Gene Literature Dashboard

Viewing October 2022 — 766 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← September 2022 November 2022 →
Also flagged:Huntington diseaseneurodegenerative diseasebehavioralHDamino acidsglutathione
Journal Article 2022-10-31 ✓ 5 Snippets Pradhan SS, Thota SM, Rajaratnam S, Bhagavatham SKS, Pulukool SK, Rathnakumar S, Phalguna KS, Dandamudi RB, Pargaonkar A, Joseph P, Joshy EV, Sivaramakrishnan V.
In-Text Gene Mentions

HTT protein aggregation in response to knockout of ALT1 could be mitigated by the addition of alanine (Fig. 7D).

Our analysis showed that levels of glutamine are elevated in mouse and yeast metabolomics datasets but decreased in those from HD patients; and addition of glutamine in yeast model of HD led to significantly increased aggregation of HTT protein (Fig. 4A,B).

Our results emphasize the importance of the tryptophan pathway in modulating HTT protein aggregates and its implication for disease.

Metabolic addition and gene-knockout experiments targeting selected pathways showed their role in modulating HTT protein aggregation in the yeast model of HD.

HD, which affects the central nervous system (CNS), is caused by cytosine-adenine-guanine (CAG) repeats in the huntingtin gene (HTT), resulting in an expanded polyQ stretch within the HTT protein, leading to neurodegeneration (MacDonald et al., 1993; Trottier et al., 1995).

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disease associated with polyglutamine expansion in the protein huntingtin (HTT). Although the length of the polyglutamine repeat correlates with age at disease onset and severity, psychological, cognitive and behavioral complications point to the existence of disease modifiers. Mitochondrial dysfunction and metabolic deregulation are both associated with the HD but, despite multi-omics characterization of patients and model systems, their mechanisms have remained elusive. Systems analysis of multi-omics data and its validation by using a yeast model could help to elucidate pathways that modulate protein aggregation. Metabolomics analysis of HD patients and of a yeast model of HD was, therefore, carried out. Our analysis showed a considerable overlap of deregulated metabolic pathways. Further, the multi-omics analysis showed deregulated pathways common in human, mice and yeast model systems, and those that are unique to them. The deregulated pathways include metabolic pathways of various amino acids, glutathione metabolism, longevity, autophagy and mitophagy. The addition of certain metabolites as well as gene knockouts targeting the deregulated metabolic and autophagy pathways in the yeast model system showed that these pathways do modulate protein aggregation. Taken together, our results showed that the modulation of deregulated pathways influences protein aggregation in HD, and has implications for progression and prognosis. This article has an associated First Person interview with the first author of the paper.

Also flagged:SERTautismintellectual disabilityneurodevelopmental disordersserotonin uptake transporterextracellular
Journal Article 2022-10-31 No Snippets De Gregorio R, Subah G, Chan JC, Speranza L, Zhang X, Ramakrishnan A, Shen L, Maze I, Stanton PK, Sze JY.
Show Full Abstract

Neurodevelopmental disorders ranging from autism to intellectual disability display sex-biased prevalence and phenotypical presentations. Despite increasing knowledge about temporospatial cortical map development and genetic variants linked to neurodevelopmental disorders, when and how sex-biased neural circuit derailment may arise in diseased brain remain unknown. Here, we identify in mice that serotonin uptake transporter (SERT) in non-serotonergic neurons - hippocampal and prefrontal pyramidal neurons - confers sex-biased effects specifically during neural circuit development. A set of gradient-patterned CA3 pyramidal neurons transiently express SERT to clear extracellular serotonin, coinciding with hippocampal synaptic circuit establishment. Ablating pyramidal neuron SERT (SERTPyramidΔ) alters dendritic spine developmental trajectory in the hippocampus, and precipitates sex-biased impairments in long-term activity-dependent hippocampal synaptic plasticity and cognitive behaviors. Transcriptomic analyses identify sex-biased alterations in gene sets associated with autism, dendritic spine structure, synaptic function and male-specific enrichment of dysregulated genes in glial cells in early postnatal SERTPyramidΔ hippocampus. Our data suggest that SERT function in these pyramidal neurons underscores a temporal- and brain region-specific regulation of normal sex-dimorphic circuit development and a source for sex-biased vulnerability to cognitive and behavioral impairments. This article has an associated 'The people behind the papers' interview.

Also flagged:protein degradationproteolysisdegradationautophagymicrotubule-associated protein 1A/1B light chain 3LC3
Journal Article 2022-10-31 ✓ 2 Snippets Ding Y, Xing D, Fei Y, Lu B.
In-Text Gene Mentions

For example, autophagy enhancement by rapamycin only marginally increased polyQ·ATTECs, possibly because the baseline autophagosome number is probably adequate for polyQ·ATTECs to tether mHTT protein molecules for degradation, at least under the conditions tested.9 This is somewhat consistent with the observation that the total HTT protein contributes to only a tiny fraction (∼ 0.01%) of the whole proteome.9 In contrast, the effects of LD·ATTECs and BRD4·ATTECs were significantly enhanced by the treatment with the autophagy enhancer rapamycin.10,144,223 The exact mechanistic explanation is unclear, but LDs and BRD4 may require a more significant number of autophagosomes for degradation because of LDs’ high level in the OA-induced cells and BRD4's limited accessibility to autophagosomes due to its nuclear localization, respectively.

Novartis recently reported a brain penetrant small molecule, branaplam, that can be orally administered (Fig. 10) as an mHTT lowering compound.107 Branaplam promotes the inclusion of a pseudoexon that carries in-frame stop codons in the HTT transcript (Fig. 9), leading to reduced mHTT protein levels in HD patient cells, an HD mouse model, and blood samples from Spinal Muscular Atrophy (SMA) Type I patients dosed branaplam orally for SMA.107

Show Full Abstract

Targeted protein degradation (TPD) provides unprecedented opportunities for drug discovery. While the proteolysis-targeting chimera (PROTAC) technology has already entered clinical trials and changed the landscape of small-molecule drugs, new degrader technologies harnessing alternative degradation machineries, especially lysosomal pathways, have emerged and broadened the spectrum of degradable targets. We have recently proposed the concept of autophagy-tethering compounds (ATTECs) that hijack the autophagy protein microtubule-associated protein 1A/1B light chain 3 (LC3) for targeted degradation. Other groups also reported degrader technologies engaging lysosomal pathways through different mechanisms including AUTACs, AUTOTACs, LYTACs and MoDE-As. In this review, we analyse and discuss ATTECs along with other lysosomal-relevant degrader technologies. Finally, we will briefly summarize the current status of these degrader technologies and envision possible future studies.

Also flagged:neurodegenerative diseasesendoplasmic reticulumagingUPRtranscription factorXBP1
Journal Article 2022-10-31 No Snippets Cabral-Miranda F, Tamburini G, Martinez G, Ardiles AO, Medinas DB, Gerakis Y, Hung MD, Vidal R, Fuentealba M, Miedema T, Duran-Aniotz C, Diaz J, Ibaceta-Gonzalez C, Sabusap CM, Bermedo-Garcia F, Mujica P, Adamson S, Vitangcol K, Huerta H, Zhang X, Nakamura T, Sardi SP, Lipton SA, Kennedy BK, Henriquez JP, Cárdenas JC, Plate L, Palacios AG, Hetz C.
Show Full Abstract

Aging is a major risk factor to develop neurodegenerative diseases and is associated with decreased buffering capacity of the proteostasis network. We investigated the significance of the unfolded protein response (UPR), a major signaling pathway activated to cope with endoplasmic reticulum (ER) stress, in the functional deterioration of the mammalian brain during aging. We report that genetic disruption of the ER stress sensor IRE1 accelerated age-related cognitive decline. In mouse models, overexpressing an active form of the UPR transcription factor XBP1 restored synaptic and cognitive function, in addition to reducing cell senescence. Proteomic profiling of hippocampal tissue showed that XBP1 expression significantly restore changes associated with aging, including factors involved in synaptic function and pathways linked to neurodegenerative diseases. The genes modified by XBP1 in the aged hippocampus where also altered. Collectively, our results demonstrate that strategies to manipulate the UPR in mammals may help sustain healthy brain aging.

Also flagged:TMPRSS2spike glycoproteintransmembrane protease serine 2camostatnafamostatserine proteases
Journal Article 2022-10-31 No Snippets Moumbock AFA, Tran HTT, Lamy E, Günther S.
Show Full Abstract

Host cell entry of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is facilitated via priming of its spike glycoprotein by the human transmembrane protease serine 2 (TMPRSS2). Although camostat and nafamostat are two highly potent covalent TMPRSS2 inhibitors, they nevertheless did not hold promise in COVID-19 clinical trials, presumably due to their short plasma half-lives. Herein, we report an integrative chemogenomics approach based on computational modeling and in vitro enzymatic assays, for repurposing serine-targeted covalent inhibitors. This led to the identification of BC-11 as a covalent TMPRSS2 inhibitor displaying a unique selectivity profile for serine proteases, ascribable to its boronic acid warhead. BC-11 showed modest inhibition of SARS-CoV-2 (omicron variant) spike pseudotyped particles in a cell-based entry assay, and a combination of BC-11 and AHN 1-055 (a spike glycoprotein inhibitor) demonstrated better viral entry inhibition than either compound alone. Given its low molecular weight and good activity against TMPRSS2, BC-11 qualifies as a good starting point for further structural optimizations.

Also flagged:guaninechromatinorganizationgene expressionDNA binding proteinsnucleotides
Journal Article 2022-10-31 ✓ 1 Snippet Wang G, Vasquez KM.
In-Text Gene Mentions

HTT

Show Full Abstract

Repetitive elements in the human genome, once considered 'junk DNA', are now known to adopt more than a dozen alternative (that is, non-B) DNA structures, such as self-annealed hairpins, left-handed Z-DNA, three-stranded triplexes (H-DNA) or four-stranded guanine quadruplex structures (G4 DNA). These dynamic conformations can act as functional genomic elements involved in DNA replication and transcription, chromatin organization and genome stability. In addition, recent studies have revealed a role for these alternative structures in triggering error-generating DNA repair processes, thereby actively enabling genome plasticity. As a driving force for genetic variation, non-B DNA structures thus contribute to both disease aetiology and evolution.

Also flagged:neurodegenerative disordersAmyotrophic Lateral Sclerosissynapsesthrombospondins 5glypicans 6synaptogenesis
Journal Article 2022-10-31 ✓ 1 Snippet Brandebura AN, Paumier A, Onur TS, Allen NJ.
In-Text Gene Mentions

Htt

Show Full Abstract

There is increasing appreciation that non-neuronal cells contribute to the initiation, progression and pathology of diverse neurodegenerative disorders. This Review focuses on the role of astrocytes in disorders including Alzheimer disease, Parkinson disease, Huntington disease and amyotrophic lateral sclerosis. The important roles astrocytes have in supporting neuronal function in the healthy brain are considered, along with studies that have demonstrated how the physiological properties of astrocytes are altered in neurodegenerative disorders and may explain their contribution to neurodegeneration. Further, the question of whether in neurodegenerative disorders with specific genetic mutations these mutations directly impact on astrocyte function, and may suggest a driving role for astrocytes in disease initiation, is discussed. A summary of how astrocyte transcriptomic and proteomic signatures are altered during the progression of neurodegenerative disorders and may relate to functional changes is provided. Given the central role of astrocytes in neurodegenerative disorders, potential strategies to target these cells for future therapeutic avenues are discussed.

Also flagged:PTGS2inflammatory responsepreeclampsiaNF-κBPEprostaglandin endoperoxide synthase 2
Journal Article 2022-10-31 ✓ 2 Snippets Li R, Xie J, Xu W, Zhang L, Lin H, Huang W.
In-Text Gene Mentions

…p-p65, IκB-α, p-IκB-α,PTGIS, CAV1, AGTR1).…

…levels, and downregulatedPTGISlevel.…

Show Full Abstract

Preeclampsia (PE) is a serious obstetric complication, in which trophoblast cell invasion and migration contribute to placental inflammation. In line with the discovery that mRNA prostaglandin endoperoxide synthase 2 (PTGS2) participates in the inflammatory responses in various disorders, our study aims to explore the role of PTGS2 in trophoblast invasion and further in inflammatory response in PE, ultimately providing new therapeutic targets. Bioinformatics analysis was exploited to examine PTGS2 expression in GSE40182 and find inflammatory response-relevant genes in downstream targets of PTGS2. HTR-8/SVneo cells were treated with lipopolysaccharide (LPS) and transfected with short hairpin RNA against PTGS2 (shPTGS2). Quantitative real-time polymerase chain reaction (qRT-PCR), Western blotting, and immunofluorence assays were performed to quantify the expressions of PTGS2 and involved genes (matrix metallopeptidase 2 (MMP-2), tissue inhibitors of metalloproteinase-2 (TIMP-2), p65, p-p65, IκB-α, p-IκB-α, PTGIS, CAV1, AGTR1). The migration and invasion of trophoblasts were detected through wound healing and Transwell assays. We screened out PTGS2 from GSE40182 dataset. LPS promoted cell migration and invasion, the expressions of PTGS2 and MMP-2, and reduced the expression of TIMP-2, while PTGS2 knockdown reversed all above effects of LPS. Activation of nuclear factor kappa-B (NF-κB) pathway was reinforced by LPS which also upregulated CAV1 and AGTR1 levels, and downregulated PTGIS level. Also, the effects of LPS were offset by PTGS2 knockdown. Altogether, PTGS2 silencing reverses the promoting effect of LPS on trophoblast invasion and inflammation in PE, making a breakthrough in the research regarding molecular mechanism of PE.

Also flagged:Nrf2depressionmitochondrialautophagical disorderferroptosisnuclear factor erythroid 2-related factor 2
Journal Article 2022-10-31 No Snippets Zuo C, Cao H, Song Y, Gu Z, Huang Y, Yang Y, Miao J, Zhu L, Chen J, Jiang Y, Wang F.
Show Full Abstract

The balance between oxidation and antioxidant is crucial for maintaining homeostasis. Once disrupted, it can lead to various pathological outcomes and diseases, such as depression. Oxidative stress can result in or aggravate a battery of pathological processes including mitochondrial dysfunction, neuroinflammation, autophagical disorder and ferroptosis, which have been found to be involved in the development of depression. Inhibition of oxidative stress and related pathological processes can help improve depression. In this regard, the nuclear factor erythroid 2-related factor 2 (Nrf2) in the antioxidant defense system may play a pivotal role. Nrf2 activation can not only regulate the expression of a series of antioxidant genes that reduce oxidative stress and its damages, but also directly regulate the genes related to the above pathological processes to combat the corresponding alterations. Therefore, targeting Nrf2 has great potential for the treatment of depression. Activation of Nrf2 has antidepressant effect, but the specific mechanism remains to be elucidated. This article reviews the key role of Nrf2 in depression, focusing on the possible mechanisms of Nrf2 regulating oxidative stress and related pathological processes in depression treatment. Meanwhile, we summarize some natural and synthetic compounds targeting Nrf2 in depression therapy. All the above may provide new insights into targeting Nrf2 for the treatment of depression and provide a broad basis for clinical transformation.

Also flagged:COVID-19-19anxietypanicbehavioralSARS
Journal Article 2022-10-31 No Snippets Zhu X, Niu Z, Zhang H, Huang J, Zuo X.
Show Full Abstract

The COVID-19 pandemic has led to extensive news coverage, causing investor sentiment to swing, which has further increased financial market price volatility. There is an increasing need to find a hedge against sentiment risk. This paper examines the hedge capabilities of gold and Bitcoin against COVID-19-related news sentiment (CNS) risk under a nonlinear autoregressive distributed lag (NARDL) model. Our empirical results reveal that there is an obvious asymmetric effect from the CNS on gold prices in the short run and that the decrease in the COVID-19-related news index would have a greater impact on gold prices than when it increases. The impact of CNS on Bitcoin prices is asymmetric in the long and short term, especially in the long term. In addition, we conclude that gold is a hedge against CNS risk in the long term, and the hedging effect of Bitcoin is mainly reflected in the short-term.

Also flagged:sildenafilbronchopulmonary dysplasiachronic respiratory insufficiencyinterstitial fibrosispulmonary hypertensiongestation
Journal Article 2022-10-31 No Snippets Lang JE, Hornik CD, Martz K, Jacangelo J, Anand R, Greenberg R, Hornik C, Zimmerman K, Smith PB, Benjamin DK, Laughon M, Best Pharmaceuticals for Children Act—Pediatric Trials Network Steering Committee.
Show Full Abstract

Bronchopulmonary dysplasia (BPD) is a disease of chronic respiratory insufficiency stemming from premature birth and iatrogenic lung injury leading to alveolar simplification, impaired alveolar-capillary development, interstitial fibrosis, and often pulmonary hypertension. BPD is the most common pulmonary sequela of prematurity and is often fatal; however, there remains no FDA-approved therapies to treat or prevent BPD. Sildenafil is increasingly used off-label in premature infants despite scant safety and efficacy data. Sildenafil reduces lung injury and preserves normal vasculature in preclinical models, and improves outcomes in children with pulmonary hypertension, and thus is a promising candidate for BPD. Following phase I studies, we developed the phase II SIL02 trial to describe the safety, pharmacokinetics and preliminary effectiveness of intravenous and enteral sildenafil in premature infants at risk for BPD. SIL02 is a randomized, double-blind, placebo-controlled, 3-cohort, sequential dose-escalating trial of enteral or intravenous (IV) sildenafil dosed every 8 h for up to 34 days. The target IV doses were 0.125, 0.5 and 1 mg/kg/dose in cohorts 1, 2 and 3, respectively; while the enteral doses will be double the IV doses. Eligible infants must be < 29 weeks' gestation at birth and requiring respiratory support at 7-28 days' postnatal age. Adverse events and preliminary effectiveness will be compared by treatment group. Using the final population PK model, empirical Bayesian estimates will be generated for each patient. Preliminary effectiveness will be measured by the incidence of moderate to severe BPD or death at 36 weeks and change in the BPD risk estimation.

Also flagged:Breast CancercancerHER2hormone receptorneutropeniaanemia
Journal Article 2022-10-31 No Snippets Nguyen SM, Pham AT, Nguyen LM, Cai H, Tran TV, Shu XO, Tran HTT.
Show Full Abstract

Understanding the burden and factors related to chemotherapy-induced toxicity is important in treatment planning for breast cancer patients. We conducted a prospective study among 396 newly diagnosed and chemotherapy-treated breast cancer patients recruited in two major cancer hospitals in northern Vietnam. Toxicities were captured through medical chart reviews and patient self-reports and graded using NCI CTCAE classification. Associations for sociodemographic and clinical factors with chemotherapy-induced toxicities during first-line chemotherapy were evaluated via multivariable logistic regression. Severe (i.e., grade ≥ 3) hematological (38.6%), and gastrointestinal (12.9%) toxicities were common. A pre-existing nephrological condition was significantly associated with the risk of severe hematological toxicity with adjusted odds ratios (OR) and 95% confidence intervals (CIs) of 2.30 (1.32-4.01). Patients living in rural areas had a lower risk of severe hematological toxicity (OR = 0.48; 95% CI, 0.30-0.77). Patients diagnosed with stage II and stage III-IV had a lower risk of severe gastrointestinal toxicity with ORs and 95% CIs of 0.26 (0.12-0.59) and 0.47 (0.20-1.10), respectively. Triple-negative/basal-like subtype was associated with a higher risk of severe hematological (OR = 3.15; 95% CI, 1.56-6.34) and gastrointestinal toxicities (OR = 3.60; 95% CI, 1.45-8.95) comparing to hormone receptor (HR)-positive HER2-negative subtype. Further research investigating underlying mechanisms would facilitate the development and delivery of personalized treatment and care plans.

Also flagged:SynthesisMitochondriaphenolic acidsCyreneorganellescardiovascular diseases
Journal Article 2022-10-31 No Snippets Pecora D, Annunziata F, Pegurri S, Picone P, Pinto A, Nuzzo D, Tamborini L.
Show Full Abstract

A series of phenolic derivatives designed to selectively target mitochondria were synthesized under flow conditions starting from natural phenolic acids. The two-step continuous flow protocol, performed in Cyrene, a bioavailable dipolar aprotic solvent, allowed the isolation of the MITO compounds in moderate to good yields. The MITO compounds obtained, as a first step, were tested for their safety by cell viability analysis. The cytocompatible dose, in human neuronal cell line SH-SH5Y, depends on the type of compound and the non-toxic dose is between 3.5 and 125 µM. Among the seven MITO compounds synthesized, two of them have shown interesting performances, being able to protect mitochondria from oxidative insult.

Also flagged:ThioredoxinTrxthioredoxin reductaseTrxRcell proliferationmultiple sclerosis
Journal Article 2022-10-31 ✓ 2 Snippets Bjørklund G, Zou L, Peana M, Chasapis CT, Hangan T, Lu J, Maes M.
In-Text Gene Mentions

Huntington’s disease (HD) is a progressive autosomal dominant neurodegenerative disorder [179,180] caused by a trinucleotide CAG repeats in exon-1 of the huntingtin gene (HTT) on the fourth chromosome (4p16.3) [181], resulting in the expression of a polyglutamine-expanded mutant Huntington protein (mHTT) at the amino-terminal end of the protein [182].

…the huntingtin gene (HTT) on the fourth…

Show Full Abstract

The thioredoxin system, consisting of thioredoxin (Trx), thioredoxin reductase (TrxR), and NADPH, plays a fundamental role in the control of antioxidant defenses, cell proliferation, redox states, and apoptosis. Aberrations in the Trx system may lead to increased oxidative stress toxicity and neurodegenerative processes. This study reviews the role of the Trx system in the pathophysiology and treatment of Alzheimer's, Parkinson's and Huntington's diseases, brain stroke, and multiple sclerosis. Trx system plays an important role in the pathophysiology of those disorders via multiple interactions through oxidative stress, apoptotic, neuro-immune, and pro-survival pathways. Multiple aberrations in Trx and TrxR systems related to other redox systems and their multiple reciprocal relationships with the neurodegenerative, neuro-inflammatory, and neuro-oxidative pathways are here analyzed. Genetic and environmental factors (nutrition, metals, and toxins) may impact the function of the Trx system, thereby contributing to neuropsychiatric disease. Aberrations in the Trx and TrxR systems could be a promising drug target to prevent and treat neurodegenerative, neuro-inflammatory, neuro-oxidative stress processes, and related brain disorders.

Also flagged:Digestionphenolic compoundsphenolic acidsflavan-3-olsphenolicsferrous
Journal Article 2022-10-31 ✓ 2 Snippets Milinčić DD, Stanisavljević NS, Kostić AŽ, Gašić UM, Stanojević SP, Tešić ŽL, Pešić MB.
In-Text Gene Mentions

…TPC values forDCCand their undigested…

…TAC values ofDCCand TM or…

Show Full Abstract

This study deals with the evaluation of the bioaccessibility and antioxidant properties of phenolic compounds from heat-treated skim goat-milk powder fortified with grape-pomace-seed extract, after in vitro gastrointestinal digestion. Ultra-high performance liquid chromatography coupled to diode array detection and mass spectrometry (UHPLC-DAD MS/MS) analysis confirmed the abundant presence of phenolic acids and flavan-3-ols in the grape-pomace-seed extract (SE) and heat-treated skim goat-milk/seed-extract powder (TME). After in vitro digestion of TME powder and recovery of total quantified phenolics, flavan-3-ols and phenolic acids were 18.11%, 24.54%, and 1.17%, respectively. Low recovery of grape-pomace-seed phenolics indicated strong milk protein-phenolic interactions. Electrophoretic analysis of a soluble fraction of digested heat-treated skim goat milk (TM) and TME samples showed the absence of bands originating from milk proteins, indicating their hydrolysis during in vitro gastrointestinal digestion. The digested TME sample had better antioxidant properties in comparison to the digested TM sample (except for the ferrous ion-chelating capacity, FCC), due to the presence of bioaccessible phenolics. Taking into account the contribution of the digestive cocktail, digested TME sample had lower values of total phenolic content (TPC), in vitro phosphomolybdenum reducing capacity (TAC) and ferric reducing power (FRP), compared to the undigested TME sample. These results could be attributed to low recovery of phenolic compounds. TME powder could be a good carrier of phenolics to the colon; thus, TME powder could be a promising ingredient in the formulation of functional food.

Also flagged:Multiple MyelomamethylationhistonepathogenesisMGUSchromosome
Journal Article 2022-10-31 No Snippets Ismail NH, Mussa A, Zakaria NA, Al-Khreisat MJ, Zahidin MA, Ramli NN, Mohammad SNNA, Hassan R, Mohd Noor NH, Iberahim S, Zulkafli Z, Mohamed Yusoff S, Husin A, Johan MF.
Show Full Abstract

Multiple myeloma (MM) is an exceptionally complicated and heterogeneous disease that is caused by the abnormal proliferation of malignant monoclonal plasma cells initiated in the bone marrow. In disease progression, a multistep process including differentiation, proliferation, and invasion is involved. Despite great improvement in treatment outcomes in recent years due to the substantial discovery of novel therapeutic drugs, MM is still regarded as an incurable disease. Patients with MM are afflicted by confronting remission periods accompanied by relapse or progression outcomes, which inevitably progress to the refractory stage. In this regard, MM may need new medications or modifications in therapeutic strategies to overcome resistance. A variety of genetic abnormalities (e.g., point mutations, translocations, and deletions) and epigenetic changes (e.g., DNA methylation, histone modification, and non-coding RNA) contribute to the pathogenesis and development of MM. Here, we review the significant roles of epigenetic mechanisms in the development and progression of MM. We also highlight epigenetic pathways as potential novel treatment avenues for MM, including their interplay, use of epigenetic inhibitors, and major involvement in immuno-oncology.

Also flagged:Circadian Clockesophageal squamous carcinomaESCCTP53NAGLUCD8
Journal Article 2022-10-31 ✓ 2 Snippets Cheng J, Chen F, Cheng Y.
In-Text Gene Mentions

Chen et al. used bioinformatics methods to identify ESCC methylation-driven genes and established a reliable risk prognosis model consisting of GPBAR1, OLFM4, FOXI2, and CASP10 and it provided potential biomarkers for the early treatment and prognosis evaluation of ESCC [19].

…consisting of GPBAR1,OLFM4, FOXI2, and CASP10…

Show Full Abstract

<h4>Background</h4>Studies suggested that circadian clock genes (CCGs) in human esophageal squamous carcinoma (ESCC) samples are dysregulated. However, the relevance of CCGs to lymph node metastasis (LNM) and prognosis of ESCC remains unclear.<h4>Methods</h4>The differentially expressed genes (DEGs) between normal and ESCC samples in The Cancer Genome Atlas database (TCGA) database were intersected with the genes associated with LNM (LNMGs) in ESCC samples and 300 CCGs to obtain the differentially expressed LNM-associated CCGs (DE-LNM-CCGs). The risk model was constructed by Cox regression analysis in the TCGA-ESCC training set, and the accuracy of the risk model was verified by risk profile and overall survival profile. Furthermore, differences of 23 immune cells, 13 immune functions, and immune checkpoint molecules between the high- and low-risk groups were assessed using the single-sample gene set enrichment analysis (ssGSEA) algorithm. Gene set enrichment analysis (GSEA) was conducted to investigate the functional differences between low- and high-risk groups. Finally, we validated the mRNA expression levels of prognostic model genes by quantitative real-time polymerase chain reaction (qRT-PCR).<h4>Results</h4>A total of six DE-LNM-CCGs were identified in TCGA-ESCC. TP53 and NAGLU were selected by Cox regression analysis to construct the risk model. Risk profile plots, overall survival plots, and validation results of the risk model in the validation set indicated that the constructed risk model was reliable. The result of ssGSEA showed that the percentages of activated B cells, activated dendritic cells, effector memory CD8 T cells, immune function in neutrophils, plasmacytoid dendritic cells, T cell co-inhibition, and Type 17 T helper cells were different between the high- and low-risk groups. In addition, the expression of CD274, PDCD1, TNFRSF18, and TNFRSF9 was dysregulated between the high- and low-risk groups. GSEA revealed that the high-risk group was associated with cell differentiation, oxidative phosphorylation, and steroid biosynthesis pathways, while the low-risk group was associated with chromosome, ECM-receptor interaction, and other pathways. Finally, qRT-PCR results showed that the mRNA expression levels of two prognostic genes were consistent with TCGA.<h4>Conclusion</h4>In conclusion, the risk model constructed based on TP53 and NAGLU could accurately predict the prognosis.

Also flagged:methylationneurological diseasesneuropsychiatric diseasesfrontotemporal dementiaautismamyotrophic lateral sclerosis
Journal Article 2022-10-31 ✓ 2 Snippets Younesian S, Yousefi AM, Momeny M, Ghaffari SH, Bashash D.
In-Text Gene Mentions

The incidence of more than 40 CAG trinucleotide repeats in the huntingtin gene (HTT) located on chromosome 4 gives rise to one of the most dreadful neurodegenerative diseases, named Huntington’s disease (HD).

…MutantHTT

Show Full Abstract

DNA methylation is critical for the normal development and functioning of the human brain, such as the proliferation and differentiation of neural stem cells, synaptic plasticity, neuronal reparation, learning, and memory. Despite the physical stability of DNA and methylated DNA compared to other epigenetic modifications, some DNA methylation-based biomarkers have translated into clinical practice. Increasing reports indicate a strong association between DNA methylation profiles and various clinical outcomes in neurological diseases, making DNA methylation profiles valuable as novel clinical markers. In this review, we aim to discuss the latest evidence concerning DNA methylation alterations in the development of neurodegenerative, neurodevelopmental, and neuropsychiatric diseases. We also highlighted the relationship of DNA methylation alterations with the disease progression and outcome in many neurological diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, frontotemporal dementia, and autism.

Also flagged:Leukemiaacute myeloid leukemiaAMLT cell receptorlymphocyte differentiationCD34
Journal Article 2022-10-31 ✓ 5 Snippets Zhao F, Zhang X, Pei X, Yang D, Han M.
In-Text Gene Mentions

Notably, our results demonstrate downregulation in T cell co-stimulation molecules (HLA class II regulators [CIITA, IRF8, IRF4], the T cell receptor-signaling pathway [CD247, CD3E, CD3G, ITK], activated molecules [LAT2, TNFSF4, IFNG, IL15]) and the up-regulation of inhibitory T cell ligand (PVR) in the RE group, which are known to drive relapsed AML cells to evade from immune control (Figure 6A,B).

…activated molecules [LAT2,TNFSF4, IFNG, IL15]) and…

…CD79B, CD70 andTNFSF4( Table 2…

TNFSF4(OX40L) is known…

…the downregulation ofTNFSF4expression controlled by…

Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) are a novel class of epigenetic regulators that participate in leukemogenesis. However, their roles in leukemia relapse after transplantation remain unclear.<h4>Methods</h4>We defined the circRNAs profile of the bone-marrow-enriched CD34<sup>+</sup> cells from ten acute myeloid leukemia (AML) patients after transplantation (five relapse [RE] and five continuous complete remission [CR]) and four healthy controls (HCs) by RNA-seq. Differentially expressed circRNAs were validated using real-time quantitative polymerase chain reaction (RT-qPCR) in an independent cohort of six AML patients with pairwise samples at diagnosis and at relapse and six controls.<h4>Results</h4>The bioinformatics analysis revealed a distinct circRNAs profile in relapse patients compared with controls (CR or HCs), while there was no significant difference between CR and HCs. Functional enrichment analysis demonstrated that mRNAs co-expressed with identified circRNAs were primarily involved in immune-related pathways, including the T cell receptor signaling pathway and lymphocyte differentiation. Moreover, we performed a protein-protein interaction network based on the immune-related genes and annotated 20 hub genes. The abnormal expression of hub genes was responsible for impairing T cell co-stimulation and activation, thus contributing to the immune escape of relapse blasts. We further constructed competing endogenous RNAs (ceRNA) regulatory networks based on immune-related genes and identified 10 key circRNAs that are associated with immune evasion. Six candidate circRNAs and their associated miRNA/mRNAs in the ceRNA network were randomly selected to be validated in another set by RT-qPCR.<h4>Conclusions</h4>CircRNAs dysregulation may be involved in the immune evasion of relapse blasts and is associated with AML relapse. Our results identify several promising biomarkers and might provide novel insights into the biology of AML relapse post-transplantation.

Also flagged:ATP5OGHRHRTRIM55EIF2AK1PLEKHA1BRAP
Journal Article 2022-10-31 ✓ 1 Snippet Wang H, Wang X, Li M, Sun H, Chen Q, Yan D, Dong X, Pan Y, Lu S.
In-Text Gene Mentions

…candidate genes (CACNA1Eand ACBD6 )…

Show Full Abstract

Growth traits are crucial economic traits in the commercial pig industry and have a substantial impact on pig production. However, the genetic mechanism of growth traits is not very clear. In this study, we performed a genome-wide association study (GWAS) based on the specific-locus amplified fragment sequencing (SLAF-seq) to analyze ten growth traits on 223 four-way intercross pigs. A total of 227,921 highly consistent single nucleotide polymorphisms (SNPs) uniformly dispersed throughout the entire genome were used to conduct GWAS. A total of 53 SNPs were identified for ten growth traits using the mixed linear model (MLM), of which 18 SNPs were located in previously reported quantitative trait loci (QTL) regions. Two novel QTLs on SSC4 and SSC7 were related to average daily gain from 30 to 60 kg (ADG30-60) and body length (BL), respectively. Furthermore, 13 candidate genes (<i>ATP5O</i>, <i>GHRHR</i>, <i>TRIM55</i>, <i>EIF2AK1</i>, <i>PLEKHA1</i>, <i>BRAP</i>, <i>COL11A2</i>, <i>HMGA1</i>, <i>NHLRC1</i>, <i>SGSM1</i>, <i>NFATC2</i>, <i>MAML1</i>, and <i>PSD3</i>) were found to be associated with growth traits in pigs. The GWAS findings will enhance our comprehension of the genetic architecture of growth traits. We suggested that these detected SNPs and corresponding candidate genes might provide a biological foundation for improving the growth and production performance of pigs in swine breeding.

Also flagged:Cancerpathogenesiscancerscolorectal cancercolorectal adenomaadenoma
Journal Article 2022-10-31 ✓ 2 Snippets Urh K, Zidar N, Boštjančič E.
In-Text Gene Mentions

Up to date, several CSC-related markers have been described in adenomas, e.g., CD133 [19], LGR5, PROM1 [20], IL-8 [21], OLFM4, and ASCL2 [22], but more information is required to understand malignant transformation, despite current findings in the field [19,20,21,22,23].

…[ 21 ],OLFM4, and ASCL2…

Show Full Abstract

Cancer stem cells (CSC) play one of the crucial roles in the pathogenesis of various cancers, including colorectal cancer (CRC). Although great efforts have been made regarding our understanding of the cancerogenesis of CRC, CSC involvement in CRC development is still poorly understood. Using bioinformatics and RNA-seq data of normal mucosa, colorectal adenoma, and carcinoma (<i>n</i> = 106) from GEO and TCGA, we identified candidate CSC genes and analyzed pathway enrichment analysis (PEI) and protein-protein interaction analysis (PPI). Identified CSC-related genes were validated using qPCR and tissue samples from 47 patients with adenoma, adenoma with early carcinoma, and carcinoma without and with lymph node metastasis and were compared to normal mucosa. Six CSC-related genes were identified: <i>ANLN</i>, <i>CDK1</i>, <i>ECT2</i>, <i>PDGFD</i>, <i>TNC</i>, and <i>TNXB</i>. <i>ANLN</i>, <i>CDK1, ECT2,</i> and <i>TNC</i> were differentially expressed between adenoma and adenoma with early carcinoma. <i>TNC</i> was differentially expressed in CRC without lymph node metastases whereas <i>ANLN</i>, <i>CDK1,</i> and <i>PDGFD</i> were differentially expressed in CRC with lymph node metastases compared to normal mucosa. <i>ANLN</i> and <i>PDGFD</i> were differentially expressed between carcinoma without and with lymph node metastasis. Our study identified and validated CSC-related genes that might be involved in early stages of CRC development <i>(ANLN, CDK1, ECT2, TNC)</i> and in development of metastasis <i>(ANLN, PDGFD).</i>

Also flagged:TumorNASHHepatocellular CarcinomaNon-alcoholic steatohepatitisdeathviral hepatitis
Journal Article 2022-10-31 ✓ 1 Snippet Chien SC, Lin YJ, Lee CT, Chiu YC, Chou TC, Chiu HC, Tsai HW, Su CM, Yang TH, Chiang HC, Tsai WC, Yang KC, Cheng PN.
In-Text Gene Mentions

…Wilson disease, orhemochromatosis.…

Show Full Abstract

The outcomes for patients with NASH-related HCC after curative resection have not been clarified. This study compared the overall survival (OS), time-to-tumor recurrence (TTR), and recurrence-free survival (RFS) associated with NASH-related HCC and virus-related HCC after resection. <b>Methods:</b> Patients with HCC who underwent curative resection were retrospectively enrolled. Baseline characteristics, including disease etiologies and clinical and tumor features, were reviewed. The primary outcomes were OS, TTR, and RFS. <b>Results:</b> Two hundred and six patients were enrolled (HBV: <i>n</i> = 121, HCV: <i>n</i> = 54, NASH: <i>n</i> = 31). Of those with virus-related HCC, 84.0% achieved viral suppression. In both the overall and propensity-score-matched cohorts, those with NASH-related HCC experienced recurrence significantly earlier than those with virus-related HCC (median TTR: 1108 days vs. non-reached; <i>p</i> = 0.03). Through multivariate analysis, NASH-related HCC (hazard ratio (HR), 2.27; 95% confidence interval (CI), 1.25-4.12) was independently associated with early recurrence. The unadjusted RFS rate of the NASH-related HCC group was lower than the virus-related HCC group. There was no difference in the OS between the two groups. <b>Conclusions:</b> NASH-related HCC was associated with earlier tumor recurrence following curative resection compared to virus-related HCC. Post-surgical surveillance is crucial for detecting early recurrence in patients with NASH-related HCC.

Also flagged:Cerebral Venous Sinus ThrombosisScrub Typhus Infectionscrub typhusinfectious diseasecentral nervous system infectionspathogenesis
Journal Article 2022-10-31 ✓ 1 Snippet Biswas U, Ghosh R, Chakraborty A, Mondal SR, Roy D, Bhattacharjee A, Roy D, Benito-León J.
In-Text Gene Mentions

…Protein-C, protein-S, anti-thrombin-III, factor-V Leiden mutation,…

Show Full Abstract

Neurological manifestations of scrub typhus, a re-emerging infectious disease of tropic/subtropics caused by <i>Orientia tsutsugamushi</i> infection, have been ever-evolving. Several central nervous system infections have been acknowledged for the development of cerebral venous sinus thrombosis (CVT). Nevertheless, CVT has been a rarely described addendum to the ever-evolving "neuro-scrub" spectrum. Proposed pathogenesis for the development of CVT is disseminated endotheliitis resulting in the triad of venous stasis (due to raised intracranial pressure), cerebral vasculopathy (endothelial damage), and capillary perivasculitis (endothelial damage and resultant hypercoagulable state generated by inflammatory mediators). We herein report a case of a previously healthy young female from the Indian subcontinent who was diagnosed with CVT, following scrub typhus. She responded well to conventional therapy with antibiotics and anticoagulants. CVT is amid the few completely reversible neurological catastrophes if diagnosed and treated early. Again, scrub typhus infection is treated with commonly available and extremely "affordable" antibiotics therapy. Hence, the authors propose that all cases of acute febrile illness with neurological manifestations from scrub-typhus endemic zones (like several parts of India) should be tested for the presence of <i>Orientia tsutsugamushi</i> infection and treated accordingly.

Also flagged:tumorreverse transcriptionARHGAP31TMCC1metabolismPPAR
Journal Article 2022-10-31 ✓ 5 Snippets Jiang P, Xue W, Xi C, Zhuang L, Yuan Z, Liu Z, Sun T, Xu X, Tan Y, Ding W.
In-Text Gene Mentions

High risk individuals were more sensitive to some immunotherapies (including anti-TNFSF4 anti-SIRPA, anti-CD276 and anti-TNFSF15) and some conventional chemotherapy drugs (including lapatinib and paclitaxel).

Moreover, our study indicates that high-risk individuals are likely to be susceptible to some immunotherapies (including anti-TNFSF4, anti-SIRPA, anti-CD276 and anti-TNFSF15) and some conventional chemotherapy drugs (including lapatinib and paclitaxel).

…munotherapies (including anti-TNFSF4anti-SIRPA, anti-CD276 and…

…the expression ofTNFSF4, SIRPA, CD276 and…

…munotherapies (including anti-TNFSF4, anti-SIRPA, anti-CD276 and…

Show Full Abstract

<h4>Background</h4>The acidic microenvironment (AME), like hypoxia, inflammation, or immunoreaction, is a hallmark of the tumor microenvironment (TME). This work aimed to develop a prediction signature dependent on AME-associated lncRNAs in order to predict the prognosis of LC individuals.<h4>Methods</h4>We downloaded RNA-seq information and the corresponding clinical and predictive data from The Cancer Genome Atlas (TCGA) dataset and conducted univariate and multivariate Cox regression analyses to identify AME-associated lncRNAs for the construction of a prediction signature The Kaplan-Meier technique was utilized to determine the overall survival (OS) rate of the high (H)-risk and low (L)-risk groups. Using gene set enrichment analysis (GSEA) the functional variations between the H- and L-risk groups were investigated. The association between the prediction signature and immunological state was investigated using single-sample GSEA (ssGSEA). Additionally, the association between the predicted signature and the therapeutic response of LC individuals was evaluated. Lastly, quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to verify the risk model.<h4>Results</h4>We generated a signature comprised of seven AME-associated lncRNAs (LINC01116, AC002511.2, LINC00426, ARHGAP31-AS1, LINC01060, TMCC1-AS1, AC012065.1). The H-risk group had a worse prognosis than the L- risk group. The AME-associated lncRNA signature might determine the prognosis of individuals with LC independently. The AME-related lncRNA signature shows a greater predictive effectiveness than clinic-pathological factors, with an area under the receiver operating characteristic (ROC) curve of 0.806%. When participants were categorized based on several clinico-pathological characteristics, the OS of high-risk individuals was shorter compared to low-risk patients. GSEA demonstrated that the metabolism of different acids and the PPAR signaling pathway are closely associated with low-risk individuals. The prognostic signature was substantially associated with the immunological status of LC individuals, as determined by ssGSEA. High risk individuals were more sensitive to some immunotherapies (including anti-TNFSF4 anti-SIRPA, anti-CD276 and anti-TNFSF15) and some conventional chemotherapy drugs (including lapatinib and paclitaxel). Finally, the expression levels of the seven lncRNAs comprising the signature were tested by qRT-PCR.<h4>Conclusions</h4>A basis for the mechanism of AME-associated lncRNAs in LC is provided by the prediction signature, which also offers clinical therapeutic recommendations for LC individuals.

Also flagged:fibrinogenextrahepatic cholangiocarcinomaalbuminFPRNLRPLR
Journal Article 2022-10-31 ✓ 1 Snippet Li S, Zhang X, Lou C, Gu Y, Zhao J.
In-Text Gene Mentions

…11 ), andDCC( 17 ,…

Show Full Abstract

<h4>Background</h4>Systemic inflammation is important in the development of extrahepatic cholangiocarcinoma (ECC). The aim of this study was to compare the prognostic power of preoperative peripheral blood inflammatory markers and the novel FLR-N score in patients with resectable ECC.<h4>Methods</h4>A total of 140 patients with resectable ECC and 140 healthy controls (HCs) were recruited for the study. The Mann-Whitney U test was used to evaluate the differences in inflammatory markers between groups. Kaplan-Meier and Cox regression analyses were used to evaluate the prognostic power of preoperative fibrinogen, albumin, prealbumin, bilirubin, neutrophils, lymphocytes, monocytes, platelets, fibrinogen-to-lymphocyte ratio (FLR), fibrinogen-to-albumin ratio (FAR), fibrinogen-to-prealbumin ratio (FPR), neutrophil-to-lymphocyte ratio (NLR), platelet-to-lymphocyte ratio (PLR), monocyte-to-lymphocyte ratio (MLR), FLR-neutrophil (FLR-N) score, and CA19-9 in patients with resectable ECC. Nomogram was developed based on the results of multivariate Cox analyses.<h4>Results</h4>Patients with resectable ECC had significantly higher levels of neutrophils, monocytes, fibrinogen, FLR, FAR, FPR, NLR, PLR, and MLR and lower levels of lymphocytes, albumin, and prealbumin than HCs (all P < 0.01). Albumin, prealbumin, and FPR had a good ability to distinguish between ECC patients with total bilirubin < 34 µmol/L and HCs (AUCs of 0.820, 0.827, and 0.836, respectively). Kaplan-Meier analysis showed that high neutrophil, fibrinogen, FLR, FAR, PLR, MLR, and FLR-N score values were associated with poor survival in patients with resectable ECC. Multivariate analyses indicated that neutrophils (P = 0.022), FLR (P = 0.040), FLR-N score (P < 0.0001), and positive lymph node metastasis (P = 0.016) were independent factors for overall survival (OS). Nomogram were developed to predict OS for patients with ECC.<h4>Conclusion</h4>The prognostic roles of inflammatory markers in patients with resectable ECC were different. The preoperative neutrophil count, FLR and FLR-N score could serve as noninvasive markers for predicting the prognosis of resectable ECC.

Also flagged:ferroptosismalignant tumorscolorectal cancertumorsmalignant tumorcancer
Journal Article 2022-10-31 ✓ 1 Snippet Wang X, Xu Y, Dai L, Yu Z, Wang M, Chan S, Sun R, Han Q, Chen J, Zuo X, Wang Z, Hu X, Yang Y, Zhao H, Hu K, Zhang H, Chen W.
In-Text Gene Mentions

…C10orf99 , andOLFM4were screened as…

Show Full Abstract

Oxidative stress and ferroptosis exhibit crosstalk in many types of human diseases, including malignant tumors. We aimed to develop an oxidative stress- and ferroptosis-related gene (OFRG) prognostic signature to predict the prognosis and therapeutic response in patients with colorectal cancer (CRC). Thirty-four insertion genes between oxidative stress-related genes and ferroptosis-related genes were identified as OFRGs. We then performed bioinformatics analysis of the expression profiles of 34 OFRGs and clinical information of patients obtained from multiple datasets. Patients with CRC were divided into three OFRG clusters, and differentially expressed genes (DEGs) between clusters were identified. OFRG clusters correlated with patient survival and immune cell infiltration. Prognosis-related DEGs in three clusters were used to calculate the risk score, and a prognostic signature was constructed according to the risk score. In this study, patients in the low-risk group had better prognosis, higher immune cell infiltration levels, and better responses to fluorouracil-based chemotherapy and immune checkpoint blockade therapy than high-risk patients; these results were successfully validated with multiple independent datasets. Thus, low-risk CRC could be defined as hot tumors and high-risk CRC could be defined as cold tumors. To further identify potential biomarkers for CRC, the expression levels of five signature genes in CRC and adjacent normal tissues were further verified <i>via</i> an <i>in vitro</i> experiment. In conclusion, we identified 34 OFRGs and constructed an OFRG-related prognostic signature, which showed excellent performance in predicting survival and therapeutic responses for patients with CRC. This could help to distinguish cold and hot tumors in CRC, and the results might be helpful for precise treatment protocols in clinical practice.

Also flagged:deathproline isomeraseprolyl cis-trans isomeraseNIMA-interacting 1Pin1phosphorylation
Journal Article 2022-10-31 ✓ 1 Snippet Zhang JH, Ni SY, Tan YT, Luo J, Wang SC.
In-Text Gene Mentions

…disease), the mutatedHttprotein promotes the…

Show Full Abstract

<b>Background:</b> Regulation of cell death plays a key role in numerous diseases. As a proline isomerase, prolyl cis-trans isomerase NIMA-interacting 1 (Pin1) is important for the regulation of signaling pathways. An in-depth understanding of how Pin1 participates in the process of cell death, which affects the occurrence and development of diseases, will aid in the discovery of new disease mechanisms and therapeutic methods. Thus, the purpose of our study was to discover the research trends and hotspots of Pin1 and cell death through bibliometric analyses and to provide insights for understanding the future development of basic research and treatment of diseases. <b>Methods:</b> Documents were extracted from the Web of Science Core Collection on 7 May 2022. We selected articles and reviews published in English from 2000 to 2021, and visual and statistical analyses of countries, institutions, authors, references and keywords were performed using VOSviewer 1.6.18 and CiteSpace 5.8. <b>Results:</b> A total of 395 articles and reviews were selected. Since 2001, the number of articles on Pin1 and cell death has increased annually. Publications come from 43 countries, with the US having the most publications and citations. We identified 510 authors, with Giannino Del Sal having the most articles and Paola Zacchi having the most co-citations. <i>The Journal of Biological Chemistry</i> is the most researched journal, and <i>Nature</i> and its subjournals are the most cited journals. Apoptosis, phosphorylation, and breast cancer were the three most common keywords. <b>Conclusion:</b> The number of documents showed an increasing trend from 2001 to 2014. Stagnant growth after 2014 may be related to the absence of new research hotspots. Cooperative links between core institutions need to be strengthened, and the institution with the highest citation count in recent years is Fujian Medical University in China. The role of Pin1 in cell death requires further research to discover new research hotspots. Before breakthroughs in molecular mechanism or signaling pathway research, future research will focus more on the treatment of diseases represented by Pin1 inhibitors.

Also flagged:aspartic andglutamic acidtumortrinucleotidechromatinmetabolism
Journal Article 2022-10-31 ✓ 1 Snippet Shukla S, Lazarchuk P, Pavlova MN, Sidorova JM.
In-Text Gene Mentions

…proteins, ATXN3 andHTT, and arrived at…

Show Full Abstract

D/E repeats are stretches of aspartic and/or glutamic acid residues found in over 150 human proteins. We examined genomic stability of D/E repeats and functional characteristics of D/E repeat-containing proteins vis-à-vis the proteins with poly-Q or poly-A repeats, which are known to undergo pathologic expansions. Mining of tumor sequencing data revealed that D/E repeat-coding regions are similar to those coding poly-Qs and poly-As in increased incidence of trinucleotide insertions/deletions but differ in types and incidence of substitutions. D/E repeat-containing proteins preferentially function in chromatin metabolism and are the more likely to be nuclear and interact with core histones, the longer their repeats are. One of the longest D/E repeats of unknown function is in ATAD2, a bromodomain family ATPase frequently overexpressed in tumors. We demonstrate that D/E repeat deletion in ATAD2 suppresses its binding to nascent and mature chromatin and to the constitutive pericentromeric heterochromatin, where ATAD2 represses satellite transcription.

Also flagged:Retroperitoneal soft tissue sarcomaretroperitoneal liposarcomasarcomasCancertumortumors
Journal Article 2022-10-31 ✓ 2 Snippets Cui L, Tian X, Yan L, Guan X, Dong B, Zhao M, Lv A, Liu D, Wu J, Hao C.
In-Text Gene Mentions

…F2, AHSG, AMBP,SERPINC1(Figure 1 F).…

…F2, AHSG, AMBP,SERPINC1.…

Show Full Abstract

<b><i>Purpose</i>:</b> Retroperitoneal liposarcoma (RLPS) is a rare malignancy without effective treatment. Since current treatment for unresectable RLPS is unsatisfactory, immunotherapy and targeted therapy are urgently needed. Siglec-15 is a transmembrane protein highly homologous to PD-L1 and is involved in tumor immune escape. The biological function of Siglec-15 in RLPS, its prognostic relevance and its relationship with PD-L1 need to be further clarified. In this study, we aimed to explore the biological function of Siglec-15 in sarcomas through bioinformatics analysis, and we also evaluated Siglec-15 and PD-L1 expression in RLPS samples. The relationship between the expression of Siglec-15 and PD-L1 and their clinicopathological relevance and prognostic value were also investigated in clinical RLPS patients. <b>Methods:</b> The RNA sequencing data of 259 sarcoma cases and 48 RLPS cases from TCGA were used to analyze the Siglec-15 expression and the differentially expressed genes (DEG) related with Siglec-15 expression. In addition, DEGs were subsequently analyzed through the gene ontology (GO)/ Kyoto Encyclopedia of Genes and Genomes (KEGG) and protein-protein interaction (PPI) network. Tumor specimens were obtained from 91 RLPS patients of our sarcoma center, and Siglec-15 and PD-L1 expression were evaluated using immunohistochemistry. The correlation between the expression level of these two markers as well as their correlation with clinicopathological factors and prognosis of RLPS patients was also assessed. <b>Results:</b> GEPIA analysis showed that the high expression of Siglec-15 was associated with poor sarcoma OS (P=0.034). A total of 682 differential genes were identified between the high and low expression groups of Siglec-15 in RLPS. Enrichment analysis of the KEGG pathway showed that Siglec-15 was related to the Hippo signaling pathway and the neuroactive ligand-receptor interaction. GO annotation analysis showed that the expression of Siglec-15 may thus be able to affect serine hydrolase activity, alongside signal receptor activator activity. The top 5 genes with the largest number of connection points are APOA1, F2, AHSG, AMBP, SERPINC1. In subsequent studies, we used 91 liposarcoma samples from our center for verification. Siglec-15 was expressed in 84.6% of RLPS cases, whereas PD-L1 was expressed in 17.6% of RLPS cases. A negative correlation was observed between Siglec-15 and PD-L1 expression (<i>P</i>=0.020). In this group of RLPS patients, high Siglec-15 expression was correlated with poorer disease-free survival (DFS) (<i>P</i>=0.021), and it was an independent predictor of DFS (hazard ratio: 2.298; 95% confidence interval: 1.154-4.576; <i>P</i>=0.018). However, we did not find a correlation between PD-L1 expression and overall survival or DFS in RLPS patients. <b>Conclusion:</b> The DEG and signaling pathways identified in the study could provide a preliminary understanding of the underlying molecular mechanisms of Siglec-15 in the development and progression of RLPS. High expression of Siglec-15 was a negative independent predictive factor for DFS of RLPS. The negative relationship between Siglec-15 and PD-L1 expression suggested that the Siglec-15 pathway might be an important supplement to PD-L1 treatment.

Also flagged:cognitioncognitive impairmentageingneurodegenerative diseasesautosomal dominant dementiaHD
Journal Article 2022-10-31 ✓ 3 Snippets Papoutsi M, Flower M, Hensman Moss DJ, Holmans P, Estevez-Fraga C, Johnson EB, Scahill RI, Rees G, Langbehn D, Tabrizi SJ, Track-HD Investigators .
In-Text Gene Mentions

A recent study16 has identified MSH3 as a modifier of cognitive function in Huntington’s disease rather than motor function, while we have previously shown in this cohort that variation in MSH3, specifically carrying a 3a allele, has a protective effect on a composite score of disease progression, which included cognitive and psychomotor function.24,27 It is currently hypothesized that MSH3 is introducing an expansion of the HTT CAG repeat in the process of repair.

Huntington’s disease is a genetic, neurodegenerative disorder caused by an abnormal coronary artery angiography (CAG) repeat expansion in the Huntingtin (HTT)gene.

…the Huntingtin (HTT)gene.…

Show Full Abstract

An important step towards the development of treatments for cognitive impairment in ageing and neurodegenerative diseases is to identify genetic and environmental modifiers of cognitive function and understand the mechanism by which they exert an effect. In Huntington's disease, the most common autosomal dominant dementia, a small number of studies have identified intellectual enrichment, i.e. a cognitively stimulating lifestyle and genetic polymorphisms as potential modifiers of cognitive function. The aim of our study was to further investigate the relationship and interaction between genetic factors and intellectual enrichment on cognitive function and brain atrophy in Huntington's disease. For this purpose, we analysed data from Track-HD, a multi-centre longitudinal study in Huntington's disease gene carriers and focused on the role of intellectual enrichment (estimated at baseline) and the genes <i>FAN1</i>, <i>MSH3</i>, <i>BDNF</i>, <i>COMT</i> and <i>MAPT</i> in predicting cognitive decline and brain atrophy. We found that carrying the 3a allele in the <i>MSH3</i> gene had a positive effect on global cognitive function and brain atrophy in multiple cortical regions, such that 3a allele carriers had a slower rate of cognitive decline and atrophy compared with non-carriers, in agreement with its role in somatic instability. No other genetic predictor had a significant effect on cognitive function and the effect of <i>MSH3</i> was independent of intellectual enrichment. Intellectual enrichment also had a positive effect on cognitive function; participants with higher intellectual enrichment, i.e. those who were better educated, had higher verbal intelligence and performed an occupation that was intellectually engaging, had better cognitive function overall, in agreement with previous studies in Huntington's disease and other dementias. We also found that intellectual enrichment interacted with the <i>BDNF</i> gene, such that the positive effect of intellectual enrichment was greater in Met66 allele carriers than non-carriers. A similar relationship was also identified for changes in whole brain and caudate volume; the positive effect of intellectual enrichment was greater for Met66 allele carriers, rather than for non-carriers. In summary, our study provides additional evidence for the beneficial role of intellectual enrichment and carrying the 3a allele in <i>MSH3</i> in cognitive function in Huntington's disease and their effect on brain structure.

Also flagged:uterine leiomyomatosiscardiac myxomaneoplasmdeep vein thrombosisintravenous leiomyomatosissmooth muscle neoplasm
Journal Article 2022-10-31 ✓ 1 Snippet Coşkun Sungur E, Selçuk İ, Özbek HM, Aytekin O, Öge Köklü N, Turhan N, Talay S, Sarıtaş A, Raşit Yalçın H.
In-Text Gene Mentions

…protein S andantithrombin-IIIactivity were 37.7%…

Show Full Abstract

Extrapelvic intravenous uterine leiomyomatosis is a rare smooth muscle neoplasm. Uterine leiomyomatosis is a histologically benign pathology. Rarely, it can be confused with a cardiac mass. A 44-year-old female patient was admitted with increasing severity of pain and swelling in both legs for the past week. The patient was initially diagnosed with bilateral deep vein thrombosis. After further evaluation, we decided that the patient had cardiac myxoma. However, we intraoperatively observed that the lesion in the right atrium was arising from the inferior vena cava. In the final postoperative histopathological evaluation, the definite diagnosis was extrapelvic intravenous leiomyomatosis. The patient was discharged uneventfully following her second operation.

Preprints.org 2022-10-31 Preprint (No Snippets API) Tran DM, Vu UT, Hoang CN, Nguyen HTT, Nguyen PH, Tran MCT, Chu AN, Phan PH.
Show Full Abstract

<h4>Background: </h4> The robustness of sero-surveillence has delineated the high burden of SARS-CoV-2 infection in children; however, these existing data showed wide variation. This study aimed to identify the serostatus of antibodies against SARS-CoV-2 and associated factors among children following the fourth pandemic wave in Vietnam. <h4>Methods:</h4> A cross-sectional study was conducted at Vietnam National Children&rsquo;s Hospital (VNCH) between March 13 and April 3, 2022. 4,032 eligible children seeking medical care for any medical condition not related to acute Covid-19 infections was tested for IgG SARS-CoV-2 Antibodies by ADVIA Centaur&reg; SARS-CoV-2 IgG (sCOVG) assay using the residuals of routine blood samples. <h4>Results:</h4> The median age of enrolled children was 39 (IQR=14-82) months. The overall seropositive prevalence was 59.2%, and the median antibody titer was 4.78 [IQR 2.38-9.57] UI/mL. The risk of seropositivity and the median antibody titer was not related to gender (58.6% versus 60.1%, 4.9 versus 4.6 UI/mL, all p&amp;gt;0.05). Among age groups, the highest seroprevalence was reported in the children aged 13 to &amp;lt;36 months old. Children aged &le;12 months were likely to be seropositive compared to children aged 36 to &amp;lt;60 months (59.2% versus 57.5%, p=0.49) and those aged &ge;144 months (59.2% versus 65.5%, p=0.16). Children aged &ge;144 months exhibited a significantly higher titer of protective COVID-19 antibodies than other age groups (p &amp;lt;0.001). In multivariate logistic regression, we observed independent factors associated with SARS-CoV-2 seropositivity, including the age 13 to &amp;lt;36 months (OR=1.29, 95%CI=1.06-1.56, p=0.01), 60 to &amp;lt;144 months (OR=79, 95%CI=0.67-0.95, p=0.01), &ge;144 months (OR=1.84, 95%CI=1.21-2.8, p=0.005), the presence of infected household members (OR=2.36, 95%CI=2.06&ndash;2.70, p&amp;lt;0.001), participants from Hanoi (OR=1.54, 95%CI=1.34-1.77, p&amp;lt;0.001), underlying conditions (OR=0.71, 95%CI=0.60-0.85, p&amp;lt;=0.001), and using corticosteroids or immunosuppressants (OR=0.64, 95%CI=0.48-0.86, p=0.003). <h4>Conclusions:</h4> This study highlights a high seroprevalence of antibodies against SARS-CoV-2 among children seeking medical care for non-COVID-19-related conditions in a tertiary children&rsquo;s hospital in Hanoi, Vietnam. In the context of reopening in-person schools and future emerged COVID-19 variants, this point will also be a key message about the necessity of &ldquo;rush-out&rdquo; immunization coverage for children, especially those under the age of three years.

Also flagged:Ferroptosisdeathironlipidglutathione peroxidase 4GPX4
Journal Article 2022-10-30 No Snippets Ma T, Du J, Zhang Y, Wang Y, Wang B, Zhang T.
Show Full Abstract

Ferroptosis is a form of programmed cell death characterized by intracellular iron accumulation and lipid peroxidation, and earlier studies identified glutathione peroxidase 4 (GPX4) as an essential regulator of this process. Ferroptosis plays an essential role in tumors, degenerative diseases, and ischemia-reperfusion injury. However, researchers have found that inhibition of GPX4 does not entirely suppress ferroptosis in certain diseases, or cells express resistance to ferroptosis agonists that inhibit GPX4. As research progresses, it has been discovered that there are multiple regulatory pathways for ferroptosis that are independent of GPX4. The study of GPX4-independent ferroptosis pathways can better target ferroptosis to prevent and treat various diseases. Here, the currently inhibited pulmonary GPX4-dependent ferroptosis pathways will be reviewed.

Also flagged:nucleotidepolymerasechromosomeDNA polymerasedeoxyribonucleotide triphosphatesmotor proteins
Journal Article 2022-10-30 ✓ 5 Snippets Cuenca-Guardiola J, de la Morena-Barrio B, García JL, Sanchis-Juan A, Corral J, Fernández-Breis JT.
In-Text Gene Mentions

The study was conducted on seven patients with thrombosis that had AT quantitative type I deficiency caused by a CNV affecting SERPINC1. These SVs were detected by MLPA after negative results of sequencing the whole gene [24].

…gene defects onSERPINC1and from a…

…coding gene (SERPINC1), mostly SNVs…

…a CNV affectingSERPINC1, we found…

…a CNV affectingSERPINC1.…

Show Full Abstract

<h4>Introduction</h4>Whole-genome sequencing using nanopore technologies can uncover structural variants, which are DNA rearrangements larger than 50 base pairs. Nanopore technologies can also characterize their boundaries with single-base accuracy, owing to the kilobase-long reads that encompass either full variants or their junctions. Other methods, such as next-generation short read sequencing or PCR assays, are limited in their capabilities to detect or characterize structural variants. However, the existing software for nanopore sequencing data analysis still reports incomplete variant sets, which also contain erroneous calls, a considerable obstacle for the molecular diagnosis or accurate genotyping of populations.<h4>Methods</h4>We compared multiple factors affecting variant calling, such as reference genome version, aligner (minimap2, NGMLR, and lra) choice, and variant caller combinations (Sniffles, CuteSV, SVIM, and NanoVar), to find the optimal group of tools for calling large (>50 kb) deletions and duplications, using data from seven patients exhibiting gross gene defects on SERPINC1 and from a reference variant set as the control. The goal was to obtain the most complete, yet reasonably specific group of large variants using a single cell of PromethION sequencing, which yielded lower depth coverage than short-read sequencing. We also used a custom method for the statistical analysis of the coverage value to refine the resulting datasets.<h4>Results</h4>We found that for large deletions and duplications (>50 kb), the existing software performed worse than for smaller ones, in terms of both sensitivity and specificity, and newer tools had not improved this. Our novel software, disCoverage, could polish variant callers' results, improving specificity by up to 62% and sensitivity by 15%, the latter requiring other data or samples.<h4>Conclusion</h4>We analyzed the current situation of >50-kb copy number variants with nanopore sequencing, which could be improved. The methods presented in this work could help to identify the known deletions and duplications in a set of patients, while also helping to filter out erroneous calls for these variants, which might aid the efforts to characterize a not-yet well-known fraction of genetic variability in the human genome.

Also flagged:GlioblastomaGlioblastoma multiformeGBMcancerspathogenesisBR3
Journal Article 2022-10-30 ✓ 3 Snippets Dymova MA, Vasileva NS, Kuligina EV, Savinovskaya YI, Zinchenko ND, Ageenko AB, Mishinov SV, Stepanov GA, Richter VA, Semenov DV.
In-Text Gene Mentions

It was observed that miR-25-5p is involved in the pathogenesis and processes of vascular diseases by targeting neuronal growth regulator 1 (NEGR1) via regulating the JAK/STAT signaling pathway [66].

…diseases by targetingneuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1) via regulating the…

Show Full Abstract

Glioblastoma multiforme (GBM) is one of the most highly metastatic cancers. The study of the pathogenesis of GBM, as well as the development of targeted oncolytic drugs, require the use of actual cell models, in particular, the use of 3D cultures or neurospheres (NS). During the formation of NS, the adaptive molecular landscape of the transcriptome, which includes various regulatory RNAs, changes. The aim of this study was to reveal changes in the expression of microRNAs (miRNAs) and their target mRNAs in GBM cells under conditions of NS formation. Neurospheres were obtained from both immortalized U87 MG and patient-derived BR3 GBM cell cultures. Next generation sequencing analysis of small and long RNAs of adherent and NS cultures of GBM cells was carried out. It was found that the formation of NS proceeds with an increase in the level of seven and a decrease in the level of 11 miRNAs common to U87 MG and BR3, as well as an increase in the level of 38 and a decrease in the level of 12 mRNA/lncRNA. Upregulation of miRNAs hsa-miR: -139-5p; -148a-3p; -192-5p; -218-5p; -34a-5p; and -381-3p are accompanied by decreased levels of their target mRNAs: RTN4, FLNA, SH3BP4, DNPEP, ETS2, MICALL1, and GREM1. Downregulation of hsa-miR: -130b-5p, -25-5p, -335-3p and -339-5p occurs with increased levels of mRNA-targets BDKRB2, SPRY4, ERRFI1 and TGM2. The involvement of SPRY4, ERRFI1, and MICALL1 mRNAs in the regulation of EGFR/FGFR signaling highlights the role of hsa-miR: -130b-5p, -25-5p, -335-3p, and -34a-5p not only in the formation of NS, but also in the regulation of malignant growth and invasion of GBM. Our data provide the basis for the development of new approaches to the diagnosis and treatment of GBM.

Also flagged:Narcolepsyneurological disorderneurological diseasessleepcataplexysleep paralysis
Journal Article 2022-10-30 ✓ 1 Snippet Chavda V, Chaurasia B, Umana GE, Tomasi SO, Lu B, Montemurro N.
In-Text Gene Mentions

Other antigen-presenting pathway genes linked to narcolepsy include variants of cathepsin H (CTSH, which encodes pro-cathepsin H, which processes peptides and is then presented by MHC class II on dendritic cells) and tumor necrosis factor ligand superfamily member 4 (TNFSF4, which regulates immune cell fate).

Show Full Abstract

Narcolepsy is a chronic, long-term neurological disorder characterized by a decreased ability to regulate sleep-wake cycles. Some clinical symptoms enter into differential diagnosis with other neurological diseases. Excessive daytime sleepiness and brief involuntary sleep episodes are the main clinical symptoms. The majority of people with narcolepsy experience cataplexy, which is a loss of muscle tone. Many people experience neurological complications such as sleep cycle disruption, hallucinations or sleep paralysis. Because of the associated neurological conditions, the exact pathophysiology of narcolepsy is unknown. The differential diagnosis is essential because relatively clinical symptoms of narcolepsy are easy to diagnose when all symptoms are present, but it becomes much more complicated when sleep attacks are isolated and cataplexy is episodic or absent. Treatment is tailored to the patient's symptoms and clinical diagnosis. To facilitate the diagnosis and treatment of sleep disorders and to better understand the neuropathological mechanisms of this sleep disorder, this review summarizes current knowledge on narcolepsy, in particular, genetic and non-genetic associations of narcolepsy, the pathophysiology up to the inflammatory response, the neuromorphological hallmarks of narcolepsy, and possible links with other diseases, such as diabetes, ischemic stroke and Alzheimer's disease. This review also reports all of the most recent updated research and therapeutic advances in narcolepsy. There have been significant advances in highlighting the pathogenesis of narcolepsy, with substantial evidence for an autoimmune response against hypocretin neurons; however, there are some gaps that need to be filled. To treat narcolepsy, more research should be focused on identifying molecular targets and novel autoantigens. In addition to therapeutic advances, standardized criteria for narcolepsy and diagnostic measures are widely accepted, but they may be reviewed and updated in the future with comprehension. Tailored treatment to the patient's symptoms and clinical diagnosis and future treatment modalities with hypocretin agonists, GABA agonists, histamine receptor antagonists and immunomodulatory drugs should be aimed at addressing the underlying cause of narcolepsy.

Also flagged:Gliomatumorprimary tumorTumors of the central nervous systemmalignant tumormalignant tumors
Journal Article 2022-10-30 ✓ 5 Snippets Zhang H, Huang Y, Yang E, Gao X, Zou P, Sun J, Tian Z, Bao M, Liao D, Ge J, Yang Q, Li X, Zhang Z, Luo P, Jiang X.
In-Text Gene Mentions

…Antibodies againstNEGR1(#bs-11095R, rabbit pAb)…

…13 key genes (NEGR1, ANGPTL2, TMEM100, SOX4,…

…Seven DEFRGs (NEGR1, ANGPTL2, TMEM100, MEX3A,…

…× expression ofNEGR1+ –0.40452456 ×…

NEGR1, MEX3A, ANGPTL2, and…

Show Full Abstract

<h4>Background</h4>Glioma is the most common primary tumor of the central nervous system with a high lethality rate. This study aims to mine fibroblast-related genes with prognostic value and construct a corresponding prognostic model.<h4>Methods</h4>A glioma-related TCGA (The Cancer Genome Atlas) cohort and a CGGA (Chinese Glioma Genome Atlas) cohort were incorporated into this study. Variance expression profiling was executed via the "limma" R package. The "clusterProfiler" R package was applied to perform a GO (Gene Ontology) analysis. The Kaplan-Meier (K-M) curve, LASSO regression analysis, and Cox analyses were implemented to determine the prognostic genes. A fibroblast-related risk model was created and affirmed by independent cohorts. We derived enriched pathways between the fibroblast-related high- and low-risk subgroups using gene set variation analysis (GSEA). The immune infiltration cell and the stromal cell were calculated using the microenvironment cell populations-counter (MCP-counter) method, and the immunotherapy response was assessed with the SubMap algorithm. The chemotherapy sensitivity was estimated using the "pRRophetic" R package.<h4>Results</h4>A total of 93 differentially expressed fibroblast-related genes (DEFRGs) were uncovered in glioma. Seven prognostic genes were filtered out to create a fibroblast-related gene signature in the TCGA-glioma cohort training set. We then affirmed the fibroblast-related risk model via TCGA-glioma cohort and CGGA-glioma cohort testing sets. The Cox regression analysis proved that the fibroblast-related risk score was an independent prognostic predictor in prediction of the overall survival of glioma patients. The fibroblast-related gene signature revealed by the GSEA was applicable to the immune-relevant pathways. The MCP-counter algorithm results pointed to significant distinctions in the tumor microenvironment between fibroblast-related high- and low-risk subgroups. The SubMap analysis proved that the fibroblast-related risk score could predict the clinical sensitivity of immunotherapy. The chemotherapy sensitivity analysis indicated that low-risk patients were more sensitive to multiple chemotherapeutic drugs.<h4>Conclusion</h4>Our study identified prognostic fibroblast-related genes and generated a novel risk signature that could evaluate the prognosis of glioma and offer a theoretical basis for clinical glioma therapy.

Also flagged:Bladder Cancercancersmall tumorsmalignant neoplasmscarcinoma in situtumor
Journal Article 2022-10-30 ✓ 1 Snippet Harsanyi S, Novakova ZV, Bevizova K, Danisovic L, Ziaran S.
In-Text Gene Mentions

An improved urine DNA methylation panel of three biomarkers (PCDH17, POU4F2, and PENK) showed SN of 97% and SP of 87% in BC detection [98].

Show Full Abstract

Bladder cancer (BC) is the 10th most frequent cancer in the world. The initial diagnosis and surveillance of BC require a combination of invasive and non-invasive methods, which are costly and suffer from several limitations. Cystoscopy with urine cytology and histological examination presents the standard diagnostic approach. Various biomarkers (e.g., proteins, genes, and RNAs) have been extensively studied in relation to BC. However, the new trend of liquid biopsy slowly proves to be almost equally effective. Cell-free DNA, non-coding RNA, and other subcellular structures are now being tested for the best predictive and diagnostic value. In this review, we focused on published gene mutations, especially in DNA fragments, but also epigenetic modifications, and non-coding RNA (ncRNA) molecules acquired by liquid biopsy. We performed an online search in PubMed/Medline, Scopus, and Web of Science databases using the terms "bladder cancer", in combination with "markers" or "biomarkers" published until August 2022. If applicable, we set the sensitivity and specificity threshold to 80%. In the era of precision medicine, the development of complex laboratory techniques fuels the search and development of more sensitive and specific biomarkers for diagnosis, follow-up, and screening of BC. Future efforts will be focused on the validation of their sensitivity, specificity, predictive value, and their utility in everyday clinical practice.

Also flagged:Mitochondrial EpilepsyPrimary mitochondrial diseasesmetabolismEpilepsyneurological illnessesmitochondrial disease
Journal Article 2022-10-30 No Snippets Lopriore P, Gomes F, Montano V, Siciliano G, Mancuso M.
Show Full Abstract

Primary mitochondrial diseases are relatively common inborn errors of energy metabolism, with a combined prevalence of 1 in 4300. These disorders typically affect tissues with high energy requirements, including the brain. Epilepsy affects >1% of the worldwide population, making it one of the most common neurological illnesses; it may be the presenting feature of a mitochondrial disease, but is often part of a multisystem clinical presentation. The major genetic causes of mitochondrial epilepsy are mutations in mitochondrial DNA and in the nuclear-encoded gene POLG. Treatment of mitochondrial epilepsy may be challenging, often representing a poor prognostic feature. This narrative review will cover the most recent advances in the field of mitochondrial epilepsy, from pathophysiology and genetic etiologies to phenotype and treatment options.

Also flagged:phosphorylationsepsissynapsesRap1ribosomal protein S6Magi1
Journal Article 2022-10-29 No Snippets Bai Y, Li L, Dong B, Ma W, Chen H, Yu Y.
Show Full Abstract

Our previous studies illustrated that 2% H<sub>2</sub> inhalation can protect against sepsis-associated encephalopathy (SAE) which is characterized by high mortality and has no effective treatment. To investigate the underlying role of protein phosphorylation in SAE and H<sub>2</sub> treatment, a mouse model of sepsis was constructed by caecal ligation and puncture (CLP), then treated with H<sub>2</sub> (CLP + H<sub>2</sub> ). Brain tissues of the mice were collected to be analysed with tandem mass tag-based quantitative proteomics coupled with IMAC enrichment of phosphopeptides and LC-MS/MS analysis. In proteomics and phosphoproteomics analysis, 268 differentially phosphorylated proteins (DPPs) showed a change in the phosphorylated form in the CLP + H<sub>2</sub> group (p < 0.05). Gene ontology analysis revealed that these DPPs were enriched in multiple cellular components, biological processes, and molecular functions. KEGG pathway analysis revealed that they were enriched in glutamatergic synapses, tight junctions, the PI3K-Akt signalling pathway, the HIF-1 signalling pathway, the cGMP-PKG signalling pathway, the Rap1 signalling pathway, and the vascular smooth muscle contraction. The phosphorylated forms of six DPPs, including ribosomal protein S6 (Rps6), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma (Ywhag/14-3-3), phosphatase and tensin homologue deleted on chromosome ten (Pten), membrane-associated guanylate kinase 1 (Magi1), mTOR, and protein kinase N2 (Pkn2), were upregulated and participated in the PI3K-Akt signalling pathway. The WB results showed that the phosphorylation levels of Rps6, Ywhag, Pten, Magi1, mTOR, and Pkn2 were increased. The DPPs and phosphorylation-mediated molecular network alterations in H<sub>2</sub> -treated CLP mice may elucidate the biological roles of protein phosphorylation in the therapeutic mechanism of H<sub>2</sub> treatment against SAE.

Also flagged:ubiquitinmitochondrianeurodegenerative diseasesamyotrophic lateral sclerosisALSdiabetes
Journal Article 2022-10-29 ✓ 1 Snippet Karbowski M, Oshima Y, Verhoeven N.
In-Text Gene Mentions

Htt

Show Full Abstract

Through their role in energy generation and regulation of several vital pathways, including apoptosis and inflammation, mitochondria are critical for the life of eukaryotic organisms. Mitochondrial dysfunction is a major problem implicated in the etiology of many pathologies, including neurodegenerative diseases, such as Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS), diabetes, cardiovascular diseases, and many others. Proteotoxic stress, here defined as a reduction in bioenergetic activity induced by the accumulation of aberrant proteins in the mitochondria, is likely to be implicated in disease-linked mitochondrial and cellular decline. Various quality control pathways, such as mitochondrial unfolded protein response (mtUPR), the ubiquitin (Ub)-dependent degradation of aberrant mitochondrial proteins, and mitochondria-specific autophagy (mitophagy), respond to proteotoxic stress and eliminate defective proteins or dysfunctional mitochondria. This work provides a concise review of mechanisms by which disease-linked aberrant proteins affect mitochondrial function and an overview of mitochondrial quality control pathways that counteract mitochondrial proteotoxicity. We focus on mitochondrial quality control mechanisms relying on the Ub-mediated protein degradation, such as mitochondria-specific autophagy and the mitochondrial arm of the Ub proteasome system (UPS). We highlight the importance of a widening perspective of how these pathways protect mitochondria from proteotoxic stress to better understand mitochondrial proteotoxicity in overlapping pathophysiological pathways. Implications of these mechanisms in disease development are also briefly summarized.

Also flagged:TumorcancerExtracellular vesiclestranslationalhematopoietic tumorsdeath
Journal Article 2022-10-29 No Snippets Ebrahimi N, Faghihkhorasani F, Fakhr SS, Moghaddam PR, Yazdani E, Kheradmand Z, Rezaei-Tazangi F, Adelian S, Mobarak H, Hamblin MR, Aref AR.
Show Full Abstract

Almost all clinical oncologists agree that the discovery of reliable, accessible, and non-invasive biomarkers is necessary to decrease cancer mortality. It is possible to employ reliable biomarkers to diagnose cancer in the early stages, predict the patient prognosis, follow up the response to treatment, and estimate the risk of disease recurrence with high sensitivity and specificity. Extracellular vesicles (EVs), especially exosomes, have been the focus of translational research to develop such biomarkers over the past decade. The abundance and distribution of exosomes in bodily fluids, including serum, saliva, and urine, as well as their ability to transport various biomolecules (nucleic acids, proteins, and lipids) derived from their parent cells, make exosomes reliable, accessible, and potent biomarkers for diagnosis and follow-up of solid and hematopoietic tumors. In addition, exosomes play a vital role in various cellular processes, including tumor progression, by participating in intercellular communication. Although these advantages underline the high potential of tumor-derived exosomes as diagnostic biomarkers, the lack of standardized effective methods for their isolation, identification, and precise characterization makes their application challenging in clinical settings. We discuss the importance of non-coding RNAs (ncRNAs) in cellular processes, and the role of tumor-derived exosomes containing ncRNAs as potential biomarkers in several types of cancer. In addition, the advantages and challenges of these studies for translation into clinical applications are covered.

Also flagged:DeferoxaminePosthemorrhagic hydrocephalusintraventricular hemorrhageironpathogenesishydrocephalus
Journal Article 2022-10-29 ✓ 1 Snippet Ramagiri S, Pan S, DeFreitas D, Yang PH, Raval DK, Wozniak DF, Esakky P, Strahle JM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Posthemorrhagic hydrocephalus occurs in up to 30% of infants with high-grade intraventricular hemorrhage and is associated with the worst neurocognitive outcomes in preterm infants. The mechanisms of posthemorrhagic hydrocephalus after intraventricular hemorrhage are unknown; however, CSF levels of iron metabolic pathway proteins including hemoglobin have been implicated in its pathogenesis. Here, we develop an animal model of intraventricular hemorrhage using intraventricular injection of hemoglobin at post-natal day 4 that results in acute and chronic hydrocephalus, pathologic choroid plexus iron accumulation, and subsequent choroid plexus injury at post-natal days 5, 7, and 15. This model also results in increased expression of aquaporin-1, Na<sup>+</sup>/K<sup>+</sup>/Cl<sup>-</sup> cotransporter 1, and Na<sup>+</sup>/K<sup>+</sup>/ATPase on the apical surface of the choroid plexus 24 h post-intraventricular hemorrhage. We use this model to evaluate a clinically relevant treatment strategy for the prevention of neurological sequelae after intraventricular hemorrhage using intraventricular administration of the iron chelator deferoxamine at the time of hemorrhage. Deferoxamine treatment prevented posthemorrhagic hydrocephalus for up to 11 days after intraventricular hemorrhage and prevented the development of sensorimotor gating deficits. In addition, deferoxamine treatment facilitated acute iron clearance through the choroid plexus and subsequently reduced choroid plexus iron levels at 24 h with reversal of hemoglobin-induced aquaporin-1 upregulation on the apical surface of the choroid plexus. Intraventricular administration of deferoxamine at the time of intraventricular hemorrhage may be a clinically relevant treatment strategy for preventing posthemorrhagic hydrocephalus and likely acts through promoting iron clearance through the choroid plexus to prevent hemoglobin-induced injury.

Also flagged:liver cancersPrimary liver cancerliver cancertumorstumorTP53
Journal Article 2022-10-29 No Snippets Fujita M, Chen MM, Siwak DR, Sasagawa S, Oosawa-Tatsuguchi A, Arihiro K, Ono A, Miura R, Maejima K, Aikata H, Ueno M, Hayami S, Yamaue H, Chayama K, Lee JS, Lu Y, Mills GB, Liang H, Nishizuka SS, Nakagawa H.
Show Full Abstract

Primary liver cancer is a heterogeneous disease in terms of its etiology, histology, and therapeutic response. Concurrent proteomic and genomic characterization of a large set of clinical liver cancer samples can help elucidate the molecular basis of heterogeneity and thus serve as a valuable resource for personalized liver cancer treatment. In this study, we perform proteomic profiling of ~300 proteins on 259 primary liver cancer tissues with reverse-phase protein arrays, mutational analysis using whole genome sequencing and transcriptional analysis with RNA-Seq. Patients are of Japanese ethnic background and mainly HBV or HCV positive, providing insight into this important liver cancer subtype. Unsupervised classification of tumors based on protein expression profiles reveal three proteomic subclasses R1, R2, and R3. The R1 subclass is immunologically hot and demonstrated a good prognosis. R2 contains advanced proliferative tumor with TP53 mutations, high expression of VEGF receptor 2 and the worst prognosis. R3 is enriched with CTNNB1 mutations and elevated mTOR signaling pathway activity. Twenty-two proteins, including CDK1 and CDKN2A, are identified as potential prognostic markers. The proteomic classification presented in this study can help guide therapeutic decision making for liver cancer treatment.

Also flagged:Osteopeniaatrophyblood disordersextracellularbone remodelingossification
Journal Article 2022-10-29 No Snippets Mochi F, Scatena E, Rodriguez D, Ginebra MP, Del Gaudio C.
Show Full Abstract

One of humanity's greatest challenges is space exploration, which requires an in-depth analysis of the data continuously collected as a necessary input to fill technological gaps and move forward in several research sectors. Focusing on space crew healthcare, a critical issue to be addressed is tissue regeneration in extreme conditions. In general, it represents one of the hottest and most compelling goals of the scientific community and the development of suitable therapeutic strategies for the space environment is an urgent need for the safe planning of future long-term manned space missions. Osteopenia is a commonly diagnosed disease in astronauts due to the physiological adaptation to altered gravity conditions. In order to find specific solutions to bone damage in a reduced gravity environment, bone tissue engineering is gaining a growing interest. With the aim to critically investigate this topic, the here presented review reports and discusses bone tissue engineering scenarios in microgravity, from scaffolding to bioreactors. The literature analysis allowed to underline several key points, such as the need for (i) biomimetic composite scaffolds to better mimic the natural microarchitecture of bone tissue, (ii) uniform simulated microgravity levels for standardized experimental protocols to expose biological materials to the same testing conditions, and (iii) improved access to real microgravity for scientific research projects, supported by the so-called democratization of space.

Also flagged:hepatocellular carcinomatumorlocalizationmanganesezincferrite
Journal Article 2022-10-29 No Snippets Sobhani T, Shahbazi-Gahrouei D, Zahraei M, Hejazi SH, Dousti F, Rostami M.
Show Full Abstract

<h4>Purpose</h4>Achieving new contrast enhancer agents that can produce high-resolution images in magnetic resonance imaging (MRI) with a minimum dose and side effects has always been important.<h4>Methods</h4>Herein, the pegylated curcumin-coated manganese-zinc ferrite nanoparticles (MZF@CA-PEG-CUR NPs) have been reported as an MR imaging nanoprobe in hepatocellular carcinoma detection in the murine model for the first time. In vitro studies were done on HEPA 1-6 cancer cells and L929 as normal cells, and in vivo studies were done on hepatocellular carcinoma (HCC) using xenograft models of HCC.<h4>Results</h4>The prepared NP had a diameter of 105 nm with narrow size distribution and was superparamagnetic with a saturated magnetization (Ms) of 39 emu/g. The NP was biocompatible without any significant hemolysis and cytotoxicity. Prussian blue staining showed more cellular uptake of HEPA 1-6 compared to L929 control cells after incubation (P < 0.05). The concentration of Fe in mice blood confirmed the plasma half-life of about 3 h; it seems the PEGylation increased the circulation time. ICP-OES of Fe showed the highest tumor localization for MZF@CA-CUR-PEG NPs, due to passive accumulation, compared to the other mice studied organs. The r<sub>2</sub> relaxivity of NPs was 134.89 mM<sup>- 1</sup> s<sup>- 1</sup>, and in vitro MRI demonstrated better effects in HEPA 1-6 cells than in L929 (P < 0.05). Also, in vivo MR images showed signal enhancement efficacy in tumor-bearing mice.<h4>Conclusion</h4>This study demonstrated that the MZF@CA-CUR-PEG nanoprobe could be a promising candidate as an MR imaging agent in hepatocellular carcinoma early detection.

Also flagged:Neonatal hemochromatosisironacute liver failuredeathcirrhosisThalassemia
Journal Article 2022-10-29 ✓ 3 Snippets Tsuge M, Kodera A, Sumitomo H, Araki T, Yoshida R, Yasui K, Sato H, Washio Y, Washio K, Shigehara K, Yashiro M, Yagi T, Tsukahara H.
In-Text Gene Mentions

…family history ofhemochromatosis, and no mutations…

…hereditary hemochromatosis (HFE, HJV ,…

…Neonatalhemochromatosis

Show Full Abstract

<h4>Background</h4>Neonatal hemochromatosis causes acute liver failure during the neonatal period, mostly due to gestational alloimmune liver disease (GALD). Thalassemia causes hemolytic anemia and ineffective erythropoiesis due to mutations in the globin gene. Although neonatal hemochromatosis and thalassemia have completely different causes, the coexistence of these diseases can synergistically exacerbate iron overload. We report that a newborn with εγδβ-thalassemia developed neonatal hemochromatosis, which did not respond to iron chelators and rapidly worsened, requiring living-donor liver transplantation.<h4>Case presentation</h4>A 1-day-old Japanese boy with hemolytic anemia and targeted red blood cells was diagnosed with εγδβ-thalassemia by genetic testing, and required frequent red blood cell transfusions. At 2 months after birth, exacerbation of jaundice, grayish-white stool, and high serum ferritin levels were observed, and liver biopsy showed iron deposition in hepatocytes and Kupffer cells. Magnetic resonance imaging scans showed findings suggestive of iron deposits in the liver, spleen, pancreas, and bone marrow. The total amount of red blood cell transfusions administered did not meet the criteria for post-transfusion iron overload. Administration of an iron-chelating agent was initiated, but iron overload rapidly progressed to liver failure without improvement in jaundice and liver damage. He underwent living-donor liver transplantation from his mother, after which iron overload disappeared, and no recurrence of iron overload was observed. Immunohistochemical staining for C5b-9 in the liver was positive. Serum hepcidin levels were low and serum growth differentiation factor-15 levels were high prior to living-donor liver transplantation.<h4>Conclusions</h4>We reported that an infant with εγδβ-thalassemia developed NH due to GALD, and that coexistence of ineffective erythropoiesis in addition to erythrocyte transfusions may have exacerbated iron overload. Low serum hepcidin levels, in this case, might have been caused by decreased hepcidin production arising from fetal liver damage due to neonatal hemochromatosis and increased hepcidin-inhibiting hematopoietic mediators due to the ineffective hematopoiesis observed in thalassemia.

Also flagged:psoriasis vulgarisagingtelomeremethylation5-methylcytosinetelomeres
Journal Article 2022-10-29 ✓ 2 Snippets Beranek M, Borsky P, Fiala Z, Andrys C, Hamakova K, Chmelarova M, Kovarikova H, Karas A, Kremlacek J, Palicka V, Borska L.
In-Text Gene Mentions

Another study, examining whole blood methylation differences in psoriasis, identified three regions on chromosome-8, and chromosome-6 loci MICA, IRIF1, PSORS1C3, and TNFSF4 as hypermethylated in paternally transmitted disease, while PSORS1C1 was hypomethylated.37

…IRIF1, PSORS1C3, andTNFSF4as hypermethylated in…

Show Full Abstract

<h4>Background</h4>The pathogenesis of psoriasis vulgaris involves changes in DNA molecules, genomic instability, telomere attrition, and epigenetic alterations among them. These changes are also considered important mechanisms of aging in cells and tissues.<h4>Objective</h4>This study dealt with oxidation damage, telomere length and methylation status in DNA originating from peripheral blood of 41 psoriatic patients and 30 healthy controls.<h4>Methods</h4>Oxidative damage of serum DNA/RNA was determined immunochemically. Real-time PCR was used for the analysis of the telomere length. ELISA technique determined levels of 5-methylcytosine in blood cells' DNA.<h4>Results</h4>Oxidative damage of serum DNA/RNA was higher in patients than in controls (median, 3758 vs. 2286pg/mL, p<0.001). A higher length of telomeres per chromosome was found in patients whole-cell DNA than in controls (3.57 vs. 3.04 kilobases, p=0.011). A negative correlation of the length of telomeres with an age of the control subjects was revealed (Spearman's rho=-0.420, p=0.028). Insignificantly different levels of 5-methylcytosine in patients and controls were observed (33.20 vs. 23.35%, p=0.234). No influences of sex, smoking, BMI, PASI score, and metabolic syndrome on the methylation status were found.<h4>Study limitations</h4>i) A relatively small number of the participants, particularly for reliable subgroup analyses, ii) the Caucasian origin of the participants possibly influencing the results of the parameters determined, and iii) Telomerase activity was not directly measured in serum or blood cells.<h4>Conclusion</h4>The study demonstrated increased levels of oxidized DNA/RNA molecules in the serum of patients with exacerbated psoriasis vulgaris. The results were minimally influenced by sex, the presence of metabolic syndrome, or cigarette smoking. In the psoriatic blood cells' DNA, the authors observed longer telomeres compared to healthy controls, particularly in females. Insignificantly higher global DNA methylation in psoriasis cases compared to the controls indicated marginal clinical importance of this epigenetic test performed in the blood cells' DNA.

Also flagged:Peroxiredoxin 6proteolysisPrdx 6degradationcaspaseBax
Journal Article 2022-10-29 ✓ 5 Snippets Wang X, Huang L, Zhang Y, Zhu L, Yang X, Zuo H, Luo X, Mao Y, Hopkins DL.
In-Text Gene Mentions

…the inhibitor ofPrdx6(NSC348884) for different…

…The expression ofPrdx6, proteolysis indicated by…

…significantly reduced thePrdx6level, while the…

…cells adaptively increasedPrdx6expression to resist…

…samples in whichPrdx6was inhibited demonstrated…

Show Full Abstract

The objective of the present study was to explore the effect of Peroxiredoxin 6 (Prdx 6) on beef tenderization during the early postmortem period. The longissimus lumborum (LL) were obtained at 45 min postmortem from 6 beef carcasses and then incubated with or without the inhibitor of Prdx6 (NSC348884) for different times, followed by incubation with or without the H<sub>2</sub>O<sub>2</sub> (simulation of oxidative stress). The expression of Prdx6, proteolysis indicated by desmin degradation, cell apoptosis rate and expression of caspases were measured. The results indicated that the inhibitor significantly reduced the Prdx6 level, while the cells adaptively increased Prdx6 expression to resist the oxidative stress caused by H<sub>2</sub>O<sub>2</sub>. Moreover, the samples in which Prdx6 was inhibited demonstrated more severe desmin degradation accompanied by a higher apoptosis rate which was induced by the increase in caspase degradation as well as the ratio of Bax/Bcl-2. These results demonstrated that inhibiting Prdx6 could promote cell apoptosis and further accelerate beef tenderization.

Also flagged:ITCHAutoimmune DiseaseADMFDfailure to thrivedevelopmental delaysystemic autoimmunity
Journal Article 2022-10-29 ✓ 2 Snippets Wolfe R, Heiman P, D'Annibale O, Karunanidhi A, Powers A, Mcguire M, Seminotti B, Dobrowolski SF, Reyes-Múgica M, Torok KS, Mohsen AW, Vockley J, Ghaloul-Gonzalez L.
In-Text Gene Mentions

A link between mitochondrial physiology and the ubiquitin proteasome system (UPS) has been postulated, with mutations in intramitochondrial E3 ubiquitin ligase (FBXL4) leading to mitochondrial encephalopathy accompanied by severe deficiencies in mitochondrial bioenergetics and alterations in oxidative phosphorylation (OXPHOS) proteins [[16], [17], [18]].

…ubiquitin ligase (FBXL4) leading to…

Show Full Abstract

Autoimmune Disease, Multisystem, with Facial Dysmorphism (ADMFD) is an autosomal recessive disorder due to pathogenic variants in the <i>ITCH</i> gene. It is characterized by failure to thrive, dysmorphic facial features, developmental delay, and systemic autoimmunity that can manifest variably with autoimmune hepatitis, thyroiditis, and enteropathy, among other organ manifestations. It was originally described in 10 consanguineous Old Order Amish patients, and more recently in two patients of White British and Black German ethnicities. While the role of ITCH protein in apoptosis and inflammation has previously been characterized, a defect in cellular bioenergetics has not yet been reported in ITCH deficiency. Here we present a Caucasian female originally evaluated for possible mitochondrial respiratory chain deficiency, who ultimately was found to have two novel variants in <i>ITCH</i> with absence of ITCH protein in patient derived fibroblasts. Clinical studies of patient muscle showed mitochondrial DNA copy number of 57% compared to controls. Functional studies in skin fibroblasts revealed decreased activity of mitochondrial fatty acid oxidation and oxidative phosphorylation, and decreased overall ATP production. Our findings confirm mitochondrial energy dysfunction in a patient with ITCH deficiency offering the opportunity to assess alternative therapeutic options.

Also flagged:bindingtransductionsynthesispeptidecarbohydrateglucose
Journal Article 2022-10-29 No Snippets Ullah SF, Moreira G, Datta SPA, McLamore E, Vanegas D.
Show Full Abstract

Biolayer interferometry (BLI) is a well-established laboratory technique for studying biomolecular interactions important for applications such as drug development. Currently, there are interesting opportunities for expanding the use of BLI in other fields, including the development of rapid diagnostic tools. To date, there are no detailed frameworks for implementing BLI in target-recognition studies that are pivotal for developing point-of-need biosensors. Here, we attempt to bridge these domains by providing a framework that connects output(s) of molecular interaction studies with key performance indicators used in the development of point-of-need biosensors. First, we briefly review the governing theory for protein-ligand interactions, and we then summarize the approach for real-time kinetic quantification using various techniques. The 2020 PRISMA guideline was used for all governing theory reviews and meta-analyses. Using the information from the meta-analysis, we introduce an experimental framework for connecting outcomes from BLI experiments (<i>K</i><sub>D</sub>, <i>k</i><sub>on</sub>, <i>k</i><sub>off</sub>) with electrochemical (capacitive) biosensor design. As a first step in the development of a larger framework, we specifically focus on mapping BLI outcomes to five biosensor key performance indicators (sensitivity, selectivity, response time, hysteresis, operating range). The applicability of our framework was demonstrated in a study of case based on published literature related to SARS-CoV-2 spike protein to show the development of a capacitive biosensor based on truncated angiotensin-converting enzyme 2 (ACE2) as the receptor. The case study focuses on non-specific binding and selectivity as research goals. The proposed framework proved to be an important first step toward modeling/simulation efforts that map molecular interactions to sensor design.

Also flagged:GliomaglioblastomadeathYO-PRO-1malignant gliomaautophagy
Journal Article 2022-10-29 No Snippets Yu S, Chen L, Song K, Shu T, Fang Z, Ding L, Liu J, Jiang L, Zhang G, Zhang B, Qin Z.
Show Full Abstract

The heat-sink effect and thermal damage of conventional thermal ablative technologies can be minimized by irreversible electroporation (IRE), which results in clear ablative boundaries and conservation of blood vessels, facilitating maximal safe surgical resection for glioblastoma. Although much comparative data about the death forms in IRE have been published, the comprehensive genetic regulatory mechanism for apoptosis, among other forms of regulatory cell death (RCD), remains elusive. We investigated the electric field intensity threshold for apoptosis/necrosis (YO-PRO-1/PI co-staining) of the U251 human malignant glioma cell line with stepwise increased uniform field intensity. Time course samples (0-6 h) of apoptosis induction and sham treatment were collected for transcriptome sequencing. Sequencing showed that transcription factor <i>AP-1</i> and its target gene <i>Bim</i> (Bcl2l11), related to the signaling pathway, played a major role in the apoptosis of glioma after IRE. The sequencing results were confirmed by qPCR and Western blot. We also found that the transcription changes also implicated three other forms of RCD: autophagy, necroptosis, and immunogenic cell death (ICD), in addition to apoptosis. These together imply that IRE possibly mediates apoptosis by the <i>AP-1-Bim</i> pathway, causes mixed RCD simultaneously, and has the potential to aid in the generation of a systemic antitumor immune response.

Also flagged:breast cancercancergene expressiondeathHER2solid tumors
Journal Article 2022-10-29 No Snippets Adnan N, Najnin T, Ruan J.
Show Full Abstract

Accurate prediction of breast cancer metastasis in the early stages of cancer diagnosis is crucial to reduce cancer-related deaths. With the availability of gene expression datasets, many machine-learning models have been proposed to predict breast cancer metastasis using thousands of genes simultaneously. However, the prediction accuracy of the models using gene expression often suffers from the diverse molecular characteristics across different datasets. Additionally, breast cancer is known to have many subtypes, which hinders the performance of the models aimed at all subtypes. To overcome the heterogeneous nature of breast cancer, we propose a method to obtain personalized classifiers that are trained on subsets of patients selected using the similarities between training and testing patients. Results on multiple independent datasets showed that our proposed approach significantly improved prediction accuracy compared to the models trained on the complete training dataset and models trained on specific cancer subtypes. Our results also showed that personalized classifiers trained on positively and negatively correlated patients outperformed classifiers trained only on positively correlated patients, highlighting the importance of selecting proper patient subsets for constructing personalized classifiers. Additionally, our proposed approach obtained more robust features than the other models and identified different features for different patients, making it a promising tool for designing personalized medicine for cancer patients.

Also flagged:neurodegenerative diseasesamyotrophic lateral sclerosisfrontotemporal dementiaADdementiapositron
Journal Article 2022-10-29 No Snippets Huseby CJ, Delvaux E, Brokaw DL, Coleman PD.
Show Full Abstract

The clinical diagnosis of neurodegenerative diseases is notoriously inaccurate and current methods are often expensive, time-consuming, or invasive. Simple inexpensive and noninvasive methods of diagnosis could provide valuable support for clinicians when combined with cognitive assessment scores. Biological processes leading to neuropathology progress silently for years and are reflected in both the central nervous system and vascular peripheral system. A blood-based screen to distinguish and classify neurodegenerative diseases is especially interesting having low cost, minimal invasiveness, and accessibility to almost any world clinic. In this study, we set out to discover a small set of blood transcripts that can be used to distinguish healthy individuals from those with Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, or frontotemporal dementia. Using existing public datasets, we developed a machine learning algorithm for application on transcripts present in blood and discovered small sets of transcripts that distinguish a number of neurodegenerative diseases with high sensitivity and specificity. We validated the usefulness of blood RNA transcriptomics for the classification of neurodegenerative diseases. Information about features selected for the classification can direct the development of possible treatment strategies.

Also flagged:Breast cancercancerdeathmetabolismdetoxificationcell death
Journal Article 2022-10-29 ✓ 1 Snippet Barata IS, Gomes BC, Rodrigues AS, Rueff J, Kranendonk M, Esteves F.
In-Text Gene Mentions

…I2 synthase (PTGIS), and dopamine…

Show Full Abstract

The altered activity of drug metabolism enzymes (DMEs) is a hallmark of chemotherapy resistance. Cytochrome P450s (CYPs), mainly CYP3A4, and several oxidoreductases are responsible for Phase I metabolism of doxorubicin (DOX), an anthracycline widely used in breast cancer (BC) treatment. This study aimed to investigate the role of Phase I DMEs involved in the first stages of acquisition of DOX-resistance in BC cells. For this purpose, the expression of 92 DME genes and specific CYP-complex enzymes activities were assessed in either sensitive (MCF-7 parental cells; MCF-7/DOX<sup>S</sup>) or DOX-resistant (MCF-7/DOX<sup>R</sup>) cells. The DMEs genes detected to be significantly differentially expressed in MCF-7/DOX<sup>R</sup> cells (12 CYPs and eight oxidoreductases) were indicated previously to be involved in tumor progression and/or chemotherapy response. The analysis of CYP-mediated activities suggests a putative enhanced CYP3A4-dependent metabolism in MCF-7/DOX<sup>R</sup> cells. A discrepancy was observed between CYP-enzyme activities and their corresponding levels of mRNA transcripts. This is indicative that the phenotype of DMEs is not linearly correlated with transcription induction responses, confirming the multifactorial complexity of this mechanism. Our results pinpoint the potential role of specific CYPs and oxidoreductases involved in the metabolism of drugs, retinoic and arachidonic acids, in the mechanisms of chemo-resistance to DOX and carcinogenesis of BC.

Also flagged:Trichostatin AhistoneDNA methyltransferasesrheumatoid arthritisHDAC3SIRT2
Journal Article 2022-10-29 ✓ 3 Snippets Ząbek T, Witarski W, Szmatoła T, Sawicki S, Mrozowicz J, Samiec M.
In-Text Gene Mentions

…NFIB, NFIX, PRRX1,SOX6, TCF7L1, TRPS1, ZBTB20)…

…with SOX5 andSOX6(TFs) [ 25…

…even detected TSA-relatedSOX6downregulation, pointing to…

Show Full Abstract

Epigenetic mechanisms of gene regulation are important for the proper differentiation of cells used for therapeutic and regenerative purposes. The primary goal of the present study was to investigate the impacts of 5-aza-2' deoxycytidine (5-AZA-dc)- and/or trichostatin A (TSA)-mediated approaches applied to epigenomically modulate the ex vivo expanded equine chondrocytes maintained in monolayer culture on the status of chondrogenic cytodifferentiation at the transcriptome level. The results of next-generation sequencing of 3' mRNA-seq libraries on stimulated and unstimulated chondrocytes of the third passage showed no significant influence of 5-AZA-dc treatment. Chondrocytes stimulated with TSA or with a combination of 5-AZA-dc+TSA revealed significant expressional decline, mainly for genes encoding histone and DNA methyltransferases, but also for other genes, many of which are enriched in canonical pathways that are important for chondrocyte biology. The TSA- or 5-AZA-dc+TSA-induced upregulation of expanded chondrocytes included genes that are involved in histone hyperacetylation and also genes relevant to rheumatoid arthritis and inflammation. Chondrocyte stimulation experiments including a TSA modifier also led to the unexpected expression incrementation of genes encoding HDAC3, SIRT2, and SIRT5 histone deacetylases and the MBD1 CpG-binding domain protein, pointing to another function of the TSA agent besides its epigenetic-like properties. Based on the transcriptomic data, TSA stimulation seems to be undesirable for chondrogenic differentiation of passaged cartilaginous cells in a monolayer culture. Nonetheless, obtained transcriptomic results of TSA-dependent epigenomic modification of the ex vivo expanded equine chondrocytes provide a new source of data important for the potential application of epigenetically altered cells for transplantation purposes in tissue engineering of the equine skeletal system.

Also flagged:TransferrinCognitive DeficitsChronic Schizophreniaironschizophreniacognition
Journal Article 2022-10-29 ✓ 5 Snippets Chen P, Wang D, Xiu M, Chen D, Lackey B, Wu HE, Wang L, Zhang X.
In-Text Gene Mentions

The hemochromatosis HFE gene polymorphism (H63D at rs1799945) is also associated with reduced transferrin levels and white matter fiber integrity in the external capsule [44].

Another study also demonstrated that the investigated HFE mutations (C282Y and H63D) and/or TF-C2 polymorphism were not correlated with schizophrenia/schizoaffective disorder [35].

In humans, the gene encoding transferrin is located on chromosome 3q21, encoding a molecule that binds to hemochromatosis (HFE) protein to form a stable complex that regulates iron transport [30].

…that binds tohemochromatosis(HFE) protein to…

…binds to hemochromatosis (HFE) protein to form…

Show Full Abstract

A large amount of recent literature has focused on impaired iron homeostasis in the pathophysiology of schizophrenia. Specifically, microarray analysis has illustrated associations between the transferrin locus and schizophrenia. To elaborate on the effects of transferrin on schizophrenia and its psychiatric phenotypes, our study aimed to investigate whether transferrin gene polymorphism was correlated with cognitive deficits and clinical symptoms in schizophrenia. We recruited 564 patients with chronic schizophrenia and 422 healthy controls (HCs) in a Han Chinese population, collected phenotypic data, and genotyped the rs3811655 polymorphism of the transferrin gene. Our results showed that the rs3811655 polymorphism was related to cognitive performance in both patients and HCs, as well as negative symptoms in patients (all p < 0.05), and patients carrying at least one G-allele showed worsened cognition/severe negative symptoms (all p < 0.05). Further analyses also found that the rs3811655 polymorphism in combination with cognition may exert small but significant contributions to the negative (β = −0.10, t = −2.48, p < 0.05) or total psychiatric symptoms (β = −0.08, t = −1.92, p < 0.05) in patients. Our findings indicated that the rs3811655 polymorphism may be implicated in the cognitive deficits of schizophrenia and HCs as well as psychiatric symptoms in patients, which suggested the possible iron regulatory mechanism in the pathology of schizophrenia.

Also flagged:NanomaterialsGlass ionomerfluoridedecayoxideoral diseases
Journal Article 2022-10-29 No Snippets Fierascu RC.
Show Full Abstract

Glass ionomer cements (GICs), restorative materials with commercial availability spanning over five decades, are widely applied due to their advantages (including bio-compatibility, fluoride release, or excellent bonding properties). However, GICs have shortcomings. Among the disadvantages limiting the application of GICs, the poor mechanical properties are the most significant. In order to enhance the mechanical or antimicrobial properties of these materials, the addition of nanomaterials represents a viable approach. The present paper aims to review the literature on the application of different types of nanomaterials for the enhancement of GICs' mechanical and antimicrobial properties, which could lead to several clinical benefits, including better physical properties and the prevention of tooth decay. After applying the described methodology, representative articles published in the time period 2011-present were selected and included in the final review, covering the modification of GICs with metallic nanoparticles (Cu, Ag), metallic and metalloid oxide nanoparticles (TiO<sub>2</sub>, ZnO, MgO, Al<sub>2</sub>O<sub>3</sub>, ZrO<sub>2</sub>, SiO<sub>2</sub>), apatitic nanomaterials, and other nanomaterials or multi-component nanocomposites.

Also flagged:ACE2TMPRSS2EVsChronic hepatitisCHinfection
Journal Article 2022-10-29 ✓ 1 Snippet Rosso C, Demelas C, Agostini G, Abate ML, Vernero M, Caviglia GP, D'Amato D, Armandi A, Tapparo M, Guariglia M, Troshina G, Massano A, Olivero A, Nicolosi A, Zannetti A, Pellicano R, Ciancio A, Saracco GM, Ribaldone DG, Bugianesi E, Fagoonee S.
In-Text Gene Mentions

…liver disease, andhemochromatosiswere excluded.…

Show Full Abstract

Chronic hepatitis (CH) of dysmetabolic or viral etiology has been associated with poor prognosis in patients who experienced the severe acute respiratory coronavirus virus-2 (SARS-Cov-2) infection. We aimed to explore the impact of SARS-Cov-2 infection on disease severity in a group of patients with CH. Forty-two patients with CH of different etiology were enrolled (median age, 56 years; male gender, 59%). ACE2 and TMPRSS2 were measured in plasma samples of all patients by ELISA and in the liver tissue of a subgroup of 15 patients by Western blot. Overall, 13 patients (31%) experienced SARS-Cov-2 infection: 2/15 (15%) had CHB, 5/12 (39%) had CHC, and 6/15 (46%) had non-alcoholic fatty liver disease (NAFLD). Compared to viral CH patients, NAFLD subjects showed higher circulating ACE2 levels (<i>p</i> = 0.0019). Similarly, hepatic expression of ACE2 was higher in subjects who underwent SARS-Cov-2 infection compared to the counterpart, (3.24 ± 1.49 vs. 1.49 ± 1.32, <i>p</i> = 0.032). Conversely, hepatic TMPRSS2 was significantly lower in patients who experienced symptomatic COVID-19 disease compared to asymptomatic patients (<i>p</i> = 0.0038). Further studies are necessary to understand the impact of COVID-19 in patients with pre-existing liver diseases.

Also flagged:MANFsecretionHepatic fibrosisPeroxiredoxin 6carbontetrachloride
Journal Article 2022-10-29 ✓ 5 Snippets Tao X, Wang D, Liang Y, Yang L, He E, Zhou J, He Y, Liang J, Wang P, Chhetri G, Li Q, Shen Y, Shen Y.
In-Text Gene Mentions

To explore the underlying mechanisms, we identified mesencephalic astrocyte-derived neurotrophic factor (MANF), a suppressor for hepatic fibrosis and NF-κB pathway, as an interacting protein of PRDX6.

In conclusion, PRDX6 is an effective inhibitor for hepatic fibrosis through a non-enzymic dependent interacting with MANF, which will offer a potential target for hepatic fibrosis therapy.

Furthermore, we found that PRDX6 knockout promoted α-SMA expression in normal and fibrotic conditions, especially in hepatic fibrosis.

PRDX6inhibits hepatic stellate…

…Peroxiredoxin 6 (PRDX6), a multifunctional protein,…

Show Full Abstract

Hepatic fibrosis is a chronic inflammatory process with hepatic stellate cells (HSCs) activation. Peroxiredoxin 6 (PRDX6), a multifunctional protein, was reported to protect against liver injury induced by ischemia/reperfusion and high-fat diet. However, the effect of PRDX6 on hepatic fibrosis remains unclear. Male Sprague-Dawley rats were treated with carbon tetrachloride (CCl<sub>4</sub>) for 4-8 weeks to induce hepatic fibrosis. Here, we found that PRDX6 was mainly expressed in hepatocytes and significantly upregulated in CCl<sub>4</sub>-induced liver fibrosis. To clarify the impact of PRDX6 in hepatic fibrosis, we constructed a PRDX6 knockout (PRDX6<sup>-/-</sup>) rat model by using CRISPR/Cas9 method. We found that PRDX6 deficiency accelerated CCl<sub>4</sub>-induced liver fibrosis. Furthermore, we found that PRDX6 knockout promoted α-SMA expression in normal and fibrotic conditions, especially in hepatic fibrosis. PRDX6 knockout significantly upregulated Col1α1 and Col3α1 in fibrotic tissues. To explore the underlying mechanisms, we identified mesencephalic astrocyte-derived neurotrophic factor (MANF), a suppressor for hepatic fibrosis and NF-κB pathway, as an interacting protein of PRDX6. PRDX6 promoted MANF secretion by binding to the C-terminus of MANF, which did not depend on its peroxidase and PLA<sub>2</sub> activities. Similarly, MANF increased PRDX6 protein level and promoted its secretion. Additionally, PRDX6 knockout increased p65 level either in cytoplasm or nuclei in HSCs under fibrotic condition. In conclusion, PRDX6 is an effective inhibitor for hepatic fibrosis through a non-enzymic dependent interacting with MANF, which will offer a potential target for hepatic fibrosis therapy.

Also flagged:obesityosteoarthritisOAlipopolysaccharideknee OAmetabolism
Journal Article 2022-10-29 ✓ 1 Snippet Arbeeva L, Azcarate-Peril MA, Cui Y, Nelson AE, Loeser RF.
In-Text Gene Mentions

…in patients withhemochromatosis[ 14 ].…

Show Full Abstract

<h4>Objective</h4>To examine the plasma microbiome for differences between obese individuals with and without osteoarthritis (OA) and its association with serum lipopolysaccharide (LPS).<h4>Design</h4>Blood samples from 70 participants with body mass index (BMI) ​≥ ​30kg/m2 and age ≥55 years, with (cases) or without (controls) hand plus knee OA, were analyzed for serum LPS and composition of the plasma microbiome. The Dirichlet-multinominal recursive partitioning model (DM-RPart) was applied to microbiome compositional data to test the hypothesis that LPS levels distinguish plasma microbiome, accounting for BMI and age.<h4>Results</h4>No significant differences in alpha diversity, or compositional differences between groups at the genus level, were seen between cases and controls (p ​= ​0.11). β-Diversity was significantly associated with serum LPS levels (p ​= ​0.01). DM-RPart resulted in an optimal tree with 3 divisions: 1) based on age (split at 69 years); 2) those older than 69 were split based on BMI; 3) those with BMI <39 ​kg/m2 were split based on LPS level (at 65 EU/ml). This resulted in 4 groups (nodes 2, and 5-7). Participants in node 2 were younger and the majority had no or mild OA. Those in nodes 5 and 6 were comparable in age and BMI but node 6 had higher LPS and more severe OA. Individuals in node 7 were older, had higher BMI, and the most severe OA.<h4>Conclusions</h4>Our results suggest a relationship between serum LPS and the plasma microbiome in a subgroup of obese individuals with hand plus knee OA that could reflect differences in intestinal permeability.

Also flagged:PS1PM5PVS1amino acidnucleotideBRCA1
Journal Article 2022-10-28 ✓ 1 Snippet Bhat V, Adzhubei IA, Fife JD, Lebo M, Cassa CA.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Purpose</h4>This study aimed to explore whether evidence of pathogenicity from prior variant classifications in ClinVar could be used to inform variant interpretation using the American College of Medical Genetics and Genomics/Association for Molecular Pathology clinical guidelines.<h4>Methods</h4>We identified distinct single-nucleotide variants (SNVs) that are either similar in location or in functional consequence to pathogenic variants in ClinVar and analyzed evidence in support of pathogenicity using 3 interpretation criteria.<h4>Results</h4>Thousands of variants, including many in clinically actionable disease genes (American College of Medical Genetics and Genomics secondary findings v3.0), have evidence of pathogenicity from existing variant classifications, accounting for 2.5% of nonsynonymous SNVs within ClinVar. Notably, there are many variants with uncertain or conflicting classifications that cause the same amino acid substitution as other pathogenic variants (PS1, N = 323), variants that are predicted to cause different amino acid substitutions in the same codon as pathogenic variants (PM5, N = 7692), and loss-of-function variants that are present in genes in which many loss-of-function variants are classified as pathogenic (PVS1, N = 3635). Most of these variants have similar computational predictions of pathogenicity and splicing effect as their associated pathogenic variants.<h4>Conclusion</h4>Broadly, for >1.4 million SNVs exome wide, information from previously classified variants could be used to provide evidence of pathogenicity. We have developed a pipeline to identify variants meeting these criteria that may inform interpretation efforts.

Also flagged:pituitary neuroendocrine tumorsneuroendocrine tumorstumorsNFDLG5ETS2
Journal Article 2022-10-28 ✓ 1 Snippet Aydin B, Beklen H, Arga KY, Bayrakli F, Turanli B.
In-Text Gene Mentions

…biological levels revealedDCC, DLG5, ETS2, FOXO1,…

Show Full Abstract

<h4>Purpose</h4>Non-functioning pituitary neuroendocrine tumors are challengingly diagnosed tumors in the clinic. Transsphenoidal surgery remains the first-line treatment. Despite the development of state-of-the-art techniques, no drug therapy is currently approved for the treatment. There are also no randomized controlled trials comparing therapeutic strategies or drug therapy for the management after surgery. Therefore, novel therapeutic interventions for the therapeutically challenging NF-PitNETs are urgently needed.<h4>Methods</h4>We integrated epigenome and transcriptome data (both coding and non-coding) that elucidate disease-specific signatures, in addition to biological and pharmacological data, to utilize rational pathway and drug prioritization in NF-PitNETs. We constructed an epigenome- and transcriptome-based PPI network and proposed hub genes. The signature-based drug repositioning based on the integration of multi-omics data was performed.<h4>Results</h4>The construction of a disease-specific network based on three different biological levels revealed DCC, DLG5, ETS2, FOXO1, HBP1, HMGA2, PCGF3, PSME4, RBPMS, RREB1, SMAD1, SOCS1, SOX2, YAP1, ZFHX3 as hub proteins. Signature-based drug repositioning using hub proteins yielded repositioned drug candidates that were confirmed in silico via molecular docking. As a result of molecular docking simulations, palbociclib, linifanib, trametinib, eplerenone, niguldipine, and zuclopenthixol showed higher binding affinities with hub genes compared to their inhibitors and were proposed as potential repositioned therapeutics for the management of NF-PitNETs.<h4>Conclusion</h4>The proposed systems' biomedicine-oriented multi-omics data integration for drug repurposing to provide promising results for the construction of effective clinical therapeutics. To the best of our knowledge, this is the first study reporting epigenome- and transcriptome-based drug repositioning for NF-PitNETs using in silico confirmations.

Also flagged:nonalcoholic fatty liver diseaseNAFLDliver fibrosistype IV collagenliver diseasefibrosis
Journal Article 2022-10-28 ✓ 1 Snippet Kobayashi T, Ogawa Y, Shinoda S, Iwaki M, Nogami A, Honda Y, Kessoku T, Imajo K, Yoneda M, Saito S, Yamamoto K, Oeda S, Takahashi H, Sumida Y, Nakajima A.
In-Text Gene Mentions

…gitis, sclerosing cholangitis,hemochromatosis, α1-antitrypsin deficiency, o…

Show Full Abstract

A 2-step approach, Fibrosis-4 index (FIB-4) followed by vibration-controlled transient elastography (VCTE), has been proposed to predict advanced fibrosis in patients with nonalcoholic fatty liver disease (NAFLD). We aimed to develop a novel 3-step approach for predicting advanced fibrosis. We enrolled 284 biopsy-confirmed NAFLD patients from two tertiary care centers and developed subgroups (n = 190), including 3.7% of patients with advanced fibrosis, assuming a primary care setting. In the 3-step approach, patients with intermediate-to-high FIB-4 in the first step underwent an enhanced liver fibrosis test or measurement of type IV collagen 7S domain as the second step, and VCTE was performed if the second step value was higher than the cutoff. In 284 cases, a tertiary care cohort with 36.3% advanced fibrosis, the 3-step approach showed significantly higher specificity and positive predictive value than the 2-step approach. In the subgroup with 3.7% advanced fibrosis, the 3-step approach significantly reduced the referral rate to specialists, the number of high-risk patients (i.e., liver biopsy candidates), and healthcare costs by 12.5% to 15.8%. The 3-step approach may improve the diagnostic performance to predict advanced fibrosis in NAFLD, which could lower rates of referrals to specialists, liver biopsies, and medical costs.

Also flagged:LPCAT1tumorshepatocellular carcinomatumorcheckpointgene expression
Journal Article 2022-10-28 ✓ 1 Snippet Li L, Wang X, Ding Y, Hui N, Su B, Yang M.
In-Text Gene Mentions

…expression were UPB1,SERPINC1, DAO, GLYATL1 and…

Show Full Abstract

<h4>Background</h4>Lysophosphatidylcholine acyltransferase 1 (LPCAT1) is overexpressed in multiple human tumors. However, the role of LPCAT1 in hepatocellular carcinoma (HCC) has not been understood. We aim to explore the relationships between LPCAT1 expression and prognosis, clinicopathological features, tumor microenvironment (TME), immune cell infiltration, immune checkpoint gene expression, and related signaling pathways in HCC. Furthermore, we also explored the relationship between LPCAT1 expression and drug sensitivity to HCC treatment.<h4>Methods</h4>The expression profiles were acquired from the Cancer Genome Atlas (TCGA) and the Human Protein Atlas (THPA). Immune status and infiltration in cancer tissues were explored using the single sample gene set enrichment analysis (ssGSEA) and CIBERSORT algorithm.<h4>Results</h4>LPCAT1 was overexpressed in HCC, and its expression was related to poor prognosis, LPCAT1 was an independent prognostic biomarker in HCC. Expression of LPCAT1 increased statistically with the increase of clinical stage and grade of HCC patients. GO and KEGG network analysis revealed that LPCAT1 positively associated molecules were mostly enriched in functions related to cell adhesion. The TME score of high-LPCAT1 group was significantly higher than that of low-LPCAT1 group. Immune infiltrating cells positively correlated with LPCAT1 expression were Macrophages M0, B cells memory, Dendritic cells activated, T cells regulatory and T cells gamma delta in HCC. We found a positive correlation between LPCAT1 and most immune checkpoint gene expression. The IC50 of 5-Fluorouracil, Gemcitabine, Mitomycin C, Sorafenib and Cabozantinib in patients with high-LPCAT1 expression was lower than that in patients with low-LPCAT1 expression. Our findings provide a wealth of information for further understanding of the biological functions and signaling pathways of LPCAT1 in HCC.<h4>Conclusions</h4>LPCAT1 is an independent prognostic biomarker and associated with tumor microenvironment, immune cell infiltration, immune checkpoint expression and drug sensitivity in hepatocellular carcinoma.

Also flagged:RNA binding proteinsgene expressionmodificationsMLLleukemiaregulators
Journal Article 2022-10-28 ✓ 1 Snippet Tran TM, Rao DS.
In-Text Gene Mentions

…AF9 (MLLT3), AF10 (MLLT10) and ENL (MLLT1),…

Show Full Abstract

RNA binding proteins (RBPs) have recently emerged as important post-transcriptional gene expression regulators in both normal development and disease. RBPs influence the fate of mRNAs through multiple mechanisms of action such as RNA modifications, alternative splicing, and miR-mediated regulation. This complex and, often, combinatorial regulation by RBPs critically impacts the expression of oncogenic transcripts and, thus, the activation of pathways that drive oncogenesis. Here, we focus on the major features of RBPs, their mechanisms of action, and discuss the current progress in investigating the function of important RBPs in MLL-rearranged leukemia.

Also flagged:RNAPIIkinaseP-TEFbendonucleasephosphatasephosphorylation
Journal Article 2022-10-28 ✓ 1 Snippet Stein CB, Field AR, Mimoso CA, Zhao C, Huang KL, Wagner EJ, Adelman K.
In-Text Gene Mentions

Lrriq3

Show Full Abstract

RNA polymerase II (RNAPII) pausing in early elongation is critical for gene regulation. Paused RNAPII can be released into productive elongation by the kinase P-TEFb or targeted for premature termination by the Integrator complex. Integrator comprises endonuclease and phosphatase activities, driving termination by cleavage of nascent RNA and removal of stimulatory phosphorylation. We generated a degron system for rapid Integrator endonuclease (INTS11) depletion to probe the direct consequences of Integrator-mediated RNA cleavage. Degradation of INTS11 elicits nearly universal increases in active early elongation complexes. However, these RNAPII complexes fail to achieve optimal elongation rates and exhibit persistent Integrator phosphatase activity. Thus, only short transcripts are significantly upregulated following INTS11 loss, including transcription factors, signaling regulators, and non-coding RNAs. We propose a uniform molecular function for INTS11 across all RNAPII-transcribed loci, with differential effects on particular genes, pathways, or RNA biotypes reflective of transcript lengths rather than specificity of Integrator activity.

Also flagged:osteoporosisCOVID-19aluminaaluminumtitaniummineralization
Journal Article 2022-10-28 No Snippets Iolascon G, Paoletta M, Liguori S, Gimigliano F, Moretti A.
Show Full Abstract

Bone fragility is the susceptibility to fracture even for common loads because of structural, architectural, or material alterations of bone tissue that result in poor bone strength. In osteoporosis, quantitative and qualitative changes in density, geometry, and micro-architecture modify the internal stress state predisposing to fragility fractures. Bone fragility substantially depends on the structural behavior related to the size and shape of the bone characterized by different responses in the load-deformation curve and on the material behavior that reflects the intrinsic material properties of the bone itself, such as yield and fatigue. From a clinical perspective, the measurement of bone density by DXA remains the gold standard for defining the risk of fragility fracture in all population groups. However, non-quantitative parameters, such as macro-architecture, geometry, tissue material properties, and microcracks accumulation can modify the bone's mechanical strength. This review provides an overview of the role of different contributors to bone fragility and how these factors might be influenced by the use of anti-osteoporotic drugs and by the COVID-19 pandemic.

Also flagged:Cas9translationalPD-1non-small cell lung cancertumorgenetic diseases
Journal Article 2022-10-28 No Snippets Huang K, Zapata D, Tang Y, Teng Y, Li Y.
Show Full Abstract

Since its mechanism discovery in 2012 and the first application for mammalian genome editing in 2013, CRISPR-Cas9 has revolutionized the genome engineering field and created countless opportunities in both basic science and translational medicine. The first clinical trial of CRISPR therapeutics was initiated in 2016, which employed ex vivo CRISPR-Cas9 edited PD-1 knockout T cells for the treatment of non-small cell lung cancer. So far there have been dozens of clinical trials registered on ClinicalTrials.gov in regard to using the CRISPR-Cas9 genome editing as the main intervention for therapeutic applications; however, most of these studies use ex vivo genome editing approach, and only a few apply the in vivo editing strategy. Compared to ex vivo editing, in vivo genome editing bypasses tedious procedures related to cell isolation, maintenance, selection, and transplantation. It is also applicable to a wide range of diseases and disorders. The main obstacles to the successful translation of in vivo therapeutic genome editing include the lack of safe and efficient delivery system and safety concerns resulting from the off-target effects. In this review, we highlight the therapeutic applications of in vivo genome editing mediated by the CRISPR-Cas9 system. Following a brief introduction of the history, biology, and functionality of CRISPR-Cas9, we showcase a series of exemplary studies in regard to the design and implementation of in vivo genome editing systems that target the brain, inner ear, eye, heart, liver, lung, muscle, skin, immune system, and tumor. Current challenges and opportunities in the field of CRISPR-enabled therapeutic in vivo genome editing are also discussed.

Also flagged:Pancreatic adenocarcinomamalignant tumorstumorcancercancersangiogenesis
Journal Article 2022-10-28 ✓ 2 Snippets Zheng JH, Yao HF, Duan ZH, Ji PX, Yang J, Zhu YH, Jia QY, Yang JY, Liu DJ, Sun YW, Chen PC, Shi PD, Chen L.
In-Text Gene Mentions

…(PD-1), CD44, BTLA,TNFSF4, CD28, CD70, TNFRSF8,…

…showed that CD44,TNFSF4, CD70, TNFSF9, and…

Show Full Abstract

Pancreatic adenocarcinoma (PAAD), one of the most malignant tumors, not only has abundant mesenchymal components, but is also characterized by an extremely high metastatic risk. The purpose of this study was to construct a model of stroma- and metastasis-associated prognostic signature, aiming to benefit the existing clinical staging system and predict the prognosis of patients. First, stroma-associated genes were screened from the TCGA database with the ESTIMATE algorithm. Subsequently, transcriptomic data from clinical tissues in the RenJi cohort were screened for metastasis-associated genes. Integrating the two sets of genes, we constructed a risk prognostic signature by Cox and LASSO regression analysis. We then obtained a risk score by a quantitative formula and divided all samples into high- and low-risk groups based on the scores. The results demonstrated that patients with high-risk scores have a worse prognosis than those with low-risk scores, both in the TCGA database and in the RenJi cohort. In addition, tumor mutation burden, chemotherapeutic drug sensitivity and immune infiltration analysis also exhibited significant differences between the two groups. In exploring the potential mechanisms of how stromal components affect tumor metastasis, we simulated different matrix stiffness in vitro to explore its effect on EMT key genes in PAAD cells. We found that cancer cells stimulated by high matrix stiffness may trigger EMT and promote PAAD metastasis.

Also flagged:PARK7AcetaminophenAcute Liver Injurymitophagymitochondrial synthesismitochondrial
Journal Article 2022-10-28 ✓ 1 Snippet Cai J, Kong D, Long Z, Liu J, Liu R, Hai C.
In-Text Gene Mentions

…itochondrial stress, includingPRDX6, VDAC2, HSP70 and…

Show Full Abstract

Mitochondrial dysfunction and oxidative stress are considered to be key events in acetaminophen (APAP)-induced acute liver injury. Mitochondrial quality control, including mitophagy and mitochondrial synthesis, can restore mitochondrial homeostasis and thus protect the liver. The role of PARK7, a mitochondrial stress protein, in regulating mitochondrial quality control in APAP-induced hepatotoxicity is unclear. In this study, L02 cells, AML12 cells and C57/BL6 mice were each used to establish models of APAP-induced acute liver injury. PARK7 was silenced in vitro by lentiviral transfection and knocked down in vivo by AAV adeno-associated virus. Changes in cell viability, apoptosis, reactive oxygen species (ROS) level, serum enzyme activity and pathological features were evaluated after APAP treatment. Western blotting, real-time PCR, immunofluorescence, electron microscopy and Seahorse assays were used to detect changes in key indicators of mitochondrial quality control. The results showed that APAP treatment decreased cell viability and increased the apoptosis rate, ROS levels, serum enzyme activity, pathological damage and PARK7 expression. PARK7 silencing or knockdown ameliorated APAP-induced damage to the cells and liver. Furthermore, PARK7 silencing enhanced mitophagy, increased mitochondrial synthesis, and led to a switch from oxidative phosphorylation to glycolysis. Taken together, these results suggest that PARK7 is involved in APAP-induced acute liver injury by regulating mitochondrial quality control and metabolic reprogramming. Therefore, PARK7 may be a promising therapeutic target for APAP-induced liver injury.

Also flagged:PCacancertumorandrogencarcinomaProstate Cancer
Journal Article 2022-10-28 No Snippets Adamiecki R, Hryniewicz-Jankowska A, Ortiz MA, Li X, Porter-Hansen BA, Nsouli I, Bratslavsky G, Kotula L.
Show Full Abstract

In 2022, prostate cancer (PCa) is estimated to be the most commonly diagnosed cancer in men in the United States-almost 270,000 American men are estimated to be diagnosed with PCa in 2022. This review compares and contrasts in vivo models of PCa with regards to the altered genes, signaling pathways, and stages of tumor progression associated with each model. The main type of model included in this review are genetically engineered mouse models, which include conditional and constitutive knockout model. 2D cell lines, 3D organoids and spheroids, xenografts and allografts, and patient derived models are also included. The major applications, advantages and disadvantages, and ease of use and cost are unique to each type of model, but they all make it easier to translate the tumor progression that is seen in the mouse prostate to the human prostate. Although both human and mouse prostates are androgen-dependent, the fact that the native, genetically unaltered prostate in mice cannot give rise to carcinoma is an especially critical component of PCa models. Thanks to the similarities between the mouse and human genome, our knowledge of PCa has been expanded, and will continue to do so, through models of PCa.

Also flagged:IronHaemochromatosisgenetic disordergenetic disordersHCHalcohol
Journal Article 2022-10-28 ✓ 5 Snippets Dorniak K, Daniłowicz-Szymanowicz L, Sikorska K, Rozwadowska K, Fijałkowska J, Glińska A, Tuzimek M, Sabisz A, Żarczyńska-Buchowiecka M, Świątczak M, Dudziak M, Szurowska E.
In-Text Gene Mentions

…Conclusions: In contemporaryhemochromatosis, significant myocardial iron…

…a Tertiary CenterHemochromatosisCohort—A Cardiac Magnetic…

Hemochromatosis(HCH), a multisystemic…

…mutations in theHFEgene (C282Y/C282Y) are…

…OtherHFEgene mutations and…

Show Full Abstract

Background: Haemochromatosis (HCH), a common genetic disorder with variable penetrance, results in progressive but understudied iron overload. We prospectively evaluated organ iron loading and cardiac function in a tertiary center HCH cohort. Methods: 42 HCH patients (47 ± 14 years) and 36 controls underwent laboratory workup and cardiac magnetic resonance (CMR), including T1 and T2* mapping. Results: Myocardial T2* (myoT2*), myocardial T1 (myoT1) and liver T2* (livT2*) were lower in patients compared to controls (33 ± 4 ms vs. 36 ± 3 ms [p = 0.004], 964 ± 33 ms vs. 979 ± 25 ms [p = 0.028] and 21 ± 10 ms vs. 30 ± 5 ms [p < 0.001], respectively). MyoT2* did not reach the threshold of clinically significant iron overload (<20 ms), in any of the patients. In 22 (52.4%) patients, at least one of the tissue parameters was reduced. Reduced myocardial T2* and/or T1 were found in 10 (23.8%) patients, including 4 pts with normal livT2*. LivT2* was reduced in 18 (42.9%) patients. MyoT1 and livT2* inversely correlated with ferritin (rs = −0.351 [p = 0.028] and rs = −0.602 [p < 0.001], respectively). LivT2* by a dedicated sequence and livT2* by cardiac T2* mapping showed good agreement (ICC = 0.876 p < 0.001). Conclusions: In contemporary hemochromatosis, significant myocardial iron overload is rare. Low myocardial T2* and/or T1 values may warrant closer follow-up for accelerated myocardial iron overload even in patients without overt liver overload. Cardiac T2* mapping sequence allows for liver screening at the time of CMR.

Also flagged:COVID-19infectious diseaseinfection
Journal Article 2022-10-28 ✓ 1 Snippet Chen S, Guo L, Patrick Qiang Q.
In-Text Gene Mentions

…can construct the t-copula-DCC-GARCH model.…

Show Full Abstract

This paper investigates the multidimensional spatial effects of risk spillovers among Chinese financial institutions and the dynamic evolution of financial risk contagion in the tail risk correlation network over different time periods. We first measure risk spillovers from financial submarkets to the stock market, identifying five periods using structural breakpoint tests. Then, we construct a spatial error financial network panel model by combining complex network and spatial econometric theory to explore the spatial spillover variability. Finally, we calculate the Bonacich centrality of nodes in the tail risk network and analyze the dynamic evolution of the financial impact path during the different time periods. The results show that the multidimensional spatial spillovers of financial risk among financial institutions are obvious and time varying. The spatial spillovers of financial institutions are positively correlated with the turnover rate and negatively correlated with the exchange rate, interest rate and return volatility. Financial institutions of the same type in the tail risk network display intraindustry risk clustering, and the systemically important institutions identified based on Bonacich centrality differ significantly across time. Moreover, when risk spillovers increase, external shocks' destructive power and speed of transmission to the network rise.

Also flagged:lysine-translationalacetylmitochondriacarbon
Journal Article 2022-10-28 ✓ 1 Snippet Qian P, Ma F, Zhang W, Cao D, Li L, Liu Z, Pei P, Zhang T, Wang S, Wu J.
In-Text Gene Mentions

…The upregulation ofAntithrombin-IIIand the downregulation…

Show Full Abstract

Physical exercise benefits hippocampal function through various molecular mechanisms. Protein acetylation, a conserved and widespread post-translational modification, is involved in the synaptic plasticity and memory. However, whether exercise can change global acetylation and the role of acetylated proteins in the hippocampus have remained largely unknown. Herein, using healthy adult mice running for 6 weeks as exercise model and sedentary mice as control, we analyzed the hippocampal lysine acetylome and proteome by Liquid chromatography-tandem mass spectrometry. As a result, we profiled the lysine acetylation landscape for the hippocampus and identified 3,876 acetyl sites and 1,764 acetylated proteins. A total of 272 acetyl sites on 252 proteins were differentially regulated by chronic exercise, among which 18.58% acetylated proteins were annotated in mitochondria. These proteins were dominantly deacetylated and mainly associated with carbon-related metabolism, the Hippo signaling pathway, ribosomes, and protein processing. Meanwhile, 21 proteins were significantly expressed and enriched in the pathway of complement and coagulation cascades. Our findings provide a new avenue for understanding the molecular mechanisms underlying the benefits of exercise for hippocampal function and can contribute to the promotion of public health.

Also flagged:mitochondrialserotonin transportermental disordersmitochondriaorganellesphosphorylation
Journal Article 2022-10-28 ✓ 5 Snippets Brivio P, Gallo MT, Karel P, Cogi G, Fumagalli F, Homberg JR, Calabrese F.
In-Text Gene Mentions

…showing this symptom (5-HTTknockout rats) which…

…the FC paradigm,5-HTTknockout (5-HTT –/–…

…paradigm, 5-HTT knockout (5-HTT–/– ) animals…

…the serotonin transporter (5-HTT) has been associated…

…the role of5-HTTin the disorders,…

Show Full Abstract

Stress-related mental disorders encompass a plethora of pathologies that share the exposure to a negative environment as trigger for their development. The vulnerability to the effects of a negative environment is not equal to all but differs between individuals based on the genetic background makeup. Here, to study the molecular mechanisms potentially underlying increased threat anticipation, we employed an animal model showing this symptom (5-HTT knockout rats) which we exposed to Pavlovian fear conditioning (FC). We investigated the role of mitochondria, taking advantage of the recent evidence showing that the dynamic of these organelles is dysregulated after stress exposure. Behavioral experiments revealed that, during the second day of extinction of the FC paradigm, 5-HTT knockout (5-HTT<sup>-/-</sup>) animals showed a lack of fear extinction recall. From a mechanistic standpoint, we carried out our molecular analyses on the amygdala and prefrontal cortex, given their role in the management of the fear response due to their tight connection. We demonstrated that mitochondrial dynamics are impaired in the amygdala and prefrontal cortex of 5-HTT<sup>-/-</sup> rats. The dissection of the potential contributing factors revealed a critical role in the mechanisms regulating fission and fusion that are dysregulated in transgenic animals. Furthermore, mitochondrial oxidative phosphorylation, mitochondrial biogenesis, and the production of antioxidant enzymes were altered in these brain regions in 5-HTT<sup>-/-</sup> rats. In summary, our data suggest that increased extracellular 5-HT levels cause an unbalance of mitochondrial functionality that could contribute to the reduced extinction recall of 5-HTT<sup>-/-</sup> rats, pointing out the role of mitochondrial dynamics in the etiology of psychiatric disorders. Our findings, also, provide some interesting insights into the targeted development of drugs to treat such disorders.

Also flagged:mood disordersdepressionanxietymental illnessesmental disordersleep
Journal Article 2022-10-28 ✓ 1 Snippet Marcolongo-Pereira C, Castro FCAQ, Barcelos RM, Chiepe KCMB, Rossoni Junior JV, Ambrosio RP, Chiarelli-Neto O, Pesarico AP.
In-Text Gene Mentions

Several studies have linked 5-HTTLPR, a degenerate repeat polymorphic region of the gene encoding the serotonin transporter (5-HTT), directly to stress and mental illness (Lesch et al., 1996).

Show Full Abstract

Stress is an important factor in the development of several human pathologies. The response of rodents and humans to stress depends on many factors; some people and rodents develop stress-related mood disorders, such as depression and anxiety in humans, depression-like and anxiety-like behavior in mice and rats, while others report no new psychological symptoms in response to chronic or acute stress, and are considered susceptible and resilient to stress, respectively. Resilience is defined as the ability to thrive in the face of adversity and is a learned process that can help protect against occupational stressors and mental illnesses. There is growing interest in the underlying mechanisms involved in resilience and vulnerability to depression caused by stress, and some studies have demonstrated that individual variability in the way animals and humans respond to stress depends on several mechanisms, such as oxidative stress, neuronal plasticity, immunology and genetic factors, among others not discussed in this review, this review provides a general overview about this mechanism.

Also flagged:tumorCancersquamous cell carcinomalung adenocarcinomaimmune responsenon-small cell lung cancer
Journal Article 2022-10-28 ✓ 4 Snippets Tang Z, Wang Q, Chen P, Guo H, Shi J, Pan Y, Li C, Zhou C.
In-Text Gene Mentions

Our findings indicate that the combination of CEACAM1, TNFSF4, GEM, CD47, VTCN1, and TANlncSig in squamous cell carcinoma can effectively stratify patients by prognosis, highlighting these immune checkpoint receptors as potential therapeutic targets against advanced lung cancer.

In lung squamous cell carcinoma, the combination of CEACAM1, TNFSF4, gem, CD47, vtcn1 and risk score can well stratify the prognosis of patients.

…combination of CEACAM1,TNFSF4, gem, CD47, vtcn1…

…combination of CEACAM1,TNFSF4, GEM, CD47, VTCN1,…

Show Full Abstract

Cancer immune function and tumor microenvironment are governed by long noncoding RNAs (lncRNAs). Nevertheless, it has yet to be established whether lncRNAs play a role in tumor-associated neutrophils (TANs). Here, a computing framework based on machine learning was used to identify neutrophil-specific lncRNA with prognostic significance in squamous cell carcinoma and lung adenocarcinoma using univariate Cox regression to comprehensively analyze immune, lncRNA, and clinical characteristics. The risk score was determined using LASSO Cox regression analysis. Meanwhile, we named this risk score as "TANlncSig." TANlncSig was able to distinguish between better and worse survival outcomes in various patient datasets independently of other clinical variables. Functional assessment of TANlncSig showed it is a marker of myeloid cell infiltration into tumor infiltration and myeloid cells directly or indirectly inhibit the anti-tumor immune response by secreting cytokines, expressing immunosuppressive receptors, and altering metabolic processes. Our findings highlighted the value of TANlncSig in TME as a marker of immune cell infiltration and showed the values of lncRNAs as indicators of immunotherapy.

Also flagged:myelodysplastic syndromeacute myeloid leukemiamyeloid neoplasmsAMLchromatin-remodelingspliceosome
Journal Article 2022-10-28 ✓ 1 Snippet Ambinder AJ, DeZern AE.
In-Text Gene Mentions

*Includes AMLs with: t(4;11)(q21.3;q23.3)/AFF1::KMT2A; t(6;11)(q27;q23.3)/AFDN::KMT2A; t(10;11)(p12.3;q23.3)/MLLT10::KMT2A; t(10;11)(q21.3;q23.3)/TET1::KMT2A; t(11;19)(q23.3;p13.1)/KMT2A::ELL; t(11;19)(q23.3;p13.3)/KMT2A::MLLT1 (Occurs predominantly in infants and children)

Show Full Abstract

Myelodysplastic syndrome and acute myeloid leukemia are heterogeneous myeloid neoplasms which arise from the accumulation of mutations in a myeloid stem cell or progenitor that confer survival or growth advantages. These disease processes are formally differentiated by clinical, laboratory, and morphological presentations, especially with regard to the preponderance of blasts in the peripheral blood or bone marrow (AML); however, they are closely associated through their shared lineage as well as their existence on a spectrum with some cases of MDS displaying increased blasts, a feature that reflects more AML-like behavior, and the propensity for MDS to transform into AML. It is increasingly recognized that the distinctions between these two entities result from the divergent patterns of genetic alterations that drive each of them. Mutations in genes related to chromatin-remodeling and the spliceosome are seen in both MDS and AML arising out of antecedent MDS, while mutations in genes related to signaling pathways such as <i>RAS</i> or <i>FLT3</i> are more typically seen in AML or otherwise are a harbinger of transformation. In this review, we focus on the insights into the biological and genetic distinctions and similarities between MDS and AML that are now used to refine clinical prognostication, guide disease management, and to inform development of novel therapeutic approaches.

Also flagged:Cutaneous melanomascancersBRAFNRASNF1skin melanomas
Journal Article 2022-10-28 ✓ 2 Snippets Georgoulias G, Zaravinos A.
In-Text Gene Mentions

In specific, we compared the expression of 49 immunostimulators (BTNL2, C10orf54, CD27, CD274, CD276, CD28, CD40, CD40LG, CD48, CD70, CD80, CD86, CXCL12, CXCR4, ENTPD1, HHLA2, ICOS, ICOSLG, IL2RA, IL6, IL6R, KLRC1, KLRK1, LTA, MICA, MICB, NT5E, PDCD1LG2, PVR, RAET1E, TMEM173, TMIGD2, TNFRSF13B, TNFRSF13C, TNFRSF14, TNFRSF17, TNFRSF18, TNFRSF25, TNFRSF4, TNFRSF8, TNFRSF9, TNFSF13, TNFSF13B, TNFSF14, TNFSF15, TNFSF18, TNFSF4, TNFSF9 and ULBP1) and 23 immunoinhibitors (ADORA2A, BTLA, CD160, CD244, CD96, CSF1R, CTLA4, HAVCR2, IDO1, IL10, IL10RB, KDR, KIR2DL1, KIR2DL2, KIR2DL3, LAG3, LGALS9, PDCD1, PVRL2, TGFB1, TGFBR1, TIGIT and VTCN1) across TMBhigh, TMBint and TMBlow melanoma tumors.

…TNFSF14, TNFSF15, TNFSF18,TNFSF4, TNFSF9 and ULBP1…

Show Full Abstract

Skin melanoma cells are tightly interconnected with their tumor microenvironment (TME), which influences their initiation, progression, and sensitivity/resistance to therapeutic interventions. An immune-active TME favors patient response to immune checkpoint inhibition (ICI), but not all patients respond to therapy. Here, we assessed differential gene expression in primary and metastatic tumors from the TCGA-SKCM dataset, compared to normal skin samples from the GTEx project and validated key findings across 4 independent GEO datasets, as well as using immunohistochemistry in independent patient cohorts. We focused our attention on examining the expression of various immune receptors, immune-cell fractions, immune-related signatures and mutational signatures across cutaneous melanomas with diverse tumor mutation burdens (TMB). Globally, the expression of most immunoreceptors correlated with patient survival, but did not differ between TMB<sup>high</sup> and TMB<sup>low</sup> tumors. Melanomas were enriched in <i>"naive T-cell", "effector memory T-cell", "exhausted T-cell", "resting Treg T-cell"</i> and <i>"Th1-like"</i> signatures, irrespective of their <i>BRAF</i>, <i>NF1</i> or <i>RAS</i> mutational status. Somatic mutations in <i>IDO1</i> and <i>HLA-DRA</i> were frequent and could be involved in hindering patient response to ICI therapies. We finally analyzed transcriptome profiles of ICI-treated patients and associated their response with high levels of IFNγ, Merck18, CD274, CD8, and low levels of myeloid-derived suppressor cells (MDSCs), cancer-associated fibroblasts (CAFs) and M2 macrophages, irrespective of their TMB status. Overall, our findings highlight the importance of pre-existing T-cell immunity in ICI therapeutic outcomes in skin melanoma and suggest that TMB<sup>low</sup> patients could also benefit from such therapies.

Also flagged:colorectal cancertumorgene expressionmethylationcancerchromosomes
Journal Article 2022-10-28 ✓ 1 Snippet Zheng X, Ma Y, Bai Y, Huang T, Lv X, Deng J, Wang Z, Lian W, Tong Y, Zhang X, Yue M, Zhang Y, Li L, Li L, Peng M.
In-Text Gene Mentions

…HMCN1, AHNAK2, PCDH15,CACNA1E, DNAH8, ATM, VPS13B,…

Show Full Abstract

The incidence and mortality of colorectal cancer (CRC) are increasing year by year. The accurate classification of CRC can realize the purpose of personalized and precise treatment for patients. The tumor microenvironment (TME) plays an important role in the malignant progression and immunotherapy of CRC. An in-depth understanding of the clusters based on the TME is of great significance for the discovery of new therapeutic targets for CRC. We extracted data on CRC, including gene expression profile, DNA methylation array, somatic mutations, clinicopathological information, and copy number variation (CNV), from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO) (four datasets-GSE14333, GSE17538, GSE38832, and GSE39582), cBioPortal, and FireBrowse. The MCPcounter was utilized to quantify the abundance of 10 TME cells for CRC samples. Cluster repetitive analysis was based on the Hcluster function of the Pheatmap package in R. The ESTIMATE package was applied to compute immune and stromal scores for CRC patients. PCA analysis was used to remove batch effects among different datasets and transform genome-wide DNA methylation profiling into methylation of tumor-infiltrating lymphocyte (MeTIL). We evaluated the mutation differences of the clusters using MOVICS, DeconstructSigs, and GISTIC packages. As for therapy, TIDE and SubMap analyses were carried out to forecast the immunotherapy response of the clusters, and chemotherapeutic sensibility was estimated based on the pRRophetic package. All results were verified in the TCGA and GEO data. Four immune clusters (ImmClust-CS1, ImmClust-CS2, ImmClust-CS3, and ImmClust-CS4) were identified for CRC. The four ImmClusts exhibited distinct TME compositions, cancer-associated fibroblasts (CAFs), functional orientation, and immune checkpoints. The highest immune, stromal, and MeTIL scores were observed in CS2, in contrast to the lowest scores in CS4. CS1 may respond to immunotherapy, while CS2 may respond to immunotherapy after anti-CAFs. Among the four ImmClusts, the top 15 markers with the highest mutation frequency were acquired, and CS1 had significantly lower CNA on the focal level than other subtypes. In addition, CS1 and CS2 patients had more stable chromosomes than CS3 and CS4. The most sensitive chemotherapeutic agents in these four ImmClusts were also found. IHC results revealed that CD29 stained significantly darker in the cancer samples, indicating that their CD29 was highly expressed in colon cancer. This work revealed the novel clusters based on TME for CRC, which would guide in predicting the prognosis, biological features, and appropriate treatment for patients with CRC.

Also flagged:visioncorneal diseasesblindnessdisorders of the corneamembraneextracellular
Journal Article 2022-10-28 ✓ 1 Snippet Maiti G, Monteiro de Barros MR, Hu N, Dolgalev I, Roshan M, Foster JW, Tsirigos A, Wahlin KJ, Chakravarti S.
In-Text Gene Mentions

…cell markers (DCC,NNAT,NRXN1 , and CNTNAP2…

Show Full Abstract

The cornea is a protective and refractive barrier in the eye crucial for vision. Understanding the human cornea in health, disease, and cell-based treatments can be greatly advanced with cornea organoids developed in culture from induced pluripotent stem cells. While a limited number of studies have investigated the single-cell transcriptomic composition of the human cornea, its organoids have not been examined similarly. Here, we elucidated the transcriptomic cell fate map of 4-month-old human cornea organoids and human donor corneas. The organoids harbor cell clusters that resemble cells of the corneal epithelium, stroma, and endothelium, with subpopulations that capture signatures of early developmental states. Unlike the adult cornea where the largest cell population is stromal, the organoids contain large proportions of epithelial and endothelial-like cells. These corneal organoids offer a 3D model to study corneal diseases and integrated responses of different cell types.

bioRxiv 2022-10-28 Preprint (No Snippets API) Pita-Juarez Y, Karagkouni D, Kalavros N, Melms JC, Niezen S, Delorey TM, Essene AL, Brook OR, Pant D, Skelton-Badlani D, Naderi P, Huang P, Pan L, Hether T, Andrews TS, Ziegler CG, Reeves J, Myloserdnyy A, Chen R, Nam A, Phelan S, Liang Y, Amin AD, Biermann J, Hibshoosh H, Veregge M, Kramer Z, Jacobs C, Yalcin Y, Phillips D, Slyper M, Subramanian A, Ashenberg O, Bloom-Ackermann Z, Tran VM, Gomez J, Sturm A, Zhang S, Fleming SJ, Warren S, Beechem J, Hung D, Babadi M, Padera RF, MacParland SA, Bader GD, Imad N, Solomon IH, Miller E, Riedel S, Porter CB, Villani A, Tsai LT, Hide W, Szabo G, Hecht J, Rozenblatt-Rosen O, Shalek AK, Izar B, Regev A, Popov Y, Jiang ZG, Vlachos IS.
Show Full Abstract

The molecular underpinnings of organ dysfunction in acute COVID-19 and its potential long-term sequelae are under intense investigation. To shed light on these in the context of liver function, we performed single-nucleus RNA-seq and spatial transcriptomic profiling of livers from 17 COVID-19 decedents. We identified hepatocytes positive for SARS-CoV-2 RNA with an expression phenotype resembling infected lung epithelial cells. Integrated analysis and comparisons with healthy controls revealed extensive changes in the cellular composition and expression states in COVID-19 liver, reflecting hepatocellular injury, ductular reaction, pathologic vascular expansion, and fibrogenesis. We also observed Kupffer cell proliferation and erythrocyte progenitors for the first time in a human liver single-cell atlas, resembling similar responses in liver injury in mice and in sepsis, respectively. Despite the absence of a clinical acute liver injury phenotype, endothelial cell composition was dramatically impacted in COVID-19, concomitantly with extensive alterations and profibrogenic activation of reactive cholangiocytes and mesenchymal cells. Our atlas provides novel insights into liver physiology and pathology in COVID-19 and forms a foundational resource for its investigation and understanding.

Also flagged:mTORkinasemetabolismautophagyspinocerebellar ataxia type 2SCA2
Journal Article 2022-10-27 ✓ 5 Snippets Paul S, Dansithong W, Gandelman M, Figueroa KP, Zu T, Ranum LPW, Scoles DR, Pulst SM.
In-Text Gene Mentions

We recently reported that staufen1 (STAU1), a stress granule (SG) protein, was overabundant in fibroblast cell lines from patients with spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis, frontotemporal degeneration, Huntington's, Alzheimer's, and Parkinson's diseases as well as animal models, and patient tissues.

Targeting mTOR by rapamycin or RNAi normalized STAU1 abundance in an SCA2 cellular model.<h4>Interpretation</h4>STAU1 interaction with mTOR drives its hyperactivation and inhibits autophagic flux in multiple models of neurodegeneration.

…reported that staufen1 (STAU1), a stress granule…

STAU1overabundance is associated…

…assays to contextualizeSTAU1interaction with MTOR…

Show Full Abstract

<h4>Objective</h4>The mechanistic target of rapamycin (mTOR) kinase is one of the master coordinators of cellular stress responses, regulating metabolism, autophagy, and apoptosis. We recently reported that staufen1 (STAU1), a stress granule (SG) protein, was overabundant in fibroblast cell lines from patients with spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis, frontotemporal degeneration, Huntington's, Alzheimer's, and Parkinson's diseases as well as animal models, and patient tissues. STAU1 overabundance is associated with mTOR hyperactivation and links SG formation with autophagy. Our objective was to determine the mechanism of mTOR regulation by STAU1.<h4>Methods</h4>We determined STAU1 abundance with disease- and chemical-induced cellular stressors in patient cells and animal models. We also used RNA-binding assays to contextualize STAU1 interaction with MTOR mRNA.<h4>Results</h4>STAU1 and mTOR were overabundant in bacterial artificial chromosome (BAC)-C9ORF72, ATXN2<sup>Q127</sup> , and Thy1-TDP-43 transgenic mouse models. Reducing STAU1 levels in these mice normalized mTOR levels and activity and autophagy-related marker proteins. We also saw increased STAU1 levels in HEK293 cells transfected to express C9ORF72-relevant dipeptide repeats (DPRs). Conversely, DPR accumulations were not observed in cells treated by STAU1 RNA interference (RNAi). Overexpression of STAU1 in HEK293 cells increased mTOR levels through direct MTOR mRNA interaction, activating downstream targets and impairing autophagic flux. Targeting mTOR by rapamycin or RNAi normalized STAU1 abundance in an SCA2 cellular model.<h4>Interpretation</h4>STAU1 interaction with mTOR drives its hyperactivation and inhibits autophagic flux in multiple models of neurodegeneration. Staufen, therefore, constitutes a novel target to modulate mTOR activity and autophagy, and for the treatment of neurodegenerative diseases. ANN NEUROL 2023;93:398-416.

Also flagged:cancercomplexageingantibodiesalcoholcytosine
Journal Article 2022-10-27 ✓ 1 Snippet Solís-Moruno M, Batlle-Masó L, Bonet N, Aróstegui JI, Casals F.
In-Text Gene Mentions

The list of reported cases of diseases includes other organs and tissues beyond blood, such as Alport syndrome, in which somatic variants in COL4A3 can impair the function of kidneys [56], or Huntington’s disease with a somatic expansion of the CAG triplet in the HTT gene in the brain [57].

Show Full Abstract

Somatic genetic variants have been studied for several years mostly concerning cancer, where they contribute to its origin and development. It is also clear that the somatic variants load is greater in aged individuals in comparison to younger ones, pointing to a cause/consequence of the senescence process. More recently, researchers have focused on the role of this type of variation in healthy tissue and its dynamics in cell lineages and different organs. In addition, somatic variants have been described to contribute to monogenic diseases, and the number of evidences of their role in complex disorders is also increasing. Thanks to recent advances in next-generation sequencing technologies, this type of genetic variation can be now more easily studied than in the past, although we still face some important limitations. Novel strategies for sampling, sequencing and filtering are being investigated to detect these variants, although validating them with an orthogonal approach will most likely still be needed. In this review, we aim to update our knowledge of somatic variation detection and its relation to healthy tissue and non-cancer diseases.

Also flagged:nucleusoxygenmetabolismdeathchemoreceptionSERT
Journal Article 2022-10-27 ✓ 2 Snippets Bhandare A, van de Wiel J, Roberts R, Braren I, Huckstepp R, Dale N.
In-Text Gene Mentions

…NM_010484 , Alias:5-HTT, AI323329 , Htt,…

…5-HTT, AI323329 ,Htt, SertA).…

Show Full Abstract

Regulation of systemic PCO<sub>2</sub> is a life-preserving homeostatic mechanism. In the medulla oblongata, the retrotrapezoid nucleus (RTN) and rostral medullary Raphe are proposed as CO<sub>2</sub> chemosensory nuclei mediating adaptive respiratory changes. Hypercapnia also induces active expiration, an adaptive change thought to be controlled by the lateral parafacial region (pF<sub>L</sub>). Here, we use GCaMP6 expression and head-mounted mini-microscopes to image Ca<sup>2+</sup> activity in these nuclei in awake adult mice during hypercapnia. Activity in the pF<sub>L</sub> supports its role as a homogenous neuronal population that drives active expiration. Our data show that chemosensory responses in the RTN and Raphe differ in their temporal characteristics and sensitivity to CO<sub>2</sub>, raising the possibility these nuclei act in a coordinated way to generate adaptive ventilatory responses to hypercapnia. Our analysis revises the understanding of chemosensory control in awake adult mouse and paves the way to understanding how breathing is coordinated with complex non-ventilatory behaviours.

Also flagged:GPR97autoimmune diseasesadhesion moleculeCD177-associated membrane proteinase 3conjugationextracellular
Journal Article 2022-10-27 ✓ 3 Snippets Chu TY, Zheng-Gérard C, Huang KY, Chang YC, Chen YW, I KY, Lo YL, Chiang NY, Chen HY, Stacey M, Gordon S, Tseng WY, Sun CY, Wu YM, Pan YS, Huang CH, Lin CY, Chen TC, El Omari K, Antonelou M, Henderson SR, Salama A, Seiradake E, Lin HH.
In-Text Gene Mentions

…and olfactomedin 4 (OLFM4)(~57 kDa) are all…

…By contrast,OLFM4is a specific…

…of neutrophils expressingOLFM4or glycosylphosphatidylinosito…

Show Full Abstract

Neutrophils play essential anti-microbial and inflammatory roles in host defense, however, their activities require tight regulation as dysfunction often leads to detrimental inflammatory and autoimmune diseases. Here we show that the adhesion molecule GPR97 allosterically activates CD177-associated membrane proteinase 3 (mPR3), and in conjugation with several protein interaction partners leads to neutrophil activation in humans. Crystallographic and deletion analysis of the GPR97 extracellular region identified two independent mPR3-binding domains. Mechanistically, the efficient binding and activation of mPR3 by GPR97 requires the macromolecular CD177/GPR97/PAR2/CD16b complex and induces the activation of PAR2, a G protein-coupled receptor known for its function in inflammation. Triggering PAR2 by the upstream complex leads to strong inflammatory activation, prompting anti-microbial activities and endothelial dysfunction. The role of the complex in pathologic inflammation is underscored by the finding that both GPR97 and mPR3 are upregulated on the surface of disease-associated neutrophils. In summary, we identify a PAR2 activation mechanism that directs neutrophil activation, and thus inflammation. The PR3/CD177/GPR97/PAR2/CD16b protein complex, therefore, represents a potential therapeutic target for neutrophil-mediated inflammatory diseases.

Gallbladder cancer.

Also flagged:Gallbladder cancerpathogenesistumourcancercancer of thecancer of the biliary tract
Journal Article 2022-10-27 No Snippets Roa JC, García P, Kapoor VK, Maithel SK, Javle M, Koshiol J.
Show Full Abstract

Gallbladder cancer (GBC) is the most common cancer of the biliary tract, characterized by a very poor prognosis when diagnosed at advanced stages owing to its aggressive behaviour and limited therapeutic options. Early detection at a curable stage remains challenging because patients rarely exhibit symptoms; indeed, most GBCs are discovered incidentally following cholecystectomy for symptomatic gallbladder stones. Long-standing chronic inflammation is an important driver of GBC, regardless of the lithiasic or non-lithiasic origin. Advances in omics technologies have provided a deeper understanding of GBC pathogenesis, uncovering mechanisms associated with inflammation-driven tumour initiation and progression. Surgical resection is the only treatment with curative intent for GBC but very few cases are suitable for resection and most adjuvant therapy has a very low response rate. Several unmet clinical needs require to be addressed to improve GBC management, including discovery and validation of reliable biomarkers for screening, therapy selection and prognosis. Standardization of preneoplastic and neoplastic lesion nomenclature, as well as surgical specimen processing and sampling, now provides reproducible and comparable research data that provide a basis for identifying and implementing early detection strategies and improving drug discovery. Advances in the understanding of next-generation sequencing, multidisciplinary care for GBC, neoadjuvant and adjuvant strategies, and novel systemic therapies including chemotherapy and immunotherapies are gradually changing the treatment paradigm and prognosis of this recalcitrant cancer.

Also flagged:albuminliver diseasealcoholchronic hepatitis C infectionGBMbloodborne infection
Journal Article 2022-10-27 No Snippets Park H, Lo-Ciganic WH, Huang J, Wu Y, Henry L, Peter J, Sulkowski M, Nelson DR.
Show Full Abstract

Despite the availability of efficacious direct-acting antiviral (DAA) therapy, the number of people infected with hepatitis C virus (HCV) continues to rise, and HCV remains a leading cause of liver-related morbidity, liver transplantation, and mortality. We developed and validated machine learning (ML) algorithms to predict DAA treatment failure. Using the HCV-TARGET registry of adults who initiated all-oral DAA treatment, we developed elastic net (EN), random forest (RF), gradient boosting machine (GBM), and feedforward neural network (FNN) ML algorithms. Model performances were compared with multivariable logistic regression (MLR) by assessing C statistics and other prediction evaluation metrics. Among 6525 HCV-infected adults, 308 patients (4.7%) experienced DAA treatment failure. ML models performed similarly in predicting DAA treatment failure (C statistic [95% CI]: EN, 0.74 [0.69-0.79]; RF, 0.74 [0.69-0.80]; GBM, 0.72 [0.67-0.78]; FNN, 0.75 [0.70-0.80]), and all 4 outperformed MLR (C statistic [95% CI]: 0.51 [0.46-0.57]), and EN used the fewest predictors (n = 27). With Youden index, the EN had 58.4% sensitivity and 77.8% specificity, and nine patients were needed to evaluate to identify 1 DAA treatment failure. Over 60% treatment failure were classified in top three risk decile subgroups. EN-identified predictors included male sex, treatment < 8 weeks, treatment discontinuation due to adverse events, albumin level < 3.5 g/dL, total bilirubin level > 1.2 g/dL, advanced liver disease, and use of tobacco, alcohol, or vitamins. Addressing modifiable factors of DAA treatment failure may reduce the burden of retreatment. Machine learning algorithms have the potential to inform public health policies regarding curative treatment of HCV.

Also flagged:blinding diseasesangiogenesisbranch retinal vein occlusionmetabolismmembranebasal lamina
Journal Article 2022-10-27 ✓ 1 Snippet Darche M, Verschueren A, Belle M, Boucherit L, Fouquet S, Sahel JA, Chédotal A, Cascone I, Paques M.
In-Text Gene Mentions

…related to theDCCgene defect, using…

Show Full Abstract

The ocular vasculature is critically involved in many blinding diseases and is also a popular research model for the exploration of developmental and pathological angiogenesis. The development of ocular vessels is a complex, finely orchestrated sequence of events, involving spatial and temporal coordination of hyaloid, choroidal and retinal networks. Comprehensive studies of the tridimensional dynamics of microvascular remodeling are limited by the fact that preserving the spatial disposition of ocular vascular networks is cumbersome using classical histological procedures. Here, we demonstrate that light-sheet fluorescence microscopy (LFSM) of cleared mouse eyes followed by extensive virtual dissection offers a solution to this problem. To the best of our knowledge, this is the first 3D quantification of the evolution of the hyaloid vasculature and of post-occlusive venous remodeling together with the characterization of spatial distribution of various cell populations in ocular compartments, including the vitreous. These techniques will prove interesting to obtain other insights in scientific questions addressing organ-wide cell interactions.

Also flagged:pseudouridinespseudouridinereverse transcriptioncytosineTRUB1cancer
Journal Article 2022-10-27 ✓ 2 Snippets Dai Q, Zhang LS, Sun HL, Pajdzik K, Yang L, Ye C, Ju CW, Liu S, Wang Y, Zheng Z, Zhang L, Harada BT, Dou X, Irkliyenko I, Feng X, Zhang W, Pan T, He C.
In-Text Gene Mentions

…as ERH ,ZNF664, DKC1 ,…

…which ERH ,ZNF664, DKC1 ,…

Show Full Abstract

Functional characterization of pseudouridine (Ψ) in mammalian mRNA has been hampered by the lack of a quantitative method that maps Ψ in the whole transcriptome. We report bisulfite-induced deletion sequencing (BID-seq), which uses a bisulfite-mediated reaction to convert pseudouridine stoichiometrically into deletion upon reverse transcription without cytosine deamination. BID-seq enables detection of abundant Ψ sites with stoichiometry information in several human cell lines and 12 different mouse tissues using 10-20 ng input RNA. We uncover consensus sequences for Ψ in mammalian mRNA and assign different 'writer' proteins to individual Ψ deposition. Our results reveal a transcript stabilization role of Ψ sites installed by TRUB1 in human cancer cells. We also detect the presence of Ψ within stop codons of mammalian mRNA and confirm the role of Ψ in promoting stop codon readthrough in vivo. BID-seq will enable future investigations of the roles of Ψ in diverse biological processes.

Also flagged:GeldanamycinPeroxyredoxin 6peroxiredoxin 6phospholipaseNF-κBtranscription factor
Journal Article 2022-10-27 ✓ 2 Snippets Novoselova EG, Glushkova OV, Sharapov MG, Khrenov MO, Parfenyuk SB, Lunin SM, Novoselova TV, Mubarakshina AK, Goncharov RG, Fesenko EE.
In-Text Gene Mentions

The aim of the study was to evaluate the possibility of increasing the radioprotective potential of peroxiredoxin 6 (Prdx6) and its mutant form S32A by their combined use with geldanamycin (GA) for 3T3 fibroblasts irradiated with X-rays at a dose of 6 Gy.

…of peroxiredoxin 6 (Prdx6) and its mutant…

Show Full Abstract

The aim of the study was to evaluate the possibility of increasing the radioprotective potential of peroxiredoxin 6 (Prdx6) and its mutant form S32A by their combined use with geldanamycin (GA) for 3T3 fibroblasts irradiated with X-rays at a dose of 6 Gy. The mutant enzyme S32A, which does not have phospholipase activity, exhibits a more pronounced radioprotective activity when combined with GA. The use of this combination of radioprotective drugs completely abolishes the peak of NF-κB activity in irradiated 3T3 cells. Another transcription factor, p53, which is an indicator of the level of cell apoptosis and increases upon irradiation, is also reduced by S32A in combination with GA. The low-molecular-weight protein p21, which is a marker of cell senescence and whose production increases upon irradiation, is also normalized when S32A is used in combination with GA. In addition, the use of this combination of radioprotective drugs significantly reduces the stress response of 3T3 cells to X-ray irradiation.

Also flagged:organizationNeurotransmitter receptorspositrontransportersneurotransmitter receptortransporter
Journal Article 2022-10-27 ✓ 3 Snippets Hansen JY, Shafiei G, Markello RD, Smart K, Cox SML, Nørgaard M, Beliveau V, Wu Y, Gallezot JD, Aumont É, Servaes S, Scala SG, DuBois JM, Wainstein G, Bezgin G, Funck T, Schmitz TW, Spreng RN, Galovic M, Koepp MJ, Duncan JS, Coles JP, Fryer TD, Aigbirhio FI, McGinnity CJ, Hammers A, Soucy JP, Baillet S, Guimond S, Hietala J, Bedard MA, Leyton M, Kobayashi E, Rosa-Neto P, Ganz M, Knudsen GM, Palomero-Gallagher N, Shine JM, Carson RE, Tuominen L, Dagher A, Misic B.
In-Text Gene Mentions

Here, we make some specific notes: (1) 5-HTT and GABAA involve comparisons between the same tracers (DASB and flumazenil, respectively), but one map is converted to density using autoradiography data (see ref. 9 and ref. 8) and the other is not7,64,69; (2) raclopride is a popular D2 tracer but has unreliable binding in the cortex and is, therefore, an inappropriate tracer to use for mapping D2 densities in the cortex, but we show its comparison to FLB457 and another D2 tracer, fallypride, for completeness98,99,103; and (3) the chosen carfentanil (MOR) map was collated across carfentanil images in the PET Turku Centre database—because our alternative map is a partly overlapping subset of participants, we did not combine the tracers into a single mean map93,101.

Interestingly, we found that serotonin transporter (5-HTT) distributions contribute more to OCD, schizophrenia and BD profiles than any other receptors.

…that serotonin transporter (5-HTT) distributions contribute mor…

Show Full Abstract

Neurotransmitter receptors support the propagation of signals in the human brain. How receptor systems are situated within macro-scale neuroanatomy and how they shape emergent function remain poorly understood, and there exists no comprehensive atlas of receptors. Here we collate positron emission tomography data from more than 1,200 healthy individuals to construct a whole-brain three-dimensional normative atlas of 19 receptors and transporters across nine different neurotransmitter systems. We found that receptor profiles align with structural connectivity and mediate function, including neurophysiological oscillatory dynamics and resting-state hemodynamic functional connectivity. Using the Neurosynth cognitive atlas, we uncovered a topographic gradient of overlapping receptor distributions that separates extrinsic and intrinsic psychological processes. Finally, we found both expected and novel associations between receptor distributions and cortical abnormality patterns across 13 disorders. We replicated all findings in an independently collected autoradiography dataset. This work demonstrates how chemoarchitecture shapes brain structure and function, providing a new direction for studying multi-scale brain organization.

Also flagged:neurodegenerative disorderagingdeathHDchromatinautophagy
Journal Article 2022-10-27 No Snippets Oh YM, Lee SW, Kim WK, Chen S, Church VA, Cates K, Li T, Zhang B, Dolle RE, Dahiya S, Pak SC, Silverman GA, Perlmutter DH, Yoo AS.
Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder with adult-onset clinical symptoms, but the mechanism by which aging drives the onset of neurodegeneration in patients with HD remains unclear. In this study we examined striatal medium spiny neurons (MSNs) directly reprogrammed from fibroblasts of patients with HD to model the age-dependent onset of pathology. We found that pronounced neuronal death occurred selectively in reprogrammed MSNs from symptomatic patients with HD (HD-MSNs) compared to MSNs derived from younger, pre-symptomatic patients (pre-HD-MSNs) and control MSNs from age-matched healthy individuals. We observed age-associated alterations in chromatin accessibility between HD-MSNs and pre-HD-MSNs and identified miR-29b-3p, whose age-associated upregulation promotes HD-MSN degeneration by impairing autophagic function through human-specific targeting of the STAT3 3' untranslated region. Reducing miR-29b-3p or chemically promoting autophagy increased the resilience of HD-MSNs against neurodegeneration. Our results demonstrate miRNA upregulation with aging in HD as a detrimental process driving MSN degeneration and potential approaches for enhancing autophagy and resilience of HD-MSNs.

Also flagged:Alzheimer's diseaseADpathogenesisAmyloid betanorepinephrine
Journal Article 2022-10-27 ✓ 1 Snippet Negrey JD, Dobbins DL, Howard TD, Borgmann-Winter KE, Hahn CG, Kalinin S, Feinstein DL, Craft S, Shively CA, Register TC.
In-Text Gene Mentions

…histone 8 (H4C8), and TRNA‐YW…

Show Full Abstract

<h4>Introduction</h4>Olfactory impairment in older individuals is associated with an increased risk of Alzheimer's disease (AD). Characterization of age versus neuropathology-associated changes in the brain olfactory pathway may elucidate processes underlying early AD pathogenesis. Here, we report age versus AD neuropathology-associated differential transcription in four brain regions in the olfactory pathway of 10 female African green monkeys (vervet, <i>Chlorocebus aethiops sabaeus</i>), a well-described model of early AD-like neuropathology.<h4>Methods</h4>Transcriptional profiles were determined by microarray in the olfactory bulb (OB), piriform cortex (PC), temporal lobe white matter (WM), and inferior temporal cortex (ITC). Amyloid beta (Aβ) plaque load in parietal and temporal cortex was determined by immunohistochemistry, and concentrations of Aβ42, Aβ40, and norepinephrine in ITC were determined by enzyme-linked immuosorbent assay (ELISA). Transcriptional profiles were compared between middle-aged and old animals, and associations with AD-relevant neuropathological measures were determined.<h4>Results</h4>Transcriptional profiles varied by brain region and age group. Expression levels of <i>TRO</i> and <i>RNU4-1</i> were significantly lower in all four regions in the older group. An additional 29 genes were differentially expressed by age in three of four regions. Analyses of a combined expression data set of all four regions identified 77 differentially expressed genes (DEGs) by age group. Among these DEGs, older subjects had elevated levels of <i>CTSB</i> <i>, EBAG9</i>, <i>LAMTOR3</i>, and <i>MRPL17</i>, and lower levels of <i>COMMD10</i> and <i>TYW1B</i>. A subset of these DEGs was associated with neuropathology biomarkers. Notably, <i>CTSB</i> was positively correlated with Aβ plaque counts, Aβ42:Aβ40 ratios, and norepinephrine levels in all brain regions.<h4>Discussion</h4>These data demonstrate age differences in gene expression in olfaction-associated brain regions. Biological processes exhibiting age-related enrichment included the regulation of cell death, vascular function, mitochondrial function, and proteostasis. A subset of DEGs was specifically associated with AD phenotypes. These may represent promising targets for future mechanistic investigations and perhaps therapeutic intervention.

Also flagged:phospholipidscholelithiasis syndromeLowphospholipidcholelithiasisLPAC
Journal Article 2022-10-27 ✓ 1 Snippet Cherraqi A, Imrani K, Andour H, Messaoud O, Benelhosni K, Billah NM, Nassar I.
In-Text Gene Mentions

…such as andhemochromatosiswere normal.…

Show Full Abstract

Low phospholipid-associated cholelithiasis (LPAC) is a rare, still poorly understood genetic disorder characterized by the association of an ABCB4 mutation and low biliary phospholipid concentration with recurrent cholelithiasis, responsible for the development of intrahepatic lithiasis in adults. The mutation of the ABCB4 gene, which codes for the ABCB4/MDR3 ductal protein, a biliary transporter, leads to precipitation of cholesterol crystals in the bile ducts leading to the formation of intrahepatic stones. The diagnosis should be suspected when at least 2 of the following criteria are present: onset of symptoms before age 40; recurrence of biliary symptoms (biliary colic, jaundice, cholangitis, acute pancreatitis) after cholecystectomy; presence of echogenic foci in the liver indicative of intrahepatic stones or biliary sludge; previous episode(s) of intrahepatic cholestasis during pregnancy; and a family history of gallstones in first degree relatives. Imaging techniques, especially ultrasound, play an important role in the detection of intrahepatic stones. The majority of clinical situations are simple and not serious, often managed by medical treatment with ursodeoxycholic acid, but certain complicated forms may require more invasive endoscopic or surgical treatment. We report a case of a 43-year-old woman, cholecystectomized 5 years ago, who presented with liver colic-like pain with cytolysis and biological cholestasis. Ultrasound and MRI showed the presence of intrahepatic calculi disseminated along the bile duct pathway creating a comet tail appearance and generating a posterior shadow cone. The interrogation of the patient showed that her sister was being followed for LPAC syndrome. The diagnosis of LPAC syndrome was retained and the patient was put under medical treatment with ursodeoxycholic acid with regular clinical, biological and radiological follow-up.

Also flagged:gene expressionspermatogenesisfertilizationembryo developmentinseminationmating
Journal Article 2022-10-27 No Snippets Indriastuti R, Pardede BP, Gunawan A, Ulum MF, Arifiantini RI, Purwantara B.
Show Full Abstract

Nowadays, selection of superior male candidates in livestock as a source of frozen semen based on sperm quality at the cellular level is not considered accurate enough for predicting the potential of male fertility. Sperm transcriptome analysis approaches, such as messenger RNA levels, have been shown to correlate with fertility rates. Using this technology in livestock growth has become the principal method, which can be widely applied to predict male fertility potential in the livestock industry through the analysis of the sperm transcriptome. It provides the gene expression to validate the function of sperm in spermatogenesis, fertilization, and embryo development, as the parameters of male fertility. This review proposes a transcriptomic analysis approach as a high-throughput method to predict the fertility potential of livestock more accurately in the future.

Also flagged:myoblast proliferationWntmuscle developmentcholesterolprotein synthesisMYH1
Journal Article 2022-10-27 No Snippets Chen J, Zhang S, Chen G, Deng X, Zhang D, Wen H, Yin Y, Lin Z, Zhang X, Luo W.
Show Full Abstract

Chinese Shitou goose is a type of large goose with high meat yield. Understanding the genetic regulation of muscle development in Shitou goose would be beneficial to improve the meat production traits of geese. Muscle development is regulated by genes related to myoblast proliferation and differentiation. In this study, the RNA-seq method was used to construct the mRNA and lncRNA expression profiles of Shitou goose myoblasts and myotubes. A total of 1664 differentially expressed (DE) mRNAs and 244 DE-lncRNAs were identified. The alternative mRNA splicing in proliferation and differentiation stages was also analyzed. Notably, pathways enriched in DE-mRNAs, DE-splicing transcripts, and DE-lncRNAs all point to the Wnt signaling pathway, indicating that the Wnt signaling is a key regulatory pathway of muscle development in Shitou goose. We also constructed the interactive network of DE-lncRNAs and DE-mRNAs and revealed some key genes of lncRNAs regulating the proliferation and differentiation of myoblasts. These results provide new insights for the study of the muscle development of the Shitou goose.

Also flagged:NAFLDPolycystic Ovary Syndromepatatin-like phospholipase domain containing 3PCOSnonalcoholic fatty liver diseaseinsulin resistance
Journal Article 2022-10-27 ✓ 1 Snippet Recuero AM, Gomes LG, Maciel GAR, de Mello Malta F, Salles APM, Vezozzo DCP, Baracat EC, Pinho JRR, Carrilho FJ, Stefano JT, Oliveira CP.
In-Text Gene Mentions

…hepatitis, Wilson’s disease,hemochromatosis, celiac disease, cholestatic…

Show Full Abstract

Background: The aim of this study was to determine the frequency of the rs738409 polymorphism in the patatin-like phospholipase domain containing 3 (PNPLA3) gene in patients with polycystic ovary syndrome (PCOS) and its impact on nonalcoholic fatty liver disease (NAFLD) risk and severity. We also evaluated other risk factors associated with NAFLD and advanced fibrosis. Methods: This was a cross-sectional study involving 163 patients with PCOS at a tertiary center. Genotyping for the PNPLA3 polymorphism was undertaken using a TaqMan assay. The degree of fibrosis was defined by transient elastography. Results: The prevalence of NAFLD was 72.4%, and the polymorphism was heterozygous in 41.7% and homozygous in 8% of patients. Homeostasis model assessment of insulin resistance ≥ 2.5 was the main factor associated with the risk of developing NAFLD (OR = 4.313, p = 0.022), and its effect was amplified by the polymorphism (OR = 12.198, p = 0.017). Age > 32 years also conferred a higher risk for NAFLD. HDL values ≥ 50 mg/dL conferred protection against the outcome. Metabolic syndrome (OR = 13.030, p = 0.020) and AST > 32 U/L (OR = 9.039, p = 0.009) were independent risk factors for advanced fibrosis. Conclusions: In women with PCOS, metabolic characteristics are more relevant than PNPLA3 polymorphism regarding the risk for NAFLD and its advanced forms, but these factors can act synergistically, increasing disease risk.

Also flagged:EthanolTriglycerideNonalcoholic steatohepatitisNASHfructosemetabolic syndrome
Journal Article 2022-10-27 ✓ 1 Snippet Mbaye B, Borentain P, Magdy Wasfy R, Alou MT, Armstrong N, Mottola G, Meddeb L, Ranque S, Gérolami R, Million M, Raoult D.
In-Text Gene Mentions

…HCV), autoimmune hepatitis,hemochromatosis, and drug-induced liver…

Show Full Abstract

Nonalcoholic steatohepatitis (NASH) increases with fructose consumption and metabolic syndrome and has been recently linked with endogenous ethanol production, notably by high alcohol-producing <i>Klebsiella pneumoniae</i> (HiAlc Kpn). <i>Candida</i> yeasts are the main causes of auto-brewery syndromes but have been neglected in NASH. Here, the fecal ethanol and microbial content of 10 cases and 10 controls were compared. Ethanol was measured by gas chromatography-mass spectrometry. Species identification was performed by MALDI-TOF MS, and triglyceride production was assessed by a colorimetric enzymatic assay. The fecal ethanol concentration was four times higher in patients with NASH (median [interquartile range]: 0.13 [0.05-1.43] vs. 0.034 [0.008-0.57], <i>p</i> = 0.037). Yeasts were isolated from almost all cases but not from controls (9/10 vs. 0/10, <i>p</i> = 0.0001). <i>Pichia kudriavzevii</i> was the most frequent (four patients), while <i>Candida glabrata</i>, <i>Candida albicans,</i> and <i>Galactomyces geotrichum</i> were identified in two cases each. The concentration of ethanol produced by yeasts was 10 times higher than that produced by bacteria (median, 3.36 [0.49-5.60] vs. 0.32 [0.009-0.43], <i>p</i> = 0.0029). Using a 10% D-fructose restricted medium, we showed that NASH-associated yeasts transformed fructose in ethanol. Unexpectedly, yeasts isolated from NASH patients produced a substantial amount of triglycerides. <i>Pichia kudriavzevii</i> strains produced the maximal ethanol and triglyceride levels in vitro. Our preliminary human descriptive and in vitro experimental results suggest that yeasts have been neglected. In addition to <i>K. pneumoniae</i>, gut <i>Pichia</i> and <i>Candida</i> yeasts could be linked with NASH pathophysiology in a species- and strain-specific manner through fructose-dependent endogenous alcohol and triglyceride production.

Also flagged:Neurodegenerative diseasesPost-translational modificationsconjugationubiquitin-like modifierSUMOSUMOylation
Journal Article 2022-10-27 ✓ 5 Snippets Mandel N, Agarwal N.
In-Text Gene Mentions

It is caused by the expansion of a CAG repeat (encoding glutamine) at the exon 1 of the Huntingtin (HTT) gene [131,132,133].

The onset and progression of HD are associated with the presence of more than 36 CAG triplet repeats encoding polyQ tract in the HTT protein.

The ubiquitination of HTT causes its proteasome-mediated degradation, whereas the SUMOylation of the identical lysine residues protects it from degradation.

…of Huntingtin protein (HTT).…

…the Huntingtin (HTT) gene […

Show Full Abstract

Neurodegenerative diseases (NDDs) are irreversible, progressive diseases with no effective treatment. The hallmark of NDDs is the aggregation of misfolded, modified proteins, which impair neuronal vulnerability and cause brain damage. The loss of synaptic connection and the progressive loss of neurons result in cognitive defects. Several dysregulated proteins and overlapping molecular mechanisms contribute to the pathophysiology of NDDs. Post-translational modifications (PTMs) are essential regulators of protein function, trafficking, and maintaining neuronal hemostasis. The conjugation of a small ubiquitin-like modifier (SUMO) is a reversible, dynamic PTM required for synaptic and cognitive function. The onset and progression of neurodegenerative diseases are associated with aberrant SUMOylation. In this review, we have summarized the role of SUMOylation in regulating critical proteins involved in the onset and progression of several NDDs.

Also flagged:Autism spectrum disorderneurodevelopmental disorderAutismneurodevelopmental disordersCornelia de LangeFragile X syndromes
Journal Article 2022-10-27 ✓ 1 Snippet Lyons-Warren AM, Wangler MF, Wan YW.
In-Text Gene Mentions

…all Areas subgroup,SOX6and NRXN3 which…

Show Full Abstract

Autism spectrum disorder is a common, heterogeneous neurodevelopmental disorder lacking targeted treatments. Additional features include restricted, repetitive patterns of behaviors and differences in sensory processing. We hypothesized that detailed sensory features including modality specific hyper- and hypo-sensitivity could be used to identify clinically recognizable subgroups with unique underlying gene variants. Participants included 378 individuals with a clinical diagnosis of autism spectrum disorder who contributed Short Sensory Profile data assessing the frequency of sensory behaviors and whole genome sequencing results to the Autism Speaks' MSSNG database. Sensory phenotypes in this cohort were not randomly distributed with 10 patterns describing 43% (162/378) of participants. Cross comparison of two independent cluster analyses on sensory responses identified six distinct sensory-based subgroups. We then characterized subgroups by calculating the percent of patients in each subgroup who had variants with a Combined Annotation Dependent Depletion (CADD) score of 15 or greater in each of 24,896 genes. Each subgroup exhibited a unique pattern of genes with a high frequency of variants. These results support the use of sensory features to identify autism spectrum disorder subgroups with shared genetic variants.

Also flagged:extracellularvesiclesendosomessignal transductionblood circulationsecretion
Journal Article 2022-10-27 No Snippets Rajput A, Varshney A, Bajaj R, Pokharkar V.
Show Full Abstract

Currently, particular interest among the scientific community is focused on exploring the use of exosomes for several pharmaceutical and biomedical applications. This is due to the identification of the role of exosomes as an excellent intercellular communicator by delivering the requisite cargo comprising of functional proteins, metabolites and nucleic acids. Exosomes are the smallest extracellular vesicles (EV) with sizes ranging from 30-100 nm and are derived from endosomes. Exosomes have similar surface morphology to cells and act as a signal transduction channel between cells. They encompass different biomolecules, such as proteins, nucleic acids and lipids, thus rendering them naturally as an attractive drug delivery vehicle. Like the other advanced drug delivery systems, such as polymeric nanoparticles and liposomes to encapsulate drug substances, exosomes also gained much attention in enhancing therapeutic activity. Exosomes present many advantages, such as compatibility with living tissues, low toxicity, extended blood circulation, capability to pass contents from one cell to another, non-immunogenic and special targeting of various cells, making them an excellent therapeutic carrier. Exosome-based molecules for drug delivery are still in the early stages of research and clinical trials. The problems and clinical transition issues related to exosome-based drugs need to be overcome using advanced tools for better understanding and systemic evaluation of exosomes. In this current review, we summarize the most up-to-date knowledge about the complex biological journey of exosomes from biogenesis and secretion, isolation techniques, characterization, loading methods, pharmaceutical and therapeutic applications, challenges and future perspectives of exosomes.

Also flagged:phytolgallic acidlipidglycerol trioleateunsaturatedwater
Journal Article 2022-10-27 No Snippets Wang S, Wang H, Yan F, Wang J, Liu S.
Show Full Abstract

In this study, a novel galloyl phytol antioxidant was developed by incorporating the branched phytol chain with gallic acid through mild Steglich esterification. The evaluation of the radical scavenging activity, lipid oxidation in a liposomal model, and glycerol trioleate revealed its superior antioxidant activities in both dispersed and bulk oils. Then, the antioxidant capacity enhancement of galloyl phytol was further explored using thermal gravimetry/differential thermal analysis (TG/DTA), transmission electron microscopy (TEM), and molecular modeling. The EC50 values of GP, GPa, and GE were 0.256, 0.262, and 0.263 mM, respectively, which exhibited comparable DPPH scavenging activities. These investigations unveiled that the branched aliphatic chain enforced the coiled molecular conformation and the unsaturated double bond in the phytol portion further fixed the coiled conformation, which contributed to a diminished aggregation tendency and enhanced antioxidant activities in dispersed and bulk oils. The remarkable antioxidant performance of galloyl phytol suggested intriguing and non-toxic natural antioxidant applications in the food industry, such as effectively inhibiting the oxidation of oil and improvement of the quality and shelf life of the oil, which would contribute to the use of tea resources and extending the tea industry chain.

Also flagged:Iron DeficiencyIDHbtransferrin receptoranemiairon
Journal Article 2022-10-27 ✓ 1 Snippet Roy R, Kück M, Radziwolek L, Kerling A.
In-Text Gene Mentions

…cases, even triggerhemochromatosiswith appropriate genetic…

Show Full Abstract

Background: Iron deficiency is a common phenomenon in sports and may lead to impaired physical performance. The aim of the study was to determine the frequency of iron deficiency in competitive athletes and to discuss the resulting consequences. Methods: The data of 629 athletes (339 male, 290 female) who presented for their annual basic sports medicine examination were investigated. Depending on age (<14 years, 15−17 years, ≥18−30 years), four groups ((I.) normal hemoglobin (Hb) and ferritin level (≥30 ng/mL for adults and 15−18-year-olds; ≥20 ng/mL, respectively, ≥15 ng/mL for adolescents and children), (II.) prelatent iron deficiency (ID) (normal Hb, low ferritin), (III.) latent ID (additionally elevated soluble transferrin receptor or decreased transferrin saturation) and (IV.) manifest anemia) were distinguished. In addition, the iron status and exercise capacity of different types of sports were compared. Results: Overall we found an iron deficiency of 10.9% in male (mainly in adolescence) and 35.9% in female athletes (emphasized in adolescence and young adulthood). There were no significant differences in iron status in regard to the different sport types or in maximum performance for the different groups of iron deficiency. Conclusions: Adolescent and female athletes are more likely to have an iron deficiency. Therapy concepts for athletes therefore should pay attention to iron-rich diets.

Also flagged:PHACTR1Atherosclerosischronic inflammatory vascular diseaseEndotheliitisendothelial dysfunctionED
Journal Article 2022-10-27 ✓ 1 Snippet Su M, Zhao W, Li Y, Li H, Xu S, Weng J.
In-Text Gene Mentions

…containing 92 (CCDC92) , tribbles pseudokinase…

Show Full Abstract

Atherosclerosis is a chronic inflammatory vascular disease in which endothelial cells play an important role in maintaining vascular homeostasis. Endotheliitis caused by endothelial dysfunction (ED) is the key cause for the development of cardiovascular and cerebrovascular diseases as well as other vascular system diseases. Resveratrol (RES), a multi-functional polyphenol present in edible plants and fruits, prevents cardiovascular disease by regulating a variety of athero-relevant signaling pathways. By transcriptome profiling of RES-treated human umbilical vein endothelial cells (HUVECs) and in-depth bioinformatic analysis, we observed that differentially expressed genes (DEGs) were enriched in KEGG pathways of fluid shear stress and atherosclerosis, suggesting that the RES may serve as a good template for a shear stress mimetic drug that hold promise in combating atherosclerosis. A heat map and multiple datasets superimposed screening revealed that RES significantly down-regulated phosphatase and actin modulator 1 (PHACTR1), a pivotal coronary artery disease risk gene associated with endothelial inflammation and polyvascular diseases. We further demonstrate that RES down-regulated the gene and protein expression of PHACTR1 and inhibited TNF-α-induced adhesion of THP-1 monocytes to activated endothelial cells via suppressing the expression of PHACTR1. Taken together, our study reveals that PHACTR1 represents a new molecular target for RES to maintain endothelial cell homeostasis and prevent atherosclerotic cardiovascular disease.

Also flagged:IronHomeostasismetabolismelectron transportadenosine triphosphatesynthesis
Journal Article 2022-10-27 No Snippets Kim SL, Shin S, Yang SJ.
Show Full Abstract

Iron plays a role in energy metabolism as a component of vital enzymes and electron transport chains (ETCs) for adenosine triphosphate (ATP) synthesis. The tricarboxylic acid (TCA) cycle and oxidative phosphorylation are crucial in generating ATP in mitochondria. At the mitochondria matrix, heme and iron-sulfur clusters are synthesized. Iron-sulfur cluster is a part of the aconitase in the TCA cycle and a functional or structural component of electron transfer proteins. Heme is the prosthetic group for cytochrome c, a principal component of the respiratory ETC. Regarding fat metabolism, iron regulates mitochondrial fat oxidation and affects the thermogenesis of brown adipose tissue (BAT). Thermogenesis is a process that increases energy expenditure, and BAT is a tissue that generates heat via mitochondrial fuel oxidation. Iron deficiency may impair mitochondrial fuel oxidation by inhibiting iron-containing molecules, leading to decreased energy expenditure. Although it is expected that impaired mitochondrial fuel oxidation may be restored by iron supplementation, its underlying mechanisms have not been clearly identified. Therefore, this review summarizes the current evidence on how iron regulates energy metabolism considering the TCA cycle, oxidative phosphorylation, and thermogenesis. Additionally, we relate iron-mediated metabolic regulation to obesity and obesity-related complications.

Also flagged:Ferroptosisdeathironlipidperoxidesautophagy
Journal Article 2022-10-27 ✓ 1 Snippet Ji Y, Zheng K, Li S, Ren C, Shen Y, Tian L, Zhu H, Zhou Z, Jiang Y.
In-Text Gene Mentions

HD is a progressive neurodegenerative disease characterized by rapid involuntary movements and cognitive impairment, ultimately leading to death, due to expansion of CAG repeats in the Huntingtin (HTT).

Show Full Abstract

Ferroptosis is a newly discovered way of programmed cell death, mainly caused by the accumulation of iron-dependent lipid peroxides in cells, which is morphologically, biochemically and genetically different from the previously reported apoptosis, necrosis and autophagy. Studies have found that ferroptosis plays a key role in the occurrence and development of neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease and vascular dementia, which suggest that ferroptosis may be involved in regulating the progression of neurodegenerative diseases. At present, on the underlying mechanism of ferroptosis in neurodegenerative diseases is still unclear, and relevant research is urgently needed to clarify the regulatory mechanism and provide the possibility for the development of agents targeting ferroptosis. This review focused on the regulatory mechanism of ferroptosis and its various effects in neurodegenerative diseases, in order to provide reference for the research on ferroptosis in neurodegenerative diseases.

Also flagged:necroptosistumordeathgastric cancergene expressionCYTL1
Journal Article 2022-10-27 ✓ 5 Snippets Khan M, Lin J, Wang B, Chen C, Huang Z, Tian Y, Yuan Y, Bu J.
In-Text Gene Mentions

(B) A correlation matrix illustrating Pearson’s correlation coefficients indicating the relationship among expression levels of RIPK1, RIPK3, MLKL (necroptosis core mediators), NRGPI oncogenes (SERPINE1, GPX3, GRP, FCN1, CYTL1, CNTN1, PLCL1, and APOD), and markers of WNT signaling pathway (WNT2B, WNT9A), TGF-β signaling pathway (TGFB1, TGFB3), and macrophage (CD63, CD206, CD163) in the clinical samples (n = 4) of stomach adenocarcinoma.

Representative images of expression (brown, cell cytoplasmic/nucleus stain) of RIPK1, RIPK3, MLKL (necroptosis core mediators), NRGPI oncogenes (SERPINE1, GPX3, GRP, FCN1, CYTL1, CNTN1, PLCL1, and APOD), markers of WNT signaling pathway (WNT2B, WNT9A), TGF-β signaling pathway (TGFB1, TGFB3), and macrophage (CD63, CD206, CD163) in the clinical samples of stomach adenocarcinoma.

PLCL1 was demonstrated to induce abnormal lipid metabolism in tumor cells by interacting with metabolism-related gene uncoupling protein 1 (UCP1), thereby repressing progression of clear cell renal cell carcinoma (ccRCC) (78).

(A) Expression level (IHC quantification) of RIPK1, RIPK3, MLKL (necroptosis core mediators), NRGPI oncogenes (SERPINE1, GPX3, GRP, FCN1, CYTL1, CNTN1, PLCL1, and APOD), and markers of WNT signaling pathway (WNT2B, WNT9A), TGF-β signaling pathway (TGFB1, TGFB3), and macrophage (CD63, CD206, CD163) in the clinical samples (n = 4) of stomach adenocarcinoma.

…10 genes (CYTL1,PLCL1, CGB5, CNTN1, GRP,…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) represents a major global clinical problem with very limited therapeutic options and poor prognosis. Necroptosis, a recently discovered inflammatory form of cell death, has been implicated in carcinogenesis and inducing necroptosis has also been considered as a therapeutic strategy.<h4>Objective</h4>We aim to evaluate the role of this pathway in gastric cancer development, prognosis and immune aspects of its tumor microenvironment.<h4>Methods and results</h4>In this study, we evaluated the gene expression of 55 necroptosis-related genes (NRGs) that were identified <i>via</i> carrying out a comprehensive review of the medical literature. Necroptosis pathway was deregulated in gastric cancer samples (n=375) as compared to adjacent normal tissues (n=32) obtained from the "The Cancer Genome Atlas (TCGA)". Based on the expression of these NRGs, two molecular subtypes were obtained through consensus clustering that also showed significant prognostic difference. Differentially expressed genes between these two clusters were retrieved and subjected to prognostic evaluation <i>via</i> univariate cox regression analysis and LASSO cox regression analysis. A 13-gene risk signature, termed as necroptosis-related genes prognostic index (NRGPI), was constructed that comprehensively differentiated the gastric cancer patients into high- and low-risk subgroups. The prognostic significance of NRGPI was validated in the GEO cohort (GSE84437: n=408). The NRGPI-high subgroup was characterized by upregulation of 10 genes (CYTL1, PLCL1, CGB5, CNTN1, GRP, APOD, CST6, GPX3, FCN1, SERPINE1) and downregulation of 3 genes (EFNA3, E2F2, SOX14). Further dissection of these two risk groups by differential gene expression analysis indicated involvement of signaling pathways associated with cancer cell progression and immune suppression such as WNT and TGF-β signaling pathway. Para-inflammation and type-II interferon pathways were activated in NRGPI-high patients with an increased infiltration of Tregs and M2 macrophage indicating an exhausted immune phenotype of the tumor microenvironment. These molecular characteristics were mainly driven by the eight NRGPI oncogenes (CYTL1, PLCL1, CNTN1, GRP, APOD, GPX3, FCN1, SERPINE1) as validated in the gastric cancer cell lines and clinical samples. NRGPI-high patients showed sensitivity to a number of targeted agents, in particular, the tyrosine kinase inhibitors.<h4>Conclusions</h4>Necroptosis appears to play a critical role in the development of gastric cancer, prognosis and shaping of its tumor immune microenvironment. NRGPI can be used as a promising prognostic biomarker to identify gastric cancer patients with a cold tumor immune microenvironment and poor prognosis who may response to selected molecular targeted therapy.

Also flagged:UNC13ACongenital Encephalopathysynaptic vesiclesynapseNervous SystemUncoordinated 13
Journal Article 2022-10-27 ✓ 5 Snippets Mullins JR, McFadden K, Snow N, Oviedo A.
In-Text Gene Mentions

…UNC13A, UNC13B, andUNC13Care located on…

…mouse model ofUNC13Closs.…

UNC13Cis another member…

…have shown thatUNC13Cis involved in…

…since UNC13A andUNC13Care both parts…

Show Full Abstract

Uncoordinated 13 (<i>UNC13A</i>) affects movement in <i>Caenorhabditis elegans</i> (<i>C. elegans</i>). It is responsible for docking, priming, and stabilizing synaptic vesicle fusion complexes in the neuronal synapse and neuromuscular junction (NMJ). It also plays an important role in central nervous system development. We report the detailed clinical history and central nervous system neuropathologic findings in an infantile case with homozygous <i>UNC13A</i> loss of function variant, in order to advance the understanding of this critically important synaptic vesicle protein. This is the first detailed central nervous system neuropathologic report of this rare case of homozygous <i>UNC13A </i>loss.

Also flagged:CarbonylLipidGlutathioneCopperSODMn
Journal Article 2022-10-27 No Snippets Kurup AR, Nair N.
Show Full Abstract

Copper a quintessential transitional metal is required for development and function of normal brain and its deficiency has been associated with impairments in brain function. The present study investigates the effects of dietary copper deficiency on brain sub-regions of male Wistar rats for 2-, 4- and 6-week. Pre-pubertal rats were divided into four groups: negative control (NC), copper control (CC), pairfed (PF) and copper deficient (CD). In brain sub regions total protein concentration, glutathione concentration and Cu-Zn SOD activity were down regulated after 2-, 4- and 6 weeks compared to controls and PF groups. Significant increase in brain sub regions was observed in protein carbonyl and lipid peroxidation concentration as well as total SOD, Mn SOD and catalase activities after 2-, 4- and 6 weeks of dietary copper deficiency. Experimental evidences indicate that impaired copper homeostasis has the potential to generate reactive oxygen species enhancing the susceptibility to oxidative stress by inducing up- and down-regulation of non-enzymatic and enzymatic profile studied in brain sub regions causing loss of their normal function which can consequently lead to deterioration of cell structure and death if copper deficiency is prolonged.

Research Square 2022-10-27 Preprint (No Snippets API) Sahraei Z, Panahi P, Afaghi S, Amirdosara M, Salamzadeh J, Tarki FE, Darazam IA.
Show Full Abstract

<h4>Objectives: </h4> It remains unclear which formulation of corticosteroid regimen has the optimum efficacies on COVID-19 pneumonia. Herein we evaluated two regimens including methylprednisolone at a dose of 1 mg/kg every 12 hours (low-dose group) and 1000 mg/day pulse-therapy for 3 days following 1 mg/kg every 12 hours (high-dose group) methylprednisolone to assess the clinical outcomes in acute respiratory distress syndrome (ARDS) due to COVID-19. Methods This randomized clinical trial was performed on patients with mild to moderate ARDS following COVID-19 randomly assigned to receive low-dose (n = 47) or high-dose (n = 48) intravenous methylprednisolone. Two groups were matched for age, gender, BMI, comorbidities, leukocytes, lymphocytes, neutrophil/lymphocyte, platelet, hemoglobin, and inflammatory markers (ESR, CRP, Ferritin). both regimens were initiated upon admission and continued for 10-days. the clinical outcome and secondary complications were evaluated. Results and discussion Evaluating in-hospital outcomes, no difference was revealed in the duration of ICU-stays (5.4 ± 4.6 vs 4.5 ± 4.9, p-value = 0.35), total hospital-stays (8 ± 3.1 vs 6.9 ± 3.4, p-value = 0.1), requirement rate for invasive ventilation (29.2% vs 36.2%, p-value = 0.4) or none-invasive ventilation (16.6% vs 23.4%, p-value = 0.4), and hemoperfusion (16.6% vs 11.3%, p-value = 0.3) between the groups. Fatality due to ARDS (29.2% vs 38.3, p-value = 0.3), and septic shock (4.2%, 6.4%, p-value = 0.3) was respectively reported in low-dose and high-dose groups, with no significant difference. Patients who received pulse-therapy had significantly higher bacterial pneumonia co-infection events (18.7% versus 10.6% (p-value = 0.01). What is new and conclusion: adjuvant pulse-therapy for intravenous methylprednisolone does not improve the in-hospital clinical outcomes among mild to moderate ARDS COVID-19 patients. Higher risk of Bacterial pneumonia should be considered in such cases receiving the higher dose of steroids.

Also flagged:cytoplasmmembranevesiclesCopolymercholesteryl2
Journal Article 2022-10-26 No Snippets Huang X, Hürlimann D, Spanke HT, Wu D, Skowicki M, Dinu IA, Dufresne ER, Palivan CG.
Show Full Abstract

Cell-derived vesicles retain the cytoplasm and much of the native cell membrane composition. Therefore, they are attractive for investigations of membrane biophysics, drug delivery systems, and complex molecular factories. However, their fragility and aggregation limit their applications. Here, the mechanical properties and stability of giant plasma membrane vesicles (GPMVs) are enhanced by decorating them with a specifically designed diblock copolymer, cholesteryl-poly[2-aminoethyl methacrylate-b-poly(ethylene glycol) methyl ether acrylate]. When cross-linked, this polymer brush enhances the stability of the GPMVs. Furthermore, the pH-responsiveness of the copolymer layer allows for a controlled cargo loading/release, which may enable various bioapplications. Importantly, the cross-linked-copolymer GPMVs are not cytotoxic and preserve in vitro membrane integrity and functionality. This effective strategy to equip the cell-derived vesicles with stimuli-responsive cross-linkable copolymers is expected to open a new route to the stabilization of natural membrane systems and overcome barriers to biomedical applications.

Also flagged:glucosedisaccharidetrehalosecytoplasmcarbonenvelope
Journal Article 2022-10-26 No Snippets Pohane AA, Moore DJ, Lepori I, Gordon RA, Nathan TO, Gepford DM, Kavunja HW, Swarts BM, Siegrist MS.
Show Full Abstract

In mycobacteria, the glucose-based disaccharide trehalose cycles between the cytoplasm, where it is a stress protectant and carbon source, and the cell envelope, where it is released as a byproduct of outer mycomembrane glycan biosynthesis and turnover. Trehalose recycling via the LpqY-SugABC transporter promotes virulence, antibiotic recalcitrance, and efficient adaptation to nutrient deprivation. The source(s) of trehalose and the regulation of recycling under these and other stressors are unclear. A key technical gap in addressing these questions has been the inability to trace trehalose recycling in situ, directly from its site of liberation from the cell envelope. Here we describe a bifunctional chemical reporter that simultaneously marks mycomembrane biosynthesis and subsequent trehalose recycling with alkyne and azide groups. Using this probe, we discovered that the recycling efficiency for trehalose increases upon carbon starvation, concomitant with an increase in LpqY-SugABC expression. The ability of the bifunctional reporter to probe multiple, linked steps provides a more nuanced understanding of mycobacterial cell envelope metabolism and its plasticity under stress.

Also flagged:neuromuscular diseasescerebellar ataxianeurologyoligonucleotidesantibodiesneurodegenerative diseases
Journal Article 2022-10-26 ✓ 1 Snippet Miyatake S, Koshimizu E, Fujita A, Doi H, Okubo M, Wada T, Hamanaka K, Ueda N, Kishida H, Minase G, Matsuno A, Kodaira M, Ogata K, Kato R, Sugiyama A, Sasaki A, Miyama T, Satoh M, Uchiyama Y, Tsuchida N, Hamanoue H, Misawa K, Hayasaka K, Sekijima Y, Adachi H, Yoshida K, Tanaka F, Mizuguchi T, Matsumoto N.
In-Text Gene Mentions

…ATXN1 41 ,HTT22 (with protective…

Show Full Abstract

We developed a diagnostic method for repeat expansion diseases using a long-read sequencer to improve currently available, low throughput diagnostic methods. We employed the real-time target enrichment system of the nanopore GridION sequencer using the adaptive sampling option, in which software-based target assignment is available without prior sample enrichment, and built an analysis pipeline that prioritized the disease-causing loci. Twenty-two patients with various neurological and neuromuscular diseases, including 12 with genetically diagnosed repeat expansion diseases and 10 manifesting cerebellar ataxia, but without genetic diagnosis, were analyzed. We first sequenced the 12 molecularly diagnosed patients and accurately confirmed expanded repeats in all with uniform depth of coverage across the loci. Next, we applied our method and a conventional method to 10 molecularly undiagnosed patients. Our method corrected inaccurate diagnoses of two patients by the conventional method. Our method is superior to conventional diagnostic methods in terms of speed, accuracy, and comprehensiveness.

Also flagged:tumourCancerprimary cancerdimethylsulfoxideisopropanolchromatin
Journal Article 2022-10-26 ✓ 1 Snippet Heide T, Househam J, Cresswell GD, Spiteri I, Lynn C, Mossner M, Kimberley C, Fernandez-Mateos J, Chen B, Zapata L, James C, Barozzi I, Chkhaidze K, Nichol D, Gunasri V, Berner A, Schmidt M, Lakatos E, Baker AM, Costa H, Mitchinson M, Piazza R, Jansen M, Caravagna G, Ramazzotti D, Shibata D, Bridgewater J, Rodriguez-Justo M, Magnani L, Graham TA, Sottoriva A.
In-Text Gene Mentions

…example, SOX5 andSOX6) that are…

Show Full Abstract

Colorectal malignancies are a leading cause of cancer-related death<sup>1 </sup>and have undergone extensive genomic study<sup>2,3</sup>. However, DNA mutations alone do not fully explain malignant transformation<sup>4-7</sup>. Here we investigate the co-evolution of the genome and epigenome of colorectal tumours at single-clone resolution using spatial multi-omic profiling of individual glands. We collected 1,370 samples from 30 primary cancers and 8 concomitant adenomas and generated 1,207 chromatin accessibility profiles, 527 whole genomes and 297 whole transcriptomes. We found positive selection for DNA mutations in chromatin modifier genes and recurrent somatic chromatin accessibility alterations, including in regulatory regions of cancer driver genes that were otherwise devoid of genetic mutations. Genome-wide alterations in accessibility for transcription factor binding involved CTCF, downregulation of interferon and increased accessibility for SOX and HOX transcription factor families, suggesting the involvement of developmental genes during tumourigenesis. Somatic chromatin accessibility alterations were heritable and distinguished adenomas from cancers. Mutational signature analysis showed that the epigenome in turn influences the accumulation of DNA mutations. This study provides a map of genetic and epigenetic tumour heterogeneity, with fundamental implications for understanding colorectal cancer biology.

Also flagged:AMLmethylationCTCFbindinggene expressionacute myeloid leukemia
Journal Article 2022-10-26 No Snippets Xu J, Song F, Lyu H, Kobayashi M, Zhang B, Zhao Z, Hou Y, Wang X, Luan Y, Jia B, Stasiak L, Wong JH, Wang Q, Jin Q, Jin Q, Fu Y, Yang H, Hardison RC, Dovat S, Platanias LC, Diao Y, Yang Y, Yamada T, Viny AD, Levine RL, Claxton D, Broach JR, Zheng H, Yue F.
Show Full Abstract

Acute myeloid leukaemia (AML) represents a set of heterogeneous myeloid malignancies, and hallmarks include mutations in epigenetic modifiers, transcription factors and kinases<sup>1-5</sup>. The extent to which mutations in AML drive alterations in chromatin 3D structure and contribute to myeloid transformation is unclear. Here we use Hi-C and whole-genome sequencing to analyse 25 samples from patients with AML and 7 samples from healthy donors. Recurrent and subtype-specific alterations in A/B compartments, topologically associating domains and chromatin loops were identified. RNA sequencing, ATAC with sequencing and CUT&Tag for CTCF, H3K27ac and H3K27me3 in the same AML samples also revealed extensive and recurrent AML-specific promoter-enhancer and promoter-silencer loops. We validated the role of repressive loops on their target genes by CRISPR deletion and interference. Structural variation-induced enhancer-hijacking and silencer-hijacking events were further identified in AML samples. Hijacked enhancers play a part in AML cell growth, as demonstrated by CRISPR screening, whereas hijacked silencers have a downregulating role, as evidenced by CRISPR-interference-mediated de-repression. Finally, whole-genome bisulfite sequencing of 20 AML and normal samples revealed the delicate relationship between DNA methylation, CTCF binding and 3D genome structure. Treatment of AML cells with a DNA hypomethylating agent and triple knockdown of DNMT1, DNMT3A and DNMT3B enabled the manipulation of DNA methylation to revert 3D genome organization and gene expression. Overall, this study provides a resource for leukaemia studies and highlights the role of repressive loops and hijacked cis elements in human diseases.

Also flagged:myocardial infarctionacute myocardial infarction-ST-elevation myocardial infarctiondiabetesCardiovascular diseaseatherosclerosis
Journal Article 2022-10-26 ✓ 1 Snippet Kolden MØ, Nymo SH, Øie E.
In-Text Gene Mentions

…patients with NSTEMI (type 1 infarction1 infarction) from…

Show Full Abstract

<h4>Background</h4>There is consensus that low socioeconomic status (SES) is associated with an increased risk of acute myocardial infarction (AMI), but the extent to which traditional coronary risk factors and other characteristics of low SES mediate this effect remains uncertain. This study examined AMI patients residing in neighbouring city districts with the same local hospital despite having among the most considerable differences in mean SES in Norway. Our purpose was to assess low SES as a coronary risk factor and examine whether traditional coronary risk factors or ancestry mediate this effect.<h4>Methods</h4>Six hundred six patients (215 and 391 with a low and high neighbourhood-level SES, respectively) admitted to Diakonhjemmet Hospital with non-ST-elevation myocardial infarction (NSTEMI) between 2014 and 2017, entered analysis. Data from the Norwegian Myocardial Infarction Register were used to identify patient characteristics, and the STATA/SE 15.1 software was used to perform the statistical analyses.<h4>Results</h4>Patients from socioeconomically disadvantaged city-districts had a 4.9 years earlier onset of AMI (68.99 vs. 73.89 years; p < 0.001) and a higher prevalence of previous AMI, known diabetes, and current smokers (36% vs. 27%, 25% vs. 12%, and 33% vs. 17%, respectively; all p ≤ 0.05). When only comparing patients with a first time AMI, an even greater difference in the age at AMI onset was found (6.1 yrs; p < 0.001). The difference in age at AMI onset remained statistically significant when adjusting for traditional coronary risk factors (3.28 yrs; 95% confidence interval (CI) 1.11-5.44; p = 0.003), but not when adjusting for presumed non-Northwest-European ancestry (1.81 yrs; 95% CI -0.55 to 4.17; p = 0.132).<h4>Conclusion</h4>This study supports earlier research showing an increased risk of AMI in socioeconomically disadvantaged individuals. In our population, presumed non-Northwest-European ancestry could entirely explain the increased risk, whereas traditional coronary risk factors could only partly explain the increased risk.

Also flagged:Topoisomerases Idegradationbindingchromosomedosage compensationTOP-1
Journal Article 2022-10-26 ✓ 2 Snippets Morao AK, Kim J, Obaji D, Sun S, Ercan S.
In-Text Gene Mentions

…SummaryCondensinsare evolutionarily conserved…

Condensinsare molecular motors…

Show Full Abstract

Condensins are evolutionarily conserved molecular motors that translocate along DNA and form loops. To address how DNA topology affects condensin translocation, we applied auxin-inducible degradation of topoisomerases I and II and analyzed the binding and function of an interphase condensin that mediates X chromosome dosage compensation in C. elegans. TOP-2 depletion reduced long-range spreading of condensin-DC (dosage compensation) from its recruitment sites and shortened 3D DNA contacts measured by Hi-C. TOP-1 depletion did not affect long-range spreading but resulted in condensin-DC accumulation within expressed gene bodies. Both TOP-1 and TOP-2 depletion resulted in X chromosome derepression, indicating that condensin-DC translocation at both scales is required for its function. Together, the distinct effects of TOP-1 and TOP-2 suggest two distinct modes of condensin-DC association with chromatin: long-range DNA loop extrusion that requires decatenation/unknotting of DNA and short-range translocation across genes that requires resolution of transcription-induced supercoiling.

Also flagged:Immuneinflammatory responseimmune responsedepressionadolescent depressionIL-1β
Journal Article 2022-10-26 ✓ 2 Snippets Ferencova N, Visnovcova Z, Ondrejka I, Funakova D, Hrtanek I, Kelcikova S, Tonhajzerova I.
In-Text Gene Mentions

For example, a polymorphism in the IL-1β promoter at position 511 has been associated with higher depressive symptoms severity whether the polymorphism is associated with increased IL-1β production (allele 511T) or decreased IL-1β production (allele 511C).59–61 Similar findings have been reported with polymorphisms in TNF-α and CRP promoters.62 Further, the genome-wide association analyses identified the 44 risk gene variants in MDD with 4 of them (namely LACC1, OLFM4, TIAF1, and NR4A2) being associated with immune responses.63 Besides, a recent weighted gene co-expression network analysis (WGCNA) identified three genes related to immune responses (IL1RAP, UBE2W, and UBE2D1) as hub genes of adolescent MDD.64 Further research involving genome-wide association studies, transcriptomics and WGCNA is needed to exactly shed light on the genetic contributions of inflammation-related depression.

…them (namely LACC1,OLFM4, TIAF1 , and…

Show Full Abstract

<h4>Purpose</h4>Nowadays, the role of two tightly interconnected systems, the inflammatory response system (IRS) and the compensatory immune response system (CIRS) in depression, is increasingly discussed. Various studies indicate pro-inflammatory activity in adolescent depression; however, there is an almost complete lack of findings about IRS and CIRS balance. Thus, we aimed to assess different IRS and CIRS indices, profiles, and IRS/CIRS ratios in drug-naïve MDD patients at adolescent age, with respect to sex.<h4>Patients and methods</h4>One hundred MDD adolescents (40 boys, average age: 15.4±1.2 yrs.) and 60 controls (28 boys, average age: 15.3±1.5 yrs.) were examined. Evaluated parameters were 1. plasma levels of interleukin (IL)-1α, IL-1β, IL-2, IL-4, IL-6, IL-8, IL-10, interferon gamma, tumor necrosis factor alpha (TNF-α), soluble receptor of IL-6 (sIL-6R), soluble receptors of TNF-α (sTNF-R1, sTNF-R2); 2. profiles: IL-6 trans-signaling, M1 macrophage signaling, helper T lymphocytes (Th) 1 profile, regulatory T lymphocytes (Treg)+Th2, allIRS, and allCIRS; 3. IRS vs CIRS activity ratios: TNF-α/TNF-R1, TNF-α/TNF-R2, TNF-α/sTNF-Rs (ie sTNF-R1+sTNF-R2), Th1/Th2, Th1/Treg, Th1/Th2+Treg, M1/Th2, M1/Treg, M1/Treg+Th2, allIRS/allCIRS.<h4>Results</h4>MDD patients showed increased IL-4, IL-10, TNF-α, sIL-6R, Treg+Th2, allIRS, allCIRS, and TNF-α/sTNF-Rs, and decreased Th1/Th2+Treg. MDD females showed increased IL-10 and TNF-α compared to control females. MDD males showed increased IL-4, IL-10, sIL-6R, Treg+Th2, and TNF-α/TNF-R1 compared to control males. Increased sTNF-R1 was found in MDD males compared to MDD females. Positive correlations were found between CDI score and sIL-6R and IL-10 in the total group and between CDI score and IL-10 in adolescent males.<h4>Conclusion</h4>Our study for the first time extensively evaluated IRS and CIRS interactions revealing enhanced pro-inflammatory TNF-α signaling and IL-6 trans-signaling in association with increased IL-10- and IL-4-mediated anti-inflammatory activity in first-episode depression at the adolescent age. Moreover, results reflect the sex-specific simultaneous activation of IRS and CIRS pathways in adolescent depression.

Also flagged:cancerhead and neck cancerpurinepyrimidinemetabolismpentose
Journal Article 2022-10-26 No Snippets Wang FS, Chen PR, Chen TY, Zhang HX.
Show Full Abstract

Computer-aided methods can be used to screen potential candidate targets and to reduce the time and cost of drug development. In most of these methods, synthetic lethality is used as a therapeutic criterion to identify drug targets. However, these methods do not consider the side effects during the identification stage. This study developed a fuzzy multi-objective optimization for identifying anti-cancer targets that not only evaluated cancer cell mortality, but also minimized side effects due to treatment. We identified potential anti-cancer enzymes and antimetabolites for the treatment of head and neck cancer (HNC). The identified one- and two-target enzymes were primarily involved in six major pathways, namely, purine and pyrimidine metabolism and the pentose phosphate pathway. Most of the identified targets can be regulated by approved drugs; thus, these drugs are potential candidates for drug repurposing as a treatment for HNC. Furthermore, we identified antimetabolites involved in pathways similar to those identified using a gene-centric approach. Moreover, <i>HMGCR</i> knockdown could not block the growth of HNC cells. However, the two-target combinations of (<i>UMPS</i>, <i>HMGCR</i>) and (<i>CAD</i>, <i>HMGCR</i>) could achieve cell mortality and improve metabolic deviation grades over 22% without reducing the cell viability grade.

Also flagged:genetic disorderHbthalassemiaβ-thalassemia majorβ-thalassemiaglobin
Journal Article 2022-10-26 ✓ 4 Snippets Munoz CJ, Pires IS, Jani V, Gopal S, Palmer AF, Cabrales P.
In-Text Gene Mentions

…lead to secondaryhemochromatosis(i.e., iron overload)…

…as hepatosplenomegaly andhemochromatosis.…

…a reduction ofhemochromatosisassociated with thalassemia.…

…leading to secondaryhemochromatosis.…

Show Full Abstract

β-thalassemia is a genetic hemoglobin (Hb) disorder that affects millions of people world-wide. It is characterized by ineffective erythropoiesis and anemia. The resultant chronic anemia can require life-long blood transfusion regimens, leading to secondary hemochromatosis. Moreover, the abnormal red blood cells (RBCs) from β-thalassemia patients are prone to hemolytic events that release cell-free Hb and heme causing a series of events that result in oxidative organ and tissue damage. In this study, β-thalassemic mice were treated with a protein scavenger for six weeks, apohemoglobin-haptoglobin (apoHb-Hp), this protein scavenges cell free Hb and heme. We hypothesize that scavenging cell-free Hb and heme will lead to a positive therapeutic event. After the apoHb-hp treatment it was observed to reduce the weight of the liver and spleen and show an improvement in liver function by a drop in ALT, AST, and ALP markers. ApoHb-hp treatment also hints at an improved RBC half-life as the number of reticulocytes decreased, the mean corpuscular volume (MCV) increased, mean corpuscular hemoglobin increase and the RBC distribution width decreased. Furthermore, apoHb-Hp treatment reduced circulating serum iron concentration and transferrin saturation concentration. Based on these outcomes, introducing a scavenger protein can benefit β-thalassemic mice. This study demonstrated that apoHb-Hp treatment may be a viable strategy to mitigate toxicities associated with cell free Hb and heme, a driver of β-thalassemic issues.

Also flagged:neurodevelopmental disorderhereditary intellectual disabilityautism spectrum disordersfragile X mental retardation proteinFMRPRNA-binding protein
Journal Article 2022-10-26 ✓ 4 Snippets Couto RR, Kubaski F, Siebert M, Félix TM, Brusius-Facchin AC, Leistner-Segal S.
In-Text Gene Mentions

MiR-125b is involved with GRIN2A downregulation, and this gene encodes an important subunit of NR2A, a subunit of NMDA receptor.11 Variants of GRIN2A have been described as associated with several neurodevelopmental disorders, including epilepsy and ASD.39 Another target gene for miR-125b is SIM1, involved with behavioral disorders, ASD, and obesity in humans.40,41 miR-132 was found to reduce SOX5 mRNA and protein expression.42 Subsequent to this finding, SOX5 had been identified as a novel candidate gene for ASD.43 Furthermore, miR-132-3p was found to target SOX6 and downregulated its protein expression.44SOX6 variants have been reported to cause a neurodevelopmental syndrome associated with attention deficit and hyperactivity disorder.45 Another gene target and downregulated by miR-132 is MAPK1.

…SRY-box 6 (SOX6), mitogen-activated protein…

…found to targetSOX6and downregulated its…

…44SOX6variants have been…

Show Full Abstract

<h4>Background and objectives</h4>Fragile X syndrome (FXS) is a neurodevelopmental disorder, identified as the most common cause of hereditary intellectual disability and monogenic cause of autism spectrum disorders (ASDs), caused by the loss of fragile X mental retardation protein (FMRP). FMRP is an RNA-binding protein, a regulator of translation that plays an important role in neurodevelopment, and its loss causes cognitive and behavioral deficits. MicroRNAs (miRNAs) are small molecules that regulate gene expression in diverse biological processes. Previous studies found that the interaction of FMRP with miR-125b and miR-132 regulates the maturation and synaptic plasticity in animal models and miRNA dysregulation plays a role in the pathophysiology of FXS. The present study aimed to analyze the expression of miR-125b-5p and miR-132-3p in the serum of patients with FXS.<h4>Methods</h4>The expressions of circulating miRNAs were studied in the serum of 10 patients with FXS and 20 controls using the real-time quantitative retrotranscribed method analyzed by relative quantification. Receiver operating characteristic (ROC) curves and the area under the ROC curve (AUC) were generated to assess the diagnostic values of the miRNAs.<h4>Results</h4>We found that both miR-125b and miR-132 were increased in the serum of patients with FXS compared with controls and likely involved with FMRP loss. The AUC (95% confidence interval) of miR-125b and miR-132 was 0.94 (0.86-1.0) and 0.89 (0.77-1.0), respectively. Databases allowed for the identification of possible target genes for miR-125b and miR-132, whose products play an important role in the homeostasis of the nervous system.<h4>Discussion</h4>Our results indicate that serum miR-125b and miR-132 may serve as potential biomarkers for FXS. The increased expression of circulating miR-125b and miR-132 seems to be associated with the genotype of FXS. Predicted gene targets of the differentially regulated miRNAs are involved in cognitive performance and ASD phenotype.<h4>Classification of evidence</h4>This study provides Class III evidence that miR-125b and miR-132 distinguish men with FXS from normal controls.

Also flagged:tumorsCancersimmune responsescancerLGALS9Galectin-9
Journal Article 2022-10-26 ✓ 2 Snippets Murakami K, Miyatake S, Miyamae J, Saeki K, Shinya M, Akashi N, Mitsui I, Kobayashi K, Saeki K, Maeta N, Kanda T, Okamura Y, Hemmi H.
In-Text Gene Mentions

Quantitative RT-PCR (qPCR) analysis revealed that some immune regulatory molecules, such as LGALS9 (coding Galectin-9) and CD48, were expressed in most canine tumors, but other molecules, such as CD274 (coding PD-L1), IL4I1, PVR, TNFSF18, ICOSLG, and TNFSF4, were rarely expressed.

…TNFSF18, ICOSLG, andTNFSF4, were rarely expressed.…

Show Full Abstract

Cancers utilize a variety of molecules to escape host immune responses. Better understanding the immune environment surrounding cancer may facilitate application of innovative cancer immunotherapies, such as immune checkpoint inhibitors, to dogs as well as humans. In this study, we screened the expression of 20 immune regulatory molecules in diverse canine tumors (n = 59). Quantitative RT-PCR (qPCR) analysis revealed that some immune regulatory molecules, such as LGALS9 (coding Galectin-9) and CD48, were expressed in most canine tumors, but other molecules, such as CD274 (coding PD-L1), IL4I1, PVR, TNFSF18, ICOSLG, and TNFSF4, were rarely expressed. NECTIN2 was highly expressed in epithelial tumors but was low in non-epithelial tumors. In contrast, VSIR and CD200 expressions were low in epithelial tumors but high in non-epithelial tumors. Interestingly, several tumors expressed distinctive immunoregulatory factors. Hepatocellular carcinomas expressed FGL1, mast cell tumors expressed PDCD1LG2 (coding PD-L2), transitional cell carcinomas expressed VTCN1 (coding B7x), and lymphomas and squamous cell carcinomas expressed CD70. Consistent with qPCR results, immunofluorescence staining confirmed that hepatocellular carcinomas expressed FGL-1 protein. Thus, this study reveals the expression profile of immunoregulatory molecules in canine tumors and opens the door to better understanding the relationship between canine tumors and host immunity.

Also flagged:exopolysaccharidesfermentationmembranelactosesucrosetrehalose
Journal Article 2022-10-26 No Snippets Jeong SG, Choi IS, Kim HM, Chang JY, Park HW.
Show Full Abstract

Storage stability of freeze-dried lactic acid bacteria is a critical factor for their cost-effectiveness. Long-term storage of lactic acid bacteria enables microbial industry to reduce distribution costs. Herein, we investigated the effect of cold adaptation under supercooling conditions at -5°C on the viability of <i>Leuconostoc mesenteroides</i> WiKim32 during the freeze-drying process and subsequent storage. Cold adaptation increased the thickness of exopolysaccharides (EPS) and improved the viability of freeze-dried <i>Leu. mesenteroides</i> WiKim32. Compared to non-adapted cells, cold-adapted cells showed a 35.4% increase in EPS thickness under supercooling conditions. The viability of EPS-hydrolyzed cells was lower than that of untreated cells, implying that EPS plays a role in protection during the freeze-drying process. Cold adaptation increased the storage stability of freeze-dried <i>Leu. mesenteroides</i> WiKim32. Fifty-six days after storage, the highest viability (71.3%) was achieved with cold adaptation at -5°C. When EPS-containing broth was added prior to the freeze-drying process, the viability further increased to 82.7%. These results imply that cold adaptation by supercooling pretreatment would be a good strategy for the long-term storage of <i>Leu. mesenteroides</i> WiKim32.

Also flagged:phosphorusmagnesiumcalciumalkali metalswaterphosphates
Journal Article 2022-10-26 No Snippets Jetsrisuparb K, Jeejaila T, Saengthip C, Kasemsiri P, Ngernyen Y, Chindaprasirt P, Knijnenburg JTN.
Show Full Abstract

The presence of magnesium (Mg) and calcium (Ca) in biochar-based fertilizers is linked to the slow release of phosphorus (P), but these alkali metals have not been systematically compared under identical conditions. In this study, sugarcane filter cake was treated with H<sub>3</sub>PO<sub>4</sub> and MgO or CaO followed by pyrolysis at 600 °C to produce a Mg/P-rich biochar (MgPA-BC) and a Ca/P-rich biochar (CaPA-BC), respectively. The P-loaded biochars were studied by extraction and kinetic release in water over 240 hours to assess the potential P availability. X-ray diffraction and Fourier-transform infrared (FTIR) spectroscopy were used to characterize the pristine and post-kinetics biochars to identify the responsible phases for phosphate release. Additionally, the dissolved P concentrations in the kinetic release experiment were compared to thermodynamic solubility calculations of common Mg and Ca phosphates. Both MgPA-BC and CaPA-BC had P loadings of 73-74 g kg<sup>-1</sup> but showed distinctly different release behaviors. Phosphate dissolution from MgPA-BC was gradual and reached 10 g P per kg biochar after 240 hours, with rate-determining phases being Mg<sub>2</sub>P<sub>2</sub>O<sub>7</sub> (Mg pyrophosphate), MgNH<sub>4</sub>PO<sub>4</sub>·6H<sub>2</sub>O (struvite), and Mg<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>·22H<sub>2</sub>O (cattiite). In contrast, CaPA-BC only released 1.2 g P per kg biochar. Phosphate release from CaPA-BC was limited by the low solubility of Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> (Ca pyrophosphate) and (Ca,Mg)<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub> (whitlockite). Co-pyrolysis with MgO retained P in a more soluble and available form than CaO, making MgO a preferential additive over CaO to immobilize phytoavailable P in biochar-based fertilizers with higher fertilizer effectiveness.

Also flagged:waterNPCdegradationslithium
Journal Article 2022-10-26 ✓ 1 Snippet Desalegn B, Gebeyehu D, Tamirat B.
In-Text Gene Mentions

…These includeDCC[ 20 ,…

Show Full Abstract

Nowadays, engineers are toiling away to achieve the maximum possible wind energy harvesting with low costs through enhancing the performances of WECSs in efforts to realize the wind power future forecasts. In fact, achieving this is basically not an easy task due to the intricacies that partly stem from the stochastic nature of wind energy. Further, the efforts in this regard can also be impacted by the ongoing trends in various wind energy conversion-related technologies, and engineering approaches. Hence, the wind power optimization is determined depending on the types of WECS technologies, output power smoothing, and design development approaches that be employed. Currently, the variable speed operations-based WECS technologies are generally opted in wind farm applications. Meanwhile, power management system is the heart of a WECS, where smoothing output power with reducing costs could be implemented. On the other hand, the automated control strategies were reported in literatures to better optimize WECSs' performances particularly in terms of costs compared to ESS devices. On this basis, MBPC and hybrid control algorithms were commonly presented as the current state-of-the-art for systems modeling, whereas MBD was preferred to be an efficient and cost-saving approach for advanced development of automated control systems. This study aims to conduct comparative analyses on WECS technologies (with different generators, and PECs) based on their energy harvesting capability, cost-effectiveness, and advances in designs. Assessments of the approaches and strategies for smoothing power production are also presented. Finally, the study concludes that trends in PECs, automated control strategies and MBD are the most compelling.

Also flagged:Serotonin5-hydroxytryptaminenoradrenaline5-HT transportersNA transportersNAT
Journal Article 2022-10-26 ✓ 5 Snippets Griebsch NI, Kern J, Hansen J, Rullmann M, Luthardt J, Helfmeyer S, Dekorsy FJ, Soeder M, Hankir MK, Zientek F, Becker GA, Patt M, Meyer PM, Dietrich A, Blüher M, Ding YS, Hilbert A, Sabri O, Hesse S.
In-Text Gene Mentions

While manipulations that alter brain serotoninergic signaling clearly affect body weight, studies implicating 5-HT transporters and NA transporters (5-HTT and NAT, respectively) as a main drug treatment target for human obesity have not been conclusive.

Sibutramine, an anorexic drug affecting both 5-HT and NA tone by inhibiting 5-HTT and NAT has shown good therapeutic efficacy with regard to weight reduction in the treatment of severe obesity [25].

Contrary to the hypothesis of simply blocking both transporter sites, previous research indicated that 5-HTT and NAT behave differently in overweight and obesity.

According to these observations, both 5-HTT and NAT availability change with alterations in body weight and subsequently are not stable traits in obesity.

The aim of the present study was to elucidate over a broad range of BMI (normal-weight to severe obesity) whether changes in BMI are associated with changes in central 5-HT as well as NA transmission, specifically with changes in 5-HTT and NAT availability before and after 6 months of dietary intervention or RYGB surgery.

Show Full Abstract

Serotonin (5-hydroxytryptamine, 5-HT) as well as noradrenaline (NA) are key modulators of various fundamental brain functions including the control of appetite. While manipulations that alter brain serotoninergic signaling clearly affect body weight, studies implicating 5-HT transporters and NA transporters (5-HTT and NAT, respectively) as a main drug treatment target for human obesity have not been conclusive. The aim of this positron emission tomography (PET) study was to investigate how these central transporters are associated with changes of body weight after 6 months of dietary intervention or Roux-en-Y gastric bypass (RYGB) surgery in order to assess whether 5-HTT as well as NAT availability can predict weight loss and consequently treatment success. The study population consisted of two study cohorts using either the 5-HTT-selective radiotracer [11C]DASB to measure 5-HTT availability or the NAT-selective radiotracer [11C]MRB to assess NAT availability. Each group included non-obesity healthy participants, patients with severe obesity (body mass index, BMI, >35 kg/m2) following a conservative dietary program (diet) and patients undergoing RYGB surgery within a 6-month follow-up. Overall, changes in BMI were not associated with changes of both 5-HTT and NAT availability, while 5-HTT availability in the dorsal raphe nucleus (DRN) prior to intervention was associated with substantial BMI reduction after RYGB surgery and inversely related with modest BMI reduction after diet. Taken together, the data of our study indicate that 5-HTT and NAT are involved in the pathomechanism of obesity and have the potential to serve as predictors of treatment outcomes.

Also flagged:CancerNeurotoxicitygene expressionlysinehistoneHDACs
Journal Article 2022-10-26 ✓ 2 Snippets Squarzoni A, Scuteri A, Cavaletti G.
In-Text Gene Mentions

In another in vivo model of HD, the involvement of HDAC3 is linked to aberrant transcriptional patterns, expansion in the huntingtin (Htt) gene and the negative regulation of genes involved in cognitive functions [19].

observed an association between HDAC4 and mutant Htt in HD, with the formation of cytoplasmic inclusions [45].

Show Full Abstract

Histone deacetylases (HDACs) are a group of enzymes that modify gene expression through the lysine acetylation of both histone and non-histone proteins, leading to a broad range of effects on various biological pathways. New insights on this topic broadened the knowledge on their biological activity and even more questions arose from those discoveries. The action of HDACs is versatile in biological pathways and, for this reason, inhibitors of HDACs (HDACis) have been proposed as a way to interfere with HDACs' involvement in tumorigenesis. In 2006, the first HDACi was approved by FDA for the treatment of cutaneous T-cell lymphoma; however, more selective HDACis were recently approved. In this review, we will consider new information on HDACs' expression and their regulation for the treatment of central and peripheral nervous system diseases.

Also flagged:neurodegenerative disorderHuntingtinHDcognitive declinemyelinaxons
Journal Article 2022-10-26 ✓ 5 Snippets Sun Y, Tong H, Yang T, Liu L, Li XJ, Li S.
In-Text Gene Mentions

HTT is a large protein of 3144 amino acids that can interact with numerous intracellular interactors, which allows HTT protein to participate in diverse cellular functions, including transcription, intracellular transport, cell metabolism, and homeostasis [3].

The genetic cause of HD is an expanded CAG trinucleotide repeat (>35) in the HTT gene encoding an abnormally long polyglutamine (polyQ) tract in the huntingtin (HTT) protein [1,2].

R6/2 mice are the most extensively studied HD mouse model and express a human HTT exon1 with 135 CAG repeats, driven by the human HTT promoter.

However, HD KI mice express full-length mutant HTT protein at the endogenous level, but have longer life span, milder and much later-onset of phenotypes.

Huang et al. generated the PLP-HD transgenic mice, which express N-terminal 208 amino acids of HTT with 150Q selectively in oligodendrocytes and found that these mice had an early onset of phenotypes with severe myelin degeneration, suggesting an autonomous mHTT effect in the oligodendrocytes [53].

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant inherited progressive neurodegenerative disorder. It is caused by a CAG repeat expansion in the Huntingtin gene that is translated to an expanded polyglutamine (PolyQ) repeat in huntingtin protein. HD is characterized by mood swings, involuntary movement, and cognitive decline in the late disease stage. HD patients often die 15-20 years after disease onset. Currently, there is no cure for HD. Due to the striking neuronal loss in HD, most studies focused on the investigation of the predominantly neuronal degeneration in specific brain regions. However, the pathology of the white matter area in the brains of HD patients was also reported by clinical imaging studies, which showed white matter abnormalities even before the clinical onset of HD. Since oligodendrocytes form myelin sheaths around the axons in the brain, white matter lesions are likely attributed to alterations in myelin and oligodendrocyte-associated changes in HD. In this review, we summarized the evidence for white matter, myelin, and oligodendrocytes alterations that were previously observed in HD patients and animal models. We also discussed potential mechanisms for white matter changes and possible treatment to prevent glial dysfunction in HD.

Also flagged:ManganeseOxaliplatinNeuropathyoxygenmitochondrialmetabolism
Journal Article 2022-10-26 No Snippets Prieux-Klotz C, Chédotal H, Zoumpoulaki M, Chouzenoux S, Chêne C, Lopez-Sanchez A, Thomas M, Ranjan Sahoo P, Policar C, Batteux F, Bertrand HC, Nicco C, Coriat R.
Show Full Abstract

Reactive oxygen species (ROS) are produced by every aerobic cell during mitochondrial oxidative metabolism as well as in cellular response to xenobiotics, cytokines, and bacterial invasion. Superoxide Dismutases (SOD) are antioxidant proteins that convert superoxide anions (O<sub>2</sub><sup>•-</sup>) to hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) and dioxygen. Using the differential in the level of oxidative stress between normal and cancer cells, SOD mimetics can show an antitumoral effect and prevent oxaliplatin-induced peripheral neuropathy. New Pt(IV) conjugate prodrugs (OxPt-x-Mn1C1A (x = 1, 1-OH, 2)), combining oxaliplatin and a Mn SOD mimic (MnSODm Mn1C1A) with a covalent link, were designed. Their stability in buffer and in the presence of sodium ascorbate was studied. In vitro, their antitumoral activity was assessed by the viability and ROS production of tumor cell lines (CT16, HCT 116, KC) and fibroblasts (primary culture and NIH 3T3). In vivo, a murine model of colorectal cancer was created with subcutaneous injection of CT26 cells in Balb/c mice. Tumor size and volume were measured weekly in four groups: vehicle, oxaliplatin, and oxaliplatin associated with MnSODm Mn1C1A and the bis-conjugate OxPt-2-Mn1C1A. Oxaliplatin-induced peripheral neuropathy (OIPN) was assessed using a Von Frey test reflecting chronic hypoalgesia. Tolerance to treatment was assessed with a clinical score including four items: weight loss, weariness, alopecia, and diarrhea. In vitro, Mn1C1A associated with oxaliplatin and Pt(IV) conjugates treatment induced significantly higher production of H<sub>2</sub>O<sub>2</sub> in all cell lines and showed a significant improvement of the antitumoral efficacy compared to oxaliplatin alone. In vivo, the association of Mn1C1A to oxaliplatin did not decrease its antitumoral activity, while OxPt-2-Mn1C1A had lower antitumoral activity than oxaliplatin alone. Mn1C1A associated with oxaliplatin significantly decreased OIPN and also improved global clinical tolerance of oxaliplatin. A neuroprotective effect was observed, associated with a significantly improved tolerance to oxaliplatin without impairing its antitumoral activity.

Also flagged:Ferritin Heavy ChainPeroxiredoxin 6HFerritinFTH1iron
Journal Article 2022-10-26 ✓ 5 Snippets Di Sanzo M, Cozzolino F, Battaglia AM, Aversa I, Monaco V, Sacco A, Biamonte F, Palmieri C, Procopio F, Santamaria G, Ortuso F, Pucci P, Monti M, Faniello MC.
In-Text Gene Mentions

So, our findings demonstrate the inhibitory effects of FTH1 on PRDX6 and suggest a new potential therapeutic target for the development of novel therapeutic strategies for the treatments of such cancers overexpressing PRDX6.

Furthermore, to verify if the interaction between FTH1 and PRDX6 is independent by cell lines, we replicated the same experiment in non-small cell lung cancer (NSCLC) NCI-H460 cells, transiently transfected with 3xFlag-FTH1 or 3xFlag control vector.

Then, the results so far obtained suggested that the interaction between FTH1/PRDX6 in cancer cells might alter cell proliferation and migration, leading to a less invasive phenotype.

…the peroxiredoxin family (PRDX6), an antioxidant enzyme…

…The FTH1/PRDX6interaction was further…

Show Full Abstract

The H Ferritin subunit (FTH1), as well as regulating the homeostasis of intracellular iron, is involved in complex pathways that might promote or inhibit carcinogenesis. This function may be mediated by its ability to interact with different molecules. To gain insight into the FTH1 interacting molecules, we analyzed its interactome in HEK293T cells. Fifty-one proteins have been identified, and among them, we focused our attention on a member of the peroxiredoxin family (PRDX6), an antioxidant enzyme that plays an important role in cell proliferation and in malignancy development. The FTH1/PRDX6 interaction was further supported by co-immunoprecipitation, in HEK293T and H460 cell lines and by means of computational methods. Next, we demonstrated that FTH1 could inhibit PRDX6-mediated proliferation and migration. Then, the results so far obtained suggested that the interaction between FTH1/PRDX6 in cancer cells might alter cell proliferation and migration, leading to a less invasive phenotype.

Also flagged:furunculosisinfectiongene expressioncomplement activationcytoskeletonSystemic Infection
Journal Article 2022-10-26 ✓ 1 Snippet Chakraborty S, Hossain A, Cao T, Gnanagobal H, Segovia C, Hill S, Monk J, Porter J, Boyce D, Hall JR, Bindea G, Kumar S, Santander J.
In-Text Gene Mentions

…, plasminogen ,antithrombin-III) and spleen…

Show Full Abstract

Lumpfish is utilized as a cleaner fish to biocontrol sealice infestations in Atlantic salmon farms. <i>Aeromonas salmonicida</i>, a Gram-negative facultative intracellular pathogen, is the causative agent of furunculosis in several fish species, including lumpfish. In this study, lumpfish were intraperitoneally injected with different doses of <i>A. salmonicida</i> to calculate the LD<sub>50</sub>. Samples of blood, head-kidney, spleen, and liver were collected at different time points to determine the infection kinetics. We determined that <i>A. salmonicida</i> LD<sub>50</sub> is 10<sup>2</sup> CFU per dose. We found that the lumpfish head-kidney is the primary target organ of <i>A. salmonicida</i>. Triplicate biological samples were collected from head-kidney, spleen, and liver pre-infection and at 3- and 10-days post-infection for RNA-sequencing. The reference genome-guided transcriptome assembly resulted in 6246 differentially expressed genes. The <i>de novo</i> assembly resulted in 403,204 transcripts, which added 1307 novel genes not identified by the reference genome-guided transcriptome. Differential gene expression and gene ontology enrichment analyses suggested that <i>A. salmonicida</i> induces lethal infection in lumpfish by uncontrolled and detrimental blood coagulation, complement activation, inflammation, DNA damage, suppression of the adaptive immune system, and prevention of cytoskeleton formation.

Also flagged:Salmonella infectioncell cyclecytoskeletonSE infectionSEinfection
Journal Article 2022-10-26 ✓ 1 Snippet Adetunji A, Casey T, Franco J, Shah D, Fasina Y.
In-Text Gene Mentions

…Whereas,PRDX6, MGST1, and GPX1…

Show Full Abstract

Salmonella enteritidis is a foodborne pathogen that causes high morbidity in poultry. Proteomic analysis by liquid chromatography tandem mass spectrometry (LC-MS/MS) was used to study the effects of Salmonella infection on spleen proteome in broiler chickens. Day-old broilers were assigned to control (CON; n = 60) or Salmonella challenge (CON−SE; n = 60), and gavaged with Tryptic soy agar broth or SE. A subset of chicks was euthanized on D3 and D7 (n = 4/group/day) and the spleen was removed, and rapidly frozen, subsequently proteome was measured using label-free LC-MS/MS. Protein spectra were mapped to Gallus gallus Uniprot database. Differentially abundant proteins (DAP; FDR < 0.05) between days and treatments were identified using ANOVA. Cecal content of Salmonella in CON−SE was 3.37 log10 CFU/g and CON were negative. Across the 16 samples, 2625 proteins were identified. Proteins that decreased in abundance between days mediated cell cycle progression, while those that increased in abundance function in cytoskeleton and mRNA processing. SE infection caused an increase in proteins that mediated redox homeostasis, lysosomal activities, and energy production, while proteins decreased in abundance-mediated developmental progression. Proteomic signatures of spleen suggest SE infection was metabolically costly, and energy was diverted from normal developmental processes to potentiate disease resistance mechanisms.

Also flagged:Moxifloxacinbiofilm-associated infectionslipidacetylcysteinepolyurethane
Journal Article 2022-10-26 No Snippets Pinto RM, Seabra CL, De Jonge M, Martins MCL, Van Dijck P, Reis S, Nunes C.
Show Full Abstract

Bacterial biofilms of <i>Staphylococcus aureus</i>, formed on implants, have a massive impact on the increasing number of antimicrobial resistance cases. The current treatment for biofilm-associated infections is based on the administration of antibiotics, failing to target the biofilm matrix. This work is focused on the development of multiple lipid nanoparticles (MLNs) encapsulating the antibiotic moxifloxacin (MOX). The nanoparticles were functionalized with d-amino acids to target the biofilm matrix. The produced formulations exhibited a mean hydrodynamic diameter below 300 nm, a low polydispersity index, and high encapsulation efficiency. The nanoparticles exhibited low cytotoxicity towards fibroblasts and low hemolytic activity. To target bacterial cells and the biofilm matrix, MOX-loaded MLNs were combined with a nanosystem encapsulating a matrix-disruptive agent: N-acetyl-L-cysteine (NAC). The nanosystems alone showed a significant reduction of both <i>S. aureus</i> biofilm viability and biomass, using the microtiter plate biofilm model. Further, biofilms grown inside polyurethane catheters were used to assess the effect of combining MOX-loaded and NAC-loaded nanosystems on biofilm viability. An increased antibiofilm efficacy was observed when combining the functionalized MOX-loaded MLNs and NAC-loaded nanosystems. Thus, nanosystems as carriers of bactericidal and matrix-disruptive agents are a promising combinatory strategy towards the eradication of <i>S. aureus</i> biofilms.

Also flagged:Mucoepidermoid Carcinomasmucoepidermoid carcinomahost genometumorp16oncogenes
Journal Article 2022-10-26 ✓ 2 Snippets Gu W, Bhangale A, Heft Neal ME, Smith JD, Brummel C, McHugh JB, Spector ME, Mills RE, Brenner JC.
In-Text Gene Mentions

Importantly, the one HPV16+ tumor expressed high levels of p16, had high expression of HPV16 oncogenes E6 and E7, and displayed a complex integration pattern that included breakpoints into 13 host genes including PIK3AP1, HIPI, OLFM4,SIRT1, ARAP2, TMEM161B-AS1, and EPS15L1 as well as 9 non-genic regions.

…PIK3AP1 , HIPI,OLFM4, SIRT1 , ARAP2…

Show Full Abstract

Mucoepidermoid Carcinomas (MEC) represent the most common malignancies of salivary glands. Approximately 50% of all MEC cases are known to harbor <i>CRTC1/3-MAML2</i> gene fusions, but the additional molecular drivers remain largely uncharacterized. Here, we sought to resolve controversy around the role of human papillomavirus (HPV) as a potential driver of mucoepidermoid carcinoma. Bioinformatics analysis was performed on 48 MEC transcriptomes. Subsequent targeted capture DNA sequencing was used to annotate HPV content and integration status in the host genome. HPV of any type was only identified in 1/48 (2%) of the MEC transcriptomes analyzed. Importantly, the one HPV16+ tumor expressed high levels of p16, had high expression of HPV16 oncogenes E6 and E7, and displayed a complex integration pattern that included breakpoints into 13 host genes including <i>PIK3AP1</i>, <i>HIPI,</i>&nbsp;<i>OLFM4,</i><i>SIRT1</i>, <i>ARAP2</i>, <i>TMEM161B-AS1,</i> and <i>EPS15L1</i> as well as 9 non-genic regions. In this cohort, HPV is a rare driver of MEC but may have a substantial etiologic role in cases that harbor the virus. Genetic mechanisms of host genome integration are similar to those observed in other head and neck cancers.

Also flagged:importin 4importin 5bindingkaryopherinslocalizationImportins
Journal Article 2022-10-26 ✓ 2 Snippets Panagiotopoulos AA, Kalyvianaki K, Tsodoulou PK, Darivianaki MN, Dellis D, Notas G, Daskalakis V, Theodoropoulos PA, Panagiotidis CΑ, Castanas E, Kampa M.
In-Text Gene Mentions

…tyrosine kinase substrate),HTT(huntingtin), TCP11L1 (…

…protein L7) andHTT(Huntingtin), previously repor…

Show Full Abstract

Nuclear translocation of large proteins is mediated through karyopherins, carrier proteins recognizing specific motifs of cargo proteins, known as nuclear localization signals (NLS). However, only few NLS signals have been reported until now. In the present work, NLS signals for Importins 4 and 5 were identified through an unsupervised <i>in silico</i> approach, followed by experimental <i>in vitro</i> validation. The sequences LPPRS(G/P)P and KP(K/Y)LV were identified and are proposed as recognition motifs for Importins 4 and 5 binding, respectively. They are involved in the trafficking of important proteins into the nucleus. These sequences were validated in the breast cancer cell line T47D, which expresses both Importins 4 and 5. Elucidating the complex relationships of the nuclear transporters and their cargo proteins is very important in better understanding the mechanism of nuclear transport of proteins and laying the foundation for the development of novel therapeutics, targeting specific importins.

Also flagged:centralsystemCNSmonogeneticneurodegenerative disorderstransduction
Journal Article 2022-10-26 ✓ 3 Snippets Zhou K, Han J, Wang Y, Zhang Y, Zhu C.
In-Text Gene Mentions

…carrying miRNA targetingHtt(AAV5- miHtt )…

…achieve widespread miRNA-Httin the striatum…

…thus preventing mutantHttaggravation and neuronal…

Show Full Abstract

Gene therapy is a powerful tool to treat various central nervous system (CNS) diseases ranging from monogenetic diseases to neurodegenerative disorders. Adeno-associated viruses (AAVs) have been widely used as the delivery vehicles for CNS gene therapies due to their safety, CNS tropism, and long-term therapeutic effect. However, several factors, including their ability to cross the blood-brain barrier, the efficiency of transduction, their immunotoxicity, loading capacity, the choice of serotype, and peripheral off-target effects should be carefully considered when designing an optimal AAV delivery strategy for a specific disease. In addition, distinct routes of administration may affect the efficiency and safety of AAV-delivered gene therapies. In this review, we summarize different administration routes of gene therapies delivered by AAVs to the brain in mice and rats. Updated knowledge regarding AAV-delivered gene therapies may facilitate the selection from various administration routes for specific disease models in future research.

Also flagged:cell cycleCX-5461RNA polymerase Ilipopolysaccharideinterferon-γIL-1β
Journal Article 2022-10-26 No Snippets Wang J, Zheng Z, Cui X, Dai C, Li J, Zhang Q, Cheng M, Jiang F.
Show Full Abstract

CX-5461, a novel selective RNA polymerase I inhibitor, shows potential anti-inflammatory and immunosuppressive activities. However, the molecular mechanisms underlying the inhibitory effects of CX-5461 on macrophage-mediated inflammation remain to be clarified. In the present study, we attempted to identify the systemic biological processes which were modulated by CX-5461 in inflammatory macrophages. Primary peritoneal macrophages were isolated from normal Sprague Dawley rats, and primed with lipopolysaccharide or interferon-γ. Genome-wide RNA sequencing was performed. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases were used for gene functional annotations. Enrichment analysis was conducted using the ClusterProfiler package of R software. We found that CX-5461 principally induced a molecular signature related to cell cycle inhibition in primed macrophages, featuring downregulation of genes encoding cell cycle mediators and concomitant upregulation of cell cycle inhibitors. At the same concentration, however, CX-5461 did not induce a systemic anti-inflammatory transcriptional program, although some inflammatory genes such as IL-1β and gp91phox NADPH oxidase were downregulated by CX-5461. Our data further highlighted a central role of p53 in orchestrating the molecular networks that were responsive to CX-5461 treatment. In conclusion, our study suggested that limiting cell proliferation predominated in the inhibitory effects of CX-5461 on macrophage-mediated inflammation.

Also flagged:diabetesimmune responsesbindingdiabetic complicationstype 1 diabetestype 2 diabetes
Journal Article 2022-10-26 ✓ 1 Snippet Yin W, Zhang Z, Xiao Z, Li X, Luo S, Zhou Z.
In-Text Gene Mentions

Circ_0000712 potentiated HG-caused apoptosis, inflammation, oxidative stress, and fibrosis in DN by targeting the miR-879-5p and regulating SOX6 expression (Zhao et al., 2021).

Show Full Abstract

A novel class of non-coding RNA transcripts called circular RNAs (circRNAs) have been the subject of significant recent studies. Accumulating evidence points that circRNAs play an important role in the cellular processes, inflammatory expression, and immune responses through sponging miRNA, binding, or translating in proteins. Studies have found that circRNAs are involved in the physiologic and pathologic processes of diabetes. There has been an increased focus on the relevance of between abnormal circRNA expression and the development and progression of various types of diabetes and diabetes-related diseases. These circRNAs not only serve as promising diagnostic and prognostic molecular biomarkers, but also have important biological roles in islet cells, diabetes, and its complications. In addition, many circRNA signaling pathways have been found to regulate the occurrence and development of diabetes. Here we comprehensively review and discuss recent advances in our understanding of the physiologic function and regulatory mechanisms of circRNAs on pancreatic islet cells, different subtypes in diabetes, and diabetic complications.

Also flagged:COVID-19measlescytotoxic T-lymphocyte-associated protein 4CTLA4CD28tumor necrosis factor ligand superfamily member 4
Journal Article 2022-10-26 ✓ 5 Snippets Chen DP, Wen YH, Lin WT, Hsu FP.
In-Text Gene Mentions

Therefore, this study conducted a detailed analysis to investigate the association between genes and the second signal for T cell activation and understand the effect of genes on the side effects after vaccination, including cytotoxic T-lymphocyte-associated protein 4 (CTLA4), CD28, tumor necrosis factor ligand superfamily member 4 (TNFSF4), and programmed cell death protein 1 (PDCD1) and the side effects caused by COVID-19 vaccination.

…superfamily member 4 (TNFSF4) and programmed cell…

…and rs1234314 ofTNFSF4were associated with…

…superfamily member 4 (TNFSF4), and programmed cell…

…costimulatory genes (CTLA4,TNFSF4, CD28, and PDCD1)…

Show Full Abstract

People often worry about the side effects after vaccination, reducing the willingness to vaccinate. Thus, we tried to find out the risk of single nucleotide polymorphism (SNP) vaccines to improve the willingness and confidence in vaccination. Allergic and inflammatory reactions are the common vaccine side effects caused by immune system overreaction. In addition, a previous study showed significantly higher frequency of febrile reactions to measles vaccines in American Indians than in Caucasian children, indicating that the side effects varied in accordance with genetic polymorphisms in individuals. Thus, SNPs of immune regulatory genes, cytotoxic T-lymphocyte-associated protein 4 (CTLA4), CD28, tumor necrosis factor ligand superfamily member 4 (TNFSF4) and programmed cell death protein 1 (PDCD1) were included in this study to analyze their association with vaccine side effects. Moreover, 61 healthy participants were asked on the number of doses they received, the brand of the vaccine, and the side effects they suffered. We found that several SNPs were associated with side effects after the first or second dose of mRNA or adenoviral vector vaccines. Furthermore, these SNPs were associated with several autoimmune diseases and cancer types; thus, they played an important role in immune regulation. Moreover, rs3181096 and rs3181098 of CD28, rs733618 and rs3087243 of CTLA, and rs1234314 of TNFSF4 were associated with mild vaccine side effects induced by mRNA and adenoviral vector vaccines, which would play a potential role in vaccine-induced immune responses and may further lead to fatal side effects. These results could serve as a basis for investigating the mechanism of vaccine side effects. Furthermore, it was hoped that these results would address public concerns about the side effects of the COVID-19 vaccination. In clinical application, a rapid screening test can be performed to assess the risk of vaccine side effects before vaccination and provide immediate treatment.

Also flagged:Metastatic castration-resistant prostate cancerCRPCbone metastasesdeathbisphosphonatesandrogen
Journal Article 2022-10-26 No Snippets Chang J, Jiang Z, Ma T, Li J, Chen J, Ye P, Feng L.
Show Full Abstract

Metastatic castration-resistant prostate cancer (CRPC) has long been considered to be associated with patient mortality. Among metastatic organs, bone is the most common metastatic site, with more than 90% of advanced patients developing bone metastases (BMs) before 24 months of death. Although patients were recommended to use bone-targeted drugs represented by bisphosphonates to treat BMs of CRPC, there was no significant improvement in patient survival. In addition, the use of immunotherapy and androgen deprivation therapy is limited due to the immunosuppressed state and resistance to antiandrogen agents in patients with bone metastases. Therefore, it is still essential to develop a safe and effective therapeutic schedule for CRPC patients with BMs. To this end, we propose a multiplex drug repurposing scheme targeting differences in patient immune cell composition. The identified drug candidates were ranked from the perspective of M2 macrophages by integrating transcriptome and network-based analysis. Meanwhile, computational chemistry and clinical trials were used to generate a comprehensive drug candidate list for the BMs of CRPC by drug redundancy structure filtering. In addition to docetaxel, which has been approved for clinical trials, the list includes norethindrone, testosterone, menthol and foretinib. This study provides a new scheme for BMs of CRPC from the perspective of M2 macrophages. It is undeniable that this multiplex drug repurposing scheme specifically for immune cell-related bone metastases can be used for drug screening of any immune-related disease, helping clinicians find promising therapeutic schedules more quickly, and providing reference information for drug R&D and clinical trials.

Also flagged:male infertilityoxygensuperoxide dismutaseSODglutathione peroxidasesperoxiredoxins
Journal Article 2022-10-26 ✓ 1 Snippet O'Flaherty C, Scarlata E.
In-Text Gene Mentions

…capacitation, particularly byPRDX6.…

Show Full Abstract

<h4>In brief</h4>This review focuses on the enzymatic antioxidant mechanisms to fight oxidative stress by spermatozoa, highlighting the differences among mammalian species. We discuss recent evidence about players that promote and fight oxidative stress and the need for novel strategies to diagnose and treat cases of male infertility associated with oxidative damage of the spermatozoon.<h4>Abstract</h4>The spermatozoon is very sensitive to high reactive oxygen species (ROS) levels due to its limited antioxidant system. A consortium of antioxidant enzymes, including superoxide dismutase (SOD), glutathione peroxidases (GPXs), peroxiredoxins (PRDXs), thioredoxins, and glutathione-S-transferases, is necessary to produce healthy spermatozoa and to maintain sperm quality to ensure motility, capacitation, and DNA integrity. A delicate balance between ROS production and antioxidant enzymes is needed to ensure ROS-dependent sperm capacitation. GPX4 is an essential component of the mitochondrial sheath in mammalian spermatozoa, and GPX5 is a crucial antioxidant defence in the mouse epididymis to protect the sperm genome during the maturation of the spermatozoon. The mitochondrial superoxide (O2·-) production is controlled by SOD2, and the hydrogen peroxide (H2O2) generated by SOD2 activity and peroxynitrite (ONOO-) are scavenged mainly by PRDXs in human spermatozoa. PRDXs regulate the redox signalling necessary for sperm motility and capacitation, particularly by PRDX6. This enzyme is the first line of defence against oxidative stress to prevent lipid peroxidation and DNA oxidation by scavenging H2O2 and ONOO- through its peroxidase activity and repairing oxidized membranes by its calcium-independent phospholipase A2 activity. The success of antioxidant therapy in treating infertility resides in the proper diagnosis of the presence of oxidative stress and which type of ROS are produced. Thus, more research on the molecular mechanisms affected by oxidative stress, the development of novel diagnostic tools to identify infertile patients with oxidative stress, and randomized controlled trials are of paramount importance to generate personalized antioxidant therapy to restore male fertility.

bioRxiv 2022-10-26 Preprint (No Snippets API) Elena-Real CA, Sagar A, Urbanek A, Popovic M, Morató A, Estaña A, Fournet A, Lund XL, Shi Z, Costa L, Thureau A, Allemand F, Swenson RE, Milhiet P, Barducci A, Cortés J, Sinnaeve D, Sibille N, Bernadó P.
Show Full Abstract

Huntington’s Disease is a neurodegenerative disorder caused by a CAG expansion of the first exon of the HTT gene, resulting in an extended poly-glutamine (poly-Q) tract in the N-terminus of the protein huntingtin (httex1). The structural changes occurring to the poly-Q when increasing its length remain poorly understood mainly due to its intrinsic flexibility and the strong compositional bias of the protein. The systematic application of site-specific isotopic labeling has enabled residue-specific NMR investigations of the poly-Q tract of pathogenic httex1 variants with 46 and 66 consecutive glutamines. The integrative analysis of the data reveals that the poly-Q tract adopts long α-helical conformations stabilized by glutamine side-chain to backbone hydrogen bonds. 19 F-NMR of site-specifically incorporated fluoro-glutamines and molecular dynamics simulations demonstrate that the mechanism propagating α-helical conformations towards the poly-Q from the upstream N17 domain is independent of the poly-Q track length. Aggregation and atomic force microscopy experiments show that the presence of long and persistent α-helices in the poly-Q tract is a stronger signature in defining the aggregation kinetics and the structure of the resulting fibrils than the number of glutamines. The ensemble of our observations provides a structural perspective of the pathogenicity of expanded httex1 and paves the way to a deeper understanding of poly-Q related diseases.

Also flagged:Phomoxanthone AcancerATP synthasetetrahydroxanthonecisplatinsynthesis
Journal Article 2022-10-25 No Snippets Ali R, Parelkar SS, Thompson PR, Mitroka-Batsford S, Yerramilli S, Scarlata SF, Mistretta KS, Coburn JM, Mattson AE.
Show Full Abstract

Phomoxanthone A is a naturally occurring molecule and a powerful anti-cancer agent, although its mechanism of action is unknown. To facilitate the determination of its biological target(s), we used affinity-based labelling using a phomoxanthone A probe. Labelled proteins were pulled down, subjected to chemoproteomics analysis using LC-MS/MS and ATP synthase was identified as a likely target. Mitochondrial ATP synthase was validated in cultured cells lysates and in live intact cells. Our studies show sixty percent inhibition of ATP synthase by 260 μM phomoxanthone A.

Also flagged:cancersegmentationPolydimethylsiloxaneSiliconalginic acidprostate cancer
Journal Article 2022-10-25 No Snippets Gardner K, Uddin MM, Tran L, Pham T, Vanapalli S, Li W.
Show Full Abstract

Encapsulation of cells inside microfluidic droplets is central to several applications involving cellular analysis. Although, theoretically the encapsulation statistics are expected to follow a Poisson distribution, experimentally this may not be achieved due to lack of full control of the experimental variables and conditions. Therefore, there is a need for automatic detection of droplets and cell count enumeration within droplets so a process control feedback to adjust experimental conditions can be implemented. In this study, we use a deep learning object detector called You Only Look Once (YOLO), an influential class of object detectors with several benefits over traditional methods. This paper investigates the application of both YOLOv3 and YOLOv5 object detectors in the development of an automated droplet and cell detector. Experimental data was obtained from a microfluidic flow focusing device with a dispersed phase of cancer cells. The microfluidic device contained an expansion chamber downstream of the droplet generator, allowing for visualization and recording of cell-encapsulated droplet images. In the procedure, a droplet bounding box is predicted, then cropped from the original image for the individual cells to be detected through a separate model for further examination. The system includes a production set for additional performance analysis with Poisson statistics while providing an experimental workflow with both droplet and cell models. The training set is collected and preprocessed before labeling and applying image augmentations, allowing for a generalizable object detector. Precision and recall were utilized as a validation and test set metric, resulting in a high mean average precision (mAP) metric for an accurate droplet detector. To examine model limitations, the predictions were compared to ground truth labels, illustrating that the YOLO predictions closely matched with the droplet and cell labels. Furthermore, it is demonstrated that droplet enumeration from the YOLOv5 model is consistent with hand counted ratios and the Poisson distribution, confirming that the platform can be used in real-time experiments for cell encapsulation optimization.

Also flagged:tumorstumordeathferroptosisredox homeostasisiron
Journal Article 2022-10-25 No Snippets Wu J, Zhu S, Wang P, Wang J, Huang J, Wang T, Guo L, Liang D, Meng Q, Pan H.
Show Full Abstract

The occurrence of tumors is associated with the upregulation or downregulation of certain genes. The identification of novel tumor therapies has revealed that regulation of tumor cell death can either promote or suppress the occurrence and development of tumors. Iron‑dependent lipid free oxygen radical accumulation causes tumor cells to die by ferroptosis, a form of regulated cell death. Multiple mechanisms mediate this mode of cell death, including redox homeostasis, iron metabolism, mitochondrial activity, breakdown of amino acids, lipids and sugars and epigenetic regulatory and disease‑associated signaling pathways. The present review discussed epigenetic mechanism of ferroptosis with the aim of providing novel insight for optimization of the effects of antitumor therapy.

Also flagged:nonalcoholic fatty liver diseaseNAFLDdeathcardiovascular diseaseCVDcolorectal cancer
Journal Article 2022-10-25 ✓ 2 Snippets Lan Y, Lu Y, Li J, Hu S, Chen S, Wang Y, Yuan X, Liu H, Wang X, Wu S, Wang L.
In-Text Gene Mentions

…C virus infection,hemochromatosis, α‐1 antitrypsin deficiency,…

…[ 47 ]hemochromatosis, [ 48 ]…

Show Full Abstract

The ability to determine the prognosis of lean nonalcoholic fatty liver disease (NAFLD) is essential for decision making in clinical settings. Using a large community-based Chinese cohort, we aimed to investigate NAFLD outcomes by body mass index (BMI). We used the restricted cubic splines method to investigate the dose-response relationship between BMI and outcomes in subjects with NAFLD and those without NAFLD. We included 73,907 subjects from the Kailuan cohort and grouped all subjects into four phenotypes by using NAFLD and BMI (<23 kg/m<sup>2</sup> ). The probability of developing outcomes for individuals with lean NAFLD (LN), overweight/obese NAFLD (ON), overweight/obese non-NAFLD (ONN), and lean non-NAFLD (LNN) was estimated. We found a U-shaped association between BMI and death but a linear positive association concerning cardiovascular disease (CVD) after adjusting for age and other covariates. Compared with the LNN group, the adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of the LN, ON, and ONN groups were 1.30 (1.14-1.49), 0.86 (0.80-0.91), 0.84 (0.80-0.89) for all-cause death, 2.61 (1.13-6.03), 0.74 (0.44-1.26), 1.10 (0.70-1.74) for liver-related death, 2.12 (1.46-3.08), 1.23 (0.99-1.54), 1.19 (0.98-1.43) for digestive system cancers, and 2.04 (1.40-2.96), 1.30 (1.05-1.61), 1.21 (1.01-1.46) for obesity-related cancers. Subjects with LN had a significantly higher risk of colorectal cancer and esophagus cancer. However, the ON group had the highest CVD risk (HR, 1.39; 95% CI, 1.27-1.52). The LN group with hypertension had a higher risk of adverse outcomes, and those without hypertension had a similar risk compared to LNN. Conclusion: Subjects with LN may experience a higher risk of all-cause death, digestive system cancers, and obesity-related cancers than the other three groups but a lower risk of CVD than ON subjects. LN with hypertension may be a high-risk phenotype.

Also flagged:Histone H3extracellularnucleuschromatinextracellular spacedegradation
Journal Article 2022-10-25 No Snippets Tilley DO, Abuabed U, Zimny Arndt U, Schmid M, Florian S, Jungblut PR, Brinkmann V, Herzig A, Zychlinsky A.
Show Full Abstract

Neutrophils are critical to host defence, executing diverse strategies to perform their antimicrobial and regulatory functions. One tactic is the production of neutrophil extracellular traps (NETs). In response to certain stimuli, neutrophils decondense their lobulated nucleus and release chromatin into the extracellular space through a process called NETosis. However, NETosis, and the subsequent degradation of NETs, can become dysregulated. NETs are proposed to play a role in infectious as well as many non-infection related diseases including cancer, thrombosis, autoimmunity and neurological disease. Consequently, there is a need to develop specific tools for the study of these structures in disease contexts. In this study, we identified a NET-specific histone H3 cleavage event and harnessed this to develop a cleavage site-specific antibody for the detection of human NETs. By microscopy, this antibody distinguishes NETs from chromatin in purified and mixed cell samples. It also detects NETs in tissue sections. We propose this antibody as a new tool to detect and quantify NETs.

Also flagged:mTORC1metabolismmechanistic target of rapamycin complex 1protein kinasebiosynthesisdegradation
Journal Article 2022-10-25 ✓ 1 Snippet Zhu J, Wang H, Jiang X.
In-Text Gene Mentions

…PE-binding protein 1 (PEBP1)-mediated LC3 lipidation, was…

Show Full Abstract

The mechanistic target of rapamycin complex 1 (mTORC1), a multi-subunit protein kinase complex, interrogates growth factor signaling with cellular nutrient and energy status to control metabolic homeostasis. Activation of mTORC1 promotes biosynthesis of macromolecules, including proteins, lipids, and nucleic acids, and simultaneously suppresses catabolic processes such as lysosomal degradation of self-constituents and extracellular components. Metabolic regulation has emerged as a critical determinant of various cellular death programs, including apoptosis, pyroptosis, and ferroptosis. In this article, we review the expanding knowledge on how mTORC1 coordinates metabolic pathways to impinge on cell death regulation. We focus on the current understanding on how nutrient status and cellular signaling pathways connect mTORC1 activity with ferroptosis, an iron-dependent cell death program that has been implicated in a plethora of human diseases. In-depth understanding of the principles governing the interaction between mTORC1 and cell death pathways can ultimately guide the development of novel therapies for the treatment of relevant pathological conditions.

Also flagged:YapTazosteogenesischondrogenesistranscriptional regulatorsbinding
Journal Article 2022-10-25 ✓ 1 Snippet Zhao X, Tang L, Le TP, Nguyen BH, Chen W, Zheng M, Yamaguchi H, Dawson B, You S, Martinez-Traverso IM, Erhardt S, Wang J, Li M, Martin JF, Lee BH, Komatsu Y, Wang J.
In-Text Gene Mentions

Sox6

Show Full Abstract

Neural crest cells (NCCs) are multipotent stem cells that can differentiate into multiple cell types, including the osteoblasts and chondrocytes, and constitute most of the craniofacial skeleton. Here, we show through in vitro and in vivo studies that the transcriptional regulators Yap and Taz have redundant functions as key determinants of the specification and differentiation of NCCs into osteoblasts or chondrocytes. Primary and cultured NCCs deficient in <i>Yap</i> and <i>Taz</i> switched from osteogenesis to chondrogenesis, and NCC-specific deficiency for <i>Yap</i> and <i>Taz</i> resulted in bone loss and ectopic cartilage in mice. Yap bound to the regulatory elements of key genes that govern osteogenesis and chondrogenesis in NCCs and directly regulated the expression of these genes, some of which also contained binding sites for the TCF/LEF transcription factors that interact with the Wnt effector β-catenin. During differentiation of NCCs in vitro and NCC-derived osteogenesis in vivo, Yap and Taz promoted the expression of osteogenic genes such as <i>Runx2</i> and <i>Sp7</i> but repressed the expression of chondrogenic genes such as <i>Sox9</i> and <i>Col2a1</i>. Furthermore, Yap and Taz interacted with β-catenin in NCCs to coordinately promote osteoblast differentiation and repress chondrogenesis. Together, our data indicate that Yap and Taz promote osteogenesis in NCCs and prevent chondrogenesis, partly through interactions with the Wnt-β-catenin pathway.

Also flagged:oxygenorganizationsleepneurological disordersalcoholnicotine
Journal Article 2022-10-25 No Snippets Ochab JK, Wątorek M, Ceglarek A, Fafrowicz M, Lewandowska K, Marek T, Sikora-Wachowicz B, Oświęcimka P.
Show Full Abstract

We applied detrended fluctuation analysis, power spectral density, and eigenanalysis of detrended cross-correlations to investigate fMRI data representing a diurnal variation of working memory in four visual tasks: two verbal and two nonverbal. We show that the degree of fractal scaling is regionally dependent on the engagement in cognitive tasks. A particularly apparent difference was found between memorisation in verbal and nonverbal tasks. Furthermore, the detrended cross-correlations between brain areas were predominantly indicative of differences between resting state and other tasks, between memorisation and retrieval, and between verbal and nonverbal tasks. The fractal and spectral analyses presented in our study are consistent with previous research related to visuospatial and verbal information processing, working memory (encoding and retrieval), and executive functions, but they were found to be more sensitive than Pearson correlations and showed the potential to obtain other subtler results. We conclude that regionally dependent cognitive task engagement can be distinguished based on the fractal characteristics of BOLD signals and their detrended cross-correlation structure.

Also flagged:Chromosomeautosomessex chromosomeschromosomesdosage compensationnucleotide
Journal Article 2022-10-25 No Snippets Geneva AJ, Park S, Bock DG, de Mello PLH, Sarigol F, Tollis M, Donihue CM, Reynolds RG, Feiner N, Rasys AM, Lauderdale JD, Minchey SG, Alcala AJ, Infante CR, Kolbe JJ, Schluter D, Menke DB, Losos JB.
Show Full Abstract

Rapid technological improvements are democratizing access to high quality, chromosome-scale genome assemblies. No longer the domain of only the most highly studied model organisms, now non-traditional and emerging model species can be genome-enabled using a combination of sequencing technologies and assembly software. Consequently, old ideas built on sparse sampling across the tree of life have recently been amended in the face of genomic data drawn from a growing number of high-quality reference genomes. Arguably the most valuable are those long-studied species for which much is already known about their biology; what many term emerging model species. Here, we report a highly complete chromosome-scale genome assembly for the brown anole, Anolis sagrei - a lizard species widely studied across a variety of disciplines and for which a high-quality reference genome was long overdue. This assembly exceeds the vast majority of existing reptile and snake genomes in contiguity (N50 = 253.6 Mb) and annotation completeness. Through the analysis of this genome and population resequence data, we examine the history of repetitive element accumulation, identify the X chromosome, and propose a hypothesis for the evolutionary history of fusions between autosomes and the X that led to the sex chromosomes of A. sagrei.

Also flagged:Huntington's diseaseHDfrontotemporal dementiaamyotrophic lateral sclerosisALSpolymerase
Journal Article 2022-10-25 ✓ 4 Snippets Manini A, Gagliardi D, Meneri M, Antognozzi S, Del Bo R, Scaglione C, Comi GP, Corti S, Ronchi D.
In-Text Gene Mentions

In this scenario, we performed a screening analysis of CAG repeats in HTT in our cohort of ALS patients, to further assess huntingtin role in motor neuron disorders (MNDs).

Thomas and colleagues have recently challenged this finding, highlighting several points which argue against the role of HTT pathogenic expansions in FTD/ALS.4

…alleles in theHTTgene (42 and…

…direct involvement ofHTTin ALS pathogenesis,…

Show Full Abstract

HTT full-penetrance pathogenic repeat expansions, the genetic cause of Huntington's disease (HD), have been recently reported in a minority of frontotemporal dementia/amyotrophic lateral sclerosis (ALS) patients (0.13%). We analyzed HTT CAG repeats in an Italian cohort of ALS patients (n = 467) by repeat-primed polymerase chain reaction. One patient harbored two expanded alleles in the HTT gene (42 and 37 CAG repeats). The absence of HD typical symptoms and the clinical picture consistent with ALS, corroborated by the diagnostic assessment, apparently excluded a misdiagnosis of HD.

Also flagged:IronAlcohol-associated liver diseasechronic liver diseaseAlcoholic liver steatosissteatohepatitisliver fibrosis
Journal Article 2022-10-25 ✓ 5 Snippets Ali N, Ferrao K, Mehta KJ.
In-Text Gene Mentions

…conditions, such ashemochromatosisand nonalcoholic fatty…

Hemochromatosisis an iron-overload…

…For patients withhemochromatosiswho show high…

…in case ofhemochromatosis, where not all…

…iron-overloaded patients withhemochromatosis, it is not…

Show Full Abstract

Alcohol-associated liver disease (ALD) is a common chronic liver disease with increasing incidence worldwide. Alcoholic liver steatosis/steatohepatitis can progress to liver fibrosis/cirrhosis, which can cause predisposition to hepatocellular carcinoma. ALD diagnosis and management are confounded by several challenges. Iron loading is a feature of ALD which can exacerbate alcohol-induced liver injury and promote ALD pathologic progression. Knowledge of the mechanisms that mediate liver iron loading can help identify cellular/molecular targets and thereby aid in designing adjunct diagnostic, prognostic, and therapeutic approaches for ALD. Herein, the cellular mechanisms underlying alcohol-induced liver iron loading are reviewed and how excess iron in patients with ALD can promote liver fibrosis and aggravate disease pathology is discussed. Alcohol-induced increase in hepatic transferrin receptor-1 expression and up-regulation of high iron protein in Kupffer cells (proposed) facilitate iron deposition and retention in the liver. Iron is loaded in both parenchymal and nonparenchymal liver cells. Iron-loaded liver can promote ferroptosis and thereby contribute to ALD pathology. Iron and alcohol can independently elevate oxidative stress. Therefore, a combination of excess iron and alcohol amplifies oxidative stress and accelerates liver injury. Excess iron-stimulated hepatocytes directly or indirectly (through Kupffer cell activation) activate the hepatic stellate cells via secretion of proinflammatory and profibrotic factors. Persistently activated hepatic stellate cells promote liver fibrosis, and thereby facilitate ALD progression.

Also flagged:immune responseCOVID-19infectionpathogenesisORF7aORF7b
Journal Article 2022-10-25 ✓ 1 Snippet García-García T, Fernández-Rodríguez R, Redondo N, de Lucas-Rius A, Zaldívar-López S, López-Ayllón BD, Suárez-Cárdenas JM, Jiménez-Marín Á, Montoya M, Garrido JJ.
In-Text Gene Mentions

…PCDHGB5, PCDH10, andPCDH17), and catenins…

Show Full Abstract

SARS-CoV-2, the causative agent of the present COVID-19 pandemic, possesses eleven accessory proteins encoded in its genome, and some have been implicated in facilitating infection and pathogenesis through their interaction with cellular components. Among these proteins, accessory protein ORF7a and ORF7b functions are poorly understood. In this study, A549 cells were transduced to express ORF7a and ORF7b, respectively, to explore more in depth the role of each accessory protein in the pathological manifestation leading to COVID-19. Bioinformatic analysis and integration of transcriptome results identified defined canonical pathways and functional groupings revealing that after expression of ORF7a or ORF7b, the lung cells are potentially altered to create conditions more favorable for SARS-CoV-2, by inhibiting the IFN-I response, increasing proinflammatory cytokines release, and altering cell metabolic activity and adhesion. Based on these results, it is plausible to suggest that ORF7a or ORF7b could be used as biomarkers of progression in this pandemic.

Also flagged:GPX2Wntprostate cancerPCaGene Expressionglutathione peroxidase 2
Journal Article 2022-10-25 No Snippets Yang M, Zhu X, Shen Y, He Q, Qin Y, Shao Y, Yuan L, Ye H.
Show Full Abstract

<h4>Objective</h4>This study aimed to establish a prognostic model related to prostate cancer (PCa) recurrence-free survival (RFS) and identify biomarkers.<h4>Methods</h4>The RFS prognostic model and key genes associated with PCa were established using Least Absolute Shrinkage and Selection Operator (LASSO) and Cox regression from the Cancer Genome Atlas (TCGA)-PRAD and the Gene Expression Omnibus (GEO) GSE46602 datasets. The weighted gene co-expression network (WGCNA) was used to analyze the obtained key modules and genes, and gene set enrichment analysis (GSEA) was performed. The phenotype and mechanism were verified in vitro.<h4>Results</h4>A total of 18 genes were obtained by LASSO regression, and an RFS model was established and verified (TCGA, AUC: 0.774; GSE70768, AUC: 0.759). Three key genes were obtained using multivariate Cox regression. WGCNA analysis obtained the blue module closely related to the Gleason score (cor = -0.22, <i>P</i> = 3.3<i>e</i> - 05) and the unique gene glutathione peroxidase 2 (GPX2). Immunohistochemical analysis showed that the expression of GPX2 was significantly higher in patients with PCa than in patients with benign prostatic hyperplasia (<i>P</i> < 0.05), but there was no significant correlation with the Gleason score (GSE46602 and GSE6919 verified), which was also verified in the GSE46602 and GSE6919 datasets. The GSEA results showed that GPX2 expression was mainly related to the epithelial-mesenchymal transition (EMT) and Wnt pathways. Additionally, GPX2 expression significantly correlated with eight kinds of immune cells. In human PCa cell lines LNCaP and 22RV1, si-GPX2 inhibited proliferation and invasion, and induced apoptosis when compared with si-NC. The protein expression of Wnt3a, glycogen synthase kinase 3β (GSK3β), phosphorylated (p)-GSK3β, β-catenin, p-β-catenin, c-myc, cyclin D1, and vimentin decreased; the expression of E-cadherin increased; and the results for over-GPX2 were opposite to those for over-NC. The protein expression of GPX2 decreased, and β-catenin was unchanged in the si-GPX2+ SKL2001 group compared with the si-NC group.<h4>Conclusion</h4>We successfully constructed the PCa RFS prognostic model, obtained RFS-related biomarker GPX2, and found that GPX2 regulated PCa progression and triggered Wnt/β-catenin/EMT pathway molecular changes.

Also flagged:neuromuscular diseaseCNMPtosisrespiratory insufficiencymyopathyDNM2
Journal Article 2022-10-25 ✓ 1 Snippet Hayes LH, Perdomini M, Aykanat A, Genetti CA, Paterson HL, Cowling BS, Freitag C, Beggs AH.
In-Text Gene Mentions

…patient had concurrenthemochromatosis, but otherwise no…

Show Full Abstract

<h4>Background and objectives</h4>Centronuclear myopathy (CNM) due to mutations in the dynamin 2 gene, <i>DNM2</i>, is a rare neuromuscular disease about which little is known. The objective of this study was to describe the range of clinical presentations and subsequent natural history of <i>DNM2</i>-related CNM.<h4>Methods</h4>Pediatric and adult patients with suspicion for a CNM diagnosis and confirmed heterozygous pathogenic variants in <i>DNM2</i> were ascertained between December 8, 2000, and May 1, 2019. Data were collected through a retrospective review of genetic testing results, clinical records, and pathology slides combined with patient-reported clinical findings via questionnaires.<h4>Results</h4>Forty-two patients with <i>DNM2</i>-related CNM, whose ages ranged from 0.95 to 75.76 years at most recent contact, were enrolled from 34 families in North or South America and Europe. There were 8 different <i>DNM2</i> pathogenic variants within the cohort. Of the 32 biopsied patients, all had histologic features of CNM. The disease onset was in infancy or childhood in 81% of the cohort, and more than half of the patients had high arched palates, indicative of weakness in utero. Ambulation was affected in nearly all (92%) the patients, and while the rapidity of progression was variable, most (67%) reported a "deteriorating course." Ptosis, ophthalmoparesis, facial weakness, dysphagia, and respiratory insufficiency were commonly reported. One-third of the patients experienced restricted jaw mobility. Certain pathogenic variants appear to correlate with a more severe phenotype.<h4>Discussion</h4><i>DNM2</i>-related CNM has a predominantly early-onset, often congenital, myopathy resulting in progressive difficulty with ambulation and occasionally bulbar and respiratory dysfunction. This detailed characterization of the phenotype provides important information to support clinical trial readiness for future disease-modifying therapies.

Also flagged:atherosclerosisASatherosclerotic diseasesADhypertensionhyperglycemia
Journal Article 2022-10-25 No Snippets Tan Q, He S, Leng X, Zheng D, Mao F, Hao J, Chen K, Jiang H, Lin Y, Yang J.
Show Full Abstract

<i>N</i><sup>6</sup>-methyladenosine (m<sup>6</sup>A) modification is a newly discovered regulatory mechanism in eukaryotes. As one of the most common epigenetic mechanisms, m<sup>6</sup>A's role in the development of atherosclerosis (AS) and atherosclerotic diseases (AD) has also received increasing attention. Herein, we elucidate the effect of m<sup>6</sup>A on major risk factors for AS, including lipid metabolism disorders, hypertension, and hyperglycemia. We also describe how m<sup>6</sup>A methylation contributes to endothelial cell injury, macrophage response, inflammation, and smooth muscle cell response in AS and AD. Subsequently, we illustrate the m<sup>6</sup>A-mediated aberrant biological role in the pathogenesis of AS and AD, and analyze the levels of m<sup>6</sup>A methylation in peripheral blood or local tissues of AS and AD, which helps to further discuss the diagnostic and therapeutic potential of m<sup>6</sup>A regulation for AS and AD. In summary, studies on m<sup>6</sup>A methylation provide new insights into the pathophysiologic mechanisms of AS and AD, and m<sup>6</sup>A methylation could be a novel diagnostic biomarker and therapeutic target for AS and AD.

Also flagged:Serotonin Transporterpathogenesisobesitydexamethasonecorticotropin-releasing hormoneCRH
Journal Article 2022-10-25 ✓ 5 Snippets Schinke C, Rullmann M, Luthardt J, Drabe M, Preller E, Becker GA, Patt M, Regenthal R, Zientek F, Sabri O, Then Bergh F, Hesse S.
In-Text Gene Mentions

While the role of 5-HTT polymorphisms mediating gene environment interactions in affective disorders is debated [69,70,71], pointing towards only modest effects if existent at all [72], some studies found hints for a higher HPA responsiveness using the dex/CRH test in individuals with depression carrying the S/S allele [36,73] or in healthy S/S females by means of the cortisol awakening response [74], or saliva after a defined psychosocial stressor [75].

In non-obesity controls, cortisol AUC correlated positively with hippocampal 5-HTT BPND.

In obesity, ACTH curve indicators were positively associated with averaged 5-HTT BPND throughout the brain, while region-specific correlations could be found between ACTH curve indicators and 5-HTT BPND of the caudate nucleus, but not for cortisol parameters.

Region-specific analyses showed that cortisol but not ACTH curve parameters correlated significantly with 5-HTT BPND of the hippocampus (r = 0.59, p = 0.04, see Table 2, Figure 3F).

Objective: To investigate the relation of HPA responsiveness and serotonin transporter (5-HTT) availability in otherwise healthy individuals with obesity class II or III (OB) compared to non-obesity controls (NO).

Show Full Abstract

<h4>Background</h4>Alterations of hypothalamic-pituitary-adrenal (HPA) axis activity and serotonergic signaling are implicated in the pathogenesis of human obesity and may contribute to its metabolic and mental complications. The association of these systems has not been investigated in human obesity.<h4>Objective</h4>To investigate the relation of HPA responsiveness and serotonin transporter (5-HTT) availability in otherwise healthy individuals with obesity class II or III (OB) compared to non-obesity controls (NO).<h4>Study participants</h4>Twenty-eight OB (21 females; age 36.6 ± 10.6 years; body mass index (BMI) 41.2 ± 5.1 kg/m<sup>2</sup>) were compared to 12 healthy NO (8 females; age 35.8 ± 7.4 years; BMI 22.4 ± 2.3 kg/m<sup>2</sup>), matched for age and sex.<h4>Methods</h4>HPA axis responsiveness was investigated using the combined dexamethasone/corticotropin-releasing hormone (dex/CRH) test, and curve indicators were derived for cortisol and adrenocorticotropic hormone (ACTH). The 5-HTT selective tracer [<sup>11</sup>C]DASB was applied, and parametric images of the binding potentials (BP<sub>ND</sub>) were calculated using the multilinear reference tissue model and evaluated by atlas-based volume of interest (VOI) analysis. The self-questionnaires of behavioral inhibition system/behavioral activation system (BIS/BAS) with subscales drive, fun-seeking and reward were assessed.<h4>Results</h4>OB showed significant positive correlations of ACTH curve parameters with overall 5-HTT BP<sub>ND</sub> (ACTH<sub>AUC</sub>: <i>r</i> = 0.39, <i>p</i> = 0.04) and 5-HTT BP<sub>ND</sub> of the caudate nucleus (ACTH<sub>AUC</sub>: <i>r</i> = 0.54, <i>p</i> = 0.003). In NO, cortisol indicators correlated significantly with BP<sub>ND</sub> in the hippocampus (cortisol<sub>AUC</sub>: <i>r</i> = 0.59, <i>p</i> = 0.04). In OB, BAS reward was inversely associated with the ACTH<sub>AUC</sub> (<i>r</i> = -0.49, <i>p =</i> 0.009).<h4>Conclusion</h4>The present study supports a serotonergic-neuroendocrine association, which regionally differs between OB and NO. In OB, areas processing emotion and reward seem to be in-volved. The finding of a serotonergic HPA correlation may have implications for other diseases with dysregulated stress axis responsiveness, and for potential pharmacologic interven-tions.

Also flagged:TauopathiesdementiaAmyloid betaTaumicrotubules
Journal Article 2022-10-25 ✓ 1 Snippet Rawat P, Sehar U, Bisht J, Selman A, Culberson J, Reddy PH.
In-Text Gene Mentions

Romina Vuono and colleagues examined post-mortem brain samples from patients with HD and investigated the role of tau in the pathology of HD, and found that MAPT haplotypes affect the rate of cognitive decline in a large group of patients with HD, some mutant HTT aggregates co-localized with both the 3R- and 4R-tau deposits, and altered 4R:3R tau isoform ratio in Huntington’s disease brains [132].

Show Full Abstract

Alzheimer's disease (AD) is the leading cause of dementia in elderly people. Amyloid beta (Aβ) deposits and neurofibrillary tangles are the major pathological features in an Alzheimer's brain. These proteins are highly expressed in nerve cells and found in most tissues. Tau primarily provides stabilization to microtubules in the part of axons and dendrites. However, tau in a pathological state becomes hyperphosphorylated, causing tau dysfunction and leading to synaptic impairment and degeneration of neurons. This article presents a summary of the role of tau, phosphorylated tau (p-tau) in AD, and other tauopathies. Tauopathies, including Pick's disease, frontotemporal dementia, corticobasal degeneration, Alzheimer's disease, argyrophilic grain disease, progressive supranuclear palsy, and Huntington's disease, are the result of misprocessing and accumulation of tau within the neuronal and glial cells. This article also focuses on current research on the post-translational modifications and genetics of tau, tau pathology, the role of tau in tauopathies and the development of new drugs targeting p-tau, and the therapeutics for treating and possibly preventing tauopathies.

Also flagged:DiabetesDiabetes mellitusmetabolic diseaseinsulininsulin resistanceType 1 diabetes mellitus
Journal Article 2022-10-25 No Snippets Angelescu MA, Andronic O, Dima SO, Popescu I, Meivar-Levy I, Ferber S, Lixandru D.
Show Full Abstract

Diabetes mellitus (DM) is a complex metabolic disease with many specifically related complications. Early diagnosis of this disease could prevent the progression to overt disease and its related complications. There are several limitations to using existing biomarkers, and between 24% and 62% of people with diabetes remain undiagnosed and untreated, suggesting a large gap in current diagnostic practices. Early detection of the percentage of insulin-producing cells preceding loss of function would allow for effective therapeutic interventions that could delay or slow down the onset of diabetes. MicroRNAs (miRNAs) could be used for early diagnosis, as well as for following the progression and the severity of the disease, due to the fact of their pancreatic specific expression and stability in various body fluids. Thus, many studies have focused on the identification and validation of such groups or "signatures of miRNAs" that may prove useful in diagnosing or treating patients. Here, we summarize the findings on miRNAs as biomarkers in diabetes and those associated with direct cellular reprogramming strategies, as well as the relevance of miRNAs that act as a bidirectional switch for cell therapy of damaged pancreatic tissue and the studies that have measured and tracked miRNAs as biomarkers in insulin resistance are addressed.

Also flagged:testosteronesex differentiationspermatogenesisLHkinasestranscription factors
Journal Article 2022-10-25 No Snippets Demmouche ZB, Tremblay JJ.
Show Full Abstract

Leydig cells produce testosterone, a hormone essential for male sex differentiation and spermatogenesis. The pituitary hormone, LH, stimulates testosterone production in Leydig cells by increasing the intracellular cAMP levels, which leads to the activation of various kinases and transcription factors, ultimately stimulating the expression of the genes involved in steroidogenesis. The second messenger, cAMP, is subsequently degraded to AMP, and the increase in the intracellular AMP levels activates AMP-dependent protein kinase (AMPK). Activated AMPK potently represses steroidogenesis. Despite the key roles played by the various stimulatory and inhibitory kinases, the proteins phosphorylated by these kinases during steroidogenesis remain poorly characterized. In the present study, we have used a quantitative LC-MS/MS approach, using total and phosphopeptide-enriched proteins to identify the global changes that occur in the proteome and phosphoproteome of MA-10 Leydig cells during both the stimulatory phase (Fsk/cAMP treatment) and inhibitory phase (AICAR-mediated activation of AMPK) of steroidogenesis. The phosphorylation levels of several proteins, including some never before described in Leydig cells, were significantly altered during the stimulation and inhibition of steroidogenesis. Our data also provide new key insights into the finely tuned and dynamic processes that ensure adequate steroid hormone production.

Also flagged:waterpolyethyleneoxidestem cell differentiationmembraneFluoresceinpenicillin
Journal Article 2022-10-25 No Snippets Trossbach M, de Lucas Sanz M, Seashore-Ludlow B, Joensson HN.
Show Full Abstract

Droplet microfluidics utilize a monodisperse water-in-oil emulsion, with an expanding toolbox offering a wide variety of operations on a range of droplet sizes at high throughput. However, translation of these capabilities into applications for non-expert laboratories to fully harness the inherent potential of microscale manipulations is woefully trailing behind. One major obstacle is that droplet microfluidic setups often rely on custom fabricated devices, costly liquid actuators, and are not easily set up and operated by non-specialists. This impedes wider adoption of droplet technologies in, e.g., the life sciences. Here, we demonstrate an easy-to-use minimal droplet production setup with a small footprint, built exclusively from inexpensive commercially sourced parts, powered and controlled by a laptop. We characterize the components of the system and demonstrate production of droplets ranging in volume from 3 to 21 nL in a single microfluidic device. Furthermore, we describe the dynamic tuning of droplet composition. Finally, we demonstrate the production of droplet-templated cell spheroids from primary cells, where the mobility and simplicity of the setup enables its use within a biosafety cabinet. Taken together, we believe this minimal droplet setup is ideal to drive broad adoption of droplet microfluidics technology.

Also flagged:Neurodegenerative DiseasesNeurodegenerative disordersamyotrophic lateral sclerosisALSdeathAD
Journal Article 2022-10-25 ✓ 5 Snippets Dailah HG.
In-Text Gene Mentions

In HD, the genetic inactivation of CaN and FK506 provided protection against mHtt toxicity by increasing the phosphorylation of Htt, and also improved the defect in BDNF transport [272,273].

In HD, the generation of the pro-apoptotic Hippi-Hip-1 complex is increased because of the mutated Htt-mediated rise in the free cellular level of HIP-1 [178].

As a result, the level of wild-type Htt becomes depleted, which can result in some of the characteristics of HD [175].

HD can occur due to the abnormal expansion of the CAG trinucleotide repeat sequence in the huntingtin (Htt) gene encoding a protein called Htt.

…the phosphorylation ofHtt, and also improved…

Show Full Abstract

Neurodegenerative disorders (NDs) include Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS) and the common feature of NDs is the progressive death of specific neurons in the brain. Apoptosis is very important in developing the nervous system, nonetheless an elevated level of cell death has been observed in the case of NDs. NDs are different in terms of their neuronal vulnerability and clinical manifestations, however they have some overlapping neurodegenerative pathways. It has been demonstrated by several studies with cell lines and animal models that apoptosis has a significant contribution to make in advancing AD, ALS, HD, and PD. Numerous dying neurons were also identified in the brains of individuals with NDs and these conditions were found to be linked with substantial cell loss along with common characteristics of apoptosis including activation of caspases and cysteine-proteases, DNA fragmentation, and chromatin condensation. It has been demonstrated that several therapeutic agents including antioxidants, minocycline, GAPDH ligands, p53 inhibitors, JNK (c-Jun N-Terminal Kinase) inhibitors, glycogen synthase kinase-3 inhibitor, non-steroidal anti-inflammatory drugs, D2 dopamine receptor agonists, FK506, cell cycle inhibitors, statins, drugs targeting peroxisome proliferator-activated receptors, and gene therapy have the potential to provide protection to neurons against apoptosis. Therefore, the use of these potential therapeutic agents might be beneficial in the treatment of NDs. In this review, we have summarized the pathways that are linked with apoptotic neuronal death in the case of various NDs. We have particularly focused on the therapeutic agents that have neuroprotective properties and the potential to regulate apoptosis in NDs.

Also flagged:Carbonalkaloidsdegradationheterocyclichydroxylmethoxy
Journal Article 2022-10-25 No Snippets Hammud HH, Maache SA, Al Otaibi N, Sheikh NS.
Show Full Abstract

The corrosion inhibition effect of the three extracts from Harmal roots (HRE), leaves (HLE), and flowers (HFE) were studied for carbon steel corrosion inhibition in 0.25 M H<sub>2</sub>SO<sub>4</sub> solution. The electrochemical impedance study indicated that the three types of extracts decreased corrosion effectively through a charge transfer mechanism. Harmal roots and leaf extracts showed inhibition values of 94.1% and 94.2%, while it was 88.7% for Harmal flower extract at the inhibitor concentration of 82.6 ppm. Potentiodynamic polarization data revealed that Harmal extracts acted through predominant cathodic type inhibition. Both the corrosion current density and corrosion rate decreased significantly in the presence of Harmal extracts compared to blank solution. The corrosion rate (mpy) value was 63.3, 86.1, and 180.7 for HRE, HLE, and HFE, respectively. The adsorption-free energy change Δ<i>G<sub>ads</sub></i> (kJ·mol<sup>-1</sup>) values calculated from the Langmuir adsorption isotherm plots were for HRE (-35.08), HLE (-33.17), and HFE (-33.12). Thus, corrosion inhibition occurred due to the adsorption of Harmal extract on the carbon steel surface via the chemisorption mechanism. Moreover, a computational investigation using B3LYP/6-311G++(d,p) basis set in both gaseous and aqueous phases was performed for the major alkaloids (1-8) present in the Harmal extract.

Also flagged:cholesterollipoproteinstatinmineralatherosclerosislipoproteins
Journal Article 2022-10-25 ✓ 3 Snippets Li G, Park JN, Park HJ, Suh JH, Choi HS.
In-Text Gene Mentions

…PRDX2, PRDX3, PRDX5,PRDX6, GPX1, SOD1, SOD2,…

…PRDXs (PRDX1 toPRDX6) are a family…

…PRDX2, PRDX3, PRDX5,PRDX6, GPX-1, SOD1, SOD2,…

Show Full Abstract

High cholesterol-induced bone loss is highly associated with oxidative stress, which leads to the generation of oxysterols, such as 7-ketocholesterol (7-KC). Here, we conducted in vivo and in vitro experiments to determine whether arctiin prevents high cholesterol diet-induced bone loss by decreasing oxidative stress. First, arctiin was orally administered to atherogenic diet (AD)-fed C57BL/6J male mice at a dose of 10 mg/kg for 6 weeks. Micro-computerized tomography (μCT) analysis showed that arctiin attenuated AD-induced boss loss. For our in vitro experiments, the anti-oxidant effects of arctiin were evaluated in 7-KC-stimulated osteoclasts (OCs). Arctiin decreased the number and activity of OCs and inhibited autophagy by disrupting the nuclear localization of transcription factor EB (TFEB) and downregulating the oxidized TFEB signaling pathway in OCs upon 7-KC stimulation. Furthermore, arctiin decreased the levels of reactive oxygen species (ROS) by enhancing the expression of nuclear factor erythroid 2-related factor 2 (Nrf2), catalase, and heme oxygenase 1 (HO-1), all of which affected OC differentiation. Conversely, silencing of Nrf2 or HO-1/catalase attenuated the effects of arctiin on OCs. Collectively, our findings suggested that arctiin attenuates 7-KC-induced osteoclastogenesis by increasing the expression of ROS scavenging genes in the Nrf2/HO-1/catalase signaling pathway, thereby decreasing OC autophagy. Moreover, arctiin inhibits the oxidation and nuclear localization of TFEB, thus protecting mice from AD-induced bone loss. Our findings thus demonstrate the therapeutic potential of arctiin for the prevention of cholesterol-induced bone loss.

Also flagged:neurodegenerative diseasespathogenesisferroptosisenergy metabolism disordersautophagyendoplasmic reticulum
Journal Article 2022-10-25 No Snippets Dou Y, Zhao D.
Show Full Abstract

Natural molecules with favorable safety profile and broad pharmacological activities have shown great promise in the treatment of various neurodegenerative diseases (NDDs). Current studies applying natural molecules against NDDs mainly focus on well-recognized conventional pathogenesis, such as toxic protein aggregation, oxidative stress, and neuroinflammation. However, accumulating evidence reveals that some underlying pathogenic mechanisms are involved earlier and more deeply in the occurrence and development of NDDs, such as ferroptosis, energy metabolism disorders, autophagy-lysosomal dysfunction, endoplasmic reticulum stress, and gut dysbiosis. Therefore, determining whether natural molecules can play therapeutic roles in these emerging pathogenic mechanisms will help clarify the actual targets of natural molecules and their future clinical translation. Furthermore, how to overcome the inability of most poorly water-soluble natural molecules to cross the blood-brain barrier is also critical for effective NDD treatment. This review summarizes emerging pathogenic mechanisms targeted by natural molecules for NDD treatment, proposes nanocarrier-based drug delivery and intranasal administration to enhance the intracerebral bioavailability of natural molecules, and summarizes the current state of clinical research on natural product-based therapeutics.

Also flagged:Bufalintumorwaterfluoresceinliver cancertumors
Journal Article 2022-10-25 No Snippets Xu J, Lin S, Hu H, Xing Q, Geng J.
Show Full Abstract

Bufalin (buf) has poor solubility in aqueous solution, poor tumor targeting, and many non-specific toxic and side effects. The advantages of high-molecular-weight polymer conjugates are that they can improve the water solubility of buf, prolong plasma half-life, and reduce non-specific toxicity. A novel water-soluble polymer-drug conjugate with buf and fluorescein pendants was prepared by the combination of reversible addition-fragmentation transfer (RAFT) polymerization and click chemistry. Its anticancer performance and cellular uptake behavior against liver cancer were investigated in vitro. The polymer-buf conjugates exhibit controlled release and tumor-targeting capabilities, showing promise for clinical applications.

Also flagged:ferroptosistumorimmunoregulationovarian cancergene expressiongynecologic malignancy
Journal Article 2022-10-25 ✓ 1 Snippet Liu Y, Du S, Yuan M, He X, Zhu C, Han K, Zhu Y, Yang Q, Tong R.
In-Text Gene Mentions

…, ALOX5 ,SLC2A14, and MT1G…

Show Full Abstract

Ferroptosis has been implicated in tumor progression and immunoregulation. Identification of ferroptosis-related prognostic gene is important for immunotherapy and prognosis in ovarian cancer (OV). We assessed the potential predictive power of a novel ferroptosis-related gene (FRG) signature for prognosis and immunotherapy in Asian and Caucasian OV populations. We collected gene expression profiles and clinicopathological data from public databases. The least absolute shrinkage and selection operator Cox regression algorithm was used to construct the FRG signature. Receiver operating characteristic (ROC) curve, Kaplan-Meier method, Cox regression model were used to evaluate the clinical benefits of FRG signature. Gene functional and gene set enrichment analyses were used for functional annotation and immune landscape analysis. A 15-FRG signature was constructed and used to stratify patients into two risk groups. Patients in the high-risk group had significantly worse survival. The risk score was a significant independent risk factor for OS. The area under the ROC curve indicated the good prediction performance of the FRG signature. Notably, the low-risk group showed a significant enrichment in immune-related pathways and a "hot" immune status. The risk score was found to be an efficient and robust predictor of response to immunotherapy. In conclusion, our study identified a novel 15-FRG prognostic signature that can be used for prognostic prediction and precision immunotherapy in Asian and Caucasian OV populations.

Also flagged:braintransporter5-HT 1Abehavioralaggressioninjuries
Journal Article 2022-10-25 ✓ 5 Snippets Dugré JR, Potvin S.
In-Text Gene Mentions

…(5-HT 1A and5-HTT).…

…mainly serotonin transporter (5-HTT) and 5-HT 2A…

…as serotonin transporters5-HTT( rs =…

…) and transporter (5-HTT) maps.…

…the role of5-HTTin negative emotionality,…

Show Full Abstract

In the past decades, a growing body of evidence has suggested that some individuals may exhibit antisocial behaviors following brain lesions. Recently, some authors have shown that lesions underpinning antisocial behaviors may disrupt a particular brain network during resting-state. However, it remains unknown whether these brain lesions may alter specific mental processes during tasks. Therefore, we conducted meta-analytic co-activation analyses on lesion masks of 17 individuals who acquired antisocial behaviors following their brain lesions. Each lesion mask was used as a seed of interest to examine their aberrant co-activation network using a database of 143 whole-brain neuroimaging studies on antisocial behaviors (<i>n</i> = 5,913 subjects). We aimed to map the lesion brain network that shows deficient activity in antisocial population against a null distribution derived from 655 control lesions. We further characterized the lesion-based meta-analytic network using term-based decoding (Neurosynth) as well as receptor/transporter density maps (JuSpace). We found that the lesion meta-analytic network included the amygdala, orbitofrontal cortex, ventro- and dorso-medial prefrontal cortex, fusiform face area, and supplementary motor area (SMA), which correlated mainly with emotional face processing and serotoninergic system (5-HT<sub>1A</sub> and 5-HTT). We also investigated the heterogeneity in co-activation networks through data-driven methods and found that lesions could be grouped in four main networks, encompassing emotional face processing, general emotion processing, and reward processing. Our study shows that the heterogeneous brain lesions underpinning antisocial behaviors may disrupt specific mental processes, which further increases the risk for distinct antisocial symptoms. It also highlights the importance and complexity of studying brain lesions in relationship with antisocial behaviors.

Also flagged:ShikoninferroptosisMultiple myelomahematologicaldeathproteasome
Journal Article 2022-10-25 ✓ 1 Snippet Li W, Fu H, Fang L, Chai H, Gao T, Chen Z, Qian S.
In-Text Gene Mentions

…protein 1 (PEBP1), nicotinamide N-methyltransf…

Show Full Abstract

Multiple myeloma (MM) is an incurable hematological malignancy that lacks effective therapeutic interventions. Ferroptosis is a newly discovered form of cell death that has shown great potential for MM therapy. As a proteasome inhibitor and necroptosis inducer, shikonin (SHK) performs dual functions in MM cells. However, whether SHK inhibits the development of MM <i>via</i> ferroptosis or any other mechanism remains elusive. Here, we provide evidence that SHK treatment was capable of inducing ferroptosis and immunogenic cell death (ICD) in MM. The results showed that SHK treatment induced lactate dehydrogenase release, triggered cell death, evoked oxidative stress, and enhanced ferrous iron and lipid peroxidation levels. Furthermore, treatment with ferroptosis inhibitors reversed SHK-induced cell death, which indicated that ferroptosis contributed to this phenomenon. Meanwhile, ferroptosis was accompanied by the extracellular release of Adenosine 5'-triphosphate (ATP) and High mobility group protein B1 (HMGB1), which are characteristics of ICD. Further investigation showed that glutamic-oxaloacetic transaminase 1 (GOT1) acted as a critical mediator of SHK-induced ferroptosis by promoting ferritinophagy. In conclusion, our findings suggest that SHK exerts ferroptotic effects on MM by regulating GOT1-mediated ferritinophagy. Thus, SHK is a potential therapeutic agent for MM.

Also flagged:non-alcoholic fatty liver diseaseNAFLDdiabetic nephropathyDNGene Expressiontranscription factors
Journal Article 2022-10-25 ✓ 1 Snippet Yan Q, Zhao Z, Liu D, Li J, Pan S, Duan J, Dong J, Liu Z.
In-Text Gene Mentions

…as autoimmune hepatitis,hemochromatosis, and Wilson’s disease…

Show Full Abstract

<h4>Background</h4>Growing evidence indicates that non-alcoholic fatty liver disease (NAFLD) is related to the occurrence and development of diabetic nephropathy (DN). This bioinformatics study aimed to explore optimal crosstalk genes and related pathways between NAFLD and DN.<h4>Methods</h4>Gene expression profiles were downloaded from Gene Expression Omnibus. CIBERSORT algorithm was employed to analyze the similarity of infiltrating immunocytes between the two diseases. Protein-protein interaction (PPI) co-expression network and functional enrichment analysis were conducted based on the identification of common differentially expressed genes (DEGs). Least absolute shrinkage and selection operator (LASSO) regression and Boruta algorithm were implemented to initially screen crosstalk genes. Machine learning models, including support vector machine, random forest model, and generalized linear model, were utilized to further identify the optimal crosstalk genes between DN and NAFLD. An integrated network containing crosstalk genes, transcription factors, and associated pathways was developed.<h4>Results</h4>Four gene expression datasets, including GSE66676 and GSE48452 for NAFLD and GSE30122 and GSE1009 for DN, were involved in this study. There were 80 common DEGs between the two diseases in total. The PPI network built with the 80 common genes included 77 nodes and 83 edges. Ten optimal crosstalk genes were selected by LASSO regression and Boruta algorithm, including <i>CD36, WIPI1, CBX7, FCN1, SLC35D2, CP, ZDHHC3, PTPN3, LPL</i>, and <i>SPP1</i>. Among these genes, LPL and SPP1 were the most significant according to NAFLD-transcription factor network. Five hundred twenty-nine nodes and 1,113 edges comprised the PPI network of activated pathway-gene. In addition, 14 common pathways of these two diseases were recognized using Gene Ontology (GO) analysis; among them, regulation of the lipid metabolic process is closely related to both two diseases.<h4>Conclusions</h4>This study offers hints that NAFLD and DN have a common pathogenesis, and LPL and SPP1 are the most relevant crosstalk genes. Based on the common pathways and optimal crosstalk genes, our proposal carried out further research to disclose the etiology and pathology between the two diseases.

Also flagged:Ischemic Strokeneurological disordersstrokefatty acidtricarboxylic acidHomeostasis
Journal Article 2022-10-25 ✓ 3 Snippets Ge Y, Zadeh M, Yang C, Candelario-Jalil E, Mohamadzadeh M.
In-Text Gene Mentions

In the cecum and colon, we also detected the activation of FAO-associated genes (e.g., Acadl and Eci2) in stroke mice, but the number of genes and the extent of activation, as determined by GSEA, were less than those in the ileum.

…by PPARs (exceptEci2) and are…

…(e.g., Acadl andEci2) in stroke…

Show Full Abstract

Ischemic stroke critically impacts neurovascular homeostasis, potentially resulting in neurological disorders. However, the mechanisms through which stroke-induced inflammation modifies the molecular and metabolic circuits, particularly in ileal epithelial cells (iECs), currently remain elusive. Using multiomic approaches, we illustrated that stroke impaired the ileal microbiome and associated metabolites, leading to increased inflammatory signals and altered metabolites, potentially deteriorating the iEC homeostasis. Bulk transcriptomic and metabolomic profiling demonstrated that stroke enhanced fatty acid oxidation while reducing the tricarboxylic acid (TCA) cycle in iECs within the first day after stroke. Intriguingly, single-cell RNA sequencing analysis revealed that stroke dysregulated cell-type-specific gene responses within iECs and reduced frequencies of goblet and tuft cells. Additionally, stroke augmented interleukin-17A<sup>+</sup> γδ T cells but decreased CD4<sup>+</sup> T cells in the ileum. Collectively, our findings provide a comprehensive overview of stroke-induced intestinal dysbiosis and unveil responsive gene programming within iECs with implications for disease development.

Also flagged:PCDH19transmembraneprotocadherinX-chromosomePCDH-clustering epilepsysynapse
Journal Article 2022-10-25 ✓ 1 Snippet Pancho A, Mitsogiannis MD, Aerts T, Dalla Vecchia M, Ebert LK, Geenen L, Noterdaeme L, Vanlaer R, Stulens A, Hulpiau P, Staes K, Van Roy F, Dedecker P, Schermer B, Seuntjens E.
In-Text Gene Mentions

…as the relatedPCDH17, which plays a…

Show Full Abstract

PCDH19 is a transmembrane protein and member of the protocadherin family. It is encoded by the X-chromosome and more than 200 mutations have been linked to the neurodevelopmental PCDH-clustering epilepsy (PCDH19-CE) syndrome. A disturbed cell-cell contact that arises when random X-inactivation creates mosaic absence of PCDH19 has been proposed to cause the syndrome. Several studies have shown roles for PCDH19 in neuronal proliferation, migration, and synapse function, yet most of them have focused on cortical and hippocampal neurons. As epilepsy can also be caused by impaired interneuron migration, we studied the role of PCDH19 in cortical interneurons during embryogenesis. We show that cortical interneuron migration is affected by altering PCDH19 dosage by means of overexpression in brain slices and medial ganglionic eminence (MGE) explants. We also detect subtle defects when PCDH19 expression was reduced in MGE explants, suggesting that the dosage of PCDH19 is important for proper interneuron migration. We confirm this finding <i>in vivo</i> by showing a mild reduction in interneuron migration in heterozygote, but not in homozygote PCDH19 knockout animals. In addition, we provide evidence that subdomains of PCDH19 have a different impact on cell survival and interneuron migration. Intriguingly, we also observed domain-dependent differences in migration of the non-targeted cell population in explants, demonstrating a non-cell-autonomous effect of PCDH19 dosage changes. Overall, our findings suggest new roles for the extracellular and cytoplasmic domains of PCDH19 and support that cortical interneuron migration is dependent on balanced PCDH19 dosage.

bioRxiv 2022-10-25 Preprint (No Snippets API) Hochgerner H, Tibi M, Netser S, Ophir O, Reinhardt N, Singh S, Lin Z, Wagner S, Zeisel A.
Show Full Abstract

The amygdala is one of the most widely studied regions in behavioral neuroscience. A plethora of classical, and new paradigms have dissected its precise involvement in emotional and social sensing, learning, and memory. Several important insights resulted from the use of genetic markers – yet, in the age of single cell transcriptomics, the amygdala remains molecularly underdescribed. Here, we present a molecular cell type taxonomy of the full mouse amygdala in fear learning and consolidation. We performed single-cell RNA-seq on naïve and fear conditioned mice, inferred the 130 neuronal cell types distributions in silico using orthogonal spatial transcriptomic datasets, and describe the cell types’ transcriptional responses to learning and memory consolidation. Only a fraction of cells, within a subset of all neuronal types, were transcriptionally responsive to fear learning, memory and retrieval. These activated engram cells upregulated activity-response genes, and processes of synaptic signaling, plasticity, development and neurite outgrowth. Our transcriptome-wide data confirm known actors, and describe several new candidate genes. The atlas may help pinpoint the amygdala’s circuits in performing emotional sensing and integration, and provide new insights to the global cellular processes involved.

Also flagged:IAEDNRAPTCH1RYKTNIKFTO
Journal Article 2022-10-24 ✓ 1 Snippet Hong EP, Youn DH, Kim BJ, Lee JJ, Nam S, Yoo H, Kim HC, Rhim JK, Park JJ, Jeon JP.
In-Text Gene Mentions

…SAP18 , andUNC13Cwas observed.…

Show Full Abstract

<h4>Objective</h4>The association between boule (BOLL) and endothelin receptor type A (EDNRA) loci and intracranial aneurysm (IA) formation has been reported via genome-wide association studies. We sought to identify genome-wide interactions involving BOLL and EDNRA loci for IA in a Korean adult cohort.<h4>Methods</h4>Genome-wide pairwise interaction analyses of BOLL and EDNRA involving 250 patients with IA and 296 controls were performed using the additive effect model after adjusting for confounding factors.<h4>Results</h4>Among 512575 single-nucleotide polymorphisms (SNPs), 23 and 11 common SNPs suggested a genome-wide interaction threshold (p<1.25×10-8) involving rs700651 (BOLL) and rs6841581 (EDNRA). Rather than singe SNP effect of BOLL or EDNRA on IA development, they showed a synergistic effect on IA formation via multifactorial pair-wise interactions. The rs1105980 of PTCH1 gene showed the most significant interaction with rs700651 (natural log-transformed odds ratio [lnOR], 1.53; p=6.41×10-11). The rs74585958 of RYK gene interacted strongly with rs6841581 (lnOR, -19.91; p=1.64×10-9). Although, there was no direct interaction between BOLL and EDNRA variants, two EDNRA-interacting gene variants of TNIK (rs11925024 and rs1231) and FTO (rs9302654), and one BOLL-interacting METTL4 gene variant (rs549315) exhibited marginal interaction with BOLL gene.<h4>Conclusion</h4>BOLL or EDNRA may have a synergistic effect on IA formation via multifactorial pair-wise interactions.

Also flagged:HDneurofilament light chainbehavioralautosomal dominant neurodegenerative disorderpolyglutamineoligonucleotides
Journal Article 2022-10-24 ✓ 5 Snippets Marchionini DM, Liu JP, Ambesi-Impiombato A, Kerker K, Cirillo K, Bansal M, Mushlin R, Brunner D, Ramboz S, Kwan M, Kuhlbrodt K, Tillack K, Peters F, Rauhala L, Obenauer J, Greene JR, Hartl C, Khetarpal V, Lager B, Rosinski J, Aaronson J, Alam M, Signer E, Muñoz-Sanjuán I, Howland D, Zeitlin SO.
In-Text Gene Mentions

Huntington’s disease (HD) is a progressive autosomal dominant neurodegenerative disorder that is caused by the expansion of a CAG repeat within the huntingtin (HTT) gene that encodes an expanded polyglutamine (polyQ) tract in the HTT protein.

The LacO/LacIR-regulatable mutant Htt allele was generated using gene targeting by inserting synthetic LacO sequences (31) flanking the transcriptional start site of HttQ140 (49) that expresses a full-length chimeric mouse/human mHtt with human exon 1 sequence encoding N terminal sequence, including an expanded polyQ stretch and the adjacent human proline-rich region.

Previous studies with limited brain distribution of total Htt or allele-specific mHtt lowering greater than 50% have shown attenuation of discrete phenotypes in HD rodent models (5–17).

…mutant huntingtin (mHtt) expression.…

…whether early mHttlowering (before measurable…

Show Full Abstract

We have developed an inducible Huntington's disease (HD) mouse model that allows temporal control of whole-body allele-specific mutant huntingtin (mHtt) expression. We asked whether moderate global lowering of mHtt (~50%) was sufficient for long-term amelioration of HD-related deficits and, if so, whether early mHtt lowering (before measurable deficits) was required. Both early and late mHtt lowering delayed behavioral dysfunction and mHTT protein aggregation, as measured biochemically. However, long-term follow-up revealed that the benefits, in all mHtt-lowering groups, attenuated by 12 months of age. While early mHtt lowering attenuated cortical and striatal transcriptional dysregulation evaluated at 6 months of age, the benefits diminished by 12 months of age, and late mHtt lowering did not ameliorate striatal transcriptional dysregulation at 12 months of age. Only early mHtt lowering delayed the elevation in cerebrospinal fluid neurofilament light chain that we observed in our model starting at 9 months of age. As small-molecule HTT-lowering therapeutics progress to the clinic, our findings suggest that moderate mHtt lowering allows disease progression to continue, albeit at a slower rate, and could be relevant to the degree of mHTT lowering required to sustain long-term benefits in humans.

Also flagged:extracellularfibulin 7agingmatricellular proteinsDlx1Slc1a3
Journal Article 2022-10-24 No Snippets Raja E, Changarathil G, Oinam L, Tsunezumi J, Ngo YX, Ishii R, Sasaki T, Imanaka-Yoshida K, Yanagisawa H, Sada A.
Show Full Abstract

Tissue stem cells (SCs) divide infrequently as a protective mechanism against internal and external stresses associated with aging. Here, we demonstrate that slow- and fast-cycling SCs in the mouse skin epidermis undergo distinct aging processes. Two years of lineage tracing reveals that Dlx1+ slow-cycling clones expand into the fast-cycling SC territory, while the number of Slc1a3+ fast-cycling clones gradually declines. Transcriptome analysis further indicate that the molecular properties of each SC population are altered with age. Mice lacking fibulin 7, an extracellular matrix (ECM) protein, show early impairments resembling epidermal SC aging, such as the loss of fast-cycling clones, delayed wound healing, and increased expression of inflammation- and differentiation-related genes. Fibulin 7 interacts with structural ECM and matricellular proteins, and the overexpression of fibulin 7 in primary keratinocytes results in slower proliferation and suppresses differentiation. These results suggest that fibulin 7 plays a crucial role in maintaining tissue resilience and epidermal SC heterogeneity during skin aging.

Also flagged:CASKACh receptorsneurotransmitter receptorlocalizationsynapseslin-2
Journal Article 2022-10-24 ✓ 2 Snippets Li L, Liu H, Qian KY, Nurrish S, Zeng XT, Zeng WX, Wang J, Kaplan JM, Tong XJ, Hu Z.
In-Text Gene Mentions

…/FARP, LIN-2/CASK, and UNC-40/DCC[ 20 –…

…/FARP, LIN-2/CASK, and UNC-40/DCC) [ 24 ];…

Show Full Abstract

Changes in neurotransmitter receptor abundance at post-synaptic elements play a pivotal role in regulating synaptic strength. For this reason, there is significant interest in identifying and characterizing the scaffolds required for receptor localization at different synapses. Here we analyze the role of two C. elegans post-synaptic scaffolding proteins (LIN-2/CASK and FRM-3/FARP) at cholinergic neuromuscular junctions. Constitutive knockouts or muscle specific inactivation of lin-2 and frm-3 dramatically reduced spontaneous and evoked post-synaptic currents. These synaptic defects resulted from the decreased abundance of two classes of post-synaptic ionotropic acetylcholine receptors (ACR-16/CHRNA7 and levamisole-activated AChRs). LIN-2's AChR scaffolding function is mediated by its SH3 and PDZ domains, which interact with AChRs and FRM-3/FARP, respectively. Thus, our findings show that post-synaptic LIN-2/FRM-3 complexes promote cholinergic synaptic transmission by recruiting AChRs to post-synaptic elements.

Also flagged:TNFαIFNγproinflammatory cytokineIFNGR1inflammatory responsecytokine
Journal Article 2022-10-24 ✓ 1 Snippet Babaeijandaghi F, Paiero A, Long R, Tung LW, Smith SP, Cheng R, Smandych J, Kajabadi N, Chang CK, Ghassemi A, Kennedy WDM, Soliman H, Schutz PW, Rossi FMV.
In-Text Gene Mentions

…, Traf6 ,Vrk2) , leukocyte chemotaxis…

Show Full Abstract

IFNγ is traditionally known as a proinflammatory cytokine with diverse roles in antimicrobial and antitumor immunity. Yet, findings regarding its sources and functions during the regeneration process following a sterile injury are conflicting. Here, we show that natural killer (NK) cells are the main source of IFNγ in regenerating muscle. Beyond this cell population, IFNγ production is limited to a small population of T cells. We further show that NK cells do not play a major role in muscle regeneration following an acute injury or in dystrophic mice. Surprisingly, the absence of IFNγ per se also has no effect on muscle regeneration following an acute injury. However, the role of IFNγ is partially unmasked when TNFα is also neutralized, suggesting a compensatory mechanism. Using transgenic mice, we showed that conditional inhibition of IFNGR1 signaling in muscle stem cells or fibro-adipogenic progenitors does not play a major role in muscle regeneration. In contrast to common belief, we found that IFNγ is not present in the early inflammatory phase of the regeneration process but rather peaks when macrophages are acquiring an anti-inflammatory phenotype. Further transcriptomic analysis suggests that IFNγ cooperates with TNFα to regulate the transition of macrophages from pro- to anti-inflammatory states. The absence of the cooperative effect of these cytokines on macrophages, however, does not result in significant regeneration impairment likely due to the presence of other compensatory mechanisms. Our findings support the arising view of IFNγ as a pleiotropic inflammatory regulator rather than an inducer of the inflammatory response.

Also flagged:clustered regularly interspaced short palindromic repeatsCRISPR-associated (Cas)genetic disordersinfectious diseasesCasCas9
Journal Article 2022-10-24 ✓ 2 Snippets Chavez M, Chen X, Finn PB, Qi LS.
In-Text Gene Mentions

In addition, a dual sgRNA approach has been used in vitro to excise a 44 kb promoter region upstream of a mutant HTT gene to silence its expression and thereby ablate expression of the Huntington disease-causing variant87 (Fig. 4d).

Expression of the huntingtin gene (HTT) leads to the neural degeneration that is associated with Huntington disease.

Show Full Abstract

The clustered regularly interspaced short palindromic repeats (CRISPR) renaissance was catalysed by the discovery that RNA-guided prokaryotic CRISPR-associated (Cas) proteins can create targeted double-strand breaks in mammalian genomes. This finding led to the development of CRISPR systems that harness natural DNA repair mechanisms to repair deficient genes more easily and precisely than ever before. CRISPR has been used to knock out harmful mutant genes and to fix errors in coding sequences to rescue disease phenotypes in preclinical studies and in several clinical trials. However, most genetic disorders result from combinations of mutations, deletions and duplications in the coding and non-coding regions of the genome and therefore require sophisticated genome engineering strategies beyond simple gene knockout. To overcome this limitation, the toolbox of natural and engineered CRISPR-Cas systems has been dramatically expanded to include diverse tools that function in human cells for precise genome editing and epigenome engineering. The application of CRISPR technology to edit the non-coding genome, modulate gene regulation, make precise genetic changes and target infectious diseases has the potential to lead to curative therapies for many previously untreatable diseases.

Also flagged:Nonalcoholic fatty livercirrhosishepatocellular carcinomalipidmetabolismpathogenesis
Journal Article 2022-10-24 ✓ 5 Snippets Sveinbjornsson G, Ulfarsson MO, Thorolfsdottir RB, Jonsson BA, Einarsson E, Gunnlaugsson G, Rognvaldsson S, Arnar DO, Baldvinsson M, Bjarnason RG, DBDS Genomic consortium, Eiriksdottir T, Erikstrup C, Ferkingstad E, Halldorsson GH, Helgason H, Helgadottir A, Hindhede L, Hjorleifsson G, Jones D, Knowlton KU, Lund SH, Melsted P, Norland K, Olafsson I, Olafsson S, Oskarsson GR, Ostrowski SR, Pedersen OB, Pedersen OB, Snaebjarnarson AS, Sigurdsson E, Steinthorsdottir V, Schwinn M, Thorgeirsson G, Thorleifsson G, Jonsdottir I, Bundgaard H, Nadauld L, Bjornsson ES, Rulifson IC, Rafnar T, Norddahl GL, Thorsteinsdottir U, Sulem P, Gudbjartsson DF, Holm H, Stefansson K.
In-Text Gene Mentions

These two variants are associated with cirrhosis through alcohol consumption (ADH1B)37 and hemochromatosis (HFE)38, rather than solely through hepatic fat.

The cirrhosis effects were proportional to the PDFF effects (Fig. 2) except for p.His48Arg in ADH1B (alcohol dehydrogenase 1b) and p.Cys282Tyr in HFE (homeostatic iron regulator).

…and p.Cys282Tyr inHFE(homeostatic iron regulator).…

…) 37 andhemochromatosis( HFE )…

…and hemochromatosis (HFE) 38 ,…

Show Full Abstract

Nonalcoholic fatty liver (NAFL) and its sequelae are growing health problems. We performed a genome-wide association study of NAFL, cirrhosis and hepatocellular carcinoma, and integrated the findings with expression and proteomic data. For NAFL, we utilized 9,491 clinical cases and proton density fat fraction extracted from 36,116 liver magnetic resonance images. We identified 18 sequence variants associated with NAFL and 4 with cirrhosis, and found rare, protective, predicted loss-of-function variants in MTARC1 and GPAM, underscoring them as potential drug targets. We leveraged messenger RNA expression, splicing and predicted coding effects to identify 16 putative causal genes, of which many are implicated in lipid metabolism. We analyzed levels of 4,907 plasma proteins in 35,559 Icelanders and 1,459 proteins in 47,151 UK Biobank participants, identifying multiple proteins involved in disease pathogenesis. We show that proteomics can discriminate between NAFL and cirrhosis. The present study provides insights into the development of noninvasive evaluation of NAFL and new therapeutic options.

Also flagged:autismautism spectrum disorderspathogenesisNLGN3postsynaptic adhesion moleculeNeuroligin-3
Journal Article 2022-10-24 ✓ 1 Snippet Wang L, Mirabella VR, Dai R, Su X, Xu R, Jadali A, Bernabucci M, Singh I, Chen Y, Tian J, Jiang P, Kwan KY, Pak C, Liu C, Comoletti D, Hart RP, Chen C, Südhof TC, Pang ZP.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Mutations in many synaptic genes are associated with autism spectrum disorders (ASD), suggesting that synaptic dysfunction is a key driver of ASD pathogenesis. Among these mutations, the R451C substitution in the NLGN3 gene that encodes the postsynaptic adhesion molecule Neuroligin-3 is noteworthy because it was the first specific mutation linked to ASDs. In mice, the corresponding Nlgn3 R451C-knockin mutation recapitulates social interaction deficits of ASD patients and produces synaptic abnormalities, but the impact of the NLGN3 R451C mutation on human neurons has not been investigated. Here, we generated human knockin neurons with the NLGN3 R451C and NLGN3 null mutations. Strikingly, analyses of NLGN3 R451C-mutant neurons revealed that the R451C mutation decreased NLGN3 protein levels but enhanced the strength of excitatory synapses without affecting inhibitory synapses; meanwhile NLGN3 knockout neurons showed reduction in excitatory synaptic strengths. Moreover, overexpression of NLGN3 R451C recapitulated the synaptic enhancement in human neurons. Notably, the augmentation of excitatory transmission was confirmed in vivo with human neurons transplanted into mouse forebrain. Using single-cell RNA-seq experiments with co-cultured excitatory and inhibitory NLGN3 R451C-mutant neurons, we identified differentially expressed genes in relatively mature human neurons corresponding to synaptic gene expression networks. Moreover, gene ontology and enrichment analyses revealed convergent gene networks associated with ASDs and other mental disorders. Our findings suggest that the NLGN3 R451C mutation induces a gain-of-function enhancement in excitatory synaptic transmission that may contribute to the pathophysiology of ASD.

Also flagged:glucosemetabolismfatty acidsneurodegenerative disordersneurodegenerative diseaseAD
Journal Article 2022-10-24 No Snippets McDonald TS, Lerskiatiphanich T, Woodruff TM, McCombe PA, Lee JD.
Show Full Abstract

Neurodegeneration refers to the selective and progressive loss-of-function and atrophy of neurons, and is present in disorders such as Alzheimer's, Huntington's, and Parkinson's disease. Although each disease presents with a unique pattern of neurodegeneration, and subsequent disease phenotype, increasing evidence implicates alterations in energy usage as a shared and core feature in the onset and progression of these disorders. Indeed, disturbances in energy metabolism may contribute to the vulnerability of neurons to apoptosis. In this review we will outline these disturbances in glucose metabolism, and how fatty acids are able to compensate for this impairment in energy production in neurodegenerative disorders. We will also highlight underlying mechanisms that could contribute to these alterations in energy metabolism. A greater understanding of these metabolism-neurodegeneration processes could lead to improved treatment options for neurodegenerative disease patients.

Also flagged:Hereditary hyperferritinemia-cataract syndromeironferritin light chainhereditaryhyperferritinemia-cataract syndromeophthalmic diseases
Journal Article 2022-10-24 ✓ 5 Snippets Alvarenga AM, Silva NKD, Cançado RD, Carvalho LEMR, Santos PCJL.
In-Text Gene Mentions

…be misdiagnosed ashemochromatosis.…

…avoid misdiagnosis ofhemochromatosis, other diseases associated…

HFEgene mutations associated…

…mutations associated withhemochromatosisare common in…

…for the pathogenichemochromatosismutation and for…

Show Full Abstract

Hereditary hyperferritinemia-cataract syndrome is a rare autosomal dominant disease caused by a genetic mutation in the iron responsive element in the 5' untranslated region of the ferritin light chain gene. Hereditary hyperferritinemia-cataract syndrome is characterized by elevated serum ferritin levels and bilateral cataract development early in life and may be misdiagnosed as hemochromatosis. This case report describes a Brazilian family with a clinical diagnosis of hereditary hyperferritinemia-cataract syndrome, which was submitted to ferritin light chain gene sequencing. The genetic mutation c.-164C>G was identified in the 5' untranslated region. In conclusion, genetic testing can be used for accurate diagnosis of hereditary hyperferritinemia-cataract syndrome to avoid misdiagnosis of hemochromatosis, other diseases associated with iron overload or ophthalmic diseases.

Also flagged:melatonintranscription factorsgene expressionWNThigh-sulfurkeratin
Journal Article 2022-10-24 ✓ 2 Snippets Chai Y, Liu Z, Fu S, Liu B, Guo L, Dai L, Sun Y, Zhang W, Li C, Liu T.
In-Text Gene Mentions

…TIRAP , andSUDS3( Figure 7B…

…TIRAP , andSUDS3, was analyzed…

Show Full Abstract

The interplay between melatonin and immune system is well recognized in humans. The true integration of research on cashmere goat is still far from clear, especially for cashmere goat maintained in wool and cashmere growth. In this study, we applied various approaches to identify the complex regulated network between the immune-related genes and transcription factors (TFs) and to explore the relationship between melatonin and gene expression in cashmere goats. In total, 1,599 and 1756 immune-related genes were found in the blood and skin of cashmere goats, respectively, and 24 differentially expressed immune-related GO terms were highly expressed in blood after melatonin implantation. We studied the melatonin-dependent networks between the TFs and immune-related genes in cashmere goat. The 3 major regulatory networks were interconnected through TFs. The TFs, such as <i>PHF5A, REXO4, STRAP, JUNB, GATAD2A, ZNF710,</i> and <i>VDR</i>, were also expressed in the blood and skin tissue of cashmere goat. In addition, most genes in these networks, such as <i>VDR, JUNB,</i> and <i>Trib3</i>, were involved in WNT pathway, which is related to cashmere wool growth regulation<i>.</i> On the network basis, we developed a knockout mouse model to identify the network interaction. We observed that 8 high-sulfur protein genes, 12 keratin (KRT) genes, and 19 keratin associated protein (KRTAP) genes related to the growth of cashmere wool were almost not expressed in <i>Trib3</i> <sup>-/-</sup> rat skin. Our results suggested that the expression of genes related to wool and cashmere growth may be regulated by the interaction network between genes affected by melatonin and immune-related genes. In summary, we outlined some particularly promising ways for future research on immune-related genes of cashmere goats and the role of melatonin in wool and cashmere growth.

Also flagged:cariescaries lesionsocclusalinfectioncross-infectionroot caries
Journal Article 2022-10-24 No Snippets Lancaster PE, Carmichael FA, Clerehugh V, Brettle DS.
Show Full Abstract

<b>Background:</b> Human enamel and dentin temperatures have been assessed with non-contact infrared imaging devices for safety and diagnostic capacity and require an emissivity parameter to enable absolute temperature measurements. Emissivity is a ratio of thermal energy emitted from an object of interest, compared to a perfect emitter at a given temperature and wavelength, being dependent on tissue composition, structure, and surface texture. Evaluating the emissivity of human enamel and dentin is varied in the literature and warrants review. The primary aim of this study was to evaluate the emissivity of the external and internal surface of human enamel and dentin, free from acquired or developmental defects, against a known reference point. The secondary aim was to assess the emissivity value of natural caries in enamel and dentin. <b>Method:</b> Fourteen whole human molar teeth were paired within a thermally stable chamber at 30°C. Two additional teeth (one sound and one with natural occlusal caries-ICDAS caries score 4 and radiographic score RB4) were sliced and prepared as 1-mm-thick slices and placed on a hot plate at 30°C within the chamber. A 3M Scotch Super 33 + Black Vinyl Electrical Tape was used for the known emissivity reference-point of 0.96. All samples were allowed to reach thermal equilibrium, and a FLIR SC305 infrared camera recorded the warming sequence. Emissivity values were calculated using the Tape reference point and thermal camera software. <b>Results:</b> The external enamel surface mean emissivity value was 0.96 (SD 0.01, 95% CI 0.96-0.97), whereas the internal enamel surface value was 0.97 (SD 0.01, 95% CI 0.96-0.98). The internal crown-dentin mean emissivity value was 0.94 (SD 0.02, 95% CI 0.92-0.95), whereas the internal root-dentin value was 0.93 (SD 0.02, 95% CI 0.91-0.94) and the surface root-dentin had a value of 0.84 (SD 0.04, 95% CI 0.77-0.91). The mean emissivity value of the internal enamel surface with caries was 0.82 (SD 0.05, 95% CI 0.38-1.25), and the value of the internal crown-dentin with caries was 0.73 (SD 0.08, 95% CI 0.54-0.92). <b>Conclusion:</b> The emissivity values of sound enamel, both internal and external, were similar and higher than those of all sound dentin types in this study. Sound dentin emissivity values diminished from the crown to the root and root surface. The lowest emissivity values were recorded in caries lesions of both tissues. This methodology can improve emissivity acquisition for comparison of absolute temperatures between studies which evaluate thermal safety concerns during dental procedures and may offer a caries diagnostic aid.

Also flagged:hepatocellular carcinomatumorinflammatory responseimmune responseLiver cancercancer
Journal Article 2022-10-24 ✓ 3 Snippets Kimm MA, Kästle S, Stechele MMR, Öcal E, Richter L, Ümütlü MR, Schinner R, Öcal O, Salvermoser L, Alunni-Fabbroni M, Seidensticker M, Goldberg SN, Ricke J, Wildgruber M.
In-Text Gene Mentions

This result may be explained by an underlying hemochromatosis with a mutation in the HFE gene.

…by an underlyinghemochromatosiswith a mutation…

…mutation in theHFEgene.…

Show Full Abstract

Local ablative therapies are established treatment modalities in the treatment of early- and intermediate-stage hepatocellular carcinoma (HCC). Systemic effects of local ablation on circulating immune cells may contribute to patients' response. Depending on their activation, myeloid cells are able to trigger HCC progression as well as to support anti-tumor immunity. Certain priming of monocytes may already occur while still in the circulation. By using flow cytometry, we analyzed peripheral blood monocyte cell populations from a prospective clinical trial cohort of 21 HCC patients following interstitial brachytherapy (IBT) or radiofrequency ablation (RFA) and investigated alterations in the composition of monocyte subpopulations and monocytic myeloid-derived suppressor cells (mMDSCs) as well as receptors involved in orchestrating monocyte function. We discovered that mMDSC levels increased following both IBT and RFA in virtually all patients. Furthermore, we identified varying alterations in the level of monocyte subpopulations following radiation compared to RFA. (A) Liquid biopsy liquid biopsy of circulating monocytes in the future may provide information on the inflammatory response towards local ablation as part of an orchestrated immune response.

Also flagged:GCLMtumorBladder cancerferroptosisPD-L1STAT
Journal Article 2022-10-24 ✓ 2 Snippets Wang S, Wang H, Zhu S, Li F.
In-Text Gene Mentions

…including the GUCY1A1,PRDX6, GCLM, ACSL5 and…

…overexpression of GUCY1A1,PRDX6, GCLM and reduction…

Show Full Abstract

Bladder cancer (BCa) is a life-threaten disease with an increasing incidence with age, and immunotherapy has become an important treatment for BCa, while the efficiency of the immune system declines with age. It is vital to reveal the mechanisms of tumor immune microenvironment (TIME) and identify novel immunotherapy targets for BCa. Through analyzing the RNA-seq of TCGA-BLCA cohort, we distinguished two ferroptosis-related BCa clusters, and we discovered that in comparation with cluster 2, the cluster 1 BCa patients showed higher PD-L1 expression, more unfavorable overall survival and higher tumor stage and grade. XCELL analyses showed that higher level of Th2 cell and Myeloid dendritic cell were enriched in cluster 1, while NK T cell was enriched in cluster 2, and TIDE analysis revealed that cluster 2 was more sensitive to immunotherapy than cluster 1. GSEA analysis implied that Toll-like signaling pathway and JAK_STAT signaling pathway were significantly enriched in cluster 1. Subsequently, through performing bioinformatic analysis and cell experiments, we demonstrated that GCLM is overexpressed in BCa and indicates dismal prognosis, and knockdown of GCLM can significantly suppress the colony formation ability of BCa cells. Furthermore, we also found that GCLM might be correlated with immune infiltration in BCa, and can serve as a tumor promotor and immunological biomarker in BCa, our research showed the vital roles of ferroptosis regulators in TIME of BCa, and GCLM is a latent therapeutic target for cancer immunotherapy.

Also flagged:Systemic lupus erythematosusSLEinflammatory diseaseautoantibodieschromatinribonucleoproteins
Journal Article 2022-10-24 ✓ 2 Snippets Carrillo-Rodríguez P, Robles-Guirado JÁ, Cruz-Palomares A, Palacios-Pedrero MÁ, González-Paredes E, Más-Ciurana A, Franco-Herrera C, Ruiz-de-Castroviejo-Teba PA, Lario A, Longobardo V, Montosa-Hidalgo L, Pérez-Sánchez-Cañete MM, Corzo-Corbera MM, Redondo-Sánchez S, Jodar AB, Blanco FJ, Zumaquero E, Merino R, Sancho J, Zubiaur M.
In-Text Gene Mentions

…Serpina3-related genes, andantithrombin-IIIencoded by Serpinc1,…

…antithrombin-III encoded bySerpinc1, the most important…

Show Full Abstract

In CD38-deficient ( <i><i>Cd38<sup>-/-</sup></i> )</i> mice intraperitoneal injection of pristane induces a lupus-like disease, which is milder than that induced in WT mice, showing significant differences in the inflammatory and autoimmune processes triggered by pristane. Extracellular vesicles (EV) are present in all body fluids. Shed by cells, their molecular make-up reflects that of their cell of origin and/or tissue pathological situation. The aim of this study was to analyze the protein composition, protein abundance, and functional clustering of EV released by peritoneal exudate cells (PECs) in the pristane experimental lupus model, to identify predictive or diagnostic biomarkers that might discriminate the autoimmune process in lupus from inflammatory reactions and/or normal physiological processes. In this study, thanks to an extensive proteomic analysis and powerful bioinformatics software, distinct EV subtypes were identified in the peritoneal exudates of pristane-treated mice: 1) small EV enriched in the tetraspanin CD63 and CD9, which are likely of exosomal origin; 2) small EV enriched in CD47 and CD9, which are also enriched in plasma-membrane, membrane-associated proteins, with an ectosomal origin; 3) small EV enriched in keratins, ECM proteins, complement/coagulation proteins, fibrin clot formation proteins, and endopetidase inhibitor proteins. This enrichment may have an inflammation-mediated mesothelial-to-mesenchymal transition origin, representing a protein corona on the surface of peritoneal exudate EV; 4) HDL-enriched lipoprotein particles. Quantitative proteomic analysis allowed us to identify an anti-inflammatory, Annexin A1-enriched pro-resolving, neutrophil protein signature, which was more prominent in EV from pristane-treated <i>Cd38<sup>-/-</sup></i> mice, and quantitative differences in the protein cargo of the ECM-enriched EV from <i>Cd38<sup>-/-</sup></i> vs WT mice. These differences are likely to be related with the distinct inflammatory outcome shown by <i>Cd38<sup>-/-</sup></i> vs WT mice in response to pristane treatment. Our results demonstrate the power of a hypothesis-free and data-driven approach to transform the heterogeneity of the peritoneal exudate EV from pristane-treated mice in valuable information about the relative proportion of different EV in a given sample and to identify potential protein markers specific for the different small EV subtypes, in particular those proteins defining EV involved in the resolution phase of chronic inflammation.

Also flagged:Transactivation Response DNA-Binding Protein of 43TDP-43trans-activationDNA-binding protein of 43kDapathogenesisbrain disorders
Journal Article 2022-10-24 ✓ 3 Snippets Hussain H, Djurin T, Rodriguez J, Daneelian L, Sundi S, Fadel A, Saadoon Z.
In-Text Gene Mentions

HD is an autosomal dominant disorder caused by a trinucleotide, nucleobase coding triplet cytosine (C), adenine (A), guanine (G) (CAG), repeat mutation of the Huntingtin gene that is responsible for encoding the Huntingtin protein (HTT) and the eventual dysfunction of the subcortical motor circuits [41].

…the Huntingtin protein (HTT) and the eventual…

…MutantHttaggregation precedes the…

Show Full Abstract

The trans-activation response DNA-binding protein of 43kDa (TDP-43) is involved in the pathogenesis of multiple brain disorders. As scientists are unraveling TDP-43 function and its impact on various diseases, we have begun to subcategorize them into TDP-43 proteinopathies. Furthermore, glial cell dysfunction contributes to various disorders, and TDP-43 is involved with glial cells via multiple pathways (direct or indirect) that aggravate the pathophysiology of such disorders. We are only now discovering and understanding the vast and diverse roles TDP-43 plays on neuronal cells and its effects on gliosis and neurodegenerative pathologies. It has multiple roles: mRNA maturation and splicing, transporting and maintaining mRNA stability, a component of stress granules and ubiquitination of dysfunctional or misfolded proteins, transcription of microtubule "Futsch" protein, and a role in maintaining synapse integrity and possibly more as we continue to research and uncover the labyrinth of the neuronal network. TDP-43 could also have a detrimental impact on glial cell activation and pathophysiology in diseases where TDP-43 is associated with its pathogenesis. We will review the pathophysiology of various neurological disorders that are associated with the alteration of the TDP-43 levels along with glial cell activation. Further, multiple diseases have glial cell participation in the pathogenesis, and the role of TDP-43 has not yet been investigated. We, therefore, explore those disorders in the context of both TDP-43 and glial cells involvement. This step will enhance the understanding of neurodegeneration where further research could prompt curative modalities with the advancement of technology.

Also flagged:anxietymood disordersneurogenesislipidmetabolismneuropsychiatric diseases
Journal Article 2022-10-24 No Snippets Herrera-Rivero M, Bohn L, Witten A, Jüngling K, Kaiser S, Richter SH, Stoll M, Sachser N.
Show Full Abstract

<b>Background:</b> The amygdala is crucial for emotional cognitive processing. Affective or emotional states can bias cognitive processes, including attention, memory, and decision-making. This can result in optimistic or pessimistic behaviors that are partially driven by the activation of the amygdala. The resulting emotional cognitive bias is a common feature of anxiety and mood disorders, both of which are interactively influenced by genetic and environmental factors. It is also known that emotional cognitive biases can be influenced by environmental factors. However, little is known about the effects of genetics and/or gene-environment interactions on emotional cognitive biases. We investigated the effects of the genetic background and environmental enrichment on the transcriptional profiles of the mouse amygdala following a well-established cognitive bias test. <b>Methods:</b> Twenty-four female C57BL/6J and B6D2F1N mice were housed either in standard (control) conditions or in an enriched environment. After appropriate training, the cognitive bias test was performed on 19 mice that satisfactorily completed the training scheme to assess their responses to ambiguous cues. This allowed us to calculate an "optimism score" for each mouse. Subsequently, we dissected the anterior and posterior portions of the amygdala to perform RNA-sequencing for differential expression and other statistical analyses. <b>Results:</b> In general, we found only minor changes in the amygdala's transcriptome associated with the levels of optimism in our mice. In contrast, we observed wide molecular effects of the genetic background in both housing environments. The C57BL/6J animals showed more transcriptional changes in response to enriched environments than the B6D2F1N mice. We also generally found more dysregulated genes in the posterior than in the anterior portion of the amygdala. Gene set overrepresentation analyses consistently implicated cellular metabolic responses and immune processes in the differences observed between mouse strains, while processes favoring neurogenesis and neurotransmission were implicated in the responses to environmental enrichment. In a correlation analysis, lipid metabolism in the anterior amygdala was suggested to influence the levels of optimism. <b>Conclusions:</b> Our observations underscore the importance of selecting appropriate animal models when performing molecular studies of affective conditions or emotional states, and suggest an important role of immune and stress responses in the genetic component of emotion regulation.

SSRN 2022-10-24 Preprint (No Snippets API) Alhatlani BY, Aljabr W, Alhamlan FS, Almatroudi A, Azam M, Alsaleem M, Allemailem KS.
Show Full Abstract

Viral RNA–host protein interactions contribute to different aspects of the viral life cycle. Middle East respiratory syndrome coronavirus (MERS-CoV), belonging to the Coronaviridae family, causes the Middle East respiratory syndrome (MERS) that is responsible for approximately 900 deaths most of which occur in the Arabian Peninsula. MERS-CoV has an enveloped positive-sense, single-stranded RNA genome that contains highly conserved RNA secondary structures at the 5ʹ and 3ʹ terminal regions. We conducted this study to identify the host factors that interact with the 5ʹ extremity of the MERS-CoV RNA genome. We performed RNA affinity chromatography followed by mass spectrometry and identified 59 host factors that bind to the 5ʹ end of the MERS-CoV RNA genome in Vero E6 cells. Most of the identified cellular proteins have been previously reported to interact with the genome of other RNA viruses, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), such as STAU1, hnRNP A1, TRIM23, and NCAM. We also validated our mass spectrometry results using western blot analysis. Results suggested that the multifunctional dsRNA-binding protein STAU1 could interact specifically with the RNA stem-loop structure at the 5ʹ end of MERS-CoV and SARS-CoV-2. Protein–protein interaction network analysis revealed that the majority of the identified proteins could interact with each other, indicating that they could be functionally relevant. Altogether, these data enhance our knowledge about the viral RNA–host interactions of coronaviruses, which could thus serve as targets for developing antiviral therapeutics against MERS-CoV and SARS-CoV-2.<br><br>Funding Information: This project was funded by the Ministry of Health, Saudi Arabia (Grant no. 826, on 20/04/2020).<br><br>Declaration of Interests: None to declare.

Also flagged:Exophiala dermatitidis mycosisacute leukemiaE. dermatitidis infectionscutaneous infectionecthyma gangrenosumskin lesions
Journal Article 2022-10-23 ✓ 1 Snippet Nakatani R, Ashiarai M, Yoshihara H, Yada K, Nozaki T, Ushigusa T, Mori N, Hasegawa D.
In-Text Gene Mentions

…chain reaction revealed KMT2A-MLLT10fusion transcript.…

Show Full Abstract

<h4>Background</h4>Exophiala dermatitidis is a dematiaceous fungus isolated from various environmental sources. Systemic E. dermatitidis infections can lead to fatal outcomes, and treatment has not yet been standardized. Although E. dermatitidis is also known to cause cutaneous infection, it has not been previously reported to appear as ecthyma gangrenosum (EG), an uncommon cutaneous lesion in neutropenic patients that is mainly caused by Pseudomonas aeruginosa.<h4>Case presentation</h4>A 2-month-old male infant with mixed-phenotype acute leukemia presented with prolonged fever unresponsive to antibacterial and antifungal agents during myelosuppression due to remission induction therapy. He also presented with skin lesions on the left wrist and left lower quadrant of the abdomen. The abdominal lesion gradually turned black and necrotic, which was consistent with the findings of the EG. E. dermatitidis was isolated from the blood, stool, wrist skin, and endotracheal aspirate. During hematopoietic recovery, consolidation in both lungs was evident. Multiagent antifungal treatment failed to eliminate E. dermatitidis from blood. In order to salvage the central venous catheter, ethanol lock therapy (ELT) was adopted, following which the blood culture became negative. The abdominal lesion that evolved as a necrotic mass connecting the small intestine and subcutaneous tissue adjacent to the skin was surgically resected. After these interventions, the general condition improved.<h4>Conclusion</h4>Disseminated E. dermatitidis mycosis in the neutropenic infant was successfully managed with a multidisciplinary treatment consisting of multiagent antifungal treatment, ELT, and surgery.

Also flagged:methylationimprintingcytosinespathogenesisCtcfmethyl
Journal Article 2022-10-23 ✓ 2 Snippets Sarnataro A, De Riso G, Cocozza S, Pezone A, Majello B, Amente S, Scala G.
In-Text Gene Mentions

…e Huntington’s disease-causingHttgene mutation and…

…dataset comprises heterozygousHttknock-in ( Q175…

Show Full Abstract

DNA methylation is an epigenetic modification that plays a pivotal role in major biological mechanisms, such as gene regulation, genomic imprinting, and genome stability. Different combinations of methylated cytosines for a given DNA locus generate different epialleles and alterations of these latter have been associated with several pathological conditions. Existing computational methods and statistical tests relevant to DNA methylation analysis are mostly based on the comparison of average CpG sites methylation levels and they often neglect non-CG methylation. Here, we present EpiStatProfiler, an R package that allows the analysis of CpG and non-CpG based epialleles starting from bisulfite sequencing data through a collection of dedicated extraction functions and statistical tests. EpiStatProfiler is provided with a set of useful auxiliary features, such as customizable genomic ranges, strand-specific epialleles analysis, locus annotation and gene set enrichment analysis. We showcase the package functionalities on two public datasets by identifying putative relevant loci in mice harboring the Huntington's disease-causing Htt gene mutation and in Ctcf +/- mice compared to their wild-type counterparts. To our knowledge, EpiStatProfiler is the first package providing functionalities dedicated to the analysis of epialleles composition derived from any kind of bisulfite sequencing experiment.

Also flagged:Intestinal TuberculosisAbdominal tuberculosistuberculosisanorexialymphadenopathiesinfectious colitis
Journal Article 2022-10-23 ✓ 1 Snippet Araújo T, Silva A, Laranjo P, Shigaeva Y, Bernardo T.
In-Text Gene Mentions

…were normal, excludinghemochromatosis.…

Show Full Abstract

Abdominal tuberculosis is an uncommon clinical entity, and it can involve the gastrointestinal tract but also the peritoneum, lymph nodes, and solid organs. Its prevalence is higher among individuals from endemic regions for tuberculosis. Epidemiological risk factors associated with typical symptoms and complementary exams should prompt early treatment. We describe the case of a 47-year-old man, originally from India, residing in Portugal for approximately a year. He presented to our emergency department with a three-week-long history of diarrhea, diffuse abdominal pain, more intense on the left quadrants of the abdomen, anorexia, asthenia, and loss of nearly 10% of his body weight. Abdominal and pelvic imaging showed diffuse circumferential thickening of the distal ileum and adjacent mesentery with associated lymphadenopathies. A colonoscopy confirmed the presence of an ulcerated deformative lesion of the cecum with the involvement of the terminal ileum. Initial suspicion of infectious colitis versus inflammatory bowel disease led the team to prescribe antibiotics and corticosteroid therapy, which was associated with bronchoalveolar lavage and sputum samples negative for <i>Mycobacterium tuberculosis</i>, delaying the diagnosis of intestinal tuberculosis. The lack of improvement after weeks of the initial medical therapy, and with histopathological examination of cervical lymphadenopathy showing the presence of granulomatous lymphadenitis with necrosis, led the medical team to start antituberculostatic therapy. The patient showed significant clinical and laboratory improvement, but after two months of adequate treatment a cavitated nodule appeared on the upper lobe of the left lung, and a <i>Mycobacterium tuberculosis</i> <i>complex</i> was identified in the bronchoalveolar lavage. Timely diagnosis and adequate treatment are essential to lower mortality rates of intestinal tuberculosis, and epidemiological risk factors have a great deal of importance on this matter and must always be taken into account.

Also flagged:Endometrial cancersatypical endometrial hyperplasiaendometrioid endometrial cancerendometrial cancerLCN2SAA1
Journal Article 2022-10-22 ✓ 1 Snippet Ren X, Liang J, Zhang Y, Jiang N, Xu Y, Qiu M, Wang Y, Zhao B, Chen X.
In-Text Gene Mentions

…cells ( PECAM1,PCDH17) 19 ,…

Show Full Abstract

Endometrial cancers are complex ecosystems composed of cells with distinct phenotypes, genotypes, and epigenetic states. Current models do not adequately reflect oncogenic origin and pathological progression in patients. Here we use single-cell RNA sequencing to profile cells from normal endometrium, atypical endometrial hyperplasia, and endometrioid endometrial cancer (EEC), which altogether represent the step-by-step development of endometrial cancer. We find that EEC originates from endometrial epithelial cells but not stromal cells, and unciliated glandular epithelium is the source of EEC. We also identify LCN2 + /SAA1/2 + cells as a featured subpopulation of endometrial tumorigenesis. Finally, the stromal niche and immune environment changes during EEC progression are described. This study elucidates the evolution of cell populations in EEC development at single-cell resolution, which would provide a direction to facilitate EEC research and diagnosis.

Also flagged:HTstroketissue plasminogen activatorhemorrhagiciron oxide nanoparticlesoxygen
Journal Article 2022-10-22 No Snippets Choi W, Cho H, Kim G, Youn I, Key J, Han S.
Show Full Abstract

<h4>Background</h4>Recombinant tissue plasminogen activator (rtPA) has a short half-life, and additional hemorrhagic transformation (HT) can occur when treatment is delayed. Here, we report the design and thrombolytic performance of 3 [Formula: see text]m discoidal polymeric particles loaded with rtPA and superparamagnetic iron oxide nanoparticles (SPIONs), referred to as rmDPPs, to address the HT issues of rtPA.<h4>Methods</h4>The rmDPPs consisted of a biodegradable polymeric matrix, rtPA, and SPIONs and were synthesized via a top-down fabrication.<h4>Results</h4>The rmDPPs could be concentrated at the target site with magnetic attraction, and then the rtPA could be released under acoustic stimulus. Therefore, we named that the particles had magnetoacoustic properties. For the in vitro blood clot lysis, the rmDPPs with magnetoacoustic stimuli could not enhance the lytic potential compared to the rmDPPs without stimulation. Furthermore, although the reduction of the infarcts in vivo was observed along with the magnetoacoustic stimuli in the rmDPPs, more enhancement was not achieved in comparison with the rtPA. A notable advantage of rmDPPs was shown in delayed administration of rmDPPs at poststroke. The late treatment of rmDPPs with magnetoacoustic stimuli could reduce the infarcts and lead to no additional HT issues, while rtPA alone could not show any favorable prognosis.<h4>Conclusion</h4>The rmDPPs may be advantageous in delayed treatment of thrombotic patients.

Also flagged:vitamin Dbehavioralnitric oxideC-reactive proteinattention deficit/hyperactivity disorderADHD
Journal Article 2022-10-22 No Snippets Sangouni AA, Mirhosseini H, Hosseinzadeh M.
Show Full Abstract

<h4>Background</h4>Attention deficit/hyperactivity disorder (ADHD) is the most common chronic mental and behavioral disorder among children. Some studies showed the lower levels of vitamin D in patients with ADHD compared with the healthy people. Few clinical trials were conducted in this field. The present study will be performed to examine the effect of vitamin D supplementation in children with ADHD.<h4>Methods</h4>We will conduct a double-blind, randomized controlled clinical trial to investigate the effect of vitamin D supplementation on brain waves, behavioral performance, serum nitric oxide, malondialdehyde, and high-sensitivity C-reactive protein in 50 patients with ADHD. The intervention group will receive one capsule 50,000 IU vitamin D every week, for 8 weeks. The control group will receive one placebo capsule containing 1000 mg olive oil every week. Electroencephalography will be performed for 10 min using Brain Master Discovery from 19 scalp sites both before the first intervention and the 10 sessions of the therapy. The artifact-free periods of 1-min electroencephalography data will be analyzed for quantitative electroencephalography measures.<h4>Discussion</h4>For the first time, this clinical trial will evaluate the effect of vitamin D supplementation on brain waves, serum nitric oxide, malondialdehyde, and high-sensitivity C-reactive protein in patients with ADHD. The results of the present clinical trial will provide a better vision about the vitamin D efficacy in patients with ADHD.<h4>Trial registration</h4>Registered on 5 November 2020 at Iranian Registry of Clinical Trials with code number IRCT20200922048802N1 ( https://www.irct.ir/trial/51410 ).

Also flagged:Endometrial Cancertumorestrogenluciferasebreast cancerglucocorticoid receptors
Journal Article 2022-10-22 No Snippets Guerra-Rodríguez M, López-Rojas P, Amesty Á, Aranda-Tavío H, Brito-Casillas Y, Estévez-Braun A, Fernández-Pérez L, Guerra B, Recio C.
Show Full Abstract

Tamoxifen improves the overall survival rate in hormone receptor-positive breast cancer patients. However, despite the fact that it exerts antagonistic effects on the ERα, it can act as a partial agonist, resulting in tumor growth in estrogen-sensitive tissues. In this study, highly functionalized 5-hydroxy-2<i>H</i>-pyrrol-2-ones were synthesized and evaluated by using ERα- and phenotype-based screening assays. Compounds <b>32</b> and <b>35</b> inhibited 17β-estradiol (E2)-stimulated ERα-mediated transcription of the luciferase reporter gene in breast cancer cells without inhibition of the transcriptional activity mediated by androgen or glucocorticoid receptors. Compound <b>32</b> regulated E2-stimulated ERα-mediated transcription by partial antagonism, whereas compound <b>35</b> caused rapid and non-competitive inhibition. Monitoring of 2D and 3D cell growth confirmed potent antitumoral effects of both compounds on ER-positive breast cancer cells. Furthermore, compounds <b>32</b> and <b>35</b> caused apoptosis and blocked the cell cycle of ER-positive breast cancer cells in the sub-G1 and G0/G1 phases. Interestingly, compound <b>35</b> suppressed the functional activity of ERα in the uterus, as demonstrated by the inhibition of E2-stimulated transcription of estrogen and progesterone receptors and alkaline phosphatase enzymatic activity. Compound <b>35</b> showed a relatively low binding affinity with ERα. However, its antiestrogenic effect was associated with an increased polyubiquitination and a reduced protein expression of ERα. Clinically relevant, a possible combinatory therapy with compound <b>35</b> may enhance the antitumoral efficacy of 4-hydroxy-tamoxifen in ER-positive breast cancer cells. In silico ADME predictions indicated that these compounds exhibit good drug-likeness, which, together with their potential antitumoral effects and their lack of estrogenic activity, offers a pharmacological opportunity to deepen the study of ER-positive breast cancer treatment.

Also flagged:FIP200MethylationSETD2Trim21RB1CC1autophagy
Journal Article 2022-10-22 ✓ 2 Snippets Dai Y, Luo W, Li W, Chen Z, Wang X, Chang J.
In-Text Gene Mentions

…Cul3-KLHL20, MUL1, and NEDD4L…

…of p62, TAX1BP1,CCPG1, and Rab5 […

Show Full Abstract

FIP200, also known as RB1CC1, is a protein that assembles the autophagy initiation complex. Its post-translational modifications and degradation mechanisms are unclear. Upon autophagy activation, we find that FIP200 is methylated at lysine1133 (K1133) by methyltransferase SETD2. We identify the E3 ligase Trim21 to be responsible for FIP200 ubiquitination by targeting K1133, resulting in FIP200 degradation through the ubiquitin-proteasome system. SETD2-induced methylation blocks Trim21-mediated ubiquitination and degradation, preserving autophagy activity. SETD2 and Trim21 orchestrate FIP200 protein stability to achieve dynamic and precise control of autophagy flux.

Also flagged:Netrin-1Neogeninneural guidance factorcancermelanomaCell migration
Journal Article 2022-10-22 ✓ 5 Snippets Untiveros G, Raskind A, Linares L, Dotti A, Strizzi L.
In-Text Gene Mentions

In contrast, another report described expression of both Netrin-1 and DCC in melanoma, which appeared to play a role in survival and progression of melanoma [18].

For instance, one study showed that melanoma cells do not express Netrin-1 or DCC but express UNC5 receptors, which trigger endothelial cell repulsion [17].

…the Netrin-1 receptorsDCC(deleted in colon…

…to UNC5 andDCCalso appears to…

…express Netrin-1 orDCCbut express UNC5…

Show Full Abstract

Netrin-1 is a neural guidance factor that regulates migration and positioning of neural crest-derived cells during embryonic development. Depending on the type of Netrin-1 receptor expression, cells are either attracted or repulsed by Netrin-1. Postnatal expression of Netrin-1 is detected in brain, colon, liver, and kidney, which are common sites of cancer metastasis, including melanoma. Thus, understanding the dynamics between Netrin-1 and its receptors could explain the attraction of melanoma towards these Netrin-1-expressing tissues. Here, we investigate whether the Netrin-1-attractive receptor Neogenin can affect migration of melanoma cells towards a Netrin-1 source. Results from Western blot (WB) analysis show higher expression of Neogenin in aggressive compared to non-aggressive melanoma cells. Cell migration experiments show increased migration of Neogenin-expressing aggressive melanoma cells towards exogenous, soluble recombinant human Netrin-1 and towards a Netrin-1-expressing cell line. Furthermore, WB reveals ERK1/2 activation and increased N-cadherin expression in Neogenin-expressing aggressive melanoma cells treated with rhNetrin-1. Moreover, treatment with anti-Neogenin blocking antibody caused decreased migration towards Netrin-1-expressing cells and reduced ERK1/2 activity in Neogenin-expressing aggressive melanoma cells. These results suggest Neogenin may play a role during migration of melanoma cells towards Netrin-1 via ERK1/2 signaling.

Also flagged:Glaucomablindnessoptic nerve degenerationglaucomatous neuropathyaxonsretinal ischemia
Journal Article 2022-10-22 No Snippets Youale J, Bigot K, Kodati B, Jaworski T, Fan Y, Nsiah NY, Pappenhagen N, Inman DM, Behar-Cohen F, Bordet T, Picard E.
Show Full Abstract

Iron is essential for retinal metabolism, but an excess of ferrous iron causes oxidative stress. In glaucomatous eyes, retinal ganglion cell (RGC) death has been associated with dysregulation of iron homeostasis. Transferrin (TF) is an endogenous iron transporter that controls ocular iron levels. Intraocular administration of TF is neuroprotective in various models of retinal degeneration, preventing iron overload and reducing iron-induced oxidative stress. Herein, we assessed the protective effects of TF on RGC survival, using ex vivo rat retinal explants exposed to iron, NMDA-induced excitotoxicity, or CoCl<sub>2</sub>-induced hypoxia, and an in vivo rat model of ocular hypertension (OHT). TF significantly preserved RGCs against FeSO<sub>4</sub>-induced toxicity, NMDA-induced excitotoxicity, and CoCl<sub>2</sub>-induced hypoxia. TF protected RGCs from apoptosis, ferroptosis, and necrosis. In OHT rats, TF reduced RGC loss by about 70% compared to vehicle-treated animals and preserved about 47% of the axons. Finally, increased iron staining was shown in the retina of a glaucoma patient's eye as compared to non-glaucomatous eyes. These results indicate that TF can interfere with different cell-death mechanisms involved in glaucoma pathogenesis and demonstrate the ability of TF to protect RGCs exposed to elevated IOP. Altogether, these results suggest that TF is a promising treatment against glaucoma neuropathy.

Also flagged:Systemic Juvenile Idiopathic ArthritisMacrophage Activation SyndromesJIAcritical diseasesviral infectionsneoplasia
Journal Article 2022-10-22 ✓ 2 Snippets Ailioaie LM, Ailioaie C, Litscher G.
In-Text Gene Mentions

…(most: CD177 ,OLFM4, ARHGEF12 ,…

…, MPO ,OLFM4, and PGLYRP1…

Show Full Abstract

Systemic juvenile idiopathic arthritis (sJIA) and its complication, macrophage activation syndrome (sJIA-MAS), are rare but sometimes very serious or even critical diseases of childhood that can occasionally be characterized by nonspecific clinical signs and symptoms at onset-such as non-remitting high fever, headache, rash, or arthralgia-and are biologically accompanied by an increase in acute-phase reactants. For a correct positive diagnosis, it is necessary to rule out bacterial or viral infections, neoplasia, and other immune-mediated inflammatory diseases. Delays in diagnosis will result in late initiation of targeted therapy. A set of biomarkers is useful to distinguish sJIA or sJIA-MAS from similar clinical entities, especially when arthritis is absent. Biomarkers should be accessible to many patients, with convenient production and acquisition prices for pediatric medical laboratories, as well as being easy to determine, having high sensitivity and specificity, and correlating with pathophysiological disease pathways. The aim of this review was to identify the newest and most powerful biomarkers and their synergistic interaction for easy and accurate recognition of sJIA and sJIA-MAS, so as to immediately guide clinicians in correct diagnosis and in predicting disease outcomes, the response to treatment, and the risk of relapses. Biomarkers constitute an exciting field of research, especially due to the heterogeneous nature of cytokine storm syndromes (CSSs) in the COVID era. They must be selected with utmost care-a fact supported by the increasingly improved genetic and pathophysiological comprehension of sJIA, but also of CSS-so that new classification systems may soon be developed to define homogeneous groups of patients, although each with a distinct disease.

Also flagged:colony-stimulating factor-1 receptorinfectionanti-inflammatory cytokineshomeostasismacrophage differentiationcolony-stimulating factor-1
Journal Article 2022-10-21 ✓ 1 Snippet Yadav S, Priya A, Borade DR, Agrawal-Rajput R.
In-Text Gene Mentions

Moreover, combining the highly specific CSF-1R inhibitors such as DCC-3014 and ARRY-382 with avelumab and pembrolizumab, respectively, has shown significant potential as a technique for inducing tumor suppression by multifactorial immune cell regulation[136, 212].

Show Full Abstract

Macrophages are one of the first innate immune cells to reach the site of infection or injury. Diverse functions from the uptake of pathogen or antigen, its killing, and presentation, the release of pro- or anti-inflammatory cytokines, activation of adaptive immune cells, clearing off tissue debris, tissue repair, and maintenance of tissue homeostasis have been attributed to macrophages. Besides tissue-resident macrophages, the circulating macrophages are recruited to different tissues to get activated. These are highly plastic cells, showing a spectrum of phenotypes depending on the stimulus received from their immediate environment. The macrophage differentiation requires colony-stimulating factor-1 (CSF-1) or macrophage colony-stimulating factor (M-CSF), colony-stimulating factor-2 (CSF-2), or granulocyte-macrophage colony-stimulating factor (GM-CSF) and different stimuli activate them to different phenotypes. The richness of tissue macrophages is precisely controlled via the CSF-1 and CSF-1R axis. In this review, we have given an overview of macrophage origin via hematopoiesis/myelopoiesis, different phenotypes associated with macrophages, their clinical significance, and how they are altered in various diseases. We have specifically focused on the function of CSF-1/CSF-1R signaling in deciding macrophage fate and the outcome of aberrant CSF-1R signaling in relation to macrophage phenotype in different diseases. We further extend the review to briefly discuss the possible strategies to manipulate CSF-1R and its signaling with the recent updates.

Also flagged:autophagypathogenesismembranecell-cell adhesionproteinmitochondrial
Journal Article 2022-10-21 No Snippets Marzoog BA.
Show Full Abstract

Endothelial cells (EC) are the anatomical boundaries between the intravascular and extravascular space. Damage to ECs is catastrophic and induces endothelial cell dysfunction. The pathogenesis is multifactorial and involves dysregulation in the signaling pathways, membrane lipids ratio disturbance, cell-cell adhesion disturbance, unfolded protein response, lysosomal and mitochondrial stress, autophagy dysregulation, and oxidative stress. Autophagy is a lysosomal-dependent turnover of intracellular components. Autophagy was recognized early in the pathogenesis of endothelial dysfunction. Autophagy is a remarkable patho (physiological) process in the cell homeostasis regulation including EC. Regulation of autophagy rate is disease-dependent and impaired with aging. Up-regulation of autophagy induces endothelial cell regeneration/differentiation and improves the function of impaired ones. The paper scrutinizes the molecular mechanisms and triggers of EC dysregulation and current perspectives for future therapeutic strategies by autophagy targeting.

Also flagged:venous thromboembolismATsecretiontype I AT deficiencytype II AT deficiencyantithrombin deficiency
Journal Article 2022-10-21 ✓ 5 Snippets Li M, Jiang S, Liu S, Jin Y, Wang M.
In-Text Gene Mentions

…caused by variousSERPINC1defects associated with…

…flanking sequences ofSERPINC1were amplified by…

…TheSERPINC1gene analysis indicated…

…AT gene (SERPINC1) which encodes…

…defect in theSERPINC1gene.…

Show Full Abstract

<h4>Background</h4>Inherited AT deficiency is an autosomal-dominant thrombophilic disorder usually caused by various SERPINC1 defects associated with a high risk of recurrent venous thromboembolism. In this article, the phenotype, gene mutation, and molecular pathogenic mechanisms were determined in three pedigrees with inherited AT deficiency.<h4>Methods</h4>Coagulation indices were examined on STAGO STA-R-MAX analyzer. The AT:Ag was analyzed by ELISA. All exons and flanking sequences of SERPINC1 were amplified by PCR. AT wild type and three mutant expression plasmids were constructed and then transfected into HEK293FT cells. The expression level of AT protein was analyzed by ELISA and Western blot.<h4>Results</h4>The AT:A and AT:Ag of probands 1 and 3 were decreased to 49% and 52 mg/dL, 38% and 44 mg/dL, respectively. The AT:A of proband 2 was decreased to 32%. The SERPINC1 gene analysis indicated that there was a p.Ile421Thr in proband 1, a p.Leu417Gln in proband 2, and a p.Met252Thr in proband 3, respectively. The AT mRNA expression level of the three mutants was not significantly different from AT-WT by qRT-PCR. The results of ELISA and Western blot tests showed that the AT-M252T and AT-I421T mutants had a higher AT expression than the AT wild type (AT-WT), and the AT protein expression of AT-L417Q mutants had no significant difference compared with AT-WT in the cell lysate. The AT expression levels of AT-M252T and AT-I421T mutants were lower than that of AT-WT, and there was no significant difference between AT-L417Q mutant and AT-WT in the supernatant.<h4>Conclusion</h4>The p.I421T and p.M252T mutations affected the secretion of AT protein leading to type I AT deficiency of probands 1 and 3. The p.Leu417Gln mutation was responsible for the impaired or ineffective activity AT protein in proband 2 and caused type II AT deficiency.

Also flagged:cytokinezinc finger protein 36degradationZFP36immune cell activationautoimmune encephalomyelitits
Journal Article 2022-10-21 ✓ 1 Snippet Cook ME, Bradstreet TR, Webber AM, Kim J, Santeford A, Harris KM, Murphy MK, Tran J, Abdalla NM, Schwarzkopf EA, Greco SC, Halabi CM, Apte RS, Blackshear PJ, Edelson BT.
In-Text Gene Mentions

Roquin-1

Show Full Abstract

RNA binding proteins are important regulators of T cell activation, proliferation, and cytokine production. The zinc finger protein 36 (ZFP36) family genes (<i>Zfp36</i>, <i>Zfp36l1</i>, and <i>Zfp36l2</i>) encode RNA binding proteins that promote the degradation of transcripts containing AU-rich elements. Numerous studies have demonstrated both individual and shared functions of the ZFP36 family in immune cells, but their collective function in T cells remains unclear. Here, we found a redundant and critical role for the ZFP36 proteins in regulating T cell quiescence. T cell-specific deletion of all three ZFP36 family members in mice resulted in early lethality, immune cell activation, and multiorgan pathology characterized by inflammation of the eyes, central nervous system, kidneys, and liver. Mice with T cell-specific deletion of any two <i>Zfp36</i> genes were protected from this spontaneous syndrome. Triply deficient T cells overproduced proinflammatory cytokines, including IFN-γ, TNF, and GM-CSF, due to increased mRNA stability of these transcripts. Unexpectedly, T cell-specific deletion of both <i>Zfp36l1</i> and <i>Zfp36l2</i> rendered mice resistant to experimental autoimmune encephalomyelitits due to failed priming of antigen-specific CD4<sup>+</sup> T cells. ZFP36L1 and ZFP36L2 double-deficient CD4<sup>+</sup> T cells had poor proliferation during in vitro T helper cell polarization. Thus, the ZFP36 family redundantly regulates T cell quiescence at homeostasis, but ZFP36L1 and ZFP36L2 are specifically required for antigen-specific T cell clonal expansion.

Also flagged:Homeostasisinfarctcancerinjurycirrhosisliver cancer
Journal Article 2022-10-21 ✓ 1 Snippet Huppert SS, Schwartz RE.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Liver regeneration occurs in response to diverse injuries and is capable of functionally reestablishing the lost parenchyma. This phenomenon has been known since antiquity, encapsulated in the Greek myth where Prometheus was to be punished by Zeus for sharing the gift of fire with humanity by having an eagle eat his liver daily, only to have the liver regrow back, thus ensuring eternal suffering and punishment. Today, this process is actively leveraged clinically during living donor liver transplantation whereby up to a two-thirds hepatectomy (resection or removal of part of the liver) on a donor is used for transplant to a recipient. The donor liver rapidly regenerates to recover the lost parenchymal mass to form a functional tissue. This astonishing regenerative process and unique capacity of the liver are examined in further detail in this review.

Also flagged:DNA methyltransferase 3ADNA methyltransferase 3 ADNMT3Ainflammatory bowel diseasemethylationtumor necrosis factor
Journal Article 2022-10-21 ✓ 2 Snippets Fazio A, Bordoni D, Kuiper JWP, Weber-Stiehl S, Stengel ST, Arnold P, Ellinghaus D, Ito G, Tran F, Messner B, Henning A, Bernardes JP, Häsler R, Luzius A, Imm S, Hinrichsen F, Franke A, Huber S, Nikolaus S, Aden K, Schreiber S, Sommer F, Natoli G, Mishra N, Rosenstiel P.
In-Text Gene Mentions

…(01027166), Dnmt3b (01240113),Olfm4(01320260), Ccnd1 (00432359),…

…stem cell markerOlfm4and the proliferative…

Show Full Abstract

Genetic variants in the DNA methyltransferase 3 A (DNMT3A) locus have been associated with inflammatory bowel disease (IBD). DNMT3A is part of the epigenetic machinery physiologically involved in DNA methylation. We show that DNMT3A plays a critical role in maintaining intestinal homeostasis and gut barrier function. DNMT3A expression is downregulated in intestinal epithelial cells from IBD patients and upon tumor necrosis factor treatment in murine intestinal organoids. Ablation of DNMT3A in Caco-2 cells results in global DNA hypomethylation, which is linked to impaired regenerative capacity, transepithelial resistance and intercellular junction formation. Genetic deletion of Dnmt3a in intestinal epithelial cells (Dnmt3a<sup>ΔIEC</sup>) in mice confirms the phenotype of an altered epithelial ultrastructure with shortened apical-junctional complexes, reduced Goblet cell numbers and increased intestinal permeability in the colon in vivo. Dnmt3a<sup>ΔIEC</sup> mice suffer from increased susceptibility to experimental colitis, characterized by reduced epithelial regeneration. These data demonstrate a critical role for DNMT3A in orchestrating intestinal epithelial homeostasis and response to tissue damage and suggest an involvement of impaired epithelial DNMT3A function in the etiology of IBD.

Also flagged:Nucleic Acidtype 2 diabetescardiovascular diseasesgene expressioncancerbinding
Journal Article 2022-10-21 ✓ 1 Snippet Kumari N, Siddhanta K, Panja S, Joshi V, Jogdeo C, Kapoor E, Khan R, Kollala SS, Kumar B, Sil D, Singh AB, Murry DJ, Oupický D.
In-Text Gene Mentions

…single gene (e.g.,hemochromatosis) whereas others are…

Show Full Abstract

Nucleic acid (NA) therapy has gained importance over the past decade due to its high degree of selectivity and minimal toxic effects over conventional drugs. Currently, intravenous (IV) or intramuscular (IM) formulations constitute majority of the marketed formulations containing nucleic acids. However, oral administration is traditionally preferred due to ease of administration as well as higher patient compliance. To leverage the benefits of oral delivery for NA therapy, the NA of interest must be delivered to the target site avoiding all degrading and inhibiting factors during its transition through the gastrointestinal tract. The oral route presents myriad of challenges to NA delivery, making formulation development challenging. Researchers in the last few decades have formulated various delivery systems to overcome such challenges and several reviews summarize and discuss these strategies in detail. However, there is a need to differentiate between the approaches based on target so that in future, delivery strategies can be developed according to the goal of the study and for efficient delivery to the desired site. The goal of this review is to summarize the mechanisms for target specific delivery, list and discuss the formulation strategies used for oral delivery of NA therapies and delineate the similarities and differences between local and systemic targeting oral delivery systems and current challenges.

Also flagged:axonssynapticcell surface proteinsaxoninnervationCSP
Journal Article 2022-10-21 ✓ 1 Snippet Lobb-Rabe M, DeLong K, Salazar RJ, Zhang R, Wang Y, Carrillo RA.
In-Text Gene Mentions

…the IgLON family,Negr1, signals through the…

Show Full Abstract

The paths axons travel to reach their targets and the subsequent synaptic connections they form are highly stereotyped. How cell surface proteins (CSPs) mediate these processes is not completely understood. The Drosophila neuromuscular junction (NMJ) is an ideal system to study how pathfinding and target specificity are accomplished, as the axon trajectories and innervation patterns are known and easily visualized. Dpr10 is a CSP required for synaptic partner choice in the neuromuscular and visual circuits and for axon pathfinding in olfactory neuron organization. In this study, we show that Dpr10 is also required for motor axon pathfinding. To uncover how Dpr10 mediates this process, we used immunoprecipitation followed by mass spectrometry to identify Dpr10 associated proteins. One of these, Nocte, is an unstructured, intracellular protein implicated in circadian rhythm entrainment. We mapped nocte expression in larvae and found it widely expressed in neurons, muscles, and glia. Cell-specific knockdown suggests nocte is required presynaptically to mediate motor axon pathfinding. Additionally, we found that nocte and dpr10 genetically interact to control NMJ assembly, suggesting that they function in the same molecular pathway. Overall, these data reveal novel roles for Dpr10 and its newly identified interactor, Nocte, in motor axon pathfinding and provide insight into how CSPs regulate circuit assembly.

Also flagged:Breast cancersolid tumortriple‐negative breast cancerestrogen receptorsERprogesterone receptors
Journal Article 2022-10-21 ✓ 2 Snippets Zhu Y, Zhang H, Pan C, He G, Cui X, Yu X, Zhang X, Wu D, Yang J, Wu X, Luo H, Liu X.
In-Text Gene Mentions

Consistent with previous studies,51 the most frequently mutated genes in TNBC patients were TP53 (95%), PIK3CA (29%), TTN (19%), FSIP2 (19%), SYNE1 (19%), TONSL (19%), PKHD1L1 (14%), ADCY8 (14%), CACNA1E (14%), and CEP63 (14%) (Figure 2A and Table S2).

…(14%), ADCY8 (14%),CACNA1E(14%), and CEP63…

Show Full Abstract

<h4>Background</h4>Although neoadjuvant chemotherapy (NAC) is currently the best therapy for triple-negative breast cancer (TNBC), resistance still occurs in a considerable proportion, thus it is crucial to understand resistance mechanisms and identify predictive biomarkers for patients selection.<h4>Methods</h4>Biopsy samples were collected from 21 patients with TNBC who underwent NAC. Whole-exome sequencing (WES), targeted sequencing, and multiplex immunohistochemistry (mIHC) were carried out on the clinical samples and used to identify and validate potential biomarkers associated with response to NAC. In addition, data on 190 TNBC patients who had undergone chemotherapy were obtained from The Cancer Genome Atlas (TCGA) and analyzed to further validate our findings.<h4>Results</h4>Both the tumor mutational burden (TMB) and tumor neoantigen burden (TNB) were significantly higher in responders than in non-responders. Higher response rates and longer survival rates were observed in patients with higher TMB. Patients with higher ratios of CD8 to M2 macrophages had higher response rates and improved survival rates. Finally, the integrated analysis demonstrated that the combination of TMB and the ratio of CD8 T cells to M2 macrophages could further distinguish patients who benefitted from the treatment in both enrolled patients and public data.<h4>Conclusions</h4>The findings of this study indicated that the combination of TMB and the ratio of CD8 T cells to M2 macrophages may be a potential biomarker for improving the recognition of NAC responders, thereby providing a basis for developing precision NAC regimens.

Also flagged:Primary Liver CancerGGTAFPTERTtumorvp
Journal Article 2022-10-21 ✓ 1 Snippet Akuta N, Sezaki H, Fujiyama S, Kawamura Y, Hosaka T, Kobayashi M, Saitoh S, Arase Y, Ikeda K, Suzuki Y, Suzuki F, Kumada H.
In-Text Gene Mentions

…to have nohemochromatosis, Wilson disease, primary…

Show Full Abstract

<h4>Introduction</h4>Simple predictive markers enabling even nonspecialized medical doctors and clinicopathological features of primary liver cancer (PLC) following HCV clearance with direct-acting antivirals (DAAs) are unclear.<h4>Methods</h4>The subjects of this retrospective study were 2,476 patients following HCV clearance with DAAs. All patients were confirmed to be PLC-free before and during DAAs.<h4>Results</h4>PLC was diagnosed in 73 patients during the follow-up, with an incidence rate per 1 000 person-years of 5.9. The annual rate of PLC during the first 6 years was 0.6%. Multivariate analysis identified gender, GGT, and FIB-4 index as the significant determinants of PLC. According to a combination of these risk factors, the cumulative PLC incidence rates were significantly different among the five subgroups based on the number of PLC risk scores. In 73 patients with PLC, the rates of abnormal AFP, PIVKAII, and serum TERT C228T positive were 37.0, 32.4, and 22.2%. PIVKAII levels in BCLC stage A and B were significantly higher than those in stage 0. In 41 patients, who underwent surgical resection for PLC, maximum tumor diameters of abnormal PIVKAII were significantly larger than those of normal PIVKAII. PLC of abnormal PIVKAII significantly indicated presence of vp more than that of normal PIVKAII, and did not contain well-differentiated HCC.<h4>Conclusions</h4>Combination of simple markers, enabling even nonspecialized medical doctors, is useful for the evaluation of PLC risk following HCV clearance with DAAs. However, imaging studies are regularly recommended for the early detection of PLC.

Also flagged:neurocognitive disorderpathogenesisneurodegenerative diseasesGene ExpressionagingTbx20
Journal Article 2022-10-21 ✓ 5 Snippets Bao N, Liu J, Peng Z, Zhang R, Ni R, Li R, Wu J, Liu Z, Pan B.
In-Text Gene Mentions

Unc13c has also been found to be associated with neurodegeneration in a genetic dementia in Finland [28].

Unc13c was significantly down-regulated in spinal cord tissues of patients with amyotrophic lateral sclerosis [26].

…groups, which wereUnc13c, Tbx20 and St8sia2…

… mmu_circ_0000331/miR-1224-3p/Unc13cand mmu_circ_0000406/miR-24-3p…

Unc13c, Tbx20, and St8sia2…

Show Full Abstract

Postoperative neurocognitive disorder (PND) is a common complication in older patients. However, its pathogenesis has still remained elusive. Recent studies have shown that circular RNA (circRNA) plays an important role in the development of neurodegenerative diseases, such as PND after surgery. CircRNA, as a competitive endogenous RNA (ceRNA), mainly acts as a molecular sponge for miRNA to "adsorb" microRNA (miRNA) and to reduce the inhibitory effects of miRNAs on target mRNA. The sequencing data of circRNA were obtained from the Gene Expression Omnibus (GEO) database. By bioinformatic methods, circAtlas, miRDB, miRTarBase and miRwalk databases were applied to construct circRNA-miRNA-mRNA networks and screen differentially expressed mRNAs. To improve the accuracy of the data, we randomly divided aging mice into control (non-PND group) and PND groups, and used high-throughput sequencing to analyze their brain hippocampal tissue for analysis. Three key genes were cross-detected in the data of both groups, which were Unc13c, Tbx20 and St8sia2 (as hub genes), providing new targets for PND treatment. According to the results of the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses, immune cell infiltration analysis, gene set enrichment analysis (GSEA), Connectivity Map (CMap) analysis, quantitative real-time polymerase chain reaction (qRT-PCR), the genes that were not related to the central nervous system were removed, and finally, mmu_circ_0000331/miR-1224-3p/Unc13c and mmu_circ_0000406/miR-24-3p/St8sia2 ceRNA networks were identified. In addition, the CMap method was used to select the top 4 active compounds with the largest negative correlation absolute values, including cimaterol, Rucaparib, FG-7142, and Hydrocortisone.

Also flagged:RemineralizationCarbomerDental carieschronic diseasescalcium phosphatescaries lesions
Journal Article 2022-10-21 No Snippets Bonchev A, Simeonov M, Shestakova P, Vasileva R, Titorenkova R, Apostolov A, Dyulgerova E, Vassileva E.
Show Full Abstract

Dental caries remains one of the most prevalent bacterium-caused chronic diseases affecting both adults and children worldwide. The development of new materials for enhancing its remineralization is one of the most promising approaches in the field of advanced dental materials as well as one of the main challenges in non-invasive dentistry. The aim of the present study is to develop novel hybrid materials based on (PDMAEMA)/Carbomer 940 microgels with in situ deposited calcium phosphates (CaP) and to reveal their potential as a remineralization system for artificial caries lesions. To this purpose, novel PDMAEMA/Carbomer 940 microgels were obtained and their core-shell structure was revealed by transmission electron microscopy (TEM). They were successfully used as a matrix for in situ calcium phosphate deposition, thus giving rise to novel hybrid microgels. The calcium phosphate phases formed during the deposition process were studied by X-ray diffraction and infrared spectroscopy, however, due to their highly amorphous nature, the nuclear magnetic resonance (NMR) was the method that was able to provide reliable information about the formed inorganic phases. The novel hybrid microgels were used for remineralization of artificial caries lesions in order to prove their ability to initiate their remineralization. The remineralization process was followed by scanning electron microscopy (SEM), X-ray diffraction, infrared and Raman spectroscopies and all these methods confirmed the successful enamel rod remineralization upon the novel hybrid microgel application. Thus, the study confirmed that novel hybrid microgels, which could ensure a constant supply of calcium and phosphate ions, are a viable solution for early caries treatment.

Also flagged:CytokinesSASPagingIL-1αIL-8cellular senescence
Journal Article 2022-10-21 No Snippets Chou LY, Ho CT, Hung SC.
Show Full Abstract

It has been known that senescence-associated secretory phenotype (SASP) triggers senescence of the surrounding normal cells. However, SASP signaling regarding mesenchymal stromal cell aging remains to be fully elucidated. Therefore, the present study aimed to clarify the molecular mechanism of late (passage) MSC-induced paracrine SASP-mediated senescence of early (passage) MSCs during ex vivo expansion. Here, we conducted an extensive characterization of senescence features in bone-marrow (BM)-derived MSCs from healthy human donors. Late MSCs displayed an enlarged senescent-like morphology, induced SASP-related proinflammatory cytokines (IL-1α and IL-8), and reduced clonogenic capacity and osteogenic differentiation when compared to early MSCs. Of note, paracrine effects of SASP-related IL-1α and IL-8 from late MSCs induced cellular senescence of early MSCs via an NF-κB-dependent manner. Moreover, cellular senescence of early MSCs was promoted by the synergistic action of IL-1α and IL-8. However, inhibition of NF-κB by shRNA transfection or using inhibitors in early MSCs blocked early MSCs cellular senescence caused by paracrine SASP of late MSCs. In conclusion, these findings reveal that late MSCs display features of senescence and that, during ex vivo expansion, SASP-related proinflammatory cytokines contribute to activate a cellular senescence program in early MSCs that may ultimately impair their functionality.

Also flagged:OX40LOX40APCosteoarthritisRApathogenesis
Journal Article 2022-10-21 ✓ 5 Snippets Cai X, Zhang M, Ren F, Fei W, Zhang X, Zhao Y, Yao Y, Lin N.
In-Text Gene Mentions

Tnfsf4fl/fl mice and…

…Primer information ofTnfsf4(5’→3’): forward primer…

…OX40L deletion (Tnfsf4fl/fl / Lyz2…

…mice) and controlTnfsf4fl/fl mice to…

Tnfsf4fl/fl / Lyz2…

Show Full Abstract

Signaling via the OX40/OX40L axis plays a key role in CD4<sup>+</sup> T cell development, and OX40L expression is primarily restricted to antigen-presenting cells (APCs). This study was designed to assess the role of APC-mediated OX40L expression in the context of the development of rheumatoid arthritis (RA)-associated CD4<sup>+</sup> T cell subsets. For these analyses, clinical samples were harvested from patients with osteoarthritis and RA, with additional analyses performed using OX40<sup>-/-</sup> mice and mice harboring monocyte/macrophage-specific deletions of OX40L. Together, these analyses revealed tissue-specific roles for OX40/OX40L signaling in RA. Specifically, higher levels of synovial macrophage OX40L expression were associated with the enhanced development of T follicular helper cells in the joint microenvironment, thereby contributing to the pathogenesis of RA. This Tfh differentiation was found to be OX40/OX40L-dependent in this synovial setting. Overall, these results indicate that the expression of OX40L by synovia macrophages is necessary to support Tfh differentiation in the joint tissues, thus offering new insight regarding the etiological basis for RA progression.

Also flagged:Betulinsynthesisindoleester3-indolyl betulincancer
Journal Article 2022-10-21 No Snippets Bębenek E, Chrobak E, Rzepka Z, Wrześniok D.
Show Full Abstract

As part of the search for new medicinal substances with potential application in oncology, the synthesis of new compounds combining the betulin molecule and the indole system was carried out. The structure of the ester derivatives obtained in the Steglich reaction was confirmed by spectroscopic methods (<sup>1</sup>H and <sup>13</sup>C NMR, HR-MS). The obtained new 3-indolyl betulin derivatives were evaluated for anticancer activity against several human cancer cell lines (melanomas, breast cancers, colorectal adenocarcinomas, lung cancer) as well as normal human fibroblasts. The significant reduction in MCF-7 cells viability for 28-hydroxy-(lup-20(29)-ene)-3-yl 2-(1<i>H</i>-indol-3-yl)acetate was observed at a concentration of 10 µg/mL (17 µM). In addition, cytometric analysis showed that this compound strongly reduces the proliferation rate of breast cancer cells. For this, the derivative showing the promising cytotoxic effect on MCF-7 breast cancer cells, the pharmacokinetic profile prediction was performed using in silico methods. Based on the results obtained in the study, it can be concluded that indole-functionalized triterpene EB367 is a promising starting point for further research in the field of breast cancer therapy or the synthesis of new derivatives.

Also flagged:TransferrinFerritinIronFerroptosisEstradiolBiosynthesis
Journal Article 2022-10-21 ✓ 1 Snippet Sze SCW, Zhang L, Zhang S, Lin K, Ng TB, Ng ML, Lee KF, Lam JKW, Zhang Z, Yung KKL.
In-Text Gene Mentions

…Inhemochromatosis, which is a…

Show Full Abstract

We report herein a novel mechanism, unraveled by proteomics and validated by in vitro and in vivo studies, of the aberrant aging-associated upregulation of ovarian transferrin and ferritin in rat ovaries. The ovarian mass and serum estradiol titer plummeted while the ovarian labile ferrous iron and total iron levels escalated with age in rats. Oxidative stress markers, such as nitrite/nitrate, 3-nitrotyrosine, and 4-hydroxy-2-nonenal, accumulated in the aging ovaries due to an aberrant upregulation of the ovarian transferrin, ferritin light/heavy chains, and iron regulatory protein 2(IRP2)-mediated transferrin receptor 1 (TfR1). Ferritin inhibited estradiol biosynthesis in ovarian granulosa cells in vitro via the upregulation of a nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and p65/p50-induced oxidative and inflammatory factor inducible nitric oxide synthase (iNOS). An in vivo study demonstrated how the age-associated activation of NF-κB induced the upregulation of iNOS and the tumor necrosis factor α (TNFα). The downregulation of the keap1-mediated nuclear factor erythroid 2-related factor 2 (Nrf2), that induced a decrease in glutathione peroxidase 4 (GPX4), was observed. The aberrant transferrin and ferritin upregulation triggered an iron accumulation via the upregulation of an IRP2-induced TfR1. This culminates in NF-κB-iNOS-mediated ovarian oxi-inflamm-aging and serum estradiol decrement in naturally aging rats. The iron accumulation and the effect on ferroptosis-related proteins including the GPX4, TfR1, Nrf2, Keap1, and ferritin heavy chain, as in testicular ferroptosis, indicated the triggering of ferroptosis. In young rats, an intraovarian injection of an adenovirus, which expressed iron regulatory proteins, upregulated the ovarian NF-κB/iNOS and downregulated the GPX4. These novel findings have contributed to a prompt translational research on the ovarian aging-associated iron metabolism and aging-associated ovarian diseases.

Also flagged:colorectal cancercolorectal cancersBRAFPI3KCancerkinase
Journal Article 2022-10-21 No Snippets Voutsadakis IA.
Show Full Abstract

<i>Background:</i> Colorectal cancer represents a common malignancy and remains incurable in the metastatic stage. Identification of molecular alterations that are present in colorectal cancer has led to the introduction of targeted therapies that improve outcomes. <i>BRAF</i> and <i>PIK3CA</i> mutations are observed in a subset of colorectal cancers. Colorectal cancers bearing <i>BRAF</i> mutations may be treated with specific BRAF inhibitors. These drugs benefit patients with <i>BRAF</i> mutant colorectal cancers but responses are rather brief, and progression is the rule. In contrast, no PI3K inhibitors have proven successful yet in the disease. Thus, new treatments to supplement the currently available drugs would be welcome to further improve survival. <i>Methods:</i> Profiled colorectal cancer cell lines from the Cancer Cell Line Encyclopedia (CCLE) were examined for <i>BRAF</i> and <i>PIK3CA</i> mutations and were interrogated for molecular characteristics and concomitant alterations that mirror clinical sample alterations. The Genomics of Drug Sensitivity in Cancer (GDSC) project was used for determination of drug sensitivities of <i>BRAF</i> mutated colorectal cell lines with or without concomitant <i>PIK3CA</i> mutations. The Cancer Dependency Map project served as the basis for identification of molecular dependencies and vulnerabilities in these cell lines. <i>Results:</i> CCLE includes 84 colorectal cancer cell lines, which recapitulate the molecular landscape of colorectal cancer. Of these, 23 and 24 cell lines possess <i>BRAF</i> and <i>PIK3CA</i> mutations, respectively. Seven <i>BRAF</i> mutant cell lines have V600E mutations and 14 <i>PIK3CA</i> mutant cell lines have hotspot helical or kinase domain mutations. V600E <i>BRAF</i> mutant cell lines with or without hotspot <i>PIK3CA</i> mutations are heterogeneous in their MSI status and mimic colorectal cancer tissues in other prevalent abnormalities including <i>APC</i> and <i>TP53</i> mutations. Essential genes for survival include <i>CTNNB1</i>, <i>WRN</i>, and pyrimidine metabolism enzyme <i>CAD</i>. Besides <i>BRAF</i> mutations, BRAF inhibitor sensitivity in colorectal cancer cell lines is conferred by <i>SACS</i> mutations and <i>PRKN</i> locus loss. <i>Conclusions:</i> Colorectal cancer cell lines bearing the frequent <i>BRAF</i> and <i>PIK3CA</i> mutations present many alterations of the parental cancer tissue. Described vulnerabilities represent leads for therapeutic exploration in colorectal cancers with the corresponding alterations.

Also flagged:Platinum4-chlorophenylacetic acidacidglioblastomaneuroblastomatumour
Journal Article 2022-10-21 No Snippets Aputen AD, Elias MG, Gilbert J, Sakoff JA, Gordon CP, Scott KF, Aldrich-Wright JR.
Show Full Abstract

A new series of cytotoxic platinum(IV) complexes (<b>1</b>-<b>8</b>) incorporating halogenated phenylacetic acid derivatives (4-chlorophenylacetic acid, 4-fluorophenylacetic acid, 4-bromophenylacetic acid and 4-iodophenylacetic acid) were synthesised and characterised using spectroscopic and spectrometric techniques. Complexes <b>1</b>-<b>8</b> were assessed on a panel of cell lines including HT29 colon, U87 glioblastoma, MCF-7 breast, A2780 ovarian, H460 lung, A431 skin, Du145 prostate, BE2-C neuroblastoma, SJ-G2 glioblastoma, MIA pancreas, the ADDP-resistant ovarian variant, and the non-tumour-derived MCF10A breast line. The in vitro cytotoxicity results confirmed the superior biological activity of the studied complexes, especially those containing 4-fluorophenylacetic acid and 4-bromophenylacetic acid ligands, namely <b>4</b> and <b>6</b>, eliciting an average GI<sub>50</sub> value of 20 nM over the range of cell lines tested. In the Du145 prostate cell line, <b>4</b> exhibited the highest degree of potency amongst the derivatives, displaying a GI<sub>50</sub> value of 0.7 nM, which makes it 1700-fold more potent than cisplatin (1200 nM) and nearly 7-fold more potent than our lead complex, <b>56ME<i>SS</i></b> (4.6 nM) in this cell line. Notably, in the ADDP-resistant ovarian variant cell line, <b>4</b> (6 nM) was found to be almost 4700-fold more potent than cisplatin. Reduction reaction experiments were also undertaken, along with studies aimed at determining the complexes' solubility, stability, lipophilicity, and reactive oxygen species production.

Also flagged:Hypertensionchronic diseasesmental health disordersAMP-dependent protein kinaseAMPKglucose
Journal Article 2022-10-21 ✓ 5 Snippets Mompeo O, Freidin MB, Gibson R, Hysi PG, Christofidou P, Segal E, Valdes AM, Spector TD, Menni C, Mangino M.
In-Text Gene Mentions

The 1p31.1 locus harbours the neuronal growth regulator 1 (NEGR1) gene, which has previously been associated with psychiatric [56], behavioural [57], nutritional [13] and metabolic disorders [43].

…locus harbours theneuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1) gene, which…

…The COLOC-PP forNEGR1(PP H4 =…

…and 16q12.2, harbouringNEGR1and FTO genes,…

Show Full Abstract

Diet is a modifiable risk factor for common chronic diseases and mental health disorders, and its effects are under partial genetic control. To estimate the impact of diet on individual health, most epidemiological and genetic studies have focused on individual aspects of dietary intake. However, analysing individual food groups in isolation does not capture the complexity of the whole diet pattern. Dietary indices enable a holistic estimation of diet and account for the intercorrelations between food and nutrients. In this study we performed the first ever genome-wide association study (GWA) including 173,701 individuals from the UK Biobank to identify genetic variants associated with the Dietary Approaches to Stop Hypertension (DASH) diet. DASH was calculated using the 24 h-recall questionnaire collected by UK Biobank. The GWA was performed using a linear mixed model implemented in BOLT-LMM. We identified seven independent single-nucleotide polymorphisms (SNPs) associated with DASH. Significant genetic correlations were observed between DASH and several educational traits with a significant enrichment for genes involved in the AMP-dependent protein kinase (AMPK) activation that controls the appetite by regulating the signalling in the hypothalamus. The colocalization analysis implicates genes involved in body mass index (BMI)/obesity and neuroticism (<i>ARPP21, RP11-62H7.2, MFHAS1, RHEBL1</i>). The Mendelian randomisation analysis suggested that increased DASH score, which reflect a healthy diet style, is causal of lower glucose, and insulin levels. These findings further our knowledge of the pathways underlying the relationship between diet and health outcomes. They may have significant implications for global public health and provide future dietary recommendations for the prevention of common chronic diseases.

Also flagged:nosocomial infectionsZeoliteERG11FUR1infectious diseasesInfectious communicable disorders
Journal Article 2022-10-21 No Snippets Aldossary HA, Rehman S, Jermy BR, AlJindan R, Aldayel A, AbdulAzeez S, Akhtar S, Khan FA, Borgio JF, Al-Suhaimi EA.
Show Full Abstract

<i>Candida auris</i> (<i>C. auris</i>), an emerging multidrug-resistant microorganism, with limited therapeutical options, is one of the leading causes of nosocomial infections. The current study includes 19 <i>C. auris</i> strains collected from King Fahd Hospital of the University and King Fahad Specialist Hospital in Dammam, identified by <i>18S rRNA</i> gene and <i>ITS</i> region sequencing. Drug-resistance-associated mutations in <i>ERG11, TAC1B and FUR1</i> genes were screened to gain insight into the pattern of drug resistance. Molecular identification was successfully achieved using <i>18S rRNA</i> gene and <i>ITS</i> region and 5 drug-resistance-associated missense variants identified in the <i>ERG11</i> (F132Y and K143R) and <i>TAC1B</i> (H608Y, P611S and A640V) genes of <i>C. auris</i> strains, grouped into 3 clades. The prophylactic and therapeutic application of hydrothermally synthesized Ag-silicalite-1 (Si/Ag ratio 25) nanomaterial was tested against the 3 clades of clinical <i>C. auris</i> strains. 4wt%Ag/TiZSM-5 prepared using conventional impregnation technique was used for comparative study, and nano formulations were characterized using different techniques. The antibiofilm activity of nanomaterials was tested by cell kill assay, scanning electron microscopy (SEM) and light microscopy. Across all the clades of <i>C. auris</i> strains, 4 wt%Ag/TiZSM-5 and Ag-silicalite-1 demonstrated a significant (<i>p</i> = 1.1102 × 10<sup>-16</sup>) inhibitory effect on the biofilm's survival rate: the lowest inhibition value was (10%) with Ag-silicalite-1 at 24 and 48 h incubation. A profound change in morphogenesis in addition to the reduction in the number of <i>C.</i><i>auris</i> cells was shown by SEM and light microscopy. The presence of a high surface area and the uniform dispersion of nanosized Ag species displays enhanced anti-<i>Candida</i> activity, and therefore it has great potential against the emerging multidrug-resistant <i>C. auris</i>.

Also flagged:HereditaryAntithrombinDeficiencyvenous thromboembolismheparinsThrombosis
Journal Article 2022-10-21 ✓ 1 Snippet Roberts JC, von Drygalski A, Zhou JY, Rodgers GM, Ansteatt K, Tarantino MD.
In-Text Gene Mentions

…associated with heterozygousSERPINC1gene variants (generally…

Show Full Abstract

Hereditary antithrombin deficiency (ATD) is a rare autosomal dominant condition (estimated prevalence 1:500-1:5000). Most ATD patients have AT activity levels 40-60% of normal. We present treatments for venous thromboembolism (VTE) in five cases of hereditary ATD. Four patients had a family history of ATD, and one had a <i>de novo</i> mutation. The majority of patients had a VTE while on prophylactic anticoagulation. AT concentrate augmentation was added in these cases to treat the VTE and for prophylaxis against further episodes. Two patients had significant bleeding events, one had permanent physical sequelae. Two of the patients were pregnant. VTE is a common cause of morbidity and mortality during pregnancy. Although low molecular weight heparins are the drugs of choice during pregnancy, this treatment was inadequate in one patient (developed VTE on therapy). These cases emphasize the need to screen for ATD in young patients (<55 years) presenting with VTE. AT augmentation therapy may be necessary in patients inadequately treated with conventional anticoagulants. Careful monitoring and individualized care are needed in ATD patients, especially those with demonstrated bleeding tendencies.

Also flagged:Ulcerative colitisautoimmune diseaseribonucleic acidsGene ExpressionCD44HIF1A
Journal Article 2022-10-21 ✓ 1 Snippet Xu S, Chen S, Zhang M, An W, Li J, Sun Z, Xu Y.
In-Text Gene Mentions

…ANK3, TSPAN6, andPCDH17.…

Show Full Abstract

Ulcerative colitis (UC) is a common autoimmune disease worldwide. Circular RNA (circRNA) is a type of noncoding ribonucleic acids (ncRNAs). In addition to their roles in numerous biological processes, circRNAs are also linked to a vast range of diseases including UC. Although previous studies have examined many circRNAs, the physiological and pathological roles of the circRNA-associated competing endogenous RNA (ceRNA) network in UC remain unclear. Thus, we constructed a circRNA-miRNA-mRNA network based on the ceRNA hypothesis by analyzing data from the National Center for Biotechnology Information Gene Expression Omnibus (NCBI-GEO) database. Genes with higher degree values than others in the ceRNA network were selected as central nodes when constructing the corresponding core subnetworks. To fully understand the biological function of the ceRNA network, we entered all differentially expressed mRNAs (DEmRNAs) from the ceRNA network into the Database for Annotation and Integrated Discovery (DAVID), which was used to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. We further entered DEmRNAs into the STRING database for protein-protein interaction (PPI) network analysis. The results elucidated that the ceRNA network comprised 403 circRNA nodes, 5 miRNA nodes, 138 mRNA nodes, and 559 edges. Three core ceRNA subnetworks centered on hsa-miR-342-3p, hsa-miR-199a-5p, and hsa-miR-142-3p were reconstructed in this study. GO and KEGG enrichment analyses identified 167 enriched GO categories and 14 enriched KEGG pathway terms. The core PPI network was composed of 15 core targets, of which CD44, HIF1A, and MMP2 were the most significant. In summary, 3 hub miRNAs (hsa-miR-342-3p, hsa-miR-199a-5p, hsa-miR-142-3p) and 3 hub genes (CD44, HIF1A, and MMP2) might play an important role in the development of UC. These hub nodes, first proposed here, might also be used as potential diagnostic markers and therapeutic targets.

Also flagged:cancerN7-methylguanosinetumormethylationcancersmethyladenine
Journal Article 2022-10-21 ✓ 4 Snippets Wei W, Liu C, Wang C, Wang M, Jiang W, Zhou Y, Zhang S.
In-Text Gene Mentions

What’s more, correlation analysis between the m7Gscore and immune checkpoint molecules in each cancer was also conducted and we found most immune checkpoint molecules were negatively correlated with the m7gscore across cancers, except for CD274 in KIRP, KIRC and KICH, CD276 in PRAD and ESCA, ICOSLG in KIRP and KIRC, IL-1A in HNSC, SIGLEC15 in KICH and TNFSF4 in PRAD (Supplementary Figure S3C).

…IL6, CCL2, IL10,TNFSF4, HAVCR2, CD4, ICOS,…

…groups, except forTNFSF4( Figure 7C…

…in KICH andTNFSF4in PRAD (…

Show Full Abstract

Although immunotherapy has made great strides in cancer therapy, its effectiveness varies widely among individual patients as well as tumor types, and there is an urgent need to develop biomarkers for effectively assessing immunotherapy response. In recent years, RNA methylation regulators have demonstrated to be novel potential biomarkers for prognosis as well as immunotherapy of cancers, such as N6-methyladenine (m6A) and 5-methylcytosine (m5C). N7-methylguanosine (m7G) is a prevalent RNA modification in eukaryotes, but the relationship between m7G regulators and prognosis as well as tumor immune microenvironment is still unclear. In this study, a pan-cancer analysis of 26 m7G regulators across 17 cancer types was conducted based on the bioinformatics approach. On the one hand, a comprehensive analysis of expression features, genetic variations and epigenetic regulation of m7G regulators was carried out, and we found that the expression tendency of m7G regulators were different among tumors and their aberrant expression in cancers could be affected by single nucleotide variation (SNV), copy number variation (CNV), DNA methylation and microRNA (miRNA) separately or simultaneously. On the other hand, the m7Gscore was modeled based on single sample gene set enrichment analysis (ssGSEA) for evaluating the relationships between m7G regulators and cancer clinical features, hallmark pathways, tumor immune microenvironment, immunotherapy response as well as pharmacotherapy sensitivity, and we illustrated that the m7Gscore exhibited tight correlations with prognosis, several immune features, immunotherapy response and drug sensitivity in most cancers. In conclusion, our pan-cancer analysis revealed that m7G regulators may exert critical roles in the tumor progression and immune microenvironment, and have the potential as biomarkers for predicting prognosis, immunotherapy response as well as candidate drug compounds for cancer patients.

Also flagged:histonesbindingchromatinRcH1.GH1nucleotide
Journal Article 2022-10-21 ✓ 5 Snippets Guo J, Li P, Yu A, Chapman MA, Liu A.
In-Text Gene Mentions

…evolutionary analysis oflinker histoneshistones in castor…

…H1s, orlinker histoneshistones, are ubiquitous…

…we identified fivelinker histoneshistones from 13…

…H1 histones (linker histoneshistones) are ubiquitous…

…Specificlinker histoneshistones (such as…

Show Full Abstract

H1s, or linker histones, are ubiquitous proteins in eukaryotic cells, consisting of a globular GH1 domain flanked by two unstructured tails. Whilst it is known that numerous non-allelic variants exist within the same species, the degree of interspecific and intraspecific variation and divergence of linker histones remain unknown. The conserved basic binding sites in GH1 and evenly distributed strong positive charges on the C-terminal domain (CTD) are key structural characters for linker histones to bind chromatin. Based on these features, we identified five linker histones from 13 GH1-containing proteins in castor bean (<i>Ricinus communis</i>), which were named as RcH1.1, RcH1.2a, RcH1.2b, RcH1.3, and RcH1.4 based on their phylogenetic relationships with the H1s from five other economically important Euphorbiaceae species (<i>Hevea brasiliensis Jatropha curcas</i>, <i>Manihot esculenta Mercurialis annua</i>, and <i>Vernicia fordii</i>) and <i>Arabidopsis thaliana</i>. The expression profiles of <i>RcH1</i> genes in a variety of tissues and stresses were determined from RNA-seq data. We found three <i>RcH1</i> genes (<i>RcH1.1</i>, <i>RcH1.2a</i>, and <i>RcH1.3</i>) were broadly expressed in all tissues, suggesting a conserved role in stabilizing and organizing the nuclear DNA. <i>RcH1.2a</i> and <i>RcH1.4</i> was preferentially expressed in floral tissues, indicating potential involvement in floral development in castor bean. Lack of non-coding region and no expression detected in any tissue tested suggest that <i>RcH1.2b</i> is a pseudogene. <i>RcH1.3</i> was salt stress inducible, but not induced by cold, heat and drought in our investigation. Structural comparison confirmed that GH1 domain was highly evolutionarily conserved and revealed that N- and C-terminal domains of linker histones are divergent between variants, but highly conserved between species for a given variant. Although the number of <i>H1</i> genes varies between species, the number of H1 variants is relatively conserved in more closely related species (such as within the same family). Through comparison of nucleotide diversity of linker histone genes and oil-related genes, we found similar mutation rate of these two groups of genes. Using Tajima's <i>D</i> and ML-HKA tests, we found <i>RcH1.1</i> and <i>RcH1.3</i> may be under balancing selection.

Also flagged:tissue homeostasisinflammatory responsesresponse to inflammationinflammatory responseCD14CD16
Journal Article 2022-10-21 ✓ 2 Snippets Cui Y, Gutierrez S, Ariai S, Öberg L, Thörn K, Gehrmann U, Cloonan SM, Naessens T, Olsson H.
In-Text Gene Mentions

…Many disorders, includinghemochromatosis, metabolic disorders, infecti…

…diseases such ashemochromatosis, liver cirrhosis and…

Show Full Abstract

Iron is a key element for systemic oxygen delivery and cellular energy metabolism. Thus regulation of systemic and local iron metabolism is key for maintaining energy homeostasis. Significant changes in iron levels due to malnutrition or hemorrhage, have been associated with several diseases such as hemochromatosis, liver cirrhosis and COPD. Macrophages are key cells in regulating iron levels in tissues as they sequester excess iron. How iron overload affects macrophage differentiation and function remains a subject of debate. Here we used an <i>in vitro</i> model of monocyte-to-macrophage differentiation to study the effect of iron overload on macrophage function. We found that providing excess iron as soluble ferric ammonium citrate (FAC) rather than as heme-iron complexes derived from stressed red blood cells (sRBC) interferes with macrophage differentiation and phagocytosis. Impaired macrophage differentiation coincided with increased expression of oxidative stress-related genes. Addition of FAC also led to increased levels of cellular and mitochondrial reactive oxygen species (ROS) and interfered with mitochondrial function and ATP generation. The effects of iron overload were reproduced by the mitochondrial ROS-inducer rotenone while treatment with the ROS-scavenger N-Acetylcysteine partially reversed FAC-induced effects. Finally, we found that iron-induced oxidative stress interfered with upregulation of M-CSFR and MAFB, two crucial determinants of macrophage differentiation and function. In summary, our findings suggest that high levels of non-heme iron interfere with macrophage differentiation by inducing mitochondrial oxidative stress. These findings might be important to consider in the context of diseases like chronic obstructive pulmonary disease (COPD) where both iron overload and defective macrophage function have been suggested to play a role in disease pathogenesis.

Also flagged:chromosomeamyotrophic lateral sclerosisdementiashexanucleotideFrontotemporal Dementia SyndromeFrontotemporal dementia
Journal Article 2022-10-21 No Snippets Kim EJ, Na DL, Kim HJ, Park KW, Lee JH, Roh JH, Kwon JC, Yoon SJ, Jung NY, Jeong JH, Jang JW, Kim HJ, Park KH, Choi SH, Kim S, Park YH, Kim BC, Youn YC, Ki CS, Kim SH, Seo SW, Kim YE.
Show Full Abstract

<h4>Background</h4>Frontotemporal dementia (FTD) syndrome is a genetically heterogeneous group of diseases. Pathogenic variants in the chromosome 9 open reading frame 72 (<i>C9orf72</i>), microtubule-associated protein tau (<i>MAPT</i>), and progranulin (<i>GRN</i>) genes are mainly associated with genetic FTD in Caucasian populations.<h4>Objective</h4>To understand the genetic background of Korean patients with FTD syndrome.<h4>Methods</h4>We searched for pathogenic variants of 52 genes related to FTD, amyotrophic lateral sclerosis, familial Alzheimer's disease, and other dementias, and hexanucleotide repeats of the <i>C9orf72</i> gene in 72 Korean patients with FTD using whole exome sequencing and the repeat-primed polymerase chain reaction, respectively.<h4>Results</h4>One likely pathogenic variant, p.G706R of <i>MAPT</i>, in a patient with behavioral variant FTD (bvFTD) and 13 variants of uncertain significance (VUSs) in nine patients with FTD were identified. Of these VUSs, M232R of the <i>PRNP</i> gene, whose role in pathogenicity is controversial, was also found in two patients with bvFTD.<h4>Conclusions</h4>These results indicate that known pathogenic variants of the three main FTD genes (<i>MAPT</i>, <i>GRN</i>, and <i>C9orf72</i>) in Western countries are rare in Korean FTD patients.

Also flagged:inflammatory disease syndromeinfectionsepsisSiglec-Fpathogenesisextracellular cold-inducible RNA-binding protein
Journal Article 2022-10-21 ✓ 2 Snippets Murao A, Aziz M, Wang P.
In-Text Gene Mentions

…+ , low-density,OLFM4+ , and…

OLFM4

Show Full Abstract

<h4>Abstract</h4>Sepsis is a severe inflammatory disease syndrome caused by the dysregulated host response to infection. Neutrophils act as the first line of defense against pathogens by releasing effector molecules such as reactive oxygen species, myeloperoxidase, and neutrophil extracellular traps. However, uncontrolled activation of neutrophils and extensive release of effector molecules often cause a "friendly fire" to damage organ systems. Although neutrophils are considered a short-lived, terminally differentiated homogeneous population, recent studies have revealed its heterogeneity comprising different subsets or states implicated in sepsis pathophysiology. Besides the well-known N1 and N2 subsets of neutrophils, several new subsets including aged, antigen-presenting, reverse-migrated, intercellular adhesion molecule-1 + , low-density, olfactomedin 4 + , and Siglec-F + neutrophils have been reported. These neutrophils potentially contribute to the pathogenesis of sepsis based on their proinflammatory and immunosuppressive functions. Damage-associated molecular patterns (DAMPs) are endogenous molecules to induce inflammation by stimulating pattern recognition receptors on immune cells. Different kinds of DAMPs have been shown to contribute to sepsis pathophysiology, including extracellular cold-inducible RNA-binding protein, high-mobility group box 1, extracellular histones, and heat shock proteins. In this review, we summarize the different subsets of neutrophils and their association with sepsis and discuss the novel roles of DAMPs on neutrophil heterogeneity.

Also flagged:QuinoxalinesDesoxyquinoxalinesantibodiesQuinoxalinedesoxymetabolitesmethyl
Journal Article 2022-10-21 No Snippets Song W, Luo M, Li H, Xiao J, He X, Liang J, Peng D.
Show Full Abstract

Quinoxalines (Qx) are chemically synthesized antibacterial drugs with strong antibacterial and growth-promoting effects. Qx is heavily abused by farmers, resulting in large residues in animal-derived foods, which pose a serious threat to human health. Desoxyquinoxalines (DQx), which have the highest residue levels, have been identified as the major toxicant and have become a new generation of residue markers. In this study, we prepared monoclonal antibodies (mAb) based on a new generation metabolite (desoxymequindox, DMEQ) and establish an indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) for the rapid determination of Qx residues in food. The mAb exhibited high sensitivity with half maximal inhibitory concentration (IC<sub>50</sub>) and a linear range of 2.84 µg/L and 0.8-12.8 µg/L, respectively. Additionally, the cross-reactivity (CR) of the mAb showed that it recognized multiple DQx to varying levels. The limits of detection (LOD), limits of quantification (LOQ), and recoveries for the ic-ELISA assay of pork, swine liver, swine kidney, chicken, and chicken liver were 0.48-0.58 µg/kg, 0.61-0.90 µg/kg, and 73.7-107.8%, respectively, and the coefficients of variation (CV) were less than 11%. The results of the ic-ELISA showed a good correlation with LC-MS/MS in animal-derived foods. This suggests that this analytical method can be used for the rapid screening of QX residues.

bioRxiv 2022-10-21 Preprint (No Snippets API) Sgammeglia N, Widmer YF, Kaldun JC, Fritsch C, Bruggmann R, Sprecher SG.
Show Full Abstract

The formation of long-term memories requires changes in the transcriptional program and de novo protein synthesis. One of the critical regulators for long-term memory (LTM) formation and maintenance is the transcription factor CREB. Genetic studies have dissected the requirement of CREB activity within memory circuits, however less is known about the genetic mechanisms acting downstream of CREB and how they may contribute defining LTM phases. To better understand the downstream mechanisms, we here used a targeted DamID approach (TaDa). We generated a CREB-Dam fusion protein using the fruit fly Drosophila melanogaster as model. Expressing CREB-Dam in the mushroom bodies (MBs), a brain center implicated in olfactory memory formation, we identified genes that are differentially expressed between paired and unpaired appetitive training paradigm. Of those genes we selected candidates for an RNAi screen in which we identified genes causing increased or decreased LTM.

bioRxiv 2022-10-21 Preprint (No Snippets API) Yakoubi WE, Akera T.
Show Full Abstract

Reproductive isolation occurs when the genomes of two populations accumulate genetic incompatibilities that prevent inter-breeding. Cell biological understanding of such hybrid incompatibility is limited, especially for hybrid female sterility. Here we find that species divergence in condensin regulation and centromere organization between two mouse species, Mus musculus and Mus spretus , drives chromosome de-condensation and mis-segregation in their F1 hybrid oocytes, reducing female fertility. The chromosome condensation defects in hybrid oocytes were especially prominent at Mus musculus centromeres due to their highly abundant major satellite DNA, leading to species-specific chromosome mis-segregation. This study provides the first mechanistic insights into hybrid incompatibility in female meiosis and demonstrates that condensin mis-regulation can be a reproductive isolating barrier in mammals.

bioRxiv 2022-10-21 Preprint (No Snippets API) Malysheva V, Ray-Jones H, Lakes N, Brown RA, Cazares TA, Clay O, Ohayon DE, Artemov P, Wayman JA, Yang ZF, Della Rosa M, Della Rosa M, Petitjean C, Booth C, Ellaway JI, Barnes JR, Dangel AW, Saini A, Orchard WR, Chen X, Parameswaran S, Burden F, Frontini M, Nagano T, Fraser P, Schoenfelder S, Weirauch MT, Kottyan LC, Smith DF, Powell N, Weimer JM, Oltz EM, Wallace C, Miraldi ER, Waggoner S, Spivakov M.
Show Full Abstract

Innate lymphoid cells (ILCs) are rare, tissue-resident innate lymphocytes that functionally mirror CD4+ T helper cell lineages but lack antigen receptors. Type 3 ILCs (ILC3s) are enriched in the gut, airways, and mucosal lymphoid tissues, where they regulate inflammation and promote barrier integrity. To define the regulatory architecture of primary human ILC3s, we map promoter-anchored chromosomal contacts using high-resolution, low-input Promoter Capture Hi-C (PCHi-C) in these cells alongside CD4+ T cells. By combining statistical detection with a PCHi-C-adapted Activity-by-Contact approach, we link promoters to distal regulatory elements, identifying hundreds of ILC3-specific contacts. We use these maps to connect genome-wide association study (GWAS) risk variants for Crohn’s disease to target genes using multiCOGS, a Bayesian framework that integrates PCHi-C with summary-statistic imputation and multivariate fine-mapping. This analysis highlights both known and unanticipated candidates, including CLN3 , a causal gene for the neurodevelopmental Batten disease. Using a mouse ILC3-like cell line, we show that Cln3 is downregulated upon cytokine stimulation, and Cln3 overexpression alters stimulation-induced transcriptional programmes and cytokine secretion. Extending this approach, we generate a catalogue of ILC3-linked risk genes for five additional autoimmune conditions and show that they are enriched for regulators of the ILC3 inflammatory response identified in a CRISPR interference screen. Together, these findings illuminate long-range gene control in ILC3s and prioritise known and newly implicated autoimmune risk genes with potential roles in this clinically important cell type.

bioRxiv 2022-10-21 Preprint (No Snippets API) Boucherie DE, Reneman L, Booij J, Martins D, Dipasquale O, Schrantee A.
Show Full Abstract

<h4>Background</h4> Selective serotonin reuptake inhibitors (SSRIs) potentiate serotonergic neurotransmission by blocking the serotonin transporter (5-HTT), but the functional brain response to SSRIs involves neural circuits beyond regions with high 5-HTT expression. Currently, it is unclear whether and how changes in 5-HTT availability after SSRI administration modulate brain function of key serotoninergic circuits, including those characterized by high availability of serotonin 1A receptors (5-HT1AR). <h4>Aim</h4> We investigated the association between 5-HTT availability and 5-HTT- and 5-HT1AR-enriched functional connectivity (FC) after an acute citalopram challenge. <h4>Methods</h4> We analyzed multimodal data from a dose-response, placebo-controlled, double-blind study, in which 45 healthy women were randomized into three groups receiving placebo, a low (4 mg), or high (16 mg) oral dose of citalopram. Receptor-Enhanced Analysis of functional Connectivity by Targets was used to estimate 5-HTT- and 5-HT1AR-enriched FC from resting-state and task-based fMRI. 5-HTT availability was determined using [ 123 I]FP-CIT single-photon emission computerized tomography. <h4>Results</h4> 5-HTT availability was negatively correlated with resting-state 5-HTT-enriched FC, and with task-dependent 5-HT1AR-enriched FC. Our exploratory analyses revealed lower 5-HT1AR-enriched FC in the low dose group compared to the high dose group at rest and the placebo group during the task. <h4>Conclusions</h4> Taken together, our findings provide evidence for differential links between 5-HTT availability and brain function within 5-HTT and 5-HT1AR pathways and in context- and dose-dependent manner. As such, they support a potential pivotal role of the 5-HT1AR in the effects of citalopram on the brain and add to its potential as a therapeutic avenue for mood and anxiety disturbances.

bioRxiv 2022-10-21 Preprint (No Snippets API) Van Raamsdonk JM, Al-Shekeli H, Wagner L, Bredy TW, Chan L, Pearson J, Schwab C, Murphy Z, Devon RS, Lu G, Kobor MS, Hayden MR, Leavitt BR.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington disease (HD) is an adult-onset neurodegenerative disorder that is caused by a trinucleotide CAG repeat expansion in the HTT gene that codes for the protein huntingtin (HTT or Htt in mice). HTT is a multi-functional, ubiquitously expressed protein that is essential for embryonic survival, normal neurodevelopment, and adult brain function. The ability of wild-type HTT to protect neurons against various forms of death raises the possibility that loss of normal HTT function may worsen disease progression in HD. Huntingtin-lowering therapeutics are being evaluated in clinical trials for HD, but concerns have been raised that decreasing wild-type HTT levels may have adverse effects. Here we show that Htt levels modulate the occurrence of an idiopathic seizure disorder that spontaneously occurs in FVB/N mice. These abnormal FVB/N mice demonstrate various cardinal features of mouse models of epilepsy including spontaneous seizures, astrocytosis, neuronal hypertrophy, upregulation of brain-derived neurotrophic factor (BDNF), and sudden seizure-related death. Interestingly, decreasing wild-type Htt levels increased the frequency of this disorder, while over-expression of HTT completely prevented it. Examination of the mechanism underlying huntingtin’s ability to modulate the frequency of this seizure disorder indicated that over-expression of full length HTT can promote neuronal survival following seizures. Overall, our results demonstrate a protective role for huntingtin in this form of epilepsy and provide a plausible explanation for the observation of seizures in the juvenile form of HD, Lopes-Maciel-Rodan syndrome, and Wolf-Hirschhorn syndrome. Adverse effects caused by altering huntingtin levels has ramifications related to Huntingtin-lowering therapies in development to treat HD.

Also flagged:Parkinson's DiseasePDpathogenesisgene expressionTTC3ZMYND10
Journal Article 2022-10-20 ✓ 1 Snippet Huang T, Zhao JY, Pan RR, Jiang T, Fu XX, Huang Q, Wang XX, Gong PY, Tian YY, Zhang YD.
In-Text Gene Mentions

…YO16-AS1, AGBL5-IT1, HOTAIRM1,RABGAP1L-IT1, HLCS-IT1, and LINC00393)…

Show Full Abstract

Emerging evidence suggested that long non-coding RNAs (lncRNAs) were involved in Parkinson's disease (PD) pathogenesis. Herein, we used gene expression profiles from GEO database to construct a PD-specific ceRNA network. Functional enrichment analysis suggested that ceRNA network might participate in the development of PD. PPI networks were constructed, and the ceRNA subnetwork based on five hub genes was set up. In a cohort of 32 PD patients and 31 healthy controls, the expression of 10 DElncRNAs (TTC3-AS1, LINC01259, ZMYND10-AS1, CHRM3-AS1, MYO16-AS1, AGBL5-IT1, HOTAIRM1, RABGAP1L-IT1, HLCS-IT1, and LINC00393) were further verified. Consistent with the microarray data, LINC01259 expression was significantly lower in PD patients compared with controls (P = 0.008). Intriguingly, such a difference was only observed among male patients and male controls when dividing study participants based on their gender (P = 0.016). However, the expression of other lncRNAs did not differ significantly between the two groups. Receiver operating characteristic (ROC) curve analysis revealed that the diagnostic power of LINC01259 was 0.694 for PD and 0.677 for early-stage PD. GSEA enrichment analysis revealed that LINC01259 was mainly enriched in biological processes associated with immune function and inflammatory response. Moreover, LINC01259 expression was not correlated with age of patients, disease duration, disease stage, MDS-UPDRS score, MDS-UPDRS III score, MMSE score, and MOCA score. The current study provides further evidence for the dysregulation of lncRNAs in circulating leukocytes of PD patients, revealing that LINC01259 has clinical potential as a novel immune and inflammatory biomarker for PD and early-stage PD diagnosis.

Also flagged:asthmachronic inflammatory lung diseasetranscription factorspathogenesispairingTF
Journal Article 2022-10-20 No Snippets Shaik NA, Nasser K, Mohammed A, Mujalli A, Obaid AA, El-Harouni AA, Elango R, Banaganapalli B.
Show Full Abstract

Asthma is a life-threatening and chronic inflammatory lung disease that is posing a true global health challenge. The genetic basis of the disease is fairly well examined. However, the molecular crosstalk between microRNAs (miRNAs), target genes, and transcription factors (TFs) networks and their contribution to disease pathogenesis and progression is not well explored. Therefore, this study was aimed at dissecting the molecular network between mRNAs, miRNAs, and TFs using robust computational biology approaches. The transcriptomic data of bronchial epithelial cells of severe asthma patients and healthy controls was studied by different systems biology approaches like differentially expressed gene detection, functional enrichment, miRNA-target gene pairing, and mRNA-miRNA-TF molecular networking. We detected the differential expression of 1703 (673 up-and 1030 down-regulated) genes and 71 (41 up-and 30 down-regulated) miRNAs in the bronchial epithelial cells of asthma patients. The DEGs were found to be enriched in key pathways like IL-17 signaling (KEGG: 04657), Th1 and Th2 cell differentiation (KEGG: 04658), and the Th17 cell differentiation (KEGG: 04659) (p-values = 0.001). The results from miRNAs-target gene pairs-transcription factors (TFs) have detected the key roles of 3 miRs (miR-181a-2-3p; miR-203a-3p; miR-335-5p), 6 TFs (TFAM, FOXO1, GFI1, IRF2, SOX9, and HLF) and 32 miRNA target genes in eliciting autoimmune reactions in bronchial epithelial cells of the respiratory tract. Through systemic implementation of comprehensive system biology tools, this study has identified key miRNAs, TFs, and miRNA target gene pairs as potential tissue-based asthma biomarkers.

Also flagged:FABP4tumorcancerscolon adenocarcinomaCOADCancer
Journal Article 2022-10-20 ✓ 1 Snippet Wu D, Xiang L, Peng L, Gu H, Tang Y, Luo H, Liu H, Wang Y.
In-Text Gene Mentions

…TNFRSF17, TNFRSF18, TNFRSF25,TNFSF4, TNFSF13, TNFSF13B, and…

Show Full Abstract

<h4>Background</h4>Fatty acid-binding protein 4 (FABP4) has been reported to be associated with tumor progress and poor prognosis in various cancers. However, the relationship between FABP4 expression and tumor immunity in colon adenocarcinoma (COAD) is still poorly understood.<h4>Methods</h4>FABP4 mRNA expression was analyzed using The Cancer Genome Atlas (TCGA)-COAD data. FABP4 protein staining was performed by immunohistochemistry (IHC) staining in our 10 paired COAD samples and corresponding adjacent noncancerous tissues. The association between FABP4 and immune cell infiltration was evaluated by Tumor Immune Estimation Resource (TIMER) database. FABP4 coexpressed genes were identified based on Cancer Cell Line Encyclopedia (CCLE) database, which were employed for further enrichment analysis. FABP4 related immunomodulators was identified by Tumor and Immune System Interaction Database (TISIDB) database, and a prognostic risk signature was constructed based on FABP4-related immunomodulators using stepwise Cox regression analysis. A nomogram consists of FABP4 related immunomodulators signature and clinical parameters was developed to predict the overall survival (OS).<h4>Results</h4>In TCGA data, we found that the decreased FABP4 mRNA expression in COAD samples compared with normal samples, and low FABP4 mRNA expression was associated with B cells, CD4+ T cells, CD8+ T cells, myeloid dendritic cells, macrophages, and neutrophils. In our 10 paired samples, the protein levels of COAD were lower in all COAD tissues than in their adjacent noncancerous tissues. Functional enrichment analysis revealed that FABP4 coexpressed genes were mostly enriched in immune-related pathways. Based on 54 FABP4-related immunomodulators, a 2-gene FABP4-related prognostic risk signature was developed, and the signature stratified the patients into the high-risk and low-risk groups with statistically different survival outcomes. The Nomogram consists of the prognostic signature and clinical parameters had a certain predictability for prognosis of COAD patients.<h4>Conclusion</h4>These findings suggest that FABP4 is associated with 2-gene immune signature which also correlate with the prognosis of COAD patients.

Also flagged:SOD1Superoxide dismutase 1Lgr5gene expressionWNTPaneth cell differentiation
Journal Article 2022-10-20 ✓ 3 Snippets Wang YC, Leng XX, Zhou CB, Lu SY, Tsang CK, Xu J, Zhang MM, Chen HM, Fang JY.
In-Text Gene Mentions

…1 ]) andOlfm4[ 2 ].…

…Technology, 12202, 1:500),OLFM4(Cell Signaling Technology,…

…of ISCs expressingOLFM4, a marker of…

Show Full Abstract

Superoxide dismutase 1 (SOD1) modulates intestinal barrier integrity and intestinal homeostasis as an antioxidant enzyme. Intestinal homeostasis is maintained by the intestinal stem cells (ISCs). However, whether and how SOD1 regulates ISCs is unknown. In this study, we established intestinal organoids from tamoxifen-inducible intestinal epithelial cell-specific Sod1 knockout (Sod1<sup>f/f</sup>; Vil-creERT2) mice. We found that loss of Sod1 in organoids suppressed the proliferation and survival of cells and Lgr5 gene expression. SOD1 is known for nearly half a century for its canonical role as an antioxidant enzyme. We identified its enzyme-independent function in ISC: inhibition of SOD1 enzymatic activity had no impact on organoid growth, and enzymatically inactive Sod1 mutants could completely rescue the growth defects of Sod1 deficient organoids, suggesting that SOD1-mediated ISC growth is independent of its enzymatic activity. Moreover, Sod1 deficiency did not affect the ROS levels of the organoid, but induced the elevated WNT signaling and excessive Paneth cell differentiation, which mediates the occurrence of growth defects in Sod1 deficient organoids. In vivo, epithelial Sod1 loss induced a higher incidence of apoptosis in the stem cell regions and increased Paneth cell numbers, accompanied by enhanced expression of EGFR ligand Epiregulin (EREG) in the stromal tissue, which may compensate for Sod1 loss and maintain intestinal structure in vivo. Totally, our results show a novel enzyme-independent function of SOD1 in ISC growth under homeostasis.

Also flagged:Zymosan-Atissue homeostasisTLR2WntASCL2transcription factor
Journal Article 2022-10-20 ✓ 5 Snippets Du J, Fang L, Zhao J, Yu Y, Feng Z, Wang Y, Cheng Y, Li B, Gao F, Liu C.
In-Text Gene Mentions

…WNT3A, MYD88, TLR2,OLFM4, ASCL2, CYCLIND1, AXIN2)…

…the expression ofOLFM4.…

…Lgr5 + FISH,OLFM4Immunofluorescence, and Ki-67…

…YAP1, WNT5A, WNT3A,OLFM4, ASCL2, CYCLIND1, and…

…another ISCs marker,OLFM4, to investigate the…

Show Full Abstract

Intestinal stem cells (ISCs) are responsible for intestinal tissue homeostasis and are important for the regeneration of the damaged intestinal epithelia. Through the establishment of ionizing radiation (IR) induced intestinal injury model, we found that a TLR2 agonist, Zymosan-A, promoted the regeneration of ISCs in vivo and in vitro. Zymosan-A improved the survival of abdominal irradiated mice (81.82% of mice in the treated group vs. 30% of mice in the PBS group), inhibited the radiation damage of intestinal tissue, increased the survival rate of intestinal crypts and the number of ISCs after lethal IR in vivo. Through organoid experiments, we found that Zymosan-A promoted the proliferation and differentiation of ISCs after IR. Remarkably, the results of RNA sequencing and Western Blot (WB) showed that Zymosan-A reduced IR-induced intestinal injury via TLR2 signaling pathway and Wnt signaling pathway and Zymosan-A had no radioprotection on TLR2 KO mice, suggesting that Zymosan-A may play a radioprotective role by targeting TLR2. Moreover, our results revealed that Zymosan-A increased ASCL2, a transcription factor of ISCs, playing a core role in the process of Zymosan-A against IR-induced intestinal injury and likely contributing to the survival of intestinal organoids post-radiation. In conclusion, we demonstrated that Zymosan-A promotes the regeneration of ISCs by upregulating ASCL2.

Also flagged:PTSDmethylationcancercardiovascular diseasetranscription factorbinding
Journal Article 2022-10-20 No Snippets Kaliman P, Cosín-Tomás M, Madrid A, Roque López S, Llanez-Anaya E, Papale LA, Alisch RS, Davidson RJ.
Show Full Abstract

Adverse childhood experiences (ACEs, i.e., abuse, neglect, household dysfunction) represent a potential risk factor for a wide range of long-lasting diseases and shorter life expectancy. We recently described a 1-week residential group program, based on mindfulness training, artistic expression and EMDR group therapy, that significantly reduced PTSD-related symptoms and increased attention/awareness-related outcomes in adolescent girls with multiple ACEs in a randomized controlled study. Since epigenetic mechanisms (i.e., DNA methylation) have been associated with the long-lasting effects of ACEs, the present report extends these prior findings by exploring genome-wide DNA methylation changes following the program. Saliva samples from all participants (n = 44) were collected and genomic DNA was extracted prior (T1) and following (T2) the intervention. Genome-wide DNA methylation analysis using the MethylationEPIC beadchip array (Illumina) revealed 49 differentially methylated loci (DML; p value < 0.001; methylation change > 10%) that were annotated to genes with roles in biological processes linked to early childhood adversity (i.e., neural, immune, and endocrine pathways, cancer and cardiovascular disease). DNA sequences flanking these DML showed significant enrichment of transcription factor binding sites involved in inflammation, cancer, cardiovascular disease, and brain development. Methylation changes in SIRT5 and TRAPPC2L genes showed associations with changes in trauma-related psychological measures. Results presented here suggest that this multimodal group program for adolescents with multiple victimization modulates the DNA methylome at sites of potential relevance for health and behavioral disorders associated with ACEs.

Also flagged:ureacreatinineuric acidmetabolismnitrogenexcretion
Journal Article 2022-10-20 ✓ 2 Snippets Prahl MC, Müller CBM, Albrecht D, Koch F, Wimmers K, Kuhla B.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6), both involved in…

…higher abundances ofPRDX6, which is located…

Show Full Abstract

Milk urea concentration is an indicator for dietary nitrogen (N)-supply and urinary N-excretion. Dairy cows with high (HMU) compared to low milk urea (LMU) concentration have greater plasma urea, creatinine and uric acid concentrations, but if the liver metabolism accounts for these differences is unknown. Eighteen HMU and 18 LMU cows were fed a diet with a low (LP) or normal (NP) crude protein concentration. A N balance study was performed and a <sup>13</sup>C-urea bolus was administered to measure urea pool size. Liver samples were analyzed by 2D-gel-based proteomics and RT-qPCR. Although HMU cows had a greater urea pool, plasma urea, uric acid, and hippuric acid concentrations, these differences were not associated with altered expressions of genes related to urea cycling or N-metabolism. Instead, HMU cows had higher oxidative stress levels. Conclusively, other factors than hepatic urea metabolism account for milk urea concentrations. Despite higher plasma urea concentrations and argininosuccinate synthase 1 protein expression on the LP diet, urea cycle mRNA expressions were not affected, indicating that its activity is not controlled at transcriptional level. Feeding the LP diet resulted in increased expressions of enzymes catabolizing fatty acids, but the reason remains to be investigated in future studies.

Also flagged:organizationmetabolic disordersgene expressionglucagon-like peptide-1 receptorGlp1rprepronociceptin
Journal Article 2022-10-20 ✓ 5 Snippets Steuernagel L, Lam BYH, Klemm P, Dowsett GKC, Bauder CA, Tadross JA, Hitschfeld TS, Del Rio Martin A, Chen W, de Solis AJ, Fenselau H, Davidsen P, Cimino I, Kohnke SN, Rimmington D, Coll AP, Beyer A, Yeo GSH, Brüning JC.
In-Text Gene Mentions

…against Sst andUnc13cto target the…

…of Sst /Unc13c-positive cells expressed…

…multiple subclusters ofUnc13c-expressing C185-118: Otp.…

…52.2% of theUnc13c-and Sst -positive…

…between Nts andUnc13cexpression in Pnoc…

Show Full Abstract

The hypothalamus plays a key role in coordinating fundamental body functions. Despite recent progress in single-cell technologies, a unified catalog and molecular characterization of the heterogeneous cell types and, specifically, neuronal subtypes in this brain region are still lacking. Here, we present an integrated reference atlas, 'HypoMap,' of the murine hypothalamus, consisting of 384,925 cells, with the ability to incorporate new additional experiments. We validate HypoMap by comparing data collected from Smart-Seq+Fluidigm C1 and bulk RNA sequencing of selected neuronal cell types with different degrees of cellular heterogeneity. Finally, via HypoMap, we identify classes of neurons expressing glucagon-like peptide-1 receptor (Glp1r) and prepronociceptin (Pnoc), and validate them using single-molecule in situ hybridization. Collectively, HypoMap provides a unified framework for the systematic functional annotation of murine hypothalamic cell types, and it can serve as an important platform to unravel the functional organization of hypothalamic neurocircuits and to identify druggable targets for treating metabolic disorders.

Also flagged:methylationbreast cancercancerofcell growthtumor
Journal Article 2022-10-20 ✓ 3 Snippets Chen Y, Li H, Sun X.
In-Text Gene Mentions

It is interesting that, the expressions of MYBL2, CSE1L, and most neighbors of NAE1 (59/63) are significantly different between tumor and normal tissues (P-value < 0.05, Wilcoxon rank sum test with continuity correction), but as a link gene NAE1 is not differentially expressed (see Fig. 6B).

…genes MYBL2 andCSE1Lwith high methylation…

…expressions of MYBL2,CSE1L, and most neighbors…

Show Full Abstract

<h4>Background</h4>It is important to understand the functional impact of somatic mutation and methylation aberration at an individual level to implement precision medicine. Recent studies have demonstrated that the perturbation of gene interaction networks can provide a fundamental link between genotype (or epigenotype) and phenotype. However, it is unclear how individual mutations affect the function of biological networks, especially for individual methylation aberration. To solve this, we provided a sample-specific driver module construction method using the 2-order network theory and hub-gene theory to identify individual perturbation networks driven by mutations or methylation aberrations.<h4>Results</h4>Our method integrated multi-omics of breast cancer, including genomics, transcriptomics, epigenomics and interactomics, and provided new insight into the synergistic collaboration between methylation and mutation at an individual level. A common driver pattern of breast cancer was identified from a novel perspective of a driver module, which is correlated to the occurrence and development of breast cancer. The constructed driver module reflects the survival prognosis and degree of malignancy among different subtypes of breast cancer. Additionally, subtype-specific driver modules were identified.<h4>Conclusions</h4>This study explores the driver module of individual cancer, and contributes to a better understanding of the mechanism of breast cancer driven by the mutations and methylation variations from the point of view of the driver network. This work will help identify new therapeutic combinations of gene mutations and drugs in humans.

Also flagged:cancerAphidicolincell cyclehydroxyureagene expressionchromosome
Journal Article 2022-10-20 ✓ 2 Snippets Shaikh N, Mazzagatti A, De Angelis S, Johnson SC, Bakker B, Spierings DCJ, Wardenaar R, Maniati E, Wang J, Boemo MA, Foijer F, McClelland SE.
In-Text Gene Mentions

…near large geneNEGR1, which was expressed…

…and DAB1 andNEGR1on chromosome 1).…

Show Full Abstract

<h4>Background</h4>A major driver of cancer chromosomal instability is replication stress, the slowing or stalling of DNA replication. How replication stress and genomic instability are connected is not known. Aphidicolin-induced replication stress induces breakages at common fragile sites, but the exact causes of fragility are debated, and acute genomic consequences of replication stress are not fully explored.<h4>Results</h4>We characterize DNA copy number alterations (CNAs) in single, diploid non-transformed cells, caused by one cell cycle in the presence of either aphidicolin or hydroxyurea. Multiple types of CNAs are generated, associated with different genomic regions and features, and observed copy number landscapes are distinct between aphidicolin and hydroxyurea-induced replication stress. Coupling cell type-specific analysis of CNAs to gene expression and single-cell replication timing analyses pinpointed the causative large genes of the most recurrent chromosome-scale CNAs in aphidicolin. These are clustered on chromosome 7 in RPE1 epithelial cells but chromosome 1 in BJ fibroblasts. Chromosome arm level CNAs also generate acentric lagging chromatin and micronuclei containing these chromosomes.<h4>Conclusions</h4>Chromosomal instability driven by replication stress occurs via focal CNAs and chromosome arm scale changes, with the latter confined to a very small subset of chromosome regions, potentially heavily skewing cancer genome evolution. Different inducers of replication stress lead to distinctive CNA landscapes providing the opportunity to derive copy number signatures of specific replication stress mechanisms. Single-cell CNA analysis thus reveals the impact of replication stress on the genome, providing insights into the molecular mechanisms which fuel chromosomal instability in cancer.

Also flagged:solid tumorchromatintranslationaltumorcancermechanotransduction
Journal Article 2022-10-20 ✓ 1 Snippet Foster DS, Januszyk M, Delitto D, Yost KE, Griffin M, Guo J, Guardino N, Delitto AE, Chinta M, Burcham AR, Nguyen AT, Bauer-Rowe KE, Titan AL, Salhotra A, Jones RE, da Silva O, Lindsay HG, Berry CE, Chen K, Henn D, Mascharak S, Talbott HE, Kim A, Nosrati F, Sivaraj D, Ransom RC, Matthews M, Khan A, Wagh D, Coller J, Gurtner GC, Wan DC, Wapnir IL, Chang HY, Norton JA, Longaker MT.
In-Text Gene Mentions

Sox6

Show Full Abstract

Cancer-associated fibroblasts (CAFs) are integral to the solid tumor microenvironment. CAFs were once thought to be a relatively uniform population of matrix-producing cells, but single-cell RNA sequencing has revealed diverse CAF phenotypes. Here, we further probed CAF heterogeneity with a comprehensive multiomics approach. Using paired, same-cell chromatin accessibility and transcriptome analysis, we provided an integrated analysis of CAF subpopulations over a complex spatial transcriptomic and proteomic landscape to identify three superclusters: steady state-like (SSL), mechanoresponsive (MR), and immunomodulatory (IM) CAFs. These superclusters are recapitulated across multiple tissue types and species. Selective disruption of underlying mechanical force or immune checkpoint inhibition therapy results in shifts in CAF subpopulation distributions and affected tumor growth. As such, the balance among CAF superclusters may have considerable translational implications. Collectively, this research expands our understanding of CAF biology, identifying regulatory pathways in CAF differentiation and elucidating therapeutic targets in a species- and tumor-agnostic manner.

Also flagged:glucosepancreatic and duodenal homeobox 1PDX1insulintranscription factorpancreatic diseases
Journal Article 2022-10-20 ✓ 1 Snippet Usher ET, Showalter SA.
In-Text Gene Mentions

…, 82 )Sox6HMG TF Represses…

Show Full Abstract

The pancreatic and duodenal homeobox 1 (PDX1) is a central regulator of glucose-dependent transcription of insulin in pancreatic β cells. PDX1 transcription factor activity is integral to the development and sustained health of the pancreas; accordingly, deciphering the complex network of cellular cues that lead to PDX1 activation or inactivation is an important step toward understanding the etiopathologies of pancreatic diseases and the development of novel therapeutics. Despite nearly 3 decades of research into PDX1 control of Insulin expression, the molecular mechanisms that dictate the function of PDX1 in response to glucose are still elusive. The transcriptional activation functions of PDX1 are regulated, in part, by its two intrinsically disordered regions, which pose a barrier to its structural and biophysical characterization. Indeed, many studies of PDX1 interactions, clinical mutations, and posttranslational modifications lack molecular level detail. Emerging methods for the quantitative study of intrinsically disordered regions and refined models for transactivation now enable us to validate and interrogate the biochemical and biophysical features of PDX1 that dictate its function. The goal of this review is to summarize existing PDX1 studies and, further, to generate a comprehensive resource for future studies of transcriptional control via PDX1.

Ferroptosis in heart failure.

Also flagged:heart failureFerroptosisdeathironlipidperoxides
Journal Article 2022-10-20 No Snippets Yang X, Kawasaki NK, Min J, Matsui T, Wang F.
Show Full Abstract

With its complicated pathobiology and pathophysiology, heart failure (HF) remains an increasingly prevalent epidemic that threatens global human health. Ferroptosis is a form of regulated cell death characterized by the iron-dependent lethal accumulation of lipid peroxides in the membrane system and is different from other types of cell death such as apoptosis and necrosis. Mounting evidence supports the claim that ferroptosis is mainly regulated by several biological pathways including iron handling, redox homeostasis, and lipid metabolism. Recently, ferroptosis has been identified to play an important role in HF induced by different stimuli such as myocardial infarction, myocardial ischemia reperfusion, chemotherapy, and others. Thus, it is of great significance to deeply explore the role of ferroptosis in HF, which might be a prerequisite to precise drug targets and novel therapeutic strategies based on ferroptosis-related medicine. Here, we review current knowledge on the link between ferroptosis and HF, followed by critical perspectives on the development and progression of ferroptotic signals and cardiac remodeling in HF.

Also flagged:tumorBTKKRASHDAC1EP300Lymphoma
Journal Article 2022-10-20 ✓ 2 Snippets Varier KM, Dan G, Liu W, Wu G, Xiao C, Lei H, Ling T, Jiang Y, Chen Y, Ben-David Y, Li Y, Zhang N, Gajendran B, Shen X.
In-Text Gene Mentions

…ation of the KRAS/HDAC1/EP300/PEBP1axis.…

…tumor suppressor genesPEBP1and SAP18.…

Show Full Abstract

Lymphoma is a cancer of the lymphoid cells that originated in matured B or T cells. The bioactive natural compounds can efficiently treat this disease with lesser side effects. Thus, in this study, a natural stilbene B10 (3-methoxy 5-hydroxy stilbene) isolated from Cajanus cajan (Pigeon Pea) was screened for its anti-proliferative efficacy against 13 cancer cell lines. B10 showed a potential effect on the human lymphoma (Raji) cells. Cytotoxicity analysis of B10 has revealed IC<sub>50</sub> concentrations in Raji cells at low doses (18 µM) than other cancer cell lines. The B10 could significantly cause dose and time-dependent inhibition in the proliferation of Raji cells triggering intrinsic apoptosis and S/G<sub>1</sub> phase cellular arrest. There was an increased expression of phospho-γ-H2A.X and decreased expression of cyclin D1, causing DNA damage and cell cycle arrest, post- B10 treatments. The mitochondrial membrane potential (MMP) variations observed after B10 treatment led to changes in Bax/Bcl-2 ratio, cytochrome C release, and enhanced expression of cleaved caspase3, 9, PARP-1, and APAF-1. The B10 inhibited the proliferation of Raji cells by significantly downregulating the expression of KRAS, BTK, MDM2, P-JAK2, P-STAT3, PI3K, HDAC1/2, SIRT7, and EP300. The treatment upregulated the tumor suppressor genes PEBP1 and SAP18. Thus, the study could reveal the selective inhibitory effects of B10 on lymphoma, suggesting it as a probable innovative chemotherapeutic agent.

Also flagged:intellectual disabilityautism spectrum disordersbehavioralreverse transcriptiondegradationTRIP12
Journal Article 2022-10-20 ✓ 5 Snippets Yi S, Chen F, Qin Z, Yi S, Huang L, Huang L, Feng Y, Wei H, Yang Q, Zhang Q, Luo J.
In-Text Gene Mentions

…( PARP1 ,SOX6, and SMARCE1…

…PARP1, PTF1A, RNF168,SOX6, SMARCE1, and USP7.…

…TheSOX6(SRY-box transcription factor…

…TRIP12 binds toSOX6protein and induces…

…an increase inSOX6protein levels.…

Show Full Abstract

<h4>Background and objectives</h4>Clark-Baraitser syndrome is characterized by intellectual disability with or without autism spectrum disorders, speech delay, motor delay, behavioral abnormalities, and facial dysmorphism. It is caused by a heterozygous pathogenic variant in the thyroid hormone receptor interactor 12 (<i>TRIP12</i>) gene. However, loss of function and haploinsufficiency are the pathogenic mechanisms behind the <i>TRIP12</i>-related disorder.<h4>Methods</h4>We conducted an exome sequencing analysis for 2 unrelated patients with moderate intellectual disability, speech delay, and motor delay.<h4>Results</h4>We identified 2 de novo <i>TRIP12</i> mutations in these 2 patients. One patient had a frameshift duplication, whereas the other had a synonymous variant. Both patients presented with common features of the syndrome, but clinical heterogeneity has been also observed between them. For the synonymous variant, reverse transcription PCR in RNA extracted from leukocytes demonstrated the presence of a truncated messenger RNA (mRNA) transcript that skipped exon 12. This transcript escapes degradation at the mRNA level. To assess the effect of the synonymous substitute on TRIP12 proteolytic activity, the expression of 9 known responsive genes at the mRNA level was measured, of which 3 genes were upregulated at least 2-fold in the patient.<h4>Discussion</h4>We reported 2 patients with Clark-Baraitser syndrome caused by novel synonymous and frameshift variants in the <i>TRIP12</i> gene, and our study expands the mutation spectrum of the <i>TRIP12</i> gene. This study will help to improve our understanding of variable phenotypic presentations in <i>TRIP12</i>-related disorders.

Also flagged:enterocolitisterminal ileitispiperacillintazobactamciprofloxacinliver abscess
Journal Article 2022-10-20 ✓ 1 Snippet Dudina M, Søgaard KK, Deleuran T, Joensen KG, Frøkjær JB, Nielsen HL.
In-Text Gene Mentions

…other signs ofhemochromatosis.…

Show Full Abstract

<i>Yersinia pseudotuberculosis</i> is a rare Gram-negative bacillus that cause enterocolitis and terminal ileitis. We report the first Danish case with <i>Y. pseudotuberculosis</i> multiple pyogenic liver abscess presenting with 6 weeks intermittently fever, fatigue, and weight loss. The patient was successfully treated with percutaneous drainage and intravenous piperacillin/tazobactam and oral ciprofloxacin.

Also flagged:liver diseasesGene Expressionreverse transcriptionliver diseasedamagedecompensated cirrhosis
Journal Article 2022-10-20 No Snippets Han YH, He XM, Lee SJ, Mao YY, Liu XC, Sun HN, Jin MH, Kwon T.
Show Full Abstract

The incidence of liver diseases has been increasing steadily. However, it has some shortcomings, such as high cost and organ donor scarcity. The application of stem cell research has brought new ideas for the treatment of liver diseases. Therefore, it is particularly important to clarify the molecular and regulatory mechanisms of differentiation of bone marrow-derived stem cells (BMSCs) into liver cells. Herein, we screened differentially expressed genes between hepatocytes and untreated BMSCs to identify the genes responsible for the differentiation of BMSCs into hepatocytes. GSE30419 gene microarray data of BMSCs and GSE72088 gene microarray data of primary hepatocytes were obtained from the Gene Expression Omnibus database. Transcriptome Analysis Console software showed that 1896 genes were upregulated and 2506 were downregulated in hepatocytes as compared with BMSCs. Hub genes were analyzed using the STRING and Cytoscape v 3.8.2, revealing that twenty-four hub genes, play a pivotal role in the differentiation of BMSCs into hepatocytes. The expression of the hub genes in the BMSCs and hepatocytes was verified by reverse transcription-quantitative PCR (RT-qPCR). Next, the target miRNAs of hub genes were predicted, and then the lncRNAs regulating miRNAs was discovered, thus forming the lncRNA-miRNA-mRNA interaction chain. The results indicate that the lncRNA-miRNA-mRNA interaction chain may play an important role in the differentiation of BMSCs into hepatocytes, which provides a new therapeutic target for liver disease treatment.

Also flagged:acute respiratory illnessacute respiratory distress syndromemultiple organ failuredeathsevere acute respiratory infectionSARI
Journal Article 2022-10-20 No Snippets Postelnicu R, Srivastava A, Bhatraju PK, Wurfelc MM, Anesi GL, Gonzalez M, Andrews A, Lutrick K, Kumar VK, Uyeki TM, Cobb PJ, Segal LN, Brett-Major D, Liebler JM, Kratochvil CJ, Mukherjee V, Broadhurst MJ, Lee R, Wyles D, Sevransky JE, Evans L, Landsittel D.
Show Full Abstract

Respiratory virus infections cause significant morbidity and mortality ranging from mild uncomplicated acute respiratory illness to severe complications, such as acute respiratory distress syndrome, multiple organ failure, and death during epidemics and pandemics. We present a protocol to systematically study patients with severe acute respiratory infection (SARI), including severe acute respiratory syndrome coronavirus 2, due to respiratory viral pathogens to evaluate the natural history, prognostic biomarkers, and characteristics, including hospital stress, associated with clinical outcomes and severity.<h4>Design</h4>Prospective cohort study.<h4>Setting</h4>Multicenter cohort of patients admitted to an acute care ward or ICU from at least 15 hospitals representing diverse geographic regions across the United States.<h4>Patients</h4>Patients with SARI caused by infection with respiratory viruses that can cause outbreaks, epidemics, and pandemics.<h4>Interventions</h4>None.<h4>Measurements and main results</h4>Measurements include patient demographics, signs, symptoms, and medications; microbiology, imaging, and associated tests; mechanical ventilation, hospital procedures, and other interventions; and clinical outcomes and hospital stress, with specimens collected on days 0, 3, and 7-14 after enrollment and at discharge. The primary outcome measure is the number of consecutive days alive and free of mechanical ventilation (VFD) in the first 30 days after hospital admission. Important secondary outcomes include organ failure-free days before acute kidney injury, shock, hepatic failure, disseminated intravascular coagulation, 28-day mortality, adaptive immunity, as well as immunologic and microbiologic outcomes.<h4>Conclusions</h4>SARI-Preparedness is a multicenter study under the collaboration of the Society of Critical Care Medicine Discovery, Resilience Intelligence Network, and National Emerging Special Pathogen Training and Education Center, which seeks to improve understanding of prognostic factors associated with worse outcomes and increased resource utilization. This can lead to interventions to mitigate the clinical impact of respiratory virus infections associated with SARI.

Also flagged:Albuminextracellularmineralizationhydroxyapatiteapatitemineral
Journal Article 2022-10-20 No Snippets Mehwish N, Xu M, Zaeem M, Lee BH.
Show Full Abstract

A crucial method for adding new functions to current biomaterials for biomedical applications has been surface functionalization via molecular design. Mussel-inspired polydopamine (PDA) has generated much attention as a facile method for the functionalization of biomaterials because of its substantial independence in deposition, beneficial cell interactions, and significant responsiveness aimed at secondary functionalization. Because of their porous structure, the bovine serum albumin methacryloyl (BSAMA)-BM cryogels were functionalized with PDA (BM-PDA), which may reproduce the architecture and biological purpose of the natural extracellular environment. Excellent antioxidative and antibacterial qualities, improved mineralization, and better cell responsiveness were all demonstrated by BM-PDA. BM-PDA scaffolds maintained their linked and uniform pores after functionalization, which can make it easier for nutrients to be transported during bone repair. As a result, hydroxyapatite (HA)-coated BM* and BM-PDA* cryogels were created through successive mineralization with the goal of mineralized bone tissue repair. The heterogeneous nucleation and surface roughness contributed to rod-like apatite production in BM-PDA* cryogels whereas BM* cryogels were made up of plate-like HA morphologies. Analysis results showed that after five cycles, the mineral contents were around 57% and the HA units remained equally dispersed on the surface of BM-PDA* with a Ca/P ratio of 1.63. Other natural polymer-based cryogels can be coated using this general, rapid, and simple PDA coating technique and utilized as implants for bone tissue engineering. Future clinical uses of albumin cryogels for bone tissue engineering will advance as a result of additional in-vivo testing of such PDA-coated cryogels.

Also flagged:LUADNecroptosisLung cancerlung adenocarcinomacell cycletumor
Journal Article 2022-10-20 ✓ 1 Snippet Zhang B, Wang Y, Zhou X, Zhang Z, Ju H, Diao X, Wu J, Zhang J.
In-Text Gene Mentions

…PDCD1LG2, PD-L1 (CD274),TNFSF4, and TNFRSF9 (…

Show Full Abstract

Necroptosis is a type of programmed necrosis that is different from apoptosis and necrosis. Lung cancer has the highest incidence and mortality worldwide, and lung adenocarcinoma is the most common subtype of lung cancer. However, the role of necroptosis in the occurrence and development of LUAD remains largely unexplored. In this paper, four NRGs and nine NRGs determined by big data analysis were used to effectively predict the risk of early LUAD (AUC = 0.994) and evaluate the prognostic effect on LUAD patients (AUC = 0.826). Meanwhile, ESTIMATE, single-sample gene set enrichment analysis (ssGSEA), genomic variation analysis (GSVA), gene set enrichment analysis (GSEA), and immune checkpoint analysis were used to explore the enrichment characteristics and immune research related to the prognostic model. In deep data mining, we were surprised to find that prognostic models also regulate the immune microenvironment, cell cycle, and DNA damage repair mechanisms. Thus, we demonstrated a significant correlation between model evaluation results, ICI treatment, and chemotherapeutic drug sensitivity. The low-risk population has a stronger tumor immune response, and the potential for ICI treatment is greater. People at high risk respond less to immunotherapy but respond well to chemotherapy drugs. In addition, PANX1, a core gene with important value in immune regulation, prognosis assessment, and early diagnosis, has been identified for the first time, which provides a new target for the immunotherapy of LUAD as well as a new theoretical basis for the basic research, clinical diagnosis, and individualized treatment of LUAD.

Also flagged:CoagulationHemostasisAntithrombinProtein CProtein SThrombin
Journal Article 2022-10-20 ✓ 2 Snippets Di Felice G, Vidali M, Parisi G, Pezzi S, Di Pede A, Deidda G, D'Agostini M, Carletti M, Ceccarelli S, Porzio O.
In-Text Gene Mentions

…hromogenic assay (STA-STACHROMATIII).…

…The STA-StachromATIIIfunctional assay is…

Show Full Abstract

<i>Background</i>: The objective of this study was to establish the age and sex-dependent reference intervals for coagulation assays evaluated in healthy children, ranging from 0 days to 16 years old. <i>Methods</i>: PT, aPTT, Fibrinogen (functional), Antithrombin activity, Protein C anticoagulant activity, Protein S free antigen, Thrombin time, D-Dimer, Von Willebrand Factor antigen, Lupus anticoagulant (screening), extrinsic and intrinsic pathway factors, and activated Protein C resistance were evaluated using STA-R Max<sup>2</sup>. <i>Results</i>: A total of 1280 subjects (671 males and 609 females) were divided into five groups, according to their age: 0-15 days (n = 280, 174 M and 106 F), 15-30 days (n = 208, 101 M and 107 F), 1-6 months (n = 369, 178 M and 191 F), 6-12 months (n = 214, 110 M and 104 F), and 1-16 years (n = 209, 108 M and 101 F). The 95% reference intervals and the 90% CI were established using the Harrell-Davis bootstrap method and the bootstrap percentile method, respectively. <i>Conclusions</i>: The present study supports the concept that adult and pediatric subjects should be evaluated using different reference intervals, at least for some coagulation tests, to avoid misdiagnosis, which can potentially lead to serious consequences for patients and their families, and ultimately the healthcare system.

Also flagged:azoospermiamale infertilityandrogensspermatogenesisinfertilityNon-Obstructive Azoospermia
Journal Article 2022-10-20 ✓ 2 Snippets Azizi H, Hashemi Karoii D, Skutella T.
In-Text Gene Mentions

The microarray analysis of three human cases with different non-obstructive azoospermia showed that microtubule-associated protein 4 (MAP4), ubiquitin conjugating enzyme E2 E3 (UBE2E3), aminopeptidase puromycin sensitive (NPEPPS), endothelin receptor type A (EDNRA), suppression of tumorigenicity 7 (ST7), ubiquitin-like with PHD and ring finger domains 1 (UHRF1), transmembrane channel-like 6 (TMC6), ribosomal modification protein rimK-like family member B (RIMKLB), X-linked inhibitor of apoptosis (XIAP), patatin-like phospholipase domain containing 5 (PNPLA5), ribonucleotide reductase regulatory subunit M2 (RRM2), ring finger protein 114 (RNF114), ring finger and WD repeat domain 3 (RFWD3), zinc finger E-box binding homeobox 1 (ZEB1), sorting nexin 4 (SNX4), SPG7 matrix AAA peptidase subunit (SPG7), methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), histone deacetylase 6 (HDAC6), coiled-coil domain containing 144A (CCDC144A), transmembrane O-mannosyltransferase targeting cadherins 4 (TMTC4), exportin 6 (XPO6), kelch-like family member 12 (KLHL12), E2F associated phosphoprotein (EAPP), zinc finger protein 254 (ZNF254), FKBP prolyl isomerase 5 (FKBP), ribosome biogenesis homolog (URB2), poly(ADP-ribose) polymerase 2 (PARP2), small nucleolar RNA, H/ACA box 16B (SNORA16B), serine incorporator 4 (SERINC4), protein kinase C and casein kinase substrate in neurons 2 (PACSIN2), anillin, actin binding protein (ANLN), neurolysin (NLN), replication factor C subunit (RFC3), FTO alpha-ketoglutarate dependent dioxygenase (FTO), YEATS domain containing 4 (YEATS4), signal transducer and activator of transcription 1 (STAT1), L-2-hydroxyglutarate dehydrogenase (L2HGDH), leucyl-tRNA synthetase (LARS), phosphatidylinositol glycan anchor biosynthesis class K (PIGK), WD repeat domain 90 (WDR90), G2 and S-phase expressed 1 (GTSE1), PC4 and SFRS1 interacting protein 1 (PSIP1), telomerase associated protein 1 (TEP1), ADP ribosylation factor-like GTPase 17B (ARL17), GTP binding protein 10 (GTPBP10), polypeptide N-acetylgalactosaminyl transferase 15 (GALNTL2), U2AF homology motif kinase 1 (UHMK1), 3-oxoacid CoA-transferase 1 (OXCT1), glutathione S-transferase theta 2 (GSTT2), tuftelin interacting protein 11 (TFIP11), hydroxysteroid 17-beta dehydrogenase 7 (HSD17B7), stathmin 1 (STMN1), ribonuclease P/MRP subunit p30 (RPP30), pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), non-SMC condensin I complex subunit G (NCAPG), MYC associated zinc finger protein (MAZ), HEAT repeat containing 2 (HEATR2), activator of basal transcription 1 (ABT1), ALMS1 centrosome and basal body associated protein ALMS1), sperm antigen with calponin homology and coiled-coil domains 1-like (CYTSA), sestrin 1 (SESN1), RAB2B, latent transforming growth factor beta binding protein 3 (LTBP3), folliculin interacting protein 2 (FNIP2), RecQ-like helicase 5 (RECQL5), establishment of sister chromatid cohesion N-acetyltransferase 2 (ESCO2), RAP2A, major histocompatibility complex, class I-related (MR1), synaptojanin 2 (SYNJ2), folliculin interacting protein 1 (FNIP1), protein phosphatase 2 regulatory subunit B’delta (PPP2R5D), regulator of G protein signaling 2 (RGS2), rhomboid domain containing 2 (RHBDD2), polypyrimidine tract binding protein 3 (PTBP3: Also known as ROD1), signal regulatory protein gamma (SIRPG), cyclin Y (CCNY), MLLT11 transcription factor 7 cofactor (MLLT11), ATA-box binding protein associated factor 9b (TAF9B), RAS p21 protein activator 2 (RASA2), kinesin family member 4A (KIF4A), MAS related GPR family member F (MRGPRF), glutathione S-transferase theta 2B (GSTT2B), EBP-like (EBPL), signal regulatory protein beta 1 (SIRPB1), serpin family B member 8 (SERPINB8), PWWP domain containing 2A (PWWP2A), dihydrofolate reductase (DHFR), codanin 1 (CDAN1), phospholipid scramblase 3 (PLSCR3), zinc finger protein 253 (ZNF253), spectrin beta, non-erythrocytic 1 (SPTBN1), WD repeat domain 19 (WDR19), Rac family small GTPase 2 (RAC2), zinc finger protein 618 (ZNF618), sorbitol dehydrogenase (SORD), Family with sequence similarity 118 member A (FAM118A), kinetochore-associated Ndc80 complex subunit SPC24 (SPC24), INO80 complex subunit C (INO80C), PMS1 homolog 1 (PMS1), carboxylesterase 1 (CES1), Ras related GTP binding D (RRAGD), phosphatase domain containing paladin 1 (Also known as KIAA1274), progestin and adipoQ receptor family member 4 (PAQR4), MID1, and S100 calcium binding protein A1 (S100A1) were upregulated versus the normal case.

…SPTBN1, UHMK1, STAT1,ABT1, DHFR, ZNF260, SORL1,…

Show Full Abstract

Non-obstructive azoospermia (NOA) is a serious cause of male infertility. The Sertoli cell responds to androgens and takes on roles supporting spermatogenesis, which may cause infertility. This work aims to enhance the genetic diagnosis of NOA via the discovery of new and hub genes implicated in human NOA and to better assess the odds of successful sperm extraction according to the individual's genotype. Whole exome sequencing (WES) was done on three NOA patients to find key genes involved in NOA. We evaluated genome-wide transcripts (about 50,000 transcripts) by microarray between the Sertoli of non-obstructive azoospermia and normal cells. The microarray analysis of three human cases with different non-obstructive azoospermia revealed that 32 genes were upregulated, and the expressions of 113 genes were downregulated versus the normal case. For this purpose, Enrich Shiny GO, STRING, and Cytoscape online evaluations were applied to predict the functional and molecular interactions of proteins and then recognize the master pathways. The functional enrichment analysis demonstrated that the biological process (BP) terms "inositol lipid-mediated signaling", "positive regulation of transcription by RNA polymerase II", and "positive regulation of DNA-templated transcription" significantly changed in upregulated differentially expressed genes (DEGs). The BP investigation of downregulated DEGs highlighted "mitotic cytokinesis", "regulation of protein-containing complex assembly", "cytoskeleton-dependent cytokinesis", and the "peptide metabolic process". Overrepresented molecular function (MF) terms in upregulated DEGs included "ubiquitin-specific protease binding", "protease binding", "phosphatidylinositol trisphosphate phosphatase activity", and "clathrin light chain binding". Interestingly, the MF analysis of the downregulated DEGs revealed overexpression in "ATPase inhibitor activity", "glutathione transferase activity", and "ATPase regulator activity". Our findings suggest that these genes and their interacting hub proteins could help determine the pathophysiologies of germ cell abnormalities and infertility.

Also flagged:BCL2VenetoclaxPI3KIDH2FLT3acute myeloid leukemia
Journal Article 2022-10-20 No Snippets Seipel K, Brügger Y, Mandhair H, Bacher U, Pabst T.
Show Full Abstract

In October 2020, the FDA granted regular approval to venetoclax (ABT-199) in combination with hypomethylating agents for newly-diagnosed acute myeloid leukemia (AML) in adults 75 years or older, or in patients with comorbidities precluding intensive chemotherapy. The treatment response to venetoclax combination treatment, however, may be short-lived, and leukemia relapse is the major cause of treatment failure. Multiple studies have confirmed the upregulation of the anti-apoptotic proteins of the B-cell lymphoma 2 (BCL2) family and the activation of intracellular signaling pathways associated with resistance to venetoclax. To improve treatment outcome, compounds targeting anti-apoptotic proteins and signaling pathways have been evaluated in combination with venetoclax. In this study, the BCL-XL inhibitor A1331852, MCL1-inhibitor S63845, dual PI3K-mTOR inhibitor bimiralisib (PQR309), BMI-1 inhibitor unesbulin (PTC596), MEK-inhibitor trametinib (GSK1120212), and STAT3 inhibitor C-188-9 were assessed as single agents and in combination with venetoclax, for their ability to induce apoptosis and cell death in leukemic cells grown in the absence or presence of bone marrow stroma. Enhanced cytotoxic effects were present in all combination treatments with venetoclax in AML cell lines and AML patient samples. Elevated in vitro efficacies were observed for the combination treatment of venetoclax with A1331852, S63845 and bimiralisib, with differing response markers for each combination. For the venetoclax and bimiralisib combination treatment, responders were enriched for <i>IDH2</i> and <i>FLT3</i> mutations, whereas non-responders were associated with <i>PTPN11</i> mutations. The combination of PI3K/mTOR dual pathway inhibition with bimiralisib and BCL2 inhibition with venetoclax has emerged as a candidate treatment in <i>IDH2-</i> and <i>FLT3</i>-mutated AML.

Also flagged:Neurodegenerative DiseasesPrion diseasestransmissible spongiform encephalopathiesmethylationpost-translational modificationshistones
Journal Article 2022-10-20 ✓ 4 Snippets Hernaiz A, Toivonen JM, Bolea R, Martín-Burriel I.
In-Text Gene Mentions

In addition, inhibition of HDAC3 improves motor deficits, suppresses striatal CAG repeat expansions, and reduces the accumulation of oligomeric forms of mutant htt in HD transgenic mice [100,101].

Interestingly, artificial miRNAs have also been used to successfully reduce mutant htt levels in a transgenic HD sheep model and in a humanized Hu128/21 HD mouse model [211,212].

A genome-wide DNA methylation profile of cortex tissues from HD patients suggests that DNA methylation may have a minimal association with HD status but could be correlated with the age of disease onset and contribute to the tissue-specific expression patterns of huntingtin (HTT) [39].

Moreover, a multiomic study has proposed that the positive effect of HDAC4 knockdown in rescuing synaptic function in HD mice could be a consequence of synaptic vesicle trafficking regulation, and HDAC4 could interact with htt via association with htt-interacting proteins [98].

Show Full Abstract

Prion diseases are transmissible spongiform encephalopathies (TSEs) caused by a conformational conversion of the native cellular prion protein (PrP<sup>C</sup>) to an abnormal, infectious isoform called PrP<sup>Sc</sup>. Amyotrophic lateral sclerosis, Alzheimer's, Parkinson's, and Huntington's diseases are also known as prion-like diseases because they share common features with prion diseases, including protein misfolding and aggregation, as well as the spread of these misfolded proteins into different brain regions. Increasing evidence proposes the involvement of epigenetic mechanisms, namely DNA methylation, post-translational modifications of histones, and microRNA-mediated post-transcriptional gene regulation in the pathogenesis of prion-like diseases. Little is known about the role of epigenetic modifications in prion diseases, but recent findings also point to a potential regulatory role of epigenetic mechanisms in the pathology of these diseases. This review highlights recent findings on epigenetic modifications in TSEs and prion-like diseases and discusses the potential role of such mechanisms in disease pathology and their use as potential biomarkers.

Also flagged:Heart Failuredepressionanxietymajor depressionpro–B-type natriuretic peptideage-related syndrome
Journal Article 2022-10-20 No Snippets Nguyen TT, Nguyen TX, Nguyen TTH, Nguyen TN, Nguyen HTT, Nguyen HTT, Nguyen AT, Pham T, Vu HTT.
Show Full Abstract

This study aimed to assess the symptom burden among older patients hospitalised for heart failure. This hospital-based, cross-sectional study was conducted at the National Geriatric Hospital, Hanoi, Vietnam, from June 2019 to August 2020. Face-to-face interviews were performed to gather the following information: socio-demographic characteristics, heart failure classification, and clinical characteristics (comorbidities, polypharmacy, pro-B-type natriuretic peptide, left ventricular ejection fraction (LVEF), symptom burden, and depression). Symptom burden was assessed using the Edmonton Symptom Assessment Scale (ESAS), and depression was measured using the Patient Health Questionnaire. A total of 314 patients participated in the study. The mean participant age was 72.67 (SD = 9.42) years. The most frequently reported symptoms on the ESAS were shortness of breath (95.5%), fatigue (94.8%), and anxiety (81.2%). In univariate analyses, depression was significantly associated with heart failure class (<i>p</i> < 0.05). Multivariate linear regression revealed that major depression was significantly associated with total symptom burden score (Beta: 11.74; 95% CI: 9.24-14.23) and LVEF (Beta: -0.09; 95% CI: -0.17-(-0.007)). Patients hospitalised for heart failure experienced a high burden of symptoms. Further studies addressing adverse outcomes and expanding to community-dwelling older people are essential. Palliative care approaches that target symptom reduction should be considered in patients with heart failure.

Also flagged:Coagulationviral infectionCOVID-19coagulopathysepsisdisseminated intravascular coagulation
Journal Article 2022-10-20 ✓ 1 Snippet Kaiafa G, Savopoulos C, Karlafti E, Pantazi K, Paramythiotis D, Thomaidou E, Daios S, Ztriva E, Gionis M, Fyntanidou V, Argiriadou H, Didangelos T.
In-Text Gene Mentions

…C (protein C),ATIII(antithrombin III), PAI…

Show Full Abstract

Coronavirus disease is a viral infection that can affect multiple systems and be expressed with many-or no-symptoms. The viral infection begins when the virus binds to the host's receptor and from that point on, it is transmitted to the rest of the body, where it causes inflammatory reactions. Among other tissues and systems, SARS-CoV-2 impacts the coagulation system, where it triggers the immunothrombotic response. Its effects are rather intense and can lead to many complications. COVID-19-associated coagulopathy is frequently observed in hospitalized patients, especially ICU patients, and can be proven detrimental. It is usually accompanied by other complications, such as sepsis-induced coagulopathy, disseminated intravascular coagulation and venous thromboembolism. Since all these conditions lead to poor prognosis for severely ill patients, thromboprophylaxis and coagulopathy prognosis are just as important as the therapeutic handling of these patients. Since the beginning of the pandemic, many biomarkers have been considered useful when trying to assess the thrombotic risk of hospitalized patients or evaluate the severity of their situation. At the same time, many drugs have already been tested-while others are still being trialed-in order to find the optimal therapy for each urgent situation.

Also flagged:HydroxyapatiteMagnesium PhosphateInfectionbone morphogenetic proteinBMP4ceftriaxone
Journal Article 2022-10-20 ✓ 1 Snippet Florea DA, Grumezescu V, Bîrcă AC, Vasile BȘ, Iosif A, Chircov C, Stan MS, Grumezescu AM, Andronescu E, Chifiriuc MC.
In-Text Gene Mentions

In this study, we used the matrix-assisted pulsed laser evaporation (MAPLE) technique to obtain hydroxyapatite (Ca10(PO4)6(OH)2) and magnesium phosphate (Mg3(PO4)2) thin coatings containing bone morphogenetic protein (BMP4) for promoting implants osteointegration and further nebulized with the antibiotic ceftriaxone (CXF) to prevent peri-implant infections.

Show Full Abstract

In this study, we used the matrix-assisted pulsed laser evaporation (MAPLE) technique to obtain hydroxyapatite (Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) and magnesium phosphate (Mg<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>) thin coatings containing bone morphogenetic protein (BMP4) for promoting implants osteointegration and further nebulized with the antibiotic ceftriaxone (CXF) to prevent peri-implant infections. The samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), selected area electron diffraction (SAED), infrared microscopy (IRM) and Fourier-transform infrared spectroscopy (FT-IR). Furthermore, the antimicrobial properties were evaluated on <i>Staphylococcus aureus</i> biofilms and the cytocompatibility on the MC3T3-E1 cell line. The obtained results proved the potential of the obtained coatings for bone implant applications, providing a significant antimicrobial and antibiofilm effect, especially in the first 48 h, and cytocompatibility in relation to murine osteoblast cells.

Also flagged:Peptidestripeptidelipoic acidphenethylaminecytoplasmicmembrane
Journal Article 2022-10-20 No Snippets Wang L, Liu H, Li X, Yao C.
Show Full Abstract

In this research, we constructed a novel engineered tripeptide modified with lipoic acid (LA-RWR), followed by crosslinking of lipoic acid to form nanoparticles (c-LA-RWR). LA-RWR was also modified with phenethylamine (PEA) on the C-terminus to achieve better antibacterial activities. The as-prepared c-LA-RWR and LA-RWR-PEA were effective against <i>E.</i><i>coli</i>, <i>S.</i><i>aureus</i>, <i>C.</i><i>albicans</i>, and methicillin-resistant <i>Staphylococcus aureus</i>, with minimum inhibitory concentration values ranging from 2 to 16 µg/mL, which greatly improved the performance of LA-RWR. Similar antibacterial activities were demonstrated in anti-biofilm activity; there was no matter on the biofilm that was already established or forming. Moreover, c-LA-RWR/LA-RWR-PEA remarkably induced cytoplasmic membrane depolarization and outer membrane permeabilization, resulting in varying degrees of damage to the bacterial morphology, which were consistent with the results obtained via electron microscopy. Thus, our results show that c-LA-RWR/LA-RWR-PEA exhibited excellent efficacy against a variety of microorganisms with good biosafety, providing new strategies by which to improve the performance of antimicrobial peptides.

Also flagged:HydroxyapatitepectinhydroxylcarboxylNanohydroxyapatiteMicrobial Infections
Journal Article 2022-10-20 No Snippets Saidi N, Azzaoui K, Ramdani M, Mejdoubi E, Jaradat N, Jodeh S, Hammouti B, Sabbahi R, Lamhamdi A.
Show Full Abstract

Hydroxyapatite (HAp) attracts interest as a biomaterial for use in bone substitution or allografts. In the current work, biomaterial nanocomposites based on HAp and pectin were synthesized by using the double decomposition method, which involved using pectin extracted from fresh cladodes of the prickly pear, <i>Opuntia ficus-indica</i>. The crystallinity, purity, and several analytical techniques like Fourier transform infrared spectroscopy, X-ray diffraction, and scanning electron microscopy were used to understand the surface's shape. The results revealed that the produced HAp/pectin nanoparticles are pure, spherical, and amorphous. The spectroscopic data indicated a substantial interaction between HAp and pectin, specifically between Ca (II) and pectin hydroxyl and carboxyl groups. The presence of pectin showed a noticeable influence on the prepared nanocomposite texture and porosity. We further assess the antibacterial and antifungal activity of the developed nanocomposite against a number of pathogenic bacteria and fungi, evaluated by the well diffusion method. In the absence of pectin, the XRD analysis revealed that the HAp nanoparticles had 10.93% crystallinity. When the pectin concentration reached 10 wt.%, it was reduced to approximately 7.29%. All synthesized nanocomposites demonstrated strong antimicrobial activity against both Gram-positive (<i>Staphylococcus aureus</i> and <i>Bacillus cereus</i>) and Gram-negative (<i>Escherichia coli</i> and <i>Pseudomonas aeruginosa</i>) bacteria in addition to various fungi (e.g., <i>Aspergillus fumigatus</i>, <i>Penicillium funiculosum</i>, and <i>Trichoderma viride</i>). This study endorses the HAp/Pectin nanocomposite as an efficient antimicrobial material for biomedical advanced applications.

Also flagged:mycobacterial infectionofmycobacterial infectionsBCGitisdisseminated tuberculosisto
Journal Article 2022-10-20 ✓ 5 Snippets Varzari A, Deyneko IV, Bruun GH, Dembic M, Hofmann W, Cebotari VM, Ginda SS, Andresen BS, Illig T.
In-Text Gene Mentions

To date, over 200 disease-associated variants in 17 autosomal (IFNGR1, IFNGR2, IL12B, IL12RB1, IL12RB2, STAT1, TYK2, IRF8, SPPL2A, IL23R, ISG15, JAK1, RORC, ZNFX1, TBX21, IFNG and USP18) and two X-linked (IKBKG and CYBB) genes have been described in patients with MSMD (Bustamante, 2020; Kerner et al., 2020; Tom Le Voye et al., 2021; Martin-Fernandez et al., 2022).

Using singleton WES, 12 heterozygous (monoallelic) mutations in the eight MSMD-causing genes, namely TYK2, ZNFX1, IFNGR1, IL23R, JAK1, IL12B, STAT1 and IL12RB, were detected in six patients.

…ISG15, JAK1, RORC,ZNFX1, TBX21, IFNG and…

…, IL23R ,ZNFX1, TBX21 ,…

…namely TYK2 ,ZNFX1, IFNGR1 ,…

Show Full Abstract

Inborn errors of immunity are known to influence susceptibility to mycobacterial infections. The aim of this study was to characterize the genetic profile of nine patients with mycobacterial infections (eight with BCGitis and one with disseminated tuberculosis) from the Republic of Moldova using whole-exome sequencing. In total, 12 variants in eight genes known to be associated with Mendelian Susceptibility to Mycobacterial Disease (MSMD) were detected in six out of nine patients examined. In particular, a novel splice site mutation c.373-2A>C in <i>STAT1</i> gene was found and functionally confirmed in a patient with disseminated tuberculosis. Trio analysis was possible for seven out of nine patients, and resulted in 23 candidate variants in 15 novel genes. Four of these genes - <i>GBP2</i>, <i>HEATR3</i>, <i>PPP1R9B</i> and <i>KDM6A</i> were further prioritized, considering their elevated expression in immune-related tissues. Compound heterozygosity was found in <i>GBP2</i> in a single patient, comprising a maternally inherited missense variant c.412G>A/p.(Ala138Thr) predicted to be deleterious and a paternally inherited intronic mutation c.1149+14T>C. Functional studies demonstrated that the intronic mutation affects splicing and the level of transcript. Finally, we analyzed pathogenicity of variant combinations in gene pairs and identified five patients with putative oligogenic inheritance. In summary, our study expands the spectrum of genetic variation contributing to susceptibility to mycobacterial infections in children and provides insight into the complex/oligogenic disease-causing mode.

Also flagged:Endometriosisgynecological diseasepathogenesisGene Expressioncomplement activationcell adhesion
Journal Article 2022-10-20 ✓ 5 Snippets Bae SJ, Jo Y, Cho MK, Jin JS, Kim JY, Shim J, Kim YH, Park JK, Ryu D, Lee HJ, Joo J, Ha KT.
In-Text Gene Mentions

We also found four druggable genes: FZD7, LY96, PTGIS, and CFH. FZD7 is a direct target of vantictumab, a neutralizing antibody currently being developed as an anticancer agent, particularly for triple-negative breast cancer (72, 73).

Three genes, FZD7, LY96, and PTGIS, were found to be associated with drugs vantictumab, eritoran tetrasodium, and phenylbutazone, respectively (Table 3).

According to western blot analysis, the protein levels of LY96, PDLIM3, and PTGIS were higher in the tissues of endometriosis patients.

(A–D) The protein expression of (A) LY96, (B) PDLIM3, (C) PTGIS, and (D) WISP2 was measured by IHC analysis of endometrial tissues from healthy volunteers or endometriosis patients.

The protein expression of LY96, PDLIM3, PTGIS, and WISP2 in endometriosis tissue.

Show Full Abstract

Endometriosis is a gynecological disease prevalent in women of reproductive age, and it is characterized by the ectopic presence and growth of the eutopic endometrium. The pathophysiology and diagnostic biomarkers of endometriosis have not yet been comprehensively determined. To discover molecular markers and pathways underlying the pathogenesis of endometriosis, we identified differentially expressed genes (DEGs) in three Gene Expression Omnibus microarray datasets (GSE11691, GSE23339, and GSE7305) and performed gene set enrichment analysis (GSEA) and protein-protein interaction (PPI) network analyses. We also validated the identified genes <i>via</i> immunohistochemical analysis of tissues obtained from patients with endometriosis or healthy volunteers. A total of 118 DEGs (79 upregulated and 39 downregulated) were detected in each dataset with a lower (fold change) FC cutoff (log2|FC| > 1), and 17 DEGs (11 upregulated and six downregulated) with a higher FC cutoff (log2|FC| > 2). KEGG and GO functional analyses revealed enrichment of signaling pathways associated with inflammation, complement activation, cell adhesion, and extracellular matrix in endometriotic tissues. Upregulation of seven genes (<i>C7</i>, <i>CFH</i>, <i>FZD7</i>, <i>LY96</i>, <i>PDLIM3</i>, <i>PTGIS</i>, and <i>WISP2</i>) out of 17 was validated <i>via</i> comparison with external gene sets, and protein expression of four genes (<i>LY96</i>, <i>PDLIM3</i>, <i>PTGIS</i>, and <i>WISP2</i>) was further analyzed by immunohistochemistry and western blot analysis. Based on these results, we suggest that TLR4/NF-κB and Wnt/frizzled signaling pathways, as well as estrogen receptors, regulate the progression of endometriosis. These pathways may be therapeutic and diagnostic targets for endometriosis.

Also flagged:Ferroptosisirondeathphospholipidlipidmetabolism
Journal Article 2022-10-20 No Snippets Zhou LP, Zhang RJ, Jia CY, Kang L, Zhang ZG, Zhang HQ, Wang JQ, Zhang B, Shen CL.
Show Full Abstract

Ferroptosis, an iron-dependent form of programmed cell death marked by phospholipid peroxidation, is regulated by complex cellular metabolic pathways including lipid metabolism, iron balance, redox homeostasis, and mitochondrial activity. Initial research regarding the mechanism of ferroptosis mainly focused on the solute carrier family 7 member 11/glutathione/glutathione peroxidase 4 (GPX4) signal pathway. Recently, novel mechanisms of ferroptosis, independent of GPX4, have been discovered. Numerous pathologies associated with extensive lipid peroxidation, such as drug-resistant cancers, ischemic organ injuries, and neurodegenerative diseases, are driven by ferroptosis. Ferroptosis is a new therapeutic target for the intervention of IVDD. The role of ferroptosis in the modulation of intervertebral disc degeneration (IVDD) is a significant topic of interest. This is a novel research topic, and research on the mechanisms of IVDD and ferroptosis is ongoing. Herein, we aim to review and discuss the literature to explore the mechanisms of ferroptosis, the relationship between IVDD and ferroptosis, and the regulatory networks in the cells of the nucleus pulposus, annulus fibrosus, and cartilage endplate to provide references for future basic research and clinical translation for IVDD treatment.

Also flagged:PTEN-induced kinase 1ParkindegradationmitochondriamitochondrialMitophagy
Journal Article 2022-10-20 ✓ 1 Snippet Braun MM, Puglielli L.
In-Text Gene Mentions

Huntington’s disease (HD) is a rare, monogenic, autosomal dominant neurodegenerative disorder affecting an estimated 5–10 people per 100,000 that is caused by expansion of the polyglutamine (polyQ) region in the huntingtin protein (HTT) (Labbadia and Morimoto, 2013).

Show Full Abstract

The selective degradation of mitochondria through mitophagy is a crucial process for maintaining mitochondrial function and cellular health. Mitophagy is a specialized form of selective autophagy that uses unique machinery to recognize and target damaged mitochondria for mitophagosome- and lysosome-dependent degradation. This process is particularly important in cells with high metabolic activity like neurons, and the accumulation of defective mitochondria is a common feature among neurodegenerative disorders. Here, we describe essential steps involved in the induction and progression of mitophagy, and then highlight the various mechanisms that specifically contribute to defective mitophagy in highly prevalent neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, and Amyotrophic Lateral Sclerosis.

Also flagged:neurodevelopmental disordersbrain developmentdevelopmental delayintellectual disabilitiesIDautism spectrum disorder
Journal Article 2022-10-20 ✓ 1 Snippet Damianidou E, Mouratidou L, Kyrousi C.
In-Text Gene Mentions

For instance, mutations in the ARFGEF2 gene encoding the vesicle trafficking Brefeldin A-associated guanine exchange factor 2 (BIG2), are implicated in the manifestation of PH in humans (Sheen, 2014).

Show Full Abstract

Neurodevelopmental disorders (NDDs) are a heterogeneous group of impairments that affect the development of the central nervous system leading to abnormal brain function. NDDs affect a great percentage of the population worldwide, imposing a high societal and economic burden and thus, interest in this field has widely grown in recent years. Nevertheless, the complexity of human brain development and function as well as the limitations regarding human tissue usage make their modeling challenging. Animal models play a central role in the investigation of the implicated molecular and cellular mechanisms, however many of them display key differences regarding human phenotype and in many cases, they partially or completely fail to recapitulate them. Although <i>in vitro</i> two-dimensional (2D) human-specific models have been highly used to address some of these limitations, they lack crucial features such as complexity and heterogeneity. In this review, we will discuss the advantages, limitations and future applications of <i>in vivo</i> and <i>in vitro</i> models that are used today to model NDDs. Additionally, we will describe the recent development of 3-dimensional brain (3D) organoids which offer a promising approach as human-specific <i>in vitro</i> models to decipher these complex disorders.

Also flagged:Liver diseaseenteropathyCommon variable immunodeficiencyCVIDerrors ofliver disorder
Journal Article 2022-10-20 ✓ 1 Snippet Lima FMS, Toledo-Barros M, Alves VAF, Duarte MIS, Takakura C, Bernardes-Silva CF, Marinho AKBB, Grecco O, Kalil J, Kokron CM.
In-Text Gene Mentions

…for hepatitis C),hemochromatosis, Wilson’s disease, alcoholic…

Show Full Abstract

Common variable immunodeficiency (CVID) is one of the inborn errors of immunity that have the greatest clinical impact. Rates of morbidity and mortality are higher in patients with CVID who develop liver disease than in those who do not. The main liver disorder in CVID is nodular regenerative hyperplasia (NRH), the cause of which remains unclear and for which there is as yet no treatment. The etiology of liver disease in CVID is determined by analyzing the liver injury and the associated conditions. The objective of this study was to compare CVID patients with and without liver-spleen axis abnormalities in terms of clinical characteristics, as well as to analyze liver and duodenal biopsies from those with portal hypertension (PH), to elucidate the pathophysiology of liver injury. Patients were divided into three groups: Those with liver disease/PH, those with isolated splenomegaly, and those without liver-spleen axis abnormalities. Clinical and biochemical data were collected. Among 141 CVID patients, 46 (32.6%) had liver disease/PH; 27 (19.1%) had isolated splenomegaly; and 68 (48.2%) had no liver-spleen axis abnormalities. Among the liver disease/PH group, patients, even those with mild or no biochemical changes, had clinical manifestations of PH, mainly splenomegaly, thrombocytopenia, and esophageal varices. Duodenal celiac pattern was found to correlate with PH (p < 0.001). We identified NRH in the livers of all patients with PH (<i>n</i> = 11). Lymphocytic infiltration into the duodenal mucosa also correlated with PH. Electron microscopy of liver biopsy specimens showed varying degrees of lymphocytic infiltration and hepatocyte degeneration, which is a probable mechanism of lymphocyte-mediated cytotoxicity against hepatocytes and enterocytes. In comparison with the CVID patients without PH, those with PH were more likely to have lymphadenopathy (p < 0.001), elevated β<sub>2</sub>-microglobulin (p < 0.001), low B-lymphocyte counts (p < 0.05), and low natural killer-lymphocyte counts (p < 0.05). In CVID patients, liver disease/PH is common and regular imaging follow-up is necessary. These patients have a distinct immunological phenotype that may predispose to liver and duodenal injury from lymphocyte-mediated cytotoxicity. Further studies could elucidate the cause of this immune-mediated mechanism and its treatment options.

Also flagged:CD44CD133Colorectal cancercancerColorectal Stem Cell Cancerdeath
Journal Article 2022-10-20 ✓ 1 Snippet Abdou Hassan W, Muqresh MA, Omer M.
In-Text Gene Mentions

…in colon cancer (DCC), K-Ras, p53, B-Raf…

Show Full Abstract

Colorectal cancer (CRC) is the most preventable malignancy globally, with a high mortality rate. Cancer stem cells (CSCs) are found previously in multiple types of cancer; CRC is one of them, and it has been correlated with several biomarkers. The two most essential markers related to colorectal CSCs are CD44 and CD133, which play a significant role in diagnosis, treatment, and prognosis. Unfortunately, the CSCs with positive CD44 and CD133 biomarkers illustrated an alarming prognosis. Several trials were trying to target those markers to improve the prognosis and cure. We aimed to review the papers that relate to the two markers in terms of diagnosis, treatment, and prognosis.

Also flagged:IL28Bchronic hepatitis Bhepatitis Bliver cirrhosiscirrhosishepatitis B infection
Journal Article 2022-10-20 ✓ 1 Snippet Cakal B, Cavus B, Atasoy A, Altunok D, Poda M, Bulakci M, Gulluoglu M, Demirci M, Sener LT, Arslan AB, Akyuz F.
In-Text Gene Mentions

…as Wilson andhemochromatosis), and alcohol-induced liver…

Show Full Abstract

<h4>Objective</h4>The purpose of this study was to evaluate the relationship of IL28B rs12979860 and rs8099917 polymorphisms with the clinical, histological, and virological outcomes of patients with chronic hepatitis B (CHB) also the treatment responses of patients who received Nucleos(t)ide analogs (NAs) therapy.<h4>Methods</h4>This study included 152 CHB patients who were underwent liver parenchymal biopsy. The IL28B rs12979860 and rs8099917 polymorphism were genotyped using the TaqMan assay.<h4>Results</h4>The IL28B rs12979860 CC and IL28B rs8099917 TT were identified as the genotypes with the highest frequency in all patients. On the other hand, IL28B rs12979860 TT and IL28B rs8099917 GG were the genotypes with the lowest frequency. The frequency of IL28B rs8099917 TG genotype was significantly different between patients with hepatitis B, who has histologically defined liver cirrhosis and no-fibrosis (p=0.02). In addition, a statistically significant correlation was found between the presence of IL28B rs8099917 G allele and virological unresponsiveness to NAs treatments in CHB patients (p=0.028).<h4>Conclusion</h4>The presence of the IL28B rs8099917 G allele in CHB patients might be associated with the risk of developing cirrhosis and virological unresponsiveness to NAs treatments.

Also flagged:M. incognita disease complexM. incognita infectionethanolsporulationtranslational elongation factorβeta-tubulin
Journal Article 2022-10-20 No Snippets Dyer DR, Newman M, Lawrence KS.
Show Full Abstract

This study assess the population diversity and temporal variability of caused by <i>Fusarium oxysporum</i> f. sp. <i>vasinfectum</i> (FOV) races/genotypes infecting cotton cultivars with either FOV or <i>Meloidogyne incognita</i> resistance. All plants sampled demonstrated typical symptoms of FOV including wilting, chlorosis and necrosis of the leaves, and discoloration of the vascular tissue in the stem. A diverse population of FOV was characterized. Eight races/genotypes of FOV were collected throughout the three site years. FOV race 1 was the most predominant in all tests (AUDPC=101.1); statistically higher numbers of isolates from LA-108 (AUDPC=59.9), race 8 (AUDPC=47.5), and race 2 (AUDPC=38.6) were also found compared to other races and genotypes collected. FOV race 1, race 2, race 8, and 108 were the most virulent races identified. The genotypes MDS-12, LA-110, and LA-127/140 were found in all tests but at a low incidence, and LA-112 was only found in trace amounts. MDS-12, LA-110, LA-112, and LA-127/140 produced less disease pressure. FOV race 4 which is highly virulent and present in California and Texas was not found in Alabama. A positive correlation was observed between the accumulation of growing degree days and FOV race 1, race 2, race 8, LA-108, and LA-110. Later symptom expression influenced by seasonal heat partially mitigates damage allowing cotton to produce bolls though they may be reduced in number and lint quality. Plant resistance to the FOV as expressed in these cultivars appears to provide better protection than <i>M. incognita</i> resistance. PhytoGen 72, which is resistant to FOV races/genotypes had low levels of FOV infection even though it sustained a high level of <i>M. incognita</i> root population density. The <i>M. incognita</i> resistant cultivars Deltapine 1558NR B2RF and PhytoGen 480 W3FE supported a lower nematode population density, however, FOV disease incidence was not reduced. FOV races/genotypes did not vary significantly between the nematode resistant and nematode susceptible cultivars.

Also flagged:ALSpathogenesisdegradationamyotrophic lateral sclerosisneurodegenerative diseasedeath
Journal Article 2022-10-19 ✓ 1 Snippet Elbasiouny SM.
In-Text Gene Mentions

…used abnormally lowDCCfrequencies (which evokes…

Show Full Abstract

In amyotrophic lateral sclerosis (ALS), abnormalities in motoneuronal excitability are seen in early pathogenesis and throughout disease progression. Fully understanding motoneuron excitability dysfunction may lead to more effective treatments. Yet decades of research have not produced consensus on the nature, role or underlying mechanisms of motoneuron excitability dysfunction in ALS. For example, contrary to Ca excitotoxicity theory, predictions of motoneuronal hyper-excitability, normal and hypo-excitability have also been seen at various disease stages and in multiple ALS lines. Accordingly, motoneuron excitability dysfunction in ALS is a disputed topic in the field. Specifically, the form (hyper, hypo or unchanged) and what role excitability dysfunction plays in the disease (pathogenic or downstream of other pathologies; neuroprotective or detrimental) are currently unclear. Although several motoneuron properties that determine cellular excitability change in the disease, some of these changes are pro-excitable, whereas others are anti-excitable, making dynamic fluctuations in overall 'net' excitability highly probable. Because various studies assess excitability via differing methods and at differing disease stages, the conflicting reports in the literature are not surprising. Hence, the overarching process of excitability degradation and motoneuron degeneration is not fully understood. Consequently, the discrepancies on motoneuron excitability dysfunction in the literature represent a substantial barrier to our understanding of the disease. Emerging studies suggest that biological variables, variations in experimental protocols, issues of rigor and sampling/analysis strategies are key factors that may underlie conflicting data in the literature. This review highlights potential confounding factors for researchers to consider and also offers ideas on avoiding pitfalls and improving robustness of data.

Also flagged:bindingHuntingtinpolyglutamineHuntington's diseaseautophagosomehydrogen
Journal Article 2022-10-19 ✓ 5 Snippets Guan J, Song Z, Wei G, Qiao Q.
In-Text Gene Mentions

Abnormal elongation of the polyglutamine tract transforms exon 1 of the Huntingtin protein (Htt-exon-1) from wildtype to pathogenic form, and causes Huntington's disease.

Our simulations reveal that the ispinesib binding induces opposite conformational changes in pathogenic and wildtype Htt-exon-1, <i>i.e.</i>, the 'entropy collapse' with significant reduction of β-sheets <i>versus</i> the 'entropy expansion' with a slight increase of α-helices.

Herein, we carry out extensive molecular dynamics simulations with an enhanced sampling method to investigate the ispinesib inducing conformational changes of pathogenic and wildtype Htt-exon-1 and the corresponding binding mechanisms.

…the Huntingtin protein (Htt-exon-1) from wildtype to…

…structural ensemble ofHtt-exon-1 is highly heterogeneou…

Show Full Abstract

Abnormal elongation of the polyglutamine tract transforms exon 1 of the Huntingtin protein (Htt-exon-1) from wildtype to pathogenic form, and causes Huntington's disease. As an intrinsically disordered protein, the structural ensemble of Htt-exon-1 is highly heterogeneous and the detailed conformation of toxic species is still under debate. Ispinesib, a potential small-molecule drug, has been identified to selectively link the pathogenic Htt-exon-1 into the autophagosome to degrade, thus opening an innovative therapeutic direction. However, the molecular mechanisms behind this selectivity remain largely elusive. Herein, we carry out extensive molecular dynamics simulations with an enhanced sampling method to investigate the ispinesib inducing conformational changes of pathogenic and wildtype Htt-exon-1 and the corresponding binding mechanisms. Our simulations reveal that the ispinesib binding induces opposite conformational changes in pathogenic and wildtype Htt-exon-1, <i>i.e.</i>, the 'entropy collapse' with significant reduction of β-sheets <i>versus</i> the 'entropy expansion' with a slight increase of α-helices. Network analyses further reveal that there are two stable binding sites in the pathogenic Htt-exon-1, while the binding on the wildtype Htt-exon-1 is highly dynamic and non-specific. These dramatic differences originate from the underlying distinct binding interactions. More specifically, stronger hydrogen bonds serve as the specific binding anchors in pathogenic Htt-exon-1, while stronger hydrophobic interactions dominate in the dynamic binding with wildtype Htt-exon-1. Our simulations provide an atomistic mechanism for the ispinesib selective binding on the pathogenic Htt-exon-1, and further shed light on the general mechanisms of small molecule modulation on intrinsically disordered proteins.

Also flagged:ossificationfibrodysplasiafibrodysplasia ossificans progressivagenetic disordertransductionACVR1
Journal Article 2022-10-19 ✓ 1 Snippet Yang YS, Kim JM, Xie J, Chaugule S, Lin C, Ma H, Hsiao E, Hong J, Chun H, Shore EM, Kaplan FS, Gao G, Shim JH.
In-Text Gene Mentions

…Tnfsf11, Tnfsf13, Tnfsf13b,Tnfsf4, Vegfa , and…

Show Full Abstract

Heterotopic ossification is the most disabling feature of fibrodysplasia ossificans progressiva, an ultra-rare genetic disorder for which there is currently no prevention or treatment. Most patients with this disease harbor a heterozygous activating mutation (c.617 G > A;p.R206H) in ACVR1. Here, we identify recombinant AAV9 as the most effective serotype for transduction of the major cells-of-origin of heterotopic ossification. We use AAV9 delivery for gene replacement by expression of codon-optimized human ACVR1, ACVR1R206H allele-specific silencing by AAV-compatible artificial miRNA and a combination of gene replacement and silencing. In mouse skeletal cells harboring a conditional knock-in allele of human mutant ACVR1 and in patient-derived induced pluripotent stem cells, AAV gene therapy ablated aberrant Activin A signaling and chondrogenic and osteogenic differentiation. In Acvr1(R206H) knock-in mice treated locally in early adulthood or systemically at birth, trauma-induced endochondral bone formation was markedly reduced, while inflammation and fibroproliferative responses remained largely intact in the injured muscle. Remarkably, spontaneous heterotopic ossification also substantially decreased in in Acvr1(R206H) knock-in mice treated systemically at birth or in early adulthood. Collectively, we develop promising gene therapeutics that can prevent disabling heterotopic ossification in mice, supporting clinical translation to patients with fibrodysplasia ossificans progressiva.

Also flagged:MHC-IMHC-IIantigen presentationcancerdevil facial tumourstumour
Journal Article 2022-10-19 ✓ 4 Snippets Ong CEB, Cheng Y, Siddle HV, Lyons AB, Woods GM, Flies AS.
In-Text Gene Mentions

…include CD74 ,butyrophilin subfamily 2 member A2subfamily 2 member…

…member A2 (BTN2A2) and gamma-interferon-inducib…

…Except forBTN2A2and IFI30 ,…

…expression of butyrophilinBTN2A2by CIITA in…

Show Full Abstract

MHC-I and MHC-II molecules are critical components of antigen presentation and T cell immunity to pathogens and cancer. The two monoclonal transmissible devil facial tumours (DFT1, DFT2) exploit MHC-I pathways to overcome immunological anti-tumour and allogeneic barriers. This exploitation underpins the ongoing transmission of DFT cells across the wild Tasmanian devil population. We have previously shown that the overexpression of NLRC5 in DFT1 and DFT2 cells can regulate components of the MHC-I pathway but not MHC-II, establishing the stable upregulation of MHC-I on the cell surface. As MHC-II molecules are crucial for CD4<sup>+</sup> T cell activation, MHC-II expression in tumour cells is beginning to gain traction in the field of immunotherapy and cancer vaccines. The overexpression of Class II transactivator in transfected DFT1 and DFT2 cells induced the transcription of several genes of the MHC-I and MHC-II pathways. This was further supported by the upregulation of MHC-I protein on DFT1 and DFT2 cells, but interestingly MHC-II protein was upregulated only in DFT1 cells. This new insight into the regulation of MHC-I and MHC-II pathways in cells that naturally overcome allogeneic barriers can inform vaccine, immunotherapy and tissue transplant strategies for human and veterinary medicine.

Also flagged:aginggene expressionmembraneLYVE1S100a8S100a9
Journal Article 2022-10-19 ✓ 2 Snippets Krasniewski LK, Chakraborty P, Cui CY, Mazan-Mamczarz K, Dunn C, Piao Y, Fan J, Shi C, Wallace T, Nguyen C, Rathbun IA, Munk R, Tsitsipatis D, De S, Sen P, Ferrucci L, Gorospe M.
In-Text Gene Mentions

…, Prdx5 ,Prdx6, Prdx1 ,…

…Prdx5 , andPrdx6mRNAs), inflammation (e.g.…

Show Full Abstract

Tissue-resident macrophages represent a group of highly responsive innate immune cells that acquire diverse functions by polarizing toward distinct subpopulations. The subpopulations of macrophages that reside in skeletal muscle (SKM) and their changes during aging are poorly characterized. By single-cell transcriptomic analysis with unsupervised clustering, we found 11 distinct macrophage clusters in male mouse SKM with enriched gene expression programs linked to reparative, proinflammatory, phagocytic, proliferative, and senescence-associated functions. Using a complementary classification, membrane markers LYVE1 and MHCII identified four macrophage subgroups: LYVE1-/MHCII<sup>hi</sup> (M1-like, classically activated), LYVE1+/MHCII<sup>lo</sup> (M2-like, alternatively activated), and two new subgroups, LYVE1+/MHCII<sup>hi</sup> and LYVE1-/MHCII<sup>lo</sup>. Notably, one new subgroup, LYVE1+/MHCII<sup>hi</sup>, had traits of both M2 and M1 macrophages, while the other new subgroup, LYVE1-/MHCII<sup>lo</sup>, displayed strong phagocytic capacity. Flow cytometric analysis validated the presence of the four macrophage subgroups in SKM and found that LYVE1- macrophages were more abundant than LYVE1+ macrophages in old SKM. A striking increase in proinflammatory markers (<i>S100a8</i> and <i>S100a9</i> mRNAs) and senescence-related markers (<i>Gpnmb</i> and <i>Spp1</i> mRNAs) was evident in macrophage clusters from older mice. In sum, we have identified dynamically polarized SKM macrophages and propose that specific macrophage subpopulations contribute to the proinflammatory and senescent traits of old SKM.

Also flagged:E3 Ligasesneurodegenerative diseasesE3 ubiquitin ligasesdeubiquitinating enzymespathogenesisUbiquitination
Journal Article 2022-10-19 ✓ 1 Snippet Liu N, Lin MM, Wang Y.
In-Text Gene Mentions

The pathological hallmark of HD is an expansion mutation of trinucleotide CAG in exon 1 of the huntingtin gene (HTT) [98].

Show Full Abstract

Despite annual increases in the incidence and prevalence of neurodegenerative diseases, there is a lack of effective treatment strategies. An increasing number of E3 ubiquitin ligases (E3s) and deubiquitinating enzymes (DUBs) have been observed to participate in the pathogenesis mechanisms of neurodegenerative diseases, on the basis of which we conducted a systematic literature review of the studies. This review will help to explore promising therapeutic targets from highly dynamic ubiquitination modification processes.

Also flagged:non-alcoholic fatty liver diseaseNAFLDgene expressionsecretionLPAlipoprotein A
Journal Article 2022-10-19 ✓ 1 Snippet Hagemann CA, Legart C, Møllerhøj MB, Madsen MR, Hansen HH, Kønig MJ, Helgstrand F, Hjørne FP, Toxværd A, Langhoff JL, Kielgast UL, Gluud LL, Ægidius H, Rigbolt KTG, Vilsbøll T, Jelsing J, Knop FK.
In-Text Gene Mentions

…antitrypsin deficiency andhemochromatosis.…

Show Full Abstract

Non-invasive biomarkers of non-alcoholic fatty liver disease (NAFLD) supporting diagnosis and monitoring disease progression are urgently needed. The present study aimed to establish a bioinformatics pipeline capable of defining and validating NAFLD biomarker candidates based on paired hepatic global gene expression and plasma bioanalysis from individuals representing different stages of histologically confirmed NAFLD (no/mild, moderate, more advanced NAFLD). Liver secretome gene signatures were generated in a patient cohort of 26 severely obese individuals with the majority having no or mild fibrosis. To this end, global gene expression changes were compared between individuals with no/mild NAFLD and moderate/advanced NAFLD with subsequent filtering for candidate gene products with liver-selective expression and secretion. Four candidate genes, including LPA (lipoprotein A), IGFBP-1 (insulin-like growth factor-binding protein 1), SERPINF2 (serpin family F member 2) and MAT1A (methionine adenosyltransferase 1A), were differentially expressed in moderate/advanced NAFLD, which was confirmed in three independent RNA sequencing datasets from large, publicly available NAFLD studies. The corresponding gene products were quantified in plasma samples but could not discriminate among different grades of NAFLD based on NAFLD activity score. Conclusion: We demonstrate a novel approach based on the liver transcriptome allowing for identification of secreted hepatic gene products as potential circulating diagnostic biomarkers of NAFLD. Using this approach in larger NAFLD patient cohorts may yield potential circulating biomarkers for NAFLD severity.

Also flagged:Runx2Runx3Runt-related transcription factorosteoarthritismatrix metallopeptidase 13Mmp13
Journal Article 2022-10-19 ✓ 1 Snippet Nagata K, Hojo H, Chang SH, Okada H, Yano F, Chijimatsu R, Omata Y, Mori D, Makii Y, Kawata M, Kaneko T, Iwanaga Y, Nakamoto H, Maenohara Y, Tachibana N, Ishikura H, Higuchi J, Taniguchi Y, Ohba S, Chung UI, Tanaka S, Saito T.
In-Text Gene Mentions

…induce Sox5 andSox6, leading to Col2a1…

Show Full Abstract

The Runt-related transcription factor (Runx) family plays various roles in the homeostasis of cartilage. Here, we examined the role of Runx2 and Runx3 for osteoarthritis development in vivo and in vitro. Runx3-knockout mice exhibited accelerated osteoarthritis following surgical induction, accompanied by decreased expression of lubricin and aggrecan. Meanwhile, Runx2 conditional knockout mice showed biphasic phenotypes: heterozygous knockout inhibited osteoarthritis and decreased matrix metallopeptidase 13 (Mmp13) expression, while homozygous knockout of Runx2 accelerated osteoarthritis and reduced type II collagen (Col2a1) expression. Comprehensive transcriptional analyses revealed lubricin and aggrecan as transcriptional target genes of Runx3, and indicated that Runx2 sustained Col2a1 expression through an intron 6 enhancer when Sox9 was decreased. Intra-articular administration of Runx3 adenovirus ameliorated development of surgically induced osteoarthritis. Runx3 protects adult articular cartilage through extracellular matrix protein production under normal conditions, while Runx2 exerts both catabolic and anabolic effects under the inflammatory condition.

Also flagged:16 S ribosomal RNA (rRNA)V1-V2ASV16 S ribosomal RNA (rRNA)C1qBPCARD8
Journal Article 2022-10-19 ✓ 1 Snippet Moitinho-Silva L, Degenhardt F, Rodriguez E, Emmert H, Juzenas S, Möbus L, Uellendahl-Werth F, Sander N, Baurecht H, Tittmann L, Lieb W, Gieger C, Peters A, Ellinghaus D, Bang C, Franke A, Weidinger S, Rühlemann MC.
In-Text Gene Mentions

…localized at genesHTT(locus id: 5,…

Show Full Abstract

Despite the increasing knowledge about factors shaping the human microbiome, the host genetic factors that modulate the skin-microbiome interactions are still largely understudied. This contrasts with recent efforts to characterize host genes that influence the gut microbiota. Here, we investigated the effect of genetics on skin microbiota across three different skin microenvironments through meta-analyses of genome-wide association studies (GWAS) of two population-based German cohorts. We identified 23 genome-wide significant loci harboring 30 candidate genes involved in innate immune signaling, environmental sensing, cell differentiation, proliferation and fibroblast activity. However, no locus passed the strict threshold for study-wide significance (P < 6.3 × 10<sup>-10</sup> for 80 features included in the analysis). Mendelian randomization (MR) analysis indicated the influence of staphylococci on eczema/dermatitis and suggested modulating effects of the microbiota on other skin diseases. Finally, transcriptional profiles of keratinocytes significantly changed after in vitro co-culturing with Staphylococcus epidermidis, chosen as a representative of skin commensals. Seven candidate genes from the GWAS were found overlapping with differential expression in the co-culturing experiments, warranting further research of the skin commensal and host genetic makeup interaction.

Also flagged:Arl13bHedgehogprimaryciliumorganellekeratin 5
Journal Article 2022-10-19 ✓ 1 Snippet Girardet L, Cyr DG, Belleannée C.
In-Text Gene Mentions

Sox6

Show Full Abstract

Epithelial cells orchestrate a series of intercellular signaling events in response to tissue damage. While the epididymis is composed of a pseudostratified epithelium that controls the acquisition of male fertility, the maintenance of its integrity in the context of tissue damage or inflammation remains largely unknown. Basal cells of the epididymis contain a primary cilium, an organelle that controls cellular differentiation in response to Hedgehog signaling cues. Hypothesizing its contribution to epithelial homeostasis, we knocked out the ciliary component ARL13B in keratin 5-positive basal cells. In this model, the reduced size of basal cell primary cilia was associated with impaired Hedgehog signaling and the loss of KRT5, KRT14, and P63 basal cell markers. When subjected to tissue injury, the epididymal epithelium from knock-out mice displayed imbalanced rates of cell proliferation/apoptosis and failed to properly regenerate in vivo. This response was associated with changes in the transcriptomic landscape related to immune response, cell differentiation, cell adhesion, and triggered severe hypoplasia of the epithelium. Together our results indicate that the ciliary GTPase, ARL13B, participates in the transduction of the Hedgehog signaling pathway to maintain basal cell stemness needed for tissue regeneration. These findings provide new insights into the role of basal cell primary cilia as safeguards of pseudostratified epithelia.

Also flagged:lipidamino acidmetabolismfatty acidPerilipin 2kidney fibrosis
Journal Article 2022-10-19 ✓ 1 Snippet Li H, Dixon EE, Wu H, Humphreys BD.
In-Text Gene Mentions

Plcl1

Show Full Abstract

The underlying cellular events driving kidney fibrogenesis and metabolic dysfunction are incompletely understood. Here, we employed single-cell combinatorial indexing RNA sequencing to analyze 24 mouse kidneys from two fibrosis models. We profiled 309,666 cells in one experiment, representing 50 cell types/states encompassing epithelial, endothelial, immune, and stromal populations. Single-cell analysis identified diverse injury states of the proximal tubule, including two distinct early-phase populations with dysregulated lipid and amino acid metabolism, respectively. Lipid metabolism was defective in the chronic phase but was transiently activated in the very early stages of ischemia-induced injury, where we discovered increased lipid deposition and increased fatty acid β-oxidation. Perilipin 2 was identified as a surface marker of intracellular lipid droplets, and its knockdown in vitro disrupted cell energy state maintenance during lipid accumulation. Surveying epithelial cells across nephron segments identified shared and unique injury responses. Stromal cells exhibited high heterogeneity and contributed to fibrogenesis by epithelial-stromal crosstalk.

Also flagged:bone morphogenetic proteinsBMPscollagenBMPbone formationtumor
Journal Article 2022-10-19 No Snippets Arias-Betancur A, Badilla-Wenzel N, Astete-Sanhueza Á, Farfán-Beltrán N, Dias FJ.
Show Full Abstract

Different types of biomaterials have been used to fabricate carriers to deliver bone morphogenetic proteins (BMPs) in both dentoalveolar and maxillofacial bone regeneration procedures. Despite that absorbable collagen sponge (ACS) is considered the gold standard for BMP delivery, there is still some concerns regarding its use mainly due to its poor mechanical properties. To overcome this, novel systems are being developed, however, due to the wide variety of biomaterial combination, the heterogeneous assessment of newly formed tissue, and the intended clinical applications, there is still no consensus regarding which is more efficient in a particular clinical scenario. The combination of two or more biomaterials in different topological configurations has allowed specific controlled-release patterns for BMPs, improving their biological and mechanical properties compared with classical single-material carriers. However, more basic research is needed. Since the BMPs can be used in multiple clinical scenarios having different biological and mechanical needs, novel carriers should be developed in a context-specific manner. Thus, the purpose of this review is to gather current knowledge about biomaterials used to fabricate delivery systems for BMPs in both dentoalveolar and maxillofacial contexts. Aspects related with the biological, physical and mechanical characteristics of each biomaterial are also presented and discussed.

Also flagged:porphyrinsend stage renal diseasemetabolismESRDporphyrinporphyrias
Journal Article 2022-10-19 ✓ 1 Snippet Goldman S, Zidan O, Edel Y, Schechter A, Mimouni T, Hodak E, Cohen S, Mamet R, Rozen-Zvi B, Levi A.
In-Text Gene Mentions

…HIV infection andhemochromatosis[ [3] ,…

Show Full Abstract

<h4>Introduction</h4>Several abnormalities of porphyrin metabolism leading to Porphyria Cutanea Tarda (PCT) have been described in early studies of End Stage Renal Disease (ESRD) patients, with a reported prevalence of 5-18%. We aimed to evaluate porphyrin levels and correlation to skin manifestations in modern dialysis era.<h4>Methods</h4>The study cohort included adult hemodialysis patients from a single center tertiary medical center. All patients underwent a full skin examination, completed the Dermatology Life Quality Index questioner, and provided a blood sample for porphyrin levels assessment.<h4>Results</h4>A total of 94 adult hemodialysis patients were recruited to the study. No clinical PCT was diagnosed. Porphyrin levels did not correlate with any clinical or dialysis quality parameters.<h4>Conclusions</h4>In modern hemodialysis era, possibly due to improved porphyrins' metabolism and dialysis removal, PCT is much less prevalent among hemodialysis patients than previously reported in the past.

Also flagged:LipidtransthyretinamyloidosisCOVID-19vesiclephospholipid
Journal Article 2022-10-19 ✓ 1 Snippet Mashima R, Takada S.
In-Text Gene Mentions

Thus, the degradation of this gene is expected to treat both hemophilia A and B. In a murine model, the inactivation of Serpinc1 gene by LNP-encapsulated siRNA has been examined with a therapeutic outcome.

Show Full Abstract

Lipid nanoparticles (LNPs) are an emerging vehicle for gene delivery that accommodate both nucleic acid and protein. Based on the experience of therapeutic liposomes, current LNPs have been developed based on the chemistry of lipids and RNA and on the biology of human disease. LNPs have been used for the development of Onpattro, an siRNA drug for transthyretin-mediated amyloidosis, in 2018. The subsequent outbreak of COVID-19 required a vaccine for its suppression. LNP-based vaccine production received much attention for this and resulted in great success. In this review, the essential technology of LNP gene delivery has been described according to the chemistry for LNP production and biology for its clinical application.

Also flagged:parvovirus infectionpolymerasenucleotidesnucleotidecapsid proteinviral genome
Journal Article 2022-10-19 No Snippets Dong HV, Tran GTH, Nguyen HTT, Nguyen TM, Trinh DQ, Le VP, Choowongkomon K, Rattanasrisomporn J.
Show Full Abstract

In total, 130 tissue-pooled samples collected from ducks in some provinces/cities in north Vietnam were examined for waterfowl parvovirus genome identification. Twenty-six (20%) samples were positive for the parvovirus infection, based on polymerase chain reaction analysis. Of the 38 farms tested, 14 (36.84%) were positive for the waterfowl parvovirus genome. The rate of the parvovirus genome detection in ducks aged 2−4 weeks (37.04%) was significantly (p < 0.05) higher than that at ages <2 weeks (9.09%) and >4 weeks (16.30%). The positive rate on medium-scale farms (9.36%) was significantly (p < 0.05) lower than for small-scale (31.03%) and large-scale (29.73%) farms. The lengths of the four Vietnamese waterfowl parvovirus genomes identified were 4750 nucleotides. Among the four Vietnamese parvovirus genomes, nucleotide identities were from 99.29% to 99.87%. Phylogenetic analysis of the near-complete genomes indicated that the waterfowl circulating in northern Vietnam belonged to the novel goose parvovirus (NGPV) group. The Vietnamese NGPV group was closely related to the Chinese group. Recombination analysis suggested that the Vietnam/VNUA-26/2021 strain was generated by a recombination event. One positive selection site of the capsid protein was detected.

Also flagged:Sodium monofluorophosphatefluoridesodium fluoridephosphoric acidfluoride ionscaries
Journal Article 2022-10-19 No Snippets Satou R, Yamagishi A, Takayanagi A, Iwasaki M, Kamijo H, Sugihara N.
Show Full Abstract

Sodium monofluorophosphate (MFP) is a component of fluoride-containing dentifrices and is more biosafe than the conventional sodium fluoride (NaF). MFP can respond not only on the tooth surface layer but also deep into the enamel. We aim to confirm that high concentrations of acid phosphate MFP (AP-MFP, 9000 ppmF), used in professional care, could lead to a highly biosafe fluoride application method that acts through the deep enamel layers. Sample groups were respectively treated in vitro with NaF, acidulated phosphate fluoride (APF), MFP, and AP-MFP, and the samples were compared against an untreated group. Characterizations after fluoride application confirmed that MFP and AP-MFP treatments improved the acid resistance of enamel compared to that of conventional methods. Furthermore, the acid resistance of highly concentrated MFPs improved by using phosphoric acid. Although the acid resistance from the AP-MFP method is not as good as that using APF, AP-MFP can act both on the surface layer and deep into the enamel. Moreover, AP-MFP retains fluoride ions as much as APF does on the tooth surface. The proposed fluoride application method using AP-MFP introduces a dental treatment for acid resistance that is highly biosafe and penetrates deep layers of the enamel.

Also flagged:Hydroxyapatiteapatiteoctacalcium phosphateagingskeletal diseasesinfection
Journal Article 2022-10-19 No Snippets Aubry C, Drouet C, Azaïs T, Kim HJ, Oh JM, Karacan I, Chou J, Ben-Nissan B, Camy S, Cazalbou S.
Show Full Abstract

Biphasic macroporous Hydroxyapatite/β-Tricalcium Phosphate (HA/β-TCP) scaffolds (BCPs) are widely used for bone repair. However, the high-temperature HA and β-TCP phases exhibit limited bioactivity (low solubility of HA, restricted surface area, low ion release). Strategies were developed to coat such BCPs with biomimetic apatite to enhance bioactivity. However, this can be associated with poor adhesion, and metastable solutions may prove difficult to handle at the industrial scale. Alternative strategies are thus desirable to generate a highly bioactive surface on commercial BCPs. In this work, we developed an innovative "coating from" approach for BCP surface remodeling via hydrothermal treatment under supercritical CO<sub>2</sub>, used as a reversible pH modifier and with industrial scalability. Based on a set of complementary tools including FEG-SEM, solid state NMR and ion exchange tests, we demonstrate the remodeling of macroporous BCP surface with the occurrence of dissolution-reprecipitation phenomena involving biomimetic CaP phases. The newly precipitated compounds are identified as bone-like nanocrystalline apatite and octacalcium phosphate (OCP), both known for their high bioactivity character, favoring bone healing. We also explored the effects of key process parameters, and showed the possibility to dope the remodeled BCPs with antibacterial Cu<sup>2+</sup> ions to convey additional functionality to the scaffolds, which was confirmed by in vitro tests. This new process could enhance the bioactivity of commercial BCP scaffolds via a simple and biocompatible approach.

Also flagged:oligonucleotideneurodegenerative disorderscancerorphan diseasesnucleotidesoligonucleotides
Journal Article 2022-10-19 ✓ 1 Snippet Thakur S, Sinhari A, Jain P, Jadhav HR.
In-Text Gene Mentions

…disease Huntingtin protein (HTT) ASO NCT03761849 Tofersen…

Show Full Abstract

It is estimated that the human genome encodes 15% of proteins that are considered to be disease-modifying. Only 2% of these proteins possess a druggable site that the approved clinical candidates target. Due to this disparity, there is an immense need to develop therapeutics that may better mitigate the disease or disorders aroused by non-druggable and druggable proteins or enzymes. The recent surge in approved oligonucleotide therapeutics (OT) indicates the imminent potential of these therapies. Oligonucleotide-based therapeutics are of intermediate size with much-improved selectivity towards the target and fewer off-target effects than small molecules. The OTs include Antisense RNAs, MicroRNA (MIR), small interfering RNA (siRNA), and aptamers, which are currently being explored for their use in neurodegenerative disorders, cancer, and even orphan diseases. The present review is a congregated effort to present the past and present of OTs and the current efforts to make OTs for plausible future therapeutics. The review provides updated literature on the challenges and bottlenecks of OT and recent advancements in OT drug delivery. Further, this review deliberates on a newly emerging approach to personalized treatment for patients with rare and fatal diseases with OT.

Also flagged:immuneAutism spectrum disordercytokineantigen presentationantibodies-
Journal Article 2022-10-19 ✓ 1 Snippet Erbescu A, Papuc SM, Budisteanu M, Arghir A, Neagu M.
In-Text Gene Mentions

ADA, adenosine deaminase; AKT2, AKT serine/threonine kinase 2; AKT3, AKT serine/threonine kinase 3; ApaI, abbreviation of a VDR gene polymorphism; ASD, autism spectrum disorder; BAFF, B-cell activating factor; BsmI, abbreviation of a VDR gene polymorphism; CAMK2A, calcium/calmodulin dependent protein kinase II alpha; CAMK2B, calcium/calmodulin dependent protein kinase II beta; CCR3, C-C motif chemokine receptor 3; CD, cluster of differentiation; Cj1137c, glycosyltransferase; COX, cyclooxygenases; CSF, cerebrospinal fluid; CSTB, Cystatin B; CXCR, C-X-C motif chemokine receptor; CYB, cytochrome B; DETs, differentially expressed transcripts; DNA, deoxyribonucleic acid; DNAm, DNA methylation; DRP1, dynamin 1 like; EGFR, epidermal growth factor receptor; FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; FIS1, fission, mitochondrial 1; FokI, abbreviation of a VDR gene polymorphism; FRα, folate receptor alpha; GBS, group B streptococcus; GI, gastrointestinal system; GM-CSF, granulocyte-macrophage colony-stimulating factor; GSTA1, glutathione S-transferase alpha 1; GSTM1, glutathione S-transferase mu 1; GSTP1, glutathione S-transferase pi 1; GSTs, glutathione transferases; GSTT1, glutathione S-transferase theta 1; H2O2, hydrogen peroxide; HIGD2A, HIG1 hypoxia inducible domain family member 2A; HLA, human leukocyte antigen; HLA-A, major histocompatibility complex, class I, A; HLA-DRB1, HLA class II histocompatibility antigen, DRB1 beta chain; HOCl, hypochlorous acid; HSP70i, inducible heat shock protein 70; IFN, interferon; Ig, immunoglobulins; IL, interleukin; iNOS, inducible nitric oxide synthase; JAK1, Janus kinase 1; kfiC, glycosyltransferase; LCL, lymphoblastoid cell line; lncRNA, long non-coding ribonucleic acid; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; MCP, macrophage chemoattractant protein; MFN1, mitofusin 1; MFN2, mitofusin 2; MHC, major histocompatibility complex; miRNA, micro ribonucleic acid; MPO, myeloperoxidase; MRC1, mannose receptor C-type 1; mRNA, messenger ribonucleic acid; mTOR, mammalian target of rapamycin kinase; NADH, the reduced form of nicotinamide adenine dinucleotide; NADPH, nicotinamide adenine dinucleotide phosphate; ND4L, NADH:ubiquinone oxidoreductase core subunit 4L; NDDs, neurodevelopmental disorders; NF1, neurofibromin 1; NK, natural killer; NO, nitric oxide; NOSs, NO synthases; NOX, nicotinamide adenine dinucleotide phosphate oxidase; NR4A1, nuclear receptor subfamily 4 group A member 1; OPA1, OPA1 mitochondrial dynamin like GTPase; PBMCs, peripheral blood mononuclear cells; PRKAA2, protein kinase AMP-activated catalytic subunit alpha 2; PTEN, phosphatase and tensin homolog; RNA, ribonucleic acid; RNAseq, RNA sequencing; RNS, reactive nitrogen species; ROS, reactive oxygen species; S6K1, ribosomal protein S6 kinase beta-1; SCID, severe combined human immune deficiency; SNVs, single nucleotide variants; SOD, superoxide dismutase; STAT, signal transducer and activator of transcription; TaqI, abbreviation of an VDR gene polymorphism; TCR, T cell receptor; TGF, transforming growth factor; Th, helper cells; THRIL, TNF and HNRNPL related immunoregulatory long non-coding RNA; TLR4, toll like receptor 4; TNF, tumor necrosis factor; Tnfsf13b, TNF superfamily member 13b gene; mTORC1, mechanistic target of rapamycin complex 1; TSC1, TSC complex subunit 1; TSC2, TSC complex subunit 2; UCP2, uncoupling protein 2; UQCRC1, ubiquinol-cytochrome c reductase core protein 1; VDR, vitamin D receptor; VFGM, virulence factor-related gut microbiota; wlaN, beta-1,3 galactosyltransferase; ZNF322, zinc finger protein 322.

Show Full Abstract

Autism spectrum disorder (ASD) is a neurodevelopmental condition characterized by communication and social interaction deficits, and by restricted interests and stereotyped, repetitive behavior patterns. ASD has a strong genetic component and a complex architecture characterized by the interplay of rare and common genetic variants. Recently, increasing evidence suggest a significant contribution of immune system dysregulation in ASD. The present paper reviews the latest updates regarding the altered immune landscape of this complex disorder highlighting areas with potential for biomarkers discovery as well as personalization of therapeutic approaches. Cross-talk between the central nervous system and immune system has long been envisaged and recent evidence brings insights into the pathways connecting the brain to the immune system. Disturbance of cytokine levels plays an important role in the establishment of a neuroinflammatory milieu in ASD. Several other immune molecules involved in antigen presentation and inflammatory cellular phenotypes are also at play in ASD. Maternal immune activation, the presence of brain-reactive antibodies and autoimmunity are other potential prenatal and postnatal contributors to ASD pathophysiology. The molecular players involved in oxidative-stress response and mitochondrial system function, are discussed as contributors to the pro-inflammatory pattern. The gastrointestinal inflammation pathways proposed to play a role in ASD are also discussed. Moreover, the body of evidence regarding some of the genetic factors linked to the immune system dysregulation is reviewed and discussed. Last, but not least, the epigenetic traits and their interactions with the immune system are reviewed as an expanding field in ASD research. Understanding the immune-mediated pathways that influence brain development and function, metabolism, and intestinal homeostasis, may lead to the identification of robust diagnostic or predictive biomarkers for ASD individuals. Thus, novel therapeutic approaches could be developed, ultimately aiming to improve their quality of life.

Also flagged:Mitochondriaorganellesdeathmitochondrialautophagysynthesis
Journal Article 2022-10-19 No Snippets Green A, Hossain T, Eckmann DM.
Show Full Abstract

Mitochondria are cell organelles that play pivotal roles in maintaining cell survival, cellular metabolic homeostasis, and cell death. Mitochondria are highly dynamic entities which undergo fusion and fission, and have been shown to be very motile <i>in vivo</i> in neurons and <i>in vitro</i> in multiple cell lines. Fusion and fission are essential for maintaining mitochondrial homeostasis through control of morphology, content exchange, inheritance of mitochondria, maintenance of mitochondrial DNA, and removal of damaged mitochondria by autophagy. Mitochondrial motility occurs through mechanical and molecular mechanisms which translocate mitochondria to sites of high energy demand. Motility also plays an important role in intracellular signaling. Here, we review key features that mediate mitochondrial dynamics and explore methods to advance the study of mitochondrial motility as well as mitochondrial dynamics-related diseases and mitochondrial-targeted therapeutics.

Also flagged:CENPACentromere protein AmitosisgliomaGene Expressionpolymerase
Journal Article 2022-10-19 ✓ 1 Snippet Wang B, Wei W, Long S, Wang L, Yang B, Wu D, Li Z, Li Z, Arshad M, Li X, Chen J.
In-Text Gene Mentions

…TNFRSF9, TNFSF14, andTNFSF4in the data…

Show Full Abstract

<h4>Background</h4>Glioma is the most common primary tumor of the central nervous system (CNS). Centromere protein A (CENPA) plays an essential role in ensuring that mitosis proceeds normally. The effect of CENPA on glioma is rarely reported. However, the current study aims to explore whether aberrant CENPA expression promotes glioma progression and the potential mechanisms involved.<h4>Methods</h4>The GEPIA website, The Cancer Genome Atlas, and the Gene Expression Omnibus (GEO) were used to assess the expression of CENPA in glioma. The results were validated by real-time quantitative polymerase chain reaction and immunohistochemical staining of clinical samples. The relationship between the expression and prognostic value of the CENPA gene in glioma was investigated by Kaplan-Meier (KM) survival analysis with RNA-seq and clinical profiles downloaded from the Chinese Glioma Genome Atlas (CGGA) and UCSC Xena. The association between CENPA and clinical characteristics was also evaluated. Cell Counting Kit-8 (CCK8) assay, wound healing assay using two glioma cell lines, gene set enrichment analysis (GSEA), KEGG and gene ontology (GO) enrichment analysis, immune infiltration analysis, temozolomide (TMZ) sensitivity analysis, and single-cell sequence analysis were performed to explore the underlying mechanisms of high CENPA expression and its effect on glioma development. Finally, we performed a Cox analysis based on the expression of CENPA to predict patient prognosis.<h4>Results</h4>CENPA was significantly upregulated in glioma tissue samples and correlated with patient prognosis. Moreover, the downregulation of CENPA inhibited the migration and proliferation of glioma cells. In addition, the expression level of CENPA was significantly correlated with the grade, primary-recurrent-secondary (PRS) type, IDH mutation status, and 1p19q codeletion status. Furthermore, CENPA could serve as an independent prognostic factor for glioma that mainly interferes with the normal progression of mitosis and regulates the tumor immune microenvironment favoring glioma development.<h4>Conclusion</h4>CENPA may act as a prognostic factor in patients with glioma and provide a novel target for the treatment of gliomas.

Also flagged:NLRP3Infectioncaspase-1secretiondeathT. gondii infection
Journal Article 2022-10-19 ✓ 2 Snippets Yoon C, Ham YS, Gil WJ, Yang CS.
In-Text Gene Mentions

Further, the colorectal cancer pathway involved genes which are DCC, Smad2, Smad4, hMLH1, hMSH2, and hMSH3 protein expression were regulated after T. gondii infection.

The DCC protein expression was elevated after T. gondii infection.

Show Full Abstract

Infection with the protozoan parasite <i>Toxoplasma gondii</i> (<i>T. gondii</i>) results in the activation of nucleotide-binding domain leucine-rich repeat containing receptors (NLRs), which in turn leads to inflammasome assembly and the subsequent activation of caspase-1, secretion of proinflammatory cytokines, and pyroptotic cell death. Several recent studies have addressed the role of the NLRP3 inflammasome in <i>T. gondii</i> infection without reaching a consensus on its roles. Moreover, the mechanisms of NLRP3 inflammasome activation in different cell types remain unknown. Here we review current research on the activation and specific role of the NLRP3 inflammasome in <i>T. gondii</i> infection.

Also flagged:Calpainproteolysisposttranslational modificationscalciumproteasespolyglutamine disorders
Journal Article 2022-10-19 ✓ 2 Snippets Incebacak Eltemur RD, Nguyen HP, Weber JJ.
In-Text Gene Mentions

Early reports indicated that cleavage by caspases, especially caspase-6, was a relevant molecular modifier of HD pathogenesis, and inhibiting HTT caspase-dependent cleavage ameliorated multiple disease hallmarks in cell and animal models (Wellington et al., 1998, 2000, 2002; Graham et al., 2006).

…BothHTTand Atx3 undergo…

Show Full Abstract

Among posttranslational modifications, directed proteolytic processes have the strongest impact on protein integrity. They are executed by a variety of cellular machineries and lead to a wide range of molecular consequences. Compared to other forms of proteolytic enzymes, the class of calcium-activated calpains is considered as modulator proteases due to their limited proteolytic activity, which changes the structure and function of their target substrates. In the context of neurodegeneration and - in particular - polyglutamine disorders, proteolytic events have been linked to modulatory effects on the molecular pathogenesis by generating harmful breakdown products of disease proteins. These findings led to the formulation of the <i>toxic fragment hypothesis</i>, and calpains appeared to be one of the key players and auspicious therapeutic targets in Huntington disease and Machado Joseph disease. This review provides a current survey of the role of calpains in proteolytic processes found in polyglutamine disorders. Together with insights into general concepts behind <i>toxic fragments</i> and findings in polyglutamine disorders, this work aims to inspire researchers to broaden and deepen the knowledge in this field, which will help to evaluate calpain-mediated proteolysis as a unifying and therapeutically targetable posttranslational mechanism in neurodegeneration.

Also flagged:α-glucosidaseacylhydrazoneα-amylasebindingdiabetes mellitus
Journal Article 2022-10-19 No Snippets Wu Y, Liu C, Hu L.
Show Full Abstract

Efforts to combine advantages of fragment-based drug design (FBDD) and dynamic combinatorial chemistry (DCC) for the development of selective α-glucosidase inhibitors were described. Starting from 5 rationally designed fragments, two iterative dynamic combinatorial libraries (DCLs) comprising 29 acylhydrazone products were generated and screened using α-glucosidase and α-amylase as the templates. The optimal ligand identified showed substantial α-glucosidase inhibition with high selectivity over α-amylase as well as low cytotoxicity. Furthermore, inhibition type and detailed ligand/enzyme binding interactions were elucidated by the binding kinetic study and docking simulation, respectively.

Also flagged:hepatic fibrosischronic liver diseasesliver cirrhosiscirrhosisliver fibrosischronic liver disease
Journal Article 2022-10-19 ✓ 1 Snippet Malik P, Pillai S, Agarwal K, Abdelwahed S, Bhandari R, Singh A, Chidharla A, Patel K, Singh P, Manaktala P, Rabbani R, Koritala T, Gupta S.
In-Text Gene Mentions

…in patients withhemochromatosisfor use of…

Show Full Abstract

<h4>Background</h4>Ultrasound-based transient elastography (TE) is a non-invasive alternative to liver biopsy for the staging of hepatic fibrosis due to various chronic liver diseases. This meta-analysis aims to assess the diagnostic accuracy of TE for detecting liver cirrhosis (F4) and severe fibrosis (F3) in patients with chronic liver diseases, in comparison to the gold standard liver biopsy.<h4>Methods</h4>A systematic search was performed using PubMed search engine following Preferred Reporting Items for Systematic reviews and Meta-Analysis (PRISMA) guidelines from inception to May 2021. The meta-analysis studies evaluating the diagnostic accuracy of TE for severe fibrosis and cirrhosis were identified. We conducted a meta-meta-analysis to generate pooled estimates of the sensitivity, specificity, and diagnostic odds ratios (ORs) for F3 and F4 fibrosis stage.<h4>Results</h4>We included five studies with a total of 124 sub-studies and 20,341 patients in our analysis. Three studies have reported the diagnostic accuracy of TE in detecting F3/severe fibrosis stage and found 81.9% pooled sensitivity (95% confidence interval (CI): 79.9-83.7%; P < 0.001) (I<sup>2</sup> = 0%), 84.7% pooled specificity (95% CI: 81.3-87.6%) (I<sup>2</sup> = 81%; P = 0.02). All five studies reported the diagnostic accuracy of TE in detecting F4/liver cirrhosis stage. We found 84.8% pooled sensitivity (95% CI: 81.4-87.7%) (I<sup>2</sup> = 86.4%; P < 0.001), 87.5% pooled specificity (95% CI: 85.4-89.3%) (I<sup>2</sup> = 90%; P < 0.001) and pooled diagnostic OR (41.8; 95% CI: 3.9 - 56.5) (I<sup>2</sup> = 87%; P < 0.001).<h4>Conclusions</h4>Ultrasound-based TE has excellent diagnostic accuracy for identifying cirrhosis and liver fibrosis stages 3. Future studies should focus on estimating the diagnostic accuracy of other fibrosis stages in chronic liver disease patients. This will eventually decrease the risk associated with invasive liver biopsy.

Also flagged:chromosomal regionsreproductioninfertilitymiscarriagegestationchromosomes
Journal Article 2022-10-19 ✓ 1 Snippet Yıldız O, Sılan F, Karakaya T, Özdemir Ö.
In-Text Gene Mentions

…, LINC01566 ,NEGR1, FRG2DP ,…

Show Full Abstract

<h4>Background</h4>It is not always possible to determine the causative basis of pregnancy losses and even today it has been reported that 50% of cases with recurrent pregnancy loss (RPL) have no reason to be detected. In our study, it is aimed to reveal the copy number variations (CNVs) of the genes which presumably have a potential effect in individuals with RPL and contribute to subsequent functional studies in the follow-up.<h4>Methods</h4>We retrospectively evaluated the array-comparative genomic hybridization (aCGH) data of cytogenetically 64 normal individuals (21 couples, 11 unrelated women, and 11 unrelated men) who had applied to our outpatient clinic from January 2016 to December 2017, for the history of idiopathic two or more RPL.<h4>Results</h4>A total of 83 CNVs were detected in 56 different chromosomal regions [36% (20/56) is deletion and 64% (36/56) is duplication] in 40/64 (62.5%) of the cases. Two detected deleterious CNVs encompassing 1p36.22-p36.21 and 10q11.22 chromosomal locus have been reported as pathogenic according to the Database of Genomic Variants (DGV).<h4>Discussion</h4>CNVs that may play a role in the genetic etiology of idiopathic RPL were revealed in our study and potential chromosomal loci were introduced to the literature for further analysis. The detection of CNVs and their association with reproduction such as RPL, infertility, and even other diseases will allow us to have more information about the clinical consequences and will make it possible to provide more accurate and comprehensive genetic counseling.

Also flagged:amino acidorganizationamino acidscarbonGlycinedisulfides
Journal Article 2022-10-19 No Snippets Petrizzelli F, Biagini T, Bianco SD, Liorni N, Napoli A, Castellana S, Mazza T.
Show Full Abstract

Protein Structure Networks (PSNs) are a well-known mathematical model for estimation and analysis of the three-dimensional protein structure. Investigating the topological architecture of PSNs may help identify the crucial amino acid residues for protein stability and protein-protein interactions, as well as deduce any possible mutational effects. But because proteins go through conformational changes to give rise to essential biological functions, this has to be done dynamically over time. The most effective method to describe protein dynamics is molecular dynamics simulation, with the most popular software programs for manipulating simulations to infer interaction networks being RING, MD-TASK, and NAPS. Here, we compare the computational approaches used by these three tools-all of which are accessible as web servers-to understand the pathogenicity of missense mutations and talk about their potential applications as well as their advantages and disadvantages.

Research Square 2022-10-19 Preprint (No Snippets API) Strawbridge R, Forsyth L, Cullen B, Graham N, Lyall D, Lyall L, Pell J, Ward J, Smith D.
Show Full Abstract

<title>Abstract</title> <p>People with severe mental illness have a higher risk of cardiometabolic disease than the general population. Traditionally attributed to sociodemographic and behavioural factors and medication effects, recent genetic studies have provided evidence of shared biological mechanisms underlying mental illness and cardiometabolic disease. This study aimed to determine whether signals in the <italic>DCC</italic> locus, implicated in cardiometabolic and psychiatric conditions, were shared with, or distinct. Using the UK Biobank cohort, we systematically assessed the impact of genetic variation in the <italic>DCC</italic> (deleted in colorectal carcinoma) locus on traits related to cardiometabolic and psychiatric conditions in unrelated “white British” participants (N = 402837). Logistic or linear regression were applied assuming an additive genetic model and adjusting for age, sex, genotyping chip and population structure (eight genetic principal components). Bonferroni correction for the number of independent SNPs within the locus was applied. Conditional analyses (including lead variants as covariates) and trans-ancestry analyses were used to investigate linkage disequilibrium between signals. Significant associations were observed between <italic>DCC</italic> variants and smoking, anhedonia, body mass index (BMI), neuroticism and mood instability, with multiple conditionally-independent signals being identified for the latter three traits. Conditional analyses and linkage disequilibrium structure suggested signals for smoking and BMI were distinct from each other and the mood traits, whilst individual mood traits were inter-related in a complex manner. Genetic variation in the <italic>DCC</italic> locus had distinct effects on BMI, smoking and mood traits, and therefore is unlikely to contribute to shared mechanisms underpinning mental and cardiometabolic traits.</p>

Also flagged:extracellularglucosediabetic nephropathyDNSRY-box transcription factor 6SOD
Journal Article 2022-10-18 ✓ 5 Snippets Shu S, Xu Z, Lu H, Li Z, Zhang Y.
In-Text Gene Mentions

In addition, miR-137 expression was negatively correlated with circHOMER1 and SOX6 expression in DN patients.<h4>Conclusion</h4>CircHOMER1 promoted HG-induced HMCs oxidative stress, inflammation and ECM accumulation via the miR-137/SOX6 axis, suggesting that circHOMER1 might be a target for DN treatment.

…transcription factor 6 (SOX6) expression.…

…deposition-related markers andSOX6were assessed by…

…and circHOMER1 orSOX6was analysed by…

…miR-137 to regulateSOX6.…

Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) play an important regulatory role in human diseases, including diabetic nephropathy (DN). The purpose of this study was to investigate the role and mechanism of circHOMER1 action in DN.<h4>Methods</h4>Human mesangial cells (HMCs) were tested with high glucose (HG) to mimic DN cell models. Quantitative real-time PCR was performed to determine circHOMER1, microRNA (miR)-137 and SRY-box transcription factor 6 (SOX6) expression. SOD activity and MDA level were detected to evaluate cell oxidative stress. ELISA assay was used to analyse the levels of inflammation factors. The protein levels of extracellular matrix (ECM) deposition-related markers and SOX6 were assessed by western blot analysis. The interaction between miR-137 and circHOMER1 or SOX6 was analysed by dual-luciferase reporter assay and RNA pull-down assay.<h4>Results</h4>CircHOMER1 was highly expressed in HG-induced HMCs and DN patients. Downregulation of circHOMER1 suppressed oxidative stress, inflammation and ECM deposition in HMCs induced by HG. In terms of mechanism, circHOMER1 could sponge miR-137 to regulate SOX6. Function assays showed that miR-137 inhibitor or SOX6 overexpression revoked the negative regulation of circHOMER1 knockdown on HG-induced HMCs injury. In addition, miR-137 expression was negatively correlated with circHOMER1 and SOX6 expression in DN patients.<h4>Conclusion</h4>CircHOMER1 promoted HG-induced HMCs oxidative stress, inflammation and ECM accumulation via the miR-137/SOX6 axis, suggesting that circHOMER1 might be a target for DN treatment.

Also flagged:hematopoiesisinfectionviral infectionspattern recognition receptorsToll‐like receptorsTLRs
Journal Article 2022-10-18 No Snippets Sezaki M, Hayashi Y, Nakato G, Wang Y, Nakata S, Biswas S, Morishima T, Fakruddin M, Moon J, Ahn S, Kim P, Miyamoto Y, Baba H, Fukuda S, Takizawa H.
Show Full Abstract

Bone marrow (BM)-resident hematopoietic stem and progenitor cells (HSPCs) are often activated following bacterial insults to replenish the host hemato-immune system, but how they integrate the associated tissue damage signals to initiate distal tissue repair is largely unknown. Here, we show that acute gut inflammation expands HSPCs in the BM and directs them to inflamed mesenteric lymph nodes through GM-CSFR activation for further expansion and potential differentiation into Ly6C<sup>+</sup> /G<sup>+</sup> myeloid cells specialized in gut tissue repair. We identified this process to be mediated by Bacteroides, a commensal gram-negative bacteria that activates innate immune signaling. These findings establish cross-organ communication between the BM and distant inflamed sites, whereby a certain subset of multipotent progenitors is specified to respond to imminent hematopoietic demands and to alleviate inflammatory symptoms.

Also flagged:Acute Lymphoblastic LeukemiaALLminimal residual diseaseKMT2AresidualMLL
Journal Article 2022-10-18 ✓ 1 Snippet Attarbaschi A, Möricke A, Harrison CJ, Mann G, Baruchel A, De Moerloose B, Conter V, Devidas M, Elitzur S, Escherich G, Hunger SP, Horibe K, Manabe A, Loh ML, Pieters R, Schmiegelow K, Silverman LB, Stary J, Vora A, Pui CH, Schrappe M, Zimmermann M, Ponte-di-Legno Childhood Acute Lymphoblastic Leukemia Working Group.
In-Text Gene Mentions

MLLT10

Show Full Abstract

<h4>Purpose</h4>We aimed to study prognostic factors and efficacy of allogeneic hematopoietic stem-cell transplantation (allo-HSCT) in first remission of patients with noninfant childhood acute lymphoblastic leukemia (ALL) with 11q23/<i>KMT2A</i> rearrangements treated with chemotherapy regimens between 1995 and 2010.<h4>Patients and methods</h4>Data were retrospectively retrieved from 629 patients with 11q23/<i>KMT2A</i>-rearranged ALL from 17 members of the Ponte-di-Legno Childhood ALL Working Group. Clinical and biologic characteristics, early response assessed by minimal residual disease at the end of induction (EOI) therapy, and allo-HSCT were analyzed for their impact on outcomes.<h4>Results</h4>A specific 11q23/<i>KMT2A</i> translocation partner gene was identified in 84.3% of patients, with the most frequent translocations being t(4;11)(q21;q23) (n = 273; 51.5%), t(11;19)(q23;p13.3) (n = 106; 20.0%), t(9;11)(p21_22;q23) (n = 76; 14.3%), t(6;11)(q27;q23) (n = 20; 3.8%), and t(10;11)(p12;q23) (n = 14; 2.6%); 41 patients (7.7%) had less frequently identified translocation partner genes. Patient characteristics and early response varied among subgroups, indicating large biologic heterogeneity and diversity in therapy sensitivity among 11q23/<i>KMT2A</i>-rearranged ALL. The EOI remission rate was 93.2%, and the 5-year event-free survival (EFS) for the entire cohort was 69.1% ± 1.9%, with a range from 41.7% ± 17.3% for patients with t(9;11)-positive T-ALL (n = 9) and 64.8% ± 3.0% for patients with t(4;11)-positive B-ALL (n = 266) to 91.2% ± 4.9% for patients with t(11;19)-positive T-ALL (n = 34). Low EOI minimal residual disease was associated with favorable EFS, and induction failure was particularly predictive of nonresponse to further therapy and relapse and poor EFS. In addition, EFS was not improved by allo-HSCT compared with chemotherapy only in patients with both t(4;11)-positive B-ALL (n = 64 <i>v</i> 51; <i>P</i> = .10) and 11q23/<i>KMT2A</i>-rearranged T-ALL (n = 16 <i>v</i> 10; <i>P</i> = .69).<h4>Conclusion</h4>Compared with historical data, prognosis of patients with noninfant 11q23/<i>KMT2A</i>-rearranged ALL has improved, but allo-HSCT failed to affect outcome. Targeted therapies are needed to reduce relapse and treatment-related mortality rates.

Also flagged:GliosisInterferonAgingTraumatic brain injurycognitionCognitive impairment
Journal Article 2022-10-18 ✓ 1 Snippet Wangler LM, Bray CE, Packer JM, Tapp ZM, Davis AC, O'Neil SM, Baetz K, Ouviña M, Witzel M, Godbout JP.
In-Text Gene Mentions

MMS22L

Show Full Abstract

Traumatic brain injury (TBI) is associated with chronic psychiatric complications and increased risk for development of neurodegenerative pathology. Aged individuals account for most TBI-related hospitalizations and deaths. Nonetheless, neurobiological mechanisms that underlie worsened functional outcomes after TBI in the elderly remain unclear. Therefore, this study aimed to identify pathways that govern differential responses to TBI with age. Here, adult (2 months of age) and aged (16-18 months of age) male C57BL/6 mice were subjected to diffuse brain injury (midline fluid percussion), and cognition, gliosis, and neuroinflammation were determined 7 or 30 d postinjury (dpi). Cognitive impairment was evident 7 dpi, independent of age. There was enhanced morphologic restructuring of microglia and astrocytes 7 dpi in the cortex and hippocampus of aged mice compared with adults. Transcriptional analysis revealed robust age-dependent amplification of cytokine/chemokine, complement, innate immune, and interferon-associated inflammatory gene expression in the cortex 7 dpi. Ingenuity pathway analysis of the transcriptional data showed that type I interferon (IFN) signaling was significantly enhanced in the aged brain after TBI compared with adults. Age prolonged inflammatory signaling and microgliosis 30 dpi with an increased presence of rod microglia. Based on these results, a STING (stimulator of interferon genes) agonist, DMXAA, was used to determine whether augmenting IFN signaling worsened cortical inflammation and gliosis after TBI. DMXAA-treated Adult-TBI mice showed comparable expression of myriad genes that were overexpressed in the cortex of Aged-TBI mice, including <i>Irf7</i>, <i>Clec7a</i>, <i>Cxcl10</i>, and <i>Ccl5</i> Overall, diffuse TBI promoted amplified IFN signaling in aged mice, resulting in extended inflammation and gliosis.<b>SIGNIFICANCE STATEMENT</b> Elderly individuals are at higher risk of complications following traumatic brain injury (TBI). Individuals >70 years old have the highest rates of TBI-related hospitalization, neurodegenerative pathology, and death. Although inflammation has been linked with poor outcomes in aging, the specific biological pathways driving worsened outcomes after TBI in aging remain undefined. In this study, we identify amplified interferon-associated inflammation and gliosis in aged mice following TBI that was associated with persistent inflammatory gene expression and microglial morphologic diversity 30 dpi. STING (stimulator of interferon genes) agonist DMXAA was used to demonstrate a causal link between augmented interferon signaling and worsened neuroinflammation after TBI. Therefore, interferon signaling may represent a therapeutic target to reduce inflammation-associated complications following TBI.

Also flagged:PEP carboxykinasecancersphosphorylationHIF-1transcription factorresponse to
Journal Article 2022-10-18 No Snippets Vora M, Pyonteck SM, Popovitchenko T, Matlack TL, Prashar A, Kane NS, Favate J, Shah P, Rongo C.
Show Full Abstract

Actively dividing cells, including some cancers, rely on aerobic glycolysis rather than oxidative phosphorylation to generate energy, a phenomenon termed the Warburg effect. Constitutive activation of the Hypoxia Inducible Factor (HIF-1), a transcription factor known for mediating an adaptive response to oxygen deprivation (hypoxia), is a hallmark of the Warburg effect. HIF-1 is thought to promote glycolysis and suppress oxidative phosphorylation. Here, we instead show that HIF-1 can promote gluconeogenesis. Using a multiomics approach, we reveal the genomic, transcriptomic, and metabolomic landscapes regulated by constitutively active HIF-1 in C. elegans. We use RNA-seq and ChIP-seq under aerobic conditions to analyze mutants lacking EGL-9, a key negative regulator of HIF-1. We integrate these approaches to identify over two hundred genes directly and functionally upregulated by HIF-1, including the PEP carboxykinase PCK-1, a rate-limiting mediator of gluconeogenesis. This activation of PCK-1 by HIF-1 promotes survival in response to both oxidative and hypoxic stress. Our work identifies functional direct targets of HIF-1 in vivo, comprehensively describing the metabolome induced by HIF-1 activation in an organism.

Also flagged:tumorcervical cancercervical intraepithelial neoplasiaCINCCmetabolism
Journal Article 2022-10-18 No Snippets Vikramdeo KS, Anand S, Pierce JY, Singh AP, Singh S, Dasgupta S.
Show Full Abstract

<h4>Backgrounds</h4>Microbiome dysbiosis is an important contributing factor in tumor development and thus may be a risk predictor for human malignancies. In the United States, women with Hispanic/Latina (HIS) and African American (AA) background have a higher incidence of cervical cancer and poorer outcomes than Caucasian American (CA) women.<h4>Methods</h4>Here, we assessed the distribution pattern of microbiota in cervical intraepithelial neoplasia (CIN) lesions obtained from HIS (n = 12), AA (n = 12), and CA (n = 12) women, who were screened for CC risk assessment. We employed a 16S rRNA gene sequencing approach adapted from the NIH-Human Microbiome Project to identify the microbial niche in all CIN lesions (n = 36).<h4>Results</h4>We detected an appreciably decreased abundance of beneficial Lactobacillus in the CIN lesions of the AA and HIS women compared to the CA women. Differential abundance of potentially pathogenic Prevotella, Delftia, Gardnerella, and Fastidiosipila was also evident among the various racial groups. An increased abundance of Micrococcus was also evident in AA and HIS women compared to the CA women. The detection level of Rhizobium was higher among the AA ad CA women compared to the HIS women. In addition to the top 10 microbes, a unique niche of 27 microbes was identified exclusively in women with a histopathological diagnosis of CIN. Among these microbes, a group of 8 microbiota; Rubellimicrobium, Podobacter, Brevibacterium, Paracoccus, Atopobium, Brevundimonous, Comamonous, and Novospingobium was detected only in the CIN lesions obtained from AA and CA women.<h4>Conclusions</h4>Microbial dysbiosis in the cervical epithelium represented by an increased ratio of potentially pathogenic to beneficial microbes may be associated with increased CC risk disparities. Developing a race-specific reliable panel of microbial markers could be beneficial for CC risk assessment, disease prevention, and/or therapeutic guidance.

Also flagged:neurogenesisparaformaldehydeNestinpositronsucroseepilepsy
Journal Article 2022-10-18 No Snippets Terreros-Roncal J, Flor-García M, Moreno-Jiménez EP, Rodríguez-Moreno CB, Márquez-Valadez B, Gallardo-Caballero M, Rábano A, Llorens-Martín M.
Show Full Abstract

The hippocampus hosts the continuous addition of new neurons throughout life-a phenomenon named adult hippocampal neurogenesis (AHN). Here we revisit the occurrence of AHN in more than 110 mammalian species, including humans, and discuss the further validation of these data by single-cell RNAseq and other alternative techniques. In this regard, our recent studies have addressed the long-standing controversy in the field, namely whether cells positive for AHN markers are present in the adult human dentate gyrus (DG). Here we review how we developed a tightly controlled methodology, based on the use of high-quality brain samples (characterized by short postmortem delays and ≤24 h of fixation in freshly prepared 4% paraformaldehyde), to address human AHN. We review that the detection of AHN markers in samples fixed for 24 h required mild antigen retrieval and chemical elimination of autofluorescence. However, these steps were not necessary for samples subjected to shorter fixation periods. Moreover, the detection of labile epitopes (such as Nestin) in the human hippocampus required the use of mild detergents. The application of this strictly controlled methodology allowed reconstruction of the entire AHN process, thus revealing the presence of neural stem cells, proliferative progenitors, neuroblasts, and immature neurons at distinct stages of differentiation in the human DG. The data reviewed here demonstrate that methodology is of utmost importance when studying AHN by means of distinct techniques across the phylogenetic scale. In this regard, we summarize the major findings made by our group that emphasize that overlooking fundamental technical principles might have consequences for any given research field.

Also flagged:hyperferritinemiapruritusironalcohol use disordercorticosteroidsprednisone
Journal Article 2022-10-18 ✓ 5 Snippets Osman S, Haber RM.
In-Text Gene Mentions

…for hyperferritinemia andhemochromatosis.…

…a diagnosis ofhemochromatosisor (b) a…

…genetic mutation forhemochromatosis.…

…the symptomatology ofhemochromatosisdid not discuss…

…had a singleHFEmutation, which has…

Show Full Abstract

Generalized pruritus can be the manifestation of many dermatologic and systemic diseases. However, it has been reported infrequently in the literature as a consequence of hyperferritinemia. We report the case of a 70-year-old male presenting to dermatology due to generalized pruritus in the absence of a rash, who was subsequently found to have a significantly elevated serum ferritin and transferrin saturation with otherwise normal iron studies. Hereditary hemochromatosis was ruled out on genetic testing; however, etiologies of secondary iron overload including alcohol use disorder and non-alcoholic fatty liver disease were present. The patient had minimal relief of his pruritus with topical corticosteroids, oral prednisone, and moisturizers. The only successful treatment was phlebotomy which resulted in complete resolution of his long-standing pruritus. We present the fifth case of generalized pruritus associated with hyperferritinemia, treated successfully with phlebotomy.

Also flagged:Tatgene expressionB-cell lymphomasTat proteinB-cell lymphomagenesisTatC22G
Journal Article 2022-10-18 ✓ 1 Snippet Valyaeva AA, Tikhomirova MA, Potashnikova DM, Bogomazova AN, Snigiryova GP, Penin AA, Logacheva MD, Arifulin EA, Shmakova AA, Germini D, Kachalova AI, Saidova AA, Zharikova AA, Musinova YR, Mironov AA, Vassetzky YS, Sheval EV, Sheval EV.
In-Text Gene Mentions

…, SOX5 ,SOX6, SSX1 ,…

Show Full Abstract

An increased frequency of B-cell lymphomas is observed in human immunodeficiency virus-1 (HIV-1)-infected patients, although HIV-1 does not infect B cells. Development of B-cell lymphomas may be potentially due to the action of the HIV-1 Tat protein, which is actively released from HIV-1-infected cells, on uninfected B cells. The exact mechanism of Tat-induced B-cell lymphomagenesis has not yet been precisely identified. Here, we ectopically expressed either Tat or its TatC22G mutant devoid of transactivation activity in the RPMI 8866 lymphoblastoid B cell line and performed a genome-wide analysis of host gene expression. Stable expression of both Tat and TatC22G led to substantial modifications of the host transcriptome, including pronounced changes in antiviral response and cell cycle pathways. We did not find any strong action of Tat on cell proliferation, but during prolonged culturing, Tat-expressing cells were displaced by non-expressing cells, indicating that Tat expression slightly inhibited cell growth. We also found an increased frequency of chromosome aberrations in cells expressing Tat. Thus, Tat can modify gene expression in cultured B cells, leading to subtle modifications in cellular growth and chromosome instability, which could promote lymphomagenesis over time.

Also flagged:COPDcorticosteroidsChronic obstructive pulmonary diseasecorticosteroidbacterial infectionH. influenzae infection
Journal Article 2022-10-18 No Snippets Beech A, Jackson N, Singh D.
Show Full Abstract

Higher blood and sputum eosinophil counts are associated with a greater response to corticosteroids in COPD. Low blood eosinophil counts exhibit greater stability over time whereas higher counts demonstrate more variability. Stability of airway eosinophil levels is less well understood. We have studied the stability of sputum eosinophil counts. Differential cell count data for COPD patients (n = 100) were analysed. Subjects with two sputum eosinophil counts, 6 months apart, were included in the analysis. Patients were stratified based on baseline sputum eosinophil count into ‘low’, ‘intermediate’ and ‘high’ groups: eosinophilLOW (<1%), eosinophilINT (1−3%) and eosinophilHIGH (≥3%). Sputum eosinophil counts showed good stability (rho = 0.61, p < 0.0001, ICC of 0.77), with 67.4% of eosinophilLOW patients remaining in the same category on repeat sampling. Bland−Altman analysis of the whole cohort (median difference between measurements = 0.00%, 90th percentile = −1.4 and 4.7%) showed greater variation at higher counts. This was confirmed by the wider 90th centiles in the eosinophilINT (−1.50 to 5.65) and eosinophilHIGH groups (−5.33 to 9.80) compared to the eosinophilLOW group (−0.40 to 1.40). The repeatability of sputum eosinophil counts was related to the baseline eosinophil count; sputum eosinophilLOW COPD patients were relatively stable over time, while the eosinophilHIGH group showed greater variability. These results can facilitate the identification of COPD endotypes with differential responses to treatment.

Also flagged:oxygenagingp38 mitogen-activated protein kinaseresponse to oxidative stressdetoxificationmitogen-activated protein kinase kinase kinase
Journal Article 2022-10-18 ✓ 1 Snippet Hwang M, Shrestha C, Kang S, Kim J.
In-Text Gene Mentions

…TAOK1, TAOK2, andTAOK3) , and mekk-3…

Show Full Abstract

Oxidative stress resulting from reactive oxygen species and other toxic metabolites is involved in human diseases, and it plays an important role in aging. In <i>Caenorhabditis elegans</i>, SKN-1 is required for protection against oxidative stress and aging. As p38 mitogen-activated protein kinase signaling is activated in response to oxidative stress, SKN-1 accumulates in intestinal nuclei and induces phase II detoxification genes. However, NSY-1, a well-known mitogen-activated protein kinase kinase kinase (MAPKKK) of <i>C. elegans</i>, acts as a partial regulator of the SKN-1-induced oxidative stress signaling pathway, suggesting that the regulator for optimal activation of SKN-1 remains unknown. Here, we report a MAPKKK, MEKK-3, as a new regulator required for full activation of SKN-1-mediated resistance against oxidative stress and aging. In RNA-interference-based screening, we found that the simultaneous knockdown of <i>mekk-3</i> and <i>nsy-1</i> significantly decreased the oxidative stress resistance and survival of SKN-1 transgenic worms. MEKK-3 was induced in response to oxidative stress. Mechanistic analysis revealed that double knockdown of <i>mekk-3</i> and <i>nsy-1</i> completely suppressed the nuclear localization of SKN-1. These results were reproduced in mutant worms in which SKN-1 is constitutively localized to intestinal nuclei. In addition, <i>mekk-3</i> and <i>nsy-1</i> were required for optimal induction of SKN-1 target genes such as <i>gcs-1</i> and <i>trx-1</i>. These data indicate that MEKK-3 plays an essential role in the SKN-1-dependent signaling pathway involved in oxidative stress resistance and longevity by cooperating with NSY-1.

Also flagged:CannabinoidsendocannabinoidsoxygenCB1CB2cannabinoid receptors
Journal Article 2022-10-18 No Snippets Tadijan A, Vlašić I, Vlainić J, Đikić D, Oršolić N, Jazvinšćak Jembrek M.
Show Full Abstract

In the last few decades, endocannabinoids, plant-derived cannabinoids and synthetic cannabinoids have received growing interest as treatment options in neurodegenerative conditions. In various experimental settings, they have displayed antioxidative, anti-inflammatory, antiapoptotic, immunomodulatory, and neuroprotective effects. However, due to numerous targets and downstream effectors of their action, the cellular and molecular mechanisms underlying these effects are rather complex and still under discussion. Cannabinoids are able to neutralize free radicals and modulate the production of reactive oxygen species and the activity of antioxidative systems acting on CB1 and CB2 cannabinoid receptors. The activation of CB1 receptors stimulates signaling pathways involved in antioxidative defense and survival (such as the phosphoinositide 3-kinase (PI3K)/Akt, mitogen-activated protein kinase (MAPK), and Nrf2 pathways) and regulates glutamatergic signaling, the activation of N-methyl-D-aspartate (NMDA) receptors, calcium influx, and the induction of Ca<sup>2+</sup>-regulated signaling cascades, whereas the neuroprotective effects mediated by CB2 receptors are due to the suppression of microglial activation and the release of prooxidative and proinflammatory mediators. This review summarizes the main molecular mechanisms and new advances in understanding the antioxidative and neuroprotective effects of cannabinoids. Because of the plethora of possible pharmacological interventions related to oxidative stress and cannabinoid-mediated neuroprotection, future research should be directed towards a better understanding of the interplay between activated signal transduction pathways and molecular targets with the aim to improve treatment options and efficacy by targeting the endocannabinoid system.

Also flagged:bone formationagingcatabolismdegradationcell divisionosteogenesis
Journal Article 2022-10-18 No Snippets Levi G, Narboux-Nême N, Cohen-Solal M.
Show Full Abstract

Skeletal shape and mechanical properties define, to a large extent, vertebrate morphology and physical capacities. During development, skeletal morphogenesis results from dynamic communications between chondrocytes, osteoblasts, osteoclasts, and other cellular components of the skeleton. Later in life, skeletal integrity depends on the regulatory cascades that assure the equilibrium between bone formation and resorption. Finally, during aging, skeletal catabolism prevails over anabolism resulting in progressive skeletal degradation. These cellular processes depend on the transcriptional cascades that control cell division and differentiation in each cell type. Most <i>Distal-less</i> (<i>Dlx</i>) homeobox transcription factors are directly involved in determining the proliferation and differentiation of chondrocytes and osteoblasts and, indirectly, of osteoclasts. While the involvement of <i>Dlx</i> genes in the regulation of skeletal formation has been well-analyzed thanks to several mutant mouse models, the role of these genes in the maintenance of bone integrity has been only partially studied. The importance of <i>Dlx</i> genes for adult bone tissues is evidenced by their central role in the regulatory pathways involving <i>Osx/Sp</i>7 and <i>Runx2</i>, the two major master genes of osteogenesis. <i>Dlx</i> genes appear to be involved in several bone pathologies including, for example, osteoporosis. Indeed, at least five large-scale GWAS studies which aimed to detect loci associated with human bone mineral density (BMD) have identified a known <i>DLX5/6</i> regulatory region within chromosome 7q21.3 in proximity of SEM1/FLJ42280/DSS1 coding sequences, suggesting that <i>DLX5/6</i> expression is critical in determining healthy BMD. This review aims to summarize the major findings concerning the involvement of <i>Dlx</i> genes in skeletal development and homeostasis and their involvement in skeletal aging and pathology.

Also flagged:LOMARSpathogenesispsychomotor developmental delaysAutismbruxismchromosome
Journal Article 2022-10-18 ✓ 5 Snippets Koshevaya YS, Kusakin AV, Buchinskaia NV, Pechnikova VV, Serebryakova EA, Koroteev AL, Glotov AS, Glotov OS.
In-Text Gene Mentions

…variations in theHTTgene was conducted.…

…significance in theHTTgene, presumably associated…

…TheHTTgene (OMIM 613004)…

…40 of theHTTgene.…

…a singly intactHTTgene allele […

Show Full Abstract

Lopes−Maciel−Rodan syndrome (LOMARS) is an extremely rare disorder, with only a few cases reported worldwide. LOMARS is caused by a compound heterozygous mutation in the HTT gene. Little is known about LOMARS pathogenesis and clinical manifestations. Whole exome sequencing (WES) was performed to achieve a definitive molecular diagnosis of the disorder. All NGS-identified variants underwent the Sanger confirmation. In addition, a literature review on genetic variations in the HTT gene was conducted. The paper reports a case of LOMARS in a pediatric patient in Russia. A preterm girl of non-consanguineous parents demonstrated severe psychomotor developmental delays in her first 12 months. By the age of 6 years, she failed to develop speech but was able to understand everyday phrases and perform simple commands. Autism-like behaviors, stereotypies, and bruxism were noted during the examination. WES revealed two undescribed variants of unknown clinical significance in the HTT gene, presumably associated with the patient’s phenotype (c.2350C>T and c.8440C>A). Medical re-examination of parents revealed that the patient inherited these variants from her father and mother. Lopes−Maciel−Rodan syndrome was diagnosed based on overlapping clinical findings and the follow-up genetic examination of parents. Our finding expands the number of reported LOMARS cases and provides new insights into the genetic basis of the disease.

Also flagged:Nanoparticlesalkylmembranesindomethacinvinylacrylic acid
Journal Article 2022-10-18 No Snippets Berdiaki A, Kuskov AN, Kulikov PP, Thrapsanioti LN, Giatagana EM, Stivaktakis P, Shtilman MI, Tsatsakis A, Nikitovic D.
Show Full Abstract

An amphiphilic copolymer of N-vinyl-2-pyrrolidone and acrylic acid-namely, p(VP-AA)-OD6000 (p(VP-AA))-was synthesized to prepare p(VP-AA) nanoparticles (NPs). Furthermore, the copolymer was linked with CFSE, and the so-prepared nanoparticles were loaded with the DiI dye to form D nanoparticles (DNPs). In this study, as demonstrated by immunofluorescence microscopy, immunofluorescence, and confocal microscopy, DNPs were readily taken up by human microvascular endothelial cells (HMEC-1) cells in a concentration-dependent manner. Upon uptake, both the CFSE dye (green stain) and the DiI dye (red stain) were localized to the cytoplasm of treated cells. Treatment with p(VP-AA) did not affect the viability of normal and challenged with LPS, HMEC-1 cells at 0.010 mg/mL and induced a dose-dependent decrease of these cells' viability at the higher concentrations of 0.033 and 0.066 mg/mL (<i>p</i> ≤ 0.01; <i>p</i> ≤ 0.001, respectively). Furthermore, we focused on the potential immunological activation of HMEC-1 endothelial cells upon p(VP-AA) NPs treatment by assessing the expression of adhesion molecules (E-Selectin, ICAM-1, and V-CAM). NPs treatments at concentrations utilized (<i>p</i> = NS) did not affect individual adhesion molecules' expression. p(VP-AA) NPs do not activate the endothelium and do not affect its viability at pharmacologically relevant concentrations.

Also flagged:HDADU13 small nucleolar RNApathogenesisneurodegenerative diseasetelomere
Journal Article 2022-10-18 ✓ 1 Snippet Romano S, Romano C, Peconi M, Fiore A, Bellucci G, Morena E, Troili F, Cipollini V, Annibali V, Giglio S, Mechelli R, Ferraldeschi M, Veneziano L, Mantuano E, Sani G, Vecchione A, Umeton R, Giubilei F, Salvetti M, Corbo RM, Scarabino D, Ristori G.
In-Text Gene Mentions

…exon of theHTTgene, which encodes…

Show Full Abstract

Plasma small RNAs have been recently explored as biomarkers in Huntington’s disease (HD). We performed an exploratory study on nine HD patients, eight healthy subjects (HS), and five psychiatric patients (PP; to control for iatrogenic confounder effects) through an Affymetrix-Gene-Chip-miRNA-Array. We validated the results in an independent population of 23 HD, 15 pre-HD, 24 PP, 28 Alzheimer’s disease (AD) patients (to control the disease-specificity) and 22 HS through real-time PCR. The microarray results showed higher levels of U13 small nucleolar RNA (SNORD13) in HD patients than controls (fold change 1.54, p = 0.003 HD vs. HS, and 1.44, p = 0.0026 HD vs. PP). In the validation population, a significant increase emerged with respect to both pre-HD and the control groups (p < 0.0001). SNORD13 correlated with the status of the mutant huntingtin carrier (r = 0.73; p < 0.001) and the disease duration (r = 0.59; p = 0.003). The receiver operating characteristic (ROC) curve analysis showed the high accuracy of SNORD13 in discriminating HD patients from other groups (AUC = 0.963). An interactome and pathway analysis on SNORD13 revealed enrichments for factors relevant to HD pathogenesis. We report the unprecedented finding of a potential disease-specific role of SNORD13 in HD. It seems to peripherally report a ‘tipping point’ in the pathogenic cascade at the neuronal level.

Also flagged:Colorectal cancerdeathcancercolon cancergene expressionrectal cancer
Journal Article 2022-10-18 ✓ 1 Snippet Yang BY, Sakharkar MK.
In-Text Gene Mentions

…, NCAM1 ,NEGR1, NLGN1 ,…

Show Full Abstract

Colorectal cancer (CRC) is a leading cause of death from cancer in Canada. Early detection of CRC remains crucial in managing disease prognosis and improving patient survival. It can also facilitate prevention, screening, and treatment before the disease progresses to a chronic stage. In this study, we developed a strategy for identifying colon cancer biomarkers from both gene expression and gene pair correlation. Using the RNA-Seq dataset TCGA-COAD, a panel of 71 genes, including the 20 most upregulated genes, 20 most downregulated genes and 31 genes involved in the most significantly altered gene pairs, were selected as potential biomarkers for colon cancer. This signature set of genes could be used for early diagnosis. Furthermore, this strategy could be applied to other types of cancer.

Also flagged:Liver Diseasetype 2 diabetes mellitusnonalcoholic fatty liver diseaseNAFLDhepatic steatosisinsulin resistance
Journal Article 2022-10-18 ✓ 1 Snippet Mantovani A, Taverna A, Cappelli D, Beatrice G, Csermely A, Sani E, Byrne CD, Targher G.
In-Text Gene Mentions

…drugs, autoimmunity orhemochromatosis); (b) cirrhosis, cancer…

Show Full Abstract

Currently, there are limited data regarding the long-term effect of liver stiffness on glycaemic control in patients with type 2 diabetes mellitus (T2DM) and nonalcoholic fatty liver disease (NAFLD). We prospectively followed an outpatient sample of 61 consecutive postmenopausal women with T2DM and NAFLD who had baseline data on liver ultrasonography and Fibroscan<sup>®</sup>-assessed liver stiffness measurement (LSM) in 2017 and who underwent follow-up in 2022. Haemoglobin A1c (HbA1c) was measured both at baseline and follow-up. At baseline, 52 patients had NAFLD (hepatic steatosis) alone, and 9 had NAFLD with coexisting clinically significant fibrosis (defined as LSM ≥ 7 kPa on Fibroscan<sup>®</sup>). At follow-up, 16 patients had a worsening of glycaemic control (arbitrarily defined as HbA1c increase ≥ 0.5% from baseline). The prevalence of NAFLD and coexisting clinically significant fibrosis at baseline was at least three times greater among patients who developed worse glycaemic control at follow-up, compared with those who did not (31.3% vs. 8.9%; <i>p</i> = 0.030). In logistic regression analysis, the presence of NAFLD and clinically significant fibrosis was associated with an approximately 4.5-fold increased likelihood of developing worse glycaemic control at follow-up (odds ratio 4.66, 95% confidence interval 1.07-20.3; <i>p</i> = 0.041), even after adjustment for baseline confounding factors, such as age, body mass index, haemoglobin A1c (or HOMA-estimated insulin resistance) and use of some glucose-lowering agents that may positively affect NAFLD and liver fibrosis. In conclusion, our results suggest that the presence of Fibroscan<sup>®</sup>-assessed significant fibrosis was associated with a higher risk of developing worse glycaemic control in postmenopausal women with T2DM and NAFLD.

Also flagged:Inflammatory bowel diseaseulcerative colitisnutritional deficiencyvitamin Dfolic acidiron
Journal Article 2022-10-18 ✓ 3 Snippets Dragasevic S, Stankovic B, Kotur N, Milutinovic AS, Milovanovic T, Stojkovic Lalosevic M, Stojanovic M, Pavlovic S, Popovic D.
In-Text Gene Mentions

Two studies analyzed TMPRSS6 and HFE variants in adult and pediatric celiac disease in which, as in IBD, iron deficiency anemia is a very common condition [62,63].

One Mendelian randomization study measured the causal associations of iron status with gout, rheumatoid arthritis, and inflammatory bowel disease using HFE and TMPRSS6 genetic variants as instrumental variables for exposure [138].

Interestingly, the studies demonstrated an association of HFE C282Y with iron deficiency anemia, in contrast with the expected role of this variant in iron overload.

Show Full Abstract

Inflammatory bowel disease (IBD), Crohn's disease (CD) and ulcerative colitis (UC) are complex diseases whose etiology is associated with genetic and environmental risk factors, among which are diet and gut microbiota. To date, IBD is an incurable disease and the main goal of its treatment is to reduce symptoms, prevent complications, and improve nutritional status and the quality of life. Patients with IBD usually suffer from nutritional deficiency with imbalances of specific micronutrient levels that contribute to the further deterioration of the disease. Therefore, along with medications usually used for IBD treatment, therapeutic strategies also include the supplementation of micronutrients such as vitamin D, folic acid, iron, and zinc. Micronutrient supplementation tailored according to individual needs could help patients to maintain overall health, avoid the triggering of symptoms, and support remission. The identification of individuals' genotypes associated with the absorption, transport and metabolism of micronutrients can modify future clinical practice in IBD and enable individualized treatment. This review discusses the personalized approach with respect to genetics related to micronutrients commonly used in inflammatory bowel disease treatment.

Also flagged:D-Mannoseciprofloxacinaldohexosesugarresveratrol-mannose carboxylate
Journal Article 2022-10-18 No Snippets Cassano R, Curcio F, Procopio D, Fiorillo M, Trombino S.
Show Full Abstract

This article describes the preparation, characterization, and performance evaluation of functional microspheres useful for the release of ciprofloxacin. The particles were obtained using D-mannose, a natural aldohexose sugar, and resveratrol, a powerful antioxidant. In particular, the above compounds were initially converted into D-mannose carboxylate and resveratrol methacrylate and, therefore, subjected to an esterification reaction. The resulting product was used for the preparation of the microspheres which were characterized by light scattering, FT-IR spectrophotometry and scanning electron microscopy (SEM). Subsequently, their degree of bloating was evaluated at pH 1.2 to simulate the pH of the stomach, at pH 6.8 and pH 7.4 to mimic the intestinal environment. The antibiotic ciprofloxacin was then loaded into the microspheres, with an encapsulation efficiency of 100%. The cumulative amount of drug released was 55% at pH 6.8 and 99% at pH 7.4. The tests conducted to evaluate the antibacterial activity demonstrated the ability of the microspheres obtained to inhibit the growth of <i>Escherichia coli</i>. The antioxidant efficacy, due to the presence of resveratrol in their structure, was confirmed using rat liver microsomal membranes. The results obtained have highlighted how the microspheres based on D-mannose and resveratrol can be considered promising multifunctional vectors useful in the treatment of intestinal and urinary infections.

Also flagged:Netrin-1ObesityNetrin (NTN)-1type 2 diabetes(NTN1
Journal Article 2022-10-18 ✓ 5 Snippets Mentxaka A, Gómez-Ambrosi J, Ramírez B, Rodríguez A, Becerril S, Neira G, Valentí V, Moncada R, Silva C, Unamuno X, Cienfuegos JA, Escalada J, Frühbeck G, Catalán V.
In-Text Gene Mentions

NTN-1 exerts chemoattractive or chemorepulsive functions depending on its receptors, including neogenin-1 (NEO-1), deleted in colorectal carcinomas (DCC), A2B receptor (A2BAR), uncoordinated-5 homolog family members (UNC5A, UNC5B, UNC5C, and UNC5D), CD146, and integrin subunits [8].

The upregulation of NEO1 in adipocytes after the treatment with NTN-1 together with the lack of changes in the expression of UNC5B and DCC suggest that NTN-1 mainly signals through NEO-1 in VAT during obesity, being reinforced by the positive correlation found between the expression levels of NTN1 and NEO1 in the VAT.

…in colorectal carcinomas (DCC), A2B receptor (A2BAR),…

…( ASC ),DCC, IL1A ,…

…the expression ofDCCand UNC5B remained…

Show Full Abstract

Netrin (NTN)-1 exhibits pro- and anti-inflammatory roles in different settings, playing important roles in the obesity-associated low-grade chronic inflammation. We aimed to determine the impact of NTN-1 on obesity and obesity-associated type 2 diabetes, as well as its role in visceral adipose tissue (VAT) inflammation. A total of 91 subjects were enrolled in this case-control study. Circulating levels of NTN-1 and its receptor neogenin (NEO)-1 were determined before and after weight loss achieved by caloric restriction and bariatric surgery. mRNA levels of NTN1 and NEO1 were assessed in human VAT, liver, and peripheral blood mononuclear cells. In vitro studies in human visceral adipocytes and human monocytic leukemia cells (THP-1)-derived macrophages were performed to analyze the impact of inflammation-related mediators on the gene expression levels of NTN1 and its receptor NEO1 as well as the effect of NTN-1 on inflammation. Increased (p < 0.001) circulating concentrations of NTN-1 in obesity decreased (p < 0.05) after diet-induced weight loss being also associated with a reduction in glucose (p < 0.01) and insulin levels (p < 0.05). Gene expression levels of NTN1 and NEO1 were upregulated (p < 0.05) in the VAT from patients with obesity with the highest expression in the stromovascular fraction cells compared with mature adipocytes (p < 0.01). NTN1 expression levels were enhanced (p < 0.01) under hypoxia and by inflammatory factors in both adipocytes and macrophages. Adipocyte-conditioned media strongly upregulated (p < 0.001) the mRNA levels of NTN1 in macrophages. The treatment of adipocytes with NTN-1 promoted the upregulation (p < 0.05) of pro-inflammatory and chemotactic molecules as well as its receptor NEO1. Collectively, these findings suggest that NTN-1 regulates VAT chronic inflammation and insulin resistance in obesity.

Also flagged:ferroptosisironpulmonary fibrosisIdiopathic pulmonary fibrosischronic progressive diseaseextracellular
Journal Article 2022-10-18 ✓ 3 Snippets Pei Z, Qin Y, Fu X, Yang F, Huo F, Liang X, Wang S, Cui H, Lin P, Zhou G, Yan J, Wu J, Chen ZN, Zhu P.
In-Text Gene Mentions

In addition, it had been confirmed that pulmonary fibrosis and functional decline were also related to abnormal iron overload in bleomycin-induced pulmonary fibrosis mouse model, and the similar phenomenon had also been verified in the iron overload model of homeostatic iron regulator (Hfe) gene-deficient mice [20].

…conditions including cancer,hemochromatosis, sickle cell disease,…

…homeostatic iron regulator (Hfe) gene-deficient mice […

Show Full Abstract

Idiopathic pulmonary fibrosis (IPF) is a chronic progressive disease characterized by excessive proliferation of fibroblasts and excessive accumulation of extracellular matrix (ECM). Ferroptosis is a novel form of cell death characterized by the lethal accumulation of iron and lipid peroxidation, which is associated with many diseases. Our study addressed the potential role played by ferroptosis and iron accumulation in the progression of pulmonary fibrosis. We found that the inducers of pulmonary fibrosis and injury, namely, bleomycin (BLM) and lipopolysaccharide (LPS), induced ferroptosis of lung epithelial cells. Both the ferroptosis inhibitor liproxstatin-1 (Lip-1) and the iron chelator deferoxamine (DFO) alleviated the symptoms of pulmonary fibrosis induced by bleomycin or LPS. TGF-β stimulation upregulated the expression of transferrin receptor protein 1 (TFRC) in the human lung fibroblast cell line (MRC-5) and mouse primary lung fibroblasts, resulting in increased intracellular Fe<sup>2+</sup>, which promoted the transformation of fibroblasts into myofibroblasts. Mechanistically, TGF-β enhanced the expression and nuclear localization of the transcriptional coactivator tafazzin (TAZ), which combined with the transcription factor TEA domain protein (TEAD)-4 to promote the transcription of TFRC. In addition, elevated Fe<sup>2+</sup> failed to induce the ferroptosis of fibroblasts, which might be related to the regulation of iron export and lipid metabolism. Finally, we specifically knocked out TFRC expression in fibroblasts in mice, and compared with those in the control mice, the symptoms of pulmonary fibrosis were reduced in the knockout mice after bleomycin induction. Collectively, these findings suggest the therapeutic potential of ferroptosis inhibitors and iron chelators in treating pulmonary fibrosis.

Also flagged:diabetes mellitusaminotransferaseglycogenGlycogenic hepatopathynonalcoholic fatty livertype 1 diabetes mellitus
Journal Article 2022-10-18 ✓ 2 Snippets Plaza Enriquez L, Konindala N, Yeh H, Khatiwada P, Sanchez Valenzuela M, Askari K.
In-Text Gene Mentions

…disease, viral hepatitis,hemochromatosis, and Wilson disease…

…Wilson's disease andhemochromatosis, serum ceruloplasmin, 24-hour…

Show Full Abstract

<h4>Introduction</h4>Glycogenic hepatopathy is a rare complication of uncontrolled diabetes mellitus that presents with hepatomegaly and transient elevation in serum aminotransferase enzymes. The underlying pathophysiology involves excessive accumulation of intrahepatic glycogen. Glycogenic hepatopathy is usually underdiagnosed because it is difficult to differentiate from other entities, such as the nonalcoholic fatty liver. The gold standard for diagnosis is liver biopsy. Glycogenic hepatopathy can be reversed by the achievement of adequate glycemic control. <i>Case description</i>. A 19-year-old female patient with a history of poorly controlled type 1 diabetes mellitus that resulted in several episodes of diabetes ketoacidosis requiring hospital admissions. The patient presented to the emergency room with generalized weakness and fatigue found to have diabetic ketoacidosis. Blood tests revealed abnormal liver function with aspartate aminotransferase 1129 U/L (13-37 U/L), alanine aminotransferase 766 U/L (13-56 U/L), alkaline phosphatase 216 U/L (45-117 U/L), total bilirubin 1.0 mg/dL (0.2-1.3 mg/dL), albumin 3.8 g/dL (3.4-5.0 g/dL), partial thromboplastin time < 20 s (23-31 s), prothrombin time 11.8 s (9.5-11.5 s), and international normalized ratio 1.1. Acute hepatitis serologies were negative. Epstein-Barr virus and cytomegalovirus were ruled out. Extensive autoimmune hepatitis tests were negative. Primary biliary cirrhosis was also ruled out. A liver biopsy was obtained, which was diagnostic of glycogenic hepatopathy.<h4>Conclusion</h4>Glycogenic hepatopathy must be suspected in patients with uncontrolled type 1 diabetes mellitus who present with elevated liver enzymes and hepatomegaly. Treating this rare condition requires a timely diagnosis with liver biopsy and strict glycemic control.

Also flagged:Traumatic brain injurydeathnecroptosispyroptosisferroptosisCyclophilin D
Journal Article 2022-10-18 ✓ 3 Snippets Nie Z, Tan L, Niu J, Wang B.
In-Text Gene Mentions

…the existence ofPEBP1/15LO-driven ferroptosis in TB…

…And thePEBP1/15LO can drive the…

…of cell death,PEBP1can inhibit the…

Show Full Abstract

Traumatic brain injury (TBI) is a major cause of death and disability in the population worldwide, of which key injury mechanism involving the death of nerve cells. Many recent studies have shown that regulatory necrosis is involved in the pathological process of TBI which includes necroptosis, pyroptosis, ferroptosis, parthanatos, and Cyclophilin D (CypD) mediated necrosis. Therefore, targeting the signaling pathways involved in regulatory necrosis may be an effective strategy to reduce the secondary injury after TBI. Meanwhile, drugs or genes are used as interference factors in various types of regulatory necrosis, so as to explore the potential treatment methods for the secondary injury after TBI. This review summarizes the current progress on regulatory necrosis in TBI.

Also flagged:ferroptosisdeathamyloid precursor proteinironlipiddeferiprone
Journal Article 2022-10-18 No Snippets Miao M, Han Y, Wang Y, Yang Y, Zhu R, Sun M, Zhang J.
Show Full Abstract

<b>Background:</b> Ferroptosis is a newly proposed concept of programmed cell death and has been widely studied in many diseases during the past decade. However, a bibliometric study that concentrates on publication outputs and research trends of ferroptosis related to the brain is lacking. <b>Methods:</b> We retrieved publication data in the field of ferroptosis in the brain from the Web of Science Core Collection on 31 December 2021. A bibliometric analysis was performed using VOSviewer and CiteSpace software. <b>Results:</b> Six hundred fifty-six documents focusing on ferroptosis in the brain were published from 2012 to 2021. The number of publications in this field has shown a steady increase in recent years. Most publications were from China (338) and the United States (166), while the most productive organizations were at the University of Melbourne (34) and University of Pittsburgh (23). Ashley I. Bush was the most productive author, while Scott J Dixon was the most co-cited author. The journal Free Radical Biology and Medicine published the most articles in this field, while Cell was the most cited journal. Among 656 publications, top 10 cited documents were cited at least 300 times. Among the top 20 references with the strongest citation bursts, half of the papers had a burst until 2021. The keywords analysis suggests that the top 20 keywords appeared at least 40 times. Additionally, "amyloid precursor protein" was the keyword with strongest bursts. <b>Conclusion:</b> Research on ferroptosis in the brain will continue to be highly regarded. This study analyzed the research landscape of ferroptosis in the brain and offers a new reference for researchers in this field.

Also flagged:Aminoacyl-tRNA synthetasesamino acidprotein synthesisprotein biosynthesisgenetic diseasesgenetic disorders
Journal Article 2022-10-18 No Snippets Turvey AK, Horvath GA, Cavalcanti ARO.
Show Full Abstract

The Aminoacyl-tRNA Synthetases (aaRSs) are an evolutionarily ancient family of enzymes that catalyze the esterification reaction linking a transfer RNA (tRNA) with its cognate amino acid matching the anticodon triplet of the tRNA. Proper functioning of the aaRSs to create aminoacylated (or "charged") tRNAs is required for efficient and accurate protein synthesis. Beyond their basic canonical function in protein biosynthesis, aaRSs have a surprisingly diverse array of non-canonical functions that are actively being defined. The human genome contains 37 genes that encode unique aaRS proteins. To date, 56 human genetic diseases caused by damaging variants in aaRS genes have been described: 46 are autosomal recessive biallelic disorders and 10 are autosomal dominant monoallelic disorders. Our appreciation of human diseases caused by damaging genetic variants in the aaRSs has been greatly accelerated by the advent of next-generation sequencing, with 89% of these gene discoveries made since 2010. In addition to these genetic disorders of the aaRSs, anti-synthetase syndrome (ASSD) is a rare autoimmune inflammatory myopathy that involves the production of autoantibodies that disrupt aaRS proteins. This review provides an overview of the basic biology of aaRS proteins and describes the rapidly growing list of human diseases known to be caused by genetic variants or autoimmune targeting that affect both the canonical and non-canonical functions of these essential proteins.

Also flagged:C9orf85CXorf38transmembrane protein metal cation symporter ZIP8SLC39A8solute carriertransportation
Journal Article 2022-10-18 ✓ 1 Snippet Tan HW, Xu YM, Liang ZL, Cai NL, Wu YY, Lau ATY.
In-Text Gene Mentions

…CD109, CPM, EFNA1,NEGR1, and TCTN3), 4…

Show Full Abstract

Human transmembrane protein metal cation symporter ZIP8 (SLC39A8) is a member of the solute carrier gene family responsible for intracellular transportation of essential micronutrients, including manganese, selenium, and zinc. Previously, we established a ZIP8-knockout (KO) human cell model using the CRISPR/Cas9 system and explored how the expression of ZIP8 could possibly contribute to a wide range of human diseases. To further assess the biophysiological role of ZIP8, in the current study, we employed isobaric tags for relative and absolute quantitation (iTRAQ) and detected the changes of the proteome in ZIP8-KO cells (proteomic data are available <i>via</i> ProteomeXchange with identifier PXD036680). A total of 286 differentially expressed proteins (206 downregulated and 80 upregulated proteins) were detected in the ZIP8-KO cell model, and subsequent bioinformatics analyses (GO, KEGG, KOG, and PPI) were performed on these proteins. Interestingly, four "uncharacterized" proteins (proteins with unknown biological function) were identified in the differentially expressed proteins: C1orf198, C9orf85, C17orf75, and CXorf38-all of which were under-expressed in the ZIP8-KO cells. Notably, C9orf85 and CXorf38 were amongst the top-10 most downregulated proteins, and their expressions could be selectively induced by essential micronutrients. Furthermore, clinical-based bioinformatic analysis indicated that positive correlations between the gene expressions of <i>ZIP8</i> and <i>C9orf85</i> or <i>CXorf38</i> were observed in multiple cancer types. Overall, this study reveals the proteomic landscape of cells with impaired ZIP8 and uncovers the potential relationships between essential micronutrients and uncharacterized proteins C9orf85 and CXorf38. The differentially expressed proteins identified in ZIP8-KO cells could be the potential targets for diagnosing and/or treating human ZIP8-associated diseases, including but not limited to malnutrition, viral infection, and cancers.

Also flagged:Ischemic strokeISAutophagyagingorganellesStroke
Journal Article 2022-10-18 No Snippets Li X, Li L, Si X, Zhang Z, Ni Z, Zhou Y, Liu K, Xia W, Zhang Y, Gu X, Huang J, Yin C, Shao A, Jiang L.
Show Full Abstract

Ischemic stroke (IS) is a severe disease with a high disability, recurrence, and mortality rates. Autophagy, a highly conserved process that degrades damaged or aging organelles and excess cellular components to maintain homeostasis, is activated during IS. It influences the blood-brain barrier integrity and regulates apoptosis. Circular RNAs (circRNAs) are novel non-coding RNAs involved in IS-induced autophagy and participate in various pathological processes following IS. In addition, they play a role in autophagy regulation. This review summarizes current evidence on the roles of autophagy and circRNA in IS and the potential mechanisms by which circRNAs regulate autophagy to influence IS injury. This review serves as a basis for the clinical application of circRNAs as novel biomarkers and therapeutic targets in the future.

Also flagged:OsteoarthritisOAGene Expressiontranscription factorscell motilityextracellular
Journal Article 2022-10-18 ✓ 1 Snippet Qi L, Wang J, Chen X, Ding Y, Ling B, Wang W, Xu J, Xue Z.
In-Text Gene Mentions

…, SOX5, andSOX6were largely downregulated…

Show Full Abstract

Osteoarthritis (OA) is characterised by cartilage destruction; however, there are no specific drugs available for its treatment. Cartilage-derived stem/progenitor cells (CSPCs) are multipotent cells that play an essential role in cartilage renewal and may provide critical insights into the medical needs for OA treatment. However, alterations in cell function and fate of CSPCs during OA progression have seldom been analysed, especially at the single-cell level. Additionally, it has been reported that CSPCs can migrate to the cartilage injury area, although the mechanism of migration remains elusive. Thus, understanding the changing patterns of CSPCs in the pathological process of OA is important in the effort to develop stem cell therapy for OA. Here, we downloaded single-cell transcriptomic data of patients with OA from the Gene Expression Omnibus (GEO) database and performed unbiased clustering of the cells based on gene expression patterns using the Seurat package. Using common stem cell markers and chondrogenic transcription factors, we traced CSPCs throughout all stages of OA. We further explored the dynamics of CSPCs in OA progression and validated the single-cell RNA sequencing data <i>in vitro</i> using qPCR, immunofluorescence, and western blotting. Specifically, we primarily explored the heterogeneity of CSPCs at the single-cell level and found that it was closely associated with OA progression. Our results indicate significantly reduced chondrogenic differentiation capacity in CSPCs during the late stage of OA, while their proliferation capacity tended to increase. We also found that genes implicated in fibrosis, cell motility, and extracellular matrix remodelling were upregulated in CSPCs during the progression of OA. Our study revealed the dynamics of stem cells in OA progression and may inform the development of stem cell therapy for OA.

Also flagged:DementiaADAD dementiadementiasproteinopathiesamnestic dementia
Journal Article 2022-10-18 No Snippets Mehta RI, Schneider JA.
Show Full Abstract

Dementias encompass a range of debilitating neurologic conditions. Here, we summarize the neuropathology of common forms of dementia, focusing on Alzheimer disease (AD) and related dementias. AD is part of a spectrum of neurodegenerative diseases that consists of various protein inclusions (ie, proteinopathies) but other brain abnormalities are also related to dementia. Beta-amyloid and tau aggregates are hallmarks of AD. Other tissue substrates include Lewy bodies, TDP-43 inclusions, vascular brain lesions, and mixed pathologies. This review highlights the complexity of neurodegenerative and other disease substrates and summarizes topography of these lesions and concepts of mixed brain pathologies, resistance, and resilience.

Also flagged:Sarcopeniachronic liver diseasemulti-organ failure syndromeinfectionsmalnutritionchronic diseases
Journal Article 2022-10-18 No Snippets Veraldi S, Pietrobattista A, Soglia G, Monti L, Alterio T, Mosca A, Liccardo D, Basso MS, Della Corte C, Russo L, Candusso M, Chiusolo F, Tortora F, Spada M, Maggiore G.
Show Full Abstract

Sarcopenia is a clinical condition characterized by a reduction in muscle mass, which typically affects adult patients; however, it has recently been recognized in pediatric literature. Few studies in children with chronic liver disease (CLD) undergoing liver transplantation (LT) have investigated the role of sarcopenia, with controversial results. The aim of our study was to assess the prevalence and impact of sarcopenia among children with CLD who are candidates for LT. We conducted a retrospective, single-center study at Bambino Gesù Children's Hospital (Rome, Italy) from July 2016 to July 2021, evaluating all children (0-16 years old) with CLD listed for LT with an abdomen computed tomography imaging available before LT. The total psoas muscle surface area (t-PMSA) was defined as the sum of left and right psoas muscle surface area measured at L4-L5 on axial images. The t-PMSA <i>z</i>-score was calculated according to reference data, and sarcopenia was defined as a t-PMSA <i>z</i>-score of ≤-2 (1-16 years) or a psoas muscle index [PMI; PMI = t-PMSA/(100 × BSA)] of <50th percentile of the population examined (<1 year). Clinical, laboratory, and LT outcome data were collected from all the patients with CLD. 27 out 48 (56%) of the patients aged 1-16 years were sarcopenic. No differences were noted in anthropometrics, nutritional support, liver function tests, model for ESLD (MELD), or pediatric ESLD (PELD) scores between patients with and without sarcopenia. The former showed a higher prevalence of respiratory complications (66.7% vs. 42.1%) and need for inotropes (40.7% vs. 10.8%) after LT. Among patients aged 0-1 years (<i>n</i>: 36), those with reduced muscle mass (50%) had a longer hospitalization time (44 vs. 24 days) and higher incidences of multi-organ failure syndrome (38.9% vs. 0%) and intensive care unit-related infections (61.1% vs. 27.8%) compared to those with greater muscle mass. t-PMSA and PMI were statistically significant predictors of LT outcomes. Sarcopenia is a reliable index of frailty in children with CLD, as its presence is associated with the risk of a more challenging LT. Future studies will have to investigate the functional aspects of sarcopenia and conceive preventive measures of muscle wasting in CLD patients.

Also flagged:aryldiazoacetateshydrocarboncarbenesarylcycloalkanesaryldiazoacetate
Journal Article 2022-10-18 ✓ 1 Snippet Wei B, Sharland JC, Blackmond DG, Musaev DG, Davies HML.
In-Text Gene Mentions

DCC

Show Full Abstract

Detailed kinetic studies on the functionalization of unactivated hydrocarbon sp<sup>3</sup> C-H bonds by dirhodium-catalyzed reaction of aryldiazoacetates revealed that the C-H functionalization step is rate-determining. The efficiency of this step was increased by using the hydrocarbon as solvent and using donor/acceptor carbenes with an electron-withdrawing substituent on the aryl donor group. The optimum catalyst for these reactions is the tetraphenylphthalimido derivative Rh2(<i>R</i>-TPPTTL)<sub>4</sub> and a further beneficial refinement was obtained by using <i>N,N'</i>-dicyclohexylcarbodiimide as an additive. Under the optimum conditions with a catalyst loading of 0.001 mol %, effective enantioselective C-H functionalization (66-97% yield, 83-97% ee) was achieved of cycloalkanes with a range of aryldiazoacetates as long as the aryldiazoacetate was not to sterically demanding. The reaction with cyclohexane using a catalyst loading of 0.0005 mol % could be recharged twice with additional aryldiazoacetate, resulting in an overall dirhodium catalyst turnover number of 580,000.

Also flagged:Lgr5Noggingrowth factoranaplastic lymphoma kinaseALKprostaglandin E2
Journal Article 2022-10-18 ✓ 1 Snippet , , .
In-Text Gene Mentions

OLFM4

Show Full Abstract

No abstract available.

Research Square 2022-10-18 Preprint (No Snippets API) Luo H, Hu X, Li Y, Lei D, Tan G, Zeng Y, Qin B.
Show Full Abstract

<h4>Background: </h4> Hepatitis B virus (HBV) infection is the most critical factor underlying liver cirrhosis and hepatocellular carcinoma worldwide.The triple motif protein 38 (TRIM38) is an interferon-stimulated gene (ISG) that can indirectly inhibit various DNA and RNA viruses by modulating the type I interferon response.However, the relationship between TRIM38 and HBV infection and therapy is yet to be elucidated.Our study aims to investigate the correlation between TRIM38 expression levels and the efficacy of HBV infection and IFN-α therapy in patients with CHB. Methods TRIM38 was overexpressed or knocked down in human hepatoma cells and the cells and supernatant were collected.The levels of HBV RNA, pgRNA and supernatant antigen were detected by qRT-PCR or ELISA to evaluate the inhibitory effect of TRIM38 on HBV.Blood samples of CHB patients who received pegylated interferon-α(PEG-IFN-α) therapy were collected, and PBMC was isolated.The alternation in the gene expression level of TRIM38 was detected by qRT-PCR, and the predictive value of TRIM38 changes during early therapy was evaluated.The induction of antiviral proteins was analyzed by immunoblotting. Results In human hepatoma cells, TRIM38 was highly induced by IFN-alpha (IFN-α) and enhanced anti-HBV activity.Furthermore, combined treatment with TRIM38 and IFN-α increased antiviral proteins levels.The overexpression of TRIM38 inhibited while knockdown of TRIM38 elevated HBV replication and gene expression in HepG2 and HepG2.2.15 cells.TRIM38 is negatively correlated with chronic HBV infection.Prospective study showed that high levels of TRIM38 in peripheral blood PBMCs were observed in the early responders, and higher TRIM38 expression co-related with a better response to PEG-IFN-α therapy. Conclusions Taken together, our study suggested that TRIM38 plays a vital role in HBV replication and gene expression and TRIM38 may become a new target for the treatment of HBV.

Also flagged:antibodyCCSgene expressioncell surfacetranslationalheart block
Journal Article 2022-10-17 No Snippets Goodyer WR, Beyersdorf BM, Duan L, van den Berg NS, Mantri S, Galdos FX, Puluca N, Buikema JW, Lee S, Salmi D, Robinson ER, Rogalla S, Cogan DP, Khosla C, Rosenthal EL, Wu SM.
Show Full Abstract

Accidental injury to the cardiac conduction system (CCS), a network of specialized cells embedded within the heart and indistinguishable from the surrounding heart muscle tissue, is a major complication in cardiac surgeries. Here, we addressed this unmet need by engineering targeted antibody-dye conjugates directed against the CCS, allowing for the visualization of the CCS in vivo following a single intravenous injection in mice. These optical imaging tools showed high sensitivity, specificity, and resolution, with no adverse effects on CCS function. Further, with the goal of creating a viable prototype for human use, we generated a fully human monoclonal Fab that similarly targets the CCS with high specificity. We demonstrate that, when conjugated to an alternative cargo, this Fab can also be used to modulate CCS biology in vivo, providing a proof of principle for targeted cardiac therapeutics. Finally, in performing differential gene expression analyses of the entire murine CCS at single-cell resolution, we uncovered and validated a suite of additional cell surface markers that can be used to molecularly target the distinct subcomponents of the CCS, each prone to distinct life-threatening arrhythmias. These findings lay the foundation for translational approaches targeting the CCS for visualization and therapy in cardiothoracic surgery, cardiac imaging, and arrhythmia management.

Also flagged:CDK8CDK19tissue homeostasiscyclin dependent kinasesMediator kinasesMediator
Journal Article 2022-10-17 ✓ 4 Snippets Dannappel MV, Zhu D, Sun X, Chua HK, Poppelaars M, Suehiro M, Khadka S, Lim Kam Sian TC, Sooraj D, Loi M, Gao H, Croagh D, Daly RJ, Faridi P, Boyer TG, Firestein R.
In-Text Gene Mentions

…Olfactomedin 4–positive (OLFM4-positive) cells exhibited a…

…early progenitor markersOlfm4, Ascl2 ,…

…Notably,Olfm4gene expression was…

…for CDK8/19 inOlfm4transcription.…

Show Full Abstract

Initiation and maintenance of transcriptional states are critical for controlling normal tissue homeostasis and differentiation. The cyclin dependent kinases CDK8 and CDK19 (Mediator kinases) are regulatory components of Mediator, a highly conserved complex that orchestrates enhancer-mediated transcriptional output. While Mediator kinases have been implicated in the transcription of genes necessary for development and growth, its function in mammals has not been well defined. Using genetically defined models and pharmacological inhibitors, we showed that CDK8 and CDK19 function in a redundant manner to regulate intestinal lineage specification in humans and mice. The Mediator kinase module bound and phosphorylated key components of the chromatin remodeling complex switch/sucrose non-fermentable (SWI/SNF) in intestinal epithelial cells. Concomitantly, SWI/SNF and MED12-Mediator colocalized at distinct lineage-specifying enhancers in a CDK8/19-dependent manner. Thus, these studies reveal a transcriptional mechanism of intestinal cell specification, coordinated by the interaction between the chromatin remodeling complex SWI/SNF and Mediator kinase.

Also flagged:TRPM8colorectal cancertumourion channelsWntcolon cancer
Journal Article 2022-10-17 ✓ 2 Snippets Pagano E, Romano B, Cicia D, Iannotti FA, Venneri T, Lucariello G, Nanì MF, Cattaneo F, De Cicco P, D'Armiento M, De Luca M, Lionetti R, Lama S, Stiuso P, Zoppoli P, Falco G, Marchianò S, Fiorucci S, Capasso R, Di Marzo V, Borrelli F, Izzo AA.
In-Text Gene Mentions

(i) Wnt signalling pathway‐associated genes (Axin 2 [axis inhibition protein 2], Sox‐9 [SRY‐box transcription factor 9], Cyclin D1, C‐Myc, CD44, MMP7 [matrix metalloproteinase 7], MMP2 [matrix metalloproteinase 2], OLFM4 [olfactomedin protein 4] and SMAD4) mRNA expression was evaluated by RT–qPCR and calculated by using the 2−ΔΔCt formula in xenografted tumours explanted from mice treated with vehicle (black) or WS12 (blue) (n = 5 different biological samples).

…(matrix metalloproteinase 2),OLFM4(olfactomedin protein 4)…

Show Full Abstract

<h4>Background and purpose</h4>Transient receptor potential melastatin type-8 (TRPM8) is a cold-sensitive cation channel protein belonging to the TRP superfamily of ion channels. Here, we reveal the molecular mechanism of TRPM8 and its clinical relevance in colorectal cancer (CRC).<h4>Experimental approach</h4>TRPM8 expression and its correlation with the survival rate of CRC patients was analysed. To identify the key pathways and genes related to TRPM8 high expression, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were conducted in CRC patients. TRPM8 functional role was assessed by using Trpm8<sup>-/-</sup> mice in models of sporadic and colitis-associated colon cancer. TRPM8 pharmacological targeting by WS12 was evaluated in murine models of CRC.<h4>Key results</h4>TRPM8 is overexpressed in colon primary tumours and in CD326<sup>+</sup> tumour cell fraction. TRPM8 high expression was related to lower survival rate of CRC patients, Wnt-Frizzled signalling hyperactivation and adenomatous polyposis coli down-regulation. In sporadic and colitis-associated models of colon cancer, either absence or pharmacological desensitization of TRPM8 reduced tumour development via inhibition of the oncogenic Wnt/β-catenin signalling. TRPM8 pharmacological blockade reduced tumour growth in CRC xenograft mice by reducing the transcription of Wnt signalling regulators and the activation of β-catenin and its target oncogenes such as C-Myc and Cyclin D1.<h4>Conclusion and implications</h4>Human data provide valuable insights to propose TRPM8 as a prognostic marker with a negative predictive value for CRC patient survival. Animal experiments demonstrate TRPM8 involvement in colon cancer pathophysiology and its potential as a drug target for CRC.

Also flagged:agingphosphoinositide 3-kinasePI3KAKTinsulininsulin-like growth factor-1
Journal Article 2022-10-17 ✓ 1 Snippet Wang X, Li X, Li L, Yang X, Wang J, Liu X, Chen J, Liu S, Zhang N, Li J, Wang H.
In-Text Gene Mentions

HFE significantly improved cell viability, increased superoxide dismutase, catalase, and glutathione peroxidase activity, decreased lactate dehydrogenase release, the level of reactive oxygen species (ROS), and malondialdehyde content in H<sub>2</sub>O<sub>2</sub>-induced PC12 cells (<i>p</i> < 0.05).

Show Full Abstract

Hawthorn (<i>Crataegus pinnatifida</i>) fruit has a long history of use as traditional Chinese medicine and is shown to have many health benefits including antioxidant and anti-aging. In this study, the anti-aging mechanism of hawthorn fruit extract (HFE) is predicted by network pharmacology and further verified in H<sub>2</sub>O<sub>2</sub>-induced PC12 cells and <i>Caenorhabditis elegans</i>. Network pharmacology predicted that the antiaging mechanism of HFE is mainly involved in phosphoinositide 3-kinase (PI3K)/AKT and the insulin/insulin-like growth factor-1 (IIS) signaling pathway. HFE significantly improved cell viability, increased superoxide dismutase, catalase, and glutathione peroxidase activity, decreased lactate dehydrogenase release, the level of reactive oxygen species (ROS), and malondialdehyde content in H<sub>2</sub>O<sub>2</sub>-induced PC12 cells (<i>p</i> < 0.05). HFE significantly increased the mean lifespan of <i>C. elegans</i> by 28.43% (100 μg mL<sup>-1</sup>) and enhanced the stress resistance to H<sub>2</sub>O<sub>2</sub>, paraquat, juglone, ultraviolet radiation, and heat shock. HFE also suppressed the accumulation of aging pigments, improved the body bending ability, increased antioxidant enzyme activities, and reduced the contents of ROS and malondialdehyde. In addition, relevant gene expression, lifespan experiments with mutant strains, and molecular docking studies supported the results that HFE might extend lifespan through the IIS signal pathway.

Also flagged:mitochondrialsprGPAMRNF123LLGL1bone development disorders
Journal Article 2022-10-17 No Snippets Mittan-Moreau CS, Kelehear C, Toledo LF, Bacon J, Guayasamin JM, Snyder A, Zamudio KR.
Show Full Abstract

Widespread introduced species can be leveraged to investigate the genetic, ecological and adaptive processes underlying rapid evolution and range expansion, particularly the contributions of genetic diversity to adaptation. Rhinella marina, the cane toad, has been a focus of invasion biology for decades in Australia. However, their introduction history in North America is less clear. Here, we investigated the roles of introduction history and genetic diversity in establishment success of cane toads across their introduced range. We used reduced representation sequencing (ddRAD) to obtain 34,000 SNPs from 247 toads in native (French Guiana, Guyana, Ecuador, Panama, Texas) and introduced (Bermuda, southern Florida, northern Florida, Hawai'i, Puerto Rico) populations. Unlike all other cane toad introductions, we found that Florida populations were more closely related to native Central American lineages (R. horribilis), than to native Southern American lineages (R. marina). Furthermore, we found high levels of diversity and population structure in the native range, corroborating suggestions that R. marina is a species complex. We also found that introduced populations exhibit only slightly lower genetic diversity than native populations. Together with demographic analyses, this indicates founding populations of toads in Florida were larger than previously reported. Lastly, within R. marina, only one of 245 putatively adaptive SNPs showed fixed differences between native and introduced ranges, suggesting that putative selection in these introduced populations is based upon existing genetic variation. Our findings highlight the importance of genetic sequencing in understanding biological introductions and hint at the role of standing genetic variation in range expansion.

Also flagged:vascular smooth muscle cell proliferationAtherosclerosisAScardiovascular diseasedeathwound-healing
Journal Article 2022-10-17 ✓ 5 Snippets Sheng Y, Yang Z, Feng Z, Wang Y, Ji N.
In-Text Gene Mentions

…migration via inhibitingSOX6.…

…between miR-499-5p andSOX6.…

…(UTR) region ofSOX6.…

…significantly reversed by <i>SOX6</i> overexpression.…

…binding and inhibitingSOX6expression.…

Show Full Abstract

Atherosclerosis (AS) is the primary etiology of cardiovascular disease, which is considered the leading cause of death all over the world. MicroRNA miR-499-5p was involved in the functional regulation of myocardial and skeletal muscle, whereas its role in atherosclerosis, especially in vascular smooth muscle cells (VSMCs), remains unclear. Our study aims to investigate the effects of miR-499-5p in the proliferation and migration of VSMCs and potential mechanisms. We used mouse aortic vascular smooth muscle cells (MOVAS) and <i>ApoE<sup>-/-</sup></i> mice to establish the models of AS in vitro and in vivo, respectively. RT-PCR was performed to detect the expression level of miR-499-5p. Subsequently, Cell Counting Kit-8 (CCK-8) assays, Transwell assays, and wound-healing assays were used to evaluate cell proliferation and migration. Dual-luciferase reporter assay was performed to validate the interaction between miR-499-5p and SOX6. miR-499-5p significantly increased in aorta tissues of mice in AS tissues and vascular smooth muscle cells treated with ox-LDL. miR-499-5p overexpression could promote the proliferation and migration of MOVAS. Bioinformatics analysis predicted and further experiments verified that miR-499-5p could directly bind to the 3'-untranslated region (UTR) region of SOX6. Further, miR-499-5p induced an increased expression of smooth muscle proliferation and migration-related genes, <i>PCNA, cyclin D1</i>, and matrix metalloproteinase (<i>MMP2</i>), as well as the decreased expression of proliferation inhibiting factor <i>p21</i>, which was significantly reversed by <i>SOX6</i> overexpression. miR-499-5p boosts the proliferation and migration of smooth muscle cells by binding and inhibiting SOX6 expression. The miR-499-5p/SOX6 axis may present a promising therapeutic implication for the prevention and treatment of cardiovascular diseases.

Also flagged:HuntingtinHuntingtin-associated protein 1HAP1Huntington diseaseCas9gene expression
Journal Article 2022-10-17 ✓ 4 Snippets Chen X, Sun Y, Chen L, Chen XS, Pan M, Zhang Y, Wang Q, Yang W, Yin P, He D, Guo X, Yang S, Zeng Y, Yan S, Li XJ, Li S.
In-Text Gene Mentions

…of Hap1 andHttin the rodent…

…HAP1 with mutantHTTmay be involved…

…involved in mutantHTT-mediated neurotoxicity in adu…

HTT

Show Full Abstract

Huntingtin-associated protein 1 (HAP1) is the first identified protein whose function is affected by its abnormal interaction with mutant huntingtin (mHTT), which causes Huntington disease. However, the expression patterns of Hap1 and Htt in the rodent brain are not correlated. Here we found that the primate HAP1, unlike the rodent Hap1, is correlatively expressed with HTT in the primate brains. CRISPR/Cas9 targeting revealed that HAP1 deficiency in the developing human neurons did not affect neuronal differentiation and gene expression as seen in the mouse neurons. However, deletion of HAP1 exacerbated neurotoxicity of mutant HTT in the organotypic brain slices of adult monkeys. These findings demonstrate differential HAP1 expression and function in the mouse and primate brains, and suggest that interaction of HAP1 with mutant HTT may be involved in mutant HTT-mediated neurotoxicity in adult primate neurons.

Also flagged:DHFRpolyglutamineHDroot hairGTP cyclohydrolase Ifolate
Journal Article 2022-10-17 ✓ 5 Snippets Hung CY, Zhu C, Kittur FS, He M, Arning E, Zhang J, Johnson AJ, Jawa GS, Thomas MD, Ding TT, Xie J.
In-Text Gene Mentions

After years of intensive research following the discovery of abnormally expanded polyQ (> 36Q) in huntingtin exon 1 (Httex1) as the cause for HD [3], mutant Htt (mHtt) protein was found to alter the protein structure and properties and cause the protein aggregation leading to the dysregulation of many cellular processes, such as gene transcription, proteostasis, mitochondrial function and chromatin modification, resulting in cortico-striatal miscommunication and progressive neuronal loss [1, 4–6].

Most importantly, plants naturally lack Htt homologs, and transgenic plants expressing Htt or mHtt would avoid any endogenous Htt’s effects, which will simplify the interpretation of polyQ effects compared to any HD animal models.

…events, we expressedHttexon1 (Htt ex1…

…expressed Htt exon1 (Httex1 ) with…

…from severely affectedHttex1 Q63 and…

Show Full Abstract

Pathophysiology associated with Huntington's disease (HD) has been studied extensively in various cell and animal models since the 1993 discovery of the mutant huntingtin (mHtt) with abnormally expanded polyglutamine (polyQ) tracts as the causative factor. However, the sequence of early pathophysiological events leading to HD still remains elusive. To gain new insights into the early polyQ-induced pathogenic events, we expressed Htt exon1 (Htt<sub>ex1</sub>) with a normal (21), or an extended (42 or 63) number of polyQ in tobacco plants. Here, we show that transgenic plants accumulated Htt<sub>ex1</sub> proteins with corresponding polyQ tracts, and mHtt<sub>ex1</sub> induced protein aggregation and affected plant growth, especially root and root hair development, in a polyQ length-dependent manner. Quantitative proteomic analysis of young roots from severely affected Htt<sub>ex1</sub>Q63 and unaffected Htt<sub>ex1</sub>Q21 plants showed that the most reduced protein by polyQ63 is a GTP cyclohydrolase I (GTPCH) along with many of its related one-carbon (C<sub>1</sub>) metabolic pathway enzymes. GTPCH is a key enzyme involved in folate biosynthesis in plants and tetrahydrobiopterin (BH<sub>4</sub>) biosynthesis in mammals. Validating studies in 4-week-old R6/2 HD mice expressing a mHtt<sub>ex1</sub> showed reduced levels of GTPCH and dihydrofolate reductase (DHFR, a key folate utilization/alternate BH<sub>4</sub> biosynthesis enzyme), and impaired C<sub>1</sub> and BH<sub>4</sub> metabolism. Our findings from mHtt<sub>ex1</sub> plants and mice reveal impaired expressions of GTPCH and DHFR and may contribute to a better understanding of mHtt-altered C<sub>1</sub> and BH<sub>4</sub> metabolism, and their roles in the pathogenesis of HD.

Also flagged:ALLacute lymphoblastic leukaemianucleotidePAX5IKZF1EPOR
Journal Article 2022-10-17 ✓ 3 Snippets Rehn J, Mayoh C, Heatley SL, McClure BJ, Eadie LN, Schutz C, Yeung DT, Cowley MJ, Breen J, White DL.
In-Text Gene Mentions

…, AFF1-KMT2A ,MLLT10-PICALM , MLLT10-DDX3X and…

…, MLLT10-PICALM ,MLLT10-DDX3X and ZNF384-EP300 )…

…= 3) and DDX3X-MLLT10(n = 1)…

Show Full Abstract

RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, integrating RNA-seq in a clinical setting requires rapid detection and accurate reporting of clinically relevant alterations. Here we present RaScALL, an implementation of the k-mer based variant detection tool km, capable of identifying more than 100 prognostically significant lesions observed in ALL, including gene fusions, single nucleotide variants and focal gene deletions. We compared genomic alterations detected by RaScALL and those reported by alignment-based de novo variant detection tools in a study cohort of 180 Australian patient samples. Results were validated using 100 patient samples from a published North American cohort. RaScALL demonstrated a high degree of accuracy for reporting subtype defining genomic alterations. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% of reported cases in the study cohort (n = 164) and 95% of samples (n = 63) in the validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n = 12) and IKZF1 p.N159Y (n = 4). Intragenic IKZF1 deletions resulting in aberrant transcript isoforms were also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches. The application of RaScALL enables rapid identification and reporting of previously identified genomic alterations of known clinical relevance.

Also flagged:gene expressionmembranesplacentationtransforming growth factor betainhibin beta BINHBB
Journal Article 2022-10-17 ✓ 1 Snippet Wen J, Ishihara T, Renfree MB, Griffith OW.
In-Text Gene Mentions

PTGIS

Show Full Abstract

The evolution of a placenta requires several steps including changing the timing of reproductive events, facilitating nutrient exchange, and the capacity for maternal-fetal communication. To understand the evolution of maternal-fetal communication, we used ligand-receptor gene expression as a proxy for the potential for cross-talk in a live-bearing lizard (<i>Pseudemoia entrecasteauxii</i>) and homologous tissues in a related egg-laying lizard (<i>Lampropholis guichenot</i><i>i</i>). Approximately 70% of expressed ligand/receptor genes were shared by both species. Gene ontology (GO) analysis showed that there was no GO-enrichment in the fetal membranes of the egg-laying species, but live-bearing fetal tissues were significantly enriched for 50 GO-terms. Differences in enrichment suggest that the evolution of viviparity involved reinforcing specific signalling pathways, perhaps to support fetal control of placentation. One identified change was in transforming growth factor beta signalling. Using immunohistochemistry, we show the production of the signalling molecule inhibin beta B (INHBB) occurs in viviparous fetal membranes but was absent in closely related egg-laying tissues, suggesting that the evolution of viviparity may have involved changes to signalling via this pathway. We argue that maternal-fetal signalling evolved through co-opting expressed signalling molecules and recruiting new signalling molecules to support the complex developmental changes required to support a fetus <i>in utero</i>. This article is part of the theme issue 'Extraembryonic tissues: exploring concepts, definitions and functions across the animal kingdom'.

Also flagged:romidepsinhistone deacetylaseprovirusCD4bindingantibody
Journal Article 2022-10-17 No Snippets Gunst JD, Pahus MH, Rosás-Umbert M, Lu IN, Benfield T, Nielsen H, Johansen IS, Mohey R, Østergaard L, Klastrup V, Khan M, Schleimann MH, Olesen R, Støvring H, Denton PW, Kinloch NN, Copertino DC, Ward AR, Alberto WDC, Nielsen SD, Puertas MC, Ramos V, Reeves JD, Petropoulos CJ, Martinez-Picado J, Brumme ZL, Jones RB, Fox J, Tolstrup M, Nussenzweig MC, Caskey M, Fidler S, Søgaard OS.
Show Full Abstract

Attempts to reduce the human immunodeficiency virus type 1 (HIV-1) reservoir and induce antiretroviral therapy (ART)-free virologic control have largely been unsuccessful. In this phase 1b/2a, open-label, randomized controlled trial using a four-group factorial design, we investigated whether early intervention in newly diagnosed people with HIV-1 with a monoclonal anti-HIV-1 antibody with a CD4-binding site, 3BNC117, followed by a histone deacetylase inhibitor, romidepsin, shortly after ART initiation altered the course of HIV-1 infection ( NCT03041012 ). The trial was undertaken in five hospitals in Denmark and two hospitals in the United Kingdom. The coprimary endpoints were analysis of initial virus decay kinetics and changes in the frequency of CD4<sup>+</sup> T cells containing intact HIV-1 provirus from baseline to day 365. Secondary endpoints included changes in the frequency of infected CD4<sup>+</sup> T cells and virus-specific CD8<sup>+</sup> T cell immunity from baseline to day 365, pre-ART plasma HIV-1 3BNC117 sensitivity, safety and tolerability, and time to loss of virologic control during a 12-week analytical ART interruption that started at day 400. In 55 newly diagnosed people (5 females and 50 males) with HIV-1 who received random allocation treatment, we found that early 3BNC117 treatment with or without romidepsin enhanced plasma HIV-1 RNA decay rates compared to ART only. Furthermore, 3BNC117 treatment accelerated clearance of infected cells compared to ART only. All groups had significant reductions in the frequency of CD4<sup>+</sup> T cells containing intact HIV-1 provirus. At day 365, early 3BNC117 + romidepsin was associated with enhanced HIV-1 Gag-specific CD8<sup>+</sup> T cell immunity compared to ART only. The observed virological and immunological effects of 3BNC117 were most pronounced in individuals whose pre-ART plasma HIV-1 envelope sequences were antibody sensitive. The results were not disaggregated by sex. Adverse events were mild to moderate and similar between the groups. During a 12-week analytical ART interruption among 20 participants, 3BNC117-treated individuals harboring sensitive viruses were significantly more likely to maintain ART-free virologic control than other participants. We conclude that 3BNC117 at ART initiation enhanced elimination of plasma viruses and infected cells, enhanced HIV-1-specific CD8<sup>+</sup> immunity and was associated with sustained ART-free virologic control among persons with 3BNC117-sensitive virus. These findings strongly support interventions administered at the time of ART initiation as a strategy to limit long-term HIV-1 persistence.

Also flagged:esophageal adenocarcinomatumortumorscanceradenocarcinomasquamous cell carcinoma
Journal Article 2022-10-17 ✓ 2 Snippets Croft W, Evans RPT, Pearce H, Elshafie M, Griffiths EA, Moss P.
In-Text Gene Mentions

Furthermore, expression of the OLFM4 gene associated with nodal metastasis [43] was focused within a single tumor-associated cluster and indicates the potential of single cell analysis to define clusters associated with specific clinical features.

…expression of theOLFM4gene associated with…

Show Full Abstract

Immune checkpoint blockade has recently proven effective in subsets of patients with esophageal adenocarcinoma (EAC) but little is known regarding the EAC immune microenvironment. We determined the single cell transcriptional profile of EAC in 8 patients who were treatment-naive (n = 4) or had received neoadjuvant chemotherapy (n = 4). Analysis of 52,387 cells revealed 10 major cell subsets of tumor, immune and stromal cells. Prior to chemotherapy tumors were heavy infiltrated by T regulatory cells and exhausted effector T cells whilst plasmacytoid dendritic cells were markedly expanded. Two dominant cancer-associated fibroblast populations were also observed whilst endothelial populations were suppressed. Pathological remission following chemotherapy associated with broad reversal of immune abnormalities together with fibroblast transition and an increase in endothelial cells whilst a chemoresistant epithelial stem cell population correlated with poor response. These findings reveal features that underlie and limit the response to current immunotherapy and identify a range of novel opportunities for targeted therapy.

Also flagged:agingmethylationcytosinesDNA methyltransferasesDNMT3ADNMT3B
Journal Article 2022-10-17 ✓ 1 Snippet Higham J, Kerr L, Zhang Q, Walker RM, Harris SE, Howard DM, Hawkins EL, Sandu AL, Steele JD, Waiter GD, Murray AD, Evans KL, McIntosh AM, Visscher PM, Deary IJ, Cox SR, Sproul D.
In-Text Gene Mentions

…are targeted bypolycomb repressiverepressive complexes in…

Show Full Abstract

<h4>Background</h4>DNA methylation is an epigenetic mark associated with the repression of gene promoters. Its pattern in the genome is disrupted with age and these changes can be used to statistically predict age with epigenetic clocks. Altered rates of aging inferred from these clocks are observed in human disease. However, the molecular mechanisms underpinning age-associated DNA methylation changes remain unknown. Local DNA sequence can program steady-state DNA methylation levels, but how it influences age-associated methylation changes is unknown.<h4>Results</h4>We analyze longitudinal human DNA methylation trajectories at 345,895 CpGs from 600 individuals aged between 67 and 80 to understand the factors responsible for age-associated epigenetic changes at individual CpGs. We show that changes in methylation with age occur at 182,760 loci largely independently of variation in cell type proportions. These changes are especially apparent at 8322 low CpG density loci. Using SNP data from the same individuals, we demonstrate that methylation trajectories are affected by local sequence polymorphisms at 1487 low CpG density loci. More generally, we find that low CpG density regions are particularly prone to change and do so variably between individuals in people aged over 65. This differs from the behavior of these regions in younger individuals where they predominantly lose methylation.<h4>Conclusions</h4>Our results, which we reproduce in two independent groups of individuals, demonstrate that local DNA sequence influences age-associated DNA methylation changes in humans in vivo. We suggest that this occurs because interactions between CpGs reinforce maintenance of methylation patterns in CpG dense regions.

Also flagged:skin cancerskin malignanciesgene expressionskin cancerssynthesisextracellular
Journal Article 2022-10-17 ✓ 1 Snippet Srivastava A, Bencomo T, Das I, Lee CS.
In-Text Gene Mentions

Their findings demonstrate that melanoma cells transition from a melanocytic transcriptional state to a mesenchymal-like one through a stable intermediate state characterized by unique chromatin features and transcriptionally regulated by SOX6, NFATC2, EGR3, ELF1 and ETV456.

Show Full Abstract

The human skin is a complex organ that forms the first line of defense against pathogens and external injury. It is composed of a wide variety of cells that work together to maintain homeostasis and prevent disease, such as skin cancer. The exponentially rising incidence of skin malignancies poses a growing public health challenge, particularly when the disease course is complicated by metastasis and therapeutic resistance. Recent advances in single-cell transcriptomics have provided a high-resolution view of gene expression heterogeneity that can be applied to skin cancers to define cell types and states, understand disease evolution, and develop new therapeutic concepts. This approach has been particularly valuable in characterizing the contribution of immune cells in skin cancer, an area of great clinical importance given the increasing use of immunotherapy in this setting. In this review, we highlight recent skin cancer studies utilizing bulk RNA sequencing, introduce various single-cell transcriptomics approaches, and summarize key findings obtained by applying single-cell transcriptomics to skin cancer.

Also flagged:interoceptionhematopoiesismetabolismHomeostasisglucoselipid
Journal Article 2022-10-17 ✓ 1 Snippet Lv X, Gao F, Cao X.
In-Text Gene Mentions

DCC

Show Full Abstract

Accumulating evidence indicates that interoception maintains proper physiological status and orchestrates metabolic homeostasis by regulating feeding behaviors, glucose balance, and lipid metabolism. Continuous skeletal remodeling consumes a tremendous amount of energy to provide skeletal scaffolding, support muscle movement, store vital minerals, and maintain a niche for hematopoiesis, which are processes that also contribute to overall metabolic balance. Although skeletal innervation has been described for centuries, recent work has shown that skeletal metabolism is tightly regulated by the nervous system and that skeletal interoception regulates bone homeostasis. Here, we provide a general discussion of interoception and its effects on the skeleton and whole-body metabolism. We also discuss skeletal interoception-mediated regulation in the context of pathological conditions and skeletal pain as well as future challenges to our understanding of these process and how they can be leveraged for more effective therapy.

Also flagged:transdifferentiationmethylationkeratin 18transcription factorscell cyclecell adhesion
Journal Article 2022-10-17 ✓ 3 Snippets Yan XR, Shi T, Xiao JY, Liu YF, Zheng HL.
In-Text Gene Mentions

…like 1 (PLCL1).…

…for promoter ofPLCL1, the site…

…ThePLCL1could activate the…

Show Full Abstract

During mammary development, the transdifferentiation of mammary preadipocytes is one of the important sources for lactating mammary epithelial cells (MECs). However, there is limited knowledge about the mechanisms of dynamic regulation of transcriptome and genome-wide DNA methylation in the preadipocyte transdifferentiation process. Here, to gain more insight into these mechanisms, preadipocytes were isolated from adipose tissues from around the goat mammary gland (GM-preadipocytes). The GM-preadipocytes were cultured on Matrigel in conditioned media made from goat MECs to induce GM-preadipocyte-to-MEC transdifferentiation. The transdifferentiated GM-preadipocytes showed high abundance of keratin 18, which is a marker protein of MECs, and formed mammary acinar-like structures after 8 days of induction. Then, we performed transcriptome and DNA methylome profiling of the GM-preadipocytes and transdifferentiated GM-preadipocytes, respectively, and the differentially expressed genes and differentially methylated genes that play underlying roles in the process of transdifferentiation were obtained. Subsequently, we identified the candidate transcription factors in regulating the GM-preadipocyte-to-MEC transdifferentiation by transcription factor-binding motif enrichment analysis of differentially expressed genes and differentially methylated genes. Meanwhile, the secretory proteome of GM-preadipocytes cultured in conditioned media was also detected. By integrating the transcriptome, DNA methylome, and proteome, three candidate genes, four proteins, and several epigenetic regulatory axes were further identified, which are involved in regulation of the cell cycle, cell polarity establishment, cell adhesion, cell reprogramming, and adipocyte plasticity. These findings provide novel insights into the molecular mechanism of preadipocyte transdifferentiation and mammary development.

Also flagged:Cas9dCas9SALL1SDS3histone deacetylasenuclease
Journal Article 2022-10-17 ✓ 2 Snippets Mills C, Riching A, Keller A, Stombaugh J, Haupt A, Maksimova E, Dickerson SM, Anderson E, Hemphill K, Ebmeier C, Schiel JA, Levenga J, Perkett M, Smith AVB, Strezoska Z.
In-Text Gene Mentions

…1 (SALL1) andSin3a corepressor complex componentcorepressor complex component…

…RISPRi construct, dCas9-SALL1-SUDS3mRNA was co-delivered…

Show Full Abstract

While CRISPR interference (CRISPRi) systems have been widely implemented in pooled lentiviral screening, there has been limited use with synthetic guide RNAs for the complex phenotypic readouts enabled by experiments in arrayed format. Here we describe a novel deactivated Cas9 fusion protein, dCas9-SALL1-SDS3, which produces greater target gene repression than first or second generation CRISPRi systems when used with chemically modified synthetic single guide RNAs (sgRNAs), while exhibiting high target specificity. We show that dCas9-SALL1-SDS3 interacts with key members of the histone deacetylase and Swi-independent three complexes, which are the endogenous functional effectors of SALL1 and SDS3. Synthetic sgRNAs can also be used with <i>in vitro</i>-transcribed dCas9-SALL1-SDS3 mRNA for short-term delivery into primary cells, including human induced pluripotent stem cells and primary T cells. Finally, we used dCas9-SALL1-SDS3 for functional gene characterization of DNA damage host factors, orthogonally to small interfering RNA, demonstrating the ability of the system to be used in arrayed-format screening.

Also flagged:cirrhosis) infectionHCV infectionsinterferonantibodyHCV infection
Journal Article 2022-10-17 No Snippets Jiang X, Diaby V, Vouri SM, Lo-Ciganic W, Parker RL, Wang W, Chang SH, Wilson DL, Henry L, Park H.
Show Full Abstract

<h4>Introduction</h4>The objective of this study was to estimate the economic impact of providing universal hepatitis C virus testing in commercially insured middle-aged persons who inject drugs in the U.S.<h4>Methods</h4>This study developed a dynamic 10-year economic model to project the clinical and economic outcomes associated with hepatitis C virus testing among middle-aged adult persons who inject drugs, from a payer's perspective. Costs related to hepatitis C virus testing, direct-acting antiviral, and liver-related outcomes between the (1) current hepatitis C virus testing rate (i.e., 8%) and (2) universal hepatitis C virus testing rate (i.e., 100%) were compared. Among patients testing positive, 21% of those without cirrhosis and 48% of those with cirrhosis were assumed to initiate direct-acting antivirals. Sensitivity analyses were performed to identify variables (e.g., direct-acting antiviral drug costs, hepatitis C virus testing costs, direct-acting antiviral treatment rate) influencing this study's conclusion.<h4>Results</h4>The model predicts that during the 10-year period, universal hepatitis C virus testing will cost an additional $242 per person who injects drugs to the payers' healthcare budgets compared with the current scenario. Sensitivity analyses showed values ranging from $1,656 additional costs to $1,085 cost savings across all varied parameters and scenarios. A total of 80% of the current direct-acting antiviral costs indicated that cost savings will be $383 per person who injects drugs.<h4>Conclusions</h4>Universal hepatitis C virus testing among persons who inject drugs would not achieve cost savings within 10 years, with the cost of direct-acting antivirals contributing the most to the spending. To promote universal hepatitis C virus testing among persons who inject drugs, decreasing direct-acting antiviral costs and sustainable funding streams for hepatitis C virus testing should be considered.

Also flagged:oxygendeathretinal diseasesthioredoxinglutaredoxincysteines
Journal Article 2022-10-17 ✓ 2 Snippets Ren X, Léveillard T.
In-Text Gene Mentions

Interestingly, Akagi's group reported that Prdx5 and Prdx6 were the most expressed Prdx genes in rat retina among the 6 paralogues and overexpressing them protected pig retinal pericytes from high glucose-induced oxidative damage [127].

In a mouse model of Leber congenital amaurosis (LCA) after gene therapy with AAV-delivered RPE65, a proteomic study found PRDX6 was significantly upregulated among 39 other proteins.

Show Full Abstract

The human retina is facing a big challenge of reactive oxygen species (ROS) from endogenous and exogenous sources. Excessive ROS can cause damage to DNA, lipids, and proteins, triggering abnormal redox signaling, and ultimately lead to cell death. Thus, oxidative stress has been observed in inherited retinal diseases as a common hallmark. To counteract the detrimental effect of ROS, cells are equipped with various antioxidant defenses. In this review, we will focus on the antioxidant systems in the retina and how they can protect retina from oxidative stress. Both small antioxidants and antioxidant enzymes play a role in ROS removal. Particularly, the thioredoxin and glutaredoxin systems, as the major antioxidant systems in mammalian cells, exert functions in redox signaling regulation via modifying cysteines in proteins. In addition, the thioredoxin-like rod-derived cone viability factor (RdCVFL) and thioredoxin interacting protein (TXNIP) can modulate metabolism in photoreceptors and promote their survival. In conclusion, elevating the antioxidant capacity in retina is a promising therapy to curb the progress of inherited retinal degeneration.

Also flagged:neurological diseasestransductiontranscription factorsgene expressionneurogenesisneuroglobin
Journal Article 2022-10-17 ✓ 1 Snippet Clark IH, Roman A, Fellows E, Radha S, Var SR, Roushdy Z, Borer SM, Johnson S, Chen O, Borgida JS, Steevens A, Shetty A, Strell P, Low WC, Grande AW.
In-Text Gene Mentions

Huntington’s Disease (HD) is an autosomal dominant disease caused by a mutation in the gene encoding the huntingtin protein (HTT).

Show Full Abstract

A persistent barrier to the cure and treatment of neurological diseases is the limited ability of the central and peripheral nervous systems to undergo neuroregeneration and repair. Recent efforts have turned to regeneration of various cell types through cellular reprogramming of native cells as a promising therapy to replenish lost or diminished cell populations in various neurological diseases. This review provides an in-depth analysis of the current viral vectors, genes of interest, and target cellular populations that have been studied, as well as the challenges and future directions of these novel therapies. Furthermore, the mechanisms by which cellular reprogramming could be optimized as treatment in neurological diseases and a review of the most recent cellular reprogramming in vitro and in vivo studies will also be discussed.

Also flagged:MyogenesisCell AdhesionImmunoglobulin-like cell adhesion moleculeglycosylphosphatidylinositol-anchored membrane proteinmembranecell-to-
Journal Article 2022-10-17 ✓ 2 Snippets Lim JH, Ahmad K, Chun HJ, Hwang YC, Qadri AF, Ali S, Ahmad SS, Shaikh S, Choi J, Kim J, Jin JO, Kim M, Han SS, Choi I, Lee EJ.
In-Text Gene Mentions

…brane protein (LSAMP), IgLON4-neuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1), and IgLON5.…

Show Full Abstract

Immunoglobulin-like cell adhesion molecule (IgLON4) is a glycosylphosphatidylinositol-anchored membrane protein that has been associated with neuronal growth and connectivity, and its deficiency has been linked to increased fat mass and low muscle mass. Adequate information on IgLON4 is lacking, especially in the context of skeletal muscle. In this study, we report that IgLON4 is profusely expressed in mouse muscles and is intensely localized on the cell membrane. IgLON4 expression was elevated in CTX-injected mouse muscles, which confirmed its role during muscle regeneration, and was abundantly expressed at high concentrations at cell-to-cell adhesion and interaction sites during muscle differentiation. IgLON4 inhibition profoundly affected myotube alignment, and directional analysis confirmed this effect. Additionally, results demonstrating a link between IgLON4 and lipid rafts during myogenic differentiation suggest that IgLON4 promotes differentiation by increasing lipid raft accumulation. These findings support the notion that a well-aligned environment promotes myoblast differentiation. Collectively, IgLON4 plays a novel role in myogenesis and regeneration, facilitates myotube orientation, and is involved in lipid raft accumulation.

Also flagged:cancerRAF-kinase inhibitor proteinRKIPtumourtranslationaltumours
Journal Article 2022-10-17 No Snippets Papale M, Netti GS, Stallone G, Ranieri E.
Show Full Abstract

One of the most dangerous aspects of cancer cell biology is their ability to grow, spread and form metastases in the main vital organs. The identification of dysregulated markers that drive intracellular signalling involved in the malignant transformation of neoplastic cells and the understanding of the mechanisms that regulate these processes is undoubtedly a key objective for the development of new and more targeted therapies. RAF-kinase inhibitor protein (RKIP) is an endogenous tumour suppressor protein that affects tumour cell survival, proliferation, and metastasis. RKIP might serve as an early tumour biomarker since it exhibits significantly different expression levels in various cancer histologies and it is often lost during metastatic progression. In this review, we discuss the specific impact of transcriptional, post-transcriptional and post-translational regulation of expression and activation/inhibition of RKIP and focus on those tumours for which experimental data on all these factors are available. In this way, we could select how these processes cooperate with RKIP expression in (1) Lung cancer; (2) Colon cancer, (3) Breast cancer; (4) myeloid neoplasm and Multiple Myeloma, (5) Melanoma and (6) clear cell Renal Cell Carcinoma. Furthermore, since RKIP seems to be a key marker of the development of several tumours and it may be assessed easily in various biological fluids, here we discuss the potential role of RKIP dosing in more accessible biological matrices other than tissues. Moreover, this objective may intercept the still unmet need to identify new and more accurate markers for the early diagnosis and prognosis of many tumours.

Also flagged:cognitive impairmentneurological disordersACEDementiaADR
Journal Article 2022-10-17 ✓ 5 Snippets Cao LX, Wang G, Guo QH, Zhang W, Bak T, Huang Y.
In-Text Gene Mentions

ACE-IIIis also scored…

…et al. verifiedACE-IIIwith satisfactory sensitivity…

…stages of AD,ACE-IIIhas been used…

…reasonable proportion inACE-III.…

ACE-IIIhas been proven…

Show Full Abstract

Addenbrooke's cognitive examination (ACE) is a cognitive screening tool that has developed through three stages: ACE, ACE-Revised (ACE-R), and ACE-Ⅲ. In addition, mini-Addenbrooke's Cognitive Examination (M-ACE) and ACE mobile are the additional versions that is derived from ACE-III. ACE and its related versions show better performance than Mini-Mental State Examination (MMSE) and Montreal Cognitive Assessment (MoCA) in detecting mild cognitive impairment in different neurological disorders. It has been translated into numerous languages, including Chinese. Through reviewing the history, validity, and comparison with other cognitive tests of Chinese versions of ACE, it aims to facilitate the clinical and scientific use, further development, improvement, and validation of Chinese versions of ACE in various neurological disorders and ultimately promote early identification and management of cognitive impairment in China.

Also flagged:HuntingtinoligonucleotidesHDneurodegenerative disorderchoreadystonia
Journal Article 2022-10-17 ✓ 3 Snippets Riccardi C, D'Aria F, Fasano D, Digilio FA, Carillo MR, Amato J, De Rosa L, Paladino S, Melone MAB, Montesarchio D, Giancola C.
In-Text Gene Mentions

… Center (Bloomington, IN, USA): w*; P{UAS-HTT.128Q.FL}f27b-8765 P{w[+mW.hs]=GawB}elav[C155].3.1…

…the wild-type huntingtin (HTT) protein.…

…encoding a mutatedHTTprotein (mHTT) containing…

Show Full Abstract

Two analogues of the MS3 aptamer, which was previously shown to have an exquisite capability to selectively bind and modulate the activity of mutant huntingtin (mHTT), have been here designed and evaluated in their physicochemical and biological properties. Featured by a distinctive propensity to form complex G-quadruplex structures, including large multimeric aggregates, the original 36-mer MS3 has been truncated to give a 33-mer (here named MS3-33) and a 17-mer (here named MS3-17). A combined use of different techniques (UV, CD, DSC, gel electrophoresis) allowed a detailed physicochemical characterization of these novel G-quadruplex-forming aptamers, tested in vitro on SH-SY5Y cells and in vivo on a <i>Drosophila</i> Huntington's disease model, in which these shorter MS3-derived oligonucleotides proved to have improved bioactivity in comparison with the parent aptamer.

Also flagged:β-globinfetal hemoglobinγ-globintranslationalSCDsickle cell anemia
Journal Article 2022-10-17 No Snippets Cyrus C, Vatte C, Al-Nafie A, Chathoth S, Akhtar MS, Darwish M, Almohazey D, AlDubayan SH, Steinberg MH, Al-Ali A.
Show Full Abstract

<i>Background and Objectives</i>: Sickle cell anemia (SCA) is a hereditary monogenic disease due to a single β-globin gene mutation that codes for the production of sickle hemoglobin. Its phenotype is modulated by fetal hemoglobin (HbF), a product of γ-globin genes. Exploring the molecules that regulate γ-globin genes at both transcriptional and translational levels, including microRNA (miRNA), might help identify alternative therapeutic targets. <i>Materials and Methods</i>: Using next-generation sequencing we identified pre-miRNAs and mature miRNA expression signatures associated with different HbF levels in patients homozygous for the sickle hemoglobin gene. The involvement of identified miRNAs in potential SCD-related pathways was investigated with the DIANA TOOL and miRWalk 2.0 database. <i>Results</i>: miR-184 were most highly upregulated in reticulocytes. miR-3609 and miR-483-5p were most highly downregulated in sickle cell anemia with high HbF. miR-370-3p that regulates LIN28A, and miR-451a which is effective in modulating α- and β- globin levels were also significantly upregulated. miRNA targeted gene pathway interaction identified BCL7A, BCL2L1, LIN28A, KLF6, GATA6, solute carrier family genes and ZNF genes associated with erythropoiesis, cell cycle regulation, glycosphingolipid biosynthesis, cAMP, cGMP-PKG, mTOR, MAPK and PI3K-AKT signaling pathways and cancer pathways. <i>Conclusions</i>: miRNA signatures and their target genes identified novel miRNAs that could regulate fetal hemoglobin production and might be exploited therapeutically.

Also flagged:G (VP7VP4RVAoutercapsid
Journal Article 2022-10-17 No Snippets Patić A, Vuković V, Kovačević G, Petrović V, Ristić M, Djilas M, Knežević P, Pustahija T, Štrbac M, Djekić Malbaša J, Rajčević S, Hrnjaković Cvjetković I.
Show Full Abstract

Rotaviruses (RV) are the leading cause of gastroenteritis in infants, young children, and adults, responsible for serious disease burden. In the period 2012-2018, a cross-sectional study was conducted using stool samples collected from patients with acute gastroenteritis from Vojvodina, Serbia. We described age and gender distribution, as well as seasonal patterns of RV prevalence. Out of 1853 included stool samples, RV was detected in 29%. Hospitalized children between 1-2 years old were especially affected by RV infection (45%). The highest prevalence of infection was observed during the colder, winter/spring months. We compared sequenced representative G and P genotypes circulating in Serbia with vaccine strains and determined their genetic similarity. Genotype combination G2P[4] was the most prevalent (34.6%), followed by G2P[8] (24.1%) and G1P[8] (21.1%). Given that several epitopes were conserved, neutralization motifs among circulating strains can be characterized as sufficiently matching vaccine strains Rotarix™ and RotaTeq™, but existing antigenic disparities should not be overlooked. The present results contribute to a better insight into the prevalence of rotavirus infection in our region and point out the need for epidemiological surveillance of rotaviruses before the introduction of vaccines. These data can help formulate future vaccine strategies in Serbia.

Also flagged:Nipecotic Acidneurodegenerative disordercognitive impairmentAcetylcholinesteraseADethyl
Journal Article 2022-10-17 No Snippets Papagiouvannis G, Theodosis-Nobelos P, Rekka EA.
Show Full Abstract

Alzheimer's Disease (AD) is a common neurodegenerative disorder characterized by memory loss and cognitive impairment. Its pathology has not been fully clarified and therefore highly effective treatments have not been obtained yet. Almost all the current treatment options aim to alleviate only the symptoms and not to eliminate the disease itself. Acetylcholinesterase inhibitors are the main therapeutic agents against AD, whereas oxidative stress and inflammation have been found to be of great significance for the development and progression of neurodegeneration. In this work, ethyl nipecotate (ethyl-piperidine-3-carboxylate), a heterocyclic carboxylic acid derivative, which acts as a GABA reuptake inhibitor and has been used in research for diseases involving GABAergic neurotransmission dysfunction, was amidated with various carboxylic acids bearing antioxidant and/or anti-inflammatory properties (e.g., ferulic acid, sinapic acid, butylated hydroxycinnamic acid). Most of our compounds have significant antioxidant potency as lipid peroxidation inhibitors (IC<sub>50</sub> as low as 20 μΜ), as oxidative protein glycation inhibitors (inhibition up to 57%), and act as DPPH reducing agents. Moreover, our compounds are moderate LOX inhibitors (up to 33% at 100 μΜ) and could reduce rat paw edema induced by carrageenan by up to 61%. Finally, some of them possessed inhibitory activity against acetylcholinesterase (IC<sub>50</sub> as low as to 47 μΜ). Our results indicate that our compounds could have the potentiality for further optimization as multi-targeting agents directed against AD.

Also flagged:gene expressionRituximabtogene expressionsPolysaccharideimmune responses
Journal Article 2022-10-17 No Snippets Xue S, Rogers LRK, Zheng M, He J, Piermarocchi C, Mias GI.
Show Full Abstract

Differential Network (DN) analysis is a method that has long been used to interpret changes in gene expression data and provide biological insights. The method identifies the rewiring of gene networks in response to external perturbations. Our study applies the DN method to the analysis of RNA-sequencing (RNA-seq) time series datasets. We focus on expression changes: (i) in saliva of a human subject after pneumococcal vaccination (PPSV23) and (ii) in primary B cells treated <i>ex vivo</i> with a monoclonal antibody drug (Rituximab). The DN method enabled us to identify the activation of biological pathways consistent with the mechanisms of action of the PPSV23 vaccine and target pathways of Rituximab. The community detection algorithm on the DN revealed clusters of genes characterized by collective temporal behavior. All saliva and some B cell DN communities showed characteristic time signatures, outlining a chronological order in pathway activation in response to the perturbation. Moreover, we identified early and delayed responses within network modules in the saliva dataset and three temporal patterns in the B cell data.

Also flagged:meniscus tearsposttraumatic osteoarthritispathogenesisOAmeniscus injuriesimmune response
Journal Article 2022-10-17 ✓ 2 Snippets Xiao X, Yang X, Ren S, Meng C, Yang Z.
In-Text Gene Mentions

…GSN, ORC1, TLN2,SOX6, NKD2 and ADAMTS19),…

…mRNAs, GSN, ORC1,SOX6, NKD2 and ADAMTS19…

Show Full Abstract

<b>Background:</b> Despite ample evidence demonstrating that anterior cruciate ligament (ACL) and meniscus tears are associated with posttraumatic osteoarthritis (PTOA) development, the contributing factors remain unknown. Synovial inflammation has recently been recognized as a pivotal factor in the pathogenesis of OA. However, there is a lack of data on synovial profiles after ACL or meniscus injuries, which may contribute to PTOA. <b>Methods:</b> Twelve patients with ACL tears and/or meniscus injuries were recruited. During surgery, synovial tissues were obtained from the injured knees. The inflammation status of the synovium was characterized according to macroscopic criteria and histological synovitis grades. Then the synovial tissues were classified as control group or inflamed group. High-throughput RNA sequencing of the synovial samples (3 vs. 3) was conducted to identify differentially expressed (DE) RNAs. Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, and protein-protein interaction (PPI) analyses were performed to investigate DE mRNAs. Next, competing endogenous RNA (ceRNA) networks were constructed based on bioinformatics analyses. Associations of the identified DE genes (DEGs) with infiltrating immune cells were explored using Pearson correlation analysis. <b>Results:</b> The results showed that 2793 mRNAs, 3392 lncRNAs and 211 miRNAs were significantly DE between two groups. The top 3 significantly upregulated GO terms and KEGG pathways were immune response, adaptive immune response and immune system process, systemic lupus erythematosus, haematopoietic cell lineage and cytokine-cytokine receptor interaction, respectively. In PPI networks, the top 10 hub genes were IL6, CCR7, C3, CCR5, CXCR3, CXCL8, IL2, CCR3, CCR2 and CXCL1. Seven mRNAs (EPHA5, GSN, ORC1, TLN2, SOX6, NKD2 and ADAMTS19), 4 lncRNAs (MIR4435-2HG, TNXA, CEROX1 and TMEM92-AS1) and 3 miRNAs (miR-486-5p, miR-199a-3p and miR-21-3p) were validated by quantitative real-time polymerase chain reaction and sub-networks were constructed. In correlation analysis, MMP9 correlated positively with M0 macrophages and plasma cells, NKD2 positively with CD8 T cells, and CCR7 and IL2RB positively with naive B cells. <b>Conclusion:</b> Our study provides foundational synovial inflammation profiles following knee trauma. The ceRNA and PPI networks provide new insight into the biological processes and underlying mechanisms of PTOA. The differential infiltration profiles of immune cells in synovium may contribute to PTOA development. This study also highlights immune-related DEGs as potential PTOA treatment biomarkers.

Also flagged:systemic lupus erythematosusSLEgene expressionnephritispathogenesisIRS1
Journal Article 2022-10-17 No Snippets Elghzaly AA, Sun C, Looger LL, Hirose M, Salama M, Khalil NM, Behiry ME, Hegazy MT, Hussein MA, Salem MN, Eltoraby E, Tawhid Z, Alwasefy M, Allam W, El-Shiekh I, Elserafy M, Abdelnaser A, Hashish S, Shebl N, Shahba AA, Elgirby A, Hassab A, Refay K, El-Touchy HM, Youssef A, Shabacy F, Hashim AA, Abdelzaher A, Alshebini E, Fayez D, El-Bakry SA, Elzohri MH, Abdelsalam EN, El-Khamisy SF, Ibrahim S, Ragab G, Nath SK.
Show Full Abstract

Systemic lupus erythematosus (SLE) susceptibility has a strong genetic component. Genome-wide association studies (GWAS) across trans-ancestral populations show both common and distinct genetic variants of susceptibility across European and Asian ancestries, while many other ethnic populations remain underexplored. We conducted the first SLE GWAS on Egyptians-an admixed North African/Middle Eastern population-using 537 patients and 883 controls. To identify novel susceptibility loci and replicate previously known loci, we performed imputation-based association analysis with 6,382,276 SNPs while accounting for individual admixture. We validated the association analysis using adaptive permutation tests (<i>n</i> = 10<sup>9</sup>). We identified a novel genome-wide significant locus near <i>IRS1/miR-5702</i> (P<sub>corrected</sub> = 1.98 × 10<sup>-8</sup>) and eight novel suggestive loci (P<sub>corrected</sub> < 1.0 × 10<sup>-5</sup>). We also replicated (P<sub>perm</sub> < 0.01) 97 previously known loci with at least one associated nearby SNP, with <i>ITGAM, DEF6-PPARD</i> and <i>IRF5</i> the top three replicated loci. SNPs correlated (<i>r</i> <sup>2</sup> > 0.8) with lead SNPs from four suggestive loci (<i>ARMC9, DIAPH3</i>, <i>IFLDT1,</i> and <i>ENTPD3</i>) were associated with differential gene expression (3.5 × 10<sup>-95</sup> < <i>p</i> < 1.0 × 10<sup>-2</sup>) across diverse tissues. These loci are involved in cellular proliferation and invasion-pathways prominent in lupus and nephritis. Our study highlights the utility of GWAS in an admixed Egyptian population for delineating new genetic associations and for understanding SLE pathogenesis.

Also flagged:HPGDSlipidmetabolismcancerLUADGene Expression
Journal Article 2022-10-17 ✓ 2 Snippets Shao F, Mao H, Luo T, Li Q, Xu L, Xie Y.
In-Text Gene Mentions

…PPARG, ALOX15, ALOX5,PTGIS, PTGES, HPGDS, PLA2G1B,…

…LPL, CYP4F3 andPTGIS( Figure 4E…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is the most common respiratory globallywith a poor prognosis. Lipid metabolism is extremely important for the occurrence and development of cancer. However, the role of genes involved in lipid metabolism in LUAD development is unclear. We aimed to identify the abnormal lipid metabolism pathway of LUAD, construct a novel prognostic model of LUAD, and discover novel biomarkers involved in lipid metabolism in LUAD.<h4>Methods</h4>Based on differentially expressed genes involved in lipid metabolism in LUAD samples from The Cancer Genome Atlas (TCGA), abnormal lipid metabolism pathways in LUAD were analyzed. The lasso penalized regression analysis was performed on the TCGA cohort (training set) to construct a risk score formula. The predictive ability of the risk score was validated in the Gene Expression Omnibus (GEO) dataset (validation set) using Kaplan-Meier analysis and ROC curves. Finally, based on CRISPR gene editing technology, hematopoietic prostaglandin D synthase (HPGDS) was knocked out in A549 cell lines, the changes in lipid metabolism-related markers were detected by western blotting, and the changes in cell migration were detected by transwell assay.<h4>Results</h4>Based on the differential genes between lung cancer tissue and normal tissue, we found that the arachidonic acid metabolism pathway is an abnormal lipid metabolism pathway in both lung adenocarcinoma and lung squamous cell carcinoma. Based on the sample information of TCGA and abnormally expressed lipid metabolism-related genes, a 9-gene prognostic risk score was successfully constructed and validated in the GEO dataset. Finally, we found that knockdown of HPGDS in A549 cell lines promoted lipid synthesis and is more invasive than in control cells. Rescue assays showed that ACSL1 knockdown reversed the pro-migration effects of HPGDS knockdown. The knockdown of HPGDS promoted migration response by upregulating the expression of the lipid metabolism key enzymes ACSL1 and ACC.<h4>Conclusion</h4>The genes involved in lipid metabolism are associated with the occurrence and development of LUAD. HPGDS can be a therapeutic target of a potential lipid metabolism pathway in LUAD, and the therapeutic target of lipid metabolism genes in LUAD should be studied further.

Also flagged:atrial fibrillationhypertensionangiotensin receptorneprilysinmetabolismcyclic
Journal Article 2022-10-17 ✓ 2 Snippets Fang Q, Wang J, Wei J, Long X, Wang Y, He J, Yuan X, Du J.
In-Text Gene Mentions

…including Hadha, Hadhb,Eci2, and Acadl…

…Hadhb , andEci2, the top…

Show Full Abstract

Left atrial remodeling, characterized by enlargement and hypertrophy of the left atrium and increased fibrosis, was accompanied by an increased incidence of atrial fibrillation. While before morphological changes at the early stage of hypertension, how overloaded hypertension influences the transcriptomic profile of the left atrium remains unclear. Therefore, RNA-sequencing was performed to define the RNA expressing profiles of left atrium in spontaneously hypertensive rats (SHRs) and normotensive Wistar-Kyoto (WKY) rats as a control group. We also compared the changes in the RNA expression profiles in SHRs treated with an angiotensin receptor blocker (ARB) and angiotensin receptor-neprilysin inhibitor (ARNI) to assess the distinct effects on the left atrium. In total, 1,558 differentially expressed genes were found in the left atrium between WKY rats and SHRs. Bioinformatics analysis showed that these mRNAs could regulate upstream pathways in atrial remodeling through atrial fibrosis, inflammation, electrical remodeling, and cardiac metabolism. The regulated transcripts detected in the left atrial tissue in both the ARB-treated and ARNI-treated groups were related to metabolism. In contrast to the ARB-treated rates, the transcripts in ARNI-treated rats were mapped to the cyclic guanosine monophosphate-protein kinase G signaling pathway.

Also flagged:sexually transmitted infectionsSTIsNeutrophil activationurethral infection-evasion proteinscell–cell adhesion proteins
Journal Article 2022-10-17 ✓ 1 Snippet Chigorimbo-Murefu NTL, Potgieter M, Dzanibe S, Gabazana Z, Buri G, Chawla A, Nleya B, Olivier AJ, Harryparsad R, Calder B, Garnett S, Maziya L, Lewis DA, Jaspan H, Wilson D, Passmore JS, Mulder N, Blackburn J, Bekker LG, Gray CM.
In-Text Gene Mentions

…tensities of peroxiredoxin-6 (PRDX6, P30041 ), PYCARD…

Show Full Abstract

There is limited data on the role of asymptomatic STIs (aSTIs) on the risk of human immunodeficiency virus (HIV) acquisition in the male genital tract (MGT). The impact of foreskin removal on lowering HIV acquisition is well described, but molecular events leading to HIV acquisition are unclear. Here, in this pilot study, we show that asymptomatic urethral infection with <i>Chlamydia trachomatis</i> (CT) significantly impacts the foreskin proteome composition. We developed and optimized a shotgun liquid chromatography coupled tandem mass spectrometry (MS)-based proteomics approach and utilized this on foreskins collected at medical male circumcision (MMC) from 16 aSTI<sup>+</sup> men and 10 age-matched STI- controls. We used a novel bioinformatic metaproteomic pipeline to detect differentially expressed (DE) proteins. Gene enrichment ontology analysis revealed proteins associated with inflammatory and immune activation function in both inner and outer foreskin from men with an aSTI. Neutrophil activation/degranulation and viral-evasion proteins were significantly enriched in foreskins from men with aSTI, whereas homotypic cell-cell adhesion proteins were enriched in foreskin tissue from men without an aSTI. Collectively, our data show that asymptomatic urethral sexually transmitted infections result in profound alterations in epithelial tissue that are associated with depletion of barrier integrity and immune activation.

Also flagged:autoantibodiessystemic diseaseRosicca syndromelymphomaSSA
Journal Article 2022-10-17 No Snippets Vílchez-Oya F, Balastegui Martin H, García-Martínez E, Corominas H.
Show Full Abstract

Sjögren's syndrome (SjS) is a heterogeneous systemic disease. The abnormal responses to La/SSB and Ro/SSA of both B-cells and T-cells are implicated as well as others, in the destruction of the epithelium of the exocrine glands, whose tissue characteristically shows a peri-epithelial lymphocytic infiltration that can vary from sicca syndrome to systemic disease and lymphoma. Despite the appearance of new autoantibodies, anti-Ro/SSA is still the only autoantibody included in the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) classification criteria and is used extensively as a traditional biomarker in clinical practice. The study and findings of new autoantibodies in SjS has risen in the previous decade, with a central role given to diagnosis and elucidating new aspects of SjS physiopathology, while raising the opportunity to establish clinical phenotypes with the goal of predicting long-term complications. In this paper, we critically review the classic and the novel autoantibodies in SjS, analyzing the methods employed for detection, the pathogenic role and the wide spectrum of clinical phenotypes.

Also flagged:systemic lupus erythematosusSLEantinuclear antibodiespathogenesisautoimmune diseaseschronic autoimmune disease
Journal Article 2022-10-17 No Snippets Liang J, Xie F, Feng J, Huang C, Shen J, Han Z, Luo W, He J, Chen H.
Show Full Abstract

The diagnosis and differential classification of systemic lupus erythematosus (SLE) is difficult, especially in patients with early-onset SLE who are susceptible to systemic multi-organ damage and serious complications and have difficulties in individualized treatment. At present, diagnosis is based mainly on clinical manifestations and the detection of serological antinuclear antibodies. The pathogenesis of SLE involves multiple factors, is clinically heterogeneous, and lacks specific biomarkers. Therefore, it is necessary to identify new biomarkers for the diagnosis and subtype classification of SLE. Non-coding RNAs (ncRNAs) are composed of microRNAs, long non-coding RNAs, small nucleolar RNAs, circular RNAs, and transfer RNAs. They play an important role in the occurrence and development of diseases and are used widely in the early diagnosis and prognosis of autoimmune diseases. In this review, we focus on the research progress in the diagnosis and prognostic assessment of SLE using humoral to tissue level ncRNAs.

Also flagged:interferonchronic hepatitisChronic hepatitis Bhepatocellular carcinomapathogenesisInterferons
Journal Article 2022-10-17 ✓ 1 Snippet Yang Z, Sun B, Xiang J, Wu H, Kan S, Hao M, Chang L, Liu H, Wang D, Liu W.
In-Text Gene Mentions

…(GBP2, PVRL4, CBFβ,TRIM38, TRIM5γ, TRIM25, and…

Show Full Abstract

Human hepatitis B virus (HBV) is a small, enveloped DNA virus that causes acute and chronic hepatitis. Chronic hepatitis B (CHB) is associated with hepatocellular carcinoma pathogenesis. Interferons (IFNs) have been used for the treatment of CHB for a long time, with advantages including less treatment duration and sustained virological response. Presently, various evidence suggests that epigenetic modification of the viral covalently closed circular DNA (cccDNA) and the host genome is crucial for the regulation of viral activity. This modification includes histone acetylation, DNA methylation, N6-methyladenosine, and non-coding RNA modification. IFN treatment for CHB can stimulate multiple IFN-stimulated genes for inhibiting virus replication. IFNs can also affect the HBV life cycle through epigenetic modulation. In this review, we summarized the different mechanisms through which IFN-α inhibits HBV replication, including epigenetic regulation. Moreover, the mechanisms underlying IFN activity are discussed, which indicated its potential as a novel treatment for CHB. It is proposed that epigenetic changes such as histone acetylation, DNA methylation, m6A methylation could be the targets of IFN, which may offer a novel approach to HBV treatment.

Also flagged:3,4-methylenedioxymethamphetamineecstasyliver failurehepatitisinjuryAcute Hepatic Injury
Journal Article 2022-10-17 ✓ 1 Snippet Sharma NR, Sharma B, Lamichhane S, Pokhrel M, Gautam S.
In-Text Gene Mentions

…hepatitis, Wilson's disease,hemochromatosis, and autoimmune hepatitis.…

Show Full Abstract

The recreational use of a drug such as 3,4-methylenedioxymethamphetamine (MDMA), also known as "ecstasy," may be associated with significant side effects. Although liver failure with ecstasy is rare, the use of the drug should be investigated in all patients with severe hepatitis of unknown origin. Early diagnosis and intervention can prevent patients from ending up in liver transplantation. Here, we present a case of a 27-year-old female who developed acute liver injury secondary to recreational intoxication with ecstasy.

Also flagged:OCT4SOX2KLF4infectiongene expressionLMYC
Journal Article 2022-10-17 No Snippets Kunitomi A, Hirohata R, Arreola V, Osawa M, Kato TM, Nomura M, Kawaguchi J, Hara H, Kusano K, Takashima Y, Takahashi K, Fukuda K, Takasu N, Yamanaka S.
Show Full Abstract

Naive human induced pluripotent stem cells (iPSCs) can be generated by reprogramming somatic cells with Sendai virus (SeV) vectors. However, only dermal fibroblasts have been successfully reprogrammed this way, and the process requires culture on feeder cells. Moreover, SeV vectors are highly persistent and inhibit subsequent differentiation of iPSCs. Here, we report a modified SeV vector system to generate transgene-free naive human iPSCs with superior differentiation potential. The modified method can be applied not only to fibroblasts but also to other somatic cell types. SeV vectors disappear quickly at early passages, and this approach enables the generation of naive iPSCs in a feeder-free culture. The naive iPSCs generated by this method show better differentiation to trilineage and extra-embryonic trophectoderm than those derived by conventional methods. This method can expand the application of iPSCs to research on early human development and regenerative medicine.

Also flagged:keratinizationextracellularangiogenesisendothelial dysfunctionsystemic sclerosis vasculopathysystemic sclerosis
Journal Article 2022-10-17 No Snippets Spinella A, Lo Tartaro D, Gibellini L, de Pinto M, Pinto V, Bonetti E, Lolli F, Lattanzi M, Lumetti F, Amati G, De Santis G, Cossarizza A, Salvarani C, Giuggioli D.
Show Full Abstract

<h4>Objective</h4>Systemic sclerosis is characterized by endothelial dysfunction, autoimmunity abnormalities, and fibrosis of the skin and internal organs. The pathogenetic mechanisms underlying systemic sclerosis vasculopathy are still not clarified. A complex cellular and extracellular network of interactions has been studied, but it is currently unclear what drives the activation of fibroblasts/myofibroblasts and the extracellular matrix deposition.<h4>Methods</h4>Using RNA sequencing, the aim of the work was to identify potential functional pathways implied in systemic sclerosis pathogenesis and markers of endothelial dysfunction and fibrosis in systemic sclerosis patients. RNA-sequencing analysis was performed on RNA obtained from biopsies from three systemic sclerosis patients and three healthy controls enrolled in our University Hospital. RNA was used to generate sequencing libraries that were sequenced according to proper transcriptomic analyses. Subsequently, we performed gene set enrichment analysis of differentially expressed genes on the entire list of genes that compose the RNA-sequencing expression matrix.<h4>Results</h4>Gene set enrichment analysis revealed that healthy controls were characterized by gene signatures related to stromal stem cells proliferation, cytokine-cytokine receptor interaction, macrophage-enriched metabolic network, whereas systemic sclerosis tissues were enriched in signatures associated with keratinization, cornification, retinoblastoma 1 and tumor suppressor 53 signaling.<h4>Conclusion</h4>According to our data, RNA-sequencing and pathway analysis revealed that systemic sclerosis subjects display a discrete pattern of gene expression associated with keratinization, extracellular matrix generation, and negative regulation of angiogenesis and stromal stem cells proliferation. Further analysis on larger numbers of patients is needed; however, our findings provide an interesting framework for the development of biomarkers useful to explore potential future therapeutic approaches.

Also flagged:fatty acidsmetabolismredox homeostasisfatty acidethanolstarch
Journal Article 2022-10-17 ✓ 1 Snippet Baldassini W, Gagaoua M, Santiago B, Rocha L, Torrecilhas J, Torres R, Curi R, Neto OM, Padilha P, Santos F, Lanna DP, Chardulo LA.
In-Text Gene Mentions

…stress (PARK7 andPRDX6), and proteolysis (CAPN1)…

Show Full Abstract

Wet distiller grains (WDG) are a corn by-product rich in protein and fiber that can be used in feedlot diets. This study evaluated F1 Angus-Nellore bulls fed on a control diet vs. WDG (<i>n</i> = 25/treatment). After a period of 129 days on these feeds, the animals were slaughtered and <i>Longissimus</i><i>thoracis</i> samples were collected for both a meat quality evaluation and gel-based proteomic analyses. A greater ribeye area (99.47 cm²) and higher carcass weight (333.6 kg) (<i>p</i> < 0.05) were observed in the WDG-finished cattle compared to the control (80.7 cm²; 306.3 kg). Furthermore, there were differences (<i>p</i> < 0.05) in the intramuscular fat between the WDG and control animals (IMF = 2.77 vs. 4.19%), which led to a significant decrease (<i>p</i> < 0.05) in saturated fatty acids (FA). However, no differences (<i>p</i> > 0.10) were observed in terms of tenderness, evaluated using Warner-Bratzler shear force (WBSF). The proteomic and bioinformatic analyses revealed substantial changes in the biological processes, molecular functions, and cellular components of the WDG-finished cattle compared to the control. Proteins related to a myriad of interconnected pathways, such as contractile and structural pathways, energy metabolism, oxidative stress and cell redox homeostasis, and transport and signaling. In this experiment, the use of WDG supplementation influenced the protein expression of several proteins, some of which are known biomarkers of beef quality (tenderness and color), as well as the protein-protein interactions that can act as the origins of increases in muscle growth and reductions in IMF deposition. However, despite the effects on the proteome, the tenderness, evaluated by WBSF, and fatty acid profile were not compromised by WDG supplementation.

Also flagged:acute rejectionG1-phasemetabolismimmune responselymphocyte activationIL-15
Journal Article 2022-10-17 No Snippets McDaniels JM, Shetty AC, Rousselle TV, Bardhi E, Maluf DG, Mas VR.
Show Full Abstract

Despite recent advances made in short-term outcomes; minimal improvements have been observed in long-term kidney transplantation outcomes. Due to an imbalance between organ transplant availability and patient waiting list, expanding kidney allograft longevity is a critical need in the field. Prior studies have either focused on early ischemic and immunological conditions affecting kidney allografts (e.g., delayed graft function, acute rejection) or late stage chronic injury when interventions are no longer feasible. However, studies characterizing kidney allografts with normal function by its cellular distribution, cell-cell interactions, and associated molecular pathways are lacking. Herein, we used single nuclei RNA-sequencing to uncover the cellular landscape and transcriptome of the normal kidney allograft. We profiled 40,950 nuclei from seven human kidney biopsies (normal native, <i>N</i> = 3; normal allograft, <i>N</i> = 4); normal allograft protocol biopsies were collected ≥15-months post-transplant. A total of 17 distinct cell clusters were identified with proximal tubules (25.70 and 21.01%), distal tubules (15.22 and 18.20%), and endothelial cells (EC) (4.26 and 9.94%) constituting the major cell populations of normal native and normal allograft kidneys, respectively. A large proportion of cycling cells from normal native kidneys were in G1-phase (43.96%) whereas cells from normal allograft were predominantly in S-phase (32.69%). This result suggests that transcriptional differences between normal native and normal allograft biopsies are dependent on the new host environment, immunosuppression, and injury-affliction. In the normal allograft, EC-specific genes upregulated metabolism, the immune response, and cellular growth, emphasizing their role in maintaining homeostasis during the ongoing alloreactive stress response. Immune cells, including B (2.81%), macrophages (24.96%), monocytes (15.29%), natural killer (NK) (12.83%), neutrophils (8.44%), and T cells (14.41%, were increased in normal allografts despite lack of histological or clinical evidence of acute rejection. Phenotypic characterization of immune cell markers supported lymphocyte activation and proinflammatory cytokines signaling pathways (i.e., <i>IL-15, IL-32</i>). The activation of B, NK, and T cells reveals potential immune cells underlying subclinical inflammation and repair. These single nuclei analyses provide novel insights into kidney and immune cell associated signaling pathways that portray kidney grafts with normal allograft function beyond 2-years post-transplant, revealing a novel perspective in understanding long-term allograft graft survival.

bioRxiv 2022-10-17 Preprint (No Snippets API) Chaudhari K, Zhang K, Yam PT, Zang Y, Kramer DA, Schlienger S, Calabretta S, Collins M, Srour M, Chen B, Charron F, Bashaw GJ.
Show Full Abstract

<h4>SUMMARY</h4> The axon guidance cue, Netrin-1, signals through its receptor DCC to attract commissural axons to the midline. Pathogenic variants in DCC frequently lead to congenital mirror movements (CMM), but how these variants impact DCC function is largely unknown. Screening of DCC in individuals with CMM recently revealed a novel variant located in a conserved motif in the cytoplasmic tail of DCC that is predicted to bind to a central actin nucleation promoting factor, the WAVE regulatory complex (WRC). Here, we use biochemical and axon guidance assays to show that this CMM-associated DCC variant is pathogenic by disrupting the interaction between DCC and the WRC. This DCC-WRC interaction is evolutionarily conserved and is required for Netrin-1 mediated commissural axon outgrowth and guidance. Together, we identify the WRC as a pivotal component of Netrin-1/DCC signaling and further provide a molecular mechanism explaining how genetic variants in DCC may lead to CMM.

bioRxiv 2022-10-17 Preprint (No Snippets API) Desai M, Hemant, Deo A, Naik J, Bose T, Majumdar A.
Show Full Abstract

Orb2 the Drosophila homolog of Cytoplasmic polyadenylation element binding protein (CPEB) forms prion-like oligomers. These oligomers consist of Orb2A and Orb2B isoforms and their formation are dependent on the oligomerization of the Orb2A isoform. Drosophila with a mutation diminishing Orb2A’s prion-like oligomerization forms long-term memory but fails to maintain it over time. Since, this prion-like oligomerization of Orb2A plays a crucial role in the maintenance of memory, here we aim to find what regulates this oligomerization. In an immunoprecipitation-based screen, we identify interactors of Orb2A in the Hsp40 and Hsp70 families of proteins. Amongst these, we find an Hsp40 family protein Mrj as a regulator of the conversion of Orb2A to its prion-like form. Mrj interacts with Hsp70 proteins and acts as a chaperone by interfering with the aggregation of pathogenic Huntingtin. Unlike its mammalian homolog, we find Drosophila Mrj is neither an essential gene nor causes any gross neurodevelopmental defect. We observe a loss of Mrj results in a reduction in Orb2 oligomers. Further, the knockdown of Mrj in the mushroom body neurons results in a deficit in long-term memory. Our work implicates a chaperone Mrj in mechanisms of memory regulation through controlling the oligomerization of Orb2A and its association with the translating polysomes.

Also flagged:hepatocellular carcinomaLiver CancerPrimary liver cancercancerliver diseasesascites
Journal Article 2022-10-16 ✓ 1 Snippet Ott D, Gawish A, Lux A, Heinze C, Brunner TB, Hass P.
In-Text Gene Mentions

…Six patients hadhemochromatosisand three had…

Show Full Abstract

<h4>Background and purpose</h4>ALBI and IBI are new scores to evaluate the liver function in patients with hepatocellular carcinoma (HCC). The purpose of this study was to evaluate the prognostic abilities of those scores in patients treated with interstitial brachytherapy (iBT).<h4>Materials and methods</h4>190 patients treated with iBT between 01.01.2006 and 01.01.2018 were included in this study. The clinical target dose was 15 Gy. The patients were all in Child-Pugh stadium A or B and across the Barcelona Clinic Liver Cancer (BCLC) Stages 0-C. Retrospectively ALBI and IBI were calculated pre- and post-therapeutic until 6 months after iBT. Hazards ratios were calculated, and p values corrected using the false discovery rate according to Benjamini and Hochberg.<h4>Results</h4>The median overall survival was 23.5 months (CI 19-28.5 months), and the median progression-free survival was 7.5 months (CI 6-9 months). Elevated ALBI showed a significantly higher risk to die with a hazard ratio (HR) of 2.010 (ALBI 2 vs. 1) and 4082 (ALBI 3 vs. 1), respectively. The IBI did also show a higher risk with an HR of 1.816 (IBI 1 vs. 0) and 4608 (IBI 2 vs. 0), respectively. Even 3 months after therapy elevated ALBI and IBI showed poor overall survival. Concerning progression-free survival, ALBI and IBI could not provide any relevant additional information.<h4>Conclusion</h4>ALBI and IBI are useful tools to predict the overall survival in patients treated with iBT and might be helpful to assign the patients to the appropriate therapy.

Also flagged:liver tumorsmetabolic disorderporphyrinbiosynthesis5-aminolevulinic acidporphobilinogen
Journal Article 2022-10-16 ✓ 1 Snippet Haverkamp T, Bronisch O, Knösel T, Mogler C, Weichert W, Stauch T, Schmid C, Rummeny C, Beykirch MK, Petrides PE.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Introduction</h4>Acute intermittent porphyria (AIP) is a very rare (orphan) metabolic disorder of porphyrin biosynthesis which is characterized by elevated plasma and urine levels of 5-aminolevulinic acid (5-ALA) and porphobilinogen (PBG). Patients with this disorder which is caused by a germline mutation of the hydroxymethylbilan-synthase (HMBS)-gene have a high risk of primary liver cancer which may be determined by disease activity. The exact mechanism of carcinogenesis of this rare tumor is unknown, however.<h4>Materials and methods</h4>We analyzed paraffin-embedded formalin-fixed liver tumor and normal liver specimens of two female AIP patients treated at the Munich EPNET center. One patient had developed hepatocellular carcinoma (HCC), the other intrahepatic cholangiocarcinoma (CCA). Since biallelic inactivation of HMBS had been observed in one study, we used Sanger and next-generation sequencing with a 8 gene porphyria panel plus 6 potential modifier loci to search for mutations in DNA extractions.<h4>Results</h4>In the patient with the HCC, we found a second inactivating mutation in the HMBS gene in the tumor but not in the adjacent normal liver tissue. No mutation could be found in the liver tissues of the patient with CCA, however.<h4>Conclusions</h4>Biallelic inactivation of HMBS or protoporphyrinogen-oxidase (PPOX), another enzyme of porphyrin biosynthesis, has been observed in patients with acute porphyrias and liver tumors. We could confirm this in our patient with HCC with a mutation in HMBS but not in the one with CCA. Since 5-ALA can be converted into carcinogenic substances such as 4,5-dioxovaleric acid (DOVA) or 3,6-dihydropyrazine-2,5-dipropanoic acid (= cyclic dimerization product of 5-ALA), local production of these metabolites in hepatic areas with complete loss of HMBS activity may contribute to liver carcinogenesis.

Also flagged:epigallocatechin-3-gallatephorbolmyristateacetateGelatinmatrix metalloproteinase
Journal Article 2022-10-16 No Snippets Kassouri C, Rodriguez Torres S, Gonzalez Suarez N, Duhamel S, Annabi B.
Show Full Abstract

<h4>Background</h4>The promyelocytic leukemia cell differentiation process enables recapitulation of the polarized M1 or M2 macrophage-like phenotype with inflammatory and immune-suppressive properties. While evidence supports the anti-inflammatory effect of dietary-derived epigallocatechin-3-gallate (EGCG), its impact on the onset of immune phenotype molecular signature remains unclear.<h4>Methods</h4>Human HL60 promyelocytic cells grown in suspension were differentiated into CD11b<sup>High</sup>/CD14<sup>Low</sup> adherent macrophages with phorbol 12-myristate 13-acetate (PMA). Gelatin zymography was used to assess the levels of matrix metalloproteinase (MMP)-9, and total RNA was isolated for RNAseq and RT-qPCR assessment of differentially expressed gene levels involved in inflammation and immunity. Protein lysates were used to assess the phosphorylation status of signaling intermediates involved in macrophage-like cell differentiation.<h4>Results</h4>Cell adhesion and induction of MMP-9 were indicative of HL60 cell differentiation into a macrophage-like phenotype. The extracellular signal-regulated kinase (ERK), glycogen synthase kinase (GSK)-3, p90 ribosomal S6 kinases (RSK), and cAMP-response-element-binding protein (CREB) were all phosphorylated, and EGCG reduced such phosphorylation status. Increases in inflammation and immunity genes included, among others, <i>CCL22</i>, <i>CSF1</i>, <i>CSF2</i>, <i>IL1B</i>, and <i>TNF</i>, which inductions were prevented by EGCG. This was corroborated by unbiased transcriptomic analysis which further highlighted the capacity of EGCG to downregulate the hematopoietic stem cell regulator <i>CBFA2T3</i>.<h4>Conclusion</h4>EGCG inhibits inflammatory signaling crosstalk and prevents the onset of an immune phenotype in macrophage-like differentiated cells.

Also flagged:element (RibosomalsecretedMetabolitectg1ctg3
Journal Article 2022-10-16 ✓ 1 Snippet Xu F, Li X, Ren H, Zeng R, Wang Z, Hu H, Bao J, Que Y.
In-Text Gene Mentions

…Eight SMBGCs were found to have more than a 50% similarity with the known SMBGCs, with four having a 100% similarity with the clavaric acid biosynthetic gene cluster from Hypholoma sublateritium , melanin biosynthetic gene cluster from B. oryzae ,AbT1biosynthetic gene cluster from Aureobasidium pullulans, and (-)-Mellein biosynthetic gene cluster from Parastagonospora nodorum , respectively ( Figure 7 C).…

Show Full Abstract

The sexual morph <i>Leptosphaeria taiwanensis</i> Yen and Chi and its asexual morph <i>Stagonospora tainanensis</i> W. H. Hsieh is an important necrotrophic fungal phytopathogen, which causes sugarcane leaf blight, resulting in loss of cane tonnage and sucrose in susceptible sugarcane varieties. Decoding the genome and understanding of the basis of virulence is vitally important for devising effective disease control strategies. Here, we present a 38.25-Mb high-quality genome assembly of <i>S. tainanensis</i> strain StFZ01, denovo assembled with 10.19 Gb Nanopore sequencing long reads (~267×) and 3.82 Gb Illumina short reads (~100×). The genome assembly consists of 12 contigs with N50 of 2.86 Mb of which 5 belong to the telomere to telomere (T2T) chromosome. It contains 13.20% repeat sequences, 12,543 proteins, and 12,206 protein-coding genes with the BUSCO completeness 99.18% at fungi (<i>n</i> = 758) and 99.87% at ascomycota (<i>n</i> = 1706), indicating the high accuracy and completeness of our gene annotations. The virulence analysis in silico revealed the presence of 2379 PHIs, 599 CAZys, 248 membrane transport proteins, 191 cytochrome P450 enzymes, 609 putative secreted proteins, and 333 effectors in the StFZ01 genome. The genomic resources presented here will not only be helpful for development of specific molecular marker and diagnosis technique, population genetics, molecular taxonomy, and disease managements, it can also provide a significant precise genomic reference for investigating the ascomycetous genome, the necrotrophic lifestyle, and pathogenicity in the future.

Also flagged:COVID-19Neurological DiseasesNeuropsychiatric DisordersCoronavirus Disease 2019infectionneurological disorders
Journal Article 2022-10-16 ✓ 4 Snippets Onisiforou A, Spyrou GM.
In-Text Gene Mentions

HD is an inherited genetic disease involving mutation to the huntingtin (HTT) gene, therefore genetic susceptibility genes where not collected from DisGeNET, but the HTT was mapped on the COVID-19-host PPIs network to investigate if SARS-CoV-2 viral proteins interact with the HTT gene.

…to the huntingtin (HTT) gene, therefore genetic…

…, but theHTTwas mapped on…

…interact with theHTTgene.…

Show Full Abstract

Coronavirus Disease 2019 (COVID-19) is associated with increased incidence of neurological diseases and neuropsychiatric disorders after infection, but how it contributes to their development remains under investigation. Here, we investigate the possible relationship between COVID-19 and the development of ten neurological disorders and three neuropsychiatric disorders by exploring two pathological mechanisms: (i) dysregulation of host biological processes via virus-host protein-protein interactions (PPIs), and (ii) autoreactivity of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) epitopes with host "self" proteins via molecular mimicry. We also identify potential genetic risk factors which in combination with SARS-CoV-2 infection might lead to disease development. Our analysis indicated that neurodegenerative diseases (NDs) have a higher number of disease-associated biological processes that can be modulated by SARS-CoV-2 via virus-host PPIs than neuropsychiatric disorders. The sequence similarity analysis indicated the presence of several matching 5-mer and/or 6-mer linear motifs between SARS-CoV-2 epitopes with autoreactive epitopes found in Alzheimer's Disease (AD), Parkinson's Disease (PD), Myasthenia Gravis (MG) and Multiple Sclerosis (MS). The results include autoreactive epitopes that recognize amyloid-beta precursor protein (APP), microtubule-associated protein tau (MAPT), acetylcholine receptors, glial fibrillary acidic protein (GFAP), neurofilament light polypeptide (NfL) and major myelin proteins. Altogether, our results suggest that there might be an increased risk for the development of NDs after COVID-19 both via autoreactivity and virus-host PPIs.

bioRxiv 2022-10-16 Preprint (No Snippets API) Saha S, Krishnan H, Padinjat R.
Show Full Abstract

Lithium (Li) is a widely used as a mood stabilizer in the clinical management of Bipolar Affective Disorder (BPAD). However, the molecular targets of Li in neural cells that underpin its therapeutic effect remain unresolved. Inositol monophosphatase (IMPA1), is an enzyme involved in the resynthesis of phosphatidylinositol 4,5-bisphosphate (PIP 2 ) following receptor-activated phospholipase C (PLC) signalling. In vitro , Li inhibits IMPA1, but the relevance of this inhibition within neural cells remains unknown. Here we report that in human cells, treatment with therapeutically relevant concentrations of Li reduces receptor activated calcium release from intracellular stores and delays the resynthesis of PIP 2 following receptor activated PLC signalling. Both these effects of Li are abrogated in cells where IMPA1 has been deleted. We also observed that in human forebrain cortical neurons, treatment with Li results in reduced neuronal excitability as well as reduced calcium signals following receptor activated PLC signalling. Following Li treatment of human forebrain cortical neurons, transcriptome analyses reveal downregulation of multiple components of the glutamate receptor signalling system. Glutamate is a key excitatory neurotransmitter in the human brain and thus our findings provide an insight into the mechanisms underlying the dampening of neuronal excitability following Li treatment. Collectively, our findings suggest that Li inhibits receptor activated PLC signalling leading to an altered transcriptional response and reduced neuronal excitability.

Also flagged:Polyproline IPolyprolinepeptideamino acidicindolinecarboxylic acid
Journal Article 2022-10-15 No Snippets Pollastrini M, Pasquinelli L, Górecki M, Balzano F, Cupellini L, Lipparini F, Uccello Barretta G, Marchetti F, Pescitelli G, Angelici G.
Show Full Abstract

Polyproline I helical structures are often considered as the hidden face of their most famous geminal sibling, Polyproline II, as PPI is generally spotted only within a conformational equilibrium. We designed and synthesized a stable Polyproline I structure exploiting the striking tendency of (<i>S</i>)-indoline-2-carboxylic acid to drive the peptide bond conformation toward the <i>cis</i> amide isomer, when dissolved in polar solvents. The cooperative effect of only four amino acidic units is sufficient to form a preferential structure in solution. We shed light on this rare secondary structure with a thorough analysis of the spectroscopic and chiroptical properties of the tetramer, supported by X-ray crystallography and computational studies.

Also flagged:skin cancermetastatic diseasetumorcancermelanomaextracellular
Journal Article 2022-10-15 ✓ 5 Snippets Sabato C, Noviello TMR, Covre A, Coral S, Caruso FP, Besharat ZM, Splendiani E, Masuelli L, Battistelli C, Vacca A, Catanzaro G, Po A, Anichini A, Maio M, Ceccarelli M, Di Giacomo AM, Ferretti E.
In-Text Gene Mentions

Indeed, we found that the gene TNFSF4, coding for the immunoregulatory protein OX40L [22], was a putative target of 3 of the pEV-microRNA melanoma signature, namely miR-412-3p, miR-507 and miR-1203.

…Superfamily Member 4 (TNFSF4) cloned downstream of…

…3’ UTR ofTNFSF4were transiently co-transfecte…

…miRNA on theTNFSF43'UTR.…

…that the geneTNFSF4, coding for the…

Show Full Abstract

<h4>Background</h4>Melanoma is the deadliest form of skin cancer and metastatic disease is associated with a significant survival rate drop. There is an urgent need for consistent tumor biomarkers to scale precision medicine and reduce cancer mortality. Here, we aimed to identify a melanoma-specific circulating microRNA signature and assess its value as a diagnostic tool.<h4>Methods</h4>The study consisted of a discovery phase and two validation phases. Circulating plasma extracellular vesicles (pEV) associated microRNA profiles were obtained from a discovery cohort of metastatic melanoma patients and normal subjects as controls. A pEV-microRNA signature was obtained using a LASSO penalized logistic regression model. The pEV-microRNA signature was subsequently validated both in a publicly available dataset and in an independent internal cohort.<h4>Results</h4>We identified and validated in three independent cohorts a panel of melanoma-specific circulating microRNAs that showed high accuracy in differentiating melanoma patients from healthy subjects with an area under the curve (AUC) of 1.00, 0.94 and 0.75 respectively. Investigation of the function of the pEV-microRNA signature evidenced their possible immune suppressive role in melanoma patients.<h4>Conclusions</h4>We demonstrate that a blood test based on circulating microRNAs can non-invasively detect melanoma, offering a novel diagnostic tool for improving standard care. Moreover, we revealed an immune suppressive role for melanoma pEV-microRNAs.

Also flagged:DLBCLnon-Hodgkin lymphomaextranodaltumorIGLL5TP53
Journal Article 2022-10-15 No Snippets Li SS, Zhai XH, Liu HL, Liu TZ, Cao TY, Chen DM, Xiao LX, Gan XQ, Cheng K, Hong WJ, Huang Y, Lian YF, Xiao J.
Show Full Abstract

<h4>Background</h4>Diffuse large B-cell lymphoma (DLBCL) is the most common aggressive non-Hodgkin lymphoma, and about 10% of DLBCL cases primarily occur in the gastrointestinal tract. Previous reports have revealed that primary gastrointestinal-DLBCL (pGI-DLBCL) harbors different genetic mutations from other nodal or extranodal DLBCL. However, the exonic mutation profile of pGI-DLBCL has not been fully addressed.<h4>Methods</h4>We performed whole-exome sequencing of matched tumor tissues and blood samples from 53 pGI-DLBCL patients. The exonic mutation profiles were screened, and the correlations between genetic mutations and clinicopathological characteristics were analyzed.<h4>Results</h4>A total of 6,588 protein-altering events were found and the five most frequent mutated genes in our pGI-DLBCL cohort were IGLL5 (47%), TP53 (42%), BTG2 (28%), P2RY8 (26%) and PCLO (23%). Compared to the common DLBCL, significantly less or absence of MYD88 (0%), EZH2 (0%), BCL2 (2%) or CD79B (8%) mutations were identified in pGI-DLBCL. The recurrent potential driver genes were mainly enriched in pathways related to signal transduction, infectious disease and immune regulation. In addition, HBV infection had an impact on the mutational signature in pGI-DLBCL, as positive HBsAg was significantly associated with the TP53 and LRP1B mutations, two established tumor suppressor genes in many human cancers. Moreover, IGLL5 and LRP1B mutations were significantly correlated with patient overall survival and could serve as two novel prognostic biomarkers in pGI-DLBCL.<h4>Conclusions</h4>Our study provides a comprehensive view of the exonic mutation profile of the largest pGI-DLBCL cohort to date. The results could facilitate the clinical development of novel therapeutic and prognostic biomarkers for pGI-DLBCL.

Also flagged:Lef1transcription factorSmad4Atf2Beta-cateninmechanotransduction
Journal Article 2022-10-15 ✓ 1 Snippet Yuan L, Roy B, Ratna P, Uhler C, Shivashankar GV.
In-Text Gene Mentions

…proteins (Sox2, Sox3,Sox6, etc.),…

Show Full Abstract

Long-term sustained mechano-chemical signals in tissue microenvironment regulate cell-state transitions. In recent work, we showed that laterally confined growth of fibroblasts induce dedifferentiation programs. However, the molecular mechanisms underlying such mechanically induced cell-state transitions are poorly understood. In this paper, we identify Lef1 as a critical somatic transcription factor for the mechanical regulation of de-differentiation pathways. Network optimization methods applied to time-lapse RNA-seq data identify Lef1 dependent signaling as potential regulators of such cell-state transitions. We show that Lef1 knockdown results in the down-regulation of fibroblast de-differentiation and that Lef1 directly interacts with the promoter regions of downstream reprogramming factors. We also evaluate the potential upstream activation pathways of Lef1, including the Smad4, Atf2, NFkB and Beta-catenin pathways, thereby identifying that Smad4 and Atf2 may be critical for Lef1 activation. Collectively, we describe an important mechanotransduction pathway, including Lef1, which upon activation, through progressive lateral cell confinement, results in fibroblast de-differentiation.

Also flagged:SynthesisGlycyrrhizic AcidAmino-Acid Methyl Estersglutamic acidamino-acidcarbohydrate
Journal Article 2022-10-15 No Snippets Baltina LA, Baltina LA, Petrova SF, Gabdrakhmanova SF, Makara NS, Sapozhnikova TA.
Show Full Abstract

Conjugates of glycyrrhizic acid (GA) with methyl esters of <i>L</i>-amino acids (valine, methionine, and glutamic acid) containing the amino-acid residues in the carbohydrate moiety of the glycoside were synthesized using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide. The resulting GA conjugates at a dose of 2 mg/kg stimulated a primary immune response (production of antibody-forming cells, AFCs) in outbred mice by 1.6 - 3 times as compared with the control. The conjugate of GA with Glu(OMe)<sub>2</sub> stimulated antibody genesis in outbred mice 1.7 times more efficiently than <i>N</i>-acetylmuramyl dipeptide and showed a stimulating effect on AFC production in the spleen of CBA mice.

Also flagged:acute leukemiaAcute myeloid leukemiaAMLacute blood cancerscancerCarfilzomib
Journal Article 2022-10-15 ✓ 5 Snippets Salavaty A, Shehni SA, Ramialison M, Currie PD.
In-Text Gene Mentions

AML; Cancer stem cells; Drug repurposing; Zonisamide; Carfilzomib; Amitriptyline; CA1; MAOB; TNFSF4.

Furthermore, according to the COSMIC database (Tate et al., 2019), while none of the samples of the TCGA AML dataset showed a copy number loss, only one of the samples showed a copy number gain (TCGA-GR-A4D9-01) in TNFSF4.

Consequently, down-regulation of TNFSF4 (OX40 ligand) would suppress the aforementioned phenomenon in AML development.

In addition, the interrogation of TNFSF4 on the Cancer Gene and Pathway Explorer (CGPE) (Liu et al., 2021a) web server indicated that TNFSF4 is highly active in several relevant KEGG pathways such as Acute Myeloid Leukemia, other well-known cancer-related pathways (e.g. JAK-STAT signalling pathway), and pathways relevant to the stemness level of hematopoietic cells (e.g. Hematopoietic cell lineage) in AML cell lines (Supplementary figure S7).

In silico functional assays on AML key CSC genes, and more comprehensively on TNFSF4 as an instance, revealed the functional relevance of these genes to the viability and proliferation of AML cells.

Show Full Abstract

Acute myeloid leukemia (AML) is one of the most prevalent and acute blood cancers with a poor prognosis and low overall survival rate, especially in the elderly. Although several new AML markers and drug targets have been recently identified, the rate of long-term cancer eradication has not improved significantly due to the presence and drug resistance of AML cancer stem cells (CSCs). Here we develop a novel computational pipeline to analyze the transcriptomic profiles of AML cancer (stem) cells and identify novel candidate AML CSC markers and drug targets. In our novel pipeline we apply a top-down meta-analysis strategy to integrate The Cancer Genome Atlas data with CSC datasets to infer cell stemness features. As a result, a set of genes termed the "AML key CSC genes" along with all the available drugs/compounds that could target them were identified. Overall, our novel computational pipeline could retrieve known cancer drugs (Carfilzomib) and predicted novel drugs such as Zonisamide, Amitriptyline, and their targets amongst the top ranked drugs and drug targets for targeting AML. Additionally, the pipeline applied in this study could be used for the identification of CSC-specific markers, drivers and their respective targeting drugs in other cancer types.

Also flagged:tryptophanmetabolismsenile dementiaPHScd 1Phenoxazinone Synthase
Journal Article 2022-10-15 ✓ 1 Snippet Zhuravlev AV, Ivanova PN, Makaveeva KA, Zakharov GA, Nikitina EA, Savvateeva-Popova EV.
In-Text Gene Mentions

…3-HOK/KYNA level inhttmutant, a Drosophila…

Show Full Abstract

Being involved in development of Huntington's, Parkinson's and Alzheimer's diseases, kynurenine pathway (KP) of tryptophan metabolism plays a significant role in modulation of neuropathology. Accumulation of a prooxidant 3-hydroxykynurenine (3-HOK) leads to oxidative stress and neuronal cell apoptosis. <i>Drosophila</i> mutant <i>cardinal</i> (<i>cd</i><sup>1</sup>) with 3-HOK excess shows age-dependent neurodegeneration and short-term memory impairments, thereby presenting a model for senile dementia. Although <i>cd</i> gene for phenoxazinone synthase (PHS) catalyzing 3-HOK dimerization has been presumed to harbor the <i>cd</i><sup>1</sup> mutation, its molecular nature remained obscure. Using next generation sequencing, we have shown that the <i>cd</i> gene in <i>cd</i><sup>1</sup> carries a long deletion leading to PHS active site destruction. Contrary to the wild type <i>Canton-S</i> (<i>CS</i>), <i>cd</i><sup>1</sup> males showed defective long-term memory (LTM) in conditioned courtship suppression paradigm (CCSP) at days 5-29 after eclosion. The number of dopaminergic neurons (DAN) regulating fly locomotor activity showed an age-dependent tendency to decrease in <i>cd</i><sup>1</sup> relative to <i>CS</i>. Thus, in accordance with the concept "from the gene to behavior" proclaimed by S. Benzer, we have shown that the aberrant PHS sequence in <i>cd</i><sup>1</sup> provokes drastic LTM impairments and DAN alterations.

Also flagged:Fatty AcidMetabolismcancertumorCD8type II interferon
Journal Article 2022-10-15 No Snippets Guo Y, Pan S, Ke Y, Pan J, Li Y, Ma H.
Show Full Abstract

<h4>Background</h4>Esophageal cancer (ESCA) is a major cause of cancer-related mortality worldwide. Altered fatty acid metabolism is a hallmark of cancer. However, studies on the roles of fatty acid metabolism-related genes (FRGs) in ESCA remain limited.<h4>Method</h4>We identified differentially expressed FRGs (DE-FRGs). Then, the DE-FRGs prognostic model was constructed and validated using a comprehensive analysis. Moreover, the correlation between the risk model and clinical characteristics was investigated. A nomogram for predicting survival was established and evaluated. Subsequently, the difference in tumor microenvironment (TME) was compared between two risk groups. The sensitivity of key DE-FRGs to chemotherapeutic interventions and their correlation with immune cells were investigated. Finally, DEGs between two risk groups were measured and the prognostic value of key DE-FRGs in ESCA was confirmed in other databases.<h4>Results</h4>A prognostic model was constructed based on seven selected DEG-FRGs. TNM staging and CD8+ T cells were significantly correlated with high-risk groups. Low-risk groups exhibited more infiltrated M0 macrophages, an activation of type II interferon (IFN-γ) responses, and were found to be more suitable for immunotherapy. Seven key DE-FRGs with prognostic value were found to be considerably influenced by different chemotherapy drugs.<h4>Conclusion</h4>A prognostic model based on seven DE-FRGs may efficiently predict patient prognosis and immunotherapy response, helping to develop individualized treatment strategies in ESCA.

Also flagged:TNFRSF1ALiver InjurySepsisGene Expressioninfectionliver disease
Journal Article 2022-10-15 ✓ 2 Snippets Zhou S, Zhao W, Li J, Huang Y, Yang J, Wang Q, Xu Y, Duan C, Wang Y, Yin W.
In-Text Gene Mentions

Sepsis may also induce acute kidney injury (AKI), and studies showed that VMP1, SLPI, PTX3, TIMP1, OLFM4, LCN2, and S100A9 genes were markedly correlated with the development and progression of septic-shock-associated AKI [12].

…SLPI, PTX3, TIMP1,OLFM4, LCN2, and S100A9…

Show Full Abstract

Sepsis is a severe disease with high mortality, and liver injury is an independent risk factor for sepsis morbidity and mortality. We analyzed co-differentially expressed genes (co-DEGs) to explore potential biomarkers and therapeutic targets for sepsis-related liver injury. Three gene expression datasets (GSE60088, GSE23767, and GSE71530) were downloaded from the Gene Expression Omnibus (GEO). DEGs were screened between sepsis and control samples using GEO2R. The association of these DEGs with infection and liver disease was analyzed by using the CTD database. GO functional analysis, KEGG pathway enrichment analysis, and protein-protein interaction (PPI) network analysis were performed to elucidate the potential molecular mechanism of DEGs. DEGs of different tissues in GSE60088 were analyzed again to obtain specific markers of septic liver injury. Mouse model of sepsis was also established by cecal ligation and puncture (CLP), and the expression of specific markers in liver, lung, and kidney tissues was analyzed using Western blot. Here, we identified 21 DEGs in three datasets with 8 hub genes, all of which showed higher inference scores in liver diseases than bacterial infections. Among them, only TNFRSF1A had a liver-specific differential expression. TNFRSF1A was also confirmed to be specifically reduced in septic liver tissues in mice. Therefore, TNFRSF1A may serve as a potential biomarker for septic liver injury.

Also flagged:signal transductionHST1deacetylaseEthyl methane sulfonateTAC1zinc finger nuclear transcription factor
Journal Article 2022-10-14 ✓ 1 Snippet Zhao L, Zheng Y, Wang Y, Wang S, Wang T, Wang C, Chen Y, Zhang K, Zhang N, Dong Z, Chen F.
In-Text Gene Mentions

…annotated as aNAD‐dependent deacetylase HST1‐likedeacetylase HST1‐like (…

Show Full Abstract

Tiller angle is one of the most important agronomic traits and one key factor for wheat ideal plant architecture, which can both increase photosynthetic efficiency and greatly enhance grain yield. Here, a deacetylase HST1-like (TaHST1L) gene controlling wheat tiller angle was identified by the combination of a genome-wide association study (GWAS) and bulked segregant analysis (BSA). Ethyl methane sulfonate (EMS)-mutagenized tetraploid wheat lines with the premature stop codon of TaHST1L exhibited significantly smaller tiller angles than the wild type. TaHST1L-overexpressing (OE) plants exhibited significantly larger tiller angles and increased tiller numbers in both winter and spring wheat, while TaHST1L-silenced RNAi plants displayed significantly smaller tiller angles and decreased tiller numbers. Moreover, TaHST1L strongly interacted with TaIAA17 and inhibited its expression at the protein level, and thus possibly improved the content of endogenous auxin in the basal tissue of tillers. The transcriptomics and metabolomics results indicated that TaHST1L might change plant architecture by mediating auxin signal transduction and regulating endogenous auxin levels. In addition, a 242-bp insertion/deletion (InDel) in the TaHST1L-A1 promoter altered transcriptional activity and TaHST1L-A1b allele with the 242-bp insertion widened the tiller angle of TaHST1L-OE transgenic rice plants. Wheat varieties with TaHST1L-A1b allele possessed the increased tiller angle and grain yield. Further analysis in wheat and its progenitors indicated that the 242-bp InDel possibly originated from wild emmer and was strongly domesticated in the current varieties. Therefore, TaHST1L involved in the auxin signalling pathway showed the big potential to improve wheat yield by controlling plant architecture.

Also flagged:translationalcell differentiationgene expressionlocalizationcytoplasmnucleus
Journal Article 2022-10-14 No Snippets Brancato V, Brentari I, Coscujuela Tarrero L, Furlan M, Nicassio F, Denti MA.
Show Full Abstract

Since the formalization of the Central Dogma of molecular biology, the relevance of RNA in modulating the flow of information from DNA to proteins has been clear. More recently, the discovery of a vast set of non-coding transcripts involved in crucial aspects of cellular biology has renewed the enthusiasm of the RNA community. Moreover, the remarkable impact of RNA therapies in facing the COVID19 pandemics has bolstered interest in the translational opportunities provided by this incredible molecule. For all these reasons, the Italian Society of Biophysics and Molecular Biology (SIBBM) decided to dedicate its 17th yearly meeting, held in June 2022 in Rome, to the many fascinating aspects of RNA biology. More than thirty national and international speakers covered the properties, modes of action and applications of RNA, from its role in the control of development and cell differentiation to its involvement in disease. Here, we summarize the scientific content of the conference, highlighting the take-home message of each presentation, and we stress the directions the community is currently exploring to push forward our comprehension of the RNA World 3.0.

Also flagged:axonalpost-translational modificationsAPEX2phosphorylationsbrain disordersproline
Journal Article 2022-10-14 ✓ 5 Snippets Dumrongprechachan V, Salisbury RB, Butler L, MacDonald ML, Kozorovitskiy Y.
In-Text Gene Mentions

…show the Netrin1 (NTN1)-DCCsubnetwork in the…

Dccis a netrin…

…Activation of theDCCpathway by netrin…

…YN-mediated phosphorylation ofDCC( Meriane et…

…data show thatDCCexpression decreases over…

Show Full Abstract

Mammalian axonal development begins in embryonic stages and continues postnatally. After birth, axonal proteomic landscape changes rapidly, coordinated by transcription, protein turnover, and post-translational modifications. Comprehensive profiling of axonal proteomes across neurodevelopment is limited, with most studies lacking cell-type and neural circuit specificity, resulting in substantial information loss. We create a Cre-dependent APEX2 reporter mouse line and map cell-type-specific proteome of corticostriatal projections across postnatal development. We synthesize analysis frameworks to define temporal patterns of axonal proteome and phosphoproteome, identifying co-regulated proteins and phosphorylations associated with genetic risk for human brain disorders. We discover proline-directed kinases as major developmental regulators. APEX2 transgenic reporter proximity labeling offers flexible strategies for subcellular proteomics with cell type specificity in early neurodevelopment, a critical period for neuropsychiatric disease.

Also flagged:tumorhepatocellular carcinomaPOLR3CKPNA2IC1Liver cancer
Journal Article 2022-10-14 ✓ 2 Snippets Li YF, Hou QQ, Zhao S, Chen X, Tang M, Li L.
In-Text Gene Mentions

For example, BTLA, C10orf54, CD244, CD27, CD276, CD40LG, CD47, CD48, CD80, CD86, CD96, CTLA4, HAVCR2, HLA-A, HLA-DMA, HLA-DMB, HLA-DPA1, HLA-DPB1, HLA-DQB1, HLA-DRA, HLA-DRB1, HLA-DRB5, ICOS, LAG3, LAIR1, LGALS9, NRP1, PDCD1, SIRPA, TNFRSF14, TNFRSF18, TNFRSF25, TNFRSF4, TNFSF15, and TNFSF4 were significantly upregulated in IC2 tumors in both the TCGA and ICGC cohorts, while CEACAM1 and TDO2 were overexpressed in IC1 tumors in both the TCGA and ICGC cohorts.

…TNFSF15 , andTNFSF4were significantly upregulated…

Show Full Abstract

<h4>Background</h4>To screen efficacious neoantigens for the development of LIHC mRNA vaccines, construct LIHC immune clusters, and therefore select patients who might benefit from vaccination.<h4>Methods</h4>RNA-seq data and clinical information of 371 TCGA-LIHC and 231 ICGC-LIHC cohorts were downloaded. Differentially expressed genes and their associations with prognosis were analyzed by GEPIA, genetic alterations were examined in the cBioPortal portal, and the association between genes and immune infiltrating cells was explored by TIMER. The immune clusters were constructed by consistency clustering, and the immune landscape was described using CIBERSORT.<h4>Results</h4>POLR3C and KPNA2 were identified as LIHC tumor neoantigens related to inferior prognosis and antigen-presenting cell infiltration. In addition, three immune clusters (IC1, IC2 and IC3) with significant differences in molecular, immune cytological, and clinical features were identified in both the TCGA and ICGC LIHC cohorts. Immune "hot" phenotype IC3 displayed a better survival than IC2, and immune "cold" phenotype IC1 exhibited a high tumor mutation burden.<h4>Conclusion</h4>In conclusion, for the development of anti-LIHC mRNA vaccines, we identified efficacious neoantigens POLR3C and KPNA2, profiled the tumor microenvironment of LIHC, and identified IC1 patients as the subgroup who might not most benefit from vaccination.

Also flagged:Congenital Heart DiseaseNascent polypeptide-Associated ComplexSignal-Recognition-ParticleSRPHOXC12
Journal Article 2022-10-14 No Snippets Schroeder AM, Nielsen T, Lynott M, Vogler G, Colas AR, Bodmer R.
Show Full Abstract

Establishing a catalog of Congenital Heart Disease (CHD) genes and identifying functional networks would improve our understanding of its oligogenic underpinnings. Our studies identified protein biogenesis cofactors Nascent polypeptide-Associated Complex (NAC) and Signal-Recognition-Particle (SRP) as disease candidates and novel regulators of cardiac differentiation and morphogenesis. Knockdown (KD) of the alpha- (Nacα) or beta-subunit (bicaudal, bic) of NAC in the developing Drosophila heart disrupted cardiac developmental remodeling resulting in a fly with no heart. Heart loss was rescued by combined KD of Nacα with the posterior patterning Hox gene Abd-B. Consistent with a central role for this interaction in cardiogenesis, KD of Nacα in cardiac progenitors derived from human iPSCs impaired cardiac differentiation while co-KD with human HOXC12 and HOXD12 rescued this phenotype. Our data suggest that Nacα KD preprograms cardioblasts in the embryo for abortive remodeling later during metamorphosis, as Nacα KD during translation-intensive larval growth or pupal remodeling only causes moderate heart defects. KD of SRP subunits in the developing fly heart produced phenotypes that targeted specific segments and cell types, again suggesting cardiac-specific and spatially regulated activities. Together, we demonstrated directed function for NAC and SRP in heart development, and that regulation of NAC function depends on Hox genes.

Also flagged:ERVERVsgagenvelopeenvenvV1
Journal Article 2022-10-14 ✓ 5 Snippets Simpson J, Kozak CA, Boso G.
In-Text Gene Mentions

…51 species of Carnivora that contained the BTN1A1 andBTN2A1genes and 87 species of Artiodactyla that contained at least 25 kb long sequence surrounding the ARTenvV in a single scaffold/chromosome were used for further analysis ( S1 Table ).…

…We observed high levels of sequence conservation of the CARenvV ORF among Carnivora as well as sequence conservation in most exons of the linked BTN1A1 andBTN2A1genes in all the species examined confirming the orthology of this region ( Fig 1B ).…

…the BTN1A1 andBTN2A1genes and 87…

…encompasses BTN1A1 andBTN2A1( CARenvV )…

…genes BTN1A1 andBTN2A1( Fig 1A…

Show Full Abstract

Endogenous retroviruses (ERVs) found in vertebrate genomes are remnants of retroviral invasions of their ancestral species. ERVs thus represent molecular fossil records of ancient retroviruses and provide a unique opportunity to study viral-host interactions, including cross-species transmissions, in deep time. While most ERVs contain the mutated remains of the original retrovirus, on rare occasions evolutionary selection pressures lead to the co-option/exaptation of ERV genes for a host function. Here, we report the identification of two ancient related non-orthologous ERV env genes, ARTenvV and CARenvV, that are preserved with large open reading frames (ORFs) in the mammalian orders Artiodactyla and Carnivora, respectively, but are not found in other mammals. These Env proteins lack a transmembrane motif, but phylogenetic analyses show strong sequence preservation and positive selection of the env surface ORF in their respective orders, and transcriptomic analyses show a broad tissue expression pattern for both ARTenvV and CARenvV, suggesting that these genes may be exapted for a host function. Multiple lines of evidence indicate that ARTenvV and CARenvV were derived from an ancient ancestral exogenous gamma-like retrovirus that was independently endogenized in two mammalian orders more than 60 million years ago, which roughly coincides with the K-Pg mass extinction event and subsequent mammalian diversification. Thus, these findings identify the oldest known retroviral cross-ordinal transmission of a gamma-like retrovirus with no known extant infectious counterpart in mammals, and the first discovery of the convergent co-option of an ERV gene derived from the same ancestral retrovirus in two different mammalian orders.

Also flagged:non-muscle myosin IILgr5NM IIconstrictionWntNotch
Journal Article 2022-10-14 ✓ 1 Snippet Pentinmikko N, Lozano R, Scharaw S, Andersson S, Englund JI, Castillo-Azofeifa D, Gallagher A, Broberg M, Song KY, Sola Carvajal A, Speidel AT, Sundstrom M, Allbritton N, Stevens MM, Klein OD, Teixeira A, Katajisto P.
In-Text Gene Mentions

…everse: ATGCCGGGAGCTATCTTTCT),Olfm4(forward: ACCACACCTCCAACATCACC…

Show Full Abstract

Niche-derived factors regulate tissue stem cells, but apart from the mechanosensory pathways, the effect of niche geometry is not well understood. We used organoids and bioengineered tissue culture platforms to demonstrate that the conical shape of Lgr5<sup>+</sup> small intestinal stem cells (ISCs) facilitate their self-renewal and function. Inhibition of non-muscle myosin II (NM II)-driven apical constriction altered ISC shape and reduced niche curvature and stem cell capacity. Niche curvature is decreased in aged mice, suggesting that suboptimal interactions between old ISCs and their niche develop with age. We show that activation of NM IIC or physical restriction to young topology improves in vitro regeneration by old epithelium. We propose that the increase in lateral surface area of ISCs induced by apical constriction promotes interactions between neighboring cells, and the curved topology of the intestinal niche has evolved to maximize signaling between ISCs and neighboring cells.

Also flagged:CD32breast cancerextracellulartransmembraneCD28colon cancer
Journal Article 2022-10-14 No Snippets Sconocchia G, Lanzilli G, Cesarini V, Silvestris DA, Rezvani K, Arriga R, Caratelli S, Chen K, Dou J, Cenciarelli C, Toietta G, Baldari S, Sconocchia T, De Paolis F, Aureli A, Iezzi G, Irno Consalvo M, Buccisano F, Del Principe MI, Maurillo L, Venditti A, Ottaviani A, Spagnoli GC.
Show Full Abstract

The FcγRII (CD32) ligands are IgFc fragments and pentraxins. The existence of additional ligands is unknown. We engineered T cells with human chimeric receptors resulting from the fusion between CD32 extracellular portion and transmembrane CD8α linked to CD28/ζ chain intracellular moiety (CD32-CR). Transduced T cells recognized three breast cancer (BC) and one colon cancer cell line among 15 tested in the absence of targeting antibodies. Sensitive BC cell conjugation with CD32-CR T cells induced CD32 polarization and down-regulation, CD107a release, mutual elimination, and proinflammatory cytokine production unaffected by human IgGs but enhanced by cetuximab. CD32-CR T cells protected immunodeficient mice from subcutaneous growth of MDA-MB-468 BC cells. RNAseq analysis identified a 42 gene fingerprint predicting BC cell sensitivity and favorable outcomes in advanced BC. ICAM1 was a major regulator of CD32-CR T cell-mediated cytotoxicity. CD32-CR T cells may help identify cell surface CD32 ligand(s) and novel prognostically relevant transcriptomic signatures and develop innovative BC treatments.

Also flagged:behavioralsensory processingbrain disorderscognitionhomeoboxhedgehog
Journal Article 2022-10-14 ✓ 1 Snippet van der Meer D, Kaufmann T.
In-Text Gene Mentions

…e.g., COMT ,5 -HTT-HTT or DAT1…

Show Full Abstract

Cortical morphology is a key determinant of cognitive ability and mental health. Its development is a highly intricate process spanning decades, involving the coordinated, localized expression of thousands of genes. We are now beginning to unravel the genetic architecture of cortical morphology, thanks to the recent availability of large-scale neuroimaging and genomic data and the development of powerful biostatistical tools. Here, we review the progress made in this field, providing an overview of the lessons learned from genetic studies of cortical volume, thickness, surface area, and folding as captured by neuroimaging. It is now clear that morphology is shaped by thousands of genetic variants, with effects that are region- and time-dependent, thereby challenging conventional study approaches. The most recent genome-wide association studies have started discovering common genetic variants influencing cortical thickness and surface area, yet together these explain only a fraction of the high heritability of these measures. Further, the impact of rare variants and non-additive effects remains elusive. There are indications that the quickly increasing availability of data from whole-genome sequencing and large, deeply phenotyped population cohorts across the lifespan will enable us to uncover much of the missing heritability in the upcoming years. Novel approaches leveraging shared information across measures will accelerate this process by providing substantial increases in statistical power, together with more accurate mapping of genetic relationships. Important challenges remain, including better representation of understudied demographic groups, integration of other 'omics data, and mapping of effects from gene to brain to behavior across the lifespan.

Also flagged:secretioncarbohydratesamino acidsgene expressionCollagenase Dvitamin A
Journal Article 2022-10-14 ✓ 1 Snippet Ardisasmita AI, Schene IF, Joore IP, Kok G, Hendriks D, Artegiani B, Mokry M, Nieuwenhuis EES, Fuchs SA.
In-Text Gene Mentions

…F9 , andSERPINC1.…

Show Full Abstract

The myriad of available hepatocyte in vitro models provides researchers the possibility to select hepatocyte-like cells (HLCs) for specific research goals. However, direct comparison of hepatocyte models is currently challenging. We systematically searched the literature and compared different HLCs, but reported functions were limited to a small subset of hepatic functions. To enable a more comprehensive comparison, we developed an algorithm to compare transcriptomic data across studies that tested HLCs derived from hepatocytes, biliary cells, fibroblasts, and pluripotent stem cells, alongside primary human hepatocytes (PHHs). This revealed that no HLC covered the complete hepatic transcriptome, highlighting the importance of HLC selection. HLCs derived from hepatocytes had the highest transcriptional resemblance to PHHs regardless of the protocol, whereas the quality of fibroblasts and PSC derived HLCs varied depending on the protocol used. Finally, we developed and validated a web application (HLCompR) enabling comparison for specific pathways and addition of new HLCs. In conclusion, our comprehensive transcriptomic comparison of HLCs allows selection of HLCs for specific research questions and can guide improvements in culturing conditions.

Also flagged:dihydrouracil-oxidaseClass-I dihydroorotate dehydrogenasesynthesispyrimidinesdihydrouracilUracil
Journal Article 2022-10-14 No Snippets Bouwknegt J, Vos AM, Ortiz Merino RA, van Cuylenburg DC, Luttik MAH, Pronk JT.
Show Full Abstract

Analysis of predicted fungal proteomes revealed a large family of sequences that showed similarity to the Saccharomyces cerevisiae Class-I dihydroorotate dehydrogenase Ura1, which supports synthesis of pyrimidines under aerobic and anaerobic conditions. However, expression of codon-optimised representatives of this gene family, from the ascomycete Alternaria alternata and the basidiomycete Schizophyllum commune, only supported growth of an S. cerevisiae ura1Δ mutant when synthetic media were supplemented with dihydrouracil. A hypothesis that these genes encode NAD(P)<sup>+</sup>-dependent dihydrouracil dehydrogenases (EC 1.3.1.1 or 1.3.1.2) was rejected based on absence of complementation in anaerobic cultures. Uracil- and thymine-dependent oxygen consumption and hydrogen-peroxide production by cell extracts of S. cerevisiae strains expressing the A. alternata and S. commune genes showed that, instead, they encode active dihydrouracil oxidases (DHO, EC1.3.3.7). DHO catalyses the reaction dihydrouracil + O<sub>2</sub> → uracil + H<sub>2</sub>O<sub>2</sub> and was only reported in the yeast Rhodotorula glutinis (Owaki in J Ferment Technol 64:205-210, 1986). No structural gene for DHO was previously identified. DHO-expressing strains were highly sensitive to 5-fluorodihydrouracil (5F-dhu) and plasmids bearing expression cassettes for DHO were readily lost during growth on 5F-dhu-containing media. These results show the potential applicability of fungal DHO genes as counter-selectable marker genes for genetic modification of S. cerevisiae and other organisms that lack a native DHO. Further research should explore the physiological significance of this enigmatic and apparently widespread fungal enzyme.

Also flagged:traumamajor depressive disorderDepressionanxietyinsomnianeglect
Journal Article 2022-10-14 No Snippets Wang H, Liao Y, Guo L, Zhang H, Zhang Y, Lai W, Teopiz KM, Song W, Zhu D, Li L, Lu C, Fan B, McIntyre RS.
Show Full Abstract

<h4>Background</h4>Suboptimal medication adherence is a major reason for failure in the management of major depressive disorder (MDD), childhood trauma might be an essential risk factor of suboptimal medication adherence. This study aimed to comprehensively explore the associations between different types of childhood trauma and medication adherence among patients with MDD, and to test whether resilience has moderating effects on the foregoing associations.<h4>Methods</h4>Participants were from the Depression Cohort in China (ChiCTR registry number 1900022145), 282 MDD patients with completed both baseline and 12-weeks follow-up investigations were included in this study. The diagnosis of MDD was assessed by trained psychiatrists using the Mini-International Neuropsychiatric Interview (M.I.N.I.). Childhood trauma was evaluated using the Childhood Trauma Questionnaire-28 item Short Form (CTQ-SF), and resilience was evaluated using the Connor-Davidson Resilience Scale (CD-RISC). Demographic characteristics, depression symptoms, anxiety symptoms, suicidal ideation, suicidal attempt, insomnia symptoms, and painful somatic symptoms were also investigated. Participants were divided into groups of optimal and suboptimal adherence based on their Medication Adherence Rating Scale scores. Logistic regression and stratified analyses were performed.<h4>Results</h4>A total of 234 participants (83%) reported suboptimal medication adherence. After adjusting for covariates, CTQ total scores (AOR = 1.03, 95%CI = 1.01-1.06), CTQ measures of sexual abuse (AOR = 1.17, 95%CI = 1.01-1.37), and CTQ measures of physical neglect (AOR = 1.12, 95%CI = 1.02-1.23) were all associated with an increased likelihood of suboptimal adherence. There were significant moderating effects of resilience on the associations of childhood trauma (P = 0.039) and physical neglect (P = 0.034) with medication adherence. The stratification analyses showed that CTQ total scores and CTQ measures of physical neglect were independently associated with an increased risk of suboptimal adherence among patients with MDD with low-resilience or moderate-resilience, while not significantly associated with suboptimal adherence in those with high-resilience.<h4>Conclusion</h4>Childhood trauma was a significant risk factor of suboptimal adherence among patients with MDD, and resilience moderated the foregoing association. Obtaining a history of childhood trauma and assessing resilience may help identify patients with suboptimal adherence when providing MDD pharmacotherapy. Psychiatrists may consider enhancing resilience to cope with the adverse effects of childhood trauma on medication adherence.

Also flagged:innervationbindingisofluranelectinfluoresceinagglutinin
Journal Article 2022-10-14 ✓ 4 Snippets Swensen AC, Veličković D, Williams SM, Moore RJ, Day LZ, Niessen S, Hennessy S, Posso C, Monetti M, Qian WJ, Jacobs J, Whiteley L, Zhu Y, Piehowski PD.
In-Text Gene Mentions

…ino-acyl groups)(Acat1, Hadhb,Prdx6, Fasn, and Oxsm)…

…in oxidoreductase activity (Prdx6, Impdh2, Txn1, Prdx4,…

…group of enzymes (Prdx6, Prdx4, and Park7)…

…group of enzymes (Prdx6, Txn1, Prdx4, and…

Show Full Abstract

Despite their diminutive size, islets of Langerhans play a large role in maintaining systemic energy balance in the body. New technologies have enabled us to go from studying the whole pancreas to isolated whole islets, to partial islet sections, and now to islet substructures isolated from within the islet. Using a microfluidic nanodroplet-based proteomics platform coupled with laser capture microdissection and field asymmetric waveform ion mobility spectrometry, we present an in-depth investigation of protein profiles specific to features within the islet. These features include the islet-acinar interface vascular tissue, inner islet vasculature, isolated endocrine cells, whole islet with vasculature, and acinar tissue from around the islet. Compared to interface vasculature, unique protein signatures observed in the inner vasculature indicate increased innervation and intra-islet neuron-like crosstalk. We also demonstrate the utility of these data for identifying localized structure-specific drug-target interactions using existing protein/drug binding databases.

Also flagged:COVID-19CholangiopathyAutoimmune Hepatitiscoronavirus disease 2019hepatitischolangitis
Journal Article 2022-10-14 ✓ 1 Snippet Zafar M, Gordon K, Macken L, Parvin J, Heath S, Whibley M, Tibble J.
In-Text Gene Mentions

…Genetic screening forhemochromatosisin view of…

Show Full Abstract

The coronavirus disease 2019 (COVID-19) pandemic has been associated with significant morbidity and mortality. Following the introduction of vaccines, various side effects have been reported. Whilst those reported may be attributed to the vaccine itself, at times, it may simply incite an immunological phenomenon. We present a case series of two patients who presented with symptoms of yellowing of the eyes and the skin along with fatigue, and tiredness, following vaccination for COVID-19. The diagnosis of post COVID-19-vaccination related hepatitis is one of the fewer, less understood, yet reported side effects associated with significant morbidity. The diagnosis of COVID-19 vaccination-related cholangitis is an outcome reported here for the first time to the best of our knowledge. It was alarming that both patients did not have any significant past history of medical ailments. A prompt assessment followed by investigations including liver biopsy assisted in a timely understanding of the phenomenon with complete resolution of the symptoms.

Also flagged:liver cancerliver diseaseschronic hepatitis Bliver cirrhosishepatocellular carcinomaHp
Journal Article 2022-10-14 ✓ 4 Snippets Huang H, Zhang Q, Zhang Y, Sun X, Liu C, Wang Q, Huang Y, Li Q, Wu Z, Pu C, Sun A.
In-Text Gene Mentions

Compared with the CHB group, the significantly down-regulated proteins in the AA group were SERPINC1, APOA4, and TTR (Table 3).

…AA group wereSERPINC1, APOA4, and TTR…

…AA group wereSERPINC1and APOA4 (…

…SERPIND1, FGA andSERPINC1were the core…

Show Full Abstract

<h4>Purpose</h4>Reliable biomarkers for the diagnosis and differential diagnosis of various stages of liver cancer are lacking. In this study, we aim to detect the levels of differentially expressed proteins (DEPs) in serum exosomes of patients with different liver diseases using a sensitive method.<h4>Patients and methods</h4>Exosomes were purified and validated. The expression of DEPs in exosomes from patients with chronic hepatitis B (CHB), liver cirrhosis (LC) and hepatocellular carcinoma (HCC) was validated by parallel reaction monitoring (PRM) technology and Western blotting, and the biological functions were analyzed by bioinformatics analysis.<h4>Results</h4>A total of 11 DEPs were identified by PRM technology. Significantly higher level of haptoglobin (Hp) was detected in HCC patients as compared to LC and CHB patients. HCC patients had a significantly lower level of transthyretin (TTR) in the patients with CHB. Among the patients with HCC who undertaken surgery, the postoperative levels of CRP, SERPINA3 and Heparin cofactor 2 (SERPIND1) were significantly reduced compared to their respective preoperative levels.<h4>Conclusion</h4>Hp and TTR may be potential markers for early diagnosis of HCC. CRP, SERPINA3 and SERPIND1 may serve as potential prognostic indicators for HCC patients undertaken surgery.

Also flagged:immune responseimmune responsesCOVID-19infectionACE2binding
Journal Article 2022-10-14 ✓ 1 Snippet Lee HK, Knabl L, Walter M, Furth PA, Hennighausen L.
In-Text Gene Mentions

…MMP8 , VHPS-5768;OLFM4( GW112 ),…

Show Full Abstract

Omicron is currently the dominant SARS-CoV-2 variant and several sublineages have emerged. Questions remain about the impact of previous SARS-CoV-2 exposure on cross-variant immune responses elicited by the SARS-CoV-2 Omicron sublineage BA.2 compared to BA.1. Here we show that without previous history of COVID-19, BA.2 infection induces a reduced immune response against all variants of concern (VOC) compared to BA.1 infection. The absence of ACE2 binding in sera of previously naïve BA.1 and BA.2 patients indicates a lack of meaningful neutralization. In contrast, anti-spike antibody levels and neutralizing activity greatly increased in the BA.1 and BA.2 patients with a previous history of COVID-19. Transcriptome analyses of peripheral immune cells showed significant differences in immune response and specific antibody generation between BA.1 and BA.2 patients as well as significant differences in the expression of specific immune genes. In summary, prior infection status significantly impacts the innate and adaptive immune response against VOC following BA.2 infection.

Also flagged:lung cancersmall-cell lung cancerSCLCepidermal growth factor receptorEGFRtyrosine kinase
Journal Article 2022-10-14 ✓ 1 Snippet Sato Y, Saito G, Fujimoto D.
In-Text Gene Mentions

In a mouse model,defects of TP53 and Rb1 depressed epigeneticinitiators, such as enhancers of the zeste homolog 2 (Ezh2) andsex-determining region Y-box 2 (Sox2), were identified, whichwere shown to be involved in resistance to antiandrogen therapy and lineageplasticity.108 De-repression of the placental gene, paternallyexpressed gene 10 (PEG10) and involvement of transmembraneserine protease 2(TMPRSS2)/endocrine/reproductive/gastrointestinal(ERG) fusion or transcription factors, such as the forkheadbox protein A1 (FOXA1) and POU domain class 3 transcriptionfactor 2 (POU3F2) have been reported to play roles in thesmall-cell transformation mechanisms of prostate cancer.109, , –112 However, although theloss of function of TP53 and Rb1 is commonbetween NSCLC and prostate cancer in the mechanism of HTs to SCLC, some of theabove-mentioned genes, especially the transcription factors, have not beenidentified in HTs to SCLC from NSCLC.

Show Full Abstract

Histologic transformation (HT) is a major cause of drug resistance to therapy in patients with lung cancer. HTs to small-cell lung cancer (SCLC) have been reported frequently in patients with epidermal growth factor receptor (<i>EGFR</i>)-mutated lung cancer. Although HTs have an impact on the clinical outcomes in patients owing to a high refractoriness to treatments, there is limited data on the prevalence, causes, mechanisms, treatment efficacy, and future treatment strategies. In this review, we assess the literature regarding HTs comprehensively, including those describing EGFR-tyrosine kinase inhibitors, other molecular targeted drugs, and immune checkpoint inhibitors. Furthermore, we discuss the mechanisms of HTs and the lineage plasticity to SCLC and squamous cell carcinoma in lung cancer. In addition, we summarize the treatment efficacy and future perspectives of HTs in patients with lung cancer, and propose better management strategies for this group of patients.

Also flagged:Calcium PhosphateHydroxyapatitesynthesisosteogenesisaginginfection
Journal Article 2022-10-14 No Snippets Hou X, Zhang L, Zhou Z, Luo X, Wang T, Zhao X, Lu B, Chen F, Zheng L.
Show Full Abstract

Traumatic, tumoral, and infectious bone defects are common in clinics, and create a big burden on patient's families and society. Calcium phosphate (CaP)-based biomaterials have superior properties and have been widely used for bone defect repair, due to their similarities to the inorganic components of human bones. The biological performance of CaPs, as a determining factor for their applications, are dependent on their physicochemical properties. Hydroxyapatite (HAP) as the most thermally stable crystalline phase of CaP is mostly used in the form of ceramics or composites scaffolds with polymers. Nanostructured CaPs with large surface areas are suitable for drug/gene delivery systems. Additionally, CaP scaffolds with hierarchical nano-/microstructures have demonstrated excellent ability in promoting bone regeneration. This review focuses on the relationships and interactions between the physicochemical/biological properties of CaP biomaterials and their species, sizes, and morphologies in bone regeneration, including synthesis strategies, structure control, biological behavior, and the mechanisms of CaP in promoting osteogenesis. This review will be helpful for scientists and engineers to further understand CaP-based biomaterials (CaPs), and be useful in developing new high-performance biomaterials for bone repair.

Also flagged:gene expressionco-transductiontranscription factorTFchondrogenesisSox9
Journal Article 2022-10-14 ✓ 5 Snippets Li M, Zhang L, Li J, Zhu Q.
In-Text Gene Mentions

Although double knockout of Sox5 and Sox6 leads to severe chondrodysplasia [46], lacking either of them has modest skeletal defects, suggestive of genetic redundancy.

…, Sfr1 ,Sox6, and Sox9…

…c-Myc, Foxa3, Plagl1,Sox6, Sox8, Sox5, Trps1,…

…than Sox9 +Sox6-containing combinations; and …

…a lesser extent,Sox6played an important…

Show Full Abstract

Treatment of full-thickness articular cartilage defects with exposure of subchondral bone often seen in osteoarthritic conditions has long been a great challenge, especially with a focus on the feasibility of in situ cartilage regeneration through minimally invasive procedures. Osteoblasts that situate in the subchondral bone plate may be considered a potentially vital endogenous source of cells for cartilage resurfacing through direct reprogramming into chondrocytes. Microarray-based gene expression profiles were generated to compare tissue-specific transcripts between subchondral bone and cartilage of mice and to assess age-dependent differences of chondrocytes as well. On osteoblast cell lines established from mouse proximal tibial subchondral bone, sequential screening by co-transduction of transcription factor (TF) genes that distinguish chondrocytes from osteoblasts reveals a shortlist of potential reprogramming factors exhibiting combined effects in inducing chondrogenesis of subchondral bone osteoblasts. A further combinatorial approach unexpectedly identified two 3-TF combinations containing Sox9 and Sox5 that exhibit differences in reprogramming propensity with the third TF c-Myc or Plagl1, which appeared to direct the converted chondrocytes toward either a superficial or a deeper zone phenotype. Thus, our approach demonstrates the possibility of converting osteoblasts into two major chondrocyte subpopulations with two combinations of three genes (Sox9, Sox5, and c-Myc or Plagl1). The findings may have important implications for developing novel in situ regeneration strategies for the reconstruction of full-thickness cartilage defects.

Also flagged:neuro-degenerative disorderchromosomeHDdeathmitochondrialPathogenesis
Journal Article 2022-10-14 ✓ 5 Snippets Irfan Z, Khanam S, Karmakar V, Firdous SM, El Khier BSIA, Khan I, Rehman MU, Khan A.
In-Text Gene Mentions

Mutations produce conformational anomalies and improper folding of htt in HD patients, resulting in a buildup of misfolded htt in the cytoplasm if chaperones are not precise.

Mutant htt interrupts CRE-mediated transcription in HD patients (Figure 1B) with direct interaction or sequestration of CBP and TAFII130 in the nucleus.

Mutation of Htt characterized with repeat expansion of CAG trinucleotides is the key factor in HD.

Background: Huntington’s disease is an inherited autosomal dominant trait neuro-degenerative disorder caused by changes (mutations) of a gene called huntingtin (htt) that is located on the short arm (p) of chromosome 4, CAG expansion mutation.

Xyloketal adheres to mutant htt proteins and inhibits the htt aggregation process, hence slowing the progression of HD [235].

Show Full Abstract

<h4>Background</h4>Huntington's disease is an inherited autosomal dominant trait neuro-degenerative disorder caused by changes (mutations) of a gene called huntingtin (<i>htt</i>) that is located on the short arm (p) of chromosome 4, CAG expansion mutation. It is characterized by unusual movements, cognitive and psychiatric disorders.<h4>Objective</h4>This review was undertaken to apprehend biological pathways of Huntington's disease (HD) pathogenesis and its management by nature-derived products. Natural products can be lucrative for the management of HD as it shows protection against HD in pre-clinical trials. Advanced research is still required to assess the therapeutic effectiveness of the known organic products and their isolated compounds in HD experimental models.<h4>Summary</h4>Degeneration of neurons in Huntington's disease is distinguished by progressive loss of motor coordination and muscle function. This is due to the expansion of CAG trinucleotide in the first exon of the <i>htt</i> gene responsible for neuronal death and neuronal network degeneration in the brain. It is believed that the factors such as molecular genetics, oxidative stress, excitotoxicity, mitochondrial dysfunction, neuroglia dysfunction, protein aggregation, and altered UPS leads to HD. The defensive effect of the natural product provides therapeutic efficacy against HD. Recent reports on natural drugs have enlightened the protective role against HD via antioxidant, anti-inflammatory, antiapoptotic, and neurofunctional regulation.

Also flagged:chronic obstructive pulmonary diseaseCOPDpathogenesisIEAATFCEP350
Journal Article 2022-10-14 ✓ 2 Snippets Su L, Qiao Y, Luo J, Huang R, Xiao Y.
In-Text Gene Mentions

…including, AATF ,HTT, CEP350, ADAMTS9, TLL2…

…group: AATF (18%),HTT(16%), CEP350 (14%),…

Show Full Abstract

Frequent acute exacerbations are the leading cause of high rates of hospitalization and mortality in chronic obstructive pulmonary disease (COPD). Despite the enormous worldwide medical burden, reliable molecular markers for effective early diagnosis and prognosis of acute exacerbations are still lacking. Both the host genetics and airway microbiome are known to play potential roles in the pathogenesis of frequent exacerbations. Here, we performed whole exome sequencing (WES) and 16S rRNA gene sequencing to explore the interaction between these two factors and their implications in the pathogenesis of frequent exacerbations. We collected peripheral blood (n = 82), sputum samples (n = 59) and clinical data from 50 frequent-exacerbation phenotype (FE) COPD patients and 32 infrequent-exacerbation phenotype (IE) as controls. Based on filtering the deleterious sites, candidate mutated genes shared only in FE patients and did not occur in the IE group were identified. Microbiota analysis revealed significant differences in bacterial diversity and composition between FE and IE groups. We report the underlying pathogenic gene including, <i>AATF</i>, <i>HTT, CEP350, ADAMTS9, TLL2</i> genes, etc., and explore their possible genotypic-phenotypic correlations with microbiota dysbiosis. Importantly, we observed that <i>AATF</i> gene mutations were significantly negatively correlated with microbial richness and diversity. Our study indicated several deleterious mutations in candidate genes that might be associated with microbial dysbiosis and the increased risk of frequent acute exacerbations in COPD patients. These results provide novel evidence that exomes and related microbiomes may potentially serve as biomarkers for predicting frequent acute exacerbations in COPD patients.

Also flagged:Cas9diffuse large B-cell lymphomaDLBCLmitochondrial ribosomal proteinsMHC-Iimmune response
Journal Article 2022-10-14 ✓ 5 Snippets Menegatti J, Nakel J, Stepanov YK, Caban KM, Ludwig N, Nord R, Pfitzner T, Yazdani M, Vilimova M, Kehl T, Lenhof HP, Philipp SE, Meese E, Fröhlich T, Grässer FA, Hart M.
In-Text Gene Mentions

…CFL2, CLIC4,STAU1, and TWF1 are…

…NUFIP2, HDLBP, SBDS,MRPL39, NPM3, MRPS5, MRPL44)…

…elongation (MRPS25, MRPL38,MRPL39, MRPS5, MRPL44), were…

…nodes: MRPL44, MRPS5,MRPL39, MRPS25, and MRPL38.…

…(e.g., CFL2, TWF1,STAU1and CLIC4) of…

Show Full Abstract

<h4>Background</h4>As microRNA-142 (miR-142) is the only human microRNA gene where mutations have consistently been found in about 20% of all cases of diffuse large B-cell lymphoma (DLBCL), we wanted to determine the impact of miR-142 inactivation on protein expression of DLBCL cell lines.<h4>Methods</h4>miR-142 was deleted by CRISPR/Cas9 knockout in cell lines from DLBCL.<h4>Results</h4>By proteome analyses, miR-142 knockout resulted in a consistent up-regulation of 52 but also down-regulation of 41 proteins in GC-DLBCL lines BJAB and SUDHL4. Various mitochondrial ribosomal proteins were up-regulated in line with their pro-tumorigenic properties, while proteins necessary for MHC-I presentation were down-regulated in accordance with the finding that miR-142 knockout mice have a defective immune response. CFL2, CLIC4, STAU1, and TWF1 are known targets of miR-142, and we could additionally confirm AKT1S1, CCNB1, LIMA1, and TFRC as new targets of miR-142-3p or -5p.<h4>Conclusions</h4>Seed-sequence mutants of miR-142 confirmed potential targets and novel targets of miRNAs can be identified in miRNA knockout cell lines. Due to the complex contribution of miRNAs within cellular regulatory networks, in particular when miRNAs highly present in RISC complexes are replaced by other miRNAs, primary effects on gene expression may be covered by secondary layers of regulation.

Also flagged:CalciumCell Proliferationrhabdomyolysisimmune responsepurine nucleotidemetabolism
Journal Article 2022-10-14 No Snippets Valberg SJ, Velez-Irizarry D, Williams ZJ, Henry ML, Iglewski H, Herrick K, Fenger C.
Show Full Abstract

Certain Standardbred racehorses develop recurrent exertional rhabdomyolysis (RER-STD) for unknown reasons. We compared gluteal muscle histopathology and gene/protein expression between Standardbreds with a history of, but not currently experiencing rhabdomyolysis (<i>N</i> = 9), and race-trained controls (<i>N</i> = 7). Eight RER-STD had a few mature fibers with small internalized myonuclei, one out of nine had histologic evidence of regeneration and zero out of nine degeneration. However, RER-STD versus controls had 791/13,531 differentially expressed genes (DEG). The top three gene ontology (GO) enriched pathways for upregulated DEG (<i>N</i> = 433) were inflammation/immune response (62 GO terms), cell proliferation (31 GO terms), and hypoxia/oxidative stress (31 GO terms). Calcium ion regulation (39 GO terms), purine nucleotide metabolism (32 GO terms), and electron transport (29 GO terms) were the top three enriched GO pathways for down-regulated DEG (<i>N</i> = 305). DEG regulated RYR1 and sarcoplasmic reticulum calcium stores. Differentially expressed proteins (DEP ↑<i>N</i> = 50, ↓<i>N</i> = 12) involved the sarcomere (24% of DEP), electron transport (23%), metabolism (20%), inflammation (6%), cell/oxidative stress (7%), and other (17%). DEP included ↑superoxide dismutase, ↑catalase, and DEP/DEG included several cysteine-based antioxidants. In conclusion, gluteal muscle of RER-susceptible Standardbreds is characterized by perturbation of pathways for calcium regulation, cellular/oxidative stress, inflammation, and cellular regeneration weeks after an episode of rhabdomyolysis that could represent therapeutic targets.

Also flagged:waterosmoregulationgene expressiontransmembranereproductiondigestion
Journal Article 2022-10-14 ✓ 1 Snippet Nedoluzhko A, Orlova SY, Kurnosov DS, Orlov AM, Galindo-Villegas J, Rastorguev SM.
In-Text Gene Mentions

…of synapse-110 ,dcc netrin 1 receptornetrin 1 receptor…

Show Full Abstract

Pacific herring (<i>Clupea pallasii</i>) is an essential target of commercial fishing in the North Pacific Ocean. Previous studies have suggested the existence of marine and lake ecological forms of this species within its range. The lake ecological form of herring has a shortened life cycle, spending the winter and spawning in brackish waters near the shoreline without long migrations for feeding; it also has a relatively smaller body size than the marine form. Genetic-based studies have shown that brackish water Pacific herring not only can be distinguished as a separate lake ecological form but possibly has its genetic legacy. Here, as part of an ongoing study, using ddRAD-sequencing data for marine and lake ecological forms from a total of 54 individuals and methods of comparative bioinformatics, we describe genomic signatures of freshwater adaptivity in Pacific herring. In total, 253 genes containing discriminating SNPs were found, and part of those genes was organized into genome clusters, also known as "genomic islands of divergence". Moreover, the Tajima's D test showed that these loci are under directional selection in the lake populations of the Pacific herring. Yet, most discriminating loci between the lake and marine ecological forms of Pacific herring do not intersect (by gene name) with those in other known marine fish species with known freshwater/brackish populations. However, some are associated with the same physiological trait-osmoregulation.

Also flagged:TFALBMBmetabolismALDOAGAPDH
Journal Article 2022-10-14 ✓ 3 Snippets Severino M, Gagaoua M, Baldassini W, Ribeiro R, Torrecilhas J, Pereira G, Curi R, Chardulo LA, Padilha P, Neto OM.
In-Text Gene Mentions

…ATP metabolism (ATP5F1B,PEBP1and AK1), indicating…

…(ATPIF1, ENO1, ENO3,PEBP1, PYGM, PGM1 and…

…(ALB, TF, MB,PEBP1and CA3) and…

Show Full Abstract

Proteomics has been widely used to study muscle biology and meat quality traits from different species including beef. Beef proteomics studies allow a better understanding of the biological processes related to meat quality trait determination. This study aimed to decipher by means of two-dimensional electrophoresis (2D-PAGE), mass spectrometry and bioinformatics the changes in post-mortem muscle with a focus on proteins differentially expressed in the Longissimus thoracis (LT) muscle of immunocastrated young heifers and steers. Carcass traits, chemical composition, pH, instrumental color (L*, a*, b*), cooking loss and Warner-Bratzler shear force (WBSF) of meat from F1 Montana-Nellore cattle were also evaluated. Backfat thickness (BFT) and intramuscular fat content (IMF) were 46.8% and 63.6% higher in heifers (p < 0.05), respectively, while evaporation losses (EL) were 10.22% lower compared to steers. No differences (p > 0.05) were observed for tenderness evaluated by WBSF (3, 10, and 17 days post-mortem), pH, and color traits (L*, a* and b*) between the experimental groups. The study revealed several proteins to be differentially expressed proteins in heifers compared steers (p < 0.05). In heifers, proteins involved in nutrient transport (TF, ALB, and MB), energy metabolism (ALDOA, GAPDH, and PKM), and oxidative stress and response to stress (HSPA8 and CA3) were associated with a greater BFT and IMF deposition. The higher expression of these proteins indicated greater oxidative capacity and lower glycolytic activity in the LT muscle of heifers. In steers, there was greater abundance of protein expression related to muscle contraction and proteins of structure (ACTA1, TPM2 and TNNT3), energy metabolism (ENO1, ENO3, PYGM, PGM1 and TPI1) and ATP metabolism (ATP5F1B, PEBP1 and AK1), indicating greater glycogenolysis in LT muscle, suggesting a shift in the glycolytic/oxidative fibers of steers.

Also flagged:Reward Deficiency SyndromeMental Illnesswatercognitiondepressionschizophrenia
Journal Article 2022-10-14 ✓ 2 Snippets Blum K, Dennen CA, Elman I, Bowirrat A, Thanos PK, Badgaiyan RD, Downs BW, Bagchi D, Baron D, Braverman ER, Gupta A, Green R, McLaughlin T, Barh D, Gold MS.
In-Text Gene Mentions

In fact, in terms of major depression, transcriptome-wide association research analyses of major depression indicated significant correlations with the expression of DRD2 in the nucleus accumbens (NAc) and NEGR1 in the hypothalamus, among others.

…accumbens (NAc) andNEGR1in the hypothalamus,…

Show Full Abstract

Reward Deficiency Syndrome (RDS) is defined as a breakdown of reward neurotransmission that results in a wide range of addictive, compulsive, and impulsive behaviors. RDS is caused by a combination of environmental (epigenetic) influences and DNA-based (genetic) neurotransmission deficits that interfere with the normal satisfaction of human physiological drives (i.e., food, water, and sex). An essential feature of RDS is the lack of integration between perception, cognition, and emotions that occurs because of (1) significant dopaminergic surges in motivation, reward, and learning centers causing neuroplasticity in the striato-thalamic-frontal cortical loop; (2) hypo-functionality of the excitatory glutamatergic afferents from the amygdala-hippocampus complex. A large volume of literature regarding the known neurogenetic and psychological underpinnings of RDS has revealed a significant risk of dopaminergic gene polymorphic allele overlap between cohorts of depression and subsets of schizophrenia. The suggestion is that instead of alcohol, opioids, gambling disorders, etc. being endophenotypes, the true phenotype is RDS. Additionally, reward deficiency can result from depleted or hereditary hypodopaminergia, which can manifest as a variety of personality traits and mental/medical disorders that have been linked to genetic studies with dopamine-depleting alleles. The carrying of known DNA antecedents, including epigenetic insults, results in a life-long vulnerability to RDS conditions and addictive behaviors. Epigenetic repair of hypodopaminergia, the causative basis of addictive behaviors, may involve precision DNA-guided therapy achieved by combining the Genetic Addiction Risk Severity (GARS) test with a researched neutraceutical having a number of variant names, including KB220Z. This nutraceutical formulation with pro-dopamine regulatory capabilities has been studied and published in peer-reviewed journals, mostly from our laboratory. Finally, it is our opinion that RDS should be given an ICD code and deserves to be included in the DSM-VI because while the DSM features symptomology, it is equally important to feature etiological roots as portrayed in the RDS model.

Also flagged:Vitamin Dgene expressionembryogenesisX-chromosomemethylationhistone
Journal Article 2022-10-14 ✓ 1 Snippet Mazur A, Frączek P, Tabarkiewicz J.
In-Text Gene Mentions

…s, coactivators, corepressors,chromatin modifiersmodifiers, remodelers, and…

Show Full Abstract

Epigenetics is a series of alterations regulating gene expression without disrupting the DNA sequence of bases. These regulatory mechanisms can result in embryogenesis, cellular differentiation, X-chromosome inactivation, and DNA-protein interactions. The main epigenetic mechanisms considered to play a major role in both health and disease are DNA methylation, histone modifications, and profiling of non-coding RNA. When the fragile balance between these simultaneously occurring phenomena is disrupted, the risk of pathology increases. Thus, the factors that determine proper epigenetic modeling are defined and those with disruptive influence are sought. Several such factors with proven negative effects have already been described. Diet and nutritional substances have recently been one of the most interesting targets of exploration for epigenetic modeling in disease states, including autoimmunity. The preventive role of proper nutrition and maintaining sufficient vitamin D concentration in maternal blood during pregnancy, as well as in the early years of life, is emphasized. Opportunities are also being investigated for affecting the course of the disease by exploring nutriepigenetics. The authors aim to review the literature presenting vitamin D as one of the important nutrients potentially modeling the course of disease in selected autoimmune disorders.

Also flagged:Phenolic AcidsDepressionpsychiatric disorderautophagyneurogenesismental disorder
Journal Article 2022-10-14 No Snippets Cordeiro MLDS, Martins VGQA, Silva APD, Rocha HAO, Rachetti VPS, Scortecci KC.
Show Full Abstract

Depression is a psychiatric disorder affecting the lives of patients and their families worldwide. It is an important pathophysiology; however, the molecular pathways involved are not well understood. Pharmacological treatment may promote side effects or be ineffective. Consequently, efforts have been made to understand the molecular pathways in depressive patients and prevent their symptoms. In this context, animal models have suggested phytochemicals from medicinal plants, especially phenolic acids, as alternative treatments. These bioactive molecules are known for their antioxidant and antiinflammatory activities. They occur in some fruits, vegetables, and herbal plants. This review focused on phenolic acids and extracts from medicinal plants and their effects on depressive symptoms, as well as the molecular interactions and pathways implicated in these effects. Results from preclinical trials indicate the potential of phenolic acids to reduce depressive-like behaviour by regulating factors associated with oxidative stress, neuroinflammation, autophagy, and deregulation of the hypothalamic-pituitary-adrenal axis, stimulating monoaminergic neurotransmission and neurogenesis, and modulating intestinal microbiota.

Also flagged:PolymercancerPolymerstumourwaterretinoids
Journal Article 2022-10-14 No Snippets Nicosia A, La Perna G, Cucci LM, Satriano C, Mineo P.
Show Full Abstract

Polymer-based systems have been demonstrated in novel therapeutic and diagnostic (theranostic) treatments for cancer and other diseases. Polymers provide a useful scaffold to develop multifunctional nanosystems that combine various beneficial properties such as drug delivery, bioavailability, and photosensitivity. For example, to provide passive tumour targeting of small drug molecules, polymers have been used to modify and functionalise the surface of water-insoluble drugs. This approach also allows the reduction of adverse side effects, such as retinoids. However, multifunctional polymer conjugates containing several moieties with distinct features have not been investigated in depth. This report describes the development of a one-pot approach to produce a novel multifunctional polymer conjugate. As a proof of concept, we synthesised polyvinyl alcohol (PVA) covalently conjugated with rhodamine B (a tracking agent), folic acid (a targeting agent), and all-trans retinoic acid (ATRA, a drug). The obtained polymer (PVA@RhodFR) was characterised by MALDI-TOF mass spectrometry, gel permeation chromatography, thermal analysis, dynamic light-scattering, NMR, UV-Vis, and fluorescence spectroscopy. Finally, to evaluate the efficiency of the multifunctional polymer conjugate, cellular differentiation treatments were performed on the neuroblastoma SH-SY5Y cell line. In comparison with standard ATRA-based conditions used to promote cell differentiation, the results revealed the high capability of the new PVA@RhodFR to induce neuroblastoma cells differentiation, even with a short incubation time and low ATRA concentration.

Also flagged:microcephalyCoronavirus Disease 2019COVID-19polymerinfectious diseasesphoton
Journal Article 2022-10-14 No Snippets Wu Y, Yang R, Wu Q, Huang M, Shu B, Wu W, Sun B, Xia J, Chen X, Liao Y.
Show Full Abstract

Emerging infectious diseases have brought a huge impact on human society in recent years. The outbreak of Zika virus (ZIKV) in the Americas resulted in a large number of babies born with microcephaly. More seriously, the Coronavirus Disease 2019 (COVID-19) was globally spread and caused immeasurable damages. Thus, the monitoring of highly pathogenic viruses is important to prevent and control emerging infectious diseases. Herein, a dendritic polymer probe-amplified ECL-scan imaging system was constructed to realize trace analysis of viral emerging infectious diseases. A dendritic polymer probe was employed as the efficient signal emitter component that could generate an amplified ECL signal on the integrated chip, and the signal was detected by a single-photon level charge coupled device-based ECL-scan imaging system. With this strategy, the ZIKV in a complex system of blood, urine, and saliva was detected. The results indicated that a high sensitivity of 50 copies and superior specificity were achieved. Furthermore, this strategy realized highly sensitive detection (10 copies) of the S and N protein gene sequence of the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-Cov2) and spiked pseudovirus samples. Thus, the dendritic polymer probe-amplified ECL-scan imaging system suitably met the strict clinical requirements for trace analysis of an emerging virus, and thus has the potential to serve as a paradigm for monitoring emerging infectious diseases.

Also flagged:deathorganizationoxygenbrain developmentlaminincorticogenesis
Journal Article 2022-10-14 ✓ 1 Snippet Sozzi E, Kajtez J, Bruzelius A, Wesseler MF, Nilsson F, Birtele M, Larsen NB, Ottosson DR, Storm P, Parmar M, Fiorenzano A.
In-Text Gene Mentions

…markers such asSOX6, FABP7 ,…

Show Full Abstract

Human pluripotent stem cells (hPSCs) are intrinsically able to self-organize into cerebral organoids that mimic features of developing human brain tissue. These three-dimensional structures provide a unique opportunity to generate cytoarchitecture and cell-cell interactions reminiscent of human brain complexity in a dish. However, current <i>in vitro</i> brain organoid methodologies often result in intra-organoid variability, limiting their use in recapitulating later developmental stages as well as in disease modeling and drug discovery. In addition, cell stress and hypoxia resulting from long-term culture lead to incomplete maturation and cell death within the inner core. Here, we used a recombinant silk microfiber network as a scaffold to drive hPSCs to self-arrange into engineered cerebral organoids. Silk scaffolding promoted neuroectoderm formation and reduced heterogeneity of cellular organization within individual organoids. Bulk and single cell transcriptomics confirmed that silk cerebral organoids display more homogeneous and functionally mature neuronal properties than organoids grown in the absence of silk scaffold. Furthermore, oxygen sensing analysis showed that silk scaffolds create more favorable growth and differentiation conditions by facilitating the delivery of oxygen and nutrients. The silk scaffolding strategy appears to reduce intra-organoid variability and enhances self-organization into functionally mature human brain organoids.

Also flagged:metabolismmetabolic diseasesATmetabolic diseasepathogenesisME
Journal Article 2022-10-14 No Snippets Michelotti TC, Kisby BR, Flores LS, Tegeler AP, Fokar M, Crasto C, Menarim BC, Loux SC, Strieder-Barboza C.
Show Full Abstract

Adipose tissue (AT) is an endocrine organ with a central role on whole-body energy metabolism and development of metabolic diseases. Single-cell and single-nuclei RNA sequencing (scRNA-seq and snRNA-seq, respectively) analyses in mice and human AT have revealed vast cell heterogeneity and functionally distinct subtypes that are potential therapeutic targets to metabolic disease. In periparturient dairy cows, AT goes through intensive remodeling and its dysfunction is associated with metabolic disease pathogenesis and decreased productive performance. The contributions of depot-specific cells and subtypes to the development of diseases in dairy cows remain to be studied. Our objective was to elucidate differences in cellular diversity of visceral (VAT) and subcutaneous (SAT) AT in dairy cows at the single-nuclei level. We collected matched SAT and VAT samples from three dairy cows and performed snRNA-seq analysis. We identified distinct cell types including four major mature adipocytes (AD) and three stem and progenitor cells (ASPC) subtypes, along with endothelial cells (EC), mesothelial cells (ME), immune cells, and pericytes and smooth muscle cells. All major cell types were present in both SAT and VAT, although a strong VAT-specificity was observed for ME, which were basically absent in SAT. One ASPC subtype was defined as adipogenic (<i>PPARG</i>+) while the other two had a fibro-adipogenic profile (<i>PDGFRA+</i>). We identified vascular and lymphatic EC subtypes, and different immune cell types and subtypes in both SAT and VAT, i.e., macrophages, monocytes, T cells, and natural killer cells. Not only did VAT show a greater proportion of immune cells, but these visceral immune cells had greater activation of pathways related to immune and inflammatory response, and complement cascade in comparison with SAT. There was a substantial contrast between depots for gene expression of complement cascade, which were greatly expressed by VAT cell subtypes compared to SAT, indicating a pro-inflammatory profile in VAT. Unprecedently, our study demonstrated cell-type and depot-specific heterogeneity in VAT and SAT of dairy cows. A better understanding of depot-specific molecular and cellular features of SAT and VAT will aid in the development of AT-targeted strategies to prevent and treat metabolic disease in dairy cows, especially during the periparturient period.

Also flagged:mineralPhosphoruscalciuminositol phosphatesInsP 6degradation
Journal Article 2022-10-14 ✓ 5 Snippets Ponsuksili S, Hadlich F, Perdomo-Sabogal A, Reyer H, Oster M, Trakooljul N, Iqbal MA, Schmucker S, Stefanski V, Roth C, Silva AC, Huber K, Sommerfeld V, Rodehutscord M, Wimmers K.
In-Text Gene Mentions
⭐ same-sentence co-mention

…cover the transcriptsVSIG10, PEBP1 and the…

⭐ same-sentence co-mention

…the transcripts VSIG10,PEBP1and the miRNAs…

…was observed betweenVSIG10and miRNA-181b-5p transcripts…

…protein 1 (PEBP1) and V-set…

…containing 10 (VSIG10) were strongly…

Show Full Abstract

Aggregation of data, including deep sequencing of mRNA and miRNA data in jejunum mucosa, abundance of immune cells, metabolites, or hormones in blood, composition of microbiota in digesta and duodenal mucosa, and production traits collected along the lifespan, provides a comprehensive picture of lifelong adaptation processes. Here, respective data from two laying hen strains (Lohmann Brown-Classic (LB) and Lohmann LSL-Classic (LSL) collected at 10, 16, 24, 30, and 60 wk of age were analyzed. Data integration revealed strain- and stage-specific biosignatures, including elements indicative of molecular pathways discriminating the strains. Although the strains performed the same, they differed in the activity of immunological and metabolic functions and pathways and showed specific gut-microbiota-interactions in different production periods. The study shows that both strains employ different strategies to acquire and maintain their capabilities under high performance conditions, especially during the transition phase. Furthermore, the study demonstrates the capacity of such integrative analyses to elucidate molecular pathways that reflect functional biodiversity. The bioinformatic reduction of the multidimensional data provides good guidance for further manual review of the data.

Also flagged:ossificationinfectionosteoporosisdiabetesmethyl methacrylatemetals
Journal Article 2022-10-14 ✓ 1 Snippet Nadine S, Fernandes IJ, Correia CR, Mano JF.
In-Text Gene Mentions

Although mice deficient in Sox5 or Sox6 alone survive with mild skeletal dysplasia, the formation of cartilage in Sox5/Sox6 double-knockout mice is harshly compromised.38

Show Full Abstract

In order to solve the clinical challenges related to bone grafting, several tissue engineering (TE) strategies have been proposed to repair critical-sized defects. Generally, the classical TE approaches are designed to promote bone repair via intramembranous ossification. Although promising, strategies that direct the osteogenic differentiation of mesenchymal stem/stromal cells are usually characterized by a lack of functional vascular supply, often resulting in necrotic cores. A less explored alternative is engineering bone constructs through a cartilage-mediated approach, resembling the embryological process of endochondral ossification. The remodeling of an intermediary hypertrophic cartilaginous template triggers vascular invasion and bone tissue deposition. Thus, employing this knowledge can be a promising direction for the next generation of bone TE constructs. This review highlights the most recent biomimetic strategies for applying endochondral ossification in bone TE while discussing the plethora of cell types, culture conditions, and biomaterials essential to promote a successful bone regeneration process.

Also flagged:AMPKNonalcoholic fatty liver diseaseNAFLDnonalcoholic steatohepatitisNASHmetabolic syndrome
Journal Article 2022-10-14 ✓ 1 Snippet Song N, Xu H, Wu S, Luo S, Xu J, Zhao Q, Wang R, Jiang X.
In-Text Gene Mentions

…primary biliary cirrhosis,hemochromatosis, drug-induced liver disease…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD), especially nonalcoholic steatohepatitis (NASH), is a common hepatic manifestation of metabolic syndrome. However, there are no effective therapy to treat this devastating disease. Accumulating evidence suggests that the generation of elastin-derived peptides (EDPs) and the inhibition of adiponectin receptors (AdipoR)1/2 plays essential roles in hepatic lipid metabolism and liver fibrosis. We recently reported that the AdipoR1/2 dual agonist JT003 significantly degraded the extracellular matrix (ECM) and ameliorated liver fibrosis. However, the degradation of the ECM lead to the generation of EDPs, which could further alter liver homeostasis negatively. Thus, in this study, we successfully combined AdipoR1/2 agonist JT003 with V14, which acted as an inhibitor of EDPs-EBP interaction to overcome the defect of ECM degradation. We found that combination of JT003 and V14 possessed excellent synergistic benefits on ameliorating NASH and liver fibrosis than either alone since they compensate the shortage of each other. These effects are induced by the enhancement of the mitochondrial antioxidant capacity, mitophagy, and mitochondrial biogenesis <i>via</i> AMPK pathway. Furthermore, specific suppression of AMPK could block the effects of the combination of JT003 and V14 on reduced oxidative stress, increased mitophagy and mitochondrial biogenesis. These positive results suggested that this administration of combination of AdipoR1/2 dual agonist and inhibitor of EDPs-EBP interaction can be recommended alternatively for an effective and promising therapeutic strategy for the treatment of NAFLD and NASH related fibrosis.

Also flagged:dementiavascular dementiafrontotemporal dementiaParkincognitive declinetau
Journal Article 2022-10-14 ✓ 1 Snippet Lindbohm JV, Mars N, Sipilä PN, Singh-Manoux A, Runz H, FinnGen, Livingston G, Seshadri S, Xavier R, Hingorani AD, Ripatti S, Kivimäki M.
In-Text Gene Mentions

…IFNAR1, IL-27 andNEGR1.…

Show Full Abstract

Immune system and blood-brain barrier dysfunction are implicated in the development of Alzheimer's and other dementia-causing diseases, but their causal role remains unknown. We performed Mendelian randomization for 1,827 immune system- and blood-brain barrier-related biomarkers and identified 127 potential causal risk factors for dementia-causing diseases. Pathway analyses linked these biomarkers to amyloid-β, tau and α-synuclein pathways and to autoimmunity-related processes. A phenome-wide analysis using Mendelian randomization-based polygenic risk score in the FinnGen study (n = 339,233) for the biomarkers indicated shared genetic background for dementias and autoimmune diseases. This association was further supported by human leukocyte antigen analyses. In inverse-probability-weighted analyses that simulate randomized controlled drug trials in observational data, anti-inflammatory methotrexate treatment reduced the incidence of Alzheimer's disease in high-risk individuals (hazard ratio compared with no treatment, 0.64, 95% confidence interval 0.49-0.88, P = 0.005). These converging results from different lines of human research suggest that autoimmunity is a modifiable component in dementia-causing diseases.

Also flagged:extracellularvesiclesmitochondrialpathogenesisneurodegenerative diseasesHuntington's disease
Journal Article 2022-10-14 No Snippets Beatriz M, Vilaça R, Anjo SI, Manadas B, Januário C, Rego AC, Lopes C.
Show Full Abstract

Mitochondrial and autophagy dysfunction are mechanisms proposed to be involved in the pathogenesis of several neurodegenerative diseases. Huntington's disease (HD) is a progressive neurodegenerative disorder associated with mutant Huntingtin-induced abnormalities in neuronal mitochondrial dynamics and quality control. Former studies suggest that the removal of defective mitochondria may be compromised in HD. Mitochondrial quality control (MQC) is a complex, well-orchestrated pathway that can be compromised through mitophagy dysregulation or impairment in the mitochondria-lysosomal axis. Another mitochondrial stress response is the generation of mitochondrial-derived vesicles that fuse with the endolysosomal system and form multivesicular bodies that are extruded from cells as extracellular vesicles (EVs). In this work, we aimed to study the presence of mitochondrial components in human EVs and the relation to the dysfunction of both mitochondria and the autophagy pathway. We comprehensively characterized the mitochondrial and autophagy alterations in premanifest and manifest HD carriers and performed a proteomic and genomic EVs profile. We observed that manifest HD patients exhibit mitochondrial and autophagy impairment associated with enhanced EVs release. Furthermore, we detected mitochondrial DNA and proteins in EVs released by HD cells and in neuronal-derived EVs including VDAC-1 and alpha and beta subunits of ATP synthase F1. HD-extracellular vesicles transport higher levels of mitochondrial genetic material in manifest HD patients, suggesting an alternative pathway for the secretion of reactive mitochondrial components. This study provides a novel framework connecting EVs enhanced release of mitochondrial components to mitochondrial and lysosomal dysfunction in HD.

Also flagged:extracellularvesiclevesicleswound healingdegradationmembranes
Journal Article 2022-10-14 No Snippets Chen A, Tian H, Yang N, Zhang Z, Yang GY, Cui W, Tang Y.
Show Full Abstract

The discovery and development of extracellular vesicles in tissue engineering have shown great potential for tissue regenerative therapies. However, their vesicle nature requires dosage-dependent administration and efficient interactions with recipient cells. Researchers have resorted to biomaterials for localized and sustained delivery of extracellular vesicles to the targeted cells, but not much emphasis has been paid on the design of the materials, which deeply impacts their molecular interactions with the loaded extracellular vesicles and subsequent delivery. Therefore, we present in this review a comprehensive survey of extracellular vesicle delivery systems from the viewpoint of material design at the molecular level. We start with general requirements of the materials and delve into different properties of delivery systems as a result of different designs, from material selections to processing strategies. Based on these differences, we analyzed the performance of extracellular vesicle delivery and tissue regeneration in representative studies. In light of the current missing links within the relationship of material structures, physicochemical properties and delivery performances, we provide perspectives on the interactions of materials and extracellular vesicles and the possible extension of materials. This review aims to be a strategic enlightenment for the future design of extracellular vesicle delivery systems to facilitate their translation from basic science to clinical applications.

bioRxiv 2022-10-14 Preprint (No Snippets API) van Duin L, Krautz R, Rennie S, Andersson R.
Show Full Abstract

Many genes are co-expressed and form genomic domains of coordinated gene activity. However, the regulatory determinants of domain co-activity remain unclear. Here, we leverage human individual variation in gene expression to characterize the co-regulatory processes underlying domain co-activity and systematically quantify their effect sizes. We employ transcriptional decomposition to extract from RNA expression data an expression component related to co-activity revealed by genomic positioning. This strategy reveals close to 1,500 co-activity domains, covering most expressed genes, of which the large majority are invariable across individuals. Focusing specifically on domains with high variability in co-activity reveals that contained genes have a higher sharing of eQTLs, a higher variability in enhancer interactions, and an enrichment of binding by variably expressed transcription factors compared to genes within non-variable domains. Through careful quantification of the relative contributions of regulatory processes underlying co-activity, we find transcription factor expression levels to be the main determinant of gene co-activity. Our results indicate that distal trans effects contribute more than local genetic variation to individual variation in co-activity domains.

Also flagged:liver diseaseAlagille syndromecholestasisALGSportal hypertensiondeath
Journal Article 2022-10-13 No Snippets Vandriel SM, Li LT, She H, Wang JS, Gilbert MA, Jankowska I, Czubkowski P, Gliwicz-Miedzińska D, Gonzales EM, Jacquemin E, Bouligand J, Spinner NB, Loomes KM, Piccoli DA, D'Antiga L, Nicastro E, Sokal É, Demaret T, Ebel NH, Feinstein JA, Fawaz R, Nastasio S, Lacaille F, Debray D, Arnell H, Fischler B, Siew S, Stormon M, Karpen SJ, Romero R, Kim KM, Baek WY, Hardikar W, Shankar S, Roberts AJ, Evans HM, Jensen MK, Kavan M, Sundaram SS, Chaidez A, Karthikeyan P, Sanchez MC, Cavalieri ML, Verkade HJ, Lee WS, Squires JE, Hajinicolaou C, Lertudomphonwanit C, Fischer RT, Larson-Nath C, Mozer-Glassberg Y, Arikan C, Lin HC, Bernabeu JQ, Alam S, Kelly DA, Carvalho E, Ferreira CT, Indolfi G, Quiros-Tejeira RE, Bulut P, Calvo PL, Önal Z, Valentino PL, Desai DM, Eshun J, Rogalidou M, Dezsőfi A, Wiecek S, Nebbia G, Pinto RB, Wolters VM, Tamara ML, Zizzo AN, Garcia J, Schwarz K, Beretta M, Sandahl TD, Jimenez-Rivera C, Kerkar N, Brecelj J, Mujawar Q, Rock N, Busoms CM, Karnsakul W, Lurz E, Santos-Silva E, Blondet N, Bujanda L, Shah U, Thompson RJ, Hansen BE, Kamath BM, Global ALagille Alliance (GALA) Study Group.
Show Full Abstract

<h4>Background and aims</h4>Alagille syndrome (ALGS) is a multisystem disorder, characterized by cholestasis. Existing outcome data are largely derived from tertiary centers, and real-world data are lacking. This study aimed to elucidate the natural history of liver disease in a contemporary, international cohort of children with ALGS.<h4>Approach and results</h4>This was a multicenter retrospective study of children with a clinically and/or genetically confirmed ALGS diagnosis, born between January 1997 and August 2019. Native liver survival (NLS) and event-free survival rates were assessed. Cox models were constructed to identify early biochemical predictors of clinically evident portal hypertension (CEPH) and NLS. In total, 1433 children (57% male) from 67 centers in 29 countries were included. The 10 and 18-year NLS rates were 54.4% and 40.3%. By 10 and 18 years, 51.5% and 66.0% of children with ALGS experienced ≥1 adverse liver-related event (CEPH, transplant, or death). Children (>6 and ≤12 months) with median total bilirubin (TB) levels between ≥5.0 and <10.0 mg/dl had a 4.1-fold (95% confidence interval [CI], 1.6-10.8), and those ≥10.0 mg/dl had an 8.0-fold (95% CI, 3.4-18.4) increased risk of developing CEPH compared with those <5.0 mg/dl. Median TB levels between ≥5.0 and <10.0 mg/dl and >10.0 mg/dl were associated with a 4.8 (95% CI, 2.4-9.7) and 15.6 (95% CI, 8.7-28.2) increased risk of transplantation relative to <5.0 mg/dl. Median TB <5.0 mg/dl were associated with higher NLS rates relative to ≥5.0 mg/dl, with 79% reaching adulthood with native liver ( p < 0.001).<h4>Conclusions</h4>In this large international cohort of ALGS, only 40.3% of children reach adulthood with their native liver. A TB <5.0 mg/dl between 6 and 12 months of age is associated with better hepatic outcomes. These thresholds provide clinicians with an objective tool to assist with clinical decision-making and in the evaluation of therapies.

Also flagged:antibodycortisolglucoseantibodiessurface plasmonGlass
Journal Article 2022-10-13 ✓ 1 Snippet Buskermolen AD, Lin YT, van Smeden L, van Haaften RB, Yan J, Sergelen K, de Jong AM, Prins MWJ.
In-Text Gene Mentions

PBS tablets, NaCl, Cortisol 3-CMO, NHS, DCC-Urea, EDC, HOBt, DIPEA, sucrose, trehalose, and bovine serum albumin (BSA) were purchased from Sigma-Aldrich.

Show Full Abstract

There is a need for sensing technologies that can continuously monitor concentration levels of critical biomolecules in applications such as patient care, fundamental biological research, biotechnology and food industry, as well as the environment. However, it is fundamentally difficult to develop measurement technologies that are not only sensitive and specific, but also allow monitoring over a broad concentration range and over long timespans. Here we describe a continuous biomolecular sensing methodology based on the free diffusion of biofunctionalized particles hovering over a sensor surface. The method records digital events due to single-molecule interactions and enables biomarker monitoring at picomolar to micromolar concentrations without consuming any reagents. We demonstrate the affinity-based sensing methodology for DNA-based sandwich and competition assays, and for an antibody-based cortisol assay. Additionally, the sensor can be dried, facilitating storage over weeks while maintaining its sensitivity. We foresee that this will enable the development of continuous monitoring sensors for applications in fundamental research, for studies on organs on a chip, for the monitoring of patients in critical care, and for the monitoring of industrial processes and bioreactors as well as ecological systems.

Also flagged:benzo[a]pyrenechronic obstructive pulmonary diseaselung adenocarcinomaCOPDlipopolysaccharidecell proliferation
Journal Article 2022-10-13 ✓ 1 Snippet Wang L, Chen Q, Liu T, Bai T, Zhang M, Hu Y, Li J, Chang F.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Objective</h4>This experiment is explores the genes that play a key role, their expression changes and the biological processes in the transformation of chronic obstructive pulmonary disease (COPD) into lung adenocarcinoma (LAC). Meanwhile, identify the effects of Benzo[a]pyrene (BaP) in the conversion of COPD into LAC.<h4>Methods</h4>1. Differential expression genes of COPD and LAC were screened and analyzed by high-throughput microarray data between the two diseases and their respective control groups. 2. The screened genes were used for routine bioinformatics analysis such as functional analysis, expression verification, protein interaction analysis and functional enrichment. 3. Cigarette smoke extract (CSE) combined with lipopolysaccharide (LPS) was used to establish an in vitro COPD model. 4. MTT assay was used to detect the influence of B(a)P in effect on A549 cell proliferation. CCK-8, Transwell invasion test and scratch test were used to detect the cell proliferation, invasion and migration ability, while qPCR and Western Blot tests were used to observe the cell proliferation, apoptosis and changes in related indicators such as EMT. 5. Experimental method of separately adding agonists (tBHQ) and inhibitors (DIC) of NQO1 was used to confirm the effect of NQO1 on A549 cell proliferation, apoptosis, migration and invasion. 6. To further clarify whether BaP exerted effect on cell proliferation, apoptosis, migration and invasion through NQO1, we knocked down NQO1 gene and then infecting cells with BaP.<h4>Results</h4>1. We screened genes of COPD and LAC using datasets from GSE151052, GSE118370, and GSE140797. After screening, the genes upregulated in COPD and downregulated in LAC were RTKN2, SLC6A4, and HBB, the gene downregulated in COPD and upregulated in LAC was NQO1, the genes downregulated in both COPD and LAC were FPR1, LYVE1 and PKHD1L1. 2. The main signaling pathways in which the target genes were enriched are cell cycle, EMT, PI3K/AKT, and apoptosis. In the data included GEPIA, PKHD1L1, FPR1, LYVE1, RTKN2, HBB, and SLC6A4 were significantly downregulated and NQO1 was upregulated in LAC relative to controls. In addition, there were 46 interaction proteins in the target genes, and the functions they enriched included hydrogen peroxide catabolism, etc. 3. When A549 cell was stimulated with 100 ng/mL LPS+ 10% CSE, the COX-2 expression indicated that COPD model in vitro was successfully established. 4. The optimal dose and action time were screened which were 1 μM and 24 h. Compared to the control group, COPD and BaP group increased cell proliferation and invasion capabilities. On the basis of COPD, adding BaP could further increase the proliferation and migration capabilities. Interestingly, the levels of NQO1 decreased in COPD models, while increased by BaP. 5. tBHQ can increase the proliferation and migration capacity of A549 cells, which is inhibited by the addition of DIC. 6. The enhanced proliferation, migration and invasion of A549 cells by BaP were attenuated after knockdown of NQO1.<h4>Conclusion</h4>Our study reveals that PKHD1L1, FPR1, LYVE1, RTKN2, HBB, SLC6A4 and NQO1 may play an important role in the conversion of COPD to LAC. High NQO1 expression may increase the proliferation and migration ability of A549 cells, and BaP may promote the EMT state by increasing the expression of NQO1, thereby making the COPD model in vitro expose the tumor characteristics.

Also flagged:chromatinG1 phasechromatin remodelingchromosomeGene expressionresponse to
Journal Article 2022-10-13 ✓ 1 Snippet Min S, Ji JH, Heo Y, Cho H.
In-Text Gene Mentions

…of transcription, recruitingpolycomb repressiverepressive complex (PRC)…

Show Full Abstract

In eukaryotic cells, DNA damage can occur at any time and at any chromatin locus, including loci at which active transcription is taking place. DNA double-strand breaks affect chromatin integrity and elicit a DNA damage response to facilitate repair of the DNA lesion. Actively transcribed genes near DNA lesions are transiently suppressed by crosstalk between DNA damage response factors and polycomb repressive complexes. Epigenetic modulation of the chromatin environment also contributes to efficient DNA damage response signaling and transcriptional repression. On the other hand, RNA transcripts produced in the G1 phase, as well as the active chromatin context of the lesion, appear to drive homologous recombination repair. Here, we discuss how the ISWI family of chromatin remodeling factors coordinates the DNA damage response and transcriptional repression, especially in transcriptionally active regions, highlighting the direct modulation of the epigenetic environment.

Also flagged:Notchdigestive cancerscancergene expressiontranslationalcolorectal cancer
Journal Article 2022-10-13 ✓ 4 Snippets Emam O, Wasfey EF, Hamdy NM.
In-Text Gene Mentions

The conventional chromosomal instability mechanism is characterized by the accumulation of mutations that are initiated after mutational inactivation in the adenomatous polyposis coli (APC), accompanied by oncogenes activations including ki-ras2 Kirsten rat sarcoma viral oncogene homolog (Kras), cyclooxygenase-2 (COX2) and v-raf murine sarcoma viral oncogene homolog B1 (BRAF), tumor suppressor genes silencing including TP53, Deleted in colon cancer/Deleted in pancreatic cancer locus4 (DCC/DPC4) and loss of heterozygosity of chromosome 18 [171, 172].

…NFX1-Type Containing 1 (ZNFX1) antisense RNA (ZFAS1)…

…strand next toZNFX1protein coding gene;…

…pancreatic cancer locus4 (DCC/DPC4) and loss of…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is one of the most prevalent digestive cancers, ranking the 2nd cause of cancer-related fatality worldwide. The worldwide burden of CRC is predicted to rise by 60% by 2030. Environmental factors drive, first, inflammation and hence, cancer incidence increase. MAIN: The Notch-signaling system is an evolutionarily conserved cascade, has role in the biological normal developmental processes as well as malignancies. Long non-coding RNAs (LncRNAs) have become major contributors in the advancement of cancer by serving as signal pathways regulators. They can control gene expression through post-translational changes, interactions with micro-RNAs or down-stream effector proteins. Recent emerging evidence has emphasized the role of lncRNAs in controlling Notch-signaling activity, regulating development of several cancers including CRC.<h4>Conclusion</h4>Notch-associated lncRNAs might be useful prognostic biomarkers or promising potential therapeutic targets for CRC treatment. Therefore, here-in we will focus on the role of "Notch-associated lncRNAs in CRC" highlighting "the impact of Notch-associated lncRNAs as player for cancer induction and/or progression."

Also flagged:deliriumSepsisencephalopathysleepcognitivehypersensitivity
Journal Article 2022-10-13 No Snippets Consoli DC, Spitznagel BD, Owen BM, Kang H, Williams Roberson S, Pandharipande P, Wesley Ely E, Nobis WP, Bastarache JA, Harrison FE.
Show Full Abstract

Sepsis and systemic inflammation are often accompanied by severe encephalopathy, sleep disruption and delirium that strongly correlate with poor clinical outcomes including long-term cognitive deficits. The cardinal manifestations of delirium are fluctuating altered mental status and inattention, identified in critically ill patients by interactive bedside assessment. The lack of analogous assessments in mouse models or clear biomarkers is a challenge to preclinical studies of delirium. In this study, we utilized concurrent measures of telemetric EEG recordings and neurobehavioral tasks in mice to characterize inattention and persistent cognitive deficits following polymicrobial sepsis. During the 24-hour critical illness period for the mice, slow-wave EEG dominance, sleep disruption, and hypersensitivity to auditory stimuli in neurobehavioral tasks resembled clinical observations in delirious patients in which alterations in similar outcome measurements, although measured differently in mice and humans, are reported. Mice were tested for nest building ability 7 days after sepsis induction, when sickness behaviors and spontaneous activity had returned to baseline. Animals that showed persistent deficits determined by poor nest building at 7 days also exhibited molecular changes in hippocampal long-term potentiation compared to mice that returned to baseline cognitive performance. Together, these behavioral and electrophysiological biomarkers offer a robust mouse model with which to further probe molecular pathways underlying brain and behavioral changes during and after acute illness such as sepsis.

Also flagged:Zearalenone-zearalenolβ-zearalenolmetabolismgene expressionamino acid
Journal Article 2022-10-13 ✓ 1 Snippet Ma L, Jiang Y, Lu F, Wang S, Liu M, Liu F, Huang L, Li Y, Jiao N, Jiang S, Yuan X, Yang W.
In-Text Gene Mentions

…, pericentric heterochromatin,histone deacetylase complexdeacetylase complex, and…

Show Full Abstract

Zearalenone (ZEN), also known as the F-2 toxin, is a common contaminant in cereal crops and livestock products. This experiment aimed to reveal the changes in the proteomics of ZEN-induced intestinal damage in weaned piglets by tandem mass spectrometry tags. Sixteen weaned piglets either received a basal diet or a basal diet supplemented with 3.0 mg/kg ZEN in a 32 d study. The results showed that the serum levels of ZEN, α-zearalenol, and β-zearalenol were increased in weaned piglets exposed to ZEN (p < 0.05). Zearalenone exposure reduced apparent nutrient digestibility, increased intestinal permeability, and caused intestinal damage in weaned piglets. Meanwhile, a total of 174 differential proteins (DEPs) were identified between control and ZEN groups, with 60 up-regulated DEPs and 114 down-regulated DEPs (FC > 1.20 or <0.83, p < 0.05). Gene ontology analysis revealed that DEPs were mainly involved in substance transport and metabolism, gene expression, inflammatory, and oxidative stress. The Kyoto Encyclopedia of Genes and Genomes analysis revealed that DEPs were significantly enriched in 25 signaling pathways (p < 0.05), most of which were related to inflammation and amino acid metabolism. Our study provides valuable clues to elucidate the possible mechanism of ZEN-induced intestinal injury.

Also flagged:epidermal growth factor receptorstem cell proliferationprogesteronecalvingoestrusgestation
Journal Article 2022-10-13 ✓ 1 Snippet Liu Q, Zhang M, Guo T, Wu S, Zong Y, Xu C, Zhu Z, Zhang Y, Cao Z.
In-Text Gene Mentions

…NEDD4 , circSOX6(down-regulated), and circ…

Show Full Abstract

Circular RNA (circRNA) is expressed in cells and tissues of several species. However, the expression of circRNAs in the blood of Jianghuai buffaloes during early pregnancy has not been reported. In this study, we identified the DECs in the blood of Jianghuai buffaloes and annotated the functions of these DECs. The results showed that there were 890 DECs between the pregnant and non-pregnant groups, of which more than 80% were exon-derived circRNAs, including 323 up-regulated circRNAs and 567 down-regulated circRNAs. Enrichment analysis revealed that DECs were mainly enriched in the epidermal growth factor receptor-signaling pathway important for embryonic development and pregnancy maintenance. In addition, most DECs have multiple miRNA targets, suggesting that these DECs have the potential to function as miRNA sponges. In conclusion, several DECs are present between pregnant and non-pregnant Jianghuai buffaloes, and these DECs are associated with embryo implantation and pregnancy establishment.

Also flagged:MethylationHistonechronic inflammatory diseaseperiodontitispathogenesisperiodontal inflammation
Journal Article 2022-10-13 ✓ 2 Snippets Liaw A, Liu C, Ivanovski S, Han P.
In-Text Gene Mentions

Differential DNA methylation at the promoter regions of 12 genes (DCC, KCNA3, KCNA2, RIMS2, HOXB7, PNOC, IRX1, JSRP1, TBX1, OPCML, CECR1, SCN4B) has been detected between periodontitis and clinically healthy tissues [41].

…of 12 genes (DCC, KCNA3, KCNA2, RIMS2,…

Show Full Abstract

<i>Background</i>: Periodontitis is a chronic inflammatory disease involving an interplay between bacteria, inflammation, host response genes, and environmental factors. The manifestation of epigenetic factors during periodontitis pathogenesis and periodontal inflammation is still not well understood, with limited reviews on histone modification with periodontitis management. This scoping review aims to evaluate current evidence of global and specific DNA methylation and histone modification in periodontitis and discuss the gaps and implications for future research and clinical practice. <i>Methods</i>: A scoping literature search of three electronic databases was performed in SCOPUS, MEDLINE (PubMed) and EMBASE. As epigenetics in periodontitis is an emerging research field, a scoping review was conducted to identify the extent of studies available and describe the overall context and applicability of these results. <i>Results</i>: Overall, 30 studies were evaluated, and the findings confirmed that epigenetic changes in periodontitis comprise specific modifications to DNA methylation patterns and histone proteins modification, which can either dampen or promote the inflammatory response to bacterial challenge. <i>Conclusions</i>: The plasticity of epigenetic modifications has implications for the future development of targeted epi-drugs and diagnostic tools in periodontitis. Such advances could be invaluable for the early detection and monitoring of susceptible individuals.

Also flagged:WntAgingcancersKlothoprogeriascaffolding protein
Journal Article 2022-10-13 No Snippets Asano N, Takeuchi A, Imatani A, Saito M, Jin X, Hatta W, Uno K, Koike T, Masamune A.
Show Full Abstract

Aging is considered a risk factor for various diseases including cancers. In this aging society, there is an urgent need to clarify the molecular mechanisms involved in aging. Wnt signaling has been shown to play a crucial role in the maintenance and differentiation of tissue stem cells, and intensive studies have elucidated its pivotal role in the aging of neural and muscle stem cells. However, until recently, such studies on the gastrointestinal tract have been limited. In this review, we discuss recent advances in the study of the role of Wnt signaling in the aging of the gastrointestinal tract and aging-related carcinogenesis.

Also flagged:SelenomethionineMethylmercuryseleniumimmune responsesataxiahearing
Journal Article 2022-10-13 ✓ 1 Snippet Mellingen RM, Myrmel LS, Rasinger JD, Lie KK, Bernhard A, Madsen L, Nøstbakken OJ.
In-Text Gene Mentions

…(MGST3) and peroxiredoxin-6 (PRDX6) from our dataset.…

Show Full Abstract

Methylmercury (MeHg) is a well-known environmental contaminant, particularly harmful to the developing brain. The main human dietary exposure to MeHg occurs through seafood consumption. However, seafood also contains several nutrients, including selenium, which has been shown to interact with MeHg and potentially ameliorate its toxicity. The aim of this study was to investigate the combined effects of selenium (as selenomethionine; SeMet) and MeHg on mercury accumulation in tissues and the effects concomitant dietary exposure of these compounds exert on the hippocampal proteome and transcriptome in mice. Adolescent male BALB/c mice were exposed to SeMet and two different doses of MeHg through their diet for 11 weeks. Organs, including the brain, were sampled for mercury analyses. Hippocampi were collected and analyzed using proteomics and transcriptomics followed by multi-omics bioinformatics data analysis. The dietary presence of SeMet reduced the amount of mercury in several organs, including the brain. Proteomic and RNA-seq analyses showed that both protein and RNA expression patterns were inversely regulated in mice receiving SeMet together with MeHg compared to MeHg alone. Several pathways, proteins and RNA transcripts involved in conditions such as immune responses and inflammation, oxidative stress, cell plasticity and Alzheimer's disease were affected inversely by SeMet and MeHg, indicating that SeMet can ameliorate several toxic effects of MeHg in mice.

Also flagged:polyacrylamidewatercholinesterasesparaoxonasesulfatedisulfide
Journal Article 2022-10-13 No Snippets Masson P, Lushchekina S.
Show Full Abstract

The functional structure of proteins results from marginally stable folded conformations. Reversible unfolding, irreversible denaturation, and deterioration can be caused by chemical and physical agents due to changes in the physicochemical conditions of pH, ionic strength, temperature, pressure, and electric field or due to the presence of a cosolvent that perturbs the delicate balance between stabilizing and destabilizing interactions and eventually induces chemical modifications. For most proteins, denaturation is a complex process involving transient intermediates in several reversible and eventually irreversible steps. Knowledge of protein stability and denaturation processes is mandatory for the development of enzymes as industrial catalysts, biopharmaceuticals, analytical and medical bioreagents, and safe industrial food. Electrophoresis techniques operating under extreme conditions are convenient tools for analyzing unfolding transitions, trapping transient intermediates, and gaining insight into the mechanisms of denaturation processes. Moreover, quantitative analysis of electrophoretic mobility transition curves allows the estimation of the conformational stability of proteins. These approaches include polyacrylamide gel electrophoresis and capillary zone electrophoresis under cold, heat, and hydrostatic pressure and in the presence of non-ionic denaturing agents or stabilizers such as polyols and heavy water. Lastly, after exposure to extremes of physical conditions, electrophoresis under standard conditions provides information on irreversible processes, slow conformational drifts, and slow renaturation processes. The impressive developments of enzyme technology with multiple applications in fine chemistry, biopharmaceutics, and nanomedicine prompted us to revisit the potentialities of these electrophoretic approaches. This feature review is illustrated with published and unpublished results obtained by the authors on cholinesterases and paraoxonase, two physiologically and toxicologically important enzymes.

Also flagged:CapsaicinSynthasecapsaicinoidcapsaicin synthaseamideamino acid
Journal Article 2022-10-13 No Snippets Milde R, Schnabel A, Ditfe T, Hoehenwarter W, Proksch C, Westermann B, Vogt T.
Show Full Abstract

Capsaicin, produced by diverse <i>Capsicum</i> species, is among the world's most popular spices and of considerable pharmaceutical relevance. Although the capsaicinoid biosynthetic pathway has been investigated for decades, several biosynthetic steps have remained partly hypothetical. Genetic evidence suggested that the decisive capsaicin synthase is encoded by the <i>Pun1</i> locus. Yet, the genetic evidence of the <i>Pun1</i> locus was never corroborated by functionally active capsaicin synthase that presumably catalyzes an amide bond formation between <i>trans</i> 8-methyl-6-nonenoyl-CoA derived from branched-chain amino acid biosynthesis and vanilloylamine derived from the phenylpropanoid pathway. In this report, we demonstrate the enzymatic activity of a recombinant capsaicin synthase encoded by <i>Pun1</i>, functionally expressed in <i>Escherichia coli</i>, and provide information on its substrate specificity and catalytic properties. Recombinant capsaicin synthase is specific for selected aliphatic CoA-esters and highly specific for vanilloylamine. Partly purified from <i>E. coli</i>, the recombinant active enzyme is a monomeric protein of 51 kDa that is independent of additional co-factors or associated proteins, as previously proposed. These data can now be used to design capsaicin synthase variants with different properties and alternative substrate preferences.

Also flagged:Pulmonary arterial hypertensionpulmonary vascular diseasevasoconstrictionright ventricular hypertrophycardiovascular diseaseslipopolysaccharides
Journal Article 2022-10-13 ✓ 2 Snippets Chen YH, Yuan W, Meng LK, Zhong JC, Liu XY.
In-Text Gene Mentions

Similarly, the 5-HTT inhibitors, fluoxetine and citalopram, impeded human PASMC growth in vitro by blocking SERT expression [106].

The serotonin transporter (SERT or 5-HTT) is a monoamine transporter protein that delivers serotonin into cells.

Show Full Abstract

Pulmonary arterial hypertension (PAH) is a malignant pulmonary vascular disease characterized by increased pulmonary vascular resistance, pulmonary vasoconstriction, and right ventricular hypertrophy. Recent developments in genomics and metabolomics have gradually revealed the roles of the gut microbiota (GM) and its metabolites in cardiovascular diseases. Accumulating evidence reveals that the GM plays important roles in the occurrence and development of PAH. Gut microbiota dysbiosis directly increases the gut permeability, thereby facilitating pathological bacterial translocation and allowing translocation of bacterial products such as lipopolysaccharides from the gut into circulation. This process aggravates pulmonary perivascular inflammation and exacerbates PAH development through the endothelial-mesenchymal transition. Additionally, a shift in the composition of PAH also affects the gut metabolites. Changes in gut metabolites, such as decreased short-chain fatty acids, increased trimethylamine N-oxide, and elevated serotonin, contribute to pulmonary perivascular inflammation and pulmonary vascular remodeling by activating several signaling pathways. Studies of the intestinal microbiota in treating pulmonary hypertension have strengthened linkages between the GM and PAH. Probiotic therapy and fecal microbiota transplantation may supplement existing PAH treatments. In this article, we provide new insight for diagnosing, preventing and treating PAH by adding to the current knowledge of the intestinal flora mechanisms and its metabolites efficacy involved in PAH.

Also flagged:Shank2excitatory postsynaptic scaffolding proteinpsychiatric disordersautism spectrum disorderintellectual disabilityattention-deficit/hyperactivity disorder
Journal Article 2022-10-13 No Snippets Yoo YE, Yoo T, Kang H, Kim E.
Show Full Abstract

Shank2 is an abundant excitatory postsynaptic scaffolding protein that has been implicated in various neurodevelopmental and psychiatric disorders, including autism spectrum disorder (ASD), intellectual disability, attention-deficit/hyperactivity disorder, and schizophrenia. <i>Shank2</i>-mutant mice show ASD-like behavioral deficits and altered synaptic and neuronal functions, but little is known about how different brain regions and gene dosages affect the transcriptomic phenotypes of these mice. Here, we performed RNA-Seq-based transcriptomic analyses of the prefrontal cortex, hippocampus, and striatum in adult <i>Shank2</i> heterozygous (HT)- and homozygous (HM)-mutant mice lacking exons 6-7. The prefrontal cortical, hippocampal, and striatal regions showed distinct transcriptomic patterns associated with synapse, ribosome, mitochondria, spliceosome, and extracellular matrix (ECM). The three brain regions were also distinct in the expression of ASD-related and ASD-risk genes. These differential patterns were stronger in the prefrontal cortex where the HT transcriptome displayed increased synaptic gene expression and reverse-ASD patterns whereas the HM transcriptome showed decreased synaptic gene expression and ASD-like patterns. These results suggest brain region- and gene dosage-differential transcriptomic changes in <i>Shank2</i>-mutant mice.

Also flagged:translationalneurodegenerative diseasesneurodegenerative diseaseamyotrophic lateral sclerosisPDAD
Journal Article 2022-10-13 ✓ 5 Snippets Chia K, Klingseisen A, Sieger D, Priller J.
In-Text Gene Mentions

The zebrafish homolog of human HTT encodes a protein of 3,121 amino acids with 70% identity to mammalian HTT, but only 4 glutamines compared to 7 in mice and up to 35 in humans (Karlovich et al., 1998).

Mutant HTT (mHTT) fragments are very unstable as a consequence of the long polyQ repeat and forms aggregates that are localized in intranuclear inclusions, a hallmark of HD pathology (Squitieri et al., 1994; Lee et al., 2012; Semaka et al., 2013).

Huntington’s disease (HD) is an autosomal-dominant inheritable neurodegenerative disorder that results from a CAG repeat extension in exon 1 of the huntingtin gene (HTT), which translates into a long polyQ repeat in the huntingtin protein.

The overexpression of human mHTT, and different Htt knockdown analyses showed increased apoptosis and neuronal cell death in brain regions ortholog to those affected in HD patients (like the striatum), and disturbed neural tube formation.

As previously reported in HD BAC transgenic mice, an N-terminal 17 (N17) amino acid fragment of HTT adjacent to the polyQ expansion domain regulates protein stability, toxicity, and sub-cellular localization (Gu et al., 2015).

Show Full Abstract

The zebrafish is increasingly recognized as a model organism for translational research into human neuropathology. The zebrafish brain exhibits fundamental resemblance with human neuroanatomical and neurochemical pathways, and hallmarks of human brain pathology such as protein aggregation, neuronal degeneration and activation of glial cells, for example, can be modeled and recapitulated in the fish central nervous system. Genetic manipulation, imaging, and drug screening are areas where zebrafish excel with the ease of introducing mutations and transgenes, the expression of fluorescent markers that can be detected <i>in vivo</i> in the transparent larval stages overtime, and simple treatment of large numbers of fish larvae at once followed by automated screening and imaging. In this review, we summarize how zebrafish have successfully been employed to model human neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, and Huntington's disease. We discuss advantages and disadvantages of choosing zebrafish as a model for these neurodegenerative conditions.

Also flagged:extracellularvesiclesSpinocerebellar ataxiaautosomal dominant neurodegenerative diseaseneurodegenerative diseasesataxia
Journal Article 2022-10-13 ✓ 2 Snippets Ding Y, Zhang Y, Liu X.
In-Text Gene Mentions

EV-mediated the delivery of DnaJ Homolog Subfamily B Member 6 (DNAJB6) molecular chaperone inhibits the aggregation of polyQ and HTT proteins to delay the onset of HD (Joshi et al., 2021).

…Anti-Huntington (HTT) siRNAs effectively reduce…

Show Full Abstract

Spinocerebellar ataxia (SCA) is an autosomal dominant neurodegenerative disease (ND) with a high mortality rate. Symptomatic treatment is the only clinically adopted treatment. However, it has poor effect and serious complications. Traditional diagnostic methods [such as magnetic resonance imaging (MRI)] have drawbacks. Presently, the superiority of RNA interference (RNAi) and extracellular vesicles (EVs) in improving SCA has attracted extensive attention. Both can serve as the potential biomarkers for the diagnosing and monitoring disease progression. Herein, we analyzed the basis and prospect of therapies for SCA. Meanwhile, we elaborated the development and application of miRNAs, siRNAs, shRNAs, and EVs in the diagnosis and treatment of SCA. We propose the combination of RNAi and EVs to avoid the adverse factors of their respective treatment and maximize the benefits of treatment through the technology of EVs loaded with RNA. Obviously, the combinational therapy of RNAi and EVs may more accurately diagnose and cure SCA.

Also flagged:infectionimmune responseorganellesmetabolismcytokinesecretion
Journal Article 2022-10-13 No Snippets Fraschilla I, Evavold CL.
Show Full Abstract

Metabolic shifts can occur in cells of the innate immune system in response to microbial infection. Whether these metabolic shifts benefit host defense and propagation of an immune response appears to be context dependent. In an arms race, host-adapted microbes and mammalian cells vie for control of biosynthetic machinery, organelles, and metabolites. Herein, we discuss the intersection of host metabolism and cell-intrinsic immunity with implications for cell fate during infection. Sensation of microbial ligands in isolation results in host metabolic shifts that imbues normal innate immune function, such as cytokine secretion. However, living microbes have an arsenal of effectors and strategies to subvert cell-intrinsic immune responses by manipulating host metabolism. Consequently, host metabolism is monitored as an indicator of invasion or manipulation by a pathogen, primarily through the actions of guard proteins and inflammasome pathways. In this review, we frame initiation of cell-intrinsic immunity in the context of host metabolism to include a physiologic "Goldilocks zone" of allowable shifts with guard circuits monitoring wide perturbations away from this zone for the initiation of innate immune responses. Through comparison of studies with purified microbial ligands, dead microbes, and live pathogens we may begin to understand how shifts in metabolism determine the outcome of host-pathogen interactions.

Also flagged:glioblastoma multiformeGBMbrain cancerstumorGJB6SLC12A5
Journal Article 2022-10-13 No Snippets Ghafouri-Fard S, Safarzadeh A, Mahmud Hussen B, Akhavan-Bahabadi M, Taheri M, Sharifi G.
Show Full Abstract

Glioblastoma multiforme (GBM) is the most frequent malignant type of primary brain cancers and is a malignancy with poor prognosis. Thus, it is necessary to find novel therapeutic modalities based on molecular events occur at different stages of tumor progression. We used expression profiles of GBM tissues that contained long non-coding RNA (lncRNA), microRNA (miRNA) and mRNA signatures to make putative ceRNA networks. Our strategy led to identification of 1080 DEmRNAs, including 777 downregulated DEmRNAs (such as GJB6 and SLC12A5) and 303 upregulated DEmRNAs (such as TOP2A and RRM2), 19 DElncRNAs, including 16 downregulated DElncRNAs (such as MIR7-3HG and MIR124-2HG) and 3 upregulated DElncRNAs (such as CRNDE and XIST) and 49 DEmiRNAs, including 10 downregulated DEmiRNAs (such as hsa-miR-10b-5p and hsa-miR-1290) and 39 upregulated DEmiRNAs (such as hsa-miR-219a-2-3p and hsa-miR-338-5p). We also identified DGCR5, MIAT, hsa-miR-129-5p, XIST, hsa-miR-128-3p, PART1, hsa-miR-10b-5p, LY86-AS1, CRNDE, and DLX6-AS1 as 10 hub genes in the ceRNA network. The current study provides novel insight into molecular events during GBM pathogenesis. The identified molecules can be used as therapeutic targets for GBM.

Also flagged:cancerDiabetes mellitusdiabetic kidney diseaseend-stage renal diseasesglucosemetabolism
Journal Article 2022-10-13 ✓ 1 Snippet Cheng Y, Wu X, Xia Y, Liu W, Wang P.
In-Text Gene Mentions

dissected that KCNQ1OT1 governed cell oxidative stress, proliferation, inflammation and extracellular matrix enhancement through miR-147a/SOX6 pathway in diabetic nephropathy (82).

Show Full Abstract

Diabetes mellitus often results in several complications, such as diabetic kidney disease (DKD) and end-stage renal diseases (ESRDs). Cancer patients often have the dysregulated glucose metabolism. Abnormal glucose metabolism can enhance the tumor malignant progression. Recently, lncRNAs have been reported to regulate the key proteins and signaling pathways in DKD development and progression and in cancer patients with diabetes. In this review article, we elaborate the evidence to support the function of lncRNAs in development of DKD and diabetes-associated cancer. Moreover, we envisage that lncRNAs could be diagnosis and prognosis biomarkers for DKD and cancer patients with diabetes. Furthermore, we delineated that targeting lncRNAs might be an alternative approach for treating DKD and cancer with dysregulated glucose metabolism.

Also flagged:membranesparturitionextracellularcell growthoxygengestation
Journal Article 2022-10-13 No Snippets Vidal MS, Lintao RCV, Severino MEL, Tantengco OAG, Menon R.
Show Full Abstract

Survivors of preterm birth struggle with multitudes of disabilities due to improper <i>in utero</i> programming of various tissues and organ systems contributing to adult-onset diseases at a very early stage of their lives. Therefore, the persistent rates of low birth weight (birth weight < 2,500 grams), as well as rates of neonatal and maternal morbidities and mortalities, need to be addressed. Active research throughout the years has provided us with multiple theories regarding the risk factors, initiators, biomarkers, and clinical manifestations of spontaneous preterm birth. Fetal organs, like the placenta and fetal membranes, and maternal tissues and organs, like the decidua, myometrium, and cervix, have all been shown to uniquely respond to specific exogenous or endogenous risk factors. These uniquely contribute to dynamic changes at the molecular and cellular levels to effect preterm labor pathways leading to delivery. Multiple intervention targets in these different tissues and organs have been successfully tested in preclinical trials to reduce the individual impacts on promoting preterm birth. However, these preclinical trial data have not been effectively translated into developing biomarkers of high-risk individuals for an early diagnosis of the disease. This becomes more evident when examining the current global rate of preterm birth, which remains staggeringly high despite years of research. We postulate that studying each tissue and organ in silos, as how the majority of research has been conducted in the past years, is unlikely to address the network interaction between various systems leading to a synchronized activity during either term or preterm labor and delivery. To address current limitations, this review proposes an integrated approach to studying various tissues and organs involved in the maintenance of normal pregnancy, promotion of normal parturition, and more importantly, contributions towards preterm birth. We also stress the need for biological models that allows for concomitant observation and analysis of interactions, rather than focusing on these tissues and organ in silos.

Also flagged:Cancerclear cell renal cell carcinomaccRCCtumortranscription factorsDNA methyltransferases
Journal Article 2022-10-13 ✓ 1 Snippet Zhou P, Hu H, Lu Y, Xiao J, Wang Y, Xun Y, Xu J, Liu C, Wang S, Hu J.
In-Text Gene Mentions

…Forchromatin modifiersmodifiers, KDM6B, EP300,…

Show Full Abstract

Recent studies suggest that cancer stemness drives the acquired drug resistance process in cancer therapy. The complementary information provided by multi-omics data can help us to gain a deeper understanding of this process. This study aims to elucidate the impact of cancer stemness on the frontline treatment of clear cell renal cell carcinoma (ccRCC). Consensus clustering based on stem/progenitor signatures refined 3 subgroups in 1,730 tumor samples. We identified master regulons that regulate cancer stemness phenotypes, including key transcription factors, DNA methyltransferases, and promoter methylation probes. In addition, we compared the clinicopathological traits, genomic heterogeneity, cancer hallmarks, tumor microenvironment (TME), and oncological prognosis of the stemness subgroups. Cancer stemness was correlated with reduced efficiency of immune checkpoint blockade therapy. Cancer stemness profoundly affects the prognosis and treatment outcome of ccRCC by increasing genomic instability, tumor-associated malignant events, and immunosuppressive factors. For clinical application, we established and validated a 243-gene signature from stem/progenitor-related genes to distinguish anti-PD-1 outcomes. Overall, this presented study suggested that cancer stemness leads to adaptive resistance to anti-PD-1 treatment in CD8<sup>+</sup> T-infiltrated ccRCC and provides a new reference for strategy development to further improve immunotherapy response rates.

Also flagged:AscitesLiver diseasecommon variable immunodeficiencyliver enzymescirrhosisportal hypertension
Journal Article 2022-10-13 ✓ 1 Snippet Camões G, Fernandes DA, Ferreira DM, Santos A, Carvalho A.
In-Text Gene Mentions

…lpha-1-antitrypsin deficiency,hemochromatosis, celiac disease, inflammatory…

Show Full Abstract

Liver disease is one of the possible clinical manifestations of common variable immunodeficiency and can range from mild hepatomegaly and persistent elevation of liver enzymes to cirrhosis, portal hypertension, and nodular regenerative hyperplasia. The last one is the most common histologic presentation of liver involvement by common variable immunodeficiency and its clinical spectrum can range from asymptomatic to cholestasis, liver cirrhosis, or idiopathic non-cirrhotic portal hypertension, with the severe manifestations being less recognised. We present a case of a 48-year-old woman who was referred for an internal medicine consultation for evaluation of rapidly progressing (span of three months) large-volume ascites and marked asthenia. The patient had a past medical history of common variable immunodeficiency and a recent episode of severe haemolytic anaemia. Peritoneal fluid analyses identified portal hypertension as the cause of the ascites. Abdominal Doppler ultrasound and contrasted abdominal computed tomography confirmed the presence of permeable hepatic and portal veins. Liver biopsy revealed regenerative nodular hyperplasia without cirrhosis. A diagnosis of idiopathic non-cirrhotic portal hypertension secondary to common variable immunodeficiency was made. Treatment was adjusted with considerable improvement in ascites. In conclusion, idiopathic non-cirrhotic portal hypertension is a possible and often overlooked complication in patients with common variable immunodeficiency and is an exclusion diagnosis that requires a high level of suspicion, especially in patients with ascites.

Also flagged:Calcium pyrophosphatedepositionpolyarthritischronic inflammatory demyelinating polyneuropathycalciumpyrophosphate
Journal Article 2022-10-13 ✓ 1 Snippet Carpenter EA, Siddique Z, El-Zammar O, May A, Mirchia K.
In-Text Gene Mentions

…agnesemia, hypothyroidism, andhemochromatosisare some of…

Show Full Abstract

Calcium pyrophosphate deposition disease is not an uncommon cause of polyarthritis, especially in the elderly. This disease typically affects the appendicular skeleton but may rarely affect the axial skeleton as well. When the axial skeleton is involved, it can lead to numerous neurological signs and can be disabling. We describe a case in which a 68-year-old male presented with on-and-off myelopathy and was thought to have chronic inflammatory demyelinating polyneuropathy. Magnetic resonance imaging of the spine suggested an inflammatory or infectious lesion at the thoracic level. However, after a surgical biopsy, pathologists concluded that calcium pyrophosphate deposition, or pseudogout, was the cause of this patient's neurological symptoms. Pseudogout in the spine, especially the thoracic spine, is exceptionally rare. There are very few additional cases reported. In this report, we review the current literature on existing similar cases, radiological findings, risk factors, and treatments for this condition in hopes of increasing knowledge and awareness of this rare differential.

Also flagged:neurological disordersnucleusoligonucleotideHuntington's diseaseneuromuscular diseasesHD
Journal Article 2022-10-13 ✓ 5 Snippets Ly S, Didiot MC, Ferguson CM, Coles AH, Miller R, Chase K, Echeverria D, Wang F, Sadri-Vakili G, Aronin N, Khvorova A.
In-Text Gene Mentions

Another HD-shared feature observed in repeat-associated neurodegenerative diseases is aberrant RNA processing, which has been reported in post-mortem HD brains.69,70 Such events include mis-splicing of HTT mRNA to produce HTT1a.

Using Huntington’s disease mouse models and patient brains, Ly et al. identify the widespread formation of nuclear mutant HTT messenger RNA clusters.

HD is caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene,4 resulting in transcription of CAG repeat-expanded mutant HTT mRNA and translation of polyglutamine (poly Q) repeat-expanded mutant HTT protein.

In both HD models (all ages), we observed higher nuclear retention (∼75%) of Hs HTT mRNA compared to Mm Htt mRNA (Fig. 2A and B, Fig. 3A and B).

Yet, investigations into Huntington’s disease—caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene—have primarily focused on toxic protein gain-of-function as the primary disease-causing feature.

Show Full Abstract

Mutant messenger RNA (mRNA) and protein contribute to the clinical manifestation of many repeat-associated neurological disorders, with the presence of nuclear RNA clusters being a common pathological feature. Yet, investigations into Huntington's disease-caused by a CAG repeat expansion in exon 1 of the <i>huntingtin</i> (<i>HTT</i>) gene-have primarily focused on toxic protein gain-of-function as the primary disease-causing feature. To date, mutant <i>HTT</i> mRNA has not been identified as an <i>in vivo</i> hallmark of Huntington's disease. Here, we report that, in two Huntington's disease mouse models (YAC128 and BACHD-97Q-ΔN17), mutant <i>HTT</i> mRNA is retained in the nucleus. Widespread formation of large mRNA clusters (∼0.6-5 µm<sup>3</sup>) occurred in 50-75% of striatal and cortical neurons. Cluster formation was independent of age and driven by expanded repeats. Clusters associate with chromosomal transcriptional sites and quantitatively co-localize with the aberrantly processed N-terminal exon 1-intron 1 mRNA isoform, <i>HTT1a</i>. <i>HTT1a</i> mRNA clusters are observed in a subset of neurons from human Huntington's disease post-mortem brain and are likely caused by somatic expansion of repeats. In YAC128 mice, clusters, but not individual <i>HTT</i> mRNA, are resistant to antisense oligonucleotide treatment. Our findings identify mutant <i>HTT</i>/<i>HTT1a</i> mRNA clustering as an early, robust molecular signature of Huntington's disease, providing <i>in vivo</i> evidence that Huntington's disease is a repeat expansion disease with mRNA involvement.

Also flagged:protein degradationDegradationcatalytic activityorganellesubiquitinextracellular
Journal Article 2022-10-13 No Snippets Ghosh S, Ramadas B, Manna D.
Show Full Abstract

Degradation strategies have shown enormous promise after the inception of molecules like PROTACs (PRoteolysis TArgeting Chimeras) that induce the degradation of the substrate of choice rather than depending on blocking their catalytic activity like conventional inhibitory drugs. Over the past two decades, the application of PROTACs has made quite an impact, even reaching clinical translations. However, a major class of macromolecular targets, be that large proteins, aggregates, organelles or non-protein substrates, remain untouched when utilizing the ubiquitin-proteasomal pathway of degradation. In this review, we have attempted to cover modalities of targeted degradation that instead focus on recruiting the lysosomal pathway of degradation, which is gaining importance and being explored extensively as alternate and efficient approaches for treating disease-related milieus.

Also flagged:osteoporosisacidmineralpotassiummagnesiumcalcium
Journal Article 2022-10-13 ✓ 1 Snippet Farshbaf-Khalili A, Ostadrahimi A, Heris JA, Sarrafi S, Mohammadisima N.
In-Text Gene Mentions

…ases (hemophilia, thalassemia,hemochromatosis), use of hormonal…

Show Full Abstract

This study aimed to investigate the association between dietary acid load (DAL) and primary osteoporosis. This was a cross-sectional study. Among 850 randomly selected postmenopausal women aged 50-65 years, 232 women consisted of 124 women with normal bone mineral density (BMD) and 108 with primary osteoporosis were selected after examining the eligibility criteria. Demographic characteristics, anthropometric indices, and physical activity were collected through questionnaires. Osteoporosis was diagnosed using the dual-energy X-ray absorptiometry method. DAL was assessed by a valid and reliable semiquantitative food frequency questionnaire during the last year. Independent <i>t</i>-test, Mann-Whitney, Chi-square, and adjusted binary logistic regression were used for data analysis through SPSS/24. There were significant differences between the two groups in terms of age, body mass index (BMI), number of deliveries, and years after menopause (<i>p</i> < .05). The mean (standard deviation (SD)) potential renal acid load (PRAL) and net endogenous acid production (NEAP) were higher in postmenopausal women with osteoporosis than those with normal BMD (PRAL: -13.1 ± 11.1 mEq/day vs. -10.8 ± 12.7 mEq/day; NEAP: 29.5 ± 8.5 mEq/day vs. 31.2 ± 9.2 mEq/day). The mean consumption of potassium, magnesium, and calcium in the osteoporosis group was significantly lower than in the other group (<i>p</i> < .05). There were significant associations between osteoporosis with PRAL (odds ratio (OR) = 1.030; 95% confidence interval (CI): 1.001 to 1.060, <i>p</i> = .027) and NEAP scores (OR = 1.041; 95% CI: 1.003 to 1.081, <i>p</i> = .037). The odds of osteoporosis increased by 3% following one unit increase in PRAL score. Similarly, it increased by 4% with increasing NEAP score up to one unit. Therefore, dietary patterns that produce high DAL can have a detrimental effect on bone health.

Also flagged:malnutritionovernutritionobesityundernutritionFTOMC4R
Journal Article 2022-10-12 ✓ 1 Snippet Tan PY, Moore JB, Bai L, Tang G, Gong YY.
In-Text Gene Mentions

…Iron Regulator (HFE) C282Y allele…

Show Full Abstract

Genetic background interacts with dietary components to modulate nutritional health status. This study aimed to review the evidence for gene-diet interactions in all forms of malnutrition. A comprehensive systematic literature search was conducted through April 2021 to identify observational and intervention studies reporting the effects of gene-diet interactions in over-nutrition, under-nutrition and micronutrient status. Risk of publication bias was assessed using the Quality Criteria Checklist and a tool specifically designed for gene-diet interaction research. 167 studies from 27 populations were included. The majority of studies investigated single nucleotide polymorphisms (SNPs) in overnutrition (n = 158). Diets rich in whole grains, vegetables, fruits and low in total and saturated fats, such as Mediterranean and DASH diets, showed promising effects for reducing obesity risk among individuals who had higher genetic risk scores for obesity, particularly the risk alleles carriers of <i>FTO</i> rs9939609, rs1121980 and rs1421085. Other SNPs in <i>MC4R</i>, <i>PPARG</i> and <i>APOA5</i> genes were also commonly studied for interaction with diet on overnutrition though findings were inconclusive. Only limited data were found related to undernutrition (n = 1) and micronutrient status (n = 9). The findings on gene-diet interactions in this review highlight the importance of personalized nutrition, and more research on undernutrition and micronutrient status is warranted.

Also flagged:triamcinolone acetonideocular hypertensionGlucocorticosteroidssteroidTriamcinoloneCRPPA
Journal Article 2022-10-12 ✓ 1 Snippet Badrinarayanan L, Nagarajan H, Rishi P, Rishi E, George RJ, Chitipothu S.
In-Text Gene Mentions

…ARHGAP1, TIMELESS andTNFSF4genes were found…

Show Full Abstract

Glucocorticosteroids commonly used to treat certain ocular inflammatory conditions cause an unwarranted elevation in intraocular pressure (IOP) leading to steroid-induced ocular hypertension (OHT). This study aims to identify novel genetic variants in the Indian population associated with steroid responsiveness, specifically to that of intravitreal Triamcinolone acetonide (TA) injections, which leads to OHT in 27% of the TA-treated Indian subjects. Genetic determinants and pathways regulating TA-OHT progression were investigated by applying whole-genome sequencing (WGS) on DNA extracted from 53 blood samples that included TA responders and non-responders. Sequencing analysis yielded 45 intronic and 49 exonic variants to be associated with TA-OHT, which are known to play a vital role in eye, heart, brain, and bone deformities. Of these, the most significant genetic variant associated with TA-OHT was further considered for molecular dynamics (MD) simulation studies. Variants in the CRPPA, PLOD1, ARHGAP1, TIMELESS and TNFSF4 genes were found to be directly implicating TA-OHT. Furthermore, these genes were enriched in pathways associated with cardiomyopathy, focal adhesion, extracellular matrix, and actin cytoskeleton reorganization. MD simulation studies revealed that the top significant variant (rs141625803) in the CRPPA gene possesses a high pathogenic and structurally destabilizing effect. Thus, novel genetic variants that could be significantly associated with the TA-OHT progression were identified in this study. Validation of these targets in a larger cohort of patients along with their functional analysis would inform on the disease, thereby adding to the existing knowledge on the pathophysiology of TA-OHT.

Also flagged:cancerantibodiessignal transductioncancerskinasestumors
Journal Article 2022-10-12 No Snippets Min HY, Lee HY.
Show Full Abstract

Since the initial clinical approval in the late 1990s and remarkable anticancer effects for certain types of cancer, molecular targeted therapy utilizing small molecule agents or therapeutic monoclonal antibodies acting as signal transduction inhibitors has served as a fundamental backbone in precision medicine for cancer treatment. These approaches are now used clinically as first-line therapy for various types of human cancers. Compared to conventional chemotherapy, targeted therapeutic agents have efficient anticancer effects with fewer side effects. However, the emergence of drug resistance is a major drawback of molecular targeted therapy, and several strategies have been attempted to improve therapeutic efficacy by overcoming such resistance. Herein, we summarize current knowledge regarding several targeted therapeutic agents, including classification, a brief biology of target kinases, mechanisms of action, examples of clinically used targeted therapy, and perspectives for future development.

Also flagged:Melanomaskin cancercell growthdeathmelanincancer
Journal Article 2022-10-12 ✓ 2 Snippets Karami Fath M, Azargoonjahromi A, Soofi A, Almasi F, Hosseinzadeh S, Khalili S, Sheikhi K, Ferdousmakan S, Owrangi S, Fahimi M, Zalpoor H, Nabi Afjadi M, Payandeh Z, Pourzardosht N.
In-Text Gene Mentions

On the other hand, miR-211 can block the invasion and migration of melanoma cells [156], and repress POU3F2 (POU-domain class 3 transcription factor 2, also known as brain-specific homeobox 2 (BRN2)) which acts as a MITF suppressor.

Zhao et al. have indicated that downregulation of miR-107 (a tumor suppressor) represses melanoma cell invasion through POU3F2 targeting [209].

Show Full Abstract

Melanoma is the most aggressive form of skin cancer resulting from genetic mutations in melanocytes. Several factors have been considered to be involved in melanoma progression, including genetic alteration, processes of damaged DNA repair, and changes in mechanisms of cell growth and proliferation. Epigenetics is the other factor with a crucial role in melanoma development. Epigenetic changes have become novel targets for treating patients suffering from melanoma. These changes can alter the expression of microRNAs and their interaction with target genes, which involves cell growth, differentiation, or even death. Given these circumstances, we conducted the present review to discuss the melanoma risk factors and represent the current knowledge about the factors related to its etiopathogenesis. Moreover, various epigenetic pathways, which are involved in melanoma progression, treatment, and chemo-resistance, as well as employed epigenetic factors as a solution to the problems, will be discussed in detail.

Correction.

Also flagged:SQSTM1MAVSdegradationAutophagy
Journal Article 2022-10-12 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:ironsulfategastric siderosisextracellular spacesiderosisGastric
Journal Article 2022-10-12 ✓ 1 Snippet Tun KM, Naga Y, Mesgun S, Aponte-Pieras J, Jinadasa P, Ohning G.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Gastric siderosis is the deposition of excess amount of iron from oral ferrous sulfate supplements to the gastric mucosa. It is an often overlooked entity in the literature and can be related to symptoms such as dyspepsia, nausea, and melena through mucosal injury. Different etiologies of gastric siderosis display distinct histopathological patterns. Pattern B, which is most commonly associated with oral iron supplements, is seen when iron is deposited in the extracellular space of the lamina propria. It is crucial to consider gastric siderosis as a potential diagnosis in symptomatic patients and to evaluate the necessity of oral ferrous sulfate supplements.

Also flagged:primary tumorsporadic colorectal cancertumorsPTSLSrectal tumors
Journal Article 2022-10-12 ✓ 1 Snippet Kamphues C, Lefevre JH, Wang J, Amini N, Beaugerie L, Kuehn F, Park SH, Andreatos N, Lauscher JC, Enea D, Lehmann KS, Peru N, Weixler B, Kirchgesner J, Degro CE, Pozios I, van Beekum CJ, Schölch S, Zambonin D, Schineis C, Loch FN, Geka D, Theoxari M, Wu B, Wang PP, Antoniou E, Pikoulis E, Moussata D, Theodoropoulos G, Ouaissi M, Seeliger H, Inaba Y, Scaringi S, Reißfelder C, Vilz TO, Lin C, Yang SK, Beyer K, Renz BW, Sasaki K, Margonis GA, Svrcek M, Kreis ME.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background</h4>Although primary tumor sidedness (PTS) has a known prognostic role in sporadic colorectal cancer (CRC), its role in Inflammatory Bowel Disease related CRC (IBD-CRC) is largely unknown. Thus, we aimed to evaluate the prognostic role of PTS in patients with IBD-CRC.<h4>Methods</h4>All eligible patients with surgically treated, non-metastatic IBD-CRC were retrospectively identified from institutional databases at ten European and Asian academic centers. Long term endpoints included recurrence-free (RFS) and overall survival (OS). Multivariable Cox proportional hazard regression as well as propensity score analyses were performed to evaluate whether PTS was significantly associated with RFS and OS.<h4>Results</h4>A total of 213 patients were included in the analysis, of which 32.4% had right-sided (RS) tumors and 67.6% had left-sided (LS) tumors. PTS was not associated with OS and RFS even on univariable analysis (5-year OS for RS vs LS tumors was 68.0% vs 77.3%, respectively, p = 0.31; 5-year RFS for RS vs LS tumors was 62.8% vs 65.4%, respectively, p = 0.51). Similarly, PTS was not associated with OS and RFS on propensity score matched analysis (5-year OS for RS vs LS tumors was 82.9% vs 91.3%, p = 0.79; 5-year RFS for RS vs LS tumors was 85.1% vs 81.5%, p = 0.69). These results were maintained when OS and RFS were calculated in patients with RS vs LS tumors after excluding patients with rectal tumors (5-year OS for RS vs LS tumors was 68.0% vs 77.2%, respectively, p = 0.38; 5-year RFS for RS vs LS tumors was 62.8% vs 59.2%, respectively, p = 0.98).<h4>Conclusions</h4>In contrast to sporadic CRC, PTS does not appear to have a prognostic role in IBD-CRC.

Also flagged:StressTumorcancerbreast cancermetabolismsignal transduction
Journal Article 2022-10-12 ✓ 2 Snippets Zhao J, Ma H, Feng R, Li D, Liu B, YueYu, Cao X, Wang X.
In-Text Gene Mentions

…expression of CD80,TNFSF4, CD276, and NRP1…

…response to anti-CD80,TNFSF4, CD276, and NRP1…

Show Full Abstract

<h4>Background</h4>The association between oxidative stress and lncRNAs within the cancer-related researching field has been a controversial subject. At present, the exact function of oxidative stress as well as lncRNAs exert in breast cancer (BC) are still unclear. Therefore, the present study examined the lncRNAs oxidative stress-related in BC.<h4>Methods</h4>Transcriptome data of BC obtained from TCGA (The Cancer Genome Atlas) database were used to generate synthetic matrices. Patients with breast cancer were randomly assigned to training, testing, or combined groups. The prognostic signature of oxidative stress was created using the selection operator Cox regression method, and the difference in prognosis between groups was examined using Kaplan-Meier curves, the accuracy of which was calculated using a receiver-operating characteristic-area through the curve (ROC-AUC) analysis with internal validation. Also, the Gene Set Enrichment Analyses (GSEA) was applied for the analysis of the risk groups. To conclude, the half-maximal inhibitory concentration (IC50) of these groups were investigated by immunoassay assay.<h4>Results</h4>A model based on 7 lncRNAs related to oxidative stress was proposed, and the calibration plots and projected prognosis matched well. For prognosis at 5, 3, and 1 year, the area under the ROC curve (AUC) values were 0.777, 0.777, and 0.759. The functions of target genes identified by GSEA appear to be mainly expressed in metabolism, signal transduction, tumorigenesis, and also the progression. The remarkable differences in IC50 and gene expression between risk groups in this study provide a deep insight for further systemic treatment. Higher macrophage scores were acquired in the high-risk group, of which patients showed more response to conventional chemotherapy drugs, such as AKT inhibitor VIII and Lapatinib, as well as immunotherapy strategies including anti-CD80, TNF SF4, CD276, and NRP1.<h4>Conclusion</h4>The prognosis of breast cancer can be independently predicted by the markers, which sheds light on further research of the specific role of lncRNAs which are oxidative stress-related and clinical treatment of breast cancer.

Also flagged:FerroptosisGene ExpressionpsoriasisLSSLC7A5SLC7A11
Journal Article 2022-10-12 ✓ 1 Snippet Mao J, Ma X.
In-Text Gene Mentions

…strategies for treatinghemochromatosisand acute lung…

Show Full Abstract

<h4>Purpose</h4>Psoriasis is closely linked to ferroptosis. This study aimed to identify potential ferroptosis-associated genes in psoriasis using bioinformatics.<h4>Methods</h4>Data from the GSE30999 dataset was downloaded from the Gene Expression Omnibus (GEO), and the ferroptosis-associated genes were retrieved from FerrDb. The differentially expressed ferroptosis-associated genes were identified using Venn diagrams. Subsequently, a network of protein-protein interactions (PPIs) between psoriasis targets and ferroptosis-associated genes was constructed based on the STRING database and analyzed by Cytoscape software. The Metascape portal conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. Moreover, the expression of ferroptosis-related genes was verified in the GSE13355 dataset. Finally, the verified genes were used to predict the therapeutic drugs for psoriasis using the DGIdb/CMap database. SwissDock was used to examine ligand docking, and UCSF Chimera displayed the results visually.<h4>Results</h4>Among 85 pairs of psoriasis lesion (LS) and no-lesion (NL) samples from patients, 19 ferroptosis-associated genes were found to be differentially expressed (3 upregulated genes and 16 downregulated genes). Based on the PPI results, these ferroptosis-associated genes interact with each other. The GO and KEGG enrichment analysis of differentially expressed ferroptosis-related genes indicated several enriched terms related to the oxidative stress response. The GSE13355 dataset verified the results of the bioinformatics analysis obtained from the GSE30999 dataset regarding SLC7A5, SLC7A11, and CHAC1. Psoriasis-related compounds corresponding to SLC7A5 and SLC7A11 were also identified, including Melphalan, Quisqualate, Riluzole, and Sulfasalazine.<h4>Conclusion</h4>We identified 3 differentially expressed ferroptosis-related genes through bioinformatics analysis. SLC7A5, SLC7A11, and CHAC1 may affect the development of psoriasis by regulating ferroptosis. These results open new avenues in understanding the treatment of psoriasis.

Also flagged:Fatty Acidnonalcoholic steatohepatitisNASHnonalcoholic fatty liver diseaseNAFLDalanine aminotransferase
Journal Article 2022-10-12 ✓ 1 Snippet Miyake T, Furukawa S, Matsuura B, Yoshida O, Miyazaki M, Shiomi A, Kanzaki S, Nakaguchi H, Sunago K, Nakamura Y, Imai Y, Watanabe T, Yamamoto Y, Koizumi Y, Tokumoto Y, Hirooka M, Kumagi T, Abe M, Hiasa Y.
In-Text Gene Mentions

…rimary sclerosing cholangitis,hemochromatosis, Wilson’s disease, and…

Show Full Abstract

The relationship between advanced nonalcoholic steatohepatitis (NASH) and plasma fatty acid composition remains unknown. We aimed to examine the plasma fatty acid composition in biopsy-confirmed nonalcoholic fatty liver disease (NAFLD) and evaluate the relationship between histological findings and fatty acid composition. Overall, 235 patients (134 women) with NAFLD were enrolled. Comprehensive blood chemistry tests and histological examinations of liver samples were conducted. Multivariate analyses adjusted for age, sex, body mass index, alanine aminotransferase, hemoglobin A1c, creatinine, total cholesterol, triglyceride, and NAFLD Activity Score values showed that lower levels of arachidic, behenic, α-linolenic, eicosatetraenoic, docosapentaenoic, and docosahexaenoic acids and higher levels of mead acid were associated with fibrosis stage 3-4. Furthermore, higher lauric acid, myristic acid, and palmitic acid levels and monounsaturated fatty acids such as palmitoleic acid and oleic acid were significantly associated with high NAS in analyses adjusted for the same factors and fibrosis stage. The plasma fatty acid composition was associated with the histological evidence of NASH. Increased synthesis of fatty acids is associated with NASH; insufficient intake of n-3 essential fatty acids and reduced elongation of fatty acids are associated with fibrosis in NASH. These features may help clinicians to understand and treat advanced NASH cases.

Also flagged:HSPA1Bheat strokeheat shock proteinsHSPsHSP90AA2DNAJA1
Journal Article 2022-10-12 No Snippets Alele FO, Otto JR, Malau-Aduli BS, Malau-Aduli AEO.
Show Full Abstract

Heat tolerance and exertional heat stroke (EHS) are rare health conditions that have been described and characterised but have never been genetically solved. Knowledge of the role of single nucleotide polymorphisms (SNPs) in heat shock proteins (HSPs) genes and their associations with heat tolerance and EHS is limited. This pilot study aimed to identify SNP in HSPA1B, HSP90AA2 and DNAJA1 genes and their associations with heat tolerance and EHS history in a quasi-experimental design. Participants comprised Australian Defence Force members (ADF) who had a history of EHS and the general population. Genomic DNA samples were extracted from the venous blood samples of 48 participants, sequenced and analysed for SNP. Forty-four per cent (44%) of the participants were heat intolerant, and 29% had a history of EHS. Among participants with a history of EHS, there was an association between heat tolerance and HSPA1B SNP at the g.31829044 locus. However, there were no associations between HSPA1B and HSP90AA2 SNP and heat tolerance. All participants had the same distribution for the DNAJA1 SNP. In conclusion, the findings indicate an association between the HSPA1B genetic variant at the g.31829044 locus and heat tolerance among ADF participants with a history of EHS. Further research with a larger number of military participants will shed more light on the associations between HSP genes and heat tolerance.

Also flagged:mesenchymal neoplasmtumorkinaseneoplasmgastrointestinal tumorsmultikinase
Journal Article 2022-10-12 ✓ 1 Snippet Andrzejewska M, Czarny J, Derwich K.
In-Text Gene Mentions

Finally, the effect of the recent development of KIT/PDGFRA inhibitors is ripretinib (formerly DCC-2618), whose effectiveness in inhibition of a wide range of KIT mutants in patients with drug-resistant GISTs has been confirmed in preclinical cancer models and preliminary clinical data [70].

Show Full Abstract

Gastrointestinal stromal tumor is the most common mesenchymal neoplasm of the gastrointestinal tract, usually found in elderly adults. It is infrequent among pediatric patients and usually differs biologically from adult-type diseases presenting mutations of <i>KIT</i> and <i>PDGFR</i> genes. In this population, more frequent is the wild-type GIST possessing <i>SDH</i>, <i>TRK</i>, <i>RAS</i>, <i>NF1</i> mutations, among others. Both tumor types require individualized treatment with kinase inhibitors that are still being tested in the pediatric population due to the different neoplasm biology. We review the latest updates to the management of pediatric gastrointestinal tumors with a particular focus on the advances in molecular biology of the disease that enables the definition of possible resistance. Emerging treatment with kinase inhibitors that could serve as targeted therapy is discussed, especially with multikinase inhibitors of higher generation, the effectiveness of which has already been confirmed in the adult population.

Also flagged:Neonatal cholestasisNCcholestasisinfectiongalactosemiatyrosinemia type 1
Journal Article 2022-10-12 ✓ 2 Snippets Quelhas P, Jacinto J, Cerski C, Oliveira R, Oliveira J, Carvalho E, Dos Santos J.
In-Text Gene Mentions

…recommended whether neonatalhemochromatosisis being considered…

…If neonatalhemochromatosisis confirmed an…

Show Full Abstract

Neonatal cholestasis (NC) starts during the first three months of life and comprises extrahepatic and intrahepatic groups of diseases, some of which have high morbimortality rates if not timely identified and treated. Prolonged jaundice, clay-colored or acholic stools, and choluria in an infant indicate the urgent need to investigate the presence of NC, and thenceforth the differential diagnosis of extra- and intrahepatic causes of NC. The differential diagnosis of NC is a laborious process demanding the accurate exclusion of a wide range of diseases, through the skillful use and interpretation of several diagnostic tests. A wise integration of clinical-laboratory, histopathological, molecular, and genetic evaluations is imperative, employing extensive knowledge about each evaluated disease as well as the pitfalls of each diagnostic test. Here, we review the difficulties involved in correctly diagnosing the cause of cholestasis in an affected infant.

Also flagged:MigraineHeadachetype 2 diabetesEHMT2SLC44A4PLEKHA1
Journal Article 2022-10-12 No Snippets Islam MR, The International Headache Genetics Consortium Ihgc, Nyholt DR.
Show Full Abstract

Migraine and headache frequently co-occur with type 2 diabetes (T2D), suggesting a shared aetiology between the two conditions. We used genome-wide association study (GWAS) data to investigate the genetic overlap and causal relationship between migraine and headache with T2D. Using linkage disequilibrium score regression (LDSC), we found a significant genetic correlation between migraine and T2D (rg = 0.06, p = 1.37 × 10−5) and between headache and T2D (rg = 0.07, p = 3.0 × 10−4). Using pairwise GWAS (GWAS-PW) analysis, we identified 11 pleiotropic regions between migraine and T2D and 5 pleiotropic regions between headache and T2D. Cross-trait SNP meta-analysis identified 23 novel SNP loci (Pmeta < 5 × 10−8) associated with migraine and T2D, and three novel SNP loci associated with headache and T2D. Cross-trait gene-based overlap analysis identified 33 genes significantly associated (Pgene-based < 3.85 × 10−6) with migraine and T2D, and 11 genes associated with headache and T2D, with 7 genes (EHMT2, SLC44A4, PLEKHA1, CFDP1, TMEM170A, CHST6, and BCAR1) common between them. There was also a significant overlap of genes nominally associated (Pgene-based < 0.05) with both migraine and T2D (Pbinomial-test = 2.83 × 10−46) and headache and T2D (Pbinomial-test = 4.08 × 10−29). Mendelian randomisation (MR) analyses did not provide consistent evidence for a causal relationship between migraine and T2D. However, we found headache was causally associated (inverse-variance weighted, ORIVW = 0.90, Pivw = 7 × 10−3) with T2D. Our findings robustly confirm the comorbidity of migraine and headache with T2D, with shared genetically controlled biological mechanisms contributing to their co-occurrence, and evidence for a causal relationship between headache and T2D.

Also flagged:Retinal Degenerationphotoreceptor degenerationmitogen-activated protein kinaseMAPKgene expressionretinal degeneration-1
Journal Article 2022-10-12 ✓ 1 Snippet Chen Y, Dong Y, Yan J, Wang L, Yu S, Jiao K, Paquet-Durand F.
In-Text Gene Mentions

…genes, Braf ,Taok3, Nlk ,…

Show Full Abstract

The cellular mechanisms underlying hereditary photoreceptor degeneration are still poorly understood. The aim of this study was to systematically map the transcriptional changes that occur in the degenerating mouse retina at the single cell level. To this end, we employed single-cell RNA-sequencing (scRNA-seq) and retinal degeneration-1 (<i>rd1</i>) mice to profile the impact of the disease mutation on the diverse retinal cell types during early post-natal development. The transcriptome data allowed to annotate 43,979 individual cells grouped into 20 distinct clusters. We further characterized cluster-specific metabolic and biological changes in individual cell types. Our results highlight Ca<sup>2+</sup>-signaling as relevant to hereditary photoreceptor degeneration. Although metabolic reprogramming in retina, known as the 'Warburg effect', has been documented, further metabolic changes were noticed in <i>rd1</i> mice. Such metabolic changes in <i>rd1</i> mutation was likely regulated through mitogen-activated protein kinase (MAPK) pathway. By combining single-cell transcriptomes and immunofluorescence staining, our study revealed cell type-specific changes in gene expression, as well as interplay between Ca<sup>2+</sup>-induced cell death and metabolic pathways.

Also flagged:CancerIron oxide nanoparticletransporterscarcinomalymph node metastasisiron deficiency
Journal Article 2022-10-12 No Snippets Aram E, Moeni M, Abedizadeh R, Sabour D, Sadeghi-Abandansari H, Gardy J, Hassanpour A.
Show Full Abstract

Iron oxide nanoparticle (IONPs) have become a subject of interest in various biomedical fields due to their magnetism and biocompatibility. They can be utilized as heat mediators in magnetic hyperthermia (MHT) or as contrast media in magnetic resonance imaging (MRI), and ultrasound (US). In addition, their high drug-loading capacity enabled them to be therapeutic agent transporters for malignancy treatment. Hence, smartening them allows for an intelligent controlled drug release (CDR) and targeted drug delivery (TDD). Smart magnetic nanoparticles (SMNPs) can overcome the impediments faced by classical chemo-treatment strategies, since they can be navigated and release drug via external or internal stimuli. Recently, they have been synchronized with other modalities, e.g., MRI, MHT, US, and for dual/multimodal theranostic applications in a single platform. Herein, we provide an overview of the attributes of MNPs for cancer theranostic application, fabrication procedures, surface coatings, targeting approaches, and recent advancement of SMNPs. Even though MNPs feature numerous privileges over chemotherapy agents, obstacles remain in clinical usage. This review in particular covers the clinical predicaments faced by SMNPs and future research scopes in the field of SMNPs for cancer theranostics.

Also flagged:doxorubicinchitosancancersdegradationhydrogenHydroxyapatite
Journal Article 2022-10-12 No Snippets Wu MY, Liang YH, Yen SK.
Show Full Abstract

Porous hydroxyapatite-gelatin (Hap-Gel) composite microspheres derived by wet chemical methods were used as carriers of doxorubicin (DOX) coupled with chitosan (Chi) for treating cancers. Through X-ray diffraction, specific surface area porosimetry, chemisorption analysis and inductively coupled plasma mass spectrometry, the crystalline phase, composition, morphology, and pore distribution of HAp-Gel microspheres were all characterized. HAp nanosized crystals and Gel polymers form porous microspheres after blending and exhibit a specific surface area of 158.64 m<sup>2</sup>/g, pore sizes from 3 to 150 nm, and pore volumes of 0.4915 cm<sup>3</sup>/g. These characteristics are suitable for carriers of DOX. Furthermore, by the addition of chitosan during drug loading, its drug-entrapment efficiency increases from 70% to 99% and the release duration increases from a 100% burst within a day to only 45% over half a year since the pores in the composite microspheres provide a shielding effect throughout the degradation period of the chitosan. According to the MTT tests, cell viability of DOX-Chi/HAp-Gel is 57.64% on day 5, similar to the result treated with DOX only. It is concluded that under the protection of pores in the microspheres, the chitosan abundant of hydroxyls combining HAp-Gel and DOX by forming hydrogen bonds indeed enhances the entrapment efficiency, prolongs the releasing period and maintains DOX's ability to perform medicine functions unaffected after loading.

Also flagged:small subunit ribosomal RNASSU rDNAITS1‐5.8S‐ITS2 rRNAITS15.8SITS2 rRNA
Journal Article 2022-10-12 No Snippets Li B, Song Y, Hao T, Wang L, Zheng W, Lyu Z, Chen Y, Pan X.
Show Full Abstract

In the class Colpodea, there are many unresolved evolutionary relationships among taxa. Here, we report 30 new sequences including SSU-rRNA, ITS1-5.8S- ITS2 rRNA, and the mitochondrial small subunit ribosomal RNA (mtSSU-rRNA) genes of five colpodeans, and conduct phylogenetic analyses based on each individual gene and a two-gene concatenated dataset. For the first time, multi-genes were used to analyze phylogenetic relationships in the class Colpodea. The main findings are: (1) SSU-rRNA, ITS1-5.8S- ITS2 rRNA, and mtSSU-rRNA gene sequences of <i>C</i>. <i>reniformis</i> and <i>C</i>. <i>grandis</i> are provided for the first time, and these two species group into the clade including <i>C</i>. <i>inflata</i>, <i>C</i>. <i>lucida</i>, <i>C</i>. <i>cucullus</i>, and <i>C</i>. <i>henneguyi</i>; (2) clustering pattern and morphological similarity indicate that <i>Bresslauides discoideus</i> has a close relation with Colpodidae spp.; (3) <i>Emarginatophrya</i> genus diagnosis is improved to be 'Hausmanniellidae with sharply shortened and isometric leftmost 1-4 ciliary rows' and <i>Colpoda elliotti</i> is transferred to <i>Emarginatophrya</i>; (4) the genus <i>Colpoda</i> is still non-monophyletic with the addition of 10 populations from five <i>Colpoda</i> species sequences, but there are only two <i>Colpoda</i> groups left based on the present work: Group I comprises <i>C</i>. <i>inflata</i>, <i>C</i>. <i>lucida</i>, <i>C</i>. <i>cucullus</i>, <i>C</i>. <i>henneguyi</i>, <i>C</i>. <i>reniformis</i>, and <i>C</i>. <i>grandis</i>, Group II comprises <i>C</i>. <i>maupasi</i> and <i>C</i>. <i>ecaudata</i>, and the presence of diagonal grooves and the way the vestibular opens might be the two key features that differentiates <i>Colpoda</i> species groups; (5) a close molecular relationship, and highly similar merotelokinetal mode, somatic ciliary pattern, and basic organization of the oral apparatus with <i>P</i>. <i>steinii</i> suggests <i>Bromeliothrix metopoides</i> should be temporarily assigned to Colpodidae.

Also flagged:Autism Spectrum Disorderbehavioralneurodevelopmental disorderautismpsychiatric disordersRARB
Journal Article 2022-10-12 ✓ 4 Snippets Matta J, Dobrino D, Yeboah D, Howard S, El-Manzalawy Y, Obafemi-Ajayi T.
In-Text Gene Mentions

…associated with theDCCgene which has…

…C4 has onlyDCCas an important…

…is associated withDCC.…

…which six genes (DCC, RNF38, LRBA, EPHB2,…

Show Full Abstract

Autism Spectrum Disorder (ASD) is extremely heterogeneous clinically and genetically. There is a pressing need for a better understanding of the heterogeneity of ASD based on scientifically rigorous approaches centered on systematic evaluation of the clinical and research utility of both phenotype and genotype markers. This paper presents a holistic PheWAS-inspired method to identify meaningful associations between ASD phenotypes and genotypes. We generate two types of phenotype-phenotype (p-p) graphs: a direct graph that utilizes only phenotype data, and an indirect graph that incorporates genotype as well as phenotype data. We introduce a novel methodology for fusing the direct and indirect p-p networks in which the genotype data is incorporated into the phenotype data in varying degrees. The hypothesis is that the heterogeneity of ASD can be distinguished by clustering the p-p graph. The obtained graphs are clustered using network-oriented clustering techniques, and results are evaluated. The most promising clusterings are subsequently analyzed for biological and domain-based relevance. Clusters obtained delineated different aspects of ASD, including differentiating ASD-specific symptoms, cognitive, adaptive, language and communication functions, and behavioral problems. Some of the important genes associated with the clusters have previous known associations to ASD. We found that clusters based on integrated genetic and phenotype data were more effective at identifying relevant genes than clusters constructed from phenotype information alone. These genes included five with suggestive evidence of ASD association and one known to be a strong candidate.

Also flagged:SLEautoimmune diseaseautoantibodiespathogenesisSystemic lupus erythematosusCD4
Journal Article 2022-10-12 ✓ 5 Snippets Zhang XX, You JP, Liu XR, Zhao YF, Cui Y, Zhao ZZ, Qi YY.
In-Text Gene Mentions

It is well established that tumor necrosis factor ligand superfamily member 4 (TNFSF4) gene polymorphisms are associated with SLE susceptibility in large sample sizes and diverse multiracial and multiethnic populations (23–30).

The mRNA expression of PRDX6 was elevated in peripheral blood cells, peripheral blood mononuclear cells (PBMCs), and multiple cell subpopulations, such as B cells, CD4+ T cells, CD3+ cells, and monocytes in patients with SLE.

The expression of PRDX6 was elevated in B cells (Figures 2A, B) and CD4+ T cells (Figures 2C, D) in patients with SLE compared with healthy control individuals and approached marginal statistical significance.

Importantly, the mRNA expression of PRDX6 was elevated in peripheral blood cells, PBMCs, and multiple cell subpopulations, including B cells, CD4+ T cells, CD3+ cells, and monocytes, in patients with SLE.

PRDX6AS1 gene polymorphisms…

Show Full Abstract

<h4>Background</h4>Systemic lupus erythematosus (SLE) is a complex, multisystem autoimmune disease that is characterized by the production of autoantibodies. Although accumulated evidence suggests that the dysregulation of long non-coding RNAs (lncRNAs) is involved in the pathogenesis of SLE, the genetic contributions of lncRNA coding genes to SLE susceptibility remain largely unknown. Here, we aimed to provide more evidence for the role of lncRNA coding genes to SLE susceptibility.<h4>Methods</h4>The genetic association analysis was first adopted from the previous genome-wide association studies (GWAS) and was then validated in an independent cohort. <i>PRDX6-AS1</i> is located at chr1:173204199-173446294. It spans a region of approximately 240 kb, and 297 single nucleotide polymorphisms (SNPs) were covered by the previous GWAS. Differential expression at the mRNA level was analyzed based on the ArrayExpress Archive database.<h4>Results</h4>A total of 33 SNPs were associated with SLE susceptibility, with a <i>P</i><1.68×10<sup>-4</sup>. The strongest association signal was detected at rs844649 (<i>P</i>=2.12×10<sup>-6</sup>), according to the previous GWAS. Combining the results from the GWAS Chinese cohort and our replication cohort, we pursued a meta-analysis approach and found a pronounced genetic association between <i>PRDX6-AS1</i> rs844649 and SLE susceptibility (p<sub>meta</sub>=1.24×10<sup>-13</sup>, OR 1.50, 95% CI: 1.34-1.67). The mRNA expression of <i>PRDX6</i> was elevated in peripheral blood cells, peripheral blood mononuclear cells (PBMCs), and multiple cell subpopulations, such as B cells, CD4<sup>+</sup> T cells, CD3<sup>+</sup> cells, and monocytes in patients with SLE. The <i>PRDX6</i> protein expression level was also increased in patients with SLE compared with healthy donors.<h4>Conclusion</h4>Our study provides new evidence that variants located in lncRNA coding genes are associated with SLE susceptibility.

Also flagged:human leukocyte antigen-GHLA-Gcancersliver infectionsautoimmune liver diseasestype 1 AIH
Journal Article 2022-10-12 No Snippets Littera R, Perra A, Miglianti M, Piras IS, Mocci S, Lai S, Melis M, Zolfino T, Balestrieri C, Conti M, Serra G, Figorilli F, Firinu D, Onali S, Matta L, Porcu C, Pes F, Fanni D, Manieli C, Vacca M, Cusano R, Trucas M, Cipri S, Tranquilli S, Rassu S, Cannas F, Carta MG, Kowalik MA, Giuressi E, Faa G, Chessa L, Giglio S.
Show Full Abstract

The immunomodulatory effects of HLA-G expression and its role in cancers, human liver infections and liver transplantation are well documented, but so far, there are only a few reports addressing autoimmune liver diseases, particularly autoimmune hepatitis (AIH).<h4>Method and materials</h4>We analyzed the genetic and phenotypic characteristics of HLA-G in 205 type 1 AIH patients (AIH-1) and a population of 210 healthy controls from Sardinia (Italy).<h4>Results</h4>Analysis of the HLA-G locus showed no substantial differences in allele frequencies between patients and the healthy control population. The HLA-G UTR-1 haplotype was the most prevalent in both AIH-1 patients and controls (40.24% and 34.29%). Strong linkage was found between the HLA-G UTR-1 haplotype and HLA-DRB1*03:01 in AIH-1 patients but not controls (<i>D'</i> = 0.92 <i>vs D'</i> = 0.50 respectively; P = 1.3x10<sup>-8</sup>). Soluble HLA-G (sHLA-G) levels were significantly lower in AIH-1 patients compared to controls [13.9 (11.6 - 17.4) U/mL <i>vs</i> 21.3 (16.5 - 27.8) U/mL; P = 0.011]. Twenty-four patients with mild or moderate inflammatory involvement, as assessed from liver biopsy, showed much higher sHLA-G levels compared to the 28 patients with severe liver inflammation [33.5 (23.6 - 44.8) U/mL <i>vs</i> 8.8 (6.1 - 14.5) U/mL; P = 0.003]. Finally, immunohistochemistry analysis of 52 liver biopsies from AIH-1 patients did not show expression of HLA-G molecules in the liver parenchyma. However, a percentage of 69.2% (36/52) revealed widespread expression of HLA-G both in the cytoplasm and the membrane of plasma cells labeled with anti-HLA-G monoclonal antibodies.<h4>Conclusion</h4>This study highlights the positive immunomodulatory effect of HLA-G molecules on the clinical course of AIH-1 and how this improvement closely correlates with plasma levels of sHLA-G. However, our results open the debate on the ambiguous role of HLA-G molecules expressed by plasma cells, which are pathognomonic features of AIH-1.

Also flagged:OsteosarcomaOSbone tumorstumorHydrogelsextracellular
Journal Article 2022-10-12 No Snippets Tian H, Wu R, Feng N, Zhang J, Zuo J.
Show Full Abstract

Osteosarcoma (OS), as a typical kind of bone tumors, has a high incidence among adolescents. Traditional tumor eradication avenues for OS such as chemotherapy, surgical therapy and radiation therapy usually have their own drawbacks including recurrence and metastasis. In addition, another serious issue in the treatment of OS is bone repair because the bone after tumor invasion usually has difficulty in repairing itself. Hydrogels, as a synthetic or natural platform with a porous three-dimensional structure, can be applied as desirable platforms for OS treatment. They can not only be used as carriers for tumor therapeutic drugs but mimic the extracellular matrix for the growth and differentiation of mesenchymal stem cells (MSCs), thus providing tumor treatment and enhancing bone regeneration at the same time. This review focuses the application of hydrogels in OS suppression and bone regeneration, and give some suggests on future development.

Also flagged:antibodiesepidermolysis bullosaalbinismALSspinal muscular atrophyhemophilia
Journal Article 2022-10-12 ✓ 1 Snippet Han Q, Fu H, Chu X, Wen R, Zhang M, You T, Fu P, Qin J, Cui T.
In-Text Gene Mentions

…gaucher disease, andhemochromatosis, but also has…

Show Full Abstract

As the incidence of rare diseases increases each year, the total number of rare disease patients worldwide is nearly 400 million. Orphan medications are drugs used to treat rare diseases. Orphan drugs, however, are rare and patients often struggle to utilize them and expensive medications during treatment. Orphan drugs have been the focus of new drug research and development for both domestic and international pharmaceutical companies as a result of the substantial investment being made in the field of rare diseases. Clinical breakthroughs have been made in every field, from traditional antibodies and small molecule drugs to gene therapy, stem cell therapy and small nucleic acid drugs. We here review the therapeutic means of rare diseases and drug development of rare diseases to show the progress of treatment of rare diseases in order to provide a reference for clinical use and new drug development of rare diseases in China.

Also flagged:bronchopulmonary dysplasiachronic inflammatory lung diseaseoxygeninfectionintra-uterine growth restrictionpulmonary hypertension
Journal Article 2022-10-12 No Snippets Barrett JS, Cala Pane M, Knab T, Roddy W, Beusmans J, Jordie E, Singh K, Davis JM, Romero K, Padula M, Thebaud B, Turner M.
Show Full Abstract

The 21<sup>st</sup> Century Cures Act requires FDA to expand its use of real-world evidence (RWE) to support approval of previously approved drugs for new disease indications and post-marketing study requirements. To address this need in neonates, the FDA and the Critical Path Institute (C-Path) established the International Neonatal Consortium (INC) to advance regulatory science and expedite neonatal drug development. FDA recently provided funding for INC to generate RWE to support regulatory decision making in neonatal drug development. One study is focused on developing a validated definition of bronchopulmonary dysplasia (BPD) in neonates. BPD is difficult to diagnose with diverse disease trajectories and few viable treatment options. Despite intense research efforts, limited understanding of the underlying disease pathobiology and disease projection continues in the context of a computable phenotype. It will be important to determine if: 1) a large, multisource aggregation of real-world data (RWD) will allow identification of validated risk factors and surrogate endpoints for BPD, and 2) the inclusion of these simulations will identify risk factors and surrogate endpoints for studies to prevent or treat BPD and its related long-term complications. The overall goal is to develop qualified, fit-for-purpose disease progression models which facilitate credible trial simulations while quantitatively capturing mechanistic relationships relevant for disease progression and the development of future treatments. The extent to which neonatal RWD can inform these models is unknown and its appropriateness cannot be guaranteed. A component of this approach is the critical evaluation of the various RWD sources for context-of use (COU)-driven models. The present manuscript defines a landscape of the data including targeted literature searches and solicitation of neonatal RWD sources from international stakeholders; analysis plans to develop a family of models of BPD in neonates, leveraging previous clinical trial experience and real-world patient data is also described.

Also flagged:schizophreniaclozapinepathogenesisbehavioralPsychosischlorpromazine
Journal Article 2022-10-12 ✓ 3 Snippets Jiao S, Cao T, Cai H.
In-Text Gene Mentions

The 5-HTT, encoded by the SLC6A4 gene, is responsible for reabsorption of serotonin into the presynaptic neuron and is a major regulator of serotonin function (Lesch et al., 1996).

Additionally, because HTTLPR regulates the transcriptional activity of the 5-HTT gene, genotypes with low expression such S'/S′ or S'/L′ would be more likely to have poor responses to clozapine (Kohlrausch et al., 2010).

…activity of the5-HTTgene, genotypes with…

Show Full Abstract

Treatment-resistant schizophrenia (TRS) often results in severe disability and functional impairment. Currently, the diagnosis of TRS is largely exclusionary and emphasizes the improvement of symptoms that may not be detected early and treated according to TRS guideline. As the gold standard, clozapine is the most prescribed selection for TRS. Therefore, how to predict TRS in advance is critical for forming subsequent treatment strategy especially clozapine is used during the early stage of TRS. Although mounting studies have identified certain clinical factors and neuroimaging characteristics associated with treatment response in schizophrenia, the predictors for TRS remain to be explored. Biomarkers, particularly for peripheral biomarkers, show great potential in predicting TRS in view of their predictive validity, noninvasiveness, ease of testing and low cost that would enable their widespread use. Recent evidence supports that the pathogenesis of TRS may be involved in abnormal neurotransmitter systems, inflammation and stress. Due to the heterogeneity of TRS and the lack of consensus in diagnostic criteria, it is difficult to compare extensive results among different studies. Based on the reported neurobiological mechanisms that may be associated with TRS, this paper narratively reviews the updates of peripheral biomarkers of TRS, from genetic and other related perspectives. Although current evidence regarding biomarkers in TRS remains fragmentary, when taken together, it can help to better understand the neurobiological interface of clinical phenotypes and psychiatric symptoms, which will enable individualized prediction and therapy for TRS in the long run.

Also flagged:cancerscancerbreast cancerGene Expressiontranscription factorstriple-negative breast cancer
Journal Article 2022-10-12 ✓ 1 Snippet Wang S, Shang P, Yao G, Ye C, Chen L, Hu X.
In-Text Gene Mentions

…such as EOMES,POU3F2, NR3C1, and RUNX1…

Show Full Abstract

<b>Background:</b> Breast carcinoma is well recognized to be having the highest global occurrence rate among all cancers, being the leading cause of cancer mortality in females. The aim of this study was to elucidate breast cancer at the genomic and transcriptomic levels in different subtypes so that we can develop more personalized treatments and precision medicine to obtain better outcomes. <b>Method:</b> In this study, an expression profiling dataset downloaded from the Gene Expression Omnibus database, GSE45827, was re-analyzed to compare the expression profiles of breast cancer samples in the different subtypes. Using the GEO2R tool, different expression genes were identified. Using the STRING online tool, the protein-protein interaction networks were conducted. Using the Cytoscape software, we found modules, seed genes, and hub genes and performed pathway enrichment analysis. The Kaplan-Meier plotter was used to analyze the overall survival. MicroRNAs and transcription factors targeted different expression genes and were predicted by the Enrichr web server. <b>Result:</b> The analysis of these elements implied that the carcinogenesis and development of triple-negative breast cancer were the most important and complicated in breast carcinoma, occupying the most different expression genes, modules, seed genes, hub genes, and the most complex protein-protein interaction network and signal pathway. In addition, the luminal A subtype might occur in a completely different way from the other three subtypes as the pathways enriched in the luminal A subtype did not overlap with the others. We identified 16 hub genes that were related to good prognosis in triple-negative breast cancer. Moreover, <i>SRSF1</i> was negatively correlated with overall survival in the Her2 subtype, while in the luminal A subtype, it showed the opposite relationship. Also, in the luminal B subtype, <i>CCNB1</i> and <i>KIF23</i> were associated with poor prognosis. Furthermore, new transcription factors and microRNAs were introduced to breast cancer which would shed light upon breast cancer in a new way and provide a novel therapeutic strategy. <b>Conclusion:</b> We preliminarily delved into the potentially comprehensive molecular mechanisms of breast cancer by creating a holistic view at the genomic and transcriptomic levels in different subtypes using computational tools. We also introduced new prognosis-related genes and novel therapeutic strategies and cast new light upon breast cancer.

Also flagged:cancerdeathcolorectal cancergene expressiononcogenestumour
Journal Article 2022-10-12 ✓ 1 Snippet Xiao Y, Qiu M, Tan C, Huang W, Hu S, Jiang X, Guo M, Wang C, Liang J, Wu Y, Li M, Li Q, Qin C.
In-Text Gene Mentions

…stasis by regulating miR-4736/CSE1Lsignaling pathway, which…

Show Full Abstract

As the third most common cancer and the second leading cause of cancer death worldwide, colorectal cancer (CRC) poses a serious threat to people's health. In recent years, circRNA has been widely reported as a new biomarker in CRC, but a comprehensive summary and analysis is lacking. This study aims to evaluate the diagnostic, therapeutic and prognostic significance of circRNAs in CRC by systematically analysing their expression patterns, biological functions and clinical significance in CRC. The literature on circRNA in CRC was searched in the PubMed database and included for analysis after screening according to strict inclusion and exclusion criteria. The UALCAN online tool was used to obtain host gene expression data. The miRTargetLink 2.0 was used to predict target genes for miRNAs action in CRC patients. Cytoscape was used to construct circRNA-miRNA-mRNA interaction networks. From the 236 included papers, we identified 217 circRNAs and their associated 108 host genes and 145 miRNAs. Among the 145 miRNAs, 27 miRNAs had no corresponding target genes. After prediction of target genes and differential analysis, a total of 25 target genes were obtained and a circRNA-miRNA-mRNA interaction network was constructed. Among the 217 circRNAs, 74 were associated with diagnosis, 160 with treatment and 51 with prognosis. And 154 of them function as oncogenes while 58 as tumour suppressor genes. In addition, these circRNAs include 32 exosomal circRNAs, which have unique advantages as biomarkers. In total, we summarize and analyze the expression patterns, biological functions and clinical significance of circRNAs in CRC. In addition, we constructed some new circRNA-miRNA-mRNA regulatory axes based on the miRNAs sponged by circRNAs.

Also flagged:melanomaFerroptosisirondeathtumorstumor
Journal Article 2022-10-12 ✓ 5 Snippets Rao Y, Zhu J, Zheng H, Dong W, Lin Q.
In-Text Gene Mentions

We observed expressions of ferroptosis related proteins including ALOX5, PEBP1, ACSL4 and ZEB1 in melanoma, which showed a strong cytoplasmic staining (Figure 8).

The protein level of ferroptosis-related genes was verified by the HPA database and IHC test, leading to the discovery that the expressions of ALOX5, PEBP1, ACSL4, and ZEB1 proteins up-regulated in tumor tissues, and existed differences between tumor tissues and normal tissues.

Our results suggest that PEBP1 may affect the prognosis of melanoma by LncRNA.

…of ALOX5 ,PEBP1, ACSL4 ,…

…dilution 1:100, Abcam), Anti-PEBP1(EPR2875Y, dilution 1:250,…

Show Full Abstract

Ferroptosis is an iron-dependent programmed cell death related to the biological process of many kinds of tumors. Long noncoding RNAs (<i>LncRNA)</i> have been found to play essential roles in the tumor, and their functions in the ferroptosis of tumor cells have been partially discovered. However, there is no summary of ferroptosis-related <i>LncRNA</i> and its functions in melanoma. In the present study, we aim to explore the expression profile of ferroptosis-related <i>LncRNA</i> genes and their value in melanoma prognosis by bioinformatics analysis. The expression of ferroptosis-related gene (<i>FRG</i>) from melanoma clinical data was extracted based on the Cancer Genome Atlas (<i>TCGA</i>) database. By screening the <i>RNA</i> expression data of 472 cases of melanoma and 810 cases of normal skin, eighteen ferroptosis-related differential genes were found to be related to the overall survival rate. Furthermore, 384 ferroptosis-related <i>LncRNAs</i> were discovered through constructing the <i>mRNA-LncRNA</i> co-expression network, and ten of them were found with prognostic significance in melanoma by multivariate Cox analysis. Risk assessment showed that the high expression of <i>LncRNA00520</i> is associated with poor prognosis, while the increased expression of the other LncRNA is beneficial to the prognosis of patients with melanoma. From univariate and multivariate Cox regression analysis, there were ten ferroptosis-related LncRNA risk models towards to be significant independent prognostic factors for patients with melanoma and valuable predictive factors for overall survival (<i>OS</i>)(P<0.05). The <i>ROC</i> curve further suggested that the risk score has relatively reliable predictive ability (<i>AUC</i>=0.718). The protein level of ferroptosis-related genes was verified by the <i>HPA</i> database and <i>IHC</i> test, leading to the discovery that the expressions of <i>ALOX5</i>, <i>PEBP1</i>, <i>ACSL4</i>, and <i>ZEB1</i> proteins up-regulated in tumor tissues, and existed differences between tumor tissues and normal tissues. In conclusion, we identified ten ferroptosis-related <i>LncRNA</i> and constructed a prognosis model base.

Also flagged:Protonmetabolismcholinemyo-inositolglutamateglutathione
Journal Article 2022-10-12 ✓ 3 Snippets Lowe AJ, Rodrigues FB, Arridge M, De Vita E, Johnson EB, Scahill RI, Byrne LM, Tortelli R, Heslegrave A, Zetterberg H, Wild EJ.
In-Text Gene Mentions

Huntington’s disease is a neurodegenerative disease characterized by progressive motor, psychiatric and cognitive dysfunction.1 Invariably fatal, Huntington’s disease is caused by an autosomal dominant mutation in the HTT gene, producing a CAG repeat expansion in the ubiquitously expressed huntingtin protein (HTT).2 This mutated pathogenic product (mHTT) causes a wide array of toxicities and disruption of downstream pathways, resulting in neuronal death.3 With genetic testing, the development of Huntington’s disease can be accurately predicted; however, there remains a need to discover clinically relevant biomarkers with the ability to detect and quantify pathogenic change, pharmacological target engagement and treatment response.4 Due to its non-invasive nature, accessibility and the potential to standardise parameters across multiple sites, neuroimaging is a valuable source of information about progression and prognosis4 and has been utilized in Huntington’s disease to explore cross-sectional and longitudinal changes in brain structure, metabolism and activation patterns.5–12

…mutation in theHTTgene, producing a…

…expressed huntingtin protein (HTT).…

Show Full Abstract

Proton magnetic resonance spectroscopy is a non-invasive method of exploring cerebral metabolism. In Huntington's disease, altered proton magnetic resonance spectroscopy-determined concentrations of several metabolites have been described; however, findings are often discrepant and longitudinal studies are lacking. Proton magnetic resonance spectroscopy metabolites may represent a source of biomarkers, thus their relationship with established markers of disease progression require further exploration to assess prognostic value and elucidate pathways associated with neurodegeneration. In a prospective single-site controlled cohort study with standardized collection of CSF, blood, phenotypic and volumetric imaging data, we used 3 T proton magnetic resonance spectroscopy in conjunction with the linear combination of model spectra method to quantify seven metabolites (total <i>n</i>-acetylaspartate, total creatine, total choline, myo-inositol, GABA, glutamate and glutathione) in the putamen of 59 participants at baseline (15 healthy controls, 15 premanifest and 29 manifest Huntington's disease gene expansion carriers) and 48 participants at 2-year follow-up (12 healthy controls, 13 premanifest and 23 manifest Huntington's disease gene expansion carriers). Intergroup differences in concentration and associations with CSF and plasma biomarkers; including neurofilament light chain and mutant Huntingtin, volumetric imaging markers; namely whole brain, caudate, grey matter and white matter volume, measures of disease progression and cognitive decline, were assessed cross-sectionally using generalized linear models and partial correlation. We report no significant groupwise differences in metabolite concentration at baseline but found total creatine and total <i>n</i>-acetylaspartate to be significantly reduced in manifest compared with premanifest participants at follow-up. Additionally, total creatine and myo-inositol displayed significant associations with reduced caudate volume across both time points in gene expansion carriers. Although relationships were observed between proton magnetic resonance spectroscopy metabolites and biofluid measures, these were not consistent across time points. To further assess prognostic value, we examined whether baseline proton magnetic resonance spectroscopy values, or rate of change, predicted subsequent change in established measures of disease progression. Several associations were found but were inconsistent across known indicators of disease progression. Finally, longitudinal mixed-effects models revealed glutamine + glutamate to display a slow linear decrease over time in gene expansion carriers. Altogether, our findings show some evidence of reduced total <i>n</i>-acetylaspartate and total creatine as the disease progresses and cross-sectional associations between select metabolites, namely total creatine and myo-inositol, and markers of disease progression, potentially highlighting the proposed roles of neuroinflammation and metabolic dysfunction in disease pathogenesis. However, the absence of consistent group differences, inconsistency between baseline and follow-up, and lack of clear longitudinal change suggests that proton magnetic resonance spectroscopy metabolites have limited potential as Huntington's disease biomarkers.

Also flagged:Xanthoneneurodegenerative diseaseconjugationglobularagingneurodegenerative diseases
Journal Article 2022-10-12 ✓ 5 Snippets Wang L, Hsiung CH, Liu X, Wang S, Loredo A, Zhang X, Xiao H.
In-Text Gene Mentions

For this study, we chose the well-known huntingtin (Htt) protein, whose N-terminus contains variable numbers of glutamine residues (polyQ).

The ability of glutamine to interact with water may contribute to the reduced extent of desolvation in Htt–polyQ aggregates.

…protein represented byHtt–polyQ. Third, our studies…

…the well-known huntingtin (Htt) protein, whose N-terminus…

…the polarity ofHtt–110Q aggregates.…

Show Full Abstract

Proper three-dimensional structures are essential for maintaining the functionality of proteins and for avoiding pathological consequences of improper folding. Misfolding and aggregation of proteins have been both associated with neurodegenerative disease. Therefore, a variety of fluorogenic tools that respond to both polarity and viscosity have been developed to detect protein aggregation. However, the rational design of highly sensitive fluorophores that respond solely to polarity has remained elusive. In this work, we demonstrate that electron-withdrawing heteroatoms with (d-p)-π* conjugation can stabilize lowest unoccupied molecular orbital (LUMO) energy levels and promote bathochromic shifts. Guided by computational analyses, we have devised a novel series of xanthone-based solvatochromic fluorophores that have rarely been systematically studied. The resulting probes exhibit superior sensitivity to polarity but are insensitive to viscosity. As proof of concept, we have synthesized protein targeting probes for live-cell confocal imaging intended to quantify the polarity of misfolded and aggregated proteins. Interestingly, our results reveal several layers of protein aggregates in a way that we had not anticipated. First, microenvironments with reduced polarity were validated in the misfolding and aggregation of folded globular proteins. Second, granular aggregates of AgHalo displayed a less polar environment than aggregates formed by folded globular protein represented by Htt-polyQ. Third, our studies reveal that granular protein aggregates formed in response to different types of stressors exhibit significant polarity differences. These results show that the solvatochromic fluorophores solely responsive to polarity represent a new class of indicators that can be widely used for detecting protein aggregation in live cells, thus paving the way for elucidating cellular mechanisms of protein aggregation as well as therapeutic approaches to managing intracellular aggregates.

bioRxiv 2022-10-12 Preprint (No Snippets API) Nguyen-Dien GT, Kozul K, Cui Y, Townsend B, Kulkarni PG, Ooi SS, Marzio A, Carrodus N, Zuryn S, Pagano M, Parton RG, Lazarou M, Millard S, Taylor RW, Collins BM, Jones MJ, Pagan JK.
Show Full Abstract

Cells selectively remove damaged or excessive mitochondria through mitophagy, a specialized form of autophagy, to maintain mitochondrial quality and quantity. Mitophagy is induced in response to diverse conditions, including hypoxia, cellular differentiation, and mitochondrial damage. However, the mechanisms by which cells remove specific dysfunctional mitochondria under steady-state conditions to fine-tune mitochondrial content are not well understood. Here, we report that SCF FBXL4 , an SKP1/CUL1/F-box protein ubiquitin ligase complex, localizes to the mitochondrial outer membrane in unstressed cells and mediates the constitutive ubiquitylation and degradation of the mitophagy receptors NIX and BNIP3 to suppress basal levels of mitophagy. We demonstrate that, unlike wild-type FBXL4, pathogenic variants of FBXL4 that cause encephalopathic mtDNA depletion syndrome (MTDPS13), do not efficiently interact with the core SCF ubiquitin ligase machinery or mediate the degradation of NIX and BNIP3. Thus, we reveal a molecular mechanism that actively suppresses mitophagy via preventing NIX and BNIP3 accumulation and propose that excessive basal mitophagy in the FBXL4-associated mtDNA depletion syndrome is caused by dysregulation of NIX and BNIP3 turnover.

Research Square 2022-10-12 Preprint (No Snippets API) Chen H, Zhou T, Wang Y, Wen S, Dao P, Chen M.
Show Full Abstract

Bladder cancer (BCa) is the most common male neoplastic disease, and its pathogenesis has not been fully explained. In this study, 5 key molecules, including CNTN1, MAP1A, EMP1, MFAP5, and PTGIS, were identified as key genes in the progression of BCa, and their riskScore was constructed. We found these five key genes to be significantly correlated with patient prognosis and immune checkpoint molecules, and the riskScore had a surprisingly accurate ability to predict patient prognosis and immunotherapy efficacy. Among the high-risk groups identified by the riskScore, patient prognosis and immunotherapy effect were significantly worse than the others. In summary, we proved that 5 key genes were able to impact the prognosis of BCa, TME immune infiltration, and the efficacy of immunotherapy, and the riskScore tool we constructed will contribute to the development of individualized treatment for BCa.

Also flagged:E3 ubiquitin ligasedevelopmental disorderintellectual disabilityepilepsyautism spectrum disorderCUL3
Journal Article 2022-10-11 ✓ 5 Snippets Sleyp Y, Valenzuela I, Accogli A, Ballon K, Ben-Zeev B, Berkovic SF, Broly M, Callaerts P, Caylor RC, Charles P, Chatron N, Cohen L, Coppola A, Cordeiro D, Cuccurullo C, Cuscó I, Janette diMonda, Duran-Romaña R, Ekhilevitch N, Fernández-Alvarez P, Gordon CT, Isidor B, Keren B, Lesca G, Maljaars J, Mercimek-Andrews S, Morrow MM, Muir AM, University of Washington Center for Mendelian Genomics, Rousseau F, Salpietro V, Scheffer IE, Schnur RE, Schymkowitz J, Souche E, Steyaert J, Stolerman ES, Vengoechea J, Ville D, Washington C, Weiss K, Zaid R, Sadleir LG, Mefford HC, Peeters H.
In-Text Gene Mentions

De novo missense variants in the E3 ubiquitin ligase adaptor KLHL20 cause a developmental disorder with intellectual disability, epilepsy, and autism spectrum disorder.

Phenotyping of patients with de novo missense variants in KLHL20 was performed.<h4>Results</h4>We studied 14 patients with de novo missense variants in KLHL20, delineating a genetic syndrome with patients having mild to severe intellectual disability, febrile seizures or epilepsy, autism spectrum disorder, hyperactivity, and subtle dysmorphic facial features.

We report on a neurodevelopmental disorder caused by de novo missense variants in KLHL20.<h4>Methods</h4>Patients were ascertained by the investigators through Matchmaker Exchange.

The recurrent missense and the 3 other missense variants all clustered in the Kelch-type β-propeller domain of the KLHL20 protein, which shapes the substrate binding surface.<h4>Conclusion</h4>Our findings implicate KLHL20 in a neurodevelopmental disorder characterized by intellectual disability, febrile seizures or epilepsy, autism spectrum disorder, and hyperactivity.

…ubiquitin ligase adaptorKLHL20cause a developmental…

Show Full Abstract

<h4>Purpose</h4>KLHL20 is part of a CUL3-RING E3 ubiquitin ligase involved in protein ubiquitination. KLHL20 functions as the substrate adaptor that recognizes substrates and mediates the transfer of ubiquitin to the substrates. Although KLHL20 regulates neurite outgrowth and synaptic development in animal models, a role in human neurodevelopment has not yet been described. We report on a neurodevelopmental disorder caused by de novo missense variants in KLHL20.<h4>Methods</h4>Patients were ascertained by the investigators through Matchmaker Exchange. Phenotyping of patients with de novo missense variants in KLHL20 was performed.<h4>Results</h4>We studied 14 patients with de novo missense variants in KLHL20, delineating a genetic syndrome with patients having mild to severe intellectual disability, febrile seizures or epilepsy, autism spectrum disorder, hyperactivity, and subtle dysmorphic facial features. We observed a recurrent de novo missense variant in 11 patients (NM_014458.4:c.1069G>A p.[Gly357Arg]). The recurrent missense and the 3 other missense variants all clustered in the Kelch-type β-propeller domain of the KLHL20 protein, which shapes the substrate binding surface.<h4>Conclusion</h4>Our findings implicate KLHL20 in a neurodevelopmental disorder characterized by intellectual disability, febrile seizures or epilepsy, autism spectrum disorder, and hyperactivity.

Also flagged:Autophagyorganelleslysosomaldegradationmacroautophagycytoplasm
Journal Article 2022-10-11 ✓ 1 Snippet Overhoff M, Tellkamp F, Hess S, Tolve M, Tutas J, Faerfers M, Ickert L, Mohammadi M, De Bruyckere E, Kallergi E, Delle Vedove A, Nikoletopoulou V, Wirth B, Isensee J, Hucho T, Puchkov D, Isbrandt D, Krueger M, Kloppenburg P, Kononenko NL.
In-Text Gene Mentions

…proteomics analysis (includingLRRC7, DLGAP4, SHANK3, STXBP5,…

Show Full Abstract

Autophagy provides nutrients during starvation and eliminates detrimental cellular components. However, accumulating evidence indicates that autophagy is not merely a housekeeping process. Here, by combining mouse models of neuron-specific ATG5 deficiency in either excitatory or inhibitory neurons with quantitative proteomics, high-content microscopy, and live-imaging approaches, we show that autophagy protein ATG5 functions in neurons to regulate cAMP-dependent protein kinase A (PKA)-mediated phosphorylation of a synapse-confined proteome. This function of ATG5 is independent of bulk turnover of synaptic proteins and requires the targeting of PKA inhibitory R1 subunits to autophagosomes. Neuronal loss of ATG5 causes synaptic accumulation of PKA-R1, which sequesters the PKA catalytic subunit and diminishes cAMP/PKA-dependent phosphorylation of postsynaptic cytoskeletal proteins that mediate AMPAR trafficking. Furthermore, ATG5 deletion in glutamatergic neurons augments AMPAR-dependent excitatory neurotransmission and causes the appearance of spontaneous recurrent seizures in mice. Our findings identify a novel role of autophagy in regulating PKA signaling at glutamatergic synapses and suggest the PKA as a target for restoration of synaptic function in neurodegenerative conditions with autophagy dysfunction.

Also flagged:extracellularangiogenesisCD31fascia matrix proteinscollagentenascin-C
Journal Article 2022-10-11 No Snippets Ziegler ME, Sorensen AM, Banyard DA, Sayadi LR, Chnari E, Hatch MM, Tassey J, Mirzakhanyan Y, Gershon PD, Hughes CCW, Evans GRD, Widgerow AD.
Show Full Abstract

<h4>Background</h4>Autologous fat grafting is commonly used for soft-tissue repair (approximately 90,000 cases per year in the United States), but outcomes are limited by volume loss (20% to 80%) over time. Human allograft adipose matrix (AAM) stimulates de novo adipogenesis in vivo, but retention requires optimization. The extracellular matrix derived from superficial fascia, interstitial within the adipose layer, is typically removed during AAM processing. Thus, fascia, which contains numerous important proteins, might cooperate with AAM to stimulate de novo adipogenesis, improving long-term retention compared to AAM alone.<h4>Methods</h4>Human AAM and fascia matrix proteins (back and upper leg regions) were identified by mass spectrometry and annotated by gene ontology. A three-dimensional in vitro angiogenesis assay was performed. Finally, AAM and/or fascia (1 mL) was implanted into 6- to 8-week-old male Fischer rats. After 8 weeks, the authors assessed graft retention by gas pycnometry and angiogenesis (CD31) and adipocyte counts (hematoxylin and eosin) histologically.<h4>Results</h4>Gene ontology annotation revealed an angiogenic enrichment pattern unique to the fascia, including lactadherin, collagen alpha-3(V) chain, and tenascin-C. In vitro, AAM stimulated 1.0 ± 0.17 angiogenic sprouts per bead. The addition of fascia matrix increased sprouting by 88% (2.0 ± 0.12; P < 0.001). A similar angiogenic response (CD31) was observed in vivo. Graft retention volume was 25% (0.25 ± 0.13) for AAM, significantly increasing to 60% (0.60 ± 0.14) for AAM/fascia ( P < 0.05). De novo adipogenesis was 12% (12.4 ± 7.4) for AAM, significantly increasing to 51% (51.2 ± 8.0) for AAM/fascia ( P < 0.001) by means of adipocyte quantification.<h4>Conclusions</h4>Combining fascia matrix with AAM improves angiogenesis and adipogenesis compared to AAM alone in rats. These preliminary in vitro and pilot animal studies should be further validated before definitive clinical adoption.<h4>Clinical relevance statement</h4>When producing an off-the-shelf adipose inducing product by adding a connective tissue fascial component (that is normally discarded) to the mix of adipose matrix, vasculogenesis is increased and, thus, adipogenesis and graft survival is improved. This is a significant advance in this line of product.

Also flagged:lipidcoronary artery diseasedyslipidemiaLDLRlipoproteincholesterol
Journal Article 2022-10-11 No Snippets Selvaraj MS, Li X, Li Z, Pampana A, Zhang DY, Park J, Aslibekyan S, Bis JC, Brody JA, Cade BE, Chuang LM, Chung RH, Curran JE, de las Fuentes L, de Vries PS, Duggirala R, Freedman BI, Graff M, Guo X, Heard-Costa N, Hidalgo B, Hwu CM, Irvin MR, Kelly TN, Kral BG, Lange L, Li X, Lisa M, Lubitz SA, Manichaikul AW, Michael P, Montasser ME, Morrison AC, Naseri T, O'Connell JR, Palmer ND, Palmer ND, Peyser PA, Reupena MS, Smith JA, Sun X, Taylor KD, Tracy RP, Tsai MY, Wang Z, Wang Y, Bao W, Wilkins JT, Yanek LR, Zhao W, Arnett DK, Blangero J, Boerwinkle E, Bowden DW, Chen YI, Correa A, Cupples LA, Dutcher SK, Ellinor PT, Fornage M, Gabriel S, Germer S, Gibbs R, He J, Kaplan RC, Kardia SLR, Kim R, Kooperberg C, Loos RJF, Viaud-Martinez KA, Mathias RA, McGarvey ST, Mitchell BD, Nickerson D, North KE, Psaty BM, Redline S, Reiner AP, Vasan RS, Rich SS, Willer C, Rotter JI, Rader DJ, Lin X, NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium, Peloso GM, Natarajan P.
Show Full Abstract

Blood lipids are heritable modifiable causal factors for coronary artery disease. Despite well-described monogenic and polygenic bases of dyslipidemia, limitations remain in discovery of lipid-associated alleles using whole genome sequencing (WGS), partly due to limited sample sizes, ancestral diversity, and interpretation of clinical significance. Among 66,329 ancestrally diverse (56% non-European) participants, we associate 428M variants from deep-coverage WGS with lipid levels; ~400M variants were not assessed in prior lipids genetic analyses. We find multiple lipid-related genes strongly associated with blood lipids through analysis of common and rare coding variants. We discover several associated rare non-coding variants, largely at Mendelian lipid genes. Notably, we observe rare LDLR intronic variants associated with markedly increased LDL-C, similar to rare LDLR exonic variants. In conclusion, we conducted a systematic whole genome scan for blood lipids expanding the alleles linked to lipids for multiple ancestries and characterize a clinically-relevant rare non-coding variant model for lipids.

Also flagged:gene expressionmetabolismreproductionlactationpubertygrowth hormone
Journal Article 2022-10-11 No Snippets Hou H, Chan C, Yuki KE, Sokolowski D, Roy A, Qu R, Uusküla-Reimand L, Faykoo-Martinez M, Hudson M, Corre C, Goldenberg A, Zhang Z, Palmert MR, Wilson MD.
Show Full Abstract

<h4>Background</h4>The pituitary gland regulates essential physiological processes such as growth, pubertal onset, stress response, metabolism, reproduction, and lactation. While sex biases in these functions and hormone production have been described, the underlying identity, temporal deployment, and cell-type specificity of sex-biased pituitary gene regulatory networks are not fully understood.<h4>Methods</h4>To capture sex differences in pituitary gene regulation dynamics during postnatal development, we performed 3' untranslated region sequencing and small RNA sequencing to ascertain gene and microRNA expression, respectively, across five postnatal ages (postnatal days 12, 22, 27, 32, 37) that span the pubertal transition in female and male C57BL/6J mouse pituitaries (n = 5-6 biological replicates for each sex at each age).<h4>Results</h4>We observed over 900 instances of sex-biased gene expression and 17 sex-biased microRNAs, with the majority of sex differences occurring with puberty. Using miRNA-gene target interaction databases, we identified 18 sex-biased genes that were putative targets of 5 sex-biased microRNAs. In addition, by combining our bulk RNA-seq with publicly available male and female mouse pituitary single-nuclei RNA-seq data, we obtained evidence that cell-type proportion sex differences exist prior to puberty and persist post-puberty for three major hormone-producing cell types: somatotropes, lactotropes, and gonadotropes. Finally, we identified sex-biased genes in these three pituitary cell types after accounting for cell-type proportion differences between sexes.<h4>Conclusion</h4>Our study reveals the identity and postnatal developmental trajectory of sex-biased gene expression in the mouse pituitary. This work also highlights the importance of considering sex biases in cell-type composition when understanding sex differences in the processes regulated by the pituitary gland.

Also flagged:HDAC2DNA MethyltransferaseDNMT3BWntBcl2gliomas
Journal Article 2022-10-11 ✓ 4 Snippets Ren X, Jiang Z, Xu K.
In-Text Gene Mentions

The expression of 5-HTT correlated with the phenomenon of autophagy in tumor cells, suggesting that HDAC2 plays a role in tumor cell autophagy and apoptosis through the downregulation of 5-HTT expression.

…ydroxytryptamine transporter (5-HTT) in HepG2 and…

…bound to the5-HTTpromoter region leading…

…the expression of5-HTTby the chromatin…

Show Full Abstract

<h4>Purpose</h4>To investigate the role and molecular mechanism of HDAC2 in glioma.<h4>Methods</h4>GSE16011, GSE31262, and GSE90598 datasets were used to identify co-expressed genes, GO analysis, and KEGG analysis to identify gene enrichment pathways, and PPI networks were constructed to identify gene interrelationships. HDAC2 enrichment on DNMT3B promoter and DNMT3B enrichment on Bcl2 CpG island was detected by a ChIP assay. The expression, prognosis, and hierarchical distribution of HDAC2, DNMT3B, and Bcl2 were examined in the CGGA database, and the correlation between HDAC2 and DNMT3B, Bcl2, and DNMT3B and Bcl2 was assessed.<h4>Results</h4>The HDAC2-DNMT3B-Bcl2 axis is differentially expressed and interacts in gliomas. HDAC2 activates the transcriptional activity of DNMT3B, and DNMT3B inhibits the expression of Bcl2. HDAC2 and DNMT3B are highly expressed in gliomas and have a poor prognosis, while Bcl2 is lowly expressed in gliomas and has a good prognosis.<h4>Conclusion</h4>HDAC2 promotes DNMT3B transcriptional repression of Bcl2 expression and Wnt pathway activity, thereby activating glioma cell activity in vitro and in vivo.

Also flagged:L-Amino Acid DecarboxylaseAADCAromatic L-amino acid decarboxylaseAADC) deficiencymetabolic disorderdopa decarboxylase
Journal Article 2022-10-11 ✓ 1 Snippet Rizzi S, Spagnoli C, Frattini D, Pisani F, Fusco C.
In-Text Gene Mentions

…heterozygous variants inDCCgene were demonstrated,…

Show Full Abstract

Aromatic L-amino acid decarboxylase (AADC) deficiency is a rare congenital autosomal recessive metabolic disorder caused by pathogenic homozygous or compound heterozygous variants in the dopa decarboxylase (DDC) gene. Adeno-associated viral vector-mediated gene transfer of the human AADC gene into the putamina has become available. This systematic review on PubMed, Scopus databases, and other sources is aimed at describing the AADC whole phenotypic spectrum in order to facilitate its early diagnosis. Literature reviews, original articles, retrospective and comparative studies, large case series, case reports, and short communications were considered. A database was set up using Microsoft Excel to collect clinical, molecular, biochemical, and therapeutic data. By analysing 261 patients from 41 papers with molecular and/or biochemical diagnosis of AADC deficiency for which individuality could be determined with certainty, we found symptom onset to occur in the first 6 months of life in 93% of cases. Hypotonia and developmental delay are cardinal signs, reported as present in 73.9% and 72% of cases, respectively. Oculogyric crises were seen in 67% of patients while hypokinesia in 42% and ptosis in 26%. Dysautonomic features have been revealed in 53% and gastrointestinal symptoms in 19% of cases. With 37% and 30% of patients reported being affected by sleep and behavioural disorders, it seems to be commoner than previously acknowledged. Although reporting bias cannot be excluded, there is still a need for comprehensive clinical descriptions of symptoms at onset and during follow-up. In fact, our review suggests that most of the neurological and extraneurological symptoms and signs reported, although quite frequent in this condition, are not pathognomonic, and therefore, ADCC deficiency can remain an underdiscovered disorder.

Also flagged:Transcription FactorMYBL2lung adenocarcinomaantibodybindingFOXM1
Journal Article 2022-10-11 No Snippets Lee Y, Wu Z, Yang S, Schreiner SM, Gonzalez-Smith LD, Rhie SK.
Show Full Abstract

Overexpression of MYBL2 is associated with poor survival of lung adenocarcinoma patients, but the molecular mechanism by which it regulates transcription and carcinogenesis has not yet been elucidated. In this study, we performed ChIP-seq using an MYBL2-targeted antibody and discovered that MYBL2 primarily binds to the promoters of highly expressed genes in lung adenocarcinoma cells. Using a knockdown experiment of MYBL2 and global transcriptome profiling, we identified that over a thousand genes are dysregulated by MYBL2, and MYBL2 acts as a transcriptional activator in lung adenocarcinoma cells. Moreover, we revealed that the binding sites of FOXM1 are largely shared with MYBL2 binding sites, and genes involved in cell cycle phase transitions are regulated by these transcription factors. We furthermore investigated the effect of a previously reported FOXM1 inhibitor, FDI-6, in lung adenocarcinoma cells. We demonstrated that FDI-6 decreases the proliferation of lung adenocarcinoma cells and inhibits the activities of FOXM1 as well as MYBL2. Moreover, we found that genes involved in cell death and cell cycle are inhibited by FDI-6. Overall, our findings suggest that MYBL2 and FOXM1 activate cell cycle genes together, acting as oncogenic transcription factors in lung adenocarcinoma cells, and they are potential treatment targets for the disease.

Also flagged:Periodontitischronic non-communicable diseaseperiodontal inflammationpathogenesispro-inflammatory cytokineschemotaxis
Journal Article 2022-10-11 ✓ 2 Snippets Sansores-España LD, Melgar-Rodríguez S, Vernal R, Carrillo-Ávila BA, Martínez-Aguilar VM, Díaz-Zúñiga J.
In-Text Gene Mentions

…of Olfactomedin 4 (OLFM4) [ 7 ].…

…in some neutrophils:OLFM4within granules, and…

Show Full Abstract

Periodontitis is a chronic non-communicable disease caused by dysbiotic changes that affect the subgingival microbiota. During periodontitis, neutrophils play a central role in the initial recognition of bacteria, and their number increases with the appearance of the first signs of periodontal inflammation. Recent evidence has led to the proposition that neutrophils can also functionally polarize, determining selective activity patterns related to different diseases. Two well-defined neutrophil phenotypes have been described, the pro-inflammatory N1 subset and the suppressor N2 subset. To date, it has not been established whether these different neutrophil subtypes play a role in the pathogenesis of periodontitis. Thus, this scoping review aimed to determine whether there was evidence to suggest that the neutrophils present in periodontal tissues can be associated with certain phenotypes. The research question, population, concept, and context sought to identify original articles, in humans, that detected the presence of neutrophils in the periodontal tissues of people affected by periodontitis. Based on the search strategy, we found 3658 studies. After removing the papers with abstracts not related to the outcome measures and eligibility criteria, 16 articles were included for qualitative analysis. Several studies identified the presence of different neutrophil subsets, specifically, the naive, pro- and para-inflammatory, hyper-reactive and hyper-active, and high- and low-responder phenotypes. The existing evidence demonstrates the presence of pro-inflammatory, hyper-reactive and high-responder neutrophils in periodontal tissues affected with periodontitis. There is no evidence demonstrating the presence of the N1 or N2 phenotypes in periodontal tissues during periodontitis. However, the existence of pro-inflammatory phenotypes, which increase NETosis and degranulation, and increase the production of pro-inflammatory cytokines, could be suggestive of the N1 phenotypes.

Also flagged:prostate-specific 1membrane antigenPSMAtype II transmembrane proteinProstate-specific membrane antigenPCaphoton
Journal Article 2022-10-11 No Snippets Luan X, Zhou H, Chen Y, Zhang X, Cui M, Chen K, Xu X, Zhang J, Xu B.
Show Full Abstract

<h4>Purpose</h4>Prostate cancer (PCa) is characterized by high expression of prostate-specific 1membrane antigen (PSMA), a type II transmembrane protein. Prostate-specific membrane antigen positron emission tomography (PSMA PET) has high sensitivity and specificity and can therefore be potentially used to detect PCa. Exploiting the advantages of PSMA PET imaging, in this study, we aim to develop a novel radiopharmaceutical to facilitate biopsy punching of PCa.<h4>Methods</h4>We synthesized a high-affinity radiopharmaceutical of PSMA (<sup>125</sup>I-PSMA-7). We evaluated the properties of <sup>125</sup>I-PSMA-7, including the purity, stability, affinity, partition coefficient, and toxicity. (PSMA+) 22Rv1 and (PSMA-) PC3 cell lines were used to evaluate <sup>125</sup>I-PSMA-7 in vitro. BALB/c nude mice bearing 22Rv1 and PC3 xenografts were used for biodistribution and imaging. The uptake of the main organs was evaluated in vivo using single photon emission computed tomography (SPECT).<h4>Results</h4><sup>125</sup>I-PSMA-7 had a purity of 99.6% and remained stable for seven days and was therefore always safe to use. <sup>125</sup>I-PSMA-7 had a Ki of 4.037 × 10<sup>-11</sup> and a partition coefficient of -1.80. The results of in vitro cellular experiments showed a high uptake by 22Rv1 cells (ranging from 2.88 ± 0.14 IA%/10<sup>6</sup> at 5 min to 61.98 ± 3.43 IA%/10<sup>6</sup> at 24 h, where the internalization was 46.1% at 1 h and 88.06% at 24 h). However, the uptake of PC3 cells was very low (ranging from 0.34 ± 0.08 IA%/10<sup>6</sup> at 5 min to 1.60 ± 0.15 IA%/10<sup>6</sup> at 24 h). The tumors' uptake of <sup>125</sup>I-PSMA-7 ranged from 9.02 ± 0.30 ID%/g at 1 h to 4.11 ± 1.04 ID%/g at 7 d and the tumor/muscle ratios and tumor/blood ratios increased over time. In addition, we used γ-counter to measure cpm per milligram of tumor and muscle on days 4 and 7. The background on day 4 is 42 cpm and the tumor is 1739 cpm/mg and the muscle is 45 cpm/mg, and the background on day 7 is 74 cpm and the tumor is 1404cpm/mg and the muscle is 32 cpm/mg. At 1 h post-injection, the high uptake of <sup>125</sup>I-PSMA-7 resulted in clear delineation of 22Rv1-derived tumors upon imaging. By comparison, 22Rv1-blocking mice took up less <sup>125</sup>I-PSMA-7.<h4>Conclusions</h4>These results show that <sup>125</sup>I-PSMA-7 is a promising radiotracer that could be used to puncture the prostate. <sup>125</sup>I-PSMA-7 could be applied to targeted biopsy, reducing the need for saturated biopsy.

Also flagged:HydroxyapatiteSynthesisWatermetalschitosanglycerol
Journal Article 2022-10-11 No Snippets Akartasse N, Azzaoui K, Mejdoubi E, Elansari LL, Hammouti B, Siaj M, Jodeh S, Hanbali G, Hamed R, Rhazi L.
Show Full Abstract

Water purification from toxic metals was the main objective of this work. A composite in film form was prepared from the biomaterials hydroxyapatite, chitosan and glycerol using the dissolution/recrystallization method. A nanoparticle-based film with a homogenous and smooth surface was produced. The results of total reflectance infrared spectroscopy (ATR-FTIR) and thermal gravimetric analysis (TGA/DTA) demonstrated the presence of a substantial physical force between composite components. The composite was tested for its ability to absorb Cd2+ and Zn2+ ions from aqueous solutions. Cd2+ and Zn2+ adsorption mechanisms are fit using the Langmuir model and the pseudo-second-order model. Thermodynamic parameters indicated that Cd2+ and Zn2+ ion adsorption onto the composite surface is spontaneous and preferred at neutral pH and temperatures somewhat higher than room temperature. The adsorption studies showed that the maximum adsorption capacity of the HAp/CTs bio-composite membrane for Cd2+ and Zn2+ ions was in the order of cadmium (120 mg/g) > Zinc (90 mg/g) at an equilibrium time of 20 min and a temperature of 25 °C. The results obtained on the physico-chemical properties of nanocomposite membranes and their sorption capacities offer promising potential for industrial and biological activities.

Also flagged:Delta-cateninmedulloblastomamalignant tumorGene Expressionwound healingepithelial-mesenchymal transition
Journal Article 2022-10-11 ✓ 1 Snippet Hu Y, Zhu S, Xu R, Wang M, Chen F, Zhang Z, Feng B, Wang J, Chen Z, Wang J.
In-Text Gene Mentions

…PTGER4, THUMPD3, PDZD2,LRRC7, ZMYND19, NR3C1 and…

Show Full Abstract

<b>Background:</b> Medulloblastoma is the most common pediatric malignant tumor in central nervous system. Although its prognosis has been improved enormously by the combination treatments with surgery, radiotherapy, and chemotherapy, it still could progress <i>via</i> invasion and distant dissemination. We aimed to investigate molecular mechanisms of medulloblastoma invasion in the current work. <b>Methods:</b> The gene expression profile of medulloblastoma were analyzed based on the data deposited in Gene Expression Omnibus (GEO) and filtered according to brain specific proteins in the Uniprot. Delta-catenin was identified and further analyzed about its expression and roles in the prognosis of medulloblastoma patient. The function of delta-catenin on cell invasion and migration were investigated by transwell and wound healing assay. Whether delta-catenin participates in the epithelial-mesenchymal transition (EMT) regulated invasion was also studied. <b>Results:</b> Delta-catenin expression was highly upregulated in tumor tissues compared to normal tissues from medulloblastoma patients in five independent, nonoverlapping cohorts. Furthermore, delta-catenin expression level was upregulated in WNT subgroup, and significantly correlated with better prognosis, and associated with metastasis through GEO database analysis. Functional assays indicated that delta-catenin inhibited medulloblastoma cell invasion and migration through regulating the key factors of EMT pathway, such as E-cadherin and vimentin. <b>Conclusion:</b> Delta-catenin might be a positive predictor for prognosis of medulloblastoma patients, through attenuating medulloblastoma cell invasion by inhibiting EMT pathway.

Also flagged:MitophagyAgingmitochondrialage-related diseasesmetabolic disordersneuropathies
Journal Article 2022-10-11 ✓ 2 Snippets Rappe A, McWilliams TG.
In-Text Gene Mentions

The mitochondrial disease associated FBXL4, was also recently implicated in the regulation of mammalian mitophagy (Alsina at al. 2020).

…tochondrial disease associatedFBXL4, was also recently…

Show Full Abstract

Aging is characterised by the progressive accumulation of cellular dysfunction, stress, and inflammation. A large body of evidence implicates mitochondrial dysfunction as a cause or consequence of age-related diseases including metabolic disorders, neuropathies, various forms of cancer and neurodegenerative diseases. Because neurons have high metabolic demands and cannot divide, they are especially vulnerable to mitochondrial dysfunction which promotes cell dysfunction and cytotoxicity. Mitophagy neutralises mitochondrial dysfunction, providing an adaptive quality control strategy that sustains metabolic homeostasis. Mitophagy has been extensively studied as an inducible stress response in cultured cells and short-lived model organisms. In contrast, our understanding of physiological mitophagy in mammalian aging remains extremely limited, particularly in the nervous system. The recent profiling of mitophagy reporter mice has revealed variegated vistas of steady-state mitochondrial destruction across different tissues. The discovery of patients with congenital autophagy deficiency provokes further intrigue into the mechanisms that underpin neural integrity. These dimensions have considerable implications for targeting mitophagy and other degradative pathways in age-related neurological disease.

Also flagged:ferroptosisribosomephosphorylationMitophagyHIF-1Jun
Journal Article 2022-10-11 ✓ 1 Snippet Zhang J, Cui Y.
In-Text Gene Mentions

…MAP1LC3A, MT3, OTUB1,PRDX6, SAT1, SELENOS, TAZ,…

Show Full Abstract

There are studies on the hypoxia adaptation in yak, but there are few studies on the regulation of ferroptosis by hypoxia. This study was the first time to explore ferroptosis-related genes about hypoxia in yak. In this study, the oviduct epithelial cells between yak and bovine are performed by integrative analysis for functions, regulating network and hub genes. The results showed 29 up-regulated ferroptosis genes and 67 down-regulated ferroptosis genes, and GO-KEGG analysis showed that up-regulated differentially expressed genes (DEGs) were significantly enriched in ribosome pathway and oxidative phosphorylation pathway. Down-regulated DEGs were significantly enriched in longevity regulating pathway-mammal pathway. Mitophagy-Animal Pathway was a significant enrichment pathway for the up-regulated differentially expressed ferroptosis genes (DE-FRGs). HIF-1 signaling pathway is a significant pathway for the down-regulated DE-FRGs. By constructing DE-FRGs protein-protein interaction (PPI) network, 10 hub DE-FRGs (Jun, STAT3, SP1, HIF1A, Mapk1, Mapk3, Rela, Ulk1, CDKN1A, EPAS1) were obtained. The bta-mir-21-5p, bta-mir-10a and bta-mir-17-5p related to STAT3 were predicted. The results of this study indicated the important genes and pathways of the hypoxia in yak, and it was the first time to study ferroptosis genes and pathways related to the hypoxia adaptation by bulk-seq in yak. This study provided sufficient transcriptome datas for hypoxia adaptation.

Also flagged:bone disordersmineralizationossificationhypophosphatasiahypophosphatemiaachondroplasia
Journal Article 2022-10-11 ✓ 1 Snippet Thrailkill KM, Kalaitzoglou E, Fowlkes JL.
In-Text Gene Mentions

Asfotase alfa consists of the tissue non-specific alkaline phosphatase (TNSALP) enzyme linked to the human IgG Fc domain and a terminal deca-aspartate peptide which enhances targeting to hydroxyapatite Ca10(PO4)6(OH)2 crystals.

Show Full Abstract

In recent years, new therapies for the treatment of rare pediatric bone disorders have emerged, guided by an increasing understanding of the genetic and molecular etiology of these diseases. Herein, we review three such disorders, impacted by debilitating deficits in bone mineralization or cartilage ossification, as well as the novel disease-modifying drugs that are now available to treat these conditions. Specifically, we discuss asfotase alfa, burosumab-twza, and vosoritide, for the treatment of hypophosphatasia, X-linked hypophosphatemia and achondroplasia, respectively. For each skeletal disorder, an overview of the clinical phenotype and natural history of disease is provided, along with a discussion of the clinical pharmacology, mechanism of action and FDA indication for the relevant medication. In each case, a brief review of clinical trial data supporting drug development for each medication is provided. Additionally, guidance as to drug dosing and long-term monitoring of adverse events and pediatric efficacy is presented, to aid the clinician seeking to utilize these novel therapies in their practice, or to become familiar with the healthcare expectations for children receiving these medications through specialized multidisciplinary clinics. The availability of these targeted therapies now significantly augments treatment options for conditions in which past therapy has relied upon less specific, symptomatic medical and orthopedic care.

Also flagged:colorectal cancertumorcancersagingnucleotideschromatin
Journal Article 2022-10-11 No Snippets He J, Wu W.
Show Full Abstract

This review aimed to use bibliometric analysis to sort out, analyze and summarize the knowledge foundation and hot topics in the field of long noncoding RNAs (lncRNAs) in colorectal cancer (CRC), and point out future trends to inspire related research and innovation. We used CiteSpace to analyze publication outputs, countries, institutions, authors, journals, references, and keywords. Knowledge foundations, hotspots, and future trends were then depicted. The overall research showed the trend of biomedical-oriented multidisciplinary. Much evidence indicates that lncRNA plays the role of oncogene or tumor suppressor in the occurrence and development of CRC. Besides, many lncRNAs have multiple mechanisms. lncRNAs and metastasis of CRC, lncRNAs and drug resistance of CRC, and the clinical application of lncRNAs in CRC are current research hotspots. Through insight into the development trend of lncRNAs in CRC, this study will help researchers extract hidden valuable information for further research.

Also flagged:Thrombocytopenic PurpuraHemolytic Uremic SyndromeHUSthrombotic thrombocytopenic purpurarenal damageAcute kidney injury
Journal Article 2022-10-11 ✓ 1 Snippet Patel M, Pawar T, Agrawal S, Mudey G, Kumar S, Acharya S, Manuja N.
In-Text Gene Mentions

…and antithrombin III (ATIII) can be useful…

Show Full Abstract

Endothelial cell injury, intravascular platelet-fibrin thrombi, and vascular damage are found in hemolytic uremic syndrome (HUS) and thrombotic thrombocytopenic purpura (TTP). The two disorders frequently manifest independently and are the important causes of acute renal damage. Acute kidney injury developed in our patient after blood transfusion and later on, the patient developed neurological complications. The patient was managed symptomatically and conservatively. Plasmapheresis and corticosteroid administration showed improved results.

Also flagged:degradationubiquitinproteasomeautophagylysosomeautophagy-
Journal Article 2022-10-11 No Snippets Zhang Y, Liu X, Klionsky DJ, Lu B, Zhong Q.
Show Full Abstract

Targeted degradation, having emerged as a powerful and promising strategy in drug discovery in the past two decades, has provided a solution for many once undruggable targets involved in various diseases. While earlier targeted degradation tools, as exemplified by PROteolysis-TArgeting Chimera (PROTAC), focused on harnessing the ubiquitin-proteasome system, novel approaches that aim to utilize autophagy, a potent, lysosome-dependent degradation pathway, have also surfaced recently as promising modalities. In this review, we first introduce the mechanisms that establish selectivity in autophagy, which provides the rationales for autophagy-based targeted degradation; we also provide an overview on the panoply of cellular machinery involved in this process, an arsenal that could be potentially harnessed. On this basis, we propose four strategies for designing autophagy-based targeted degraders, including Tagging Targets, Directly Engaging Targets, Initiating Autophagy at Targets, and Phagophore-Tethering to Targets. We introduce the current frontiers in this field, including AUtophagy-TArgeting Chimera (AUTAC), Targeted Protein Autophagy (TPA), AUTOphagy-TArgeting Chimera (AUTOTAC, not to be confused with AUTAC), AuTophagosome TEthering Compound (ATTEC), and other experimental approaches as case studies for each strategy. Finally, we put forward a workflow for generating autophagy-based degraders and some important questions that may guide and inspire the process.

bioRxiv 2022-10-11 Preprint (No Snippets API) Elcocks H, Brazel AJ, McCarron KR, Kaulich M, Husnjak K, Mortiboys H, Clague MJ, Urbé S.
Show Full Abstract

The selective autophagy of mitochondria is linked to mitochondrial quality control and is critical to a healthy organism. We have conducted a CRISPR/Cas9 screen of human E3 ubiquitin ligases for influence on mitophagy under both basal cell culture conditions and following acute mitochondrial depolarisation. We identify two Cullin RING ligases, VHL and FBXL4 as the most profound negative regulators of basal mitophagy. We show that these converge through control of the mitophagy adaptors BNIP3 and BNIP3L/NIX through different mechanisms. FBXL4 suppression of BNIP3 and NIX levels is mediated via direct interaction and protein destabilisation rather than suppression of HIF1α-mediated transcription. Depletion of NIX but not BNIP3 is sufficient to restore mitophagy levels. Our study enables a full understanding of the aetiology of early onset mitochondrial encephalomyopathy that is supported by analysis of a disease associated mutation. We further show that the compound MLN4924, which globally interferes with Cullin RING ligase activity, is a strong inducer of mitophagy providing a research tool in this context and a candidate therapeutic agent for conditions linked to mitochondrial dysfunction.

Research Square 2022-10-11 Preprint (No Snippets API) Bouassida M, Egloff M, Levy J, Chatron N, Bernardini L, Guyader GL, Tabet A, Schluth-Bolard C, Brancati F, Giuffrida M, Dard R, Clorennec J, Coursimault J, Vialard F, Herve B.
Show Full Abstract

<title>Abstract</title> <p>Microduplications involving the <italic>MYT1L</italic> gene have mostly been described in series of patients with isolated schizophrenia. However, few reports have been published, and the phenotype has still not been well characterized. We sought to further characterize the phenotypic spectrum of this condition by describing the clinical features of patients with a pure 2p25.3 microduplication that included all or part of <italic>MYT1L</italic>. Through a French national collaboration and a literature review, we assessed a large cohort of patients (n = 43) with pure 2p25.3 microduplications identified by chromosomal microarray analysis. For each case, we recorded clinical data, the microduplication size, and the inheritance pattern. The clinical features were variable and included developmental and speech delays (33%), autism spectrum disorder (23%), mild-to-moderate intellectual disability (21%), schizophrenia (21%), or behavioral disorders (16%). Eleven patients did not have an obvious neuropsychiatric disorder. The microduplications ranged from 62.4 kb to 3.8 Mb in size and led to either duplication of all or part of <italic>MYT1L</italic>. There were seven cases of intragenic duplication. The inheritance pattern was available for 18 patients: the microduplication was inherited in 13 cases, and all but one of the parents had a normal phenotype. Our comprehensive review and expansion of the phenotypic spectrum associated with 2p25.3 microduplications involving <italic>MYT1L</italic> (previously linked to schizophrenia) should help clinicians to better assess, counsel and manage affected individuals. <italic>MYT1L</italic> microduplications are characterized by a spectrum of neuropsychiatric phenotypes with incomplete penetrance and variable expressivity, which are probably due to as-yet unknown genetic and nongenetic modifiers.</p>

Also flagged:VRK1cancerCas9cancersgliomasneuroblastomas
Journal Article 2022-10-10 ✓ 5 Snippets So J, Mabe NW, Englinger B, Chow KH, Moyer SM, Yerrum S, Trissal MC, Marques JG, Kwon JJ, Shim B, Pal S, Panditharatna E, Quinn T, Schaefer DA, Jeong D, Mayhew DL, Hwang J, Beroukhim R, Ligon KL, Stegmaier K, Filbin MG, Hahn WC.
In-Text Gene Mentions

In VRK2hi tumors where the VRK2 promoter is unmethylated, both VRK1 and VRK2 may phosphorylate BAF during mitosis to mediate nuclear envelope disassembly.

By comprehensively integrating genome-scale, loss-of-function genetic screens with RNA sequencing and analysis of DNA methylation patterns, we identified the nuclear serine/threonine kinase vaccinia-related kinase 1 (VRK1) as a highly selective dependency in adult and pediatric CNS and PNS tumors that exhibit low expression of the VRK1 paralog VRK2.

To verify the synthetic lethal relationship between VRK1 and VRK2 experimentally, we focused on a panel of 4 GBM cell lines with heterogeneous expression of VRK2 (Supplemental Figure 6, A and B).

We conclude that VRK2 promoter methylation is observable among cancer subtypes and is a predictor for VRK2 expression and thus a VRK1 dependency.

To create an isogenic experimental model, we deleted VRK2 in the VRK2hi SF172 GBM cell line and then introduced either a control or VRK1 sgRNA.

Show Full Abstract

Collateral lethality occurs when loss of a gene/protein renders cancer cells dependent on its remaining paralog. Combining genome-scale CRISPR/Cas9 loss-of-function screens with RNA sequencing in over 900 cancer cell lines, we found that cancers of nervous system lineage, including adult and pediatric gliomas and neuroblastomas, required the nuclear kinase vaccinia-related kinase 1 (VRK1) for their survival in vivo. VRK1 dependency was inversely correlated with expression of its paralog VRK2. VRK2 knockout sensitized cells to VRK1 loss, and conversely, VRK2 overexpression increased cell fitness in the setting of VRK1 loss. DNA methylation of the VRK2 promoter was associated with low VRK2 expression in human neuroblastomas and adult and pediatric gliomas. Mechanistically, depletion of VRK1 reduced barrier-to-autointegration factor phosphorylation during mitosis, resulting in DNA damage and apoptosis. Together, these studies identify VRK1 as a synthetic lethal target in VRK2 promoter-methylated adult and pediatric gliomas and neuroblastomas.

Also flagged:Cas9nonsense-mediated decayHDCRISPRendonucleasechromosome
Journal Article 2022-10-10 ✓ 5 Snippets Shin JW, Hong EP, Park SS, Choi DE, Seong IS, Whittaker MN, Kleinstiver BP, Chen RZ, Lee JM.
In-Text Gene Mentions

As a complementary approach, this study tested the concept of allele-specific CRISPR/Cas9 targeting an exonic PAM site present only on the mutant HTT in a given HD subject to induce NMD of the mutant HTT mRNA.

However, 1 copy of Htt (i.e., heterozygous KO) is sufficient to support the survival of mice (7, 9), and individuals with 1 functional copy of HTT do not present HD symptoms or developmental problems (51–53).

Given that HD is caused by a dominant gain-of-function mutation (1, 54), these observations suggest that selective inactivation of the mutant HTT gene may produce significant clinical benefits without side effects.

Huntington’s disease (HD) is caused by an expanded CAG trinucleotide repeat in the first exon of the huntingtin gene (HTT) (1).

Therefore, developing new HD mouse models carrying only 1 copy of mutant Htt with relevant human genetic variations will be critical in precisely determining editing efficiencies and functional consequences of mutant-specific NMD-CRISPR/Cas9 strategies.

Show Full Abstract

Dominant gain-of-function mechanisms in Huntington's disease (HD) suggest that selective silencing of mutant HTT produces robust therapeutic benefits. Here, capitalizing on exonic protospacer adjacent motif-altering (PAM-altering) SNP (PAS), we developed an allele-specific CRISPR/Cas9 strategy to permanently inactivate mutant HTT through nonsense-mediated decay (NMD). Comprehensive sequence/haplotype analysis identified SNP-generated NGG PAM sites on exons of common HTT haplotypes in HD subjects, revealing a clinically relevant PAS-based mutant-specific CRISPR/Cas9 strategy. Alternative allele of rs363099 (29th exon) eliminates the NGG PAM site on the most frequent normal HTT haplotype in HD, permitting mutant-specific CRISPR/Cas9 therapeutics in a predicted ~20% of HD subjects with European ancestry. Our rs363099-based CRISPR/Cas9 showed perfect allele specificity and good targeting efficiencies in patient-derived cells. Dramatically reduced mutant HTT mRNA and complete loss of mutant protein suggest that our allele-specific CRISPR/Cas9 strategy inactivates mutant HTT through NMD. In addition, GUIDE-Seq analysis and subsequent validation experiments support high levels of on-target gene specificity. Our data demonstrate a significant target population, complete mutant specificity, decent targeting efficiency in patient-derived cells, and minimal off-target effects on protein-coding genes, proving the concept of PAS-based allele-specific NMD-CRISPR/Cas9 and supporting its therapeutic potential in HD.

Also flagged:fenofibrateprimary biliary cholangitisursodeoxycholic acidcirrhosisalkaline phosphataseALP
Journal Article 2022-10-10 ✓ 1 Snippet Ding D, Guo G, Liu Y, Zheng L, Jia G, Deng J, Sun R, Wang X, Guo C, Shang Y, Han Y.
In-Text Gene Mentions

…injury, viral hepatitis,hemochromatosis, hepatocellular carcinoma) we…

Show Full Abstract

Fenofibrate (FF) has shown potential benefits in patients with primary biliary cholangitis (PBC) who have an incomplete response to ursodeoxycholic acid (UDCA). However, the efficacy and safety of FF in patients with cirrhosis remain unclear. To evaluate the efficacy and safety of additional FF therapy in patients with PBC-related cirrhosis with an incomplete response to UDCA, we conducted a retrospective analysis comparing the clinical results of additional FF therapy and continued UDCA monotherapy. A total of 59 patients were included; 27 cases underwent UDCA monotherapy and 32 cases underwent UDCA combined with FF therapy. A significant difference in alkaline phosphatase (ALP) normalization was achieved in the FF group compared to the UDCA group (37% vs. 11%, respectively; p = 0.020). Additional FF therapy was an independent risk factor for ALP normalization (hazard ratio, 7.679; 95% confidence interval, 2.059-28.633; p = 0.003). Hepatic deterioration was experienced by 40% versus 48% (p = 0.562) while 11% vs. 37% (p = 0.111) experienced liver-related mortality or liver transplantation in the FF and UDCA groups, respectively. Compared to UDCA monotherapy, additional FF therapy was associated with lower United Kingdom (UK)-PBC risk score and surrogate serum indices of liver fibrosis. After 12 months of add-on FF therapy, median ALP level and UK-PBC risk score decreased 35% and 52% from baseline (p = 0.001 and 0.210, respectively). Serum aminotransferase, triglyceride, and cholesterol decreased progressively, while total bilirubin, serum creatinine, blood urea, estimated glomerular filtration rate, aspartate aminotransferase-to-platelet ratio index, and fibrosis-4 index remained stable in FF-treated cirrhotic cases during follow-up. No significant adverse effects associated with additional FF therapy were observed in our cohort. Conclusion: Additional FF therapy was associated with higher ALP normalization rates and lower UK-PBC risk scores in patients with cirrhotic PBC with an incomplete response to UDCA. In addition, FF therapy seemed safe and well tolerated with a low frequency of adverse effects in patients with cirrhosis.

Also flagged:endoplasmic reticulumAntithrombinserine proteaseantithrombin deficiencyprotein secretionsecretion
Journal Article 2022-10-10 ✓ 5 Snippets Bravo-Pérez C, Toderici M, Chambers JE, Martínez-Menárguez JA, Garrido-Rodriguez P, Pérez-Sanchez H, de la Morena-Barrio B, Padilla J, Miñano A, Cifuentes-Riquelme R, Vicente V, Lozano ML, Marciniak SJ, de la Morena-Barrio ME, Corral J.
In-Text Gene Mentions

…encoded by theSERPINC1gene (1q23-q25.1; 13.5…

…pathogenic variants inSERPINC1have been described…

…case reports ofSERPINC1mutations involving AT…

…heterozygous mutation inSERPINC1(40–60%).…

…Gene variants inSERPINC1were determined by…

Show Full Abstract

Antithrombin, a major endogenous anticoagulant, is a serine protease inhibitor (serpin). We characterized the biological and clinical impact of variants involving C-terminal antithrombin. We performed comprehensive molecular, cellular, and clinical characterization of patients with C-terminal antithrombin variants from a cohort of 444 unrelated individuals with confirmed antithrombin deficiency. We identified 17 patients carrying 12 C-terminal variants, 5 of whom had the p.Arg445Serfs*17 deletion. Five missense variants caused qualitative deficiency, and 7, including 4 insertion-deletion variants, induced severe quantitative deficiency, particularly p.Arg445Serfs*17 (antithrombin <40%). This +1 frameshift variant had a molecular size similar to that of WT antithrombin but possessed a different C-terminus. Morphologic and cotransfection experiments showed that recombinant p.Arg445Serfs*17 was retained at the endoplasmic reticulum and had a dominant-negative effect on WT antithrombin. Characterization of different 1+ frameshift, aberrant C-terminal variants revealed that protein secretion was determined by frameshift site. The introduction of Pro441 in the aberrant C-terminus, shared by 5 efficiently secreted variants, partially rescued p.Arg445Serfs*17 secretion. C-terminal antithrombin mutants have notable heterogeneity, related to variant type and localization. Aberrant C-terminal variants caused by 1+ frameshift, with similar size as WT antithrombin, may be secreted or not, depending on frameshift site. The severe clinical phenotypes of these genetic changes are consistent with their dominant-negative effects.

Also flagged:IronalcoholAlcohol-associated liver diseasechronic liver diseaseshepatic steatosissteatohepatitis
Journal Article 2022-10-10 ✓ 2 Snippets Ferrao K, Ali N, Mehta KJ.
In-Text Gene Mentions

While hemochromatosis can occur due to mutations in the non-HFE genes, a common cause is the inheritance of C282Y mutation in the HFE gene.

…alcohol consumption byhemochromatosis(iron overload) patients…

Show Full Abstract

Alcohol-associated liver disease (ALD) is one of the most common chronic liver diseases. Its pathological spectrum includes the overlapping stages of hepatic steatosis/steatohepatitis that can progress to liver fibrosis and cirrhosis; both are risk factors for hepatocellular carcinoma. Moreover, ALD diagnosis and management pose several challenges. The early pathological stages are reversible by alcohol abstinence, but these early stages are often asymptomatic, and currently, there is no specific laboratory biomarker or diagnostic test that can confirm ALD etiology. Alcohol consumers frequently show dysregulation of iron and iron-related proteins. Examination of iron-related parameters in this group may aid in early disease diagnosis and better prognosis and management. For this, a coherent overview of the status of iron and iron-related proteins in alcohol consumers is essential. Therefore, here, we collated and reviewed the alcohol-induced alterations in iron and iron-related proteins. Reported observations include unaltered, increased, or decreased levels of hemoglobin and serum iron, increments in intestinal iron absorption (facilitated via upregulations of duodenal divalent metal transporter-1 and ferroportin), serum ferritin and carbohydrate-deficient transferrin, decrements in serum hepcidin, decreased or unaltered levels of transferrin, increased or unaltered levels of transferrin saturation, and unaltered levels of soluble transferrin receptor. Laboratory values of iron and iron-related proteins in alcohol consumers are provided for reference. The causes and mechanisms underlying these alcohol-induced alterations in iron parameters and anemia in ALD are explained. Notably, alcohol consumption by hemochromatosis (iron overload) patients worsens disease severity due to the synergistic effects of excess iron and alcohol.

Also flagged:Interleukin-6IL-6Hepatocellular carcinomabindingliver cancerpathogenesis
Journal Article 2022-10-10 ✓ 1 Snippet Badshah Y, Shabbir M, Khan K, Fatima M, Majoka I, Aslam L, Munawar H.
In-Text Gene Mentions

…disease, type 2-diabetes,hemochromatosis, obesity, and previously…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most common liver malignancy. Early diagnosis of HCC has always been challenging. This study aims to assess the pathogenicity and the prevalence of IL-6 -174G/C (rs1800795) and TGFβ-1 +29C/T (rs1800470) polymorphisms in HCV-infected HCC patients. Experimental strategies are integrated with computational approaches to analyse the pathogenicity of the TGFβ-1 +29C/T and IL-6-174 G/C polymorphisms in HCV-induced HCC. AliBaba2 was used to predict the effect of IL-6-174 G/C on transcription factor binding site in IL-6 gene. Structural changes in the mutant TGFβ-1 structure were determined through project HOPE. To assess the polymorphic prevalence of IL-6 -174G/C and TGFβ-1 +29C/T genotypes in HCC and control subjects, amplification refractory mutation system PCR (ARMS-PCR) was performed on 213 HCC and 216 control samples. GraphPad Prism version 8.0 was used for the statistical analysis of the results. In-silico analysis revealed the regulatory nature of both IL-6 -174G/C and TGFβ-1 +29C/T polymorphisms. ARMS-PCR results revealed that the individuals carrying TT genotype for TGFβ-1 gene have an increased risk of developing HCC (p<0.0001, OR = 5.403, RR = 2.062) as compared to individuals with CT and CC genotype. Similarly, GC genotype carriers for IL-6 gene exhibit an increased risk of HCC susceptibility (p<0.0001, OR = 2.276, RR = 1.512) as compared to the people carrying the GG genotype. Genotype TT of TGFβ-1 gene and genotype GC of IL-6 gene are found to be associated with HCV-induced HCC. IL-6 polymorphism may alter its transcription that leads to its pathogenicity. TGFβ-1 polymorphism may alter protein structure stability.

Also flagged:Chagas Cardiomyopathychromosomeparasitic infectionheart failurechromatingene expression
Journal Article 2022-10-10 No Snippets Sabino EC, Franco LAM, Venturini G, Velho Rodrigues M, Marques E, Oliveira-da Silva LC, Martins LNA, Ferreira AM, Almeida PEC, Silva FDD, Leite SF, Nunes MDCP, Haikal DS, Oliveira CDL, Cardoso CS, Seidman JG, Seidman CE, Casas JP, Ribeiro ALP, Krieger JE, Pereira AC.
Show Full Abstract

<h4>Background</h4>Chronic Chagas Cardiomyopathy (CCC) usually develops between 10 and 20 years after the first parasitic infection and is one of the leading causes of end-stage heart failure in Latin America. Despite the great inter-individual variability in CCC susceptibility (only 30% of infected individuals ever present CCC), there are no known predictors for disease development in those chronically infected.<h4>Methodology/principal findings</h4>We describe a new susceptibility locus for CCC through a GWAS analysis in the SaMi-Trop cohort, a population-based study conducted in a Chagas endemic region from Brazil. This locus was also associated with CCC in the REDS II Study. The newly identified locus (rs34238187, OR 0.73, p-value 2.03 x 10-9) spans a haplotype of approximately 30Kb on chromosome 18 (chr18: 5028302-5057621) and is also associated with 80 different traits, most of them blood protein traits significantly enriched for immune-related biological pathways. Hi-C data show that the newly associated locus is able to interact with chromatin sites as far as 10Mb on chromosome 18 in a number of different cell types and tissues. Finally, we were able to confirm, at the tissue transcriptional level, the immune-associated blood protein signature using a multi-tissue differential gene expression and enrichment analysis.<h4>Conclusions/significance</h4>We suggest that the newly identified locus impacts CCC risk among T cruzi infected individuals through the modulation of a downstream transcriptional and protein signature associated with host-parasite immune response. Functional characterization of the novel risk locus is warranted.

Also flagged:fertilizationchromatinacetylationCBPp300HDAC
Journal Article 2022-10-10 No Snippets Wang M, Chen Z, Zhang Y.
Show Full Abstract

Epigenome reprogramming after fertilization enables transcriptionally quiescent maternal and paternal chromatin to acquire a permissive state for subsequent zygotic genome activation (ZGA). H3K27 acetylation (H3K27ac) is a well-established chromatin marker of active enhancers and promoters. However, reprogramming dynamics of H3K27ac during maternal-to-zygotic transition (MZT) in mammalian embryos are not well-studied. By profiling the allelic landscape of H3K27ac during mouse MZT, we show that H3K27ac undergoes three waves of rapid global transitions between oocyte stage and 2-cell stage. Notably, germinal vesicle oocyte and zygote chromatin are globally hyperacetylated, with noncanonical, broad H3K27ac domains that correlate with broad H3K4 trimethylation (H3K4me3) and open chromatin. H3K27ac marks genomic regions primed for activation including ZGA genes, retrotransposons, and active alleles of imprinted genes. We show that CBP/p300 and HDAC activities play important roles in regulating H3K27ac dynamics and are essential for preimplantation development. Specifically, CBP/p300 acetyltransferase broadly deposits H3K27ac in zygotes to induce the opening of condensed chromatin at putative enhancers and ensure proper ZGA. On the contrary, HDACs revert broad H3K27ac domains to canonical domains and safeguard ZGA by preventing premature expression of developmental genes. In conclusion, coordinated activities of CBP/p300 and HDACs during mouse MZT are essential for ZGA and preimplantation development.

Also flagged:E3 ubiquitin ligaseARIH1antiviral immunitycGAScyclic GMP-AMP synthasepost-translational modifications
Journal Article 2022-10-10 ✓ 1 Snippet Xiong TC, Wei MC, Li FX, Shi M, Gan H, Tang Z, Dong HP, Liuyu T, Gao P, Zhong B, Zhang ZD, Lin D.
In-Text Gene Mentions

…E3 ubiquitin ligaseTRIM38targets cGAS for…

Show Full Abstract

The cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS) plays a critical role in antiviral immunity and autoimmunity. The activity and stability of cGAS are fine-tuned by post-translational modifications. Here, we show that ariadne RBR E3 ubiquitin protein ligase 1 (ARIH1) catalyzes the mono-ISGylation and induces the oligomerization of cGAS, thereby promoting antiviral immunity and autoimmunity. Knockdown or knockout of ARIH1 significantly inhibits herpes simplex virus 1 (HSV-1)- or cytoplasmic DNA-induced expression of type I interferons (IFNs) and proinflammatory cytokines. Consistently, tamoxifen-treated ER-Cre;Arih1<sup>fl/fl</sup> mice and Lyz2-Cre; Arih1<sup>fl/fl</sup> mice are hypersensitive to HSV-1 infection compared with the controls. In addition, deletion of ARIH1 in myeloid cells alleviates the autoimmune phenotypes and completely rescues the autoimmune lethality caused by TREX1 deficiency. Mechanistically, HSV-1- or cytosolic DNA-induced oligomerization and activation of cGAS are potentiated by ISGylation at its K187 residue, which is catalyzed by ARIH1. Our findings thus reveal an important role of ARIH1 in innate antiviral and autoimmune responses and provide insight into the post-translational regulation of cGAS.

Also flagged:hepatocellular carcinomatumourmetabolismGene Expressiondeathtryptophan
Journal Article 2022-10-10 ✓ 2 Snippets Xue C, Gu X, Zhao Y, Jia J, Zheng Q, Su Y, Bao Z, Lu J, Li L.
In-Text Gene Mentions

…, TNFSF18 ,TNFSF4, TNFSF9 ,…

…TNFRSF14, NRP1, LAIR1,TNFSF4, CD276, CD80, CD44…

Show Full Abstract

<h4>Background</h4>L-tryptophan (Trp) metabolism involved in mediating tumour development and immune suppression. However, comprehensive analysis of the role of the Trp metabolism pathway is still a challenge.<h4>Methods</h4>We downloaded Trp metabolism-related genes' expression data from different public databases, including TCGA, Gene Expression Omnibus (GEO) and Hepatocellular Carcinoma Database (HCCDB). And we identified two metabolic phenotypes using the ConsensusClusterPlus package. Univariate regression analysis and lasso Cox regression analysis were used to establish a risk model. CIBERSORT and Tracking of Indels by DEcomposition (TIDE) analyses were adopted to assess the infiltration abundance of immune cells and tumour immune escape.<h4>Results</h4>We identified two metabolic phenotypes, and patients in Cluster 2 (C2) had a better prognosis than those in Cluster 1 (C1). The distribution of clinical features between the metabolic phenotypes showed that patients in C1 tended to have higher T stage, stage, grade, and death probability than those of patients in C2. Additionally, we screened 739 differentially expressed genes (DEGs) between the C1 and C2. We generated a ten-gene risk model based on the DEGs, and the area under the curve (AUC) values of the risk model for predicting overall survival. Patients in the low-risk subgroup tended to have a significantly longer overall survival than that of those in the high-risk group. Moreover, univariate analysis indicated that the risk model was significantly correlated with overall survival. Multivariate analysis showed that the risk model remained an independent risk factor in hepatocellular carcinoma (p < 0.0001).<h4>Conclusions</h4>We identified two metabolic phenotypes based on genes of the Trp metabolism pathway, and we established a risk model that could be used for predicting prognosis and guiding immunotherapy in patients with hepatocellular carcinoma.

Also flagged:ExtracellularNeuroblastomaNBneuroendocrine neoplasmextracranial tumortumor
Journal Article 2022-10-10 ✓ 5 Snippets Horwacik I.
In-Text Gene Mentions

As examples of DRs relevant to the topic of this review, DCC netrin 1 receptor (DCC, previously named deleted in colorectal carcinoma) and its homologue neogenin (NEO1) are discussed.

…MET, RET, ALK,DCC, NEO1, IR, IGF1R,…

…of this review,DCCnetrin 1 receptor…

…netrin 1 receptor (DCC, previously named deleted…

DCCwas shown to…

Show Full Abstract

Neuroblastoma (NB) is a pediatric neuroendocrine neoplasm. It arises from the sympatho-adrenal lineage of neural-crest-derived multipotent progenitor cells that fail to differentiate. NB is the most common extracranial tumor in children, and it manifests undisputed heterogeneity. Unsatisfactory outcomes of high-risk (HR) NB patients call for more research to further inter-relate treatment and molecular features of the disease. In this regard, it is well established that in the tumor microenvironment (TME), malignant cells are engaged in complex and dynamic interactions with the extracellular matrix (ECM) and stromal cells. The ECM can be a source of both pro- and anti-tumorigenic factors to regulate tumor cell fate, such as survival, proliferation, and resistance to therapy. Moreover, the ECM composition, organization, and resulting signaling networks are vastly remodeled during tumor progression and metastasis. This review mainly focuses on the molecular mechanisms and effects of interactions of selected ECM components with their receptors on neuroblastoma cells. Additionally, it describes roles of enzymes modifying and degrading ECM in NB. Finally, the article gives examples on how the knowledge is exploited for prognosis and to yield new treatment options for NB patients.

Also flagged:CardiomyopathyDesmincardiomyopathiesapparatusmitochondriametabolism
Journal Article 2022-10-10 ✓ 1 Snippet Elsnicova B, Hornikova D, Tibenska V, Kolar D, Tlapakova T, Schmid B, Mallek M, Eggers B, Schlötzer-Schrehardt U, Peeva V, Berwanger C, Eberhard B, Durmuş H, Schultheis D, Holtzhausen C, Schork K, Marcus K, Jordan J, Lücke T, van der Ven PFM, Schröder R, Clemen CS, Zurmanova JM.
In-Text Gene Mentions

…Ech1, Echs1, Eci1,Eci2, Hadh, Hadha, Hadhb,…

Show Full Abstract

Desmin mutations cause familial and sporadic cardiomyopathies. In addition to perturbing the contractile apparatus, both desmin deficiency and mutated desmin negatively impact mitochondria. Impaired myocardial metabolism secondary to mitochondrial defects could conceivably exacerbate cardiac contractile dysfunction. We performed metabolic myocardial phenotyping in left ventricular cardiac muscle tissue in desmin knock-out mice. Our analyses revealed decreased mitochondrial number, ultrastructural mitochondrial defects, and impaired mitochondria-related metabolic pathways including fatty acid transport, activation, and catabolism. Glucose transporter 1 and hexokinase-1 expression and hexokinase activity were increased. While mitochondrial creatine kinase expression was reduced, fetal creatine kinase expression was increased. Proteomic analysis revealed reduced expression of proteins involved in electron transport mainly of complexes I and II, oxidative phosphorylation, citrate cycle, beta-oxidation including auxiliary pathways, amino acid catabolism, and redox reactions and oxidative stress. Thus, desmin deficiency elicits a secondary cardiac mitochondriopathy with severely impaired oxidative phosphorylation and fatty and amino acid metabolism. Increased glucose utilization and fetal creatine kinase upregulation likely portray attempts to maintain myocardial energy supply. It may be prudent to avoid medications worsening mitochondrial function and other metabolic stressors. Therapeutic interventions for mitochondriopathies might also improve the metabolic condition in desmin deficient hearts.

Also flagged:MyocarditisCOVID-19macrocytic anemiaacute myeloid leukemiaChronic Myocarditisprednisone
Journal Article 2022-10-10 No Snippets Dobronyi I, Porter D, Roifman I, Orbach A, Strauss BH.
Show Full Abstract

A 25-year-old man presented with chest pain and an elevated troponin level following COVID-19 vaccination. Despite initial response to nonsteroidal anti-inflammatory drugs, he developed a recurrent and relapsing course requiring multiple readmissions. Cardiac magnetic resonance imaging confirmed myocarditis. Due to progressing macrocytic anemia, he was eventually diagnosed with acute myeloid leukemia, thought to be the underlying driver of his recurrent and persistent myocarditis.

Also flagged:Ischemic StrokeIS-glycanbiosynthesisstroke
Journal Article 2022-10-10 No Snippets Jiang S, Wu J, Geng Y, Zhang Y, Wang Y, Wu J, Lu C, Luo G, Zan J, Zhang Y.
Show Full Abstract

Ischemic stroke (IS) is one of the leading causes of disability and mortality worldwide. This study aims to find the crucial exosomal miRNAs associated with IS by using bioinformatics methods, reveal potential biomarkers for IS, and investigate the association between the identified biomarker and immune cell pattern in the peripheral blood of IS patients. In this study, 3 up-regulated miRNAs (hsa-miR-15b-5p, hsa-miR-184, and hsa-miR-16-5p) miRNAs in the serum exosomes between IS patients and healthy controls from GEO database (GSE199942) and 25 down-regulated genes of peripheral blood mononuclear cells of IS patients from GSE22255 were obtained with the help of the R software. GO annotation and KEGG pathway enrichment analysis showed that the 25 down-regulated genes were associated with coenzyme metabolic process and were mainly enriched in the N-glycan biosynthesis pathway. Furthermore, we performed the LASSO algorithm to narrow down the above 25 intersected genes, and identified 8 key genes which had a good diagnostic value in discriminating IS patients from the healthy controls analyzed with ROC curve. CIBERSORT algorithm indicated that the abundance of M0 macrophages and resting mast cells was significantly lower than that of the control group. The spearman correlation analysis showed that STT3A was negatively correlated with the proportion of follicular helper T cells, activated NK cells and resting dendritic cells. Finally, GSE117064 showed that has-miR-16-5p was more advantageous for diagnosing stroke. In conclusion, hsa-miR-15b-5p, hsa-miR-184, and hsa-miR-16-5p are identified as specific related exosomal miRNAs for IS patients. These genes may provide new targets for the early identification of IS.

Also flagged:TP53uterine corpus endometrial carcinomaUCECtumorcisplatinpaclitaxel
Journal Article 2022-10-10 No Snippets Wang Y, Qu X, Li L, He D.
Show Full Abstract

<h4>Background</h4>TP53 mutation is a common mutation gene in uterine corpus endometrial carcinoma (UCEC), and the TP53 signaling pathway plays an essential role in the tumorigenesis, progression, and immune infiltration in UCEC. We aimed to discover TP53 pathway-related lncRNAs in UCEC. <i>Materials and methods</i>. 528 UCEC patients with 587 transcriptional profiles were enrolled in this study. We first investigated the differential status of TP53 signaling pathway between tumor and normal tissues by GSEA analysis, then identified TP53 pathway-related lncRNAs, accordingly establishing a nine TP53 pathway related to the lncRNA signature in the training set and verified this signature in the test set. Besides, the interaction network was constructed; the immune infiltration, drug response to cisplatin and paclitaxel, and mutation atlas were investigated. Finally, we performed a subgroup analysis to check the universality of this signature.<h4>Results</h4>A nine TP53 pathway-related lncRNA prognostic signature was constructed and verified superior accuracy in predicting the overall survival of UCEC patients. Besides, high-risk patients showed a poor prognosis, but they were more sensitive to the cisplatin and paclitaxel. Notably, M2 macrophages were higher infiltrated in high-risk patients, and TP53 showed a significantly higher mutation in high-risk patients than low-risk patients.<h4>Conclusions</h4>We constructed and verified a nine TP53 pathway-related lncRNA prognostic signature in UCEC, which also contributes to the decision-making of the chemotherapy.

Also flagged:GXYLT2NotchtumorsBLCAbladder cancertumor
Journal Article 2022-10-10 ✓ 1 Snippet Wu S, Qiu S, Chen W, Ding L, Wu L.
In-Text Gene Mentions

…IL6, IL2RA, TNFRSF9,TNFSF4, TNFSF13B, and TNFRSF8)…

Show Full Abstract

<h4>Background</h4>GXYLT2 (glucoside xylosyltransferase 2) was known as an important gene that regulates classical Notch signaling and is involved in progression in human tumors. However, the correlation between GXYLT2 expression and bladder cancer remains unclear.<h4>Methods</h4>GXYLT2 expression was analyzed by ONCOMINE database, GEPIA database, and TIMER database. The Cancer Genome Atlas (TCGA) was utilized to confirm relationships between GXYLT2 and molecular subtypes of BLCA (bladder cancer). We discovered prognostic value of GXYLT2 in BLCA using GEPIA, LinkedOmics database, and Kaplan-Meier Plotter database. Subsequently, correlations between GXYLT2 and tumor immune infiltration were investigated through TIMER and TISIDB website. We then downloaded data of patients with BLCA from TCGA website, to conduct functional annotations and to construct protein-protein interaction network through STRING and Enrich web servers.<h4>Results</h4>Significant differences were observed between GXYLT2 expression of bladder cancer and normal tissues. GXYLT2 was a poor prognostic biomarker in BLCA with impact on diverse clinical characteristics. We found that GXYLT2 was closely related to tumor immune infiltrated cells and immune genes. Functional annotations indicated that GXYLT2 was linked to immune-related pathways.<h4>Conclusions</h4>The results suggested that GXYLT2 was associated with a poor prognosis and tumor immune cell infiltration of BLCA. GXYLT2 could be a promising therapeutic target in bladder cancer.

Also flagged:Hepatocellular carcinomaliver cancerstumorcirrhosisreverse transcriptionepithelial cell adhesion molecule
Journal Article 2022-10-10 ✓ 1 Snippet Armakolas A, Dimopoulou V, Nezos A, Stamatakis G, Samiotaki M, Panayotou G, Tampaki M, Stathaki M, Dourakis S, Koskinas J.
In-Text Gene Mentions

…PROS1, SAA4, SERPINA4,SERPINC1, SERPIND1, SPG11, TTR…

Show Full Abstract

Hepatocellular carcinoma (HCC) accounts for the majority of primary liver cancers. Early detection/diagnosis is vital for the prognosis of HCC, whereas diagnosis at late stages is associated with very low survival rate. Early diagnosis is based on 6-month surveillance of the patient and the use of at least two imaging modalities. The aim of this study was to investigate diagnostic markers for the detection of early HCC based on proteome analysis, microRNAs (miRNAs) and circulating tumor cells (CTCs) in the blood of patients with cirrhosis or early or advanced HCC. We studied 89 patients with HCC, of whom 33 had early HCC and 28 were cirrhotic. CTCs were detected by real-time quantitative reverse transcription PCR and immunofluorescence using the markers epithelial cell adhesion molecule (EPCAM), vimentin, alpha fetoprotein (aFP) and surface major vault protein (sMVP). Expression of the five most common HCC-involved miRNAs (miR-122, miR-200a, miR-200b, miR-221, miR-222) was examined in serum using quantitative real time PCR (qRT-PCR). Finally, patient serum was analyzed via whole proteome analysis (LC/MS). Of 53 patients with advanced HCC, 27 (51%) had detectable CTCs. Among these, 10/27 (37%) presented evidence of mesenchymal or intermediate stage cells (vimentin and/or sMVP positive). Moreover, 5/17 (29%) patients with early HCC and 2/28 (7%) cirrhotic patients had detectable CTCs. Patients with early or advanced HCC exhibited a significant increase in miR-200b when compared to cirrhotic patients. Our proteome analysis indicated that early HCC patients present a significant upregulation of APOA2, APOC3 proteins when compared to cirrhotic patients. When taken in combination, this covers the 100% of the patients with early HCC. miR-200b, APOA2 and APOC3 proteins are sensitive markers and can be potentially useful in combination for the early diagnosis of HCC.

Also flagged:Alcohol-Related Liver Diseasefatty liver diseasessteatohepatitiscirrhosisalcoholliver disease
Journal Article 2022-10-10 No Snippets Ha Y, Jeong I, Kim TH.
Show Full Abstract

Alcohol-related liver disease (ALD) refers to a spectrum of liver manifestations ranging from fatty liver diseases, steatohepatitis, and fibrosis/cirrhosis with chronic inflammation primarily due to excessive alcohol use. Currently, ALD is considered as one of the most prevalent causes of liver disease-associated mortality worldwide. Although the pathogenesis of ALD has been intensively investigated, the present understanding of its biomarkers in the context of early clinical diagnosis is not complete, and novel therapeutic targets that can significantly alleviate advanced forms of ALD are limited. While alcohol abstinence remains the primary therapeutic intervention for managing ALD, there are currently no approved medications for treating ALD. Furthermore, given the similarities and the differences between ALD and non-alcoholic fatty liver disease in terms of disease progression and underlying molecular mechanisms, numerous studies have demonstrated that many therapeutic interventions targeting several signaling pathways, including oxidative stress, inflammatory response, hormonal regulation, and hepatocyte death play a significant role in ALD treatment. Therefore, in this review, we summarized several key molecular targets and their modes of action in ALD progression. We also described the updated therapeutic options for ALD management with a particular emphasis on potentially novel signaling pathways.

Also flagged:PolyarginineTumorP3H4bladder cancerazidepentapeptide
Journal Article 2022-10-10 No Snippets Hao L, Shi Z, Dong Y, Chen J, Pang K, He H, Zhang S, Wu W, Zhang Q, Han C.
Show Full Abstract

<h4>Purpose</h4>Prolyl 3-hydroxylase family member 4 (P3H4) is a potent prognostic oncogene in bladder cancer (BC), and the inhibition of P3H4 suppresses BC tumor growth. This study aimed to evaluate the efficiency of P3H4 inhibition for BC tumor therapy via tumor-targeting nanoparticles.<h4>Methods and results</h4>A linear polyarginine peptide (R9) was synthesized, azide-modified, and then assembled with cyclic pentapeptide cRGDfK. Chlorin e6 (ce6)-conjugated CH3-R9-RGD nanoparticles were prepared for the delivery of siP3H4 into T24 cells in vitro and BC tumors in vivo. Dynamic light scattering analysis identified that the optimum CH3-R9-RGD@siP3H4 molar ratio was 30/1. CH3-R9-RGD@ce6/siP3H4 nanocomposites decreased P3H4 expression and cell proliferation and promoted reactive oxygen species production, apoptosis, and calreticulin exposure in T24 cells in vitro. In vivo experiments showed that CH3-R9-RGD@ce6/siP3H4 nanocomposites caused pathological changes, suppressed BC tumor growth, promoted caspase 3 expression, and enhanced calreticulin exposure in tumor cells.<h4>Conclusions</h4>The tumor-targeting CH3-R9-RGD nanocomposites encapsulating siP3H4 and ce6 might be an alternative therapeutic strategy or intravesical instillation chemotherapy for BC.

Also flagged:Kidney diseasesnucleotidesnucleuscytoplasmcancersimprinting
Journal Article 2022-10-10 No Snippets Liu C, Ma K, Zhang Y, He X, Song L, Chi M, Han Z, Li G, Zhang Q, Liu C.
Show Full Abstract

The most extensively and well-investigated sequences in the human genome are protein-coding genes, while large numbers of non-coding sequences exist in the human body and are even more diverse with more potential roles than coding sequences. With the unveiling of non-coding RNA research, long-stranded non-coding RNAs (lncRNAs), a class of transcripts >200 nucleotides in length primarily expressed in the nucleus and rarely in the cytoplasm, have drawn our attention. LncRNAs are involved in various levels of gene regulatory processes, including but not limited to promoter activity, epigenetics, translation and transcription efficiency, and intracellular transport. They are also dysregulated in various pathophysiological processes, especially in diseases and cancers involving genomic imprinting. In recent years, numerous studies have linked lncRNAs to the pathophysiology of various kidney diseases. This review summarizes the molecular mechanisms involved in lncRNAs, their impact on kidney diseases, and associated complications, as well as the value of lncRNAs as emerging biomarkers for the prevention and prognosis of kidney diseases, suggesting their potential as new therapeutic tools.

Also flagged:hepatocellular carcinomaRNA polymerase IIliver cancerGene Expressioncell proliferationtumor
Journal Article 2022-10-10 ✓ 1 Snippet Yang P, Liu H, Li Y, Gao Q, Chen X, Chang J, Li Y, Chen S, Dong R, Wu H, Liu C, Liu G.
In-Text Gene Mentions

Interestingly, TCERG1 is involved in the pathogenesis of Huntington’s disease (HD) (Arango et al., 2006; Andresen et al., 2007) and plays a neuroprotective role in HD due to its overexpression that can rescue neuronal cell death caused by mutant HTT neurotoxicity.

Show Full Abstract

<b>Objective:</b> Transcription elongation factor 1 (<i>TCERG1</i>) is a nuclear protein consisted of multiple protein structural domains that plays an important role in regulating the transcription, extension, and splicing regulation of RNA polymerase II. However, the prognostic and immunological role of <i>TCERG</i>1 in human cancer remains unknown. In this study, we analyzed the expression of <i>TCERG1</i> gene in hepatocellular carcinoma (HCC) patients, its clinical significance, and its possible prognostic value by bioinformatics. <b>Methods:</b> RNA sequencing data and clinicopathological characteristics of patients with HCC were collected from TCGA and CCLE databases. The Wilcoxon rank-sum test was used to analyze the expression of <i>TCERG1</i> in HCC tissues and normal tissues. The protein levels of <i>TCERG1</i> between normal and liver cancer tissues were analyzed by the Human Protein Atlas Database (HPA) (www.proteinatlas.org). Validation was performed using the Gene Expression Omnibus (GEO) dataset of 167 samples. The expression of <i>TCERG1</i> in HCC cells were verified by qRT-PCR, and CCK-8, scratch assay and Transwell assay were performed to detect cell proliferation, migration and invasion ability. According to the median value of <i>TCERG1</i> expression, patients were divided into high and low subgroups. Logistic regression, GSEA enrichment, TME, and single-sample set gene enrichment analysis (ssGSEA) were performed to explore the effects of <i>TCERG1</i> on liver cancer biological function and immune infiltrates. <i>TCERG1</i> co-expression networks were studied through the CCLE database and the LinkedOmics database to analyze genes that interact with <i>TCERG1</i>. <b>Results:</b> The expression levels of <i>TCERG1</i> in HCC patient tissues were significantly higher than in normal tissues. Survival analysis showed that high levels of <i>TCERG1</i> expression were significantly associated with low survival rates in HCC patients. Multifactorial analysis showed that high <i>TCERG1</i> expression was an independent risk factor affecting tumor prognosis. This result was also verified in the GEO database. Cellular experiments demonstrated that cell proliferation, migration and invasion were inhibited after silencing of <i>TCERG1</i> gene expression. Co-expression analysis revealed that <i>CPSF6</i> and <i>MAML1</i> expression were positively correlated with <i>TCERG1</i>. GSEA showed that in samples with high <i>TCERG1</i> expression, relevant signaling pathways associated with cell cycle, apoptosis, pathways in cancer and enriched in known tumors included Wnt signaling pathway, Vegf signaling pathway, Notch signaling pathway, MAPK signaling pathway and MTOR pathways. The expression of <i>TCERG1</i> was positively correlated with tumor immune infiltrating cells (T helper two cells, T helper cells). <b>Conclusion:</b> <i>TCERG1</i> gene is highly expressed in hepatocellular carcinoma tissues, which is associated with the poor prognosis of liver cancer, and may be one of the markers for the diagnosis and screening of liver cancer and the prediction of prognosis effect. At the same time, <i>TCERG1</i> may also become a new target for tumor immunotherapy.

Also flagged:CancerTumormechanosensorycalciumPiezo1cytoskeleton
Journal Article 2022-10-10 No Snippets Tijore A, Yang B, Sheetz M.
Show Full Abstract

For over two centuries, clinicians have hypothesized that cancer developed preferentially at the sites of repeated damage, indicating that cancer is basically "continued healing." Tumor cells can develop over time into other more malignant types in different environments. Interestingly, indefinite growth correlates with the depletion of a modular, early rigidity sensor, whereas restoring these sensors in tumor cells blocks tumor growth on soft surfaces and metastases. Importantly, normal and tumor cells from many different tissues exhibit transformed growth without the early rigidity sensor. When sensors are restored in tumor cells by replenishing depleted mechanosensory proteins that are often cytoskeletal, cells revert to normal rigidity-dependent growth. Surprisingly, transformed growth cells are sensitive to mechanical stretching or ultrasound which will cause apoptosis of transformed growth cells (Mechanoptosis). Mechanoptosis is driven by calcium entry through mechanosensitive Piezo1 channels that activate a calcium-induced calpain response commonly found in tumor cells. Since tumor cells from many different tissues are in a transformed growth state that is, characterized by increased growth, an altered cytoskeleton and mechanoptosis, it is possible to inhibit growth of many different tumors by mechanical activity and potentially by cytoskeletal inhibitors.

Also flagged:fisetinflavonoidneurodegenerative diseasesmitochondrialmembranelipid
Journal Article 2022-10-10 ✓ 1 Snippet Hassan SSU, Samanta S, Dash R, Karpiński TM, Habibi E, Sadiq A, Ahmadi A, Bunagu S.
In-Text Gene Mentions

Feeding of fisetin-containing diet to Drosophila flies expressing pathogenic human Htt (w elav:Gal4/w; P{UAS-Httex1p Q93}/+) (Httex1p Q93) enhanced ERK phosphorylation and activation, resulting in ∼25% diminution of neurodegeneration, suppression of symptoms of HD and increased 77% of overall survival (Maher et al., 2011a).

Show Full Abstract

Oxidative stress (OS) disrupts the chemical integrity of macromolecules and increases the risk of neurodegenerative diseases. Fisetin is a flavonoid that exhibits potent antioxidant properties and protects the cells against OS. We have viewed the NCBI database, PubMed, Science Direct (Elsevier), Springer-Nature, ResearchGate, and Google Scholar databases to search and collect relevant articles during the preparation of this review. The search keywords are OS, neurodegenerative diseases, fisetin, etc. High level of ROS in the brain tissue decreases ATP levels, and mitochondrial membrane potential and induces lipid peroxidation, chronic inflammation, DNA damage, and apoptosis. The subsequent results are various neuronal diseases. Fisetin is a polyphenolic compound, commonly present in dietary ingredients. The antioxidant properties of this flavonoid diminish oxidative stress, ROS production, neurotoxicity, neuro-inflammation, and neurological disorders. Moreover, it maintains the redox profiles, and mitochondrial functions and inhibits NO production. At the molecular level, fisetin regulates the activity of PI3K/Akt, Nrf2, NF-κB, protein kinase C, and MAPK pathways to prevent OS, inflammatory response, and cytotoxicity. The antioxidant properties of fisetin protect the neural cells from inflammation and apoptotic degeneration. Thus, it can be used in the prevention of neurodegenerative disorders.

Also flagged:cancersbladder cancerPFKFB4EDNRAGSNGAS1
Journal Article 2022-10-10 No Snippets Shen C, Li Z, Zhang Y, Zhang Z, Wu Z, Da, Yang S, Wang Z, Zhang Y, Qie Y, Zhao G, Lin Y, Huang S, Zhou M, Hu H.
Show Full Abstract

Increasing evidences have demonstrated that circular RNA (circRNAs) plays a an essential regulatory role in initiation, progression and immunotherapy resistance of various cancers. However, circRNAs have rarely been studied in bladder cancer (BCa). The purpose of this research is to explore new circRNAs and their potential mechanisms in BCa. A novel ceRNA-regulated network, including 87 differentially expressed circRNAs (DE-circRNAs), 126 DE-miRNAs, and 217 DE-mRNAs was constructed to better understanding the biological processes using Cytoscape 3.7.1 based on our previously high-throughput circRNA sequencing and five GEO datasets. Subsequently, five randomly selected circRNAs (upregulated circ_0001681; downregulated circ_0000643, circ_0001798, circ_0006117 and circ_0067900) in 20 pairs of BCa and paracancerous tissues were confirmed using qRT-PCR. Functional analysis results determined that 772 GO functions and 32 KEGG pathways were enriched in the ceRNA network. Ten genes (PFKFB4, EDNRA, GSN, GAS1, PAPPA, DTL, TGFBI, PRSS8, RGS1 and TCF4) were selected for signature construction among the ceRNA network. The Human Protein Atlas (HPA) expression of these genes were consistent with the above sequencing data. Notably, the model was validated in multiple external datasets (GSE13507, GSE31684, GSE48075, IMvigor210 and GSE32894). The immune-infiltration was evaluated by 7 published algorithms (i.e., TIMER, CIBERSORT, CIBERSORT-ABS, QUANTISEQ, MCPCOUNTER, XCELL and EPIC). Next, Correlations between riskscore or risk groups and clinicopathological data, overall survival, recognized immunoregulatory cells or common chemotherapeutic agents of BCa patients were performed using wilcox rank test, chi-square test, cox regression and spearman's correlation analysis; and, these results are significant. According to R package "GSVA" and "clusterProfiler", the most significantly enriched HALLMARK and KEGG pathway was separately the 'Epithelial Mesenchymal Transition' and 'Ecm Receptor Interaction' in the high- vs. low-risk group. Additionally, the functional experiments <i>in vitro</i> also revealed that the overexpression of has_circ_0067900 significantly impaired the proliferation, migration, and invasion capacities of BCa cells. Collectively, the results of the current study provide a novel landscape of circRNA-associated ceRNA-regulated network in BCa. The ceRNA-associated gene model which was constructed presented a high predictive performance for the prognosis, immunotherapeutic responsiveness, and chemotherapeutic sensitivity of BCa. And, has_circ_0067900 was originally proposed as tumor suppressor for patients with BCa.

Also flagged:COVID-19lung cancerCOVID-19 infectioninfectioncancertumor
Journal Article 2022-10-10 No Snippets Aramini B, Masciale V, Samarelli AV, Tonelli R, Cerri S, Clini E, Stella F, Dominici M.
Show Full Abstract

COVID-19 infection caused by SARS-CoV-2 is considered catastrophic because it affects multiple organs, particularly those of the respiratory tract. Although the consequences of this infection are not fully clear, it causes damage to the lungs, the cardiovascular and nervous systems, and other organs, subsequently inducing organ failure. In particular, the effects of SARS-CoV-2-induced inflammation on cancer cells and the tumor microenvironment need to be investigated. COVID-19 may alter the tumor microenvironment, promoting cancer cell proliferation and dormant cancer cell (DCC) reawakening. DCCs reawakened upon infection with SARS-CoV-2 can populate the premetastatic niche in the lungs and other organs, leading to tumor dissemination. DCC reawakening and consequent neutrophil and monocyte/macrophage activation with an uncontrolled cascade of pro-inflammatory cytokines are the most severe clinical effects of COVID-19. Moreover, neutrophil extracellular traps have been demonstrated to activate the dissemination of premetastatic cells into the lungs. Further studies are warranted to better define the roles of COVID-19 in inflammation as well as in tumor development and tumor cell metastasis; the results of these studies will aid in the development of further targeted therapies, both for cancer prevention and the treatment of patients with COVID-19.

Also flagged:membranecancerbladder cancertumorstumorlocalization
Journal Article 2022-10-10 ✓ 1 Snippet Feng L, Yang J, Zhang W, Wang X, Li L, Peng M, Luo P.
In-Text Gene Mentions

…CD48, LGALS9, IDO1,TNFSF4, TNFRSF4, CD27, CD28,…

Show Full Abstract

Based on the importance of basement membrane (BM) in cancer invasion and metastasis, we constructed a BM-associated lncRNA risk model to group bladder cancer (BCa) patients. Transcriptional and clinical data of BCa patients were downloaded from The Cancer Genome Atlas (TCGA), and the expressed genes of BM-related proteins were obtained from the BM-BASE database. We download the GSE133624 chip data from the GEO database as an external validation dataset. We screened for statistically different BM genes between tumors and adjacent normal tissues. Co-expression analysis of lncRNAs and differentially expressed BM genes was performed to identify BM-related lncRNAs. Then, differentially expressed BM-related lncRNAs (DEBMlncRNAs) between tumor and normal tissues were identified. Univariate/multivariate Cox regression analysis was performed to select lncRNAs for risk assessment. LASSO analysis was performed to build a prognostic model. We constructed a model containing 8 DEBMlncRNAs (AC004034.1, AL662797.1, NR2F1-AS1, SETBP1-DT, AC011503.2, AC093010.2, LINC00649 and LINC02321). The prognostic risk model accurately predicted the prognosis of BCa patients and revealed that tumor aggressiveness and distant metastasis were associated with higher risk scores. In this model, we constructed a nomogram to assist clinical decision-making based on clinicopathological characteristics such as age, T, and N. The model also showed good predictive power for the tumor microenvironment and mutational burden. We validated the expression of eight lncRNAs using the dataset GSE133624 and two human bladder cancer cell lines (5637, BIU-87) and examined the expression and cellular localization of LINC00649 and AC011503.2 using a human bladder cancer tissue chip. We found that knockdown of LINC00649 expression in 5637 cells promoted the proliferation of 5637 cells.Our eight DEBMlncRNA risk models provide new insights into predicting prognosis, tumor invasion, and metastasis in BCa patients.

Also flagged:LUADnon-small cell lung cancersNSCLCLung adenocarcinomalung cancerGene Expression
Journal Article 2022-10-10 ✓ 1 Snippet Chen P, Quan Z, Song X, Gao Z, Yuan K.
In-Text Gene Mentions

…, SIGLEC10 andOLFM4( Figure 7B…

Show Full Abstract

<h4>Background</h4>Approximately 80% of lung cancers are non-small cell lung cancers (NSCLC). Lung adenocarcinoma (LUAD) is the main subtype of NSCLC. The incidence and mortality of lung cancer are also increasing yearly. Myogenic differentiation family inhibitor (<i>MDFI</i>) as a transcription factor, its role in lung cancer has not yet been clarified.<h4>Methods</h4>LUAD data were downloaded from The Cancer Genome Atlas (TCGA) database and Gene Expression Omnibus (GEO), analyzed and plotted using the R language. Associations between Clinical information and <i>MDFI</i> expression were assessed using logistic regression analyses to explore the effects of <i>MDFI</i> on LUAD. Two sets of tissue microarrays (TMAs) further confirmed the overexpression of <i>MDFI</i> in LUAD and its impact on prognosis. In addition, we examined the correlation between <i>MDFI</i> and immune infiltration. To investigate the effect of <i>MDFI</i> on the biological behavior of LUAD tumor cells by GSEA and GO/KEGG analysis. The survival status and somatic mutational characteristics of patients according to <i>MDFI</i> levels were depicted and analyzed.<h4>Results</h4>Expression of high <i>MDFI</i> in LUAD tissues <i>via</i> analyzing TCGA dataset (<i>P <</i>0.001). Kaplan-Meier survival analysis indicated a poor prognosis for those patients with LUAD who had upregulated <i>MDFI</i> expression levels (<i>P <</i>0.001). This was also verified by two groups of TMAs (<i>P</i>=0.024). Using logistic statistics analysis, <i>MDFI</i> was identified as an independent predictive factor and was associated with poor prognosis in LUAD (<i>P <</i>0.001, <i>P</i> =0.021). Assessment of clinical characteristics, tumor mutation burden (TMB), and tumor microenvironment (TME) between high- and low-expression score groups showed lower TMB, richer immune cell infiltration, and better prognosis in the low-risk group.<h4>Conclusion</h4>This study showed that <i>MDFI</i> was overexpressed in LUAD and was significantly associated with poor prognosis, indicating that <i>MDFI</i> may be used as a potential novel biomarker for the diagnosis and prognosis of LUAD. <i>MDFI</i> is associated with immune infiltration of LUAD and it is reasonable to speculate that it plays an important role in tumor proliferation and spread. In view of the significant differences in <i>MDFI</i> expression between different biological activities, LUAD patients with <i>MDFI</i> overexpression may obtain more precise treatment strategies in the clinic.

Also flagged:immune responseNon-alcoholic fatty liver diseaseNAFLDmetabolic syndromeobesitycirrhosis
Journal Article 2022-10-10 ✓ 1 Snippet Ortiz-López N, Fuenzalida C, Dufeu MS, Pinto-León A, Escobar A, Poniachik J, Roblero JP, Valenzuela-Pérez L, Beltrán CJ.
In-Text Gene Mentions

…chronic liver disease (hemochromatosis, autoimmune liver disease,…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) is a complex and heterogeneous disorder considered a liver-damaging manifestation of metabolic syndrome. Its prevalence has increased in the last decades due to modern-day lifestyle factors associated with overweight and obesity, making it a relevant public health problem worldwide. The clinical progression of NAFLD is associated with advanced forms of liver injury such as fibrosis, cirrhosis, and hepatocellular carcinoma (HCC). As such, diverse pharmacological strategies have been implemented over the last few years, principally focused on metabolic pathways involved in NAFLD progression. However, a variable response rate has been observed in NAFLD patients, which is explained by the interindividual heterogeneity of susceptibility to liver damage. In this scenario, it is necessary to search for different therapeutic approaches. It is worth noting that chronic low-grade inflammation constitutes a central mechanism in the pathogenesis and progression of NAFLD, associated with abnormal composition of the intestinal microbiota, increased lymphocyte activation in the intestine and immune effector mechanisms in liver. This review aims to discuss the current knowledge about the role of the immune response in NAFLD development. We have focused mainly on the impact of altered gut-liver-microbiota axis communication on immune cell activation in the intestinal mucosa and the role of subsequent lymphocyte homing to the liver in NAFLD development. We further discuss novel clinical trials that addressed the control of the liver and intestinal immune response to complement current NAFLD therapies.

Also flagged:intestinalimmune disordersintestinal inflammationintestinal diseasesoxygenbacteria infection
Journal Article 2022-10-10 ✓ 2 Snippets Wan Z, Zhang X, Jia X, Qin Y, Sun N, Xin J, Zeng Y, Jing B, Fang J, Pan K, Zeng D, Bai Y, Wang H, Ma H, Ni X.
In-Text Gene Mentions

…xia/reoxygenation by targetingSOX6.…

… apoptosis through miR-499-5p-SOX6.…

Show Full Abstract

<h4>Background</h4>Intestinal microbiota plays an important role in maintaining the microecological balance of the gastrointestinal tract in various animals. Disturbances in the intestinal microbiota may lead to the proliferation of potentially pathogenic bacteria that become the dominant species, leading to intestinal immune disorders, intestinal inflammation, and other intestinal diseases. Numerous studies have been confirmed that high-altitude exposure affects the normal function of the intestine and the composition of the intestinal microbiota. However, it is still necessary to reveal the changes in intestinal microbiota in high-altitude exposure environments, and clarify the relationship between the proliferation of potentially pathogenic bacteria and intestinal injury in this environment. In addition, explored probiotics that may have preventive effects against intestinal diseases.<h4>Methods and results</h4>C57BL/6 mice were randomly divided into three groups, a high-altitude group (HA), control group (C), and high-altitude probiotic group (HAP). The HA and HAP groups were subjected to hypoxia modeling for 14 days in a low-pressure oxygen chamber with daily gavage of 0.2 mL of normal saline (HA) and <i>Lactobacillus johnsonii</i> YH1136 bacterial fluid (HAP), while the control group was fed normally. <i>L. johnsonii</i> YH1136 was isolated from feces of a healthy Tibetan girl in Baingoin county, the Nagqu region of the Tibet Autonomous Region, at an altitude of 5000 meters. Our observations revealed that gavage of YH1136 was effective in improving the damage to the intestinal barrier caused by high-altitude exposure to hypoxic environments and helped to reduce the likelihood of pathogenic bacteria infection through the intestinal barrier. It also positively regulates the intestinal microbiota to the extent of Lactobacillus being the dominant microbiome and reducing the number of pathogenic bacteria. By analyzing the expression profile of ileal microRNAs and correlation analysis with intestinal microbiota, we found that Staphylococcus and Corynebacterium1 cooperated with miR-196a-1-3p and miR-3060-3p, respectively, to play a regulatory role in the process of high-altitude hypoxia-induced intestinal injury.<h4>Conclusion</h4>These findings revealed the beneficial effect of <i>L. johnsonii</i> YH1136 in preventing potential endogenous pathogenic bacteria-induced intestinal dysfunction in high-altitude environments. The mechanism may be related to the regulation of intestinal injury from the perspective of the gut microbiota as well as miRNAs.

Also flagged:microfilamentsIMP3neurodegenerative diseasesmicrotubulesHDcytoskeleton
Journal Article 2022-10-10 ✓ 4 Snippets Yang HI, Huang PY, Chan SC, Tung CW, Cheng PH, Chen CM, Yang SH.
In-Text Gene Mentions

Huntington’s disease (HD) is an inheritable and autosomal dominant disease, and is caused by an expansion of CAG trinucleotide repeats in exon 1 of the Huntingtin (HTT) gene.1

R6/2 HD transgenic mice carry truncated exon1 of HTT gene with expanded polyQ under control of an HTT promoter.58

We further determined the role of IMP3 and IGF2 toward mutant HTT (mHTT) aggregates in HD.

…the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is one of the inheritable neurodegenerative diseases, and these diseases share several similar pathological characteristics, such as abnormal neuronal morphology. miR-196a is a potential target to provide neuroprotective functions, and has been reported to enhance polymerization of neuronal microtubules in HD. While microtubules and microfilaments are two important components of the neuronal cytoskeleton, whether miR-196a improves neuronal microfilaments is still unknown. Here, we identify insulin-like growth factor 2 mRNA binding protein 3 (IMP3), and show that miR-196a directly suppresses IMP3 to increase neurite outgrowth in neurons. In addition, IMP3 disturbs neurite outgrowth <i>in vitro</i> and <i>in vivo</i>, and worsens the microfilament polymerization. Moreover, insulin-like growth factor-II (IGF2) is identified as the downstream target of IMP3, and miR-196a downregulates IMP3 to upregulate IGF2, which increases microfilamental filopodia numbers and activates Cdc42 to increase neurite outgrowth. Besides, miR-196a increases neurite outgrowth through IGF2 in different HD models. Finally, higher expression of IMP3 and lower expression IGF2 are observed in HD transgenic mice and patients, and increase the formation of aggregates in the HD cell model. Taken together, miR-196a enhances polymerization of neuronal microfilaments through suppressing IMP3 and upregulating IGF2 in HD, supporting the neuroprotective functions of miR-196a through neuronal cytoskeleton in HD.

medRxiv 2022-10-10 Preprint (No Snippets API) Budu-Aggrey A, Kilanowski A, Sobczyk MK, Shringarpure SS, Mitchell R, Reis K, Reigo A, Mägi R, Nelis M, Tanaka N, Brumpton BM, Thomas LF, Sole-Navais P, Flatley C, Espuela-Ortiz A, Herrera-Luis E, Lominchar JV, Bork-Jensen J, Marenholz I, Arnau-Soler A, Jeong A, Fawcett KA, Baurecht H, Rodriguez E, Alves AC, Kumar A, Sleiman PM, Chang X, Medina-Gomez C, Hu C, Xu C, Qi C, El-Heis S, Titcombe P, Antoun E, Fadista J, Wang CA, Thiering E, Xiao S, Kress S, Kothalawala DM, Kadalayil L, Duan J, Zhang H, Hoffmann T, Jorgenson E, Choquet H, Risch N, Njølstad P, Andreassen OA, Johansson S, Almqvist C, Gong T, Ullemar V, Karlsson R, Magnusson PK, Szwajda A, Burchard EG, Thyssen JP, Hansen T, Kårhus LL, Dantoft TM, Jeanrenaud AC, Ghauri A, Arnold A, Homuth G, Lau S, Nöthen MM, Hübner N, Imboden M, Visconti A, Falchi M, Bataille V, Hysi P, Ballardini N, Boomsma DI, Hottenga JJ, Müller-Nurasyid M, Ahluwalia TS, Stokholm J, Chawes B, Schoos AM, Esplugues A, Bustamante M, Raby B, Arshad H, German C, 23andMe Research Team, Esko T, Milani LA, Metspalu A, Terao C, Abuabara K, Løset M, Hveem K, Jacobsson B, Pino-Yanes M, Strachan DP, Grarup N, Linneberg A, Lee Y, Probst-Hensch N, Weidinger S, Jarvelin M, Melén E, Hakonarson H, Hakonarson H, Irvine AD, Jarvis DL, Nijsten T, Duijts L, Vonk JM, Koppelmann GH, Godfrey KM, Barton SJ, Feenstra B, Pennell CE, Sly PD, Holt PG, Williams KL, Bisgaard H, Bønnelykke K, Curtin J, Simpson A, Murray C, Schikowski T, Bunyavanich S, Weiss ST, Holloway JW, Min J, Brown SJ, Standl M, Paternoster L.
Show Full Abstract

Atopic dermatitis (AD) is a common inflammatory skin condition and prior genome-wide association studies have identified 71 associated loci. In the current study we conducted the largest AD GWAS to date (discovery N=1,086,394, replication N=3,604,027), combining previously reported cohorts with additional available data. We identified 81 loci (29 novel) in the European-only analysis and 15 additional loci in the multi-ancestry analysis (6 novel). All 81 variants replicated in a separate European analysis. Eleven variants from the multi-ancestry analysis replicated in at least one of the populations tested (European, Latino or African). While four variants appeared to be specific to individuals of Japanese ancestry. AD loci showed enrichment for DNAse I hypersensitivity and eQTL signals in blood. At each locus we prioritised candidate genes by integrating multi-omic data. The implicated genes are predominantly in immune pathways of relevance to atopic inflammation and some offer drug repurposing opportunities.

Also flagged:ActinCytoskeletonmembranesdeath-relatedRac
Journal Article 2022-10-09 ✓ 4 Snippets Yumura S, Talukder MSU, Pervin MS, Tanvir MIO, Matsumura T, Fujimoto K, Tanaka M, Itoh G.
In-Text Gene Mentions

The ortholog of Huntington’s disease protein Huntingtin (Htt) regulates myosin II phosphorylation through phosphatase PP2A, affecting chemotaxis and cytokinesis [83,84].

…disease protein Huntingtin (Htt) regulates myosin II…

…The deletion ofHttdid not affect…

…such as DwwA,Htt, RgaA, MHCKs A…

Show Full Abstract

The repair of wounded cell membranes is essential for cell survival. Upon wounding, actin transiently accumulates at the wound site. The loss of actin accumulation leads to cell death. The mechanism by which actin accumulates at the wound site, the types of actin-related proteins participating in the actin remodeling, and their signaling pathways are unclear. We firstly examined how actin accumulates at a wound site in <i>Dictyostelium</i> cells. Actin assembled de novo at the wound site, independent of cortical flow. Next, we searched for actin- and signal-related proteins targeting the wound site. Fourteen of the examined proteins transiently accumulated at different times. Thirdly, we performed functional analyses using gene knockout mutants or specific inhibitors. Rac, WASP, formin, the Arp2/3 complex, profilin, and coronin contribute to the actin dynamics. Finally, we found that multiple signaling pathways related to TORC2, the Elmo/Doc complex, PIP2-derived products, PLA2, and calmodulin are involved in the actin dynamics for wound repair.

Also flagged:SorafenibHepatocellular carcinomacancerdeathtyrosine kinaseD-alanine
Journal Article 2022-10-09 ✓ 1 Snippet Abushawish KYI, Soliman SSM, Giddey AD, Al-Hroub HM, Mousa M, Alzoubi KH, El-Huneidi W, Abu-Gharbieh E, Omar HA, Elgendy SM, Bustanji Y, Soares NC, Semreen MH.
In-Text Gene Mentions

…such as diabetes,hemochromatosis, and non-alcoholic fatty…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the second prominent cause of cancer-associated death worldwide. Usually, HCC is diagnosed in advanced stages, wherein sorafenib, a multiple target tyrosine kinase inhibitor, is used as the first line of treatment. Unfortunately, resistance to sorafenib is usually encountered within six months of treatment. Therefore, there is a critical need to identify the underlying reasons for drug resistance. In the present study, we investigated the proteomic and metabolomics alterations accompanying sorafenib resistance in hepatocellular carcinoma Hep3B cells by employing ultra-high-performance liquid chromatography quadrupole time of flight mass spectrometry (UHPLC-QTOF-MS). The Bruker Human Metabolome Database (HMDB) library was used to identify the differentially abundant metabolites through MetaboScape 4.0 software (Bruker). For protein annotation and identification, the Uniprot proteome for Homo sapiens (Human) database was utilized through MaxQuant. The results revealed that 27 metabolites and 18 proteins were significantly dysregulated due to sorafenib resistance in Hep3B cells compared to the parental phenotype. D-alanine, L-proline, o-tyrosine, succinic acid and phosphatidylcholine (PC, 16:0/16:0) were among the significantly altered metabolites. Ubiquitin carboxyl-terminal hydrolase isozyme L1, mitochondrial superoxide dismutase, UDP-glucose-6-dehydrogenase, sorbitol dehydrogenase and calpain small subunit 1 were among the significantly altered proteins. The findings revealed that resistant Hep3B cells demonstrated significant alterations in amino acid and nucleotide metabolic pathways, energy production pathways and other pathways related to cancer aggressiveness, such as migration, proliferation and drug-resistance. Joint pathway enrichment analysis unveiled unique pathways, including the antifolate resistance pathway and other important pathways that maintain cancer cells' survival, growth, and proliferation. Collectively, the results identified potential biomarkers for sorafenib-resistant HCC and gave insights into their role in chemotherapeutic drug resistance, cancer initiation, progression and aggressiveness, which may contribute to better prognosis and chemotherapeutic outcomes.

Also flagged:COVID-19Myocardial injuryMIcoronavirus disease 2019pathogenesisMyocardial Infarction
Journal Article 2022-10-09 ✓ 1 Snippet Moll-Bernardes R, Mattos JD, Schaustz EB, Sousa AS, Ferreira JR, Tortelly MB, Pimentel AML, Figueiredo ACBS, Noya-Rabelo MM, Sales ARK, Albuquerque DC, Rosado-de-Castro PH, Camargo GC, Souza OF, Bozza FA, Medei E, Luiz RR.
In-Text Gene Mentions

…herosclerosis and thrombosis (type 1 infarction1 infarction), or…

Show Full Abstract

Myocardial injury (MI), defined by troponin elevation, has been associated with increased mortality and adverse outcomes in patients with coronavirus disease 2019 (COVID-19), but the role of this biomarker as a risk predictor remains unclear. Data from adult patients hospitalized with COVID-19 were recorded prospectively. A multiple logistic regression model was used to quantify associations of all variables with in-hospital mortality, including the calculation of odds ratios (ORs) and confidence intervals (CI). Troponin measurement was performed in 1476 of 4628 included patients, and MI was detected in 353 patients, with a prevalence of 23.9%; [95% CI, 21.8-26.1%]. The total in-hospital mortality rate was 10.9% [95% CI, 9.8-12.0%]. The mortality was much higher among patients with MI than among those without MI, with a prevalence of 22.7% [95% CI, 18.5-27.3%] vs. 5.5% [95% CI, 4.3-7.0%] and increased with each troponin level. After adjustment for age and comorbidities, the model revealed that the mortality risk was greater for patients with MI [OR = 2.99; 95% CI, 2.06-4.36%], and for those who did not undergo troponin measurement [OR = 2.2; 95% CI, 1.62-2.97%], compared to those without MI. Our data support the role of troponin as an important risk predictor for these patients, capable of discriminating between those with a low or increased mortality rate. In addition, our findings suggest that this biomarker has a remarkable negative predictive value in COVID-19.

Also flagged:Diaza-1,3-butadienesimineshydrazones1,2-diaza1,3-diaza2
Journal Article 2022-10-09 No Snippets Heredia-Moya J, Zurita DA, Cadena-Cruz JE, Alcívar-León CD.
Show Full Abstract

Many heterocyclic compounds can be synthetized using diaza-1,3-butadienes (DADs) as key structural precursors. Isolated and in situ diaza-1,3-butadienes, produced from their respective precursors (typically imines and hydrazones) under a variety of conditions, can both react with a wide range of substrates in many kinds of reactions. Most of these reactions discussed here include nucleophilic additions, Michael-type reactions, cycloadditions, Diels-Alder, inverse electron demand Diels-Alder, and aza-Diels-Alder reactions. This review focuses on the reports during the last 10 years employing 1,2-diaza-, 1,3-diaza-, 2,3-diaza-, and 1,4-diaza-1,3-butadienes as intermediates to synthesize heterocycles such as indole, pyrazole, 1,2,3-triazole, imidazoline, pyrimidinone, pyrazoline, -lactam, and imidazolidine, among others. Fused heterocycles, such as quinazoline, isoquinoline, and dihydroquinoxaline derivatives, are also included in the review.

Also flagged:Phenolic AcidsSynthesiscaffeic and ferulic acidsCell-cycleCancerdeath
Journal Article 2022-10-09 No Snippets Ezzat SM, Teba HES, Shahin IG, Hafez AM, Kamal AM, Aborehab NM.
Show Full Abstract

A crucial target in drug research is magnifying efficacy and decreasing toxicity. Therefore, using natural active constituents as precursors will enhance both safety and biological activities. Despite having many pharmacological activities, caffeic and ferulic acids showed limited clinical usage due to their poor bioavailability and fast elimination. Therefore, semisynthetic compounds from these two acids were prepared and screened as anticancer agents. In this study, CA and FA showed very potent anticancer activity against Caco-2 cells. Consequently, eighteen derivatives were tested against the same cell line. Four potent candidates were selected for determination of the selectivity index, where compound <b>10</b> revealed a high safety margin. Compound <b>10</b> represented a new scaffold and showed significant cytotoxic activity against Caco-2. Cell-cycle analysis and evaluation of apoptosis showed that derivatives <b>10</b>, <b>7</b>, <b>11</b>, <b>15</b> and <b>14</b> showed the highest proportion of cells in a late apoptotic stage.

Also flagged:CurcuminWatersynthesiscancercarbontumor
Journal Article 2022-10-09 No Snippets Yakub G, Manolova NE, Rashkov IB, Markova N, Toshkova R, Georgieva A, Mincheva R, Toncheva A, Raquez JM, Dubois P.
Show Full Abstract

During the past years, the synthesis of polymer prodrug structures, based on natural phytochemical compounds with a great range of valuable biological properties, has become a promising solution in cancer prevention, imaging, and detection. Curcumin (Curc) remains one of the most studied natural products, due to the impressive palette of biological properties and the possibility to be easily loaded in various micro- and nanostructures and chemically modified. In this study, pegylated curcumin derivatives were prepared by a direct esterification reaction between poly(ethylene glycol)diacid (PEG of 600 g/mol molar mass, PEG<sub>600</sub>) and Curc in the presence of <i>N</i>,<i>N</i>'-dicyclohexylcarbodiimide (PEG<sub>600</sub>-Curc). The successful reaction resulted in a water-soluble stable product that was characterized by infrared spectroscopy (Fourier transform infrared (FT-IR)) and proton (<sup>1</sup>H) and carbon (<sup>13</sup>C) NMR. The effect of the pH values of buffer solutions on PEG<sub>600</sub>-Curc spectral properties (absorption and photoluminescence) was investigated by UV-vis and fluorescence spectrophotometry. Based on the biological tests, it was confirmed that PEG<sub>600</sub>-Curc exhibits cytotoxic activity against Graffi cell lines, as a function of the Curc concentration in the conjugate and the incubation time. PEG<sub>600</sub>-Curc antibacterial activity was validated in microbiological tests against pathogenic microorganisms such as <i>Staphylococcus aureus</i>. Most importantly, despite the covalent attachment of Curc to PEG and the slight reduction in the therapeutic index of the conjugate, both the anticancer and antimicrobial activities remain the highest reported, thus opening the gate for further, more clinically oriented studies.

Also flagged:Tyrosine kinasesKMT2AMLLacute leukemiascancertyrosine kinase
Journal Article 2022-10-09 No Snippets Uckun FM, Qazi S.
Show Full Abstract

<b>Aim:</b> The main goal of this study was to elucidate at the transcript level the tyrosine kinase expression profiles of primary leukemia cells from mixed lineage leukemia 1 gene rearranged (KMT2A/MLL-R<sup>+</sup>) acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) patients. <b>Methods:</b> We evaluated protein tyrosine kinase (PTK) gene expression profiles of primary leukemic cells in KMT2A/MLL-R<sup>+</sup> AML and ALL patients using publicly available archived datasets. <b>Results:</b> Our studies provided unprecedented evidence that the genetic signatures of KMT2A/MLL-R<sup>+</sup> AML and ALL cells are characterized by transcript-level overexpression of specific PTK. In infants, children and adults with KMT2A/MLL-R<sup>+</sup> ALL, as well as pediatric patients with KMT2A/MLL-R<sup>+</sup> AML, the gene expression levels for FLT3, BTK, SYK, JAK2/JAK3, as well as several SRC family PTK were differentially amplified. In adults with KMT2A/MLL-R<sup>+</sup> AML, the gene expression levels for SYK, JAK family kinase TYK2, and the SRC family kinases FGR and HCK were differentially amplified. <b>Conclusion:</b> These results provide new insights regarding the clinical potential of small molecule inhibitors of these PTK, many of which are already FDA/EMA-approved for other indications, as components of innovative multi-modality treatment platforms against KMT2A/MLL-R<sup>+</sup> acute leukemias.

Also flagged:Gene expressionmethylationcopper arsenateglutathionylationarsenicalproliferating cell nuclear antigen
Journal Article 2022-10-09 ✓ 2 Snippets Takahashi N, Yamaguchi S, Ohtsuka R, Takeda M, Yoshida T, Kosaka T, Harada T.
In-Text Gene Mentions

…Prdx2, Car3, Rnh1,Prdx6) were upregulated,…

…Prdx2, Car3, Rnh1,Prdx6), which have…

Show Full Abstract

Our previous 4-week repeated dose toxicity study showed that wood preservative chromated copper arsenate (CCA) induced hepatocellular hypertrophy accompanied by biochemical hepatic dysfunction and an increase in oxidative stress marker, 8-hydroxydeoxyguanosine, in female rats. To further explore the molecular mechanisms of CCA hepatotoxicity, we analyzed 10%-buffered formalin-fixed liver samples from female rats for cell proliferation, apoptosis, and protein glutathionylation and conducted microarray analysis on frozen liver samples from female rats treated with 0 or 80 mg/kg/day of CCA. Chemical analysis revealed that dimethylated arsenical was the major metabolite in liver tissues of male and female rats. CCA increase labeling indices of proliferating cell nuclear antigen and decrease terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling accompanied with increased expression of protein glutathionylation, indicating a decrease in glutathione (GSH) in hepatocytes of female rats. Microarray analysis revealed that CCA altered gene expression of antioxidants, glutathione-S-transferase (GST), heat shock proteins and ubiquitin-proteasome pathway, cell proliferation, apoptosis, DNA methylation, cytochrome P450, and glucose and lipid metabolism in female rats. Increased expression of GSTs, including <i>Gsta2</i>, <i>Gsta3</i>, <i>Mgst1</i>, and <i>Cdkn1b</i> (<i>p27</i>), and decreased expression of the antioxidant <i>Mt1</i>, and DNA methylation <i>Dnmt1</i>, <i>Dnmt3a</i>, and <i>Ctcf</i> were confirmed in the liver of female rats in a dose-dependent manner. Methylation status of the promoter region of the <i>Mt1</i> was not evidently changed between control and treatment groups. The results suggested that CCA decreased GSH and altered the expression of several genes, including antioxidants, GST, and DNA methylation, followed by impaired cell proliferation in the liver of female rats.

Also flagged:autophagyJ3neurodegenerative disorderdeathmTORprotein degradation
Journal Article 2022-10-08 ✓ 5 Snippets Long J, Luo X, Fang D, Song H, Fang W, Shan H, Liu P, Lu B, Yin XM, Hong L, Li M.
In-Text Gene Mentions

Huntington’s disease (HD) is a neurodegenerative disorder caused by aggregation of the mutant huntingtin (mHTT) protein encoded from extra tracts of CAG repeats in exon 1 of the HTT gene.

We further demonstrated that J3, with high permeability to the brain-blood barrier, could significantly alleviate HD-associated phenotypes and biomarkers, such as total HTT (T-HTT) and DARPP-32 in the mouse model of HD.

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder that occurs due to abnormal expansion of the CAG repeat sequence in the exon 1 of the HTT gene.

The results revealed that administration of J3 at different doses for 12 weeks decreased the levels of T-HTT and DARPP-32 in HdhQ140/Q140, indicating that HD changes could be ameliorated by J3 (Fig. 6A, B, Additional file 6: S6A-B).

…1 of theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by aggregation of the mutant huntingtin (mHTT) protein encoded from extra tracts of CAG repeats in exon 1 of the HTT gene. mHTT proteins are neurotoxic to render the death of neurons and a series of disease-associated phenotypes. The mHTT is degraded through autophagy pathway and ubiquitin-proteasome system (UPS). This study identified a small molecule, J3, as an autophagy inducer by high-content screening. The results revealed that J3 could inhibit mTOR, thus promoting autophagic flux and long-lived protein degradation. Further, J3 selectively lowered the soluble and insoluble mHTT but not wild type HTT levels in cell models. The HdhQ140 mice showed reduced HD-associated activity and loss of motor functions. However, administration of J3 showed increased activity and a slight improvement in the motor function in the open-field test, balance beam test, and rotarod tests. Furthermore, in vivo studies revealed that J3 decreased T-HTT and misfolded protein levels in the striatum and increased the levels of the medium spiny neuron marker DARPP-32. In addition, J3 showed good permeability across the brain-blood barrier efficiently, suggesting that J3 was a promising candidate for the treatment of HD.

Also flagged:colorectal cancercancertumortumorslung cancermelanoma
Journal Article 2022-10-08 ✓ 1 Snippet Shen R, Li P, Zhang B, Feng L, Cheng S.
In-Text Gene Mentions

…( FRZB ),SOX6and PDGFRA ,…

Show Full Abstract

<h4>Background</h4>Single-cell transcription data provided unprecedented molecular information, enabling us to directly encode the ecosystem of colorectal cancer (CRC). Characterization of the diversity of epithelial cells and how they cooperate with tumor microenvironment cells (TME) to endow CRC with aggressive characteristics at single-cell resolution is critical for the understanding of tumor progression mechanism.<h4>Methods</h4>In this study, we comprehensively analyzed the single-cell transcription data, bulk-RNA sequencing data and pathological tissue data. In detail, cellular heterogeneity of TME and epithelial cells were analyzed by unsupervised classification and consensus nonnegative matrix factorization analysis, respectively. Functional status of epithelial clusters was annotated by CancerSEA and its crosstalk with TME cells was investigated using CellPhoneDB and correlation analysis. Findings from single-cell transcription data were further validated in bulk-RNA sequencing data and pathological tissue data.<h4>Results</h4>A distinct cellular composition was observed between tumor and normal tissues, and tumors exhibited immunosuppressive phenotypes. Regarding epithelial cells, we identified one highly invasiveQuery cluster, C4, that correlated closely with tumor-associated macrophages (TAMs) and cancer-associated fibroblasts (CAFs). Further analysis emphasized the TAMs subclass TAM1 and CAFs subclass S5 are closely related with C4.<h4>Conclusions</h4>In summary, our study elaborates on the cellular heterogeneity of CRC, revealing that TAMs and CAFs were critical for crosstalk network epithelial cells and TME cells. This in-depth understanding of cancer cell-TME network provided theoretical basis for the development of new drugs targeting this sophisticated network in CRC.

Also flagged:Intrahepatic cholangiocarcinomaperoxiredoxin 6calcium-independent phospholipase A2iPLA2glutathione peroxidaseGPx
Journal Article 2022-10-08 ✓ 5 Snippets Li H, Wu Z, Zhong R, Zhang Q, Chen Q, Shen Y.
In-Text Gene Mentions

Immunostaining showed lower protein expression of Wnt7a, Wnt7b, Mmp7 and Ccnd2 in tumor tissues of the PRDX6 knockout group compared to the wild-type group (Fig. 5B).

Sequencing results showed that Wnt7a, Wnt7b, Fzd2, Mmp7 and Ccnd2 in the Wnt signaling pathway were downregulated after PRDX6 knockout, suggesting that this signaling pathway may be involved in the regulation of PRDX6's cancer-promoting effect.

We confirmed that gene expressions in the Wnt7a/b cascade were inhibited in ICC tissues after PRDX6 knockout by using qRT-PCR and immunohistochemistry analysis.

After the ICC model was established in PRDX6 knockout rats, malignant progression and Ki67 positive cells in the knockout group were reduced, indicating that PRDX6 knockout affects the progression of ICC.

PRDX6 may promote the occurrence and development of ICC by regulating Wnt7a/Mmp7 in cancer cells and Wnt7b/Ccnd2 in macrophages.

Show Full Abstract

Intrahepatic cholangiocarcinoma (ICC) has a poor prognosis. The bifunctional protein peroxiredoxin 6 (PRDX6), which has both calcium-independent phospholipase A2 (iPLA2) and glutathione peroxidase (GPx) activity, participates in the development of multiple tumors. However, the function and clinical significance of PRDX6 in ICC remain unclear. In this study, we characterized PRDX6 in both human ICC and thioacetamide (TAA)-induced rat ICC. We found PRDX6 was significantly increased in ICC tissues, compared with the peritumoral tissues, and PRDX6 expression level was positively correlated with the malignant phenotype in ICC patients. Furthermore, PRDX6 genetic knockout significantly inhibited the tumor progression in rats. By using RNA sequencing analysis, we found 127 upregulated genes and 321 downregulated genes after PRDX6 knockout. In addition, we noticed a significant repression in the Wnt7a/b cascade, which has been shown to play an important role in the occurrence of ICC. We confirmed that gene expressions in the Wnt7a/b cascade were inhibited in ICC tissues after PRDX6 knockout by using qRT-PCR and immunohistochemistry analysis. Collectively, our findings suggest that PRDX6 may promote ICC by regulating the Wnt7a/b pathway, which could be a novel therapeutic target for ICC.

Also flagged:hyperplastic polypHPserrated adenomadysplasiaserrated neoplasiaadenoma
Journal Article 2022-10-08 ✓ 5 Snippets Zhou YJ, Lu XF, Chen H, Wang XY, Cheng W, Zhang QW, Chen JN, Wang XY, Jin JZ, Yan FR, Chen H, Li XB.
In-Text Gene Mentions

…synthase component ATP5MC1,OLFM4+ , and…

…of Epi-SL includedOLFM4(intestinal stem cell…

…of Ki67 hiOLFM4hi Epithelial Cells…

…stem cell markerOLFM4, HES1, and JUN,…

…subcluster (MKI67 hiOLFM4hi SSL-specific).…

Show Full Abstract

<h4>Background & aims</h4>Approximately one-third of colorectal cancers develop from serrated lesions (SLs), including hyperplastic polyp (HP), sessile serrated lesion (SSL), traditional serrated adenoma (TSA), and SSL with dysplasia (SSLD) through the serrated neoplasia pathway, which progresses faster than the conventional adenoma-carcinoma pathway. We sought to depict the currently unclarified molecular and immune alterations by the single-cell landscape in SLs.<h4>Methods</h4>We performed single-cell RNA sequencing of 16 SLs (including 4 proximal HPs, 5 SSLs, 2 SSLDs, and 5 TSAs) vs 3 normal colonic tissues.<h4>Results</h4>A total of 60,568 high-quality cells were obtained. Two distinct epithelial clusters with redox imbalance in SLs were observed, along with upregulation of tumor-promoting SerpinB6 that regulated ROS level. Epithelial clusters of SSL and TSA showed distinct molecular features: SSL-specific epithelium manifested overexpressed proliferative markers with Notch pathway activation, whereas TSA-specific epithelium showed Paneth cell metaplasia with aberrant lysozyme expression. As for immune contexture, enhanced cytotoxic activity of CD8<sup>+</sup> T cells was observed in SLs; it was mainly attributable to increased proportion of CD103<sup>+</sup>CD8<sup>+</sup> tissue-resident memory T cells, which might be regulated by retinoic acid metabolism. Microenvironment of SLs was generally immune-activated, whereas some immunosuppressive cells (regulatory T cells, anti-inflammatory macrophages, MDK<sup>+</sup>IgA<sup>+</sup> plasma cells, MMP11-secreting PDGFRA<sup>+</sup> fibroblasts) also emerged at early stage and further accumulated in SSLD.<h4>Conclusion</h4>Epithelial, immune, and stromal components in the serrated pathway undergo fundamental alterations. Future molecular subtypes of SLs and potential immune therapy might be developed.

Also flagged:ANPEPaminopeptidase NRASangiotensin(Ang) IIIAng IV
Journal Article 2022-10-08 ✓ 1 Snippet Kim JH, Afridi R, Cho E, Yoon JH, Lim YH, Lee HW, Ryu H, Suk K.
In-Text Gene Mentions

…C4A, CFH, andSERPINC1were associated with…

Show Full Abstract

Astrocytes are major supportive glia and immune modulators in the brain; they are highly secretory in nature and interact with other cell types via their secreted proteomes. To understand how astrocytes communicate during neuroinflammation, we profiled the secretome of human astrocytes following stimulation with proinflammatory factors. A total of 149 proteins were significantly upregulated in stimulated astrocytes, and a bioinformatics analysis of the astrocyte secretome revealed that the brain renin-angiotensin system (RAS) is an important mechanism of astrocyte communication. We observed that the levels of soluble form of aminopeptidase N (sANPEP), an RAS component that converts angiotensin (Ang) III to Ang IV in a neuroinflammatory milieu, significantly increased in the astrocyte secretome. To elucidate the role of sANPEP and Ang IV in neuroinflammation, we first evaluated the expression of Ang IV receptors in human glial cells because Ang IV mediates biological effects through its receptors. The expression of angiotensin type 1 receptor was considerably upregulated in activated human microglial cells but not in human astrocytes. Moreover, interleukin-1β release from human microglial cells was synergistically increased by cotreatment with sANPEP and its substrate, Ang III, suggesting the proinflammatory action of Ang IV generated by sANPEP. In a mouse neuroinflammation model, brain microglial activation and proinflammatory cytokine expression levels were increased by intracerebroventricular injection of sANPEP and attenuated by an enzymatic inhibitor and neutralizing antibody against sANPEP. Collectively, our results indicate that astrocytic sANPEP-induced increase in Ang IV exacerbates neuroinflammation by interacting with microglial proinflammatory receptor angiotensin type 1 receptor, highlighting an important role of indirect crosstalk between astrocytes and microglia through the brain RAS in neuroinflammation.

Also flagged:Huntington's diseaseHDantibodies
Journal Article 2022-10-08 ✓ 5 Snippets Layburn FE, Tan AYS, Mehrabi NF, Curtis MA, Tippett LJ, Turner CP, Riguet N, Aeschbach L, Lashuel HA, Dragunow M, Faull RLM, Singh-Bains MK.
In-Text Gene Mentions

Mutant Htt is a current target for novel therapeutic strategies for HD, however, the lack of translation from preclinical research to disease-modifying treatments highlights the need to improve our understanding of the role of Htt protein in the human brain.

MAB5374, MW1, and EPR5526 Htt aggregate numbers were positively correlated with CAG repeat length, and negatively correlated with the age of symptom onset in HD.

Huntington's disease (HD) is caused by a CAG repeat expansion mutation in the gene encoding the huntingtin (Htt) protein, with mutant Htt protein subsequently forming aggregates within the brain.

Together, these results suggest that longer CAG repeat lengths correlate with Htt aggregation in the HD human brain, and greater Htt cortical aggregate deposition is associated with an earlier age of symptom onset in HD.

This study also reinforces that antibodies MAB5492, MW8, and 2B7 which have been utilized to characterize Htt in animal models of HD do not specifically immunolabel Htt aggregates in HD human brain tissue exclusively, thereby highlighting the need for validated means of Htt detection to support drug development for HD.

Show Full Abstract

Huntington's disease (HD) is caused by a CAG repeat expansion mutation in the gene encoding the huntingtin (Htt) protein, with mutant Htt protein subsequently forming aggregates within the brain. Mutant Htt is a current target for novel therapeutic strategies for HD, however, the lack of translation from preclinical research to disease-modifying treatments highlights the need to improve our understanding of the role of Htt protein in the human brain. This study aims to undertake an immunohistochemical screen of 12 candidate antibodies against various sequences along the Htt protein to characterize Htt distribution and expression in post-mortem human brain tissue microarrays (TMAs). Immunohistochemistry was performed on middle temporal gyrus TMAs comprising of up to 28 HD and 27 age-matched control cases, using 12 antibodies specific to various sequences along the Htt protein. From this study, six antibodies directed to the Htt N-terminus successfully immunolabeled human brain tissue. Htt aggregates and Htt protein expression levels for the six successful antibodies were subsequently quantified with a customized automated image analysis pipeline on the TMAs. A 2.5-12 fold increase in the number of Htt aggregates were detected in HD cases using antibodies MAB5374, MW1, and EPR5526, despite no change in overall Htt protein expression compared to control cases, suggesting a redistribution of Htt into aggregates in HD. MAB5374, MW1, and EPR5526 Htt aggregate numbers were positively correlated with CAG repeat length, and negatively correlated with the age of symptom onset in HD. However, the number of Htt aggregates did not correlate with the degree of striatal degeneration or the degree of cortical neuron loss. Together, these results suggest that longer CAG repeat lengths correlate with Htt aggregation in the HD human brain, and greater Htt cortical aggregate deposition is associated with an earlier age of symptom onset in HD. This study also reinforces that antibodies MAB5492, MW8, and 2B7 which have been utilized to characterize Htt in animal models of HD do not specifically immunolabel Htt aggregates in HD human brain tissue exclusively, thereby highlighting the need for validated means of Htt detection to support drug development for HD.

Also flagged:Nano-HydroxyapatitesHydroxyapatiteinflammation responseinflammatory responseimmune response
Journal Article 2022-10-08 No Snippets Zhao DW, Fan XC, Zhao YX, Zhao W, Zhang YQ, Zhang RH, Cheng L.
Show Full Abstract

Research on regulation of the immune microenvironment based on bioactive materials is important to osteogenic regeneration. Hydroxyapatite (HAP) is believed to be a promising scaffold material for dental and orthopedic implantation due to its ideal biocompatibility and high osteoconductivity. However, any severe inflammation response can lead to loosening and fall of implantation, which cause implant failures in the clinic. Morphology modification has been widely studied to regulate the host immune environment and to further promote bone regeneration. Here, we report the preparation of nHAPs, which have uniform rod-like shape and different size (200 nm and 400 nm in length). The morphology, biocompatibility, and anti-inflammatory properties were evaluated. The results showed that the 400 nm nHAPs exhibited excellent biocompatibility and osteoimmunomodulation, which can not only induce M2-phenotype macrophages (M2) polarization to decrease the production of inflammatory cytokines, but also promote the production of osteogenic factor. The reported 400 nm nHAPs are promising for osteoimmunomodulation in bone regeneration, which is beneficial for clinical application of bone defects.

Also flagged:osteoporosisironhereditary hemochromatosisHHmetabolic diseasechromosome
Journal Article 2022-10-08 ✓ 5 Snippets Taujan GC, Iconaru L, Rosu M, Kosmopoulou OA, Papadopoulou IB, Baleanu F.
In-Text Gene Mentions

…be affected byhemochromatosisinclude the liver,…

…mutations in theHFEgene, located on…

…be categorized asHFE‐related and non‐HFE related.…

…as HFE‐related and non‐HFErelated.…

…the prevalence ofHFE‐unrelated HH is about…

Show Full Abstract

Besides important metabolic repercussions, iron overload is reported to be associated with deleterious effects on articulations and bones. We present the case of a male patient diagnosed with severe osteoporosis and vertebral fracture, in whom the evaluation for secondary osteoporosis revealed hereditary hemochromatosis.

Also flagged:ATG7OsteosarcomaGene ExpressionferroptosisCBSMUC1
Journal Article 2022-10-08 ✓ 5 Snippets Jiang R, He S, Gong H, Wang Y, Wei W, Chen J, Hu J, Ye C, LiuHuang S, Jin S, Wei H, Xu W, Xiao J.
In-Text Gene Mentions

In summary, 3 genes in the prognostic signature (ATG7, SOCS1, and PEBP1) were reported to facilitate ferroptosis in tumor cells, while the remaining two genes (CBS, MUC1) are the opposite.

In addition, Phosphatidylethanolamine Binding Protein 1 (PEBP1) induced ferroptosis in epithelial cells by generating hydroperoxy-phosphatidylethanolamine [46] and was involved in the cell death process in hepatocellular carcinoma by regulating ferroptosis [47].

…ATG7, SOCS1, andPEBP1) was developed, and…

…(ATG7, SOCS1, andPEBP1).…

…+ (−0.7295 ∗PEBP1exp.).…

Show Full Abstract

<h4>Background</h4>Ferroptosis has gained significant attention from oncologists as a vital outcome of oxidative stress. The aim of this study was to develop a prognostic signature that was based on the ferroptosis-related genes (FRGs) for osteosarcoma patients and explore their specific role in osteosarcoma.<h4>Methods</h4>The training cohort dataset was extracted from the Therapeutically Applicable Research to Generate Effective Treatments (TARGET) database. Different techniques like the univariate Cox regression, least absolute shrinkage and selection operator (LASSO) regression, multivariate Cox regression analyses, and the Kaplan-Meier (KM) survival analyses were utilized to develop a prognostic signature. Then, the intrinsic relationship between the developed gene signature and the infiltration levels of the immune cells was further investigated. An external validation dataset from the Gene Expression Omnibus (GEO) database was employed to assess the predictive ability of the developed gene signature. Subsequently, the specific function of potential FRG in affecting the oxidative stress reaction and ferroptosis of osteosarcoma cells was identified.<h4>Results</h4>A prognostic signature based on 5 FRGs (CBS, MUC1, ATG7, SOCS1, and PEBP1) was developed, and the patients were classified into the low- and high-risk groups (categories). High-risk patients displayed poor overall survival outcomes. The risk level was seen to be an independent risk factor for determining the prognosis of osteosarcoma patients (<i>p</i> < 0.001, hazard ratio: 7.457, 95% CI: 3.302-16.837). Additionally, the risk level was associated with immune function, which might affect the survival status of osteosarcoma patients. Moreover, the findings of the study indicated that the expression of ATG7 was related to the regulation of oxidative stress in osteosarcoma. Silencing the ATG7 gene promoted the proliferation and migration in osteosarcoma cells, suppressing the oxidative stress and ferroptosis process.<h4>Conclusions</h4>A novel FRG signature was developed in this study to predict the prognosis of osteosarcoma patients. The results indicated that ATG7 might regulate the process of oxidative stress and ferroptosis in osteosarcoma cells and could be used as a potential target to develop therapeutic strategies for treating osteosarcoma.

Also flagged:cDNAmRNAPLAC8-codingtransporting V0IFNG
Journal Article 2022-10-08 ✓ 1 Snippet Pham PH, Tockovska T, Leacy A, Iverson M, Ricker N, Susta L.
In-Text Gene Mentions

…synthase 1), andSHISA6(shisa family member…

Show Full Abstract

Aquatic bird bornavirus 1 (ABBV-1) is a neurotropic virus that infects waterfowls, resulting in persistent infection. Experimental infection showed that both Muscovy ducks and chickens support persistent ABBV-1 infection in the central nervous system (CNS), up to 12 weeks post-infection (wpi), without the development of clinical disease. The aim of the present study was to describe the transcriptomic profiles in the brains of experimentally infected Muscovy ducks and chickens infected with ABBV-1 at 4 and 12 wpi. Transcribed RNA was sequenced by next-generation sequencing and analyzed by principal component analysis (PCA) and differential gene expression. The functional annotation of differentially expressed genes was evaluated by gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. The PCA showed that the infected ducks sampled at both 4 and 12 wpi clustered separately from the controls, while only the samples from the chickens at 12 wpi, but not at 4 wpi, formed a separate cluster. In the ducks, more genes were differentially expressed at 4 wpi than 12 wpi, and the majority of the highly differentially expressed genes (DEG) were upregulated. On the other hand, the infected chickens had fewer DEGs at 4 wpi than at 12 wpi, and the majority of those with high numbers of DEGs were downregulated at 4 wpi and upregulated at 12 wpi. The functional annotation showed that the most enriched GO terms were immune-associated in both species; however, the terms associated with the innate immune response were predominantly enriched in the ducks, whereas the chickens had enrichment of both the innate and adaptive immune response. Immune-associated pathways were also enriched according to the KEGG pathway analysis in both species. Overall, the transcriptomic analysis of the duck and chicken brains showed that the main biological responses to ABBV-1 infection were immune-associated and corresponded with the levels of inflammation in the CNS.

Also flagged:cerebellinNMDA-receptorsynapsesAMPA-receptorssynapse formationCbln2
Journal Article 2022-10-07 ✓ 3 Snippets Dai J, Liakath-Ali K, Golf SR, Südhof TC.
In-Text Gene Mentions

…neogenin-1 (Neo1) andDCC( Wei et…

…Cbln2) or to Neo1/DCC(Cbln4), cerebellins are…

…to Neogenin-1 andDCC, while biophysical studies…

Show Full Abstract

At CA1→subiculum synapses, alternatively spliced neurexin-1 (Nrxn1<sup>SS4+</sup>) and neurexin-3 (Nrxn3<sup>SS4+</sup>) enhance NMDA-receptors and suppress AMPA-receptors, respectively, without affecting synapse formation. Nrxn1<sup>SS4+</sup> and Nrxn3<sup>SS4+</sup> act by binding to secreted cerebellin-2 (Cbln2) that in turn activates postsynaptic GluD1 receptors. Whether neurexin-Cbln2-GluD1 signaling has additional functions besides regulating NMDA- and AMPA-receptors, and whether such signaling performs similar roles at other synapses, however, remains unknown. Here, we demonstrate using constitutive Cbln2 deletions in mice that at CA1→subiculum synapses, Cbln2 performs no additional developmental roles besides regulating AMPA- and NMDA-receptors. Moreover, low-level expression of functionally redundant Cbln1 did not compensate for a possible synapse-formation function of Cbln2 at CA1→subiculum synapses. In exploring the generality of these findings, we examined the prefrontal cortex where Cbln2 was recently implicated in spinogenesis, and the cerebellum where Cbln1 is known to regulate parallel-fiber synapses. In the prefrontal cortex, Nrxn1<sup>SS4+</sup>-Cbln2 signaling selectively controlled NMDA-receptors without affecting spine or synapse numbers, whereas Nrxn3<sup>SS4+</sup>-Cbln2 signaling had no apparent role. In the cerebellum, conversely, Nrxn3<sup>SS4+</sup>-Cbln1 signaling regulated AMPA-receptors, whereas now Nrxn1<sup>SS4+</sup>-Cbln1 signaling had no manifest effect. Thus, Nrxn1<sup>SS4+</sup>- and Nrxn3<sup>SS4+</sup>-Cbln1/2 signaling complexes differentially control NMDA- and AMPA-receptors in different synapses in diverse neural circuits without regulating synapse or spine formation.

Also flagged:membrane proteinslocalizationlocalizationsanion exchangersSLC17organic anion transporters
Journal Article 2022-10-07 ✓ 5 Snippets Tan HL, Bungert-Plümke S, Kortzak D, Fahlke C, Stölting G.
In-Text Gene Mentions

…UsingDCC-SMLM, we determined the…

…UsingDCC-SMLM to determine the…

…states using theDCCmodel ( Equation…

…as in ourDCC-SMLM experiments ( Figure…

…single oligomeric state,DCC-SMLM counting can only…

Show Full Abstract

The oligomeric state of plasma membrane proteins is the result of the interactions between individual subunits and an important determinant of their function. Most approaches used to address this question rely on extracting these complexes from their native environment, which may disrupt weaker interactions. Therefore, microscopy techniques have been increasingly used in recent years to determine oligomeric states in situ. Classical light microscopy suffers from insufficient resolution, but super-resolution methods such as single molecule localization microscopy (SMLM) can circumvent this problem. When using SMLM to determine oligomeric states of proteins, subunits are labeled with fluorescent proteins that only emit light following activation or conversion at different wavelengths. Typically, individual molecules are counted based on a binomial distribution analysis of emission events detected within the same diffraction-limited volume. This strategy requires low background noise, a high recall rate for the fluorescent tag and intensive post-imaging data processing. To overcome these limitations, we developed a new method based on SMLM to determine the oligomeric state of plasma membrane proteins. Our dual-color colocalization (DCC) approach allows for accurate in situ counting even with low efficiencies of fluorescent protein detection. In addition, it is robust in the presence of background signals and does not require temporal clustering of localizations from individual proteins within the same diffraction-limited volume, which greatly simplifies data acquisition and processing. We used DCC-SMLM to resolve the controversy surrounding the oligomeric state of two SLC26 multifunctional anion exchangers and to determine the oligomeric state of four members of the SLC17 family of organic anion transporters.

Also flagged:HDbehavioralgenetic neurodegenerative disorderneurodegenerative disordermitochondrialcalcium
Journal Article 2022-10-07 ✓ 5 Snippets Weiss AR, Liguore WA, Brandon K, Wang X, Liu Z, Domire JS, Button D, Srinivasan S, Kroenke CD, McBride JL.
In-Text Gene Mentions

Huntington’s disease (HD) is a genetic, progressive neurodegenerative disorder caused by an expanded CAG/CAA repeat in exon 1 of the HTT gene (Sapp et al., 2001).

…of human mutantHTT( mHTT )…

…1 of theHTTgene ( Sapp…

…repeats, the encodedHTTprotein misfolds and…

…), both bearingHTTgenes with expanded…

Show Full Abstract

We created a new nonhuman primate model of the genetic neurodegenerative disorder Huntington's disease (HD) by injecting a mixture of recombinant adeno-associated viral vectors, serotypes AAV2 and AAV2.retro, each expressing a fragment of human mutant <i>HTT</i> (<i>mHTT</i>) into the caudate and putamen of adult rhesus macaques. This modeling strategy results in expression of mutant huntingtin protein (mHTT) and aggregate formation in the injected brain regions, as well as dozens of other cortical and subcortical brain regions affected in human HD patients. We queried the disruption of cortico-basal ganglia circuitry for 30 months post-surgery using a variety of behavioral and imaging readouts. Compared to controls, mHTT-treated macaques developed working memory decline and progressive motor impairment. Multimodal imaging revealed circuit-wide white and gray matter degenerative processes in several key brain regions affected in HD. Taken together, we have developed a novel macaque model of HD that may be used to develop disease biomarkers and screen promising therapeutics.

Also flagged:restriction modification enzymesCRISPRCas9Cas13CasCRISPR-Cas
Journal Article 2022-10-07 No Snippets Cui N, Faure G, Singh A, Macrae R, Zhang F.
Show Full Abstract

Many powerful molecular biology tools have their origins in natural systems, including restriction modification enzymes and the CRISPR effectors, Cas9, Cas12, and Cas13. Heightened interest in these systems has led to mining of genomic and metagenomic data to identify new orthologs of these proteins, new types of CRISPR systems, and uncharacterized natural systems with novel mechanisms. To accelerate metagenomic mining, we developed a high-throughput, low-cost droplet microfluidic-based method for enrichment of rare sequences in a mixed starting population. Using a computational pipeline, we then searched in the enriched data for the presence of CRISPR-Cas systems, identifying a previously unknown CRISPR-Cas system. Our approach enables researchers to efficiently mine metagenomic samples for sequences of interest, greatly accelerating the search for nature's treasures.

Also flagged:antibodyBCRantigencell maturationCD4class switching
Journal Article 2022-10-07 ✓ 1 Snippet Robinson AM, Higgins BW, Shuparski AG, Miller KB, McHeyzer-Williams LJ, McHeyzer-Williams MG.
In-Text Gene Mentions

Rc3h1

Show Full Abstract

Understanding how follicular helper T cells (TFH) regulate the specialization, maturation, and differentiation of adaptive B cell immunity is crucial for developing durable high-affinity immune protection. Using indexed single-cell molecular strategies, we reveal a skewed intraclonal assortment of higher-affinity T cell receptors and the distinct molecular programming of the localized TFH compartment compared with emigrant conventional effector T<sub>H</sub> cells. We find a temporal shift in B cell receptor class switch, which permits identification of inflammatory and anti-inflammatory modules of transcriptional programming that subspecialize TFH function before and during the germinal center (GC) reaction. Late collapse of this local primary GC reaction reveals a persistent post-GC TFH population that discloses a putative memory TFH program. These studies define subspecialized antigen-specific TFH transcriptional programs that progressively change with antibody class-specific evolution of high-affinity B cell immunity and a memory TFH transcriptional program that emerges upon local GC resolution.

Also flagged:Chromosomeorganizationadenosine triphosphatebindingcell cyclesporulation
Journal Article 2022-10-07 ✓ 5 Snippets Roberts DM, Anchimiuk A, Kloosterman TG, Murray H, Wu LJ, Gruber S, Errington J.
In-Text Gene Mentions

…Chromosome remodelling by SMC/Condensinin B. subtilis…

…The conserved SMC/Condensincomplexes, loaded by…

…act to prevent SMC/Condensincomplex release onto…

…loading of the SMC/Condensincomplex at Spo0J-…

…which act after SMC/Condensinloading at parS…

Show Full Abstract

SMC complexes, loaded at ParB-<i>parS</i> sites, are key mediators of chromosome organization in bacteria. ParA/Soj proteins interact with ParB/Spo0J in a pathway involving adenosine triphosphate (ATP)-dependent dimerization and DNA binding, facilitating chromosome segregation in bacteria. In <i>Bacillus subtilis</i>, ParA/Soj also regulates DNA replication initiation and along with ParB/Spo0J is involved in cell cycle changes during endospore formation. The first morphological stage in sporulation is the formation of an elongated chromosome structure called an axial filament. Here, we show that a major redistribution of SMC complexes drives axial filament formation in a process regulated by ParA/Soj. Furthermore, and unexpectedly, this regulation is dependent on monomeric forms of ParA/Soj that cannot bind DNA or hydrolyze ATP. These results reveal additional roles for ParA/Soj proteins in the regulation of SMC dynamics in bacteria and yet further complexity in the web of interactions involving chromosome replication, segregation and organization, controlled by ParAB and SMC.

Also flagged:methylationNucleotidemetabolismNotchWntinflammatory response
Journal Article 2022-10-07 No Snippets Kothiyal P, Eley G, Ilangovan H, Hoadley KA, Elgart SR, Mao XW, Eslami P.
Show Full Abstract

The space environment includes unique hazards like radiation and microgravity which can adversely affect biological systems. We assessed a multi-omics NASA GeneLab dataset where mice were hindlimb unloaded and/or gamma irradiated for 21 days followed by retinal analysis at 7 days, 1 month or 4 months post-exposure. We compared time-matched epigenomic and transcriptomic retinal profiles resulting in a total of 4178 differentially methylated loci or regions, and 457 differentially expressed genes. Highest correlation in methylation difference was seen across different conditions at the same time point. Nucleotide metabolism biological processes were enriched in all groups with activation at 1 month and suppression at 7 days and 4 months. Genes and processes related to Notch and Wnt signaling showed alterations 4 months post-exposure. A total of 23 genes showed significant changes in methylation and expression compared to unexposed controls, including genes involved in retinal function and inflammatory response. This multi-omics analysis interrogates the epigenomic and transcriptomic impacts of radiation and hindlimb unloading on the retina in isolation and in combination and highlights important molecular mechanisms at different post-exposure stages.

Also flagged:TRPM8LEPRCRB1SFI1behaviouralfatty-acid
Journal Article 2022-10-07 No Snippets Pirri F, Ometto L, Fuselli S, Fernandes FAN, Ancona L, Perta N, Di Marino D, Le Bohec C, Zane L, Trucchi E.
Show Full Abstract

The eco-evolutionary history of penguins is characterised by shifting from temperate to cold environments. Breeding in Antarctica, the Emperor penguin appears as an extreme outcome of this process, with unique features related to insulation, heat production and energy management. However, whether this species actually diverged from a less cold-adapted ancestor, more ecologically similar to its sister species, the King penguin, is still an open question. As the Antarctic colonisation likely resulted in vast changes in selective pressure experienced by the Emperor penguin, the relative quantification of the genomic signatures of selection, unique to each sister species, could answer this question. Applying phylogeny-based selection tests on 7651 orthologous genes, we identified a more pervasive selection shift in the Emperor penguin than in the King penguin, supporting the hypothesis that its extreme cold adaptation is a derived state. Furthermore, among candidate genes under selection, four (TRPM8, LEPR, CRB1, and SFI1) were identified before in other cold-adapted homeotherms, like the woolly Mammoth, while other 161 genes can be assigned to biological functions relevant to cold adaptation identified in previous studies. Location and structural effects of TRPM8 substitutions in Emperor and King penguin lineages support their functional role with putative divergent effects on thermal adaptation. We conclude that extreme cold adaptation in the Emperor penguin largely involved unique genetic options which, however, affect metabolic and physiological traits common to other cold-adapted homeotherms.

Also flagged:Dendrimer-4-PhenylbutyrateNeurological DeficitsX-linked adrenoleukodystrophygenetic disordercerebral demyelinating diseasechildhood
Journal Article 2022-10-07 No Snippets Nemeth CL, Gӧk Ö, Tomlinson SN, Sharma A, Moser AB, Kannan S, Kannan RM, Fatemi A.
Show Full Abstract

X-linked adrenoleukodystrophy (ALD) is a genetic disorder that presents neurologically as either a rapid and fatal cerebral demyelinating disease in childhood (childhood cerebral adrenoleukodystrophy; ccALD) or slow degeneration of the spinal cord in adulthood (adrenomyeloneuropathy; AMN). All forms of ALD result from mutations in the ATP Binding Cassette Subfamily D Member (ABCD) 1 gene, encoding a peroxisomal transporter responsible for the import of very long chain fatty acids (VLCFA) and results mechanistically in a complex array of dysfunction, including endoplasmic reticulum stress, oxidative stress, mitochondrial dysfunction, and inflammation. Few therapeutic options exist for these patients; however, an additional peroxisomal transport protein (ABCD2) has been successfully targeted previously for compensation of dysfunctional ABCD1. 4-Phenylbutyrate (4PBA), a potent activator of the ABCD1 homolog ABCD2, is FDA approved, but use for ALD has been stymied by a short half-life and thus a need for unfeasibly high doses. We conjugated 4PBA to hydroxyl polyamidoamine (PAMAM) dendrimers (D-4PBA) to a create a long-lasting and intracellularly targeted approach which crosses the blood-brain barrier to upregulate Abcd2 and its downstream pathways. Across two studies, Abcd1 knockout mice administered D-4PBA long term showed neurobehavioral improvement and increased Abcd2 expression. Furthermore, when the conjugate was administered early, significant reduction of VLCFA and improved survival of spinal cord neurons was observed. Taken together, these data show improved efficacy of D-4PBA compared to previous studies of free 4PBA alone, and promise for D-4PBA in the treatment of complex and chronic neurodegenerative diseases using a dendrimer delivery platform that has shown successes in recent clinical trials. While recovery in our studies was partial, combined therapies on the dendrimer platform may offer a safe and complete strategy for treatment of ALD.

Also flagged:gene expressioniNOSvasodilationPtgs2Edn1portal hypertension
Journal Article 2022-10-07 ✓ 4 Snippets Arlt J, Vlaic S, Feuer R, Thomas M, Settmacher U, Dahmen U, Dirsch O.
In-Text Gene Mentions

The selected marker genes of these four mechanisms were as follows: The NO pathway was represented by the marker genes eNOS, iNOS, nNOS, and Gucy1a2, the arachidonic acid pathway by the marker genes Pla2g4a, Ptgs1, Ptgs2, Ptgis, Tbxas1, Tbxa2r, the endothelin pathway by the marker genes Edn1, ET-RA, and ET-RB, and the adenosine-based HABR was represented by the marker genes Adora1, Adora2a, and Adora3 (Fig. 1).

…Pla2g4a, Ptgs1, Ptgs2,Ptgis, Tbxas1, Tbxa2r, the…

…into prostacyclin byPtgisand acts as…

…Pla2g4a, Ptgs1, Ptgs2,Ptgis, Tbxas1, and Tbxa2r…

Show Full Abstract

<h4>Background</h4>In previous studies, five vasoactive drugs were investigated for their effect on the recovery process after extended liver resection without observing relevant improvements. We hypothesized that an analysis of gene expression could help to identify potentially druggable pathways and could support the selection of promising drug candidates.<h4>Methods</h4>Liver samples obtained from rats after combined 70% partial hepatectomy and right median hepatic vein ligation (n = 6/group) sacrificed at 0 h, 24 h, 48 h, and 7days were selected for this study. Liver samples were collected from differentially perfused regions of the median lobe (obstruction-zone, border-zone, normal-zone). Gene expression profiling of marker genes regulating hepatic hemodynamics, vascular remodeling, and liver regeneration was performed with microfluidic chips. We used 3 technical replicates from each sample. Raw data were normalized using LEMming and differentially expressed genes were identified using LIMMA.<h4>Results</h4>The strongest differences were found in obstruction-zone at 24 h and 48 h postoperatively compared to all other groups. mRNA expression of marker genes from hepatic hemodynamics pathways (iNOS,Ptgs2,Edn1) was most upregulated.<h4>Conclusion</h4>These upregulated genes suggest a strong vasoconstrictive effect promoting arterial hypoperfusion in the obstruction-zone. Reducing iNOS expression using selective iNOS inhibitors seems to be a promising approach to promote vasodilation and liver regeneration.

Also flagged:arsenitediabetesgene expressionsarsenicgene expressionTranscription factor
Journal Article 2022-10-07 ✓ 1 Snippet Shang B, Venkatratnam A, Hartwell H, Douillet C, Cable P, Liu T, Zou F, Ideraabdullah FY, Fry RC, Stýblo M.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

We have previously reported that preconception exposure to iAs may contribute to the development of diabetes in mouse offspring by altering gene expressions in paternal sperm. However, the individual contributions of iAs and its methylated metabolites, monomethylated arsenic (MAs) and dimethylated arsenic (DMAs), to changes in the sperm transcriptome could not be determined because all three As species are present in sperm after in vivo iAs exposure. The goal of the present study was to assess As species-specific effects using an ex vivo model. We exposed freshly isolated mouse sperm to either 0.1 or 1 μM arsenite (iAs<sup>III</sup>) or the methylated trivalent arsenicals, MAs<sup>III</sup> and DMAs<sup>III</sup>, and used RNA-sequencing to identify differentially expressed genes, enriched pathways, and associated protein networks. For all arsenicals tested, the exposures to 0.1 μM concentrations had greater effects on gene expression than 1 μM exposures. Transcription factor AP-1 and B cell receptor complexes were the most significantly enriched pathways in sperm exposed to 0.1 μM iAs<sup>III</sup>. The Mre11 complex and Antigen processing were top pathways targeted by exposure to 0.1 μM MAs<sup>III</sup> and DMAs<sup>III</sup>, respectively. While there was no overlap between gene transcripts altered by ex vivo exposures in the present study and those altered by in vivo exposure in our prior work, several pathways were shared, including PI3K-Akt signaling, Focal adhesion, and Extracellular matrix receptor interaction pathways. Notably, the protein networks associated with these pathways included those with known roles in diabetes. This study is the first to assess the As species-specific effects on sperm transcriptome, linking these effects to the diabetogenic effects of iAs exposure.

Also flagged:CytokinesChronic liver diseasecirrhosishepatocellular carcinomaliver cirrhosiscytokine
Journal Article 2022-10-07 ✓ 1 Snippet Beudeker BJB, Groothuismink ZMA, van der Eijk AA, Debes JD, Boonstra A.
In-Text Gene Mentions

…auto-immune liver disease,hemochromatosis, Wilson’s disease, antitrypsi…

Show Full Abstract

Background and Aims: Chronic liver disease—from any etiology—can progress to fibrosis, cirrhosis and hepatocellular carcinoma (HCC). The progression of liver cirrhosis to the end stages of disease is influenced by a variety of factors, including inflammatory cytokines. We pursued a study of cytokine-mediated inflammatory responses in hepatitis B (HBV), hepatitis C (HCV), alcoholic liver disease (ALD) and non-alcoholic fatty liver disease (NAFLD) patients with liver cirrhosis. Methods: Immune profiles were determined through the serum multiplex profiling of >100 cytokines in a 188 cirrhotic patients, 35 healthy controls and 196 early-stage HCC patients. Results: Patients with liver cirrhosis exhibited a vast upregulation of proinflammatory cytokines (p < 0.0001), including those with pro-oncogenic features, when compared to healthy individuals. In contrast to prevailing assumptions, each etiological cause of cirrhosis exhibited a unique cytokine profile in blood. Regardless of antiviral therapy, HBV cirrhosis patients had the largest number of upregulated proinflammatory mediators, compared to HCV, ALD and NAFLD (p < 0.0001). To further evaluate the etiology-dependent modulation of cytokine response in relation to liver cancer, we studied cytokine profiles in early-stage HCC patients strictly stratified by underlying liver disease. We observed unique sets of differentially expressed cytokines in each cohort of early-stage HCC patients of different cirrhosis etiologies. Conclusions: Our findings, therefore, underscore the importance of stratification by the etiological cause of liver cirrhosis in immune-based studies.

Also flagged:MAPKchromatincancermitogen-activated protein kinasescell proliferationcell surface
Journal Article 2022-10-07 ✓ 3 Snippets Wang Q, Feng J, Tang L.
In-Text Gene Mentions
⭐ same-sentence co-mention

HCC: hepatocellular carcinoma; ICC: intrahepatic cholangiocarcinoma; cHCC–CCA: combined hepatocellular carcinoma–cholangiocarcinoma; HBV: hepatitis B virus; HCV: hepatitis C virus; MAPK: mitogen activated protein kinase; ERK: extracellular signal-regulated kinase; JNK: c-Jun N-terminal kinase; SAPK: stress-activated protein kinase; NcRNAs: non-coding RNAs; LncRNA: long non-coding RNA; miRNA: microRNA; circRNA: circular RNA; snoRNA: small nucleolar RNA; siRNA: small interfering RNA; HOTAIR: lncRNA HOX transcript antisense RNA; HULC: highly upregulated in liver cancer; TERC: telomerase RNA component; ceRNA: competing endogenous RNA; MRX34: a liposomal mimic of microRNA-34a; AGO: Argonaute; UTR: untranslated regions; TGFBR1: Transforming Growth Factor-β Receptor 1; FGF9: fibroblast growth factor 9; NRG1: Neuregulin-1; EMT: epithelial–mesenchymal transition; NFAT5: nuclear factor of activated T-cells 5; AP-1: activator protein 1; DARS2: aspartyl-tRNA synthetase 2, mitochondrial; PBX3: PBX homeobox 3; CDK2: cyclin-dependent kinase 2; MMP2: matrix metallopeptidase 2; circASAP1: a circRNA derived from exons 2 and 3 of the ASAP1 gene, hsa_circ_0085616; c-MET: cellular-mesenchymal epithelial transition factor; HGF: hepatocyte growth factor; ZNF418: Zinc-finger protein 418; PTPN1: Protein tyrosine phosphatase N1; NF-Κb:nuclear factor kappa B; TNF-α: tumor necrosis factor alpha; PAH: polycyclic aromatic hydrocarbons; EGFR: epidermal growth factor receptor; PD-L1: programmed death-ligand 1; HLA-ABC: human leukocyte antigen class-I (HLA-I); HK2: hexokinase-2; HSP27: heat shock protein 27; PPAR: peroxisome proliferators-activated receptors; CCL2: C-C chemokine ligand 2; FoxO1: forkhead box O1; p-p38: phosphorylated p38; p-ERK: phosphorylated ERK; p-JNK: phosphorylated JNK; EphA2: EPH receptor A2; CAMK4: calmodulin-dependent protein kinase IV; IRI: ischemia/reperfusion injury; TRAF6: TNF receptor-associated factor 6; PHLDA1: pleckstrin homology-like domain family member 1; ASK1: apoptosis signal-regulating kinase 1; CASE: Compound Astragalus and Salvia miltiorrhiza Extract; TGF-β1: transforming growth factor-β1; Luteolin: 3,4,5,7-tetrahydroxy flavone; FLOT1: flotillin 1; BaP: Benzo [a]pyrene; SDG: Secoisolariciresinol diglucoside; ARA: Adriamycin Resistance Associated; ZAK: zipper containing kinase AZK; TICs: tumor-initiating cells; c-Myb: Myb proto-oncogene; PPP1CA: protein phosphatase 1 catalytic subunit alpha; OPG: osteoprotegerin; EZH2: Enhancer of zeste homologue 2; IGF2BP1: insulin-like growth factor 2 mRNA-binding protein 1; HIST1H1C: H1.2 linker histone, cluster member; STAU1: staufen double-stranded RNA binding protein 1; HIF1a: hypoxia inducible factor 1 subunit alpha; NAFLD: nonalcoholic fatty liver disease; mascRNA: MALAT1-associated small cytoplasmic RNA; vtRNA: vault RNA; RNP: ribonucleoprotein; TFEB: transcription factor EB; CLEAR: coordinated lysosomal expression and regulation; ASRPS: a small regulatory peptide of STAT3; ASAP: ATP synthase-associated peptide; AR: androgen receptor; RAB35: member of RAS oncogene family; SNAP23: synaptosome associated protein 23; HER2: human epidermal growth factor receptor 2; DDX6: DEAD/H-box RNA hel-icase 6; RRM2: ribonucleotide reductase subunit M2; LumB: luminal B; RTK: receptor tyrosine kinase; HGFR, c-MET: hepatocyte growth factor receptor; VEGFR: Vascular Endothelial Growth Factor receptor; PDGFR: platelet derived growth factor receptor; DOR: δ opioid receptor; E2F7: E2F transcription factor 7; HUVECs: human umbilical vein endothelial cells; RUNX2: runt-related transcription factor 2; IGF-1R: insulin like growth factor 1 receptor; NSCLC: non-small-cell lung carcinoma; HRI: heme-regulated inhibitor; ATF4: activating transcription factor 4.

The decrease in NFAT5 expression inhibits NFAT5 binding to the aspartyl-tRNA synthetase 2 (DARS2) promoter, thereby promoting DARS2 (HCC oncogene) expression.

…activator protein 1;DARS2: aspartyl-tRNA synthetase 2,…

Show Full Abstract

The advancement in high-throughput sequencing analysis and the evaluation of chromatin state maps have revealed that eukaryotic cells produce many non-coding transcripts/RNAs. Further, a strong association was observed between some non-coding RNAs and cancer development. The mitogen-activated protein kinases (MAPK) belong to the serine-threonine kinase family and are the primary signaling pathways involved in cell proliferation from the cell surface to the nucleus. They play an important role in various human diseases. A few non-coding RNAs associated with the MAPK signaling pathway play a significant role in the development of several malignancies, including liver cancer. In this review, we summarize the molecular mechanisms and interactions of microRNA, lncRNA, and other non-coding RNAs in the development of liver cancer that are associated with the MAPK signaling pathway. Further, we briefly discuss the therapeutic strategies for liver cancer related to ncRNA and the MAPK signaling pathway.

Also flagged:CatechinsDown syndromemineralepigallocatechin-3-gallateTScongenital disorder
Journal Article 2022-10-07 ✓ 1 Snippet Llambrich S, González-Colom R, Wouters J, Roldán J, Salassa S, Wouters K, Van Bulck V, Sharpe J, Callaerts-Vegh Z, Vande Velde G, Martínez-Abadías N.
In-Text Gene Mentions

…genes upstream ofMrpl39to the telomeric…

Show Full Abstract

Altered skeletal development in Down syndrome (DS) results in a brachycephalic skull, flattened face, shorter mandibular ramus, shorter limbs, and reduced bone mineral density (BMD). Our previous study showed that low doses of green tea extract enriched in epigallocatechin-3-gallate (GTE-EGCG), administered continuously from embryonic day 9 to postnatal day 29, reduced facial dysmorphologies in the Ts65Dn (TS) mouse model of DS, but high doses could exacerbate them. Here, we extended the analyses to other skeletal structures and systematically evaluated the effects of high and low doses of GTE-EGCG treatment over postnatal development in wild-type (WT) and TS mice using in vivo µCT and geometric morphometrics. TS mice developed shorter and wider faces, skulls, and mandibles, together with shorter and narrower humerus and scapula, and reduced BMD dynamically over time. Besides facial morphology, GTE-EGCG did not rescue any other skeletal phenotype in TS treated mice. In WT mice, GTE-EGCG significantly altered the shape of the skull and mandible, reduced the length and width of the long bones, and lowered the BMD. The disparate effects of GTE-EGCG depended on the dose, developmental timepoint, and anatomical structure analyzed, emphasizing the complex nature of DS and the need to further investigate the simultaneous effects of GTE-EGCG supplementation.

Also flagged:cerebral infarctioncardiovascular diseaseischemic strokeimmune responsechemokinesadhesion molecules
Journal Article 2022-10-07 No Snippets Yang K, Zeng L, Ge A, Wang S, Zeng J, Yuan X, Mei Z, Wang G, Ge J.
Show Full Abstract

Cerebral infarction/ischemia-reperfusion injury is currently the disease with the highest mortality and disability rate of cardiovascular disease. Current studies have shown that nerve cells die of ischemia several hours after ischemic stroke, which activates the innate immune response in the brain, promotes the production of neurotoxic substances such as inflammatory cytokines, chemokines, reactive oxygen species and - nitrogen oxide, and mediates the destruction of blood-brain barrier and the occurrence of a series of inflammatory cascade reactions. Meanwhile, the expression of adhesion molecules in cerebral vascular endothelial cells increased, and immune inflammatory cells such as polymorphonuclear neutrophils, lymphocytes and mononuclear macrophages passed through vascular endothelial cells and entered the brain tissue. These cells recognize antigens exposed by the central nervous system in the brain, activate adaptive immune responses, and further mediate secondary neuronal damage, aggravating neurological deficits. In order to reduce the above-mentioned damage, the body induces peripheral immunosuppressive responses through negative feedback, which increases the incidence of post-stroke infection. This process is accompanied by changes in the immune status of the ischemic brain tissue in local and systemic systems. A growing number of studies implicate noncoding RNAs (ncRNAs) as novel epigenetic regulatory elements in the dysfunction of various cell subsets in the neurovascular unit after cerebral infarction/ischemia-reperfusion injury. In particular, recent studies have revealed advances in ncRNA biology that greatly expand the understanding of epigenetic regulation of immune responses and inflammation after cerebral infarction/ischemia-reperfusion injury. Identification of aberrant expression patterns and associated biological effects of ncRNAs in patients revealed their potential as novel biomarkers and therapeutic targets for cerebral infarction/ischemia-reperfusion injury. Therefore, this review systematically presents recent studies on the involvement of ncRNAs in cerebral infarction/ischemia-reperfusion injury and neuroimmune inflammatory cascades, and elucidates the functions and mechanisms of cerebral infarction/ischemia-reperfusion-related ncRNAs, providing new opportunities for the discovery of disease biomarkers and targeted therapy. Furthermore, this review introduces clustered regularly interspaced short palindromic repeats (CRISPR)-Display as a possible transformative tool for studying lncRNAs. In the future, ncRNA is expected to be used as a target for diagnosing cerebral infarction/ischemia-reperfusion injury, judging its prognosis and treatment, thereby significantly improving the prognosis of patients.

Also flagged:lactatemetabolismbreast cancercancerGene Expressionprocessing
Journal Article 2022-10-07 ✓ 5 Snippets Li J, Qiao H, Wu F, Sun S, Feng C, Li C, Yan W, Lv W, Wu H, Liu M, Chen X, Liu X, Wang W, Cai Y, Zhang Y, Zhou Z, Zhang Y, Zhang S.
In-Text Gene Mentions

We found that protein expressions of DARS2, ESRP1, SLC2A1, and TH were markedly high in BC tissues, whereas protein expression of MAFF was low in BC tissues (Figure 10K).

Figures 10A–E showed that, based on GTEx and TCGA databases, all five HLMRGs were differentially expressed between BC and normal samples. DARS2, ESRP1, SLC2A1, and TH were increased in BC, whereas MAFF was increased in normal tissues. Survival analysis indicated that high expression of DARS2, ESRP1, SLC2A1, and TH were related to poor prognosis, while high expression of MAFF was linked to better prognosis (Figures 10F–J).

The sensitivity to vorinostat was positively correlated with DARS2 (Figure 9H; Table S4).

DARS2 has been identified as a hepatocellular carcinoma (HCC) oncogene that promotes HCC cell cycle progression and inhibits HCC cell apoptosis (83).

In lung adenocarcinoma cells, DARS2 is involved in proliferation, invasion, and apoptosis and shows promise as a therapeutic target (84).

Show Full Abstract

<h4>Background</h4>Breast cancer is the most common cancer worldwide. Hypoxia and lactate metabolism are hallmarks of cancer. This study aimed to construct a novel hypoxia- and lactate metabolism-related gene signature to predict the survival, immune microenvironment, and treatment response of breast cancer patients.<h4>Methods</h4>RNA-seq and clinical data of breast cancer from The Cancer Genome Atlas database and Gene Expression Omnibus were downloaded. Hypoxia- and lactate metabolism-related genes were collected from publicly available data sources. The differentially expressed genes were identified using the "edgeR" R package. Univariate Cox regression, random survival forest (RSF), and stepwise multivariate Cox regression analyses were performed to construct the hypoxia-lactate metabolism-related prognostic model (HLMRPM). Further analyses, including functional enrichment, ESTIMATE, CIBERSORTx, Immune Cell Abundance Identifier (ImmuCellAI), TIDE, immunophenoscore (IPS), pRRophetic, and CellMiner, were performed to analyze immune status and treatment responses.<h4>Results</h4>We identified 181 differentially expressed hypoxia-lactate metabolism-related genes (HLMRGs), 24 of which were valuable prognostic genes. Using RSF and stepwise multivariate Cox regression analysis, five HLMRGs were included to establish the HLMRPM. According to the medium-risk score, patients were divided into high- and low-risk groups. Patients in the high-risk group had a worse prognosis than those in the low-risk group (<i>P</i> < 0.05). A nomogram was further built to predict overall survival (OS). Functional enrichment analyses showed that the low-risk group was enriched with immune-related pathways, such as antigen processing and presentation and cytokine-cytokine receptor interaction, whereas the high-risk group was enriched in mTOR and Wnt signaling pathways. CIBERSORTx and ImmuCellAI showed that the low-risk group had abundant anti-tumor immune cells, whereas in the high-risk group, immunosuppressive cells were dominant. Independent immunotherapy datasets (IMvigor210 and GSE78220), TIDE, IPS and pRRophetic analyses revealed that the low-risk group responded better to common immunotherapy and chemotherapy drugs.<h4>Conclusions</h4>We constructed a novel prognostic signature combining lactate metabolism and hypoxia to predict OS, immune status, and treatment response of patients with breast cancer, providing a viewpoint for individualized treatment.

Also flagged:autophagyGastric cancertumor-related genescancerscisplatin
Journal Article 2022-10-07 ✓ 5 Snippets Xu H, Xu B, Hu J, Xia J, Tong L, Zhang P, Yang L, Tang L, Chen S, Du J, Wang Y, Li Y.
In-Text Gene Mentions

Phospholipase C‐like 1 (PLCL1), which is homologous to the PLC family, is associated with tumor growth suppression (45) and metastasis (46).

The downregulation of PLCL1 expression in clear cell renal carcinoma and neuroblastoma was found to be predictive of poor prognosis (47, 48).

…( CYTL1 ,PLCL1, SNCG ,…

…expression quantity ofPLCL1) + (0.0630…

…C‐like 1 (PLCL1), which is…

Show Full Abstract

Gastric cancer (GC) is a major global health issue and one of the leading causes of tumor-associated mortality worldwide. Autophagy is thought to play a critical role in the development and progression of GC, and this process is controlled by a set of conserved regulators termed autophagy-related genes (ATGs). However, the complex contribution of autophagy to cancers is not completely understood. Accordingly, we aimed to develop a prognostic model based on the specific role of ATGs in GC to improve the prediction of GC outcomes. First, we screened 148 differentially expressed ATGs between GC and normal tissues in The Cancer Genome Atlas (TCGA) cohort. Consensus clustering in these ATGs was performed, and based on that, 343 patients were grouped into two clusters. According to Kaplan-Meier survival analysis, cluster C2 had a worse prognosis than cluster C1. Then, a disease risk model incorporating nine differentially expressed ATGs was constructed based on the least absolute shrinkage and selection operator (LASSO) regression analysis, and the ability of this model to stratify patients into high- and low-risk groups was verified. The predictive value of the model was confirmed using both training and validation cohorts. In addition, the results of functional enrichment analysis suggested that GC risk is correlated with immune status. Moreover, autophagy inhibition increased sensitivity to cisplatin and exacerbated reactive oxygen species accumulation in GC cell lines. Collectively, the results indicated that this novel constructed risk model is an effective and reliable tool for predicting GC outcomes and could help with individual treatment through ATG targeting.

Also flagged:Nrf2intracerebral haemorrhagevascular dementiahaematomainjurytranscription factor
Journal Article 2022-10-07 No Snippets Loan JJM, Al-Shahi Salman R, McColl BW, Hardingham GE.
Show Full Abstract

Haemorrhage into the brain parenchyma can be devastating. This manifests as spontaneous intracerebral haemorrhage (ICH) after head trauma, and in the context of vascular dementia. Randomised controlled trials have not reliably shown that haemostatic treatments aimed at limiting ICH haematoma expansion and surgical approaches to reducing haematoma volume are effective. Consequently, treatments to modulate the pathophysiological responses to ICH, which may cause secondary brain injury, are appealing. Following ICH, microglia and monocyte derived cells are recruited to the peri-haematomal environment where they phagocytose haematoma breakdown products and secrete inflammatory cytokines, which may trigger both protective and harmful responses. The transcription factor Nrf2, is activated by oxidative stress, is highly expressed by central nervous system microglia and macroglia. When active, Nrf2 induces a transcriptional programme characterised by increased expression of antioxidant, haem and heavy metal detoxification and proteostasis genes, as well as suppression of proinflammatory factors. Therefore, Nrf2 activation may facilitate adaptive-protective immune cell responses to ICH by boosting resistance to oxidative stress and heavy metal toxicity, whilst limiting harmful inflammatory signalling, which can contribute to further blood brain barrier dysfunction and cerebral oedema. In this review, we consider the responses of immune cells to ICH and how these might be modulated by Nrf2 activation. Finally, we propose potential therapeutic strategies to harness Nrf2 to improve the outcomes of patients with ICH.

Also flagged:acoziborolebiosynthesisCPSF3polypeptideendocytosishuman African trypanosomiasis
Journal Article 2022-10-07 ✓ 2 Snippets Sharma A, Cipriano M, Ferrins L, Hajduk SL, Mensa-Wilmot K.
In-Text Gene Mentions

…and 0.36-fold forDCC25 and DCC…

…DCC 25 andDCC90 , respectively…

Show Full Abstract

NEU-4438 is a lead for the development of drugs against <i>Trypanosoma brucei</i>, which causes human African trypanosomiasis. Optimized with phenotypic screening, targets of NEU-4438 are unknown. Herein, we present a cell perturbome workflow that compares NEU-4438's molecular modes of action to those of SCYX-7158 (acoziborole). Following a 6 h perturbation of trypanosomes, NEU-4438 and acoziborole reduced steady-state amounts of 68 and 92 unique proteins, respectively. After analysis of proteomes, hypotheses formulated for modes of action were tested: Acoziborole and NEU-4438 have different modes of action. Whereas NEU-4438 prevented DNA biosynthesis and basal body maturation, acoziborole destabilized CPSF3 and other proteins, inhibited polypeptide translation, and reduced endocytosis of haptoglobin-hemoglobin. These data point to CPSF3-independent modes of action for acoziborole. In case of polypharmacology, the cell-perturbome workflow elucidates modes of action because it is target-agnostic. Finally, the workflow can be used in any cell that is amenable to proteomic and molecular biology experiments.

Also flagged:Neu1Neu2Neu3Neu4MMP9HP
Journal Article 2022-10-07 ✓ 5 Snippets Hong Y, Chen L, Sun J, Xing L, Yang Y, Jin X, Cai H, Dong L, Zhou L, Zhang Z.
In-Text Gene Mentions

Furthermore, several studies showed that the abundance of neutrophil subtypes with high expression of OLFM4 was associated with the severity of sepsis (Kangelaris et al., 2021; Kassam et al., 2021).

…The geneOLFM4was found to…

…the finding thatOLFM4expressed in neutrophils…

…high level ofOLFM4compared to other…

…al. found thatOLFM4was upregulated in…

Show Full Abstract

Neutrophils constitute the largest proportion of nucleated peripheral blood cells, and neutrophils have substantial heterogeneity. We profiled nearly 300,000 human peripheral blood cells in this study using single-cell RNA sequencing. A large proportion (>50%) of these cells were annotated as neutrophils. Neutrophils were further clustered into four subtypes, including Neu1, Neu2, Neu3, and Neu4. Neu1 is characterized by high expression of MMP9, HP, and RGL4. Neu1 was associated with septic shock and significantly correlated with the sequential organ failure assessment (SOFA) score. A gene expression module in Neu1 named Neu1_C (characterized by expression of NFKBIA, CXCL8, G0S2, and FTH1) was highly predictive of septic shock with an area under the curve of 0.81. The results were extensively validated in external bulk datasets by using single-cell deconvolution methods. In summary, our study establishes a general framework for studying neutrophil-related mechanisms, prognostic biomarkers, and potential therapeutic targets for septic shock.

Also flagged:autonomic dysfunctionneurodegenerative diseasecytosineadenineguanineHuntingtin
Journal Article 2022-10-07 ✓ 2 Snippets Schultz JL, Heinzerling AE, Brinker AN, Harshman LA, Magnotta VA, Kamholz JA, Boes AD, Nopoulos PC.
In-Text Gene Mentions

Huntington’s disease is a neurodegenerative disease caused by an abnormally high number of cytosine–adenine–guanine (CAG) repeats in the Huntingtin gene (Htt) encoding for the Huntingtin protein.1,2 Patients with Huntington’s disease experience progressively worsening motor, cognitive, and psychiatric symptoms that are associated with striatal degeneration.3,4 A relatively underinvestigated phenomenon associated with Huntington’s disease is an observed imbalance of the autonomic nervous system (ANS), with increased sympathetic tone.5-9 This increase in sympathetic tone may contribute to a number of important symptoms that significantly impact quality of life in Huntington’s disease, including sleep disturbances, sexual dysfunction, and bowel and bladder dysfunction.8,10,11 Evidence for increased sympathetic tone is seen in Huntington’s disease patients having elevated resting heart rate, blood pressure, and core body temperature relative to healthy individuals.12,13 The underlying cause of autonomic symptoms in Huntington’s disease is unknown.

…Huntingtin gene (Htt) encoding for…

Show Full Abstract

Autonomic dysfunction has been described in patients with Huntington's disease, but it is unclear if these changes in autonomic tone are related to the central autonomic network. We performed a pilot study to investigate the relationship between the integrity of the central autonomic network and peripheral manifestiations of autonomic dysfunction in premanifest Huntington's disease. We recruited male participants with pre-motor-manifest Huntington's disease and a comparison group consisting of healthy, male participants of approximately the same age. As this was a pilot study, only males were included to reduce confounding. Participants underwent a resting-state functional magnetic resonance imaging study to quantify functional connectivity within the central autonomic network, as well as a resting 3-lead ECG to measure heart rate variability with a particular focus on the parasympathetic time-domain measures of root mean square of successive differences between normal heartbeats. The pre-motor-manifest Huntington's disease participants had significantly decreased root mean square of successive differences between normal heartbeats values compared with the healthy comparison group. The pre-motor-manifest Huntington's disease group had significantly lower functional connectivity within the central autonomic network, which was positively correlated with root mean square of successive differences between normal heartbeats. Patients with pre-motor-manifest Huntington's disease have reduced functional connectivity within the central autonomic network, which is significantly associated with observed changes in autonomic function.

Also flagged:DementiaNeurodegenerative DisordersYoung-onset dementiadementiascognitive declinepsychoses
Journal Article 2022-10-07 ✓ 2 Snippets Fatima K, Mehendale AM, Reddy H.
In-Text Gene Mentions

A mutation of autosomal dominant nature on chromosome 4 with cytosine, adenine, and guanine (CAG) trinucleotide chain repeats in the Huntingtin (HTT) gene, resulting in Huntington's disease [25].

…the Huntingtin (HTT) gene, resulting…

Show Full Abstract

Young-onset dementia (YOD) refers to a neurological ailment primarily affecting people below 65 years of age in roughly about 8% of cases found through various researches. The high rate of prevalence of secondary dementias among older patients proves that younger people show a better prognosis of the conditions causing dementia than older people. However, effective interventions have to be usually provided early in the course of cognitive decline to help facilitate cognitive improvement. The risk of development of prodromal dementia is high if there is a development of psychoses in middle-aged or older people. When there is a development of psychoses in middle to late life, the likelihood of this indicates prodromal dementia is high. The clinical presentation is quite variable and often subtle in frontotemporal dementia (FTD) but may be dominated by personality change, behavioral disturbances, motivation, or the loss of empathy. There is great heterogeneity in the probable causes of dementia in young age as compared to dementia in old age, and some observed differences also exist in the course and characteristics of the disease. These causes may range from the most probable cause such as Alzheimer's disease (AD) to causes with low probability, such as metabolic disorders and prion diseases. The symptoms of young-onset dementia include a gradual development of personality and behavioral changes over a period of years. However, in the initial stages of young-onset dementia, this change can be attributed to various issues, such as depression, marital problems, and menopause. Other neurodegenerative diseases such as Huntington's disease show presentations such as changes in personality, chorea, and depression that can be observed in patients in their early adulthood. A few other neurodegenerative disorders are myoclonic epilepsy with ragged red fibers (MERRF) and mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) with presentations such as characterized muscle weakness, poor growth, problems with vision and hearing, and the involvement of the multi-organ system, including the central nervous system to name a few. There is also the prevalence of juvenile parkinsonism in the community, which represents a group of clinicopathological entities present before the age of 21. Young-onset Parkinson's disease (PD) (YOPD) appears to have the same pathological presentation as late-onset Parkinson's disease (LOPD). Recent researches have proved that "gene therapy" can be useful in the treatment and in preventing the progression of symptoms in cases of neurodegenerative diseases.

Also flagged:metabolismgene expressioncell phasesynthesismethylationRNA-binding proteins
Journal Article 2022-10-07 ✓ 1 Snippet Choi JO, Ham JH, Hwang SS.
In-Text Gene Mentions

Since ICOS is essential for the regulation of T cell immunity, particularly in TFH and germinal center (GC) responses (84), disrupted activity of ROQUIN1/2 spontaneously causes severe autoimmunity resembling SLE characterized by splenomegaly and abnormally increased GC formation, as seen in Sanroque strain mice which contain the M199R mutation in Rc3h1 (encoding ROQUIN1) (85, 86).

Show Full Abstract

RNA metabolism plays a central role in regulating of T cell-mediated immunity. RNA processing, modifications, and regulations of RNA decay influence the tight and rapid regulation of gene expression during T cell phase transition. Thymic selection, quiescence maintenance, activation, differentiation, and effector functions of T cells are dependent on selective RNA modulations. Recent technical improvements have unveiled the complex crosstalk between RNAs and T cells. Moreover, resting T cells contain large amounts of untranslated mRNAs, implying that the regulation of RNA metabolism might be a key step in controlling gene expression. Considering the immunological significance of T cells for disease treatment, an understanding of RNA metabolism in T cells could provide new directions in harnessing T cells for therapeutic implications.

Also flagged:thrombomodulindisseminated intravascular coagulationstreptococcal toxic shock syndromedeathinfectionsepsis
Journal Article 2022-10-07 ✓ 2 Snippets Kato Y, Kawaguchi H, Iwataki S, Kihara H, Okada S.
In-Text Gene Mentions

…RhTM andantithrombin-IIIwere administered on…

…(380 U/kg/day) andantithrombin-III(30 U/kg/day) were…

Show Full Abstract

Disseminated intravascular coagulation (DIC) is a common and morbid complication of streptococcal toxic shock syndrome (STSS). Because DIC with STSS progresses rapidly, prompt and proper care is critical. The present report describes the case of a 10-year-old boy who survived STSS with DIC without sequelae after treatment with combination anticoagulant therapy of recombinant human soluble thrombomodulin (rhTM) and danaparoid. RhTM and antithrombin-III were administered on day 1. RhTM administration was continued. Despite this, on day 2, his general condition remained poor, his fever persisted and his DIC score increased from an initial 5 points upon admission to 9 points. Therefore, danaparoid was additionally administered from day 2 onwards. The patient recovered without serious complications. Combination anticoagulant therapy of rhTM and danaparoid for DIC in a child with STSS was effective and safe. Therefore, this combination therapy could be used as an option for managing high-risk, rapidly progressing disease states, which predispose to morbid sequelae and death, such as DIC with STSS. RhTM and danaparoid therapy may reduce the risk of serious complications, such as organ failure, and improve the prognosis not only in STSS but also in other conditions with infection and DIC concurrence, such as sepsis.

Also flagged:Gene Expressionatopic dermatitisimmune responsesinflammatory responsesofplatelet activation
Journal Article 2022-10-07 No Snippets Nousbeck J, McAleer MA, Irvine AD.
Show Full Abstract

To enhance the understanding of molecular mechanisms and mine previously unidentified biomarkers of pediatric atopic dermatitis, PBMC gene expression profiles were generated by RNA sequencing in infants with atopic dermatitis and age-matched controls. A total of 178 significantly differentially expressed genes (DEGs) (115 upregulations and 63 downregulations) were seen, compared with those in healthy controls. The DEGs identified included <i>IL1β</i>, <i>TNF</i>, <i>TREM1</i>, <i>IL18R1</i>, and <i>IL18RAP</i>. DEGs were validated by real-time RT- qPCR in a larger number of samples from PBMCs of infants with atopic dermatitis aged <12 months. Using the DAVID (Database for Annotation, Visualization and Integrated Discovery) database, functional and pathway enrichment analyses of DEGs were performed. Gene ontology enrichment analysis showed that DEGs were associated with immune responses, inflammatory responses, regulation of immune responses, and platelet activation. Pathway analysis indicated that DEGs were enriched in cytokine‒cytokine receptor interaction, immunoregulatory interactions between lymphoid and nonlymphoid cells, hematopoietic cell lineage, phosphoinositide 3-kinase‒protein kinase B signaling pathway, NK cell‒mediated cytotoxicity, and platelet activation. Furthermore, the protein‒protein interaction network was predicted using the STRING (Search Tool for the Retrieval of Interacting Genes/Proteins) database and visualized with Cytoscape software. Finally, on the basis of the protein‒protein interaction network, 18 hub genes were selected, and two significant modules were obtained. In conclusion, this study sheds light on the molecular mechanisms of pediatric atopic dermatitis and may provide diagnostic biomarkers and therapeutic targets.

medRxiv 2022-10-07 Preprint (No Snippets API) Praus F, Künstner A, Sauer T, Kohl M, Kern K, Deichmann S, Végvári Á, Keck T, Busch H, Habermann JK, Gemoll T.
Show Full Abstract

Colorectal cancer (CRC) is one of the most prevalent cancers, with over one million new cases. The prognosis of CRC considerably depends on the disease stage and metastatic status. As precision oncology for patients with CRC continues to improve, this study aims to integrate genomic, transcriptomic, and proteomic analyses to identify significant expression differences during colorectal progression using a unique set of paired patient samples concerning tumor heterogeneity. We analyzed fresh-frozen tissue samples of matched healthy colon mucosa, colorectal carcinoma, and liver metastasis from same patients prepared under strict cryogenic conditions. While somatic mutations of known cancer-related genes were analyzed using Illumina’s TruSeq Amplicon Cancer Panel, the transcriptome was assessed comprehensively using Clariom D microarrays. The global proteome was evaluated by liquid chromatography-coupled mass spectrometry (LC-MS/MS) and validated by two-dimensional difference in-gel electrophoresis. Subsequent unsupervised principal component clustering, statistical comparisons, and gene set enrichment analyses were calculated using differential expression results. While panomics revealed low RNA and protein expression of CA1, CLCA1, MATN2, AHCYL2, and FCGBP in malignant tissues compared to healthy colon mucosa, no differentially expressed RNA or protein targets were detected between tumor and metastatic tissues. Subsequent intra-patient comparisons revealed highly specific expression differences (e.g., SRSF3, OLFM4, and CEACAM5) associated with a patient-individual transcriptome and proteome. In conclusion, the results highlight the importance of inter- and intra-tumor heterogeneity alongside the individual, patient-paired evaluation for clinical studies. Next to changes among groups reflecting colorectal cancer progression, we identified significant expression differences between patient-individual normal colon mucosa, primary tumor, and liver metastasis, which could speed up the implementation of precision oncology in the future.

Also flagged:axonsgene expressiontranscription factorscell bodiesresponses toextracellular
Journal Article 2022-10-06 ✓ 1 Snippet Beine Z, Wang Z, Tsoulfas P, Blackmore MG.
In-Text Gene Mentions

Dcc

Show Full Abstract

The mammalian brain contains numerous neurons distributed across forebrain, midbrain, and hindbrain that project axons to the lower spinal cord and work in concert to control movement and achieve homeostasis. Extensive work has mapped the anatomic location of supraspinal cell types and continues to establish specific physiological functions. The patterns of gene expression that typify and distinguish these disparate populations, however, are mostly unknown. Here, using adult mice of mixed sex, we combined retrograde labeling of supraspinal cell nuclei with fluorescence-activated nuclei sorting and single-nuclei RNA sequencing analyses to transcriptionally profile neurons that project axons from the brain to lumbar spinal cord. We identified 14 transcriptionally distinct cell types and used a combination of established and newly identified marker genes to assign an anatomic location to each. To validate the putative marker genes, we visualized selected transcripts and confirmed selective expression within lumbar-projecting neurons in discrete supraspinal regions. Finally, we illustrate the potential utility of these data by examining the expression of transcription factors that distinguish different supraspinal cell types and by surveying the expression of receptors for growth and guidance cues that may be present in the spinal cord. Collectively, these data establish transcriptional differences between anatomically defined supraspinal populations, identify a new set of marker genes of use in future experiments, and provide insight into potential differences in cellular and physiological activity across the supraspinal connectome.<b>SIGNIFICANCE STATEMENT</b> The brain communicates with the body through a wide variety of neuronal populations with distinct functions and differential sensitivity to damage and disease. We have used single-nuclei RNA sequencing technology to distinguish patterns of gene expression within a diverse set of neurons that project axons from the mouse brain to the lumbar spinal cord. The results reveal transcriptional differences between populations previously defined on the basis of anatomy, provide new marker genes to facilitate rapid identification of cell type in future work, and suggest distinct responsiveness of different supraspinal populations to external growth and guidance cues.

Also flagged:autismSHANK3organizationintellectual disabilityprotocadherinsprotocadherin
Journal Article 2022-10-06 ✓ 2 Snippets Wang Y, Chiola S, Yang G, Russell C, Armstrong CJ, Wu Y, Spampanato J, Tarboton P, Ullah HMA, Edgar NU, Chang AN, Harmin DA, Bocchi VD, Vezzoli E, Besusso D, Cui J, Cattaneo E, Kubanek J, Shcheglovitov A.
In-Text Gene Mentions

…such as GSX2,SOX6, DLX1 , and…

…including GSX2 ,SOX6, and SALL3…

Show Full Abstract

Human telencephalon is an evolutionarily advanced brain structure associated with many uniquely human behaviors and disorders. However, cell lineages and molecular pathways implicated in human telencephalic development remain largely unknown. We produce human telencephalic organoids from stem cell-derived single neural rosettes and investigate telencephalic development under normal and pathological conditions. We show that single neural rosette-derived organoids contain pallial and subpallial neural progenitors, excitatory and inhibitory neurons, as well as macroglial and periendothelial cells, and exhibit predictable organization and cytoarchitecture. We comprehensively characterize the properties of neurons in SNR-derived organoids and identify transcriptional programs associated with the specification of excitatory and inhibitory neural lineages from a common pool of NPs early in telencephalic development. We also demonstrate that neurons in organoids with a hemizygous deletion of an autism- and intellectual disability-associated gene SHANK3 exhibit intrinsic and excitatory synaptic deficits and impaired expression of several clustered protocadherins. Collectively, this study validates SNR-derived organoids as a reliable model for studying human telencephalic cortico-striatal development and identifies intrinsic, synaptic, and clustered protocadherin expression deficits in human telencephalic tissue with SHANK3 hemizygosity.

Also flagged:psychiatric disordersleepmyelinbehavioraldepressionpsychiatric disorders
Journal Article 2022-10-06 ✓ 2 Snippets Fries GR, Saldana VA, Finnstein J, Rein T.
In-Text Gene Mentions

Top MDD-associated genes in the latest GWAS study are linked to synaptic function: the neuronal growth regulator 1 (NEGR1) controls synapse number and dendritic maturation [19].

NEGR1 SNPs have also been associated with low white matter integrity [20] and responsiveness to selective serotonin (5-HT) reuptake inhibitors [21].

Show Full Abstract

Major depressive disorder (MDD) is a psychiatric disease of still poorly understood molecular etiology. Extensive studies at different molecular levels point to a high complexity of numerous interrelated pathways as the underpinnings of depression. Major systems under consideration include monoamines, stress, neurotrophins and neurogenesis, excitatory and inhibitory neurotransmission, mitochondrial dysfunction, (epi)genetics, inflammation, the opioid system, myelination, and the gut-brain axis, among others. This review aims at illustrating how these multiple signaling pathways and systems may interact to provide a more comprehensive view of MDD's neurobiology. In particular, considering the pattern of synaptic activity as the closest physical representation of mood, emotion, and conscience we can conceptualize, each pathway or molecular system will be scrutinized for links to synaptic neurotransmission. Models of the neurobiology of MDD will be discussed as well as future actions to improve the understanding of the disease and treatment options.

Also flagged:Head and neck cancertumorcancermethylationsquamous cell head and neck cancerepithelial tumors
Journal Article 2022-10-06 ✓ 2 Snippets Birknerova N, Mancikova V, Paul ED, Matyasovsky J, Cekan P, Palicka V, Parova H.
In-Text Gene Mentions

They reported a 5-gene diagnostic panel (CCNA1, DAPK, DCC, MINT31, and p16), which identified HNSCC patients with 34.1% sensitivity and 91.8% specificity.

The authors found significant EDNRB and DCC hypermethylation to be associated with the HNSCC diagnosis with 75% sensitivity and 48% specificity, confirming previous results [40].

Show Full Abstract

Head and neck cancer (HNC) remains one of the leading causes of mortality worldwide due to tumor diagnosis at a late stage, loco-regional aggression, and distant metastases. A standardized diagnostic procedure for HNC is a tissue biopsy that cannot faithfully portray the in-depth tumor dynamics. Therefore, there is an urgent need to develop simple, accurate, and non-invasive methods for cancer detection and follow-up. A saliva-based liquid biopsy allows convenient, non-invasive, and painless collection of high volumes of this biofluid, with the possibility of repetitive sampling, all enabling real-time monitoring of the disease. No approved clinical test for HNC has yet been established. However, epigenetic changes in saliva circulating cell-free DNA (cfDNA) have the potential for a wide range of clinical applications. Therefore, the aim of this review is to present an overview of cfDNA-based methylation patterns in saliva for early detection of HNC, with particular attention to circulating tumor DNA (ctDNA). Due to advancements in isolation and detection technologies, as well as next- and third-generation sequencing, recent data suggest that salivary biomarkers may be successfully applied for early detection of HNC in the future, but large prospective clinical trials are still warranted.

Also flagged:Metabolic Disordersobesityabdominal obesityhypertensiontype 2 diabeteshypercholesterolemia
Journal Article 2022-10-06 No Snippets Kim YS, Park YC, Choi JE, Park JM, Han K, Kim K, Kim BT, Hong KW.
Show Full Abstract

Although many genome-wide association studies (GWASs) have evaluated the association with metabolic disorders, the current study is the first attempt to analyze the genetic risk factors for various metabolic disorders according to sex and age groups of the life course in Korean adults. A total population of 50,808 people were included in this GWAS. The genetic traits for eight metabolic phenotypes were investigated in peri-, and postmenopausal women compared to a younger group or men of corresponding age groups. The metabolic phenotypes include general obesity, abdominal obesity, hypertension, type 2 diabetes, hypercholesterolemia, hypertriglyceridemia, hypo-high-density lipoprotein cholesterolemia, and metabolic syndrome. In the total participants, GWAS results for eight metabolic phenotypes found 101 significant loci. Of these, 15 loci were the first reported to be associated with the risk of metabolic disorder. Interestingly, some of the significant loci presented the association with the various phenotypes, which presented when there was a correlation between phenotypes. In addition, we analyzed divided by gender and age (young adult, peri-menopausal group, older adult), and specifically identified specific loci in peri-menopausal women. Meanwhile, several genetic factors associated with metabolic disorders were newly reported in our study. In particular, several genes were significantly associated with one of the metabolic phenotypes in only a single specific group. These findings suggest that menopausal transition rather than aging itself potentiates the influence of genetic risks on metabolic disorders. In addition, some genetic loci with low frequencies may play a role in the metabolic disturbances in a specific sex and age group. The genetic traits derived from our study may contribute to understanding the genetic risk factors for metabolic disorders in the Korean population.

Also flagged:Hydroxyapatitetitaniumoxidenanofiberssilverhydroxyl
Journal Article 2022-10-06 No Snippets Ehlert M, Radtke A, Bartmański M, Piszczek P.
Show Full Abstract

The important issue associated with the design and the fabrication of the titanium and titanium alloy implants is the increase of their biointegration with bone tissue. In the presented paper, the research results concerning the conditions used in the cathodic deposition of hydroxyapatite on the surface Ti6Al4V substrates primarily modified by the production of TiO<sub>2</sub> nanoporous coatings, TiO<sub>2</sub> nanofibers, and titanate coatings, are discussed. Despite excellent biocompatibility with natural bone tissue of materials based on hydroxyapatite (HA), their poor adhesion to the substrate caused the limited use in the implants' construction. In our works, we have focused on the comparison of the structure, physicochemical, and mechanical properties of coating systems produced at different conditions. For this purpose, scanning electron microscopy images, chemical composition, X-ray diffraction patterns, infrared spectroscopy, wettability, and mechanical properties are analyzed. Our investigations proved that the intermediate titanium oxide coatings presence significantly increases the adhesion between the hydroxyapatite layer and the Ti6Al4V substrate, thus solving the temporary delamination problems of the HA layer.

Also flagged:HDHuntington disease‐like 2cognitive declineHDL2Huntington's diseasechorea
Journal Article 2022-10-06 No Snippets Ruscitti F, Origone P, Rosti G, Trevisan L, Marchese R, Brugnolo A, Massa F, Castellini P, Mandich P.
Show Full Abstract

Chorea, cognitive decline, and psychiatric symptoms are shared by Huntington's disease (HD) and similar conditions called HD phenocopies. We describe the first case reported in Italy of Huntington disease-like 2 (HDL2), clinically and radiologically indistinguishable from HD, showing the importance of considering African ancestry in the diagnostic process.

Also flagged:angiogenesistumorcancerpancreatic cancerARGsPD-1
Journal Article 2022-10-06 ✓ 2 Snippets Ge W, Shentu D, Wang Y, Wang Y, Xue S, Yue M, Mao T, Zhang X, Xu H, Li S, Ma J, Yao J, Cui J, Wang L.
In-Text Gene Mentions

…TNFRSF18, CD276, CD160,TNFSF4, and VTCN1…

…CD44, TNFRSF18, CD160,TNFSF4, and VTCN1, are…

Show Full Abstract

Angiogenesis, a hallmark of cancer, is related to prognosis, tumor progression, and treatment response. Nevertheless, the correlation of angiogenesis-based molecular signature with clinical outcome and immune cell infiltration has not been thoroughly studied in pancreatic cancer. In this study, multiple bioinformatics methods were combined to evaluate prognosis, immune cell infiltration, and the alterations of angiogenesis-related genes (ARGs) in PC samples, and further establish a novel angiogenesis-related gene signature. Moreover, the protein and mRNA expression levels of four angiogenesis risk genes were determined by Human Protein Atlas (HPA) database and qPCR analysis, respectively. Here, we recognized two distinct angiogenesis subtypes and two gene subtypes, and revealed the critical roles of ARGs in the tumor immune microenvironment (TIME), clinical features, and prognosis. Consequently, we established an ARGs score to predict prognosis and therapeutic response of PC patients, and validated its robust predictive ability. Additionally, the ARGs score was markedly associated with clinical outcomes, tumor mutation burden (TMB), and chemotherapeutic drug sensitivity. In brief, our findings imply that the ARGs score is a robust prognostic indicator and may contribute to the development of effective individualized therapies for PC.

Also flagged:protein kinasesCK1Casein kinasescancerneurological diseasescasein kinase 1
Journal Article 2022-10-06 ✓ 2 Snippets Baier A, Szyszka R.
In-Text Gene Mentions

Mutations in the huntingtin gene (HTT) encoding huntingtin are responsible for the onset of HD.

…the huntingtin gene (HTT) encoding huntingtin are…

Show Full Abstract

Casein kinases are involved in a variety of signaling pathways, and also in inflammation, cancer, and neurological diseases. Therefore, they are regarded as potential therapeutic targets for drug design. Recent studies have highlighted the importance of the casein kinase 1 superfamily as well as protein kinase CK2 in the development of several neurodegenerative pathologies, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. CK1 kinases and their closely related tau tubulin kinases as well as CK2 are found to be overexpressed in the mammalian brain. Numerous substrates have been detected which play crucial roles in neuronal and synaptic network functions and activities. The development of new substances for the treatment of these pathologies is in high demand. The impact of these kinases in the progress of neurodegenerative disorders, their bona fide substrates, and numerous natural and synthetic compounds which are able to inhibit CK1, TTBK, and CK2 are discussed in this review.

Also flagged:ferroptosisleukemiacancersAKR1C3BECN1CAV1
Journal Article 2022-10-06 ✓ 1 Snippet Pan B, Li Y, Xu Z, Miao Y, Yin H, Kong Y, Zhang X, Liang J, Xia Y, Wang L, Li J, Wu J, Xu W.
In-Text Gene Mentions

…CDKN2A, GABARAPL2, HRAS,PEBP1, SLC1A5, and VDAC2)…

Show Full Abstract

<h4>Background</h4>Chronic lymphocytic leukemia (CLL) is the most common leukemia in the western world. Although the treatment landscape for CLL is rapidly evolving, there are still some patients who develop drug resistance or disease refractory. Ferroptosis is a type of lipid peroxidation-induced cell death and has been suggested to have prognostic value in several cancers. Our research aims to build a prognostic model to improve risk stratification in CLL patients and facilitate more accurate assessment for clinical management.<h4>Methods</h4>The differentially expressed ferroptosis-related genes (FRGs) in CLL were filtered through univariate Cox regression analysis based on public databases. Least absolute shrinkage and selection operator (LASSO) Cox algorithms were performed to construct a prognostic risk model. CIBERSORT and single-sample gene set enrichment analysis (ssGSEA) were performed to estimate the immune infiltration score and immune-related pathways. A total of 36 CLL patients in our center were enrolled in this study as a validation cohort. Moreover, a nomogram model was established to predict the prognosis.<h4>Results</h4>A total of 15 differentially expressed FRGs with prognostic significance were screened out. After minimizing the potential risk of overfitting, we constructed a novel ferroptosis-related prognostic score (FPS) model with nine FRGs (AKR1C3, BECN1, CAV1, CDKN2A, CXCL2, JDP2, SIRT1, SLC1A5, and SP1) and stratified patients into low- and high-risk groups. Kaplan-Meier analysis showed that patients with high FPS had worse overall survival (OS) (<i>P</i><0.0001) and treatment-free survival (TFS) (<i>P</i><0.0001). ROC curves evaluated the prognostic prediction ability of the FPS model. Additionally, the immune cell types and immune-related pathways were correlated with the risk scores in CLL patients. In the validation cohort, the results confirmed that the high-risk group was related to worse OS (<i>P</i><0.0001), progress-free survival (PFS) (<i>P</i>=0.0140), and TFS (<i>P</i>=0.0072). In the multivariate analysis, only FPS (<i>P</i>=0.011) and CLL-IPI (<i>P</i>=0.010) were independent risk indicators for OS. Furthermore, we established a nomogram including FPS and CLL-IPI that could strongly and reliably predict individual prognosis.<h4>Conclusion</h4>A novel FPS model can be used in CLL for prognostic prediction. The model index may also facilitate the development of new clinical ferroptosis-targeted therapies in patients with CLL.

Also flagged:lung cancerLUADmethylationEXO1JNKBI-D1870
Journal Article 2022-10-06 ✓ 1 Snippet Zhang L, Jiang B, Lan Z, Yang C, Yao Y, Lin J, Wei Q.
In-Text Gene Mentions

…HMCN1, RELN, MXRA5,CACNA1E, VCAN, CSMD2, PKHD1L1,…

Show Full Abstract

<h4>Objective</h4>Lung adenocarcinoma (LUAD) is the most prevalent lung cancer subtype, but its immune infiltration features are not comprehensively understood. To address the issue, the present study was initiated to describe the immune infiltrations across LUAD from cellular compositional, functional, and mechanism perspectives.<h4>Methods</h4>We adopted five LUAD datasets (GSE32863, GSE43458, GSE75037, TCGA-LUAD, and GSE72094). Differentially expressed genes between LUAD and controls were selected for co-expression network analysis. Risky immune cell types were determined for classifying LUAD patients as diverse subtypes, followed by a comparison of antitumor immunity and therapeutic response between subtypes. Then, LUAD- and subtype-related key module genes affected by DNA methylation were determined for quantifying a scoring scheme. EXO1 was chosen for functional analysis <i>via in vitro</i> assays.<h4>Results</h4>Two immune cell infiltration-based subtypes (C1 and C2) were established across LUAD, with poorer prognostic outcomes and lower infiltration of immune cell types in C1. Additionally, C1 presented higher responses to immune checkpoint blockade and targeted agents (JNK inhibitor VIII, BI-D1870, RO-3306, etc.). The scoring system (comprising GAPDH, EXO1, FYN, CFTR, and KLF4) possessed higher accuracy in estimating patients' prognostic outcomes. EXO1 upregulation contributed to the growth, migration, and invasion of LUAD cells. In addition, EXO1 facilitated PD-L1 and sPD-L1 expression in LUAD cells.<h4>Conclusion</h4>Altogether, our findings offer a comprehensive understanding of the immune infiltration landscape on prognosis and therapeutic response of LUAD as well as unveil potential epigenetic and transcriptomic mechanisms, which might assist personalized treatment.

Also flagged:Ferroptosisirondeathcancerskidney renal papillary cell carcinomaAKR1C3
Journal Article 2022-10-06 ✓ 1 Snippet Yin H, Lin M, Liang S, Wei M, Huang C, Qin F, Nong J, Zeng X, Nong C, Qin H.
In-Text Gene Mentions

…by AKR1C3 ,PEBP1, ABCC1 ,…

Show Full Abstract

Ferroptosis, an iron-dependent form of selective cell death, is involved in the development of many cancers. However, the role of ferroptosis-related genes (FRGs) in kidney renal papillary cell carcinoma (KIRP) is unclear. In this study, we examined the mRNA expression profiles and clinical data of patients with KIRP from the TCGA cohort. Consequently, 41 differentially-expressed FRGs were screened using the limma package, and 17 prognostic-related FRGs were identified by survival analysis and univariate Cox regression analyses. Thereafter, a ferroptosis-related gene prognostic index (FRGPI) was constructed based on five FRGs (<i>AKR1C3</i>, <i>SAT1</i>, <i>FANCD2</i>, <i>HSBP1</i> and <i>SQLE</i>), using lasso Cox and multivariate Cox regression analyses. KIRP patients with high FRGPI scores displayed worse outcomes. Furthermore, the FRGPI was shown to be a reliable independent prognostic factor in both the training and testing cohorts. Comprehensive analysis also showed that the FRGPI can distinguish gene mutation, functional enrichment of immune cells and molecular function-related pathways. Interestingly, low FRGPI score could be more benefit from immune checkpoint inhibitors (ICIs) therapy. Then, the two hub prognostic genes (<i>AKR1C3 and FANCD2</i>) as a risk gene for KIRP were identified based on the FRGPI module, and the expression profiles of these two genes were validated using human KIRP cells, besides, we furthermore discovered that <i>Fancd2</i> is significantly up-regulated in most cancers and is associated with prognosis. In conclusion, these findings showed that FRGPI can accurately predict the prognosis of patients with KIRP, suggesting that this risk model is a promising prognostic biomarker for these patients. Moreover, targeting ferroptosis (<i>FANCD2</i>) could be a potential therapeutic alternative for various cancers.

Also flagged:hepatocellular carcinomatumorPDLIM3KLF2ROR2PGF
Journal Article 2022-10-06 ✓ 5 Snippets Song L, Xu C, Zhang T, Chen S, Hu S, Cheng B, Tong H, Li X.
In-Text Gene Mentions

Through a series of screening, 9 neutrophil-related genes (PDLIM3, KLF2, ROR2, PGF, EFNB1, PDZD4, PLN, PCDH17, DOK5) with good prognostic value for HCC were finally obtained.

Through univariate Cox regression analysis, Lasso regression and multivariable Cox regression analysis, 9 neutrophil-related genes (PDLIM3, KLF2, ROR2, PGF, EFNB1, PDZD4, PLN, PCDH17, DOK5) related to the prognosis of HCC were finally screened.

Liu and his team found that PCDH17 is regulated by DNMT3B methylation and inhibits cell proliferation, invasion and migration in HCC via EMT (Liu et al., 2022).

Finally, through multivariate Cox regression analysis, we screened out 9 neutrophil-related genes (PDLIM3, KLF2, ROR2, PGF, EFNB1, PDZD4, PLN, PCDH17, DOK5, Supplementary Table S4) that are beneficial for predicting the prognosis of HCC patients.

Nine genes with prognostic value in HCC (PDLIM3, KLF2, ROR2, PGF, EFNB1, PDZD4, PLN, PCDH17, DOK5) were finally screened.

Show Full Abstract

<b>Background:</b> Growing evidence suggests that infiltrating neutrophils are key players in hepatocellular carcinoma (HCC) tumor progression. However, a comprehensive analysis of the biological roles of neutrophil infiltration and related genes in clinical outcomes and immunotherapy is lacking. <b>Methods:</b> HCC samples were obtained from the TCGA and GEO databases. The CIBERSORT algorithm was used to reveal the TIME landscape. Gene modules significantly associated with neutrophils were found using weighted gene co-expression network analysis (WGCNA), a "dynamic tree-cut" algorithm, and Pearson correlation analysis. Genes were screened using Cox regression analysis and LASSO and prognostic value validation was performed using Kaplan-Meier curves and receiver operating characteristic (ROC) curves. Risk scores (RS) were calculated and nomograms were constructed incorporating clinical variables. Gene set variation analysis (GSVA) was used to calculate signaling pathway activity. Immunophenoscore (IPS) was used to analyze differences in immunotherapy among samples with different risk scores. Finally, the relationship between RS and drug sensitivity was explored using the pRRophetic algorithm. <b>Results:</b> 10530 genes in 424 samples (50 normal samples, 374 tumor samples) were obtained from the TCGA database. Using WGCNA, the "MEbrown" gene module was most associated with neutrophils. Nine genes with prognostic value in HCC (<i>PDLIM3</i>, <i>KLF2</i>, <i>ROR2</i>, <i>PGF</i>, <i>EFNB1</i>, <i>PDZD4</i>, <i>PLN</i>, <i>PCDH17</i>, <i>DOK5</i>) were finally screened. Prognostic nomograms based on RS, gender, tumor grade, clinical stage, T, N, and M stages were constructed. The nomogram performed well after calibration curve validation. There is an intrinsic link between risk score and TMB and TIME. Samples with different risk scores differed in different signaling pathway activity, immunopharmaceutical treatment and chemotherapy sensitivity. <b>Conclusion:</b> In conclusion, a comprehensive analysis of neutrophil-related prognostic features will help in prognostic prediction and advance individualized treatment.

Also flagged:cancercancerstumorhepatocellular carcinomatumorsTONSL
Journal Article 2022-10-06 ✓ 5 Snippets Guo Z, Liu F, Gong Q.
In-Text Gene Mentions

Although this study characterizes the role of MMS22L in pan-cancer and reveals an important role of MMS22L in HCC, there are inevitably some limitations in this study.

Eventually, we investigated the role of MMS22L in hepatocellular carcinoma (HCC).

Altogether, these results suggest that the roles of MMS22L in different tumors are diverse and complex and suggest that MMS22L may be a promising target for tumor therapy.

However, the role of MMS22L in human cancers remains unclear.

It also demonstrates the potential mechanism of MMS22L in pan-cancer and its potential function in predicting immunotherapy response.

Show Full Abstract

Methyl methanesulfonate-sensitivity protein 22-like (MMS22L) is crucial in protecting genome integrity during DNA replication by preventing DNA damage and maintaining efficient homologous recombination. However, the role of MMS22L in human cancers remains unclear. Here, we reported the landscape of MMS22L using multi-omics data and identified the relationship between the MMS22L status and pan-cancer prognosis. In addition, the correlation of MMS22L mRNA expression levels with tumor mutational burden, microsatellite instability, homologous recombination deficiency, and loss of heterozygosity in pan-cancer was also described in this study. Furthermore, this study was the first to characterize the relationship between mRNA expression of MMS22L and immune cell infiltration in the tumor microenvironment in human cancer. Concurrently, this study explored the crucial role of MMS22L in different immunotherapy cohorts through current immunotherapy experiments. Eventually, we investigated the role of MMS22L in hepatocellular carcinoma (HCC). The results demonstrated that MMS22L is widely expressed in multiple HCC cell lines, and our results emphasized that MMS22L was involved in HCC progression and affects the prognosis of patients with HCC through multiple independent validation cohorts. Collectively, our findings reveal the essential role of MMS22L as a tumor-regulating gene in human cancers while further emphasizing its feasibility as a novel molecular marker in HCC. These findings provide an essential reference for the study of MMS22L in tumors.

Also flagged:glycopeptidesphosphopeptidesphosphorylationhydrogenalbuminhistidine
Journal Article 2022-10-06 No Snippets Shang D, Chen C, Dong X, Cui Y, Qiao Z, Li X, Liang X.
Show Full Abstract

Protein phosphorylation and glycosylation coordinately regulate numerous complex biological processes. However, the main methods to simultaneously enrich them are based on the coordination interactions or Lewis acid-base interactions, which suffer from low coverage of target molecules due to strong intermolecular interactions. Here, we constructed a poly-histidine modified silica (SiO<sub>2</sub>@Poly-His) microspheres-based method for the simultaneous enrichment, sequential elution and analysis of phosphopeptides and glycopeptides. The SiO<sub>2</sub>@Poly-His microspheres driven by hydrophilic interactions and multiple hydrogen bonding interactions exhibited high selectivity and coverage for simultaneous enrichment of phosphopeptides and glycopeptides from 1,000 molar folds of bovine serum albumin interference. Furthermore, "on-line deglycosylation" strategy allows sequential elution of phosphopeptides and glycopeptides, protecting phosphopeptides from hydrolysis during deglycosylation and improving the coverage of phosphopeptides. The application of our established method to HT29 cell lysates resulted in a total of 1,601 identified glycopeptides and 694 identified phosphopeptides, which were 1.2-fold and 1.5-fold higher than those obtained from the co-elution strategy, respectively. The SiO<sub>2</sub>@Poly-His based simultaneous enrichment and sequential separation strategy might have great potential in co-analysis of PTMs-proteomics of biological and clinic samples.

Also flagged:Spinal and bulbar muscular atrophySBMAneuromuscular genetic diseaseandrogen receptorARtranscriptional regulator
Journal Article 2022-10-06 ✓ 3 Snippets Sengupta M, Pluciennik A, Merry DE.
In-Text Gene Mentions

…ligase acts onHttin two very…

…mediated degradation ofHtt; however, K63-polyubiquitinat…

…E3 ligase promotedHttaggregation ( Bhat…

Show Full Abstract

Spinal and bulbar muscular atrophy (SBMA) is a neurodegenerative and neuromuscular genetic disease caused by the expansion of a polyglutamine-encoding CAG tract in the androgen receptor (AR) gene. The AR is an important transcriptional regulator of the nuclear hormone receptor superfamily; its levels are regulated in many ways including by ubiquitin-dependent degradation. Ubiquitination is a post-translational modification (PTM) which plays a key role in both AR transcriptional activity and its degradation. Moreover, the ubiquitin-proteasome system (UPS) is a fundamental component of cellular functioning and has been implicated in diseases of protein misfolding and aggregation, including polyglutamine (polyQ) repeat expansion diseases such as Huntington's disease and SBMA. In this review, we discuss the details of the UPS system, its functions and regulation, and the role of AR ubiquitination and UPS components in SBMA. We also discuss aspects of the UPS that may be manipulated for therapeutic effect in SBMA.

Also flagged:B-cell receptorpulmonary vascular diseaseright ventricular failuredeathmonocrotalinegene expression
Journal Article 2022-10-06 ✓ 5 Snippets Chen Y, Wu C, Wang X, Zhou X, Kang K, Cao Z, Yang Y, Zhong Y, Xiao G.
In-Text Gene Mentions

Interestingly, the expression of BAFFR, TNFSF4, TNFRSF4, MZB1, CD19, IGHM, and JCHAIN was elevated in the present study, indicating that B cells were activated to produce antibodies, thus in line with the evidence of local immunoglobulin production in PAH (38).

Moreover, a series of humoral immune response-associated genes, such as BTK, BAFFR, and TNFSF4, were found to be differentially expressed in PAH.

As shown in Figure 6A, the validation of the RNA-seq dataset by real-time PCR showed the upregulation of BAFFR, BTK, TNFSF4, CD20, and IGHM, thus confirming the upregulation of humoral immune response-associated genes in MCT-induced PAH.

…BTK, BAFFR, andTNFSF4, were found to…

…AGC C-3′ forTNFSF4; forward-5′- CAA CAG…

Show Full Abstract

<h4>Background</h4>Pulmonary arterial hypertension (PAH) is a devastating cardio-pulmonary vascular disease in which chronic elevated pulmonary arterial pressure and pulmonary vascular remodeling lead to right ventricular failure and premature death. However, the exact molecular mechanism causing PAH remains unclear.<h4>Methods</h4>RNA sequencing was used to analyze the transcriptional profiling of controls and rats treated with monocrotaline (MCT) for 1, 2, 3, and 4 weeks. Weighted gene co-expression network analysis (WGCNA) was employed to identify the key modules associated with the severity of PAH. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed to explore the potential biological processes and pathways of key modules. Real-time PCR and western blot analysis were used to validate the gene expression. The hub genes were validated by an independent dataset obtained from the Gene Expression Omnibus database.<h4>Results</h4>A total of 26 gene modules were identified by WGCNA. Of these modules, two modules showed the highest correlation with the severity of PAH and were recognized as the key modules. GO analysis of key modules showed the dysregulated inflammation and immunity, particularly B-cell-mediated humoral immunity in MCT-induced PAH. KEGG pathway analysis showed the significant enrichment of the B-cell receptor signaling pathway in the key modules. Pathview analysis revealed the dysregulation of the B-cell receptor signaling pathway in detail. Moreover, a series of humoral immune response-associated genes, such as BTK, BAFFR, and TNFSF4, were found to be differentially expressed in PAH. Additionally, five genes, including BANK1, FOXF1, TLE1, CLEC4A1, and CLEC4A3, were identified and validated as the hub genes.<h4>Conclusion</h4>This study identified the dysregulated B-cell receptor signaling pathway, as well as novel genes associated with humoral immune response in MCT-induced PAH, thereby providing a novel insight into the molecular mechanisms underlying inflammation and immunity and therapeutic targets for PAH.

Also flagged:ReninBrain neurodegenerative diseasesangiotensinaldosteronewatersodium
Journal Article 2022-10-06 ✓ 2 Snippets Bild W, Vasincu A, Rusu RN, Ababei DC, Stana AB, Stanciu GD, Savu B, Bild V.
In-Text Gene Mentions

HD is caused by an abnormal expanded repeat of CAG trinucleotide in the huntingtin (HTT) gene, which leads to the formation of mutant huntingtin protein (mHTT), a key player in the pathogenesis of the disorder [137,138,139,140].

Similar to the evolution of PrPC towards PrPSc in PRDs such as kuru, Creutzfeldt-Jakob, GSS, and fatal familial insomnia, all NDG afflictions show misfolding proteins, such as α-synuclein [192], A-β, APP, τ in AD, TDP-43 in ALS, HTT, and the amyloid protein [193].

Show Full Abstract

Brain neurodegenerative diseases (BND) are debilitating conditions that are especially characteristic of a certain period of life and considered major threats to human health. Current treatments are limited, meaning that there is a challenge in developing new options that can efficiently tackle the different components and pathophysiological processes of these conditions. The renin-angiotensin-aldosterone system (RAS) is an endocrine axis with important peripheral physiological functions such as blood pressure and cardiovascular homeostasis, as well as water and sodium balance and systemic vascular resistance-functions which are well-documented. However, recent work has highlighted the paracrine and autocrine functions of RAS in different tissues, including the central nervous system (CNS). It is known that RAS hyperactivation has pro-inflammatory and pro-oxidant effects, thus suggesting that its pharmacological modulation could be used in the management of these conditions. The present paper underlines the involvement of RAS and its components in the pathophysiology of BNDs such as Parkinson's disease (PD), Alzheimer's disease (AD), multiple sclerosis (MS), Huntington's disease (HD), motor neuron disease (MND), and prion disease (PRD), as well as the identification of drugs and pharmacologically active substances that act upon RAS, which could alleviate their symptomatology or evolution, and thus, contribute to novel therapeutic approaches.

bioRxiv 2022-10-06 Preprint (No Snippets API) Ton MN, Keitley D, Theeuwes B, Guibentif C, Ahnfelt-Rønne J, Andreassen TK, Calero-Nieto FJ, Imaz-Rosshandler I, Pijuan-Sala B, Nichols J, Benito-Gutiérrez È, Marioni JC, Göttgens B.
Show Full Abstract

<h4>ABSTRACT</h4> Biomedical research relies heavily on the use of model organisms to gain insight into human health and development. Traditionally, the mouse has been the favored vertebrate model, due to its experimental and genetic tractability. Non-rodent embryological studies however highlight that many aspects of early mouse development, including the egg-cylinder topology of the embryo and its method of implantation, diverge from other mammals, thus complicating inferences about human development. In this study, we constructed a morphological and molecular atlas of rabbit development, which like the human embryo, develops as a flat-bilaminar disc. We report transcriptional and chromatin accessibility profiles of almost 180,000 single cells and high-resolution histology sections from embryos spanning gastrulation, implantation, amniogenesis, and early organogenesis. Using a novel computational pipeline, we compare the transcriptional landscape of rabbit and mouse at the scale of the entire organism, revealing that extra-embryonic tissues, as well as gut and PGC cell types, are highly divergent between species. Focusing on these extra-embryonic tissues, which are highly accessible in the rabbit, we characterize the gene regulatory programs underlying trophoblast differentiation and identify novel signaling interactions involving the yolk sac mesothelium during hematopoiesis. Finally, we demonstrate how the combination of both rabbit and mouse atlases can be leveraged to extract new biological insights from sparse macaque and human data. The datasets and analysis pipelines reported here set a framework for a broader cross-species approach to decipher early mammalian development, and are readily adaptable to deploy single cell comparative genomics more broadly across biomedical research.

Also flagged:membranehyperpolarizationsodiumcalciumion channelsGly
Journal Article 2022-10-05 No Snippets Snyder RR, Blitz DM.
Show Full Abstract

Neural network flexibility includes changes in neuronal participation between networks, such as the switching of neurons between single- and dual-network activity. We previously identified a neuron that is recruited to burst in time with an additional network via modulation of its intrinsic membrane properties, instead of being recruited synaptically into the second network. However, the modulated intrinsic properties were not determined. Here, we use small networks in the Jonah crab (<i>Cancer borealis</i>) stomatogastric nervous system (STNS) to examine modulation of intrinsic properties underlying neuropeptide (Gly<sup>1</sup>-SIFamide)-elicited neuronal switching. The lateral posterior gastric neuron (LPG) switches from exclusive participation in the fast pyloric (∼1 Hz) network, due to electrical coupling, to dual-network activity that includes periodic escapes from the fast rhythm via intrinsically generated oscillations at the slower gastric mill network frequency (∼0.1 Hz). We isolated LPG from both networks by pharmacology and hyperpolarizing current injection. Gly<sup>1</sup>-SIFamide increased LPG intrinsic excitability and rebound from inhibition and decreased spike frequency adaptation, which can all contribute to intrinsic bursting. Using ion substitution and channel blockers, we found that a hyperpolarization-activated current, a persistent sodium current, and calcium or calcium-related current(s) appear to be primary contributors to Gly<sup>1</sup>-SIFamide-elicited LPG intrinsic bursting. However, this intrinsic bursting was more sensitive to blocking currents when LPG received rhythmic electrical coupling input from the fast network than in the isolated condition. Overall, a switch from single- to dual-network activity can involve modulation of multiple intrinsic properties, while synaptic input from a second network can shape the contributions of these properties.<b>NEW & NOTEWORTHY</b> Neuropeptide-elicited intrinsic bursting was recently determined to switch a neuron from single- to dual-network participation. Here we identified multiple intrinsic properties modulated in the dual-network state and candidate ion channels underlying the intrinsic bursting. Bursting at the second network frequency was more sensitive to blocking currents in the dual-network state than when neurons were synaptically isolated from their home network. Thus, synaptic input can shape the contributions of modulated intrinsic properties underlying dual-network activity.

Also flagged:TBC1D18Rab5GAPendosomeRab7Rab5-GAP
Journal Article 2022-10-05 ✓ 1 Snippet Hiragi S, Matsui T, Sakamaki Y, Fukuda M.
In-Text Gene Mentions

…0825-1-AP; Proteintech), anti-RABGAP1L(TBC1D18) rabbit polyclonal…

Show Full Abstract

Rab5 and Rab7 are known to regulate endosome maturation, and a Rab5-to-Rab7 conversion mediated by a Rab7 activator, Mon1-Ccz1, is essential for progression of the maturation process. However, the importance and mechanism of Rab5 inactivation during endosome maturation are poorly understood. Here, we report a novel Rab5-GAP, TBC1D18, which is associated with Mon1 and mediates endosome maturation. We found that increased active Rab5 (Rab5 hyperactivation) in addition to reduced active Rab7 (Rab7 inactivation) occurs in the absence of Mon1. We present evidence showing that the severe defects in endosome maturation in Mon1-KO cells are attributable to Rab5 hyperactivation rather than to Rab7 inactivation. We then identified TBC1D18 as a Rab5-GAP by comprehensive screening of TBC-domain-containing Rab-GAPs. Expression of TBC1D18 in Mon1-KO cells rescued the defects in endosome maturation, whereas its depletion attenuated endosome formation and degradation of endocytosed cargos. Moreover, TBC1D18 was found to be associated with Mon1, and it localized in close proximity to lysosomes in a Mon1-dependent manner.

Also flagged:influenza virus infectioninfectionsinterferonIFNfactorSTAT
Journal Article 2022-10-05 ✓ 2 Snippets Forst CV, Martin-Sancho L, Tripathi S, Wang G, Dos Anjos Borges LG, Wang M, Geber A, Lashua L, Ding T, Zhou X, Carter CE, Metreveli G, Rodriguez-Frandsen A, Urbanowski MD, White KM, Stein DA, Moulton H, Chanda SK, Pache L, Shaw ML, Ross TM, Ghedin E, García-Sastre A, Zhang B.
In-Text Gene Mentions

…as IFI16 ,ZNFX1, and ATAD1…

…, PSAP ,STAU1, and TGFBI…

Show Full Abstract

Molecular responses to influenza A virus (IAV) infections vary between mammalian species. To identify conserved and species-specific molecular responses, we perform a comparative study of transcriptomic data derived from blood cells, primary epithelial cells, and lung tissues collected from IAV-infected humans, ferrets, and mice. The molecular responses in the human host have unique functions such as antigen processing that are not observed in mice or ferrets. Highly conserved gene coexpression modules across the three species are enriched for IAV infection-induced pathways including cell cycle and interferon (IFN) signaling. <i>TDRD7</i> is predicted as an IFN-inducible host factor that is up-regulated upon IAV infection in the three species. <i>TDRD7</i> is required for antiviral IFN response, potentially modulating IFN signaling via the JAK/STAT/IRF9 pathway. Identification of the common and species-specific molecular signatures, networks, and regulators of IAV infection provides insights into host-defense mechanisms and will facilitate the development of novel therapeutic interventions against IAV infection.

Also flagged:Ironhemoglobinizationoxygenhematopoiesisiron-regulatory protein 1IRP1
Journal Article 2022-10-05 ✓ 2 Snippets Bonadonna M, Altamura S, Tybl E, Palais G, Qatato M, Polycarpou-Schwarz M, Schneider M, Kalk C, Rüdiger W, Ertl A, Anstee N, Bogeska R, Helm D, Milsom MD, Galy B.
In-Text Gene Mentions

…Regnase-1 (ZC3H12A) andRoquin-1(RC3H1) nucleases (…

…(ZC3H12A) and Roquin-1 (RC3H1) nucleases ( 5…

Show Full Abstract

Iron is mostly devoted to the hemoglobinization of erythrocytes for oxygen transport. However, emerging evidence points to a broader role for the metal in hematopoiesis, including the formation of the immune system. Iron availability in mammalian cells is controlled by iron-regulatory protein 1 (IRP1) and IRP2. We report that global disruption of both IRP1 and IRP2 in adult mice impairs neutrophil development and differentiation in the bone marrow, yielding immature neutrophils with abnormally high glycolytic and autophagic activity, resulting in neutropenia. IRPs promote neutrophil differentiation in a cell intrinsic manner by securing cellular iron supply together with transcriptional control of neutropoiesis to facilitate differentiation to fully mature neutrophils. Unlike neutrophils, monocyte count was not affected by IRP and iron deficiency, suggesting a lineage-specific effect of iron on myeloid output. This study unveils the previously unrecognized importance of IRPs and iron metabolism in the formation of a major branch of the innate immune system.

Also flagged:ironhypoferremiainflammatory responseinfectionserythropoiesisgranulopoiesis
Journal Article 2022-10-05 ✓ 1 Snippet Frost JN, Wideman SK, Preston AE, Teh MR, Ai Z, Wang L, Cross A, White N, Yazicioglu Y, Bonadonna M, Clarke AJ, Armitage AE, Galy B, Udalova IA, Drakesmith H.
In-Text Gene Mentions

…results from iron-loadedhemochromatosisand dialysis patients,…

Show Full Abstract

Low plasma iron (hypoferremia) induced by hepcidin is a conserved inflammatory response that protects against infections but inhibits erythropoiesis. How hypoferremia influences leukocytogenesis is unclear. Using proteomic data, we predicted that neutrophil production would be profoundly more iron-demanding than generation of other white blood cell types. Accordingly in mice, hepcidin-mediated hypoferremia substantially reduced numbers of granulocytes but not monocytes, lymphocytes, or dendritic cells. Neutrophil rebound after anti-Gr-1-induced neutropenia was blunted during hypoferremia but was rescued by supplemental iron. Similarly, hypoferremia markedly inhibited pharmacologically stimulated granulopoiesis mediated by granulocyte colony-stimulating factor and inflammation-induced accumulation of neutrophils in the spleen and peritoneal cavity. Furthermore, hypoferremia specifically altered neutrophil effector functions, suppressing antibacterial mechanisms but enhancing mitochondrial reactive oxygen species-dependent NETosis associated with chronic inflammation. Notably, antagonizing endogenous hepcidin during acute inflammation enhanced production of neutrophils. We propose plasma iron modulates the profile of innate immunity by controlling monocyte-to-neutrophil ratio and neutrophil activity in a therapeutically targetable system.

Also flagged:Gallbladder carcinomacancerchronic cholecystitisPLA2G2Atumorcholecystitis
Journal Article 2022-10-05 ✓ 5 Snippets Wang X, Liu C, Chen J, Chen L, Ren X, Hou M, Cui X, Jiang Y, Liu E, Zong Y, Duan A, Fu X, Yu W, Zhao X, Yang Z, Zhang Y, Fu J, Wang H.
In-Text Gene Mentions

For instance, GBC9-MT showed elevated expression of CD24 (immune checkpoint in promoting immune evasion) and IGFBP2 (metabolic checkpoint in promoting tumor growth), and GBC10-MT displayed cancer stem cell signature (OLFM4) and enhanced cell migration (e.g., CLDN3, CEACAM5) (Supplementary Table S6).

…EPC markers (e.g.,OLFM4, PHGR1 )…

…, NR2F1/2 ,SOX6) and bile…

…( REG4 ,OLFM4, MUC2 )…

…cell signature (OLFM4) and enhanced…

Show Full Abstract

Gallbladder carcinoma (GBC) is the most common biliary tract malignancy with the lowest survival rate, primarily arising from chronic inflammation. To better characterize the progression from inflammation to cancer to metastasis, we performed single-cell RNA sequencing across samples of 6 chronic cholecystitis, 12 treatment-naive GBCs, and 6 matched metastases. Benign epithelial cells from inflamed gallbladders displayed resting, immune-regulating, and gastrointestinal metaplastic phenotypes. A small amount of PLA2G2A<sup>+</sup> epithelial cells with copy number variation were identified from a histologically benign sample. We validated significant overexpression of PLA2G2A across in situ GBCs, together with increased proliferation and cancer stemness in PLA2G2A-overexpressing GBC cells, indicating an important role for PLA2G2A during early carcinogenesis. Malignant epithelial cells displayed pervasive cancer hallmarks and cellular plasticity, differentiating into metaplastic, inflammatory, and mesenchymal subtypes with distinct transcriptomic, genomic, and prognostic patterns. Chronic cholecystitis led to an adapted microenvironment characterized by MDSC-like macrophages, CD8<sup>+</sup> T<sub>RM</sub> cells, and CCL2<sup>+</sup> immunity-regulating fibroblasts. By contrast, GBC instigated an aggressive and immunosuppressive microenvironment, featured by tumor-associated macrophages, Treg cells, CD8<sup>+</sup> T<sub>EX</sub> cells, and STMN1<sup>+</sup> tumor-promoting fibroblasts. Single-cell and bulk RNA-seq profiles consistently showed a more suppressive immune milieu for GBCs with inflammatory epithelial signatures, coupled with strengthened epithelial-immune crosstalk. We further pinpointed a subset of senescence-like fibroblasts (FN1<sup>+</sup>TGM2<sup>+</sup>) preferentially enriched in metastatic lesions, which promoted GBC migration and invasion via their secretory phenotype. Collectively, this study provides comprehensive insights into epithelial and microenvironmental reprogramming throughout cholecystitis-propelled carcinogenesis and metastasis, laying a new foundation for the precision therapy of GBC.

Also flagged:virulence factorhost cellGKN1GKN2PSCAhost cells
Journal Article 2022-10-05 No Snippets Aguilar C, Pauzuolis M, Pompaiah M, Vafadarnejad E, Arampatzi P, Fischer M, Narres D, Neyazi M, Kayisoglu Ö, Sell T, Blüthgen N, Morkel M, Wiegering A, Germer CT, Kircher S, Rosenwald A, Saliba AE, Bartfeld S.
Show Full Abstract

The human gastric epithelium forms highly organized gland structures with different subtypes of cells. The carcinogenic bacterium Helicobacter pylori can attach to gastric cells and subsequently translocate its virulence factor CagA, but the possible host cell tropism of H. pylori is currently unknown. Here, we report that H. pylori preferentially attaches to differentiated cells in the pit region of gastric units. Single-cell RNA-seq shows that organoid-derived monolayers recapitulate the pit region, while organoids capture the gland region of the gastric units. Using these models, we show that H. pylori preferentially attaches to highly differentiated pit cells, marked by high levels of GKN1, GKN2 and PSCA. Directed differentiation of host cells enable enrichment of the target cell population and confirm H. pylori preferential attachment and CagA translocation into these cells. Attachment is independent of MUC5AC or PSCA expression, and instead relies on bacterial TlpB-dependent chemotaxis towards host cell-released urea, which scales with host cell size.

Also flagged:HES3penicillinstreptomycinRho-associated protein kinaseROCKY-27632
Journal Article 2022-10-05 No Snippets Fleck JS, Jansen SMJ, Wollny D, Zenk F, Seimiya M, Jain A, Okamoto R, Santel M, He Z, Camp JG, Treutlein B.
Show Full Abstract

Self-organizing neural organoids grown from pluripotent stem cells<sup>1-3</sup> combined with single-cell genomic technologies provide opportunities to examine gene regulatory networks underlying human brain development. Here we acquire single-cell transcriptome and accessible chromatin data over a dense time course in human organoids covering neuroepithelial formation, patterning, brain regionalization and neurogenesis, and identify temporally dynamic and brain-region-specific regulatory regions. We developed Pando-a flexible framework that incorporates multi-omic data and predictions of transcription-factor-binding sites to infer a global gene regulatory network describing organoid development. We use pooled genetic perturbation with single-cell transcriptome readout to assess transcription factor requirement for cell fate and state regulation in organoids. We find that certain factors regulate the abundance of cell fates, whereas other factors affect neuronal cell states after differentiation. We show that the transcription factor GLI3 is required for cortical fate establishment in humans, recapitulating previous research performed in mammalian model systems. We measure transcriptome and chromatin accessibility in normal or GLI3-perturbed cells and identify two distinct GLI3 regulomes that are central to telencephalic fate decisions: one regulating dorsoventral patterning with HES4/5 as direct GLI3 targets, and one controlling ganglionic eminence diversification later in development. Together, we provide a framework for how human model systems and single-cell technologies can be leveraged to reconstruct human developmental biology.

Also flagged:Pediatric encephalitisEncephalitisencephalopathypleocytosisneuroinflammatory disordershemophagocytic lymphohistiocytosis
Journal Article 2022-10-05 ✓ 2 Snippets Malik D, Simon DW, Thakkar K, Rajan DS, Kernan KF.
In-Text Gene Mentions

Other risk polymorphisms included Crohn’s disease: NOD2 p.Leu248Arg; FCN3 deficiency: FCN3 p.Leu117SerfsTer65; Increased IL-6, TNF-ɑ, Ig levels: CD40 p.Pro227Ala; MASP2 deficiency: MASP2 p.Asp120Gly; Reduced apoptotic function: CASP10 p.Tyr446Cys; and leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation: DARS2 p.Gly338Gln.

…and lactate elevation:DARS2p.Gly338Gln.…

Show Full Abstract

Pediatric encephalitis has significant morbidity and mortality, yet 50% of cases are unexplained. Host genetics plays a role in encephalitis' development; however, the contributing variants are poorly understood. One child with anti-NMDA receptor encephalitis and ten with unexplained encephalitis underwent whole genome sequencing to identify rare candidate variants in genes known to cause monogenic immunologic and neurologic disorders, and polymorphisms associated with increased disease risk. Using the professional Human Genetic Mutation Database (Qiagen), we divided the candidate variants into three categories: monogenic deleterious or potentially deleterious variants (1) in a disease-consistent inheritance pattern; (2) in carrier states; and (3) disease-related polymorphisms. Six patients (55%) had a deleterious or potentially deleterious variant in a disease-consistent inheritance pattern, five (45%) were heterozygous carriers for an autosomal recessive condition, and six (55%) carried a disease-related polymorphism. Finally, seven (64%) had more than one variant, suggesting possible polygenetic risk. Among variants identified were those implicated in atypical hemolytic uremic syndrome, common variable immunodeficiency, hemophagocytic lymphohistiocytosis, and systemic lupus erythematosus. This preliminary study shows genetic variation related to inborn errors of immunity in acute pediatric encephalitis. Future research is needed to determine if these variants play a functional role in the development of unexplained encephalitis.

Also flagged:mitochondrialmatrixcytosolHSP70co-chaperoneGRPEL1
Journal Article 2022-10-05 ✓ 1 Snippet Neupane N, Rajendran J, Kvist J, Harjuhaahto S, Hu B, Kinnunen V, Yang Y, Nieminen AI, Tyynismaa H.
In-Text Gene Mentions

…expressed in theDars2knockout mice, which…

Show Full Abstract

Effective protein import from cytosol is critical for mitochondrial functions and metabolic regulation. We describe here the mammalian muscle-specific and systemic consequences to disrupted mitochondrial matrix protein import by targeted deletion of the mitochondrial HSP70 co-chaperone GRPEL1. Muscle-specific loss of GRPEL1 caused rapid muscle atrophy, accompanied by shut down of oxidative phosphorylation and mitochondrial fatty acid oxidation, and excessive triggering of proteotoxic stress responses. Transcriptome analysis identified new responders to mitochondrial protein import toxicity, such as the neurological disease-linked intermembrane space protein CHCHD10. Besides communication with ER and nucleus, we identified crosstalk of distressed mitochondria with peroxisomes, in particular the induction of peroxisomal Acyl-CoA oxidase 2 (ACOX2), which we propose as an ATF4-regulated peroxisomal marker of integrated stress response. Metabolic profiling indicated fatty acid enrichment in muscle, a shift in TCA cycle intermediates in serum and muscle, and dysregulated bile acids. Our results demonstrate the fundamental importance of GRPEL1 and provide a robust model for detecting mammalian inter-organellar and systemic responses to impaired mitochondrial matrix protein import and folding.

Also flagged:progesterone receptorprogesteroneoestrogenoestrogen receptorsPGRdecidualization
Journal Article 2022-10-05 No Snippets Lee SH, Lim CL, Shen W, Tan SMX, Woo ARE, Yap YHY, Sian CAS, Goh WWB, Yu WP, Li L, Lin VCL.
Show Full Abstract

<h4>Background</h4>Progesterone receptor (PGR) is a master regulator of uterine function through antagonistic and synergistic interplays with oestrogen receptors. PGR action is primarily mediated by activation functions AF1 and AF2, but their physiological significance is unknown.<h4>Results</h4>We report the first study of AF1 function in mice. The AF1 mutant mice are infertile with impaired implantation and decidualization. This is associated with a delay in the cessation of epithelial proliferation and in the initiation of stromal proliferation at preimplantation. Despite tissue selective effect on PGR target genes, AF1 mutations caused global loss of the antioestrogenic activity of progesterone in both pregnant and ovariectomized models. Importantly, the study provides evidence that PGR can exert an antioestrogenic effect by genomic inhibition of Esr1 and Greb1 expression. ChIP-Seq data mining reveals intermingled PGR and ESR1 binding on Esr1 and Greb1 gene enhancers. Chromatin conformation analysis shows reduced interactions in these genes' loci in the mutant, coinciding with their upregulations.<h4>Conclusion</h4>AF1 mediates genomic inhibition of ESR1 action globally whilst it also has tissue-selective effect on PGR target genes.

Also flagged:Wntβ-Cateninembryogenesisembryo developmentmesendodermectoderm differentiation
Journal Article 2022-10-05 ✓ 1 Snippet Shen X, Li M, Wang C, Liu Z, Wu K, Wang A, Bi C, Lu S, Long H, Zhu G.
In-Text Gene Mentions

…the Hif-1α-OE_vs_Con group;Pou3f2, a neural lineage…

Show Full Abstract

<h4>Background</h4>Hypoxia naturally happens in embryogenesis and thus serves as an important environmental factor affecting embryo development. Hif-1α, an essential hypoxia response factor, was mostly considered to mediate or synergistically regulate the effect of hypoxia on stem cells. However, the function and relationship of hypoxia and Hif-1α in regulating mesendoderm differentiation remains controversial.<h4>Results</h4>We here discovered that hypoxia dramatically suppressed the mesendoderm differentiation and promoted the ectoderm differentiation of mouse embryonic stem cells (mESCs). However, hypoxia treatment after mesendoderm was established promoted the downstream differentiation of mesendoderm-derived lineages. These effects of hypoxia were mediated by the repression of the Wnt/β-Catenin pathway and the Wnt/β-Catenin pathway was at least partially regulated by the Akt/Gsk3β axis. Blocking the Wnt/β-Catenin pathway under normoxia using IWP2 mimicked the effects of hypoxia while activating the Wnt/β-Catenin pathway with CHIR99021 fully rescued the mesendoderm differentiation suppression caused by hypoxia. Unexpectedly, Hif-1α overexpression, in contrast to hypoxia, promoted mesendoderm differentiation and suppressed ectoderm differentiation. Knockdown of Hif-1α under normoxia and hypoxia both inhibited the mesendoderm differentiation. Moreover, hypoxia even suppressed the mesendoderm differentiation of Hif-1α knockdown mESCs, further implying that the effects of hypoxia on the mesendoderm differentiation were Hif-1α independent. Consistently, the Wnt/β-Catenin pathway was enhanced by Hif-1α overexpression and inhibited by Hif-1α knockdown. As shown by RNA-seq, unlike hypoxia, the effect of Hif-1α was relatively mild and selectively regulated part of hypoxia response genes, which fine-tuned the effect of hypoxia on mESC differentiation.<h4>Conclusions</h4>This study revealed that hypoxia is fine-tuned by Hif-1α and regulates the mesendoderm and ectoderm differentiation by manipulating the Wnt/β-Catenin pathway, which contributed to the understanding of hypoxia-mediated regulation of development.

Also flagged:Synthesisopioid receptorslipasepropan-2-olvinylacetate
Journal Article 2022-10-05 No Snippets Borowiecki P.
Show Full Abstract

To develop potent and safer analgesics, we designed and synthesized a novel enantiomerically enriched ethereal analog of (R)-iso-moramide, namely 2-[(2R)-2-(morpholin-4-yl)propoxy]-2,2-diphenyl-1-(pyrrolidin-1-yl)ethan-1-one. The titled active agent can potentially serve as a powerful synthetic opiate with an improved affinity and selectivity toward opioid receptors (ORs). This hypothesis was postulated based on docking studies regarding the respective complexes between the designed ligand and µ-OR, δ-OR, and κ-OR. The key step of the elaborated asymmetric synthesis of novel analog involves lipase-catalyzed kinetic resolution of racemic 1-(morpholin-4-yl)propan-2-ol, which was accomplished on a 10 g scale via an enantioselective transesterification employing vinyl acetate as an irreversible acyl donor in tert-butyl methyl ether (MTBE) as the co-solvent. Next, the obtained homochiral (S)-(+)-morpholino-alcohol (>99% ee) was functionalized into corresponding chloro-derivative using thionyl chloride (SOCl2) or the Appel reaction conditions. Further transformation with N-diphenylacetyl-1-pyrrolidine under phase-transfer catalysis (PTC) conditions using O2-saturated DMSO/NaOH mixture as an oxidant furnished the desired levorotatory isomer of the title product isolated in 26% total yield after three steps, and with 89% ee. The absolute configuration of the key-intermediate of (R)-(−)-iso-moramide was determined using a modified form of Mosher’s methodology. The preparation of the optically active dextrorotatory isomer of the titled product (87% ee) was carried out essentially by the same route, utilizing (R)-(−)-1-(morpholin-4-yl)propan-2-ol (98% ee) as a key intermediate. The spectroscopic characterization of the ethereal analog of iso-moramide and the enantioselective retention relationship of its enantiomers using HPLC on the cellulose-based chiral stationary phase were performed. Moreover, as a proof-of-principle, single-crystal X-ray diffraction (XRD) analysis of the synthesized 2-[(2R)-2-(morpholin-4-yl)propoxy]-2,2-diphenyl-1-(pyrrolidin-1-yl)ethan-1-one is reported.

Also flagged:polysaccharidestumortumorshematopoiesisfucoidancancer
Journal Article 2022-10-05 ✓ 1 Snippet Kiselevskiy MV, Anisimova NY, Ustyuzhanina NE, Vinnitskiy DZ, Tokatly AI, Reshetnikova VV, Chikileva IO, Shubina IZ, Kirgizov KI, Nifantiev NE.
In-Text Gene Mentions

…thrombin with antithrombin (ATIII) or heparin cofactor…

Show Full Abstract

Fucoidans are natural sulfated polysaccharides that have a wide range of biological functions and are regarded as promising antitumor agents. The activity of various fucoidans and their derivatives has been demonstrated in vitro on tumor cells of different histogenesis and in experiments on mice with grafted tumors. However, these experimental models showed low levels of antitumor activity and clinical trials did not prove that this class of compounds could serve as antitumor drugs. Nevertheless, the anti-inflammatory, antiangiogenic, immunostimulating, and anticoagulant properties of fucoidans, as well as their ability to stimulate hematopoiesis during cytostatic-based antitumor therapy, suggest that effective fucoidan-based drugs could be designed for the supportive care and symptomatic therapy of cancer patients. The use of fucoidans in cancer patients after chemotherapy and radiation therapy might promote the rapid improvement of hematopoiesis, while their anti-inflammatory, immunomodulatory, and anticoagulant effects have the potential to improve the quality of life of patients with advanced cancer.

Also flagged:,6difluorobenzamides1,2,3-triazoles1,3,4-oxadiazolesmethylene3
Journal Article 2022-10-05 No Snippets Barbier T, Badiou C, Davy F, Queneau Y, Dumitrescu O, Lina G, Soulère L.
Show Full Abstract

Five series of heterocyclic tripartite 2,6-difluorobenzamides, namely 1,2,3-triazoles, 1,2,4- and 1,3,4-oxadiazoles, analogs of reported model anti-staphylococcal compounds, were prepared. The purpose was to investigate the influence of the nature of the heterocyclic central scaffold on the biological activity against three strains of <i>S. aureus,</i> including two drug-resistant ones. Among the 15 compounds of the new collection, a 3-(4-<i>tert</i>-butylphenyl)-1,2,4-oxadiazole linked via a methylene group with a 2,6-difluorobenzamide moiety (<b>II.c</b>) exhibited a minimal inhibitory concentration between 0.5 and 1 µg/mL according to the strain. Subsequent studies on <b>II.c</b> demonstrated no human cytotoxicity, while targeting the bacterial divisome.

Also flagged:dibenzothiophenemineralization2-hydroxybiphenylsulfurcarbonthiophenic compounds
Journal Article 2022-10-05 No Snippets Martínez I, Mohamed ME, García JL, Díaz E.
Show Full Abstract

A synthetic dibenzothiophene (DBT) mineralization pathway has been engineered in recombinant cells of <i>Pseudomonas azelaica</i> Aramco J strain for its use in biodesulfurization of thiophenic compounds and crude oil. This functional pathway consists of a combination of a recombinant 4S pathway responsible for the conversion of DBT into 2-hydroxybiphenyl (2HBP) and a 2HBP mineralization pathway that is naturally present in the parental <i>P. azelaica</i> Aramco J strain. This novel approach allows overcoming one of the major bottlenecks of the biodesulfurization process, i.e., the feedback inhibitory effect of 2HBP on the 4S pathway enzymes. Resting cells-based biodesulfurization assays using DBT as a sulfur source showed that the 2HBP generated from the 4S pathway is subsequently metabolized by the cell, yielding an increase of 100% in DBT removal with respect to previously optimized <i>Pseudomonas putida</i> biodesulfurizing strains. Moreover, the recombinant <i>P. azelaica</i> Aramco J strain was able to use DBT as a carbon source, representing the best characterized biocatalyst harboring a DBT mineralization pathway and constituting a suitable candidate to develop future bioremediation/bioconversion strategies for oil-contaminated sites.

Also flagged:TBMtb infectionhost cellinflammatory responselatent tuberculosis infectionTB infection
Journal Article 2022-10-05 ✓ 1 Snippet Gough M, Singh DK, Singh B, Kaushal D, Mehra S.
In-Text Gene Mentions

…transport and signaling (CACNA1Eand CACNA1I in…

Show Full Abstract

<i>Mycobacterium tuberculosis</i> (<i>Mtb</i>) has developed specialized mechanisms to parasitize its host cell, the macrophage. These mechanisms allow it to overcome killing by oxidative burst and persist in the wake of an inflammatory response. <i>Mtb</i> infection in the majority of those exposed is controlled in an asymptomatic form referred to as latent tuberculosis infection (LTBI). HIV is a well-known catalyst of reactivation of LTBI to active TB infection (ATB). Through the use of nonhuman primates (NHPs) co-infected with <i>Mtb</i> and Simian Immunodeficiency Virus (<i>Mtb</i>/SIV), we are able to simulate human progression of TB/AIDS comorbidity. The advantage of NHP models is that they recapitulate the breadth of human TB outcomes, including immune control of infection, and loss of this control due to SIV co-infection. Identifying correlates of immune control of infection is important for both vaccine and therapeutics development. Using macaques infected with <i>Mtb</i> or <i>Mtb</i>/SIV and with different clinical outcomes we attempted to identify signatures between those that progress to active infection after SIV challenge (reactivators) and those that control the infection (non-reactivators). We particularly focused on pathways relevant to myeloid origin cells such as macrophages, as these innate immunocytes have an important contribution to the initial control or the lack thereof, following <i>Mtb</i> infection. Using bacterial burden, C-reactive protein (CRP), and other clinical indicators of disease severity as a guide, we were able to establish gene signatures of host disease state and progression. In addition to gene signatures, clustering algorithms were used to differentiate between host disease states and identify relationships between genes. This allowed us to identify clusters of genes which exhibited differential expression profiles between the three groups of macaques: ATB, LTBI and <i>Mtb</i>/SIV. The gene signatures were associated with pathways relevant to apoptosis, ATP production, phagocytosis, cell migration, and Type I interferon (IFN), which are related to macrophage function. Our results suggest novel macrophage functions that may play roles in the control of <i>Mtb</i> infection with and without co-infection with SIV. These results particularly point towards an interplay between Type I IFN signaling and IFN-γ signaling, and the resulting impact on lung macrophages as an important determinant of progression to TB.

Also flagged:Cuproptosisimmune responseImmune checkpoint geneshepatocellular carcinomacopperdeath
Journal Article 2022-10-05 ✓ 5 Snippets Cong T, Luo Y, Liu Y, Yang C, Yang H, Li Y, Li J, Li X.
In-Text Gene Mentions

(A) Univariate analysis shows that cuproptosis-related ICGs, including CD276, LGALS9, CD40LG, BTNL9, SIRPA, BTN2A1, and TNFRSF4 genes, were associated with the prognosis of HCC patients.

Cano et al. (Cano et al., 2021) reported that the BTN2A1 gene influences Vγ9Vδ2+ T cells to mediate cytotoxic attacks on cancer cells.

The anti-BTN2A1 monoclonal antibodies help to mitigate the cytotoxic effects of Vγ9Vδ2+ T cells on cancer cells (Cano et al., 2021).

…, SIRPA ,BTN2A1, and TNFRSF4…

…CD40LG , andBTN2A1) ( Figures…

Show Full Abstract

Immune checkpoint genes (ICGs), the foundation of immunotherapy, are involved in the incidence and progression of hepatocellular carcinoma (HCC). Cuproptosis is characterized by copper-induced cell death, and this novel cell death pathway has piqued the interest of researchers in recent years. It is worth noting that there is little information available in the literature to determine the relationship between cuproptosis and anti-tumor immunity. We identified 39 cuproptosis-related ICGs using ICGs co-expressed with cuproptosis-related genes. A prognostic risk signature was constructed using the Cox regression and the least absolute shrinkage and selection operator analysis methods. The signature was built using the Cancer Genome Atlas (TCGA)-Liver Hepatocellular Carcinoma database. The TCGA and International Cancer Genome Consortium cohorts were classified into two groups; the low- and high-risk groups were determined using a prognostic signature comprised of five genes. The multivariate Cox regression analysis revealed that the signature could independently predict overall survival. Furthermore, the level of immune infiltration analysis revealed the robustness of the prognostic signature-immune cell infiltration relationship observed for Tregs, macrophages, helper T cells, and naive B cells. Both groups showed significant differences in immune checkpoint expression levels. The gene enrichment analysis was used for characterization, and the results revealed that enriching various pathways such as PI3K-AKT-mTOR signaling, glycolysis, Wnt/beta-catenin signaling, and unfolded protein response could potentially influence the prognosis of patients with HCC and the level of immune infiltration. The sensitivity of the two groups of patients to various drug-targeted therapy methods and immunotherapy was analyzed. In conclusion, the findings presented here lay the foundation for developing individualized treatment methods for HCC patients. The findings also revealed that studying the cuproptosis-based pathway can aid in the prognosis of HCC patients. It is also possible that cuproptosis contributes to developing anti-tumor immunity in patients.

Also flagged:infertilityMYRFLFANCAINSL3USP9XSHF
Journal Article 2022-10-05 No Snippets Zhao S, Sun W, Chen SY, Li Y, Wang J, Lai S, Jia X.
Show Full Abstract

Cattle-yak, the first-generation offspring of cattle and yak, inherited many excellent characteristics from their parents. However, F1 male hybrid infertility restricts the utilization of heterosis greatly. In this study, we first compared the testicular tissue histological characteristics of three cattle, three yaks, and three cattle-yak. Then we explored the miRNA profiles and the target functions of nine samples with RNA-seq technology. We further analyzed the function of DE gene sets of mRNA profiles identified previously with GSEA. Testicular histology indicated that the seminiferous tubules became vacuolated and few active germ cells can be seen. RNA-seq results showed 47 up-regulated and 34 down-regulated, 16 up-regulated and 21 down-regulated miRNAs in cattle and yaks compared with cattle-yak, respectively. From the intersection of DE miRNAs, we identified that bta-miR-7 in cattle-yak is down-regulated. Target prediction indicated that the filtered genes especially MYRFL, FANCA, INSL3, USP9X, and SHF of bta-miR-7 may play crucial roles in the reproductive process. With further network analysis and GSEA, we screened such hub genes and function terms, we also found some DE gene sets that enriched in ATP binding, DNA binding, and reproduction processes. We concluded that bta-miR-7 may play an important role in influencing fecundity. Our study provides new insights for explaining the molecular mechanism of cattle-yak infertility.

Also flagged:inseminationinseminationsgene expressionchromatinPRM1protamine deficiency
Journal Article 2022-10-05 ✓ 1 Snippet Donnellan EM, Perrier JP, Keogh K, Štiavnická M, Collins CM, Dunleavy EM, Sellem E, Bernecic NC, Lonergan P, Kenny DA, Fair S.
In-Text Gene Mentions

…CRISP2, CCT8 andPEBP1( 9 ),…

Show Full Abstract

Bulls used in artificial insemination, with apparently normal semen quality, can vary significantly in their field fertility. This study aimed to characterize the transcriptome of spermatozoa from high (HF) and low (LF) fertility bulls at the mRNA and miRNA level in order to identify potential novel markers of fertility. Holstein-Friesian bulls were assigned to either the HF or LF group (<i>n</i> = 10 per group) based on an adjusted national fertility index from a minimum of 500 inseminations. Total RNA was extracted from a pool of frozen-thawed spermatozoa from three different ejaculates per bull, following which mRNA-seq and miRNA-seq were performed. Six mRNAs and 13 miRNAs were found differentially expressed (<i>P</i> < 0.05, FC > 1.5) between HF and LF bulls. Of particular interest, the gene pathways targeted by the 13 differentially expressed miRNAs were related to embryonic development and gene expression regulation. Previous studies reported that disruptions to protamine 1 mRNA (<i>PRM1</i>) had deleterious consequences for sperm chromatin structure and fertilizing ability. Notably, <i>PRM1</i> exhibited a higher expression in spermatozoa from LF than HF bulls. In contrast, Western Blot analysis revealed a decrease in PRM1 protein abundance for spermatozoa from LF bulls; this was not associated with increased protamine deficiency (measured by the degree of chromatin compaction) or DNA fragmentation, as assessed by flow cytometry analyses. However, protamine deficiency was positively and moderately correlated with the percentage of spermatozoa with DNA fragmentation, irrespective of fertility group. This study has identified potential biomarkers that could be used for improving semen quality assessments of bull fertility.

Also flagged:transcription factorsGene expressionchromatinTFCancerneoplasia
Journal Article 2022-10-05 No Snippets Donohue LKH, Guo MG, Zhao Y, Jung N, Bussat RT, Kim DS, Neela PH, Kellman LN, Garcia OS, Meyers RM, Altman RB, Khavari PA.
Show Full Abstract

Gene expression is controlled by transcription factors (TFs) that bind cognate DNA motif sequences in <i>cis</i>-regulatory elements (CREs). The combinations of DNA motifs acting within homeostasis and disease, however, are unclear. Gene expression, chromatin accessibility, TF footprinting, and H3K27ac-dependent DNA looping data were generated and a random-forest-based model was applied to identify 7,531 cell-type-specific <i>cis</i>-regulatory modules (CRMs) across 15 diploid human cell types. A co-enrichment framework within CRMs nominated 838 cell-type-specific, recurrent heterotypic DNA motif combinations (DMCs), which were functionally validated using massively parallel reporter assays. Cancer cells engaged DMCs linked to neoplasia-enabling processes operative in normal cells while also activating new DMCs only seen in the neoplastic state. This integrative approach identifies cell-type-specific <i>cis</i>-regulatory combinatorial DNA motifs in diverse normal and diseased human cells and represents a general framework for deciphering <i>cis</i>-regulatory sequence logic in gene regulation.

Also flagged:intellectuallywateriron deficiencybehavioralidiopathicdevelopmental intellectual disability
Journal Article 2022-10-05 No Snippets Brown MJ, Patel P, Nash E, Dikid T, Blanton C, Forsyth JE, Fontaine R, Sharma P, Keith J, Babu B, Vaisakh TP, Azarudeen MJ, Riram B, Shrivastava A.
Show Full Abstract

Childhood lead exposure remains a key health concern for officials worldwide, contributing some 600,000 new cases of intellectually disabled children annually. Most children affected by high exposure to lead live in low- and middle-income countries. The leaded gasoline phase out in India was completed in 2000. Yet, in 2020, an estimated 275 million children aged 0 to 9 years had blood lead levels (BLLs) ≥ 5 μg/dL known to adversely affect intelligence and behavior. Lead sources reported in India include spices, cookware, paint, traditional medicines and cosmetics, and lead-acid battery recycling and repair. However, their relative contribution has not been characterized. More than 200 lead pollution sites related to battery recycling and repair activities were identified in Bihar and Jharkhand, India. Ninety percent of the recycling sites had soil lead concentrations exceeding the US Environmental Protection Agency's standards. We compared blood and environmental lead levels in two groups of children in Patna, Bihar. Households in proximity to battery recycling operations (Proximal n = 67) versus households distal to these operations (Distal n = 68). The average age of children was 40 months; 46% were female. Overall, the geometric mean (GM) BLL was 11.6 μg/dL. GM BLLs of children in Proximal and Distal households were not significantly different (10.2 μg/dL vs. 13.1 μg/dL respectively; p≤0.07). About 87% children, 56 Proximal and 62 Distal had BLLs ≥5 μg/dl. Lead concentrations in environmental samples were significantly higher in Proximal households (soil mean 9.8 vs. 1.6 μg/ft2; dust mean 52.9 vs. 29.9 μg/ft2 p<0.001; Proximal vs. Distal respectively) whereas concentrations in all spices were higher in Distal households (mean 46.8 vs 134.5 ppm p<0.001; Proximal vs. Distal respectively), and turmeric (mean 59.4 vs. 216.9 ppm Proximal vs. Distal respectively). In multivariate analyses for all children lead in spices and turmeric and number of rooms in the house were significant while for the Proximal group only lead in spices remained in the model. The predictive value of these models was poor. For the Distal group, a model with lead concentration in spices, turmeric and soil and number of rooms in the house was a much better fit. Of the 34 water samples collected, 7 were above the Indian standard of 10 ppb for lead in drinking water (2 in the Proximal area, 5 in the Distal area). Children in Patna, Bihar, India are exposed to multiple sources of lead, with lead levels in house dust and loose, locally sourced spices the most likely to increase blood lead levels. A holistic approach to blood lead testing and source identification and remediation are necessary to prevent lead exposure.

Also flagged:AutophagyMacroautophagyautophagosomemembranecytoplasmiclysosomes
Journal Article 2022-10-05 No Snippets Pant A, Yao X, Lavedrine A, Viret C, Dockterman J, Chauhan S, Chong-Shan Shi, Manjithaya R, Cadwell K, Kufer TA, Kehrl JH, Coers J, Sibley LD, Faure M, Taylor GA, Chauhan S.
Show Full Abstract

Autophagy is a highly conserved process that utilizes lysosomes to selectively degrade a variety of intracellular cargo, thus providing quality control over cellular components and maintaining cellular regulatory functions. Autophagy is triggered by multiple stimuli ranging from nutrient starvation to microbial infection. Autophagy extensively shapes and modulates the inflammatory response, the concerted action of immune cells, and secreted mediators aimed to eradicate a microbial infection or to heal sterile tissue damage. Here, we first review how autophagy affects innate immune signaling, cell-autonomous immune defense, and adaptive immunity. Then, we discuss the role of non-canonical autophagy in microbial infections and inflammation. Finally, we review how crosstalk between autophagy and inflammation influences infectious, metabolic, and autoimmune disorders.

bioRxiv 2022-10-05 Preprint (No Snippets API) Barron JC, Nafar F, Parsons MP.
Show Full Abstract

Huntingtin (HTT), an exceptionally large protein with hundreds of interacting partners within the central nervous system, has been extensively studied due to its role in Huntington’s disease (HD) pathology. HD is a monogenic disorder caused by a polyglutamine repeat expansion in the HTT gene, which results in the production of a pathogenic mutant huntingtin (mHTT) protein, and toxic effects of this mutant protein in the context of HD have been well-established. Less-established, however, is the role of wild type HTT (wtHTT) in the adult brain, particularly in areas outside the corticostriatal pathway. wtHTT has previously been suggested to play a vital role in cellular functions that promote synapse homeostasis, such as fast axonal transport of synaptic cargo, vesicle replenishment and receptor localization and stability. Synaptic dysfunction precedes and predicts cell death in many neurodegenerative diseases including HD (termed synaptopathies) and whether proper synaptic transmission can be maintained without wtHTT in extrastriatal brain areas such as the hippocampus remains unknown. Consequences of wtHTT reduction in the adult brain are of particular importance as clinical trials for many non-selective HTT-lowering therapies for HD are underway, which are unable to distinguish between mHTT and wtHTT, and therefore reduce levels of both proteins. We investigated the consequences of wtHTT loss of function in the CA3-CA1 pathway of the adult hippocampus using a conditional knockout mouse model and found that 1-2 month deletion of wtHTT in excitatory hippocampal neurons inhibits post-tetanic potentiation and completely abolishes NMDA receptor-dependent long-term potentiation in these animals. These data reveal a novel role of wtHTT as an essential regulator of short- and long-term plasticity in the adult hippocampus.

Also flagged:Iron deficiencymaternal anemiaautism spectrum disordersironiron deficiency anemiapagophagia
Journal Article 2022-10-04 ✓ 1 Snippet Benson AE, Shatzel JJ, Ryan KS, Hedges MA, Martens K, Aslan JE, Lo JO.
In-Text Gene Mentions

Hemochromatosis

Show Full Abstract

Iron deficiency and/or iron deficiency anemia (IDA) complicate nearly 50% of pregnancies globally, negatively impacting both maternal and fetal outcomes. Iron deficiency can cause a range of symptoms that range from aggravating to debilitating including fatigue, poor quality of life, pagophagia, and restless leg syndrome. Iron deficiency and IDA are also associated with maternal complications including preterm labor, increased rates of cesarean delivery, postpartum hemorrhage, and maternal death. Fetal complications include increased rates of low birth weight and small for gestational age newborns. Prenatal maternal anemia has also been associated with autism spectrum disorders in the neonate, although causation is not established. Deficiency in the newborn is associated with compromised memory, processing, and bonding, with some of these deficits persisting into adulthood. Despite the prevalence and consequences associated with iron deficiency in pregnancy, data show that it is routinely undertreated. Due to the physiologic changes of pregnancy, all pregnant individuals should receive oral iron supplementation. However, the bioavailability of oral iron is poor and it is often ineffective at preventing and treating iron deficiency. Likewise, it frequently causes gastrointestinal symptoms that can worsen the quality of life in pregnancy. Intravenous iron formulations administered in a single or multiple dose series are now available. There is increasing data suggesting that newer intravenous formulations are safe and effective in the second and third trimesters and should be strongly considered in pregnant individuals without optimal response to oral iron repletion.

Also flagged:Cancerinfectionspaclitaxelpolyacrylamidetumorester
Journal Article 2022-10-04 No Snippets Bordat A, Boissenot T, Ibrahim N, Ferrere M, Levêque M, Potiron L, Denis S, Garcia-Argote S, Carvalho O, Abadie J, Cailleau C, Pieters G, Tsapis N, Nicolas J.
Show Full Abstract

Chemotherapy is almost exclusively administered via the intravenous (IV) route, which has serious limitations (e.g., patient discomfort, long hospital stays, need for trained staff, high cost, catheter failures, infections). Therefore, the development of effective and less costly chemotherapy that is more comfortable for the patient would revolutionize cancer therapy. While subcutaneous (SC) administration has the potential to meet these criteria, it is extremely restrictive as it cannot be applied to most anticancer drugs, such as irritant or vesicant ones, for local toxicity reasons. Herein, we report a facile, general, and scalable approach for the SC administration of anticancer drugs through the design of well-defined hydrophilic polymer prodrugs. This was applied to the anticancer drug paclitaxel (Ptx) as a worst-case scenario due to its high hydrophobicity and vesicant properties (two factors promoting necrosis at the injection site). After a preliminary screening of well-established polymers used in nanomedicine, polyacrylamide (PAAm) was chosen as a hydrophilic polymer owing to its greater physicochemical, pharmacokinetic, and tumor accumulation properties. A small library of Ptx-based polymer prodrugs was designed by adjusting the nature of the linker (ester, diglycolate, and carbonate) and then evaluated in terms of rheological/viscosity properties in aqueous solutions, drug release kinetics in PBS and in murine plasma, cytotoxicity on two different cancer cell lines, acute local and systemic toxicity, pharmacokinetics and biodistribution, and finally their anticancer efficacy. We demonstrated that Ptx-PAAm polymer prodrugs could be safely injected subcutaneously without inducing local toxicity while outperforming Taxol, the commercial formulation of Ptx, thus opening the door to the safe transposition from IV to SC chemotherapy.

Also flagged:GPCRGPCRsbindingligandsamino acidG-protein coupled receptors
Journal Article 2022-10-04 ✓ 1 Snippet Wakefield AE, Bajusz D, Kozakov D, Keserű GM, Vajda S.
In-Text Gene Mentions

GPR52

Show Full Abstract

Despite the growing number of G protein-coupled receptor (GPCR) structures, only 39 structures have been cocrystallized with allosteric inhibitors. These structures have been studied by protein mapping using the FTMap server, which determines the clustering of small organic probe molecules distributed on the protein surface. The method has found druggable sites overlapping with the cocrystallized allosteric ligands in 21 GPCR structures. Mapping of Alphafold2 generated models of these proteins confirms that the same sites can be identified without the presence of bound ligands. We then mapped the 394 GPCR X-ray structures available at the time of the analysis (September 2020). Results show that for each of the 21 structures with bound ligands there exist many other GPCRs that have a strong binding hot spot at the same location, suggesting potential allosteric sites in a large variety of GPCRs. These sites cluster at nine distinct locations, and each can be found in many different proteins. However, ligands binding at the same location generally show little or no similarity, and the amino acid residues interacting with these ligands also differ. Results confirm the possibility of specifically targeting these sites across GPCRs for allosteric modulation and help to identify the most likely binding sites among the limited number of potential locations. The FTMap server is available free of charge for academic and governmental use at https://ftmap.bu.edu/.

Also flagged:chromatinorganizationgene expressionNF-κBMycobacterium tuberculosis infectionmycobacterial disease
Journal Article 2022-10-04 No Snippets Lin D, Xu W, Hong P, Wu C, Zhang Z, Zhang S, Xing L, Yang B, Zhou W, Xiao Q, Wang J, Wang C, He Y, Chen X, Cao X, Man J, Reheman A, Wu X, Hao X, Hu Z, Chen C, Cao Z, Yin R, Fu ZF, Zhou R, Teng Z, Li G, Cao G.
Show Full Abstract

Immunocytes dynamically reprogram their gene expression profiles during differentiation and immunoresponse. However, the underlying mechanism remains elusive. Here, we develop a single-cell Hi-C method and systematically delineate the 3D genome and dynamic epigenetic atlas of macrophages during these processes. We propose "degree of disorder" to measure genome organizational patterns inside topologically-associated domains, which is correlated with the chromatin epigenetic states, gene expression, and chromatin structure variability in individual cells. Furthermore, we identify that NF-κB initiates systematic chromatin conformation reorganization upon Mycobacterium tuberculosis infection. The integrated Hi-C, eQTL, and GWAS analysis depicts the atlas of the long-range target genes of mycobacterial disease susceptible loci. Among these, the SNP rs1873613 is located in the anchor of a dynamic chromatin loop with LRRK2, whose inhibitor AdoCbl could be an anti-tuberculosis drug candidate. Our study provides comprehensive resources for the 3D genome structure of immunocytes and sheds insights into the order of genome organization and the coordinated gene transcription during immunoresponse.

Also flagged:gene expressioncell receptorgestationvariable antigen receptorsinfectionsviral infections
Journal Article 2022-10-04 ✓ 1 Snippet Sanchez Sanchez G, Papadopoulou M, Azouz A, Tafesse Y, Mishra A, Chan JKY, Fan Y, Verdebout I, Porco S, Libert F, Ginhoux F, Vandekerckhove B, Goriely S, Vermijlen D.
In-Text Gene Mentions

…tyrophillin-dependent (BTN3A1,BTN2A1, BTN3A2) 5 ,…

Show Full Abstract

Developmental thymic waves of innate-like and adaptive-like γδ T cells have been described, but the current understanding of γδ T cell development is mainly limited to mouse models. Here, we combine single cell (sc) RNA gene expression and sc γδ T cell receptor (TCR) sequencing on fetal and pediatric γδ thymocytes in order to understand the ontogeny of human γδ T cells. Mature fetal γδ thymocytes (both the Vγ9Vδ2 and nonVγ9Vδ2 subsets) are committed to either a type 1, a type 3 or a type 2-like effector fate displaying a wave-like pattern depending on gestation age, and are enriched for public CDR3 features upon maturation. Strikingly, these effector modules express different CDR3 sequences and follow distinct developmental trajectories. In contrast, the pediatric thymus generates only a small effector subset that is highly biased towards Vγ9Vδ2 TCR usage and shows a mixed type 1/type 3 effector profile. Thus, our combined dataset of gene expression and detailed TCR information at the single-cell level identifies distinct functional thymic programming of γδ T cell immunity in human.

Also flagged:hematological diseasessolid tumorscancerblood diseaseshematological malignancieshypoplastic
Journal Article 2022-10-04 ✓ 2 Snippets Lahtinen AK, Koski J, Ritari J, Hyvärinen K, Koskela S, Partanen J, Vettenranta K, Koskenvuo M, Niittyvuopio R, Salmenniemi U, Itälä-Remes M, Jahnukainen K, Kilpivaara O, Wartiovaara-Kautto U.
In-Text Gene Mentions

…e.g. with underlyinghemochromatosis, as was the…

…children with homozygousHFEmutations in the…

Show Full Abstract

Allogeneic hematopoietic stem cell transplantation (HSCT) provides patients with severe hematologic disease a well-established potential for curation. Incorporation of germline analyses in the workup of HSCT patients is not a common practice. Recognizing rare harmful germline variants may however affect patients' pre-transplantation care, choice of the stem cell donor, and complication risks. We analyzed a population-based series of germline exome data of 432 patients who had undergone HSCT. Our aim was to identify clinically relevant variants that may challenge the outcome of the HSCT. We focused on genes predisposing to hematological diseases, or solid tumors, and genes included in the American College of Medical Genetics secondary findings list v3.0. As population-specific controls, we used GnomAD non-cancer Finns (n = 10,816). We identified in our population-based analysis rare harmful germline variants in disease-predisposing or actionable toxicity-increasing genes in 17.8% of adult and pediatric patients that have undergone HSCT (15.1% and 22.9%, respectively). More than half of the patients with a family member as a donor had not received genetic diagnosis prior to the HSCT. Our results encourage clinicians to incorporate germline genetic testing in the HSCT protocol in the future in order to reach optimal long-term outcome for the patients.

Also flagged:Synthesisglycyrrhetinic acidMurrayafoline AHepatocellular carcinomacancerliver cancer
Journal Article 2022-10-04 No Snippets Dinh CT, Vu HT, Phan QTH, Nguyen LP, Tran TQ, Van Tran D, Quy NN, Pham DTN, Nguyen DT.
Show Full Abstract

Hepatocellular carcinoma is a common type of cancer associated with a high mortality rate. Among several bioactive compounds, Murrayafoline A (MuA) has been proved as a bio substance that exhibits great potentials in treating liver cancer. In order to overcome the high cytotoxicity and low solubility of MuA, a delivery system based on nanocarriers is necessary to deliver MuA towards the desired target. In the present study, 18β-glycyrrhetinic acid (GA), which is known as a ligand for liver targeting, was used to construct the cholesterol-poly (ethylene glycol)-glycyrrhetinic acid (GA-PEG-Chol) conjugate and liposome for MuA administration. The compound was then examined for therapeutic efficacy and safety in HUVEC and HepG2 cells in 2D and 3D cell cultures. Results have shown that MuA-loaded liposomes had IC<sub>50</sub> value of 2 µM in HepG2 and had the cytosolic absorption of 8.83 ± 0.97 ng/10<sup>5</sup> cells, while The IC50 value of MuA-loaded liposomes in HUVEC cell lines was 15 µM and the the cytosolic absorption was recorded as 3.62 ± 0.61 cells. The drug test on the 3D cancer sphere platform of the HepG2 cancer sphere showed that MuA-loaded GA liposomes had the highest efficacy at a concentration of 100 µg/mL. In short, these results suggest that MuA-loaded GA liposomes have the potential for maintenance drug delivery and liver targeting.

Also flagged:fatty acidmetabolismtumorcancerGene ExpressionTranscription factor
Journal Article 2022-10-04 ✓ 2 Snippets Chen E, Yi J, Jiang J, Zou Z, Mo Y, Ren Q, Lin Z, Lu Y, Zhang J, Liu J.
In-Text Gene Mentions

…ICOS, IDO1, LAG3,TNFSF4, PDCD1 (PD-1), and…

…ACSM3, ACOX2, CPT2,ECI2, ECHS1, DECR, SLC27A6,…

Show Full Abstract

<h4>Background</h4>Fatty acid (FA) metabolism is considered the emerging cause of tumor development and metastasis, driving poor prognosis. Long non-coding RNAs (lncRNAs) are closely related to cancer progression and play important roles in FA metabolism. Thus, the discovery of FA metabolism-related lncRNA signatures to predict outcome and immunotherapy response is critical in improving the survival of patients with hepatocellular carcinoma (HCC).<h4>Methods</h4>FA metabolism scores and a FA metabolism-related lncRNA signature were constructed using a single-sample gene set enrichment analysis based on The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. "ConsensusClusterPlus" was used to screen molecular subtypes. Chi-squared test and Fisher's exact test were applied to explore the relationship between clinical, genomic mutation characteristics and subtypes. Transcription factor (TF) activity scores, cellular distributions, immune cell infiltration, and immunotherapy response were employed to investigate the functions of FA metabolism-related lncRNA signatures. FA metabolism microarray and western blot were performed to detect the biological function of candidate lncRNAs.<h4>Results</h4>A total of 70 lncRNAs that highly correlated with FA metabolism scores in two cohorts were used to construct two distinct clusters. Patients in cluster 2 had lower FA metabolism scores and worse survival than those in cluster 1. Patients in cluster 2 exhibited a high frequency of DNA damage, gene mutations, oncogenic signaling such as epithelial-to-mesenchymal transition, and a high degree of immune cell infiltration. Moreover, the lncRNA signature could predict the effects of immunotherapy in patients with HCC. Furthermore, three lncRNAs (SNHG1, LINC00261, and SNHG7) were identified that were highly correlated with FA metabolism. Additionally, SNHG1 and SNHG7 were found to regulate various FA metabolism-related genes and ferroptosis-related genes in vitro experiments. GSEA analysis revealed that SNHG1 and SNHG7 promote fatty acid beta-oxidation. SNHG1 and SNHG7 silencing dramatically reduced lipid droplets in HCC cells. Many immune-infiltration genes and TFs were overexpressed in HCC tissues with SNHG1 and SNHG7 high expression.<h4>Conclusions</h4>A novel molecular model of FA metabolism-related lncRNAs was developed, which has significantly prognostic potential in HCC diagnosis and aids in clinical decision making.

Also flagged:CPT2metabolismmalignant tumorcarcinomastumorcell proliferation
Journal Article 2022-10-04 ✓ 1 Snippet Liu J, Li Y, Xiao Q, Li Y, Peng Y, Gan Y, Shu G, Yi H, Yin G.
In-Text Gene Mentions

…EHHADH, HMGCS2, ENPP1,ECI2, ACSL6, SLC25A20, DGAT2,…

Show Full Abstract

<h4>Background</h4>The incidence of colorectal cancer (CRC) is considered to be the third-highest malignant tumor among all carcinomas. The alterations in cellular bioenergetics (metabolic reprogramming) are associated with several malignant phenotypes in CRC, such as tumor cell proliferation, invasion, metastasis, chemotherapy resistance, as well as promotes its immune escape. However, the expression pattern of metabolism-associated genes that mediate metabolic reprogramming in CRC remains unknown.<h4>Methods</h4>In this study, we screened out CPT2 by investigating the function of a series of metabolism-related genes in CRC progression by integrating the data from the TCGA and GEO databases. Next, we collected CRC tissues (n = 24) and adjacent non-tumor tissues (n = 8) and analyzed mRNA levels by qRT-PCR, and proteins levels of CPT2 in CRC cell lines by western blotting. CCK-8 assay, colony formation assay, Edu assay and flow cytometry assay were performed to assess the effects of CPT2 on proliferation in vitro.<h4>Results</h4>We identified 236 metabolism-related genes that are differentially expressed in colorectal cancer, of which 49 up-regulated and 187 down-regulated, and found CPT2 as the most significant gene associated with favorable prognosis in CRC. It was revealed that CPT2 expression was consistently down-regulated in CRC cell lines and tissues. Moreover, knockdown of CPT2 could promote the proliferative ability of CRC cells, whereas over-expression of CPT2 significantly suppressed the cell growth.<h4>Conclusion</h4>In summary, CPT2 can provide new insights about the progression and occurrence of the tumor as it acts as an independent prognostic factor in CRC sufferers.

Also flagged:SEPHS1Selenophosphate synthetaseselenophosphatesynthesisseleniumSEPHS2
Journal Article 2022-10-04 ✓ 1 Snippet Bang J, Kang D, Jung J, Yoo TJ, Shim MS, Gladyshev VN, Tsuji PA, Hatfield DL, Kim JH, Lee BJ.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Selenophosphate synthetase (SEPHS) was originally discovered in prokaryotes as an enzyme that catalyzes selenophosphate synthesis using inorganic selenium and ATP as substrates. However, in contrast to prokaryotes, two paralogs, SEPHS1 and SEPHS2, occur in many eukaryotes. Prokaryotic SEPHS, also known as SelD, contains either cysteine (Cys) or selenocysteine (Sec) in the catalytic domain. In eukaryotes, only SEPHS2 carries out selenophosphate synthesis and contains Sec at the active site. However, SEPHS1 contains amino acids other than Sec or Cys at the catalytic position. Phylogenetic analysis of SEPHSs reveals that the ancestral SEPHS contains both selenophosphate synthesis and another unknown activity, and that SEPHS1 lost the selenophosphate synthesis activity. The three-dimensional structure of SEPHS1 suggests that its homodimer is unable to form selenophosphate, but retains ATPase activity to produce ADP and inorganic phosphate. The most prominent function of SEPHS1 is that it is implicated in the regulation of cellular redox homeostasis. Deficiency of SEPHS1 leads to the disturbance in the expression of genes involved in redox homeostasis. Different types of reactive oxygen species (ROS) are accumulated in response to SEPHS deficiency depending on cell or tissue types. The accumulation of ROS causes pleiotropic effects such as growth retardation, apoptosis, DNA damage, and embryonic lethality. SEPHS1 deficiency in mouse embryos affects retinoic signaling and other related signaling pathways depending on the embryonal stage until the embryo dies at E11.5. Dysregulated SEPHS1 is associated with the pathogenesis of various diseases including cancer, Crohn's disease, and osteoarthritis.

Also flagged:Chronic Obstructive Pulmonary DiseaseCOPDGene Expressionleukocyte chemotaxiscell chemotaxisleukocyte migration
Journal Article 2022-10-04 No Snippets Han H, Hao L.
Show Full Abstract

<h4>Background</h4>Chronic obstructive pulmonary disease (COPD) is a common chronic disease of the respiratory tract, with high prevalence, high disability, and poor prognosis. However, the molecular mechanism of COPD needs to be further revealed.<h4>Methods</h4>We obtained the gene expression profile and miRNA expression profile of COPD patients from Gene Expression Omnibus (GEO) database, and the differentially expressed genes (DEGs) and differentially expressed miRNAs (DEmis) in COPD were identified. Subsequently, the COPD-related ceRNA network was constructed based on the interaction between lncRNA, miRNA, and mRNA using the lncACTdb database. Finally, the Cytoscape software was used to analyze the network topology and COPD-related lncRNAs.<h4>Results</h4>Firstly, the 519 DEGs and 17 DEmis were identified from COPD GEO datasets. GO enrichment showed that leukocyte chemotaxis, cell chemotaxis, and myeloid leukocyte migration were upregulated, and muscle and membrane repolarization-related biological progress were downregulated in COPD. KEGG pathway enrichment shows that the p53 pathway was upregulated in COPD. Hallmark enrichment showed that chronic neutrophil inflammation was a sign of the pathogenesis of COPD. Next, a ceRNA network including 93 DEGs, 2 DEmi, 463 lncRNAs, and 1157 DEG-lncRNA, DEmi-lncRNA, and DEmi-DEG interactions were obtained. The hub-lncRNA (the network is ranked in the top 10) as the core marker of COPD, including SNHG12, SLFNL1-AS1, KCNQ1OT1, XIST, EAF1-AS1, FOXD2-AS1, NORAD, PINK1-AS and RP11-69E11.4. And the cytoHubba analysis identified ATM, SMAD7 and HIF1A as hub genes of ceRNA network.<h4>Conclusion</h4>This study provides a landscape of ceRNA network of COPD, which help to reveal the underlying pathophysiological mechanisms of COPD and shed light on novel therapeutic strategies for COPD.

Also flagged:c-MYCcolorectal cancerERKtranslationalp38αkinase
Journal Article 2022-10-04 ✓ 2 Snippets Lepore Signorile M, Grossi V, Fasano C, Forte G, Disciglio V, Sanese P, De Marco K, La Rocca F, Armentano R, Valentini AM, Giannelli G, Simone C.
In-Text Gene Mentions

Eighty-five percent of sporadic CRCs progress through the classical adenoma–carcinoma sequence, showing a lack of allelic balance at several chromosomal loci, such as 5q (APC), 18q (DCC/SMAD4), and 17q (p53), and chromosomal amplification and translocation, which together contribute to tumor aneuploidy and chromosomal instability [3,4,5].

…5q (APC), 18q (DCC/SMAD4), and 17q (p53),…

Show Full Abstract

c-MYC is one of the most important factors involved in colorectal cancer (CRC) initiation and progression; indeed, it is found to be upregulated in up to 80% of sporadic cases. During colorectal carcinogenesis, c-MYC is maintained upregulated through β-catenin-mediated transcriptional activation and ERK-mediated post-translational stabilization. Our data demonstrate that p38α, a kinase involved in CRC metabolism and survival, contributes to c-Myc protein stability. Moreover, we show that p38α, like ERK, stabilizes c-MYC protein levels by preventing its ubiquitination. Of note, we found that p38α phosphorylates c-MYC and interacts with it both in vitro and in cellulo. Extensive molecular analyses in the cellular and in vivo models revealed that the p38α kinase inhibitors, SB202190 and ralimetinib, affect c-MYC protein levels. Ralimetinib also exhibited a synthetic lethality effect when used in combination with the MEK1 inhibitor trametinib. Overall, our findings identify p38α as a promising therapeutic target, acting directly on c-MYC, with potential implications for countering c-MYC-mediated CRC proliferation, metastatic dissemination, and chemoresistance.

Also flagged:Peptidehomeostatic iron regulatorironmetabolismhereditary haemochromatosisHH-type I
Journal Article 2022-10-04 ✓ 5 Snippets Goncalves Monteiro D, Rishi G, Gorman DM, Burnet G, Aliyanto R, Rosengren KJ, Frazer DM, Subramaniam VN, Clark RJ.
In-Text Gene Mentions

Therefore, we designed a series of 10–30 residue peptides based on HFE α1 and α2 helical segments and helices 1 and 3 of TFR1 that incorporated the key amino acid residues involved in complex formation (Table 1).

For both HFE α1α2-s1 and HFE α1α2-s2, the amino acid residues around the linkage experience significant deviations towards more negative values relative to the parent peptide (see Asp18/182 for HFE α1α2-s1 and Phe7/106 for HFE α1α2-s2, Figure 4B).

Interestingly, for HFE α1α2, which corresponds to a peptide containing helical segments from both α1 and α2 helical domains of HFE joined by a couple of glycine residues, the Hα secondary chemical shift analysis shows two regions of negative values that align with each of the α1 and α2 helical regions (Figure 3) although for these shifts are not as pronounced in the α1 region as in the HFE α1 peptide; this is presumably because HFE α1 is N-terminally extended when compared to HFE α1α2.

…The proteinHFE(homeostatic iron regulator)…

…and mutations inHFEunderlie the most…

Show Full Abstract

The protein HFE (homeostatic iron regulator) is a key regulator of iron metabolism, and mutations in HFE underlie the most frequent form of hereditary haemochromatosis (HH-type I). Studies have shown that HFE interacts with transferrin receptor 1 (TFR1), a homodimeric type II transmembrane glycoprotein that is responsible for the cellular uptake of iron via iron-loaded transferrin (holo-transferrin) binding. It has been hypothesised that the HFE/TFR1 interaction serves as a sensor to the level of iron-loaded transferrin in circulation by means of a competition mechanism between HFE and iron-loaded transferrin association with TFR1. To investigate this, a series of peptides based on the helical binding interface between HFE and TFR1 were generated and shown to significantly interfere with the HFE/TFR1 interaction in an in vitro proximity ligation assay. The helical conformation of one of these peptides, corresponding to the α1 and α2 helices of HFE, was stabilised by the introduction of sidechain lactam "staples", but this did not result in an increase in the ability of the peptide to disrupt the HFE/TFR1 interaction. These peptides inhibitors of the protein-protein interaction between HFE and TFR1 are potentially useful tools for the analysis of the functional role of HFE in the regulation of hepcidin expression.

Also flagged:Gastric cancertumorneoplasmcancerIFNGR1Notch-3
Journal Article 2022-10-04 ✓ 2 Snippets Jiang T, Mei L, Yang X, Sun T, Wang Z, Ji Y.
In-Text Gene Mentions

It is suggested that circulating HULC and ZNFX1-AS1 may serve as potential biomarkers for the diagnosis and prognosis of GC [49].

Another study found that lncRNA LINC01234 was also higher in GC samples than adjacent normal tissues, and 17 associations including 2 transcription factors (TFs) (ELK1 and ZNF664) and 17 RNA binding protein (RBP) interactions were identified to be co-expressed [56].

Show Full Abstract

Gastric cancer (GC) is one of the most prevalent malignant types worldwide, especially in East Asia. Due to its frequently advanced stage at diagnosis, the mortality from GC is high and the prognosis is still unsatisfactory. Thus, early detection using effective screening approaches is vital to decrease the morbidity and mortality of GC. Interestingly, biomarkers can be used for diagnosis, prediction of sensitivity to treatment, and prognosis in GC. The potential biomarkers detectable in liquid biopsies such as circulating tumor cells (CTCs), long non-coding RNAs (lncRNAs), cell-free DNA (cfDNA), microRNAs, and exosomes reveal numerous information regarding the early prediction and the outcomes for GC patients. Additionally, using the novel serum biomarkers has opened up new opportunities for diagnosing and monitoring patients with GC. This review mainly summarizes the novel progress and approaches in GC biomarkers, which could be potentially used for early diagnosis and therapy monitoring. Meanwhile, we also discussed the advantages, disadvantages, and future perspectives of GC biomarkers.

Also flagged:mitophagyneurodegenerative diseasesdeathmitochondrialmitochondriaautophagy
Journal Article 2022-10-04 ✓ 3 Snippets Wang Q, Xue H, Yue Y, Hao S, Huang SH, Zhang Z.
In-Text Gene Mentions

…repeats in theHTTgene is the…

…the conformation ofHTTprotein and produces…

…neurons, huntingtin protein (HTT) performs essential functions…

Show Full Abstract

Neurodegenerative diseases are a class of incurable and debilitating diseases characterized by progressive degeneration and death of cells in the central nervous system. They have multiple underlying mechanisms; however, they all share common degenerative features, such as mitochondrial dysfunction. According to recent studies, neurodegenerative diseases are associated with the accumulation of dysfunctional mitochondria. Selective autophagy of mitochondria, called mitophagy, can specifically degrade excess or dysfunctional mitochondria within cells. In this review, we highlight recent findings on the role of mitophagy in neurodegenerative disorders. Multiple studies were collected, including those related to the importance of mitochondria, the mechanism of mitophagy in protecting mitochondrial health, and canonical and non-canonical pathways in mitophagy. This review elucidated the important function of mitophagy in neurodegenerative diseases, discussed the research progress of mitophagy in neurodegenerative diseases, and summarized the role of mitophagy-related proteins in neurological diseases. In addition, we also highlight pharmacological advances in neurodegeneration.

Also flagged:fatty acidHigh-grade serous ovarian cancercancerOvarian cancergynecologic malignanciestumor
Journal Article 2022-10-04 ✓ 4 Snippets Cao T, Dong J, Huang J, Tang Z, Shen H.
In-Text Gene Mentions

…GABARAPL1, ACSM3, D2HGDH,PTGIS, PPARA, and HSP90AA1…

…+ 0.10 × exp(PTGIS) + 0.51 ×…

…GABARAPL1, ACSM3, D2HGDH,PTGIS, PPARA, and HSP90AA1.…

…GABARAPL1 (E) ,PTGIS(F) , and…

Show Full Abstract

High-grade serous ovarian cancer (HGSOC) is a heterogeneous cancer characterized by high relapse rate. Approximately 80% of women are diagnosed with late-stage disease, and 15-25% of patients experience primary treatment resistance. Ovarian cancer brings tremendous suffering and is the most malignant type in all gynecologic malignancies. Metabolic reprogramming in tumor microenvironment (TME), especially fatty acid metabolism, has been identified to play a crucial role in cancer prognosis. Yet, the underlying mechanism of fatty acid metabolism on ovarian cancer progression is severely understudied. Recently, studies have demonstrated the role of fatty acid metabolism reprogramming in immune cells, but their roles on cancer cell metastasis and cancer immunotherapy response are poorly characterized. Here, we reported that the fatty acid-related genes are aberrantly varied between ovarian cancer and normal samples. Using samples in publicly databases and bio-informatic analyses with fatty acid-related genes, we disentangled that cancer cases can be classified into high- and low-risk groups related with prognosis. Furthermore, the nomogram model was constructed to predict the overall survival. Additionally, we reported that different immune cells infiltration was presented between groups, and immunotherapy response differed in two groups. Results showed that our signature may have good prediction value on immunotherapy efficacy, especially for anti-PD-1 and anti-CTLA-4. Our study systematically marked the critical association between cancer immunity in TME and fatty acid metabolism, and bridged immune phenotype and metabolism programming in tumors, thereby constructed the metabolic-related prognostic model and help to understand the underlying mechanism of immunotherapy response.

Also flagged:gastric cancerCREB1MAPK1MITFcancerspathogenesis
Journal Article 2022-10-04 ✓ 2 Snippets Wang Y, Li M, Zeng J, Yang Y, Li Z, Hu S, Yang F, Wang N, Wang W, Tie J.
In-Text Gene Mentions

(35) inferred that CSE1L silencing promotes apoptosis and inhibits tumour growth and metastasis by decreasing MITF expression.

…) inferred thatCSE1Lsilencing promotes apoptosis…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) is one of the most malignant and lethal cancers worldwide. Multiple microRNAs (miRNAs) have been identified as key regulators in the progression of GC. However, the underlying pathogenesis that miRNAs govern GC malignancy remains uncertain. Here, we identified a novel miR-585-5p as a key regulator in GC development.<h4>Methods</h4>The expression of miR-585-5p in the context of GC tissue was detected by <i>in situ</i> hybridization for GC tissue microarray and assessed by H-scoring. The gain- and loss-of-function analyses comprised of Cell Counting Kit-8 assay and Transwell invasion and migration assay. The expression of downstream microphthalmia-associated transcription factor (MITF), cyclic AMP-responsive element-binding protein 1 (CREB1) and mitogen-activated protein kinase 1 (MAPK1) were examined by Immunohistochemistry, quantitative real-time PCR and western blot. The direct regulation between miR-585-5p and MITF/CREB1/MAPK1 were predicted by bioinformatic analysis and screened by luciferase reporter assay. The direct transcriptional activation of CREB1 on MITF was verified by luciferase reporter assay, chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assays (EMSAs). The interaction between MAPK1 and MITF was confirmed by co-immunoprecipitation (Co-IP) and immunofluorescent double-labelled staining.<h4>Results</h4>MiR-585-5p is progressively downregulated in GC tissues and low miR-585-5p levels were strongly associated with poor clinical outcomes. Further gain- and loss-of-function analyses showed that miR-585-5p possesses strong anti-proliferative and anti-metastatic capacities in GC. Follow-up studies indicated that miR-585-5p targets the downstream molecules CREB1 and MAPK1 to regulate the transcriptional and post-translational regulation of MITF, respectively, thus controlling its expression and cancer-promoting activity. MiR-585-5p directly and negatively regulates MITF together with CREB1 and MAPK1. According to bioinformatic analysis, promotor reporter gene assays, ChIP and EMSAs, CREB1 binds to the promotor region to enhance transcriptional expression of MITF. Co-IP and immunofluorescent double-labelled staining confirmed interaction between MAPK1 and MITF. Protein immunoprecipitation revealed that MAPK1 enhances MITF activity <i>via</i> phosphorylation (Ser73). MiR-585-5p can not only inhibit MITF expression directly, but also hinder MITF expression and pro-cancerous activity in a CREB1-/MAPK1-dependent manner indirectly.<h4>Conclusions</h4>In conclusion, this study uncovered miR-585-5p impedes gastric cancer proliferation and metastasis by orchestrating the interactions among CREB1, MAPK1 and MITF.

Also flagged:metabolismPLEKHA5TONSLPTGER4LCORLGPAT3
Journal Article 2022-10-04 ✓ 2 Snippets Wang P, Li X, Zhu Y, Wei J, Zhang C, Kong Q, Nie X, Zhang Q, Wang Z.
In-Text Gene Mentions

This study identified genes such as GPAT3, ARNTL2, EHHADH, CEBPB, DNAJB9, ZNF496, AGO2, GALNT18, and NEGR1 as critical for obesity traits or adipose metabolism (see Table 7).

…GALNT18 , andNEGR1as critical for…

Show Full Abstract

Milk production and body conformation traits are critical economic traits for dairy cows. To understand the basic genetic structure for those traits, a genome wide association study was performed on milk yield, milk fat yield, milk fat percentage, milk protein yield, milk protein percentage, somatic cell score, body form composite index, daily capacity composite index, feed, and leg conformation traits, based on the Illumina Bovine HD100k BeadChip. A total of 57, 12 and 26 SNPs were found to be related to the milk production, somatic cell score and body conformation traits in the Holstein cattle. Genes with pleiotropic effect were also found in this study. Seven significant SNPs were associated with multi-traits and were located on the <i>PLEC, PLEKHA5, TONSL, PTGER4</i>, and <i>LCORL</i> genes. In addition, some important candidate genes, like <i>GPAT3, CEBPB, AGO2, SLC37A1</i>, and <i>FNDC3B</i>, were found to participate in fat metabolism or mammary gland development. These results can be used as candidate genes for milk production, somatic cell score, and body conformation traits of Holstein cows, and are helpful for further gene function analysis to improve milk production and quality.

Also flagged:D2RdopaminelevodopadyskinesiaD1 receptorshydroxydopamine
Journal Article 2022-10-04 ✓ 2 Snippets Florio E, Serra M, Lewis RG, Kramár E, Freidberg M, Wood M, Morelli M, Borrelli E.
In-Text Gene Mentions

…as ADORA2A andGPR52, as well as,…

…LRRK2, CHRM4, AKAP5,GPR52, RYR3, PDE10a, RGS4,…

Show Full Abstract

Degeneration of dopaminergic neurons leads to Parkinson's disease (PD), characterized by reduced levels of striatal dopamine (DA) and impaired voluntary movements. DA replacement is achieved by levodopa treatment which in long-term causes involuntary movements or dyskinesia. Dyskinesia is linked to the pulsatile activation of D1 receptors of the striatal medium spiny neurons (MSNs) forming the direct output pathway (dMSNs). The contribution of DA stimulation of D2R in MSNs of the indirect pathway (iMSNs) is less clear. Using the 6-hydroxydopamine model of PD, here we show that loss of DA-mediated inhibition of these neurons intensifies levodopa-induced dyskinesia (LID) leading to reprogramming of striatal gene expression. We propose that the motor impairments characteristic of PD and of its therapy are critically dependent on D2R-mediated iMSNs activity. D2R signaling not only filters inputs to the striatum but also indirectly regulates dMSNs mediated responses.

Also flagged:braingene expressionNeuronal differentiationchromatinbrain developmentSMAD
Journal Article 2022-10-04 ✓ 1 Snippet Samara A, Spildrejorde M, Sharma A, Falck M, Leithaug M, Modafferi S, Bjørnstad PM, Acharya G, Gervin K, Lyle R, Eskeland R.
In-Text Gene Mentions

…as OTX2 andSOX6( Figures 2…

Show Full Abstract

Neuronal differentiation of pluripotent stem cells is an established method to study physiology, disease, and medication safety. However, the sequence of events in human neuronal differentiation and the ability of <i>in vitro</i> models to recapitulate early brain development are poorly understood. We developed a protocol optimized for the study of early human brain development and neuropharmacological applications. We comprehensively characterized gene expression and epigenetic profiles at four timepoints, because the cells differentiate from embryonic stem cells towards a heterogeneous population of progenitors, immature and mature neurons bearing telencephalic signatures. A multi-omics roadmap of neuronal differentiation, combined with searchable interactive gene analysis tools, allows for extensive exploration of early neuronal development and the effect of medications.

Also flagged:mammalian target of rapamycinJanus kinasesignal transducer and activator of transcriptionmitogen‑activated protein kinaseinsulin resistancefatty liver disease
Journal Article 2022-10-04 ✓ 2 Snippets Han GP, Kim JH, Kim JM, Kil DY.
In-Text Gene Mentions

The seed node of module 3 is SERPINC1, one of the biomarkers for the prediction of NAFLD, showing upregulated in WES group (Pirola and Sookoian, 2018).

…module 3 isSERPINC1, one of…

Show Full Abstract

Eggshell is composed of a very ordered and mineralized structure and is important for egg quality. Eggshell strength is particularly important because of its direct association with economic outcomes and egg safety. Various factors related to laying hens and their environment affects eggshell strength. However, the molecular mechanisms of liver functions related to decreased eggshell strength of aged laying hens are largely unknown. Therefore, this study aimed to identify potential factors affecting eggshell strength in aged laying hens at the hepatic transcriptomic level. A total of five hundred 92-wk-old Hy-line Brown laying hens were screened to select those exhibiting the greatest variation in eggshell strength. Based on the final eggshell strength, 12 hens producing eggs with strong eggshell strength (SES) and weak eggshell strength (WES) were finally selected (n = 6) for liver tissue sampling. The RNA-sequencing was performed to identify differentially expressed genes (DEGs) between the 2 groups. We identified a total of 2,084 DEGs, of which 1,358 genes were upregulated and 726 genes were downregulated in the WES group compared with SES group. According to the Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis, the DEGs indicated the mammalian target of rapamycin signaling pathway, the Janus kinase-signal transducer and activator of transcription pathway, the mitogen‑activated protein kinase signaling pathway, and the insulin resistance pathways. Genes related to fatty liver disease were upregulated in WES group compared with SES group. In addition, expression of several genes associated with oxidative stress and bone resorption activity was altered in aged laying hens with different eggshell strength. Overall, these findings contribute to the identification of genes involved in different intensity of eggshell strength, enabling more understanding of the hepatic molecular mechanism underlying in decreased eggshell strength of aged laying hens.

Also flagged:FibromyalgiaIrritable Bowel SyndromeIBSfibromyalgia syndromeFMSpain syndrome
Journal Article 2022-10-04 ✓ 3 Snippets Valencia C, Fatima H, Nwankwo I, Anam M, Maharjan S, Amjad Z, Abaza A, Vasavada AM, Sadhu A, Khan S.
In-Text Gene Mentions

They stated that the alteration in the 5-HTT gene produces a higher index of psychiatric symptoms such as depression, anxiety, and fatigue in patients with FMS.

…and serotonin transporter5-HTT.…

…alteration in the5-HTTgene produces a…

Show Full Abstract

Irritable bowel syndrome (IBS) is a common pathology in middle-aged patients and a regular consultation in the gastroenterology office. The prevalence is high in females with a ratio of 2:1, and due to its multifactorial etiology, it is difficult to address the symptomatology. On the other hand, fibromyalgia syndrome (FMS) is a chronic widespread pain syndrome also prevalent in the female population, characterized by systemic symptoms. It is proven that 28-59 % of patients with FMS develop IBS at some point in their illness; on the other hand, 32-77% of those with IBS will develop FMS. Our study aims to compile information about the pathogenesis of these diseases and highlight their common processes to target these two illnesses potentially.  This systematic review comprises twenty-three studies published between 2017 and 2022, selected by electronic research with keywords and Medical Subject Headings (MESH) strategy. The articles were taken from PubMed, Pubmed Central (PMC), Medline, and Cochrane libraries and met the inclusion and exclusion criteria and the pertinent quality checklists. Of the reviewed studies, 10 were case-control, six were narrative reviews, three were systematic reviews, three were cross-sectional, and one was a cohort study. They investigated the correlation and similitudes in the pathogenic process between FMS and IBS. There are some similar mechanisms in the physiopathologies of IBS and FMS, where the immune system, especially the mast cells (MCs), along with their products, receptors, the inflammatory cells with their intermediaries, hormones, and neurotransmitters such as serotonin, act together pathologically. Also, the role of the microbiota is very important in this pathogenesis since dysbiosis alters the levels of serotonin in the body and can produce hyperstimulation of the autonomic nervous system. There are common associated factors in IBS and FMS, with evident symptoms presented in both syndromes such as fatigue, pain, hypersensitivity, depression, anxiety, and others, that could be correlated in a certain way. After this systematic review, we can conclude that the most accepted theories of the common pathogenesis are the role of serotonin and MCs with their inflammatory biomarkers, which can affect different parts of the body producing the characteristic symptomatology. Moreover, other pathogenic mechanisms such as the involvement of microbiota and dysregulation of the gut-brain axis have shown promising results, and further investigation should be made to support their role.

Also flagged:transient receptor potential cation channel 6transient receptor potential 6 subfamily C, member 6TRPC6phosphorylationnitric oxideprostacyclin
Journal Article 2022-10-03 ✓ 3 Snippets Numaga-Tomita T, Shimauchi T, Kato Y, Nishiyama K, Nishimura A, Sakata K, Inada H, Kita S, Iwamoto T, Nabekura J, Birnbaumer L, Mori Y, Nishida M.
In-Text Gene Mentions

…c‐654, RRID:AB_631422 ), anti‐PTGIS(1:100 dilution Santa…

…of eNOS andPTGIS(prostaglandin synthase; CYP8A…

…up‐regulated eNOS andPTGISproteins in the…

Show Full Abstract

<h4>Background and purpose</h4>Capillary arterialization, characterized by the coverage of pre-existing or nascent capillary vessels with vascular smooth muscle cells (VSMCs), is critical for the development of collateral arterioles to improve post-ischaemic blood flow. We previously demonstrated that the inhibition of transient receptor potential 6 subfamily C, member 6 (TRPC6) channels facilitate contractile differentiation of VSMCs under ischaemic stress. We here investigated whether TRPC6 inhibition promotes post-ischaemic blood flow recovery through capillary arterialization in vivo.<h4>Experimental approach</h4>Mice were subjected to hindlimb ischaemia by ligating left femoral artery. The recovery rate of peripheral blood flow was calculated by the ratio of ischaemic left leg to non-ischaemic right one. The number and diameter of blood vessels were analysed by immunohistochemistry. Expression and phosphorylation levels of TRPC6 proteins were determined by western blotting and immunohistochemistry.<h4>Key results</h4>Although the post-ischaemic blood flow recovery is reportedly dependent on endothelium-dependent relaxing factors, systemic TRPC6 deletion significantly promoted blood flow recovery under the condition that nitric oxide or prostacyclin production were inhibited, accompanying capillary arterialization. Cilostazol, a clinically approved drug for peripheral arterial disease, facilitates blood flow recovery by inactivating TRPC6 via phosphorylation at Thr69 in VSMCs. Furthermore, inhibition of TRPC6 channel activity by pyrazole-2 (Pyr2; BTP2; YM-58483) promoted post-ischaemic blood flow recovery in Apolipoprotein E-knockout mice.<h4>Conclusion and implications</h4>Suppression of TRPC6 channel activity in VSMCs could be a new strategy for the improvement of post-ischaemic peripheral blood circulation.

Also flagged:transcription factorBach2BTB domain And CNC Homolog 2transcription repressorcellTCF1
Journal Article 2022-10-03 ✓ 1 Snippet Li S, Bern MD, Miao B, Fan C, Xing X, Inoue T, Piersma SJ, Wang T, Colonna M, Kurosaki T, Yokoyama WM.
In-Text Gene Mentions

…Kit , andSox6in Bach2-deficient NK…

Show Full Abstract

BTB domain And CNC Homolog 2 (Bach2) is a transcription repressor that actively participates in T and B lymphocyte development, but it is unknown if Bach2 is also involved in the development of innate immune cells, such as natural killer (NK) cells. Here, we followed the expression of Bach2 during murine NK cell development, finding that it peaked in immature CD27<sup>+</sup>CD11b<sup>+</sup> cells and decreased upon further maturation. Bach2 showed an organ and tissue-specific expression pattern in NK cells. Bach2 expression positively correlated with the expression of transcription factor TCF1 and negatively correlated with genes encoding NK effector molecules and those involved in the cell cycle. Lack of Bach2 expression caused changes in chromatin accessibility of corresponding genes. In the end, Bach2 deficiency resulted in increased proportions of terminally differentiated NK cells with increased production of granzymes and cytokines. NK cell-mediated control of tumor metastasis was also augmented in the absence of Bach2. Therefore, Bach2 is a key checkpoint protein regulating NK terminal maturation.

Also flagged:AlcoholObesityCirrhosishepatocellular carcinomapatatin-like phospholipase domain-containing protein 3death
Journal Article 2022-10-03 ✓ 1 Snippet Kim HS, Xiao X, Byun J, Jun G, DeSantis SM, Chen H, Thrift AP, El-Serag HB, Kanwal F, Amos CI.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Importance</h4>Alcohol drinking and obesity are associated with an increased risk of cirrhosis and hepatocellular carcinoma (HCC), but the risk is not uniform among people with these risk factors. Genetic variants, such as I148M in the patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene, may play an important role in modulating cirrhosis and HCC risk.<h4>Objective</h4>To investigate the joint associations of the PNPLA3 I148M variant, alcohol intake, and obesity with the risk of cirrhosis, HCC, and liver disease-related mortality.<h4>Design, setting, and participants</h4>This prospective cohort study analyzed 414 209 participants enrolled in the UK Biobank study from March 2006 to December 2010. Participants had no previous diagnosis of cirrhosis and HCC and were followed up through March 2021.<h4>Exposures</h4>Self-reported alcohol intake (nonexcessive vs excessive), obesity (body mass index ≥30 [calculated as weight in kilograms divided by height in meters squared]), and PNPLA3 I148M variant status (noncarrier, heterozygous carrier, or homozygous carrier) from initial assessment.<h4>Main outcomes and measures</h4>The primary outcomes were incident cirrhosis and HCC cases and liver disease-related death ascertained from inpatient hospitalization records and death registry. The risks were calculated by Cox proportional hazards regression models.<h4>Results</h4>A total of 414 209 participants (mean [SD] age, 56.3 [8.09] years; 218 567 women [52.8%]; 389 452 White race and ethnicity [94.0%]) were included. Of these participants, 2398 participants (0.6%) developed cirrhosis (5.07 [95% CI, 4.87-5.28] cases per 100 person-years), 323 (0.1%) developed HCC (0.68 [95% CI, 0.61-0.76] cases per 100 person-years), and 878 (0.2%) died from a liver disease-related cause (1.76 [95% CI, 1.64-1.88] cases per 100 person-years) during a median follow-up of 10.9 years. Synergistic interactions between the PNPLA3 I148M variant, obesity, and alcohol intake were associated with the risk of cirrhosis, HCC, and liver disease-related mortality. The risk of cirrhosis increased supramultiplicatively (adjusted hazard ratio [aHR], 17.52; 95% CI, 12.84-23.90) in individuals with obesity, with excessive drinking, and who were homozygous carriers compared with those with no obesity, with nonexcessive drinking, and who were noncarriers. Supramultiplicative associations between the 3 factors and risks of HCC were found in individuals with 3 risk factors (aHR, 30.13; 95% CI, 16.51-54.98) and liver disease-related mortality (aHR, 21.82; 95% CI, 13.78-34.56). The PNPLA3 I148M variant status significantly differentiated the risk of cirrhosis, HCC, and liver disease-related mortality in persons with excessive drinking and obesity.<h4>Conclusions and relevance</h4>This study found synergistic associations of the PNPLA3 I148M variant, excessive alcohol intake, and obesity with increased risk of cirrhosis, HCC, and liver disease-related death in the general population. The PNPLA3 I148M variant status may help refine the risk stratification for liver disease in persons with excessive drinking and obesity who may need early preventive measures.

Also flagged:coagulationfactor XIImembraneclottingHemostasisblood clotting
Journal Article 2022-10-03 ✓ 2 Snippets Méndez Rojano R, Lai A, Zhussupbekov M, Burgreen GW, Cook K, Antaki JF.
In-Text Gene Mentions

…II prothrombin, 9)ATIIIanti-thrombin, 10) XII…

…step through antithrombin (ATIII).…

Show Full Abstract

Over the past decade, much of the development of computational models of device-related thrombosis has focused on platelet activity. While those models have been successful in predicting thrombus formation in medical devices operating at high shear rates (> 5000 s-1), they cannot be directly applied to low-shear devices, such as blood oxygenators and catheters, where emerging information suggest that fibrin formation is the predominant mechanism of clotting and platelet activity plays a secondary role. In the current work, we augment an existing platelet-based model of thrombosis with a partial model of the coagulation cascade that includes contact activation of factor XII and fibrin production. To calibrate the model, we simulate a backward-facing-step flow channel that has been extensively characterized in-vitro. Next, we perform blood perfusion experiments through a microfluidic chamber mimicking a hollow fiber membrane oxygenator and validate the model against these observations. The simulation results closely match the time evolution of the thrombus height and length in the backward-facing-step experiment. Application of the model to the microfluidic hollow fiber bundle chamber capture both gross features such as the increasing clotting trend towards the outlet of the chamber, as well as finer local features such as the structure of fibrin around individual hollow fibers. Our results are in line with recent findings that suggest fibrin production, through contact activation of factor XII, drives the thrombus formation in medical devices operating at low shear rates with large surface area to volume ratios.

Also flagged:NOX1TNFαsecretionoxygenlectintranscription factors
Journal Article 2022-10-03 ✓ 1 Snippet Hsu NY, Nayar S, Gettler K, Talware S, Giri M, Alter I, Argmann C, Sabic K, Thin TH, Ko HM, Werner R, Tastad C, Stappenbeck T, Azabdaftari A, Uhlig HH, Chuang LS, Cho JH.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Objective</h4>Loss-of-function mutations in genes generating reactive oxygen species (ROS), such as <i>NOX1</i>, are associated with IBD. Mechanisms whereby loss of ROS drive IBD are incompletely defined.<h4>Design</h4>ROS measurements and single-cell transcriptomics were performed on colonoids stratified by <i>NOX1</i> genotype and TNFα stimulation. Clustering of epithelial cells from human UC (inflamed and uninflamed) scRNASeq was performed. Validation of M cell induction was performed by immunohistochemistry using UEA1 (ulex europaeus agglutin-1 lectin) and in vivo with DSS injury.<h4>Results</h4>TNFα induces ROS production more in NOX1-WT versus NOX1-deficient murine colonoids under a range of Wnt-mediated and Notch-mediated conditions. scRNASeq from inflamed and uninflamed human colitis versus TNFα stimulated, in vitro colonoids defines substantially shared, induced transcription factors; NOX1-deficient colonoids express substantially lower levels of STAT3 (signal transducer and activator of transcription 3), CEBPD (CCAAT enhancer-binding protein delta), <i>DNMT1</i> (DNA methyltransferase) and <i>HIF1A</i> (hypoxia-inducible factor) baseline. Subclustering unexpectedly showed marked TNFα-mediated induction of M cells (sentinel cells overlying lymphoid aggregates) in NOX1-deficient colonoids. M cell induction by UEA1 staining is rescued with H<sub>2</sub>O<sub>2</sub> and paraquat, defining extra- and intracellular ROS roles in maintenance of LGR5+ stem cells. DSS injury demonstrated <i>GP2</i> (glycoprotein-2), basal lymphoplasmacytosis and UEA1 induction in NOX1-deficiency. Principal components analyses of M cell genes and decreased DNMT1 RNA velocity correlate with UC inflammation.<h4>Conclusions</h4>NOX1 deficiency plus TNFα stimulation contribute to colitis through dysregulation of the stem cell niche and altered cell differentiation, enhancing basal lymphoplasmacytosis. Our findings prioritise ROS modulation for future therapies.

Also flagged:familial insomniaTORneurodegenerative diseasesprion diseasesfatal familial insomniaCJD
Journal Article 2022-10-03 No Snippets Bauer S, Dittrich L, Kaczmarczyk L, Schleif M, Benfeitas R, Jackson WS.
Show Full Abstract

Selective neuronal vulnerability is common in neurodegenerative diseases but poorly understood. In genetic prion diseases, including fatal familial insomnia (FFI) and Creutzfeldt-Jakob disease (CJD), different mutations in the <i>Prnp</i> gene manifest as clinically and neuropathologically distinct diseases. Here we report with electroencephalography studies that theta waves are mildly increased in 21 mo old knock-in mice modeling FFI and CJD and that sleep is mildy affected in FFI mice. To define affected cell types, we analyzed cell type-specific translatomes from six neuron types of 9 mo old FFI and CJD mice. Somatostatin (SST) neurons responded the strongest in both diseases, with unexpectedly high overlap in genes and pathways. Functional analyses revealed up-regulation of neurodegenerative disease pathways and ribosome and mitochondria biogenesis, and down-regulation of synaptic function and small GTPase-mediated signaling in FFI, implicating down-regulation of mTOR signaling as the root of these changes. In contrast, responses in glutamatergic cerebellar neurons were disease-specific. The high similarity in SST neurons of FFI and CJD mice suggests that a common therapy may be beneficial for multiple genetic prion diseases.

Also flagged:ofgene expressionneurodegenerative disordersHDCNS disordersgene silencing
Journal Article 2022-10-03 ✓ 5 Snippets Conroy F, Miller R, Alterman JF, Hassler MR, Echeverria D, Godinho BMDC, Knox EG, Sapp E, Sousa J, Yamada K, Mahmood F, Boudi A, Kegel-Gleason K, DiFiglia M, Aronin N, Khvorova A, Pfister EL.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by the expansion of the CAG repeat region of the Huntingtin (HTT) gene.

Here, we focus on two SNPs in the htt gene (Supplementary Fig. 1): rs362273 in exon 57, which is heterozygous in 35% of HD patients, and rs362307 in exon 67, which is heterozygous in 48% of HD patients34,35.

…the Huntingtin (HTT) gene.…

…Reducing huntingtin protein (htt) expression is a…

…prepared for humanHTT(SA-50339) mRNA, mouse…

Show Full Abstract

Small interfering RNAs are a new class of drugs, exhibiting sequence-driven, potent, and sustained silencing of gene expression in vivo. We recently demonstrated that siRNA chemical architectures can be optimized to provide efficient delivery to the CNS, enabling development of CNS-targeted therapeutics. Many genetically-defined neurodegenerative disorders are dominant, favoring selective silencing of the mutant allele. In some cases, successfully targeting the mutant allele requires targeting single nucleotide polymorphism (SNP) heterozygosities. Here, we use Huntington's disease (HD) as a model. The optimized compound exhibits selective silencing of mutant huntingtin protein in patient-derived cells and throughout the HD mouse brain, demonstrating SNP-based allele-specific RNAi silencing of gene expression in vivo in the CNS. Targeting a disease-causing allele using RNAi-based therapies could be helpful in a range of dominant CNS disorders where maintaining wild-type expression is essential.

Also flagged:psilocybinlysergic acid diethylamideSerotonin 2a5-HT2a) receptor5-HT2a receptorspositron
Journal Article 2022-10-03 ✓ 1 Snippet Singleton SP, Luppi AI, Carhart-Harris RL, Cruzat J, Roseman L, Nutt DJ, Deco G, Kringelbach ML, Stamatakis EA, Kuceyeski A.
In-Text Gene Mentions

…the serotonin transporter,5-HTT, all obtained from…

Show Full Abstract

Psychedelics including lysergic acid diethylamide (LSD) and psilocybin temporarily alter subjective experience through their neurochemical effects. Serotonin 2a (5-HT2a) receptor agonism by these compounds is associated with more diverse (entropic) brain activity. We postulate that this increase in entropy may arise in part from a flattening of the brain's control energy landscape, which can be observed using network control theory to quantify the energy required to transition between recurrent brain states. Using brain states derived from existing functional magnetic resonance imaging (fMRI) datasets, we show that LSD and psilocybin reduce control energy required for brain state transitions compared to placebo. Furthermore, across individuals, reduction in control energy correlates with more frequent state transitions and increased entropy of brain state dynamics. Through network control analysis that incorporates the spatial distribution of 5-HT2a receptors (obtained from publicly available positron emission tomography (PET) data under non-drug conditions), we demonstrate an association between the 5-HT2a receptor and reduced control energy. Our findings provide evidence that 5-HT2a receptor agonist compounds allow for more facile state transitions and more temporally diverse brain activity. More broadly, we demonstrate that receptor-informed network control theory can model the impact of neuropharmacological manipulation on brain activity dynamics.

Also flagged:PRF1UNC13Dfamilialhemophagocytic lymphohistiocytosis
Journal Article 2022-10-03 No Snippets Moreno-Ruiz N, Genomics England Research Consortium, Lao O, Aróstegui JI, Laayouni H, Casals F.
Show Full Abstract

An important fraction of patients with rare disorders remains with no clear genetic diagnostic, even after whole-exome or whole-genome sequencing, posing a difficulty in giving adequate treatment and genetic counseling. The analysis of genomic data in rare disorders mostly considers the presence of single gene variants in coding regions that follow a concrete monogenic mode of inheritance. A digenic inheritance, with variants in two functionally-related genes in the same individual, is a plausible alternative that might explain the genetic basis of the disease in some cases. In this case, digenic disease combinations should be absent or underrepresented in healthy individuals. We develop a framework to evaluate the significance of digenic combinations and test its statistical power in different scenarios. We suggest that this approach will be relevant with the advent of new sequencing efforts including hundreds of thousands of samples.

Also flagged:lactylationhistonetranslationalgene expressionmetabolismmodifications
Journal Article 2022-10-03 No Snippets Galle E, Wong CW, Ghosh A, Desgeorges T, Melrose K, Hinte LC, Castellano-Castillo D, Engl M, de Sousa JA, Ruiz-Ojeda FJ, De Bock K, Ruiz JR, von Meyenn F.
Show Full Abstract

<h4>Background</h4>Histone lactylation has been recently described as a novel histone post-translational modification linking cellular metabolism to epigenetic regulation.<h4>Results</h4>Given the expected relevance of this modification and current limited knowledge of its function, we generate genome-wide datasets of H3K18la distribution in various in vitro and in vivo samples, including mouse embryonic stem cells, macrophages, adipocytes, and mouse and human skeletal muscle. We compare them to profiles of well-established histone modifications and gene expression patterns. Supervised and unsupervised bioinformatics analysis shows that global H3K18la distribution resembles H3K27ac, although we also find notable differences. H3K18la marks active CpG island-containing promoters of highly expressed genes across most tissues assessed, including many housekeeping genes, and positively correlates with H3K27ac and H3K4me3 as well as with gene expression. In addition, H3K18la is enriched at active enhancers that lie in proximity to genes that are functionally important for the respective tissue.<h4>Conclusions</h4>Overall, our data suggests that H3K18la is not only a marker for active promoters, but also a mark of tissue specific active enhancers.

Also flagged:neurological disorderslipiddegradationgene expressionmembraneneurological diseases
Journal Article 2022-10-03 No Snippets Yang J, Luly KM, Green JJ.
Show Full Abstract

Nonviral nanoparticles have emerged as an attractive alternative to viral vectors for gene therapy applications, utilizing a range of lipid-based, polymeric, and inorganic materials. These materials can either encapsulate or be functionalized to bind nucleic acids and protect them from degradation. To effectively elicit changes to gene expression, the nanoparticle carrier needs to undergo a series of steps intracellularly, from interacting with the cellular membrane to facilitate cellular uptake to endosomal escape and nucleic acid release. Adjusting physiochemical properties of the nanoparticles, such as size, charge, and targeting ligands, can improve cellular uptake and ultimately gene delivery. Applications in the central nervous system (CNS; i.e., neurological diseases, brain cancers) face further extracellular barriers for a gene-carrying nanoparticle to surpass, with the most significant being the blood-brain barrier (BBB). Approaches to overcome these extracellular challenges to deliver nanoparticles into the CNS include systemic, intracerebroventricular, intrathecal, and intranasal administration. This review describes and compares different biomaterials for nonviral nanoparticle-mediated gene therapy to the CNS and explores challenges and recent preclinical and clinical developments in overcoming barriers to nanoparticle-mediated delivery to the brain. This article is categorized under: Therapeutic Approaches and Drug Discovery > Nanomedicine for Neurological Disease Therapeutic Approaches and Drug Discovery > Emerging Technologies Nanotechnology Approaches to Biology > Nanoscale Systems in Biology.

Also flagged:Metabolismglutamateion homeostasisglycogensynapsesgap junction
Journal Article 2022-10-03 ✓ 2 Snippets Chen Z, Yuan Z, Yang S, Zhu Y, Xue M, Zhang J, Leng L.
In-Text Gene Mentions

…high expression ofUnc13cand Slc1a3 .…

…low expression ofUnc13cand Gfap .…

Show Full Abstract

Astrocytes are the most abundant cells in the brain. They have many important functions in the central nervous system (CNS), including the maintenance of glutamate and ion homeostasis, the elimination of oxidative stress, energy storage in glycogen, tissue repair, regulating synaptic activity by releasing neurotransmitters, and participating in synaptic formation. Astrocytes have special highly ramified structure. Their branches contact with synapses of neurons inwardly, with fine structure and wrapping synapses; their feet contact with blood vessels of brain parenchyma outward, almost wrapping the whole brain. The adjacent astrocytes rarely overlap and communicate with each other through gap junction channels. The ideal location of astrocytes enables them to sense the weak changes of their surroundings and provide the structural basis for the energy supply of neurons. Neurons and astrocytes are closely coupled units of energy metabolism in the brain. Neurons consume a lot of ATPs in the process of neurotransmission. Astrocytes provide metabolic substrates for neurons, maintain high activity of neuron, and facilitate information transmission of neurons. This article reviews the characteristics of glucose metabolism, lipid metabolism, and amino acid metabolism of astrocytes. The metabolic interactions between astrocytes and neurons, astrocytes and microglia were also detailed discussed. Finally, we classified analyzed the role of metabolic disorder of astrocytes in the occurrence and development of neurodegenerative diseases.

Also flagged:Hyperlipidemiamyocardial ischemiaacute myocardial ischemiaVEGFeNOSMMP-9
Journal Article 2022-10-03 ✓ 1 Snippet Zhou J, Li H, Xun L, Wang L, Zhao Q.
In-Text Gene Mentions

At serial time points after the HL-AMI models (on day 1–7 following AMI modeling, or day 30–36 after HFE administration), rats in subgroups 1–7 were anaesthetized with pentobarbital and phlebotomized from their celiac artery in turn.

Show Full Abstract

This study aims to explore the role of hyperlipidemia in the mobilization of bone marrow (BM) endothelial progenitor cells (EPCs) induced by acute myocardial ischemia (AMI). To establish the hyperlipidemia complicated with AMI (HL-AMI) model, SD rats were intragastrically administered the high-fat emulsion for 4 weeks. Then their left anterior descending arteries were ligated. Rats in each group were randomly subdivided into seven subgroups. During 1st ~ 7th day following AMI modeling, rats in 1st ~ 7th subgroups were selected to be phlebotomized from their celiac artery after being anesthetized by pentobarbitone in turn. The quantity of circulating EPCs (CEPCs) was detected by flow cytometry, the expression of VEGF, eNOS, NO, MMP-9 in myocardial tissue was analyzed by western blot, and their plasma level was assayed by ELISA. Dynamic curves were plotted using these data. Within 7 days following AMI, compared with the AMI rats, in the HL-AMI rats, the myocardial infarct size, the plasma activity of CK, CK-MB, and the collagen deposition all remained at the higher levels; meanwhile, these rats showed more significant decreases in the count of CEPCs, the plasma level of VEGF etc., and their expression in myocardial tissue (<i>P</i> < 0.05 or <i>P</i> < 0.01). Our study showed that hyperlipidemia may attenuate the mobilization of BM EPCs induced by AMI via VEGF/eNOS/NO/MMP-9 signal pathway, which might partly account for hyperlipidemia hampering the repairs of AMI-induced cardiac injury.

Also flagged:Bone Metastasisrenal cell carcinomaRCCtumorliverlung metastasis
Journal Article 2022-10-03 No Snippets Xu C, Liu W, Yin C, Li W, Liu J, Sheng W, Tang H, Li W, Zhang Q.
Show Full Abstract

<h4>Purpose</h4>Since the prognosis of renal cell carcinoma (RCC) patients with bone metastasis (BM) is poor, this study is aimed at using big data to build a machine learning (ML) model to predict the risk of BM in RCC patients.<h4>Methods</h4>A retrospective study was conducted on 40,355 RCC patients in the SEER database from 2010 to 2017. LASSO regression and multivariate logistic regression analysis was performed to determine independent risk factors of RCC-BM. Six ML algorithm models, including LR, GBM, XGB, RF, DT, and NBC, were used to establish risk models for predicting RCC-BM. The prediction performance of ML models was weighed by 10-fold cross-validation.<h4>Results</h4>The study investigated 40,355 patients diagnosed with RCC in the SEER database, where 1,811 (4.5%) were BM patients. Independent risk factors for BM were tumor grade, T stage, N stage, liver metastasis, lung metastasis, and brain metastasis. Among the RCC-BM risk prediction models established by six ML algorithms, the XGB model showed the best prediction performance (AUC = 0.891). Therefore, a network calculator based on the XGB model was established to individually assess the risk of BM in patients with RCC.<h4>Conclusion</h4>The XGB risk prediction model based on the ML algorithm performed a good prediction effect on BM in RCC patients.

Also flagged:KITLGGlomerular Endothelial Cell InjuryDiabetic NephropathyDNhyperglycemiasecretion
Journal Article 2022-10-03 ✓ 5 Snippets Huang JC, Chen SC, Chang WA, Hung WW, Wu PH, Wu LY, Chang JM, Hsu YL, Tsai YC.
In-Text Gene Mentions

…primers (KITLG, PCDH7,PCDH17and GADPH) used…

…and protocadherin 17 (PCDH17), in coronary artery…

…of PCDH7 andPCDH17in HGECs treated…

…affect PCDH7 andPCDH17, while AGEs decreased…

…junction PCDH7 andPCDH17at the mRNA…

Show Full Abstract

Diabetic nephropathy (DN) is an increasing threat to human health. The impact of hyperglycemia or its metabolites, advanced glycation end-products (AGEs), on glomerular endothelial cells (GECs) and their pathophysiologic mechanisms are not well explored. Our results reveal that AGEs increased the expression and secretion of the KIT ligand (KITLG) in GECs. Both AGEs and KITLG promoted endothelial-to-mesenchymal transition (EndoMT) in GECs and further increased the permeability of GECs through the AKT/extracellular-signal-regulated kinase pathway. Inhibition of KITLG's effects by imatinib prevented AGE-medicated EndoMT in GECs, supporting the belief that KITLG is a critical factor for GEC injury. We found higher KITLG levels in the GECs and urine of db/db mice compared with db/m mice, and urinary KITLG levels were positively correlated with the urinary albumin-to-creatinine ratio (ACR). Furthermore, type 2 diabetic patients had higher urinary KITLG levels than normal individuals, as well as urinary KITLG levels that were positively correlated with urinary ACR and negatively correlated with the estimated glomerular filtration rate. KITLG plays a pathogenic role in GEC injury in DN and might act as a biomarker of DN progression.

Also flagged:brain diseaseneurological disordersneurological diseaseschronic neurological diseasesamyotrophic lateral sclerosismultiple sclerosis
Journal Article 2022-10-03 No Snippets Reddy DS, Abeygunaratne HN.
Show Full Abstract

This article describes commonly used experimental and clinical biomarkers of neuronal injury and neurodegeneration for the evaluation of neuropathology and monitoring of therapeutic interventions. Biomarkers are vital for diagnostics of brain disease and therapeutic monitoring. A biomarker can be objectively measured and evaluated as a proxy indicator for the pathophysiological process or response to therapeutic interventions. There are complex hurdles in understanding the molecular pathophysiology of neurological disorders and the ability to diagnose them at initial stages. Novel biomarkers for neurological diseases may surpass these issues, especially for early identification of disease risk. Validated biomarkers can measure the severity and progression of both acute neuronal injury and chronic neurological diseases such as epilepsy, migraine, Alzheimer's disease, Parkinson's disease, Huntington's disease, traumatic brain injury, amyotrophic lateral sclerosis, multiple sclerosis, and other brain diseases. Biomarkers are deployed to study progression and response to treatment, including noninvasive imaging tools for both acute and chronic brain conditions. Neuronal biomarkers are classified into four core subtypes: blood-based, immunohistochemical-based, neuroimaging-based, and electrophysiological biomarkers. Neuronal conditions have progressive stages, such as acute injury, inflammation, neurodegeneration, and neurogenesis, which can serve as indices of pathological status. Biomarkers are critical for the targeted identification of specific molecules, cells, tissues, or proteins that dramatically alter throughout the progression of brain conditions. There has been tremendous progress with biomarkers in acute conditions and chronic diseases affecting the central nervous system.

Also flagged:Tumorlonidamineglutaminemetabolismhyaluronic acidethyl
Journal Article 2022-10-03 No Snippets Fu Z, Du H, Meng S, Yao M, Zhao P, Li X, Zheng X, Yuan Z, Yang H, Cai K, Dai L.
Show Full Abstract

The starvation therapy mediated by the lonidamine (LND) was limited by the low drug delivery efficiency, off-target effect and compensative glutamine metabolism. Herein, a hyaluronic acid (HA)-modified reduction-responsive micellar nanosystem co-loaded with glycolysis and glutamine metabolism inhibitor (LND and bis-2-(5-phenylacetmido-1,2,4-thiadiazol-2-yl)ethyl sulfide, BPTES) was constructed for tumor-targeted dual-starvation therapy. The <i>in vitro</i> and <i>in vivo</i> results collectively suggested that the fabricated nanosystem could effectively endocytosed by tumor cells via HA receptor-ligand recognition, and rapidly release starvation-inducers LND and BPTES in response to the GSH-rich intratumoral cytoplasm. Furthermore, the released LND and BPTES were capable of inducing glycolysis and glutamine metabolism suppression, and accompanied by significant mitochondrial damage, cell cycle arrest and tumor cells apoptosis, eventually devoting to the blockade of the energy and substance supply and tumor killing with high efficiency. In summary, HPPPH@L@B nanosystem significantly inhibited the compensatory glycolysis and glutamine metabolism via the dual-starvation therapy strategy, blocked the indispensable energy and substance supply of tumors, consequently leading to the desired tumor starvation and effective tumor killing with reliable biosafety.

Also flagged:Livedoid vasculopathythrombophiliasneoplasmscoagulation disorderinflammatory vasculitisLivedo
Journal Article 2022-10-03 ✓ 1 Snippet Burg MR, Mitschang C, Goerge T, Schneider SW.
In-Text Gene Mentions

…and protein S-deficiency,antithrombin-III-deficiency, prothrombin G2021…

Show Full Abstract

Livedoid vasculopathy is a rare, chronic-recurrent occlusive disorder in the microcirculation of dermal vessels. The clinical appearance is characterized by <i>Livedo racemosa</i>, painful ulceration, located in the distal parts of the lower extremities, followed by healing as porcelain-white, atrophic scars, the so-called <i>Atrophie blanche</i>. Different conditions that can promote a hypercoagulable state, such as inherited and acquired thrombophilias, autoimmune connective-tissue diseases and neoplasms, can be associated with livedoid vasculopathy. Therefore, livedoid vasculopathy is currently considered to be a coagulation disorder, clearly distinguished from inflammatory vasculitis. Although there are hints to hypercoaguability and secondary inflammation, pathophysiology is not completely understood. Diagnosis is made by synopsis of history, clinical and histopathological findings. Early and adequate therapy is essential to maintain life quality and avoid irreversible complications. Better understanding of molecular mechanisms is required to establish appropriate therapy regimens. This article presents the current state of knowledge about livedoid vasculopathy and proposes an algorithmic approach for diagnosis and therapy.

Also flagged:Niemann-Pick type C1 proteindegenerative retinal diseasesmembranepeptidescell-matrix adhesion-cell
Journal Article 2022-10-03 No Snippets Li JK, Rao YQ, Koh SK, Zhao P, Zhou L, Li J.
Show Full Abstract

Palmitoylation is a dynamic process that regulates the activity of the modified proteins. Retinal pigment epithelial (RPE) cells play pivotal roles in the visual cycle and maintaining healthy photoreceptor cells. Dysfunctional RPE cells are often associated with degenerative retinal diseases. The aim of the study was to identify potentially palmitoylated proteins in human RPE cells. By using the detergent-resistant membrane, we found 312 potentially palmitoylated peptides which corresponded to 192 proteins in RPE cells, including 55 new candidate proteins which were not reported before. Gene enrichment analysis highlighted significant enrichment of palmitoylated proteins in cell-matrix adhesion, cell-cell recognition, protein cellular localization, and translation, among others. We further studied the effect of 3 potential palmitoylation sites (Cys 799, 900, and 816) of Niemann-Pick type C1 protein (NPC1) on cholesterol accumulation. We found that mutation of any single Cys alone had no significant effect on intracellular cholesterol accumulation while simultaneous mutation of Cys799 and 800 caused significant cholesterol accumulation in the late endosome. No further cholesterol accumulation was observed by adding another mutation at Cys 816. However, the mutation did not alter the cellular localization of the protein. Conclusion: PRE cells have an abundant number of palmitoylated proteins which are involved in cellular processes critical to visual function. The palmitoylation at Cys799 and 800 was needed for cholesterol export, but not the intracellular localization of NPC1.

Also flagged:amino acidkynureninecatabolismKPkynurenic acidAnthranilic acid
Journal Article 2022-10-03 ✓ 1 Snippet Fathi M, Vakili K, Yaghoobpoor S, Tavasol A, Jazi K, Hajibeygi R, Shool S, Sodeifian F, Klegeris A, McElhinney A, Tavirani MR, Sayehmiri F.
In-Text Gene Mentions

…the Huntington gene (HTT).…

Show Full Abstract

<h4>Background</h4>Tryptophan (TRP) is an essential amino acid that must be provided in the diet. The kynurenine pathway (KP) is the main route of TRP catabolism into nicotinamide adenosine dinucleotide (NAD<sup>+</sup>), and metabolites of this pathway may have protective or degenerative effects on the nervous system. Thus, the KP may be involved in neurodegenerative diseases.<h4>Objectives</h4>The purpose of this systematic review and meta-analysis is to assess the changes in KP metabolites such as TRP, kynurenine (KYN), kynurenic acid (KYNA), Anthranilic acid (AA), 3-hydroxykynurenine (3-HK), 5-Hydroxyindoleacetic acid (5-HIAA), and 3-Hydroxyanthranilic acid (3-HANA) in Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD) patients compared to the control group.<h4>Methods</h4>We conducted a literature search using PubMed/Medline, Scopus, Google Scholar, Web of Science, and EMBASE electronic databases to find articles published up to 2022. Studies measuring TRP, KYN, KYNA, AA, 3-HK, 5-HIAA, 3-HANA in AD, PD, or HD patients and controls were identified. Standardized mean differences (SMDs) were used to determine the differences in the levels of the KP metabolites between the two groups.<h4>Results</h4>A total of 30 studies compromising 689 patients and 774 controls were included in our meta-analysis. Our results showed that the blood levels of TRP was significantly lower in the AD (SMD=-0.68, 95% CI=-0.97 to -0.40, p=0.000, I2 = 41.8%, k=8, n=382), PD (SMD=-0.77, 95% CI=-1.24 to -0.30, p=0.001, I2 = 74.9%, k=4, n=352), and HD (SMD=-0.90, 95% CI=-1.71 to -0.10, p=0.028, I2 = 91.0%, k=5, n=369) patients compared to the controls. Moreover, the CSF levels of 3-HK in AD patients (p=0.020) and the blood levels of KYN in HD patients (p=0.020) were lower compared with controls.<h4>Conclusion</h4>Overall, the findings of this meta-analysis support the hypothesis that the alterations in the KP may be involved in the pathogenesis of AD, PD, and HD. However, additional research is needed to show whether other KP metabolites also vary in AD, PD, and HD patients. So, the metabolites of KP can be used for better diagnosing these diseases.

Also flagged:E3 ubiquitin ligaseshepatocellular carcinomaMARCH ligasetumorCYP2C9G6PD
Journal Article 2022-10-03 ✓ 2 Snippets Cao J, Tu DY, Zhou J, Jiang GQ, Jin SJ, Su BB, Tang H, Tang YH, Wang AQ, Wang Q, Liu RJ, Zhang C, Bai DS.
In-Text Gene Mentions

…(12%), PCLO (12%),DNAH10(12%), RYR2 (10%),…

…(7%), XIRP2 (6%),CACNA1E(6%), and FLG…

Show Full Abstract

The membrane-associated RING-CH (MARCH) family, a member of the E3 ubiquitin ligases, has been confirmed by a growing number of studies to be associated with immune function and has been highlighted as a potential immunotherapy target. In our research, hepatocellular carcinoma (HCC) patients were divided into C1 and C2 MARCH ligase-related patterns by the non-negative matrix factorization (NMF) algorithm. Multiple analyses revealed that the MARCH ligase-related cluster was related to prognosis, clinicopathological characteristics, and the tumor immune microenvironment (TIME). Next, the signature (risk score) of the MARCH prognosis was constructed, including eight genes associated with the MARCH ligase (<i>CYP2C9</i>, <i>G6PD</i>, <i>SLC1A5</i>, <i>SPP1</i>, <i>ANXA10</i>, <i>CDC20</i>, <i>PON1</i>, and <i>FTCD</i>). The risk score showed accuracy and stability. We found that the correlations between risk score and TIME, tumor mutation burden (TMB), prognosis, and clinicopathological characteristics were significant. Additionally, the risk score also had important guiding significance for HCC treatment, including chemotherapy, immunotherapy, and transarterial chemoembolization (TACE).

Also flagged:neurodegenerative diseasessildenafilaspirinthalidomideadalimumabKinase
Journal Article 2022-10-03 ✓ 1 Snippet Kakoti BB, Bezbaruah R, Ahmed N.
In-Text Gene Mentions

When a mutation in the HTT gene’s exon 1 on chromosome 4p16.3 results in CAG (C-cytosine, A-adenine, and G-guanine) trinucleotide DNA segment extension, repetition, and multiplicity, HD develops.

Show Full Abstract

Drug repositioning or repurposing is the process of discovering leading-edge indications for authorized or declined/abandoned molecules for use in different diseases. This approach revitalizes the traditional drug discovery method by revealing new therapeutic applications for existing drugs. There are numerous studies available that highlight the triumph of several drugs as repurposed therapeutics. For example, sildenafil to aspirin, thalidomide to adalimumab, and so on. Millions of people worldwide are affected by neurodegenerative diseases. According to a 2021 report, the Alzheimer's disease Association estimates that 6.2 million Americans are detected with Alzheimer's disease. By 2030, approximately 1.2 million people in the United States possibly acquire Parkinson's disease. Drugs that act on a single molecular target benefit people suffering from neurodegenerative diseases. Current pharmacological approaches, on the other hand, are constrained in their capacity to unquestionably alter the course of the disease and provide patients with inadequate and momentary benefits. Drug repositioning-based approaches appear to be very pertinent, expense- and time-reducing strategies for the enhancement of medicinal opportunities for such diseases in the current era. Kinase inhibitors, for example, which were developed for various oncology indications, demonstrated significant neuroprotective effects in neurodegenerative diseases. This review expounds on the classical and recent examples of drug repositioning at various stages of drug development, with a special focus on neurodegenerative disorders and the aspects of threats and issues viz. the regulatory, scientific, and economic aspects.

Also flagged:Neurotrophin3hepatocellular carcinomaJNKP38MAPKliver cancer
Journal Article 2022-10-03 ✓ 2 Snippets Yang Z, Zhang H, Yin M, Cheng Z, Jiang P, Feng M, Liao B, Liu Z.
In-Text Gene Mentions

…regulatory target ofPOU3F2, and human neuron…

…controlled by thePOU3F2/NTF3 pathway 25 .…

Show Full Abstract

Although liver cancer is a malignant tumor with the highest mortality across the world, its pathogenesis and therapeutic targets remain unclear. Apoptosis, a natural cell death mechanism, is an important target of anticancer therapy. The discovery of effective apoptotic regulators can lead to the identification of novel therapeutic targets for treating cancer. Neurotrophin 3 (NTF3) is a member of the nerve growth factor (NGF) family that is involved in the progression of various cancers, including medulloblastoma, primitive neuroectodermal brain tumors, and breast cancer. NTF3 is under-expressed in human hepatocellular carcinoma (HCC), albeit its specific effects and the action mechanism have not been elucidated. Here, we confirmed that NTF3 expression was significantly low in HCC with reference to the GSEA database. By collecting patient data from our center and performing qRT-PCR analysis, we found that <i>NTF3</i> expression was significantly downregulated in 74 patients with HCC. Low NTF3 expression was associated with a shorter overall survival (OS), recurrence-free survival (RFS), progression-free survival (PFS), and disease-specific survival (DSS). Both <i>in vivo</i> and <i>in vitro</i> experiments revealed that NTF3 considerably inhibited the progression of HCC cells. We found that the ligand NTF3 is regulated by c-Jun and binds to the p75 neurotrophin receptor (p75NTR) and then activates the JNK and P38 MAPK pathways to induce apoptosis. Entinostat (the target of HDAC1/HDAC3) can activate the NTF3/p75NTR pathway. These results indicate that NTF3 is a tumor suppressor, and that its low expression can help in predict poor clinical outcomes in HCC. Therefore, NTF3 can be used as a potential treatment molecule for HCC.

Also flagged:GSTM2colon cancercolorectal cancercancertumorsRAD21
Journal Article 2022-10-03 ✓ 4 Snippets Zhang W, Shi Y, Niu S, Li L, Lin L, Gao X, Cai W, Chen Y, Zhong Y, Tang D, Tang M, Dai Y.
In-Text Gene Mentions

…the functions ofPCDH17mutations…

…LOXL4, DNAH3, CPS1,PCDH17, L3MBTL4, PLCG1, SAFB,…

…Among these mutations,PCDH17has been identified…

…be related toPCDH17mutation.…

Show Full Abstract

According to a recent report by GLOBOCAN, colorectal cancer is the third most common and second most deadly cancer in 2020. In our previous proteomic study, we found that the expression of GSTM2 in colon tissues was significantly lower than that in para-cancer tissues, and its lower expression was associated with reduced overall survival rate of patients, suggesting that this gene might play a role in the occurrence of colon cancer. As a member of the detoxifying enzyme family, GSTM2 is likely to play an important role in the initiation of tumors. Whereas, the functions of GSTM2 in colon cancer are barely known. In this study, using the RNA-Seq datasets of colon cancer patients from public database (n<sub>tumor</sub> = 457, n<sub>normal</sub> = 41), we confirmed the reduced expression of GSTM2 and its prognostic value in colon cancer. Furthermore, we used our own Chinese cohort (n<sub>tumor</sub> = 100, n<sub>normal</sub> = 72) verified the lower GSTM2 expression in colon cancer, and also its effects on patient prognosis. Subsequently, we uncovered two potential reasons for the lower expression of GSTM2 in colon cancer tissues, including the deep deletion of GSTM2 on genome, and the up-regulation of RAD21 or SP1. Moreover, we disclosed that GSTM2 might be involved in several immune-related pathways in colon cancer, such as chemokine signaling and leukocyte transendothelial migration. Finally, we revealed that the GSTM2 expression was closely related to the immune-related scores of colon cancer and the infiltration ratios of various immune cells, suggesting that GSTM2 might regulate the development of colon cancer by modulating immune microenvironment. In conclusion, we uncovered the prognostic value of GSTM2 based on the public data and our own data, revealed its potential regulatory role in tumor immune microenvironment, and disclosed the probable reasons for its lower expression in colon cancer. The findings of our study provide a potential prognostic biomarker and drug target for clinical diagnosis and treatment of colon cancer.

Also flagged:extracellularvesiclescancerwound healingangiogenesishematopoietic diseases
Journal Article 2022-10-03 No Snippets Pozzobon M, D'Agostino S, Roubelakis MG, Cargnoni A, Gramignoli R, Wolbank S, Gindraux F, Bollini S, Kerdjoudj H, Fenelon M, Di Pietro R, Basile M, Borutinskaitė V, Piva R, Schoeberlein A, Eissner G, Giebel B, Ponsaerts P.
Show Full Abstract

Perinatal tissues, such as placenta and umbilical cord contain a variety of somatic stem cell types, spanning from the largely used hematopoietic stem and progenitor cells to the most recently described broadly multipotent epithelial and stromal cells. As perinatal derivatives (PnD), several of these cell types and related products provide an interesting regenerative potential for a variety of diseases. Within COST SPRINT Action, we continue our review series, revising and summarizing the modalities of action and proposed medical approaches using PnD products: cells, secretome, extracellular vesicles, and decellularized tissues. Focusing on the brain, bone, skeletal muscle, heart, intestinal, liver, and lung pathologies, we discuss the importance of potency testing in validating PnD therapeutics, and critically evaluate the concept of PnD application in the field of tissue regeneration. Hereby we aim to shed light on the actual therapeutic properties of PnD, with an open eye for future clinical application. This review is part of a quadrinomial series on functional/potency assays for validation of PnD, spanning biological functions, such as immunomodulation, anti-microbial/anti-cancer, anti-inflammation, wound healing, angiogenesis, and regeneration.

Also flagged:endoplasmic reticulumobesitycognitionwatercognitive impairmentcalcium
Journal Article 2022-10-03 ✓ 1 Snippet Niu Y, Chang P, Liu T, Shen X, Zhao H, Zhang M, Lei S, Chen B, Yu J.
In-Text Gene Mentions

…Axl, Olfr488, Ighmbp2,Htt, Prickle2, Sypl2, Ahcy,…

Show Full Abstract

Obesity induced by a high-fat diet (HFD) is an important cause of impaired memory and cognitive function, but the underlying mechanisms are not clear. In the present study, we analyzed the levels of circRNAs in the hippocampus of C57BL/6J mice and evaluated the memory and cognition ability of C57BL/6J mice with HFD using Morris water maze and Y-maze approaches to explore the potential mechanisms linking circRNAs in obesity-associated cognitive impairment. Learning performance showed that HFD-induced obesity mice have impaired memory and cognition. The Arraystar analysis of the hippocampus displayed that HFD-induced obesity leads to the differential expression of circRNAs (DE-circRNAs) in mice. In total, 46 circular RNAs with elevated expression and 10 with decreased expression were identified. Among them, mmu_circRNA_004797 was identified to be significantly downregulated and the expression of mmu_circRNA_21040 was significantly upregulated in the HFD-fed mice, compared with control mice by PCR test. Bioinformatics analysis also showed that the upregulated circRNAs were related to the neuronal function and behavior, and material transport process, while downregulated circRNAs participated in the process of cell response to external stimuli, such as cellular response to nutrient levels. Furthermore, the KEGG pathway analysis showed that the upregulated circRNAs are mainly involved in Axon guidance, calcium signaling pathway, and ErbB signaling pathway. Only a single significant pathway, that is, "protein processing in endoplasmic reticulum", was observed in the downregulated circRNAs. Finally, we examined the deficits of hippocampal synaptic plasticity and detected the expression of ER stress-related protein. The results showed that ER stress was activated in the hippocampus, and hippocampal synaptic plasticity deficits were displayed. Our results demonstrated that circRNAs were most likely implicated in the predisposition to obesity-associated cognitive impairment.

Also flagged:ALSneurodegenerative diseasesamyotrophic lateral sclerosisfrontotemporal dementiadementiacognition
Journal Article 2022-10-03 No Snippets Gelon PA, Dutchak PA, Sephton CF.
Show Full Abstract

Synaptic loss is a pathological feature of all neurodegenerative diseases including amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). ALS is a disease of the cortical and spinal motor neurons resulting in fatal paralysis due to denervation of muscles. FTD is a form of dementia that primarily affects brain regions controlling cognition, language and behavior. Once classified as two distinct diseases, ALS and FTD are now considered as part of a common disease spectrum based on overlapping clinical, pathological and genetic evidence. At the cellular level, aggregation of common proteins and overlapping gene susceptibilities are shared in both ALS and FTD. Despite the convergence of these two fields of research, the underlying disease mechanisms remain elusive. However, recent discovers from ALS and FTD patient studies and models of ALS/FTD strongly suggests that synaptic dysfunction is an early event in the disease process and a unifying hallmark of these diseases. This review provides a summary of the reported anatomical and cellular changes that occur in cortical and spinal motor neurons in ALS and FTD tissues and models of disease. We also highlight studies that identify changes in the proteome and transcriptome of ALS and FTD models and provide a conceptual overview of the processes that contribute to synaptic dysfunction in these diseases. Due to space limitations and the vast number of publications in the ALS and FTD fields, many articles have not been discussed in this review. As such, this review focuses on the three most common shared mutations in ALS and FTD, the hexanucleuotide repeat expansion within intron 1 of <i>chromosome</i> 9 <i>open reading frame 72</i> (<i>C9ORF72</i>), <i>transactive response DNA binding protein 43</i> (<i>TARDBP or TDP-43</i>) and <i>fused in sarcoma</i> (<i>FUS)</i>, with the intention of highlighting common pathways that promote synaptic dysfunction in the ALS-FTD disease spectrum.

Also flagged:nucleotidemelaninMYO5APRKG1GSTCDRTN1
Journal Article 2022-10-03 ✓ 5 Snippets Aboul-Naga AM, Alsamman AM, El Allali A, Elshafie MH, Abdelal ES, Abdelkhalek TM, Abdelsabour TH, Mohamed LG, Hamwieh A.
In-Text Gene Mentions

…PLCB1, STEAP3, KSR2,UNC13C, PEBP4 , and…

…LAMA2, DSC2, andUNC13Cgenes), Kinase (…

…Kinase ( KSR2,UNC13C, PRKG1, SH3BGR, PLCB1,…

…, KSR2 ,UNC13C, PEBP4, and…

…le-nucleotide polymorphisms inUNC13C(Unc-13 Homolog C)…

Show Full Abstract

Heat stress caused by climatic changes is one of the most significant stresses on livestock in hot and dry areas. It has particularly adverse effects on the ability of the breed to maintain homeothermy. Developing countries are advised to protect and prepare their animal resources in the face of potential threats such as climate change. The current study was conducted in Egypt's three hot and dry agro-ecological zones. Three local sheep breeds (Saidi, Wahati, and Barki) were studied with a total of 206 ewes. The animals were exercised under natural heat stress. The heat tolerance index of the animals was calculated to identify animals with high and low heat tolerance based on their response to meteorological and physiological parameters. Genomic variation in these breeds was assessed using 64,756 single nucleotide polymorphic markers (SNPs). From the perspective of comparative adaptability to harsh conditions, our objective was to investigate the genomic structure that might control the adaptability of local sheep breeds to environmental stress under hot and dry conditions. In addition, indices of population structure and diversity of local breeds were examined. Measures of genetic diversity showed a significant influence of breed and location on populations. The standardized index of association (rbarD) ranged from 0.0012 (Dakhla) to 0.026 (Assuit), while for the breed, they ranged from 0.004 (Wahati) to 0.0103 (Saidi). The index of association analysis (I<sup>a</sup>) ranged from 1.42 (Dakhla) to 35.88 (Assuit) by location and from 6.58 (Wahati) to 15.36 (Saidi) by breed. The most significant SNPs associated with heat tolerance were found in the <i>MYO5A, PRKG1, GSTCD,</i> and <i>RTN1</i> genes (<i>p</i> ≤ 0.0001). <i>MYO5A</i> produces a protein widely distributed in the melanin-producing neural crest of the skin. Genetic association between genetic and phenotypic variations showed that OAR1_18300122.1, located in <i>ST3GAL3</i>, had the greatest positive effect on heat tolerance. Genome-wide association analysis identified SNPs associated with heat tolerance in the <i>PLCB1, STEAP3, KSR2, UNC13C, PEBP4</i>, and <i>GPAT2</i> genes.

Also flagged:receptor-interacting proteinRIP) kinaseskinasedeathamino acidinnate immunity
Journal Article 2022-10-03 No Snippets Lv S, Jiang Y, Li Y, Huang R, Peng L, Ma Z, Lu N, Lin X, Yan J.
Show Full Abstract

The group of receptor-interacting protein (RIP) kinases has seven members (<i>RIPK1-7</i>), with one homologous kinase domain but distinct non-kinase regions. Although <i>RIPK1-3</i> have emerged as key modulators of inflammation and cell death, few studies have connected <i>RIPK4-7</i> to immune responses. The divergence in domain structures and paralogue information in the Ensembl database have raised question about the phylogeny of <i>RIPK1-7</i>. In this study, phylogenetic trees of RIPK1-7 and paralogues constructed using full-length amino acid sequences or Kinase domain demonstrate that RIPK6 and RIPK7 are distinct from RIPK1-5 and paralogues shown in the Ensembl database are inaccurate. Comparative and evolutionary analyses were subsequently performed to gain new clues about the potential functions of <i>RIPK3-7</i>. <i>RIPK3</i> gene loss in birds and animals that undergo torpor, a common physiological phenomenon in cold environments, implies that <i>RIPK3</i> may be involved in ischemia-reperfusion injury and/or high metabolic rate. The negligible expression of <i>RIPK4</i> and <i>RIPK5</i> in immune cells is likely responsible for the lack of studies on the direct role of these members in immunity; <i>RIPK6</i> and <i>RIPK7</i> are conserved among plants, invertebrates and vertebrates, and dominantly expressed in innate immune cells, indicating their roles in innate immunity. Overall, our results provide insights into the multifaceted and conserved biochemical functions of <i>RIP</i> kinases.

Also flagged:fibrotic liver diseasesextracellularangiogenesiscirrhosisliverliver fibrosis
Journal Article 2022-10-03 ✓ 1 Snippet Li Y, Wu J, Liu R, Zhang Y, Li X.
In-Text Gene Mentions

The mRNA profiles of anoikis-resistant HCC cells revealed the significant reduced leucine-rich repeat containing 7 (LRRC7) expressions since extracellular mature exosomal miR-25-5p directly targeted its 5' UTR, which facilitated the trans-endothelial migration of CTCs in a dose dependent manner 60.

Show Full Abstract

The increasing prevalence of fibrotic liver diseases resulting from different etiologies has become a major global problem for public health. Fibrotic liver diseases represent a redundant accumulation of extracellular matrix, dysregulation of immune homeostasis and angiogenesis, which eventually contribute to the progression of cirrhosis and liver malignancies. The concerted actions among liver cells including hepatocytes, hepatic stellate cells, kupffer cells, liver sinusoidal endothelial cells and other immune cells are essential for the outcome of liver fibrosis. Recently, a growing body of literature has highlighted that extracellular vesicles (EVs) are critical mediators of intercellular communication among different liver cells either in local or distant microenvironments, coordinating a variety of systemic pathological and physiological processes. Despite the increasing interests in this field, there are still relatively few studies to classify the contents and functions of EVs in intercellular transmission during hepatic fibrogenesis. This review aims to summarize the latest findings with regards to the cargo loading, release, and uptake of EVs in different liver cells and clarify the significant roles of EVs played in fibrotic liver diseases.

Also flagged:SynthesisIlamycinsrufomycinscycloheptapeptidesamino acidsAAA+ protein
Journal Article 2022-10-03 No Snippets Greve J, Mogk A, Kazmaier U.
Show Full Abstract

Ilamycins/rufomycins are marine cycloheptapeptides containing unusual amino acids. Produced by <i>Streptomyces</i> sp., these compounds show potent activity against a range of mycobacteria, including multidrug-resistant strains of <i>Mycobacterium tuberculosis</i>. The cyclic peptides target the AAA+ protein ClpC1 that, together with the peptidases ClpP1/ClpP2, forms an essential ATP-driven protease. Derivatives of the ilamycins with a simplified tryptophane unit are synthesized in a straightforward manner. The ilamycin derivative <b>26</b> with a cyclic hemiaminal structure is active in the nM-range against several mycobacterial strains and shows no significant cytotoxicity. In contrast, derivative <b>27</b>, with a glutamic acid at this position, is significantly less active, with MICs in the mid µM-range. Detailed investigations of the mode of action of <b>26</b> indicate that <b>26</b> deregulates ClpC1 activity and strongly enhances ClpC1-WT ATPase activity. The consequences of <b>26</b> on ClpC1 proteolytic activities were substrate-specific, suggesting dual effects of <b>26</b> on ClpC1-WT function. The positive effect relates to ClpC1-WT ATPase activation, and the negative to competition with substrates for binding to the ClpC1 NTD.

Also flagged:mitochondrialaminoacyl-tRNA synthetasesamino acidsARSagingcytoplasmic
Journal Article 2022-10-03 No Snippets Zheng T, Luo Q, Han C, Zhou J, Gong J, Chun L, Xu XZS, Liu J.
Show Full Abstract

Reducing the rate of translation promotes longevity in multiple organisms, representing a conserved mechanism for lifespan extension. Aminoacyl-tRNA synthetases (ARSs) catalyze the loading of amino acids to their cognate tRNAs, thereby playing an essential role in translation. Mutations in ARS genes are associated with various human diseases. However, little is known about the role of ARSs in aging, particularly whether and how these genes regulate lifespan. Here, using <i>Caenorhabditis elegans</i> as a model, we systematically characterized the role of all three types of ARS genes in lifespan regulation, including mitochondrial, cytoplasmic, and cyto-mito bifunctional ARS genes. We found that, as expected, RNAi knockdown of mitochondrial ARS genes extended lifespan. Surprisingly, knocking down cytoplasmic or cyto-mito bifunctional ARS genes shortened lifespan, though such treatment reduced the rate of translation. These results reveal opposing roles of mitochondrial and cytoplasmic ARSs in lifespan regulation, demonstrating that inhibiting translation may not always extend lifespan.

Also flagged:depressionParkinson's DiseasePDmethylationagingcytokine
Journal Article 2022-10-03 No Snippets Paul KC, Kusters C, Furlong M, Zhang K, Yu Y, Folle AD, Del Rosario I, Keener A, Bronstein J, Sinsheimer JS, Horvath S, Ritz B.
Show Full Abstract

Although Parkinson's Disease (PD) is typically described in terms of motor symptoms, depression is a common feature. We explored whether depression influences blood-based genome-wide DNA methylation (DNAm) in 692 subjects from a population-based PD case-control study, using both a history of clinically diagnosed depression and current depressive symptoms measured by the geriatric depression scale (GDS). While PD patients in general had more immune activation and more accelerated epigenetic immune system aging than controls, the patients experiencing current depressive symptoms (GDS≥5) showed even higher levels of both markers than patients without current depressive symptoms (GDS<5). For PD patients with a history of clinical depression compared to those without, we found no differences in immune cell composition. However, a history of clinical depression among patients was associated with differentially methylated CpGs. Epigenome-wide association analysis (EWAS) revealed 35 CpGs associated at an FDR≤0.05 (569 CpGs at FDR≤0.10, 1718 CpGs at FDR≤0.15). Gene set enrichment analysis implicated immune system pathways, including immunoregulatory interactions between lymphoid and non-lymphoid cells (p-adj = 0.003) and cytokine-cytokine receptor interaction (p-adj = 0.004). Based on functional genomics, 25 (71%) of the FDR≤0.05 CpGs were associated with genetic variation at 45 different methylation quantitative trait loci (meQTL). Twenty-six of the meQTLs were also expression QTLs (eQTLs) associated with the abundance of 53 transcripts in blood and 22 transcripts in brain (substantia nigra, putamen basal ganglia, or frontal cortex). Notably, cg15199181 was strongly related to rs823114 (SNP-CpG p-value = 3.27E-310), a SNP identified in a PD meta-GWAS and related to differential expression of <i>PM20D1</i>, <i>RAB29</i>, <i>SLC41A1</i>, and <i>NUCKS1</i>. The entire set of genes detected through functional genomics was most strongly overrepresented for interferon-gamma-mediated signaling pathway (enrichment ratio = 18.8, FDR = 4.4e-03) and T cell receptor signaling pathway (enrichment ratio = 13.2, FDR = 4.4e-03). Overall, the current study provides evidence of immune system involvement in depression among Parkinson's patients.

bioRxiv 2022-10-03 Preprint (No Snippets API) Golbano A, Pardo L, Menacho CM, Rierola M, Claro E, Wood LB, Masgrau R, Galea E.
Show Full Abstract

<h4>ABSTRACT</h4> X-linked adrenoleukodystrophy (X-ALD) is a rare neurometabolic and demyelinating disorder caused by loss of function mutations of the ABCD1 transporter that imports very-long-chain fatty acids (VLCFA) into the peroxisome for beta-oxidation. Impaired ABCD1 function results in VLCFA accumulation, which ultimately causes lethal forms of X-ALD in children (CCALD) and adults (CAMN). Because X-ALD is a genetic disorder, we looked for signs of altered neurodevelopmental pathways in the transcriptomes of brain cortical tissues free of pathology from patients that died of CALD or CAMN. Several categories related to brain development, axonal growth, synaptic signaling and synaptic compartments were significantly dysregulated in both CALD and CAMN, suggesting that congenital circuit abnormalities might be structural in brains of mutated ABCD1 carriers. We partially dissected the cellular origin of dysregulated pathways using rat neuronal and astrocytic cultures in which X-ALD was modeled by silencing of Abcd1 and Abcd2 by RNA interference. Abcd2 was silenced lest it compensated for Abcd1 loss. Abcd1/2 deficient neurons presented higher rates of death, reduced sizes and defective formation of spines, dendrites and axons. The aberrant neuron development was caused by cell-autonomous and astrocyte-dependent mechanisms, and involved Wnt signaling, as suggested by the rescue of the expression of a synaptic gene upon pharmacological activation of the Wnt pathway. As recently proposed for neurogenetic disorders such as Huntington’s disease, our data suggest that X-ALD has a neurodevelopmental component that may cause psychiatric alterations and prime neural circuits for neurodegeneration. If this is the case, therapies aimed at restoring neural-circuit function in neurodevelopmental disorders may be reprofiled for X-ALD therapeutics.

bioRxiv 2022-10-03 Preprint (No Snippets API) Stern B, Monteleone P, Zoldan J.
Show Full Abstract

With new daily discoveries about the long-term impacts of COVID-19 there is a clear need to develop in vitro models that can be used to better understand the pathogenicity and impact of COVID-19. Here we demonstrate the utility of developing a model of endothelial dysfunction that utilizes induced pluripotent stem cell-derived endothelial progenitors encapsulated in collagen hydrogels to study the effects of COVID-19 on the endothelium. We found that treating these cell-laden hydrogels with SARS-CoV-2 spike protein resulted in a significant decrease in the number of vessel-forming cells as well as vessel network connectivity. Following treatment with the anti-inflammatory drug dexamethasone, we were able to prevent SARS-CoV-2 spike protein-induced endothelial dysfunction. In addition, we confirmed release of inflammatory cytokines associated with the COVID-19 cytokine storm. In conclusion, we have demonstrated that even in the absence of immune cells, we are able to use this 3D in vitro model for angiogenesis to reproduce COVID-19 induced endothelial dysfunction seen in clinical settings.

Also flagged:immunoglobulinlight chain amyloidosislight chainAL) amyloidosishematologic disorderlight chains
Journal Article 2022-10-02 ✓ 1 Snippet Fraser CS, Spetz JKE, Qin X, Presser A, Choiniere J, Li C, Yu S, Blevins F, Hata AN, Miller JW, Bradshaw GA, Kalocsay M, Sanchorawala V, Sarosiek S, Sarosiek KA.
In-Text Gene Mentions

…synthetase 2, mitochondrial (DARS2) and isoleucyl-tRNA synthetas…

Show Full Abstract

Immunoglobulin light chain (AL) amyloidosis is an incurable hematologic disorder typically characterized by the production of amyloidogenic light chains by clonal plasma cells. These light chains misfold and aggregate in healthy tissues as amyloid fibrils, leading to life-threatening multi-organ dysfunction. Here we show that the clonal plasma cells in AL amyloidosis are highly primed to undergo apoptosis and dependent on pro-survival proteins MCL-1 and BCL-2. Notably, this MCL-1 dependency is indirectly targeted by the proteasome inhibitor bortezomib, currently the standard of care for this disease and the related plasma cell disorder multiple myeloma, due to upregulation of pro-apoptotic Noxa and its inhibitory binding to MCL-1. BCL-2 inhibitors sensitize clonal plasma cells to multiple front-line therapies including bortezomib, dexamethasone and lenalidomide. Strikingly, in mice bearing AL amyloidosis cell line xenografts, single agent treatment with the BCL-2 inhibitor ABT-199 (venetoclax) produces deeper remissions than bortezomib and triples median survival. Mass spectrometry-based proteomic analysis reveals rewiring of signaling pathways regulating apoptosis, proliferation and mitochondrial metabolism between isogenic AL amyloidosis and multiple myeloma cells that divergently alter their sensitivity to therapies. These findings provide a roadmap for the use of BH3 mimetics to exploit endogenous and induced apoptotic vulnerabilities in AL amyloidosis.

Also flagged:degradationorganellesTranscription factor EBTFEBALPneurodegenerative disease
Journal Article 2022-10-02 ✓ 4 Snippets Jiao F, Zhou B, Meng L.
In-Text Gene Mentions

Instead, they found reduced amounts of cytosolic cargo inside ‘empty’ autophagosomes caused by aberrant p62‐polyQ‐Htt interaction, which in turn yields a low protein degradation rate in HD samples.124

Furthermore, HEP14 obviously reduced the accumulation of polyQ‐Htt aggregates in 97Q‐induced HD cell models, promotes lysosome‐dependent clearance of lipid droplets in oleic acid‐induced cells, and reduces Aβ plaques in APP/PS1 mice.67

However, many recent studies have also shown that TFEB overexpression does not reduce mutant HTT aggregation in a mouse model of HD, possibly related to the formation of mHtt‐TFEB coaggregation mediated by a prion‐like domain (PrLD) near the N‐terminus of TFEB.159, 160

HD is a common polyQ neurodegenerative disease caused by repeat expansion of CAG trinucleotide in the first exon of the huntingtin (Htt) gene.123

Show Full Abstract

The autophagy-lysosomal pathway (ALP) is involved in the degradation of protein aggregates and damaged organelles. Transcription factor EB (TFEB), a major regulator of ALP, has emerged as a leading factor in addressing neurodegenerative disease pathology, including Alzheimer's disease (AD), Parkinson's disease (PD), PolyQ diseases, and Amyotrophic lateral sclerosis (ALS). In this review, we delineate the regulation of TFEB expression and its functions in ALP. Dysfunctions of TFEB and its role in the pathogenesis of several neurodegenerative diseases are reviewed. We summarize the protective effects and molecular mechanisms of some TFEB-targeted agonists in neurodegenerative diseases. We also offer our perspective on analyzing the pros and cons of these agonists in the treatment of neurodegenerative diseases from the perspective of drug development. More studies on the regulatory mechanisms of TFEB in other biological processes will aid our understanding of the application of TFEB-targeted therapy in neurodegeneration.

Also flagged:ABC transporterIDPbindingbindingsamino acidTNFRSF
Journal Article 2022-10-02 No Snippets Fu ZQ, Sha HL, Sha B.
Show Full Abstract

In this study, we presented an AISID method extending AlphaFold-Multimer's success in structure prediction towards identifying specific protein interactions with an optimized AISIDscore. The method was tested to identify the binding proteins in 18 human TNFSF (Tumor Necrosis Factor superfamily) members for each of 27 human TNFRSF (TNF receptor superfamily) members. For each TNFRSF member, we ranked the AISIDscore among the 18 TNFSF members. The correct pairing resulted in the highest AISIDscore for 13 out of 24 TNFRSF members which have known interactions with TNFSF members. Out of the 33 correct pairing between TNFSF and TNFRSF members, 28 pairs could be found in the top five (including 25 pairs in the top three) seats in the AISIDscore ranking. Surprisingly, the specific interactions between TNFSF10 (TNF-related apoptosis-inducing ligand, TRAIL) and its decoy receptors DcR1 and DcR2 gave the highest AISIDscore in the list, while the structures of DcR1 and DcR2 are unknown. The data strongly suggests that AlphaFold-Multimer might be a useful computational screening tool to find novel specific protein bindings. This AISID method may have broad applications in protein biochemistry, extending the application of AlphaFold far beyond structure predictions.

Also flagged:transcription factorsbindingcell differentiationSoxsex-determining regionSry
Journal Article 2022-10-02 No Snippets Akinyemi MO, Finucan J, Grytsay A, Osaiyuwu OH, Adegbaju MS, Ogunade IM, Thomas BN, Peters SO, Morenikeji OB.
Show Full Abstract

<i>Sox</i> genes are an evolutionarily conserved family of transcription factors that play important roles in cellular differentiation and numerous complex developmental processes. In vertebrates, <i>Sox</i> proteins are required for cell fate decisions, morphogenesis, and the control of self-renewal in embryonic and adult stem cells. The <i>Sox</i> gene family has been well-studied in multiple species including humans but there has been scanty or no research into Bovidae. In this study, we conducted a detailed evolutionary analysis of this gene family in Bovidae, including their physicochemical properties, biological functions, and patterns of inheritance. We performed a genome-wide cataloguing procedure to explore the <i>Sox</i> gene family using multiple bioinformatics tools. Our analysis revealed a significant inheritance pattern including conserved motifs that are critical to the ability of <i>Sox</i> proteins to interact with the regulatory regions of target genes and orchestrate multiple developmental and physiological processes. Importantly, we report an important conserved motif, EFDQYL/ELDQYL, found in the <i>Sox</i>E and <i>Sox</i>F groups but not in other <i>Sox</i> groups. Further analysis revealed that this motif sequence accounts for the binding and transactivation potential of <i>Sox</i> proteins. The degree of protein-protein interaction showed significant interactions among <i>Sox</i> genes and related genes implicated in embryonic development and the regulation of cell differentiation. We conclude that the <i>Sox</i> gene family uniquely evolved in Bovidae, with a few exhibiting important motifs that drive several developmental and physiological processes.

Also flagged:axoncell motilitybone remodelingguidance receptorsguidance receptoraxons
Journal Article 2022-10-02 ✓ 2 Snippets Laws KM, Bashaw GJ.
In-Text Gene Mentions

Dcc

Dcc 93

Show Full Abstract

Classical axon guidance ligands and their neuronal receptors were first identified due to their fundamental roles in regulating connectivity in the developing nervous system. Since their initial discovery, it has become clear that these signaling molecules play important roles in the development of a broad array of tissue and organ systems across phylogeny. In addition to these diverse developmental roles, there is a growing appreciation that guidance signaling pathways have important functions in adult organisms, including the regulation of tissue integrity and homeostasis. These roles in adult organisms include both tissue-intrinsic activities of guidance molecules, as well as systemic effects on tissue maintenance and function mediated by the nervous and vascular systems. While many of these adult functions depend on mechanisms that mirror developmental activities, such as regulating adhesion and cell motility, there are also examples of adult roles that may reflect signaling activities that are distinct from known developmental mechanisms, including the contributions of guidance signaling pathways to lineage commitment in the intestinal epithelium and bone remodeling in vertebrates. In this review, we highlight studies of guidance receptors and their ligands in adult tissues outside of the nervous system, focusing on <i>in vivo</i> experimental contexts. Together, these studies lay the groundwork for future investigation into the conserved and tissue-specific mechanisms of guidance receptor signaling in adult tissues.

bioRxiv 2022-10-02 Preprint (No Snippets API) Juilland M, Alouche N, Ubezzi I, Gonzalez M, Erdmann T, Lenz G, Luther SA, Thome M.
Show Full Abstract

The protease Malt1 controls the development and function of lymphocytes and promotes lymphomagenesis by cleaving a limited set of cellular substrates, many of which regulate gene transcription. Here, we report the identification of the integrin-binding scaffold protein Tensin-3 as a Malt1 substrate in activated B cells. B cells expressing a non-cleavable form of Tensin-3 (TNS3-nc) showed normal NF-κB and JNK transcriptional responses but increased and prolonged integrin-dependent adhesion upon activation. Moreover, mice expressing a non-cleavable form of Tensin-3 displayed reduced antibody production in response to immunization with a T-cell dependent antigen. We also explored the role of Tensin-3 in diffuse large B cell lymphomas and mantle cell lymphomas characterized by constitutive Malt1 activity, which showed strong constitutive Tensin-3 cleavage and a correlating reduction in total Tensin-3 levels. Silencing of Tensin-3 expression in Malt1-driven lymphoma models did not affect cellular proliferation but enhanced the dissemination of xenografted lymphoma cells. Thus, Malt1-dependent Tensin-3 cleavage limits integrin-dependent B-cell adhesion and promotes humoral immune responses and metastatic spreading of B cell lymphomas in a transcription-independent manner.

Also flagged:glutamateHDPathogenesisneurodegenerative disorderneurodegenerative diseasechorea
Journal Article 2022-10-01 ✓ 5 Snippets Pérot JB, Célestine M, Palombo M, Dhenain M, Humbert S, Brouillet E, Flament J.
In-Text Gene Mentions

Similarly, in human studies, the number of premanifest mutant HTT gene carriers or early stage HD patients to be included to observe a significant atrophy of their striatum is high (>30) (61).

It has been shown that selective inactivation of mutant HTT in progenitors of oligodendrocytes in the YAC128CAG mouse model of HD was sufficient to alleviate motor symptoms and defects in myelination, supporting the hypothesis of a cell autonomous mechanism of WM defects in HD (82).

…the protein huntingtin (htt) ( 2 ).…

…Mutanthtt(m-htt) is toxic…

…the presence of m-httin oligodendrocytes of…

Show Full Abstract

Pathogenesis of the inherited neurodegenerative disorder Huntington's disease (HD) is progressive with a long presymptomatic phase in which subtle changes occur up to 15 years before the onset of symptoms. Thus, there is a need for early, functional biomarker to better understand disease progression and to evaluate treatment efficacy far from onset. Recent studies have shown that white matter may be affected early in mutant HTT gene carriers. A previous study performed on 12 months old Ki140CAG mice showed reduced glutamate level measured by Chemical Exchange Saturation Transfer of glutamate (gluCEST), especially in the corpus callosum. In this study, we scanned longitudinally Ki140CAG mice with structural MRI, diffusion tensor imaging, gluCEST and magnetization transfer imaging, in order to assess white matter integrity over the life of this mouse model characterized by slow progression of symptoms. Our results show early defects of diffusion properties in the anterior part of the corpus callosum at 5 months of age, preceding gluCEST defects in the same region at 8 and 12 months that spread to adjacent regions. At 12 months, frontal and piriform cortices showed reduced gluCEST, as well as the pallidum. MT imaging showed reduced signal in the septum at 12 months. Cortical and striatal atrophy then appear at 18 months. Vulnerability of the striatum and motor cortex, combined with alterations of anterior corpus callosum, seems to point out the potential role of white matter in the brain dysfunction that characterizes HD and the pertinence of gluCEST and DTI as biomarkers in HD.

Also flagged:alpha-synucleinlocalizationnucleusbehavioralPDphosphorylation
Journal Article 2022-10-01 ✓ 2 Snippets Geertsma HM, Suk TR, Ricke KM, Horsthuis K, Parmasad JA, Fisk ZA, Callaghan SM, Rousseaux MWC.
In-Text Gene Mentions

Interestingly, among these 10 hits we noticed a few proteins of particular importance in DA signaling and have been associated with PD, such as Cacna1e, Darpp-32 [dopamine- and cAMP-regulated neuronal phosphoprotein a.k.a. protein phosphatase 1 regulator inhibitor subunit 1b (Ppp1r1b)], Fgf1, Gng7 (G Protein Subunit Gamma 7), Pde10a (Phosphodiesterase 10A) and SerpinA1a (38–45).

…PD, such asCacna1e, Darpp-32 [dopamine- and…

Show Full Abstract

A growing body of evidence suggests that nuclear alpha-synuclein (αSyn) plays a role in the pathogenesis of Parkinson's disease (PD). However, this question has been difficult to address as controlling the localization of αSyn in experimental systems often requires protein overexpression, which affects its aggregation propensity. To overcome this, we engineered SncaNLS mice, which localize endogenous αSyn to the nucleus. We characterized these mice on a behavioral, histological and biochemical level to determine whether the increase of nuclear αSyn is sufficient to elicit PD-like phenotypes. SncaNLS mice exhibit age-dependent motor deficits and altered gastrointestinal function. We found that these phenotypes were not linked to αSyn aggregation or phosphorylation. Through histological analyses, we observed motor cortex atrophy in the absence of midbrain dopaminergic neurodegeneration. We sampled cortical proteomes of SncaNLS mice and controls to determine the molecular underpinnings of these pathologies. Interestingly, we found several dysregulated proteins involved in dopaminergic signaling, including Darpp32, Pde10a and Gng7, which we further confirmed was decreased in cortical samples of the SncaNLS mice compared with controls. These results suggest that chronic endogenous nuclear αSyn can elicit toxic phenotypes in mice, independent of its aggregation. This model raises key questions related to the mechanism of αSyn toxicity in PD and provides a new model to study an underappreciated aspect of PD pathogenesis.

Also flagged:IronanemiaAnemia of cancercanceriron deficiencyerythropoiesis
Journal Article 2022-10-01 ✓ 1 Snippet Bregolat NF, Ruetten M, Da Silva MC, Aboouf MA, Ademi H, Büren NV, Armbruster J, Stirn M, Altamura S, Marques O, Rodriguez JMM, Samillan VJ, Singh RP, Wielockx B, Muckenthaler MU, Gassmann M, Thiersch M.
In-Text Gene Mentions

…while Bmp2 ,Hfeand Hjv were…

Show Full Abstract

Anemia of cancer (AoC) with its multifactorial etiology and complex pathology is a poor prognostic indicator for cancer patients. One of the main causes of AoC is cancer-associated inflammation that activates mechanisms, commonly observed in anemia of inflammation, whereby functional iron deficiency and iron-restricted erythropoiesis are induced by increased hepcidin levels in response to raised levels of interleukin-6. So far only a few AoC mouse models have been described, and most of them did not fully recapitulate the interplay of anemia, increased hepcidin levels and functional iron deficiency in human patients. To test if the selection and the complexity of AoC mouse models dictates the pathology or if AoC in mice per se develops independently of iron deficiency, we characterized AoC in Trp53floxWapCre mice that spontaneously develop breast cancer. These mice developed AoC associated with high levels of interleukin-6 and iron deficiency. However, hepcidin levels were not increased and hypoferremia coincided with anemia rather than causing it. Instead, an early shift in the commitment of common myeloid progenitors from the erythroid to the myeloid lineage resulted in increased myelopoiesis and in the excessive production of neutrophils that accumulate in necrotic tumor regions. This process could not be prevented by either iron or erythropoietin treatment. Trp53floxWapCre mice are the first mouse model in which erythropoietin-resistant anemia is described and may serve as a disease model to test therapeutic approaches for a subpopulation of human cancer patients with normal or corrected iron levels who do not respond to erythropoietin.

Also flagged:autosomal dominant optic atrophyOPA1DOAoptic neuropathyoptic nerve degenerationvision
Journal Article 2022-10-01 ✓ 1 Snippet Sladen PE, Jovanovic K, Guarascio R, Ottaviani D, Salsbury G, Novoselova T, Chapple JP, Yu-Wai-Man P, Cheetham ME.
In-Text Gene Mentions

…, ROBO2 ,DCC) and genes…

Show Full Abstract

Autosomal dominant optic atrophy (DOA) is the most common inherited optic neuropathy, characterized by the preferential loss of retinal ganglion cells (RGCs), resulting in optic nerve degeneration and progressive bilateral central vision loss. More than 60% of genetically confirmed patients with DOA carry variants in the nuclear OPA1 gene, which encodes for a ubiquitously expressed, mitochondrial GTPase protein. OPA1 has diverse functions within the mitochondrial network, facilitating inner membrane fusion and cristae modelling, regulating mitochondrial DNA maintenance and coordinating mitochondrial bioenergetics. There are currently no licensed disease-modifying therapies for DOA and the disease mechanisms driving RGC degeneration are poorly understood. Here, we describe the generation of isogenic, heterozygous OPA1 null induced pluripotent stem cell (iPSC) (OPA1+/-) through clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 gene editing of a control cell line, in conjunction with the generation of DOA patient-derived iPSC carrying OPA1 variants, namely, the c.2708_2711delTTAG variant (DOA iPSC), and previously reported missense variant iPSC line (c.1334G>A, DOA plus [DOA]+ iPSC) and CRISPR/Cas9 corrected controls. A two-dimensional (2D) differentiation protocol was used to study the effect of OPA1 variants on iPSC-RGC differentiation and mitochondrial function. OPA1+/-, DOA and DOA+ iPSC showed no differentiation deficit compared to control iPSC lines, exhibiting comparable expression of all relevant markers at each stage of differentiation. OPA1+/- and OPA1 variant iPSC-RGCs exhibited impaired mitochondrial homeostasis, with reduced bioenergetic output and compromised mitochondrial DNA maintenance. These data highlight mitochondrial deficits associated with OPA1 dysfunction in human iPSC-RGCs, and establish a platform to study disease mechanisms that contribute to RGC loss in DOA, as well as potential therapeutic interventions.

Also flagged:IgGantibodiesantibody
Journal Article 2022-10-01 No Snippets Vu DM, Vu DTB, Do TTT, Olmsted AE, Dao BH, Thai TT, Nguyen CL, Le NTT, Le TA, Bui HTT, Pham TN, Moore MR.
Show Full Abstract

<h4>Background</h4>Before the SARS-CoV-2 Delta variant arrived in Vietnam, case rates suggested seroprevalence of SARS-CoV-2 was low. Beginning in March 2021, we assessed different dosing schedules and adverse events following immunization (AEFIs) for ChAdOx1 nCoV-19 vaccine among healthcare workers (HCWs).<h4>Methods</h4>We performed a prospective cohort study to estimate the prevalence of IgG antibodies to SARS-CoV-2 before and after ChAdOx1 nCoV-19 vaccination. We conducted antibody testing among HCWs in February 2021 (baseline), before the second dose (June-July 2021), and 1 and 3 months after the second dose. We detected antibodies to SARS-CoV-2 using Tetracore® FlexImmArray™, and surrogate neutralizing antibodies using GenScript cPass™. Neither assay can distinguish natural from vaccine-induced antibodies. We assessed AEFIs through interview post-dose 1 and 1 month post-dose 2.<h4>Results</h4>Before vaccination, 1/617 participants (0.16%) had antibodies to SARS-CoV-2. Of these 617, 405 were vaccinated with ChAdOx1 nCoV-19 with 4-8- (60%), 9-12- (27%), or ≥13-week (13%) intervals between the 2 doses. Three months following series completion, 99% and 97% of vaccinated participants had ≥1 sample with detectable antibodies and surrogate neutralizing antibodies against SARS-CoV-2, respectively. We observed no significant differences among those with different dosing intervals at last follow-up. All participants reported PCR testing for SARS-CoV-2 during the study; 2 (0.5%) were laboratory-confirmed. AEFIs were more frequent post-dose 1 (81%) vs post-dose 2 (21%).<h4>Conclusions</h4>In this population, regardless of dosing interval, ChAdOx1 nCoV-19 induced antibodies within 3 months of the second dose. These findings may offer flexibility to policymakers when balancing programmatic considerations with vaccine effectiveness.

Also flagged:gene expressionestrous cycleimmune responsepro-inflammatory cytokinesinseminationmucus
Journal Article 2022-10-01 ✓ 1 Snippet Abril-Parreño L, Krogenæs AK, Druart X, Cormican P, Fair S, Meade KG.
In-Text Gene Mentions

…SLC6A14 ), theForkhead Box C1Box C1 (…

Show Full Abstract

Worldwide, cervical artificial insemination using frozen-thawed semen yields low pregnancy rates. The only exception to this is in Norway, where vaginal insemination with frozen-thawed semen yields pregnancy rates in excess of 60% and which has been attributed to the specific ewe breed used. Our previous work demonstrated differences in cervical gene expression at the follicular phase of the estrous cycle in ewe breeds with known differences in pregnancy rates. In this study, we characterized the cervical transcriptome of the same ewe breeds [Suffolk, Belclare, Fur, and Norwegian White Sheep (NWS)] during the luteal phase, as an optimal environment at the luteal phase could better prepare the cervix for sperm migration through the cervix at the subsequent follicular phase. High-quality RNA extracted from postmortem cervical tissue was analyzed by RNA sequencing. After stringent filtering, 1051, 1924, and 611 differentially expressed genes (DEGs) were detected in the low-fertility Suffolk breed compared with Belclare, Fur, and NWS, respectively. Gene ontology analysis identified increased humoral adaptive immune response pathways in Suffolk. Increased expression of multiple immune genes supports the presence of an active immune response in the cervix of Suffolk ewes, which differentiates them significantly from the other three ewe breeds. Inflammatory pathways were upregulated in the Suffolk, resulting in higher expression of the potent pro-inflammatory cytokines. Therefore, higher levels of pro-inflammatory cytokines indicate unresolved inflammation in the cervix of the low-fertility Suffolk breed that could contribute to reduced cervical sperm transport in the next follicular phase.

Also flagged:DementiaMild Cognitive ImpairmentACEneurocognitive impairment
Journal Article 2022-10-01 ✓ 1 Snippet Bhattacharyya B, Mukherjee R, Mukherjee A, Das G, Dogra AK, Das S, Biswas A.
In-Text Gene Mentions

…o 0.955.<h4>Conclusion</h4>TheACE-III-Bengali is found to…

Show Full Abstract

<h4>Objective</h4>Bengali, the 6th most spoken language globally with 268 million speakers, demands a culturally appropriate tool for screening any cognitive compromise in this population. Addenbrooke Cognitive Examination-III (ACE-III) is a standardized tool used for screening and/or diagnostic purpose worldwide. The aim of the present study was to adapt and validate ACE-III into Bengali language.<h4>Methods</h4>The ACE-III UK Version A (2012) was adapted with linguistically and culturally appropriate items and validated on Bengali speakers. The participants consisted of 40 dementia and 22 Mild Cognitive Impairment (MCI) patients and 120 healthy-controls. Reliability and validity were examined. Discriminant function analysis was done. Sensitivity and specificity were evaluated and optimum cut-offs were established for MCI and dementia.<h4>Results</h4>Both sensitivity and specificity of ACE-III-Bengali of identifying dementia was 1; sensitivity for MCI ranged from 0.83 to 1, specificity from 0.76 to 1. Discriminant function analysis showed a significant difference in all domains of ACE-III-Bengali between healthy individuals and persons with neurocognitive impairment. Separate optimum ACE-III-Bengali cut-off scores were established according to level of education. For low education (<Class 10) cut-off was 83 for dementia and 86 for MCI, whereas, for high education (≥Class 10) it was 85 and 88 for dementia and MCI, respectively. The area under curve for distinguishing dementia and MCI ranged from 0.949 to 0.955.<h4>Conclusion</h4>The ACE-III-Bengali is found to have high diagnostic accuracy in identifying dementia and MCI in the Bengali population.

Also flagged:STAT3triple-negative breast cancerHigh-mobility group nucleosome-binding domain 4bindingnucleosomeHMGN1
Journal Article 2022-10-01 ✓ 5 Snippets Mou J, Xu X, Wang F, Kong W, Chen J, Ren J.
In-Text Gene Mentions

HMGN4 belongs to HMGNs family, in which HMGN1, 2 and 5 have been reported to play roles in oncogenesis of various cancers.

Moreover, we found that HMGN4 controlled the proliferation of human TNBC cells both in vitro and in vivo.

HMGN4 plays a key role in STAT3-mediated oncogenesis of triple-negative breast cancer.

In summary, our findings not only identified a novel regulator in TNBC cell proliferation but also revealed the mechanism by which HMGN4 acted as a downstream gene of STAT3 to participate in the STAT3 pathway, which indicated that HMGN4 was likely to be a potential novel target for anti-TNBC therapy.

In this study, we discovered for the first time that HMGN4 was highly expressed in human triple-negative breast cancer (TNBC), based on the analysis of the TCGA database.

Show Full Abstract

High-mobility group nucleosome-binding domain 4 (HMGN4) exerts biological functions by regulating gene transcription through binding with nucleosome. As a new epigenetic regulator discovered in 2001, its biological functions have not been clarified. HMGN4 belongs to HMGNs family, in which HMGN1, 2 and 5 have been reported to play roles in oncogenesis of various cancers. However, it is reported that HMGN4 was associated with thyroid and liver cancer. In this study, we discovered for the first time that HMGN4 was highly expressed in human triple-negative breast cancer (TNBC), based on the analysis of the TCGA database. Moreover, we found that HMGN4 controlled the proliferation of human TNBC cells both in vitro and in vivo. Mechanistically, the positive correlation occurred between HMGN4 and STAT3 downstream genes while HMGN4 played an indispensable role in constitutively active STAT3 (STAT3C) induced colony formation. Interestingly, we reported that STAT3 regulated HMGN4 transcription as its transcriptional factor by chromatin immunoprecipitation and HMGN4 promoter-luc assays. That is to say, there is a feed-forward signaling circuit between HMGN4 and STAT3, which might control TNBC cell growth. Finally, we proved that the interference of HMGN4 by nanovehicle-packaged siRNA may be a potentially effective approach in TNBC treatment. In summary, our findings not only identified a novel regulator in TNBC cell proliferation but also revealed the mechanism by which HMGN4 acted as a downstream gene of STAT3 to participate in the STAT3 pathway, which indicated that HMGN4 was likely to be a potential novel target for anti-TNBC therapy.

Also flagged:cancertumorextracellularmetabolismdeathblood circulation
Journal Article 2022-10-01 No Snippets Er EE, Tello-Lafoz M, Huse M.
Show Full Abstract

Epithelial transformation and carcinogenesis are characterized by profound alterations in cell mechanics that significantly affect multiple steps of the metastatic cascade. The ability of cancer cells to grow in the primary tumor, to locally invade through the confining extracellular matrix, to survive in circulation, and to extravasate into distant vital organs all depend on specific mechanical characteristics. Importantly, recent studies have shown that the mechanical properties of cancer cells also influence their interactions with immune and stromal cells. Here, we discuss the mechanical changes that cancer cells undergo during metastasis, how these changes affect immune and stromal responses, and the implications of these new insights for therapeutic intervention.

Also flagged:leukemia inhibitory factorLIFmyogenesisnuclear factor erythroid 2-related factor 2Nrf2Heart failure
Journal Article 2022-10-01 ✓ 1 Snippet Yao J, Ma F, Zhang L, Zhu C, Jumabay M, Yao Z, Wang L, Cai X, Zhang D, Qiao X, Shivkumar K, Pellegrini M, Yao Y, Wu X, Boström KI.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Adipose-derived cells (ADCs) from white adipose tissue are promising stem cell candidates because of their large regenerative reserves and the potential for cardiac regeneration. However, given the heterogeneity of ADC and its unsolved mechanisms of cardiac acquisition, ADC-cardiac transition efficiency remains low. In this study, we explored the heterogeneity of ADCs and the cellular kinetics of 39,432 single-cell transcriptomes along the leukemia inhibitory factor (LIF)-induced ADC-cardiac transition. We identified distinct ADC subpopulations that reacted differentially to LIF when entering the cardiomyogenic program, further demonstrating that ADC-myogenesis is time-dependent and initiates from transient changes in nuclear factor erythroid 2-related factor 2 (Nrf2) signaling. At later stages, pseudotime analysis of ADCs navigated a trajectory with 2 branches corresponding to activated myofibroblast or cardiomyocyte-like cells. Our findings offer a high-resolution dissection of ADC heterogeneity and cell fate during ADC-cardiac transition, thus providing new insights into potential cardiac stem cells.

Also flagged:sleepcomplexpathogenesisinsomniahypersomniasleep apnea
Journal Article 2022-10-01 ✓ 1 Snippet Sonti S, Grant SFA.
In-Text Gene Mentions

VRK2

Show Full Abstract

Sleep occurs universally and is a biological necessity for human functioning. The consequences of diminished sleep quality impact physical and physiological systems such as neurological, cardiovascular, and metabolic processes. In fact, people impacted by common complex diseases experience a wide range of sleep disturbances. It is challenging to uncover the underlying molecular mechanisms responsible for decreased sleep quality in many disease systems owing to the lack of suitable sleep biomarkers. However, the discovery of a genetic component to sleep patterns has opened a new opportunity to examine and understand the involvement of sleep in many disease states. It is now possible to use major genomic resources and technologies to uncover genetic contributions to many common diseases. Large scale prospective studies such as the genome wide association studies (GWAS) have successfully revealed many robust genetic signals associated with sleep-related traits. With the discovery of these genetic variants, a major objective of the community has been to investigate whether sleep-related traits are associated with disease pathogenesis and other health complications. Mendelian Randomization (MR) represents an analytical method that leverages genetic loci as proxy indicators to establish causal effect between sleep traits and disease outcomes. Given such variants are randomly inherited at birth, confounding bias is eliminated with MR analysis, thus demonstrating evidence of causal relationships that can be used for drug development and to prioritize clinical trials. In this review, we outline the results of MR analyses performed to date on sleep traits in relation to a multitude of common complex diseases.

Also flagged:PTENPIK3CABreast Cancerinvasive breast cancertumorstumor
Journal Article 2022-10-01 ✓ 1 Snippet Wang T, Heng YJ, Baker GM, Bret-Mounet VC, Quintana LM, Frueh L, Hankinson SE, Holmes MD, Chen WY, Willett WC, Rosner B, Tamimi RM, Eliassen AH.
In-Text Gene Mentions

Tumor suppressor gene PTEN

Show Full Abstract

<h4>Background</h4>The relationships between PTEN loss and/or PIK3CA mutation and breast cancer prognosis remain controversial. We aim to examine the associations in large epidemiologic cohorts.<h4>Methods</h4>We followed women with invasive breast cancer from the Nurses' Health Studies with available data on tumor PTEN expression (n = 4,111) and PIK3CA mutation (n = 2,930). PTEN expression was evaluated by IHC and digitally scored (0%-100%). Pyrosequencing of six hotspot mutations of PIK3CA was performed.<h4>Results</h4>We found loss of PTEN expression (≤10%) occurred in 17% of cases, and PIK3CA mutations were detected in 11% of cases. After adjusting for clinical and lifestyle factors, PTEN loss was not associated with worse breast cancer-specific mortality among all samples [HR, 0.85; 95% confidence intervals (CI), 0.71-1.03] or among estrogen receptor (ER)-positive tumors (HR, 0.99; 95% CI, 0.79-1.24). However, among ER-negative tumors, PTEN loss was associated with lower breast cancer-specific mortality (HR, 0.68; 95% CI, 0.48-0.95). PIK3CA mutation was not strongly associated with breast cancer-specific mortality (HR, 0.89; 95% CI, 0.67-1.17). Compared with tumors without PTEN loss and without PIK3CA mutation, those with alterations (n = 540) were not at higher risk (HR, 1.07; 95% CI, 0.86-1.34). However, women with both PTEN loss and PIK3CA mutation (n = 38) were at an increased risk of breast cancer-specific mortality (HR, 1.65; 95% CI, 0.83-3.26).<h4>Conclusions</h4>In this large epidemiologic study, the PTEN-mortality association was more pronounced for ER-negative tumors, and the joint PTEN loss and PIK3CA mutation may be associated with worse prognosis.<h4>Impact</h4>Further studies with a larger sample of ER-negative tumors are needed to replicate our findings and elucidate underlying mechanisms.

Also flagged:ERprolinePELP1peptidepeptidesPIP1
Journal Article 2022-10-01 No Snippets Altwegg KA, Viswanadhapalli S, Mann M, Chakravarty D, Krishnan S, Liu Z, Liu J, Pratap UP, Ebrahimi B, Sanchez JR, Li X, Ma S, Park BH, Santhamma B, Chen Y, Lai Z, Raj GV, Yuan Y, Zhou D, Sareddy GR, Tekmal RR, McHardy S, Huang TH, Rao MK, Vankayalapati H, Vadlamudi RK.
Show Full Abstract

Most patients with estrogen receptor alpha-positive (ER+) breast cancers initially respond to treatment but eventually develop therapy resistance with disease progression. Overexpression of oncogenic ER coregulators, including proline, glutamic acid, and leucine-rich protein 1 (PELP1), are implicated in breast cancer progression. The lack of small molecules that inhibits PELP1 represents a major knowledge gap. Here, using a yeast-two-hybrid screen, we identified novel peptide inhibitors of PELP1 (PIP). Biochemical assays demonstrated that one of these peptides, PIP1, directly interacted with PELP1 to block PELP1 oncogenic functions. Computational modeling of PIP1 revealed key residues contributing to its activity and facilitated the development of a small-molecule inhibitor of PELP1, SMIP34, and further analyses confirmed that SMIP34 directly bound to PELP1. In breast cancer cells, SMIP34 reduced cell growth in a dose-dependent manner. SMIP34 inhibited proliferation of not only wild-type (WT) but also mutant (MT) ER+ and therapy-resistant breast cancer cells, in part by inducing PELP1 degradation via the proteasome pathway. RNA sequencing analyses showed that SMIP34 treatment altered the expression of genes associated with estrogen response, cell cycle, and apoptosis pathways. In cell line-derived and patient-derived xenografts of both WT and MT ER+ breast cancer models, SMIP34 reduced proliferation and significantly suppressed tumor progression. Collectively, these results demonstrate SMIP34 as a first-in-class inhibitor of oncogenic PELP1 signaling in advanced breast cancer.<h4>Significance</h4>Development of a novel inhibitor of oncogenic PELP1 provides potential therapeutic avenues for treating therapy-resistant, advanced ER+ breast cancer.

Also flagged:aspirinacetylsalicylic acidsalicylic acidwaterASAmyocardial infarction
Journal Article 2022-10-01 No Snippets Atar D, Sarkar S, Kolev E, Mura C, Brosstad F, Theodorsen L, Westen GI, Stribolt-Halvorsen PE.
Show Full Abstract

<h4>Objectives</h4>The primary objective of this study was to assess the pharmacokinetic profiles of acetylsalicylic acid (ASA) and salicylic acid (SA) after administration of two different formulations of aspirin under fasting and fed conditions.<h4>Materials and methods</h4>The study was a randomized, open-label, parallel-group, 2-arm crossover study conducted at a single center. Healthy subjects were randomized to receive 300 mg of aspirin in either a 15-mL oral solution (pre-packaged vial containing powder and solvent that are combined at the time of administration) or a single solid tablet to be chewed and swallowed with 150 mL of water. Treatment visits were separated by a 10-day wash-out period.<h4>Results</h4>At 3 minutes, ASA concentrations for the oral solution fed state and fasting state arms exceeded those for the chewed tablet (fed 299 vs. 139 ng/mL; fasting 356 vs. 204 ng/mL). Compared to the chewed tablet, the mean plasma ASA concentration was 74% greater with the oral solution under fasting conditions, and 115% greater under fed conditions. Similarly, at 3 minutes, the mean SA plasma concentration with the oral solution under fed and fasting conditions exceeded those for the chewed tablet (fed 310 vs. 160 ng/mL; fasting 330 vs. 185 ng/mL). Under fasting conditions, the mean plasma ASA AUC<sub>0-last</sub>, with the oral solutions was 168,076.8 min.ng/mL compared to 163,726.3 min.ng/mL with the chewed tablet. Under fed conditions, the mean plasma ASA AUC<sub>0-last</sub>, with the oral solutions was 179,116.7 min.ng/mL compared to 164,704.3 min.ng/mL with the chewed tablet.<h4>Conclusion</h4>This phase 1 study showed that use of an aspirin oral solution provided more rapid exposure to higher plasma concentration levels of ASA and SA than chewing a solid tablet.

Also flagged:RNA binding proteinsRBPbindingRNA-binding proteinsmetabolismSLBP
Journal Article 2022-10-01 ✓ 5 Snippets Laverty KU, Jolma A, Pour SE, Zheng H, Ray D, Morris Q, Hughes TR.
In-Text Gene Mentions

…39 ) andRC3H1( 40 ).…

RC3H1and Nova2 peaks…

…(e.g. SNRPA and Roquin/RC3H1( 48 ,…

…(e.g. HNRNPL and Roquin/RC3H1( 49 ,…

…The proteinRC3H1, or Roquin, binds…

Show Full Abstract

Modelling both primary sequence and secondary structure preferences for RNA binding proteins (RBPs) remains an ongoing challenge. Current models use varied RNA structure representations and can be difficult to interpret and evaluate. To address these issues, we present a universal RNA motif-finding/scanning strategy, termed PRIESSTESS (Predictive RBP-RNA InterpretablE Sequence-Structure moTif regrESSion), that can be applied to diverse RNA binding datasets. PRIESSTESS identifies dozens of enriched RNA sequence and/or structure motifs that are subsequently reduced to a set of core motifs by logistic regression with LASSO regularization. Importantly, these core motifs are easily visualized and interpreted, and provide a measure of RBP secondary structure specificity. We used PRIESSTESS to interrogate new HTR-SELEX data for 23 RBPs with diverse RNA binding modes and captured known primary sequence and secondary structure preferences for each. Moreover, when applying PRIESSTESS to 144 RBPs across 202 RNA binding datasets, 75% showed an RNA secondary structure preference but only 10% had a preference besides unpaired bases, suggesting that most RBPs simply recognize the accessibility of primary sequences.

Also flagged:chronicliver diseaseHCV infectiondeathnoncirrhosiscompensated cirrhosis
Journal Article 2022-10-01 No Snippets Kaplan DE, Serper M, Kaushik A, Durkin C, Raad A, El-Moustaid F, Smith N, Yehoshua A.
Show Full Abstract

<b>BACKGROUND:</b> Direct-acting antivirals (DAAs) have been a breakthrough therapeutic innovation in the treatment of chronic hepatitis C virus (HCV) with significantly improved efficacy, safety, and tolerability. <b>OBJECTIVE:</b> To evaluate the cost-effectiveness of treating patients with HCV with DAAs compared with pre-DAAs or no treatment over a lifetime horizon from the perspective of the US Veterans Affairs (VA) health care system. <b>METHODS:</b> A hybrid decision-tree and Markov model simulated the health outcomes of a cohort of 142,147 patients with HCV with an average age of 63 years. Demographic data, treatment rates and distribution, treatment efficacy by subpopulation, and health state costs were sourced from VA data. Treatment costs and utility values were sourced from publicly available databases and prior publications for older regimens. <b>RESULTS:</b> Over a lifetime horizon, the use of DAAs results in a significant reduction in advanced liver disease events compared with pre-DAA and no treatment. Total cost savings of $7 and $9 billion over a lifetime horizon (50 years) were predicted for patients who received DAA treatments compared with patients treated with pre-DAA treatments and those who were untreated, respectively. Cost savings were achieved quickly after treatment, with DAAs being inexpensive when compared with both the pre-DAA and untreated scenarios within 5 years. The DAA intervention dominated (ie, more effective and less costly) for both the pre-DAA and untreated strategies on both a per-patient and cohort basis. <b>CONCLUSIONS:</b> The use of DAA-based treatments in patients with HCV in the VA system significantly reduced long-term HCV-related morbidity and mortality, while providing cost savings within only 5 years of treatment. <b>DISCLOSURES:</b> This work was supported by Gilead Inc. Health Economic Outcomes Research group, grant number GS-US-18-HCV003. Drs Yehoshua and Kaushik are employees of Gilead in the Health Economic Outcome Research group. These individuals reviewed the manuscript but did not contribute to input or output of the Markov model. Maple Health Group (Dr El-Moustaid, Ms Raad, and Dr Smith) are consultants hired by Gilead for Markov modeling expertise. The model used in this study was previously published and peer reviewed. Data inputted into the model related to patient demographic, treatment outcomes, clinical outcomes, and costs were completely independent in derivation by Drs Kaplan, Serper, and Durkin and were not influenced by the funding sponsor. Dr Kaplan reports grants from Gilead Inc. during the conduct of the study and grants from Gilead Inc., other from Glycotest Inc., other from AstraZeneca, other from Exact Sciences, and other from Bayer outside the submitted work.

Also flagged:kininserineproteasePKbradykininHK
Journal Article 2022-10-01 ✓ 1 Snippet Favier B, Bicout DJ, Baroso R, Paclet MH, Drouet C.
In-Text Gene Mentions

…the main beingC1 InhibitorInhibitor (C1-INH) […

Show Full Abstract

Human kallikrein-kinin system (KKS) is a proteolytic cascade with two serine-protease zymogen couples (Factor XII and prekallikrein (PK) and their activated forms, FXIIa, PKa, respectively), releasing bradykinin by cleavage of native high-molecular-weight kininogen (nHK) into cleaved HK. For KKS investigation in human plasma, this cascade is usually triggered on ice eventually by mixing with purified proteins. It has been established that purified FXIIa, PK, and nHK required a fixed order and timing for mixing protein on ice to ensure reproducibility of testing, we investigated the activation kinetics of both enzymes. The activation process of this in vitro minimal reconstitution of KKS was studied by progress curve analysis, in condition of high enzyme/substrate ratio and by using on natural rather than peptide substrates. FXIIa and PKa were found five-times less active on ice than at 37°C: kcat = 0.133 ± 0.034 and 0.0119 ± 0.0027 s-1, KM = 672 ± 150 and 115 ± 24 nM, respectively. The progress curve analysis of our in vitro KKS reconstitutions differed from a Michaelis-Menten mathematical simulation by a faster initial rate and a slower late rate. These two features were also observed ex vivo by using dextran sulfate-activated plasma and could reinforce the hypothesis of a maximal local effect (bradykinin release) and a minimal systemic consequence (PK preservation) in KKS activation process. Analyzing the complete curve of cold KKS activation would provide valuable information for ex vivo investigation of KKS in samples from patients presenting with hereditary angioedema and other inflammatory conditions.

Also flagged:acridineacridinescarboxamidecarbonoligodeoxynucleotideAcridine-4-carboxamides
Journal Article 2022-10-01 ✓ 4 Snippets Kostelansky F, Miletin M, Havlinova Z, Szotakova B, Libra A, Kucera R, Novakova V, Zimcik P.
In-Text Gene Mentions

…assay for theHFEgene with the…

…a part ofHFEgene containing two…

…sequences of theHFEgene were selected,…

…the mutations inHFEgene was observed…

Show Full Abstract

The short oligodeoxynucleotide (ODN) probes are suitable for good discrimination of point mutations. However, the probes suffer from low melting temperatures. In this work, the strategy of using acridine-4-carboxamide intercalators to improve thermal stabilisation is investigated. The study of large series of acridines revealed that optimal stabilisation is achieved upon decoration of acridine by secondary carboxamide carrying sterically not demanding basic function bound through a two-carbon linker. Two highly active intercalators were attached to short probes (13 or 18 bases; designed as a part of HFE gene) by click chemistry into positions 7 and/or 13 and proved to increase the melting temperate (Tm) of the duplex by almost 8°C for the best combination. The acridines interact with both single- and double-stranded DNAs with substantially preferred interaction for the latter. The study of interaction suggested higher affinity of the acridines toward the GC- than AT-rich sequences. Good discrimination of two point mutations was shown in practical application with HFE gene (wild type, H63D C &gt; G and S65C A &gt; C mutations). Acridine itself can also serve as a fluorophore and also allows discrimination of the fully matched sequences from those with point mutations in probes labelled only with acridine.

Also flagged:Condensin Icondensin IIorganizationGamma Interferon Activated Inhibitor of TranslationL1retrotransposition
Journal Article 2022-10-01 ✓ 3 Snippets Ward JR, Khan A, Torres S, Crawford B, Nock S, Frisbie T, Moran JV, Longworth MS.
In-Text Gene Mentions

…3′UTR independent, SuperCondensinComplex (SCC) in…

…II proteins, SuperCondensincomplexes (SCCs).…

Condensinproteins cooperate in…

Show Full Abstract

Condensin I and condensin II are multi-subunit complexes that are known for their individual roles in genome organization and preventing genomic instability. However, interactions between condensin I and condensin II subunits and cooperative roles for condensin I and condensin II, outside of their genome organizing functions, have not been reported. We previously discovered that condensin II cooperates with Gamma Interferon Activated Inhibitor of Translation (GAIT) proteins to associate with Long INterspersed Element-1 (LINE-1 or L1) RNA and repress L1 protein expression and the retrotransposition of engineered L1 retrotransposition in cultured human cells. Here, we report that the L1 3'UTR is required for condensin II and GAIT association with L1 RNA, and deletion of the L1 RNA 3'UTR results in increased L1 protein expression and retrotransposition. Interestingly, like condensin II, we report that condensin I also binds GAIT proteins, associates with the L1 RNA 3'UTR, and represses L1 retrotransposition. We provide evidence that the condensin I protein, NCAPD2, is required for condensin II and GAIT protein association with L1 RNA. Furthermore, condensin I and condensin II subunits interact to form a L1-dependent super condensin complex (SCC) which is located primarily within the cytoplasm of both transformed and primary epithelial cells. These data suggest that increases in L1 expression in epithelial cells promote cytoplasmic condensin protein associations that facilitate a feedback loop in which condensins may cooperate to mediate L1 repression.

Also flagged:HistonesHistonechromatinnucleosomeH2AH2B
Journal Article 2022-10-01 No Snippets Seal RL, Denny P, Bruford EA, Gribkova AK, Landsman D, Marzluff WF, McAndrews M, Panchenko AR, Shaytan AK, Talbert PB.
Show Full Abstract

Histones have a long history of research in a wide range of species, leaving a legacy of complex nomenclature in the literature. Community-led discussions at the EMBO Workshop on Histone Variants in 2011 resulted in agreement amongst experts on a revised systematic protein nomenclature for histones, which is based on a combination of phylogenetic classification and historical symbol usage. Human and mouse histone gene symbols previously followed a genome-centric system that was not applicable across all vertebrate species and did not reflect the systematic histone protein nomenclature. This prompted a collaboration between histone experts, the Human Genome Organization (HUGO) Gene Nomenclature Committee (HGNC) and Mouse Genomic Nomenclature Committee (MGNC) to revise human and mouse histone gene nomenclature aiming, where possible, to follow the new protein nomenclature whilst conforming to the guidelines for vertebrate gene naming. The updated nomenclature has also been applied to orthologous histone genes in chimpanzee, rhesus macaque, dog, cat, pig, horse and cattle, and can serve as a framework for naming other vertebrate histone genes in the future.

Also flagged:insulininsulin insensitivityorganizationmatingcapsulemorphogenesis
Journal Article 2022-10-01 No Snippets Genevcius BC, Calandriello DC, Torres TT.
Show Full Abstract

Our understanding of the genetic architecture of phenotypic traits has experienced drastic growth over the last years. Nevertheless, the majority of studies associating genotypes and phenotypes have been conducted at the ontogenetic level. Thus, we still have an elusive knowledge of how these genetic-developmental architectures evolve themselves and how their evolution is mirrored in the phenotypic change across evolutionary time. We tackle this gap by reconstructing the evolution of male genital size, one of the most complex traits in insects, together with its underlying genetic architecture. Using the order Hemiptera as a model, spanning over 350 million years of evolution, we estimate the correlation between genitalia and three features: development rate, body size, and rates of DNA substitution in 68 genes associated with genital development. We demonstrate that genital size macro-evolution has been largely dependent on body size and weakly influenced by development rate and phylogenetic history. We further revealed significant correlations between mutation rates and genital size for 19 genes. Interestingly, these genes have diverse functions and participate in distinct signaling pathways, suggesting that genital size is a complex trait whose fast evolution has been enabled by molecular changes associated with diverse morphogenetic processes. Our data further demonstrate that the majority of DNA evolution correlated with the genitalia has been shaped by negative selection or neutral evolution. Thus, in terms of sequence evolution, changes in genital size are predominantly facilitated by relaxation of constraints rather than positive selection, possibly due to the high pleiotropic nature of the morphogenetic genes.

Also flagged:Mitochondrial Dynamin-Related Protein Drp1Drp1doxorubicincancersheart failuremitochondria
Journal Article 2022-10-01 ✓ 1 Snippet Deng Y, Ngo DTM, Holien JK, Lees JG, Lim SY.
In-Text Gene Mentions

…disorder known ashemochromatosisthat causes iron…

Show Full Abstract

<h4>Purpose of review</h4>This study is aimed at reviewing the recent progress in Drp1 inhibition as a novel approach for reducing doxorubicin-induced cardiotoxicity and for improving cancer treatment.<h4>Recent findings</h4>Anthracyclines (e.g. doxorubicin) are one of the most common and effective chemotherapeutic agents to treat a variety of cancers. However, the clinical usage of doxorubicin has been hampered by its severe cardiotoxic side effects leading to heart failure. Mitochondrial dysfunction is one of the major aetiologies of doxorubicin-induced cardiotoxicity. The morphology of mitochondria is highly dynamic, governed by two opposing processes known as fusion and fission, collectively known as mitochondrial dynamics. An imbalance in mitochondrial dynamics is often reported in tumourigenesis which can lead to adaptive and acquired resistance to chemotherapy. Drp1 is a key mitochondrial fission regulator, and emerging evidence has demonstrated that Drp1-mediated mitochondrial fission is upregulated in both cancer cells to their survival advantage and injured heart tissue in the setting of doxorubicin-induced cardiotoxicity. Effective treatment to prevent and mitigate doxorubicin-induced cardiotoxicity is currently not available. Recent advances in cardio-oncology have highlighted that Drp1 inhibition holds great potential as a targeted mitochondrial therapy for doxorubicin-induced cardiotoxicity.

Also flagged:calcinosisleptospirosisskin lesionsrenal andhepatic diseasesystemic disease
Journal Article 2022-10-01 No Snippets Muller C, Gaguère E, Muller A, Husson JC, Degorce-Rubiales F.
Show Full Abstract

A 4-month-old male beagle dog was presented for a 15-day history of firm cutaneous nodules. Histopathological examination of skin biopsies revealed calcinosis cutis. However, re-evaluation 40 d later confirmed spontaneous resolution of the lesions without specific treatment. Two weeks before development of the skin lesions, this dog had been hospitalized and treated for acute renal and hepatic disease attributed to leptospirosis, with both PCR and serology positive for <i>Leptospira australis.</i> Calcinosis cutis secondary to a systemic disease (leptospirosis, blastomycosis) has been rarely reported. In this case, the suspected pathogenesis included organic stress (cortisol hypersecretion) and abnormal calcium/phosphorus metabolism during acute renal failure. To our knowledge, this is the third published case of cutis calcinosis associated with leptospirosis in dogs. Key clinical message: Previous leptospirosis should be considered in a dog with calcinosis cutis. The cutaneous lesions appeared after acute leptospirosis and regressed spontaneously.

Also flagged:Folic acidSodium Fluoridesodiumfluorideovulationfertilization
Journal Article 2022-10-01 No Snippets Lin X, Fu B, Xiong Y, Xu S, Liu J, Zaky MY, Qiu D, Wu H.
Show Full Abstract

Excessive sodium fluoride (NaF) intake interferes with reproductive function in humans and animals; however, strategies to prevent these effects are still underexplored. Here, we showed that <i>in vivo</i> and <i>in vitro</i> supplementation of folic acid (FA) efficaciously improved the quality of NaF-exposed oocytes. FA supplementation not only increased ovulation of oocytes from NaF-treated mice but also enhanced oocyte meiotic competency and fertilization ability by restoring the spindle/chromosome structure. Moreover, FA supplementation could exert a beneficial effect on NaF- exposed oocytes by restoring mitochondrial function, eliminating reactive oxygen species accumulation to suppress apoptosis. We also found that FA supplementation restored the defective phenotypes in oocytes through a <i>Sirt1</i>/<i>Sod2</i>-dependent mechanism. Inhibition of <i>Sirt1</i> with EX527 abolished the FA-mediated improvement in NaF-exposed oocyte quality. Collectively, our data indicated that FA supplementation is a feasible approach to protect oocytes from NaF-related deterioration.

Also flagged:Ischemic strokeneurological diseasegene expressionstrokeIShemorrhagic stroke
Journal Article 2022-10-01 No Snippets Qiu M, Zong JB, He QW, Liu YX, Wan Y, Li M, Zhou YF, Wu JH, Hu B.
Show Full Abstract

Ischemic stroke is a detrimental neurological disease characterized by an irreversible infarct core surrounded by an ischemic penumbra, a salvageable region of brain tissue. Unique roles of distinct brain cell subpopulations within the neurovascular unit and peripheral immune cells during ischemic stroke remain elusive due to the heterogeneity of cells in the brain. Single-cell RNA sequencing (scRNA-seq) allows for an unbiased determination of cellular heterogeneity at high-resolution and identification of cell markers, thereby unveiling the principal brain clusters within the cell-type-specific gene expression patterns as well as cell-specific subclusters and their functions in different pathways underlying ischemic stroke. In this review, we have summarized the changes in differentiation trajectories of distinct cell types and highlighted the specific pathways and genes in brain cells that are impacted by stroke. This review is expected to inspire new research and provide directions for investigating the potential pathological mechanisms and novel treatment strategies for ischemic stroke at the level of a single cell.

Also flagged:CytokinesIntervertebral disc degenerationDiabetes mellituschronic inflammatory diseasediabetesTNF-α
Journal Article 2022-10-01 No Snippets Li S, Huang C, Xiao J, Wu Y, Zhang Z, Zhou Y, Tian N, Wu Y, Wang X, Zhang X.
Show Full Abstract

Intervertebral disc degeneration (IVDD) is a major cause of low back pain. Diabetes mellitus is a chronic inflammatory disease that may cause or aggravate IVDD; however, the mechanism by which diabetes induce IVDD is currently unclear. Compared to non-diabetic individuals, diabetic patients have higher levels of plasma cytokines, especially TNF-α, IL-1β, IL-5, IL-6, IL-7, IL-10, and IL-18. Due to the crucial role of cytokines in the process of intervertebral disc degeneration, we hypothesized that elevation of these cytokines in plasma of diabetic patients may be involved in the process of diabetes-induced IVDD. In this review, changes in plasma cytokine levels in diabetic patients were summarized and the potential role of elevated cytokines in diabetes-induced IVDD was discussed. Results showed that some cytokines such as TNF-α and IL-1β may accelerate the development of IVDD, while others such as IL-10 is supposed to prevent its development. Apoptosis, senescence, and extracellular matrix metabolism were found to be regulated by these cytokines in IVDD. Further studies are required to validate the cytokines targeted strategy for diabetic IVDD therapy.

Also flagged:Diabetic NephropathyexonucleasediabetesDNkidney diseaseend-stage renal diseases
Journal Article 2022-10-01 No Snippets Liu M, Zhao J.
Show Full Abstract

Circular RNAs (circRNAs) are widespread endogenous transcripts lacking 5'-caps and 3'-polyadenylation tails. Their closed-loop structure confers exonuclease resistance and extreme stability. CircRNAs play essential roles in various diseases, including diabetes. Diabetic nephropathy (DN) is the leading cause of end-stage kidney disease and is one of the most common complications of diabetes. CircRNAs are key in DN and therefore important for understanding DN pathophysiology and developing new therapeutic strategies. In the present review, we briefly introduce the characteristics and functions of circRNAs and summarize recent discoveries on how circRNAs participate in DN. Based on these advances, we suggest future perspectives for studying circRNAs in DN to improve DN treatment and management.

Also flagged:Cyclosporin Aimmune responseNFATdephosphorylationphosphatasebinding
Journal Article 2022-10-01 No Snippets Ulengin-Talkish I, Cyert MS.
Show Full Abstract

Intracellular Ca<sup>2+</sup> signals are temporally controlled and spatially restricted. Signaling occurs adjacent to sites of Ca<sup>2+</sup> entry and/or release, where Ca<sup>2+</sup>-dependent effectors and their substrates co-localize to form signaling microdomains. Here we review signaling by calcineurin, the Ca<sup>2+</sup>/calmodulin regulated protein phosphatase and target of immunosuppressant drugs, Cyclosporin A and FK506. Although well known for its activation of the adaptive immune response via NFAT dephosphorylation, systematic mapping of human calcineurin substrates and regulators reveals unexpected roles for this versatile phosphatase throughout the cell. We discuss calcineurin function, with an emphasis on where signaling occurs and mechanisms that target calcineurin and its substrates to signaling microdomains, especially binding of cognate short linear peptide motifs (SLiMs). Calcineurin is ubiquitously expressed and regulates events at the plasma membrane, other intracellular membranes, mitochondria, the nuclear pore complex and centrosomes/cilia. Based on our expanding knowledge of localized CN actions, we describe a cellular atlas of Ca<sup>2+</sup>/calcineurin signaling.

Also flagged:cancercondylomaswartstumorscervical cancercervical carcinoma
Journal Article 2022-10-01 No Snippets Ramberg IMS.
Show Full Abstract

Human papillomaviruses (HPV) are involved in approximately 5% of solid cancers worldwide. The mucosotropic genotypes infect the stratified epithelium of various locations, where persistent infection may lead to invasive carcinomas. While the causative role of HPV in certain anogenital and head and neck carcinomas is well established, the role of HPV in carcinomas arising in the mucosal membranes of the ocular adnexal tissue (the lacrimal drainage system and the conjunctiva) has been a topic of great uncertainty. Therefore, we conducted a series of studies to assess the correlation between HPV and carcinomas arising in the mucosa of the ocular adnexal tissue and characterize the clinical, histopathological, and genomic features of the tumors in the context of HPV status in a Danish nationwide cohort. We collected clinical and histopathological data and tumor specimens from patients with carcinomas of the conjunctiva and the lacrimal drainage system, and their potential precursors, identified in Danish nationwide registries. The HPV status of the tumors was determined by the combined use of HPV DNA polymerase chain reaction (PCR), HPV E6/E7 mRNA in-situ hybridization, and p16 immunohistochemistry. The genomic profile was investigated by high-throughput DNA sequencing targeting 523 cancer-relevant genes. The literature to date on carcinomas of the lacrimal drainage system and the conjunctiva was summarized. In the Danish cohort, 67% of all carcinomas of the lacrimal drainage system and 21% of all conjunctival carcinomas were HPV-positive. HPV16 was the most frequently implicated genotype. A full-thickness expression of the viral oncogenes E6 and E7 was evident in almost all HPV DNA-positive cases. The HPV-positive carcinomas of the conjunctiva and the lacrimal drainage system shared histopathological and genomic features distinct from their HPV-negative counterparts. The HPV-positive carcinomas were characterized by a non-keratinizing morphology, p16 overexpression, high transcriptional activity of HPV E6/E7, and frequent pathogenic variants in the PI3K-AKT signaling cascade. In contrast, the HPV-negative carcinomas were characterized by a keratinizing morphology, lack of p16 and E6/E7 expression, and frequent somatic pathogenic variants in TP53, CDKN2A, and RB1. Among the patients with conjunctival tumors, HPV positivity was associated with a younger age at diagnosis and a higher risk of recurrence. In conclusion, the results support an etiological role of HPV in a subset of conjunctival and LDS carcinomas and their precursor lesions. Our investigations have shown that the HPV-positive carcinomas of the ocular adnexa share genomic and phenotypic characteristics with HPV-positive carcinomas of other anatomical locations. Therefore, these patients may be eligible for inclusion in future basket trials and future treatment regimens tailored to the more frequently occurring HPV-positive carcinomas of other locations. Future research will further elucidate the diagnostic, prognostic, and predictive role of HPV in these carcinomas.

Also flagged:ExtracellularVesiclestissue remodelinghypoxia-inducible transcription factor 2 alphainfertilitysecretion
Journal Article 2022-10-01 No Snippets Ma Q, Beal JR, Song X, Bhurke A, Bagchi IC, Bagchi MK.
Show Full Abstract

The mouse decidua secretes many factors that act in a paracrine/autocrine manner to critically control uterine decidualization, neovascularization, and tissue remodeling that ensure proper establishment of pregnancy. The precise mechanisms that dictate intercellular communications among the uterine cells during early pregnancy remain unknown. We recently reported that conditional deletion of the gene encoding the hypoxia-inducible transcription factor 2 alpha (Hif2α) in mouse uterus led to infertility. Here, we report that HIF2α in mouse endometrial stromal cells (MESCs) acts via the cellular trafficking regulator RAB27b to control the secretion of extracellular vesicles (EVs) during decidualization. We also found that Hif2α-regulated pathways influence the biogenesis of EVs. Proteomic analysis of EVs secreted by decidualizing MESCs revealed that they harbor a wide variety of protein cargoes whose composition changed as the decidualization process progressed. The EVs enhanced the differentiation capacity of MESCs and the production of angiogenic factors by these cells. We also established that matrix metalloproteinase-2, a prominent EV cargo protein, modulates uterine remodeling during decidualization. Collectively, our results support the concept that EVs are central to the mechanisms by which the decidual cells communicate with each other and other cell types within the uterus to facilitate successful establishment of pregnancy.

Also flagged:Tumorcancerpancreatic cancertumorscell motilitygene expression
Journal Article 2022-10-01 ✓ 1 Snippet Ghaddar B, Biswas A, Harris C, Omary MB, Carpizo DR, Blaser MJ, De S.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Microorganisms are detected in multiple cancer types, including in putatively sterile organs, but the contexts in which they influence oncogenesis or anti-tumor responses in humans remain unclear. We recently developed single-cell analysis of host-microbiome interactions (SAHMI), a computational pipeline to recover and denoise microbial signals from single-cell sequencing of host tissues. Here we use SAHMI to interrogate tumor-microbiome interactions in two human pancreatic cancer cohorts. We identify somatic-cell-associated bacteria in a subset of tumors and their near absence in nonmalignant tissues. These bacteria predominantly pair with tumor cells, and their presence is associated with cell-type-specific gene expression and pathway activities, including cell motility and immune signaling. Modeling results indicate that tumor-infiltrating lymphocytes closely resemble T cells from infected tissue. Finally, using multiple independent datasets, a signature of cell-associated bacteria predicts clinical prognosis. Tumor-microbiome crosstalk may modulate tumorigenesis in pancreatic cancer with implications for clinical management.

Also flagged:cabotegravirsexually transmitted infectionhepatitis BAIDSestradioltestosterone
Journal Article 2022-10-01 No Snippets Doan AH, Vu CMH, Nguyen TT, Green KE, Phan HTT, Janamnuaysook R, Vu BN, Le TM, Do KQ, Tran TT, Ngo TM, Basu L, Tran LK, Humeau Z.
Show Full Abstract

<h4>Introduction</h4>Although HIV prevalence among transgender women who have sex with men in Vietnam is high (16-18%), uptake of pre-exposure prophylaxis (PrEP) is low compared to other populations. When PrEP was initiated in 2017, gender-affirming healthcare was largely unavailable. Lack of access to competent, stigma-free healthcare is a well-documented barrier to transgender women's uptake of PrEP and primary healthcare (PHC). We aimed to demonstrate the utility of a PrEP quality improvement intervention in pinpointing and addressing barriers to PrEP use among transgender women in Vietnam.<h4>Methods</h4>We applied a real-world participatory continuous quality improvement (CQI) and Plan-Do-Study-Act (PDSA) methodology to ascertain barriers to PrEP uptake among transgender women and determine priority actions for quality improvement. A CQI team representing transgender women leaders, key population (KP)-clinic staff, public-sector HIV managers and project staff applied PDSA to test solutions to identified barriers that addressed the primary quality improvement outcome of the monthly change in PrEP uptake among transgender women and secondary outcomes, including month-3 PrEP continuation, the impact of offering PHC on PrEP uptake and unmet PrEP need. We utilized routine programmatic data and a descriptive cross-sectional study enrolling 124 transgender women to measure these outcomes from October 2018 to September 2021.<h4>Results</h4>Five key barriers to PrEP uptake among transgender women were identified and corresponding solutions were put in place: (1) offering gender-affirming care training to KP-clinics and community-based organizations; (2) integrating gender-affirming services into 10 KP-clinics; (3) offering PHC through five one-stop shop (OSS) clinics; (4) implementing a campaign addressing concerns related to hormone use and PrEP interactions; and (5) developing national HIV and transgender healthcare guidelines. New PrEP enrolment and month-3 PrEP continuation increased significantly among transgender women. Of 235 transgender women who initially sought healthcare other than PrEP at OSS clinics, 26.4% subsequently enrolled in PrEP. About one-third of transgender women reported unmet PrEP need, while two-thirds indicated an interest in long-acting cabotegravir.<h4>Conclusions</h4>Offering gender-competent, integrated PHC can increase PrEP enrolment and continuation, and can be an entry-point for PrEP among those seeking care within PHC clinics. More work is needed to expand access to transgender women-led and -competent healthcare in Vietnam.

Also flagged:IronmetabolismCancerFerroptosisdeathpolyunsaturated fatty acids
Journal Article 2022-10-01 No Snippets Qu L, He X, Tang Q, Fan X, Liu J, Lin A.
Show Full Abstract

Cancer cells undergo substantial metabolic alterations to sustain increased energy supply and uncontrolled proliferation. As an essential trace element, iron is vital for many biological processes. Evidence has revealed that cancer cells deploy various mechanisms to elevate the cellular iron concentration to accelerate proliferation. Ferroptosis, a form of cell death caused by iron-catalyzed excessive peroxidation of polyunsaturated fatty acids (PUFAs), is a promising therapeutic target for therapy-resistant cancers. Previous studies have reported that long noncoding RNA (lncRNA) is a group of critical regulators involved in modulating cell metabolism, proliferation, apoptosis, and ferroptosis. In this review, we summarize the associations among iron metabolism, ferroptosis, and ferroptosis-related lncRNA in tumorigenesis. This information will help deepen understanding of the role of lncRNA in iron metabolism and raise the possibility of targeting lncRNA and ferroptosis in cancer combination therapy.

Also flagged:mechanotransductionneurodegenerative diseasepathogenesisneurodegenerative diseasesorganellesAmyotrophic Lateral Sclerosis
Journal Article 2022-10-01 ✓ 1 Snippet Tortorella I, Argentati C, Emiliani C, Morena F, Martino S.
In-Text Gene Mentions

HD is a neurodegenerative disorder caused by mutations in the Huntingtin (HTT) gene; an aberrant expansion of the Cytosine/Adenine/Guanine (CAG) triplet in exon 1 produces HTT proteins with polyglutamine domains which become pathological when exceeding 35 repeats.

Show Full Abstract

In this review, we shed light on recent advances regarding the characterization of biochemical pathways of cellular mechanosensing and mechanotransduction with particular attention to their role in neurodegenerative disease pathogenesis. While the mechanistic components of these pathways are mostly uncovered today, the crosstalk between mechanical forces and soluble intracellular signaling is still not fully elucidated. Here, we recapitulate the general concepts of mechanobiology and the mechanisms that govern the mechanosensing and mechanotransduction processes, and we examine the crosstalk between mechanical stimuli and intracellular biochemical response, highlighting their effect on cellular organelles' homeostasis and dysfunction. In particular, we discuss the current knowledge about the translation of mechanosignaling into biochemical signaling, focusing on those diseases that encompass metabolic accumulation of mutant proteins and have as primary characteristics the formation of pathological intracellular aggregates, such as Alzheimer's Disease, Huntington's Disease, Amyotrophic Lateral Sclerosis and Parkinson's Disease. Overall, recent findings elucidate how mechanosensing and mechanotransduction pathways may be crucial to understand the pathogenic mechanisms underlying neurodegenerative diseases and emphasize the importance of these pathways for identifying potential therapeutic targets.

Also flagged:Neurological disordersneurodegenerative diseasesprion diseasesprionsdendritedeath
Journal Article 2022-10-01 No Snippets Villar-Gómez N, Ojeda-Hernandez DD, López-Muguruza E, García-Flores S, Bonel-García N, Benito-Martín MS, Selma-Calvo B, Canales-Aguirre AA, Mateos-Díaz JC, Montero-Escribano P, Matias-Guiu JA, Matías-Guiu J, Gómez-Pinedo U.
Show Full Abstract

Neurological disorders are a leading cause of morbidity worldwide, giving rise to a growing need to develop treatments to revert their symptoms. This review highlights the great potential of recent advances in cell therapy for the treatment of neurological disorders. Through the administration of pluripotent or stem cells, this novel therapy may promote neuroprotection, neuroplasticity, and neuroregeneration in lesion areas. The review also addresses the administration of these therapeutic molecules by the intranasal route, a promising, non-conventional route that allows for direct access to the central nervous system without crossing the blood-brain barrier, avoiding potential adverse reactions and enabling the administration of large quantities of therapeutic molecules to the brain. Finally, we focus on the need to use biomaterials, which play an important role as nutrient carriers, scaffolds, and immune modulators in the administration of non-autologous cells. Little research has been conducted into the integration of biomaterials alongside intranasally administered cell therapy, a highly promising approach for the treatment of neurological disorders.

Also flagged:Forkhead Box OPathogenesisType 2 diabetesFOXOdiabetestranscription factors
Journal Article 2022-10-01 No Snippets Marchelek-Mysliwiec M, Nalewajska M, Turoń-Skrzypińska A, Kotrych K, Dziedziejko V, Sulikowski T, Pawlik A.
Show Full Abstract

Type 2 diabetes is a disease that causes numerous complications disrupting the functioning of the entire body. Therefore, new treatments for the disease are being sought. Studies in recent years have shown that forkhead box O (FOXO) proteins may be a promising target for diabetes therapy. FOXO proteins are transcription factors involved in numerous physiological processes and in various pathological conditions, including cardiovascular diseases and diabetes. Their roles include regulating the cell cycle, DNA repair, influencing apoptosis, glucose metabolism, autophagy processes and ageing. FOXO1 is an important regulator of pancreatic beta-cell function affecting pancreatic beta cells under conditions of insulin resistance. FOXO1 also protects beta cells from damage resulting from oxidative stress associated with glucose and lipid overload. FOXO has been shown to affect a number of processes involved in the development of diabetes and its complications. FOXO regulates pancreatic β-cell function during metabolic stress and also plays an important role in regulating wound healing. Therefore, the pharmacological regulation of FOXO proteins is a promising approach to developing treatments for many diseases, including diabetes mellitus. In this review, we describe the role of FOXO proteins in the pathogenesis of diabetes and the role of the modulation of FOXO function in the therapy of this disease.

Also flagged:Hydroxyapatitetitaniumcalcium phosphateshydroxyapatitesagingoxide
Journal Article 2022-10-01 No Snippets Prosolov KA, Lastovka VV, Khimich MA, Chebodaeva VV, Khlusov IA, Sharkeev YP.
Show Full Abstract

Functionalization of titanium (Ti)-based alloy implant surfaces by deposition of calcium phosphates (CaP) has been widely recognized. Substituted hydroxyapatites (HA) allow the coating properties to be tailored based on the use of different Ca substitutes. The formation of antibacterial CaP coatings with the incorporation of Zn or Cu by an RF magnetron sputtering is proposed. The influence of RF magnetron targets elemental composition and structure in the case of Zn-HA and Cu-HA, and the influence of substrate's grain size, the substrate's temperature during the deposition, and post-deposition heat treatment (HT) on the resulting coatings are represented. Sintering the targets at 1150 °C resulted in a noticeable structural change with an increase in cell volume and lattice parameters for substituted HA. The deposition rate of Cu-HA and Zn-HA was notably higher compared to stochiometric HA (10.5 and 10) nm/min vs. 9 ± 0.5 nm/min, respectively. At the substrate temperature below 100 °C, all deposited coatings were found to be amorphous with an atomic short-range order corresponding to the {300} plane of crystalline HA. All deposited coatings were found to be hyper-stochiometric with Ca/P ratios varying from 1.9 to 2.5. An increase in the substrate temperature to 200 °C resulted in the formation of equiaxed grain structure on both coarse-grained (CG) and nanostructured (NS) Ti. The use of NS Ti notably increased the scratch resistance of the deposited coatings from18 ± 1 N to 22 ± 2 N. Influence of HT in air or Ar atmosphere is also discussed. Thus, the deposition of Zn- or Cu-containing CaP is a complex process that could be fine-tuned using the obtained research results.

Also flagged:SynthesisSerotoninergichydroxyArylpiperazinesnucleuspropyl
Journal Article 2022-10-01 No Snippets Sparaco R, Kędzierska E, Kaczor AA, Bielenica A, Magli E, Severino B, Corvino A, Gibuła-Tarłowska E, Kotlińska JH, Andreozzi G, Luciano P, Perissutti E, Frecentese F, Casertano M, Leśniak A, Bujalska-Zadrożny M, Oziębło M, Capasso R, Santagada V, Caliendo G, Fiorino F.
Show Full Abstract

A new series of 5-norbornene-2-carboxamide derivatives was prepared and their affinities to the 5-HT<sub>1A</sub>, 5-HT<sub>2A</sub>, and 5-HT<sub>2C</sub> receptors were evaluated and compared to a previously synthesized series of derivatives characterized by exo-N-hydroxy-5-norbornene-2,3-dicarboximidenucleus, in order to identify selective ligands for the above-mentioned subtype receptors. Arylpiperazines represents one of the most important classes of 5-HT<sub>1A</sub>R ligands, and recent research concerning new derivatives has been focused on the modification of one or more portions of such pharmacophore. The combination of structural elements (heterocyclic nucleus, propyl chain and 4-substituted piperazine), known to be critical to the affinity to 5-HT<sub>1A</sub> receptors, and the proper selection of substituents led to compounds with high specificity and affinity towards serotoninergic receptors. The most active compounds were selected for further in vivo assays to determine their functional activity. Finally, to rationalize the obtained results, molecular docking studies were performed. The results of the pharmacological studies showed that <b>Norbo-4</b> and <b>Norbo-18</b> were the most active and promising derivatives for the serotonin receptor considered in this study.

Also flagged:extracellularvesicleExtracellular vesiclesglycansmembranelipid
Journal Article 2022-10-01 No Snippets Hallal S, Tűzesi Á, Grau GE, Buckland ME, Alexander KL.
Show Full Abstract

Extracellular vesicles (EVs) are lipid-membrane enclosed nanoparticles that play significant roles in health and disease. EVs are abundant in body fluids and carry an array of molecules (proteins, lipids, nucleic acids and glycans) that reflect the identity and activity of their cell-of-origin. While the advent of high throughput omics technologies has allowed in-depth characterisation of EV compositions, how these molecular species are spatially distributed within EV structures is not well appreciated. This is particularly true of the EV surface where a plethora of molecules are reported to be both integral and peripherally associated to the EV membrane. This coronal layer or 'atmosphere' that surrounds the EV membrane contributes to a large, highly interactive and dynamic surface area that is responsible for facilitating EV interactions with the extracellular environment. The EV coronal layer harbours surface molecules that reflect the identity of parent cells, which is likely a highly valuable property in the context of diagnostic liquid biopsies. In this review, we describe the current understanding of the mechanical, electrostatic and molecular properties of the EV surface that offer significant biomarker potential and contribute to a highly dynamic interactome.

Also flagged:GPC3brain developmentCancerUncoordinated-5 receptor Dmorphogen receptorglypican-3
Journal Article 2022-10-01 ✓ 1 Snippet Akkermans O, Delloye-Bourgeois C, Peregrina C, Carrasquero-Ordaz M, Kokolaki M, Berbeira-Santana M, Chavent M, Reynaud F, Raj R, Agirre J, Aksu M, White ES, Lowe E, Ben Amar D, Zaballa S, Huo J, Pakos I, McCubbin PTN, Comoletti D, Owens RJ, Robinson CV, Castellani V, Del Toro D, Seiradake E.
In-Text Gene Mentions

…tly, perhaps involving Unc-40/DCC, which binds LON-2/GPC3,…

Show Full Abstract

Neural migration is a critical step during brain development that requires the interactions of cell-surface guidance receptors. Cancer cells often hijack these mechanisms to disseminate. Here, we reveal crystal structures of Uncoordinated-5 receptor D (Unc5D) in complex with morphogen receptor glypican-3 (GPC3), forming an octameric glycoprotein complex. In the complex, four Unc5D molecules pack into an antiparallel bundle, flanked by four GPC3 molecules. Central glycan-glycan interactions are formed by N-linked glycans emanating from GPC3 (N241 in human) and C-mannosylated tryptophans of the Unc5D thrombospondin-like domains. MD simulations, mass spectrometry and structure-based mutants validate the crystallographic data. Anti-GPC3 nanobodies enhance or weaken Unc5-GPC3 binding and, together with mutant proteins, show that Unc5/GPC3 guide migrating pyramidal neurons in the mouse cortex, and cancer cells in an embryonic xenograft neuroblastoma model. The results demonstrate a conserved structural mechanism of cell guidance, where finely balanced Unc5-GPC3 interactions regulate cell migration.

Also flagged:strokecerebral infarctioncapsulecapsulesINSALB
Journal Article 2022-10-01 No Snippets Ma S, Fan W, Zhang J.
Show Full Abstract

<h4>Background</h4>Chuanxiong Tongluo capsules have been widely used to treat recovered stroke and cerebral infarction, but their specific therapeutic mechanism is not well understood.<h4>Methods</h4>This study aims to investigate the mechanism of action for Chuanzhi Tongluo capsule on cerebral infarction based on a network pharmacology approach. The TCMSP platform collected the chemical composition of Chuanzhi Tongluo capsules. Its potential targets were predicted by Swiss target prediction and standardized using the Uniprot database for gene normalization. Meanwhile, the OMIM, Genecards, and TTD databases were used to obtain the targets related to cerebral infarction. The standard targets of Chuanzhi Tongluo capsule and cerebral infarction were uploaded to the STRING database to construct protein-protein interaction networks. Topological methods analyzed the key targets and components in the drug-component-disease-target network. Gene ontology function and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of the shared targets were performed using the DAVID database.<h4>Results</h4>A total of 105 active ingredients and 427 targets were associated with Chuanzhi Tongluo capsule, and there were 3055 targets related to cerebral infarction disease and 240 common targets between the two keywords. The key targets included INS, ALB, IL-6, VEGFA, TNF, and TP53. The conduction pathways involved include the calcium signaling pathway, cAMP signaling pathway, cGMP-PKG signaling pathway, and TNF signaling pathway.<h4>Conclusion</h4>The active ingredients in Chuanzhi Tongluo capsule may participate in the therapeutic process of cerebral infarction by regulating the calcium, cAMP, cGMP-PKG, and TNF signaling pathway through critical targets such as INS, ALB, IL-6, VEGFA, TNF, and TP53.

Also flagged:AngiogenesisGlioblastomaGBMbrain tumorBevasizumabvascular endothelial growth factor-A
Journal Article 2022-10-01 ✓ 1 Snippet Daneshimehr F, Barabadi Z, Abdolahi S, Soleimani M, Verdi J, Ebrahimi-Barough S, Ai J.
In-Text Gene Mentions

…eptors), netrins receptor UNC/DCC, and canonical Wnt…

Show Full Abstract

Angiogenesis is a characteristic of glioblastoma (GBM), the most fatal and therapeutic-resistant brain tumor. Highly expressed angiogenic cytokines and proliferated microvascular system made anti-angiogenesis treatments a thoroughly plausible approach for GBM treatment. Many trials have proved to be not only as a safe but also as an effective approach in GBM retardation in a certain time window as seen in radiographic response rates; however, they have failed to implement significant improvements in clinical manifestation whether alone or in combination with radio/chemotherapy. Bevasizumab, an anti-vascular endothelial growth factor-A (VEGF-A) antibody, is the only agent that exerts meaningful clinical influence by improving progression-free survival (PFS) and partially alleviate clinical symptoms, nevertheless, it could not prolong the overall survival (OS) in patients with GBM. The data generated from phase II trials clearly revealed a correlation between elevated reperfusion, subsequent to vascular normalization induction, and improved clinical outcomes which explicitly indicates anti-angiogenesis treatments are beneficial. In order to prolong these initial benefits observed in a certain period of time after anti-angiogenesis targeting, some aspects of the therapy should be tackled: recognition of other bypass angiogenesis pathways activated following antiangiogenesis therapy, identification of probable pathways that induce insensitivity to shortage of blood supply, and classifying the patients by mapping their GBM-related gene profile as biomarkers to predict their responsiveness to therapy. Herein, the molecular basis of brain vasculature development in normal and tumoral conditions is briefly discussed and it is explained how "vascular normalization" concept opened a window to a better comprehension of some adverse effects observed in anti-angiogenesis therapy in clinical condition. Then, the most targeted angiogenesis pathways focused on ligand/receptor interactions in GBM clinical trials are reviewed. Lastly, different targeting strategies applied in anti-angiogenesis treatment are discussed.

Also flagged:totranslationallytranslationalribosomesBDNFtranscription factors
Journal Article 2022-10-01 ✓ 2 Snippets Sapkota D, Kater MSJ, Sakers K, Nygaard KR, Liu Y, Koester SK, Fass SB, Lake AM, Khazanchi R, Khankan RR, Krawczyk MC, Smit AB, Maloney SE, Verheijen MHG, Zhang Y, Dougherty JD.
In-Text Gene Mentions

Beyond what was found by GO, it highlighted a surprising connection to neurodegenerative diseases driven by the Huntington’s disease-related genes Htt and Smcr8 as well as some forms of intellectual disability driven by the neurofibromatosis genes Nf1 and Nf2 and the Cornelia de Lange syndrome genes Smc3 and Nipbl.

…ington’s disease-related genesHttand Smcr8 as…

Show Full Abstract

Within eukaryotic cells, translation is regulated independent of transcription, enabling nuanced, localized, and rapid responses to stimuli. Neurons respond transcriptionally and translationally to synaptic activity. Although transcriptional responses are documented in astrocytes, here we test whether astrocytes have programmed translational responses. We show that seizure activity rapidly changes the transcripts on astrocyte ribosomes, some predicted to be downstream of BDNF signaling. In acute slices, we quantify the extent to which cues of neuronal activity activate translation in astrocytes and show that this translational response requires the presence of neurons, indicating that the response is non-cell autonomous. We also show that this induction of new translation extends into the periphery of astrocytes. Finally, synaptic proteomics show that new translation is required for changes that occur in perisynaptic astrocyte protein composition after fear conditioning. Regulation of translation in astrocytes by neuronal activity suggests an additional mechanism by which astrocytes may dynamically modulate nervous system functioning.

Also flagged:PrkcqKdm4boligodendrocytebipolar disorderTrank1locomotion
Journal Article 2022-10-01 ✓ 1 Snippet Wang N, Langfelder P, Stricos M, Ramanathan L, Richman JB, Vaca R, Plascencia M, Gu X, Zhang S, Tamai TK, Zhang L, Gao F, Ouk K, Lu X, Ivanov LV, Vogt TF, Lu QR, Morton AJ, Colwell CS, Aaronson JS, Rosinski J, Horvath S, Yang XW.
In-Text Gene Mentions

Htt

Show Full Abstract

Brain tissue transcriptomes may be organized into gene coexpression networks, but their underlying biological drivers remain incompletely understood. Here, we undertook a large-scale transcriptomic study using 508 wild-type mouse striatal tissue samples dissected exclusively in the afternoons to define 38 highly reproducible gene coexpression modules. We found that 13 and 11 modules are enriched in cell-type and molecular complex markers, respectively. Importantly, 18 modules are highly enriched in daily rhythmically expressed genes that peak or trough with distinct temporal kinetics, revealing the underlying biology of striatal diurnal gene networks. Moreover, the diurnal coexpression networks are a dominant feature of daytime transcriptomes in the mouse cortex. We next employed the striatal coexpression modules to decipher the striatal transcriptomic signatures from Huntington's disease models and heterozygous null mice for 52 genes, uncovering novel functions for Prkcq and Kdm4b in oligodendrocyte differentiation and bipolar disorder-associated Trank1 in regulating anxiety-like behaviors and nocturnal locomotion.

Also flagged:cancertumorproteaseMucosa-associated lymphoid tissue protein 1MALT1lymphoma
Journal Article 2022-10-01 ✓ 1 Snippet Mempel TR, Krappmann D.
In-Text Gene Mentions

…the cleavage ofRoquin-1/2.…

Show Full Abstract

An innovative strategy for cancer therapy is to combine the inhibition of cancer cell-intrinsic oncogenic signaling with cancer cell-extrinsic immunological activation of the tumor microenvironment (TME). In general, such approaches will focus on two or more distinct molecular targets in the malignant cells and in cells of the surrounding TME. In contrast, the protease Mucosa-associated lymphoid tissue protein 1 (MALT1) represents a candidate to enable such a dual approach by engaging only a single target. Originally identified and now in clinical trials as a lymphoma drug target based on its role in the survival and proliferation of malignant lymphomas addicted to chronic B cell receptor signaling, MALT1 proteolytic activity has recently gained additional attention through reports describing its tumor-promoting roles in several types of non-hematological solid cancer, such as breast cancer and glioblastoma. Besides cancer cells, regulatory T (Treg) cells in the TME are particularly dependent on MALT1 to sustain their immune-suppressive functions, and MALT1 inhibition can selectively reprogram tumor-infiltrating Treg cells into Foxp3-expressing proinflammatory antitumor effector cells. Thereby, MALT1 inhibition induces local inflammation in the TME and synergizes with anti-PD-1 checkpoint blockade to induce antitumor immunity and facilitate tumor control or rejection. This new concept of boosting tumor immunotherapy in solid cancer by MALT1 precision targeting in the TME has now entered clinical evaluation. The dual effects of MALT1 inhibitors on cancer cells and immune cells therefore offer a unique opportunity for combining precision oncology and immunotherapy to simultaneously impair cancer cell growth and neutralize immunosuppression in the TME. Further, MALT1 targeting may provide a proof of concept that modulation of Treg cell function in the TME represents a feasible strategy to augment the efficacy of cancer immunotherapy. Here, we review the role of MALT1 protease in physiological and oncogenic signaling, summarize the landscape of tumor indications for which MALT1 is emerging as a therapeutic target, and consider strategies to increase the chances for safe and successful use of MALT1 inhibitors in cancer therapy.

Also flagged:infectionsinfectionMeticillinMethicillinpolyaminesspermidine
Journal Article 2022-10-01 No Snippets Alkhzem AH, Laabei M, Woodman TJ, Blagbrough IS.
Show Full Abstract

Antibiotic resistance is now a growing threat to human health, further exacerbated by the lack of new antibiotics. We describe the practical synthesis of a series of substituted polyamine succinamides and branched polyamines that are potential new antibiotics against both Gram-positive and Gram-negative bacteria, including MRSA and Pseudomonas aeruginosa. They are prepared via 1,4-Michael addition of acrylonitrile and then hydrogenation of the nitrile functional groups to primary amines. They are built upon the framework of the naturally occurring polyamines thermine (3.3.3, norspermine) and spermine (3.4.3), homo- and heterodimeric polyamine succinic amides. Linking two of the same or different polyamines together via amide bonds can be achieved by introducing a carboxylic acid group on the first polyamine, then coupling that released carboxylic acid to a free primary amine in the second polyamine. If the addition of positive charges on the amino groups along the polyamine chains are a key factor in their antimicrobial activity against Gram-negative bacteria, then increasing them will increase the antimicrobial activity. Synthesising polyamine amide dimers will increase the total net positive charge compared to their monomers. The design and practical synthesis of such homo- and hetero-dimers of linear polyamines, spermine and norspermine, are reported. Several of these compounds do not display significant antibacterial activity against Gram-positive or Gram-negative bacteria, including MRSA and Pseudomonas aeruginosa. However, the most charged analogue, a branched polyamine carrying eight positive charges at physiological pH, displays antibiofilm activity with a 50 % reduction in PAO1 at 16-32 μg mL<sup>-1</sup> .

Also flagged:diabetesRoLaSSBbradicardia
Journal Article 2022-10-01 No Snippets Samesima N, God EG, Kruse JCL, Leal MG, Pinho C, França FFAC, Pimenta J, Cardoso AF, Paixão A, Fonseca A, Pérez-Riera AR, Ribeiro ALP, Madaloso BA, Luna Filho B, Oliveira CAR, Grupi CJ, Moreira DAR, Kaiser E, Paixão GMM, Feitosa Filho G, Pereira Filho HG, Grindler J, Aziz JL, Molina MS, Facin M, Tobias NMMO, Oliveira PA, Sanches PCR, Teixeira RA, Atanes SM, Pastore CA.
Show Full Abstract

No abstract available.

Also flagged:GliosisObesityneurodegenerative diseasestype 2 diabetes mellituslipidglucose
Journal Article 2022-10-01 No Snippets Bandala C, Cárdenas-Rodríguez N, Reyes-Long S, Cortes-Altamirano JL, Garciadiego-Cázares D, Lara-Padilla E, Ibáñez-Cervantes G, Mancilla-Ramírez J, Gómez-Manzo S, Alfaro-Rodríguez A.
Show Full Abstract

Obesity remains a global health problem. Chronic low-grade inflammation in this pathology has been related to comorbidities such as cognitive alterations that, in the long term, can lead to neurodegenerative diseases. Neuroinflammation or gliosis in patients with obesity and type 2 diabetes mellitus has been related to the effect of adipokines, high lipid levels and glucose, which increase the production of free radicals. Cerebral gliosis can be a risk factor for developing neurodegenerative diseases, and antioxidants could be an alternative for the prevention and treatment of neural comorbidities in obese patients.<h4>Aim</h4>Identify the immunological and oxidative stress mechanisms that produce gliosis in patients with obesity and propose antioxidants as an alternative to reducing neuroinflammation.<h4>Method</h4>Advanced searches were performed in scientific databases: PubMed, ProQuest, EBSCO, and the Science Citation index for research on the physiopathology of gliosis in obese patients and for the possible role of antioxidants in its management.<h4>Conclusion</h4>Patients with obesity can develop neuroinflammation, conditioned by various adipokines, excess lipids and glucose, which results in an increase in free radicals that must be neutralized with antioxidants to reduce gliosis and the risk of long-term neurodegeneration.

Also flagged:Curcuminmitochondrialpathogenesisoxygenmitochondriamitochondrial respiratory chain
Journal Article 2022-10-01 No Snippets Sathyabhama M, Priya Dharshini LC, Karthikeyan A, Kalaiselvi S, Min T.
Show Full Abstract

Oxidative stress and mitochondrial dysfunction are associated with the pathogenesis of several human diseases. The excessive generation of reactive oxygen species (ROS) and/or lack of adequate antioxidant defenses causes DNA mutations in mitochondria, damages the mitochondrial respiratory chain, and alters membrane permeability and mitochondrial defense mechanisms. All these alterations are linked to the development of numerous diseases. Curcumin, an active ingredient of turmeric plant rhizomes, exhibits numerous biological activities (i.e., antioxidant, anti-inflammatory, anticancer, and antimicrobial). In recent years, many researchers have shown evidence that curcumin has the ability to reduce the oxidative stress- and mitochondrial dysfunction-associated diseases. In this review, we discuss curcumin's antioxidant mechanism and significance in oxidative stress reduction and suppression of mitochondrial dysfunction in mammals. We also discuss the research gaps and give our opinion on how curcumin research in mammals should proceed moving forward.

Also flagged:SynthesesCalciumHydroxyapatiteZinccalcium phosphateosteoporosis
Journal Article 2022-10-01 No Snippets Otsuka M, Saito H, Sasaki T.
Show Full Abstract

Calcium-deficient zinc-containing calcium phosphate (ZnAP), which has sustained zinc release properties that are effective for treating osteoporosis, can be efficiently synthesized as a biomaterial through wet grinding. To elucidate the physicochemical mechanism of these mechanochemical syntheses, ground products were obtained from the starting material powder (S-CP), consisting of calcium hydrogen phosphate dihydrate (CHPD), calcium oxide (CaO), and zinc oxide (ZnO), by wet and dry grinding for 0-3 h in a centrifugal ball mill. The ground S-CP products were analyzed using powder X-ray diffraction (XRD) and near-infrared spectroscopy (NIRS); the crystal transformations and molecular interactions of the ground products were kinetically analyzed. The XRD and second-derivative NIRS results indicate that the S-CP is primarily transformed into ZnAP via amorphous solid formation in wet grinding, and the reaction follows a consecutive reaction model. In contrast, in dry grinding, the ground product of CHPD and CaO is transformed into an amorphous solid following an equilibrium reaction model; however, ZnO is predominantly not transformed and remains crystalline.

Also flagged:Acute mesenteric ischemiaischemiaand splenic vein thrombosisrivaroxabanMesenteric ischemiaAcute mesenteric venous thrombosis
Journal Article 2022-10-01 ✓ 1 Snippet Zhao JW, Cui XH, Zhao WY, Wang L, Xing L, Jiang XY, Gong X, Yu L.
In-Text Gene Mentions

…(normal range 60%-140%);antithrombin-III, 90% (normal range…

Show Full Abstract

<h4>Background</h4>Mesenteric ischemia represents an uncommon complication of splanchnic vein thrombosis, and it is less infrequently seen in young women using oral contraceptives. Diagnosis is often delayed in the emergency room; thus, surgical intervention may be inevitable and the absence of thrombus regression or collateral circulation may lead to further postoperative ischemia and a fatal outcome.<h4>Case summary</h4>We report a 28-year-old female patient on oral contraceptives who presented with acute abdominal pain. Her physical examination findings were not consistent with her symptoms of severe pain and abdominal distention. These findings and her abnormal blood tests raised suspicion of acute mesenteric ischemia (AMI) induced by splanchnic vein thrombosis. Contrast-enhanced abdominal computed tomography revealed ischemia of the small intestine with portomesenteric and splenic vein thrombosis (PMSVT). We treated the case promptly by anticoagulation after diagnosis. We then performed delayed segmental bowel resection after thrombus regression and established collateral circulation guided by collaboration with a multidisciplinary team. The patient had an uneventful postoperative course and was discharged 14 d after surgery and took rivaroxaban orally for 6 mo. In subsequent follow-up to date, the patient has not complained of any other discomfort.<h4>Conclusion</h4>AMI induced by PMSVT should be considered in young women who are taking oral contraceptives and have acute abdominal pain. Prompt anticoagulation followed by surgery is an effective treatment strategy.

Also flagged:OX40solid tumorstumorcell activationnon-small cell lungcancers
Journal Article 2022-10-01 No Snippets Davis EJ, Martin-Liberal J, Kristeleit R, Cho DC, Blagden SP, Berthold D, Cardin DB, Vieito M, Miller RE, Hari Dass P, Orcurto A, Spencer K, Janik JE, Clark J, Condamine T, Pulini J, Chen X, Mehnert JM.
Show Full Abstract

<h4>Background</h4>OX40 is a costimulatory receptor upregulated on antigen-activated T cells and constitutively expressed on regulatory T cells (Tregs). INCAGN01949, a fully human immunoglobulin G1κ anti-OX40 agonist monoclonal antibody, was designed to promote tumor-specific immunity by effector T-cell activation and Fcγ receptor-mediated Treg depletion. This first-in-human study was conducted to determine the safety, tolerability, and preliminary efficacy of INCAGN01949.<h4>Methods</h4>Phase I/II, open-label, non-randomized, dose-escalation and dose-expansion study conducted in patients with advanced or metastatic solid tumors. Patients received INCAGN01949 monotherapy (7-1400 mg) in 14-day cycles while deriving benefit. Safety measures, clinical activity, pharmacokinetics, and pharmacodynamic effects were assessed and summarized with descriptive statistics.<h4>Results</h4>Eighty-seven patients were enrolled; most common tumor types were colorectal (17.2%), ovarian (8.0%), and non-small cell lung (6.9%) cancers. Patients received a median three (range 1-9) prior therapies, including immunotherapy in 24 patients (27.6%). Maximum tolerated dose was not reached; one patient (1.1%) receiving 350 mg dose reported dose-limiting toxicity of grade 3 colitis. Treatment-related adverse events were reported in 45 patients (51.7%), with fatigue (16 (18.4%)), rash (6 (6.9%)), and diarrhea (6 (6.9%)) being most frequent. One patient (1.1%) with metastatic gallbladder cancer achieved a partial response (duration of 6.3 months), and 23 patients (26.4%) achieved stable disease (lasting &gt;6 months in one patient). OX40 receptor occupancy was maintained over 90% among all patients receiving doses of ≥200 mg, while no treatment-emergent antidrug antibodies were detected across all dose levels. Pharmacodynamic results demonstrated that treatment with INCAGN01949 did not enhance proliferation or activation of T cells in peripheral blood or reduce circulating Tregs, and analyses of tumor biopsies did not demonstrate any consistent increase in effector T-cell infiltration or function, or decrease in infiltrating Tregs.<h4>Conclusion</h4>No safety concerns were observed with INCAGN01949 monotherapy in patients with metastatic or advanced solid tumors. However, tumor responses and pharmacodynamic effects on T cells in peripheral blood and post-therapy tumor biopsies were limited. Studies evaluating INCAGN01949 in combination with other therapies are needed to further evaluate the potential of OX40 agonism as a therapeutic approach in patients with advanced solid tumors.<h4>Trial registration number</h4>NCT02923349.

Also flagged:hepatocellular carcinomacancergene expressionsuppressor of cytokine signaling 2SOCS2SERPINF2
Journal Article 2022-10-01 ✓ 2 Snippets Hou M.
In-Text Gene Mentions

Decreased expression of SERPINF2 may lead to an increase in the level of activated plasmin, which will damage the stability of the fibrin bundle and thereby damage the integrity of the extracellular matrix of the liver.[22] Interestingly, the gene interactions between Proc and Serpinc1 and Plg and Serpinf2 are related to liver function and regeneration.[23] However, humans made few studies on the role of SERPINF2 in HCC, so we will further investigate it.

…between Proc andSerpinc1and Plg and…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) has become the fifth most common cancer globally, with the second-highest mortality rate and poor survival outcomes. In our research, we aimed to use The Cancer Genome Atlas and gene expression omnibus databases to identify potential genetic biomarkers to predict and improve the survival rate of HCC patients.<h4>Methods</h4>In GSE60502, GSE76427, and GSE84402, we performed differential expression analysis to obtain differentially expressed genes (DEGs). In the The Cancer Genome Atlas database, the FPKM expression profile was subjected to weighted gene co-expression analysis to obtain modules closely related to HCC. We received common genes by intersecting the genes in the module with the differential genes. Then, we fused the common genes' expression profiles, survival time, and survival status for univariate, Least Absolute Shrinkage and Selection Operator, and multivariate COX regression analysis to obtain prognostic genes. Predictive genes were performed in K-M survival analysis and combined with clinical data for independent predictive analysis.<h4>Results</h4>After differential expression analysis, GSE60502 obtained 1107 DEGs, GSE76427 obtained 424 DEGs, and GSE84402 obtained 1668 DEGs. Through weighted gene co-expression analysis analysis, we can see that the blue and brown modules were closely associated with HCC. After single and multivariate COX regression analysis, we found that suppressor of cytokine signaling 2 (SOCS2) and SERPINF2 were independent prognostic genes for HCC. After survival analysis, HCC patients with high expression of SOCS2 and SERPINF2 had a longer survival time. These 2 genes in normal liver tissues were higher than in HCC at the transcriptional level.<h4>Conclusion</h4>SOCS2 and SERPINF2 were new independent prognostic genes of HCC. So, they may provide new treatment methods and measures for diagnosing HCC.

Also flagged:epidermal growthkeratinizationmembranesdesmosomesextracellular spacecytoskeleton
Journal Article 2022-10-01 No Snippets Zhou F, Cheng T, Xing Y, Ma H, Yang L.
Show Full Abstract

<h4>Background</h4>This study explored underlying gene signatures of low birth weight (LBW) by analyzing differentially expressed genes (DEGs) between LBW and normal birth weight (NBW) subjects.<h4>Methods</h4>Subjects with different birth weight was collected from GEO database. P < .05 and | logFC | ≥ 1.0 were used for screening DEGs. David (2021 Update) was used to perform GO annotation and KEGG signaling pathway enrichment analysis. The protein-protein interaction network of DEGs was constructed using the STRING database, in which hub genes were mined through Cytoscape software.<h4>Results</h4>A total of 326 DEGs were identified, including 287 up-regulated genes and 39 down-regulated genes. The GO biological processes enriched by DEGs mainly involved epidermal growth, keratinization and intermediate fibrous tissue. The DEGs were significantly enriched in intracellular insoluble membranes, desmosomes and extracellular space. Their molecular functions mainly focused on structural molecular activity, structural components of epidermis and structural components of cytoskeleton. PI3K/AKT signaling pathway and tight junction were highlighted as critical pathways enriched by DEGs. Ten hub genes which included KRT14, EGF, DSP, DSG1, KRT16, KRT6A, EPCAM, SPRR1B, PKP1, and PPL were identified from the constructed protein-protein interaction network.<h4>Conclusion</h4>A total of 326 DEGs and 10 hub genes were identified as candidates for metabolic disorders in LBW individuals. Our results indicated PI3K/AKT signaling pathway as an intrauterine adaptive mechanism for LBW individuals. We observed activated PI3K/AKT pathway in LBW individuals, which would promote growth and development at the early stage of life, but adversely introduce extra metabolic stress and thereby potentially induce metabolic disorders in adulthood.

Also flagged:Hepcidinironpeptidehormoneiron deficiencychronic renal disease
Journal Article 2022-10-01 ✓ 2 Snippets Fathi ZH, Mohammad JA, Younus ZM, Mahmood SM.
In-Text Gene Mentions

HFE hemochromatosis

HFE

Show Full Abstract

There are several blood-based markers to assess iron stores, but they all have some limitations. Hepcidin, a low-molecular-weight peptide hormone, is produced mainly by the liver. It is the main regulator of iron homeostasis by preventing iron release into plasma from absorptive enterocytes and macrophages. This review aims to critically assess existing data on potential role of hepcidin in diagnosis, particularly the (pre) analytical implications of the hepcidin measurement. There is a well-known causative correlation between hepcidin and iron deficiency. Therefore, hepcidin is considered as a promising marker in the assessment of iron status, particularly in patients with a diagnostic dilemma, such as patients with chronic renal disease and infants. The clinical implications of this peptide hormone in diagnosis of other diseases have been expanded in the recent studies, including elevated hepcidin levels in neoplastic diseases, sepsis, and inflammation. The potential role of hepcidin in diagnosis is controversial in the various types of iron deficiency because data are conflicting (as in anaemia of chronic disease) or limited (as in infants), whereas in the case of hereditary haemochromatosis, it has been proposed that hepcidin may be used for stratification of molecular testing, or to improve the frequency of phlebotomy, however, this issue still needs to be investigated. Due to lack of a clinically approved test, the medical application of this peptide as a biomarker in diagnosis is restricted. Recently, assays have been developed to determine hepcidin levels in serum and urine, facilitating the future use of hepcidin in research and clinical practice.

Also flagged:ovarian cancergynecological cancersGene ExpressionOCprogrammed death-ligand 1PD-L1
Journal Article 2022-10-01 ✓ 5 Snippets Chen S, Yang M, Yang H, Tang Q, Gu C, Wei W.
In-Text Gene Mentions

…protein 1 like (RABGAP1L), mitotic arrest deficient…

…PPM1K, PPP1CA, EXT1,RABGAP1L, MAD2L1, XPC, EGLN3,…

…of CCNDBP1, PPM1K,RABGAP1L, and ZNF25 were…

…+ 0.6944571 ×RABGAP1L− 0.0278971 ×…

…between EXT1 andRABGAP1Lexpression (see Figure…

Show Full Abstract

<h4>Background</h4>Ovarian cancer (OC) is the most lethal malignancy among gynecological cancers worldwide. It is urgent to identify effective biomarkers for the prognosis and diagnosis of OC.<h4>Methods</h4>We analyzed 4 OC Gene Expression Omnibus (GEO) data sets to detect differentially expressed genes (DEGs). To explore potential correlations between the gene sets and clinical features, we conducted weighted gene co-expression network analysis (WGCNA). Hub genes were identified from the key modules by univariate Cox regression, least absolute shrinkage and selection operator (LASSO), and multivariate Cox regression analyses and risk scores were calculated based on the expressions of the hub genes. Univariate and multivariate Cox regression analyses were conducted to determine the values of the diagnoses for OC patients. We also determined the predictive value of the long non-coding RNA (lncRNA) score in response to immunotherapy and chemotherapeutic drugs.<h4>Results</h4>DEGs were analyzed between the OC and normal ovarian tissues and prognostic modules were identified by a WGCNA. Nine hub genes chose from the prognostic modules were determined the prognostic values in OC. The risk scores were calculated based on the expression of hub genes, and patients with high-risk scores had poor survival. Univariate and multivariate Cox regression analyses showed that the risk score was an independent prognostic factor for OC. Additionally, the levels of hub genes were also found to be related to immune cell infiltration in OC microenvironments. An immunotherapy cohort showed that high-risk scores enhanced the response to anti-programmed death-ligand 1 (PD-L1) immunotherapy and was remarkably correlated with the inflamed immune phenotype, and had significant therapeutic advantages and clinical benefits. Further, patients with high-risk scores were more sensitive to midostaurin.<h4>Conclusions</h4>We identified the risk score including protein phosphatase, Mg2+/Mn2+ dependent 1K (PPM1K), protein phosphatase 1 catalytic subunit alpha (PPP1CA), exostosin glycosyltransferase 1 (EXT1), RAB GTPase activating protein 1 like (RABGAP1L), mitotic arrest deficient 2 like 1 (MAD2L1), xeroderma pigmentosum complementation group C (XPC), Egl-9 family hypoxia inducible factor 3 (EGLN3), cyclin D1 binding protein 1 (CCNDBP1), and zinc finger protein 25 (ZNF25), and validated their prognostic and predicted values for OC.

Also flagged:solid tumourschitosanbreast cancercancertumourssolid tumour
Journal Article 2022-10-01 No Snippets Sarwar S, Bashir S, Asim MH, Ikram F, Ahmed A, Omema U, Asif A, Chaudhry AA, Hu Y, Ustundag CB.
Show Full Abstract

A pH responsive nanoparticle-hydrogel hybrid drug delivery system was investigated for in-depth anticancer drug delivery to solid tumours. It consists of acid susceptible polymer nanoparticles loaded in a chitosan hydrogel. The hybrid formulation was characterized by UV-visible spectroscopy, FTIR, SEM, TEM, particle size analysis, zeta potential measurement and viscosity measurement. Drug encapsulation and nanoparticle loading efficiencies were found to be 48% and 72% respectively which describes the efficient interaction of the chemical entities in this hybrid drug delivery system. The hydrogel exhibited pH responsive behaviour: minimal drug and nanoparticle release at physiological pH but an increase in viscosity under acidic conditions and fast nanoparticle and drug release. The cytotoxicity of the drug loaded hydrogel was investigated against the MCF-7 breast cancer cell line along with the drug and nanoparticles without hydrogel. The drug loaded hydrogel showed a better cytotoxic effect on MCF-7 cancer cells. Thus, drug loaded nanoparticles containing hydrogel could be a better option for maximum drug distribution in tumours.

Also flagged:coagulationtissue factor pathwaytissue factor pathway inhibitorTFPIvenous thromboembolismvenous thrombosis
Journal Article 2022-10-01 ✓ 1 Snippet Manderstedt E, Lind-Halldén C, Halldén C, Elf J, Svensson PJ, Engström G, Melander O, Baras A, Lotta LA, Zöller B, Regeneron Genetics Center.
In-Text Gene Mentions

…variants of theSERPINC1, PROC ,…

Show Full Abstract

<h4>Background</h4>Tissue factor is the main initiator of blood coagulation, and tissue factor pathway inhibitor (TFPI) is the primary inhibitor of the initiation of blood coagulation.The genetic variation of <i>TFPI</i> and the relation to venous thromboembolism (VTE), that is, venous thrombosis and pulmonary embolism, remains to be clarified. This exome sequencing study aimed to determine the molecular epidemiology of the <i>TFPI</i> gene and the relation to VTE in a large population-based cohort of middle-aged and older adults.<h4>Methods</h4>The exomes of <i>TFPI</i> were analyzed for variants in 28,794 subjects without previous VTE (born 1923-1950, 60% women), who participated in the Malmö Diet and Cancer Study (1991-1996). Patients were followed until the first event of VTE, death, or 2018. Qualifying variants were defined as loss-of-function or nonbenign (PolyPhen-2) missense variants with minor allele frequency less than 0.1%.<h4>Results</h4>No common variant was associated with VTE. Nine rare variants (two loss-of-function and seven nonbenign missense) were classified as qualifying and included in collapsing analysis. Prevalence of qualifying variants was 0.09%. Five individuals with VTE compared to 17 individuals without VTE carried one qualifying variant. Cox multivariate regression analysis adjusted for age, sex, body mass index, systolic blood pressure, smoking and alcohol consumption, rs6025, rs1799963, and ancestry showed a hazard ratio of 2.9 (95% CI, 1.2-7.1) for rare qualifying variants.<h4>Conclusion</h4>Rare qualifying <i>TFPI</i> variants were associated with VTE, suggesting that rare variants in <i>TFPI</i> contribute to the development of VTE. The qualifying <i>TFPI</i> gene variants were very rare, suggesting a constrained gene.

Also flagged:non-small cell lung cancerscancerLung adenocarcinomasquamous cell carcinomanon-small cell lung cancerlung cancer
Journal Article 2022-10-01 ✓ 1 Snippet Vellichirammal NN, Albahrani A, Guda C.
In-Text Gene Mentions

…, LRRTM3 ,DCC, and SCN1A…

Show Full Abstract

<h4>Background</h4>Lung cancer remains the leading cause of cancer-related deaths in the US despite novel treatment protocols, with about 235,000 new cases and 131,000 deaths expected from this cancer in 2021 alone. Lung adenocarcinoma and squamous cell carcinoma, which are both subtypes of non-small cell lung cancer, account for most lung cancer cases, and comparing the molecular signatures in these two cancers can identify novel mechanisms that contribute to non-small cell lung cancer oncogenesis.<h4>Methods</h4>We, in this study, performed a comprehensive gene fusion profiling of these cancers, which is understudied in lung cancers. Using an alignment-free fusion detection tool, 'ChimeRScope', we screened for gene fusions in lung adenocarcinoma and squamous cell carcinoma datasets from The Cancer Gene Atlas database. Fusion profiles in these two cancer subtypes were essentially different with minimal overlap.<h4>Results</h4>Our analysis revealed a positive association of smoking to fusion frequency in lung adenocarcinoma but not in squamous cell carcinoma and identified several fusion genes that could be explored as markers associated with cigarette smoke exposure. We also identified differentially regulated pathways linked to E2F, G2M checkpoint, and MTORC1 signaling upregulated and P53 pathway downregulated in samples containing high fusions in lung adenocarcinoma. Our results indicate that downregulation of the P53 pathway leads to higher gene fusion formation in lung adenocarcinoma.<h4>Conclusions</h4>This manuscript provides a strong rationale for investigating the molecular mechanisms of cigarette smoke-induced gene fusion formation associated with lung cancer. Novel recurrent fusions associated with cigarette smoke were identified in our study, which could further be investigated for patient stratification, personalized therapy, and therapeutic monitoring.

Also flagged:gastric cancerGene ExpressioncancertumorLBPSERPINE1
Journal Article 2022-10-01 ✓ 2 Snippets Ni Z, Zhang J, Huang C, Xie H, Ge B, Huang Q.
In-Text Gene Mentions

…TNFRSF4 , andTNFSF4; r>0.3, Spearman,…

…Interestingly, bothTNFSF4and its receptor…

Show Full Abstract

<h4>Background</h4>The tumor microenvironment (TME) and inflammation play vital roles in the development and progression of gastric cancer (GC). However, there are no inflammation-related models that can predict the prognosis and immunotherapy response of GC patients. We aimed to establish a prognostic model based on an inflammation-related gene (IRG) signature that can predict poor clinical outcomes in GC.<h4>Methods</h4>We searched IRGs in The Cancer Genome Atlas (TCGA) database and identified genes differentially expressed in GC. The model was constructed using univariate Cox and least absolute shrinkage and selection operator (LASSO) regression analysis and validated using Gene Expression Omnibus (GEO) database. Receiver operating characteristic (ROC) curve, principal component analysis (PCA), and t-distribution stochastic neighbor embedding (t-SNE) analysis were performed to evaluate model performance. Independent prognostic factor, immune infiltration, cancer stemness, immunotherapy response analysis and gene set enrichment analysis (GSEA) were performed for functional evaluation.<h4>Results</h4>An inflammation-related risk model was established based on 8 genes (<i>F2</i>, <i>LBP</i>, <i>SERPINE1</i>, <i>ADAMTS12</i>, <i>FABP4</i>, <i>PROC</i>, <i>TNFSF18</i>, and <i>CYSLTR1</i>). Risk score significantly correlated with poor outcomes and independently predicted prognosis. It was also associated with immune infiltration and reflected immunotherapy response.<h4>Conclusions</h4>We established and validated an inflammation-related prognostic model that predicts immune escape and patient prognosis in GC. Our model is expected to improve clinical outcomes by facilitating clinical decision making and the development of individualized treatments.

Also flagged:Complement C5deathGene Expressionreverse transcriptionpolymerasecomplement 5
Journal Article 2022-10-01 No Snippets Chang H, Jin L, Xie P, Zhang B, Yu M, Li H, Liu S, Yan J, Zhou B, Li X, Xu Y, Xiao Y, Ye Q, Guo L.
Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is one of the most prominent malignant diseases, with a high incidence and a dismal prognosis. Metastasis to the liver is the leading cause of death in CRC patients. This study aimed to identify accurate metastatic biomarkers of CRC and investigate the potential molecular mechanisms of liver metastasis of colorectal cancer (LMCRC).<h4>Methods</h4>Three independent datasets were screened and downloaded from the Gene Expression Omnibus (GEO) database. The GEO2R tool was used to identify differentially expressed genes (DEGs) in CRC tissues and liver metastases. Next, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted using the Database for Annotation, Visualization, and Integrated Discovery (DAVID). Furthermore, the protein-protein interactions (PPIs) of the DEGs were analyzed using the Search Tool for the Retrieval of Interacting Genes (STRING) database, Cytoscape, and Molecular Complex Detection (MCODE). Next, the expression levels and Kaplan-Meier survival analysis of the target gene between normal colon and CRC tissues were performed by UALCAN. The expression of the target gene in tissues and cell lines was verified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR), western blot, and immunohistochemistry (IHC) assay. The impact of the target gene on the proliferation, invasion, and migration ability of COAD cells was explored <i>in vitro</i>.<h4>Results</h4>A total of 92 common DEGs were found in the three independent datasets. GO/KEGG enrichment analysis showed that the DEGs were mainly involved in 14 different pathways. The protein-protein interaction (PPI) network revealed that complement 5 (C5), the upstream gene of C8A in the complement system, was associated with C8 and other key hub genes. Meanwhile, the online UALCAN resource showed that C5 was up-regulated and facilitated malignant progression in COAD samples. Next, we confirmed that C5 remarkably increased and promoted cell proliferation, migration, and invasion in CRC cell lines, SW620 and SW480. The IHC assay showed C5 was also highly expressed in a majority of LMCRC tissues compared with paired CRC tissues.<h4>Conclusions</h4>The findings of our integrated bioinformatics study suggest that complement C5 might serve as a potential therapeutic target in patients with CRC.

Also flagged:glutaminemetabolismGene Expressiontumoraldehyde dehydrogenase 5 family member A1hepatocellular carcinoma
Journal Article 2022-10-01 ✓ 1 Snippet Jin S, Cao J, Kong LB.
In-Text Gene Mentions

…Superfamily Member 4 (TNFSF4) , and CD40…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) has one of the highest mortality rates worldwide. Abnormal glutamine metabolism (GM) has been reported to be involved in HCC progression. The current study sought to examine the predictive value of GM in HCC patient's prognosis and therapy response.<h4>Methods</h4>The RNA-sequencing data and clinical information of HCC samples were obtained from The Cancer Genome Atlas (TCGA) database (N=377) and Gene Expression Omnibus (GEO) database (N=242). By analyzing a data set from TCGA, we showed that the GM landscape of HCC patients was developed based on the non-negative matrix factorization (NMF) algorithm. Univariate Cox regression and least absolute shrinkage and selection operator (LASSO)-penalized Cox regression analyses were used to construct a risk model. The accuracy of the model, which was based on the GM-related genes (GMRGs), was verified by Kaplan-Meier (K-M) and receiver operating characteristic (ROC) curves. We also verified the reliability of the model based on GEO data. Finally, the immune infiltration analysis, pathway enrichment analysis, and treatment response prediction results were compared to each other in the 2 risk groups.<h4>Results</h4>In our study, the HCC samples were divided into 2 GM-related patterns; that is, C1 and C2. The multi-analysis revealed that the GM-related patterns were associated with the pathologic stage, T stages, N stages, histologic grade, and the tumor immune microenvironment (TIME). Next, the prognostic model containing 5 GMRGs (i.e., aldehyde dehydrogenase 5 family member A1<i>, ASNSD1,</i> carbamoyl-phosphate synthetase 1<i>, GMPS,</i> and <i>PPAT</i>) was constructed to calculate the risk score. The high-risk group of HCC patients had significantly worse overall survival (OS) than the low-risk group in both datasets (P<0.001). Multivariate Cox regression uncover the riskScores may serve as an independent prognostic marker for HCC patients [TCGA: hazard ratio (HR) =2.909 (1.940-4.362), P<0.001; GEO: HR =2.911 (1.753-5.848), P=0.043]. Finally, we found that the prognostic model was significantly correlated with the pathologic stage and TIME of the HCC patients in both databases. Moreover, the prognostic model may guide the immunotherapy, chemotherapy, and targeted drugs choice.<h4>Conclusions</h4>In summary, we developed a GM-related 5-gene risk-score model, which may be a useful tool for predicting prognosis and guiding the treatment of HCC patients.

Also flagged:ATP1B1diffuse large B-cell lymphomacancerDLBCLgene expressionCluster of Differentiation 19
Journal Article 2022-10-01 ✓ 2 Snippets Zhang S, Wang H, Liu A.
In-Text Gene Mentions

…Growth Regulator 1 (NEGR1) interacting protein, which…

…diseases related toNEGR1( 29 ).…

Show Full Abstract

<h4>Background</h4>Copy number variations (CNVs) participate in the development and progression of cancer by altering the expression levels of genes. However, it is unclear whether this correlation exists in diffuse large B-cell lymphoma (DLBCL).<h4>Methods</h4>Differentially expressed genes (DEGs) were identified from the GSE25638 and GSE56315 datasets. Modules that were highly related to DLBCL prognosis were obtained by Weighted Gene Co-expression Network Analysis (WGCNA). We performed an integrated analysis between CNV and differential gene expression in The Cancer Genome Atlas (TCGA) DLBCL. The DEGs were then overlapped with the module genes and expression-copy number variations-related (Exp-CNV-related) genes to obtain the common key genes. Time-dependent receiver operating characteristic (ROC) analysis was utilized to evaluate the accuracy of the key gene in predicting the prognosis of DLBCL. Next, we conducted a Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis to explore the key gene. The potential molecule drugs of the key gene were identified by Connectivity Map (Cmap) analysis.<h4>Results</h4>A turquoise module with 160 genes was identified as the signature module. ATP1B1 is overexpressed in DLBCL cell lines, compared to Cluster of Differentiation 19+B (CD19+B) cells. The ROC curve indicated that ATP1B1 could be a biomarker for diagnosing DLBCL, and the forest map suggested that <i>ATP1B1</i> gene expression levels had a greater impact on the prognosis of patients with DLBCL. The area under curve (AUC) value of the time-dependent ROC curve with values based on the 1-, 3-, and 5-year survivability were 0.576, 0.663, and 0.706, respectively. Pathway analysis demonstrated the relationship between ATP1B1 and focal adhesion, etc. The inhibitory effects of ATP1B1 downregulation on DLBCL cell proliferation, cell migration, invasion, and cell adhesion were also examined. We found out that the higher proliferation ability in ATP1B1-overexpression cells was rescued with roxithromycin.<h4>Conclusions</h4>ATP1B1 is a copy number driver gene that could potentially be adopted as a diagnostic biomarker and therapeutic target of DLBCL.

Also flagged:lung adenocarcinomaLUADgene expressioncancerCYP4F12Down syndrome cell adhesion molecule
Journal Article 2022-10-01 ✓ 2 Snippets Lin GY, Gao ZS, Zheng XH, Zheng JP, Ye SX, Wang ZY.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT) protein encoded by…

…gene polymorphisms and5-HTTare possibly associated…

Show Full Abstract

<h4>Background</h4>There are several mechanisms believed to be essential for the development of distant metastasis in lung adenocarcinoma (LUAD), but the prediction of distant metastasis is still a challenge. The purpose of the present study was to examine the specific changes in RNA expression, including long non-coding RNAs (lncRNAs) in distant metastasis patients.<h4>Methods</h4>We compared differentially expressed genes involved in distant metastasis from otherwise non-metastasis and healthy adults using a gene expression profile. We first ranked gene sets (or gene signatures) that identify each class. An advanced multiple-class classifier was built based on the gene sets. Our classifier consisted of 282 genes and could predict cancer and distant metastasis with error rates of approximately 0.01 and 0.2, respectively. Then, gene networks were built to undermine gene relations to each class.<h4>Results</h4>Cytochrome P450 family 4 subfamily F member 12 (CYP4F12) was the first gene in the ranking of the distant metastasis case. Down syndrome cell adhesion molecule (DSCAM) was the top gene in the rank list of the non-metastasis case. Solute carrier family 6 member 4 (SLC6A4) was associated with normal tissues. LncRNA family with sequence similarity 66 member A (FAM66A) and lncRNA PSORS1C3 were found to be associated with tumor metastasis.<h4>Conclusions</h4>Our classifier could successfully predict distant metastasis in LUAD patients. LncRNA FAM66A and lncRNA PSORS1C3 in our model could play a role in cancer development.

Also flagged:lung adenocarcinomaferroptosisnecroptosisLUADprogrammed cell deathpyroptosis
Journal Article 2022-10-01 ✓ 1 Snippet Peng L, Ji J, Zhang C, Wu Z, Sun Y, Fan K, Du W, Liu A, Jiao W.
In-Text Gene Mentions

…ferroptosis mediated by 15LOX/PEBP1( 25 ).…

Show Full Abstract

<h4>Background</h4>Identifying populations that benefit from immune checkpoint blockade (ICB) therapy remains a major challenge in the treatment of lung adenocarcinoma (LUAD). Existing programmed cell death (PCD) related prognostic models only consider a single mechanism, such as ferroptosis, necroptosis, and pyroptosis, and do not reflect the interaction of multiple mechanisms. This study aims to explore lncRNAs associated with multiple modes of PCD and reveal a risk signature to assess prognosis and treatment outcomes in LUAD patients.<h4>Methods</h4>Based on expression data in The Cancer Genome Atlas (TCGA) database, ferroptosis, necroptosis, and pyroptosis-related lncRNAs (FNPRlncRNAs) were obtained by taking the intersection of ferroptosis-related lncRNAs (FRlncRNAs), necroptosis-related lncRNAs (NRlncRNAs), and pyroptosis-related lncRNAs (PRlncRNAs) differentially expressed in LUAD and normal tissues. Patients with complete survival information and expression data from TCGA database were randomly assigned to training and testing sets (1:1). Univariate, LASSO, and multivariate Cox regression analyses were performed on the training set, and a risk signature was established. Kaplan-Meier survival curves were used to verify the prognostic ability of risk signature, and receiver operating characteristic (ROC) curves were used to assess the predictive accuracy. We then analyzed molecular and immune profile differences between high and low-risk subgroups. T-cell dysfunction and Exclusion (TIDE) scores were used to assess the response to immunotherapy in each risk subgroup. Finally, three LUAD clusters (C1, C2, and C3) were identified according to the risk signature.<h4>Results</h4>Patients in the low-risk subgroup had higher overall survival (OS) than that in the high-risk subgroup in the K-M survival curve. The area under ROC curves (AUC) of 1-, 3-, and 5-year ROC were 0.742, 0.762, and 0.749 in the training set, and 0.672, 0.642, and 0.563 in the testing set, respectively. Compared with the high-risk subgroup, patients in the low-risk subgroup have beneficial tumor immune microenvironment and molecular characteristics, but are less likely to benefit from immunotherapy. Finally, the three LUAD clusters (C1, C2, C3) identified by risk signature had different responses to drug treatment.<h4>Conclusions</h4>The prognosis risk signature constructed using FNPRlncRNAs is helpful to predict the prognosis of LUAD and may contribute to its individualized treatment.

Also flagged:hypothyroidismestrogensthyroid hormone-binding globulinTBGiodinedegradation
Journal Article 2022-10-01 ✓ 1 Snippet Solha STG, Mattar R, Teixeira PFDS, Chiamolera MI, Maganha CA, Zaconeta ACM, Souza RT.
In-Text Gene Mentions

…trative diseases (amyloidosis,hemochromatosis, sarcoidosis), drug use,…

Show Full Abstract

No abstract available.

Also flagged:lung cancersmall cell lung cancerSCLCnonsmall cell lung cancerNSCLCmetastatic disease
Journal Article 2022-10-01 ✓ 1 Snippet Rivière A, Lecuyer AI, Laurent E, Lefebvre C, Lecomte T, Olivier E, Carmier D, Plantier L, Grammatico-Guillon L.
In-Text Gene Mentions

…were obtained fromDCC.…

Show Full Abstract

<h4>Background</h4>It is unclear whether delays in care affect prognosis of patients with lung cancer. The primary objective of this study was to describe the care pathway of patients diagnosed with lung cancer in a French region. Secondary objectives were to identify markers associated with 1) time from imaging to treatment and 2) with 1-year survival.<h4>Methods</h4>In a retrospective cohort study, clinical data from multidisciplinary team meetings for all incident lung cancer cases discussed in 2018 in one French region were matched with medico-administrative data from the National Health Insurance Database. Care pathway time intervals were estimated for small cell lung cancer (SCLC), resected nonsmall cell lung cancer (NSCLC) and unresected NSCLC. Factors associated with delay in the care pathway were identified using linear regression; 1-year survival was analysed using Cox modelling.<h4>Results</h4>A total of 685 patients were included. Median time between imaging and treatment was 49 days (interquartile range: 33-73), and was lower in cases of metastatic disease, SCLC and private care. At 1 year, 48% had died (resected NSCLC 12%). In unresected NSCLC, time from diagnostic imaging to first treatment <49 days was associated with a higher risk of death. Time intervals were similar in patients with squamous cell carcinoma <i>versus</i> adenocarcinoma or undifferentiated carcinoma.<h4>Discussion</h4>Time intervals in the care pathways of lung cancer were similar to previous reports, confirming the robustness of retrospective databases. In unresectable NSCLC, rapid care was not associated with better survival.

Also flagged:Gamma-GlutamyltransferaseGlutathioneLiver Cirrhosisliver diseasesγ-glutamyl transferaseGGT
Journal Article 2022-10-01 ✓ 1 Snippet Pomacu MM, Stănciulescu CE, Trașcă DM, Pădureanu V, Goga LD, Pisoschi CG, Bugă AM.
In-Text Gene Mentions

…] and peroxiredoxinPrdx6[ 14 ];…

Show Full Abstract

Oxidative stress involvement in liver diseases has been extensively studied. A direct assessment of the reactive species incriminated is avoided due to their short lifespan and high cost. For these reasons an inexpensive and easy to perform test for whole body oxidative stress is highly desired. This pilot study was conducted to assess the relationship between γ-glutamyl transferase (GGT) activity and markers of oxidative stress: reduced glutathione (GSH), glutathione peroxidase (GPx) activity and lipid peroxidation in patients with liver cirrhosis due to chronic ethanol consumption and viral hepatitis. Forty-eight patients with alcoholic liver cirrhosis and cirrhosis developed after HBV and HCV infection were included in this study.Blood GSH andGPxand serum GGT and MDAwere assayed and the results were statistically analyzed. The activity of serum GGT was significantly higher in the alcoholic group. The relationship between GGT activity, GSH and MDA levels was different between groups.A strong significant positive correlation between GGT and GSH was noticed for the patients from GGT Q3 and Q4 quartiles in the group of viral liver cirrhosis, while for alcoholics the relationship between GGT and GSH showed the trend for a negative correlation.The values of serum MDA differ significantly between groups (p<0.015); a very significant variation was observed at low levels of GGT activity (p<0.006). Our study demonstrates that the GSH antioxidant defense system is more compromisedin alcoholic cirrhosisand tends to correlate negatively with GGT. Even in its normal range GGT might be an early and sensitive marker of oxidative stress.

Also flagged:bone morphogenetic proteinBMP2collagen 1OSTvascular endothelial growth factorVEGF
Journal Article 2022-10-01 No Snippets Ozmen O, Tomul F, Sirin YS.
Show Full Abstract

<h4>Background</h4>Enhancing the bone healing procedure would resultantly improve the post-recovery life quality, as well as the speed with which the patient returns to their former life quality. Porous structures can provide a large surface area and abundant channels to facilitate mass transfer.<h4>Objective</h4>To evaluate the application of mesoporous materials in the bone healing of surgically created defects on the tibiae of male adult Wistar rats.<h4>Methods</h4>The defect areas were evaluated after implantation of 4 types of bioactive glass histopathologically and immunohistochemically. Fifty adult rats were divided into 5 groups including a control group without material. The used products were mesoporous bioactive glass (MBG), Cu-MBG, Zn-MBG, and Cu-Zn-MBG. Unicortical bone defects with a 3 mm diameter were performed in both tibiae of the animals and filled with 4 types of glass particles. The rats were then euthanized at 15 d and 30 d. Tibial samples were collected and the tissues forwarded for histological processing, and examined using light microscopy. Additionally, bone healing was evaluated by assessing the levels of bone morphogenetic protein BMP2, collagen 1, osteocalcin (OST), and vascular endothelial growth factor (VEGF) using immunohistochemical methods.<h4>Results</h4>Within the 15th day, all groups presented connective tissue septa; at the 30th day, the new bone formation was more intense in the Cu-Zn-MBG group. Additionally, BMP2, collagen 1, OST, and VEGF immune expression were more prominent in the Cu-Zn-MBG group.<h4>Conclusions</h4>The study results indicated that MBG may be used for the repairing of bone defects. Cu-Zn-MBG may be the best choice for this purpose.

Abstract

Also flagged:titanium dioxidetitaniumCatalaseglutathioneperoxidasetert‐butyl hydroperoxide
Journal Article 2022-10-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:venous thromboembolismFGGABOcancer
Journal Article 2022-10-01 ✓ 3 Snippets Natae S, Sándor J, Ádány R, Fiatal S.
In-Text Gene Mentions

…genotyped for rs121909567 (SERPINC1), rs1799963 (F2), rs2036914…

…terestingly, the rs121909567 (SERPINC1) SNP was not…

…Conclusions rs121909567 (SERPINC1) was confirmed as…

Show Full Abstract

No abstract available.