively correlated with plasma brain-derived neurotrophic factor (BDNF) concentration. We constructed the ANRIL knockout mice model, and found that ANRIL deficiency reversed the abnormal expression of BDNF, along with endothelial nitric oxide synthase (eNOS), vascular adhesion molecule 1 (VCAM-1) and Von Willebrand factor (vWF). Meanwhile, mitochondrial dynamics-related proteins, Dynamin-related protein 1 (Drp1) and mitofusins (Mfn2) level were also recovered. In addition, in vitro, serum derived from CKD patients and uremia toxins induced abnormal expression of ANRIL. By making use of the gain- and loss-of-function approaches, we observed that ANRIL mediated endothelial dysfunction through BDNF downregulation. To explore the specific mechanism, RNA pull-down and RNA-binding protein immunoprecipitation (RIP) were used to explore the binding of ANRIL to histone methyltransferase Enhancer of zeste homolog 2 (EZH2). Further experiments found increased EZH2 and histone H3 lysine 27 trimethylation (H3K27me3) levels at the BDNF promoter region. Collectively, we demonstrated that ANRIL mediate BDNF transcriptional suppression through recruitment of EZH2 to the BDNF promoter region, then regulated the proteins expression related to endothelial function and mitochondrial dynamics. This study provides new insights for the study of endothelial dysfunction in CKD.

Also flagged:neurodevelopmental disorderscystic fibrosisalphabeta-thalassemiaMonogenic diseaseCFTR
Journal Article 2022-07-29 ✓ 2 Snippets Boonsawat P, Horn AHC, Steindl K, Baumer A, Joset P, Kraemer D, Bahr A, Ivanovski I, Cabello EM, Papik M, Zweier M, Oneda B, Sirleto P, Burkhardt T, Sticht H, Rauch A.
In-Text Gene Mentions

…> 2%, withHFEbeing most frequent…

…hypomorphic variants inHFE, SERPINA1, BTD ,…

Show Full Abstract

The magnitude of clinical utility of preconception expanded carrier screening (ECS) concerning its potential to reduce the risk of affected offspring is unknown. Since neurodevelopmental disorders (NDDs) in their offspring is a major concern of parents-to-be, we addressed the question of residual risk by assessing the risk-reduction potential for NDDs in a retrospective study investigating ECS with different criteria for gene selection and definition of pathogenicity. We used exome sequencing data from 700 parents of children with NDDs and blindly screened for carrier-alleles in up to 3046 recessive/X-linked genes. Depending on variant pathogenicity thresholds and gene content, NDD-risk-reduction potential was up to 43.5% in consanguineous, and 5.1% in nonconsanguineous couples. The risk-reduction-potential was compromised by underestimation of pathogenicity of missense variants (false-negative-rate 4.6%), inherited copy-number variants and compound heterozygosity of one inherited and one de novo variant (0.9% each). Adherence to the ACMG recommendations of restricting ECS to high-frequency genes in nonconsanguineous couples would more than halve the detectable inherited NDD-risk. Thus, for optimized clinical utility of ECS, screening in recessive/X-linked genes regardless of their frequency (ACMG Tier-4) and sensible pathogenicity thresholds should be considered for all couples seeking ECS.

Also flagged:agingToll-like receptorTLRTLRsnucleotide receptorsMAVS
Journal Article 2022-07-29 ✓ 2 Snippets Kron NS.
In-Text Gene Mentions

…NFX1-type containing 1 (ZNFX1), has also been…

…search, three potentialZNFX1genes (LOC101862822, LOC101857…

Show Full Abstract

The immune repertoires of mollusks beyond commercially important organisms such as the pacific oyster Crassostrea gigas or vectors for human pathogens like the bloodfluke planorb Biomphalaria glabrata are understudied. Despite being an important model for neural aging and the role of inflammation in neuropathic pain, the immune repertoire of Aplysia californica is poorly understood. Recent discovery of a neurotropic nidovirus in Aplysia has highlighted the need for a better understanding of the Aplysia immunome. To address this gap in the literature, the Aplysia reference genome was mined using InterProScan and OrthoFinder for putative immune genes. The Aplysia genome encodes orthologs of all critical components of the classical Toll-like receptor (TLR) signaling pathway. The presence of many more TLRs and TLR associated adapters than known from vertebrates suggest yet uncharacterized, novel TLR associated signaling pathways. Aplysia also retains many nucleotide receptors and antiviral effectors known to play a key role in viral defense in vertebrates. However, the absence of key antiviral signaling adapters MAVS and STING in the Aplysia genome suggests divergence from vertebrates and bivalves in these pathways. The resulting immune gene set of this in silico study provides a basis for interpretation of future immune studies in this important model organism.

Also flagged:polymeraseextracellulargene expressionPax6Sox1Sox2
Journal Article 2022-07-29 No Snippets Sun C, Dong Y, Wei J, Cai M, Liang D, Fu Y, Zhou Y, Sui Y, Wu F, Mikhaylov R, Wang H, Fan F, Xie Z, Stringer M, Yang Z, Wu Z, Tian L, Yang X.
Show Full Abstract

Human embryonic stem cells (hESCs) and their derived products offer great promise for targeted therapies and drug screening, however, the hESC differentiation process of mature neurons is a lengthy process. To accelerate the neuron production, an acoustic stimulator producing surface acoustic waves (SAWs) is proposed and realized by clamping a flexible printed circuit board (PCB) directly onto a piezoelectric substrate. Neural differentiation of the hESCs is greatly accelerated after application of the acoustic stimulations. Acceleration mechanisms for neural differentiation have been explored by bulk RNA sequencing, quantitative polymerase chain reaction (qPCR) and immunostaining. The RNA sequencing results show changes of extracellular matrix-related and physiological activity-related gene expression in the low or medium SAW dose group and the high SAW dose group, respectively. The neural progenitor cell markers, including Pax6, Sox1, Sox2, Sox10 and Nkx2-1, are less expressed in the SAW dose groups compared with the control group by the qPCR. Other genes including Alk, Cenpf, Pcdh17, and Actn3 are also found to be regulated by the acoustic stimulation. Moreover, the immunostaining confirmed that more mature neuron marker Tuj1-positive cells, while less stem cell marker Sox2-positive cells, are presented in the SAW dose groups. These results indicate that the SAW stimulation accelerated neural differentiation process. The acoustic stimulator fabricated by using the PCB is a promising tool in regulation of stem cell differentiation process applied in cell therapy. STATEMENT OF SIGNIFICANCE: Human embryonic stem cells (hESC) are used for investigating the complex mechanisms involved in the development of specialized biological cells and organs. Different types of hESCs derived cell products can be used for cell therapy procedures aiming to regenerate functional tissues in patients who suffer from various degenerative diseases. Accelerating the hESCs' differentiation process can considerably benefit the clinical utilization of these cells. This study develops a highly effective acoustic stimulator working at ∼20 MHz to investigate what roles do acousto-mechanical stimuli play in the differentiation of hESCs. Our results show that acoustic dose alters the extracellular matrix and physiological activity-related gene expression, which indicates that the acoustic stimulation is an important tool for regulating the stem cells' differentiation processes in cell therapy.

Also flagged:obesitydiabetes mellitusrenal diseasecardiovascular diseaseSGLT-2DPP-4
Journal Article 2022-07-29 No Snippets Rana R, Manoharan J, Gupta A, Gupta D, Elwakiel A, Khawaja H, Fatima S, Zimmermann S, Singh K, Ambreen S, Gadi I, Biemann R, Jiang S, Shahzad K, Kohli S, Isermann B.
Show Full Abstract

Diabetic kidney disease (DKD) is an emerging pandemic, paralleling the worldwide increase in obesity and diabetes mellitus. DKD is now the most frequent cause of end-stage renal disease and is associated with an excessive risk of cardiovascular morbidity and mortality. DKD is a consequence of systemic endothelial dysfunction. The endothelial-dependent cytoprotective coagulation protease activated protein C (aPC) ameliorates glomerular damage in DKD, in part by reducing mitochondrial ROS generation in glomerular cells. Whether aPC reduces mitochondrial ROS generation in the tubular compartment remains unknown. Here, we conducted expression profiling of kidneys in diabetic mice (wild-type and mice with increased plasma levels of aPC, APC<sup>high</sup> mice). The top induced pathways were related to metabolism and in particular to oxidoreductase activity. In tubular cells, aPC maintained the expression of genes related to the electron transport chain, PGC1-α expression, and mitochondrial mass. These effects were associated with reduced mitochondrial ROS generation. Likewise, NLRP3 inflammasome activation and sterile inflammation, which are known to be linked to excess ROS generation in DKD, were reduced in diabetic APC<sup>high</sup> mice. Thus, aPC reduces mitochondrial ROS generation in tubular cells and dampens the associated renal sterile inflammation. These studies support approaches harnessing the cytoprotective effects of aPC in DKD.

Also flagged:intMantiviral responsesantigen presentationphosphorylationTLR7CD14
Journal Article 2022-07-29 ✓ 2 Snippets Talker SC, Barut GT, Lischer HEL, Rufener R, von Münchow L, Bruggmann R, Summerfield A.
In-Text Gene Mentions

…highest transcription ofBTN2A2, a butyrophilin…

…T-cell activation (BTN2A2, CD52 ,…

Show Full Abstract

Similar to human monocytes, bovine monocytes can be split into CD14<sup>high</sup>CD16<sup>-</sup> classical, CD14<sup>high</sup>CD16<sup>high</sup> intermediate and CD14<sup>-/dim</sup>CD16<sup>high</sup> nonclassical monocytes (cM, intM, and ncM, respectively). Here, we present an in-depth analysis of their steady-state bulk- and single-cell transcriptomes, highlighting both pronounced functional specializations and transcriptomic relatedness. Bulk gene transcription indicates pro-inflammatory and antibacterial roles of cM, while ncM and intM appear to be specialized in regulatory/anti-inflammatory functions and tissue repair, as well as antiviral responses and T-cell immunomodulation. Notably, intM stood out by high expression of several genes associated with antigen presentation. Anti-inflammatory and antiviral functions of ncM are further supported by dominant oxidative phosphorylation and selective strong responses to TLR7/8 ligands, respectively. Moreover, single-cell RNA-seq revealed previously unappreciated heterogeneity within cM and proposes intM as a transient differentiation intermediate between cM and ncM.

Also flagged:MHCpeptidesmajor histocompatibility complexTAPtapasinpeptide
Journal Article 2022-07-29 No Snippets Halabi S, Kaufman J.
Show Full Abstract

The functions of a wide variety of molecules with structures similar to the classical class I and class II molecules encoded by the major histocompatibility complex (MHC) have been studied by biochemical and structural studies over decades, with many aspects for humans and mice now enshrined in textbooks as dogma. However, there is much variation of the MHC and MHC molecules among the other jawed vertebrates, understood in the most detail for the domestic chicken. Among the many unexpected features in chickens is the co-evolution between polymorphic TAP and tapasin genes with a dominantly-expressed class I gene based on a different genomic arrangement compared to typical mammals. Another important discovery was the hierarchy of class I alleles for a suite of properties including size of peptide repertoire, stability and cell surface expression level, which is also found in humans although not as extreme, and which led to the concept of generalists and specialists in response to infectious pathogens. Structural studies of chicken class I molecules have provided molecular explanations for the differences in peptide binding compared to typical mammals. These unexpected phenomena include the stringent binding with three anchor residues and acidic residues at the peptide C-terminus for fastidious alleles, and the remodelling binding sites, relaxed binding of anchor residues in broad hydrophobic pockets and extension at the peptide C-terminus for promiscuous alleles. The first few studies for chicken class II molecules have already uncovered unanticipated structural features, including an allele that binds peptides by a decamer core. It seems likely that the understanding of how MHC molecules bind and present peptides to lymphocytes will broaden considerably with further unexpected discoveries through biochemical and structural studies for chickens and other non-mammalian vertebrates.

Also flagged:inseminationTryptophanallantoic acidtocopherol-aTGM2TMEM51
Journal Article 2022-07-29 ✓ 1 Snippet Banerjee P, Rodning SP, Diniz WJS, Dyce PW.
In-Text Gene Mentions

…PLA2G2F , andSHISA6as differentially expressed…

Show Full Abstract

Reproductive failure remains a significant challenge to the beef industry. The omics technologies have provided opportunities to improve reproductive efficiency. We used a multistaged analysis from blood profiles to integrate metabolome (plasma) and transcriptome (peripheral white blood cells) in beef heifers. We used untargeted metabolomics and RNA-Seq paired data from six AI-pregnant (AI-P) and six nonpregnant (NP) Angus-Simmental crossbred heifers at artificial insemination (AI). Based on network co-expression analysis, we identified 17 and 37 hub genes in the AI-P and NP groups, respectively. Further, we identified <i>TGM2</i>, <i>TMEM51</i>, <i>TAC3</i>, <i>NDRG4</i>, and <i>PDGFB</i> as more connected in the NP heifers' network. The NP gene network showed a connectivity gain due to the rewiring of major regulators. The metabolomic analysis identified 18 and 15 hub metabolites in the AI-P and NP networks. Tryptophan and allantoic acid exhibited a connectivity gain in the NP and AI-P networks, respectively. The gene-metabolite integration identified tocopherol-a as positively correlated with ENSBTAG00000009943 in the AI-P group. Conversely, tocopherol-a was negatively correlated in the NP group with <i>EXOSC2</i>, <i>TRNAUIAP</i>, and <i>SNX12</i>. In the NP group, α-ketoglutarate-<i>SMG8</i> and putrescine-<i>HSD17B13</i> were positively correlated, whereas a-ketoglutarate-<i>ALAS2</i> and tryptophan-<i>MTMR1</i> were negatively correlated. These multiple interactions identified novel targets and pathways underlying fertility in bovines.

Also flagged:Hepatitis-induced liver injuryDILIacute liver diseasetoxic hepatitisparacetamol
Journal Article 2022-07-29 ✓ 1 Snippet Dijmărescu I, Guță OM, Brezeanu LE, Dijmărescu AD, Becheanu CA, Păcurar D.
In-Text Gene Mentions

…be excluded arehemochromatosis, alfa1-antitrypsin deficiency…

Show Full Abstract

Drug-induced liver injury (DILI) is uncommon but potentially lethal. Over 6 years, 2533 children with acute liver disease were identified in our center, 48 of which suffered from toxic hepatitis, and 40 exhibited DILI (22 paracetamol-related, 14 albendazole-related). The most affected children were in the 13-17-year-old age group. The mean time between drug ingestion and disease diagnosis was 25.4 h for paracetamol-related DILI and 21.6 days for the albendazole-related group. Clinical features were mostly gastrointestinal, jaundice being reported in 30% of the cases. Regarding the type of liver injury, for 70% of the patients it was hepatocellular (mostly paracetamol toxicity), for 11% cholestatic, and for 19% mixed (albendazole-related). The mean initial ALT value was 1020 U/L for all DILIs. Coagulopathy was only identified for the acetaminophen-related group. The median number of hospitalization days was 6.9 for DILI related to acetaminophen ingestion, compared with 7 for the idiosyncratic pattern. When applying the DILI severity index, 81% of the patients were categorized as having a mild hepatic ailment, while 19% had a moderate-severe or severe disease. No deaths were reported in the study group. The diagnosis of DILI involves the exclusion of other causes of liver injury; therefore, it is considered one of the most challenging diagnoses in hepatology.

Also flagged:Liver FibrosisNon-alcoholic fatty liver diseaseNAFLDdecompensatedcirrhosishepatic failure
Journal Article 2022-07-29 ✓ 1 Snippet Calapod OP, Marin AM, Pantea Stoian A, Fierbinteanu-Braticevici C.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosis, were excluded.…

Show Full Abstract

Background and Objectives: Non-alcoholic fatty liver disease (NAFLD)-related severe liver fibrosis is associated with a higher risk of progressing to decompensated cirrhosis and hepatic failure and developing NAFLD-related hepatocellular carcinoma (HCC), particularly in populations with diabetes. Our pilot study aims to evaluate the performances of various noninvasive methods in predicting liver fibrosis in a population of patients with diabetes and to establish a new scoring system for the prediction of severe fibrosis (>F3). Materials and Methods: A total of 175 patients with diabetes were enrolled for liver fibrosis evaluation. Using the degree of agreement (concordance) between a noninvasive score based on serum biomarkers (NAFLD fibrosis score) and point shear-wave elastography (pSWE) as the reference method, we generated receiver operating characteristic (ROC) curves and performed a multivariate analysis to predict severe liver fibrosis. Results: In our population of patients with diabetes, gamma-glutamyltransferase (GGT), age, body mass index (BMI), the homeostatic model assessment of insulin resistance (HOMA-IR), and glycosylated hemoglobin (HbA1C) were significant predictors for the diagnosis of the F3/F4 group (area under the ROC: 0.767, 0.743, 0.757, 0.772, and 0.7, respectively; p < 0.005 for all). Moreover, the combined composite score (the sum of GGT, age, BMI, HOMA index, and HbA1C) had the highest diagnostic performance at a cut-off value of 3 (AUROC—0.899; p < 0001). The sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) were 91.20%, 79%, 79%, and 89%, respectively, and 89% of patients were correctly classified as having severe liver fibrosis. In contrast with the Fibrosis 4 (FIB-4) score and the AST-to-platelet ratio index (APRI), the composite score had the best accuracy in discriminating advanced fibrosis. Conclusions: The proposed composite score had a reliable and acceptable diagnostic accuracy in identifying patients with diabetes at risk of having severe fibrosis using readily available laboratory and clinical data.

Also flagged:Juvenile hemochromatosisironliver diseasecirrhosistransaminasehereditary hemochromatosis type 2
Journal Article 2022-07-29 ✓ 2 Snippets Nashed B, Fonseca C, Vander Pols W, Kumar S, Lyons H, Berman B, Guzzardo GM.
In-Text Gene Mentions

…is suggestive ofhemochromatosis.…

…genetic panel forhemochromatosiswas obtained that…

Show Full Abstract

Juvenile hemochromatosis is a rare inherited disorder of iron regulation leading to iron overload, which usually presents before the age of 30. One of the most serious clinical characteristics associated with early-onset iron overload is liver disease with eventual cirrhosis, often associated with a reduced life expectancy even after treatment. This case report summarizes an asymptomatic pediatric patient with persistently elevated transaminase levels, which led to a diagnosis of juvenile hemochromatosis relatively early in the course of his disease. The aim of this case report is to increase awareness and stress the importance of early diagnosis and treatment, as it is vital to prevent life-threatening complications and optimize patient outcomes. Consideration should be taken to recognize potential manifestations despite the rarity of the condition. Patients with signs of hepatocellular injury without explanation should prompt evaluation including consideration for iron overload after other common causes are ruled out.

Research Square 2022-07-29 Preprint (No Snippets API) Ballestra LV, De Blasis R, Pacelli G.
Show Full Abstract

In the popular BEKK and DCC multivariate GARCH models, the high number of parameters and the requirement of the positive definiteness of the covariance and correlation matrices pose some difficulties during the estimation process. To avoid these issues, we propose two modifications of the BEKK and DCC models which employ two spherical parameterizations applied to the Cholesky decompositions of the covariance and correlation matrices respectively. In their full specification, the introduced Cholesky-BEKK and Cholesky-DCC models allow for a reduction of the number of parameters compared to their traditional counterparts. Moreover, the application of the spherical transformation does not require the imposition of inequality constraints on the parameters during the estimation. An application to two crude oils, WTI and Brent, and the main exchange rate prices demonstrates that the Cholesky-BEKK and Cholesky-DCC models are able to capture the dynamics of the covariances and correlations. In addition, the Kupiec test on different portfolio compositions confirms the good performance of the proposed models.

Also flagged:extracellularvesiclesAtherosclerosisage-related diseasesenescence-associated secretorySerpin Family F Member 1
Journal Article 2022-07-28 ✓ 1 Snippet Głuchowska A, Cysewski D, Baj-Krzyworzeka M, Szatanek R, Węglarczyk K, Podszywałow-Bartnicka P, Sunderland P, Kozłowska E, Śliwińska MA, Dąbrowski M, Sikora E, Mosieniak G.
In-Text Gene Mentions

…among those proteins (SERPINC1, SERPINA7, Complement factor…

Show Full Abstract

Atherosclerosis, a common age-related disease, is characterized by intense immunological activity. Atherosclerotic plaque is composed of endothelial cells, vascular smooth muscle cells (VSMCs), lipids and immune cells infiltrating from the blood. During progression of the disease, VSMCs undergo senescence within the plaque and secrete SASP (senescence-associated secretory phenotype) factors that can actively modulate plaque microenvironment. We demonstrated that senescent VSMCs secrete increased number of extracellular vesicles (senEVs). Based on unbiased proteomic analysis of VMSC-derived EVs and of the soluble fraction of SASP (sSASP), more than 900 proteins were identified in each of SASP compartments. Comparison of the composition of VMSC-derived EVs with the SASP atlas revealed several proteins, including Serpin Family F Member 1 (SERPINF1) and Thrombospondin 1 (THBS1), as commonly upregulated components of EVs secreted by senescent VSMCs and fibroblasts. Among soluble SASP factors, only Growth Differentiation Factor 15 (GDF15) was universally increased in the secretome of senescent VSMCs, fibroblasts, and epithelial cells. Bioinformatics analysis of EV proteins distinguished functionally organized protein networks involved in immune cell function regulation. Accordingly, EVs released by senescent VSMCs induced secretion of IL-17, INFγ, and IL-10 by T cells and of TNFα produced by monocytes. Moreover senEVs influenced differentiation of monocytes favoring mix M1/M2 polarization with proinflammatory characteristics. Altogether, our studies provide a complex, unbiased analysis of VSMC SASP and prove that EVs derived from senescent VSMCs influence the cytokine milieu by modulating immune cell activity. Our results strengthen the role of senescent cells as an important inducer of inflammation in atherosclerosis.

Also flagged:Set 1BAMHanSet 2SLC15A2CYP3A5
Journal Article 2022-07-28 No Snippets Lee SB, Shin JY, Kwon NJ, Kim C, Seo JS.
Show Full Abstract

The accurate identification of genetic variants contributing to therapeutic drug response or adverse effects is the first step in implementation of precision drug therapy. Targeted sequencing has recently become a common methodology for large-scale studies of genetic variation thanks to its favorable balance between low cost, high throughput, and deep coverage. Here, we present ClinPharmSeq, a targeted sequencing panel of 59 genes with associations to pharmacogenetic (PGx) phenotypes, as a platform to explore the relationship between drug response and genetic variation, both common and rare. For validation, we sequenced DNA from 64 ethnically diverse Coriell samples with ClinPharmSeq to call star alleles (haplotype patterns) in 27 genes using the bioinformatics tool PyPGx. These reference samples were extensively characterized by multiple laboratories using PGx testing assays and, more recently, whole genome sequencing. We found that ClinPharmSeq can consistently generate deep-coverage data (mean = 274x) with high uniformity (30x or above = 94.8%). Our genotype analysis identified a total of 185 unique star alleles from sequencing data, and showed that diplotype calls from ClinPharmSeq are highly concordant with that from previous publications (97.6%) and whole genome sequencing (97.9%). Notably, all 19 star alleles with complex structural variation including gene deletions, duplications, and hybrids were recalled with 100% accuracy. Altogether, these results demonstrate that the ClinPharmSeq platform offers a feasible path for broad implementation of PGx testing and optimization of individual drug treatments.

Also flagged:glucoseinsulinMTNR1BG6PC2FOXA2chromatin
Journal Article 2022-07-28 No Snippets DiCorpo D, Gaynor SM, Russell EM, Westerman KE, Raffield LM, Majarian TD, Wu P, Sarnowski C, Highland HM, Jackson A, Hasbani NR, de Vries PS, Brody JA, Hidalgo B, Guo X, Perry JA, O'Connell JR, Lent S, Montasser ME, Cade BE, Jain D, Wang H, D'Oliveira Albanus R, Varshney A, Yanek LR, Lange L, Palmer ND, Almeida M, Peralta JM, Aslibekyan S, Baldridge AS, Bertoni AG, Bielak LF, Chen CS, Chen YI, Choi WJ, Goodarzi MO, Floyd JS, Irvin MR, Kalyani RR, Kelly TN, Lee S, Liu CT, Loesch D, Manson JE, Minster RL, Naseri T, Pankow JS, Rasmussen-Torvik LJ, Reiner AP, Reupena MS, Selvin E, Smith JA, Weeks DE, Xu H, Yao J, Zhao W, Parker S, Alonso A, Arnett DK, Blangero J, Boerwinkle E, Correa A, Cupples LA, Curran JE, Duggirala R, He J, Heckbert SR, Kardia SLR, Kim RW, Kooperberg C, Liu S, Mathias RA, McGarvey ST, Mitchell BD, Morrison AC, Peyser PA, Psaty BM, Redline S, Shuldiner AR, Taylor KD, Vasan RS, Viaud-Martinez KA, Florez JC, Wilson JG, Sladek R, Rich SS, Rotter JI, Lin X, Dupuis J, Meigs JB, Wessel J, Manning AK.
Show Full Abstract

The genetic determinants of fasting glucose (FG) and fasting insulin (FI) have been studied mostly through genome arrays, resulting in over 100 associated variants. We extended this work with high-coverage whole genome sequencing analyses from fifteen cohorts in NHLBI's Trans-Omics for Precision Medicine (TOPMed) program. Over 23,000 non-diabetic individuals from five race-ethnicities/populations (African, Asian, European, Hispanic and Samoan) were included. Eight variants were significantly associated with FG or FI across previously identified regions MTNR1B, G6PC2, GCK, GCKR and FOXA2. We additionally characterize suggestive associations with FG or FI near previously identified SLC30A8, TCF7L2, and ADCY5 regions as well as APOB, PTPRT, and ROBO1. Functional annotation resources including the Diabetes Epigenome Atlas were compiled for each signal (chromatin states, annotation principal components, and others) to elucidate variant-to-function hypotheses. We provide a catalog of nucleotide-resolution genomic variation spanning intergenic and intronic regions creating a foundation for future sequencing-based investigations of glycemic traits.

Also flagged:autophagybone tumorEwing sarcomaATG2BATG10DAPK1
Journal Article 2022-07-28 ✓ 1 Snippet Wen J, Wan L, Dong X.
In-Text Gene Mentions

…CYP26B1, TRPM4, SYT1,DCC, SLC7A5, ADRB1, ZFPM2,…

Show Full Abstract

<h4>Background</h4>Ewing sarcoma (ES) is the second most common primary malignant bone tumor mainly occurring in children, adolescents and young adults with high metastasis and mortality. Autophagy has been reported to be involved in the survival of ES, but the role remains unclear. Therefore, it's necessary to investigate the prognostic value of autophagy related genes using bioinformatics methods.<h4>Results</h4>ATG2B, ATG10 and DAPK1 were final screened genes for a prognostic model. KM and risk score plots showed patients in high score group had better prognoses both in training and validation sets. C-indexes of the model for training and validation sets were 0.68 and 0.71, respectively. Calibration analyses indicated the model had high prediction accuracy in training and validation sets. The AUC values of ROC for 1-, 3-, 5-year prediction were 0.65, 0.73 and 0.84 in training set, 0.88, 0.73 and 0.79 in validation set, which suggested high prediction accuracy of the model. Decision curve analyses showed that patients could benefit much from the model. Differential and functional analyses suggested that autophagy and apoptosis were upregulated in high risk score group.<h4>Conclusions</h4>ATG2B, ATG10 and DAPK1 were autophagy related genes with potential protective function in ES. The prognostic model established by them exhibited excellent prediction accuracy and discriminatory capacities. They might be used as potential prognostic biomarkers and therapeutic targets in ES.

Also flagged:HELIX syndromeHypohidrosisglandIchthyosisXerostomiaorganization
Journal Article 2022-07-28 No Snippets Obtel N, Le Cabec A, Nguyen TN, Giabicani E, Giabicani E, Van Malderen SJM, Garrevoet J, Percot A, Paris C, Dean C, Hadj-Rabia S, Houillier P, Breiderhoff T, Bardet C, Coradin T, Ramirez Rozzi F, Chaussain C.
Show Full Abstract

In epithelia, claudin proteins are important components of the tight junctions as they determine the permeability and specificity to ions of the paracellular pathway. Mutations in CLDN10 cause the rare autosomal recessive HELIX syndrome (Hypohidrosis, Electrolyte imbalance, Lacrimal gland dysfunction, Ichthyosis, and Xerostomia), in which patients display severe enamel wear. Here, we assess whether this enamel wear is caused by an innate fragility directly related to claudin-10 deficiency in addition to xerostomia. A third molar collected from a female HELIX patient was analyzed by a combination of microanatomical and physicochemical approaches (i.e., electron microscopy, elemental mapping, Raman microspectroscopy, and synchrotron-based X-ray fluorescence). The enamel morphology, formation time, organization, and microstructure appeared to be within the natural variability. However, we identified accentuated strontium variations within the HELIX enamel, with alternating enrichments and depletions following the direction of the periodical striae of Retzius. These markings were also present in dentin. These data suggest that the enamel wear associated with HELIX may not be related to a disruption of enamel microstructure but rather to xerostomia. However, the occurrence of events of strontium variations within dental tissues might indicate repeated episodes of worsening of the renal dysfunction that may require further investigations.

Also flagged:HeparinCOVID-19Heparinsglycosaminoglycansaccharidethrombosis
Journal Article 2022-07-28 ✓ 4 Snippets Iqbal Z, Sadaf S.
In-Text Gene Mentions

…to antithrombin III (ATIII); and (iv) a…

…tasaccharide sequence activateATIIIto inhibit coagulation…

…and activation ofATIII, which is a…

…having affinity toATIII.…

Show Full Abstract

Heparin is a subject of ever-growing interest for laboratory researchers and pharmaceutical industry. One of the driving factors is its critical life-saving drug status, which during the COVID-19 pandemic has assumed a central role in disease treatment and/or prevention. Apart, heparin is one amongst few drugs enjoying a "demand constant" status. In 2020, heparin market size was valued to US$6.5 bn., and given the ongoing stability in the COVID-19 health crisis, it is expected to reach US$11.43 bn. by 2027 with yearly growth rate momentum (CAGR) of 3.9% during the forecast period (Pepi et al., Mol Cell Proteomics 20:100,025, 2021). As patent is a limited monopoly, every year, many patents on low molecular weight heparin (LMWH; a chemically or enzymatically degraded product of unfractionated heparin) are losing market exclusivity worldwide, inviting the generic/biosimilar drug manufacturers to capture market share with cheaper drug products. By tracking patent expiration, drugs in patent litigation, regulatory setbacks for innovator companies (such as those seeking data exclusivity or patent term extension), or other unexpected events affecting market demand and competition, generics can make investment decisions in manufacturing off-patent LMWH drug products of commercial significance. However, given the US Food and Drug Administration (FDA), European Medicine Agency (EMA), Drug Regulatory Authority of Pakistan (DRAP), and other regulatory authorities scientifically rigorous standards for generic/biosimilar LMWH drug products marketing approval, the market is secured and momentous for drug makers that could demonstrate through scientific and clinical dataset that the generic/biosimilar LMWH drug product is of the same quality and purity as the innovator drug product. This study presents an overview of the patent landscape of commercially available LMWHs and advanced analytical techniques for their structural and biochemical characterization for quality control and quality assurance during manufacturing and post-marketing. The study also covers FDA, EMA, Health Canada, and DRAP's current approaches to evaluating the generic/biosimilar LMWH drug products for quality, safety including immunogenicity, and efficacy.

Also flagged:SynthesisGlycyrrhizic Acidglycyrrhetinic acidinfectious diseasesCOVID-19hepatic infections
Journal Article 2022-07-28 No Snippets Mohammed EAH, Peng Y, Wang Z, Qiang X, Zhao Q.
Show Full Abstract

Glycyrrhizic acid and its primary metabolite glycyrrhetinic acid, are the main active ingredients in the licorice roots (glycyrrhiza species), which are widely used in several countries of the world, especially in east asian countries (China, Japan). These ingredients and their derivatives play an important role in treating many diseases, especially infectious diseases such as COVID-19 and hepatic infections. This review aims to summarize the different ways of synthesising the amide derivatives of glycyrrhizic acid and the main ways to synthesize the glycyrrhitinic acid derivatives. Also, to determine the main biological and pharmacological activity for these compounds from the previous studies to provide essential data to researchers for future studies.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1134/S1068162022050132.

Also flagged:TUG1SOX2Melanomacutaneous carcinomasTaurine-upregulated gene 1melanomas
Journal Article 2022-07-28 ✓ 2 Snippets Deng J, Li Y, Song J, Zhu F.
In-Text Gene Mentions

There are growing numbers of studies that have investigated melanoma-related lncRNAs, such like lncRNA cancer susceptibility candidate 2(7), as a melanoma-suppressing lncRNA; and homeobox A11-antisense RNA (8), ZNFX1 antisense RNA 1(9) and H19 Imprinted Maternally Expressed Transcript (10), as melanoma-accelerating lncRNAs.

…( 8 ),ZNFX1antisense RNA 1(…

Show Full Abstract

Melanoma is the most prevalent malignancy of cutaneous carcinomas. Taurine-upregulated gene 1 (TUG1), a lncRNA, is a pivotal regulator of cutaneous malignancies. The present study aimed to investigate the impact and possible mechanisms of action of TUG1 behind the progression of melanomas. Reverse transcription-quantitative PCR was conducted to detect the expression levels of TUG1, microRNA (miR)-145-5p and SOX2 in melanoma tissues and cell lines. Cell Counting Kit-8 (CCK-8) assays were performed to measure the proliferative ability of melanoma cells and transwell assays were used to examine the migration and invasion of melanoma cells. Dual luciferase reporter and RNA immunoprecipitation (RIP) assays were utilized to identify the interactions among TUG1, miR-145-5p and SOX2. Western blotting and immunohistochemical assays were performed to determine the expression profile of SOX2. The impact of TUG1 on melanoma tumorigenesis was assessed using tumorigenicity assays. TUG1 expression levels were elevated in melanoma tumor tissues and cell lines. Reduced TUG1 expression levels significantly inhibited the proliferative, migratory and invasive abilities of melanoma cells. The expression levels of miR-145-5p were decreased in melanoma tumor tissues and cell lines. TUG1 directly targeted miR-145-5p and downregulated miR-145-5p. Upregulation of TUG1 counteracted the promotion of the proliferative, migratory and invasive abilities of melanoma cells induced by the overexpression of miR-145-5p. SOX2 was a target of miR-145-5p and its expression was negatively regulated by miR-145-5p, while positively regulated by TUG1. TUG1 regulated SOX2 expression through sponging miR-145-5p. Silencing of TUG1 also inhibited melanoma tumorigenesis in mice. In conclusion, the TUG1/miR-145-5p/SOX2 axis regulated the migration and invasion of melanoma cells.

Also flagged:Hepatocellular Carcinomatumorstumorglutamine-synthetasecytoplasmicmembrane
Journal Article 2022-07-28 ✓ 1 Snippet de Souza AJS, Malheiros AP, da Silva VL, da Silva TC, Cogliati B, de Sá LRM.
In-Text Gene Mentions

…the occurrence ofhemochromatosishas been associated…

Show Full Abstract

The increasing interest of tumors in wildlife is important for biodiversity conservation and for monitoring environmental agents and/or contaminants with potential impact on human health. Here we described the occurrence of hepatocellular carcinoma (HCC) in noncirrhotic liver of a free-ranging three-toed sloth (<i>Bradypus variegatus</i>) from the Atlantic Forest biome in Brazil. The HCC showed a moderate mononuclear inflammatory infiltrate within the tumor tissue but with no inflammation and fibrosis in the adjacent liver tissue. Upon immunohistochemistry, neoplastic cells were diffusely positive for HepPar-1 and glutamine-synthetase presenting an irregular and random immunostaining pattern; β-catenin was positive in the cytoplasmic membrane of malignant hepatocytes; and cytokeratin 19 immunostaining was restricted to bile duct epithelial cells. The liver tissue was negative for HBV-like and HCV-like viruses assessed by molecular tests. The potential similarity of pathogenesis may reinforce the need for research on environmental and/or infectious agents associated with HCC that may contribute to the understanding of cancer in wildlife.

Also flagged:Autophagyorganelleslysosomesdegradationangiogenesiscytoplasmic
Journal Article 2022-07-28 No Snippets Duan Z, Shi Y, Lin Q, Hamaï A, Mehrpour M, Gong C.
Show Full Abstract

Autophagy, a lysosome-mediated cellular degradation pathway, recycles intracellular components to maintain metabolic balance and survival. Autophagy plays an important role in tumor immunotherapy as a "double-edged sword" that can both promote and inhibit tumor progression. Autophagy acts on innate and adaptive immunity and interacts with immune cells to modulate tumor immunotherapy. The discovery of autophagy inducers and autophagy inhibitors also provides new insights for clinical anti-tumor therapy. However, there are also difficulties in the application of autophagy-related regulators, such as low bioavailability and the lack of efficient selectivity. This review focuses on autophagy-related immunogenic regulation and its application in cancer therapy.

Also flagged:Gastrointestinal Stromal TumorsGISTmesenchymal neoplasmneoplasmprimary tumortumor
Journal Article 2022-07-28 No Snippets Khan J, Ullah A, Waheed A, Karki NR, Adhikari N, Vemavarapu L, Belakhlef S, Bendjemil SM, Mehdizadeh Seraj S, Sidhwa F, Ghleilib I, Foroutan S, Blakely AM, Del Rivero J, Karim NA, Vail E, Heneidi S, Mesa H.
Show Full Abstract

Introduction: Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal neoplasm of the gastrointestinal (GI) system. Most GISTs originate from the interstitial cells of Cajal (ICC), the pacemaker cell situated between the circular and longitudinal layers of the muscularis propria along the GI tract. In this population-based study using the SEER database, we sought to identify demographic, clinical, and pathologic factors that affect the prognosis and survival of patients with this neoplasm. Molecular genetic advances, current management guidelines, and advances in targeted therapy are discussed. Methods: Demographic and clinical data from GIST patients were retrieved from the SEER research plus database for the period 2000−2018. Statistical analysis was performed with IBM SPSS® v20.2 software using the Chi-square test, paired t-test, multivariate analysis, and Kaplan−Meier functions. Results: A total of 10,833 patients with GIST were identified. Most patients were between 60−74 years of age: 40%, Caucasian: 68%, and the male to female ratio was 1.1:1. The most common primary tumor sites were stomach: 63%, small intestine: 30%, rectum: 3%, and esophagus: 0.7%. When reported, the grade of differentiation was well: 38%, moderately: 32%, undifferentiated: 19%, poorly: 12%. The size of most tumors ranged between 6−10 cm: 36% and they were treated by surgical intervention: 82% and/or chemotherapy/targeted therapy: 39%. The stage was localized: 66%, advanced: 19%, and regional: 15%. The 5-year survival was 74% (95% confidence interval (95% CI) = 72.6−74.7), and the 5-year cause-specific survival 82% (95% CI = 80.7−82.6). The 5-year cause-specific survival by treatment included surgery at 86% (95% CI = 85.4−87.3), chemotherapy/targeted therapy with or without surgery at 77% (95% CI = 75.7−78.9), and radiation at 75% (95% CI = 74.5−80). On multivariable analysis tumor size > 5 cm, poorly and undifferentiated grade, age > 60, and distant metastases at presentation were associated with worse overall survival. Conclusion: GISTs comprise 1−2% of malignancies of the GI tract, usually affect male Caucasians between the ages of 60 and 74 years, most tumors occur in the stomach and small intestine, and are usually >5 cm, but still localized, at the time of diagnosis. Most tumors receive multimodality surgical and chemotherapy/targeted therapy treatment, with a 5-year overall survival of 74% and cause-specific survival of 82%. GIST patients would benefit from enrollment in large clinical trials to establish better therapy guidelines for unresectable, treatment-refractory, and recurrent tumors.

Also flagged:Endoplasmic ReticulumMitochondriametabolic diseasesNon-alcoholic fatty liver diseaseNAFLDobesity
Journal Article 2022-07-28 ✓ 1 Snippet Jin C, Felli E, Lange NF, Berzigotti A, Gracia-Sancho J, Dufour JF.
In-Text Gene Mentions

…B or C;hemochromatosis; autoimmune hepatitis; choles…

Show Full Abstract

The interaction between the mitochondria and the endoplasmic reticulum (ER) is essential for hepatocyte function. An increase in ER-mitochondria contacts (ERMCs) is associated with various metabolic diseases. Non-alcoholic fatty liver disease (NAFLD) is associated with obesity and type 2 diabetes, and its progressive form non-alcoholic steatohepatitis (NASH) can lead to cirrhosis and hepatocellular carcinoma. However, the role of ERMCs in the progression of NAFL to NASH is still unclear. We assessed whether ERMCs could correlate with NAFLD severity. We used a proximity ligation assay to measure the abundance of ERMCs in liver biopsies from patients with biopsy-proven NAFLD (<i>n</i> = 48) and correlated the results with histological and metabolic syndrome (MetS) features. NAFLD patients were included according to inclusion and exclusion criteria, and then assigned to NAFL (<i>n</i> = 9) and NASH (<i>n</i> = 39) groups. ERMCs density could discriminate NASH from NAFL (sensitivity 61.5%, specificity 100%). ERMCs abundance correlated with hepatocellular ballooning. Moreover, the density of ERMCs increased with an increase in the number of MetS features. In conclusion, ERMCs increased from NAFL to NASH, in parallel with the number of MetS features, supporting a role for this interaction in the pathophysiology of NASH.

Also flagged:AMLacute myeloid leukaemiagranulocyte-macrophage-colony-stimulating-factorGM-CSFKit-ILeukaemia
Journal Article 2022-07-28 No Snippets Schwepcke C, Klauer LK, Deen D, Amberger DC, Fischer Z, Doraneh-Gard F, Gunsilius C, Hirn-Lopez A, Kroell T, Tischer J, Weinmann M, Werner JO, Rank A, Schmid C, Schmetzer HM.
Show Full Abstract

Dendritic cells (DC) and leukaemia derived DC (DC<sub>leu</sub>) are potent stimulators of anti-leukaemic activity in acute myeloid leukaemia (AML) and can be generated from mononuclear cells in vitro following standard DC/DC<sub>leu</sub>-generating protocols. With respect to future clinical applications though, DC/DC<sub>leu</sub>-generating protocols specifically designed for application in a whole-blood-(WB)-environment must be established. Therefore, we developed ten new DC/DC<sub>leu</sub>-generating protocols (kits; Kit-A/-C/-D/-E/-F/-G/-H/-I/-K/-M) for the generation of DC/DC<sub>leu</sub> from leukaemic WB, containing calcium-ionophore, granulocyte-macrophage-colony-stimulating-factor (GM-CSF), tumour-necrosis-factor-alpha, prostaglandin-E<sub>1</sub> (PGE<sub>1</sub>), prostaglandin-E<sub>2</sub> (PGE<sub>2</sub>) and/or picibanil (OK-432). All protocols were evaluated regarding their performance in generating DC/DC<sub>leu</sub> using refined classification and/or ranking systems; DC/DC<sub>leu</sub> were evaluated regarding their performance in stimulating anti-leukaemic activity using a cytotoxicity fluorolysis assay. Overall, we found the new kits capable to generate (mature) DC/DC<sub>leu</sub> from leukaemic WB. Through refined classification and ranking systems, we were able to select Kit-I (GM-CSF + OK-432), -K (GM-CSF + PGE<sub>2</sub>) and -M (GM-CSF + PGE<sub>1</sub>) as the most efficient kits in generating (mature) DC/DC<sub>leu</sub>, which are further competent to stimulate immunoreactive cells to show an improved anti-leukaemic cytotoxicity as well. This great performance of Kit-I, -K and -M in mediating DC/DC<sub>leu</sub>-based anti-leukaemic immunity in a WB-environment in vitro constitutes an important and directive step for translating DC/DC<sub>leu</sub>-based immunotherapy of AML into clinical application.

Also flagged:NLRP3neurodegenerative diseasecognitionHDtranscription factorsdeath
Journal Article 2022-07-28 ✓ 4 Snippets Paldino E, Fusco FR.
In-Text Gene Mentions

TFEB can promote polyQ-Htt clearance, and its impaired expression alters its function in HD pathogenesis [51,52].

…TFEB can promote polyQ-Httclearance, and its…

…ich targets full-length polyQ-Htt, CMA selectively targets…

…amino-terminal fragments ofHtt.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disease characterized by several symptoms encompassing movement, cognition, and behavior. The mutation of the <i>IT15</i> gene encoding for the huntingtin protein is the cause of HD. Mutant huntingtin interacts with and impairs the function of several transcription factors involved in neuronal survival. Although many mechanisms determining neuronal death have been described over the years, the significant role of inflammation has gained momentum in the last decade. Drugs targeting the elements that orchestrate inflammation have been considered powerful tools to treat HD. In this review, we will describe the data supporting inflammasome and NLRP3 as a target of therapeutics to fight HD, deepening the possible mechanisms of action underlying these effects.

Also flagged:Anemiaadenomyosiscoagulationprothrombinthrombinfibrinogen
Journal Article 2022-07-28 ✓ 1 Snippet Lin Q, Li T, Ding S, Yu Q, Zhang X.
In-Text Gene Mentions

…factor XIII andantithrombin-IIIare significantly higher…

Show Full Abstract

Patients with adenomyosis are hypercoagulable and often accompanied by anemia, but the specific changes in anemia-related coagulation parameters are still unclear. This study investigated the changes in and influencing factors of coagulation parameters related to anemia in patients with adenomyosis (AM). The coagulation parameters, including platelet count (PC), plasma prothrombin time (PT), activated partial prothrombin time (APTT), thrombin time (TT) and fibrinogen (FB), and hemoglobin (Hb), were measured in patients with adenomyosis (229 cases in AM group), uterine leiomyoma (265 cases in LM group), and undergoing tubal anastomosis (142 cases in the control group). The age of the control group was younger than that of the AM group and the LM group. Compared with the AM and LM groups, the uterus size of the control group was smaller; the AM group was larger than the LM group. The Hb concentration of the AM group was lower than that of the LM and control groups. Compared with the LM and control groups, PC increased and TT shortened in the AM group. APTT in the AM group was shorter than in the control group, and PT was longer than in the LM group. After adjustment using multiple logistic regression analysis, adenomyosis was correlated with Hb concentration (or = 0.971, 95% CI 0.954−0.988, p < 0.001), PC (or = 1.006, 95% CI 1.002−1.011, p = 0.004), PT (or = 3.878, 95% CI 2.347−6.409, p < 0.001), age (or = 1.062, 95% CI 1.013−1.114, p = 0.013), and uterine size (or = 1.103, 95% CI 1.011−1.203, p = 0.028). Correlation analysis showed that PC (r = −0.309) and PT (r = −0.252) were negatively correlated with anemia. The increase in Hb-related PC and PT in patients with adenomyosis indicates that the timely and early detection of coagulation parameters is needed for patients with severe anemia, older age, and larger uterine volume.

Also flagged:obesitydiabetesmetabolic syndromecardiovascular diseaseadipocytokinesmitochondria
Journal Article 2022-07-28 ✓ 1 Snippet Khalil M, Shanmugam H, Abdallah H, John Britto JS, Galerati I, Gómez-Ambrosi J, Frühbeck G, Portincasa P.
In-Text Gene Mentions

Meanwhile, an up-representation of PEBP1 and ApoJ was detected after the oral consumption of omega-3, confirming its role in the modulation of insulin resistance.

Show Full Abstract

The abnormal expansion of body fat paves the way for several metabolic abnormalities including overweight, obesity, and diabetes, which ultimately cluster under the umbrella of metabolic syndrome (MetS). Patients with MetS are at an increased risk of cardiovascular disease, morbidity, and mortality. The coexistence of distinct metabolic abnormalities is associated with the release of pro-inflammatory adipocytokines, as components of low-to-medium grade systemic inflammation and increased oxidative stress. Adopting healthy lifestyles, by using appropriate dietary regimens, contributes to the prevention and treatment of MetS. Metabolic abnormalities can influence the function and energetic capacity of mitochondria, as observed in many obesity-related cardio-metabolic disorders. There are preclinical studies both in cellular and animal models, as well as clinical studies, dealing with distinct nutrients of the Mediterranean diet (MD) and dysfunctional mitochondria in obesity and MetS. The term "<i>Mitochondria nutrients</i>" has been adopted in recent years, and it depicts the adequate nutrients to keep proper mitochondrial function. Different experimental models show that components of the MD, including polyphenols, plant-derived compounds, and polyunsaturated fatty acids, can improve mitochondrial metabolism, biogenesis, and antioxidant capacity. Such effects are valuable to counteract the mitochondrial dysfunction associated with obesity-related abnormalities and can represent the beneficial feature of polyphenols-enriched olive oil, vegetables, nuts, fish, and plant-based foods, as the main components of the MD. Thus, developing mitochondria-targeting nutrients and natural agents for MetS treatment and/or prevention is a logical strategy to decrease the burden of disease and medications at a later stage. In this comprehensive review, we discuss the effects of the MD and its bioactive components on improving mitochondrial structure and activity.

Also flagged:NanohydroxyapatiteHydrogelsgum arabicchitosanacrylic acidapatite
Journal Article 2022-07-28 No Snippets Makar LE, Nady N, Abd El-Fattah A, Shawky N, Kandil SH.
Show Full Abstract

In this work, physical cross-linking was used to create nanocomposite hydrogels composed of unmodified gum arabic (GA), chitosan (Ch), and natural nanohydroxyapatite (nHA), using an acrylic acid (AA) solvent. Different GA/chitosan contents (15%, 25%, and 35% of the used AA) as well as different nHA contents (2, 5, and 10 wt.%), were used and studied. The natural nHA and the fabricated GA/Ch/nHA nanocomposite hydrogels were characterized using different analysis techniques. Using acrylic acid solvent produced novel hydrogels with compressive strength of 15.43-22.20 MPa which is similar to that of natural cortical bone. The addition of natural nHA to the hydrogels resulted in a significant improvement in the compressive strength of the fabricated hydrogels. In vitro studies of water absorption and degradation-and in vivo studies-confirmed that the nanocomposite hydrogels described here are biodegradable, biocompatible, and facilitate apatite formation while immersed in the simulated body fluid (SBF). In light of these findings, the GA/Ch/nHA nanocomposite hydrogels are recommended for preparing bioactive nanoscaffolds for testing in bone regeneration applications.

Also flagged:SynthesisCarotenoid Succinateshydroxy carotenoidsmelatoninamidewater
Journal Article 2022-07-28 No Snippets Czett D, Böddi K, Nagy V, Takátsy A, Deli J, Tone P, Balogh GT, Vincze A, Agócs A.
Show Full Abstract

Carotenoid succinates were synthesized from hydroxy carotenoids and were coupled to a commercially available derivative of melatonin via amide bond for producing more powerful anti-oxidants and yet new hybrid lipophilic bifunctional molecules with additional therapeutic effects. The coupling reactions produced conjugates in acceptable to good yields. Succinylation increased the water solubility of the carotenoids, while the conjugation with melatonin resulted in more lipophilic derivatives. The conjugates showed self-assembly in aqueous medium and yielded relatively stable colloidal solutions in phosphate-buffered saline. Antioxidant behavior was measured with ABTS and the FRAP methods for the carotenoids, the carotenoid succinates, and the conjugates with melatonin. A strong dependence on the quality of the solvent was observed. TEAC values of the new derivatives in phosphate-buffered saline were found to be comparable to or higher than those of parent carotenoids, however, synergism was observed only in FRAP assays.

Also flagged:Piperineacute pancreatitisFAM134B-deathEndoplasmic reticulum
Journal Article 2022-07-28 ✓ 5 Snippets Huang W, Zhang J, Jin W, Yang J, Yu G, Shi H, Shi K.
In-Text Gene Mentions

Next, we found that piperine reduced ER-stress by enhancing FAM134B and CCPG1 dependent ER-phagy, thereby alleviating pancreatic injury.<h4>Conclusion</h4>Impaired ER-phagy was both a cause and a consequence of ER-stress in AP mice, which contributed to the transition from AP to SAP.

Through using FAM134B<sup>-/-</sup> and CCPG1<sup>-/-</sup>, we investigated the mechanism of piperine in the treatment of acute pancreatitis.<h4>Results</h4>In this study, we confirmed that with the progression of acute pancreatitis, the pancreatic endoplasmic reticulum stress increased continuously, but the ER-phagy increased first and then was inhibited.

As a natural alkaloid, piperin is found in black pepper and has anti-inflammatory properties, whose effect on ER-phagy in pancreatitis has not been studied.<h4>Purpose</h4>The objective of this study was to demonstrate the pivotal role of FAM134B and CCPG1 dependent ER-phagy for alleviating acute pancreatitis and explore the molecular mechanism of piperine in alleviating acute pancreatitis.<h4>Method</h4>In this study we investigated the role of ER-phagy in acute pancreatitis and whether piperine could alleviate pancreatitis through ER-phagy regulation.

…for FAM134B andCCPG1dependent ER-phagy.…

…and FAM134B andCCPG1was main ER-phagy…

Show Full Abstract

<h4>Background</h4>Acute pancreatitis was a common acute abdominal disease characterized by pancreatic acinar cell death and inflammation. Endoplasmic reticulum autophagy (ER-phagy) coud maintain cell homeostasis by degrading redundant and disordered endoplasmic reticulum and FAM134B and CCPG1 was main ER-phagy receptors. As a natural alkaloid, piperin is found in black pepper and has anti-inflammatory properties, whose effect on ER-phagy in pancreatitis has not been studied.<h4>Purpose</h4>The objective of this study was to demonstrate the pivotal role of FAM134B and CCPG1 dependent ER-phagy for alleviating acute pancreatitis and explore the molecular mechanism of piperine in alleviating acute pancreatitis.<h4>Method</h4>In this study we investigated the role of ER-phagy in acute pancreatitis and whether piperine could alleviate pancreatitis through ER-phagy regulation. We first detected endoplasmic reticulum stress (ER-stress) and ER-phagy in different degrees of acute pancreatitis. Then we used ER-stress and autophagy regulators to explore the relationship between ER-stress and ER-phagy in acute pancreatitis and their regulation of cell death. Through using FAM134B<sup>-/-</sup> and CCPG1<sup>-/-</sup>, we investigated the mechanism of piperine in the treatment of acute pancreatitis.<h4>Results</h4>In this study, we confirmed that with the progression of acute pancreatitis, the pancreatic endoplasmic reticulum stress increased continuously, but the ER-phagy increased first and then was inhibited. Meanwhile, in acute pancreatitis, ER-stress and ER-phagy interacted: endoplasmic reticulum stress can induce ER-phagy, but serious ER-stress would inhibit ER-phagy; and ER-phagy could alleviate ER-stress. Next, we found that piperine reduced ER-stress by enhancing FAM134B and CCPG1 dependent ER-phagy, thereby alleviating pancreatic injury.<h4>Conclusion</h4>Impaired ER-phagy was both a cause and a consequence of ER-stress in AP mice, which contributed to the transition from AP to SAP. Piperine targeting ER-phagy provided a new insight into the pharmacological mechanism of piperine in treating AP.

Also flagged:Netrin-1hypersensitivityvisceralirritable bowel syndromeIBSvisceral hypersensitivity
Journal Article 2022-07-28 ✓ 5 Snippets Wang J, Duan G, Zhan T, Dong Z, Zhang Y, Chen Y, Sun H, Xu S.
In-Text Gene Mentions

Among the shared DEGs, four axon guidance-related pathway genes were identified, including Netrin-1, DCC, PlexinA4, and MET, which were upregulated in MS rats of different periods (Figures 4F–G).

Moreover, the results suggested that Netrin-1/DCC/GluA1 signaling pathway may be a potential therapeutic target for the treatment of visceral hypersensitivity and associated anxiety disorder.

These novel findings suggest that long-lasting over-expression of Netrin-1 can mediate visceral hypersensitivity and anxiety disorder from the post-weaning period to adulthood by activating DCC/GluA1 pathway in the hippocampus.

Interestingly, Netrin-1 and DCC were specific ligands or receptors for each other, indicating that their co-upregulation might be a potential mechanism in MS-induced visceral hypersensitivity.

Altogether, a novel hypothesis emerged that the activation of the Netrin-1/DCC/GluA1 pathway, which resulted in strengthening hippocampal LTP in MS rats, finally led to the visceral hypersensitivity and anxiety-like behaviors from the post-weaning period to adulthood.

Show Full Abstract

Early adverse life events (EALs), such as maternal separation (MS), can cause visceral hypersensitivity, which is thought to be a key pathophysiological mechanism of irritable bowel syndrome (IBS). Previous studies mainly focused on EALs-induced visceral hypersensitivity in adulthood but did not consider that it may have occurred in the preadult period. We previously found that rats who experienced MS suffered from visceral hypersensitivity starting from the post-weaning period. Moreover, the hippocampus is considered to be critical in regulating the formation of visceral hypersensitivity induced by MS. But the underlying mechanisms throughout different life periods are unclear. In this study, behavioral tests, RNA-seq, lentiviral interference, and molecular biology techniques were applied to investigate the molecular mechanism in the hippocampus underlying MS-induced long-lasting visceral hypersensitivity. It was found that both visceral sensitivity and anxiety-like behaviors were significantly increased in MS rats in post-weaning, prepubertal, and adult periods, especially in the prepubertal period. Subsequently, RNA-seq targeting the hippocampus identified that the expression level of Netrin-1 was significantly increased in all periods, which was further confirmed by quantitative real-time PCR and Western blot. Knocking-down hippocampal Netrin-1 in the post-weaning period by lentivirus interference alleviated visceral hypersensitivity and anxiety-like behaviors of MS rats in the later phase of life. In addition, deleted in colorectal cancer (DCC), instead of neogenin-1(Neo-1) or uncoordinated (UNC5), was proved to be the specific functional receptor of Netrin-1 in regulating visceral hypersensitivity, whose upregulation may result in the most severe symptoms in the prepubertal period. Furthermore, the activation of the Netrin-1/DCC pathway could enhance long-term potentiation (LTP) in the hippocampus, probably <i>via</i> recruitment of the AMPA receptor subunit GluA1, which finally resulted in the formation of visceral hypersensitivity. These novel findings suggest that long-lasting over-expression of Netrin-1 can mediate visceral hypersensitivity and anxiety disorder from the post-weaning period to adulthood by activating DCC/GluA1 pathway in the hippocampus. Moreover, early intervention of Netrin-1 in the post-weaning period could lead to significant symptom relief afterward, which provides evidence that the Netrin-1/DCC/GluA1 signaling pathway may be a potential therapeutic target for the treatment of visceral hypersensitivity in clinics.

Also flagged:ironmetabolismiron deficiencyestrogenprogesteronecycle
Journal Article 2022-07-28 ✓ 1 Snippet Badenhorst CE, Forsyth AK, Govus AD.
In-Text Gene Mentions

…at risk ofhemochromatosis(McKnight et al.,…

Show Full Abstract

Iron metabolism research in the past decade has identified menstrual blood loss as a key contributor to the prevalence of iron deficiency in premenopausal females. The reproductive hormones estrogen and progesterone influence iron regulation and contribute to variations in iron parameters throughout the menstrual cycle. Despite the high prevalence of iron deficiency in premenopausal females, scant research has investigated female-specific causes and treatments for iron deficiency. In this review, we provide a comprehensive discussion of factors that influence iron status in active premenopausal females, with a focus on the menstrual cycle. We also outline several practical guidelines for monitoring, diagnosing, and treating iron deficiency in premenopausal females. Finally, we highlight several areas for further research to enhance the understanding of iron metabolism in this at-risk population.

Also flagged:Neurological disordersCyclin-dependent kinases 5Cdk5synapsesaxonphosphorylation
Journal Article 2022-07-28 No Snippets Ao C, Li C, Chen J, Tan J, Zeng L.
Show Full Abstract

Neurological disorders are a group of disorders with motor, sensory or cognitive damage, caused by dysfunction of the central or peripheral nervous system. Cyclin-dependent kinases 5 (Cdk5) is of vital significance for the development of the nervous system, including the migration and differentiation of neurons, the formation of synapses, and axon regeneration. However, when the nervous system is subject to pathological stimulation, aberrant activation of Cdk5 will induce abnormal phosphorylation of a variety of substrates, resulting in a cascade signaling pathway, and thus lead to pathological changes. Cdk5 is intimately related to the pathological mechanism of a variety of neurological disorders, such as A-β protein formation in Alzheimer's disease, mitochondrial fragmentation in cerebral ischemia, and apoptosis of dopaminergic neurons in Parkinson's disease. It is worth noting that Cdk5 inhibitors have been reported to have neuroprotective effects by inhibiting related pathological processes. Therefore, in this review, we will briefly introduce the physiological and pathological mechanisms of Cdk5 in the nervous system, focusing on the recent advances of Cdk5 in neurological disorders and the prospect of targeted Cdk5 for the treatment of neurological disorders.

Also flagged:amino acidTGF-βamino acidsascorbateglutathioneMRSA infections
Journal Article 2022-07-28 No Snippets Møller KV, Nguyen HTT, Mørch MGM, Hesselager MO, Mulder FAA, Fuursted K, Olsen A.
Show Full Abstract

Probiotic bacteria are increasingly popular as dietary supplements and have the potential as alternatives to traditional antibiotics. We have recently shown that pretreatment with <i>Lactobacillus</i> spp. Lb21 increases the life span of <i>C. elegans</i> and results in resistance toward pathogenic methicillin-resistant <i>Staphylococcus aureus</i> (MRSA). The Lb21-mediated MRSA resistance is dependent on the DBL-1 ligand of the TGF-β signaling pathway. However, the underlying changes at the metabolite level are not understood which limits the application of probiotic bacteria as timely alternatives to traditional antibiotics. In this study, we have performed untargeted nuclear magnetic resonance-based metabolic profiling. We report the metabolomes of <i>Lactobacillus</i> spp. Lb21 and control <i>E. coli</i> OP50 bacteria as well as the nematode-host metabolomes after feeding with these diets. We identify 48 metabolites in the bacteria samples and 51 metabolites in the nematode samples and 63 across all samples. Compared to the control diet, the <i>Lactobacilli</i> pretreatment significantly alters the metabolic profile of the worms. Through sparse Partial Least Squares discriminant analyses, we identify the 20 most important metabolites distinguishing probiotics from the regular OP50 food and worms fed the two different bacterial diets, respectively. Among the changed metabolites, we find lower levels of essential amino acids as well as increased levels of the antioxidants, ascorbate, and glutathione. Since the probiotic diet offers significant protection against MRSA, these metabolites could provide novel ways of combatting MRSA infections.

Also flagged:sitagliptinnon-alcoholic fatty liver diseasesnon-alcoholic fatty liver diseaseNAFLDtransferasesAST
Journal Article 2022-07-28 ✓ 1 Snippet Doustmohammadian A, Nezhadisalami A, Safarnezhad Tameshke F, Motamed N, Maadi M, Farahmand M, Sohrabi M, Clark CCT, Ajdarkosh H, Faraji AH, Nikkhah M, Sobhrakhshankhah E, Ebrahimi R, Zamani F.
In-Text Gene Mentions

…patitis, autoimmune hepatitis,hemochromatosis, Wilson disease, liver…

Show Full Abstract

The current study aimed to evaluate the efficacy of sitagliptin vs. placebo in treating non-alcoholic fatty liver disease (NAFLD). In a triple-blind randomized clinical trial, we assigned 120 eligible subjects with NAFLD to receive daily dosing of 50 mg sitagliptin (<i>n</i> = 60) or the placebo (<i>n</i> = 60) for 56 weeks and lifestyle modification in both groups. Laboratory and anthropometric outcomes were measured, and liver stiffness was assessed using a fibroscan. The primary outcome measures were changes from baseline in fibrosis scores and liver transferases. Out of 120 patients randomized into sitagliptin and placebo groups, 76 patients completed the trial, of whom 44 were in the sitagliptin and 32 in the placebo groups. Patients receiving sitagliptin showed a significant decrease in the fibrosis scores (<i>P</i> = 0.001). The reductions in the alanine aminotransferase (AST) (<i>P</i> = 0.036) and aspartate AST (<i>P</i> < 0.001) levels were also statistically significant. The effect of sitagliptin in reducing fibrosis scores was significantly greater in normal-weight and overweight individuals than in obese individuals (<i>p</i> = 0.036, and <i>p</i> = 0.018, respectively), whereas the effects of sitagliptin on AST levels were greater among overweight/obese patients (<i>p</i> = 0.028, and <i>p</i> = 0.016, respectively). Sitagliptin reduced fibrosis scores and liver enzymes in NAFLD patients after 56 weeks of therapy. The changes in fibrosis scores were more prominent in patients with normal weight and overweight than obese patients, whereas the effects on AST levels were greater among overweight/obese patients. Other randomized trials with larger sample sizes and longer treatment durations may be required before precise results can be reached.<h4>Clinical trial registration</h4>[https://www.irct.ir/trial/46140], identifier [IRCT20140430017505N2].

Also flagged:porcine epidemic diarrheaPEDIgGantibodiesIFN-γG2a
Journal Article 2022-07-28 No Snippets Ho TT, Trinh VT, Tran HX, Le PTT, Nguyen TT, Hoang HTT, Pham MD, Conrad U, Pham NB, Chu HH.
Show Full Abstract

Porcine epidemic diarrhea virus (PEDV) is a serious infectious causative agent in swine, especially in neonatal piglets. PEDV genotype 2 (G2) strains, particularly G2a, were the primary causes of porcine epidemic diarrhea (PED) outbreaks in Vietnam. Here, we produced a plant-based CO-26K-equivalent epitope (COE) variant from a Vietnamese highly virulent PEDV strain belonging to genotype 2a (COE/G2a) and evaluated the protective efficacy of COE/G2a-GCN4pII protein (COE/G2a-pII) in piglets against the highly virulent PEDV G2a strain following passive immunity. The 5-day-old piglets had high levels of PEDV-specific IgG antibodies, COE-IgA specific antibodies, neutralizing antibodies, and IFN-γ responses. After virulent challenge experiments, all of these piglets survived and had normal clinical symptoms, no watery diarrhea in feces, and an increase in their body weight, while all of the negative control piglets died. These results suggest that the COE/G2a-pII protein produced in plants can be developed as a promising vaccine candidate to protect piglets against PEDV G2a infection in Vietnam.

Also flagged:RAD51recombinaseBRCA2cancerbindingN
Journal Article 2022-07-28 No Snippets Bagnolini G, Balboni B, Schipani F, Gioia D, Veronesi M, De Franco F, Kaya C, Jumde RP, Ortega JA, Girotto S, Hirsch AKH, Roberti M, Cavalli A.
Show Full Abstract

RAD51 is an ATP-dependent recombinase, recruited by BRCA2 to mediate DNA double-strand breaks repair through homologous recombination and represents an attractive cancer drug target. Herein, we applied for the first-time protein-templated dynamic combinatorial chemistry on RAD51 as a hit identification strategy. Upon design of <i>N</i>-acylhydrazone-based dynamic combinatorial libraries, RAD51 showed a clear templating effect, amplifying 19 <i>N</i>-acylhydrazones. Screening against the RAD51-BRCA2 protein-protein interaction via ELISA assay afforded 10 inhibitors in the micromolar range. Further <sup>19</sup>F NMR experiments revealed that <b>7</b> could bind RAD51 and be displaced by BRC4, suggesting an interaction in the same binding pocket of BRCA2. These results proved not only that ptDCC could be successfully applied on full-length oligomeric RAD51, but also that it could address the need of alternative strategies toward the identification of small-molecule PPI inhibitors.

Also flagged:oxygennitrogensuperoxidehydroxylperoxylaging
Journal Article 2022-07-28 ✓ 1 Snippet Sun Y, Ji X, Cui J, Mi Y, Zhang J, Guo Z.
In-Text Gene Mentions

…activity using theDCCcatalytic system […

Show Full Abstract

A series of phenolic acid chitooligosaccharide (COS) derivatives synthesized by two mild and green methods were illuminated in this paper. Seven phenolic acids were selected to combine two kinds of COS derivatives: the phenolic acid chitooligosaccharide salt derivatives and the phenolic-acid-acylated chitooligosaccharide derivatives. The structures of the derivatives were characterized by FT-IR and <sup>1</sup>H NMR spectra. The antioxidant experiment results in vitro (including DPPH-radical scavenging activity, superoxide-radical scavenging activity, hydroxyl-radical scavenging ability, and reducing power) demonstrated that the derivatives exhibited significantly enhanced antioxidant activity compared to COS. Moreover, the study showed that the phenolic acid chitooligosaccharide salts had stronger antioxidant activity than phenolic-acid-acylated chitooligosaccharide. The cytotoxicity assay of L929 cells in vitro indicated that the derivatives had low cytotoxicity and good biocompatibility. In conclusion, this study provides a possible synthetic method for developing novel and nontoxic antioxidant agents which can be used in the food and cosmetics industry.

Also flagged:MembraneTumortumorsimmune responsesmembranescancer
Journal Article 2022-07-28 ✓ 2 Snippets Zhang Y, Zhang X, Li H, Liu J, Wei W, Gao J.
In-Text Gene Mentions

Zhang et al. achieved the targeting of breast carcinoma in situ and lung metastases by coating a versatile ROS-cleavable camptothecin (CPT) prodrug (DCC) with a TAM membrane, and achieved the targeting of breast carcinoma in situ and lung metastasis by ROS-triggered CA/CPT release and CA/CPT- mediated ROS generation induces tumor ICD [70].

…hat macrophage membrane-coatedDCCcould interfere with…

Show Full Abstract

The advent of immunotherapy, which improves the immune system's ability to attack and eliminate tumors, has brought new hope for tumor treatment. However, immunotherapy regimens have seen satisfactory results in only some patients. The development of nanotechnology has remarkably improved the effectiveness of tumor immunotherapy, but its application is limited by its passive immune clearance, poor biocompatibility, systemic immunotoxicity, etc. Therefore, membrane-coated biomimetic nanoparticles have been developed by functional, targeting, and biocompatible cell membrane coating technology. Membrane-coated nanoparticles have the advantages of homologous targeting, prolonged circulation, and the avoidance of immune responses, thus remarkably improving the therapeutic efficacy of tumor immunotherapy. Herein, this review explores the recent advances and future perspectives of cell membrane-coated nanoparticles for tumor immunotherapy.

Also flagged:TXNRD1GPX4selenocysteinesynthesisselenoproteinsSec
Journal Article 2022-07-28 ✓ 5 Snippets Santesmasses D, Gladyshev VN.
In-Text Gene Mentions

…positively associated withPRDX6and negatively with…

…functional links toPRDX6and SCD.…

…with SCD andPRDX6

…two additional proteins,PRDX6and SCD.…

…functional interactions ofPRDX6( https://string-db.org ;…

Show Full Abstract

The human genome has 25 genes coding for selenocysteine (Sec)-containing proteins, whose synthesis is supported by specialized Sec machinery proteins. Here, we carried out an analysis of the co-essentiality network to identify functional partners of selenoproteins and Sec machinery. One outstanding cluster included all seven known Sec machinery proteins and two critical selenoproteins, GPX4 and TXNRD1. Additionally, these nine genes were further positively associated with PRDX6 and negatively with SCD, linking the latter two genes to the essential role of selenium. We analyzed the essentiality scores of gene knockouts in this cluster across one thousand cancer cell lines and found that Sec metabolism genes are strongly selective for a subset of primary tissues, suggesting that certain cancer cell lineages are particularly dependent on selenium. A separate outstanding cluster included selenophosphate synthetase SEPHS1, which was linked to a group of transcription factors, whereas the remaining selenoproteins were linked neither to these clusters nor among themselves. The data suggest that key components of Sec machinery have already been identified and that their primary role is to support the functions of GPX4 and TXNRD1, with further functional links to PRDX6 and SCD.

Also flagged:polyhydramnioshydropsimmune responseserotransferrinprothrombintransthyretin
Journal Article 2022-07-28 No Snippets Navakauskienė R, Baronaitė S, Matuzevičius D, Krasovskaja N, Treigytė G, Arlauskienė A, Navakauskas D.
Show Full Abstract

Mass spectrometry-based proteomics have become a valued tool for conducting comprehensive analyses in amniotic fluid samples with pathologies. Our research interest is the finding and characterization of proteins related to normal vs. polyhydramnios (non-immune hydrops) pregnancy. Proteomic analysis was performed on proteins isolated from fresh amniotic fluid samples. Proteins were fractionated by 2DE using a different pI range (pI 3-11, pI 4-7) and analyzed with MALDI-TOF-MS. Furthermore, by using computational analysis, identified proteins in protein maps specific to normal vs. polyhydramnios pregnancy were compared and the quantities of expressed proteins were evaluated mathematically. Comparative analysis of proteome characteristic for the same polyhydramnios pregnancy fractionated by 2DE in different pI range (3-11 and 4-7) was performed and particular protein groups were evaluated for the quantification of changes within the same protein level. Proteins of normal and polyhydramnios pregnancies were fractionated by 2DE in pI range 3-11 and in pI range 4-7. Mass spectrometry analysis of proteins has revealed that the quantity changes of the main identified proteins in normal vs. polyhydramnios pregnancy could be assigned to immune response and inflammation proteins, cellular signaling and regulation proteins, metabolic proteins, etc. Specifically, we have identified and characterized proteins associated with heart function and circulatory system and proteins associated with abnormalities in prenatal medicine. The following are: serotransferrin, prothrombin, haptoglobin, transthyretin, alpha-1-antitrypsin, zinc-alpha-2-glycprotein, haptoglobin kininogen-1, hemopexin, clusterin, lumican, afamin, gelsolin. By using computational analysis, we demonstrated that some of these proteins increased a few times in pathological pregnancy. Computer assistance analysis of 2DE images suggested that, for the better isolation of the proteins' isoforms, those levels increased/decreased in normal vs. polyhydramnios pregnancy, and the fractionation of proteins in pI rage 3-11 and 4-7 could be substantial. We analyzed and identified by MS proteins specific for normal and polyhydramnios pregnancies. Identified protein levels increased and/or modification changed in case of non-immune hydrops fetus and in cases of cardiovascular, anemia, growth restriction, and metabolic disorders. Computational analysis for proteomic characterization empower to estimate the quantitative changes of proteins specific for normal vs. polyhydramnios pregnancies.

Also flagged:BenzothiazoleParagangliomabenzothiazolescancersphenylacetamidenucleus
Journal Article 2022-07-28 No Snippets Amoroso R, De Lellis L, Florio R, Moreno N, Agamennone M, De Filippis B, Giampietro L, Maccallini C, Fernández I, Recio R, Cama A, Fantacuzzi M, Ammazzalorso A.
Show Full Abstract

The antiproliferative effects played by benzothiazoles in different cancers have aroused the interest for these molecules as promising antitumor agents. In this work, a library of phenylacetamide derivatives containing the benzothiazole nucleus was synthesized and compounds were tested for their antiproliferative activity in paraganglioma and pancreatic cancer cell lines. The novel synthesized compounds induced a marked viability reduction at low micromolar concentrations both in paraganglioma and pancreatic cancer cells. Derivative <b>4l</b> showed a greater antiproliferative effect and higher selectivity index against cancer cells, as compared to other compounds. Notably, combinations of derivative <b>4l</b> with gemcitabine at low concentrations induced enhanced and synergistic effects on pancreatic cancer cell viability, thus supporting the relevance of compound <b>4l</b> in the perspective of clinical translation. A target prediction analysis was also carried out on <b>4l</b> by using multiple computational tools, identifying cannabinoid receptors and sentrin-specific proteases as putative targets contributing to the observed antiproliferative activity.

Also flagged:Panhypopituitarismtype 2 diabetes mellitusHypopituitarismpituitary apoplexySheehan's syndromeanemia
Journal Article 2022-07-28 ✓ 2 Snippets Ansari Y, Ansari SA, Khan TMA, Naqvi S, Lyons K.
In-Text Gene Mentions

…were lymphocytic hypophysitis,hemochromatosis, and neurosarcoidosis.…

Hemochromatosisis extremely rare…

Show Full Abstract

We present a case of a 35-year-old female with type 2 diabetes mellitus who delivered a female neonate via normal vaginal delivery without any peripartum complication and minimal blood loss. The patient developed features of panhypopituitarism in the post-partum period with imaging with CT and MRI showing unremarkable pituitary gland. This is a rare presentation of post-partum panhypopituitarism with normal imaging studies.

Also flagged:nucleotideamino acidActinATPasecell motilitycell division
Journal Article 2022-07-28 No Snippets Duong HTT, Suzuki H, Katagiri S, Shibata M, Arai M, Yura K.
Show Full Abstract

Sequencing of individual human genomes enables studying relationship among nucleotide variations, amino acid substitutions, effect on protein structures and diseases. Many studies have found general tendencies, for instance, that pathogenic variations tend to be found in the buried regions of the protein structures, that benign variations tend to be found on the surface of the proteins, and that variations on evolutionary conserved residues tend to be pathogenic. These tendencies were deduced from globular proteins with standard evolutionary changes in amino acid sequences. In this study, we investigated the variation distribution on actin, one of the highly conserved proteins. Many nucleotide variations and three-dimensional structures of actin have been registered in databases. By combining those data, we found that variations buried inside the protein were rather benign and variations on the surface of the protein were pathogenic. This idiosyncratic distribution of the variation impact is likely ascribed to the extensive use of the surface of the protein for protein-protein interactions in actin.

Also flagged:HHIroniron overload-related diseaseOverloadHereditary hemochromatosismetabolism
Journal Article 2022-07-28 ✓ 5 Snippets Hasan SMM, Farrell J, Borgaonkar M.
In-Text Gene Mentions

…mutations in theHFEgene.…

…mutations of theHFEgene encoding for…

…mutations within theHFEgene: C282Y, which…

…Non-HFEmutations, such as…

…common than theHFEvariants ( 5…

Show Full Abstract

<h4>Background</h4>Hereditary hemochromatosis (HH) occurs due to mutations in the HFE gene. While the C282Y mutation is the most common genotype reported in HH, other genotypes are found less frequently, indicating variable degrees of penetrance. We studied the penetrance of the C282Y/H63D compound heterozygote genotype in developing clinically significant iron overload.<h4>Methods</h4>We have completed a retrospective analysis on every individual within Newfoundland & Labrador who were diagnosed as C282Y/H63D compound heterozygote between 1996 and 2009 through a molecular genetics study. We collected data for up to 10 years following the initial genotyping using electronic health records, including laboratory values, phlebotomy status, radiologic reports and clinic records. Iron overload status was classified based on the <i>HealthIron</i> study.<h4>Results</h4>Between 1996 and 2009, 247 individuals with available health records tested positive for C282Y/H63D compound heterozygosity. Over the 10 years of our study, 5.3% of patients exhibited iron overload-related disease on the background of documented iron overload. Including these individuals, 10.1% of patients had documented iron overload, 23.1% of patients had a provisional iron overload and the remaining 66.8% of patients had no evidence of iron overload. Only 44 patients had documented phlebotomies, likely based on their severe phenotype at baseline. Despite phlebotomy, the prevalence of iron overload was higher among these patients. The penetrance of compound heterozygosity was also significantly higher among men (<i>P <</i> 0.01).<h4>Conclusion</h4>C282Y/H63D compound heterozygosity is a low penetrance genotype in HH. This is the largest reported cohort of C282Y/H63D compound heterozygotes in North America with an extended follow-up.

Also flagged:antibodyCRISPRCas9mitosisjoiningGFP
Journal Article 2022-07-27 ✓ 1 Snippet Droogers WJ, Willems J, MacGillavry HD, de Jong APH.
In-Text Gene Mentions

…stop codon inCacna1e, likely preventing…

Show Full Abstract

CRISPR/Cas9-mediated knock-in methods enable the labeling of individual endogenous proteins to faithfully determine their spatiotemporal distribution in cells. However, reliable multiplexing of knock-in events in neurons remains challenging because of cross talk between editing events. To overcome this, we developed conditional activation of knock-in expression (CAKE), allowing efficient, flexible, and accurate multiplex genome editing. To diminish cross talk, CAKE is based on sequential, recombinase-driven guide RNA (gRNA) expression to control the timing of genomic integration of each donor sequence. We show that CAKE is broadly applicable in rat neurons to co-label various endogenous proteins, including cytoskeletal proteins, synaptic scaffolds, ion channels and neurotransmitter receptor subunits. To take full advantage of CAKE, we resolved the nanoscale co-distribution of endogenous synaptic proteins using super-resolution microscopy, demonstrating that their co-organization correlates with synapse size. Finally, we introduced inducible dimerization modules, providing acute control over synaptic receptor dynamics in living neurons. These experiments highlight the potential of CAKE to reveal new biological insight. Altogether, CAKE is a versatile method for multiplex protein labeling that enables the detection, localization, and manipulation of endogenous proteins in neurons.

Also flagged:cancercancersleukemiareverse transcriptasegene expressionHeme
Journal Article 2022-07-27 No Snippets Lee YE, Park JH, Lim HJ, Kim HR, Shin JH, Shin MG.
Show Full Abstract

No abstract available.

Also flagged:post-traumatic stress disorderPTSDpathogenesisADKC3orf18RIMS2
Journal Article 2022-07-27 No Snippets Zhang Z, Meng P, Zhang H, Jia Y, Wen Y, Zhang J, Chen Y, Li C, Pan C, Cheng S, Yang X, Yao Y, Liu L, Zhang F.
Show Full Abstract

Although previous genome-wide association studies (GWASs) on post-traumatic stress disorder (PTSD) have identified multiple risk loci, how these loci confer risk of PTSD remains unclear. Through the FUSION pipeline, we integrated two human brain proteome reference datasets (ROS/MAP and Banner) with the PTSD GWAS dataset, respectively, to conduct a proteome-wide association study (PWAS) analysis. Then two transcriptome reference weights (Rnaseq and Splicing) were applied to a transcriptome-wide association study (TWAS) analysis. Finally, the PWAS and TWAS results were investigated through brain imaging analysis. In the PWAS analysis, 8 and 13 candidate genes were identified in the ROS/MAP and Banner reference weight groups, respectively. Examples included <i>ADK</i> (<i>p</i><sub>PWAS-ROS/MAP</sub> = 3.00 × 10<sup>-5</sup>) and <i>C3orf18</i> (<i>p</i><sub>PWAS-Banner</sub> = 7.07 × 10<sup>-31</sup>). Moreover, the TWAS also detected multiple candidate genes associated with PTSD in two different reference weight groups, including <i>RIMS2</i> (<i>p</i><sub>TWAS-Splicing</sub> = 3.84 × 10<sup>-2</sup>), <i>CHMP1A</i> (<i>p</i><sub>TWAS-Rnaseq</sub> = 5.09 × 10<sup>-4</sup>), and <i>SIRT5</i> (<i>p</i><sub>TWAS-Splicing</sub> = 4.81 × 10<sup>-3</sup>). Further comparison of the PWAS and TWAS results in different populations detected the overlapping genes: <i>MADD</i> (<i>p</i><sub>PWAS-Banner</sub> = 4.90 × 10<sup>-2</sup>, <i>p</i><sub>TWAS-Splicing</sub> = 1.23 × 10<sup>-2</sup>) in the total population and <i>GLO1</i>(<i>p</i><sub>PWAS-Banner</sub> = 4.89 × 10<sup>-3</sup>, <i>p</i><sub>TWAS-Rnaseq</sub> = 1.41 × 10<sup>-3</sup>) in females. Brain imaging analysis revealed several different brain imaging phenotypes associated with <i>MADD</i> and <i>GLO1</i> genes. Our study identified multiple candidate genes associated with PTSD in the proteome and transcriptome levels, which may provide new clues to the pathogenesis of PTSD.

Also flagged:digestionironexcretionhyperinsulinemiawaterhepatopathy
Journal Article 2022-07-27 ✓ 2 Snippets Sullivan KE, Lavin SR, Livingston S, Knutson M, Valdes EV, Warren LK.
In-Text Gene Mentions

…water lead tohemochromatosisand hepatopathy iron…

…clinical signs ofhemochromatosisor histologic lesions…

Show Full Abstract

While iron overload disorder (IOD) and related disease states are not considered a common occurrence in domestic equids, these issues appear prevalent in black rhinoceroses under human care. In addressing IOD in black rhinos, altering dietary iron absorption and excretion may be the most globally practical approach. A main option for treatment used across other species such as humans, is chelation therapy using iron-specific synthetic compounds. As horses may serve as an appropriate digestive model for the endangered rhinoceros, we evaluated the potential use of the oral iron chelator N,N-bis(2-hydroxybenzyl)ethylenediamine-N,N-diacetic acid (HBED) in horses for safety and efficacy prior to testing in black rhinoceros. Health and iron digestibility and dynamics were assessed in horses (n = 6) before, and after treatment with HBED (50 mg/kg body weight) for 8 days using a crossover design with serum, faecal and urine collection. A preliminary pharmacokinetic trial was also performed but no trace of HBED was found in serially sampled plasma through 8 h post-oral dosing. HBED increased urinary iron output in horses compared to control by 0.7% of total iron intake (p < 0.01), for an average of 27 mg urinary iron/day, similar to human chelation goals. Blood chemistry, blood cell counts and overall wellness were not affected by treatment. As healthy horses are able to regulate iron absorption, the lack of change in iron balance is unsurprising. Short-term HBED administration appeared to be safely tolerated by horses, therefore it was anticipated it would also be safe to administer to black rhinos for the management of iron overload.

Also flagged:alanineaspartate aminotransferasehemoglobinMCPDiabetesALT
Journal Article 2022-07-27 ✓ 5 Snippets Barton JC, Barton JC, Acton RT.
In-Text Gene Mentions

HFE

The HFE gene (homeostatic iron regulator, chromosome 6p23.1) [1] that encodes HFE, a negative upstream regulator of hepcidin [2], and two common non-ancestral HFE alleles p.C282Y (c.845G>A; rs1800562) and p.H63D (c.187C>G; rs1799545) were discovered in referred white patients with hemochromatosis and iron overload (IO) in 1996 [1].

Rare types of hemochromatosis, usually diagnosed in referred patients, are associated with novel HFE alleles [6] or deleterious alleles in genes that encode hemojuvelin BMP co-receptor (HJV, chromosome 1q21.1), transferrin receptor 2 (TFR2, chromosome 7q22.1), hepcidin antimicrobial peptide (HAMP, chromosome 19q13.12), and solute carrier family 40 member 1 (ferroportin) (SLC40A1, chromosome 2q32.2) [7].

At CE, a morning blood sample was obtained after an overnight fast to measure SF and TS (Hitachi 9/11 Analyzer, Roche Applied Science, Indianapolis, IN, USA), to confirm HFE genotype based on p.C282Y and p.H63D allele-specific analyses [11], to measure complete blood counts (Beckman Coulter GenS, Beckman/Coulter, Fullerton, CA, USA), and to measure serum ALT, AST, and glucose (Hitachi 9/11 Analyzer, Roche Applied Science, Madison, WI, USA) [9].

Neither novel HFE alleles nor deleterious alleles in TFR2, HAMP, and SCL40A1 were detected in referred hemochromatosis patients with p.H63D/p.H63D [34, 35].

Show Full Abstract

<h4>Background</h4>Screening program participants with iron overload (IO) phenotypes without HFE p.C282Y/p.C282Y are incompletely characterized.<h4>Methods</h4>We studied white participants who had IO phenotypes without p.C282Y/p.C282Y in post-screening clinical examinations (CE). We defined IO phenotypes as a) elevated serum ferritin (SF) and transferrin saturation (TS) at screening and CE, and b) absence of IO treatment, anemia, transfusion >10 units, alcohol intake >30 g/d, hepatitis B or C, and pregnancy. We defined IO-related disease as elevated alanine or aspartate aminotransferase (ALT/AST) or swelling/tenderness of 2nd/3rd metacarpophalangeal (MCP) joints. All participants had HFE p.C282Y and p.H63D genotyping.<h4>Results</h4>There were 32 men and 26 women (mean age 54±16 y). Median food/supplemental iron intakes were 14.3/0.0 mg/d. Relative risks of HFE genotypes were 12.9 (p.C282Y/p.H63D), 3.0 (p.H63D/p.H63D), 1.9 (p.C282Y/wt), 0.9 (p.H63D/wt), and 0.5 (wt/wt) compared to 42,640 white screening participants without IO phenotypes or p.C282Y/p.C282Y. Regression on SF revealed positive associations: MCV (p = 0.0006; β coefficient = 0.4531); swelling/tenderness of MCP joints (p = 0.0033; β = 0.3455); and p.H63D/wt (p = 0.0015; β = 0.4146). IO-related disease (18 elevated ALT/AST, one swelling/tenderness of MCP joints) occurred in 19 participants (7 men, 12 women). Median MCV was higher in participants with IO-related disease (97 fL vs. 94 fL; p = 0.0007). Logistic regression on IO-related disease revealed a significant association with diabetes (p = 0.0416; odds ratio 18.9 (95% confidence interval 1.0, 341.1)).<h4>Conclusions</h4>In the present 58 screening program participants who had IO phenotypes without HFE p.C282Y/p.C282Y, relative risks of HFE genotypes p.C282Y/p.H63D, p.H63D/p.H63D, and p.C282Y/wt were significantly higher than in 42,640 white screening participants with neither IO phenotypes nor p.C282Y/p.C282Y. SF was significantly associated with MCV, swelling/tenderness of 2nd/3rd MCP joints, and p.H63D/wt. IO-related disease was significantly associated with MCV and diabetes.

Also flagged:synaptic transmissionsynapsesaxon terminalsRibbonCa 2+Ca V α 1
Journal Article 2022-07-27 No Snippets Zhang G, Liu JB, Yuan HL, Chen SY, Singer JH, Ke JB.
Show Full Abstract

Retinal bipolar cells (BCs) compose the canonical vertical excitatory pathway that conveys photoreceptor output to inner retinal neurons. Although synaptic transmission from BC terminals is thought to rely almost exclusively on Ca<sup>2+</sup> influx through voltage-gated Ca<sup>2+</sup> (Ca<sub>V</sub>) channels mediating L-type currents, the molecular identity of Ca<sub>V</sub> channels in BCs is uncertain. Therefore, we combined molecular and functional analyses to determine the expression profiles of Ca<sub>V</sub> α<sub>1</sub>, β, and α<sub>2</sub>δ subunits in mouse rod bipolar (RB) cells, BCs from which the dynamics of synaptic transmission are relatively well-characterized. We found significant heterogeneity in Ca<sub>V</sub> subunit expression within the RB population from mice of either sex, and significantly, we discovered that transmission from RB synapses was mediated by Ca<sup>2+</sup> influx through P/Q-type (Ca<sub>V</sub>2.1) and N-type (Ca<sub>V</sub>2.2) conductances as well as the previously-described L-type (Ca<sub>V</sub>1) and T-type (Ca<sub>V</sub>3) conductances. Furthermore, we found both Ca<sub>V</sub>1.3 and Ca<sub>V</sub>1.4 proteins located near presynaptic ribbon-type active zones in RB axon terminals, indicating that the L-type conductance is mediated by multiple Ca<sub>V</sub>1 subtypes. Similarly, Ca<sub>V</sub>3 α<sub>1</sub>, β, and α<sub>2</sub>δ subunits also appear to obey a "multisubtype" rule, i.e., we observed a combination of multiple subtypes, rather than a single subtype as previously thought, for each Ca<sub>V</sub> subunit in individual cells.<b>SIGNIFICANCE STATEMENT</b> Bipolar cells (BCs) transmit photoreceptor output to inner retinal neurons. Although synaptic transmission from BC terminals is thought to rely almost exclusively on Ca<sup>2+</sup> influx through L-type voltage-gated Ca<sup>2+</sup> (Ca<sub>V</sub>) channels, the molecular identity of Ca<sub>V</sub> channels in BCs is uncertain. Here, we report unexpectedly high molecular diversity of Ca<sub>V</sub> subunits in BCs. Transmission from rod bipolar (RB) cell synapses can be mediated by Ca<sup>2+</sup> influx through P/Q-type (Ca<sub>V</sub>2.1) and N-type (Ca<sub>V</sub>2.2) conductances as well as the previously-described L-type (Ca<sub>V</sub>1) and T-type (Ca<sub>V</sub>3) conductances. Furthermore, Ca<sub>V</sub>1, Ca<sub>V</sub>3, β, and α<sub>2</sub>δ subunits appear to obey a "multisubtype" rule, i.e., a combination of multiple subtypes for each subunit in individual cells, rather than a single subtype as previously thought.

Also flagged:UbiquitinProteasomeGliomaastrocytomaASglioblastoma
Journal Article 2022-07-27 ✓ 4 Snippets Vriend J, Klonisch T.
In-Text Gene Mentions

The two E3 ligases genes with most significant (by ANOVA) over-expression in GBM were TTF2 and AURKA. The two E3 ligase genes with most significant relative higher expression in ODG were DTX4 and RNF170. Three of the TRIM genes whose expression was elevated in GBM (compared to ODG), TRIM21, TRIM5, and TRIM38, encode proteins that (i) regulate viral entry into the host cell, (ii) are involved in the innate immune response to viruses and (iii) respond to INF-gamma signaling with upregulated expression (Carthagena et al. 2009).

Several genes associated with the GO category of “Regulation of viral entry into host cells,” TRIM5, TRIM21, TRIM22, and TRIM38 were over-expressed in GBM compared to ODG and non-tumor samples.

…TRIM5 , andTRIM38, encode proteins…

…TRIM22 , andTRIM38were over-expressed in…

Show Full Abstract

We have mined public genomic datasets to identify genes coding for components of the ubiquitin proteasome system (UPS) that may qualify as potential diagnostic and therapeutic targets in the three major glioma types, astrocytoma (AS), glioblastoma (GBM), and oligodendroglioma (ODG). In the Sun dataset of glioma (GEO ID: GSE4290), expression of the genes UBE2S and UBE2C, which encode ubiquitin conjugases important for cell-cycle progression, distinguished GBM from AS and ODG. KEGG analysis showed that among the ubiquitin E3 ligase genes differentially expressed, the Notch pathway was significantly over-represented, whereas among the E3 ligase adaptor genes the Hippo pathway was over-represented. We provide evidence that the UPS gene contributions to the Notch and Hippo pathway signatures are related to stem cell pathways and can distinguish GBM from AS and ODG. In the Sun dataset, AURKA and TPX2, two cell-cycle genes coding for E3 ligases, and the cell-cycle gene coding for the E3 adaptor CDC20 were upregulated in GBM. E3 ligase adaptor genes differentially expressed were also over-represented for the Hippo pathway and were able to distinguish classic, mesenchymal, and proneural subtypes of GBM. Also over-expressed in GBM were PSMB8 and PSMB9, genes encoding subunits of the immunoproteasome. Our transcriptome analysis provides a strong rationale for UPS members as attractive therapeutic targets for the development of more effective treatment strategies in malignant glioma. Ubiquitin proteasome system and glioblastoma: E1-ubiquitin-activating enzyme, E2-ubiquitin-conjugating enzyme, E3-ubiquitin ligase. Ubiquitinated substrates of E3 ligases may be degraded by the proteasome. Expression of genes for specific E2 conjugases, E3 ligases, and genes for proteasome subunits may serve as differential markers of subtypes of glioblastoma.

Also flagged:ironchronic kidney diseasemetabolismiron deficiencyanaemiaglomerular filtration
Journal Article 2022-07-27 ✓ 2 Snippets Greenwood SA, Beckley-Hoelscher N, Asgari E, Ayis S, Baker LA, Banerjee D, Bhandari S, Bramham K, Chilcot J, Burton J, Kalra PA, Lightfoot CJ, McCafferty K, Mercer TH, Okonko DO, Oliveira B, Reid C, Smith AC, Swift PA, Mangelis A, Watson E, Wheeler DC, Wilkinson TJ, Reid F, Macdougall IC.
In-Text Gene Mentions

…genes (haemochromatosis gene (HFE), Transmembrane proteinase se…

…regulatory genotype (e.g.,HFEand TMPRSS6) on…

Show Full Abstract

<h4>Background</h4>Many people living with chronic kidney disease (CKD) are iron deficient, even though they may not be anaemic. The Iron and Muscle study aims to evaluate whether iron supplementation reduces symptoms of fatigue, improves muscle metabolism, and leads to enhanced exercise capacity and physical function. We report here the trial design and baseline characteristics.<h4>Methods</h4>This is a prospective, double-blind multicentre randomised controlled trial (RCT) including 75 non-dialysis stage 3-4 CKD patients with iron deficiency but without anaemia. Patients were randomly (1:1) assigned to either: i) intravenous iron therapy, or ii) placebo, with concurrent recruitment of eight CKD non-iron deficient participants and six healthy volunteers. The primary outcome of the study is the six-minute walk test (6MWT) distance between baseline and four-weeks. An additional exercise training programme for patients in both groups was initiated and completed between 4 and 12 weeks, to determine the effect of iron repletion compared to placebo treatment in the context of patients undertaking an exercise programme. Additional secondary outcomes include fatigue, physical function, muscle strength, muscle metabolism, quality of life, resting blood pressure, clinical chemistry, safety and harms associated with the iron therapy intervention and the exercise training intervention, and hospitalisations. All outcomes were conducted at baseline, 4, and 12 weeks, with a nested qualitative study, to investigate the experience of living with iron deficiency and intervention acceptability. The cohort have been recruited and baseline assessments undertaken.<h4>Results</h4>Seventy-five individuals were recruited. 44% of the randomised cohort were male, the mean (SD) age was 58 (14) years, and 56% were White. Body mass index was 31 (7) kg/m<sup>2</sup>; serum ferritin was 59 (45) μg/L, transferrin saturation was 22 (10) %, and haemoglobin was 125 (12) g/L at randomisation for the whole group. Estimated glomerular filtration rate was 35 (12) mL/min/1.73 m<sup>2</sup> and the baseline 6MWT distance was 429 (174) m.<h4>Conclusion</h4>The results from this study will address a substantial knowledge gap in the effects of intravenous iron therapy, and offer potential clinical treatment options, to improve exercise capacity, physical function, fatigue, and muscle metabolism, for non-dialysis patients with CKD who are iron-deficient but not anaemic. It will also offer insight into the potential novel effects of an 8-week exercise training programme.<h4>Trial registration</h4>EudraCT: 2018-000,144-25 Registered 28/01/2019.

Also flagged:SUPT4HCREBZFMAPRE1EPM2AIP1MLHgene expression
Journal Article 2022-07-27 ✓ 3 Snippets Deng N, Zhang Y, Ma Z, Lin R, Cheng TH, Tang H, Snyder MP, Cohen SN.
In-Text Gene Mentions

Reduction of the Supt4h or Supt5h concentration by an amount that only marginally alters overall transcript production can prominently affect the ability of RNAPII to proceed through DNA regions containing expanded nucleotide repeats, and dependence on Supt4h or Supt5h for efficient transcript production has been observed for mutated alleles of the HTT gene (16–19), the orf72 locus on human chromosome 9 (i.e. C9orf72 (20,21)) and the NOP56 gene (22)—which are associated respectively with Huntington's Disease, amyotrophic lateral sclerosis and frontotemporal dementia, and SCA36 type ataxia.

…alleles of theHTTgene ( 16–19…

…Huntington's Disease (theHTTgene) ( 16–18…

Show Full Abstract

The DSIF complex comprising the Supt4h and Supt5h transcription elongation proteins clamps RNA polymerase II (RNAPII) onto DNA templates, facilitating polymerase processivity. Lowering DSIF components can differentially decrease expression of alleles containing nucleotide repeat expansions, suggesting that RNAPII transit through repeat expansions is dependent on DSIF functions. To globally identify sequence features that affect dependence of the polymerase on DSIF in human cells, we used ultra-deep ChIP-seq analysis and RNA-seq to investigate and quantify the genome-wide effects of Supt4h loss on template occupancy and transcript production. Our results indicate that RNAPII dependence on Supt4h varies according to G + C content. Effects of DSIF knockdown were prominent during transcription of sequences high in G + C but minimal for sequences low in G + C and were particularly evident for G + C-rich segments of long genes. Reanalysis of previously published ChIP-seq data obtained from mouse cells showed similar effects of template G + C composition on Supt5h actions. Our evidence that DSIF dependency varies globally in different template regions according to template sequence composition suggests that G + C content may have a role in the selectivity of Supt4h knockdown and Supt5h knockdown during transcription of gene alleles containing expansions of G + C-rich repeats.

Also flagged:hydroxychloroquineimmunoglobulinlupusautoantibodiesSSARo
Journal Article 2022-07-27 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Epidermal Growth Factor Receptor 2human epidermal growth factor receptor 2Gene ExpressionmitochondrialHER2breast cancer
Journal Article 2022-07-27 No Snippets Dong X, Dai H, Sun A, Yu Z, Du Y.
Show Full Abstract

<h4>Objective</h4>To identify trastuzumab-resistant genes predicting drug response and poor prognosis in human epidermal growth factor receptor 2 positive (HER2+) breast cancer.<h4>Methods</h4>Gene expression profiles from the GEO (Gene Expression Omnibus) database were obtained and analyzed. Differentially expressed genes (DEGs) between the pathological complete response (pCR) group and non-pCR group in a trastuzumab neoadjuvant therapy cohort and DEGs between Herceptin-resistant and wild-type cell lines were detected and evaluated. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analyses were performed to select the functional hub genes. The hub genes' prognostic power was validated by another trastuzumab adjuvant treatment cohort.<h4>Results</h4>Fifty upregulated overlapping DEGs were identified by analyzing two trastuzumab resistance-related GEO databases. Functional analysis picked out ten hub genes enriched in mitochondrial function and metabolism pathways: <i>ASCL1</i>, <i>CPT2</i>, <i>DLD</i>, <i>ELVOL7</i>, <i>GAMT</i>, <i>NQO1</i>, <i>SLC23A1</i>, <i>SPR</i>, <i>UQCRB</i>, and <i>UQCRQ.</i> These hub genes could distinguish patients with trastuzumab resistance from the sensitive ones. Further survival analysis of hub genes showed that <i>DLD</i> overexpression was significantly associated with an unfavorable prognosis in HER2+ breast cancer patients.<h4>Conclusion</h4>Ten novel trastuzumab resistance-related genes were discovered, of which <i>DLD</i> could be used for trastuzumab response prediction and prognostic prediction in HER2+ breast cancer.

Also flagged:Ironoxygenbindingdeathinfectionimmune response
Journal Article 2022-07-27 No Snippets Ward JL, Torres-Gonzalez M, Ammons MCB.
Show Full Abstract

The association of hyperinflammation and hyperferritinemia with adverse outcomes in SARS-CoV-2-infected patients suggests an integral role for iron homeostasis in pathogenesis, a commonly described symptom of respiratory viral infections. This dysregulated iron homeostasis results in viral-induced lung injury, often lasting long after the acute viral infection; however, much remains to be understood mechanistically. Lactoferrin is a multipurpose glycoprotein with key immunomodulatory, antimicrobial, and antiviral functions, which can be found in various secreted fluids, but is most abundantly characterized in milk from all mammalian species. Lactoferrin is found at its highest concentrations in primate colostrum; however, the abundant availability of bovine-dairy-derived lactoferrin (bLf) has led to the use of bLf as a functional food. The recent research has demonstrated the potential value of bovine lactoferrin as a therapeutic adjuvant against SARS-CoV-2, and herein this research is reviewed and the potential mechanisms of therapeutic targeting are considered.

Also flagged:catecholmelaninspigmentationtyrosinasetyrosineacid
Journal Article 2022-07-27 No Snippets Argenziano R, Della Greca M, Panzella L, Napolitano A.
Show Full Abstract

We report herein an optimized procedure for preparation of carboxamides of 5,6-dihydroxyindole-2-carboxylic acid (DHICA), the main biosynthetic precursor of the skin photoprotective agents melanins, to get access to pigments with more favorable solubility properties with respect to the natural ones. The developed procedure was based on the use of a coupling agent (HATU/DIPEA) and required protection of the catechol function by easily removable acetyl groups. The O-acetylated compounds could be safely stored and taken to the reactive o-diphenol form just before use. Satisfactorily high yields (>85%) were obtained for all amides. The oxidative polymerization of the synthesized amides carried out in air in aqueous buffer at pH 9 afforded melanin-like pigmented materials that showed chromophores resembling those of DHICA-derived pigments, with a good covering of the UVA and the visible region, and additionally exhibited a good solubility in alcoholic solvents, a feature of great interest for the exploitation of these materials as ingredients of dermocosmetic formulations.

Also flagged:Hepatocellular carcinomacancertumorPD1PD-L1CTLA-4
Journal Article 2022-07-27 ✓ 3 Snippets Hu B, Gao J, Shi J, Zhang F, Shi C, Wen P, Wang Z, Guo W, Zhang S.
In-Text Gene Mentions

The pronounced somatic mutations were also observed in patients in C2, including TP53, CTNNB1, TNN, and CACNA1E. Previous studies had revealed that the mutation of TP53 and CTNNB1 mediated cell cycle and WNT signaling pathways, resulting in tumor progression (33).

…TNN , andCACNA1E( Figure 7B…

…TNN , andCACNA1E.…

Show Full Abstract

<h4>Introduction</h4>Necroptosis is a novel pattern of immunogenic cell death and has triggered an emerging wave in antitumor therapy. More evidence has suggested the potential associations between necroptosis and intra-tumoral heterogeneity. Currently, the underlying role of necroptosis remains elusive in hepatocellular carcinoma (HCC) at antitumor immunity and inter-tumoral heterogeneity.<h4>Methods</h4>This study enrolled a total of 728 HCC patients and 139 immunotherapy patients from eight public datasets. The consensus clustering approach was employed to depict tumor heterogeneity of cancer necroptosis. Subsequently, our study further decoded the heterogeneous clinical outcomes, genomic landscape, biological behaviors, and immune characteristics in necroptosis subtypes. For each patient, providing curative clinical recommendations and developing potential therapeutic drugs were used to promote precise medicine.<h4>Results</h4>With the use of the weighted gene coexpression network analysis (WGCNA) algorithm, necroptosis-associated long non-coding RNAs (lncRNAs) (NALRs) were identified in HCC. Based on the NALR expression, two heterogeneous subtypes were decoded with distinct clinical outcomes. Compared to patients in C1, patients in C2 harbored superior pathological stage and presented more unfavorable overall survival and recurrence-free survival. Then, the robustness and reproducibility of necroptosis subtypes were further validated <i>via</i> the nearest template prediction (NTP) approach and classical immune phenotypes. Through comprehensive explorations, C1 was characterized by enriched immune-inflammatory and abundant immune infiltration, while C2 possessed elevated proliferative and metabolic activities and highly genomic instability. Moreover, our results indicated that C1 was more prone to obtain desirable benefits from immunotherapy. For patients in C2, numerous underlying therapeutic agents were developed, which might produce significant efficacy.<h4>Conclusion</h4>This study identified two necroptosis subtypes with distinct characteristics, decoding the tumor heterogeneity. For an individualized patient, our work tailored corresponding treatment strategies to improve clinical management.

Also flagged:Hepatic fibrosisliver graft fibrosisfibrosisbiliary complicationsliver diseaseviral infection
Journal Article 2022-07-27 No Snippets Gu LH, Lv ZC, Wu HX, Hou YC, Gao RL, Xi ZF, Fang H, Feng H, Jiang LX, Xia Q.
Show Full Abstract

<h4>Background</h4>The 20-year survival rate in pediatric patients after liver transplantation (LT) was no more than 70%. Hepatic fibrosis is one of the principal factors affecting the long-term prognosis. Imaging evaluation was the first-line examination for pediatric liver graft assessment. However, the sensitivity and specificity were insufficient. Thus, two-dimensional shear wave elastography (2D-SWE) was performed to evaluate liver graft stiffness and complication in post-transplant pediatric receipt.<h4>Materials and methods</h4>In this retrospective cohort, 343 pediatric recipients who underwent liver graft biopsy in our tertiary LT center were recruited between June 2018 and December 2020. The 2D-SWE evaluation, laboratory examination, routine post-transplant biopsy, and hepatic pathological assessment were performed.<h4>Results</h4>Ninety-eight of the 343 pediatric patients were included according to the protocol. The Liver Stiffness Measurements (LSM) value of 2D-SWE was significantly elevated in post-transplant fibrosis (<i>p</i> < 0.0001). The LSM value of patients with post-transplant biliary complications (<i>p</i> < 0.0001) and biopsy-proven rejection (BPR, <i>p</i> = 0.0016) also rose compared to regular recovery patients. Concerning the sensitivity and specificity of 2D-SWE in diagnosing liver graft fibrosis, the area under the ROC curve (AUC) was 88%, and the optimal cutoff value was 10.3 kPa.<h4>Conclusion</h4>Pediatric LSM by 2D-SWE was efficient. Routine 2D-SWE evaluation could be optimal to predict significant liver graft fibrosis.

Also flagged:heterotopiaSubependymal heterotopianeuronal migration disorderepilepsyfilamin Agestation
Journal Article 2022-07-27 ✓ 1 Snippet Lv B, Zhou Y, Zeng J, Wang L, Zhao F, Chen H, Li X, Song Y, Xiao M, Ding Z, Cheng B.
In-Text Gene Mentions

…SEH concerns theARFGEF2gene ( Ferland…

Show Full Abstract

Subependymal heterotopia (SEH) is a rare neuronal migration disorder consisting of gray matter nodules along the lateral ventricular walls and is often associated with other brain malformations. Despite most SEH cases showing epilepsy during their lifetimes, very few patients with asymptomatically familial SEH tend to cause misdiagnosis or missed diagnosis. We present four familial SEH cases without any positive symptoms and medical history, including two fetuses, who were diagnosed by MRI and confirmed by genetic testing with mutation of filamin A. This report emphasizes the role of MRI in the recognition of SEH at an early age of gestation and in asymptomatically familial SEH. MRI provides a fast, repeatable, reliable, and cheap choice for detecting and screening familial SEH.

Also flagged:HuntingtinCysteineamino acidprotein synthesissulfurglutathione
Journal Article 2022-07-27 ✓ 1 Snippet Paul BD, Sbodio JI, Snyder SH.
In-Text Gene Mentions

…either full-length wild-typeHtt, wtHtt (HD17), or…

Show Full Abstract

Cysteine is a semi-essential amino acid that not only plays an essential role as a component of protein synthesis, but also in the generation of numerous sulfur-containing molecules such as the antioxidant glutathione and coenzyme A. We previously showed that the metabolism of cysteine is dysregulated in Huntington's disease (HD), a neurodegenerative disorder triggered by the expansion of polyglutamine repeats in the protein huntingtin. In this study, we showed that cysteine metabolism is compromised at multiple levels in HD, both transcriptional and post-translational. Accordingly, restoring cysteine homeostasis may be beneficial in HD.

Also flagged:TNFRheumatoid ArthritisproteasomelipoproteinsRAautoimmune disease
Journal Article 2022-07-27 No Snippets Jezernik G, Gorenjak M, Potočnik U.
Show Full Abstract

Anti-TNF therapy has significantly improved disease control in rheumatoid arthritis, but a fraction of rheumatoid arthritis patients do not respond to anti-TNF therapy or lose response over time. Moreover, the mechanisms underlying non-response to anti-TNF therapy remain largely unknown. To date, many single biomarkers of response to anti-TNF therapy have been published but they have not yet been analyzed as a system of interacting nodes. The aim of our study is to systematically elucidate the biological processes underlying non-response to anti-TNF therapy in rheumatoid arthritis using the gene ontologies of previously published predictive biomarkers. Gene networks were constructed based on published biomarkers and then enriched gene ontology terms were elucidated in subgroups using gene ontology software tools. Our results highlight the novel role of proteasome-mediated protein catabolic processes (<i>p</i> = 2.91 × 10<sup>-15</sup>) and plasma lipoproteins (<i>p</i> = 4.55 × 10<sup>-11</sup>) in anti-TNF therapy response. The results of our gene ontology analysis help elucidate the biological processes underlying non-response to anti-TNF therapy in rheumatoid arthritis and encourage further study of the highlighted processes.

Also flagged:Multiple SclerosisSP1TNF-αneuro-inflammatory disorderMSrelapsing-remitting multiple sclerosis
Journal Article 2022-07-27 ✓ 5 Snippets Hadi N, Seifati SM, Nateghi B, Ravaghi P, Khosravian F, Namazi F, Fotouhi Firouzabad M, Shaygannejad V, Salehi M.
In-Text Gene Mentions

In this in silico-experimental study, we evaluated the association of miR-106a, miR-125b, and miR330- with TNFSF4 and SP1 gene expression levels in 60 RRMS patients and 30 healthy controls byreal-time polymerase chain reaction (PCR).

…Patients by TargetingTNFSF4and SP1 in…

…miRNAs' impact onTNFSF4and Sp1 genes…

…and miR330- withTNFSF4and SP1 gene…

…The expression ofTNFSF4in patients demonstrated…

Show Full Abstract

<h4>Objective</h4>Multiple sclerosis (MS) is a complex multifactorial neuro-inflammatory disorder. This complexity arises from the evidence suggesting that MS is developed by interacting with environmental and genetic factors. This study aimed to evaluate the miR-106a, miR-125b, and miR330- expression levels in relapsing-remitting multiple sclerosis (RRMS) patients. The miRNAs' impact on TNFSF4 and Sp1 genes through the NF-кB/TNF-α signaling pathway was analyzed by measuring the expression levels in case and controls.<h4>Materials and methods</h4>In this in silico-experimental study, we evaluated the association of miR-106a, miR- 125b, and miR330- with TNFSF4 and SP1 gene expression levels in 60 RRMS patients and 30 healthy controls by real-time polymerase chain reaction (PCR).<h4>Results</h4>The expression levels of miR-330, miR-106a, and miR125-b in blood samples of RRMS patients were predominantly reduced. The expression of TNFSF4 in patients demonstrated a significant enhancement, in contrast to the diminishing Sp1 gene expression level in controls.<h4>Conclusion</h4>Our findings indicated an association between miR-106a and miR-330 and miR125-b expression and RRMS in our study population. Our data suggested that the miR106-a, miR125-b, and mir330- expression are correlated with TNFSF4 and Sp1 gene expression levels.

Also flagged:ironTShereditary haemochromatosisHHerythropoiesisarthritis
Journal Article 2022-07-27 ✓ 2 Snippets Ryan E, Mulready K, Wiegerinck E, Russell J, Swinkels DW, Stewart S.
In-Text Gene Mentions

…mutation in theHFEgene [ 1…

…the mutation inHFE) and thereby modulating…

Show Full Abstract

C282Y homozygotes exposed to sustained elevated transferrin saturation (TS) may develop worsening clinical symptoms. This might be related to the appearance of non-transferrin bound iron (NTBI) when TS≥50% and labile plasma iron (LPI) when TS levels reach 75-80%. In this study, NTBI levels were examined in 219 randomly selected untreated and treated C282Y homozygotes. Overall, 161 of 219 had TS ≥ 50%, 124 of whom had detectable NTBI (≥0.47 µM, 1.81 µM [0.92-2.46 µM]) with a median serum ferritin 320 µg/L (226-442 µg/L). Ninety of 219 homozygotes had TS ≥ 75%, and all had detectable NTBI (2.21 µM [1.53-2.59 µM] with a median ferritin 338 µg/L [230-447 µg/L]). Of 125 homozygotes who last had phlebotomy ≥12 months ago (42 months [25-74 months], 92 had TS levels ≥ 50%, and 70 of these had NTBI ≥ 0.47 µM (2.06 µM [1.23-2.61µM]). Twenty-six of these 70 had a normal ferritin. Fifty-five of 125 had TS ≥ 75%, and NTBI was detected in all of these (2.32 µM [1.57-2.77 µM]) with a median ferritin 344 µg/L (255-418 µg/L). Eighteen of these 55 had a normal ferritin. In summary, NTBI is frequently found in C282Y homozygotes with TS ≥ 50%. Furthermore, C282Y homozygotes in the maintenance phase often have TS ≥ 50% together with a normal ferritin. Therefore, monitoring the TS level during the maintenance phase is recommended as an accessible clinical marker of the presence of NTBI.

Research Square 2022-07-27 Preprint (No Snippets API) Ochi Y, Hu D, Li D, Arakaki W, Mawatari A, Shigeta M, Wu Y, Hayashinaka E, Neyama H, Tahara T, Wada Y, Li F, Doi H, Watanabe Y, Cui Y.
Show Full Abstract

A s eries of symptoms, including fever, widespread pain, fatigue, and even ageusia, have frequently been reported in the context of various infections, such as COVID-19. Although the pathogenic mechanisms underlying an infection causing fever and pain have been well established, the mechanisms of fatigue induced by infection remain unclear. To elucidate whether and how the peripheral infection cause fatigue via regional neuroinflammation, we performed a brain-wide investigation of neuroinflammation in a peripheral pseudoinfection rat model using [ 18 F]DPA-714 positron emission tomography (PET) imaging analysis, in which the polyriboinosinic: polyribocytidylic acid (poly I:C) was intraperitoneally injected. Consistent with previous reports, transient fever lasting for several hours and subsequent suppression of spontaneous activity lasting a few days were induced by poly I:C treatment. Significant increase in plasma interleukin (IL)-1β, IL-6 and tumour necrosis factor (TNF)-α were observed at 2 and 4 h following poly I:C treatment. PET imaging analysis revealed that the brain uptake of [ 18 F]DPA-714 was significantly increased in several brain regions one day after poly I:C treatment, such as the dorsal raphe (DR), parvicellular part of red nucleus (RPC), A5 and A7 noradrenergic nucleus, compared with the control group. The accumulation of [ 18 F]DPA-714 in the DR, RPC and A5 was positively correlated with the fatigue-like behavior, and that in the A7 tended to positively correlate with fever. These findings suggest that peripheral infection may trigger regional neuroinflammation, which may cause specific symptoms such as fatigue. A similar mechanism might be involved in COVID-19.

Also flagged:liver diseasesRDCOVID-19Primary Biliary Cholangitisα1-antitrypsin deficiencypolycystic liver disease
Journal Article 2022-07-26 No Snippets Pericleous M, Kelly C, Schilsky M, Dhawan A, Ala A.
Show Full Abstract

<h4>Introduction</h4>A rare disease is defined by the European Health Commission as a disorder affecting less than 5/10,000 of the population. There are at least 20 rare liver diseases (RLDs) seen frequently in the adult and paediatric liver clinic, signifying that the hepatology community can be influential in developing such patient databases for registering patients with rare hepatic conditions. The aim of this review was, first, to identify registries for RLDs in Europe, and, second, to design a universal blueprint for the development of a registry for RLD by using lessons learnt from the European registries that have already been established.<h4>Methods</h4>We searched PubMed, Google Scholar and clinicaltrials.gov using the MESH terms 'registries', 'database management systems', 'database' and the non-MESH terms 'database$', 'registry', 'repository' and 'repositories'. We only included studies in English from countries/consortia of the European Union (EU). Our literature search was performed in 2020.<h4>Results</h4>We identified 37 registries for RLDs in Europe. Using information from the design of these registries we designed a blueprint for the development of a patient registry for an RLD consisting of a theoretical, technical and maintenance phase.<h4>Discussion</h4>It is believed that rare diseases may affect as much as 6-8% of the EU population across its 28 member states. Here we have provided a toolkit for designing a registry for an RLD. Our article will complement the efforts of loco-regional, national and international groups seeking to establish robust systems for data collection and analysis for orphan liver diseases.

Also flagged:GNB3NOS3ACE IIACTN3PPARGC1AAMPD1
Journal Article 2022-07-26 ✓ 5 Snippets Konopka MJ, van den Bunder JCML, Rietjens G, Sperlich B, Zeegers MP.
In-Text Gene Mentions

…2.85 [1.27–6.39] forHFEGG + CG…

…(0%–20%) except forHFE(71%), GNB3 (80%),…

…iron regulator (HFE) rs1799945 (GG…

…(0%–20%) except forHFE(71%), GNB3 (80%)…

…AMPD1 andHFE

Show Full Abstract

The aim of this systematic review and meta-analysis was to identify the genetic variants of (inter)national competing long-distance runners and road cyclists compared with controls. The Medline and Embase databases were searched until 15 November 2021. Eligible articles included genetic epidemiological studies published in English. A homogenous group of endurance athletes competing at (inter)national level and sedentary controls were included. Pooled odds ratios based on the genotype frequency with corresponding 95% confidence intervals (95%CI) were calculated using random effects models. Heterogeneity was addressed by Q-statistics, and I<sup>2</sup> . Sources of heterogeneity were examined by meta-regression and risk of bias was assessed with the Clark Baudouin scale. This systematic review comprised of 43 studies including a total of 3938 athletes and 10 752 controls in the pooled analysis. Of the 42 identified genetic variants, 13 were investigated in independent studies. Significant associations were found for five polymorphisms. Pooled odds ratio [95%CI] favoring athletes compared with controls was 1.42 [1.12-1.81] for ACE II (I/D), 1.66 [1.26-2.19] for ACTN3 TT (rs1815739), 1.75 [1.34-2.29] for PPARGC1A GG (rs8192678), 2.23 [1.42-3.51] for AMPD1 CC (rs17602729), and 2.85 [1.27-6.39] for HFE GG + CG (rs1799945). Risk of bias was low in 25 (58%) and unclear in 18 (42%) articles. Heterogeneity of the results was low (0%-20%) except for HFE (71%), GNB3 (80%), and NOS3 (76%). (Inter)national competing runners and cyclists have a higher probability to carry specific genetic variants compared with controls. This study confirms that (inter)national competing endurance athletes constitute a unique genetic make-up, which likely contributes to their performance level.

Also flagged:Ripretinibgastrointestinal stromal tumorssolid tumorsimatinibtyrosine kinaseKIT
Journal Article 2022-07-26 No Snippets Goggin C, Stansfeld A, Mahalingam P, Thway K, Smith MJ, Huang P, Jones RL, Napolitano A.
Show Full Abstract

Over the past 20 years, the management of gastrointestinal stromal tumors has acted as an important model in the advancement of molecularly targeted therapies for solid tumors. The success of imatinib has established it as a lasting therapy in the management of early-stage and advanced disease in the first-line setting. Imatinib resistance inevitably develops, resulting in the need for further lines of therapy. Ripretinib is an orally administered switch-control tyrosine kinase inhibitor, specifically developed to target both primary and secondary KIT and PDGFRα resistance mutations. Herein, the authors discuss the molecular rationale, the preclinical evidence and the clinical use of ripretinib in the treatment of gastrointestinal stromal tumors in the advanced stages of disease.

Also flagged:ductal carcinoma in situDCISneoplasiainvasive ductal carcinomaGene ExpressionBreast Cancer
Journal Article 2022-07-26 No Snippets Zhang J, Lin H, Hou L, Xiao H, Gong X, Guo X, Cao X, Liu Z.
Show Full Abstract

Following the implementation of breast screening programs, the occurrence of ductal carcinoma in situ (DCIS) as an early type of neoplasia has increased. Although the prognosis is promising, 20%-50% of DCIS patients will progress to invasive ductal carcinoma (IDC) if not treated. It is essential to look for promising biomarkers for predicting DCIS prognosis. The Gene Expression Omnibus (GEO) database was used to explore the expression of genes that differed between DCIS and normal tissue in this investigation. Enrichment analysis was performed to characterize the biological role and intrinsic process pathway. The Cancer Genome Atlas Breast Cancer Dataset was used to categorize the hub genes, and the results were confirmed using the Cytoscape plugin CytoHubba and MCODE. The prognostic ability of the core gene signature was determined through time-dependent receiver operating characteristic (ROC), Kaplan-Meier survival curve, Oncomine databases, and UALCAN databases. In addition, the prognostic value of core genes was verified in proliferation assays. We identified 217 common differentially expressed genes (DEGs) in the present study, with 101 upregulated and 138 downregulated genes. The top genes were obtained from the PPI network (protein-protein interaction). A unique six-gene signature (containing GAPDH, CDH2, BIRC5, NEK2, IDH2, and MELK) was developed for DCIS prognostic prediction. Centered on the Cancer Genome Atlas (TCGA) cohort, the ROC curve showed strong results in prognosis prediction. The six core gene signatures is often overexpressed in DCIS, with a weak prognosis. Furthermore, when breast cancer cells are transfected with small interfering RNAs, downregulation of core gene expression substantially inhibits cell proliferation, revealing a high potential for employing core genes in DCIS prognosis. In conclusion, the current investigation verified the six core genes signatures for prospective DCIS biomarkers, which may aid clinical decision-making for individual care.

Also flagged:MEF2Ccerebral ischemiaoxygenglucosegene expressionsluciferase
Journal Article 2022-07-26 ✓ 2 Snippets Xu J, Huang X, Liu S, Chen D, Xie Y, Zhao Z.
In-Text Gene Mentions

…LncRNAZNFX1antisense RNA 1…

…ABSTRACT LncRNAZNFX1 antisense RNA 1antisense RNA 1…

Show Full Abstract

LncRNA ZNFX1 antisense RNA 1 (ZFAS1) could improve neuronal damage and inhibit inflammation and apoptosis. We conducted an in-depth exploration on the protective mechanism of ZFAS1 in cerebral ischemia-reperfusion injury. Overexpressed or silenced plasmids of ZFAS1 were transfected into the cells to analyze the effects of oxygen-glucose deprivation/reperfusion (OGD/R) treatment on the viability, apoptosis and related gene expressions of Neuro-2a cell by performing MTT assay, flow cytometry, qRT-PCR, and Western blot. Bioinformatic analysis, qRT-PCR, dual-luciferase reporter assay and RNA immunoprecipitation were used to screen and verify the miRNA(s) which could competitively bind with ZFAS1 and downstream mRNA(s) targeted by the miRNA(s). The effects of ZFAS1 and the above target miRNA(s) or gene(s) on the apoptosis of OGD/R-injured cells, apoptosis-related proteins, inflammatory factors and p65/IκBα pathway were further verified via the rescue test. The results from the middle cerebral artery occlusion (MCAO) mouse model <i>in vivo</i> were consistent with those from the cellular experiments. The expression of lncRNA ZFAS1 in OGD/R-injured cells was inhibited, and the up-regulation of ZFAS1 protected Neuro-2a cells. MiR-421-3p was predicted to be the target miRNA of ZFAS1 and could offset the protective effect of ZFAS1 overexpression on OGD/R-injured cells following its up-regulation. MEF2C, which was the downstream target gene of miR-421-3p, reversed the OGD/R-induced enhanced cell damage caused by miR-421-3p mimic when MEF2C was overexpressed. In <i>in vivo</i> studies, ZFAS1 overexpression reduced brain tissue infarction, apoptosis and gene regulation caused by MCAO, while miR-421-3p mimic had the opposite effect. Collectively, the regulation of lncRNA ZFAS1/miR-421-3p/MEF2C axis showed protective effects on cerebral ischemia-reperfusion injury.

Also flagged:tumornon-small cell lung cancerNSCLCPD-L1CD274gene expression
Journal Article 2022-07-26 ✓ 2 Snippets Gao Y, Stein MM, Kase M, Cummings AL, Bharanikumar R, Lau D, Garon EB, Patel SP.
In-Text Gene Mentions

Among the 1,526 differentially expressed genes identified, only 12 also significantly differed by stage (C1orf111, CCR4, POU5F1, CDCA7, CYP4A11, CD83, BTN2A2, PBXIP1, OSGEP, DYNLL1, CD1A, and PIM3), suggesting the expression differences identified between stage III and stage IV NSCLC tumors were not driven by EGFR-mutated tumors.

…CDCA7, CYP4A11, CD83,BTN2A2, PBXIP1, OSGEP, DYNLL1,…

Show Full Abstract

<h4>Background</h4>Adjuvant immune checkpoint blockade (ICB) following chemoradiotherapy and adding ICB to chemotherapy have been key advances for stages III-IV non-small cell lung cancer (NSCLC) treatment. However, known biomarkers like PD-L1 are not consistently indicative of ICB response. Other markers within the tumor immune microenvironment (TIME) may better reflect ICB response and/or resistance mechanisms, but an understanding of how TIMEs differ between stage III and IV NSCLC has not been explored.<h4>Methods</h4>Real-world data from unresectable, stage III-IV, non-squamous, pretreatment NSCLCs (stage III n = 106, stage IV n = 285) were retrospectively analyzed. PD-L1 immunohistochemistry (IHC) was compared to CD274 gene expression. Then, differential gene expression levels, pathway enrichment, and immune infiltrate between stages were calculated from whole-transcriptome RNA-seq. Analyses were stratified by EGFR status.<h4>Results</h4>PD-L1 IHC and CD274 expression in tumor cells were highly correlated (n = 295, P < 2.2e-16, ⍴ = 0.74). CTLA4 expression was significantly increased in stage III tumors (P = 1.32e-04), while no differences were observed for other ICB-related genes. Metabolic pathway activity was significantly enriched in stage IV tumors (P = 0.004), whereas several immune-related KEGG pathways were enriched in stage III. Stage IV tumors had significantly increased macrophage infiltration (P = 0.0214), and stage III tumors had a significantly higher proportion of CD4 + T cells (P = 0.017). CD4 + T cells were also relatively more abundant in EGFR-mutant tumors vs. wild-type (P = 0.0081).<h4>Conclusion</h4>Directly comparing the TIMEs of stage III and IV NSCLC, these results carry implications for further studies of ICB response in non-resectable stage III NSCLC and guide further research of prognostic biomarkers and therapeutic targets.

Also flagged:free radicallackFRPEPOXK12radical
Journal Article 2022-07-26 No Snippets Lin JT, Lalevee J, Cheng DC.
Show Full Abstract

The kinetics and the conversion features of two 3-component systems (A/B/N), based on the proposed new kinetic schemes of Mokbel and Mau et al, in which a visible LED is used to excite a copper complex to its excited triplet state (G*). The coupling of G* with iodonium salt and ethyl 4-(dimethylamino)benzoate (EDB) produces both free radical polymerization (FRP) of acrylates and the free radical promoted cationic polymerization (CP) of epoxides using various new copper complex as the initiator. Higher FRP and CP conversion can be achieved by co-additive of [B] and N, via the dual function of (i) regeneration [A], and (ii) generation of extra radicals. The interpenetrated polymer network (IPN) capable of initiating both FRP and CP in a blend of TMPTA and EPOX. The synergic effects due to CP include: (i) CP can increase viscosity limiting the diffusional oxygen replenishment; (ii) the cation also acts as a diluting agent for the IPN network, and (iii) the exothermic property of the CP. The catalytic cycle, synergic effects, and the oxygen inhibition are theoretically confirmed to support the experimental hypothesis. The measured results of Mokbel and Mau et al are well analyzed and matching the predicted features of our modeling.

Also flagged:CSFCPCCardiac arrestCPC 1CPRglucose
Journal Article 2022-07-26 No Snippets Paul M, Benghanem S, Merceron S, Bellut H, Dumas F, Henry A, Bruneel F, Bedos JP, Cariou A, Legriel S.
Show Full Abstract

<h4>Introduction</h4>Lumbar puncture is among the investigations used to identify various neurological conditions, including some that can cause cardiac arrest (CA). However, CA per se may alter cerebrospinal fluid (CSF) characteristics. Few studies have investigated CSF findings after CA. In this descriptive work, we assessed the frequency and risk factors of abnormal CSF findings after CA and the contribution of CSF analysis to the etiological diagnosis.<h4>Materials and methods</h4>We retrospectively studied data from prospectively established databases of consecutive patients who were admitted to two French ICUs in 2007-2016 with sustained return of spontaneous circulation (ROSC) after CA and who underwent lumbar puncture as an etiological investigation.<h4>Results</h4>Of 1984 patients with sustained ROSC, 55 (2.7%) underwent lumbar puncture and were included. Lumbar puncture identified a neurological cause of CA in 2/55 (3.6%) patients. Nonspecific CSF abnormalities were noted in 37/53 (69.8%) patients. By multivariate analysis, postresuscitation shock was positively associated with CSF abnormalities (OR, 6.92; 95% confidence interval [95%CI], 1.62-37.26; P = 0.013). A no-flow time above 6 minutes (OR, 0.19; 95%CI, 0.03-1.11; P = 0.076) and a respiratory cause of CA (OR, 2.91; 95%CI, 0.53-23.15; P = 0.24) were not statistically associated with CSF abnormalities. Nonspecific CSF abnormalities were not significantly associated with poor outcomes (Cerebral Performance Category ≥3; P = 0.06).<h4>Conclusions</h4>Lumbar puncture, although infrequently performed, may contribute to the etiological diagnosis of CA, albeit rarely. Nonspecific CSF abnormalities seem common after CA, notably with postresuscitation shock, and may be related to blood-brain barrier disruption. These findings may help to interpret CSF findings after CA. Further studies are warranted to assess our results.

Also flagged:ARCHsleeping
Journal Article 2022-07-26 ✓ 1 Snippet Nouman M, Hashim M, Trifan VA, Spinu AE, Siddiqi MF, Khan FU.
In-Text Gene Mentions

…MultivariateDCC-GARCH models results…

Show Full Abstract

Despite a direct ban on charging interest, interest-based benchmarks are used as a pricing reference by a majority of Islamic banks, due in part to the absence of stable and widely- published alternatives. Benchmarking interest rate exposes Islamic banks to the problems of conventional banks, particularly the interest rate risk. Against this backdrop, the present study empirically examines the dynamic linkage between the interest rate volatility and the financing of Islamic banks. The empirical analysis is carried using evidence from the Islamic banking industry of Pakistan during the time period 2006-2020. The multivariate Johansen and Jusiles Co-integration test and Vector Error Correction Model (VECM) are used as the baseline econometric models. Moreover, the DCC-GARCH model is employed for robustness and ensuring the consistency of results. The results indicate that a significant long-term and short-term relationship exists between the interest rate volatility and the financing of Islamic banking industry providing significant evidence for co-movements and convergence. These findings suggest that paradoxical as it may seem, the financing of Islamic banks operating within a dual banking system is subject to interest rate risk, mainly due to benchmarking interest rate, which in-turn makes Islamic banks vulnerable to the rate of return risk and withdrawal risk. Moreover, corporate financing, in particular, is more vulnerable to interest rate risk.

Also flagged:ferroptosisirondeathphospholipidspolyunsaturated fatty acidslipid
Journal Article 2022-07-26 No Snippets Yang L, Cao LM, Zhang XJ, Chu B.
Show Full Abstract

Ferroptosis is an iron-dependent regulated cell death marked by excessive oxidative phospholipids (PLs). The polyunsaturated fatty acids-containing phospholipids (PUFA-PLs) are highly susceptible to lipid peroxidation under oxidative stress. Numerous pulmonary diseases occurrences and degenerative pathologies are driven by ferroptosis. This review discusses the role of ferroptosis in the pathogenesis of pulmonary diseases including asthma, lung injury, lung cancer, fibrotic lung diseases, and pulmonary infection. Additionally, it is proposed that targeting ferroptosis is a potential treatment for pulmonary diseases, particularly drug-resistant lung cancer or antibiotic-resistant pulmonary infection, and reduces treatment-related adverse events.

Also flagged:set 1RPErunCRYABTMTB18
Journal Article 2022-07-26 No Snippets Chen L, Perera ND, Karoukis AJ, Feathers KL, Ali RR, Thompson DA, Fahim AT.
Show Full Abstract

The retinal pigment epithelium (RPE) is a polarized monolayer that secretes growth factors and cytokines towards the retina apically and the choroid basolaterally. Numerous RPE secreted proteins have been linked to the pathogenesis of age-related macular degeneration (AMD). The purpose of this study was to determine the differential apical and basolateral secretome of RPE cells, and the effects of oxidative stress on directional secretion of proteins linked to AMD and angiogenesis. Tandem mass tag spectrometry was used to profile proteins in human iPSC-RPE apical and basolateral conditioned media. Changes in secretion after oxidative stress induced by H<sub>2</sub>O<sub>2</sub> or tert-butyl hydroperoxide (tBH) were investigated by ELISA and western analysis. Out of 926 differentially secreted proteins, 890 (96%) were more apical. Oxidative stress altered the secretion of multiple factors implicated in AMD and neovascularization and promoted a pro-angiogenic microenvironment by increasing the secretion of pro-angiogenic molecules (VEGF, PTN, and CRYAB) and decreasing the secretion of anti-angiogenic molecules (PEDF and CFH). Apical secretion was impacted more than basolateral for PEDF, CRYAB and CFH, while basolateral secretion was impacted more for VEGF, which may have implications for choroidal neovascularization. This study lays a foundation for investigations of dysfunctional RPE polarized protein secretion in AMD and other chorioretinal degenerative disorders.

Also flagged:cell divisionhepatocellular carcinomaironcancerscytokinesistumors
Journal Article 2022-07-26 ✓ 5 Snippets Dong P, Cai Z, Li B, Zhu Y, Chan AKY, Chiang MWL, Au CH, Sung WK, Cheung TT, Lo CM, Man K, Lee NP.
In-Text Gene Mentions

HFE (Hemochromatosis) is a conventional iron level regulator and its loss of function due to gene mutations increases the risk of cancers including hepatocellular carcinoma (HCC).

Here, we first reported HFE as an oncogene in HCC and its undescribed function on promoting abscission in cytokinesis during mitotic cell division, independent of its iron-regulating ability.

Clinical analyses revealed HFE upregulation in tumors linking to large tumor size and poor prognosis.

Likewise, studies focusing on HFE overexpression in cancers are all limited to linking up these events as a consequence of iron level deregulation.

HFE(Hemochromatosis) is a…

Show Full Abstract

HFE (Hemochromatosis) is a conventional iron level regulator and its loss of function due to gene mutations increases the risk of cancers including hepatocellular carcinoma (HCC). Likewise, studies focusing on HFE overexpression in cancers are all limited to linking up these events as a consequence of iron level deregulation. No study has explored any iron unrelated role of HFE in cancers. Here, we first reported HFE as an oncogene in HCC and its undescribed function on promoting abscission in cytokinesis during mitotic cell division, independent of its iron-regulating ability. Clinical analyses revealed HFE upregulation in tumors linking to large tumor size and poor prognosis. Functionally and mechanistically, HFE promoted cytokinetic abscission via facilitating ESCRT abscission machinery recruitment to the abscission site through signaling a novel HFE/ALK3/Smads/LIF/Hippo/YAP/YY1/KIF13A axis. Pharmacological blockage of HFE signaling axis impeded tumor phenotypes in vitro and in vivo. Our data on HFE-driven HCC unveiled a new mechanism utilized by cancer cells to propel rapid cell division. This study also laid the groundwork for tumor intolerable therapeutics development given the high cytokinetic dependency of cancer cells and their vulnerability to cytokinetic blockage.

Also flagged:gene expressiontranslationalnucleuscytoplasmlocalizationnuclear export factors
Journal Article 2022-07-26 ✓ 1 Snippet Kaczynski TJ, Au ED, Farkas MH.
In-Text Gene Mentions

…Repeat expansions inHTTand C9ORF72 are…

Show Full Abstract

<h4>Background</h4>Long noncoding RNAs (lncRNAs) are emerging as a class of genes whose importance has yet to be fully realized. It is becoming clear that the primary function of lncRNAs is to regulate gene expression, and they do so through a variety of mechanisms that are critically tied to their subcellular localization. Although most lncRNAs are poorly understood, mapping lncRNA subcellular localization can provide a foundation for understanding these mechanisms.<h4>Results</h4>Here, we present an initial step toward uncovering the localization landscape of lncRNAs in the human retinal pigment epithelium (RPE) using high throughput RNA-Sequencing (RNA-Seq). To do this, we differentiated human induced pluripotent stem cells (iPSCs) into RPE, isolated RNA from nuclear and cytoplasmic fractions, and performed RNA-Seq on both. Furthermore, we investigated lncRNA localization changes that occur in response to oxidative stress. We discovered that, under normal conditions, most lncRNAs are seen in both the nucleus and the cytoplasm to a similar degree, but of the transcripts that are highly enriched in one compartment, far more are nuclear than cytoplasmic. Interestingly, under oxidative stress conditions, we observed an increase in lncRNA localization in both nuclear and cytoplasmic fractions. In addition, we found that nuclear localization was partially attributable to the presence of previously described nuclear retention motifs, while adenosine to inosine (A-to-I) RNA editing appeared to play a very minimal role.<h4>Conclusions</h4>Our findings map lncRNA localization in the RPE and provide two avenues for future research: 1) how lncRNAs function in the RPE, and 2) how one environmental factor, in isolation, may potentially play a role in retinal disease pathogenesis through altered lncRNA localization.

Also flagged:RFX6MafBInsulinPAX4PDX1INS
Journal Article 2022-07-26 ✓ 2 Snippets Ghoneim MA, Gabr MM, Refaie AF, El-Halawani SM, Al-Issawi MM, Elbassiouny BL, Kader MAAE, Ismail AM, Zidan MF, Karras MS, Magar RW, Khater SM, Ashamallah SA, Zakaria MM, Kloc M.
In-Text Gene Mentions

For the next 12 days, the cells were cultured in high glucose (4.5 g glucose/L) human MSC-medium supplemented with10 mM nicotinamide (Sigma-Aldrich), 10 nM glucagon-like peptide-1 (Sigma—Aldrich), 10 μg/l PRDX6 protein (Biovision, CA, USA) and 0.1 nM exendin-4 (Sigma-Aldrich).

…(Sigma—Aldrich), 10 µg/lPRDX6protein (Biovision, CA,…

Show Full Abstract

<h4>Background</h4>The purpose of this study was to investigate allogenic immune responses following the transplantation of insulin-producing cells (IPCs) differentiated from human adipose tissue-derived stem cells (hAT-MSCs) into humanized mice.<h4>Methods</h4>hAT-MSCs were isolated from liposuction aspirates obtained from HLA-A2-negative healthy donors. These cells were expanded and differentiated into IPCs. HLA-A2-positive humanized mice (NOG-EXL) were divided into 4 groups: diabetic mice transplanted with IPCs, diabetic but nontransplanted mice, nondiabetic mice transplanted with IPCs and normal untreated mice. Three million differentiated cells were transplanted under the renal capsule. Animals were followed-up to determine their weight, glucose levels (2-h postprandial), and human and mouse insulin levels. The mice were euthanized 6-8 weeks posttransplant. The kidneys were explanted for immunohistochemical studies. Blood, spleen and bone marrow samples were obtained to determine the proportion of immune cell subsets (CD4<sup>+</sup>, CD8<sup>+</sup>, CD16<sup>+</sup>, CD19<sup>+</sup> and CD69<sup>+</sup>), and the expression levels of HLA-ABC and HLA-DR.<h4>Results</h4>Following STZ induction, blood glucose levels increased sharply and were then normalized within 2 weeks after cell transplantation. In these animals, human insulin levels were measurable while mouse insulin levels were negligible throughout the observation period. Immunostaining of cell-bearing kidneys revealed sparse CD45<sup>+</sup> cells. Immunolabeling and flow cytometry of blood, bone marrow and splenic samples obtained from the 3 groups of animals did not reveal a significant difference in the proportions of immune cell subsets or in the expression levels of HLA-ABC and HLA-DR.<h4>Conclusion</h4>Transplantation of IPCs derived from allogenic hAT-MSCs into humanized mice was followed by a muted allogenic immune response that did not interfere with the functionality of the engrafted cells. Our findings suggest that such allogenic cells could offer an opportunity for cell therapy for insulin-dependent diabetes without immunosuppression, encapsulation or gene manipulations.

Also flagged:traumaNFATNFATc1NFATC2IPNFATc2NFATc4
Journal Article 2022-07-26 No Snippets Yu BF, Yin N, Wang Z, Chen XX, Dai CC, Wei J.
Show Full Abstract

<h4>Objective</h4>To investigate the dynamic expression of NFAT family of periosteum in guided bone regeneration process.<h4>Material and methods</h4>The swine ribs on one side were used as the trauma group and the contralateral side as the control group. After rib segment was removed, periosteum was sutured to form a closed cavity mimicking guided bone regeneration. The periosteum and regenerated bone tissue were collected at nine time points for gene sequencing and hematoxylin-eosin staining. The expression data of each member were extracted for analysis. Expression correlations among various members were analyzed.<h4>Results</h4>Staining showed the guided bone regeneration was almost completed 1 month after the operation with later stage for bone remodeling. The expression levels of each member in both groups changed greatly, especially within postoperative 1.5 months. The expression of NFATc1 and NFATC2IP in trauma group was significantly correlated with those of control group. The foldchange of each member also had large fluctuations especially within 1.5 months. In the trauma group, NFATc2 and NFATc4 were significantly upregulated, and there was a significant aggregation correlation of NFAT family expression between the various time points within one month, similar to the "pattern-block" phenomenon.<h4>Conclusion</h4>This study revealed the dynamic expression of NFAT family in guided bone regeneration, and provided a reference for the specific mechanism. The first 1.5 months is a critical period and should be paid attention to. The significant high-expression of NFATc2 and NFATc4 may role importantly in this process, which needs further research to verify it.

Also flagged:heroinmethamphetaminenaloxoneinfectious diseasesopioid use disorderdrug
Journal Article 2022-07-26 No Snippets Jenkins RA, Whitney BM, Nance RM, Allen TM, Cooper HLF, Feinberg J, Fredericksen R, Friedmann PD, Go VF, Jenkins WD, Korthuis PT, Miller WC, Pho MT, Rudolph AE, Seal DW, Smith GS, Stopka TJ, Westergaard RP, Young AM, Zule WA, Delaney JAC, Tsui JI, Crane HM, Rural Opioid Initiative.
Show Full Abstract

<h4>Objective</h4>To characterize and address the opioid crisis disproportionately impacting rural U.S. regions.<h4>Methods</h4>The Rural Opioid Initiative (ROI) is a two-phase project to collect and harmonize quantitative and qualitative data and develop tailored interventions to address rural opioid use. The baseline quantitative survey data from people who use drugs (PWUD) characterizes the current opioid epidemic (2018-2020) in eight geographically diverse regions.<h4>Results</h4>Among 3,084 PWUD, 92% reported ever injecting drugs, 86% reported using opioids (most often heroin) and 74% reported using methamphetamine to get high in the past 30 days; 53% experienced homelessness in the prior 6 months; and 49% had ever overdosed. Syringe service program use varied by region and 53% had ever received an overdose kit or naloxone prescription. Less than half (48%) ever received medication for opioid use disorder (MOUD).<h4>Conclusions</h4>The ROI combines data across eight rural regions to better understand drug use including drivers and potential interventions in rural areas with limited resources. Baseline ROI data demonstrate extensive overlap between opioid and methamphetamine use, high homelessness rates, inadequate access to MOUD, and other unmet needs among PWUD in the rural U.S. By combining data across studies, the ROI provides much greater statistical power to address research questions and better understand the syndemic of infectious diseases and drug use in rural settings including unmet treatment needs.

Also flagged:InfectionsCarbapenemGram-negative infectionsnosocomial infectionsβ-lactamasecefiderocol
Journal Article 2022-07-26 No Snippets Giamarellou H, Karaiskos I.
Show Full Abstract

Carbapenem resistance in Gram-negative bacteria has come into sight as a serious global threat. Carbapenem-resistant Gram-negative pathogens and their main representatives <i>Klebsiella pneumoniae</i>, <i>Acinetobacter baumannii</i>, and <i>Pseudomonas aeruginosa</i> are ranked in the highest priority category for new treatments. The worrisome phenomenon of the recent years is the presence of difficult-to-treat resistance (DTR) and pandrug-resistant (PDR) Gram-negative bacteria, characterized as non-susceptible to all conventional antimicrobial agents. DTR and PDR Gram-negative infections are linked with high mortality and associated with nosocomial infections, mainly in critically ill and ICU patients. Therapeutic options for infections caused by DTR and PDR Gram-negative organisms are extremely limited and are based on case reports and series. Herein, the current available knowledge regarding treatment of DTR and PDR infections is discussed. A focal point of the review focuses on salvage treatment, synergistic combinations (double and triple combinations), as well as increased exposure regimen adapted to the MIC of the pathogen. The most available data regarding novel antimicrobials, including novel β-lactam-β-lactamase inhibitor combinations, cefiderocol, and eravacycline as potential agents against DTR and PDR Gram-negative strains in critically ill patients are thoroughly presented.

Also flagged:RNA-Binding ProteinSTAU2Pancreatic adenocarcinomacancerRNA-binding proteinstumor
Journal Article 2022-07-26 ✓ 1 Snippet Wang X, Kuang W, Ding J, Li J, Ji M, Chen W, Shen H, Shi Z, Wang D, Wang L, Yang P.
In-Text Gene Mentions

…a paralog ofSTAU1, which mediates…

Show Full Abstract

Pancreatic adenocarcinoma (PAAD) is a highly aggressive cancer. RNA-binding proteins (RBPs) regulate highly dynamic post-transcriptional processes and perform very important biological functions. Although over 1900 RBPs have been identified, most are considered markers of tumor progression, and further information on their general role in PAAD is not known. Here, we report a bioinformatics analysis that identified five hub RBPs and produced a high-value prognostic model based on The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) datasets. Among these, the prognostic signature of the double-stranded RNA binding protein Staufen double-stranded RNA (<i>STAU2</i>) was identified. Firstly, we found that it is a highly expressed critical regulator of PAAD associated with poor clinical outcomes. Accordingly, the knockdown of <i>STAU2</i> led to a profound decrease in PAAD cell growth, migration, and invasion and induced apoptosis of PAAD cells. Furthermore, through multiple omics analyses, we identified the key target genes of <i>STAU2</i>: Palladin cytoskeletal associated protein (<i>PALLD</i>), Heterogeneous nuclear ribonucleoprotein U (<i>HNRNPU</i>), SERPINE1 mRNA Binding Protein 1 (<i>SERBP1</i>), and DEAD-box polypeptide 3, X-Linked (<i>DDX3X</i>). Finally, we found that a high expression level of <i>STAU2</i> not only helps PAAD evade the immune response but is also related to chemotherapy drug sensitivity, which implies that <i>STAU2</i> could serve as a potential target for combinatorial therapy. These findings uncovered a novel role for <i>STAU2</i> in PAAD aggression and resistance, suggesting that it probably represents a novel therapeutic and drug development target.

Also flagged:cholesterolomega-3 fatty acidsWatermyoglobinmitochondrialcarotenoids
Journal Article 2022-07-26 ✓ 2 Snippets Ahmed RO, Ali A, Al-Tobasei R, Leeds T, Kenney B, Salem M.
In-Text Gene Mentions

…Peroxiredoxin-6 (PRDX6), on chromosome…

…these genes (PRDX6and AP-1 )…

Show Full Abstract

The visual appearance of the fish fillet is a significant determinant of consumers' purchase decisions. Depending on the rainbow trout diet, a uniform bright white or reddish/pink fillet color is desirable. Factors affecting fillet color are complex, ranging from the ability of live fish to accumulate carotenoids in the muscle to preharvest environmental conditions, early postmortem muscle metabolism, and storage conditions. Identifying genetic markers of fillet color is a desirable goal but a challenging task for the aquaculture industry. This study used weighted, single-step GWAS to explore the genetic basis of fillet color variation in rainbow trout. We identified several SNP windows explaining up to 3.5%, 2.5%, and 1.6% of the additive genetic variance for fillet redness, yellowness, and whiteness, respectively. SNPs are located within genes implicated in carotenoid metabolism (β,β-carotene 15,15'-dioxygenase, retinol dehydrogenase) and myoglobin homeostasis (ATP synthase subunit β, mitochondrial (<i>ATP5F1B</i>)). These genes are involved in processes that influence muscle pigmentation and postmortem flesh coloration. Other identified genes are involved in the maintenance of muscle structural integrity (kelch protein 41b (<i>klh41b</i>), collagen α-1(XXVIII) chain (<i>COL28A1</i>), and cathepsin K (<i>CTSK</i>)) and protection against lipid oxidation (peroxiredoxin, superoxide dismutase 2 (<i>SOD2</i>), sestrin-1, Ubiquitin carboxyl-terminal hydrolase-10 (<i>USP10</i>)). A-to-G single-nucleotide polymorphism in β,β-carotene 15,15'-dioxygenase, and <i>USP10</i> result in isoleucine-to-valine and proline-to-leucine non-synonymous amino acid substitutions, respectively. Our observation confirms that fillet color is a complex trait regulated by many genes involved in carotenoid metabolism, myoglobin homeostasis, protection against lipid oxidation, and maintenance of muscle structural integrity. The significant SNPs identified in this study could be prioritized via genomic selection in breeding programs to improve fillet color in rainbow trout.

Also flagged:wound healingHydrogelssynthesiscell growthextracellularpolysaccharides
Journal Article 2022-07-26 No Snippets Sánchez-Cid P, Jiménez-Rosado M, Romero A, Pérez-Puyana V.
Show Full Abstract

Nowadays, there are still numerous challenges for well-known biomedical applications, such as tissue engineering (TE), wound healing and controlled drug delivery, which must be faced and solved. Hydrogels have been proposed as excellent candidates for these applications, as they have promising properties for the mentioned applications, including biocompatibility, biodegradability, great absorption capacity and tunable mechanical properties. However, depending on the material or the manufacturing method, the resulting hydrogel may not be up to the specific task for which it is designed, thus there are different approaches proposed to enhance hydrogel performance for the requirements of the application in question. The main purpose of this review article was to summarize the most recent trends of hydrogel technology, going through the most used polymeric materials and the most popular hydrogel synthesis methods in recent years, including different strategies of enhancing hydrogels' properties, such as cross-linking and the manufacture of composite hydrogels. In addition, the secondary objective of this review was to briefly discuss other novel applications of hydrogels that have been proposed in the past few years which have drawn a lot of attention.

Also flagged:thyroid-associated ophthalmopathyRASD1pathogenesisinterferon-γCell-cell communicationthyroid
Journal Article 2022-07-26 ✓ 5 Snippets Li Z, Wang M, Tan J, Zhu L, Zeng P, Chen X, Xie L, Duan R, Chen B, Tao T, Wang R, Wang X, Su W.
In-Text Gene Mentions

…/ ACKR1 andTNFSF4/ TNFRSF4 interactions…

…the interaction ofTNFSF4(OX40L) and TNFRSF4…

TNFSF4and TNFRSF4 work…

…47 , 48TNFSF4has been reported…

…major source ofTNFSF4and acting on…

Show Full Abstract

There is a specific reactivity and characteristic remodeling of the periocular tissue in thyroid-associated ophthalmopathy (TAO). However, local cell changes responsible for these pathological processes have not been sufficiently identified. Here, single-cell RNA sequencing is performed to characterize the transcriptional changes of cellular components in the orbital connective tissue in individuals with TAO. Our study shows that lipofibroblasts with RASD1 expression are highly involved in inflammation and adipogenesis during TAO. ACKR1<sup>+</sup> endothelial cells and adipose tissue macrophages may engage in TAO pathogenesis. We find CD8<sup>+</sup>CD57<sup>+</sup> cytotoxic T lymphocytes with the terminal differentiation phenotype to be another source of interferon-γ, a molecule actively engaging in TAO pathogenesis. Cell-cell communication analysis reveals increased activity of CXCL8/ACKR1 and TNFSF4/TNFRSF4 interactions in TAO. This study provides a comprehensive local cell landscape of TAO and may be valuable for future therapy investigation.

Also flagged:SLC6A4depressionanxietyserotonin transporterbehavioraltranslational
Journal Article 2022-07-26 ✓ 5 Snippets Popa N, Bachar D, Roberts AC, Santangelo AM, Gascon E.
In-Text Gene Mentions

Not only do we reveal such region-specific miRNA associations related to the SLC6A4 variants but we also identify Deleted in Colorectal Cancer (DCC),35 the cognate receptor of Netrin-1 and a gene previously implicated in affective disorders, as a downstream target of the differently expressed miRNA networks.

Accordingly, loss-of-function mutations in DCC result in severe neurodevelopmental disorders involving different degrees of disorganization of axonal tracts.65

These specific signatures resulted in a differential regulation of Deleted in Colon Carcinoma (DCC), a gene previously linked to multiple psychiatric diseases.

In addition, our finding that genetic variants in SLC6A4 are correlated with a differential expression of miRNAs and, ultimately, in DCC further supports the central position of DCC in the genetic networks of psychiatric disorders.

Our results show that: i) miRNAs are dramatically different across cell types and cortical regions; ii) SLC6A4 polymorphisms are correlated with miRNA signatures in area 32 of vmPFC; and iii) levels of specific miRNAs as well as of the target gene, DCC, correlate with anxiety-like behavior in response to uncertain threat in an intruder test.

Show Full Abstract

<h4>Background</h4>Psychiatric diseases such as depression and anxiety are multifactorial conditions, highly prevalent in western societies. Human studies have identified a number of high-risk genetic variants for these diseases. Among them, polymorphisms in the promoter region of the serotonin transporter gene (SLC6A4) have attracted much attention. However, due to the paucity of experimental models, molecular alterations induced by these genetic variants and how they correlate to behavioral deficits have not been examined. In this regard, marmosets have emerged as a powerful model in translational neuroscience to investigate molecular underpinnings of complex behaviors.<h4>Methods</h4>Here, we took advantage of naturally occurring genetic polymorphisms in marmoset SLC6A4 gene that have been linked to anxiety-like behaviors. Using FACS-sorting, we profiled microRNA contents in different brain regions of genotyped and behaviorally-phenotyped marmosets.<h4>Findings</h4>We revealed that marmosets bearing different SLC6A4 variants exhibit distinct microRNAs signatures in a region of the prefrontal cortex whose activity has been consistently altered in patients with depression/anxiety. We also identified Deleted in Colorectal Cancer (DCC), a gene previously linked to these diseases, as a downstream target of the differently expressed microRNAs. Significantly, we showed that levels of both microRNAs and DCC in this region were highly correlated to anxiety-like behaviors.<h4>Interpretation</h4>Our findings establish links between genetic variants, molecular modifications in specific cortical regions and complex behavioral responses, providing new insights into gene-behavior relationships underlying human psychopathology.<h4>Funding</h4>This work was supported by France National Agency, NRJ Foundation, Celphedia and Fondation de France as well as the Wellcome Trust.

Also flagged:synthesisindole-3-carboxylic acidtransport inhibitor response 1phytohormonesauxin receptor protein TIR1TIR1
Journal Article 2022-07-26 No Snippets Wang X, Luo MJ, Wang YX, Han WQ, Miu JX, Luo XP, Zhang AD, Kuang Y.
Show Full Abstract

Auxins as an important class of phytohormones play essential roles in plant life cycle; therefore, developing compounds with auxin-like properties for plant growth regulation and weed control applications is of great significance. Herein, we reported the design, synthesis, and herbicidal activity evaluation of a series of novel indole-3-carboxylic acid derivatives as auxin receptor protein TIR1 antagonists. Petri dish herbicidal activity assay demonstrated that most of the as-synthesized target compounds exhibited good-to-excellent inhibition effects (60-97% inhibitory rates) on roots and shoots of both dicotyledonous rape (<i>B. napus</i>) and monocotyledonous barnyard grass (<i>E. crus-galli</i>). The inhibition rates of compounds <b>10d</b> and <b>10h</b> reached up to 96% and 95% for the root of rape (<i>B. napus</i>) at 100 mg/L, and they also maintained 92% and 93% inhibition rates even if at 10 mg/L, respectively. Molecular docking revealed that the interactions between these synthesized target compounds and TIR1 protein include tight π-π stacking, hydrogen bond, and hydrophobic interactions. This work expands the range of auxin chemistry for the development of new auxin mimic herbicides.

Also flagged:thrombincoagulationprothrombinfibrinogenprothrombinasetissue factor
Journal Article 2022-07-26 ✓ 1 Snippet Carlo A, Yan Q, Ten Cate H, De Laat-Kremers R, De Laat B, Ninivaggi M.
In-Text Gene Mentions

…STA ® -StachromATIIIkit (reagent and…

Show Full Abstract

<h4>Background</h4>The haemostatic balance is an equilibrium of pro- and anticoagulant factors that work synergistically to prevent bleeding and thrombosis. As thrombin is the central enzyme in the coagulation pathway, it is desirable to measure thrombin generation (TG) in order to detect possible bleeding or thrombotic phenotypes, as well as to investigate the capacity of drugs affecting the formation of thrombin. By investigating the underlying processes of TG (i.e., prothrombin conversion and inactivation), additional information is collected about the dynamics of thrombin formation.<h4>Objectives</h4>To obtain reference values for thrombin dynamics (TD) analysis in 112 healthy donors using an automated system for TG.<h4>Methods</h4>TG was measured on the ST Genesia, fibrinogen on the Start, anti-thrombin (AT) on the STA R Max and α<sub>2</sub>Macroglobulin (α<sub>2</sub>M) with an in-house chromogenic assay.<h4>Results</h4>TG was measured using STG-BleedScreen, STG-ThromboScreen and STG-DrugScreen. The TG data was used as an input for TD analysis, in combination with plasma levels of AT, α<sub>2</sub>M and fibrinogen that were 113% (108-118%), 2.6 μM (2.2 μM-3.1 μM) and 2.9 g/L (2.6-3.2 g/L), respectively. The maximum rate of the prothrombinase complex (PCmax) and the total amount of prothrombin converted (PCtot) increased with increasing tissue factor (TF) concentration. PC<sub>tot</sub> increased from 902 to 988 nM, whereas PC<sub>max</sub> increased from 172 to 508 nM/min. Thrombin (T)-AT and T-α<sub>2</sub>M complexes also increased with increasing TF concentration (i.e., from 860 to 955 nM and from 28 to 33 nm, respectively). PC<sub>tot</sub>, T-AT and T-α<sub>2</sub>M complex formation were strongly inhibited by addition of thrombomodulin (-44%, -43%, and -48%, respectively), whereas PC<sub>max</sub> was affected less (-24%). PC<sub>tot</sub>, PC<sub>max</sub>, T-AT, and T-α<sub>2</sub>M were higher in women using oral contraceptives (OC) compared to men/women without OC, and inhibition by thrombomodulin was also significantly less in women on OC (<i>p</i> < 0.05).<h4>Conclusions</h4>TG measured on the ST Genesia can be used as an input for TD analysis. The data obtained can be used as reference values for future clinical studies as the balance between prothrombin conversion and thrombin inactivation has shown to be useful in several clinical settings.

Also flagged:Asthmaneutrophilic asthmacorticosteroidschromatinextracellularhistones
Journal Article 2022-07-26 ✓ 2 Snippets Kim JY, Stevens P, Karpurapu M, Lee H, Englert JA, Yan P, Lee TJ, Pabla N, Pietrzak M, Park GY, Christman JW, Chung S.
In-Text Gene Mentions

We evaluated the expression of genes associated with ETosis (48–52) including Atf3, Atf4, Bax, Ptgs2, Arg2, Il1b, Rps3, Prdx6, Jun, Cd74, C3, and Hmgb1 in leukocyte clusters of the SA model (Figure 6C).

…, Rps3 ,Prdx6, Jun ,…

Show Full Abstract

Asthma is phenotypically heterogeneous with several distinctive pathological mechanistic pathways. Previous studies indicate that neutrophilic asthma has a poor response to standard asthma treatments comprising inhaled corticosteroids. Therefore, it is important to identify critical factors that contribute to increased numbers of neutrophils in asthma patients whose symptoms are poorly controlled by conventional therapy. Leukocytes release chromatin fibers, referred to as extracellular traps (ETs) consisting of double-stranded (ds) DNA, histones, and granule contents. Excessive components of ETs contribute to the pathophysiology of asthma; however, it is unclear how ETs drive asthma phenotypes and whether they could be a potential therapeutic target. We employed a mouse model of severe asthma that recapitulates the intricate immune responses of neutrophilic and eosinophilic airway inflammation identified in patients with severe asthma. We used both a pharmacologic approach using miR-155 inhibitor-laden exosomes and genetic approaches using miR-155 knockout mice. Our data show that ETs are present in the bronchoalveolar lavage fluid of patients with mild asthma subjected to experimental subsegmental bronchoprovocation to an allergen and a severe asthma mouse model, which resembles the complex immune responses identified in severe human asthma. Furthermore, we show that miR-155 contributes to the extracellular release of dsDNA, which exacerbates allergic lung inflammation, and the inhibition of miR-155 results in therapeutic benefit in severe asthma mice. Our findings show that targeting dsDNA release represents an attractive therapeutic target for mitigating neutrophilic asthma phenotype, which is clinically refractory to standard care.

Also flagged:Gad2Hirschsprung diseaseaganglionosisEndothelin receptor type BEdnrbHirschsprung
Journal Article 2022-07-26 ✓ 1 Snippet Bhave S, Guyer RA, Picard N, Omer M, Hotta R, Goldstein AM.
In-Text Gene Mentions

…, Sox2 ,Sox6, and S100b…

Show Full Abstract

Hirschsprung disease is most often characterized by aganglionosis limited to the distal colon and rectum, and mice lacking the Endothelin receptor type B (Ednrb) faithfully recapitulate this phenotype. However, despite the presence of enteric ganglia in the small intestine, both human patients and Ednrb-/- mice suffer from dysmotility and altered gastrointestinal function, thus raising the possibility of enteric nervous system (ENS) abnormalities proximal to the aganglionic region. We undertook the present study to determine whether abnormalities with the ENS in ganglionated regions may account for abnormal gastrointestinal function. We performed single-cell RNA sequencing on ENS cells from the small intestine of Ednrb-/- mice and compared the results to a published single-cell dataset. Our results identified a missing population of neurons marked by the enzyme Gad2, which catalyzes the production of <i>γ</i>-Aminobutyric acid (GABA), in the small intestine of Ednrb-/- animals. This result was confirmed by immunostaining enteric ganglia from Ednrb-/- mice and their wild-type littermates. These data show for the first time that ganglionated regions of the Hirschsprung gut lack a neuronal subpopulation, which may explain the persistent gastrointestinal dysfunction after surgical correction of Hirschsprung disease.

Also flagged:MalignantPeritoneal MesotheliomaMesotheliomaneoplasmcirrhosismalignant peritoneal mesothelioma
Journal Article 2022-07-26 ✓ 1 Snippet Kerosky ZP, Powell CR, Lindholm PC.
In-Text Gene Mentions

…for Wilson’s disease,hemochromatosis, hepatitis A, B,…

Show Full Abstract

Mesothelioma is a difficult-to-detect neoplasm that rarely develops in the peritoneum. In patients with unexplained ascites, pleural fluid analysis and ultrasonography is often the first step to achieving a diagnosis. This case report shares a unique presentation in which a patient who presented with unexplained ascites, was initially thought to have cirrhosis but was later found to have malignant peritoneal mesothelioma after cross-sectional imaging and tissue acquisition. This case illustrates the importance of a high clinical index of suspicion for mesothelioma given its variety of clinical presentations, as well as the utility of early cross-sectional imaging in such cases.

Also flagged:postpartum depressiondepressionpsychiatric diseasesmajor depressiongeneralized anxietyattention deficit disorder
Journal Article 2022-07-25 No Snippets Rasmussen MH, Poulsen GJ, Wohlfahrt J, Videbech P, Melbye M.
Show Full Abstract

<h4>Objective</h4>Many psychiatric diseases have a strong familial aggregation, but it is unknown whether postpartum depression (PPD) without prior psychiatric history aggregates in families.<h4>Methods</h4>Based on Danish national registers, we constructed a cohort with information on 848,544 singleton deliveries (1996-2017). Women with an episode of PPD were defined as having used antidepressant medication and/or had a hospital contact for depression within 6 months after delivery. Those with psychiatric history prior to the delivery were excluded. We estimated relative risk (RR) of PPD, comparing women with female relatives with and without PPD history, respectively.<h4>Results</h4>Overall, women with a PPD history in female blood relatives had themselves a higher risk of PPD (RR = 1.64, 95% CI 1.16-2.34). Having the first-degree female relative with PPD history was associated with a more than 2.5 times (RR = 2.65, 95% CI 1.79-3.91) increased risk of PPD. However, having the second/third-degree female relative and/or a female non-blood relative with PPD history did not increase the woman's own risk of PPD (RR = 0.58, 95% CI 0.26-1.28, RR = 1.09, 95% CI 0.83-1.44).<h4>Conclusion</h4>Postpartum depression aggregates in families with no other psychiatric history, but the findings do not support a strong genetic trait as a major cause. Other possible mechanisms are shared environment and/or health-seeking behavior in close relationships.

Also flagged:TFEBTFE3neurodegenerative diseasesmacroautophagyautophagylysosome
Journal Article 2022-07-25 ✓ 5 Snippets Carling PJ, Ryan BJ, McGuinness W, Kataria S, Humble SW, Milde S, Duce JA, Kapadia N, Zuercher WJ, Davis JB, Di Daniel E, Wade-Martins R.
In-Text Gene Mentions

The more potent analogs induced subsequent upregulation of the CLEAR gene network and cleared pathological HTT protein in a cellular model of proteinopathy, demonstrating their potential to alleviate neurodegeneration-relevant phenotypes.Abbreviations: AD: Alzheimer disease; AK: adenylate kinase; CLEAR: coordinated lysosomal expression and regulation; CQ: chloroquine; HD: Huntington disease; PD: Parkinson disease; PKIS2: Published Kinase Inhibitor Set 2; PRKD: protein kinase D; TFEB: transcription factor EB.

Overexpression of PPARGC1A/PGC-1α and activation of TFEB expression, or direct TFEB overexpression and subsequent upregulation of the CLEAR gene network eliminated HTT protein aggregates and reduced neurotoxicity in HD transgenic mice and cell models [34].

…and cleared pathologicalHTTprotein in a…

…expression and reduceHTTprotein…

…gene network eliminatedHTTprotein aggregates and…

Show Full Abstract

The accumulation of toxic protein aggregates in multiple neurodegenerative diseases is associated with defects in the macroautophagy/autophagy-lysosome pathway. The amelioration of disease phenotypes across multiple models of neurodegeneration can be achieved through modulating the master regulator of lysosome function, TFEB (transcription factor EB). Using a novel multi-parameter high-throughput screen for cytoplasmic:nuclear translocation of endogenous TFEB and the related transcription factor TFE3, we screened the Published Kinase Inhibitor Set 2 (PKIS2) library as proof of principle and to identify kinase regulators of TFEB and TFE3. Given that TFEB and TFE3 are responsive to cellular stress we have established assays for cellular toxicity and lysosomal function, critical to ensuring the identification of hit compounds with only positive effects on lysosome activity. In addition to AKT inhibitors which regulate TFEB localization, we identified a series of quinazoline-derivative compounds that induced TFEB and TFE3 translocation. A novel series of structurally-related analogs was developed, and several compounds induced TFEB and TFE3 translocation at higher potency than previously screened compounds. KINOME<i>scan</i> and cell-based KiNativ kinase profiling revealed high binding for the PRKD (protein kinase D) family of kinases, suggesting good selectivity for these compounds. We describe and utilize a cellular target-validation platform using CRISPRi knockdown and orthogonal PRKD inhibitors to demonstrate that the activity of these compounds is independent of PRKD inhibition. The more potent analogs induced subsequent upregulation of the CLEAR gene network and cleared pathological HTT protein in a cellular model of proteinopathy, demonstrating their potential to alleviate neurodegeneration-relevant phenotypes. <b>Abbreviations:</b> AD: Alzheimer disease; AK: adenylate kinase; CLEAR: coordinated lysosomal expression and regulation; CQ: chloroquine; HD: Huntington disease; PD: Parkinson disease; PKIS2: Published Kinase Inhibitor Set 2; PRKD: protein kinase D; TFEB: transcription factor EB.

Also flagged:Lung adenocarcinomaLUADlung cancertumordeathPI3K
Journal Article 2022-07-25 No Snippets Zeng Y, Pan Y, Zhang B, Luo Y, Tian J, Wang Y, Ju X, Wu J, Li Y.
Show Full Abstract

BACKGROUND Lung adenocarcinoma (LUAD) is the most common type of lung cancer, which poses a serious threat to human life and health. -(-)Guaiol, an effective ingredient of many medicinal herbs, has been shown to have a high potential for tumor interference and suppression. However, knowledge of pharmacological mechanisms is still lacking adequate identification or interpretation. MATERIAL AND METHODS The genes of LUAD patients collected from TCGA were analyzed using limma and WGCNA. In addition, targets of (-)-Guaiol treating LUAD were selected through a prediction network. Venn analysis was then used to visualize the overlapping genes, which were further condensed using the PPI network. GO and KEGG analyses were performed sequentially, and the essential targets were evaluated and validated using molecular docking. In addition, cell-based verification, including the CCK-8 assay, cell death assessment, apoptosis analysis, and western blot, was performed to determine the mechanism of action of (-)-Guaiol. RESULTS The genes included 959 differentially-expressed genes, 6075 highly-correlated genes, and 480 drug-target genes. Through multivariate analysis, 23 hub genes were identified and functional enrichment analyses revealed that the PI3K/Akt signaling pathway was the most significant. Experiment results showed that -(-)Guaiol can inhibit LUAD cell growth and induce apoptosis. Additional evidence suggested that the PI3K/Akt signaling pathway established an inseparable role in the antitumor processes of -(-)Guaiol, which is consistent with network pharmacology results. CONCLUSIONS Our results show that the effect of (-)-Guaiol in LUAD treatment involves the PI3K/Akt signaling pathway, providing a useful reference and medicinal value in the treatment of LUAD.

Also flagged:JAK1Gene Expressionmemory impairmentsbehavioralcognitive problemscognition
Journal Article 2022-07-25 ✓ 2 Snippets Singh G, Singh V, Kim T, Ertel A, Fu W, Schneider JS.
In-Text Gene Mentions

Further analysis (Fig. 5C–E) revealed skipped exon events for a number of genes associated with various neuronal functions, including Rho GTPase Activating Protein 17(Arhgap17 or Nadrin), a GTPase-activating protein regulates calcium dependent exocytosis in nerve endings48, Doublecortin-like kinase 1(Dclk1), which plays important roles in neurogenesis and neural plasticity49, Calcium Voltage-Gated Channel Subunit Alpha1E (Cacna1e), involved in neurotransmitter release50,51, and Netrin G1 (Ntng1), a cell adhesion molecule involved in regulating fear and anxiety behaviors52.

…Channel Subunit Alpha1E (Cacna1e) , involved in…

Show Full Abstract

Early life lead (Pb) exposure is detrimental to neurobehavioral development. The quality of the environment can modify negative influences from Pb exposure, impacting the developmental trajectory following Pb exposure. Little is known about the molecular underpinnings in the brain of the interaction between Pb and the quality of the environment. We examined relationships between early life Pb exposure and living in an enriched versus a non-enriched postnatal environment on genome-wide transcription profiles in hippocampus CA1. RNA-seq identified differences in the transcriptome of enriched vs. non-enriched Pb-exposed animals. Most of the gene expression changes associated with Pb exposure were reversed by enrichment. This was also true for changes in upstream regulators, splicing events and long noncoding RNAs. Non-enriched rats also had memory impairments; enriched rats had no deficits. The results demonstrate that an enriched environment has a profound impact on behavior and the Pb-modified CA1 transcriptome. These findings show the potential for interactions between Pb exposure and the environment to result in significant transcriptional changes in the brain and, to the extent that this may occur in Pb-exposed children, could influence neuropsychological/educational outcomes, underscoring the importance for early intervention and environmental enrichment for Pb-exposed children.

Also flagged:-2 infectioninterferoncell proliferationdeathNF-κBjunctional
Journal Article 2022-07-25 ✓ 1 Snippet Biering SB, Sarnik SA, Wang E, Zengel JR, Leist SR, Schäfer A, Sathyan V, Hawkins P, Okuda K, Tau C, Jangid AR, Duffy CV, Wei J, Gilmore RC, Alfajaro MM, Strine MS, Wrynla XH, Van Dis E, Catamura C, Yamashiro LH, Belk JA, Begeman A, Stark JC, Shon DJ, Fox DM, Ezzatpour S, Huang E, Olegario N, Rustagi A, Volmer AS, Livraghi-Butrico A, Wehri E, Behringer RR, Cheon DJ, Schaletzky J, Aguilar HC, Puschnik AS, Button B, Pinsky BA, Blish CA, Baric RS, O'Neal WK, Bertozzi CR, Wilen CB, Boucher RC, Carette JE, Stanley SA, Harris E, Konermann S, Hsu PD.
In-Text Gene Mentions

…ondrion-localized dsRNA-sensorZNFX1(Fig. 1d )…

Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) causes a range of symptoms in infected individuals, from mild respiratory illness to acute respiratory distress syndrome. A systematic understanding of host factors influencing viral infection is critical to elucidate SARS-CoV-2-host interactions and the progression of Coronavirus disease 2019 (COVID-19). Here, we conducted genome-wide CRISPR knockout and activation screens in human lung epithelial cells with endogenous expression of the SARS-CoV-2 entry factors ACE2 and TMPRSS2. We uncovered proviral and antiviral factors across highly interconnected host pathways, including clathrin transport, inflammatory signaling, cell-cycle regulation, and transcriptional and epigenetic regulation. We further identified mucins, a family of high molecular weight glycoproteins, as a prominent viral restriction network that inhibits SARS-CoV-2 infection in vitro and in murine models. These mucins also inhibit infection of diverse respiratory viruses. This functional landscape of SARS-CoV-2 host factors provides a physiologically relevant starting point for new host-directed therapeutics and highlights airway mucins as a host defense mechanism.

Also flagged:Lung cancercancerdeathNon-small cell lung cancerNSCLCLUAD
Journal Article 2022-07-25 ✓ 5 Snippets Lin G, Lin L, Lin H, Xu Y, Chen W, Liu Y, Wu J, Chen S, Lin Q, Zeng Y, Xu Y.
In-Text Gene Mentions

Further RT-qPCR analysis also demonstrated that IL-5, IL-1A, CXCL10, TNFSF4 and INHBE were significantly changed in LUAD cells after C1QTNF6 knockdown or overexpression, which suggested the importance of the cytokine-cytokine receptor interaction pathway in the process of C1QTNF6 regulating tumor progression.

Our results demonstrated that the mRNA expressions of IL-5, IL-1A, CXCL10, TNFSF4 and INHBE were significantly altered when regulating C1QTNF6 (Fig. 6E), which suggested the essential implications of the cytokine-cytokine receptor interaction pathway in the process of C1QTNF6 regulating tumor progression.

…IL-1A, CXCL10, IL-5,TNFSF4, INHBE and TGFBR1…

…IL-1A, CXCL10, IL-5,TNFSF4and INHBE were…

…IL-5, IL-1A, CXCL10,TNFSF4and INHBE were…

Show Full Abstract

<h4>Objective</h4>C1QTNF6 has been implicated as an essential component in multiple cellular and molecular preliminary event, including inflammation, glucose metabolism, endothelial cell modulation and carcinogenesis. However, the biological process and potential mechanism of C1QTNF6 in lung adenocarcinoma (LUAD) are indefinite and remain to be elucidated. Therefore, we investigated the interaction among the traits of C1QTNF6 and LUAD pathologic process.<h4>Methods</h4>RT-qPCR and western blot were conducted to determine the expression levels of C1QTNF6. RNA interference and overexpression of C1QTNF6 were constructed to identify the biological function of C1QTNF6 in cellular proliferative, migratory and invasive potentials in vitro. Dual-luciferase reporter assay was applied to identify the possible interaction between C1QTNF6 and miR-29a-3p. Moreover, RNA sequencing analysis of C1QTNF6 knockdown was performed to identify the potential regulatory pathways.<h4>Results</h4>C1QTNF6 was upregulated in stage I LUAD tissues compared with adjacent non-cancerous tissues. Concurrently, C1QTNF6 knockdown could remarkably inhibit cell proliferation, migratory and invasive abilities, while overexpression of C1QTNF6 presented opposite results. Additionally, miR-29a-3p may serve as an upstream regulator of C1QTNF6 and reduce the expression of C1QTNF6. Subsequent experiments showed that miR-29a-3p could decrease the cell mobility and proliferation positive cell rates, as well as reduce the migratory and invasive possibilities in LUAD cells via downregulating C1QTNF6. Moreover, RNA sequencing analysis demonstrated that the cytokine-cytokine receptor interaction pathway may participate in the process of C1QTNF6 regulating tumor progression.<h4>Conclusion</h4>Our study first demonstrated that downregulation of C1QTNF6 could inhibit tumorigenesis and progression in LUAD cells negatively regulated by miR-29a-3p. These consequences could reinforce our awareness and understanding of the underlying mechanism and provide a promising therapeutic target for LUAD.

Also flagged:Gene expressionADCY3Rap1RasADH1BDOCK9
Journal Article 2022-07-25 No Snippets Wu J, Wang M, Han L, Zhang H, Lei S, Zhang Y, Mo X.
Show Full Abstract

<h4>Background</h4>Genome-wide association studies (GWASs) have identified hundreds of loci for body mass index (BMI), but functional variants in these loci are less known. The purpose of this study was to identify RNA modification-related SNPs (RNAm-SNPs) for BMI in GWAS loci. BMI-associated RNAm-SNPs were identified in a GWAS of approximately 700,000 individuals. Gene expression and circulating protein levels affected by the RNAm-SNPs were identified by QTL analyses. Mendelian randomization (MR) methods were applied to test whether the gene expression and protein levels were associated with BMI.<h4>Results</h4>A total of 78 RNAm-SNPs associated with BMI (P < 5.0 × 10<sup>-8</sup>) were identified, including 65 m<sup>6</sup>A-, 10 m<sup>1</sup>A-, 3 m<sup>7</sup>G- and 1 A-to-I-related SNPs. Two functional loss, high confidence level m<sup>6</sup>A-SNPs, rs6713978 (P = 6.4 × 10<sup>-60</sup>) and rs13410999 (P = 8.2 × 10<sup>-59</sup>), in the intron of ADCY3 were the top significant SNPs. These two RNAm-SNPs were associated with ADCY3 gene expression in adipose tissues, whole blood cells, the tibial nerve, the tibial artery and lymphocytes, and the expression levels in these tissues were associated with BMI. Proteins enriched in specific KEGG pathways, such as natural killer cell-mediated cytotoxicity, the Rap1 signaling pathway and the Ras signaling pathway, were affected by the RNAm-SNPs, and circulating levels of some of these proteins (ADH1B, DOCK9, MICB, PRDM1, STOM, TMPRSS11D and TXNDC12) were associated with BMI in MR analyses.<h4>Conclusions</h4>Our study identified RNAm-SNPs in BMI-related genomic loci and suggested that RNA modification may affect BMI by affecting the expression levels of corresponding genes and proteins.

Also flagged:Gene ExpressionBladder CancerTumortoANGAPOE
Journal Article 2022-07-25 ✓ 2 Snippets Chen R, Pagano I, Sun Y, Murakami K, Goodison S, Vairavan R, Tahsin M, Black PC, Rosser CJ, Furuya H.
In-Text Gene Mentions

Chung et al. selected 10 candidate hypermethylated genes from data collected from tumor tissue and monitored these in voided urine samples by quantitative, methylation-specific RT-PCR and identified a multigene predictive model comprised of five target genes (MYO3A, CA10, NKX6-2, DBC1 and SOX11) [29].

…target genes (MYO3A,CA10, NKX6-2, DBC1 and…

Show Full Abstract

Bladder cancer is a biologically heterogeneous disease with variable clinical presentations, outcomes and responses to therapy. Thus, the clinical utility of single biomarkers for the detection and prediction of biological behavior of bladder cancer is limited. We have previously identified and validated a bladder cancer diagnostic signature composed of 10 biomarkers, which has been incorporated into a multiplex immunoassay bladder cancer test, Oncuria™. In this study, we evaluate whether these 10 biomarkers can assist in the prediction of bladder cancer clinical outcomes. Tumor gene expression and patient survival data from bladder cancer cases from The Cancer Genome Atlas (TCGA) were analyzed. Alignment between the mRNA expression of 10 biomarkers and the TCGA 2017 subtype classification was assessed. Kaplan-Meier analysis of multiple gene expression datasets indicated that high expression of the combined 10 biomarkers correlated with a significant reduction in overall survival. The analysis of three independent, publicly available gene expression datasets confirmed that multiplex prognostic models outperformed single biomarkers. In total, 8 of the 10 biomarkers from the Oncuria™ test were significantly associated with either luminal or basal molecular subtypes, and thus, the test has the potential to assist in the prediction of clinical outcome.

Also flagged:metabolismsecretionmalnutritioncancerscardiovascular diseasesneurodegenerative diseases
Journal Article 2022-07-25 No Snippets Hitachi K, Honda M, Tsuchida K.
Show Full Abstract

Skeletal muscle is a pivotal organ in humans that maintains locomotion and homeostasis. Muscle atrophy caused by sarcopenia and cachexia, which results in reduced muscle mass and impaired skeletal muscle function, is a serious health condition that decreases life longevity in humans. Recent studies have revealed the molecular mechanisms by which long non-coding RNAs (lncRNAs) regulate skeletal muscle mass and function through transcriptional regulation, fiber-type switching, and skeletal muscle cell proliferation. In addition, lncRNAs function as natural inhibitors of microRNAs and induce muscle hypertrophy or atrophy. Intriguingly, muscle atrophy modifies the expression of thousands of lncRNAs. Therefore, although their exact functions have not yet been fully elucidated, various novel lncRNAs associated with muscle atrophy have been identified. Here, we comprehensively review recent knowledge on the regulatory roles of lncRNAs in skeletal muscle atrophy. In addition, we discuss the issues and possibilities of targeting lncRNAs as a treatment for skeletal muscle atrophy and muscle wasting disorders in humans.

Also flagged:ExtracellularNLRP3sepsishistonespyroptosisdeath
Journal Article 2022-07-25 ✓ 2 Snippets Beltrán-García J, Osca-Verdegal R, Pérez-Cremades D, Novella S, Hermenegildo C, Pallardó FV, García-Giménez JL.
In-Text Gene Mentions

…form of Peroxiredoxin-6 (Prdx6) in HUVEC (…

…hyperoxidized form ofPrdx6.…

Show Full Abstract

<h4>Introduction</h4>Circulating extracellular histones acquire relevance as cytotoxic mediators in sepsis. Extracellular histones act as damage-associated molecular patterns (DAMPs), which induce oxidative stress and NLRP3 inflammasome activation. Inflammasome mediates pyroptosis, a programmed cell death mechanism that produces inflammation. Despite evidence for inflammasome activation in immune cells during sepsis, it was unknown whether extracellular histones can produce endothelial inflammasomes activation.<h4>Methods</h4>We used human umbilical vein endothelial cells (HUVEC) to explore the activation of pyroptosis, endothelial function and inflammation by extracellular histones. We evaluated pyroptosis by flow cytometry, caspase-1 activity assay, and gene and protein expression analysis by RT-qPCR and Western blot, respectively. The upstream molecular responses involved in pyroptosis activation by extracellular histones were validated by means of using antioxidant glutathione ethyl ester and NLRP3 inflammasome inhibitors. Finally, using mass spectrometry, we measured circulating histones in blood from critically-ill patients and demonstrated that circulating histone levels correlated with the expression of pyroptosis-related cytokines, the release of endothelial adhesion factors and septic shock severity.<h4>Results</h4>We found that extracellular histones mediate the activation of NLRP3 inflammasome and pyroptosis in endothelial cells by contributing to endothelial dysfunction and the dysregulation of the immune response mediated by endothelium. Likewise, we demonstrated how the hyperacetylation of extracellular histones or the use of antioxidants decreased pyroptosis. In addition, we showed that pyroptosis is a feasible process occurring in septic shock patients.<h4>Discussion</h4>Circulating histone levels correlated with the expression of pro-inflammatory and pyroptosis-related cytokines, the release of endothelial adhesion factors and septic shock severity. We propose to block histone-mediated pyroptosis as a feasible therapeutic strategy in sepsis.

Also flagged:VaspinLeptinAdiponectinhepatosteatosisadipokinetriglyceride
Journal Article 2022-07-25 ✓ 1 Snippet Özkan EA, Sadigov A, Öztürk O.
In-Text Gene Mentions

…with viral hepatitis,hemochromatosis, Wilson disease, autoimmune…

Show Full Abstract

To investigate adipokines (vaspin, omentin-1, adiponectin and leptin) and their correlation with hepatosteatosis degree in obese/overweight (O/O) children. We analyzed adipokine levels of 81 children (49 O/O, [body mass index (BMI) > 95<sup>th</sup>] and 32 non-obese (BMI = 5-85<sup>th</sup>) admitted to the pediatric outpatient clinic. Serum triglyceride, glucose, low density lipoprotein-cholesterol, total cholesterol, high density lipoprotein-cholesterol, alanine aminotransferase, aspartate aminotransferase (AST), insulin, HbA1c levels and leptin, omentin-1, vaspin, adiponectin levels were studied. O/O children with hepatosteatosis were divided into grades 1, 2 and 3 according to the degree of hepatosteatosis determined by ultrasonography. While AST (p = 0.001), triglyceride (p = 0.006), BMI percentile (p = 0.000), HOMA index (p = 0.002), systolic blood pressure (p = 0.02), leptin (p = 0.001), omentin-1 (p = 0.001), adiponectin (p = 0.001) levels were higher, vaspin level was lower (p = 0.008) in the (O/O) group compared to the controls. There was a positive correlation between HDL and vaspin, and a negative correlation between HDL and omentin-1 in the O/O group. Also it was observed that as the degree of hepatosteotosis increased, leptin (p = 0.004), omentin-1 (p = 0.001) levels were increased. There was no significant change in vaspin level (p = 0.128). The high levels of omentin-1, leptin and adiponectin have an association with the development of hepatosteatosis in O/O children.

Also flagged:Necroptosisliver cancercancerstumorTP53Hepatocellular Carcinoma
Journal Article 2022-07-25 ✓ 1 Snippet Ren H, Zheng J, Cheng Q, Yang X, Fu Q.
In-Text Gene Mentions

…, TNFSF18 ,TNFSF4, VTCN1 ,…

Show Full Abstract

<b>Background:</b> Hepatocellular carcinoma (HCC) is a common type of primary liver cancer and has a poor prognosis. In recent times, necroptosis has been reported to be involved in the progression of multiple cancers. However, the role of necroptosis in HCC prognosis remains elusive. <b>Methods:</b> The RNA-seq data and clinical information of HCC patients were downloaded from The Cancer Genome Atlas (TCGA) and International Cancer Genome Consortium (ICGC) databases. Differentially expressed genes (DEGs) and prognosis-related genes were explored, and the nonnegative matrix factorization (NMF) clustering algorithm was applied to divide HCC patients into different subtypes. Based on the prognosis-related DEGs, univariate Cox and LASSO Cox regression analyses were used to construct a necroptosis-related prognostic model. The relationship between the prognostic model and immune cell infiltration, tumor mutational burden (TMB), and drug response were explored. <b>Results:</b> In this study, 13 prognosis-related DEGs were confirmed from 18 DEGs and 24 prognostic-related genes. Based on the prognosis-related DEGs, patients in the TCGA cohort were clustered into three subtypes by the NMF algorithm, and patients in C3 had better survival. A necroptosis-related prognostic model was established according to LASSO analysis, and HCC patients in TCGA and ICGC were divided into high- and low-risk groups. Kaplan-Meier (K-M) survival analysis revealed that patients in the high-risk group had a shorter survival time compared to those in the low-risk group. Using univariate and multivariate Cox analyses, the prognostic model was identified as an independent prognostic factor and had better survival predictive ability in HCC patients compared with other clinical biomarkers. Furthermore, the results revealed that the high-risk patients had higher stromal, immune, and ESTIMATE scores; higher TP53 mutation rate; higher TMB; and lower tumor purities compared to those in the low-risk group. In addition, there were significant differences in predicting the drug response between the high- and low-risk groups. The protein and mRNA levels of these prognostic genes were upregulated in HCC tissues compared to normal liver tissues. <b>Conclusion:</b> We established a necroptosis-related prognostic signature that may provide guidance for individualized drug therapy in HCC patients; however, further experimentation is needed to validate our results.

Also flagged:DyslipidemiaType 2 diabetestype 2 diabetes mellituspolymerasecell proliferationdevelopment
Journal Article 2022-07-25 ✓ 5 Snippets Bao T, Wang S, Yang Y, He L, Han L, Zhai T, Chen J, Zhou Q, Zhao X, Lian F, Zhao L, Tong X.
In-Text Gene Mentions

Based on the comparison between the two groups, it can be speculated that XLOC-005590 reversely regulates the expression of ECI2, thereby affecting glucose and lipid metabolism.

The results of gene chip sequencing showed that the expression of XLOC-005590 and HNF1A-AS1 was upregulated in obese T2DM patients with dyslipidemia compared with that in healthy volunteers, and the downstream ECI2 expression was significantly downregulated.

…the downstream gene (ECI2) was downregulated in…

…was downregulated andECI2was upregulated compared…

…HNF1A-AS1, and mRNA:ECI2were selected for…

Show Full Abstract

<h4>Objective</h4>To use systems biology to explore the biomolecular network mechanism of the Jiangtang Tiaozhi Recipe (JTTZR) in the intervention of obese Type 2 diabetes (T2DM) patients with dyslipidemia.<h4>Methods</h4>Twelve patients with obese type 2 diabetes mellitus and dyslipidemia (traditional Chinese medicine syndrome differentiation was excess heat syndrome of the stomach and intestines) were treated with JTTZR for 24 weeks, and 12 patients were included in the healthy control group. First, blood samples from 6 patients in each group (disease group before treatment, disease group after treatment, and healthy control group) were collected for RNA microarray analysis. Quantitative polymerase chain reaction (qPCR) was used to validate these target lncRNAs and mRNAs. Finally, a detailed analysis of the differences in the disease group before treatment vs. the healthy control group and the disease group after treatment vs. the disease group before treatment was undertaken. In addition, we focused on disease-related pathways and analyzed the correlation between the differential expression of target lncRNAs and clinical indicators.<h4>Results</h4>(1) Disease group before treatment vs. healthy control group: There were 557 up-regulated lncRNAs, 273 down-regulated lncRNAs, 491 up-regulated mRNAs, and 1639 down-regulated mRNAs. GO analysis and pathway analysis showed that T2DM may be related to cell proliferation in the forebrain, post-embryonic organ development, calcium signaling pathway. qPCR validation showed that the expression of XLOC-005590 and HNF1A-AS1 as target lncRNAs increased, and this was verified by gene chip analysis. (2) Disease group after treatment vs. disease group before treatment: 128 lncRNAs were upregulated, 32 lncRNAs were downregulated, 45 mRNAs were upregulated, and 140 mRNAs were downregulated. GO analysis and pathway analysis showed that JTTZR may treat T2DM through endosome transport, the insulin signaling pathway, and glycine, serine, and threonine metabolism. qPCR validation showed that in the healthy control group, XLOC_005590 was upregulated, whereas the downstream gene (ECI2) was downregulated in the disease group before treatment. However, after 24 weeks of intervention with JTTZR, XLOC_005590 was downregulated and ECI2 was upregulated compared with the disease group before treatment (0 weeks) (<i>P <</i>0.05).<h4>Conclusion</h4>JTTZR may interfere in patients with obese T2DM with dyslipidemia by regulating pathways such as fatty acid degradation, glycolysis/gluconeogenesis, and pyruvate metabolism.

Also flagged:Cancersadaptivecancergene expressiondeathgenetic disease
Journal Article 2022-07-25 ✓ 1 Snippet Uthamacumaran A, Zenil H.
In-Text Gene Mentions

For instance, we can identify the negative feedback loops regulating the Suvà glioma stemness network (POU3F2, SOX2, SALL2, and OLIG2) and experimentally quantify their oscillations using time-lapse fluorescent-imaging within GBM-derived cancer stem cells to understand their cell fate dynamics and reprogrammability (71).

Show Full Abstract

Cancers are complex adaptive diseases regulated by the nonlinear feedback systems between genetic instabilities, environmental signals, cellular protein flows, and gene regulatory networks. Understanding the cybernetics of cancer requires the integration of information dynamics across multidimensional spatiotemporal scales, including genetic, transcriptional, metabolic, proteomic, epigenetic, and multi-cellular networks. However, the time-series analysis of these complex networks remains vastly absent in cancer research. With longitudinal screening and time-series analysis of cellular dynamics, universally observed causal patterns pertaining to dynamical systems, may self-organize in the signaling or gene expression state-space of cancer triggering processes. A class of these patterns, strange attractors, may be mathematical biomarkers of cancer progression. The emergence of intracellular chaos and chaotic cell population dynamics remains a new paradigm in systems medicine. As such, chaotic and complex dynamics are discussed as mathematical hallmarks of cancer cell fate dynamics herein. Given the assumption that time-resolved single-cell datasets are made available, a survey of interdisciplinary tools and algorithms from complexity theory, are hereby reviewed to investigate critical phenomena and chaotic dynamics in cancer ecosystems. To conclude, the perspective cultivates an intuition for computational systems oncology in terms of nonlinear dynamics, information theory, inverse problems, and complexity. We highlight the limitations we see in the area of statistical machine learning but the opportunity at combining it with the symbolic computational power offered by the mathematical tools explored.

Also flagged:RNA polymerase IIIPol IIIpolymerasetoviral infectionsinterferon
Journal Article 2022-07-25 ✓ 2 Snippets Doratt BM, Vance E, Malherbe DC, Ebbert MTW, Messaoudi I.
In-Text Gene Mentions

…receptor activity) andDCC(nervous system) were…

…system ( VSTM2L,NEGR1, PCDH1, NFASC ).…

Show Full Abstract

Ancestral RNA polymerase III (Pol III) is a multi-subunit polymerase responsible for transcription of short non-coding RNA, such as double-stranded short interspersed nuclear elements (SINEs). Although SINE ncRNAs are generally transcriptionally repressed, they can be induced in response to viral infections and can stimulate immune signaling pathways. Indeed, mutations in RNA Pol III have been associated with poor antiviral interferon response following infection with varicella zoster virus (VZV). In this study, we probed the role of Pol III transcripts in the detection and initial immune response to VZV by characterizing the transcriptional response following VZV infection of wild type A549 lung epithelial cells as well as A549 cells lacking specific RNA sensors MAVS and TLR3, or interferon-stimulated genes RNase L and PKR in presence or absence of functional RNA Pol III. Multiple components of the antiviral sensing and interferon signaling pathways were involved in restricting VZV replication in lung epithelial cells thus suggesting an innate defense system with built-in redundancy. In addition, RNA Pol III silencing altered the antiviral transcriptional program indicating that it plays an essential role in the sensing of VZV infection.

Also flagged:genetic disordersgeneticcomplexgenetic diseaseHNF1AHNF4A
Journal Article 2022-07-25 No Snippets Kingdom R, Wright CF.
Show Full Abstract

The same genetic variant found in different individuals can cause a range of diverse phenotypes, from no discernible clinical phenotype to severe disease, even among related individuals. Such variants can be said to display incomplete penetrance, a binary phenomenon where the genotype either causes the expected clinical phenotype or it does not, or they can be said to display variable expressivity, in which the same genotype can cause a wide range of clinical symptoms across a spectrum. Both incomplete penetrance and variable expressivity are thought to be caused by a range of factors, including common variants, variants in regulatory regions, epigenetics, environmental factors, and lifestyle. Many thousands of genetic variants have been identified as the cause of monogenic disorders, mostly determined through small clinical studies, and thus, the penetrance and expressivity of these variants may be overestimated when compared to their effect on the general population. With the wealth of population cohort data currently available, the penetrance and expressivity of such genetic variants can be investigated across a much wider contingent, potentially helping to reclassify variants that were previously thought to be completely penetrant. Research into the penetrance and expressivity of such genetic variants is important for clinical classification, both for determining causative mechanisms of disease in the affected population and for providing accurate risk information through genetic counseling. A genotype-based definition of the causes of rare diseases incorporating information from population cohorts and clinical studies is critical for our understanding of incomplete penetrance and variable expressivity. This review examines our current knowledge of the penetrance and expressivity of genetic variants in rare disease and across populations, as well as looking into the potential causes of the variation seen, including genetic modifiers, mosaicism, and polygenic factors, among others. We also considered the challenges that come with investigating penetrance and expressivity.

Also flagged:Transferrin Receptor 1Cancerchimeric antigen receptorgenetransductionTfR1
Journal Article 2022-07-24 ✓ 1 Snippet Cheng EL, Cardle II, Kacherovsky N, Bansia H, Wang T, Zhou Y, Raman J, Yen A, Gutierrez D, Salipante SJ, des Georges A, Jensen MC, Pun SH.
In-Text Gene Mentions

HFE

Show Full Abstract

The clinical manufacturing of chimeric antigen receptor (CAR) T cells includes cell selection, activation, gene transduction, and expansion. While the method of T-cell selection varies across companies, current methods do not actively eliminate the cancer cells in the patient's apheresis product from the healthy immune cells. Alarmingly, it has been found that transduction of a single leukemic B cell with the CAR gene can confer resistance to CAR T-cell therapy and lead to treatment failure. In this study, we report the identification of a novel high-affinity DNA aptamer, termed tJBA8.1, that binds transferrin receptor 1 (TfR1), a receptor broadly upregulated by cancer cells. Using competition assays, high resolution cryo-EM, and <i>de novo</i> model building of the aptamer into the resulting electron density, we reveal that tJBA8.1 shares a binding site on TfR1 with holo-transferrin, the natural ligand of TfR1. We use tJBA8.1 to effectively deplete B lymphoma cells spiked into peripheral blood mononuclear cells with minimal impact on the healthy immune cell composition. Lastly, we present opportunities for affinity improvement of tJBA8.1. As TfR1 expression is broadly upregulated in many cancers, including difficult-to-treat T-cell leukemias and lymphomas, our work provides a facile, universal, and inexpensive approach for comprehensively removing cancerous cells from patient apheresis products for safe manufacturing of adoptive T-cell therapies.

Also flagged:antibodycarbofuranbenfuracarbcarbosulfanhydroxyalbumin
Journal Article 2022-07-24 No Snippets Wu Y, Fan Q, Chen Y, Sun X, Shi G.
Show Full Abstract

To produce a sensitive monoclonal antibody (mAb) for the simultaneous detection of carbofuran, benfuracarb, carbosulfan and 3-hydroxy-carbofuran, 2,3-dihydro-2,2-dimethyl-7-benzofuranmethanamine (DDB) was conjugated to bovine serum albumin (BSA) to prepare the immunogen DDB-BSA and mice were immunized. Coating antigens were prepared by conjugating DDB and 5-methoxy-2,3-dihydrobenzofuran-3-acetic acid (MDA) to BSA and ovalbumin (OVA), respectively. Furthermore, the effect of different antibody-antigen pairs on the sensitivity of ELISA and LFIA methods for the detection of carbofuran was investigated. After the immunization, a high-affinity mAb 13C8 was obtained. The ability of the coating antigen to compete with carbofuran for binding antibodies was found to be significantly different between ELISA and LFIA methods. With the antibody-antigen pair 13C8-MDA-OVA, the IC<sub>50</sub> values of the ELISA and QD-LFIA methods for carbofuran were 0.18 ng/mL and 0.67 ng/mL, respectively. The cross-reactivity (CR) values of the two methods for benfuracarb, carbosulfan and 3-hydroxy-carbofuran ranged from 72.0% to 83.7%, while, for other carbamate pesticides, the CR values were less than 1%. The spiked recoveries of carbofuran in vegetables by the QD-LFIA method were 83-111%, with a coefficient of variation below 10%, and the test results of the actual samples were consistent with the HPLC-MS method. Overall, this study provides key materials for the development of immunoassays for carbofuran and its analogues, and the antibody-antigen pair selection strategy established in this study provides useful insights for the development of sensitive immunoassays for other compounds.

Also flagged:RKIPRafcancerRaf-1tumorimmune response
Journal Article 2022-07-24 ✓ 2 Snippets Bach VN, Ding J, Yeung M, Conrad T, Odeh HN, Cubberly P, Figy C, Ding HF, Trumbly R, Yeung KC.
In-Text Gene Mentions

…ethanolamine-binding protein (PEBP1) of the PEBP…

PEBP1(=RKIP) was entered…

Show Full Abstract

Raf-1 kinase inhibitor protein was first identified as a negative regulator of the Raf signaling pathway. Subsequently, it was shown to have a causal role in containing cancer progression and metastasis. Early studies suggested that RKIP blocks cancer progression by inhibiting the Raf-1 pathway. However, it is not clear if the RKIP tumor and metastasis suppression function involve other targets. In addition to the Raf signaling pathway, RKIP has been found to modulate several other signaling pathways, affecting diverse biological functions including immune response. Recent advances in medicine have identified both positive and negative roles of immune response in cancer initiation, progression and metastasis. It is possible that one way that RKIP exerts its effect on cancer is by targeting an immune response mechanism. Here, we provide evidence supporting the causal role of tumor and metastasis suppressor RKIP in downregulating signaling pathways involved with immune response in breast cancer cells and discuss its potential ramification on cancer therapy.

Also flagged:Calcium phosphatehydroxyapatitewollastoniteporecell differentiationcell adhesion
Journal Article 2022-07-24 No Snippets Cestari F, Yang Y, Wilbig J, Günster J, Motta A, Sglavo VM.
Show Full Abstract

The pore geometry of bone scaffolds has a major impact on their cellular response; for this reason, 3D printing is an attractive technology for bone tissue engineering, as it allows for the full control and design of the porosity. Calcium phosphate materials synthesized from natural sources have recently attracted a certain interest because of their similarity to natural bone, and they were found to show better bioactivity than synthetic compounds. Nevertheless, these materials are very challenging to be processed by 3D printing due to technological issues related to their nanometric size. In this work, bone scaffolds with different pore geometries, with a uniform size or with a size gradient, were fabricated by binder jetting 3D printing using a biphasic calcium phosphate (BCP) nanopowder derived from cuttlebones. To do so, the nanopowder was mixed with a glass-ceramic powder with a larger particle size (45-100 µm) in 1:10 weight proportions. Pure AP40mod scaffolds were also printed. The sintered scaffolds were shown to be composed mainly by hydroxyapatite (HA) and wollastonite, with the amount of HA being larger when the nanopowder was added because BCP transforms into HA during sintering at 1150 °C. The addition of bio-derived powder increases the porosity from 60% to 70%, with this indicating that the nanoparticles slow down the glass-ceramic densification. Human mesenchymal stem cells were seeded on the scaffolds to test the bioactivity in vitro. The cells' number and metabolic activity were analyzed after 3, 5 and 10 days of culturing. The cellular behavior was found to be very similar for samples with different pore geometries and compositions. However, while the cell number was constantly increasing, the metabolic activity on the scaffolds with gradient pores and cuttlebone-derived powder decreased over time, which might be a sign of cell differentiation. Generally, all scaffolds promoted fast cell adhesion and proliferation, which were found to penetrate and colonize the 3D porous structure.

Also flagged:rhodaminepositroncoppersynthesiscopper-coordination
Journal Article 2022-07-23 No Snippets AlHokbany N, AlJammaz I, AlOtaibi B, AlMalki Y, AlJammaz B, Okarvi SM.
Show Full Abstract

<h4>Background</h4>Myocardial perfusion imaging (MPI) is one of the most commonly performed investigations in nuclear medicine procedures. Due to the longer half-life of the emerging positron emitter copper-64 and its availability from low energy cyclotron, together with its well-known coordination chemistry, we have synthesized <sup>64</sup>Cu-labeled NOTA- and <sup>64</sup>Cu-NOTAM-rhodamine conjugates as potential cardiac imaging agents using PET.<h4>Results</h4><sup>64</sup>Cu-NOTA- and <sup>64</sup>Cu-NOTAM-rhodamine conjugates were synthesized using a traightforward and one-step simple reaction. Radiochemical yields were greater than 97% (decay corrected), with a total synthesis time of less than 25 min. Radiochemical purities were always greater than 98% as assessed by TLC and HPLC. These synthetic approaches hold considerable promise as a simple method for <sup>64</sup>Cu-rhodamine conjugates synthesis, with high radiochemical yield and purity. Biodistribution studies in normal Fischer rats at 60 min post-injection, demonstrated significant heart uptake and a good biodistribution profile for both the radioconjugates. However, the <sup>64</sup>Cu-NOTAM-rhodamine conjugate has shown more heart uptake (~ 10% ID/g) over the <sup>64</sup>Cu-NOTA-rhodamine conjugate (5.6% ID/g).<h4>Conclusions</h4>These results demonstrate that these radioconjugates may be useful probes for the PET evaluation of MPI.

Also flagged:ExtracellularNlrp3adenosine triphosphatepattern recognition receptorextracellular spacecell surface
Journal Article 2022-07-23 ✓ 2 Snippets Thapa A, Abdelbaset-Ismail A, Chumak V, Adamiak M, Brzezniakiewicz-Janus K, Ratajczak J, Kucia M, Ratajczak MZ.
In-Text Gene Mentions

…of transcriptional factorSOX6[ 37 ]…

…of transcriptional factorSOX6, that plays a…

Show Full Abstract

We postulated that mobilization, homing, and engraftment of hematopoietic stem/progenitor cells (HSCPs) is facilitated by a state of sterile inflammation induced in bone marrow (BM) after administration of pro-mobilizing drugs or in response to pre-transplant myeloablative conditioning. An important role in this phenomenon plays purinergic signaling that by the release of extracellular adenosine triphosphate (eATP) activates in HSPCs and in cells in the hematopoietic microenvironment an intracellular pattern recognition receptor (PPR) known as Nlrp3 inflammasome. We reported recently that its deficiency results in defective trafficking of HSPCs. Moreover, it is known that eATP after release into extracellular space is processed by cell surface expressed ectonucleotidases CD39 and CD73 to extracellular adenosine (eAdo) that in contrast to eATP shows an anti-inflammatory effect. Based on data that the state of sterile inflammation promotes trafficking of HSPCs, and since eAdo is endowed with anti-inflammatory properties we become interested in how eAdo will affect the mobilization, homing, and engraftment of HSPCs and which of eAdo receptors are involved in these processes. As expected, eAdo impaired HSPCs trafficking and this occurred in autocrine- and paracrine-dependent manner by direct stimulation of these cells or by affecting cells in the BM microenvironment. We report herein for the first time that this defect is mediated by activation of the A<sub>2B</sub> receptor and a specific inhibitor of this receptor improves eAdo-aggravated trafficking of HSPCs. To explain this at the molecular level eAdo-A<sub>2B</sub> receptor interaction upregulates in HSPCs in NF-kB-, NRF2- and cAMP-dependent manner heme oxygenase-1 (HO-1), that is Nlrp3 inflammasome inhibitor. This corroborated with our analysis of proteomics signature in murine HSPCs exposed to eAdo that revealed that A<sub>2B</sub> inhibition promotes cell migration and proliferation. Based on this we postulate that blockage of A<sub>2B</sub> receptor may accelerate the mobilization of HSPCs as well as their hematopoietic reconstitution and this approach could be potentially considered in the future to be tested in the clinic.

Also flagged:bindingNANOGGATA6Fate-determining transcription factorschromatintranscription factors
Journal Article 2022-07-23 No Snippets Thompson JJ, Lee DJ, Mitra A, Frail S, Dale RK, Rocha PP.
Show Full Abstract

Fate-determining transcription factors (TFs) can promote lineage-restricted transcriptional programs from common progenitor states. The inner cell mass (ICM) of mouse blastocysts co-expresses the TFs NANOG and GATA6, which drive the bifurcation of the ICM into either the epiblast (Epi) or the primitive endoderm (PrE), respectively. Here, we induce GATA6 in embryonic stem cells-that also express NANOG-to characterize how a state of co-expression of opposing TFs resolves into divergent lineages. Surprisingly, we find that GATA6 and NANOG co-bind at the vast majority of Epi and PrE enhancers, a phenomenon we also observe in blastocysts. The co-bound state is followed by eviction and repression of Epi TFs, and quick remodeling of chromatin and enhancer-promoter contacts thus establishing the PrE lineage while repressing the Epi fate. We propose that co-binding of GATA6 and NANOG at shared enhancers maintains ICM plasticity and promotes the rapid establishment of Epi- and PrE-specific transcriptional programs.

Also flagged:ageingmetabolismamino acidssaltsugarmalnutrition
Journal Article 2022-07-23 No Snippets Wu Q, Wu Q, Gao ZJ, Yu X, Wang P.
Show Full Abstract

Nutriments have been deemed to impact all physiopathologic processes. Recent evidences in molecular medicine and clinical trials have demonstrated that adequate nutrition treatments are the golden criterion for extending healthspan and delaying ageing in various species such as yeast, drosophila, rodent, primate and human. It emerges to develop the precision-nutrition therapeutics to slow age-related biological processes and treat diverse diseases. However, the nutritive advantages frequently diversify among individuals as well as organs and tissues, which brings challenges in this field. In this review, we summarize the different forms of dietary interventions extensively prescribed for healthspan improvement and disease treatment in pre-clinical or clinical. We discuss the nutrient-mediated mechanisms including metabolic regulators, nutritive metabolism pathways, epigenetic mechanisms and circadian clocks. Comparably, we describe diet-responsive effectors by which dietary interventions influence the endocrinic, immunological, microbial and neural states responsible for improving health and preventing multiple diseases in humans. Furthermore, we expatiate diverse patterns of dietotheroapies, including different fasting, calorie-restricted diet, ketogenic diet, high-fibre diet, plants-based diet, protein restriction diet or diet with specific reduction in amino acids or microelements, potentially affecting the health and morbid states. Altogether, we emphasize the profound nutritional therapy, and highlight the crosstalk among explored mechanisms and critical factors to develop individualized therapeutic approaches and predictors.

Also flagged:melanomatumourimmune responseDeleted incolorectal cancertransmembrane dependence receptor
Journal Article 2022-07-23 ✓ 5 Snippets Li Y, Wang Q, Chen Y, Zhao L.
In-Text Gene Mentions

In the TCGA cohort, DCC-mutated samples presented more neoantigens, higher proportions of infiltrating antitumour immunocytes and lower proportions of infiltrating pro-tumour immunocytes than DCC wild-type samples.

The associations of DCC mutation with chromosomal instability and immunotherapeutic efficacy in melanoma are largely uncharacterised.<h4>Methods</h4>We performed an integrated study based on biological experiments and multi-dimensional data types, including genomic, transcriptomic and clinical immune checkpoint blockade (ICB)-treated melanoma cohorts from public databases.<h4>Results</h4>DCC mutation was significantly correlated with the tumour mutational burden (TMB) in The Cancer Genome Atlas (TCGA), International Cancer Genome Consortium (ICGC) and ICB-treated melanoma cohorts.

<h4>Background</h4>Deleted in colorectal cancer (DCC) encodes a transmembrane dependence receptor and is frequently mutated in melanoma.

Furthermore, patients harbouring mutated DCC treated with ICB showed remarkable clinical benefits in terms of the response rate and overall survival.<h4>Conclusions</h4>Somatic mutations in DCC are associated with improved clinical outcomes in ICB-treated melanoma patients.

…Somatic mutations inDCCare associated with…

Show Full Abstract

<h4>Background</h4>Deleted in colorectal cancer (DCC) encodes a transmembrane dependence receptor and is frequently mutated in melanoma. The associations of DCC mutation with chromosomal instability and immunotherapeutic efficacy in melanoma are largely uncharacterised.<h4>Methods</h4>We performed an integrated study based on biological experiments and multi-dimensional data types, including genomic, transcriptomic and clinical immune checkpoint blockade (ICB)-treated melanoma cohorts from public databases.<h4>Results</h4>DCC mutation was significantly correlated with the tumour mutational burden (TMB) in The Cancer Genome Atlas (TCGA), International Cancer Genome Consortium (ICGC) and ICB-treated melanoma cohorts. DCC expression levels were correlated with DNA damage response and repair (DDR) pathways responsive to irradiation (IR) in the Malme-3M and SK-MEL-2 cell lines. In the TCGA cohort, DCC-mutated samples presented more neoantigens, higher proportions of infiltrating antitumour immunocytes and lower proportions of infiltrating pro-tumour immunocytes than DCC wild-type samples. DCC-mutated samples were significantly enriched in activated immune response and DDR pathways. Furthermore, patients harbouring mutated DCC treated with ICB showed remarkable clinical benefits in terms of the response rate and overall survival.<h4>Conclusions</h4>Somatic mutations in DCC are associated with improved clinical outcomes in ICB-treated melanoma patients. Once further validated, the DCC mutational status can improve patient selection for clinical practice and future study enrolment.

Also flagged:heparintinzaparindeep venous thrombosisDVTpulmonary embolismPE
Journal Article 2022-07-23 ✓ 3 Snippets Amerali M, Politou M.
In-Text Gene Mentions

…of Antithrombin III (ATIII) mainly on activated…

…in differences inATIIIbinding affinity affecting…

…binding to bothATIIIand endothelial cells.…

Show Full Abstract

<h4>Purpose</h4>Low molecular weight heparins (LMWHs) are a group of heterogenous moieties, long used in the prevention and treatment of thrombosis. They derive from heparin and since they are prepared by different methods of depolymerization, they differ in pharmacokinetic properties and anticoagulant profiles, and thus are not clinically interchangeable.<h4>Methods</h4>In this review we provide an overview of tinzaparin's main characteristics and uses.<h4>Results</h4>Tinzaparin which is produced by the enzymatic depolymerization of unfractionated heparin (UFH) can be used for the treatment and prevention of deep venous thrombosis (DVT) and pulmonary embolism (PE); it has been also used in special populations such as elders, obese, pregnant women, and patients with renal impairment and/or cancer with favorable outcomes in both safety and efficacy, with a once daily dose regimen. Furthermore, LMWHs are extensively used in clinical practice for both thromboprophylaxis and thrombosis treatment of COVID-19 patients.<h4>Conclusion</h4>Tinzaparin features support the hypothesis for having a role in immunothrombosis treatment (i.e. in the context of cancer ,COVID-19), interfering not only with coagulation cascade but also exhibiting anti-inflammatory potency.

Also flagged:HDdystoniaataxiatrinucleotidescytosineadenine
Journal Article 2022-07-23 ✓ 4 Snippets Afzal M, Sayyed N, Alharbi KS, Alzarea SI, Alshammari MS, Alomar FA, Alenezi SK, Quazi AM, Alzarea AI, Kazmi I.
In-Text Gene Mentions

Several studies have suggested that HD-like symptoms arise as a consequence of repeats of trinucleotides, such as cytosine, adenine, and guanine (CAG), on the short arm of the chromosome in the HTT gene.

…mutations in theHTTgene, resulting in…

…aggregation of theHTTprotein.…

…encodes for theHTTprotein represents fundamental…

Show Full Abstract

<b>Background:</b> Rosiridin is a compound extracted from <i>Rhodiola sachalinensis</i>; water extracts of <i>Rhodiola</i> root elicit positive effects on the human central nervous system and improve brain function. They are also thought to be beneficial to one's health, in addition to being antioxidants. The present study aims to evaluate the anti-Huntington's effect of rosiridin against 3-nitropropionic acid (3-NPA)-induced Huntington's disease (HD)-like effects in rats. <b>Materials and Methods:</b> The acute toxicity in rats was elucidated to track the conceivable toxicities in the rats. The effectiveness of rosiridin at a dosage of 10 mg/kg was evaluated against several dose administrations of 3-NPA-induced HD-like symptoms in the rats for 22 days. At the end of the study, behavioral parameters were assessed as a hallmark for the cognitive and motor functions in the rats. Similarly, after the behavioral assessment, the animals were sacrificed to obtain a brain tissue homogenate. The prepared homogenate was utilized for the estimation of several biochemical parameters, including oxidative stress (glutathione, catalase, and malondialdehyde), brain-derived neurotrophic factor and succinate dehydrogenase activity, and the glutamate and acetylcholinesterase levels in the brain. Furthermore, inflammatory mediators linked to the occurrence of neuroinflammation in rats were evaluated in the perfused brain tissues. <b>Results:</b> The rosiridin-treated group exhibited a significant restoration of behavioral parameters, including in the beam-walk test, latency in falling during the hanging wire test, and percentage of memory retention during the elevated plus-maze test. Further, rosiridin modulated several biochemical parameters, including oxidative stress, pro-inflammatory activity, brain-derived neurotrophic factor, nitrite, and acetylcholinesterase as compared to disease control group that was treated with 3-NPA. <b>Conclusions:</b> The current study exhibits the anti-Huntington's effects of rosiridin in experimental animal models.

Also flagged:Deathoxygendetoxificationcancerinflammatory responsemitochondrial
Journal Article 2022-07-23 No Snippets Ferrer JLM, Garcia RL.
Show Full Abstract

Cigarette smoke is a rich source of carcinogens and reactive oxygen species (ROS) that can damage macromolecules including DNA. Repair systems can restore DNA integrity. Depending on the duration or intensity of stress signals, cells may utilize various survival and adaptive mechanisms. ROS levels are kept in check through redundant detoxification processes controlled largely by antioxidant systems. This review covers and expands on the mechanisms available to cigarette smoke-exposed cancer cells for restoring the redox balance. These include multiple layers of transcriptional control, each of which is posited to be activated upon reaching a particular stress threshold, among them the <i>NRF2</i> pathway, the <i>AP-1</i> and <i>NF-kB</i> pathways, and, finally, <i>TP53</i>, which triggers apoptosis if extreme toxicity is reached. The review also discusses long noncoding RNAs, which have been implicated recently in regulating oxidative stress-with roles in ROS detoxification, the inflammatory response, oxidative stress-induced apoptosis, and mitochondrial oxidative phosphorylation. Lastly, the emerging roles of tunneling nanotubes in providing additional mechanisms for metabolic rescue and the regulation of redox imbalance are considered, further highlighting the expanded redox reset arsenal available to cells.

Also flagged:Iron-refractory iron deficiency anemiaIRIDAiron deficiency anemiaironpathogenesisHb
Journal Article 2022-07-23 No Snippets Hoving V, Korman SE, Antonopoulos P, Donker AE, Schols SEM, Swinkels DW.
Show Full Abstract

Iron-refractory iron deficiency anemia (IRIDA) is an autosomal recessive inherited form of iron deficiency anemia characterized by discrepantly high hepcidin levels relative to body iron status. However, patients with monoallelic exonic <i>TMPRSS6</i> variants have also been reported to express the IRIDA phenotype. The pathogenesis of an IRIDA phenotype in these patients is unknown and causes diagnostic uncertainty. Therefore, we retrospectively summarized the data of 16 patients (4 men, 12 women) who expressed the IRIDA phenotype in the presence of only a monoallelic <i>TMPRSS6</i> variant. Eight unaffected relatives with identical exonic <i>TMPRSS6</i> variants were used as controls. Haplotype analysis was performed to assess the (intra)genetic differences between patients and relatives. The expression and severity of the IRIDA phenotype were highly variable. Compared with their relatives, patients showed lower Hb, MCV, and TSAT/hepcidin ratios and inherited a different wild-type allele. We conclude that IRIDA in monoallelic <i>TMPRSS6</i>-affected patients is a phenotypically and genotypically heterogeneous disease that is more common in female patients. We hypothesize that allelic imbalance, polygenetic inheritance, or modulating environmental factors and their complex interplay are possible causes. This explorative study is the first step toward improved insights into the pathophysiology and improved diagnostic accuracy for patients presenting with IRIDA and a monoallelic exonic <i>TMPRSS6</i> variant.

Also flagged:neurodegenerative diseasesHDCNS diseaseautoimmune demyelinating diseases of theCytosineAdenine
Journal Article 2022-07-23 ✓ 4 Snippets Achenbach J, Saft C, Faissner S, Ellrichmann G.
In-Text Gene Mentions

Suffering from neurodegenerative Huntington’s disease (HD) is accompanied with manifold heterogeneous motoric, cognitive, and psychiatric symptoms.1, –3 Although the distinct cause of disease is known with a Cytosine-Adenine-Guanine (CAG)-trinucleotide repeat expansion in the huntingtin gene (HTT) encoding for mutant huntingtin protein (mHTT) associated with toxic effects at the molecular level, exact pathomechanisms remain to be elucidated.1 There is evidence that molecular changes and pathophysiology in HD is accompanied by neuroinflammation due to an influence of the innate and adaptive immune system with activation of microglia and expression of proinflammatory cytokines in the striatum accelerating neurodegenerative processes starting in pre-manifest stages of the disease already.4, , –7 Elevation of pro-inflammatory cytokines such as interleukin (IL)-6, IL-7, and others in animal models and patients suggests inflammatory mechanisms as part of the pathophysiology in HD.

As inclusion criteria for manifest HD group, all included participants had a diagnostic confidence level (DCL) of 4 [unequivocal signs of clinical manifest HD (>99% confidence)], a total motor score (TMS) >5, and a genetically confirmed report with ⩾36 CAG repeats in the Huntingtin gene (HTT).

…huntingtin gene (HTT) encoding for…

…Huntingtin gene (HTT).…

Show Full Abstract

<h4>Background</h4>The role of neuroinflammation and autoimmune processes in neurodegenerative diseases is not fully understood. Activation of microglia with expression of proinflammatory cytokines supports the hypothesis that immune processes may play an important role in the pathophysiology of Huntington's disease (HD) and thus, immunomodulating therapies might have potential neuroprotective properties. Until now, no disease-modifying therapy (DMT) is available for HD.<h4>Objective</h4>The aim of this research was to characterize a cohort of patients suffering from both HD and autoimmune demyelinating diseases of the central nervous system (classified as G35-37 in ICD-10; ADD-CNS) in comparison to HD cases without ADD-CNS. In particular, we were interested to investigate potential modulating effects on disease manifestation and progression of HD over time of prescribed immunomodulating medications (DMT).<h4>Methods</h4>We analyzed the course of HD regarding motoric, functional, and cognitive aspects, using longitudinal data of up to 2 years from the worldwide registry study ENROLL-HD. Additional cross-sectional data in the largest cohort worldwide of HD patients was analyzed using demographic and molecular genetic parameters. Data were analyzed using analysis of variance (ANOVA) for cross-sectional and repeated-measures ANOVA for longitudinal parameters in IBM SPSS Statistics V.27.<h4>Results</h4>Within the ENROLL-HD database, we investigated <i>N =</i> 21,116 participants and identified <i>n</i> = 60 participants suffering from ADD-CNS. Molecular, genetic, and demographic data did not differ between groups. The subgroup of <i>n =</i> 32 participants with motor-manifest HD revealed better cognitive performance in five out of eight cognitive tests at baseline with less progression over time in two tests (all <i>p <</i> 0.05). Differentiation between DMT-treated and untreated patients revealed better cognitive and motor performance in the DMT group; those patients, however, tended to be younger. Pre-manifest HD patients simultaneously diagnosed with ADD-CNS (<i>n =</i> 12) showed lower functional scores and more decline over time when compared with other pre-manifest HD (<i>p <</i> 0.05).<h4>Conclusion</h4>Patients suffering from motor-manifest HD and simultaneously from ADD-CNS have better cognitive capacities compared with other motor-manifest HD patients. Moreover, DMTs might have beneficial effects on progression of neurodegeneration including the motor phenotype. However, this effect might have been biased by younger age in DMT-treated patients. Pre-manifest HD patients showed more functional impairment as expected due to their additional ADD-CNS disease.

Also flagged:nucleusbehaviorallong-term potentiationlong-term depressionGene expressionneurogenesis
Journal Article 2022-07-23 ✓ 2 Snippets Zhou QJ, Liu X, Zhang L, Wang R, Yin T, Li X, Li G, He Y, Ding Z, Ma P, Wang SZ, Mao B, Zhang S, Wang GD.
In-Text Gene Mentions

…GRM7, TENM2 andCACNA1E, while Cluster…

…in Cluster 9;SOX6was expressed in…

Show Full Abstract

The process of domestication has led to dramatic differences in behavioral traits between domestic dogs and gray wolves. Whole-genome research found that a class of putative positively selected genes were related to various aspects of learning and memory, such as long-term potentiation and long-term depression. In this study, we constructed a single-nucleus transcriptomic atlas of the dog hippocampus to illustrate its cell types, cell lineage and molecular features. Using the transcriptomes of 105 057 nuclei from the hippocampus of a Beagle dog, we identified 26 cell clusters and a putative trajectory of oligodendrocyte development. Comparative analysis revealed a significant convergence between dog differentially expressed genes (DEGs) and putative positively selected genes (PSGs). Forty putative PSGs were DEGs in glutamatergic neurons, especially in Cluster 14, which is related to the regulation of nervous system development. In summary, this study provides a blueprint to understand the cellular mechanism of dog domestication.

Also flagged:deathplasminogentPAcreatinineend-stage renal diseaseESRD
Journal Article 2022-07-22 ✓ 5 Snippets Olausson M, Antony D, Travnikova G, Johansson M, Nayakawde NB, Banerjee D, Søfteland JM, Premaratne GU.
In-Text Gene Mentions

…Lys-plasminogen,antithrombin-III(ATIII), and alteplase…

…lasminogen, antithrombin-III (ATIII), and alteplase (tPA)…

…of naturally occurringantithrombin-III(ATIII).…

…y occurring antithrombin-III (ATIII).…

…Lys-plasminogen; 600 UATIII) in a volume…

Show Full Abstract

<h4>Background</h4>Due to organ shortage, many patients do not receive donor organs. The present novel thrombolytic technique utilizes organs from donors with uncontrolled donation after circulatory deaths (uDCD), with up to 4-5 h warm ischemia, without advanced cardiopulmonary resuscitation (aCPR) or extracorporeal circulation (EC) after death.<h4>Methods</h4>The study group of pigs (n = 21) underwent simulated circulatory death. After 2 h, an ice slush was inserted into the abdomen. Kidneys were retrieved 4.5 h after death. Lys-plasminogen, antithrombin-III (ATIII), and alteplase (tPA) were injected through the renal arteries on the back table. Subsequent ex vivo perfusion at 15 °C was continued for 3 h, followed by 3 h with red blood cells (RBCs) at 32 °C. Perfusion outcome and histology were compared between uDCD kidneys, receiving no thrombolytic treatment (n = 8), and live donor kidneys (n = 7). The study kidneys were then transplanted into pigs as autologous grafts with a single functioning autologous kidney as the only renal support. uDCD control pigs (n = 8), receiving no ex vivo perfusion, served as controls.<h4>Results</h4>Vascular resistance decreased to <200 mmHg/mL/min ( P < 0.0023) and arterial flow increased to >100 mL/100 g/min ( P < 0.00019) compared to controls. In total 13/21 study pigs survived for >10 days, while all uDCD control pigs died. Histology was preserved after reconditioning, and the creatinine level after 10 days was next to normal.<h4>Conclusions</h4>Kidneys from extended uDCD, not receiving aCPR/EC, can be salvaged using thrombolytic treatment to remove fibrin thrombi while preserving histology and enabling transplantation with a clinically acceptable early function.

Also flagged:retinal degenerative diseasesvisionneuroretinametabolismSnap25Cntn1
Journal Article 2022-07-22 ✓ 1 Snippet Mao S, Miao A, Cui Y, Lu J, Pan J, Wang Y, Hong Y, Luo Y.
In-Text Gene Mentions

…>Snap25</i>, <i>Cntn1</i>, <i>Negr1</i>, <i>Dpysl2</i>, <i>Dpysl3…

Show Full Abstract

Stem cell replacement therapy has emerged as one of the most promising treatment options for retinal degenerative diseases, which are the main causes of irreversible vision loss. Three-dimensional (3D) retinal organoid culture is a cutting-edge technology for differentiating embryonic stem cells into retinal cells by forming a laminated retinal structure. However, 3D culture systems have strict requirements with respect to the experimental environment and culture technologies. Our study aimed to investigate the effect of retinal conditioned medium (RCM) at different developmental stages on the early differentiation of embryonic stem cells into retina in a 3D culture system. In this study, we added RCM to the 3D culture system and found that it could promote the differentiation of mouse embryonic stem cells (mESCs) into neuroretina. We further explored the possible mechanisms of RCM that regulate differentiation through proteomic analysis. RCM at different time points disclosed different protein profiles. Proteins which improved energy metabolism of mESCs might help improve the viability of embryonic bodies. We then screened out <i>Snap25</i>, <i>Cntn1</i>, <i>Negr1</i>, <i>Dpysl2</i>, <i>Dpysl3</i>, and <i>Crmp1</i> as candidate proteins that might play roles in the differentiation and neurogenesis processes of mESCs, hoping to provide a basis for optimizing a retinal differentiation protocol from embryonic stem cells.

Also flagged:ironlung cancercanceroxygenbiosynthesismetabolism
Journal Article 2022-07-22 ✓ 5 Snippets Qin H, Zeng W, Zeng W, Lou Y.
In-Text Gene Mentions

Three SNPs [rs1800562 and rs1799945 in hemochromatosis (HFE) and rs855791 in the transmembrane protease serine 6 gene (TMPRSS6)] out of these SNPs demonstrated an association with all 4 iron biomarkers (Table 1).

…and rs1799945 inhemochromatosis(HFE) and rs855791…

…rs1799945 in hemochromatosis (HFE) and rs855791 in…

…have demonstrated thatHFEand TMPRSS6 can…

…rs1799945) within theHFEgene was low…

Show Full Abstract

Observational studies provided conflicting results on the association between iron status and the risk of lung cancer. The aim of our study was to investigate the effect of genetically determined iron status on lung cancer risk using a mendelian randomization (MR) approach. Single-nucleotide polymorphisms for iron status were selected from a genome-wide meta-analysis of 48,972 subjects. Genetic association estimates for risk of lung cancer were derived from a Genome-Wide Association Study (GWAS) summary performed by the International Lung Cancer Consortium. The inverse-variance weighted method was used for the main analyses and sensitivity analyses. MR analysis demonstrated that increased genetically-predicted iron status did not causally increase risk of lung cancer. The odds ratios were 1.11 (95% CI, 0.92, 1.34; P = .26), 0.76 (95% CI, 0.52, 1.12; P = .17), 1.09 (95% CI, 0.86, 1.38; P = .47), and 0.91 (95% CI, 0.81, 1.02; P = .11) per 1 standard deviation increment of serum iron, ferritin, transferrin saturation, and transferrin levels, respectively. No observed indication of heterogeneity (P for Q > 0.05) or pleiotropy (P for intercept > 0.05) were found from the sensitivity analysis. The MR study indicated that genetic iron status was not causally associated with the risk of lung cancer, the causal relationship between iron status and lung cancer needs to be further elucidated by additional studies that strictly control for confounding factors.

Also flagged:HDHuntingtinAgo2DroshaDicerautophagy
Journal Article 2022-07-22 ✓ 5 Snippets Petry S, Keraudren R, Nateghi B, Loiselle A, Pircs K, Jakobsson J, Sephton C, Langlois M, St-Amour I, Hébert SS.
In-Text Gene Mentions

To understand the impact of endogenous human Htt on miRNA maturation, we first evaluated Htt expression and pathology in two different brain regions in human HD (Table 1).

The molecular mechanisms leading to Htt-mediated neurodegeneration are still unresolved, although it is well recognized that abnormal regulation of gene expression is an early and critical feature of HD neuropathology [26, 35, 38].

We quantified the amount of Htt protein in 41 HD patients (N = 10 HD2, N = 23 HD3, N = 8 HD4) and 25 Controls from matching striatal and cortical tissues.

Thus overall, in line with previous results suggesting that HD pathology starts in the striatum, the striatal tissue samples analyzed herein presented severe signs of Htt pathology and neurodegeneration compared to the parietal cortex of the same individuals.

These experiments validate and extend our previous biochemical studies on Htt pathology and other proteinopathies exclusively in the striatum (putamen) [47].

Show Full Abstract

Altered microRNA (miRNA) expression is a common feature of Huntington's disease (HD) and could participate in disease onset and progression. However, little is known about the underlying causes of miRNA disruption in HD. We and others have previously shown that mutant Huntingtin binds to Ago2, a central component of miRNA biogenesis, and disrupts mature miRNA levels. In this study, we sought to determine if miRNA maturation per se was compromised in HD. Towards this end, we characterized major miRNA biogenesis pathway components and miRNA maturation products (pri-miRNA, pre-miRNA, and mature) in human HD (N = 41, Vonsattel grades HD2-4) and healthy control (N = 25) subjects. Notably, the striatum (putamen) and cortex (BA39) from the same individuals were analyzed in parallel. We show that Ago2, Drosha, and Dicer were strongly downregulated in human HD at the early stages of the disease. Using a panel of HD-related miRNAs (miR-10b, miR-196b, miR-132, miR-212, miR-127, miR-128), we uncovered various types of maturation defects in the HD brain, the most prominent occurring at the pre-miRNA to mature miRNA maturation step. Consistent with earlier findings, we provide evidence that alterations in autophagy could participate in miRNA maturation defects. Notably, most changes occurred in the striatum, which is more prone to HTT aggregation and neurodegeneration. Likewise, we observed no significant alterations in miRNA biogenesis in human HD cortex and blood, strengthening tissue-specific effects. Overall, these data provide important clues into the underlying mechanisms behind miRNA alterations in HD-susceptible tissues. Further investigations are now required to understand the biological, diagnostic, and therapeutic implications of miRNA/RNAi biogenesis defects in HD and related neurodegenerative disorders.

Also flagged:tioPC 43TNF-αIL-6IL-1βIL-10
Journal Article 2022-07-22 ✓ 5 Snippets Cai S, Fan C, Xie L, Zhong H, Li A, Lv S, Liao M, Yang X, Su X, Wang Y, Wang H, Wang M, Huang P, Liu Y, Wang Y, Liu Y, Wang T, Zhong Y, Ma L.
In-Text Gene Mentions

PTGIS, prostacyclin I2 synthase, can catalyze the conversion of prostaglandin H2 to prostaglandin I2, which plays an essential role in immunoregulatory function [31].

…high + ,PTGIShigh + ,…

…low + ,PTGISlow + ,…

…addition, CXCL12 andPTGISwere highly expressed…

PTGIS, prostacyclin I2…

Show Full Abstract

<h4>Background</h4>Mesenchymal stromal cells (MSCs) are heterogeneous populations. Heterogeneity exists within the same tissue and between different tissues. Some studies have found enormous heterogeneity in immunomodulatory function among MSCs derived from different tissues. Moreover, the underlying mechanism of heterogeneity in immunomodulatory abilities is still unclear.<h4>Methods</h4>Foreskin mesenchymal stromal cells (FSMSCs) and human umbilical cord mesenchymal stromal cells (HuMSCs) were isolated and cultured until the third passage. According to the International Association for Cell Therapy standard, we confirmed the cell type. Then, FSMSCs and HuMSCs were cocultured with human peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) in vitro. Furthermore, the supernatant was sampled for an enzyme-linked immunosorbent assay to investigate the secretion of IL-1β, IL-6, IL-10, TNF-α, and TGF-β1. Finally, we performed single-cell RNA sequencing (scRNA-seq) of FSMSCs and HuMSCs.<h4>Results</h4>We successfully identified FSMSCs and HuMSCs as MSCs. When cocultured with LPS pretreated PBMCs, FSMSCs and HuMSCs could effectively reduced the secretion of IL-1β and TNF-α. However, FSMSCs stimulated the PBMCs to secrete more IL-10, TGF-β1, and IL-6. Furthermore, 4 cell subsets were identified from integrated scRNA-seq data, including proliferative MSCs (MKI67<sup>+</sup>, CD146<sup>low+</sup>, NG2<sup>+</sup>, PDGFRB<sup>-</sup>), pericytes (CD146<sup>high+</sup>, PDGFRB<sup>+</sup>, MKI67<sup>-</sup>, CD31<sup>-</sup>, CD45<sup>-</sup>, CD34<sup>-</sup>), immune MSCs (CXCL12<sup>high+</sup>, PTGIS<sup>high+</sup>, PDGFRB<sup>+</sup>, CD146<sup>-</sup>, MKI67<sup>-</sup>) and progenitor proliferative MSCs (CXCL12<sup>low+</sup>, PTGIS<sup>low+</sup>, PDGFRB<sup>+</sup>, CD146<sup>-</sup>, MKI67<sup>-</sup>). Among them, we found that immune MSCs with strengthened transcriptional activity were similar to pericytes with regard to the degree of differentiated. Various of immune-related genes, gene sets, and regulons were also enriched in immune MSCs. Moreover, immune MSCs were determined to be close to other cell subsets in cell-cell communication analysis. Finally, we found that the proportion of immune MSCs in foreskin tissue was highest when comparing the subset compositions of MSCs derived from different tissues.<h4>Conclusions</h4>FSMSCs show better immunomodulatory capacity than HuMSCs in vitro. Moreover, immune MSCs may play a vital role in the heterogeneity of immunoregulatory properties. This study provides new insights suggesting that immune MSCs can be isolated to exert stable immunoregulatory functions without being limited by the heterogeneity of MSCs derived from different tissues.

Also flagged:Meningiomasintracranial tumorsTumorscentral nervous system tumorsTERTCDKN2A
Journal Article 2022-07-22 No Snippets Okano A, Miyawaki S, Teranishi Y, Ohara K, Hongo H, Sakai Y, Ishigami D, Nakatomi H, Saito N.
Show Full Abstract

The treatment of World Health Organization (WHO) grades 2 and 3 meningiomas remains difficult and controversial. The pathogenesis of high-grade meningiomas was expected to be elucidated to improve treatment strategies. The molecular biology of meningiomas has been clarified in recent years. High-grade meningiomas have been linked to NF2 mutations and 22q deletion. CDKN2A/B homozygous deletion and TERT promoter mutations are independent prognostic factors for WHO grade 3 meningiomas. In addition to 22q loss, 1p, 14p, and 9q loss have been linked to high-grade meningiomas. Meningiomas enriched in copy number alterations may be biologically invasive. Furthermore, several new comprehensive classifications of meningiomas have been proposed based on these molecular biological features, including DNA methylation status. The new classifications may have implications for treatment strategies for refractory aggressive meningiomas because they provide a more accurate prognosis compared to the conventional WHO classification. Although several systemic therapies, including molecular targeted therapies, may be effective in treating refractory aggressive meningiomas, these drugs are being tested. Systemic drug therapy for meningioma is expected to be developed in the future. Thus, this review aims to discuss the distinct genomic alterations observed in WHO grade 2 and 3 meningiomas, as well as their diagnostic and therapeutic implications and systemic drug therapies for high-grade meningiomas.

Also flagged:Mineralizationcollagenhydroxyapatitefibrilsgold nanoparticlesnanostructures
Journal Article 2022-07-22 No Snippets Zhou Y, Chai Y, Mikami K, Tagaya M.
Show Full Abstract

The mineralization process of the osseous layer, which is highly calcified <i>in vivo</i>, was successfully imitated by the immersion process of the decalcified fish scales in simplified simulated body fluid (SSBF). An alkali treatment was used to modify the native collagen in the decalcified Tilapia fish scale. After the alkali treatment, the mineralization was facilitated in SSBF. The XRD patterns and SEM-EDS observation results demonstrated that the externally-mineralized layers by the immersion process were highly similar to the osseous layer containing lower-crystalline hydroxyapatite, suggesting that the simple biomimetic precipitation process was developed.

Also flagged:PDanosmiaolfactionmicrosomiaDepressionOlfactory dysfunction
Journal Article 2022-07-22 No Snippets Fan W, Li H, Li H, Li Y, Wang J, Jia X, Yang Q.
Show Full Abstract

The present study aimed to investigate the association between the functional connectivity (FC) of the olfactory cortex and olfactory performance in Parkinson's disease (PD). Eighty-two early PD patients and twenty-one healthy controls underwent structural and resting-state functional MRI scans, as well as neuropsychological assessments from the Parkinson's Progression Markers Initiative database. A whole brain voxel-wise regression analysis was conducted to evaluate the relationship between the FC of the entorhinal cortex (EC-FC) and olfactory performance. Then, a one-way ANCOVA, based on the regions of interest, was performed with SPSS to investigate the group differences and correlation analysis that were used to analyze the relationships between the FC and neuropsychological assessments. In addition, regression models were used to evaluate the risk factors for the decreased olfactory function. A significantly negative correlation was observed between the olfactory performance and the left EC-FC in the right dorsal cingulate gyrus (dCC) in patients. The PD patients with anosmia exhibited significantly higher FC values than the PD patients with normal olfaction or the PD patients with mild to moderate microsomia. Except for the olfactory performance, no significant correlation was detected between the neuropsychological assessments and the FC values. A linear regression analysis revealed that the increased FC and Geriatric Depression Scale are independently associated with lower the University of Pennsylvania Smell Identification Test scores. The current findings enhanced the understanding of olfactory dysfunction-related pathophysiological mechanisms in early PD and suggested that the left EC-FC in the right dCC may be a potential neuroimaging biomarker for olfactory performance.

Also flagged:hereditary breast/ovarian cancerBRCAHereditary BreastOvarian CancerBRCA1BRCA2
Journal Article 2022-07-22 No Snippets BenAyed-Guerfali D, Kifagi C, BenKridis-Rejeb W, Ammous-Boukhris N, Ayedi W, Khanfir A, Daoud J, Mokdad-Gargouri R.
Show Full Abstract

(1) Background: Germline variants in <i>BRCA1/BRCA2</i> genes explain about 20% of hereditary breast/ovarian cancer (HBOC) cases. In the present paper, we aim to identify genetic determinants in <i>BRCA</i>-negative families from the South of Tunisia. (2) Methods: Exome Sequencing (ES) was performed on the lymphocyte DNA of patients negative for <i>BRCA</i> mutations from each Tunisian family with a high risk of HBOC. (3) Results: We focus on the canonical genes associated with HBOC and identified missense variants in DNA damage response genes, such as <i>ATM</i>, <i>RAD52</i>, and <i>RAD54</i>; however, no variants in <i>PALB2</i>, <i>Chek2</i>, and <i>TP53</i> genes were found. To identify novel candidate genes, we selected variants harboring a loss of function and identified 17 stop-gain and 11 frameshift variants in genes not commonly known to be predisposed to HBOC. Then, we focus on rare and high-impact genes shared by at least 3 unrelated patients from each family and selected 16 gene variants. Through combined data analysis from MCODE with gene ontology and KEGG pathways, a short list of eight candidate genes (<i>ATM</i>, <i>EP300</i>, <i>LAMA1</i>, <i>LAMC2</i>, <i>TNNI3</i>, <i>MYLK</i>, <i>COL11A2</i>, and <i>LAMB3</i>) was created. The impact of the 24 selected genes on survival was analyzed using the TCGA data resulting in a selection of five candidate genes (<i>EP300</i>, <i>KMT2C</i>, <i>RHPN2</i>, <i>HSPG2</i>, and <i>CCR3)</i> that showed a significant association with survival. (4) Conclusions: We identify novel candidate genes predisposed to HBOC that need to be validated in larger cohorts and investigated by analyzing the co-segregation of selected variants in affected families and the locus-specific loss of heterozygosity to highlight their relevance for HBOC risk.

Also flagged:MethylationFragile X Syndromeinfectionsbehavioralneurodevelopmental disabilitiesautism
Journal Article 2022-07-22 ✓ 2 Snippets AlOlaby RR, Zafarullah M, Barboza M, Peng G, Varian BJ, Erdman SE, Lebrilla C, Tassone F.
In-Text Gene Mentions

Among them were the Ncdn, the Agpat1, the Dctn1, the Fbx011, the Emx2, the Dcc gene, and the Gart genes, all encoding for proteins associated with seizures, abnormal hippocampal brain development ID, ASD, ADHD, anxiety, developmental delays, aggression, hyperactivity, altered social skills, delays in speech and language skills, and childhood epilepsy [46,51,66,67].

…Emx2 , theDccgene, and the…

Show Full Abstract

Environmental factors such as diet, gut microbiota, and infections have proven to have a significant role in epigenetic modifications. It is known that epigenetic modifications may cause behavioral and neuronal changes observed in neurodevelopmental disabilities, including fragile X syndrome (FXS) and autism (ASD). Probiotics are live microorganisms that provide health benefits when consumed, and in some cases are shown to decrease the chance of developing neurological disorders. Here, we examined the epigenetic outcomes in offspring mice after feeding of a probiotic organism, <i>Lactobacillus reuteri</i> (<i>L. reuteri</i>), to pregnant mother animals. In this study, we tested a cohort of Western diet-fed descendant mice exhibiting a high frequency of behavioral features and lower FMRP protein expression similar to what is observed in FXS in humans (described in a companion manuscript in this same GENES special topic issue). By investigating 17,735 CpG sites spanning the whole mouse genome, we characterized the epigenetic profile in two cohorts of mice descended from mothers treated and non-treated with <i>L. reuteri</i> to determine the effect of prenatal probiotic exposure on the prevention of FXS-like symptoms. We found several genes involved in different neurological pathways being differentially methylated (<i>p</i> ≤ 0.05) between the cohorts. Among the key functions, synaptogenesis, neurogenesis, synaptic modulation, synaptic transmission, reelin signaling pathway, promotion of specification and maturation of neurons, and long-term potentiation were observed. The results of this study are relevant as they could lead to a better understanding of the pathways involved in these disorders, to novel therapeutics approaches, and to the identification of potential biomarkers for early detection of these conditions.

Also flagged:type 2 diabetesDiabeteshypertensiondyslipidemiaobesitycentral obesity
Journal Article 2022-07-22 ✓ 2 Snippets Pipal KV, Mamtani M, Patel AA, Jaiswal SG, Jaisinghani MT, Kulkarni H.
In-Text Gene Mentions

Further, the Harmonizome database identified another 22 genes (ARHGAP42, CA10, CACNA2D3, CGNL1, CLIC5, DLGAP1, FAT3, FRMD4A, GPR6, HECW1, IQCJ-SCHIP1, MAML2, MBOAT1, NCALD, NRP2, PBRM1, PTPRM, SLC24A3, SORCS2, SPOCK1, SYNDIG1 and TMEM132B) as diabetes-related from those found to be significant in this study.

…22 genes (ARHGAP42,CA10, CACNA2D3, CGNL1, CLIC5,…

Show Full Abstract

Type 2 diabetes (T2D) is a complex metabolic derangement that has a strong genetic basis. There is substantial population-specificity in the association of genetic variants with T2D. The Indian urban Sindhi population is at a high risk of T2D. The genetic basis of T2D in this population is unknown. We interrogated 28 pooled whole blood genomes of 1402 participants from the Diabetes In Sindhi Families In Nagpur (DISFIN) study using Illumina's Global Screening Array. From a total of 608,550 biallelic variants, 140 were significantly associated with T2D after adjusting for comorbidities, batch effects, pooling error, kinship status and pooling variation in a random effects multivariable logistic regression framework. Of the 102 well-characterized genes that these variants mapped onto, 70 genes have been previously reported to be associated with T2D to varying degrees with known functional relevance. Excluding open reading frames, intergenic non-coding elements and pseudogenes, our study identified 22 novel candidate genes in the Sindhi population studied. Our study thus points to the potential, interesting candidate genes associated with T2D in an ethnically endogamous population. These candidate genes need to be fully investigated in future studies.

Also flagged:AntibodypraziquantelschistosomiasisnanoliposomesNLPtropical diseases
Journal Article 2022-07-22 ✓ 1 Snippet Adekiya TA, Kumar P, Kondiah PPD, Choonara YE.
In-Text Gene Mentions

Praziquantel, phospholipids (Asolectin from soybean), cholesterol (CHOL), phosphatidylethanolamine distearoyl methoxypolyethleneglycol conjugate (DSPE-mPEG2000COOH), N-hydroxysulfosuccinimide (NHS), N,N′ -dicyclohexylcarbodiimide (DCC), and 49,409 Atto 488 Phalloidin and Biochemical assays (AST, ALT, ALP, bilirubin, and creatinine) kits were purchased from Sigma-Aldrich (St.

Show Full Abstract

This study employed nanotechnological techniques to design and develop a praziquantel nanoliposomal (NLP) system and surface-functionalized the NLP with anti-calpain antibody (anti-calpain-NLP) for targeted praziquantel (PZQ) delivery in the treatment of schistosomiasis. Anti-calpain-NLPs were prepared and validated for their physicochemical parameters, in vitroand in vivotoxicity, drug entrapment efficiency (DEE), drug loading capacity (DLC), drug release, and parasitological cure rate. The particle sizes for the formulated nanoliposomes ranged from 88.3 to 92.7 nm (PDI = 0.17-0.35), and zeta potential ranged from -20.2 to -31.9 mV. The DLC and DEE ranged from 9.03 to 14.16 and 92.07 to 94.63, respectively. The functionalization of the nanoliposome surface was stable, uniform, and spherical. Fourier-transform infrared (FTIR), thermal behavior and X-ray powder diffraction (XRPD) analysis confirmed that the anti-calpain antibody and PZQ were attached to the surface and the nanoliposomes inner core, respectively. The drug sustained release was shown to be 93.2 and 91.1% within 24 h for NLP and anti-calpain-NLP, respectively. In thein vitroanalysis study, the nanoliposome concentrations range of 30 to 120 μg/mL employed revealed acceptable levels of cell viability, with no significant cytotoxic effects on RAW 264.7 murine macrophage as well as 3T3 human fibroblast cells. Biochemical markers and histopathological analysis showed that the formulated nanoliposomes present no or minimal oxidative stress and confer hepatoprotective effects on the animals. <b>The cure rate of the anti-calpain-NLP and PZQ was assessed by parasitological analysis</b><b>,</b> <b>and it was discovered that treatment with 250 mg/kg anti-calpain-NLP demonstrated greater activity on the total worm burden, and ova count for both the juvenile and adult schistosomes in the intestine and liver of infected mice.</b> The findings so obtained supported the ability of oral anti-calpain-NLP to target young and adult schistosomes in the liver and porto-mesenteric locations, resulting in improved effectiveness of PZQ.

Also flagged:Hydroxyapatitesynthesiscell proliferationcrystallitecalcium phosphatemineral
Journal Article 2022-07-22 No Snippets Cursaru LM, Iota M, Piticescu RM, Tarnita D, Savu SV, Savu ID, Dumitrescu G, Popescu D, Hertzog RG, Calin M.
Show Full Abstract

The aim of this work is to study the physical-chemical, mechanical, and biocompatible properties of hydroxyapatite obtained by hydrothermal synthesis, at relatively low temperatures and high pressures, starting from natural sources (Rapana whelk shells), knowing that these properties influence the behavior of nanostructured materials in cells or tissues. Thus, hydroxyapatite nanopowders were characterized by chemical analysis, Fourier-transform infrared spectroscopy (FT-IR), dynamic light scattering (DLS), scanning electron microscopy (SEM), and X-ray diffraction (XRD). In vitro studies on osteoblast cell lines (cytotoxicity and cell proliferation), as well as preliminary mechanical tests, have been performed. The results showed that the obtained powders have a crystallite size below 50 nm and particle size less than 100 nm, demonstrating that hydrothermal synthesis led to hydroxyapatite nanocrystalline powders, with a Ca:P ratio close to the stoichiometric ratio and a controlled morphology (spherical particle aggregates). The tensile strength of HAp samples sintered at 1100 °C/90 min varies between 37.6-39.1 N/mm<sup>2</sup>. HAp samples sintered at 1300 °C/120 min provide better results for the investigated mechanical properties. The coefficient of friction has an appropriate value for biomechanical applications. The results of cell viability showed that the cytotoxic effect is low for all tested samples. Better cell proliferation is observed for osteoblasts grown on square samples.

Also flagged:Multiple SclerosisMSneurodegenerative demyelinating disorder of themyelinpathogenesisvitamin D
Journal Article 2022-07-22 ✓ 1 Snippet Vakrakou AG, Alexaki A, Brinia ME, Anagnostouli M, Stefanis L, Stathopoulos P.
In-Text Gene Mentions

Moreover, in 95 patients with MS, gene expression levels from blood autophagy-related genes (ATG16L2, ATG9A, BCL2, FAS, GAA, HGS, PIK3R1, RAB24, RGS19, ULK1, FOXO1, HTT) were significantly altered (false discovery rate < 0.05, either up or downregulated) compared to healthy individuals [76].

Show Full Abstract

This article recapitulates the evidence on the role of mammalian targets of rapamycin (mTOR) complex pathways in multiple sclerosis (MS). Key biological processes that intersect with mTOR signaling cascades include autophagy, inflammasome activation, innate (e.g., microglial) and adaptive (B and T cell) immune responses, and axonal and neuronal toxicity/degeneration. There is robust evidence that mTOR inhibitors, such as rapamycin, ameliorate the clinical course of the animal model of MS, experimental autoimmune encephalomyelitis (EAE). New, evolving data unravel mechanisms underlying the therapeutic effect on EAE, which include balance among T-effector and T-regulatory cells, and mTOR effects on myeloid cell function, polarization, and antigen presentation, with relevance to MS pathogenesis. Radiologic and preliminary clinical data from a phase 2 randomized, controlled trial of temsirolimus (a rapamycin analogue) in MS show moderate efficacy, with significant adverse effects. Large clinical trials of indirect mTOR inhibitors (metformin) in MS are lacking; however, a smaller prospective, non-randomized study shows some potentially promising radiological results in combination with ex vivo beneficial effects on immune cells that might warrant further investigation. Importantly, the study of mTOR pathway contributions to autoimmune inflammatory demyelination and multiple sclerosis illustrates the difficulties in the clinical application of animal model results. Nevertheless, it is not inconceivable that targeting metabolism in the future with cell-selective mTOR inhibitors (compared to the broad inhibitors tried to date) could be developed to improve efficacy and reduce side effects.

Also flagged:deathferroptosisironlipid oxidemetabolismglutathione peroxidase 4
Journal Article 2022-07-22 No Snippets Li J, Jia B, Cheng Y, Song Y, Li Q, Luo C.
Show Full Abstract

With the acceleration of population aging, nervous system diseases including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), anxiety, depression, stroke, and traumatic brain injury (TBI) have become a huge burden on families and society. The mechanism of neurological disorders is complex, which also lacks effective treatment, so relevant research is required to solve these problems urgently. Given that oxidative stress-induced lipid peroxidation eventually leads to ferroptosis, both oxidative stress and ferroptosis are important mechanisms causing neurological disorders, targeting mediators of oxidative stress and ferroptosis have become a hot research direction at present. Our review provides a current view of the mechanisms underlying ferroptosis and oxidative stress participate in neurological disorders, the potential application of molecular mediators targeting ferroptosis and oxidative stress in neurological disorders. The target of molecular mediators or agents of oxidative stress and ferroptosis associated with neurological disorders, such as reactive oxygen species (ROS), nuclear factor erythroid 2-related factor-antioxidant response element (Nrf2-ARE), n-acetylcysteine (NAC), Fe<sup>2+</sup>, NADPH, and its oxidases NOX, has been described in this article. Given that oxidative stress-induced ferroptosis plays a pivotal role in neurological disorders, further research on the mechanisms of ferroptosis caused by oxidative stress will help provide new targets for the treatment of neurological disorders.

Also flagged:leucoencephalopathylactateLBSL
Journal Article 2022-07-22 ✓ 2 Snippets Zhang A, Lu J, Xiao F.
In-Text Gene Mentions

…commonly induced byDARS2abnormalities and accompanied…

…biallelic mutations inDARS2.…

Show Full Abstract

Leucoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL) is commonly induced by DARS2 abnormalities and accompanied by slowly progressing pyramidal and cerebellar dysfunction, as well as concomitant dorsal column dysfunction. In this study, an LBSL induced pluripotent stem cell (iPSC) line was generated from peripheral blood mononuclear cells of a female patient carrying biallelic mutations in DARS2. Pluripotency, differentiation potential, and karyotypic normality of this cell line were confirmed. This iPSC line offers a useful cellular model to investigate LBSL phenotypes, mechanisms, and therapy.

Iron status of blood donors.

Also flagged:Ironiron deficiencyanemiaHemoglobinIDrestless leg syndrome
Journal Article 2022-07-22 No Snippets Spencer BR, Mast AE.
Show Full Abstract

<h4>Purpose of review</h4>This review examines recent research on the prevalence and importance of iron deficiency in blood donors, and on efforts to mitigate it.<h4>Recent findings</h4>Premenopausal females, teenagers, and high-frequency donors are at the highest risk for donation-induced iron deficiency, in both high-resource and low-resource settings. The physiology relating iron stores to hemoglobin levels and low hemoglobin deferral is well elucidated in blood donor populations, yet the clinical effects attributable to iron loss in the absence of anemia are challenging to identify. Expanded adoption of ferritin testing is improving donor management but may cause decreases in the blood supply from temporary donor loss. The potential for personalized donor management is emerging with development of computational models that predict individual interdonation intervals that aim to optimize blood collected from each donor while minimizing low hemoglobin deferrals.<h4>Summary</h4>Measures to reduce iron deficiency are available that can be deployed on a standardized or, increasingly, personalized basis. Blood centers, regulators, and donors should continue to evaluate different tactics for addressing this problem, to obtain a balanced approach that is optimal for maintaining adequate collections while safeguarding donor health.

Also flagged:cytoplasmic granulesantigen presentationcytokineimmune responsesinfectionsautoimmune disorders
Journal Article 2022-07-22 No Snippets Höglund J, Hadizadeh F, Ek WE, Karlsson T, Johansson Å.
Show Full Abstract

Eosinophils play important roles in the release of cytokine mediators in response to inflammation. Many associations between common genetic variants and eosinophils have already been reported, using single nucleotide polymorphism (SNP) array data. Here, we have analyzed 200,000 whole-exome sequences (WES) from the UK Biobank cohort and performed gene-based analyses of eosinophil count. We defined five different variant weighting schemes to incorporate information on both deleteriousness and frequency. A total of 220 genes in 55 distinct (>10 Mb apart) genomic regions were found to be associated with eosinophil count, of which seven genes (<i>ALOX15</i>, <i>CSF2RB</i>, <i>IL17RA</i>, <i>IL33</i>, <i>JAK2</i>, <i>S1PR4</i>, and <i>SH2B3</i>) are driven by rare variants, independent of common variants identified in genome-wide association studies. Two additional genes, <i>NPAT</i> and <i>RMI1</i>, have not been associated with eosinophil count before and are considered novel eosinophil loci. These results increase our knowledge about the effect of rare variants on eosinophil count, which can be of great value for further identification of therapeutic targets.

Also flagged:TIE-2Angiopoietin 2cancersANGPT2melanomaPD-L1
Journal Article 2022-07-22 ✓ 1 Snippet Marguier A, Laheurte C, Lecoester B, Malfroy M, Boullerot L, Renaudin A, Seffar E, Kumar A, Nardin C, Aubin F, Adotevi O.
In-Text Gene Mentions

…Junction, NJ, USA;DCC-2036), 50 nM of…

Show Full Abstract

Myeloid-derived suppressor cells (MDSCs) are a heterogeneous group of immune suppressive cells detected in several human cancers. In this study, we investigated the features and immune suppressive function of a novel subset of monocytic MDSC overexpressing TIE-2 (TIE-2<sup>+</sup> M-MDSC), the receptor for the pro-angiogenic factor angiopoietin 2 (ANGPT2). We showed that patients with melanoma exhibited a higher circulating rate of TIE-2<sup>+</sup> M-MDSCs, especially in advanced stages, as compared to healthy donors. The distribution of the TIE-2<sup>+</sup> M-MDSC rate toward the melanoma stage correlated with the serum level of ANGPT2. TIE-2<sup>+</sup> M-MDSC from melanoma patients overexpressed immune suppressive molecules such as PD-L1, CD73, TGF-β, and IL-10, suggesting a highly immunosuppressive phenotype. The exposition of these cells to ANGPT2 increased the expression of most of these molecules, mainly Arginase 1. Hence, we observed a profound impairment of melanoma-specific T-cell responses in patients harboring high levels of TIE-2<sup>+</sup> M-MDSC along with ANGPT2. This was confirmed by <i>in vitro</i> experiments indicating that the addition of ANGPT2 increased the ability of TIE-2<sup>+</sup> M-MDSC to suppress antitumor T-cell function. Furthermore, by using TIE-2 kinase-specific inhibitors such as regorafenib or rebastinib, we demonstrated that an active TIE-2 signaling was required for optimal suppressive activity of these cells after ANGPT2 exposition. Collectively, these results support that TIE-2<sup>+</sup> M-MDSC/ANGPT2 axis represents a potential immune escape mechanism in melanoma.

Also flagged:brainalcoholdrug abusesynaptogenesisamphetaminecocaine
Journal Article 2022-07-22 ✓ 5 Snippets Vázquez-Ágredos A, Gámiz F, Gallo M.
In-Text Gene Mentions

…in colorectal cancer (DCC) which is involved…

DCC receptorsreceptors within mesolimbic…

…the Netrin-1 receptorDCC.…

…authors demonstrate thatDCCis the relevant…

…amphetamine dose inDCCand Netrin-1 expression.…

Show Full Abstract

Adolescence is a late developmental period marked by pronounced reorganization of brain networks in which epigenetic mechanisms play a fundamental role. This brain remodeling is associated with a peculiar behavior characterized by novelty seeking and risky activities such as alcohol and drug abuse, which is associated with increased susceptibility to stress. Hence, adolescence is a vulnerable postnatal period since short- and long-term deleterious effects of alcohol drinking and drug abuse are a serious worldwide public health concern. Among several other consequences, it has been proposed that exposure to stress, alcohol, or other drugs disrupts epigenetic mechanisms mediated by small non-coding microRNAs (miRNAs). During adolescence, this modifies the expression of a variety of genes involved in neurodevelopmental processes such as proliferation, differentiation, synaptogenesis, neural plasticity, and apoptosis. Hence, the effect of miRNAs dysregulation during adolescence might contribute to a long-term impact on brain function. This systematic review focuses on the miRNA expression patterns in the adolescent rodent brain with special interest in the impact of stress and drugs such as amphetamine, cocaine, nicotine, cannabis, and ketamine. The results point to a relevant and complex role of miRNAs in the regulation of the molecular processes involved in adolescent brain development as part of a dynamic epigenetic network sensitive to environmental events with distinctive changes across adolescence. Several miRNAs have been assessed evidencing changing expression profiles during the adolescent transition which are altered by exposure to stress and drug abuse. Since this is an emerging rapidly growing field, updating the present knowledge will contribute to improving our understanding of the epigenetic regulation mechanisms involved in the neurodevelopmental changes responsible for adolescent behavior. It can be expected that increased knowledge of the molecular mechanisms mediating the effect of environmental threats during the adolescent critical developmental period will improve understanding of psychiatric and addictive disorders emerging at this stage.

Also flagged:tumorlung adenocarcinomaLUADCTLA4metformincisplatin
Journal Article 2022-07-22 ✓ 1 Snippet Xu C, Song L, Yang Y, Liu Y, Pei D, Liu J, Guo J, Liu N, Li X, Liu Y, Li X, Yao L, Kang Z.
In-Text Gene Mentions

…genes (such asTNFSF4and TNFRSF9 )…

Show Full Abstract

<h4>Background</h4>Numerous studies have found that infiltrating M2 macrophages play an important role in the tumor progression of lung adenocarcinoma (LUAD). However, the roles of M2 macrophage infiltration and M2 macrophage-related genes in immunotherapy and clinical outcomes remain obscure.<h4>Methods</h4>Sample information was extracted from TCGA and GEO databases. The TIME landscape was revealed using the CIBERSORT algorithm. Weighted gene co-expression network analysis (WGCNA) was used to find M2 macrophage-related gene modules. Through univariate Cox regression, lasso regression analysis, and multivariate Cox regression, the genes strongly associated with the prognosis of LUAD were screened out. Risk score (RS) was calculated, and all samples were divided into high-risk group (HRG) and low-risk group (LRG) according to the median RS. External validation of RS was performed using GSE68571 data information. Prognostic nomogram based on risk signatures and other clinical information were constructed and validated with calibration curves. Potential associations of tumor mutational burden (TMB) and risk signatures were analyzed. Finally, the potential association of risk signatures with chemotherapy efficacy was investigated using the pRRophetic algorithm.<h4>Results</h4>Based on 504 samples extracted from TCGA database, 183 core genes were identified using WGCNA. Through a series of screening, two M2 macrophage-related genes (<i>GRIA1</i> and <i>CLEC3B</i>) strongly correlated with LUAD prognosis were finally selected. RS was calculated, and prognostic risk nomogram including gender, age, T, N, M stage, clinical stage, and RS were constructed. The calibration curve shows that our constructed model has good performance. HRG patients were suitable for new ICI immunotherapy, while LRG was more suitable for CTLA4-immunosuppressive therapy alone. The half-maximal inhibitory concentrations (IC50) of the four chemotherapeutic drugs (metformin, cisplatin, paclitaxel, and gemcitabine) showed significant differences in HRG/LRG.<h4>Conclusions</h4>In conclusion, a comprehensive analysis of the role of M2 macrophages in tumor progression will help predict prognosis and facilitate the advancement of therapeutic techniques.

Also flagged:MAP/microtubule affinity-regulating kinase 4MARK4neuronal migrationmicrotubulecell cyclecancers
Journal Article 2022-07-22 ✓ 2 Snippets Ahmed S, Mobashir M, Al-Keridis LA, Alshammari N, Adnan M, Abid M, Hassan MI.
In-Text Gene Mentions

…MTOR, VDAC2, MYH10,ARFGEF2, RPTOR, NEDD4, PSMC2,…

…MTOR, VDAC2, MYH10,ARFGEF2, RPTOR, and NEDD4…

Show Full Abstract

MAP/microtubule affinity-regulating kinase 4 (MARK4) is associated with various biological functions, including neuronal migration, cell polarity, microtubule dynamics, apoptosis, and cell cycle regulation, specifically in the G1/S checkpoint, cell signaling, and differentiation. It plays a critical role in different types of cancers. Hepatocellular carcinoma (HCC) is the one of the most common forms of liver cancer caused due to mutations, epigenetic aberrations, and altered gene expression patterns. Here, we have applied an integrated network biology approach to see the potential links of MARK4 in HCC, and subsequently identified potential herbal drugs. This work focuses on the naturally-derived compounds from medicinal plants and their properties, making them targets for potential anti-hepatocellular treatments. We further analyzed the HCC mutated genes from the TCGA database by using cBioPortal and mapped out the MARK4 targets among the mutated list. MARK4 and Mimosin, Quercetin, and Resveratrol could potentially interact with critical cancer-associated proteins. A set of the hepatocellular carcinoma altered genes is directly the part of infection, inflammation, immune systems, and cancer pathways. Finally, we conclude that among all these drugs, Gingerol and Fisetin appear to be the highly promising drugs against MARK4-based targets, followed by Quercetin, Resveratrol, and Apigenin.

Also flagged:Eosinophiltumorbladder urothelial carcinomaBLCACLEC2DBladder Urothelial Cancer
Journal Article 2022-07-22 ✓ 1 Snippet Xu C, Song L, Peng H, Yang Y, Liu Y, Pei D, Guo J, Liu N, Liu J, Li X, Li C, Kang Z.
In-Text Gene Mentions

…genes ( TNFSF9,TNFSF4, TNFRSF8 ) were…

Show Full Abstract

<b>Background:</b> Numerous studies have shown that infiltrating eosinophils play a key role in the tumor progression of bladder urothelial carcinoma (BLCA). However, the roles of eosinophils and associated hub genes in clinical outcomes and immunotherapy are not well known. <b>Methods:</b> BLCA patient data were extracted from the TCGA database. The tumor immune microenvironment (TIME) was revealed by the CIBERSORT algorithm. Candidate modules and hub genes associated with eosinophils were identified by weighted gene co-expression network analysis (WGCNA). The external GEO database was applied to validate the above results. TIME-related genes with prognostic significance were screened by univariate Cox regression analysis, lasso regression, and multivariate Cox regression analysis. The patient's risk score (RS) was calculated and divided subjects into high-risk group (HRG) and low-risk group (LRG). The nomogram was developed based on the risk signature. Models were validated <i>via</i> receiver operating characteristic (ROC) curves and calibration curves. Differences between HRG and LRG in clinical features and tumor mutational burden (TMB) were compared. The Immune Phenomenon Score (IPS) was calculated to estimate the immunotherapeutic significance of RS. Half-maximal inhibitory concentrations (IC50s) of chemotherapeutic drugs were predicted by the pRRophetic algorithm. <b>Results:</b> 313 eosinophil-related genes were identified by WGCNA. Subsequently, a risk signature containing 9 eosinophil-related genes (<i>AGXT, B3GALT2, CCDC62, CLEC1B, CLEC2D, CYP19A1, DNM3, SLC5A9, SLC26A8</i>) was finally developed <i>via</i> multiplex analysis and screening. Age (<i>p</i> < 0.001), grade (<i>p</i> < 0.001), and RS (<i>p</i> < 0.001) were independent predictors of survival in BLCA patients. Based on the calibration curve, our risk signature nomogram was confirmed as a good predictor of BLCA patients' prognosis at 1, 3, and 5 years. The association analysis of RS and immunotherapy indicated that low-risk patients were more credible for novel immune checkpoint inhibitors (ICI) immunotherapy. The chemotherapeutic drug model suggests that RS has an effect on the drug sensitivity of patients. <b>Conclusions:</b> In conclusion, the eosinophil-based RS can be used as a reliable clinical predictor and provide insights into the precise treatment of BLCA.

Also flagged:Coronavirus Disease of 2019COVID-19Severe Acute RespiratorybindingACE2coronavirus disease 2019
Journal Article 2022-07-22 ✓ 1 Snippet Ahmed WS, Philip AM, Biswas KH.
In-Text Gene Mentions

…Additionally, the averageDCCanalysis revealed a…

Show Full Abstract

Coronavirus Disease of 2019 (COVID-19) caused by Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has resulted in a massive health crisis across the globe, with some genetic variants gaining enhanced infectivity and competitive fitness, and thus significantly aggravating the global health concern. In this regard, the recent SARS-CoV-2 alpha, beta, and gamma variants (B.1.1.7, B.1.351, and P.1 lineages, respectively) are of great significance in that they contain several mutations that increase their transmission rates as evident from clinical reports. By the end of March 2021, these variants were accounting for about two-thirds of SARS-CoV-2 variants circulating worldwide. Specifically, the N501Y mutation in the S1 spike receptor binding domain (S1-RBD) of these variants have been reported to increase its affinity for ACE2, although the basis for this is not entirely clear yet. Here, we dissect the mechanism underlying the increased binding affinity of the N501Y mutant for ACE2 using molecular dynamics (MD) simulations of the available ACE2-S1-RBD complex structure (6M0J) and show a prolonged and stable interfacial interaction of the N501Y mutant S1-RBD with ACE2 compared to the wild type S1-RBD. Additionally, we find that the N501Y mutant S1-RBD displays altered dynamics that likely aids in its enhanced interaction with ACE2. By elucidating a mechanistic basis for the increased affinity of the N501Y mutant S1-RBD for ACE2, we believe that the results presented here will aid in developing therapeutic strategies against SARS-CoV-2 including designing of therapeutic agents targeting the ACE2-S1-RBD interaction.

Also flagged:Infantile spasmsISepilepsy disordersepilepsyHDAC4GRM7
Journal Article 2022-07-22 ✓ 2 Snippets Lee S, Jang S, Kim JI, Chae JH, Kim KJ, Lim BC.
In-Text Gene Mentions

…heterozygous variants inCACNA1Eand KMT2E .…

…the ACMG criteria,CACNA1Ec.1807A>C (p.Ile603Leu) of…

Show Full Abstract

Infantile spasms (IS) are a clinically and genetically heterogeneous group of epilepsy disorders in early infancy. The genetic backgrounds of IS have been gradually unraveled along with the increased application of next-generation sequencing (NGS). However, to date, only selected genomic regions have been sequenced using a targeted approach in most cases of IS, and the genetic etiologies of the majority of patients remain unknown. We conducted a proof-of-concept study using whole-genome sequencing (WGS) for the genetic diagnosis of IS. We included 16 patients with IS for this study, and WGS was applied as a first-tier test for genetic diagnosis. In total, we sequenced the whole genomes of 28 participants, including the genomes of six patients, which were sequenced with those of their parents. Among variants identified, we focused on those located in epilepsy or seizure-associated genes. We used two different methods to call relevant large deletions from WGS results. We found pathogenic or likely pathogenic variants in four patients (25.0%); a <i>de novo</i> variant in <i>HDAC4</i>, compound heterozygous variants in <i>GRM7</i>, and heterozygous variants in <i>CACNA1E</i> and <i>KMT2E</i>. We also selected two more candidate variants in <i>SOX5</i> and <i>SHROOM4</i> intronic regions. Although there are currently several difficulties in applying WGS for genetic diagnosis, especially in clinical interpretation of non-coding variants, we believe that developing sequencing technologies would overcome these hurdles in the near future. Considering the vast genetic heterogeneity and the substantial portion of patients with unknown etiologies, further studies using whole genomic approaches are necessary for patients with IS.

Also flagged:PyroptosiscancerCNS diseasesneurodegenerative diseasesstrokemultiple sclerosis
Journal Article 2022-07-22 No Snippets Wu X, Wan T, Gao X, Fu M, Duan Y, Shen X, Guo W.
Show Full Abstract

In addition to its profound implications in the fight against cancer, pyroptosis have important role in the regulation of neuronal injury. Microglia are not only central members of the immune regulation of the central nervous system (CNS), but are also involved in the development and homeostatic maintenance of the nervous system. Under various pathological overstimulation, microglia pyroptosis contributes to the massive release of intracellular inflammatory mediators leading to neuroinflammation and ultimately to neuronal damages. In addition, microglia pyroptosis lead to further neurological damage by decreasing the ability to cleanse harmful substances. The pathogenic roles of microglia in a variety of CNS diseases such as neurodegenerative diseases, stroke, multiple sclerosis and depression, and many other neurological disorders have been gradually unveiled. In the context of different neurological disorders, inhibition of microglia pyroptosis by targeting NOD-like receptor family pyrin domain containing (NLRP) 3, caspase-1 and gasdermins (GSDMs) by various chemical agents as well as natural products significantly improve the symptoms or outcome in animal models. This study will provide new ideas for immunomodulatory treatment of CNS diseases.

Also flagged:neurological disorderschorioretinaloptic nerve anomalydystoniadevelopmental delaymitochondrial
Journal Article 2022-07-22 ✓ 4 Snippets Baker EK, Ulm EA, Belonis A, Brightman DS, Hallinan BE, Leslie ND, Miethke AG, Vawter-Lee M, Wu Y, Pena LDM.
In-Text Gene Mentions

The association between CACNA1E variants and developmental and epileptic encephalopathy was published subsequent to the completion of the patient’s original exome and reported on reanalysis (Helbig et al., 2018).

…heterozygous variant inCACNA1E, NM_001205293.1 :c.1054G >…

…variant in theCACNA1Egene reported during…

…The association betweenCACNA1Evariants and developmental…

Show Full Abstract

Exome sequencing (ES) became clinically available in 2011 and promised an agnostic, unbiased next-generation sequencing (NGS) platform for patients with symptoms believed to have a genetic etiology. The diagnostic yield of ES has been estimated to be between 25-40% and may be higher in specific clinical scenarios. Those who remain undiagnosed may have no molecular findings of interest on ES, variants of uncertain significance in genes that are linked to human disease, or variants of uncertain significance in candidate genes that are not definitively tied to human disease. Recent evidence suggests that a post-exome evaluation consisting of clinical re-phenotyping, functional studies of candidate variants in known genes, and variant reevaluation can lead to a diagnosis in 5-15% of additional cases. In this brief research study, we present our experience on post-exome evaluations in a cohort of patients who are believed to have a genetic etiology for their symptoms. We have reached a full or partial diagnosis in approximately 18% (6/33) of cases that have completed evaluations to date. We accomplished this by utilizing NGS-based methods that are available on a clinical basis. A sample of these cases highlights the utility of ES reanalysis with updated phenotyping allowing for the discovery of new genes, re-adjudication of known variants, incorporating updated phenotypic information, utilizing functional testing such as targeted RNA sequencing, and deploying other NGS-based testing methods such as gene panels and genome sequencing to reach a diagnosis.

Also flagged:CancerglycoproteincalciumglucosephosphorusSTC2
Journal Article 2022-07-22 ✓ 2 Snippets Jiang ZH, Shen X, Wei Y, Chen Y, Chai H, Xia L, Leng W.
In-Text Gene Mentions

STC2 activates ITGB2/FAK/SOX6 and PI3K–AKT signaling pathways in some cancers (Yang et al., 2017; Li et al., 2022).

…STC2 activates ITGB2/FAK/SOX6and PI3K–AKT signaling…

Show Full Abstract

<b>Background:</b> Stanniocalcin-2 (STC2) is a secreted glycoprotein which plays an important role in regulating the homeostasis of calcium, glucose homeostasis, and phosphorus metastasis. Accumulating evidence suggests that STC2 is implicated in cancer mechanisms. However, the effects of STC2 on cancer development and progression across pan-cancer are not yet completely known. <b>Methods:</b> Data were downloaded from The Cancer Genome Atlas database to obtain differentially expressed genes significantly associated with prognosis (key genes). A gene was selected for subsequent correlation studies by integrating the significance of prognosis and the time-dependent ROC curve. Gene expression of different tumor types was analyzed based on the UCSC XENA website. Furthermore, our study investigated the correlation of STC2 expression between prognosis, immune cell infiltration, immune checkpoint genes (ICGs), mismatch repair genes (MMRs), tumor mutation burden (TMB), microsatellite instability (MSI), and drug sensitivity in various malignant tumors. Gene set enrichment analysis (GSEA) was conducted for correlated genes of STC2 to explore potential mechanisms. <b>Results:</b> A total of 3,429 differentially expressed genes and 397 prognosis-related genes were identified from the TCGA database. Twenty-six key genes were found by crossing the former and the latter, and the highest risk gene, STC2, was selected for subsequent correlation studies. STC2 had good diagnostic performance for HNSCC, and was closely related to the survival status and clinicopathological stage of HNSCC patients. In pan-cancer analysis, STC2 was upregulated in 20 cancers and downregulated in seven cancers. STC2 overexpression was overall negatively correlated with overall survival, disease-free survival, disease-specific survival, and progress-free survival. STC2 was profoundly correlated with the tumor immune microenvironment, including immune cell infiltration, ICGs, MMRs, TMB, and MSI. Moreover, STC2 was significantly negatively correlated with the sensitivity or resistance of multiple drugs. <b>Conclusion:</b> STC2 was a potential prognostic biomarker for pan-cancer and a new immunotherapy target.

Also flagged:proteolysiscytosolUPPpathogenesisdipeptideubiquitin
Journal Article 2022-07-22 No Snippets Sikander R, Arif M, Ghulam A, Worachartcheewan A, Thafar MA, Habib S.
Show Full Abstract

The major mechanism of proteolysis in the cytosol and nucleus is the ubiquitin-proteasome pathway (UPP). The highly controlled UPP has an effect on a wide range of cellular processes and substrates, and flaws in the system can lead to the pathogenesis of a number of serious human diseases. Knowledge about UPPs provide useful hints to understand the cellular process and drug discovery. The exponential growth in next-generation sequencing wet lab approaches have accelerated the accumulation of unannotated data in online databases, making the UPP characterization/analysis task more challenging. Thus, computational methods are used as an alternative for fast and accurate identification of UPPs. Aiming this, we develop a novel deep learning-based predictor named "2DCNN-UPP" for identifying UPPs with low error rate. In the proposed method, we used proposed algorithm with a two-dimensional convolutional neural network with dipeptide deviation features. To avoid the over fitting problem, genetic algorithm is employed to select the optimal features. Finally, the optimized attribute set are fed as input to the 2D-CNN learning engine for building the model. Empirical evidence or outcomes demonstrates that the proposed predictor achieved an overall accuracy and AUC (ROC) value using 10-fold cross validation test. Superior performance compared to other state-of-the art methods for discrimination the relations UPPs classification. Both on and independent test respectively was trained on 10-fold cross validation method and then evaluated through independent test. In the case where experimentally validated ubiquitination sites emerged, we must devise a proteomics-based predictor of ubiquitination. Meanwhile, we also evaluated the generalization power of our trained modal <i>via</i> independent test, and obtained remarkable performance in term of 0.862 accuracy, 0.921 sensitivity, 0.803 specificity 0.803, and 0.730 Matthews correlation coefficient (MCC) respectively. Four approaches were used in the sequences, and the physical properties were calculated combined. When used a 10-fold cross-validation, 2D-CNN-UPP obtained an AUC (ROC) value of 0.862 predicted score. We analyzed the relationship between UPP protein and non-UPP protein predicted score. Last but not least, this research could effectively analyze the large scale relationship between UPP proteins and non-UPP proteins in particular and other protein problems in general and our research work might improve computational biological research. Therefore, we could utilize the latest features in our model framework and Dipeptide Deviation from Expected Mean (DDE) -based protein structure features for the prediction of protein structure, functions, and different molecules, such as DNA and RNA.

Also flagged:SOX11transcription factorregionembryogenesisneurogenesisneurodevelopmental disorder
Journal Article 2022-07-22 ✓ 2 Snippets Ding Y, Chen J, Tang Y, Chen LN, Yao RE, Yu T, Yin Y, Wang X, Wang J, Li N.
In-Text Gene Mentions

…SOX5 (OMIM# 604975),SOX6(OMIM# 607257), SOX8…

…SLC19A2 (OMIM#603941), andTNFSF4(OMIM# 603,594) (…

Show Full Abstract

SOX11 is a transcription factor belonging to the sex determining region Y-related high-mobility group box family that plays a vital role in early embryogenesis and neurogenesis. <i>De novo</i> variants in <i>SOX11</i> have been initially reported to cause a rare neurodevelopmental disorder, mainly referred to Coffin-siris syndrome 9 (CSS9, OMIM# 615866) which is characterized with growth deficiency, intellectual disability (ID), microcephaly, coarse facies, and hypoplastic nails of the fifth fingers and/or toes. A recent large-scale cohort study suggests that <i>SOX11</i> variation would result in a clinically and molecularly distinct disease from CSS. Here, we describe three unrelated Chinese cases with variable phenotype, mainly involving developmental delay, ID, short statute, microcephaly, facial deformities (i.e., prominent forehead, arched eye brow, flat nasal bridge, broad nose and short philtrum), and cryptorchidism. Whole-exome sequencing (WES) revealed three novel heterozygous variants in the <i>SOX11</i> gene, including two missense variants of c.337T>C (p.Y113H) and c.425C>G (p.A142G), and one nonsense variant of c.820A>T (p. K142*). Luciferase reporting assay shows that the two missense variants impair the transcriptional activity of the <i>SOX11</i> target gene <i>GDF5</i>. Additionally, WES uncovered a 4,300 kb deletion involving the region of 1q24.2-q25.1 (hg19,chr1:169,433,149-173,827,682) in patient 1, which also contributes to the condition of the patient. In summary, this is the first report of Chinese cases with <i>de novo</i> variants of <i>SOX11</i>. Our study partially supports the previous observation that the phenotype caused by <i>SOX11</i> variants somewhat differs from classical CSS.

Also flagged:Gastric CancertumorAlpha-2 collagen type ICOL1A2tissue inhibitor matrix metalloproteinase 1TIMP1
Journal Article 2022-07-22 ✓ 1 Snippet Yu Z, Liang C, Tu H, Qiu S, Dong X, Zhang Y, Ma C, Li P.
In-Text Gene Mentions

…) showed thatOLFM4, IGF2BP3, CLDN1, and…

Show Full Abstract

<b>Background</b> <b>:</b> Owing to complex molecular mechanisms in gastric cancer (GC) oncogenesis and progression, existing biomarkers and therapeutic targets could not significantly improve diagnosis and prognosis. This study aims to identify the key genes and signaling pathways related to GC oncogenesis and progression using bioinformatics and meta-analysis methods. <b>Methods:</b> Eligible microarray datasets were downloaded and integrated using the meta-analysis method. According to the tumor stage, GC gene chips were classified into three groups. Thereafter, the three groups' differentially expressed genes (DEGs) were identified by comparing the gene data of the tumor groups with those of matched normal specimens. Enrichment analyses were conducted based on common DEGs among the three groups. Then protein-protein interaction (PPI) networks were constructed to identify relevant hub genes and subnetworks. The effects of significant DEGs and hub genes were verified and explored in other datasets. In addition, the analysis of mutated genes was also conducted using gene data from The Cancer Genome Atlas database. <b>Results:</b> After integration of six microarray datasets, 1,229 common DEGs consisting of 1,065 upregulated and 164 downregulated genes were identified. Alpha-2 collagen type I (COL1A2), tissue inhibitor matrix metalloproteinase 1 (TIMP1), thymus cell antigen 1 (THY1), and biglycan (BGN) were selected as significant DEGs throughout GC development. The low expression of ghrelin (GHRL) is associated with a high lymph node ratio (LNR) and poor survival outcomes. Thereafter, we constructed a PPI network of all identified DEGs and gained 39 subnetworks and the top 20 hub genes. Enrichment analyses were performed for common DEGs, the most related subnetwork, and the top 20 hub genes. We also selected 61 metabolic DEGs to construct PPI networks and acquired the relevant hub genes. Centrosomal protein 55 (CEP55) and POLR1A were identified as hub genes associated with survival outcomes. <b>Conclusion:</b> The DEGs, hub genes, and enrichment analysis for GC with different stages were comprehensively investigated, which contribute to exploring the new biomarkers and therapeutic targets.

Also flagged:GlucosinolateGlucosinolatesdegradationallylhydroxybutyl
Journal Article 2022-07-22 No Snippets Hoffmann H, Ott C, Raupbach J, Andernach L, Renz M, Grune T, Hanschen FS.
Show Full Abstract

Glucosinolates are plant secondary metabolites found in cruciferous vegetables (Brassicaceae) that are valued for their potential health benefits. Frequently consumed representatives of these vegetables, for example, are white or red cabbage, which are typically boiled before consumption. Recently, 3-alk(en)yl-4-hydroxythiazolidine-2-thiones were identified as a class of thermal glucosinolate degradation products that are formed during the boiling of cabbage. Since these newly discovered compounds are frequently consumed, this raises questions about their potential uptake and their possible bioactive functions. Therefore, 3-allyl-4-hydroxythiazolidine-2-thione (allyl HTT) and 4-hydroxy-3-(4-(methylsulfinyl) butyl)thiazolidine-2-thione (4-MSOB HTT) as degradation products of the respective glucosinolates sinigrin and glucoraphanin were investigated. After consumption of boiled red cabbage broth, recoveries of consumed amounts of the degradation products in urine collected for 24 h were 18 ± 5% for allyl HTT and 21 ± 4% for 4-MSOB HTT (mean ± SD, <i>n</i> = 3). To investigate the stability of the degradation products during uptake and to elucidate the uptake mechanism, both an <i>in vitro</i> stomach and an <i>in vitro</i> intestinal model were applied. The results indicate that the uptake of allyl HTT and 4-MSOB HTT occurs by passive diffusion. Both compounds show no acute cell toxicity, no antioxidant potential, and no change in NAD(P)H dehydrogenase quinone 1 (NQO1) activity up to 100 μM. However, inhibition of glycogen synthase kinases-3 (GSK-3) in the range of 20% for allyl HTT for the isoform GSK-3β and 29% for 4-MSOB HTT for the isoform GSK-3α at a concentration of 100 μM was found. Neither health-promoting nor toxic effects of 3-alk(en)yl-4-hydroxythiazolidine-2-thiones were found in the four tested assays carried out in this study, which contrasts with the properties of other glucosinolate degradation products, such as isothiocyanates.

Also flagged:deathautophagyautophagosomebindingSTATmetabolism
Journal Article 2022-07-22 ✓ 1 Snippet Fang D, Fang Y, Zhang W, Xiang Y, Cheng X, Liang M, Xia H.
In-Text Gene Mentions

…PRKAG2, SDC1, PBDC1,ECI2, ACE, PEX14, and…

Show Full Abstract

<b>Background:</b> Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-specific complication characterized by pruritus without skin damage and jaundice. The poor perinatal outcomes include fetal distress, preterm birth, and unexpected intrauterine death. However, the mechanism of ICP leading to poor prognosis is still unclear. <b>Methods:</b> We analyzed 10 ICP and 10 normal placental specimens through quantitative proteomics of data-independent acquisition (DIA) to screen and identify differentially expressed proteins. GO, KEGG, COG/KOG, StringDB, InterProScan, Metascape, BioGPS, and NetworkAnalyst databases were used in this study. PITA, miRanda, TargetScan, starBase, and LncBase Predicted <i>v.2</i> were used for constructing a competing endogenous RNA (ceRNA) network. Cytoscape was used for drawing regulatory networks, and cytoHubba was used for screening core nodes. The ICP rat models were used to validate the pathological mechanism. <b>Results:</b> GO, KEGG, and COG/KOG functional enrichment analysis results showed the differentially expressed proteins participated in autophagy, autophagosome formation, cofactor binding, JAK-STAT signaling pathway, and coenzyme transport and metabolism. DisGeNET analysis showed that these differentially expressed proteins were associated with red blood cell disorder and slow progression. We further analyzed first 12 proteins in the upregulated and downregulated differentially expressed proteins and incorporated clinicopathologic parameters. Our results showed HBG1, SPI1, HBG2, HBE1, FOXK1, KRT72, SLC13A3, MBD2, SP9, GPLD1, MYH7, and BLOC1S1 were associated with ICP development. ceRNA network analysis showed that MBD2, SPI1, FOXK1, and SLC13A3 were regulated by multiple miRNAs and lncRNAs. <b>Conclusion:</b> ICP was associated with autophagy. The ceRNA network of MBD2, SPI1, FOXK1, and SLC13A3 was involved in ICP progression, and these core proteins might be potential target.

Also flagged:Hepatocellular carcinomacancerMatrinecholinecreatinevaline
Journal Article 2022-07-22 ✓ 1 Snippet Wang K, Ye X, Yin C, Ren Q, Chen Y, Qin X, Duan C, Lu A, Gao L, Guan D.
In-Text Gene Mentions

…GGT1, AGXT2, andPRDX6( Figure 6…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a complex issue in cancer treatment in the world at present. Matrine is the main active ingredient isolated from <i>Sophora flavescens</i> air and possesses excellent antitumor effects in HCC. However, the specific underlying mechanisms, especially the possible relationships between the anti-HCC effect of matrine and the related metabolic network of HCC, are not yet clear and need further clarification. In this study, an integrative metabolomic-based bioinformatics algorithm was designed to explore the underlying mechanism of matrine on HCC by regulating the metabolic network. Cell clone formation, invasion, and adhesion assay were utilized in HCC cells to evaluate the anti-HCC effect of matrine. A cell metabolomics approach based on LC-MS was used to obtain the differential metabolites and metabolic pathways regulated by matrine. The maximum activity contribution score model was developed and applied to calculate high contribution target genes of matrine, which could regulate a metabolic network based on the coexpression matrix of matrine-regulated metabolic genes and targets. Matrine significantly repressed the clone formation and invasion, enhanced cell-cell adhesion, and hampered cell matrix adhesion in SMMC-7721 cells. Metabolomics results suggested that matrine markedly regulated the abnormal metabolic network of HCC by regulating the level of choline, creatine, valine, spermidine, 4-oxoproline, D-(+)-maltose, L-(-)-methionine, L-phenylalanine, L-pyroglutamic acid, and pyridoxine, which are involved in D-glutamine and D-glutamate metabolism, glycine, serine and threonine metabolism, arginine and proline metabolism, etc. Our proposed metabolomic-based bioinformatics algorithm showed that the regulating metabolic networks of matrine exhibit anti-HCC effects through acting on MMP7, ABCC1, PTGS1, etc. At last, MMP7 and its related target <i>β</i>-catenin were validated. Together, the metabolomic-based bioinformatics algorithm reveals the effects of the regulating metabolic networks of matrine in treating HCC relying on the unique characteristics of the multitargets and multipathways of traditional Chinese medicine.

Also flagged:γ-Phostamsγ-phosphonolactamsphosphorusγ-lactamsoxidessynthesis
Journal Article 2022-07-22 No Snippets Xu J.
Show Full Abstract

γ-Phostams include γ-phosphonolactams and γ-phosphinolactams and their fused derivatives, phosphorus analogues of γ-lactams. They are 1,2-azaphospholidine 2-oxides and 1,2-azaphospholine 2-oxides and important biological five-membered azaphosphaheterocycles. They have been prepared through two major strategies of cyclizations and annulations. Cyclizations achieve ring construction through the formation of any bond in the ring, while annulations build the ring via [4 + 1] and [3 + 2] fashions with the simultaneous formation of two bonds. The review includes the synthesis of 1,2-azaphospholidine and 1,2-azaphospholine 2-oxides/sulfides and their fused derivatives.

Also flagged:lipidmetabolismnucleotidereproductionwatergene expression
Journal Article 2022-07-22 ✓ 3 Snippets Xu NY, Liu ZY, Yang QM, Bian PP, Li M, Zhao X.
In-Text Gene Mentions

HMGN4 can be a promising candidate biomarker for hepatocellular carcinoma (Xia et al., 2019).

…RPS6KA1L , andHMGN4were detected using…

HMGN4can be a…

Show Full Abstract

Climate change, especially weather extremes like extreme cold or extreme hot, is a major challenge for global livestock. One of the animal breeding goals for sustainable livestock production should be to breed animals with excellent climate adaptability. Indigenous livestock and poultry are well adapted to the local climate, and they are good resources to study the genetic footprints and mechanism of the resilience to weather extremes. In order to identify selection signatures and genes that might be involved in hot adaptation in indigenous chickens from different tropical climates, we conducted a genomic analysis of 65 indigenous chickens that inhabit different climates. Several important unique positively selected genes (PSGs) were identified for each local chicken group by the cross-population extended haplotype homozygosity (XP-EHH). These PSGs, verified by composite likelihood ratio, genetic differentiation index, nucleotide diversity, Tajima's D, and decorrelated composite of multiple signals, are related to nerve regulation, vascular function, immune function, lipid metabolism, kidney development, and function, which are involved in thermoregulation and hot adaptation. However, one common PSG was detected for all three tropical groups of chickens via XP-EHH but was not confirmed by other five types of selective sweep analyses. These results suggest that the hot adaptability of indigenous chickens from different tropical climate regions has evolved in parallel by taking different pathways with different sets of genes. The results from our study have provided reasonable explanations and insights for the rapid adaptation of chickens to diverse tropical climates and provide practical values for poultry breeding.

Also flagged:hereditary hemochromatosisHHliver diseasechronic liver diseasemetabolic liver diseaseportal vein thrombosis
Journal Article 2022-07-21 ✓ 1 Snippet Lymberopoulos P, Prakash S, Shaikh A, Bhatnagar A, Allam AK, Goli K, Goss JA, Kanwal F, Rana A, Kowdley KV, Jalal P, George Cholankeril.
In-Text Gene Mentions

HFE

Show Full Abstract

There have been conflicting data regarding liver transplantation (LT) outcomes for hereditary hemochromatosis (HH), with no recent data on LT outcomes in patients with HH in the past decade. Using the United Network for Organ Sharing registry, we evaluated waitlist and post-LT survival in all adult patients listed for HH without concomitant liver disease from 2003 to 2019. Post-LT survival for HH was compared with a propensity-matched (recipient and donor factors) cohort of recipients with chronic liver disease (CLD). From 2003 to 2019, 862 patients with HH were listed for LT, of which 55.6% ( n = 479) patients underwent LT. The 1- and 5-year post-LT survival rates in patients with HH were 88.7% (95% confidence interval [CI], 85.4%-91.4%) and 77.5% (95% CI, 72.8%-81.4%), respectively, and were comparable with those in the propensity-matched CLD cohort ( p value = 0.96). Post-LT survival for HH was lower than for Wilson's disease, another hereditary metabolic liver disease with similar LT volume ( n = 365). Predictors for long-term (5-year) post-LT mortality included presence of portal vein thrombosis (hazard ratio [HR], 1.96; 95% CI, 1.07-3.58), obesity measurements greater than Class II (HR, 1.98; 95% CI, 1.16-3.39), and Karnofsky performance status (HR, 0.98; 95% CI, 0.97-0.99) at the time of LT. The leading cause of post-LT death ( n = 145) was malignancy (25.5%), whereas cardiac disease was the cause in less than 10% of recipients. In conclusion, short- and long-term survival rates for HH are excellent and comparable with those of other LT recipients. Improving extrahepatic metabolic factors and functional status in patients with HH prior to LT may improve outcomes.

Also flagged:major depressive disorderdepressionketamineironthalassemiamonoamine
Journal Article 2022-07-21 ✓ 5 Snippets Uzungil V, Tran H, Aitken C, Wilson C, Opazo CM, Li S, Payet JM, Mawal CH, Bush AI, Hale MW, Hannan AJ, Renoir T.
In-Text Gene Mentions

In contrast, 5-HTT KO mice that were treated with deferiprone prior to swim-stress exposure had a reduction in c-Fos expression in the lateral amygdala, thus reversing the increased neuronal activity of this region following PST exposure.

Meanwhile, in swim stress–exposed mice, 5-HTT KO mice treated with deferiprone had decreased c-Fos expression compared to vehicle treatment (p < 0.05) (Fig. 3a).

It is possible that deferiprone is inhibiting the increase in neuronal activity of the lateral amygdala in the 5-HTT KO mice following swim-stress exposure, resulting in reduced immobility time in the PST.

In subnuclei of the dorsal raphe, a significant stress × genotype × treatment interaction was observed (F(1,47) = 6.24, p < 0.05) with the post hoc test revealing that in behaviourally naive mice, 5-HTT KO mice treated with deferiprone had increased c-Fos expression compared to vehicle-treated mice (p < 0.05) (Fig. 3b).

In addition, as 5-HTT KO mice also have elevated oxidative stress markers [26], it would be important to explore whether deferiprone is also reducing oxidative stress in 5-HTT KO mice.

Show Full Abstract

Depressed individuals who carry the short allele for the serotonin-transporter-linked promotor region of the gene are more vulnerable to stress and have reduced response to first-line antidepressants such as selective serotonin reuptake inhibitors. Since depression severity has been reported to correlate with brain iron levels, the present study aimed to characterise the potential antidepressant properties of the iron chelator deferiprone. Using the serotonin transporter knock-out (5-HTT KO) mouse model, we assessed the behavioural effects of acute deferiprone on the Porsolt swim test (PST) and novelty-suppressed feeding test (NSFT). Brain and blood iron levels were also measured following acute deferiprone. To determine the relevant brain regions activated by deferiprone, we then measured c-Fos expression and applied network-based analyses. We found that deferiprone reduced immobility time in the PST in 5-HTT KO mice and reduced latency to feed in the NSFT in both genotypes, suggesting potential antidepressant-like effects. There was no effect on brain or blood iron levels following deferiprone treatment, potentially indicating an acute iron-independent mechanism. Deferiprone reversed the increase in c-Fos expression induced by swim stress in 5-HTT KO mice in the lateral amygdala. Functional network analyses suggest that hub regions of activity in mice treated with deferiprone include the caudate putamen and prefrontal cortex. The PST-induced increase in network modularity in wild-type mice was not observed in 5-HTT KO mice. Altogether, our data show that the antidepressant-like effects of deferiprone could be acting via an iron-independent mechanism and that these therapeutic effects are underpinned by changes in neuronal activity in the lateral amygdala.

Also flagged:LrbaCas9poreAntibodyGSTamino acid
Journal Article 2022-07-21 ✓ 2 Snippets Hara Y, Ando F, Oikawa D, Ichimura K, Yanagawa H, Sakamaki Y, Nanamatsu A, Fujiki T, Mori S, Suzuki S, Yui N, Mandai S, Susa K, Mori T, Sohara E, Rai T, Takahashi M, Sasaki S, Kagechika H, Tokunaga F, Uchida S.
In-Text Gene Mentions

Aside from LRBA–PKA RIIβ interaction, FMP-API-1/27 only slightly inhibited the AKAP13–PKA RIIα interaction, whereas forskolin inhibited ARFGEF2–PKA RIIα, AKAP12–PKA RIIβ, MSN–PKA RIIβ, OPA1–PKA RIIα, and OPA1–PKA RIIβ interactions (Fig. 6C and SI Appendix, Fig. S10).

…whereas forskolin inhibitedARFGEF2–PKA RIIα, AKAP12–PKA RIIβ,…

Show Full Abstract

Protein kinase A (PKA) directly phosphorylates aquaporin-2 (AQP2) water channels in renal collecting ducts to reabsorb water from urine for the maintenance of systemic water homeostasis. More than 50 functionally distinct PKA-anchoring proteins (AKAPs) respectively create compartmentalized PKA signaling to determine the substrate specificity of PKA. Identification of an AKAP responsible for AQP2 phosphorylation is an essential step toward elucidating the molecular mechanisms of urinary concentration. PKA activation by several compounds is a novel screening strategy to uncover PKA substrates whose phosphorylation levels were nearly perfectly correlated with that of AQP2. The leading candidate in this assay proved to be an AKAP termed lipopolysaccharide-responsive and beige-like anchor protein (LRBA). We found that LRBA colocalized with AQP2 in vivo, and <i>Lrba</i> knockout mice displayed a polyuric phenotype with severely impaired AQP2 phosphorylation. Most of the PKA substrates other than AQP2 were adequately phosphorylated by PKA in the absence of LRBA, demonstrating that LRBA-anchored PKA preferentially phosphorylated AQP2 in renal collecting ducts. Furthermore, the LRBA-PKA interaction, rather than other AKAP-PKA interactions, was robustly dissociated by PKA activation. AKAP-PKA interaction inhibitors have attracted attention for their ability to directly phosphorylate AQP2. Therefore, the LRBA-PKA interaction is a promising drug target for the development of anti-aquaretics.

Also flagged:Heterogeneous nuclear ribonucleoprotein UHNRNPUchromatinorganizationbrain disordersintellectual disability
Journal Article 2022-07-21 ✓ 2 Snippets Sapir T, Kshirsagar A, Gorelik A, Olender T, Porat Z, Scheffer IE, Goldstein DB, Devinsky O, Reiner O.
In-Text Gene Mentions

…gene events (Dcc, Siva1 , and…

…alternative splicing ofDccby NOVA has…

Show Full Abstract

HNRNPU encodes the heterogeneous nuclear ribonucleoprotein U, which participates in RNA splicing and chromatin organization. Microdeletions in the 1q44 locus encompassing HNRNPU and other genes and point mutations in HNRNPU cause brain disorders, including early-onset seizures and severe intellectual disability. We aimed to understand HNRNPU's roles in the developing brain. Our work revealed that HNRNPU loss of function leads to rapid cell death of both postmitotic neurons and neural progenitors, with an apparent higher sensitivity of the latter. Further, expression and alternative splicing of multiple genes involved in cell survival, cell motility, and synapse formation are affected following Hnrnpu's conditional truncation. Finally, we identified pharmaceutical and genetic agents that can partially reverse the loss of cortical structures in Hnrnpu mutated embryonic brains, ameliorate radial neuronal migration defects and rescue cultured neural progenitors' cell death.

Also flagged:bicyclopentanecarboxylic acidsorganohalidespropellaneBCP
Journal Article 2022-07-21 No Snippets Dong W, Yen-Pon E, Li L, Bhattacharjee A, Jolit A, Molander GA.
Show Full Abstract

Strained bicyclic substructures are increasingly relevant in medicinal chemistry discovery research because of their role as bioisosteres. Over the last decade, the successful use of bicyclo[1.1.1]pentane (BCP) as a para-disubstituted benzene replacement has made it a highly valuable pharmacophore. However, various challenges, including limited and lengthy access to useful BCP building blocks, are hampering early discovery research. Here we report a single-step transition-metal-free multi-component approach to synthetically versatile BCP boronates. Radicals derived from commonly available carboxylic acids and organohalides perform additions onto [1.1.1]propellane to afford BCP radicals, which then engage in polarity-matched borylation. A wide array of alkyl-, aryl- and alkenyl-functionalized BCP boronates were easily prepared. Late-stage functionalization performed on natural products and approved drugs proceeded with good efficiency to generate the corresponding BCP conjugates. Various photoredox transformations forging C-C and C-N bonds were demonstrated by taking advantage of BCP trifluoroborate salts derived from the BCP boronates.

Also flagged:PARP1SNAI2BRCApoly (ADP-ribose) polymerasePARPPARPis
Journal Article 2022-07-21 ✓ 1 Snippet Ding X, Zhu Z, Lapek J, McMillan EA, Zhang A, Chung CY, Dubbury S, Lapira J, Firdaus S, Kang X, Gao J, Oyer J, Chionis J, Rollins RA, Li L, Niessen S, Bagrodia S, Zhang L, VanArsdale T.
In-Text Gene Mentions

…TAF5, ILF3, HNRNPU,DARS2and RBMX.…

Show Full Abstract

The synthetic lethal association between BRCA deficiency and poly (ADP-ribose) polymerase (PARP) inhibition supports PARP inhibitor (PARPi) clinical efficacy in BRCA-mutated tumors. PARPis also demonstrate activity in non-BRCA mutated tumors presumably through induction of PARP1-DNA trapping. Despite pronounced clinical response, therapeutic resistance to PARPis inevitably develops. An abundance of knowledge has been built around resistance mechanisms in BRCA-mutated tumors, however, parallel understanding in non-BRCA mutated settings remains insufficient. In this study, we find a strong correlation between the epithelial-mesenchymal transition (EMT) signature and resistance to a clinical PARPi, Talazoparib, in non-BRCA mutated tumor cells. Genetic profiling demonstrates that SNAI2, a master EMT transcription factor, is transcriptionally induced by Talazoparib treatment or PARP1 depletion and this induction is partially responsible for the emerging resistance. Mechanistically, we find that the PARP1 protein directly binds to SNAI2 gene promoter and suppresses its transcription. Talazoparib treatment or PARP1 depletion lifts PARP1-mediated suppression and increases chromatin accessibility around SNAI2 promoters, thus driving SNAI2 transcription and drug resistance. We also find that depletion of the chromatin remodeler CHD1L suppresses SNAI2 expression and reverts acquired resistance to Talazoparib. The PARP1/CHD1L/SNAI2 transcription axis might be therapeutically targeted to re-sensitize Talazoparib in non-BRCA mutated tumors.

Also flagged:mitochondrialNFκBFENIBfamiliar encephalopathyneuroserpininclusion bodies
Journal Article 2022-07-21 ✓ 2 Snippets D'Acunto E, Gianfrancesco L, Serangeli I, D'Orsi M, Sabato V, Guadagno NA, Bhosale G, Caristi S, Failla AV, De Jaco A, Cacci E, Duchen MR, Lupo G, Galliciotti G, Miranda E.
In-Text Gene Mentions

With this system, we have previously shown that G392E NS expression leads to the activation of an antioxidant adaptive response, consisting in the upregulation of several antioxidant genes (Aldh1b1, Apoe, Gpx1, Gstm1, Prdx6, Scara3, Sod2), suggesting that G392E NS cells react to an oxidative insult caused by NS polymers; when challenged with drugs that block the antioxidant protective pathways, by glutathione chelation with DEM and catalase inhibition with 3-amino-1,2,4 triazole, G392E NS neurons die by apoptosis at a higher proportion than control neurons, supporting an increased sensitivity to oxidative stress upon conditions that impair the antioxidant response [17].

…Apoe, Gpx1, Gstm1,Prdx6, Scara3, Sod2), suggesting…

Show Full Abstract

The neurodegenerative condition FENIB (familiar encephalopathy with neuroserpin inclusion bodies) is caused by heterozygous expression of polymerogenic mutant neuroserpin (NS), with polymer deposition within the endoplasmic reticulum (ER) of neurons. We generated transgenic neural progenitor cells (NPCs) from mouse fetal cerebral cortex stably expressing either the control protein GFP or human wild type, polymerogenic G392E or truncated (delta) NS. This cellular model makes it possible to study the toxicity of polymerogenic NS in the appropriated cell type by in vitro differentiation to neurons. Our previous work showed that expression of G392E NS in differentiated NPCs induced an adaptive response through the upregulation of several genes involved in the defence against oxidative stress, and that pharmacological reduction of the antioxidant defences by drug treatments rendered G392E NS neurons more susceptible to apoptosis than control neurons. In this study, we assessed mitochondrial distribution and found a higher percentage of perinuclear localisation in G392E NS neurons, particularly in those containing polymers, a phenotype that was enhanced by glutathione chelation and rescued by antioxidant molecules. Mitochondrial membrane potential and contact sites between mitochondria and the ER were reduced in neurons expressing the G392E mutation. These alterations were associated with a pattern of ER stress that involved the ER overload response but not the unfolded protein response. Our results suggest that intracellular accumulation of NS polymers affects the interaction between the ER and mitochondria, causing mitochondrial alterations that contribute to the neuronal degeneration seen in FENIB patients.

Also flagged:coxsackievirus A10 infectionhand, foot, and mouth diseasepathogenesisviralCV-A10 infectioninfection
Journal Article 2022-07-21 No Snippets Hu Y, Wang L, Zhong M, Zhao W, Wang Y, Song J, Zhang Y.
Show Full Abstract

Coxsackievirus A10 (CV-A10), the causative agent of hand, foot, and mouth disease (HFMD), caused a series of outbreaks in recent years and often leads to neurological impairment, but a clear understanding of the disease pathogenesis and host response remains elusive. Cellular microRNAs (miRNAs), a large family of non-coding RNA molecules, have been reported to be key regulators in viral pathogenesis and virus-host interactions. However, the role of host cellular miRNAs defensing against CV-A10 infection is still obscure. To address this issue, we systematically analyzed miRNA expression profiles in CV-A10-infected 16HBE cells by high-throughput sequencing methods in this study. It allowed us to successfully identify 312 and 278 miRNAs with differential expression at 12 h and 24 h post-CV-A10 infection, respectively. Among these, 4 miRNAs and their target genes were analyzed by RT-qPCR, which confirmed the sequencing data. Gene target prediction and enrichment analysis revealed that the predicted targets of these miRNAs were significantly enriched in numerous cellular processes, especially in regulation of basic physical process, host immune response and neurological impairment. And the integrated network was built to further indicate the regulatory roles of miRNAs in host-CV-A10 interactions. Consequently, our findings could provide a beneficial basis for further studies on the regulatory roles of miRNAs relevant to the host immune responses and neuropathogenesis caused by CV-A10 infection.

Also flagged:urothelial carcinomakidney diseasecancersolid tumorsbladder cancerpathogenesis
Journal Article 2022-07-21 ✓ 3 Snippets Lim LM, Chung WY, Hwang DY, Yu CC, Ke HL, Liang PI, Lin TW, Cheng SM, Huang AM, Kuo HT.
In-Text Gene Mentions

Of these cancer driver genes, 79 were uniquely identified in the UCKT cohort, and 17 of them (BTK, CARD11, ELL, FNBP1, GNAQ, HOXD13, IKZF1, MAX, MLLT10, NTRK3, PAX5, SEPTIN6, SEPTIN9, SH3GL1, SLC34A2, TAL1, and TRAF7) exhibited mutations that occurred in two or more patients (Table 3).

After deleting the genes without amino acid change, only 14 genes (CARD11, FNBP1, GNAQ, HOXD13, IKZF1, MAX, MLLT10, NTRK3, SEPTIN6, SEPTIN9, SH3GL1, SLC34A2, TAL1, and TRAF7) were left.

…, MAX ,MLLT10, NTRK3 ,…

Show Full Abstract

Kidney transplantation is a lifesaving option for patients with end-stage kidney disease. In Taiwan, urothelial carcinoma (UC) is the most common de novo cancer after kidney transplantation (KT). UC has a greater degree of molecular heterogeneity than do other solid tumors. Few studies have explored genomic alterations in UC after KT. We performed whole-exome sequencing to compare the genetic alterations in UC developed after kidney transplantation (UCKT) and in UC in patients on hemodialysis (UCHD). After mapping and variant calling, 18,733 and 11,093 variants were identified in patients with UCKT and UCHD, respectively. We excluded known single-nucleotide polymorphisms (SNPs) and retained genes that were annotated in the Catalogue of Somatic Mutations in Cancer (COSMIC), in the Integrative Onco Genomic cancer mutations browser (IntOGen), and in the Cancer Genome Atlas (TCGA) database of genes associated with bladder cancer. A total of 14 UCKT-specific genes with SNPs identified in more than two patients were included in further analyses. The single-base substitution (SBS) profile and signatures showed a relative high T > A pattern compared to COMSIC UC mutations. Ingenuity pathway analysis was used to explore the connections among these genes. GNAQ, IKZF1, and NTRK3 were identified as potentially involved in the signaling network of UCKT. The genetic analysis of posttransplant malignancies may elucidate a fundamental aspect of the molecular pathogenesis of UCKT.

Also flagged:axontranscription factorsaxonsnucleussynapsesaxonal
Journal Article 2022-07-21 No Snippets Whitney IE, Butrus S, Dyer MA, Rieke F, Sanes JR, Shekhar K.
Show Full Abstract

The development and connectivity of retinal ganglion cells (RGCs), the retina's sole output neurons, are patterned by activity-independent transcriptional programs and activity-dependent remodeling. To inventory the molecular correlates of these influences, we applied high-throughput single-cell RNA sequencing (scRNA-seq) to mouse RGCs at six embryonic and postnatal ages. We identified temporally regulated modules of genes that correlate with, and likely regulate, multiple phases of RGC development, ranging from differentiation and axon guidance to synaptic recognition and refinement. Some of these genes are expressed broadly while others, including key transcription factors and recognition molecules, are selectively expressed by one or a few of the 45 transcriptomically distinct types defined previously in adult mice. Next, we used these results as a foundation to analyze the transcriptomes of RGCs in mice lacking visual experience due to dark rearing from birth or to mutations that ablate either bipolar or photoreceptor cells. 98.5% of visually deprived (VD) RGCs could be unequivocally assigned to a single RGC type based on their transcriptional profiles, demonstrating that visual activity is dispensable for acquisition and maintenance of RGC type identity. However, visual deprivation significantly reduced the transcriptomic distinctions among RGC types, implying that activity is required for complete RGC maturation or maintenance. Consistent with this notion, transcriptomic alternations in VD RGCs significantly overlapped with gene modules found in developing RGCs. Our results provide a resource for mechanistic analyses of RGC differentiation and maturation, and for investigating the role of activity in these processes.

Also flagged:kidney diseasehypertensionchronic kidney diseasegene expressionextracellularvesicles
Journal Article 2022-07-21 ✓ 1 Snippet Surapaneni A, Schlosser P, Zhou L, Liu C, Chatterjee N, Arking DE, Dutta D, Coresh J, Rhee EP, Grams ME.
In-Text Gene Mentions

BTN2A2

Show Full Abstract

Investigations into the causal underpinnings of disease processes can be aided by the incorporation of genetic information. Genetic studies require populations varied in both ancestry and prevalent disease in order to optimize discovery and ensure generalizability of findings to the global population. Here, we report the genetic determinants of the serum proteome in 466 African Americans with chronic kidney disease attributed to hypertension from the richly phenotyped African American Study of Kidney Disease and Hypertension (AASK) study. Using the largest aptamer-based protein profiling platform to date (6,790 proteins or protein complexes), we identified 969 genetic associations with 900 unique proteins; including 52 novel cis (local) associations and 379 novel trans (distant) associations. The genetic effects of previously published cis-protein quantitative trait loci (pQTLs) were found to be highly reproducible, and we found evidence that our novel genetic signals colocalize with gene expression and disease processes. Many trans- pQTLs were found to reflect associations mediated by the circulating cis protein, and the common trans-pQTLs are enriched for processes involving extracellular vesicles, highlighting a plausible mechanism for distal regulation of the levels of secreted proteins. Thus, our study generates a valuable resource of genetic associations linking variants to protein levels and disease in an understudied patient population to inform future studies of drug targets and physiology.

Also flagged:TAF-Iβchaperonesgene expressionhistoneslinker histone isoform H1.10chaperone
Journal Article 2022-07-21 ✓ 1 Snippet Feng H, Zhou BR, Schwieters CD, Bai Y.
In-Text Gene Mentions

linker histones

Show Full Abstract

Linker histone H1, facilitated by its chaperones, plays an essential role in regulating gene expression by maintaining chromatin's higher-order structure and epigenetic state. However, we know little about the structural mechanism of how the chaperones recognize linker histones and conduct their function. Here, we used biophysical and biochemical methods to investigate the recognition of human linker histone isoform H1.10 by the TAF-Iβ chaperone. Both H1.10 and TAF-Iβ proteins consist of folded cores and disordered tails. We found that H1.10 formed a complex with TAF-Iβ in a 2:2 stoichiometry. Using distance restraints obtained from methyl-TROSY NMR and spin labels, we built a structural model for the core region of the complex. In the model, the TAF-Iβ core interacts with the globular domain of H1.10 mainly through electrostatic interactions. We confirmed the interactions by measuring the effects of mutations on the binding affinity. A comparison of our structural model with the chromatosome structure shows that TAF-Iβ blocks the DNA binding sites of H1.10. Our study provides insights into the structural mechanism whereby TAF-Iβ functions as a chaperone by preventing H1.10 from interacting with DNA directly.

Also flagged:cancertumorsmalignant tumorsmalignant tumoramino acidmitochondria
Journal Article 2022-07-21 ✓ 2 Snippets Dunnick JK, Pandiri AR, Shockley KR, Herbert R, Mav D, Phadke D, Shah RR, Merrick BA.
In-Text Gene Mentions

Trim38

Ccpg1

Show Full Abstract

<h4>Background and aims</h4>In this study ten mouse strains representing ~90% of genetic diversity in laboratory mice (B6C3F1/J, C57BL/6J, C3H/HeJ, A/J, NOD.B1oSnH2/J, NZO/HILtJ, 129S1/SvImJ, WSB/EiJ, PWK/PhJ, CAST/EiJ) were examined to identify the mouse strain with the lowest incidence of cancer. The unique single polymorphisms (SNPs) associated with this low cancer incidence are reported.<h4>Methods</h4>Evaluations of cancer incidence in the 10 mouse strains were based on gross and microscopic diagnosis of tumors. Single nucleotide polymorphisms (SNPs) in the coding regions of the genome were derived from the respective mouse strains located in the Sanger mouse sequencing database and the B6C3F1/N genome from the National Toxicology Program (NTP).<h4>Results</h4>The WSB strain had an overall lower incidence of both benign and malignant tumors compared to the other mouse strains. At 2 years, the incidence of total malignant tumors (Poly-3 incidence rate) ranged from 2% (WSB) to 92% (C3H) in males, and 14% (WSB) to 93% (NZO) in females, and the total incidence of benign and malignant tumor incidence ranged from 13% (WSB) to 99% (C3H) in males and 25% (WSB) to 96% (NOD) in females. Single nucleotide polymorphism (SNP) patterns were examined in the following strains: B6C3F1/N, C57BL/6J, C3H/HeJ, 129S1/SvImJ, A/J, NZO/HILtJ, CAST/EiJ, PWK/PhJ, and WSB/EiJ. We identified 7519 SNPs (involving 5751 Ensembl transcripts of 3453 Ensembl Genes) that resulted in a unique amino acid change in the coding region of the WSB strain.<h4>Conclusions</h4>The inherited genetic patterns in the WSB cancer-resistant mouse strain occurred in genes involved in multiple cell functions including mitochondria, metabolic, immune, and membrane-related cell functions. The unique SNP patterns in a cancer resistant mouse strain provides insights for understanding and developing strategies for cancer prevention.

Also flagged:NNMTGliomaTumortumorspolymerasenicotinamide adenine dinucleotide
Journal Article 2022-07-21 ✓ 2 Snippets Sun W, Zou Y, Cai Z, Huang J, Hong X, Liang Q, Jin W.
In-Text Gene Mentions

…vision, Drosophila)-like 2),NEGR1(neural growth regulator…

…Drosophila)-like 2), NEGR1 (neural growth regulator 1growth regulator 1),…

Show Full Abstract

<h4>Purpose</h4>Increasing evidence has revealed that nicotinamide <i>N</i>-methyltransferase (NNMT) is a key factor influencing the prognosis of tumors. The present study aimed to investigate the role of NNMT in glioma and to elucidate the associated functional mechanisms.<h4>Methods</h4>Clinical samples were analyzed by immunohistochemical staining and Western blotting to evaluate NNMT expression in glioma and normal brain tissues. The correlation between NNMT expression and glioma was analyzed using the Cancer Genome Atlas (TCGA) database. Additionally, NNMT was knocked down in two types of glioma cells, U87 and U251, to evaluate the invasive ability of these cells. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to validate NNMT knockdown in the cells. Furthermore, ELISA was used to determine the balance between nicotinamide adenine dinucleotide and nicotinamide adenine dinucleotide hydrogen (NAD/NADH ratio), which verified the altered methylation patterns in the cells. The glioma xenograft mouse models were used to verify the regulatory role of NNMT, GAP43, and SIRT1.<h4>Results</h4>Analysis based on our clinical glioma samples and TCGA database revealed that overexpression of NNMT was associated with poor prognosis of patients. Knockdown of NNMT reduced the invasive ability of glioma cells, and downregulation of its downstream protein GAP43 occurred due to altered cellular methylation caused by NNMT overexpression. Gene Set Enrichment Analysis confirmed that NNMT modulated the NAD-related signaling pathway and showed a negative association between NNMT and SIRT1. Moreover, the regulatory roles of NNMT, GAP43, and SIRT1 were confirmed in glioma xenograft mouse models.<h4>Conclusion</h4>Overexpression of NNMT causes abnormal DNA methylation through regulation of the NAD/NADH ratio, which in turn leads to the downregulation of GAP43 and SIRT1, eventually altering the biological behavior of tumor cells.

Also flagged:Thioredoxinperoxidesoxygencell homeostasisglutathionethioredoxin reductase
Journal Article 2022-07-21 No Snippets Hasan AA, Kalinina E, Tatarskiy V, Shtil A.
Show Full Abstract

Oxidative stress involves the increased production and accumulation of free radicals, peroxides, and other metabolites that are collectively termed reactive oxygen species (ROS), which are produced as by-products of aerobic respiration. ROS play a significant role in cell homeostasis through redox signaling and are capable of eliciting damage to macromolecules. Multiple antioxidant defense systems have evolved to prevent dangerous ROS accumulation in the body, with the glutathione and thioredoxin/thioredoxin reductase (Trx/TrxR) systems being the most important. The Trx/TrxR system has been used as a target to treat cancer through the thiol-disulfide exchange reaction mechanism that results in the reduction of a wide range of target proteins and the generation of oxidized Trx. The TrxR maintains reduced Trx levels using NADPH as a co-substrate; therefore, the system efficiently maintains cell homeostasis. Being a master regulator of oxidation-reduction processes, the Trx-dependent system is associated with cell proliferation and survival. Herein, we review the structure and catalytic properties of the Trx/TrxR system, its role in cellular signaling in connection with other redox systems, and the factors that modulate the Trx system.

Also flagged:IGF1ROsteosarcomabone tumorgene expressionCancerInsulin growth factor receptor 1
Journal Article 2022-07-21 ✓ 1 Snippet Taylor AM, Sun JM, Yu A, Voicu H, Shen J, Barkauskas DA, Triche TJ, Gastier-Foster JM, Man TK, Lau CC.
In-Text Gene Mentions

…studies include 1p31.1 (NEGR1), 8q24.3 and 12q14.1…

Show Full Abstract

Osteosarcoma is a primary malignant bone tumor arising from bone-forming mesenchymal cells in children and adolescents. Despite efforts to understand the biology of the disease and identify novel therapeutics, the survival of osteosarcoma patients remains dismal. We have concurrently profiled the copy number and gene expression of 226 osteosarcoma samples as part of the Strategic Partnering to Evaluate Cancer Signatures (SPECS) initiative. Our results demonstrate the heterogeneous landscape of osteosarcoma in younger populations by showing the presence of genome-wide copy number abnormalities occurring both recurrently among samples and in a high frequency. Insulin growth factor receptor 1 (IGF1R) is a receptor tyrosine kinase which binds IGF1 and IGF2 to activate downstream pathways involved in cell apoptosis and proliferation. We identify prevalent amplification of IGF1R corresponding with increased gene expression in patients with poor survival outcomes. Our results substantiate previously tenuously associated copy number abnormalities identified in smaller datasets (13q34+, 20p13+, 4q35-, 20q13.33-), and indicate the significance of high fibroblast growth factor receptor 2 (FGFR2) expression in distinguishing patients with poor prognosis. FGFR2 is involved in cellular proliferation processes such as division, growth and angiogenesis. In summary, our findings demonstrate the prognostic significance of several genes associated with osteosarcoma pathogenesis.

Also flagged:alcoholic hepatitisAHeubiosislipopolysaccharidealanine aminotransferasegamma-glutamyltranspeptidase
Journal Article 2022-07-21 ✓ 1 Snippet Gupta H, Kim SH, Kim SK, Han SH, Kwon HC, Suk KT.
In-Text Gene Mentions

…ancreatitis, delirium tremens,hemochromatosis, Wilson’s disease, drug-induc…

Show Full Abstract

Gut microbiota performs indispensable functions in the pathophysiology of alcoholic hepatitis (AH). We investigated the effects of Lacticaseibacillus rhamnosus R0011 and Lactobacillus helveticus for gut microbial restoration toward eubiosis in patients with AH. A multicenter, double-blind, and randomized trial was conducted. Probiotics (n = 44) and placebo (n = 45) groups received, during 7 days, L. rhamnosus R0011/L. helveticus R0052 at 120 mg/day and placebo. All patients were hospitalized to ensure abstinence. Liver function, lipopolysaccharide level, and stool analysis were evaluated in patients before and after 7 days of treatment. At baseline, the dominant bacteria were Gram-negative in both groups which decreased after the probiotics treatment and exhibited a significant reduction in lipopolysaccharide level (p < 0.001). The probiotics ameliorated the Child−Pugh scores (p < 0.001). Furthermore, the probiotics group showed a decline in the levels of alanine aminotransferase and gamma-glutamyltranspeptidase (p < 0.05). The probiotics changed the gut microbial composition at various taxonomical levels. The proportion of Bacteroidetes (147%) was increased after 7 days of probiotics supplementation while Proteobacteria (30%) and Fusobacteria (0%) were decreased. Administration of L. rhamnosus R0011 and L. helveticus R0052 conceivably associated with restoration of gut microbiome in AH patients and improved AH by modulating the gut−liver axis.

Also flagged:pathogenesismental disordersmajor depressive disorderglucocorticoidNetrin-1stress-related disorders
Journal Article 2022-07-21 ✓ 4 Snippets Schell G, Roy B, Prall K, Dwivedi Y.
In-Text Gene Mentions

Transfection of IMR-32 cells (human neuroblastoma cell line) with a miR-218 mimic demonstrated the ability of miR-218 to regulate DCC [106].

…and targeting the Netrin-1/DCCsignaling pathway.…

…The Netrin-1/DCCsignaling pathway, along…

…GR signaling or Netrin-1/DCCsignaling [ 110…

Show Full Abstract

Understanding the epigenetic role of microRNAs (miRNAs) has been a critical development in the field of neuropsychiatry and in understanding their underlying pathophysiology. Abnormalities in miRNA expression are often seen as key to the pathogenesis of many stress-associated mental disorders, including major depressive disorder (MDD). Recent advances in omics biology have further contributed to this understanding and expanded the role of miRNAs in networking a diverse array of molecular pathways, which are essentially related to the stress adaptivity of a healthy brain. Studies have highlighted the role of many such miRNAs in causing maladaptive changes in the brain's stress axis. One such miRNA is miR-218, which is debated as a critical candidate for increased stress susceptibility. miR-218 is expressed throughout the brain, notably in the hippocampus and prefrontal cortex (PFC). It is expressed at various levels through life stages, as seen by adolescent and adult animal models. Until now, a minimal number of studies have been conducted on human subjects to understand its role in stress-related abnormalities in brain circuits. However, several studies, including animal and cell-culture models, have been used to understand the impact of miR-218 on stress response and hypothalamic-pituitary-adrenal (HPA) axis function. So far, expression changes in this miRNA have been found to regulate signaling pathways such as glucocorticoid signaling, serotonergic signaling, and glutamatergic signaling. Recently, the developmental role of miR-218 has generated interest, given its increasing expression from adolescence to adulthood and targeting the Netrin-1/DCC signaling pathway. Since miR-218 expression affects neuronal development and plasticity, it is expected that a change in miR-218 expression levels over the course of development may negatively impact the process and make individuals stress-susceptible in adulthood. In this review, we describe the role of miR-218 in stress-induced neuropsychiatric conditions with an emphasis on stress-related disorders.

Also flagged:glaucomavisionscleromalaciascleritisneovascular glaucoma5-fluorouracil
Journal Article 2022-07-21 No Snippets Feldman RM, Chuang AZ, Mansberger SL, Tanna AP, Blieden LS, Bell NP, Gross RL, Pasquale LR, Greenfield DS, Liebmann JM, Weinreb RN, ASSISTS Group.
Show Full Abstract

<h4>Prcis</h4>Short-term overall success rates were high with either SGDD or CPC. However, SGDD was associated with more clinic visits and an increased risk of additional glaucoma surgery. Both treatments were reasonable options for eyes with inadequately controlled IOP after a single GDD.<h4>Purpose</h4>The purpose of this study is to compare the implantation of a second glaucoma drainage device (SGDD) and transscleral cyclophotocoagulation (CPC) in eyes with inadequately controlled intraocular pressure (IOP), despite the presence of a preexisting glaucoma drainage device.<h4>Methods</h4>Patients with inadequately controlled IOP, despite the medical therapy and a preexisting glaucoma drainage device, were enrolled at 14 clinical centers and randomly assigned to treatment with a SGDD or CPC.<h4>Main outcome measures</h4>Surgical failure was defined as: (1) IOP ≤5 mm Hg or >18 mm Hg or <20% reduction below baseline on maximum tolerated topical ocular hypotensive therapy, (2) reoperation for glaucoma, or (3) loss of light perception. The primary outcome measure was overall success with or without adjunctive medical therapy.<h4>Results</h4>Forty-two eyes of 42 participants were randomized to SGDD (n=22) or CPC (n=20). Mean duration of follow-up was 18.6 (±12.1; range: 1.1-38.6) months. The cumulative success rate was 79% for SGDD and 88% for CPC at 1 year ( P =0.63). Although the study was underpowered, no significant differences in IOP, postoperative number of IOP-lowering medications, or adverse events were observed. The number of additional glaucoma surgeries ( P =0.003), office visits during the first 3 months ( P <0.001), and office visits per month after month 3 ( P <0.001) were greater in the SGDD group.<h4>Conclusions</h4>Short-term overall success rates were high with either SGDD or CPC. However, SGDD was associated with more clinic visits and an increased risk of additional glaucoma surgery.

Also flagged:cellulosenanofibersbiopolymernitrogenbiopolymersnanocellulose
Journal Article 2022-07-21 No Snippets Dutta S, Pal S, Panwar P, Sharma RK, Bhutia PL.
Show Full Abstract

Driven by the possibility of precise transformational change in nutrient-enrichment technology to meet global food demand, advanced nutrient delivery strategies have emerged to pave the path toward success for nutrient enrichment in edible parts of crops through bioderived nanocarriers with increased productivity. Slow and controlled release of nutrient carrier materials influences the nutrient delivery rate in soil and in the edible parts of crops with a sluggish nutrient delivery to enhance their availability in roots by minimizing nutrient loss. With a limited understanding of the nutrient delivery mechanism in soil and the edible parts of crops, it is envisaged to introduce nutrient-enrichment technology for nutrient delivery that minimizes environmental impact due to its biodegradable nature. This article attempts to analyze the possible role of the cellulose matrix for nutrient release and the role of cellulose nanocomposites and nanofibers. We have proposed a few cellulose derived biofortificant materials as nutrient carriers, such as (1) nanofibers, (2) polymer-nanocellulose-clay composites, (3) silk-fibroin derived nanocarriers, and (4) carboxymethyl cellulose. An effort is undertaken to describe the research need by linking a biopolymer derived nanocarrier for crop growth regulation and experimental nitrogen release analysis. We have finally provided a perspective on cellulose nanofibers (CNFs) for microcage based nutrient loading ability. This article aims to explain why biopolymer derived nutrient carriers are the alternative candidate for alleviating nutrient deficiency challenges which are involved in focusing the nutrient delivery profile of biopolymers and promising biofortification of crops.

Also flagged:Generalized dystoniaParkinsonismLRRK2
Journal Article 2022-07-21 No Snippets Díaz-Feliz L, Feliz-Feliz C, Del Val J, Ávila-Fernández A, Lorda-Sanchez I, García-Ruiz PJ.
Show Full Abstract

No abstract available.

Also flagged:OncogeneTumornon-small cell lung cancerNSCLCMETLung Cancer
Journal Article 2022-07-21 No Snippets Tsui DCC, Drusbosky LM, Wienke S, Gao D, Bubie A, Barbacioru C, Camidge DR.
Show Full Abstract

<h4>Introduction</h4>Defining clinically relevant MET amplification levels in non-small cell lung cancer (NSCLC) remains challenging. We hypothesize that oncogene overlap and MET amplicon size decline with increase in MET plasma copy number (pCN), thus enriching for MET-dependent states.<h4>Patients and methods</h4>We interrogated cell-free DNA NGS results of 16,782 patients with newly diagnosed advanced NSCLC to identify those with MET amplification as reported using Guardant360. Co-occurring genomic mutations and copy number alterations within each sample were evaluated. An exploratory method of adjusting for tumor fraction was also performed and amplicon size for MET was analyzed when available.<h4>Results</h4>MET amplification was detected in 207 (1.2%) of samples. pCN ranged from 2.1 to 52.9. Of these, 43 (20.8%) had an overlapping oncogenic driver, including 23 (11.1%) METex14 skipping or other MET mutations. The degree of (non-MET) oncogene overlap decreased with increases in pCN. Patients with MET pCN ≥ 2.7 had lower rates of overlapping drivers compared to those with MET pCN < 2.7 (6.1% vs. 16.3%, P = .033). None of the 7 patients with pCN > 6.7 had an overlapping driver. After adjusting for tumor fraction, adjusted pCN (ApCN) was also lower for those with overlapping drivers than those without (median ApCN 4.9 vs. 7.3, P =.024). There was an inverse relationship between amplicon size and pCN.<h4>Conclusions</h4>We propose that a high MET pCN and/or ApCN, together with the absence of overlapping oncogenic drivers and small MET amplicon size, will enrich for patients most likely to derive benefit from MET targeted therapy.

bioRxiv 2022-07-21 Preprint (No Snippets API) Meng X, Navoly G, Giannakopoulou O, Levey D, Koller D, Pathak G, Koen N, Lin K, Rentería ME, Feng Y, Gaziano JM, Stein DJ, Zar HJ, Campbell ML, van Heel DA, Trivedi B, Finer S, McQuillin A, Bass N, Chundru VK, Martin H, Huang QQ, Valkovskaya M, Kuo P, Chen H, Tsai S, Liu Y, Kendler KS, Peterson RE, Cai N, Fang Y, Sen S, Scott L, Burmeister M, Loos R, Preuss M, Actkins KV, Davis LK, Uddin M, Wani A, Wildman D, Ursano RJ, Kessler RC, Kanai M, Okada Y, Sakaue S, Rabinowitz J, Maher B, Uhl G, Eaton W, Cruz-Fuentes CS, Martinez-Levy GA, Campos AI, Millwood IY, Chen Z, Li L, Wassertheil-Smoller S, Jiang Y, Tian C, Martin NG, Mitchell BL, Byrne EM, Wray NR, Awasthi S, Coleman JRI, Ripke S, PGC MDD Working Group, China Kadoorie Biobank Collaborative Group, the 23andMe Research Team, Genes & Health Research Team, Sofer T, Walters RG, Polimanti R, Dunn EC, Stein MB, Gelernter J, Lewis C, Kuchenbaecker K.
Show Full Abstract

Most genome-wide association studies (GWAS) of major depression (MD) have been conducted in samples of European ancestry. Here we report a multi-ancestry GWAS of MD, adding data from 21 studies with 88,316 MD cases and 902,757 controls to previously reported data from individuals of European ancestry. This includes samples of African (36% of effective sample size), East Asian (26%) and South Asian (6%) ancestry and Hispanic/Latinx participants (32%). The multi-ancestry GWAS identified 190 significantly associated loci, 53 of them novel. For previously reported loci from GWAS in European ancestry the power-adjusted transferability ratio was 0.6 in the Hispanic/Latinx group and 0.3 in each of the other groups. Fine-mapping benefited from additional sample diversity: the number of credible sets with ≤5 variants increased from 3 to 12. A transcriptome-wide association study identified 354 significantly associated genes, 205 of them novel. Mendelian Randomisation showed a bidirectional relationship with BMI exclusively in samples of European ancestry. This first multi-ancestry GWAS of MD demonstrates the importance of large diverse samples for the identification of target genes and putative mechanisms.

Also flagged:cancertumorglucosemetabolismtumorspathogenesis
Journal Article 2022-07-20 ✓ 1 Snippet Wu W, Wen K.
In-Text Gene Mentions

…mRNA through theSTAU1-mediated degradation pathway …

Show Full Abstract

As epigenetic regulators, long non‑coding RNAs (lncRNAs) are involved in various important regulatory processes and typically interact with RNA‑binding proteins (RBPs) to exert their core functional effects. An increasing number of studies have demonstrated that lncRNAs can regulate the occurrence and development of cancer through a variety of complex mechanisms and can also participate in tumor glucose metabolism by directly or indirectly regulating the Warburg effect. As one of the metabolic characteristics of tumor cells, the Warburg effect provides a large amount of energy and numerous intermediate products to meet the consumption demands of tumor metabolism, providing advantages for the occurrence and development of tumors. The present review article summarizes the regulatory effects of lncRNAs on the reprogramming of glucose metabolism after interacting with RBPs in tumors. The findings discussed herein may aid in the better understanding of the pathogenesis of malignancies, and may provide novel therapeutic targets, as well as new diagnostic and prognostic markers for human cancers.

Also flagged:FAKfocal adhesionHuntington's diseaseHDneurodegenerative disorderdeath
Journal Article 2022-07-20 ✓ 3 Snippets Lee HN, Hyeon SJ, Kim H, Sim KM, Kim Y, Ju J, Lee J, Wang Y, Ryu H, Seong J.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative disorder caused by a polyglutamine expansion in the protein huntingtin (HTT) [55].

While the final pathological consequence of HD is the neuronal cell death in the striatum region of the brain, it is still unclear how mutant HTT (mHTT) causes synaptic dysfunctions at the early stage and during the progression of HD.

…the protein huntingtin (HTT) [55].…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a polyglutamine expansion in the protein huntingtin (HTT) [55]. While the final pathological consequence of HD is the neuronal cell death in the striatum region of the brain, it is still unclear how mutant HTT (mHTT) causes synaptic dysfunctions at the early stage and during the progression of HD. Here, we discovered that the basal activity of focal adhesion kinase (FAK) is severely reduced in a striatal HD cell line, a mouse model of HD, and the human post-mortem brains of HD patients. In addition, we observed with a FRET-based FAK biosensor [59] that neurotransmitter-induced FAK activation is decreased in HD striatal neurons. Total internal reflection fluorescence (TIRF) imaging revealed that the reduced FAK activity causes the impairment of focal adhesion (FA) dynamics, which further leads to the defect in filopodial dynamics causing the abnormally increased number of immature neurites in HD striatal neurons. Therefore, our results suggest that the decreased FAK and FA dynamics in HD impair the proper formation of neurites, which is crucial for normal synaptic functions [52]. We further investigated the molecular mechanism of FAK inhibition in HD and surprisingly discovered that mHTT strongly associates with phosphatidylinositol 4,5-biphosphate, altering its normal distribution at the plasma membrane, which is crucial for FAK activation [14, 60]. Therefore, our results provide a novel molecular mechanism of FAK inhibition in HD along with its pathological mechanism for synaptic dysfunctions during the progression of HD.

Also flagged:antibodyFNbindingkinasePak1Arl4
Journal Article 2022-07-20 ✓ 2 Snippets Lin MC, Yu CJ, Lee FS.
In-Text Gene Mentions

…of polyQ-expanded Huntingtin (Htt) ( 34 ),…

…reported to reduceHttaggregation via chaperone-like…

Show Full Abstract

The Arl4 small GTPases participate in a variety of cellular events, including cytoskeleton remodeling, vesicle trafficking, cell migration, and neuronal development. Whereas small GTPases are typically regulated by their GTPase cycle, Arl4 proteins have been found to act independent of this canonical regulatory mechanism. Here, we show that Arl4A and Arl4D (Arl4A/D) are unstable due to proteasomal degradation, but stimulation of cells by fibronectin (FN) inhibits this degradation to promote Arl4A/D stability. Proteomic analysis reveals that FN stimulation induces phosphorylation at S143 of Arl4A and at S144 of Arl4D. We identify Pak1 as the responsible kinase for these phosphorylations. Moreover, these phosphorylations promote the chaperone protein HYPK to bind Arl4A/D, which stabilizes their recruitment to the plasma membrane to promote cell migration. These findings not only advance a major mechanistic understanding of how Arl4 proteins act in cell migration but also achieve a fundamental understanding of how these small GTPases are modulated by revealing that protein stability, rather than the GTPase cycle, acts as a key regulatory mechanism.

Also flagged:MST1NAFLDchronic liver diseasesterile 20-like kinase 1nanoparticleinsulin resistance
Journal Article 2022-07-20 No Snippets Li Y, Nie JJ, Yang Y, Li J, Li J, Wu X, Liu X, Chen DF, Yang Z, Xu FJ, Yang Y.
Show Full Abstract

To date, few effective treatments have been licensed for nonalcoholic fatty liver disease (NAFLD), which a kind of chronic liver disease. Mammalian sterile 20-like kinase 1 (MST1) is reported to be involved in the development of NAFLD. Thus, we evaluated the suitability of a redox-unlockable polymeric nanoparticle Hep@PGEA vector to deliver MST1 or siMST1 (HCP/MST1 or HCP/siMST1) for NAFLD therapy. The Hep@PGEA vector can efficiently deliver the condensed functional nucleic acids MST1 or siMST1 into NAFLD-affected mouse liver to upregulate or downregulate MST1 expression. The HCP/MST1 complexes significantly improved liver insulin resistance sensitivity and reduced liver damage and lipid accumulation by the AMPK/SREBP-1c pathway without significant adverse events. Instead, HCP/siMST1 delivery exacerbates the NAFLD. The analysis of NAFLD patient samples further clarified the role of MST1 in the development of hepatic steatosis in patients with NAFLD. The MST1-based gene intervention is of considerable potential for clinical NAFLD therapy, and the Hep@PGEA vector provides a promising option for NAFLD gene therapy.

Also flagged:Galectin-3pattern recognition receptorsTLR4TREM2microglia activationlectin
Journal Article 2022-07-20 No Snippets García-Revilla J, Boza-Serrano A, Espinosa-Oliva AM, Soto MS, Deierborg T, Ruiz R, de Pablos RM, Burguillos MA, Venero JL.
Show Full Abstract

The advent of high-throughput single-cell transcriptomic analysis of microglia has revealed different phenotypes that are inherently associated with disease conditions. A common feature of some of these activated phenotypes is the upregulation of galectin-3. Representative examples of these phenotypes include disease-associated microglia (DAM) and white-associated microglia (WAM), whose role(s) in neuroprotection/neurotoxicity is a matter of high interest in the microglia community. In this review, we summarise the main findings that demonstrate the ability of galectin-3 to interact with key pattern recognition receptors, including, among others, TLR4 and TREM2 and the importance of galectin-3 in the regulation of microglia activation. Finally, we discuss increasing evidence supporting the involvement of this lectin in the main neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, traumatic brain injury, and stroke.

Also flagged:protein pligbrightCirclinghowsim
Journal Article 2022-07-20 No Snippets Wang S, Atkinson GRS, Hayes WB.
Show Full Abstract

Topological network alignment aims to align two networks node-wise in order to maximize the observed common connection (edge) topology between them. The topological alignment of two protein-protein interaction (PPI) networks should thus expose protein pairs with similar interaction partners allowing, for example, the prediction of common Gene Ontology (GO) terms. Unfortunately, no network alignment algorithm based on topology alone has been able to achieve this aim, though those that include sequence similarity have seen some success. We argue that this failure of topology alone is due to the sparsity and incompleteness of the PPI network data of almost all species, which provides the network topology with a small signal-to-noise ratio that is effectively swamped when sequence information is added to the mix. Here we show that the weak signal can be detected using multiple stochastic samples of "good" topological network alignments, which allows us to observe regions of the two networks that are robustly aligned across multiple samples. The resulting network alignment frequency (NAF) strongly correlates with GO-based Resnik semantic similarity and enables the first successful cross-species predictions of GO terms based on topology-only network alignments. Our best predictions have an AUPR of about 0.4, which is competitive with state-of-the-art algorithms, even when there is no observable sequence similarity and no known homology relationship. While our results provide only a "proof of concept" on existing network data, we hypothesize that predicting GO terms from topology-only network alignments will become increasingly practical as the volume and quality of PPI network data increase.

Also flagged:OctacalciumphosphatecalciumOCPcalcium phosphatecarboxylate ions
Journal Article 2022-07-20 No Snippets Yokoi T, Shimabukuro M, Kawashita M.
Show Full Abstract

Octacalcium phosphate (OCP) belongs to a family of calcium phosphate compounds. OCP has unique crystal-chemical properties; among calcium phosphate compounds, only OCP can incorporate carboxylate ions into its crystal lattice. An OCP with incorporated carboxylate ions is called an OCP carboxylate (OCPC). OCPCs are investigated for applications in novel adsorbents, electrochemical devices, and biomaterials. Several wet methods are available for the synthesis of OCPCs, and the characteristics and advantages of each method are explained. Representative characterization methods, i.e. X-ray diffraction and Fourier transform infrared spectroscopy, used for the detection of carboxylate ion incorporation into the OCP interlayers are explained. Various carboxylic acids can be incorporated into OCP, and these types of carboxylic acid are presented with reference to the latest research results. The incorporation of carboxylate ions into OCP represents a modification of the OCP crystal at the molecular level and can impart various functions. Challenging physicochemical and biomaterial applications of OCPCs are thus introduced, although they are still in the research phase. Finally, future perspectives and challenges for OCPC research are described.

Also flagged:Aflatoxin B1AFB1inflammatory responsemetabolismcancertranslational
Journal Article 2022-07-20 ✓ 1 Snippet Iori S, Pauletto M, Bassan I, Bonsembiante F, Gelain ME, Bardhi A, Barbarossa A, Zaghini A, Dacasto M, Giantin M.
In-Text Gene Mentions

…subunit alpha1 E (CACNA1E) showed an opposite…

Show Full Abstract

Aflatoxin B1 (AFB1) is a food contaminant metabolized mostly in the liver and leading to hepatic damage. Livestock species are differently susceptible to AFB1, but the underlying mechanisms of toxicity have not yet been fully investigated, especially in ruminants. Thus, the aim of the present study was to better characterize the molecular mechanism by which AFB1 exerts hepatotoxicity in cattle. The bovine fetal hepatocyte cell line (BFH12) was exposed for 48 h to three different AFB1 concentrations (0.9 µM, 1.8 µM and 3.6 µM). Whole-transcriptomic changes were measured by RNA-<i>seq</i> analysis, showing significant differences in the expression of genes mainly involved in inflammatory response, oxidative stress, drug metabolism, apoptosis and cancer. As a confirmatory step, post-translational investigations on genes of interest were implemented. Cell death associated with necrosis rather than apoptosis events was noted. As far as the toxicity mechanism is concerned, a molecular pathway linking inflammatory response and oxidative stress was postulated. Toll-Like Receptor 2 (TLR2) activation, consequent to AFB1 exposure, triggers an intracellular signaling cascade involving a kinase (p38β MAPK), which in turn allows the nuclear translocation of the activator protein-1 (AP-1) and NF-κB, finally leading to the release of pro-inflammatory cytokines. Furthermore, a p38β MAPK negative role in cytoprotective genes regulation was postulated. Overall, our investigations improved the actual knowledge on the molecular effects of this worldwide relevant natural toxin in cattle.

Also flagged:acquired immunodeficiency syndromeAIDSinfectionsecretioncognitive declinehistone deacetylases
Journal Article 2022-07-20 No Snippets Hernandez CA, Eliseo E.
Show Full Abstract

The human immunodeficiency virus-1 (HIV) enters the brain shortly after infection, leading to long-term neurological complications in half of the HIV-infected population, even in the current anti-retroviral therapy (ART) era. Despite decades of research, no biomarkers can objectively measure and, more importantly, predict the onset of HIV-associated neurocognitive disorders. Several biomarkers have been proposed; however, most of them only reflect late events of neuronal damage. Our laboratory recently identified that ATP and PGE<sub>2</sub>, inflammatory molecules released through Pannexin-1 channels, are elevated in the serum of HIV-infected individuals compared to uninfected individuals and other inflammatory diseases. More importantly, high circulating ATP levels, but not PGE<sub>2</sub>, can predict a decline in cognition, suggesting that HIV-infected individuals have impaired ATP metabolism and associated signaling. We identified that Pannexin-1 channel opening contributes to the high serological ATP levels, and ATP in the circulation could be used as a biomarker of HIV-associated cognitive impairment. In addition, we believe that ATP is a major contributor to chronic inflammation in the HIV-infected population, even in the anti-retroviral era. Here, we discuss the mechanisms associated with Pannexin-1 channel opening within the circulation, as well as within the resident viral reservoirs, ATP dysregulation, and cognitive disease observed in the HIV-infected population.

Also flagged:AutophagyNeurodegenerative Diseasesprotein degradationlysosomesdegradationalpha-synuclein
Journal Article 2022-07-20 No Snippets Wang YT, Lu JH.
Show Full Abstract

Chaperone-mediated autophagy (CMA) is a protein degradation mechanism through lysosomes. By targeting the KFERQ motif of the substrate, CMA is responsible for the degradation of about 30% of cytosolic proteins, including a series of proteins associated with neurodegenerative diseases (NDs). The fact that decreased activity of CMA is observed in NDs, and ND-associated mutant proteins, including alpha-synuclein and Tau, directly impair CMA activity reveals a possible vicious cycle of CMA impairment and pathogenic protein accumulation in ND development. Given the intrinsic connection between CMA dysfunction and ND, enhancement of CMA has been regarded as a strategy to counteract ND. Indeed, genetic and pharmacological approaches to modulate CMA have been shown to promote the degradation of ND-associated proteins and alleviate ND phenotypes in multiple ND models. This review summarizes the current knowledge on the mechanism of CMA with a focus on its relationship with NDs and discusses the therapeutic potential of CMA modulation for ND.

Also flagged:LipopolysaccharideInflammatory Bowel Diseaseintestinal cancergastrointestinalintestinal mast cell tumorcolorectal cancer
Journal Article 2022-07-20 ✓ 5 Snippets Sahoo DK, Borcherding DC, Chandra L, Jergens AE, Atherly T, Bourgois-Mochel A, Ellinwood NM, Snella E, Severin AJ, Martin M, Allenspach K, Mochel JP.
In-Text Gene Mentions

Genes associated with proliferation such as proliferating cell nuclear antigen (PCNA), prominin 1 (PROM1), HOP homeobox (HOPX), and olfactomedin 4 (OLFM4) were also upregulated in LPS treated IBD intestinal organoids and tumor enteroids (Figure 1c).

Other intestinal stem cell markers and genes associated with proliferation, notably proliferating cell nuclear antigen (PCNA), prominin 1 (PROM1), HOP homeobox (HOPX), and olfactomedin 4 (OLFM4), were also increased in LPS-treated IBD intestinal organoids and tumor enteroids.

…olfactomedin 4 (OLFM4) were also…

…olfactomedin 4 (OLFM4), were also…

…Likewise,OLFM4is a highly…

Show Full Abstract

Lipopolysaccharide (LPS) is associated with chronic intestinal inflammation and promotes intestinal cancer progression in the gut. While the interplay between LPS and intestinal immune cells has been well-characterized, little is known about LPS and the intestinal epithelium interactions. In this study, we explored the differential effects of LPS on proliferation and the transcriptome in 3D enteroids/colonoids obtained from dogs with naturally occurring gastrointestinal (GI) diseases including inflammatory bowel disease (IBD) and intestinal mast cell tumor. The study objective was to analyze the LPS-induced modulation of signaling pathways involving the intestinal epithelia and contributing to colorectal cancer development in the context of an inflammatory (IBD) or a tumor microenvironment. While LPS incubation resulted in a pro-cancer gene expression pattern and stimulated proliferation of IBD enteroids and colonoids, downregulation of several cancer-associated genes such as <i>Gpatch4</i>, <i>SLC7A1</i>, <i>ATP13A2</i>, and <i>TEX45</i> was also observed in tumor enteroids. Genes participating in porphyrin metabolism (<i>CP</i>), nucleocytoplasmic transport (<i>EEF1A1</i>), arachidonic acid, and glutathione metabolism (<i>GPX1</i>) exhibited a similar pattern of altered expression between IBD enteroids and IBD colonoids following LPS stimulation. In contrast, genes involved in anion transport, transcription and translation, apoptotic processes, and regulation of adaptive immune responses showed the opposite expression patterns between IBD enteroids and colonoids following LPS treatment. In brief, the crosstalk between LPS/TLR4 signal transduction pathway and several metabolic pathways such as primary bile acid biosynthesis and secretion, peroxisome, renin-angiotensin system, glutathione metabolism, and arachidonic acid pathways may be important in driving chronic intestinal inflammation and intestinal carcinogenesis.

Also flagged:Acute lymphoblastic leukemiaALLchildhood cancerB cell acute leukemialeukemiasolid tumor
Journal Article 2022-07-20 No Snippets Severgnini M, D'Angiò M, Bungaro S, Cazzaniga G, Cifola I, Fazio G.
Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most frequent childhood cancer. For the last three decades, conventional cytogenetic and molecular approaches allowed the identification of genetic abnormalities having prognostic and therapeutic relevance. Although the current cure rate in pediatric B cell acute leukemia is approximately 90%, it remains one of the leading causes of mortality in childhood. Furthermore, in the contemporary protocols, chemotherapy intensity was raised to the maximal levels of tolerability, and further improvements in the outcome will depend on the characterization and reclassification of the disease, as well as on the development of new targeted drugs. The recent technological advances in genome-wide profiling techniques have allowed the exploration of the molecular heterogeneity of this disease, even though some potentially interesting biomarkers such as conjoined genes have not been deeply investigated yet. In the present study, we performed the transcriptome sequencing (RNA-seq) of 10 pediatric B cell precursor (BCP)-ALL cases with different risk (four standard- and six high-risk patients) enrolled in the Italian AIEOP-BFM ALL2000 protocol, in order to characterize the full spectrum of transcriptional events and to identify novel potential genetic mechanisms sustaining their different early response to therapy. Total RNA was extracted from primary leukemic blasts and RNA-seq was performed by Illumina technology. Bioinformatics analysis focused on fusion transcripts, originated from either inter- or intra-chromosomal structural rearrangements. Starting from a raw list of 9001 candidate events, by employing a custom-made bioinformatics pipeline, we obtained a short list of 245 candidate fusions. Among them, 10 events were compatible with chromosomal translocations. Strikingly, 235/245 events were intra-chromosomal fusions, 229 of which involved two contiguous or overlapping genes, resulting in the so-called conjoined genes (CGs). To explore the specificity of these events in leukemia, we performed an extensive bioinformatics meta-analysis and evaluated the presence of the fusions identified in our 10 BCP-ALL cohort in several other publicly available RNA-seq datasets, including leukemic, solid tumor and normal sample collections. Overall, 14/229 (6.1%) CGs were found to be exclusively expressed in leukemic cases, suggesting an association between CGs and leukemia. Moreover, CGs were found to be common events both in standard- and high-risk BCP-ALL patients and it might be suggestive of a novel potential transcriptional regulation mechanism active in leukemic cells.

Also flagged:Liver SteatosisFibrosisType 2 Diabetes MellitusNon-alcoholic fatty liver diseaseNAFLDsteatosis
Journal Article 2022-07-20 ✓ 1 Snippet Trifan A, Stratina E, Nastasa R, Rotaru A, Stafie R, Zenovia S, Huiban L, Sfarti C, Cojocariu C, Cuciureanu T, Muzica C, Chiriac S, Girleanu I, Singeap AM, Stanciu C.
In-Text Gene Mentions

…as hepatitis B/C,hemochromatosis, Wilson’s disease, alcohol…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) is a common finding among patients with type 2 diabetes mellitus (T2DM). Between NAFLD and T2DM exist a bidirectional relationship. Patients with T2DM are at high risk for NAFLD, and evidence suggests that T2DM is linked to progressive NAFLD and poor liver outcomes. NAFLD promotes the development of T2DM and leads to a substantial increase in the risk of T2DM complications. This study aimed to assess the prevalence of liver steatosis and fibrosis in patients with T2DM from north-eastern Romania by using Vibration-Controlled Transient Elastography (VCTE) with Controlled Attenuation Parameter (CAP), which is a non-invasive method and can assess simultaneously liver steatosis and fibrosis. In total, 424 consecutive patients with T2DM were enrolled and evaluated using VCTE with CAP from January 2020 to January 2022. Clinical and laboratory data were recorded in all patients. For the CAP score, we used the following cut-offs: mild steatosis (S1)—274 dB/m, moderate steatosis (S2)—290 dB/m, and severe steatosis (S3)—302 dB/m. For liver fibrosis, to differentiate between fibrosis stages, the cut-off values were F ≥ 8.2 kPa for significant fibrosis (F2), F ≥ 9.7 kPa for advanced fibrosis (F3), and F ≥ 13.6 kPa for cirrhosis (F4). In total, 380 diabetic patients (72.6%) had liver steatosis (51.3% females, the mean age of 55.22 ± 10.88 years, mean body mass index (BMI) 29.12 ± 5.64 kg/m2). Among them, 26 (8.4%) patients had moderate liver steatosis (S2) and 242 (78.5%) patients had severe hepatic steatosis (S3). According to VCTE measurements, 176 (57.14%) patients had liver fibrosis, 36 (11.7%) of them had advanced fibrosis (F3), and 42 (13.6%) diabetic patients had cirrhosis (F4). Univariate analyses showed that severe steatosis was significantly associated with ferritin (β = 0.223, p = 0.022), total cholesterol (β = 0.159, p = 0.031), and HDL-cholesterol (β = −0.120, p = 0.006). In multivariate analyses, BMI (β = 0.349, p < 0.001), fasting plasma glucose (β = 0.211, p = 0.006), and triglycerides (β = 0.132, p = 0.044) were predictors of S3. Patients with T2DM have a high prevalence of severe steatosis and advanced fibrosis which can lead to the development and progression of complications with high morbidity and mortality rates. Hence, it is necessary to implement screening strategies to prevent advanced liver disease in patients with T2DM.

Also flagged:Renal cell carcinomaRCCsolid tumor of thetumorsclear cell renal cell carcinomaccRCC
Journal Article 2022-07-20 No Snippets Gong Z, Wu X, Guo Q, Du H, Zhang F, Kong Y.
Show Full Abstract

<h4>Background</h4>Renal cell carcinoma (RCC) is a common malignancy of the genitourinary system and clear cell renal cell carcinoma (ccRCC) is the most representative subtype. The morbidity and mortality of ccRCC have gradually risen during recent years; however, the pathogenesis and potential biomarkers remain unclear. The purpose of our study was to find out prognostic genes correlated with somatic mutation and the underlying mechanisms of <i>HMCN1</i> mutation in ccRCC.<h4>Methods</h4>Somatic mutation data of two ccRCC cohorts were acquired from TCGA and cBioPortal. Genes frequently mutated in both datasets were extracted, from which tumor mutation burden and survival analysis revealed three prognostic genes. Further comprehensive analysis of <i>HMCN1</i> mutation was carried out to identify differentially expressed genes and apply functional annotations. The correlation of <i>HMCN1</i> mutation and tumor immunity was also evaluated.<h4>Results</h4><i>HMCN1</i>, <i>SYNE1</i>, and <i>BAP1</i> mutations were associated with both tumor mutation burden and clinical prognosis in ccRCC. Gene enrichment analysis suggested the effects of <i>HMCN1</i> mutation on biological processes and pathways linked to energy metabolism. <i>HMCN1</i> mutation was also correlated with anti-tumor immunity. There were several limitations in the sample size and cohort availability of the present computational study.<h4>Conclusions</h4>The present results inferred that <i>HMCN1</i> mutation might have an important clinical significance for ccRCC patients by regulating metabolism and the immune microenvironment.

Also flagged:Obstructive sleep apneaoxygensleep apneasleepsleep-disordered breathinghigh blood pressure
Journal Article 2022-07-20 No Snippets Cederberg KLJ, Hanif U, Peris Sempere V, Hédou J, Leary EB, Schneider LD, Lin L, Zhang J, Morse AM, Blackman A, Schweitzer PK, Kotagal S, Bogan R, Kushida CA, Ju YS, Petousi N, Turnbull CD, Mignot E, The Stages Cohort Investigator Group.
Show Full Abstract

Obstructive sleep apnea (OSA), a disease associated with excessive sleepiness and increased cardiovascular risk, affects an estimated 1 billion people worldwide. The present study examined proteomic biomarkers indicative of presence, severity, and treatment response in OSA. Participants (n = 1391) of the Stanford Technology Analytics and Genomics in Sleep study had blood collected and completed an overnight polysomnography for scoring the apnea−hypopnea index (AHI). A highly multiplexed aptamer-based array (SomaScan) was used to quantify 5000 proteins in all plasma samples. Two separate intervention-based cohorts with sleep apnea (n = 41) provided samples pre- and post-continuous/positive airway pressure (CPAP/PAP). Multivariate analyses identified 84 proteins (47 positively, 37 negatively) associated with AHI after correction for multiple testing. Of the top 15 features from a machine learning classifier for AHI ≥ 15 vs. AHI < 15 (Area Under the Curve (AUC) = 0.74), 8 were significant markers of both AHI and OSA from multivariate analyses. Exploration of pre- and post-intervention analysis identified 5 of the 84 proteins to be significantly decreased following CPAP/PAP treatment, with pathways involving endothelial function, blood coagulation, and inflammatory response. The present study identified PAI-1, tPA, and sE-Selectin as key biomarkers and suggests that endothelial dysfunction and increased coagulopathy are important consequences of OSA, which may explain the association with cardiovascular disease and stroke.

Also flagged:CancerSUMOylationtranslationalproteasesligaseslocalization
Journal Article 2022-07-20 No Snippets Lara-Ureña N, Jafari V, García-Domínguez M.
Show Full Abstract

SUMOylation is a post-translational modification that has emerged in recent decades as a mechanism involved in controlling diverse physiological processes and that is essential in vertebrates. The SUMO pathway is regulated by several enzymes, proteases and ligases being the main actors involved in the control of sumoylation of specific targets. Dysregulation of the expression, localization and function of these enzymes produces physiological changes that can lead to the appearance of different types of cancer, depending on the enzymes and target proteins involved. Among the most studied proteases and ligases, those of the SENP and PIAS families stand out, respectively. While the proteases involved in this pathway have specific SUMO activity, the ligases may have additional functions unrelated to sumoylation, which makes it more difficult to study their SUMO-associated role in cancer process. In this review we update the knowledge and advances in relation to the impact of dysregulation of SUMO proteases and ligases in cancer initiation and progression.

Also flagged:Pleomorphic adenomalocalized tumortransdifferentiationtranscription factorsEMT-TFsTWIST
Journal Article 2022-07-20 ✓ 5 Snippets Matsumiya-Matsumoto Y, Morita Y, Uzawa N.
In-Text Gene Mentions

…express Sox9 andSox6and produce aggrecan…

…Sox9,Sox6, and Sox5 make…

…in concert withSox6or Sox5 as…

…because they expressSox6.…

…They expressed Sox9,Sox6, and Twist1, but…

Show Full Abstract

Pleomorphic adenoma (PA) is a localized tumor that presents pleomorphic or mixed characteristics of epithelial origin and is interwoven with mucoid tissue, myxoid tissue, and chondroid masses. The literature reported that PA most often occurs in adults aged 30-60 years and is a female predilection; the exact etiology remains unclear. Epithelial-mesenchymal transition (EMT) is the transdifferentiation of stationary epithelial cells primarily activated by a core set of transcription factors (EMT-TFs) involved in DNA repair and offers advantages under various stress conditions. Data have suggested that EMTs represent the basic principle of tissue heterogeneity in PAs, demonstrating the potential of adult epithelial cells to transdifferentiate into mesenchymal cells. It has also been reported that multiple TFs, such as TWIST and SLUG, are involved in EMT in PA and that SLUG could play an essential role in the transition from myoepithelial to mesenchymal cells. Given this background, this review aims to summarize and clarify the involvement of EMT in the development of PA, chondrocyte differentiation, and malignant transformation to contribute to the fundamental elucidation of the mechanisms underlying EMT.

Also flagged:glutamic acidwaterpolypeptidecalciumbindingL-glutamic acid
Journal Article 2022-07-20 No Snippets Parati M, Clarke L, Anderson P, Hill R, Khalil I, Tchuenbou-Magaia F, Stanley MS, McGee D, Mendrek B, Kowalczuk M, Radecka I.
Show Full Abstract

Poly-γ-glutamic acid (γ-PGA) is a bio-derived water-soluble, edible, non-immunogenic nylon-like polymer with the biochemical characteristics of a polypeptide. This Bacillus-derived material has great potential for a wide range of applications, from bioremediation to tunable drug delivery systems. In the context of oral care, γ-PGA holds great promise in enamel demineralisation prevention. The salivary protein statherin has previously been shown to protect tooth enamel from acid dissolution and act as a reservoir for free calcium ions within oral cavities. Its superb enamel-binding capacity is attributed to the L-glutamic acid residues of this 5380 Da protein. In this study, γ-PGA was successfully synthesised from Bacillus subtilis natto cultivated on supplemented algae media and standard commercial media. The polymers obtained were tested for their potential to inhibit demineralisation of hydroxyapatite (HAp) when exposed to caries simulating acidic conditions. Formulations presenting 0.1, 0.25, 0.5, 0.75, 1, 2, 3 and 4% (w/v) γ-PGA concentration were assessed to determine the optimal conditions. Our data suggests that both the concentration and the molar mass of the γ-PGA were significant in enamel protection (p = 0.028 and p < 0.01 respectively). Ion Selective Electrode, combined with Fourier Transform Infra-Red studies, were employed to quantify enamel protection capacity of γ-PGA. All concentrations tested showed an inhibitory effect on the dissolution rate of calcium ions from hydroxyapatite, with 1% (wt) and 2% (wt) concentrations being the most effective. The impact of the average molar mass (M) on enamel dissolution was also investigated by employing commercial 66 kDa, 166 kDa, 440 kDa and 520 kDa γ-PGA fractions. All γ-PGA solutions adhered to the surface of HAp with evidence that this remained after 60 min of continuous acidic challenge. Inductively Coupled Plasma analysis showed a significant abundance of calcium ions associated with γ-PGA, which suggests that this material could also act as a responsive calcium delivery system. We have concluded that all γ-PGA samples tested (commercial and algae derived) display enamel protection capacity regardless of their concentration or average molar mass. However, we believe that γ-PGA D/L ratios might affect the binding more than its molar mass.

Also flagged:hydroxyapatitechitosanFGF2osteoblast differentiationcell adhesiontumors
Journal Article 2022-07-20 No Snippets Grumezescu V, Grumezescu AM, Ficai A, Negut I, Vasile BȘ, Gălățeanu B, Hudiță A.
Show Full Abstract

The bioactive and biocompatible properties of hydroxyapatite (HAp) promote the osseointegration process. HAp is widely used in biomedical applications, especially in orthopedics, as well as a coating material for metallic implants. We obtained composite coatings based on HAp, chitosan (CS), and FGF2 by a matrix-assisted pulsed laser evaporation (MAPLE) technique. The coatings were physico-chemically investigated by means of X-ray Diffraction (XRD), Transmission Electron Microscopy (TEM), Infrared Microscopy (IRM), and Scanning Electron Microscopy (SEM). Further, biological investigations were performed. The MAPLE-composite coatings were tested in vitro on the MC3T3-E1 cell line in order to endorse cell attachment and growth without toxic effects and to promote pre-osteoblast differentiation towards the osteogenic lineage. These coatings can be considered suitable for bone tissue engineering applications that lack toxicity and promotes cell adhesion and proliferation while also sustaining the differentiation of pre-osteoblasts towards mature bone cells.

Also flagged:Hydroxyapatitecancersolid tumorangiogenesistissue cancermetabolism
Journal Article 2022-07-20 No Snippets Kargozar S, Mollazadeh S, Kermani F, Webster TJ, Nazarnezhad S, Hamzehlou S, Baino F.
Show Full Abstract

Beyond their well-known applications in bone tissue engineering, hydroxyapatite nanoparticles (HAp NPs) have also been showing great promise for improved cancer therapy. The chemical structure of HAp NPs offers excellent possibilities for loading and delivering a broad range of anticancer drugs in a sustained, prolonged, and targeted manner and thus eliciting lower complications than conventional chemotherapeutic strategies. The incorporation of specific therapeutic elements into the basic composition of HAp NPs is another approach, alone or synergistically with drug release, to provide advanced anticancer effects such as the capability to inhibit the growth and metastasis of cancer cells through activating specific cell signaling pathways. HAp NPs can be easily converted to smart anticancer agents by applying different surface modification treatments to facilitate the targeting and killing of cancer cells without significant adverse effects on normal healthy cells. The applications in cancer diagnosis for magnetic and nuclear in vivo imaging are also promising as the detection of solid tumor cells is now achievable by utilizing superparamagnetic HAp NPs. The ongoing research emphasizes the use of HAp NPs in fabricating three-dimensional scaffolds for the treatment of cancerous tissues or organs, promoting the regeneration of healthy tissue after cancer detection and removal. This review provides a summary of HAp NP applications in cancer theranostics, highlighting the current limitations and the challenges ahead for this field to open new avenues for research.

Also flagged:synthesisbile saltscholesterolbile acidBile acidsglucose
Journal Article 2022-07-20 ✓ 1 Snippet Ahmed M.
In-Text Gene Mentions

…HCC, liver failure,hemochromatosis, portal vein thrombosis,…

Show Full Abstract

Bile is a unique body fluid synthesized in our liver. Enterohepatic circulation preserves bile in our body through its efficient synthesis, transport, absorption, and reuptake. Bile is the main excretory route for bile salts, bilirubin, and potentially harmful exogenous lipophilic substances. The primary way of eliminating cholesterol is bile. Although bile has many organic and inorganic contents, bile acid is the most physiologically active component. Bile acids have a multitude of critical physiologic functions in our body. These include emulsification of dietary fat, absorption of fat and fat-soluble vitamins, maintaining glucose, lipid, and energy homeostasis, sustenance of intestinal epithelial integrity and epithelial cell proliferation, reducing inflammation in the intestine, and prevention of enteric infection due to its antimicrobial properties. But bile acids can be harmful in certain altered conditions like cholecystectomy, terminal ileal disease or resection, cholestasis, duodenogastric bile reflux, duodenogastroesophageal bile reflux, and bile acid diarrhea. Bile acids can have malignant potentials as well. There are also important diagnostic and therapeutic roles of bile acid and bile acid modulation.

Also flagged:Transcription FactorPou3f1transcription factorsGAD67Atoh1Pax6
Journal Article 2022-07-20 ✓ 1 Snippet Wu JPH, Yeung J, Rahimi-Balaei M, Wu SR, Zoghbi H, Goldowitz D.
In-Text Gene Mentions

…also known asPou3f2, has been previously…

Show Full Abstract

The cerebellar nuclear (CN) neurons are a molecularly heterogeneous population whose specification into the different cerebellar nuclei is defined by the expression of varying sets of transcription factors. Here, we present a novel molecular marker, Pou3f1, that delineates specific sets of glutamatergic CN neurons. The glutamatergic identity of Pou3f1<sup>+</sup> cells was confirmed by: (1) the co-expression of vGluT2, a cell marker of glutamatergic neurons; (2) the lack of co-expression between Pou3f1 and GAD67, a marker of GABAergic neurons; (3) the co-expression of Atoh1, the master regulator required for the production of all cerebellar glutamatergic lineages; and (4) the absence of Pou3f1-expressing cells in the <i>Atoh1</i>-null cerebellum. Furthermore, the lack of Pax6 and Tbr1 expression in Pou3f1<sup>+</sup> cells reveals that Pou3f1-expressing CN neurons specifically settle in the interposed and dentate nuclei. In addition, the Pou3f1-labeled glutamatergic CN neurons can be further classified by the expression of Brn2 and Irx3. The results of the present study align with previous findings highlighting that the survival of the interposed and dentate CN neurons is largely independent of Pax6. More importantly, the present study extends the field's collective knowledge of the molecular diversity of cerebellar nuclei.

Also flagged:organelleautophagyNAFLDlipidmetabolismmitochondrial
Journal Article 2022-07-20 No Snippets Zhang Y, Chen Y.
Show Full Abstract

<h4>Abstract</h4>Non-alcoholic fatty liver disease (NAFLD) is a disorder of lipid metabolism. The lipotoxic intermediates of lipid metabolism cause mitochondrial dysfunction and endoplasmic reticulum stress. Organelle-specific autophagy is responsible for the removal of dysfunctional organelles to maintain intracellular homeostasis. Lipophagy contributes to lipid turnover by degrading lipid droplets. The level of autophagy changes during the course of NAFLD, and the activation of hepatocyte autophagy might represent a method of treating NAFLD.

Also flagged:Gene Expressionhousekeeping genesGreenbindingNeurogenin 2Ngn2
Journal Article 2022-07-20 No Snippets Srinivasaraghavan VN, Zafar F, Schüle B.
Show Full Abstract

To optimize differentiation protocols for stem cell-based <i>in vitro</i> modeling applications, it is essential to assess the change in gene expression during the differentiation process. This allows controlling its differentiation efficiency into the target cell types. While RNA transcriptomics provides detail at a larger scale, timing and cost are prohibitive to include such analyses in the optimization process. In contrast, expression analysis of individual genes is cumbersome and lengthy. Here, we developed a versatile and cost-efficient SYBR Green array of 27 markers along with two housekeeping genes to quickly screen for differentiation efficiency of human induced pluripotent stem cells (iPSCs) into excitatory cortical neurons. We first identified relevant pluripotency, neuroprogenitor, and neuronal markers for the array by literature search, and designed primers with a product size of 80-120 bp length, an annealing temperature of 60°C, and minimal predicted secondary structures. We spotted combined forward and reverse primers on 96-well plates and dried them out overnight. These plates can be prepared in advance in batches and stored at room temperature until use. Next, we added the SYBR Green master mix and complementary DNA (cDNA) to the plate in triplicates, ran quantitative PCR (qPCR) on a Quantstudio 6 Flex, and analyzed results with QuantStudio software. We compared the expression of genes for pluripotency, neuroprogenitor cells, cortical neurons, and synaptic markers in a 96-well format at four different time points during the cortical differentiation. We found a sharp reduction of pluripotency genes within the first three days of pre-differentiation and a steady increase of neuronal markers and synaptic markers over time. In summary, we built a gene expression array that is customizable, fast, medium-throughput, and cost-efficient, ideally suited for optimization of differentiation protocols for stem cell-based <i>in vitro</i> modeling.

Also flagged:BASP1transcriptional corepressorchromatinlipidmyristoylationhistone
Journal Article 2022-07-20 ✓ 2 Snippets Moorhouse AJ, Loats AE, Medler KF, Roberts SGE.
In-Text Gene Mentions

…MYC, RELA, TFCP2,POU3F2, YY1, and CTCF…

…at RELA, TFCPP2,POU3F2, YY1, and CTCF…

Show Full Abstract

The transcriptional corepressor BASP1 requires N-terminal myristoylation for its activity and functions through interactions with nuclear lipids. Here we determine the role of BASP1 lipidation in histone modification and the modulation of chromatin accessibility. We find that the removal of the active histone modifications H3K9ac and H3K4me3 by BASP1 requires the N-terminal myristoylation of BASP1. In contrast, the placement of the repressive histone modification, H3K27me3, by BASP1 does not require BASP1 lipidation. RNA-seq and ATAC-seq analysis finds that BASP1 regulates the activity of multiple transcription factors and induces extensive changes in chromatin accessibility. We find that ∼50% of BASP1 target genes show lipidation-dependent chromatin compaction and transcriptional repression. Our results suggest that BASP1 elicits both lipid-dependent and lipid-independent functions in histone modification and transcriptional repression. In accordance with this, we find that the tumor suppressor activity of BASP1 is also partially dependent on its myristoylation.

Also flagged:methyladenosineadenosineCardiovascular diseasesribonucleic acidsmetabolic disorderscardiovascular disease
Journal Article 2022-07-20 No Snippets Sikorski V, Vento A, Kankuri E, IHD-EPITRAN Consortium.
Show Full Abstract

Cardiovascular diseases lead the mortality and morbidity disease metrics worldwide. A multitude of chemical base modifications in ribonucleic acids (RNAs) have been linked with key events of cardiovascular diseases and metabolic disorders. Named either RNA epigenetics or epitranscriptomics, the post-transcriptional RNA modifications, their regulatory pathways, components, and downstream effects substantially contribute to the ways our genetic code is interpreted. Here we review the accumulated discoveries to date regarding the roles of the two most common epitranscriptomic modifications, N<sup>6</sup>-methyl-adenosine (m<sup>6</sup>A) and adenosine-to-inosine (A-to-I) editing, in cardiovascular disease.

Also flagged:monoaminesynaptic vesiclescognitionbehavioralgene expressionsVmat1
Journal Article 2022-07-20 ✓ 2 Snippets Sato DX, Inoue YU, Kuga N, Hattori S, Nomoto K, Morimoto Y, Sala G, Hagihara H, Kikusui T, Sasaki T, Ikegaya Y, Miyakawa T, Inoue T, Kawata M.
In-Text Gene Mentions

…of Cplx1 ,Negr1, and Nts…

…(i.e., Cplx1 ,Negr1, and Nts…

Show Full Abstract

The human vesicular monoamine transporter 1 (<i>VMAT1</i>) harbors unique substitutions (Asn136Thr/Ile) that affect monoamine uptake into synaptic vesicles. These substitutions are absent in all known mammals, suggesting their contributions to distinct aspects of human behavior modulated by monoaminergic transmissions, such as emotion and cognition. To directly test the impact of these human-specific mutations, we introduced the humanized residues into mouse <i>Vmat1</i> via CRISPR/Cas9-mediated genome editing and examined changes at the behavioral, neurophysiological, and molecular levels. Behavioral tests revealed reduced anxiety-related traits of <i>Vmat1</i> <sup>Ile</sup> mice, consistent with human studies, and electrophysiological recordings showed altered oscillatory activity in the amygdala under anxiogenic conditions. Transcriptome analyses further identified changes in gene expressions in the amygdala involved in neurodevelopment and emotional regulation, which may corroborate the observed phenotypes. This knock-in mouse model hence provides compelling evidence that the mutations affecting monoaminergic signaling and amygdala circuits have contributed to the evolution of human socio-emotional behaviors.

Also flagged:MethotrexateRheumatoid ArthritiscytopeniasRAautoimmune diseaseautoantibodies
Journal Article 2022-07-20 ✓ 1 Snippet Mustafa SH, Ahmad T, Balouch M, Iqbal F, Durrani T.
In-Text Gene Mentions

…disease, such ashemochromatosis, Wilsons disease, and…

Show Full Abstract

Objective The objective of this study was to determine the safety profile of methotrexate (MTX) therapy in patients with rheumatoid arthritis Study design This was a cross-sectional observational study. Place and duration of the study The study took place in the Division of Rheumatology, Lady Reading Hospital Peshawar, from May 2020 to August 2021. Methodology A total of 411 patients with rheumatoid arthritis and receiving MTX in the dose of 10-20 mg/week for at least four months were included by consecutive sampling. All patients were followed for four months for the development of cytopenias, deranged liver function tests, renal function tests, fever, and gastrointestinal upsets. Data were recorded on a pro forma. Results There were 237 (57.6%) females and 174 (42.4%) males. The female to male ratio was 1.4: 1. The average age of patients was 43.01 years + 17.1 SD with a range of 18-72 years. Gastrointestinal side effects were the most common, found in 49 patients (11.9%), followed by mucocutaneous side effects in 35 patients (8.5%) and fever (34 patients, 8.3%). Conclusion Every one in three patients developed some adverse effect within six months of methotrexate therapy. Moreover, we conclude that gastrointestinal side effects were the most common side effects seen.

Also flagged:Rett syndromeintellectual disabilityregulatorsynapsessynapsesynaptic transmission
Journal Article 2022-07-19 ✓ 1 Snippet Horvath PM, Piazza MK, Kavalali ET, Monteggia LM.
In-Text Gene Mentions

NEGR1

Show Full Abstract

Rett syndrome is a leading cause of intellectual disability in females primarily caused by loss of function mutations in the transcriptional regulator MeCP2. Loss of MeCP2 leads to a host of synaptic phenotypes that are believed to underlie Rett syndrome pathophysiology. Synaptic deficits vary by brain region upon MeCP2 loss, suggesting distinct molecular alterations leading to disparate synaptic outcomes. In this study, we examined the contribution of MeCP2's newly described role in miRNA regulation to regional molecular and synaptic impairments. Two miRNAs, miR-101a and miR-203, were identified and confirmed as upregulated in MeCP2 KO mice in the hippocampus and cortex, respectively. miR-101a overexpression in hippocampal cultures led to opposing effects at excitatory and inhibitory synapses and in spontaneous and evoked neurotransmission, revealing the potential for a single miRNA to broadly regulate synapse function in the hippocampus. These results highlight the importance of regional alterations in miRNA expression and the specific impact on synaptic function with potential implications for Rett syndrome.

Also flagged:receptorsimmune responsesviral infectionCas9MHC IIHLA-DR
Journal Article 2022-07-19 ✓ 1 Snippet Deseke M, Rampoldi F, Sandrock I, Borst E, Böning H, Ssebyatika GL, Jürgens C, Plückebaum N, Beck M, Hassan A, Tan L, Demera A, Janssen A, Steinberger P, Koenecke C, Viejo-Borbolla A, Messerle M, Krey T, Prinz I.
In-Text Gene Mentions

…require the butyrophilinsBTN2A1and BTN3A1 to…

Show Full Abstract

The innate and adaptive roles of γδ T cells and their clonal γδ T cell receptors (TCRs) in immune responses are still unclear. Recent studies of γδ TCR repertoire dynamics showed massive expansion of individual Vδ1+ γδ T cell clones during viral infection. To judge whether such expansion is random or actually represents TCR-dependent adaptive immune responses, information about their cognate TCR ligands is required. Here, we used CRISPR/Cas9-mediated screening to identify HLA-DRA, RFXAP, RFX5, and CIITA as required for target cell recognition of a CMV-induced Vγ3Vδ1+ TCR, and further characterization revealed a direct interaction of this Vδ1+ TCR with the MHC II complex HLA-DR. Since MHC II is strongly upregulated by interferon-γ, these results suggest an inflammation-induced MHC-dependent immune response of γδ T cells.

Also flagged:Community-acquired pneumoniaCAPacute respiratory diseaseCOVID-19pathogenesisimmune response
Journal Article 2022-07-19 ✓ 1 Snippet Corica B, Tartaglia F, D'Amico T, Romiti GF, Cangemi R.
In-Text Gene Mentions

…IL-6, IL-10, D-dimer,antithrombin-III, and Factor IX).…

Show Full Abstract

Awareness of the influence of sex ands gender on the natural history of several diseases is increasing. Community-acquired pneumonia (CAP) is the most common acute respiratory disease, and it is associated with both morbidity and mortality across all age groups. Although a role for sex- and gender-based differences in the development and associated complications of CAP has been postulated, there is currently high uncertainty on the actual contribution of these factors in the epidemiology and clinical course of CAP. More evidence has been produced on the topic during the last decades, and sex- and gender-based differences have also been extensively studied in COVID-19 patients since the beginning of the SARS-CoV-2 pandemic. This review aims to provide an extensive outlook of the role of sex and gender in the epidemiology, pathogenesis, treatment, and outcomes of patients with CAP, and on the future research scenarios, with also a specific focus on COVID-19.

Also flagged:traumatic brain injurydementianeurodegenerative disordersaxon guidanceneuritecell adhesion
Journal Article 2022-07-19 ✓ 1 Snippet Cente M, Matyasova K, Csicsatkova N, Tomikova A, Porubska S, Niu Y, Majdan M, Filipcik P, Jurisica I.
In-Text Gene Mentions

Htt

Show Full Abstract

History of traumatic brain injury (TBI) represents a significant risk factor for development of dementia and neurodegenerative disorders in later life. While histopathological sequelae and neurological diagnostics of TBI are well defined, the molecular events linking the post-TBI signaling and neurodegenerative cascades remain unknown. It is not only due to the brain's inaccessibility to direct molecular analysis but also due to the lack of well-defined and highly informative peripheral biomarkers. MicroRNAs (miRNAs) in blood are promising candidates to address this gap. Using integrative bioinformatics pipeline including miRNA:target identification, pathway enrichment, and protein-protein interactions analysis we identified set of genes, interacting proteins, and pathways that are connected to previously reported peripheral miRNAs, deregulated following severe traumatic brain injury (sTBI) in humans. This meta-analysis revealed a spectrum of genes closely related to critical biological processes, such as neuroregeneration including axon guidance and neurite outgrowth, neurotransmission, inflammation, proliferation, apoptosis, cell adhesion, and response to DNA damage. More importantly, we have identified molecular pathways associated with neurodegenerative conditions, including Alzheimer's and Parkinson's diseases, based on purely peripheral markers. The pathway signature after acute sTBI is similar to the one observed in chronic neurodegenerative conditions, which implicates a link between the post-sTBI signaling and neurodegeneration. Identified key hub interacting proteins represent a group of novel candidates for potential therapeutic targets or biomarkers.

Also flagged:α-Synucleinopathiesneurodegenerative diseasesAPOEα-synucleinopathyParkinson's diseasePD
Journal Article 2022-07-19 ✓ 2 Snippets Pérez-Oliveira S, Álvarez I, Rosas I, Menendez-González M, Blázquez-Estrada M, Aguilar M, Corte D, Buongiorno M, Molina-Porcel L, Aldecoa I, Martí MJ, Sánchez-Juan P, Infante J, González-Aramburu I, García-González P, Rosende-Roca M, Boada M, Ruiz A, Periñán MT, Macías-García D, Muñoz-Delgado L, Gómez-Garre P, Mir P, Clarimón J, Lleo A, Alcolea D, De la Casa-Fages B, Duarte I, Álvarez V, Pastor P.
In-Text Gene Mentions

<h4>Background</h4>Previous studies suggest a link between CAG repeat number in the HTT gene and non-Huntington neurodegenerative diseases.<h4>Objective</h4>The aim is to analyze whether expanded HTT CAG alleles and/or their size are associated with the risk for developing α-synucleinopathies or their behavior as modulators of the phenotype.<h4>Methods</h4>We genotyped the HTT gene CAG repeat number and APOE-Ɛ isoforms in a case-control series including patients with either clinical or neuropathological diagnosis of α-synucleinopathy.<h4>Results</h4>We identified three Parkinson's disease (PD) patients (0.30%) and two healthy controls (0.19%) carrying low-penetrance HTT repeat expansions whereas none of the dementia with Lewy bodies (DLB) or multisystem atrophy (MSA) patients carried pathogenic HTT expansions.

HTTintermediate alleles' (IAs)…

Show Full Abstract

<h4>Background</h4>Previous studies suggest a link between CAG repeat number in the HTT gene and non-Huntington neurodegenerative diseases.<h4>Objective</h4>The aim is to analyze whether expanded HTT CAG alleles and/or their size are associated with the risk for developing α-synucleinopathies or their behavior as modulators of the phenotype.<h4>Methods</h4>We genotyped the HTT gene CAG repeat number and APOE-Ɛ isoforms in a case-control series including patients with either clinical or neuropathological diagnosis of α-synucleinopathy.<h4>Results</h4>We identified three Parkinson's disease (PD) patients (0.30%) and two healthy controls (0.19%) carrying low-penetrance HTT repeat expansions whereas none of the dementia with Lewy bodies (DLB) or multisystem atrophy (MSA) patients carried pathogenic HTT expansions. In addition, a clear increase in the number of HTT CAG repeats was found among DLB and PD groups influenced by the male gender and also by the APOE4 allele among DLB patients. HTT intermediate alleles' (IAs) distribution frequency increased in the MSA group compared with controls (8.8% vs. 3.9%, respectively). These differences were indeed statistically significant in the MSA group with neuropathological confirmation. Two MSA HTT CAG IAs carriers with 32 HTT CAG repeats showed isolated polyQ inclusions in pons and basal nuclei, which are two critical structures in the neurodegeneration of MSA.<h4>Conclusions</h4>Our results point to a link between HTT CAG number, HTT IAs, and expanded HTT CAG repeats with other non-HD brain pathology and support the hypothesis that they can share common neurodegenerative pathways. © 2022 International Parkinson and Movement Disorder Society.

Also flagged:HAP40HuntingtinbindingproteasomepolyglutamineHD
Journal Article 2022-07-19 ✓ 5 Snippets Xu S, Li G, Ye X, Chen D, Chen Z, Xu Z, Daniele M, Tambone S, Ceccacci A, Tomei L, Ye L, Yu Y, Solbach A, Farmer SM, Stimming EF, McAllister G, Marchionini DM, Zhang S.
In-Text Gene Mentions

To test this prediction in a pathological setting, we knocked down HTT or HAP40 expression in GM04857, a human HD homozygote fibroblast cell line that was derived from a HD patient homozygous for HD mutations, with one of the HTT alleles containing 40 CAG repeat and the other 50 CAG repeat.

To further confirm this result in human setting, we next examined the levels of HTT and HAP40 proteins in human fibroblast cell lines derived from thirteen HD patients and eight normal controls.

Given that HAP40 binds full-length HTT (fl-HTT), but not its N-terminal region alone [35,36], we next tested another well-characterized fly HD model, which expresses mutant human fl-HTT with 128Q (fl-HTT-128Q) or wildtype control of fl-HTT with 16Q (fl-HTT-16Q) [52].

Abnormal polyglutamine expansion in huntingtin (HTT) protein causes neurodegenerative Huntington’s disease (HD).

Perturbation of huntingtin (HTT)’s physiological function is one postulated pathogenic factor in Huntington’s disease (HD).

Show Full Abstract

Perturbation of huntingtin (HTT)'s physiological function is one postulated pathogenic factor in Huntington's disease (HD). However, little is known how HTT is regulated in vivo. In a proteomic study, we isolated a novel ~40kDa protein as a strong binding partner of Drosophila HTT and demonstrated it was the functional ortholog of HAP40, an HTT associated protein shown recently to modulate HTT's conformation but with unclear physiological and pathologic roles. We showed that in both flies and human cells, HAP40 maintained conserved physical and functional interactions with HTT. Additionally, loss of HAP40 resulted in similar phenotypes as HTT knockout. More strikingly, HAP40 strongly affected HTT's stability, as depletion of HAP40 significantly reduced the levels of endogenous HTT protein while HAP40 overexpression markedly extended its half-life. Conversely, in the absence of HTT, the majority of HAP40 protein were degraded, likely through the proteasome. Further, the affinity between HTT and HAP40 was not significantly affected by polyglutamine expansion in HTT, and contrary to an early report, there were no abnormal accumulations of endogenous HAP40 protein in HD cells from mouse HD models or human patients. Lastly, when tested in Drosophila models of HD, HAP40 partially modulated the neurodegeneration induced by full-length mutant HTT while showed no apparent effect on the toxicity of mutant HTT exon 1 fragment. Together, our study uncovers a conserved mechanism governing the stability and in vivo functions of HTT and demonstrates that HAP40 is a central and positive regulator of endogenous HTT. Further, our results support that mutant HTT is toxic regardless of the presence of its partner HAP40, and implicate HAP40 as a potential modulator of HD pathogenesis through its multiplex effect on HTT's function, stability and the potency of mutant HTT's toxicity.

Also flagged:saltspore formationstarchextracellularamylasepectinase
Journal Article 2022-07-19 ✓ 1 Snippet Chauhan J, Gohel S.
In-Text Gene Mentions

Vigna radiata L .

Show Full Abstract

To explore the in vivo and in vitro plant growth promoting activities, biocatalytic potential, and antimicrobial activity of salt tolerance rhizoactinobacteria, rhizospheric soil of a halotolerant plant Saueda maritima L. was collected from Rann of Tiker, near Little Rann of Kutch, Gujarat (India). The morphology analysis of the isolated strain TSm39 revealed that the strain belonged to the phylum actinobacteria, as it was stained Gram-positive, displayed filamentous growth, showed spore formation and red pigment production on starch casein agar (SCA). It was identified as Georgenia soli based on 16S rRNA gene sequencing. The Georgenia soli strain TSm39 secreted extracellular amylase, pectinase, and protease. It showed in vitro plant growth-promoting (PGP) activities such as indole acetic acid (IAA) production, siderophore production, ammonia production, and phosphate solubilization. In vivo plant growth-promoting traits of strain TSm39 revealed 30% seed germination on water agar and vigor index 374.4. Additionally, a significant increase (p ≤ 0.05) was found in growth parameters such as root length (16.1 ± 0.22), shoot length (15.2 ± 0.17), the fresh weight (g), and dry weight (g) of the roots (0.43 ± 0.42 and 0.32 ± 0.12), shoots (0.62 ± 0.41 and 0.13 ± 0.03), and leaves (0.42 ± 0.161 and 0.14 ± 0.42) in treated seeds of Vigna radiata L. plant with the strain TSm39 compared to control. The antibiotic susceptibility profile revealed resistance of the strain TSm39 to erythromycin, ampicillin, tetracycline, and oxacillin, while it displayed maximum sensitivity to vancomycin (40 ± 0.72), chloramphenicol (40 ± 0.61), clarithromycin (40 ± 1.30), azithromycin (39 ± 0.42), and least sensitivity to teicoplanin (15 ± 0.15). Moreover, the antimicrobial activity of the strain TSm39 was observed against Gram's positive and Gram's negative microorganisms such as Shigella, Proteus vulgaris, and Bacillus subtilis. These findings indicated that the Georgenia soli strain TSm39 has multiple plant-growth-promoting properties and biocatalytic potential that signifies its agricultural applications in the enhancement of crop yield and quality and would protect the plant against plant pathogens.

Also flagged:psychological disordersmajor depressive disorderbipolar disorderattention-deficit hyperactivity disorderpsychopathologiesaggression
Journal Article 2022-07-19 ✓ 4 Snippets Javelle F, Löw A, Bloch W, Hosang T, Jacobsen T, Johnson SL, Schenk A, Zimmer P.
In-Text Gene Mentions

Two key regulators of serotonergic signaling are the serotonin transporter (5-HTT) and the monoamine oxidase A (MAO-A), which respectively remove serotonin from the synaptic cleft and catabolize monoamines with a strong affinity for serotonin and catecholamines [13–15].

…the serotonin transporter (5-HTT) and the monoamine…

…The5-HTTprotein is encoded…

…have, respectively, fewer5-HTTand MAO-A mRNA…

Show Full Abstract

The unique contribution of the serotonin transporter-linked polymorphic region (5-HTTLPR), intronic region 2 (STin2), and monoamine oxidase A (MAO-A) genes to individual differences in personality traits has been widely explored, and research has shown that certain forms of these polymorphisms relate to impulsivity and impulsivity-related disorders. Humans showing these traits are also described as having an asymmetrical prefrontal cortical activity when compared to others. In this explorative study, we examine the relationship between serotonergic neurotransmission polymorphisms, cortical activity features (prefrontal alpha asymmetry, individual alpha peak frequency [iAPF]), emotion-related and non-emotion-related impulsivity in humans. 5-HTTLPR, MAO-A, and STin2 polymorphisms were assessed in blood taken from 91 participants with high emotion-related impulsivity levels. Sixty-seven participants completed resting electroencephalography and a more comprehensive impulsivity index. In univariate analyses, iAPF correlated with both forms of emotion-related impulsivity. In multiple linear regression models, 5-HTTLPR polymorphism (model 1, adj. R<sup>2</sup> = 15.2%) and iAPF were significant interacting predictors of emotion-related impulsivity, explaining a large share of the results' variance (model 2, adj. R<sup>2</sup> = 21.2%). Carriers of the low transcriptional activity 5-HTTPLR and MAO-A phenotypes obtained higher emotion-related impulsivity scores than others did. No significant results were detected for non-emotion-related impulsivity or for a form of emotion-related impulsivity involving cognitive/motivational reactivity to emotion. Our findings support an endophenotypic approach to impulsivity, showing that tri-allelic 5-HTTLPR polymorphism, iAPF, and their interaction are relevant predictors of one form of emotion-related impulsivity.

Also flagged:thrombinproteasesantibodiessecretionhemophilia AE2
Journal Article 2022-07-19 ✓ 1 Snippet Venisse L, François D, Madjène C, Brouwers E, de Raucourt E, Boulaftali Y, Declerck P, Arocas V, Bouton MC.
In-Text Gene Mentions

…1 (PAI‐1) andSERPINC1/antithrombin (AT), SERPINE2/P…

Show Full Abstract

<h4>Introduction</h4>Serpin E2 or protease nexin-1 (PN-1) is a glycoprotein belonging to the serpin superfamily, whose function is closely linked to its ability to inhibit thrombin and proteases of the plasminergic system.<h4>Objectives</h4>In the absence of specific quantitative methods, an ELISA for the quantification of human PN-1 was characterized and used in biological fluids.<h4>Methods</h4>The ELISA for human PN-1 was developed using two monoclonal antibodies raised against human recombinant PN-1. PN-1 was quantified in plasma, serum, platelet secretion from controls and patients with hemophilia A and in conditioned medium of aortic tissue.<h4>Results</h4>A linear dose-response curve was observed between 2 and 35 ng/mL human PN-1. Intra- and interassay coefficients of variation were 6.2% and 11.1%, respectively. Assay recoveries of PN-1 added to biological samples were ≈95% in plasma, ≈97% in platelet reaction buffer, and ≈93% in RPMI cell culture medium. Levels of PN-1 secreted from activated human platelets from controls was similar to that of patients with hemophilia A. PN-1 could be detected in conditioned media of aneurysmal aorta but not in that of control aorta.<h4>Conclusion</h4>This is the first fully characterized ELISA for human serpin E2 level in biological fluids. It may constitute a relevant novel tool for further investigations on the pathophysiological role of serpin E2 in a variety of clinical studies.

Also flagged:host cellsinflammatory bowel diseaseinnate immunityG-protein-coupled receptorsdiabetesdigestion
Journal Article 2022-07-19 ✓ 1 Snippet Doms S, Fokt H, Rühlemann MC, Chung CJ, Kuenstner A, Ibrahim SM, Franke A, Turner LM, Baines JF.
In-Text Gene Mentions

…, Adcyap1 ,Serpinc1, and Wnt11…

Show Full Abstract

Determining the forces that shape diversity in host-associated bacterial communities is critical to understanding the evolution and maintenance of metaorganisms. To gain deeper understanding of the role of host genetics in shaping gut microbial traits, we employed a powerful genetic mapping approach using inbred lines derived from the hybrid zone of two incipient house mouse species. Furthermore, we uniquely performed our analysis on microbial traits measured at the gut mucosal interface, which is in more direct contact with host cells and the immune system. Several mucosa-associated bacterial taxa have high heritability estimates, and interestingly, 16S rRNA transcript-based heritability estimates are positively correlated with cospeciation rate estimates. Genome-wide association mapping identifies 428 loci influencing 120 taxa, with narrow genomic intervals pinpointing promising candidate genes and pathways. Importantly, we identified an enrichment of candidate genes associated with several human diseases, including inflammatory bowel disease, and functional categories including innate immunity and G-protein-coupled receptors. These results highlight key features of the genetic architecture of mammalian host-microbe interactions and how they diverge as new species form.

Also flagged:TauHuntington's DiseaseHDneurodegenerative disorderHuntingtinmicrotubule-associated tau
Journal Article 2022-07-19 ✓ 4 Snippets Petry S, Nateghi B, Keraudren R, Sergeant N, Planel E, Hébert SS, St-Amour I.
In-Text Gene Mentions

Using Western blot and PCR, we characterized the relationship between MAPT splicing of exons 2, 3 and 10, tauopathy and Htt pathologies, as well as neurodegeneration markers in matching putamen and cortical samples from HD (N = 48) and healthy control (N = 25) subjects.

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by an expansion of CAG repeats in the Huntingtin (HTT) gene.

…in the Huntingtin (HTT) gene.…

…10, tauopathy andHttpathologies, as well…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by an expansion of CAG repeats in the Huntingtin (HTT) gene. Accumulating evidence suggests that the microtubule-associated tau protein participates in the pathogenesis of HD. Recently, we have identified changes in tau alternative splicing of exons 2, 3 and 10 in the putamen of HD patients (St-Amour et al, 2018). In this study, we sought to determine whether tau mis-splicing events were equally observed in other brain regions that are less prone to neurodegeneration. Using Western blot and PCR, we characterized the relationship between MAPT splicing of exons 2, 3 and 10, tauopathy and Htt pathologies, as well as neurodegeneration markers in matching putamen and cortical samples from HD (N = 48) and healthy control (N = 25) subjects. We first show that levels of 4R-tau (exon 10 inclusion) isoforms are higher in both the putamen and the cortex of individuals with HD, consistent with earlier findings. On the other hand, higher 0N-tau (exclusion of exons 2 and 3) and lower 1N-tau (exclusion of exon 3) isoforms were seen exclusively in the putamen of HD individuals. Interestingly, investigated splicing factors were deregulated in both regions whereas exon 2 differences coincided with increased tau hyperphosphorylation, aggregation and markers of neurodegeneration. Overall, these results imply a differential regulation of tau exon 2 and exon 10 alternative splicing in HD putamen that could provide a useful biomarker or therapeutic target.

Also flagged:Myelinogenesismyelinneurogenesisoligodendrogenesismyelinationaxon
Journal Article 2022-07-19 ✓ 2 Snippets Dermitzakis I, Manthou ME, Meditskou S, Miliaras D, Kesidou E, Boziki M, Petratos S, Grigoriadis N, Theotokis P.
In-Text Gene Mentions

…with this, SOX5,SOX6, SOX9, and SOX10…

…while SOX5 andSOX6increase PDGFRα expression,…

Show Full Abstract

The mammalian central nervous system (CNS) coordinates its communication through saltatory conduction, facilitated by myelin-forming oligodendrocytes (OLs). Despite the fact that neurogenesis from stem cell niches has caught the majority of attention in recent years, oligodendrogenesis and, more specifically, the molecular underpinnings behind OL-dependent myelinogenesis, remain largely unknown. In this comprehensive review, we determine the developmental cues and molecular drivers which regulate normal myelination both at the prenatal and postnatal periods. We have indexed the individual stages of myelinogenesis sequentially; from the initiation of oligodendrocyte precursor cells, including migration and proliferation, to first contact with the axon that enlists positive and negative regulators for myelination, until the ultimate maintenance of the axon ensheathment and myelin growth. Here, we highlight multiple developmental pathways that are key to successful myelin formation and define the molecular pathways that can potentially be targets for pharmacological interventions in a variety of neurological disorders that exhibit demyelination.

Also flagged:proteasepolypscancersreverse transcriptionmineralpolyp
Journal Article 2022-07-19 No Snippets Simmons AJ, Lau KS.
Show Full Abstract

In droplet-based single-cell RNA-sequencing (scRNA-seq) experiments, cells, along with some of their surrounding buffer and ambient material, are encapsulated into droplets for mRNA capture and barcoding. This protocol details the steps for human gut tissue dissociation using cold active protease, and subsequent isolation of single epithelial cells, with enrichment of viability through washes. Next, the steps for encapsulation on the inDrops scRNA-seq platform are described. This procedure has been demonstrated to be applicable to polyps, cancers, and inflamed tissues. For complete details on the use and execution of this protocol, please refer to Chen et al. (2021).

Also flagged:Melanomanon-small cell lung cancerNSCLCHeparan sulfate proteoglycan 2HSPG2tumors
Journal Article 2022-07-19 ✓ 2 Snippets Zhang W, Lin Z, Shi F, Wang Q, Kong Y, Ren Y, Lyu J, Sheng C, Li Y, Qin H, Wang S, Wang Q.
In-Text Gene Mentions

By using the same pooled melanoma and NSCLC cohorts [12,54,56], we also discovered other mutations of the genes FAT1, COL3A1, NRAS, NARS2, DCC, and PTPRT were associated with better ICI response and outcome.

…, NARS2 ,DCC, and PTPRT…

Show Full Abstract

Immune checkpoint inhibitors (ICIs) markedly promote the survival outcome of advanced melanoma and non-small cell lung cancer (NSCLC). Clinically, favorable ICI treatment efficacy is noticed only in a smaller proportion of patients. Heparan sulfate proteoglycan 2 (HSPG2) frequently mutates in both tumors. Herein, we aim to investigate the immunotherapeutic and immunological roles of <i>HSPG2</i> mutations in melanoma and NSCLC. A total of 631 melanoma samples and 109 NSCLC samples with both somatic mutational profiles and clinical immunotherapy data were curated. In addition, by using The Cancer Genome Atlas data, genomic and immunological traits behind <i>HSPG2</i> mutations were elucidated. Melanoma patients with <i>HSPG2</i> mutations had a markedly extended ICI outcome than other patients. An association between <i>HSPG2</i> mutations and the improved outcome was further confirmed in NSCLC. In addition, an elevated ICI response rate was presented in <i>HSPG2</i>-mutated NSCLC patients (81.8% vs. 29.7%, <i>p</i> = 0.002). Subsequent analyses revealed that <i>HSPG2</i>-mutated patients had a favorable abundance of response immunocytes, an inferior abundance of suppression immunocytes, enhanced mutational burden, and interferon response-relevant signaling pathways. We uncovered that <i>HSPG2</i> mutations were predictive of a better ICI response and associated with preferable immunogenicity, which may be considered as a genomic determinant to customize biotherapy strategies.

Also flagged:G-protein-coupled receptorsGPCRstransmembraneβ2 Adrenergic Receptorβ2-ARmembrane proteins
Journal Article 2022-07-19 ✓ 3 Snippets Di Paola L, Poudel H, Parise M, Giuliani A, Leitner DM.
In-Text Gene Mentions

…map of theDCCmatrix (see Section…

…comparison of theDCCfor active (upper…

…correlation coefficient inDCCin the inactive…

Show Full Abstract

Activation of G-protein-coupled receptors (GPCRs) is mediated by molecular switches throughout the transmembrane region of the receptor. In this work, we continued along the path of a previous computational study wherein energy transport in the β2 Adrenergic Receptor (β2-AR) was examined and allosteric switches were identified in the molecular structure through the reorganization of energy transport networks during activation. In this work, we further investigated the allosteric properties of β2-AR, using Protein Contact Networks (PCNs). In this paper, we report an extensive statistical analysis of the topological and structural properties of β2-AR along its molecular dynamics trajectory to identify the activation pattern of this molecular system. The results show a distinct character to the activation that both helps to understand the allosteric switching previously identified and confirms the relevance of the network formalism to uncover relevant functional features of protein molecules.

Also flagged:electron transfer-titanium dioxidenanoparticlessilveriron oxide
Journal Article 2022-07-19 No Snippets Cameron SJ, Sheng J, Hosseinian F, Willmore WG.
Show Full Abstract

Nanoparticles (NPs) are increasingly used in a wide variety of applications and products; however, NPs may affect stress response pathways and interact with proteins in biological systems. This review article will provide an overview of the beneficial and detrimental effects of NPs on stress response pathways with a focus on NP-protein interactions. Depending upon the particular NP, experimental model system, and dose and exposure conditions, the introduction of NPs may have either positive or negative effects. Cellular processes such as the development of oxidative stress, the initiation of the inflammatory response, mitochondrial function, detoxification, and alterations to signaling pathways are all affected by the introduction of NPs. In terms of tissue-specific effects, the local microenvironment can have a profound effect on whether an NP is beneficial or harmful to cells. Interactions of NPs with metal-binding proteins (zinc, copper, iron and calcium) affect both their structure and function. This review will provide insights into the current knowledge of protein-based nanotoxicology and closely examines the targets of specific NPs.

Also flagged:Factor XIIIcoagulation factor thirteenFXIIIcoagulationbrain injuryTrauma-induced coagulopathy
Journal Article 2022-07-19 ✓ 4 Snippets Katzensteiner M, Ponschab M, Schöchl H, Oberladstätter D, Zipperle J, Osuchowski M, Schlimp CJ.
In-Text Gene Mentions

…range 23.0–33.2 s);antithrombin-IIIactivity (ATIII, normal…

…); antithrombin-III activity (ATIII, normal range 75–125%);…

…Vienna, Austria) andantithrombin-IIIconcentrate (Kybernin ®…

…TP1, whereas theATIIIlevel was significantly…

Show Full Abstract

Trauma patients admitted to an intensive care unit (ICU) may potentially experience a deficiency of coagulation factor thirteen (FXIII). In this retrospective cohort study conducted at a specialized trauma center, ICU patients were studied to determine the dependency of FXIII activity levels on clinical course and substitution with blood and coagulation products. A total of 189 patients with a median injury severity score (ISS) of 25 (16−36, IQR) were included. Abbreviated injury scores for extremities (r = −0.38, p < 0.0001) but not ISS (r = −0.03, p = 0.45) showed a negative correlation with initial FXIII levels. Patients receiving FXIII concentrate presented with a median initial FXIII level of 54 (48−59)% vs. 88 (74−108)%, p < 0.0001 versus controls; they had fewer ICU-free days: 17 (0−22) vs. 22 (16−24), p = 0.0001; and received higher amounts of red blood cell units: 5 (2−9) vs. 4 (1−7), p < 0.03 before, and 4 (2−7) vs. 1 (0−2), p < 0.0001 after FXIII substitution. Matched-pair analyses based on similar initial FXIII levels did not reveal better outcome endpoints in the FXIII-substituted group. The study showed that a low initial FXIII level correlated with the clinical course in this trauma cohort, but a substitution of FXIII did not improve endpoints within the range of the studied FXIII levels. Future prospective studies should investigate the utility of FXIII measurement and lower threshold values of FXIII, which trigger substitution in trauma patients.

Also flagged:PorcinedsRNA-binding proteinRIG-Ibindinginnate immunity responsepattern recognition receptors
Journal Article 2022-07-19 ✓ 4 Snippets Ji L, Liu Q, Wang N, Wang Y, Sun J, Yan Y.
In-Text Gene Mentions

…binding protein staufen1 (STAU1) was identified as…

…the mechanism ofSTAU1on RNA virus…

…we demonstrated thatSTAU1is a highly…

…The porcineSTAU1(pSTAU1) could bind…

Show Full Abstract

Innate immune system composed of pathogen pattern recognition receptors (PRRs) is the first barrier to recognize and defend viral invasion. Previously,the double-stranded RNA binding protein staufen1 (STAU1) was identified as an important candidate in regulating RIG-I/MDA5 signaling axis, which is the major cytosolic PRRs for initiating immune response to antagonize RNA viruses. However, the mechanism of STAU1 on RNA virus infection is still unclear. In the present study, we demonstrated that STAU1 is a highly conservative dsRNA-binding protein in human and mammals. The porcine STAU1 (pSTAU1) could bind to the PEDV original dsRNA in cytoplasm. Furthermore, pSTAU1 is a binding partner that can positively increase the combination of MDA5 and dsRNA in cells, but slightly on RIG-I-dsRNA binding. Moreover, knockdown pSTAU1 led to inhibition of poly(I:C)-stimulated, VSV and RIG-I/MDA5-induced activation of porcine INF-β promotor activation. Overexpression pSTAU1 could positively suppress the VSV proliferation in 3D4/21 cells. In sum, our data identify pSTAU1 as a key component of RIG-I/MDA5 binding viral dsRNA required for innate antiviral immunity in swine. The novel findings provide a new insight into host sensing the RNA-viruses infection.

Also flagged:GFPcytoplasmgene expressionsecretionGUSpeptides
Journal Article 2022-07-19 No Snippets Le NTP, Phan TTP, Phan HTT, Truong TTT, Schumann W, Nguyen HD.
Show Full Abstract

The influence of fusion tags to produce recombinant proteins in the cytoplasm of <i>Bacillus subtilis</i> is not well-studied as in <i>E. coli</i>. This study aimed to investigate the influence of His-tags with different codons on the protein production levels of the high expression gene (<i>gfp+</i>) and low expression gene (<i>egfp</i>) in the cytoplasm of <i>B. subtilis</i> cells. We used three different N-terminal His-tags, M-6xHis, MRGS-8xHis and MEA-8xHis, to investigate their effects on the production levels of GFP variants under the control of the P<i>grac</i>212 in <i>B. subtilis</i>. The fusions of His-tags with GFP+ caused a reduction compared to the construct without His-tag. When three His-tags fused with <i>egfp</i>, the EGFP production levels were significantly increased up to 3.5-, 12-, and 15-fold. This study suggested that His-tag at the N-terminus could enhance the protein production for the low expression gene and reduce that of the high expression gene in <i>B. subtilis</i>.

Also flagged:transcriptional coactivatorsYes-associated proteintranscriptional coactivatorbindingTAZstem
Journal Article 2022-07-19 ✓ 3 Snippets Deng F, Wu Z, Zou F, Wang S, Wang X.
In-Text Gene Mentions

…the ISC markerOlfm4( Wang et…

…such as Lgr5,Olfm4, and Lrig1 (…

…recovered Lgr5 andOlfm4expression 3 –…

Show Full Abstract

The Hippo pathway and its downstream effectors, the transcriptional coactivators Yes-associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ), control stem cell fate and cell proliferation and differentiation and are essential for tissue self-renewal and regeneration. YAP/TAZ are the core components of the Hippo pathway and they coregulate transcription when localized in the nucleus. The intestinal epithelium undergoes well-regulated self-renewal and regeneration programs to maintain the structural and functional integrity of the epithelial barrier. This prevents luminal pathogen attack, and facilitates daily nutrient absorption and immune balance. Inflammatory bowel disease (IBD) is characterized by chronic relapsing inflammation of the entire digestive tract. Impaired mucosal healing is a prominent biological feature of IBD. Intestinal self-renewal is primarily dependent on functional intestinal stem cells (ISCs), especially Lgr5<sup>+</sup> crypt base columnar (CBC) cells and transient-amplifying (TA) cells in the crypt base. However, intestinal wound healing is a complicated process that is often associated with epithelial cells, and mesenchymal and immune cells in the mucosal microenvironment. Upon intestinal injury, nonproliferative cells rapidly migrate towards the wound bed to reseal the damaged epithelium, which is followed by cell proliferation and differentiation. YAP is generally localized in the nucleus of Lgr5<sup>+</sup> CBC cells, where it transcriptionally regulates the expression of the ISC marker Lgr5 and plays an important role in intestinal self-renewal. YAP/TAZ are the primary mechanical sensors of the cellular microenvironment. Their functions include expanding progenitor and stem cell populations, reprogramming differentiated cells into a primitive state, and mediating the regenerative function of reserve stem cells. Thus, YAP/TAZ play extremely crucial roles in epithelial repair after damage. This review provides an overview of the Hippo-YAP/TAZ signaling pathway and the processes of intestinal self-renewal and regeneration. In particular, we summarize the roles of YAP/TAZ in the phases of intestinal self-renewal and regeneration to suggest a potential strategy for IBD treatment.

Also flagged:Aspergillosisfungalgranulomaneutropeniaammoniumdeath
Journal Article 2022-07-19 ✓ 1 Snippet Desoubeaux G, Cray C, Chesnay A.
In-Text Gene Mentions

…For instance,F-box/LRR-repeat protein 4protein 4, THAP…

Show Full Abstract

Aspergillosis remains difficult to diagnose in animals. Laboratory-based assays are far less developed than those for human medicine, and only few studies have been completed to validate their utility in routine veterinary diagnostics. To overcome the current limitations, veterinarians and researchers have to propose alternative methods including extrapolating from human diagnostic tools and using innovative technology. In the present overview, two specific examples were complementarily addressed in penguins and dolphins to illustrate how is challenging the diagnosis of aspergillosis in animals. Specific focus will be made on the novel application of simple testing in blood based on serological assays or protein electrophoresis and on the new information garnered from metabolomics/proteomics to discover potential new biomarkers. In conclusion, while the diagnostic approach of aspergillosis in veterinary medicine cannot be directly taken from options developed for human medicine, it can certainly serve as inspiration.

Also flagged:HDaxonneurotransmittersynaptic vesiclesynapsedoxycycline
Journal Article 2022-07-19 ✓ 5 Snippets Dinamarca MC, Colombo L, Tousiaki NE, Müller M, Pecho-Vrieseling E.
In-Text Gene Mentions

The localization of HTT at the synapse, its prominent role in both pre- and postsynaptic function, and the finding that synaptic dysfunction occurs before neuronal atrophy and behavioral symptoms in HD (Di Figlia et al., 1995; Sun et al., 2001; Marcora and Kennedy, 2010; Rozas et al., 2011; Barron et al., 2021), led us to investigate whether mHTT affects early developmental properties of synaptogenesis in human neurons.

Furthermore, in HD neuronal cultures and mouse models, the HTT mutation results in decreased levels of both Bassoon mRNA and protein (Huang et al., 2020).

…Wild-typeHTTis a regulator…

…the huntingtin (HTT) gene, which…

…of a mutantHTTprotein (mHTT) with…

Show Full Abstract

Huntington's disease (HD) is a monogenic disease that results in a combination of motor, psychiatric, and cognitive symptoms. It is caused by a CAG trinucleotide repeat expansion in the exon 1 of the huntingtin (<i>HTT</i>) gene, which results in the production of a mutant HTT protein (mHTT) with an extended polyglutamine tract (PolyQ). Severe motor symptoms are a hallmark of HD and typically appear during middle age; however, mild cognitive and personality changes often occur already during early adolescence. Wild-type HTT is a regulator of synaptic functions and plays a role in axon guidance, neurotransmitter release, and synaptic vesicle trafficking. These functions are important for proper synapse assembly during neuronal network formation. In the present study, we assessed the effect of mHTT exon1 isoform on the synaptic and functional maturation of human induced pluripotent stem cell (hiPSC)-derived neurons. We used a relatively fast-maturing hiPSC line carrying a doxycycline-inducible pro-neuronal transcription factor, (iNGN2), and generated a double transgenic line by introducing only the exon 1 of <i>HTT,</i> which carries the mutant CAG (<i>mHTTEx1</i>). The characterization of our cell lines revealed that the presence of mHTTEx1 in hiPSC-derived neurons alters the synaptic protein appearance, decreases synaptic contacts, and causes a delay in the development of a mature neuronal activity pattern, recapitulating some of the developmental alterations observed in HD models, nonetheless in a shorted time window. Our data support the notion that HD has a neurodevelopmental component and is not solely a degenerative disease.

Also flagged:Tripartite motif-containing genesTRIMsimmunitytumorimmune responsesbreast cancer
Journal Article 2022-07-19 ✓ 5 Snippets Ning L, Huo Q, Xie N.
In-Text Gene Mentions

DCC is considered a tumor suppressor; downregulation of TRIM9 and TRIM68 in BC may lead to changes in BC, although we did not see the correlation in the mRNA level (Spearman coefficient r = 0.022, 0.043).

Some genes (TRIM22/TRIM38/TRIM5/TRIM59) are expressed lower in tumor cells than in other cell types (Figures 4D–F).

…Some genes ( TRIM22/TRIM38/TRIM5/TRIM59 ) are expressed…

…netrin 1 receptor (DCC).…

DCCis considered a…

Show Full Abstract

Tripartite motif-containing genes (TRIMs), with a ubiquitin ligase's function, play critical roles in antitumor immunity by activating tumor-specific immune responses and stimulating tumor proliferation, thus affecting patient outcomes. However, the expression pattern and prognostic values of TRIMs in breast cancer (BC) are not well clarified. In this study, several datasets and software were integrated to perform a comprehensive analysis of the expression pattern in TRIMs and investigate their prognosis values in BC. We found that <i>TRIM59/46</i> were significantly upregulated and <i>TRIM66/52-AS1/68/7/2/9/29</i> were decreased in BC and validated them using an independent cohort. The expression of numerous TRIMs are significantly correlated with BC molecular subtypes, but not with tumor stages or patient age at diagnosis. Higher expression of <i>TRIM3</i>/<i>14</i>/<i>69</i>/<i>45</i> and lower expressions of <i>TRIM68</i>/<i>2</i> were associated with better overall survival in BC using the Kaplan-Meier analysis. The multivariate Cox proportional hazards model identified <i>TRIM45</i> as an independent prognostic marker. Further analysis of single-cell RNA-seq data revealed that most TRIMs are also expressed in nontumor cells. Higher expression of some TRIMs in the immune or stromal cells suggests an important role of TRIMs in the BC microenvironment. Functional enrichment of the co-expression genes indicates that they may be involved in muscle contraction and interferon-gamma signaling pathways. In brief, through the analysis, we provided several TRIMs that may contribute to the tumor progression and <i>TRIM45</i> as a potential new prognostic biomarker for BC.

Also flagged:polymerasegenetic disordersTAOK1Brain AbnormalitiesTAO kinaseTAOK2
Journal Article 2022-07-19 ✓ 2 Snippets Yu L, Yang C, Shang N, Ding H, Zhu J, Zhu Y, Tan H, Zhang Y.
In-Text Gene Mentions

…TAOK2 , andTAOK3, which encode…

…TAOK1, TAOK2, andTAOK3, respectively ( Dan…

Show Full Abstract

A dilated lateral ventricle is a relatively common finding on prenatal ultrasound, and the causes are complex. We aimed to explore the etiology of a fetus with a dilated lateral ventricle. Trio whole-exome sequencing was performed to detect causative variants. A <i>de novo</i> variant of <i>TAOK1</i> (NM_020791.2: c.227A>G) was detected in the proband and evaluated for potential functional impacts using a variety of prediction tools. Droplet digital polymerase chain reaction was used to exclude the parental mosaicism and to verify the phasing of the <i>de novo</i> variant. Based on peripheral blood analysis, the parents did not exhibit mosaicism at this site, and the <i>de novo</i> variant was paternally derived. Here, we describe a fetus with a <i>de novo</i> likely pathogenic variant of <i>TAOK1</i> who had a dilated lateral ventricle and a series of particular phenotypes. This case expands the clinical spectrum of <i>TAOK1</i>-associated disorders. We propose a method for solving genetic disorders in which the responsible genes have not yet gone through ClinGen curation, particularly for prenatal cases.

Also flagged:Non-Alcoholic Fatty Liver Diseasechronic diseasesNAFLDPDhepatic steatosisalcohol
Journal Article 2022-07-19 ✓ 1 Snippet Sohouli MH, Fatahi S, Izze da Silva Magalhães E, Rodrigues de Oliveira B, Rohani P, Ezoddin N, Roshan MM, Hekmatdoost A.
In-Text Gene Mentions

…oholic steatohepatitis (NASH),hemochromatosis, viral infections, or…

Show Full Abstract

<h4>Background</h4>Evidence suggests the role of changing traditional lifestyle patterns, such as Paleolithic, to the modern lifestyle in the incidence and epidemic of chronic diseases. The purpose of this study was to investigate the associations between the Paleolithic diet (PD) and the Paleolithic-like lifestyle and the risk of non-alcoholic fatty liver disease (NAFLD) among an adult population.<h4>Materials and methods</h4>This case-control study was carried out among 206 patients with NAFLD and 306 healthy subjects aged >18 years. PD score was evaluated using a validated 168-item quantitative food frequency questionnaire. In addition, to calculate the Paleolithic-like lifestyle score, the components of physical activity, body mass index (BMI), and smoking status of the participants were combined with the score of the PD.<h4>Results</h4>The mean PD and Paleolithic-like lifestyle scores were 38.11 ± 5.63 and 48.92 ± 6.45, respectively. After adjustment for potential confounders, higher scores of adherence to the PD diet conferred a protection for the presence of NAFLD [odds ratio (OR): 0.53; 95% confidence interval (CI): 0.28-0.98; <i>P</i> for trend = 0.021]. Furthermore, PD and healthy lifestyle habits were negatively associated with NAFLD (OR = 0.42, 95% CI 0.23-0.78; <i>P</i> for trend = 0.007).<h4>Conclusion</h4>Our data suggest that the PD alone and in combination with lifestyle factors was associated with decreased risk of NAFLD in a significant manner in the overall population. However, prospective studies are needed to further investigate this association.

Also flagged:Nanogelsneurodegenerative disordersbrain tumorsepilepsyischemic strokecentral nervous system
Journal Article 2022-07-19 ✓ 2 Snippets Zhang Y, Zou Z, Liu S, Miao S, Liu H.
In-Text Gene Mentions

The known molecular mechanism of HD involves a single mutation of the huntingtin (HTT) gene exon 1, which leads to polyQ expansion, resulting in the misfolding and aggregation of the huntingtin protein in the brain (Li et al., 2020).

The nanocarrier complex reduces HTT gene expression in ST14A-Htt120q rat striatum cells and primary human HD fibroblasts.

Show Full Abstract

Nanogels have come out as a great potential drug delivery platform due to its prominently high colloidal stability, high drug loading, core-shell structure, good permeation property and can be responsive to environmental stimuli. Such nanoscopic drug carriers have more excellent abilities over conventional nanomaterials for permeating to brain parenchyma <i>in vitro</i> and <i>in vivo</i>. Nanogel-based system can be nanoengineered to bypass physiological barriers via non-invasive treatment, rendering it a most suitable platform for the management of neurological conditions such as neurodegenerative disorders, brain tumors, epilepsy and ischemic stroke, etc. Therapeutics of central nervous system (CNS) diseases have shown marked limited site-specific delivery of CNS by the poor access of various drugs into the brain, due to the presences of the blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BCSFB). Hence, the availability of therapeutics delivery strategies is considered as one of the most major challenges facing the treatment of CNS diseases. The primary objective of this review is to elaborate the newer advances of nanogel for CNS drugs delivery, discuss the early preclinical success in the field of nanogel technology and highlight different insights on its potential neurotoxicity.

Also flagged:brainagingneurodegenerative diseaseADneurodegenerative diseaseslearning disorders
Journal Article 2022-07-19 No Snippets Jett S, Schelbaum E, Jang G, Boneu Yepez C, Dyke JP, Pahlajani S, Diaz Brinton R, Mosconi L.
Show Full Abstract

Ovarian hormones, particularly 17β-estradiol, are involved in numerous neurophysiological and neurochemical processes, including those subserving cognitive function. Estradiol plays a key role in the neurobiology of aging, in part due to extensive interconnectivity of the neural and endocrine system. This aspect of aging is fundamental for women's brains as all women experience a drop in circulating estradiol levels in midlife, after menopause. Given the importance of estradiol for brain function, it is not surprising that up to 80% of peri-menopausal and post-menopausal women report neurological symptoms including changes in thermoregulation (vasomotor symptoms), mood, sleep, and cognitive performance. Preclinical evidence for neuroprotective effects of 17β-estradiol also indicate associations between menopause, cognitive aging, and Alzheimer's disease (AD), the most common cause of dementia affecting nearly twice more women than men. Brain imaging studies demonstrated that middle-aged women exhibit increased indicators of AD endophenotype as compared to men of the same age, with onset in perimenopause. Herein, we take a translational approach to illustrate the contribution of ovarian hormones in maintaining cognition in women, with evidence implicating menopause-related declines in 17β-estradiol in cognitive aging and AD risk. We will review research focused on the role of endogenous and exogenous estrogen exposure as a key underlying mechanism to neuropathological aging in women, with a focus on whether brain structure, function and neurochemistry respond to hormone treatment. While still in development, this research area offers a new sex-based perspective on brain aging and risk of AD, while also highlighting an urgent need for better integration between neurology, psychiatry, and women's health practices.

Also flagged:polyphenolsoxygenALSdegradationexcretionNeurodegenerative Diseases
Journal Article 2022-07-19 ✓ 1 Snippet Marino A, Battaglini M, Moles N, Ciofani G.
In-Text Gene Mentions

This phenomenon may be attributed tothe impairment of the ascorbate-dependent collagen synthesis thatis necessary for both blood vessels and myelin formation.21 Moreover, The role of ascorbic acid deficiencyin AD was studied by Dixit et al. in biogenic mouse models heterozygousfor the SVCT2 ascorbate transporter and with human AD mutations inthe APP presenilin and (PSEN1) genes.22 The deficiency of ascorbic acid in the CNS impairscognition, enhances amyloid deposition, and increases oxidative stressin both the APP/PSEN1 model and in aging wild-type mice.22 Furthermore, ascorbic acid displays a neuroprotectionrole against glutamate-dependent excitotoxicity and neurodegenerationin the developing postnatal rat brain.23 Concerning HD, interesting work by Castro’s group demonstratedthat the SVCT2 ascorbate transporter of striatal neurons expressingthe mutant huntingtin (HTT) gene failed the translocationto the plasma membrane, with consequent impairment of the ascorbicacid uptake.24 The authors suggested thatthis phenomenon may produce early metabolic failure and neurodegenerationin HD.

Show Full Abstract

Natural antioxidants are a very large diversified family of molecules classified by activity (enzymatic or nonenzymatic), chemical-physical properties (e.g., hydrophilic or lipophilic), and chemical structure (e.g., vitamins, polyphenols, etc.). Research on natural antioxidants in various fields, such as pharmaceutics, nutraceutics, and cosmetics, is among the biggest challenges for industry and science. From a biomedical point of view, the scavenging activity of reactive oxygen species (ROS) makes them a potential tool for the treatment of neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, Huntington's disease, dementia, and amyotrophic lateral sclerosis (ALS). In addition to the purified phytochemical compounds, a variety of natural extracts characterized by a complex mixture of antioxidants and anti-inflammatory molecules have been successfully exploited to rescue preclinical models of these diseases. Extracts derived from <i>Ginkgo biloba</i>, grape, oregano, curcumin, tea, and ginseng show multitherapeutic effects by synergically acting on different biochemical pathways. Furthermore, the reduced toxicity associated with many of these compounds limits the occurrence of side effects. The support of nanotechnology for improving brain delivery, controlling release, and preventing rapid degradation and excretion of these compounds is of fundamental importance. This review reports on the most promising results obtained on <i>in vitro</i> systems, <i>in vivo</i> models, and in clinical trials, by exploiting natural-derived antioxidant compounds and extracts, in their free form or encapsulated in nanocarriers.

Also flagged:phloretinTRAILpolyphenolstumor necrosis factor-related apoptosis-inducing ligandcolon cancercancer
Journal Article 2022-07-19 ✓ 1 Snippet Kim JL, Lee DH, Pan CH, Park SJ, Oh SC, Lee SY.
In-Text Gene Mentions

…no. 4976) and anti-c-poly(ADP-ribose) polymerasepolymerase (PARP) (rabbit…

Show Full Abstract

Phloretin is one of the apple polyphenols with anticancer activities. Since tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) serves important roles in inducing apoptosis, the present study examined the effect of phloretin on TRAIL-induced apoptosis in colon cancer cells. Treatment with both phloretin and TRAIL markedly suppressed the survival of cancer cells from several colon cancer cell lines compared with that of cells treated with either TRAIL or phloretin. Additionally, decreased numbers of colonies were observed following addition of phloretin and TRAIL. Furthermore, TRAIL- and phloretin-treated HT-29-Luc cells exhibited decreased luciferase activity. Increased apoptosis was observed in phloretin- and TRAIL-treated HT-29-Luc colon cancer cells, accompanying elevated levels of cleaved poly(ADP-ribose) polymerase, and caspase-3, -8 and -9. The expression levels of MCL1 apoptosis regulator BCL2 family member (Mcl-1) were decreased following addition of phloretin in colon cancer cells. In addition, overexpression of Mcl-1 in phloretin- and TRAIL-treated HT-29-Luc cells resulted in increased cell survival. Treatment of HT-29-Luc cells with a combination of cycloheximide (CHX) and phloretin led to a more prominent decrease in Mcl-1 expression compared with that in cells treated with CHX alone, while Mcl-1 expression was recovered by treatment with MG132. Binding of ubiquitin with Mcl-1 was verified using immunoprecipitation. Intraperitoneal injection of both TRAIL and phloretin into tumor xenografts was associated with a decreased tumor volume compared with that following injection with either TRAIL or phloretin. Overall, the present results suggest a synergistic effect of phloretin on TRAIL-induced apoptosis in colon cancer cells.

Also flagged:myocardial infarctionTAK1ubiquitin E3 ligaseangiotensin IIMIsecretion
Journal Article 2022-07-19 ✓ 5 Snippets Lu Z, Hao C, Qian H, Zhao Y, Bo X, Yao Y, Ma G, Chen L.
In-Text Gene Mentions

Mechanistically, TRIM38 suppressed cardiac fibrosis progression by attenuating TAK1/MAPK signaling.

This was consistent with our finding that TRIM38-mediated degradation of TAB2/3 was completely impeded by an inhibitor of the lysosome (chloroquine), but not by a proteasome inhibitor (MG132).

TRIM38 expression is decreased in a mouse model of myocardial infarction

Thus, we hypothesized that TRIM38 targeted the TAK1-TAB2/3 complex to regulate cardiac fibrosis.

Myocardial disorders and cardiac interstitial fibrosis were markedly alleviated in AAV9-TRIM38 mice after MI (Figures 4D and 4E).

Show Full Abstract

The role of tripartite motif (TRIM) 38, a ubiquitin E3 ligase regulating various pathophysiological processes, in cardiac fibrosis remains unclear. Here, a model of angiotensin II and myocardial infarction (MI)-induced fibrosis was established to explore its role in cardiac fibrosis and its underlying mechanisms. Cardiac fibrosis in the mouse MI model was mitigated by TRIM38 overexpression, but aggravated by its depletion. Consistently, <i>in vitro</i> overexpression or knockdown of TRIM38 ameliorated or aggravated the proliferation and secretion of cardiac fibroblasts (CFs) exposed to fibrotic stimulation, respectively. Mechanistically, TRIM38 suppressed cardiac fibrosis progression by attenuating TAK1/MAPK signaling. Inhibiting TAK1/MAPK signaling with a pharmacological inhibitor greatly reversed the effects of TRIM38 knockdown on CF secretion. Specifically, TRIM38 interacted with and "targeted" TAB2 and TAB3 for degradation, subsequently inhibiting TAK1 phosphorylation and negatively regulating MAPK signaling. These findings can help develop therapeutic strategies to treat and prevent cardiac fibrosis.

Also flagged:Membranecyaninelipidesterdegradationbinding
Journal Article 2022-07-19 No Snippets Gaikwad H, Wang G, Li Y, Bourne D, Simberg D.
Show Full Abstract

Red blood cells (RBCs) are natural carriers for sustained drug delivery, imaging, and in vivo sensing. One of the popular approaches to functionalize RBCs is through lipophilic anchors, but the structural requirements for anchor stability and in vivo longevity remain to be investigated. Using fluorescent lipids with the same cyanine 3 (Cy3) headgroup but different lipid chain and linker, the labeling efficiency of RBCs and in vivo stability are investigated. Short-chain derivatives exhibited better insertion efficiency, and mouse RBCs are better labeled than human RBCs. Short-chain derivatives demonstrate low retention in vivo. Derivatives with ester bonds are especially unstable, due to removal and degradation. On the other hand, long-chain, covalently linked derivatives show remarkably long retention and stability (over 80 days half life in the membrane). The clearance organs are liver and spleen with evidence of lipid transfer to the liver sinusoidal endothelium. Notably, RBCs modified with PEGylated lipid show decreased macrophage uptake. Some of the derivatives promote binding of antibodies in human plasma and mouse sera and modest increase in complement deposition and hemolysis, but these do not correlate with in vivo stability of RBCs. Ultra-stable anchors can enable functionalization of RBCs for drug delivery, imaging, and sensing.

Research Square 2022-07-19 Preprint (No Snippets API) Vedove AD, Natarajan J, Zanni G, Eckenweiler M, Bühl AM, Storbeck M, Boixet JG, Barresi S, Pizzi S, Hölker I, Körber F, Franzmann TM, Bertini ES, Kirschner J, Alberti S, Tartaglia M, Wirth B.
Show Full Abstract

<title>Abstract</title> <p>CAPRIN1 is a ubiquitously expressed protein, abundant in the brain, where it regulates the transport and translation of mRNAs of genes involved in synaptic plasticity. Here we describe two unrelated children, who developed early-onset ataxia, dysarthria, cognitive decline and muscular weakness. Trio exome sequencing unraveled the identical <italic>de novo</italic> c.1535C>T (p.Pro512Leu) missense variant in <italic>CAPRIN1</italic>, affecting a highly conserved residue. <italic>In silico</italic> analyses predict an increased aggregation propensity of the mutated protein. Indeed, overexpressed CAPRIN1<sup>P512L</sup> forms insoluble ubiquitinated aggregates, sequestrating proteins associated with neurodegenerative disorders (ATXN2, GEMIN5, SNRNP200 and SNCA). Moreover, the CAPRIN1<sup>P512L</sup> mutation in isogenic iPSC-derived cortical neurons causes reduced neuronal activity and altered stress granule dynamics. Furthermore, nano-differential scanning fluorimetry reveals that CAPRIN1<sup>P512L</sup> aggregation is strongly enhanced by RNA <italic>in vitro</italic>. These findings associate the gain-of-function Pro512Leu mutation to early-onset ataxia and neurodegeneration, unveiling a critical residue of CAPRIN1 and a key role of RNA-protein interactions.</p>

bioRxiv 2022-07-19 Preprint (No Snippets API) Avvisati R, Kaufmann A, Young CJ, Portlock GE, Cancemi S, Costa RP, Magill PJ, Dodson PD.
Show Full Abstract

<h4>ABSTRACT</h4> Midbrain dopamine neurons are thought to play key roles in learning by conveying the difference between expected and actual outcomes. While this teaching signal is often considered to be uniform, recent evidence instead supports diversity in dopamine signaling. However, it remains poorly understood how heterogeneous signals might be organized to facilitate the role of downstream circuits mediating distinct aspects of behavior. Here we investigated the organizational logic of dopaminergic signaling by recording and labeling individual midbrain dopamine neurons during associative behavior. We defined combinations of protein expression and cellular localization to sort recorded neurons according to the striatal regions they innervate. Our findings show that reward information and task variables are not only heterogeneously encoded, with multiplexing, but also differentially distributed across populations of dopamine neurons projecting to different regions of striatum. These data, supported by computational modelling, indicate that such distributional coding can maximize dynamic range and tailor dopamine signals to facilitate the specialized roles of different striatal regions.

Also flagged:Diabetic nephropathyDNend-stage renal diseaseESRDdiabetes mellituschronic kidney diseases
Journal Article 2022-07-18 No Snippets Abid F, Rubab Z, Fatima S, Qureshi A, Azhar A, Jafri A.
Show Full Abstract

<h4>Background</h4>Human Kidney Injury Molecule-1, also known as HAVCR-1 (Hepatitis A virus cellular receptor 1), belongs to the cell-surface protein of immunoglobulin superfamily involved in the phagocytosis by acting as scavenger receptor epithelial cells. The study focused on pinpointing the mechanisms and genes that interact with KIM-1.<h4>Methods</h4>This in-silico study was done from March 2019 to December 2019. The Enrichment and protein-protein interaction (PPI) network carefully choose proteins. In addition, the diagramed gene data sets were accomplished using FunRich version 3.1.3. It was done to unveil the proteins that may affect the regulation of HAVCR1 or may be regulated by this protein. These genes were then further considered in pathway analysis to discover the dysregulated pathways in diabetic nephropathy. The long list of differentially expressed genes is meaningless without pathway analysis.<h4>Results</h4>Critical pathways that are dysregulated in diabetic nephropathy patients have been identified. These include Immune System (Total = 237, P < 0.05), Innate Immune System (Total = 140, P < 0.05), Cytokine Signaling Immune system (Total = 116, P < 0.05), Adaptive Immune System (Total = 85) and Neutrophil degranulation (Total = 78).<h4>Conclusion</h4>The top 5 genes that are interacting directly with HIVCR1 include CASP3, CCL2, SPP1, B2M, and TIMP1 with degrees 161, 144, 108, 107, and 105 respectively for Immune system pathways (Innate Immune System, Cytokine Signaling Immune system, Adaptive Immune System and Neutrophil degranulation).

Also flagged:CalciumCancerdeathcalcium channelsmitochondrialimmunoregulation
Journal Article 2022-07-18 No Snippets Bai S, Lan Y, Fu S, Cheng H, Lu Z, Liu G.
Show Full Abstract

As the indispensable second cellular messenger, calcium signaling is involved in the regulation of almost all physiological processes by activating specific target proteins. The importance of calcium ions (Ca<sup>2+</sup>) makes its "Janus nature" strictly regulated by its concentration. Abnormal regulation of calcium signals may cause some diseases; however, artificial regulation of calcium homeostasis in local lesions may also play a therapeutic role. "Calcium overload," for example, is characterized by excessive enrichment of intracellular Ca<sup>2+</sup>, which irreversibly switches calcium signaling from "positive regulation" to "reverse destruction," leading to cell death. However, this undesirable death could be defined as "calcicoptosis" to offer a novel approach for cancer treatment. Indeed, Ca<sup>2+</sup> is involved in various cancer diagnostic and therapeutic events, including calcium overload-induced calcium homeostasis disorder, calcium channels dysregulation, mitochondrial dysfunction, calcium-associated immunoregulation, cell/vascular/tumor calcification, and calcification-mediated CT imaging. In parallel, the development of multifunctional calcium-based nanomaterials (e.g., calcium phosphate, calcium carbonate, calcium peroxide, and hydroxyapatite) is becoming abundantly available. This review will highlight the latest insights of the calcium-based nanomaterials, explain their application, and provide novel perspective. Identifying and characterizing new patterns of calcium-dependent signaling and exploiting the disease element linkage offer additional translational opportunities for cancer theranostics.

Also flagged:IronCOVID-19pathogenesisanemiahypoferremiahyperferritinemia
Journal Article 2022-07-18 No Snippets Suriawinata E, Mehta KJ.
Show Full Abstract

COVID-19 can cause detrimental effects on health. Vaccines have helped in reducing disease severity and transmission but their long-term effects on health and effectiveness against future viral variants remain unknown. COVID-19 pathogenesis involves alteration in iron homeostasis. Thus, a contextual understanding of iron-related parameters would be very valuable for disease prognosis and therapeutics.Accordingly, we reviewed the status of iron and iron-related proteins in COVID-19. Iron-associated alterations in COVID-19 reported hitherto include anemia of inflammation, low levels of serum iron (hypoferremia), transferrin and transferrin saturation, and high levels of serum ferritin (hyperferritinemia), hepcidin, lipocalin-2, catalytic iron, and soluble transferrin receptor (in ICU patients). Hemoglobin levels can be low or normal, and compromised hemoglobin function has been proposed. Membrane-bound transferrin receptor may facilitate viral entry, so it acts as a potential target for antiviral therapy. Lactoferrin can provide natural defense by preventing viral entry and/or inhibiting viral replication. Serum iron and ferritin levels can predict COVID-19-related hospitalization, severity, and mortality. Serum hepcidin and ferritin/transferrin ratio can predict COVID-19 severity. Here, serum levels of these iron-related parameters are provided, caveats of iron chelation for therapy are discussed and the interplay of these iron-related parameters in COVID-19 is explained.This synopsis is crucial as it clearly presents the iron picture of COVID-19. The information may assist in disease prognosis and/or in formulating iron-related adjunctive strategies that can help reduce infection/inflammation and better manage COVID-19 caused by future variants. Indeed, the current picture will augment as more is revealed about these iron-related parameters in COVID-19.

Also flagged:MembranesMembrane ProteinMembrane proteinsmembranetransportersphospholipid
Journal Article 2022-07-18 No Snippets Piper SJ, Johnson RM, Wootten D, Sexton PM.
Show Full Abstract

Membrane proteins are highly diverse in both structure and function and can, therefore, present different challenges for structure determination. They are biologically important for cells and organisms as gatekeepers for information and molecule transfer across membranes, but each class of membrane proteins can present unique obstacles to structure determination. Historically, many membrane protein structures have been investigated using highly engineered constructs or using larger fusion proteins to improve solubility and/or increase particle size. Other strategies included the deconstruction of the full-length protein to target smaller soluble domains. These manipulations were often required for crystal formation to support X-ray crystallography or to circumvent lower resolution due to high noise and dynamic motions of protein subdomains. However, recent revolutions in membrane protein biochemistry and cryo-electron microscopy now provide an opportunity to solve high resolution structures of both large, >1 megadalton (MDa), and small, <100 kDa (kDa), drug targets in near-native conditions, routinely reaching resolutions around or below 3 Å. This review provides insights into how the recent advances in membrane biology and biochemistry, as well as technical advances in cryo-electron microscopy, help us to solve structures of a large variety of membrane protein groups, from small receptors to large transporters and more complex machineries.

Also flagged:cirrhosisinfectionsinfectionportal hypertensionportal vein thrombosisesophageal varices
Journal Article 2022-07-18 ✓ 1 Snippet Wehmeyer MH, Sekhri H, Wroblewski R, Galante A, Meyer T, Lohse AW, Schulze Zur Wiesch J.
In-Text Gene Mentions

…1 patient withhemochromatosis, 1 patient with…

Show Full Abstract

<h4>Background</h4>Asplenia or functional hyposplenism are risk factors for severe infections, and vaccinations against encapsulated bacteria are advised. There are only limited data regarding the spleen function of cirrhotic patients.<h4>Methods</h4>We evaluated spleen function in patients with liver cirrhosis, who were prospectively enrolled in this study. Spleen function was evaluated by the measurement of pitted erythrocytes. Functional hyposplenism was defined as a percentage of PE of >15%.<h4>Results</h4>117 patients, mean age 58.4 years and 61.5% (n = 72) male with liver cirrhosis were included. Functional hyposplenism was diagnosed in 28/117 patients (23.9%). Pitted erythrocytes correlated with albumin (p = 0.024), bilirubin (p<0.001), international normalized ratio (INR; p = 0.004), model of end-stage liver disease (MELD) score (p<0.001) and liver stiffness (p = 0.011). Patients with functional hyposplenism had higher MELD scores (median 13 vs. 10; p = 0.021), liver stiffness (46.4 kPa vs. 26.3 kPa; p = 0.011), INR (1.3 vs. 1.2; p = 0.008) and a higher Child-Pugh stage (Child C in 32.1% vs. 11.2%; p = 0.019) as compared to patients without functional hyposplenism. Functional hyposplenism was not associated with the etiology of cirrhosis. Importantly, 9/19 patients with Child C cirrhosis had functional hyposplenism.<h4>Conclusion</h4>A quarter of patients with liver cirrhosis and almost 50% of patients with Child C cirrhosis have functional hyposplenism. Functional hyposplenism is associated with poor liver function and the degree of portal hypertension, which is characterized by higher liver stiffness measurements in transient elastography.

Also flagged:photonpositronlanthanidewaterelectrondodecane
Journal Article 2022-07-18 No Snippets Oliveira AC, Filipe HAL, Ramalho JPP, Salvador A, Geraldes CFGC, Moreno MJ, Loura LMS.
Show Full Abstract

The correct parametrization of lanthanide complexes is of the utmost importance for their characterization using computational tools such as molecular dynamics simulations. This allows the optimization of their properties for a wide range of applications, including medical imaging. Here we present a systematic study to establish the best strategies for the correct parametrization of lanthanide complexes using [Gd(DOTA)]<sup>-</sup> as a reference, which is used as a contrast agent in MRI. We chose the bonded model to parametrize the lanthanide complexes, which is especially important when considering the study of the complex as a whole (e.g., for the study of the dynamics of its interaction with proteins or membranes). We followed two strategies: a so-called heuristic approach employing strategies already published by other authors and another based on the more recent MCPB.py tool. Adjustment of the Lennard-Jones parameters of the metal was required. The final topologies obtained with both strategies were able to reproduce the experimental ion to oxygen distance, vibrational frequencies, and other structural properties. We report a new strategy to adjust the Lennard-Jones parameters of the metal ion in order to capture dynamic properties such as the residence time of the capping water (τ<sub>m</sub>). For the first time, the correct assessment of the τ<sub>m</sub> value for Gd-based complexes was possible by recording the dissociative events over up to 10 μs all-atom simulations. The MCPB.py tool allowed the accurate parametrization of [Gd(DOTA)]<sup>-</sup> in a simpler procedure, and in this case, the dynamics of the water molecules in the outer hydration sphere was also characterized. This sphere was divided into the first hydration layer, an intermediate region, and an outer hydration layer, with a residence time of 18, 10 and 19 ps, respectively, independent of the nonbonded parameters chosen for Gd<sup>3+</sup>. The Lennard-Jones parameters of Gd<sup>3+</sup> obtained here for [Gd(DOTA)]<sup>-</sup> may be used with similarly structured gadolinium MRI contrast agents. This allows the use of molecular dynamics simulations to characterize and optimize the contrast agent properties. The characterization of their interaction with membranes and proteins will permit the design of new targeted contrast agents with improved pharmacokinetics.

Also flagged:Tolfenamic acidNox1p53p53-induced gene 1malonic acidoxygen
Journal Article 2022-07-18 ✓ 4 Snippets Yang X, Zhang H, Qu T, Wang Y, Zhong Y, Yan Y, Ji X, Chi T, Liu P, Zou L.
In-Text Gene Mentions

Wig1 interacts with Htt mRNA, preferentially with mutant Htt, and mediates HD-associated pathological cellular phenotypes.

…be no mutantHttin malonic acid-injected…

…Wig1 interacts withHttmRNA, preferentially with…

…preferentially with mutantHtt, and mediates HD-associated…

Show Full Abstract

It has been reported that wild-type p53-induced gene 1 (Wig1), which is downstream of p53, regulates the expression of mutant huntingtin protein (mHtt) in Huntington's disease (HD) patients and transgenic mouse brains. Intrastriatal injection of malonic acid in rats is often used as a model to study the pathological changes of Huntington's disease, and this model has the advantages of a fast preparation and low cost. Therefore, in this study, we used intrastriatal injections of 6 μM malonic acid in rats to evaluate the effect of tolfenamic acid on motor and cognitive deficits and the effect of 6 mg/kg and 32 mg/kg tolfenamic acid on p53 and its downstream targets, such as Wig1. The results showed that 32 mg/kg tolfenamic acid attenuated motor and spatial memory dysfunction, prevented Nox1-mediated reactive oxygen species (ROS) production, and downregulated the activity of p53 by increasing the phosphorylation level at the Ser378 site and decreasing the acetylation level at the Lys382 site. Tolfenamic acid reduced mouse double minute 2 (Mdm2), phosphatase and tensin homologue (Pten), P53-upregulated modulator of apoptosis (Puma) and Bcl2-associated X (Bax) at the mRNA level to inhibit apoptosis and downregulated sestrin 2 (Sesn2) and hypoxia inducible factor 1, alpha subunit (Hif-1α) mRNA levels to exert antioxidative stress effects. In addition, 32 mg/kg tolfenamic acid played a role in neuroprotection by decreasing the terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL)-positive cell numbers. However, there was no difference in the Wig mRNA level among all groups, and tolfenamic acid could not decrease the protein level of Wig1. In conclusion, tolfenamic acid inhibited the ROS-generating oxidase Nox1-regulated p53 activity and attenuated motor and spatial memory deficits in malonic acid-injected rats.

Also flagged:membranesPostpartumplacental abruptionchorioamnionitiseclampsiapreeclampsia
Journal Article 2022-07-18 No Snippets Karimi N, Molaee G, Tarkesh Esfahani N, Montazeri A.
Show Full Abstract

<h4>Background</h4>The third stage of labor begins with the baby's birth and ends with the expulsion of the placenta and embryonic membranes. The prolongation of the third stage of labor, placental retention, subsequent issues such as postpartum hemorrhage, and manual removal of the placenta have adverse outcomes, which eventually affect the positive experience of delivery. The present study aimed to assess the effect of placental cord drainage on the duration of the third stage of labor and to clarify its effects on postpartum hemorrhage, retained placenta, and incidence of manual removal of placenta.<h4>Methods</h4>This study was a parallel-group randomized trial. Four hundred women in the third stage of labor after vaginal delivery were randomized into the drainage (placenta drainage, n = 200) and the control groups (no placenta drainage, n = 200). In both groups, the third stage of labor was performed with the active method, and the placenta was removed using the Brandt-Andrews maneuver with maternal pushing. The duration of the third stage was compared between the two groups as the primary outcome. Also, the incidence of postpartum hemorrhage, retained placenta, and manual removal of placenta was compared.<h4>Results</h4>In all, 175 women in the drainage group and 165 women in the control group were included in the analysis. The third stage of labor was significantly shorter after placental cord drainage. The mean duration of the third stage was 7.09 ± 1.01 minutes in the drainage group, and it was 10.43 ± 3.20 minutes in the control group (P < 0.001). Postpartum hemorrhage, retained placenta, and incidence of manual removal of placenta in the drainage group was significantly less than in the control group.<h4>Conclusion</h4>Placental cord drainage is a simple and non-invasive method of reducing the duration of the third stage of labor. This method does not increase postpartum complications.<h4>Trial registration</h4>IRCT2014041917341N1 , retrospectively registered at 15. 10. 2017.

Also flagged:melatoninspermatogenesisDoxorubicinreproductiongerm cell proliferationPCNA
Journal Article 2022-07-18 ✓ 4 Snippets Zi T, Liu Y, Zhang Y, Wang Z, Wang Z, Zhan S, Peng Z, Li N, Liu X, Liu F.
In-Text Gene Mentions

…SOD1, CAT andPRDX6, and the apoptotic…

…SOD1, CAT andPRDX6that had been…

…maintained SOD1 andPRDX6expression levels (which…

…SOD1,PRDX6and CAT had…

Show Full Abstract

Doxorubicin (DOX) is an effective chemotherapy drug, but its clinical use has adverse effects on male reproduction. However, there are few studies about the specific biological processes related to male reproduction or strategies for improving fertility protection. In this paper, we examined the effects of DOX on spermatogenesis and sperm function, and tested the possible protective role of melatonin (MLT) against DOX's reproductive toxicity. DOX-treated mice showed signs of significantly impaired spermatogenesis, including vacuolated epithelial cells, decreased testis weights, and lowered sperm counts and motility. DOX also reduced germ cell proliferation (PCNA) and meiosis-related proteins (SYCP3), but this effect could be partially improved with MLT administration. HSPA2 expression was maintained, which indicated that although MLT did not improve sperm motility, it did have a significant protective effect on elongated sperm. IVF results showed that MLT could partially promote two-cell and blastocyte development that was restricted by DOX. MLT reversed DOX-driven changes in the testes, including the antioxidant indices of SOD1, CAT and PRDX6, and the apoptotic indices of BAX and Caspase3. These results suggest that MLT effectively prevents DOX-induced early reproductive toxicity, and increase our understanding of the molecular mechanisms underlying DOX's effects on male reproduction and the protective mechanism of MLT.

Also flagged:estrusreproductionTYRPASIPMITFKIT
Journal Article 2022-07-18 ✓ 3 Snippets Zhang CL, Liu C, Zhang J, Zheng L, Chang Q, Cui Z, Liu S.
In-Text Gene Mentions

…TMTC2, USP25 andVRK2.…

PCDH17can affect the…

…luteum 64 ,PCDH17is involved in…

Show Full Abstract

The southern margin of the Taklimakan Desert is characterized by low rainfall, heavy sandstorms, sparse vegetation and harsh ecological environment. The indigenous sheep in this area are rich in resources, with the advantages of perennial estrus and good resistance to stress in most sheep. Exploring the molecular markers of livestock adaptability in this environment will provide the molecular basis for breeding research to cope with extreme future changes in the desert environment. In this study, we analyzed the population genetic structure and linkage imbalance of five sheep breeds with three different agricultural geographic characteristics using four complementary genomic selection signals: fixation index (FST), cross-population extended haplotype homozygosity (xp-EHH), Rsb (extended haplotype homozygosity between-populations) and iHS (integrated haplotype homozygosity score). We used Illumina Ovine SNP 50K Genotyping BeadChip Array, and gene annotation and enrichment analysis were performed on selected regions of the obtained genome. The ovary of Qira Black sheep (Follicular phase, Luteal phase, 30th day of pregnancy, 45th day of pregnancy) was collected, and the differentially expressed genes were screened by transcriptomic sequencing. Genome-wide selective sweep results and transcriptome data were combined for association analysis to obtain candidate genes associated with perennial estrus and stable reproduction. In order to verify the significance of the results, 15 resulting genes were randomly selected for fluorescence quantitative analysis. The results showed that Dolang sheep and Qira Black sheep evolved from Kazak sheep. Linkage disequilibrium analysis showed that the decay rate of sheep breeds in the Taklimakan Desert was higher than that in Yili grassland. The signals of FST, xp-EHH, Rsb and iHS detected 526, 332, 308 and 408 genes, respectively, under the threshold of 1% and 17 overlapping genes under the threshold of 5%. A total of 29 genes were detected in association analysis of whole-genome and transcriptome data. This study reveals the genetic mechanism of perennial estrus and environmental adaptability of indigenous sheep breeds in the Taklimakan Desert. It provides a theoretical basis for the conservation and exploitation of genetic resources of indigenous sheep breeds in extreme desert environment. This provides a new perspective for the quick adaptation of sheep and other mammals to extreme environments and future climate changes.

Also flagged:AMLleukemiaacute myeloid leukemiaNPM1CBFBMYH11
Journal Article 2022-07-18 ✓ 1 Snippet Röhnert MA, Kramer M, Schadt J, Ensel P, Thiede C, Krause SW, Bücklein V, Hoffmann J, Jaramillo S, Schlenk RF, Röllig C, Bornhäuser M, McCarthy N, Freeman S, Oelschlägel U, von Bonin M.
In-Text Gene Mentions

…KMT2A-PTD : 10, PICALM::MLLT10: 1, m…

Show Full Abstract

Measurable residual disease (MRD) detected by multiparametric flow cytometry (MFC) is associated with unfavorable outcome in patients with AML. A simple, broadly applicable eight-color panel was implemented and analyzed utilizing a hierarchical gating strategy with fixed gates to develop a clear-cut LAIP-based DfN approach. In total, 32 subpopulations with aberrant phenotypes with/without expression of markers of immaturity were monitored in 246 AML patients after completion of induction chemotherapy. Reference values were established utilizing 90 leukemia-free controls. Overall, 73% of patients achieved a response by cytomorphology. In responders, the overall survival was shorter for MRD<sup>pos</sup> patients (HR 3.8, p = 0.006). Overall survival of MRD<sup>neg</sup> non-responders was comparable to MRD<sup>neg</sup> responders. The inter-rater-reliability for MRD detection was high with a Krippendorffs α of 0.860. The mean time requirement for MRD analyses at follow-up was very short with 04:31 minutes. The proposed one-tube MFC approach for detection of MRD allows a high level of standardization leading to a promising inter-observer-reliability with a fast turnover. MRD defined by this strategy provides relevant prognostic information and establishes aberrancies outside of cell populations with markers of immaturity as an independent risk feature. Our results imply that this strategy may provide the base for multicentric immunophenotypic MRD assessment.

Also flagged:Solid cancerssquamous cell carcinomasadenocarcinomastumorinfectionmetaplastic SCC
Journal Article 2022-07-18 ✓ 2 Snippets Song Q, Yang Y, Jiang D, Qin Z, Xu C, Wang H, Huang J, Chen L, Luo R, Zhang X, Huang Y, Xu L, Yu Z, Tan S, Deng M, Xue R, Qie J, Li K, Yin Y, Yue X, Sun X, Su J, He F, Ding C, Hou Y.
In-Text Gene Mentions

Consistently with the findings in these DEPs, we found that PKM-ENO1 showed a consistent poor prognosis value (p < 0.05) in pancreatic adenocarcinoma and HNSC/ESCC, whereas VRK2-TP63 showed a poor prognostic value (p < 0.05) in pancreatic adenocarcinoma and a good prognostic value in ESCC/LUSC (Supplementary Fig. 6c).

…and HNSC/ESCC, whereasVRK2-TP63 showed a poor…

Show Full Abstract

Squamous cell carcinoma (SCC) and adenocarcinoma (AC) are two main histological subtypes of solid cancer; however, SCCs are derived from different organs with similar morphologies, and it is challenging to distinguish the origin of metastatic SCCs. Here we report a deep proteomic analysis of 333 SCCs of 17 organs and 69 ACs of 7 organs. Proteomic comparison between SCCs and ACs identifies distinguishable pivotal pathways and molecules in those pathways play consistent adverse or opposite prognostic roles in ACs and SCCs. A comparison between common and rare SCCs highlights lipid metabolism may reinforce the malignancy of rare SCCs. Proteomic clusters reveal anatomical features, and kinase-transcription factor networks indicate differential SCC characteristics, while immune subtyping reveals diverse tumor microenvironments across and within diagnoses and identified potential druggable targets. Furthermore, tumor-specific proteins provide candidates with differentially diagnostic values. This proteomics architecture represents a public resource for researchers seeking a better understanding of SCCs and ACs.

Also flagged:CNS) diseasesAlzheimer's diseasesADParkinson's DiseasesPDbrain tumors
Journal Article 2022-07-18 ✓ 2 Snippets Luo M, Lee LKC, Peng B, Choi CHJ, Tong WY, Voelcker NH.
In-Text Gene Mentions

In addition to the HTT gene, several genetic modifiers encoding proteins that are associated with HD through different mechanisms have been identified recently, such as Nme1 (suppressing) mutant HTT),[185] NF (providing) neurotrophic support,[186] CYP46A1 (affecting brain cholesterol metabolism),[187] and TLR4/TREM2 (affecting inflammation).[188] Targeting these genes via gene therapy led to decreased HTT aggregation and improved motor performance in HD animal models, which could be potential therapeutic targets for HD drug development.[185, 186, 187, 188]

For example, Save et al. showed that more than 50% of HTT mRNA was reduced by siRNA delivered by chitosan NPs in different brain regions of HD mice after intranasal administration.[21] Another study attempted to knock down genes expressing nuclear factor (NF)‐κB p65 in stroke mice by systemically injecting curdlan NPs loaded with the targeting siRNA, which increased the neuron density and alleviated the nuclear pyknosis and neuronal necrosis in the brain.[249] In a nutshell, siRNA has been used to specifically target a wide range of biomarkers in CNS diseases.

Show Full Abstract

Central Nervous System (CNS) diseases, such as Alzheimer's diseases (AD), Parkinson's Diseases (PD), brain tumors, Huntington's disease (HD), and stroke, still remain difficult to treat by the conventional molecular drugs. In recent years, various gene therapies have come into the spotlight as versatile therapeutics providing the potential to prevent and treat these diseases. Despite the significant progress that has undoubtedly been achieved in terms of the design and modification of genetic modulators with desired potency and minimized unwanted immune responses, the efficient and safe in vivo delivery of gene therapies still poses major translational challenges. Various non-viral nanomedicines have been recently explored to circumvent this limitation. In this review, an overview of gene therapies for CNS diseases is provided and describes recent advances in the development of nanomedicines, including their unique characteristics, chemical modifications, bioconjugations, and the specific applications that those nanomedicines are harnessed to deliver gene therapies.

Also flagged:HSP70mitochondrialproteasomemultiple myelomaheat shock protein 70chaperones
Journal Article 2022-07-18 ✓ 1 Snippet Ferguson ID, Lin YT, Lam C, Shao H, Tharp KM, Hale M, Kasap C, Mariano MC, Kishishita A, Patiño Escobar B, Mandal K, Steri V, Wang D, Phojanakong P, Tuomivaara ST, Hann B, Driessen C, Van Ness B, Gestwicki JE, Wiita AP.
In-Text Gene Mentions

DNAJC1

Show Full Abstract

Proteasome inhibitor (PI) resistance remains a central challenge in multiple myeloma. To identify pathways mediating resistance, we first mapped proteasome-associated genetic co-dependencies. We identified heat shock protein 70 (HSP70) chaperones as potential targets, consistent with proposed mechanisms of myeloma cells overcoming PI-induced stress. We therefore explored allosteric HSP70 inhibitors (JG compounds) as myeloma therapeutics. JG compounds exhibited increased efficacy against acquired and intrinsic PI-resistant myeloma models, unlike HSP90 inhibition. Shotgun and pulsed SILAC mass spectrometry demonstrated that JGs unexpectedly impact myeloma proteostasis by destabilizing the 55S mitoribosome. Our data suggest JGs have the most pronounced anti-myeloma effect not through inhibiting cytosolic HSP70 proteins but instead through mitochondrial-localized HSP70, HSPA9/mortalin. Analysis of myeloma patient data further supports strong effects of global proteostasis capacity, and particularly HSPA9 expression, on PI response. Our results characterize myeloma proteostasis networks under therapeutic pressure while motivating further investigation of HSPA9 as a specific vulnerability in PI-resistant disease.

Also flagged:axon guidanceephrinaxontranslationalEph receptors(Robo)
Journal Article 2022-07-18 No Snippets Sullivan KG, Bashaw GJ.
Show Full Abstract

Friedrich Bonhoeffer made seminal contributions to the study of axon guidance in the developing nervous system. His discoveries of key cellular and molecular mechanisms that dictate wiring specificity laid the foundation for countless investigators who have followed in his footsteps. Perhaps his most significant contribution was the cloning and characterization of members of the conserved ephrin family of repulsive axon guidance cues. In this review, we highlight the major contributions that Bonhoeffer and his colleagues made to the field of axon guidance, and discuss ongoing investigations into the diverse array of mechanisms that ensure that axon repulsion is precisely regulated to allow for accurate pathfinding. Specifically, we focus our discussion on the post-translational regulation of two major families of repulsive axon guidance factors: ephrin ligands and their Eph receptors, and slit ligands and their Roundabout (Robo) receptors. We will give special emphasis to the ways in which regulated endocytic trafficking events allow navigating axons to adjust their responses to repellant signals and how these trafficking events are intimately related to receptor signaling. By highlighting parallels and differences between the regulation of these two important repulsive axon guidance pathways, we hope to identify key outstanding questions for future investigation.

Also flagged:Myocarditischitrichoorganisation
Journal Article 2022-07-18 No Snippets Tran TD, Vu PM, Pham HTM, Au LN, Do HP, Doan HTT, Huynh N, Huynh QTV, Le BK, Ngo DQ, Nguyen HTM, Nguyen KD, Nguyen NA, Nguyen PH, Nguyen TA, Tran TC, Chau HN, Vuong LN, Vu NV.
Show Full Abstract

The competency-based undergraduate curriculum reform at the University of Medicine and Pharmacy at Ho Chi Minh City, Faculty of Medicine (UMP-FM) is detailed and reviewed in reference to the instructional and institutional reforms, and enabling actions recommended by the Lancet 2010 Commission for Health Professional Education. Key objectives are to: revise the overall 6-year curriculum to be more integrated and competency-based; reinforce students' knowledge application, problem-solving, clinical competence, self-directed learning and soft skills; develop a comprehensive and performance-based student assessment programme; and establish a comprehensive quality monitoring programme to facilitate changes and improvements. New features include early introduction to the practice of medicine, family- and community-based medicine, professionalism, interprofessional education, electives experiences, and a scholarly project. Institutional reform introduces a faculty development programme, joint planning mechanism, a "culture of critical inquiry", and a transparent faculty reward system. Lessons learnt from the curriculum reform at UMP-FM could be helpful to medical schools from low- and middle-income countries considering transitioning from a traditional to a competency-based curriculum.<h4>Funding</h4>This work receives no external funding.

Also flagged:Curcuminnuclear factor erythroid-2-related factor 2Nrf2ASC-JM17Spinocerebellar ataxia type 3SCA3
Journal Article 2022-07-18 ✓ 2 Snippets Wu YL, Chang JC, Chao YC, Chan H, Hsieh M, Liu CS.
In-Text Gene Mentions

In Huntington’s disease models, mutant huntingtin (Htt) disrupts Nrf2 signaling, which contributes to impaired mitochondrial dynamics and may enhance susceptibility to oxidative stress in striatal cells [17].

…models, mutant huntingtin (Htt) disrupts Nrf2 signaling,…

Show Full Abstract

Unlike other nuclear factor erythroid-2-related factor 2 (Nrf2) activators, the mechanism of action of curcumin analog, ASC-JM17 (JM17), in regulating oxidative homeostasis remains unknown. Spinocerebellar ataxia type 3 (SCA3) is an inherited polyglutamine neurodegenerative disease caused mainly by polyglutamine neurotoxicity and oxidative stress. Presently, we compared actions of JM17 with those of known Nrf2 activators, omaveloxolone (RTA-408) and dimethyl fumarate (DMF), using human neuroblastoma SK-N-SH cells with stable transfection of full-length ataxin-3 protein with 78 CAG repeats (MJD78) to clarify the resulting pathological mechanism by assaying mitochondrial function, mutant ataxin-3 protein toxicity, and oxidative stress. JM17, 1 μM, comprehensively restored mitochondrial function, decreased mutant protein aggregates, and attenuated intracellular/mitochondrial reactive oxygen species (ROS) levels. Although JM17 induced dose-dependent Nrf2 activation, a low dose of JM17 (less than 5 μM) still had a better antioxidant ability compared to the other Nrf2 activators and specifically increased mitochondrial superoxide dismutase 2 in an Nrf2-dependent manner as shown by knockdown experiments with siRNA. It showed that activation of Nrf2 in response to ROS generated in mitochondria could play an import role in the benefit of JM17. This study presents the diversified regulation of JM17 in a pathological process and helped develop more effective therapeutic strategies for SCA3.

Also flagged:CBX2mTORC1DREAMchromatinbindingpolycomb repressive complex 1
Journal Article 2022-07-18 ✓ 1 Snippet Bilton LJ, Warren C, Humphries RM, Kalsi S, Waters E, Francis T, Dobrowinski W, Beltran-Alvarez P, Wade MA.
In-Text Gene Mentions

…expression via twopolycomb repressiverepressive complexes (Polycomb…

Show Full Abstract

Chromobox 2 (CBX2) is a chromatin-binding component of polycomb repressive complex 1, which causes gene silencing. CBX2 expression is elevated in triple-negative breast cancer (TNBC), for which there are few therapeutic options. Here, we aimed to investigate the functional role of CBX2 in TNBC. CBX2 knockdown in TNBC models reduced cell numbers, which was rescued by ectopic expression of wild-type CBX2 but not a chromatin binding-deficient mutant. Blocking CBX2 chromatin interactions using the inhibitor SW2_152F also reduced cell growth, suggesting CBX2 chromatin binding is crucial for TNBC progression. RNA sequencing and gene set enrichment analysis of CBX2-depleted cells identified downregulation of oncogenic signalling pathways, including mTORC1 and E2F signalling. Subsequent analysis identified that CBX2 represses the expression of mTORC1 inhibitors and the tumour suppressor RBL2. RBL2 repression, in turn, inhibits DREAM complex activity. The DREAM complex inhibits E2F signalling, causing cell senescence; therefore, inhibition of the DREAM complex via CBX2 may be a key oncogenic driver. We observed similar effects in oestrogen receptor-positive breast cancer, and analysis of patient datasets suggested CBX2 inhibits RBL2 activity in other cancer types. Therapeutic inhibition of CBX2 could therefore repress mTORC1 activation and promote DREAM complex-mediated senescence in TNBC and could have similar effects in other cancer types.

Also flagged:Endometrial AdenocarcinomaTumorDSCAMcancerbreast cancerendometrial tumor
Journal Article 2022-07-18 No Snippets Treeck O, Weber F, Fritsch J, Skrzypczak M, Schüler-Toprak S, Buechler C, Ortmann O.
Show Full Abstract

Accumulating evidence suggests that lncRNA DSCAM-AS1 acts tumor-promoting in various cancer entities. In breast cancer, DSCAM-AS1 was shown to be the lncRNA being most responsive to induction by estrogen receptor α (ERα). In this study, we examined the function of DSCAM-AS1 in endometrial adenocarcinoma using in silico and different in vitro approaches. Initial analysis of open-source data revealed DSCAM-AS1 overexpression in endometrial cancer (EC) (p < 0.01) and a significant association with shorter overall survival of EC patients (HR = 1.78, p < 0.01). In EC, DSCAM-AS1 was associated with endometrial tumor promotor gene PRL and with expression of ERα and its target genes TFF1 and PGR. Silencing of this lncRNA by RNAi in two EC cell lines was more efficient in ERα-negative HEC-1B cells and reduced their growth and the expression of proliferation activators like NOTCH1, PTK2 and EGR1. DSCAM-AS1 knockdown triggered an anti-tumoral transcriptome response as revealed by Affymetrix microarray analysis, emerging from down-regulation of tumor-promoting genes and induction of tumor-suppressive networks. Finally, several genes regulated upon DSCAM-AS1 silencing in vitro were found to be inversely correlated with this lncRNA in EC tissues. This study clearly suggests an oncogenic function of DSCAM-AS1 in endometrial adenocarcinoma via activation of a tumor-promoting transcriptome profile.

Also flagged:ProanthocyanidinsAnthocyaninsflavonoidchronic diseasesnon-small cell lung cancerNSCLC
Journal Article 2022-07-18 ✓ 1 Snippet Alsharairi NA.
In-Text Gene Mentions

…ssion, prostacyclin synthase (PTGIS)/PGI2 (as measured by…

Show Full Abstract

In traditional medicine, different parts of plants, including fruits, have been used for their anti-inflammatory and anti-oxidative properties. Plant-based foods, such as fruits, seeds and vegetables, are used for therapeutic purposes due to the presence of flavonoid compounds. Proanthocyanidins (PCs) and anthocyanins (ACNs) are the major distributed flavonoid pigments in plants, which have therapeutic potential against certain chronic diseases. PCs and ACNs derived from plant-based foods and/or medicinal plants at different nontoxic concentrations have shown anti-non-small cell lung cancer (NSCLC) activity in vitro/in vivo models through inhibiting proliferation, invasion/migration, metastasis and angiogenesis and by activating apoptosis/autophagy-related mechanisms. However, the potential mechanisms by which these compounds exert efficacy against nicotine-induced NSCLC are not fully understood. Thus, this review aims to gain insights into the mechanisms of action and therapeutic potential of PCs and ACNs in nicotine-induced NSCLC.

Also flagged:OsteogenesisALPmineralizationbone formationhydroxyapatitetitanium
Journal Article 2022-07-18 No Snippets Ding Z, Peng Q, Zuo J, Wang Y, Zhou H, Tang Z, Tang Z.
Show Full Abstract

The boronized Ti6Al4V/HA composite is deemed to be an important biomaterial because of its potential remarkable mechanical and biological properties. This paper reports the osteogenesis performance of the boronized Ti6Al4V/HA composite, which was prepared by microwave sintering of powders of Ti6Al4V, hydroxyapatite (HA), and TiB<sub>2</sub> in high-purity Ar gas at 1050 °C for 30 min, as dental implant based on both cell experiments in vitro and animal experiments in vivo. The comparison between the boronized Ti6Al4V/HA composite and Ti, Ti6Al4V, and boronized Ti6Al4V in the terms of adhesion, proliferation, alkaline phosphate (ALP) activity, and mineralization of MG-63 cells on their surfaces confirmed that the composite exhibited the best inductive osteogenesis potential. It exerted a more significant effect on promoting the early osteogenic differentiation of osteoblasts and exhibited the maximum optical density (OD) value in the MTT assay and the highest levels of ALP activity and mineralization ability, primarily ascribed to its bioactive HA component, porous structure, and relatively rough micro-morphology. The in vivo study in rabbits based on the micro-computed tomography (micro-CT) analysis, histological and histomorphometric evaluation, and biomechanical testing further confirmed that the boronized Ti6Al4V/HA composite had the highest new bone formation potential and the best osseointegration property after implantation for up to 12 weeks, mainly revealed by the measured values of bone volume fraction, bone implant contact, and maximum push-out force which, for example, reached 48.64%, 61%, and 150.3 ± 6.07 N at the 12th week. Owing to these inspiring features, it can serve as a highly promising dental implant.

Also flagged:hydroxyapatitesynthesisionsnanoapatitemetal ionsnanopatites
Journal Article 2022-07-18 No Snippets Huang SM, Liu SM, Chen WC, Ko CL, Shih CJ, Chen JC.
Show Full Abstract

The objective of this study was to prepare hydroxyapatite (HA) with potential antibacterial activity against gram-negative and gram-positive bacteria by incorporating different atomic ratios of Cu<sup>2+</sup> (0.1-1.0%), Mg<sup>2+</sup> (1.0-7.0%), and Zn<sup>2+</sup> (1.0-7.0%) to theoretically replace Ca<sup>2+</sup> ions during the hydrothermal synthesis of grown precipitated HA nanorods. This study highlights the role of comparing different metal ions on synthetic nanoapatite in regulating the antibacterial properties and toxicity. The comparisons between infrared spectra and between diffractograms have confirmed that metal ions do not affect the formation of HA phases. The results show that after doped Cu<sup>2+</sup>, Mg<sup>2+</sup>, and Zn<sup>2+</sup> ions replace Ca<sup>2+</sup>, the ionic radius is almost the same, but significantly smaller than that of the original Ca<sup>2+</sup> ions, and the substitution effect causes the lattice distance to change, resulting in crystal structure distortion and reducing crystallinity. The reduction in the length of the nanopatites after the incorporation of Cu<sup>2+</sup>, Mg<sup>2+</sup>, and Zn<sup>2+</sup> ions confirmed that the metal ions were mainly substituted during the growth of the rod-shape nanoapatite Ca<sup>2+</sup> distributed along the longitudinal site. The antibacterial results show that nanoapatite containing Cu<sup>2+</sup> (0.1%), Mg<sup>2+</sup> (3%), and Zn<sup>2+</sup> (5-7%) has obvious and higher antibacterial activity against gram-positive bacteria Staphylococcus aureus within 2 days. The antibacterial effect against the gram-negative bacillus <i>Escherichia coli</i> is not as pronounced as against <i>Staphylococcus aureus</i>. The antibacterial effect of Cu<sup>2+</sup> substituted Ca<sup>2+</sup> with an atomic ratio of 0.1~1.0% is even better than that of Mg<sup>2+</sup>- and Zn<sup>2+</sup>- doped with 1~7% groups. In terms of cytotoxicity, nanoapatites with Cu<sup>2+</sup> (~0.2%) exhibit cytotoxicity, whereas Mg<sup>2+</sup>- (1-5%) and Zn<sup>2+</sup>- (~1%) doped nanoapatites are biocompatible at low concentrations but become cytotoxic as ionic concentration increases. The results show that the hydrothermally synthesized nanoapatite combined with Cu<sup>2+</sup> (0.2%), Mg<sup>2+</sup> (3%), and Zn<sup>2+</sup> (3%) exhibits low toxicity and high antibacterial activity, which provides a good prospect for bypassing antibiotics for future biomedical applications.

Also flagged:Cerebrovascular diseaseischemic cerebrovascular diseasevisionaphasiaAspirinatorvastatin
Journal Article 2022-07-18 ✓ 5 Snippets Wang L, Tang X.
In-Text Gene Mentions

…as follows: DD,ATIII, and PC levels…

…levels decreased, andATIIIlevels increased (…

…were lower, andATIIIlevels were higher…

…high levels ofATIIIafter treatment were…

ATIIIis a natural…

Show Full Abstract

<h4>Objective</h4>To analyze the significance of ezetimibe in combination with low- to moderate-intensity atorvastatin adjuvant aspirin therapy for cerebrovascular disease.<h4>Methods</h4>110 patients with cerebrovascular disease treated in our hospital from June 2020 to June 2021 were selected and divided into 55 patients in the control group and 55 patients in the study group according to the lottery method. After a comprehensive examination, patients in the two groups should be given aspirin for treatment; the control group was treated with conventional dose of atorvastatin on top of the above, and the study group was given ezetimibe and medium-low-dose atorvastatin on top of aspirin treatment, activities of daily living (ADL) score, carotid artery intima-media thickness, lipid level, coagulation level, clinical effect, and adverse rate of the two groups which were tested and compared.<h4>Results</h4>After treatment, ADL score, high-density leptin cholesterol (HDL-C), and ATIII levels increased, while carotid artery media thickness, triglyceride (TG), total cholesterol (TC), low-density leptin cholesterol (LDL-C), DD, PC, and hs-CRP levels decreased (<i>P</i> < 0.05). After treatment, ADL score, HDL-C, and ATIII levels were higher in the study group. The levels of carotid media thickness, TG, TC, LDL-C, DD, PC, and hs-CRP were significantly lower (<i>P</i> < 0.05). The clinical effect of the study group was outstanding (<i>P</i> < 0.05). The defect rate of the study group was lower than that of the control group, but there was no difference (<i>P</i> < 0.05).<h4>Conclusion</h4>Ezetimibe combined with medium- and low-intensity atorvastatin with aspirin in the treatment of cerebrovascular diseases can effectively improve the coagulation function of patients, reduce the level of inflammatory factors in patients, and improve the level of blood lipids in patients, with high safety and worthy of clinical application.

Also flagged:endometrial cancerendometrial cancersPD-L1avelumabdurvalumabTumor
Journal Article 2022-07-18 ✓ 2 Snippets Chen Q, Wang C, Lei X, Huang T, Zhou R, Lu Y.
In-Text Gene Mentions

Next, we identified significant mutation genes (SMGs FDR < 0.1) by MutSig, CYT-low primary tumors were significantly associated with mutations in PIK3CA, FOXA2 (Figure 2(e)), whereas, CYT-high primary tumors with a totally different group of genes, including PTEN, PIK3CA, ARHGAP35, KANSL1, ACVR2A, SUDS3, and B2M (Figure 2(f)).

…ARHGAP35, KANSL1, ACVR2A,SUDS3, and B2M (…

Show Full Abstract

Immune checkpoint blockade (ICB) has been explored as a therapeutic strategy to recover the antitumor immune activities against endometrial cancer (EC) escaping from immune surveillance. Increasing evidence has indicated that microsatellite instability (MSI) is a promising biomarker to stratify patients for the ICB therapy. However, even in patients with MSI-High (MSI-H) endometrial cancers, PD-L1 inhibitors, avelumab, and durvalumab have shown only 27% of response rates. Therefore, there is an urgent need to discover new biomarkers for a predictive response to ICB therapy. In this study, we demonstrated that the immune cytolytic activity (CYT) index was significantly correlated with the development and response to immunotherapy in EC. The data showed that higher CYT was significantly associated with better clinical outcome, more antitumor infiltrating immune cells, fewer somatic copy number alterations, but a higher TMB (Tumor mutational burden) status. Furthermore, CYT-high EC was notably relevant to the high expression of various immune checkpoint molecules and showed more effective responses to ICB treatment. Taken together, this study provided new insights into the connection between diverse genetic events and the immune microenvironment in EC and indicated that the CYT status might be a promising biomarker to stratify patients with EC for ICB therapy.

Also flagged:cancerthoriumactiniumradiumleadastatine
Journal Article 2022-07-18 No Snippets Sporer E, Poulie CBM, Bäck T, Lindegren S, Jensen H, Kempen PJ, Kjaer A, Herth MM, Jensen AI.
Show Full Abstract

Astatine-211 (<sup>211</sup>At) is one of the most promising α-emitters for targeted alpha therapy, especially of cancer metastases. However, the lack of a stable isotope, frequent <i>in vivo</i> deastatination, and limited radiochemical knowledge makes it challenging to apply. Here, we report a new strategy for radiolabeling the lipophilic core of polymeric micelles (PMs) with covalently bound <sup>211</sup>At. The PMs were radiolabeled via either an indirect synthon-based method or directly on the amphipathic block copolymer. The radiochemistry was optimized with iodine-125 (<sup>125</sup>I) and then adapted for <sup>211</sup>At, enabling the use of both elements as a potential theranostic pair. PMs that were core-radiolabeled with both <sup>125</sup>I or <sup>211</sup>At were prepared and characterized, based on a PEG(5k)-PLGA(10k) co-polymer. The stability of the radiolabeled PMs was evaluated in mouse serum for 21 h, showing radiochemical stability above 85%. After <i>in vivo</i> evaluation of the <sup>211</sup>At- labeled PMs, 4-5 % ID/g of the <sup>211</sup>At could still be detected in the blood, showing a promising <i>in vivo</i> stability of the PMs. Further, <sup>211</sup>At-labeled PMs accumulated in the spleen (20-30 %ID/g) and the liver (2.5- 5.5 %ID/g), along with some detection of <sup>211</sup>At in the thyroid (3.5-9 %ID/g). This led to the hypothesis that deastatination takes place in the liver, whereas good stability of the <sup>211</sup>At core-radiolabel was observed in the blood.

Also flagged:Lung AdenocarcinomaTumorlung cancercell differentiationLUADtumors
Journal Article 2022-07-18 ✓ 1 Snippet Luo Y, Deng X, Que J, Li Z, Xie W, Dai G, Chen L, Wang H.
In-Text Gene Mentions

…PVR , andTNFSF4correlated with unfavorable…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is the most common subtype of lung cancer which typically exhibits a diverse progression trajectory. Our study sought to explore the cell differentiation trajectory of LUAD and its clinical relevance.<h4>Methods</h4>Utilizing a single-cell RNA-sequencing dataset (GSE117570), we identified LUAD cells of distinct differential status along with differentiation-related genes (DRGs). DRGs were applied to the analysis of bulk-tissue RNA-sequencing dataset (GSE72094) to classify tumors into different subtypes, whose clinical relevance was further analyzed. DRGs were also applied to gene co-expression network analysis (WGCNA) using another bulk-tissue RNA-sequencing dataset (TCGA-LUAD). Genes from modules that demonstrated a significant correlation with clinical traits and were differentially expressed between normal tissue and tumors were identified. Among these, genes with significant prognostic relevance were used for the development of a prognostic nomogram, which was tested on TCGA-LUAD dataset and validated in GSE72094. Finally, CCK-8, EdU, cell apoptosis, cell colony formation, and Transwell assays were used to verify the functions of the identified genes.<h4>Results</h4>Four clusters of cells with distinct differentiation status were characterized, whose DRGs were predominantly correlated with pathways of immune regulation. Based on DRGs, tumors could be clustered into four subtypes associated with distinct immune microenvironment and clinical outcomes. DRGs were categorized into four modules. A total of nine DRGs (<i>SFTPB</i>, <i>WFDC2</i>, <i>HLA-DPA1</i>, <i>TIMP1</i>, <i>MS4A7</i>, <i>HLA-DQA1</i>, <i>VCAN</i>, <i>KRT8</i>, and <i>FABP5</i>) with most significant survival-predicting power were integrated to develop a prognostic model, which outperformed the traditional parameters in predicting clinical outcomes. Finally, we verified that knockdown of WFDC2 inhibited proliferation, migration, and invasion but promoted the apoptosis of A549 cells <i>in vitro</i>.<h4>Conclusion</h4>The cellular composition and cellular differentiation status of tumor mass can predict the clinical outcomes of LUAD patients. It also plays an important role in shaping the tumor immune microenvironment.

Also flagged:antimicrobial immunitybutyrophilin 3A1BTN3butyrophilin 2A1infectionslocalization
Journal Article 2022-07-18 ✓ 1 Snippet Gay L, Mezouar S, Cano C, Frohna P, Madakamutil L, Mège JL, Olive D.
In-Text Gene Mentions

…and butyrophilin 2A1 (BTN2A1) dependent manner.…

Show Full Abstract

The T cell receptor Vγ9Vδ2 T cells bridge innate and adaptive antimicrobial immunity in primates. These Vγ9Vδ2 T cells respond to phosphoantigens (pAgs) present in microbial or eukaryotic cells in a butyrophilin 3A1 (BTN3) and butyrophilin 2A1 (BTN2A1) dependent manner. In humans, the rapid expansion of circulating Vγ9Vδ2 T lymphocytes during several infections as well as their localization at the site of active disease demonstrates their important role in the immune response to infection. However, Vγ9Vδ2 T cell deficiencies have been observed in some infectious diseases such as active tuberculosis and chronic viral infections. In this review, we are providing an overview of the mechanisms of Vγ9Vδ2 T cell-mediated antimicrobial immunity. These cells kill infected cells mainly by releasing lytic mediators and pro-inflammatory cytokines and inducing target cell apoptosis. In addition, the release of chemokines and cytokines allows the recruitment and activation of immune cells, promoting the initiation of the adaptive immune response. Finaly, we also describe potential new therapeutic tools of Vγ9Vδ2 T cell-based immunotherapy that could be applied to emerging infections.

Also flagged:liver fibrosisnonalcoholic fatty liver diseaseNAFLDIRtype 2 diabetesALT
Journal Article 2022-07-18 ✓ 1 Snippet Bril F, Godinez Leiva E, Lomonaco R, Shrestha S, Kalavalapalli S, Gray M, Cusi K.
In-Text Gene Mentions

…C, autoimmune hepatitis,hemochromatosis, Wilson’s disease, drug-induc…

Show Full Abstract

<h4>Aim</h4>The optimal screening strategy for advanced liver fibrosis in overweight and obese patients is unknown. The aim of this study is to compare the performance of different strategies to select patients at high risk of advanced liver fibrosis for screening using non-invasive tools.<h4>Methods</h4>All patients underwent: liver <sup>1</sup>H-MRS and percutaneous liver biopsy (in those with nonalcoholic fatty liver disease [NAFLD]). Unique selection strategies were compared to determine the best screening algorithm: (A) A "metabolic approach": selecting patients based on HOMA-IR ≥ 3; (B) A "diabetes approach": selecting only patients with type 2 diabetes; (C) An "imaging approach": selecting patients with hepatic steatosis based on <sup>1</sup>H-MRS; (D) A "liver biochemistry approach": selecting patients with elevated ALT (i.e., ≥ 30 IU/L for males and ≥ 19 IU/L for females); and (E) Universal screening of overweight and obese patients. FIB-4 index, NAFLD fibrosis score, and APRI were applied as screening strategies.<h4>Results</h4>A total of 275 patients were included in the study. Patients with advanced fibrosis (<i>n</i> = 29) were matched for age, gender, ethnicity, and BMI. Selecting patients by ALT elevation provided the most effective strategy, limiting the false positive rate while maintaining the sensitivity compared to universal screening. Selecting patients by any other strategy did not contribute to increasing the sensitivity of the approach and resulted in more false positive results.<h4>Conclusion</h4>Universal screening of overweight/obese patients for advanced fibrosis with non-invasive tools is unwarranted, as selection strategies based on elevated ALT levels lead to the same sensitivity with a lower false positive rate (i.e., fewer patients that would require a liver biopsy or referral to hepatology).

Also flagged:mycobacterial diseaseMSMDprimary immunodeficienciesMendelian susceptibility to mycobacterial diseaseclinicalPID
Journal Article 2022-07-18 ✓ 5 Snippets Xia L, Liu XH, Yuan Y, Lowrie DB, Fan XY, Li T, Hu ZD, Lu SH.
In-Text Gene Mentions

In 2021, an AR ZNFX1 deficiency was identified in thirteen patients from eight unrelated kindreds with severe infections by both RNA and DNA viruses and virally triggered inflammatory episodes (43).

…2.1.18ZNFX1

…TheZNFX1gene encodes NFX1-type…

…TheZNFX1protein binds to…

ZNFX1is located on…

Show Full Abstract

Mendelian susceptibility to mycobacterial disease (MSMD) arises from a group of rare inherited errors of immunity that result in selective susceptibility of otherwise healthy people to clinical disease caused by low virulence strains of mycobacteria, such as <i>Mycobacterium bovis</i> Bacille Calmette-Guérin (BCG) and environmental mycobacteria. Patients have normal resistance to other pathogens and no overt abnormalities in routine immunological and hematological evaluations for primary immunodeficiencies. At least 19 genes and 34 clinical phenotypes have been identified in MSMD. However, there have been no systematic reports on the clinical characteristics and genetic backgrounds of MSMD in China. In this review, on the one hand, we summarize an update findings on molecular defects and immunological mechanisms in the field of MSMD research globally. On the other hand, we undertook a systematic review of PubMed (MEDLINE), the Cochrane Central Register of Controlled Trials (CENTRAL), Web of Science, EMBASE, CNKI, and Wanfang to identify articles published before Jan 23, 2022, to summarize the clinical characteristics, diagnosis, treatment, and prognosis of MSMD in China. All the English and Chinese publications were searched without any restriction on article types.

medRxiv 2022-07-18 Preprint (No Snippets API) Muthinja MJ, Guelngar CO, Fall M, Jama F, Shuja HA, Nambafu J, Bocoum A, Massi DG, Ojo OO, Okubadejo NU, Taiwo FT, Diop AM, De Chacus CJ, Cissé FA, Cissé A, Hooker J, Sokhi D, Houlden H, Rizig M.
Show Full Abstract

<h4>Background</h4> Africans are underrepresented in Huntington’s disease research. A European ancestor was postulated to have introduced the mutant Huntingtin ( mHtt ) gene to the continent, however recent work has shown the existence of a unique Huntingtin haplotype in South-Africa specific to indigenous Africans. <h4>Objective</h4> We aimed to investigate the CAG repeats expansion in the Huntingtin ( Htt ) gene in a geographically diverse cohort of patients with chorea and unaffected controls from sub-Saharan Africa. <h4>Methods</h4> We evaluated 104 participants: 45 patients with chorea, 24 asymptomatic first-degree relatives of subjects with chorea and 35 healthy controls for the presence of the mHtt . Participants were recruited from 6 African countries. Additional data were collected from patients positive for the mHtt including demographics, presence of psychiatric and cognitive symptoms, family history, spoken languages and tribal origin. Additionally, their pedigrees were examined to estimate the number of people at risk of developing HD and to trace back the earliest account of the disease in each region. <h4>Results</h4> HD cases were identified in all countries. 53.3% of patients with chorea were carriers for the mHTT ; median tract size 45 CAG repeats. Of the asymptomatic relatives 41.6% were carriers for the mHTT; median tract size 42.5 CAG. No homozygous carries were identified. Median CAG tract size in controls was 17 CAG repeats. Men and women were equally affected by HD. All patients with HD—bar three who were juvenile onset of <21 years—were defined as adult onset (median age of onset 40 years). HD transmission followed an autosomal dominant pattern in 80% (16/20) of HD families. In familial cases, maternal transmission was higher (56%) than paternal transmission (44%). The number of asymptomatic individuals at risk of developing HD was estimated at 10 times more than the symptomatic patients. HD could be traced back to the early 1900s in most African sites. HD cases spread over 8 tribes belonging to two distinct linguistic lineages separated from each other approximately 37 kya ago: Nilo-Sahara and Niger-Congo. <h4>Conclusion</h4> This is the first study examining HD in multiple sites in sub-Saharan Africa. We demonstrated that HD is found in multiple tribes residing in 6 sub-Saharan African countries including the first genetically confirmed HD cases from Guinea and Kenya. The prevalence of HD in the African continent, its associated socio-economic impact, and genetic origins need further exploration and reappraisal.

Also flagged:hepatocellular carcinomalipidferroptosisironliver cancertumor
Journal Article 2022-07-16 ✓ 1 Snippet Long S, Chen Y, Wang Y, Yao Y, Xiao S, Fu K.
In-Text Gene Mentions

…In addition,PEBP1and SAT1 were…

Show Full Abstract

<h4>Background</h4>Excessive iron accumulation and lipid peroxidation are primary characteristics of ferroptosis in hepatocellular carcinoma (HCC). Ferroptosis inducer combined with immunotherapy has become a new hope for HCC patients. Therefore, the construction and validation of subtype-specific sensitivity to ferroptosis inducer will be helpful for hierarchical management and precise individual therapy.<h4>Methods</h4>RNA-seq transcriptome and clinical data of HCC patients were extracted from International Cancer Genome Consortium (ICGC) dataset and The Cancer Genome Atlas (TCGA) dataset. Consistency matrix and data clustering of the both cohorts were constructed by 'ConsensusClusterPlus' package. Single-sample gene set enrichment analysis (ssGSEA) analysis was performed to evaluate immune infiltration. Cox analysis was utilized to construct a ferroptosis phenotype-related prognostic model (FRPM) in HCC. The predictive efficiency of the constructed FRPM was evaluated through Kaplan Meier (K-M) survival analyses and Receiver Operating Characteristic (ROC) curves. The expression levels of candidate genes were detected and validated by Real-Time PCR between liver cancer tissues and adjacent non-tumor liver tissues.<h4>Results</h4>45 differentially expressed ferroptosis-related genes (FRGs) were identified between HCC tissues and non-tumor liver tissues. Furthermore, four ferroptosis-associated clusters (FACs) of HCC were established via consensus clustering. Subsequently, we established a FRPM, consisting of four prognostic genes (SLC7A11, SLC1A5, GCLM and SAT1), to evaluate the survival of HCC patients, based on which, patients were divided into high-risk group and low-risk group. The high-risk group exhibited worse survival compared to low-risk group (p < 0.0001 both in TCGA and ICGC cohorts). Patients belong to different FACs or different risk scores showed distinct clinical characteristics. Moreover, in the validation experiment, the transcriptional expression levels of the four prognostic genes were consistent with the results drew from datasets.<h4>Conclusion</h4>We revealed a novel FRGs signature, which may provide the molecular characteristic data for effectively prognostic evaluation and potential personalized therapy for HCC patients.

Also flagged:VCP D1 ATPaseneurodegenerative diseasesspinocerebellar ataxiasubiquitinproteasomeautophagy-
Journal Article 2022-07-16 No Snippets Wrobel L, Hill SM, Djajadikerta A, Fernandez-Estevez M, Karabiyik C, Ashkenazi A, Barratt VJ, Stamatakou E, Gunnarsson A, Rasmusson T, Miele EW, Beaton N, Bruderer R, Feng Y, Reiter L, Castaldi MP, Jarvis R, Tan K, Bürli RW, Rubinsztein DC.
Show Full Abstract

Enhancing the removal of aggregate-prone toxic proteins is a rational therapeutic strategy for a number of neurodegenerative diseases, especially Huntington's disease and various spinocerebellar ataxias. Ideally, such approaches should preferentially clear the mutant/misfolded species, while having minimal impact on the stability of wild-type/normally-folded proteins. Furthermore, activation of both ubiquitin-proteasome and autophagy-lysosome routes may be advantageous, as this would allow effective clearance of both monomeric and oligomeric species, the latter which are inaccessible to the proteasome. Here we find that compounds that activate the D1 ATPase activity of VCP/p97 fulfill these requirements. Such effects are seen with small molecule VCP activators like SMER28, which activate autophagosome biogenesis by enhancing interactions of PI3K complex components to increase PI(3)P production, and also accelerate VCP-dependent proteasomal clearance of such substrates. Thus, this mode of VCP activation may be a very attractive target for many neurodegenerative diseases.

Also flagged:LCORLNCAPGHERC6FAM184BSLIT2MMRN1
Journal Article 2022-07-16 ✓ 1 Snippet Smith JL, Wilson ML, Nilson SM, Rowan TN, Schnabel RD, Decker JE, Seabury CM.
In-Text Gene Mentions

…24 Mb (i.e.,DNAJC1and SIRT1 )…

Show Full Abstract

<h4>Background</h4>Genotypic information produced from single nucleotide polymorphism (SNP) arrays has routinely been used to identify genomic regions associated with complex traits in beef and dairy cattle. Herein, we assembled a dataset consisting of 15,815 Red Angus beef cattle distributed across the continental U.S. and a union set of 836,118 imputed SNPs to conduct genome-wide association analyses (GWAA) for growth traits using univariate linear mixed models (LMM); including birth weight, weaning weight, and yearling weight. Genomic relationship matrix heritability estimates were produced for all growth traits, and genotype-by-environment (GxE) interactions were investigated.<h4>Results</h4>Moderate to high heritabilities with small standard errors were estimated for birth weight (0.51 ± 0.01), weaning weight (0.25 ± 0.01), and yearling weight (0.42 ± 0.01). GWAA revealed 12 pleiotropic QTL (BTA6, BTA14, BTA20) influencing Red Angus birth weight, weaning weight, and yearling weight which met a nominal significance threshold (P ≤ 1e-05) for polygenic traits using 836K imputed SNPs. Moreover, positional candidate genes associated with Red Angus growth traits in this study (i.e., LCORL, LOC782905, NCAPG, HERC6, FAM184B, SLIT2, MMRN1, KCNIP4, CCSER1, GRID2, ARRDC3, PLAG1, IMPAD1, NSMAF, PENK, LOC112449660, MOS, SH3PXD2B, STC2, CPEB4) were also previously associated with feed efficiency, growth, and carcass traits in beef cattle. Collectively, 14 significant GxE interactions were also detected, but were less consistent among the investigated traits at a nominal significance threshold (P ≤ 1e-05); with one pleiotropic GxE interaction detected on BTA28 (24 Mb) for Red Angus weaning weight and yearling weight.<h4>Conclusions</h4>Sixteen well-supported QTL regions detected from the GWAA and GxE GWAA for growth traits (birth weight, weaning weight, yearling weight) in U.S. Red Angus cattle were found to be pleiotropic. Twelve of these pleiotropic QTL were also identified in previous studies focusing on feed efficiency and growth traits in multiple beef breeds and/or their composites. In agreement with other beef cattle GxE studies our results implicate the role of vasodilation, metabolism, and the nervous system in the genetic sensitivity to environmental stress.

Also flagged:neurodegenerative diseasesecretionneurotrophic factorsglial cell line-derived neurotrophic factorGDNFbrain-derived neurotrophic factor
Journal Article 2022-07-16 ✓ 3 Snippets Rahbaran M, Zekiy AO, Bahramali M, Jahangir M, Mardasi M, Sakhaei D, Thangavelu L, Shomali N, Zamani M, Mohammadi A, Rahnama N.
In-Text Gene Mentions

Also, HD, a well-known incurable hereditary neurodegenerative condition, causes motor impairment and cognitive decline because of the mutated and toxic huntingtin (HTT) protein function [35].

Thanks to the central role of HTT protein in adjusting neuronal progress, disruption in HTT expression and normal function may lead to HD progress.

Other studies have evinced that a single-nucleotide polymorphism (SNP) in nuclear factor-κB (NF-κB) binding site in the promoter of the HTT gene may provoke HD onset [37].

Show Full Abstract

Recently, mesenchymal stromal cell (MSC)-based therapy has become an appreciated therapeutic approach in the context of neurodegenerative disease therapy. Accordingly, a myriad of studies in animal models and also some clinical trials have evinced the safety, feasibility, and efficacy of MSC transplantation in neurodegenerative conditions, most importantly in Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD). The MSC-mediated desired effect is mainly a result of secretion of immunomodulatory factors in association with release of various neurotrophic factors (NTFs), such as glial cell line-derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF). Thanks to the secretion of protein-degrading molecules, MSC therapy mainly brings about the degradation of pathogenic protein aggregates, which is a typical appearance of chronic neurodegenerative disease. Such molecules, in turn, diminish neuroinflammation and simultaneously enable neuroprotection, thereby alleviating disease pathological symptoms and leading to cognitive and functional recovery. Also, MSC differentiation into neural-like cells in vivo has partially been evidenced. Herein, we focus on the therapeutic merits of MSCs and also their derivative exosome as an innovative cell-free approach in AD, HD, PD, and ALS conditions. Also, we give a brief glimpse into novel approaches to potentiate MSC-induced therapeutic merits in such disorders, most importantly, administration of preconditioned MSCs.

Also flagged:ironmetabolismiron deficiency anemiaIDAiron deficiencydextran
Journal Article 2022-07-16 No Snippets Qiu F, Li R, Gu S, Zhao Y, Yang L.
Show Full Abstract

<h4>Background</h4>Iron and vitamin D (VD) is essential to health. Previous studies have shown that iron homeostasis has a potential effect on VD metabolism, but the mechanism is not fully understood.<h4>Objectives</h4>To explore the relationship between VD metabolism and iron metabolism, as well as the regulatory mechanism of iron on VD metabolism.<h4>Methods</h4>40 male rats were fed adaptively for 7 days and randomly divided into control (C, n = 6 normal diet) group and model (M, n = 24 iron deficient diet) by simple randomization, the latter was used to establish iron deficiency anemia (IDA) model. After 6 weeks of feeding, the M group was randomly divided into: iron deficiency group (DFe), low iron group (LFe), medium iron group (MFe) and high iron group (HFe) by block randomization. Different doses of iron dextran (based on iron content (100 g·bw·d)): 0, 1.1, 3.3 and 9.9 mg) were given respectively. After 4 weeks, the rats were anesthetized with 8% chloral hydrate, Blood (collected from the abdominal aorta), liver and kidney tissues were collected. The serum and tissues were separately packed and frozen at -80℃ for testing.<h4>Results</h4>The results showed that the levels of hemoglobin (Hb), red blood cell (RBC), serum iron (SI), liver iron, and kidney iron in DFe group were lower than those in the other four groups, while the levels of total iron-binding capacity (TIBC), transferrin (TF) and transferrin receptor (Tfr) in DFe group were higher than those in other groups; The serum levels of 25-(OH)D<sub>3</sub> and 1,25-(OH)<sub>2</sub>D<sub>3</sub> in DFe group were significantly lower than those in C group (P < 0.05). The correlation analysis showed that the levels of 25-(OH)D<sub>3</sub> and 1,25-(OH)<sub>2</sub>D<sub>3</sub> were negatively correlated with TIBC, TF and Tfr no correlation with SI. Western blotting, immunofluorescence, and q-PCR results showed that compared with C group, the protein and gene expressions of CYP2R1, CYP27A1, and CYP24A1 in DFe group were down-regulated, and the expression of CYP27B1 protein and gene was up-regulated in DFe group.<h4>Conclusion</h4>Iron may be involved in the metabolism of VD<sub>3</sub> by regulating the expression of VD<sub>3</sub> hydroxylase, suggesting that appropriate iron supplementation might promote the activation of VD<sub>3</sub>.

Also flagged:obesitydepressionpsychiatric disordersmedicalhypersomniainflammation
Journal Article 2022-07-16 ✓ 2 Snippets Frank P, Jokela M, Batty GD, Lassale C, Steptoe A, Kivimäki M.
In-Text Gene Mentions
⭐ same-sentence co-mention

…genetic variation (e.g.,OLFM4and NEGR1 )…

⭐ same-sentence co-mention

…(e.g., OLFM4 andNEGR1) ( Wray…

Show Full Abstract

<h4>Objectives</h4>Obesity is associated with increased risk of depression, but the extent to which this association is symptom-specific is unknown. We examined the associations of overweight and obesity with individual depressive symptoms.<h4>Methods</h4>We pooled data from 15 population-based cohorts comprising 57,532 individuals aged 18 to 100 years at study entry. Primary analyses were replicated in an independent cohort, the UK Biobank study (n = 122,341, age range 38 to 72). Height and weight were assessed at baseline and body mass index (BMI) was computed. Using validated self-report measures, 24 depressive symptoms were ascertained once in 16 cross-sectional, and twice in 7 prospective cohort studies (mean follow-up 3.2 years).<h4>Results</h4>In the pooled analysis of the primary cohorts, 22,045 (38.3 %) participants were overweight (BMI between 25 and 29.9 kg/m<sup>2</sup>), 12,025 (20.9 %) class I obese (BMI between 30 and 34.9 kg/m<sup>2</sup>), 7,467 (13.0 %) class II-III obese (BMI ≥ 35 kg/m<sup>2</sup>); and 7,046 (12.3 %) were classified as depressed. After multivariable adjustment, obesity class I was cross-sectionally associated with 1.11-fold (95 % confidence interval 1.01-1.22), and obesity class II-III with 1.31-fold (1.16-1.49) higher odds of overall depression. In symptom-specific analyses, robust associations were apparent for 4 of the 24 depressive symptoms ('could not get going/lack of energy', 'little interest in doing things', 'feeling bad about yourself, and 'feeling depressed'), with confounder-adjusted odds ratios of having 3 or 4 of these symptoms being 1.32 (1.10-1.57) for individuals with obesity class I, and 1.70 (1.34-2.14) for those with obesity class II-III. Elevated C-reactive protein and 21 obesity-related diseases explained 23 %-31 % of these associations. Symptom-specific associations were confirmed in longitudinal analyses where obesity preceded symptom onset, were stronger in women compared with men, and were replicated in UK Biobank.<h4>Conclusions</h4>Obesity is associated with a distinct set of depressive symptoms. These associations are partially explained by systemic inflammation and obesity-related morbidity. Awareness of this obesity-related symptom profile and its underlying biological correlates may inform better targeted treatments for comorbid obesity and depression.

Also flagged:Autism spectrum disorderautismnucleusintellectual disabilityIDcyst
Journal Article 2022-07-16 ✓ 2 Snippets Ambrosino S, Elbendary H, Lequin M, Rijkelijkhuizen D, Banaschewski T, Baron-Cohen S, Bast N, Baumeister S, Buitelaar J, Charman T, Crawley D, Dell'Acqua F, Hayward H, Holt R, Moessnang C, Persico AM, Sacco R, San José Cáceres A, Tillmann J, EU-AIMS LEAP Group, Loth E, Ecker C, Oranje B, Murphy D, Durston S.
In-Text Gene Mentions

For example, PNH are disorders of the last phase of neuronal migration associated to, among others, FLNA or ARFGEF2 mutations.

…others, FLNA orARFGEF2mutations.…

Show Full Abstract

<h4>Background</h4>Autism spectrum disorder (ASD) is a group of neurodevelopmental conditions associated with quantitative differences in cortical and subcortical brain morphometry. Qualitative assessment of brain morphology provides complementary information on the possible underlying neurobiology. Studies of neuroradiological findings in ASD have rendered mixed results, and await robust replication in a sizable and independent sample.<h4>Methods</h4>We systematically and comprehensively assessed neuroradiological findings in a large cohort of participants with ASD and age-matched controls (total N = 620, 348 ASD and 272 controls), including 70 participants with intellectual disability (47 ASD, 23 controls). We developed a comprehensive scoring system, augmented by standardized biometric measures.<h4>Results</h4>There was a higher incidence of neuroradiological findings in individuals with ASD (89.4 %) compared to controls (83.8 %, p = .042). Certain findings were also more common in ASD, in particular opercular abnormalities (OR 1.9, 95 % CI 1.3-3.6) and mega cisterna magna (OR 2.4, 95 % CI 1.4-4.0) reached significance when using FDR, whereas increases in macrocephaly (OR 2.0, 95 % CI 1.2-3.2), cranial deformities (OR 2.4, 95 % CI: 1.0-5.8), calvarian / dural thickening (OR 1.5, 95 % CI 1.0-2.3), ventriculomegaly (OR 3.4, 95 % CI 1.3-9.2), and hypoplasia of the corpus callosum (OR 2.7, 95 % CI 1.1-6.3) did not survive this correction. Furthermore, neuroradiological findings were more likely to occur in isolation in controls, whereas they clustered more frequently in ASD. The incidence of neuroradiological findings was higher in individuals with mild intellectual disability (95.7 %), irrespective of ASD diagnosis.<h4>Conclusion</h4>There was a subtly higher prevalence of neuroradiological findings in ASD, which did not appear to be specific to the condition. Individual findings or clusters of findings may point towards the neurodevelopmental mechanisms involved in individual cases. As such, clinical MRI assessments may be useful to guide further etiopathological (genetic) investigations, and are potentially valuable to fundamental ASD research.

Also flagged:reproductionmetabolismvisionPRKG1FOXO1TPM4
Journal Article 2022-07-16 No Snippets Du H, Yu J, Li Q, Zhang M.
Show Full Abstract

<i>Panthera tigris</i> is a top predator that maintains the integrity of forest ecosystems and is an integral part of biodiversity. No more than 400 Amur tigers (<i>P. t. altaica</i>) are left in the wild, whereas the South China tiger (<i>P. t. amoyensis</i>) is thought to be extinct in the wild, and molecular biology has been widely used in conservation and management. In this study, the genetic information of Amur tigers and South China tigers was studied by whole-genome sequencing (WGS). A total of 647 Gb of high-quality clean data was obtained. There were 6.3 million high-quality single-nucleotide polymorphisms (SNPs), among which most (66.3%) were located in intergenic regions, with an average of 31.72% located in coding sequences. There were 1.73 million insertion-deletions (InDels), among which there were 2438 InDels (0.10%) in the coding region, and 270 thousand copy number variations (CNVs). Significant genetic differences were found between the Amur tiger and the South China tiger based on a principal component analysis and phylogenetic tree. The linkage disequilibrium analysis showed that the linkage disequilibrium attenuation distance of the South China tiger and the Amur tiger was almost the same, whereas the r<sup>2</sup> of the South China tiger was 0.6, and the r<sup>2</sup> of the Amur tiger was 0.4. We identified functional genes and regulatory pathways related to reproduction, disease, predation, and metabolism and characterized functional genes related to survival in the wild, such as smell, vision, muscle, and predatory ability. The data also provide new evidence for the adaptation of Amur tigers to cold environments. <i>PRKG1</i> is involved in temperature regulation in a cold climate. <i>FOXO1</i> and <i>TPM4</i> regulate body temperature to keep it constant. Our results can provide genetic support for precise interspecies conservation and management planning in the future.

Also flagged:ADdementiasgene expressionTissuenucleusgene expressions
Journal Article 2022-07-16 No Snippets Dai Y, Jia P, Zhao Z, Gottlieb A.
Show Full Abstract

<h4>Background</h4>Genome-wide association studies have successfully identified variants associated with multiple conditions. However, generalizing discoveries across diverse populations remains challenging due to large variations in genetic composition. Methods that perform gene expression imputation have attempted to address the transferability of gene discoveries across populations, but with limited success.<h4>Methods</h4>Here, we introduce a pipeline that combines gene expression imputation with gene module discovery, including a dense gene module search and a gene set variation analysis, to address the transferability issue. Our method feeds association probabilities of imputed gene expression with a selected phenotype into tissue-specific gene-module discovery over protein interaction networks to create higher-level gene modules.<h4>Results</h4>We demonstrate our method's utility in three case-control studies of Alzheimer's disease (AD) for three different race/ethnic populations (Whites, African descent and Hispanics). We discovered 182 AD-associated genes from gene modules shared between these populations, highlighting new gene modules associated with AD.<h4>Conclusions</h4>Our innovative framework has the potential to identify robust discoveries across populations based on gene modules, as demonstrated in AD.

Also flagged:HSC70Carotid Artery Atherosclerosisnonalcoholic fatty liver diseaseNAFLDatherosclerosisheat shock 70 kDa protein 8
Journal Article 2022-07-16 ✓ 1 Snippet Zhao W, Mori H, Tomiga Y, Tanaka K, Perveen R, Mine K, Inadomi C, Yoshioka W, Kubotsu Y, Isoda H, Kuwashiro T, Oeda S, Akiyama T, Zhao Y, Ozaki I, Nagafuchi S, Kawaguchi A, Aishima S, Anzai K, Takahashi H.
In-Text Gene Mentions

…, drug-induced hepatotoxicity,hemochromatosis, Wilson’s disease, or…

Show Full Abstract

There is an association between nonalcoholic fatty liver disease (NAFLD) and atherosclerosis, but the genetic risk of atherosclerosis in NAFLD remains unclear. Here, a single-nucleotide polymorphism (SNP) of the heat shock 70 kDa protein 8 (<i>HSPA8</i>) gene was analyzed in 123 NAFLD patients who had been diagnosed using a liver biopsy, and the NAFLD phenotype including the maximum intima-media thickness (Max-IMT) of the carotid artery was investigated. Patients with the minor allele (A/G or G/G) of rs2236659 showed a lower serum heat shock cognate 71 kDa protein concentration than those with the major A/A allele. Compared with the patients with the major allele, those with the minor allele showed a higher prevalence of hypertension and higher Max-IMT in men. No significant associations between the <i>HSPA8</i> genotype and hepatic pathological findings were identified. In decision-tree analysis, age, sex, liver fibrosis, and <i>HSPA8</i> genotype were individually associated with severe carotid artery atherosclerosis (Max-IMT ≥ 1.5 mm). Noncirrhotic men aged ≥ 65 years were most significantly affected by the minor allele of <i>HSPA8</i>. To predict the risk of atherosclerosis and cardiovascular disease, <i>HSPA8</i> SNP genotyping might be useful, particularly for older male NAFLD patients.

Also flagged:Silversilver chloridemyosin I heavy chainheat shock protein 70methyltransferaseprotein kinase
Journal Article 2022-07-16 ✓ 1 Snippet Chimkhan N, Thammasittirong SN, Roytrakul S, Krobthong S, Thammasittirong A.
In-Text Gene Mentions

Condensinis a hetero-pentameric…

Show Full Abstract

Silver/silver chloride nanoparticles (Ag/AgCl NPs) are an alternative approach to control the larvae of <i>Aedes aegypti</i>, a vector of mosquito-borne diseases. However, the molecular mechanisms of Ag/AgCl NPs to <i>A. aegypti</i> have not been reported. In this work, Ag/AgCl NPs were synthesized using supernatant, mixed toxins from <i>Bacillus thuringiensis</i> subsp. <i>israelensis</i> (<i>Bti</i>), and heterologously expressed Cry4Aa and Cry4Ba toxins. The images from scanning electron microscopy revealed that the Ag/AgCl NPs were spherical in shape with a size range of 25-100 nm. The larvicidal activity against <i>A. aegypti</i> larvae revealed that the Ag/AgCl NPs synthesized using the supernatant of <i>Bti</i> exhibited higher toxicity (LC<sub>50</sub> = 0.133 μg/mL) than the Ag/AgCl NPs synthesized using insecticidal proteins (LC<sub>50</sub> = 0.148-0.217 μg/mL). The proteomic response to Ag/AgCl NPs synthesized using the supernatant of <i>Bti</i> in <i>A. aegypti</i> larvae was compared to the ddH<sub>2</sub>O-treated control. Two-dimensional gel electrophoresis analysis revealed 110 differentially expressed proteins, of which 15 were selected for identification using mass spectrometry. Six upregulated proteins (myosin I heavy chain, heat shock protein 70, the F<sub>0</sub>F<sub>1</sub>-type ATP synthase beta subunit, methyltransferase, protein kinase, and condensin complex subunit 3) that responded to Ag/AgCl NP treatment in <i>A. aegypti</i> were reported for NP treatments in different organisms. These results suggested that possible mechanisms of action of Ag/AgCl NPs on <i>A. aegypti</i> larvae are: mitochondrial dysfunction, DNA and protein damage, inhibition of cell proliferation, and cell apoptosis. The findings from this work provide greater insight into the action of green synthesized Ag/AgCl NPs on the control of <i>A. aegypti</i> larvae.

Also flagged:Extracellular Vesiclesextracellularvesicleshemostasisinfectious diseasesThrombosis
Journal Article 2022-07-16 No Snippets Eustes AS, Dayal S.
Show Full Abstract

Platelet-derived extracellular vesicles (PEVs) play important roles in hemostasis and thrombosis. There are three major types of PEVs described based on their size and characteristics, but newer types may continue to emerge owing to the ongoing improvement in the methodologies and terms used to define various types of EVs. As the literature on EVs is growing, there are continuing attempts to standardize protocols for EV isolation and reach consensus in the field. This review provides information on mechanisms of PEV production, characteristics, cellular interaction, and their pathological role, especially in autoimmune and infectious diseases. We also highlight the mechanisms through which PEVs can activate parent cells in a feedback loop.

Also flagged:Behavioral healthnonalcoholic steatohepatitischronic liver diseasenonalcoholic fatty liver diseaseNAFLDobesity
Journal Article 2022-07-16 No Snippets Sharma A, Albhaisi S, Sanyal AJ.
Show Full Abstract

Content available: Author Interview and Audio Recording.

Also flagged:transcription factorstissue developmentNAC transcription factorschromosomeleaf developmentbacterial leaf spot disease
Journal Article 2022-07-15 ✓ 2 Snippets Tariq R, Hussain A, Tariq A, Khalid MHB, Khan I, Basim H, Ingvarsson PK.
In-Text Gene Mentions

…as NAC-I toNAC-XIII, respectively.…

…named NAC-I toNAC-XIII.…

Show Full Abstract

<h4>Background</h4>Mung bean is a short-duration and essential food crop owing to its cash prominence in Asia. Mung bean seeds are rich in protein, fiber, antioxidants, and phytonutrients. The NAC transcription factors (TFs) family is a large plant-specific family, participating in tissue development regulation and abiotic and biotic stresses.<h4>Results</h4>In this study, we perform genome-wide comparisons of VrNAC with their homologs from Arabidopsis. We identified 81 NAC transcription factors (TFs) in mung bean genome and named as per their chromosome location. A phylogenetic analysis revealed that VrNACs are broadly distributed in nine groups. Moreover, we identified 20 conserved motifs across the VrNACs highlighting their roles in different biological process. Based on the gene structure of the putative VrNAC and segmental duplication events might be playing a vital role in the expansion of mung bean genome. A comparative phylogenetic analysis of mung bean NAC together with homologs from Arabidopsis allowed us to classify NAC genes into 13 groups, each containing several orthologs and paralogs. Gene ontology (GO) analysis categorized the VrNACs into biological process, cellular components and molecular functions, explaining the functions in different plant physiology processes. A gene co-expression network analysis identified 173 genes involved in the transcriptional network of putative VrNAC genes. We also investigated how miRNAs potentially target VrNACs and shape their interactions with proteins. VrNAC1.4 (Vradi01g03390.1) was targeted by the Vra-miR165 family, including 9 miRNAs. Vra-miR165 contributes to leaf development and drought tolerance. We also performed qRT-PCR on 22 randomly selected VrNAC genes to assess their expression patterns in the NM-98 genotype, widely known for being tolerant to drought and bacterial leaf spot disease.<h4>Conclusions</h4>This genome-wide investigation of VrNACs provides a unique resource for further detailed investigations aimed at predicting orthologs functions and what role the play under abiotic and biotic stress, with the ultimate aim to improve mung bean production under diverse environmental conditions.

Also flagged:metabolismageingage-relatedchromosomal regionschromatinchromosome
Journal Article 2022-07-15 ✓ 4 Snippets Wright KM, Deighan AG, Di Francesco A, Freund A, Jojic V, Churchill GA, Raj A.
In-Text Gene Mentions

Negr1 has also been implicated in obesity (Lee et al., 2012), autistic behavior, memory deficits, and increased susceptibility to seizures (Singh et al., 2018) in mice, and body mass index (Speliotes et al., 2010), and major depressive disorder (Hyde et al., 2016) in humans.

…example is theneuronal growth regulator 1growth regulator 1…

…regulator 1 (Negr1) gene, a…

Negr1has also been…

Show Full Abstract

Understanding how genetic variation shapes a complex trait relies on accurately quantifying both the additive genetic and genotype-environment interaction effects in an age-dependent manner. We used a linear mixed model to quantify diet-dependent genetic contributions to body weight measured through adulthood in diversity outbred female mice under five diets. We observed that heritability of body weight declined with age under all diets, except the 40% calorie restriction diet. We identified 14 loci with age-dependent associations and 19 loci with age- and diet-dependent associations, with many diet-dependent loci previously linked to neurological function and behavior in mice or humans. We found their allelic effects to be dynamic with respect to genomic background, age, and diet, identifying several loci where distinct alleles affect body weight at different ages. These results enable us to more fully understand and predict the effectiveness of dietary intervention on overall health throughout age in distinct genetic backgrounds.

Also flagged:MethylationNEFHcancerrenal cell cancerRCCmethylation-
Journal Article 2022-07-15 ✓ 5 Snippets Koudonas A, Papaioannou M, Kampantais S, Anastasiadis A, Hatzimouratidis K, Dimitriadis G.
In-Text Gene Mentions

Comparison of quantitative results between matched tumor and normal tissues revealed tumor-specific hypermethylation of PCDH17, NEFH, and RASSF1A genes in tumor tissues, which reached statistical significance (Table 2) and characterized the majority of cohort’s patients (Fig. 2).

PCDH17 gene is located in the 13q.21.2 chromosome and belongs to the protocadherins family, which have varied tumor suppression functions such as regulation of cell to cell adhesion, growth control, signal transduction, and are downregulated through methylation in many forms of cancer.[26] Protocadherin-17 (PCDH17) seems to prevent cancer progression through EMT regulation.[27] Reduced expression was associated with metastasis and invasion in hepatocellular carcinoma[28] and predicted resistance to chemotherapy in colorectal cancer,[29] while PCDH17 gene methylation was correlated with shorter survival in patients with bladder cancer,[30] prostate cancer,[31] and with metastasis in breast cancer.[27] In RCC, quantitative methylation analysis of PCDH17 in tissue showed a statistically significant difference between patients and cancer-free individuals only in ccRCC (clear cell renal cell carcinoma) and pRCC (papillary renal cell carcinoma), while no difference was found after analysis in urine.[32] Another study depicted a statistically significant difference in the methylation status of cancerous and normal adjacent tissues of RCC patients using qualitative data.[33] Additionally, PCDH17 methylation status in cancer tissues proved to be an independent prognostic factor for progression and overall survival.

PCDH17 was more methylated in patients with ccRCC subtype (P = .015) and high-grade tumors (P = .013), while NEFH methylation was higher in locally advanced tumors (P = .032).

In this study, we investigated the possible association of promoter methylation of PCDH17, NEFH, RASSF1A, and FHIT, genes with the prognosis of nonmetastatic RCC patients.

In the current study, we aimed to discover the tissue-specific alterations and prognostic potential of the methylation status of PCDH17, NEFH, RASSF1A, and FHIT in cancerous and normal adjacent tissues from patients with RCC (Fig. 5).

Show Full Abstract

DNA methylation makes up a main part of the molecular mechanism of cancer evolution and has shown promising results in the prognosis of renal cell cancer (RCC). In this study, we investigated the possible association of promoter methylation of PCDH17, NEFH, RASSF1A, and FHIT, genes with the prognosis of nonmetastatic RCC patients. Cancerous and normal adjacent tissues from surgical specimens of 41 patients with long follow-up were treated for DNA isolation and bisulfite conversion. The gene promoter methylation was determined with quantitative methylation-specific PCR (qMSP). Wilcoxon signed-rank test was used for paired methylation comparisons, while univariate linear regression and Mann-Whitney test were applied for associating methylation status with clinical and disease characteristics. Cox regression proportional hazards models and Kaplan-Meier plots were used for survival analyses in reference to methylation status. Paired comparisons showed tissue-specific hypermethylation for PCDH17 (P < .001), NEFH (P < .001), RASSF1A (P = .032), while a positive association of methylation in normal tissues with age was demonstrated for PCDH17 (P < .001), RASSF1A (P < .001), FHIT (P < .001). PCDH17 was more methylated in cases with clear cell RCC (P = .015) and high-grade tumor (P = .013), while NEFH methylation was higher in locally advanced cases (P = .032). PCDH17 hypermethylation in cancerous and normal tissues was linked to shorter disease-specific survival (DSS, P = .026, P = .004), disease-free survival (DFS, P = .004, P = .019) while NEFH hypermethylation in cancerous tissues was related to shorter DSS (P = .032). Increased methylation difference of NEFH was also associated with shorter DSS (P = .041) and DFS (P = .020), while the corresponding parameter for PCDH17 was associated with poor DFS (P = .014). Kaplan-Meier curves for hypermethylation in cancer tissues demonstrated different clinical courses for PCDH17 (P = .017), NEFH (P = .023) regarding DSS, and PCDH17 (P = .001) regarding DFS. Our study not only highlights the prognostic value of promoter methylation of PCDH17 and NEFH in cancer tissues but also is the first report of the prognostic value of methylation alterations in normal tissues. Our findings are the first report of the prognostic value of methylation alterations in normal tissues, which can contribute to improved assessment of recurrence risk.

Also flagged:ferroptosishepatocellular carcinomatumormethylationGene expressioncancer of the liver
Journal Article 2022-07-15 ✓ 2 Snippets Wang D, Zhang L, Zhang Y, Zhang Y, Xu S.
In-Text Gene Mentions
⭐ same-sentence co-mention

…ifferentially expressed ICGs (BTN2A1, BTN2A2, BTNL9, CD276,…

⭐ same-sentence co-mention

…expressed ICGs (BTN2A1,BTN2A2, BTNL9, CD276, CD47,…

Show Full Abstract

<h4>Background</h4>Long noncoding RNAs (lncRNAs) have been implicated in the development of hepatocellular carcinoma (HCC). Mounting evidence shows that lncRNAs can be used as prognostic biomarkers of HCC. Here, we developed a multi-lncRNA prognostic signature comprising ferroptosis-related lncRNAs in HCC.<h4>Methods</h4>Gene expression data and clinical information of HCC were obtained from the TCGA dataset. Differentially expressed genes of ferroptosis (DE-Ferrs) were screened. Correlation analysis was carried between lncRNAs and DE-Ferrs to identify ferroptosis-related lncRNAs. lncRNAs associated with prognosis and ferroptosis were identified using Univariate Cox analysis. Data from a TCGA dataset were randomly grouped into training and verification sets. The least absolute shrinkage and selection operator method analysis was carried out to identify lncRNAs with prognostic value. These lncRNAs were used to construct a prognostic signature using the training set. The signature was validated in the verification set.<h4>Results</h4>A total of 90 DE-Ferrs-related lncRNAs were identified which were significantly correlated with HCC prognosis. Seven lncRNAs were used to construct a 7-lncRNA signature. The area under the curves for 1-, 3-, and 5-year overall survival (OS) were 0.748, 0.681, and 0.659 in the training set, and 0.791, 0.731, and 0.815 in the validation set, respectively. The results demonstrated that a high-risk score was significantly associated with a high tumor grade, high infiltration of macrophages and fibroblasts in the tumor, and high expression of m6A methylation regulatory factors. A nomogram was constructed using the risk score and clinical features for predicting the prognosis of HCC. The nomogram showed high prediction accuracy.<h4>Conclusion</h4>In conclusion, the established 7 ferroptosis-related lncRNAs signature can accurately predict HCC prognosis.

Also flagged:COVID-19deathimmune suppressionironhyperglycemiadiabetes mellitus
Journal Article 2022-07-15 ✓ 4 Snippets Miryala SK, Anbarasu A, Ramaiah S.
In-Text Gene Mentions

…include GSTM6, TIMD2,SERPINC1, NR1I3 and KNGL.…

…The geneSERPINC1encodes for the…

…for the proteinantithrombin-IIIand is a…

…genes GSTM6, TIMD2,SERPINC1NR1I3, and KNGL…

Show Full Abstract

Patients admitted to the hospital with coronavirus disease (COVID-19) are at risk for acquiring mycotic infections in particular Candidemia. Candida albicans (C. albicans) constitutes an important component of the human mycobiome and the most common cause of invasive fungal infections. Invasive yeast infections are gaining interest among the scientific community as a consequence of complications associated with severe COVID-19 infections. Early identification and surveillance for Candida infections is critical for decreasing the COVID-19 mortality. Our current study attempted to understand the molecular-level interactions between the human genes in different organs during systematic candidiasis. Our research findings have shed light on the molecular events that occur during Candidiasis in organs such as the kidney, liver, and spleen. The differentially expressed genes (up and down-regulated) in each organ will aid in designing organ-specific therapeutic protocols for systemic candidiasis. We observed organ-specific immune responses such as the development of the acute phase response in the liver; TGF-pathway and genes involved in lymphocyte activation, and leukocyte proliferation in the kidney. We have also observed that in the kidney, filament production, up-regulation of iron acquisition mechanisms, and metabolic adaptability are aided by the late initiation of innate defense mechanisms, which is likely related to the low number of resident immune cells and the sluggish recruitment of new effector cells. Our findings point to major pathways that play essential roles in specific organs during systemic candidiasis. The hub genes discovered in the study can be used to develop novel drugs for clinical management of Candidiasis.

Also flagged:acral melanomacancercutaneous melanomamethylationacral melanomasTAPBP
Journal Article 2022-07-15 ✓ 2 Snippets Vicente ALSA, Novoloaca A, Cahais V, Awada Z, Cuenin C, Spitz N, Carvalho AL, Evangelista AF, Crovador CS, Reis RM, Herceg Z, de Lima Vazquez V, Ghantous A.
In-Text Gene Mentions

Among them, PKHD1L1, LRP1B, ADGRV1 and DNAH10 were hypomethylated in UV-mutant compared with non UV-mutant cutaneous melanoma patients in BCH (Supplementary Fig. 3a).

…, ADGRV1 andDNAH10were hypomethylated in…

Show Full Abstract

Ultraviolet radiation (UV) is causally linked to cutaneous melanoma, yet the underlying epigenetic mechanisms, known as molecular sensors of exposure, have not been characterized in clinical biospecimens. Here, we integrate clinical, epigenome (DNA methylome), genome and transcriptome profiling of 112 cutaneous melanoma from two multi-ethnic cohorts. We identify UV-related alterations in regulatory regions and immunological pathways, with multi-OMICs cancer driver potential affecting patient survival. TAPBP, the top gene, is critically involved in immune function and encompasses several UV-altered methylation sites that were validated by targeted sequencing, providing cost-effective opportunities for clinical application. The DNA methylome also reveals non UV-related aberrations underlying pathological differences between the cutaneous and 17 acral melanomas. Unsupervised epigenomic mapping demonstrated that non UV-mutant cutaneous melanoma more closely resembles acral rather than UV-exposed cutaneous melanoma, with the latter showing better patient prognosis than the other two forms. These gene-environment interactions reveal translationally impactful mechanisms in melanomagenesis.

Also flagged:clear cell renal cell carcinomaUBE3Ccancertumorcell proliferationangiogenesis
Journal Article 2022-07-15 ✓ 5 Snippets Xu Z, Chen S, Liu R, Chen H, Xu B, Xu W, Chen M.
In-Text Gene Mentions

Venn diagram showed that PEBP1 and SMARCA1 overlapped in circPOLR2A-interacting proteins and the proteins with independent prognostic value in cRCC (Fig. 4b).

It has been reported that PEBP1 could serve as a suppressor in cancer progression via the Raf1/MEK/ERK signaling pathway [71–74].

(c, d, e) Bioinformatics analysis of the CPTAC database suggested that PEBP1 protein levels were associated with cRCC tumor size (c), pathologic T stage (d) and Fuhrman grade (e) in the cRCC cohort.

Bioinformatics analysis indicated that the protein level of PEBP1 was negatively correlated with tumor size, pathologic T stage and Fuhrman grade in the cRCC cohort from the CPTAC database (Supplemental Fig. 2c, d and e).

(f) Kaplan-Meier method and log-rank test confirmed that the PEBP1 protein level was a favorable prognostic factor in the cRCC cohort from CPTAC database.

Show Full Abstract

<h4>Background</h4>Increasing evidence has demonstrated that circular RNAs (circRNAs) are implicated in cancer progression. However, the aberrant expression and biological functions of circRNAs in clear cell renal cell carcinoma (cRCC) remain largely elusive.<h4>Method</h4>Differentially expressed circRNAs in cRCC were filtered via bioinformatics analysis. Aberrant circPOLR2A expression was validated in cRCC tissues and cell lines via qRT-PCR. Sanger sequencing was used to identify the backsplicing site of circPOLR2A. In vitro and in vivo functional experiments were performed to evaluate the role of circPOLR2A in cRCC malignancy. RNA pull-down, mass spectrometry, RIP, FISH and immunofluorescence assays were used to identify and validate the circPOLR2A-interacting proteins. Ubiquitination modification and interaction between proteins were detected via Co-IP and western blotting. The m6A modification in circPOLR2A was validated by the meRIP assay.<h4>Results</h4>Bioinformatics analysis revealed that circPOLR2A was highly expressed in cRCC tissues and metastatic cRCC tissues. CircPOLR2A expression was associated with tumor size and TNM stage in cRCC patients. In vitro and in vivo functional assays revealed that circPOLR2A accelerated cRCC cell proliferation, migration, invasion and angiogenesis, while inhibiting apoptosis. Further mechanistic research suggested that circPOLR2A could interact with UBE3C and PEBP1 proteins, and that UBE3C could act as a specific ubiquitin E3 ligase for the PEBP1 protein. The UBE3C/circPOLR2A/PEBP1 protein-RNA ternary complex enhanced the UBE3C-mediated ubiquitination and degradation of the PEBP1 protein which could inactivate the ERK signaling pathway. Rescue experiments revealed that the PEBP1 protein was the functional downstream target of circPOLR2A. Furthermore, m6A modification in circPOLR2A was confirmed, and the m6A reader YTHDF2 could regulate circPOLR2A expression.<h4>Conclusion</h4>Our study demonstrated that circPOLR2A modulated the UBE3C-mediated ubiquitination and degradation of the PEBP1 protein, and further activated the ERK pathway during cRCC progression and metastasis. The m6A reader, YTHDF2, regulated circPOLR2A expression in cRCC. Hence, circPOLR2A could be a potential target for the diagnosis and treatment of cRCC.

Also flagged:deathhematologic malignanciesbiosynthesishematological malignanciesneoplasmsacute leukemia
Journal Article 2022-07-15 ✓ 2 Snippets Deng F, Zhang C, Lu T, Liao EJ, Huang H, Wei S.
In-Text Gene Mentions

…co-splicing sites ofDCC(deleted in colorectal…

…ructures highly-different fromDCC.…

Show Full Abstract

As one of the leading causes of death, hematologic malignancies are associated with an ever-increasing incidence, and drug resistance and relapse of patients after treatment represent clinical challenges. Therefore, there are pressing demands to uncover biomarkers to indicate the development, progression, and therapeutic targets for hematologic malignancies. Circular RNAs (circRNAs) are covalently closed circular-single-stranded RNAs whose biosynthesis is regulated by various factors and is widely-expressed and evolutionarily conserved in many organisms and expressed in a tissue-/cell-specific manner. Recent reports have indicated that circRNAs plays an essential role in the progression of hematological malignancies. However, circRNAs are difficult to detect with low abundance using conventional techniques. We need to learn more information about their features to develop new detection methods. Herein, we sought to retrospect the current knowledge about the characteristics of circRNAs and summarized research on circRNAs in hematological malignancies to explore a potential direction.

Also flagged:hypoxia-inducible factorHIFoxygenangiogenesiserythropoiesisintegrin-linked kinase
Journal Article 2022-07-15 ✓ 1 Snippet Sharma V, Varshney R, Sethy NK.
In-Text Gene Mentions

…(PRDX2), peroxiredoxin 6 (PRDX6), protein deglycase 1…

Show Full Abstract

Both genomics- and proteomics-based investigations have identified several essential genes, proteins, and pathways that may facilitate human adaptive genotype/phenotype in a population-specific manner. This comprehensive review provides an up-to-date list of genes and proteins identified for human adaptive responses to high altitudes. Genomics studies for indigenous high-altitude populations like Tibetans, Andeans, Ethiopians, and Sherpas have identified 169 genes under positive natural selection. Similarly, global proteomics studies have identified 258 proteins (± 1.2-fold or more) for Tibetan, Sherpa, and Ladakhi highlanders. The primary biological processes identified for genetic signatures include hypoxia-inducible factor (HIF)-mediated oxygen sensing, angiogenesis, and erythropoiesis. In contrast, major biological processes identified for proteomics signatures include 14-3-3 mediated sirtuin signaling, integrin-linked kinase (ILK), phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT), and integrin signaling. Comparing genetic and protein signatures, we identified 7 common genes/proteins (HBB/hemoglobin subunit beta, TF/serotransferrin, ANGPTL4/angiopoietin-related protein 4, CDC42/cell division control protein 42 homolog, GC/vitamin D-binding protein, IGFBP1/insulin-like growth factor-binding protein 1, and IGFBP2/insulin-like growth factor-binding protein 2) involved in crucial molecular functions like IGF-1 signaling, LXR/RXR activation, ferroptosis signaling, iron homeostasis signaling and regulation of cell cycle. Our combined multi-omics analysis identifies common molecular targets and pathways for human adaptation to high altitude. These observations further corroborate convergent positive selection of hypoxia-responsive molecular pathways in humans and advocate using multi-omics techniques for deciphering human adaptive responses to high altitude.

Also flagged:mood instabilitymajor depressionDEPpsychiatric disordersMOODschizophrenia
Journal Article 2022-07-15 ✓ 5 Snippets Hindley G, O'Connell KS, Rahman Z, Frei O, Bahrami S, Shadrin A, Høegh MC, Cheng W, Karadag N, Lin A, Rødevand L, Fan CC, Djurovic S, Lagerberg TV, Dale AM, Smeland OB, Andreassen OA.
In-Text Gene Mentions

…ychiatric disorders, includingPLCL1in SCZ, PLCL2…

…in BIP, andNEGR1in DEP (Pardiñas…

…Among these,VRK2, KIAA1109 ,…

…Furthermore,VRK2, AC110781.3 ,…

…substantia nigra (VRK2), caudate, hypothalamus…

Show Full Abstract

Recent genome-wide association studies of mood instability (MOOD) have found significant positive genetic correlation with major depression (DEP) and weak correlations with other psychiatric disorders. We investigated the polygenic overlap between MOOD and psychiatric disorders beyond genetic correlation to better characterize putative shared genetic determinants. GWAS summary statistics for schizophrenia (SCZ, n = 105,318), bipolar disorder (BIP, n = 413,466), DEP (n = 450,619), attention-deficit hyperactivity disorder (ADHD, n = 53,293), and MOOD (n = 363,705) were analyzed using the bivariate causal mixture model and conjunctional false discovery rate methods. MOOD correlated positively with all psychiatric disorders, but with wide variation in strength (r<sub>g</sub>  = 0.10-0.62). Of 10.4 K genomic variants influencing MOOD, 4 K-9.4 K influenced psychiatric disorders. Furthermore, MOOD was jointly associated with DEP at 163 loci, SCZ at 110, BIP at 60 and ADHD at 25. Fifty-three jointly associated loci were overlapping across two or more disorders, seven of which had discordant effect directions on psychiatric disorders. Genes mapped to loci associated with MOOD and all four disorders were enriched in a single gene-set, "synapse organization." The extensive polygenic overlap indicates shared molecular underpinnings across MOOD and psychiatric disorders. However, distinct patterns of genetic correlation and effect directions may relate to differences in the core clinical features of each disorder.

Also flagged:Cancerocular diseasedeathmembranePAX6KRT12
Journal Article 2022-07-15 ✓ 3 Snippets van Zyl T, Yan W, McAdams AM, Monavarfeshani A, Hageman GS, Sanes JR.
In-Text Gene Mentions

…as EBF2 andSHISA6( SI Appendix…

…, NECTIN3 ,CACNA1E, ENPP2 ,…

…, LRRN2 ,CACNA1E).…

Show Full Abstract

The anterior segment of the eye consists of the cornea, iris, ciliary body, crystalline lens, and aqueous humor outflow pathways. Together, these tissues are essential for the proper functioning of the eye. Disorders of vision have been ascribed to defects in all of them; some disorders, including glaucoma and cataract, are among the most prevalent causes of blindness in the world. To characterize the cell types that compose these tissues, we generated an anterior segment cell atlas of the human eye using high-throughput single-nucleus RNA sequencing (snRNAseq). We profiled 195,248 nuclei from nondiseased anterior segment tissues of six human donors, identifying >60 cell types. Many of these cell types were discrete, whereas others, especially in the lens and cornea, formed continua corresponding to known developmental transitions that persist in adulthood. Having profiled each tissue separately, we performed an integrated analysis of the entire anterior segment, revealing that some cell types are unique to a single structure, whereas others are shared across tissues. The integrated cell atlas was then used to investigate cell type-specific expression patterns of more than 900 human ocular disease genes identified through either Mendelian inheritance patterns or genome-wide association studies.

Also flagged:Polysaccharidepolysaccharideswateralcoholgalactansugars
Journal Article 2022-07-15 ✓ 1 Snippet Figueroa FA, Abdala-Díaz RT, Pérez C, Casas-Arrojo V, Nesic A, Tapia C, Durán C, Valdes O, Parra C, Bravo-Arrepol G, Soto L, Becerra J, Cabrera-Barjas G.
In-Text Gene Mentions

…inhibition by potentiatingantithrombin-III(AT-III) or heparin…

Show Full Abstract

Codium bernabei is a green alga that grows on Chilean coasts. The composition of its structural polysaccharides is still unknown. Hence, the aim of this work is to isolate and characterize the hot water extracted polysaccharide fractions. For this purpose, the water extracts were further precipitated in alcohol (TPs) and acid media (APs), respectively. Both fractions were characterized using different physicochemical techniques such as GC-MS, GPC, FTIR, TGA, and SEM. It is confirmed that the extracted fractions are mainly made of sulfated galactan unit, with a degree of sulfation of 19.3% (TPs) and 17.4% (ATs) and a protein content of 3.5% in APs and 15.6% in TPs. Other neutral sugars such as xylose, glucose, galactose, fucose, mannose, and arabinose were found in a molar ratio (0.05:0.6:1.0:0.02:0.14:0.11) for TPs and (0.05:0.31:1.0:0.03:0.1:0.13) for ATs. The molecular weight of the polysaccharide samples was lower than 20 kDa. Both polysaccharides were thermally stable (Tonset > 190 °C) and showed antioxidant activity according to the ABTS•+ and DPPH tests, where TPs fractions had higher scavenging activity (35%) compared to the APs fractions. The PT and APTTS assays were used to measure the anticoagulant activity of the polysaccharide fractions. In general, the PT activity of the TPs and APs was not different from normal plasma values. The exception was the TPs treatment at 1000 µg mL−1 concentration. The APTTS test revealed that clotting time for both polysaccharides was prolonged regarding normal values at 1000 µg mL−1. Finally, the antitumor test in colorectal carcinoma (HTC-116) cell line, breast cancer (MCF-7) and human leukemia (HL-60) cell lines showed the cytotoxic effect of TPs and APs. Those results suggest the potential biotechnological application of sulfate galactan polysaccharides isolated from a Chilean marine resource.

Also flagged:FerroptosisLung adenocarcinomaLUADlung squamous cell carcinomanon-small cell lung cancerNSCLC
Journal Article 2022-07-15 ✓ 4 Snippets Zhang N, Wu Y, Wu Y, Wang L, Chen J, Wang X, Chard Dunmall LS, Cheng Z, Wang Y.
In-Text Gene Mentions

Recent studies have found that PEBP1 plays a vital role in tumor development.

…of GPX4 andPEBP1.…

…have found thatPEBP1plays a vital…

PEBP1induces apoptosis through…

Show Full Abstract

Background: Lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSCC) are two of the most common subtypes of non-small cell lung cancer (NSCLC), with high mortality rates and rising incidence worldwide. Ferroptosis is a mode of programmed cell death caused by lipid peroxidation, the accumulation of reactive oxygen species, and is dependent on iron. The recent discovery of ferroptosis has provided new insights into tumor development, and the clinical relevance of ferroptosis for tumor therapy is being increasingly appreciated. However, its role in NSCLC remains to be explored. Methods: The clinical and molecular data for 1727 LUAD and LUSCC patients and 73 control individuals were obtained from the Gene Expression Omnibus (GEO) database and the Cancer Genome Atlas (TCGA) database. Gene expression profiles, copy number variations and somatic mutations of 57 ferroptosis-related genes in 1727 tumor samples from the four datasets were used in a univariate Cox analysis and consensus clustering analysis. The biological signatures of each pattern were identified. A ferroptosis score was generated by combining the univariate Cox regression analysis and random forest algorithm followed by principal component analysis (PCA) and further investigated for its predictive and therapeutic value in LUAD and LUSCC. Results: The expression of 57 ferroptosis-related genes in NSCLC patients differed significantly from that of normal subjects. Based on unsupervised clustering of ferroptosis-related genes, we divided all patients into three ferroptosis expression pattern groups, which showed differences in ferroptosis-associated gene expression patterns, immune cell infiltration levels, prognostic characteristics and enriched pathways. Using the differentially expressed genes in the three ferroptosis expression patterns, a set of 17 ferroptosis-related gene prognostic models was established, which clustered all patients in the cohort into a low score group and a high score group, with marked differences in prognosis (p < 0.001). The high ferroptosis score was significantly associated with positive response to radiotherapy (p < 0.001), high T stage (p < 0.001), high N stage (p < 0.001) and high-grade tumor (p < 0.001) characteristics. Conclusions: The 17 ferroptosis-associated genes show great potential for stratifying LUAD and LUSCC patients into high and low risk groups. Interestingly, a high ferroptosis score in LUAD patients was associated with a good prognosis, whereas a similar high ferroptosis score in LUSCC patients was associated with a poor prognosis. Familiarity with the mechanisms underlying ferroptosis and its implications for the treatment of NSCLC, as well as its effect on OS and PFS, may provide guidance and insights in developing new therapeutic targets for NSCLC.

Also flagged:Major Depressionpathogenesisgene expressiontranscription factorbindingSLC12A5
Journal Article 2022-07-15 ✓ 2 Snippets Pérez-Granado J, Piñero J, Medina-Rivera A, Furlong LI.
In-Text Gene Mentions

Some of the pGenes are associated with processes related to MD pathogenesis, such as TLR4, involved in immune response [33], ESR2, a regulator of estrogen response [34], TCF4, with a role in nervous system development [35], DCC, in charge of axon guidance and neuronal connectivity [36], PAX5, which interferes in mouse neural stem cells proliferation and migration [37,38], and CYP7B1, that participates in the metabolism of the neurosteroids DHEA and pregnenolone [39].

…[ 35 ],DCC, in charge of…

Show Full Abstract

Understanding the molecular basis of major depression is critical for identifying new potential biomarkers and drug targets to alleviate its burden on society. Leveraging available GWAS data and functional genomic tools to assess regulatory variation could help explain the role of major depression-associated genetic variants in disease pathogenesis. We have conducted a fine-mapping analysis of genetic variants associated with major depression and applied a pipeline focused on gene expression regulation by using two complementary approaches: cis-eQTL colocalization analysis and alteration of transcription factor binding sites. The fine-mapping process uncovered putative causally associated variants whose proximal genes were linked with major depression pathophysiology. Four colocalizing genetic variants altered the expression of five genes, highlighting the role of SLC12A5 in neuronal chlorine homeostasis and MYRF in nervous system myelination and oligodendrocyte differentiation. The transcription factor binding analysis revealed the potential role of rs62259947 in modulating P4HTM expression by altering the YY1 binding site, altogether regulating hypoxia response. Overall, our pipeline could prioritize putative causal genetic variants in major depression. More importantly, it can be applied when only index genetic variants are available. Finally, the presented approach enabled the proposal of mechanistic hypotheses of these genetic variants and their role in disease pathogenesis.

Also flagged:neurological disordersHDtranscytosisHuntington Diseaseautosomal dominant neurodegenerative disordercytoplasmic
Journal Article 2022-07-15 ✓ 5 Snippets Vignone D, Gonzalez Paz O, Fini I, Cellucci A, Auciello G, Battista MR, Gloaguen I, Fortuni S, Cariulo C, Khetarpal V, Dominguez C, Muñoz-Sanjuán I, Di Marco A.
In-Text Gene Mentions

On the other hand, a polyQ-independent Singulex assay employing the same capture antibody (2B7) and D7F7 (~aa1220) as the detection antibody was used for interrogating the expression levels of HTT protein (Fodale et al., submitted to Journal of Huntington’s Disease).

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by the CAG repeat in the exon 1 of the huntingtin gene, which encodes for huntingtin (HTT), a cytoplasmic protein ubiquitously expressed in all cells of the body.

…encodes for huntingtin (HTT), a cytoplasmic protein…

…for revealing theHTTprotein in a…

…higher affinity forHTTbearing expanded polyQ…

Show Full Abstract

While blood-brain barrier (BBB) dysfunction has been described in neurological disorders, including Huntington's disease (HD), it is not known if endothelial cells themselves are functionally compromised when promoting BBB dysfunction. Furthermore, the underlying mechanisms of BBB dysfunction remain elusive given the limitations with mouse models and post mortem tissue to identify primary deficits. We established models of BBB and undertook a transcriptome and functional analysis of human induced pluripotent stem cell (iPSC)-derived brain-like microvascular endothelial cells (iBMEC) from HD patients or unaffected controls. We demonstrated that HD-iBMECs have abnormalities in barrier properties, as well as in specific BBB functions such as receptor-mediated transcytosis.

Also flagged:Methylationchronic diseasescardiometabolic diseasesgene expressionbindingtranscription factors
Journal Article 2022-07-15 ✓ 2 Snippets Hellbach F, Baumeister SE, Wilson R, Wawro N, Dahal C, Freuer D, Hauner H, Peters A, Winkelmann J, Schwettmann L, Rathmann W, Kronenberg F, Koenig W, Meisinger C, Waldenberger M, Linseisen J.
In-Text Gene Mentions

Table 5 contains p-values for the calculated marginal effect size, the marginal standard error and the interaction p-value adjusted for genomic inflation and corrected by the FDR—for the 10 lowest p-values per food group, if available. A table with all statistically significant results of the interaction analysis is provided in Table S2, including data of the analysis of hs-CRP and the nutrients alcohol and folic acid. FDR-corrected p-values below an alpha of 0.1 were regarded as statistically significant. We observed much evidence for an effect modification with metabotype for some food groups. These food groups were cruciferous vegetables with 83 signals for mainly metabotype 1 (Figure 1), cheese with 164 signals for metabotype 3 (Figure 2), whole grain products with 17 signals for metabotype 3, total meat with seven signals for metabotype 2, eggs with nine signals for metabotypes 2 and 3 and margarine with 81 signals for metabotype 3. Cruciferous and cheese forest plots were produced to show the wide distribution of effect sizes. See Figures S39–S42 for the remaining forest plots. We checked for genes that appeared multiple times across food groups or in the analysis of one food group. These were ASB16, CCDC149, TMEM88B, KRTAP9-6, and MTHFD1L, which can be found in Table S2 with color codes and as interaction plots in Figures S43–S51 section. The most interesting finding of genes that appeared multiple times is MTHFD1L, which translates to the protein methylenetetrahydrofolate dehydrogenase-1 similar to and essentially part of the regeneration of methionine from homocysteine. We found significant signals for CpGs that were annotated to genes that are associated with eye health: RP1L1, EML1, PITPNC1, NRL (see Figure 3 for interaction plots with calculated marginal effect sizes). Other gene annotations were retinoid X receptor gamma (RXRG), which is a nuclear receptor reacting to retinoic acid, glutathione peroxidase 2 (GPX2), which is a crucial part of the human being’s antioxidant-system and paraoxonase 3 (PON3), which inhibits the oxidation of low-density lipoprotein. The results from the sensitivity analysis, where we accounted for genomic inflation, showed that several associations were no longer statistically significant, although many persisted (see Table S3 for all results and Figures S52–S57 for t- and p-value distribution). For the six food groups that we examined for stability of results, 22 associations remained significant for cruciferous vegetables, 33 associations for cheese, 16 associations for whole grain products, zero associations for total meat and eggs, and all associations remained for margarine. None of the CpG-annotated genes associated with eye health persisted. Some examples of CpG sites that were still significant are those annotated to MTHFD1L, HFE, CDH4, TLR5 and 3 of 4 CpGs that were annotated to TMEM88B. In the sensitivity analysis accounting for physical activity and menopause, the p-value for all signals remained <0.05, except for one in the food group cruciferous for metabotype 3, see Table S4.

…annotated to MTHFD1L,HFE, CDH4, TLR5 and…

Show Full Abstract

Associations between diet and DNA methylation may vary among subjects with different metabolic states, which can be captured by clustering populations in metabolically homogenous subgroups, called metabotypes. Our aim was to examine the relationship between habitual consumption of various food groups and DNA methylation as well as to test for effect modification by metabotype. A cross-sectional analysis of participants (median age 58 years) of the population-based prospective KORA FF4 study, habitual dietary intake was modeled based on repeated 24-h diet recalls and a food frequency questionnaire. DNA methylation was measured using the Infinium MethylationEPIC BeadChip providing data on >850,000 sites in this epigenome-wide association study (EWAS). Three metabotype clusters were identified using four standard clinical parameters and BMI. Regression models were used to associate diet and DNA methylation, and to test for effect modification. Few significant signals were identified in the basic analysis while many significant signals were observed in models including food group-metabotype interaction terms. Most findings refer to interactions of food intake with metabotype 3, which is the metabotype with the most unfavorable metabolic profile. This research highlights the importance of the metabolic characteristics of subjects when identifying associations between diet and white blood cell DNA methylation in EWAS.

Also flagged:Acute Respiratory Distress SyndromeARDSdefense responsecoagulationoxygenbinding
Journal Article 2022-07-15 ✓ 3 Snippets Wildi K, Bouquet M, Ainola C, Livingstone S, Colombo SM, Heinsar S, Sato N, Sato K, Wilson E, Abbate G, Passmore MR, Hyslop K, Liu K, Li Bassi G, Suen JY, Fraser JF.
In-Text Gene Mentions

…< 0.001%) displayingantithrombin-IIIprecursor (SERPINC1), thrombin…

…g antithrombin-III precursor (SERPINC1), thrombin (F2), kininogen-1…

antithrombin-IIIprecursor…

Show Full Abstract

Despite decades of comprehensive research, Acute Respiratory Distress Syndrome (ARDS) remains a disease with high mortality and morbidity worldwide. The discovery of inflammatory subphenotypes in human ARDS provides a new approach to study the disease. In two different ovine ARDS lung injury models, one induced by additional endotoxin infusion (phenotype 2), mimicking some key features as described in the human hyperinflammatory group, we aim to describe protein expression among the two different ovine models. Nine animals on mechanical ventilation were included in this study and were randomized into (a) phenotype 1, <i>n</i> = 5 (Ph1) and (b) phenotype 2, <i>n</i> = 4 (Ph2). Plasma was collected at baseline, 2, 6, 12, and 24 h. After protein extraction, data-independent SWATH-MS was applied to inspect protein abundance at baseline, 2, 6, 12, and 24 h. Cluster analysis revealed protein patterns emerging over the study observation time, more pronounced by the factor of time than different injury models of ARDS. A protein signature consisting of 33 proteins differentiated among Ph1/2 with high diagnostic accuracy. Applying network analysis, proteins involved in the inflammatory and defense response, complement and coagulation cascade, oxygen binding, and regulation of lipid metabolism were activated over time. Five proteins, namely LUM, CA2, KNG1, AGT, and IGJ, were more expressed in Ph2.

Also flagged:Peptideheart failurecancersmuscular dystrophyviral infectionsnucleotides
Journal Article 2022-07-15 No Snippets Gallicano GI, Fu J, Mahapatra S, Sharma MVR, Dillon C, Deng C, Zahid M.
Show Full Abstract

Causes and treatments for heart failure (HF) have been investigated for over a century culminating in data that have led to numerous pharmacological and surgical therapies. Unfortunately, to date, even with the most current treatments, HF remains a progressive disease with no therapies targeting the cardiomyocytes directly. Technological advances within the past two to three years have brought about new paradigms for treating many diseases that previously had been extremely difficult to resolve. One of these new paradigms has been a shift from pharmacological agents to antisense technology (e.g., microRNAs) to target the molecular underpinnings of pathological processes leading to disease onset. Although this paradigm shift may have been postulated over a decade ago, only within the past few years has it become feasible. Here, we show that miRNA106a targets genes that, when misregulated, have been shown to cause hypertrophy and eventual HF. The addition of miRNA106a suppresses misexpressed HF genes and reverses hypertrophy. Most importantly, using a cardiac targeting peptide reversibly linked to miRNA106a, we show delivery is specific to cardiomyocytes.

Also flagged:Cardiac HypertrophyHeart Failuremyocardial infarctionischemiamembrane transportersNHE1
Journal Article 2022-07-15 No Snippets Xia H, Zahra A, Jia M, Wang Q, Wang Y, Campbell SL, Wu J.
Show Full Abstract

Cardiac hypertrophy is defined as increased heart mass in response to increased hemodynamic requirements. Long-term cardiac hypertrophy, if not counteracted, will ultimately lead to heart failure. The incidence of heart failure is related to myocardial infarction, which could be salvaged by reperfusion and ultimately invites unfavorable myocardial ischemia-reperfusion injury. The Na<sup>+</sup>/H<sup>+</sup> exchangers (NHEs) are membrane transporters that exchange one intracellular proton for one extracellular Na<sup>+</sup>. The first discovered NHE isoform, NHE1, is expressed almost ubiquitously in all tissues, especially in the myocardium. During myocardial ischemia-reperfusion, NHE1 catalyzes increased uptake of intracellular Na<sup>+</sup>, which in turn leads to Ca<sup>2+</sup> overload and subsequently myocardial injury. Numerous preclinical research has shown that NHE1 is involved in cardiac hypertrophy and heart failure, but the exact molecular mechanisms remain elusive. The objective of this review is to demonstrate the potential role of NHE1 in cardiac hypertrophy and heart failure and investigate the underlying mechanisms.

Also flagged:COVID-19respiratory tract infectionrespiratory distress syndromeinflammatory responsehypercoagulationvenous thrombosis
Journal Article 2022-07-15 No Snippets Belfiore MP, Russo GM, Gallo L, Atripaldi U, Tamburrini S, Caliendo V, Impieri L, Del Canto MT, Ciani G, Parrella P, Mangoni di Santo Stefano ML, Salvia AAH, Urraro F, Nardone V, Coppola N, Reginelli A, Cappabianca S.
Show Full Abstract

<h4>Introduction</h4>Coronavirus SARS-CoV-2, the causative agent of COVID-19, primarily causes a respiratory tract infection that is not limited to respiratory distress syndrome, but it is also implicated in other body systems. Systemic complications were reported due to an exaggerated inflammatory response, which involves severe alveolar damage in the lungs and exacerbates the hypercoagulation that leads to venous thrombosis, ischemic attack, vascular dysfunction and infarction of visceral abdominal organs. Some complications are related to anticoagulant drugs that are administrated to stabilize hypercoagulability, but increase the risk of bleeding, hematoma and hemorrhage. The aim of this study is to report the diagnostic role of CT in the early diagnosis and management of patients with severe COVID-19 complications through the most interesting cases in our experience.<h4>Material and methods</h4>The retrospective analysis of patients studied for COVID-19 in our institution and hospitals, which are part of the university training network, was performed.<h4>Cases</h4>Pneumomediastinum, cortical kidney necrosis, splenic infarction, cerebral ischemic stroke, thrombosis of the lower limb and hematomas are the most major complications that are reviewed in this study.<h4>Conclusions</h4>Since the onset of the COVID-19 pandemic, the CT imaging modality with its high sensitivity and specificity remains the preferred imaging choice to diagnose early the different complications associated with COVID-19, such as thrombosis, ischemic stroke, infarction and pneumomediastinum, and their management, which significantly improved the outcomes.

Also flagged:tunnelingnanotubenanotubesF-actinorganelleneurodegenerative disease
Journal Article 2022-07-15 No Snippets Lagalwar S.
Show Full Abstract

Tunneling nanotubes (TNTs), intercellular connections enriched with F-actin, were first identified as a viable means of cellular communication and organelle transport in animal cells at the early part of this century. Within the last 10 years, these microscopic and highly dynamic protrusions have been implicated in neurodegenerative disease propagation and pathogenesis. A host of aggregation-prone protein inclusions, including those containing alpha-synuclein, tau, prions and others, hijack this communication mechanism in both neurons and astrocytes. The exact cellular mechanisms underlying TNT-based propagation remain largely unknown, however, common practices can be identified. First, selective expression of the aggregation-prone form of proteins increases TNT density; next, endo-lysosomal pathways appear to support the loading and unloading of protein onto the TNT; and finally, TNT assembly results in the spontaneous formation of aggregation-prone protein inclusions in "acceptor" cells, indicating that TNTs are involved in not only the transport of inclusions but also in the seeding of new inclusions in naïve cells. These observations have implications for the spreading of neurodegenerative disease in the central nervous system and the consequent progression of symptoms. Here, I will summarize the empirical evidence of TNT-based aggregation-prone protein propagation to date, and propose an inclusive model of aggregate inclusion propagation along TNTs.

Also flagged:adenosine Receptorextracellularadenosineadenosine receptorsAdora2bhypoxia-inducible transcription factor HIF1A
Journal Article 2022-07-15 ✓ 2 Snippets Yuan X, Mills T, Doursout MF, Evans SE, Vidal Melo MF, Eltzschig HK.
In-Text Gene Mentions

Several previous studies have implicated netrin-1 signaling in attenuating myocardial ischemia and reperfusion injury (Mao et al., 2014), and have also identified signaling events related to classic netrin-1 receptors, e.g., via DCC signaling (Zhang and Cai, 2010; Bouhidel et al., 2015; Li et al., 2015).

This study was based on the notion that the interaction of netrin-1 with its receptor deleted in colorectal carcinoma (DCC) might involve an additional co-receptor, since netrin-1 protein only co-immunoprecipitate with DCC if cross-linked.

Show Full Abstract

During hypoxia or inflammation, extracellular adenosine levels are elevated. Studies using pharmacologic approaches or genetic animal models pertinent to extracellular adenosine signaling implicate this pathway in attenuating hypoxia-associated inflammation. There are four distinct adenosine receptors. Of these, it is not surprising that the Adora2b adenosine receptor functions as an endogenous feedback loop to control hypoxia-associated inflammation. First, Adora2b activation requires higher adenosine concentrations compared to other adenosine receptors, similar to those achieved during hypoxic inflammation. Second, Adora2b is transcriptionally induced during hypoxia or inflammation by hypoxia-inducible transcription factor HIF1A. Studies seeking an alternative adenosine receptor activation mechanism have linked netrin-1 with Adora2b. Netrin-1 was originally discovered as a neuronal guidance molecule but also functions as an immune-modulatory signaling molecule. Similar to Adora2b, netrin-1 is induced by HIF1A, and has been shown to enhance Adora2b signaling. Studies of acute respiratory distress syndrome (ARDS), intestinal inflammation, myocardial or hepatic ischemia and reperfusion implicate the netrin-Adora2b link in tissue protection. In this review, we will discuss the potential molecular linkage between netrin-1 and Adora2b, and explore studies demonstrating interactions between netrin-1 and Adora2b in attenuating tissue inflammation.

Also flagged:Binge eating disorderBEDobesitytype II diabetesheart diseasesucrose
Journal Article 2022-07-15 ✓ 1 Snippet Sena KD, Beierle JA, Richardson KT, Kantak KM, Bryant CD.
In-Text Gene Mentions

A preprint of a human genome-wide association study (GWAS) using data from the Million Veterans Program reported three risk loci near the HFE, MCHR2, and LRP11 genes influencing binge eating (Burstein et al., 2022), and further human genome-wide polygenic scores found genetic correlations in individuals with “binge-type” eating disorders and psychiatric disorders, like ADHD and depression (Hübel et al., 2021).

Show Full Abstract

Binge eating disorder (BED) is defined as chronic episodes of consuming large amounts of food in less than 2 h. Binge eating disorder poses a serious public health problem, as it increases the risk of obesity, type II diabetes, and heart disease. Binge eating is a highly heritable trait; however, its genetic basis remains largely unexplored. We employed a mouse model for binge eating that focused on identifying heritable differences between inbred substrains in acute and escalated intake of sucrose-sweetened palatable food vs. unsweetened chow pellets in a limited, intermittent access paradigm. In the present study, we examined two genetically similar substrains of BALB/c mice for escalation in food consumption, incubation of craving after a no-food training period, and compulsive-like food consumption in an aversive context. BALB/cJ and BALB/cByJ mice showed comparable levels of acute and escalated consumption of palatable food across training trials. Surprisingly, BALB/cByJ mice also showed binge-like eating of the unsweetened chow pellets similar to the escalation in palatable food intake of both substrains. Finally, we replicated the well-documented decrease in anxiety-like behavior in BALB/cByJ mice in the light-dark conflict test that likely contributed to greater palatable food intake than BALB/cJ in the light arena. To summarize, BALB/cByJ mice show binge-like eating in the presence and absence of sucrose. Possible explanations for the lack of selectivity in binge-like eating across diets (e.g., novelty preference, taste) are discussed.

Also flagged:fluoxetinemajor depressive disordervenlafaxineP-glycoprotein transporterbupropionserotonin transporter
Journal Article 2022-07-15 No Snippets Stäuble CK, Meier R, Lampert ML, Mikoteit T, Hatzinger M, Allemann SS, Hersberger KE, Meyer Zu Schwabedissen HE.
Show Full Abstract

We report the case of a 50-year-old male with major depressive disorder (MDD) to illustrate the challenge of finding effective antidepressant pharmacotherapy and the role that the patient's genetic makeup may play. Recent treatment attempts before clinic admission included venlafaxine and fluoxetine. Venlafaxine was discontinued due to lack of response, and subsequently switched to fluoxetine based on pharmacogenotyping of the P-glycoprotein transporter (P-gp, encoded by <i>ABCB1</i>) by the outpatient psychiatrist. Despite steady state serum levels within the therapeutic range, the patient did not benefit from fluoxetine either, necessitating admission to our clinic. Here a clinical pharmacist-led medication review including additional pharmacogenetic (PGx) analysis resulted in the change of the antidepressant therapy to bupropion. Under the new regimen, established in the in-patient-setting, the patient remitted. However, based on the assessed pharmacokinetics-related gene variants, including <i>CYP</i>s and <i>ABCB1</i>, non-response to fluoxetine could not be conclusively explained. Therefore, we retrospectively selected the serotonin transporter (SERT1, encoded by <i>SLC6A4</i>) for further genetic analysis of pharmacodynamic variability. The patient presented to be a homozygous carrier of the short allele variant in the 5-HTTLPR (S/S) located within the <i>SLC6A4</i> promoter region, which has been associated with a reduced expression of the SERT1. This case points out the potential relevance of panel PGx testing considering polymorphisms in genes of pharmacokinetic as well as pharmacodynamic relevance.

Also flagged:ocular disordersocular diseasesretinal diseasesblindnessgene transfertranslational
Journal Article 2022-07-15 No Snippets Panikker P, Roy S, Ghosh A, Poornachandra B, Ghosh A.
Show Full Abstract

Successful sequencing of the human genome and evolving functional knowledge of gene products has taken genomic medicine to the forefront, soon combining broadly with traditional diagnostics, therapeutics, and prognostics in patients. Recent years have witnessed an extraordinary leap in our understanding of ocular diseases and their respective genetic underpinnings. As we are entering the age of genomic medicine, rapid advances in genome sequencing, gene delivery, genome surgery, and computational genomics enable an ever-increasing capacity to provide a precise and robust diagnosis of diseases and the development of targeted treatment strategies. Inherited retinal diseases are a major source of blindness around the world where a large number of causative genes have been identified, paving the way for personalized diagnostics in the clinic. Developments in functional genetics and gene transfer techniques has also led to the first FDA approval of gene therapy for LCA, a childhood blindness. Many such retinal diseases are the focus of various clinical trials, making clinical diagnoses of retinal diseases, their underlying genetics and the studies of natural history important. Here, we review methodologies for identifying new genes and variants associated with various ocular disorders and the complexities associated with them. Thereafter we discuss briefly, various retinal diseases and the application of genomic technologies in their diagnosis. We also discuss the strategies, challenges, and potential of gene therapy for the treatment of inherited and acquired retinal diseases. Additionally, we discuss the translational aspects of gene therapy, the important vector types and considerations for human trials that may help advance personalized therapeutics in ophthalmology. Retinal disease research has led the application of precision diagnostics and precision therapies; therefore, this review provides a general understanding of the current status of precision medicine in ophthalmology.

Also flagged:CINvisionembryoLhx8Calm1Hmgb1
Journal Article 2022-07-15 No Snippets Li Z, Wang D, Guo W, Zhang S, Chen L, Zhang YH, Lu L, Pan X, Huang T, Cai YD.
Show Full Abstract

Mammalian cortical interneurons (CINs) could be classified into more than two dozen cell types that possess diverse electrophysiological and molecular characteristics, and participate in various essential biological processes in the human neural system. However, the mechanism to generate diversity in CINs remains controversial. This study aims to predict CIN diversity in mouse embryo by using single-cell transcriptomics and the machine learning methods. Data of 2,669 single-cell transcriptome sequencing results are employed. The 2,669 cells are classified into three categories, caudal ganglionic eminence (CGE) cells, dorsal medial ganglionic eminence (dMGE) cells, and ventral medial ganglionic eminence (vMGE) cells, corresponding to the three regions in the mouse subpallium where the cells are collected. Such transcriptomic profiles were first analyzed by the minimum redundancy and maximum relevance method. A feature list was obtained, which was further fed into the incremental feature selection, incorporating two classification algorithms (random forest and repeated incremental pruning to produce error reduction), to extract key genes and construct powerful classifiers and classification rules. The optimal classifier could achieve an MCC of 0.725, and category-specified prediction accuracies of 0.958, 0.760, and 0.737 for the CGE, dMGE, and vMGE cells, respectively. The related genes and rules may provide helpful information for deepening the understanding of CIN diversity.

Also flagged:DiarrheaIrritable Bowel SyndromeIBSpeptideshypersensitivitypathogenesis
Journal Article 2022-07-15 No Snippets Zhang G, Zhang T, Cao Z, Tao Z, Wan T, Yao M, Su X, Wei W.
Show Full Abstract

<h4>Background</h4>Irritable bowel syndrome (IBS) is a common disorder of gut-brain interaction with challenging treatment. According to evidence-based studies, acupuncture is likely to be a promising therapy and subservient adjunct for IBS. Mechanism study of acupuncture based on related clinical trials of high quality, nevertheless, is still vacant.<h4>Aim</h4>This study aims to assess the results and qualities of current clinical evidence and conclude the relevant pathophysiological mechanisms and therapeutic effects of acupuncture on IBS with diarrhea (IBS-D).<h4>Methods</h4>Literature from four databases, namely, PubMed, Cochrane Library, EMBASE, and Web of Science, was systematically searched to obtain eligible randomized controlled trials (RCTs), which contained mechanism research of acupuncture treatment in IBS-D patients. Two independent reviewers completed data extraction and quality evaluation using the RevMan 5.4.1 software.<h4>Results</h4>Ten trials that covered 19 items related to mechanism research were included in this review. Acupuncture was reported to improve IBS-D symptoms and quality of life, with positive effects in regulating brain-gut peptides, cerebral activities, neuroendocrine functions, psychological state, and inflammatory GI and hypersensitive intestinal tracts.<h4>Conclusion</h4>Acupuncture has potential influence on pathophysiology alterations such as regulating brain-gut peptides, altering cerebral connectivity and activity, promoting neuroendocrine functions and mental state, and mitigating inflammation as well as hypersensitivity of bowels in IBS-D patients, but further studies of high quality are still necessary.<h4>Systematic review registration</h4>[https://www.crd.york.ac.uk/PROSPERO], identifier [CRD42022320331].

Also flagged:angiogenesistumorsGene ExpressionARGcancerHER2
Journal Article 2022-07-15 ✓ 1 Snippet Ma N, Li J, Lv L, Li C, Li K, Wang B.
In-Text Gene Mentions

PTGIS

Show Full Abstract

<h4>Objective</h4>Tumor angiogenesis plays a pivotal role in the development and metastasis of tumors. This study aimed to elucidate the association between angiogenesis-related genes (ARGs) and the prognosis of patients with gastric cancer (GC).<h4>Methods</h4>Transcriptomics and clinical data of GC samples were obtained from The Cancer Genome Atlas (TCGA) as the training group and those from Gene Expression Omnibus (GEO, including GSE26253, GSE26091 and GSE66229) as the validation groups. Single-sample gene set enrichment analysis (ssGSEA) was performed for gene set enrichment analysis on the gene set of angiogenesis and divided patients into high- or low-ARG group. Subsequently, to improve the availability of the ARG signature, a ARGs subtype predictor was then constructed by integrating of four machine learning methods, including support vector machine (SVM), least absolute shrinkage and selection operator (LASSO) regression, Random Forest and Boruta (RFB) and extreme gradient boosting (XGBoost). Kaplan-Meier and receiver operating characteristic curves were used to evaluate the performance of prognosis prediction. The EPIC and xCELL method were used to calculate the profile of tumor-infiltrated immune cells.<h4>Results</h4>The expression levels of a total of 36 ARGs that correlated with the survival of patients with GC were identified and utilized to establish an ARG-related prognosis signature. The area under the curve for predicting overall survival (OS) in the training group at the 1-, 3- and 5-year was 0.61, 0.64 and 0.76, respectively, and this was further validated using three independent GEO datasets. Moreover, the ARG signatures were significantly correlated with cancer-associated fibroblasts (CAFs), and GC patients that exhibited both high ARG expression level and matrix CAFs level had the most inferior outcomes. The multiple machine learning algorithms were applied to establish a 10-gene ARG subtype predictor, and notably, a high ARG-subtype predictor score was associated with reduced efficacy of immunotherapy, and potential anti-HER2 or FGFR4 therapy, but an increased sensitivity to anti-angiogenesis-related therapy.<h4>Conclusion</h4>The novel ARGs-based classification may act as a potential prognostic predictor for GC and be used as a guidance for clinicians in selecting potential responders for immunotherapy and targeted therapy.

Also flagged:cancertumorcancersbreast cancerimmune responsesBRCA
Journal Article 2022-07-15 ✓ 5 Snippets Chen G, Cao J, Zhao H, Cong Y, Qiao G.
In-Text Gene Mentions

Three hub genes (CCR7, IL18, and TNFSF4), highly expressed in BC tissues, were selected from this network.

Univariate Cox and LASSO regression analyses were utilized to review 19 genes (AMIGO2, APCDD1L, CCR7, CFB, CLIC3, EFNB3, F2RL2, FAM189A2, IL18, LY6E, MMP1, NMNAT2, NTRK3, OLFML2B, PSD2, PSME2, SH3BP1, SPIB, and TNFSF4) that could be utilized as an immune-related biomarker for BC.

…SPIB , andTNFSF4) were screened…

…(CCR7, IL18, andTNFSF4) were identified (…

…SPIB , andTNFSF4) that could…

Show Full Abstract

<h4>Introduction</h4>Breast cancer (BC) is the most common cancer in women worldwide and has a high mortality rate. The fact that the tumor microenvironment affects clinical outcomes of all types of cancers underlines the involvement of various immune-related genes (IRGs). Therefore, this study aimed to establish an IRGs-based signature for the prognosis of BC patients.<h4>Material and methods</h4>In this study, 12 immune cell infiltrating degrees in 1,102 BC cases from The Cancer Genome Atlas (TCGA) database were assessed, and RNA-sequencing (RNA-seq) data of these samples were analyzed by single-sample gene set enrichment analysis (ssGSEA). Based on the results, high, low, and middle immune infiltrating clusters were constructed. A total of 138 overlapped differentially expressed genes (DEGs) were identified in the high and low infiltrating clusters, as well as in normal and BC samples. Univariate Cox regression and LASSO analyses were also performed. Furthermore, GSEA suggested some highly enriched pathways in the different immune infiltrating clusters, leading to a better understanding of potential mechanisms of immune infiltration in BC.<h4>Results</h4>Finally, 19 immune-related genes were identified that could be utilized as a potential prognostic biomarker for BC. Kaplan-Meier plot and ROC curve, univariate as well as multivariate Cox analyses were carried out, which suggested that the 19-IRG-based signature is a significant prognosis factor independent of clinical features. Based on the analysis of protein-protein interactions (PPI), the three hub genes were identified.<h4>Conclusions</h4>These results provide a new method to predict the prognosis and survival of BC based on the three genes' features.

Also flagged:cancerDoxorubicintumorstumormatrix metalloproteinase2MMP2
Journal Article 2022-07-15 No Snippets Li S, Li F, Wan D, Chen Z, Pan J, Liang XJ.
Show Full Abstract

Chemotherapy remains the mainstay of cancer treatment, benefiting millions of patients each year, but the side effects of chemotherapy drugs severely limit their clinical use. Doxorubicin (DOX) can cause various side effects such as heart damage and treatment-related tumors. The effective use of active and passive targeting will improve the clinical application of DOX. Here, TPGS<sub>3350</sub> and bioactive peptides were utilized to construct a micelle-based stage-by-stage impelled efficient system (missiles) for DOX delivery (DOX missiles). By taking advantage of the EPR effect, DOX missiles are efficiently enriched at the tumor site. After being cleaved by matrix metalloproteinase2 (MMP2), the peptide (VRGD) targets tumor cells to facilitate uptake of the missiles by the tumor cells via receptor-mediated endocytosis. The intracellular activated caspase-3-catalyzed explosion of DOX missiles further enables efficient tumor killing. This study provides an efficient approach for DOX delivery and toxicity reduction.

Also flagged:autoantibodiesIFN-γopportunistic infectionsbindingIFN-γR1antibody
Journal Article 2022-07-14 ✓ 1 Snippet Shih HP, Ding JY, Sotolongo Bellón J, Lo YF, Chung PH, Ting HT, Peng JJ, Wu TY, Lin CH, Lo CC, Lin YN, Yeh CF, Chen JB, Wu TS, Liu YM, Kuo CY, Wang SY, Tu KH, Ng CY, Lei WT, Tsai YH, Chen JH, Chuang YT, Huang JY, Rey FA, Chen HK, Chang TW, Piehler J, Chi CY, Ku CL.
In-Text Gene Mentions

…TBX21 , andZNFX1.…

Show Full Abstract

Anti-interferon (IFN)-γ autoantibodies (AIGAs) are a pathogenic factor in late-onset immunodeficiency with disseminated mycobacterial and other opportunistic infections. AIGAs block IFN-γ function, but their effects on IFN-γ signaling are unknown. Using a single-cell capture method, we isolated 19 IFN-γ-reactive monoclonal antibodies (mAbs) from patients with AIGAs. All displayed high-affinity (KD < 10-9 M) binding to IFN-γ, but only eight neutralized IFN-γ-STAT1 signaling and HLA-DR expression. Signal blockade and binding affinity were correlated and attributed to somatic hypermutations. Cross-competition assays identified three nonoverlapping binding sites (I-III) for AIGAs on IFN-γ. We found that site I mAb neutralized IFN-γ by blocking its binding to IFN-γR1. Site II and III mAbs bound the receptor-bound IFN-γ on the cell surface, abolishing IFN-γR1-IFN-γR2 heterodimerization and preventing downstream signaling. Site III mAbs mediated antibody-dependent cellular cytotoxicity, probably through antibody-IFN-γ complexes on cells. Pathogenic AIGAs underlie mycobacterial infections by the dual blockade of IFN-γ signaling and by eliminating IFN-γ-responsive cells.

Also flagged:neurodegenerative diseasebindingcalmodulincalciumHuntingtinHD
Journal Article 2022-07-14 ✓ 1 Snippet Kapadia K, Trojniak AE, Guzmán Rodríguez KB, Klus NJ, Huntley C, McDonald P, Roy A, Frankowski KJ, Aubé J, Muma NA.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease is a progressive and lethal neurodegenerative disease caused by an increased CAG repeat mutation in exon 1 of the huntingtin gene (mutant huntingtin). Current drug treatments provide only limited symptomatic relief without impacting disease progression. Previous studies in our lab and others identified the abnormal binding of mutant huntingtin protein with calmodulin, a key regulator of calcium signaling. Disrupting the abnormal binding of mutant huntingtin to calmodulin reduces perturbations caused by mutant huntingtin in cell and mouse models of Huntington's disease and importantly normalizes receptor-stimulated calcium release. Using a series of high-throughput <i>in vitro</i> and cell-based screening assays, we identified numerous small-molecule hits that disrupt the binding of mutant huntingtin to calmodulin and demonstrate protective effects. Iterative optimization of one hit resulted in nontoxic, selective compounds that are protective against mutant huntingtin cytotoxicity and normalized receptor-stimulated intracellular calcium release in PC12 cell models of Huntington's disease. Importantly, the compounds do not work by reducing the levels of mutant huntingtin, allowing this strategy to complement future molecular approaches to reduce mutant huntingtin expression. Our novel scaffold will serve as a prototype for further drug development in Huntington's disease. These studies indicate that the development of small-molecule compounds that disrupt the binding of mutant huntingtin to calmodulin is a promising approach for the advancement of therapeutics to treat Huntington's disease.

Also flagged:alcoholironcognitionalcohol dependencealcohol use disordermyelin
Journal Article 2022-07-14 ✓ 2 Snippets Topiwala A, Wang C, Ebmeier KP, Burgess S, Bell S, Levey DF, Zhou H, McCracken C, Roca-Fernández A, Petersen SE, Raman B, Husain M, Gelernter J, Miller KL, Smith SM, Nichols TE.
In-Text Gene Mentions

…]): rs1800562—in theHFEgene that is…

…]; rs1799945—also inHFE, carried by approximately…

Show Full Abstract

<h4>Background</h4>Brain iron deposition has been linked to several neurodegenerative conditions and reported in alcohol dependence. Whether iron accumulation occurs in moderate drinkers is unknown. Our objectives were to investigate evidence in support of causal relationships between alcohol consumption and brain iron levels and to examine whether higher brain iron represents a potential pathway to alcohol-related cognitive deficits.<h4>Methods and findings</h4>Observational associations between brain iron markers and alcohol consumption (n = 20,729 UK Biobank participants) were compared with associations with genetically predicted alcohol intake and alcohol use disorder from 2-sample mendelian randomization (MR). Alcohol intake was self-reported via a touchscreen questionnaire at baseline (2006 to 2010). Participants with complete data were included. Multiorgan susceptibility-weighted magnetic resonance imaging (9.60 ± 1.10 years after baseline) was used to ascertain iron content of each brain region (quantitative susceptibility mapping (QSM) and T2*) and liver tissues (T2*), a marker of systemic iron. Main outcomes were susceptibility (χ) and T2*, measures used as indices of iron deposition. Brain regions of interest included putamen, caudate, hippocampi, thalami, and substantia nigra. Potential pathways to alcohol-related iron brain accumulation through elevated systemic iron stores (liver) were explored in causal mediation analysis. Cognition was assessed at the scan and in online follow-up (5.82 ± 0.86 years after baseline). Executive function was assessed with the trail-making test, fluid intelligence with puzzle tasks, and reaction time by a task based on the "Snap" card game. Mean age was 54.8 ± 7.4 years and 48.6% were female. Weekly alcohol consumption was 17.7 ± 15.9 units and never drinkers comprised 2.7% of the sample. Alcohol consumption was associated with markers of higher iron (χ) in putamen (β = 0.08 standard deviation (SD) [95% confidence interval (CI) 0.06 to 0.09], p < 0.001), caudate (β = 0.05 [0.04 to 0.07], p < 0.001), and substantia nigra (β = 0.03 [0.02 to 0.05], p < 0.001) and lower iron in the thalami (β = -0.06 [-0.07 to -0.04], p < 0.001). Quintile-based analyses found these associations in those consuming >7 units (56 g) alcohol weekly. MR analyses provided weak evidence these relationships are causal. Genetically predicted alcoholic drinks weekly positively associated with putamen and hippocampus susceptibility; however, these associations did not survive multiple testing corrections. Weak evidence for a causal relationship between genetically predicted alcohol use disorder and higher putamen susceptibility was observed; however, this was not robust to multiple comparisons correction. Genetically predicted alcohol use disorder was associated with serum iron and transferrin saturation. Elevated liver iron was observed at just >11 units (88 g) alcohol weekly c.f. <7 units (56 g). Systemic iron levels partially mediated associations of alcohol intake with brain iron. Markers of higher basal ganglia iron associated with slower executive function, lower fluid intelligence, and slower reaction times. The main limitations of the study include that χ and T2* can reflect changes in myelin as well as iron, alcohol use was self-reported, and MR estimates can be influenced by genetic pleiotropy.<h4>Conclusions</h4>To the best of our knowledge, this study represents the largest investigation of moderate alcohol consumption and iron homeostasis to date. Alcohol consumption above 7 units weekly associated with higher brain iron. Iron accumulation represents a potential mechanism for alcohol-related cognitive decline.

Also flagged:structural maintenance ofchromosomesproteinbinding
Journal Article 2022-07-14 ✓ 1 Snippet Kim E, Gonzalez AM, Pradhan B, van der Torre J, Dekker C.
In-Text Gene Mentions

Condensin, a structural maintenance…

Show Full Abstract

Condensin, a structural maintenance of chromosomes (SMC) complex, has been shown to be a molecular motor protein that organizes chromosomes by extruding loops of DNA. In cells, such loop extrusion is challenged by many potential conflicts, for example, the torsional stresses that are generated by other DNA-processing enzymes. It has so far remained unclear how DNA supercoiling affects loop extrusion. Here, we use time-lapse single-molecule imaging to study condensin-driven DNA loop extrusion on supercoiled DNA. We find that condensin binding and DNA looping are stimulated by positively supercoiled DNA, and condensin preferentially binds near the tips of supercoiled plectonemes. Upon loop extrusion, condensin collects nearby plectonemes into a single supercoiled loop that is highly stable. Atomic force microscopy imaging shows that condensin generates supercoils in the presence of ATP. Our findings provide insight into the topology-regulated loading and formation of supercoiled loops by SMC complexes and clarify the interplay of loop extrusion and supercoiling.

Also flagged:OAS1COVID-19coronavirus disease 2019nonsense-mediated decayOAS3Nucleotide
Journal Article 2022-07-14 No Snippets Banday AR, Stanifer ML, Florez-Vargas O, Onabajo OO, Papenberg BW, Zahoor MA, Mirabello L, Ring TJ, Lee CH, Albert PS, Andreakos E, Arons E, Barsh G, Biesecker LG, Boyle DL, Brahier MS, Burnett-Hartman A, Carrington M, Chang E, Choe PG, Chisholm RL, Colli LM, Dalgard CL, Dude CM, Edberg J, Erdmann N, Feigelson HS, Fonseca BA, Firestein GS, Gehring AJ, Guo C, Ho M, Holland S, Hutchinson AA, Im H, Irby L, Ison MG, Joseph NT, Kim HB, Kreitman RJ, Korf BR, Lipkin SM, Mahgoub SM, Mohammed I, Paschoalini GL, Pacheco JA, Peluso MJ, Rader DJ, Redden DT, Ritchie MD, Rosenblum B, Ross ME, Anna HPS, Savage SA, Sharma S, Siouti E, Smith AK, Triantafyllia V, Vargas JM, Vargas JD, Verma A, Vij V, Wesemann DR, Yeager M, Yu X, Zhang Y, Boulant S, Chanock SJ, Feld JJ, Prokunina-Olsson L.
Show Full Abstract

The chr12q24.13 locus encoding OAS1-OAS3 antiviral proteins has been associated with coronavirus disease 2019 (COVID-19) susceptibility. Here, we report genetic, functional and clinical insights into this locus in relation to COVID-19 severity. In our analysis of patients of European (n = 2,249) and African (n = 835) ancestries with hospitalized versus nonhospitalized COVID-19, the risk of hospitalized disease was associated with a common OAS1 haplotype, which was also associated with reduced severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) clearance in a clinical trial with pegIFN-λ1. Bioinformatic analyses and in vitro studies reveal the functional contribution of two associated OAS1 exonic variants comprising the risk haplotype. Derived human-specific alleles rs10774671-A and rs1131454 -A decrease OAS1 protein abundance through allele-specific regulation of splicing and nonsense-mediated decay (NMD). We conclude that decreased OAS1 expression due to a common haplotype contributes to COVID-19 severity. Our results provide insight into molecular mechanisms through which early treatment with interferons could accelerate SARS-CoV-2 clearance and mitigate against severe COVID-19.

Also flagged:lipid metabolismpeptidesprolineLPPmitochondrial membraneder
Journal Article 2022-07-14 ✓ 1 Snippet Moreno-Ulloa A, Delgado-De la Herrán HC, Álvarez-Delgado C, Mendoza-Porras O, Carballo-Castañeda RA, Donis-Maturano L, Villarreal F.
In-Text Gene Mentions

…], peroxiredoxin-6 [PRDX6, UniProtKB: O77834 ]),…

Show Full Abstract

Coronary artery endothelial cells (CAEC) exert an important role in the development of cardiovascular disease. Dysfunction of CAEC is associated with cardiovascular disease in subjects with type 2 diabetes mellitus (T2DM). However, comprehensive studies of the effects that a diabetic environment exerts on this cellular type are scarce. The present study characterized the molecular perturbations occurring on cultured bovine CAEC subjected to a prolonged diabetic environment (high glucose and high insulin). Changes at the metabolite and peptide level were assessed by Liquid Chromatography-Mass Spectrometry (LC-MS<sup>2</sup>) and chemoinformatics. The results were integrated with published LC-MS<sup>2</sup>-based quantitative proteomics on the same in vitro model. Our findings were consistent with reports on other endothelial cell types and identified novel signatures of DNA/RNA, amino acid, peptide, and lipid metabolism in cells under a diabetic environment. Manual data inspection revealed disturbances on tryptophan catabolism and biosynthesis of phenylalanine-based, glutathione-based, and proline-based peptide metabolites. Fluorescence microscopy detected an increase in binucleation in cells under treatment that also occurred when human CAEC were used. This multi-omics study identified particular molecular perturbations in an induced diabetic environment that could help unravel the mechanisms underlying the development of cardiovascular disease in subjects with T2DM.

Also flagged:SLPSSTBoB
Journal Article 2022-07-14 No Snippets Murali Krishna UV, Das SK, Uma KN, Jha AK, Pandithurai G.
Show Full Abstract

Tropospheric Biennial Oscillation (TBO) is characterized by a tendency for a relatively stronger monsoon to be followed by a relatively weaker one (positive) or vice-versa (negative). This study examines the distribution of different convective systems occurring during TBO phases over the Indian monsoon region. During negative TBO phase, convection is preferential over the Arabian Sea (AS), whereas during positive TBO phase, it is favoured over the land areas and Bay of Bengal (BoB). The isolated shallow convection (ISC) is dominated over the AS and Indian west coast during negative TBO years. A relatively stable environment (statically) capped with drier mid-troposphere results in abundant ISC over the AS. Broad stratiform rain (BSR) dominates over the central and east coast of India, BoB and Myanmar coast during positive TBO years and wide convective core (WCC) are present along the orographic regions, i.e., Myanmar coast and Western Ghats during negative TBO phase. The anomalous easterlies induced by the upper-ocean temperature gradient interact with the mean monsoon winds during positive TBO to provide pathways for developing BSR echoes. The deep-wide convection (DWC) are higher along the Himalayan foothills during positive TBO years. The moist low-level flow from the AS is trapped by dry mid-level flow from high latitudes, resulting in orographic lifting along the Himalayan foothills and form DWC.

Also flagged:Prostate cancerPCamalignant tumorcancerlocalized prostate cancerandrogen
Journal Article 2022-07-14 ✓ 5 Snippets Luo C, Liu Z, Gan Y, Gao X, Zu X, Zhang Y, Ye W, Cai Y.
In-Text Gene Mentions

Recent studies have shown that stimulation of OX40, the ligand of TNFSF4, is helpful for therapeutic immunization strategies for cancer [38].

…levels (CX3CL1 andTNFSF4) in distinct HRD…

…cluster 1 andTNFSF4(BH-adjusted p =…

…Paradoxically,TNFSF4was significantly up-regulated…

…the ligand ofTNFSF4, is helpful for…

Show Full Abstract

<h4>Background</h4>Homologous recombination deficiency (HRD) is closely associated with patient prognosis and treatment options in prostate cancer (PCa). However, there is a lack of quantitative indicators related to HRD to predict the prognosis of PCa accurately.<h4>Methods</h4>We screened HRD-related genes based on the HRD scores and constructed an HRD cluster system to explore different clinicopathological, genomic, and immunogenomic patterns among the clusters. A risk signature, HRDscore, was established and evaluated by multivariate Cox regression analysis. We noticed that SLC26A4, a model gene, demonstrated unique potential to predict prognosis and HRD in PCa. Multi-omics analysis was conducted to explore its role in PCa, and the results were validated by qRT-PCR and immunohistochemistry.<h4>Results</h4>Three HRD clusters were identified with significant differences in patient prognosis, clinicopathological characteristics, biological pathways, immune infiltration characteristics, and regulation of immunomodulators. Further analyses revealed that the constructed HRDscore system was an independent prognostic factor of PCa patients with good stability. Finally, we identified a single gene, SLC26A4, which significantly correlated with prognosis in three independent cohorts. Importantly, SLC26A4 was confirmed to distinguish PCa (AUC for mRNA 0.845; AUC for immunohistochemistry score 0.769) and HRD (AUC for mRNA 0.911; AUC for immunohistochemistry score 0.689) at both RNA and protein levels in our cohort.<h4>Conclusion</h4>This study introduces HRDscore to quantify the HRD pattern of individual PCa patients. Meanwhile, SLC26A4 is a novel biomarker and can reasonably predict the prognosis and HRD in PCa.

Also flagged:Hyponatremiagene expressionbone lossosteoporosisagingsyndrome of
Journal Article 2022-07-14 No Snippets Barsony J, Xu Q, Verbalis JG.
Show Full Abstract

Growing evidence indicates that chronic hyponatremia represents a significant risk for bone loss, osteoporosis, and fractures in our aging population. Our prior studies on a rat model of the syndrome of inappropriate antidiuretic hormone secretion indicated that chronic hyponatremia causes osteoporosis by increasing osteoclastic bone resorption, thereby liberating stored sodium from bone. Moreover, studies in RAW264.7 pre-osteoclastic cells showed increased osteoclast formation and resorptive activity in response to low extracellular fluid sodium ion concentration (low [Na<sup>+</sup>]). These studies implicated a direct stimulatory effect of low [Na<sup>+</sup>] rather than the low osmolality on cultured osteoclastic cells. In the present cellular studies, we explored gene expression changes triggered by low [Na<sup>+</sup>] using RNA sequencing and gene ontology analysis. Results were confirmed by mouse whole genome microarray, and quantitative RT-PCR. Findings confirmed gene expression changes supporting osteoclast growth and differentiation through stimulation of receptor activator of nuclear factor kappa-B ligand (RANKL), and PI3K/Akt pathways, and revealed additional pathways. New findings on low [Na<sup>+</sup>]-induced upregulation of lysosomal genes, mitochondrial energy production, MMP-9 expression, and osteoclast motility have supported the significance of osteoclast transcriptomic responses. Functional assays demonstrated that RANL and low [Na<sup>+</sup>] independently enhance osteoclast functions. Understanding the molecular mechanisms of hyponatremia-induced osteoporosis provides the basis for future studies identifying sodium-sensing mechanisms in osteoclasts, and potentially other bone cells, and developing strategies for treatment of bone fragility in the vulnerable aging population most affected by both chronic hyponatremia and osteoporosis. ISSUE SECTIONS: Signaling Pathways; Parathyroid, Bone, and Mineral Metabolism.

Also flagged:hematological diseasessickle cell diseasethalassemiaasacquired immunodeficiency sydromeAIDS
Journal Article 2022-07-14 ✓ 4 Snippets Zhou W, Yang J, Zhang Y, Hu X, Wang W.
In-Text Gene Mentions

HD is a rare ND with an autosomal dominant inheritance caused by an abnormality in the HTT gene.193

Currently, many in vitro and in vivo studies have demonstrated that the huntingtin (HTT) gene is closely related to the occurrence of HD.102, 103, 104

…abnormality in theHTTgene.…

…the huntingtin (HTT) gene is…

Show Full Abstract

The expanding genome editing toolbox has revolutionized life science research ranging from the bench to the bedside. These "molecular scissors" have offered us unprecedented abilities to manipulate nucleic acid sequences precisely in living cells from diverse species. Continued advances in genome editing exponentially broaden our knowledge of human genetics, epigenetics, molecular biology, and pathology. Currently, gene editing-mediated therapies have led to impressive responses in patients with hematological diseases, including sickle cell disease and thalassemia. With the discovery of more efficient, precise and sophisticated gene-editing tools, more therapeutic gene-editing approaches will enter the clinic to treat various diseases, such as acquired immunodeficiency sydrome (AIDS), hematologic malignancies, and even severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection. These initial successes have spurred the further innovation and development of gene-editing technology. In this review, we will introduce the architecture and mechanism of the current gene-editing tools, including clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated nuclease-based tools and other protein-based DNA targeting systems, and we summarize the meaningful applications of diverse technologies in preclinical studies, focusing on the establishment of disease models and diagnostic techniques. Finally, we provide a comprehensive overview of clinical information using gene-editing therapeutics for treating various human diseases and emphasize the opportunities and challenges.

Also flagged:reproductionbehavioralwateralcoholmineralsmineral
Journal Article 2022-07-14 No Snippets Zhang W, Zhang N, Zheng S, Zhang W, Liu J, He L, Ezemaduka AN, Li G, Ning J, Xian B, Gao S.
Show Full Abstract

To study the effects of different types of commercially available drinks/beverages on neurobehavior using the model organism <i>C. elegans</i>, and critically review their potential health hazards. Eighteen kinds of beverages from the supermarket were randomly selected and grouped into seven categories namely functional beverage, tea beverage, plant protein beverage, fruit juice beverage, dairy beverage, carbonated beverage and coffee beverage. The pH value, specific gravity and osmotic pressure were also examined. The L4 stage N2 worms were exposed to different concentration of tested beverages (0, 62.5, 125, 250 and 500 µL/mL) for 24 h to measure the survival rate and locomotory behavior such as head thrashing, body bending as well as pharyngeal pumping. All the 18 beverages tested did not induce any visible lethal effects in the nematodes. However, exposure to different types of tested beverages exhibited different effects on the behavioral ability of <i>C. elegans</i>: (1) sports functional beverage and herbal tea drink accelerated the head thrashing and body bending of nematodes when compared to the control group (<i>P</i> < 0.05). (2) The vibration frequency of the pharyngeal pump of nematodes was significantly accelerated after treated with three plant protein beverages (almond milk, coconut milk and milk tea) and dairy products A and B (<i>P</i> < 0.05), and decelerated after treatment with other tested beverages. (3) Carbonated beverage significantly inhibits the head thrashing, body bending and pharyngeal pumping vibration (<i>P</i> < 0.05). Our results indicate that 18 kinds of popular beverages in the market have different influence on the neurobehavior in <i>C. elegans</i>, which may be related to their different components or properties. Further research would be required to conduct a systematic analysis of the effect of beverages by appropriate kinds, taking into consideration other endpoints such as reproduction, lifespan and molecular stress response, <i>etc.</i>, and to elucidate the mechanism for its potential health hazards.

Also flagged:Schiff BasesP21S21S11fitS30
Journal Article 2022-07-14 No Snippets Eranna SC, Panchangam RK, Kengaiah J, Adimule SP, Foro S, Sannagangaiah D.
Show Full Abstract

New Schiff bases functionalized with amide and phenolic groups synthesized by the condensation of 2-hydroxybenzaldehyde and 2-hydroxyacetophenone with amino acid amides which in turn were prepared in two steps from <i>N</i>-Boc-amino acids and homoveraltrylamine through intermediate compounds <i>N</i>-Boc-amino acids amides. The compounds were characterized by elemental analysis, FT-IR, UV-Vis, and NMR spectroscopy. The crystal structures of three Schiff bases were determined by single crystal X-ray diffraction. There exists O-H ⋯ N, N-H ⋯ O, and C-H ⋯ O types of hydrogen bonds and C-H ⋯ π secondary bonding interactions in these crystalline solids. The Schiff bases have been screened for anticoagulant and antiplatelet aggregation activities. All the compounds showed procoagulant activity which shortens the clotting time of citrated human plasma in both platelet-rich plasma and platelet-poor plasma except the derivatives of L-methionine which showed anticoagulant activity by prolonging the clotting time. In addition, the compounds derived from benzyl cysteine and phenylalanine showed adenosine diphosphate induced antiplatelet aggregation activity, whereas others did not show any role. Moreover, all these compounds revealed non-hemolytic activity with red blood cells.<h4>Graphical abstract</h4><h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s00706-022-02936-6.

Also flagged:PDGFBplatelet-derived growth factor BPDGFRBplatelet-derived growth factor receptor betatranscription factorSRF
Journal Article 2022-07-14 No Snippets Orlich MM, Diéguez-Hurtado R, Muehlfriedel R, Sothilingam V, Wolburg H, Oender CE, Woelffing P, Betsholtz C, Gaengel K, Seeliger M, Adams RH, Nordheim A.
Show Full Abstract

<h4>Background</h4>Pericytes and vascular smooth muscle cells, collectively known as mural cells, are recruited through PDGFB (platelet-derived growth factor B)-PDGFRB (platelet-derived growth factor receptor beta) signaling. MCs are essential for vascular integrity, and their loss has been associated with numerous diseases. Most of this knowledge is based on studies in which MCs are insufficiently recruited or fully absent upon inducible ablation. In contrast, little is known about the physiological consequences that result from impairment of specific MC functions. Here, we characterize the role of the transcription factor SRF (serum response factor) in MCs and study its function in developmental and pathological contexts.<h4>Methods</h4>We generated a mouse model of MC-specific inducible <i>Srf</i> gene deletion and studied its consequences during retinal angiogenesis using RNA-sequencing, immunohistology, in vivo live imaging, and in vitro techniques.<h4>Results</h4>By postnatal day 6, pericytes lacking SRF were morphologically abnormal and failed to properly comigrate with angiogenic sprouts. As a consequence, pericyte-deficient vessels at the retinal sprouting front became dilated and leaky. By postnatal day 12, also the vascular smooth muscle cells had lost SRF, which coincided with the formation of pathological arteriovenous shunts. Mechanistically, we show that PDGFB-dependent SRF activation is mediated via MRTF (myocardin-related transcription factor) cofactors. We further show that MRTF-SRF signaling promotes pathological pericyte activation during ischemic retinopathy. RNA-sequencing, immunohistology, in vivo live imaging, and in vitro experiments demonstrated that SRF regulates expression of contractile SMC proteins essential to maintain the vascular tone.<h4>Conclusions</h4>SRF is crucial for distinct functions in pericytes and vascular smooth muscle cells. SRF directs pericyte migration downstream of PDGFRB signaling and mediates pathological pericyte activation during ischemic retinopathy. In vascular smooth muscle cells, SRF is essential for expression of the contractile machinery, and its deletion triggers formation of arteriovenous shunts. These essential roles in physiological and pathological contexts provide a rationale for novel therapeutic approaches through targeting SRF activity in MCs.

Also flagged:cancertumorcancersbraincytoplasmicRNA1
Journal Article 2022-07-14 ✓ 2 Snippets Han X, Wang Y, Zhao R, Zhang G, Qin C, Fu L, Jin H, Jiang X, Yang K, Cai H.
In-Text Gene Mentions

Ding et al. identified the BCYRN1/miR-490-3p/POU3F2 ceRNA regulatory network mediating reduced survival and increased tumor cell proliferation and metastasis in HCC patients [18].

…tified the BCYRN1 /miR-490-3p/POU3F2ceRNA regulatory network…

Show Full Abstract

<h4>Background</h4>Although combination therapies have substantially improved the clinical outcomes of cancer patients, the prognosis and early diagnosis remain unsatisfactory. As a result, it is critical to look for novel indicators linked to cancer. Despite a number of recent studies indicating that the lncRNA brain cytoplasmic RNA1(<i>BCYRN1</i>) may be a potential predictive biomarker in cancer patients, <i>BCYRN1</i>'s prognostic value is still being debated.<h4>Methods</h4>We utilized PubMed, Embase, Web of Science, and the Cochrane Library to search for studies related to <i>BCYRN1</i> until October 2021. Valid data were extracted after determining the articles according to the inclusion and exclusion criteria, and forest plots were made using Stata software. We used hazard ratios (HRs) or odds ratios (ORs) with 95% confidence intervals to evaluate the relationship between abnormal <i>BCYRN1</i> expression and patient prognosis and clinicopathological characteristics.<h4>Results</h4>Meta-analysis revealed that increased <i>BCYRN1</i> expression was associated with both overall tumor survival (OS; HR = 1.84, 95% CI 1.51-2.25, <i>p</i> < 0.0001) and disease-free survival (DFS; HR = 1.65, 95% CI 1.20-2.26, <i>p</i>=0.002). Furthermore, a strong association was discovered between increased <i>BCYRN1</i> expression and tumor invasion depth (OR = 2.11, 95% CI 1.49-2.99, <i>p</i>=0.000), clinical stage (OR = 2.52, 95% CI 1.18-5.37, <i>p</i>=0.017), and distant tumor metastasis (OR = 4.19, 95% CI 1.45-12.05, <i>p</i>=0.008).<h4>Conclusions</h4>We found that high <i>BCYRN1</i> expression was associated with poor survival prognosis and aggressive clinicopathological characteristics in various cancers, indicating that it is a potential prognostic indicator as well as a therapeutic target. Further research is needed on pan-cancer cohorts to determine the clinical relevance of <i>BCYRN1</i> in distinct cancer types.

Also flagged:deathmitochondriaredoxdegenerative retinal diseasesmitochondrialNuclear respiratory factor 1
Journal Article 2022-07-14 ✓ 1 Snippet Kiyama T, Chen CK, Zhang A, Mao CA.
In-Text Gene Mentions

…activity for non-canonicalpolycomb repressiverepressive complex ncPRC1.3…

Show Full Abstract

The retina, the accessible part of the central nervous system, has served as a model system to study the relationship between energy utilization and metabolite supply. When the metabolite supply cannot match the energy demand, retinal neurons are at risk of death. As the powerhouse of eukaryotic cells, mitochondria play a pivotal role in generating ATP, produce precursors for macromolecules, maintain the redox homeostasis, and function as waste management centers for various types of metabolic intermediates. Mitochondrial dysfunction has been implicated in the pathologies of a number of degenerative retinal diseases. It is well known that photoreceptors are particularly vulnerable to mutations affecting mitochondrial function due to their high energy demand and susceptibility to oxidative stress. However, it is unclear how defective mitochondria affect other retinal neurons. Nuclear respiratory factor 1 (Nrf1) is the major transcriptional regulator of mitochondrial biogenesis, and loss of <i>Nrf1</i> leads to defective mitochondria biogenesis and eventually cell death. Here, we investigated how different retinal neurons respond to the loss of <i>Nrf1</i>. We provide in vivo evidence that the disruption of <i>Nrf1</i>-mediated mitochondrial biogenesis results in a slow, progressive degeneration of all retinal cell types examined, although they present different sensitivity to the deletion of <i>Nrf1</i>, which implicates differential energy demand and utilization, as well as tolerance to mitochondria defects in different neuronal cells. Furthermore, transcriptome analysis on rod-specific <i>Nrf1</i> deletion uncovered a previously unknown role of Nrf1 in maintaining genome stability.

Also flagged:Interstitial Cystitisinterstitial cystitis/bladder pain syndromeIC-isoprostaneMCP-1RANTES
Journal Article 2022-07-14 ✓ 2 Snippets Jiang YH, Jhang JF, Ho HC, Chiou DY, Kuo HC.
In-Text Gene Mentions

…type 2 fromESSIC type 1 ICtype 1 IC/BPS…

…less substantial inESSIC type 1 ICtype 1 IC/BPS…

Show Full Abstract

Both hypoxia and chronic suburothelial inflammation are important pathophysiological findings in patients with interstitial cystitis/bladder pain syndrome (IC/BPS). This study investigated the roles of urine oxidative stress biomarkers and inflammatory cytokines in patients with IC/BPS. Urine samples were collected from 159 IC/BPS patients and 28 controls. The targeted analytes included oxidative stress biomarkers (8-OHdG, 8-isoprostane, and total antioxidant capacity) and inflammatory cytokines (MCP-1, RANTES, CXCL10, Eotaxin, MIP-1β, and IL-8). IC/BPS patients were classified into four clinical subgroups, based on the glomerulation grade and the maximal bladder capacity under anesthesia. Patients with IC/BPS had urine oxidative stress biomarkers and inflammatory cytokines profiles that were distinct from those of the controls and among each subgroup. Both 8-OHdG and 8-isoprostane showed a high diagnostic ability to distinguish type 2 IC/BPS patients (as classified by the European Society for the Study of Interstitial Cystitis) from controls. Additionally, they both showed positive and negative correlations with the glomerulation grade and the maximal bladder capacity under anesthesia, respectively. Limitations included intra-individual variation and sex influence. Urine oxidative stress biomarkers might have a role in diagnosing IC/BPS and differentiating its clinical subtypes. In addition to inflammatory cytokines, urine oxidative stress biomarkers have the potential to be novel biomarkers in patients with IC/BPS.

Also flagged:gene expressionGastriccancermitochondrialgene-expressionGastric_cancer
Journal Article 2022-07-14 ✓ 4 Snippets Wang Y, Xu Y, Zang Z, Wu L, Li Z.
In-Text Gene Mentions

…stem cell markerOLFM4is mainly expressed…

…The expression ofOLFM4increases from CAG…

OLFM4-expressing GMCs were rarely…

…The proportion ofOLFM4-expressing cells reached the…

Show Full Abstract

Nonlinear dimensionality reduction (NLDR) methods such as t-Distributed Stochastic Neighbour Embedding (t-SNE) and Uniform Manifold Approximation and Projection (UMAP) have been widely used for biological data exploration, especially in single-cell analysis. However, the existing methods have drawbacks in preserving data's geometric and topological structures. A high-dimensional data analysis method, called Panoramic manifold projection (Panoramap), was developed as an enhanced deep learning framework for structure-preserving NLDR. Panoramap enhances deep neural networks by using cross-layer geometry-preserving constraints. The constraints constitute the loss for deep manifold learning and serve as geometric regularizers for NLDR network training. Therefore, Panoramap has better performance in preserving global structures of the original data. Here, we apply Panoramap to single-cell datasets and show that Panoramap excels at delineating the cell type lineage/hierarchy and can reveal rare cell types. Panoramap can facilitate trajectory inference and has the potential to aid in the early diagnosis of tumors. Panoramap gives improved and more biologically plausible visualization and interpretation of single-cell data. Panoramap can be readily used in single-cell research domains and other research fields that involve high dimensional data analysis.

Also flagged:ischemic strokebehavioralneurogenesisangiogenesisinflammatory responsestroke
Journal Article 2022-07-14 No Snippets Hur HJ, Lee JY, Kim DH, Cho MS, Lee S, Kim HS, Kim DW.
Show Full Abstract

Previous studies have shown that early therapeutic events of neural precursor cells (NPCs) transplantation to animals with acute ischemic stroke readily protected neuronal cell damage and improved behavioral recovery through paracrine mechanisms. In this study, we tested the hypothesis that administration of conditioned medium from NPCs (NPC-CMs) could recapitulate the beneficial effects of cell transplantation. Rats with permanent middle cerebral artery occlusion (pMCAO) were randomly assigned to one of the following groups: PBS control, Vehicle (medium) controls, single (NPC-CM(S)) or multiple injections of NPC-CM(NPC-CM(M)) groups. A single intravenous injection of NPC-CM exhibited strong neuroregenerative potential to induce behavioral recovery, and multiple injections enhanced this activity further by suppressing inflammatory damage and inducing endogenous neurogenesis leading to histopathological and functional recovery. Proteome analysis of NPC-CM identified a number of proteins that are known to be associated with nervous system development, neurogenesis, and angiogenesis. In addition, transcriptome analysis revealed the importance of the inflammatory response during stroke recovery and some of the key hub genes in the interaction network were validated. Thus, our findings demonstrated that NPC-CM promoted functional recovery and reduced cerebral infarct and inflammation with enhanced endogenous neurogenesis, and the results highlighted the potency of NPC-CM in stroke therapy.

Also flagged:Neuroendocrine Prostate Cancerandrogen receptorARprostate cancerandrogenmetastatic prostate cancer
Journal Article 2022-07-14 No Snippets Storck WK, May AM, Westbrook TC, Duan Z, Morrissey C, Yates JA, Alumkal JJ.
Show Full Abstract

The androgen receptor (AR) signaling pathway is critical for growth and differentiation of prostate cancer cells. For that reason, androgen deprivation therapy with medical or surgical castration is the principal treatment for metastatic prostate cancer. More recently, new potent AR signaling inhibitors (ARSIs) have been developed. These drugs improve survival for men with metastatic castration-resistant prostate cancer (CRPC), the lethal form of the disease. However, ARSI resistance is nearly universal. One recently appreciated resistance mechanism is lineage plasticity or switch from an AR-driven, luminal differentiation program to an alternate differentiation program. Importantly, lineage plasticity appears to be increasing in incidence in the era of new ARSIs, strongly implicating AR suppression in this process. Lineage plasticity and shift from AR-driven tumors occur on a continuum, ranging from AR-expressing tumors with low AR activity to AR-null tumors that have activation of alternate differentiation programs versus the canonical luminal program found in AR-driven tumors. In many cases, AR loss coincides with the activation of a neuronal program, most commonly exemplified as therapy-induced neuroendocrine prostate cancer (t-NEPC). While genetic events clearly contribute to prostate cancer lineage plasticity, it is also clear that epigenetic events-including chromatin modifications and DNA methylation-play a major role. Many epigenetic factors are now targetable with drugs, establishing the importance of clarifying critical epigenetic factors that promote lineage plasticity. Furthermore, epigenetic marks are readily measurable, demonstrating the importance of clarifying which measurements will help to identify tumors that have undergone or are at risk of undergoing lineage plasticity. In this review, we discuss the role of AR pathway loss and activation of a neuronal differentiation program as key contributors to t-NEPC lineage plasticity. We also discuss new epigenetic therapeutic strategies to reverse lineage plasticity, including those that have recently entered clinical trials.

Also flagged:ERSIL-8vWFAsymmetric dimethylarginineIL-6ET-1
Journal Article 2022-07-14 No Snippets Santos-Gomes J, Gandra I, Adão R, Perros F, Brás-Silva C.
Show Full Abstract

Pulmonary arterial hypertension (PAH), also known as Group 1 Pulmonary Hypertension (PH), is a PH subset characterized by pulmonary vascular remodeling and pulmonary arterial obstruction. PAH has an estimated incidence of 15-50 people per million in the United States and Europe, and is associated with high mortality and morbidity, with patients' survival time after diagnosis being only 2.8 years. According to current guidelines, right heart catheterization is the gold standard for diagnostic and prognostic evaluation of PAH patients. However, this technique is highly invasive, so it is not used in routine clinical practice or patient follow-up. Thereby, it is essential to find new non-invasive strategies for evaluating disease progression. Biomarkers can be an effective solution for determining PAH patient prognosis and response to therapy, and aiding in diagnostic efforts, so long as their detection is non-invasive, easy, and objective. This review aims to clarify and describe some of the potential new candidates as circulating biomarkers of PAH.

Also flagged:Cancerdeathprogrammed cell death protein 1PD-1antibodytranslational
Journal Article 2022-07-14 ✓ 5 Snippets Moore EK, Strazza M, Mor A.
In-Text Gene Mentions

In contrast, another study found that low VRK2 levels are associated with the abnormal MEK/ERK signaling seen in breast cancer; thus, VRK2 has a complex signaling role in cancer (70).

SHP2, ITK, VRK2, PTPN2, GSK-3, CDK4/6, and PAG all have evidence supporting their relationship to the PD-1 pathway in T cells and pro-tumorigenic role in cancer cells.

Similarly, pediatric and adult gliomas and neuroblastomas require either VRK1 or VRK2, which have overlapping but essential pro-survival function in these cancers (66).

Additionally, in an MC38 murine tumor model, a VRK2 inhibitor AZD-7762 decreased tumor growth in a VRK2-dependent and T cell-dependent manner.

VRK2 is most highly expressed in cells undergoing division, and is therefore present in notable amounts in some cancer cells (63).

Show Full Abstract

Cancer remains the second leading cause of death in the US, accounting for 25% of all deaths nationwide. Immunotherapy techniques bolster the immune cells' ability to target malignant cancer cells and have brought immense improvements in the field of cancer treatments. One important inhibitory protein in T cells, programmed cell death protein 1 (PD-1), has become an invaluable target for cancer immunotherapy. While anti-PD-1 antibody therapy is extremely successful in some patients, in others it fails or even causes further complications, including cancer hyper-progression and immune-related adverse events. Along with countless translational studies of the PD-1 signaling pathway, there are currently close to 5,000 clinical trials for antibodies against PD-1 and its ligand, PD-L1, around 80% of which investigate combinations with other therapies. Nevertheless, more work is needed to better understand the PD-1 signaling pathway and to facilitate new and improved evidence-based combination strategies. In this work, we consolidate recent discoveries of PD-1 signaling mediators and their therapeutic potential in combination with anti-PD-1/PD-L1 agents. We focus on the phosphatases SHP2 and PTPN2; the kinases ITK, VRK2, GSK-3, and CDK4/6; and the signaling adaptor protein PAG. We discuss their biology both in cancer cells and T cells, with a focus on their role in relation to PD-1 to determine their potential in therapeutic combinations. The literature discussed here was obtained from a search of the published literature and ClinicalTrials.gov with the following key terms: checkpoint inhibition, cancer immunotherapy, PD-1, PD-L1, SHP2, PTPN2, ITK, VRK2, CDK4/6, GSK-3, and PAG. Together, we find that all of these proteins are logical and promising targets for combination therapy, and that with a deeper mechanistic understanding they have potential to improve the response rate and decrease adverse events when thoughtfully used in combination with checkpoint inhibitors.

Also flagged:cancertopcGASSTINGlung adenocarcinomaPD-1
Journal Article 2022-07-14 ✓ 1 Snippet Zhao C, Xiong K, Adam A, Ji Z, Li X.
In-Text Gene Mentions

…PRDM9, ANK2, andLRRC7was observed in…

Show Full Abstract

This study aims to investigate the immune and epigenetic mutational landscape of necroptosis in lung adenocarcinoma (LUAD), identify novel molecular phenotypes, and develop a prognostic scoring system based on necroptosis regulatory molecules for a better understanding of the tumor immune microenvironment (TIME) in LUAD. Based on the Cancer Genome Atlas and Gene Expression Omnibus database, a total of 29 overlapped necroptosis-related genes were enrolled to classify patients into different necroptosis phenotypes using unsupervised consensus clustering. We systematically correlated the phenotypes with clinical features, immunocyte infiltrating levels, and epigenetic mutation characteristics. A novel scoring system was then constructed, termed NecroScore, to quantify necroptosis of LUAD by principal component analysis. Three distinct necroptosis phenotypes were confirmed. Two clusters with high expression of necroptosis-related regulators were "hot tumors", while another phenotype with low expression was a "cold tumor". Molecular characteristics, including mutational frequency and types, copy number variation, and regulon activity differed significantly among the subtypes. The NecroScore, as an independent prognostic factor (HR=1.086, 95%CI=1.040-1.133, p<0.001), was able to predict the survival outcomes and show that patients with higher scores experienced a poorer prognosis. It could also evaluate the responses to immunotherapy and chemotherapeutic efficiency. In conclusion, necroptosis-related molecules are correlated with genome diversity in pan-cancer, playing a significant role in forming the TIME of LUAD. Necroptosis phenotypes can distinguish different TIME and molecular features, and the NecroScore is a promising biomarker for predicting prognosis, as well as immuno- and chemotherapeutic benefits in LUAD.

Also flagged:flumemoryCD4Seahorseprotonoxygen
Journal Article 2022-07-14 ✓ 5 Snippets Xue S, Zheng T, Yan J, Ma J, Lin C, Dong S, Wei C, Li T, Zhang X, Li G.
In-Text Gene Mentions

PLCL1, as a survival-related gene of GC, is also significantly correlated with clinical characteristics, tumor microenvironment immune cells, tumor mutation burden (TMB), and tumor necrosis factor (TNF) (33).

Validation of multiple data sets shows that ABCA6, PLCL1, and PLOD2 can jointly predict disease-free survival and overall survival and may serve as potential targets for treating GC, providing a basis for developing targeted drugs.

These DEGs were further screened and analyzed with the GC cohort of TCGA to establish a 3-gene prognostic model (PLCL1, PLOD2 and ABCA6).

…prognostic model (PLCL1, PLOD2 and…

…three genes (PLCL1, PLOD2 ,…

Show Full Abstract

<h4>Objective</h4>Although the incidence of gastric cancer (GC) is decreasing, GC remains one of the leading cancers in the world. Surgical resection, radiotherapy, chemotherapy, and neoadjuvant therapy have advanced, but patients still face the risk of recurrence and poor prognosis. This study provides new insights for assessment of prognosis and postoperative recurrence of GC patients.<h4>Methods</h4>We collected paired cancer and adjacent tissues of 17 patients with early primary GC for bulk transcriptome sequencing. By comparing the transcriptome information of cancer and adjacent cancer, 321 differentially expressed genes (DEGs) were identified. These DEGs were further screened and analyzed with the GC cohort of TCGA to establish a 3-gene prognostic model (<i>PLCL1</i>, <i>PLOD2</i> and <i>ABCA6</i>). At the same time, the predictive ability of this risk model is validated in multiple public data sets. Besides, the differences in immune cells proportion between the high- and low-risk groups were analyzed by the CIBERSORT algorithm with the Leukocyte signature matrix (LM22) gene signature to reveal the role of the immune microenvironment in the occurrence and development of GC.<h4>Results</h4>The model could divide GC samples from TCGA cohorts into two groups with significant differences in overall and disease-free survival. The excellent predictive ability of this model was also validated in multiple other public data sets. The proportion of these immune cells such as resting mast cells, T cells CD4+ memory activated and Macrophages M2 are significantly different between high and low risk group.<h4>Conclusion</h4>These three genes used to build the models were validated as biomarkers for predicting tumor recurrence and survival. They may have potential significance for the treatment and diagnosis of patients in the future, and may also promote the development of targeted drugs.

Also flagged:Pneumococcal Meningitisinvasive pneumococcal diseasebacterial meningitisinvasive bacterial infectionsPneumococcal diseasemeningitis
Journal Article 2022-07-14 No Snippets Rybak A, Varon E, Masson E, Etchevers A, Levy-Brühl D, Ouldali N, Levy C, Cohen R.
Show Full Abstract

Only a few clusters of invasive pneumococcal disease have been described globally in children, and most of these cases occurred before pneumococcal vaccination implementation. Two unusual cases of pneumococcal meningitis, occurring in the same daycare center over a 3-day period, were reported. Both cerebrospinal fluid (CSF) were sent to the National reference center for pneumococci. In addition, we decided to perform a pneumococcal carriage study on all children and staff of the daycare center to analyze the pneumococcal serotypes circulating in this DCC and to discuss an antibiotic chemoprophylaxis. CSF culture was positive for pneumococcus, and serotype 25A was identified by latex agglutination. The second case had negative CSF culture, but CSF antigen test and gene amplification results were positive for <i>Streptococcus pneumoniae</i>. Serotype 12F was identified by using molecular biology. The absence of correlation between these strains was confirmed by multi-locus sequence typing. In the carriage study, we included 29 children (median age 1.9 years, interquartile range 1.4-2.5) and 10 adults. Among the children, 24 carried <i>Streptococcus pneumoniae</i> (83%). The main serotypes isolated were 23A for 6 children and 25A for 5 children; serotypes were non-typeable for 3 children. Only 1 of 10 adults tested carried <i>Streptococcus pneumoniae</i> (serotype 12F). Despite this temporo-spatial pattern, the cases were unrelated and not due to carriage of a particular serotype. No specific action has been taken for the other children attending this DCC, and no other case of bacterial meningitis occurred.

Also flagged:COVID-19-19infectioninfectionsBMP
Journal Article 2022-07-14 No Snippets Kakhkharov J, Bianchi R.
Show Full Abstract

The Australian government and Reserve Bank of Australia responded to challenges posed by the COVID-19 pandemic with a number of rapid interventions within a short period of time in early to mid-2020. We examine the impact of news relating to COVID-19, monetary policy interventions, containment measures, and the unwinding of restrictions on Australian bank and FinTech stock prices. The global pandemic was caused by factors outside the banking sector and capital markets, therefore, the policy responses from this unique crisis provides us with new knowledge. Bank and FinTech stock prices were more sensitive to the government's macroeconomic announcements and the unwinding of containment measures than to monetary policy interventions in this unique environment. The response of banks and FinTechs to COVID-19 related macroeconomic decisions is consistent with the response of bank stock prices in previous financial crises. This finding suggests a stronger emphasis on macroeconomic announcements is required as a stabilizing policy tool when managing future crises from outside the banking and capital market sectors.

bioRxiv 2022-07-14 Preprint (No Snippets API) Taylor RS, Ruiz Daniels R, Dobie R, Naseer S, Clark TC, Henderson NC, Boudinot P, Martin SA, Macqueen DJ.
Show Full Abstract

The liver is a multitasking organ with essential functions for vertebrate health spanning metabolism and immunity. In contrast to mammals, our understanding of liver cellular heterogeneity and its role in regulating immunological status remains poorly defined in fishes. Addressing this knowledge gap, we generated a transcriptomic atlas of 47,432 nuclei isolated from the liver of Atlantic salmon ( Salmo salar L.) contrasting control fish with those challenged with a pathogenic strain of Aeromonas salmonicida , a problematic bacterial pathogen in global aquaculture. We identified the major liver cell types and their sub-populations, revealing poor conservation of many hepatic cell marker genes utilized in mammals, while identifying novel heterogeneity within the hepatocyte, lymphoid, and myeloid lineages. This included polyploid hepatocytes, multiple T cell populations including γδ T cells, and candidate populations of monocytes/macrophages/dendritic cells. A dominant hepatocyte population radically remodeled its transcriptome following infection to activate the acute phase response and other defense functions, while repressing routine functions such as metabolism. These defense-specialized hepatocytes showed strong activation of genes controlling protein synthesis and secretion, presumably to support the release of acute phase proteins into circulation. The infection response further involved up-regulation of numerous genes in an immune-cell specific manner, reflecting functions in pathogen recognition and killing, antigen presentation, phagocytosis, regulation of inflammation, B cell differentiation and T cell activation. Overall, this study greatly enhances our understanding of the multifaceted role played by liver cells in immune defense and metabolic remodeling following infection and provides many novel cell-specific marker genes to empower future studies of this organ in fishes.

Also flagged:Myh7cardiac hypertrophyangiotensin IIobesitycardiometabolic disordersglucose intolerance
Journal Article 2022-07-13 ✓ 5 Snippets de Oliveira Silva T, Lino CA, Miranda JB, Balbino-Silva CS, Lunardon G, Lima VM, Jensen L, Donato J, Irigoyen MC, Barreto-Chaves MLM, Diniz GP.
In-Text Gene Mentions

Collectively, our results indicate that obesity-associated cardiac hypertrophy in female mice is accompanied by alterations in diverse miRNAs, and suggest that the miR-143-3p-Sox6-Myh7 pathway may play a key role in obesity-induced cardiac hypertrophy.

The results indicate that the miRNA-143-3p-Sox6-Myh7 pathway may play a key role in obesity-induced cardiac hypertrophy.<h4>Abstract</h4>Obesity induces cardiometabolic disorders associated with a high risk of mortality.

Female mice fed an obesogenic diet exhibited cardiac hypertrophy associated with increased levels of miRNA-143-3p, decreased mRNA levels of Sox6 and increased mRNA levels of Myh7.

The miRNA-143-3p-Sox6-Myh7 pathway is altered in obesogenic diet-induced cardiac hypertrophy.

…The miRNA-143-3p-Sox6-Myh7 pathway is altered…

Show Full Abstract

<h4>New findings</h4>What is the central question of this study? What is the effect of an obesogenic diet on the expression of microRNAs (miRNAs) involved in cardiac hypertrophy in female mice? What is the main finding and its importance? Female mice fed an obesogenic diet exhibited cardiac hypertrophy associated with increased levels of miRNA-143-3p, decreased mRNA levels of Sox6 and increased mRNA levels of Myh7. Inhibition of miRNA-143-3p increased Sox6 mRNA levels and reduced Myh7 expression in cardiomyocytes, and prevented angiotensin II-induced cardiomyocyte hypertrophy. The results indicate that the miRNA-143-3p-Sox6-Myh7 pathway may play a key role in obesity-induced cardiac hypertrophy.<h4>Abstract</h4>Obesity induces cardiometabolic disorders associated with a high risk of mortality. We have previously shown that the microRNA (miRNA) expression profile is changed in obesity-induced cardiac hypertrophy in male mice. Here, we investigated the effect of an obesogenic diet on the expression of miRNAs involved in cardiac hypertrophy in female mice. Female mice fed an obesogenic diet displayed an increased body weight gain, glucose intolerance, insulin resistance and dyslipidaemia. In addition, obese female mice exhibited cardiac hypertrophy associated with increased levels of several miRNAs, including miR-143-3p. Bioinformatic analysis identified Sox6, regulator of Myh7 gene transcription, as a predicted target of miR-143-3p. Female mice fed an obesogenic diet exhibited decreased mRNA levels of Sox6 and increased expression of Myh7 in the heart. Loss-of-function studies in cardiomyocytes revealed that inhibition of miR-143-3p increased Sox6 mRNA levels and reduced Myh7 expression. Collectively, our results indicate that obesity-associated cardiac hypertrophy in female mice is accompanied by alterations in diverse miRNAs, and suggest that the miR-143-3p-Sox6-Myh7 pathway may play a key role in obesity-induced cardiac hypertrophy.

Also flagged:thrombinserine proteasecoagulationEndothelial cell surface adhesion moleculevon Willebrand factorAntithrombin‐III
Journal Article 2022-07-13 ✓ 5 Snippets Wulftange WJ, Kucukal E, Man Y, An R, Monchamp K, Sevrain CD, Dashora HR, Owusu-Ansah AT, Bode A, Ilich A, Little JA, Key NS, Gurkan UA.
In-Text Gene Mentions

…the efficacy ofATIIIin mitigating the…

…or without anATIIIpretreatment.…

…to thrombin andATIIItreatments were also…

…We found thatATIIIpretreatment of ECs…

…Furthermore,ATIIImitigated cellular contraction…

Show Full Abstract

Individuals with sickle cell disease (SCD) have persistently elevated thrombin generation that results in a state of systemic hypercoagulability. Antithrombin-III (ATIII), an endogenous serine protease inhibitor, inhibits several enzymes in the coagulation cascade, including thrombin. Here, we utilize a biomimetic microfluidic device to model the morphology and adhesive properties of endothelial cells (ECs) activated by thrombin and examine the efficacy of ATIII in mitigating the adhesion of SCD patient-derived red blood cells (RBCs) and EC retraction. Microfluidic devices were fabricated, seeded with ECs, and incubated under physiological shear stress. Cells were then activated with thrombin with or without an ATIII pretreatment. Blood samples from subjects with normal haemoglobin (HbAA) and subjects with homozygous SCD (HbSS) were used to examine RBC adhesion to ECs. Endothelial cell surface adhesion molecule expression and confluency in response to thrombin and ATIII treatments were also evaluated. We found that ATIII pretreatment of ECs reduced HbSS RBC adhesion to thrombin-activated endothelium. Furthermore, ATIII mitigated cellular contraction and reduced surface expression of von Willebrand factor and vascular cell adhesion molecule-1 (VCAM-1) mediated by thrombin. Our findings suggest that, by attenuating thrombin-mediated EC damage and RBC adhesion to endothelium, ATIII may alleviate the thromboinflammatory manifestations of SCD.

Also flagged:Polyesternanoparticlecomplement activationpolytraumaclottingprothrombin
Journal Article 2022-07-13 ✓ 1 Snippet Maisha N, Kulkarni C, Pandala N, Zilberberg R, Schaub L, Neidert L, Glaser J, Cannon J, Janeja V, Lavik EB.
In-Text Gene Mentions

ATIII

Show Full Abstract

Intravenously infusible nanoparticles to control bleeding have shown promise in rodents, but translation into preclinical models has been challenging as many of these nanoparticle approaches have resulted in infusion responses and adverse outcomes in large animal trauma models. We developed a hemostatic nanoparticle technology that was screened to avoid one component of the infusion response: complement activation. We administered these hemostatic nanoparticles, control nanoparticles, or saline volume controls in a porcine polytrauma model. While the hemostatic nanoparticles promoted clotting as marked by a decrease in prothrombin time and both the hemostatic nanoparticles and controls did not active complement, in a subset of the animals, hard thrombi were found in uninjured tissues in both the hemostatic and control nanoparticle groups. Using data science methods that allow one to work across heterogeneous data sets, we found that the presence of these thrombi correlated with changes in IL-6, INF-alpha, lymphocytes, and neutrophils. While these findings might suggest that this formulation would not be a safe one for translation for trauma, they provide guidance for developing screening tools to make nanoparticle formulations in the complex milieux of trauma as well as for therapeutic interventions more broadly. This is important as we look to translate intravenously administered nanoparticle formulations for therapies, particularly considering the vascular changes seen in a subset of patients following COVID-19. We need to understand adverse events like thrombi more completely and screen for these events early to make nanomaterials as safe and effective as possible.

Also flagged:IL23RMSMDIFN-γIL12Bacille Calmette-Guérin diseaseIL-23
Journal Article 2022-07-13 ✓ 2 Snippets Staels F, Lorenzetti F, De Keukeleere K, Willemsen M, Gerbaux M, Neumann J, Tousseyn T, Pasciuto E, De Munter P, Bossuyt X, Gijsbers R, Liston A, Humblet-Baron S, Schrijvers R.
In-Text Gene Mentions

To date, 19 genes are implicated in MSMD (CYBB, IFNGR1, IFNGR2, IFNG, IL12RB1, IL12B, IL23R, IL12RB2, ISG15, IRF8, JAK1, NEMO, RORC, SPPL2A, STAT1, TBX21, TYK2, USP18, ZNFX1).

…TBX21, TYK2, USP18,ZNFX1) .…

Show Full Abstract

<h4>Purpose</h4>Mendelian susceptibility to mycobacterial disease (MSMD) is caused by inborn errors of IFN-γ immunity. The most frequent genetic defects are found in IL12 or a subunit of its receptor. IL23R deficiency in MSMD has only been reported once, in two pediatric patients from the same kindred with isolated disseminated Bacille Calmette-Guérin disease. We evaluated the impact of a homozygous stop mutation in IL23R (R381X), identified by whole exome sequencing, in an adult patient with disseminated non-tuberculous mycobacterial disease.<h4>Methods</h4>We performed functional validation of the R381X mutation by evaluating IL23R expression and IL-23 signaling (STAT3 phosphorylation, IFN-γ production) in primary cells (PBMCs, EBV-B cells) and cell lines (HeLa) with or without back-complementation of wild-type IL23R.<h4>Results</h4>We report on a 48-year-old male with disseminated non-tuberculous mycobacterial disease. We identified and characterized a homozygous loss-of-function stop mutation underlying IL23R deficiency, resulting in near absent expression of membrane bound IL23R. IL23R deficiency was characterized by impaired IL-23-mediated IFN-γ secretion in CD4<sup>+</sup>, CD8<sup>+</sup> T, and mucosal-associated invariant T (MAIT) cells, and low frequencies of circulating Th17 (CD3<sup>+</sup>CD45RA<sup>-</sup>CCR4<sup>+</sup>CXCR3<sup>-</sup>RORγT<sup>+</sup>), Th1* (CD45RA<sup>-</sup>CCR4<sup>-</sup>CXCR3<sup>+</sup>RORγT<sup>+</sup>), and MAIT (CD3<sup>+</sup>CD8<sup>+</sup>Vα7.2<sup>+</sup>CD161<sup>+</sup>) cells. Although the patient did not have a history of recurrent fungal infections, impaired Th17 differentiation and blunted IL-23-mediated IL-17 secretion in PBMCs were observed.<h4>Conclusion</h4>We demonstrate that impaired IL-23 immunity caused by a homozygous R381X mutation in IL23R underlies MSMD, corroborating earlier findings with a homozygous p.C115Y IL23R mutation. Our report further supports a model of redundant contribution of IL-23- to IL-17-mediated anti-fungal immunity.1.

Also flagged:Huntington's diseaseneurodegenerative illnesspolyglutaminehereditary disordersnucleotideamino acid
Journal Article 2022-07-13 ✓ 4 Snippets Khan MQ, Mubeen H, Khan ZQ, Masood A, Zafar A, Wattoo JI, Nisa AU.
In-Text Gene Mentions

…missense mutations inHTTgene causing Huntington's…

…protein-protein interaction ofHTTwith other proteins…

…the function ofHTTand its interacting…

…residues of theHTTprotein, involved in…

Show Full Abstract

<h4>Background</h4>Huntington's disease is a rare neurodegenerative illness of the central nervous system that is inherited in an autosomal dominant pattern. Mutant huntingtin protein is produced as a result of enlargement of CAG repeat in the N-terminal of the polyglutamine tract.<h4>Aim of the study</h4>Herein, we aim to investigate the mutations and their effects on the HTT gene and its genetic variants. Additionally, the protein-protein interaction of HTT with other proteins and receptor-ligand interaction with the three-dimensional structure of huntingtin protein were identified.<h4>Methods</h4>A comprehensive analysis of the HTT interactome and protein-ligand interaction has been carried out to provide a global picture of structure-function analysis of huntingtin protein. Mutations were analyzed and mutation verification tools were used to check the effect of mutation on protein function.<h4>Results</h4>The results showed, mutations in a single gene are not only responsible for causing a particular disease but may also cause other hereditary disorders as well. Moreover, the modification at the nucleotide level also cause the change in the specific amino acid which may disrupt the function of HTT and its interacting proteins contributing in disease pathogenesis. Furthermore, the interaction between MECP2 and BDNF lowers the rate of transcriptional activity. Molecular docking further confirmed the strong interaction between MECP2 and BDNF with highest affinity. Amino acid residues of the HTT protein, involved in the interaction with tetrabenazine were N912, Y890, G2385, and V2320. These findings proved, tetrabenazine as one of the potential therapeutic agent for treatment of Huntington's disease.<h4>Conclusion</h4>These results give further insights into the genetics of Huntington's disease for a better understanding of disease models which will be beneficial for the future therapeutic studies.

Also flagged:type 2 diabetesobesityhypertensiondiabetic cardiomyopathydiabetesleft ventricular diastolic dysfunction
Journal Article 2022-07-13 ✓ 1 Snippet Wang Z, Wang C, Xie Z, Huang X, ShangGuan H, Zhu W, Wang S.
In-Text Gene Mentions

…acid level, andATIIIas risk factors…

Show Full Abstract

<h4>Aim</h4>Type 2 diabetes may impair cardiac structure and function at very early stage, other factors, for example, obesity and hypertension, can induce aforementioned abnormalities individually. This study aimed to explore precise prevention and treatment of diabetic cardiomyopathy (DCM) by using cluster analysis of echocardiographic variables.<h4>Methods and results</h4>A total of 66 536 inpatients with diabetes from 2013 to 2018 were investigated, and 7112 patients were available for analysis after nadir. The cluster analysis was performed on echocardiographic variables to assess the clinical profiles and risk factors of clusters. Two clusters were identified. Cluster 1 with 3576 patients (50.3%, including 62.5% female) had hypertension in 62.4%, while the lower rate of obesity (13.7%). Ultrasound findings showed that 79.9% of them had left ventricular diastolic dysfunction (LVDD), the most characteristic change in the early stages of DCM. Systolic blood pressure (SBP), uric acid and antithrombin III were independent risk factors for LVDD (P < 0.0001); 64.0% of the 3536 patients in the second group were male, with a high prevalence of obesity (30.1%) and a higher prevalence of hypertension (79.5%), In particular, decreased systolic function and a high rate of LV hypertrophy (46.8%) represented the progressive phase of DCM (P < 0.0001). SBP, diastolic blood pressure, BMI and creatinine were independent correlates of LV mass index (P < 0.05).<h4>Conclusion</h4>The cluster analysis of echocardiographic variables may improve the identification of groups of patients with similar risks and different disease courses and will facilitate the achievement of targeted early prevention and treatment of DCM.

Also flagged:RAD51lackCXCR4a a aTrichostatinGFP
Journal Article 2022-07-13 ✓ 2 Snippets Pan X, Qu K, Yuan H, Xiang X, Anthon C, Pashkova L, Liang X, Han P, Corsi GI, Xu F, Liu P, Zhong J, Zhou Y, Ma T, Jiang H, Liu J, Wang J, Jessen N, Bolund L, Yang H, Xu X, Church GM, Gorodkin J, Lin L, Luo Y.
In-Text Gene Mentions

HTT

…hemoglobinopathies, SCD, CCR5,HTT, CEP290). (…

Show Full Abstract

Methods for sensitive and high-throughput evaluation of CRISPR RNA-guided nucleases (RGNs) off-targets (OTs) are essential for advancing RGN-based gene therapies. Here we report SURRO-seq for simultaneously evaluating thousands of therapeutic RGN OTs in cells. SURRO-seq captures RGN-induced indels in cells by pooled lentiviral OTs libraries and deep sequencing, an approach comparable and complementary to OTs detection by T7 endonuclease 1, GUIDE-seq, and CIRCLE-seq. Application of SURRO-seq to 8150 OTs from 110 therapeutic RGNs identifies significantly detectable indels in 783 OTs, of which 37 OTs are found in cancer genes and 23 OTs are further validated in five human cell lines by targeted amplicon sequencing. Finally, SURRO-seq reveals that thermodynamically stable wobble base pair (rG•dT) and free binding energy strongly affect RGN specificity. Our study emphasizes the necessity of thoroughly evaluating therapeutic RGN OTs to minimize inevitable off-target effects.

Also flagged:respbehaviorsSBShomopolymerCohesinChromatin
Journal Article 2022-07-13 ✓ 1 Snippet Conte M, Irani E, Chiariello AM, Abraham A, Bianco S, Esposito A, Nicodemi M.
In-Text Gene Mentions

…that Cohesin andCondensincan be components…

Show Full Abstract

Loop-extrusion and phase-separation have been proposed as mechanisms that shape chromosome spatial organization. It is unclear, however, how they perform relative to each other in explaining chromatin architecture data and whether they compete or co-exist at the single-molecule level. Here, we compare models of polymer physics based on loop-extrusion and phase-separation, as well as models where both mechanisms act simultaneously in a single molecule, against multiplexed FISH data available in human loci in IMR90 and HCT116 cells. We find that the different models recapitulate bulk Hi-C and average multiplexed microscopy data. Single-molecule chromatin conformations are also well captured, especially by phase-separation based models that better reflect the experimentally reported segregation in globules of the considered genomic loci and their cell-to-cell structural variability. Such a variability is consistent with two main concurrent causes: single-cell epigenetic heterogeneity and an intrinsic thermodynamic conformational degeneracy of folding. Overall, the model combining loop-extrusion and polymer phase-separation provides a very good description of the data, particularly higher-order contacts, showing that the two mechanisms can co-exist in shaping chromatin architecture in single cells.

Also flagged:Rheumatoid ArthritisAnnexinVmemory_valCD74HLA-DRB1
Journal Article 2022-07-13 ✓ 1 Snippet Hardt U, Carlberg K, Af Klint E, Sahlström P, Larsson L, van Vollenhoven A, Hernandez Machado S, Israelsson L, Amara K, Chemin K, Korotkova M, Karlsson Hedestam GB, Catrina AI, Teichmann SA, Ståhl PL, Malmström V.
In-Text Gene Mentions

…low expression ofTNFSF4encoding CD134 (also…

Show Full Abstract

B cells play a significant role in established Rheumatoid Arthritis (RA). However, it is unclear to what extent differentiated B cells are present in joint tissue already at the onset of disease. Here, we studied synovial biopsies (n = 8) captured from untreated patients at time of diagnosis. 3414 index-sorted B cells underwent RNA sequencing and paired tissue pieces were subjected to spatial transcriptomics (n = 4). We performed extensive bioinformatics analyses to dissect the local B cell composition. Select plasma cell immunoglobulin sequences were expressed as monoclonal antibodies and tested by ELISA. Memory and plasma cells were found irrespective of autoantibody status of the patients. Double negative memory B cells were prominent, but did not display a distinct transcriptional profile. The tissue architecture implicate both local B cell maturation via T cell help and plasma cell survival niches with a strong CXCL12-CXCR4 axis. The immunoglobulin sequence analyses revealed clonality between the memory B and plasma cell pools further supporting local maturation. One of the plasma cell-derived antibodies displayed citrulline autoreactivity, demonstrating local autoreactive plasma cell differentiation in joint biopsies captured from untreated early RA. Hence, plasma cell niches are not a consequence of chronic inflammation, but are already present at the time of diagnosis.

Also flagged:Synaptic boutonsneurofilamentpre-pulse inhibitionlocalizationbrightbouton
Journal Article 2022-07-13 No Snippets Uemura M, Furuse T, Yamada I, Kushida T, Abe T, Imai K, Nagao S, Kudoh M, Yoshizawa K, Tamura M, Kiyonari H, Wakana S, Hirano S.
Show Full Abstract

Protocadherin 9 (Pcdh9) is a member of the cadherin superfamily and is uniquely expressed in the vestibular and limbic systems; however, its physiological role remains unclear. Here, we studied the expression of Pcdh9 in the limbic system and phenotypes of Pcdh9-knock-out mice (Pcdh9 KO mice). Pcdh9 mRNA was expressed in the fear extinction neurons that express protein phosphatase 1 regulatory subunit 1 B (Ppp1r1b) in the posterior part of the basolateral amygdala (pBLA), as well as in the Cornu Ammonis (CA) and Dentate Gyrus (DG) neurons of the hippocampus. We show that the Pcdh9 protein was often localised at synapses. Phenotypic analysis of Pcdh9 KO mice revealed no apparent morphological abnormalities in the pBLA but a decrease in the spine number of CA neurons. Further, the Pcdh9 KO mice were related to features such as the abnormal optokinetic response, less approach to novel objects, and reduced fear extinction during recovery from the fear. These results suggest that Pcdh9 is involved in eliciting positive emotional behaviours, possibly via fear extinction neurons in the pBLA and/or synaptic activity in the hippocampal neurons, and normal optokinetic eye movement in brainstem optokinetic system-related neurons.

Also flagged:GSTsparcl1BiPAutismHevinendoplasmic reticulum
Journal Article 2022-07-13 ✓ 1 Snippet Taketomi T, Yasuda T, Morita R, Kim J, Shigeta Y, Eroglu C, Harada R, Tsuruta F.
In-Text Gene Mentions

…oteins, transcription factors,chromatin modifiersmodifiers, and protein…

Show Full Abstract

Hevin is a secreted extracellular matrix protein that is encoded by the SPARCL1 gene. Recent studies have shown that Hevin plays an important role in regulating synaptogenesis and synaptic plasticity. Mutations in the SPARCL1 gene increase the risk of autism spectrum disorder (ASD). However, the molecular basis of how mutations in SPARCL1 increase the risk of ASD is not been fully understood. In this study, we show that one of the SPARCL1 mutations associated with ASD impairs normal Hevin secretion. We identified Hevin mutants lacking the EF-hand motif through analyzing ASD-related mice with vulnerable spliceosome functions. Hevin deletion mutants accumulate in the endoplasmic reticulum (ER), leading to the activation of unfolded protein responses. We also found that a single amino acid substitution of Trp<sup>647</sup> with Arg in the EF-hand motif associated with a familial case of ASD causes a similar phenotype in the EF-hand deletion mutant. Importantly, molecular dynamics (MD) simulation revealed that this single amino acid substitution triggers exposure of a hydrophobic amino acid to the surface, increasing the binding of Hevin with molecular chaperons, BIP. Taken together, these data suggest that the integrity of the EF-hand motif in Hevin is crucial for proper folding and that ASD-related mutations impair the export of Hevin from the ER. Our data provide a novel mechanism linking a point mutation in the SPARCL1 gene to the molecular and cellular characteristics involved in ASD.

Also flagged:ZBTB46transcription factortissue homeostasisCCR6pro-inflammatory cytokinesOX40L
Journal Article 2022-07-13 No Snippets Zhou W, Zhou L, Zhou J, JRI Live Cell Bank, Chu C, Zhang C, Sockolow RE, Eberl G, Sonnenberg GF.
Show Full Abstract

RORγt is a lineage-specifying transcription factor that is expressed by immune cells that are enriched in the gastrointestinal tract and promote immunity, inflammation and tissue homeostasis<sup>1-15</sup>. However, fundamental questions remain with regard to the cellular heterogeneity among these cell types, the mechanisms that control protective versus inflammatory properties and their functional redundancy. Here we define all RORγt<sup>+</sup> immune cells in the intestine at single-cell resolution and identify a subset of group 3 innate lymphoid cells (ILC3s) that expresses ZBTB46, a transcription factor specifying conventional dendritic cells<sup>16-20</sup>. ZBTB46 is robustly expressed by CCR6<sup>+</sup> lymphoid-tissue-inducer-like ILC3s that are developmentally and phenotypically distinct from conventional dendritic cells, and its expression is imprinted by RORγt, fine-tuned by microbiota-derived signals and increased by pro-inflammatory cytokines. ZBTB46 restrains the inflammatory properties of ILC3s, including the OX40L-dependent expansion of T helper 17 cells and the exacerbated intestinal inflammation that occurs after enteric infection. Finally, ZBTB46<sup>+</sup> ILC3s are a major source of IL-22, and selective depletion of this population renders mice susceptible to enteric infection and associated intestinal inflammation. These results show that ZBTB46 is a transcription factor that is shared between conventional dendritic cells and ILC3s, and identify a cell-intrinsic function for ZBTB46 in restraining the pro-inflammatory properties of ILC3s and a non-redundant role for ZBTB46<sup>+</sup> ILC3s in orchestrating intestinal health.

Also flagged:infectious diseaseslectinSLC2A11infectionsphenolCD3D
Journal Article 2022-07-13 ✓ 4 Snippets Lukaszewski RA, Jones HE, Gersuk VH, Russell P, Simpson A, Brealey D, Walker J, Thomas M, Whitehouse T, Ostermann M, Koch A, Zacharowski K, Kruhoffer M, Chaussabel D, Singer M.
In-Text Gene Mentions

OLFM4

Specifically, a 7 gene set (B4GALT5, AFF1, LDLR, ATXN7L3, LARP4B, SLC36A1, TRPM2, AUC >0.85, PPV >0.8) for infection versus SIRS- models, a 12 gene set (ATXN1, SLC41A3, MED13L, STOM, B4GALT5, MIDN, HVCN1, LDLR, CFLAR, SPATA13, EIF4G3, METTL7B, AUC >0.9, PPV >0.8) for infection versus SIRS+ models, and an eight gene set (DOK3, ICAM2, IL1R1, LGALS2, LSG1, RPL13A, RPS13, SGSH, AUC >0.75 (PPV >0.7) for sepsis vs. uncomplicated infection were sufficient to classify postoperative outcomes.

…gene set (B4GALT5, AFF1, LDLR, ATXN7L3,…

…SLC41A3, MED13L, STOM,B4GALT5, MIDN, HVCN1, LDLR,…

Show Full Abstract

<h4>Purpose</h4>Early accurate diagnosis of infection ± organ dysfunction (sepsis) remains a major challenge in clinical practice. Utilizing effective biomarkers to identify infection and impending organ dysfunction before the onset of clinical signs and symptoms would enable earlier investigation and intervention. To our knowledge, no prior study has specifically examined the possibility of pre-symptomatic detection of sepsis.<h4>Methods</h4>Blood samples and clinical/laboratory data were collected daily from 4385 patients undergoing elective surgery. An adjudication panel identified 154 patients with definite postoperative infection, of whom 98 developed sepsis. Transcriptomic profiling and subsequent RT-qPCR were undertaken on sequential blood samples taken postoperatively from these patients in the three days prior to the onset of symptoms. Comparison was made against postoperative day-, age-, sex- and procedure- matched patients who had an uncomplicated recovery (n =151) or postoperative inflammation without infection (n =148).<h4>Results</h4>Specific gene signatures optimized to predict infection or sepsis in the three days prior to clinical presentation were identified in initial discovery cohorts. Subsequent classification using machine learning with cross-validation with separate patient cohorts and their matched controls gave high Area Under the Receiver Operator Curve (AUC) values. These allowed discrimination of infection from uncomplicated recovery (AUC 0.871), infectious from non-infectious systemic inflammation (0.897), sepsis from other postoperative presentations (0.843), and sepsis from uncomplicated infection (0.703).<h4>Conclusion</h4>Host biomarker signatures may be able to identify postoperative infection or sepsis up to three days in advance of clinical recognition. If validated in future studies, these signatures offer potential diagnostic utility for postoperative management of deteriorating or high-risk surgical patients and, potentially, other patient populations.

Also flagged:adiponectinnonalcoholic fatty liver diseaseNAFLDtype 2 diabetes mellitusinsulinliver diseases
Journal Article 2022-07-13 ✓ 1 Snippet Mantovani A, Zusi C, Csermely A, Salvagno GL, Colecchia A, Lippi G, Maffeis C, Targher G.
In-Text Gene Mentions

…drugs, autoimmunity, andhemochromatosis); (b) cirrhosis, cancer,…

Show Full Abstract

<h4>Purpose</h4>Little is known about the association between plasma adiponectin levels and nonalcoholic fatty liver disease (NAFLD) in patients with type 2 diabetes mellitus (T2DM). We examined whether there is an association between lower plasma adiponectin levels and the presence/severity of NAFLD in people with T2DM.<h4>Methods</h4>We cross-sectionally recruited 79 men with non-insulin-treated T2DM and no known liver diseases, who had consecutively attended our diabetes outpatient service over a 6-month period and who underwent both ultrasonography and Fibroscan-measured liver stiffness (LSM). Nine single nucleotide polymorphisms (PNPLA3 rs738409 and other genetic variants) associated with NAFLD were investigated.<h4>Results</h4>Among the 79 participants included (mean age 67 ± 10 years, BMI 27.7 ± 4 kg/m<sup>2</sup>), 28 did not have NAFLD, 32 had steatosis alone, and 19 had NAFLD with coexisting significant fibrosis (LSM ≥ 7.0 kPa by Fibroscan®). Compared to those without NAFLD, patients with hepatic steatosis alone and those with hepatic steatosis and coexisting significant fibrosis had lower high-molecular-weight adiponectin levels (5.5 [IQR 2.3-7.6] vs. 2.4 [1.8-3.7] vs. 1.6 [1.0-2.9] µg/mL; p < 0.001). After adjustment for age, body mass index, insulin resistance, and the PNPLA3 rs738409 variant, lower plasma adiponectin levels were found to be associated with increased odds of both steatosis alone (adjusted-odds ratio [OR] 2.44, 95% CI 1.04-5.56, p = 0.042) and NAFLD with coexisting significant fibrosis (adjusted-OR 3.84, 95% CI 1.23-10.0, p = 0.020). Similar findings were observed after adjustment for the other eight genotyped NAFLD-related polymorphisms.<h4>Conclusion</h4>Lower plasma adiponectin levels are closely associated with the presence and severity of NAFLD in men with T2DM, pointing to a role of adiponectin in NAFLD development and progression.

Also flagged:transient receptor potential channelskidney renal clear cell carcinomacancernucleotidetumorBosutinib
Journal Article 2022-07-13 ✓ 2 Snippets Ren J, Yuan Q, Liu J, Zhong L, Li H, Wu G, Chen F, Tang Q.
In-Text Gene Mentions

…CD27, TNFRSF9,TNFSF4, PDCD1, CD80, ICOS,…

…of CD27, TNFRSF9,TNFSF4, PDCD1, CD80, ICOS,…

Show Full Abstract

Kidney renal clear cell carcinoma (KIRC) is among the major causes of cancer-caused mortality around the world. Transient receptor potential channels (TRPs), due to their role in various human diseases, might become potential drug targets in cancer. The mRNA expression, copy number variation, single-nucleotide variation, prognostic values, drug sensitivity, and pathway regulation of TRPs were studied across cancer types. The ArrayExpress and The Cancer Genome Atlas (TCGA) databases were used to retrieve KIRC samples. Simultaneously, training, internal, and external cohorts were grouped. In KIRC, a prognostic signature with superior survival prediction in contrast with other well-established signatures was created after a stepwise screening of optimized genes linked to TRPs using univariate Cox, weighted gene co-expression network analysis, multivariate Cox, and least absolute shrinkage and selection operator regression analyses. Subsequent to the determination of risk levels, the variations in the expression of immune checkpoint genes, tumor mutation burden, and immune subtypes and response between low-risk and high-risk subgroups were studied using a variety of bioinformatics algorithms, including ESTIMATE, XCELL, EPIC, CIBERSORT-ABS, CIBERSORT, MCPCOUNTER, TIMER, and QUANTISEQ. Gene set enrichment analysis helped in the identification of abnormal pathways across the low- and high-risk subgroups. Besides, high-risk KIRC patients might benefit from ABT888, AZD6244, AZD7762, Bosutinib, Camptothecin, CI1040, JNK inhibitor VIII, KU55933, Lenalidomide, Nilotinib, PLX4720, RO3306, Vinblastine, and ZM.447439; however, low-risk populations might benefit from Bicalutamide, FH535, and OSI906. Finally, calibration curves were used to validate the nomogram with a satisfactory predictive survival probability. In conclusion, this research provides useful insight that can aid and guide clinical practice and scientific research.

Also flagged:Eye diseasesjoint disordersHigh-density lipoproteinDiabetesGlucoserespiratory diseases
Journal Article 2022-07-13 ✓ 1 Snippet Chiou JS, Cheng CF, Liang WM, Chou CH, Wang CH, Lin WD, Chiu ML, Cheng WC, Lin CW, Lin TH, Liao CC, Huang SM, Tsai CH, Lin YJ, Tsai FJ.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

<h4>Background</h4>Height is an important anthropometric measurement and is associated with many health-related outcomes. Genome-wide association studies (GWASs) have identified hundreds of genetic loci associated with height, mainly in individuals of European ancestry.<h4>Methods</h4>We performed genome-wide association analyses and replicated previously reported GWAS-determined single nucleotide polymorphisms (SNPs) in the Taiwanese Han population (Taiwan Biobank; n = 67,452). A genetic instrument composed of 251 SNPs was selected from our GWAS, based on height and replication results as the best-fit polygenic risk score (PRS), in accordance with the clumping and p-value threshold method. We also examined the association between genetically determined height (PRS<sub>251</sub>) and measured height (phenotype). We performed observational (phenotype) and genetic PRS<sub>251</sub> association analyses of height and health-related outcomes.<h4>Results</h4>GWAS identified 6843 SNPs in 89 genomic regions with genome-wide significance, including 18 novel loci. These were the most strongly associated genetic loci (EFEMP1, DIS3L2, ZBTB38, LCORL, HMGA1, CS, and GDF5) previously reported to play a role in height. There was a positive association between PRS<sub>251</sub> and measured height (p < 0.001). Of the 14 traits and 49 diseases analyzed, we observed significant associations of measured and genetically determined height with only eight traits (p < 0.05/[14 + 49]). Height was positively associated with body weight, waist circumference, and hip circumference but negatively associated with body mass index, waist-hip ratio, body fat, total cholesterol, and low-density lipoprotein cholesterol (p < 0.05/[14 + 49]).<h4>Conclusions</h4>This study contributes to the understanding of the genetic features of height and health-related outcomes in individuals of Han Chinese ancestry in Taiwan.

Also flagged:carbon dotshydroxyapatitecancersynthesisnanohydroxyapatitedeath
Journal Article 2022-07-13 No Snippets Sengar P, Chauhan K, Hirata GA.
Show Full Abstract

Despite the significant advancement in cancer diagnosis and therapy, a huge burden remains. Consequently, much research has been diverted on the development of multifunctional nanomaterials for improvement in conventional diagnosis and therapy. Luminescent nanomaterials offer a versatile platform for the development of such materials as their intrinsic photoluminescence (PL) property offers convergence of diagnosis as well as therapy at the same time. However, the clinical translation of nanomaterials faces various challenges, including biocompatibility and cost-effective scale up production. Thus, luminescent materials with facile synthesis approach along with intrinsic biocompatibility and anticancerous activity hold significant importance. As a result, carbon dots (CDs) and nanohydroxyapatite (nHA) have attracted much attention for the development of optical imaging probes. CDs are the newest members of the carbonaceous nanomaterials family that possess intrinsic luminescent and therapeutic properties, making them a promising candidate for cancer theranostic. Additionally, nHA is an excellent bioactive material due to its compositional similarity to the human bone matrix. The nHA crystal can efficiently host rare-earth elements to attain luminescent property, which can further be implemented for cancer theranostic applications. Herein, the development of CDs and nHA based nanomaterials as multifunctional agents for cancer has been briefly discussed. The emphasis has been given to different synthesis strategies leading to different morphologies and tunable PL spectra, followed by their diverse applications as biocompatible theranostic agents. Finally, the review has been summarized with the current challenges and future perspectives.

Also flagged:COVID-19waterMicroplasticscarbondeathbiopolymers
Journal Article 2022-07-13 No Snippets Nanda N, Bharadvaja N.
Show Full Abstract

<h4>Abstract</h4>Plastics are undebatably a hot topic of discussion across international forums due to their huge ecological footprint. The onset of COVID-19 pandemic has exacerbated the issue in an irreversible manner. Bioplastics produced from renewable sources are a result of lookout for sustainable alternatives. Replacing a ton of synthetic plastics with biobased ones reduces 1.8 tons CO<sub>2</sub> emissions. Here, we begin with highlighting the problem statement-Plastic accumulation and its associated negative impacts. Microalgae outperforms plants and microbes, when used to produce bioplastic due to superior growth rate, non-competitive nature to food, and simultaneous wastewater remediation. They have minimal nutrient requirements and less dependency on climatic conditions for cultivation. These are the reasons for current boom in the algal bioplastic market. However, it is still not at par in price with the petroleum-based plastics. A brief market research has been done to better evaluate the current global status and future scope of algal bioplastics. The objective of this review is to propose possible solutions to resolve the challenges in scale up of bioplastic industry. Various bioplastic production technologies have been comprehensively discussed along with their optimization strategies. Overall studies discussed show that in order to make it cost competitive adopting a multi-dimensional approach like algal biorefinery is the best way out. A holistic comparison of any bio-based alternative with its conventional counterpart is imperative to assess its impact upon commercialization. Therefore, the review concludes with the life cycle assessment of bioplastics and measures to improve their inclusivity in a circular economy.<h4>Graphical abstract</h4>

Also flagged:vinculinImmunCOADcell deathBE2RPA32
Journal Article 2022-07-13 ✓ 3 Snippets Nunes C, Depestel L, Mus L, Keller KM, Delhaye L, Louwagie A, Rishfi M, Whale A, Kara N, Andrews SR, Dela Cruz F, You D, Siddiquee A, Cologna CT, De Craemer S, Dolman E, Bartenhagen C, De Vloed F, Sanders E, Eggermont A, Bekaert SL, Van Loocke W, Bek JW, Dewyn G, Loontiens S, Van Isterdael G, Decaesteker B, Tilleman L, Van Nieuwerburgh F, Vermeirssen V, Van Neste C, Ghesquiere B, Goossens S, Eyckerman S, De Preter K, Fischer M, Houseley J, Molenaar J, De Wilde B, Roberts SS, Durinck K, Speleman F.
In-Text Gene Mentions

Ten (DDX11, TRIP13, POLQ, FOXM1, RAD41L, MMS22L, ERCC8, FANCB, PARPBP, and RAD51AP1) of 31 highest-ranked genes from both DNA repair gene sets overlapped with the top-ranked CHK1-correlated genes in the Kocak neuroblastoma patient cohort (n = 649; GSE45545), suggesting that MYCN-RRM2–driven neuroblastomas in the double transgenic zebrafish model are also marked by enhanced ATR-CHK1 signaling activity.

…, RAD41L ,MMS22L, ERCC8 ,…

…PAF, and COMPASSchromatin modifiermodifier complexes.…

Show Full Abstract

High-risk neuroblastoma, a pediatric tumor originating from the sympathetic nervous system, has a low mutation load but highly recurrent somatic DNA copy number variants. Previously, segmental gains and/or amplifications allowed identification of drivers for neuroblastoma development. Using this approach, combined with gene dosage impact on expression and survival, we identified ribonucleotide reductase subunit M2 (RRM2) as a candidate dependency factor further supported by growth inhibition upon in vitro knockdown and accelerated tumor formation in a neuroblastoma zebrafish model coexpressing human RRM2 with MYCN. Forced RRM2 induction alleviates excessive replicative stress induced by CHK1 inhibition, while high RRM2 expression in human neuroblastomas correlates with high CHK1 activity. MYCN-driven zebrafish tumors with RRM2 co-overexpression exhibit differentially expressed DNA repair genes in keeping with enhanced ATR-CHK1 signaling activity. In vitro, RRM2 inhibition enhances intrinsic replication stress checkpoint addiction. Last, combinatorial RRM2-CHK1 inhibition acts synergistic in high-risk neuroblastoma cell lines and patient-derived xenograft models, illustrating the therapeutic potential.

Also flagged:cumenedegradationRieske non-heme iron oxygenaseROelectron transferreductase
Journal Article 2022-07-13 ✓ 1 Snippet Tsai PC, Chakraborty J, Suzuki-Minakuchi C, Terada T, Kotake T, Matsuzawa J, Okada K, Nojiri H.
In-Text Gene Mentions

…of CARDO-F fromPseudomonas resinovorans CA10resinovorans CA10 (PDB…

Show Full Abstract

Cumene dioxygenase (CumDO) is an initial enzyme in the cumene degradation pathway of Pseudomonas fluorescens IP01 and is a Rieske non-heme iron oxygenase (RO) that comprises two electron transfer components (reductase [CumDO-R] and Rieske-type ferredoxin [CumDO-F]) and one catalytic component (α<sub>3</sub>β<sub>3</sub>-type oxygenase [CumDO-O]). Catalysis is triggered by electrons that are transferred from NAD(P)H to CumDO-O by CumDO-R and CumDO-F. To investigate the binding mode between CumDO-F and CumDO-O and to identify the key CumDO-O amino acid residues for binding, we simulated docking between the CumDO-O crystal structure and predicted model of CumDO-F and identified two potential binding sites: one is at the side-wise site and the other is at the top-wise site in mushroom-like CumDO-O. Then, we performed alanine mutagenesis of 16 surface amino acid residues at two potential binding sites. The results of reduction efficiency analyses using the purified components indicated that CumDO-F bound at the side-wise site of CumDO-O, and K117 of the α-subunit and R65 of the β-subunit were critical for the interaction. Moreover, these two positively charged residues are well conserved in α<sub>3</sub>β<sub>3</sub>-type oxygenase components of ROs whose electron donors are Rieske-type ferredoxins. Given that these residues were not conserved if the electron donors were different types of ferredoxins or reductases, the side-wise site of the mushroom-like structure is thought to be the common binding site between Rieske-type ferredoxin and α<sub>3</sub>β<sub>3</sub>-type oxygenase components in ROs. <b>IMPORTANCE</b> We clarified the critical amino acid residues of the oxygenase component (Oxy) of Rieske non-heme iron oxygenase (RO) for binding with Rieske-type ferredoxin (Fd). Our results showed that Rieske-type Fd-binding site is commonly located at the stem (side-wise site) of the mushroom-like α<sub>3</sub>β<sub>3</sub> quaternary structure in many ROs. The resultant binding site was totally different from those reported at the top-wise site of the doughnut-like α<sub>3</sub>-type Oxy, although α<sub>3</sub>-type Oxys correspond to the cap (α<sub>3</sub> subunit part) of the mushroom-like α<sub>3</sub>β<sub>3</sub>-type Oxys. Critical amino acid residues detected in this study were not conserved if the electron donors of Oxys were different types of Fds or reductases. Altogether, we can suggest that unique binding modes between Oxys and electron donors have evolved, depending on the nature of the electron donors, despite Oxy molecules having shared α<sub>3</sub>β<sub>3</sub> quaternary structures.

Also flagged:Huntington's diseaseHDautosomal dominant neurodegenerative diseasepolyglutaminedeath
Journal Article 2022-07-13 ✓ 2 Snippets Grigor'eva EV, Malakhova AA, Sorogina DA, Pavlova SV, Malankhanova TB, Abramycheva NY, Klyushnikov SA, Illarioshkin SN, Zakian SM.
In-Text Gene Mentions

Huntington's disease (HD) is a hereditary autosomal dominant neurodegenerative disease caused by the polyglutamine stretch expansion in the huntingtin (HTT) protein.

…in the huntingtin (HTT) protein.…

Show Full Abstract

Huntington's disease (HD) is a hereditary autosomal dominant neurodegenerative disease caused by the polyglutamine stretch expansion in the huntingtin (HTT) protein. In HD, dysregulation of multiple cellular processes occurs, resulting in the death of medium spiny neurons of striatum. A line of induced pluripotent stem cells (iPSCs) ICGi033-A was obtained from peripheral blood mononuclear cells of a patient carrying 77 CAG repeats in the HTT gene. The iPSCs express pluripotency markers, have a normal karyotype, and differentiate into three germ layers: endoderm, ectoderm, mesoderm.

Also flagged:malignant tumorsTumorbone remodelingInterleukin-6IL6IL6 receptor
Journal Article 2022-07-13 No Snippets Chang J, Jiang Z, Jin W, Wang Y, Li J, Chen J, Li H, Feng L.
Show Full Abstract

Bone metastasis is a common complication in patients with advanced tumors, causing pain and bone destruction and affecting their quality of life. Typically, complementary and alternative medicine (CAM), with unique theoretical guidance, has played key roles in the treatment of tumor-related diseases. Gu-tong formula (GTF), as a representative prescription of traditional Chinese medicine, has been demonstrated to be an effective clinical medication for the relief of cancer pain. However, the molecular mechanism of GTF in the treatment of osteolytic metastasis is still unclear. Herein, we employ network pharmacology and molecular dynamics methods to uncover the potential treatment mechanism, indicating that GTF can reduce the levels of serum IL6 and TGFB1 and thus limit the scope of bone cortical damage. Among the active compounds, sesamin and deltoin can bind stably with IL6 and TGFB1, respectively, and have the potential to become anti-inflammatory and anticancer drugs. Although the reasons for the therapeutic effect of GTF are complex and comprehensive, this work provides biological plausibility in the treatment of osteolytic metastases, which has a guiding significance for the treatment of cancer pain with CAM.

Also flagged:keloidGene ExpressionCOL1A1COL1A2COL3A1COL5A1
Journal Article 2022-07-13 No Snippets He Y, Zhang Z, Yin B, Li S, Wang P, Lan J, Lian W, Jia C.
Show Full Abstract

<h4>Background</h4>Keloid has brought great trouble to people and currently has no uniformly successful treatment. It is urgent to find new targets to effectively prevent the progress of keloid. The current research mainly identifies the differentially expressed genes (DEGs) in keloid through high-throughput sequencing technology and bioinformatics analysis technology, to screen new therapeutic targets and potential biomarkers. However, due to the different samples, different control groups, and small sample sizes, the sequencing results obtained from different studies are quite different and lack reliability. It is necessary to analyze the existing datasets in a reasonable way.<h4>Methods</h4>Datasets about keloid were filtered in Gene Expression Omnibus (GEO) and ArrayExpress databases according to the inclusion and exclusion criteria. The discovery datasets were used for summarizing significant DEGs, and the validation datasets were to validate the mRNA and miRNA expression levels. The Encyclopedia of RNA Interactomes (ENCORI) online platform was used to predict the interactions between miRNAs and their target mRNAs. Protein-protein interaction network (PPI network) analysis and functional enrichment analysis were conducted. miRNA-mRNA network was established by Cytoscape software and verified in keloid tissue (<i>n</i> = 8) by RT-qPCR. miR-29a-3p mimic and inhibitor were transfected into keloid fibroblasts (KFs) to preliminary verify its targets, the prognostic value of which was estimated by the receiver operating characteristic (ROC) curve.<h4>Results</h4>A total of 6 datasets involving 20 patients were included. 15 miRNAs and 12 target mRNAs were identified as potential biomarkers for keloid patients. The RT-qPCR results showed that miR-29a-3p, miR-92a-3p, and miR-143-3p were downregulated, and all their target mRNAs were upregulated in keloid tissue (<i>P</i> < 0.05). The expression of COL1A1, COL1A2, COL3A1, COL5A1, and COL5A2 decreased when miR-29a-3p was overexpressed but increased when miR-29a-3p was knocked down (<i>P</i> < 0.05). And these genes had a good performance in the diagnosis of keloid, especially when using keloid nonlesional skin or normal scar tissues as controls.<h4>Conclusion</h4>The miRNA-mRNA network, especially miR-29a-3p and its targets, may provide insights into the underlying pathogenesis of keloid and serve as potential biomarkers for keloid treatment.

Also flagged:Lewy body dementiadementiaADpathogenesiscognitive declineExtracellular
Journal Article 2022-07-13 No Snippets Palmieri I, Poloni TE, Medici V, Zucca S, Davin A, Pansarasa O, Ceroni M, Tronconi L, Guaita A, Gagliardi S, Cereda C.
Show Full Abstract

Alzheimer's disease (AD) and Lewy body dementia (LBD) are two different forms of dementia, but their pathology may involve the same cortical areas with overlapping cognitive manifestations. Nonetheless, the clinical phenotype is different due to the topography of the lesions driven by the different underlying molecular processes that arise apart from genetics, causing diverse neurodegeneration. Here, we define the commonalities and differences in the pathological processes of dementia in two kindred cases, a mother and a son, who developed classical AD and an aggressive form of AD/LBD, respectively, through a neuropathological, genetic (next-generation sequencing), and transcriptomic (RNA-seq) comparison of four different brain areas. A genetic analysis did not reveal any pathogenic variants in the principal AD/LBD-causative genes. RNA sequencing highlighted high transcriptional dysregulation within the substantia nigra in the AD/LBD case, while the AD case showed lower transcriptional dysregulation, with the parietal lobe being the most involved brain area. The hippocampus (the most degenerated area) and basal ganglia (lacking specific lesions) expressed the lowest level of dysregulation. Our data suggest that there is a link between transcriptional dysregulation and the amount of tissue damage accumulated across time, assessed through neuropathology. Moreover, we highlight that the molecular bases of AD and LBD follow very different pathways, which underlie their neuropathological signatures. Indeed, the transcriptome profiling through RNA sequencing may be an important tool in flanking the neuropathological analysis for a deeper understanding of AD and LBD pathogenesis.

Also flagged:fertilizationembryoreproductionembryogenesistranslationalplacentation
Journal Article 2022-07-13 No Snippets Dvoran M, Nemcova L, Kalous J.
Show Full Abstract

Germ cell quality is a key prerequisite for successful fertilization and early embryo development. The quality is determined by the fine regulation of transcriptomic and proteomic profiles, which are prone to alteration by assisted reproduction technology (ART)-introduced in vitro methods. Gaining evidence shows the ART can influence preset epigenetic modifications within cultured oocytes or early embryos and affect their developmental competency. The aim of this review is to describe ART-determined epigenetic changes related to the oogenesis, early embryogenesis, and further in utero development. We confront the latest epigenetic, related epitranscriptomic, and translational regulation findings with the processes of meiotic maturation, fertilization, and early embryogenesis that impact the developmental competency and embryo quality. Post-ART embryo transfer, in utero implantation, and development (placentation, fetal development) are influenced by environmental and lifestyle factors. The review is emphasizing their epigenetic and ART contribution to fetal development. An epigenetic parallel among mouse, porcine, and bovine animal models and human ART is drawn to illustrate possible future mechanisms of infertility management as well as increase the awareness of the underlying mechanisms governing oocyte and embryo developmental complexity under ART conditions.

Also flagged:COVID-19Coronavirus disease 2019infectionacute-phase responseblood coagulationcell adhesion
Journal Article 2022-07-13 ✓ 1 Snippet Nuñez E, Orera I, Carmona-Rodríguez L, Paño JR, Vázquez J, Corrales FJ.
In-Text Gene Mentions

…of FBLN1, FGA,SERPINC1and IGFALS that…

Show Full Abstract

Coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), whose outbreak in 2019 led to an ongoing pandemic with devastating consequences for the global economy and human health. According to the World Health Organization, COVID-19 has affected more than 481 million people worldwide, with 6 million confirmed deaths. The joint efforts of the scientific community have undoubtedly increased the pace of production of COVID-19 vaccines, but there is still so much uncharted ground to cover regarding the mechanisms of SARS-CoV-2 infection, replication and host response. These issues can be approached by proteomics with unprecedented capacity paving the way for the development of more efficient strategies for patient care. In this study, we present a deep proteome analysis that has been performed on a cohort of 72 COVID-19 patients aiming to identify serum proteins assessing the dynamics of the disease at different age ranges. A panel of 53 proteins that participate in several functions such as acute-phase response and inflammation, blood coagulation, cell adhesion, complement cascade, endocytosis, immune response, oxidative stress and tissue injury, have been correlated with patient severity, suggesting a molecular basis for their clinical stratification. Eighteen protein candidates were further validated by targeted proteomics in an independent cohort of 84 patients including a group of individuals that had satisfactorily resolved SARS-CoV-2 infection. Remarkably, all protein alterations were normalized 100 days after leaving the hospital, which further supports the reliability of the selected proteins as hallmarks of COVID-19 progression and grading. The optimized protein panel may prove its value for optimal severity assessment as well as in the follow up of COVID-19 patients.

Also flagged:Cisplatinplatinumtaxaneserous ovarian carcinomaovarian cancercell proliferation
Journal Article 2022-07-13 ✓ 1 Snippet Noriega-Rivera R, Rivera-Serrano M, Rabelo-Fernandez RJ, Pérez-Santiago J, Valiyeva F, Vivas-Mejía PE.
In-Text Gene Mentions

…, TP53 ,SOX6, NFYA ,…

Show Full Abstract

Despite initial responses to first-line treatment with platinum and taxane-based combination chemotherapy, most high-grade serous ovarian carcinoma (HGSOC) patients will relapse and eventually develop a cisplatin-resistant fatal disease. Due to the lethality of this disease, there is an urgent need to develop improved targeted therapies against HGSOC. Herein, we identified CASC10, a long noncoding RNA upregulated in cisplatin-resistant ovarian cancer cells and ovarian cancer patients. We performed RNA sequencing (RNA-seq) in total RNA isolated from the HGSOC cell lines OVCAR3 and OV-90 and their cisplatin-resistant counterparts. Thousands of RNA transcripts were differentially abundant in cisplatin-sensitive vs. cisplatin-resistant HGSOC cells. Further data filtering unveiled CASC10 as one of the top RNA transcripts significantly increased in cisplatin-resistant compared with cisplatin-sensitive cells. Thus, we focused our studies on CASC10, a gene not previously studied in ovarian cancer. SiRNA-mediated CASC10 knockdown significantly reduced cell proliferation and invasion; and sensitized cells to cisplatin treatment. SiRNA-mediated CASC10 knockdown also induced apoptosis, cell cycle arrest, and altered the expression of several CASC10 downstream effectors. Multiple injections of liposomal CASC10-siRNA reduced tumor growth and metastasis in an ovarian cancer mouse model. Our results demonstrated that CASC10 levels mediate the susceptibility of HGSOC cells to cisplatin treatment. Thus, combining siRNA-mediated CASC10 knockdown with cisplatin may represent a plausible therapeutic strategy against HGSOC.

Also flagged:metabolismlipidliver diseasecirrhosischolesteroltriglycerides
Journal Article 2022-07-13 ✓ 1 Snippet Casas-Deza D, Martínez-Sapiña A, Espina S, Garcia-Rodriguez B, Fernandez-Bonilla EM, Sanz-Paris A, Gonzalez-Irazabal Y, Bernal-Monterde V, Arbones-Mainar JM.
In-Text Gene Mentions

…diseases, Wilson’s disease,hemochromatosis, or autoimmune hepatitis…

Show Full Abstract

<h4>Background</h4>Hepatitis C virus (HCV) produces changes at multiple levels in host metabolism, especially in lipid profile and cardio-metabolic risk. It is unclear how HCV eradication by direct-acting antivirals (DAAs) modifies those changes.<h4>Objective</h4>To evaluate the impact of DAA treatment on different risk factors associated with cardiovascular disease.<h4>Methods</h4>Prospective study with two-year follow-up. All patients treated with DAAs in the Liver Clinic of a tertiary hospital were included. Patients co-infected with HBV or HIV, with other causes of liver disease, on lipid-lowering treatment, pregnant, or with previous HCV treatment were excluded. The results were analyzed using linear mixed models.<h4>Results</h4>167 patients (53% female, 9.6% cirrhosis) were included. Low plasma lipid levels were observed before initiating HCV eradication. During the first year after treatment with DAA, we observed a sustained increase in cholesterol, triglycerides, HDL cholesterol (only in men), and LDL-cholesterol levels. An ameliorated glycemic control was also observed with a decrease in fasting insulin and reduced HOMA. Iron metabolism and coagulation function also improved with lower levels of serum ferritin and prothrombin activity; these biochemical changes resulted in a new diagnosis of hypercholesterolaemia in 17.4% of patients, requiring initiation of statins in 15%. Two non-fatal cardiovascular events were observed during the first 2 years of follow-up.<h4>Conclusions</h4>DAA treatments returned plasma lipids to the normal range without increasing either the occurrence of cardiovascular events or the consumption of lipid-lowering medication beyond what is normal in a sex- and age-matched population.

Also flagged:ginsenosidesmatKnucleotidesnucleotidereproductionspindle
Journal Article 2022-07-13 No Snippets Le HTT, Nguyen LN, Pham HLB, Le HTM, Luong TD, Huynh HTT, Nguyen VT, Nong HV, Teixidor-Toneu I, De Boer HJ, Manzanilla V.
Show Full Abstract

The global market of the medicinal plant ginseng is worth billions of dollars. Many ginseng species are threatened in the wild and effective sustainable development initiatives are necessary to preserve biodiversity at species and genetic level whilst meeting the demand for medicinal produce. This is also the case of <i>Panax vietnamensis</i> Ha & Grushv., an endemic and threatened ginseng species in Vietnam that is locally cultivated at different scales and has been the object of national breeding programs. To investigate the genetic diversity within cultivated and wild populations of <i>P. vietnamensis</i> we captured 353 nuclear markers using the Angiosperm-353 probe set. Genetic diversity and population structure were evaluated for 319 individuals of Vietnamese ginseng across its area of distribution and from wild and a varying range of cultivated areas. In total, 319 individuals were sampled. After filtering, 1,181 SNPs were recovered. From the population statistics, we observe high genetic diversity and high genetic flow between populations. This is also supported by the STRUCTURE analysis. The intense gene flow between populations and very low genetic differentiation is observed regardless of the populations' wild or cultivated status. High levels of admixture from two ancestral populations exist in both wild and cultivated samples. The high gene flow between populations can be attributed to ancient and on-going practices of cultivation, which exist in a continuum from understorey, untended breeding to irrigated farm cultivation and to trade and exchange activities. These results highlight the importance of partnering with indigenous peoples and local communities and taking their knowledge into account for biodiversity conservation and sustainable development of plants of high cultural value.

Also flagged:Severe Acute Respiratory SyndromeCOVID-19cognitive impairmentmotor disordersinfectionACE2
Journal Article 2022-07-13 No Snippets Mesmoudi S, Lapina C, Rodic M, Peschanski D.
Show Full Abstract

As the COVID-19 pandemic continues to unfold, numerous neurological symptoms emerge. The literature reports more and more manifestations of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) related to headache, dizziness, impaired consciousness, cognitive impairment, and motor disorders. Moreover, the infection of SARS-CoV-2 may have a durable neurological impact. ACE2/TMPRSS2 is the main entry point into cells for some strains of coronaviruses (CoVs), including SARS-CoV-2, which uses it to target the central nervous system (CNS). The aim of this study was to characterize the scope of the potential complex impact of a SARS-CoV-2 infection in the brain. It concerns different scales: the topographic, cognitive, sensorimotor, and genetic one. We investigated which cognitive and sensorimotor functions are associated with the brain regions where ACE2/TMPRSS2 is overexpressed, hypothesising that they might be particularly affected by the infection. Furthermore, overexpressed genes in these regions are likely to be impacted by COVID-19. This general understanding is crucial to establish the potential neurological manifestations of the infection. Data on mRNA expression levels of genes were provided by the Allen Institute for Brain Science (AIBS), and the localisation of brain functions by the LinkRbrain platform. The latter was also used to analyze the spatial overlap between ACE2/TMPRSS2 overexpression, and either function-specific brain activations or regional overexpression of other genes. The characterisation of these overexpressed genes was based on the GeneCards platform and the gene GSE164332 from the Gene Expression Omnibus database. We analysed the cognitive and sensorimotor functions whose role might be impaired, of which 88 have been categorised into seven groups: memory and recollection, motor function, pain, lucidity, emotion, sensory, and reward. Furthermore, we categorised the genes showing a significant increase in concentration of their mRNAs in the same regions where ACE2/TMPRSS2 mRNA levels are the highest. Eleven groups emerged from a bibliographical research: neurodegenerative disease, immunity, inflammation, olfactory receptor, cancer/apoptosis, executive function, senses, ischemia, motor function, myelination, and dependence. The results of this exploration could be in relation to the neurological symptoms of COVID-19. Furthermore, some genes from peripheral blood are already considered as biomarker of COVID-19. This method could generate new hypotheses to explore the neurological manifestations of COVID-19.

Also flagged:C-Type Lectin Receptorshead and neck canceresophageal cancergastric cancercolorectal cancerhepatocellular carcinoma
Journal Article 2022-07-13 ✓ 1 Snippet Zhang L, Chai D, Chen C, Li C, Qiu Z, Kuang T, Parveena M, Dong K, Yu J, Deng W, Wang W.
In-Text Gene Mentions

DC, dendritic cells; AA, arachidonic acid; Syk, spleen tyrosine kinase; P47phox, neutrophil cytosolic factor 1; HETE, the 12- and 15-hydroxyeicosatrienoic acids; PPARγ, peroxisome proliferator-activated receptor-gamma; IRF5, interferon regulatory factor 5; INAM, family with sequence similarity 26 member F; TLR4, Toll-like receptor 4; Raf1, raf-1 proto-oncogene, serine/threonine kinase; IRF4, interferon regulatory factor 4; IL, interleukin; TNFSF15, tumor necrosis factor ligand superfamily member 15; TNFSF4, tumor necrosis factor ligand superfamily member 4; TGF-β, transforming growth factor-beta 1.

Show Full Abstract

Numerous studies have demonstrated the importance of gut bacteria in the development of malignancy, while relatively little research has been done on gut mycobiota. As a part of the gut microbiome, the percentage of gut mycobiota is negligible compared to gut bacteria. However, the effect of gut fungi on human health and disease is significant. This review systematically summarizes the research progress on mycobiota, especially gut fungi, in patients with head and neck cancer (HNC), esophageal cancer (EC), gastric cancer (GC), colorectal cancer (CRC), hepatocellular carcinoma (HCC), pancreatic cancer, melanoma, breast cancer, and lung carcinoma-induced cachexia. Moreover, we also describe, for the first time in detail, the role of the fungal recognition receptors, C-type lectin receptors (CLRs) (Dectin-1, Dectin-2, Dectin-3, and Mincle) and their downstream effector caspase recruitment domain-containing protein 9 (CARD9), in tumors to provide a reference for further research on intestinal fungi in the diagnosis and treatment of malignant tumors.

Also flagged:Friedreich AtaxiaFRDAglucoseextracellularorganizationadhesion molecules
Journal Article 2022-07-13 No Snippets Imbault V, Dionisi C, Naeije G, Communi D, Pandolfo M.
Show Full Abstract

Clinical trials in rare diseases as Friedreich ataxia (FRDA) offer special challenges, particularly when multiple treatments become ready for clinical testing. Regulatory health authorities have developed specific pathways for "orphan" drugs allowing the use of a validated biomarker for initial approval. This study aimed to identify changes in cerebrospinal fluid (CSF) proteins occurring in FRDA patients that may be potential biomarkers in therapeutic trials. CSF was obtained from 5 FRDA patients (4 females, 1 male) from the Brussels site of the European Friedreich Ataxia Consortium for Translational Studies (EFACTS). Two patients were ambulatory, three used a wheelchair. Residual CSF samples from 19 patients who had had a lumbar puncture as part of a diagnostic workup were used as controls. All CSF samples had normal cells, total protein and glucose levels. Proteins were identified by label-free data-dependent acquisition mass spectrometry (MS) coupled to micro-high performance liquid chromatography. We found 172 differentially expressed proteins (DEPs) (92 up, 80 down) between FRDA patients and controls at <i>P</i> < 0.05, 34 DEPs (28 up, 6 down) at <i>P</i> < 0.0001. Remarkably, there was no overlap between FRDA patients and controls for seven upregulated and six downregulated DEPs. Represented pathways included extracellular matrix organization, signaling, the complement cascade, adhesion molecules, synaptic proteins, neurexins and neuroligins. This study supports the hypothesis that the quantitative analysis CSF proteins may provide robust biomarkers for clinical trials as well as shed light on pathogenic mechanisms. Interestingly, DEPs in FA patients CSF point to neurodegeneration and neuroinflammation processes that may respond to treatment.

Also flagged:Angiotensin-Converting Enzyme IISevere Acute Respiratory SyndromeCOVID-19Infectiongrapheneplatinum
Journal Article 2022-07-13 No Snippets Moreira G, Casso-Hartmann L, Datta SPA, Dean D, McLamore E, Vanegas D.
Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the novel coronavirus responsible for COVID-19. Infection in humans requires angiotensin-converting enzyme II (hACE2) as the point of entry for SARS-CoV-2. PCR testing is generally definitive but expensive, although it is highly sensitive and accurate. Biosensor-based monitoring could be a low-cost, accurate, and non-invasive approach to improve testing capacity. We develop a capacitive hACE2 biosensor for intact SARS-CoV-2 detection in saliva. Laser-induced graphene (LIG) electrodes were modified with platinum nanoparticles. The quality control of LIG electrodes was performed using cyclic voltammetry. Truncated hACE2 was used as a biorecognition element and attached to the electrode surface by streptavidin-biotin coupling. Biolayer interferometry was used for qualitative interaction screening of hACE2 with UV-attenuated virions. Electrochemical impedance spectroscopy (EIS) was used for signal transduction. Truncated hACE2 binds wild-type SARS-CoV-2 and its variants with greater avidity than human coronavirus (common cold virus). The limit of detection (LoD) is estimated to be 2,960 copies/ml. The detection process usually takes less than 30 min. The strength of these features makes the hACE2 biosensor a potentially low-cost approach for screening SARS-CoV-2 in non-clinical settings with high demand for rapid testing (for example, schools and airports).

Also flagged:AndrographolideCoagulationNF-κBfibrinolysisacute respiratory distress syndromeARDS
Journal Article 2022-07-13 ✓ 5 Snippets Yang G, Li X, Li Q, Xiao C, Qian H, Yang H, Shen F.
In-Text Gene Mentions

…(PIIIP), antithrombin III (ATIII) and activated protein…

…PIIIP but promotedATIIIand APC secretions…

…(PIIIP), antithrombin III (ATIII), activated protein C…

…PIIIP but PromotesATIIIand APC Secretions…

…of antithrombin III (ATIII) to decrease from…

Show Full Abstract

<h4>Background</h4>Andrographolide (Andro) has been confirmed to ameliorate alveolar hypercoagulation and fibrinolysis inhibition via NF-κB pathway in acute respiratory distress syndrome (ARDS), but the specific target of Andro is unknown.<h4>Purpose</h4>Our aim is to explore the specific target of Andro through which the drug exerted its effects on alveolar hypercoagulation and fibrinolytic inhibition in LPS-induced ARDS.<h4>Methods</h4>AECII was treated with different doses of Andro for 1 h, and then stimulated with LPS for 24 h. Expressions of tissue factor (TF), plasminogen activator inhibitor (PAI)-1 and tissue factor pathway inhibitor (TFPI) were detected. Concentrations of thrombin-antithrombin complex (TAT), pro-collagen type III peptide (PIIIP), antithrombin III (ATIII) and activated protein C (APC) in cell supernatant were measured by enzyme linked immunosorbent assay (ELISA). NF-κB signaling pathways activation was simultaneously determined. AECII with p65 down-/over-expression were used as control.<h4>Results</h4>Andro effectively inhibited TF and PAI-1 and promoted TFPI expressions on AECII induced by LPS stimulation. Andro also significantly suppressed the productions of TAT and PIIIP but promoted ATIII and APC secretions from the LPS-treated cell. Furthermore, Andro application obviously inhibited NF-κB signaling pathway activation provoked by LPS, as shown by decreased level of phosphorylation (p‑)-IKKβ/IKKβ, p-p65/p65 and p65 DNA binding activity. The effects of Andro on those factors were obviously strengthened by down- but were weakened by up-regulation of p65 gene in AECII cell.<h4>Conclusions</h4>Our data demonstrates that targeting AECII is the mechanism by which Andro ameliorates alveolar hypercoagulaiton and fibrinolytic inhibition via NF-κB pathway in ARDS. Andro is worth to be clinically further studied in ARDS treatment.

SSRN 2022-07-13 Preprint (No Snippets API) Nesteruk I.
Show Full Abstract

Objectives: Record numbers of new cases and deaths registered in Japan and European countries in early 2022 once again proved that existing vaccines cannot stop the new infections and deaths caused by SARS-CoV-2 and aroused new questions about methods of overcoming the pandemic. The pandemic waves in Japan, Ukraine, USA, Hong Kong, mainland China, European and African countries in 2020, 2021, 2022 will be compared. Possible influence of testing and vaccination levels will be investigated.Study designStatistical and comparative analysis based on the data available in internet.<br><br>Methods: The smoothed daily numbers of new cases and deaths per capita, the ratio of these characteristics and the non-linear correlation with the tests per case ratio were used.<br><br>Results: As in other countries, the deaths per case ratio in Japan decreases with the increase of the vaccination level. Non-linear correlation revealed, that the daily number of new cases drastically decreases with the increase of the tests per case ratio.<br><br>Conclusions: Increasing the level of testing (especially for people who may have contact with infected persons) and adhering to quarantine restrictions for the entire population, including vaccinated people, may be recommended to end the pandemic.<br><br>Funding Information: This work was not supported by any funding. <br><br>Declaration of Interests: The author declares no conflict of interest.<br>

Also flagged:Krüppel-like factortranscription factorsosteoarthritisOAKLF4gene expression
Journal Article 2022-07-12 ✓ 1 Snippet Kawata M, Teramura T, Ordoukhanian P, Head SR, Natarajan P, Sundaresan A, Olmer M, Asahara H, Lotz MK.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Objectives</h4>Analysing expression patterns of Krüppel-like factor (KLF) transcription factors in normal and osteoarthritis (OA) human cartilage, and determining functions and mechanisms of KLF4 and KLF2 in joint homoeostasis and OA pathogenesis.<h4>Methods</h4>Experimental approaches included human joint tissues cells, transgenic mice and mouse OA model with viral KLF4 gene delivery to demonstrate therapeutic benefit in structure and pain improvement. Mechanistic studies applied global gene expression analysis and chromatin immunoprecipitation sequencing (ChIP-seq).<h4>Results</h4>Several KLF genes were significantly decreased in OA cartilage. Among them, KLF4 and KLF2 were strong inducers of cartilage collagen genes and Proteoglycan-4. Cartilage-specific deletion of <i>Klf2</i> in mature mice aggravated severity of experimental OA. Transduction of human chondrocytes with Adenovirus (Ad) expressing KLF4 or KLF2 enhanced expression of major cartilage extracellular matrix (ECM) genes and SRY-box transcription factor-9, and suppressed mediators of inflammation and ECM-degrading enzymes. Ad-KLF4 and Ad-KLF2 enhanced similar protective functions in meniscus cells and synoviocytes, and promoted chondrocytic differentiation of human mesenchymal stem cells. Viral KLF4 delivery into mouse knees reduced severity of OA-associated changes in cartilage, meniscus and synovium, and improved pain behaviours. ChIP-seq analysis suggested that KLF4 directly bound cartilage signature genes. Ras-related protein-1 signalling was the most enriched pathway in KLF4-transduced cells, and its signalling axis was involved in upregulating cartilage ECM genes by KLF4 and KLF2.<h4>Conclusions</h4>KLF4 and KLF2 may be central transcription factors that increase protective and regenerative functions in joint tissue cells, suggesting that KLF gene transfer or molecules upregulating KLFs are therapeutic candidates for OA.

Also flagged:carbonphotosynthesiswaterphotorespirationcarboxylationcarboxylase
Journal Article 2022-07-12 No Snippets Faber AH, Griffin KL, Tjoelker MG, Pagter M, Yang J, Bruhn D.
Show Full Abstract

Leaf daytime respiration (leaf respiration in the light, R<sub>L</sub> ) is often assumed to constitute a fixed fraction of leaf dark respiration (R<sub>D</sub> ) (i.e. a fixed light inhibition of respiration (R<sub>D</sub> )) and vary diurnally due to temperature fluctuations. These assumptions were tested by measuring R<sub>L</sub> , R<sub>D</sub> and the light inhibition of R<sub>D</sub> in the field at a constant temperature using the Kok method. Measurements were conducted diurnally on 21 different species: 13 deciduous, four evergreen and four herbaceous from humid continental and humid subtropical climates. R<sub>L</sub> and R<sub>D</sub> showed significant diurnal variations and the diurnal pattern differed in trajectory and magnitude between climates, but not between plant functional types (PFTs). The light inhibition of R<sub>D</sub> varied diurnally and differed between climates and in trajectory between PFTs. The results highlight the entrainment of leaf daytime respiration to the diurnal cycle and that time of day should be accounted for in studies seeking to examine the environmental and biological drivers of leaf daytime respiration.

Also flagged:translationallipidneurological disordersProtein S-palmitoylationde-palmitoylating
Journal Article 2022-07-12 ✓ 1 Snippet Wild AR, Hogg PW, Flibotte S, Nasseri GG, Hollman RB, Abazari D, Haas K, Bamji SX.
In-Text Gene Mentions

…S -palmitoylation ofHTTin Huntington’s disease…

Show Full Abstract

Protein <i>S</i>-palmitoylation is a reversible post-translational lipid modification that plays a critical role in neuronal development and plasticity, while dysregulated <i>S</i>-palmitoylation underlies a number of severe neurological disorders. Dynamic <i>S</i>-palmitoylation is regulated by a large family of ZDHHC palmitoylating enzymes, their accessory proteins, and a small number of known de-palmitoylating enzymes. Here, we curated and analyzed expression data for the proteins that regulate <i>S</i>-palmitoylation from publicly available RNAseq datasets, providing a comprehensive overview of their distribution in the mouse nervous system. We developed a web-tool that enables interactive visualization of the expression patterns for these proteins in the nervous system (http://brainpalmseq.med.ubc.ca/), and explored this resource to find region and cell-type specific expression patterns that give insight into the function of palmitoylating and de-palmitoylating enzymes in the brain and neurological disorders. We found coordinated expression of ZDHHC enzymes with their accessory proteins, de-palmitoylating enzymes and other brain-expressed genes that included an enrichment of <i>S</i>-palmitoylation substrates. Finally, we utilized ZDHHC expression patterns to predict and validate palmitoylating enzyme-substrate interactions.

Also flagged:IL-24IL-10cell surfacemitochondrialmembraneNADH dehydrogenase (ubiquinone) 1 α subcomplex subunit 13
Journal Article 2022-07-12 ✓ 1 Snippet Sie C, Kant R, Peter C, Muschaweckh A, Pfaller M, Nirschl L, Moreno HD, Chadimová T, Lepennetier G, Kuhlmann T, Öllinger R, Engleitner T, Rad R, Korn T.
In-Text Gene Mentions

…Bdh2 , Mm00459075_m1;Cdk5rap1, Mm00482296_m1; Fcmr…

Show Full Abstract

In certain instances, Th17 responses are associated with severe immunopathology. T cell-intrinsic mechanisms that restrict pathogenic effector functions have been described for type 1 and 2 responses but are less well studied for Th17 cells. Here, we report a cell-intrinsic feedback mechanism that controls the pathogenicity of Th17 cells. Th17 cells produce IL-24, which prompts them to secrete IL-10. The IL-10-inducing function of IL-24 is independent of the cell surface receptor of IL-24 on Th17 cells. Rather, IL-24 is recruited to the inner mitochondrial membrane, where it interacts with the NADH dehydrogenase (ubiquinone) 1 α subcomplex subunit 13 (also known as Grim19), a constituent of complex I of the respiratory chain. Together, Grim19 and IL-24 promote the accumulation of STAT3 in the mitochondrial compartment. We propose that IL-24-guided mitochondrial STAT3 constitutes a rheostat to blunt extensive STAT3 deflections in the nucleus, which might then contribute to a robust IL-10 response in Th17 cells and a restriction of immunopathology in experimental autoimmune encephalomyelitis.

Also flagged:TBK1IFN-αMAVSIFN-βGAPDHIRF3
Journal Article 2022-07-12 ✓ 1 Snippet Liu W, Ma Z, Wu Y, Yuan C, Zhang Y, Liang Z, Yang Y, Zhang W, Jiao P.
In-Text Gene Mentions

…ditary hemochromatosis proteinHFEinhibits the production…

Show Full Abstract

<h4>Background</h4>Cytosolic RNA sensing can elicit immune responses against viral pathogens. However, antiviral responses must be tightly regulated to avoid the uncontrolled production of type I interferons (IFN) that might have deleterious effects on the host. Upon bacterial infection, the germinal center kinase MST4 can directly phosphorylate the adaptor TRAF6 to limit the inflammatory responses, thereby avoiding the damage caused by excessive immune activation. However, the molecular mechanism of how MST4 regulates virus-mediated type I IFN production remains unknown.<h4>Methods</h4>The expression levels of IFN-β, IFIT1, and IFIT2 mRNA were determined by RT-PCR. The expression levels of p-IRF3, IRF3, RIG-I, MAVS, and MST4 proteins were determined by Western blot. The effect of secreted level of IFN-β was measured by ELISA. The relationship between MST4 and MAVS was investigated by immunofluorescence staining and coimmunoprecipitation.<h4>Results</h4>In this study, we reported that MST4 can act as a negative regulator of type I IFN production. Ectopic expression of MST4 suppressed the Poly (I:C) (polyino-sinic-polycytidylic acid)- and Sendai virus (SeV)-triggered production of type I IFN, while the knockdown of MST4 enhanced the production of type I IFN. Mechanistically, upon SeV infection, the MST4 competed with TRAF3 to bind to the 360-540 domain of MAVS, thereby inhibiting the TRAF3/MAVS association. Additionally, MST4 facilitated the interaction between the E3 ubiquitin ligase Smurf1 and MAVS. This promoted the K48-linked ubiquitination of MAVS, thereby accelerating the ubiquitin-mediated proteasome degradation of MAVS.<h4>Conclusions</h4>Our findings showed that MST4 acted as a crucial negative regulator of RLR-mediated type I IFN production. Video Abstract.

Also flagged:cognitive declineintraventricular hemorrhagesubarachnoid hemorrhagecognitive impairmentbehavioralwater
Journal Article 2022-07-12 ✓ 1 Snippet Puglisi CH, Ander BP, Peterson C, Keiter JA, Hull H, Hawk CW, Kalistratova VS, Izadi A, Gurkoff GG, Sharp FR, Waldau B.
In-Text Gene Mentions

Dcc

Show Full Abstract

The mechanisms of cognitive decline after intraventricular hemorrhage (IVH) in some patients continue to be poorly understood. Multiple rodent models of intraventricular or subarachnoid hemorrhage have only shown mild or even no cognitive impairment on subsequent behavioral testing. In this study, we show that intraventricular hemorrhage only leads to a significant spatial memory deficit in the Morris water maze if it occurs in the setting of an elevated intracranial pressure (ICP). Histopathological analysis of these IVH + ICP animals did not show evidence of neuronal degeneration in the hippocampal formation after 2 weeks but instead showed significant microglial activation measured by lacunarity and fractal dimensions. RNA sequencing of the hippocampus showed distinct enrichment of genes in the IVH + ICP group but not in IVH alone having activated microglial signaling pathways. The most significantly activated signaling pathway was the classical complement pathway, which is used by microglia to remove synapses, followed by activation of the Fc receptor and DAP12 pathways. Thus, our study lays the groundwork for identifying signaling pathways that could be targeted to ameliorate behavioral deficits after IVH.

Also flagged:ageingmacroautophagyautophagyagingSORBS3F-actin
Journal Article 2022-07-12 No Snippets Park SJ, Frake RA, Rubinsztein DC.
Show Full Abstract

Impaired autophagosome formation and reduced flux through the macroautophagy/autophagy pathway occurs outside the brain as part of normal aging in various species. We recently identified autophagic decline in mouse brain tissue dependent on aging. This sits alongside significantly increased expression of the <i>Sorbs3/SORBS3/vinexin</i> (sorbin and SH3 domain containing 3) gene in older mouse and human brains. We found that SORBS3 negatively regulates autophagy in several cell lines, including mouse primary neurons. SORBS3 depletion increases F-actin structures, which compete with YAP1-WWTR1/TAZ to bind AMOT (angiomotin) proteins in the cytosol. Unbound YAP1-WWTR1/TAZ is free to move into the nucleus and upregulate YAP1-WWTR1/TAZ target gene expression. This upregulates autophagosome formation, in part through increased expression of myosin- and actin-related genes. Moreover, we have shown these YAP1-WWTR1/TAZ target genes are downregulated in older mouse and human brains. Taken together, our findings suggest that increased <i>SORBS3</i> expression contributes to autophagic decline in normal brain aging across species.

Also flagged:Lung adenocarcinomaLUADmetastatic malignant tumorstaurosporinehydrogenSLC2A1
Journal Article 2022-07-12 ✓ 3 Snippets Wang Z, Liu Y, Zhan X, Wang X, Zhang C, Qin L, Liu L, Qin S.
In-Text Gene Mentions

…(PD-L1), PDCD1LG2 (PD-L2),TNFSF4/7/9, TNFRSF9 and IDO1(…

…(PD-L1), PDCD1LG2 (PD-L2),TNFSF4/7/9, TNFRSF9 and IDO1.…

…(PD-L1), PDCD1LG2 (PD-L2),TNFSF4/7/9, TNFRSF9 and IDO1…

Show Full Abstract

Lung adenocarcinoma (LUAD) is a highly invasive and metastatic malignant tumor with high morbidity and mortality. This study aimed to construct a prognostic signature for LUAD patients based on metastasis-associated genes (MAGs). RNA expression profiles were downloaded from the Cancer Genome Atlas (TCGA) database. RRA method was applied to identify differentially expressed MAGs. A total of 192 significantly robust MAGs were determined among seven GEO datasets. MAGs were initially selected through the Lasso Cox regression analysis and 6 MAGs were included to construct a prognostic signature model. Transcriptome profile, patient prognosis, correlation between the risk score and clinicopathological features, immune cell infiltration characteristics, immunotherapy sensitivity and chemotherapy sensitivity differed between low- and high-risk groups after grouping according to median risk score. The reliability and applicability of the signature were further validated in the GSE31210, GSE50081 and GSE68465 cohort. CMap predicted 62 small molecule drugs on the base of the prognostic MAGs. Targeted drug staurosporine had hydrogen bonding with Gln-172 of SLC2A1, which is one of MAGs. Staurosporine could inhibit cell migration in A549 and H1299. We further verified mRNA and protein expression of 6 MAGs in A549 and H1299. The signature can serve as a promising prognostic tool and may provide a novel personalized therapeutic strategy for LUAD patients.

Also flagged:orbital inflammatory diseaseAPOA1TransferrinVCC1NUCB2E-cadherin
Journal Article 2022-07-12 ✓ 2 Snippets Zhou X, Wei R, Wang R.
In-Text Gene Mentions

…a-1-antitrypsin (SERPINA1) andantithrombin-III(SERPINC1) ( Fig.…

…RPINA1) and antithrombin-III (SERPINC1) ( Fig. 6…

Show Full Abstract

<h4>Background</h4>Thyroid-associated ophthalmopathy (TAO) is a common orbital inflammatory disease, but the abnormal expression of proteins in tears of TAO patients has not been systematically studied. The purpose of this study is to compare and analyze the total tear protein profile of TAO patients and to provide protein cues for TAO pathogenesis.<h4>Methods</h4>Tear samples were isolated from 30 TAO patients with obvious ocular surface damage and 30 healthy control subjects. Tear samples from 30 individuals were mixed and divided into three sample pools. Easy nano-scale LC-MS/MS based on labeling-free quantitative technology was utilized to profile tear proteome.<h4>Results</h4>Here, electrospray ionization mass spectra and SDS-PAGE results confirmed the good parallelisms among samples. A total of 313 proteins were obtained from six tear pools, among them, 103 differential abundance proteins (DAPs) were identified, including 99 up-regulated DAPs (including APOA1, HV103, IGH, and Transferrin variant) and four down-regulated DAPs (including FABA, VCC1, NUCB2, and E-cadherin) in the TAO group compared with the control group. GO analysis showed that up-regulated DAPs were mainly enriched in lipid metabolism and platelet molecular function, and down-regulated DAPs were involved in binding, cell junction, and cellular process. KEGG results indicated that DAPs were involved in 117 kinds of signal transduction pathways, among which the immune-related pathway of complement and coagulation cascades had the greatest relevance.<h4>Conclusion</h4>In conclusion, label-free LC-MS/MS is an effective strategy for profiling tear proteins component. Our study provides proteins and pathways altered in TAO and provides protein cues for further study on the precise mechanism of TAO pathogenesis.

Also flagged:immunoglobulinbindingprotein GGB1trifluoracetic acidhexafluoroisopropanol
Journal Article 2022-07-12 ✓ 5 Snippets Ceccon A, Tugarinov V, Torricella F, Clore GM.
In-Text Gene Mentions

CAG expansion within exon 1 of the huntingtin gene (HTT) is responsible for Huntington’s disease, a fatal, autosomal dominant neurodegenerative condition (1, –3).

…and Purification ofhttex1 Q 35…

httex1 Q 35…

…hromatography, the lyophilizedhttex1 Q 35…

…the aggregation ofhttex1 Q 35.…

Show Full Abstract

The N-terminal region of the huntingtin protein, encoded by exon-1 (htt<sup>ex1</sup>) and containing an expanded polyglutamine tract, forms fibrils that accumulate in neuronal inclusion bodies, resulting in Huntington's disease. We previously showed that reversible formation of a sparsely populated tetramer of the N-terminal amphiphilic domain, comprising a dimer of dimers in a four-helix bundle configuration, occurs on the microsecond timescale and is an essential prerequisite for subsequent nucleation and fibril formation that takes place orders of magnitude slower on a timescale of hours. For pathogenic htt<sup>ex1</sup>, such as htt<sup>ex1</sup>Q<sub>35</sub> with 35 glutamines, NMR signals decay too rapidly to permit measurement of time-intensive exchange-based experiments. Here, we show that quantitative analysis of both the kinetics and mechanism of prenucleation tetramerization and aggregation can be obtained simultaneously from a series of <sup>1</sup>H-<sup>15</sup>N band-selective optimized flip-angle short-transient heteronuclear multiple quantum coherence (SOFAST-HMQC) correlation spectra. The equilibria and kinetics of tetramerization are derived from the time dependence of the <sup>15</sup>N chemical shifts and <sup>1</sup>H-<sup>15</sup>N cross-peak volume/intensity ratios, while the kinetics of irreversible fibril formation are afforded by the decay curves of <sup>1</sup>H-<sup>15</sup>N cross-peak intensities and volumes. Analysis of data on htt<sup>ex1</sup>Q<sub>35</sub> over a series of concentrations ranging from 200 to 750 μM and containing variable (7 to 20%) amounts of the Met<sup>7</sup>O sulfoxide species, which does not tetramerize, shows that aggregation of native htt<sup>ex1</sup>Q<sub>35</sub> proceeds via fourth-order primary nucleation, consistent with the critical role of prenucleation tetramerization, coupled with first-order secondary nucleation. The Met<sup>7</sup>O sulfoxide species does not nucleate but is still incorporated into fibrils by elongation.

Also flagged:Systemic Lupus ErythematosusSLEimmune response-relatedantigen receptorT cell receptorcell differentiation
Journal Article 2022-07-12 No Snippets Xu L, Su X, Liu Z, Zhou A.
Show Full Abstract

<h4>Objective</h4>The present investigation is aimed at identifying key immune-related genes linked with SLE and their roles using integrative analysis of publically available gene expression datasets.<h4>Methods</h4>Four gene expression datasets pertaining to SLE, 2 from whole blood and 2 experimental PMBC, were sourced from GEO. Shared differentially expressed genes (DEG) were determined as SLE-related genes. Immune cell infiltration analysis was performed using CIBERSORT, and case samples were subjected to <i>k</i>-means cluster analysis using high-abundance immune cells. Key immune-related SLE genes were identified using correlation analysis with high-abundance immune cells and subjected to functional enrichment analysis for enriched Gene Ontology Biological Processes and KEGG pathways. A PPI network of genes interacting with the key immune-related SLE genes was constructed. LASSO regression analysis was performed to identify the most significant key immune-related SLE genes, and correlation with clinicopathological features was examined.<h4>Results</h4>309 SLE-related genes were identified and found functionally enriched in several pathways related to regulation of viral defenses and T cell functions. <i>k</i>-means cluster analysis identified 2 sample clusters which significantly differed in monocytes, dendritic cell resting, and neutrophil abundance. 65 immune-related SLE genes were identified, functionally enriched in immune response-related signaling, antigen receptor-mediated signaling, and T cell receptor signaling, along with Th17, Th1, and Th2 cell differentiation, IL-17, NF-kappa B, and VEGF signaling pathways. LASSO regression identified 9 key immune-related genes: DUSP7, DYSF, KCNA3, P2RY10, S100A12, SLC38A1, TLR2, TSR2, and TXN. Imputed neutrophil percentage was consistent with their expression pattern, whereas anti-Ro showed the inverse pattern as gene expression.<h4>Conclusions</h4>Comprehensive bioinformatics analyses revealed 9 key immune-related genes and their associated functions highly pertinent to SLE pathogenesis, subtypes, and identified valuable candidates for experimental research.

Also flagged:gastric cancercancerstumortumors-PD-1
Journal Article 2022-07-12 ✓ 1 Snippet Zhi S, Yang B, Zhou S, Tan J, Zhong G, Han F.
In-Text Gene Mentions

…PD-L2, CD276, TNFSF18,TNFSF4, and NRP1.…

Show Full Abstract

<h4>Background</h4>Gastric cancer is a prevalent cause of tumor death. Tumor immunotherapy aims to reshape the specific immunity to tumors in order to kill the tumor. LncRNAs play a pivotal role in regulating the tumor immune microenvironment. Herein, immune-related lncRNAs were used to establish a prognosis risk-assessment model for gastric cancer and provide personalized predictions while providing insights and targets for gastric cancer treatment to enhance patient prognosis.<h4>Methods</h4>Gastric adenocarcinoma transcriptome and clinical data were acquired from the The Cancer Genome Atlas (TCGA) database to screen the immune-related lncRNAs. Then, LASSO COX regression was utilized to construct the prognosis risk-assessment model. Afterward, the reliability of the model was evaluated the relationship between immune infiltration, clinical characteristics, and the model was analyzed.<h4>Results</h4>We identified 13 lncRNAs and constructed the prognosis assessment model. According to the median risk score of the training set, the patients were assigned to different risk groups. Overall survival time was shorter in the high-risk group. In the high-risk group, higher infiltration of mono-macrophages, dendritic cells, CD4+ T cells, and CD8+ T cells was observed. Moreover, the model was positively related to tumor metastasis.<h4>Conclusion</h4>The prognosis risk-assessment model developed in this research can effectively predict the prognosis of gastric cancer patients. This tool is expected to be further applied to clinics in the future, thus providing a novel target for immunotherapy in gastric cancer patients.

Also flagged:ReninAngiotensin SystemRASneurodegenerative diseasesHDbehavioral
Journal Article 2022-07-12 ✓ 3 Snippets Kangussu LM, Rocha NP, Valadão PAC, Machado TCG, Soares KB, Joviano-Santos JV, Latham LB, Colpo GD, Almeida-Santos AF, Furr Stimming E, Simões E Silva AC, Teixeira AL, Miranda AS, Guatimosim C.
In-Text Gene Mentions

Huntington′s disease (HD) is an autosomal-dominant neurodegenerative disease caused by an unstable CAG triplet sequence expansion in the huntingtin gene (Htt).

…the huntingtin gene (Htt) .…

…the huntingtin protein (HTT) [ 1 ,…

Show Full Abstract

The Renin-Angiotensin System (RAS) is expressed in the central nervous system and has important functions that go beyond blood pressure regulation. Clinical and experimental studies have suggested that alterations in the brain RAS contribute to the development and progression of neurodegenerative diseases. However, there is limited information regarding the involvement of RAS components in Huntington's disease (HD). Herein, we used the HD murine model, (BACHD), as well as samples from patients with HD to investigate the role of both the classical and alternative axes of RAS in HD pathophysiology. BACHD mice displayed worse motor performance in different behavioral tests alongside a decrease in the levels and activity of the components of the RAS alternative axis ACE2, Ang-(1-7), and Mas receptors in the striatum, prefrontal cortex, and hippocampus. BACHD mice also displayed a significant increase in mRNA expression of the AT1 receptor, a component of the RAS classical arm, in these key brain regions. Moreover, patients with manifest HD presented higher plasma levels of Ang-(1-7). No significant changes were found in the levels of ACE, ACE2, and Ang II. Our findings provided the first evidence that an imbalance in the RAS classical and counter-regulatory arms may play a role in HD pathophysiology.

Also flagged:coagulationclotting factorthrombinhypercoagulabilityvenous thromboembolismcoagulopathy
Journal Article 2022-07-12 No Snippets Mamczak CN, Speybroeck J, Stillson JE, Dynako J, Piscoya A, Peck EE, Aboukhaled M, Cancel E, McDonald M, Garcia D, Lovejoy J, Lubin S, Stanton R, Kutcher ME.
Show Full Abstract

The application of viscoelastic hemostatic assays (VHAs) (e.g., thromboelastography (TEG) and rotational thromboelastometry (ROTEM)) in orthopedics is in its relative infancy when compared with other surgical fields. Fortunately, several recent studies describe the emerging use of VHAs to quickly and reliably analyze the real-time coagulation and fibrinolytic status in both orthopedic trauma and elective orthopedic surgery. Trauma-induced coagulopathy-a spectrum of abnormal coagulation phenotypes including clotting factor depletion, inadequate thrombin generation, platelet dysfunction, and dysregulated fibrinolysis-remains a potentially fatal complication in severely injured and/or hemorrhaging patients whose timely diagnosis and management are aided by the use of VHAs. Furthermore, VHAs are an invaluable compliment to common coagulation tests by facilitating the detection of hypercoagulable states commonly associated with orthopedic injury and postoperative status. The use of VHAs to identify hypercoagulability allows for an accurate venous thromboembolism (VTE) risk assessment and monitoring of VTE prophylaxis. Until now, the data have been insufficient to permit an individualized approach with regard to dosing and duration for VTE thromboprophylaxis. By incorporating VHAs into routine practice, orthopedic surgeons will be better equipped to diagnose and treat the complete spectrum of coagulation abnormalities faced by orthopedic patients. This work serves as an educational primer and up-to-date review of the current literature on the use of VHAs in orthopedic surgery.

Also flagged:Curcuminobesitydiabeteschronic diseasesanaemiaallyl sulphur
Journal Article 2022-07-12 No Snippets Sivani BM, Azzeh M, Patnaik R, Pantea Stoian A, Rizzo M, Banerjee Y.
Show Full Abstract

Turmeric is a plant with a very long history of medicinal use across different cultures. Curcumin is the active part of turmeric, which has exhibited various beneficial physiological and pharmacological effects. This review aims to critically appraise the corpus of literature associated with the above pharmacological properties of curcumin, with a specific focus on antioxidant, anti-inflammatory, anticancer and antimicrobial properties. We have also reviewed the different extraction strategies currently in practice, highlighting the strengths and drawbacks of each technique. Further, our review also summarizes the clinical trials that have been conducted with curcumin, which will allow the reader to get a quick insight into the disease/patient population of interest with the outcome that was investigated. Lastly, we have also highlighted the research areas that need to be further scrutinized to better grasp curcumin's beneficial physiological and medicinal properties, which can then be translated to facilitate the design of better bioactive therapeutic leads.

Also flagged:GlioblastomaGlioblastoma MultiformeGBMacidcell surfacevimentin
Journal Article 2022-07-12 No Snippets Duskey JT, Rinaldi A, Ottonelli I, Caraffi R, De Benedictis CA, Sauer AK, Tosi G, Vandelli MA, Ruozi B, Grabrucker AM.
Show Full Abstract

Glioblastoma Multiforme (GBM) is a devastating disease with a low survival rate and few efficacious treatment options. The fast growth, late diagnostics, and off-target toxicity of currently used drugs represent major barriers that need to be overcome to provide a viable cure. Nanomedicines (NMeds) offer a way to overcome these pitfalls by protecting and loading drugs, increasing blood half-life, and being targetable with specific ligands on their surface. In this study, the FDA-approved polymer poly (lactic-co-glycolic) acid was used to optimise NMeds that were surface modified with a series of potential GBM-specific ligands. The NMeds were fully characterised for their physical and chemical properties, and then in vitro testing was performed to evaluate cell uptake and GBM cell specificity. While all targeted NMeds showed improved uptake, only those decorated with the-cell surface vimentin antibody M08 showed specificity for GBM over healthy cells. Finally, the most promising targeted NMed candidate was loaded with the well-known chemotherapeutic, paclitaxel, to confirm targeting and therapeutic effects in C6 GBM cells. These results demonstrate the importance of using well-optimised NMeds targeted with novel ligands to advance delivery and pharmaceutical effects against diseased cells while minimising the risk for nearby healthy cells.

Also flagged:Toll-like ReceptorSqualeneTocopherolTLRTLR4TLR7
Journal Article 2022-07-12 ✓ 1 Snippet Short KK, Lathrop SK, Davison CJ, Partlow HA, Kaiser JA, Tee RD, Lorentz EB, Evans JT, Burkhart DJ.
In-Text Gene Mentions

…with SARS-CoV-1 andMERS-CoV-1has suggested that…

Show Full Abstract

A diversity of vaccines is necessary to reduce the mortality and morbidity of SARS-CoV-2. Vaccines must be efficacious, easy to manufacture, and stable within the existing cold chain to improve their availability around the world. Recombinant protein subunit vaccines adjuvanted with squalene-based emulsions such as AS03™ and MF59™ have a long and robust history of safe, efficacious use with straightforward production and distribution. Here, subunit vaccines were made with squalene-based emulsions containing novel, synthetic toll-like receptor (TLR) agonists, INI-2002 (TLR4 agonist) and INI-4001 (TLR7/8 agonist), using the recombinant receptor-binding domain (RBD) of SARS-CoV-2 S protein as an antigen. The addition of the TLR4 and TLR7/8 agonists, alone or in combination, maintained the formulation characteristics of squalene-based emulsions, including a sterile filterable droplet size (<220 nm), high homogeneity, and colloidal stability after months of storage at 4, 25, and 40 °C. Furthermore, the addition of the TLR agonists skewed the immune response from Th2 towards Th1 in immunized C57BL/6 mice, resulting in an increased production of IgG2c antibodies and a lower antigen-specific production of IL-5 with a higher production of IFNγ by lymphocytes. As such, incorporating TLR4 and TLR7/8 agonists into emulsions leveraged the desirable formulation and stability characteristics of emulsions and can induce Th1-type humoral and cell-mediated immune responses to combat the continued threat of SARS-CoV-2.

Also flagged:TumorGadolinium Oxidefolic acidCirculationpositronphoton
Journal Article 2022-07-12 No Snippets Ho SL, Yue H, Lee S, Tegafaw T, Ahmad MY, Liu S, Saidi AKAA, Zhao D, Liu Y, Nam SW, Chae KS, Chang Y, Lee GH.
Show Full Abstract

Hydrophilic and biocompatible PAA-coated ultrasmall Gd<sub>2</sub>O<sub>3</sub> nanoparticles (d<sub>avg</sub> = 1.7 nm) were synthesized and conjugated with tumor-targeting ligands, i.e., cyclic arginylglycylaspartic acid (cRGD) and/or folic acid (FA). FA-PAA-Gd<sub>2</sub>O<sub>3</sub> and cRGD/FA-PAA-Gd<sub>2</sub>O<sub>3</sub> nanoparticles were successfully applied in U87MG tumor-bearing mice for tumor imaging using T<sub>1</sub> magnetic resonance imaging (MRI). cRGD/FA-PAA-Gd<sub>2</sub>O<sub>3</sub> nanoparticles with multiple tumor-targeting ligands exhibited higher contrasts at the tumor site than FA-PAA-Gd<sub>2</sub>O<sub>3</sub> nanoparticles with mono tumor-targeting ligands. In addition, the cRGD/FA-PAA-Gd<sub>2</sub>O<sub>3</sub> nanoparticles exhibited higher contrasts in all organs, especially the aorta, compared with those of the FA-PAA-Gd<sub>2</sub>O<sub>3</sub> nanoparticles, because of the blood cell hitchhiking effect of cRGD in the cRGD/FA-PAA-Gd<sub>2</sub>O<sub>3</sub> nanoparticles, which prolonged their circulation in the blood.

Also flagged:FOSNR3C1crestPrdm1IFNGR2IFNGR1
Journal Article 2022-07-12 ✓ 2 Snippets Zhu J, Yan M, Yan H, Xu L, Jiang Z, Liao G, Zhou Y, Liu W, Liang X, Li X, Xiao Y, Zhang Y.
In-Text Gene Mentions

The majority of the tumor cells were in the intermediate state, which was governed by the EGR3, NFATC2, and SOX6 (Figure 1A).

…NFATC2 , andSOX6( Figure 1A…

Show Full Abstract

Heterogeneous crosstalk between tumor cells and CD8+ T cells leads to substantial variation in clinical benefits from immunotherapy in melanoma. Due to spatial distribution and functional state heterogeneity, it is still unknown whether there is a crosstalk propensity between tumor cells and CD8+ T cells in melanoma, and how this crosstalk propensity affects the clinical outcome of patients. Using public single-cell transcriptome data, extensive heterogeneous functional states and ligand-receptor interactions of tumor cells and CD8+ T cells were revealed in melanoma. Furthermore, based on the association between cell-cell communication intensity and cell state activity in a single cell, we identified a crosstalk propensity between the tumor intermediate state and the CD8+ T exhausted state. This crosstalk propensity was further verified by pseudo-spatial proximity, spatial co-location, and the intra/intercellular signal transduction network. At the sample level, the tumor intermediate state and the CD8+ T exhausted state synergistically indicated better prognosis and both reduced in immunotherapy-resistant samples. The risk groups defined based on these two cell states could comprehensively reflect tumor genomic mutations and anti-tumor immunity information. The low-risk group had a higher <i>BRAF</i> mutation fraction as well as stronger antitumor immune response. Our findings highlighted the crosstalk propensity between the tumor intermediate state and the CD8+ T exhausted state, which may serve as a reference to guide the development of diagnostic biomarkers for risk stratification and therapeutic targets for new therapeutic strategies.

Also flagged:LIPCFABP1GAPDHPPARGPGC1AUXT
Journal Article 2022-07-12 ✓ 2 Snippets Busato S, Ford HR, Abdelatty AM, Estill CT, Bionaz M.
In-Text Gene Mentions

MRPL39

…reference genes GAPDH,MRPL39and UXT were…

Show Full Abstract

Metabolic challenges experienced by dairy cows during the transition between pregnancy and lactation (also known as peripartum), are of considerable interest from a nutrigenomic perspective. The mobilization of large amounts of non-esterified fatty acids (<b>NEFA</b>) leads to an increase in NEFA uptake in the liver, the excess of which can cause hepatic accumulation of lipids and ultimately fatty liver. Interestingly, peripartum NEFA activate the Peroxisome Proliferator-activated Receptor (<b>PPAR</b>), a transcriptional regulator with known nutrigenomic properties. The study of PPAR activation in the liver of periparturient dairy cows is thus crucial; however, current <i>in vitro</i> models of the bovine liver are inadequate, and the isolation of primary hepatocytes is time consuming, resource intensive, and prone to errors, with the resulting cells losing characteristic phenotypical traits within hours. The objective of the current study was to evaluate the use of precision-cut liver slices (<b>PCLS</b>) from liver biopsies as a model for PPAR activation in periparturient dairy cows. Three primiparous Jersey cows were enrolled in the experiment, and PCLS from each were prepared prepartum (-8.0 ± 3.6 DIM) and postpartum (+7.7± 1.2 DIM) and treated independently with a variety of PPAR agonists and antagonists: the PPARα agonist WY-14643 and antagonist GW-6471; the PPARδ agonist GW-50156 and antagonist GSK-3787; and the PPARγ agonist rosiglitazone and antagonist GW-9662. Gene expression was assayed through RT-qPCR and RNAseq, and intracellular triacylglycerol (TAG) concentration was measured. PCLS obtained from postpartum cows and treated with a PPARγ agonist displayed upregulation of <i>ACADVL</i> and <i>LIPC</i> while those treated with PPARδ agonist had increased expression of <i>LIPC, PPARD</i>, and <i>PDK4</i>. In PCLS from prepartum cows, transcription of <i>LIPC</i> was increased by all PPAR agonists and NEFA. TAG concentration tended to be larger in tissue slices treated with PPARδ agonist compared to CTR. Use of PPAR isotype-specific antagonists in PCLS cultivated in autologous blood serum failed to decrease expression of PPAR targets, except for <i>PDK4</i>, which was confirmed to be a PPARδ target. Transcriptome sequencing revealed considerable differences in response to PPAR agonists at a false discovery rate-adjusted <i>p</i>-value of 0.2, with the most notable effects exerted by the PPARδ and PPARγ agonists. Differentially expressed genes were mainly related to pathways involved with lipid metabolism and the immune response. Among differentially expressed genes, a subset of 91 genes were identified as novel putative PPAR targets in the bovine liver, by cross-referencing our results with a publicly available dataset of predicted PPAR target genes, and supplementing our findings with prior literature. Our results provide important insights on the use of PCLS as a model for assaying PPAR activation in the periparturient dairy cow.

Also flagged:COVID-19membraneCOVID-19 infectionmyocarditisCOVID-19 ReinfectionCytokine
Journal Article 2022-07-12 No Snippets Phan PH, Nguyen DT, Dao NH, Nguyen HTT, Vu AV, Hoang ST, Nguyen LV, Cao TV, Tran DM.
Show Full Abstract

<h4>Background</h4>Indirect cardiomyocyte damage-related hyperinflammatory response is one of the key mechanisms in COVID-19-induced fulminant myocarditis. In addition to the clinical benefit of using cytokines absorption hemofiltration, the effectiveness of instituting veno-arterial extracorporeal membrane oxygenation (VA-ECMO) support for cardiac compromise has been reported. However, current literature enunciates a paucity of available data on the effectiveness of these novel modalities.<h4>Case presentation</h4>We reported a 9-year-old boy with recurrent COVID-19 infection-causing fulminant myocarditis, who was treated successfully by using novel modalities of <i>oXiris</i> <sup>®</sup> hemofilter continuous venovenous hemofiltration (CVVH) and VA-ECMO. The patient made a full recovery without any sequelae.<h4>Conclusion</h4>We conclude that the novel highly-absorptive hemofilter CVVH and VA-ECMO may be effective treatment modalities in managing SARS-CoV-2-induced fulminant myocarditis. Our report highlights the need for further well-designed investigations to confirm this extrapolation.

Also flagged:Beta-Thalassemiathalassemiaβ-thalassemiaC-reactive proteinCRPglutamine aspartate transaminase
Journal Article 2022-07-12 ✓ 5 Snippets Padeniya P, Goonasekara H, Abeysekera G, Jayasekara R, Dissanayake V.
In-Text Gene Mentions

Data on the HFE gene variants in Sri Lankan patients with thalassemia have not been extensively studied.

…editary Hemochromatosis Gene (HFE) Variants in Sri…

…hereditary hemochromatosis (HFE) gene variants…

…Data on theHFEgene variants in…

…( p .H63D)HFEgene variants using…

Show Full Abstract

<h4>Introduction</h4>Co-inheritance of hereditary hemochromatosis (<i>HFE</i>) gene variants <i>p</i>. C282Y and <i>p</i>.H63D worsen iron overload in transfusion-dependent thalassemia. Data on the <i>HFE</i> gene variants in Sri Lankan patients with thalassemia have not been extensively studied. This study aimed to analyze the <i>p</i>.C282Y and <i>p</i>.H63D variants in transfusion-dependent beta (β) and HbE/β-thalassemia patients and establish an association between these variants and their serum ferritin levels.<h4>Materials and methods</h4>A total of 125 transfusion-dependent β-thalassemia major and HbE/β thalassemia patients were tested for the c.845G>A (<i>p</i>.C282Y) and c.187C>G (<i>p</i>.H63D) <i>HFE</i> gene variants using the multiplex Amplification Refractory Mutation System Polymerase Chain Reaction method. For phenotype-genotype correlation, serum ferritin levels, the erythrocyte sedimentation rate (ESR), and C-reactive protein (CRP) levels were measured. The standard descriptive statistics were used for data analysis.<h4>Results</h4>The study cohort consisted of transfusion-dependent 123 β-thalassemia and 2 HbE/β-thalassemia patients. The <i>p</i>.C282Y variant was not detected in any patient; allele frequency for the wild type (c.845GG) was 100%. Twenty-three patients were heterozygous for the <i>p</i>.H63D variant allele, and the allele frequencies were c.187CC 91.8%, c.187CG 9.2%, and c.187GG 0%. The mean serum ferritin level was relatively higher (mean level 4,987 ng/ml) in the <i>p</i>.H63D heterozygous (c.187CG) group compared to the wild type (c.187CC) group (mean level 4,571 ng/ml), but the difference was statistically not significant (<i>p</i> = 0.865). Among the total study population, CRP, ESR, and serum glutamine aspartate transaminase (SGPT) were elevated in 9 (7.2%), 65 (52%), and 82 (65.6%) patients, respectively. Among the <i>p</i>.H63D c.187CG group, elevated CRP, ESR, and SGPT were present in 5 (5%), 15 (12%), and 18 (14.4%) patients, respectively. The detected sample number was low to correlate with the confounding effect of inflammatory disorders and liver damage on the serum ferritin levels.<h4>Conclusions</h4>The <i>HFE</i> gene variant <i>p</i>.C282Y is unlikely to cause iron overload in the Asian β-thalassemia patients; the rarity of this variant in the study cohort replicates the findings of other South Asian population studies of this variant. The presence of the <i>p</i>.H63D variant could be a potential risk factor for iron overload in the β-thalassemia patients. A more extensive cohort study is required to validate this finding.

Also flagged:hydrocephalusalcohol abuseADalcoholethanollocalization
Journal Article 2022-07-12 No Snippets Ji W, Tang Z, Chen Y, Wang C, Tan C, Liao J, Tong L, Xiao G.
Show Full Abstract

Cerebrospinal fluid (CSF), a colorless liquid that generally circulates from the lateral ventricles to the third and fourth ventricles, provides essential nutrients for brain homeostasis and growth factors during development. As evidenced by an increasing corpus of research, CSF serves a range of important functions. While it is considered that decreased CSF flow is associated to the development of hydrocephalus, it has recently been postulated that motile cilia, which line the apical surfaces of ependymal cells (ECs), play a role in stimulating CSF circulation by cilia beating. Ependymal cilia protrude from ECs, and their synchronous pulsing transports CSF from the lateral ventricle to the third and fourth ventricles, and then to the subarachnoid cavity for absorption. As a result, we postulated that malfunctioning ependymal cilia could disrupt normal CSF flow, raising the risk of hydrocephalus. This review aims to demonstrate the physiological functions of ependymal cilia, as well as how cilia immobility or disorientation causes problems. We also conclude conceivable ways of treatment of hydrocephalus currently for clinical application and provide theoretical support for regimen improvements by investigating the relationship between ependymal cilia and hydrocephalus development.

Also flagged:Nicotinamide phosphoribosyltransferaseNAMPTnicotinamide adenine dinucleotidenicotinamide mononucleotideNAD-dependent sirtuinSIRT
Journal Article 2022-07-12 No Snippets Zhu Y, Xu P, Huang X, Shuai W, Liu L, Zhang S, Zhao R, Hu X, Wang G.
Show Full Abstract

Nicotinamide phosphoribosyltransferase (NAMPT) is the rate-limiting enzyme in the nicotinamide adenine dinucleotide (NAD) salvage pathway in mammals. It is of great significance in the metabolic homeostasis and cell survival via synthesizing nicotinamide mononucleotide (NMN) through enzymatic activities, serving as a key protein involved in the host's defense mechanism. The NAMPT metabolic pathway connects NAD-dependent sirtuin (SIRT) signaling, constituting the NAMPT-NAD-SIRT cascade, which is validated as a strong intrinsic defense system. Neurodegenerative diseases belong to the central nervous system (CNS) disease that seriously endangers human health. The World Health Organization (WHO) proposed that neurodegenerative diseases will become the second leading cause of human death in the next two decades. However, effective drugs for neurodegenerative diseases are scant. NAMPT is specifically highly expressed in the hippocampus, which mediates cell self-renewal and proliferation and oligodendrocyte synthesis by inducing the biosynthesis of NAD in neural stem cells/progenitor cells. Owing to the active biological function of NAMPT in neurogenesis, targeting NAMPT may be a powerful therapeutic strategy for neurodegenerative diseases. This study aims to review the structure and biological functions, the correlation with neurodegenerative diseases, and treatment advance of NAMPT, aiming to provide a novel idea for targeted therapy of neurodegenerative diseases.

Also flagged:ironcancerferroptosisgastric cancerPD-1immune response
Journal Article 2022-07-12 ✓ 1 Snippet Xiao J, Zheng L, Liu J.
In-Text Gene Mentions

…HAVCR2, CD86, PDCD1LG2,TNFSF4, CD48, CD44, CD200,…

Show Full Abstract

<b>Objective:</b> Ferroptosis is a type of iron-dependent necrosis related to cancer. Nevertheless, the features of ferroptosis in gastric cancer (GC) remain poorly understood. This study conducted a systematic analysis of ferroptosis regulators in GC. <b>Methods:</b> We gathered five GC cohorts, namely, TCGA-STAD, GSE84437, GSE62254, GSE26901, and GSE15459. Unsupervised clustering analysis was adopted to cluster GC patients into different ferroptosis subtypes based on ferroptosis regulators. Immune cell infiltration and hallmark pathway activity were estimated <i>via</i> ssGSEA. The ferroptosis index was developed with the PCA computational method. Response to chemotherapy agents and small molecular compounds was inferred <i>via</i> GDSC, CTRP, and PRISM projects. Two anti-PD-1 therapy cohorts were gathered and the potential of FPI in predicting immune response was assessed. <b>Results:</b> Expression profiles, genetic mutations, DNA methylation, prognostic implications, and drug sensitivity of ferroptosis regulators were characterized in GC. Three ferroptosis subtypes were clustered with distinct prognosis, hallmark pathway activity, and tumor-infiltrating immune cells. Ferroptosis levels were quantified based on the expression of prognostic ferroptosis-related signatures. The significant relationships between FPI and clinicopathological characteristics were observed. Furthermore, high FPI was in relation to poor prognosis, inflamed tumor microenvironment (TME) as well as high sensitivity to chemotherapy agents (docetaxel and cisplatin), and CTRP- and PRISM-derived compounds. Also, FPI acted as a promising predictor of immune response. <b>Conclusion:</b> Collectively, our findings identified a novel ferroptosis-based subtype classification of GC, and revealed the potential of ferroptosis in forming TME diversity and complexity, and guiding individualized treatment.

Also flagged:Skin CancerAgingtelomerecancerscancermelanoma
Journal Article 2022-07-12 No Snippets Son N, Cui Y, Xi W.
Show Full Abstract

<b>Background:</b> Telomere shortening is a hallmark of cellular senescence. However, telomere length (TL)-related cellular senescence has varying effects in different cancers, resulting in a paradoxical relationship between senescence and cancer. Therefore, we used observational epidemiological studies to investigate the association between TL and skin cancer and aging, and to explore whether such a paradoxical relationship exists in skin tissue. <b>Methods:</b> This study employed two-sample Mendelian randomization (MR) to analyze the causal relationship between TL and skin cancer [melanoma and non-melanoma skin cancers (NMSCs)] and aging. We studied single nucleotide polymorphisms (SNPs) obtained from pooled data belonging to genome-wide association studies (GWAS) in the literature and biobanks. Quality control was performed using pleiotropy, heterogeneity, and sensitivity analyses. <b>Results:</b> We used five algorithms to analyze the causal relationship between TL and skin aging, melanoma, and NMSCs, and obtained consistent results. TL shortening reduced NMSC and melanoma susceptibility risk with specific odds ratios (ORs) of 1.0344 [95% confidence interval (CI): 1.0168-1.0524, <i>p</i> = 0.01] and 1.0127 (95% CI: 1.0046-1.0209, <i>p</i> = 6.36E-07), respectively. Conversely, TL shortening was validated to increase the odds of skin aging (OR = 0.96, 95% CI: 0.9332-0.9956, <i>p</i> = 0.03). Moreover, the MR-Egger, maximum likelihood, and inverse variance weighted (IVW) methods found significant heterogeneity among instrumental variable (IV) estimates (identified as MR-Egger skin aging Q = 76.72, <i>p</i> = 1.36E-04; melanoma Q = 97.10, <i>p</i> = 1.62E-07; NMSCsQ = 82.02, <i>p</i> = 1.90E-05). The leave-one-out analysis also showed that the SNP sensitivity was robust to each result. <b>Conclusion:</b> This study found that TL shortening may promote skin aging development and reduce the risk of cutaneous melanoma and NMSCs. The results provide a reference for future research on the causal relationship between skin aging and cancer in clinical practice.

Also flagged:Proliferative diabetic retinopathyPDRdiabetesglucoseVEGFcell proliferation
Journal Article 2022-07-12 ✓ 1 Snippet Liu QP, Chen YY, Yu YY, An P, Xing YZ, Yang HX, Zhang YJ, Rahman K, Zhang L, Luan X, Zhang H.
In-Text Gene Mentions

…SOD1, PARK7, andPRDX6.…

Show Full Abstract

Proliferative diabetic retinopathy (PDR) is one of the main complications of diabetes, mainly caused by the aberrant proliferation of retinal vascular endothelial cells and the formation of new blood vessels. Traditional Chinese medicines possess great potential in the prevention and treatment of PDR. Bie-Jia-Ruan-Mai-Tang (BJ), a Chinese medicine formula, has a good therapeutic effect on PDR clinically; however, the mechanism of action involved remains unclear. Therefore, we investigated the effect of BJ on PDR through <i>in vitro</i> and <i>in vivo</i> experiments. A diabetic mouse model with PDR was established by feeding a high-fat-high-glucose diet combined with an intraperitoneal injection of streptozotocin (STZ), while high-glucose-exposed human retinal capillary endothelial cells (HRCECs) were employed to mimic PDR <i>in vitro</i>. The <i>in vivo</i> experiments indicated that BJ inhibited the formation of acellular capillaries, decreased the expression of VEGF, and increased the level of ZO-1 in diabetic mice retina. <i>In vitro</i> experiments showed that high glucose significantly promoted cell viability and proliferation. However, BJ inhibited cell proliferation by cycle arrest in the S phase, thus leading to apoptosis; it also increased the production of ROS, decreased the mitochondrial membrane potential, reduced the ATP production, and also reduced the expressions of p-PI3K, p-AKT, and Bcl-xL, but increased the expressions of Bax and p-NF-κB. These results suggest that BJ induces the apoptosis of HRCECs exposed to high glucose through activating the mitochondrial death pathway by decreasing the PI3K/AKT signaling and increasing the NF-κB signaling to inhibit the formation of acellular capillaries in the retina, thus impeding the development of PDR.

Also flagged:Prostate Cancercancerscancercell growthcell cyclecell differentiation
Journal Article 2022-07-12 No Snippets Chopra H, Bibi S, Goyal R, Gautam RK, Trivedi R, Upadhyay TK, Mujahid MH, Shah MA, Haris M, Khot KB, Gopan G, Singh I, Kim JK, Jose J, Abdel-Daim MM, Alhumaydhi FA, Emran TB, Kim B.
Show Full Abstract

There are more than two hundred fifty different types of cancers, that are diagnosed around the world. Prostate cancer is one of the suspicious type of cancer spreading very fast around the world, it is reported that in 2018, 29430 patients died of prostate cancer in the United State of America (USA), and hence it is expected that one out of nine men diagnosed with this severe disease during their lives. Medical science has identified cancer at several stages and indicated genes mutations involved in the cancer cell progressions. Genetic implications have been studied extensively in cancer cell growth. So most efficacious drug for prostate cancer is highly required just like other severe diseases for men. So nutraceutical companies are playing major role to manage cancer disease by the recommendation of best natural products around the world, most of these natural products are isolated from plant and mushrooms because they contain several chemoprotective agents, which could reduce the chances of development of cancer and protect the cells for further progression. Some nutraceutical supplements might activate the cytotoxic chemotherapeutic effects by the mechanism of cell cycle arrest, cell differentiation procedures and changes in the redox states, but in other, it also elevate the levels of effectiveness of chemotherapeutic mechanism and in results, cancer cell becomes less reactive to chemotherapy. In this review, we have highlighted the prostate cancer and importance of nutraceuticals for the control and management of prostate cancer, and the significance of nutraceuticals to cancer patients during chemotherapy.

Also flagged:Nuclear factor kappa BNF-κBtranscription factorscancersNF-κB inducing kinaseNIK
Journal Article 2022-07-12 No Snippets Haselager MV, Eldering E.
Show Full Abstract

NF-κB-inducing kinase (NIK) is a key player in non-canonical NF-κB signaling, involved in several fundamental cellular processes, and is crucial for B cell function and development. In response to certain signals and ligands, such as CD40, BAFF and lymphotoxin-β activation, NIK protein stabilization and subsequent NF-κB activation is achieved. Overexpression or overactivation of NIK is associated with several malignancies, including activating mutations in multiple myeloma (MM) and gain-of-function in MALT lymphoma as a result of post-translational modifications. Consequently, drug discovery studies are devoted to pharmacologic modulation of NIK and development of specific novel small molecule inhibitors. However, disease-specific <i>in vitro</i> and <i>in vivo</i> studies investigating NIK inhibition are as of yet lacking, and clinical trials with NIK inhibitors remain to be initiated. In order to bridge the gap between bench and bedside, this review first briefly summarizes our current knowledge on NIK activation, functional activity and stability. Secondly, we compare current inhibitors targeting NIK based on efficacy and specificity, and provide a future perspective on the therapeutic potential of NIK inhibition in B cell malignancies.

Also flagged:Diabetic NephropathyDNGene ExpressionFN1CD44C1QB
Journal Article 2022-07-12 No Snippets Li Z, Feng J, Zhong J, Lu M, Gao X, Zhang Y.
Show Full Abstract

<h4>Background</h4>This study aimed to identify biological markers for diabetic nephropathy (DN) and explore their underlying mechanisms.<h4>Methods</h4>Four datasets, GSE30528, GSE47183, GSE104948, and GSE96804, were downloaded from the Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) were identified using the "limma" package, and the "RobustRankAggreg" package was used to screen the overlapping DEGs. The hub genes were identified using cytoHubba of Cytoscape. Logistic regression analysis was used to further analyse the hub genes, followed by receiver operating characteristic (ROC) curve analysis to predict the diagnostic effectiveness of the hub genes. Correlation analysis and enrichment analysis of the hub genes were performed to identify the potential functions of the hub genes involved in DN.<h4>Results</h4>In total, 55 DEGs, including 38 upregulated and 17 downregulated genes, were identified from the three datasets. Four hub genes (<i>FN1</i>, <i>CD44</i>, <i>C1QB</i>, and <i>C1QA</i>) were screened out by the "UpSetR" package, and <i>FN1</i> was identified as a key gene for DN by logistic regression analysis. Correlation analysis and enrichment analysis showed that <i>FN1</i> was positively correlated with four genes (<i>COL6A3</i>, <i>COL1A2</i>, <i>THBS2</i>, and <i>CD44</i>) and with the development of DN through the extracellular matrix (ECM)-receptor interaction pathway.<h4>Conclusions</h4>We identified four candidate genes: <i>FN1</i>, <i>C1QA</i>, <i>C1QB</i>, and <i>CD44</i>. On further investigating the biological functions of <i>FN1</i>, we showed that <i>FN1</i> was positively correlated with <i>THBS2</i>, <i>COL1A2</i>, <i>COL6A3</i>, and <i>CD44</i> and involved in the development of DN through the ECM-receptor interaction pathway. <i>THBS2</i>, <i>COL1A2</i>, <i>COL6A3</i>, and <i>CD44</i> may be novel biomarkers and target therapeutic candidates for DN.

Also flagged:epilepsydeathrespiratory rhythmepilepsy syndromesG-proteininflammatory response
Journal Article 2022-07-12 ✓ 2 Snippets Leitner DF, Kanshin E, Askenazi M, Faustin A, Friedman D, Devore S, Ueberheide B, Wisniewski T, Devinsky O.
In-Text Gene Mentions

Among 4 of the 11 pathways, unique proteins were notshared with other signalling pathways: inflammatory response (CCR3 signalling ineosinophils, MAPK signalling in promoting pathogenesis of influenza), stress response(including PRDX6 in xenobiotic metabolism general signalling pathway, endothelin-1signalling) and neuronal migration/outgrowth (CDK5 signalling).

…stress response (includingPRDX6in xenobiotic metabolism…

Show Full Abstract

Brainstem nuclei dysfunction is implicated in sudden unexpected death in epilepsy. In animal models, deficient serotonergic activity is associated with seizure-induced respiratory arrest. In humans, glia are decreased in the ventrolateral medullary pre-Botzinger complex that modulate respiratory rhythm, as well as in the medial medullary raphe that modulate respiration and arousal. Finally, sudden unexpected death in epilepsy cases have decreased midbrain volume. To understand the potential role of brainstem nuclei in sudden unexpected death in epilepsy, we evaluated molecular signalling pathways using localized proteomics in microdissected midbrain dorsal raphe and medial medullary raphe serotonergic nuclei, as well as the ventrolateral medulla in brain tissue from epilepsy patients who died of sudden unexpected death in epilepsy and other causes in diverse epilepsy syndromes and non-epilepsy control cases (<i>n</i> = 15-16 cases per group/region). Compared with the dorsal raphe of non-epilepsy controls, we identified 89 proteins in non-sudden unexpected death in epilepsy and 219 proteins in sudden unexpected death in epilepsy that were differentially expressed. These proteins were associated with inhibition of EIF2 signalling (<i>P</i>-value of overlap = 1.29 × 10<sup>-8</sup>, <i>z</i> = -2.00) in non-sudden unexpected death in epilepsy. In sudden unexpected death in epilepsy, there were 10 activated pathways (top pathway: gluconeogenesis I, <i>P</i>-value of overlap = 3.02 × 10<sup>-6</sup>, <i>z</i> = 2.24) and 1 inhibited pathway (fatty acid beta-oxidation, <i>P</i>-value of overlap = 2.69 × 10<sup>-4</sup>, <i>z</i> = -2.00). Comparing sudden unexpected death in epilepsy and non-sudden unexpected death in epilepsy, 10 proteins were differentially expressed, but there were no associated signalling pathways. In both medullary regions, few proteins showed significant differences in pairwise comparisons. We identified altered proteins in the raphe and ventrolateral medulla of epilepsy patients, including some differentially expressed in sudden unexpected death in epilepsy cases. Altered signalling pathways in the dorsal raphe of sudden unexpected death in epilepsy indicate a shift in cellular energy production and activation of G-protein signalling, inflammatory response, stress response and neuronal migration/outgrowth. Future studies should assess the brain proteome in relation to additional clinical variables (e.g. recent tonic-clonic seizures) and in more of the reciprocally connected cortical and subcortical regions to better understand the pathophysiology of epilepsy and sudden unexpected death in epilepsy.

Also flagged:HuRskin agingHuman antigen RRNA-binding proteinsoxygenskin injury
Journal Article 2022-07-12 ✓ 1 Snippet Yu D, Feng Y, Jiang Z, Yan T, Fang K, Shi Y, Zhang J, Zhang S.
In-Text Gene Mentions

…CALB2, INHBA, ACSS2,OLFM4and TMPRSS11E.…

Show Full Abstract

The skin is the largest outermost organ of the human body. It is vulnerable to various damages, such as ionizing radiation. Exploration of proliferation, senescence and radiosensitivity of skin cells contributes to the development of medical and cosmetic countermeasures against skin aging and toward injury protection. Human antigen R (HuR) is one of the most widely studied RNA-binding proteins and serves an important role in stabilization of mRNA and regulation of the expression of the target genes. To investigate the role of HuR in modulating proliferation, senescence and radiosensitivity of skin cells, the present study performed an <i>in vitro</i> study using lentivirus-mediated overexpression or silencing of HuR in human keratinocyte HaCaT cells and human skin fibroblast WS1 cells. The results indicated that overexpression of HuR promoted proliferation, whereas downregulation of HuR inhibited proliferation of HaCaT and WS1 cells. Overexpression of HuR reduced apoptosis and senescence in skin cells. RNA-Seq of skin cells with HuR overexpression or knockdown identified 77 mRNAs positively or negatively correlated with HuR expression levels. In addition, silencing of HuR induced a significant increase in radiogenic reactive oxygen species after irradiation. Overexpression of HuR increased radiotolerance of HaCaT and WS1 cells. RNA immunoprecipitation coupled with RNA-Seq identified 14 mRNAs interacting with HuR upon radiation exposure. Overall, the findings of the present study illustrated the key role of HuR in modulating proliferation, senescence and radiosensitivity of skin cells providing a new therapeutic strategy for cosmetic treatments and to combat skin injury.

Research Square 2022-07-12 Preprint (No Snippets API) Li Y, Jiang D, Zhang Q, Liu E, Shao H.
Show Full Abstract

<h4>Background: </h4> Transcription factor SOX6 belongs to Sry‐related high‐mobility‐group box (SOX) family, has been reported to be downregulated and act as a tumor-suppressor gene in various solid tumors, but in acute myeloid leukemia (AML) is incompletely understood. <h4>Methods: </h4>: The SOX6 expression was analyzed between AML patients and normal controls from public data and our research cohort. Correlations between SOX6 expression and clinical, genetic features together with survival were further analyzed. <h4>Results: </h4>: In both public and our present datasets, we demonstrated that SOX6 expression is notably downregulated in AML patients compared with normal controls. Moreover, the expression level of SOX6 was dynamic, along with the disease status. SOX6 was significantly decreased in relapsed/refractory AML compared with complete remission AML. Clinically, SOX6 underexpression was signifcantly correlated with bone marrow blasts, and WBC counts. Furthermore, decreased expression of SOX6 was more common in core binding factor AML (CBF-AML), rarely found in complex karyotype AML (CK-AML), and correlated with FLT3 mutations. By survival analyses, low-expression of SOX6 was associated with shorter overall survival (OS) and event-free survival (EFS) among cytogenetic normal AML (CN-AML) patients. Moreover, both univariate and multivariate analyses showed that low SOX6 expression was an independent unfavorable prognostic biomarker for CN-AML. <h4>Conclusions: </h4>: Our fndings indicated that SOX6 underexpression, as a frequent event in AML, was associated with genetic abnormalities and prognosis in AML. SOX6 might be a valuable biomarker for risk stratification, predicting prognosis and relapse of AML.

Research Square 2022-07-12 Preprint (No Snippets API) Farag MM, Thabet MAEH, Abd-Almohsen AM, Mohammed HEAD.
Show Full Abstract

<h4>Introduction: </h4> Despite of growing evidence of the beneficial effects of placental transfusions techniques, no available sufficient data about their effects on vulnerable hemodynamics and myocardium of premature infants. purpose Study ventricular functions and hemodynamics after different techniques of placental transfusions techniques, Delayed cord clamping (DCC), Cut cord milking (C-UCM), and intact cord milking (I-UCM). methods: Infants delivered whether by Cs-section or vaginal delivery were randomly assigned to undergo C- UCM (20-30cm), I- UCM (3-4 strippings), and DCC (30–60 seconds). Functional echocardiography was done at 24 hour and 72-96 hours of life. This trial was registered in the clinical trial gov NCT04811872. <h4>Results: </h4> Of a total 196 preterm infants ≤32 weeks were enrolled in the study 57 infants were eligible and randomly assigned to the three groups. neonates randomly assigned to DCC had significantly higher superior vena cava flow and lower right ventricular systolic function in the first 24 hours of life. This finding vanished at day 3. Neonates undergone different methods of placental transfusions had similar hemoglobin, admission temperature, and mean blood pressure in the first 24 hours of life. <h4>Conclusion: </h4> Placental transfusion techniques may benefit premature neonates ≤32 weeks, but they have been shown to alter their hemodynamics and myocardial function.

Also flagged:tumorglycineaspartic acidpeptideblock copolymerscyclic arginine
Journal Article 2022-07-11 No Snippets De Lorenzi F, Rizzo LY, Daware R, Motta A, Baues M, Bartneck M, Vogt M, van Zandvoort M, Kaps L, Hu Q, Thewissen M, Casettari L, Rijcken CJF, Kiessling F, Sofias AM, Lammers T.
Show Full Abstract

Polymeric micelles are increasingly explored for tumor-targeted drug delivery. CriPec® technology enables the generation of core-crosslinked polymeric micelles (CCPMs) based on thermosensitive (mPEG-b-pHPMAmLac<sub>n</sub>) block copolymers, with high drug loading capacity, tailorable size, and controlled drug release kinetics. In this study, we decorated clinical-stage CCPM with the α<sub>v</sub>β<sub>3</sub> integrin-targeted cyclic arginine-glycine-aspartic acid (cRGD) peptide, which is one of the most well-known active targeting ligands evaluated preclinically and clinically. Using a panel of cell lines with different expression levels of the α<sub>v</sub>β<sub>3</sub> integrin receptor and exploring both static and dynamic incubation conditions, we studied the benefit of decorating CCPM with different densities of cRGD. We show that incubation time and temperature, as well as the expression levels of α<sub>v</sub>β<sub>3</sub> integrin by target cells, positively influence cRGD-CCPM uptake, as demonstated by immunofluorescence staining and fluorescence microscopy. We demonstrate that even very low decoration densities (i.e., 1 mol % cRGD) result in increased engagement and uptake by target cells as compared to peptide-free control CCPM, and that high cRGD decoration densities do not result in a proportional increase in internalization. In this context, it should be kept in mind that a more extensive presence of targeting ligands on the surface of nanomedicines may affect their pharmacokinetic and biodistribution profile. Thus, we suggest a relatively low cRGD decoration density as most suitable for in vivo application.

Also flagged:Rho KinaseHuntington's DiseaseROCKpathogenesisneurological diseasesHD
Journal Article 2022-07-11 ✓ 1 Snippet Ladduwahetty T, Lee MR, Maillard MC, Cachope R, Todd D, Barnes M, Beaumont V, Chauhan A, Gallati C, Haughan AF, Kempf G, Luckhurst CA, Matthews K, McAllister G, Mitchell P, Patel H, Rose M, Saville-Stones E, Steinbacher S, Stott AJ, Thatcher E, Tierney J, Urbonas L, Munoz-Sanjuan I, Dominguez C.
In-Text Gene Mentions

In Huntington's disease (HD), ROCK is implicated in mutant huntingtin (HTT) aggregation and neurotoxicity, and members of the ROCK pathway are increased in HD mouse models and patients.

Show Full Abstract

The Rho kinase (ROCK) pathway is implicated in the pathogenesis of several conditions, including neurological diseases. In Huntington's disease (HD), ROCK is implicated in mutant huntingtin (HTT) aggregation and neurotoxicity, and members of the ROCK pathway are increased in HD mouse models and patients. To validate this mode of action as a potential treatment for HD, we sought a potent, selective, central nervous system (CNS)-penetrant ROCK inhibitor. Identifying a compound that could be dosed orally in mice with selectivity against other AGC kinases, including protein kinase G (PKG), whose inhibition could potentially activate the ROCK pathway, was paramount for the program. We describe the optimization of published ligands to identify a novel series of ROCK inhibitors based on a piperazine core. Morphing of the early series developed in-house by scaffold hopping enabled the identification of a compound exhibiting high potency and desired selectivity and demonstrating a robust pharmacodynamic (PD) effect by the inhibition of ROCK-mediated substrate (MYPT1) phosphorylation after oral dosing.

Also flagged:colon adenocarcinomacancerGIcolorectal cancersGene Expressionlung adenocarcinoma
Journal Article 2022-07-11 ✓ 2 Snippets Rao CV, Xu C, Zhang Y, Asch AS, Yamada HY.
In-Text Gene Mentions

DDX27encodes a putative…

…metabolism regulators (e.g.,DDX27, PRPF6, SMG5) as…

Show Full Abstract

Genomic instability (GI) in cancer facilitates cancer evolution and is an exploitable target for therapy purposes. However, specific genes involved in cancer GI remain elusive. Causal genes for GI via expressions have not been comprehensively identified in colorectal cancers (CRCs). To fill the gap in knowledge, we developed a data mining strategy (Gene Expression to Copy Number Alterations; "GE-CNA"). Here we applied the GE-CNA approach to 592 TCGA CRC datasets, and identified 500 genes whose expression levels associate with CNA. Among these, 18 were survival-critical (i.e., expression levels correlate with significant differences in patients' survival). Comparison with previous results indicated striking differences between lung adenocarcinoma and CRC: (a) less involvement of overexpression of mitotic genes in generating genomic instability in the colon and (b) the presence of CNA-suppressing pathways, including immune-surveillance, was only partly similar to those in the lung. Following 13 genes (TIGD6, TMED6, APOBEC3D, EP400NL, B3GNT4, ZNF683, FOXD4, FOXD4L1, PKIB, DDB2, MT1G, CLCN3, CAPS) were evaluated as potential drug development targets (hazard ratio [> 1.3 or < 0.5]). Identification of specific CRC genomic instability genes enables researchers to develop GI targeting approach. The new results suggest that the "targeting genomic instability and/or aneuploidy" approach must be tailored for specific organs.

Also flagged:phospholipidsagingperoxiredoxin 6detoxificationphospholipidhydroperoxides
Journal Article 2022-07-11 ✓ 4 Snippets Narzt MS, Kremslehner C, Golabi B, Nagelreiter IM, Malikovic J, Hussein AM, Plasenzotti R, Korz V, Lubec G, Gruber F, Lubec J.
In-Text Gene Mentions

2012). The modulation of enzymes including peroxiredoxin 6 (PRDX6) and of phospholipases will also influence the steady-state levels of PL-esterified hydroxy fatty acids other than eicosanoids in cells. PRDX6 has a GPx activity that can reduce hydrogen peroxide and short-chain fatty acid hydroperoxides (FA–OOH) and also phospholipase, and lysophospholipid acyltransferase activities (Fisher et al. 2016). We have recently shown that in skin of mice, transgenic overexpression of peroxiredoxin 6 reduces the levels of PC-OOH, while gene knockout leads to their elevation in vivo (Rolfs et al. 2013). Importantly, we have recently found that in a comparable cohort of rats, PRDX6 was decreased in the dentate gyrus brain region of rats with impaired memory (Lubec et al. 2019). Reduced expression or activity of peroxiredoxin 6 may thus also explain the elevation of PL-OOH in the PFC; however, neither the peroxidase nor the phospholipase function of this enzyme appears to influence the OxPC levels, as one could in that case expect a decrease of PC-OH and lysophospholipids, respectively. In Alzheimer’s disease patients, the erythrocyte PC-OOH levels were found elevated (Yamashita et al. 2016) indicating an association of phosphatidylcholine peroxidation with neurodegenerative disease. Both PC-OH and PC-OOH can induce cell adhesion to ICAM-1 (Arai et al. 1997), and activate the NRF2-dependent antioxidant response (Jyrkkanen et al. 2008) and the unfolded protein response (Gargalovic et al. 2006). If PL-OOH are not detoxified at some point, they can induce cell death following the peroxidation chain reaction (Imai et al. 2017), and this so-called ferroptosis is a candidate mechanism that could promote neurodegeneration and neuro-inflammation (Maiorino et al. 2018).

…including peroxiredoxin 6 (PRDX6) and of phospholipases…

PRDX6has a GPx…

…cohort of rats,PRDX6was decreased in…

Show Full Abstract

Loss of cognitive function is a typical consequence of aging in humans and rodents. The extent of decline in spatial memory performance of rats, assessed by a hole-board test, reaches from unimpaired and comparable to young individuals to severely memory impaired. Recently, proteomics identified peroxiredoxin 6, an enzyme important for detoxification of oxidized phospholipids, as one of several synaptosomal proteins discriminating between aged impaired and aged unimpaired rats. In this study, we investigated several components of the epilipidome (modifications of phospholipids) of the prefrontal cortex of young, aged memory impaired (AI) and aged unimpaired (AU) rats. We observed an age-related increase in phospholipid hydroperoxides and products of phospholipid peroxidation, including reactive aldehydophospholipids. This increase went in hand with cortical lipofuscin autofluorescence. The memory impairment, however, was paralleled by additional specific changes in the aged rat brain epilipidome. There was a profound increase in phosphocholine hydroxides, and a significant decrease in phosphocholine-esterified azelaic acid. As phospholipid-esterified fatty acid hydroxides, and especially those deriving from arachidonic acid are both markers and effectors of inflammation, the findings suggest that in addition to age-related reactive oxygen species (ROS) accumulation, age-related impairment of spatial memory performance has an additional and distinct (neuro-) inflammatory component.

Also flagged:Obesitycardiovascular diseaseheart failure preservedchemokine receptorsdiabetesadhesion molecules
Journal Article 2022-07-11 ✓ 1 Snippet Almengló C, Fu X, Flores-Arias MT, Fernández ÁL, Viñuela JE, Martínez-Cereijo JM, Durán D, Rodríguez-Mañero M, González-Juanatey JR, Eiras S.
In-Text Gene Mentions

…TACCATTGA‐3′), olfatomedin‐4 (OLFM4) (F:5′‐AGCTCTTTCCCAGGTGTTGA‐3…

Show Full Abstract

The adiposity invokes innate immune activity, coronary microvascular dysfunction and consequently heart failure preserved ejection fraction (HFpEF). Our aim was to study the neutrophils profile on obesity and cardiovascular disease and its regulation by adipose tissue-secretome and dapagliflozin. We have isolated neutrophils from patients undergoing open heart surgery (19 women and 51 men). Its migration activity was performed with culture-transwell, transcriptional studies of proteolytic enzymes, adhesion molecules or receptors were analysed by real-time PCR and proteomics (from 20 patients) analysis by TripleTOF mass spectrometer. Differentiated HL-60 (dHL-60) was used as a preclinical model on microfluidic for endothelial cells attaching assays and genes regulation with epicardial and subcutaneous fat secretomes from patients (3 women and 9 men) or dapagliflozin 1-10 μM treatments. The transcriptional and proteomics studies have determined higher levels of adhesion molecules in neutrophils from patients with obesity. The adhesion molecule CD11b levels were higher in those patients with the combined obesity and HFpEF factors (1.70 ± 0.06 a.u. without obesity, 1.72 ± 0.04 a.u. obesity or HFpEF without obesity and 1.79 ± 0.08 a.u. obesity and HFpEF; p < .01). While fat-secretome induces its upregulation, dapagliflozin can modulated it. Because CD11b upregulation is associated with higher neutrophils migration and adhesion into endothelial cells, dapagliflozin might modulate this mechanism on patients with obesity and HFpEF.

Also flagged:myeloid neoplasmsmyelodysplastic syndromesmyeloproliferative neoplasmsmyelodysplastic/myeloproliferative neoplasmsacute myeloid leukemiaAML
Journal Article 2022-07-11 ✓ 1 Snippet Leguit RJ, Orazi A, Kucine N, Kvasnicka HM, Gianelli U, Arber DA, Porwit A, Ponzoni M.
In-Text Gene Mentions

Others typically present later in childhood (median age varying between 6.6 and 12.4 years), such as AML with t(10;11)(p12;q14); PICALM::MLLT10, AML with t(6;9)(p23;34.1); DEK::NUP214, AML with t(16;21)(p11;q22); FUS::ERG, AML with t(16;21)(q24;q22); RUNX1::CBFA2T3, AML with t(5;11); NUP98::NSD1, AML with t(6;11)(q27;q23.3); KMT2A::MLLT4, and AML with t(15;17)(q24.1;q21.2); PML::RARA [83].

Show Full Abstract

The first section of the bone marrow workshop of the European Association of Haematopathology (EAHP) 2020 Virtual Meeting was dedicated to pediatric myeloid neoplasms. The section covered the whole spectrum of myeloid neoplasms, including myelodysplastic syndromes (MDS), myeloproliferative neoplasms (MPN), myelodysplastic/myeloproliferative neoplasms (MDS/MPN), and acute myeloid leukemia (AML). The workshop cases are hereby presented, preceded by an introduction on these overall rare diseases in this age group. Very rare entities such as primary myelofibrosis, pediatric MDS with fibrosis, and MDS/MPN with JMML-like features and t(4;17)(q12;q21); FIP1L1::RARA fusion, are described in more detail.

Also flagged:methylationN6-methyladenosinemetabolismneurodegenerative disordersHDFTO
Journal Article 2022-07-11 ✓ 5 Snippets Pupak A, Singh A, Sancho-Balsells A, Alcalá-Vida R, Espina M, Giralt A, Martí E, Ørom UAV, Ginés S, Brito V.
In-Text Gene Mentions

At both stages, we identified changes in the levels of m6A in different genes linked to HD, such as Pde10a and Eif3b (at 5 months), Kalrn, Ntrk2, Gnaq, Grin2b, Dyrk1a (at 8 months) and Htt itself (at 5 and 8 months), thus strengthening our hypothesis that altered m6A methylation plays a role in HD pathology (Tables 1 and 2).

Here, we identified in a HD mice model, hypermethylation in several transcripts of genes previously described to be altered in HD such as, Pde10a [80, 81], Eif3b [82], Kalrn [47], Ntrk2 [83], Grin2b [84, 85], Dyrk1a [86] and Htt itself.

…8 months) andHttitself (at 5…

…86 ] andHttitself.…

…1 of mHtt, in both 5-…

Show Full Abstract

N6-methyladenosine (m6A) regulates many aspects of RNA metabolism and is involved in learning and memory processes. Yet, the impact of a dysregulation of post-transcriptional m6A editing on synaptic impairments in neurodegenerative disorders remains unknown. Here we investigated the m6A methylation pattern in the hippocampus of Huntington's disease (HD) mice and the potential role of the m6A RNA modification in HD cognitive symptomatology. m6A modifications were evaluated in HD mice subjected to a hippocampal cognitive training task through m6A immunoprecipitation sequencing (MeRIP-seq) and the relative levels of m6A-modifying proteins (FTO and METTL14) by subcellular fractionation and Western blot analysis. Stereotaxic CA1 hippocampal delivery of AAV-shFTO was performed to investigate the effect of RNA m6A dysregulation in HD memory deficits. Our results reveal a m6A hypermethylation in relevant HD and synaptic related genes in the hippocampal transcriptome of Hdh<sup>+/Q111</sup> mice. Conversely, m6A is aberrantly regulated in an experience-dependent manner in the HD hippocampus leading to demethylation of important components of synapse organization. Notably, the levels of RNA demethylase (FTO) and methyltransferase (METTL14) were modulated after training in the hippocampus of WT mice but not in Hdh<sup>+/Q111</sup> mice. Finally, inhibition of FTO expression in the hippocampal CA1 region restored memory disturbances in symptomatic Hdh<sup>+/Q111</sup> mice. Altogether, our results suggest that a differential RNA methylation landscape contributes to HD cognitive symptoms and uncover a role of m6A as a novel hallmark of HD.

Also flagged:gapdhil-6ccl2cxcl5cxcl2cxcl1
Journal Article 2022-07-11 No Snippets Sung PS, Yang SP, Peng YC, Sun CP, Tao MH, Hsieh SL.
Show Full Abstract

<h4>Background</h4>Coronavirus-induced disease 19 (COVID-19) infects more than three hundred and sixty million patients worldwide, and people with severe symptoms frequently die of acute respiratory distress syndrome (ARDS). Recent studies indicated that excessive neutrophil extracellular traps (NETs) contributed to immunothrombosis, thereby leading to extensive intravascular coagulopathy and multiple organ dysfunction. Thus, understanding the mechanism of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-induced NET formation would be helpful to reduce thrombosis and prevent ARDS in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection.<h4>Methods</h4>We incubated SARS-CoV-2 with neutrophils in the presence or absence of platelets to observe NET formation. We further isolated extracellular vesicles from COVID-19 patients' sera (COVID-19-EVs) to examine their ability to induce NET formation.<h4>Results</h4>We demonstrated that antagonistic mAbs against anti-CLEC5A mAb and anti-TLR2 mAb can inhibit COVID-19-EVs-induced NET formation, and generated clec5a<sup>-/-</sup>/tlr2<sup>-/-</sup> mice to confirm the critical roles of CLEC5A and TLR2 in SARS-CoV-2-induced lung inflammation in vivo. We found that virus-free extracellular COVID-19 EVs induced robust NET formation via Syk-coupled C-type lectin member 5A (CLEC5A) and TLR2. Blockade of CLEC5A inhibited COVID-19 EVs-induced NETosis, and simultaneous blockade of CLEC5A and TLR2 further suppressed SARS-CoV-2-induced NETosis in vitro. Moreover, thromboinflammation was attenuated dramatically in clec5a<sup>-/-</sup>/tlr2<sup>-/-</sup> mice.<h4>Conclusions</h4>This study demonstrates that SARS-CoV-2-activated platelets produce EVs to enhance thromboinflammation via CLEC5A and TLR2, and highlight the importance of CLEC5A and TLR2 as therapeutic targets to reduce the risk of ARDS in COVID-19 patients.

Also flagged:NLRP3rheumatoid arthritisPhospholipase C-like 1catalytic activityPLCRA
Journal Article 2022-07-11 ✓ 5 Snippets Luo S, Li XF, Yang YL, Song B, Wu S, Niu XN, Wu YY, Shi W, Huang C, Li J.
In-Text Gene Mentions

The aim of this research was to find the function and underlying mechanisms of PLCL1 in fibroblast-like synoviocyte (FLS) of rheumatoid arthritis (RA).<h4>Methods</h4>In this study, we first analyzed the expression of PLCL1 in the synovial tissue of RA patients and K/BxN mice by immunohistochemical staining.

PLCL1 regulates fibroblast-like synoviocytes inflammation via NLRP3 inflammasomes in rheumatoid arthritis.

INF39 could counteract the release of inflammatory cytokines caused by overexpression of PLCL1.<h4>Conclusion</h4>Result showed that the function of PLCL1 in RA FLS might be related to the NLRP3 inflammasomes.

Our results suggested that PLCL1 might promote the inflammatory response of RA FLS by regulating the NLRP3 inflammasomes.

PLCL1regulates fibroblast-like syno…

Show Full Abstract

<h4>Background</h4>Phospholipase C-like 1 (PLCL1), a protein that lacks catalytic activity, has similar structures to the PLC family. The aim of this research was to find the function and underlying mechanisms of PLCL1 in fibroblast-like synoviocyte (FLS) of rheumatoid arthritis (RA).<h4>Methods</h4>In this study, we first analyzed the expression of PLCL1 in the synovial tissue of RA patients and K/BxN mice by immunohistochemical staining. Then silencing or overexpressing PLCL1 in FLS before stimulating by TNF-α. The levels of IL-6, IL-1β and CXCL8 in FLS and supernatants were detected by Western Blot (WB), Real-Time Quantitative PCR and Enzyme Linked Immunosorbent Assay. We used INF39 to specifically inhibit the activation of NLRP3 inflammasomes, and detected the expression of NLRP3, Cleaved Caspase-1, IL-6 and IL-1β in FLS by WB.<h4>Result</h4>When PLCL1 was silenced, the level of IL-6, IL-1β and CXCL8 were down-regulated. When PLCL1 was overexpressed, the level of IL-6, IL-1β and CXCL8 were unregulated. The previous results demonstrated that the mechanism of PLCL1 regulating inflammation in FLS was related to NLRP3 inflammasomes. INF39 could counteract the release of inflammatory cytokines caused by overexpression of PLCL1.<h4>Conclusion</h4>Result showed that the function of PLCL1 in RA FLS might be related to the NLRP3 inflammasomes. We finally confirmed our hypothesis with the NLRP3 inhibitor INF39. Our results suggested that PLCL1 might promote the inflammatory response of RA FLS by regulating the NLRP3 inflammasomes.

Also flagged:serotonin transporter1B receptorserotoninserotonin (5-HT) 1B receptor5-HT transporterbinding
Journal Article 2022-07-11 ✓ 5 Snippets Svensson JE, Tiger M, Plavén-Sigray P, Halldin C, Schain M, Lundberg J.
In-Text Gene Mentions

The first choice of pharmacological treatment for MDD and most anxiety disorders are selective serotonin reuptake inhibitors (SSRIs) [5, 6], blocking the 5-HT transporter (5-HTT) [7].

Interestingly, a direct link between 5-HT1B autoreceptors and 5-HTT have been suggested, with increased serotonin reuptake upon 5-HT1B receptor activation in synaptosomes, as well as decreased 5-HTT activity after 5-HT1B receptor antagonist administration [15, 16].

…the 5-HT transporter (5-HTT) [ 7 ].…

5-HTTis exclusively located…

…1B autoreceptors and5-HTThave been suggested,…

Show Full Abstract

Synaptic serotonin levels in the brain are regulated by active transport into the bouton by the serotonin transporter, and by autoreceptors, such as the inhibitory serotonin (5-HT) 1B receptor which, when activated, decreases serotonin release. Animal studies have shown a regulatory link between the two proteins. Evidence of such coupling could translate to an untapped therapeutic potential in augmenting the effect of selective serotonin reuptake inhibitors through pharmacological modulation of 5-HT<sub>1B</sub> receptors. Here we will for the first time in vivo examine the relationship between 5-HT<sub>1B</sub> receptors and serotonin transporters in the living human brain. Seventeen healthy individuals were examined with PET twice, using the radioligands [11C]AZ10419369 and [<sup>11</sup>C]MADAM for quantification of the 5-HT<sub>1B</sub> receptor and the 5-HT transporter, respectively. The binding potential was calculated for a set of brain regions, and the correlations between the binding estimates of the two radioligands were studied. [<sup>11</sup>C]AZ10419369 and [<sup>11</sup>C]MADAM binding was positively correlated in all examined brain regions. In most cortical regions the correlation was strong, e.g., frontal cortex, r(15) = 0.64, p = 0.01 and parietal cortex, r(15) = 0.8, p = 0.0002 while in most subcortical regions, negligible correlations was observed. Though the correlation estimates in cortex should be interpreted with caution due to poor signal to noise ratio of [<sup>11</sup>C]MADAM binding in these regions, it suggests a link between two key proteins involved in the regulation of synaptic serotonin levels. Our results indicate a need for further studies to address the functional importance of 5-HT<sub>1B</sub> receptors in treatment with drugs that inhibit serotonin reuptake.

Also flagged:gastric cancercancerscancerexonucleaseRNA binding proteinsQKI
Journal Article 2022-07-11 No Snippets Wang X, Zhang J, Cao G, Hua J, Shan G, Lin W.
Show Full Abstract

Gastric cancer (GC) is an aggressive malignancy with a high mortality rate and poor prognosis, primarily caused by metastatic lesions. Improved understanding of GC metastasis at the molecular level yields meaningful insights into potential biomarkers and therapeutic targets. Covalently closed circular RNAs (circRNAs) have emerged as crucial regulators in diverse human cancers including GC. Furthermore, accumulating evidence has demonstrated that circRNAs exhibit the dysregulated patterns in GC and have emerged as crucial regulators in GC invasion and metastasis. However, systematic knowledge regarding the involvement of circRNAs in metastatic GC remains obscure. In this review, we outline the functional circRNAs related to GC metastasis and drug resistance and discuss their underlying mechanisms, providing a comprehensive delineation of circRNA functions on metastatic GC and shedding new light on future therapeutic interventions for GC metastases.

Also flagged:SRCCDH6RPSAMYCLCD82K-cadherin
Journal Article 2022-07-11 ✓ 5 Snippets Zhang Y, Feng Z, Xu Y, Jiang S, Zhang Q, Zhang Z, Wang K, Li X, Xu L, Yuan M, Chen Z, Cui J, Wu H, Gao Y, Wei W, Wang B, Zuo Y, Ren S.
In-Text Gene Mentions

FBXL4

The results of actinomycin D showed that the half-life of circFBXL4 was much longer than that of the linear FBXL4 transcript, circFBXL4 was more stable than mFBXL4 (Fig. 4G).

…with its receptorBTN3A3[ 6 ].…

…linear transcripts ofFBXL4were identified with…

…of the linearFBXL4transcript, circFBXL4 was…

Show Full Abstract

Liver and lymph node sinusoidal endothelial cell C-type lectin (LSECtin) plays an important regulatory role in a variety of diseases, including tumors. However, the underlying mechanism of LSECtin in gastric cancer (GC) remains largely unknown. In our research, LSECtin promoted the adhesion and invasion of GC cells, and was involved in lymphatic metastasis of GC cells. Mechanistically, LSECtin promoted the adhesion, proliferation and migration of GC cells by downregulating STAT1 expression. The circular RNA circFBXL4, which is regulated by LSECtin, sponges the microRNA miR-146a-5p to regulate STAT1 expression. The promotion of GC cell proliferation, migration and invasion mediated by LSECtin was largely inhibited by circFBXL4 overexpression or miR-146a-5p silencing. Moreover, in its role as a transcription factor, STAT1 modulated the expression of FN1 and CHD4. In conclusion, LSECtin might be involved in the lymphatic metastasis of GC by upregulating the expression of FN1 and CHD4 via the circFBXL4/miR-146a-5p/STAT1 axis, possibly indicating a newly discovered pathogenic mechanism.

Also flagged:nonalcoholic fatty liver diseaseNAFLDobesityaminotransferaselipidHemoglobin
Journal Article 2022-07-11 ✓ 1 Snippet Khurana T, Klepper C, Fei L, Sun Q, Bramlage K, Arce-Clachar AC, Xanthakos S, Mouzaki M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>To investigate the prevalence and characteristics of children with nonalcoholic fatty liver disease (NAFLD) who reduce their body mass index (BMI) z-score (BMIz) by >.25, a goal in obesity medicine, and to determine the BMIz decrease needed for serum aminotransferase normalization.<h4>Study design</h4>This retrospective, single-center study included patients aged <18 years followed for NAFLD. Patients who had undergone weight loss surgery or had other reasons for weight loss/gain were excluded. Logistic regression was used to determine the odds of achieving a BMIz change of >-.25, as well as predictors of this outcome.<h4>Results</h4>Of the 784 children who met the study criteria (median age, 13 years; 66% male; 24% Hispanic), 541 had a lowest BMIz at >90 days following the baseline clinic visit. Of these children, 168 (31%) had a BMIz change of >-.25 from baseline over a median of 367 days (IQR, 201-678 days). Decreases in serum aminotransferase and lipid levels were seen in both groups (with and without a BMIz change of >-.25); however, these decreases were more pronounced in children who achieved a BMIz drop of >.25. Hemoglobin A1c concentration did not change in either group. Young age (OR, .861; 95% CI, .81-.92; P < .01) and non-Hispanic ethnicity (OR of non-Hispanic vs Hispanic, .61; 95% CI, .38-.97; P < .04) were predictors of a BMIz change >-.25. The BMIz decrease associated with normalization of serum alanine aminotransferase was .27.<h4>Conclusions</h4>A BMIz reduction of >.25 is associated with significant changes in serum aminotransferase levels. These findings can further guide the clinical management of children with NAFLD.

Also flagged:schizophreniabrain disordersmitochondrialneuropsychiatric disordershallucinationsdelusions
Journal Article 2022-07-11 No Snippets Sebastian R, Song Y, Pak C.
Show Full Abstract

With recent advancements in psychiatric genomics, as a field, "stem cell-based disease modelers" were given the exciting yet daunting task of translating the extensive list of disease-associated risks into biologically and clinically relevant information in order to deliver therapeutically meaningful leads and insights. Despite their limitations, human induced pluripotent stem cell (iPSCs) based models have greatly aided our understanding of the molecular and cellular mechanisms underlying the complex etiology of brain disorders including schizophrenia (SCZ). In this review, we summarize the major findings from studies in the past decade which utilized iPSC models to investigate cell type-specific phenotypes relevant to idiopathic SCZ and disease penetrant alleles. Across cell type differences, several biological themes emerged, serving as potential neurodevelopmental mechanisms of SCZ, including oxidative stress and mitochondrial dysfunction, depletion of progenitor pools and insufficient differentiation potential of these progenitors, and structural and functional deficits of neurons and other supporting cells. Here, we discuss both the recent progress as well as challenges and improvements needed for future studies utilizing iPSCs as a model for SCZ and other neuropsychiatric disorders.

Also flagged:parkinsonismneurodegenerative diseasepsychological disorderscognitive declineataxiadystonia
Journal Article 2022-07-11 ✓ 2 Snippets Salari M, Beladi Moghadam N, Soleimani S, Etemadifar M.
In-Text Gene Mentions

…within the huntingtin (HTT) gene range from…

…the Huntingtin gene (HTT).…

Show Full Abstract

Huntington's disease is a progressive neurodegenerative disease that typically manifests with Choreic movements, psychological disorders, and cognitive decline. Some patients can initially present atypical movements other than the usual symptoms, such as parkinsonism, ataxia, and dystonia. In this report, we present an HD patient who presented with atypical parkinsonism.

Also flagged:neurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseamyotrophic lateral sclerosisHuntington's diseaseneurodegenerative disorders
Journal Article 2022-07-11 ✓ 2 Snippets Qin N, Geng A, Xue R.
In-Text Gene Mentions

Moreover, mutated HTT was found to impair NHEJ by disrupting the formation of the Ku70/Ku80 heterodimer in striatal neurons from transgenic HD mice [169].

Mutant HTT destroys the functional TC-NER complex by impairing the activity of PNKP and ATXN3 and subsequently suppresses DNA repair in HD mice and cell models [168].

Show Full Abstract

As the population ages, age-related neurodegenerative diseases have become a major challenge in health science. Currently, the pathology of neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease, is still not fully understood. Remarkably, emerging evidence indicates a role of genomic DNA damage and repair in various neurodegenerative disorders. Here, we summarized the current understanding of the function of DNA damage repair, especially base excision repair and double strand break repair pathways, in a variety of neurodegenerative diseases. We concluded that exacerbation of DNA lesions is found in almost all types of neurodegenerative diseases, whereas the activities of different DNA repair pathways demonstrate distinct trends, depending on disease type and even brain region. Specifically, key enzymes involved in base excision repair are likely impaired in Alzheimer's disease and amyotrophic lateral sclerosis but activated in Parkinson's disease, while nonhomologous end joining is likely downregulated in most types of neurodegenerative diseases. Hence, impairment of nonhomologous end joining is likely a common etiology for most neurodegenerative diseases, while defects in base excision repair are likely involved in the pathology of Alzheimer's disease and amyotrophic lateral sclerosis but are Parkinson's disease, based on current findings. Although there are still discrepancies and further studies are required to completely elucidate the exact roles of DNA repair in neurodegeneration, the current studies summarized here provide crucial insights into the pathology of neurodegenerative diseases and may reveal novel drug targets for corresponding neurodegenerative diseases.

Also flagged:SIRT6Vascular DiseasesAgingcardiovascular diseasesheart failurehypertension
Journal Article 2022-07-11 No Snippets Ren SC, Chen X, Gong H, Wang H, Wu C, Li PH, Chen XF, Qu JH, Tang X.
Show Full Abstract

Aging is a key risk factor for angiogenic dysfunction and cardiovascular diseases, including heart failure, hypertension, atherosclerosis, diabetes, and stroke. Members of the NAD<sup>+</sup>-dependent class III histone deacetylase family, sirtuins, are conserved regulators of aging and cardiovascular and cerebrovascular diseases. The sirtuin SIRT6 is predominantly located in the nucleus and shows deacetylase activity for acetylated histone 3 lysine 56 and lysine 9 as well as for some non-histone proteins. Over the past decade, experimental analyses in rodents and non-human primates have demonstrated the critical role of SIRT6 in extending lifespan. Recent studies highlighted the pleiotropic protective actions of SIRT6 in angiogenesis and cardiovascular diseases, including atherosclerosis, hypertension, heart failure, and stroke. Mechanistically, SIRT6 participates in vascular diseases <i>via</i> epigenetic regulation of endothelial cells, vascular smooth muscle cells, and immune cells. Importantly, SIRT6 activators (e.g., MDL-800/MDL-811) have provided therapeutic value for treating age-related vascular disorders. Here, we summarized the roles of sirtuins in cardiovascular diseases; reviewed recent advances in the understanding of SIRT6 in vascular biology, cardiovascular aging, and diseases; highlighted its therapeutic potential; and discussed future perspectives.

Also flagged:nephrotic syndromekidney diseaseswaterglomerular filtrationmembranedyslipidemia
Journal Article 2022-07-11 No Snippets Li Q, Yin M, Zhang Z, Yu Y, Liu F.
Show Full Abstract

<h4>Background</h4>Nephrotic syndrome is an enormous public healthy threaten, which causes a variety of complications and secondary disease; however, the molecular mechanism of nephrotic syndrome remains unclear.<h4>Methods</h4>In our study, RNA-seq were used to test the transcription level of patients with nephrotic syndrome, in order to investigate the interaction of circRNA-miRNA-mRNA in nephrotic syndrome patients.<h4>Results</h4>Consistent with our hypothesis, miRNAs were confirmed to be associated with nephrotic syndrome, majority of their targeting circRNAs downregulated in nephrotic syndrome patients and at the same time, the KEGG pathway analysis found that target genes of the circRNAs bonding miRNAs was highly correlated with the occurrence of kidney diseases.<h4>Conclusion</h4>Thus, we can draw a conclusion that downregulated circRNAs cause miRNA expressing aberrant and then affect the expression level of mRNA, finally leading to the generation of nephrotic syndrome.

Also flagged:cancerphosphoantigensBTN3A1mevalonateisopentenylpyrophosphate
Journal Article 2022-07-11 ✓ 5 Snippets Chan KF, Duarte JDG, Ostrouska S, Behren A.
In-Text Gene Mentions

Butyrophilin 2A1 and 3A1 (BTN2A1 and BTN3A1); cyclooxygenase-2 (COX2); granulocyte-macrophage colony stimulating factor (GM-CSF); granzyme B (GzmB); human leukocyte antigen-DR (HLA-DR); immunoglobulin A, E, or G (IgA, IgE, or IgG); inducible T-cell co-stimulator (ICOS); ICOS ligand (ICOS-L); interferon-γ (IFN-γ); major histocompatibility complex class I and II (MHC-I and -II); MHC class I chain-related antigens A and B (MICA and MICB); natural killer group 2D (NKG2D); programmed cell death 1 (PD-1); PD-1 ligand 1 (PD-L1); prostaglandin E2 (PGE2); reactive oxygen species (ROS); T-cell receptor (TCR); tumor necrosis factor-α (TNF-α); UL16-binding protein (ULBP).

Neutrophils can take up zoledronate, and despite also expressing BTN2A1 and BTN3A1, they do not have the capability of activating Vγ9Vδ2+ T cells, which may be due to their extremely limited production and accumulation of IPP (276–278).

Subsequently, the germline-encoded regions of the TCR Vγ9 chain directly bind to BTN2A1 on tumor cells (3, 32, 33), as described by us and confirmed later by others (34–36).

Conversely, some B cells can express BTN2A1 and BTN3A1, required for Vγ9Vδ2+ T-cell activation (33–35), thereby directly influencing Vδ2+ γδ T-cell activation (218, 219) as shown by early studies using Daudi cells, a B-cell malignancy cell line (Burkitt’s lymphoma) (220–226).

Following phosphoantigen binding to the intracellular B30.2 domains of BTN3A1 in tumor or pathogen-infected cells (27), BTN3A1 undergoes a conformational change (28–30) and promotes the interaction between BTN2A1 and BTN3A1 intracellular domains (31).

Show Full Abstract

A growing number of studies have shown that γδ T cells play a pivotal role in mediating the clearance of tumors and pathogen-infected cells with their potent cytotoxic, cytolytic, and unique immune-modulating functions. Unlike the more abundant αβ T cells, γδ T cells can recognize a broad range of tumors and infected cells without the requirement of antigen presentation <i>via</i> major histocompatibility complex (MHC) molecules. Our group has recently demonstrated parts of the mechanisms of T-cell receptor (TCR)-dependent activation of Vγ9Vδ2<sup>+</sup> T cells by tumors following the presentation of phosphoantigens, intermediates of the mevalonate pathway. This process is mediated through the B7 immunoglobulin family-like butyrophilin 2A1 (BTN2A1) and BTN3A1 complexes. Such recognition results in activation, a robust immunosurveillance process, and elicits rapid γδ T-cell immune responses. These include targeted cell killing, and the ability to produce copious quantities of cytokines and chemokines to exert immune-modulating properties and to interact with other immune cells. This immune cell network includes αβ T cells, B cells, dendritic cells, macrophages, monocytes, natural killer cells, and neutrophils, hence heavily influencing the outcome of immune responses. This key role in orchestrating immune cells and their natural tropism for tumor microenvironment makes γδ T cells an attractive target for cancer immunotherapy. Here, we review the current understanding of these important interactions and highlight the implications of the crosstalk between γδ T cells and other immune cells in the context of anti-tumor immunity.

Also flagged:watermetalsanaemiakidney damagepulmonary diseasemineral
Journal Article 2022-07-11 No Snippets Magara G, Varello K, Pastorino P, Francese DR, Arsieni P, Pezzolato M, Masoero L, Messana E, Caldaroni B, Abete MC, Pederiva S, Squadrone S, Elia AC, Prearo M, Bozzetta E.
Show Full Abstract

The toxicity of water samples from water distribution plants needs to be investigated further. Indeed, studies on the pro-oxidant effects driven by tap water are very limited. In this study, the water quality, pro-oxidant effects, and potential health risks driven by exposure to groundwater samples from two water plants (sites A and B) located in Northwestern Italy were investigated in a multi-level system. Physicochemical parameters and the absence of pathogens, cyanotoxins, and endocrine active substances indicated a good water quality for both sites. The 25 metals analyzed were found under the limit of quantification or compliant with the maximum limits set by national legislation. Water samples were concentrated by the solid-phase extraction system in order to assess the aquatic toxicity on Epithelioma papulosum cyprini (EPC) cell line. Levels of superoxide dismutase, catalase, glutathione peroxidase, glutathione S-transferase, and glutathione reductase were evaluated through the Integrated Biomarkers Response (IBRv2) index. EPC cell line was found a sensible model for assessing the antioxidant responses driven by both water concentrates. A similar antioxidant response was shown by plots and IBRv2 suggesting a muted risk for the two sampling sites.

Also flagged:Osteoporosissystemic skeletal disorderdegradationbone formationmetabolismvitamin D
Journal Article 2022-07-11 No Snippets Kydonaki EK, Freitas L, Reguengo H, Simón CR, Bastos AR, Fernandes EM, Canadas RF, Oliveira JM, Correlo VM, Reis RL, Vliora M, Gkiata P, Koutedakis Y, Ntina G, Pinto R, Carrillo AE, Marques F, Amorim T.
Show Full Abstract

Osteoporosis is defined by loss of bone mass and deteriorated bone microarchitecture. The present study compared the effects of available pharmacological and non-pharmacological agents for osteoporosis [alendronate (ALE) and concomitant supplementation of vitamin D (VD) and calcium (Ca)] with the effects of bovine colostrum (BC) supplementation in ovariectomized (OVX) and orchidectomized (ORX) rats. Seven-month-old rats were randomly allocated to: (1) placebo-control, (2) ALE group (7.5 μg/kg of body weight/day/5 times per week), (3) VD/Ca group (VD: 35 μg/kg of body weight/day/5 times per week; Ca: 13 mg/kg of body weight/day/3 times per week), and (4) BC supplementation (OVX: 1.5 g/day/5 times per week; ORX: 2 g/day/5 times per week). Following four months of supplementation, bone microarchitecture, strength and bone markers were evaluated. ALE group demonstrated significantly higher Ct.OV, Ct.BMC, Tb.Th, Tb.OV and Tb.BMC and significantly lower Ct.Pr, Tb.Pr, Tb.Sp, Ct.BMD and Tb.BMD, compared to placebo (p < 0.05). BC presented significantly higher Ct.Pr, Ct.BMD, Tb.Pr, Tb.Sp, and Tb.BMD and significantly lower Ct.OV, Ct.BMC, Tb.Th, Tb.OV and Tb.BMC compared to ALE in OVX rats (p < 0.05). OVX rats receiving BC experienced a significant increase in serum ALP and OC levels post-supplementation (p < 0.05). BC supplementation may induce positive effects on bone metabolism by stimulating bone formation, but appear not to be as effective as ALE.

Also flagged:respiratory diseasesrespiratory diseaselactic-co-glycolic acidtranslationalCOVID-19death
Journal Article 2022-07-11 No Snippets Areny-Balagueró A, Mekseriwattana W, Camprubí-Rimblas M, Stephany A, Roldan A, Solé-Porta A, Artigas A, Closa D, Roig A.
Show Full Abstract

Nearly four million yearly deaths can be attributed to respiratory diseases, prompting a huge worldwide health emergency. Additionally, the COVID-19 pandemic's death toll has surpassed six million, significantly increasing respiratory disease morbidity and mortality rates. Despite recent advances, it is still challenging for many drugs to be homogeneously distributed throughout the lungs, and specifically to reach the lower respiratory tract with an accurate sustained dose and minimal systemic side effects. Engineered nanocarriers can provide increased therapeutic efficacy while lessening potential biochemical adverse reactions. Poly(lactic-co-glycolic acid) (PLGA), a biodegradable polymer, has attracted significant interest as an inhalable drug delivery system. However, the influence of the nanocarrier surface charge and its intratracheal instillation has not been addressed so far. In this study, we fabricated red fluorescent PLGA nanocapsules (NCs)-Cy5/PLGA-with either positive (Cy5/PLGA+) or negative surface charge (Cy5/PLGA-). We report here on their excellent colloidal stability in culture and biological media, and after cryo-storage. Their lack of cytotoxicity in two relevant lung cell types, even for concentrations as high as 10 mg/mL, is also reported. More importantly, differences in the NCs' cell uptake rates and internalization capacity were identified. The uptake of the anionic system was faster and in much higher amounts-10-fold and 2.5-fold in macrophages and epithelial alveolar cells, respectively. The in vivo study demonstrated that anionic PLGA NCs were retained in all lung lobules after 1 h of being intratracheally instilled, and were found to accumulate in lung macrophages after 24 h, making those nanocarriers especially suitable as a pulmonary immunomodulatory delivery system with a marked translational character.

Also flagged:SenescenceTumorBladder cancercancercellular senescencecell cycle
Journal Article 2022-07-11 ✓ 1 Snippet Sun JX, Liu CQ, Xu JZ, An Y, Xu MY, Zhong XY, Zeng N, Ma SY, He HD, Zhang ZB, Wang SG, Xia QD.
In-Text Gene Mentions

…genes including RB1,DCC, TP53, LAMA3, VPS13D,…

Show Full Abstract

Bladder cancer (BCa) is the 10th most commonly diagnosed cancer worldwide, and cellular senescence is defined as a state of permanent cell cycle arrest and considered to play important roles in the development and progression of tumor. However, the comprehensive effect of senescence in BCa has not ever been systematically evaluated. Using the genome-wide CRISPR screening data acquired from DepMap (Cancer Dependency Map), senescence genes from the CellAge database, and gene expression data from The Cancer Genome Atlas (TCGA), we screened out 12 senescence genes which might play critical roles in BCa. A four-cell-senescence-regulator-gene prognostic index was constructed using the least absolute shrinkage and selection operator (LASSO) and multivariate COX regression model. The transcriptomic data and clinical information of BCa patients were downloaded from TCGA and Gene Expression Omnibus (GEO). We randomly divided the patients in TCGA cohort into training and testing cohorts and calculated the risk score according to the expression of the four senescence genes. The validity of this risk score was validated in the testing cohort (TCGA) and validation cohort (GSE13507). The Kaplan-Meier curves revealed a significant difference in the survival outcome between the high- and low-risk score groups. A nomogram including the risk score and other clinical factors (age, gender, stage, and grade) was established with better predictive capacity of OS in 1, 3, and 5 years. Besides, we found that patients in the high-risk group had higher tumor mutation burden (TMB); lower immune, stroma, and ESTIMATE scores; higher tumor purity; aberrant immune functions; and lower expression of immune checkpoints. We also performed gene set variation analysis (GSVA) and gene set enrichment analysis (GSEA) to investigate the interaction between risk score and hallmark pathways and found that a high risk score was connected with activation of senescence-related pathways. Furthermore, we found that a high risk score was related to better response to immunotherapy and chemotherapy. In conclusion, we identified a four-cell-senescence-regulator-gene prognostic index in BCa and investigated its relationship with TMB, the immune landscape of tumor microenvironment (TME), and response to immunotherapy and chemotherapy, and we also established a nomogram to predict the prognosis of patients with BCa.

Also flagged:Bladder cancermalignant cancers of the urinarytumorbladder tumorsmetastatic cancercisplatin
Journal Article 2022-07-11 ✓ 4 Snippets Xu W, Tang HJ, Anwaier A, Liu W, Tian X, Su J, Wei S, Qu Y, Zhang H, Ye D.
In-Text Gene Mentions

In the CDI pathway, a prognostic model was developed based on 36 genes, with DRD5, IGF1, and SLC2A14 expression levels being the most significantly involved in the model classification.

…Abcam, Cambridge, U.K.),SLC2A14(QC354Hu01, QchengBio, Shangha…

…IGF1 , andSLC2A14expression levels being…

SLC2A14and IGF1 showed…

Show Full Abstract

Bladder cancer is one of the most common genitourinary malignant cancers worldwide. Cell death processes, including apoptosis, ferroptosis, and necrosis, provide novel clinical and immunological insights promoting the management of precision medicine. Therefore, this study aimed to evaluate the transcriptomic profile of signatures in cell death pathways with significant prognostic implications in patients with bladder cancer from multiple independent cohorts (n = 1999). First, genes involved in apoptosis (n = 19), ferroptosis (n = 31), and necrosis (n = 6) were analyzed to evaluate the prognostic implications in bladder cancer. Significant genes were included to establish the cell-death index (CDI) of 36 genes that distinguished patients according to high and low risks. Survival analysis using the Kaplan-Meier curves clustered patients based on overall survival (18.8 vs. 96.7 months; hazard model [HR] = 3.12, <i>P</i><00001). Cox proportional hazard model was significantly associated with a higher risk of mortality using 10 external independent cohorts in patients with CDI<sup>high</sup> (HR = 1.31, 95% CI: 1.04-1.62). To explore immune parameters associated with CDI, microenvironment cell-population-counter algorithms indicated increased intratumoral heterogeneity and macrophage/monocyte infiltration and CD8<sup>+</sup> T cells in patients with CDI<sup>high</sup> group. Besides, the CDI<sup>high</sup> group showed an increased expression of the following immune checkpoints: CD276, PD-L1, CTLA-4, and T-cell exhaustion signatures. Cytokine expression analysis revealed the highest association of IL-9R, IL-17A, IL-17F, GDF7, and IFNW1 with the high-risk group. In addition, 42 patients with BCa receiving immunotherapies were enrolled from a real-world cohort, and expression patterns of three CDI hub genes (DRD5, SCL2A14, and IGF1) were detected using immunohistochemical staining. Patients with triple-negative staining of tumor tissues had significantly higher tumor-associated macrophage abundance, PD-L1 expression, predicted immunocompromised microenvironment, and prominently progressive progression (HR = 4.316, <i>P</i> = 0.0028). In conclusion, this study highlights the immunoevasive tumor microenvironment characterized by the higher tumor-associated macrophage infiltration with the presence of immune checkpoint and T-cell exhaustion genes in patients with BCa at CDI<sup>high</sup> risk who might suffer progression and be more suitable to benefit from immune checkpoint inhibitors or other immunotherapies.

Also flagged:Neuropsychiatric Diseasescaffeineneuropsychiatric disordersInsomnianeuroticismT cell receptor
Journal Article 2022-07-11 ✓ 5 Snippets Yin B, Wang X, Huang T, Jia J.
In-Text Gene Mentions

Reactome enrichment of HATs acetylate histones, HDACs deacetylate histones, HDMs demethylate histones, DNA methylation, and developmental biology together suggested the effects of both genetic and epigenetics on DCC/MDD and DCC/neuroticism.

Among these associations, two gene-tissue pairs (CYP21A2-Brain Cerebellum, ZSCAN9-Brain Cerebellum) were overlapped in TWAS for DCC and MDD.

The dysfunction of SLC39A8 had an impact on alterations in glutamate and immune function, for example, a reduction in GluN2A and GluA1/2/3 receptor surface expression, decreased BBB integrity, and increased IL-6/IL-1β protein expression (53), which may indicate that the occurrence of DCC and MDD, and LCU and insomnia is medicated by glutamate signaling and altered immune and inflammatory signals (54, 55).

Among these associations, two gene-tissue pairs (CYP21A2-Brain Cerebellum, ZSCAN9-Brain Cerebellum) were overlapped in TWAS of DCC and MDD.

⭐ same-sentence co-mention

Furthermore, our results found several genes or gene set significantly associated with DCC and MDD, including ZNFs (ZKSCAN4), BTNs (BTN1A1, BTN2A2, BTN3), and OR2B6.

Show Full Abstract

Coffee or caffeine consumption has been associated with neuropsychiatric disorders, implying a shared etiology. However, whether these associations reflect causality remains largely unknown. To understand the genetic structure of the association between decaffeinated coffee consumption (DCC) and neuropsychiatric traits, we examined the genetic correlation, causality, and shared genetic structure between DCC and neuropsychiatric traits using linkage disequilibrium score regression, bidirectional Mendelian randomization (MR), and genome-wide cross-trait meta-analysis in large GWAS Consortia for coffee consumption (<i>N</i> = 329,671) and 13 neuropsychiatric traits (sample size ranges from 36,052 to 500,199). We found strong positive genetic correlations between DCC and lifetime cannabis use (LCU; Rg = 0.48, <i>P</i> = 8.40 × 10<sup>-19</sup>), alcohol use disorder identification test (AUDIT) total score (AUDIT_T; Rg = 0.40, <i>P</i> = 4.63 × 10<sup>-13</sup>), AUDIT_C score (alcohol consumption component of the AUDIT; Rg = 0.40, <i>P</i> = 5.26 × 10<sup>-11</sup>), AUDIT_P score (dependence and hazardous-use component of the AUDIT; Rg = 0.28, <i>P</i> = 1.36 × 10<sup>-05</sup>), and strong negative genetic correlations between DCC and neuroticism (Rg = -0.15, <i>P</i> = 7.27 × 10<sup>-05</sup>), major depressed diseases (MDD; Rg = -0.15, <i>P</i> = 0.0010), and insomnia (Rg= -0.15, <i>P</i> = 0.0007). In the cross-trait meta-analysis, we identified 6, 5, 1, 1, 2, 31, and 27 shared loci between DCC and Insomnia, LCU, AUDIT_T, AUDIT_C, AUDIT_P, neuroticism, and MDD, respectively, which were mainly enriched in bone marrow, lymph node, cervix, uterine, lung, and thyroid gland tissues, T cell receptor signaling pathway, antigen receptor-mediated signaling pathway, and epigenetic pathways. A large of TWAS-significant associations were identified in tissues that are part of the nervous system, digestive system, and exo-/endocrine system. Our findings further indicated a causal influence of liability to DCC on LCU and low risk of MDD (odds ratio: 0.90, <i>P</i> = 9.06 × 10<sup>-5</sup> and 1.27, <i>P</i> = 7.63 × 10<sup>-4</sup> respectively). We also observed that AUDIT_T and AUDIT_C were causally related to DCC (odds ratio: 1.83 per 1-SD increase in AUDIT_T, <i>P</i> = 1.67 × 10<sup>-05</sup>, 1.80 per 1-SD increase in AUDIT_C, <i>P</i> = 5.09 × 10<sup>-04</sup>). Meanwhile, insomnia and MDD had a causal negative influence on DCC (OR: 0.91, 95% CI: 0.86-0.95, <i>P</i> = 1.51 × 10<sup>-04</sup> for Insomnia; OR: 0.93, 95% CI: 0.89-0.99, <i>P</i> = 6.02 × 10<sup>-04</sup> for MDD). These findings provided evidence for the shared genetic basis and causality between DCC and neuropsychiatric diseases, and advance our understanding of the shared genetic mechanisms underlying their associations, as well as assisting with making recommendations for clinical works or health education.

Also flagged:Oral CancerOSCCcancerdeathautophagyoral tumor
Journal Article 2022-07-11 ✓ 1 Snippet Erfanparast L, Taghizadieh M, Shekarchi AA.
In-Text Gene Mentions

circ-KIAA0907 induces apoptosis of OSCC cells through regulating the miR-96-5p/UNC13C axis.

Show Full Abstract

Oral cancer remains a major public concern with considerable socioeconomic impact in the world. Despite substantial advancements have been made in treating oral cancer, the five-year survival rate for oral cancer remained undesirable, and the molecular mechanisms underlying OSCC carcinogenesis have not been fully understood. Noncoding RNAs (ncRNAs) include transfer RNAs (tRNAs), as well as small RNAs such as microRNAs, and the long ncRNAs such as HOTAIR are a large segment of the transcriptome that do not have apparent protein-coding roles, but they have been verified to play important roles in diverse biological processes, including cancer cell development. Cell death, such as apoptosis, necrosis, and autophagy, plays a vital role in the progression of cancer. A better understanding of the regulatory relationships between ncRNAs and these various types of cancer cell death is therefore urgently required. The occurrence and development of oral cancer can be controlled by increasing or decreasing the expression of ncRNAs, a method which confers broad prospects for oral cancer treatment. Therefore, it is urgent for us to understand the influence of ncRNAs on the development of different modes of oral tumor death, and to evaluate whether ncRNAs have the potential to be used as biological targets for inducing cell death and recurrence of chemotherapy. The purpose of this review is to describe the impact of ncRNAs on cell apoptosis and autophagy in oral cancer in order to explore potential targets for oral cancer therapy.

Also flagged:Peptidepolypeptidesendoplasmic reticulumaminopeptidestransmembrane
Journal Article 2022-07-11 No Snippets Lang S, Nguyen D, Bhadra P, Jung M, Helms V, Zimmermann R.
Show Full Abstract

In human cells, approximately 30% of all polypeptides enter the secretory pathway at the level of the endoplasmic reticulum (ER). This process involves cleavable amino-terminal signal peptides (SPs) or more or less amino-terminal transmembrane helices (TMHs), which serve as targeting determinants, at the level of the precursor polypeptides and a multitude of cytosolic and ER proteins, which facilitate their ER import. Alone or in combination SPs and TMHs guarantee the initial ER targeting as well as the subsequent membrane integration or translocation. Cytosolic SRP and SR, its receptor in the ER membrane, mediate cotranslational targeting of most nascent precursor polypeptide chains to the polypeptide-conducting Sec61 complex in the ER membrane. Alternatively, fully-synthesized precursor polypeptides and certain nascent precursor polypeptides are targeted to the ER membrane by either the PEX-, SND-, or TRC-pathway. Although these targeting pathways may have overlapping functions, the question arises how relevant this is under cellular conditions and which features of SPs and precursor polypeptides determine preference for a certain pathway. Irrespective of their targeting pathway(s), most precursor polypeptides are integrated into or translocated across the ER membrane via the Sec61 channel. For some precursor polypeptides specific Sec61 interaction partners have to support the gating of the channel to the open state, again raising the question why and when this is the case. Recent progress shed light on the client spectrum and specificities of some auxiliary components, including Sec62/Sec63, TRAM1 protein, and TRAP. To address the question which precursors use a certain pathway or component in intact human cells, i.e., under conditions of fast translation rates and molecular crowding, in the presence of competing precursors, different targeting organelles, and relevant stoichiometries of the involved components, siRNA-mediated depletion of single targeting or transport components in HeLa cells was combined with label-free quantitative proteomics and differential protein abundance analysis. Here, we present a summary of the experimental approach as well as the resulting differential protein abundance analyses and discuss their mechanistic implications in light of the available structural data.

Also flagged:Colorectal cancerquinoneslactonesalkaloidspeptidesglycosides
Journal Article 2022-07-11 ✓ 1 Snippet Bahrami Y, Bouk S, Kakaei E, Taheri M.
In-Text Gene Mentions

…KRAS, TP53, andDCCgenes are observed…

Show Full Abstract

Colorectal cancer (CRC) is a common, and deadly disease. Despite the improved knowledge on CRC heterogeneity and advances in the medical sciences, there is still an urgent need to cope with the challenges and side effects of common treatments for the disease. Natural products (NPs) have always been of interest for the development of new medicines. Actinobacteria are known to be prolific producers of a wide range of bioactive NPs, and scientific evidence highlights their important protective role against CRC. This review is a holistic picture on actinobacter-derived cytotoxic compounds against CRC that provides a good perspective for drug development and design in near future. This review also describes the chemical structure of 232 NPs presenting anti-CRC activity with the being majority of quinones, lactones, alkaloids, peptides, and glycosides. The study reveals that most of these NPs are derived from marine actinobacteria followed by terrestrial and endophytic actinobacteria, respectively. They are predominantly produced by <i>Streptomyces</i>, <i>Micromonospors</i>, <i>Saliniospors</i> and <i>Actinomadura</i>, respectively, in which <i>Streptomyces,</i> as the predominant contributor generating over 76% of compounds exclusively. Besides it provides a valuable snapshot of the chemical structure-activity relationship of compounds, highlighting the presence or absence of some specific atoms and chemical units in the structure of compounds can greatly influence their biological activities. To the best of our knowledge, this is the first comprehensive review on natural actinobacterial compounds affecting different types of CRC. Our study reveals that the high diversity of actinobacterial strains and their NPs derivatives, described here provides a new perspective and direction for the production of new anti-CRC drugs and paves the way to innovation for drugs discovery in the future. The knowledge obtain from this review can help us to understand the pivotal application of actinobacteria in future drugs development.

Also flagged:Huntington diseaseneurodegenerative disorderHDglutaminesprolinepolyglutamine
Journal Article 2022-07-11 ✓ 5 Snippets Dawson J, Baine-Savanhu FK, Ciosi M, Maxwell A, Monckton DG, Krause A.
In-Text Gene Mentions

Huntington disease (HD; MIM: 143100) is a dominantly inherited neurodegenerative disorder, caused by expansion of the CAG repeat tract in exon 1 of the huntingtin (HTT; MIM: 613004) gene to 36 or more repeats.1

…the huntingtin (HTT; MIM: 613004…

…Specifically at theHTTlocus, a large…

…this study assessedHTTgenetic diversity in…

…sequence of theHTTprotein.…

Show Full Abstract

Huntington disease (HD)is a dominantly inherited neurodegenerative disorder caused by the expansion of a polyglutamine encoding CAG repeat in the huntingtin gene. Recently, it has been established that disease severity in HD is best predicted by the number of pure CAG repeats rather than total glutamines encoded. Along with uncovering DNA repair gene variants as <i>trans</i>-acting modifiers of HD severity, these data reveal somatic expansion of the CAG repeat as a key driver of HD onset. Using high-throughput DNA sequencing, we have determined the precise sequence and somatic expansion profiles of the <i>HTT</i> repeat tract of 68 HD-affected and 158 HD-unaffected African ancestry individuals. A high level of <i>HTT</i> repeat sequence diversity was observed, with three likely African-specific alleles identified. In the most common disease allele (30 out of 68), the typical proline-encoding CCGCCA sequence was absent. This CCGCCA-loss disease allele was associated with an earlier age of diagnosis of approximately 7.1 years and occurred exclusively on haplotype B2. Although somatic expansion was associated with an earlier age of diagnosis in the study overall, the CCGCCA-loss disease allele displayed reduced somatic expansion relative to the typical <i>HTT</i> expansions in blood DNA. We propose that the CCGCCA loss occurring on haplotype B2 is an African <i>cis</i>-acting modifier that appears to alter disease diagnosis of HD through a mechanism that is not driven by somatic expansion. The assessment of a group of individuals from an understudied population has highlighted population-specific differences that emphasize the importance of studying genetically diverse populations in the context of disease.

Also flagged:Autoimmune Liver DiseasePrimary biliary cholangitisautoimmune hepatitissiccahereditary hemochromatosiscirrhosis
Journal Article 2022-07-11 ✓ 1 Snippet Walsh K, Park J.
In-Text Gene Mentions

…In general,HFEH63D heterozygous carriers…

Show Full Abstract

Primary biliary cholangitis (PBC) is a chronic autoimmune condition with many extrahepatic manifestations that are commonly encountered as a patient's primary presenting complaints. Rarely, PBC co-exists as an "overlapping syndrome" with other liver-related autoimmune conditions such as autoimmune hepatitis (AIH). Presented is a rare case of PBC with features of AIH diagnosed in a patient who initially presented with hemoptysis and worsened sicca symptoms due to advanced Sjögren's syndrome. The patient had a three-year evolution of abnormal liver biochemistry and was found to be a heterozygous carrier for hereditary hemochromatosis (H63D mutation). Given that patients with PBC-AIH are at an increased risk of complications compared to isolated disease from either disorder, early diagnosis and prompt management can help spare patients from cirrhosis, liver failure and transplantation, or even death.

Also flagged:C hepatitishepatitis E virus infectionautoimmune hepatitisinfectionacute hepatitisacute hepatitis E
Journal Article 2022-07-11 ✓ 1 Snippet Zachou K, Azariadis K, Sofia M, Lyberopoulou A, Arvaniti P, Gatselis N, Spyrou V, Billinis C, Dalekos GN.
In-Text Gene Mentions

…diseases (Wilson’s disease,hemochromatosis) and acute vascular…

Show Full Abstract

<h4>Background</h4>Hepatitis E virus (HEV) infection incidence is increasing in Europe, accounting for the majority of acute hepatitis cases. We investigated the prevalence and clinical characteristics of acute hepatitis E (AHE) in patients with acute non-A/B/C hepatitis from central Greece, their differences from acute autoimmune hepatitis (AIH) patients and the molecular similarity of human strains to local HEV strains in wild boars.<h4>Methods</h4>Sera from 20 patients with non-A/B/C acute hepatitis (2015-2017) were tested prospectively for anti-HEV IgM, IgG antibodies and HEV-RNA. Sera from patients diagnosed with acute AIH (2000-2015; n=56) were tested retrospectively. Liver tissue samples from 40 wild boars were tested for HEV-RNA. Positive wild boar and patients' samples were sequenced and phylogenetically analyzed.<h4>Results</h4>Twelve of the 76 (16%) patients were diagnosed with AHE: HEV-RNA 11.5x10<sup>4</sup> (38.7-39.7x10<sup>6</sup>) IU/mL; 11/20 (55%) acute non-A/B/C hepatitis and 1/56 (2%) AIH patients. Patients with AHE were older than those without, predominately men, with higher alanine aminotransferase but lower IgG levels (P=0.005 and P=0.002, respectively), and had high titers of smooth muscle antibodies. Liver biopsies, performed in 6/12 patients with HEV infection, revealed histology compatible with AIH. HEV strains from both patients and wild boars belonged to genotype 3.<h4>Conclusions</h4>Approximately one sixth of patients with acute non-A/B/C hepatitis had autochthonous HEV infection with AIH features. Therefore, a careful workup to exclude HEV should be carried out in all acute hepatitis cases before a definite diagnosis of AIH is established. Wild boars seem to be an important reservoir of HEV in Greece.

arXiv 2022-07-11 Preprint (No Snippets API) Jones A, Massey SE, Zhang D, Deigin Y, Quay SC.
Show Full Abstract

The only animals other than bats reported to have been infected with SARS-CoV-2-related coronaviruses (SARS2r-CoVs) prior to the COVID-19 pandemic are pangolins. In early 2020 multiple papers reported the identification of two clades of SARS2r-CoVs, GD and GX, infecting pangolins. However the RNA-Seq datasets supporting pangolin genome assembly were widely contaminated, contained synthetic vectors or were heavily enriched or filtered with little but coronavirus sequences left in the datasets. Here we investigate two pangolin fecal samples sequenced by Li et al. (2021) provided in support of GD PCoV infection of pangolins in Guangdong and find the read distribution consistent with PCR amplicon contamination and SARS-CoV-2 contamination, and further identify the presence of synthetic plasmid sequences. We also build upon our previous work to further analyze the dataset GX/P3B by Lam et al. (2020), which is the only non enriched/heavily filtered pangolin tissue dataset sequenced by Lam et al. (2020). We identify synthetic vectors and confirm human genomic origin samples in the dataset. Finally, we find human mitochondrial sequences in all pangolin organ datasets and mouse and tiger mitochondrial sequences in selected pangolin organ datasets sequenced by Liu et al. (2019). We infer that human and mouse genomic origin sequences were probably sourced from contamination prior to sequencing, while tiger origin sequence contamination may have occurred due to index hopping during sequencing. These observations are problematic for attributing pangolins as SARS2r-CoV hosts in the datasets examined. The forensic methods developed and used here can be applied to examine any third party SRA data sets.

Also flagged:methylationepilepsyinositolmetabolismlipidneurological disorder
Journal Article 2022-07-10 ✓ 1 Snippet Pedersen S, Kverneland M, Nakken KO, Rudi K, Iversen PO, Gervin K, Selmer KK.
In-Text Gene Mentions

…( APOB48R ,B4GALT5, CERS6 ,…

Show Full Abstract

<h4>Objective</h4>The aim of this study was to investigate the impact of the modified ketogenic diet on DNA methylation in adults with epilepsy.<h4>Methods</h4>In this prospective study, we investigated the genome-wide DNA methylation in whole blood in 58 adults with epilepsy treated with the modified ketogenic for 12 weeks. Patients were recruited from the National Center for Epilepsy, Norway, from March 1, 2011 to February 28, 2017. DNA methylation was analyzed using the Illumina Infinium MethylationEPIC BeadChip array. Analysis of variance and paired t-test were used to identify differentially methylated loci after 4 and 12 weeks of dietary treatment. A false discovery rate approach with a significance threshold of <5% was used to adjust for multiple comparisons.<h4>Results</h4>We observed a genome-wide decrease in DNA methylation, both globally and at specific sites, after 4 and 12 weeks of dietary treatment. A substantial share of the differentially methylated positions (CpGs) were annotated to genes associated with epilepsy (n = 7), lipid metabolism (n = 8), and transcriptional regulation (n = 10). Furthermore, five of the identified genes were related to inositol phosphate metabolism, which may represent a possible mechanism by which the ketogenic diet attenuates seizures.<h4>Significance</h4>A better understanding of the modified ketogenic diet's influence at the molecular level may be the key to unraveling the mechanisms by which the diet can ameliorate seizures and possibly to identifying novel therapeutic targets for epilepsy.

Also flagged:SLC46A1tumorironhepatocellular carcinomaliver tumordeficiency
Journal Article 2022-07-10 ✓ 1 Snippet Wang D, Wu H, Yang J, Li M, Ling C, Gao Z, Lu H, Shen H, Tang Y.
In-Text Gene Mentions

…of patients withhemochromatosisand high iron…

Show Full Abstract

It is interesting that high iron is an independent inducer or cofactor of hepatocellular carcinoma (HCC) while the amount of iron is decreased in the liver tumor tissues. Due to the previous findings that iron deficiency promoted HCC metastasis, it is of significance to identify the underlying mechanism of iron deficiency in HCC. The tumor iron content and expressions of iron-metabolic molecules were observed in the primary liver cancers of rats and mice. The molecules that changed independently of iron were identified by comparing the expression profiles in the human HCC tissues and iron-deprived HCC cells. The downstream effects of these molecules on regulating intracellular iron content were investigated in vitro and further validated in vivo. Both in primary liver cancers of rats and mice, we confirmed the decreased iron content in tumor tissues and the altered expressions of iron-metabolic molecules, including transferrin receptor 1 (TfR1), six-transmembrane epithelial antigen of prostate 3 (STEAP3), divalent metal transporter 1 (DMT1), SLC46A1, ferroportin, hepcidin, and ferritin. Among these, STEAP3, DMT1, and SLC46A1 were altered free of iron deficiency. However, only silence or overexpression of SLC46A1 controlled the intracellular iron content of HCC cells. The interventions of STEAP3 or DMT1 could not change the intracellular iron content. Lentivirus-mediated regain of SLC46A1 expression restored the iron content in orthotopically implanted tumors, with correspondingly changes in the iron-metabolic molecules as iron increasing. Conclusion: Taken together, these results suggest that the loss of SLC46A1 expression leads to iron deficiency in liver tumor tissues, which would be an effective target to manage iron homeostasis in HCC.

Also flagged:Gene expressionActivator of heat shock protein 90hsp90) ATPaseHsp90co-chaperoneATPase
Journal Article 2022-07-10 ✓ 1 Snippet Xiao H, Wang H, He Q, Zhou J, Du S.
In-Text Gene Mentions

Htt

Show Full Abstract

Activator of heat shock protein 90 (hsp90) ATPase (Aha1) is a Hsp90 co-chaperone required for Hsp90 ATPase activation. Aha1 is essential for yeast survival and muscle development in C. elegans under elevated temperature and hsp90-deficeiency induced stress conditions. The roles of Aha1 in vertebrates are poorly understood. Here, we characterized the expression and function of Aha1 in zebrafish. We showed that zebrafish genome contains two aha1 genes, aha1a and aha1b, that show distinct patterns of expression during development. Under the normal physiological conditions, aha1a is primarily expressed in skeletal muscle cells of zebrafish embryos, while aha1b is strongly expressed in the head region. aha1a and aha1b expression increased dramatically in response to heat shock induced stress. In addition, Aha1a-GFP fusion protein exhibited a dynamic translocation in muscle cells in response to heat shock. Moreover, upregulation of aha1 expression was also observed in hsp90a1 knockdown embryos that showed a muscle defect. Genetic studies demonstrated that knockout of aha1a, aha1b or both had no detectable effect on embryonic development, survival, and growth in zebrafish. The aha1a and aha1b mutant embryos showed normal muscle development and stress response in response to heat shock. Single or double aha1a and aha1b mutants could grow into normal reproductive adults with normal skeletal muscle structure and morphology compared with wild type control. Together, data from these studies indicate that Aha1a and Aha1b are involved in stress response. However, they are dispensable in zebrafish embryonic development, growth, and survival.

Also flagged:AutophagyMacroautophagyorganellelysosomedegradationAMPK
Journal Article 2022-07-10 ✓ 1 Snippet Lu G, Wang Y, Shi Y, Zhang Z, Huang C, He W, Wang C, Shen HM.
In-Text Gene Mentions

HD is caused by the expansion of the CAG repeat within a single gene huntingtin (HTT), which encodes a large protein with an extended polyglutamine (polyQ) tail.239

Show Full Abstract

Macroautophagy/autophagy is an evolutionally conserved catabolic process in which cytosolic contents, such as aggregated proteins, dysfunctional organelle, or invading pathogens, are sequestered by the double-membrane structure termed autophagosome and delivered to lysosome for degradation. Over the past two decades, autophagy has been extensively studied, from the molecular mechanisms, biological functions, implications in various human diseases, to development of autophagy-related therapeutics. This review will focus on the latest development of autophagy research, covering molecular mechanisms in control of autophagosome biogenesis and autophagosome-lysosome fusion, and the upstream regulatory pathways including the AMPK and MTORC1 pathways. We will also provide a systematic discussion on the implication of autophagy in various human diseases, including cancer, neurodegenerative disorders (Alzheimer disease, Parkinson disease, Huntington's disease, and Amyotrophic lateral sclerosis), metabolic diseases (obesity and diabetes), viral infection especially SARS-Cov-2 and COVID-19, cardiovascular diseases (cardiac ischemia/reperfusion and cardiomyopathy), and aging. Finally, we will also summarize the development of pharmacological agents that have therapeutic potential for clinical applications via targeting the autophagy pathway. It is believed that decades of hard work on autophagy research is eventually to bring real and tangible benefits for improvement of human health and control of human diseases.

Also flagged:olfactionParkinson´s diseaseHDchromosomeHuntington diseaseCell proliferation
Journal Article 2022-07-10 ✓ 1 Snippet Krysewski LM, Power Guerra N, Glatzel A, Holzmann C, Antipova V, Schmitt O, Yu-Taeger L, Nguyen HP, Wree A, Witt M.
In-Text Gene Mentions

…human huntingtin (HTT) gene with…

Show Full Abstract

<i>Background.</i> For neurodegenerative diseases such as Huntington's disease (HD), early diagnosis is essential to treat patients and delay symptoms. Impaired olfaction, as observed as an early symptom in Parkinson´s disease, may also constitute a key symptom in HD. However, there are few reports on olfactory deficits in HD. Therefore, we aimed to investigate, in a transgenic rat model of HD: (1) whether general olfactory impairment exists and (2) whether there are disease-specific dynamics of olfactory dysfunction when the vomeronasal (VNE) and main olfactory epithelium (MOE) are compared. <i>Methods.</i> We used male rats of transgenic line 22 (TG22) of the bacterial artificial chromosome Huntington disease model (BACHD), aged 3 days or 6 months. Cell proliferation, apoptosis and macrophage activity were examined with immunohistochemistry in the VNE and MOE. <i>Results.</i> No differences were observed in cellular parameters in the VNE between the groups. However, the MOE of the 6-month-old HD animals showed a significantly increased number of mature olfactory receptor neurons. Other cellular parameters were not affected. <i>Conclusions.</i> The results obtained in the TG22 line suggest a relative stability in the VNE, whereas the MOE seems at least temporarily affected.

Also flagged:CaffeineHepcidinIronMetabolismdiabetescancer
Journal Article 2022-07-10 ✓ 2 Snippets Li ZD, Geng MY, Dou SR, Wang X, Zhang ZH, Chang YZ.
In-Text Gene Mentions

…in regulation, including TfR2/HFE, BMP/SMAD, and IL-6/STAT3…

…man haemochromatosis protein (HFE).…

Show Full Abstract

Caffeine is well-known as a psychostimulant, and it can also be beneficial in numerous diseases such as diabetes and different types of cancer. Previous studies have shown that caffeine can have a protective role in bacterial infection-induced inflammation and hyperoxia-mediated pulmonary inflammation. Hepcidin, which is regulated by the IL-6/STAT3 inflammation pathway, is a peptide hormone that maintains systemic iron homeostasis. We hypothesized that caffeine's effects on inflammation may also influence hepcidin production and therefore systemic iron metabolism. To this end, we treated 2-month-old mice with caffeine by daily intragastric administration for 7 days, administering intraperitoneal LPS after the final caffeine treatment. Twelve hours after LPS treatment the mice were euthanized, and tissues were collected. We found that caffeine decreased hepatic hepcidin expression and attenuated LPS-induced hepatic hepcidin overexpression. IL-6 expression and STAT3 phosphorylation were also reduced upon caffeine administration. Additionally, hepatic and splenic FPN1 levels increased after caffeine treatment, leading to lower iron levels in liver and spleen tissues and higher iron levels in serum. Caffeine also prevented the increase in spleen weight and decrease in body weight after LPS treatment. Together, our findings suggest that caffeine decreases hepcidin expression via inhibiting inflammation and the activation of the IL-6/STAT3 pathway, thus presenting an attractive, potential therapeutic for the treatment of anemia of inflammation.

Also flagged:APOEADlipidlipoproteinmetabolismcell junction
Journal Article 2022-07-09 ✓ 4 Snippets Nazarian A, Philipp I, Culminskaya I, He L, Kulminski AM.
In-Text Gene Mentions

…and rs12139692 (NEGR1, in LD…

…53 ] andNEGR1[ 54 ]…

…, ZDHHC14 ,NEGR1, and SLC5A8…

…to ELAVL2 andNEGR1with intelligence and…

Show Full Abstract

The mechanisms of incomplete penetrance of risk-modifying impacts of apolipoprotein E (APOE) ε2 and ε4 alleles on Alzheimer's disease (AD) have not been fully understood. We performed genome-wide analysis of differences in linkage disequilibrium (LD) patterns between 6,136 AD-affected and 10,555 AD-unaffected subjects from five independent studies to explore whether the association of the APOE ε2 allele (encoded by rs7412 polymorphism) and ε4 allele (encoded by rs429358 polymorphism) with AD was modulated by autosomal polymorphisms. The LD analysis identified 24 (mostly inter-chromosomal) and 57 (primarily intra-chromosomal) autosomal polymorphisms with significant differences in LD with either rs7412 or rs429358, respectively, between AD-affected and AD-unaffected subjects, indicating their potential modulatory roles. Our Cox regression analysis showed that minor alleles of four inter-chromosomal and ten intra-chromosomal polymorphisms exerted significant modulating effects on the ε2- and ε4-associated AD risks, respectively, and identified ε2-independent (rs2884183 polymorphism, 11q22.3) and ε4-independent (rs483082 polymorphism, 19q13.32) associations with AD. Our functional analysis highlighted ε2- and/or ε4-linked processes affecting the lipid and lipoprotein metabolism and cell junction organization which may contribute to AD pathogenesis. These findings provide insights into the ε2- and ε4-associated mechanisms of AD pathogenesis, underlying their incomplete penetrance.

Also flagged:Acetyl-CoA-Carboxylase 1fatty acidmetabolismsynthesisFASAcetyl-CoA-Carboxylase
Journal Article 2022-07-09 ✓ 4 Snippets Li S, Lu CW, Diem EC, Li W, Guderian M, Lindenberg M, Kruse F, Buettner M, Floess S, Winny MR, Geffers R, Richnow HH, Abraham WR, Grassl GA, Lochner M.
In-Text Gene Mentions

…ls, respectively: Rabbit anti-OLFM4(1:500, CST, 39141…

…antibody directed againstOlfm4, which is another…

…Δ/ΔIEC mice, theOlfm4+ cell population…

…genes Lgr5 ,Olfm4, Smoc2 ,…

Show Full Abstract

Basic processes of the fatty acid metabolism have an important impact on the function of intestinal epithelial cells (IEC). However, while the role of cellular fatty acid oxidation is well appreciated, it is not clear how de novo fatty acid synthesis (FAS) influences the biology of IECs. We report here that interfering with de novo FAS by deletion of the enzyme Acetyl-CoA-Carboxylase (ACC)1 in IECs results in the loss of epithelial crypt structures and a specific decline in Lgr5<sup>+</sup> intestinal epithelial stem cells (ISC). Mechanistically, ACC1-mediated de novo FAS supports the formation of intestinal organoids and the differentiation of complex crypt structures by sustaining the nuclear accumulation of PPARδ/β-catenin in ISCs. The dependency of ISCs on cellular de novo FAS is tuned by the availability of environmental lipids, as an excess delivery of external fatty acids is sufficient to rescue the defect in crypt formation. Finally, inhibition of ACC1 reduces the formation of tumors in colitis-associated colon cancer, together highlighting the importance of cellular lipogenesis for sustaining ISC function and providing a potential perspective to colon cancer therapy.

Also flagged:Coronavirus disease 2019COVID-19immune responseschromatingene expressionIL-6
Journal Article 2022-07-09 No Snippets Giroux NS, Ding S, McClain MT, Burke TW, Petzold E, Chung HA, Rivera GO, Wang E, Xi R, Bose S, Rotstein T, Nicholson BP, Chen T, Henao R, Sempowski GD, Denny TN, De Ussel MI, Satterwhite LL, Ko ER, Ginsburg GS, Kraft BD, Tsalik EL, Shen X, Woods CW.
Show Full Abstract

SARS-CoV-2 infection triggers profound and variable immune responses in human hosts. Chromatin remodeling has been observed in individuals severely ill or convalescing with COVID-19, but chromatin remodeling early in disease prior to anti-spike protein IgG seroconversion has not been defined. We performed the Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) and RNA-seq on peripheral blood mononuclear cells (PBMCs) from outpatients with mild or moderate symptom severity at different stages of clinical illness. Early in the disease course prior to IgG seroconversion, modifications in chromatin accessibility associated with mild or moderate symptoms were already robust and included severity-associated changes in accessibility of genes in interleukin signaling, regulation of cell differentiation and cell morphology. Furthermore, single-cell analyses revealed evolution of the chromatin accessibility landscape and transcription factor motif accessibility for individual PBMC cell types over time. The most extensive remodeling occurred in CD14+ monocytes, where sub-populations with distinct chromatin accessibility profiles were observed prior to seroconversion. Mild symptom severity was marked by upregulation of classical antiviral pathways, including those regulating IRF1 and IRF7, whereas in moderate disease, these classical antiviral signals diminished, suggesting dysregulated and less effective responses. Together, these observations offer novel insight into the epigenome of early mild SARS-CoV-2 infection and suggest that detection of chromatin remodeling in early disease may offer promise for a new class of diagnostic tools for COVID-19.

Also flagged:CRISPRaTranscription factorsgene expressionbindingTFheterochromatin
Journal Article 2022-07-09 No Snippets Ortega-Yáñez A, Cruz-Ruiz S, Vázquez M, Zurita M.
Show Full Abstract

Transcription factors (TFs) activate gene expression by binding to elements close to promoters or enhancers. Some TFs can bind to heterochromatic regions to initiate gene activation, suggesting that if a TF is able to bind to any type of heterochromatin, it can activate transcription. To investigate this possibility, we used the CRISPRa system based on dCas9-VPR as an artificial TF in Drosophila. dCas9-VPR was targeted to the TAHRE telomeric element, an example of constitutive heterochromatin, and to promoters and enhancers of the HOX Ultrabithorax (Ubx) and Sex Combs Reduced (Scr) genes in the context of facultative heterochromatin. dCas9-VPR robustly activated TAHRE transcription, showing that although this element is heterochromatic, dCas9-VPR was sufficient to activate its expression. In the case of HOX gene promoters, although Polycomb complexes epigenetically silence these genes, both were ectopically activated. When the artificial TF was directed to enhancers, we found that the expression pattern was different compared to the effect on the promoters. In the case of the Scr upstream enhancer, dCas9-VPR activated the gene ectopically but with less expressivity; however, ectopic activation also occurred in different cells. In the case of the bxI enhancer located in the third intron of Ubx, the presence of dCas9-VPR is capable of increasing transcription initiation while simultaneously blocking transcription elongation, generating a lack of functional phenotype. Our results show that CRISPRa system is able to activate transcription in any type of heterochromatin; nevertheless, its effect on transcription is subject to the intrinsic characteristics of each gene or regulatory element.

Also flagged:infectiontranscriptional silencinggreen fluorescent proteinnucleusHistonesglobin
Journal Article 2022-07-09 ✓ 1 Snippet Geis FK, Kelenis DP, Goff SP.
In-Text Gene Mentions

…as well aslinker histoneshistones upon nuclear…

Show Full Abstract

Mammalian cells mount a variety of defense mechanisms against invading viruses to prevent or reduce infection. One such defense is the transcriptional silencing of incoming viral DNA, including the silencing of unintegrated retroviral DNA in most cells. Here, we report that the lymphoid cell lines K562 and Jurkat cells reveal a dramatically higher efficiency of silencing of viral expression from unintegrated HIV-1 DNAs as compared to HeLa cells. We found K562 cells in particular to exhibit an extreme silencing phenotype. Infection of K562 cells with a non-integrating viral vector encoding a green fluorescent protein reporter resulted in a striking decrease in the number of fluorescence-positive cells and in their mean fluorescence intensity as compared to integration-competent controls, even though the levels of viral DNA in the nucleus were equal or in the case of 2-LTR circles even higher. The silencing in K562 cells was functionally distinctive. Histones loaded on unintegrated HIV-1 DNA in K562 cells revealed high levels of the silencing mark H3K9 trimethylation and low levels of the active mark H3 acetylation, as detected in HeLa cells. But infection of K562 cells resulted in low H3K27 trimethylation levels on unintegrated viral DNA as compared to higher levels in HeLa cells, corresponding to low H3K27 trimethylation levels of silent host globin genes in K562 cells as compared to HeLa cells. Most surprisingly, treatment with the HDAC inhibitor trichostatin A, which led to a highly efficient relief of silencing in HeLa cells, only weakly relieved silencing in K562 cells. In summary, we found that the capacity for silencing viral DNAs differs between cell lines in its extent, and likely in its mechanism.

Also flagged:CreatinineCystatin CHeart Failureglomerular filtrationchronic kidney diseaseChronic Renal Insufficiency
Journal Article 2022-07-09 No Snippets Chen DC, Shlipak MG, Scherzer R, Bansal N, Potok OA, Rifkin DE, Ix JH, Muiru AN, Hsu CY, Estrella MM.
Show Full Abstract

<h4>Rationale & objective</h4>Lower estimated glomerular filtration rate (eGFR) is associated with heart failure (HF) risk. However, eGFR based on cystatin C (eGFR<sub>cys</sub>) and creatinine (eGFR<sub>cr</sub>) may differ substantially within an individual. The clinical implications of these differences for risk of HF among persons with chronic kidney disease (CKD) are unknown.<h4>Study design</h4>Prospective cohort study.<h4>Setting & participants</h4>4,512 adults with CKD and without prevalent HF who enrolled in the Chronic Renal Insufficiency Cohort (CRIC) Study.<h4>Exposure</h4>Difference in GFR estimates (eGFR<sub>diff</sub>; ie, eGFR<sub>cys</sub> minus eGFR<sub>cr</sub>).<h4>Outcome</h4>Incident HF hospitalization.<h4>Analytical approach</h4>Fine-Gray proportional subhazards regression was used to investigate the associations of baseline, time-updated, and slope of eGFR<sub>diff</sub> with incident HF.<h4>Results</h4>Of 4,512 participants, one-third had eGFR<sub>cys</sub> and eGFR<sub>cr</sub> values that differed by over 15 mL/min/1.73 m<sup>2</sup>. In multivariable-adjusted models, each 15 mL/min/1.73 m<sup>2</sup> lower baseline eGFR<sub>diff</sub> was associated with higher risk of incident HF hospitalization (hazard ratio [HR], 1.20 [95% CI, 1.07-1.34]). In time-updated analyses, those with eGFR<sub>diff</sub> less than -15 mL/min/1.73 m<sup>2</sup> had higher risk of incident HF hospitalization (HR, 1.99 [95% CI, 1.39-2.86]), and those with eGFR<sub>diff</sub> ≥15 mL/min/1.73 m<sup>2</sup> had lower risk of incident HF hospitalization (HR, 0.67 [95% CI, 0.49-0.91]) compared with participants with similar eGFR<sub>cys</sub> and eGFR<sub>cr</sub>. Participants with faster declines in eGFR<sub>cys</sub> relative to eGFR<sub>cr</sub> had higher risk of incident HF (HR, 1.49 [95% CI, 1.19-1.85]) compared with those in whom eGFR<sub>cys</sub> and eGFR<sub>cr</sub> declined in parallel.<h4>Limitations</h4>Entry into the CRIC Study was determined by eGFR<sub>cr</sub>, which constrained the range of baseline eGFR<sub>cr</sub>-but not eGFR<sub>cys</sub>-values.<h4>Conclusions</h4>Among persons with CKD who have large differences between eGFR<sub>cys</sub> and eGFR<sub>cr</sub>, risk for incident HF is more strongly associated with eGFR<sub>cys</sub>. Diverging slopes between eGFR<sub>cys</sub> and eGFR<sub>cr</sub> over time are also independently associated with risk of incident HF.

Also flagged:rheumatoid arthritisprimary Sjögren's syndromeRAautoimmune diseasessystemic lupus erythematosus
Journal Article 2022-07-09 ✓ 5 Snippets Ramírez-Bello J, Jiménez-Morales S, Barbosa-Cobos RE, Sánchez-Zauco N, Hernández-Molina G, Luria-Pérez R, Fragoso JM, Cabello-Gutiérrez C, Montúfar-Robles I.
In-Text Gene Mentions

An association between TNFSF4 rs1234315C/T and pSS was also observed (OR 1.28, p = 0.04), however, after Bonferroni correction, this association was lost.<h4>Conclusion</h4>Our data suggest that TNFSF4 could be a risk factor in RA but not pSS in a Mexican population.

TNFSF4 is a risk factor for rheumatoid arthritis but not for primary Sjögren's syndrome in the Mexican population.

ADs share some susceptibility loci, such as TNFSF4, which is a classical susceptibility gene associated with systemic lupus erythematosus, but its role in RA and pSS is not yet clear.

TNFSF4 single nucleotide polymorphisms (SNPs) rs1234315C/T, rs2205960G/T, and rs704840T/G were genotyped using TaqMan probes and discrimination allelic assay.<h4>Results</h4>The three TNFSF4 SNPs were associated with susceptibility to RA (rs1234315C/T: odds ratio [OR] 1.4, p = 0.01; rs2205960G/T: OR 1.23, p = 0.03; rs704840T/G: OR 1.24, p = 0.02).

TNFSF4is a risk…

Show Full Abstract

<h4>Purpose</h4>Rheumatoid arthritis (RA) and primary Sjögren's syndrome (pSS) are autoimmune diseases (ADs) characterized by joint damage and involvement of the salivary glands, respectively. ADs share some susceptibility loci, such as TNFSF4, which is a classical susceptibility gene associated with systemic lupus erythematosus, but its role in RA and pSS is not yet clear. Thus, the aim of this study was to determine whether three TNFSFS4 polymorphisms are associated with RA and pSS.<h4>Methods</h4>Our case-control study included 500 controls, 459 patients with RA, and 210 patients with pSS from Mexico. TNFSF4 single nucleotide polymorphisms (SNPs) rs1234315C/T, rs2205960G/T, and rs704840T/G were genotyped using TaqMan probes and discrimination allelic assay.<h4>Results</h4>The three TNFSF4 SNPs were associated with susceptibility to RA (rs1234315C/T: odds ratio [OR] 1.4, p = 0.01; rs2205960G/T: OR 1.23, p = 0.03; rs704840T/G: OR 1.24, p = 0.02). An association between TNFSF4 rs1234315C/T and pSS was also observed (OR 1.28, p = 0.04), however, after Bonferroni correction, this association was lost.<h4>Conclusion</h4>Our data suggest that TNFSF4 could be a risk factor in RA but not pSS in a Mexican population.

Also flagged:HeparinCoagulationDisseminated intravascular coagulationthrombinsepsiscancer
Journal Article 2022-07-09 ✓ 4 Snippets Omidkhoda N, Abedi F, Ghavami V, Rahimi H, Samadi S, Arasteh O, Mohammadpour AH.
In-Text Gene Mentions

…its engagement withATIIIwhich makes a…

…conformational change inATIIIand so strikingly…

…coagulation enzyme to heparin-ATIIIcomplex activity is…

…no requirement forATIIIbinding [ 31…

Show Full Abstract

<h4>Methods</h4>The databases of PubMed, Scopus, Embase, and Web of Science were searched systematically up to November 2021. The quality of RCTs was assessed by Cochrane Collaboration's tool and the risk of bias was assessed for cohort studies through NOS score.<h4>Results</h4>Out of 3288 articles, eight studies were eligible to be included in this study. Our review retrieved six RCTs and two retrospective cohort studies consisting of 950 participants diagnosed by DIC. A significant effect of heparin on DIC mortality was identified in four studies. Furthermore, heparin was used as a control group in three studies.<h4>Conclusions</h4>We concluded that administration of heparin and its preparations in DIC patients could reduce the mortality rate and duration of hospitalization, especially in the earlier stages of DIC.

Also flagged:COVID-19Coronavirus disease 2019immune responsecoagulopathyrespiratory failuredeath
Journal Article 2022-07-09 ✓ 1 Snippet Ma L, Willey J.
In-Text Gene Mentions

ATIII

Show Full Abstract

Coronavirus disease 2019 (COVID-19), caused by a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), can cause life-threatening pathology characterized by a dysregulated immune response and coagulopathy. While respiratory failure induced by inflammation is the most common cause of death, micro-and macrovascular thrombosis leading to multiple organ failure are also causes of mortality. Dysregulation of systemic inflammation observed in severe COVID-19 patients is manifested by cytokine release syndrome (CRS) - the aberrant release of high levels of proinflammatory cytokines, such as IL-6, IL-1, TNFα, MP-1, as well as complement. CRS is often accompanied by activation of endothelial cells and platelets, coupled with perturbation of the balance between the pro-and antithrombotic mechanisms, resulting in thrombosis. Inflammation and thrombosis form a vicious circle, contributing to morbidity and mortality. Treatment of hyperinflammation has been shown to decrease thrombosis, while anti-thrombotic treatment also downregulates cytokine release. This review highlights the relationship between COVID-19-mediated systemic inflammation and thrombosis, the molecular pathways involved, the therapies targeting these processes, and the challenges currently encountered.

Also flagged:FAM114A1heart failuredeathCFangiotensin type 1 receptorAng II
Journal Article 2022-07-08 ✓ 1 Snippet Subbaiah KCV, Wu J, Tang WHW, Yao P.
In-Text Gene Mentions

…Adamts15 , andSerpinc1, among others…

Show Full Abstract

Cardiac pathological remodeling, a primary contributor to heart failure (HF) and death, is an important target for HF therapy. However, the signaling pathways that govern cardiac remodeling are not fully elucidated. Here, we found that a functionally unannotated human myocardial infarction-associated (MI-associated) gene, family with sequence similarity 114 member A1 (FAM114A1), is induced in failing human and mouse hearts compared with nonfailing hearts. Homozygous KO of Fam114a1 (Fam114a1-/-) in the mouse genome reduces cardiomyocyte hypertrophy, inflammation, and cardiac fibrosis while restoring cardiac function in angiotensin II-induced (Ang II-induced) and MI-induced HF mouse models. Cardiac fibroblasts (CFs) exhibit the highest FAM114A1 expression among different cardiac cell types. FAM114A1 is a critical autonomous factor for CF proliferation, activation, and migration. Mechanistically, FAM114A1 interacts with angiotensin receptor-associated protein (AGTRAP) and regulates the expression of angiotensin type 1 receptor (AT1R) and downstream Ang II signaling transduction, and it subsequently influences profibrotic response. Our results indicate that FAM114A1 regulates Ang II signaling, thereby activating CFs and other cardiac cells and augmenting pathological cardiac remodeling. These findings provide potentially novel insights into the regulation of cardiac remodeling and identify FAM114A1 as a therapeutic target for the treatment of heart disease.

Also flagged:Opioid Use DisorderBuprenorphinepolysubstancepregabalinCarisoprodolBUP
Journal Article 2022-07-08 No Snippets Elarabi HF, Radwan DN, Adem A, Marsden J, Lee AJ.
Show Full Abstract

<h4>Introduction</h4>Studying polysubstance use is a public health recommendation. In the United Arab Emirates, more than 80% of adults with opioid use disorder (OUD) use 2 or more nonopioid substances. This secondary analysis contrasts the characteristics of polysubstance users (OUD + ≥1 nonopioid) with OUD, explores the correlates and predictors of nonfatal overdose, and examines the impact of polysubstance use on OUD treatment outcomes using buprenorphine (BUP).<h4>Methods</h4>This analysis uses data from a 16-week outpatient randomized controlled trial of 141 adults with OUD allocated to BUP + incentivized adherence and abstinence monitoring (n = 70) and BUP in usual care (control, n = 71). Outcomes were nonfatal overdose events over the preceding 12 months, positive drug screens, and treatment retention. Participant characteristics were contrasted, and bivariate statistical tests were conducted for simple associations followed by logistic regression.<h4>Results</h4>Polysubstance use was reported by 117 participants (82.9%), the majority of whom used pregabalin 72.1% (n = 75). Compared with OUD, polysubstance users observed higher arrests (median, 1.0 [interquartile range, 0.0-3.0] vs 0.5 [interquartile range, 0.0-2.0]; P = 0.04]) and nonfatal overdose events (n = 33 [31.8%] vs 2 [10.8%], P = 0.003). Carisoprodol and injecting drug use independently predicted nonfatal overdose (adjusted odds ratio, 4.519 [95% confidence interval, 1.81-11.22] and 2.74 [95% confidence interval, 1.15-6.51], respectively). No significant difference was observed in opioid use and retention in treatment outcomes between groups.<h4>Conclusion</h4>Carisoprodol and injecting drug use increase the likelihood of nonfatal overdose in adults with OUD. Polysubstance use does not impact response to BUP treatment compared with OUD.

Also flagged:PRKDCcancertumorstumorprotein kinase, DNA-activated, catalytic subunitcell cycle
Journal Article 2022-07-08 ✓ 2 Snippets Yang X, Yang F, Lan L, Wen N, Li H, Sun X, Sun X.
In-Text Gene Mentions

We used SangerBox platform to investigate the association between PRKDC and the immune checkpoint genes across different tumors, as shown in Figure 6A. For example, in LIHC, PRKDC was positively correlated with expression of CD200, CD200R1, CD244, CD27, BTNL2, CD274, CD276, CD44, HAVCR4, CD28, CD80, CD86, CTLA4, HHLA2, ICOSLG, LGALS9, NRP1, TNFSF15, ICOS, LAG3, LAIR1, PDCD1, TNFSF4, TNFSF9, VSIR, VTCN1, TIGIT, TNFRSF8, and TNFSF18.

…LAG3, LAIR1, PDCD1,TNFSF4, TNFSF9, VSIR, VTCN1,…

Show Full Abstract

<h4>Background</h4>While protein kinase, DNA-activated, catalytic subunit (PRKDC) plays an important role in double-strand break repair to retain genomic stability, there is still no pan-cancer analysis based on large clinical information on the relationship between PRKDC and different tumors. For the first time, this research used numerous databases to perform a pan-cancer review for PRKDC to explore the possible mechanism of PRKDC in the etiology and outcomes in various tumors.<h4>Methods</h4>PRKDC's expression profile and prognostic significance in pan-cancer were investigated based on various databases and online platforms, including TIMER2, GEPIA2, cBioPortal, CPTAC, and SangerBox. We applied the TIMER to identified the interlink of PRKDC and the immune infiltration in assorted tumors, and the SangerBox online platform was adopted to find out the relevance between PRKDC and immune checkpoint genes, tumor mutation burden, and microsatellite instability in tumors. GeneMANIA tool was employed to create a protein-protein interaction analysis, gene set enrichment analysis was conducted to performed gene enrichment analysis.<h4>Results</h4>Overall, tumor tissue presented a higher degree of PRKDC expression than adjacent normal tissue. Meanwhile, patients with high PRKDC expression have a worse prognosis. PRKDC mutations were present in almost all The Cancer Genome Atlas tumors and might lead to a better survival prognosis. The PRKDC expression level was shown a positive correlation with tumor-infiltrating immune cells. PRKDC high expression cohorts were enriched in "cell cycle" "oocyte meiosis" and "RNA-degradation" signaling pathways.<h4>Conclusions</h4>This study revealed the potential value of PRKDC in tumor immunology and as a therapeutic target and prognostic biomarker in pan-cancer.

Hemolytic anemia in COVID-19.

Also flagged:translationTaxAutoimmune Hemolytic AnemiaVolReproductiontranslations
Journal Article 2022-07-08 ✓ 1 Snippet Al-Kuraishy HM, Al-Gareeb AI, Kaushik A, Kujawska M, Batiha GE.
In-Text Gene Mentions

…ndrome-related coronavirus 1 (MERS-CoV-1) and SARS-CoV-1 […

Show Full Abstract

COVID-19 is a global pandemic triggered by the severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2). The SARS-CoV-2 entry point involves the interaction with angiotensin-converting enzyme 2 (ACE2) receptor, CD147, and erythrocyte Band3 protein. Hemolytic anemia has been linked to COVID-19 through induction of autoimmune hemolytic anemia (AIHA) caused by the formation of autoantibodies (auto-Abs) or directly through CD147 or erythrocyte Band3 protein-mediated erythrocyte injury. Here, we aim to provide a comprehensive view of the potential mechanisms contributing to hemolytic anemia during the SARS-CoV-2 infection. Taken together, data discussed here highlight that SARS-CoV-2 infection may lead to hemolytic anemia directly through cytopathic injury or indirectly through induction of auto-Abs. Thus, as SARS-CoV-2-induced hemolytic anemia is increasingly associated with COVID-19, early detection and management of this condition may prevent the poor prognostic outcomes in COVID-19 patients. Moreover, since hemolytic exacerbations may occur upon medicines for COVID-19 treatment and anti-SARS-CoV-2 vaccination, continued monitoring for complications is also required. Given that, intelligent nanosystems offer tools for broad-spectrum testing and early diagnosis of the infection, even at point-of-care sites.

Also flagged:ionomycinamino acid residuecalciumOligonucleotidescalmodulinBioluminescence
Journal Article 2022-07-08 ✓ 1 Snippet Tian X, Zhang Y, Li X, Xiong Y, Wu T, Ai HW.
In-Text Gene Mentions

DCC

Show Full Abstract

Although fluorescent indicators have been broadly utilized for monitoring bioactivities, fluorescence imaging, when applied to mammals, is limited to superficial targets or requires invasive surgical procedures. Thus, there is emerging interest in developing bioluminescent indicators for noninvasive mammalian imaging. Bioluminescence imaging (BLI) of neuronal activity is highly desired but hindered by insufficient photons needed to digitalize fast brain activities. In this work, we develop a luciferase prosubstrate deliverable at an increased dose and activated in vivo by nonspecific esterase. We further engineer a bright, bioluminescent indicator with robust responsiveness to calcium ions (Ca<sup>2+</sup>) and appreciable emission above 600 nm. Integration of these advantageous components enables the imaging of the activity of neuronal ensembles in awake mice minimally invasively with excellent signal-to-background and subsecond temporal resolution. This study thus establishes a paradigm for studying brain function in health and disease.

Also flagged:BMPbone formationagingtumorsinfectionsarthritis
Journal Article 2022-07-08 No Snippets Stokovic N, Ivanjko N, Pecin M, Erjavec I, Smajlović A, Milesevic M, Karlovic S, Capak H, Vrbanac Z, Maticic D, Vukicevic S.
Show Full Abstract

Autologous bone graft substitute (ABGS) containing rhBMP6 in autologous blood coagulum (Osteogrow) is a novel therapeutic solution for bone regeneration. This study is aimed to investigate the long-term outcome of ABGS with synthetic ceramics (Osteogrow-C) in rabbit posterolateral spinal fusion (PLF) model. Osteogrow-C implants were implanted bilaterally between rabbit lumbar transverse processes. We compared the outcome following implantation of ABGS with ceramic particles of different chemical composition (TCP and biphasic ceramics containing both TCP and HA) and size (500-1700 µm and 74-420 µm). Outcome was analyzed after 14 and 27 weeks by microCT, histology, and biomechanical analyses. Successful bilateral spinal fusion was observed in all animals at the end of observation period. Chemical composition of ceramic particles has impact on the PLF outcome via resorption of TCP ceramics, while ceramics containing HA were only partially resorbed. Moreover, persistence of ceramic particles subsequently resulted with an increased bone volume in implants with small particles containing high proportion of HA. ABGS (rhBMP6/ABC) with various synthetic ceramic particles promoted spinal fusion in rabbits. This is the first presentation of BMP-mediated ectopic bone formation in rabbit PLF model with radiological, histological, and biomechanical features over a time course of up to 27 weeks.

Also flagged:DADIl-6TNF-αIl-10MefNST
Journal Article 2022-07-08 No Snippets Korczak M, Roszkowski P, Granica S, Piwowarski JP.
Show Full Abstract

Urolithin A (UA, 1), a gut microbiota postbiotic metabolite is attributed to express interesting biological activities indicated by in vitro, in vivo and clinical studies. Due to its strong anti-inflammatory properties it is considered as a promising lead molecule for further drug development, however, its strong phase II metabolism, severely limits its oral application. Therefore, monoesterified UA derivatives with selected NSAIDs: ibuprofen (Mix 3a/3b), mefenamic acid (Mix 4a/4b), diclofenac (Mix 5a/5b) and aspirin (Mix 6a/6b) were designed. Performed array of stability assays indicated Mix 4a/4b as a most suitable candidate for further studies due to its exceptional stability in human plasma. Thus, we evaluated effects of Mix 4a/4b on cell viability as well as the impact on cytokines secretion in THP-1 derived macrophages and compared it to UA. At high concentration (50 µM) Mix 4a/4b expressed a cytotoxic effect, however at concentration of 5 µM it significantly suppressed TNF-α secretion, and significantly increased ani-inflammatory IL-10 secretion at 10 µM without affecting cell viability. This work has led to selection of a novel UA derivatives, which are stable in solutions and in human plasma as well as posess anti-inflammatory activity towards THP-1 macrophages at non-cytotoxic concentrations.

Also flagged:ParagangliomaTNFSF14brain cancerTNFRSF9COADLymphoma
Journal Article 2022-07-08 ✓ 5 Snippets Tian W, Zhou J, Chen M, Qiu L, Li Y, Zhang W, Guo R, Lei N, Chang L.
In-Text Gene Mentions

TNFSF4

TNFSF4, also known as OX-40L, is a member of the TNF superfamily, which provides signals for CD4 T cell responses and plays an important role in tumor immunotherapy24,39,40.

At the same time, we found that ALDOA may be co-expressed with TNFSF4 to regulate tumor immune infiltration.

Our results showed that ALDOA regulates the co-expression of TNFSF4 in a variety of tumors, which may have a certain correlation with the tumor’s immune microenvironment and prognosis.

At present, the research of TNFSF4 mainly focuses on the immunomodulatory function in tumors and immune-related diseases41.

Show Full Abstract

Aldolase A (ALDOA) is an enzyme that plays an important role in glycolysis and gluconeogenesis, which is closely related to tumor metabolism. In this study, the overall roles of ALDOA in pan-cancer have been investigated from several aspects using databases and online analysis tools. Using the ONCOMINE database, the expression of ALDOA in various cancers was analyzed. The prognostic role of ALDOA was explored by PrognoScan, GEPIA, and Kaplan-Meier Plotter. The immune-related role of ALDOA and its downstream substrates was decided by TIMER, cBioPortal and String. Our data indicate that ALDOA expression level in lung adenocarcinoma, liver hepatocellular carcinoma, head and neck squamous cell carcinoma is higher than that in normal tissues. Increased expression of ALDOA often indicates a poor prognosis for patients. The correlation between ALDOA and immune infiltration among different tumors is very different. We also investigate the relationship between ALDOA and its upstream/downstream proteins. Our results showed that ALDOA could be used as a biomarker for the tumor prognosis, and could be correlated with the infiltrating levels of macrophages, CD4+ T cells and CD8+ T cells.

Also flagged:trichloroethylenecysteinelipopolysaccharidecytokinesecretionmembrane
Journal Article 2022-07-08 ✓ 1 Snippet Harris SM, Bakulski KM, Dou J, Houskamp E, Scheeres EC, Schellenboom E, Harlow O, Loch-Caruso R, Boldenow E.
In-Text Gene Mentions

B4GALT5

Show Full Abstract

Studies have shown that the trichloroethylene metabolite S-(1,2-dichlorovinyl)-l-cysteine (DCVC) inhibits cytokine secretion in pathogen stimulated fetal membrane tissue but little is known about the mechanism for these effects, including which cell types or transcriptomic pathways are impacted. Macrophages play a critical role in fetal membrane immune responses during infection. We tested the hypothesis that DCVC inhibits lipopolysaccharide (LPS) stimulated inflammation pathways in macrophage-like THP-1 cells. We treated THP-1 cells for 24 h then treated with 1, 5, or 10 μM DCVC for 24 h. After a 4 h incubation with lipopolysaccharide (LPS), we collected RNA and cell media. We performed transcriptomic analysis using RNA sequencing for 5 μM DCVC treatments and quantified cytokine release (IL-1β, IL-6, and TNF-α) for 1, 5 and 10 μM DCVC treatments. RNA sequencing analysis revealed 1399 differentially expressed genes (FDR < 0.05 and log <sub>2</sub> fold change magnitude>2.5) in cells co-treated with DCVC and LPS compared to LPS alone. For example, TNF had a log<sub>2</sub>(fold-change) = -3.5 with the addition of DCVC. Pathways downregulated (adjusted p-value<0.05) in DCVC+LPS treatments versus LPS-only treatments included: "acute inflammatory response", "production of molecular mediator of immune response" and "phagocytosis". LPS increased IL-1β, IL-6, and TNF-α levels in culture media (p < 0.001), but this was inhibited by co-treatment with DCVC (p < 0.001 for LPS vs. LPS + DCVC treatments). Our results demonstrate that DCVC suppresses inflammatory responses in macrophages.

Also flagged:COVID-19infection-19pneumoniaARCH
Journal Article 2022-07-08 No Snippets Aloui R, Ben Jabeur S, Mefteh-Wali S.
Show Full Abstract

This study uses a combination of copulas and CoVaR to investigate risk spillovers from China to G7 countries before and during the COVID-19 pandemic. Using daily data on stock and equity sectors for the period from January 1, 2013 to June 9, 2021, the main empirical results show that, before the COVID-19 pandemic, stock markets were positively related and systemic risk was comparable for all countries. However, during the COVID-19 outbreak, the level of dependence increased for all G7 countries and the upside-downside risk spillovers become on average higher for all stock markets, with the exception of Japan. Our results also provide evidence of higher market risk exposure to information from China for the technology and energy sectors. Moreover, we find an asymmetric risk spillover from China to the G7 stock markets, with higher intensity in downside risk spillovers before and during COVID-19 spread.

Also flagged:HMGCRU2AF2malignant tumorspancreatic carcinomalipidfatty acids
Journal Article 2022-07-08 ✓ 1 Snippet Wang L, Ruan Y, Wu X, Zhou X.
In-Text Gene Mentions

…13,ZNFX1 Antisense RNA 1Antisense RNA 1…

Show Full Abstract

Being one of the most lethal malignant tumors worldwide, pancreatic carcinoma (PC) shows strong invasiveness and high mortality. In tumorigenesis and progression, the role played by long-chain noncoding RNAs (lncRNAs) cannot be ignored. This article mainly probes into the function of lncRNA ZFAS1 in PC. ZFAS1 expression in PC and normal counterparts retrieved from the Genotype-Tissue Expression (GTEx) project and The Cancer Genome Atlas (TCGA) database was analysed by GEPIA2. Its expression profile in clinical specimens and human PC cell strains was quantified using qRT-PCR. Measurements of BxPC-3 cell multiplication and invasiveness employed CCK-8, plate clone formation test, and Transwell chamber assay. ZFAS1's impact on lipid content in BxPC-3 cells was detected. RNA pulldown and RIP assays analyzed the interaction of ZFAS1 with U2AF2 and HMGCR in BxPC-3 cells. Finally, the impacts of U2AF2 and HMGCR on the biological behavior of BxPC-3 were observed. ZFAS1 was kept at a high level in PC tissues versus the normal counterparts. ZFAS1 gene knockout remarkably suppressed PC cell multiplication and invasiveness and decreased the contents of free fatty acids, total cholesterol, triglycerides, and phospholipids. Mechanistically, ZFAS1 stabilized HMGCR mRNA through U2AF2, thus increasing HMGCR expression and promoting PC lipid accumulation. Meanwhile, reduced PC cell viability and invasiveness were observed after downregulating U2AF2 and HMGCR. As an oncogene of PC, ZFAS1 can modulate lipometabolism and stabilize HMGCR mRNA expression by binding with U2AF2 in PC, which is a candidate target for PC diagnosis and treatment.

Also flagged:gastrointestinal nematodeimmune responseinfectionimmune responsesB cell receptorIL-2
Journal Article 2022-07-08 ✓ 1 Snippet Aboshady HM, Félicité Y, Hira J, Barbier C, Bambou JC.
In-Text Gene Mentions

…IL1B, CXCL8, andOLFM4; Table 2 ).…

Show Full Abstract

In small ruminant production, gastrointestinal nematode (GIN) infection is one of the major causes of economic losses. The aim of this study was to compare the abomasal mucosa transcriptome of naïve and pre-infected goats at early time points after <i>Haemonchus contortus</i> infection, in order to identify different pathways and upstream regulators involved in the host immune response. Naïve and pre-infected Creole kids were orally infected with 10,000 <i>H. contortus</i> infective larvae (L3), and abomasal mucosa was sampled at 0, 4, and 6 days post-infection (dpi). At 6 dpi, all the animals were slaughtered to perform parasite burden counts. The mean number of L4 recovered in naïve kids was more than twice as high as that recovered in the pre-infected ones (5,860 and 2,474 respectively, <i>p</i> < 0.001). RNA-seq analysis showed a number of differentially expressed genes (DEGs) very low for both naïve and pre-infected animals when comparing day 0 vs. day 4 post-infection. A total of 2,237 and 3,206 DEGs were identified comparing 0 vs. 6 dpi in naïve and pre-infected animals, respectively. Interestingly, only 18 DEGs were found for the comparison of pre-infected vs. naïve animals at 6 dpi. Ingenuity pathway analysis (IPA) showed that several immune responses were activated in pre-infected compared with naïve animals at 0 and 4 dpi such as Th2 and Th1 pathways, natural killer cell, B cell receptor, IL-2, and IL-15 signaling. On the other hand, both naïve and pre-infected animals showed activation for those pathways comparing 6 vs. 0 dpi, with no difference between them. A similar pattern was recorded for upstream regulator genes which were related to immunity like TNF, IL-1β, IL-2, IL-5, TGFβ1, IFNγ, TCR, IL-18, IL-6, and IL-4. Our results showed that at 0 and 4 dpi the immune response was activated toward Th1 and Th2 pathways in pre-infected kids compared to the naïve ones, however, the same immune response was developed in naïve kids as earlier as 6 dpi. We conclude that repeated <i>H. contortus</i> infection in kid goats induced a concomitant early activation of a Th1 and Th2 immune response resulting in the regulation of worm establishment.

Also flagged:Cholestasisliver failureγ-glutamyl transpeptidasesteroidsneonatal cholestasishereditary hemochromatosis
Journal Article 2022-07-08 ✓ 5 Snippets Filippi L, Tamagnini S, Lorenzoni F, Caciotti A, Morrone A, Scaramuzzo R.
In-Text Gene Mentions

…Homozygous for H63DHFEVariant…

…mutation of theHFEgene, which is…

…mutation in theHFEgene, responsible for…

…compatible with anHFEdefect, in the…

…The observation thatHFE-knockout mice present iron…

Show Full Abstract

In a newborn with very precocious liver failure, cholestatic jaundice, and low γ-glutamyl transpeptidase, progressive hepatosplenomegaly induced a progressively worsening respiratory distress, that was successfully treated with steroids. Laboratory and genetic tests did not find any disease usually associated with neonatal cholestasis. However, the patient was positive for a homozygous mutation of the <i>HFE</i> gene, which is associated with hereditary hemochromatosis, a disease with typical onset in adulthood. Although no firm conclusions can be drawn from a single clinical case, this experience suggests that hereditary hemochromatosis could have played a role in the induction of this serious cholestasis, probably already arisen in the uterus. We suggest that hereditary hemochromatosis ought to be included in the panel of the possible causes of neonatal cholestasis and that steroids ought to be added to the pharmacological armamentarium for treating specific conditions which cause cholestasis in newborns.

Also flagged:acute liver failureTLR4NF-κBinflammatory responseToll-like proteinmembrane
Journal Article 2022-07-08 ✓ 2 Snippets Qu XQ, Chen QF, Shi QQ, Luo QQ, Zheng SY, Li YH, Bai LY, Gan S, Zhou XY.
In-Text Gene Mentions

…protein (RKIP) andPEBP1, can regulate microglia…

…PEBP family memberPEBP1and RIPK have…

Show Full Abstract

Acute liver injury (ALI) is a disease that seriously threatens human health and life, and a dysregulated inflammation response is one of the main mechanisms of ALI induced by various factors. Phosphatidylethanolamine binding protein 4 (PEBP4) is a secreted protein with multiple biological functions. At present, studies on PEBP4 exist mainly in the field of tumors and rarely in inflammation. This study aimed to explore the potential roles and mechanisms of PEBP4 on lipopolysaccharide (LPS)/D-galactosamine (D-GalN)<b>-</b>induced ALI. PEBP4 was downregulated after treatment with LPS/D-GalN in wild-type mice. PEBP4 hepatocyte-conditional knockout (CKO) aggravated liver damage and repressed liver functions, including hepatocellular edema, red blood cell infiltration, and increased aspartate aminotransferase (AST)/alanine aminotrans-ferase (ALT) activities. The inflammatory response was promoted through increased neutrophil infiltration, myeloperoxidase (MPO) activities, and cytokine secretions (interleukin-1β, IL-1β; tumor necrosis factor alpha, TNF-α; and cyclooxygenase-2, COX-2) in PEBP4 CKO mice. PEBP4 CKO also induced an apoptotic effect, including increasing the degree of apoptotic hepatocytes, the expressions and activities of caspases, and pro-apoptotic factor Bax while decreasing anti-apoptotic factor Bcl-2. Furthermore, the data demonstrated the levels of Toll-like receptor 4 (TLR4), phosphorylation-inhibitor of nuclear factor kappaB Alpha (p-IκB-α), and nuclear factor kappaB (NF-κB) p65 were upregulated, while the expressions of cytoplasmic IκB-α and NF-κB p65 were downregulated after PEBP4 CKO. More importantly, both the NF-κB inhibitor (Ammonium pyrrolidinedithiocarbamate, PDTC) and a small-molecule inhibitor of TLR4 (TAK-242) could inhibit TLR4/NF-κB signaling activation and reverse the effects of PEBP4 CKO. In summary, the data suggested that hepatocyte-conditional knockout of PEBP4 aggravated LPS/D-GalN-induced ALI, and the effect is partly mediated by activation of the TLR4/NF-κB signaling pathway.

Also flagged:OGTSTAT5metabolismO-GlcNAc transferaseinsulin resistanceglucose
Journal Article 2022-07-08 ✓ 1 Snippet Zhang Z, Salgado OC, Liu B, Moazzami Z, Hogquist KA, Farrar MA, Ruan HB.
In-Text Gene Mentions

…iron-responsive Hamp andHfegenes ( Figure…

Show Full Abstract

The immunosuppressive regulatory T (Treg) cells exert emerging effects on adipose tissue homeostasis and systemic metabolism. However, the metabolic regulation and effector mechanisms of Treg cells in coping with obesogenic insults are not fully understood. We have previously established an indispensable role of the O-linked N-Acetylglucosamine (O-GlcNAc) signaling in maintaining Treg cell identity and promoting Treg suppressor function, <i>via</i> STAT5 O-GlcNAcylation and activation. Here, we investigate the O-GlcNAc transferase (OGT)-STAT5 axis in driving the immunomodulatory function of Treg cells for metabolic homeostasis. Treg cell-specific OGT deficiency renders mice more vulnerable to high-fat diet (HFD)-induced adiposity and insulin resistance. Conversely, constitutive STAT5 activation in Treg cells confers protection against adipose tissue expansion and impaired glucose and insulin metabolism upon HFD feeding, in part by suppressing adipose lipid uptake and redistributing systemic iron storage. Treg cell function can be augmented by targeting the OGT-STAT5 axis to combat obesity and related metabolic disorders.

Also flagged:Btkcytoplasmicnonreceptor protein tyrosine kinaseTecB-cell receptorBCR
Journal Article 2022-07-08 ✓ 1 Snippet Du Y, Lei L, Ding H, Chen Y, Pathak S, Hicks J, Tran PT, Wu M, Chang B, Wirtz U, Mohan C.
In-Text Gene Mentions

…ecrosis Factor Superfamily-4 (TNFSF4) ( 11 –…

Show Full Abstract

Bruton tyrosine kinase (Btk) plays a vital role in activating and differentiating B-cells and regulating signaling in myeloid cells. Indeed, the potential use of Btk inhibitors in preventing lupus has been reported. Here, we extend these observations to 4 additional models of end-organ inflammation: (a) BWF1 lupus nephritis mice, (b) anti-GBM nephritis, (c) bleomycin-induced systemic sclerosis like skin disease, and (d) bleomycin-induced lung disease. In agreement with the previous studies, BTK inhibitor (BTKB66) treatment was effective in treating lupus nephritis in terms of reducing renal damage both functionally and histologically, accompanied by significant decrease in proteinuria. Both low-dose and high-dose BTKB66 profoundly blocked renal disease in the anti-GBM nephritis model, with efficacy that was comparable to that seen with dexamethasone. This study provides the first evidence that BTK inhibition has both therapeutic and preventative effects in bleomycin-induced SSc-like disease, in terms of reducing skin thickness, fibrosis, collagen deposition, and inflammation. Likewise, significantly lower lung inflammatory cell infiltration was observed after treatment with BTKB66. Therapeutic benefit was associated with lower numbers of macrophages, proliferating macrophages and activated T-cells in the respective injured organs. The observation that these immune cells play key roles in driving end organ inflammation in multiple systemic rheumatic diseases have broad implications for the use of BTKB66 in managing patients with systemic rheumatic diseases where multiple end organs are afflicted, including lupus and systemic sclerosis.

Also flagged:OX40LOX40tumorbreast cancerGITRLTACI
Journal Article 2022-07-08 ✓ 1 Snippet Rittig SM, Lutz MS, Clar KL, Zhou Y, Kropp KN, Koch A, Hartkopf AD, Hinterleitner M, Zender L, Salih HR, Maurer S, Hinterleitner C.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4) on platelets has…

Show Full Abstract

In conventional T cells, OX40 has been identified as a major costimulating receptor augmenting survival and clonal expansion of effector and memory T cell populations. In regulatory T cells, (Treg) OX40 signaling suppresses cellular activity and differentiation. However, clinical trials investigating OX40 agonists to enhance anti-tumor immunity, showed only limited success so far. Here we show that platelets from breast cancer patients express relevant levels of OX40L and platelet OX40L (pOX40L) inversely correlates with platelet-expressed immune checkpoint molecules GITRL (pGITRL) and TACI (pTACI). While high expression of pOX40L correlates with T and NK cell activation, elevated pOX40L levels identify patients with higher tumor grades, the occurrence of metastases, and shorter recurrence-free survival (RFS). Of note, <i>OX40</i> mRNA levels in breast cancer correlate with enhanced expression of anti-apoptotic, immune-suppressive, and tumor-promoting mRNA gene signatures. Our data suggest that OX40L on platelets might play counteracting roles in cancer and anti-tumor immunity. Since pOX40L reflects disease relapse better than the routinely used predictive markers CA15-3, CEA, and LDH, it could serve as a novel biomarker for refractory disease in breast cancer.

Also flagged:chromatindegradationexonucleasescanceresophageal cancerback-splicing
Journal Article 2022-07-08 ✓ 2 Snippets Shoda K, Kuwano Y, Ichikawa D, Masuda K.
In-Text Gene Mentions

…colorectal cancer (DCC) and were…

…the ETS-1 andDCCgenes are circular…

Show Full Abstract

Circular RNAs (circRNAs) comprise a large class of endogenous non-coding RNA with covalently closed loops and have independent functions as linear transcripts transcribed from identical genes. circRNAs are generated by a "back-splicing" process regulated by regulatory elements in cis and associating proteins in trans. Many studies have shown that circRNAs play important roles in multiple processes, including splicing, transcription, chromatin modification, miRNA sponges, and protein decoys. circRNAs are highly stable because of their closed ring structure, which prevents them from degradation by exonucleases, and are more abundant in terminally differentiated cells, such as brains. Recently, it was demonstrated that numerous circRNAs are differentially expressed in cancer cells, and their dysfunction is involved in tumorigenesis and metastasis. However, the crucial functions of these circRNAs and the dysregulation of circRNAs in cancer are still unknown. In this review, we summarize the recent reports on the biogenesis and biology of circRNAs and then catalog the advances in using circRNAs as biomarkers and therapeutic targets for cancer therapy, particularly esophageal cancer.

Also flagged:infectionHTLV-2 infectionregulation ofgene expressionimmune responsescell differentiation
Journal Article 2022-07-08 No Snippets Pilotti E, Cannata A, Magnani G, Bignami F, Corsi A, Valenti MT, Shallak M, Forlani G, Romanelli MG.
Show Full Abstract

Despite human T-cell leukemia virus type 1 (HTLV-1) and HTLV-2 being retroviruses closely related at a genomic level, HTLV-2 differs from HTLV-1 in terms of pathogenicity in both single infection and coinfection contexts. Moreover, the HTLV-2 association with clinical outcomes is still debated and several mechanisms underlying HTLV-2 infection remain unexplored as well. Cellular miRNAs are key factors in the post-transcriptional regulation of gene expression and they are known to be potential targets for several pathogens to control the host microenvironment and, in particular, escape immune responses. Here, we identified a HTLV-2-related signature of eight miRNAs (miR-125a-3p, miR-381-3p, miR-502-5p, miR-708-5p, miR-548d-5p, miR-548c-5p, miR-1-3p, and miR-511-5p) in both HTLV-2 infected PBMC and BJABGu cell lines. Altered miRNA expression patterns were correlated with the impairment of Th cell differentiation and signaling pathways driven by cytokines and transcriptional factors such as the Runt-related transcription factor (RUNX) family members. Specifically, we demonstrated that the RUNX2 protein was significantly more expressed in the presence of Tax-2 compared with Tax-1 in an in vitro cell model. To the best of our knowledge, these data represent the first contribution to elucidating the HTLV-2 mediated alteration of host cell miRNA profiles that may impact on HTLV-2 replication and persistent infection.

Also flagged:biofilm formationmethanolacetonehexanephenolic compoundsnaringin
Journal Article 2022-07-08 No Snippets Bautista-Rosales PU, Prado-Murguía AJ, Pérez-Ramírez IF, Servín-Villegas R, Magallón-Barajas FJ, Balois-Morales R, Ochoa-Jiménez VA, Magallón-Servín P.
Show Full Abstract

This study aimed to evaluate the antibacterial activity in vitro of <i>Salpianthus macrodontus</i> and <i>Azadirachta indica</i> extracts against potentially pathogenic bacteria for Pacific white shrimp. Furthermore, the extracts with higher inhibitory activity were analyzed to identify compounds responsible for bacterial inhibition and evaluate their effect on motility and biofilm formation. <i>S. macrodontus</i> and <i>A. indica</i> extracts were prepared using methanol, acetone, and hexane by ultrasound. The minimum inhibitory concentration (MIC) of the extracts was determined against <i>Vibrio parahaemolyticus, V. harveyi, Photobacterium damselae</i> and <i>P. leiognathi</i>. The polyphenol profile of those extracts showing the highest bacterial inhibition were determined. Besides, the bacterial swimming and swarming motility and biofilm formation were determined. The highest inhibitory activity against the four pathogens was found with the acetonic extract of <i>S. macrodontus</i> leaf (MIC of 50 mg/mL for <i>Vibrio</i> spp. and 25 mg/mL for <i>Photobacterium</i> spp.) and the methanol extract of <i>S. macrodontus</i> flower (MIC of 50 mg/mL for all pathogens tested). Both extracts affected the swarming and swimming motility and the biofilm formation of the tested bacteria. The main phenolic compounds related to <i>Vibrio</i> bacteria inhibition were naringin, vanillic acid, and rosmarinic acid, whilst hesperidin, kaempferol pentosyl-rutinoside, and rhamnetin were related to <i>Photobacterium</i> bacteria inhibition.

Also flagged:Curcumincerebrovascular diseasesviral infectious diseasesmalignant tumorsADhematological diseases
Journal Article 2022-07-08 ✓ 2 Snippets Liu S, Liu J, He L, Liu L, Cheng B, Zhou F, Cao D, He Y.
In-Text Gene Mentions

Through modulation of the miR-21/tissue inhibitors of metalloproteinase 3 (TIMP3) and miR-21-5p/SOX6, curcumin inhibits the proliferation, migration and invasion of hepatocellular carcinoma cells [15].

…3 (TIMP3) and miR-21-5p/SOX6, curcumin inhibits the…

Show Full Abstract

Curcumin is the most important active component in turmeric extracts. Curcumin, a natural monomer from plants has received a considerable attention as a dietary supplement, exhibiting evident activity in a wide range of human pathological conditions. In general, curcumin is beneficial to human health, demonstrating pharmacological activities of anti-inflammation and antioxidation, as well as antitumor and immune regulation activities. Curcumin also presents therapeutic potential in neurodegenerative, cardiovascular and cerebrovascular diseases. In this review article, we summarize the advancements made in recent years with respect to curcumin as a biologically active agent in malignant tumors, Alzheimer's disease (AD), hematological diseases and viral infectious diseases. We also focus on problems associated with curcumin from basic research to clinical translation, such as its low solubility, leading to poor bioavailability, as well as the controversy surrounding the association between curcumin purity and effect. Through a review and summary of the clinical research on curcumin and case reports of adverse effects, we found that the clinical transformation of curcumin is not successful, and excessive intake of curcumin may have adverse effects on the kidneys, heart, liver, blood and immune system, which leads us to warn that curcumin has a long way to go from basic research to application transformation.

Also flagged:COVID-19infections ofgene expressionischemic heart diseasecerebrovascular diseasehypertension
Journal Article 2022-07-08 No Snippets Hu Y, Rehawi G, Moyon L, Gerstner N, Ogris C, Knauer-Arloth J, Bittner F, Marsico A, Mueller NS.
Show Full Abstract

COVID-19 is a heterogeneous disease caused by SARS-CoV-2. Aside from infections of the lungs, the disease can spread throughout the body and damage many other tissues, leading to multiorgan failure in severe cases. The highly variable symptom severity is influenced by genetic predispositions and preexisting diseases which have not been investigated in a large-scale multimodal manner. We present a holistic analysis framework, setting previously reported COVID-19 genes in context with prepandemic data, such as gene expression patterns across multiple tissues, polygenetic predispositions, and patient diseases, which are putative comorbidities of COVID-19. First, we generate a multimodal network using the prior-based network inference method KiMONo. We then embed the network to generate a meaningful lower-dimensional representation of the data. The input data are obtained <i>via</i> the Genotype-Tissue Expression project (GTEx), containing expression data from a range of tissues with genomic and phenotypic information of over 900 patients and 50 tissues. The generated network consists of nodes, that is, genes and polygenic risk scores (PRS) for several diseases/phenotypes, as well as for COVID-19 severity and hospitalization, and links between them if they are statistically associated in a regularized linear model by feature selection. Applying network embedding on the generated multimodal network allows us to perform efficient network analysis by identifying nodes close by in a lower-dimensional space that correspond to entities which are statistically linked. By determining the similarity between COVID-19 genes and other nodes through embedding, we identify disease associations to tissues, like the brain and gut. We also find strong associations between COVID-19 genes and various diseases such as ischemic heart disease, cerebrovascular disease, and hypertension. Moreover, we find evidence linking PTPN6 to a range of comorbidities along with the genetic predisposition of COVID-19, suggesting that this kinase is a central player in severe cases of COVID-19. In conclusion, our holistic network inference coupled with network embedding of multimodal data enables the contextualization of COVID-19-associated genes with respect to tissues, disease states, and genetic risk factors. Such contextualization can be exploited to further elucidate the biological importance of known and novel genes for severity of the disease in patients.

Also flagged:endometrial cancerserous endometrial intraepithelial carcinomainvasive carcinomapolypsuterine serous carcinomapolyp
Journal Article 2022-07-08 No Snippets Silverwood SM, Lagstein A, Risinger JI, Gressel G.
Show Full Abstract

Currently, the application of peritoneal washings as a diagnostic tool for endometrial cancer staging is not well defined. The case described aims to highlight the current ambiguity surrounding the use of peritoneal washings in clinical practice.  A 69-year-old G3P3003 presented to her gynecologist with complaints of new-onset heavy vaginal bleeding. The patient sought an endometrial biopsy, which suggested serous endometrial intraepithelial carcinoma (EIC) focally suspicious for invasive carcinoma, with the involvement of polyps. Based on these results, a robotic-assisted total laparoscopic hysterectomy, bilateral salpingo-oophorectomy, bilateral sentinel lymph node dissection, and omentectomy were performed. Results from her final pathology exhibited a stage IA uterine serous carcinoma (USC) involving a polyp (4.2 cm in greatest dimension) with no myometrial or lymphovascular invasion, but washings were positive for adenocarcinoma. Based on her family history of malignancy, the patient underwent germline panel testing. The patient's somatic tumor testing demonstrated proficient DNA mismatch repair status, microsatellite stability, low tumor mutational burden (4 mut/Mb), low loss of heterozygosity (9%), amplification of the ERBB2 (HER2/neu) gene by both immunohistochemistry (3+, 20% positive) and fluorescence in-situ hybridization. Her tumor also had weakly positive estrogen receptor expression (1+, 10% positive); furthermore, some pathogenic variants in KRAS (c.37G>T), PIK3CA (c.263G>A), and TP53 (c.743G>A) were identified. Given the incongruent findings found with the positive peritoneal washing and negative lymph node involvement in addition to molecular testing, management for this patient was unclear. Ultimately, this case highlights a number of advances within the field of gynecological oncology but also emphasizes the persistent ambiguity and incongruency in the management of patients with early-stage high-risk histologies. Moving forward it will become increasingly important to be able to develop a more standardized process to assess how these diagnostic tools should inform prognosis and treatment plans.

Also flagged:quantum dotantibodylodenafilmethisosildenafilmirodenafiludenafil
Journal Article 2022-07-07 No Snippets Song M, Wu Q, Liu B, Li P, Jiang L, Wang Y, Dong S, Xiong Y, Hammock BD, Zhang C.
Show Full Abstract

In this study, a designed hapten possessing the classic structure of PDE-5 inhibitors was synthesized. A monoclonal antibody (mAb) with broad recognition for six PDE-5 inhibitors was further produced. For the determination of lodenafil, methisosildenafil, mirodenafil, udenafil and tadalafil, the limit of detection (LOD) and IC<sub>50</sub> ranged from 1.01 to 26.91 ng mL<sup>-1</sup> and 12.75 to 278 ng mL<sup>-1</sup>, respectively. Thereafter, a quantum dot bead-based lateral flow immunoassay (QB-LFIA) was developed, which improved the LOD and IC<sub>50</sub> to 0.32-6.52 ng mL<sup>-1</sup> and 7.45-133.8 ng mL<sup>-1</sup>, respectively. Method validation was conducted using honey and capsule samples spiked with PDE-5 inhibitors, and the recoveries of the intra- and inter-assays ranged from 81.01% to 108.16%, with coefficients of variation below 12.71%. In addition, the validity and the consistency have been confirmed with a comparison between QB-LFIA and HPLC-MS/MS (<i>R</i><sup>2</sup> = 0.9957). Furthermore, the developed QB-LFIA was employed for the inspection of real products, and several samples were found to be adulterated with lodenafil and methisosildenafil.

Also flagged:major depressive disordermethylationdepressioncardiovascular diseasestype II diabetesneuroticism
Journal Article 2022-07-07 ✓ 2 Snippets Engelmann J, Zillich L, Frank J, Wagner S, Cetin M, Herzog DP, Müller MB, Tadic A, Foo JC, Sirignano L, Braus DF, Dahmen N, Sordon S, Riemenschneider M, Spaniol C, Gasparoni G, Rietschel M, Witt SH, Lieb K, Streit F.
In-Text Gene Mentions

For example, genetic variation in RABGAP1L has been associated with the psychiatric traits ease of getting up in the morning [43], depressive affect [44], and neuroticism [45], but also metabolic traits such as BMI [46].

…genetic variation inRABGAP1Lhas been associated…

Show Full Abstract

Although the currently available antidepressants are well established in the treatment of the major depressive disorder (MDD), there is strong variability in the response of individual patients. Reliable predictors to guide treatment decisions before or in an early stage of treatment are needed. DNA-methylation has been proven a useful biomarker in different clinical conditions, but its importance for mechanisms of antidepressant response has not yet been determined. 80 MDD patients were selected out of >500 participants from the Early Medication Change (EMC) cohort with available genetic material based on their antidepressant response after four weeks and stratified into clear responders and age- and sex-matched non-responders (N = 40, each). Early improvement after two weeks was analyzed as a secondary outcome. DNA-methylation was determined using the Illumina EPIC BeadChip. Epigenome-wide association studies were performed and differentially methylated regions (DMRs) identified using the comb-p algorithm. Enrichment was tested for hallmark gene-sets and in genome-wide association studies of depression and antidepressant response. No epigenome-wide significant differentially methylated positions were found for treatment response or early improvement. Twenty DMRs were associated with response; the strongest in an enhancer region in SORBS2, which has been related to cardiovascular diseases and type II diabetes. Another DMR was located in CYP2C18, a gene previously linked to antidepressant response. Results pointed towards differential methylation in genes associated with cardiac function, neuroticism, and depression. Linking differential methylation to antidepressant treatment response is an emerging topic and represents a step towards personalized medicine, potentially facilitating the prediction of patients' response before treatment.

Also flagged:psychiatric disorderscognitiongene expressionmajor depressive disorderbehavioralmajor depression
Journal Article 2022-07-07 ✓ 1 Snippet Komorowski A, Murgaš M, Vidal R, Singh A, Gryglewski G, Kasper S, Wiltfang J, Lanzenberger R, Goya-Maldonado R.
In-Text Gene Mentions

…congruent (DUSP3, PIK3CD,CA10, HDAC9, LASS6, GRB14,…

Show Full Abstract

The exploration of the spatial relationship between gene expression profiles and task-evoked response patterns known to be altered in neuropsychiatric disorders, for example depression, can guide the development of more targeted therapies. Here, we estimated the correlation between human transcriptome data and two different brain activation maps measured with functional magnetic resonance imaging (fMRI) in healthy subjects. Whole-brain activation patterns evoked during an emotional face recognition task were associated with topological mRNA expression of genes involved in cellular transport. In contrast, fMRI activation patterns related to the acceptance of monetary rewards were associated with genes implicated in cellular localization processes, metabolism, translation, and synapse regulation. An overlap of these genes with risk genes from major depressive disorder genome-wide association studies revealed the involvement of the master regulators TCF4 and PAX6 in emotion and reward processing. Overall, the identification of stable relationships between spatial gene expression profiles and fMRI data may reshape the prospects for imaging transcriptomics studies.

Also flagged:keyyouhowE1virionscell surface
Journal Article 2022-07-07 No Snippets Stejskal L, Kalemera MD, Lewis CB, Palor M, Walker L, Daviter T, Lees WD, Moss DS, Kremyda-Vlachou M, Kozlakidis Z, Gallo G, Bailey D, Rosenberg W, Illingworth CJR, Shepherd AJ, Grove J.
Show Full Abstract

E1 and E2 (E1E2), the fusion proteins of Hepatitis C Virus (HCV), are unlike that of any other virus yet described, and the detailed molecular mechanisms of HCV entry/fusion remain unknown. Hypervariable region-1 (HVR-1) of E2 is a putative intrinsically disordered protein tail. Here, we demonstrate that HVR-1 has an autoinhibitory function that suppresses the activity of E1E2 on free virions; this is dependent on its conformational entropy. Thus, HVR-1 is akin to a safety catch that prevents premature triggering of E1E2 activity. Crucially, this mechanism is turned off by host receptor interactions at the cell surface to allow entry. Mutations that reduce conformational entropy in HVR-1, or genetic deletion of HVR-1, turn off the safety catch to generate hyper-reactive HCV that exhibits enhanced virus entry but is thermally unstable and acutely sensitive to neutralising antibodies. Therefore, the HVR-1 safety catch controls the efficiency of virus entry and maintains resistance to neutralising antibodies. This discovery provides an explanation for the ability of HCV to persist in the face of continual immune assault and represents a novel regulatory mechanism that is likely to be found in other viral fusion machinery.

Also flagged:nucleotidesgene expressioncell differentiationpathogenesisneurodegenerative disordersmultiple sclerosis
Journal Article 2022-07-07 No Snippets Plewka P, Raczynska KD.
Show Full Abstract

Long intergenic noncoding RNAs (lincRNAs) are a class of independently transcribed molecules longer than 200 nucleotides that do not overlap known protein-coding genes. LincRNAs have diverse roles in gene expression and participate in a spectrum of biological processes. Dysregulation of lincRNA expression can abrogate cellular homeostasis, cell differentiation, and development and can also deregulate the immune and nervous systems. A growing body of literature indicates their important and multifaceted roles in the pathogenesis of several different diseases. Furthermore, certain lincRNAs can be considered potential therapeutic targets and valuable diagnostic or prognostic biomarkers capable of predicting the onset of a disease, its degree of activity, or the progression phase. In this review, we discuss possible mechanisms and molecular functions of lincRNAs in the pathogenesis of selected autoimmune and neurodegenerative disorders: multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, Sjögren's syndrome, Huntington's disease, Parkinson's disease, Alzheimer's disease, and amyotrophic lateral sclerosis. This summary can provide new ideas for future research, diagnosis, and treatment of these highly prevalent and devastating diseases.

Also flagged:Pyruvate Dehydrogenase Complexlactic acidemiaE1mitochondrialPDCPDC-E1
Journal Article 2022-07-07 ✓ 1 Snippet Gokcan H, Bedoyan JK, Isayev O.
In-Text Gene Mentions

DCC

Show Full Abstract

Pyruvate dehydrogenase complex (PDC) deficiency is a major cause of primary lactic acidemia resulting in high morbidity and mortality, with limited therapeutic options. The E1 component of the mitochondrial multienzyme PDC (PDC-E1) is a symmetric dimer of heterodimers (αβ/α'β') encoded by the <i>PDHA1</i> and <i>PDHB</i> genes, with two symmetric active sites each consisting of highly conserved phosphorylation loops A and B. <i>PDHA1</i> mutations are responsible for 82-88% of cases. Greater than 85% of E1α residues with disease-causing missense mutations (DMMs) are solvent-inaccessible, with ∼30% among those involved in subunit-subunit interface contact (SSIC). We performed molecular dynamics simulations of wild-type (WT) PDC-E1 and E1 variants with E1α DMMs at R349 and W185 (residues involved in SSIC), to investigate their impact on human PDC-E1 structure. We evaluated the change in E1 structure and dynamics and examined their implications on E1 function with the specific DMMs. We found that the dynamics of phosphorylation Loop A, which is crucial for E1 biological activity, changes with DMMs that are at least about 15 Å away. Because communication is essential for PDC-E1 activity (with alternating active sites), we also investigated the possible communication network within WT PDC-E1 via centrality analysis. We observed that DMMs altered/disrupted the communication network of PDC-E1. Collectively, these results indicate allosteric effect in PDC-E1, with implications for the development of novel small-molecule therapeutics for specific recurrent E1α DMMs such as replacements of R349 responsible for ∼10% of PDC deficiency due to E1α DMMs.

Also flagged:SQSTM1lipid dropletsubiquitin-bindingautophagic receptorautophagy
Journal Article 2022-07-07 No Snippets Shroff A, Nazarko TY.
Show Full Abstract

SQSTM1/p62 (sequestosome 1) is a well-established indicator of macroautophagic/autophagic flux. It was initially characterized as the ubiquitin-binding autophagic receptor in aggrephagy, the selective autophagy of ubiquitinated protein aggregates. Recently, several studies correlated its levels with the abundance of intracellular lipid droplets (LDs). In the absence of a bona fide receptor for the selective autophagy of LDs (lipophagy), a few studies demonstrated the role of SQSTM1 in lipophagy. Our analysis of these studies shows that SQSTM1 colocalizes with LDs, bridges them with phagophores, is co-degraded with them in the lysosomes, and affects LD abundance in a variety of cells and under diverse experimental conditions. Although only one study reported all these functions together, the overwhelming and complementary evidence from other studies suggests that the role of SQSTM1 in lipophagy via tagging, movement, aggregation/clustering and sequestration of LDs is rather a common phenomenon in mammalian cells. As ubiquitination of the LD-associated proteins under stress conditions is increasingly recognized as another common phenomenon, some other ubiquitin-binding autophagic receptors, such as NBR1 and OPTN, might soon join SQSTM1 on a list of the non-exclusive lipophagy receptors.<b>Abbreviations</b>: LD: lipid droplet; LIR: LC3-interacting region; PAT: Perilipin, ADRP and TIP47 domain; SAR: selective autophagy receptor.

Also flagged:FerroptosispathogenesisirondeathperiodontitisInterleukin 1 beta
Journal Article 2022-07-07 No Snippets Zhang C, Xue P, Ke J, Cai Q.
Show Full Abstract

<h4>Objectives</h4>Periodontitis is a chronic inflammatory illness that may lead to tooth loosening and even loss, and its pathogenesis is not fully understood. Ferroptosis is an iron-dependent, regulated cell death. The present study aims to find the key ferroptosis-related genes (FRGs) in periodontitis and develop an mRNA-miRNA-lncRNA network to deeply explore the pathogenesis of periodontitis.<h4>Methods</h4>Data from the Gene Expression Omnibus (GEO) database and FerrDb database were downloaded to discover the differentially expressed mRNA, miRNA, and FRGs. Functional enrichment analysis was conducted for the differentially expressed FRGs (DE-FRGs), including gene ontology, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, and protein-protein interaction (PPI) network analysis. Targetscan and miRtarbase were used to estimate the miRNAs that DE-FRGs may interact with, whilst StarBase v3.0 was used for lncRNA-miRNA interaction.<h4>Results</h4>Seven DE-FRGs were identified through differential expression analysis. Interleukin 1 beta (IL1B) interacted with XBP1 and MMP13 in the PPI network. After taking the intersection between DE-miRNAs and predicted miRNAs, a ceRNA network containing IL1B, has-miR-185, has-miR-204, has-miR-211, has-miR-4306, and 28 lncRNAs was established.<h4>Conclusions</h4>Seven FRGs in periodontitis were identified, which might promote deeper understanding of ferroptosis in periodontitis.

Also flagged:behavioralinfectioncarbon-19COVID-19death
Journal Article 2022-07-07 No Snippets Monolina P, Chowdhury MMH, Haque MN.
Show Full Abstract

The Covid-19 pandemic has caused health crisis and concerns worldwide. The use of Personal Protective Equipment (PPE) has been the primary behavioral and policy response to avert the infection of coronavirus. The emergence of the situation resulted in increased production of PPE, creating a surge in plastic pollution and carbon footprint. The consumption of PPEs is unavoidable; however, proper PPE waste disposal plays a vital role in lessening the associated environmental impacts. This study aims to provide an overview of the environmental challenges associated with Covid-19 pandemic faced in the households located at the heart of Bangladesh, Dhaka City Corporation (DCC) area. The study determines carbon footprint in terms of carbon emission equivalent and plastic pollution potential associated with PPEs. The study further implies that there is a gap in the 3R Strategy implementation in Bangladesh hindering the nation in achieving UN's SDG-12. The findings depict that the proper implementation of the 3R strategy is fundamental for ensuring more a resilient, sustainable and livable environment in the in-pandemic and post-pandemic era and further emphasizes that a strengthened policy framework, operational environmental policy tools, environmental education, and the society and stakeholders' spontaneous response to the plastic pollution challenge are essentially required.

Also flagged:Nonalcoholic steatohepatitisNASHliver diseasepathogenesisNonalcoholic fatty liver diseaseNAFLD
Journal Article 2022-07-07 No Snippets Gao M, Xin J, Li X, Gao L, Shao S, Zhao M.
Show Full Abstract

Nonalcoholic steatohepatitis (NASH) is a liver disease caused by multiple factors, and there is no approved pharmacotherapy. The pathogenesis of NASH remains underexplored. In this study, differentially expressed circular RNAs (circRNAs) were obtained by analyzing NASH-related circRNA datasets, and then, corresponding target microRNAs (miRNAs) and messenger RNAs (mRNAs) were predicted to construct a circRNA-miRNA-mRNA regulatory network. On this basis, a total of 38 circRNAs, 7 miRNAs, and 10 mRNAs were screened out. The present study reveals novel circRNA biomarkers of NASH and reports a potential competing endogenous RNA (ceRNA) regulatory network that might provide insights for further investigation into the underlying pathogenesis of NASH.

Also flagged:CholineTumorhepatocellular carcinomafatty acid synthaseFAStumors
Journal Article 2022-07-07 ✓ 1 Snippet Ghidaglia J, Golse N, Pascale A, Sebagh M, Besson FL.
In-Text Gene Mentions

…primary biliary cholangitis,hemochromatosis, or α1-antitrypsin deficiency…

Show Full Abstract

<h4>Background</h4>Post-operative recurrence remains the strongest prognostic factor of resected hepatocellular carcinoma (HCC), making the accurate selection of patients with curable HCC a crucial issue. PET imaging combining both 18F-FDG and fatty acid synthase (FAS) radiotracers-such as Choline-has shown its interest for the initial staging and therapeutic management of patients with HCC, but its use is still not consensual. Importantly, the very first dual-tracer PET studies suggested 18F-FDG/FAS PET behavior be linked to the degree of differentiation of HCC, a major predictive factor of post-operative recurrence. Although this key molecular imaging concept may impact how dual-tracer PET will be used in early-stage HCC, its level of evidence remains largely unexplored. In this study, we conducted a systematic review of the available evidence-based data to clarify the relevance of dual 18F-FDG/18F-Choline PET in characterizing the degree of differentiation of HCC tumors.<h4>Methods</h4>A systematic search of the PubMed/Medline and Embase databases was performed up to November 2021. A systematic review of the dual-tracer 18F-FDG/18F-Choline PET behavior of histology-proven HCC according to their degree of differentiation was conducted. The overall quality of the included studies was critically assessed based on the STROBE guidelines. Information on study date, design, patient cohort characteristics, grade of differentiation of HCC tumors, and the dual-tracer PET behavior per HCC was independently extracted and summarized.<h4>Results</h4>From 440 records initially available, 6 full-text articles (99 histology-proven HCC) provided dual-tracer 18F-FDG/18F-Choline PET behavior per HCC tumor grade were included in the systematic review. Based on our analysis, 43/99 HCCs were reported to be well-differentiated, and 56/99 HCCs were reported to be less-differentiated tumors. In the well-differentiated subgroup, more than half were exclusively positive for 18F-Choline (51%), whereas 39% were positive for both 18F-FDG and 18F-Choline. In the less-differentiated subgroup, 37% of HCC patients were positive exclusively for FDG, 36% were positive for both 18F-FDG and 18F-Choline, and 25% were positive exclusively for 18F-Choline.<h4>Conclusion</h4>The 18F-FDG/18F-Choline dual-tracer PET behavior of uptake shows high overlap between well- and less differentiated HCC, making the characterization of tumors challenging based on such PET combination alone. Given our growing knowledge of the molecular complexity of HCC, further studies are necessary to refine our understanding of radiotracers' behavior in this field and improve the usefulness of PET imaging in the clinical decision process of HCC.

Also flagged:end-stage renal diseaseAPStype 2 diabetesCardiovascular Diseaseticagrelordiabetic kidney disease
Journal Article 2022-07-07 No Snippets Pong KM, Puasa N, Mahdy ZA.
Show Full Abstract

<h4>Background</h4>Delayed cord clamping (DCC) has been demonstrated to have significant benefits in reducing the incidence of intraventricular hemorrhage, blood transfusion and neonatal mortality in preterm neonates and improving hemodynamic and long-term neurodevelopment among term infants. There is no clear guideline on umbilical cord clamping (UCC) practices in Malaysia.<h4>Objective</h4>The aim of this survey was to assess the knowledge and practice of DCC among obstetric doctors and midwives in Malaysia, and pediatric colleagues who witness the delivery.<h4>Method</h4>This is a cross-sectional survey conducted in childbirth facilities in Malaysia from October 2020 to January 2021. A convenient snowball sampling was adopted. A validated questionnaire was disseminated to practicing obstetric and pediatric doctors and midwives electronically via email and WhatsApp using Google Form. The data were analyzed using descriptive and analytical statistics.<h4>Results</h4>A total of 327 respondents completed the questionnaires, comprising 206 obstetric doctors, 72 pediatric doctors and 49 midwives. The majority of respondents were specialists or higher in rank (53.2%). Only 29% reported the existence of guidelines on UCC in their place of work. Midwives (<i>P</i> = 0.003) and staff of lower ranks and level of education (<i>P</i> < 0.001) appeared to be more aware of the existence of a UCC guideline. Most respondents had positive knowledge of DCC for both term and preterm neonates. A large proportion (82%) of respondents agreed that DCC helped increase neonatal iron stores, and was good for both preterm (70.7%) and term (76.2%) neonates not requiring positive pressure ventilation. Doctors, specialists, those who are 40 years old and above, and those who have been in service for at least 10 years were found to have better knowledge regarding DCC (<i>P</i> < 0.05).<h4>Conclusion</h4>The awareness and practice of obstetric, pediatric and midwifery staff of guidelines on UCC were less than satisfactory. Even though most respondents have good knowledge and positive perception regarding benefits of DCC, these were not translated into their routine practice. Hence, a national guideline emphasizing the benefits of DCC should be made available in all childbirth facilities.

Also flagged:regulation ofgene expressionacute myocardial infarctionATP2B2KCNA1GRIN2A
Journal Article 2022-07-07 ✓ 1 Snippet Wu J, Li C, Lei Z, Cai H, Hu Y, Zhu Y, Zhang T, Zhu H, Cao J, Hu X.
In-Text Gene Mentions

…GRIN2A, SCN2B, GPM6A,CACNA1E, HDAC2, SRSF1, ANK2,…

Show Full Abstract

<h4>Background</h4>Circular RNA (circRNA) plays an important role in the regulation of gene expression and the occurrence of human diseases. However, studies on the role of circRNA in acute myocardial infarction (AMI) are limited. This study was performed to explore novel circRNA-related regulatory networks in AMI, aiming to better understand the molecular mechanism of circRNAs involvement in AMI and provide basis for further scientific research and clinical decision-making.<h4>Methods</h4>The AMI-related microarray datasets GSE160717 (circRNA), GSE31568 (miRNA), GSE61741 (miRNA), and GSE24519 (mRNA) were obtained from the Gene Expression Omnibus (GEO) database. After differential expression analysis, the regulatory relationships between these DERNAs were identified by online databases circBank, circInteractome, miRDB, miRWalk, Targetscan, and then two circRNA-miRNA-mRNA regulatory networks were constructed. Differentially expressed genes (DEGs) in this network were selected followed by enrichment analysis and protein-protein interaction (PPI) analysis. Hub genes were identified using Cytohubba plug-in of Cytoscape software. Hub genes and hub gene-related miRNAs were used for receiver operating characteristic curve (ROC) analysis to identify potential biomarkers. The relative expression levels of these biomarkers were further assessed by GSE31568 (miRNA) and GSE66360 (mRNA). Finally, on the basis of the above analysis, myocardial hypoxia model was constructed to verify the expression of Hub genes and related circRNAs.<h4>Results</h4>A total of 83 DEcircRNAs, 109 CoDEmiRNAs and 1204 DEGs were significantly differentially expressed in these datasets. The up-regulated circRNAs and down-regulated circRNAs were used to construct a circRNA-miRNA-mRNA regulatory network respectively. These circRNA-related DEGs were mainly enriched in the terms of "FOXO signaling pathway," "T cell receptor signaling pathway," "MAPK signaling pathway," "Insulin resistance," "cAMP signaling pathway," and "mTOR signaling pathway." The top 10 hub genes ATP2B2, KCNA1, GRIN2A, SCN2B, GPM6A, CACNA1E, HDAC2, SRSF1, ANK2, and HNRNPA2B1 were identified from the PPI network. Hub genes GPM6A, SRSF1, ANK2 and hub gene-related circRNAs hsa_circ_0023461, hsa_circ_0004561, hsa_circ_0001147, hsa_circ_0004771, hsa_circ_0061276, and hsa_circ_0045519 were identified as potential biomarkers in AMI.<h4>Conclusion</h4>In this study, the potential circRNAs associated with AMI were identified and two circRNA-miRNA-mRNA regulatory networks were constructed. This study explored the mechanism of circRNA involvement in AMI and provided new clues for the selection of new diagnostic markers and therapeutic targets for AMI.

Also flagged:TRIME3 ligaseshepatoma carcinomaTRIMsTRIM16TRIM17
Journal Article 2022-07-07 ✓ 2 Snippets Hu W, Liu D, Li R, Qian H, Qiu W, Ye Q, Kong F.
In-Text Gene Mentions

…positively related toTNFSF4( Figure 4F…

…TRIM50 correlated toTNFSF4.…

Show Full Abstract

<b>Background:</b> As significant components of E3 ligases, the tripartite motif (TRIM) proteins participate in various biological processes and facilitate the development of several diseases. Nevertheless, the correlations of TIRMs with hepatitis B virus (HBV)-positive hepatoma carcinoma (HCC) are not well elaborated. <b>Methods:</b> The expression profile of TRIM genes in HBV-associated HCC and related clinical information were extracted from the Cancer Genome Atla (TCGA) database and the International Cancer Genome Consortium (ICGC) database. Dependent on the ConsensusPathDB and STRING databases, the gene ontology, Reactome pathways, and protein-protein interaction were assessed. Relied on TIMER 2.0 database, the relationship of the TRIMs with immune infiltration was investigated. Using multivariate analysis and Kaplan Meier analysis, the association between TRIM genes and the prognostic value was examined. <b>Results:</b> A total of 17 TRIM genes, including TRIM16, TRIM17, and TRIM31 with fold change no less than 1.5, were discovered to upregulate in HBV-associated HCC in both TCGA and ICGC cohorts. Relied on gene enrichment analysis, the identified TRIMs were observed to not only be related to the interferon and cytokine signaling but also linked to the adaptive immune system. Particularly, the co-expression patterns of identified TRIMs with other E3 ligase genes and many innate immune genes that are associated with Toll-like receptor signaling, apoptosis, and SUMOylation. Besides, some of identified TRIM expressions were also linked to the infiltration levels of T cells and B cells. Additionally, several TRIM genes were associated with various clinical factors and relevant to the poor survival of HBV-associated HCC. <b>Conclusion:</b> Our findings could deepen our understanding of TRIMs and their correlations with HBV-associated HCC. Furthermore, some of these TRIMs may be utilized as new prognostic markers of HBV-related HCC prognosis, or act as potential molecular targets for the disease.

Also flagged:PathogenesisNASHNonalcoholic steatohepatitisalcoholic hepatitisalcoholnonalcoholic fatty liver disease
Journal Article 2022-07-07 ✓ 1 Snippet Shao G, Liu Y, Lu L, Zhang G, Zhou W, Wu T, Wang L, Xu H, Ji G.
In-Text Gene Mentions

…haemostatic iron regulator (HFE) gene ( Bugianesi…

Show Full Abstract

Nonalcoholic steatohepatitis (NASH) is a clinical syndrome with pathological changes that are similar to those of alcoholic hepatitis without a history of excessive alcohol consumption. It is a specific form of nonalcoholic fatty liver disease (NAFLD) that is characterized by hepatocyte inflammation based on hepatocellular steatosis. Further exacerbation of NASH can lead to cirrhosis, which may then progress to hepatocellular carcinoma (HCC). There is a lack of specific and effective treatments for NASH and NASH-driven HCC, and the mechanisms of the progression of NASH to HCC are unclear. Therefore, there is a need to understand the pathogenesis and progression of these diseases to identify new therapeutic approaches. Currently, an increasing number of studies are focusing on the utility of natural products in NASH, which is likely to be a promising prospect for NASH. This paper reviews the possible mechanisms of the pathogenesis and progression of NASH and NASH-derived HCC, as well as the potential therapeutic role of natural products in NASH and NASH-derived HCC.

Also flagged:capsulebrain ischemialipopolysaccharidecytokine receptorbindingAGE
Journal Article 2022-07-07 No Snippets Li N, Sun J, Chen JL, Bai X, Wang TH.
Show Full Abstract

<b>Objective:</b> To investigate the effect of Zhilong Huoxue Tongyu capsule (ZLH) in the treatment of cerebral ischemia-reperfusion injury and determine the underlying molecular network mechanism. <b>Methods:</b> The treatment effect of Zhilong Huoxue Tongyu capsule (ZLH) was evaluated for cerebral ischemia-reperfusion injury in middle cerebral artery occlusion (MACO) rat, and the underlying molecular network mechanism was explored by using molecular network analysis based on network pharmacology, bioinformatics including protein-protein interaction (PPI) network, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG), as well as molecular docking. <b>Results:</b> The neurological function of rats in the ZLH group was significantly improved compared to those in the NS group (<i>p</i> = 0.000), confirming the positive effect of ZLH for the treatment of brain ischemia. There were 126 intersecting genes screened in ischemia-reperfusion cerebrum that are associated with several important biological processes, such as lipopolysaccharide, and the most important cell component, such as raft, as well as the most important molecular function pointed as cytokine receptor binding. The most important KEGG signaling pathway was the AGE-RAGE signaling pathway in diabetic complications. Moreover, according to the STRING interaction in the PPI network, 10 hub genes including MAPK14, FOS, MAPK1, JUN, MYC, RELA, ESR1, STAT1, AKT1, and IL6 were selected and exhibited in Cytoscape and molecular docking. Lastly, the relation between PPI, GO, and KEGG was analyzed. These findings indicated that multiple hub network genes have been involved in behavior improvement in cerebral ischemia-reperfusion rats subjected to ZLH treatment. <b>Conclusion:</b> Zhilong Huoxue Tongyu capsule improves cerebral ischemia-reperfusion and is associated with multiple network gene expressions.

Also flagged:cysteinephenylalaninedeltaCD94topamino acids
Journal Article 2022-07-07 ✓ 1 Snippet Vyborova A, Janssen A, Gatti L, Karaiskaki F, Yonika A, van Dooremalen S, Sanders J, Beringer DX, Straetemans T, Sebestyen Z, Kuball J.
In-Text Gene Mentions

…members BTN3A1 andBTN2A1, orchestrated by interaction…

Show Full Abstract

γ9δ2T cells fill a distinct niche in human immunity due to the unique physiology of the phosphoantigen-reactive γ9δ2TCR. Here, we highlight reproducible TCRδ complementarity-determining region 3 (CDR3δ) repertoire patterns associated with γ9δ2T cell proliferation and phenotype, thus providing evidence for the role of the CDR3δ in modulating <i>in vivo</i> T-cell responses. Features that determine γ9δ2TCR binding affinity and reactivity to the phosphoantigen-induced ligand <i>in vitro</i> appear to similarly underpin <i>in vivo</i> clonotypic expansion and differentiation. Likewise, we identify a CDR3δ bias in the γ9δ2T cell natural killer receptor (NKR) landscape. While expression of the inhibitory receptor CD94/NKG2A is skewed toward cells bearing putative high-affinity TCRs, the activating receptor NKG2D is expressed independently of the phosphoantigen-sensing determinants, suggesting a higher net NKR activating signal in T cells with TCRs of low affinity. This study establishes consistent repertoire-phenotype associations and justifies stratification for the T-cell phenotype in future research on γ9δ2TCR repertoire dynamics.

Also flagged:gene expressionlumenintestinal diseasestumormicrobial infectionHomeostasis
Journal Article 2022-07-07 ✓ 1 Snippet Yan H, Ye Y, Zhao H, Zuo H, Li Y.
In-Text Gene Mentions

Chapuy et al. (2019) identified six subpopulations within the colon CD14+ macrophage population, two of which were monocyte-like CD64hiCD163− and macrophage-like CD64hiCD163hi cells. CD64hiCD163− cells secreted proinflammatory cytokines, such as IL-1β and IL-23, specifically infiltrating the inflamed colon, which correlated with the endoscopic disease severity score. Moreover, CD64hiCD163− cells can promote Th17/Th1 responses in tissue memory CD4+ T cells through the IL-1β signaling pathway. By comparing the transcriptomes of patients with ulcerative colitis (UC) and healthy individuals, Smillie et al. (2019) identified 51 cellular subtypes, including epithelial, stromal, and immune cells. Among these, BEST4+ enterocytes, microfold-like cells, and inflammatory fibroblasts contributed to resistance to anti-TNF treatment. Mapping the risk variants in cell types and pathways identified UC risk genes as cell type-specific and co-regulated within limited cellular subtypes and pathways. Kinchen et al. (2018) observed four colon fibroblast subtypes expressing distinct transcriptional regulators and functional pathways and identified a stem-like SOX6+CD142+ subpopulation in neighboring crypts. Moreover, a specifically activated TNFSF14+ mesenchymal subpopulation was observed in colitis, fueling inflammation by slowing epithelial proliferation and contributing to oxidative stress.

Show Full Abstract

The intestinal tract is composed of different cell lineages with distinct functions and gene expression profiles, providing uptake of nutrients and protection against insults to the gut lumen. Changes in or damage to the cellulosity or local environment of the intestinal tract can cause various diseases. Single-cell RNA sequencing (scRNA-seq) is a powerful tool for profiling and analyzing individual cell data, making it possible to resolve rare and intermediate cell states that are hardly observed at the bulk level. In this review, we discuss the application of intestinal tract scRNA-seq in identifying novel cell subtypes and states, targets, and explaining the molecular mechanisms involved in intestinal diseases. Finally, we provide future perspectives on using single-cell techniques to discover molecular and cellular targets and biomarkers as a new approach for developing novel therapeutics for intestinal diseases.

Also flagged:CCDC102BTSPAN1RPS21SH3BGRL3SPTBN1UQCR10
Journal Article 2022-07-07 ✓ 5 Snippets Sugai T, Osakabe M, Niinuma T, Sugimoto R, Eizuka M, Tanaka Y, Yanagawa N, Otsuka K, Sasaki A, Matsumoto T, Suzuki H.
In-Text Gene Mentions

OLFM4

Specific paired miRNA/mRNA networks, including hsa-miR-34a-5p/SLC12A2, hsa-miR-15b-5p/SLC12A2, hsa-miR-195-5p/SLC12A2, hsa-miRNA-502-3p/OLFM4, hsa-miRNA-6807-5p/ZG16, and hsa-miRNA 3064-5p/SH3BGRL3, were identified in samples of adenoma, IMC, and CRC with the MSS phenotype.

…-5p/SLC12A2, hsa-miRNA-502-3p/OLFM4, hsa-miRNA-6807-5p/ZG16, and …

…olfactomedin 4 (OLFM4).…

…to that ofOLFM4( Figure 3-B…

Show Full Abstract

<h4>Background</h4>Although MicroRNAs (miRNAs) play important roles in various biological processes, the biological functions of miRNAs are achieved through mRNAs. The aim of this study is to identify dysregulated miRNA/mRNA expression patterns in colorectal tumors.<h4>Methods</h4>We examined 42 colorectal tumors [15 adenomas, 8 intramucosal cancers (IMCs), and 19 invasive colorectal cancers (CRCs)] with the microsatellite stable (MSS) phenotype (first cohort). The first cohort was used for genome-wide miRNA and mRNA expression arrays, whereas the second cohort (37 colorectal neoplasias) was used for validation analyses. Finally, we used 15 cases of "adenoma in/with carcinoma" to identify network patterns of miRNAs/mRNAs that were directly associated with neoplastic progression. In addition, simple regression analysis for array-based and RT-PCR analyses was performed to select candidate miRNA-mRNA pairs. Transfection of miRNA mimics was also performed to confirm whether target mRNA expression is affected by specific miRNAs.<h4>Results</h4>Specific paired miRNA/mRNA networks, including hsa-miR-34a-5p/SLC12A2, hsa-miR-15b-5p/SLC12A2, hsa-miR-195-5p/SLC12A2, hsa-miRNA-502-3p/OLFM4, hsa-miRNA-6807-5p/ZG16, and hsa-miRNA 3064-5p/SH3BGRL3, were identified in samples of adenoma, IMC, and CRC with the MSS phenotype. In adenomatous lesions obtained from the same tumor with a carcinomatous lesion, we identified pairs of miRNA-130a-3p/HSPA8 and miRNA-22-3p/RP53 that were linked to multiple pathways. On the other hand, 2 pairs of miRNA/mRNA (miRNA-660-5p and miRNA-664a-5p/APP) were found in isolated carcinomatous glands. Ectopic expression of miRNA 3064-5p suppressed SH3BGRL3 expression.<h4>Conclusions</h4>We found that networks based on specific pairs of miRNAs/mRNAs contribute to progression from adenomatous and carcinomatous lesions. Our results provide insights into the molecular tumorigenesis of colorectal tumors.

Also flagged:bone formationangiogenesisadhesive proteinsphenylalaninedopamineamino acid
Journal Article 2022-07-07 No Snippets Wu H, Zhao C, Lin K, Wang X.
Show Full Abstract

Repairing bone defects remains a challenge in clinical practice and the application of artificial scaffolds can enhance local bone formation, but the function of unmodified scaffolds is limited. Considering different application scenarios, the scaffolds should be multifunctionalized to meet specific demands. Inspired by the superior adhesive property of mussels, polydopamine (PDA) has attracted extensive attention due to its universal capacity to assemble on all biomaterials and promote further adsorption of multiple external components to form PDA-based multilayered coatings with multifunctional property, which can induce synergistic enhancement of new bone formation, such as immunomodulation, angiogenesis, antibiosis and antitumor property. This review will summarize mussel-inspired PDA-based multilayered coatings for enhanced bone formation, including formation mechanism and biofunction of PDA coating, as well as different functional components. The synergistic enhancement of multiple functions for better bone formation will also be discussed. This review will inspire the design and fabrication of PDA-based multilayered coatings for different application scenarios and promote deeper understanding of their effect on bone formation, but more efforts should be made to achieve clinical translation. On this basis, we present a critical conclusion, and forecast the prospects of PDA-based multilayered coatings for bone regeneration.

Also flagged:organizationaggregationpathogenesisproteostasisamyloid proteinsamino acids
Journal Article 2022-07-07 No Snippets Villalobos-Alva J, Ochoa-Toledo L, Villalobos-Alva MJ, Aliseda A, Pérez-Escamirosa F, Altamirano-Bustamante NF, Ochoa-Fernández F, Zamora-Solís R, Villalobos-Alva S, Revilla-Monsalve C, Kemper-Valverde N, Altamirano-Bustamante MM.
Show Full Abstract

Proteins are some of the most fascinating and challenging molecules in the universe, and they pose a big challenge for artificial intelligence. The implementation of machine learning/AI in protein science gives rise to a world of knowledge adventures in the workhorse of the cell and proteome homeostasis, which are essential for making life possible. This opens up epistemic horizons thanks to a coupling of human tacit-explicit knowledge with machine learning power, the benefits of which are already tangible, such as important advances in protein structure prediction. Moreover, the driving force behind the protein processes of self-organization, adjustment, and fitness requires a space corresponding to gigabytes of life data in its order of magnitude. There are many tasks such as novel protein design, protein folding pathways, and synthetic metabolic routes, as well as protein-aggregation mechanisms, pathogenesis of protein misfolding and disease, and proteostasis networks that are currently unexplored or unrevealed. In this systematic review and biochemical meta-analysis, we aim to contribute to bridging the gap between what we call <i>binomial</i> artificial intelligence (AI) and protein science (PS), a growing research enterprise with exciting and promising biotechnological and biomedical applications. We undertake our task by exploring "the state of the art" in AI and machine learning (ML) applications to protein science in the scientific literature to address some critical research questions in this domain, including What kind of tasks are already explored by ML approaches to protein sciences? What are the most common ML algorithms and databases used? What is the situational diagnostic of the AI-PS inter-field? What do ML processing steps have in common? We also formulate novel questions such as Is it possible to discover what the rules of protein evolution are with the binomial AI-PS? How do protein folding pathways evolve? What are the rules that dictate the folds? What are the minimal nuclear protein structures? How do protein aggregates form and why do they exhibit different toxicities? What are the structural properties of amyloid proteins? How can we design an effective proteostasis network to deal with misfolded proteins? We are a cross-functional group of scientists from several academic disciplines, and we have conducted the systematic review using a variant of the PICO and PRISMA approaches. The search was carried out in four databases (PubMed, Bireme, OVID, and EBSCO Web of Science), resulting in 144 research articles. After three rounds of quality screening, 93 articles were finally selected for further analysis. A summary of our findings is as follows: regarding AI applications, there are mainly four types: <i>1</i>) genomics, <i>2</i>) protein structure and function, <i>3</i>) protein design and evolution, and <i>4</i>) drug design. In terms of the ML algorithms and databases used, supervised learning was the most common approach (85%). As for the databases used for the ML models, PDB and UniprotKB/Swissprot were the most common ones (21 and 8%, respectively). Moreover, we identified that approximately 63% of the articles organized their results into three steps, which we labeled <i>pre-process</i>, <i>process</i>, and <i>post-process</i>. A few studies combined data from several databases or created their own databases after the pre-process. Our main finding is that, as of today, there are no research road maps serving as guides to address gaps in our knowledge of the AI-PS binomial. All research efforts to collect, integrate multidimensional data features, and then analyze and validate them are, so far, uncoordinated and scattered throughout the scientific literature without a clear epistemic goal or connection between the studies. Therefore, our main contribution to the scientific literature is to offer a road map to help solve problems in drug design, protein structures, design, and function prediction while also presenting the "state of the art" on research in the AI-PS binomial until February 2021. Thus, we pave the way toward future advances in the synthetic redesign of novel proteins and protein networks and artificial metabolic pathways, learning lessons from nature for the welfare of humankind. Many of the novel proteins and metabolic pathways are currently non-existent in nature, nor are they used in the chemical industry or biomedical field.

Also flagged:Programmed Cell DeathColon canceralcoholobesitydeathferroptosis
Journal Article 2022-07-07 No Snippets Pan B, Zheng B, Xing C, Liu J.
Show Full Abstract

Programmed cell death (PCD) is an evolutionarily conserved process of cell suicide that is regulated by various genes and the interaction of multiple signal pathways. Non-canonical programmed cell death (PCD) represents different signaling excluding apoptosis. Colon cancer is the third most incident and the fourth most mortal worldwide. Multiple factors such as alcohol, obesity, and genetic and epigenetic alternations contribute to the carcinogenesis of colon cancer. In recent years, emerging evidence has suggested that diverse types of non-canonical programmed cell death are involved in the initiation and development of colon cancer, including mitotic catastrophe, ferroptosis, pyroptosis, necroptosis, parthanatos, oxeiptosis, NETosis, PANoptosis, and entosis. In this review, we summarized the association of different types of non-canonical PCD with tumorigenesis, progression, prevention, treatments, and prognosis of colon cancer. In addition, the prospect of drug-resistant colon cancer therapy related to non-canonical PCD, and the interaction between different types of non-canonical PCD, was systemically reviewed.

Also flagged:Congenital Heart Defectsstillbirthtranscription factorsNKX2-5TBX5transcription factor
Journal Article 2022-07-07 ✓ 3 Snippets Meerschaut I, Steyaert W, Bové T, François K, Martens T, De Groote K, De Wilde H, Muiño Mosquera L, Panzer J, Vandekerckhove K, Moons L, Vermassen P, Symoens S, Coucke PJ, De Wolf D, Callewaert B.
In-Text Gene Mentions

…, SLC4A4 ,SOX6, THOC1 ,…

…ras signaling gene,SOX6(MIM 607257) was…

…of EPHB2 ,SOX6, and TSC2…

Show Full Abstract

Congenital heart defects (CHD) are the most common congenital anomalies in liveborn children. In contrast to syndromic CHD (SCHD), the genetic basis of isolated CHD (ICHD) is complex, and the underlying pathogenic mechanisms appear intricate and are incompletely understood. Next to rare Mendelian conditions, somatic mosaicism or a complex multifactorial genetic architecture are assumed for most ICHD. We performed exome sequencing (ES) in 73 parent-offspring ICHD trios using proband DNA extracted from cardiac tissue. We identified six germline de novo variants and 625 germline rare inherited variants with 'damaging' in silico predictions in cardiac-relevant genes expressed in the developing human heart. There were no CHD-relevant somatic variants. Transmission disequilibrium testing (TDT) and association testing (AT) yielded no statistically significant results, except for the AT of missense variants in cilia genes. Somatic mutations are not a common cause of ICHD. Rare de novo and inherited protein-damaging variants may contribute to ICHD, possibly as part of an oligogenic or polygenic disease model. TDT and AT failed to provide informative results, likely due to the lack of power, but provided a framework for future studies in larger cohorts. Overall, the diagnostic value of ES on cardiac tissue is limited in individual ICHD cases.

Also flagged:WDcoppercopper-transportingATP7BswallowingD-penicillamine
Journal Article 2022-07-07 ✓ 1 Snippet Samadzadeh S, Kruschel T, Novak M, Kallenbach M, Hefter H.
In-Text Gene Mentions

…Then,hemochromatosiswas suspected, and…

Show Full Abstract

Background: Wilson’s disease (WD) is an autosomal-recessive disorder of copper deposition caused by pathogenic variants in the copper-transporting ATP7B gene. There is not a clear correlation between genotype and phenotype in WD regarding symptom manifestations. This is supported by the presentation of genetically identical WD twins with phenotypic discordance and different response behavior to WD-specific therapy. Case Presentation: One of the female homozygous twins (age: 26 yrs) developed writing, speaking, swallowing and walking deficits which led to in-patient examination without conclusive results but recommended genetic testing. Both sisters were tested and were heterozygous for the C.2304dupC;p(Met769Hisf*26) and the C.3207C>A;p(His1069Gln) mutation. Self-medication of the affected sibling with 450 mg D-penicillamine (DPA) did not prevent further deterioration. She developed a juvenile parkinsonian syndrome and became wheelchair-bound and anarthric. A percutaneous endoscopic gastrostomy was applied. Her asymptomatic sister helped her with her daily life. Despite the immediate increase of the DPA dose (up to 1800 mg within 3 weeks) in the severely affected patient and the initiation of DPA therapy (up to 600 mg within 2 weeks) in the asymptomatic patient after the first visit in our institution, liver function tests further deteriorated in both patients. After 2 months, the parkinsonian patient started to improve and walk again, but experienced several falls, broke her right shoulder and underwent two necessary surgical interventions. With further consequent copper elimination therapy, liver dysfunction improved in both patients, without need for orthotopic liver transplantation (LTX) in the severely affected patient. Her excellent recovery of liver and brain dysfunction was only transiently interrupted by the development of a nephrotic syndrome which disappeared after switching to Cuprior®. Unfortunately, she died from fulminant pneumonia. Conclusion: Despite identical genetic disposition, WD symptom presentations may develop differently in monozygotic twins, and they may need to be placed on a very different therapeutical regimen. The underlying gene-environment interaction is unclear so far.

Also flagged:Autism Spectrum DisorderAttention-Deficit/Hyperactivity DisorderADHDAutism spectrum disordersneurodevelopmental disordersautism
Journal Article 2022-07-07 No Snippets Dougnon G, Matsui H.
Show Full Abstract

Autism spectrum disorders (ASD) and attention-deficit/hyperactivity disorder (ADHD) are two debilitating neurodevelopmental disorders. The former is associated with social impairments whereas the latter is associated with inattentiveness, hyperactivity, and impulsivity. There is recent evidence that both disorders are somehow related and that genes may play a large role in these disorders. Despite mounting human and animal research, the neurological pathways underlying ASD and ADHD are still not well understood. Scientists investigate neurodevelopmental disorders by using animal models that have high similarities in genetics and behaviours with humans. Mice have been utilized in neuroscience research as an excellent animal model for a long time; however, the zebrafish has attracted much attention recently, with an increasingly large number of studies using this model. In this review, we first discuss ASD and ADHD aetiology from a general point of view to their characteristics and treatments. We also compare mice and zebrafish for their similarities and discuss their advantages and limitations in neuroscience. Finally, we summarize the most recent and existing research on zebrafish and mouse models of ASD and ADHD. We believe that this review will serve as a unique document providing interesting information to date about these models, thus facilitating research on ASD and ADHD.

Also flagged:Neurodegenerative disordersagingneurological disordersbrain disordersNeurodegenerationNeurodegenerative Diseases
Journal Article 2022-07-07 ✓ 1 Snippet Martano S, De Matteis V, Cascione M, Rinaldi R.
In-Text Gene Mentions

…peptide of theHTTprotein and plays…

Show Full Abstract

Neurodegenerative disorders (NDs) affect a great number of people worldwide and also have a significant socio-economic impact on the aging population. In this context, nanomedicine applied to neurological disorders provides several biotechnological strategies and nanoformulations that improve life expectancy and the quality of life of patients affected by brain disorders. However, available treatments are limited by the presence of the blood-brain barrier (BBB) and the blood-cerebrospinal fluid barrier (B-CSFB). In this regard, nanotechnological approaches could overcome these obstacles by updating various aspects (e.g., enhanced drug-delivery efficiency and bioavailability, BBB permeation and targeting the brain parenchyma, minimizing side effects). The aim of this review is to carefully explore the key elements of different neurological disorders and summarize the available nanomaterials applied for neurodegeneration therapy looking at several types of nanocarriers. Moreover, nutraceutical-loaded nanoparticles (NPs) and synthesized NPs using green approaches are also discussed underling the need to adopt eco-friendly procedures with a low environmental impact. The proven antioxidant properties related to several natural products provide an interesting starting point for developing efficient and green nanotools useful for neuroprotection.

Also flagged:primary progressive aphasiadementiaagingdementiasbrain atrophyfrontotemporal lobar degeneration
Journal Article 2022-07-07 ✓ 4 Snippets Foxe D, Hu A, Cheung SC, Ahmed RM, Cordato NJ, Devenney E, Hwang YT, Halliday GM, Mueller N, Leyton CE, Hodges JR, Burrell JR, Irish M, Piguet O.
In-Text Gene Mentions

…utility of theACE-IIIin characterizing the…

…on availability ofACE-III(not ACE-R; no…

…the ACE-R orACE-III.…

…observed for theACE-IIItotal score, where…

Show Full Abstract

The Addenbrooke's Cognitive Examination III is a brief cognitive screening tool that is widely used for the detection and monitoring of dementia. Recent findings suggest that the three variants of primary progressive aphasia can be distinguished based on their distinct profiles on the five subdomain scores of this test. Here, we investigated the utility of the Addenbrooke's Cognitive Examination III to differentiate the primary progressive aphasia variants based on their item-by-item performance profiles on this test. From these results, we created an interactive primary progressive aphasia Addenbrooke's Cognitive Examination III calculator which predicts the variant based on a patient's unique item-by-item profile. Twenty-eight logopenic variant, 25 non-fluent variant and 37 semantic variant primary progressive aphasia patients and 104 healthy controls completed the Addenbrooke's Cognitive Examination III at first clinical presentation. Multinomial regression analyses were conducted to establish performance profiles among groups, and R Shiny from RStudio was used to create the interactive Addenbrooke's Cognitive Examination III diagnostic calculator. To verify its accuracy, probability values of the regression model were derived based on a 5-fold cross-validation of cases. The calculator's accuracy was then verified in an independent sample of 17 logopenic, 19 non-fluent and 13 semantic variant primary progressive aphasia patients and 68 Alzheimer's disease patients who had completed the Addenbrooke's Cognitive Examination III (or an older version of this test: Revised) and had <i>in vivo</i> amyloid-PET imaging and/or brain autopsy pathological confirmation. Cross-validation of cases in the calculator model revealed different rates of sensitivity in classifying variants: semantic = 100%, non-fluent = 80.6% and logopenic = 79.9%; healthy controls were distinguished from primary progressive aphasia patients with 100% sensitivity. Verification of <i>in vivo</i> amyloid and/or autopsy-confirmed patients showed that the calculator correctly classified 10/13 (77%) semantic variant, 3/19 (16%) non-fluent variant and 4/17 (24%) logopenic variant patients. Importantly, for patients who were not classified, diagnostic probability values mostly pointed toward the correct clinical diagnosis. Furthermore, misclassified diagnoses of the primary progressive aphasia cohort were rare (1/49; 2%). Although 22 of the 68 Alzheimer's disease patients (32%) were misclassified with primary progressive aphasia, 19/22 were misclassified with the logopenic variant (i.e. falling within the same neuropathological entity). The Addenbrooke's Cognitive Examination III primary progressive aphasia diagnostic calculator demonstrates sound accuracy in differentiating the variants based on an item-by-item Addenbrooke's Cognitive Examination III profile. This calculator represents a new frontier in using data-driven approaches to differentiate the primary progressive aphasia variants.

Also flagged:axonsdendritessynapsesneuronal surface receptorssurface receptorsaxon guidance
Journal Article 2022-07-06 ✓ 2 Snippets Cortés E, Pak JS, Özkan E.
In-Text Gene Mentions

Draxin is mostly disordered, except for a disulfide‐rich C‐terminal domain of ~65 amino acids, which binds the fourth IG domain on DCC,58, 59, 60 and resembles the C‐terminal domain of Dickkopf.60

Across all major bilaterian model systems, Netrins belonging to the branch including vertebrate Netrin 1, 2, 3 and 5, and protostome Netrins bind two major classes of receptors: deleted in colorectal cancer (DCC) class of proteins and uncoordinated 5 (Unc5) class of proteins.

Show Full Abstract

One of the fundamental properties of a neuronal circuit is the map of its connections. The cellular and developmental processes that allow for the growth of axons and dendrites, selection of synaptic targets, and formation of functional synapses use neuronal surface receptors and their interactions with other surface receptors, secreted ligands, and matrix molecules. Spatiotemporal regulation of the expression of these receptors and cues allows for specificity in the developmental pathways that wire stereotyped circuits. The families of molecules controlling axon guidance and synapse formation are generally conserved across animals, with some important exceptions, which have consequences for neuronal connectivity. Here, we summarize the distribution of such molecules across multiple taxa, with a focus on model organisms, evolutionary processes that led to the multitude of such molecules, and functional consequences for the diversification or loss of these receptors.

Also flagged:immunity proteintransferrinsuccinate dehydrogenase complexbeta-actinbeta-2-microglobulinHprt1
Journal Article 2022-07-06 ✓ 3 Snippets Siller A, Hofer NT, Tomagra G, Burkert N, Hess S, Benkert J, Gaifullina A, Spaich D, Duda J, Poetschke C, Vilusic K, Fritz EM, Schneider T, Kloppenburg P, Liss B, Carabelli V, Carbone E, Ortner NJ, Striessnig J.
In-Text Gene Mentions

Cacna1e

…For Cav2.3 (Cacna1e) splice variant…

…Cav2.3 α1-subunit (Cacna1e) transcripts are…

Show Full Abstract

In dopaminergic (DA) <i>Substantia nigra</i> (SN) neurons Cav2.3 R-type Ca<sup>2+</sup>-currents contribute to somatodendritic Ca<sup>2+</sup>-oscillations. This activity may contribute to the selective degeneration of these neurons in Parkinson's disease (PD) since Cav2.3-knockout is neuroprotective in a PD mouse model. Here, we show that in tsA-201-cells the membrane-anchored β2-splice variants β2a and β2e are required to stabilize Cav2.3 gating properties allowing sustained Cav2.3 availability during simulated pacemaking and enhanced Ca<sup>2+</sup>-currents during bursts. We confirmed the expression of β2a- and β2e-subunit transcripts in the mouse SN and in identified SN DA neurons. Patch-clamp recordings of mouse DA midbrain neurons in culture and SN DA neurons in brain slices revealed SNX-482-sensitive R-type Ca<sup>2+</sup>-currents with voltage-dependent gating properties that suggest modulation by β2a- and/or β2e-subunits. Thus, β-subunit alternative splicing may prevent a fraction of Cav2.3 channels from inactivation in continuously active, highly vulnerable SN DA neurons, thereby also supporting Ca<sup>2+</sup> signals contributing to the (patho)physiological role of Cav2.3 channels in PD.

Also flagged:Leigh syndromeneurometabolic disordermitochondrialLSpyruvate dehydrogenasePDH
Journal Article 2022-07-06 ✓ 1 Snippet Romero-Morales AI, Robertson GL, Rastogi A, Rasmussen ML, Temuri H, McElroy GS, Chakrabarty RP, Hsu L, Almonacid PM, Millis BA, Chandel NS, Cartailler JP, Gama V.
In-Text Gene Mentions

…and BRN2 (POU3F2; PDH: P…

Show Full Abstract

Leigh syndrome (LS) is a rare, inherited neurometabolic disorder that presents with bilateral brain lesions caused by defects in the mitochondrial respiratory chain and associated nuclear-encoded proteins. We generated human induced pluripotent stem cells (iPSCs) from three LS patient-derived fibroblast lines. Using whole-exome and mitochondrial sequencing, we identified unreported mutations in pyruvate dehydrogenase (GM0372, PDH; GM13411, MT-ATP6/PDH) and dihydrolipoyl dehydrogenase (GM01503, DLD). These LS patient-derived iPSC lines were viable and capable of differentiating into progenitor populations, but we identified several abnormalities in three-dimensional differentiation models of brain development. LS patient-derived cerebral organoids showed defects in neural epithelial bud generation, size and cortical architecture at 100 days. The double mutant MT-ATP6/PDH line produced organoid neural precursor cells with abnormal mitochondrial morphology, characterized by fragmentation and disorganization, and showed an increased generation of astrocytes. These studies aim to provide a comprehensive phenotypic characterization of available patient-derived cell lines that can be used to study Leigh syndrome.

Also flagged:NTSR1tumorcysteine cathepsincysteine proteasesneurotensin receptor subtype 1colon cancer
Journal Article 2022-07-06 No Snippets Fan W, Zhang W, Allen S, Alshehri S, Muilenburg KM, Zheng C, Garrison JC.
Show Full Abstract

Many low-molecular weight targeted radiotherapeutics (TRTs) are capable of rapidly achieving exceptional tumor to non-target ratios shortly after administration. However, the low tumor residence time of many TRTs limits therapeutic dose delivery and has become the Achilles heel to their clinical translation. To combat the tumor efflux of these otherwise promising agents, we have previously presented a strategy of equipping low-molecular weight TRTs with irreversible cysteine cathepsin inhibitors (e.g., E-64 analogues). These inhibitors are capable of forming irreversible adducts with cysteine proteases within the endolysosomal compartments of cells. Using these endolysosomal trapping agents (ETs), the receptor-targeted constructs are able to increase tumor retention and, thus, deliverable therapeutic doses. In this study, we examine this approach in the development of agents targeting the neurotensin receptor subtype 1 (NTSR1), a receptor overexpressed in numerous cancers. Using an antagonistic NTSR1-targeting vector, we explore the impact of charge modification of the ETs on the in vitro and in vivo biological performance of the constructs using HT-29 colon cancer models. Four ETs (based on the epoxysuccinyl peptide E-64) with various charge states were synthesized and incorporated into the structures of the NTSR1-targeted antagonist. These four <sup>177</sup>Lu-labeled, ET-enhanced, NTSR1-targeted agents (<sup>177</sup>Lu-NA-ET1-4), along with the structurally analogous <sup>177</sup>Lu-3BP-227, currently in clinical trials, underwent a battery of in vitro assays using HT-29 xenograft colon cancer cells to examine their NTSR1 binding, internalization and efflux, inhibition, and adduct formation properties. The biodistribution profile of these constructs was studied in an HT-29 mouse model. Charge modification of the terminal carboxylic acid and arginine of the ETs had deleterious effects on inhibition kinetics and in vitro adduct formation. Contrastingly, deletion of the arginine resulted in a modest increase in inhibition kinetics. Incorporation of ETs into the NTSR1-targeted agents was well-tolerated with minimal impact on the in vivo NTSR1 targeting but resulted in increased renal uptake. This study demonstrates that the ETs can be successfully incorporated into antagonistic NTSR1-targeted constructs without compromising their adduct formation capabilities. Based on these results, further exploration of the endolysosomal trapping approach is warranted in NTSR1- and other receptor-targeted antagonistic constructs.

Also flagged:collagenperiodontitispeptidematrix-metalloproteinaseMMPSynthesis
Journal Article 2022-07-06 No Snippets Fraser D, Nguyen T, Kotelsky A, Lee W, Buckley M, Benoit DSW.
Show Full Abstract

Cell and tissue alignment is a defining feature of periodontal tissues. Therefore, the development of scaffolds that can guide alignment of periodontal ligament cells (PDLCs) relative to tooth root (dentin) surfaces is highly relevant for periodontal tissue engineering. To control PDLC alignment adjacent to the dentin surface, poly(ethylene glycol) (PEG)-based hydrogels were explored as a highly tunable matrix for encapsulating cells and directing their activity. Specifically, a composite system consisting of dentin blocks, PEG hydrogels, and PDLCs was created to control PDLC alignment through hydrogel swelling. PDLCs in composites with minimal hydrogel swelling showed random alignment adjacent to dentin blocks. In direct contrast, the presence of hydrogel swelling resulted in PDLC alignment perpendicular to the dentin surface, with the degree and extension of alignment increasing as a function of swelling. Replicating this phenomenon with different molds, block materials, and cells, together with predictive modeling, indicated that PDLC alignment was primarily a biomechanical response to swelling-mediated strain. Altogether, this study describes a novel method for inducing cell alignment adjacent to stiff surfaces through applied strain and provides a model for the study and engineering of periodontal and other aligned tissues.

Also flagged:bincorMediruneredNucleotide
Journal Article 2022-07-06 No Snippets Liautard-Haag C, Durif G, VanGoethem C, Baux D, Louis A, Cayrefourcq L, Lamairia M, Willems M, Zordan C, Dorian V, Rooryck C, Goizet C, Chaussenot A, Monteil L, Calvas P, Miry C, Favre R, Le Boette E, Fradin M, Roux AF, Cossée M, Koenig M, Alix-Panabière C, Guissart C, Vincent MC.
Show Full Abstract

The field of noninvasive prenatal diagnosis (NIPD) has undergone significant progress over the last decade. Direct haplotyping has been successfully applied for NIPD of few single-gene disorders. However, technical issues remain for triplet-repeat expansions. The objective of this study was to develop an NIPD approach for couples at risk of transmitting dynamic mutations. This method includes targeted enrichment for linked-read libraries and targeted maternal plasma DNA sequencing. We also developed an innovative Bayesian procedure to integrate the Hoobari fetal genotyping model for inferring the fetal haplotype and the targeted gene variant status. Our method of directly resolving parental haplotypes through targeted linked-read sequencing was smoothly performed using blood samples from families with Huntington's disease or myotonic dystrophy type 1. The Bayesian analysis of transmission of parental haplotypes allowed defining the genotype of five fetuses. The predicted variant status of four of these fetuses was in agreement with the invasive prenatal diagnosis findings. Conversely, no conclusive result was obtained for the NIPD of fragile X syndrome. Although improvements should be made to achieve clinically acceptable accuracy, our study shows that linked-read sequencing and parental haplotype phasing can be successfully used for NIPD of triplet-repeat expansion diseases.Trial registration: NCT04698551_date of first registration: 07/01/2021.

Also flagged:sex chromosomesautosomesTrypsincollagenasecollagenase 1Aantibodies
Journal Article 2022-07-06 No Snippets Garcia-Alonso L, Lorenzi V, Mazzeo CI, Alves-Lopes JP, Roberts K, Sancho-Serra C, Engelbert J, Marečková M, Gruhn WH, Botting RA, Li T, Crespo B, van Dongen S, Kiselev VY, Prigmore E, Herbert M, Moffett A, Chédotal A, Bayraktar OA, Surani A, Haniffa M, Vento-Tormo R.
Show Full Abstract

Gonadal development is a complex process that involves sex determination followed by divergent maturation into either testes or ovaries<sup>1</sup>. Historically, limited tissue accessibility, a lack of reliable in vitro models and critical differences between humans and mice have hampered our knowledge of human gonadogenesis, despite its importance in gonadal conditions and infertility. Here, we generated a comprehensive map of first- and second-trimester human gonads using a combination of single-cell and spatial transcriptomics, chromatin accessibility assays and fluorescent microscopy. We extracted human-specific regulatory programmes that control the development of germline and somatic cell lineages by profiling equivalent developmental stages in mice. In both species, we define the somatic cell states present at the time of sex specification, including the bipotent early supporting population that, in males, upregulates the testis-determining factor SRY and sPAX8s, a gonadal lineage located at the gonadal-mesonephric interface. In females, we resolve the cellular and molecular events that give rise to the first and second waves of granulosa cells that compartmentalize the developing ovary to modulate germ cell differentiation. In males, we identify human SIGLEC15<sup>+</sup> and TREM2<sup>+</sup> fetal testicular macrophages, which signal to somatic cells outside and inside the developing testis cords, respectively. This study provides a comprehensive spatiotemporal map of human and mouse gonadal differentiation, which can guide in vitro gonadogenesis.

Also flagged:behaviorsVisionNdnfRelnAcetylcholineVipr2
Journal Article 2022-07-06 ✓ 1 Snippet Bugeon S, Duffield J, Dipoppa M, Ritoux A, Prankerd I, Nicoloutsopoulos D, Orme D, Shinn M, Peng H, Forrest H, Viduolyte A, Reddy CB, Isogai Y, Carandini M, Harris KD.
In-Text Gene Mentions

…, Tnfaip8l3 ,Unc13c, Pdlim3 ,…

Show Full Abstract

Transcriptomics has revealed that cortical inhibitory neurons exhibit a great diversity of fine molecular subtypes<sup>1-6</sup>, but it is not known whether these subtypes have correspondingly diverse patterns of activity in the living brain. Here we show that inhibitory subtypes in primary visual cortex (V1) have diverse correlates with brain state, which are organized by a single factor: position along the main axis of transcriptomic variation. We combined in vivo two-photon calcium imaging of mouse V1 with a transcriptomic method to identify mRNA for 72 selected genes in ex vivo slices. We classified inhibitory neurons imaged in layers 1-3 into a three-level hierarchy of 5 subclasses, 11 types and 35 subtypes using previously defined transcriptomic clusters<sup>3</sup>. Responses to visual stimuli differed significantly only between subclasses, with cells in the Sncg subclass uniformly suppressed, and cells in the other subclasses predominantly excited. Modulation by brain state differed at all hierarchical levels but could be largely predicted from the first transcriptomic principal component, which also predicted correlations with simultaneously recorded cells. Inhibitory subtypes that fired more in resting, oscillatory brain states had a smaller fraction of their axonal projections in layer 1, narrower spikes, lower input resistance and weaker adaptation as determined in vitro<sup>7</sup>, and expressed more inhibitory cholinergic receptors. Subtypes that fired more during arousal had the opposite properties. Thus, a simple principle may largely explain how diverse inhibitory V1 subtypes shape state-dependent cortical processing.

Also flagged:nucleotideamino acidORF2Cap proteinnucleotidesamino acids
Journal Article 2022-07-06 No Snippets Doan HTT, Do RT, Thao PTP, Le XTK, Nguyen KT, Hien NTT, Duc LM, Pham LTK, Le TH.
Show Full Abstract

We conducted nucleotide and amino acid sequence alignment and phylogenetic analysis of porcine circovirus ORF2 (Cap protein) from 17 PCV2-positive clinical samples from nine different northern Vietnamese provinces (Mar 2018-Nov 2020), four local vaccines, and 77 reference strains. We identified one PCV2a (1/17 = 5.9%), five PCV2b (5/17 = 29.9%), and 11 PCV2d (11/17 = 64.7%) isolates, while only PCV2d was detected in 2020. Timeline analysis indicated an increasing predominance of PCV2d nationwide (2018-2020). With strong nodal support (98% for nucleotides and 74% for amino acids), the phylogenetic tree topology revealed a distinct PCV2h clade including recombinant/intermediate strains and local vaccines. The Cap protein sequences from 11 PCV2d field strains had the 2d-genotype-typical motif <sup>86</sup>SNPLSV<sup>91</sup> in loop CD, the motif TGID in loop GH-HI, and the motif <sup>230</sup>PLNPK<sup>234</sup> in loop CT. The PCV2h isolates (and vaccines) had the <sup>86</sup>SNPLSV<sup>91</sup>, SAID, and <sup>230</sup>L(N/H)PK<sup>234</sup> motifs. Selection pressure analysis indicated positive selection at seven sites: A<sup>68</sup>N in immunoreactive region (IRR)-A; <sup>119</sup>G and <sup>130</sup>V in IRR-B; and <sup>167</sup>L, T<sup>190</sup>(A/S), <sup>194</sup>D and <sup>202</sup>F in IRR-C. We identified PCV2h as the genotype of the recombinant strains, which resulted from intergenotype recombination of PCV2a, PCV2b, and PCV2d. The current data provide new information about the diversity, distribution, and dominance of the PCV2 genotype in Vietnam.

Also flagged:CO1cell deathfars2Annexin VPax6extracellular
Journal Article 2022-07-06 ✓ 1 Snippet Chen X, Liu F, Li B, Wang Y, Yuan L, Yin A, Chen Q, Hu W, Yao Y, Zhang M, Wu Y, Chen K.
In-Text Gene Mentions

…mt-aaRSs genes includingDARS2[ 3 ],…

Show Full Abstract

<h4>Background</h4>Neurodegenerative diseases encompass an extensive and heterogeneous group of nervous system disorders which are characterized by progressive degeneration and death of neurons. Many lines of evidence suggest the participation of mitochondria dysfunction in these diseases. Mitochondrial phenylalanyl-tRNA synthetase, encoded by FARS2, catalyzes the transfer of phenylalanine to its cognate tRNA for protein synthesis. As a member of mt-aaRSs genes, FARS2 missense homozygous mutation c.424G > T (p.D142Y) found in a Chinese consanguineous family first built the relationship between pure hereditary spastic paraplegia (HSP) and FARS2 gene. More FARS2 variations were subsequently found to cause heterogeneous group of neurologic disorders presenting three main phenotypic manifestations: infantile-onset epileptic mitochondrial encephalopathy, later-onset spastic paraplegia and juvenile onset refractory epilepsy. Studies showed that aminoacylation activity is frequently disrupt in cases with FARS2 mutations, indicating a loss-of-function mechanism. However, the underlying pathogenesis of neuropathy-associated Fars2 deficiency is still largely unknown.<h4>Results</h4>Early gestation lethality of global Fars2 knockout mice was observed prior to neurogenesis. The conditional Fars2 knockout-mouse model delayed lethality to late-gestation, resulting in a thinner cortex and an enlarged ventricle which is consist with the MRI results revealing cortical atrophy and reduced cerebral white matter volume in FARS2-deficient patients. Delayed development of neurite outgrowth followed by neuronal apoptosis was confirmed in Fars2-knockdown mouse primary cultured neurons. Zebrafish, in which fars2 was knocked down, exhibited aberrant motor neuron function including reduced locomotor capacity which well restored the spastic paraplegia phenotype of FARS2-deficient patients. Altered mitochondrial protein synthesis and reduced levels of oxidative phosphorylation complexes were detected in Fars2-deficient samples. And thus, reduced ATP, total NAD levels and mitochondrial membrane potential, together with increased ROS production, revealed mitochondrial dysfunction both in vitro and in vivo. Dctn3 is a potential downstream molecule in responds to Fars2 deficient in neurons, which may provide some evidence for the development of pathogenesis study and therapeutic schedule.<h4>Conclusions</h4>The Fars2 deficiency genetic models developed in this study cover the typical clinical manifestations in FARS2 patients, and help clarify how neuropathy-associated Fars2 deficiency, by damaging the mitochondrial respiratory chain and impairing mitochondrial function, affects neuronal development and potentiates neuronal cell apoptosis.

Also flagged:genetic diseaseslipidnanoparticleendocytosismembranesacidification
Journal Article 2022-07-06 No Snippets Raguram A, Banskota S, Liu DR.
Show Full Abstract

In vivo gene editing therapies offer the potential to treat the root causes of many genetic diseases. Realizing the promise of therapeutic in vivo gene editing requires the ability to safely and efficiently deliver gene editing agents to relevant organs and tissues in vivo. Here, we review current delivery technologies that have been used to enable therapeutic in vivo gene editing, including viral vectors, lipid nanoparticles, and virus-like particles. Since no single delivery modality is likely to be appropriate for every possible application, we compare the benefits and drawbacks of each method and highlight opportunities for future improvements.

Also flagged:histone deacetylasesHDACsacetylcancergene expressionSMRT
Journal Article 2022-07-06 No Snippets Lee K, Whedon SD, Wang ZA, Cole PA.
Show Full Abstract

Classical histone deacetylases (HDACs) are enzymes that can hydrolytically cleave acetyl-Lys in histones and other proteins and serve as established drug targets in some forms of cancer. Class I HDACs 1-3 typically exist in a range of multiprotein complexes inside cells and show distinct biological functions in modulating gene expression. In recent years, it has become possible to purify and analyze the structure and enzymatic properties of several of these HDAC complexes, including CoREST, MiDAC, NuRD, Sin3, SMRT, MIER, and RERE. Here, we summarize what is experimentally established and/or computationally predicted about the structure of these complexes to describe their particular catalytic activities and site-specificities with modified nucleosome substrates.

Also flagged:Amyotrophic Lateral SclerosisALSmotor neuron degenerationintellectual disabilityIDintellectual disabilities
Journal Article 2022-07-06 ✓ 5 Snippets Goldstein O, Inbar T, Kedmi M, Gana-Weisz M, Abramovich B, Orr-Urtreger A, Drory VE.
In-Text Gene Mentions

Because these variants have very low allele frequencies (estimated frequencies of 1:200,000 in AJs and 1:269 millions worldwide, for GTP2-p.D422Y homozygotes and DNAH10-R3699C/W4348C CH, respectively) and are predicted to be pathogenic, this may suggest that although FUS-P525L is a necessary and sufficient for the motor symptoms of ALS, additional genetic variants may be involved in the overall expression of ID phenotype.

This proband also carried 2 rare variants in DNAH10, R3699C (allele frequency 6.2E-05), and W4348C (allele frequency 2.4E-05), both highly conserved, change a large amino acid to a tiny, have a high disease propensity score (1.71 and 2.21, respectively), with a large decrease effect of protein stability (DDG of [−0.99] and [−1.75], respectively).

…( GPT2 ,DNAH10, and SCUBE2…

…D371Y), andDNAH10(p.R3699C/p.…

…( SCUBE2 ,DNAH10, GPT2 ,…

Show Full Abstract

<h4>Background and objectives</h4>Amyotrophic lateral sclerosis (ALS) is characterized by upper and lower motor neuron degeneration, with juvenile ALS (jALS) defined as disease with age at onset (AAO) before 25 years. We aimed to identify the genetic basis of 2 unrelated patients with jALS with very rapid deterioration and early age intellectual disability (ID) and to assess association of genetic findings with both phenotypes in a large cohort of patients with ALS and controls, and in the literature.<h4>Methods</h4>Exome sequencing was performed in 2 unrelated probands and their parents. Trio analyses included de novo, rare homozygosity, and compound heterozygosity analyses. A TaqMan genotyping assay was used to genotype ALS cohorts. A systematic literature review was conducted and additional information from authors obtained to assess prevalence of fused in sarcoma (<i>FUS</i>)-ALS associated with ID.<h4>Results</h4>A de novo mutation <i>FUS</i>-P525L was identified in both patients. Additional variations were identified in other genes related to intellectual disabilities. Among 8 additional unrelated juvenile patients, one carried the same <i>FUS</i> mutation and had a similar medical history of mild ID and fulminant ALS, whereas the others did not carry any <i>FUS</i> coding mutations and had no reported learning or intellectual disabilities (<i>p</i> = 0.0083). In addition, 486 patients with ALS with AAO ≥25 years were negative for this mutation. An extensive literature review showed that among all patients with <i>FUS</i>-related ALS with full phenotype reports, 10.3% exhibited additional learning/intellectual disabilities.<h4>Discussion</h4><i>FUS</i>-P525L mutation was identified in 3 among 10 patients with jALS (30%) in our clinical cohort, all with a very aggressive disease course and ID. Together with literature reports, these results support a novel association between mutations in <i>FUS</i> and early life ID. Additional variations identified in genes related to ID and brain development in our patients (<i>GPT2</i>, <i>DNAH10</i>, and <i>SCUBE2</i>) may suggest a complex oligogenic inheritance for this phenotype. We propose that this mutation should be screened in patients with ALS with very early AAO, aggressive disease course, and sporadic occurrence, especially when ALS is accompanied by ID.

Also flagged:HepcidinpeptideCOVID-19Coronavirus Disease 2019diabetesinsulin
Journal Article 2022-07-06 ✓ 1 Snippet Zeinivand M, Jamali-Raeufy N, Zavvari F.
In-Text Gene Mentions

…tomegalovirus (HCMV) infectionHFE(Homeostatic Iron Regulator),…

Show Full Abstract

Coronavirus Disease 2019 (COVID-19) is a recent public health issue worldwide. Also, diabetes is a frequent condition with high mortality. There is a strong relationship between COVID-19 and diabetes. This article analyses the intricate relationship between COVID-19 and hepcidin. Hepcidin increases in aged non-insulin diabetic patients. Hepcidin is the last target treatment of several medications commonly used. Viral diseases, especially SARS-CoV19, can activate the hepcidin pathway leading to an elevation in the iron load. This increased iron is released into the bloodstream and results in cell death through ferroptosis, like free iron. Excess iron has pro-coagulative and toxic effects. Hepcidin overexpression and iron overload are associated with COVID-19 infection and can be considered potential targets for treatment. Several studies have shown dalteparin (anti-Hepcidin) could improve the symptoms of COVID-19 in diabetics by appropriately modulating and decreasing oxidative stress and inflammation. This finding can be leading to enhancing the existing knowledge about Therapeutic measures for reducing Covid-19 impairments in diabetics and is suggested as a possible therapeutic agent in diabetes.

Also flagged:calciumsynthesismineralsbone formationmineralizationhydroxyapatite
Journal Article 2022-07-06 No Snippets Galvão RA, Pavon B, Morán MCB, Barbin MVC, Martimbianco ALC, Colares Neto GP.
Show Full Abstract

<h4>Objective</h4>The objective of this study was to map and synthesize evidence on the adequacy of dietary calcium intake and dairy products in Brazilian preschoolers and schoolchildren.<h4>Data source</h4>Evidence searches were performed in the MEDLINE (via PubMed) and Latin American and Caribbean Health Sciences Literature (LILACS; via BVS) databases, with no restriction on date or language of publication. Experimental or observational studies that evaluated healthy Brazilian children between 2 and 12 incomplete years old were included.<h4>Data synthesis</h4>A total of 18 studies were included. Seven of 11 studies of 11 studies (63.6%) identified mean values of dietary calcium intake below the age recommendation, especially in schoolchildren, with the progression of the age group. Among preschoolers, studies with direct weighing of food showed higher mean values of dietary calcium ingested compared to those with dietary recall. Children attending public daycare centers on a part-time basis tended to have inadequate calcium intake. The consumption of milk and dairy products was lower among older children, especially schoolchildren.<h4>Conclusions</h4>Inadequate dietary calcium intake seems to be prevalent in Brazil during childhood, especially among schoolchildren. Therefore, the evaluation of milk and dairy products intake must be considered in order to desgn appropriate corrective actions.

Also flagged:gene expressionBSL2chromosomecell divisioncell cyclechromosomes
Journal Article 2022-07-06 No Snippets Gorbsky GJ, Daum JR, Sapkota H, Summala K, Yoshida H, Georgescu C, Wren JD, Peshkin L, Horb ME.
Show Full Abstract

The diploid anuran <i>Xenopus tropicalis</i> has emerged as a key research model in cell and developmental biology. To enhance the usefulness of this species, we developed methods for generating immortal cell lines from Nigerian strain (NXR_1018, RRID:SCR_013731) <i>X. tropicalis</i> embryos. We generated 14 cell lines that were propagated for several months. We selected four morphologically distinct lines, XTN-6, XTN-8, XTN-10 and XTN-12 for further characterization. Karyotype analysis revealed that three of the lines, XTN-8, XTN-10 and XTN-12 were primarily diploid. XTN-6 cultures showed a consistent mixed population of diploid cells, cells with chromosome 8 trisomy, and cells containing a tetraploid content of chromosomes. The lines were propagated using conventional culture methods as adherent cultures at 30°C in a simple, diluted L-15 medium containing fetal bovine serum without use of a high CO<sub>2</sub> incubator. Transcriptome analysis indicated that the four lines were distinct lineages. These methods will be useful in the generation of cell lines from normal and mutant strains of <i>X. tropicalis</i> as well as other species of <i>Xenopus</i>.

Also flagged:Vitamin D Deficiencymetabolic diseasesobesityhyperlipidemiadiabetes mellitusvitamin D
Journal Article 2022-07-06 ✓ 1 Snippet Mohd Ghozali N, Giribabu N, Salleh N.
In-Text Gene Mentions

It has also been proposed that vitamin D upregulates the Cacna1e gene, which encodes the Cav2.3 subunit of R-type VGCC [85].

Show Full Abstract

Vitamin D deficiency is a common health problem worldwide. Despite its known skeletal effects, studies have begun to explore its extra-skeletal effects, that is, in preventing metabolic diseases such as obesity, hyperlipidemia, and diabetes mellitus. The mechanisms by which vitamin D deficiency led to these unfavorable metabolic consequences have been explored. Current evidence indicates that the deficiency of vitamin D could impair the pancreatic <i>β</i>-cell functions, thus compromising its insulin secretion. Besides, vitamin D deficiency could also exacerbate inflammation, oxidative stress, and apoptosis in the pancreas and many organs, which leads to insulin resistance. Together, these will contribute to impairment in glucose homeostasis. This review summarizes the reported metabolic effects of vitamin D, in order to identify its potential use to prevent and overcome metabolic diseases.

Also flagged:ERβestrogen receptorsnuclear receptorsestrogenligand-transcription factors
Journal Article 2022-07-06 No Snippets Song D, He H, Indukuri R, Huang Z, Stepanauskaite L, Sinha I, Haldosén LA, Zhao C, Williams C.
Show Full Abstract

The two estrogen receptors ERα and ERβ are nuclear receptors that bind estrogen (E2) and function as ligand-inducible transcription factors. They are homologues and can form dimers with each other and bind to the same estrogen-response element motifs in the DNA. ERα drives breast cancer growth whereas ERβ has been reported to be anti-proliferative. However, they are rarely expressed in the same cells, and it is not fully investigated to which extent their functions are different because of inherent differences or because of different cellular context. To dissect their similarities and differences, we here generated a novel estrogen-dependent cell model where ERα homodimers can be directly compared to ERβ homodimers within the identical cellular context. By using CRISPR-cas9 to delete ERα in breast cancer MCF7 cells with Tet-Off-inducible ERβ expression, we generated MCF7 cells that express ERβ but not ERα. MCF7 (ERβ only) cells exhibited regulation of estrogen-responsive targets in a ligand-dependent manner. We demonstrated that either ER was required for MCF7 proliferation, but while E2 increased proliferation <i>via</i> ERα, it reduced proliferation through a G2/M arrest <i>via</i> ERβ. The two ERs also impacted migration differently. In absence of ligand, ERβ increased migration, but upon E2 treatment, ERβ reduced migration. E2 <i>via</i> ERα, on the other hand, had no significant impact on migration. RNA sequencing revealed that E2 regulated a transcriptome of around 800 genes <i>via</i> each receptor, but over half were specific for either ERα or ERβ (417 and 503 genes, respectively). Functional gene ontology enrichment analysis reinforced that E2 regulated cell proliferation in opposite directions depending on the ER, and that ERβ specifically impacted extracellular matrix organization. We corroborated that ERβ bound to cis-regulatory chromatin of its unique proposed migration-related direct targets ANXA9 and TFAP2C. In conclusion, we demonstrate that within the same cellular context, the two ERs regulate cell proliferation in the opposite manner, impact migration differently, and each receptor also regulates a distinct set of target genes in response to E2. The developed cell model provides a novel and valuable resource to further complement the mechanistic understanding of the two different ER isoforms.

Also flagged:CancerOLFML2Bolfactomedin-like 2Bolfactomedintumorstumor
Journal Article 2022-07-06 ✓ 1 Snippet Hu P, Zhang X, Li Y, Xu L, Qiu H.
In-Text Gene Mentions

…genes, especially inTNFSF4, TNFSF8, STING1, IL6,…

Show Full Abstract

<b>Background:</b> The function of olfactomedin-like 2B (OLFML2B), as a member of the olfactomedin domain-containing protein family, remains ambiguous, especially in tumors. The current study explores the possible correlation between OLFML2B, prognosis, and immune infiltration in pan-cancer. <b>Methods:</b> We applied a number of bioinformatics techniques to probe the prospective function of OLFML2B, consisting of its association with prognosis, clinicopathology, alteration, GSEA, tumor microenvironment (TME), immune-associated genes, immune infiltration, tumor mutational burden (TMB), microsatellite instability (MSI), and drug sensitivity in several cancer types. qPCR and immunohistochemistry were used to identify OLFML2B expression in LIHC cell lines and liver cancer tissues. <b>Results:</b> We discovered that OLFML2B was overexpressed in 14 cancers and positively related to several cancer type prognoses. The expression of OLFML2B was further validated in the LIHC cell lines. OLFML2B expression was bound up with TMB in 13 cancers, MSI in 10 cancers, and TME in almost all cancers. Furthermore, OLFML2B was highly co-expressed with genes encoding immune activators and immune suppressors. We further found that OLFML2B played a role in infiltrating different types of immune cells, such as macrophages and cancer-associated fibroblasts. OLFML2B may influence various cancer and immune-related pathways, such as the PI3K-Akt signaling pathway, ECM-receptor interaction, focal adhesion, and leukocyte transendothelial migration. In addition, OLFML2B may increase drug resistance of binimetinib, cobimentinib, and trametinib. <b>Conclusion:</b> Our outcomes reveal that OLFML2B may act as a prognostic marker and a potential target in immunotherapy for diverse tumors due to its oncogenesis function and immune infiltration.

Also flagged:circularosteogenesisankylosing spondylitisAScell matrix adhesionTGF-beta
Journal Article 2022-07-06 No Snippets Wang S, Chen F, Zeng C, Gu H, Wang Z, Yu W, Wu Y, Shen H.
Show Full Abstract

Recent studies have reported that circular RNAs (circRNAs) play a crucial regulatory role in a variety of human diseases. However, the roles of circRNAs in pathological osteogenesis in ankylosing spondylitis (AS) remain unclear. We conducted circRNA and miRNA expression profiling of osteogenically differentiated bone marrow-derived mesenchymal stem cells (BMSCs) of patients with AS compared with those of healthy donors (HDs) by RNA sequencing (RNA-seq). Results showed that a total of 31806 circRNAs were detected in the BMSC samples, of which 418 circRNAs were significantly differentially expressed (DE) with a fold change ≥2 and <i>p</i> value <0.05. Among these, 204 circRNAs were upregulated, and 214 were downregulated. GO and KEGG analyses demonstrated that the DE circRNAs were mainly involved in the regulation of biological processes of the cell matrix adhesion and the TGF-beta signaling pathway, which are closely related to AS. circRNA-miRNA interaction networks related to the TGF-beta signaling pathway were established. The results of qRT-PCR showed that has_circ_0070562 was significantly up-regulated in AS-MSCs. <i>In vitro</i> experiments showed that silencing of has_circ_0070562 weakened osteogenesis of AS-BMSCs. In conclusion, we identified numerous circRNAs that were dysregulated in AS-BMSCs compared with HD-BMSCs. Bioinformatic analyses suggested that these dysregulated circRNAs might play important functional roles in AS-BMSCs osteogenesis. Circ_0070562 functioned as a pro-ostegenic factor and might serve as a potential biomarker and a therapeutic target for AS.

Also flagged:BTN3A2cancerlung adenocarcinomaLUADT-cell receptorB-cell receptor
Journal Article 2022-07-06 ✓ 1 Snippet Lin Y, Zhou H, Li S.
In-Text Gene Mentions

…BTN3A1, BTN3A2, andBTN3A3.…

Show Full Abstract

<b>Background:</b> Butyrophilin subfamily 3 member A2 (BTN3A2) is an important mediator in immune activation, and it is reported to be linked to many cancer progresses. However, the relation with infiltrating immune and prognosis of BTN3A2 in lung adenocarcinoma are not clear. <b>Methods:</b> In our study, we checked the mRNA expression and protein expression profile of BTN3A2 in lung adenocarcinoma (LUAD) and its relation to clinical outcomes using TIMER and UALCAN databases. In addition, we analyzed the survival of BTN3A2 in LUAD using the Kaplan-Meier Plotter database and PrognoScan database. Moreover, we analyzed gene set enrichment analysis (GSEA) of the BTN3A2. Next, we explored the relation of BTN3A2 expression with the immune infiltration by TIMER. At last, in order to enrich the regulatory mechanism of BTN3A2, we used miRarbase, starbase, and miRDB databases to look for miRNA targets of BTN3A2. <b>Results:</b> The mRNA along with the protein expression of BTN3A2 in the LUAD group was lower than that in the normal group. In addition, high BTN3A2 expression was connected with good first progression (FP) and overall survival (OS) in LUAD. Then, the GSEA analysis demonstrated that T-cell receptor signaling cascade, B-cell receptor signaling cascade, natural killer cell-mediated cytotoxicity, immune receptor activity, immunological synapse, and T-cell activation were enriched differentially in the BTN3A2 high expression phenotype of LUAD. Moreover, BTN3A2 expression is a remarkable positive correlation with invading levels of tumor purity, B cells, neutrophils, CD4+ T cells, dendritic cells, macrophages, and CD8+ T cells in LUAD, and B cells and dendritic cells were linked with a good prognosis of LUAD. To further enrich the possible regulatory mechanisms of BTN3A2, we analyzed the miRNA targets. The results showed that hsa-miR-17-5p may be miRNA targets of BTN3A2. <b>Conclusion:</b> Taking together, we provide evidence of BTN3A2 as possible prognosis biomarkers of LUAD. In addition, high BTN3A2 expression in LUAD may influence the prognosis because of immune invasion. Moreover, our findings provide a potential mechanism that hsa-miR-17-5p may be miRNA targets of BTN3A2.

Also flagged:auxin-responsive protein IAA14YUCAUXPP2Cprobable protein phosphatase 2C 24probable flavin-containing monooxygenase 1
Journal Article 2022-07-06 ✓ 5 Snippets Wen Y, Li S, Bao G, Wang J, Liu X, Hu J, Zhao F, Zhao Z, Shi B, Luo Y.
In-Text Gene Mentions

…hub genes P4HA2,FBXL4, and PPARA…

…four genes (FBXL4, FBXO32, TBC1D17 ,…

FBXL4was found to…

FBXL4, FBXO32, TBC1D17 ,…

…The proteinsFBXL4and FBX032 are…

Show Full Abstract

Tibetan sheep are mainly distributed in the Qinghai-Tibet Plateau. Its meat is not only essential for the local people but also preferred by the non-inhabitant of this plateau also. To investigate the salient development features and molecular mechanism of the meat difference of LT muscle caused by different growth stages in Tibetan sheep, the carcass performance, meat quality, and comparative transcriptome analysis were performed for investigating the potential molecular mechanism of the meat quality difference of the LT muscle caused by four growth stages [4-months old (4 months), 1.5-years old (1.5 years), 3.5-years old (3.5 years), and 6-years old (6 years)] in the Tibetan sheep. The shear force increased with the increase of age (<i>p</i> < 0.05) while the intramuscular fat (IMF) was the highest at 1.5 y. The AMPK signaling pathway was significantly enriched in the four comparative groups. The weighted gene co-expression network analysis (WGCNA) results showed that the hub genes <i>P4HA2, FBXL4</i>, and <i>PPARA</i> were identified to regulate the meat quality. In summary, 1.5 years was found to be the most suitable slaughter age of the Tibetan sheep which ensured better meat tenderness and higher IMF content. Moreover, the genes <i>LIPE, LEP, ADIPOQ, SCD</i>, and <i>FASN</i> may regulate the transformation of the muscle fiber types through the AMPK signaling pathway, further affecting the meat quality.

Also flagged:TumorglioblastomaGBMGene expressionepithelial mesenchymal transitiontumor necrosis factor-α
Journal Article 2022-07-06 ✓ 1 Snippet Liu D, Wan Y, Qu N, Fu Q, Liang C, Zeng L, Yang Y.
In-Text Gene Mentions

…IDO1, PDCD1, andTNFSF4( Figures 5A,B…

Show Full Abstract

Although the role of hypoxia has been greatly explored and unveiled in glioblastoma (GBM), the mechanism of hypoxia-related long non-coding (lnc) RNAs has not been clearly understood. This study aims to reveal the crosstalk among hypoxia-related lncRNAs, tumor microenvironment (TME), and tumorigenesis for GBM. Gene expression profiles of GBM patients were used as a basis for identifying hypoxia-related lncRNAs. Unsupervised consensus clustering was conducted for classifying samples into different molecular subtypes. Gene set enrichment analysis (GSEA) was performed to analyze the enrichment of a series of genes or gene signatures. Three molecular subtypes were constructed based on eight identified hypoxia-related lncRNAs. Oncogenic pathways, such as epithelial mesenchymal transition (EMT), tumor necrosis factor-α (TNF-α) signaling, angiogenesis, hypoxia, P53 signaling, and glycolysis pathways, were significantly enriched in C1 subtype with poor overall survival. C1 subtype showed high immune infiltration and high expression of immune checkpoints. Furthermore, we identified 10 transcription factors (TFs) that were highly correlated with lncRNA-FAM66C. Three key lncRNAs (ADAMTS9-AS2, LINC00968, and LUCAT1) were screened as prognostic biomarkers for GBM. This study shed light on the important role of hypoxia-related lncRNAs for TME modulation and tumorigenesis in GBM. The eight identified hypoxia-related lncRNAs, especially FAM66C may serve as key regulators involving in hypoxia-related pathways.

Also flagged:head and neck squamous cell carcinomashead and neck cancertumorcancercancersHNSCC
Journal Article 2022-07-06 No Snippets Boguszewicz Ł.
Show Full Abstract

This review focuses on the molecular biology of head and neck squamous cell carcinomas and presents current and emerging biomarkers of the response of patients to induction chemotherapy. The usefulness of genes, proteins, and parameters from diagnostic clinical imaging as well as other clinicopathological parameters is thoroughly discussed. The role of induction chemotherapy before radiotherapy or before chemo-radiotherapy is still debated, as the data on its efficacy are somehow confusing. Despite the constant improvement of treatment protocols and the introduction of new cytostatics, there is still no consensus regarding the use of induction chemotherapy in the treatment of head and neck cancer, with the possible exception of larynx preservation. Such difficulties indicate that potential future treatment strategies should be personalized. Personalized medicine, in which individual tumor genetics drive the selection of targeted therapies and treatment plans for each patient, has recently emerged as the next generation of cancer therapy. Early prediction of treatment outcome or its toxicity may be highly beneficial for those who are at risk of the development of severe toxicities or treatment failure-a different treatment strategy may be applied to these patients, sparing them unnecessary pain. The literature search was carried out in the PubMed and ScienceDirect databases as well as in the selected conference proceedings repositories. Of the 265 articles and abstracts found, only 30 met the following inclusion criteria: human studies, analyzing prediction of induction chemotherapy outcome or toxicity based on the pretreatment (or after the first cycle, if more cycles of induction were administered) data, published after the year 2015. The studies regarding metastatic and recurrent cancers as well as the prognosis of overall survival or the outcome of consecutive treatment were not taken into consideration. As revealed from the systematic inspection of the papers, there are over 100 independent parameters analyzed for their suitability as prognostic markers in HNSCC patients undergoing induction chemotherapy. Some of them are promising, but usually they lack important features such as high specificity and sensitivity, low cost, high positive predictive value, clinical relevance, short turnaround time, etc. Subsequent studies are necessary to confirm the usability of the biomarkers for personal medicine.

Also flagged:cell differentiationsodium alginatesynthesisgenes expressionhost cellspolycation
Journal Article 2022-07-06 No Snippets Khvorostina MA, Mironov AV, Nedorubova IA, Bukharova TB, Vasilyev AV, Goldshtein DV, Komlev VS, Popov VK.
Show Full Abstract

Gene therapy is one of the most promising approaches in regenerative medicine to restore damaged tissues of various types. However, the ability to control the dose of bioactive molecules in the injection site can be challenging. The combination of genetic constructs, bioresorbable material, and the 3D printing technique can help to overcome these difficulties and not only serve as a microenvironment for cell infiltration but also provide localized gene release in a more sustainable way to induce effective cell differentiation. Herein, the cell transfection with plasmid DNA directly incorporated into sodium alginate prior to 3D printing was investigated both in vitro and in vivo. The 3D cryoprinting ensures pDNA structure integrity and safety. 3D printed gene-activated scaffolds (GAS) mediated HEK293 transfection in vitro and effective synthesis of model EGFP protein in vivo, thereby allowing the implementation of the developed GAS in future tissue engineering applications.

Also flagged:host celldeathinflammatory responsesinflammatory responsehost cell deathpyroptosis
Journal Article 2022-07-06 ✓ 1 Snippet Chen H, Zhang J, He Y, Lv Z, Liang Z, Chen J, Li P, Liu J, Yang H, Tao A, Liu X.
In-Text Gene Mentions

OLFM4 (a neutrophil protein) negatively regulated host defense against bacterial infection and reduced immune defense against S. aureus in mice with CGD [24].

Show Full Abstract

<i>Staphylococcus aureus</i> is a very common Gram-positive bacterium, and <i>S. aureus</i> infections play an extremely important role in a variety of diseases. This paper describes the types of virulence factors involved, the inflammatory cells activated, the process of host cell death, and the associated diseases caused by <i>S. aureus</i>. <i>S. aureus</i> can secrete a variety of enterotoxins and other toxins to trigger inflammatory responses and activate inflammatory cells, such as keratinocytes, helper T cells, innate lymphoid cells, macrophages, dendritic cells, mast cells, neutrophils, eosinophils, and basophils. Activated inflammatory cells can express various cytokines and induce an inflammatory response. <i>S. aureus</i> can also induce host cell death through pyroptosis, apoptosis, necroptosis, autophagy, etc. This article discusses <i>S. aureus</i> and MRSA (methicillin-resistant <i>S. aureus</i>) in atopic dermatitis, psoriasis, pulmonary cystic fibrosis, allergic asthma, food poisoning, sarcoidosis, multiple sclerosis, and osteomyelitis. Summarizing the pathogenic mechanism of <i>Staphylococcus aureus</i> provides a basis for the targeted treatment of <i>Staphylococcus aureus</i> infection.

Also flagged:Central nervous system tumorscancerdeathmedulloblastomaglioblastomaGBM
Journal Article 2022-07-06 No Snippets Ahmed SP, Castresana JS, Shahi MH.
Show Full Abstract

Central nervous system tumors are a leading cause of cancer-related death in children and adults, with medulloblastoma (MB) and glioblastoma (GBM) being the most prevalent malignant brain tumors, respectively. Despite tremendous breakthroughs in neurosurgery, radiation, and chemotherapeutic techniques, cell heterogeneity and various genetic mutations impacting cell cycle control, cell proliferation, apoptosis, and cell invasion result in unwanted resistance to treatment approaches, with a 5-year survival rate of 70-80% for medulloblastoma, and the median survival time for patients with glioblastoma is only 15 months. Developing new medicines and utilizing combination medications may be viewed as excellent techniques for battling MB and GBM. Circular RNAs (circRNAs) can affect cancer-developing processes such as cell proliferation, cell apoptosis, invasion, and chemoresistance in this regard. As a result, several compounds have been introduced as prospective therapeutic targets in the fight against MB and GBM. The current study aims to elucidate the fundamental molecular and cellular mechanisms underlying the pathogenesis of GBM in conjunction with circRNAs. Several mechanisms were examined in detail, including PI3K/Akt/mTOR signaling, Wnt/-catenin signaling, angiogenic processes, and metastatic pathways, in order to provide a comprehensive knowledge of the involvement of circRNAs in the pathophysiology of MB and GBM.

Also flagged:FerroptosisdeathcancertumortranslationalRAS
Journal Article 2022-07-06 No Snippets von Samson-Himmelstjerna FA, Kolbrink B, Riebeling T, Kunzendorf U, Krautwald S.
Show Full Abstract

Ten years after its initial description, ferroptosis has emerged as the most intensely studied entity among the non-apoptotic forms of regulated cell death. The molecular features of ferroptotic cell death and its functional role have been characterized in vitro and in an ever-growing number of animal studies, demonstrating that it exerts either highly detrimental or, depending on the context, occasionally beneficial effects on the organism. Consequently, two contrary therapeutic approaches are being explored to exploit our detailed understanding of this cell death pathway: the inhibition of ferroptosis to limit organ damage in disorders such as drug-induced toxicity or ischemia-reperfusion injury, and the induction of ferroptosis in cancer cells to ameliorate anti-tumor strategies. However, the path from basic science to clinical utility is rocky. Emphasizing ferroptosis inhibition, we review the success and failures thus far in the translational process from basic research in the laboratory to the treatment of patients.

Also flagged:calciummitochondrialneurodegenerative diseasescardiopathiesmitochondrial diseasescancer
Journal Article 2022-07-06 ✓ 1 Snippet Suárez-Rivero JM, Pastor-Maldonado CJ, Povea-Cabello S, Álvarez-Córdoba M, Villalón-García I, Talaverón-Rey M, Suárez-Carrillo A, Munuera-Cabeza M, Reche-López D, Cilleros-Holgado P, Piñero-Pérez R, Sánchez-Alcázar JA.
In-Text Gene Mentions

Fu et al. [115] found that mutant Htt suppressed the expression of ABCB10, a component of the UPRmt [116], in various HD models by impairing its mRNA stability.

Show Full Abstract

Mitochondrial dysfunction is a key hub that is common to many diseases. Mitochondria's role in energy production, calcium homeostasis, and ROS balance makes them essential for cell survival and fitness. However, there are no effective treatments for most mitochondrial and related diseases to this day. Therefore, new therapeutic approaches, such as activation of the mitochondrial unfolded protein response (UPR<sup>mt</sup>), are being examined. UPR<sup>mt</sup> englobes several compensation processes related to proteostasis and antioxidant mechanisms. UPR<sup>mt</sup> activation, through an hormetic response, promotes cell homeostasis and improves lifespan and disease conditions in biological models of neurodegenerative diseases, cardiopathies, and mitochondrial diseases. Although UPR<sup>mt</sup> activation is a promising therapeutic option for many conditions, its overactivation could lead to non-desired side effects, such as increased heteroplasmy of mitochondrial DNA mutations or cancer progression in oncologic patients. In this review, we present the most recent UPR<sup>mt</sup> activation therapeutic strategies, UPR<sup>mt</sup>'s role in diseases, and its possible negative consequences in particular pathological conditions.

Also flagged:Salicylanilidescyclohexanedionesnocodazolecolchicinebindingtubulin
Journal Article 2022-07-06 No Snippets Gargantilla M, Persoons L, Kauerová T, Del Río N, Daelemans D, Priego EM, Kollar P, Pérez-Pérez MJ.
Show Full Abstract

The superimposition of the X-ray complexes of cyclohexanediones (i.e., TUB015), described by our research group, and nocodazole, within the colchicine binding site of tubulin provided an almost perfect overlap of both ligands. This structural information led us to propose hybrids of TUB015 and nocodazole using a salicylanilide core structure. Interestingly, salicylanilides, such as niclosamide, are well-established signal transducers and activators of transcription (STAT3) inhibitors with anticancer properties. Thus, different compounds with this new scaffold have been synthesized with the aim to identify compounds inhibiting tubulin polymerization and/or STAT3 signaling. As a result, we have identified new salicylanilides (<b>6</b> and <b>16</b>) that showed significant antiproliferative activity against a panel of cancer cells. Both compounds were able to reduce the levels of p-STAT3<sup>Tyr705</sup> without affecting the total expression of STAT3. While compound <b>6</b> inhibited tubulin polymerization and arrested the cell cycle of DU145 cells at G2/M, similar to TUB015, compound <b>16</b> showed a more potent effect on inhibiting STAT3 phosphorylation and arrested the cell cycle at G1/G0, similar to niclosamide. In both cases, no toxicity towards PBMC cells was detected. Thus, the salicylanilides described here represent a new class of antiproliferative agents affecting tubulin polymerization and/or STAT3 phosphorylation.

Also flagged:HAPB2PB1PANSinfluenza
Journal Article 2022-07-06 ✓ 1 Snippet El Sayes M, Kandeil A, Moatasim Y, El Taweel A, Rubrum A, Kutkat O, Kamel MN, Badra R, Barakat AB, McKenzie PP, El-Shesheny R, Webby RJ, Kayali G, Ali MA.
In-Text Gene Mentions

…groups of 11C57BL/six micemice (6 to…

Show Full Abstract

From 2010 to 2013, genotype I avian influenza A(H9N2) viruses of the G1-lineage were isolated from several poultry species in Egypt. In 2014, novel reassortant H9N2 viruses were detected in pigeons designated as genotype II. To monitor the subsequent genetic evolution of Egyptian A(H9N2) viruses, we characterized the full genomes of 173 viruses isolated through active surveillance from 2017 to 2022. In addition, we compared the virological characteristics and pathogenicity of representative viruses. Phylogenetic analysis of the HA indicated that all studied sequences from 2017-2021 were grouped into G1-like H9N2 viruses previously detected in Egypt. Phylogenetic analysis indicated that the Egyptian A(H9N2) viruses had undergone further reassortment, inheriting four genes (PB2, PB1, PA, NS) from genotype II, with their remaining segments deriving from genotype I viruses (these viruses designated as genotype III). Studying the virological features of the two most dominant genotypes (I and III) of Egyptian H9N2 viruses in vitro and in vivo indicated that both replicated well in mammalian cells, but did not show any clinical signs in chickens, ducks, and mice. Monitoring avian influenza viruses through surveillance programs and understanding the genetic and antigenic characteristics of circulating H9N2 viruses are essential for risk assessment and influenza pandemic preparedness.

Also flagged:bindinglectinsglycoproteinglycolipidsmembranepeptide
Journal Article 2022-07-06 No Snippets Bui DT, Li Z, Kitov PI, Han L, Kitova EN, Fortier M, Fuselier C, Granger Joly de Boissel P, Chatenet D, Doucet N, Tompkins SM, St-Pierre Y, Mahal LK, Klassen JS.
Show Full Abstract

Electrospray ionization mass spectrometry (ESI-MS) is a powerful label-free assay for detecting noncovalent biomolecular complexes <i>in vitro</i> and is increasingly used to quantify binding thermochemistry. A common assumption made in ESI-MS affinity measurements is that the relative ion signals of free and bound species quantitatively reflect their relative concentrations in solution. However, this is valid only when the interacting species and their complexes have similar ESI-MS response factors (RFs). For many biomolecular complexes, such as protein-protein interactions, this condition is not satisfied. Existing strategies to correct for nonuniform RFs are generally incompatible with static nanoflow ESI (nanoESI) sources, which are typically used for biomolecular interaction studies, thereby significantly limiting the utility of ESI-MS. Here, we introduce slow mixing mode (SLOMO) nanoESI-MS, a direct technique that allows both the RF and affinity (<i>K</i> <sub>d</sub>) for a biomolecular interaction to be determined from a single measurement using static nanoESI. The approach relies on the continuous monitoring of interacting species and their complexes under nonhomogeneous solution conditions. Changes in ion signals of free and bound species as the system approaches or moves away from a steady-state condition allow the relative RFs of the free and bound species to be determined. Combining the relative RF and the relative abundances measured under equilibrium conditions enables the <i>K</i> <sub>d</sub> to be calculated. The reliability of SLOMO and its ease of use is demonstrated through affinity measurements performed on peptide-antibiotic, protease-protein inhibitor, and protein oligomerization systems. Finally, affinities measured for the binding of human and bacterial lectins to a nanobody, a viral glycoprotein, and glycolipids displayed within a model membrane highlight the tremendous power and versatility of SLOMO for accurately quantifying a wide range of biomolecular interactions important to human health and disease.

Also flagged:mitochondrialmitochondrial genomeformitochondrial disordersMitochondriaorganellescalcium
Journal Article 2022-07-06 No Snippets Almannai M, El-Hattab AW, Azamian MS, Ali M, Scaglia F.
Show Full Abstract

Mitochondrial DNA (mtDNA) replication depends on the mitochondrial import of hundreds of nuclear encoded proteins that control the mitochondrial genome maintenance and integrity. Defects in these processes result in an expanding group of disorders called mtDNA maintenance defects that are characterized by mtDNA depletion and/or multiple mtDNA deletions with variable phenotypic manifestations. As it applies for mitochondrial disorders in general, current treatment options for mtDNA maintenance defects are limited. Lately, with the development of model organisms, improved understanding of the pathophysiology of these disorders, and a better knowledge of their natural history, the number of preclinical studies and existing and planned clinical trials has been increasing. In this review, we discuss recent preclinical studies and current and future clinical trials concerning potential therapeutic options for the different mtDNA maintenance defects.

Also flagged:extracellularorganogenesisorganizationtranslationaltissue developmenttissue homeostasis
Journal Article 2022-07-06 No Snippets Unagolla JM, Jayasuriya AC.
Show Full Abstract

Organoid, a 3D structure derived from various cell sources including progenitor and differentiated cells that self-organize through cell-cell and cell-matrix interactions to recapitulate the tissue/organ-specific architecture and function <i>in vitro</i>. The advancement of stem cell culture and the development of hydrogel-based extracellular matrices (ECM) have made it possible to derive self-assembled 3D tissue constructs like organoids. The ability to mimic the actual physiological conditions is the main advantage of organoids, reducing the excessive use of animal models and variability between animal models and humans. However, the complex microenvironment and complex cellular structure of organoids cannot be easily developed only using traditional cell biology. Therefore, several bioengineering approaches, including microfluidics, bioreactors, 3D bioprinting, and organoids-on-a-chip techniques, are extensively used to generate more physiologically relevant organoids. In this review, apart from organoid formation and self-assembly basics, the available bioengineering technologies are extensively discussed as solutions for traditional cell biology-oriented problems in organoid cultures. Also, the natural and synthetic hydrogel systems used in organoid cultures are discussed when necessary to highlight the significance of the stem cell microenvironment. The selected organoid models and their therapeutic applications in drug discovery and disease modeling are also presented.

bioRxiv 2022-07-06 Preprint (No Snippets API) Klein TA, Grebenc DW, Shah PY, McArthur OD, Dickson BH, Surette MG, Kim Y, Whitney JC.
Show Full Abstract

<h4>ABSTRACT</h4> Bacterial type VIIb secretion systems (T7SSb) are multi-subunit integral membrane protein complexes found in Firmicutes that play a role in both bacterial competition and virulence by secreting toxic effector proteins. The majority of characterized T7SSb effectors adopt a polymorphic domain architecture consisting of a conserved N-terminal Leu-X-Gly (LXG) domain and a variable C-terminal toxin domain. Recent work has started to reveal the diversity of toxic activities exhibited by LXG effectors; however, little is known about how these proteins are recruited to the T7SSb apparatus. In this work, we sought to characterize genes encoding domains of unknown function (DUFs) 3130 and 3958, which frequently co-occur with LXG effector-encoding genes. Using coimmunoprecipitation-mass spectrometry analyses, in vitro copurification experiments and T7SSb secretion assays, we find that representative members of these protein families form heteromeric complexes with their cognate LXG domain and in doing so, function as targeting factors that promote effector export. Additionally, an X-ray crystal structure of a representative DUF3958 protein, combined with predictive modelling of DUF3130 using AlphaFold2, reveals structural similarity between these protein families and the ubiquitous WXG100 family of T7SS effectors. Interestingly, we identify a conserved FxxxD motif within DUF3130 that is reminiscent of the YxxxD/E “export arm” found in Mycobacterial T7SSa substrates and mutation of this motif abrogates LXG effector secretion. Overall, our data experimentally link previously uncharacterized bacterial DUFs to type VIIb secretion and reveal a molecular signature required for LXG effector export. <h4>Significance statement</h4> Type VIIb secretion systems (T7SSb) are protein secretion machines used by an array of Gram-positive bacterial genera including Staphylococcus, Streptococcus, Bacillus , and Enterococcus . These bacteria use the T7SSb to facilitate interbacterial killing and pathogenesis through the secretion of toxins. Although the modes of toxicity for a number of these toxins have been investigated, the mechanisms by which they are recognized and secreted by T7SSb remains poorly understood. The significance of this work is the discovery of two new protein families, termed Lap1 and Lap2, that directly interact with these toxins and are required for their secretion. Overall, Lap1 and Lap2 represent two widespread families of proteins that function as targeting factors that participate in T7SSb-dependent toxin release from Gram-positive bacteria.

Research Square 2022-07-06 Preprint (No Snippets API) Yu S, Ma C, Wang H, Yu B, Luan Y, Xia Z.
Show Full Abstract

<title>Abstract</title> <p>Background Gliomas, as the most common aggressive type of primary brain tumors, are highly prevalent and incurable among adults. The dysregulation of transcription factors, including sex determining region Y (SRY)-related high-mobility group (HMG) box (SOX) genes, are considered to be important in cancer development and progression. The aim of our study was to evaluate the effect of SOX9 in the prognosis of glioma. Results We revealed aberrant regulation of most SOX family genes by using 1289 glioma samples from the Cancer Genome Atlas (TCGA) and Chinese Glioma Genome Atlas (CGGA) cohorts. We identified 4 critical genes, SOX3, SOX6, SOX8 and SOX9, -based risk signature model through LASSO regression and a specific <italic>SOX9</italic> + cell state with more pronounced malignancy through high-quality single-cell RNA sequencing data analysis. The up regulation of SOX9 and the downregulation of SOX3, SOX6, and SOX8 indicate a decrease in overall survival. The SOX9 + cell state represents a greater proliferative capacity and invasive metastatic properties and is a primary source of attraction for infiltration of bone marrow-derived myeloid (BMM) cells, which are also demonstrated by multicolor immunofluorescence analysis. Conclusions Our study suggests that SOX9 is an independent prognostic and predictive factor for glioma, and the potential interaction between SOX9 + malignant cells and BMM deserves further investigation.</p>

Also flagged:colorectal cancertumorfibrinogencancertumorsextracellular
Journal Article 2022-07-05 ✓ 1 Snippet Hassani I, Anbiah B, Kuhlers P, Habbit NL, Ahmed B, Heslin MJ, Mobley JA, Greene MW, Lipke EA.
In-Text Gene Mentions

OLFM4

Show Full Abstract

The development of physiologically relevant<i>in vitro</i>colorectal cancer (CRC) models is vital for advancing understanding of tumor biology. Although CRC patient-derived xenografts (PDXs) recapitulate key patient tumor characteristics and demonstrate high concordance with clinical outcomes, the use of this<i>in vivo</i>model is costly and low-throughput. Here we report the establishment and in-depth characterization of an<i>in vitro</i>tissue-engineered CRC model using PDX cells. To form the 3D engineered CRC-PDX (3D-eCRC-PDX) tissues, CRC PDX tumors were expanded<i>in vivo</i>, dissociated, and the isolated cells encapsulated within PEG-fibrinogen hydrogels. Following PEG-fibrinogen encapsulation, cells remain viable and proliferate within 3D-eCRC-PDX tissues. Tumor cell subpopulations, including human cancer and mouse stromal cells, are maintained in long-term culture (29 days); cellular subpopulations increase ratiometrically over time. The 3D-eCRC-PDX tissues mimic the mechanical stiffness of originating tumors. Extracellular matrix protein production by cells in the 3D-eCRC-PDX tissues resulted in approximately 57% of proteins observed in the CRC-PDX tumors also being present in the 3D-eCRC-PDX tissues on day 22. Furthermore, we show congruence in enriched gene ontology molecular functions and Hallmark gene sets in 3D-eCRC-PDX tissues and CRC-PDX tumors compared to normal colon tissue, while prognostic Kaplan-Meier plots for overall and relapse free survival did not reveal significant differences between CRC-PDX tumors and 3D-eCRC-PDX tissues. Our results demonstrate high batch-to-batch consistency and strong correlation between our<i>in vitro</i>tissue-engineered PDX-CRC model and the originating<i>in vivo</i>PDX tumors, providing a foundation for future studies of disease progression and tumorigenic mechanisms.

Also flagged:TNC-CLysil oxidase like enzyme-2TNChepatitis B surface antigenLiver DiseaseWilson disease
Journal Article 2022-07-05 ✓ 1 Snippet Altinbas A, Holmes JA, Salloum S, Lidofsky A, Alatrakchi N, Somsouk M, Hunt P, Deeks S, Chew KW, Lauer G, Kruger A, Lin W, Chung RT.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<b>Background:</b> Lysil oxidase like enzyme-2 (LOXL-2) and TNC-C play important roles in organ fibrosis. We assessed circulating LOXL-2 and TNC-C levels and their relationship to fibrosis severity in HIV- and/or HCV-infected individuals. <b>Methods:</b> Healthy controls (n = 22), HIV mono- (n = 15), HCV mono- (n = 52) and HCV/HIV-co-infected (n = 92) subjects were included. <b>Results:</b> LOXL-2 and TNC-C levels were significantly higher in HCV mono- and HCV/HIV-co-infected individuals with F0 compared to healthy controls. In addition, in HCV/HIV-co-infected individuals, LOXL-2 levels were higher in intermediate fibrosis compared to no/mild fibrosis. <b>Conclusion:</b> In HCV/HIV-co-infected study participants, both LOXL-2 and TNC-C were significantly higher in intermediate fibrosis compared to no/mild fibrosis, but did not further increase with advanced fibrosis. Furthermore, both markers were elevated among HCV/HIV-positive individuals with mild/no fibrosis.

Also flagged:Hepatocellular CarcinomaHereditary hemochromatosisHHdeathnon-alcoholic fatty liver diseasediabetes
Journal Article 2022-07-05 ✓ 5 Snippets Natarajan Y, Patel P, Chu J, Yu X, Hernaez R, El-Serag H, Kanwal F.
In-Text Gene Mentions

…Patients with VariousHFEGenotypes.…

…and across variousHFEgenotypes remain unclear.<h4>M…

…with ≥ 1HFEgenotype test in…

…535 had otherHFEmutations; 3767 without…

…TheseHFEgenotypes, older age,…

Show Full Abstract

<h4>Background and aims</h4>Hereditary hemochromatosis (HH) is associated with increased risk of hepatocellular carcinoma (HCC). However, HCC risk factors within this population and across various HFE genotypes remain unclear.<h4>Methods</h4>We conducted a retrospective cohort study of patients with ≥ 1 HFE genotype test in the Veterans Health Administration. We followed patients until HCC, death, or 6/30/19. We calculated incidence rates (IRs) and used Cox proportional hazards models to estimate HCC risk. In patients with type-1 HH genotypes (C282Y/C282Y or C282Y/H63D), we examined risk factors for HCC.<h4>Results</h4>We identified 5225 patients: 260 were C282Y/C282Y; 227 were C282Y/H63D; 436 were H63D heterozygous; 535 had other HFE mutations; 3767 without mutation. IR for C282Y/C282Y homozygotes (5.59/1000 PYs) and C282Y/H63D compound heterozygotes (4.12/1000 PYs) were significantly higher than controls (0.92/1000 PYs) with adjusted hazard ratio (adj HR), 95% CI 8.80, 4.17-18.54; and 5.25, 2.24-12.32, respectively. HCC risk was higher in H63D heterozygote than controls (adj HR = 2.82, 95% CI 1.21-6.58); cases were related to non-alcoholic fatty liver disease. Among patients with HH, age ≥ 65 (adj HR = 2.2, 95% CI 0.47-10.27), diabetes (adj HR 3.74, 95% CI 1.25-11.20) and high baseline aspartate-aminotransferase to platelet ratio-index (APRI, adj HR = 3.91, 95% CI 1.29-11.89) had higher risk. Among patients with high baseline ferritin, persistent ferritin > 250 ng/mL had higher risk.<h4>Conclusion</h4>HCC risk was high in C282Y homozygous and C282Y/H63D patients. These HFE genotypes, older age, diabetes, high APRI/ferritin levels were associated with increased risk. While H63D heterozygous genotype was associated with HCC risk, this association might be due to metabolic factors.

Also flagged:CDH7EFNA5ILF3DTD1CDH18HEATR3
Journal Article 2022-07-05 ✓ 5 Snippets Lai D, Schwantes-An TH, Abreu M, Chan G, Hesselbrock V, Kamarajan C, Liu Y, Meyers JL, Nurnberger JI, Plawecki MH, Wetherill L, Schuckit M, Zhang P, Edenberg HJ, Porjesz B, Agrawal A, Foroud T.
In-Text Gene Mentions

VRK2

ZBTB37

DCC

ZNF644

UNC13C

Show Full Abstract

Genome-wide association studies (GWAS) in admixed populations such as African Americans (AA) have limited sample sizes, resulting in poor performance of polygenic risk scores (PRS). Based on the observations that many disease-causing genes are shared between AA and European ancestry (EA) populations, and some disease-causing variants are located within the boundaries of these genes, we proposed a novel gene-based PRS framework (PRS<sub>gene</sub>) by using variants located within disease-associated genes. Using the AA GWAS of alcohol use disorder (AUD) from the Million Veteran Program and the EA GWAS of problematic alcohol use as the discovery GWAS, we identified 858 variants from 410 genes that were AUD-related in both AA and EA. PRS<sub>gene</sub> calculated using these variants were significantly associated with AUD in three AA target datasets (P-values ranged from 7.61E-05 to 6.27E-03; Betas ranged from 0.15 to 0.21) and outperformed PRS calculated using all variants (P-values ranged from 7.28E-03 to 0.16; Betas ranged from 0.06 to 0.18). PRS<sub>gene</sub> were also associated with AUD in an EA target dataset (P-value = 0.02, Beta = 0.11). In AA, individuals in the highest PRS<sub>gene</sub> decile had an odds ratio of 1.76 (95% CI: 1.32-2.34) to develop AUD compared to those in the lowest decile. The 410 genes were enriched in 54 Gene Ontology biological processes, including ethanol oxidation and processes involving the synaptic system, which are known to be AUD-related. In addition, 26 genes were targets of drugs used to treat AUD or other diseases that might be considered for repurposing to treat AUD. Our study demonstrated that the gene-based PRS had improved performance in evaluating AUD risk in AA and provided new insight into AUD genetics.

Also flagged:StatcytokinesisSLDphosphateSunVol
Journal Article 2022-07-05 No Snippets Sun J, Wu J, Wu S, Goswami R, Girardo S, Cao L, Guck J, Koukourakis N, Czarske JW.
Show Full Abstract

Quantitative phase imaging (QPI) is a label-free technique providing both morphology and quantitative biophysical information in biomedicine. However, applying such a powerful technique to in vivo pathological diagnosis remains challenging. Multi-core fiber bundles (MCFs) enable ultra-thin probes for in vivo imaging, but current MCF imaging techniques are limited to amplitude imaging modalities. We demonstrate a computational lensless microendoscope that uses an ultra-thin bare MCF to perform quantitative phase imaging with microscale lateral resolution and nanoscale axial sensitivity of the optical path length. The incident complex light field at the measurement side is precisely reconstructed from the far-field speckle pattern at the detection side, enabling digital refocusing in a multi-layer sample without any mechanical movement. The accuracy of the quantitative phase reconstruction is validated by imaging the phase target and hydrogel beads through the MCF. With the proposed imaging modality, three-dimensional imaging of human cancer cells is achieved through the ultra-thin fiber endoscope, promising widespread clinical applications.

Also flagged:calretininperipherincaspase3fitRUNX1calbindin
Journal Article 2022-07-05 ✓ 1 Snippet Petitpré C, Faure L, Uhl P, Fontanet P, Filova I, Pavlinkova G, Adameyko I, Hadjab S, Lallemend F.
In-Text Gene Mentions

Dcc

Show Full Abstract

Different types of spiral ganglion neurons (SGNs) are essential for auditory perception by transmitting complex auditory information from hair cells (HCs) to the brain. Here, we use deep, single cell transcriptomics to study the molecular mechanisms that govern their identity and organization in mice. We identify a core set of temporally patterned genes and gene regulatory networks that may contribute to the diversification of SGNs through sequential binary decisions and demonstrate a role for NEUROD1 in driving specification of a I<sub>c</sub>-SGN phenotype. We also find that each trajectory of the decision tree is defined by initial co-expression of alternative subtype molecular controls followed by gradual shifts toward cell fate resolution. Finally, analysis of both developing SGN and HC types reveals cell-cell signaling potentially playing a role in the differentiation of SGNs. Our results indicate that SGN identities are drafted prior to birth and reveal molecular principles that shape their differentiation and will facilitate studies of their development, physiology, and dysfunction.

Also flagged:cell activationmultiple sclerosisneurodegenerative disorderMSpathogenesisaxonal
Journal Article 2022-07-05 No Snippets Cappelletti C, Eriksson A, Brorson IS, Leikfoss IS, Kråbøl O, Høgestøl EA, Vitelli V, Mjaavatten O, Harbo HF, Berven F, Bos SD, Berge T.
Show Full Abstract

<h4>Background</h4>Multiple sclerosis (MS) is an autoimmune, neurodegenerative disorder with a strong genetic component that acts in a complex interaction with environmental factors for disease development. CD4<sup>+</sup> T cells are pivotal players in MS pathogenesis, where peripherally activated T cells migrate to the central nervous system leading to demyelination and axonal degeneration. Through a proteomic approach, we aim at identifying dysregulated pathways in activated T cells from MS patients as compared to healthy controls.<h4>Methods</h4>CD4<sup>+</sup> T cells were purified from peripheral blood from MS patients and healthy controls by magnetic separation. Cells were left unstimulated or stimulated in vitro through the TCR and costimulatory CD28 receptor for 24 h prior to sampling. Electrospray liquid chromatography-tandem mass spectrometry was used to measure protein abundances.<h4>Results</h4>Upon T cell activation the abundance of 1801 proteins was changed. Among these proteins, we observed an enrichment of proteins expressed by MS-susceptibility genes. When comparing protein abundances in T cell samples from healthy controls and MS patients, 18 and 33 proteins were differentially expressed in unstimulated and stimulated CD4<sup>+</sup> T cells, respectively. Moreover, 353 and 304 proteins were identified as proteins exclusively induced upon T cell activation in healthy controls and MS patients, respectively and dysregulation of the Nur77 pathway was observed only in samples from MS patients.<h4>Conclusions</h4>Our study highlights the importance of CD4<sup>+</sup> T cell activation for MS, as proteins that change in abundance upon T cell activation are enriched for proteins encoded by MS susceptibility genes. The results provide evidence for proteomic disturbances in T cell activation in MS, and pinpoint to dysregulation of the Nur77 pathway, a biological pathway known to limit aberrant effector T cell responses.

Also flagged:OsteoarthritisOAdegenerative diseaseageingcartilage degenerationatherosclerosis
Journal Article 2022-07-05 ✓ 1 Snippet Liao H, Tu Q, Kang Y, Mao G, Li Z, Hu S, Sheng P, Wang X, Xu Y, Long D, Xu Y, Kang Y, Zhang Z.
In-Text Gene Mentions

…chondrogenesis via targetingSOX6/SOX5.…

Show Full Abstract

<h4>Objectives</h4>Osteoarthritis (OA) is a degenerative disease causing the progressive destruction of articular cartilage; however, the aetiology has not yet been elucidated. Circular RNAs (circRNAs) are reportedly involved in cartilage degeneration and OA development. In the present study, we identified that circNFIX regulates chondrogenesis and cartilage homeostasis.<h4>Materials and methods</h4>Microarray analysis was performed to explore circRNA expression during the chondrogenic differentiation of human adipose-drived stem cells (hADSCs). CircNFIX expression was determined using quantitative reverse transcription-polymerase chain reaction and in situ hybridization. Gain- and loss-of-function assays were performed to validate the role of circNFIX in cartilage homeostasis. RNA pull-down, Argonaute2-RNA immunoprecipitation and luciferase reporter assays were performed to evaluate the interactions among circNFIX, miR758-3p and KDM6A.<h4>Results</h4>CircNFIX expression was upregulated in the early and middle stages, whereas downregulated in the late stage of hADSC chondrogenesis. CircNFIX inhibition attenuated hADSC chondrogenesis. CircNFIX was remarkably downregulated in OA samples, circNFIX overexpression protected against chondrocyte degradation and alleviated OA progression in the destabilization of the medial meniscus OA model. Mechanistically, circNFIX acted as a sponge of miR758-3p and played a role in the chondrogenesis and chondrocyte degeneration by targeting the miR-758-3p/KDM6A axis.<h4>Conclusions</h4>Our results revealed a key role of circNFIX in chondrogenesis and cartilage homeostasis, which may provide a potential therapeutic strategy for OA treatment.

Also flagged:cancerOxidative phosphorylationAntigen processing and presentationagingHedgehog signaling pathwayAdherens junction
Journal Article 2022-07-05 ✓ 1 Snippet Dong M, Cui X, Wang G, Zhang Q, Li X.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Breast cancer (BC) is an inflammatory tumor caused by a variety of pathological factors, and is still the most common malignant tumor in women. Immune-related genes (IRGs) play a prominent role in the oncogenesis and progression of BC, and are of tumor-specific expression patterns that would benefit the prognosis evaluation. However, there were no systematic studies concerning the possibilities of IRGs in BC prognosis. In this study, the Cancer Genome Atlas (TCGA) database was used to integrate the expression profiles of IRG with the overall survival (OS) rate of 1039 breast cancer patients. The Cox regression analysis was used to predict the survival-related IRGs in BC. Then, we successfully screened a total of 6 IRGs, including PSME2, ULBP2, IGHE, SCG2, SDC1, and SSTR1, and accordingly constructed a prognosis prediction model of BC. Based on the IRG-related model, the BC patients were divided into high- and low-risk groups, and the association between the prognostic model and tumor immune microenvironment (TME) was further explored. The prognostic model reflected the infiltration of various immune cells. Moreover, the low-risk group was found to be with higher immunophenoscore and distinct mutation signatures compared with the high-risk group. The histological validation showed that SDC1, as well as M2 macrophage biomarker CD206, were both of higher abundance in BC samples of high-risk patients, compared with those of low-risk patients. Our results identify the clinically significant IRGs and demonstrate the importance of the IRG-based immune prognostic model in BC monitoring, prognosis prediction, and therapy.

Also flagged:GPX2GSHPx-GIglutathione peroxidaseGPXGPX1localization
Journal Article 2022-07-05 No Snippets Esworthy RS, Doroshow JH, Chu FF.
Show Full Abstract

We published the first paper to characterize GPX2 (aka GSHPx-GI) as a selenoenzyme with glutathione peroxidase activity in 1993. Among the four Se-GPX isozymes, GPX1-4, GPX1 and GPX2 are closely related in terms of structure, substrate specificities, and subcellular localization. What sets them apart are distinct patterns of gene regulation, tissue distribution and response to selenium. While we identified the digestive tract epithelium as the main site of GPX2 expression, later work has shown GPX2 is found more widely in epithelial tissues with concentration of expression in stem cell and proliferative compartments. GPX2 expression is regulated over a wide range of levels by many pathways, including NRF2, WNT, p53, RARE and this often results in attaching undue significance to GPX2 as GPX2 is only a part of a system of hydroperoxidase activities, including GPX1, peroxiredoxins and catalase. These other activities may play equal or greater roles, particularly in cell lines cultured without selenium supplementation and often with very low GPX2 levels. This could be assessed by examining levels of mRNA and protein among these various peroxidases at the outset of studies. As an example, it was found that GPX1 responds to the absence of GPX2 in mouse ileum and colon epithelium with higher expression. As such, both Gpx1 and Gpx2 had to be knocked out in mice to produce ileocolitis. However, we note that the actual role of GPX1 and GPX2 in relation to peroxiredoxin function is unclear. There may be an interdependence that requires only low amounts of GPX1 and/or GPX2 in a supporting role to maintain proper peroxiredoxin function. GPX2 levels may be prognostic for cancer progression in colon, breast, prostate and liver, however, there is no consistent trend for higher or lower levels to be favorable.

Also flagged:genetic disordersgenetic white matter disorderswhite matter disordersmonogenicdevelopmental disordersdevelopmental and epileptic encephalopathies
Journal Article 2022-07-05 ✓ 2 Snippets Stutterd CA, Vanderver A, Lockhart PJ, Helman G, Pope K, Uebergang E, Love C, Delatycki MB, Thorburn D, Mackay MT, Peters H, Kornberg AJ, Patel C, Rodriguez-Casero V, Waak M, Silberstein J, Sinclair A, Nolan M, Field M, Davis MR, Fahey M, Scheffer IE, Freeman JL, Wolf NI, Taft RJ, van der Knaap MS, Simons C, Leventer RJ.
In-Text Gene Mentions

…SLC17A5, TUBB4A, BOLA3,DARS2).…

DARS2

Show Full Abstract

<h4>Background</h4>Next generation sequencing studies have revealed an ever-increasing number of causes for genetic disorders of central nervous system white matter. A substantial number of disorders are identifiable from their specific pattern of biochemical and/or imaging findings for which single gene testing may be indicated. Beyond this group, the causes of genetic white matter disorders are unclear and a broader approach to genomic testing is recommended.<h4>Aim</h4>This study aimed to identify the genetic causes for a group of individuals with unclassified white matter disorders with suspected genetic aetiology and highlight the investigations required when the initial testing is non-diagnostic.<h4>Methods</h4>Twenty-six individuals from 22 families with unclassified white matter disorders underwent deep phenotyping and genome sequencing performed on trio, or larger, family groups. Functional studies and transcriptomics were used to resolve variants of uncertain significance with potential clinical relevance.<h4>Results</h4>Causative or candidate variants were identified in 15/22 (68.2%) families. Six of the 15 implicated genes had been previously associated with white matter disease (COL4A1, NDUFV1, SLC17A5, TUBB4A, BOLA3, DARS2). Patients with variants in the latter two presented with an atypical phenotype. The other nine genes had not been specifically associated with white matter disease at the time of diagnosis and included genes associated with monogenic syndromes, developmental disorders, and developmental and epileptic encephalopathies (STAG2, LSS, FIG4, GLS, PMPCA, SPTBN1, AGO2, SCN2A, SCN8A). Consequently, only 46% of the diagnoses would have been made via a current leukodystrophy gene panel test.<h4>Discussion</h4>These results confirm the importance of broad genomic testing for patients with white matter disorders. The high diagnostic yield reflects the integration of deep phenotyping, whole genome sequencing, trio analysis, functional studies, and transcriptomic analyses.<h4>Conclusions</h4>Genetic white matter disorders are genetically and phenotypically heterogeneous. Deep phenotyping together with a range of genomic technologies underpin the identification of causes of unclassified white matter disease. A molecular diagnosis is essential for prognostication, appropriate management, and accurate reproductive counseling.

Also flagged:Triple-Negative Breast CancerRNA-Binding ProteinsRBPcancerAGO1EIF4A3
Journal Article 2022-07-05 No Snippets Magalhães L, Ribeiro-Dos-Santos AM, Cruz RL, Nakamura KDM, Brianese R, Burbano R, Ferreira SP, Oliveira ELF, Anaissi AKM, Nahúm MCS, Demachki S, Vidal AF, Carraro DM, Ribeiro-Dos-Santos Â.
Show Full Abstract

Circular RNAs (circRNAs) are a class of long non-coding RNAs that have the ability to sponge RNA-Binding Proteins (RBPs). Triple-negative breast cancer (TNBC) has very aggressive behavior and poor prognosis for the patient. Here, we aimed to characterize the global expression profile of circRNAs in TNBC, in order to identify potential risk biomarkers. For that, we obtained RNA-Seq data from TNBC and control samples and performed validation experiments using FFPE and frozen tissues of TNBC patients and controls, followed by in silico analyses to explore circRNA-RBP interactions. We found 16 differentially expressed circRNAs between TNBC patients and controls. Next, we mapped the RBPs that interact with the top five downregulated circRNAs (hsa_circ_0072309, circ_0004365, circ_0006677, circ_0008599, and circ_0009043) and hsa_circ_0000479, resulting in a total of 16 RBPs, most of them being enriched to pathways related to cancer and gene regulation (e.g., AGO1/2, EIF4A3, ELAVL1, and PTBP1). Among the six circRNAs, hsa_circ_0072309 was the one that presented the most confidence results, being able to distinguish TNBC patients from controls with an AUC of 0.78 and 0.81, respectively. This circRNA may be interacting with some RBPs involved in important cancer-related pathways and is a novel potential risk biomarker of TNBC.

Also flagged:cardiovascular diseaseCVDpolyphenolsfatty acidslipoproteinsceramides
Journal Article 2022-07-05 ✓ 3 Snippets Barbacini P, Blottner D, Capitanio D, Trautmann G, Block K, Torretta E, Moriggi M, Salanova M, Gelfi C.
In-Text Gene Mentions

…glycoprotein 2 (ORM2),antithrombin-III(SERPINC1), heparin cofactor…

…2 (ORM2), antithrombin-III (SERPINC1), heparin cofactor 2…

…C4A, C3, SERPING1,SERPINC1, GC, HP, LRG1,…

Show Full Abstract

Physical inactivity or prolonged bed rest (BR) induces muscle deconditioning in old and young subjects and can increase the cardiovascular disease risk (CVD) with dysregulation of the lipemic profile. Nutritional interventions, combining molecules such as polyphenols, vitamins and essential fatty acids, can influence some metabolic features associated with physical inactivity and decrease the reactive oxidative and nitrosative stress (RONS). The aim of this study was to detect circulating molecules correlated with BR in serum of healthy male subjects enrolled in a 60-day BR protocol to evaluate a nutritional intervention with an antioxidant cocktail as a disuse countermeasure (Toulouse COCKTAIL study). The serum proteome, sphingolipidome and nitrosoproteome were analyzed adopting different mass spectrometry-based approaches. Results in placebo-treated BR subjects indicated a marked decrease of proteins associated with high-density lipoproteins (HDL) involved in lipemic homeostasis not found in the cocktail-treated BR group. Moreover, long-chain ceramides decreased while sphingomyelin increased in the BR cocktail-treated group. In placebo, the ratio of <i>S</i>-nitrosylated/total protein increased for apolipoprotein D and several proteins were over-nitrosylated. In cocktail-treated BR subjects, the majority of protein showed a pattern of under-nitrosylation, except for ceruloplasmin and hemopexin, which were over-nitrosylated. Collectively, data indicate a positive effect of the cocktail in preserving lipemic and RONS homeostasis in extended disuse conditions.

Also flagged:Immune Thrombocytopenic PurpuraITPCOVID-19COVID-19 infectionthrombocytopeniaimmunological disorders
Journal Article 2022-07-05 ✓ 3 Snippets Santhosh S, Malik B, Kalantary A, Kunadi A.
In-Text Gene Mentions

…medical history ofhemochromatosis, type 2 diabetes…

…history significant forhemochromatosis, type 2 diabetes…

…was significant forhemochromatosisand diabetes mellitus…

Show Full Abstract

Immune thrombocytopenic purpura (ITP) has been linked to the COVID-19 vaccine series as a rare adverse event but has recently emerged in the literature as a sequela of natural COVID-19 infection. ITP is a diagnosis of exclusion where a diagnosis is made by having isolated thrombocytopenia (platelet count <100,000/μL) and no other identifiable etiology for the thrombocytopenia. We share the case of a young male without any history of hematological or immunological disorders presenting with severe, symptomatic thrombocytopenia following a natural COVID-19 infection. Patients should be made aware of the potential risk of adverse events with not only vaccination but also even mild cases of natural infection with COVID-19. An emphasis should be placed on the fact that the benefits of vaccination continue to outweigh the potential risks of adverse events, even in those with a pre-existing diagnosis of ITP.

Also flagged:Peptideliver tumortumorhydrazonepentapeptideendocytosis
Journal Article 2022-07-05 No Snippets Liang J, Guo R, Xuan M, Sun Q, Wu W.
Show Full Abstract

<h4>Purpose</h4>This study aimed to construct a DOX conjugate with liver tumor targeting and acid sensitivity based on a short aromatic peptide FFYEE, which could amplify the tumor inhibition efficacy of DOX and alleviate tissue toxicity.<h4>Methods</h4>A novel DOX-peptide conjugate, D-gal-FFYEE-hyd-DOX, was constructed by linking DOX to the side chain of FFYEE with acid-sensitive hydrazone bond and by modifying the C-terminal of peptide with α-D-galactosamine (D-gal) as targeting ligand. The structure of D-gal-FFYEE-hyd-DOX was characterized by mass spectrometry, infrared spectroscopy (IR), and UV-Vis spectroscopy (UV-Vis). The assembly characteristics of pentapeptide FFYEE and D-gal-FFYEE-hyd-DOX were observed by transmission electron microscope (TEM). In vitro drug release, cytotoxicity, endocytosis, in vivo antitumor experiment and histopathology analysis were investigated.<h4>Results</h4>Peptide FFYEE endowed the D-gal-FFYEE-hyd-DOX with self-assembly performance and improved biocompatibility. D-gal-FFYEE-hyd-DOX can self-assemble into nanofibers with a diameter of ~ 40 nm in neutral aqueous solution and significantly reduced the cytotoxicity of free DOX to L02 cells. In vitro drug release results showed that D-gal-FFYEE-hyd-DOX had acid sensitivity and controlled release characteristics. The cytotoxicity and endocytosis investigations confirmed that D-gal-FFYEE-hyd-DOX enhanced the cellular uptake of DOX and inhibition effect on HepG2 cells. In vivo antitumor experiment indicated that D-gal-FFYEE-hyd-DOX could significantly inhibit the growth of liver tumor in mice and reduce the side effects of DOX.<h4>Conclusion</h4>The conjugate D-gal-FFYEE-hyd-DOX with liver tumor targeting and acid sensitivity has the characteristics of strong tumor inhibition and low toxicity, hinting the great clinical application potential for targeted delivery of DOX in cancer treatment.

Also flagged:leukoencephalopathymitochondrial enzymeaspartyl-tRNA synthetaseMT-ASPRSLactateLBSL
Journal Article 2022-07-05 ✓ 5 Snippets Wongkittichote P, Magistrati M, Shimony JS, Smyser CD, Fatemi SA, Fine AS, Bellacchio E, Dallabona C, Shinawi M.
In-Text Gene Mentions

Biallelic pathogenic variants in the nuclear gene DARS2 (MIM# 610956), encoding the mitochondrial enzyme aspartyl-tRNA synthetase (MT-ASPRS) cause leukoencephalopathy with Brain Stem and Spinal Cord Involvement and Lactate Elevation (LBSL) (MIM# 611105), a neurometabolic disorder characterized by progressive ataxia, spasticity, developmental arrest or regression and characteristic brain MRI findings.

Functional analysis of missense DARS2 variants in siblings with leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation.

…analysis of missenseDARS2variants in siblings…

…the nuclear geneDARS2(MIM# 610956), encoding…

…determine pathogenicity ofDARS2variants, expand the…

Show Full Abstract

Biallelic pathogenic variants in the nuclear gene DARS2 (MIM# 610956), encoding the mitochondrial enzyme aspartyl-tRNA synthetase (MT-ASPRS) cause leukoencephalopathy with Brain Stem and Spinal Cord Involvement and Lactate Elevation (LBSL) (MIM# 611105), a neurometabolic disorder characterized by progressive ataxia, spasticity, developmental arrest or regression and characteristic brain MRI findings. Most patients exhibit a slowly progressive disease course with motor deterirartion that begins in childhood or adolescence, but can also occasionaly occur in adulthood. More severe LBSL presentations with atypical brain MRI findings have been recently described. Baker's yeast orthologue of DARS2, MSD1, is required for growth on oxidative carbon sources. A yeast with MSD1 knockout (msd1Δ) demonstrated a complete lack of oxidative growth which could be rescued by wild-type MSD1 but not MSD1 with pathogenic variants. Here we reported two siblings who exhibited developmental regression and ataxia with different age of onset and phenotypic severity. Exome sequencing revealed 2 compound heterozygous missense variants in DARS2: c.473A>T (p.Glu158Val) and c.829G>A (p.Glu277Lys); this variant combination has not been previously reported. The msd1Δ yeast transformed with plasmids expressing p.Glu259Lys, equivalent to human p.Glu277Lys, showed complete loss of oxidative growth and oxygen consumption, while the strain carrying p.Gln137Val, equivalent to human p.Glu158Val, showed a significant reduction of oxidative growth, but a residual ability to grow was retained. Structural analysis indicated that p.Glu158Val may interfere with protein binding of tRNA<sup>Asp</sup>, while p.Glu277Lys may impact both homodimerization and catalysis of MT-ASPRS. Our data illustrate the utility of yeast model and in silico analysis to determine pathogenicity of DARS2 variants, expand the genotypic spectrum and suggest intrafamilial variability in LBSL.

Also flagged:Colon CancerribonucleoproteincadherinbindingT-cell leukemia virus 1 infectionGNAI1
Journal Article 2022-07-05 ✓ 3 Snippets Dong W, Wu D, Xu S, Sun Q, Ci X.
In-Text Gene Mentions

…RANBP 1, SRPX2,STAU1, PGRMC2, CADM1, and…

STAU1influences colon cancer…

…NUPL2, RANBP1, SRPX2,STAU1, PGRMC2, CADM1, and…

Show Full Abstract

<h4>Background</h4>The competing endogenous RNA (CeRNA) network plays important roles in the occurrence and development of colon cancer. This research is aimed at constructing a miRNA-mRNA network associated with exosomes in colon cancer.<h4>Methods</h4>We explored the GEO database and then analyzed the RNAs of 722 samples to obtain differentially expressed miRNAs (DEMs) and mRNAs (DEGs) alongside the progress of colon cancer. Next, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of DEM target genes and DEGs were performed. In addition, a miRNA-mRNA network related to exosomes in colon cancer was constructed based on DEMs and DEGs. Finally, the expression of miRNA and mRNA in the network was verified by GEPIA2 on the base of TCGA database.<h4>Results</h4>Through our analysis, 19 DEMs (17 up and 2 down) and 1672 DEGs (954 up and 718 down) were screened. The GO and KEGG results show that these DEGs were mainly enriched in ribonucleoprotein complex biogenesis, noncoding RNA metabolic process, cell-substrate junction, cadherin binding, transcription coregulator activity, and regulation of the human T-cell leukemia virus 1 infection-related pathway. Besides, a miRNA-mRNA network, including 4 miRNAs (hsa-miR-623, hsa-miR-320c, hsa-miR-486-5p, and hsa-miR-1290) and 7 mRNAs (GNAI1, CADM1, PGRMC2, etc.), was constructed. Three of these seven mRNAs were downregulated in colon cancer. Ultimately, the GNAI1, CADM1, and PGRMC2 expression levels were verified by TCGA database.<h4>Conclusions</h4>This study reveals the network relationship between colon cancer exosome-derived miRNA and targeted mRNA. It deepens our understanding of new molecular mechanisms and pathways that may play a role in the occurrence and metastasis of colon cancer.

Also flagged:Ribonucleic AcidAcute Respiratory Distress SyndromeARDSPh2matrix metalloproteinase 8olfactomedin 4
Journal Article 2022-07-05 ✓ 5 Snippets Wildi K, Hyslop K, Millar J, Livingstone S, Passmore MR, Bouquet M, Wilson E, LiBassi G, Fraser JF, Suen JY.
In-Text Gene Mentions

Abbreviations: OA, oleic acid; OA-IV-LPS, oleic acid and lipopolysaccharide intravenously; MMP8, matrix metalloproteinase 8; OLFM4, olfactomedin; RETN, resistin; GPR84G, protein-coupled receptor 84; CEACAM1, CEA cell adhesion molecule 1; LCN2, lipocalin 2; ANKRD22, ankyrin repeat domain 22; CD177, CD177 molecule; TCN1, transcobalamin 1; MME, membrane metalloendopeptidase; ADGRE3, adhesion G protein-coupled receptor E3; TGFBI, transforming growth factor beta induced; HAL, histidine ammonia-lyase; and SULF2, sulfatase 2.

Abbreviations: OA, oleic acid; OA-IV-LPS, oleic acid and lipopolysaccharide intravenously; MMP8, matrix metalloproteinase 8; OLFM4, olfactomedin; RETN, resistin; GPR84G, protein-coupled receptor 84; CEACAM1, CEA cell adhesion molecule 1; LCN2, lipocalin 2; ZDHHC18, zinc finger dhhc-type palmitoyltransferase 18; ANKRD22, ankyrin repeat domain 22; CD177, CD177 molecule; TCN1, transcobalamin 1; MME, membrane metalloendopeptidase; RBP7, retinol binding protein 7; ADGRE3, adhesion G protein-coupled receptor E3; TGFBI, transforming growth factor beta induced; HAL, histidine ammonia-lyase; and SULF2, sulfatasse 2.

…(MMP8), olfactomedin 4 (OLFM4), resistin (RETN), G…

…( p 0.14),OLFM4( p 0.15),…

…Furthermore,OLFM4and CD177 expression…

Show Full Abstract

<h4>Background</h4>The discovery of biological subphenotypes in acute respiratory distress syndrome (ARDS) might offer a new approach to ARDS in general and possibly targeted treatment, but little is known about the underlying biology yet. To validate our recently described ovine ARDS phenotypes model, we compared a subset of messenger ribonucleic acid (mRNA) markers in leukocytes as reported before to display differential expression between human ARDS subphenotypes to the expression in lung tissue in our ovine ARDS phenotypes model (phenotype 1 (Ph1): hypoinflammatory; phenotype 2 (Ph2): hyperinflammatory).<h4>Methods</h4>We studied 23 anesthetized sheep on mechanical ventilation with observation times between 6 and 24 h. They were randomly allocated to the two phenotypes (<i>n</i> = 14 to Ph1 and <i>n</i> = 9 to Ph2). At study end, lung tissue was harvested and preserved in RNAlater. After tissue homogenization in TRIzol, total RNA was extracted and custom capture and reporter probes designed by NanoString Technologies were used to measure the expression of 14 genes of interest and the 6 housekeeping genes on a nCounter SPRINT profiler.<h4>Results</h4>Among the 14 mRNA markers, in all animals over all time points, 13 markers showed the same trend in ovine Ph2/Ph1 as previously reported in the MARS cohort: matrix metalloproteinase 8, olfactomedin 4, resistin, G protein-coupled receptor 84, lipocalin 2, ankyrin repeat domain 22, CD177 molecule, and transcobalamin 1 expression was higher in Ph2 and membrane metalloendopeptidase, adhesion G protein-coupled receptor E3, transforming growth factor beta induced, histidine ammonia-lyase, and sulfatase 2 expression was higher in Ph1. These expression patterns could be found when different sources of mRNA - such as blood leukocytes and lung tissue - were compared.<h4>Conclusion</h4>In human and ovine ARDS subgroups, similar activated pathways might be involved (e.g., oxidative phosphorylation, NF-κB pathway) that result in specific phenotypes.

Also flagged:N7-MethylguanosineAcute myeloid leukemiaAMLhematological tumor-methylation
Journal Article 2022-07-05 No Snippets Zhang B, Li D, Wang R.
Show Full Abstract

Acute myeloid leukemia (AML) is an aggressive hematological tumor caused by the malignant transformation of myeloid progenitor cells. Although intensive chemotherapy leads to an initial therapeutic response, relapse due to drug resistance remains a significant challenge. In recent years, accumulating evidence has suggested that post-transcriptional methylation modifications are strongly associated with tumorigenesis. However, the mRNA profile of m7G modification in AML and its role in drug-resistant AML are unknown. In this study, we used MeRIP-seq technology to establish the first transcriptome-wide m7G methylome profile for AML and drug-resistant AML cells, and differences in m7G between the two groups were analyzed. In addition, bioinformatics analysis was conducted to explore the function of m7G-specific methylated transcripts. We found significant differences in m7G mRNA modification between AML and drug-resistant AML cells. Furthermore, bioinformatics analysis revealed that differential m7G-modified mRNAs were associated with a wide range of cellular functions. Importantly, down-methylated m7G modification was significantly enriched in ABC transporter-related mRNAs, which are widely recognized to play a key role in multidrug resistance. Our results provide new insights into a novel function of m7G methylation in drug resistance progression of AML.

Also flagged:Depressionpsychiatric disordersbrain developmentepigenetichistonemodifications
Journal Article 2022-07-05 No Snippets Cheng Z, Su J, Zhang K, Jiang H, Li B.
Show Full Abstract

Depression has an alarmingly high prevalence worldwide. A growing body of evidence indicates that environmental factors significantly affect the neural development and function of the central nervous system and then induce psychiatric disorders. Early life stress (ELS) affects brain development and has been identified as a major cause of depression. It could promote susceptibility to stress in adulthood. Recent studies have found that ELS induces epigenetic changes that subsequently affect transcriptional rates of differentially expressed genes. The epigenetic modifications involved in ELS include histone modifications, DNA methylation, and non-coding RNA. Understanding of these genetic modifications may identify mechanisms that may lead to new interventions for the treatment of depression. Many reports indicate that different types of ELS induce epigenetic modifications of genes involved in the neurotransmitter systems, such as the dopaminergic system, the serotonergic system, the gamma-aminobutyric acid (GABA)-ergic system, and the glutamatergic system, which further regulate gene expression and ultimately induce depression-like behaviors. In this article, we review the effects of epigenetic modifications on the neurotransmitter systems in depression-like outcomes produced by different types of ELS in recent years, aiming to provide new therapeutic targets for patients who suffer from depression.

Also flagged:cavernous hemangiomavascular malformationcavernous hemangiomasimmune responsesUCHL1tumours
Journal Article 2022-07-05 ✓ 2 Snippets Ji F, Liu Y, Shi J, Liu C, Fu S, Wang H, Ren B, Mi D, Gao S, Sun D.
In-Text Gene Mentions

All the detected GPCRs in the cavernous hemangioma (ADRA1D, ADRA2B, ADRA2C, AVPR2, CNR1, GALR1, GPR20, LPAR4, OXTR, P2RY2, TACR1, CYSLTR1, TAS1R1, TAS2R43, MAS1, GPR156, P2RY8, GPR52, and GPR85) were expressed at markedly higher levels in EC1 than EC2 (Supplementary Figure S17).

…, P2RY8 ,GPR52, and GPR85…

Show Full Abstract

A cavernous hemangioma, well-known as vascular malformation, is present at birth, grows proportionately with the child, and does not undergo regression. Although a cavernous hemangioma has well-defined histopathological characteristics, its origin remains controversial. In the present study, we characterized the cellular heterogeneity of a cavernous hemangioma using single-cell RNA sequencing (scRNA-seq). The main contribution of the present study is that we discovered a large number of embryonic mesenchymal stem cells (MSCs) in a cavernous hemangioma and proposed that cavernous hemangiomas may originate from embryonic MSCs. Further analysis of the embryonic MSCs revealed that: 1) proinflammatory cytokines and related genes <i>TNF</i>, <i>TNFSF13B</i>, <i>TNFRSF12A</i>, <i>TNFAIP6</i>, and <i>C1QTNF6</i> are significantly involved in the MSC-induced immune responses in cavernous hemangiomas; 2) <i>UCHL1</i> is up-regulated in the embryonic MSC apoptosis induced by proinflammatory cytokines; 3) the UCHL1-induced apoptosis of MSCs may play an important role in the MSC-induced immune responses in cavernous hemangiomas; and 4) <i>UCHL1</i> can be used as a marker gene to detect embryonic MSCs at different apoptosis stages. In addition to MSCs, ECs, macrophages, T lymphocytes and NKCs were intensively investigated, revealing the genes and pathways featured in cavernous hemangiomas. The present study revealed the origin of cavernous hemangiomas and reported the marker genes, cell types and molecular mechanisms, which are associated with the origin, formation, progression, diagnosis and therapy of cavernous hemangiomas. The better understanding of the MSC-induced immune responses in benign tumours helps to guide future investigation and treatment of embryonic MSC-caused tumours. Our findings initiated future research for the rediscovery of MSCs, cancers/tumours and the UCHL1-induced apoptosis.

Also flagged:parasitic diseaseinfectionimmune responsesSchistosomiasisimmune responsetropical diseases
Journal Article 2022-07-05 ✓ 1 Snippet Winkelmann F, Rabes A, Reinholdt C, Koslowski N, Koczan D, Reisinger EC, Sombetzki M.
In-Text Gene Mentions

…erythrocyte development (e.g.,sox6, klf1 ,…

Show Full Abstract

<h4>Background</h4>Schistosomiasis is a severe parasitic disease that is primarily driven by the host's immune response to schistosome eggs trapped in tissue and by the granulomatous inflammatory and fibrotic reaction they cause. Despite significant progress in understanding the complex immunological processes involved in the relationship between schistosomes and their host, neither an effective vaccine against the infection nor anti-fibrotic drugs currently exists, making the search for new targets for schistosome drugs and vaccine candidates even more important. In order to identify new molecular targets for defense against or elimination of the parasite, we investigate herein the interplay between the host and male or female schistosomes, clearly separating this from the action of the parasite eggs.<h4>Methods</h4>For this purpose, we infected 6-8-week-old female NMRI mice with 100 male (M), female (F), or both (MF) <i>S. mansoni</i> cercariae and performed a comparative transcriptomic and flow cytometric analysis of their spleens.<h4>Results</h4>Principal component analysis of a total of 22,207 transcripts showed a clear clustering of the experimental groups. We identified a total of 1,293 genes in group M, 512 genes in group F, and 4,062 genes in group MF that were differentially expressed compared to naive controls. The highest percentage of regulated genes (2,972; 65.9%) was found in group MF alone, but there was a large overlap between groups M and MF (798; 17.7%) and a small overlap between groups F and MF (91; 2.0%). Only 4.5% of genes (201) were revealed to be regulated in all experimental groups (M/F/MF). In addition, we were able to show that both worm sexes trigger immune responses in an egg-independent manner (non-polarized Th1 and Th2 response), with female worms exerting less regulatory influence than males.<h4>Conclusion</h4>Our data show that adult schistosomes trigger sex-specific, egg-independent immune responses. The lists of genes regulated by adult female or male worms presented here may be useful in deciphering host-parasite interactions to identify targets for schistosome elimination.

Also flagged:AntibodyTNFRSFCancerimmune responsesTumor necrosis factor receptorCD40
Journal Article 2022-07-05 No Snippets Liu L, Wu Y, Ye K, Cai M, Zhuang G, Wang J.
Show Full Abstract

Co-stimulation signaling in various types of immune cells modulates immune responses in physiology and disease. Tumor necrosis factor receptor superfamily (TNFRSF) members such as CD40, OX40 and CD137/4-1BB are expressed on myeloid cells and/or lymphocytes, and they regulate antigen presentation and adaptive immune activities. TNFRSF agonistic antibodies have been evaluated extensively in preclinical models, and the robust antitumor immune responses and efficacy have encouraged continued clinical investigations for the last two decades. However, balancing the toxicities and efficacy of TNFRSF agonistic antibodies remains a major challenge in the clinical development. Insights into the co-stimulation signaling biology, antibody structural roles and their functionality in immuno-oncology are guiding new advancement of this field. Leveraging the interactions between antibodies and the inhibitory Fc receptor FcγRIIB to optimize co-stimulation agonistic activities dependent on FcγRIIB cross-linking selectively in tumor microenvironment represents the current frontier, which also includes cross-linking through tumor antigen binding with bispecific antibodies. In this review, we will summarize the immunological roles of TNFRSF members and current clinical studies of TNFRSF agonistic antibodies. We will also cover the contribution of different IgG structure domains to these agonistic activities, with a focus on the role of FcγRIIB in TNFRSF cross-linking and clustering bridged by agonistic antibodies. We will review and discuss several Fc-engineering approaches to optimize Fc binding ability to FcγRIIB in the context of proper Fab and the epitope, including a cross-linking antibody (xLinkAb) model and its application in developing TNFRSF agonistic antibodies with improved efficacy and safety for cancer immunotherapy.

Also flagged:kinaseamino acidhydrogenbindingnucleotidemetabolism
Journal Article 2022-07-05 ✓ 2 Snippets Panda G, Mishra N, Sharma D, Kutum R, Bhoyar RC, Jain A, Imran M, Senthilvel V, Divakar MK, Mishra A, Garg P, Banerjee P, Sivasubbu S, Scaria V, Ray A.
In-Text Gene Mentions

…EPHA7, RET, andTAOK3had a structure…

…PI4K2B, PIK3CG, GRK4,TAOK3, and IRKA1) from…

Show Full Abstract

India confines more than 17% of the world's population and has a diverse genetic makeup with several clinically relevant rare mutations belonging to many sub-group which are undervalued in global sequencing datasets like the 1000 Genome data (1KG) containing limited samples for Indian ethnicity. Such databases are critical for the pharmaceutical and drug development industry where diversity plays a crucial role in identifying genetic disposition towards adverse drug reactions. A qualitative and comparative sequence and structural study utilizing variant information present in the recently published, largest curated Indian genome database (IndiGen) and the 1000 Genome data was performed for variants belonging to the kinase coding genes, the second most targeted group of drug targets. The sequence-level analysis identified similarities and differences among different populations based on the nsSNVs and amino acid exchange frequencies whereas a comparative structural analysis of IndiGen variants was performed with pathogenic variants reported in UniProtKB Humsavar data. The influence of these variations on structural features of the protein, such as structural stability, solvent accessibility, hydrophobicity, and the hydrogen-bond network was investigated. In-silico screening of the known drugs to these Indian variation-containing proteins reveals critical differences imparted in the strength of binding due to the variations present in the Indian population. In conclusion, this study constitutes a comprehensive investigation into the understanding of common variations present in the second largest population in the world and investigating its implications in the sequence, structural and pharmacogenomic landscape. The preliminary investigation reported in this paper, supporting the screening and detection of ADRs specific to the Indian population could aid in the development of techniques for pre-clinical and post-market screening of drug-related adverse events in the Indian population.

Also flagged:Cardiomyopathy DisorderImmune DisorderMyocarditisinflammatory disease of the heartdilated cardiomyopathycardiomyopathy
Journal Article 2022-07-05 ✓ 1 Snippet Seidel F, Laser KT, Klingel K, Dartsch J, Theisen S, Pickardt T, Holtgrewe M, Gärtner A, Berger F, Beule D, Milting H, Schubert S, Klaassen S, Kühnisch J.
In-Text Gene Mentions

…HADHA , HCN4,HFE, HRAS, HSPB8,…

Show Full Abstract

Myocarditis is an inflammatory disease of the heart. Pediatric myocarditis with the dilated cardiomyopathy (DCM) phenotype may be caused by likely pathogenic or pathogenic genetic variants [(L)P] in cardiomyopathy (CMP) genes. Systematic analysis of immune disorder gene defects has not been performed so far. We analyzed 12 patients with biopsy-proven myocarditis and the DCM phenotype together with their parents using whole-exome sequencing (WES). The WES data were filtered for rare pathogenic variants in CMP (<i>n</i> = 89) and immune disorder genes (<i>n</i> = 631). Twelve children with a median age of 2.9 (1.0-6.8) years had a mean left ventricular ejection fraction of 28% (22-32%) and myocarditis was confirmed by endomyocardial biopsy. Patients with primary immunodeficiency were excluded from the study. Four patients underwent implantation of a ventricular assist device and subsequent heart transplantation. Genetic analysis of the 12 families revealed an (L)P variant in the CMP gene in 8/12 index patients explaining DCM. Screening of recessive immune disorder genes identified a heterozygous (L)P variant in 3/12 index patients. This study supports the genetic impact of CMP genes for pediatric myocarditis with the DCM phenotype. Piloting the idea that additional immune-related genetic defects promote myocarditis suggests that the presence of heterozygous variants in these genes needs further investigation. Altered cilium function might play an additional role in inducing inflammation in the context of CMP.

Also flagged:Iron SucroseCarboxymaltoseIron IsomaltosideAnemiaend-stage kidney diseaseErythropoiesis
Journal Article 2022-07-05 ✓ 3 Snippets Rostoker G, Lepeytre F, Merzoug M, Griuncelli M, Loridon C, Boulahia G, Cohen Y.
In-Text Gene Mentions

…patients with genetichemochromatosisand secondary hemosiderosis…

…biopsy in genetichemochromatosispatients treated by…

…patients with genetichemochromatosisand in those…

Show Full Abstract

Anemia is a major complication of end-stage kidney disease (ESKD). Erythropoiesis-stimulating agents and intravenous (IV) iron are the current backbone of anemia treatment in ESKD. Iron overload induced by IV iron is a potential clinical problem in dialysis patients. We compared the pharmacokinetics of liver accumulation of iron sucrose, currently used worldwide, with two third-generation IV irons (ferric carboxymaltose and iron isomaltoside). We hypothesized that better pharmacokinetics of newer irons could improve the safety of anemia management in ESKD. Liver iron concentration (LIC) was analyzed in 54 dialysis patients by magnetic resonance imaging under different modalities of iron therapy. LIC increased significantly in patients treated with 1.2 g or 2.4 g IV iron sucrose (p < 0.001, Wilcoxon test), whereas no significant increase was observed in patients treated with ferric carboxymaltose or iron isomaltoside (p > 0.05, Wilcoxon-test). Absolute differences in LIC reached 25 μmol/g in the 1.2 g iron sucrose group compared with only 5 μmol/g in the 1 g ferric carboxymaltose and 1 g iron isomaltoside groups (p < 0.0001, Kruskal−Wallis test). These results suggest the beneficial consequences of using ferric carboxymaltose or iron isomaltoside on liver structure in ESKD due to their pharmacokinetic ability to minimize iron overload.

Also flagged:cognitive impairmentmild cognitive impairmentdementiacognitive declinecognitionneurodegenerative dementia
Journal Article 2022-07-05 ✓ 2 Snippets Costa S, St George RJ, McDonald JS, McDonald JS, Wang X, Alty J.
In-Text Gene Mentions

…had significantly lowerACE-IIIscores compared to…

…was added intoACE-IIIto replace the…

Show Full Abstract

Figure drawing tasks are commonly used standalone or as part of broader screening tests to detect cognitive impairment. Only one study has compared the classification accuracy of three common drawing tasks—overlapping infinity loops, wire cube, and the clock drawing task (CDT)—in mild cognitive impairment (MCI) and dementia, but age and education, which impact performance, were not accounted for. We replicated the research, adjusting for age and education and, for the first time, assessed subjective cognitive decline (SCD) too. Participants were recruited from the Tasmanian ISLAND Cognitive Clinic and healthy controls from a community sample. All participants completed the three figure drawing tasks. The clinic patients were categorised according to interdisciplinary consensus diagnosis. Binomial logistic regression and area under ROC curves (AUC) were calculated to determine the discriminatory ability of each drawing task. Overall, 112 adults were recruited; 51 had normal cognition (NC), 21 SCD, 24 MCI, and 16 had dementia. The infinity loops test did not discriminate any of the groups, casting some doubt on its usefulness. The wire cube discriminated NC from dementia (AUC 0.7; p < 0.05). The CDT discriminated NC from dementia (AUC 0.77; p < 0.01), NC from cognitive impairment (dementia + MCI; AUC 0.59; p < 0.05), and MCI from dementia (AUC 0.76; p < 0.01). None of the tests discriminated NC from MCI or NC from SCD. The CDT was the most discriminatory test, followed by the wire cube. This may help guide clinicians who often choose just one figure drawing task due to time constraints or patient fatigue.

Also flagged:osteoarthritisAnkle osteoarthritisOAhip OAchronic diseaseknee OA
Journal Article 2022-07-05 ✓ 1 Snippet Herrera-Pérez M, Valderrabano V, Godoy-Santos AL, de César Netto C, González-Martín D, Tejero S.
In-Text Gene Mentions

…causes (rheumatoid arthritis,hemochromatosis, hemophilia, or osteonecrosis…

Show Full Abstract

Ankle osteoarthritis (OA) is much less frequent than knee or hip OA, but it can be equally disabling, greatly affecting the quality of life of the patients. Approximately 80% of ankle OA is post-traumatic, mainly secondary to malleolar fractures, being another of the main causes untreated in chronic instability. The average age of the patient affected by ankle OA is around 50 years, being therefore active patients and in working age who seek to maintain mobility and remain active. The authors conducted a comprehensive review of the conservative, medical, and surgical treatment of ankle OA. Initial conservative treatment is effective and should be attempted in any stage of OA. From a pharmacological point of view, non-steroidal anti-inflammatory drugs (NSAIDs) and intra-articular infiltrations can produce temporary relief of symptoms. After the failure of conservative-medical treatment, two large groups of surgical treatment have been described: joint-preserving and joint-sacrificing procedures. In the early stages, only periarticular osteotomies have enough evidence to recommend in ankle OA with malalignment. Both ankle arthrodesis and ankle replacement can produce satisfactory functional results if correctly indicated in the final stages of the disease. Finally, the authors propose a global treatment algorithm that can aid in the decision-making process.

Also flagged:serotonin transporterserotoninreuptakedapoxetineejaculation
Journal Article 2022-07-05 No Snippets Abdullah, Yang Y, Ding SS, Sun P, Huoyong-Wei, Hong T, Xing J.
Show Full Abstract

No abstract available.

bioRxiv 2022-07-05 Preprint (No Snippets API) Gauthier S, Tran-Dinh A, Morilla I.
Show Full Abstract

Many efforts have been recently done to characterise the molecular mechanisms of COVID-19 disease. These efforts resulted in a full structural identification of ACE2 as principal receptor of the Sars-CoV-2 spike protein in the cell. However, there are still important open questions related to other proteins involved in the progression of the disease. To this end, we have modelled the plasma proteome of 384 COVID patients. The model calibrated proteins measures at three time tags and make also use of the detailed clinical evaluation outcome of each patient after their hospital stay at day 28. Our analysis is able to discriminate severity of the disease by means of a metric based on available WHO scores of disease progression. Then, we identify by topological vectorisation those proteins shifting the most in their expression depending on that severity classification. Finally, the extracted topological invariants respect the protein expression at different times were used as base of a graph convolutional network. This model enabled the dynamical learning of the molecular interactions produced between the identified proteins.

Also flagged:cytopeniaAnnexin VCancer-valAnnexinVMADD
Journal Article 2022-07-04 No Snippets Liu L, Vujovic A, Deshpande NP, Sathe S, Anande G, Chen HTT, Xu J, Minden MD, Yeo GW, Unnikrishnan A, Hope KJ, Lu Y.
Show Full Abstract

Chemo-resistance in acute myeloid leukemia (AML) patients is driven by leukemic stem cells (LSCs) resulting in high rates of relapse and low overall survival. Here, we demonstrate that upregulation of the splicing factor, RBM17 preferentially marks and sustains LSCs and directly correlates with shorten patient survival. RBM17 knockdown in primary AML cells leads to myeloid differentiation and impaired colony formation and in vivo engraftment. Integrative multi-omics analyses show that RBM17 repression leads to inclusion of poison exons and production of nonsense-mediated decay (NMD)-sensitive transcripts for pro-leukemic factors and the translation initiation factor, EIF4A2. We show that EIF4A2 is enriched in LSCs and its inhibition impairs primary AML progenitor activity. Proteomic analysis of EIF4A2-depleted AML cells shows recapitulation of the RBM17 knockdown biological effects, including pronounced suppression of proteins involved in ribosome biogenesis. Overall, these results provide a rationale to target RBM17 and/or its downstream NMD-sensitive splicing substrates for AML treatment.

Also flagged:methylationendometriosisvasodilationprostacyclin synthaseDNA methyltransferase 1DNMT1
Journal Article 2022-07-04 ✓ 5 Snippets Peng H, Weng L, Lei S, Hou S, Yang S, Li M, Zhao D.
In-Text Gene Mentions

Zhao Dong at Tongji University in Shanghai, China, and co-workers used human tissue samples and mouse models to determine the roles of a metabolite called prostacyclin (PGI2) and its catalytic enzyme (prostacyclin synthase, PTGIS) in endometriosis.

Knocking down the expression level of PTGIS was shown to promote the migration and proliferation of bladder cancer cells37, demonstrating a more complicated role for PTGIS.

The lentiviruses CON077, LV-HIF-1A-RNAi, LV-DNMT1-RNAi (hU6-MCS-Ubiquitin-EGFP-IRES-puromycin), CON238, LV-PTGIS and LV-DNMT1 (Ubi-MCS-3FLAG-SV40-EGFP-IRES-puromycin) were all constructed by GENECHEM (Shanghai).

Hypoxia-hindered methylation of PTGIS in endometrial stromal cells accelerates endometriosis progression by inducing CD16− NK-cell differentiation

As shown, the EMs model mice that received ptgis−/− uterine fragments had dramatically attenuated weights of endometriosis-like lesions in the peritoneal cavity compared to the recipient mice in the WT group (Fig. 3e, f), demonstrating that the activated PTGIS/PGI2 signaling pathway facilitated EMs progression in vivo.

Show Full Abstract

Prostacyclin (PGI<sub>2</sub>) plays key roles in shaping the immune microenvironment and modulating vasodilation, whereas its contribution to endometriosis (EMs) remains largely unclear. Our study suggested that prostacyclin synthase (PTGIS)-dependent PGI<sub>2</sub> signaling was significantly activated in EMs, which was involved in the hypoxic microenvironment of ectopic lesions and deficient methylation status of the PTGIS promoter. Notably, in vitro assays, hypoxia promoted PTGIS expression through DNA methyltransferase 1 (DNMT1)-mediated DNA methylation deficiency in endometrial stromal cells (ESCs); PTGIS overexpression enhanced the adhesive ability of ESCs and led to elevated PGI<sub>2</sub> production, and PGI<sub>2</sub> triggered CD16<sup>-</sup> (encoded by FCGR3, Fc fragment of IgG receptor IIIa) natural killer (NK)-cell differentiation through PGI<sub>2</sub> receptor (IP, PTGIR) in an ESC/NK-cell coculture system. Our rodent model experiment suggested that treatment with the PGI<sub>2</sub> analog iloprost and adoptive transfer of fcgr3 knockout (fcgr3<sup>-/-</sup>) NK cells aggravated EMs progression and that genetic ablation of ptgis (ptgis<sup>-/-</sup>) in ectopic lesions and treatment with the PTGIR antagonist RO1138452 partially rescued this outcome. Thus, our findings identified the contribution of PGI<sub>2</sub> to EMs progression via enhancement of the adhesive ability of ESCs and inhibition of the activity of NK cells. We hypothesized that PGI<sub>2</sub> is a target for EMs intervention and provide a rationale for studying pharmacological PTGIR inhibition and PTGIS genetic depletion therapies as therapeutic strategies for EMs.

Also flagged:eosinophiliaDRESS SyndromeDRESSnecrotizing pneumoniapleural effusionpneumonia
Journal Article 2022-07-04 ✓ 1 Snippet Gruber S, Gona-Hoepler L, Bangert C, Diesner SC, Schmidthaler K, Szepfalusi Z.
In-Text Gene Mentions

…factor IX 36%,ATIIIactivity 72%).…

Show Full Abstract

Drug reaction with eosinophilia and systemic symptoms (DRESS) belongs to the group of severe cutaneous adverse reactions. Here we report a case of drug hypersensitivity against multiple antibiotics with DRESS in a young child with necrotizing pneumonia.

Also flagged:Ironlipidmitochondriallipogenesislipolysishypoxia-inducible factor-1 α
Journal Article 2022-07-04 ✓ 1 Snippet Song CC, Pantopoulos K, Chen GH, Zhong CC, Zhao T, Zhang DG, Luo Z.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Iron is an essential micro-element, involved in multiple biological activities in vertebrates. Excess iron accumulation has been identified as an important mediator of lipid deposition. However, the underlying mechanisms remain unknown. In the present study, we found that a high-iron diet significantly increased intestinal iron content and upregulated the mRNA expression of two iron transporters (zip14 and fpn1). Intestinal iron overload increased lipogenesis, reduced lipolysis and promoted oxidative stress and mitochondrial dysfunction. Iron-induced lipid accumulation was mediated by hypoxia-inducible factor-1 α (HIF1α), which was induced in response to mitochondrial oxidative stress following inhibition of prolyl hydroxylase 2 (PHD2). Mechanistically, iron promoted lipid deposition by enhancing the DNA binding capacity of HIF1α to the pparγ and fas promoters. Our results provide experimental evidence that oxidative stress, mitochondrial dysfunction and the HIF1α-PPARγ pathway are critical mediators of iron-induced lipid deposition.

Also flagged:maternal depressiondepressionmajor depressive episodepostnatal depressionmajor depressive disordergestation
Journal Article 2022-07-04 ✓ 1 Snippet Craig MC, Sethna V, Gudbrandsen M, Pariante CM, Seneviratne T, Stoencheva V, Sethi A, Catani M, Brammer M, Murphy DGM, Daly E.
In-Text Gene Mentions

…of the of5-HTTpromoter have been…

Show Full Abstract

<h4>Background</h4>Offspring exposed to prenatal maternal depression (PMD) are vulnerable to depression across their lifespan. The underlying cause(s) for this elevated intergenerational risk is most likely complex. However, depression is underpinned by a dysfunctional frontal-limbic network, associated with core information processing biases (e.g. attending more to sad stimuli). Aberrations in this network might mediate transmission of this vulnerability in infants exposed to PMD. In this study, we aimed to explore the association between foetal exposure to PMD and frontal-limbic network function in infancy, hypothesising that, in response to emotional sounds, infants exposed to PMD would exhibit atypical activity in these regions, relative to those not exposed to PMD.<h4>Method</h4>We employed a novel functional magnetic resonance imaging sequence to compare brain function, whilst listening to emotional sounds, in 78 full-term infants (3-6 months of age) born to mothers with and without a diagnosis of PMD.<h4>Results</h4>After exclusion of 19 datasets due to infants waking up, or moving excessively, we report between-group brain activity differences, between 29 infants exposed to PMD and 29 infants not exposed to PMD, occurring in temporal, striatal, amygdala/parahippocampal and frontal regions (<i>p</i> < 0.005). The offspring exposed to PMD exhibited a relative increase in activation to sad sounds and reduced (or unchanged) activation to happy sounds in frontal-limbic clusters.<h4>Conclusions</h4>Findings of a differential response to positive and negative valanced sounds by 3-6 months of age may have significant implications for our understanding of neural mechanisms that underpin the increased risk for later-life depression in this population.

Also flagged:mitochondrialNeurological disorderscognitive impairmentAlzheimer's diseaseADamyotrophic lateral sclerosis
Journal Article 2022-07-04 ✓ 4 Snippets Olesen MA, Villavicencio-Tejo F, Quintanilla RA.
In-Text Gene Mentions

HD is a dominantly inherited disease caused by the repetition of CAG (cytosine, adenine, and guanine) trinucleotides of the huntingtin (HTT) protein gene located on chromosome 4 [159, 160].

Also, other reports demonstrated that the SH-SY5Y human neuroblastoma cells that express mutant HTT present a significant association of this protein with mitochondrial fraction (specifically in OMM), leading to calcium dysregulation, cytochrome c release, swelling, and mPTP opening [170].

However, treatment with peptide P110 (suppressor of DRP1 activity) in the zQ175 knock-in mouse model (zQ175 allele encodes the human HTT exon one sequence with a ~ 190 CAG repeats) disables the translocation of DRP1 into mitochondria, improves locomotor activity and reduces the white matter degeneration of the corpus callosum in HD mice [172].

These effects can be explained, since studies in HD skin fibroblasts have shown a co-localization between mutant HTT and DRP1 [334].

Show Full Abstract

Neurological disorders (NDs) are characterized by progressive neuronal dysfunction leading to synaptic failure, cognitive impairment, and motor injury. Among these diseases, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS) have raised a significant research interest. These disorders present common neuropathological signs, including neuronal dysfunction, protein accumulation, oxidative damage, and mitochondrial abnormalities. In this context, mitochondrial impairment is characterized by a deficiency in ATP production, excessive production of reactive oxygen species, calcium dysregulation, mitochondrial transport failure, and mitochondrial dynamics deficiencies. These defects in mitochondrial health could compromise the synaptic process, leading to early cognitive dysfunction observed in these NDs. Interestingly, skin fibroblasts from AD, PD, HD, and ALS patients have been suggested as a useful strategy to investigate and detect early mitochondrial abnormalities in these NDs. In this context, fibroblasts are considered a viable model for studying neurodegenerative changes due to their metabolic and biochemical relationships with neurons. Also, studies of our group and others have shown impairment of mitochondrial bioenergetics in fibroblasts from patients diagnosed with sporadic and genetic forms of AD, PD, HD, and ALS. Interestingly, these mitochondrial abnormalities have been observed in the brain tissues of patients suffering from the same pathologies. Therefore, fibroblasts represent a novel strategy to study the genesis and progression of mitochondrial dysfunction in AD, PD, HD, and ALS. This review discusses recent evidence that proposes fibroblasts as a potential target to study mitochondrial bioenergetics impairment in neurological disorders and consequently to search for new biomarkers of neurodegeneration.

Also flagged:Pulmonary thromboembolismdeathheart attackstrokeventricleright ventricular failure
Journal Article 2022-07-04 ✓ 1 Snippet Vasan AS, Hosur B, Sharma M, Garg Y.
In-Text Gene Mentions

thrombin-III

Show Full Abstract

Pulmonary thromboembolism (PTE) remains the third leading cause of cardiovascular death, after a heart attack and stroke. Haemodynamically unstable PTE (previously called high-risk or massive) is one of the dreaded conditions commonly found in people working in high-altitude areas. Due to the individual variations in clot characteristics and the haemodynamics, these patients offer unique therapeutic challenges by delay in access to tertiary care, being recalcitrant to the systemic thrombolysis as well as complete recanalisation by endovascular thrombectomy. We present a rare case of haemodynamically unstable right pulmonary trunk occlusion with delayed presentation and sustained right ventricular strain despite systemic thrombolysis, managed successfully by catheter-directed thrombectomy. Despite the partial recanalisation of only the right inferior pulmonary artery branches and persistent superior branch occlusion, there was an immediate clinical benefit and no recurrence of symptoms with maintenance therapy of newer oral anticoagulants.

Also flagged:HERC2GAPDHmineralsIronATG7systemic lupus erythematosus
Journal Article 2022-07-04 ✓ 1 Snippet Ni Z, Li Y, Song D, Ding J, Mei S, Sun S, Cheng W, Yu J, Zhou L, Kuang Y, Li M, Cai Z, Yu C.
In-Text Gene Mentions

…intracerebral hemorrhage, andhemochromatosisstudies [ 50…

Show Full Abstract

Endometriosis (EMs) occurs in approximately 50% of women with infertility. The main causes of EMs-related infertility are follicle dysplasia and reduced oocyte quality. Iron overload occurs in ovarian follicular fluid (FF) of patients with EMs, and this condition is associated with oocyte maturation disorder. However, the underlying molecular mechanism remains largely unknown. In the present study, we identified the mechanism underlying ferroptosis in ovarian granulosa cells and oocyte maturation failure in EMs based on a retrospective review of in vitro fertilization/intracytoplasmic sperm injection-frozen embryo transfer outcomes in infertile patients with EMs. Mouse granulosa cells were treated with EMs-related infertile patients' follicular fluid (EMFF) in vitro. Western blot analysis, quantitative polymerase chain reaction, fluorescence staining, and transmission electron microscopy were used to assess granulosa cells ferroptosis. The effects of exosomes were examined by nanoparticle tracking analysis, RNA-seq, and Western blot analysis. Finally, the therapeutic values of vitamin E and iron chelator (deferoxamine mesylate) in vivo were evaluated in an EMs-related infertility model. Patients with ovarian EMs experienced poorer oocyte fertility than patients with non-ovarian EMs. We observed that EMFF with iron overload-induced granulosa cell ferroptosis in vitro and in vivo. Mechanically, nuclear receptor coactivator four-dependent ferritinophagy was involved in this process. Notably, granulosa cells undergoing ferroptosis further suppressed oocyte maturation by releasing exosomes from granulosa cells. In therapeutic studies, vitamin E and iron chelators effectively alleviated EMs-related infertility models. Our study indicates a novel mechanism through which EMFF with iron overload induces ferroptosis of granulosa cells and oocyte dysmaturity in EMs-related infertility, providing a potential therapeutic strategy for EMs-related infertility.

Also flagged:HRPGAPDHCIDEADIRAS1KLF12HIF1AN
Journal Article 2022-07-04 ✓ 2 Snippets Liu Y, Wang J, Shou Y, Xu W, Huang Z, Xu J, Chen K, Liu J, Liu D, Liang H, Yang H, Zhang X.
In-Text Gene Mentions

Moreover, Phospholipase C-like 1 (PLCL1) was identified to activate lipid browning via stabilizing the protein of UCP1, which leaded to the inhibition of ccRCC [13].

…Phospholipase C-like 1 (PLCL1) was identified to…

Show Full Abstract

Abnormal accumulation of lipids has been highlighted in the progression of clear cell renal cell carcinoma (ccRCC). However, the underlying mechanism remains unclear. Emerging evidence suggests long noncoding RNAs (lncRNAs) participate in the regulation of lipid metabolism. In this study, we found lncRNA COL18A1-AS1 was downregulated in ccRCC and that higher COL18A1-AS1 expression indicated better prognosis. Decreased COL18A1-AS1 expression was caused by DNA methylation at the CpG islands within its promoter. Restoring the epigenetically silenced COL18A1-AS1 repressed tumor progression, promoted lipid browning and consumption in vitro and in vivo. Mechanistically, COL18A1-AS1 could competitively bind miR-1286 to increase the expression of Krüppel-like factor 12 (KLF12). Downregulation of COL18A1-AS1 in ccRCC resulted in the low expression of KLF12. COL18A1-AS1/KLF12 positively regulated uncoupling protein 1 (UCP1)-mediated lipid browning, which promotes tumor cell "slimming" and inhibits tumor progression. When tumor cell "slimming" occurred, lipid droplets turned into tiny pieces, and lipids were consumed without producing ATP energy. Taken together, our findings on COL18A1-AS1-miR-1286/KLF12 axis revealed a potential mechanism of abnormal accumulation of lipids in ccRCC and could be a promising therapeutic target for ccRCC patients.

Also flagged:Breast cancercancerstumorsdeathaponecrosisNecroptosis
Journal Article 2022-07-04 ✓ 1 Snippet Zhang Y, Yue Q, Cao F, Li Y, Wei Y.
In-Text Gene Mentions

…CD200, NRP1, andTNFSF4were observed significant…

Show Full Abstract

Necroptosis is a genetically regulated form of necrotic cell death that has emerged as an important pathway in cancers. Long non-coding RNAs (lncRNAs) are key regulators of breast cancer development. Nevertheless, few studies are reporting the effect of lncRNAs in necroptosis processes and the role of necroptosis-related lncRNAs (NRLs). The present study aimed to construct a prognostic model based on NRLs in breast cancer. NRLs were identified by combining expression profiling data from The Cancer Genome Atlas (TCGA) with necroptosis-related genes. The non-negative matrix factorization (NMF) clustering analysis was conducted to identify molecular subtypes of BC, and the clinical outcome and tumor-infiltrating immune cells (TIICs) in the different molecular subtypes were analyzed. Four molecular subtypes based on NRLs were identified, and these four molecular subtypes could predict clinical features, prognosis, and tumor-infiltrating immune cells (TIICs). A 4-NRLs signature and nomogram were established and validated its predictive capability of overall survival (OS) in breast cancer patients. Analyses of clinicopathological features, prognosis, TIICs, tumor microenvironment (TME), somatic mutations, and drug response revealed significant differences between the two risk groups. In addition, we found that low-risk patients exhibited higher levels of immune checkpoints and showed higher immunogenicity in immunophenoscore (IPS) analysis. In conclusion, we constructed a prognostic model based on the expression profile of NRLs, which may facilitate the assessment of patient prognosis, immunotherapeutic responses, and maybe a promising therapeutic target in clinical practice.

Also flagged:breast cancerchromatintumorcancerdeathbreast tumors
Journal Article 2022-07-04 No Snippets Sideris N, Dama P, Bayraktar S, Stiff T, Castellano L.
Show Full Abstract

Breast cancer affects millions of women each year. Despite recent advances in targeted treatments breast cancer remains a significant threat to women's health. In recent years the development of high-throughput sequencing technologies has advanced the field of transcriptomics shedding light on the role of non-coding RNAs (ncRNAs), including long ncRNAs (lncRNAs), in human cellular function and disease. LncRNAs are classified as transcripts longer than 200nt with no coding potential. These transcripts constitute a diverse group of regulatory molecules essential to the modulation of crucial cellular processes, which dysregulation of leads to disease. LncRNAs exert their regulatory functions through their sequences and by forming complex secondary and tertiary structures that interact with other transcripts, chromatin and/or proteins. Numerous studies have provided evidence of the involvement of LncRNAs in tumor development and disease progression. They possess multiple characteristics that make them novel therapeutic and diagnostic targets. Indeed, the discovery of a novel mechanism by which lncRNAs associated with proteins can induce the formation of phase-separated droplets broadens our understanding of the spatiotemporal control of cellular processes and opens up developing a new treatment. Nevertheless, the role and the molecular mechanisms of many lncRNAs in the regulation of cellular processes and cancer still remain elusive. This is due to the absence of a thorough characterization of the regulatory role of their loci and the functional impact of their aberrations in cancer biology. Here, we present some of the latest advances concerning the role of LncRNAs in breast cancer.

Also flagged:chromatinH2A.Zsox9HepescytosinesChloroform
Journal Article 2022-07-04 ✓ 1 Snippet Baranasic D, Hörtenhuber M, Balwierz PJ, Zehnder T, Mukarram AK, Nepal C, Várnai C, Hadzhiev Y, Jimenez-Gonzalez A, Li N, Wragg J, D'Orazio FM, Relic D, Pachkov M, Díaz N, Hernández-Rodríguez B, Chen Z, Stoiber M, Dong M, Stevens I, Ross SE, Eagle A, Martin R, Obasaju O, Rastegar S, McGarvey AC, Kopp W, Chambers E, Wang D, Kim HR, Acemel RD, Naranjo S, Łapiński M, Chong V, Mathavan S, Peers B, Sauka-Spengler T, Vingron M, Carninci P, Ohler U, Lacadie SA, Burgess SM, Winata C, van Eeden F, Vaquerizas JM, Gómez-Skarmeta JL, Onichtchouk D, Brown BJ, Bogdanovic O, van Nimwegen E, Westerfield M, Wardle FC, Daub CO, Lenhard B, Müller F.
In-Text Gene Mentions

DCC

Show Full Abstract

Zebrafish, a popular organism for studying embryonic development and for modeling human diseases, has so far lacked a systematic functional annotation program akin to those in other animal models. To address this, we formed the international DANIO-CODE consortium and created a central repository to store and process zebrafish developmental functional genomic data. Our data coordination center ( https://danio-code.zfin.org ) combines a total of 1,802 sets of unpublished and re-analyzed published genomic data, which we used to improve existing annotations and show its utility in experimental design. We identified over 140,000 cis-regulatory elements throughout development, including classes with distinct features dependent on their activity in time and space. We delineated the distinct distance topology and chromatin features between regulatory elements active during zygotic genome activation and those active during organogenesis. Finally, we matched regulatory elements and epigenomic landscapes between zebrafish and mouse and predicted functional relationships between them beyond sequence similarity, thus extending the utility of zebrafish developmental genomics to mammals.

Also flagged:cancertumorCD8CD4antigen presentationextracellular
Journal Article 2022-07-04 ✓ 1 Snippet Laureano RS, Sprooten J, Vanmeerbeerk I, Borras DM, Govaerts J, Naulaerts S, Berneman ZN, Beuselinck B, Bol KF, Borst J, Coosemans A, Datsi A, Fučíková J, Kinget L, Neyns B, Schreibelt G, Smits E, Sorg RV, Spisek R, Thielemans K, Tuyaerts S, De Vleeschouwer S, de Vries IJM, Xiao Y, Garg AD.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4, also known as…

Show Full Abstract

Dendritic cell (DC)-based vaccination for cancer treatment has seen considerable development over recent decades. However, this field is currently in a state of flux toward niche-applications, owing to recent paradigm-shifts in immuno-oncology mobilized by T cell-targeting immunotherapies. DC vaccines are typically generated using autologous (patient-derived) DCs exposed to tumor-associated or -specific antigens (TAAs or TSAs), in the presence of immunostimulatory molecules to induce DC maturation, followed by reinfusion into patients. Accordingly, DC vaccines can induce TAA/TSA-specific CD8<sup>+</sup>/CD4<sup>+</sup> T cell responses. Yet, DC vaccination still shows suboptimal anti-tumor efficacy in the clinic. Extensive efforts are ongoing to improve the immunogenicity and efficacy of DC vaccines, often by employing combinatorial chemo-immunotherapy regimens. In this Trial Watch, we summarize the recent preclinical and clinical developments in this field and discuss the ongoing trends and future perspectives of DC-based immunotherapy for oncological indications.

Also flagged:OLFM2glycoproteinsmetabolisminnate immunitycancerNAFLD
Journal Article 2022-07-04 ✓ 5 Snippets Bertran L, Jorba-Martin R, Barrientos-Riosalido A, Portillo-Carrasquer M, Aguilar C, Riesco D, Martínez S, Vives M, Sabench F, Castillo DD, Richart C, Auguet T.
In-Text Gene Mentions

Although OLFM2 is involved in the regulation of the energy metabolism and OLFM4 is an important player in inflammation, innate immunity and cancer, the role of OLFMs in NAFLD-related intestinal dysbiosis remains unknown.

Furthermore, OLFM4 is an important player in the cellular process of inflammation, and it has important roles in innate immunity against bacterial infection, gastrointestinal inflammation, and cancer [17,31].

Later, when the subjects were divided according to the presence of NASH, an increase in OLFM2 relative expression in the NASH group was observed in comparison with the non-NASH group, as shown in Figure 1B. However, regarding OLFM4, we did not report significant differences between groups (Figure 1C,D).

In this study, we analysed the hepatic mRNA expression of OLFM2 and the jejunal expression of OLFM4 in a well-established cohort of women with morbid obesity (MO), classified according to their hepatic histology into normal liver (n = 27), simple steatosis (n = 26) and nonalcoholic steatohepatitis (NASH, n = 16).

The work was mainly focused on defining the specific role of OLFM2 in hepatic tissue and OLFM4 in jejunum samples in MO patients with or without NAFLD.

Show Full Abstract

Olfactomedins (OLFMs) are a family of glycoproteins that play a relevant role in embryonic development and in some pathological processes. Although OLFM2 is involved in the regulation of the energy metabolism and OLFM4 is an important player in inflammation, innate immunity and cancer, the role of OLFMs in NAFLD-related intestinal dysbiosis remains unknown. In this study, we analysed the hepatic mRNA expression of <i>OLFM2</i> and the jejunal expression of <i>OLFM4</i> in a well-established cohort of women with morbid obesity (MO), classified according to their hepatic histology into normal liver (<i>n</i> = 27), simple steatosis (<i>n</i> = 26) and nonalcoholic steatohepatitis (NASH, <i>n</i> = 16). Our results showed that <i>OLFM2</i> hepatic mRNA was higher in NASH, in advanced degrees of steatosis and in the presence of lobular inflammation. Additionally, we obtained positive correlations between hepatic <i>OLFM2</i> and glucose, cholesterol, trimethylamine N-oxide and deoxycholic acid levels and hepatic fatty acid synthase, and negative associations with weight and jejunal Toll-like receptors (<i>TLR4</i>) and <i>TLR5</i> expression. Regarding jejunal <i>OLFM4</i>, we observed positive correlations with circulating interleukin (IL)-8, IL-10, IL-17 and jejunal <i>TLR9</i>. In conclusion, OLFM2 in the liver seems to play a relevant role in NAFLD progression, while OLFM4 in the jejunum could be involved in gut dysbiosis-related inflammatory events.

Also flagged:cardiac arrestdeathHepatocellular carcinomaend-stage liver diseasehepatitis Cacute liver failure
Journal Article 2022-07-04 ✓ 1 Snippet Houben P, Bormann E, Kneifel F, Katou S, Morgül MH, Vogel T, Bahde R, Radünz S, Pascher A, Schmidt H, Brockmann JG, Becker F.
In-Text Gene Mentions

…(including Caroli disease,hemochromatosis, amyloidosis, and cryptogenic…

Show Full Abstract

In liver transplantation, older donor age is a well-known risk factor for dismal outcomes, especially due to the high susceptibility of older grafts to ischemia-reperfusion injury. However, whether the factors correlating with impaired graft and patient survival following the transplantation of older grafts follow a linear trend among elderly donors remains elusive. In this study, liver transplantations between January 2006 and May 2018 were analyzed retrospectively. Ninety-two recipients of grafts from donors ≥65 years were identified and divided into two groups: (1) ≥65-69 and (2) ≥ 70 years. One-year patient survival was comparable between recipients of grafts from donors ≥65-69 and ≥70 years (78.9% and 70.0%). One-year graft survival was 73.1% (donor ≥65-69) and 62.5% (donor ≥ 70), while multivariate analysis revealed superior one-year graft survival to be associated with a donor age of ≥65-69. No statistically significant differences were found for rates of primary non-function. The influence of donor age on graft and patient survival appears not to have a distinct impact on dismal outcomes in the range of 65-70 years. The impact of old donor age needs to be balanced with other risk factors, as these donors provide grafts that offer a lifesaving graft function.

Also flagged:Amyotrophic lateral sclerosisALSneurodegenerative diseaseneuromuscular diseasesmuscle atrophyrespiratory failure
Journal Article 2022-07-04 ✓ 2 Snippets Yang EJ, Lee SH, Cai M.
In-Text Gene Mentions

Therefore, studies are also needed to investigate the efficacy of HFE in various ALS models, such as mice modeling TDP43 and C9orf72 ALS, as this experiment was performed only in hSOD1G93A mice before it can be established that HFE are therapeutic candidates for patients with ALS.

…G93A mice followingHFEtreatment compared with…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS), a multicomplex neurodegenerative disease, has multiple underlying pathological factors and can induce other neuromuscular diseases, leading to muscle atrophy and respiratory failure. Currently, there is no effective drug for treating patients with ALS. Herbal medicine, used to treat various diseases, has multitarget effects and does not usually induce side effects. Each bioactive component in such herbal combinations can exert a mechanism of action to increase therapeutic efficacy. Herein, we investigated the efficacy of an herbal formula, comprising <i>Achyranthes bidentata</i> Blume, <i>Eucommia ulmoides</i> Oliver, and <i>Paeonia lactiflora</i> Pallas, in suppressing the pathological mechanism of ALS in male hSOD1<sup>G93A</sup> mice. Herbal formula extract (HFE) (1 mg/g) were orally administered once daily for six weeks, starting at eight weeks of age, in hSOD1<sup>G93A</sup> transgenic mice. To evaluate the effects of HFE, we performed footprint behavioral tests, western blotting, and immunohistochemistry to detect protein expression and quantitative PCR to detect mRNA levels in the muscles and spinal cord of hSOD1<sup>G93A</sup> mice. HFE-treated hSOD1<sup>G93A</sup> mice showed increased anti-inflammation, antioxidation, and regulation of autophagy in the muscles and spinal cord. Thus, HEF can be therapeutic candidates for inhibiting disease progression in patients with ALS. This study has some limitations. Although this experiment was performed only in male hSOD1<sup>G93A</sup> mice, studies that investigate the efficacy of HEF in various ALS models including female mice, such as mice modeling TAR DNA-binding protein 43 (TDP43) and ORF 72 on chromosome 9 (C9<i>orf</i>72) ALS, are required before it can be established that HEF are therapeutic candidates for patients with ALS.

Also flagged:metabolismdegradationmethyltransferasesRNA-binding proteinsdemethylasescancer
Journal Article 2022-07-04 No Snippets Chen H, Wang Y, Su H, Zhang X, Chen H, Yu J.
Show Full Abstract

N<sup>6</sup>-Methyladenosine (m<sup>6</sup>A) is the most abundant modification on eukaryote messenger RNA and plays a key role in posttranscriptional regulation of RNA metabolism including splicing, intracellular transport, degradation, and translation. m<sup>6</sup>A is dynamically regulated by methyltransferases (writers), RNA-binding proteins (readers), and demethylases (erasers). Recent studies demonstrate that perturbation of m<sup>6</sup>A regulators remarkably influences cell fate transitions through rewiring various biological processes, such as growth, differentiation, and survival. Moreover, aberrant m<sup>6</sup>A modification is implicated in a variety of diseases, in particular cancer. In this review, we describe the functional linkage of m<sup>6</sup>A modifications to cellular reprogramming and cancer stemness properties.

Also flagged:In vitrofertilizationembryo transferinfertilityhatchingproteases
Journal Article 2022-07-04 ✓ 1 Snippet Yang G, Chen J, He Y, Luo H, Yuan H, Chen L, Huang L, Mao F, Hu S, Qian Y, Miao C, Feng R.
In-Text Gene Mentions

…atistically significant level:Prdx6, Nppb, Gclm, Dppa1,…

Show Full Abstract

Mammalian blastocyst hatching is an essential prerequisite for successful embryo implantation. As the rate-limiting step of current assisted reproductive technology, understanding the key factors regulating blastocyst hatching would be significantly helpful to improve the performance of the assisted reproductive practice. In early embryo development, the fine-tuned elimination of maternal materials and the balanced protein turnover are inevitable for the competent to hatch and implant into endometrium. Neddylation, a ubiquitination-like protein modification, has been shown to be involved in oocyte maturation and early embryo development. In this study, aiming to discover an unknown role of neddylation in the blastocyst hatching process, we provided functional evidence of neddylation in mammalian embryo quality and blastocyst hatching. Treatment with MLN4924, a specific neddylation inhibitor, lowered the embryo quality and dramatically reduced the hatching rate in mouse blastocysts. The transcriptional profile showed the upregulation of oxidative stress-related genes and aberrant expression of immune-related genes. The elevated oxidative stress was validated by qPCR and markers of apoptosis, DNA damage, reactive oxygen species, and cytoskeleton. Moreover, we found the secreted IL-1β level was reduced in an NF-κB-independent manner, leading to the final poor embryo quality and blastocyst hatching failure. This is the first report of neddylation being of great importance in the mammalian blastocyst hatching process. Further investigations uncovering more detailed molecular mechanisms of neddylation regulation in blastocyst hatching would greatly promote not only the understanding of this crucial biological process but also the clinical application in reproductive centers.

Also flagged:cancertype 2 diabetesAcneanxietythyroid cancerGigantism
Journal Article 2022-07-04 ✓ 1 Snippet Rasouli J, Casella G, Zhang W, Xiao D, Kumar G, Fortina P, Zhang GX, Ciric B, Rostami A.
In-Text Gene Mentions

…TNFSF11, TNFSF8, andTNFSF4( Figures 6E–G…

Show Full Abstract

GM-CSF-producing T helper (Th) cells play a crucial role in the pathogenesis of autoimmune diseases such as multiple sclerosis (MS). Recent studies have identified a distinct population of GM-CSF-producing Th cells, named ThGM cells, that also express cytokines TNF, IL-2, and IL-3, but lack expression of master transcription factors (TF) and signature cytokines of commonly recognized Th cell lineages. ThGM cells are highly encephalitogenic in a mouse model of MS, experimental autoimmune encephalomyelitis (EAE). Similar to Th17 cells, in response to IL-12, ThGM cells upregulate expression of T-bet and IFN-γ and switch their phenotype to Th1. Here we show that in addition to T-bet, TF RUNX3 also contributes to the Th1 switch of ThGM cells. T-bet-deficient ThGM cells in the CNS of mice with EAE had low expression of RUNX3, and knockdown of RUNX3 expression in ThGM cells abrogated the Th1-inducing effect of IL-12. Comparison of ThGM and Th1 cell transcriptomes showed that ThGM cells expressed a set of TFs known to inhibit the development of other Th lineages. Lack of expression of lineage-specific cytokines and TFs by ThGM cells, together with expression of TFs that inhibit the development of other Th lineages, suggests that ThGM cells are a non-polarized subset of Th cells with lineage characteristics.

Also flagged:Gene expressionnucleotideneurodegenerative disorderspyrimidineCUBage-related illnesses
Journal Article 2022-07-04 ✓ 1 Snippet Khandia R, Saeed M, Alharbi AM, Ashraf GM, Greig NH, Kamal MA.
In-Text Gene Mentions

…common in theHTTgene associated with…

Show Full Abstract

Codon usage analysis is a crucial part of molecular characterization and is used to determine the factors affecting the evolution of a gene. The length of a gene is an important parameter that affects the characteristics of the gene, such as codon usage, compositional parameters, and sometimes, its functions. In the present study, we investigated the association of various parameters related to codon usage with the length of genes. Gene expression is affected by nucleotide disproportion. In sixty genes related to neurodegenerative disorders, the G nucleotide was the most abundant and the T nucleotide was the least. The nucleotide T exhibited a significant association with the length of the gene at both the overall compositional level and the first and second codon positions. Codon usage bias (CUB) of these genes was affected by pyrimidine and keto skews. Gene length was found to be significantly correlated with codon bias in neurodegeneration associated genes. In gene segments with lengths below 1,200 bp and above 2,400 bp, CUB was positively associated with length. Relative synonymous CUB, which is another measure of CUB, showed that codons TTA, GTT, GTC, TCA, GGT, and GGA exhibited a positive association with length, whereas codons GTA, AGC, CGT, CGA, and GGG showed a negative association. GC-ending codons were preferred over AT-ending codons. Overall analysis indicated that the association between CUB and length varies depending on the segment size; however, CUB of 1,200-2,000 bp gene segments appeared not affected by gene length. In synopsis, analysis suggests that length of the genes correlates with various imperative molecular signatures including A/T nucleotide disproportion and codon choices. In the present study we additionally evaluated various molecular features and their correlation with different indices of codon usage, like the Codon Adaptation Index (CAI) and Relative Dynonymous Codon Usage (RSCU) of codons. We also considered the impact of gene fragment size on different molecular features in genes related to neurodegeneration. This analysis will aid our understanding of and in potentially modulating gene expression in cases of defective gene functioning in clinical settings.

Also flagged:IL-6IL-1βMfn2Mfn1Fis1TNF
Journal Article 2022-07-04 ✓ 2 Snippets Tian Y, Liu Q, Zhou Y, Chen XY, Pan Y, Xu H, Yang Z.
In-Text Gene Mentions

To screen for mutations in the probands, we used a targeted gene capture sequencing panel composed of 160 genes reported to be associated with leukoencephalopathies, including AARS2, ABAT, ABCD1, ACOX1, ACTA2, ADH1C, AIMP1, ALDH3A2, APBB2, ARSA, ASPA, BCKDHA, BCKDHB, BCS1L, CHM, CLCN2, COA5, COX15, COX6B1, CSF1R, CTC1, CYP27A1, DARS2, DBT, DDC, DLD, DNAJC13, DNAJC6, ECM1, EIF2B1, EIF2B2, EIF2B3, EIF2B4, and EIF2B5 (Supplementary Table S1).

…, CYP27A1 ,DARS2, DBT ,…

Show Full Abstract

Vanishing white matter disease (VWM) is one of the most common childhood inherited leukoencephalopathies with autosomal recessive inheritance. Mutations in five genes, <i>EIF2B1-5</i>, have been identified as the major cause of VWM. In this study, a targeted gene capture sequencing panel comprising 160 known pathogenic genes associated with leukoencephalopathies was performed in a large Han Chinese family affected by adult-onset VWM, and a novel heterozygous missense mutation (c.1337G > A [p. R446H]) in <i>EIF2B4</i> (NM_001034116.2) was detected. Further functional studies in HEK 293 cells showed dramatically reduced EIF2Bδ protein levels in the mutated group compared with the wild-type group. This study revealed that a heterozygous missense mutation (c.1337G > A [p. R446H]) in <i>EIF2B4</i> was potentially associated with the adult-onset mild phenotype of VWM. In contrast to previous reports, autosomal dominant inheritance was also observed in adult-onset VWM.

Also flagged:p53FerroptosisPeptiderheumatoid arthritisRAgalectin-1
Journal Article 2022-07-04 ✓ 1 Snippet Hu J, Zhang R, Chang Q, Ji M, Zhang H, Geng R, Li C, Wang Z.
In-Text Gene Mentions

…target for amelioratinghemochromatosis-related tissue damage and…

Show Full Abstract

<b>Backgrounds:</b> Rheumatoid arthritis synovial fibroblasts (RASFs) are the primary cells responsible for destruction of marginal cartilage in rheumatoid arthritis (RA). G1dP3, a bioactive peptide derived from galectin-1 domain, possesses potent anti-inflammatory and anti-proliferation properties in RASFs. This study aimed to determine the effects of G1dP3 ferroptosis induction in RASFs and to further clarify the possible mechanisms. <b>Methods:</b> TNF-α was used to establish a RA model in MH7A cells. Cell Counting Kit-8 assays were employed to detect MH7A cell viability with different treatments. The occurrence of ferroptosis was examined by Lipid ROS assay, cellular labile iron pool measurement, reduced glutathione/oxidized glutathione activity, Gpx4 expression and transmission electron microscopy (TEM) morphology observation. Lentiviral-mediated siRNA interference was used to determine the downstream pathway. <b>Results:</b> G1dP3 markedly suppressed MH7A cell viability induced by TNF-α. G1dP3-treated MH7A cells presented the morphological features of ferroptosis. Moreover, G1dP3 triggered ferroptosis in MH7A cells by promoting the accumulation of lipid peroxides as well as iron deposition. Inhibition of ferroptosis alleviated G1dP3-mediated suppression of MH7A cell viability. Furthermore, G1dP3 increased p53 expression, which in turn transcriptionally suppressed SLC7A11, a key component of system X<sub>c</sub> <sup>-</sup> essential for ferroptosis. Knockdown of p53 abrogated the ferroptotic effects of G1dP3 on MH7A cells. <b>Conclusion:</b> Our findings reveal that the bioactive peptide G1dP3 promotes RASFs ferroptosis cell death via a p53/SLC7A11 axis-dependent mechanism, suggesting its potential role in the treatment of RA.

Also flagged:GNMTdegAKR1D1FRMPD4STMN2VSTM2A
Journal Article 2022-07-04 ✓ 1 Snippet Wo Q, Liu Z, Hu L.
In-Text Gene Mentions

…, ABCA13 ,CACNA1E, LRP1B ,…

Show Full Abstract

<b>Background:</b> In order to reveal the functions of ferroptosis in prostate cancer (PCa), a ferroptosis potential index (FPI) was built. This study researched the influence of ferroptosis on gene mutations, various cellular signaling pathways, biochemical recurrence (BCR), and drug resistance in both FPI-high and FPI-low groups. <b>Methods:</b> RNA-seq, somatic mutation data, and clinical data were obtained from The Cancer Genome Atlas (TCGA). FPI values were calculated. All samples were divided into FPI-high and FPI-low groups. The BCR-free survival rate, tumor mutation burden (TMB) value, cellular signaling pathway, differentially expressed genes (DEGs), and drug resistance in the two FPI groups were identified. Human PCa cells, LNCaP, were treated with ferroptosis inducer erastin or inhibitor ferrostatin-1. The expression of hub genes was detected by qRT-PCR and Western blot. <b>Results:</b> A high FPI level was significantly related to poor BCR-free survival. Also, higher TMB value was found in the FPI-high group, and FPI was shown to be associated with gene mutations. Then, genes in both groups were revealed to be enriched in different pathways. A total of 310 DEGs were identified to be involved in muscle system processes and neuroactive ligand-receptor interactions. A total of 101 genes were found to be related to BCR-free survival, and a protein-protein interaction (PPI) network was constructed. Two sub-modules were identified by MCODE, and eight hub genes were screened out, among which <i>SYT4</i> had higher expression levels and poorer BCR-free survival in the FPI-high group, while the remaining hub genes had lower expression levels and poorer BCR-free survival. Drug sensitivity was revealed to be different in the two groups by study on the IC<sub>50</sub> data of different molecules and ferroptosis regulator gene (FRG) expressions. Finally, erastin increased the expression of SYT4 in LNCaP and decreased the expression of the other four genes (ACTC1, ACTA1, ACTN2, and MYH6), while ferrostatin-1 led to the opposite results. The molecular experimental results were consistent with those of bioinformatics analysis, except TNNI1, TNNC2, and NRAP. <b>Conclusion:</b> The current research depicted the ferroptosis level and FRGs in PCa. Ferroptosis was related to TMB value, BCR-free survival, and drug resistance. This study will be beneficial to further research studies on ferroptosis-related molecular mechanisms.

Also flagged:NSCLCcancernon-small cell lung cancermelanomaITRLINC01272
Journal Article 2022-07-04 No Snippets Ma J, Zhang M, Yu J.
Show Full Abstract

<h4>Background</h4>Numerous studies have reported that long non-coding RNAs (lncRNAs) play important roles in immune-related pathways in cancer. However, immune-related lncRNAs and their roles in predicting immunotherapeutic response and prognosis of non-small cell lung cancer (NSCLC) patients treated with immunotherapy remain largely unexplored.<h4>Methods</h4>Transcriptomic data from NSCLC patients were used to identify novel lncRNAs by a custom pipeline. ImmuCellAI was utilized to calculate the infiltration score of immune cells. The marker genes of immunotherapeutic response-related (ITR)-immune cells were used to identify immune-related (IR)-lncRNAs. A co-expression network was constructed to determine their functions. LASSO and multivariate Cox analyses were performed on the training set to construct an immunotherapeutic response and immune-related (ITIR)-lncRNA signature for predicting the immunotherapeutic response and prognosis of NSCLC. Four independent datasets involving NSCLC and melanoma patients were used to validate the ITIR-lncRNA signature.<h4>Results</h4>In total, 7,693 novel lncRNAs were identified for NSCLC. By comparing responders with non-responders, 154 ITR-lncRNAs were identified. Based on the correlation between the marker genes of ITR-immune cells and lncRNAs, 39 ITIR-lncRNAs were identified. A co-expression network was constructed and the potential functions of 38 ITIR-lncRNAs were annotated, most of which were related to immune/inflammatory-related pathways. Single-cell RNA-seq analysis was performed to confirm the functional prediction results of an ITIR-lncRNA, LINC01272. Four-ITIR-lncRNA signature was identified and verified for predicting the immunotherapeutic response and prognosis of NSCLC. Compared with non-responders, responders had a lower risk score in both NSCLC datasets (P<0.05). NSCLC patients in the high-risk group had significantly shorter PFS/OS time than those in the low-risk group in the training and testing sets (P<0.05). The AUC value was 1 of responsiveness in the training set. In melanoma validation datasets, patients in the high-risk group also had significantly shorter OS/PFS time than those in the low-risk group (P<0.05). The ITIR-lncRNA signature was an independent prognostic factor (P<0.001).<h4>Conclusion</h4>Thousands of novel lncRNAs in NSCLC were identified and characterized. In total, 39 ITIR-lncRNAs were identified, 38 of which were functionally annotated. Four ITIR-lncRNAs were identified as a novel ITIR-lncRNA signature for predicting the immunotherapeutic response and prognosis in NSCLC patients treated with immunotherapy.

Also flagged:PI3KAKTrectal cancercancerCas9mTOR
Journal Article 2022-07-04 ✓ 4 Snippets Wanigasooriya K, Barros-Silva JD, Tee L, El-Asrag ME, Stodolna A, Pickles OJ, Stockton J, Bryer C, Hoare R, Whalley CM, Tyler R, Sillo T, Yau C, Ismail T, Beggs AD.
In-Text Gene Mentions

The first consisted of CEACAM5 and CEACAM6 expressing tumour cells, colonic stem cells with high expression of OLFM4 and HIST1H4C (Figure 4C).

…PLK2 , whereasOLFM4, SLC39A5, ABCB1 ,…

…high expression ofOLFM4and HIST1H4C (…

…the dependence receptorsDCCand UNC5H (…

Show Full Abstract

<h4>Objectives</h4>Partial or total resistance to preoperative chemoradiotherapy occurs in more than half of locally advanced rectal cancer patients. Several novel or repurposed drugs have been trialled to improve cancer cell sensitivity to radiotherapy, with limited success. We aimed to understand the mechanisms of resistance to chemoradiotherapy in rectal cancer using patient derived organoid models.<h4>Design</h4>To understand the mechanisms underlying this resistance, we compared the pre-treatment transcriptomes of patient-derived organoids (PDO) with measured radiotherapy sensitivity to identify biological pathways involved in radiation resistance coupled with single cell sequencing, genome wide CRISPR-Cas9 and targeted drug screens.<h4>Results</h4>RNA sequencing enrichment analysis revealed upregulation of PI3K/AKT/mTOR and epithelial mesenchymal transition pathway genes in radioresistant PDOs. Single-cell sequencing of pre & post-irradiation PDOs showed mTORC1 and PI3K/AKT upregulation, which was confirmed by a genome-wide CRSIPR-Cas9 knockout screen using irradiated colorectal cancer (CRC) cell lines. We then tested the efficiency of dual PI3K/mTOR inhibitors in improving cancer cell sensitivity to radiotherapy. After irradiation, significant AKT phosphorylation was detected (<i>p</i>=0.027) which was abrogated with dual PI3K/mTOR inhibitors and lead to significant radiosensitisation of the HCT116 cell line and radiation resistant PDO lines.<h4>Conclusions</h4>The PI3K/AKT/mTOR pathway upregulation contributes to radioresistance and its targeted pharmacological inhibition leads to significant radiosensitisation in CRC organoids, making it a potential target for clinical trials.

Also flagged:NAAAMAN2B1RPH3ALMAP2K3LILRB3CTD
Journal Article 2022-07-04 ✓ 2 Snippets Zhang Q, Huang H, Zhang M, Fang C, Wang N, Jing X, Guo J, Sun W, Yang X, Xu Z.
In-Text Gene Mentions

CSE1L

…HSPA8, CAND1, RPA1,STAU1, ATAD3A, PABPC1, and…

Show Full Abstract

<h4>Background</h4>Sarcoidosis is an inflammatory disease characterized by non-caseating granuloma formation in various organs, with several recognized genetic and environmental risk factors. Despite substantial progress, the genetic determinants associated with its prognosis remain largely unknown.<h4>Objectives</h4>This study aimed to identify the genetic changes involved in sarcoidosis and evaluate their clinical relevance.<h4>Methods</h4>We performed whole-exome sequencing (WES) in 116 sporadic sarcoidosis patients (acute sarcoidosis patients, n=58; chronic sarcoidosis patients, n=58). In addition, 208 healthy controls were selected from 1000 G East Asian population data. To identify genes enriched in sarcoidosis, Fisher exact tests were performed. The identified genes were included for further pathway analysis using Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG). Additionally, we used the STRING database to construct a protein network of rare variants and Cytoscape to identify hub genes of signaling pathways.<h4>Results</h4>WES and Fisher's exact test identified 1,311 variants in 439 protein-coding genes. A total of 135 single nucleotide polymorphisms (SNPs) on 30 protein-coding genes involved in the immunological process based on the GO and KEGG enrichment analysis. Pathway enrichment analysis showed osteoclast differentiation and cytokine-cytokine receptor interactions. Three missense mutations (rs76740888, rs149664918, and rs78251590) in two genes (PRSS3 and CNN2) of immune-related genes showed significantly different mutation frequencies between the disease group and healthy controls. The correlation of genetic abnormalities with clinical outcomes using multivariate analysis of the clinical features and mutation loci showed that the missense variant (rs76740888, Chr9:33796673 G>A) of PRSS3 [<i>p</i>=0.04, odds ratio (OR) = 2.49] was significantly associated with chronic disease prognosis. Additionally, the top two hub genes were CCL4 and CXCR4 based on protein-protein interaction (PPI) network analysis.<h4>Conclusion</h4>Our study provides new insights into the molecular pathogenesis of sarcoidosis and identifies novel genetic alterations in this disease, especially PRSS3, which may be promising targets for future therapeutic strategies for chronic sarcoidosis.

Also flagged:Neurodegenerative diseasespolysaccharidesautophagymitochondrialPDAD
Journal Article 2022-07-04 ✓ 3 Snippets Wang Y, Chen R, Yang Z, Wen Q, Cao X, Zhao N, Yan J.
In-Text Gene Mentions

Huntington’s disease is a single-gene autosomal dominant neurodegenerative disorder with the disease-causing gene IT-15 (the HTT gene).

HD is characterized by a general shrinkage of the brain and degeneration of the striatum (caudate nucleus and putamen) due to the mutation of Huntingtin (HTT) gene (Jimenez-Sanchez et al., 2017); The symptoms of HD encompasses psychiatric conditions, cognitive defects, motor impairment (e.g., chorea; Huang et al., 2016).

…of Huntingtin (HTT) gene (…

Show Full Abstract

Neurodegenerative diseases (NDs) are characterized by progressive degeneration and necrosis of neurons, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease and others. There are no existing therapies that correct the progression of these diseases, and current therapies provide merely symptomatic relief. The use of polysaccharides has received significant attention due to extensive biological activities and application prospects. Previous studies suggest that the polysaccharides as a candidate participate in neuronal protection and protect against NDs. In this review, we demonstrate that various polysaccharides mediate NDs, and share several common mechanisms characterized by autophagy, apoptosis, neuroinflammation, oxidative stress, mitochondrial dysfunction in PD and AD. Furthermore, this review reveals potential role of polysaccharides <i>in vitro</i> and <i>in vivo</i> models of NDs, and highlights the contributions of polysaccharides and prospects of their mechanism studies for the treatment of NDs. Finally, we suggest some remaining questions for the field and areas for new development.

Also flagged:Neurodegenerative DiseasesprionALScytoplasmicnucleocytoplasmicageing
Journal Article 2022-07-04 ✓ 5 Snippets Girdhar A, Guo L.
In-Text Gene Mentions

The mislocalization of NCT factors, such as Gle1 and RanGAP1, has been observed in the presence of polyQ-Htt aggregates in mouse models and in HD patients, resulting in a disturbed Ran gradient [255].

Huntington’s disease (HD) is a rare, inherited, and progressive neurodegenerative disease caused by CAG-repeat expansion in exon 1 of the huntingtin gene, leading to the expression of mutant huntingtin (Htt) protein with expanded polyglutamine (polyQ) repeat [238,239].

One study revealed the interaction of Nup62 and RanGAP1 with intranuclear polyQ-Htt inclusions across different models, such as transgenic mouse, drosophila, primary neurons, HD patient-derived iPSC neurons, and post-mortem human HD brain regions [245].

Thus, mutant Htt-mediated NCT defects are a common phenotype in HD.

In mouse and cell models of HD, perinuclear inclusions of mutant Htt disrupt the nuclear membrane, causing cell-cycle re-entry and striatal cell death [162].

Show Full Abstract

RNA-binding proteins (RBPs) with a low-complexity prion-like domain (PLD) can undergo aberrant phase transitions and have been implicated in neurodegenerative diseases such as ALS and FTD. Several nuclear RBPs mislocalize to cytoplasmic inclusions in disease conditions. Impairment in nucleocytoplasmic transport is another major event observed in ageing and in neurodegenerative disorders. Nuclear import receptors (NIRs) regulate the nucleocytoplasmic transport of different RBPs bearing a nuclear localization signal by restoring their nuclear localization. NIRs can also specifically dissolve or prevent the aggregation and liquid-liquid phase separation of wild-type or disease-linked mutant RBPs, due to their chaperoning activity. This review focuses on the LLPS of intrinsically disordered proteins and the role of NIRs in regulating LLPS in neurodegeneration. This review also discusses the implication of NIRs as therapeutic agents in neurogenerative diseases.

Also flagged:Follicle-Stimulating HormoneN-glycosylationfollicle- stimulating hormoneFshbGFPprogesterone
Journal Article 2022-07-04 ✓ 3 Snippets McDonald R, Eudy J, Southekal S, Gadu B, Kumar T.
In-Text Gene Mentions

…(Man2a1, Man1c1, andB4galt5.),…

…Man2a1, Man1c1, andB4galt5.…

…13 months, whereB4galt5, Man1a2, Mgat5, and…

Show Full Abstract

OBJECTIVES/GOALS: Age-specific N-glycosylation occurs on follicle- stimulating hormone (FSH) in pituitaries of post-menopausal women and results in a higher ratio of fully glycosylated to hypoglycosylated FSH. Our goal is to identify in vivo the N-glycosylation pathway enzymes and the regulatory mechanisms in gonadotropes of young and old female mice. METHODS/STUDY POPULATION: Pituitaries were isolated from female mice (at 4m and 8m; n=5 per group) carrying an Fshb-Cre transgene on a Rosa mT/mG genetic background and the GFP-tagged gonadotropes were purified by FACS. RNA-Seq analysis, and subsequent qPCR assays were performed on GFP+ cells from pituitaries of female mice at 4m (reproductively young), 8m (reproductively mid age) and ≥ 12m (reproductively old) of age. To identify the role of progesterone signaling in age-dependent N-glycosylation in gonadotropes, a gonadotrope-specific knockout of Pgr was achieved. Gonadotropes from these mutant mice at 4-, 8-, and ≥12 months of age (n=5 per group) were isolated for qPCR analysis of N-glycosylation enzyme gene expression. Predicted progesterone receptor (PR) promoter binding sequences was performed using JASPAR. RESULTS/ANTICIPATED RESULTS: RNA-seq identified 28 differentially expressed N-glycosylation enzyme-encoding mRNAs in gonadotropes of female mice at 4- and 8-months. Three genes showed significant differences between ages (Man2a1, Man1c1, and B4galt5.), and further qPCR analyses revealed six out of eight genes analyzed showed age-dependent expression, including Man2a1, Man1c1, and B4galt5. The promoters of all N-glycosylation enzyme genes showed strong predicted binding sequences for PR. Further qPCR analysis showed age-and genotype-dependent differences in N-glycosylation enzyme expression in Pgr cKO females, with the most striking differences observed at 13 months, where B4galt5, Man1a2, Mgat5, and Man2a1 were downregulated in Pgr cKO gonadotropes compared to controls. DISCUSSION/SIGNIFICANCE: We identified changes in the N-glycosylation machinery in female mouse gonadotropes and confirmed the age- and Pr-dependent regulation of the corresponding mRNAs. Our results provide insights into the mechanisms at the level of the pituitary by which old age-specific FSH glycoform regulates osteoporosis and weight gain in post-menopausal women.

Also flagged:spermine oxidasesynthesisSMOXbindingtranslational
Journal Article 2022-07-04 No Snippets Furbish A, Burger P, Peterson Y, Woster P.
Show Full Abstract

OBJECTIVES/GOALS: The goal of this project was to conduct a preliminary assessment of in vivo feasibility early on in the drug-discovery process in an effort to expedite the translation of novel drug scaffolds to potential clinical candidates. The data gathered in this study will be used to direct analog synthesis of our current lead compounds through rational drug design. METHODS/STUDY POPULATION: Based on virtual and physical high-throughput screening efforts and subsequent similarity searching, we identified a set of potent and selective spermine oxidase (SMOX) inhibitors adhering to a common structural scaffold. In order to address potential barriers to in vivo use, we then conducted a robust optimization analysis in an effort to identify analogs with improved drug-like characteristics. Docking simulations to predict binding were performed and visualized using molecular modeling software (MOE and PyMol). ADMET properties were calculated using a variety of software resources including SwissADME and CDD Vault. RESULTS/ANTICIPATED RESULTS: Through these optimization efforts, we were able to successfully identify analogs with improved drug-like characteristics, including increases in predicted CNS penetration, isosteric replacement of metabolically labile functional groups, increased lipophilicity, and elimination of structural attributes suggestive of off-target activity. Analogs were ranked according to predicted binding and properties of in vivo feasibility. Compounds achieving the highest scores were then selected as scaffolds to guide analog synthesis. DISCUSSION/SIGNIFICANCE: Despite evidence implicating induction of SMOX as a mechanism contributing to neuronal pathology, the lack of potent and selective inhibitors with profiles conducive for in vivo use has significantly impeded clinical investigation of this target. In this presentation, rational drug design focusing on translational optimization will be discussed.

bioRxiv 2022-07-04 Preprint (No Snippets API) Mora A, Schmidt C, Balderson B, Frezza C, Bodén M.
Show Full Abstract

Clear cell renal cell carcinoma (ccRCC) tumours develop and progress via complex remodelling of the kidney epigenome, transcriptome, proteome, and metabolome. Given the subsequent tumour and inter-patient heterogeneity, drug-based treatments report limited success, calling for multi-omics studies to extract regulatory relationships, and ultimately, to develop targeted therapies. However, current methods are unable to extract nonlinear multi-omics perturbations. Here, we present SiRCle ( Si gnature Re gulatory Cl ust e ring), a novel method to integrate DNA methylation, RNA-seq and proteomics data. Applying SiRCle to a case study of ccRCC, we disentangle the layer (DNA methylation, transcription and/or translation) where dys-regulation first occurs and find the primary biological processes altered. Next, we detect regulatory differences between patient subsets by using a variational autoencoder to integrate omics’ data followed by statistical comparisons on the integrated space. In ccRCC patients, SiRCle allows to identify metabolic enzymes and cell-type-specific markers associated with survival along with the likely molecular driver behind the gene’s perturbations.

Also flagged:GlioblastomaGBMbrain cancertumorIDHastrocytoma
Journal Article 2022-07-03 No Snippets Pandey N, Anastasiadis P, Carney CP, Kanvinde PP, Woodworth GF, Winkles JA, Kim AJ.
Show Full Abstract

Glioblastoma (GBM) is the most common malignant adult brain cancer with no curative treatment strategy. A significant hurdle in GBM treatment is effective therapeutic delivery to the brain-invading tumor cells that remain following surgery within functioning brain regions. Developing therapies that can either directly target these brain-invading tumor cells or act on other cell types and molecular processes supporting tumor cell invasion and recurrence are essential steps in advancing new treatments in the clinic. This review highlights some of the drug delivery strategies and nanotherapeutic technologies that are designed to target brain-invading GBM cells or non-neoplastic, invasion-supporting cells residing within the GBM tumor microenvironment.

Also flagged:Polyglutamine diseasespolyglutamineandrogen receptordeathskeletal muscle atrophymetabolism
Journal Article 2022-07-03 ✓ 3 Snippets Marchioretti C, Zuccaro E, Pandey UB, Rosati J, Basso M, Pennuto M.
In-Text Gene Mentions

Amyotrophic lateral sclerosis (ALS), spinal and bulbar muscular atrophy (SBMA), Huntington’s disease (HD), dentatorubral pallidoluysian atrophy (DRPLA), and spinocerebellar ataxia (SCA), cytosine-adenine-guanine (CAG), androgen receptor (AR), huntingtin (HTT), TATA-box binding protein (TBP), induced pluripotent stem cells (iPSCs), mechanistic target of rapamycin (mTOR), transcription factor EB (TFEB), peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), myocyte enhancer factor 2 (MEF2).

…receptor (AR), huntingtin (HTT), atrophin-1, ataxin-1, ataxi…

…receptor (AR), huntingtin (HTT), TATA-box binding protein…

Show Full Abstract

Polyglutamine diseases are characterized by selective dysfunction and degeneration of specific types of neurons in the central nervous system. In addition, nonneuronal cells can also be affected as a consequence of primary degeneration or due to neuronal dysfunction. Skeletal muscle is a primary site of toxicity of polyglutamine-expanded androgen receptor, but it is also affected in other polyglutamine diseases, more likely due to neuronal dysfunction and death. Nonetheless, pathological processes occurring in skeletal muscle atrophy impact the entire body metabolism, thus actively contributing to the inexorable progression towards the late and final stages of disease. Skeletal muscle atrophy is well recapitulated in animal models of polyglutamine disease. In this review, we discuss the impact and relevance of skeletal muscle in patients affected by polyglutamine diseases and we review evidence obtained in animal models and patient-derived cells modeling skeletal muscle.

Also flagged:mineralssilicatefeldsparsaluminosilicatehydratedcalcium
Journal Article 2022-07-03 No Snippets Fares G, Alhozaimy AM.
Show Full Abstract

Two sources of natural scoria rocks were procured and ground for use in concrete as natural pozzolans (NP1 and NP2). The evaluation of their pozzolanic reactivity is carried out using different techniques and approaches. The primary goal of employing these techniques is to monitor the amount of portlandite (CH=Ca(OH)<sub>2</sub>) consumed during steam curing at low or high pressure. The pozzolanicity of NP powders is determined either directly by monitoring CH variation or indirectly by compressive strength and microstructure development. Autoclave curing is known to stimulate the pozzolanicity of the inert siliceous and aluminosiliceous materials under its high-pressure steam conditions. Both steam-curing conditions were applied in this investigation. In this study, X-ray diffraction, scanning electron microscope, thermogravimetric, Fourier transform infrared, and isothermal analyzers were used. It is concluded that the nature and types of minerals in SR determine their pozzolanic reactivity as either low-pressure steam-reactive or high-pressure steam-reactive cementitious materials. Due to the nature of their silicate structures, notably single-chain or 3D-framework structures, plagioclase feldspars (albite-anorthite) minerals are high-pressure steam-reactive minerals, whereas pyroxene (enstatite and diopside) minerals are low-pressure steam-reactive minerals. Using high-pressure steam curing, varied replacement levels of up to 60% were achieved in NP1, with a consistent strength activity index (SAI) of 99%, while an SAI of 79% was obtained with NP2. During low-pressure steam curing, NP1 and NP2 consumed around 72 and 80% of portlandite, respectively, demonstrating their relative pozzolanic reactivity. When compared to the control concrete mix, the strength activity indices of NP1, NP2, and class F fly ash in their normal concrete mixes reached 74.3, 82, and 73.7%, respectively, after 56 days of normal curing conditions.

Also flagged:TumorPaclitaxelsolid tumorCD13 receptorsPeptideLipid
Journal Article 2022-07-03 ✓ 1 Snippet Gupta M, Sharma V, Sharma K, Kumar A, Sharma A, Kazmi I, Al-Abbasi FA, Alzarea SI, Afzal O, Altamimi ASA, Singh SK, Gupta G, Paudel KR, Hansbro PM, Dua K.
In-Text Gene Mentions

kNGR (Asn-Gly-Arg): NGR based peptide ligand, DSPE-PEG: 1, 2-Distearoyl-sn-glycero-3-phosphoethanolamine-Poly(ethylene glycol), PTX: Paclitaxel, PLNs-kNGR-NPs: PLGA–lecithin–PEG core-shell nanoparticles, PLNs: polymer lipid hybrid nanoparticles, PLGA: Poly(lactic-co-glycolic acid), DOX: Doxorubicin, HUVEC: Human endothelial cell line, HT-1080: Human fibrosarcoma cell line, FITC: Fluorescein isothiocyanate, PI: Propidium iodide, MTT: 3-(4,5-dimethyl thiazol-2-yl)-2,5-diphenyltetrazolium bromide, NHS: N-Hydroxysuccinimide, DCC: N, N′-Dicyclohexylcarbodiimide, DMSO: Dimethyl sulfoxide, PCS: Photon correlation spectroscopy, TPVG: Trypsin Phosphate Versene Glucose, % EE: Percentage entrapment efficiency, FBS: Fetal bovine serum, BSA: Bovine Serum Albumin, PS: Paclitaxel based drug solution, % VI: Percentage volume growth percentage inhibition, %WI: Percentage tumor weight growth percentage inhibition etc.

Show Full Abstract

The present study aims to design, develop and characterize kNGR (Asn-Gly-Arg) peptide-conjugated lipid-polymer-based nanoparticles for the target-specific delivery of anticancer bioactive(s), i.e., Paclitaxel (PTX). The kNGR-PEG-DSPE conjugate was synthesized and characterized by using spectral analysis. The dual-targeted PLGA-lecithin-PEG core-shell nanoparticles (PLNs-kNGR-NPs) were synthesized using a modified nanoprecipitation process, and their physiological properties were determined. The results support that, compared to other NPs, PLNs-kNGR-NPs are highly cytotoxic, owing to higher apoptosis and intracellular uptake. The significance of rational nanoparticle design for synergistic treatment is shown by the higher tumor volume inhibition percentage rate (59.7%), compared to other designed formulations in Balb/c mice in the HT-1080 tumor-induced model. The overall results indicate that the PLNs-kNGR-NPs-based hybrid lipid-polymer nanoparticles present the highest therapeutic efficacy against solid tumor overexpressing the CD13 receptors.

Also flagged:Adhesion moleculeAmigo2axonsmembrane adhesion moleculeimmunoglobulinolfaction
Journal Article 2022-07-02 ✓ 4 Snippets Company V, Murcia-Ramón R, Andreu-Cervera A, Aracil-Pastor P, Almagro-García F, Martínez S, Echevarría D, Puelles E.
In-Text Gene Mentions

…colon carcinoma (DCC), and also…

…the presence ofDCC, the receptor of…

…, 40 NoDCCpositive axons defasciculated…

…molecules such asDCC, Robo or Ephrins…

Show Full Abstract

<h4>Background</h4>The fasciculus retroflexus is the prominent efferent pathway from the habenular complex. Medial habenular axons form a core packet whereas lateral habenular axons course in a surrounding shell. Both groups of fibers share the same initial pathway but differ in the final segment of the tract, supposedly regulated by surface molecules. The gene Amigo2 codes for a membrane adhesion molecule with an immunoglobulin-like domain 2 and is selectively expressed in the medial habenula. We present it as a candidate for controlling the fasciculation behavior of medial habenula axons.<h4>Results</h4>First, we studied the development of the habenular efferents in an Amigo2 lack of function mouse model. The fasciculus retroflexus showed a variable defasciculation phenotype. Gain of function experiments allowed us to generate a more condensed tract and rescued the Amigo2 knock-out phenotype. Changes in Amigo2 function did not alter the course of habenular fibers.<h4>Conclusion</h4>We have demonstrated that Amigo2 plays a subtle role in the fasciculation of the fasciculus retroflexus.

Also flagged:Type 2 diabetes mellituschronic metabolic diseaseinsulinretinopathynephropathyneuropathy
Journal Article 2022-07-02 ✓ 5 Snippets Dai Y, Ma X, Zhang J, Yu S, Zhu Y, Wang J.
In-Text Gene Mentions

Next, actinomycin D assays revealed a half‐life of hsa_circ_0115355 transcripts exceeding 24 h, indicating greater stability of this molecule than linear CSE1L mRNA transcripts in INS‐1 cells (Figure 1D).

(D)The expression of hsa_circ_0115355 and CSE1L mRNA expression after actinomycin D treatment.

…of hsa_circ_0115355 andCSE1Lby qRT‐PCR, β‐actin…

…R could degradeCSE1LmRNA (Figure 1C…

…molecule than linearCSE1LmRNA transcripts in…

Show Full Abstract

<h4>Background</h4>Type 2 diabetes mellitus (T2DM) is a complex metabolic disease closely related to obesity, a growing global health problem. T2DM is characterized by decreased islet beta-cell mass and impaired insulin release from these cells, and this dysfunction is exacerbated by hyperglycemia (glucolipotoxicity). Circular RNAs (circRNAs) are abnormally expressed and play a regulatory role in T2DM.<h4>Objective</h4>This study aimed to evaluate the function and molecular mechanism of hsa_circ_0115355 in the progression of T2DM.<h4>Methods</h4>The regulatory effect of hsa_circ_0115355 on INS-1 cell function was assessed under glucolipotoxicity by MTT, flow cytometry analysis, and insulin secretion assay. Dual-luciferase experiments revealed a direct interaction of hsa_circ_0115355 with miR-145 and miR-145 with SIRT1. Furthermore, the regulatory role of the hsa_circ_0115355/miR-145/SIRT1 axis was verified by examining the function of INS-1.<h4>Results</h4>In this study, hsa_circ_0115355 was significantly underexpressed in both patients with T2DM and INS-1 cell lines. This study thus showed that hsa_circ_0115355 inhibits the occurrence and development of T2DM by regulating the expression of SIRT1 by adsorbing miR-145.<h4>Conclusion</h4>The underexpression hsa_circ_0115355 is also a potential novel diagnostic marker and therapeutic target for T2DM.

Also flagged:actinbase excision repair8-Oxoguanine DNA glycosylaseprotein 5transferase complexMembrane invagination
Journal Article 2022-07-02 ✓ 5 Snippets Ekuban A, Shichino S, Zong C, Ekuban FA, Kinoshita K, Ichihara S, Matsushima K, Ichihara G.
In-Text Gene Mentions

HTT

More specifically, low expression of TNFSF4 mRNA was associated with worse prognosis in melanoma patients71.

…included cytokines (TNFSF4, TNFAIP8L1, TNFAIP8L2-SCNM1 a…

…(TNFRSF) such asTNFSF4, and TNFRSF10A…

…low expression ofTNFSF4mRNA was associated…

Show Full Abstract

1,2-Dichloropropane (1,2-DCP), a synthetic organic solvent, has been implicated in causality of cholangiocarcinoma (bile duct cancer). 1,2-DCP-induced occupational cholangiocarcinoma show a different carcinogenic process compared to common cholangiocarcinoma, but its mechanism remains elusive. We reported previously that exposure of MMNK-1 cholangiocytes co-cultured with THP-1 macrophages, but not monocultured MMNK-1 cholangiocytes, to 1,2-DCP induced activation-induced cytidine deaminase (AID) expression, DNA damage and ROS production. The aim of this study was to identify relevant biological processes or target genes expressed in response to 1,2-DCP, using an in vitro system where cholangiocytes are co-cultured with macrophages. The co-cultured cells were exposed to 1,2-DCP at 0, 0.1 or 0.4 mM for 24 h, and then the cell lysates were assessed by transcriptome analysis. 1,2-DCP upregulated the expression of base excision repair genes in MMNK-1 cholangiocytes in the co-cultures, whereas it upregulated the expression of cell cycle-related genes in THP-1 macrophages. Activation of the base excision repair pathway might result from the previously observed DNA damage in MMNK-1 cholangiocytes co-cultured with THP-1 macrophages, although involvement of other mechanisms such as DNA replication, cell death or other types of DNA repair was not disproved. Cross talk interactions between cholangiocytes and macrophages leading to DNA damage in the cholangiocytes should be explored.

Also flagged:PIK3CAcanceracetylsalicylic acidaspirincolorectal cancerClass IA Phosphatidylinositol 3-kinases
Journal Article 2022-07-02 No Snippets Hall DCN, Benndorf RA.
Show Full Abstract

PIK3CA mutations are amongst the most prevalent somatic mutations in cancer and are associated with resistance to first-line treatment along with low survival rates in a variety of malignancies. There is evidence that patients carrying PIK3CA mutations may benefit from treatment with acetylsalicylic acid, commonly known as aspirin, particularly in the setting of colorectal cancer. In this regard, it has been clarified that Class IA Phosphatidylinositol 3-kinases (PI3K), whose catalytic subunit p110α is encoded by the PIK3CA gene, are involved in signal transduction that regulates cell cycle, cell growth, and metabolism and, if disturbed, induces carcinogenic effects. Although PI3K is associated with pro-inflammatory cyclooxygenase-2 (COX-2) expression and signaling, and COX-2 is among the best-studied targets of aspirin, the mechanisms behind this clinically relevant phenomenon are still unclear. Indeed, there is further evidence that the protective, anti-carcinogenic effect of aspirin in this setting may be mediated in a COX-independent manner. However, until now the understanding of aspirin's prostaglandin-independent mode of action is poor. This review will provide an overview of the current literature on this topic and aims to analyze possible mechanisms and targets behind the aspirin sensitivity of PIK3CA-mutated cancers.

Also flagged:early endosomecell surfaceMAP1LC3Bclathrin-mediated endocytosisOPTNCALCOCO2
Journal Article 2022-07-02 ✓ 1 Snippet Coelho PP, Hesketh GG, Pedersen A, Kuzmin E, Fortier AN, Bell ES, Ratcliffe CDH, Gingras AC, Park M.
In-Text Gene Mentions

…G8-proteins (p62/SQSTM1, NBR1,CCPG1, RETREG1/FAM134B) 26 (Fig.…

Show Full Abstract

Autophagy selectively targets cargo for degradation, yet mechanistic understanding remains incomplete. The ATG8-family plays key roles in autophagic cargo recruitment. Here by mapping the proximal interactome of ATG8-paralogs, LC3B and LC3C, we uncover a LC3C-Endocytic-Associated-Pathway (LEAP) that selectively recruits plasma-membrane (PM) cargo to autophagosomes. We show that LC3C localizes to peripheral endosomes and engages proteins that traffic between PM, endosomes and autophagosomes, including the SNARE-VAMP3 and ATG9, a transmembrane protein essential for autophagy. We establish that endocytic LC3C binds cargo internalized from the PM, including the Met receptor tyrosine kinase and transferrin receptor, and is necessary for their recruitment into ATG9 vesicles targeted to sites of autophagosome initiation. Structure-function analysis identified that LC3C-endocytic localization and engagement with PM-cargo requires the extended carboxy-tail unique to LC3C, the TBK1 kinase, and TBK1-phosphosites on LC3C. These findings identify LEAP as an unexpected LC3C-dependent pathway, providing new understanding of selective coupling of PM signalling with autophagic degradation.

Also flagged:SCA2ATXN2ataxin-2autosomal dominant disorder spinocerebellar ataxia type 2ALSTDP-43
Journal Article 2022-07-02 ✓ 5 Snippets Scoles DR, Gandelman M, Paul S, Dexheimer T, Dansithong W, Figueroa KP, Pflieger LT, Redlin S, Kales SC, Sun H, Maloney D, Damoiseaux R, Henderson MJ, Simeonov A, Jadhav A, Pulst SM.
In-Text Gene Mentions

Moreover, we observed elevated STAU1 and hyperactive mTOR signaling with elevated LC3-II in TDP-43 ALS patient fibroblasts and spinal cords of TDP-43 mice, which was restored when mice were haploinsufficient for STAU1 (13).

We have shown that the SG protein STAU1 becomes highly (up to sixfold) elevated in SCA2 and ALS models (12).

This was attributed to increased mTOR mRNA translation mediated by direct mRNA interaction by the stress-related protein STAU1, which was also highly elevated in these SCA2 cells and models (12, 13).

We found that STAU1 and molecular target of rapamycin (mTOR) are both overabundant in SCA2 and ALS patient fibroblasts and mouse models associated with abnormal autophagy, which can be rescued by RNAi targeting STAU1, ATXN2, or MTOR (13).

Collectively, these data support that lowering ATXN2 expression can restore abnormal STAU1, autophagy, and UPR signaling associated with disease in SCA2 and ALS.

Show Full Abstract

CAG repeat expansions in the ATXN2 (ataxin-2) gene can cause the autosomal dominant disorder spinocerebellar ataxia type 2 (SCA2) as well as increase the risk of ALS. Abnormal molecular, motor, and neurophysiological phenotypes in SCA2 mouse models are normalized by lowering ATXN2 transcription, and reduction of nonmutant Atxn2 expression has been shown to increase the life span of mice overexpressing the TDP-43 (transactive response DNA-binding protein 43 kDa) ALS protein, demonstrating the potential benefits of targeting ATXN2 transcription in humans. Here, we describe a quantitative high-throughput screen to identify compounds that lower ATXN2 transcription. We screened 428,759 compounds in a multiplexed assay using an ATXN2-luciferase reporter in human embryonic kidney 293 (HEK-293) cells and identified a diverse set of compounds capable of lowering ATXN2 transcription. We observed dose-dependent reductions of endogenous ATXN2 in HEK-293 cells treated with procillaridin A, 17-dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG), and heat shock protein 990 (HSP990), known inhibitors of HSP90 and Na<sup>+</sup>/K<sup>+</sup>-ATPases. Furthermore, HEK-293 cells expressing polyglutamine-expanded ATXN2-Q58 treated with 17-DMAG had minimally detectable ATXN2, as well as normalized markers of autophagy and endoplasmic reticulum stress, including STAU1 (Staufen 1), molecular target of rapamycin, p62, LC3-II (microtubule-associated protein 1A/1B-light chain 3II), CHOP (C/EBP homologous protein), and phospho-eIF2α (eukaryotic initiation factor 2α). Finally, bacterial artificial chromosome ATXN2-Q22 mice treated with 17-DMAG or HSP990 exhibited highly reduced ATXN2 protein abundance in the cerebellum. Taken together, our study demonstrates inhibition of HSP90 or Na<sup>+</sup>/K<sup>+</sup>-ATPases as potentially effective therapeutic strategies for treating SCA2 and ALS.

Also flagged:BaseCas9cytosine deaminaseHbbcancersickle cell anemia
Journal Article 2022-07-02 ✓ 2 Snippets Zhang G, Zhu C, Chen X, Yan J, Xue D, Wei Z, Chuai G, Liu Q.
In-Text Gene Mentions

Previous studies have shown that many genes related to human diseases are also pleiotropic genes, such as HTT and Hbb. Mutation of the HTT gene can cause Huntington’s disease, while patients can show a notable increase in fecundity and experience lower rates of cancer [15], [16].

…Mutation of theHTTgene can cause…

Show Full Abstract

Base editing technology is being increasingly applied in genome engineering, but the current strategy for designing guide RNAs (gRNAs) relies substantially on empirical experience rather than a dependable and efficient in silico design. Furthermore, the pleiotropic effect of base editing on disease treatment remains unexplored, which prevents its further clinical usage. Here, we presented BExplorer, an integrated and comprehensive computational pipeline to optimize the design of gRNAs for 26 existing types of base editors in silico. Using BExplorer, we described its results for two types of mainstream base editors, BE3 and ABE7.10, and evaluated the pleiotropic effects of the corresponding base editing loci. BExplorer revealed 524 and 900 editable pathogenic single nucleotide polymorphism (SNP) loci in the human genome together with the selected optimized gRNAs for BE3 and ABE7.10, respectively. In addition, the impact of 707 edited pathogenic SNP loci following base editing on 131 diseases was systematically explored by revealing their pleiotropic effects, indicating that base editing should be carefully utilized given the potential pleiotropic effects. Collectively, the systematic exploration of optimized base editing gRNA design and the corresponding pleiotropic effects with BExplorer provides a computational basis for applying base editing in disease treatment.

Also flagged:SARS-CoV-2 infectionpneumoniaacute respiratory distress syndromeARDSpathogenesisrenin
Journal Article 2022-07-02 ✓ 2 Snippets Ciechanowicz AK, Lay WX, Prado Paulino J, Suchocki E, Leszczak S, Leszczak C, Kucia M.
In-Text Gene Mentions

…hanolamine-binding protein 1 (PEBP1), myotrophin (MTPN), keratin,…

…(INAR2), roquin-2 (RC3H2),DCC-interacting protein 13-betaprotein 13-beta (DP13B),…

Show Full Abstract

SARS-CoV-2 infection leads to severe lung damage due to pneumonia and, in more severe cases, leads to acute respiratory distress syndrome, or ARDS. This affects the viability of bronchoalveolar cells. An important role in the pathogenesis of these complications is the hyperactivation of the renin-angiotensin-aldosterone (RAA) pathway and induction of cytokine storm that occurs in an Nlrp3 inflammasome-dependent manner. To shed more light on the susceptibility of lung tissue to SARS-CoV-2 infection, we evaluated murine bronchioalveolar stem cells (BASC), alveolar type II cells (AT2), and 3D-derived organoids expression of mRNA encoding genes involved in virus entry into cells, components of RAA, and genes that comprise elements of the Nlrp3 inflammasome pathway. We noticed that all these genes are expressed by lung alveolar stem cells and organoids-derived from these cells. Interestingly, all these cells express a high level of ACE2 that, on the one hand, serves as an entry receptor for SARS-CoV-2 and, on the other, converts angiotensin II into its physiological antagonist, angiotensin 1-7 (Ang 1-7), which has been reported to have a protective role in lung damage. To shed more light on the role of Ang 1-7 on lung tissue, we exposed lung-derived BASC and AT2 cells to this mediator of RAA and noticed that it increases the proliferation of these cells. Based on this, Ang 1-7 could be employed to alleviate the damage to lung alveolar stem/progenitor cells during SARS-CoV-2 infection.

Also flagged:Malonamideatrial fibrillationglycinamidebenzamidinearylthrombin
Journal Article 2022-07-02 No Snippets Purgatorio R, Gambacorta N, Samarelli F, Lopopolo G, de Candia M, Catto M, Nicolotti O, Altomare CD.
Show Full Abstract

The rational discovery of new peptidomimetic inhibitors of the coagulation factor Xa (fXa) could help set more effective therapeutic options (to prevent atrial fibrillation). In this respect, we explored the conformational impact on the enzyme inhibition potency of the malonamide bridge, compared to the glycinamide one, as a linker connecting the P1 benzamidine anchoring moiety to the P4 aryl group of novel selective fXa inhibitors. We carried out structure-activity relationship (SAR) studies aimed at investigating <i>para</i>- or <i>meta</i>-benzamidine as the P1 basic group as well as diversely decorated aryl moieties as P4 fragments. To this end, twenty-three malonamide derivatives were synthesized and tested as inhibitors of fXa and thrombin (thr); the molecular determinants behind potency and selectivity were also studied by employing molecular docking. The malonamide linker, compared to the glycinamide one, does significantly increase anti-fXa potency and selectivity. The <i>meta</i>-benzamidine (P1) derivatives bearing 2',4'-difluoro-biphenyl as the P4 moiety proved to be highly potent reversible fXa-selective inhibitors, achieving inhibition constants (<i>K</i><sub>i</sub>) in the low nanomolar range. The most active compounds were also tested against cholinesterase (ChE) isoforms (acetyl- or butyrylcholinesterase, AChE, and BChE), and some of them returned single-digit micromolar inhibition potency against AChE and/or BChE, both being drug targets for symptomatic treatment of mild-to-moderate Alzheimer's disease. Compounds <b>19h</b> and <b>22b</b> were selected as selective fXa inhibitors with potential as multimodal neuroprotective agents.

Also flagged:Aminoacyl-tRNA SynthetaseCancerAminoacyl-tRNA synthetasesamino acidsprotein synthesiscytoplasmic
Journal Article 2022-07-02 ✓ 1 Snippet Sangha AK, Kantidakis T.
In-Text Gene Mentions

…mitochondria (AARS2, CARS2,DARS2, EARS2, FARS2, HARS2,…

Show Full Abstract

Aminoacyl-tRNA synthetases (ARSs) are essential enzymes that load amino acids to their cognate tRNA molecules. The expression of certain ARSs and tRNAs has been shown to be deregulated in cancer, presumably to accommodate elevated protein synthesis requirements. In this work, the expression of cytoplasmic ARSs and tRNAs in ten TCGA cancers has been systematically examined. ARSs were found to be mostly upregulated in tumours and their upregulation often correlated with worse patient survival. tRNAs were found to be either upregulated or downregulated in tumours and their expression sometimes correlated to worse survival outcomes. However, although the expression of most ARSs and tRNAs was deregulated in tumours when compared to healthy adjacent tissues, only in a few cases, and independently, did it correlate to patient survival. These data point to the general uncoupling of concomitant ARS and tRNA expression deregulation and patient survival, highlighting the different ARS and tRNA requirements in cancers.

Also flagged:reverse transcriptionCRISPRclustered regularly interspaced short palindromic repeatsCRISPR-associated proteinCasCas13
Journal Article 2022-07-02 ✓ 1 Snippet Wu L, Wang X, Wu C, Cao X, Tang T, Huang H, Huang X.
In-Text Gene Mentions

…cluding SARS-CoV-2, hCov-HKU1,MERS-uPEand SARS-CoV-1 were…

Show Full Abstract

Early and accurate diagnosis of SARS-CoV-2 was crucial for COVID-19 control and urgently required ultra-sensitive and rapid detection methods. CRISPR-based detection systems have great potential for rapid SARS-CoV-2 detection, but detecting ultra-low viral loads remains technically challenging. Here, we report an ultrasensitive CRISPR/Cas12a-based electrochemical detection system with an electrochemical biosensor, dubbed CRISPR-SPCE, in which the CRISPR ssDNA reporter was immobilized onto a screen-printed carbon electrode. Electrochemical signals are detected due to CRISPR cleavage, giving enhanced detection sensitivity. CRISPR-SPCE enables ultrasensitive SARS-CoV-2 detection, reaching as few as 0.27 copies μL<sup>-1</sup>. Moreover, CRISPR-SPCE is also highly specific and inexpensive, providing a fast and simple SARS-CoV-2 assay.

Also flagged:segmentationopsincancer
Journal Article 2022-07-01 No Snippets Guo Y, Krupa O, Stein J, Wu G, Krishnamurthy A.
Show Full Abstract

Image-based cell counting is a fundamental yet challenging task with wide applications in biological research. In this paper, we propose a novel unified deep network framework designed to solve this problem for various cell types in both 2D and 3D images. Specifically, we first propose SAU-Net for cell counting by extending the segmentation network U-Net with a Self-Attention module. Second, we design an extension of Batch Normalization (BN) to facilitate the training process for small datasets. In addition, a new 3D benchmark dataset based on the existing mouse blastocyst (MBC) dataset is developed and released to the community. Our SAU-Net achieves state-of-the-art results on four benchmark 2D datasets - synthetic fluorescence microscopy (VGG) dataset, Modified Bone Marrow (MBM) dataset, human subcutaneous adipose tissue (ADI) dataset, and Dublin Cell Counting (DCC) dataset, and the new 3D dataset, MBC. The BN extension is validated using extensive experiments on the 2D datasets, since GPU memory constraints preclude use of 3D datasets. The source code is available at https://github.com/mzlr/sau-net.

Also flagged:HLA-DQA1HLANeuromyelitis Optica Spectrum DisorderHLA-DQ alpha 1inflammatory demyelinating disease of thenervous system
Journal Article 2022-07-01 ✓ 2 Snippets Zhou L, He Z, Zhu L, Zhu JJ, Zhu JH, Pan J.
In-Text Gene Mentions

…, interleukin-17, andTNFSF4as susceptibility genes…

…, HLA-DPB ,TNFSF4, and GTF2I…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies for neuromyelitis optica spectrum disorder (NMOSD) have established an association between HLA-DQ alpha 1 (DQA1) and risk for NMOSD. Though ethnicity is generally considered a major influencing factor in genetic analyses, little is known regarding the association of HLA-DQA1 polymorphisms with NMOSD in the Han population, especially the single-nucleotide polymorphisms (SNPs) at HLA-DQA1 .<h4>Methods</h4>We genotyped SNP at loci rs28383224 in a case-control study consisting of 137 subjects (51 patients with NMOSD and 86 unrelated controls were recruited) of Han ethnicity. Logistic regression was used to test the association of SNP with NMOSD susceptibility, the sex and age were adjusted, odds ratios and 95% confidence intervals were estimated.<h4>Results</h4>The rs28383224 polymorphism and susceptibility to NMOSD were not statistically associated ( P >0.05) in the Han population in the current study. No significant difference was found in allelic frequencies or genotypic distributions among different subsets of NMOSD patients ( P >0.05).<h4>Conclusion</h4>In the current study, there is no evidence that polymorphism of rs28383224 in the HLA-DQA1 gene is associated with the risk of NMOSD in the Han Chinese population.

Also flagged:glioblastomaspleiotrophinglioblastomatumortumorsangiogenesis
Journal Article 2022-07-01 ✓ 5 Snippets Knudsen AM, Halle B, Cédile O, Burton M, Baun C, Thisgaard H, Anand A, Hubert C, Thomassen M, Michaelsen SR, Olsen BB, Dahlrot RH, Bjerkvig R, Lathia JD, Kristensen BW.
In-Text Gene Mentions

Interestingly, these findings could be validated in early recurrent patient GBMs, which had significantly higher fractions of SOX2+ cells (45.3% vs 22.9%, P = .002, Figure 3E), OLIG2+ cells (27.9% vs 18.1%, P = .03, Figure 3F), POU3F2+ cells (43.8% vs 24.8%, P = .03, Figure 3G), and Notch1+ staining area (34.7% vs 9.8%, P = .004, Supplementary Figure 3B) compared to the patient-matched primary tumors.

Interestingly, SOX2, POU3F2, and OLIG2, which were all upregulated in recurrent GBMs, have, along with SALL2, been described as essential neurodevelopmental transcription factors, which drive GSC propagation.24 It has been proposed that a subset of GSCs are in a plastic cellular state associated with an inflammatory wound response,28 and our demonstration of a shift from mesenchymal to proneural subtype fits with this hypothesis.

Expression changes of selected genes SOX2, POU3F2, OLIG2, and NOTCH1 were validated at the protein level in xenografts and early recurrent patient tumors.

Functional investigations in vitro confirmed that exogenous PTN could re-induce expression of SOX2, POU3F2, and to a lesser extent OLIG2 in tumor cells after culturing in the absence of growth factors EGF and FGF (Figure 5J).

…genes SOX2 ,POU3F2, OLIG2 ,…

Show Full Abstract

<h4>Background</h4>Glioblastomas are highly resistant to therapy, and virtually all patients experience tumor recurrence after standard-of-care treatment. Surgical tumor resection is a cornerstone in glioblastoma therapy, but its impact on cellular phenotypes in the local postsurgical microenvironment has yet to be fully elucidated.<h4>Methods</h4>We developed a preclinical orthotopic xenograft tumor resection model in rats with integrated 18F-FET PET/CT imaging. Primary and recurrent tumors were subject to bulk and single-cell RNA sequencing. Differentially expressed genes and pathways were investigated and validated using tissue specimens from the xenograft model, 23 patients with matched primary/recurrent tumors, and a cohort including 190 glioblastoma patients. Functional investigations were performed in vitro with multiple patient-derived cell cultures.<h4>Results</h4>Tumor resection induced microglia/macrophage infiltration, angiogenesis as well as proliferation and upregulation of several stem cell-related genes in recurrent tumor cells. Expression changes of selected genes SOX2, POU3F2, OLIG2, and NOTCH1 were validated at the protein level in xenografts and early recurrent patient tumors. Single-cell transcriptomics revealed the presence of distinct phenotypic cell clusters in recurrent tumors which deviated from clusters found in primary tumors. Recurrent tumors expressed elevated levels of pleiotrophin (PTN), secreted by both tumor cells and tumor-associated microglia/macrophages. Mechanistically, PTN could induce tumor cell proliferation, self-renewal, and the stem cell program. In glioblastoma patients, high PTN expression was associated with poor overall survival and identified as an independent prognostic factor.<h4>Conclusion</h4>Surgical tumor resection is an iatrogenic driver of PTN-mediated self-renewal in glioblastoma tumor cells that promotes therapeutic resistance and tumor recurrence.

Also flagged:mitochondrialdeathPDE6Brd1metabolismcalcium
Journal Article 2022-07-01 ✓ 1 Snippet Jiang K, Mondal AK, Adlakha YK, Gumerson J, Aponte A, Gieser L, Kim JW, Boleda A, Brooks MJ, Nellissery J, Fox DA, Balaban R, Covian R, Swaroop A.
In-Text Gene Mentions

ECI2

Show Full Abstract

Retinal diseases exhibit extensive genetic heterogeneity and complex etiology with varying onset and severity. Mutations in over 200 genes can lead to photoreceptor dysfunction and/or cell death in retinal neurodegeneration. To deduce molecular pathways that initiate and/or drive cell death, we adopted a temporal multiomics approach and examined molecular and cellular events in newborn and developing photoreceptors before the onset of degeneration in a widely-used Pde6brd1/rd1 (rd1) mouse, a model of autosomal recessive retinitis pigmentosa caused by PDE6B mutations. Transcriptome profiling of neonatal and developing rods from the rd1 retina revealed early downregulation of genes associated with anabolic pathways and energy metabolism. Quantitative proteomics of rd1 retina showed early changes in calcium signaling and oxidative phosphorylation, with specific partial bypass of complex I electron transfer, which precede the onset of cell death. Concurrently, we detected alterations in central carbon metabolism, including dysregulation of components associated with glycolysis, pentose phosphate and purine biosynthesis. Ex vivo assays of oxygen consumption and transmission electron microscopy validated early and progressive mitochondrial stress and abnormalities in mitochondrial structure and function of rd1 rods. These data uncover mitochondrial overactivation and related metabolic alterations as determinants of early pathology and implicate aberrant calcium signaling as an initiator of higher mitochondrial stress. Our studies thus provide a mechanistic framework with mitochondrial damage and metabolic disruptions as early drivers of photoreceptor cell death in retinal degeneration.

Also flagged:CCNA2Fanconi anemiagene expressionBRCA1CCNE1beta-Actin
Journal Article 2022-07-01 ✓ 4 Snippets Gönenc II, Wolff A, Schmidt J, Zibat A, Müller C, Cyganek L, Argyriou L, Räschle M, Yigit G, Wollnik B.
In-Text Gene Mentions

Condensincomplexes are ring-like…

Condensincomplexes I and…

Condensinsare multi-subunit SMC-containi…

Condensincomplexes are essential…

Show Full Abstract

Bloom syndrome (BS) is an autosomal recessive disease clinically characterized by primary microcephaly, growth deficiency, immunodeficiency and predisposition to cancer. It is mainly caused by biallelic loss-of-function mutations in the BLM gene, which encodes the BLM helicase, acting in DNA replication and repair processes. Here, we describe the gene expression profiles of three BS fibroblast cell lines harboring causative, biallelic truncating mutations obtained by single-cell (sc) transcriptome analysis. We compared the scRNA transcription profiles from three BS patient cell lines to two age-matched wild-type controls and observed specific deregulation of gene sets related to the molecular processes characteristically affected in BS, such as mitosis, chromosome segregation, cell cycle regulation and genomic instability. We also found specific upregulation of genes of the Fanconi anemia pathway, in particular FANCM, FANCD2 and FANCI, which encode known interaction partners of BLM. The significant deregulation of genes associated with inherited forms of primary microcephaly observed in our study might explain in part the molecular pathogenesis of microcephaly in BS, one of the main clinical characteristics in patients. Finally, our data provide first evidence of a novel link between BLM dysfunction and transcriptional changes in condensin complex I and II genes. Overall, our study provides novel insights into gene expression profiles in BS on an sc level, linking specific genes and pathways to BLM dysfunction.

Also flagged:holoprosencephalybrain cystHydrocephalusaqueductal stenosisBrain damageChromosome
Journal Article 2022-07-01 ✓ 2 Snippets Yaron Y, Ofen Glassner V, Mory A, Zunz Henig N, Kurolap A, Bar Shira A, Brabbing Goldstein D, Marom D, Ben Sira L, Baris Feldman H, Malinger G, Krajden Haratz K, Reches A.
In-Text Gene Mentions

…a maternally inheritedDCC(OMIM 157600) loss‐of‐function…

…known consequence ofDCCmutations 42 .…

Show Full Abstract

<h4>Objective</h4>Prenatally detected central nervous system (CNS) anomalies present a diagnostic challenge. In this study, we compared the diagnostic yield of exome sequencing (ES) and chromosomal microarray analysis (CMA) in fetuses with a major CNS anomaly.<h4>Methods</h4>This was a retrospective study of 114 cases referred for genetic evaluation following termination of pregnancy (TOP) due to a major CNS anomaly detected on prenatal ultrasound. All fetuses were first analyzed by CMA. All CMA-negative cases were offered ES. CMA-positive cases were reanalyzed using ES to assess its ability to detect copy-number variants (CNVs).<h4>Results</h4>CMA identified a pathogenic or likely pathogenic (P/LP) CNV in 11/114 (10%) cases. Eighty-six CMA-negative cases were analyzed using ES, which detected P/LP sequence variants in 38/86 (44%). Among recurrent cases (i.e. cases with a previously affected pregnancy), the incidence of P/LP sequence variants was non-significantly higher compared with non-recurrent ones (12/19 (63%) vs 26/67 (39%); P = 0.06). Among the 38 cases with an ES diagnosis, 20 (53%) were inherited and carried a significant risk of recurrence. Reanalysis of 10 CMA-positive cases by ES demonstrated that the bioinformatics pipeline used for sequence variant analysis also detected all P/LP CNVs, as well as three previously known non-causative CNVs.<h4>Conclusions</h4>In our study, ES provided a high diagnostic yield (> 50%) in fetuses with severe CNS structural anomalies, which may have been partly due to the highly selected case series that included post-TOP cases from a specialist referral center. These data suggest that ES may be considered as a first-tier test for the prenatal diagnosis of major fetal CNS anomalies, detecting both P/LP sequence variants and CNVs. This is of particular importance given the time constraints of an ongoing pregnancy and the risk of recurrence in future pregnancies. © 2022 The Authors. Ultrasound in Obstetrics & Gynecology published by John Wiley & Sons Ltd on behalf of International Society of Ultrasound in Obstetrics and Gynecology.

Also flagged:Ovarian CancersCIP2ATumoroncoproteintumorsoxygen
Journal Article 2022-07-01 No Snippets Cvrljevic AN, Butt U, Huhtinen K, Grönroos TJ, Böckelman C, Lassus H, Butzow R, Haglund C, Kaipio K, Arsiola T, Laajala TD, Connolly DC, Ristimäki A, Carpen O, Pouwels J, Westermarck J.
Show Full Abstract

Identification of ovarian cancer patient subpopulations with increased sensitivity to targeted therapies could offer significant clinical benefit. We report that 22% of the high-grade ovarian cancer tumors at diagnosis express CIP2A oncoprotein at low levels. Furthermore, regardless of their significantly lower likelihood of disease relapse after standard chemotherapy, a portion of relapsed tumors retain their CIP2A-deficient phenotype. Through a screen for therapeutics that would preferentially kill CIP2A-deficient ovarian cancer cells, we identified reactive oxygen species inducer APR-246, tested previously in ovarian cancer clinical trials. Consistent with CIP2A-deficient ovarian cancer subtype in humans, CIP2A is dispensable for development of MISIIR-Tag-driven mouse ovarian cancer tumors. Nevertheless, CIP2A-null ovarian cancer tumor cells from MISIIR-Tag mice displayed APR-246 hypersensitivity both in vitro and in vivo. Mechanistically, the lack of CIP2A expression hypersensitizes the ovarian cancer cells to APR-246 by inhibition of NF-κB activity. Accordingly, combination of APR-246 and NF-κB inhibitor compounds strongly synergized in killing of CIP2A-positive ovarian cancer cells. Collectively, the results warrant consideration of clinical testing of APR-246 for CIP2A-deficient ovarian cancer tumor subtype patients. Results also reveal CIP2A as a candidate APR-246 combination therapy target for ovarian cancer.

Also flagged:ursodeoxycholic acidhypertransaminasemiaACOX2ACOX3aminotransferaseoxygen
Journal Article 2022-07-01 ✓ 1 Snippet Alonso-Peña M, Espinosa-Escudero R, Herraez E, Briz O, Cagigal ML, Gonzalez-Santiago JM, Ortega-Alonso A, Fernandez-Rodriguez C, Bujanda L, Calvo Sanchez M, D Avola D, Londoño MC, Diago M, Fernandez-Checa JC, Garcia-Ruiz C, Andrade RJ, Lammert F, Prieto J, Crespo J, Juamperez J, Diaz-Gonzalez A, Monte MJ, Marin JJG.
In-Text Gene Mentions

…damage, autoimmune hepatitis,hemochromatosis, Wilson's disease, alpha…

Show Full Abstract

<h4>Background and aims</h4>A variant (p.Arg225Trp) of peroxisomal acyl-CoA oxidase 2 (ACOX2), involved in bile acid (BA) side-chain shortening, has been associated with unexplained persistent hypertransaminasemia and accumulation of C27-BAs, mainly 3α,7α,12α-trihydroxy-5β-cholestanoic acid (THCA). We aimed to investigate the prevalence of ACOX2 deficiency-associated hypertransaminasemia (ADAH), its response to ursodeoxycholic acid (UDCA), elucidate its pathophysiological mechanism and identify other inborn errors that could cause this alteration.<h4>Methods and results</h4>Among 33 patients with unexplained hypertransaminasemia from 11 hospitals and 13 of their relatives, seven individuals with abnormally high C27-BA levels (>50% of total BAs) were identified by high-performance liquid chromatography-mass spectrometry. The p.Arg225Trp variant was found in homozygosity (exon amplification/sequencing) in two patients and three family members. Two additional nonrelated patients were heterozygous carriers of different alleles: c.673C>T (p.Arg225Trp) and c.456_459del (p.Thr154fs). In patients with ADAH, impaired liver expression of ACOX2, but not ACOX3, was found (immunohistochemistry). Treatment with UDCA normalized aminotransferase levels. Incubation of HuH-7 hepatoma cells with THCA, which was efficiently taken up, but not through BA transporters, increased reactive oxygen species production (flow cytometry), endoplasmic reticulum stress biomarkers (GRP78, CHOP, and XBP1-S/XBP1-U ratio), and BAXα expression (reverse transcription followed by quantitative polymerase chain reaction and immunoblot), whereas cell viability was decreased (tetrazolium salt-based cell viability test). THCA-induced cell toxicity was higher than that of major C24-BAs and was not prevented by UDCA. Fourteen predicted ACOX2 variants were generated (site-directed mutagenesis) and expressed in HuH-7 cells. Functional tests to determine their ability to metabolize THCA identified six with the potential to cause ADAH.<h4>Conclusions</h4>Dysfunctional ACOX2 has been found in several patients with unexplained hypertransaminasemia. This condition can be accurately identified by a noninvasive diagnostic strategy based on plasma BA profiling and ACOX2 sequencing. Moreover, UDCA treatment can efficiently attenuate liver damage in these patients.

Also flagged:radiation-meningiomacell cyclepathogenesisRadiationMeningiomas
Journal Article 2022-07-01 ✓ 1 Snippet Pemov A, Kim J, Jones K, Vogt A, Sadetzki S, Stewart DR.
In-Text Gene Mentions

MLLT10

Show Full Abstract

Previous epidemiological studies have demonstrated elevated susceptibility to ionizing radiation in some families, thus suggesting the presence of genetic components that conferred increased rate of radiation-associated meningioma (RAM). In this study, we exome-sequenced and investigated the segregation pattern of rare deleterious variants in 11 RAM pedigrees. In addition, we performed a rare-variant association analysis in 92 unrelated familial cases of RAM that were ancestry-matched with 88 meningioma-free controls. In the pedigree analysis, we found that each family carried mostly a unique set of rare deleterious variants. A follow-up pathway analysis of the union of the genes that segregated within each of the 11 pedigrees identified a single statistically significant (q value = 7.90E-04) "ECM receptor interaction" set. In the case-control association analysis, we observed no statistically significant variants or genes after multiple testing correction; however, examination of ontological categories of the genes that associated with RAM at nominal P values <0.01 identified biologically relevant pathways such as DNA repair, cell cycle and apoptosis. These results suggest that it is unlikely that a small number of highly penetrant genes are involved in the pathogenesis of RAM. Substantially larger studies are needed to identify genetic risk variants and genes in RAM.

Also flagged:GSK3βCRY1Diabetic Hyperglycemiaglucosehyperglycemiadiabetes
Journal Article 2022-07-01 ✓ 1 Snippet Kim YY, Jang H, Lee G, Jeon YG, Sohn JH, Han JS, Lee WT, Park J, Huh JY, Nahmgoong H, Han SM, Kim J, Pak M, Kim S, Kim JS, Kim JB.
In-Text Gene Mentions

…elevated E3 ligaseF-box and leucine-rich repeat protein 3and leucine-rich repeat…

Show Full Abstract

Excessive hepatic glucose production (HGP) is a key factor promoting hyperglycemia in diabetes. Hepatic cryptochrome 1 (CRY1) plays an important role in maintaining glucose homeostasis by suppressing forkhead box O1 (FOXO1)-mediated HGP. Although downregulation of hepatic CRY1 appears to be associated with increased HGP, the mechanism(s) by which hepatic CRY1 dysregulation confers hyperglycemia in subjects with diabetes is largely unknown. In this study, we demonstrate that a reduction in hepatic CRY1 protein is stimulated by elevated E3 ligase F-box and leucine-rich repeat protein 3 (FBXL3)-dependent proteasomal degradation in diabetic mice. In addition, we found that GSK3β-induced CRY1 phosphorylation potentiates FBXL3-dependent CRY1 degradation in the liver. Accordingly, in diabetic mice, GSK3β inhibitors effectively decreased HGP by facilitating the effect of CRY1-mediated FOXO1 degradation on glucose metabolism. Collectively, these data suggest that tight regulation of hepatic CRY1 protein stability is crucial for maintaining systemic glucose homeostasis.

Also flagged:MethylationPituitary AdenomastumorgonadotropinomaNUP93LGALS1
Journal Article 2022-07-01 ✓ 2 Snippets Hallén T, Johannsson G, Dahlén R, Glad CAM, Örndal C, Engvall A, Carén H, Skoglund T, Olsson DS.
In-Text Gene Mentions

…(5′ UTR ofZNF664-FAM101A ), cg01742263 (adjust…

…to the genesZNF664-FAM101A, SLC23A1, and GABRA1…

Show Full Abstract

<h4>Context</h4>Tumor progression in surgically treated patients with nonfunctioning pituitary adenomas (NFPAs) is associated with excess mortality. Reliable biomarkers allowing early identification of tumor progression are missing.<h4>Objective</h4>To explore DNA methylation patterns associated with tumor progression in NFPA patients.<h4>Methods</h4>This case-controlled exploratory trial at a university hospital studied patients who underwent surgery for NFPA that had immunohistochemical characteristics of a gonadotropinoma. Cases included patients requiring reintervention due to tumor progression (reintervention group, n = 26) and controls who had a postoperative residual tumor without tumor progression for at least 5 years (radiologically stable group, n = 17). Genome-wide methylation data from each tumor sample were analyzed using the Infinium MethylationEPIC BeadChip platform.<h4>Results</h4>The analysis showed that 605 CpG positions were significantly differently methylated (differently methylated positions, DMPs) between the patient groups (false discovery rate adjusted P value < 0.05, beta value > 0.2), mapping to 389 genes. The largest number of DMPs were detected in the genes NUP93 and LGALS1. The 3 hypomethylated DMPs and the 3 hypermethylated DMPs with the lowest P values were all significantly (P < 0.05) and individually associated with reintervention-free survival. One of the hypermethylated DMPs with the lowest P value was located in the gene GABRA1.<h4>Conclusion</h4>In this exploratory study, DNA methylation patterns in NFPA patients were associated with postoperative tumor progression requiring reintervention. The DMPs included genes that have been previously associated with tumor development. Our study is a step toward finding epigenetic signatures to predict tumor progression in patients with NFPA.

Also flagged:thrombophiliaAntithrombin deficiencycongenital thrombophiliaFIIaheparinthrombin
Journal Article 2022-07-01 ✓ 5 Snippets de la Morena-Barrio ME, Suchon P, Jacobsen EM, Iversen N, Miñano A, de la Morena-Barrio B, Bravo-Pérez C, Padilla J, Cifuentes R, Asenjo S, Deleuze JF, Trégouët DA, Lozano ML, Vicente V, Sandset PM, Morange PE, Corral J.
In-Text Gene Mentions

We have demonstrated that up to 20% of cases with antithrombin deficiency but no SERPINC1 defect have hypoglycosylation.44

We have identified 2 new SERPINC1 variants, p.Glu227Lys and p.Asn224His, in 4 unrelated thrombophilic patients with early and recurrent thrombosis that had normal antithrombin activity.

The defect of 1 allele of SERPINC1, the gene encoding antithrombin, significantly increases the risk of venous thrombosis, while complete or very severe deficiency causes embryonic lethality.3,4

The interest in knowing the pathogenic consequences of a genetic variant disturbing the N-glycosylation at Asn224 significantly increased when we identified 2 unrelated Norwegian patients with early and severe thrombosis having a conflictive antithrombin deficiency that shared the same heterozygous SERPINC1 mutation affecting the Asn224 sequon: c.670 A>C (p.Asn224His) (Figure 1B).

Antithrombin (AT), encoded by the gene SERPINC1, is a serine protease inhibitor whose deficiency causes a severe form of dominantly inherited thrombophilia.

Show Full Abstract

Antithrombin deficiency, the most severe congenital thrombophilia, might be underestimated, as some pathogenic variants are not detected by routine functional methods. We have identified 2 new SERPINC1 variants, p.Glu227Lys and p.Asn224His, in 4 unrelated thrombophilic patients with early and recurrent thrombosis that had normal antithrombin activity. In one case, the mutation was identified by whole genome sequencing, while in the 3 remaining cases, the mutation was identified by sequencing SERPINC1 based on a single functional positive finding supporting deficiency. The 2 variants shared a common functional defect, an impaired or null N-glycosylation of Asn224 according to a eukaryotic expression model. Carriers had normal anti-FXa or anti-FIIa activities but impaired anti-FVIIa activity and a detectable loss of inhibitory function when incubating the plasma for 1 hour at 41°C. Moreover, the β glycoform of the variants, lacking 2 N-glycans, had reduced secretion, increased heparin affinity, no inhibitory activity, and a potential dominant-negative effect. These results explain the increased thrombin generation observed in carriers. Mutation experiments reflected the role that Lysine residues close to the N-glycosylation sequon have in impairing the efficacy of N-glycosylation. Our study shows new elements involved in the regulation of N-glycosylation, a key posttranslational modification that, according to our results, affects folding, secretion, and function, providing new evidence of the pathogenic consequence of an incorrect N-glycosylation of antithrombin. This study supports that antithrombin deficiency is underestimated and encourages the development of new functional and genetic tests to diagnose this severe thrombophilia.

Also flagged:PathogenesisType 1 Diabetesgene expressionextracellularglucagoninsulin
Journal Article 2022-07-01 ✓ 1 Snippet Yip L, Alkhataybeh R, Taylor C, Fuhlbrigge R, Fathman CG.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Multiple pathways contribute to the pathophysiological development of type 1 diabetes (T1D); however, the exact mechanisms involved are unclear. We performed differential gene expression analysis in pancreatic islets of NOD mice versus age-matched congenic NOD.B10 controls to identify genes that may contribute to disease pathogenesis. Novel genes related to extracellular matrix development and glucagon and insulin signaling/secretion were changed in NOD mice during early inflammation. During "respective" insulitis, the expression of genes encoding multiple chemosensory olfactory receptors were upregulated, and during "destructive" insulitis, the expression of genes involved in antimicrobial defense and iron homeostasis were downregulated. Islet inflammation reduced the expression of Hamp that encodes hepcidin. Hepcidin is expressed in β-cells and serves as the key regulator of iron homeostasis. We showed that Hamp and hepcidin levels were lower, while iron levels were higher in the pancreas of 12-week-old NOD versus NOD.B10 mice, suggesting that a loss of iron homeostasis may occur in the islets during the onset of "destructive" insulitis. Interestingly, we showed that the severity of NOD disease correlates with dietary iron intake. NOD mice maintained on low-iron diets had a lower incidence of hyperglycemia, while those maintained on high-iron diets had an earlier onset and higher incidence of disease, suggesting that high iron exposure combined with a loss of pancreatic iron homeostasis may exacerbate NOD disease. This mechanism may explain the link seen between high iron exposure and the increased risk for T1D in humans.

Also flagged:cancersilverADD1hypertension
Journal Article 2022-07-01 ✓ 1 Snippet Li PH, Chen TF, Yu JY, Shih SH, Su CH, Lin YH, Tsai HK, Juan HF, Chen CY, Huang JH.
In-Text Gene Mentions

‘A comparison of the allele frequencies or genotype distributions by the χ2 test revealed that rs6929846 of BTN2A1 was significantly associated with dyslipidemia (P < 0.05).’

Show Full Abstract

With the proliferation of genomic sequence data for biomedical research, the exploration of human genetic information by domain experts requires a comprehensive interrogation of large numbers of scientific publications in PubMed. However, a query in PubMed essentially provides search results sorted only by the date of publication. A search engine for retrieving and interpreting complex relations between biomedical concepts in scientific publications remains lacking. Here, we present pubmedKB, a web server designed to extract and visualize semantic relationships between four biomedical entity types: variants, genes, diseases, and chemicals. pubmedKB uses state-of-the-art natural language processing techniques to extract semantic relations from the large number of PubMed abstracts. Currently, over 2 million semantic relations between biomedical entity pairs are extracted from over 33 million PubMed abstracts in pubmedKB. pubmedKB has a user-friendly interface with an interactive semantic graph, enabling the user to easily query entities and explore entity relations. Supporting sentences with the highlighted snippets allow to easily navigate the publications. Combined with a new explorative approach to literature mining and an interactive interface for researchers, pubmedKB thus enables rapid, intelligent searching of the large biomedical literature to provide useful knowledge and insights. pubmedKB is available at https://www.pubmedkb.cc/.

Also flagged:immune responsesHLACD4placental malaria infectionplacental malariainflammatory cell adhesion molecules
Journal Article 2022-07-01 ✓ 1 Snippet Balle C, Armistead B, Kiravu A, Song X, Happel AU, Hoffmann AA, Kanaan SB, Nelson JL, Gray CM, Jaspan HB, Harrington WE.
In-Text Gene Mentions

…loci: GSTT1 ,ATIII, TG ,…

Show Full Abstract

Determinants of the acquisition and maintenance of maternal microchimerism (MMc) during infancy and the impact of MMc on infant immune responses are unknown. We examined factors that influence MMc detection and level across infancy and the effect of MMc on T cell responses to bacillus Calmette-Guérin (BCG) vaccination in a cohort of HIV-exposed, uninfected and HIV-unexposed infants in South Africa. MMc was measured in whole blood from 58 infants using a panel of quantitative PCR assays at day 1, and 7, 15, and 36 weeks of life. Infants received BCG at birth, and selected whole blood samples from infancy were stimulated in vitro with BCG and assessed for polyfunctional CD4+ T cell responses. MMc was present in most infants across infancy, with levels ranging from 0 to 1,193/100,000 genomic equivalents and was positively impacted by absence of maternal HIV, maternal and infant HLA compatibility, infant female sex, and exclusive breastfeeding. Initiation of maternal antiretroviral therapy prior to pregnancy partially restored MMc level in HIV-exposed, uninfected infants. Birth MMc was associated with an improved polyfunctional CD4+ T cell response to BCG. These data emphasize that both maternal and infant factors influence the level of MMc, which may subsequently affect infant T cell responses.

Also flagged:CholesterolBiosynthesis3-beta-hydroxysteroid dehydrogenase type 2HSD3B2CYB5Adehydroepiandrosterone
Journal Article 2022-07-01 ✓ 2 Snippets Pignatti E, Altinkilic EM, Bräutigam K, Grössl M, Perren A, Zavolan M, Flück CE.
In-Text Gene Mentions

Finally, we found that cholesterol deprivation leads to decreased transcriptional activity of POU3F2, which normally stimulates the expression of HSD3B2 by directly binding to its promoter.

…transcriptional activity ofPOU3F2, which normally stimulates…

Show Full Abstract

Adrenarche is an early event in sexual maturation in prepubertal children and corresponds to the postnatal development of the adrenocortical zona reticularis (zR). However, the molecular mechanisms that govern the onset and maturation of zR remain unknown. Using tissue laser microdissection combined with transcript quantification and immunodetection, we showed that the human zR receives low levels of cholesterol in comparison with other adrenal layers. To model this metabolic condition, we challenged adrenal cells in vitro using cholesterol deprivation. This resulted in reprogramming the steroidogenic pathway toward inactivation of 3-beta-hydroxysteroid dehydrogenase type 2 (HSD3B2), increased CYB5A expression, and increased biosynthesis of dehydroepiandrosterone (DHEA), 3 key features of zR maturation during adrenarche. Finally, we found that cholesterol deprivation leads to decreased transcriptional activity of POU3F2, which normally stimulates the expression of HSD3B2 by directly binding to its promoter. These findings demonstrate that cholesterol deprivation can account, at least in part, for the acquisition of a zR-like androgenic program in humans.

Also flagged:Factor V Leidenhereditary thrombophiliathrombophiliavenous thromboembolismdeep vein thrombosis
Journal Article 2022-07-01 No Snippets Morrow M, Lynch-Smith D.
Show Full Abstract

<h4>Background</h4>Factor V Leiden (FVL) is a hereditary thrombophilia, which causes the blood to be more hypercoagulable; in essence, the blood tends to clot more easily, especially under certain circumstances. It is the most common genetic mutation, causing thrombophilia in patients of white background. Patients that have FVL are at a higher risk to develop venous thromboembolism (VTE) after surgery and trauma.<h4>Objective</h4>The purpose of this review is to identify FVL as a risk factor, which may impede optimum acute cardiopulmonary management which may contribute to a longer length of stay (LOS) in the hospital.<h4>Methods</h4>This article is a systematic review of the literature involving research printed in peer-reviewed journals from 2015 to 2018. The University of Tennessee Health Science Center online library, PubMed, and Google Scholar were used for the literature search.<h4>Results</h4>The results of this study determined that although FVL is in fact a risk factor, which may impede optimum acute cardiopulmonary management which may contribute to a longer LOS, management of VTE is no different for a person with FVL compared with those without FVL.<h4>Conclusion</h4>Factor V Leiden is a risk factor for the development of VTE, specifically deep vein thrombosis, in surgical, trauma, pregnant, and hormone replacement therapy patients, thus increasing LOS and recurrence of such events. Regardless of FVL status, management of VTE should be initiated promptly and discontinued when appropriate.

Also flagged:Cyclooxygenasemicrocirculationgestationtitanium dioxidearachidonic acidthromboxane
Journal Article 2022-07-01 ✓ 1 Snippet Griffith JA, Garner KL, Bowdridge EC, DeVallance E, Schafner KJ, Engles KJ, Batchelor TP, Goldsmith WT, Wix K, Hussain S, Nurkiewicz TR.
In-Text Gene Mentions

Ptgis

Show Full Abstract

Pregnancy requires rapid adaptations in the uterine microcirculation to support fetal development. Nanomaterial inhalation is associated with cardiovascular dysfunction, which may impair gestation. We have shown that maternal nano-titanium dioxide (nano-TiO2) inhalation impairs microvascular endothelial function in response to arachidonic acid and thromboxane (TXA2) mimetics. However, the mechanisms underpinning this process are unknown. Therefore, we hypothesize that maternal nano-TiO2 inhalation during gestation results in uterine microvascular prostacyclin (PGI2) and TXA2 dysfunction. Pregnant Sprague-Dawley rats were exposed from gestational day 10-19 to nano-TiO2 aerosols (12.17  ± 1.67 mg/m3) or filtered air (sham-control). Dams were euthanized on gestational day 20, and serum, uterine radial arterioles, implantation sites, and lungs were collected. Serum was assessed for PGI2 and TXA2 metabolites. TXB2, the stable TXA2 metabolite, was significantly decreased in nano-TiO2 exposed dams (597.3 ± 84.4 vs 667.6 ± 45.6 pg/ml), whereas no difference was observed for 6-keto-PGF1α, the stable PGI2 metabolite. Radial arteriole pressure myography revealed that nano-TiO2 exposure caused increased vasoconstriction to the TXA2 mimetic, U46619, compared with sham-controls (-41.3% ± 4.3% vs -16.8% ± 3.4%). Nano-TiO2 exposure diminished endothelium-dependent vasodilation to carbaprostacyclin, a PGI2 receptor agonist, compared with sham-controls (30.0% ± 9.0% vs 53.7% ± 6.0%). Maternal nano-TiO2 inhalation during gestation decreased nano-TiO2 female pup weight when compared with sham-control males (3.633 ± 0.064 vs 3.995 ± 0.124 g). Augmented TXA2 vasoconstriction and decreased PGI2 vasodilation may lead to decreased placental blood flow and compromise maternofetal exchange of waste and nutrients, which could ultimately impact fetal health outcomes.

Also flagged:synapse formationorganizationneurological diseasesynapsesneuromuscular junctionbrain development
Journal Article 2022-07-01 ✓ 1 Snippet Duhart JC, Mosca TJ.
In-Text Gene Mentions

DCC

Show Full Abstract

A goal of modern neuroscience involves understanding how connections in the brain form and function. Such a knowledge is essential to inform how defects in the exquisite complexity of nervous system growth influence neurological disease. Studies of the nervous system in the fruit fly Drosophila melanogaster enabled the discovery of a wealth of molecular and genetic mechanisms underlying development of synapses-the specialized cell-to-cell connections that comprise the essential substrate for information flow and processing in the nervous system. For years, the major driver of knowledge was the neuromuscular junction due to its ease of examination. Analogous studies in the central nervous system lagged due to a lack of genetic accessibility of specific neuron classes, synaptic labels compatible with cell-type-specific access, and high resolution, quantitative imaging strategies. However, understanding how central synapses form remains a prerequisite to understanding brain development. In the last decade, a host of new tools and techniques extended genetic studies of synapse organization into central circuits to enhance our understanding of synapse formation, organization, and maturation. In this review, we consider the current state-of-the-field. We first discuss the tools, technologies, and strategies developed to visualize and quantify synapses in vivo in genetically identifiable neurons of the Drosophila central nervous system. Second, we explore how these tools enabled a clearer understanding of synaptic development and organization in the fly brain and the underlying molecular mechanisms of synapse formation. These studies establish the fly as a powerful in vivo genetic model that offers novel insights into neural development.

Also flagged:Type 2 DiabetesDiabetic Nephropathyalbumincreatinineinsulin resistanceIR
Journal Article 2022-07-01 ✓ 1 Snippet Sulaj A, Kopf S, von Rauchhaupt E, Kliemank E, Brune M, Kender Z, Bartl H, Cortizo FG, Klepac K, Han Z, Kumar V, Longo V, Teleman A, Okun JG, Morgenstern J, Fleming T, Szendroedi J, Herzig S, Nawroth PP.
In-Text Gene Mentions

…cholangitis, Morbus Wilson,hemochromatosis, autoimmune hepatitis); sever…

Show Full Abstract

<h4>Context</h4>Novel fasting interventions have gained scientific and public attention. Periodic fasting has emerged as a dietary modification promoting beneficial effects on metabolic syndrome.<h4>Objective</h4>Assess whether periodic fasting reduces albuminuria and activates nephropathy-driven pathways.<h4>Design/participants</h4>Proof-of-concept study where individuals with type 2 diabetes (n = 40) and increased albumin-to-creatinine ratio (ACR) were randomly assigned to receive a monthly fasting-mimicking diet (FMD) or a Mediterranean diet for 6 months with 3-month follow-up.<h4>Main outcomes measures</h4>Change in ACR was assessed by analysis of covariance adjusted for age, sex, weight loss, and baseline value. Prespecified subgroup analysis for patients with micro- vs macroalbuminuria at baseline was performed. Change in homeostatic model assessment for insulin resistance (HOMA-IR), circulating markers of dicarbonyl detoxification (methylglyoxal-derived hydroimidazolone 1, glyoxalase-1, and hydroxyacetone), DNA-damage/repair (phosphorylated histone H2AX), lipid oxidation (acylcarnitines), and senescence (soluble urokinase plasminogen activator receptor) were assessed as exploratory endpoints.<h4>Results</h4>FMD was well tolerated with 71% to 95% of the participants reporting no adverse effects. After 6 months, change in ACR was comparable between study groups [110.3 (99.2, 121.5) mg/g; P = 0.45]. FMD led to a reduction of ACR in patients with microalbuminuria levels at baseline [-30.3 (-35.7, -24.9) mg/g; P ≤ 0.05] but not in those with macroalbuminuria [434.0 (404.7, 463.4) mg/g; P = 0.23]. FMD reduced HOMA-IR [-3.8 (-5.6, -2.0); P ≤ 0.05] and soluble urokinase plasminogen activator receptor [-156.6 (-172.9, -140.4) pg/mL; P ≤ 0.05], while no change was observed in markers of dicarbonyl detoxification or DNA-damage/repair. Change in acylcarnitines was related to patient responsiveness to ACR improvement. At follow-up only HOMA-IR reduction [-1.9 (-3.7, -0.1), P ≤ 0.05]) was sustained.<h4>Conclusions</h4>Improvement of microalbuminuria and of markers of insulin resistance, lipid oxidation, and senescence suggest the potential beneficial effects of periodic fasting in type 2 diabetes.

Also flagged:small-for-gestational-agesmall-for-gestational ageGA4104 1term3 At
Journal Article 2022-07-01 No Snippets Krebs NF, Hambidge KM, Westcott JL, Garcés AL, Figueroa L, Tshefu AK, Lokangaka AL, Goudar SS, Dhaded SM, Saleem S, Ali SA, Bauserman MS, Derman RJ, Goldenberg RL, Das A, Chowdhury D, Women First Preconception Maternal Nutrition Study Group.
Show Full Abstract

<h4>Background</h4>The multicountry Women First trial demonstrated that nutritional supplementation initiated prior to conception (arm 1) or early pregnancy (arm 2) and continued until delivery resulted in significantly greater length at birth and 6 mo compared with infants in the control arm (arm 3).<h4>Objectives</h4>We evaluated intervention effects on infants' longitudinal growth trajectory from birth through 24 mo and identified predictors of length status and stunting at 24 mo.<h4>Methods</h4>Infants' anthropometry was obtained at 6, 12, 18, and 24 mo after the Women First trial (registered at clinicaltrials.gov as NCT01883193), which was conducted in low-resource settings: Democratic Republic of Congo, Guatemala, India, and Pakistan. Longitudinal models evaluated intervention effects on infants' growth trajectory from birth to 24 mo, with additional modeling used to identify adjusted predictors for growth trajectories and outcomes at 24 mo.<h4>Results</h4>Data for 2337 (95% of original live births) infants were evaluated. At 24 mo, stunting rates were 62.8%, 64.8%, and 66.3% for arms 1, 2, and 3, respectively (NS). For the length-for-age z-score (LAZ) trajectory, treatment arm was a significant predictor, with adjusted mean differences of 0.19 SD (95% CI: 0.08, 0.30; P < 0.001) and 0.17 SD (95% CI: 0.07, 0.27; P < 0.001) for arms 1 and 2, respectively. The strongest predictors of LAZ at 24 mo were birth LAZ <-2 and <-1 to ≥-2, with adjusted mean differences of -0.76 SD (95% CI: -0.93, -0.58; P < 0.001) and -0.47 SD (95% CI: -0.56, -0.38; P < 0.001), respectively. For infants with ultrasound-determined gestational age (n = 1329), the strongest predictors of stunting were birth LAZ <-2 and <-1 to ≥- 2: adjusted relative risk of 1.62 (95% CI: 1.39, 1.88; P < 0.001) and 1.46 (95% CI: 1.31, 1.62; P < 0.001), respectively.<h4>Conclusions</h4>Substantial improvements in postnatal growth are likely to depend on improved intrauterine growth, especially during early pregnancy.

Also flagged:Smad7TGF-βMyocardial infarctiongene expressionTREM1collagen
Journal Article 2022-07-01 ✓ 1 Snippet Li J, Li R, Tuleta I, Hernandez SC, Humeres C, Hanna A, Chen B, Frangogiannis NG.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Smad7 restrains TGF-β responses, and has been suggested to exert both pro- and anti-inflammatory actions that may involve effects on macrophages. Myocardial infarction triggers a macrophage-driven inflammatory response that not only plays a central role in cardiac repair, but also contributes to adverse remodeling and fibrosis. We hypothesized that macrophage Smad7 expression may regulate inflammation and fibrosis in the infarcted heart through suppression of TGF-β responses, or via TGF-independent actions. In a mouse model of myocardial infarction, infiltration with Smad7+ macrophages peaked 7 days after coronary occlusion. Myeloid cell-specific Smad7 loss in mice had no effects on homeostatic functions and did not affect baseline macrophage gene expression. RNA-seq predicted that Smad7 may promote TREM1-mediated inflammation in infarct macrophages. However, these alterations in the transcriptional profile of macrophages were associated with a modest and transient reduction in infarct myofibroblast infiltration, and did not affect dysfunction, chamber dilation, scar remodeling, collagen deposition, and macrophage recruitment. In vitro, RNA-seq and PCR arrays showed that TGF-β has profound effects on macrophage profile, attenuating pro-inflammatory cytokine/chemokine expression, modulating synthesis of matrix remodeling genes, inducing genes associated with sphingosine-1 phosphate activation and integrin signaling, and inhibiting cholesterol biosynthesis genes. However, Smad7 loss did not significantly affect TGF-β-mediated macrophage responses, modulating synthesis of only a small fraction of TGF-β-induced genes, including Itga5, Olfml3, and Fabp7. Our findings suggest a limited role for macrophage Smad7 in regulation of post-infarction inflammation and repair, and demonstrate that the anti-inflammatory effects of TGF-β in macrophages are not restrained by endogenous Smad7 induction.

Also flagged:translationEncephalitisdengueND 4tricho
Journal Article 2022-07-01 No Snippets Pommier JD, Gorman C, Crabol Y, Bleakley K, Sothy H, Santy K, Tran HTT, Nguyen LV, Bunnakea E, Hlaing CS, Aye AMM, Cappelle J, Herrant M, Piola P, Rosset B, Chevalier V, Tarantola A, Channa M, Honnorat J, Pinto AL, Rattanavong S, Vongsouvath M, Mayxay M, Phangmanixay S, Phongsavath K, Tin OS, Kyaw LL, Tin HH, Linn K, Tran TMH, Pérot P, Thuy NTT, Hien N, Phan PH, Buchy P, Dussart P, Laurent D, Eloit M, Dubot-Pérès A, Lortholary O, de Lamballerie X, Newton PN, Lecuit M, SEAe Consortium.
Show Full Abstract

<h4>Background</h4>Encephalitis is a worldwide public health issue, with a substantially high burden among children in southeast Asia. We aimed to determine the causes of encephalitis in children admitted to hospitals across the Greater Mekong region by implementing a comprehensive state-of-the-art diagnostic procedure harmonised across all centres, and identifying clinical characteristics related to patients' conditions.<h4>Methods</h4>In this multicentre, observational, prospective study of childhood encephalitis, four referral hospitals in Cambodia, Vietnam, Laos, and Myanmar recruited children (aged 28 days to 16 years) who presented with altered mental status lasting more than 24 h and two of the following minor criteria: fever (within the 72 h before or after presentation), one or more generalised or partial seizures (excluding febrile seizures), a new-onset focal neurological deficit, cerebrospinal fluid (CSF) white blood cell count of 5 per mL or higher, or brain imaging (CT or MRI) suggestive of lesions of encephalitis. Comprehensive diagnostic procedures were harmonised across all centres, with first-line testing was done on samples taken at inclusion and results delivered within 24 h of inclusion for main treatable causes of disease and second-line testing was done thereafter for mostly non-treatable causes. An independent expert medical panel reviewed the charts and attribution of causes of all the included children. Using multivariate analyses, we assessed risk factors associated with unfavourable outcomes (ie, severe neurological sequelae and death) at discharge using data from baseline and day 2 after inclusion. This study is registered with ClinicalTrials.gov, NCT04089436, and is now complete.<h4>Findings</h4>Between July 28, 2014, and Dec 31, 2017, 664 children with encephalitis were enrolled. Median age was 4·3 years (1·8-8·8), 295 (44%) children were female, and 369 (56%) were male. A confirmed or probable cause of encephalitis was identified in 425 (64%) patients: 216 (33%) of 664 cases were due to Japanese encephalitis virus, 27 (4%) were due to dengue virus, 26 (4%) were due to influenza virus, 24 (4%) were due to herpes simplex virus 1, 18 (3%) were due to Mycobacterium tuberculosis, 17 (3%) were due to Streptococcus pneumoniae, 17 (3%) were due to enterovirus A71, 74 (9%) were due to other pathogens, and six (1%) were due to autoimmune encephalitis. Diagnosis was made within 24 h of admission to hospital for 83 (13%) of 664 children. 119 (18%) children had treatable conditions and 276 (42%) had conditions that could have been preventable by vaccination. At time of discharge, 153 (23%) of 664 children had severe neurological sequelae and 83 (13%) had died. In multivariate analyses, risk factors for unfavourable outcome were diagnosis of M tuberculosis infection upon admission (odds ratio 3·23 [95% CI 1·04-10·03]), coma on day 2 (2·90 [1·78-4·72]), supplementary oxygen requirement (1·89 [1·25-2·86]), and more than 1 week duration between symptom onset and admission to hospital (3·03 [1·68-5·48]). At 1 year after inclusion, of 432 children who were discharged alive from hospital with follow-up data, 24 (5%) had died, 129 (30%) had neurological sequelae, and 279 (65%) had completely recovered.<h4>Interpretation</h4>In southeast Asia, most causes of childhood encephalitis are either preventable or treatable, with Japanese encephalitis virus being the most common cause. We provide crucial information that could guide public health policy to improve diagnostic, vaccination, and early therapeutic guidelines on childhood encephalitis in the Greater Mekong region.<h4>Funding</h4>Institut Pasteur, Institut Pasteur International Network, Fondation Merieux, Aviesan Sud, INSERM, Wellcome Trust, Institut de Recherche pour le Développement (IRD), and Fondation Total.

Also flagged:autosomal dominant neurodegenerative disorderpathogenesisproteolysisoligonucleotidecancerMSH3
Journal Article 2022-07-01 ✓ 2 Snippets Tabrizi SJ, Estevez-Fraga C, van Roon-Mom WMC, Flower MD, Scahill RI, Wild EJ, Muñoz-Sanjuan I, Sampaio C, Rosser AE, Leavitt BR.
In-Text Gene Mentions

The molecular pathogenesis of Huntington's disease is complex, with toxicity that arises from full-length expanded huntingtin and N-terminal fragments of huntingtin, which are both prone to misfolding due to proteolysis; aberrant intron-1 splicing of the HTT gene; and somatic expansion of the CAG repeat in the HTT gene.

HTT

Show Full Abstract

Huntington's disease is the most frequent autosomal dominant neurodegenerative disorder; however, no disease-modifying interventions are available for patients with this disease. The molecular pathogenesis of Huntington's disease is complex, with toxicity that arises from full-length expanded huntingtin and N-terminal fragments of huntingtin, which are both prone to misfolding due to proteolysis; aberrant intron-1 splicing of the HTT gene; and somatic expansion of the CAG repeat in the HTT gene. Potential interventions for Huntington's disease include therapies targeting huntingtin DNA and RNA, clearance of huntingtin protein, DNA repair pathways, and other treatment strategies targeting inflammation and cell replacement. The early termination of trials of the antisense oligonucleotide tominersen suggest that it is time to reflect on lessons learned, where the field stands now, and the challenges and opportunities for the future.

Also flagged:dosage compensationgene expressionchromosomeschromosomecompensationunc-9
Journal Article 2022-07-01 ✓ 5 Snippets Ragipani B, Albritton SE, Morao AK, Mesquita D, Kramer M, Ercan S.
In-Text Gene Mentions

…upregulated by theDCCin flies (…

DCCis recruited specifically…

…to recruit theDCC( Csankovszki et…

…not recruit theDCC.…

…high levels ofDCCto an autosome…

Show Full Abstract

Isolation of copy number variations and chromosomal duplications at high frequency in the laboratory suggested that Caenorhabditis elegans tolerates increased gene dosage. Here, we addressed if a general dosage compensation mechanism acts at the level of mRNA expression in C. elegans. We characterized gene dosage and mRNA expression in 3 chromosomal duplications and a fosmid integration strain using DNA-seq and mRNA-seq. Our results show that on average, increased gene dosage leads to increased mRNA expression, pointing to a lack of genome-wide dosage compensation. Different genes within the same chromosomal duplication show variable levels of mRNA increase, suggesting feedback regulation of individual genes. Somatic dosage compensation and germline repression reduce the level of mRNA increase from X chromosomal duplications. Together, our results show a lack of genome-wide dosage compensation mechanism acting at the mRNA level in C. elegans and highlight the role of epigenetic and individual gene regulation contributing to the varied consequences of increased gene dosage.

Also flagged:G1-Cyclin2Cln2chromosomeacetyltransferasecohesinsister
Journal Article 2022-07-01 ✓ 1 Snippet Buskirk S, Skibbens RV.
In-Text Gene Mentions

Condensincomplexes (condensin I…

Show Full Abstract

Eco1/Ctf7 is a highly conserved acetyltransferase that activates cohesin complexes and is critical for sister chromatid cohesion, chromosome condensation, DNA damage repair, nucleolar integrity, and gene transcription. Mutations in the human homolog of ECO1 (ESCO2/EFO2), or in genes that encode cohesin subunits, result in severe developmental abnormalities and intellectual disabilities referred to as Roberts syndrome and Cornelia de Lange syndrome, respectively. In yeast, deletion of ECO1 results in cell inviability. Codeletion of RAD61 (WAPL in humans), however, produces viable yeast cells. These eco1 rad61 double mutants, however, exhibit a severe temperature-sensitive growth defect, suggesting that Eco1 or cohesins respond to hyperthermic stress through a mechanism that occurs independent of Rad61. Here, we report that deletion of the G1 cyclin CLN2 rescues the temperature-sensitive lethality otherwise exhibited by eco1 rad61 mutant cells, such that the triple mutant cells exhibit robust growth over a broad range of temperatures. While Cln1, Cln2, and Cln3 are functionally redundant G1 cyclins, neither CLN1 nor CLN3 deletions rescue the temperature-sensitive growth defects otherwise exhibited by eco1 rad61 double mutants. We further provide evidence that CLN2 deletion rescues hyperthermic growth defects independent of START and impacts the state of chromosome condensation. These findings reveal novel roles for Cln2 that are unique among the G1 cyclin family and appear critical for cohesin regulation during hyperthermic stress.

Also flagged:interferonRetinoic acidIFNTLTBP1TGFB-binding proteinstransforming growth factor-beta
Journal Article 2022-07-01 No Snippets Hughes CHK, Mezera MA, Wiltbank MC, Pate JL.
Show Full Abstract

Several recent studies have used transcriptomics to investigate luteal changes during the maternal recognition of the pregnancy period in ruminants. Although these studies have contributed to our understanding of luteal function during early pregnancy, few attempts have been made to integrate information across these studies and distinguish key luteal transcripts or functions that are repeatably identified across multiple studies. Therefore, in this study, two independent studies of the luteal transcriptome during early pregnancy were combined and compared. In the first study, corpora lutea (CL) from day 20 of pregnancy were compared with CL collected on day 14 of pregnancy, prior to embryonic signaling. The cattle were nonlactating. In the second study, CL from day 20 of pregnancy were compared with CL collected from day 20 cyclic cattle that had been confirmed as not yet undergoing luteal regression. These were lactating cattle. Three methods were used to compare these two datasets, to identify key luteal regulators. In the first method, all transcripts with Benjamini-Hochberg-adjusted P-value (Q value) < 0.05 in both datasets were considered. This yielded 22 transcripts, including several classical interferon-stimulated genes, as well as regulators of transforming growth factor-beta (TGFB) and latent TGFB-binding proteins (LTBP)1 and 2. In the second, less conservative method, all transcripts with P < 0.01 and changed in the same direction in both datasets were considered. This yielded an additional 20 transcripts that were not identified in the first analysis, for a total of 42 common transcripts. These transcripts were regulators of functions such as inflammatory balance and matrix remodeling. In the third method, transcripts with Q < 0.10 were subject to pathway analysis, and common pathways were identified. Retinoic acid signaling and classical interferon signaling pathways were identified with this method. Finally, regulation by interferon tau (IFNT) was investigated. Among the 42 transcripts identified, 32 were regulated by IFNT in cultured luteal cells (Q < 0.05). Among those not regulated by IFNT were LTBP1 and 2, which are TGFB-binding proteins. In summary, common transcripts from two studies of the luteal transcriptome during early pregnancy were combined and shared changes were identified. This not only generated a list of potential key luteal regulators, which were mostly IFNT regulated, but also included transcripts not regulated by IFNT, including LTBP1 and 2.

Also flagged:Prostate Cancermalignant tumorsnucleotidesgene expressiontumorSTAT3
Journal Article 2022-07-01 ✓ 1 Snippet Mirzaei S, Paskeh MDA, Okina E, Gholami MH, Hushmandi K, Hashemi M, Kalu A, Zarrabi A, Nabavi N, Rabiee N, Sharifi E, Karimi-Maleh H, Ashrafizadeh M, Kumar AP, Wang Y.
In-Text Gene Mentions

…glioma progression viaSTAU1-mediated mRNA degradation […

Show Full Abstract

<h4>Background</h4>One of the most malignant tumors in men is prostate cancer that is still incurable due to its heterogenous and progressive natures. Genetic and epigenetic changes play significant roles in its development. The RNA molecules with more than 200 nucleotides in length are known as lncRNAs and these epigenetic factors do not encode protein. They regulate gene expression at transcriptional, post-transcriptional and epigenetic levels. LncRNAs play vital biological functions in cells and in pathological events, hence their expression undergoes dysregulation.<h4>Aim of review</h4>The role of epigenetic alterations in prostate cancer development are emphasized here. Therefore, lncRNAs were chosen for this purpose and their expression level and interaction with other signaling networks in prostate cancer progression were examined.<h4>Key scientific concepts of review</h4>The aberrant expression of lncRNAs in prostate cancer has been well-documented and progression rate of tumor cells are regulated via affecting STAT3, NF-κB, Wnt, PI3K/Akt and PTEN, among other molecular pathways. Furthermore, lncRNAs regulate radio-resistance and chemo-resistance features of prostate tumor cells. Overexpression of tumor-promoting lncRNAs such as HOXD-AS1 and CCAT1 can result in drug resistance. Besides, lncRNAs can induce immune evasion of prostate cancer via upregulating PD-1. Pharmacological compounds such as quercetin and curcumin have been applied for targeting lncRNAs. Furthermore, siRNA tool can reduce expression of lncRNAs thereby suppressing prostate cancer progression. Prognosis and diagnosis of prostate tumor at clinical course can be evaluated by lncRNAs. The expression level of exosomal lncRNAs such as lncRNA-p21 can be investigated in serum of prostate cancer patients as a reliable biomarker.

Also flagged:Ccne1Sox2Klf2spermatogenesisfertilizationBLIMP1
Journal Article 2022-07-01 ✓ 1 Snippet Tan K, Wilkinson MF.
In-Text Gene Mentions

…Larp1, Cgn andPrdx6) and the…

Show Full Abstract

The nuanced mechanisms driving primordial germ cells (PGC) specification remain incompletely understood since genome-wide transcriptional regulation in developing PGCs has previously only been defined indirectly. Here, using SLAMseq analysis, we determined genome-wide transcription rates during the differentiation of embryonic stem cells (ESCs) to form epiblast-like (EpiLC) cells and ultimately PGC-like cells (PGCLCs). This revealed thousands of genes undergoing bursts of transcriptional induction and rapid shut-off not detectable by RNAseq analysis. Our SLAMseq datasets also allowed us to infer RNA turnover rates, which revealed thousands of mRNAs stabilized and destabilized during PGCLC specification. mRNAs tend to be unstable in ESCs and then are progressively stabilized as they differentiate. For some classes of genes, mRNA turnover regulation collaborates with transcriptional regulation, but these processes oppose each other in a surprisingly high frequency of genes. To test whether regulated mRNA turnover has a physiological role in PGC development, we examined three genes that we found were regulated by RNA turnover: Sox2, Klf2 and Ccne1. Circumvention of their regulated RNA turnover severely impaired the ESC-to-EpiLC and EpiLC-to-PGCLC transitions. Our study demonstrates the functional importance of regulated RNA stability in germline development and provides a roadmap of transcriptional and post-transcriptional regulation during germline specification.

Also flagged:methylationcoronary artery diseaseinvasive ductal carcinomadeathCD4Cas9
Journal Article 2022-07-01 No Snippets Rakshit S, Sunny JS, George M, Hanna LE, Leela KV, Sarkar K.
Show Full Abstract

<h4>Purpose</h4>Invasive ductal carcinoma (IDC) and coronary artery disease (CAD), remains the greatest cause of death annually in women, driven by complex signalling pathways and shared several predisposing risk factors together. Therefore, it is important to find out the common epigenetic modifications which are responsible for possible disease progression from CAD to IDC.<h4>Methods</h4>CD4+T cell isolation by MACS, RT2 profiler PCR array, Gene ontology study, m6A RNA methylation, ChIP-qPCR, Q-PCR, CRISPR/Cas9-mediated knockout/overexpression, Lactate dehydrogenase release assay, RDIP-qPCR.<h4>Results</h4>We have identified several epigenetic regulators (e.g., VEGFA, AIMP1, etc.) which are mainly involved in inflammatory pathways in both the diseased conditions. Epitranscriptomic alterations such as m6A RNA methylation found abnormal in CD4+T helper cells in both IDC as well as CAD. CRISPR-Cas9 mediated knockout/overexpression of specific gene (BRCA1) are promising therapeutic approaches in diseased conditions by regulating m6A RNA methylation and also tumor suppressor gene P53. It also affected the R-loop formation which is vulnerable to DNA damage and BRCA1 can also induce CTL mediated cytotoxicity in breast cancer cells.<h4>Conclusions</h4>Therefore, by understanding the modifications of epigenetic mechanisms, their alterations and interactions will aid in the development of newer therapeutic approaches to stop the possible spread from one disease to another.

Also flagged:gene expressionextracellulartranslationalperoxisomelipidmetabolism
Journal Article 2022-07-01 ✓ 5 Snippets Wang Z, Özçam M, Abasht B.
In-Text Gene Mentions

As expected, ADAM17 and COX17 were down-regulated in the IFE group, with an FC of around 1.6 times lower than the HFE group.

…up-regulated genes inHFEgroup, HYAL2 hydrolyzes…

…between IFE andHFEchickens.…

…adipose tissue ofHFEand IFE chickens…

…lower than theHFEgroup.…

Show Full Abstract

Feed efficiency (FE) is an important trait in the broiler industry due to its direct correlation to efficient muscle growth instead of fat deposition. The present study characterized and compared gene expression profiles in abdominal fat from broiler chickens of different FE levels to enhance the understanding of FE biology. Specifically, traditional whole-transcript RNA-sequencing (RNA-seq) and 3' UTR-sequencing (3' UTR-seq) were applied to 22 and 61 samples, respectively. Overall, these two sequencing techniques shared a high correlation (0.76) between normalized counts, although 3' UTR-seq showed a higher variance in sequencing and mapping performance statistics across samples and a lower rate of uniquely mapped reads. A higher percentage of 3' UTR-seq reads mapped to introns suggested the frequent presence of cleavage sites in introns, thus warranting future research to study its regulatory function. Differential expression analysis identified 1198 differentially expressed genes (DEGs) between high FE (HFE) and intermediate FE (IFE) chickens with False Discovery Rate < 0.05 and fold change > 1.2. The processes that were significantly enriched by the DEGs included extracellular matrix remodeling and mechanisms impacting gene expression at the transcriptional and translational levels. Gene ontology enrichment analysis suggested that the divergence in fat deposition and FE in broiler chickens could be associated with peroxisome and lipid metabolism possibly regulated by G0/G1 switch gene 2 (G0S2).

Also flagged:HaspinVRK1histone H3Protein kinaseshistoneschromosomes
Journal Article 2022-07-01 ✓ 5 Snippets Cartwright TN, Harris RJ, Meyer SK, Mon AM, Watson NA, Tan C, Marcelot A, Wang F, Zinn-Justin S, Traktman P, Higgins JMG.
In-Text Gene Mentions

Here, using in vitro kinase assays, KiPIK screening, RNA interference, and CRISPR/Cas9 approaches, we were unable to substantiate a direct role for VRK1, or its paralogue VRK2, in the phosphorylation of threonine-3 or serine-10 of Histone H3 in mitosis, although loss of VRK1 did slow cell proliferation.

…or its paralogueVRK2, in the phosphorylation…

…that also containsVRK2and the pseudokinase…

…low expression ofVRK241 , 58…

…600 ng/ml humanVRK2MISSION ® esiRNA…

Show Full Abstract

Protein kinases that phosphorylate histones are ideally-placed to influence the behavior of chromosomes during cell division. Indeed, a number of conserved histone phosphorylation events occur prominently during mitosis and meiosis in most eukaryotes, including on histone H3 at threonine-3 (H3T3ph). At least two kinases, Haspin and VRK1 (NHK-1/ballchen in Drosophila), have been proposed to carry out this modification. Phosphorylation of H3 by Haspin has defined roles in mitosis, but the significance of VRK1 activity towards histones in dividing cells has been unclear. Here, using in vitro kinase assays, KiPIK screening, RNA interference, and CRISPR/Cas9 approaches, we were unable to substantiate a direct role for VRK1, or its paralogue VRK2, in the phosphorylation of threonine-3 or serine-10 of Histone H3 in mitosis, although loss of VRK1 did slow cell proliferation. We conclude that the role of VRKs, and their more recently identified association with neuromuscular disease and importance in cancers of the nervous system, are unlikely to involve mitotic histone kinase activity. In contrast, Haspin is required to generate H3T3ph during mitosis.

Also flagged:COL6A2amyloid angiopathyECMCaspaseMembrane Transportcerebral amyloid angiopathy
Journal Article 2022-07-01 ✓ 4 Snippets Handa T, Sasaki H, Takao M, Tano M, Uchida Y.
In-Text Gene Mentions

…(GFAP) and Peroxiredoxin-6 (PRDX6) in ADNC +/CAA…

…−2 ), andPRDX6(p = 3.88…

…10 −2 ),PRDX6(p = 1.12…

…proteins PRDX2 andPRDX6are increased […

Show Full Abstract

<h4>Background</h4>Cerebral amyloid angiopathy (CAA) occurs in 80% of patients with Alzheimer's disease (AD) and is mainly caused by the abnormal deposition of Aβ in the walls of cerebral blood vessels. Cerebrovascular molecular mechanisms in CAA were investigated by using comprehensive and accurate quantitative proteomics.<h4>Methods</h4>Concerning the molecular mechanisms specific to CAA, formalin-fixed paraffin-embedded (FFPE) sections were prepared from patients having AD neuropathologic change (ADNC) with severe cortical Aβ vascular deposition (ADNC +/CAA +), and from patients having ADNC without vascular deposition of Aβ (ADNC +/CAA -; so called, AD). Cerebral cortical vessels were isolated from FFPE sections using laser microdissection (LMD), processed by pressure cycling technology (PCT), and applied to SWATH (sequential window acquisition of all theoretical fragment ion spectra) proteomics.<h4>Results</h4>The protein expression levels of 17 proteins in ADNC +/CAA +/H donors (ADNC +/CAA + donors with highly abundant Aβ in capillaries) were significantly different from those in ADNC +/CAA - and ADNC -/CAA - donors. Furthermore, we identified 56 proteins showing more than a 1.5-fold difference in average expression levels between ADNC +/CAA + and ADNC -/CAA - donors, and were significantly correlated with the levels of Aβ or Collagen alpha-2(VI) chain (COL6A2) (CAA markers) in 11 donors (6 ADNC +/CAA + and 5 ADNC -/CAA -). Over 70% of the 56 proteins showed ADNC +/CAA + specific changes in protein expression. The comparative analysis with brain parenchyma showed that more than 90% of the 56 proteins were vascular-specific pathological changes. A literature-based pathway analysis showed that 42 proteins are associated with fibrosis, oxidative stress and apoptosis. This included the increased expression of Heat shock protein HSP 90-alpha, CD44 antigen and Carbonic anhydrase 1 which are inhibited by potential drugs against CAA.<h4>Conclusions</h4>The combination of LMD-based isolation of vessels from FFPE sections, PCT-assisted sample processing and SWATH analysis (FFPE-LMD-PCT-SWATH method) revealed for the first time the changes in the expression of many proteins that are involved in fibrosis, ROS production and cell death in ADNC +/CAA +  (CAA patients) vessels. The findings reported herein would be useful for developing a better understanding of the pathology of CAA and for promoting the discovery and development of drugs and biomarkers for CAA.

Also flagged:bindingaminoacidsion channelcalmodulinskinases
Journal Article 2022-07-01 No Snippets Walker B, Liu C, Wait E, Ren P.
Show Full Abstract

A next-generation protocol (Poltype 2) has been developed which automatically generates AMOEBA polarizable force field parameters for small molecules. Both features and computational efficiency have been drastically improved. Notable advances include improved database transferability using SMILES, robust torsion fitting, non-aromatic ring torsion parameterization, coupled torsion-torsion parameterization, Van der Waals parameter refinement using ab initio dimer data and an intelligent fragmentation scheme that produces parameters with dramatically reduced ab initio computational cost. Additional improvements include better local frame assignment for atomic multipoles, automated formal charge assignment, Zwitterion detection, smart memory resource defaults, parallelized fragment job submission, incorporation of Psi4 quantum package, ab initio error handling, ionization state enumeration, hydration free energy prediction and binding free energy prediction. For validation, we have applied Poltype 2 to ~1000 FDA approved drug molecules from DrugBank. The ab initio molecular dipole moments and electrostatic potential values were compared with Poltype 2 derived AMOEBA counterparts. Parameters were further substantiated by calculating hydration free energy (HFE) on 40 small organic molecules and were compared with experimental data, resulting in an RMSE error of 0.59 kcal/mol. The torsion database has expanded to include 3543 fragments derived from FDA approved drugs. Poltype 2 provides a convenient utility for applications including binding free energy prediction for computational drug discovery. Further improvement will focus on automated parameter refinement by experimental liquid properties, expansion of the Van der Waals parameter database and automated parametrization of modified bio-fragments such as amino and nucleic acids.

Also flagged:leptinEGFRc-Myccancerswound healingtumor
Journal Article 2022-07-01 No Snippets Luo SD, Tsai HT, Hwang CF, Chiu TJ, Li SH, Hsu YL, Hsiao CC, Chen CH.
Show Full Abstract

<h4>Background</h4>Leptin is important in physiological and pathological functions in various cancers, however, the significance and mechanisms of leptin in nasopharyngeal carcinoma remain ambiguous.<h4>Methods</h4>Leptin expression was analyzed by QPCR, immunohistochemistry, Western blotting, and TCGA database. The impact of gain- or loss-of-function of leptin were determined by MTT, colony formation, wound healing, and Transwell assays in NPC cells, and by a xenograft tumor model. Leptin-modulated glucose consumption and lactate production were assessed by ELISA. Furthermore, leptin-regulated signaling pathways were examined by QPCR and Western blotting assays. The immunoprecipitation assay was conducted to determine interaction between leptin and EGFR. In addition, miR-874-3p-regulated leptin expression was evaluated using bioinformatics, QPCR, luciferase assay, AGO2-RIP assay, and Western blotting.<h4>Results</h4>In this study, we found that leptin was highly expressed in the sera and tumor tissues of patients with NPC, and elevated leptin expression was associated with advanced clinical features and poor prognosis. Functional assays demonstrated that leptin remarkably promoted NPC cell growth, motility, and glycolysis in vitro and in vivo. Mechanistically, leptin associated with EGFR, resulting in enhanced cell growth through the regulation of cell-cycle related markers, glycolysis-related genes, and EGFR/AKT/c-Myc signaling. Moreover, leptin potentiated the invasive capacity of NPC cells by promoting EMT. We further explored that miR-874-3p influenced leptin-mediated NPC progression. Overexpression of miR-874-3p prevented cell growth, motility, glucose consumption, and lactate production in NPC cells, whereas miR-874-3p inhibition had the opposite effects. AGO-RIP assays confirmed that Argonaute 2 (AGO2), a protein associated with miR-874-3p, regulated leptin expression in NPC cells. The rescue assays indicated that inhibition of leptin suppressed the effects of miR-874-3p inhibitor. In clinical specimens, miR-874-3p was negatively correlated with leptin.<h4>Conclusions</h4>Leptin may serve as a novel prognostic factor and potential therapeutic target for patients with NPC. In addition, a newly discovered regulatory axis of leptin/EGFR/AKT/c-Myc can provide a novel therapeutic strategy for NPC.

Also flagged:GRASP55secretionGolgireassembly stackingtransmembranesuperoxide dismutase 1
Journal Article 2022-07-01 ✓ 5 Snippets Ahat E, Bui S, Zhang J, da Veiga Leprevost F, Sharkey L, Reid W, Nesvizhskii AI, Paulson HL, Wang Y.
In-Text Gene Mentions

These include protein aggregates formed by hyperphosphorylated tau in Alzheimer’s disease (2), mutant superoxide dismutase 1 (SOD1) (4), and TAR DNA–binding protein 43 (TDP-43) in amyotrophic lateral sclerosis (5), and mutant huntingtin (Htt) in HD (6, 7).

To analyze LC3 and Htt colocalization, cells were prepermeabilized in 125 mM potassium acetate, 25 mM Hepes, pH 7.2, and 2.5 mM magnesium acetate buffer containing 0.1% saponin (prefiltered) for 2 min on ice to release the cytosol and washed by 125 mM potassium acetate, 25 mM Hepes, pH 7.2, and 2.5 mM magnesium acetate buffer for 5 min at room temperature.

To determine whether the two bands represent different phosphorylated forms of Htt, we treated cells with a general serine/threonine kinase inhibitor, staurosporine (STS), or a general phosphatase inhibitor, okadaic acid (OA).

To obtain evidence that mature lysosomal enzymes are also secreted under stress conditions in a similar pattern as Htt, we analyzed cathepsin D secretion in the same Htt secretion assays under different stress conditions, including glucose and amino acid starvation, and inhibition of proteasomal degradation by MG132 treatment.

…including mutant huntingtin (Htt-Q74), superoxide dismutase 1…

Show Full Abstract

Recent studies demonstrated that the Golgi reassembly stacking proteins (GRASPs), especially GRASP55, regulate Golgi-independent unconventional secretion of certain cytosolic and transmembrane cargoes; however, the underlying mechanism remains unknown. Here, we surveyed several neurodegenerative disease-related proteins, including mutant huntingtin (Htt-Q74), superoxide dismutase 1 (SOD1), tau, and TAR DNA-binding protein 43 (TDP-43), for unconventional secretion; our results show that Htt-Q74 is most robustly secreted in a GRASP55-dependent manner. Using Htt-Q74 as a model system, we demonstrate that unconventional secretion of Htt is GRASP55 and autophagy dependent and is enhanced under stress conditions such as starvation and endoplasmic reticulum stress. Mechanistically, we show that GRASP55 facilitates Htt secretion by tethering autophagosomes to lysosomes to promote autophagosome maturation and subsequent lysosome secretion and by stabilizing p23/TMED10, a channel for translocation of cytoplasmic proteins into the lumen of the endoplasmic reticulum-Golgi intermediate compartment. Moreover, we found that GRASP55 levels are upregulated by various stresses to facilitate unconventional secretion, whereas inhibition of Htt-Q74 secretion by GRASP55 KO enhances Htt aggregation and toxicity. Finally, comprehensive secretomic analysis identified novel cytosolic cargoes secreted by the same unconventional pathway, including transgelin (TAGLN), multifunctional protein ADE2 (PAICS), and peroxiredoxin-1 (PRDX1). In conclusion, this study defines the pathway of GRASP55-mediated unconventional protein secretion and provides important insights into the progression of Huntington's disease.

Also flagged:colorectal cancercancerMHCbindingAHNAK2PLIN4
Journal Article 2022-07-01 ✓ 5 Snippets Zhang X, Yang L, Lei W, Hou Q, Huang M, Zhou R, Enver T, Wu S.
In-Text Gene Mentions

While no report of the relationships between stemness and CCDC92 or PLIN4, here we using knock-down experiments to assess the stemness characteristics of co-mutant genes AHNAK2, ALK, ALMS1, HLA-B, CCDC92 and PLIN4. Down-regulated expressions of AHNAK2, ALK and ALMS1 increased the ability of sphere formation in both cell lines HCT116 and SW620 (Figure 5c-f), showing their cancer stem properties.

,44 No reports were about CCDC92 (coiled-coil domain containing 92) and cancer.

…PLIN4, HLA-B, ALK,CCDC92and ALMS1 genes…

…PLIN4, HLA-B, ALK,CCDC92, and ALMS1…

…between stemness andCCDC92or PLIN4, here…

Show Full Abstract

<h4>Background</h4>Tumor heterogeneity of human colorectal cancer (CRC)-initiating cells (CRCICs) in cancer tissues often represents aggressive features of cancer progression. For high-resolution examination of CRCICs, we performed single-cell whole-exome sequencing (scWES) and bulk cell targeted exome sequencing (TES) of CRCICs to investigate stemness-specific somatic alterations or clonal evolution.<h4>Methods</h4>Single cells of three subpopulations of CRCICs (CD133<sup>+</sup>CD44<sup>+</sup>, CD133<sup>-</sup>CD44<sup>+</sup>, and CD133<sup>+</sup>CD44<sup>-</sup> cells), CRC cells (CRCCs), and control cells from one CRC tissue were sorted for scWES. Then, we set up a mutation panel from scWES data and TES was used to validate mutation distribution and clonal evolution in additional 96 samples (20 patients) those were also sorted into the same three groups of CRCICs and CRCCs. The knock-down experiments were used to analyze stemness-related mutant genes. Neoantigens of these mutant genes and their MHC binding affinity were also analyzed.<h4>Findings</h4>Clonal evolution analysis of scWES and TES showed that the CD133<sup>+</sup>CD44<sup>-</sup> CRCICs were the likely origin of CRC before evolving into other groups of CRCICs/CRCCs. We revealed that AHNAK2, PLIN4, HLA-B, ALK, CCDC92 and ALMS1 genes were specifically mutated in CRCICs followed by the validation of their functions. Furthermore, four predicted neoantigens of AHNAK2 were identified and validated, which might have applications in immunotherapy for CRC patients.<h4>Interpretation</h4>All the integrative analyses above revealed clonal evolution of CRC and new markers for CRCICs and demonstrate the important roles of CRCICs in tumorigenesis and progression of CRCs.<h4>Funding</h4>A full list of funding bodies that contributed to this study can be found in the Acknowledgements section.

Also flagged:cancercancerslactic acidcarbonic anhydrasesextracellularacidification
Journal Article 2022-07-01 No Snippets Zhou Y, Chang W, Lu X, Wang J, Zhang C, Xu Y.
Show Full Abstract

Acid-base homeostasis is a fundamental property of living cells, and its persistent disruption in human cells can lead to a wide range of diseases. In this study, we conducted a computational modeling analysis of transcriptomic data of 4750 human tissue samples of 9 cancer types in The Cancer Genome Atlas (TCGA) database. Built on our previous study, we quantitatively estimated the average production rate of OH<sup>-</sup> by cytosolic Fenton reactions, which continuously disrupt the intracellular pH (pH<sub>i</sub>) homeostasis. Our predictions indicate that all or at least a subset of 43 reprogrammed metabolisms (RMs) are induced to produce net protons (H<sup>+</sup>) at comparable rates of Fenton reactions to keep the pH<sub>i</sub> stable. We then discovered that a number of well-known phenotypes of cancers, including increased growth rate, metastasis rate, and local immune cell composition, can be naturally explained in terms of the Fenton reaction level and the induced RMs. This study strongly suggests the possibility to have a unified framework for studies of cancer-inducing stressors, adaptive metabolic reprogramming, and cancerous behaviors. In addition, strong evidence is provided to demonstrate that a popular view that Na<sup>+</sup>/H<sup>+</sup> exchangers along with lactic acid exporters and carbonic anhydrases are responsible for the intracellular alkalization and extracellular acidification in cancer may not be justified.

Also flagged:lung cancerlung tumorstumorcancerdeathKras
Journal Article 2022-07-01 No Snippets Wong-Rolle A, Dong Q, Zhu Y, Divakar P, Hor JL, Kedei N, Wong M, Tillo D, Conner EA, Rajan A, Schrump DS, Jin C, Germain RN, Zhao C.
Show Full Abstract

<h4>Background</h4>The lung intratumor microbiome influences lung cancer tumorigenesis and treatment responses, but detailed data on the extent, location, and effects of microbes within lung tumors are missing, information needed for improved prognosis and treatment.<h4>Methods</h4>To address this gap, we developed a novel spatial meta-transcriptomic method simultaneously detecting the expression level of 1,811 host genes and 3 microbe targets (bacteria, fungi, and cytomegalovirus). After rigorous validation, we analyzed the spatial meta-transcriptomic profiles of tumor cells, T cells, macrophages, other immune cells, and stroma in surgically resected tumor samples from 12 patients with early-stage lung cancer.<h4>Results</h4>Bacterial burden was significantly higher in tumor cells compared with T cells, macrophages, other immune cells, and stroma. This burden increased from tumor-adjacent normal lung and tertiary lymphoid structures to tumor cells to the airways, suggesting that lung intratumor bacteria derive from the latter route of entry. Expression of oncogenic β-catenin was strongly correlated with bacterial burden, as were tumor histological subtypes and environmental factors.<h4>Conclusions</h4>Intratumor bacteria were enriched with tumor cells and associated with multiple oncogenic pathways, supporting a rationale for reducing the local intratumor microbiome in lung cancer for patient benefit.<h4>Trial registration number</h4>NCT00242723, NCT02146170.

Also flagged:IronHereditary HemochromatosisnucleusdentateHHmovement disorders
Journal Article 2022-07-01 ✓ 3 Snippets Sethi SK, Sharma S, Gharabaghi S, Reese D, Chen Y, Adams P, Jog MS, Haacke EM.
In-Text Gene Mentions

hemochromatosis

HFE

HFE H63D

Show Full Abstract

<h4>Background and purpose</h4>Brain iron dyshomeostasis is increasingly recognized as an important contributor to neurodegeneration. Hereditary hemochromatosis is the most commonly inherited disorder of systemic iron overload. Although there is an increasing interest in excessive brain iron deposition, there is a paucity of evidence showing changes in brain iron exceeding that in healthy controls. Quantitative susceptibility mapping and R2* mapping are established MR imaging techniques that we used to noninvasively quantify brain iron in subjects with hereditary hemochromatosis.<h4>Materials and methods</h4>Fifty-two patients with hereditary hemochromatosis and 47 age- and sex-matched healthy controls were imaged using a multiecho gradient-echo sequence at 3T. Quantitative susceptibility mapping and R2* data were generated, and regions within the deep gray matter were manually segmented. Mean susceptibility and R2* relaxation rates were calculated for each region, and iron content was compared between the groups.<h4>Results</h4>We noted elevated iron levels in patients with hereditary hemochromatosis compared with healthy controls using both R2* and QSM methods in the caudate nucleus, putamen, pulvinar thalamus, red nucleus, and dentate nucleus. Additionally, the substantia nigra showed increased susceptibility while the thalamus showed an increased R2* relaxation rate compared with healthy controls, respectively.<h4>Conclusions</h4>Both quantitative susceptibility mapping and R2* showed abnormal levels of brain iron in subjects with hereditary hemochromatosis compared with controls. Quantitative susceptibility mapping and R2* can be acquired in a single MR imaging sequence and are complementary in quantifying deep gray matter iron.

Also flagged:WaterrundelarseniclgdAgua
Journal Article 2022-07-01 No Snippets Knappett PSK, Farias P, Miller GR, Hoogesteger J, Li Y, Mendoza-Sanchez I, Woodward RT, Hernandez H, Loza-Aguirre I, Datta S, Huang Y, Carrillo G, Roh T, Terrell D.
Show Full Abstract

In semiarid agricultural regions, aquifers have watered widespread economic development. Falling water tables, however, drive up energy costs and can make the water toxic for human consumption. The study area is located in central Mexico, where arsenic and fluoride are widely present at toxic concentrations in well water. We simulated the holistic outcomes from three pumping scenarios over 100 years (2020-2120); (S1) pumping rates increase at a similar rate to the past 40 years, (S2) remain constant, or (S3) decrease. Under scenario S1, by 2120, the depth to water table increased to 426 m and energy consumption for irrigation increased to 4 × 10<sup>9</sup> kWh/yr. Arsenic and fluoride concentrations increased from 14 to 46 μg/L and 1.0 to 3.6 mg/L, respectively. The combined estimated IQ point decrements from drinking untreated well water lowered expected incomes in 2120 by 27% compared to what they would be with negligible exposure levels. We calculated the 100-year Net Present Value (NPV) of each scenario assuming the 2020 average crop value to water footprint ratio of 0.12 USD/m<sup>3</sup>. Without drinking water mitigation, S1 and S3 yielded relative NPVs of -5.96 × 10<sup>9</sup> and 1.51 × 10<sup>9</sup> USD, respectively, compared to the base case (S2). The relative NPV of providing blanket reverse osmosis treatment, while keeping pumping constant (S2), was 11.55 × 10<sup>9</sup> USD and this gain increased when combined with decreased pumping (S3). If a high value, low water footprint crop was substituted (broccoli, 1.51 USD/m<sup>3</sup>), the net gains from increasing pumping were similar in size to those of implementing blanket drinking water treatment.

Also flagged:TumorchiXBP-1GAPDHHCCHepatocellular carcinoma
Journal Article 2022-07-01 ✓ 5 Snippets Chung KM, Chen YT, Hong CC, Chang IC, Lin SY, Liang LY, Chen YR, Yeh CT, Huang SF.
In-Text Gene Mentions

CA10

CA10 overexpression was also associated with HBS nonsense mutation in HBV-related HCC tumor tissues.

Therefore, the oncogenic potential of CA10 demonstrated in this study might be different from those catalytically active CAs such as CA9 which regulates an acidic extracellular microenvironment for tumor development [32].

In this study, we examined the CA10 expressions in human HCC tumor tissues, and performed tumorigenesis assays of CA10.

The above results demonstrated that CA10 up-regulation could be associated with down-regulation of miR-27b in HCC, especially in HCC with sW182* mutation.

Show Full Abstract

Hepatocellular carcinoma (HCC) is the main threat for the patients infected with hepatitis B virus (HBV), but the oncogenic mechanism of HBV-related HCC is still controversial. Previously, we have found that several HBV surface gene (HBS) non-sense mutations are oncogenic. Among these mutations, sW182* was found to have the most potent oncogenicity. In this study, we found that Carbonic Anhydrase X (CA10) level was specifically increased in sW182* mutant-expressing cells. CA10 overexpression was also associated with HBS nonsense mutation in HBV-related HCC tumor tissues. Transformation and tumorigenesis assays revealed that CA10 had significant oncogenic activity. In addition, CA10 overexpression resulted in dysregulation of apoptosis-related proteins, including Mcl-1, Bcl-2, Bcl-xL and Bad. While searching for the regulatory mechanism of CA10, miR-27b was found to downregulate CA10 expression by regulating its mRNA degradation and its expression was decreased in sW182* mutant cells. Moreover, CA10 overexpression was associated with down-regulation of miR-27b in human HBV-related HCC tumor tissues with sW182* mutation. Therefore, induction of the expression of CA10 through repression of miR-27b by sW182* might be one mechanism involved in HBS mutation-related hepatocarcinogenesis.

Also flagged:uterine leiomyomabreast cancerestrogen receptorERfibroidsbenign tumors
Journal Article 2022-07-01 ✓ 1 Snippet Wu X, Xiao C, Han Z, Zhang L, Zhao X, Hao Y, Xiao J, Gallagher CS, Kraft P, Morton CC, Li J, Jiang X.
In-Text Gene Mentions

MLLT10

Show Full Abstract

Little is known regarding the shared genetic architecture or causality underlying the phenotypic association observed for uterine leiomyoma (UL) and breast cancer (BC). Leveraging summary statistics from the hitherto largest genome-wide association study (GWAS) conducted in each trait, we investigated the genetic overlap and causal associations of UL with BC overall, as well as with its subtypes defined by the status of estrogen receptor (ER). We observed a positive genetic correlation between UL and BC overall (r<sub>g</sub> = 0.09, p = 6.00 × 10<sup>-3</sup>), which was consistent in ER+ subtype (r<sub>g</sub> = 0.06, p = 0.01) but not in ER- subtype (r<sub>g</sub> = 0.06, p = 0.08). Partitioning the whole genome into 1,703 independent regions, local genetic correlation was identified at 22q13.1 for UL with BC overall and with ER+ subtype. Significant genetic correlation was further discovered in 9 out of 14 functional categories, with the highest estimates observed in coding, H3K9ac, and repressed regions. Cross-trait meta-analysis identified 9 novel loci shared between UL and BC. Mendelian randomization demonstrated a significantly increased risk of BC overall (OR = 1.09, 95% CI = 1.01-1.18) and ER+ subtype (OR = 1.09, 95% CI = 1.01-1.17) for genetic liability to UL. No reverse causality was found. Our comprehensive genome-wide cross-trait analysis demonstrates a shared genetic basis, pleiotropic loci, as well as a putative causal relationship between UL and BC, highlighting an intrinsic link underlying these two complex female diseases.

Response to Lee et al.

Also flagged:huntingtinHuntington diseasemismatch repair
Journal Article 2022-07-01 No Snippets Langbehn DR, Registry Investigators of the European Huntington Disease Network.
Show Full Abstract

No abstract available.

Also flagged:Ferroptosisdeathironlipidagingcancer
Journal Article 2022-07-01 No Snippets Stockwell BR.
Show Full Abstract

Ferroptosis, a form of cell death driven by iron-dependent lipid peroxidation, was identified as a distinct phenomenon and named a decade ago. Ferroptosis has been implicated in a broad set of biological contexts, from development to aging, immunity, and cancer. This review describes key regulators of this form of cell death within a framework of metabolism, ROS biology, and iron biology. Key concepts and major unanswered questions in the ferroptosis field are highlighted. The next decade promises to yield further breakthroughs in the mechanisms governing ferroptosis and additional ways of harnessing ferroptosis for therapeutic benefit.

Also flagged:Chromophobe Renal Cancerbenign oncocytomaROrenal tumortumorshematoxylin
Journal Article 2022-07-01 No Snippets Bin Satter K, Ramsey Z, Tran PMH, Hopkins D, Bearden G, Richardson KP, Terris MK, Savage NM, Kavuri SK, Purohit S.
Show Full Abstract

Malignant chromophobe renal cancer (chRCC) and benign oncocytoma (RO) are two renal tumor types difficult to differentiate using histology and immunohistochemistry-based methods because of their similarity in appearance. We previously developed a transcriptomics-based classification pipeline with "Chromophobe-Oncocytoma Gene Signature" (COGS) on a single-molecule counting platform. Renal cancer patients (<i>n</i> = 32, chRCC = 17, RO = 15) were recruited from Augusta University Medical Center (AUMC). Formalin-fixed paraffin-embedded (FFPE) blocks from their excised tumors were collected. We created a custom single-molecule counting code set for COGS to assay RNA from FFPE blocks. Utilizing hematoxylin-eosin stain, pathologists were able to correctly classify these tumor types (91.8%). Our unsupervised learning with UMAP (Uniform manifold approximation and projection, accuracy = 0.97) and hierarchical clustering (accuracy = 1.0) identified two clusters congruent with their histology. We next developed and compared four supervised models (random forest, support vector machine, generalized linear model with L2 regularization, and supervised UMAP). Supervised UMAP has shown to classify all the cases correctly (sensitivity = 1, specificity = 1, accuracy = 1) followed by random forest models (sensitivity = 0.84, specificity = 1, accuracy = 1). This pipeline can be used as a clinical tool by pathologists to differentiate chRCC from RO.

Also flagged:Staufen 1RNA-binding proteincancercell proliferationphosphorylationserine
Journal Article 2022-07-01 ✓ 5 Snippets Gonzalez Quesada Y, Bonnet-Magnaval F, DesGroseillers L.
In-Text Gene Mentions

In contrast to what was observed in untransformed cells [31], STAU1 depletion or knockout had no effect on the proliferation of cancer cells, indicating that STAU1 is not essential once cells are transformed [40,41,46].

HCT116 (colorectal carcinoma cell line), STAU1-knockout HCT116 [46], and HEK293T (human embryonic kidney cell line) cells were cultured in Dulbecco modified Eagle’s medium (DMEM, Wisent) supplemented with 10% fetal bovine serum (Wisent), 100 μg/mL streptomycin, and 100 units/mL penicillin (Wisent Inc, St-Bruno, QC, Canada) under 5% CO2 atmosphere.

Mechanistically, phosphomimicry on serine 20 alters the ability of STAU1 to regulate translation and the decay of STAU1-bound mRNAs, indicating that the posttranscriptional regulation of mRNAs by STAU1 controls the balance between proliferation and apoptosis.

These results suggest that STAU1 is a sensor that controls the balance between cell proliferation and apoptosis, and, therefore, may be considered as a novel therapeutic target against cancer.

In this paper, we show that a modest increase in STAU1 expression in cancer cells triggers apoptosis as early as 12 h post-transfection and impairs proliferation in non-apoptotic cells for several days.

Show Full Abstract

Staufen 1 (STAU1) is an RNA-binding protein that is essential in untransformed cells. In cancer cells, it is rather STAU1 overexpression that impairs cell proliferation. In this paper, we show that a modest increase in STAU1 expression in cancer cells triggers apoptosis as early as 12 h post-transfection and impairs proliferation in non-apoptotic cells for several days. Interestingly, a mutation that mimics the phosphorylation of STAU1 serine 20 is sufficient to cause these phenotypes, indicating that serine 20 is at the heart of the molecular mechanism leading to apoptosis. Mechanistically, phosphomimicry on serine 20 alters the ability of STAU1 to regulate translation and the decay of STAU1-bound mRNAs, indicating that the posttranscriptional regulation of mRNAs by STAU1 controls the balance between proliferation and apoptosis. Unexpectedly, the expression of RBD2<sup>S20D</sup>, the N-terminal 88 amino acids with no RNA-binding activity, is sufficient to induce apoptosis via alteration, in trans, of the posttranscriptional functions of endogenous STAU1. These results suggest that STAU1 is a sensor that controls the balance between cell proliferation and apoptosis, and, therefore, may be considered as a novel therapeutic target against cancer.

Also flagged:Calcium PhosphateVancomycinbone diseases5-FluorouracilInterferon-methicillin
Journal Article 2022-07-01 No Snippets Prosolov KA, Komarova EG, Kazantseva EA, Lozhkomoev AS, Kazantsev SO, Bakina OV, Mishina MV, Zima AP, Krivoshchekov SV, Khlusov IA, Sharkeev YP.
Show Full Abstract

Drug delivery systems based on calcium phosphate (CaP) coatings have been recently recognized as beneficial drug delivery systems in complex cases of bone diseases for admission of drugs in the localized area, simultaneously inducing osteoinduction because of the bioavailable Ca and P ions. However, micro-arc oxidation (MAO) deposition of CaP does not allow for the formation of a coating with sufficient interconnected porosity for drug delivery purposes. Here, we report on the method to deposit CaP-based coatings using a new hybrid ultrasound-assisted MAO (UMAOH) method for deposition of coatings for drug delivery that could carry various types of drugs, such as cytostatic, antibacterial, or immunomodulatory compositions. Application of UMAOH resulted in coatings with an Ra roughness equal to 3.5 µm, a thickness of 50-55 µm, and a combination of high values of internal and surface porosity, 39 and 28%, respectively. The coating is represented by the monetite phase that is distributed in the matrix of amorphous CaP. Optimal conditions of coating deposition have been determined and used for drug delivery by impregnation with Vancomycin, 5-Fluorouracil, and Interferon-α-2b. Cytotoxicity and antimicrobial activity of the manufactured drug-carrying coatings have been studied using the three different cell lines and methicillin-resistant <i>S. aureus</i>.

Also flagged:cirrhosispathogenesisneoplasiaHepatitisHepatic neoplasmsgastrointestinal disease
Journal Article 2022-07-01 ✓ 2 Snippets Reed TJ, D'Ambrosio D, Knollmann-Ritschel BEC.
In-Text Gene Mentions

…fatty liver disease,hemochromatosis, Wilson disease, and…

…alcoholic liver disease,hemochromatosis, and hepatic venous…

Show Full Abstract

No abstract available.

Also flagged:nucleosomenucleosomessignal-dependent transcription factorsbindingchromatinnucleus
Journal Article 2022-07-01 ✓ 1 Snippet Kim J, Sheu KM, Cheng QJ, Hoffmann A, Enciso G.
In-Text Gene Mentions

linker histones

Show Full Abstract

The genomic positions of nucleosomes are a defining feature of the cell's epigenomic state, but signal-dependent transcription factors (SDTFs), upon activation, bind to specific genomic locations and modify nucleosome positioning. Here we leverage SDTFs as perturbation probes to learn about nucleosome dynamics in living cells. We develop Markov models of nucleosome dynamics and fit them to time course sequencing data of DNA accessibility. We find that (1) the dynamics of DNA unwrapping are significantly slower in cells than reported from cell-free experiments, (2) only models with cooperativity in wrapping and unwrapping fit the available data, (3) SDTF activity produces the highest eviction probability when its binding site is adjacent to but not on the nucleosome dyad, and (4) oscillatory SDTF activity results in high location variability. Our work uncovers the regulatory rules governing SDTF-induced nucleosome dynamics in live cells, which can predict chromatin accessibility alterations during inflammation at single-nucleosome resolution.

Also flagged:CaMKIIbindingkinasephosphorylationCa 2+ /calmodulin-dependent protein kinase IICaM
Journal Article 2022-07-01 ✓ 1 Snippet Özden C, Sloutsky R, Mitsugi T, Santos N, Agnello E, Gaubitz C, Foster J, Lapinskas E, Esposito EA, Saneyoshi T, Kelch BA, Garman SC, Hayashi Y, Stratton MM.
In-Text Gene Mentions

…other hand, densin-180 (LRRC7) is a postsynaptic…

Show Full Abstract

Ca<sup>2+</sup>/calmodulin-dependent protein kinase II (CaMKII) is a signaling protein required for long-term memory. When activated by Ca<sup>2+</sup>/CaM, it sustains activity even after the Ca<sup>2+</sup> dissipates. In addition to the well-known autophosphorylation-mediated mechanism, interaction with specific binding partners also persistently activates CaMKII. A long-standing model invokes two distinct S and T sites. If an interactor binds at the T-site, then it will preclude autoinhibition and allow substrates to be phosphorylated at the S site. Here, we specifically test this model with X-ray crystallography, molecular dynamics simulations, and biochemistry. Our data are inconsistent with this model. Co-crystal structures of four different activators or substrates show that they all bind to a single continuous site across the kinase domain. We propose a mechanistic model where persistent CaMKII activity is facilitated by high-affinity binding partners that kinetically compete with autoinhibition by the regulatory segment to allow substrate phosphorylation.

Also flagged:tenosynovialgiant cell tumorDiffuse-type tenosynovial giant cell tumorTGCTpathogenesiscolony-stimulating factor 1
Journal Article 2022-07-01 No Snippets Palmerini E, Staals EL.
Show Full Abstract

<h4>Purpose of review</h4>Diffuse-type tenosynovial giant cell tumor (dt-TGCT) is a benign clonal neoplastic proliferation arising from the synovium. Patients are often symptomatic, require multiple surgical procedures during their lifetime, and have reduced quality of life (QoL). Surgery is the main treatment with relapse rates ranging from 14 to 55%. The treatment strategy for patients with dt-TGCT is evolving. The purpose of this review is to describe current treatment options, and to highlight recent developments in the knowledge of the molecular pathogenesis of dt-TGCT as well as related therapeutic implications.<h4>Recent findings</h4>TGCT cells overexpress colony-stimulating factor 1 (CSF1), resulting in recruitment of CSF1 receptor (CSF1R)-bearing macrophages that are polyclonal and make up the bulk of the tumor, has led to clinical trials with CSF1R inhibitors. These inhibitors include small molecules such as pexidatinib, imatinib, nilotinib, DCC-3014 (vimseltinib), and the monoclonal antibody RG7155 (emactuzumab).<h4>Summary</h4>In conclusion, D-TGCT impairs patients' QoL. The evidence that the pathogenetic loop of D-TGCT can be inhibited has changed the therapeutic armamentarium for this condition. Clinical trials of agents that target CSF1R are currently ongoing. All this new evidence should be taken into consideration within multidisciplinary management.

Also flagged:MitochondrialMitochondriacoronavirus disease 2019COVID-19viral infectionmitochondrion-related
Journal Article 2022-07-01 ✓ 4 Snippets Duan C, Ma R, Zeng X, Chen B, Hou D, Liu R, Li X, Liu L, Li T, Huang H.
In-Text Gene Mentions

The Venn diagram shows that the following 14 mitochondrion-related genes were upregulated in the blood of patients with COVID-19 in both datasets: IFI27, IFIH1, IFIT2, IFI6, OAS1, XAF1, IFIT3, CMPK2, RSAD2, GLDC, CCNB1, TYMS, CDK1, and OLFM4 (Figure 5C).

…NUBPL, MTERF1, FOXO3,VRK2, TRAK1, SGK1, OPA3,…

…TYMS, CDK1, andOLFM4( Figure 5C…

…TYMS, CDK1, andOLFM4, were upregulated.…

Show Full Abstract

Mitochondria get caught in the crossfire of coronavirus disease 2019 (COVID-19) and antiviral immunity. The mitochondria-mediated antiviral immunity represents the host's first line of defense against viral infection, and the mitochondria are important targets of COVID-19. However, the specific manifestations of mitochondrial damage in patients with COVID-19 have not been systematically clarified. This study comprehensively analyzed one single-cell RNA-sequencing dataset of lung tissue and two bulk RNA-sequencing datasets of blood from COVID-19 patients. We found significant changes in mitochondrion-related gene expression, mitochondrial functions, and related metabolic pathways in patients with COVID-19. SARS-CoV-2 first infected the host alveolar epithelial cells, which may have induced excessive mitochondrial fission, inhibited mitochondrial degradation, and destroyed the mitochondrial calcium uniporter (MCU). The type II alveolar epithelial cell count decreased and the transformation from type II to type I alveolar epithelial cells was blocked, which exacerbated viral immune escape and replication in COVID-19 patients. Subsequently, alveolar macrophages phagocytized the infected alveolar epithelial cells, which decreased mitochondrial respiratory capacity and activated the ROS-HIF1A pathway in macrophages, thereby aggravating the pro-inflammatory reaction in the lungs. Infected macrophages released large amounts of interferon into the blood, activating mitochondrial IFI27 expression and destroying energy metabolism in immune cells. The plasma differentiation of B cells and lung-blood interaction of regulatory T cells (Tregs) was exacerbated, resulting in a cytokine storm and excessive inflammation. Thus, our findings systematically explain immune escape and excessive inflammation seen during COVID-19 from the perspective of mitochondrial quality imbalance.

Also flagged:Sevofluranesynapsiscognitionmyelinbehavioraltau
Journal Article 2022-07-01 ✓ 2 Snippets Cheng Y, Liu S, Zhang L, Jiang H.
In-Text Gene Mentions

Relative mRNA level of LRP6, DCC didn’t alter after sevoflurane exposure (n = 5, p = 0.7127 and p = 0.7065, respectively, one-way ANOVA).

…listed as follow:DCC: F: GCCGACCCTAGAAAGTGC, R:…

Show Full Abstract

Clinical trials and animal studies have indicated that long-term use or multiple administrations of anesthesia may lead to fine motor impairment in the developing brain. Most studies on anesthesia-induced neurotoxicity have focused on the hippocampus and prefrontal cortex (PFC); however, the role of other vital encephalic regions, such as the amygdala, is still unclear. Herein, we focused on sevoflurane, the most commonly used volatile anesthetic in infants, and performed a transcriptional analysis of the PFC and amygdala of macaques after multiple exposures to the anesthetic by RNA sequencing. The overall, overlapping, and encephalic region-specific transcriptional patterns were separately analyzed to reveal their functions and differentially expressed gene sets that were influenced by sevoflurane. Specifically, functional, protein-protein interaction, neighbor gene network, and gene set enrichment analyses were performed. Further, we built the basic molecular feature of the amygdala by comparing it to the PFC. In comparison with the amygdala's changing pattern following sevoflurane exposure, functional annotations of the PFC were more enriched in glial cell-related biological functions than in neuron and synapsis development. Taken together, transcriptional studies and bioinformatics analyses allow for an improved understanding of the primate PFC and amygdala.

Also flagged:17β-EstradiolReproductionestrogensteroidmetabolismestrogen receptors
Journal Article 2022-07-01 No Snippets Hanlon C, Ziezold CJ, Bédécarrats GY.
Show Full Abstract

Estradiol-17β (E<sub>2</sub>) has long been studied as the primary estrogen involved in sexual maturation of hens. Due to the oviparous nature of avian species, ovarian production of E<sub>2</sub> has been indicated as the key steroid responsible for activating the formation of the eggshell and internal egg components in hens. This involves the integration and coordination between ovarian follicular development, liver metabolism and bone physiology to produce the follicle, yolk and albumen, and shell, respectively. However, the ability of E<sub>2</sub> to be synthesized by non-gonadal tissues such as the skin, heart, muscle, liver, brain, adipose tissue, pancreas, and adrenal glands demonstrates the capability of this hormone to influence a variety of physiological processes. Thus, in this review, we intend to re-establish the role of E<sub>2</sub> within these tissues and identify direct and indirect integration between the control of reproduction, metabolism, and bone physiology. Specifically, the sources of E<sub>2</sub> and its activity in these tissues via the estrogen receptors (ERα, ERβ, GPR30) is described. This is followed by an update on the role of E<sub>2</sub> during sexual differentiation of the embryo and maturation of the hen. We then also consider the implications of the recent discovery of additional E<sub>2</sub> elevations during an extended laying cycle. Next, the specific roles of E<sub>2</sub> in yolk formation and skeletal development are outlined. Finally, the consequences of altered E<sub>2</sub> production in mature hens and the associated disorders are discussed. While these areas of study have been previously independently considered, this comprehensive review intends to highlight the critical roles played by E<sub>2</sub> to alter and coordinate physiological processes in preparation for the laying cycle.

Also flagged:cancermesotheliomaGene expressiontumorAUNIPFANCI
Journal Article 2022-07-01 ✓ 1 Snippet Zhang S, Li S, Wei Y, Xiong Y, Liu Q, Hu Z, Zeng Z, Tang F, Ouyang Y.
In-Text Gene Mentions

…CTLA4, NRP1, TNFRSF25,TNFSF4, TNFSF9, were markedly…

Show Full Abstract

Messenger RNA vaccines are considered to be a promising strategy in cancer immunotherapy, while their application on mesothelioma is still largely uncharacterized. This study aimed to identify potential antigens in mesothelioma for anti-mesothelioma mRNA vaccine development, and further determine the immune subtypes of mesothelioma for selection of suitable candidates from an extremely heterogeneous population. Gene expression data and corresponding clinicopathological information were obtained from the TCGA and gene expression omnibus, respectively. Then, the genetic alterations were compared and visualized using cBioPortal, and differentially expressed genes and their prognostic signatures were identified by GEPIA. The relationship between tumor-infiltrating immune cells and the expression of tumor antigens was systematically evaluated by TIMER online. Finally, the immune subtypes and immune landscape of mesothelioma were separately analyzed using consensus cluster and graph learning-based dimensional reduction. A total of five potential tumor antigens correlated with prognosis and infiltration of antigen-presenting cells, including AUNIP, FANCI, LASP1, PSMD8, and XPO5 were identified. Based on the expression of immune-related genes, patients with mesothelioma were divided into two immune subtypes (IS1 and IS2). Each subtype exhibited differential molecular, cellular and clinical properties. Patients with the IS1 subtype were characterized by an immune "cold" phenotype, displaying superior survival outcomes, whereas those with the IS2 subtype were characterized by an immune "hot" and immunosuppressive phenotype. Furthermore, immune checkpoints and immunogenic cell death modulators were differentially expressed between the IS1 and IS2 immune subtype tumors. The immunogenomic landscape of mesothelioma revealed a complex tumor immune microenvironment between individual patients. AUNIP, FANCI, LASP1, PSMD8, and XPO5 are putative antigens for the development of anti-mesothelioma mRNA vaccine and patients with the IS1 subtype may be considered for vaccination.

Also flagged:Deathmembranesilicamembranesmitochondrialdepolarization
Journal Article 2022-07-01 ✓ 2 Snippets Leinardi R, Longo Sanchez-Calero C, Huaux F.
In-Text Gene Mentions

…receptors (UNC5B andDCC) through the activation…

DCC Netrin 1 receptorNetrin 1 receptor…

Show Full Abstract

The prolonged perturbation of the immune system following the release of a plethora of self-molecules (known as damage-associated molecular patterns, DAMPs) by stressed or dying cells triggers acute and chronic pathological responses. DAMPs are commonly released after plasma membrane damage or complete rupture due to immunogenic cell death (ICD), upon numerous stressors including infectious and toxic agents. The set of DAMPs released after ICD include mature proinflammatory cytokines and alarmins, but also polymeric macromolecules. These self-intracellular components are recognized by injured and healthy surrounding cells <i>via</i> innate receptors, and induce upregulation of stress-response mechanisms, including inflammation. In this review, by overstepping the simple toxicological evaluation, we apply ICD and DAMP concepts to silica cytotoxicity, providing new insights on the mechanisms driving the progress and/or the exacerbation of certain SiO<sub>2</sub>-related pathologies. Finally, by proposing self-DNA as new crucial DAMP, we aim to pave the way for the development of innovative and easy-to-perform predictive tests to better identify the hazard of fine and ultrafine silica particles. Importantly, such mechanisms could be extended to nano/micro plastics and diesel particles, providing strategic advice and reports on their health issues.

Also flagged:Neuropsychiatric Disorderscognitionsucroseneuropsychiatric disorderdepressionanxiety
Journal Article 2022-07-01 No Snippets Zhang YH, Wang N, Lin XX, Wang JY, Luo F.
Show Full Abstract

Cognitive biases can arise from cognitive processing under affective states and reflect the impact of emotion on cognition. In animal studies, the existing methods for detecting animal emotional state are still relatively limited, and cognitive bias test has gradually become an important supplement. In recent years, its effectiveness in animal research related to neuropsychiatric disorders has been widely verified. Some studies have found that cognitive bias test is more sensitive than traditional test methods such as forced swimming test and sucrose preference test in detecting emotional state. Therefore, it has great potential to become an important tool to measure the influence of neuropsychiatric disorder-associated emotions on cognitive processing. Moreover, it also can be used in early drug screening to effectively assess the potential effects or side effects of drugs on affective state prior to clinical trials. In this mini-review, we summarize the application of cognitive bias tests in animal models of neuropsychiatric disorders such as depression, anxiety, bipolar disorder, and pain. We also discussed its critical value in the identification of neuropsychiatric disorders and the validation of therapeutic approaches.

Also flagged:E3 Ubiquitin Ligasesmembraneendoplasmic reticulumGolgi apparatuslysosomemitochondria
Journal Article 2022-07-01 ✓ 2 Snippets Chen X, Jiang L, Zhou Z, Yang B, He Q, Zhu C, Cao J.
In-Text Gene Mentions

CDK1 and CDK2 promote KLHL20-mediated degranulation of PML, and Pin1-mediated proline isomerization promotes the recruitment of PML to KLHL20.

KLHL20 is an important Golgi E3 protein, which regulates carcinogenesis through many different pathways, including metabolic reprogramming, cell metastasis, tumor angiogenesis and tumor growth.

Show Full Abstract

The cell membrane system comprises the plasma membrane, endoplasmic reticulum, Golgi apparatus, lysosome, mitochondria, and nuclear membrane, which are essential for maintaining normal physiological functions of cells. The proteins associated with these membrane-organelles are frequently modified to regulate their functions, the most common of which is ubiquitin modification. So far, many ubiquitin E3 ligases anchored in the membrane system have been identified as critical players facilitating intracellular biofunctions whose dysfunction is highly related to cancer. In this review, we summarized membrane-associated E3 ligases and revealed their relationship with cancer, which is of great significance for discovering novel drug targets of cancer and may open up new avenues for inducing ubiquitination-mediated degradation of cancer-associated membrane proteins <i>via</i> small chemicals such as PROTAC and molecular glue.

Also flagged:ShikoninsynthesisAcetylshikonin1,4-naphthoquinonegeranyl diphosphatemevalonate
Journal Article 2022-07-01 No Snippets Yadav S, Sharma A, Nayik GA, Cooper R, Bhardwaj G, Sohal HS, Mutreja V, Kaur R, Areche FO, AlOudat M, Shaikh AM, Kovács B, Mohamed Ahmed AE.
Show Full Abstract

Shikonin and its derivatives, isolated from traditional medicinal plant species of the genus <i>Lithospermum, Alkanna, Arnebia, Anchusa, Onosma, and Echium</i> belonging to the Boraginaceae family, have numerous applications in foods, cosmetics, and textiles. Shikonin, a potent bioactive red pigment, has been used in traditional medicinal systems to cure various ailments and is well known for its diverse pharmacological potential such as anticancer, antithrombotic, neuroprotective, antidiabetic, antiviral, anti-inflammatory, anti-gonadotropic, antioxidants, antimicrobial and insecticidal. Herein, updated research on the natural sources, pharmacology, toxicity studies, and various patents filed worldwide related to shikonin and approaches to shikonin's biogenic and chemical synthesis are reviewed. Furthermore, recent studies to establish reliable production systems to meet market demand, functional identification, and future clinical development of shikonin and its derivatives against various diseases are presented.

Also flagged:pathogenesisinfectious diseasesinfectioncoronavirus disease 2019COVID-19organization
Journal Article 2022-07-01 No Snippets Kim MB, Hwangbo S, Jang S, Jo YK.
Show Full Abstract

The recent spike in the instances of complex physiological host-microbe interactions has raised the demand for developing <i>in vitro</i> models that recapitulate the microbial microenvironment in the human body. Organoids are steadily emerging as an <i>in vitro</i> culture system that closely mimics the structural, functional, and genetic features of complex human organs, particularly for better understanding host-microbe interactions. Recent advances in organoid culture technology have become new avenues for assessing the pathogenesis of symbiotic interactions, pathogen-induced infectious diseases, and various other diseases. The co-cultures of organoids with microbes have shown great promise in simulating host-microbe interactions with a high level of complexity for further advancement in related fields. In this review, we provide an overview of bioengineering approaches for microbe-co-cultured organoids. Latest developments in the applications of microbe-co-cultured organoids to study human physiology and pathophysiology are also highlighted. Further, an outlook on future research on bioengineered organoid co-cultures for various applications is presented.

Also flagged:SOCS2EREGCX3CR1PLA2G4ARUNX1T1VCAN
Journal Article 2022-07-01 No Snippets Wu J, Zhang L, Wu S, Liu Z.
Show Full Abstract

Ferroptosis, a new way of cell death, is involved in many cancers. A growing number of studies have focused on the unique role of ferroptosis on endometrial cancer. In this study, we made a comprehensive review of the relevant articles published to get deep insights in the association of ferroptosis with endometrial cancer and to present a summary of the roles of different ferroptosis-associated genes. Accordingly, we made an evaluation of the relationships between the ferroptosis-associated genes and TNM stage, tumor grade, histological type, primary therapy outcome, invasion and recurrence of tumor, and accessing the different prognosis molecular typing based on ferroptosis-associated genes. In addition, we presented an introduction of the common drugs, which targeted ferroptosis in endometrial cancer. In so doing, we clarified the opportunities and challenges of ferroptosis activator application in treating endometrial cancer, with a view to provide a novel approach to the disease.

Also flagged:nanoparticlephthalocyaninefolic acidsodiumGlutamineelectron
Journal Article 2022-07-01 ✓ 1 Snippet Ntsimango S, Gandidzanwa S, Joseph SV, Hosten EC, Randall M, Edkins AL, Khene SM, Mashazi P, Nyokong T, Abrahams A, Tshentu ZR.
In-Text Gene Mentions

DCC

Show Full Abstract

A novel alternative route to access rhenium(V)-phthalocyanine complexes through direct metalation of metal-free phthalocyanines (H<sub>2</sub> Pcs) with a rhenium(VII) salt in the presence of various two-electron reducing agents is presented. Direct ion metalation of tetraamino- or tetranitrophthalocyanine with perrhenate (ReO<sub>4</sub><sup>-</sup> ) in the presence of triphenylphosphine led to oxidative decomposition of the H<sub>2</sub> Pcs, giving their respective phthalonitriles. Conversely, treatment of H<sub>2</sub> Pcs with ReO<sub>4</sub><sup>-</sup> employing sodium metabisulfite yielded the desired Re<sup>V</sup> O-Pc complex. Finally, reaction of H<sub>2</sub> Pcs with ReO<sub>4</sub><sup>-</sup> and NaBH<sub>4</sub> as reducing agent led to the formation of rhenium oxide (Re<sub>x</sub> O<sub>y</sub> ) nanoparticles (NPs). The NP synthesis was optimised, and the Re<sub>x</sub> O<sub>y</sub> NPs were capped with folic acid (FA) conjugated with tetraaminophthalocyanine (TAPc) to enhance their cancer cell targeting ability. The cytotoxicity profile of the resultant Re<sub>x</sub> O<sub>y</sub> -TAPc-FA NPs was assessed and found to be greater than 80 % viability in four cell lines, namely, MDA-MB-231, HCC7, HCC1806 and HEK293T. Non-cytotoxic concentrations were determined and employed in cancer cell localization studies. The particle size effect on localization of NPs was also investigated using confocal fluorescence and transmission electron microscopy. The smaller NPs (≈10 nm) were found to exhibit stronger fluorescence properties than the ≈50 nm NPs and exhibited better cell localization ability than the ≈50 nm NPs.

Also flagged:PTENLKB1Gli1Cowden syndromePeutz-Jeghers syndromegastrointestinal polyps
Journal Article 2022-07-01 ✓ 2 Snippets Cotton JL, Dang K, Hu L, Sun Y, Singh A, Rajurkar MS, Li Q, Wu X, Mao J.
In-Text Gene Mentions

However, nuclear β-catenin accumulation was not detected in the polyps of both mouse models (Figures S4A and S4B), and we did not detect up-regulation of intestinal stem cells in polyp epithelium, measured by IHC of the intestinal stem cell marker Olfm4 (Figure S5C), further supporting the notion that these polyps are distinct from the canonical polyps or adenomas.

…stem cell markerOlfm4( Figure S5C…

Show Full Abstract

PTEN and LKB1 are intimately associated with gastrointestinal tumorigenesis. Mutations of PTEN or LKB1 lead to Cowden syndrome and Peutz-Jeghers syndrome characterized by development of gastrointestinal polyps. However, the cells of origin of these polyps and underlying mechanism remain unclear. Here, we reveal that PTEN or LKB1 deficiency in Gli1+ gut mesenchymal cells, but not intestinal epithelium, drives polyp formation histologically resembling polyposis in human patients. Mechanistically, although PTEN and LKB1 converge to regulate mTOR/AKT signaling in various tumor contexts, we find that mTOR is essential for PTEN-deletion-induced polyp formation but is largely dispensable for polyposis induced by mesenchymal LKB1 deficiency. Altogether, our studies identify Gli1-expressing mesenchymal cells as a common cell of origin for polyposis associated with PTEN and LKB1 and reveal their engagement of different downstream pathways in gut mesenchyme to suppress gastrointestinal tumorigenesis.

Also flagged:Neuropilin-2prostate cancertumorcancercell surfaceNRP2
Journal Article 2022-07-01 ✓ 2 Snippets Islam R, Mishra J, Polavaram NS, Bhattacharya S, Hong Z, Bodas S, Sharma S, Bouska A, Gilbreath T, Said AM, Smith LM, Teply BA, Muders MH, Batra SK, Datta K, Dutta S.
In-Text Gene Mentions

Our RNA-seq data revealed that REST-repressed genes, such as SYP, CHGA, and INSM1; transcription factors regulating NE differentiation, such as SOX2, POU3F2, and NKX2–1; and other genes involved in NE-like cancers, such as NCAM1 and MYCN were significantly upregulated in the developed NE-like cells.

…as SOX2 ,POU3F2, and NKX2–1…

Show Full Abstract

Neuroendocrine (NE)-like tumors secrete various signaling molecules to establish paracrine communication within the tumor milieu and to create a therapy-resistant environment. It is important to identify molecular mediators that regulate this secretory phenotype in NE-like cancer. The current study highlights the importance of a cell surface molecule, Neuropilin-2 (NRP2), for the secretory function of NE-like prostate cancer (PCa). Our analysis on different patient cohorts suggests that NRP2 is high in NE-like PCa. We have developed cell line models to investigate NRP2's role in NE-like PCa. Our bioinformatics, mass spectrometry, cytokine array, and other supporting experiments reveal that NRP2 regulates robust secretory phenotype in NE-like PCa and controls the secretion of factors promoting cancer cell survival. Depletion of NRP2 reduces the secretion of these factors and makes resistant cancer cells sensitive to chemotherapy in vitro and in vivo. Therefore, targeting NRP2 can revert cellular secretion and sensitize PCa cells toward therapy.

Also flagged:Polycystic Ovary SyndromePCOSinfertilitygene expressionAURKACDC25C
Journal Article 2022-07-01 ✓ 1 Snippet Sutaji Z, Elias MH, Ahmad MF, Karim AKA, Abu MA.
In-Text Gene Mentions

…common DEGs (CD9,PCDH17, ALDH1L1, CD9 and…

Show Full Abstract

Polycystic ovary syndrome (PCOS) is a common disorder with wide-ranging clinical heterogeneity that causes infertility. However, the comprehensive molecular mechanisms of PCOS in causing infertility is remaining unclear. Hence, a comprehensive literature search was conducted using PubMed, Scopus, EBSCOhost, and Science Direct. Medical Subject Heading (MeSH) terms like PCOS, gene expression, implantation window and endometrium were used as the keywords. From 138 studies retrieved, original articles with RNA profiling on human endometrial tissues in PCOS women during the implantation window were included. Study design, sample size, sample type, method, and differentially expressed genes (DEGs) were identified from all publications. The DEGs were analyzed using the software packages DAVID, STRING, and Cytoscape. Three studies that met inclusion criteria were included, and 368 DEGs were identified. Twelve significant clusters from the protein-protein interaction network (PPI) complex were found, and cluster 1 showed very high intermolecular interactions. Five candidate genes (AURKA, CDC25C, KIF23, KIF2C, and NDC80) were identified from the systematic review and integrated bioinformatics analysis. It is concluded that cell cycle is the fundamental biological processes that were dysregulated in the endometrium of PCOS women, affecting decidualization progression in the endometrium during the implantation window.

Also flagged:IDOGallic Acidindoleamine 2,3-dioxygenasemelanomatumorimmune response
Journal Article 2022-07-01 No Snippets Liu H, Gao H, Chen C, Jia W, Xu D, Jiang G.
Show Full Abstract

In this study, we synthesized a molecule GA-1MT (GM) composed of indoleamine 2,3-dioxygenase (IDO) inhibitor (1-methyl-d-tryptophan, 1MT) called NLG8189 and gallic acid (GA) and verified its therapeutic effect on B16F10 melanoma cells and an orthotopic tumor-bearing mouse model. The synthesized molecule GM was analyzed by <sup>1</sup>H NMR and mass spectrometry (MS). In addition, we confirmed that GM could mediate the immune response in the B16F10 cell tumor model by flow cytometry and immunofluorescence. The synthesized GM molecule could increase the solubility of 1MT to enhance the drug efficacy and lower costs. Moreover, GM could inhibit melanoma growth by combining 1MT and GA. <i>In vivo</i> experiments showed that GM could effectively inhibit the expression of tyrosinase, regulate the proportion of CD4<sup>+</sup> T cells, CD8<sup>+</sup> T cells, and regulatory T cells (T<sub>reg</sub> cells) in tumors, and significantly suppress melanoma growth. The newly synthesized drug GM could more effectively inhibit melanoma than GA and 1MT alone or in combination.

Also flagged:MST1mTORC1STAT1BCRCCR2SLE
Journal Article 2022-07-01 ✓ 1 Snippet Zhu Y, Gu H, Yang L, Li N, Chen Q, Kang D, Lin S, Jing Y, Jiang P, Chen Q, Luo L, Liu J, Chang J, Li Z, Wang Y, Dai X, Miller H, Westerberg LS, Park CS, Kubo M, Gong Q, Dong L, Liu C.
In-Text Gene Mentions

Cell differentiation‐associated molecule mTOR complex 1differentiation‐associated mol…

Show Full Abstract

<h4>Background</h4>CCR2 is involved in maintaining immune homeostasis and regulating immune function. This study aims to elucidate the mechanism by which CCR2 regulates B-cell signalling.<h4>Methods</h4>In Ccr2-knockout mice, the development and differentiation of B cells, BCR proximal signals, actin movement and B-cell immune response were determined. Besides, the level of CCR2 in PBMC of SLE patients was analysed by bioinformatics.<h4>Results</h4>CCR2 deficiency reduces the proportion and number of follicular B cells, upregulates BCR proximal signalling and enhances the oxidative phosphorylation of B cells. Meanwhile, increased actin filaments aggregation and its associated early-activation events of B cells are also induced by CCR2 deficiency. The MST1/mTORC1/STAT1 axis in B cells is responsible for the regulation of actin remodelling, metabolic activities and transcriptional signalling, specific MST1, mTORC1 or STAT1 inhibitor can rescue the upregulated BCR signalling. Glomerular IgG deposition is obvious in CCR2-deficient mice, accompanied by increased anti-dsDNA IgG level. Additionally, the CCR2 expression in peripheral B cells of SLE patients is decreased than that of healthy controls.<h4>Conclusions</h4>CCR2 can utilise MST1/mTORC1/STAT1 axis to regulate BCR signalling. The interaction between CCR2 and BCR may contribute to exploring the mechanism of autoimmune diseases.

Also flagged:uptakeluciferaseNTAHEKExtracellularvesicles
Journal Article 2022-07-01 ✓ 1 Snippet Liang X, Niu Z, Galli V, Howe N, Zhao Y, Wiklander OPB, Zheng W, Wiklander RJ, Corso G, Davies C, Hean J, Kyriakopoulou E, Mamand DR, Amin R, Nordin JZ, Gupta D, Andaloussi SE.
In-Text Gene Mentions

…120 min forC57BL/six micemice).…

Show Full Abstract

Extracellular vesicles (EVs) have shown promise as potential therapeutics for the treatment of various diseases. However, their rapid clearance after administration could be a limitation in certain therapeutic settings. To solve this, an engineering strategy is employed to decorate albumin onto the surface of the EVs through surface display of albumin binding domains (ABDs). ABDs were either included in the extracellular loops of select EV-enriched tetraspanins (CD63, CD9 and CD81) or directly fused to the extracellular terminal of single transmembrane EV-sorting domains, such as Lamp2B. These engineered EVs exert robust binding capacity to human serum albumins (HSA) in vitro and mouse serum albumins (MSA) after injection in mice. By binding to MSA, circulating time of EVs dramatically increases after different routes of injection in different strains of mice. Moreover, these engineered EVs show considerable lymph node (LN) and solid tumour accumulation, which can be utilized when using EVs for immunomodulation, cancer- and/or immunotherapy. The increased circulation time of EVs may also be important when combined with tissue-specific targeting ligands and could provide significant benefit for their therapeutic use in a variety of disease indications.

Also flagged:Hepatic SteatosisChronic Hepatitis BEntecavirTenofovir Disoproxil Fumaratedeoxyribonucleic acidsteatohepatitis
Journal Article 2022-07-01 ✓ 1 Snippet Atalay R, Sayar S, Ayrancı FG, Çakmak Ş, Tanboğa İH, Doğanay L, Özdil K.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>The effect of hepatic steatosis on the response to antiviral therapy administered in chronic hepatitis B patients is yet to be clarified. In this study, our aim was to determine the effect of hepatic steatosis on the virological response in chronic hepatitis B patients who were treated with entecavir or tenofovir disoproxil fumarate.<h4>Methods</h4>This retrospective cohort study was performed using the data of liver biopsy-proven chronic hepatitis B patients with or without hepatic steatosis, who received entecavir or tenofovir disoproxil fumarate treatment between 2012 and 2017. The undetectable serum hepatitis B virus deoxyribonucleic acid level under treatment was defined as the complete virological response. The predictors of virological response were determined, and it was checked whether the virological response was affected by hepatic steatosis in chronic hepatitis B patients who have undergone entecavir or tenofovir disoproxil fumarate treatment.<h4>Results</h4>A total of 324 chronic hepatitis B patients, of which 203 (63%) were males, were included in the study. The median age of the patients was 42 years (range: 35-51 years). Hepatic steatosis was observed in 25% of the patients, and steatohepatitis in 4%. The median time to complete virological response was found to be 6 months (range: 3-9 months). In the full analysis model, the log hepatitis B virus deoxyribonucleic acid was determined as the factor most associated with virological response (P < .001). No statistically signifi- cant relationship was detected between hepatic steatosis and virological response (P = .409).<h4>Conclusion</h4>Concomitant hepatic steatosis has no significant impact on the virological response in chronic hepatitis B patients who have undergone entecavir or tenofovir disoproxil fumarate treatment.

Also flagged:solid tumorssolid epithelial tumorsIL-2IL-15cytokineNKG2D
Journal Article 2022-07-01 No Snippets Bustos X, Snedal S, Tordesillas L, Pelle E, Abate-Daga D.
Show Full Abstract

<h4>Abstract</h4>Conventionally, adoptive cell therapies have been developed and optimized using αβ T cells. However, the understudied and less abundant γδ T cells offer unique advantages to the immunotherapy field especially for therapies against solid tumors. Recently, γδ T-cell potential against a broad spectrum of malignant cells has been demonstrated in the preclinical setting. In the clinic, γδ T-cell-based immunotherapies have proven to be safe; however, their efficacy needs improvement. Considering the growing body of literature reflecting the increasing interest in γδ T cells, we sought to capture the current topics of discussion in the field, pertaining to their use in adoptive immunotherapy. We aimed to compile information about γδ T-cell enhancement in terms of expansion, phenotype, and inhibitory receptors, in addition to the latest advances in preclinical and clinical research using γδ T cells specifically against solid epithelial tumors.

Also flagged:PeptideAntibodyCalcium Phosphatep65NF-κBnuclear factor-kappa B
Journal Article 2022-07-01 No Snippets Müller EK, Białas N, Epple M, Hilger I.
Show Full Abstract

Earlier studies with nanoparticles carrying siRNA were restricted to investigating the inhibition of target-specific protein expression, while almost ignoring effects related to the nanoparticle composition. Here, we demonstrate how the design and surface decoration of nanoparticles impact the p65 nuclear factor-kappa B (NF-κB) protein expression in inflamed leucocytes and endothelial cells in vitro. We prepared silica-coated calcium phosphate nanoparticles carrying encapsulated siRNA against p65 NF-κB and surface-decorated with peptides or antibodies. We show that RGD-decorated nanoparticles are efficient in down-regulating p65 NF-κB protein expression in endothelial cells as a result of an enhanced specific cellular binding and subsequent uptake of nanoparticles. In contrast, nanoparticles decorated with IgG (whether specific or not for CD69) are efficient in down-regulating p65 NF-κB protein expression in T-cells, but not in B-cells. Thus, an optimized nanoparticle decoration with xenogenic IgG may stimulate a specific cellular uptake. In summary, the composition of siRNA-loaded calcium phosphate nanoparticles can either weaken or stimulate p65 NF-κB protein expression in targeted inflamed leucocytes and endothelial cells. In general, unveiling such interactions may be very useful for the future design of anti-p65 siRNA-based nanomedicines for treatment of inflammation-associated diseases.

Also flagged:sepsispolymeraseadenosinemethylationferroptosisPI3K
Journal Article 2022-07-01 ✓ 2 Snippets Liu B, Ao S, Tan F, Ma W, Liu H, Liang H, Yang X, Chi X.
In-Text Gene Mentions

Tang (14) identified seven co-differentially expressed genes (DEGs) of septic shock and AKI, including VMP1, SLPI, PTX3, TIMP1, OLFM4, LCN2 and S100A9, based on gene expression datasets of the Gene Expression Omnibus (GEO), but their gene expression datasets were obtained from peripheral blood samples of humans, not directly from kidney samples of sepsis.

…SLPI, PTX3, TIMP1,OLFM4, LCN2 and S100A9…

Show Full Abstract

<h4>Background</h4>Sepsis-associated acute kidney injury (SA-AKI) is one of the most frequent and serious complications of sepsis. However, the transcriptional regulatory network of the pathophysiological mechanism of the kidney has not been revealed. This study identified new mechanisms in SA-AKI using bioinformatics analyses and laboratory-based experiments.<h4>Methods</h4>We performed transcriptomic profiling of mouse kidneys after cecal ligation and puncture (CLP) to mimic clinical sepsis. RNA from kidney samples from the CLP and control groups was isolated and analyzed using bulk messenger RNA (mRNA)-seq. Differentially expressed genes (DEGs) between the two groups were identified, and GO, KEGG and GSEA pathway enrichment analyses were performed. The protein-protein interaction (PPI) network of DEGs and hub genes was analyzed. The hub genes were verified using quantitative real-time polymerase chain reaction (qPCR) or Western blotting. The interaction network, targeted microRNAs (miRNAs) and long noncoding RNAs (lncRNAs) of hub genes were predicted, and the critical miRNA-hub gene regulatory axis was verified using qPCR, Western blotting, malondialdehyde (MDA) determination and flow cytometry. Correlation analyses of N6-adenosine methylation (m6A) RNA methylation regulators and hub genes and m6A modification analysis were performed.<h4>Results</h4>A total of 4,754 DEGs were identified between the two groups using high-throughput sequencing. The pathways in which DEGs were enriched included ferroptosis (the highest enrichment score), apoptosis, and the PI3K-Akt, NF-kappa B and IL-17 signaling pathways. Seven (<i>Hmox1, Spp1, Socs3, Mapk14, Lcn2, Cxcl1</i> and <i>Cxcl12</i>) of the 15 hub genes were involved in the KEGG pathway. mmu-miR-7212-5p-Hmox1 was a key RNA regulatory axis in ferroptosis. m6A RNA methylation modifications were involved in SA-AKI. The correlation analyses showed the close interactions among the m6A RNA methylation regulators and important hub genes.<h4>Conclusions</h4>The findings of this study provide new insights into the mechanism regulating the occurrence and progression of SA-AKI. The mmu-miR-7212-5p-Hmox1 axis in ferroptosis and m6A RNA methylation regulators may have potential clinical significance for the future treatment of SA-AKI. The datasets generated for this study can be found in the repository of the GEO database (Series number: GSE186822).

Also flagged:chemokinesCaspase recruitment domain-containing protein 8-antisenseCARD8KAT8NSL complex unitKANSL1
Journal Article 2022-07-01 ✓ 2 Snippets Liu H, Zong C, Sun J, Li H, Qin G, Wang X, Zhu J, Yang Y, Xue Q, Liu X.
In-Text Gene Mentions

TNFSF4 is closely associated with therapies that induce anti-tumor immunity and may help induce a promising immune response in breast cancer (57).

TNFSF4is closely associated…

Show Full Abstract

<h4>Background</h4>Osteosarcoma (OS) is a disease with high mortality in children and adolescents, and metastasis is one of its important clinical features. However, the molecular mechanism of OS occurrence is not completely clear. Thus, we screened potential biomarkers of OS and analyze their prognostic value.<h4>Methods</h4>The Cancer Genome Atlas (TCGA) datasets were used to analyze the differential lncRNAs in patients with OS of different immune score and the lncRNAs expressed by immune cells. Cox regression was used to develop the prognosis prediction model and specify the prognosis outcomes. Risk-proportional regression model was constructed, and the samples were divided into high and low groups based on the risk scores for the survival analysis. The areas under the receiver operating characteristic (ROC) curve were calculated and the risk-score model was verified. Finally, using 4 gene sets (comprising chemokines, immune checkpoint blockades, immune activity-related genes, and immune cells), and 4 analysis tools (CIBERSORT, TIMER, XCELL and MCP) to evaluated tumor immune infiltration.<h4>Results</h4>Twenty-nine long non-coding ribonucleic acids (lncRNAs) were obtained from the intersection of the screened lncRNAs. Caspase recruitment domain-containing protein 8-antisense RNA 1 (CARD8-AS1), lncRNA five prime to Xist (FTX), KAT8 regulatory NSL complex unit 1-antisense RNA 1 (KANSL1-AS1), Neuroplastin Intronic Transcript 1 (NPTN-IT1), oligodendrocyte maturation-associated long intervening non-coding RNA (OLMALINC) and RPARP Antisense RNA 1 (RPARP-AS1) were found to be correlated with survival. Univariate and multivariate regression analysis showed risk score [HR (hazard ratio) 3.5, P value 0.0043; HR 3.7, P value 0.0033] and metastasis (HR 4.7, P value 6.60E-05; HR 4.8, P value 8.36E-05) were the key factors of patients with OS. The areas under curves (AUCs) of the 1-, 3-, and 5-year ROC curves of the prognostic model were 0.715, 0.729, and 0.771. The low-risk patients tended to have a high abundance of immune cells.<h4>Conclusions</h4>This study showed that a risk score based on 6 lncRNAs has potential value in the prognosis of OS, and patients with low-risk scores have high immune cell infiltration and good prognosis. This study may enrich understandings of underlying mechanisms related to the occurrence and development of OS.

Also flagged:PTSDtraumapsychological disorder5-hydroxytryptamine transporterreverse transcriptionpolymerase
Journal Article 2022-07-01 ✓ 5 Snippets Wu M, Lin L, Wu Y, Zheng Y, Chen H.
In-Text Gene Mentions

The 5-HTT-encoding gene has been confirmed to be associated with a variety of psychiatric diseases.

In recent years, through modern molecular genetic techniques, several genes have been identified as associated with PTSD susceptibility, including SLC6A4, DRD2, CNR1, 5-HTT, FKBP5, and DAT1, among others (13).

…, CNR1 ,5 - HTT- HTT ,…

…The5-HTT-encoding gene has been…

…S allele of5-HTTgene-linked polymorphic region…

Show Full Abstract

<h4>Background</h4>Post-traumatic stress disorder (PTSD) is a trauma-related psychological disorder with serious social and familial impacts. The involvement of 5-hydroxytryptamine transporter gene-linked polymorphic region (<i>5-HTTLPR</i>) in numerous mental disorders has been documented. This study explored the correlation between <i>5-HTTLPR</i> gene polymorphism and cognitive function in Chinese Han children with PTSD.<h4>Methods</h4>A total of 60 PTSD children treated from December 2019 to December 2021 were selected as study participants, with another 60 healthy children selected as controls. We assessed the cognitive function of participants using the Mini-Mental State Examination (MMSE). Additionally, the PTSD level was estimated by the Children's Revised Impact of Event Scale (CRIES). The <i>5-HTTLPR</i> gene polymorphism was detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR). The genotype and allele frequency were evaluated via case-control association analysis.<h4>Results</h4>Children in the PTSD group showed low MMSE scores and high CRIES scores. In terms of genotype, cases of LL, LS, and SS in PTSD children were 4 (6.67%), 20 (33.3%), and 36 (60.00%), and 18 (30.00%), 28 (46.67%), and 14 (23.33%) cases in healthy controls. In terms of allele gene frequency, incidences of L and S were 23.33% and 76.67% in PTSD children, respectively, and were 53.33% and 46.67% in healthy controls, respectively. Moreover, the CRIES and MMSE scores of LS and SS genotypes were evidently different from those of LL genotype in PTSD children.<h4>Conclusions</h4>Polymorphism of the <i>5-HTTLPR</i> gene is correlated with cognitive dysfunction in Chinese Han children with PTSD.

Also flagged:nucleusneurogenesisNR4A2nuclear receptor 4A2tyrosine hydroxylaseTH
Journal Article 2022-07-01 ✓ 2 Snippets Petese A, Fries FL, Broske B, Stumm R, Blaess S.
In-Text Gene Mentions

…the transcription factorSOX6in the adult…

…derived from aSox6-expressing medial mDA…

Show Full Abstract

Midbrain dopaminergic (mDA) neurons are generated from a ventral midbrain progenitor zone over a time span of several days [embryonic day 10.0 (E10.0) to E14.5 in mouse]. Within this neurogenic period, a progressively changing fate potential of mDA progenitors could contribute to the generation of diverse mDA neuronal subpopulations. To test this idea, we combined inducible genetic fate mapping and intersectional labeling approaches to trace the lineage of cells expressing the chemokine receptor CXCR4. The <i>Cxcr4</i> transcript is expressed in mDA progenitors and precursors, but not in differentiated mDA neurons. <i>Cxcr4</i>-expressing mDA progenitors/precursors labeled at E11.5 develop into a broad range of mDA neurons, whereas labeling of the <i>Cxcr4</i> lineage at later time points (E12.5-E15.5) results in an increasingly restricted contribution to mDA neurons proceeding from lateral to medial in the substantia nigra and from dorsal to ventral in the ventral tegmental area. In parallel, the innervation of dopaminergic projection targets by mDA neurons derived from <i>Cxcr4</i>-expressing cells is becoming more restricted: the late-generated mDA neurons innervate only the medial-rostral regions in the dorsal striatum and only the medial shell in the nucleus accumbens. Our results suggest that mDA progenitor cells become increasingly restricted in their cell fate potential over time.

Also flagged:FOXO1hepatocellular carcinomacancerGene Expressiontumorbinding
Journal Article 2022-07-01 No Snippets Yuan F, Tang Y, Cao M, Ren Y, Li Y, Yang G, Ou Q, Tustumi F, Levi Sandri GB, Raissi D, Pocha C, Deng M, Yao Z.
Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) are important for the process of cancer initiation and progression. However, the role of circRNAs in hepatocellular carcinoma (HCC) remains incompletely understood. Therefore, we further explored the expression network of circRNAs in HCC.<h4>Methods</h4>Whole-transcriptome microarrays of HCC and paired normal liver tissues were obtained from the Gene Expression Omnibus (GEO) database. The structures of tumor-associated circRNAs were acquired by the Cancer-Specific CircRNA Database (CSCD). StarBase, circBank, and R packages (miRNAtap and multiMiR) were used to predict miRNA targets of circRNAs and downstream molecules of miRNAs. Expression relationships between RNA-RNA interactions were evaluated by data from The Cancer Genome Atlas (TCGA) and GEO databases. ClusterProfiler and DOSE R packages were used for pathway enrichment to explore the biological functions of potential target genes. Finally, a possible circRNA-miRNA-mRNA regulatory network was established based on the competing endogenous RNA (ceRNA) hypothesis.<h4>Results</h4>The differentially expressed circRNAs (DECs) were matched with cancer-specific circRNAs in the CSCD database and a screening analysis was performed to obtain 5 cancer-specific circRNAs. A total of 329 possible target miRNAs for 5 cancer-specific circRNAs were predicted by the circBank database, and intersection analysis with differentially expressed miRNAs (DEmiRNAs) revealed that miR-6746-3p and miR-96-5p were the two most suitable miRNAs targets for our selected circRNAs. Further expression verification and prediction of base complementary paired binding sites demonstrated the hsa_circ_0039466/miR-96-5p axis as a crucial pathway in HCC. Next, we found that FOXO1 and LEPR were two potential downstream molecules of the hsa_circ_0039466/miR-96-5p axis through target gene prediction analysis, differential expression analysis, and intersection analysis. The pathway enrichment results suggested that the hsa_circ_0039466/miR-96-5p axis affects the progression and outcome of HCC through the insulin resistance pathway. Finally, through multi-data crossover analysis and data analysis of HCC samples further confirmed the existence of the hsa_circ_0039466/miR-96-5p/FOXO1 ceRNA regulatory network and that the axis was closely related to clinical stage.<h4>Conclusions</h4>hsa_circ_0039466 facilitates the expression of FOXO1 by sponging miR-96-5p, and ultimately inhibits tumor progression. These results provide a theoretical basis for further understanding of the gene expression network of HCC.

Also flagged:hematopoiesishepatic tumorhepatitisneoplasmshepatomaCD3
Journal Article 2022-07-01 ✓ 1 Snippet Luo M, Chen JW, Xie CM.
In-Text Gene Mentions

…setting of secondaryhemochromatosisowing to repeated…

Show Full Abstract

<h4>Background</h4>Extramedullary hematopoiesis rarely occurs within the liver alone, and is easily misdiagnosed. The radiological literature on this disease is exclusively case reports. There is a paucity of literature on the role of magnetic resonance imaging (MRI). The most common imaging modalities used are computed tomography and ultrasound. This report aims to provide more data on the appearance of extramedullary hematopoiesis using MRI to help radiologists establish the diagnosis.<h4>Case summary</h4>Three patients (one male and two females) were incidentally found to have a hepatic mass or nodule, without hepatomegaly or splenomegaly. Laboratory tests including liver function, serum hepatic tumor markers, and hepatitis serologic markers were normal. On MRI scans, all lesions showed lower signal intensity on in-phase images than on out-phase images. One case showed changes in signal intensity on T2 weighted images (WI) and diffusion WI, which shifted from hyperintensity to hypointensity with size enlargement between two rounds of imaging examination. These lesions exhibited different enhancement patterns on dynamic contrast enhancement series.<h4>Conclusion</h4>The MRI signal change and in-/out-phase image might provide useful information and help radiologists establish the diagnosis of intrahepatic extramedullary hematopoiesis.

Also flagged:strokediabetescancermethylationnucleotidesamino acid
Journal Article 2022-07-01 ✓ 1 Snippet Diatchenko L, Parisien M, Jahangiri Esfahani S, Mogil JS.
In-Text Gene Mentions

DCC

Show Full Abstract

No abstract available.

Also flagged:SaroglitazarmonosodiumglutamateobesityNLRP3metabolic disorders
Journal Article 2022-07-01 ✓ 1 Snippet Nabi S, Bhandari U, Haque SE.
In-Text Gene Mentions

In line with our results, previous reports found that high-fat emulsion (HFE) and small doses of lipopolysaccharides (LPS) for 5 weeks in Wistar rats caused adipocyte dysfunction associated with increased blood glucose levels, insulin levels, and insulin resistance in NAFLD which were decreased by saroglitazar (4 mg/kg/day, PO) treatment given from the 3rd week to the 5th week (53).

Show Full Abstract

<h4>Objectives</h4>Inflammation is the major progenitor of obesity and associated metabolic disorders. The current study investigated the modulatory role of saroglitazar on adipocyte dysfunction and associated inflammation in monosodium glutamate (MSG) obese Wistar rats.<h4>Materials and methods</h4>The molecular docking simulation studies of saroglitazar and fenofibrate were performed on the ligand-binding domain of NLRP3 and NF- κB. Under in vivo study, neonatal pups received normal saline or MSG (4 g/kg, SC) for 7 alternate days after birth. After keeping for 42 days as such, animals were divided into seven groups: Normal control; MSG control; MSG + saroglitazar (2 mg/kg); MSG + saroglitazar (4 mg/kg); saroglitazar (4 mg/kg) <i>per se</i>; MSG + fenofibrate (100 mg/kg); fenofibrate (100 mg/kg) <i>per se</i>. Drug treatments were given orally, from the 42<sup>nd</sup> to 70<sup>th</sup> day. On day 71, blood was collected and animals were sacrificed for isolation of liver and fat pads.<h4>Results</h4><i>In silico</i> study showed significant binding of saroglitazar and fenofibrate against NLRP3 and NF- κB. Saroglitazar significantly reduced body weight, body mass index, Lee's index, fat pad weights, adiposity index, decreased serum lipids, interleukin-1β (IL-1β), tumor necrosis factor-α(TNF-α), interleukin-6 (IL-6), leptin, insulin, blood glucose, HOMA-IR values, oxidative stress in the liver and increased hepatic low-density lipoprotein receptor levels. Histopathological analysis of the liver showed decreased inflammation and vacuolization, and reduced adipocyte cell size. Immunohistochemical analysis showed suppression of NLRP3 in epididymal adipocytes and NF- κB expression in the liver.<h4>Conclusion</h4>Saroglitazar ameliorated obesity and associated inflammation via modulation of NLRP3 inflammasome and NF- κB in MSG obese Wistar rats.

Also flagged:nuclear pore complexNPCmembranenucleusnuclear porecytoplasm
Journal Article 2022-07-01 ✓ 1 Snippet Spead O, Zaepfel BL, Rothstein JD.
In-Text Gene Mentions

HTT

Show Full Abstract

The nuclear pore complex (NPC) is a large multimeric structure that is interspersed throughout the membrane of the nucleus and consists of at least 33 protein components. Individual components cooperate within the nuclear pore to facilitate selective passage of materials between the nucleus and cytoplasm while simultaneously performing pore-independent roles throughout the cell. NPC dysfunction is a hallmark of neurodegenerative disorders including Alzheimer's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS). NPC components can become mislocalized or altered in expression in neurodegeneration. These alterations in NPC structure are often detrimental to the neuronal function and ultimately lead to neuronal loss. This review highlights the importance of nucleocytoplasmic transport and NPC integrity and how dysfunction of such may contribute to neurodegeneration.

Also flagged:gastric varicealportal hypertensionoxaliplatinliver fibrosiscapecitabinecolon cancer
Journal Article 2022-07-01 ✓ 1 Snippet Zhang X, Gao YY, Song DZ, Qian BX.
In-Text Gene Mentions

…atolenticular degeneration andhemochromatosis(Table 1 ).…

Show Full Abstract

<h4>Background</h4>Sinusoidal obstruction syndrome has been reported after oxaliplatin-based chemotherapy, but liver fibrosis and non-cirrhotic portal hypertension (NCPH) are rarely reported.<h4>Case summary</h4>Here, we describe the case of a 64-year-old woman who developed isolated gastric variceal bleeding 16 mo after completing eight cycles of oxaliplatin combined with capecitabine chemotherapy after colon cancer resection. Surprisingly, splenomegaly and thrombocytopenia were not accompanied by variceal bleeding, which has been reported to have predictive value for gastric variceal formation. However, a liver biopsy showed fibrosis in the portal area, suggesting NCPH. The patient underwent endoscopic treatment and experienced no further symptoms.<h4>Conclusion</h4>It is necessary to guard against long-term complications after oxaliplatin-based chemotherapy. Sometimes splenic size and platelet level may not always accurately predict the occurrence of portal hypertension.

Also flagged:Hepatogenous diabetesliver cirrhosisHDDiabetes mellitusinsulin resistanceIR
Journal Article 2022-07-01 ✓ 1 Snippet Kumar R, García-Compeán D, Maji T.
In-Text Gene Mentions

…viruses (HCV), andhemochromatosishas been deemed…

Show Full Abstract

The diabetogenic potential of liver cirrhosis (LC) has been known for a long time, and the name "hepatogenous diabetes" (HD) was coined in 1906 to define the condition. Diabetes mellitus (DM) that develops as a consequence of LC is referred to as HD. In patients with LC, the prevalence rates of HD have been reported to vary from 21% to 57%. The pathophysiological basis of HD seems to involve insulin resistance (IR) and pancreatic β-cell dysfunction. The neurohormonal changes, endotoxemia, and chronic inflammation of LC initially create IR; however, the toxic effects eventually lead to β-cell dysfunction, which marks the transition from impaired glucose tolerance to HD. In addition, a number of factors, including sarcopenia, sarcopenic obesity, gut dysbiosis, and hyperammonemia, have recently been linked to impaired glucose metabolism in LC. DM is associated with complications and poor outcomes in patients with LC, although the individual impact of each type 2 DM and HD is unknown due to a lack of categorization of diabetes in most published research. In fact, there is much skepticism within scientific organizations over the recognition of HD as a separate disease and a consequence of LC. Currently, T2DM and HD are being treated in a similar manner although no standardized guidelines are available. The different pathophysiological basis of HD may have an impact on treatment options. This review article discusses the existence of HD as a distinct entity with high prevalence rates, a strong pathophysiological basis, clinical and therapeutic implications, as well as widespread skepticism and knowledge gaps.

Also flagged:NAFLDchronic liver diseasepathogenesisnon-alcoholic steatohepatitisNASHGene Expression
Journal Article 2022-07-01 ✓ 1 Snippet Aljabban J, Rohr M, Syed S, Khorfan K, Borkowski V, Aljabban H, Segal M, Mukhtar M, Mohammed M, Panahiazar M, Hadley D, Spengler R, Spengler E.
In-Text Gene Mentions

…alcoholic consumption, andhemochromatosiswere excluded.…

Show Full Abstract

<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is the most common chronic liver disease in the United States and globally. The currently understood model of pathogenesis consists of a 'multiple hit' hypothesis in which environmental and genetic factors contribute to hepatic inflammation and injury.<h4>Aim</h4>To examine the genetic expression of NAFLD and non-alcoholic steatohepatitis (NASH) tissue samples to identify common pathways that contribute to NAFLD and NASH pathogenesis.<h4>Methods</h4>We employed the Search Tag Analyze Resource for Gene Expression Omnibus platform to search the The National Center for Biotechnology Information Gene Expression Omnibus to elucidate NAFLD and NASH pathology. For NAFLD, we conducted meta-analysis of data from 58 NAFLD liver biopsies and 60 healthy liver biopsies; for NASH, we analyzed 187 NASH liver biopsies and 154 healthy liver biopsies.<h4>Results</h4>Our results from the NAFLD analysis reinforce the role of altered metabolism, inflammation, and cell survival in pathogenesis and support recently described contributors to disease activity, such as altered androgen and long non-coding RNA activity. The top upstream regulator was found to be sterol regulatory element binding transcription factor 1 (SREBF1), a transcription factor involved in lipid homeostasis. Downstream of SREBF1, we observed upregulation in CXCL10, HMGCR, HMGCS1, fatty acid binding protein 5, paternally expressed imprinted gene 10, and downregulation of sex hormone-binding globulin and insulin-like growth factor 1. These molecular changes reflect low-grade inflammation secondary to accumulation of fatty acids in the liver. Our results from the NASH analysis emphasized the role of cholesterol in pathogenesis. Top canonical pathways, disease networks, and disease functions were related to cholesterol synthesis, lipid metabolism, adipogenesis, and metabolic disease. Top upstream regulators included pro-inflammatory cytokines tumor necrosis factor and IL1B, PDGF BB, and beta-estradiol. Inhibition of beta-estradiol was shown to be related to derangement of several cellular downstream processes including metabolism, extracellular matrix deposition, and tumor suppression. Lastly, we found riciribine (an AKT inhibitor) and ZSTK-474 (a PI3K inhibitor) as potential drugs that targeted the differential gene expression in our dataset.<h4>Conclusion</h4>In this study we describe several molecular processes that may correlate with NAFLD disease and progression. We also identified ricirbine and ZSTK-474 as potential therapy.

Also flagged:liver parenchymal diseasesalcoholic liver diseaseautoimmune hepatitisviral hepatitismetabolic liver diseasesnon-alcoholic fatty liver disease
Journal Article 2022-07-01 ✓ 1 Snippet Rangwani S, Ardeshna DR, Mumtaz K, Kelly SG, Han SY, Krishna SG.
In-Text Gene Mentions

…deficiency, Wilson disease,hemochromatosis, Gaucher’s disease, etc.…

Show Full Abstract

Endoscopic ultrasound guided liver biopsy (EUS-LB) has emerged as a minimally-invasive alternative to the traditional (percutaneous or transjugular) liver biopsy techniques for the diagnosis of liver parenchymal diseases. Po-tentially, EUS-LB combines the advantages of percutaneous and transjugular liver biopsy in addressing focused sampling in addition to measuring portal pressure. Additionally, EUS-LB facilitates access to both the lobes of the liver which is not considered with the traditional percutaneous liver biopsy. Multiple studies have compared EUS-LB with conventional liver biopsy and reported comparable diagnostic yield, increased acquisition of complete portal tracts, and longer specimen length as compared to the traditional approaches. EUS-LB is associated with lesser post-procedural pain and shorter recovery time, while providing lower risk of complications when compared to traditional liver biopsy. Innovations in needle types, needle sizes and suction techniques have aimed at further optimizing the EUS-LB technique. This review article updates current literature with focus on the variations in the technique and equipment used for EUS-LB, and compares EUS-LB with traditional methods of liver biopsy.

Also flagged:ulcerative colitisintestinal inflammatory diseasedextran sulfate sodiumHaematoxylincellimmunoglobulin A
Journal Article 2022-07-01 No Snippets Qi Q, Zhong R, Liu YN, Zhao C, Huang Y, Lu Y, Ma Z, Zheng HD, Wu LY.
Show Full Abstract

<h4>Background</h4>Ulcerative colitis (UC) is a chronic, nonspecific intestinal inflammatory disease. Acupuncture and moxibustion is proved effective in treating UC, but the mechanism has not been clarified. Proteomic technology has revealed a variety of biological markers related to immunity and inflammation in UC, which provide new insights and directions for the study of mechanism of acupuncture and moxibustion treatment of UC.<h4>Aim</h4>To investigate the mechanism of electroacupuncture (EA) and herb-partitioned moxibustion (HM) on UC rats by using proteomics technology.<h4>Methods</h4>Male Sprague-Dawley rats were randomly divided into the normal (N) group, the dextran sulfate sodium (DSS)-induced UC model (M) group, the HM group, and the EA group. UC rat model was prepared with 3% DSS, and HM and EA interventions at the bilateral Tianshu and Qihai acupoints were performed in HM or EA group. Haematoxylin and eosin staining was used for morphological evaluation of colon tissues. Isotope-labeled relative and absolute quantification (iTRAQ) and liquid chromatography-tandem mass spectrometry were performed for proteome analysis of the colon tissues, followed by bioinformatics analysis and protein-protein interaction networks establishment of differentially expressed proteins (DEPs) between groups. Then western blot was used for verification of selected DEPs.<h4>Results</h4>The macroscopic colon injury scores and histopathology scores in the HM and EA groups were significantly decreased compared to the rats in the M group (<i>P</i> < 0.01). Compared with the N group, a total of 202 DEPs were identified in the M group, including 111 up-regulated proteins and 91 down-regulated proteins, of which 25 and 15 proteins were reversed after HM and EA interventions, respectively. The DEPs were involved in various biological processes such as biological regulation, immune system progression and in multiple pathways including natural killer cell mediated cytotoxicity, intestinal immune network for immunoglobulin A (IgA) production, and FcγR-mediated phagocytosis. The Kyoto Encyclopedia of Genes and Genomes pathways of DEPs between HM and M groups, EA and M groups both included immune-associated and oxidative phosphorylation. Network analysis revealed that multiple pathways for the DEPs of each group were involved in protein-protein interactions, and the expression of oxidative phosphorylation pathway-related proteins, including ATP synthase subunit g (ATP5L), ATP synthase beta subunit precursor (Atp5f), cytochrome c oxidase subunit 4 isoform 1 (Cox4i1) were down-regulated after HM and EA interventions. Subsequent verification of selected DEPs (Synaptic vesicle glycoprotein 2A; nuclear cap binding protein subunit 1; carbamoyl phosphate synthetase 1; Cox4i1; ATP synthase subunit b, Atp5f1; doublecortin like kinase 3) by western blot confirmed the reliability of the iTRAQ data, HM and EA interventions can significantly down-regulate the expression of oxidative phosphorylation-associated proteins (Cox4i1, Atp5f1) (<i>P</i> < 0.01).<h4>Conclusion</h4>EA and HM could regulate the expression of ATP5L, Atp5f1, Cox4i1 that associated with oxidative phosphorylation, then might regulate immune-related pathways of intestinal immune network for IgA production, FcγR-mediated phagocytosis, thereby alleviating colonic inflammation of DSS-induced UC rats.

Also flagged:Acute PancreatitisType 1 DiabetesDiabetes mellitusPancreatitisinflammatory disease of the pancreasexocrine pancreatic insufficiency
Journal Article 2022-07-01 No Snippets Hart PA, Papachristou GI, Park WG, Dyer AM, Chinchilli VM, Afghani E, Akshintala VS, Andersen DK, Buxbaum JL, Conwell DL, Dungan KM, Easler JJ, Fogel EL, Greenbaum CJ, Kalyani RR, Korc M, Kozarek R, Laughlin MR, Lee PJ, Maranki JL, Pandol SJ, Phillips AE, Serrano J, Singh VK, Speake C, Tirkes T, Toledo FGS, Trikudanathan G, Vege SS, Wang M, Yazici C, Zaheer A, Forsmark CE, Bellin MD, Yadav D, Type 1 Diabetes in Acute Pancreatitis Consortium (T1DAPC).
Show Full Abstract

<h4>Abstract</h4>Acute pancreatitis (AP) is a disease characterized by an acute inflammatory phase followed by a convalescent phase. Diabetes mellitus (DM) was historically felt to be a transient phenomenon related to acute inflammation; however, it is increasingly recognized as an important late and chronic complication. There are several challenges that have prevented precisely determining the incidence rate of DM after AP and understanding the underlying mechanisms. The DREAM (Diabetes RElated to Acute Pancreatitis and its Mechanisms) Study is a prospective cohort study designed to address these and other knowledge gaps to provide the evidence needed to screen for, prevent, and treat DM after AP. In the following article, we summarize literature regarding the epidemiology of DM after AP and provide the rationale and an overview of the DREAM study.

Also flagged:DiabetesAcute PancreatitisType 1 Diabetesdiabetes mellitusDigestive and Kidney Diseasespancreatitis
Journal Article 2022-07-01 No Snippets Yazici C, Dyer AM, Conwell DL, Afghani E, Andersen DK, Basina M, Bellin MD, Boone LR, Casu A, Easler JJ, Greenbaum CJ, Hart PA, Jeon CY, Lee PJ, Meier S, Papachristou GI, Raja-Khan NT, Saeed ZI, Serrano J, Yadav D, Fogel EL, Type 1 Diabetes in Acute Pancreatitis Consortium (T1DAPC).
Show Full Abstract

<h4>Abstract</h4>Recruitment and retention of patients with acute pancreatitis (AP) in clinical studies can be challenging. While some obstacles are similar to other clinical conditions, some are unique to AP. Identifying potential barriers early and developing targeted solutions can help optimize recruitment and retention in AP studies. Such pre-emptive and detailed planning can help prospective, longitudinal studies focus on exocrine and endocrine complications of AP in accurately measuring outcomes. This article highlights the challenges in recruitment and retention strategies in AP studies and reviews available resources to create opportunities to address them. We describe the multifaceted approach used by the Recruitment and Retention Committee of the Type 1 Diabetes in Acute Pancreatitis Consortium, which builds upon earlier experiences to develop a recruitment and retention plan for the DREAM (Diabetes RElated to Acute pancreatitis and its Mechanisms) study.

Also flagged:COVID-19Cancerangiotensin converting enzyme 2Interleukin 6tumorcoronavirus disease
Journal Article 2022-07-01 No Snippets Mafi AR, Ghanbari Motlagh A, Azadeh P.
Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARSCoV-2) continues to be a worldwide healthcare problem. While our knowledge of the interaction of cancer and its management with COVID-19 mortality is gradually evolving, there are still many unanswered questions regarding the impact of COVID-19 on cancer and its prognosis. Several factors activated during COVID-19 have been implicated in tumorigenesis and the development of metastasis. Inflammation, hypoxia, reduced levels of angiotensin converting enzyme 2, elevated levels of Interleukin 6 and some other cytokines that are hallmarks of COVID-19 are capable of inducing tumor relapse and metastasis. On the other hand, there are reports that COVID-19 has been associated with cancer cure. Understanding the interaction between COVID-19 and tumor cells is essential for evaluating the potential long-term risks of COVID-19 in cancer patients, and for scheduling necessary preventive and therapeutic interventions. In this review, we briefly overview the potential impacts that COVID-19 might have on tumorigenesis and cancer relapse, as well as the role that COVID-19 might play in cancer remission and cure.

Also flagged:lipidbrain cancerbrain diseasetween 80folic aciddoxorubicin
Journal Article 2022-07-01 No Snippets Jain P, Pandey V, Soni V.
Show Full Abstract

<h4>Background & objectives</h4>The treatment of brain cancer is still challenging for an oncologist due to the presence of the blood-brain barrier (BBB) which inhibits the entry of more than 98 per cent of drugs used during the treatment of brain disease. The cytotoxic drugs used in chemotherapy for brain cancer treatment also affect the normal cells due to lack of targeting. Therefore, the objective of the study was to develop tween 80-coated solid lipid nanoparticles (SLNs) loaded with folic acid-doxorubicin (FAD) conjugate for site-specific drug delivery to brain cancer cells.<h4>Methods</h4>The FAD conjugate was synthesized by the conjugation of folic acid with doxorubicin and characterized by Fourier transform infrared spectroscopy and proton nuclear magnetic resonance spectroscopy. SLNs loaded with FAD were prepared by the solvent injection method. The SLNs were characterized by the particle size, zeta potential, surface morphology, entrapment efficiency, etc.<h4>Results</h4>The average particle size of FAD conjugate-loaded SLNs (SLN-C) was found to be 220.4±2.2 nm, with 36.2±0.6 per cent entrapment efficiency. The cytotoxicity and cellular uptake were determined on U87 MG cell lines. Half maximal inhibitory concentration value of the SLN-C was found to be 2.5 μg/ml, which confirmed the high antitumour activity against brain cancer cells.<h4>Interpretation & conclusions</h4>The cell line studies confirmed the cytotoxicity and internalization of SLN-C in U87 MG brain cancer cells. The results confirmed that tween 80-coated SLNs have the potential to deliver the doxorubicin selectively in the brain cancer cells.

Also flagged:HypercholesterolemiaFamilial hypercholesterolemiaFHmetabolic diseaseslow-density lipoprotein receptorLDLR
Journal Article 2022-07-01 ✓ 1 Snippet Jingjing Y, Zhanhua L, Huajun J.
In-Text Gene Mentions

…LCAT, APOA1, HAMP,HFE, HFE2, SLC40A1, and…

Show Full Abstract

Familial hypercholesterolemia (FH) is one of the inherited metabolic diseases, demonstrating the low-density lipoprotein receptor (LDLR) abnormality and serum cholesterol level marked elevation. FH has become an extremely high incident cause of occlusive coronary heart disease. However, even though hemorheological disorder caused by hyperlipidemia is a risk factor of ischemic cerebrovascular disease, cerebral infarction caused by FH has not been given much attention. We present a 41-year-old man with a family history of hypercholesterolemia was admitted to our hospital with dizziness, vertigo, slurred speech, and weakness in his left limbs. Head CT scan showed multiple acute cerebral infarction in the right frontal and parietal lobes. He had arcus corneae and less obvious signs of cutaneous xanthomas in the hands and knees. Molecular analysis of the LDLR gene identified heterozygous and missense mutation in exon 12 of the LDLR gene. The final diagnosis was cerebral infarction caused by FH. It is worth noting that cerebral infarction may also occur in patients with FH. Even if the most patients do not have any sign or history of cerebral ischemia, they need more attention to precise examination of the brain.

Also flagged:head and neck squamous cell carcinomacancersgastric carcinomashead and neck squamous cell carcinomasHNSCCcancer
Journal Article 2022-07-01 ✓ 2 Snippets Chettiankandy TJ, Sachdev SS, Khandekar SP, Dive A, Nagpal D, Tupkari JV.
In-Text Gene Mentions

They found that EDNRB, HOXA9, GATA4, NID-2, KIF1A, and DCC genes showed significant differential methylation between OSCC and normal tissues.

…KIF1A , andDCCgenes showed significant…

Show Full Abstract

<h4>Context</h4>Nidogen-2 (<i>NID-2</i>) hypermethylation has been implicated in many types of cancers, such as lung, bladder, and gastric carcinomas. However, its role has not yet been studied adequately in head and neck squamous cell carcinomas (HNSCC). HNSCCs constituting a major portion of the global cancer load, it is of importance to diagnose and treat them at earliest. This systematic review was performed to assess the role of <i>NID-2</i> in HNSCCs and assess its utility as a diagnostic and prognostic marker.<h4>Materials and methods</h4>A systematic search was performed across multiple databases to identify studies pertaining to analysis of expression or methylation of <i>NID-2</i> in HNSCCs. The sample size, type of cancer/premalignant condition studied, type of tissue/fluid analysed, and the various methodologies used and their results were extracted. PROSPERO registration number: CRD42021245326.<h4>Results</h4>Four studies were identified after a systematic search of literature. The studies analysed <i>NID-2</i> expression or methylation in conditions such as nasopharyngeal carcinoma, esophageal carcinoma, and oral squamous cell carcinoma (OSCC). <i>NID-2</i> was found to be a highly specific marker for HNSCCs, and serum <i>NID-2</i> levels also correlated with poor survival.<h4>Conclusion</h4>Data from the reviewed studies indicate that hypermethylation of <i>NID-2</i> is highly specific for HNSCC. The high specificity is maintained in salivary and serum samples, facilitating accurate and non-invasive prognostication of HNSCC. The relatively lower sensitivity of <i>NID-2</i> methylation may be overcome by analysing it along with a panel of multiple biomarkers such as HOX-A2 and YKL20.

Also flagged:immune responseshort-chainfatty acidsiron deficiency anemiathrombosisthrombocytosis
Journal Article 2022-07-01 ✓ 1 Snippet D'Angelo G.
In-Text Gene Mentions

…In fact,hemochromatosis16 and chronic…

Show Full Abstract

The microbiota is directly involved in the host metabolic process, as well as in immune response modulation and recruitment of different cells typology in the inflammatory site. Human microbiota modification (dysbiosis) is a condition which could be correlated with various pathologies. The short-chain fatty acids produced by the metabolic process have an important role as immune mediators. In hematology field, dysbiosis can represent a predisposing condition for triggering and/or conditioning both non-neoplastic (iron deficiency anemia, thrombosis, thrombocytosis or thrombocytopenia) and neoplastic disorders (lymphomas, leukemias, myeloma). Dysbiosis may also interfere on therapy efficacy (iron supplementation, chemotherapy, immunotherapy, and hematopoietic stem cell transplantation), impacting on patient's outcome.

Also flagged:obesityintellectual disabilitySyndromic obesitydevelopmental delaygenetic obesitybehavioral
Journal Article 2022-07-01 ✓ 5 Snippets Rodríguez-López R, Gimeno-Ferrer F, do Santos DA, Ferrer-Bolufer I, Luján CG, Alcalá OZ, García-Banacloy A, Cogollos VB, Juan CS.
In-Text Gene Mentions

This type of obesity would be early-onset with a familial phenotype non-related to intellectual disability (mainly caused by the genes LEP, LEPR, POMC, PCSK1, MC4R, ADCY3 and CEP19) or manifested with intellectual deficits (mainly caused by the genes CEP19, TUB, CPE, POU3F2, MRAP2, SH2B1, SIM1, NTRK2, BDNF and DYRK1B).

…factor 2 (POU3F2), Uncoupling Protein…

POU3F2is a gene…

…of a knockoutPOU3F2zebrafish mutant model…

…demonstrates that thePOU3F2regulator is downstream…

Show Full Abstract

<b><i>Background</i>:</b> Individuals with a phenotype of early-onset severe obesity associated with intellectual disability can have molecular diagnoses ranging from monogenic to complex genetic traits. Severe overweight is the major sign of a syndromic physical appearance and predicting the influence of a single gene and/or polygenic risk profile is extremely complicated among the majority of the cases. At present, considering rare monogenic bases as the principal etiology for the majority of obesity cases associated with intellectual disability is scientifically poor. The diversity of the molecular bases responsible for the two entities makes the appliance of the current routinely powerful genomics diagnostic tools essential. <b><i>Objective</i>:</b> Clinical investigation of these difficult-to-diagnose patients requires pediatricians and neurologists to use optimized descriptions of signs and symptoms to improve genotype correlations. <b><i>Methods</i>:</b> The use of modern integrated bioinformatics strategies which are conducted by experienced multidisciplinary clinical teams. Evaluation of the phenotype of the patient's family is also of importance. <b><i>Results</i>:</b> The next step involves discarding the monogenic canonical obesity syndromes and considering infrequent unique molecular cases, and/or then polygenic bases. Adequate management of the application of the new technique and its diagnostic phases is essential for achieving good cost/efficiency balances. <b><i>Conclusion</i>:</b> With the current clinical management, it is necessary to consider the potential coincidence of risk mutations for obesity in patients with genetic alterations that induce intellectual disability. In this review, we describe an updated algorithm for the molecular characterization and diagnosis of patients with a syndromic obesity phenotype.

Also flagged:Metabolic syndrometype 2 diabetes mellituscardiovascular diseasesdiabetesobesityhypertension
Journal Article 2022-07-01 No Snippets Gharipour M, Nezafati P, Sadeghian L, Eftekhari A, Rothenberg I, Jahanfar S.
Show Full Abstract

Metabolic syndrome (MetS) is one of the most important health issues around the world and a major risk factor for both type 2 diabetes mellitus (T2DM) and cardiovascular diseases. The etiology of MetS is determined by the interaction between genetic and environmental factors. Effective prevention and treatment of MetS notably decreases the risk of its complications such as diabetes, obesity, hypertension, and dyslipidemia. According to recent genome-wide association studies, multiple genes are involved in the incidence and development of MetS. The presence of particular genes which are responsible for obesity and lipid metabolism, affecting insulin sensitivity and blood pressure, as well as genes associated with inflammation, can increase the risk of MetS. These molecular markers, together with clinical data and findings from proteomic, metabolomic, pharmacokinetic, and other methods, would clarify the etiology and pathophysiology of MetS and facilitate the development of personalized approaches to the management of MetS. The application of personalized medicinebased on susceptibility identified genomes would help physicians recommend healthier lifestyles and prescribe medications to improve various aspects of health in patients with MetS. In recent years, personalized medicine by genetic testing has helped physicians determine genetic predisposition to MetS, prevent the disease by behavioral, lifestyle-related, or therapeutic interventions, and detect, diagnose, treat, and manage the disease. Clinically, personalized medicine is providing effective strategies for the prevention and treatment of MetS by reducing the time, cost, and failure rate of pharmaceutical clinical trials. It is also eliminating trial-and-error inefficiencies that inflate health care costs and undermine patient care.

Also flagged:pulmonary hypertensionPHgene expressionCCL2CSF2VCAM1
Journal Article 2022-07-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:19FlavinpneumoniaARCH
Journal Article 2022-07-01 No Snippets Khan A, Piserà S, Chiaramonte L, Dreassi A, Paltrinieri A.
Show Full Abstract

No abstract available.

Preprints.org 2022-07-01 Preprint (No Snippets API) White A, McGlone A, Gomez-Pastor R.
Show Full Abstract

Huntington&rsquo;s Disease (HD) is a devastating neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the HTT gene, for which no disease modifying therapies are currently available. Much of the recent research has focused on developing therapies to directly lower HTT expression, and while promising, these therapies have presented several challenges regarding administration and efficacy. Another promising therapeutic approach is the modulation of HTT post-translational modifications (PTMs) that are dysregulated in disease and have shown to play a key role in HTT toxicity. Among all PTMs, modulation of HTT phosphorylation has been proposed as an attractive therapeutic option due to the possibility of orally administering specific kinase effectors. One of the kinases described to participate in HTT phosphorylation is Protein Kinase CK2. CK2 has recently emerged as a target for the treatment of several neurological and psychiatric disorders, although its role in HD remains controversial. While pharmacological studies in vitro inhibiting CK2 resulted in reduced HTT phosphorylation and increased toxicity, genetic approaches in mouse models of HD have provided beneficial effects. In this review we discuss potential therapeutic approaches related to the manipulation of HTT-PTMs with special emphasis on the role of CK2 as a therapeutic target in HD.