Also flagged:osteoarthritisOATMJ OApathogenesisgene expressionTMJ Osteoarthritis
Journal Article2023-03-31✓ 1 SnippetTosa I, Ruscitto A, Wang Z, Chen KZ, Ono M, Embree MC.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
<h4>Objective</h4>The temporomandibular joint (TMJ) is anatomically comprised of the mandibular condylar cartilage (CC) lined with fibrocartilaginous superficial zone and is crucial for eating and dental occlusion. TMJ osteoarthritis (OA) leads to pain, joint dysfunction and permanent loss of cartilage tissue. However, there are no drugs clinically available that ameliorate OA and little is known about global profiles of genes that contribute to TMJ OA. Furthermore, animal models that recapitulate the complexity of signalling pathways contributing to OA pathogenesis are crucial for designing novel biologics that thwart OA progression. We have previously developed a New Zealand white rabbit TMJ injury model that demonstrates CC degeneration. Here, we performed genome-wide profiling to identify new signalling pathways critical for cellular functions during OA pathology.<h4>Materials and methods</h4>Temporomandibular joint OA was surgically induced in New Zealand white rabbits. Three months following injury, we performed global gene expression profiling of the TMJ condyle. RNA samples from TMJ condyles were subjected to sequencing. After raw RNA-seq data were mapped to relevant genomes, differential expression was analysed with DESeq2. Gene ontology enrichment analysis and Kyoto Encyclopedia of Genes and Genomes pathway analysis were conducted.<h4>Results/conclusions</h4>Our study revealed multiple pathways altered during TMJ OA induction including the Wnt, Notch and PI3K-Akt signalling pathways. We demonstrate an animal model that recapitulates the complexity of the cues and signals underlying TMJ OA pathogenesis, which is essential for developing and testing novel pharmacologic agents to treat OA.
Also flagged:MLKLnecroptosistumorpancreatic ductal adenocarcinomabladder urothelial carcinomacancer
Journal Article2023-03-31✓ 1 SnippetZhong B, Wang Y, Liao Y, Liang J, Wang K, Zhou D, Zhao Y, Jiang N.
In-Text Gene Mentions
Results)
…TMIGD2, CD160, ICOSLG,BTN2A1, and TNFRSF25, were…
Show Full Abstract
The involvement of necroptosis in the immunosuppressive tumor microenvironment has been established and has been shown to contribute to the growth of pancreatic ductal adenocarcinoma, indicating its role in promoting tumor development. However, the relationship between necroptosis and bladder urothelial carcinoma (BUC) has yet to be fully understood. To shed light on this issue, our study aimed to uncover the impact of necroptosis on immune cell infiltration and immunotherapy response in BUC patients. We conducted an analysis of 67 necroptosis genes to assess their expression and genomic changes across pan-cancer and identified 12 necroptosis genes that are prognostically relevant and associated with immune subtypes and tumor stemness in BUC. Using a public database of 1841 BUC samples, we then performed Unsupervised Cluster Analysis and discovered two distinct necroptotic phenotypes in BUC. These phenotypes showed significant differences in molecular subtypes, immune infiltration patterns, and gene mutation profiles. We confirmed this discovery in BUC through qPCR and WB experiments. To evaluate the impact of necroptosis on prognosis, chemotherapy sensitivity, and immunotherapy response (such as anti-PD-L1), we developed a principal component analysis model called NecroScore. Finally, we validated the effects of RIPK3 and MLKL through a nude mouse transplantation model for BUC. Our study has uncovered that necroptosis plays a role in shaping the tumor immune microenvironment in BUC. The high necroptosis phenotype (Cluster B) was characterized by a higher abundance of tumor immunosuppressive cells and more key biological processes driving tumor progression, while the low necroptosis group (Cluster A) had higher FGFR3 mutations. We found that the infiltration levels of immune cells, including CD8+ T cells, were significantly different between FGFR3 mutated and wild-type (WT) samples. Our results confirmed the reliability of NecroScore as a comprehensive assessment tool for evaluating the immunotherapeutic effect and prognosis of BUC patients, with high NecroScore values favoring basal-like differentiation and lower FGFR3 alterations. We also observed that high expression of MLKL had a significant inhibitory effect on tumor growth and increased neutrophil infiltration in vivo. In our study, we uncovered the regulation pattern of necroptosis in the tumor immune microenvironment of BUC. Additionally, we developed a scoring tool called NecroScore that can be utilized to predict the most suitable chemotherapy and immunotherapy strategy for bladder urothelial carcinoma patients. This tool can effectively guide the chemotherapy and immunotherapy regimens for patients with advanced BUC.
Also flagged:alopeciaandrogenetic alopeciatoamino acidhair lossandrogens
Journal Article2023-03-31✓ 2 SnippetsKarim N, Mirmirani P, Durbin-Johnson BP, Rocke DM, Salemi M, Phinney BS, Rice RH.
In-Text Gene Mentions
I A O 0000326)
…(17) GDA, (18)PEBP1, (19) PSMB7, (20)…
I A O 0000326)
…(32) KRT85, (33)PRDX6, (34) HSPA2, (35)…
Show Full Abstract
Protein profiling offers an effective approach to characterizing how far epidermis departs from normal in disease states. The present pilot investigation tested the hypothesis that protein expression in epidermal corneocytes is perturbed in the forehead of subjects exhibiting frontal fibrosing alopecia. To this end, samples were collected by tape stripping from subjects diagnosed with this condition and compared to those from asymptomatic control subjects and from those exhibiting androgenetic alopecia. Unlike the latter, which exhibited only 3 proteins significantly different from controls in expression level, forehead samples from frontal fibrosing alopecia subjects displayed 72 proteins significantly different from controls, nearly two-thirds having lower expression. The results demonstrate frontal fibrosing alopecia exhibits altered corneocyte protein expression in epidermis beyond the scalp, indicative of a systemic condition. They also provide a basis for quantitative measures of departure from normal by assaying forehead epidermis, useful in monitoring response to treatment while avoiding invasive biopsy.
Also flagged:T cell receptorCD16infectioncardiovascular diseasecancerCD8
Journal Article2023-03-31✓ 1 SnippetRoy Chowdhury R, Valainis JR, Dubey M, von Boehmer L, Sola E, Wilhelmy J, Guo J, Kask O, Ohanyan M, Sun M, Huang H, Huang X, Nguyen PK, Scriba TJ, Davis MM, Bendall SC, Chien YH.
In-Text Gene Mentions
Text
…BTN2A1…
Show Full Abstract
The response of gamma delta (γδ) T cells in the acute versus chronic phases of the same infection is unclear. How γδ T cells function in acute <i>Mycobacterium tuberculosis</i> (Mtb) infection is well characterized, but their response during persistent Mtb infection is not well understood, even though most infections with Mtb manifest as a chronic, clinically asymptomatic state. Here, we analyze peripheral blood γδ T cells from a South African adolescent cohort and show that a unique CD8<sup>+</sup> γδ T cell subset with features of "memory inflation" expands in chronic Mtb infection. These cells are hyporesponsive to T cell receptor (TCR)-mediated signaling but, like NK cells, can mount robust CD16-mediated cytotoxic responses. These CD8<sup>+</sup> γδ T cells comprise a highly focused TCR repertoire, with clonotypes that are <i>Mycobacterium</i> specific but not phosphoantigen reactive. Using multiparametric single-cell pseudo-time trajectory analysis, we identified the differentiation paths that these CD8<sup>+</sup> γδ T cells follow to develop into effectors in this infection state. Last, we found that circulating CD8<sup>+</sup> γδ T cells also expand in other chronic inflammatory conditions, including cardiovascular disease and cancer, suggesting that persistent antigenic exposure may drive similar γδ T cell effector programs and differentiation fates.
Also flagged:obesityleptinfollistatinadenylate cyclase 3chronic metabolic diseasetype 2 diabetes
Journal Article2023-03-31No SnippetsZhao Q, Han B, Xu Q, Wang T, Fang C, Li R, Zhang L, Pei Y.
Show Full Abstract
<h4>Abstract</h4>The prevalence of obesity has increased worldwide in recent decades. Genetic factors are now known to play a substantial role in the predisposition to obesity and may contribute up to 70% of the risk for obesity. Technological advancements during the last decades have allowed the identification of many hundreds of genetic markers associated with obesity. However, the transformation of current genetic variant-obesity associations into biological knowledge has been proven challenging. Genomics and proteomics are complementary fields, as proteomics extends functional analyses. Integrating genomic and proteomic data can help to bridge a gap in knowledge regarding genetic variant-obesity associations and to identify new drug targets for the treatment of obesity. We provide an overview of the published papers on the integrated analysis of proteomic and genomic data in obesity and summarize four mainstream strategies: overlap, colocalization, Mendelian randomization, and proteome-wide association studies. The integrated analyses identified many obesity-associated proteins, such as leptin, follistatin, and adenylate cyclase 3. Despite great progress, integrative studies focusing on obesity are still limited. There is an increased demand for large prospective cohort studies to identify and validate findings, and further apply these findings to the prevention, intervention, and treatment of obesity. In addition, we also discuss several other potential integration methods.
Also flagged:acute myeloid leukemiaAMLMYCTP53corespindle checkpoint kinase
Journal Article2023-03-31✓ 5 SnippetsCheng CK, Yung YL, Chan HY, Leung KT, Chan KYY, Leung AWK, Cheng FWT, Li CK, Wan TSK, Luo X, Pitts HA, Cheung JS, Chan NPH, Ng MHL.
In-Text Gene Mentions
Methods)
…Patients (total n = 80) with core-binding factor AML (t(8;21)(q22;q22)/RUNX1::RUNX1T1, inv(16)(p13q22)/CBFB::MYH11), APL (t(15;17)(q24;q21)/PML::RARA), 11q23/KMT2A rearrangements (KMT2A::MLLT3, KMT2A::MLLT10, KMT2A::MLLT11 and KMT2A::ELL), t(1;22)(p13;q13)/RBM15::MRTF1, t(6;9)(p22;q34)/DEK::NUP214, and t(10;11)(p12;q14)/PICALM::MLLT10 were RT-PCR tested to confirm the respective FGs.…
Methods)
…Rare fusions were those defined by the International Consensus Classification (ICC) of myeloid neoplasms and acute leukemia65 and included RBM15::MRTF1, DEK::NUP214, FUS::ERG, CBFA2T3::GLIS2, RUNX1::CBFA2T3, and PICALM::MLLT10 in this study.…
Methods)
…RUNX1::CBFA2T3 , and PICALM::MLLT10in this study.…
Pediatric acute myeloid leukemia (AML) is an uncommon but aggressive hematological malignancy. The poor outcome is attributed to inadequate prognostic classification and limited treatment options. A thorough understanding on the genetic basis of pediatric AML is important for the development of effective approaches to improve outcomes. Here, by comprehensively profiling fusion genes as well as mutations and copy number changes of 141 myeloid-related genes in 147 pediatric AML patients with subsequent variant functional characterization, we unveil complex mutational patterns of biological relevance and disease mechanisms including MYC deregulation. Also, our findings highlight TP53 alterations as strong adverse prognostic markers in pediatric AML and suggest the core spindle checkpoint kinase BUB1B as a selective dependency in this aggressive subgroup. Collectively, our present study provides detailed genomic characterization revealing not only complexities and mechanistic insights into pediatric AML but also significant risk stratification and therapeutic strategies to tackle the disease.
Also flagged:Gliomasbrain tumorcentral nervous systemCNS) tumorsGlioblastomaGBM
Journal Article2023-03-31✓ 1 SnippetYang Z, Zheng Y, Wu H, Xie H, Zhao J, Chen Z, Li L, Yue X, Zhao B, Bian E.
In-Text Gene Mentions
Introduction)
…progression by regulatingOLFM4[ 19 ].…
Show Full Abstract
<h4>Background</h4>Super-enhancers (SEs), driving high-level expression of genes with tumor-promoting functions, have been investigated recently. However, the roles of super-enhancer-associated lncRNAs (SE-lncRNAs) in tumors remain undetermined, especially in gliomas. We here established a SE-lncRNAs expression-based prognostic signature to choose the effective treatment of glioma and identify a novel therapeutic target.<h4>Methods</h4>Combined analysis of RNA sequencing (RNA-seq) data and ChIP sequencing (ChIP-seq) data of glioma patient-derived glioma stem cells (GSCs) screened SE-lncRNAs. Chinese Glioma Genome Atlas (CGGA) and The Cancer Genome Atlas (TCGA) datasets served to construct and validate SE-lncRNA prognostic signature. The immune profiles and potential immuno- and chemotherapies response prediction value of the signature were also explored. Moreover, we verified the epigenetic activation mechanism of LINC00945 via the ChIP assay, and its effect on glioma was determined by performing the functional assay and a mouse xenograft model.<h4>Results</h4>6 SE-lncRNAs were obtained and identified three subgroups of glioma patients with different prognostic and clinical features. A risk signature was further constructed and demonstrated to be an independent prognostic factor. The high-risk group exhibited an immunosuppressive microenvironment and was higher enrichment of M2 macrophage, regulatory T cells (Tregs), and Cancer-associated fibroblasts (CAFs). Patients in the high-risk group were better candidates for immunotherapy and chemotherapeutics. The SE of LINC00945 was further verified via ChIP assay. Mechanistically, BRD4 may mediate epigenetic activation of LINC00945. Additionally, overexpression of LINC00945 promoted glioma cell proliferation, EMT, migration, and invasion in vitro and xenograft tumor formation in vivo.<h4>Conclusion</h4>Our study constructed the first prognostic SE-lncRNA signature with the ability to optimize the choice of patients receiving immuno- and chemotherapies and provided a potential therapeutic target for glioma.
Also flagged:mitochondriavesiclesynapsescalciumADmitochondrial
Journal Article2023-03-31No SnippetsWang W, Zhao F, Lu Y, Siedlak SL, Fujioka H, Feng H, Perry G, Zhu X.
Show Full Abstract
Loss of synapses is the most robust pathological correlate of Alzheimer's disease (AD)-associated cognitive deficits, although the underlying mechanism remains incompletely understood. Synaptic terminals have abundant mitochondria which play an indispensable role in synaptic function through ATP provision and calcium buffering. Mitochondrial dysfunction is an early and prominent feature in AD which could contribute to synaptic deficits. Here, using electron microscopy, we examined synapses with a focus on mitochondrial deficits in presynaptic axonal terminals and dendritic spines in cortical biopsy samples from clinically diagnosed AD and age-matched non-AD control patients. Synaptic vesicle density within the presynaptic axon terminals was significantly decreased in AD cases which appeared largely due to significantly decreased reserve pool, but there were significantly more presynaptic axons containing enlarged synaptic vesicles or dense core vesicles in AD. Importantly, there was reduced number of mitochondria along with significantly increased damaged mitochondria in the presynapse of AD which correlated with changes in SV density. Mitochondria in the post-synaptic dendritic spines were also enlarged and damaged in the AD biopsy samples. This study provided evidence of presynaptic vesicle loss as synaptic deficits in AD and suggested that mitochondrial dysfunction in both pre- and post-synaptic compartments contribute to synaptic deficits in AD.
Also flagged:AHRkeratinocyte differentiationceramidesceramideChromatinluciferase
Journal Article2023-03-31✓ 1 SnippetSutter CH, Azim S, Wang A, Bhuju J, Simpson AS, Uberoi A, Grice EA, Sutter TR.
In-Text Gene Mentions
Text
…B4GALT5…
Show Full Abstract
Ligand activation of the aryl hydrocarbon receptor (AHR) accelerates keratinocyte differentiation and the formation of the epidermal permeability barrier. Several classes of lipids, including ceramides, are critical to the epidermal permeability barrier. In normal human epidermal keratinocytes, the AHR ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin, increased RNA levels of ceramide metabolism and transport genes: uridine diphosphate glucose ceramide glucosyltransferase (UGCG), ABCA12, GBA1, and SMPD1. Levels of abundant skin ceramides were also increased by 2,3,7,8-tetrachlorodibenzo-p-dioxin. These included the metabolites synthesized by UGCG, glucosylceramides, and acyl glucosylceramides. Chromatin immunoprecipitation-sequence analysis and luciferase reporter assays identified UGCG as a direct AHR target. The AHR antagonist, GNF351, inhibited the 2,3,7,8-tetrachlorodibenzo-p-dioxin-mediated RNA and transcriptional increases. Tapinarof, an AHR ligand approved for the treatment of psoriasis, increased UGCG RNA, protein, and its lipid metabolites hexosylceramides as well as increased the RNA expression of ABCA12, GBA1, and SMPD1. In Ahr-null mice, Ugcg RNA and hexosylceramides were lower than those in the wild type. These results indicate that the AHR regulates the expression of UGCG, a ceramide-metabolizing enzyme required for ceramide trafficking, keratinocyte differentiation, and epidermal permeability barrier formation.
Also flagged:Systemic Lupus ErythematosusDNASE1L3SLEsystemic autoimmune diseasepathogenesisautoantibody
Journal Article2023-03-31No SnippetsGerovska D, Araúzo-Bravo MJ.
Show Full Abstract
Cell-free (cf) extrachromosomal circular DNA (eccDNA) has a potential clinical application as a biomarker. Systemic lupus erythematosus (SLE) is a systemic autoimmune disease with a complex immunological pathogenesis, associated with autoantibody synthesis. A previous study found that SLE patients with deoxyribonuclease 1-like 3 (DNASE1L3) deficiency exhibit changes in the frequency of short and long eccDNA in plasma compared to controls. Here, using the DifCir method for differential analysis of short-read sequenced purified eccDNA data based on the split-read signal of the eccDNA on circulomics data, we show that SLE patients with DNASE1L3 deficiency have a distinctive profile of eccDNA excised by gene regions compared to controls. Moreover, this profile is specific; cf-eccDNA from the top 93 genes is detected in all SLE with DNASE1L3 deficiency samples, and none in the control plasma. The top protein coding gene producing eccDNA-carrying gene fragments is the transcription factor <i>BARX2,</i> which is involved in skeletal muscle morphogenesis and connective tissue development. The top gene ontology terms are 'positive regulation of torc1 signaling' and 'chondrocyte development'. The top Harmonizome terms are 'lymphopenia', 'metabolic syndrome x', 'asthma', 'cardiovascular system disease', 'leukemia', and 'immune system disease'. Here, we show that gene associations of cf-eccDNA can serve as a biomarker in the autoimmune rheumatic diseases.
Also flagged:Membranecoagulationfibrinogenthromboplastinhypofibrinogenaemiaglycocalyx
Journal Article2023-03-31✓ 5 SnippetsWorku ET, Win AM, Parmar D, Anstey C, Shekar K.
In-Text Gene Mentions
Discussion)
…an antithrombin III (ATIII) deficiency.…
Discussion)
…ATIIIis a plasma…
Discussion)
…ATIIIlevels are commonly…
Discussion)
…Replacement ofATIII(via concentrate or…
Discussion)
…to not measureATIIIlevels, as we…
Show Full Abstract
The temporal trends in haematological parameters and their associations with blood product transfusion requirements in patients supported with extracorporeal membrane oxygenation (ECMO) are poorly understood. We performed a retrospective data analysis to better understand the behaviour of haematological and coagulation parameters and their associations with transfusion requirements during ECMO.<h4>Methods</h4>Patient demographics, haematological and coagulation parameters, plasma haemoglobin and fibrinogen concentrations, platelet count, the international normalised ratio (INR), the activated partial thromboplastin time (APTT), and blood product transfusion data from 138 patients who received ECMO in a single high-volume centre were analysed.<h4>Results</h4>Ninety-two patients received venoarterial (VA) ECMO and 46 patients received venovenous (VV) ECMO. The median (IQR) duration of VA, and VV ECMO was 8 (5-13) days and 13 (8-23) days, respectively. There were significant reductions in haemoglobin, the platelet count, and the fibrinogen concentration upon initiation of ECMO. On average, over time, patients on VV ECMO had platelet counts 44 × 10<sup>9</sup>/L higher than those on VA ECMO (<i>p</i> ≤ 0.001). Fibrinogen and APTT did not vary significantly based on the mode of ECMO (<i>p</i> = 0.55 and <i>p</i> = 0.072, respectively). A platelet count < 50 × 10<sup>9</sup>/L or a fibrinogen level < 1.8 g/L was associated with 50% chance of PRBC transfusion, regardless of the ECMO type, and packed red blood cell (PRBC) transfusion was more common with VA ECMO. APTT was predictive of the transfusion requirement, and the decrement in APTT was discriminatory between VVECMO survivors and nonsurvivors.<h4>Conclusion</h4>ECMO support is associated with reductions in haemoglobin, platelet count, and fibrinogen. Patients supported with VA ECMO are more likely to receive a PRBC transfusion compared to those on VV ECMO. Thrombocytopaenia, hypofibrinogenaemia, and anticoagulation effect the likelihood of requiring PRBC transfusion. Further research is needed to define optimal blood management during ECMO, including appropriate transfusion triggers and the anticoagulation intensity.
Also flagged:Carbonnanomaterialsnanofibersextracellularcollagenhydroxyapatite
Journal Article2023-03-31No SnippetsDibazar ZE, Nie L, Azizi M, Nekounam H, Hamidi M, Shavandi A, Izadi Z, Delattre C.
Show Full Abstract
Bone tissue engineering integrates biomaterials, cells, and bioactive agents to propose sophisticated treatment options over conventional choices. Scaffolds have central roles in this scenario, and precisely designed and fabricated structures with the highest similarity to bone tissue have shown promising outcomes. On the other hand, using nanotechnology and nanomaterials as the enabling options confers fascinating properties to the scaffolds, such as precisely tailoring the physicochemical features and better interactions with cells and surrounding tissues. Among different nanomaterials, polymeric nanofibers and carbon nanofibers have attracted significant attention due to their similarity to bone extracellular matrix (ECM) and high surface-to-volume ratio. Moreover, bone ECM is a biocomposite of collagen fibers and hydroxyapatite crystals; accordingly, researchers have tried to mimic this biocomposite using the mineralization of various polymeric and carbon nanofibers and have shown that the mineralized nanofibers are promising structures to augment the bone healing process in the tissue engineering scenario. In this paper, we reviewed the bone structure, bone defects/fracture healing process, and various structures/cells/growth factors applicable to bone tissue engineering applications. Then, we highlighted the mineralized polymeric and carbon nanofibers and their fabrication methods.
Also flagged:Citric Acidpolyvinyl alcoholmembranescarboxylhydroxylmembrane
Journal Article2023-03-31No SnippetsHuang SM, Liu SM, Tseng HY, Chen WC.
Show Full Abstract
A series of electrospun polyvinyl alcohol (PVA) fiber membranes were crosslinked with citric acid (CA) at concentrations of 10, 20, and 30 wt.% (designated as CA10, CA20, and CA30). The effects of CA on the chemical structure, mechanical strength, swelling resistance, and cytotoxicity of the crosslinked PVA fibrous membranes were investigated. Infrared spectroscopy indicated the enhanced esterification of carboxyl and hydroxyl groups between CA and PVA. The modulus and strength of the electrospun PVA membrane increased due to the crosslinking between CA and PVA. The crosslinking of the PVA fiber matrix with CA increased the PVA binding point, thereby increasing the swelling resistance and modulus; however, the concentration of CA used was limited. Results showed that the water absorption of the PVA membranes decreased from 6.58 ± 0.04 g/g for CA10 to 3.56 ± 3.33 g/g for CA20 and 2.85 ± 0.40 g/g for CA30 with increasing CA. The water absorption remained unchanged after the membrane was soaked for a period of time, so no significant difference was found in the water absorption capacity of the same group after immersion from 1 h to 3 d. The tensile strength increased from 20.52 MPa of CA10 to 22.09 MPa of CA20. With an increased amount of CA used for crosslinking, the tensile strength and modulus of CA30 decreased to 11.48 and 13.94 MPa, respectively. Our study also showed that CA was not toxic to L929 cell viability when used for fiber crosslinking at less than 20 wt.% PVA, meaning it may be a good candidate as a support layer for guided tissue engineering.
Also flagged:major histocompatibility complexMHCcancersT-cell receptorCD4CD8
Journal Article2023-03-31✓ 2 SnippetsMa L, Feng Y, Zhou Z.
In-Text Gene Mentions
Introduction)
…(BTN) family membersBTN2A1and BTN3A1 (…
Introduction)
…BTN family proteins (BTN2A1/BTN3A1 and BTNL3/BTNL8), MHC-…
Show Full Abstract
Owing to their antitumor and major histocompatibility complex (MHC)-independent capacities, γδ T cells have gained popularity in adoptive T-cell immunotherapy in recent years. However, many unknowns still exist regarding γδ T cells, and few clinical data have been collected. Therefore, this review aims to describe all the main features of the applications of γδ T cells and provide a systematic view of current γδ T-cell immunotherapy. Specifically, this review will focus on how γδ T cells performed in treating cancers in clinics, on the γδ T-cell clinical trials that have been conducted to date, and the role of γδ T cells in the pharmaceutical industry.
Also flagged:CD4ovarian cancerOCgynecological cancercancerGene Expression
Journal Article2023-03-31✓ 1 SnippetHua T, Liu DX, Zhang XC, Li ST, Yan P, Zhao Q, Chen SB.
In-Text Gene Mentions
Results)
…UBB, SEC22B, TCEAL4,ECI2, OGN, CFI) (…
Show Full Abstract
<h4>Introduction</h4>It is believed that ovarian cancer (OC) is the most deadly form of gynecological cancer despite its infrequent occurrence, which makes it one of the most salient public health concerns. Clinical and preclinical studies have revealed that intratumoral CD4+ T cells possess cytotoxic capabilities and were capable of directly killing cancer cells. This study aimed to identify the CD4+ conventional T cells-related genes (CD4TGs) with respect to the prognosis in OC.<h4>Methods</h4>We obtained the transcriptome and clinical data from the Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. CD4TGs were first identified from single-cell datasets, then univariate Cox regression was used to screen prognosis-related genes, LASSO was conducted to remove genes with coefficient zero, and multivariate Cox regression was used to calculate riskscore and to construct the CD4TGs risk signature. Kaplan-Meier analysis, univariate Cox regression, multivariate Cox regression, time-dependent receiver operating characteristics (ROC), decision curve analysis (DCA), nomogram, and calibration were made to verify and evaluate the risk signature. Gene set enrichment analyses (GSEA) in risk groups were conducted to explore the tightly correlated pathways with the risk group. The role of riskscore has been further explored in the tumor microenvironment (TME), immunotherapy, and chemotherapy. A risk signature with 11 CD4TGs in OC was finally established in the TCGA database and furtherly validated in several GEO cohorts.<h4>Results</h4>High riskscore was significantly associated with a poorer prognosis and proven to be an independent prognostic biomarker by multivariate Cox regression. The 1-, 3-, and 5-year ROC values, DCA curve, nomogram, and calibration results confirmed the excellent prediction power of this model. Compared with the reported risk models, our model showed better performance. The patients were grouped into high-risk and low-risk subgroups according to the riskscore by the median value. The low-risk group patients tended to exhibit a higher immune infiltration, immune-related gene expression and were more sensitive to immunotherapy and chemotherapy.<h4>Discussion</h4>Collectively, our findings of the prognostic value of CD4TGs in prognosis and immune response, provided valuable insights into the molecular mechanisms and clinical management of OC.
Also flagged:MSMDdisseminated tuberculosistyphoid feverIL12RB1to mycobacterial diseaseerrors of immunity
Journal Article2023-03-31✓ 1 SnippetAbdelmajeed O, Ali MMD, Erwa NH, Mustafa A, Ahmed YA, Ahmed RHA, Mohammed HHE, Hassan ME, Ahmed M, Algam S.
In-Text Gene Mentions
Introduction)
…of CYBB andZNFX1defects that affect…
Show Full Abstract
<h4>Introduction</h4>Mendelian susceptibility to mycobacterial disease (MSMD) is a rare inherited condition characterized by selective susceptibility to weakly virulent mycobacteria, such as substrains of the bacille Calmette-Guérin (BCG) vaccine and different environmental mycobacteria.<h4>Case presentation</h4>A 7-year-old Sudanese boy was referred to the immunology clinic with a suspected diagnosis of MSMD. This followed multiple presentations with disseminated tuberculosis and typhoid fever. Genetic testing surprisingly revealed pathogenic homozygous variants in <i>IL12RB1</i> Exon 9, c.913A>T (p. Lys305*) in both the patient and his father, with a completely healthy asymptomatic carrier mother who is not blood related to the patient's father.<h4>Conclusion</h4>It is challenging to diagnose MSMD, especially in developing countries where health systems are poor and have limited resources. Family history and genetic tests may help in early MSMD treatment and avoiding disease complications.
Also flagged:strokedepressionpathogenesisischemic strokeISmajor depressive disorder
Journal Article2023-03-31No SnippetsYang Z, He M, Zhang Q, Li S, Chen H, Liao D.
Show Full Abstract
<b>Background:</b> Stroke and depression are the two most common causes of disability worldwide. Growing evidence suggests a bi-directional relationship between stroke and depression, whereas the molecular mechanisms underlying stroke and depression are not well understood. The objectives of this study were to identify hub genes and biological pathways related to the pathogenesis of ischemic stroke (IS) and major depressive disorder (MDD) and to evaluate the infiltration of immune cells in both disorders. <b>Methods:</b> Participants from the United States National Health and Nutritional Examination Survey (NHANES) 2005-2018 were included to evaluate the association between stroke and MDD. Two differentially expressed genes (DEGs) sets extracted from GSE98793 and GSE16561 datasets were intersected to generate common DEGs, which were further screened out in cytoHubba to identify hub genes. GO, KEGG, Metascape, GeneMANIA, NetworkAnalyst, and DGIdb were used for functional enrichment, pathway analysis, regulatory network analysis, and candidate drugs analysis. ssGSEA algorithm was used to analyze the immune infiltration. <b>Results:</b> Among the 29706 participants from NHANES 2005-2018, stroke was significantly associated with MDD (OR = 2.79,95% CI:2.26-3.43, <i>p</i> < 0.0001). A total of 41 common upregulated genes and eight common downregulated genes were finally identified between IS and MDD. Enrichment analysis revealed that the shared genes were mainly involved in immune response and immune-related pathways. A protein-protein interaction (PPI) was constructed, from which ten (CD163, AEG1, IRAK3, S100A12, HP, PGLYRP1, CEACAM8, MPO, LCN2, and DEFA4) were screened. In addition, gene-miRNAs, transcription factor-gene interactions, and protein-drug interactions coregulatory networks with hub genes were also identified. Finally, we observed that the innate immunity was activated while acquired immunity was suppressed in both disorders. <b>Conclusion:</b> We successfully identified the ten hub shared genes linking the IS and MDD and constructed the regulatory networks for them that could serve as novel targeted therapy for the comorbidities.
Also flagged:ExtracellularVesiclevesiclesproteinase KRNaseCD81
Journal Article2023-03-31No SnippetsShanthi KB, Fischer D, Sharma A, Kiviniemi A, Kaakinen M, Vainio SJ, Bart G.
Show Full Abstract
Astrocytes are central nervous system (CNS)-restricted glial cells involved in synaptic function and CNS blood flow regulation. Astrocyte extracellular vesicles (EVs) participate in neuronal regulation. EVs carry RNAs, either surface-bound or luminal, which can be transferred to recipient cells. We characterized the secreted EVs and RNA cargo of human astrocytes derived from an adult brain. EVs were isolated by serial centrifugation and characterized with nanoparticle tracking analysis (NTA), Exoview, and immuno-transmission electron microscopy (TEM). RNA from cells, EVs, and proteinase K/RNase-treated EVs was analyzed by miRNA-seq. Human adult astrocyte EVs ranged in sizes from 50 to 200 nm, with CD81 as the main tetraspanin marker and larger EVs positive for integrin β1. Comparison of the RNA between the cells and EVs identified RNA preferentially secreted in the EVs. In the case of miRNAs, enrichment analysis of their mRNA targets indicates that they are good candidates for mediating EV effects on recipient cells. The most abundant cellular miRNAs were also abundant in EVs, and the majority of their mRNA targets were found to be downregulated in mRNA-seq data, but the enrichment analysis lacked neuronal specificity. Proteinase K/RNase treatment of EV-enriched preparations identified RNAs secreted independently of EVs. Comparing the distribution of cellular and secreted RNA identifies the RNAs involved in intercellular communication via EVs.
Also flagged:SiliconeNosocomial infectionsbiofilm formationpoly-acrylic acidsilicone rubbercarboxylic acid
Journal Article2023-03-31No SnippetsElzahaby DA, Farrag HA, Haikal RR, Alkordi MH, Abdeltawab NF, Ramadan MA.
Show Full Abstract
Nosocomial infections caused by microbial biofilm formation on biomaterial surfaces such as urinary catheters are complicated by antibiotic resistance, representing a common problem in hospitalized patients. Therefore, we aimed to modify silicone catheters to resist microbial adherence and biofilm formation by the tested microorganisms. This study used a simple direct method to graft poly-acrylic acid onto silicone rubber films using gamma irradiation to endow the silicone surface with hydrophilic carboxylic acid functional groups. This modification allowed the silicone to immobilize ZnO nanoparticles (ZnO NPs) as an anti-biofilm. The modified silicone films were characterized by FT-IR, SEM, and TGA. The anti-adherence ability of the modified silicone films was evidenced by the inhibition of biofilm formation by otherwise strong biofilm-producing Gram-positive, Gram-negative, and yeast clinical isolates. The modified ZnO NPs grafted silicone showed good cytocompatibility with the human epithelial cell line. Moreover, studying the molecular basis of the inhibitory effect of the modified silicone surface on biofilm-associated genes in a selected Pseudomonas aeruginosa isolate showed that anti-adherence activity might be due to the significant downregulation of the expression of lasR, lasI, and lecB genes by 2, 2, and 3.3-fold, respectively. In conclusion, the modified silicone catheters were low-cost, offering broad-spectrum anti-biofilm activity with possible future applications in hospital settings.
Also flagged:Congenital Malformationsdevelopmental delayDDintellectual disabilityIDcognition
Journal Article2023-03-31No SnippetsKarim S, Hussein IR, Schulten HJ, Alsaedi S, Mirza Z, Al-Qahtani M, Chaudhary A.
Show Full Abstract
Chromosomal imbalance is implicated in developmental delay (DD), congenital malformations (CM), and intellectual disability (ID), and, thus, precise identification of copy number variations (CNVs) is essential. We therefore aimed to investigate the genetic heterogeneity in Saudi children with DD/CM/ID. High-resolution array comparative genomic hybridization (array CGH) was used to detect disease-associated CNVs in 63 patients. Quantitative PCR was done to confirm the detected CNVs. Giemsa banding-based karyotyping was also performed. Array CGH identified chromosomal abnormalities in 24 patients; distinct pathogenic and/or variants of uncertain significance CNVs were found in 19 patients, and aneuploidy was found in 5 patients including 47,XXY (n = 2), 45,X (n = 2) and a patient with trisomy 18 who carried a balanced Robertsonian translocation. CNVs including 9p24p13, 16p13p11, 18p11 had gains/duplications and CNVs, including 3p23p14, 10q26, 11p15, 11q24q25, 13q21.1q32.1, 16p13.3p11.2, and 20q11.1q13.2, had losses/deletions only, while CNVs including 8q24, 11q12, 15q25q26, 16q21q23, and 22q11q13 were found with both gains or losses in different individuals. In contrast, standard karyotyping detected chromosomal abnormalities in ten patients. The diagnosis rate of array CGH (28%, 18/63 patients) was around two-fold higher than that of conventional karyotyping (15.87%, 10/63 patients). We herein report, for the first time, the extremely rare pathogenic CNVs in Saudi children with DD/CM/ID. The reported prevalence of CNVs in Saudi Arabia adds value to clinical cytogenetics.
Also flagged:hypertensioncoronary artery diseasedeathcoronary heart diseasepolycythemia veraprimary proliferative polycythemia
Journal Article2023-03-31✓ 1 SnippetPiesanen J, Kunnas T, Nikkari ST.
In-Text Gene Mentions
Discussion)
…by the genesHFE, HJV, and BMP4…
Show Full Abstract
A 50-year-old cohort from the Tampere adult population cardiovascular risk study having hypertension and their controls were examined retrospectively at the age of 35 years, and followed up prospectively up to the age of 65 years to determine whether an early hematocrit (HCR) measurement predicts later hypertension or cardiovascular complications. A total of 307 subjects having hypertension and 579 non-hypertensive controls were chosen from the 50-year-old cohort and regrouped according to HCR values obtained when they were 35 years old, one with HCT < 45 % (n = 581), and the other, with HCT ≥ 45 % (n = 305). Hypertension and coronary artery disease (CAD) by the age of 60 years were determined by self-report and the National Hospital Discharge Registry. Outcomes for death up to the age of 65 years were collected from the National Statistics Centre. HCT ≥ 45 % at the age of 35 years associated with hypertension (p = 0.041) and CAD (P = 0.047) by the age of 60 years. When the subjects were followed up to the age of 65 years, HCT ≥ 45 % associated with premature cardiovascular death (P = 0.029), and death by any cause (P = 0.004). These results were obtained after adjusting for BMI-class recorded at 50 years of age. However, when outcome was also adjusted by gender, current smoking, vocational education, and state of one's health, association of the ≥ 45 % group with CAD and death was abolished. The association with hypertension remained (P = 0.007). In conclusion, there was a significant association of HCT ≥ 45 % at early middle age with subsequent hypertension.
Also flagged:glucoseoxygenperistalsisphotonsilver nanoparticlesGlucose oxidase
Journal Article2023-03-31No SnippetsYamanaka T, Arai F.
Show Full Abstract
This paper reports a new concept of a film-shaped micropump array for biomedical perfusion. The detailed concept, design, fabrication process, and performance evaluation using prototypes are described. In this micropump array, an open circuit potential (OCP) is generated by a planar biofuel cell (BFC), which in turn generates electro-osmotic flows (EOFs) in multiple through-holes arranged perpendicular to the micropump plane. The micropump array is thin and wireless, so it can be cut like postage stamps, easily installed in any small location, and can act as a planar micropump in solutions containing the biofuels glucose and oxygen. Perfusion at local sites are difficult with conventional techniques using multiple separate components such as micropumps and energy sources. This micropump array is expected to be applied to the perfusion of biological fluids in small locations near or inside cultured cells, cultured tissues, living organisms, and so on.
Also flagged:Obesitymetabolic disorderscholesterolmetabolismdigestionglycerolipid
Journal Article2023-03-31✓ 2 SnippetsPrabhakar L, Davis G DJ.
In-Text Gene Mentions
Discussion)
…the downregulated genes,PLCL1(Lipase) with a…
Discussion)
…PLCL1was reported for…
Show Full Abstract
Obesity is a global crisis leading to several metabolic disorders. Modernization and technology innovation has been easier for next generation sequencing using open-source online software galaxy, which allows the users to share their data and workflow mapping in an effortless manner. This study is to identify candidate genes for obesity by performing differential expression of genes. RNA-Seq analysis was performed for six different datasets retrieved from GEO database. 258 datasets from obese patients and 55 datasets from lean patients were analysed for differentially expressed genes (DEGs). DEGs analysis showed 1971 upregulated genes and 615 downregulated genes with log2FC count ≥ 2.5 and p-value < 0.05. The Gene enrichment analysis performed using Gene Ontology resource highlighted pathways associated to obesity such as cholesterol metabolism, Fat digestion and absorption and glycerolipid metabolism. Using string database protein-protein interactions network was built and the network clusters were visualized using Cytoscape software. The protein-protein interactions of the upregulated and downregulated genes were mapped to form a network, wherein PNLIP (Pancreatic lipase) and FTO (Fat mass and obesity associated protein) gene clusters were visualized as densely connected clusters in MCODE. PNLIP and FTO with its associated genes were identified as candidate genes for targeting obesity.
SSRN2023-03-31Preprint (No Snippets API)Hermans L, Kostka T, Vassallo D.
Show Full Abstract
We study the effects of low short-term interest rates on the optimal portfolio allocation in Markowitz portfolios and Risk parity portfolios. We propose a measure of Portfolio Instabil-ity, gauging the amount of optimal portfolio shifts needed to respond to exogenous shocks to the expected risk and return of the risky portfolio assets. Portfolio Instability, i.e. the selling pressure on riskier asset holdings, is found to be stronger the lower the risk-free interest rate. Heightened portfolio instability in the presence of low rates is found to emerge through two channels both of which incentivise the build-up of large and leveraged risky asset shares during calm periods which need to be unwound in the event of higher market volatility: first, low rates (mechanically) augment the excess return to be gained by investing in riskier assets and second, they are found to dampen volatility of riskier assets in the portfolio. The inverse relationship between portfolio instability and the risk-free rates is found to increase the closer the risk-free rate approaches the effective lower bound. Counterfactual analyses of the behaviour of optimal multi-asset portfolios demonstrate that the sell-off in riskier asset classes during the Covid crisis in March 2020 was more severe than would have been in the presence of higher short-term interest rates.
Also flagged:geriatric diseasemyogenesisTSG101sarcopeniaExtracellular Vesiclesextracellular
Journal Article2023-03-30✓ 1 SnippetDai H, Luo J, Deng L, Song C, Deng Z, Wu Y, Gu S, Xu J.
In-Text Gene Mentions
Discussion)
…ESCs by spongingSox6, which was contrary…
Show Full Abstract
Sarcopenia is a geriatric disease characterized by reduced muscle function and mass. The capacity to self-renew and myogenesis of satellite cells (SCs) declines with age, resulting in age-related sarcopenia. MicroRNAs (miRNAs) can regulate the proliferation and myogenesis of SCs. In this study, it is identified that miR-467a-3p and miR-874-5p could respectively mediate the stemness and myogenesis of SCs by performing bioinformatics analysis. AntagomiR-467a-3p (ant-467a) and antagomiR-874-5p (ant-874) improve the stemness and myogenesis of SCs, respectively. SC-targeting extracellular vesicles (EVs) are constructed by overexpressing TSG101 on the surface of EVs isolated from bone marrow mesenchymal stem cells. Ant-467a loaded EVs (EVs-467a) and ant-874 loaded EVs (EVs-874) are prepared by transferring ant-467a and ant-874 into SC-targeting EVs. EVs-467a and EVs-874 are more effective than ant-467a and ant-874 in promoting the stemness and myogenesis of SCs. Sequentially intermuscular injection of EVs-467a and EVs-874 significantly improve sarcopenia in ovariectomy mice. The effects of multiple injections of EVs-467a and EVs-874 in the treatment of sarcopenia could be achieved by using a hierarchically injectable hydrogel to sustainedly release EVs-467a and EVs-874 in vivo. The findings provide an EV-based SC-targeting antagomiRNAs controlled release strategy as a novel therapy against sarcopenia.
Also flagged:methylationcardiovascular diseasedeathCVDsynthesiscytosine
Journal Article2023-03-30No SnippetsKrolevets M, Cate VT, Prochaska JH, Schulz A, Rapp S, Tenzer S, Andrade-Navarro MA, Horvath S, Niehrs C, Wild PS.
Show Full Abstract
<h4>Background</h4>Cardiovascular disease (CVD) is the leading cause of death worldwide and considered one of the most environmentally driven diseases. The role of DNA methylation in response to the individual exposure for the development and progression of CVD is still poorly understood and a synthesis of the evidence is lacking.<h4>Results</h4>A systematic review of articles examining measurements of DNA cytosine methylation in CVD was conducted in accordance with PRISMA (preferred reporting items for systematic reviews and meta-analyses) guidelines. The search yielded 5,563 articles from PubMed and CENTRAL databases. From 99 studies with a total of 87,827 individuals eligible for analysis, a database was created combining all CpG-, gene- and study-related information. It contains 74,580 unique CpG sites, of which 1452 CpG sites were mentioned in ≥ 2, and 441 CpG sites in ≥ 3 publications. Two sites were referenced in ≥ 6 publications: cg01656216 (near ZNF438) related to vascular disease and epigenetic age, and cg03636183 (near F2RL3) related to coronary heart disease, myocardial infarction, smoking and air pollution. Of 19,127 mapped genes, 5,807 were reported in ≥ 2 studies. Most frequently reported were TEAD1 (TEA Domain Transcription Factor 1) and PTPRN2 (Protein Tyrosine Phosphatase Receptor Type N2) in association with outcomes ranging from vascular to cardiac disease. Gene set enrichment analysis of 4,532 overlapping genes revealed enrichment for Gene Ontology molecular function "DNA-binding transcription activator activity" (q = 1.65 × 10<sup>-11</sup>) and biological processes "skeletal system development" (q = 1.89 × 10<sup>-23</sup>). Gene enrichment demonstrated that general CVD-related terms are shared, while "heart" and "vasculature" specific genes have more disease-specific terms as PR interval for "heart" or platelet distribution width for "vasculature." STRING analysis revealed significant protein-protein interactions between the products of the differentially methylated genes (p = 0.003) suggesting that dysregulation of the protein interaction network could contribute to CVD. Overlaps with curated gene sets from the Molecular Signatures Database showed enrichment of genes in hemostasis (p = 2.9 × 10<sup>-6</sup>) and atherosclerosis (p = 4.9 × 10<sup>-4</sup>).<h4>Conclusion</h4>This review highlights the current state of knowledge on significant relationship between DNA methylation and CVD in humans. An open-access database has been compiled of reported CpG methylation sites, genes and pathways that may play an important role in this relationship.
Also flagged:autophagyagingage-related diseasesage-related illnessescancerneurodegenerative diseases
Journal Article2023-03-30✓ 1 SnippetTaban Akça K, Çınar Ayan İ, Çetinkaya S, Miser Salihoğlu E, Süntar İ.
In-Text Gene Mentions
S I O 001029)
…91). In patients with HD, an abnormally long polyglutamine-encoding CAG trinucleotide expansion produces perinuclear cytoplasmic aggregates and intranuclear inclusions. This results in mutant Htt, an autophagic substrate, ingestion of defective autophagic substrate into autophagosomes. In addition, this expansion of polyglutamine causes misfolded proteins or accumulation of protein aggregates. Deletion of polyglutamine in the Htt gene has been shown to improve disease symptoms and increase autophagosome formation (Ref. 92). In addition, the decrease in Beclin-1 expression with aging may lead to the accumulation of mutant Htt (Ref. 93). It has also been reported that the mTOR pathway plays a role in HD pathology. In a recent study, they identified the Homeodomain Interacting Protein Kinase 3 (HIPK3) gene as a negative modulator of autophagy and a positive regulator of mHtt expression levels in HD cells. It is considered that modulation of mHtt by HIPK3 can be a therapeutic target for HD (Ref. 94). Stimulation of autophagy usually occurs by inhibition of mTOR. However, since mTOR is involved in many cellular processes, its inhibition can lead to unexpected effects. Walter et al. showed that AMPK activation causes increased expression of LC3-II and p62, and induced autophagy in an mTOR-independent manner. This resulted in decreased aggregates containing mHtt and cell viability (Ref. 95).…
Show Full Abstract
The term 'autophagy' literally translates to 'self-eating' and alterations to autophagy have been identified as one of the several molecular changes that occur with aging in a variety of species. Autophagy and aging, have a complicated and multifaceted relationship that has recently come to light thanks to breakthroughs in our understanding of the various substrates of autophagy on tissue homoeostasis. Several studies have been conducted to reveal the relationship between autophagy and age-related diseases. The present review looks at a few new aspects of autophagy and speculates on how they might be connected to both aging and the onset and progression of disease. Additionally, we go over the most recent preclinical data supporting the use of autophagy modulators as age-related illnesses including cancer, cardiovascular and neurodegenerative diseases, and metabolic dysfunction. It is crucial to discover important targets in the autophagy pathway in order to create innovative therapies that effectively target autophagy. Natural products have pharmacological properties that can be therapeutically advantageous for the treatment of several diseases and they also serve as valuable sources of inspiration for the development of possible new small-molecule drugs. Indeed, recent scientific studies have shown that several natural products including alkaloids, terpenoids, steroids, and phenolics, have the ability to alter a number of important autophagic signalling pathways and exert therapeutic effects, thus, a wide range of potential targets in various stages of autophagy have been discovered. In this review, we summarised the naturally occurring active compounds that may control the autophagic signalling pathways.
Also flagged:rotavirus infectionantibodiesgene expressionIgGIFN-γsecretion
Journal Article2023-03-30No SnippetsZhou Y, Wu J, Hu X, Chen R, Lin X, Yin N, Lu C, Ye J, Zhao Y, Song X, Song Z, Wang J, Li Y, Li J, Zhang G, Sun M, Li H.
Show Full Abstract
Rotavirus is one of the main pathogens causing severe diarrhea in infants and young children < 5 years of age. The development of the next-generation rotavirus vaccine is of great significance for preventing rotavirus infection and reducing severe mortality. The current study aimed to develop and evaluate the immunogenicity of inactivated rotavirus vaccine (IRV) in rhesus monkeys. Monkeys received two or three IRV injections intramuscularly at a 4-week interval. Neutralizing antibodies, cellular immunity, PBMC gene expression profiling, and immune persistence were evaluated. Three-dose immunization of IRV induced a higher level of neutralizing, IgG and IgA antibodies compared to two-dose immunization. IRV induced IFN-γ secretion to mediate cellular immune responses, including robust pro-inflammatory and antiviral responses. Chemokine-mediated signaling pathways and immune response were broadly activated by IRV injection. The IRV-induced neutralizing antibodies resulting from two doses returned to baseline levels 20 weeks after full immunization, while those resulting from three doses returned to baseline levels 44 weeks after full immunization. Increasing immunization dose and injection number will help to improve IRV immunogenicity and neutralizing antibody persistence.
Also flagged:pine wilt diseaseinfectionextracellularresilin-like mucinoxygeninfections
Journal Article2023-03-30No SnippetsTang X, Zhou J, Koski TM, Liu S, Zhao L, Sun J.
Show Full Abstract
Many pathogens rely on their insect vectors for transmission. Such pathogens are under selection to improve vector competence for their transmission by employing various tissue or cellular responses of vectors. However, whether pathogens can actively cause hypoxia in vectors and exploit hypoxia responses to promote their vector competence is still unknown. Fast dispersal of pinewood nematode (PWN), the causal agent for the destructive pine wilt disease and subsequent infection of pine trees, is characterized by the high vector competence of pine sawyer beetles (<i>Monochamus</i> spp.), and a single beetle can harbor over 200,000 PWNs in its tracheal system. Here, we demonstrate that PWN loading activates hypoxia in tracheal system of the vector beetles. Both PWN loading and hypoxia enhanced tracheal elasticity and thickened the apical extracellular matrix (aECM) of the tracheal tubes while a notable upregulated expression of a resilin-like mucin protein Muc91C was observed at the aECM layer of PWN-loaded and hypoxic tracheal tubes. RNAi knockdown of <i>Muc91C</i> reduced tracheal elasticity and aECM thickness under hypoxia conditions and thus decreasing PWN loading. Our study suggests a crucial role of hypoxia-induced developmental responses in shaping vector tolerance to the pathogen and provides clues for potential molecular targets to control pathogen dissemination.
Also flagged:ProteolysisE3 ubiquitin ligasesubiquitindegradationE3 ligasesof apoptosis
Journal Article2023-03-30No SnippetsNg YLD, Bricelj A, Jansen JA, Murgai A, Peter K, Donovan KA, Gütschow M, Krönke J, Steinebach C, Sosič I.
Show Full Abstract
Proteolysis targeting chimeras (PROTACs) represent a new pharmacological modality to inactivate disease-causing proteins. PROTACs operate via recruiting E3 ubiquitin ligases, which enable the transfer of ubiquitin tags onto their target proteins, leading to proteasomal degradation. However, several E3 ligases are validated pharmacological targets themselves, of which inhibitor of apoptosis (IAP) proteins are considered druggable in cancer. Here, we report three series of heterobifunctional PROTACs, which consist of an IAP antagonist linked to either von Hippel-Lindau- or cereblon-recruiting ligands. Hijacking E3 ligases against each other led to potent, rapid, and preferential depletion of cellular IAPs. In addition, these compounds caused complete X-chromosome-linked IAP knockdown, which was rarely observed for monovalent and homobivalent IAP antagonists. In cellular assays, hit degrader <b>9</b> outperformed antagonists and showed potent inhibition of cancer cell viability. The hetero-PROTACs disclosed herein are valuable tools to facilitate studies of the biological roles of IAPs and will stimulate further efforts toward E3-targeting therapies.
Also flagged:Acute Myeloid LeukemiaKMT2AAMLgemtuzumab ozogamicinmyeloid leukemiaDown syndrome
Journal Article2023-03-30✓ 1 Snippetvan Weelderen RE, Klein K, Harrison CJ, Jiang Y, Abrahamsson J, Arad-Cohen N, Bart-Delabesse E, Buldini B, De Moerloose B, Dworzak MN, Elitzur S, Fernández Navarro JM, Gerbing RB, Goemans BF, de Groot-Kruseman HA, Guest E, Ha SY, Hasle H, Kelaidi C, Lapillonne H, Leverger G, Locatelli F, Masetti R, Miyamura T, Norén-Nyström U, Polychronopoulou S, Rasche M, Rubnitz JE, Stary J, Tierens A, Tomizawa D, Zwaan CM, Kaspers GJL.
In-Text Gene Mentions
Methods)
…), 10p12 ( KMT2A::MLLT10), 10p11.2 (…
Show Full Abstract
<h4>Purpose</h4>A previous study by the International Berlin-Frankfurt-Münster Study Group (I-BFM-SG) on childhood <i>KMT2A</i>-rearranged (<i>KMT2A</i>-r) AML demonstrated the prognostic value of the fusion partner. This I-BFM-SG study investigated the value of flow cytometry-based measurable residual disease (flow-MRD) and evaluated the benefit of allogeneic stem-cell transplantation (allo-SCT) in first complete remission (CR1) in this disease.<h4>Methods</h4>A total of 1,130 children with <i>KMT2A</i>-r AML, diagnosed between January 2005 and December 2016, were assigned to high-risk (n = 402; 35.6%) or non-high-risk (n = 728; 64.4%) fusion partner-based groups. Flow-MRD levels at both end of induction 1 (EOI1) and 2 (EOI2) were available for 456 patients and were considered negative (<0.1%) or positive (≥0.1%). End points were 5-year event-free survival (EFS), cumulative incidence of relapse (CIR), and overall survival (OS).<h4>Results</h4>The high-risk group had inferior EFS (30.3% high risk <i>v</i> 54.0% non-high risk; <i>P</i> < .0001), CIR (59.7% <i>v</i> 35.2%; <i>P</i> < .0001), and OS (49.2% <i>v</i> 70.5%; <i>P</i> < .0001). EOI2 MRD negativity was associated with superior EFS (n = 413; 47.6% MRD negativity <i>v</i> n = 43; 16.3% MRD positivity; <i>P</i> < .0001) and OS (n = 413; 66.0% <i>v</i> n = 43; 27.9%; <i>P</i> < .0001), and showed a trend toward lower CIR (n = 392; 46.1% <i>v</i> n = 26; 65.4%; <i>P</i> = .016). Similar results were obtained for patients with EOI2 MRD negativity within both risk groups, except that within the non-high-risk group, CIR was comparable with that of patients with EOI2 MRD positivity. Allo-SCT in CR1 only reduced CIR (hazard ratio, 0.5 [95% CI, 0.4 to 0.8]; <i>P</i> = .00096) within the high-risk group but did not improve OS. In multivariable analyses, EOI2 MRD positivity and high-risk group were independently associated with inferior EFS, CIR, and OS.<h4>Conclusion</h4>EOI2 flow-MRD is an independent prognostic factor and should be included as risk stratification factor in childhood <i>KMT2A</i>-r AML. Treatment approaches other than allo-SCT in CR1 are needed to improve prognosis.
Also flagged:retrotransposonsSCN8ACDK5RAP2transposonsneurodevelopmental diseasemicrocephaly
Journal Article2023-03-30✓ 5 SnippetsNadler MJS, Chang W, Ozkaynak E, Huo Y, Nong Y, Boillot M, Johnson M, Moreno A, Matthew P Anderson.
In-Text Gene Mentions
Results)
…Dominantly inherited mutations of huntingtin (HTT) that expand a poly-glutamine tract in exon 1 of the HTT protein underlie the neurological disorder Huntingtin’s disease (HD)37 with degeneration of medium spiny neurons of the striatum, motor deficits, and impaired cognitive executive functioning37.…
Results)
…We then crossed these SVA-lncRNA AK057321 transgenic mice to mice containing the human HTT transgene (carried in yeast artificial chromosome vector and bearing an HD model mutation, YAC128 mice39).…
Abstract)
…intronic SVAs (e.g.,HTT, CHAF1B and…
Methods)
…involving human mutantHTTtransgenic and matched…
Results)
…HTTmRNA is expressed…
Show Full Abstract
SINE-VNTR-Alu (SVA) retrotransposons arose and expanded in the genome of hominoid primates concurrent with the slowing of brain maturation. We report genes with intronic SVA transposons are enriched for neurodevelopmental disease and transcribed into long non-coding SVA-lncRNAs. Human-specific SVAs in microcephaly CDK5RAP2 and epilepsy SCN8A gene introns repress their expression via transcription factor ZNF91 to delay neuronal maturation. Deleting the SVA in CDK5RAP2 initiates multi-dimensional and in SCN8A selective sodium current neuronal maturation by upregulating these genes. SVA-lncRNA AK057321 forms RNA:DNA heteroduplexes with the genomic SVAs and upregulates these genes to initiate neuronal maturation. SVA-lncRNA AK057321 also promotes species-specific cortex and cerebellum-enriched expression upregulating human genes with intronic SVAs (e.g., HTT, CHAF1B and KCNJ6) but not mouse orthologs. The diversity of neuronal genes with intronic SVAs suggest this hominoid-specific SVA transposon-based gene regulatory mechanism may act at multiple steps to specialize and achieve neoteny of the human brain.
Also flagged:TGR5PKAc-FLIPJNKdextran sulfate sodiumulcerative colitis
Journal Article2023-03-30✓ 1 SnippetYang WJ, Han FH, Gu YP, Qu H, Liu J, Shen JH, Leng Y.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
Excessive apoptosis of intestinal epithelial cell (IEC) is a crucial cause of disrupted epithelium homeostasis, leading to the pathogenesis of ulcerative colitis (UC). The regulation of Takeda G protein-coupled receptor-5 (TGR5) in IEC apoptosis and the underlying molecular mechanisms remained unclear, and the direct evidence from selective TGR5 agonists for the treatment of UC is also lacking. Here, we synthesized a potent and selective TGR5 agonist OM8 with high distribution in intestinal tract and investigated its effect on IEC apoptosis and UC treatment. We showed that OM8 potently activated hTGR5 and mTGR5 with EC<sub>50</sub> values of 202 ± 55 nM and 74 ± 17 nM, respectively. After oral administration, a large amount of OM8 was maintained in intestinal tract with very low absorption into the blood. In DSS-induced colitis mice, oral administration of OM8 alleviated colitis symptoms, pathological changes and impaired tight junction proteins expression. In addition to enhancing intestinal stem cell (ISC) proliferation and differentiation, OM8 administration significantly reduced the rate of apoptotic cells in colonic epithelium in colitis mice. The direct inhibition by OM8 on IEC apoptosis was further demonstrated in HT-29 and Caco-2 cells in vitro. In HT-29 cells, we demonstrated that silencing TGR5, inhibition of adenylate cyclase or protein kinase A (PKA) all blocked the suppression of JNK phosphorylation induced by OM8, thus abolished its antagonizing effect against TNF-α induced apoptosis, suggesting that the inhibition by OM8 on IEC apoptosis was mediated via activation of TGR5 and cAMP/PKA signaling pathway. Further studies showed that OM8 upregulated cellular FLICE-inhibitory protein (c-FLIP) expression in a TGR5-dependent manner in HT-29 cells. Knockdown of c-FLIP blocked the inhibition by OM8 on TNF-α induced JNK phosphorylation and apoptosis, suggesting that c-FLIP was indispensable for the suppression of OM8 on IEC apoptosis induced by OM8. In conclusion, our study demonstrated a new mechanism of TGR5 agonist on inhibiting IEC apoptosis via cAMP/PKA/c-FLIP/JNK signaling pathway in vitro, and highlighted the value of TGR5 agonist as a novel therapeutic strategy for the treatment of UC.
Also flagged:AVPR2head and neck squamous cell carcinomahead and neck squamous cell carcinomaHNSCCGene Expressiontumour
Journal Article2023-03-30No SnippetsMao L, Pan Z, Chen W, Hu W, Chen X, Dai H.
Show Full Abstract
<h4>Purpose</h4>To explore the potential of AVPR2 in the immunotherapy of head and neck squamous cell carcinoma (HNSCC), thus providing insights into a novel antitumour strategy.<h4>Methods</h4>In this study, we performed a comprehensive analysis of the AVPR2 gene in HNSCC using public datasets from The Cancer Genome Atlas and Gene Expression Omnibus. We explored the potential molecular mechanism of HNSCC in clinical prognosis and tumour immunity from the aspects of gene expression, prognosis, immune subtypes, and immune infiltration.<h4>Results</h4>AVPR2 expression was significantly downregulated in primary HNSCC tissue compared with normal tissue. HNSCC patients with high AVPR2 expression had a better prognosis. Moreover, the results of GSEA showed that immune subtype surface AVPR2 is involved in immune modulation. Furthermore, significant strong correlations between AVPR2 expression and infiltrating immune cells existed in HNSCC, and marker genes of infiltrating immune cells were also significantly related to AVPR2 expression in HNSCC. These results suggest that AVPR2 expression can influence the infiltration of tumour immune cells. Finally, we found that only high levels of B-cell infiltration, rather than those of other immune cells, can predict a longer overall survival in patients with HNSCC. Future studies are needed to explore the role of AVPR2 and tumour-infiltrating B cells in HNSCC.<h4>Conclusions</h4>The AVPR2 gene may be a prognostic biomarker of HNSCC. Moreover, AVPR2 may play a role in HNSCC immune modulation, and the regulation of tumour-infiltrating B cells by AVPR2 may be a key link.
Also flagged:semaglutidewaterNeurofilament light chainNeurofilament heavy chainNEFHphosphorylation
Journal Article2023-03-30✓ 5 SnippetsChen X, Ma L, Gan K, Pan X, Chen S.
In-Text Gene Mentions
Discussion)
…The proteins associated with these neuroprotective effects (HTT, NEFH and NEFL) are potential drug targets for the treatment of obesity-induced cognitive impairment with semaglutide.…
Discussion)
…In conclusion, this study demonstrates for the first time that semaglutide can maintain normal neurocytoskeletal structure, promote axonal growth and neurogenesis by downregulating the phosphorylation of HTT Ser1843 and NEFH Ser 661, and upregulating the phosphorylation of NEFL Ser473 thereby reducing the risk of developing obesity-induced cognitive impairment.…
Discussion)
…HTTis a macromolecular…
Discussion)
…embryonic death andHttgene knock out…
Discussion)
…Wild-typeHttexerts anti-apoptotic effects…
Show Full Abstract
The aim of this paper was to investigate the effects of semaglutide on phosphorylated protein expression, and its neuroprotective mechanism in hippocampi of high-fat-diet-induced obese mice. In total, 16 obese mice were randomly divided into model group (H group) and semaglutide group (S group), with 8 mice in each group. In addition, a control group (C group) was set up comprising 8 C57BL/6J male normal mice. The Morris water maze assay was conducted to detect cognitive function changes in the mice, and to observe and compare body weight and expression levels of serological indicators between groups after the intervention. Phosphorylated proteomic analysis was performed to detect the hippocampal protein profile in mice. Proteins up-regulated twofold or down-regulated 0.5-fold in each group and with t-test p < 0.05 were defined as differentially phosphorylated proteins and were analyzed bioinformatically. The results showed that the high-fat diet-induced obese mice had reduced body weight, improved oxidative stress indexes, significantly increased the percentage of water maze trips and the number of platform crossings, and significantly shortened the water maze platform latency after semaglutide intervention. The phosphorylated proteomics results identified that 44 overlapping proteins among the three experimental groups. Most of the phosphorylated proteins identified were closely associated with pathways of neurodegeneration-multiple diseases. In addition, we identified Huntington, Neurofilament light chain, Neurofilament heavy chain as drug targets. This study demonstrates for the first time that semaglutide exerts neuroprotective effects by reducing HTT Ser1843, NEFH Ser 661 phosphorylation and increasing NEFL Ser 473 phosphorylation in hippocampal tissue of obese mice.
Also flagged:Chronic hepatitis BironBtransaminasehereditary hemochromatosishepatitis B surface antigen
Journal Article2023-03-30✓ 5 SnippetsYe Y, Xie J, Wang L, He C, Tan Y.
In-Text Gene Mentions
Title)
…complicated with secondaryhemochromatosiswas cured clinically:…
Abstract)
…causes severe secondaryhemochromatosis(SH).…
Abstract)
…the presence ofhemochromatosis.…
Abstract)
…Improvements inhemochromatosismay promote HBsAg…
Abstract)
…patient’s medical history,hemochromatosiswas believed to…
Show Full Abstract
Chronic hepatitis B (CHB) often causes iron overload in the liver but rarely causes severe secondary hemochromatosis (SH). A 48-year-old man was infected with CHB via vertical transmission. For 21 years, nonstandard treatment with second-line hepatitis B antiviral drugs has been administered. Repeated abnormalities in the liver transaminase function and continuous low-level replication of the hepatitis B virus (HBV) have been detected. The skin had turned black 5 years back. Biochemical tests and imaging revealed the presence of hemochromatosis. A liver biopsy suggested severe iron overload. Two genetic tests ruled out hereditary hemochromatosis. The patient was diagnosed with SH and treated with 400 ml bloodletting once per week and an iron-chelating agent. After 12 weeks, liver function was normal, and the skin turned white. First, hepatitis B surface antigen (HBsAg) was lost, and HBV DNA was copied at low levels. The patient was diagnosed with an occult hepatitis B infection. HBV DNA was undetectable after 4 weeks of antiviral treatment with tenofovir. Upon reviewing the patient's medical history, hemochromatosis was believed to be related to CHB with chronic inflammatory damage and no complete virological response. Improvements in hemochromatosis may promote HBsAg disappearance.
Also flagged:TumorHead and Neck Squamous Cell CarcinomacancercancersHNSCCHead and Neck Squamous Cell Carcinomas
Journal Article2023-03-30✓ 2 SnippetsBrandt A, Thiele B, Schultheiß C, Daetwyler E, Binder M.
In-Text Gene Mentions
Methods)
…The degree of methylation of the markers PAX5, Endothelin Receptor β (EDNRB), and Deleted in Colorectal Cancer (DCC) was studied in HNSCC biopsies and corresponding pretreatment oral rinses [143].…
Methods)
…in Colorectal Cancer (DCC) was studied in…
Show Full Abstract
Tumors shed cell-free DNA (cfDNA) into the plasma. "Liquid biopsies" are a diagnostic test to analyze cfDNA in order to detect minimal residual cancer, profile the genomic tumor landscape, and monitor cancers non-invasively over time. This technique may be useful in patients with head and neck squamous cell carcinoma (HNSCC) due to genetic tumor heterogeneity and limitations in imaging sensitivity. However, there are technical challenges that need to be overcome for the widespread use of liquid biopsy in the clinical management of these patients. In this review, we discuss our current understanding of HNSCC genetics and the role of cfDNA genomic analyses as an emerging precision diagnostic tool.
Also flagged:Ischemic CardiomyopathyCOVID-19pathogenesisTranscription factorangiogenesisKLF9
Journal Article2023-03-30✓ 1 SnippetLuo S, Zhang X, Xiao X, Luo W, Yang Z, Tang S, Huang W.
In-Text Gene Mentions
Results)
…GTF2E2, MYC, andZNF644.…
Show Full Abstract
Cardiovascular complications combined with COVID-19 (SARS-CoV-2) lead to a poor prognosis in patients. The common pathogenesis of ischemic cardiomyopathy (ICM) and COVID-19 is still unclear. Here, we explored potential molecular mechanisms and biomarkers for ICM and COVID-19. Common differentially expressed genes (DEGs) of ICM (GSE5406) and COVID-19 (GSE164805) were identified using GEO2R. We performed enrichment and protein-protein interaction analyses and screened key genes. To confirm the diagnostic performance for these hub genes, we used external datasets (GSE116250 and GSE211979) and plotted ROC curves. Transcription factor and microRNA regulatory networks were constructed for the validated hub genes. Finally, drug prediction and molecular docking validation were performed using cMAP. We identified 81 common DEGs, many of which were enriched in terms of their relation to angiogenesis. Three DEGs were identified as key hub genes (<i>HSP90AA1</i>, <i>HSPA9</i>, and <i>SRSF1</i>) in the protein-protein interaction analysis. These hub genes had high diagnostic performance in the four datasets (AUC > 0.7). Mir-16-5p and KLF9 transcription factor co-regulated these hub genes. The drugs vindesine and ON-01910 showed good binding performance to the hub genes. We identified <i>HSP90AA1</i>, <i>HSPA9</i>, and <i>SRSF1</i> as markers for the co-pathogenesis of ICM and COVID-19, and showed that co-pathogenesis of ICM and COVID-19 may be related to angiogenesis. Vindesine and ON-01910 were predicted as potential therapeutic agents. Our findings will contribute to a deeper understanding of the comorbidity of ICM with COVID-19.
Also flagged:Tuberous Sclerosis Complexneurocutaneous disorderhamartomastumorsprimary microcephalyintellectual disability
Journal Article2023-03-30No SnippetsPraticò AD, Falsaperla R, Comella M, Belfiore G, Polizzi A, Ruggieri M.
Show Full Abstract
Mutations of <i>TSC1</i> and <i>TSC2</i> genes cause classical Tuberous Sclerosis Complex (TSC), a neurocutaneous disorder characterized by a tendency to develop hamartias, hamartomas, and other tumors. We herein report on a girl, now aged 5 years, who presented a previously unreported, distinct clinical phenotype consisting of primary microcephaly (head circumference = 40 cm, -5.6 standard deviations), brain anomalies including hypoplasia of the corpus callosum (with a residual draft of the genu), simplified parieto-temporal gyral pattern, colpocephaly with ectasia of the temporal ventricular horns, intellectual disability, and a general pattern of reduced growth (with weight and height < 3rd centiles). No classical features of TSC were recorded; the girl harbored a novel missense variant in <i>TSC1</i> (c.611G > A). We hypothesize that her clinical phenotype could be related to a "gain-of-function" of the <i>TSC1</i> protein product hamartin, causing an increase in the effects of the protein on inhibition of its intracellular targets (i.e., mTORC or RAC1 pathways), resulting in a distinct "inverse <i>TSC1</i>-hamartin" phenotype characterized by reduced growth of cells instead of the more classical predisposition to increased cell growth.
Ferroptosis, a novel type of regulated cell death mediated by iron-dependent lipid oxidation, was discovered a decade ago. Significant progress has been made in our knowledge of ferroptosis and immune dysfunction. This review covers recent advancements in the interaction of ferroptosis and the immune system, with an emphasis on autoimmune diseases. The critical regulators of ferroptosis are summarized in the context of reactive oxygen species biology, lipid metabolism, and iron homeostasis. The molecular crosstalk between ferroptosis and different immune cells is also highlighted. Future research is expected to yield new insights into the mechanisms governing ferroptosis and its potential therapeutic benefits in autoimmune diseases.
Libman-Sacks endocarditis accounts for 6-11 percent of systemic lupus erythematosus patients and is associated with varying degrees of valvular dysfunction, increased risk for stroke and transient ischemic attacks, and increased mortality. In previous studies, left-sided valvular Libman-Sacks vegetations were more frequently detected than right sided vegetations; reported cases of bilateral involvement is very rare. A comprehensive clinical assessment and the multimodality imaging is of utmost importance in the management of systemic lupus erythematosus. In this case report, we describe a 31-year-old female patient with uncontrolled systemic lupus erythematosus initially presented with gastrointestinal symptoms but eventually had a vegetation-like structure on the posterior leaflet of the mitral valve which was revealed during routine echocardiography. Two-dimensional/three-dimensional transthoracic and transesophageal echocardiography, cardiac magnetic resonance, and cardiac computed tomography further characterized the mitral valve vegetation and revealed an additional vegetation of the pulmonary valve. Echocardiography remains the cornerstone for the detection of Libman-Sacks vegetations. Cardiac MRI and cardiac CT are useful in characterizing lesion size and effects and may prove particularly helpful in the assessment of right-sided or multivalvular endocarditis. The presence of focal brain lesions on brain MRI prompted antithrombotic therapy.
Also flagged:Huntington's diseasepsychiatricHDhereditaryneurodegenerative diseasecytosine
Journal Article2023-03-30✓ 1 SnippetZhang S, Lin J, Cheng Y, Hou Y, Shang H.
In-Text Gene Mentions
Introduction)
…of the huntingtin (HTT) gene on chromosome…
Show Full Abstract
<h4>Introduction</h4>Functional neuroimaging could provide abundant information of underling pathophysiological mechanisms of the clinical triad including motor, cognitive and psychiatric impairment in Huntington's Disease (HD).<h4>Methods</h4>We performed a voxel-based meta-analysis using anisotropic effect size-signed differential mapping (AES-SDM) method.<h4>Results</h4>6 studies (78 symptomatic HD, 102 premanifest HD and 131 healthy controls) were included in total. Altered resting-state brain activity was primarily detected in the bilateral medial part of superior frontal gyrus, bilateral anterior cingulate/paracingulate gyrus, left insula, left striatum, right cortico-spinal projections area, right inferior temporal gyrus area, right thalamus, right cerebellum and right gyrus rectus area. Premanifest and symptomatic HD patients showed different alterative pattern in the subgroup analyses.<h4>Discussion</h4>The robust and consistent abnormalities in the specific brain regions identified in the current study could help to understand the pathophysiology of HD and explore reliable neuroimaging biomarkers for monitoring disease progression, or even predicting the onset of premanifest HD patients.
Also flagged:fatty acidmetabolismtumorpolymeraseFASsoft tissue sarcoma
Journal Article2023-03-30✓ 2 SnippetsLiu B, He S, Li C, Feng C, Wang H, Zhang H, Tu C, Li Z.
In-Text Gene Mentions
Results)
…RB1, NF1, andDNAH10mutation frequencies are…
Results)
…while NF1 andDNAH10were more mutated…
Show Full Abstract
<b>Background:</b> Soft tissue sarcoma (STS) is a highly malignant tumor with a dismal prognosis. Presently, the dysregulation of fatty acid metabolism has received increasing attention in tumor research, but fewer reports are relevant to STS. <b>Methods:</b> Based on fatty acid metabolism-related genes (FRGs), a novel risk score for STS was developed utilizing univariate analysis and least absolute shrinkage selection operator (LASSO) Cox regression analyses in the STS cohort, which were further validated using the external validation cohort from other databases. Furthermore, independent prognostic analysis, C-index, ROC curves, and nomogram were carried out to investigate the predictive performance of fatty acid-related risk scores. We also analysed the differences in enrichment pathways, the immune microenvironment, gene mutations, and immunotherapy response between the two distinct fatty acid score groups. Moreover, the real-time quantitative polymerase chain reaction (RT-qPCR) was used to further verify the expression of FRGs in STS. <b>Results:</b> A total of 153 FRGs were retrieved in our study. Next, a novel fatty acid metabolism-related risk score (FAS) was constructed based on 18 FRGs. The predictive performance of FAS was also verified in external cohorts. In addition, the independent analysis, C-index, ROC curve, and nomograph also revealed that FAS could serve as an independent prognostic factor for the STS patients. Meanwhile, our results demonstrated that the STS cohort in two distinct FAS groups had different copy number variations, immune cell infiltration, and immunotherapy responses. Finally, the <i>in vitro</i> validation results demonstrated that several FRGs included in the FAS exhibited abnormal expression in STS. <b>Conclusion:</b> Altogether, our work comprehensively and systematically clarifies fatty acid metabolism's potential roles and clinical significance in STS. The novel individualized score based on fatty acid metabolism may be provided as a potential marker and treatment strategy in STS.
Also flagged:perimenopausal depressiondepressionmonoamineestrogen receptorpathogenesisMajor depression disorder
Journal Article2023-03-30✓ 2 SnippetsHan Y, Gu S, Li Y, Qian X, Wang F, Huang JH.
In-Text Gene Mentions
Introduction)
…E2 causes extensive epigenetic changes, mainly through DNA methylation to change gene transcription, such as methylation of genes (such as Est1, Cacna1c and Dcc) related to stress sensitivity and mental disorders (including human MDD) with significant differences (26).…
Introduction)
…Est1, Cacna1c andDcc) related to stress…
Show Full Abstract
With the development of social economics and the increase of working pressure, more and more women are suffering from long-term serious stress and showing symptoms of perimenopausal depression (PMD). The incidence rate of PMD is increasing, and the physical and mental health are seriously affected. However, due to the lack of accurate knowledge of pathophysiology, its diagnosis and treatment cannot be accurately executed. By consulting the relevant literature in recent years, this paper elaborates the neuroendocrine mechanism of perimenopausal depression from the aspects of epigenetic changes, monoamine neurotransmitter and receptor hypothesis, glial cell-induced neuroinflammation, estrogen receptor, interaction between HPA axis and HPG axis, and micro-organism-brain gut axis. The purpose is to probe into new ways of treatment of PMD by providing new knowledge about the neuroendocrine mechanism and treatment of PMD.
Also flagged:Short-chain fatty acidsbutyratepropionateacetateimmune responsesmetabolism
Journal Article2023-03-30No SnippetsSon MY, Cho HS.
Show Full Abstract
Short-chain fatty acids (SCFAs), such as butyrate, propionate, and acetate produced by the gut microbiota have been implicated in physiological responses (defense mechanisms, immune responses, and cell metabolism) in the human body. In several types of cancers, SCFAs, especially butyrate, suppress tumor growth and cancer cell metastasis via the regulation of the cell cycle, autophagy, cancer-related signaling pathways, and cancer cell metabolism. In addition, combination treatment with SCFAs and anticancer drugs exhibits synergistic effects, increasing anticancer treatment efficiency and attenuating anticancer drug resistance. Therefore, in this review, we point out the importance of SCFAs and the mechanisms underlying their effects in cancer treatment and suggest using SCFA-producing microbes and SCFAs to increase therapeutic efficacy in several types of cancers.
Solute carriers belong to the biggest group of transporters in the human genome, but more knowledge is needed to fully understand their function and possible role as therapeutic targets. SLC38A10, a poorly characterized solute carrier, is preliminary characterized here. By using a knockout mouse model, we studied the biological effects of SLC38A10 deficiency in vivo. We performed a transcriptomic analysis of the whole brain and found seven differentially expressed genes in SLC38A10-deficient mice (<i>Gm48159</i>, <i>Nr4a1</i>, <i>Tuba1c</i>, <i>Lrrc56</i>, <i>mt-Tp</i>, <i>Hbb-bt</i> and <i>Snord116/9</i>). By measuring amino acids in plasma, we found lower levels of threonine and histidine in knockout males, whereas no amino acid levels were affected in females, suggesting that SLC38A10<sup>-/-</sup> might affect sexes differently. Using RT-qPCR, we investigated the effect of SLC38A10 deficiency on mRNA expression of other SLC38 members, <i>Mtor</i> and <i>Rps6kb1</i> in the brain, liver, lung, muscle, and kidney, but no differences were found. Relative telomere length measurement was also taken, as a marker for cellular age, but no differences were found between the genotypes. We conclude that SLC38A10 might be important for keeping amino acid homeostasis in plasma, at least in males, but no major effects were seen on transcriptomic expression or telomere length in the whole brain.
SSRN2023-03-30Preprint (No Snippets API)Kartika T, Mathews R, Migneco G, Bundy T, Kaempf A, Pfeffer M, DeLoughery T, Moore K, Beardshear R, Oetken HJ, Case J, Hinds MT, McCarty OJT, Shatzel J, Zonies D, Zakhary B.
Show Full Abstract
Introduction: Extracorporeal membrane oxygenation (ECMO) is associated with significant thrombotic complications necessitating anticoagulation, though optimal strategy remains unknown. We aimed to evaluate thrombotic and hemorrhagic complications with heparin versus bivalirudin use in veno-venous (V-V) ECMO.<br><br>Methods: We performed a retrospective cohort study of adult patients placed on V-V ECMO with intravenous anticoagulation with either heparin or bivalirudin. Time to thrombotic event (patient-sided thrombus or circuit membrane lung exchange) and major bleed were analyzed in addition to related outcomes.<br><br>Results: We identified 95 patients placed on V-V ECMO: 61 receiving heparin, 34 bivalirudin. The bivalirudin group were more likely to have severe COVID-19, higher BMI, and longer ECMO duration. Despite this, bivalirudin was associated with reduced risk of thrombotic event (HR 0.14, 95% CI 0.06-0.32, p<0.001) and a significant increase in average lifespan of the circuit membrane lung (16 vs 10 days, p=0.004). While there was no significant difference in major bleeding for the bivalirudin group, these patients required fewer transfusions of packed red blood cells and platelets per 100 ECMO days (means of 13 vs 39, p=0.004 and 5 vs 19, p=0.014, respectively). Lastly, there was significantly improved survival to ECMO decannulation with bivalirudin in univariate analysis (median OS 53 vs 26 days, p=0.015) and a trend towards improved survival after adjusting for influential factors (HR 0.43, 95% CI 0.15-1.24, p=0.120).<br><br>Conclusions: In this real-world analysis of bivalirudin versus heparin, bivalirudin is a viable option for V-V ECMO and associated with lower risk of thrombotic complications and fewer transfusion requirements.
Research Square2023-03-30Preprint (No Snippets API)Yang B, Wang P, Liu Y, Cao F.
Show Full Abstract
<title>Abstract</title><p><bold>Background:</bold>Rheumatoid arthritis is a common inflammatory disease, with osteonecrosis of the femoral head being one of its common complications. However, the treatment of "osteonecrosis of the femoral head " is limited with insufficient drug development. The aim of this study is to explore molecular pathways and core genes associated with rheumatoid arthritis-induced osteonecrosis of the femoral head and investigate pharmacological targeting therapy for rheumatoid arthritis-induced osteonecrosis of the femoral head.<bold>Methods:</bold>In this analysis, intersection genes involved with both " rheumatoid arthritis " and "osteonecrosis of the femoral head " were identified using the Gene-Cards database, followed by functional analysis. The software programs STRING Online and Cytoscape were used to build protein-protein interaction (PPI) networks. Upon completion of the drug-gene interaction study, core genes and potential medicines were identified.<bold>Results:</bold>The Gene-Cards database discovered a total of 110 genes overlapped by "rheumatoid arthritis " and "osteonecrosis of the femoral head ". Following functional analysis, 108 important genes were selected. Subsequently, PPI analysis revealed 29 genes that may be targeted by 12 medicines and were candidates to treat rheumatoid arthritis-induced osteonecrosis of the femoral head.<bold>Conclusions:</bold>We used the Gene-Cards database and pathway analysis to identify highly related genes between " rheumatoid arthritis " and "osteonecrosis of the femoral head " and to explore potential therapeutic drugs. The following genes were investigated: HGF, MMP9, IL-1, EP300, SERPINC1, PLG, F5, and APOA1 are all involved in rheumatoid arthritis-induced osteonecrosis of the femoral head. It was found that fondaparinux, garcinol, canakinumab, and andecaliximab could be used as promising medications to treat rheumatoid arthritis-induced osteonecrosis of the femoral head.</p>
Also flagged:OxygenFerroptosisInflammatory bowel diseasechronic inflammatory diseasecolorectal cancercancer
Journal Article2023-03-29✓ 1 SnippetHuang W, Aabed N, Shah YM.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<b><i>Significance:</i></b> Reactive oxygen species (ROS) are essential in maintaining normal intestinal physiology. Inflammatory bowel disease (IBD) is a relapsing chronic inflammatory disease of the intestine that is a major risk factor for colorectal cancer (CRC). Excess ROS are widely implicated in intestinal inflammation and cancer. <b><i>Recent Advances:</i></b> Clinical data have shown that targeting ROS broadly does not yield improved outcomes in IBD and CRC. However, selectively limiting oxidative damage may improve the efficacy of ROS targeting. An accumulation of lipid ROS induces a novel oxidative cell death pathway known as ferroptosis. A growing body of evidence suggests that ferroptosis is relevant to both IBD and CRC. <b><i>Critical Issues:</i></b> We propose that inhibition of ferroptosis will improve disease severity in IBD, whereas activating ferroptosis will limit CRC progression. Data from preclinical models suggest that methods of modulating ferroptosis have been successful in attenuating IBD and CRC. <b><i>Future Directions:</i></b> The etiology of IBD and progression of IBD to CRC are still unclear. Further understanding of ferroptosis in intestinal diseases will provide novel therapies. Ferroptosis is highly linked to inflammation, cell metabolism, and is cell-type dependent. Further research in assessing the inflammatory and tumor microenvironment in the intestine may provide novel vulnerabilities that can be targeted. <i>Antioxid. Redox Signal.</i> 39, 551-568.
The use of 1,4-disubstituted 1,2,3-triazoles as trans-amide bond surrogates has become an important tool for the synthesis of metabolically stabilized peptidomimetics. These heterocyclic bioisosters are generally incorporated into the peptide backbone by applying a diazo-transfer reaction followed by CuAAC (click chemistry) with an α-amino alkyne. Even though the manual synthesis of backbone-modified triazolo-peptidomimetics has been reported by us and others, no procedure has yet been described for an automated synthesis using peptide synthesizers. In order to efficiently adapt these reactions to an automated setup, different conditions were explored, putting special emphasis on the required long-term stability of both the diazo-transfer reagent and the Cu(I) catalyst in solution. ISA·HCl is the reagent of choice to accomplish the diazo-transfer reaction; however, it was found instable in DMF, the most commonly used solvent for SPPS. Thus, an aqueous solution of ISA·HCl was used to prevent its degradation over time, and the composition in the final diazo-transfer reaction was adjusted to preserve suitable swelling conditions of the resins applied. The CuAAC reaction was performed without difficulties using [Cu (CH<sub>3</sub> CN)<sub>4</sub> ]PF<sub>6</sub> as a catalyst and TBTA as a stabilizer to prevent oxidation to Cu(II). The optimized automated two-step procedure was applied to the synthesis of structurally diverse triazolo-peptidomimetics to demonstrate the versatility of the developed methodology. Under the optimized conditions, five triazolo-peptidomimetics (8-5 amino acid residues) were synthesized efficiently using two different resins. Analysis of the crude products by HPLC-MS revealed moderate to good purities of the desired triazolo-peptidomimetics (70-85%). The synthesis time ranged between 9 and 12.5 h.
Also flagged:transcription factorschronic renal failuretranscription factorextracellular spaceextracellularexosome
Journal Article2023-03-29✓ 2 SnippetsLiu J, Duan G, Yang W, Zhang S, Liu F, Peng Y, Sun L, Liu Y, Xiao L.
In-Text Gene Mentions
Results)
…Firstly, the results showed that mRNA expression of AP1, BACH1, CDC5, FAC1, FOXJ2, IRF1, POU3F2, SOX5, SOX9 and TGIF1 in renal tubulointerstitium reversely correlated with GFR in DN patients (Fig. 5), suggesting that those transcription factor genes may contribute to the progression of DN.…
Abstract)
…, IRF1 ,POU3F2, SOX5 ,…
Show Full Abstract
<h4>Background</h4>Diabetic nephropathy (DN) is a main cause of chronic renal failure. Despite decades of extensive study, the molecular mechanisms underlying diabetic tubulointerstitial injury remain unclear. We aim to identify key transcription factor genes involved in diabetic tubulointerstitial injury.<h4>Methods</h4>A microarray dataset (GSE30122) from Gene Expression Omnibus (GEO) was downloaded. A total of 38 transcription factor genes based on 166 differentially expressed genes (DEGs) were identified by UCSC_TFBS.<h4>Results</h4>The regulatory network showed connections between the top 10 transcription factors and their target DEGs. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of targeted DEGs indicated that extracellular space, extracellular exosome, cell surface and complement and coagulation cascades were most significantly enriched. Utilizing Nephroseq v5 online platform, the mRNA expression pattern analysis of transcription factor genes demonstrated that mRNA expression of CDC5, CEBPA, FAC1, HFH1, IRF1, NFE2 and TGIF1 increased in renal tubulointerstitium of DN patients compared with normal controls while that of CEBPB and FOXO4 decreased in renal tubulointerstitium of DN patients compared with normal controls. Correlation analysis between mRNA expression of transcription factor genes in renal tubulointerstitium and clinical features showed that AP1, BACH1, CDC5, FAC1, FOXD1, FOXJ2, FOXO1, FOXO4, HFH1, IRF1, POU3F2, SOX5, SOX9, RSRFC4, S8 and TGIF1 may be related to diabetic tubulointerstitial injury.<h4>Conclusions</h4>(1) CDC5, FAC1, FOXO4, HFH1, IRF1 and TGIF1 may be key transcription factor genes. (2)Transcription factors involved in diabetic tubulointerstitial injury may become prospective targets for diagnosis and treatment of DN.
Also flagged:androgen receptoraspartate aminotransferasealanine transaminasefulminant liver failuredecompensated liver cirrhosisinjury
Journal Article2023-03-29✓ 1 SnippetLadna M, Taylor K, Bhat A, Dideban B.
In-Text Gene Mentions
I A O 0000613)
…Hemochromatosisgene testing was…
Show Full Abstract
<h4>Background</h4>RAD140 (Testalone) is a novel selective androgen receptor modulator with very limited data currently available on adverse effects related to this compound. The first-in-human phase 1 trial was recently published and did report a significant proportion of elevated aspartate aminotransferase, alanine transaminase, and total bilirubin among the test subjects. RAD140 may be associated with an idiosyncratic drug-induced liver injury. It is easily purchased online as a workout supplement. Given its ease of use from being an oral formulation, and not requiring a physician's prescription, its use among the young male population will likely rise. Clinicians should ask about the use of RAD140, and other workout supplements, in young men presenting with acute liver injury.<h4>Case presentation</h4>We present the case of a 26-year-old Caucasian male without any significant past medical history who presented with nausea, vomiting, severe right upper quadrant abdominal pain, and jaundice from acute liver injury. Extensive inpatient workup did not reveal a definite cause for his liver injury other than the use of a novel selective androgen receptor modulator called RAD140 (Testalone). He was treated with supportive care and discharged after short hospitalization. He was instructed to stop RAD140, which he reported compliance with, and on 2-month follow-up his liver function panel had normalized without recurrence of any symptoms.<h4>Conclusion</h4>Novel selective androgen receptor modulators such as RAD140 may be associated with idiosyncratic drug-induced liver injury. Workup of new liver injury in young and middle-aged males should involve asking about use of these novel compounds, for if missed and use continues, it can likely lead to fulminant liver failure or decompensated liver cirrhosis.
Also flagged:FerroptosisNeurodegenerative Diseasesdeathironlipidperoxides
Journal Article2023-03-29No SnippetsWang C, Liu H, Xu S, Deng Y, Xu B, Yang T, Liu W.
Show Full Abstract
Programed cell death plays a key role in promoting human development and maintaining homeostasis. Ferroptosis is a recently identified pattern of programmed cell death that is closely associated with the onset and progression of neurodegenerative diseases. Ferroptosis is mainly caused by the intracellular accumulation of iron-dependent lipid peroxides. The cysteine/glutamate antibody Solute carrier family 7 member 11 (SLC7A11, also known as xCT) functions to import cysteine for glutathione biosynthesis and antioxidant defense. SLC7A11 has a significant impact on ferroptosis, and inhibition of SLC7A11 expression promotes ferroptosis. Moreover, SLC7A11 is also closely associated with neurodegenerative diseases. In this paper, we summarize the relationship between ferroptosis and neurodegenerative diseases and the role of SLC7A11 during this process. The various regulatory mechanisms of SLC7A11 are also discussed. In conclusion, we are looking forward to a theoretical basis for further understanding the occurrence and development of ferroptosis in SLC7A11 and neurodegenerative diseases, and to seek new clues for the treatment of neurodegenerative diseases.
Also flagged:cystic fibrosisCFdepressionanxietychest infectionsmucus
Journal Article2023-03-29No SnippetsDawson S, Girling CJ, Cowap L, Clark-Carter D.
Show Full Abstract
<h4>Background</h4>Adherence to treatment, including inhaled therapies, is low in people with cystic fibrosis (CF). Although psychological interventions for improving adherence to inhaled therapies in people with CF have been developed, no previous published systematic review has evaluated the evidence for efficacy of these interventions.<h4>Objectives</h4>The primary objective of the review was to assess the efficacy of psychological interventions for improving adherence to inhaled therapies in people with cystic fibrosis (CF). The secondary objective was to establish the most effective components, or behaviour change techniques (BCTs), used in these interventions.<h4>Search methods</h4>We searched the Cochrane Cystic Fibrosis Trials Register, which is compiled from electronic database searches and handsearching of journals and conference abstract books. We also searched databases (PubMed; PsycINFO; EBSCO; Scopus; OpenGrey), trials registries (World Health Organization International Clinical Trials Registry Platform; US National Institutes of Health Ongoing Trials Register ClinicalTrials.gov), and the reference lists of relevant articles and reviews, with no restrictions on language, year or publication status. Date of search: 7 August 2022.<h4>Selection criteria</h4>We included randomised controlled trials (RCTs) comparing different types of psychological interventions for improving adherence to inhaled therapies in people with CF of any age, or comparing psychological interventions with usual care. We included quasi-RCTs if we could reasonably assume that the baseline characteristics were similar in both groups.<h4>Data collection and analysis</h4>Two review authors independently assessed trial eligibility and completed data extraction, risk of bias assessments, and BCT coding (using the BCT Taxonomy v1) for all included trials. We resolved any discrepancies by discussion, or by consultation with a third review author as necessary. We assessed the certainty of the evidence using GRADE.<h4>Main results</h4>We included 10 trials (1642 participants) in the review (children and adolescents in four trials; adults in five trials; and children and adults in one trial). Nine trials compared a psychological intervention with usual care; we could combine data from some of these in a number of quantitative analyses. One trial compared a psychological intervention with an active comparator (education plus problem-solving (EPS)). We identified five ongoing trials. Psychological interventions were generally multi-component and complex, containing an average of 9.6 BCTs (range 1 to 28). The two most commonly used BCTs included 'problem-solving' and 'instruction on how to perform the behaviour'. Interventions varied in their type, content and mode of delivery. They included a problem-solving intervention; a paper-based self-management workbook; a telehealth intervention; a group training programme; a digital intervention comprising medication reminders and lung function self-monitoring; a life-coaching intervention; a motivational interviewing (MI) intervention; a brief MI intervention (behaviour change counselling); and a digital intervention combined with behaviour change sessions. Intervention duration ranged from 10 weeks to 12 months. Assessment time points ranged from six to eight weeks up to 23 months. Psychological interventions compared with usual care We report data here for the 'over six months and up to 12 months' time point. We found that psychological interventions probably improve adherence to inhaled therapies (primary outcome) in people with CF compared with usual care (mean difference (MD) 9.5, 95% confidence interval (CI) 8.60 to 10.40; 1 study, 588 participants; moderate-certainty evidence). There was no evidence of a difference between groups in our second primary outcome, treatment-related adverse events: anxiety (MD 0.30, 95% CI -0.40 to 1.00; 1 study, 535 participants), or depression (MD -0.10, 95% CI -0.80 to 0.60; 1 study, 534 participants), although this was low-certainty evidence. For our secondary outcomes, there was no evidence of a difference between groups in terms of lung function (forced expiratory volume in one second (FEV<sub>1</sub>) % predicted MD 1.40, 95% CI -0.20 to 3.00; 1 study, 556 participants; moderate-certainty evidence); number of pulmonary exacerbations (adjusted rate ratio 0.96, 95% CI 0.83 to 1.11; 1 study, 607 participants; moderate-certainty evidence); or respiratory symptoms (MD 0.70, 95% CI -2.40 to 3.80; 1 study, 534 participants; low-certainty evidence). However, psychological interventions may improve treatment burden (MD 3.90, 95% CI 1.20 to 6.60; 1 study, 539 participants; low-certainty evidence). The overall certainty of the evidence ranged from low to moderate across these outcomes. Reasons for downgrading included indirectness (current evidence included adults only whereas our review question was broader and focused on people of any age) and lack of blinding of outcome assessors. Psychological interventions compared with an active comparator For this comparison the overall certainty of evidence was very low, based on one trial (n = 128) comparing an MI intervention to EPS for 12 months. We are uncertain whether an MI intervention, compared with EPS, improves adherence to inhaled therapies, lung function, or quality of life in people with CF, or whether there is an effect on pulmonary exacerbations. The included trial for this comparison did not report on treatment-related adverse events (anxiety and depression). We downgraded all reported outcomes due to small participant numbers, indirectness (trials included only adults), and unclear risk of bias (e.g. selection and attrition bias).<h4>Authors' conclusions</h4>Due to the limited quantity of trials included in this review, as well as the clinical and methodological heterogeneity, it was not possible to identify an overall intervention effect using meta-analysis. Some moderate-certainty evidence suggests that psychological interventions (compared with usual care) probably improve adherence to inhaled therapies in people with CF, without increasing treatment-related adverse events, anxiety and depression (low-certainty evidence). In future review updates (with ongoing trial results included), we hope to be able to establish the most effective BCTs (or 'active ingredients') of interventions for improving adherence to inhaled therapies in people with CF. Wherever possible, investigators should make use of the most objective measures of adherence available (e.g. data-logging nebulisers) to accurately determine intervention effects. Outcome reporting needs to be improved to enable combining or separation of measures as appropriate. Likewise, trial reporting needs to include details of intervention content (e.g. BCTs used); duration; intensity; and fidelity. Large trials with a longer follow-up period (e.g. 12 months) are needed in children with CF. Additionally, more research is needed to determine how to support adherence in 'under-served' CF populations.
Also flagged:Interleukin-10COVID-19immune responseviral infectionsCOVID-19 infectioninflammatory response
Journal Article2023-03-29No SnippetsV VR, Ramu A, Chinnappan J, Velmurugan P, Pathak R, Pashameah RA, A Oyouni AA, M Al-Amer O, I Alasseiri M, Hamadi A, A Alanazi M, Sathiamoorthi T.
Show Full Abstract
COVID-19 caused by the SARS-CoV-2 virus is widespread in all regions, and it disturbs host immune system functioning leading to extreme inflammatory reaction and hyperactivation of the immune response. Kabasura Kudineer (KSK) is preventive medicine against viral infections and a potent immune booster for inflammation-related diseases. We hypothesize that KSK and KSK similar plant compounds, might prevent or control the COVID-19 infection in the human body. 1,207 KSK and KSK similar compounds were listed and screened via the Swiss ADME tool and PAINS Remover; 303 compounds were filtered including active and similar drug compounds. The targets were retrieved from similar drugs of the active compounds of KSK. Finally, 573 genes were listed after several screening steps. Next, network analysis was performed to finalize the potential target gene: construction of protein-protein interaction of 573 genes using STRING, identifying top hub genes in Cytoscape plug-ins (MCODE and cytoHubba). These ten hub genes play a crucial role in the inflammatory response. Target-miRNA interaction was also constructed using the miRNet tool to interpret miRNAs of the target genes and their functions. Functional annotation was done via DAVID to gain a complete insight into the mechanism of the enriched pathways and other diseases related to the given target genes. In Molecular Docking analysis, IL10 attained top rank in Target-miRNA interaction and also the gene formed prominent exchanges with an excellent binding score (> = -8.0) against 19 compounds. Among them, Guggulsterone has an acute affinity score of -8.8 for IL10 and exhibits anti-inflammatory and immunomodulatory properties. Molecular Dynamics simulation study also performed for IL10 and the interacting ligand compounds using GROMACS. Finally, Guggulsterone will be recommended to enhance immunity against several inflammatory diseases, including COVID19.
The blueprints of developing organs are preset at the early stages of embryogenesis. Transcriptional and epigenetic mechanisms are proposed to preset developmental trajectories. However, we reveal that the competence for the future cardiac fate of human embryonic stem cells (hESCs) is preset in pluripotency by a specialized mRNA translation circuit controlled by RBPMS. RBPMS is recruited to active ribosomes in hESCs to control the translation of essential factors needed for cardiac commitment program, including Wingless/Integrated (WNT) signaling. Consequently, RBPMS loss specifically and severely impedes cardiac mesoderm specification, leading to patterning and morphogenetic defects in human cardiac organoids. Mechanistically, RBPMS specializes mRNA translation, selectively via 3'UTR binding and globally by promoting translation initiation. Accordingly, RBPMS loss causes translation initiation defects highlighted by aberrant retention of the EIF3 complex and depletion of EIF5A from mRNAs, thereby abrogating ribosome recruitment. We demonstrate how future fate trajectories are programmed during embryogenesis by specialized mRNA translation.
Cell state plasticity is carefully regulated in adult epithelia to prevent cancer. The aberrant expansion of the normally restricted capability for cell state plasticity in neoplasia is poorly defined. Using genetically engineered and carcinogen-induced mouse models of intestinal neoplasia, we observed that impaired differentiation is a conserved event preceding cancer development. Single-cell RNA sequencing (scRNA-seq) of premalignant lesions from mouse models and a patient with hereditary polyposis revealed that cancer initiates by adopting an aberrant transcriptional state characterized by regenerative activity, marked by <i>Ly6a</i> (Sca-1), and reactivation of fetal intestinal genes, including <i>Tacstd2</i> (Trop2). Genetic inactivation of Sox9 prevented adenoma formation, obstructed the emergence of regenerative and fetal programs, and restored multilineage differentiation by scRNA-seq. Expanded chromatin accessibility at regeneration and fetal genes upon Apc inactivation was reduced by concomitant Sox9 suppression. These studies indicate that aberrant cell state plasticity mediated by unabated regenerative activity and developmental reprogramming precedes cancer development.
Also flagged:osteoarthritisOAglycosaminoglycanspeptidecarbonatechloride
Journal Article2023-03-29No SnippetsZhang C, Vedadghavami A, He T, Charles JF, Bajpayee AG.
Show Full Abstract
Cartilage tissue exhibits early degenerative changes with onset of osteoarthritis (OA). Early diagnosis is critical as there is only a narrow time window during which therapeutic intervention can reverse disease progression. Computed tomography (CT) has been considered for cartilage imaging as a tool for early OA diagnosis by introducing radio-opaque contrast agents like ioxaglate (IOX) into the joint. IOX, however, is anionic and thus repelled by negatively charged cartilage glycosaminoglycans (GAGs) that hinders its intra-tissue penetration and partitioning, resulting in poor CT attenuation. This is further complicated by its short intra-tissue residence time owing to rapid clearance from joints, which necessitates high doses causing toxicity concerns. Here we engineer optimally charged cationic contrast agents based on cartilage negative fixed charge density by conjugating cartilage targeting a cationic peptide carrier (CPC) and multi-arm avidin nanoconstruct (mAv) to IOX, such that they can penetrate through the full thickness of cartilage within 6 h using electrostatic interactions and elicit similar CT signal with about 40× lower dose compared to anionic IOX. Their partitioning and distribution correlate strongly with spatial GAG distribution within healthy and early- to late-stage arthritic bovine cartilage tissues at 50-100× lower doses than other cationic contrast agents used in the current literature. The use of contrast agents at low concentrations also allowed for delineation of cartilage from subchondral bone as well as other soft tissues in rat tibial joints. These contrast agents are safe to use at current doses, making CT a viable imaging modality for early detection of OA and staging of its severity.
Also flagged:Toxocara canis infectioninfectionco-localizationinflammatory responsesT. canis infectionsecretion
Journal Article2023-03-29✓ 2 SnippetsZou Y, Zheng WB, Elsheikha HM, He JJ, Lu YX, Wang S, Guo A, Zhu XQ.
In-Text Gene Mentions
Discussion)
…Huntington's disease is an autosomal-dominant neurodegenerative disease caused by the expansion of CAG repeats in the Huntingtin (htt) gene [41].…
Discussion)
…the Huntingtin (htt) gene […
Show Full Abstract
<h4>Background</h4>Long non-coding RNAs (lncRNAs) and messenger RNAs (mRNAs) play crucial roles in regulating various physiological and pathological processes. However, the role of lncRNAs and mRNAs in mediating the liver response during Toxocara canis infection remains incompletely understood.<h4>Methods</h4>In the present study, the expression profile of lncRNAs and mRNAs was investigated in the liver of Beagle dogs infected by T. canis using high-throughput RNA sequencing.<h4>Results</h4>Compared with the control groups, 876 differentially expressed (DE) lncRNAs and 288 DEmRNAs were identified at 12 h post-infection (hpi), 906 DElncRNAs and 261 DEmRNAs were identified at 24 hpi, and 876 DElncRNAs and 302 DEmRNAs were identified at 36 days post-infection (dpi). A total of 16 DEmRNAs (e.g. dpp4, crp and gnas) were commonly identified at the three infection stages. Enrichment and co-localization analyses identified several pathways involved in immune and inflammatory responses during T. canis infection. Some novel DElncRNAs, such as LNC_015756, LNC_011050 and LNC_011052, were also associated with immune and inflammatory responses. Also, LNC_005105 and LNC_005401 were associated with the secretion of anti-inflammatory cytokines, which may play a role in the healing of liver pathology at the late stage of infection.<h4>Conclusions</h4>Our data provided new insight into the regulatory roles of lncRNAs and mRNAs in the pathogenesis of T. canis and improved our understanding of the contribution of lncRNAs and mRNAs to the immune and inflammatory response of the liver during T. canis infection.
Also flagged:serotonin transporterserotoninneurodevelopmental disordersmood disordersc-Fosdepression
Journal Article2023-03-29✓ 5 SnippetsShoji H, Ikeda K, Miyakawa T.
In-Text Gene Mentions
Introduction)
…In the present study, to understand the brain function of 5-HTT and to evaluate 5-HTT-deficient mice as an animal model for neuropsychiatric and neurodevelopmental disorders, we first assessed various domains of behavior in male 5-HTT heterozygous KO and homozygous KO mice and their wild-type controls using a battery of behavioral tests, including 16 different tests assessing locomotor activity in novel and familiar environments, sensory and motor function, anxiety-like and depression-related behaviors, social behaviors in novel and familiar environments, prepulse inhibition, working memory, spatial reference memory, contextual and cued fear memory, and remote memory.…
I A O 0000615)
…These findings reveal the role of 5-HTT on brain function and strengthen the notion that 5-HTT-deficient mice have a high face and construct validity of the animal model for studying anxiety and depression with altered serotonergic function.…
Introduction)
…Genetic association studies have reported that genetic variants of 5-HTT, well known as the 5-HTT gene-linked polymorphic region (5-HTTLPR), are associated with increased neuroticism, anxiety, and depression [6–8].…
Introduction)
…Finally, to investigate the stress response and brain regions associated with increased depression-related behavior caused by deletion of the 5-HTT gene, plasma corticosterone levels and brain c-Fos expression after the forced swim test were assessed in 5-HTT homozygous KO mice and their wild-type controls.…
Discussion)
…Thus, although the results suggest that 5-HTT deficiency may contribute to an improvement in recent spatial memory as seen in the T-maze test, the increased time spent in the target area in 5-HTT−/− mice could be explained by an increased motivation to escape the maze due to an enhanced anxiety-like phenotype.…
Show Full Abstract
The serotonin transporter (5-HTT) plays a critical role in the regulation of serotonin neurotransmission. Mice genetically deficient in 5-HTT expression have been used to study the physiological functions of 5-HTT in the brain and have been proposed as a potential animal model for neuropsychiatric and neurodevelopmental disorders. Recent studies have provided evidence for a link between the gut-brain axis and mood disorders. However, the effects of 5-HTT deficiency on gut microbiota, brain function, and behavior remain to be fully characterized. Here we investigated the effects of 5-HTT deficiency on different types of behavior, the gut microbiome, and brain c-Fos expression as a marker of neuronal activation in response to the forced swim test for assessing depression-related behavior in male 5-HTT knockout mice. Behavioral analysis using a battery of 16 different tests showed that 5-HTT-/- mice exhibited markedly reduced locomotor activity, decreased pain sensitivity, reduced motor function, increased anxiety-like and depression-related behavior, altered social behavior in novel and familiar environments, normal working memory, enhanced spatial reference memory, and impaired fear memory compared to 5-HTT+/+ mice. 5-HTT+/- mice showed slightly reduced locomotor activity and impaired social behavior compared to 5-HTT+/+ mice. Analysis of 16S rRNA gene amplicons showed that 5-HTT-/- mice had altered gut microbiota abundances, such as a decrease in Allobaculum, Bifidobacterium, Clostridium sensu stricto, and Turicibacter, compared to 5-HTT+/+ mice. This study also showed that after exposure to the forced swim test, the number of c-Fos-positive cells was higher in the paraventricular thalamus and lateral hypothalamus and was lower in the prefrontal cortical regions, nucleus accumbens shell, dorsolateral septal nucleus, hippocampal regions, and ventromedial hypothalamus in 5-HTT-/- mice than in 5-HTT+/+ mice. These phenotypes of 5-HTT-/- mice partially recapitulate clinical observations in humans with major depressive disorder. The present findings indicate that 5-HTT-deficient mice serve as a good and valid animal model to study anxiety and depression with altered gut microbial composition and abnormal neuronal activity in the brain, highlighting the importance of 5-HTT in brain function and the mechanisms underlying the regulation of anxiety and depression.
Also flagged:SOX9chromatinCTCFPolymercohesingene expression
Journal Article2023-03-29No SnippetsChen LF, Long HK, Park M, Swigut T, Boettiger AN, Wysocka J.
Show Full Abstract
Enhancer clusters overlapping disease-associated mutations in Pierre Robin sequence (PRS) patients regulate SOX9 expression at genomic distances over 1.25 Mb. We applied optical reconstruction of chromatin architecture (ORCA) imaging to trace 3D locus topology during PRS-enhancer activation. We observed pronounced changes in locus topology between cell types. Subsequent analysis of single-chromatin fiber traces revealed that these ensemble-average differences arise through changes in the frequency of commonly sampled topologies. We further identified two CTCF-bound elements, internal to the SOX9 topologically associating domain, which promote stripe formation, are positioned near the domain's 3D geometric center, and bridge enhancer-promoter contacts in a series of chromatin loops. Ablation of these elements results in diminished SOX9 expression and altered domain-wide contacts. Polymer models with uniform loading across the domain and frequent cohesin collisions recapitulate this multi-loop, centrally clustered geometry. Together, we provide mechanistic insights into architectural stripe formation and gene regulation over ultra-long genomic ranges.
Also flagged:Astragaloside IVNADPH oxidase 2bacterial infectioncancerASTinjury
Journal Article2023-03-29✓ 5 SnippetsCheng C, Liu K, Shen F, Zhang J, Xie Y, Li S, Hou Y, Bai G.
In-Text Gene Mentions
Title)
…Astragaloside IV targetsPRDX6, inhibits the activation…
Abstract)
…structural stability ofPRDX6and interferes with…
Abstract)
…the interaction betweenPRDX6and RAC, hindering…
Abstract)
…catalytic triad ofPRDX6.…
Abstract)
…the interaction betweenPRDX6and RAC, thereby…
Show Full Abstract
<h4>Background</h4>Radix Astragali Mongolici, as a traditional Chinese medicine, is widely used in the treatment of qi deficiency, viral or bacterial infection, inflammation and cancer. Astragaloside IV (AST), a key active compound in Radix Astragali Mongolici, has been shown to reduce disease progression by inhibiting oxidative stress and inflammation. However, the specific target and mechanism of action of AST in improving oxidative stress are still unclear.<h4>Purpose</h4>This study aims to explore the target and mechanism of AST to improve oxidative stress, and to explain the biological process of oxidative stress.<h4>Methods</h4>AST functional probes were designed to capture target proteins and combined with protein spectrum to analyze target proteins. Small molecule and protein interaction technologies were used to verify the mode of action, while computer dynamics simulation technology was used to analyze the site of interaction with the target protein. The pharmacological activity of AST in improving oxidative stress was evaluated in a mouse model of acute lung injury induced by LPS. Additionally, pharmacological and serial molecular biological approaches were used to explore the underlying mechanism of action.<h4>Results</h4>AST inhibits PLA2 activity in PRDX6 by targeting the PLA2 catalytic triad pocket. This binding alters the conformation and structural stability of PRDX6 and interferes with the interaction between PRDX6 and RAC, hindering the activation of the RAC-GDI heterodimer. Inactivation of RAC prevents NOX2 maturation, attenuates superoxide anion production, and improves oxidative stress damage.<h4>Conclusion</h4>The findings of this research indicate that AST impedes PLA2 activity by acting on the catalytic triad of PRDX6. This, in turn, disrupts the interaction between PRDX6 and RAC, thereby hindering the maturation of NOX2 and diminishing the oxidative stress damage.
Also flagged:hypopigmentary disordersvitiligopigmentation disorderspigment disordersSkin Pigmentation Disorderspigmentary disorders
Journal Article2023-03-29No SnippetsSaidani M, Darle A, Jarrige M, Polveche H, El Kassar L, Julié S, Bessou-Touya S, Holic N, Lemaitre G, Martinat C, Baldeschi C, Allouche J.
Show Full Abstract
Melanocytes are essential for skin homeostasis and protection, and their loss or misfunction leads to a wide spectrum of diseases. Cell therapy utilizing autologous melanocytes has been used for years as an adjunct treatment for hypopigmentary disorders such as vitiligo. However, these approaches are hindered by the poor proliferative capacity of melanocytes obtained from skin biopsies. Recent advances in the field of human pluripotent stem cells have fueled the prospect of generating melanocytes. Here, we have developed a well-characterized method to produce a pure and homogenous population of functional and proliferative melanocytes. The genetic stability and potential transformation of melanocytes from pluripotent stem cells have been evaluated over time during the in vitro culture process. Thanks to transcriptomic analysis, the molecular signatures all along the differentiation protocol have been characterized, providing a solid basis for standardizing the protocol. Altogether, our results promise meaningful, broadly applicable, and longer-lasting advances for pigmentation disorders and open perspectives for innovative biotherapies for pigment disorders.
Also flagged:calcium phosphatemineralshydroxyapatiteage-related macular degenerationtetracyclinechlortetracycline
Journal Article2023-03-29No SnippetsHegde KR, Puche AC, Szmacinski H, Fuller K, Ray K, Patel N, Lengyel I, Thompson RB.
Show Full Abstract
We have shown that all sub-retinal pigment epithelial (sub-RPE) deposits examined contain calcium phosphate minerals: hydroxyapatite (HAP), whitlockite (Wht), or both. These typically take the form of ca. 1 μm diameter spherules or >10 μm nodules and appear to be involved in the development and progression of age-related macular degeneration (AMD). Thus, these minerals may serve as useful biomarkers the for early detection and monitoring of sub-RPE changes in AMD. We demonstrated that HAP deposits could be imaged in vitro by fluorescence lifetime imaging microscopy (FLIM) in flat-mounted retinas using legacy tetracycline antibiotics as selective sensors for HAP. As the contrast on a FLIM image is based on the difference in fluorescence lifetime and not intensity of the tetracycline-stained HAP, distinguishing tissue autofluorescence from the background is significantly improved. The focus of the present pilot study was to assess whether vascular perfusion of the well tolerated and characterized chlortetracycline (widely used as an orally bioavailable antibiotic) can fluorescently label retinal HAP using human cadavers. We found that the tetracycline delivered through the peripheral circulation can indeed selectively label sub-RPE deposits opening the possibility for its use for ophthalmic monitoring of a range of diseases in which deposit formation is reported, such as AMD and Alzheimer disease (AD).
Also flagged:cancerstranslationalregulationcancerarrhythmiascardiac atrophy
Journal Article2023-03-29✓ 2 SnippetsCorydon TJ, Schulz H, Richter P, Strauch SM, Böhmer M, Ricciardi DA, Wehland M, Krüger M, Erzinger GS, Lebert M, Infanger M, Wise PM, Grimm D.
In-Text Gene Mentions
Results)
…Gene expression analyses on human articular chondrocytes exposed to the RPM for 24 h showed significant upregulations of IL6, RUNX2, RUNX3, SPP1, SOX6, SOX9, and MMP13. At the same time, IL8, ACAN, PRG4, ITGB1, TGFB1, COL1A1, COL2A1, COL10A1, SOD3, SOX5, MMP1, and MMP2 remained unchanged, indicating that the chondrocytes experienced stress, as evidenced by the expression of markers for osteoarthritis and cartilage damage [154].…
Results)
…, SPP1 ,SOX6, SOX9 ,…
Show Full Abstract
Microgravity (µ<i>g</i>) has a massive impact on the health of space explorers. Microgravity changes the proliferation, differentiation, and growth of cells. As crewed spaceflights into deep space are being planned along with the commercialization of space travelling, researchers have focused on gene regulation in cells and organisms exposed to real (r-) and simulated (s-) µ<i>g</i>. In particular, cancer and metastasis research benefits from the findings obtained under µ<i>g</i> conditions. Gene regulation is a key factor in a cell or an organism's ability to sustain life and respond to environmental changes. It is a universal process to control the amount, location, and timing in which genes are expressed. In this review, we provide an overview of µ<i>g</i>-induced changes in the numerous mechanisms involved in gene regulation, including regulatory proteins, microRNAs, and the chemical modification of DNA. In particular, we discuss the current knowledge about the impact of microgravity on gene regulation in different types of bacteria, protists, fungi, animals, humans, and cells with a focus on the brain, eye, endothelium, immune system, cartilage, muscle, bone, and various cancers as well as recent findings in plants. Importantly, the obtained data clearly imply that µ<i>g</i> experiments can support translational medicine on Earth.
Also flagged:lipidsynthesiscatabolismcholesterolamino acidgluconeogenesis
Journal Article2023-03-29No SnippetsLiu H, Zhou M, Dong X, Tan B, Zhang S, Yang Y, Chi S, Liu H, Yan X, Li Z.
Show Full Abstract
Understanding the molecular mechanisms involved in adaptation to alternate diets has become a significant concern, as increasing amounts of fishmeal (FM) protein in aquafeeds are being substituted with plant protein. Thus, the goal of this study was to assess growth performance, quality, and liver function of juvenile <i>Sillago sihama</i> (<i>S. sihama</i>) through growth indices, whole-body composition, histology of the liver, and RNA-sequencing (RNA-seq), after they were fed a formulated diet with 64% low-gossypol cottonseed meal (LCSM) for 56 days, compared to those fed a traditional FM-based diet. Indicators of growth, including final body weight (FBW), weight gain rate (WGR), specific growth rate (SGR), protein efficiency ratio (PER), and condition factor (CF), were considerably lower in the 64% LCSM (R64) group than in the FM diet group. In the R64 diet, the whole crude lipid was significantly lower than in the FM diet. The hematoxylin-eosin section showed that dietary high levels of LCSM resulted in diffuse lipid vacuolation in the liver of <i>S. sihama</i>. According to a liver transcriptome analysis, high LCSM intake in the diet significantly impacted lipid synthesis and catabolism, elevated pathways for cholesterol synthesis, blocked several amino acid metabolic pathways, and adversely affected hepatic gluconeogenesis and glycolysis. The findings of this study indicate that feeding high levels of LCSM in <i>S. sihama</i> is harmful to the growth of the organism and can harm the liver's structural integrity, as well as obstruct the normal metabolism of amino acids, lipids, and carbohydrates. Therefore, it is not recommended to substitute LCSM for high levels of FM in the diet of <i>S. sihama</i>.
Also flagged:Major depressive disorderpsychiatric disorderdepressionpathogenesismonoaminesneurogenesis
Journal Article2023-03-29✓ 2 SnippetsDing R, Su D, Zhao Q, Wang Y, Wang JY, Lv S, Ji X.
In-Text Gene Mentions
S I O 001029)
…Whereas miR-218 was shown to be upregulated in BA44 in MDD patients and led to a significant decrease in DCC expression levels.…
S I O 001029)
…DCC (Deleted in Colorectal Cancer) drives prefrontal cortex maturity by determining DA targets early in life, for example, in rats, signaling within dopamine neurons in the juvenile VTA determines the extent of innervation of the PFC (Torres-Berrio et al., 2017).…
Show Full Abstract
Major depressive disorder (MDD) is a psychiatric disorder with increasing prevalence worldwide. It is a leading cause of disability and suicide, severely affecting physical and mental health. However, the study of depression remains at an exploratory stage in terms of diagnostics and treatment due to the complexity of its pathogenesis. MicroRNAs are endogenous short-stranded non-coding RNAs capable of binding to the 3'untranslated region of mRNAs. Because of their ability to repress translation process of genes and are found at high levels in brain tissues, investigation of their role in depression has gradually increased recently. This article summarizes recent research progress on the relationship between microRNAs and depression. The microRNAs play a regulatory role in the pathophysiology of depression, involving dysregulation of monoamines, abnormalities in neuroplasticity and neurogenesis, hyperactivity of the HPA axis, and dysregulation of inflammatory responses. These microRNAs might provide new clue for the diagnosis and treatment of MDD, and the development of antidepressant drugs.
Also flagged:reverse transcriptaseNeurodegenerative diseasesAmyotrophic lateral sclerosisALSTelomereaging
Journal Article2023-03-29No SnippetsYu X, Liu MM, Zheng CY, Liu YT, Wang Z, Wang ZY.
Show Full Abstract
Neurodegenerative diseases (NDs) are chronic conditions that result in progressive damage to the nervous system, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and Amyotrophic lateral sclerosis (ALS). Age is a major risk factor for NDs. Telomere shortening is a biological marker of cellular aging, and telomerase reverse transcriptase (TERT) has been shown to slow down this process by maintaining telomere length. The blood-brain barrier (BBB) makes the brain a unique immune organ, and while the number of T cells present in the central nervous system is limited, they play an important role in NDs. Research suggests that NDs can be influenced by modulating peripheral T cell immune responses, and that TERT may play a significant role in T cell senescence and NDs. This review focuses on the current state of research on TERT in NDs and explores the potential connections between TERT, T cells, and NDs. Further studies on aging and telomeres may provide valuable insights for developing therapeutic strategies for age-related diseases.
Also flagged:ferroptosisAutophagydeathironlipidasthma
Journal Article2023-03-29✓ 3 SnippetsLv X, Tang W, Qin J, Wang W, Dong J, Wei Y.
In-Text Gene Mentions
Introduction)
…binding protein 1 (PEBP1), the crosslinked regulatory…
Introduction)
…PEBP1which is also…
Introduction)
…the process ofPEBP1binding with LC3-I…
Show Full Abstract
Autophagy is an evolutionarily conserved cellular process capable of degrading various biological molecules and organelles <i>via</i> the lysosomal pathway. Ferroptosis is a type of oxidative stress-dependent regulated cell death associated with the iron accumulation and lipid peroxidation. The crosslinks between ferroptosis and autophagy have been focused on since the dependence of ferroptosis on autophagy was discovered. Although the research and theories on the relationship between autophagy and ferroptosis remain scattered and fragmented, the crosslinks between these two forms of regulated cell death are closely related to the treatment of various diseases. Thereof, asthma as a chronic inflammatory disease has a tight connection with the occurrence of ferroptosis and autophagy since the crosslinked signal pathways may be the crucial regulators or exactly regulated by cells and secretion in the immune system. In addition, non-immune cells associated with asthma are also closely related to autophagy and ferroptosis. Further studies of cross-linking asthma inflammation with crosslinked signaling pathways may provide us with several key molecules that regulate asthma through specific regulators. The crosslinks between autophagy and ferroptosis provide us with a new perspective to interpret and understand the manifestations of asthma, potential drug discovery targets, and new therapeutic options to effectively intervene in the imbalance caused by abnormal inflammation in asthma. Herein, we introduce the main molecular mechanisms of ferroptosis, autophagy, and asthma, describe the role of crosslinks between ferroptosis and autophagy in asthma based on their common regulatory cells or molecules, and discuss potential drug discovery targets and therapeutic applications in the context of immunomodulatory and symptom alleviation.
Also flagged:tumorpancreatic cancermalignant tumorstumor associated cytokineTGF-βIL-10
Journal Article2023-03-29✓ 1 SnippetLi Y, Xiang S, Pan W, Wang J, Zhan H, Liu S.
In-Text Gene Mentions
I A O 0000326)
…expression of OX40 L/TNFSF4, PD-L2/PDCD1LG2 and JAM2…
Show Full Abstract
Pancreatic cancer is one of the most malignant tumors with increased incidence rate. The effect of surgery combined with chemoradiotherapy on survival of patients is unsatisfactory. New treatment strategy such as immunotherapy need to be investigated. The accumulation of desmoplastic stroma, infiltration of immunosuppressive cells including myeloid derived suppressor cells (MDSCs), tumor associated macrophages (TAMs), cancer-associated fibroblasts (CAFs), and regulatory T cells (Tregs), as well as tumor associated cytokine such as TGF-β, IL-10, IL-35, CCL5 and CXCL12 construct an immunosuppressive microenvironment of pancreatic cancer, which presents challenges for immunotherapy. In this review article, we explore the roles and mechanism of immunosuppressive cells and lymphocytes in establishing an immunosuppressive tumor microenvironment in pancreatic cancer. In addition, immunotherapy strategies for pancreatic cancer based on tumor microenvironment including immune checkpoint inhibitors, targeting extracellular matrix (ECM), interfering with stromal cells or cytokines in TME, cancer vaccines and extracellular vesicles (EVs) are also discussed. It is necessary to identify an approach of immunotherapy in combination with other modalities to produce a synergistic effect with increased response rates in pancreatic cancer therapy.
Also flagged:chlorin e6tumorspaclitaxeltumorcell proliferationthioketal
Journal Article2023-03-29No SnippetsWang C, Yang X, Qiu H, Huang K, Xu Q, Zhou B, Zhang L, Zhou M, Yi X.
Show Full Abstract
<b>Background:</b> Recently, various combination therapies for tumors have garnered popularity because of their synergistic effects in improving therapeutic efficacy and reducing side effects. However, incomplete intracellular drug release and a single method of combining drugs are inadequate to achieve the desired therapeutic effect. <b>Methods:</b> A reactive oxygen species (ROS)-sensitive co-delivery micelle (Ce6@PTP/DP). It was a photosensitizer and a ROS-sensitive paclitaxel (PTX) prodrug for synergistic chemo-photodynamic therapy. Micelles size and surface potential were measured. In vitro drug release, cytotoxicity and apoptosis were investigated. <b>Results:</b> Ce6@PTP/DP prodrug micelles exhibited good colloidal stability and biocompatibility, high PTX and Ce6 loading contents of 21.7% and 7.38%, respectively. Upon light irradiation, Ce6@PTP/DP micelles endocytosed by tumor cells can generate sufficient ROS, not only leading to photodynamic therapy and the inhibition of tumor cell proliferation, but also triggering locoregional PTX release by cleaving the thioketal (TK) bridged bond between PTX and methoxyl poly (ethylene glycol). Furthermore, compared with single drug-loaded micelles, the light-triggered Ce6@PTP/DP micelles exhibited self-amplified drug release and significantly greater inhibition of HeLa cell growth. <b>Conclusion:</b> The results support that PTX and Ce6 in Ce6@PTP/DP micelles exhibited synergistic effects on cell-growth inhibition. Thus, Ce6@PTP/DP micelles represent an alternative for realizing synergistic chemo-photodynamic therapy.
Also flagged:TDP-43transactive response DNA-binding proteinneurodegenerative diseasesamyotrophic lateral sclerosisfrontotemporal dementiafibrils
Journal Article2023-03-29✓ 1 SnippetShenoy J, Lends A, Berbon M, Bilal M, El Mammeri N, Bertoni M, Saad A, Morvan E, Grélard A, Lecomte S, Theillet FX, Buell AK, Kauffmann B, Habenstein B, Loquet A.
In-Text Gene Mentions
Introduction)
…FUS, SNCA (α-synuclein),HTT(Huntingtin), and APP…
Show Full Abstract
Aberrant aggregation of the transactive response DNA-binding protein (TDP-43) is associated with several lethal neurodegenerative diseases, including amyotrophic lateral sclerosis and frontotemporal dementia. Cytoplasmic neuronal inclusions of TDP-43 are enriched in various fragments of the low-complexity C-terminal domain and are associated with different neurotoxicity. Here we dissect the structural basis of TDP-43 polymorphism using magic-angle spinning solid-state NMR spectroscopy in combination with electron microscopy and Fourier-transform infrared spectroscopy. We demonstrate that various low-complexity C-terminal fragments, namely TDP-13 (TDP-43<sub>300-414</sub>), TDP-11 (TDP-43<sub>300-399</sub>), and TDP-10 (TDP-43<sub>314-414</sub>), adopt distinct polymorphic structures in their amyloid fibrillar state. Our work demonstrates that the removal of less than 10% of the low-complexity sequence at N- and C-termini generates amyloid fibrils with comparable macroscopic features but different local structural arrangement. It highlights that the assembly mechanism of TDP-43, in addition to the aggregation of the hydrophobic region, is also driven by complex interactions involving low-complexity aggregation-prone segments that are a potential source of structural polymorphism.
Also flagged:agingMacroautophagyautophagydeathage-related neurodegenerative diseasespathogenesis
Journal Article2023-03-29✓ 5 SnippetsDanics L, Abbas AA, Kis B, Pircs K.
In-Text Gene Mentions
S I O 001029)
…Autophagy dysfunction, which is a characteristic of HD, not only impairs the clearance of protein aggregates and non-functioning organelles, but mutant HTT also results in the loss of the beneficial regulatory role of HTT in autophagy (Martin et al., 2015; Luo et al., 2020).…
S I O 001029)
…Metformin is a type II diabetes drug that inhibits translation of mutant HTT through the MID1/PP2A/mTOR protein complex, thereby preventing its synthesis in Hdh150 mouse models in vitro and in vivo (Arnoux et al., 2018).…
S I O 001029)
…Huntington’s disease is a neurodegenerative disorder with an autosomal-dominant inheritance caused by an expansion of CAG repeats that leads to an abnormal polyglutamine strand in the huntingtin protein (HTT).…
Introduction)
…the huntingtin protein (HTT).…
Introduction)
…regulatory role ofHTTin autophagy (…
Show Full Abstract
As our society ages inexorably, geroscience and research focusing on healthy aging is becoming increasingly urgent. Macroautophagy (referred to as autophagy), a highly conserved process of cellular clearance and rejuvenation has attracted much attention due to its universal role in organismal life and death. Growing evidence points to autophagy process as being one of the key players in the determination of lifespan and health. Autophagy inducing interventions show significant improvement in organismal lifespan demonstrated in several experimental models. In line with this, preclinical models of age-related neurodegenerative diseases demonstrate pathology modulating effect of autophagy induction, implicating its potential to treat such disorders. In humans this specific process seems to be more complex. Recent clinical trials of drugs targeting autophagy point out some beneficial effects for clinical use, although with limited effectiveness, while others fail to show any significant improvement. We propose that using more human-relevant preclinical models for testing drug efficacy would significantly improve clinical trial outcomes. Lastly, the review discusses the available cellular reprogramming techniques used to model neuronal autophagy and neurodegeneration while exploring the existing evidence of autophagy's role in aging and pathogenesis in human-derived <i>in vitro</i> models such as embryonic stem cells (ESCs), induced pluripotent stem cell derived neurons (iPSC-neurons) or induced neurons (iNs).
Also flagged:SRKdegradationtransportationcognitionbehavioralvision
Journal Article2023-03-29No SnippetsHe C, Söffker D.
Show Full Abstract
Human factor-related accidents account for an increasing portion of the total accidents through the advancing level of system automation. Human reliability becomes the key issue in human-machine systems especially for safety-relevant tasks and operations. Rasmussen's SRK (skill-rule-knowledge) model is well known in the field of human factors. Likewise, it is well known that skill-based behaviors have the highest human reliability, while knowledge-based behaviors are associated with the lowest reliability scores. Although numerous studies exist on human error probability (HEP), correspondingly typically attributed directly or indirectly to these three levels of behavior, a coherent, consistent representation, especially using data sources, has not been available. In this contribution, the quantification of human behavior levels with Rasmussen's SRK model is given based on three databases for the first time. Effects of time pressure and training on human reliability switching are also analyzed based on related publications. To determine the HEP of these three levels, three databases, technique for human error rate prediction (THERP), Savannah river site human reliability analysis (SRS-HRA) and nuclear action reliability assessment (NARA), from human reliability analysis (HRA) methods are used. The procedure contains identifying the tasks including the operator involved and the assumptions the analysts made and classifying the tasks into suitable cognitive behavior mode (CBM). In this case, the relationship between SRK levels and HEP is mapped. The effects of the two in automation context very relevant performance shaping factors (PSFs), time pressure and training/knowledge degradation, on human behavior levels switching are analyzed and the explanations of the SRK switching are presented. In this case, a more general structure is established to illustrate the dynamic behavior of levels switching with six directions under different conditions. From the results we conclude that skill, rule, and knowledge behavior levels are continuous in terms of HEP and therefore allow a new inside into this key aspect of human factor quantification. Based on this analysis the consequences of daily automation in the context of autonomous transport systems in combination with human qualification and reliability degrading are from this specific and in the current automation discussion very intensively discussed. The presented discussion linking SRK levels and HEP gives a new perspective on the foreseeable consequences of further automation in application areas with increasing automation of everyday tasks (like using a highly automated vehicle).
Also flagged:GlutathioneReduced glutathionesynthesisdetoxificationperoxidesmembranes
Journal Article2023-03-29✓ 1 SnippetVázquez-Meza H, Vilchis-Landeros MM, Vázquez-Carrada M, Uribe-Ramírez D, Matuz-Mares D.
In-Text Gene Mentions
S I O 001029)
…This disease is characterized by an increase in the number of repeats of the cytosine, adenine, and guanine (CAG) triplet in the Huntington gene, located on the short arm of chromosome 4, which codes for a protein rich in glutamine residues known as huntingtin (HTT); therefore, this is considered a hereditary disease with an autosomal dominant pattern [183].…
Show Full Abstract
Reduced glutathione (GSH) is the most abundant non-protein endogenous thiol. It is a ubiquitous molecule produced in most organs, but its synthesis is predominantly in the liver, the tissue in charge of storing and distributing it. GSH is involved in the detoxification of free radicals, peroxides and xenobiotics (drugs, pollutants, carcinogens, etc.), protects biological membranes from lipid peroxidation, and is an important regulator of cell homeostasis, since it participates in signaling redox, regulation of the synthesis and degradation of proteins (S-glutathionylation), signal transduction, various apoptotic processes, gene expression, cell proliferation, DNA and RNA synthesis, etc. GSH transport is a vital step in cellular homeostasis supported by the liver through providing extrahepatic organs (such as the kidney, lung, intestine, and brain, among others) with the said antioxidant. The wide range of functions within the cell in which glutathione is involved shows that glutathione's role in cellular homeostasis goes beyond being a simple antioxidant agent; therefore, the importance of this tripeptide needs to be reassessed from a broader metabolic perspective.
Also flagged:Bile AcidsNeurodegenerative Diseasescholesteroldigestionmetabolismcell-surface receptors
Journal Article2023-03-29✓ 1 SnippetKiriyama Y, Nochi H.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease is caused by cytosine-adenine-guanine (CAG) expansion which encodes a polyglutamine at the N-terminus of huntingtin (HTT) [136].…
Show Full Abstract
Bile acids (BAs) are amphiphilic steroidal molecules generated from cholesterol in the liver and facilitate the digestion and absorption of fat-soluble substances in the gut. Some BAs in the intestine are modified by the gut microbiota. Because BAs are modified in a variety of ways by different types of bacteria present in the gut microbiota, changes in the gut microbiota can affect the metabolism of BAs in the host. Although most BAs absorbed from the gut are transferred to the liver, some are transferred to the systemic circulation. Furthermore, BAs have also been detected in the brain and are thought to migrate into the brain through the systemic circulation. Although BAs are known to affect a variety of physiological functions by acting as ligands for various nuclear and cell-surface receptors, BAs have also been found to act on mitochondria and autophagy in the cell. This review focuses on the BAs modified by the gut microbiota and their roles in intracellular organelles and neurodegenerative diseases.
Journal Article2023-03-29No SnippetsXie J, Tan B, Zhang Y.
Show Full Abstract
Bats have received increasing attention because of some unique biological features they possess. TRIM is a large family of proteins that participate in diverse cellular functions, such as antiviral immunity, DNA damage repair, tumor suppression, and aging. These functional areas appear to be highly consistent with the special characteristics of bats, such as tolerance to viruses and DNA damage generated in flight, low cancer incidence, and longevity. However, there is still a lack of systematic study of the TRIM family in bats. Here, we explored the TRIM family of bats using the genomes of 16 representative species. The results showed that the bat TRIM family contains 70 members, with 24 under positive selection and 7 duplicated. Additional transcriptomic analysis revealed the tissue-specific expressions of <i>TRIM9</i>, <i>46</i>, <i>54</i>, <i>55</i>, <i>63</i>, and <i>72</i>. Additionally, following interferon or viral stimulation, <i>TRIM</i> orthologs associated with antiviral immunity reported in humans were also upregulated in bat cells. The present study systematically analyzed the composition, evolution, and expression of bat <i>TRIM</i> genes. It may provide a theoretical basis for studies of bat TRIM in the fields of antiviral immunity, longevity, and tolerance to DNA damage.
Also flagged:colorectal tumorscolorectal cancerTumorgene expressionhematoxylinepithelial to mesenchymal transition
Journal Article2023-03-29No SnippetsFatemi M, Feng E, Sharma C, Azher Z, Goel T, Ramwala O, Palisoul SM, Barney RE, Perreard L, Kolling FW, Salas LA, Christensen BC, Tsongalis GJ, Vaickus LJ, Levy JJ.
Show Full Abstract
Over 150 000 Americans are diagnosed with colorectal cancer (CRC) every year, and annually over 50 000 individuals will die from CRC, necessitating improvements in screening, prognostication, disease management, and therapeutic options. Tumor metastasis is the primary factor related to the risk of recurrence and mortality. Yet, screening for nodal and distant metastasis is costly, and invasive and incomplete resection may hamper adequate assessment. Signatures of the tumor-immune microenvironment (TIME) at the primary site can provide valuable insights into the aggressiveness of the tumor and the effectiveness of various treatment options. Spatially resolved transcriptomics technologies offer an unprecedented characterization of TIME through high multiplexing, yet their scope is constrained by cost. Meanwhile, it has long been suspected that histological, cytological, and macroarchitectural tissue characteristics correlate well with molecular information (e.g., gene expression). Thus, a method for predicting transcriptomics data through inference of RNA patterns from whole slide images (WSI) is a key step in studying metastasis at scale. In this work, we collected tissue from 4 stage-III (pT3) matched colorectal cancer patients for spatial transcriptomics profiling. The Visium spatial transcriptomics (ST) assay was used to measure transcript abundance for 17 943 genes at up to 5000 55-micron (i.e., 1-10 cells) spots per patient sampled in a honeycomb pattern, co-registered with hematoxylin and eosin (H&E) stained WSI. The Visium ST assay can measure expression at these spots through tissue permeabilization of mRNAs, which are captured through spatially (i.e., x-y positional coordinates) barcoded, gene specific oligo probes. WSI subimages were extracted around each co-registered Visium spot and were used to predict the expression at these spots using machine learning models. We prototyped and compared several convolutional, transformer, and graph convolutional neural networks to predict spatial RNA patterns at the Visium spots under the hypothesis that the transformer- and graph-based approaches better capture relevant spatial tissue architecture. We further analyzed the model's ability to recapitulate spatial autocorrelation statistics using SPARK and SpatialDE. Overall, the results indicate that the transformer- and graph-based approaches were unable to outperform the convolutional neural network architecture, though they exhibited optimal performance for relevant disease-associated genes. Initial findings suggest that different neural networks that operate on different scales are relevant for capturing distinct disease pathways (e.g., epithelial to mesenchymal transition). We add further evidence that deep learning models can accurately predict gene expression in whole slide images and comment on understudied factors which may increase its external applicability (e.g., tissue context). Our preliminary work will motivate further investigation of inference for molecular patterns from whole slide images as metastasis predictors and in other applications.
Also flagged:MethotrexateNanohydroxyapatitePolyethylene Glycoltumorsosteosarcomahydroxyapatite
Journal Article2023-03-29No SnippetsOu L, Zhang Q, Chang Y, Xia N.
Show Full Abstract
Neoadjuvant chemotherapy is an alternative treatment modality for tumors. Methotrexate (MTX) has been often used as a neoadjuvant chemotherapy reagent for osteosarcoma surgery. However, the large dosage, high toxicity, strong drug resistance, and poor improvement of bone erosion restricted the utilization of methotrexate. Here, we developed a targeted drug delivery system using nanosized hydroxyapatite particles (nHA) as the cores. MTX was conjugated to polyethylene glycol (PEG) through the pH-sensitive ester linkage and acted as both the folate receptor-targeting ligand and the anti-cancer drug due to the similarity to the structure of folic acid. Meanwhile, nHA could increase the concentration of calcium ions after being uptake by cells, thus inducing mitochondrial apoptosis and improving the efficacy of medical treatment. In vitro drug release studies of MTX-PEG-nHA in phosphate buffered saline at different pH values (5, 6.4 and 7.4) indicated that the system showed a pH-dependent release feature because of the dissolution of ester bonds and nHA under acidic conditions. Furthermore, the treatment on osteosarcoma cells (143B, MG63, and HOS) by using MTX-PEG-nHA was demonstrated to exhibit higher therapeutic efficacy. Therefore, the developed platform possesses the great potential for osteosarcoma therapy.
Also flagged:Calcific aortic valve stenosisvalvular heart diseaseagingextracellular matrix proteinscalcium phosphateECM protein
Journal Article2023-03-29No SnippetsAnousakis-Vlachochristou N, Athanasiadou D, Carneiro KMM, Toutouzas K.
Show Full Abstract
Calcific aortic valve stenosis (CAVS) is a widespread valvular heart disease affecting people in aging societies, primarily characterized by fibrosis, inflammation, and progressive calcification, leading to valve orifice stenosis. Understanding the factors associated with CAVS onset and progression is crucial to develop effective future pharmaceutical therapies. In CAVS, native extracellular matrix proteins modifications, play a significant role in calcification in vitro and in vivo. This work aimed to review the evidence on the alterations of structural native extracellular matrix proteins involved in calcification development during CAVS and highlight its link to deregulated biomechanical function.
A percutaneous osseointegrated device becomes deeply ingrown by endosteal bone and traverses the overlying soft tissues of the residual limb, providing a direct link to the bone-anchored artificial limb. Continuous wound healing around these devices can result in the formation of sinus tracts as "down-growing" epithelial cells are unable to recognize and adhere to the "nonbiological" implant surface. Such sinus tracts provide paths for bacterial colonization and deep infection. In order to limit adverse outcomes and provide a robust seal, it was hypothesized that by coating the titanium surface of the percutaneous post with the mineral component of dental enamel, down-growing epidermal cells might recognize the coating as "biological" and adhere to this nonliving surface. To test this hypothesis, sintered partially and fully fluoridated hydroxyapatite (HA) was chosen as coatings. Using an established surgical protocol, fluorapatite (FA), hydroxyfluorapatite (FHA), HA-coated percutaneous posts, and titanium controls were surgically placed under the dorsal skin in 20 CD hairless rats. The animals were sacrificed at four weeks, and implants and surrounding tissues were harvested and subjected to further analyses. Downgrowth and granulation tissue area data showed statistically significant reductions around the FA-coated devices. Moreover, compared to the control group, the FA- and HA-coated groups showed downregulation of mRNA for EGFr, EGF, and FGF-10. Interestingly, the FA-coated group had upregulation of TGF-<i>α</i>. These data suggest that FA could become an ideal coating material for preventing downgrowth, assuming the long-term stability of these coated surfaces can be verified in a clinically relevant animal model.
medRxiv2023-03-29Preprint (No Snippets API)Zeng L, Fujita M, Gao Z, White CC, Green GS, Habib N, Menon V, Bennett DA, Boyle PA, Klein H, De Jager PL.
Show Full Abstract
<h4>Background</h4> Depression is a common psychiatric illness and global public health problem. However, our limited understanding of the biological basis of depression has hindered the development of novel treatments and interventions. <h4>Methods</h4> To identify new candidate genes for therapeutic development, we examined single-nucleus RNA sequencing (snucRNAseq) data from the dorsolateral prefrontal cortex (N=424) in relation to ante-mortem depressive symptoms. To complement these direct analyses, we also used genome- wide association study (GWAS) results for depression (N=500,199) along with genetic tools for inferring the expression of 22,159 genes in 7 cell types and 55 cell subtypes to perform transcriptome-wide association studies (TWAS) of depression followed by Mendelian randomization (MR). <h4>Results</h4> Our single-nucleus TWAS analysis identified 71 causal genes in depression that have a role in specific neocortical cell subtypes; 59 of 71 genes were novel compared to previous studies. Depression TWAS genes showed a cell type specific pattern, with the greatest enrichment being in both excitatory and inhibitory neurons as well as astrocytes. Gene expression in different neuron subtypes have different directions of effect on depression risk. Compared to lower genetically correlated traits (e.g. body mass index) with depression, higher correlated traits (e.g., neuroticism) have more common TWAS genes with depression. In parallel, we performed differential gene expression analysis in relation to depression in 55 cortical cell subtypes, and we found that genes such as ANKRD36 , MADD , TAOK3 , SCAI and CHUK are associated with depression in specific cell subtypes. <h4>Conclusions</h4> These two sets of analyses illustrate the utility of large snucRNAseq data to uncover both genes whose expression is altered in specific cell subtypes in the context of depression and to enhance the interpretation of well-powered GWAS so that we can prioritize specific susceptibility genes for further analysis and therapeutic development.
medRxiv2023-03-29Preprint (No Snippets API)Severens JF, Karakaslar EO, van der Reijden BA, Sánchez-López E, van den Berg RR, Halkes CJ, van Balen P, Veelken H, Reinders MJ, Griffioen M, van den Akker EB.
Show Full Abstract
Subtyping of acute myeloid leukaemia (AML) is predominantly based on recurrent genetic abnormalities, but recent literature indicates that transcriptomic phenotyping holds immense potential to further refine AML classification. Here we integrated five AML transcriptomic datasets with corresponding genetic information to provide an overview (n=1224) of the transcriptomic AML landscape. Consensus clustering identified 17 robust patient clusters which improved identification of CEBPA -mutated patients with favourable outcomes, and uncovered transcriptomic subtypes for KMT2A rearrangements (2), NPM1 mutations (5), and AML with myelodysplasia-related changes (AML-MRC) (5). Transcriptomic subtypes of KMT2A , NPM1 and AML-MRC showed distinct mutational profiles, cell type differentiation arrests and immune properties, suggesting differences in underlying disease biology. Moreover, our transcriptomic clusters show differences in ex-vivo drug responses, even when corrected for differentiation arrest and superiorly capture differences in drug response compared to genetic classification. In conclusion, our findings underscore the importance of transcriptomics in AML subtyping and offer a basis for future research and personalised treatment strategies. Our transcriptomic compendium is publicly available and we supply an R package to project clusters to new transcriptomic studies.
bioRxiv2023-03-29Preprint (No Snippets API)Thorwald MA, Godoy-Lugo JA, Garcia G, Silva J, Kim M, Christensen A, Mack WJ, Head E, O’Day PA, Benayoun BA, Morgan TE, Pike CJ, Higuchi-Sanabria R, Forman HJ, Finch CE.
Show Full Abstract
<h4> ABSTRACT </h4> Iron-mediated cell death (ferroptosis) is a proposed mechanism of Alzheimer’s disease (AD) pathology. While iron is essential for basic biological functions, its reactivity generates oxidants which contribute to cell damage and death. To further resolve mechanisms of iron-mediated toxicity in AD, we analyzed postmortem human brain and ApoEFAD mice. AD brains had decreased antioxidant enzymes, including those mediated by glutathione (GSH). Subcellular analyses of AD brains showed greater oxidative damage and lower antioxidant enzymes in lipid rafts, the site of amyloid processing, than in the non-raft membrane fraction. ApoE4 carriers had lower lipid raft yield with greater membrane oxidation. The hypothesized role of iron to AD pathology was tested in ApoEFAD mice by iron chelation with deferoxamine, which decreased fibrillar amyloid and lipid peroxidation, together with increased GSH-mediated antioxidants. These novel molecular pathways in iron mediated damage during AD. <h4>Graphical Abstract</h4> Hypothesis: AD brain lipid peroxidation is driven by increased brain iron and decreased antioxidant defenses. Schema shows proteins that mediate iron metabolism in relation to lipid peroxidation (HNE) and antioxidant defenses in prefrontal cortex. AD-associated increase (red), decrease (blue), or no change (grey), relative to cognitively normal elderly controls. Aβ; amyloid beta, ALDH2; alcohol dehydrogenase, APP; amyloid precursor protein, DMT1; divalent metal transporter 1; FPN, ferroportin; FSP1, ferroptosis suppressor protein 1, which requires the quinol cycle to attenuate lipid peroxidation; FTH1, ferritin heavy chain; FTL; ferritin light chain; GCLC, glutathione cysteine ligase catalytic subunit; GCLM, glutathione cysteine ligase modulator; GPx4, glutathione peroxidase 4; GSH, glutathione; GSSG, glutathione disulfide; GSTA4, glutathione S-transferase A4; HMOX; heme oxygenase; IRP, iron regulatory protein; LAT1, large neutral amino acid transporter 1; LOOH, Lipid hydroperoxides; Nrf2, Nuclear factor erythroid 2-related factor 2; Prdx6, peroxiredoxin 6; TF, transferrin, TfR; Transferrin receptor; xCT, cysteine-glutamate antiporter.
Also flagged:HSPA1ADGKHNOTCH2ParkinsonParkinson's diseasePD
Journal Article2023-03-28✓ 2 SnippetsAsad Samani L, Ghaedi K, Majd A, Peymani M, Etemadifar M.
In-Text Gene Mentions
Abstract)
…levels of NOTCH2,H4C8, and H2BC21 associated…
Abstract)
…HSPA1A/B, NOTCH2, andH4C8were overexpressed in…
Show Full Abstract
<h4>Background</h4>Diagnosis of Parkinson's disease (PD) is associated with a vast number of challenges. This study aimed to assess the overlap of PD patients' transcriptomes in the substantia nigra (SN) with peripheral blood mononuclear cells (PBMCs) to discover potential biomarkers for diagnosis.<h4>Methods</h4>GEO data were used to select genes with significant changes in expression level in the SN region and eligible studies. Also, transcriptome data related to blood of PD patients with other neurodegenerative diseases (ND) was considered. Differential expression genes between PD and control were evaluated in the SN and blood, and RT-qPCR was applied to validate the findings.<h4>Results</h4>At the expression level, no significant similarity in long non-coding RNA was found between the patients' SN and blood. While in silico results revealed 16 common mRNAs in SN and blood with significant expression levels. Among all overexpressed mRNAs, HSPA1A/B expression level had the highest expression difference between control and PD samples. Moreover, DGKH had the highest score of down-regulated genes in both blood and SN. The NOTCH pathway had the highest score pathway among up-regulated pathways, and the expression levels of NOTCH2, H4C8, and H2BC21 associated with this pathway had the most ability to separate the control and PD populations. Furthermore, RT-qPCR results revealed that HSPA1A/B, NOTCH2, and H4C8 were overexpressed in PD PBMCs, while DGKH expression levels were lower compared to controls.<h4>Conclusion</h4>Our findings indicate that expression levels of HSPA1A/B, DGKH, and NOTCH2 could be applied as candidate biomarkers to diagnose PD patients in the SN region and PBMCs.
Also flagged:papillary thyroid carcinomathyroid neoplasmborderline tumorbenign tumorRETPTC
Journal Article2023-03-28No SnippetsUmekita Y, Umeki K, Kawano F, Tanaka H, Kataoka H.
Show Full Abstract
<h4>Background</h4>Hyalinizing trabecular tumor is a rare follicular cell-derived thyroid neoplasm that is considered to be a borderline tumor with malignant potential rather than a benign tumor. The detection of RET/PTC rearrangements and nuclear cytologic features suggests a relationship between hyalinizing trabecular tumor and papillary thyroid carcinoma. Some recent observations of pathogenic genetic alterations in hyalinizing trabecular tumor have indicated that hyalinizing trabecular tumor is not related to papillary thyroid carcinoma, and should be considered an independent entity. Here we present a case of papillary thyroid carcinoma with hyalinizing trabecular tumor-like features and discuss its interesting aspects and diagnostic issues from a histopathological perspective.<h4>Case presentation</h4>A 19-year-old Japanese woman with an enlarged thyroid gland was admitted to our hospital. Based on fine-needle aspiration cytology, the enlarged nodule was suspected to be a follicular lesion or follicular tumor. A nodular lesion approximately 3 cm in diameter was detected in the left lobe of the thyroid gland. Histological analysis revealed that the tumor cells were mainly arranged in follicles. Solid nests with occasional trabecular arrangements and papillary structures were intermingled, and the tumor cells showed ground-glass nuclei and occasional nuclear grooving. Petaloid and block-like periodic-acid-Schiff and periodic-acid-methenamine-positive basement membrane components were observed in the interstitium of the solid portions of the tumor. Incomplete membranous immunoreactivity of MIB-1 (Ki-67 (cell prolferation marker)) was also observed in the cells within the solid areas. Moreover, this tumor displayed extracapsular invasion and metastasis to the perithyroidal lymph nodes, suggesting that it may be a malignant tumor. However, BRAF<sup>V600E</sup> mutation, RET/PTC rearrangements, and PAX8/GLIS 1 and PAX8/GLIS 3 rearrangements were not detected.<h4>Conclusion</h4>We diagnosed the tumor as a papillary thyroid carcinoma with characteristic features of hyalinizing trabecular tumor. Importantly, this case may indicate a possible relationship between papillary thyroid carcinoma and hyalinizing trabecular tumor, although specific genetic alterations could not be detected. We also discuss the preoperative diagnostic difficulties with fine-needle aspiration cytology and the unusual pathological findings in this case.
Also flagged:cinnamaldehydefluconazoleCINATPasessecretionserine
Journal Article2023-03-28No SnippetsDi Vito M, Garzoli S, Rosato R, Mariotti M, Gervasoni J, Santucci L, Ovidi E, Cacaci M, Lombarini G, Torelli R, Urbani A, Sanguinetti M, Bugli F.
Show Full Abstract
<i>Candida auris</i> is a multidrug-resistant fungus known to be a global public health problem. The skin-based transmission, together with the marked resistance to drugs, resulted in its rapid spread to all continents. The aim of this study was to identify an essential oil (EO) active in the fight against <i>C. auris</i>. A total of 15 EOs were tested against 10 clinical strains of <i>C. auris</i>. <i>Cinnamomum zeylanicum</i> EO (CZ-EO) was the most effective (MIC90 and MFC90 equal to 0.06% vol/vol). Three fractions obtained from CZ-EO, and the cinnamaldehyde (CIN), the major chemical compound, were tested to identify the principal compound effectives against <i>C. auris</i>. All CIN-containing samples showed anti-fungal activity. To study the synergy with fluconazole, CZ-EO, its active fraction (FR2), and CIN were tested in checkerboard tests. Results show that CZ-EO and FR2, but not CIN, synergize with fluconazole. Furthermore, only the copresence of CZ-EO or FR2 synergize with fluconazole at therapeutic concentrations of the drug (0.45 ± 0.32 μg/mL and 0.64 ± 0.67 μg/mL, respectively), while CIN only shows additive activity. <i>In vivo</i> studies conducted on <i>Galleria mellonella</i> larvae show the absence of toxicity of CZ-EO up to concentrations of 16% vol/vol, and the ability of CZ-EO to reactivate the efficacy of fluconazole when formulated at synergic concentrations. Finally, biochemical tests were made to study the mechanism of action of CZ-EO. These studies show that in the presence of both fluconazole and CZ-EO, the activity of fungal ATPases decreases and, at the same time, the amount of intracellular drug increases. <b>IMPORTANCE</b> This study highlights how small doses of CZ-EO are able to inhibit the secretion of fluconazole and promote its accumulation in the fungal cell. In this manner, the drug is able to exert its pharmacological effects bypassing the resistance of the yeast. If further studies will confirm this synergy, it will be possible to develop new therapeutic formulations active in the fight against <i>C. auris</i> resistances.
Journal Article2023-03-28✓ 1 SnippetBaysoy A, Seddu K, Salloum T, Dawson CA, Lee JJ, Yang L, Gal-Oz S, Ner-Gaon H, Tellier J, Millan A, Sasse A, Brown B, Lanier LL, Shay T, Nutt S, Dwyer D, Benoist C, Immunological Genome Project Consortium.
In-Text Gene Mentions
Results)
…the Zpf36 ,Rc3h1(Roquin) or Zc3h12a…
Show Full Abstract
"γc" cytokines are a family whose receptors share a "common-gamma-chain" signaling moiety, and play central roles in differentiation, homeostasis, and communications of all immunocyte lineages. As a resource to better understand their range and specificity of action, we profiled by RNAseq the immediate-early responses to the main γc cytokines across all immunocyte lineages. The results reveal an unprecedented landscape: broader, with extensive overlap between cytokines (one cytokine doing in one cell what another does elsewhere) and essentially no effects unique to any one cytokine. Responses include a major downregulation component and a broad Myc-controlled resetting of biosynthetic and metabolic pathways. Various mechanisms appear involved: fast transcriptional activation, chromatin remodeling, and mRNA destabilization. Other surprises were uncovered: IL2 effects in mast cells, shifts between follicular and marginal zone B cells, paradoxical and cell-specific cross-talk between interferon and γc signatures, or an NKT-like program induced by IL21 in CD8+ T cells.
Also flagged:inflammatory disorderautoimmune diseasescyclopeptidesfibronectinCyclopeptidecell adhesion
receptor
Journal Article2023-03-28No SnippetsAnselmi M, Baiula M, Spampinato S, Artali R, He T, Gentilucci L.
Show Full Abstract
α<sub>4</sub>β<sub>1</sub> integrin is a cell adhesion receptor deeply involved in the migration and accumulation of leukocytes. Therefore, integrin antagonists that inhibit leukocytes recruitment are currently regarded as a therapeutic opportunity for the treatment of inflammatory disorder, including leukocyte-related autoimmune diseases. Recently, it has been suggested that integrin agonists capable to prevent the release of adherent leukocytes might serve as therapeutic agents as well. However, very few α<sub>4</sub>β<sub>1</sub> integrin agonists have been discovered so far, thus precluding the investigation of their potential therapeutic efficacy. In this perspective, we synthesized cyclopeptides containing the LDV recognition motif found in the native ligand fibronectin. This approach led to the discovery of potent agonists capable to increase the adhesion of α<sub>4</sub> integrin-expressing cells. Conformational and quantum mechanics computations predicted distinct ligand-receptor interactions for antagonists or agonists, plausibly referable to receptor inhibition or activation.
<h4>Objective</h4>APC (adenomatous polyposis coli) gene mutation is a central initialization in colon cancer tumorigenesis. However, the connection between APC gene mutation and immunotherapy efficacy for colon cancer remains unknown. This study aimed to explore the impact of APC mutation on immunotherapy efficacy for colon cancer.<h4>Methods</h4>Colon cancer data from The Cancer Genome Atlas (TCGA) and Memorial Sloan Kettering Cancer Center (MSKCC) were used for the combined analysis. Survival analysis was performed to evaluate the association between APC mutation and immunotherapy efficacy in colon cancer patients. The expressions of immune check point molecules, tumor mutation burden (TMB), CpG methylation level, tumor purity (TP), microsatellite instability (MSI) status and tumor-infiltrating lymphocyte (TIL) in the two APC status were compared to evaluate the associations between APC mutation and immunotherapy efficacy indicators. Gene set enrichment analysis (GSEA) was performed to identify signaling pathways related to APC mutation.<h4>Results</h4>APC was the most frequently mutated gene in colon cancer. The survival analysis demonstrated that APC mutation was correlated with a worse immunotherapy outcome. APC mutation was associated with lower TMB, lower expression of immune check point molecules (PD-1/PD-L1/PD-L2), higher TP, lower MSI-High proportion and less CD8 + T cells and follicular helper T cells infiltration. GSEA indicated that APC mutation up-regulated mismatch repair pathway, which may play a negative role in evoking an antitumor immune response.<h4>Conclusion</h4>APC mutation is associated with worse immunotherapy outcome and inhibition of antitumor immunity. It can be used as a negative biomarker to predict immunotherapy response.
Also flagged:CDK4infectiondeathpalbociclibcyclin-dependent kinase 4Lgr5
Journal Article2023-03-28✓ 2 SnippetsXiang J, Wang H, Tao Q, Li W, Huang Y, Zhang Y, Yang L, Zhang S.
In-Text Gene Mentions
Abstract)
…Lineage tracing studies have shown that palbociclib protects active ISCs marked by Lgr5 and Olfm4 during chemotherapy and unexpectedly activates quiescent ISCs marked by Bmi1 to immediately participate in crypt regeneration after chemotherapy.…
Also flagged:BTN3A1T cell receptorimmunoglobulin Vcell-surfacebindingextracellular
Journal Article2023-03-28✓ 5 SnippetsWillcox CR, Salim M, Begley CR, Karunakaran MM, Easton EJ, von Klopotek C, Berwick KA, Herrmann T, Mohammed F, Jeeves M, Willcox BE.
In-Text Gene Mentions
Title)
…germline interaction withBTN2A1.…
Abstract)
…"P-Ag sensor," andBTN2A1, a direct ligand…
Abstract)
…Here, we characterizeBTN2A1interactions with Vγ9Vδ2…
Abstract)
…mutagenesis establish aBTN2A1-immunoglobulin V (IgV)/BTN3A1…
Abstract)
…BTN3A1-IgV binding toBTN2A1-IgV is mutually exclusive,…
Show Full Abstract
Vγ9Vδ2 T cells play critical roles in microbial immunity by detecting target cells exposed to pathogen-derived phosphoantigens (P-Ags). Target cell expression of BTN3A1, the "P-Ag sensor," and BTN2A1, a direct ligand for T cell receptor (TCR) Vγ9, is essential for this process; however, the molecular mechanisms involved are unclear. Here, we characterize BTN2A1 interactions with Vγ9Vδ2 TCR and BTN3A1. Nuclear magnetic resonance (NMR), modeling, and mutagenesis establish a BTN2A1-immunoglobulin V (IgV)/BTN3A1-IgV structural model compatible with their cell-surface association in cis. However, TCR and BTN3A1-IgV binding to BTN2A1-IgV is mutually exclusive, owing to binding site proximity and overlap. Moreover, mutagenesis indicates that the BTN2A1-IgV/BTN3A1-IgV interaction is non-essential for recognition but instead identifies a molecular surface on BTN3A1-IgV essential to P-Ag sensing. These results establish a critical role for BTN3A-IgV in P-Ag sensing, in mediating direct or indirect interactions with the γδ-TCR. They support a composite-ligand model whereby intracellular P-Ag detection coordinates weak extracellular germline TCR/BTN2A1 and clonotypically influenced TCR/BTN3A-mediated interactions to initiate Vγ9Vδ2 TCR triggering.
<h4>Background</h4>Episodic ataxia (EA), characterized by recurrent attacks of cerebellar dysfunction, is the manifestation of a group of rare autosomal dominant inherited disorders. EA1 and EA2 are most frequently encountered, caused by mutations in <i>KCNA1</i> and <i>CACNA1A</i>. EA3-8 are reported in rare families. Advances in genetic testing have broadened the <i>KCNA1</i> and <i>CACNA1A</i> phenotypes, and detected EA as an unusual presentation of several other genetic disorders. Additionally, there are various secondary causes of EA and mimicking disorders. Together, these can pose diagnostic challenges for neurologists.<h4>Methods</h4>A systematic literature review was performed in October 2022 for 'episodic ataxia' and 'paroxysmal ataxia', restricted to publications in the last 10 years to focus on recent clinical advances. Clinical, genetic, and treatment characteristics were summarized.<h4>Results</h4>EA1 and EA2 phenotypes have further broadened. In particular, EA2 may be accompanied by other paroxysmal disorders of childhood with chronic neuropsychiatric features. New treatments for EA2 include dalfampridine and fampridine, in addition to 4-aminopyridine and acetazolamide. There are recent proposals for EA9-10. EA may also be caused by gene mutations associated with chronic ataxias (<i>SCA-14, SCA-27, SCA-42, AOA2, CAPOS</i>), epilepsy syndromes (<i>KCNA2, SCN2A, PRRT2</i>), GLUT-1, mitochondrial disorders (<i>PDHA1, PDHX, ACO2</i>), metabolic disorders (Maple syrup urine disease, Hartnup disease, type I citrullinemia, thiamine and biotin metabolism defects), and others. Secondary causes of EA are more commonly encountered than primary EA (vascular, inflammatory, toxic-metabolic). EA can be misdiagnosed as migraine, peripheral vestibular disorders, anxiety, and functional symptoms. Primary and secondary EA are frequently treatable which should prompt a search for the cause.<h4>Discussion</h4>EA may be overlooked or misdiagnosed for a variety of reasons, including phenotype-genotype variability and clinical overlap between primary and secondary causes. EA is highly treatable, so it is important to consider in the differential diagnosis of paroxysmal disorders. Classical EA1 and EA2 phenotypes prompt single gene test and treatment pathways. For atypical phenotypes, next generation genetic testing can aid diagnosis and guide treatment. Updated classification systems for EA are discussed which may assist diagnosis and management.
Also flagged:organic acidsphosphorusfulvic acidpolyaspartic acidtannic acidsuperphosphate
Journal Article2023-03-28No SnippetsShen Y, Ma Z, Chen H, Lin H, Li G, Li M, Tan D, Gao W, Jiao S, Liu P, Song X, Chang S.
Show Full Abstract
To improve the availability of inorganic phosphorus (P) in soil, we investigated the role of three macromolecular organic acids (MOAs), including fulvic acid (FA), polyaspartic acid (PA), and tannic acid (TA), in reducing the fixation of inorganic P fertilizer in the soil. AlPO<sub>4</sub>, FePO<sub>4</sub>, and Ca<sub>8</sub>H<sub>2</sub>(PO<sub>4</sub>)<sub>6</sub>·5H<sub>2</sub>O crystals were chosen as insoluble phosphate representatives in the soil to simulate the solubilization process of inorganic P by MOAs. The microstructural and physicochemical properties of AlPO<sub>4</sub>, FePO<sub>4</sub>, and Ca<sub>8</sub>H<sub>2</sub>(PO<sub>4</sub>)<sub>6</sub>·5H<sub>2</sub>O were determined by scanning electron microscopy (SEM), Fourier-transform infrared spectroscopy (FT-IR), and X-ray photoelectron spectroscopy (XPS) before and after treatment of MOAs. In addition, the amounts of leached P and fixed inorganic P in Inceptisols and Alfisols affected by MOAs combined with superphosphate (SP) fertilizer were determined by soil leaching experiments. The presence of the three MOAs significantly increased the concentration of leached P and reduced the contents of insoluble inorganic phosphate formed with iron, aluminum, and calcium fixed in the soil, in which PA combined with SP had the most significant effect. Furthermore, the less inorganic P fixation in the combination treatment of MOAs and SP resulted in a greater wheat yield and P uptake. Therefore, MOAs could be a synergistic material for increasing P fertilizer utilization.
Also flagged:cancertumorcancersofgene expressiondeath
Journal Article2023-03-28No SnippetsWieder R.
Show Full Abstract
Differentiated epithelial cells reside in the homeostatic microenvironment of the native organ stroma. The stroma supports their normal function, their G<sub>0</sub> differentiated state, and their expansion/contraction through the various stages of the life cycle and physiologic functions of the host. When malignant transformation begins, the microenvironment tries to suppress and eliminate the transformed cells, while cancer cells, in turn, try to resist these suppressive efforts. The tumor microenvironment encompasses a large variety of cell types recruited by the tumor to perform different functions, among which fibroblasts are the most abundant. The dynamics of the mutual relationship change as the sides undertake an epic battle for control of the other. In the process, the cancer "wounds" the microenvironment through a variety of mechanisms and attracts distant mesenchymal stem cells to change their function from one attempting to suppress the cancer, to one that supports its growth, survival, and metastasis. Analogous reciprocal interactions occur as well between disseminated cancer cells and the metastatic microenvironment, where the microenvironment attempts to eliminate cancer cells or suppress their proliferation. However, the altered microenvironmental cells acquire novel characteristics that support malignant progression. Investigations have attempted to use these traits as targets of novel therapeutic approaches.
Also flagged:GlioblastomaGBMtumorSOXSRY-related HMG-boxglioma tumor
Journal Article2023-03-28✓ 3 SnippetsStevanovic M, Kovacevic-Grujicic N, Petrovic I, Drakulic D, Milivojevic M, Mojsin M.
In-Text Gene Mentions
S I O 001029)
…On the other hand, data from the Human Protein Atlas database showed that the SOX6 protein level was higher in GBM cancer tissue compared to normal tissue [54].…
S I O 001029)
…The SOXD group of potential tumor suppressors in GBM comprises SOX5, SOX6, and SOX13.…
S I O 001029)
…The expression of SOX6 was downregulated in GBM and a similar expression profile was described for SOX13 [53].…
Show Full Abstract
Glioblastoma (GBM) continues to be the most devastating primary brain malignancy. Despite significant advancements in understanding basic GBM biology and enormous efforts in developing new therapeutic approaches, the prognosis for most GBM patients remains poor with a median survival time of 15 months. Recently, the interplay between the <i>SOX</i> (SRY-related HMG-box) genes and lncRNAs (long non-coding RNAs) has become the focus of GBM research. Both classes of molecules have an aberrant expression in GBM and play essential roles in tumor initiation, progression, therapy resistance, and recurrence. In GBM, <i>SOX</i> and lncRNAs crosstalk through numerous functional axes, some of which are part of the complex transcriptional and epigenetic regulatory mechanisms. This review provides a systematic summary of current literature data on the complex interplay between <i>SOX</i> genes and lncRNAs and represents an effort to underscore the effects of SOX/lncRNA crosstalk on the malignant properties of GBM cells. Furthermore, we highlight the significance of this crosstalk in searching for new biomarkers and therapeutic approaches in GBM treatment.
…of people withhemochromatosisdeserves attention, as…
Show Full Abstract
Adequate dietary iron (Fe) intake is crucial for preventing Fe-deficient anemia, a recognized global public health concern which is important in Armenia. This study aimed to analyze the intake of Fe, both heme (from animal tissues) and non-heme (more prevalent, but less efficiently absorbed), as well as the Fe dietary sources, among adults in a representative national sample in Armenia. The study was conducted on 1400 individuals aged 18-80 and above, who were enrolled from all regions of Armenia. The Fe intake was assessed through a 24 h dietary recall survey, while Fe occurrence was determined through atomic absorption spectrophotometry (AAS). The results showed a high proportion of adults with a Fe intake lower than the average requirements set by EFSA (65%, 80% and 85% of males, total females and females at fertile age, respectively). Main Fe sources were bread, fruits and vegetables; heme Fe accounted only for <5% of total Fe intake. Compared to males, females had a lower intake of all forms of Fe (<i>p</i> < 0.05). Significant differences were observed in the intake of different forms of Fe between regions (<i>p</i> < 0.05), while the age-group 36-55 years had higher intakes of total Fe. Our data call for comprehensive nutritional security strategies in order to reduce iron deficiency in Armenia, that represents a public health concern.
Also flagged:methylationLiver fibrosisgene expressionmetabolismtumorpathogenesis
Journal Article2023-03-28✓ 4 SnippetsLyu SY, Xiao W, Cui GZ, Yu C, Liu H, Lyu M, Kuang QY, Xiao EH, Luo YH.
In-Text Gene Mentions
S I O 001029)
…As DNMT plays an important role in DNA methylation, DNMT inhibition may block the hypermethylation and downregulate related genes (such as PTGIS, PTEN, and Smad2/Smad3), inhibit the activation and proliferation of HSCs, inhibit the expression of α-SMA and COL1A1 in vitro, and delay liver fibrosis.…
S I O 001029)
…Pan et al. (2018) found that the promoter of the PTGIS gene was detected to be hypermethylated and under-expressed in TGFβ1-activated HSC-T6 and a CCl4-induced liver fibrosis mouse model, whereas enforced expression of PTGIS in vitro and in vivo could counteract the activation of HSCs and even cause apoptosis, thereby alleviating liver fibrosis.…
S I O 001029)
…DNA methylation of PTGIS plays an important role in the progression of liver fibrosis and activation of HSCs, implying that targeting PTGIS has a therapeutic potential ability to treat liver fibrosis.…
S I O 001029)
…Notably, PTGIS expression is elevated in the early stages of CCl4-induced liver fibrosis mice models only to be downregulated at a later stage (Pan et al., 2018).…
Show Full Abstract
Liver fibrosis is a repair response to injury caused by various chronic stimuli that continually act on the liver. Among them, the activation of hepatic stellate cells (HSCs) and their transformation into a myofibroblast phenotype is a key event leading to liver fibrosis, however the mechanism has not yet been elucidated. The molecular basis of HSC activation involves changes in the regulation of gene expression without changes in the genome sequence, namely, <i>via</i> epigenetic regulation. DNA methylation is a key focus of epigenetic research, as it affects the expression of fibrosis-related, metabolism-related, and tumor suppressor genes. Increasing studies have shown that DNA methylation is closely related to several physiological and pathological processes including HSC activation and liver fibrosis. This review aimed to discuss the mechanism of DNA methylation in the pathogenesis of liver fibrosis, explore DNA methylation inhibitors as potential therapies for liver fibrosis, and provide new insights on the prevention and clinical treatment of liver fibrosis.
Also flagged:cuproptosishepatocellular carcinomaFDX1LINC02870KDM4AMKLN1
Journal Article2023-03-28✓ 5 SnippetsYuan W, Xiao JH, Zhang JS, Mao BL, Wang PZ, Wang BL.
In-Text Gene Mentions
Results)⭐ same-sentence co-mention
…BTN2A1, BTN2A2, TNFSF4, CD47,…
Results)⭐ same-sentence co-mention
…BTN2A1,BTN2A2, TNFSF4, CD47, CD276,…
Results)⭐ same-sentence co-mention
…BTN2A1, BTN2A2,TNFSF4, CD47, CD276, and…
Discussion)⭐ same-sentence co-mention
…and found thatBTN2A1, BTN2A2, TNFSF4, CD47,…
Discussion)⭐ same-sentence co-mention
…found that BTN2A1,BTN2A2, TNFSF4, CD47, CD276,…
Show Full Abstract
<h4>Background</h4>The relationship between cuproptosis and HCC is still in the exploratory stage. Long noncoding RNAs (lncRNAs) have recently been linked to the progression of hepatocellular carcinoma (HCC). However, the clinical significance of lncRNAs associated with cuproptosis remains unclear.<h4>Methods</h4>Based on The Cancer Genome Atlas (TCGA) liver hepatocellular carcinoma (LIHC) dataset, we identified characteristic prognostic lncRNAs by univariate, LASSO, and multifactorial regression analysis, and constructed a prognostic signature of cuproptosis-related lncRNAs in HCC. The role of lncRNAs were identified through CCK-8, clone formation in Huh-7 cells with high expression of FDX1. Prognostic potential of the characteristic lncRNAs was evaluated in each of the two cohorts created by randomly dividing the TCGA cohort into a training cohort and a test cohort in a 1:1 ratio. Immune profiles in defined subgroups of cuproptosis-related lncRNA features as well as drug sensitivity were analyzed.<h4>Results</h4>We constructed a multigene signature based on four characteristic prognostic lncRNAs (AL590705.3, LINC02870, KDM4A-AS1, MKLN1-AS). These four lncRNAs participated in the development of cuproptosis. HCC patients were classified into high-risk and low-risk groups based on the median value of the risk score. The receiver operating characteristic curve area under the curve values for 1-, 3-, and 5-year survival were 0.773, 0.728, and 0.647, respectively, for the training cohort, and 0.764, 0.671, and 0.662, respectively, for the test cohort. Univariate and multifactorial regression analyses indicated that this prognostic feature was an independent prognostic factor for HCC. Principal component analysis plots clearly distinguished between low- and high-risk patients in terms of their probability of survival. Furthermore, gene set enrichment analysis showed that a variety of processes associated with tumor proliferation and progression were enriched in the high-risk group compared with the low-risk group. Moreover, there were significant differences in the expression of immune cell subpopulations, immune checkpoint genes, and potential drug screening, which provided distinct therapeutic recommendations for individuals with various risks.<h4>Conclusions</h4>We constructed a novel cuproptosis-associated lncRNA signature with a significant predictive value for the prognosis of patients with HCC. Cuproptosis-associated lncRNAs are associated with the tumor immune microenvironment of HCC and even the efficacy of tumor immunotherapy.
Also flagged:calciummetabolismthyroid cancerVDRgene expressioncancer
Journal Article2023-03-28No SnippetsHu C, Yan L, Li P, Yu Y.
Show Full Abstract
<h4>Introduction</h4>Papillary thyroid carcinoma is a type of thyroid cancer that exhibits significant variability in prognosis. Extensive research indicates that the impaired signaling of 1,25(OH)2D3-VDR may be a crucial factor in the development and progression of PTC.<h4>Methods</h4>To investigate this further, Integrated analysis mRNA expression information from The Cancer Genome Atlas and GEO, we compared gene expression in cancer and normal tissues and identified differentially expressed genes (DEGs). Through this analysis, we identified DEGs and calculated risk estimates for seven genetic markers.<h4>Results</h4>Subsequently, we constructed predictive models using LASSO-Cox regression to test the predictive value of these markers. Our results revealed that 64 calcium metabolism-related genes showed significant differences between tumor and normal tissues. Ten of the identified DEGs were significantly associated with overall survival, indicating their potential role in disease progression. Using the average risk score for the seven genetic markers, we divided patients into high- and low-risk groups. We found that patients in the low-risk group had significantly better overall survival than those in the high-risk group, highlighting the importance of these genetic markers in predicting prognosis. Further analysis using Cox regression demonstrated that the risk levels had independent predictive power. Additionally, we conducted functional analysis of the identified genetic markers, which showed significant differences in immune status between the two patient groups. We also investigated the effect of these calcium metabolism-related genes on thyroid cancer biological functions, immune microenvironment, and drug resistance.<h4>Discussion</h4>Our findings provide evidence of a novel genetic signature associated with calcium metabolism, which can predict prognosis in patients with PTC. These results may have significant implications for the development of new diagnostic and therapeutic approaches to improve outcomes for PTC patients.
Also flagged:brain metastasesprimary tumorsprimary tumortumorbrain tumorsbrain
Journal Article2023-03-28No SnippetsLong L, Yi Z, Zeng Y, Liu Z.
Show Full Abstract
The incidence of brain metastases (BrM) has become a growing concern recently. It is a common and often fatal manifestation in the brain during the end-stage of many extracranial primary tumors. Increasing BrM diagnoses can be attributed to improvements in primary tumor treatments, which have extended patients' lifetime, and allowed for earlier and more efficient detection of brain lesions. Currently, therapies for BrM encompass systemic chemotherapy, targeted therapy, and immunotherapy. Systemic chemotherapy regimens are controversial due to their associated side effects and limited efficacy. Targeted and immunotherapies have garnered significant attention in the medical field: they target specific molecular sites and modulate specific cellular components. However, multiple difficulties such as drug resistance and low permeability of the blood-brain barrier (BBB) remain significant challenges. Thus, there is an urgent need for novel therapies. Brain microenvironments consist of cellular components including immune cells, neurons, endothelial cells as well as molecular components like metal ions, nutrient molecules. Recent research indicates that malignant tumor cells can manipulate the brain microenvironment to change the anti-tumoral to a pro-tumoral microenvironment, both before, during, and after BrM. This review compares the characteristics of the brain microenvironment in BrM with those in other sites or primary tumors. Furthermore, it evaluates the preclinical and clinical studies of microenvironment-targeted therapies for BrM. These therapies, due to their diversity, are expected to overcome drug resistance or low permeability of the BBB with low side effects and high specificity. This will ultimately lead to improved outcomes for patients with secondary brain tumors.
Also flagged:gut disorderslipidarachidonic aciddigestionacetylcholinevasoactive intestinal peptide
Journal Article2023-03-28No SnippetsMantel M, Derkinderen P, Bach-Ngohou K, Neunlist M, Rolli-Derkinderen M.
Show Full Abstract
The enteric nervous system (ENS) continues to dazzle scientists with its ability to integrate signals, from the outside as well as from the host, to accurately regulate digestive functions. Composed of neurons and enteric glial cells, the ENS interplays with numerous neighboring cells through the reception and/or the production of several types of mediators. In particular, ENS can produce and release n-6 oxylipins. These lipid mediators, derived from arachidonic acid, play a major role in inflammatory and allergic processes, but can also regulate immune and nervous system functions. As such, the study of these n-6 oxylipins on the digestive functions, their cross talk with the ENS and their implication in pathophysiological processes is in full expansion and will be discussed in this review.
Also flagged:Ironnanoparticlelung diseasecalcium phosphatehydroxyapatiteD-mannitol
Journal Article2023-03-28No SnippetsQuarta E, Chiappi M, Adamiano A, Tampieri A, Wang W, Tetley TD, Buttini F, Sonvico F, Catalucci D, Colombo P, Iafisco M, Degli Esposti L.
Show Full Abstract
Recently, there has been increasing interest in developing biocompatible inhalable nanoparticle formulations, as they have enormous potential for treating and diagnosing lung disease. In this respect, here, we have studied superparamagnetic iron-doped calcium phosphate (in the form of hydroxyapatite) nanoparticles (FeCaP NPs) which were previously proved to be excellent materials for magnetic resonance imaging, drug delivery and hyperthermia-related applications. We have established that FeCaP NPs are not cytotoxic towards human lung alveolar epithelial type 1 (AT1) cells even at high doses, thus proving their safety for inhalation administration. Then, D-mannitol spray-dried microparticles embedding FeCaP NPs have been formulated, obtaining respirable dry powders. These microparticles were designed to achieve the best aerodynamic particle size distribution which is a critical condition for successful inhalation and deposition. The nanoparticle-in-microparticle approach resulted in the protection of FeCaP NPs, allowing their release upon microparticle dissolution, with dimensions and surface charge close to the original values. This work demonstrates the use of spray drying to provide an inhalable dry powder platform for the lung delivery of safe FeCaP NPs for magnetically driven applications.
Also flagged:hydroxyapatitecollagendegradationepigallocatechin-3-gallatelysozymemineral
Journal Article2023-03-28No SnippetsElline E, Ismiyatin K, Budhy TI.
Show Full Abstract
<h4>Background</h4>Biodegradable hydrogel scaffold is one of the crucial characteristics that determine the success of pulp regeneration. The degradation should be suitable for the growth of new tissue establishment. The aim of this study is to synthesize and compare the novel biodegradable hydrogel scaffold based on hydroxyapatite (HAp) eggshell, collagen, and epigallocatechin-3-gallate (HAp-Col-EGCG) with different HAp concentrations <i>in vitro</i>.<h4>Materials and methods</h4>This study is original research. HAp-Col-EGCG hydrogel scaffolds were prepared using 1:1, 1:2, and 1:4 ratios of collagen and HAp with 10 μmol/L EGCG. The samples were freeze-dried and immersed in phosphate buffer saline containing lysozyme enzyme. The dried samples were weighed to determine the percentage of biodegradation value (<i>P</i> < 0.05).<h4>Results</h4>The result showed HAp-Col-EGCG was biodegradable but it has not been concluded that it can be completely eliminated. The data were analyzed by one-way analysis of variance and it indicated significant differences in percentage values.<h4>Conclusion</h4>Hydrogel scaffold based on HAp-Col-EGCG can be degraded and have the potential to be used as a biodegradable scaffold in supporting tissue regeneration.
<h4>Introduction</h4>diarrhoea disease is a global health concern, persisting as one of the top five causes of morbidity and mortality in children. Viral aetiology of childhood diarrhoea is often associated with rotavirus infection of which preventable vaccines exist. Here we document circulating strains of rotavirus in the Kassena-Nankana Districts of Northern Ghana nearly a decade after the introduction of the rotavirus vaccine.<h4>Methods</h4>a cross-sectional survey of children aged 0-60 months was conducted in six health facilities within the Kassena-Nankana Districts. Faecal samples obtained from the children were analysed and characterized for rotavirus detection and genotyping using Semi-Nested Polymerase Chain Reaction.<h4>Results</h4>a total of 263 stool samples were analyzed. Out of which 14.8% and 18.6% of the diarrhoea cases were of rotavirus and parasitic etiologies respectively, with 17.4% being co-infections. Almost 27.5% of rotavirus diarrhoeal cases resulted in hospitalization. Household size (p=0.035), location (p=0.018), treatment outcome (p=0.007), vomiting (p=0.039), season (p=0.017) and month of sampling (p=0.000) were significantly associated with rotavirus infection. The rotavirus genotypes identified were G1P8, G3P6, G4P9, G10P6 and G12P8. Rotavirus vaccine-type, G1P8 was absent in Kassena-Nankana West District.<h4>Conclusion</h4>the prevalence of rotavirus was low compared to the pre-vaccination era. Also, a new rotavirus strain, G4P9 was identified to be circulating in the study area which calls for surveillance measures and more studies to better understand the situation for appropriate public health intervention.
Also flagged:amino β-cyclodextrinsCD1graphene oxidecarbonhydrazinecarbendazim
Journal Article2023-03-28No SnippetsVillalobos E, Marco JF, Yáñez C.
Show Full Abstract
In the present work, we reported on a method to combine amino β-cyclodextrins (CD1) with reduced graphene oxide (obtained by the electrochemical reduction of graphene oxide, erGO) to produce a glassy carbon electrode (GCE) modified with both CD1 and erGO (CD1-erGO/GCE). This procedure avoids the use of organic solvents such as hydrazine or long reaction times and high temperatures. The material combining both CD1 and erGO (CD1-erGO/GCE) was characterized by SEM, ATR-FTIR, Raman, XPS, and electrochemical techniques. As proof-of-concept, the determination of the pesticide carbendazim was carried out. The spectroscopic measurements, especially XPS, proved that CD1 was covalently attached to the surface of the erGO/GCE electrode. The attachment of cyclodextrin at the reduced graphene oxide produced an increase in the electrochemical behavior of the electrode. The cyclodextrin-functionalized reduced graphene oxide, CD1-erGO/GCE, showed a larger sensitivity (1.01 μA/μM) and a lower limit of detection for carbendazim (LOD = 0.50 μM) compared with the non-functionalized material, erGO/GCE, (sensitivity = 0.63 μA/μM and LOD = 4.32 μM, respectively). Overall, the results of the present work show that this simple method is suitable to attach cyclodextrins to graphene oxide, maintaining their inclusion abilities.
SSRN2023-03-28Preprint (No Snippets API)Lee C, Ren Z, Liu M.
Show Full Abstract
In this study, the DCC-MIDAS approach and its extension are adopted to reveal the long-run correlations among Chinese currency and those of ASEAN countries, and the role of RMB internationalization in driving the movements of the long-run currency correlations. The findings show that: (1) significant long-run currency correlations have been identified in the China-ASEAN Free Trade Area in general, however, the correlations are weakened during the COVID-19 pandemic; (2) the degree of correlation highly relates to the economic development of a country and Singapore plays a leading role in the ASEAN foreign exchange markets; (3) RMB internationalization is the main driving force to enhance the currency correlations in the region and the importance of Singapore dollar tends to be partly replaced by China. With respect to the increasing impact of the RMB in the China-ASEAN Free Trade Area, we provide policy implications to the Chinese government to maintain the stability of its currency in the region for the potential transition of the currency regionalization driven by the RMB. We contribute to the literature on currency linkage and integration by analyzing the long-run relationship to avoid the biased results given by the irregular short-run shocks and we make the first attempt to reveal the impact of RMB internationalization in shaping the long-run currency correlations in the free trade area dominated by China.
Also flagged:respiratory diseasespolymeraseacute phase responsecell adhesionblood coagulationCOVID-19
Journal Article2023-03-27✓ 2 SnippetsHirdman G, Bodén E, Kjellström S, Fraenkel CJ, Olm F, Hallgren O, Lindstedt S.
In-Text Gene Mentions
Discussion)
…However, new evidence points to its activity within the coagulation cascade, interfering with antithrombin/SERPINC1 and factor XIIa leading to increased coagulation indicating an increased tendency for procoagulant disorders in COVID-19 patients [41].…
Discussion)
…interfering with antithrombin/SERPINC1and factor XIIa…
Show Full Abstract
<h4>Background</h4>SARS-CoV-2 has been shown to predominantly infect the airways and the respiratory tract and too often have an unpredictable and different pathologic pattern compared to other respiratory diseases. Current clinical diagnostical tools in pulmonary medicine expose patients to harmful radiation, are too unspecific or even invasive. Proteomic analysis of exhaled breath particles (EBPs) in contrast, are non-invasive, sample directly from the pathological source and presents as a novel explorative and diagnostical tool.<h4>Methods</h4>Patients with PCR-verified COVID-19 infection (COV-POS, n = 20), and patients with respiratory symptoms but with > 2 negative polymerase chain reaction (PCR) tests (COV-NEG, n = 16) and healthy controls (HCO, n = 12) were prospectively recruited. EBPs were collected using a "particles in exhaled air" (PExA 2.0) device. Particle per exhaled volume (PEV) and size distribution profiles were compared. Proteins were analyzed using liquid chromatography-mass spectrometry. A random forest machine learning classification model was then trained and validated on EBP data achieving an accuracy of 0.92.<h4>Results</h4>Significant increases in PEV and changes in size distribution profiles of EBPs was seen in COV-POS and COV-NEG compared to healthy controls. We achieved a deep proteome profiling of EBP across the three groups with proteins involved in immune activation, acute phase response, cell adhesion, blood coagulation, and known components of the respiratory tract lining fluid, among others. We demonstrated promising results for the use of an integrated EBP biomarker panel together with particle concentration for diagnosis of COVID-19 as well as a robust method for protein identification in EBPs.<h4>Conclusion</h4>Our results demonstrate the promising potential for the use of EBP fingerprints in biomarker discovery and for diagnosing pulmonary diseases, rapidly and non-invasively with minimal patient discomfort.
Also flagged:gene expressionendothelial growthorganizationSaltlumencollagenase-2
Journal Article2023-03-27✓ 1 SnippetAfshar Y, Ma F, Quach A, Jeong A, Sunshine HL, Freitas V, Jami-Alahmadi Y, Helaers R, Li X, Pellegrini M, Wohlschlegel JA, Romanoski CE, Vikkula M, Iruela-Arispe ML.
In-Text Gene Mentions
Results)
…TGFβ, VEGF, TP53,HTT, MYC, TNF, EDN1,…
Show Full Abstract
Environmental cues, such as physical forces and heterotypic cell interactions play a critical role in cell function, yet their collective contributions to transcriptional changes are unclear. Focusing on human endothelial cells, we performed broad individual sample analysis to identify transcriptional drifts associated with environmental changes that were independent of genetic background. Global gene expression profiling by RNA sequencing and protein expression by liquid chromatography-mass spectrometry directed proteomics distinguished endothelial cells in vivo from genetically matched culture (in vitro) samples. Over 43% of the transcriptome was significantly changed by the in vitro environment. Subjecting cultured cells to long-term shear stress significantly rescued the expression of approximately 17% of genes. Inclusion of heterotypic interactions by co-culture of endothelial cells with smooth muscle cells normalized approximately 9% of the original in vivo signature. We also identified novel flow dependent genes, as well as genes that necessitate heterotypic cell interactions to mimic the in vivo transcriptome. Our findings highlight specific genes and pathways that rely on contextual information for adequate expression from those that are agnostic of such environmental cues.
Also flagged:Histone deacetylase 1histonechromatingene expressionhistone acetyltransferasesdeacetylases
Journal Article2023-03-27No SnippetsZhou JJ, Cho JS, Han H, Blitz IL, Wang W, Cho KWY.
Show Full Abstract
Histone acetylation is a pivotal epigenetic modification that controls chromatin structure and regulates gene expression. It plays an essential role in modulating zygotic transcription and cell lineage specification of developing embryos. While the outcomes of many inductive signals have been described to require enzymatic activities of histone acetyltransferases and deacetylases (HDACs), the mechanisms by which HDACs confine the utilization of the zygotic genome remain to be elucidated. Here, we show that histone deacetylase 1 (Hdac1) progressively binds to the zygotic genome from mid-blastula and onward. The recruitment of Hdac1 to the genome at blastula is instructed maternally. <i>Cis</i>-regulatory modules (CRMs) bound by Hdac1 possess epigenetic signatures underlying distinct functions. We highlight a dual function model of Hdac1 where Hdac1 not only represses gene expression by sustaining a histone hypoacetylation state on inactive chromatin, but also maintains gene expression through participating in dynamic histone acetylation-deacetylation cycles on active chromatin. As a result, Hdac1 maintains differential histone acetylation states of bound CRMs between different germ layers and reinforces the transcriptional program underlying cell lineage identities, both in time and space. Taken together, our study reveals a comprehensive role for Hdac1 during early vertebrate embryogenesis.
Also flagged:hatchingdeathmitosisapoptoticmetabolismgestation
Journal Article2023-03-27No SnippetsOkasha HM, El-Gendi GM, Eid KM.
Show Full Abstract
Egg storage duration can affect embryo mortality, hatching characteristics, hatching time, and post-hatch chick quality. In order to assess these effects, the impact of storage duration (5 days, 10 days, 15 days) and short incubation period during egg storage (SPIDES) investigated further 18, 900 eggs of broiler breeder (ROSS 308) in 3 × 2 factorial arrangement design. In the SPIDES treatment, the egg shell temperature was raised from its storage temperature (18 °C) and held at 100 °F for 3.5 h. Storage periods could significantly (P < 0.05) influence on embryo mortality (total, early, middle, and late), hatchability of both the total eggs and fertile eggs. The SPIDES treatment had a significant (P < 0.05) impact on a lower embryonic death rate and improved egg hatchability. Eggs stored for 5 days and eggs treated with SPIDES significantly (P < 0.001) shorten hatching time, batch's 90% hatching time (T 90% H), mean hatching time (MHT), maximal hatching period (MHP), and hatching window (HW). Chick quality was also determined, whereas storing eggs for 5 days and using the SPIDES treatment resulted in enhanced (P < 0.001) chick weight relative to egg weight (CW/EW), activity (AC), and chick quality score (CQS). The residual yolk sac weight (RYSW), unhealed navel (UHN %), and dirty feather (DF%) recorded the lowest (P < 0.001) values compared to long storage periods and control group. Finally, stored for 5 days treated by SPIDES positively affected the hatchability characteristics, the shortening hatching time, and the quality of chicks. Regarding the results, it was confirmed that using the SPIDES treatment to prevent the harmful effects of broiler eggs being stored for an extended period of time is a viable option.
Also flagged:pannexin 2 channelPANX2ischemiabrain injuryporePANX1
Journal Article2023-03-27✓ 1 SnippetHe Z, Zhao Y, Rau MJ, Fitzpatrick JAJ, Sah R, Hu H, Yuan P.
In-Text Gene Mentions
Introduction)
…(VRACs) formed byleucine-rich repeat-containing 8repeat-containing 8 proteins…
Show Full Abstract
The pannexin 2 channel (PANX2) participates in multiple physiological processes including skin homeostasis, neuronal development, and ischemia-induced brain injury. However, the molecular basis of PANX2 channel function remains largely unknown. Here, we present a cryo-electron microscopy structure of human PANX2, which reveals pore properties contrasting with those of the intensely studied paralog PANX1. The extracellular selectivity filter, defined by a ring of basic residues, more closely resembles that of the distantly related volume-regulated anion channel (VRAC) LRRC8A, rather than PANX1. Furthermore, we show that PANX2 displays a similar anion permeability sequence as VRAC, and that PANX2 channel activity is inhibited by a commonly used VRAC inhibitor, DCPIB. Thus, the shared channel properties between PANX2 and VRAC may complicate dissection of their cellular functions through pharmacological manipulation. Collectively, our structural and functional analysis provides a framework for development of PANX2-specific reagents that are needed for better understanding of channel physiology and pathophysiology.
Also flagged:dopamine D2-like receptorsobesityaddictionsubstance use disorderspositronphoton
Journal Article2023-03-27No SnippetsRibeiro G, Maia A, Cotovio G, Oliveira FPM, Costa DC, Oliveira-Maia AJ.
Show Full Abstract
There is significant evidence linking a 'reward deficiency syndrome' (RDS), comprising decreased availability of striatal dopamine D2-like receptors (DD2lR) and addiction-like behaviors underlying substance use disorders and obesity. Regarding obesity, a systematic review of the literature with a meta-analysis of such data is lacking. Following a systematic review of the literature, we performed random-effects meta-analyses to determine group differences in case-control studies comparing DD2lR between individuals with obesity and non-obese controls and prospective studies of pre- to post-bariatric surgery DD2lR changes. Cohen's d was used to measure effect size. Additionally, we explored factors potentially associated with group differences in DD2lR availability, such as obesity severity, using univariate meta-regression. In a meta-analysis including positron emission tomography (PET) and single-photon emission computed tomography (SPECT) studies, striatal DD2lR availability did not significantly differ between obesity and controls. However, in studies comprising patients with class III obesity or higher, group differences were significant, favoring lower DD2lR availability in the obesity group. This effect of obesity severity was corroborated by meta-regressions showing inverse associations between the body mass index (BMI) of the obesity group and DD2lR availability. Post-bariatric changes in DD2lR availability were not found, although a limited number of studies were included in this meta-analysis. These results support lower DD2lR in higher classes of obesity which is a more targeted population to explore unanswered questions regarding the RDS.
Also flagged:ubiquitindegradationKCC2nucleuscotransporter 2proteasomal degradation
Journal Article2023-03-27✓ 2 SnippetsHu JJ, Liu Y, Yao H, Cao B, Liao H, Yang R, Chen P, Song XJ.
In-Text Gene Mentions
Abstract)
…by ubiquitin ligaseFbxl4.…
Abstract)
…between KCC2 andFbxl4.…
Show Full Abstract
The emergence of consciousness from anesthesia, once assumed to be a passive process, is now considered as an active and controllable process. In the present study, we show in mice that, when the brain is forced into a minimum responsive state by diverse anesthetics, a rapid downregulation of K<sup>+</sup>/Cl<sup>-</sup> cotransporter 2 (KCC2) in the ventral posteromedial nucleus (VPM) serves as a common mechanism by which the brain regains consciousness. Ubiquitin-proteasomal degradation is responsible for KCC2 downregulation, which is driven by ubiquitin ligase Fbxl4. Phosphorylation of KCC2 at Thr1007 promotes interaction between KCC2 and Fbxl4. KCC2 downregulation leads to γ-aminobutyric acid type A receptor-mediated disinhibition, enabling accelerated recovery of VPM neuron excitability and emergence of consciousness from anesthetic inhibition. This pathway to recovery is an active process and occurs independent of anesthetic choice. The present study demonstrates that ubiquitin degradation of KCC2 in the VPM is an important intermediate step en route to emergence of consciousness from anesthesia.
Also flagged:Ferroptosisdeathapoptotic cell deathnecroptosispyroptosiscancer
Journal Article2023-03-27✓ 1 SnippetDixon SJ, Pratt DA.
In-Text Gene Mentions
Text
…PEBP1…
Show Full Abstract
It is common to think about and depict biological processes as being governed by fixed pathways with specific components interconnected by concrete positive and negative interactions. However, these models may fail to effectively capture the regulation of cell biological processes that are driven by chemical mechanisms that do not rely absolutely on specific metabolites or proteins. Here, we discuss how ferroptosis, a non-apoptotic cell death mechanism with emerging links to disease, may be best understood as a highly flexible mechanism that can be executed and regulated by many functionally related metabolites and proteins. The inherent plasticity of ferroptosis has implications for how to define and study this mechanism in healthy and diseased cells and organisms.
Also flagged:TumorHead and Neck Squamous Cell CarcinomaRac1WntKinesin family member C1KIFC1
Journal Article2023-03-27✓ 1 SnippetYu BY, Shi LG, Jiang C, Wang GK, Liu J, Wu TY.
In-Text Gene Mentions
Title)
…Kinesin Family Member C1Family Member C1…
Show Full Abstract
Kinesin family member C1 (KIFC1) is a kinesin-14 motor protein, and its abnormal upregulation promotes the malignant behavior of cancer cells. N6-methyladenosine (m6A) RNA methylation is a common modification of eukaryotic messenger RNA and affects RNA expression. In this study, we explored how KIFC1 regulated head and neck squamous cell carcinoma (HNSCC) tumorigenesis and how m6A modification affected KIFC1 expression. A bioinformatics analysis was performed to screen for genes of interest, and in vitro and in vivo studies were carried out to investigate the function and mechanism of KIFC1 in HNSCC tissues. We observed that the expression of KIFC1 in HNSCC tissues was significantly higher than that in normal or adjacent normal tissues. Patients with cancer with higher KIFC1 expression have a lower tumor differentiation status. Demethylase alkB homolog 5, a cancer-promoting factor in HNSCC tissues, could interact with KIFC1 messenger RNA and posttranscriptionally activate KIFC1 through m6A modification. KIFC1 downregulation suppressed HNSCC cell growth and metastasis in vivo and in vitro. However, overexpression of KIFC1 promoted these malignant behaviors. We demonstrated that KIFC1 overexpression activated the oncogenic Wnt/β-catenin pathway. KIFC1 interacted with the small GTPase Ras-related C3 botulinum toxin substrate 1 (Rac1) at the protein level and increased its activity. The Rho GTPase Rac1 was indicated to be an upstream activator of the Wnt/β-catenin signaling pathway, and its Rac1 inhibitor, NSC-23766, treatment reversed the effects caused by KIFC1 overexpression. Those observations demonstrate that abnormal expression of KIFC1 may be regulated by demethylase alkB homolog 5 in an m6A-dependent manner and promote HNSCC progression via the Rac1/Wnt/β-catenin pathway.
Also flagged:CCL28Lung AdenocarcinomacancerchemokinesluciferaseChromatin
Journal Article2023-03-27✓ 1 SnippetSu X, Wang G, Zheng S, Ge C, Kong F, Wang C.
In-Text Gene Mentions
Results)
…TYROBP, ZBP1 andZNFX1were positively correlated…
Show Full Abstract
<h4>Background</h4>Chemokines have been reported to play an important role in cancer immunotherapy. This study aimed to explore the chemokines involved in lung cancer immunotherapy.<h4>Methods</h4>All the public data were downloaded from The Cancer Genome Atlas Program database. Quantitative real time-PCR was used to detect the mRNA level of specific molecules and Western blot was used for the protein level. Other experiments used include luciferase reporter experiments, flow cytometric analysis, Chromatin immunoprecipitation assay, ELISA and co-cultured system.<h4>Results</h4>We found that the CCL7, CCL11, CCL14, CCL24, CCL25, CCL26, CCL28 had a higher level, while the CCL17, CCL23 had a lower level in immunotherapy non-responders. Also, we found that immunotherapy non-responders had a higher level of CD56dim NK cells, NK cells, Th1 cells, Th2 cells and Treg, yet a lower level of iDC and Th17 cells. Biological enrichment analysis indicated that in the patients with high Treg infiltration, the pathways of pancreas beta cells, KRAS signaling, coagulation, WNT BETA catenin signaling, bile acid metabolism, interferon alpha response, hedgehog signaling, PI3K/AKT/mTOR signaling, apical surface, myogenesis were significantly enriched in. CCL7, CCL11, CCL26 and CCL28 were selected for further analysis. Compared with the patients with high CCL7, CCL11, CCL26 and CCL28 expression, the patients with low CCL7, CCL11, CCL26 and CCL28 expression had a better performance of immunotherapy response and this effect might partly be due to Treg cells. Furthermore, biological exploration and clinical correlation of CCL7, CCL11, CCL26 and CCL28 were conducted, Finally, CCL28 was selected for validation. Experiments showed that under the hypoxia condition, HIF-1α was upregulated, which can directly bind to the promoter region of CCL28 and lead to its higher level. Also, CCL28 secreted by lung cancer cells could induce Tregs infiltration.<h4>Conclusion</h4>Our study provides a novel insight focused on the chemokines in lung cancer immunotherapy. Also, CCL28 was identified as an underlying biomarker for lung cancer immunotherapy.
Also flagged:titaniumdegradationosteoporosismetalsagingmetal ions
Journal Article2023-03-27No SnippetsJiang P, Zhang Y, Hu R, Shi B, Zhang L, Huang Q, Yang Y, Tang P, Lin C.
Show Full Abstract
Titanium (Ti) and its alloys have been widely used as orthopedic implants, because of their favorable mechanical properties, corrosion resistance and biocompatibility. Despite their significant success in various clinical applications, the probability of failure, degradation and revision is undesirably high, especially for the patients with low bone density, insufficient quantity of bone or osteoporosis, which renders the studies on surface modification of Ti still active to further improve clinical results. It is discerned that surface physicochemical properties directly influence and even control the dynamic interaction that subsequently determines the success or rejection of orthopedic implants. Therefore, it is crucial to endow bulk materials with specific surface properties of high bioactivity that can be performed by surface modification to realize the osseointegration. This article first reviews surface characteristics of Ti materials and various conventional surface modification techniques involving mechanical, physical and chemical treatments based on the formation mechanism of the modified coatings. Such conventional methods are able to improve bioactivity of Ti implants, but the surfaces with static state cannot respond to the dynamic biological cascades from the living cells and tissues. Hence, beyond traditional static design, dynamic responsive avenues are then emerging. The dynamic stimuli sources for surface functionalization can originate from environmental triggers or physiological triggers. In short, this review surveys recent developments in the surface engineering of Ti materials, with a specific emphasis on advances in static to dynamic functionality, which provides perspectives for improving bioactivity and biocompatibility of Ti implants.
Also flagged:RabMitophagyvesicularpathogenesisneurodegenerative diseasesvesicles
Journal Article2023-03-27No SnippetsShafique A, Brughera M, Lualdi M, Alberio T.
Show Full Abstract
Mitochondrial dysfunction and vesicular trafficking alterations have been implicated in the pathogenesis of several neurodegenerative diseases. It has become clear that pathogenetic pathways leading to neurodegeneration are often interconnected. Indeed, growing evidence suggests a concerted contribution of impaired mitophagy and vesicles formation in the dysregulation of neuronal homeostasis, contributing to neuronal cell death. Among the molecular factors involved in the trafficking of vesicles, Ras analog in brain (Rab) proteins seem to play a central role in mitochondrial quality checking and disposal through both canonical PINK1/Parkin-mediated mitophagy and novel alternative pathways. In turn, the lack of proper elimination of dysfunctional mitochondria has emerged as a possible causative/early event in some neurodegenerative diseases. Here, we provide an overview of major findings in recent years highlighting the role of Rab proteins in dysfunctional mitochondrial dynamics and mitophagy, which are characteristic of neurodegenerative diseases. A further effort should be made in the coming years to clarify the sequential order of events and the molecular factors involved in the different processes. A clear cause-effect view of the pathogenetic pathways may help in understanding the molecular basis of neurodegeneration.
Also flagged:Inborn errors of immunityclustered regularly interspaced short palindromic repeatCRISPR-associated proteinsCasgenetic diseaseserrors of immunity
Journal Article2023-03-27✓ 1 SnippetLiu X, Li G, Liu Y, Zhou F, Huang X, Li K.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease (HD) is caused by a dominantly inherited CAG repeat expansion in exon 1 of the huntingtin gene (HTT), which can be removed through CRISPR-Cas9-mediated fragment deletion in patient-derived fibroblasts and mouse models (158, 159).…
Show Full Abstract
Inborn errors of immunity (IEIs) are a group of inherited disorders caused by mutations in the protein-coding genes involved in innate and/or adaptive immunity. Hematopoietic stem cell transplantation (HSCT) is a mainstay definitive therapy for many severe IEIs. However, the lack of HLA-matched donors increases the risk of developing severe immunological complications. Gene therapy provides long-term clinical benefits and could be an attractive therapeutic strategy for IEIs. In this review, we describe the development and evolution of clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated proteins (Cas) gene-editing systems, including double-strand break (DSB)-based gene editing and DSB-free base editing or prime editing systems. Here, we discuss the advances in and issues associated with CRISPR/Cas gene editing tools and their potential as therapeutic alternatives for IEIs. We also highlight the progress of preclinical studies for the treatment of human genetic diseases, including IEIs, using CRISR/Cas and ongoing clinical trials based on this versatile technology.
Also flagged:psychiatric diseasescognitive dysfunctionsevofluranewaterbindingoxygen
Journal Article2023-03-27✓ 1 SnippetZhang M, Suo Z, Qu Y, Zheng Y, Xu W, Zhang B, Wang Q, Wu L, Li S, Cheng Y, Xiao T, Zheng H, Ni C.
In-Text Gene Mentions
Introduction)
…Sostdc1, Egfr, Prkacb,Unc13c, Tbx20 and St8sia2…
Show Full Abstract
Circular RNAs are highly stable single-stranded circular RNAs and enriched in the brain. Previous studies showed that circRNAs, as part of competing endogenous RNAs (ceRNAs) network, play an important role in neurodegenerative and psychiatric diseases. However, the mechanism of circRNA-related ceRNA networks in postoperative cognitive dysfunction (POCD) has not been elucidated yet. POCD usually occurs in elderly patients and is characterized by hippocampal dysfunction. Here, aged C57BL/6 mice were subjected to exploratory laparotomy under sevoflurane anesthesia, and this POCD model was verified by Morris water maze test. Whole-transcriptome sequencing was performed on the hippocampus of control group (Con) and surgery group. One hundred and seventy-seven DEcircRNAs, 221 DEmiRNAs and 2,052 DEmRNAs were identified between two groups. A ceRNA network was established with 92 DEcircRNAs having binding sites with 76 DEmiRNAs and 549 target DEmRNAs. In functional enrichment analysis, a pathological pattern of POCD was highlighted in the ceRNA network: Abnormal metabolic process in neural cells, including oxygen metabolism, could promote apoptosis and then affect the synaptic function, which may undermine the neural plasticity and eventually lead to changes in cognitive function and other behavioral patterns. In conclusion, this specific ceRNA network of circRNAs-miRNAs-mRNAs has provided novel insights into the regulatory mechanisms of POCD and revealed potential therapeutic gene targets.
Also flagged:myasthenia gravisautoimmune diseasesMGGene ExpressiontumorNAPB
Journal Article2023-03-27✓ 2 SnippetsZhang D, Luo L, Lu F, Li B, Lai X.
In-Text Gene Mentions
Results)
…YTHDF1, U2AF2, TARDBP,STAU1, were identified by…
Results)
…where EIF3D, RBM15,STAU1, TARDBP and YTHDF1…
Show Full Abstract
<b>Background:</b> As one of the most common autoimmune diseases, myasthenia gravis (MG) severely affects the quality of life of patients. Therefore, exploring the role of dysregulated genes between MG and healthy controls in the diagnosis of MG is beneficial to reveal new and promising diagnostic biomarkers and clinical therapeutic targets. <b>Methods:</b> The GSE85452 dataset was downloaded from the Gene Expression Omnibus (GEO) database and differential gene expression analysis was performed on MG and healthy control samples to identify differentially expressed genes (DEGs). The functions and pathways involved in DEGs were also explored by functional enrichment analysis. Significantly associated modular genes were identified by weighted gene co-expression network analysis (WGCNA), and MG dysregulated gene co-expression modular-based diagnostic models were constructed by gene set variance analysis (GSVA) and least absolute shrinkage and selection operator (LASSO). In addition, the effect of model genes on tumor immune infiltrating cells was assessed by CIBERSORT. Finally, the upstream regulators of MG dysregulated gene co-expression module were obtained by Pivot analysis. <b>Results:</b> The green module with high diagnostic performance was identified by GSVA and WGCNA. The LASSO model obtained NAPB, C5orf25 and ERICH1 genes had excellent diagnostic performance for MG. Immune cell infiltration results showed a significant negative correlation between green module scores and infiltration abundance of Macrophages M2 cells. <b>Conclusion:</b> In this study, a diagnostic model based on the co-expression module of MG dysregulated genes was constructed, which has good diagnostic performance and contributes to the diagnosis of MG.
Also flagged:Follicular lymphomaFLlymphomatumortranscription factorsnon-Hodgkin's lymphoma
Journal Article2023-03-27No SnippetsXu T, Zheng Z, Zhao W.
Show Full Abstract
Follicular lymphoma (FL) is the most common indolent lymphoma originating from germinal center B cells. FL represents a clinically and biologically heterogeneous disease. Most patients have favorable outcomes, but a subset of patients experiences early progression or transformation and has a poor prognosis. Abnormalities in FL cells and tumor microenvironment have been revealed using multi-omics techniques, including genomic, epigenomic, transcriptomic and proteomic analysis. Recurrent somatic gene aberrations mainly involve epigenetic modifiers, transcription factors, oncogenic pathways and microenvironment modulators. Single-cell transcriptomic analysis show marked inter- and intra-patient FL subclone heterogeneity. In addition, a comprehensive profile of microenvironmental components is provided, unveiling the crosstalk between tumor and microenvironment that induce FL progression and facilitate immune escape. Together, these studies provide insights into the mechanisms and biomarkers of high-risk FL populations, as well as the potential targeted and immunotherapy options. Future research should focus on integrating multi-omics aberrations to optimize therapeutic strategies in FL.
Also flagged:extracellularangiogenesisCalcium phosphatescollagenorganizationcell
Journal Article2023-03-27No SnippetsEllermann E, Meyer N, Cameron RE, Best SM.
Show Full Abstract
Bone tissue engineering (BTE) aims to improve the healing of bone fractures using scaffolds that mimic the native extracellular matrix. For successful bone regeneration, scaffolds should promote simultaneous bone tissue formation and blood vessel growth for nutrient and waste exchange. However, a significant challenge in regenerative medicine remains the development of grafts that can be vascularized successfully. Amongst other things, optimization of physicochemical conditions of scaffolds is key to achieving appropriate angiogenesis in the period immediately following implantation. Calcium phosphates and collagen scaffolds are two of the most widely studied biomaterials for BTE, due to their close resemblance to inorganic and organic components of bone, respectively, and their bioactivity, tunable biodegradability and the ability to produce tailored architectures. While various strategies exist to enhance vascularization of these scaffolds <i>in vivo</i>, further <i>in vitro</i> assessment is crucial to understand the relation between physicochemical properties of a biomaterial and its ability to induce angiogenesis. While mono-culture studies can provide evidence regarding cell-material interaction of a single cell type, a co-culture procedure is crucial for assessing the complex mechanisms involved in angiogenesis. A co-culture more closely resembles the natural tissue both physically and biologically by stimulating natural intercellular interactions and mimicking the organization of the <i>in vivo</i> environment. Nevertheless, a co-culture is a complex system requiring optimization of various parameters including cell types, cell ratio, culture medium and seeding logistics. Gaining fundamental knowledge of the mechanism behind the bioactivity of biomaterials and understanding the contribution of surface and architectural features to the vascularization of scaffolds, and the biological response in general, can provide an invaluable basis for future optimization studies. This review gives an overview of the available literature on scaffolds for BTE, and trends are extracted on the relationship between architectural features, biochemical properties, co-culture parameters and angiogenesis.
Also flagged:transductionneurological disordersHDneurological diseasesspinal muscular atrophyaromatic L-amino acid decarboxylase
Journal Article2023-03-27✓ 1 SnippetDuarte F, Ramosaj M, Hasanovic E, Regio S, Sipion M, Rey M, Déglon N.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
One obstacle to the development of gene therapies for the central nervous system is the lack of workflows for quantifying transduction efficiency in affected neural networks and ultimately predicting therapeutic potential. We integrated data from a brain cell atlas with 3D or 2D semi-automated quantification of transduced cells in segmented images to predict AAV transduction efficiency in multiple brain regions. We used this workflow to estimate the transduction efficiency of AAV2/rh.10 and AAV2.retro co-injection in the corticostriatal network affected in Huntington's disease. We then validated our pipeline in gene editing experiments targeting both human and mouse huntingtin genes in transgenic and wild-type mice, respectively. Our analysis predicted that 54% of striatal cells and 7% of cortical cells would be edited in highly transduced areas. Remarkably, in the treated animals, huntingtin gene inactivation reached 54.5% and 9.6%, respectively. These results demonstrate the power of this workflow to predict transduction efficiency and the therapeutic potential of gene therapies in the central nervous system.
The greatest risk factor for cognitive decline is aging. The biological mechanisms for this decline remain enigmatic due, in part, to the confounding of normal aging mechanisms and those that contribute to cognitive impairment. Importantly, many individuals exhibit impaired cognition in age, while some retain functionality despite their age. Here, we establish a behavioral testing paradigm to characterize age-related cognitive heterogeneity in inbred aged C57BL/6 mice and reliably separate animals into cognitively "intact" (resilient) and "impaired" subgroups using a high-resolution home-cage testing paradigm for spatial discrimination. RNA sequencing and subsequent pathway analyses of cognitively stratified mice revealed molecular signatures unique to cognitively impaired animals, including transcriptional down-regulation of genes involved in mitochondrial oxidative phosphorylation (OXPHOS) and sirtuin (<i>Sirt1</i> and <i>Sirt3</i>) expression in the hippocampus. Mitochondrial function assessed using high-resolution respirometry indicated a reduced OXPHOS coupling efficiency in cognitively impaired animals with subsequent hippocampal analyses revealing an increase in the oxidative damage marker (3-nitrotyrosine) and an up-regulation of antioxidant enzymes (Sod2, Sod1, Prdx6, etc.). Aged-impaired animals also showed increased levels of <i>IL-6</i> and <i>TNF-α</i> gene expression in the hippocampus and increased serum levels of proinflammatory cytokines, including IL-6. These results provide critical insight into the diversity of brain aging in inbred animals and reveal the unique mechanisms that separate cognitive resilience from cognitive impairment. Our data indicate the importance of cognitive stratification of aging animals to delineate the mechanisms underlying cognitive impairment and test the efficacy of therapeutic interventions.
Also flagged:Cardiovascular DiseaseCVDvesiclesextracellularangiogenesiscell
Journal Article2023-03-27No SnippetsReiss AB, Ahmed S, Johnson M, Saeedullah U, De Leon J.
Show Full Abstract
Cardiovascular disease (CVD) is the leading cause of morbidity and mortality globally. In recent decades, clinical research has made significant advances, resulting in improved survival and recovery rates for patients with CVD. Despite this progress, there is substantial residual CVD risk and an unmet need for better treatment. The complex and multifaceted pathophysiological mechanisms underlying the development of CVD pose a challenge for researchers seeking effective therapeutic interventions. Consequently, exosomes have emerged as a new focus for CVD research because their role as intercellular communicators gives them the potential to act as noninvasive diagnostic biomarkers and therapeutic nanocarriers. In the heart and vasculature, cell types such as cardiomyocytes, endothelial cells, vascular smooth muscle, cardiac fibroblasts, inflammatory cells, and resident stem cells are involved in cardiac homeostasis via the release of exosomes. Exosomes encapsulate cell-type specific miRNAs, and this miRNA content fluctuates in response to the pathophysiological setting of the heart, indicating that the pathways affected by these differentially expressed miRNAs may be targets for new treatments. This review discusses a number of miRNAs and the evidence that supports their clinical relevance in CVD. The latest technologies in applying exosomal vesicles as cargo delivery vehicles for gene therapy, tissue regeneration, and cell repair are described.
Also flagged:watercarbongraphiteindiumtin oxidesilver
Journal Article2023-03-27No SnippetsTheyagarajan K, Kim YJ.
Show Full Abstract
Electrochemical biosensors are superior technologies that are used to detect or sense biologically and environmentally significant analytes in a laboratory environment, or even in the form of portable handheld or wearable electronics. Recently, imprinted and implantable biosensors are emerging as point-of-care devices, which monitor the target analytes in a continuous environment and alert the intended users to anomalies. The stability and performance of the developed biosensor depend on the nature and properties of the electrode material or the platform on which the biosensor is constructed. Therefore, the biosensor platform plays an integral role in the effectiveness of the developed biosensor. Enormous effort has been dedicated to the rational design of the electrode material and to fabrication strategies for improving the performance of developed biosensors. Every year, in the search for multifarious electrode materials, thousands of new biosensor platforms are reported. Moreover, in order to construct an effectual biosensor, the researcher should familiarize themself with the sensible strategies behind electrode fabrication. Thus, we intend to shed light on various strategies and methodologies utilized in the design and fabrication of electrochemical biosensors that facilitate sensitive and selective detection of significant analytes. Furthermore, this review highlights the advantages of various electrode materials and the correlation between immobilized biomolecules and modified surfaces.
Also flagged:non-alcoholic fatty liver diseaseNAFLDironobesityglucoseType 2 diabetes
Journal Article2023-03-27✓ 5 SnippetsSun Z, Pan X, Tian A, Surakka I, Wang T, Jiao X, He S, Song J, Tian X, Tong D, Wen J, Zhang Y, Liu W, Chen P.
In-Text Gene Mentions
Abstract)
…HFE rs1800562 was specifically associated with lean NAFLD and demonstrated a significant mediation effect through elevating hepatic iron.…
Abstract)⭐ same-sentence co-mention
…Four loci, namely, HFE rs1800562, SLC17A3-SLC17A2-TRIM38 rs9348697, PNPLA3 rs738409, and TM6SF2 rs58542926, were associated with lean NAFLD (p <5 × 10-8).…
Results)
…The effect of HFE rs1800562 C282Y on lean NAFLD was likely imposed in a recessive model (OR 22.95, p = 7.9 × 10-33) (Table S3).…
Discussion)
…Indeed, a recent study has identified HFE as a negative regulator of LDL receptor expression in hepatocytes,41 indicating a potential steatogenic role of HFE. Steatogenic mechanisms of HFE C282Y rs1800562-A on lean NAFLD may be attributed to oxidative stress,42 macrophage activation,43 stellate cell activation,44 endoplasmic reticulum stress,45 and increased cholesterol synthesis.46…
Results)
…We set out to explore whether there is a causal relationship between lean/obese NAFLD, HFE rs1800562, and liver iron content (Fig. 1, Phase 4).…
Show Full Abstract
<h4>Background & aims</h4>Around 20% of patients with non-alcoholic fatty liver disease (NAFLD) are lean. Increasing evidence suggests that lean NAFLD is a unique subtype of the disease. We aimed to explore the metabolic profile, genetic basis, causal risk factors, and clinical sequelae underlying lean NAFLD.<h4>Methods</h4>NAFLD was diagnosed by whole liver proton density fat fraction ≥5%. Whole liver proton density fat fraction and hepatic iron were quantified using magnetic resonance imaging in the UK Biobank. Individuals in this study were stratified according to the World Health Organization criteria of obesity, into lean, overweight, and obese. Mediation analysis, Mendelian randomisation analysis, and Bayesian networks were used to identify a risk factor or a clinical sequela of lean/obese NAFLD.<h4>Results</h4>Lean NAFLD manifested a distinct metabolic profile, featured by elevated hepatic iron and fasting glucose. Four loci, namely, <i>HFE</i> rs1800562, <i>SLC17A3-SLC17A2-TRIM38</i> rs9348697, <i>PNPLA3</i> rs738409, and <i>TM6SF2</i> rs58542926, were associated with lean NAFLD (<i>p</i> <5 × 10<sup>-8</sup>). <i>HFE</i> rs1800562 was specifically associated with lean NAFLD and demonstrated a significant mediation effect through elevating hepatic iron. Type 2 diabetes was the most pronounced clinical sequela of lean NAFLD, followed by liver cirrhosis.<h4>Conclusions</h4>Our study suggested that <i>HFE</i> plays a potential steatogenic role rather than regulating iron homoeostasis in patients with lean NAFLD. The increased liver iron deposition is associated with lean NAFLD, whereas obese NAFLD is not related to hepatic iron. The clinical management of patients with lean NAFLD shall be concerned with the prevention and treatment of type 2 diabetes and liver cirrhosis.<h4>Impact and implications</h4>Lean NAFLD has a distinct natural history from obese NAFLD. This study underscored liver iron content and the genetic variant of the iron homoeostasis gene HFE as major risks of lean NAFLD, in addition to the unique metabolic profile. The development of type 2 diabetes or liver cirrhosis shall be closely monitored and prevented in patients with lean NAFLD.
Also flagged:hepatocellular carcinomanon-small cell lung cancerlung adenocarcinomabone metastasescisplatinpaclitaxel
Journal Article2023-03-27✓ 1 SnippetNa SK, Kang SH.
In-Text Gene Mentions
I A O 0000613)
…Mildhemochromatosiswith pericellular fibrosis…
Show Full Abstract
Multiple primary malignancies (MPMs) are defined as the presence of two or more malignancies in different organs, without a subordinate relationship. Although rarely reported, hepatocellular carcinoma (HCC) occasionally presents with simultaneous or metachronous primary malignancies in other organs. In this report, we describe a patient with lung adenocarcinoma and lymph node and bone metastases, treated with five chemotherapeutic regimens for 24 months. Changing the chemotherapy regimen based on the suspicion of metastasis of a new liver mass did not lead to improvements. This prompted a liver biopsy and a revised diagnosis of HCC. Sixth-line treatment with the concurrent use of cisplatin-paclitaxel for lung cancer and sorafenib for HCC, stabilized the disease. The concurrent treatment was not tolerated and was discontinued owing to adverse events. Considering our findings, treatment with increased efficacy and lower toxicity for MPMs is warranted.
medRxiv2023-03-27Preprint (No Snippets API)Wilson GN.
Show Full Abstract
<h4>Objectives</h4> Characterization of tissue laxity and dysautonomia symptoms in Ehlers-Danlos syndrome (EDS) uncovered similarities with those of post-infectious SARS-CoV-2 or long COVID19, prompting detailed comparison of their findings and influencing genes. <h4>Methods</h4> Holistic assessment of 1261 EDS outpatients for 120 history-physical findings populated a deidentified database that includes 568 patients with 317 variant genes obtained by commercial NextGen sequencing. Findings were compared to 15 of long COVID19 compiled in an extensive review, genes to 104 associated with COVID19 severity in multiple molecular studies. <h4>Results</h4> Fifteen symptoms common to Ehlers-Danlos versus long COVID19 ranged from brain fog (27-80 versus 30-70%), chronic fatigue (38-91; 30-60%), dyspnea (32-52; 29-52%) to irritable bowel (67-89; 14-78%), muscle weakness (22-49; 15-25%), and arthritis (32-94; 15-27%). Genes relevant to EDS included 6 identical to those influencing COVID19 severity ( F2 , LIFR , NLRP3 , STAT1 , T1CAM1 , TNFRSF13B ) and 18 similar including POLG - POLD4 , SLC6A2-SLC6A20 , and NFKB1-NFKB2 . Both gene sets had broad genomic distribution, many mitochondrial genes influencing EDS and many involved with immunity-inflammation modifying COVID19 severity. Recurring DNA variants in EDS that merit evaluation in COVID19 resistance include those impacting connective tissue elements--51 in COL5 (joint), 29 in COL1/2/9/11 (bone), 13 in COL3 (vessel), and 18 in FBN1 (vessel-heart)--or neural function--93 in mitochondrial DNA, 28 in COL6/12 , 16 in SCN9A/10A/11A , 14 in POLG , and 11 in genes associated with porphyria. <h4>Conclusions</h4> Holistic ascertainment of finding pattern and exome variation in EDS defined tissue laxity, neuromuscular, and autonomic correlations that transcend single abnormalities or types. Implied networks of nuclear and mitochondrial genes are linked to findings like brain fog, fatigue, and frailty in EDS, their similarity to long COVID19 supporting shared therapies for disorders affecting a minimum 0.1% of the global population.
bioRxiv2023-03-27Preprint (No Snippets API)Burigotto M, Vigorito V, Mattivi A, Gliech C, Ghetti S, Bisio A, Lolli G, Holland AJ, Fava LL.
Show Full Abstract
53BP1 acts at the crossroads between DNA repair and p53-mediated stress response. With its interactor USP28, it is part of the mitotic surveillance pathway (MSP), a sensor that monitors the duration of cell division, promoting p53-dependent cell cycle arrest when a critical time threshold is surpassed. 53BP1 dynamically associates with kinetochores, being recruited during prophase, and then undergoing a time-dependent loss of affinity. However, the relevance of this behaviour remains unclear. Here, we identify CENP-F as an interaction partner and kinetochore receptor for 53BP1. By engineering human cells with a CENP-F point mutation, we demonstrate that preventing 53BP1 kinetochore localization does not reduce MSP proficiency. Strikingly, however, preventing the loss of 53BP1 from the kinetochore by inhibiting Polo-like kinase 1 (PLK1) restrains MSP activity, a phenomenon that is abrogated in the CENP-F mutant condition. Taken together, we demonstrate that kinetochore-loaded 53BP1 represents an MSP functionally inhibited state and that PLK1-dependent re-localization of 53BP1 represents an important layer of MSP regulation.
Also flagged:carbonic anhydraseTGFB2SLC6A4NOS1serotoninnitric oxide
Journal Article2023-03-26✓ 1 SnippetSan-Jose LM, Bestion E, Pellerin F, Richard M, Di Gesu L, Salmona J, Winandy L, Legrand D, Bonneaud C, Guillaume O, Calvez O, Elmer KR, Yurchenko AA, Recknagel H, Clobert J, Cote J.
In-Text Gene Mentions
Abstract)
…the carbonic anhydrase (CA10) gene, and in…
Show Full Abstract
Although animal dispersal is known to play key roles in ecological and evolutionary processes such as colonization, population extinction and local adaptation, little is known about its genetic basis, particularly in vertebrates. Untapping the genetic basis of dispersal should deepen our understanding of how dispersal behaviour evolves, the molecular mechanisms that regulate it and link it to other phenotypic aspects in order to form the so-called dispersal syndromes. Here, we comprehensively combined quantitative genetics, genome-wide sequencing and transcriptome sequencing to investigate the genetic basis of natal dispersal in a known ecological and evolutionary model of vertebrate dispersal: the common lizard, Zootoca vivipara. Our study supports the heritability of dispersal in semi-natural populations, with less variation attributable to maternal and natal environment effects. In addition, we found an association between natal dispersal and both variation in the carbonic anhydrase (CA10) gene, and in the expression of several genes (TGFB2, SLC6A4, NOS1) involved in central nervous system functioning. These findings suggest that neurotransmitters (serotonin and nitric oxide) are involved in the regulation of dispersal and shaping dispersal syndromes. Several genes from the circadian clock (CRY2, KCTD21) were also differentially expressed between disperser and resident lizards, supporting that the circadian rhythm, known to be involved in long-distance migration in other taxa, might affect dispersal as well. Since neuronal and circadian pathways are relatively well conserved across vertebrates, our results are likely to be generalisable, and we therefore encourage future studies to further investigate the role of these pathways in shaping dispersal in vertebrates.
Also flagged:myocardial diseasediabetesheart diseasecardiovascular diseasedeathheart diseases
Journal Article2023-03-26No SnippetsAraten S, Mathieu R, Jetly A, Shin H, Hilal N, Zhang B, Morillo K, Nandan D, Sivankutty I, Chen MH, Choudhury S.
Show Full Abstract
Single-cell approaches have become an increasingly popular way of understanding the genetic factors behind disease. Isolation of DNA and RNA from human tissues is necessary to analyze multi-omic data sets, providing information on the single-cell genome, transcriptome, and epigenome. Here, we isolated high-quality single-nuclei from postmortem human heart tissues for DNA and RNA analysis. Postmortem human tissues were obtained from 106 individuals, 33 with a history of myocardial disease, diabetes, or smoking, and 73 controls without heart disease. We demonstrated that the Qiagen EZ1 instrument and kit consistently isolated genomic DNA of high yield, which can be used for checking DNA quality before conducting single-cell experiments. Here, we provide a method for single-nuclei isolation from cardiac tissue, otherwise known as the SoNIC method, which allows for the isolation of single cardiomyocyte nuclei from postmortem tissue by nuclear ploidy status. We also provide a detailed quality control measure for single-nuclei whole genome amplification and a pre-amplification method for confirming genomic integrity.
There is a large unmet medical need to develop disease-modifying treatment options for individuals with age-related degenerative diseases of the central nervous system. The sigma-2 receptor (S2R), encoded by <i>TMEM97</i>, is expressed in brain and retinal cells, and regulates cell functions via its co-receptor progesterone receptor membrane component 1 (PGRMC1), and through other protein-protein interactions. Studies describing functions of S2R involve the manipulation of expression or pharmacological modulation using exogenous small-molecule ligands. These studies demonstrate that S2R modulates key pathways involved in age-related diseases including autophagy, trafficking, oxidative stress, and amyloid-β and α-synuclein toxicity. Furthermore, S2R modulation can ameliorate functional deficits in cell-based and animal models of disease. This review summarizes the current evidence-based understanding of S2R biology and function, and its potential as a therapeutic target for age-related degenerative diseases of the central nervous system, including Alzheimer's disease, α-synucleinopathies, and dry age-related macular degeneration.
Also flagged:APCSAPOEFLOT1FN1subfertilitymale subfertility
Journal Article2023-03-26No SnippetsBecker LS, Al Smadi MA, Raeschle M, Rishik S, Abdul-Khaliq H, Meese E, Abu-Halima M.
Show Full Abstract
Although the proteome of sperm has been characterized, there is still a lack of high-throughput studies on dysregulated proteins in sperm from subfertile men, with only a few studies on the sperm proteome in asthenozoospermic and oligoasthenozoospermic men. Using liquid chromatography-mass spectrometry (LC-MS/MS) along with bioinformatics analyses, we investigated the proteomic landscape of sperm collected from subfertile men (<i>n</i> = 22), i.e., asthenozoospermic men (<i>n</i> = 13), oligoasthenozoospermic men (<i>n</i> = 9) and normozoospermic controls (<i>n</i> = 31). We identified 4412 proteins in human sperm. Out of these, 1336 differentially abundant proteins were identified in 70% of the samples. In subfertile men, 32 proteins showed a lower abundance level and 34 showed a higher abundance level when compared with normozoospermic men. Compared to normozoospermic controls, 95 and 8 proteins showed a lower abundance level, and 86 and 1 proteins showed a higher abundance level in asthenozoospermic and oligoasthenozoospermic men, respectively. Sperm motility and count were negatively correlated with 13 and 35 and positively correlated with 37 and 20 differentially abundant proteins in asthenozoospermic and oligoasthenozoospermic men, respectively. The combination of the proteins APCS, APOE, and FLOT1 discriminates subfertile males from normozoospermic controls with an AUC value of 0.95. Combined APOE and FN1 proteins discriminate asthenozoospermic men form controls with an AUC of 1, and combined RUVBL1 and TFKC oligoasthenozoospermic men with an AUC of 0.93. Using a proteomic approach, we revealed the proteomic landscape of sperm collected from asthenozoospermic or oligoasthenozoospermic men. Identified abundance changes of several specific proteins are likely to impact sperm function leading to subfertility. The data also provide evidence for the usefulness of specific proteins or protein combinations to support future diagnosis of male subfertility.
<h4>Introduction and objectives</h4>The agreement of elastography techniques in chronic Hepatitis B (CHB) needs evaluation. We aimed to evaluate, in CHB, the agreement between transient elastography (TE) and two-dimensional shear wave elastography (2D-SWE), analyzing the factors related to the disagreement of measures.<h4>Materials and methods</h4>CHB patients underwent liver stiffness measures with both TE and 2D-SWE on the same day. For concordance analysis, we defined liver fibrosis as F0/1 vs. F ≥ 2, F0/1-F2 vs. F ≥ 3 and F0/1-F2-F3 vs. F4 for both methods. Logistic regression analysis was used to identify the variables independently associated with the disagreement between methods.<h4>Results</h4>A total of 150 patients were enrolled. Liver fibrosis categorization according to TE was: F0-F1 = 73 (50.4%), F ≥ 2 = 40 (27.6%), F ≥ 3 = 21 (14.5%) and F4 = 11 (7.6%), and according to 2D-SWE was: F0/F1 = 113 (77.9%), F ≥ 2 = 32 (22.1%), F≥ 3 = 25 (17.2%) and F4 = 11 (7.6%). It was observed that 20.0% of the sample had steatosis (CAP≥ 275 dB/m). TE and SD-SWE estimated equal fibrosis stages in 79.3% of cases. Spearman's correlation coefficient was 0.71 (<i>p</i> < 0.01). Kappa values for F ≥ 2, F ≥ 3 and F = 4 were: 0.78, <i>p</i> < 0.001; 0.73, <i>p</i> < 0.001; and 0.64, <i>p</i> < 0.001, respectively. Diabetes mellitus (DM) (OR 5.04; 95%CI: 1.89-13.3; <i>p</i> < 0.001) and antiviral treatment (OR 6.79; 95%CI: 2.33-19.83; <i>p</i> < 0.001) were independently associated with discordance between both methods.<h4>Conclusions</h4>In CHB, there is strong correlation and good agreement between TE and 2D-SWE in identifying fibrosis stages. Diabetes mellitus and antiviral therapy may impact the agreement of stiffness measures obtained with these elastographic methods.
Also flagged:GHRLaron syndromeLSgenetic disorderinsulin-like growth factor 1IGF1
Journal Article2023-03-26No SnippetsSchilloks MC, Giese IM, Hinrichs A, Korbonits L, Hauck SM, Wolf E, Deeg CA.
Show Full Abstract
Laron syndrome (LS) is a rare genetic disorder characterized by low levels of insulin-like growth factor 1 (IGF1) and high levels of growth hormone (GH) due to mutations in the growth hormone receptor gene (<i>GHR</i>). A <i>GHR</i>-knockout (<i>GHR</i>-KO) pig was developed as a model for LS, which displays many of the same features as humans with LS-like transient juvenile hypoglycemia. This study aimed to investigate the effects of impaired GHR signaling on immune functions and immunometabolism in <i>GHR</i>-KO pigs. GHR are located on various cell types of the immune system. Therefore, we investigated lymphocyte subsets, proliferative and respiratory capacity of peripheral blood mononuclear cells (PBMCs), proteome profiles of CD4<sup>-</sup> and CD4<sup>+</sup> lymphocytes and IFN-α serum levels between wild-type (WT) controls and <i>GHR</i>-KO pigs, which revealed significant differences in the relative proportion of the CD4<sup>+</sup>CD8α<sup>-</sup> subpopulation and in IFN-α levels. We detected no significant difference in the respiratory capacity and the capacity for polyclonal stimulation in PBMCs between the two groups. But proteome analysis of CD4<sup>+</sup> and CD4<sup>-</sup> lymphocyte populations revealed multiple significant protein abundance differences between <i>GHR</i>-KO and WT pigs, involving pathways related to amino acid metabolism, beta-oxidation of fatty acids, insulin secretion signaling, and oxidative phosphorylation. This study highlights the potential use of <i>GHR</i>-KO pigs as a model for studying the effects of impaired GHR signaling on immune functions.
Also flagged:Gene expressioncancerchromatinorgan developmentinfectionH. pylori
Journal Article2023-03-25No SnippetsSmirnov A, Melino G, Candi E.
Show Full Abstract
Recent development of human three-dimensional organoid cultures has opened new doors and opportunities ranging from modelling human development in vitro to personalised cancer therapies. These new in vitro systems are opening new horizons to the classic understanding of human development and disease. However, the complexity and heterogeneity of these models requires cutting-edge techniques to capture and trace global changes in gene expression to enable identification of key players and uncover the underlying molecular mechanisms. Rapid development of sequencing approaches made possible global transcriptome analyses and epigenetic profiling. Despite challenges in organoid culture and handling, these techniques are now being adapted to embrace organoids derived from a wide range of human tissues. Here, we review current state-of-the-art multi-omics technologies, such as single-cell transcriptomics and chromatin accessibility assays, employed to study organoids as a model for development and a platform for precision medicine.
Journal Article2023-03-25✓ 5 SnippetsYe M, Ma Y, Qin YX, Cai B, Ma LM, Ma Z, Liu Y, Jin ZB, Zhuang WJ.
In-Text Gene Mentions
Abstract)
…These newly identified genetic variations not only broaden the genetic and clinical spectra, but also offer convincing evidence that the genes ARR3, NDUFAF7, TNFRSF21, and ZNF644 contribute to hereditable HM.…
Abstract)
…Sixteen potentially pathogenic variants predicted to affect protein function in eight of seventeen causative genes for HM in fifteen (13.3%) families were revealed, including seven novel variants, c.767 + 1G > A in ARR3, c.3214C > A/p.H1072N, and c.2195C > T/p.A732V in ZNF644, c.1270G > T/p.V424L in CPSF1, c.1918G > C/p.G640R and c.2786T > G/p.V929G in XYLT1, c.601G > C/p.E201Q in P4HA2; six rare variants, c.799G > A/p.E267K in NDUFAF7, c.1144C > T/p.R382W in TNFRSF21, c.1100C > T/p.P367L in ZNF644, c.3980C > T/p.S1327L in CPSF1, c.145G > A/p.E49K and c.325G > T/p.G109W in SLC39A5; and three known variants, c.2014A > G/p.S672G and c.3261A > C/p.E1087D in ZNF644, c.605C > T/p.P202L in TNFRSF21.…
Abstract)
…A732V inZNF644, c.1270G > T/p.…
Abstract)
…P367L inZNF644, c.3980C > T/p.…
Abstract)
…E1087D inZNF644, c.605C > T/p.…
Show Full Abstract
High myopia (HM) is a leading cause of visual impairment in the world. To expand the genotypic and phenotypic spectra of HM in the Chinese population, we investigated genetic variations in a cohort of 113 families with nonsyndromic early-onset high myopia from northwestern China by whole-exome sequencing, with focus on 17 known genes. Sixteen potentially pathogenic variants predicted to affect protein function in eight of seventeen causative genes for HM in fifteen (13.3%) families were revealed, including seven novel variants, c.767 + 1G > A in ARR3, c.3214C > A/p.H1072N, and c.2195C > T/p.A732V in ZNF644, c.1270G > T/p.V424L in CPSF1, c.1918G > C/p.G640R and c.2786T > G/p.V929G in XYLT1, c.601G > C/p.E201Q in P4HA2; six rare variants, c.799G > A/p.E267K in NDUFAF7, c.1144C > T/p.R382W in TNFRSF21, c.1100C > T/p.P367L in ZNF644, c.3980C > T/p.S1327L in CPSF1, c.145G > A/p.E49K and c.325G > T/p.G109W in SLC39A5; and three known variants, c.2014A > G/p.S672G and c.3261A > C/p.E1087D in ZNF644, c.605C > T/p.P202L in TNFRSF21. Ten of them were co-segregated with HM. The mean (± SD) examination age of these 15 probands was 14.7 (± 11.61) years. The median spherical equivalent was - 9.50 D (IQ - 8.75 ~ - 12.00) for the right eye and - 11.25 D (IQ - 9.25 ~ - 14.13) for the left eye. The median axial length was 26.67 mm (IQ 25.83 ~ 27.13) for the right eye and 26.25 mm (IQ 25.97 ~ 27.32) for the left eye. These newly identified genetic variations not only broaden the genetic and clinical spectra, but also offer convincing evidence that the genes ARR3, NDUFAF7, TNFRSF21, and ZNF644 contribute to hereditable HM. This work improves further understanding of molecular mechanism of HM.
Also flagged:nucleusextracellulartransgelinfibromodulinsecreted phosphoprotein 1SPP1
Journal Article2023-03-25✓ 2 SnippetsZhou T, Chen Y, Liao Z, Zhang L, Su D, Li Z, Yang X, Ke X, Liu H, Chen Y, Weng R, Shen H, Xu C, Wan Y, Xu R, Su P.
In-Text Gene Mentions
Results)
…SOX5 , andSOX6(Figure S6A,D ,…
Results)
…SOX5 , andSOX6, while the…
Show Full Abstract
The intervertebral disc (IVD) acts as a fibrocartilaginous joint to anchor adjacent vertebrae. Although several studies have demonstrated the cellular heterogeneity of adult mature IVDs, a single-cell transcriptomic atlas mapping early IVD formation is still lacking. Here, the authors generate a spatiotemporal and single cell-based transcriptomic atlas of human IVD formation at the embryonic stage and a comparative mouse transcript landscape. They identify two novel human notochord (NC)/nucleus pulposus (NP) clusters, SRY-box transcription factor 10 (SOX10)<sup>+</sup> and cathepsin K (CTSK)<sup>+</sup> , that are distributed in the early and late stages of IVD formation and they are validated by lineage tracing experiments in mice. Matrisome NC/NP clusters, T-box transcription factor T (TBXT)<sup>+</sup> and CTSK<sup>+</sup> , are responsible for the extracellular matrix homeostasis. The IVD atlas suggests that a subcluster of the vertebral chondrocyte subcluster might give rise to an inner annulus fibrosus of chondrogenic origin, while the fibroblastic outer annulus fibrosus preferentially expresseds transgelin and fibromodulin . Through analyzing intercellular crosstalk, the authors further find that notochordal secreted phosphoprotein 1 (SPP1) is a novel cue in the IVD microenvironment, and it is associated with IVD development and degeneration. In conclusion, the single-cell transcriptomic atlas will be leveraged to develop preventative and regenerative strategies for IVD degeneration.
Also flagged:organizationAnnexin A2S100 proteinsS100A10membranecancers
Journal Article2023-03-25No SnippetsLindsay S, Bartolotti L, Li Y.
Show Full Abstract
Annexin A2 (A2) is a member of the Annexin family, which contains Ca<sup>2+</sup> -regulated phospholipid-binding proteins. Annexins associate with S100 proteins to form heterotetramers. The A2/S100A10 heterotetramer (A2t) is the most extensively studied of these heterotetramers. It induces membrane microdomain formation, causes membrane budding, and facilitates proliferation of some cancers. In this work, the first molecular dynamics (MD) study on the complete A2t of 868 amino acids was performed. MD trajectories of more than 600 ns each were generated for complete A2t complexes with and without Ca<sup>2+</sup> ions. The outward extension of membrane-binding residues A2-K279 and A2-K281 was shown to be inhibited in the absence of Ca<sup>2+</sup> as they were captured by Ca<sup>2+</sup> -binding residue D322. F-actin binding residue A2-D339 was observed to occupy either an exposed or buried state in the absence of Ca<sup>2+</sup> , while it only occupied the buried state in the presence of Ca<sup>2+</sup> . The observed motions of the A2t subunits are highly organized with a strongly correlated central region which is negatively correlated with the periphery of the complex. The central region contains the S100A10 (p11) dimer, A2-N, and A2-I, while the periphery contains A2-II, A2-III, and A2-IV. Novel interactions between A2 and p11 were identified. A2 residues outside of A2-N (K80, R77, E82, and R145) had strong interactions with p11. Residue R145 of A2 may have a significant effect on the dynamics of the system, with its interaction resulting in asymmetric motions of A2. The presented results provide novel insights to inform future experimental studies.
Also flagged:Esophageal squamous cell carcinomaESCCtumorcanceralcoholchromosome
Journal Article2023-03-25✓ 5 SnippetsLi L, Jiang D, Zhang Q, Liu H, Xu F, Guo C, Qin Z, Wang H, Feng J, Liu Y, Chen W, Zhang X, Bai L, Tian S, Tan S, Xu C, Song Q, Liu Y, Zhong Y, Chen T, Zhou P, Zhao JY, Hou Y, Ding C.
In-Text Gene Mentions
Results)
…Generally, OLFM4 promotes S-phase transition in cancer cell proliferation23.…
Discussion)
…We applied the NMF algorithm to analyze the mutational signatures of the Fudan cohort and other ESCC cohorts, including the TCGA cohort, Moody’s cohort, etc. The integrated findings revealed that the SBS16 signature, which was associated with the ESCC patients with a drinking habit and OLFM4 mutation exhibited positive impacts on CDKs activation and thus enhancing DNA replication evidenced by the related markers, indicating the potential medicative of Dinaciclib for drinking ESCC patients.…
Results)
…Taken together, SBS16 signature was a key event in the transition from the NT phase to the IEN phase for ESCC patients with a drinking habit, in which OLFM4 mutation showed positive impacts on DNA replication (Fig. 2j).…
Results)
…To further validate the findings in our cohort, we analyzed the impacts of OLFM4 in other ESCC cohorts, such as the Li’s cohort25 and the Liu’s cohort26, and found that OLFM4 displayed positive association with DNA replication-related proteins at the protein level in these cohorts (Fig. 2d and Supplementary Fig. 3d).…
Methods)
…the mutations (e.g.,OLFM4, DCTN2 ,…
Show Full Abstract
Esophageal squamous cell carcinoma (ESCC) is malignant while the carcinogenesis is still unclear. Here, we perform a comprehensive multi-omics analysis of 786 trace-tumor-samples from 154 ESCC patients, covering 9 histopathological stages and 3 phases. Proteogenomics elucidates cancer-driving waves in ESCC progression, and reveals the molecular characterization of alcohol drinking habit associated signatures. We discover chromosome 3q gain functions in the transmit from nontumor to intraepithelial neoplasia phases, and find TP53 mutation enhances DNA replication in intraepithelial neoplasia phase. The mutations of AKAP9 and MCAF1 upregulate glycolysis and Wnt signaling, respectively, in advanced-stage ESCC phase. Six major tracks related to different clinical features during ESCC progression are identified, which is validated by an independent cohort with another 256 samples. Hyperphosphorylated phosphoglycerate kinase 1 (PGK1, S203) is considered as a drug target in ESCC progression. This study provides insight into the understanding of ESCC molecular mechanism and the development of therapeutic targets.
Also flagged:Mitochondriagene expressionmitochondrialoxygenmanganesefatty acid
Journal Article2023-03-25✓ 3 SnippetsFernandes J, Uppal K, Liu KH, Hu X, Orr M, Tran V, Go YM, Jones DP.
In-Text Gene Mentions
Results)
…the abundance ofCACNA1E[−], a subunit…
Results)
…CACNA1Emodulates neuronal firing…
Results)
…The decrease inCACNA1Eabundance while the…
Show Full Abstract
Antagonistic interaction refers to opposing beneficial and adverse signaling by a single agent. Understanding opposing signaling is important because pathologic outcomes can result from adverse causative agents or the failure of beneficial mechanisms. To test for opposing responses at a systems level, we used a transcriptome-metabolome-wide association study (TMWAS) with the rationale that metabolite changes provide a phenotypic readout of gene expression, and gene expression provides a phenotypic readout of signaling metabolites. We incorporated measures of mitochondrial oxidative stress (mtOx) and oxygen consumption rate (mtOCR) with TMWAS of cells with varied manganese (Mn) concentration and found that adverse neuroinflammatory signaling and fatty acid metabolism were connected to mtOx, while beneficial ion transport and neurotransmitter metabolism were connected to mtOCR. Each community contained opposing transcriptome-metabolome interactions, which were linked to biologic functions. The results show that antagonistic interaction is a generalized cell systems response to mitochondrial ROS signaling.
Also flagged:immune responseslactatecervical cancertumorslactic acidtumor
Journal Article2023-03-25✓ 5 SnippetsYang X, Zhang W, Zhu W.
In-Text Gene Mentions
Discussion)
…Therefore, thousands of genes up-regulated (DARS2, PC, PDP1, SDHB, PET100, COX5A, MDH2, COX6B1, TWNK, SDHA, MPC2) (Fig. 1A, P < 0.001) by lactate may collectively represent a transcriptional network that participates in the reprogramming of cells for lactate generation and carcinogenesis.…
Methods)
…contains 26 genes:DARS2, EARS2, SURF1, POLG,…
Results)
…(P < 0.001),DARS2(P < 0.001),…
Discussion)
…of genes up-regulated (DARS2, PC, PDP1, SDHB,…
Discussion)
…EP300, ACACA, LDHA,DARS2, NDUFA13 and TWNK…
Show Full Abstract
Cervical cancer is still an important problem perplexing health management in developing countries. Previous studies have shown that cervical cancer cells show markers of aerobic glycolysis, suggesting that these tumors may secrete lactic acid. Through the biological characterization of lactate gene in tumor and its relationship with immune cells in tumor microenvironment, a lactate scoring system capable of evaluating cancer prognosis was constructed to explore the molecular mechanism of lactate metabolism disorder affecting prognosis. 29 hub genes in this study were differentially expressed in cervical cancer, including 24 genes related to lactate metabolism, LDHA in Lactate dehydrogenase (LDH) group, SLC16A3 in Monocarboxylate transporters (MCT) group and three Histone lactation modification related genes (EP300, ACAT1, ACACA). More importantly, we found that from an epigenetic point of view, histone lactation plays an important role in the pathogenesis and prognosis of cervical cancer. Mainly affect the prognosis of the disease through changes in the infiltration of plasmacytoid Dendritic Cell (pDC) and Central Memory T cell (Tcm) in the tumor immune microenvironment. Lactate inhibition may be a useful tool for anticancer therapy.
Also flagged:Systemic lupus erythematosusSLEphosphorylationpathogenesishydroxychloroquinetoll-like receptor
Journal Article2023-03-25✓ 5 SnippetsFujio K.
In-Text Gene Mentions
S I O 001029)
…Takeshima et al. analyzed key driver genes in SLE and identified peroxiredoxin 6 (PRDX6) [11], which is an antioxidant enzyme that suppresses cellular ROS [32] and has been identified as an SLE-susceptibility gene [22].…
S I O 001029)
…In an eQTL analysis of Japanese subjects, PRDX6 was found to be an SLE-specific eGene in B cells.…
Systemic lupus erythematosus (SLE) is caused by a combination of genetic and environmental factors. Recently, analysis of a functional genome database of genetic polymorphisms and transcriptomic data from various immune cell subsets revealed the importance of the oxidative phosphorylation (OXPHOS) pathway in the pathogenesis of SLE. In particular, activation of the OXPHOS pathway is persistent in inactive SLE, and this activation is associated with organ damage. The finding that hydroxychloroquine (HCQ), which improves the prognosis of SLE, targets toll-like receptor (TLR) signaling upstream of OXPHOS suggests the clinical importance of this pathway. IRF5 and SLC15A4, which are regulated by polymorphisms associated with SLE susceptibility, are functionally associated with OXPHOS as well as blood interferon activity and metabolome. Future analyses of OXPHOS-associated disease-susceptibility polymorphisms, gene expression, and protein function may be useful for risk stratification of SLE.
Also flagged:coronary artery diseasesynapseCardiovascular diseasegastroesophageal reflux diseaseGERDcholesterol
Journal Article2023-03-25No SnippetsMcCaffrey TA, Toma I, Yang Z, Katz R, Reiner J, Mazhari R, Shah P, Falk Z, Wargowsky R, Goldman J, Jones D, Shtokalo D, Antonets D, Jepson T, Fetisova A, Jaatinen K, Ree N, Ri M.
Show Full Abstract
<h4>Background</h4>Cardiovascular disease had a global prevalence of 523 million cases and 18.6 million deaths in 2019. The current standard for diagnosing coronary artery disease (CAD) is coronary angiography either by invasive catheterization (ICA) or computed tomography (CTA). Prior studies employed single-molecule, amplification-independent RNA sequencing of whole blood to identify an RNA signature in patients with angiographically confirmed CAD. The present studies employed Illumina RNAseq and network co-expression analysis to identify systematic changes underlying CAD.<h4>Methods</h4>Whole blood RNA was depleted of ribosomal RNA (rRNA) and analyzed by Illumina total RNA sequencing (RNAseq) to identify transcripts associated with CAD in 177 patients presenting for elective invasive coronary catheterization. The resulting transcript counts were compared between groups to identify differentially expressed genes (DEGs) and to identify patterns of changes through whole genome co-expression network analysis (WGCNA).<h4>Results</h4>The correlation between Illumina amplified RNAseq and the prior SeqLL unamplified RNAseq was quite strong (r = 0.87), but there was only 9 % overlap in the DEGs identified. Consistent with the prior RNAseq, the majority (93 %) of DEGs were down-regulated ~1.7-fold in patients with moderate to severe CAD (>20 % stenosis). DEGs were predominantly related to T cells, consistent with known reductions in Tregs in CAD. Network analysis did not identify pre-existing modules with a strong association with CAD, but patterns of T cell dysregulation were evident. DEGs were enriched for transcripts associated with ciliary and synaptic transcripts, consistent with changes in the immune synapse of developing T cells.<h4>Conclusions</h4>These studies confirm and extend a novel mRNA signature of a Treg-like defect in CAD. The pattern of changes is consistent with stress-related changes in the maturation of T and Treg cells, possibly due to changes in the immune synapse.
Also flagged:Venous ThromboembolismPROS1MS4A1FGGF11ABO
Journal Article2023-03-24✓ 2 SnippetsSeyerle AA, Laurie CA, Coombes BJ, Jain D, Conomos MP, Brody J, Chen MH, Gogarten SM, Beutel KM, Gupta N, Heckbert SR, Jackson RD, Johnson AD, Ko D, Manson JE, McKnight B, Metcalf GA, Morrison AC, Reiner AP, Sofer T, Tang W, Wiggins KL, Trans-Omics for Precision Medicine Program, Boerwinkle E, de Andrade M, Gabriel SB, Gibbs RA, Laurie CC, Psaty BM, Vasan RS, Rice K, Kooperberg C, Pankow JS, Smith NL, Pankratz N.
In-Text Gene Mentions
Abstract)
…secondary filter), while <i>SERPINC1</i> did not (minimum…
Text
…SERPINC1…
Show Full Abstract
<h4>Background</h4>Risk for venous thromboembolism has a strong genetic component. Whole genome sequencing from the TOPMed program (Trans-Omics for Precision Medicine) allowed us to look for new associations, particularly rare variants missed by standard genome-wide association studies.<h4>Methods</h4>The 3793 cases and 7834 controls (11.6% of cases were individuals of African, Hispanic/Latino, or Asian ancestry) were analyzed using a single variant approach and an aggregate gene-based approach using our primary filter (included only loss-of-function and missense variants predicted to be deleterious) and our secondary filter (included all missense variants).<h4>Results</h4>Single variant analyses identified associations at 5 known loci. Aggregate gene-based analyses identified only <i>PROC</i> (odds ratio, 6.2 for carriers of rare variants; <i>P</i>=7.4×10<sup>-14</sup>) when using our primary filter. Employing our secondary variant filter led to a smaller effect size at <i>PROC</i> (odds ratio, 3.8; <i>P</i>=1.6×10<sup>-14</sup>), while excluding variants found only in rare isoforms led to a larger one (odds ratio, 7.5). Different filtering strategies improved the signal for 2 other known genes: <i>PROS1</i> became significant (minimum <i>P</i>=1.8×10<sup>-6</sup> with the secondary filter), while <i>SERPINC1</i> did not (minimum <i>P</i>=4.4×10<sup>-5</sup> with minor allele frequency <0.0005). Results were largely the same when restricting the analyses to include only unprovoked cases; however, one novel gene, <i>MS4A1</i>, became significant (<i>P</i>=4.4×10<sup>-7</sup> using all missense variants with minor allele frequency <0.0005).<h4>Conclusions</h4>Here, we have demonstrated the importance of using multiple variant filtering strategies, as we detected additional genes when filtering variants based on their predicted deleteriousness, frequency, and presence on the most expressed isoforms. Our primary analyses did not identify new candidate loci; thus larger follow-up studies are needed to replicate the novel <i>MS4A1</i> locus and to identify additional rare variation associated with venous thromboembolism.
Also flagged:endometriosisautoimmune diseasesankylosing spondylitisASspondyloarthritides diseasesinfertility
Journal Article2023-03-24✓ 1 SnippetZervou MI, Papageorgiou L, Vlachakis D, Spandidos DA, Eliopoulos E, Goulielmos GN.
In-Text Gene Mentions
S I O 001029)
…In the largest GWAS and replication meta-analysis of endometriosis that has been performed to date, enrolling 60,674 cases and 701,926 controls of European and East Asian ancestry, 42 genome-wide significant loci were identified, including 31 novel ones, such as ADP ribosylation factor like GTPase 14 effector protein (ARL14EP), Bcl-2-modifying factor (BMF), homeobox A10 (HOXA10), long intergenic non-protein coding RNA 629 (LINC00629), alpha 1–3-N-acetylgalactosaminyltransferase and alpha 1–3-galactosyltransferase (ABO), bassoon presynaptic cytomatrix protein (BSN), PDZ and LIM domain 5 (PDLIM5), potassium channel tetramerization domain containing 9 (KCTD9), MLLT10 histone lysine methyltransferase DOT1L cofactor (MLLT10), actin like 9 (ACTL9) and inhibitor of DNA binding 4 (ID4) (39).…
Show Full Abstract
Previous research has revealed an association between endometriosis and various autoimmune diseases, while recent data suggest, for the first time, an association between endometriosis and the risk of developing ankylosing spondylitis (AS). AS, the prototype of spondyloarthritides diseases, is a systemic, chronic, immune‑mediated inflammatory arthritis, which primarily affects the spine and sacroiliac joints, as well as the axial skeleton with or without extraspinal manifestations. AS is of polygenic inheritance and numerous immunologically relevant genes contribute to its development. Endometriosis is an enigmatic, relatively common, benign, estrogen‑dependent, heterogeneous gynecological disease, influenced by multiple genetic, epigenetic and environmental factors. It is characterized by the growth of endometrial tissue occurring in sites other than the uterine cavity, most commonly in the pelvic cavity, including the ovaries and the uterosacral ligaments, affecting up to 10% of the female population of childbearing age, causing pain and infertility. The present review discusses whether a partially shared genetic background may explain the co‑occurrence of these disorders, as well as potential similarities regarding the underlying pathogenetic mechanisms and specific molecular and cellular pathways.
Also flagged:gene expressionneural stem cell proliferationneuron migrationsynapsebrain diseasescentral nervous system disorders
Journal Article2023-03-24No SnippetsZhang WH, Jiang L, Li M, Liu J.
Show Full Abstract
The central nervous system (CNS) consists of neuron and non-neuron cells including neural stem/precursor cells (NSPCs), neuroblasts, glia cells (mainly astrocyte, oligodendroglia and microglia), which thereby form a precise and complicated network and exert diverse functions through interactions of numerous bioactive ingredients. MicroRNAs (miRNAs), with small size approximately ~ 21nt and as well-documented post-transcriptional key regulators of gene expression, are a cluster of evolutionarily conserved endogenous non-coding RNAs. More than 2000 different miRNAs has been discovered till now. MicroRNA-124(miR-124), the most brain-rich microRNA, has been validated to possess important functions in the central nervous system, including neural stem cell proliferation and differentiation, cell fate determination, neuron migration, synapse plasticity and cognition, cell apoptosis etc. According to recent studies, herein, we provide a review of this conversant miR-124 to further understand the potential functions and therapeutic and clinical value in brain diseases.
Also flagged:PSMD11PERtranslationalribonucleoproteinphosphorylationsynthesis
Journal Article2023-03-24✓ 2 SnippetsCal-Kayitmazbatir S, Francey LJ, Lee Y, Liu AC, Hogenesch JB.
In-Text Gene Mentions
Introduction)
…with IQGAP1, KPNB1,CSE1L, GSK3 β ,…
Results)
…detected IQGAP1, KPNB1,CSE1L, CRY2, CRY1, GSK3…
Show Full Abstract
The molecular circadian clock is regulated by a transcriptional translational feedback loop. However, the post-translational control mechanisms are less understood. The NRON complex is a large ribonucleoprotein complex, consisting of a lncRNA and several proteins. Components of the complex play a distinct role in regulating protein phosphorylation, synthesis, stability, and translocation in cellular processes. This includes the NFAT and the circadian clock pathway. PSMD11 is a component of the NRON complex and a lid component of the 26S proteasome. Among the PSMD family members, PSMD11 has a more specific role in circadian clock function. Here, we used cell and biochemical approaches and characterized the role of PSMD11 in regulating the stability and nuclear translocation of circadian clock proteins. We used size exclusion chromatography to enrich the NRON complex in the cytosolic and nuclear fractions. More specifically, PSMD11 knockdown affected the abundance of PER2 and CRY2 proteins and the nuclear translocation of CRY1. This changed the relative abundance of CRY1 and CRY2 in the nucleus. Thus, this work defines the role of PSMD11 in the NRON complex regulating the nuclear translocation of circadian repressors, thereby enabling cellular circadian oscillations.
Also flagged:metabolic syndromeepilepsyASMdiabetesType 2 Diabetes MellitusDiabetes mellitus
Journal Article2023-03-24✓ 1 SnippetTseng WJ, Chang CW, Hwang JS, Ko PC, Liu CJ, Lim SN.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background and objectives</h4>Diabetes mellitus (DM) contributes significantly to metabolic syndrome and cardiovascular events, and it may be a comorbidity of epilepsy. The objective of this study was to investigate whether long-term antiseizure medication (ASM) use is associated with the risk of developing type 2 diabetes.<h4>Methods</h4>We analyzed data from the Chang Gung Research Database. Patients aged ≥45 years who received ASM treatment from January 2001 to May 2019 were identified. Patients with DM-associated diseases and short-term ASM use were excluded. The patients were classified into nonenzyme interaction, enzyme-inducing, enzyme-inhibiting, and mixed ASM groups. The rate of incident diabetes associated with individual ASM was further analyzed. Propensity score weighting was performed to balance between-group differences. Analyses were conducted with Cox proportional regression models and stabilized inverse probability of treatment weighting (IPTW). Hazard ratios (HRs) were calculated at 3, 4, 6, and 9 years after the index date and the end of follow-up.<h4>Results</h4>A total of 5,103 patients were analyzed, of whom 474 took nonenzyme interaction ASMs, 1,156 took enzyme-inducing ASMs, 336 took enzyme-inhibiting ASMs, and 3,137 took mixed ASMs. During follow-up (39,248 person-years), 663 patients developed new-onset DM, and the prevalence was 13.0%. The incidence of DM plateaued at 6-9 years after ASM initiation. Enzyme-inhibiting ASMs were significantly associated with a higher HR starting at the third year and then throughout the study period. The HRs were 1.93 (95% CI 1.33-2.80), 1.85 (95% CI 1.24-2.75), and 2.08 (95% CI 1.43-3.03) in unadjusted, adjusted, and stabilized IPTW models, respectively, at the end of follow-up. The dosing of ASM did not increase the risk of DM, and none of the individual ASM analyses reached statistical significance.<h4>Discussion</h4>The long-term use of enzyme-inhibiting ASMs was associated with an increased risk of incident DM, and the risk increased with the duration of treatment. These findings may guide the choice of drugs in those requiring long-term ASM therapy, particularly in high-risk individuals.<h4>Classification of evidence</h4>This study provides Class IV evidence that enzyme-inhibiting ASMs were associated with an increased risk of developing DM compared with nonenzyme interaction ASMs.
Also flagged:Pathogenesisallergic diseasesallergic rhinitisallergic asthmaatopic dermatitisAD
Journal Article2023-03-24No SnippetsWang J, Zhou Y, Zhang H, Hu L, Liu J, Wang L, Wang T, Zhang H, Cong L, Wang Q.
Show Full Abstract
Allergic diseases such as allergic rhinitis (AR), allergic asthma (AAS), atopic dermatitis (AD), food allergy (FA), and eczema are systemic diseases caused by an impaired immune system. Accompanied by high recurrence rates, the steadily rising incidence rates of these diseases are attracting increasing attention. The pathogenesis of allergic diseases is complex and involves many factors, including maternal-fetal environment, living environment, genetics, epigenetics, and the body's immune status. The pathogenesis of allergic diseases exhibits a marked heterogeneity, with phenotype and endotype defining visible features and associated molecular mechanisms, respectively. With the rapid development of immunology, molecular biology, and biotechnology, many new biological drugs have been designed for the treatment of allergic diseases, including anti-immunoglobulin E (IgE), anti-interleukin (IL)-5, and anti-thymic stromal lymphopoietin (TSLP)/IL-4, to control symptoms. For doctors and scientists, it is becoming more and more important to understand the influencing factors, pathogenesis, and treatment progress of allergic diseases. This review aimed to assess the epidemiology, pathogenesis, and therapeutic interventions of allergic diseases, including AR, AAS, AD, and FA. We hope to help doctors and scientists understand allergic diseases systematically.
Also flagged:mitochondrialcGASimmune responseadaptor proteinSTINGlocalization
Journal Article2023-03-24✓ 1 SnippetKim J, Kim HS, Chung JH.
In-Text Gene Mentions
S I O 001029)
…During the early phase of viral infection, tripartite motif-containing 38 (Trim38, an E3 ubiquitin ligase) stabilizes cGAS by preventing its Lys48 (K48)-linked ubiquitination and subsequent degradation36.…
Show Full Abstract
In addition to constituting the genetic material of an organism, DNA is a tracer for the recognition of foreign pathogens and a trigger of the innate immune system. cGAS functions as a sensor of double-stranded DNA fragments and initiates an immune response via the adaptor protein STING. The cGAS-STING pathway not only defends cells against various DNA-containing pathogens but also modulates many pathological processes caused by the immune response to the ectopic localization of self-DNA, such as cytosolic mitochondrial DNA (mtDNA) and extranuclear chromatin. In addition, macrophages can cause inflammation by forming a class of protein complexes called inflammasomes, and the activation of the NLRP3 inflammasome requires the release of oxidized mtDNA. In innate immunity related to inflammasomes, mtDNA release is mediated by macropores that are formed on the outer membrane of mitochondria via VDAC oligomerization. These macropores are specifically formed in response to mitochondrial stress and tissue damage, and the inhibition of VDAC oligomerization mitigates this inflammatory response. The rapidly expanding area of research on the mechanisms by which mtDNA is released and triggers inflammation has revealed new treatment strategies not only for inflammation but also, surprisingly, for neurodegenerative diseases such as amyotrophic lateral sclerosis.
<h4>Background</h4>Tissue engineering for cartilage regeneration has made great advances in recent years, although there are still challenges to overcome. This study aimed to evaluate the chondrogenic differentiation of human adipose-derived mesenchymal stem cells (hADSCs) on three-dimensional scaffolds based on polyglycerol sebacate (PGS) / polycaprolactone (PCL) / gelatin(Gel) in the presence of Nanohydroxyapatite (nHA).<h4>Materials and methods</h4>In this study, a series of nHA-nanocomposite scaffolds were fabricated using 100:0:0, 60:40:0, and 60:20:20 weight ratios of PGS to PCL: Gel copolymers through salt leaching method. The morphology and porosity of prepared samples was characterized by SEM and EDX mapping analysis. Also, the dynamic contact angle and PBS adsorption tests are used to identify the effect of copolymerization and nanoparticles on scaffolds' hydrophilicity. The hydrolytic degradation properties were also analyzed. Furthermore, cell viability and proliferation as well as cell adhesion are evaluated to find out the biocompatibility. To determine the potential ability of nHA-nanocomposite scaffolds in chondrogenic differentiation, RT-PCR assay was performed to monitor the expression of collagen II, aggrecan, and Sox9 genes as markers of cartilage differentiation.<h4>Results</h4>The nanocomposites had an elastic modulus within a range of 0.71-1.30 MPa and 0.65-0.43 MPa, in dry and wet states, respectively. The PGS/PCL sample showed a water contact angle of 72.44 ± 2.2°, while the hydrophilicity significantly improved by adding HA nanoparticles. It was found from the hydrolytic degradation study that HA incorporation can accelerate the degradation rate compared with PGS and PGS/PCL samples. Furthermore, the in vitro biocompatibility tests showed significant cell attachment, proliferation, and viability of adipose-derived mesenchymal stem cells (ADMSCs). RT-PCR also indicated a significant increase in collagen II, aggrecan and Sox9 mRNA levels.<h4>Conclusions</h4>Our findings demonstrated that these nanocomposite scaffolds promote the differentiation of hADSCs into chondrocytes possibly by the increase in mRNA levels of collagen II, aggrecan, and Sox9 as markers of chondrogenic differentiation. In conclusion, the addition of PCL, Gelatin, and HA into PGS is a practical approach to adjust the general features of PGS to prepare a promising scaffold for cartilage tissue engineering.
…increased methylation inPTGIS(cg27059136) and USP19…
Show Full Abstract
<h4>Background</h4>Per- and polyfluoroalkyl substances (PFAS) are chemicals that are resistant to degradation and ubiquitous in our environments. PFAS may impact the developing epigenome, but current human evidence is limited to assessments of total DNA methylation. We assessed associations between first trimester PFAS exposures with newborn DNA methylation, including 5-methylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC). DNA methylation mediation of associations between PFAS and birth outcomes were explored in the Michigan Mother Infant Pairs cohort. Nine PFAS were measured in maternal first trimester blood. Seven were highly detected and included for analysis: PFHxS, PFOA, PFOS, PFNA, PFDA, PFUnDA, and MeFOSAA. Bisulfite-converted cord blood DNA (n = 141) and oxidative-bisulfite-converted cord blood (n = 70) were assayed on Illumina MethylationEPIC BeadChips to measure total DNA methylation (5-mC + 5-hmC) and 5-mC/5-hmC. Correcting for multiple comparisons, beta regressions were used to assess associations between levels of PFAS and total methylation, 5-mC, or 5-hmC. Nonlinear mediation analyses were used to assess the epigenetic meditation effect between PFAS and birth outcomes.<h4>Results</h4>PFAS was significantly associated with total methylation (q < 0.05: PFHxS-12 sites; PFOS-19 sites; PFOA-2 sites; PFNA-3 sites; PFDA-4 sites). In 72 female infants and 69 male infants, there were sex-specific associations between five PFAS and DNA methylation. 5-mC and 5-hmC were each significantly associated with thousands of sites for PFHxS, PFOS, PFNA, PFDA, PFUnDA, and MeFOSAA (q < 0.05). Clusters of 5-mC and 5-hmC sites were significant mediators between PFNA and PFUnDA and decreased gestational age (q < 0.05).<h4>Conclusions</h4>This study demonstrates the mediation role of specific types of DNA methylation on the relationship between PFAS exposure and birth outcomes. These results suggest that 5-mC and 5-hmC may be more sensitive to the developmental impacts of PFAS than total DNA methylation.
Also flagged:CRISPRnucleaseCasCRISPRaCRISPR-Casoligonucleotides
Journal Article2023-03-24No SnippetsBendixen L, Jensen TI, Bak RO.
Show Full Abstract
The CRISPR-Cas system is commonly known for its ability to cleave DNA in a programmable manner, which has democratized gene editing and facilitated recent breakthroughs in gene therapy. However, newer iterations of the technology using nuclease-disabled Cas enzymes have spurred a variety of different types of genetic engineering platforms such as transcriptional modulation using the CRISPR activation (CRISPRa) and CRISPR interference (CRISPRi) systems. This review introduces the creation of these programmable transcriptional modulators, various methods of delivery utilized for these systems, and recent technological developments. CRISPRa and CRISPRi have also been implemented in genetic screens for interrogating gene function and discovering genes involved in various biological pathways. We describe recent compelling examples of how these tools have become powerful means to unravel genetic networks and uncovering important information about devastating diseases. Finally, we provide an overview of preclinical studies in which transcriptional modulation has been used therapeutically, and we discuss potential future directions of these novel modalities.
Also flagged:transcription factor nuclear factor erythroid-2NF-E2)-related factor 2Nrf2NFE2L2ironmetabolism
Journal Article2023-03-24✓ 1 SnippetShakya A, McKee NW, Dodson M, Chapman E, Zhang DD.
In-Text Gene Mentions
S I O 001029)
…A host of well-established Nrf2 target genes, including SLC7A11, FTH1/FTL, SLC48A1, GPX4, PRDX6, MT1G, and HMOX1, have all been shown to be critical for cancer cell growth and conferring resistance to ferroptosis (Chorley et al., 2012; Chowdhury et al., 2009; Fan et al., 2017; Hassannia et al., 2019; Hirotsu et al., 2012; Houessinon et al., 2016; Na and Surh, 2014; Sun et al., 2016).…
Show Full Abstract
The transcription factor Nrf2 was originally identified as a master regulator of redox homeostasis, as it governs the expression of a battery of genes involved in mitigating oxidative and electrophilic stress. However, the central role of Nrf2 in dictating multiple facets of the cellular stress response has defined the Nrf2 pathway as a general mediator of cell survival. Recent studies have indicated that Nrf2 regulates the expression of genes controlling ferroptosis, an ironand lipid peroxidation-dependent form of cell death. While Nrf2 was initially thought to have anti-ferroptotic function primarily through regulation of the antioxidant response, accumulating evidence has indicated that Nrf2 also exerts anti-ferroptotic effects via regulation of key aspects of iron and lipid metabolism. In this review, we will explore the emerging role of Nrf2 in mediating iron homeostasis and lipid peroxidation, where several Nrf2 target genes have been identified that encode critical proteins involved in these pathways. A better understanding of the mechanistic relationship between Nrf2 and ferroptosis, including how genetic and/or pharmacological manipulation of Nrf2 affect the ferroptotic response, should facilitate the development of new therapies that can be used to treat ferroptosis-associated diseases.
Also flagged:CalciumMitochondrialchronic degenerative joint diseasemitochondriamembraneion channels
Journal Article2023-03-24No SnippetsLei X, Tan G, Wang Y, Chen L, Cao Y, Si B, Zhen Z, Li B, Jin Y, Wang W, Jin F.
Show Full Abstract
<h4>Introduction</h4>Osteoarthritis (OA) is a chronic degenerative joint disease accompanied by an elevated macrophage proinflammatory phenotype, which is triggered by persistent pathologically elevated calcium ion levels in mitochondria. However, existing pharmacological compounds targeting the inhibition of mitochondrial calcium ion (m[Ca<sup>2+</sup>]) influx are currently limited in terms of plasma membrane permeability and low specificity for ion channels and transporters. In the present study, we synthesized mesoporous silica nanoparticle-amidated (MSN)-ethylenebis (oxyethylenenitrilo)tetraacetic acid (EGTA)/triphenylphosphine (TPP)-polyethylene glycol (PEG) [METP] nanoparticles (NPs), which specifically target mitochondria and block excess calcium ion influx.<h4>Methods</h4>m[Ca<sup>2+</sup>] overload in OA mouse bone marrow-derived macrophages (BMDMs) was detected by a fluorescence probe. A tissue in situ fluorescence colocalization assay was used to evaluate METP NP uptake by macrophages. BMDMs from healthy mice were pretreated with a concentration gradient of METP NPs followed by lipopolysaccharide (LPS) stimulation and detection of m[Ca<sup>2+</sup>] levels in vitro. The optimal METP NP concentration was further applied, and the endoplasmic reticulum (ER) and cytoplasm calcium levels were detected. The inflammatory phenotype was measured by surface markers, cytokine secretion and intracellular inflammatory gene/protein expression. A Seahorse cell energy metabolism assay was performed to elucidate the mechanism by which METP NPs reverse the BMDM proinflammatory phenotype.<h4>Results</h4>The present study identified calcium overload in BMDM mitochondria of OA mice. We demonstrated that METP NPs reversed the increased m[Ca<sup>2+</sup>] levels in mitochondria and the proinflammatory phenotype of BMDMs, with both in vivo and in vitro experiments, via the inhibition of the mitochondrial aspartate-arginosuccinate shunt and ROS production.<h4>Conclusion</h4>We demonstrated that METP NPs are effective and highly specific regulators of m[Ca<sup>2+</sup>] overload. In addition, we demonstrated that these METP NPs reverse the macrophage proinflammatory phenotype by restoring m[Ca<sup>2+</sup>] homeostasis, thereby inhibiting the tissue inflammatory response and achieving a therapeutic effect for OA.
Also flagged:flavonoidscarotenoidsDiabetes mellituschronic metabolic disorderinsulinsecretion
Journal Article2023-03-24✓ 1 SnippetJin Y, Arroo R.
In-Text Gene Mentions
Discussion)
…The current preclinical and clinical evidence largely supports the therapeutic roles of the two natural compound groups (flavonoids and carotenoids) in preventing the advancement of diabetic conditions and the onset and progression of diabetic complications, mainly DCC, DN, and DR.…
Show Full Abstract
Diabetes mellitus is a chronic metabolic disorder caused either by inadequate insulin secretion, impaired insulin function, or both. Uncontrolled diabetes is characterized by hyperglycemia which over time leads to fatal damage to both macro-and microvascular systems, causing complications such as cardiovascular diseases, retinopathy and nephropathy. Diabetes management is conventionally delivered through modifications of diet and lifestyle and pharmacological treatment, using antidiabetic drugs, and ultimately insulin injections. However, the side effects and financial cost of medications often reduce patient compliance to treatment, negatively affecting their health outcomes. Natural phytochemicals from edible plants such as fruits and vegetables (F&V) and medicinal herbs have drawn a growing interest as potential therapeutic agents for treating diabetes and preventing the onset and progression of diabetic complications. Flavonoids, the most abundant polyphenols in the human diet, have shown antidiabetic effects in numerous <i>in vitro</i> and preclinical studies. The underlying mechanisms have been linked to their antioxidant, anti-inflammatory and immunomodulatory activities. Carotenoids, another major group of dietary phytochemicals, have also shown antidiabetic potential in recent <i>in vitro</i> and <i>in vivo</i> experimental models, possibly through a mechanism of action similar to that of flavonoids. However, scientific evidence on the efficacy of these phytochemicals in treating diabetes or preventing the onset and progression of its complications in clinical settings is scarce, which delays the translation of animal study evidence to human applications and also limits the knowledge on their modes of actions in diabetes management. This review is aimed to highlight the potential roles of flavonoids and carotenoids in preventing or ameliorating diabetes-related complications based on <i>in vivo</i> study evidence, i.e., an array of preclinical animal studies and human intervention trials. The current general consensus of the underlying mechanisms of action exerted by both groups of phytochemicals is that their anti-inflammatory action is key. However, other potential mechanisms of action are considered. In total, 50 <i>in vivo</i> studies were selected for a review after a comprehensive database search <i>via</i> PubMed and ScienceDirect from January 2002 to August 2022. The key words used for analysis are type-2 diabetes (T2DM), diabetic complications, flavonoids, carotenoids, antioxidant, anti-inflammatory, mechanisms of prevention and amelioration, animal studies and human interventions.
Also flagged:axonalMajor depressive disorderdepressionbehavioralbrainsynapse
Journal Article2023-03-24✓ 5 SnippetsMahmud A, Avramescu RG, Niu Z, Flores C.
In-Text Gene Mentions
S I O 001029)
…For a detailed description of the role of Netrin-1 and DCC receptors in stress-induced behavioral alterations in rodents and in MDD see Torres-Berrío et al. (2020a,b) and Vosberg et al. (2020).…
S I O 001029)
…From top to bottom, Netrin consists of a laminin-like domain, 3 epidermal growth factor (EGF) domains, and a Netrin-like domain; DCC consists of 4 Ig (immunoglobulin) domains, 6 fibronectin III-like (FN) domains, a transmembrane region and 3 P-motifs; Robo consists of 5 Ig domains, 3 FN domains, a membrane spanning region and 4 proline-rich regions; Slit consists of 4 leucine-rich repeats, 6 EGF-like domains, a laminin G-like module, 3 EGF-like domains and a cysteine knot; Semaphorin consists of a Sema domain, a PSI (plexin, semaphorin, and integrin) domain and an Ig domain; Neuropilin consists of 2 Sema binding domains, 2 VEGF (vascular endothelial growth factors) binding subdomains, a MAM (meprin, A-5 protein, and receptor protein-tyrosine phosphatase mu) domain, a transmembrane domain and a PDZ [post synaptic density protein (PSD95), drosophila disc large tumor suppressor (Dlg1), and zonula occludens-1 protein (zo-1)] domain; Plexin consist of a Sema domain, 3 PSI domains, 3 IPT (Ig-like, plexins, transcription factors) domains, a transmembrane region, a GAP (GTPase-accelerating proteins) domain, an RBD (Rho-GTPase binding domain) sequence and a GAP domain; the Ephrin receptor A/B consists of an ephrin binding, and EGF-like domain, two FN domains, a membrane spanning region, a kinase domain, a SAM (Sterile alpha motif) domain and a PDZ-binding domain; Ephrin consists of a membrane spanning region and a receptor binding region; Ephexin consists of a DH (Dbl homology) domain, a PH (Pleckstrin homology) domain and a SH3 (SRC Homology 3) domain; laminin consists of 3 laminin domains in the alpha chain, and 2 laminin domains in both the beta and the gamma chains, a coiled coil and 5 laminin G domains; NCAM consists of 5 IgG-like domains and two FN domains; Laminin receptor consists of single-chain variable fragment (scFv) Ig antibody binding domain, a heparin/laminin binding domain, a laminin/PrP binding domain, a transmembrane domain, and a N-terminal domain.…
S I O 001029)
…Taken together, these findings suggest that alterations in the Netrin-1/DCC guidance cue system in the PFC predispose rodents to stress-induced susceptibility and depression-like behaviors, while also being associated with MDD in humans.…
S I O 001029)
…A large and increasing number of studies show a tight link between genetic variation in the Netrin-1/DCC system and MDD.…
S I O 001029)
…Altered expression of DCC in the PFC appears to be a persistent trait in MDD, supported by two independent post-mortem brain studies which show increased Dcc mRNA levels in the PFC of adult patients who died by suicide compared to non-psychiatric control subjects (Manitt et al., 2013; Torres-Berrío et al., 2017).…
Show Full Abstract
Major depressive disorder (MDD) is a chronic and disabling disorder affecting roughly 280 million people worldwide. While multiple brain areas have been implicated, dysfunction of prefrontal cortex (PFC) circuitry has been consistently documented in MDD, as well as in animal models for stress-induced depression-like behavioral states. During brain development, axonal guidance cues organize neuronal wiring by directing axonal pathfinding and arborization, dendritic growth, and synapse formation. Guidance cue systems continue to be expressed in the adult brain and are emerging as important mediators of synaptic plasticity and fine-tuning of mature neural networks. Dysregulation or interference of guidance cues has been linked to depression-like behavioral abnormalities in rodents and MDD in humans. In this review, we focus on the emerging role of guidance cues in stress-induced changes in adult prefrontal cortex circuitry and in precipitating depression-like behaviors. We discuss how modulating axonal guidance cue systems could be a novel approach for precision medicine and the treatment of depression.
Also flagged:idiopathic pulmonary fibrosiscellular senescencelung diseaseSenescence-relatedgene expressioninfection
Journal Article2023-03-24✓ 2 SnippetsYang C, Han Z, Zhan W, Wang Y, Feng J.
In-Text Gene Mentions
Results)
…The results indicated that genes such as SPINT2, PEBP1, and KL were associated with a protective effect against death, whereas genes such as HMGA1, ITGB4, and FGFR2 were risk factors of death in IPF.…
Results)
…such as SPINT2,PEBP1, and KL were…
Show Full Abstract
<b>Background:</b> Idiopathic pulmonary fibrosis (IPF), a chronic, progressive lung disease characterized by interstitial remodeling and tissue destruction, affects people worldwide and places a great burden on society. Cellular senescence is thought to be involved in the mechanisms and development of IPF. The aim of this study was to predictively investigate subtypes of IPF according to cellular senescence-related genes and their correlation with the outcome of patients with IPF, providing possible treatment and management options for disease control. <b>Methods:</b> Gene expression profiles and follow-up data were obtained from the GEO database. Senescence-related genes were obtained from the CSGene database and analyzed their correlation with the outcome of IPF. A consensus cluster was constructed to classify the samples based on correlated genes. The GSVA and WGCNA packages in R were used to calculate the immune-related enriched fractions and construct gene expression modules, respectively. Metascape and the clusterProfiler package in R were used to enrich gene functions. The ConnectivityMap was used to probe suitable drugs for potential treatment. <b>Results:</b> A total of 99 cellular senescence-related genes were associated with IPF prognosis. Patients with IPF were divided into two subtypes with significant prognostic differences. Subtype S2 was characterized by enhanced fibrotic progression and infection, leading to acute exacerbation of IPF and poor prognosis. Finally, five cellular senescence-related genes, TYMS, HJURP, UBE2C, BIRC5, and KIF2C, were identified as potential biomarkers in poor prognostic patients with IPF. <b>Conclusion:</b> The study findings indicate that cellular senescence-related genes can be used to distinguish the prognosis of patients with IPF. Among them, five genes can be used as candidate biomarkers to predict patients with a poor prognostic subtype for which anti-fibrosis and anti-infection treatments could be suitable.
Also flagged:PhosphatidylserineCoagulationcancerphospholipidscoagulation factorstissue factor
Journal Article2023-03-24✓ 1 SnippetJing H, Wu X, Xiang M, Wang C, Novakovic VA, Shi J.
In-Text Gene Mentions
S I O 001029)
…The overexpression of CSE1L causes melanoma cells (B16F10) to generate MPs, and the knockdown of CSE1L reduces v-H-Ras-induced MP formation, matrix metalloproteinase 2 (MMP2) and MMP9 secretion as well as metastasis [50].…
Show Full Abstract
Tumor progression and cancer metastasis has been linked to the release of microparticles (MPs), which are shed upon cell activation or apoptosis and display parental cell antigens, phospholipids such as phosphatidylserine (PS), and nucleic acids on their external surfaces. In this review, we highlight the biogenesis of MPs as well as the pathophysiological processes of PS externalization and its involvement in coagulation activation. We review the available evidence, suggesting that coagulation factors (mainly tissue factor, thrombin, and fibrin) assist in multiple steps of tumor dissemination, including epithelial-mesenchymal transition, extracellular matrix remodeling, immune escape, and tumor angiogenesis to support the formation of the pre-metastatic niche. Platelets are not just bystander cells in circulation but are functional players in primary tumor growth and metastasis. Tumor-induced platelet aggregation protects circulating tumor cells (CTCs) from the blood flow shear forces and immune cell attack while also promoting the binding of CTCs to endothelial cells and extravasation, which activates tumor invasion and sustains metastasis. Finally, in terms of therapy, lactadherin can inhibit coagulation by competing effectively with coagulation factors for PS binding sites and may similarly delay tumor progression. Furthermore, we also investigate the therapeutic potential of coagulation factor inhibitors within the context of cancer treatment. The development of multiple therapies targeting platelet activation and platelet-tumor cell interactions may not only reduce the lethal consequences of thrombosis but also impede tumor growth and spread.
Journal Article2023-03-24✓ 1 SnippetDel Barrio M, Lavín L, Santos-Laso Á, Arias-Loste MT, Odriozola A, Rodriguez-Duque JC, Rivas C, Iruzubieta P, Crespo J.
In-Text Gene Mentions
I A O 0000615)
…antitrypsin deficiency orhemochromatosis.…
Show Full Abstract
Non-alcoholic fatty liver disease (NAFLD) is currently the most prevalent cause of chronic liver disease (CLD). Currently, the only therapeutic recommendation available is a lifestyle change. However, adherence to this approach is often difficult to guarantee. Alteration of the microbiota and an increase in intestinal permeability seem to be key in the development and progression of NAFLD. Therefore, the manipulation of microbiota seems to provide a promising therapeutic strategy. One way to do so is through faecal microbiota transplantation (FMT). Here, we summarize the key aspects of FMT, detail its current indications and highlight the most recent advances in NAFLD.
Also flagged:cell growthAgo1Ago2methylationAgingadriamycin
Journal Article2023-03-24✓ 2 SnippetsYang D, Xiao F, Yuan Y, Li J, Wang S, Fan X, Ni Q, Li Y, Zhang M, Gu X, Yan T, Yang M, He Z.
In-Text Gene Mentions
Results)
…, Fcgr1 ,H4C8, H2bc6 ,…
Results)
…, Nr1d1 ,H4C8, H2bc18 ,…
Show Full Abstract
tRNA-derived small RNAs (tsRNAs) are derived from tRNA and include tRNA halves (tiRNAs) and tRNA fragments (tRFs). tsRNAs have been implicated in a variety of important biological functions, such as cell growth, transcriptional regulation, and apoptosis. Emerging evidence has shown that Ago1-guided and Ago2-guided tsRNAs are expressed at 3 and 30 days in <i>Drosophila</i> and that tRF biogenesis in fruit flies affects tRNA processing and tRNA methylation. However, a wide analysis of tsRNA patterns in different ages of <i>Drosophila</i> have not been reported via the small RNA sequencing method. In the present study, tsRNAs of young (7 days) and old (42 days) <i>Drosophila</i> were sequenced and their expression characteristics were analysed. Then, a specific tRF (named <i>tRF-Trp-CCA-014</i>) was determined and was found to be conserved in fruit flies, mice, and humans. The expression patterns of <i>tRF-Trp-CCA-014</i> in different tissues and stages of fruit flies and mice, and mouse NIH/3T3 cells were detected. Furthermore, mouse embryonic fibroblast NIH/3T3 cells were used as a model to analyse the function and targets of <i>tRF-Trp-CCA-014</i>. The RNA-seq data of six groups (Mimics, Mimic NC, Inhibitors, Inhibitor NC, Aging (adriamycin), and Control (Normal)) in mouse NIH3T3 cells were analysed. The results showed that the number of tsRNAs at 42 days (417) was more than at 7 days (288); thus, it was enriched with age. tRFs-1 were the most enriched, followed by 5'-tRFs and 3'-tRFs. Twenty-one differentially expressed tsRNAs were identified between 7 days and 42 days. Then, the conserved tRF <i>tRF-Trp-CCA-014</i> was identified and found to accumulate in aged fruit flies and aged mouse NIH3T3 cells. RNA-seq data showed that most differentially expressed genes were involved in the immune system, cancer: overview, and signal translation. Furthermore, <i>tRF-Trp-CCA-014</i> was found to bind to the 3'UTR of <i>H3C4</i> in a dual-luciferase reporter gene assay. <i>tRF-Trp-CCA-014</i> and <i>H3C4</i> were detected in the cytoplasm of aged NIH3T3 cells by RNA in situ hybridization. These results suggest that the <i>H3C4</i> gene is the target of <i>tRF-Trp-CCA-014</i>. This study will advance the current understanding of tRF roles and their implication in <i>Drosophila</i> and mouse studies.
Also flagged:Sphingosine-1-phosphate lyaseSPLdegradationcell proliferationmitochondrialgene expression
Journal Article2023-03-24✓ 1 SnippetWieczorek I, Strosznajder RP.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease (HD) is an autosomal dominant inherited neurodegenerative disease caused by mutations in the huntingtin (Htt)-encoding gene (HTT).…
Show Full Abstract
Sphingosine-1-phosphate lyase (SPL) is a pyridoxal 5'-phosphate-dependent enzyme involved in the irreversible degradation of sphingosine-1-phosphate (S1P)-a bioactive sphingolipid that modulates a broad range of biological processes (cell proliferation, migration, differentiation and survival; mitochondrial functioning; and gene expression). Although SPL activity leads to a decrease in the available pool of S1P in the cell, at the same time, hexadecenal and phosphoethanolamine, compounds with potential biological activity, are generated. The increased expression and/or activity of SPL, and hence the imbalance between S1P and the end products of its cleavage, were demonstrated in several pathological states. On the other hand, loss-of-function mutations in the SPL encoding gene are a cause of severe developmental impairments. Recently, special attention has been paid to neurodegenerative diseases as the most common pathologies of the nervous system. This review summarizes the current findings concerning the role of SPL in the nervous system with an emphasis on neurodegeneration. Moreover, it briefly discusses pharmacological compounds directed to inhibit its activity.
…OLFM4 can be released by neutrophils, and the serum level of OLFM4 is increased in sepsis patients, especially patients with severe disease [303].…
S I O 001029)
…A recent study described the increased mortality of sepsis patients with high levels of circulating OLFM4+ neutrophils and the same was true for non-septic patients with infections and Systemic Inflammatory Response Syndrome (SIRS).…
S I O 001029)
…The percentage of OLFM4-expressing neutrophils in healthy individuals varies between 8 and 57% (Table 4), and the levels of positive cells increase in sepsis.…
S I O 001029)
…Indeed, decreased neutrophil CXCR2 expression in sepsis correlates with the Apache II severity score [219] and there is an association between high levels of circulating OLFM4+ neutrophils and mortality [301].…
S I O 001029)
…In total, 56% of sepsis patients with elevated OLFM4+ neutrophils died compared to 18% of patients with OLFM4+ neutrophils below 37.6% [301].…
Show Full Abstract
Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection. Common causes include gram-negative and gram-positive bacteria as well as fungi. Neutrophils are among the first cells to arrive at an infection site where they function as important effector cells of the innate immune system and as regulators of the host immune response. The regulation of neutrophil migration is therefore important both for the infection-directed host response and for the development of organ dysfunctions in sepsis. Downregulation of CXCR4/CXCL12 stimulates neutrophil migration from the bone marrow. This is followed by transmigration/extravasation across the endothelial cell barrier at the infection site; this process is directed by adhesion molecules and various chemotactic gradients created by chemotactic cytokines, lipid mediators, bacterial peptides, and peptides from damaged cells. These mechanisms of neutrophil migration are modulated by sepsis, leading to reduced neutrophil migration and even reversed migration that contributes to distant organ failure. The sepsis-induced modulation seems to differ between neutrophil subsets. Furthermore, sepsis patients should be regarded as heterogeneous because neutrophil migration will possibly be further modulated by the infecting microorganisms, antimicrobial treatment, patient age/frailty/sex, other diseases (e.g., hematological malignancies and stem cell transplantation), and the metabolic status. The present review describes molecular mechanisms involved in the regulation of neutrophil migration; how these mechanisms are altered during sepsis; and how bacteria/fungi, antimicrobial treatment, and aging/frailty/comorbidity influence the regulation of neutrophil migration.
Testicular germ cell tumours (TGCTs) are the most common malignancy in young men. Originating from foetal testicular germ cells that fail to differentiate correctly, TGCTs appear after puberty as germ cell neoplasia in situ cells that transform through unknown mechanisms into distinct seminoma and non-seminoma tumour types. A balance between activin and BMP signalling may influence TGCT emergence and progression, and we investigated this using human cell line models of seminoma (TCam-2) and non-seminoma (NT2/D1). Activin A- and BMP4-regulated transcripts measured at 6 h post-treatment by RNA-sequencing revealed fewer altered transcripts in TCam-2 cells but a greater responsiveness to activin A, while BMP4 altered more transcripts in NT2/D1 cells. Activin significantly elevated transcripts linked to pluripotency, cancer, TGF-β, Notch, p53, and Hippo signalling in both lines, whereas BMP4 altered TGF-β, pluripotency, Hippo and Wnt signalling components. Dose-dependent antagonism of BMP4 signalling by activin A in TCam-2 cells demonstrated signalling crosstalk between these two TGF-β superfamily arms. Levels of the nuclear transport protein, IPO5, implicated in BMP4 and WNT signalling, are highly regulated in the foetal mouse germline. <i>IPO5</i> knockdown in TCam-2 cells using siRNA blunted BMP4-induced transcript changes, indicating that IPO5 levels could determine TGF-β signalling pathway outcomes in TGCTs.
Also flagged:Calcium Phosphateargoncalciumphosphorusoxygenapatite
Journal Article2023-03-24No SnippetsMarchenko ES, Baigonakova GA, Dubovikov KM, Kokorev OV, Gordienko II, Chudinova EA.
Show Full Abstract
Coatings based on calcium phosphate with thicknesses of 0.5 and 2 μm were obtained by high-frequency magnetron sputtering on NiTi substrates in an argon atmosphere. The coating was characterized using X-ray diffraction, scanning electron microscopy, atomic force microscopy, and in vitro cytocompatibility and bioactivity studies. A biphasic coating of tricalcium phosphate (Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>) and hydroxyapatite (Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) with a 100% degree of crystallinity was formed on the surface. The layer enriched in calcium, phosphorus, and oxygen was observed using scanning electron microscopy and energy-dispersive X-ray spectroscopy. Scanning electron microscopy showed that the surface structure is homogeneous without visible defects. The 2 µm thick coating obtained by sputtering with a deposition time of 4 h and a deposition rate of 0.43 µm/h is uniform, contains the highest amount of the calcium phosphate phase, and is most suitable for the faster growth of cells and accelerated formation of apatite layers. Samples with calcium phosphate coatings do not cause hemolysis and have a low cytotoxicity index. The results of immersion in a solution simulating body fluid show that NiTi with the biphasic coating promotes apatite growth, which is beneficial for biological activity.
Also flagged:membranepathogenesisneurodegenerative diseasessynapseorganellesorganelle
Journal Article2023-03-24✓ 1 SnippetNam J, Gwon Y.
In-Text Gene Mentions
S I O 001029)
…Protein products of the first exon of HTT separate into liquid droplets when the number of glutamine repeats is less than those in HD patients (Peskett et al., 2018).…
Show Full Abstract
Biomolecular condensates are subcellular organizations where functionally related proteins and nucleic acids are assembled through liquid-liquid phase separation, allowing them to develop on a larger scale without a membrane. However, biomolecular condensates are highly vulnerable to disruptions from genetic risks and various factors inside and outside the cell and are strongly implicated in the pathogenesis of many neurodegenerative diseases. In addition to the classical view of the nucleation-polymerization process that triggers the protein aggregation from the misfolded seed, the pathologic transition of biomolecular condensates can also promote the aggregation of proteins found in the deposits of neurodegenerative diseases. Furthermore, it has been suggested that several protein or protein-RNA complexes located in the synapse and along the neuronal process are neuron-specific condensates displaying liquid-like properties. As their compositional and functional modifications play a crucial role in the context of neurodegeneration, further research is needed to fully understand the role of neuronal biomolecular condensates. In this article, we will discuss recent findings that explore the pivotal role of biomolecular condensates in the development of neuronal defects and neurodegeneration.
Also flagged:PeptidesIon Channelsmembraneschannelopathieshormonesecretion
Journal Article2023-03-24No SnippetsMendes LC, Viana GMM, Nencioni ALA, Pimenta DC, Beraldo-Neto E.
Show Full Abstract
The Buthidae family of scorpions consists of arthropods with significant medical relevance, as their venom contains a diverse range of biomolecules, including neurotoxins that selectively target ion channels in cell membranes. These ion channels play a crucial role in regulating physiological processes, and any disturbance in their activity can result in channelopathies, which can lead to various diseases such as autoimmune, cardiovascular, immunological, neurological, and neoplastic conditions. Given the importance of ion channels, scorpion peptides represent a valuable resource for developing drugs with targeted specificity for these channels. This review provides a comprehensive overview of the structure and classification of ion channels, the action of scorpion toxins on these channels, and potential avenues for future research. Overall, this review highlights the significance of scorpion venom as a promising source for discovering novel drugs with therapeutic potential for treating channelopathies.
Also flagged:Ischemiaoxygenacute ischemic strokesuperoxidesynaptic transmissionHsp90
Journal Article2023-03-24✓ 2 SnippetsPuzio M, Moreton N, Sullivan M, Scaife C, Glennon JC, O'Connor JJ.
In-Text Gene Mentions
Results)
…A volcano plot of differentially expressed targets following MnTMPyP treatment of CA1 regions after oxygen and glucose deprivation highlights the dramatic upregulation of Neuronal Growth regulator 1 (Negr1) in treated samples, necessary for regenerative axon sprouting (Figure 8A).…
Results)
…regulator 1 (Negr1) in treated…
Show Full Abstract
Metabolic stress and the increased production of reactive oxygen species (ROS) are two main contributors to neuronal damage and synaptic plasticity in acute ischemic stroke. The superoxide scavenger MnTMPyP has been previously reported to have a neuroprotective effect in organotypic hippocampal slices and to modulate synaptic transmission after in vitro hypoxia and oxygen-glucose deprivation (OGD). However, the mechanisms involved in the effect of this scavenger remain elusive. In this study, two concentrations of MnTMPyP were evaluated on synaptic transmission during ischemia and post-ischemic synaptic potentiation. The complex molecular changes supporting cellular adaptation to metabolic stress, and how these are modulated by MnTMPyP, were also investigated. Electrophysiological data showed that MnTMPyP causes a decrease in baseline synaptic transmission and impairment of synaptic potentiation. Proteomic analysis performed on MnTMPyP and hypoxia-treated tissue indicated an impairment in vesicular trafficking mechanisms, including reduced expression of Hsp90 and actin signalling. Alterations of vesicular trafficking may lead to reduced probability of neurotransmitter release and AMPA receptor activity, resulting in the observed modulatory effect of MnTMPyP. In OGD, protein enrichment analysis highlighted impairments in cell proliferation and differentiation, such as TGFβ1 and CDKN1B signalling, in addition to downregulation of mitochondrial dysfunction and an increased expression of CAMKII. Taken together, our results may indicate modulation of neuronal sensitivity to the ischemic insult, and a complex role for MnTMPyP in synaptic transmission and plasticity, potentially providing molecular insights into the mechanisms mediating the effects of MnTMPyP during ischemia.
Also flagged:sleeptarcicidal hormoneobsessive-compulsive disorderinfertilitysleep disordersanxiety
Journal Article2023-03-24No SnippetsMikulska P, Malinowska M, Ignacyk M, Szustowski P, Nowak J, Pesta K, Szeląg M, Szklanny D, Judasz E, Kaczmarek G, Ejiohuo OP, Paczkowska-Walendowska M, Gościniak A, Cielecka-Piontek J.
Show Full Abstract
In recent years, there has been a significant surge in reports on the health-promoting benefits of winter cherry <i>(Withania somnifera),</i> also known as Ashwagandha. Its current research covers many aspects of human health, including neuroprotective, sedative and adaptogenic effects and effects on sleep. There are also reports of anti-inflammatory, antimicrobial, cardioprotective and anti-diabetic properties. Furthermore, there are reports of reproductive outcomes and tarcicidal hormone action. This growing body of research on Ashwagandha highlights its potential as a valuable natural remedy for many health concerns. This narrative review delves into the most recent findings and provides a comprehensive overview of the current understanding of ashwagandha's potential uses and any known safety concerns and contraindications.
Also flagged:agingneurological disordersdementiagene expressionpolysomeribonucleoproteins
Journal Article2023-03-24✓ 1 SnippetWinsky-Sommerer R, King HA, Iadevaia V, Möller-Levet C, Gerber AP.
In-Text Gene Mentions
Results)
…( Prdx1 ,Prdx6), which are…
Show Full Abstract
Aging is associated with substantial physiological changes and constitutes a major risk factor for neurological disorders including dementia. Alterations in gene expression upon aging have been extensively studied; however, an in-depth characterization of post-transcriptional regulatory events remains elusive. Here, we profiled the age-related changes of the transcriptome and translatome in the female mouse hippocampus by RNA sequencing of total RNA and polysome preparations at four ages (3-, 6-, 12-, 20-month-old); and we implemented a variety of bioinformatics approaches to unravel alterations in transcript abundance, alternative splicing, and polyadenylation site selection. We observed mostly well-coordinated transcriptome and translatome expression signatures across age including upregulation of transcripts related to immune system processes and neuroinflammation, though transcripts encoding ribonucleoproteins or associated with mitochondrial functions, calcium signaling and the cell-cycle displayed substantial discordant profiles, suggesting translational control associated with age-related deficits in hippocampal-dependent behavior. By contrast, alternative splicing was less preserved, increased with age and was associated with distinct functionally-related transcripts encoding proteins acting at synapses/dendrites, RNA-binding proteins; thereby predicting regulatory roles for RBM3 and CIRBP. Only minor changes in polyadenylation site selection were identified, indicating pivotal 3'-end selection in young adults compared to older groups. Overall, our study provides a comprehensive resource of age-associated post-transcriptional regulatory events in the mouse hippocampus, enabling further examination of the molecular features underlying age-associated neurological diseases.
Also flagged:transcription factorsgene expressionbindingcancerorganellesOCT4
Journal Article2023-03-24✓ 2 SnippetsFeng C, Song C, Jiang Y, Zhao J, Zhang J, Wang Y, Yin M, Zhu J, Ai B, Wang Q, Qian F, Zhang Y, Shang D, Liu J, Li C.
In-Text Gene Mentions
Results)
…Numerous core TFs of the tissue-specific CRC network, such as ASCL2, SOX6, TBX5, FOXP2, and SOX17, were identified as candidate regulators in tumor immunotherapy, which can interfere with tumor cell growth by regulating the activity of immune cells.…
Results)
…as ASCL2 ,SOX6, TBX5 ,…
Show Full Abstract
A core transcription regulatory circuitry (CRC) is an interconnected self-regulatory circuitry that is formed by a group of core transcription factors (TFs). These core TFs collectively regulate gene expression by binding not only to their own super enhancers (SEs) but also to the SEs of one another. For most human tissue/cell types, a global view of CRCs and core TFs has not been generated. Here, we identified numerous CRCs using two identification methods and detailed the landscape of the CRCs driven by SEs in large cell/tissue samples. The comprehensive biological analyses, including sequence conservation, CRC activity and genome binding affinity were conducted for common TFs, moderate TFs, and specific TFs, which exhibit different biological features. The local module located from the common CRC network highlighted the essential functions and prognostic performance. The tissue-specific CRC network was highly related to cell identity. Core TFs in tissue-specific CRC networks exhibited disease markers, and had regulatory potential for cancer immunotherapy. Moreover, a user-friendly resource named CRCdb (http://www.licpathway.net/crcdb/index.html) was developed, which contained the detailed information of CRCs and core TFs used in this study, as well as other interesting results, such as the most representative CRC, frequency of TFs, and indegree/outdegree of TFs.
Also flagged:Acute Lymphoblastic LeukemiaALLheart failureinfiltrative cardiomyopathyCardiac Failurehematologic neoplasms
Journal Article2023-03-24✓ 1 SnippetAbdelghani MS, Altermanini M, El-Hassan M, Allam AG, Patel A.
In-Text Gene Mentions
Discussion)
…cardiac amyloidosis andhemochromatosiswere considered in…
Show Full Abstract
We report the case of acute lymphoblastic leukemia (ALL) in a 29-year-old male with no past medical history who presented with symptoms and signs of heart failure due to possible infiltrative cardiomyopathy as suggested by echocardiography. Workup including different imaging modalities confirmed the diagnosis of ALL. The patient completed his treatment course with a resolution of heart failure symptoms and normalization of cardiac function which was confirmed by different imaging modalities.
Hepatocellular carcinoma (HCC) is the third leading cause of cancer death worldwide. Ginsenoside Rk3, an important and rare saponin in heat-treated ginseng, is generated from Rg1 and has a smaller molecular weight. However, the anti-HCC efficacy and mechanisms of ginsenoside Rk3 have not yet been characterized. Here, we investigated the mechanism by which ginsenoside Rk3, a tetracyclic triterpenoid rare ginsenoside, inhibits the growth of HCC. We first explored the possible potential targets of Rk3 through network pharmacology. Both in vitro (HepG2 and HCC-LM3 cells) and in vivo (primary liver cancer mice and HCC-LM3 subcutaneous tumor-bearing mice) studies revealed that Rk3 significantly inhibits the proliferation of HCC. Meanwhile, Rk3 blocked the cell cycle in HCC at the G1 phase and induced autophagy and apoptosis in HCC. Further proteomics and siRNA experiments showed that Rk3 regulates the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) pathway to inhibit HCC growth, which was validated by molecular docking and surface plasmon resonance. In conclusion, we report the discovery that ginsenoside Rk3 binds to PI3K/AKT and promotes autophagy and apoptosis in HCC. Our data strongly support the translation of ginsenoside Rk3 into novel PI3K/AKT-targeting therapeutics for HCC treatment with low toxic side effects.
Also flagged:calciumPD-L1membranevesiclesTumorcancer
Journal Article2023-03-24✓ 1 SnippetAlam MR, Rahman MM, Li Z.
In-Text Gene Mentions
S I O 001029)
…Voltage-gated calcium ion trans-membrane channel subunits CACNA1E and CACNA1A are highly connected with tumor immunity and immune checkpoint expression regulation during tumorigenesis.135…
Show Full Abstract
Exosomes are small membrane vesicles containing microRNA, RNA, DNA fragments, and proteins that are transferred from donor cells to recipient cells. Tumor cells release exosomes to reprogram the factors associated with the tumor microenvironment (TME) causing tumor metastasis and immune escape. Emerging evidence revealed that cancer cell-derived exosomes carry immune inhibitory molecule program death ligand 1 (PD-L1) that binds with receptor program death protein 1 (PD-1) and promote tumor progression by escaping immune response. Currently, some FDA-approved monoclonal antibodies are clinically used for cancer treatment by blocking PD-1/PD-L1 interaction. Despite notable treatment outcomes, some patients show poor drug response. Exosomal PD-L1 plays a vital role in lowering the treatment response, showing resistance to PD-1/PD-L1 blockage therapy through recapitulating the effect of cell surface PD-L1. To enhance therapeutic response, inhibition of exosomal PD-L1 is required. Calcium signaling is the central regulator of tumorigenesis and can regulate exosome biogenesis and secretion by modulating Rab GTPase family and membrane fusion factors. Immune checkpoints are also connected with calcium signaling and calcium channel blockers like amlodipine, nifedipine, lercanidipine, diltiazem, and verapamil were also reported to suppress cellular PD-L1 expression. Therefore, to enhance the PD-1/PD-L1 blockage therapy response, the reduction of exosomal PD-L1 secretion from cancer cells is in our therapeutic consideration. In this review, we proposed a therapeutic strategy by targeting calcium signaling to inhibit the expression of PD-L1-containing exosome levels that could reduce the anti-PD-1/PD-L1 therapy resistance and increase the patient's drug response rate.
Research Square2023-03-24Preprint (No Snippets API)Kim RJ, Khan MA, Khan M, Chang SL.
Show Full Abstract
Coronavirus disease-2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection. SARS-CoV-2 virus is internalized by surface receptors, e.g., angiotensin-converting enzyme-2 (ACE2). Clinical reports suggest that non-insulin dependent diabetes mellitus (DM-II) may enhance COVID-19. This study investigated how DM-II augments COVID-19 complications through molecular interactions with cytokines/chemokines, using QIAGEN Ingenuity Pathway Analysis (IPA) and CLC Genomics Workbench 22 (CLCG-22). RNA-sequencing of islet β-cell genomes through CLCG-22 (SRA SRP287500) were analyzed to identify differential expression of islet β-cell genes (Iβ-CG). IPA’s QIAGEN Knowledge Base (QKB) was also used to retrieve 88 total molecules shared between DM-II and SARS-CoV-2 infection to characterize and identify Iβ-CG, due to close association with DM-II. Molecules directly associated with ACE2 and cytokines/chemokines were also identified for their association with SARS-CoV-2 infection. Using IPA, 3 Iβ-CG in common with both diseases, SCL2A2, PPARγ, and CPLX8, were downregulated by DM-II. Their downregulation occurred due to increased activity of cytokines/chemokines and ACE2. Collectively, this network meta-analysis demonstrated that interaction of SARS-CoV-2 with ACE2 could primarily induce endothelial cell dysfunction. Identification of common molecules and signaling pathways between DM-II and SARS-CoV-2 infection in this study may lead to further discovery of therapeutic measures to simultaneously combat both diseases.
Also flagged:glucocorticoidasthmaglucocorticoidseosinophilic asthmaCytokinesIL-1β
Journal Article2023-03-23✓ 1 SnippetHe LX, Yang L, Liu T, Li YN, Huang TX, Zhang LL, Luo J, Liu CT.
In-Text Gene Mentions
Results)
…such as CSF2,TNFSF4, IL-22, CXCL8 and…
Show Full Abstract
<h4>Background</h4>Patients with neutrophil-mediated asthma have poor response to glucocorticoids. The roles and mechanisms of group 3 innate lymphoid cells (ILC3s) in inducing neutrophilic airway inflammation and glucocorticoid resistance in asthma have not been fully clarified.<h4>Methods</h4>ILC3s in peripheral blood were measured by flow cytometry in patients with eosinophilic asthma (EA) and non-eosinophilic asthma (NEA). ILC3s were sorted and cultured in vitro for RNA sequencing. Cytokines production and signaling pathways in ILC3s after IL-1β stimulation and dexamethasone treatment were determined by real-time PCR, flow cytometry, ELISA and western blot.<h4>Results</h4>The percentage and numbers of ILC3s in peripheral blood was higher in patients with NEA compared with EA, and negatively correlated with blood eosinophils. IL-1β stimulation significantly enhanced CXCL8 and CXCL1 production in ILC3s via activation of p65 NF-κB and p38/JNK MAPK signaling pathways. The expression of neutrophil chemoattractants from ILC3s was insensitive to dexamethasone treatment. Dexamethasone significantly increased phosphorylation of glucocorticoid receptor (GR) at Ser226 but only with a weak induction at Ser211 residues in ILC3s. Compared to human bronchial epithelial cell line (16HBE cells), the ratio of p-GR S226 to p-GR S211 (p-GR S226/S211) was significantly higher in ILC3s at baseline and after dexamethasone treatment. In addition, IL-1β could induce Ser226 phosphorylation and had a crosstalk effect to dexamethasone via NF-κB pathway.<h4>Conclusions</h4>ILC3s were elevated in patients with NEA, and associated with neutrophil inflammation by release of neutrophil chemoattractants and were glucocorticoid (GC) resistant. This paper provides a novel cellular and molecular mechanisms of neutrophil inflammation and GC-resistance in asthma. Trial registration The study has been prospectively registered in the World Health Organization International Clinical Trials Registry Platform (ChiCTR1900027125).
<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) has a multidirectional relationship with metabolic syndrome (MetS) and used to be considered a hepatic manifestation of MetS. Perirenal fat, as a part of visceral adipose tissue (VAT), was reported to be correlated with MetS components, but data for intraorgan fat are lacking. This study was undertaken to assess the value of peripheral and intraorgan fat to predict MetS in adults with overweight and obesity with suspected NAFLD.<h4>Methods</h4>We studied 134 sequential adults (mean age, 31.5 years; 47% female) with overweight and obesity with suspected NAFLD. All participants underwent abdominal magnetic resonance imaging (MRI) examination. Anthropometric and metabolic parameters and perirenal fat thickness (PRFT), subcutaneous adipose tissue thickness (SATT), liver fat fraction (LFF), pancreas fat fraction (PFF), and lumbar spine fat fraction (LSFF) were collected. MetS was defined according to the International Diabetes Federation (IDF) criteria. Statistical analyses included basic statistics, linear correlation and logistic regression analysis.<h4>Results</h4>A total of 63 adults with MetS and 71 adults with advanced liver steatosis (grades 2 and 3) were included in our study. Patients with MetS had greater PRFT (p = 0.026) and LFF (p < 0.001), as well as greater homeostasis model assessment of insulin resistance (HOMA-IR), alanine transaminase (ALT), aspartate transaminase (AST), and decreased SATT. MetS patients had a higher proportion of advanced steatosis than those without MetS (P < 0.001). The MetS score was associated with PRFT and LFF. Logistic regression analysis showed that the PRFT and LFF were independent predictors of MetS after adjusting for age and sex. A cutoff of 9.15 mm for PRFT and 14.68% for LFF could be predictive of MetS.<h4>Conclusions</h4>This study shows that the absolute cutoff level of 9.15 mm for PRFT and 14.68% for LFF may be clinically important markers for identifying patients who are at high risk of MetS among adults with overweight and obesity with suspected NAFLD, irrespective of sex and age. Moreover, ectopic fat levels in pancreas and lumbar spine are positively associated with PRFT.<h4>Trial registration</h4>Not applicable.
Also flagged:X-chromosomedosage compensationbindingdosage compensation complexMEXMEX II
Journal Article2023-03-23✓ 5 SnippetsYang Q, Lo TW, Brejc K, Schartner C, Ralston EJ, Lapidus DM, Meyer BJ.
In-Text Gene Mentions
Results)
…Mutating it to a guanine (C4G) severely reduced DCC binding in assays conducted in vivo and in vitro.…
Results)
…In principle, that single cytosine-to-guanine transversion could be a critical evolutionary change in MEX motifs that render the motifs incapable of binding the DCC from the other species.…
Abstract)
…dosage compensation complex (DCC) controlling X expression…
Abstract)
…rapid divergence ofDCCtarget specificity could…
Abstract)
…motifs within CbrDCCrecruitment sites that…
Show Full Abstract
An evolutionary perspective enhances our understanding of biological mechanisms. Comparison of sex determination and X-chromosome dosage compensation mechanisms between the closely related nematode species <i>Caenorhabditis briggsae</i> (<i>Cbr</i>) and <i>Caenorhabditis elegans</i> (<i>Cel</i>) revealed that the genetic regulatory hierarchy controlling both processes is conserved, but the X-chromosome target specificity and mode of binding for the specialized condensin dosage compensation complex (DCC) controlling X expression have diverged. We identified two motifs within <i>Cbr</i> DCC recruitment sites that are highly enriched on X: 13 bp MEX and 30 bp MEX II. Mutating either MEX or MEX II in an endogenous recruitment site with multiple copies of one or both motifs reduced binding, but only removing all motifs eliminated binding in vivo. Hence, DCC binding to <i>Cbr</i> recruitment sites appears additive. In contrast, DCC binding to <i>Cel</i> recruitment sites is synergistic: mutating even one motif in vivo eliminated binding. Although all X-chromosome motifs share the sequence CAGGG, they have otherwise diverged so that a motif from one species cannot function in the other. Functional divergence was demonstrated in vivo and in vitro. A single nucleotide position in <i>Cbr</i> MEX can determine whether <i>Cel</i> DCC binds. This rapid divergence of DCC target specificity could have been an important factor in establishing reproductive isolation between nematode species and contrasts dramatically with the conservation of target specificity for X-chromosome dosage compensation across <i>Drosophila</i> species and for transcription factors controlling developmental processes such as body-plan specification from fruit flies to mice.
Also flagged:Atherosclerosislumenanginamyocardial infarctionstrokestatins
Journal Article2023-03-23No SnippetsVelpuri P, Rai V, Agrawal DK.
Show Full Abstract
Atherosclerosis is characterized by the development of intimal plaque, thrombosis, and stenosis of the vessel lumen causing decreased blood flow and hypoxia precipitating angina. Chronic inflammation in the stable plaque renders it unstable and rupture of unstable plaques results in the formation of emboli leading to hypoxia/ischemia to the organs by occluding the terminal branches and precipitate myocardial infarction and stroke. Such delibitating events could be controlled by the strategies that prevent plaque development or plaque stabilization. Despite the use of statins to stabilize plaques, there is a need for novel targets due to continuously increasing cases of cardiovascular events. Sirtuins (SIRTs), a family of signaling proteins, are involved in sustaining genome integrity, DNA damage response and repair, modulating oxidative stress, aging, inflammation, and energy metabolism. SIRTs play a critical role in modulating inflammation and involves in the development and progression of atherosclerosis. The role of SIRTs in relation to atherosclerosis and plaque vulnerability is scarcely discussed in the literature. Since SIRTs regulate oxidative stress, inflammation, and aging, they may also regulate plaque progression and vulnerability as these molecular mechanisms underlie the pathogenesis of plaque development, progression, and vulnerability. This review critically discusses the role of SIRTs in plaque progression and vulnerability and the possibility of targeting SIRTs to attenuate plaque rupture, focusing on the highlights in genomics, molecular pathways, and cell types involved in the underlying pathophysiology.
Journal Article2023-03-23No SnippetsSmith M, Li Z, Landry L, Merz KM, Li P.
Show Full Abstract
Atomic radii play important roles in scientific research. The covalent radii of atoms, ionic radii of ions, and van der Waals (VDW) radii of neutral atoms can all be derived from crystal structures. However, the VDW radii of ions are a challenge to determine because the atomic distances in crystal structures were determined by a combination of VDW interactions and electrostatic interactions, making it unclear how to define the VDW sphere of ions in such an environment. In the present study, we found that VDW radii, which were determined based on the 0.0015 au electron density contour through a wavefunction analysis on atoms, have excellent agreement with the VDW radii of noble-gas atoms determined experimentally. Based on this criterion, we calculated the VDW radii for various atomic ions across the periodic table, providing a systematic set of VDW radii of ions. Previously we have shown that the 12-6 Lennard-Jones nonbonded model could not simultaneously reproduce the hydration free energy (HFE) and ion-oxygen distance (IOD) for an atomic ion when its charge is +2 or higher. Because of this, we developed the 12-6-4 model to reproduce both properties at the same time by explicitly considering the ion-induced dipole interactions. However, recent studies showed it was possible to use the 12-6 model to simulate both properties simultaneously when an ion has the <i>R</i><sub>min</sub>/2 parameter (<i>i.e</i>., the VDW radius) close to the Shannon ionic radius. In the present study, we show that such a "success" is due to an unphysical overfitting, as the VDW radius of an ion should be significantly larger than its ionic radius. Through molecular dynamics simulations, we show that such overfitting causes significant issues when transferring the parameters from ion-water systems to ion-ligand and metalloprotein systems. In comparison, the 12-6-4 model shows significant improvement in comparison to the overfitted 12-6 model, showing excellent transferability across different systems. In summary, although both the 12-6-4 and 12-6 models could reproduce HFE and IOD for an ion, the 12-6-4 model accomplishes such a task based on the consideration of the physics involved, while the 12-6 model accomplishes this through overfitting, which brings significant transferability issues when simulating other systems. Hence, we strongly recommend the use of the 12-6-4 model (or even more sophisticated models) instead of overfitted 12-6 models when simulating complex systems such as metalloproteins.
Also flagged:BMPR1BHSD17B3TMEM63CMEF2BRFXANKCAMKMT
Journal Article2023-03-23No SnippetsTuersuntuoheti M, Zhang J, Zhou W, Zhang CL, Liu C, Chang Q, Liu S.
Show Full Abstract
Growth traits are quantitative traits controlled by multiple micro-effect genes. we identified molecular markers related to sheep growth traits, which formed the basis of molecular breeding. In this study, we randomly selected 100 Qira Black sheep and 84 German Merino sheep for the blood collection the jugular vein to genotype by using the Illumina Ovine SNP 50K Bead Chip. quality control criteria for statistical analysis were: rejection detection rate < 90% and minimum allele frequency (MAF) < 5%. Then, we performed Genome-wide association studies (GWAS) on sheep body weight, body height, body length, and chest circumference using mixed linear models. After getting 55 SNPs with significant correlation, they were annotated by reference genome of Ovis aries genome (Oar_v4.0) and We obtained a total of 84 candidate genes associated with production traits (BMPR1B, HSD17B3, TMEM63C, etc.). We selected BMPR1B for population validation and found a correlation between the FecB locus and body weight traits. Therefore, this study not only supplements the existing knowledge of molecular markers of sheep growth traits, but also has important theoretical significance and reference value for the mining of functional genes of sheep growth traits.
<h4>Background</h4>Hypertrophic cardiomyopathy (HCM) is a grave hazard to human health. Circular RNA (circRNAs) and micro RNA (miRNAs), which are competitive endogenous RNA, have been shown to play a critical role inHCM pathogenicity. However, to a great extent, the biological activities of ceRNA in HCM pathophysiology and prognosis remain to be investigated.<h4>Materials and methods</h4>By analyzing the expression files in the Gene Expression Comprehensive (GEO) database, differentially expressed (DE) circRNAs, miRNAs, and mRNAs in HCM were identified, and the target molecules of circRNAs and miRNAs were predicted. The intersection of the differentially expressed RNA molecules and the expected target was then calculated, and a ceRNA network was subsequently constructed using RNA molecules. Using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, the potential etiology was elucidated. qPCR was used to validate a portion of the hub gene using Angiotensin II to generate a cell hypertrophy model.<h4>Results</h4>Three large-scale HCM sample datasets were extracted from the GEO database. After crossing these molecules with their expected targets, the circRNA-miRNA-mRNA network had two DEcircRNAs, two DEmiRNAs, and thirty DEmRNAs, compared to normal tissues. Functional enrichment analysis of GO and KEGG demonstrated that many of the HCM pathways and mechanisms were associated with calcium channel release, which is also the primary focus of future research. The qPCR results revealed that circRNA, miRNA, and mRNA expression levels were different. They may include novel noninvasive indicators for the early screening and prognostic prediction of HCM.<h4>Conclusion</h4>In this study, we hypothesized a circRNA-miRNA-mRNA regulation network that is closely related to the progression and clinical outcomes of HCM and may contain promising biomarkers and treatment targets for HCM.
Also flagged:GlycolipidsTLR4secretionsugarasthmaovalbumin
Journal Article2023-03-23No SnippetsGonzález-Cuesta M, Lai AC, Chi PY, Hsu IL, Liu NT, Wu KC, García Fernández JM, Chang YJ, Ortiz Mellet C.
Show Full Abstract
Glycolipids with TLR4 agonistic properties can serve either as therapeutic agents or as vaccine adjuvants by stimulating the development of proinflammatory responses. Translating them to the clinical setting is hampered by synthetic difficulties, the lack of stability in biological media, and/or a suboptimal profile of balanced immune mediator secretion. Here, we show that replacement of the sugar fragment by an sp<sup>2</sup>-iminosugar moiety in a prototypic TLR4 agonist, <b>CCL-34</b>, yields iminoglycolipid analogues that retain or improve their biological activity in vitro and in vivo and can be accessed through scalable protocols with total stereoselectivity. Their adjuvant potential is manifested in their ability to induce the secretion of proinflammatory cytokines, prime the maturation of dendritic cells, and promote the proliferation of CD8<sup>+</sup> T cells, pertaining to a Th1-biased profile. Additionally, their therapeutic potential for the treatment of asthma, a Th2-dominated inflammatory pathology, has been confirmed in an ovalbumin-induced airway hyperreactivity mouse model.
Also flagged:tissue homeostasishyaluronanCD44chemokine receptorCCR7CXCR4
Journal Article2023-03-23No SnippetsPalomino-Segura M, Sicilia J, Ballesteros I, Hidalgo A.
Show Full Abstract
Neutrophils are formidable defenders. Their vast numbers, constant production, high cytotoxicity and capacity to produce extracellular traps, underlie their ability to efficiently protect in a microorganism-rich world. However, neutrophils are much more than immune sentinels, as evidenced by the expanding repertoire of functions discovered in the context of tissue homeostasis, regeneration or chronic pathologies. In this Perspective, we discuss general functional features of the neutrophil compartment that may be relevant in most, if not all, physiological scenarios in which they participate, including specialization in naïve tissues, transcriptional noise in the bloodstream as a potential strategy for diversification and functional bias in inflammatory sites. We intentionally present the reader with more questions than answers and propose models and approaches that we hope will shed new light onto the biology of these fascinating cells and spark new directions of research.
Also flagged:ILF3IL15cancertumorESCCpescadillo ribosomal biogenesis factor 1
Journal Article2023-03-23✓ 1 SnippetMa N, Hua R, Yang Y, Liu ZC, Pan J, Yu BY, Sun YF, Xie D, Wang Y, Li ZG.
In-Text Gene Mentions
Results)
…BOP1, WDR12 andDDX27[ 43 ], suggesting…
Show Full Abstract
<h4>Background</h4>Although immune checkpoint blockade (ICB) therapy has brought survival benefits to patients with specific cancer types, most of cancer patients remain refractory to the ICB therapy, which is largely attributed to the immunosuppressive tumor microenvironment. Thereby, it is urgent to profile key molecules and signal pathways responsible for modification of tumor microenvironment.<h4>Methods</h4>Multiple databases of esophageal squamous cell carcinoma (ESCC) were integratively analyzed to screen candidate genes responsible for infiltration of CD8<sup>+</sup> T cells. Expression of pescadillo ribosomal biogenesis factor 1 (PES1) in clinical ESCC samples was examined by qRT-PCR, western blotting, and immunohistochemistry. The mechanisms of PES1 were investigated via RNA sequencing and mass spectrometry followed by immunoprecipitation and proximity ligation assay. The clinical and therapeutic significance of PES1 in ESCC was comprehensively investigated using ESCC cells and mouse model.<h4>Results</h4>PES1 was significantly upregulated and correlated with poor prognosis in ESCC patients. PES1 knockdown decreased ESCC cell growth in vitro and in vivo and enhanced the efficacy of ICB therapy in mouse model, which was established through subcutaneous inoculation with ESCC cells. Analyses on RNA sequencing and mass spectrometry suggested that PES1 expression was negatively correlated with IL15 and ILF3 was one of the PES1-associated proteins. It has been known that ILF3 interacts with and stabilizes IL15 mRNA to increase IL15 protein level. Our data further indicated that PES1 interfered with the interaction between ILF3 and IL15 mRNA and impaired ILF3-mediated stabilization of IL15 mRNA, which eventually reduced the protein level of IL15. Interestingly, the inhibitory effect of ICB therapy boosted by PES1 knockdown dramatically antagonized by knockdown of IL15, which suppressed the tumor-infiltrated CD8<sup>+</sup> T cells in ESCC. Finally, we confirmed the relationships among PES1, IL15, and CD8<sup>+</sup> T cell infiltration in 10 locally advanced ESCC patients receiving ICB neoadjuvant therapy and demonstrated that ICB therapy would be more effective in those with low expression of PES1.<h4>Conclusions</h4>Altogether, our findings herein provided novel insights on biological function and clinical significance of PES1 and suggested that high expression of PES1 could suppress ILF3-IL15 axis-mediated immunosurveillance and promote resistance to ICB through restraining tumor-infiltrated CD8<sup>+</sup> T cells.
Also flagged:SERPINE1clear cell renal cell carcinomaccRCCpathogenesisGene Expressiontumor
Journal Article2023-03-23✓ 5 SnippetsGuo L, An T, Wan Z, Huang Z, Chong T.
In-Text Gene Mentions
Results)
…The results showed that 9 of the 10 co-expressed genes, including ITGA5, SLC2A3, ELL2, ABL2, SLC2A14, XIRP1, SHC1, CEBPB, and ADA, were significantly upregulated in ccRCC tissues (Fig. 7A–J).…
Discussion)
…Interestingly, 9 out of the 10 co-expressed genes, including ITGA5, SLC2A3, ELL2, ABL2, SLC2A14, XIRP1, SHC1, CEBPB, and ADA, were significantly upregulated in ccRCC tissues.…
Abstract)
…Among the co-expressed genes with the highest correlation, ITGA5, SLC2A3, SLC2A14, SHC1, CEBPB, and ADA were overexpressed and associated with shorter overall survival (OS) in ccRCC.…
<h4>Background</h4>Clear cell renal cell carcinoma(ccRCC) is a frequently occurring malignant tumor of the urinary system. Despite extensive research, the regulatory mechanisms underlying the pathogenesis and progression of ccRCC remain largely unknown.<h4>Methods</h4>We downloaded 5 ccRCC expression profiles from the Gene Expression Omnibus (GEO) database and obtained the list of differentially expressed genes (DEGs). Using String and Cytoscape tools, we determined the hub genes of ccRCC, and then analyzed their relationship with ccRCC patient survival. Ultimately, we identified SERPINE1 as a prognostic factor in ccRCC. Meanwhile, we confirmed the role of SERPINE1 in 786-O cells by cell transfection and in vitro experiments.<h4>Results</h4>Our analysis yielded a total of 258 differentially expressed genes, comprising 105 down-regulated genes and 153 up-regulated genes. Survival analysis of SERPINE1 expression in The Cancer Genome Atlas (TCGA) confirmed its association with the increase of tumor grade, lymph node metastasis, and tumor stage, as well as with shorter survival. Furthermore, we found that SERPINE1 expression levels were associated with CD8 + T cells, CD4 + T cells, B cells, macrophages, neutrophils, and dendritic cells. Cell experiments showed that knockdown SERPINE1 expression could inhibit the proliferation, migration and invasion of ccRCC cells. Among the co-expressed genes with the highest correlation, ITGA5, SLC2A3, SLC2A14, SHC1, CEBPB, and ADA were overexpressed and associated with shorter overall survival (OS) in ccRCC.<h4>Conclusions</h4>In this study, we identified hub genes that are strongly related to ccRCC, and highlights the potential utility of overexpressed SERPINE1 and its co-expressed genes could be used as prognostic and diagnostic biomarkers in ccRCC.
Also flagged:L1CAMaxonalaxonsaxon guidance proteinsnetrin-1SEMA3
Journal Article2023-03-23✓ 5 SnippetsTsuchimochi R, Yamagami K, Kubo N, Amimoto N, Raudzus F, Samata B, Kikuchi T, Doi D, Yoshimoto K, Mihara A, Takahashi J.
Cell replacement therapy is expected as a new and more radical treatment against brain damage. We previously reported that transplanted human cerebral organoids extend their axons along the corticospinal tract in rodent brains. The axons reached the spinal cord but were still sparse. Therefore, this study optimized the host brain environment by the adeno-associated virus (AAV)-mediated expression of axon guidance proteins in mouse brain. Among netrin-1, SEMA3, and L1CAM, only L1CAM significantly promoted the axonal extension of mouse embryonic brain tissue-derived grafts. L1CAM was also expressed by donor neurons, and this promotion was exerted in a haptotactic manner by their homophilic binding. Primary cortical neurons cocultured on L1CAM-expressing HEK-293 cells supported this mechanism. These results suggest that optimizing the host environment by the AAV-mediated expression of axon guidance molecules enhances the effect of cell replacement therapy.
Also flagged:Type 2 DiabeteschromosomechromosomesDNasechromatinMetabolic Diseases
Journal Article2023-03-23No SnippetsCostanzo MC, von Grotthuss M, Massung J, Jang D, Caulkins L, Koesterer R, Gilbert C, Welch RP, Kudtarkar P, Hoang Q, Boughton AP, Singh P, Sun Y, Duby M, Moriondo A, Nguyen T, Smadbeck P, Alexander BR, Brandes M, Carmichael M, Dornbos P, Green T, Huellas-Bruskiewicz KC, Ji Y, Kluge A, McMahon AC, Mercader JM, Ruebenacker O, Sengupta S, Spalding D, Taliun D, AMP-T2D Consortium, Smith P, Thomas MK, Akolkar B, Brosnan MJ, Cherkas A, Chu AY, Fauman EB, Fox CS, Kamphaus TN, Miller MR, Nguyen L, Parsa A, Reilly DF, Ruetten H, Wholley D, Zaghloul NA, Abecasis GR, Altshuler D, Keane TM, McCarthy MI, Gaulton KJ, Florez JC, Boehnke M, Burtt NP, Flannick J.
Show Full Abstract
Associations between human genetic variation and clinical phenotypes have become a foundation of biomedical research. Most repositories of these data seek to be disease-agnostic and therefore lack disease-focused views. The Type 2 Diabetes Knowledge Portal (T2DKP) is a public resource of genetic datasets and genomic annotations dedicated to type 2 diabetes (T2D) and related traits. Here, we seek to make the T2DKP more accessible to prospective users and more useful to existing users. First, we evaluate the T2DKP's comprehensiveness by comparing its datasets with those of other repositories. Second, we describe how researchers unfamiliar with human genetic data can begin using and correctly interpreting them via the T2DKP. Third, we describe how existing users can extend their current workflows to use the full suite of tools offered by the T2DKP. We finally discuss the lessons offered by the T2DKP toward the goal of democratizing access to complex disease genetic results.
Nanometric scale size oscillations seem to be a fundamental feature of all living organisms on Earth. Their detection usually requires complex and very sensitive devices. However, some recent studies demonstrated that very simple optical microscopes and dedicated image processing software can also fulfill this task. This novel technique, termed as optical nanomotion detection (ONMD), was recently successfully used on yeast cells to conduct rapid antifungal sensitivity tests. In this study, we demonstrate that the ONMD method can monitor motile sub-cellular organelles, such as mitochondria. Here, mitochondrial isolates (from HEK 293 T and Jurkat cells) undergo predictable motility when viewed by ONMD and triggered by mitochondrial toxins, citric acid intermediates, and dietary and bacterial fermentation products (short-chain fatty acids) at various doses and durations. The technique has superior advantages compared to classical methods since it is rapid, possesses a single organelle sensitivity, and is label- and attachment-free.
Also flagged:berberinekidney clear cell carcinomaCOVID-19infectiondeathCOVID-19 infection
Journal Article2023-03-23✓ 5 SnippetsZheng Z, Li X, Nie K, Wang X, Liang W, Yang F, Zheng K, Zheng Y.
In-Text Gene Mentions
Abstract)
…In COVID-19 patients, ACOX1, LRRK2, MMP8, SLC1A3, CPT1A, H2AC11, H4C8, and SLC1A3 were closely related to disease severity, and the general survival of KIRC patients was closely related to ACOX1, APP, CPT1A, PLK1, and TYMS.…
Abstract)
…SLC1A3, CPT1A, H2AC11,H4C8, and SLC1A3 were…
Results)
…and that ofH4C8and ITK was…
Results)
…and CPT1A, H2AC11,H4C8, and ITK expression…
Discussion)
…of CPT1A, H2AC11,H4C8, and ITK decreased.…
Show Full Abstract
<h4>Background</h4>Regarding the global coronavirus disease 2019 (COVID)-19 pandemic, kidney clear cell carcinoma (KIRC) has acquired a higher infection probability and may induce fatal complications and death following COVID-19 infection. However, effective treatment strategies remain unavailable. Berberine exhibits significant antiviral and antitumour effects. Thus, this study aimed to provide a promising and reliable therapeutic strategy for clinical decision-making by exploring the therapeutic mechanism of berberine against KIRC/COVID-19.<h4>Methods</h4>Based on large-scale data analysis, the target genes, clinical risk, and immune and pharmacological mechanisms of berberine against KIRC/COVID-19 were systematically investigated.<h4>Results</h4>In total, 1,038 and 12,992 differentially expressed genes (DEGs) of COVID-19 and KIRC, respectively, were verified from Gene Expression Omnibus and The Cancer Genome Atlas databases, respectively, and 489 berberine target genes were obtained from official websites. After intersecting, 26 genes were considered potential berberine therapeutic targets for KIRC/COVID-19. Berberine mechanism of action against KIRC/COVID-19 was revealed by protein-protein interaction, gene ontology, and Kyoto Encyclopedia of Genes and Genomes with terms including protein interaction, cell proliferation, viral carcinogenesis, and the PI3K/Akt signalling pathway. In COVID-19 patients, ACOX1, LRRK2, MMP8, SLC1A3, CPT1A, H2AC11, H4C8, and SLC1A3 were closely related to disease severity, and the general survival of KIRC patients was closely related to ACOX1, APP, CPT1A, PLK1, and TYMS. Additionally, the risk signature accurately and sensitively depicted the overall survival and patient survival status for KIRC. Numerous neutrophils were enriched in the immune system of COVID-19 patients, and the lives of KIRC patients were endangered due to significant immune cell infiltration. Molecular docking studies indicated that berberine binds strongly to target proteins.<h4>Conclusion</h4>This study demonstrated berberine as a potential treatment option in pharmacological, immunological, and clinical practice. Moreover, its therapeutic effects may provide potential and reliable treatment options for patients with KIRC/COVID-19.
Also flagged:deathfailuresepsiscytokinemyeloid cell differentiationiron
Journal Article2023-03-23✓ 1 SnippetPeng Y, Wu Q, Liu H, Zhang J, Han Q, Yin F, Wang L, Chen Q, Zhang F, Feng C, Zhu H.
In-Text Gene Mentions
Discussion)
…several DEGs (namelyOLFM4, LCN2 ,…
Show Full Abstract
<h4>Introduction</h4>Sepsis is the leading cause of death in intensive care units and is characterized by multiple organ failure, including dysfunction of the immune system. In the present study, we performed an integrative analysis on publicly available datasets to identify immune-related genes (IRGs) that may play vital role in the pathological process of sepsis, based on which a prognostic IRG signature for 28-day mortality prediction in patients with sepsis was developed and validated.<h4>Methods</h4>Weighted gene co-expression network analysis (WGCNA), Cox regression analysis and least absolute shrinkage and selection operator (LASSO) estimation were used to identify functional IRGs and construct a model for predicting the 28-day mortality. The prognostic value of the model was validated in internal and external sepsis datasets. The correlations of the IRG signature with immunological characteristics, including immune cell infiltration and cytokine expression, were explored. We finally validated the expression of the three IRG signature genes in blood samples from 12 sepsis patients and 12 healthy controls using qPCR.<h4>Results</h4>We established a prognostic IRG signature comprising three gene members (<i>LTB4R</i>, <i>HLA-DMB</i> and <i>IL4R</i>). The IRG signature demonstrated good predictive performance for 28-day mortality on the internal and external validation datasets. The immune infiltration and cytokine analyses revealed that the IRG signature was significantly associated with multiple immune cells and cytokines. The molecular pathway analysis uncovered ontology enrichment in myeloid cell differentiation and iron ion homeostasis, providing clues regarding the underlying biological mechanisms of the IRG signature. Finally, qPCR detection verified the differential expression of the three IRG signature genes in blood samples from 12 sepsis patients and 12 healthy controls.<h4>Discussion</h4>This study presents an innovative IRG signature for 28-day mortality prediction in sepsis patients, which may be used to facilitate stratification of risky sepsis patients and evaluate patients' immune state.
Also flagged:synapseCNS disordersneurological disordersCNS diseasescentral nervous system disorderscomplement activation
Journal Article2023-03-23No SnippetsZhang W, Chen Y, Pei H.
Show Full Abstract
C1q is a crucial component of the complement system, which is activated through the classical pathway to perform non-specific immune functions, serving as the first line of defense against pathogens. C1q can also bind to specific receptors to carry out immune and other functions, playing a vital role in maintaining immune homeostasis and normal physiological functions. In the developing central nervous system (CNS), C1q functions in synapse formation and pruning, serving as a key player in the development and homeostasis of neuronal networks in the CNS. C1q has a close relationship with microglia and astrocytes, and under their influence, C1q may contribute to the development of CNS disorders. Furthermore, C1q can also have independent effects on neurological disorders, producing either beneficial or detrimental outcomes. Most of the evidence for these functions comes from animal models, with some also from human specimen studies. C1q is now emerging as a promising target for the treatment of a variety of diseases, and clinical trials are already underway for CNS disorders. This article highlights the role of C1q in CNS diseases, offering new directions for the diagnosis and treatment of these conditions.
Also flagged:Hallux valguspathogenesiscytochrome P450metabolismdegenerative joint diseaseHallux
Journal Article2023-03-23✓ 1 SnippetZhou W, Jia J, Qu HQ, Ma F, Li J, Qi X, Meng X, Ding Z, Zheng G, Hakonarson H, Zeng X, Li J, Xia Q.
In-Text Gene Mentions
Results)
…HLA-H (HFE) is an important…
Show Full Abstract
Hallux valgus is a common form of foot deformity, and genetic factors contribute substantially to the pathogenesis of hallux valgus deformity. We conducted a genetic study on the structural variants underlying familial hallux valgus using whole exome sequencing approach. Twenty individuals from five hallux valgus families and two sporadic cases were included in this study. A total of 372 copy number variations were found and passed quality control filtering. Among them, 43 were only present in cases but not in controls or healthy individuals in the database of genomic variants. The genes covered by these copy number variations were enriched in gene sets related to immune signaling pathway, and cytochrome P450 metabolism. The hereditary CNVs demonstrate a dominant inheritance pattern. Two candidate pathogenic CNVs were further validated by quantitative-PCR. This study suggests that hallux valgus is a degenerative joint disease involving the dysregulation of immune and metabolism signaling pathways.
Also flagged:adult-onset carcinomacancertumormethylationWNTFibrosis
Journal Article2023-03-23✓ 1 SnippetCecere F, Pignata L, Hay Mele B, Saadat A, D'Angelo E, Palumbo O, Palumbo P, Carella M, Scarano G, Rossi GB, Angelini C, Sparago A, Cerrato F, Riccio A.
In-Text Gene Mentions
Results)
…(18q21.1), SMAD4 (18q21.2),DCC(18q21) and the…
Show Full Abstract
CRC is an adult-onset carcinoma representing the third most common cancer and the second leading cause of cancer-related deaths in the world. EO-CRC (<45 years of age) accounts for 5% of the CRC cases and is associated with cancer-predisposing genetic factors in half of them. Here, we describe the case of a woman affected by BWSp who developed EO-CRC at age 27. To look for a possible molecular link between BWSp and EO-CRC, we analysed her whole-genome genetic and epigenetic profiles in blood, and peri-neoplastic and neoplastic colon tissues. The results revealed a general instability of the tumor genome, including copy number and methylation changes affecting genes of the WNT signaling pathway, CRC biomarkers and imprinted loci. At the germline level, two missense mutations predicted to be likely pathogenic were found in compound heterozygosity affecting the Cystic Fibrosis (CF) gene CFTR that has been recently classified as a tumor suppressor gene, whose dysregulation represents a severe risk factor for developing CRC. We also detected constitutional loss of methylation of the <i>KCNQ1OT1</i>:TSS-DMR that leads to bi-allelic expression of the lncRNA <i>KCNQ1OT1</i> and BWSp. Our results support the hypothesis that the inherited CFTR mutations, together with constitutional loss of methylation of the <i>KCNQ1OT1</i>:TSS-DMR, initiate the tumorigenesis process. Further somatic genetic and epigenetic changes enhancing the activation of the WNT/beta-catenin pathway likely contributed to increase the growth advantage of cancer cells. Although this study does not provide any conclusive cause-effect relationship between BWSp and CRC, it is tempting to speculate that the imprinting defect of BWSp might accelerate tumorigenesis in adult cancer in the presence of predisposing genetic variants.
Also flagged:neurodegenerative disordersproteinopathiesgene expressionADPDHD
Journal Article2023-03-23✓ 1 SnippetLanza M, Cuzzocrea S, Oddo S, Esposito E, Casili G.
In-Text Gene Mentions
S I O 001029)
…HD is an inherited disease caused by the abnormal expansion of a repeated trinucleotide sequence (CAG) in the huntingtin gene (HTT), translated into a long polyglutamine (poly Q) tract, which causes misfolding and aggregation of the mutant huntingtin (mHTT).…
Show Full Abstract
Several neurodegenerative disorders are characterized by the accumulation of misfolded proteins and are collectively known as proteinopathies. Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD) represent some of the most common neurodegenerative disorders whose steady increase in prevalence is having a major socio-economic impact on our society. Multiple laboratories have reported hundreds of changes in gene expression in selective brain regions of AD, PD, and HD brains. While the mechanisms underlying these changes remain an active area of investigation, alterations in the expression of noncoding RNAs, which are common in AD, PD, and HD, may account for some of the changes in gene expression in proteinopathies. In this review, we discuss the role of miR-128, which is highly expressed in mammalian brains, in AD, PD, and HD. We highlight how alterations in miR-128 may account, at least in part, for the gene expression changes associated with proteinopathies. Indeed, miR-128 is involved, among other things, in the regulation of neuronal plasticity, cytoskeletal organization, and neuronal death, events linked to various proteinopathies. For example, reducing the expression of miR-128 in a mouse model of AD ameliorates cognitive deficits and reduces neuropathology. Overall, the data in the literature suggest that targeting miR-128 might be beneficial to mitigate the behavioral phenotype associated with these diseases.
Also flagged:ImatinibGastrointestinal stromal tumorsmesenchymal neoplasmsTKRKITplatelet-derived growth factor-alpha receptor
Journal Article2023-03-23✓ 2 SnippetsMasucci MT, Motti ML, Minopoli M, Di Carluccio G, Carriero MV.
In-Text Gene Mentions
S I O 001029)
…Ripretinib (Qinlock, DCC-2618) is an orally bioavailable, selective KIT and PDGFRA switch-control inhibitor, active against most KIT and PDGFRA mutations.…
S I O 000419)
…A study of DCC-2618 vs. sunitinib in advanced GIST patients after treatment with imatinib (INTRIGUE)…
Show Full Abstract
Gastrointestinal stromal tumors (GISTs) are the most common malignant mesenchymal neoplasms of the gastrointestinal tract. The gold standard for the diagnosis of GISTs is morphologic analysis with an immunohistochemical evaluation plus genomic profiling to assess the mutational status of lesions. The majority of GISTs are driven by gain-of-function mutations in the proto-oncogene c-<i>KIT</i> encoding the tyrosine kinase receptor (TKR) known as KIT and in the platelet-derived growth factor-alpha receptor (<i>PDGFRA</i>) genes. Approved therapeutics are orally available as tyrosine kinase inhibitors (TKIs) targeting KIT and/or PDGFRA oncogenic activation. Among these, <i>imatinib</i> has changed the management of patients with unresectable or metastatic GISTs, improving their survival time and delaying disease progression. Nevertheless, the majority of patients with GISTs experience disease progression after 2-3 years of imatinib therapy due to the development of secondary <i>KIT</i> mutations. Today, based on the identification of new driving oncogenic mutations, targeted therapy and precision medicine are regarded as the new frontiers for GISTs. This article reviews the most important mutations in GISTs and highlights their importance in the current understanding and treatment options of GISTs, with an emphasis on the most recent clinical trials.
Also flagged:ObesityMultiple Myelomaimmunoglobulinshematological cancersproteinssteroid
Journal Article2023-03-23No SnippetsSánchez-Maldonado JM, Cabrera-Serrano AJ, Chattopadhyay S, Campa D, Garrido MDP, Macauda A, Ter Horst R, Jerez A, Netea MG, Li Y, Hemminki K, Canzian F, Försti A, Sainz J.
Show Full Abstract
Multiple myeloma (MM) is an incurable disease characterized by the presence of malignant plasma cells in the bone marrow that secrete specific monoclonal immunoglobulins into the blood. Obesity has been associated with the risk of developing solid and hematological cancers, but its role as a risk factor for MM needs to be further explored. Here, we evaluated whether 32 genome-wide association study (GWAS)-identified variants for obesity were associated with the risk of MM in 4189 German subjects from the German Multiple Myeloma Group (GMMG) cohort (2121 MM cases and 2068 controls) and 1293 Spanish subjects (206 MM cases and 1087 controls). Results were then validated through meta-analysis with data from the UKBiobank (554 MM cases and 402,714 controls) and FinnGen cohorts (914 MM cases and 248,695 controls). Finally, we evaluated the correlation of these single nucleotide polymorphisms (SNPs) with cQTL data, serum inflammatory proteins, steroid hormones, and absolute numbers of blood-derived cell populations (<i>n =</i> 520). The meta-analysis of the four European cohorts showed no effect of obesity-related variants on the risk of developing MM. We only found a very modest association of the <i>POC5</i><sub>rs2112347G</sub> and <i>ADCY3</i><sub>rs11676272G</sub> alleles with MM risk that did not remain significant after correction for multiple testing (per-allele OR <i>=</i> 1.08, <i>p =</i> 0.0083 and per-allele OR <i>=</i> 1.06, <i>p =</i> 0.046). No correlation between these SNPs and functional data was found, which confirms that obesity-related variants do not influence MM risk.
Also flagged:parkinsonismneurofilament light chainsHDneurodegenerative disordercytosineadenine
Journal Article2023-03-23✓ 5 SnippetsMorena E, Romano C, Marconi M, Diamant S, Buscarinu MC, Bellucci G, Romano S, Scarabino D, Salvetti M, Ristori G.
In-Text Gene Mentions
S I O 001029)
…A recent phase IIa/III trial testing tominersen (formerly known as IONIS-HTTRx and RG6042), an investigational antisense medicine designed to reduce HTT production, failed in a large cohort of patients with early-stage manifest HD (mHD), despite promising results obtained in phase II [17].…
S I O 001029)
…A recent study on an experimental model of HD and plasma from patients heralded the use of exosomes as biomarker carriers in HD: the HTT protein was co-isolated with EVs from the pig model and HD patient plasma; total huntingtin levels in the EVs were higher in the plasma of HD patients than healthy controls in pig models and HD patients [35].…
Introduction)
…Huntington’s disease (HD) is an autosomal-dominant inherited, neurodegenerative disorder caused by a cytosine–adenine–guanine (CAG) polyglutamine repeat expansion in the first exon of the HTT gene encoding the huntingtin protein [1].…
S I O 001029)
…In 2012, a time-resolved Förster resonance energy transfer (TR-FRET) immunoassay to quantify mutant and total HTT protein levels in leukocytes revealed insignificant differences in total HTT between patients with HD and healthy controls.…
I A O 0000615)
…While CAG expansion in the HTT gene is a known unequivocal cause of HD, mHTT varies considerably with age of onset and clinical disease progression, suggesting that some genetic and environmental modifiers of disease may impact the effects of mHTT.…
Show Full Abstract
Huntington's disease (HD) is characterized by clinical motor impairment (e.g., involuntary movements, poor coordination, parkinsonism), cognitive deficits, and psychiatric symptoms. An inhered expansion of the CAG triplet in the huntingtin gene causing a pathogenic gain-of-function of the mutant huntingtin (<i>mHTT</i>) protein has been identified. In this review, we focus on known biomarkers (e.g., mHTT, neurofilament light chains) and on new biofluid biomarkers that can be quantified in plasma or peripheral blood mononuclear cells from mHTT carriers. Circulating biomarkers may fill current unmet needs in HD management: better stratification of patients amenable to etiologic treatment; the initiation of preventive treatment in premanifest HD; and the identification of peripheral pathogenic central nervous system cascades.
Also flagged:Sugarmembraneglucosemetabolismsugarsextracellular
Journal Article2023-03-23No SnippetsCarbó R, Rodríguez E.
Show Full Abstract
Sugar transport through the plasma membrane is one of the most critical events in the cellular transport of nutrients; for example, glucose has a central role in cellular metabolism and homeostasis. The way sugars enter the cell involves complex systems. Diverse protein systems participate in the membrane traffic of the sugars from the extracellular side to the cytoplasmic side. This diversity makes the phenomenon highly regulated and modulated to satisfy the different needs of each cell line. The beautiful thing about this process is how evolutionary processes have diversified a single function: to move glucose into the cell. The deregulation of these entrance systems causes some diseases. Hence, it is necessary to study them and search for a way to correct the alterations and utilize these mechanisms to promote health. This review will highlight the various mechanisms for importing the valuable sugars needed to create cellular homeostasis and survival in all kinds of cells.
Also flagged:N-Type Ca ChannelEpileptic SyndromesEpilepsyN-type voltage-gated calcium channelvoltage-gated calcium channelsN-type voltage-gated calcium channels
Journal Article2023-03-23✓ 2 SnippetsMayo S, Gómez-Manjón I, Marco-Hernández AV, Fernández-Martínez FJ, Camacho A, Martínez F.
In-Text Gene Mentions
Introduction)
…For instance, some pathogenic variants in CACNA1A and CACNA1E genes cause developmental and epileptic encephalopathies [MIM# 617106 and MIM# 618285].…
Introduction)
…in CACNA1A andCACNA1Egenes cause developmental…
Show Full Abstract
N-type voltage-gated calcium channel controls the release of neurotransmitters from neurons. The association of other voltage-gated calcium channels with epilepsy is well-known. The association of N-type voltage-gated calcium channels and pain has also been established. However, the relationship between this type of calcium channel and epilepsy has not been specifically reviewed. Therefore, the present review systematically summarizes existing publications regarding the genetic associations between N-type voltage-dependent calcium channel and epilepsy.
Also flagged:neoplastic diseasesleukemiascancerleukemiabenzeneformaldehyde
Journal Article2023-03-23No SnippetsKowalczyk A, Zarychta J, Lejman M, Zawitkowska J.
Show Full Abstract
The incidence and mortality due to neoplastic diseases have shown an increasing tendency over the years. Based on GLOBOCAN 2020 published by the International Agency for Research on Cancer (IARC), leukemias are the thirteenth most commonly diagnosed cancer in the world, with 78.6% of leukemia cases diagnosed in countries with a very high or high Human Development Index (HDI). Carcinogenesis is a complex process initiated by a mutation in DNA that may be caused by chemical carcinogens present in polluted environments and human diet. The IARC has identified 122 human carcinogens, e.g., benzene, formaldehyde, pentachlorophenol, and 93 probable human carcinogens, e.g., styrene, diazinone. The aim of the following review is to present the chemical carcinogens involved or likely to be involved in the pathogenesis of leukemia and to summarize the latest reports on the possibility of detecting these compounds in the environment or food with the use of electrochemical sensors.
Also flagged:monoterpeneshydrocarbonssesquiterpenestriterpenesphyto-sterols
Journal Article2023-03-23No SnippetsQamar F, Sana A, Naveed S, Faizi S.
Show Full Abstract
<i>Ocimum basilicum Linn.</i> (basil) is an aromatic culinary herb that has shown a great potential in therapeutic world. It has many promising pharmacological activities that make it centre for investigations for many researchers. Current study has been planned to determine chemical constituents of basil leaves extracts and their <i>in-vitro</i> and <i>ex-vivo</i> antioxidant and <i>in-vivo</i> antihypertensive potential. GC-MS studies of non-polar extracts showed presence of 75 compounds including monoterpenes, hydrocarbons, sesquiterpenes, triterpenes, phyto-sterols and phthalates. Higher percentages of fatty acids were also identified. The major compounds include linalool (7.65%), terpineol (1.42%), <i>tau</i>-cadinol (13.55%), methyl palmitate (14.24%), palmitic acid (14.31%), linolenic acid (1.30%) and methyl linolenate (17.72%). Electron spray ionization mass spectrometry ESI-HRMS/MS of the polar extracts revealed the presence of alkaloids, phenolic acid, amino acid, coumarin, lignin, flavanoid and terpene derivative. Total phenolic content and total flavonoid content were determined using spectrophotometric technique and calculated as gallic acid equivalents GAE/g dry weight and rutin equivalent RE/g of dry weight respectively. The highest phenolic content and flavonoid content were found in ethyl acetate extract 9.40 mg GAE/g and 15.9 mg RE/g of dry weight. All the extracts showed significant antioxidant activity in DPPH and ABTS cation decolorization assays. Dichloromethane extract possess the highest DPPH scavenging activity, i.e., 64.12% ± 0.23 at concentration of 4 mg/ml. Moreover in <i>ex-vivo</i> studies all the extracts showed prominent effect by inhibiting AAPS induce oxidation in Human erythrocytes being 69.24% ± 0.18 in dichloromethane extract, 64.44% ± 0.04 in ethyl acetate and 53.33% ± 0.09 in acetone extract. The methanol extract of <i>O. basilicum</i> exhibited significant decrease in systolic blood pressure in l-Name induced hypertensive rats at the dose of 50 mg/kg for 28 days. Total phenolic content had a higher linear correlation (r = 0.678) with antihypertensive activity, with a level of significance 95% showing that phenolic compounds in the leaves of the plant has important role in inhibiting l -NAME induced hypertension while flavonoid compounds may play a key role in the antioxidant activities of the plant, through synergism. Conclusively, <i>O. basilicum</i> leaves with bioactive metabolites are a potential source for the development of antihypertensive drugs.
Also flagged:DNA-Binding Protein CSingle-stranded DNA-binding proteinSSBDNA metabolizing enzymesExoIamino acids
Journal Article2023-03-23No SnippetsTököli A, Bodnár B, Bogár F, Paragi G, Hetényi A, Bartus É, Wéber E, Hegedüs Z, Szabó Z, Kecskeméti G, Szakonyi G, Martinek TA.
Show Full Abstract
Single-stranded DNA-binding protein (SSB) is a bacterial interaction hub and an appealing target for antimicrobial therapy. Understanding the structural adaptation of the disordered SSB C-terminus (SSB-Ct) to DNA metabolizing enzymes (e.g., ExoI and RecO) is essential for designing high-affinity SSB mimetic inhibitors. Molecular dynamics simulations revealed the transient interactions of SSB-Ct with two hot spots on ExoI and RecO. The residual flexibility of the peptide-protein complexes allows adaptive molecular recognition. Scanning with non-canonical amino acids revealed that modifications at both termini of SSB-Ct could increase the affinity, supporting the two-hot-spot binding model. Combining unnatural amino acid substitutions on both segments of the peptide resulted in enthalpy-enhanced affinity, accompanied by enthalpy-entropy compensation, as determined by isothermal calorimetry. NMR data and molecular modeling confirmed the reduced flexibility of the improved affinity complexes. Our results highlight that the SSB-Ct mimetics bind to the DNA metabolizing targets through the hot spots, interacting with both of segments of the ligands.
Also flagged:brain diseasesinnate immunity-relatedNLRP3extracellularvesiclesischemia
Journal Article2023-03-23No SnippetsChiarini A, Gui L, Viviani C, Armato U, Dal Prà I.
Show Full Abstract
Increasingly prevalent acute and chronic human brain diseases are scourges for the elderly. Besides the lack of therapies, these ailments share a neuroinflammation that is triggered/sustained by different innate immunity-related protein oligomers called inflammasomes. Relevant neuroinflammation players such as microglia/monocytes typically exhibit a strong NLRP3 inflammasome activation. Hence the idea that NLRP3 suppression might solve neurodegenerative ailments. Here we review the recent Literature about this topic. First, we update conditions and mechanisms, including RNAs, extracellular vesicles/exosomes, endogenous compounds, and ethnic/pharmacological agents/extracts regulating NLRP3 function. Second, we pinpoint NLRP3-activating mechanisms and known NLRP3 inhibition effects in acute (ischemia, stroke, hemorrhage), chronic (Alzheimer's disease, Parkinson's disease, Huntington's disease, MS, ALS), and virus-induced (Zika, SARS-CoV-2, and others) human brain diseases. The available data show that (i) disease-specific divergent mechanisms activate the (mainly animal) brains NLRP3; (ii) no evidence proves that NLRP3 inhibition modifies human brain diseases (yet ad hoc trials are ongoing); and (iii) no findings exclude that concurrently activated other-than-NLRP3 inflammasomes might functionally replace the inhibited NLRP3. Finally, we highlight that among the causes of the persistent lack of therapies are the species difference problem in disease models and a preference for symptomatic over etiologic therapeutic approaches. Therefore, we posit that human neural cell-based disease models could drive etiological, pathogenetic, and therapeutic advances, including NLRP3's and other inflammasomes' regulation, while minimizing failure risks in candidate drug trials.
Research Square2023-03-23Preprint (No Snippets API)MUHAMMAD S, Fan T, Zhang L, Fei S, Kaur K, Khan A, Bilal M, Mashwani AA, Gao Y, He J.
Show Full Abstract
<h4>Background: </h4> Disordered lipid metabolism is a novel hallmark of cancer initiation. However, the role of lipid metabolism-associated genes (LAGs) in the immune microenvironment, the prognosis, and the overall survival of lung squamous cell carcinoma (LUSC) remain unclear. <h4>Methods: </h4> This study examined 1064 LAGs in 502 LUSC tumors and 49 normal lung tissues from the Cancer Genome Atlas lung squamous cell carcinoma (TCGA-LUSC) cohort. Using univariate, least absolute shrinkage and selection operator (LASSO), and multivariate Cox regression analysis, a LAG-based gene signature was constructed for predicting the overall survival of patients with LUSC from the TCGA training-set. The predictive power of the gene signature was validated using the TCGA-internal validation cohort and six independent cohorts ( GSE73403, GSE74777, GSE157009, GSE157010, GSE157011, and GSE67061), obtained from the Gene Expression Omnibus (GEO) database.The prognosis was determined using a Kaplan-Meier analysis. The immunological aspects were examined using CIBERSORT, gene set enrichment analysis (GSEA), and tumor immune dysfunction and exclusion (TIDE) analysis. The Human Protein Atlas (HPA) database was utilized to validate the protein expression of the gene signature between LUSC tissues and normal lung tissues via immunohistochemistry staining (IHC) and Immunofluorescent . The expression of the gene signature was also assessed in various lung cancer-associated cell lines using HPA database. In addition, candidate small-molecule therapeutics for treating LUSC, were also identified using the connectivity Map (CMap) database. <h4>Results: </h4> A total of 112 lipid metabolism-associated DEGs (LADEGs) were detected in LUSC. A six-LAG-based prognostic signature ( ALOX15B, CYP24A1, PPP2R2C, PTGIS, SPTSSB, and UGT2B17) was successfully constructed and validated to predict the prognosis of LUSC patients. Functional analysis suggested that the LAGs were significantly enriched in arachidonic acid metabolism, ether lipid metabolism, metabolism of xenobiotics by cytochrome P450 , glycerophospholipid metabolism, steroid hormone biosynthesis, the fatty acid metabolic process, oxidoreductase activity, and PPAR signaling pathways. Furthermore, we determined that the six-gene signature was an independent risk factor. The prognostic model was closely related to immune cell infiltration. The expression of SPTSSB was low in high-risk patients, while ALOX15B, CYP24A1, PPP2R2C, PTGIS , and UGT2B17 were higher in high-risk patients than in low-risk ones. Identical outcomes were seen in the HPA database. In addition, the model showed that the high-risk score group had a worse overall survival (OS), and the validated cohorts showed the same result. Moreover, the prognostic signature of six LAGs predicted overall survival more accurately than conventional clinical characteristics.Based on the CMap dataset, small-molecule drugs exhibiting anticancer properties could be potential therapeutic therapies for LUSC patients. <h4>Conclusions: </h4> This study demonstrated, for the first time, that LAG expression plays a crucial role in LUSC. Furthermore, this high-efficiency six-gene LAG prognostic signature could serve as a predictive model to separate LUSC patients into high- and low-risk groups and potentially facilitate risk-stratified immunotherapy in LUSC patients. In addition, a number of small molecule drugs with significant therapeutic potential for LUSC patients were found.
Epithelial organoids derived from intestinal tissue, called enteroids, recapitulate many aspects of the organ in vitro and can be used for biological discovery, personalized medicine, and drug development. Here, we interrogated the cell signaling environment within the developing human intestine to identify niche cues that may be important for epithelial development and homeostasis. We identified an EGF family member, EPIREGULIN (EREG), which is robustly expressed in the developing human crypt. Enteroids generated from the developing human intestine grown in standard culture conditions, which contain EGF, are dominated by stem and progenitor cells and feature little differentiation and no spatial organization. Our results demonstrate that EREG can replace EGF in vitro, and EREG leads to spatially resolved enteroids that feature budded and proliferative crypt domains and a differentiated villus-like central lumen. Multiomic (transcriptome plus epigenome) profiling of native crypts, EGF-grown enteroids, and EREG-grown enteroids showed that EGF enteroids have an altered chromatin landscape that is dependent on EGF concentration, downregulate the master intestinal transcription factor CDX2, and ectopically express stomach genes, a phenomenon that is reversible. This is in contrast to EREG-grown enteroids, which remain intestine like in culture. Thus, EREG creates a homeostatic intestinal niche in vitro, enabling interrogation of stem cell function, cellular differentiation, and disease modeling.
Also flagged:Osteosarcomamalignant tumor of the boneOSbone tumorbonedoxorubicin
Journal Article2023-03-22No SnippetsShi P, Cheng Z, Zhao K, Chen Y, Zhang A, Gan W, Zhang Y.
Show Full Abstract
Osteosarcoma, the most common malignant tumor of the bone, seriously influences people's lives and increases their economic burden. Conventional chemotherapy drugs achieve limited therapeutic effects owing to poor targeting and severe systemic toxicity. Nanocarrier-based drug delivery systems can significantly enhance the utilization efficiency of chemotherapeutic drugs through targeting ligand modifications and reduce the occurrence of systemic adverse effects. A variety of ligand-modified nano-drug delivery systems have been developed for different targeting schemes. Here we review the biological characteristics and the main challenges of current drug therapy of OS, and further elaborate on different targeting schemes and ligand selection for nano-drug delivery systems of osteosarcoma, which may provide new horizons for the development of advanced targeted drug delivery systems in the future.
Also flagged:CohesinATPasechromosomegene expressionCohesinopathiesdevelopmental disorders
Journal Article2023-03-22✓ 1 SnippetMfarej MG, Hyland CA, Sanchez AC, Falk MM, Iovine MK, Skibbens RV.
In-Text Gene Mentions
Introduction)
…Condensinsare closely related…
Show Full Abstract
Cohesins are ATPase complexes that play central roles in cellular processes such as chromosome division, DNA repair, and gene expression. Cohesinopathies arise from mutations in cohesin proteins or cohesin complex regulators and encompass a family of related developmental disorders that present with a range of severe birth defects, affect many different physiological systems, and often lead to embryonic fatality. Treatments for cohesinopathies are limited, in large part due to the lack of understanding of cohesin biology. Thus, characterizing the signaling networks that lie upstream and downstream of cohesin-dependent pathways remains clinically relevant. Here, we highlight alterations in cohesins and cohesin regulators that result in cohesinopathies, with a focus on cardiac defects. In addition, we suggest a novel and more unifying view regarding the mechanisms through which cohesinopathy-based heart defects may arise.
<h4>Background</h4>Non-invasive tests are widely used to diagnose fibrosis in patients with non-alcoholic fatty liver disease (NAFLD), however, the optimal method remains unclear. We compared the accuracy of simple serum models, a serum model incorporating direct measures of fibrogenesis (Hepascore), and Fibroscan®, for detecting fibrosis in NAFLD.<h4>Methods</h4>NAFLD patients undergoing liver biopsy were evaluated with Hepascore, NAFLD Fibrosis Score (NFS), FIB-4 and AST-platelet ratio index (APRI), with a subset (n = 131) undergoing Fibroscan®. Fibrosis on liver biopsy was categorized as advanced (F3-4) or cirrhosis (F4). Accuracy was determined by area under receiving operating characteristic curves (AUC). Indeterminate ranges were calculated using published cut-offs.<h4>Results</h4>In 271 NAFLD patients, 83 (31%) had F3-4 and 47 (17%) cirrhosis. 6/131 (4%) had an unreliable Fibroscan®. For the detection of advanced fibrosis, the accuracy of Hepascore (AUC 0.88) was higher than FIB-4 (0.73), NFS (0.72) and APRI (0.69) (p < 0.001 for all). Hepascore had similar accuracy to Fibroscan® (0.80) overall, but higher accuracy in obese individuals (0.91 vs 0.80, p = 0.001). Hepascore more accurately identified patients with cirrhosis than APRI (AUC 0.85 vs 0.71, p = 0.01) and NFS (AUC 0.73, p = 0.01) but performed similar to FIB-4 and Fibroscan®. For the determination of F3-4, the proportion of patients in indeterminate area was lower for Hepascore (4.8%), compared to FIB-4 (42%), NFS (36%) and APRI (44%) (p < 0.001 for all).<h4>Conclusions</h4>Hepascore has greater accuracy and a lower indeterminate range than simple serum fibrosis tests for advanced fibrosis in NAFLD, and greater accuracy than Fibroscan® in obese individuals.
Also flagged:Aβfibrilsarcomapolyglutaminefibril formationAmyloid beta
Journal Article2023-03-22No SnippetsChakraborty D, Straub JE, Thirumalai D.
Show Full Abstract
The transition from a disordered to an assembly-competent monomeric state (N*) in amyloidogenic sequences is a crucial event in the aggregation cascade. Using a well-calibrated model for intrinsically disordered proteins (IDPs), we show that the N* states, which bear considerable resemblance to the polymorphic fibril structures found in experiments, not only appear as excitations in the free energy landscapes of Aβ40 and Aβ42, but also initiate the aggregation cascade. For Aβ42, the transitions to the different N* states are in accord with Ostwald's rule of stages, with the least stable structures forming ahead of thermodynamically favored ones. The Aβ40 and Aβ42 monomer landscapes exhibit different extents of local frustration, which we show have profound implications in dictating subsequent self-assembly. Using kinetic transition networks, we illustrate that the most favored dimerization routes proceed via N* states. We argue that Ostwald's rule also holds for the aggregation of fused in sarcoma and polyglutamine proteins.
Also flagged:nucleosidesbrain dysfunctioncancerdiabetesmitochondrial diseasesprotein synthesis
Journal Article2023-03-22✓ 1 SnippetMurakami Y, Wei FY, Kawamura Y, Horiguchi H, Kadomatsu T, Miyata K, Miura K, Oike Y, Ando Y, Ueda M, Tomizawa K, Chujo T.
In-Text Gene Mentions
Introduction)
…example, mice lackingCdk5rap1, which encodes…
Show Full Abstract
In mammalian mitochondria, translation of the AUA codon is supported by 5-formylcytidine (f<sup>5</sup>C) modification in the mitochondrial methionine tRNA anticodon. The 5-formylation is initiated by NSUN3 methylase. Human NSUN3 mutations are associated with mitochondrial diseases. Here we show that Nsun3 is essential for embryonic development in mice with whole-body Nsun3 knockout embryos dying between E10.5 and E12.5. To determine the functions of NSUN3 in adult tissue, we generated heart-specific Nsun3 knockout (Nsun3<sup>HKO</sup>) mice. Nsun3<sup>HKO</sup> heart mitochondria were enlarged and contained fragmented cristae. Nsun3<sup>HKO</sup> resulted in enhanced heart contraction and age-associated mild heart enlargement. In the Nsun3<sup>HKO</sup> hearts, mitochondrial mRNAs that encode respiratory complex subunits were not down regulated, but the enzymatic activities of the respiratory complexes decreased, especially in older mice. Our study emphasizes that mitochondrial tRNA anticodon modification is essential for mammalian embryonic development and shows that tissue-specific loss of a single mitochondrial tRNA modification can induce tissue aberration that worsens in later adulthood.
Also flagged:neurodegenerative diseasepolyglutamineHDpeptidesextracellularneurogenesis
Journal Article2023-03-22✓ 5 SnippetsTshilenge KT, Aguirre CG, Bons J, Gerencser AA, Basisty N, Song S, Rose J, Lopez-Ramirez A, Naphade S, Loureiro A, Battistoni E, Milani M, Wehrfritz C, Holtz A, Hetz C, Mooney SD, Schilling B, Ellerby LM.
In-Text Gene Mentions
Abstract)
…Although HTT is expressed in different tissues, the medium-spiny projection neurons (MSNs) in the striatum are particularly vulnerable in HD.…
Abstract)
…Huntington’s disease (HD) is a neurodegenerative disease caused by a CAG repeat expansion in the Huntingtin (HTT) gene.…
S I O 001029)
…Huntington’s disease (HD) is a rare progressive monogenic neurological disorder caused by a trinucleotide repeat expansion in exon-1 of the Huntingtin gene (HTT) (1, 2, 3).…
S I O 001029)
…HD phenotypes are linked to the expression of mutant HTT protein (mHTT) that harbors expanded glutamine stretches (over 38) in the N-terminal region.…
Abstract)
…function of theHTTprotein.…
Show Full Abstract
Huntington's disease (HD) is a neurodegenerative disease caused by a CAG repeat expansion in the Huntingtin (HTT) gene. The resulting polyglutamine (polyQ) tract alters the function of the HTT protein. Although HTT is expressed in different tissues, the medium-spiny projection neurons (MSNs) in the striatum are particularly vulnerable in HD. Thus, we sought to define the proteome of human HD patient-derived MSNs. We differentiated HD72-induced pluripotent stem cells and isogenic controls into MSNs and carried out quantitative proteomic analysis. Using data-dependent acquisitions with FAIMS for label-free quantification on the Orbitrap Lumos mass spectrometer, we identified 6323 proteins with at least two unique peptides. Of these, 901 proteins were altered significantly more in the HD72-MSNs than in isogenic controls. Functional enrichment analysis of upregulated proteins demonstrated extracellular matrix and DNA signaling (DNA replication pathway, double-strand break repair, G1/S transition) with the highest significance. Conversely, processes associated with the downregulated proteins included neurogenesis-axogenesis, the brain-derived neurotrophic factor-signaling pathway, Ephrin-A:EphA pathway, regulation of synaptic plasticity, triglyceride homeostasis cholesterol, plasmid lipoprotein particle immune response, interferon-γ signaling, immune system major histocompatibility complex, lipid metabolism, and cellular response to stimulus. Moreover, proteins involved in the formation and maintenance of axons, dendrites, and synapses (e.g., septin protein members) were dysregulated in HD72-MSNs. Importantly, lipid metabolism pathways were altered, and using quantitative image analysis, we found that lipid droplets accumulated in the HD72-MSN, suggesting a deficit in the turnover of lipids possibly through lipophagy. Our proteomics analysis of HD72-MSNs identified relevant pathways that are altered in MSNs and confirm current and new therapeutic targets for HD.
Also flagged:cancercomplexgenetic diseasegenetic diseasesCFTRcystic fibrosis
Journal Article2023-03-22✓ 1 SnippetGhoussaini M, Nelson MR, Dunham I.
In-Text Gene Mentions
Introduction)
…Examples include mutations in the CFTR gene in cystic fibrosis, in the beta-globin gene in sickle cell anemia, and in Huntington gene HTT in Huntington’s disease.…
Show Full Abstract
Evidence from human genetics supporting the therapeutic hypothesis increases the likelihood that a drug will succeed in clinical trials. Rare and common disease genetics yield a wide array of alleles with a range of effect sizes that can proxy for the effect of a drug in disease. Recent advances in large scale population collections and whole genome sequencing approaches have provided a rich resource of human genetic evidence to support drug target selection. As the range of phenotypes profiled increases and ever more alleles are discovered across world-wide populations, these approaches will increasingly influence multiple stages across the lifespan of a drug discovery programme.
Journal Article2023-03-22✓ 1 SnippetDe Simone G, Varricchio R, Ruberto TF, di Masi A, Ascenzi P.
In-Text Gene Mentions
Introduction)
…itary hemochromatosis factor (HFE); the upper part…
Show Full Abstract
Heme is the reactive center of several metal-based proteins that are involved in multiple biological processes. However, free heme, defined as the labile heme pool, has toxic properties that are derived from its hydrophobic nature and the Fe-atom. Therefore, the heme concentration must be tightly controlled to maintain cellular homeostasis and to avoid pathological conditions. Therefore, different systems have been developed to scavenge either Hb (i.e., haptoglobin (Hp)) or the free heme (i.e., high-density lipoproteins (HDL), low-density lipoproteins (LDL), hemopexin (Hx), and human serum albumin (HSA)). In the first seconds after heme appearance in the plasma, more than 80% of the heme binds to HDL and LDL, and only the remaining 20% binds to Hx and HSA. Then, HSA slowly removes most of the heme from HDL and LDL, and finally, heme transits to Hx, which releases it into hepatic parenchymal cells. The Hx:heme or HSA:heme complexes are internalized via endocytosis mediated by the CD91 and CD71 receptors, respectively. As heme constitutes a major iron source for pathogens, bacteria have evolved hemophores that can extract and uptake heme from host proteins, including HSA:heme. Here, the molecular mechanisms underlying heme scavenging and delivery from HSA are reviewed. Moreover, the relevance of HSA in disease states associated with increased heme plasma concentrations are discussed.
Also flagged:HTR1ATPH2Tryptophan CatabolitesHepatitis CInterferon-α2aserotonin
Journal Article2023-03-22✓ 5 SnippetsPawlowski T, Malyszczak K, Pawlak D, Inglot M, Zalewska M, Grzywacz A, Radkowski M, Laskus T, Janocha-Litwin J, Frydecka D.
In-Text Gene Mentions
Abstract)
…Background: Seeing that there are no data about associations between serotonin gene polymorphism and tryptophan catabolite concentration during PEG-IFN-α2a treatment, the aim of the current study is to examine (a) the associations between polymorphisms within the HTR1A, TPH2, and 5-HTT genes and the severity of depression symptoms and (b) the relationships among rs6295, rs4570625, and 5-HTTLPR rs25531polymorphisms and indoleamine 2,3-dioxygenase (IDO) activity, as well as kynurenine (KYN), tryptophan (TRP), kynurenic acid (KA), and anthranilic acid (AA) concentrations.…
…polymorphism of the5-HTTgene transcription initiation…
Methods)
…TPH2 gene, and5-HTTgene polymorphisms were…
Show Full Abstract
<h4>Background</h4>Seeing that there are no data about associations between serotonin gene polymorphism and tryptophan catabolite concentration during PEG-IFN-α2a treatment, the aim of the current study is to examine (a) the associations between polymorphisms within the HTR1A, TPH2, and 5-HTT genes and the severity of depression symptoms and (b) the relationships among rs6295, rs4570625, and 5-HTTLPR rs25531polymorphisms and indoleamine 2,3-dioxygenase (IDO) activity, as well as kynurenine (KYN), tryptophan (TRP), kynurenic acid (KA), and anthranilic acid (AA) concentrations.<h4>Materials and methods</h4>The study followed a prospective, longitudinal, single-center cohort design. The severity of the depressive symptoms of 101 adult patients with chronic HCV infections was measured during PEG-IFN-α2a/RBV treatment. We used the Montgomery-Åsberg Depression Rating Scale (MADRS) to assess the severity of depressive symptoms. The subjects were evaluated six times-at baseline and at weeks 2, 4, 8, 12, and 24. At all the time points, MADRS score, as well as KYN, TRP, KA, and AA concentrations, and IDO activity were measured. At baseline, rs6295, rs4570625, and 5-HTTLPR rs25531polymorphisms were assessed.<h4>Results</h4>Subjects with C/C genotypes of 5-HT1A and lower-expressing alleles (S/S, L<sub>G</sub>/L<sub>G</sub>, and S/L<sub>G</sub>) of 5-HTTLPR scored the highest total MADRS scores and recorded the highest increase in MADRS scores during treatment. We found associations between TRP concentrations and the TPH-2 and 5-HTTLPR rs25531 genotypes.<h4>Conclusions</h4>Our findings provide new data that we believe can help better understand infection-induced depression as a distinct type of depression.
Also flagged:Glycosphingolipidneurodegenerative disorderspolyglutaminesphingolipidsmyelin sheathsmyelination
Journal Article2023-03-22✓ 4 SnippetsPepe G, Lenzi P, Capocci L, Marracino F, Pizzati L, Scarselli P, Di Pardo A, Fornai F, Maglione V.
In-Text Gene Mentions
Abstract)
…region of huntingtin (Htt).…
Abstract)
…toxicity of mutantHttin different HD…
Introduction)
…region of huntingtin (Htt), a ubiquitous protein…
Introduction)
…stretch endows mutantHtt(mHtt) with toxic…
Show Full Abstract
Huntington's disease is one of the most common dominantly inherited neurodegenerative disorders caused by an expansion of a polyglutamine (polyQ) stretch in the N-terminal region of huntingtin (Htt). Among all the molecular mechanisms, affected by the mutation, emerging evidence proposes glycosphingolipid dysfunction as one of the major determinants. High levels of sphingolipids have been found to localize in the myelin sheaths of oligodendrocytes, where they play an important role in myelination stability and functions. In this study, we investigated any potential existing link between sphingolipid modulation and myelin structure by performing both ultrastructural and biochemical analyses. Our findings demonstrated that the treatment with the glycosphingolipid modulator THI preserved myelin thickness and the overall structure and reduced both area and diameter of pathologically giant axons in the striatum of HD mice. These ultrastructural findings were associated with restoration of different myelin marker protein, such as myelin-associated glycoprotein (MAG), myelin basic protein (MBP) and 2', 3' Cyclic Nucleotide 3'-Phosphodiesterase (CNP). Interestingly, the compound modulated the expression of glycosphingolipid biosynthetic enzymes and increased levels of GM1, whose elevation has been extensively reported to be associated with reduced toxicity of mutant Htt in different HD pre-clinical models. Our study further supports the evidence that the metabolism of glycosphingolipids may represent an effective therapeutic target for the disease.
Also flagged:nicotinecellgene expressionlung canceraxonalNRF2
Journal Article2023-03-22✓ 1 SnippetTellez CS, Grimes MJ, Juri DE, Do K, Willink R, Dye WW, Wu G, Picchi MA, Belinsky SA.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
<h4>Objectives</h4>E-cigarettes are the most commonly used nicotine containing products among youth. In vitro studies support the potential for e-cigarettes to cause cellular stress in vivo; however, there have been no studies to address whether exposure to e-liquid aerosols can induce cell transformation, a process strongly associated with pre-malignancy. We examined whether weekly exposure of human bronchial epithelial cell (HBEC) lines to e-cigarette aerosols would induce transformation and concomitant changes in gene expression and promoter hypermethylation.<h4>Materials and methods</h4>An aerosol delivery system exposed three HBEC lines to unflavored e-liquid with 1.2% nicotine, 3 flavored products with nicotine, or the Kentucky reference cigarette once a week for 12 weeks. Colony formation in soft agar, RNA-sequencing, and the EPIC Beadchip were used to evaluate transformation, genome-wide expression and methylation changes.<h4>Results</h4>Jamestown e-liquid aerosol induced transformation of HBEC2 and HBEC26, while unflavored and Blue Pucker transformed HBEC26. Cigarette smoke aerosol transformed HBEC4 and HBEC26 at efficiencies up to 3-fold greater than e-liquids. Transformed clones exhibited extensive reprogramming of the transcriptome with common and distinct gene expression changes observed between the cigarette and e-liquids. Transformation by e-liquids induced alterations in canonical pathways implicated in lung cancer that included axonal guidance and NRF2. Gene methylation, while prominent in cigarette-induced transformed clones, also affected hundreds of genes in HBEC2 transformed by Jamestown. Many genes with altered expression or epigenetic-mediated silencing were also affected in lung tumors from smokers.<h4>Conclusions</h4>These studies show that exposure to e-liquid aerosols can induce a pre-malignant phenotype in lung epithelial cells. While the Food and Drug Administration banned the sale of flavored cartridge-based electric cigarettes, consumers switched to using flavored products through other devices. Our findings clearly support expanding studies to evaluate transformation potency for the major categories of e-liquid flavors to better inform risk from these complex mixtures.
Also flagged:epithelial-mesenchymal transitionpituitary adenomasPituitary Neuroendocrine TumorsNFtumorssomatostatin receptors
Journal Article2023-03-22✓ 5 SnippetsGil J, Marques-Pamies M, Valassi E, Serra G, Salinas I, Xifra G, Casano-Sancho P, Carrato C, Biagetti B, Sesmilo G, Marcos-Ruiz J, Rodriguez-Lloveras H, Rueda-Pujol A, Aulinas A, Blanco A, Hostalot C, Simó-Servat A, Muñoz F, Rico M, Ibáñez-Domínguez J, Cordero E, Webb SM, Jordà M, Puig-Domingo M.
In-Text Gene Mentions
Abstract)
…In addition, PEBP1 could be an informative biomarker of tumor regrowth, useful for predictive medicine in NF-PitNET.…
Discussion)
…Moreover, drugs specifically designed to target KLK10 and PEBP1 would be welcome, and would be useful for pituitary tumors currently lacking an efficient medical treatment.…
Results)
…We investigated the ability of these markers in predicting recurrence in NF-PitNETs (Table 4), and found that only PEBP1 showed a difference between tumors that recurred and tumors that did not (p=0.036) (Figure 3A).…
Discussion)
…Finally, we also found that recurrent tumors expressed higher levels of PEBP1. PEBP1, also known as RKIP, is considered a metastasis suppressor gene (45, 57).…
S I O 001029)
…(A) Relative expression of PEBP1 in NF-PitNETs in tumors that recurred vs. tumors that did not.…
Show Full Abstract
<h4>Introduction</h4>Different medical therapies have been developed for pituitary adenomas. However, Non-Functioning Pituitary Neuroendocrine Tumors (NF-PitNET) have shown little response to them. Furthermore, epithelial-mesenchymal transition (EMT) has been linked to resistance to medical treatment in a significant number of tumors, including pituitary adenomas.<h4>Methods</h4>We aimed to evaluate the expression of EMT-related markers in 72 NF-PitNET and 16 non-tumoral pituitaries. To further explore the potential usefulness of medical treatment for NF-PitNET we assessed the expression of somatostatin receptors and dopamine-associated genes.<h4>Results</h4>We found that <i>SNAI1, SNAI2</i>, Vimentin, <i>KLK10, PEBP1</i>, Ki-67 and <i>SSTR2</i> were associated with invasive NF-PitNET. Furthermore, we found that the EMT phenomenon was more common in NF-PitNET than in GH-secreting pituitary tumors. Interestingly, <i>PEBP1</i> was overexpressed in recurrent NF-PitNET, and could predict growth recurrence with 100% sensitivity but only 43% specificity. In parallel with previously reported studies, <i>SSTR3</i> is highly expressed in our NF-PitNET cohort. However, <i>SSTR3</i> expression is highly heterogeneous among the different histological variants of NF-PitNET with very low levels in silent corticotroph adenomas.<h4>Conclusion</h4>NF-PitNET showed an enhanced EMT phenomenon. <i>SSTR3</i> targeting could be a good therapeutic candidate in NF-PitNET except for silent corticotroph adenomas, which express very low levels of this receptor. In addition, <i>PEBP1</i> could be an informative biomarker of tumor regrowth, useful for predictive medicine in NF-PitNET.
Also flagged:SUMOylationAcquired brain injurynervouspost-translational modificationsignal transductionbrain injury
Journal Article2023-03-22✓ 1 SnippetLuo P, Li L, Huang J, Mao D, Lou S, Ruan J, Chen J, Tang R, Shi Y, Zhou S, Yang H.
In-Text Gene Mentions
Introduction)
…abnormal accumulation ofHTTprotein, leading to…
Show Full Abstract
Acquired brain injury (ABI) is the most common disease of the nervous system, involving complex pathological processes, which often leads to a series of nervous system disorders. The structural destruction and dysfunction of the Neurovascular Unit (NVU) are prominent features of ABI. Therefore, understanding the molecular mechanism underlying NVU destruction and its reconstruction is the key to the treatment of ABI. SUMOylation is a protein post-translational modification (PTM), which can degrade and stabilize the substrate dynamically, thus playing an important role in regulating protein expression and biological signal transduction. Understanding the regulatory mechanism of SUMOylation can clarify the molecular mechanism of the occurrence and development of neurovascular dysfunction after ABI and is expected to provide a theoretical basis for the development of potential treatment strategies. This article reviews the role of SUMOylation in vascular events related to ABI, including NVU dysfunction and vascular remodeling, and puts forward therapeutic prospects.
<h4>Introduction</h4>The manifestations of cardiac metastases are extremely variable depending on their location and extension.<h4>Case presentation</h4>A 62-year-old man was admitted to the cardiac emergency department presenting with chest pain, worsening shortness of breath and palpitations. He had a history of esophageal squamous cell carcinoma treated with chemoradiotherapy, and he was not diagnosed with cardiovascular disease before. The electrocardiogram showed significant ST-segment elevations in leads II, III, and aVF. Initially, the patient was diagnosed with ST-segment elevation myocardial infarction. A cardiac point-of-care ultrasound was performed immediately revealing two large heterogeneous masses in the left ventricular wall and the apex, which changed the diagnosis and the management strategy. There was no significant change in serial cardiac biomarkers in the setting of persistent STE. Thoracic computed tomography and cardiac magnetic resonance confirmed that the patient was suffering from cardiac and lung metastases.<h4>Conclusion</h4>ECG findings of localized and prolonged STE without Q waves or changes in biomarkers may suggest myocardial tumor invasion, especially in the cancer setting. Cardiac point-of-care ultrasound is an effective, convenient, noninvasive imaging modality to guide real-time clinical decision-making.
Also flagged:rheumatoid arthritisRAmembraneTumor necrosis factor alphaTNFαIL-6
Journal Article2023-03-22✓ 1 SnippetGremese E, Tolusso B, Bruno D, Perniola S, Ferraccioli G, Alivernini S.
In-Text Gene Mentions
Introduction)
…gene encoding anSH2 domain of ζ-associated protein 70domain of ζ-associated…
Show Full Abstract
Despite the relevant advances in our understanding of the pathogenetic mechanisms regulating inflammation in rheumatoid arthritis (RA) and the development of effective therapeutics, to date, there is still a proportion of patients with RA who do not respond to treatment and end up progressing toward the development of joint damage, extra-articular complications, and disability. This is mainly due to the inter-individual heterogeneity of the molecular and cellular taxonomy of the synovial membrane, which represents the target tissue of RA inflammation. Tumor necrosis factor alpha (TNFα) and interleukin-6 (IL-6) are crucial key players in RA pathogenesis fueling the inflammatory cascade, as supported by experimental evidence derived from <i>in vivo</i> animal models and the effectiveness of biologic-Disease Modifying Anti-Rheumatic Drugs (b-DMARDs) in patients with RA. However, additional inflammatory soluble mediators such as IL-8 and IL-17 exert their pathogenetic actions promoting the detrimental activation of immune and stromal cells in RA synovial membrane, tendons, and extra-articular sites, as well as blood vessels and lungs, causing extra-articular complications, which might be excluded by the action of anti-TNFα and anti-IL6R targeted therapies. In this narrative review, we will discuss the role of IL-8 and IL-17 in promoting inflammation in multiple biological compartments (i.e., synovial membrane, blood vessels, and lung, respectively) in animal models of arthritis and patients with RA and how their selective targeting could improve the management of treatment resistance in patients.
<b>Purpose:</b> Prolyl 4-hydroxylase subunit alpha 3 (<i>P4HA3</i>) is implicated in several cancers' development. However, <i>P4HA3</i> has not been reported in other cancers, and the exact mechanism of action is currently unknown. <b>Materials and methods:</b> First, the expression profile of <i>P4HA3</i> was analyzed using a combination of the University of California Santa Cruz (UCSC) database, Cancer Cell Line Encyclopedia (CCLE) database, and Genotype-Tissue Expression (GTEx) database. UniCox and Kaplan-Meier were used to analyze the predictive value of <i>P4HA3</i>. The expression of <i>P4HA3</i> was analyzed in clinical staging, immune subtypes, and Molecular subtypes. Secondly, the correlation of <i>P4HA3</i> with immunomodulatory genes, immune checkpoint genes, RNA modification genes, immune cell infiltration, cancer-related functional status, tumor stemness index, DNA mismatch repair (MMR) genes and DNA Methyltransferase was examined. The role of <i>P4HA3</i> in DNA methylation, copy number variation (CNV), mutational status, tumor mutational burden (TMB), and microsatellite instability (MSI) was also analyzed. In addition, gene set enrichment analysis (GSEA) was used to explore the potential functional mechanisms of <i>P4HA3</i> in pan-cancer. Finally, <i>P4HA3</i>-related drugs were searched in CellMiner, Genomics of Drug Sensitivity in Cancer (GDSC), and Cancer Therapeutics Response Portal (CTRP) databases. <b>Results</b>: <i>P4HA3</i> is significantly overexpressed in most cancers and is associated with poor prognosis. <i>P4HA3</i> is strongly associated with clinical cancer stage, immune subtypes, molecular subtypes, immune regulatory genes, immune checkpoint genes, RNA modifier genes, immune cell infiltration, cancer-related functional status, tumor stemness index, MMR Gene, DNA Methyltransferase, DNA methylation, CNV, mutational status, TMB, and MSI are closely related. Available enrichment analysis revealed that <i>P4HA3</i> is associated with the epithelial-mesenchymal transition and immune-related pathways. There are currently 20 drugs associated with <i>P4HA3</i>. <b>Conclusion</b>: In human pan-cancer, <i>P4HA3</i> is associated with poor patient prognosis and multiple immune cells and may be a novel immunotherapeutic target. It may act on tumor progression through the epithelial-mesenchymal transition (EMT) pathway.
Also flagged:carbohydratemetabolisminflammatory responsesCOXfatty aciddigestion
Journal Article2023-03-22✓ 1 SnippetYang C, Ding Y, Dan X, Shi Y, Kang X.
In-Text Gene Mentions
Results)
…green), which wereDDX27, BRIX1, FTSJ3, BMS1,…
Show Full Abstract
The regulatory axis plays a vital role in interpreting the information exchange and interactions among mammal organs. In this study on feed efficiency, it was hypothesized that a rumen-liver-muscle-fat (<b>RLMF</b>) regulatory axis exists and scrutinized the flow of energy along the <b>RLMF</b> axis employing consensus network analysis from a spatial transcriptomic standpoint. Based on enrichment analysis and protein-protein interaction analysis of the consensus network and tissue-specific genes, it was discovered that carbohydrate metabolism, energy metabolism, immune and inflammatory responses were likely to be the biological processes that contribute most to feed efficiency variation on the <b>RLMF</b> regulatory axis. In addition, clusters of genes related to the electron respiratory chain, including <i>ND (2,3,4,4L,5,6), NDUF (A13, A7, S6, B3, B6), COX (1,3), CYTB, UQCR11, ATP (6,8)</i>, clusters of genes related to fatty acid metabolism including <i>APO (A1, A2, A4, B, C3), ALB, FG (A, G)</i>, as well as clusters of the ribosomal-related gene including <i>RPL (8,18A,18,15,13, P1)</i>, the <i>RPS (23,27A,3A,4X)</i>, and the <i>PSM (A1-A7, B6, C1, C3, D2-D4, D8 D9, E1)</i> could be the primary effector genes responsible for feed efficiency variation. The findings demonstrate that high feed efficiency cattle, through the synergistic action of the regulatory axis <b>RLMF</b>, may improve the efficiency of biological processes (carbohydrate metabolism, protein ubiquitination, and energy metabolism). Meanwhile, high feed efficiency cattle might enhance the ability to respond to immunity and inflammation, allowing nutrients to be efficiently distributed across these organs associated with digestion and absorption, energy-producing, and energy-storing organs. Elucidating the distribution of nutrients on the <b>RLMF</b> regulatory axis could facilitate an understanding of feed efficiency variation and achieve the study on its molecular regulation.
Also flagged:medulloblastomacancersliposarcomamethylationcancertumor
Journal Article2023-03-22✓ 1 SnippetRausch T, Snajder R, Leger A, Simovic M, Giurgiu M, Villacorta L, Henssen AG, Fröhling S, Stegle O, Birney E, Bonder MJ, Ernst A, Korbel JO.
In-Text Gene Mentions
Text
…PCDH17…
Show Full Abstract
Cancer genomes harbor a broad spectrum of structural variants (SVs) driving tumorigenesis, a relevant subset of which escape discovery using short-read sequencing. We employed Oxford Nanopore Technologies (ONT) long-read sequencing in a paired diagnostic and post-therapy medulloblastoma to unravel the haplotype-resolved somatic genetic and epigenetic landscape. We assembled complex rearrangements, including a 1.55-Mbp chromothripsis event, and we uncover a complex SV pattern termed templated insertion (TI) thread, characterized by short (mostly <1 kb) insertions showing prevalent self-concatenation into highly amplified structures of up to 50 kbp in size. TI threads occur in 3% of cancers, with a prevalence up to 74% in liposarcoma, and frequent colocalization with chromothripsis. We also perform long-read-based methylome profiling and discover allele-specific methylation (ASM) effects, complex rearrangements exhibiting differential methylation, and differential promoter methylation in cancer-driver genes. Our study shows the advantage of long-read sequencing in the discovery and characterization of complex somatic rearrangements.
Also flagged:substance use disordersaddictionalcoholcannabis use disorderopioid use disorderdopamine
Journal Article2023-03-22✓ 2 SnippetsHatoum AS, Colbert SMC, Johnson EC, Huggett SB, Deak JD, Pathak G, Jennings MV, Paul SE, Karcher NR, Hansen I, Baranger DAA, Edwards A, Grotzinger A, Substance Use Disorder Working Group of the Psychiatric Genomics Consortium, Tucker-Drob EM, Kranzler HR, Davis LK, Sanchez-Roige S, Polimanti R, Gelernter J, Edenberg HJ, Bogdan R, Agrawal A.
In-Text Gene Mentions
Text
…VRK2…
Text
…CDK5RAP1…
Show Full Abstract
Genetic liability to substance use disorders can be parsed into loci that confer general or substance-specific addiction risk. We report a multivariate genome-wide association meta-analysis that disaggregates general and substance-specific loci for published summary statistics of problematic alcohol use, problematic tobacco use, cannabis use disorder, and opioid use disorder in a sample of <b>1,025,550</b> individuals of European descent and <b>92,630 individuals of</b> African descent. Nineteen independent SNPs were genome-wide significant (<i>P</i> < 5e-8) for the general addiction risk factor (<i>addiction-rf</i>), which showed high polygenicity. Across ancestries, <i>PDE4B</i> was significant (among other genes), suggesting dopamine regulation as a cross-substance vulnerability. An <i>addiction-rf</i> polygenic risk score was associated with substance use disorders, psychopathologies, somatic conditions, and environments associated with the onset of addictions. Substance-specific loci (9 for alcohol, 32 for tobacco, 5 for cannabis, 1 for opioids) included metabolic and receptor genes. These findings provide insight into genetic risk loci for substance use disorders that could be leveraged as treatment targets.
Also flagged:colorectal cancercancercancerscolorectal cancersHbanxiety
Journal Article2023-03-21No SnippetsJenkins C, Woods F, Chandler S, Carter K, Jenkins R, Cunningham A, Nelson K, Still R, Walters JA, Gwynn N, Chea W, Harford R, O'Neill C, Hepburn J, Hill I, Wilkes H, Fegan G, Dunstan P, Harris DA.
Show Full Abstract
<h4>Background</h4>The majority of colorectal cancers (CRCs) are detected after symptomatic presentation to primary care. Given the shared symptoms of CRC and benign disorders, it is challenging to manage the risk of missed diagnosis. Colonoscopy resources cannot keep pace with increasing demand. There is a pressing need for access to simple triage tools in primary care to help prioritise patients for referral.<h4>Aim</h4>To evaluate the performance of a novel spectroscopy-based CRC blood test in primary care.<h4>Design & setting</h4>Mixed-methods pilot study of test performance and GP focus group discussions in South Wales.<h4>Method</h4>Patients on the urgent suspected cancer (USC) pathway were recruited for the Raman spectroscopy (RS) test coupled to machine learning classification ('Raman-CRC') to identify CRC within the referred population. Qualitative focus group work evaluated the acceptability of the test in primary care by thematic analysis of focus group theorising.<h4>Results</h4>A total of 532 patients aged ≥50 years referred on the USC pathway were recruited from 27 GP practices. Twenty-nine patients (5.0%) were diagnosed with CRC. Raman-CRC identified CRC with sensitivity 95.7%, specificity 69.3% with area under curve (AUC) of 0.80 compared with colonoscopy as the reference test (248 patients). Stage I and II cancers were detected with 78.6% sensitivity. Focus group themes underlined the convenience of a blood test for the patient and the test's value as a risk assessment tool in primary care.<h4>Conclusion</h4>The findings support this novel, non-invasive, blood-based method to prioritise those patients most likely to have CRC. Raman-CRC may accelerate access to diagnosis with potential to improve cancer outcomes.
Also flagged:thromboembolismdeathCOVID-19arterial thromboembolismvenous thromboembolismapixaban
Journal Article2023-03-21No SnippetsWang TY, Wahed AS, Morris A, Kreuziger LB, Quigley JG, Lamas GA, Weissman AJ, Lopez-Sendon J, Knudson MM, Siegal DM, Kasthuri RS, Alexander AJ, Wahid L, Atassi B, Miller PJ, Lawson JW, Patel B, Krishnan JA, Shapiro NL, Martin DE, Kindzelski AL, Leifer ES, Joo J, Lyu L, Pennella A, Everett BM, Geraci MW, Anstrom KJ, Ortel TL, ACTIV-4C Study Group.
Show Full Abstract
<h4>Background</h4>Patients hospitalized with COVID-19 have an increased incidence of thromboembolism. The role of extended thromboprophylaxis after hospital discharge is unclear.<h4>Objective</h4>To determine whether anticoagulation is superior to placebo in reducing death and thromboembolic complications among patients discharged after COVID-19 hospitalization.<h4>Design</h4>Prospective, randomized, double-blind, placebo-controlled clinical trial. (ClinicalTrials.gov: NCT04650087).<h4>Setting</h4>Done during 2021 to 2022 among 127 U.S. hospitals.<h4>Participants</h4>Adults aged 18 years or older hospitalized with COVID-19 for 48 hours or more and ready for discharge, excluding those with a requirement for, or contraindication to, anticoagulation.<h4>Intervention</h4>2.5 mg of apixaban versus placebo twice daily for 30 days.<h4>Measurements</h4>The primary efficacy end point was a 30-day composite of death, arterial thromboembolism, and venous thromboembolism. The primary safety end points were 30-day major bleeding and clinically relevant nonmajor bleeding.<h4>Results</h4>Enrollment was terminated early, after 1217 participants were randomly assigned, because of a lower than anticipated event rate and a declining rate of COVID-19 hospitalizations. Median age was 54 years, 50.4% were women, 26.5% were Black, and 16.7% were Hispanic; 30.7% had a World Health Organization severity score of 5 or greater, and 11.0% had an International Medical Prevention Registry on Venous Thromboembolism risk prediction score of greater than 4. Incidence of the primary end point was 2.13% (95% CI, 1.14 to 3.62) in the apixaban group and 2.31% (CI, 1.27 to 3.84) in the placebo group. Major bleeding occurred in 2 (0.4%) and 1 (0.2%) and clinically relevant nonmajor bleeding occurred in 3 (0.6%) and 6 (1.1%) apixaban-treated and placebo-treated participants, respectively. By day 30, thirty-six (3.0%) participants were lost to follow-up, and 8.5% of apixaban and 11.9% of placebo participants permanently discontinued the study drug treatment.<h4>Limitations</h4>The introduction of SARS-CoV-2 vaccines decreased the risk for hospitalization and death. Study enrollment spanned the peaks of the Delta and Omicron variants in the United States, which influenced illness severity.<h4>Conclusion</h4>The incidence of death or thromboembolism was low in this cohort of patients discharged after hospitalization with COVID-19. Because of early enrollment termination, the results were imprecise and the study was inconclusive.<h4>Primary funding source</h4>National Institutes of Health.
Also flagged:non-alcoholic fatty liver diseasetype 2 diabetesNAFLDglucosemetabolismdiabetes
Journal Article2023-03-21✓ 1 SnippetHatano Y, VanWagner LB, Carnethon MR, Bancks MP, Carson AP, Lloyd-Jones DM, Østbye T, Viera AJ, Yano Y.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Aims/hypothesis</h4>Type 2 diabetes and non-alcoholic fatty liver disease (NAFLD) are prevalent diseases of metabolic origin. We examined the association between NAFLD and the development of type 2 diabetes among non-Asian adults, and whether the association differs by race.<h4>Methods</h4>We analysed data from the Coronary Artery Risk Development in Young Adults (CARDIA) study, a population-based prospective cohort study. Participants underwent non-contrast abdominal computed tomography (CT) at baseline (2010-2011) and assessment of glucose measures at the follow-up exam (2015-2016). NAFLD was defined as liver attenuation ≤51 Hounsfield units on CT images after exclusion for other liver fat causes. Race was self-reported. We used targeted maximum likelihood estimation (TMLE) with machine-learning algorithms to estimate difference in type 2 diabetes risk between the NAFLD and non-NAFLD groups.<h4>Results</h4>Of the 1995 participants without type 2 diabetes at baseline (mean age±SD, 50.0±3.6 years; 59% women; 55.0% White and 45.0% Black), 21.7% of White and 16.8% of Black participants had NAFLD at baseline, and 3.7% of White and 8.0% of Black participants developed type 2 diabetes at follow up. After multivariable adjustment, risk difference for type 2 diabetes associated with NAFLD vs no NAFLD was 4.1% (95% CI 0.3%, 7.9%) among White participants and -1.9% (95% CI -5.7%, 2.0%) in Black participants.<h4>Conclusions/interpretation</h4>NAFLD was associated with a higher risk of type 2 diabetes among White participants but not among Black participants. This finding suggests that the effect of liver fat on impaired glucose metabolism may be smaller in Black than in White individuals.
Also flagged:non-alcoholic fatty liver diseaseT1DMNAFLDlipidliver fibrosisinsulin
Journal Article2023-03-21✓ 1 SnippetAbdallah HR, Youness ER, Bedeir MM, Abouelnaga MW, Ezzat WM, Elhosary Y, El-Hariri HM, Hussein MAEA, Ahmed HR, Eladawy R.
In-Text Gene Mentions
Methods)
…disorders, Wilson’s disease,hemochromatosis, and autoimmune hepatitis,…
Show Full Abstract
<h4>Background</h4>Type 1 diabetes mellitus (T1DM) patients are at an increased risk for non-alcoholic fatty liver disease (NAFLD). This study aimed to evaluate the clinical criteria associated with the diagnosis of Non-Alcoholic Fatty Liver Disease (NAFLD) among T1DM Egyptian children and adolescents.<h4>Methods</h4>74 T1DM patients aged 8-18 year were enrolled in this cross sectional study. Assessments of Clinical status, anthropometric measures, lipid profile, glycated haemoglobin (HbA1c) and liver enzymes were done. Abdominal Ultrasound evaluation of hepatic steatosis was done. Accordingly, patients were divided into two groups (NAFLD and normal liver group) and compared together. Assessment of liver fibrosis using acoustic radiation force impulse elastography (ARFI) was done. Statistical analysis included; independent t-test, Chi square and Fisher's Exact, Pearson and Spearman tests and Logistic regression models for factors associated with fatty liver were used when appropriate.<h4>Results</h4>In this study; 74 patients were enrolled; 37 males (50%) and 37 females with mean age 14.3 ± 3.0 year. The mean insulin dose was 1.1 ± 0.4 U/kg and mean disease duration was 6.3 ± 3.0 year. NAFLD was detected in 46 cases while 28 cases had normal liver as diagnosed by abdominal ultrasound. Cases with NAFLD had statistically significant higher BMI-Z scores, waist/hip, waist/height and sum of skin fold thicknesses compared to those with normal liver (P < 0.05). The mean value of HbA1c % was significantly higher in NAFLD group (P = 0.003). Total cholesterol, triglycerides and LDL serum levels were significantly elevated (p < 0.05), while the HDL level was significantly lower in NAFLD cases (p = 0.001). Although, serum levels of liver enzymes; ALT and AST were significantly higher among cases with NAFLD than in normal liver group (p < 0.05), their means were within normal. Using the ARFI elastography; NAFLD cases exhibited significant fibrosis (F2, 3 and 4). BMI, patient age and female gender were among risk factors for NAFLD.<h4>Conclusions</h4>NAFLD represents a serious consequence in type 1 diabetic children and adolescents that deserves attention especially with poor glycemic control. NAFLD has the potential to evolve to fibrosis. This study demonstrated a very high prevalence of NAFLD in T1D children and adolescents using US which was (62.2%) with the percent of liver fibrosis among the NAFLD cases (F2-F4) using ARFI elastography was 26%. BMI, age of patients and female gender were detected as risk factors for NAFLD.
Also flagged:STINGLipidimmune response-2infectionsCOVID-19
Journal Article2023-03-21No SnippetsZhang Y, Yan J, Hou X, Wang C, Kang DD, Xue Y, Du S, Deng B, McComb DW, Liu SL, Zhong Y, Dong Y.
Show Full Abstract
Lipid nanoparticle (LNP)-mediated delivery of messenger RNA (mRNA) COVID-19 vaccines has provided large-scale immune protection to the public. To elicit a robust immune response against SARS-CoV-2 infections, antigens produced by mRNAs encoding SARS-CoV-2 Spike glycoprotein need to be efficiently delivered and presented to antigen-presenting cells such as dendritic cells (DCs). As concurrent innate immune stimulation can facilitate the antigen presentation process, a library of non-nucleotide STING agonist-derived amino lipids (SALs) was synthesized and formulated into LNPs for mRNA delivery. SAL12 lipid nanoparticles (SAL12-LNPs) were identified as most potent in delivering mRNAs encoding the Spike glycoprotein (S) of SARS-CoV-2 while activating the STING pathway in DCs. Two doses of SAL12 S-LNPs by intramuscular immunization elicited potent neutralizing antibodies against SARS-CoV-2 in mice.
Also flagged:extracellularthioltissuecollagencollagen type Imembrane
Journal Article2023-03-21No SnippetsFan Y, Lüchow M, Badria A, Hutchinson DJ, Malkoch M.
Show Full Abstract
Human placenta is a source of extracellular matrix for tissue engineering. In this study, placenta powder (PP), made from decellularized human placenta, was physically incorporated into synthetic poly(ethylene glycol) (PEG)-based hydrogels via UV-initiated thiol-ene coupling (TEC). The PP-incorporated PEG hydrogels (MoDPEG+) showed tunable storage moduli ranging from 1080 ± 290 to 51,400 ± 200 Pa. The addition of PP (1, 4, or 8 wt %) within the PEG hydrogels increased the storage moduli, with the 8 wt % PP hydrogels showing the highest storage moduli. PP reduced the swelling ratios compared with the pristine hydrogels (MoDPEG). All hydrogels showed good biocompatibility in vitro toward human skin cells and murine macrophages, with cell viability above 91%. Importantly, cells could adhere and proliferate on MoDPEG+ hydrogels due to the bioactive PP, while MoDPEG hydrogels were bio-inert as cells moved away from the hydrogel or were distributed in a large cluster on the hydrogel surface. To showcase their potential use in application-driven research, the MoDPEG+ hydrogels were straightforwardly (i) 3D printed using the SLA technique and (ii) produced via high-energy visible light (HEV-TEC) to populate damaged soft-tissue or bone cavities. Taking advantage of the bioactivity of PP and the tunable physicochemical properties of the synthetic PEG hydrogels, the presented MoDPEG+ hydrogels show great promise for tissue regeneration.
Also flagged:colorectal cancerkinasesion channelsTumorDCPG-protein-coupled
receptors
Journal Article2023-03-21No SnippetsTredup C, Ndreshkjana B, Schneider NS, Tjaden A, Kemas AM, Youhanna S, Lauschke VM, Berger BT, Krämer A, Berger LM, Röhm S, Knapp S, Farin HF, Müller S.
Show Full Abstract
Well-characterized small molecules are essential tools for studying the biology and therapeutic relevance of a target protein. However, many compounds reported in the literature and routinely studied in biomedical research lack the potency and selectivity required for mechanistic cellular studies on the function of a given protein. Furthermore, commercially available compounds often do not include useful tools developed by industry as part of their research and development efforts, as they frequently remain proprietary. The freely available donated chemical probe (DCP) library, fueled by generous donations of compounds from industry and academia, enables easy access to a steadily growing collection of these valuable and well-characterized tools. Here, we provide a systematic description of the current DCP library collection and their associated comprehensive characterization data, including a variety of <i>in vitro</i> and cellular assays. Of note, we characterized the set in relevant human primary models by employing hepatotoxicity screening in primary human liver spheroids and viability screening in patient-derived colorectal cancer organoids and matched normal-adjacent epithelium. Taken together, the DCP library represents a well-annotated, openly available collection of tool compounds for studying a wide range of targets, including kinases, G-protein-coupled receptors, and ion channels. As such, it represents a unique resource for the biomedical research community.
<h4>Introduction</h4>Orthopaedic trauma and fracture care commonly cause perioperative anaemia and associated functional iron deficiency due to a systemic inflammatory state. Modern, strict transfusion thresholds leave many patients anaemic; managing this perioperative anaemia is an opportunity to impact outcomes in orthopaedic trauma surgery. The primary outcome of this pilot study is feasibility for a large randomised controlled trial (RCT) to evaluate intravenous iron therapy (IVIT) to improve patient well-being following orthopaedic injury. Measurements will include rate of participant enrolment, screening failure, follow-up, missing data, adverse events and protocol deviation.<h4>Methods and analysis</h4>This single-centre, pilot, double-blind RCT investigates the use of IVIT for acute blood loss anaemia in traumatically injured orthopaedic patients. Patients are randomised to receive either a single dose infusion of low-molecular weight iron dextran (1000 mg) or placebo (normal saline) postoperatively during their hospital stay for trauma management. Eligible subjects include adult patients admitted for lower extremity or pelvis operative fracture care with a haemoglobin of 7-11 g/dL within 7 days postoperatively during inpatient care. Exclusion criteria include history of intolerance to intravenous iron supplementation, active haemorrhage requiring ongoing blood product resuscitation, multiple planned procedures, pre-existing haematologic disorders or chronic inflammatory states, iron overload on screening or vulnerable populations. We follow patients for 3 months to measure the effect of iron supplementation on clinical outcomes (resolution of anaemia and functional iron deficiency), patient-reported outcomes (fatigue, physical function, depression and quality of life) and translational measures of immune cell function.<h4>Ethics and dissemination</h4>This study has ethics approval (Oregon Health & Science University Institutional Review Board, STUDY00022441). We will disseminate the findings through peer-reviewed publications and conference presentations.<h4>Trial registration number</h4>NCT05292001; ClinicalTrials.gov.
Also flagged:ageingdetoxificationnon-alcoholic fatty liver diseaseNAFLDhepatocellular carcinomaliver diseases
Journal Article2023-03-21✓ 1 SnippetPorukala M, Vinod PK.
In-Text Gene Mentions
Results)
…ACSL1, ACADVL, CPT2,ECI2) also shows this…
Show Full Abstract
The liver plays a vital role in maintaining whole-body metabolic homeostasis, compound detoxification and has the unique ability to regenerate itself post-injury. Ageing leads to functional impairment of the liver and predisposes the liver to non-alcoholic fatty liver disease (NAFLD) and hepatocellular carcinoma (HCC). Mapping the molecular changes of the liver with ageing may help to understand the crosstalk of ageing with different liver diseases. A systems-level analysis of the ageing-induced liver changes and its crosstalk with liver-associated conditions is lacking. In the present study, we performed network-level analyses of the ageing liver using mouse transcriptomic data and a protein-protein interaction (PPI) network. A sample-wise analysis using network entropy measure was performed, which showed an increasing trend with ageing and helped to identify ageing genes based on local entropy changes. To gain further insights, we also integrated the differentially expressed genes (DEGs) between young and different age groups with the PPI network and identified core modules and nodes associated with ageing. Finally, we computed the network proximity of the ageing network with different networks of liver diseases and regeneration to quantify the effect of ageing. Our analysis revealed the complex interplay of immune, cancer signalling, and metabolic genes in the ageing liver. We found significant network proximities between ageing and NAFLD, HCC, liver damage conditions, and the early phase of liver regeneration with common nodes including NLRP12, TRP53, GSK3B, CTNNB1, MAT1 and FASN. Overall, our study maps the network-level changes of ageing and their interconnections with the physiology and pathology of the liver.
Also flagged:adenomacarcinomacolon cancerIL-17immune responsemucin
Journal Article2023-03-21✓ 1 SnippetSun R, Yang Y, Lü W, Yang Y, Li Y, Liu Z, Diao D, Wang Y, Chang S, Lu M, Jiang Q, Dai B, Ma X, Zhao C, Lü M, Zhang J, Ding C, Li N, Zhang J, Xiao Z, Zhou D, Huang C.
In-Text Gene Mentions
Results)
…[ 33 ],OLFM4[ 45 ],…
Show Full Abstract
The aim of the present study was to elucidate the evolutionary trajectory of colon cells from normal colon mucosa, to adenoma, then to carcinoma in the same microenvironment. Normal colon, adenoma and carcinoma tissues from the same patient were analyzed by single-cell sequencing, which perfectly simulated the process of time-dependent colon cancer due to the same microenvironment. A total of 22 cell types were identified. Results suggest the presence of dominant clones of same cells including C2 goblet cell, epithelial cell subtype 1 (Epi1), enterocyte cell subset 0 (Entero0), and Entero5 in carcinoma. Epi1 and Entero0 were Co-enriched in antibacterial and IL-17 signaling, Entero5 was enriched in immune response and mucin-type O-glycan biosynthesis. We discovered new colon cancer related genes including AC007952.4, NEK8, CHRM3, ANO7, B3GNT6, NEURL1, ODC1 and KCNMA1. The function of TBC1D4, LTB, C2CD4A, AND GBP4/5 in T cells needs to be clarified. We used colon samples from the same person, which provide new information for colon cancer therapy.
Also flagged:peptidephosphorylationkinasesphosphatasespyruvate dehydrogenase kinase 1PDK1
Journal Article2023-03-21✓ 1 SnippetZhang T, Keele GR, Gyuricza IG, Vincent M, Brunton C, Bell TA, Hock P, Shaw GD, Munger SC, de Villena FP, Ferris MT, Paulo JA, Gygi SP, Churchill GA.
In-Text Gene Mentions
Results)
…including Il15 ,Negr1, and Stat6…
Show Full Abstract
<h4>Background</h4>Phosphorylation of proteins is a key step in the regulation of many cellular processes including activation of enzymes and signaling cascades. The abundance of a phosphorylated peptide (phosphopeptide) is determined by the abundance of its parent protein and the proportion of target sites that are phosphorylated.<h4>Results</h4>We quantified phosphopeptides, proteins, and transcripts in heart, liver, and kidney tissue samples of mice from 58 strains of the Collaborative Cross strain panel. We mapped ~700 phosphorylation quantitative trait loci (phQTL) across the three tissues and applied genetic mediation analysis to identify causal drivers of phosphorylation. We identified kinases, phosphatases, cytokines, and other factors, including both known and potentially novel interactions between target proteins and genes that regulate site-specific phosphorylation. Our analysis highlights multiple targets of pyruvate dehydrogenase kinase 1 (PDK1), a regulator of mitochondrial function that shows reduced activity in the NZO/HILtJ mouse, a polygenic model of obesity and type 2 diabetes.<h4>Conclusions</h4>Together, this integrative multi-omics analysis in genetically diverse CC strains provides a powerful tool to identify regulators of protein phosphorylation. The data generated in this study provides a resource for further exploration.
Also flagged:Liver cancerhepatocellular carcinomaPaclitaxelliver tumorsextracellularvesicles
Journal Article2023-03-21No SnippetsEllipilli S, Wang H, Binzel DW, Shu D, Guo P.
Show Full Abstract
Liver cancer such as hepatocellular carcinoma (HCC) poorly responds to chemotherapeutics as there are no effective means to deliver the drugs to liver cancer. Here we report GalNAc decorated exosomes as cargo for targeted delivery of Paclitaxel (PTX) and miR122 to liver tumors as an effective means to inhibit the HCC. Exosomes (Exos) are nanosized extracellular vesicles that deliver a payload to cancer cells effectively. GalNAc provides Exos targeting ability by binding to the asialoglycoprotein-receptor (ASGP-R) overexpressed on the liver cancer cell surface. A 4-way junction (4WJ) RNA nanoparticle was constructed to harbor 24 copies of hydrophobic PTX and 1 copy of miR122. The 4WJ RNA-PTX complex was loaded into the Exos, and its surface was decorated with GalNAc using RNA nanotechnology to obtain specific targeting. The multi-specific Exos selectively bind and efficiently delivered the payload into the liver cancer cells and exhibited the highest cancer cell inhibition due to the multi-specific effect of miR122, PTX, GalNAc, and Exos. The same was reflected in mice xenograft studies, the liver cancer was efficiently inhibited after systemic injection of the multi-specific Exos. The required effective dose of chemical drugs carried by Exos was significantly reduced, indicating high efficiency and low toxicity. The multi-specific strategy demonstrates that Exos can serve as a natural cargo vehicle for the targeted delivery of anticancer therapeutics to treat difficult-to-treat cancers.
Also flagged:Chromatinneurological disordersneurodevelopmental disordersbrain tumorstumor necrosis factorTNF
Journal Article2023-03-21No SnippetsPavlou MAS, Singh K, Ravichandran S, Halder R, Nicot N, Birck C, Grandbarbe L, Del Sol A, Michelucci A.
Show Full Abstract
Astrocytes arise from multipotent neural stem cells (NSCs) and represent the most abundant cell type of the central nervous system (CNS), playing key roles in the developing and adult brain. Since the differentiation of NSCs towards a gliogenic fate is a precisely timed and regulated process, its perturbation gives rise to dysfunctional astrocytic phenotypes. Inflammation, which often underlies neurological disorders, including neurodevelopmental disorders and brain tumors, disrupts the accurate developmental process of NSCs. However, the specific consequences of an inflammatory environment on the epigenetic and transcriptional programs underlying NSCs' differentiation into astrocytes is unexplored. Here, we address this gap by profiling in mice glial precursors from neural tissue derived from early embryonic stages along their astrocytic differentiation trajectory in the presence or absence of tumor necrosis factor (TNF), a master pro-inflammatory cytokine. By using a combination of RNA- and ATAC-sequencing approaches, together with footprint and integrated gene regulatory network analyses, we here identify key differences during the differentiation of NSCs into astrocytes under physiological and inflammatory settings. In agreement with its role to turn cells resistant to inflammatory challenges, we detect <i>Nrf2</i> as a master transcription factor supporting the astrocytic differentiation under TNF exposure. Further, under these conditions, we unravel additional transcriptional regulatory hubs, including <i>Stat3</i>, <i>Smad3</i>, <i>Cebpb</i>, and <i>Nfkb2</i>, highlighting the interplay among pathways underlying physiological astrocytic developmental processes and those involved in inflammatory responses, resulting in discrete astrocytic phenotypes. Overall, our study reports key transcriptional and epigenetic changes leading to the identification of molecular regulators of astrocytic differentiation. Furthermore, our analyses provide a valuable resource for understanding inflammation-induced astrocytic phenotypes that might contribute to the development and progression of CNS disorders with an inflammatory component.
Also flagged:Autophagymetabolismviral infectionhost cellsretinoic acid-inducible gene IRIG-I)-like receptor
Journal Article2023-03-21No SnippetsKe PY.
Show Full Abstract
Autophagy plays a homeostatic role in regulating cellular metabolism by degrading unwanted intracellular materials and acts as a host defense mechanism by eliminating infecting pathogens, such as viruses. Upon viral infection, host cells often activate retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) signaling to induce the transcription of type I interferons, thus establishing the first line of the innate antiviral response. In recent years, numerous studies have shown that virus-mediated autophagy activation may benefit viral replication through different actions on host cellular processes, including the modulation of RLR-mediated innate immunity. Here, an overview of the functional molecules and regulatory mechanism of the RLR antiviral immune response as well as autophagy is presented. Moreover, a summary of the current knowledge on the biological role of autophagy in regulating RLR antiviral signaling is provided. The molecular mechanisms underlying the crosstalk between autophagy and RLR innate immunity are also discussed.
Also flagged:Resveratrolneurodegenerative diseasesneuroglobinNGBestradiolERβ
Journal Article2023-03-21✓ 1 SnippetCracco P, Montalesi E, Parente M, Cipolletti M, Iucci G, Battocchio C, Venditti I, Fiocchetti M, Marino M.
In-Text Gene Mentions
Discussion)
…ncreasing huntingtin protein (Htt) intracellular levels through…
Show Full Abstract
A promising therapeutic strategy to delay and/or prevent the onset of neurodegenerative diseases (NDs) could be to restore neuroprotective pathways physiologically triggered by neurons against stress injury. Recently, we identified the accumulation of neuroglobin (NGB) in neuronal cells, induced by the 17β-estradiol (E2)/estrogen receptor β (ERβ) axis, as a protective response that increases mitochondria functionality and prevents the activation of apoptosis, increasing neuron resilience against oxidative stress. Here, we would verify if resveratrol (Res), an ERβ ligand, could reactivate NGB accumulation and its protective effects against oxidative stress in neuronal-derived cells (i.e., SH-SY5Y cells). Our results demonstrate that ERβ/NGB is a novel pathway triggered by low Res concentrations that lead to rapid and persistent NGB accumulation in the cytosol and in mitochondria, where the protein contributes to reducing the apoptotic death induced by hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>). Intriguingly, Res conjugation with gold nanoparticles increases the stilbene efficacy in enhancing neuron resilience against oxidative stress. As a whole, ERβ/NGB axis regulation is a novel mechanism triggered by low concentration of Res to regulate, specifically, the neuronal cell resilience against oxidative stress reducing the triggering of the apoptotic cascade.
Also flagged:reproductionspliceosomeestrous cycleadrenocorticotropin hormoneACTHfollicle-stimulating hormone
Journal Article2023-03-21✓ 1 SnippetMakowczenko KG, Jastrzebski JP, Kiezun M, Paukszto L, Dobrzyn K, Smolinska N, Kaminski T.
In-Text Gene Mentions
Results)
…, ZKSCAN5 andZNF664.…
Show Full Abstract
The physiological mechanisms of the porcine reproduction are relatively well-known. However, transcriptomic changes and the mechanisms accompanying transcription and translation processes in various reproductive organs, as well as their dependence on hormonal status, are still poorly understood. The aim of this study was to gain a principal understanding of alterations within the transcriptome, spliceosome and editome occurring in the pituitary of the domestic pig (<i>Sus scrofa domestica</i> L.), which controls basic physiological processes in the reproductive system. In this investigation, we performed extensive analyses of data obtained by high-throughput sequencing of RNA from the gilts' pituitary anterior lobes during embryo implantation and the mid-luteal phase of the estrous cycle. During analyses, we obtained detailed information on expression changes of 147 genes and 43 long noncoding RNAs, observed 784 alternative splicing events and also found the occurrence of 8729 allele-specific expression sites and 122 RNA editing events. The expression profiles of the selected 16 phenomena were confirmed by PCR or qPCR techniques. As a final result of functional meta-analysis, we acquired knowledge regarding intracellular pathways that induce changes in the processes accompanying transcription and translation regulation, which may induce modifications in the secretory activity of the porcine adenohypophyseal cells.
Also flagged:agingsenescence-associated secretoryosteoporosisextracellularcell adhesioncalcium
Journal Article2023-03-21✓ 1 SnippetSamsonraj RM, Law SF, Chandra A, Pignolo RJ.
In-Text Gene Mentions
Discussion)
…work shows thatSERPINC1and SERPINB9 are…
Show Full Abstract
Mesenchymal stem cells (MSCs) derived from bone marrow can support skeletal tissue repair and regeneration owing to their self-renewing capacity, differentiation ability, and trophic functions. Bone marrow-derived MSCs undergo dramatic changes with aging, including the senescence-associated secretory phenotype (SASP) which may largely contribute to age-related changes in bone tissue leading to osteoporosis. A mass spectrometry-based proteomics approach was used to investigate the MSC SASP. Replicative senescence was achieved by exhaustive in vitro sub-cultivation and confirmed by standard proliferation criteria. Conditioned media from non-senescent and senescent MSCs underwent mass spectrometry. Proteomics and bioinformatics analyses enabled the identification of 95 proteins expressed uniquely in senescent MSCs. Protein ontology analysis revealed the enrichment of proteins linked to the extracellular matrix, exosomes, cell adhesion, and calcium ion binding. The proteomic analysis was independently validated by taking ten identified proteins with relevance to bone aging and confirming their increased abundance in conditioned media from replicatively senescent versus non-senescent MSCs (ACTα2, LTF, SOD1, IL-6, LTBP2, PXDN, SERPINE 1, COL1α1, THBS1, OPG). These target proteins were used to further investigate changes in the MSC SASP profile in response to other inducers of senescence, ionizing radiation (IR) and H<sub>2</sub>O<sub>2</sub>. Similar secreted protein expression profiles with replicatively senescent cells were seen with H<sub>2</sub>O<sub>2</sub> treatment except for LTF and PXDN, which were increased by IR treatment. With both IR and H<sub>2</sub>O<sub>2</sub> treatment there was a decrease in THBS1. In vivo investigation of these secreted proteins with aging was shown by significant changes in the abundance of OPG, COL1α1, IL-6, ACTα2, SERPINE 1, and THBS1 in the plasma of aged rats. This unbiased, comprehensive analysis of the changes in the MSC secretome with senescence defines the unique protein signature of the SASP in these cells and provides a better understanding of the aging bone microenvironment.
Journal Article2023-03-21✓ 1 SnippetAgarwal T, Muller MJC, Atkinson A, Bismilla Z.
In-Text Gene Mentions
Abstract)
…ciblées dans lesDCCexistants et celles…
Show Full Abstract
<h4>Background</h4>While many Area of Focused Competency (AFC) Diplomas are available to those who have completed Pediatric residency training, it is not known which competencies are enhanced within each AFC discipline. Our objective was to determine which CanMEDS roles were targeted by existing AFCs available to those who have completed Pediatric residency training and identify gaps within CanMEDs roles that may be fulfilled by the development of new AFCs.<h4>Methods</h4>A qualitative study was undertaken using document analysis methodology to compare CanMEDS competencies across AFCs available to those with Royal College examination eligibility or certification in Pediatrics. RCPSC Competency Training Requirements documents were used to compare and contrast the competencies in each AFC with competencies established in Pediatric residency training. Key and Enabling Competencies were compared for each CanMEDS role to identify differences.<h4>Results</h4>Ten AFCs were identified with eligibility requirements including Royal College examination eligibility or certification in Pediatrics. All 10 AFCs included at least one new Medical Expert competency, for a total of 42 unique competencies in this role across all AFCs. The Scholar role had only 10 new competencies across seven AFCs, while only one AFC added a single unique competency in the Collaborator role.<h4>Conclusions</h4>The majority of new competencies contributed by AFCs lie within the CanMEDS role of Medical Expert. The Scholar and Collaborator roles have the least differences when comparing competencies of existing AFCs to those competencies established in Pediatric residency training. Developing additional AFCs that offer advanced skills in these roles may help close this gap within the discipline of Pediatrics.
Also flagged:homeostasisangiogenesisgene expressionTranscription factorscancerage-related macular degeneration
Journal Article2023-03-21No SnippetsWakabayashi T, Naito H.
Show Full Abstract
Vascular endothelial cells (ECs) that constitute the inner surface of blood vessels are essential for new vessel formation and organ homeostasis. ECs display remarkable phenotypic heterogeneity across different organs and the vascular tree during angiogenesis and homeostasis. Recent advances in single cell RNA sequencing (scRNA-seq) technologies have allowed a new understanding of EC heterogeneity in both mice and humans. In particular, scRNA-seq has identified new molecular signatures for arterial, venous and capillary ECs in different organs, as well as previously unrecognized specialized EC subtypes, such as the aerocytes localized in the alveolar capillaries of the lung. scRNA-seq has also revealed the gene expression profiles of specialized tissue-resident EC subtypes that are capable of clonal expansion and contribute to adult angiogenesis, a process of new vessel formation from the pre-existing vasculature. These specialized tissue-resident ECs have been identified in various different mouse tissues, including aortic endothelium, liver, heart, lung, skin, skeletal muscle, retina, choroid, and brain. Transcription factors and signaling pathways have also been identified in the specialized tissue-resident ECs that control angiogenesis. Furthermore, scRNA-seq has also documented responses of ECs in diseases such as cancer, age-related macular degeneration, Alzheimer's disease, atherosclerosis, and myocardial infarction. These new findings revealed by scRNA-seq have the potential to provide new therapeutic targets for different diseases associated with blood vessels. In this article, we summarize recent advances in the understanding of the vascular endothelial cell heterogeneity and endothelial stem cells associated with angiogenesis and homeostasis in mice and humans, and we discuss future prospects for the application of scRNA-seq technology.
Also flagged:Mitochondria-associatedgene expressioncancermitochondria-associated proteinsneuroblastomaNB
Journal Article2023-03-21✓ 3 SnippetsChai C, Chen Y, Luo Y, Zhang H, Ye Z, He X, Zou Y, Xu Y, Li L, Tang J, Wu Q.
In-Text Gene Mentions
Results)
…Overlapping these MAP genes with NB-associated differential MAP genes, we found some shared genes including SOX4, CKS2, SUV39H2, DARS2, PYCR1, and PMAIP1. These results collectively demonstrated the significance of studying MAP genes in human pan-cancers.…
Results)
…, AIFM2, andZNFX1in the NB…
Results)
…SOX4, CKS2, SUV39H2,DARS2, PYCR1 , and…
Show Full Abstract
<h4>Background</h4>Mitochondria have long been considered a potential target in cancer therapy because malignant cells are known for their altered energy production. However, there is a lack of comprehensive research on the involvement of mitochondria-associated proteins (MAPs) in neuroblastoma (NB), and their potential as therapeutic targets is yet to be fully explored.<h4>Methods</h4>MAP genes were defined based on the protein-coding genes with mitochondrial localization. The mRNA expression patterns and dynamics of MAP genes associated with NB were investigated by integrating publicly available transcriptional profiles at the cellular and tissue levels. Multivariate Cox regression analysis was conducted to reveal the association of MAP genes with the overall survival (OS) and clinical subgroups of NB patients. The single-cell RNA-seq dataset and gene dependency screening datasets were analyzed to reveal the therapeutic potential of targeting MAP genes.<h4>Results</h4>We compiled a total of 1,712 MAP genes. We found the global and cell type-specific mRNA expression changes of the MAP genes associated with NB status and survival. Our analyses revealed a group of MAP gene signatures independent of <i>MYCN</i>-amplification status associated with NB outcome. We provided computational evidence with selected MAP genes showing good performance in predicting long-term prognosis. By analyzing gene dependency of the MAP genes in NB cell lines and <i>ex vivo</i> human primary T cells, we demonstrated the therapeutic potential of targeting several MAP genes in NB tumors.<h4>Conclusions</h4>Collectively, our study provides evidence for the MAP genes as extended candidates in NB tumor stratification and staging, prognostic prediction, and targeted drug development.
Also flagged:semaglutideglucagon-like peptide-1GLP-1lipidmetabolismglucose
Journal Article2023-03-21No SnippetsZhu R, Chen S.
Show Full Abstract
<h4>Background and objectives</h4>Obesity is a global health problem with few pharmacologic options. Semaglutide is a glucagon-like peptide-1 (GLP-1) analogue that induces weight loss. Yet, the role of semaglutide in adipose tissue has not yet been examined. The following study investigated the mechanism of semaglutide on lipid metabolism by analyzing proteomics of epididymal white adipose tissue (eWAT) in obese mice.<h4>Methods</h4>A total of 36 C57BL/6JC mice were randomly divided into a normal-chow diet group (NCD, n = 12), high-fat diet (HFD, n = 12), and HFD+semaglutide group (Sema, n = 12). Mice in the Sema group were intraperitoneally administered semaglutide, and the HFD group and the NCD group were intraperitoneally administered an equal volume of normal saline. Serum samples were collected to detect fasting blood glucose and blood lipids. The Intraperitoneal glucose tolerance test (IPGTT) was used to measure the blood glucose value at each time point and calculate the area under the glucose curve. Tandem Mass Tag (TMT) combined with liquid chromatography-tandem mass spectrometry (LC-MS/MS) were used to study the expression of eWAT, while cellular processes, biological processes, corresponding molecular functions, and related network molecular mechanisms were analyzed by bioinformatics.<h4>Results</h4>Compared with the model group, the semaglutide-treated mice presented 640 differentially expressed proteins (DEPs), including 292 up-regulated and 348 down-regulated proteins. Bioinformatics analysis showed a reduction of CD36, FABP5, ACSL, ACOX3, PLIN2, ANGPTL4, LPL, MGLL, AQP7, and PDK4 involved in the lipid metabolism in the Sema group accompanied by a decrease in visceral fat accumulation, blood lipids, and improvement in glucose intolerance.<h4>Conclusion</h4>Semaglutide can effectively reduce visceral fat and blood lipids and improve glucose metabolism in obese mice. Semaglutide treatment might have beneficial effects on adipose tissues through the regulation of lipid uptake, lipid storage, and lipolysis in white adipose tissue.
Also flagged:clear cell renal cell carcinomaccRCCkidney cancercancersRenal cell carcinomaRCC
Journal Article2023-03-21✓ 1 SnippetYang J, Wang K, Yang Z.
In-Text Gene Mentions
S I O 001029)
…Studies have found that peroxisome proliferative activated receptor gamma coactivator 1 alpha (PGC1α) and phospholipase C like 1 (PLCL1) mediated cellular browning by regulating uncoupling protein 1 (UCP1) level could promote tumor “slimming” and inhibit tumor progression (125, 126).…
Show Full Abstract
Clear cell renal cell carcinoma (ccRCC) is the most prevalent histological subtype of kidney cancer, which is prone to metastasis, recurrence, and resistance to radiotherapy and chemotherapy. The burden it places on human health due to its refractory nature and rising incidence rate is substantial. Researchers have recently determined the ccRCC risk factors and optimized the clinical therapy based on the disease's underlying molecular mechanisms. In this paper, we review the established clinical therapies and novel potential therapeutic approaches for ccRCC, and we support the importance of investigating novel therapeutic options in the context of combining established therapies as a research hotspot, with the goal of providing diversified therapeutic options that promise to address the issue of drug resistance, with a view to the early realization of precision medicine and individualized treatment.
Also flagged:Histone methyltransferase SETD2clear cell renal cell carcinomaSET domain-containing 2SETD2lysinemethyltransferase
Journal Article2023-03-21✓ 5 SnippetsYu M, Qian K, Wang G, Xiao Y, Zhu Y, Ju L.
In-Text Gene Mentions
S I O 001029)
…The SETD2-HTT-HIP1R axis modifies actin, which increases actin polymerization and promotes ccRCC migration (18).…
S I O 001029)
…For example, the WW domain interacts with the Huntingtin (HTT) proline-rich region (PRR) and the actin-binding adaptor HTT-interacting protein 1-related protein (HIP1R), leading to SETD2 tri-methylating actin at lysine 68 (ActK68me3) (Figure 2).…
Introduction)
…with the Huntingtin (HTT) proline-rich region (PRR)…
Introduction)
…the actin-binding adaptorHTT-interacting protein 1-related proteinprotein 1-related protein…
Introduction)
…The SETD2-HTT-HIP1R axis modifies actin,…
Show Full Abstract
SET domain-containing 2 (SETD2) is a lysine methyltransferase that catalyzes histone H3 lysine36 trimethylation (H3K36me3) and has been revealed to play important roles in the regulation of transcriptional elongation, RNA splicing, and DNA damage repair. <i>SETD2</i> mutations have been documented in several cancers, including clear cell renal cell carcinoma (ccRCC). <i>SETD2</i> deficiency is associated with cancer occurrence and progression by regulating autophagy flux, general metabolic activity, and replication fork speed. Therefore, SETD2 is considered a potential epigenetic therapeutic target and is the subject of ongoing research on cancer-related diagnosis and treatment. This review presents an overview of the molecular functions of SETD2 in H3K36me3 regulation and its relationship with ccRCC, providing a theoretical basis for subsequent antitumor therapy based on SETD2 or H3K36me3 targets.
Also flagged:Cas9KITmastocytosissystemic mastocytosiscell-to-cell adhesionneoplasia
Journal Article2023-03-21✓ 1 SnippetBandara G, Falduto GH, Luker A, Bai Y, Pfeiffer A, Lack J, Metcalfe DD, Olivera A.
In-Text Gene Mentions
Methods)
…Human TruStain FcX and APC-conjugated anti-human c-KIT (clone 104D2), unlabeled anti-human KIT antibody (clone 104D2) and Zombie Aqua fixable viability dye were obtained from Biolegend (San Diego, CA); KIT antibody for IHC from Dako-Agilent (Santa Clara, CA); human SCF from R & D Systems; avapritinib, imatinib, dasatinib, midostaurin, fedratinib, STAT5-IN-1, SH4-54, venetoclax, ripretinib (DCC-2618), ruxolitinib, tofacitinib, and C188-9 from SelleckChem (Houston, TX); LY294002 and U0126 from Tocris (Minneapolis, MN); Pierce BCA assay and CyQuant cell proliferation assay from Thermo Fisher Scientific (Waltham, MA); and ViaStain propidium iodide (PI) staining solution from Nexelom Biosciences (Lawrence, MA).…
Show Full Abstract
The HMC-1.2 human mast cell (huMC) line is often employed in the study of attributes of neoplastic huMCs as found in patients with mastocytosis and their sensitivity to interventional drugs <i>in vitro</i> and <i>in vivo</i>. HMC-1.2 cells express constitutively active KIT, an essential growth factor receptor for huMC survival and function, due to the presence of two oncogenic mutations (D816V and V560G). However, systemic mastocytosis is commonly associated with a single D816V-KIT mutation. The functional consequences of the coexisting KIT mutations in HMC-1.2 cells are unknown. We used CRISPR/Cas9-engineering to reverse the V560G mutation in HMC-1.2 cells, resulting in a subline (HMC-1.3) with a single mono-allelic D816V-KIT variant. Transcriptome analyses predicted reduced activity in pathways involved in survival, cell-to-cell adhesion, and neoplasia in HMC-1.3 compared to HMC-1.2 cells, with differences in expression of molecular components and cell surface markers. Consistently, subcutaneous inoculation of HMC-1.3 into mice produced significantly smaller tumors than HMC-1.2 cells, and in colony assays, HMC-1.3 formed less numerous and smaller colonies than HMC-1.2 cells. However, in liquid culture conditions, the growth of HMC-1.2 and HMC-1.3 cells was comparable. Phosphorylation levels of ERK1/2, AKT and STAT5, representing pathways associated with constitutive oncogenic KIT signaling, were also similar between HMC-1.2 and HMC-1.3 cells. Despite these similarities in liquid culture, survival of HMC-1.3 cells was diminished in response to various pharmacological inhibitors, including tyrosine kinase inhibitors used clinically for treatment of advanced systemic mastocytosis, and JAK2 and BCL2 inhibitors, making HMC-1.3 more susceptible to these drugs than HMC-1.2 cells. Our study thus reveals that the additional V560G-KIT oncogenic variant in HMC-1.2 cells modifies transcriptional programs induced by D816V-KIT, confers a survival advantage, alters sensitivity to interventional drugs, and increases the tumorigenicity, suggesting that engineered huMCs with a single D816V-KIT variant may represent an improved preclinical model for mastocytosis.
Also flagged:Melanomaskin cancersCytokinetumorphosphorylationaminoacyl
Journal Article2023-03-21✓ 1 SnippetPu Z, Zhao Q, Chen J, Xie Y, Mou L, Zha X.
In-Text Gene Mentions
Results)
…TNFSF4was highly expressed…
Show Full Abstract
Melanoma is one of the deadliest skin cancers. Recently, developed single-cell sequencing has revealed fresh insights into melanoma. Cytokine signaling in the immune system is crucial for tumor development in melanoma. To evaluate melanoma patient diagnosis and treatment, the prediction value of cytokine signaling in immune-related genes (CSIRGs) is needed. In this study, the machine learning method of least absolute selection and shrinkage operator (LASSO) regression was used to establish a CSIRG prognostic signature of melanoma at the single-cell level. We discovered a 5-CSIRG signature that was substantially related to the overall survival of melanoma patients. We also constructed a nomogram that combined CSIRGs and clinical features. Overall survival of melanoma patients can be consistently predicted with good performance as well as accuracy by both the 5-CSIRG signature and nomograms. We compared the melanoma patients in the CSIRG high- and low-risk groups in terms of tumor mutation burden, infiltration of the immune system, and gene enrichment. High CSIRG-risk patients had a lower tumor mutational burden than low CSIRG-risk patients. The CSIRG high-risk patients had a higher infiltration of monocytes. Signaling pathways including oxidative phosphorylation, DNA replication, and aminoacyl tRNA biosynthesis were enriched in the high-risk group. For the first time, we constructed and validated a machine-learning model by single-cell RNA-sequencing datasets that have the potential to be a novel treatment target and might serve as a prognostic biomarker panel for melanoma. The 5-CSIRG signature may assist in predicting melanoma patient prognosis, biological characteristics, and appropriate therapy.
Also flagged:hemophilia Bhemophiliagene expressionimmune responseslipidAntithrombin
Journal Article2023-03-21✓ 3 SnippetsLee JH, Han JP, Song DW, Lee GS, Choi BS, Kim M, Lee Y, Kim S, Lee H, Yeom SC.
In-Text Gene Mentions
Abstract)
…Member 1 [Serpinc1]) was selected…
Abstract)
…deletions (indels) inSerpinc1and 67% reduction…
Text
…Serpinc1…
Show Full Abstract
Recent therapeutic strategies for hemophilia include long-term therapeutic gene expression using adeno-associated virus (AAV) and rebalancing therapy via the downregulation of anticoagulant pathways. However, these approaches have limitations in immune responses or insufficiency to control acute bleeding. Thus, we developed a therapeutic strategy for hemophilia B by a combined rebalancing and human factor 9 (h<i>F9</i>) gene knockin (KI) using a lipid nanoparticle (LNP) and AAV. Antithrombin (AT; Serpin Family C Member 1 [<i>Serpinc1</i>]) was selected as the target anticoagulation pathway for the gene KI. First, the combined use of LNP-clustered regularly interspaced short palindromic repeats (CRISPR) and AAV donor resulted in 20% insertions or deletions (indels) in <i>Serpinc1</i> and 67% reduction of blood mouse AT concentration. Second, h<i>F9</i> coding sequences were integrated into approximately 3% of the target locus. h<i>F9</i> KI yielded approximately 1,000 ng/mL human factor IX (hFIX) and restored coagulation activity to a normal level. LNP-CRISPR injection caused sustained AT downregulation and hFIX production up to 63 weeks. AT inhibition and hFIX protein-production ability could be maintained by the proliferation of genetically edited hepatocytes in the case of partial hepatectomy. The co-administration of AAV and LNP showed no severe side effects except random integrations. Our results demonstrate hemophilia B therapy by a combination of rebalancing and h<i>F9</i> KI using LNP and AAV.
Journal Article2023-03-21✓ 1 SnippetGao H, Cao Z, Liu H, Chen L, Bai Y, Wu Q, Yu X, Wei W, Wang M.
In-Text Gene Mentions
S I O 001029)
…Based on this concept, Han's group used hollow Fe3+/ tannic acid (HFE-TA) nanocapsules as carriers to deliver AAO for synergistic tumor treatment 179.…
Show Full Abstract
Chemodynamic therapy (CDT) is well-known for using the tumor microenvironment to activate the Fenton reaction or Fenton-like reaction to generate strong oxidative hydroxyl radicals for tumor-specific treatment. It is highly selective and safe, without depth limitation of tissue penetration, and shows its potential as a new green therapeutic method with great clinical application. However, the catalytic efficiency of reagents involved in the Fenton reaction is severely affected by the inherent microenvironmental limitations of tumors and the strict Fenton reaction-dependent conditions. With the increasing application of nanotechnology in the medical field, combined therapies based on different types of functional nanomaterials have opened up new avenues for the development of next-generation CDT-enhanced system. This review will comprehensively exemplify representative results of combined therapies of CDT with other antitumor therapies such as chemotherapy, phototherapy, sonodynamic therapy, radiation therapy, magnetic hyperthermia therapy, immunotherapy, starvation therapy, gas therapy, gene therapy, oncosis therapy, or a combination thereof for improving antitumor efficiency from hundreds of the latest literature, introduce strategies such as the ingenious design of nanomedicines and tumor microenvironment regulations to enhance the combination therapy, and further summarize the challenges and future perspective of CDT-based multimodal anticancer therapy.
Also flagged:lysophosphatidic acidsignal transductionovarian canceractomyosinovarian high-grade serous cancercancer
Journal Article2023-03-21No SnippetsOjasalu K, Lieber S, Sokol AM, Nist A, Stiewe T, Bullwinkel I, Finkernagel F, Reinartz S, Müller-Brüsselbach S, Grosse R, Graumann J, Müller R.
Show Full Abstract
Lysophosphatidic acid (LPA) species accumulate in the ascites of ovarian high-grade serous cancer (HGSC) and are associated with short relapse-free survival. LPA is known to support metastatic spread of cancer cells by activating a multitude of signaling pathways via G-protein-coupled receptors of the LPAR family. Systematic unbiased analyses of the LPA-regulated signal transduction network in ovarian cancer cells have, however, not been reported to date. <b>Methods:</b> LPA-induced signaling pathways were identified by phosphoproteomics of both patient-derived and OVCAR8 cells, RNA sequencing, measurements of intracellular Ca<sup>2+</sup> and cAMP as well as cell imaging. The function of LPARs and downstream signaling components in migration and entosis were analyzed by selective pharmacological inhibitors and RNA interference. <b>Results:</b> Phosphoproteomic analyses identified > 1100 LPA-regulated sites in > 800 proteins and revealed interconnected LPAR1, ROCK/RAC, PKC/D and ERK pathways to play a prominent role within a comprehensive signaling network. These pathways regulate essential processes, including transcriptional responses, actomyosin dynamics, cell migration and entosis. A critical component of this signaling network is MYPT1, a stimulatory subunit of protein phosphatase 1 (PP1), which in turn is a negative regulator of myosin light chain 2 (MLC2). LPA induces phosphorylation of MYPT1 through ROCK (T853) and PKC/ERK (S507), which is majorly driven by LPAR1. Inhibition of MYPT1, PKC or ERK impedes both LPA-induced cell migration and entosis, while interference with ROCK activity and MLC2 phosphorylation selectively blocks entosis, suggesting that MYPT1 figures in both ROCK/MLC2-dependent and -independent pathways. We finally show a novel pathway governed by LPAR2 and the RAC-GEF DOCK7 to be indispensable for the induction of entosis. <b>Conclusion:</b> We have identified a comprehensive LPA-induced signal transduction network controlling LPA-triggered cytoskeletal changes, cell migration and entosis in HGSC cells. Due to its pivotal role in this network, MYPT1 may represent a promising target for interfering with specific functions of PP1 essential for HGSC progression.
Also flagged:titanyl phosphatehereditary hemorrhagic telangiectasiahemostasisHHTthrombingelatin
Journal Article2023-03-21No SnippetsPyne JM, Murray S, Kelly BC, Song JS, Rosvall BR, Côté DWJ.
Show Full Abstract
<h4>Background</h4>To help ensure adequate hemostasis immediately following potassium titanyl phosphate (KTP) laser treatment, many centres treating hereditary hemorrhagic telangiectasia (HHT) routinely use nasal packing post-operatively. The purpose of this study was to compare hemostatic thrombin matrix with standard packing for postoperative bleeding, patient pain, and comfort.<h4>Methods</h4>A prospective, randomized, double-blinded, non-inferiority study was conducted with participants at an HHT centre of excellence (COE) and randomized to the treatment group with reconstituted thrombin gelatin matrix (Surgiflo®) or control group with a biodegradable synthetic polyurethane foam (NasoPore®). Adult subjects with confirmed HHT and moderate to severe epistaxis (a minimum calculated epistaxis severity score [ESS] of 4.0) warranting KTP laser treatment were recruited. Data was collected 2 weeks post operatively by a blinded reviewer completing a visual outcomes evaluation and each patient completing a subjective symptoms questionnaire. Non-parametric statistical analysis was employed.<h4>Results</h4>Twenty-eight adult patients were randomized to the treatment and control arms with comparable preoperative epistaxis severity scores. Postoperative nasal bleeding was equivalent. Significantly less pain was found in the treatment arm (<i>p</i> = .005). While there were trends towards less obstruction and increased satisfaction in the treatment group as well as less crusting in the control group, these findings were not statistically significant. Allocation to the treatment group was associated with an approximately $75 higher cost.<h4>Conclusions</h4>When compared to NasoPore® for hemostasis, Surgiflo® hemostatic matrix performed equivalently while causing less discomfort in HHT patients following nasal KTP treatment.<h4>Level of evidence</h4>1b.
Also flagged:LocalizationIdiopathic Inflammatory MyopathiesIIMMyositisLINC00924STAT4
Journal Article2023-03-20✓ 2 SnippetsRothwell S, Amos CI, Miller FW, Rider LG, Lundberg IE, Gregersen PK, Vencovsky J, McHugh N, Limaye V, Selva-O'Callaghan A, Hanna MG, Machado PM, Pachman LM, Reed AM, Molberg Ø, Benveniste O, Mathiesen P, Radstake T, Doria A, De Bleecker JL, De Paepe B, Maurer B, Ollier WE, Padyukov L, O'Hanlon TP, Lee A, Wedderburn LR, Chinoy H, Lamb JA, Myositis Genetics Consortium.
In-Text Gene Mentions
Discussion)
…suggestive association withPLCL1( P =…
Discussion)
…Variants inPLCL1, a gene…
Show Full Abstract
<h4>Objective</h4>The idiopathic inflammatory myopathies (IIMs) are heterogeneous diseases thought to be initiated by immune activation in genetically predisposed individuals. We imputed variants from the ImmunoChip array using a large reference panel to fine-map associations and identify novel associations in IIM.<h4>Methods</h4>We analyzed 2,565 Caucasian IIM patient samples collected through the Myositis Genetics Consortium (MYOGEN) and 10,260 ethnically matched control samples. We imputed 1,648,116 variants from the ImmunoChip array using the Haplotype Reference Consortium panel and conducted association analysis on IIM and clinical and serologic subgroups.<h4>Results</h4>The HLA locus was consistently the most significantly associated region. Four non-HLA regions reached genome-wide significance, SDK2 and LINC00924 (both novel) and STAT4 in the whole IIM cohort, with evidence of independent variants in STAT4, and NAB1 in the polymyositis (PM) subgroup. We also found suggestive evidence of association with loci previously associated with other autoimmune rheumatic diseases (TEC and LTBR). We identified more significant associations than those previously reported in IIM for STAT4 and DGKQ in the total cohort, for NAB1 and FAM167A-BLK loci in PM, and for CCR5 in inclusion body myositis. We found enrichment of variants among DNase I hypersensitivity sites and histone marks associated with active transcription within blood cells.<h4>Conclusion</h4>We found novel and strong associations in IIM and PM and localized signals to single genes and immune cell types.
Also flagged:tumorstumorchromosomeimmune responsecell adhesionangiogenesis
Journal Article2023-03-20✓ 5 SnippetsSong S, Feng L, Xi K, Sun Z, Kong D, Luo Z, Pei W, Zhang H.
In-Text Gene Mentions
Discussion)
…In CRC, OLFM4 initiates organoid culture growth and a differentiation capacity serving as a stem cell marker,[53,54] which demonstrated the major role of OLFM4+ tumor cells in the early stage, as we found enrichment of various important pathways in C1, such as Wnt, transforming growth factor beta (TGF-β), and Notch pathways.…
Results)
…Additionally, in the scRNA-seq dataset (SMC and KUL3 cohorts), OLFM4 expression was the lowest in the C3 tumor cell cluster, which was related to angiogenesis and cell adhesion activity, and the highest in the C1 tumor cell, which was associated with immune activity and the classical pathway in cancer [Figures 5J and 5K].…
S I O 001029)
…(J) Expression level of OLFM4 in three tumor clusters of the SMC cohort.…
S I O 001029)
…(K) Expression level of OLFM4 in three tumor clusters of the KUL3 cohort.…
Discussion)
…OLFM4 also inhibits cell adhesion and migration,[55] which was consistent with the cell adhesion activity of C3 with the lowest OLFM4 expression compared with the other two tumor clusters.…
Show Full Abstract
<h4>Background</h4>With functionally heterogeneous cells, tumors comprise a complex ecosystem to promote tumor adaptability and evolution under strong selective pressure from the given microenvironment. Diversifying tumor cells or intra-tumor heterogeneity is essential for tumor growth, invasion, and immune evasion. However, no reliable method to classify tumor cell subtypes is yet available. In this study, we introduced the single-cell sequencing combined with copy number characteristics to identify the types of tumor cells in microsatellite stable (MSS) colorectal cancer (CRC).<h4>Methods</h4>To characterize the somatic copy number alteration (SCNA) of MSS CRC in a single cell profile, we analyzed 26 tissue samples from 19 Korean patients (GSE132465, the Samsung Medical Center [SMC] dataset) and then verified our findings with 15 tissue samples from five Belgian patients (GSE144735, the Katholieke Universiteit Leuven 3 [KUL3] dataset). The Cancer Genome Atlas (TCGA) cohort, GSE39582 cohort, and National Cancer Center (NCC) cohort (24 MSS CRC patients were enrolled in this study between March 2017 and October 2017) were used to validate the clinical features of prognostic signatures.<h4>Results</h4>We employed single cell RNA-sequencing data to identify three types of tumor cells in MSS CRC by their SCNA characteristics. Among these three types of tumor cells, C1 and C3 had a higher SCNA burden; C1 had significant chromosome 13 and 20 amplification, whereas C3 was the polar opposite of C1, which exhibited deletion in chromosome 13 and 20. The three types of tumor cells exhibited various functions in the tumor microenvironment and harbored different mutations. C1 and C2 were linked to the immune response and hypoxia, respectively, while C3 was critical for cell adhesion activity and tumor angiogenesis. Additionally, one gene ( OLFM4 ) was identified as epithelium-specific biomarker of better prognosis of CRC (TCGA cohort: P = 0.0110; GSE39582 cohort: P = 0.0098; NCC cohort: P = 0.0360).<h4>Conclusions</h4>On the basis of copy number characteristics, we illustrated tumor heterogeneity in MSS CRC and identified three types of tumor cells with distinct roles in tumor microenvironment. By understanding heterogeneity in the intricate tumor microenvironment, we gained an insight into the mechanisms of tumor evolution, which may support the development of therapeutic strategies.
Also flagged:intrahepatic cholangiocarcinomaextrahepatic cholangiocarcinomatumorgene expressionCCcholangiocarcinoma
Journal Article2023-03-20✓ 1 SnippetSilvestri M, Nghia Vu T, Nichetti F, Niger M, Di Cosimo S, De Braud F, Pruneri G, Pawitan Y, Calza S, Cappelletti V.
<h4>Background</h4>Cholangiocarcinoma (CC) is a rare and aggressive disease with limited therapeutic options and a poor prognosis. All available public records of cohorts reporting transcriptomic data on intrahepatic cholangiocarcinoma (ICC) and extrahepatic cholangiocarcinoma (ECC) were collected with the aim to provide a comprehensive gene expression-based classification with clinical relevance.<h4>Methods</h4>A total of 543 patients with primary tumor tissues profiled by RNAseq and microarray platforms from seven public datasets were used as a discovery set to identify distinct biological subgroups. Group predictors developed on the discovery sets were applied to a single cohort of 131 patients profiled with RNAseq for validation and assessment of clinical relevance leveraging machine learning techniques.<h4>Results</h4>By unsupervised clustering analysis of gene expression data we identified both in the ICC and ECC discovery datasets four subgroups characterized by a distinct type of immune infiltrate and signaling pathways. We next developed class predictors using short gene list signatures and identified in an independent dataset subgroups of ICC tumors at different prognosis.<h4>Conclusions</h4>The developed class-predictor allows identification of CC subgroups with specific biological features and clinical behavior at single-sample level. Such results represent the starting point for a complete molecular characterization of CC, including integration of genomics data to develop in clinical practice.
Also flagged:heatgene expressionmitochondrialNRF2insulinAMPK
Journal Article2023-03-20No SnippetsHorowitz M, Kopeliovich D, Berdugo R, Smith Y, Elgavish S, Schermann H, Moran DS.
Show Full Abstract
Thermal intolerance may limit activity in hostile environments. After heat illness, two physiologically distinct phenotypes evolve: heat tolerant (HT) and heat intolerant (HI). The recognition that heat illness alters gene expression justified revisiting the established physiological concept of HI. We used a DNA microarray to examine the global transcriptional response in peripheral blood mononuclear cells (PMBCs) from HI and HT phenotypes, categorized 2-mo postheat injury using a functional physiological heat-tolerance test (HTT, 40°C)-Recovery (R, 24°C) protocol. The impact of recurrent heat stress was studied in vitro using peripheral blood mononuclear cells (PBMCs) from controls (participants with no history of heat injury), HI, and HT (categorized by functional HTT) with a customized NanoString array. There were significant differences under basal conditions between the HI and HT. HI were more immunological alerted. Almost no shared genes were found between end-HTT and recovery phases, suggesting vast cellular plasticity. In HI, mitochondrial function was dysregulated, canonical pathways associated with exercise endurance-NRF2 and insulin were downregulated, whereas AMPK and peroxisome proliferator-activated receptor (PPAR) were upregulated. HT exhibited reciprocal responses, suggesting that energy dysregulation found in HI interfered with performance in the heat. The endoplasmic-reticulum stress response was also suppressed in HI. In vitro HTT (43°C) abolished differences between HI and HT PBMCs including the HSPs genes, whereas controls showed profound HSPs upregulation.
Vibrio vulnificus is a bacterium that inhabits warm seawater or brackish water environments and causes foodborne diseases and wound infections. In severe cases, V. vulnificus invades the skeletal muscle tissue, where bacterial proliferation leads to septicemia and necrotizing fasciitis with high mortality. Despite this characteristic, information on metabolic changes in tissue infected with V. vulnificus is not available. Here, we elucidated the metabolic changes in V. vulnificus-infected mouse skeletal muscle using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS). Metabolome analysis revealed changes in muscle catabolites and energy metabolites during V. vulnificus infection. In particular, succinic acid accumulated but fumaric acid decreased in the infected muscle. However, the virulence factor deletion mutant revealed that changes in metabolites and bacterial proliferation were abolished in skeletal muscle infected with a multifunctional-autoprocessing repeats-in-toxin (MARTX) mutant. On the other hand, mice that were immunosuppressed via cyclophosphamide (CPA) treatment exhibited a similar level of bacterial counts and metabolites between the wild type and MARTX mutant. Therefore, our data indicate that V. vulnificus induces metabolic changes in mouse skeletal muscle and proliferates by using the MARTX toxin to evade the host immune system. This study indicates a new correlation between V. vulnificus infections and metabolic changes that lead to severe reactions or damage to host skeletal muscle. <b>IMPORTANCE</b> V. vulnificus causes necrotizing skin and soft tissue infections (NSSTIs) in severe cases, with high mortality and sign of rapid deterioration. Despite the severity of the infection, the dysfunction of the host metabolism in skeletal muscle triggered by V. vulnificus is poorly understood. In this study, by using a mouse wound infection model, we revealed characteristic changes in muscle catabolism and energy metabolism in skeletal muscle associated with bacterial proliferation in the infected tissues. Understanding such metabolic changes in V. vulnificus-infected tissue may provide crucial information to identify the mechanism via which V. vulnificus induces severe infections. Moreover, our metabolite data may be useful for the recognition, identification, or detection of V. vulnificus infections in clinical studies.
Also flagged:axonaxon growth conesNetrin-1axonsgrowth conesbinding
Journal Article2023-03-20✓ 1 SnippetGabir H, Gupta M, Meier M, Heide F, Koch M, Stetefeld J, Demeler B.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
NET-1 is a key chemotropic ligand that signals commissural axon migration and change in direction. NET-1 and its receptor UNC-5B switch axon growth cones from attraction to repulsion. The biophysical properties of the NET-1 + UNC-5B complex have been poorly characterized. Using multi-wavelength-AUC by adding a fluorophore to UNC-5B, we were able to separate the UNC-5B sedimentation from NET-1. Using both multi-wavelength- and single-wavelength AUC, we investigated NET-1 and UNC-5B hydrodynamic parameters and complex formation. The sedimentation velocity experiments show that NET-1 exists in a monomer-dimer equilibrium. A close study of the association shows that NET-1 forms a pH-sensitive dimer that interacts in an anti-parallel orientation. UNC-5B can form equimolar NET-1 + UNC-5B heterocomplexes with both monomeric and dimeric NET-1.
Also flagged:deathchromosomespost-traumatic stress disordermajor depressive disorderPTSDEXD3
Journal Article2023-03-20✓ 5 SnippetsAshley-Koch AE, Kimbrel NA, Qin XJ, Lindquist JH, Garrett ME, Dennis MF, Hair LP, Huffman JE, Jacobson DA, Madduri RK, Coon H, Docherty AR, Kang J, Mullins N, Ruderfer DM, VA Million Veteran Program (MVP), MVP Suicide Exemplar Workgroup, International Suicide Genetics Consortium, Harvey PD, McMahon BH, Oslin DW, Hauser ER, Hauser MA, Beckham JC.
In-Text Gene Mentions
Abstract)
…with DRD2 ,DCC, FBXL19 ,…
Abstract)
…DRD2 , andDCC.…
Results)
…on chromosome 11,DCCon chromosome 18,…
Results)
…(chromosome 11), andDCC(chromosome 18) (…
Discussion)
…chromosome 11, andDCCon chromosome 18.…
Show Full Abstract
Suicidal ideation (SI) often precedes and predicts suicide attempt and death, is the most common suicidal phenotype and is over-represented in veterans. The genetic architecture of SI in the absence of suicide attempt (SA) is unknown, yet believed to have distinct and overlapping risk with other suicidal behaviors. We performed the first GWAS of SI without SA in the Million Veteran Program (MVP), identifying 99,814 SI cases from electronic health records without a history of SA or suicide death (SD) and 512,567 controls without SI, SA or SD. GWAS was performed separately in the four largest ancestry groups, controlling for sex, age and genetic substructure. Ancestry-specific results were combined via meta-analysis to identify pan-ancestry loci. Four genome-wide significant (GWS) loci were identified in the pan-ancestry meta-analysis with loci on chromosomes 6 and 9 associated with suicide attempt in an independent sample. Pan-ancestry gene-based analysis identified GWS associations with DRD2, DCC, FBXL19, BCL7C, CTF1, ANNK1, and EXD3. Gene-set analysis implicated synaptic and startle response pathways (q's<0.05). European ancestry (EA) analysis identified GWS loci on chromosomes 6 and 9, as well as GWS gene associations in EXD3, DRD2, and DCC. No other ancestry-specific GWS results were identified, underscoring the need to increase representation of diverse individuals. The genetic correlation of SI and SA within MVP was high (rG = 0.87; p = 1.09e-50), as well as with post-traumatic stress disorder (PTSD; rG = 0.78; p = 1.98e-95) and major depressive disorder (MDD; rG = 0.78; p = 8.33e-83). Conditional analysis on PTSD and MDD attenuated most pan-ancestry and EA GWS signals for SI without SA to nominal significance, with the exception of EXD3 which remained GWS. Our novel findings support a polygenic and complex architecture for SI without SA which is largely shared with SA and overlaps with psychiatric conditions frequently comorbid with suicidal behaviors.
Also flagged:gene expressionneurological diseasesSTRspinobulbar muscular atrophyFragile X Syndromemyotonic dystrophy
Journal Article2023-03-20✓ 5 SnippetsWright SE, Todd PK.
In-Text Gene Mentions
Introduction)
…This risk-allele model is already apparent, as intermediate CAG repeat expansions in ATXN1, ATXN2, and HTT are associated with sporadic ALS and some other common neurodegenerative disorders (Elden et al., 2010; Rosas et al., 2020).…
Introduction)
…Splicing of the HTT huntingtin gene, which contains a CAG repeat, is altered at expanded repeats associated with Huntington’s Disease, resulting in the production of a transcript containing only exon 1 and the production of an exon 1 HTT protein (Gipson et al., 2013; Sathasivam et al., 2013; Neueder et al., 2017; Neueder et al., 2018; Franich et al., 2019).…
Introduction)
…huntingtin gene (HTT) produces a…
Introduction)
…tract in theHTTprotein which serves…
Introduction)
…HTTprotein structure is…
Show Full Abstract
Over a third of the human genome is comprised of repetitive sequences, including more than a million short tandem repeats (STRs). While studies of the pathologic consequences of repeat expansions that cause syndromic human diseases are extensive, the potential native functions of STRs are often ignored. Here, we summarize a growing body of research into the normal biological functions for repetitive elements across the genome, with a particular focus on the roles of STRs in regulating gene expression. We propose reconceptualizing the pathogenic consequences of repeat expansions as aberrancies in normal gene regulation. From this altered viewpoint, we predict that future work will reveal broader roles for STRs in neuronal function and as risk alleles for more common human neurological diseases.
Also flagged:Neurodegenerative Diseasespsychiatric disorderspsychosisdelusionshallucinationsneurodegenerative disease
Journal Article2023-03-20No SnippetsSeritan AL.
Show Full Abstract
<b>Background:</b> Approximately 15% of older adults may experience psychotic phenomena. Primary psychiatric disorders that manifest with psychosis (delusions, hallucinations, and disorganized thought or behavior) account for less than half. Up to 60% of late-life psychotic symptoms are due to systemic medical or neurological conditions, particularly neurodegenerative diseases. A thorough medical workup including laboratory tests, additional procedures if indicated, and neuroimaging studies is recommended. This narrative review summarizes current evidence regarding the epidemiology and phenomenology of psychotic symptoms encountered as part of the neurodegenerative disease continuum (including prodromal and manifest stages). <b>Results:</b> Prodromes are constellations of symptoms that precede the onset of overt neurodegenerative syndromes. Prodromal psychotic features, particularly delusions, have been associated with an increased likelihood of receiving a neurodegenerative disease diagnosis within several years. Prompt prodrome recognition is crucial for early intervention. The management of psychosis associated with neurodegenerative diseases includes behavioral and somatic strategies, although evidence is scarce and mostly limited to case reports, case series, or expert consensus guidelines, with few randomized controlled trials. <b>Conclusion:</b> The complexity of psychotic manifestations warrants management by interprofessional teams that provide coordinated, integrated care.
Also flagged:chromosometranscription factorchromatinDNA methyltransferasespolycomb repressorchromosomes
Journal Article2023-03-20✓ 1 SnippetDjeghloul D, Dimond A, Cheriyamkunnel S, Kramer H, Patel B, Brown K, Montoya A, Whilding C, Wang YF, Futschik ME, Veland N, Montavon T, Jenuwein T, Merkenschlager M, Fisher AG.
In-Text Gene Mentions
Results)
…be relevant becauselinker histoneshistones have been…
Show Full Abstract
Recent studies have shown that repressive chromatin machinery, including DNA methyltransferases and polycomb repressor complexes, binds to chromosomes throughout mitosis and their depletion results in increased chromosome size. In the present study, we show that enzymes that catalyze H3K9 methylation, such as Suv39h1, Suv39h2, G9a and Glp, are also retained on mitotic chromosomes. Surprisingly, however, mutants lacking histone 3 lysine 9 trimethylation (H3K9me3) have unusually small and compact mitotic chromosomes associated with increased histone H3 phospho Ser10 (H3S10ph) and H3K27me3 levels. Chromosome size and centromere compaction in these mutants were rescued by providing exogenous first protein lysine methyltransferase Suv39h1 or inhibiting Ezh2 activity. Quantitative proteomic comparisons of native mitotic chromosomes isolated from wild-type versus Suv39h1/Suv39h2 double-null mouse embryonic stem cells revealed that H3K9me3 was essential for the efficient retention of bookmarking factors such as Esrrb. These results highlight an unexpected role for repressive heterochromatin domains in preserving transcription factor binding through mitosis and underscore the importance of H3K9me3 for sustaining chromosome architecture and epigenetic memory during cell division.
Also flagged:Fibrinogenrenal interstitial fibrosischronic kidney diseaserenal fibrosisIgANgene expression
Journal Article2023-03-20✓ 2 SnippetsGuan J, Wang M, Zhao M, Ni W, Zhang M.
In-Text Gene Mentions
Results)
…Among the 16 related over-expressed urine proteins (Fig. 2), C4B, C5, C8B, C8G, C9, FGG, PROS1, SERPINC1 and SERPIND1 increased in IgAN patients with the extent of renal fibrosis.…
Results)
…C9, FGG, PROS1,SERPINC1and SERPIND1 increased…
Show Full Abstract
<h4>Background</h4>IgA nephropathy (IgAN) is a major cause of chronic kidney disease (CKD). Renal interstitial fibrosis is a hallmark of CKD progression. Non-invasive biomarkers are needed to dynamically evaluate renal fibrosis. Data independent acquisition (DIA)-based liquid chromatography-mass spectrometry (DIA-MS) was used to identify candidate urinary biomarkers in IgAN patients with different renal interstitial fibrosis degrees.<h4>Methods</h4>Eighteen biopsy-proven IgAN patients and six healthy controls were recruited in a discovery cohort. Interstitial fibrosis changes were evaluated according to Oxford MEST-C scores. Urinary samples were analyzed with DIA-MS to identify hub proteins. Hub proteins were then confirmed by enzyme-linked immunosorbent assay (ELISA) in a validation cohort and the associated gene mRNA expression was analyzed using public gene expression omnibus (GEO) datasets.<h4>Results</h4>Complement and coagulation cascades pathway was the main KEGG pathway related to the over-expressed proteins. Fibrinogen γ-Chain (FGG) was selected as the potential urinary marker for further validation. Urinary FGG to creatinine ratio (uFGG/Cr) levels were higher in both disease controls and IgAN group than in healthy controls, but were not significantly different between IgAN and disease groups. uFGG/Cr was confirmed to be increased with the extent of renal fibrosis and presented moderate correlations with T score (r = 0.614, p < 0.01) and eGFR (r = -0.682, p < 0.01), and a mild correlation with UTP (r = 0.497, p < 0.01) in IgAN group. In disease control group, uFGG/Cr was higher in patients with T1 + 2 compared to those with T0. uFGG/Cr had a good discriminatory power to distinguish different fibrosis stages in IgAN: interstitial fibrosis ≤ 5% (minimal fibrosis) vs. interstitial fibrosis (mild fibrosis) > 5%, AUC 0.743; T0 vs. T1 + 2, AUC 0.839; T0 + 1 vs. T2, AUC 0.854. In disease control group, uFGG/Cr showed better performance of AUC than UTP between minimal and mild fibrosis (p = 0.038 for Delong's test). Moreover, GSE104954 dataset showed that FGG mRNA expression was up-regulated (fold change 1.20, p = 0.009) in tubulointerstitium of IgAN patients when compared to healthy living kidney donors.<h4>Conclusion</h4>Urinary FGG is associated with renal interstitial fibrosis and could be used as a noninvasive biomarker for renal fibrosis in IgAN.
Also flagged:osteoporosismineralKukoamine AmineralizationOPGlycogen Phosphorylase
Journal Article2023-03-20No SnippetsLuo L, Guan Z, Jin X, Guan Z, Jiang Y.
Show Full Abstract
<h4>Background</h4>Osteoporosis (OP) is a major and growing public health problem characterized by decreased bone mineral density and destroyed bone microarchitecture. Previous studies found that Lycium Chinense Mill (LC) has a potent role in inhibiting bone loss. Kukoamine A (KuA), a bioactive compound extract from LC was responsible for the anti-osteoporosis effect. This study aimed to investigate the anti-osteoporosis effect of KuA isolated from LC in treating OP and its potential molecular mechanism.<h4>Method</h4>In this study, network pharmacology and molecular docking were investigated firstly to find the active ingredients of LC such as KuA, and the target genes of OP by the TCMSP platform. The LC-OP-potential Target gene network was constructed by the STRING database and network maps were built by Cytoscape software. And then, the anti-osteoporotic effect of KuA in OVX-induced osteoporosis mice and MC3T3-E1 cell lines were investigated and the potential molecular mechanism including inflammation level, cell apoptosis, and oxidative stress was analyzed by dual-energy X-ray absorptiometry (DXA), micro-CT, ELISA, RT-PCR, and Western Blotting.<h4>Result</h4>A total of 22 active compounds were screened, and we found KuA was identified as the highest active ingredient. Glycogen Phosphorylase (PYGM) was the target gene associated with a maximum number of active ingredients of LC and regulated KuA. In vivo, KuA treatment significantly increased the bone mineral density and improve bone microarchitecture for example increased BV/TV, Tb.N and Tb.Th but reduced Tb.Sp in tibia and lumber 4. Furthermore, KuA increased mRNA expression of osteoblastic differentiation-related genes in OVX mice and protects against OVX-induced cell apoptosis, oxidative stress level and inflammation level. In vitro, KuA significantly improves osteogenic differentiation and mineralization in cells experiment. In addition, KuA also attenuated inflammation levels, cell apoptosis, and oxidative stress level.<h4>Conclusion</h4>The results suggest that KuA could protect against the development of OP in osteoblast cells and ovariectomized OP model mice and these found to provide a better understanding of the pharmacological activities of KuA again bone loss.
<h4>Background</h4>Oxidative stress plays an essential role in bone health among postmenopausal women. This study aimed to compare the oxidative stress biomarkers among postmenopausal women aged 50-65 years with normal bone mineral density, osteopenia, and osteoporosis.<h4>Methods</h4>In this observational study, 120 women with normal bone mineral density, 82 with osteopenia, and 86 with osteoporosis were selected based on the densitometry data obtained from the dual-energy X-ray absorptiometry method. The serum total antioxidant capacity (TAC), superoxide dismutase (SOD) activity, and malondialdehyde (MDA) levels were measured using biochemical methods. A binary logistic regression model adjusted for confounders was used to estimate the risk of osteopenia and osteoporosis. The P-value of <0.05 was considered statistically significant.<h4>Results</h4>There were significant differences between the three groups in age, menopausal age, body mass index, and education (P<0.05). According to the binary logistic regression model, higher SOD activity and serum TAC levels were associated with a lower risk of osteoporosis (adjusted odds ratio [aOR], 0.991; 95% confidence intervals [CI], 0.986 to 0.996; and aOR, 0.373; 95% CI, 0.141 to 0.986, respectively). MDA was a significant risk factor for osteopenia in postmenopausal women (aOR, 1.702; 95% CI, 1.125 to 2.576).<h4>Conclusion</h4>Higher SOD activity and serum TAC levels in the studied postmenopausal women were associated with a significantly lower risk of osteoporosis. Moreover, the risk of osteopenia increased significantly with higher serum MDA levels.
Also flagged:gene expressionmethylationtranscription factorsHGSPDGFBAR
Journal Article2023-03-20✓ 2 SnippetsSmetanina MA, Korolenya VA, Kel AE, Sevostyanova KS, Gavrilov KA, Shevela AI, Filipenko ML.
In-Text Gene Mentions
Results)
…zone organization (ERC2,PCDH17), regulation of protein…
Results)
…vesicle clustering (CDH2,PCDH17), regulation of cyclin-depend…
Show Full Abstract
Epigenomic changes in the venous cells exerted by oscillatory shear stress towards the endothelium may result in consolidation of gene expression alterations upon vein wall remodeling during varicose transformation. We aimed to reveal such epigenome-wide methylation changes. Primary culture cells were obtained from non-varicose vein segments left after surgery of 3 patients by growing the cells in selective media after magnetic immunosorting. Endothelial cells were either exposed to oscillatory shear stress or left at the static condition. Then, other cell types were treated with preconditioned media from the adjacent layer's cells. DNA isolated from the harvested cells was subjected to epigenome-wide study using Illumina microarrays followed by data analysis with GenomeStudio (Illumina), Excel (Microsoft), and Genome Enhancer (geneXplain) software packages. Differential (hypo-/hyper-) methylation was revealed for each cell layer's DNA. The most targetable master regulators controlling the activity of certain transcription factors regulating the genes near the differentially methylated sites appeared to be the following: (1) HGS, PDGFB, and AR for endothelial cells; (2) HGS, CDH2, SPRY2, SMAD2, ZFYVE9, and P2RY1 for smooth muscle cells; and (3) WWOX, F8, IGF2R, NFKB1, RELA, SOCS1, and FXN for fibroblasts. Some of the identified master regulators may serve as promising druggable targets for treating varicose veins in the future.
Also flagged:Polyphosphate Ester-Type Transportersoxytetracyclinephosphorusoxytetracycline hydrochlorideP4P6
Journal Article2023-03-20No SnippetsKozak M, Stasiuk A, Vlizlo V, Ostapiv D, Bodnar Y, Kuz'mina N, Figurka N, Nosova N, Ostapiv R, Kotsumbas I, Varvarenko S, Samaryk V.
Show Full Abstract
Prolonged use of antibiotics can cause toxicity in human and animal cells and lead to the development of antibiotic resistance. The development of drug delivery systems for enhanced antibacterial properties of antibiotics could reduce toxic effects and minimize the development of resistance. The aim of this study was to evaluate the effectiveness of oxytetracycline in complexes with new polyphosphate ester-type transporters and to investigate the antimicrobial effect of these complexes on <i>Escherichia coli</i>, <i>Pseudomonas aeruginosa</i>, and <i>Staphylococcus aureus</i> growth in vitro. Two polyphosphate ester-type transporters with different molecular weights were synthesized, and oxytetracycline was attached through the phosphorus groups. To determine the sensitivities of microorganisms, oxytetracycline hydrochloride and oxytetracycline complexes with polyphosphate ester-type transporters (P4 and P6) were added to liquid and solid media with <i>E. coli</i>, <i>P. aeruginosa</i>, and <i>S. aureus</i> in different doses. Oxytetracycline in complex with polyphosphate ester-type transporters at low doses (2.3 to 3.8 μg/disk or μg/mL) in both solid and liquid media inhibits the growth of <i>S. aureus</i> more effectively than oxytetracycline alone. The maximum influence on <i>E. coli</i> growth on solid media is observed at a dose of 8 μg/disk of oxytetracycline in combination with both P4 and P6 polyphosphate ester-type transporters. <i>P. aeruginosa</i> growth under the influence of oxytetracycline in combination with polyphosphate-ester type transporters in a liquid medium depends on the dose of antibiotic and the day of cultivation.
Also flagged:Non-Alcoholic Fatty Liver DiseaseNAFLDchronic liver diseasenonalcoholic steatohepatitisNASHcirrhosis
Journal Article2023-03-20✓ 2 SnippetsZeng Q, Liu CH, Wu D, Jiang W, Zhang N, Tang H.
In-Text Gene Mentions
Results)
…Another four studies revealed that the serum TGFB2/TGFB2-OT1, lnc-SPARCL1-1:2, lncRNA RABGAP1L-DT-206, MALAT1, Neat1, and HULC expression were significantly higher in patients with advanced fibrosis/cirrhosis (F = 3–4) than in those without it (F = 0–2) [23,34,43,47].…
Non-alcoholic fatty liver disease (NAFLD) is currently the most common cause of chronic liver disease worldwide. Early identification and prompt treatment are critical to optimize patient management and improve long-term prognosis. Long non-coding RNA (lncRNA) and circular RNA (circRNA) are recently emerging non-coding RNAs, and are highly stable and easily detected in the circulation, representing a promising non-invasive approach for predicting NAFLD. A literature search of the Pubmed, Embase, Web of Science, and Cochrane Library databases was performed and 36 eligible studies were retrieved, including 18 on NAFLD, 13 on nonalcoholic steatohepatitis (NASH), and 11 on fibrosis and/or cirrhosis. Dynamic changes in lncRNA expression were associated with the occurrence and progression of NAFLD, among which lncRNA NEAT1, MEG3, and MALAT1 exhibited great potential as biomarkers for NAFLD. Moreover, mitochondria-located circRNA SCAR can drive metaflammation and its inhibition might be a promising therapeutic target for NASH. In this systematic review, we highlight the great potential of lncRNA/circRNA for early diagnosis and progression assessment of NAFLD. To further verify their clinical value, large-cohort studies incorporating lncRNA and circRNA expression both in liver tissue and blood should be conducted. Additionally, detailed studies on the functional mechanisms of NEAT1, MEG3, and MALAT1 will be essential for elucidating their roles in diagnosing and treating NAFLD, NASH, and fibrosis.
Also flagged:Doxorubicincanceranthracyclinebreast cancergastric cancerlymphoma
Journal Article2023-03-20No SnippetsKuang Z, Wu J, Tan Y, Zhu G, Li J, Wu M.
Show Full Abstract
Doxorubicin (DOX), a broad-spectrum chemotherapy drug, is widely applied to the treatment of cancer; however, DOX-induced cardiotoxicity (DIC) limits its clinical therapeutic utility. However, it is difficult to monitor and detect DIC at an early stage using conventional detection methods. Thus, sensitive, accurate, and specific methods of diagnosis and treatment are important in clinical practice. MicroRNAs (miRNAs) belong to non-coding RNAs (ncRNAs) and are stable and easy to detect. Moreover, miRNAs are expected to become biomarkers and therapeutic targets for DIC; thus, there are currently many studies focusing on the role of miRNAs in DIC. In this review, we list the prominent studies on the diagnosis and treatment of miRNAs in DIC, explore the feasibility and difficulties of using miRNAs as diagnostic biomarkers and therapeutic targets, and provide recommendations for future research.
…determined by thehemochromatosisgenotype and transferrin…
Introduction)
…women and thehemochromatosisgenotype in men…
Show Full Abstract
Varying levels of transferrin (Tf) have been associated with different disease conditions and are known to play a crucial role in various malignancies. Regular monitoring of the variations in Tf levels can be useful for managing related diseases, especially for the prognosis of certain cancers. We fabricated an immunosensor based on graphene oxide (GO) nanosheets to indirectly detect Tf levels in cancer patients. The GO nanosheets were deposited onto an indium tin oxide (ITO)-coated glass substrate and annealed at 120 °C to obtain reduced GO (rGO) films, followed by the immobilization of an antibody, anti-Tf. The materials and sensor probe used were systematically characterized by UV-Visible spectroscopy (UV-Vis), X-ray diffraction (XRD), atomic force microscopy (AFM), and Fourier transform infrared spectroscopy (FTIR). Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and differential pulse voltammetry (DPV) were also used for the stepwise sensor probe characterizations and Tf detection in serum samples, respectively. The anti-Tf/rGO/ITO immunosensor DPV output demonstrated an excellent Tf detection capability in the linear range of 0.1 mg mL<sup>-1</sup> to 12 mg mL<sup>-1</sup> compared to the enzyme-linked immunosorbent assay (ELISA) detection range, with a limit of detection (LOD) of 0.010 ± 0.007 mg mL<sup>-1</sup>. Furthermore, the results of the fabricated immunosensor were compared with those of the ELISA and autobioanalyzer techniques, showing an outstanding match with < 5% error and demonstrating the immunosensor's clinical potential.
Also flagged:Non-Small Cell Lung CancerLung cancerdeathtyrosine kinaseVEGF receptorantibodies
Journal Article2023-03-20No SnippetsKról K, Mazur A, Stachyra-Strawa P, Grzybowska-Szatkowska L.
Show Full Abstract
Lung cancer is the leading cause of death worldwide for both men and women. Surgery can be offered as a radical treatment at stages I and II and selected cases of stage III (III A). Whereas at more advanced stages, combined modalities of treatment are applied: radiochemotherapy (IIIB) and molecularly targeted treatment (small molecule tyrosine kinase inhibitors, VEGF receptor inhibitors, monoclonal antibodies, and immunological treatment with monoclonal antibodies). Combination treatment, composed of radiotherapy and molecular therapy, is increasingly employed in locally advanced and metastatic lung cancer management. Recent studies have indicated a synergistic effect of such treatment and modification of immune response. The combination of immunotherapy and radiotherapy may result in the enhancement of the abscopal effect. Anti-angiogenic therapy, in combination with RT, is associated with high toxicity and should be not recommended. In this paper, the authors discuss the role of molecular treatment and the possibility of its concurrent use with radiotherapy in non-small cell lung cancer (NSCLC).
Also flagged:MitochondrialClasmatodendritic DegenerationNF-κBPDIDRP1Clasmatodendrosis
Journal Article2023-03-20✓ 2 SnippetsLee DS, Kim TH, Park H, Kim JE.
In-Text Gene Mentions
Discussion)
…and peroxiredoxin 6 (Prdx6) play important roles…
Discussion)
…dysregulation of thePrdx6-GPx1-mediated signaling pathw…
Show Full Abstract
Clasmatodendrosis is a kind of astroglial degeneration pattern which facilitates excessive autophagy. Although abnormal mitochondrial elongation is relevant to this astroglial degeneration, the underlying mechanisms of aberrant mitochondrial dynamics are still incompletely understood. Protein disulfide isomerase (PDI) is an oxidoreductase in the endoplasmic reticulum (ER). Since PDI expression is downregulated in clasmatodendritic astrocytes, PDI may be involved in aberrant mitochondrial elongation in clasmatodendritic astrocytes. In the present study, 26% of CA1 astrocytes showed clasmatodendritic degeneration in chronic epilepsy rats. 2-cyano-3,12-dioxo-oleana-1,9(11)-dien-28-oic acid methyl ester (CDDO-Me; bardoxolone methyl or RTA 402) and SN50 (a nuclear factor-κB (NF-κB) inhibitor) ameliorated the fraction of clasmatodendritic astrocytes to 6.8 and 8.1% in CA1 astrocytes, accompanied by the decreases in lysosomal-associated membrane protein 1 (LAMP1) expression and microtubule-associated protein 1A/1B light-chain 3 (LC3)-II/LC3-I ratio, indicating the reduced autophagy flux. Furthermore, CDDO-Me and SN50 reduced NF-κB S529 fluorescent intensity to 0.6- and 0.57-fold of vehicle-treated animal level, respectively. CDDO-Me and SN50 facilitated mitochondrial fission in CA1 astrocytes, independent of dynamin-related protein 1 (DRP1) S616 phosphorylation. In chronic epilepsy rats, total PDI protein, S-nitrosylated PDI (SNO-PDI), and SNO-DRP1 levels were 0.35-, 0.34- and 0.45-fold of control level, respectively, in the CA1 region and increased CDDO-Me and SN50. Furthermore, PDI knockdown resulted in mitochondrial elongation in intact CA1 astrocytes under physiological condition, while it did not evoke clasmatodendrosis. Therefore, our findings suggest that NF-κB-mediated PDI inhibition may play an important role in clasmatodendrosis via aberrant mitochondrial elongation.
Also flagged:Quinazolinonesquinazoline alkaloidsacetylcholinesterasedeoxyvasicinonevasicinoneLuotonin A
Journal Article2023-03-20No SnippetsWang Z, Zhao Y, Chen J, Chen M, Li X, Jiang T, Liu F, Yang X, Sun Y, Zhu Y.
Show Full Abstract
A practical method was developed for the convenient synthesis of isoxazole-fused tricyclic quinazoline alkaloids. This procedure accesses diverse isoxazole-fused tricyclic quinazoline alkaloids and their derivatives via intramolecular cycloaddition of methyl azaarenes with <i>tert</i>-butyl nitrite (TBN). In this method, TBN acts as the radical initiator and the source of N-O. Moreover, this protocol forms new C-N, C-C, and C-O bonds via sequence nitration and annulation in a one-pot process with broad substrate scope and functionalization of natural products.
Also flagged:deoxynivalenolethylisobutylchloroformatesynthesisantibodies
Journal Article2023-03-20No SnippetsHan L, Li Y, Jiang J, Liu C, Hou J, Wang B, Wang Z.
Show Full Abstract
The purpose of this experiment was to study the design and modification of hapten molecules and artificial antigen molecules of deoxynivalenol (DON), and to compare the preparation and identification methods of four artificial antigens. According to the characteristics of the molecular structure of DON, four artificial antigen coupling methods were designed-namely, N,N'-carbonyldiimidazole (CDI), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), isobutyl chloroformate (IBCF), and N-hydroxysuccinimide (NHS)-to prepare artificial antigens and detection antigens. Through ultraviolet (UV), infrared (IR), and SDS-polyacrylamide gel electrophoresis (SDS-PAGE), along with other physical and chemical identification methods and animal immunisation, the best artificial antigen coupling method was screened. The results showed that the CDI method achieved the best effect among the synthesis methods. The titre of anti-DON polyclonal antibody (pAb) produced by animal immunisation reached 1: (6.4 × 10<sup>3</sup>). The half inhibitory concentration (I<i>C</i><sub>50</sub>) was 47.75 ng/mL, the cross-reaction rate with 3-acetyldeoxynivalenol (3-AcDON) was slightly higher at 35.3%, and there was no cross-reaction with other compounds; therefore, four artificial antigens were successfully prepared by using the molecular structure of DON. Through identification, the CDI method was screened as the best artificial antigen synthesis method, with the highest DON pAb titre, the best sensitivity, and the strongest specificity. This will lay a solid antigenic foundation for the preparation of better anti-DON monoclonal antibodies (mAbs) in the future.
Also flagged:IncretinGlucoseMetabolismimpaired glucose toleranceincretin hormonesGlucagon-like peptide-1
Journal Article2023-03-20No SnippetsNagahisa T, Kosugi S, Yamaguchi S.
Show Full Abstract
The intestine has garnered attention as a target organ for developing new therapies for impaired glucose tolerance. The intestine, which produces incretin hormones, is the central regulator of glucose metabolism. Glucagon-like peptide-1 (GLP-1) production, which determines postprandial glucose levels, is regulated by intestinal homeostasis. Nicotinamide phosphoribosyltransferase (NAMPT)-mediated nicotinamide adenine dinucleotide (NAD<sup>+</sup>) biosynthesis in major metabolic organs such as the liver, adipose tissue, and skeletal muscle plays a crucial role in obesity- and aging-associated organ derangements. Furthermore, NAMPT-mediated NAD<sup>+</sup> biosynthesis in the intestines and its upstream and downstream mediators, adenosine monophosphate-activated protein kinase (AMPK) and NAD<sup>+</sup>-dependent deacetylase sirtuins (SIRTs), respectively, are critical for intestinal homeostasis, including gut microbiota composition and bile acid metabolism, and GLP-1 production. Thus, boosting the intestinal AMPK-NAMPT-NAD<sup>+</sup>-SIRT pathway to improve intestinal homeostasis, GLP-1 production, and postprandial glucose metabolism has gained significant attention as a novel strategy to improve impaired glucose tolerance. Herein, we aimed to review in detail the regulatory mechanisms and importance of intestinal NAMPT-mediated NAD<sup>+</sup> biosynthesis in regulating intestinal homeostasis and GLP-1 secretion in obesity and aging. Furthermore, dietary and molecular factors regulating intestinal NAMPT-mediated NAD<sup>+</sup> biosynthesis were critically explored to facilitate the development of new therapeutic strategies for postprandial glucose dysregulation.
Also flagged:Folic Acidamodiaquinecancerconjugationnon-small cell lung cancerbreast cancer
Journal Article2023-03-20No SnippetsParvathaneni V, Shukla SK, Gupta V.
Show Full Abstract
The objective of this study was to construct amodiaquine-loaded, folic acid-conjugated polymeric nanoparticles (FA-AQ NPs) to treat cancer that could be scaled to commercial production. In this study, folic acid (FA) was conjugated with a PLGA polymer followed by the formulation of drug-loaded NPs. The results of the conjugation efficiency confirmed the conjugation of FA with PLGA. The developed folic acid-conjugated nanoparticles demonstrated uniform particle size distributions and had visible spherical shapes under transmission electron microscopy. The cellular uptake results suggested that FA modification could enhance the cellular internalization of nanoparticulate systems in non-small cell lung cancer, cervical, and breast cancer cell types. Furthermore, cytotoxicity studies showed the superior efficacy of FA-AQ NPs in different cancer cells such as MDAMB-231 and HeLA. FA-AQ NPs had better anti-tumor abilities demonstrated via 3D spheroid cell culture studies. Therefore, FA-AQ NPs could be a promising drug delivery system for cancer therapy.
Also flagged:Synthesiscalcium phosphatecalcium pyrophosphatesiliconcalcium orthophosphatecancer
Journal Article2023-03-20No SnippetsRichard C, Alfred-Arulrasa M, Ramadas H, Mahagamage PT, Defforge T, Gaultier G, Autret-Lambert C, Poirot N, Champion E, Magnaudeix A.
Show Full Abstract
The purpose of the study was to investigate the synthesis of economic calcium phosphate powders from recycled oyster shells, using a ball milling method. The oyster shell powder and a calcium pyrophosphate powder were used as starting materials and ball milled, then heat treated at 1,050°C for 5 h to produce calcium phosphate powders through a solid-state reaction. Electrochemically synthesized mesoporous silicon microparticles were then added to the prepared phosphate powders by mechanical mixer. The final powders were characterized using X-ray diffraction, Fourier transform infrared spectroscopy, and scanning electron microscopy to analyze their chemical composition and determine the most suitable process conditions. The biocompatibility of the produced powders was also tested <i>in vitro</i> using murine cells and the results showed good biocompatibility.
Also flagged:IgA nephropathyIgANmembranous nephropathycomplement proteinscomplementglomerular filtration
Journal Article2023-03-20No SnippetsWang D, Wu C, Chen S, Li Y, Wang L, Zhang Y, Li G.
Show Full Abstract
<h4>Background and objectives</h4>The activated complement profile in IgA nephropathy (IgAN) is still unclear. Our study investigated the profile of urinary complements in IgAN patients and its correlations with clinical and pathological characteristics.<h4>Methods</h4>Urinary protein abundance was detected by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in 50 IgAN, 50 membranous nephropathy (MN), and 68 healthy controls (HC). Then, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to identify differentially expressed proteins in IgAN patients. The differentially expressed complement proteins were screened in IgAN patients, and their correlations with laboratory or pathological parameters were analyzed. Thereafter, 7 complement components were validated by enzyme-linked immunosorbent assay (ELISA) in the urine samples of 45 IgAN patients.<h4>Results</h4>There were 786 differentially expressed proteins between IgAN and HC. KEGG analysis showed that differentially expressed urinary proteins in IgAN were enriched with complement. Of these, 67% of urinary complement protein abundance was associated with the estimated glomerular filtration rate. The urinary complement-related protein collectin12 (colec12), complement H factor (CFH), complement H factor-related protein 2 (CFHR2), and complement B factor (CFB) were positively correlated with serum creatinine; colec12, CFHR2, CFB, and C8g were positively correlated with glomerulosclerosis; CFH, CFHR2, C8g, and C9 were positively correlated with tubular atrophy/interstitial fibrosis.<h4>Conclusion</h4>Abnormally increased components of complement pathways significantly correlate with reduced renal function, proteinuria, and renal histological damage in IgAN. It could provide a potential biomarker panel for monitoring IgAN and provide clues for therapeutic choice targeting complement system of IgAN patients.
Journal Article2023-03-20✓ 1 SnippetMeng H, Nan M, Li Y, Ding Y, Yin Y, Zhang M.
In-Text Gene Mentions
Introduction)
…involving APC, TP53,DCCand members of…
Show Full Abstract
Colon cancer is the fourth leading cause of cancer death worldwide, and its progression is accompanied by a complex array of genetic variations. CRISPR/Cas9 can identify new drug-resistant or sensitive mutations in colon cancer, and can use gene editing technology to develop new therapeutic targets and provide personalized treatments, thereby significantly improving the treatment of colon cancer patients. CRISPR/Cas9 systems are driving advances in biotechnology. RNA-directed Cas enzymes have accelerated the pace of basic research and led to clinical breakthroughs. This article reviews the rapid development of CRISPR/Cas in colon cancer, from gene editing to transcription regulation, gene knockout, genome-wide CRISPR tools, therapeutic targets, stem cell genomics, immunotherapy, metabolism-related genes and inflammatory bowel disease. In addition, the limitations and future development of CRISPR/Cas9 in colon cancer studies are reviewed. In conclusion, this article reviews the application of CRISPR-Cas9 gene editing technology in basic research, diagnosis and treatment of colon cancer.
Also flagged:measlesrubellamumpsimmunoglobulin GIgGTissue
Journal Article2023-03-20✓ 5 SnippetsZhu X, Zou Y, Jia L, Ye X, Zou Y, Tu J, Li J, Yu R, Yang S, Huang P.
In-Text Gene Mentions
Abstract)
…Results: We identified 19 significant genes (ULK4, AC010132.11, SURF1, NIPAL2, TRAP1, TAF1C, AC000078.5, RP4-639F20.1, RMDN2, ATP1B3, SRSF12, RP11-477D19.2, TFB1M, XXyac-YX65C7_A.2, TAF1C, PCGF2, and BNIP1) associated with IAV at a Bonferroni-corrected threshold of p < 0.05; 14 significant genes (SOAT1, COLGALT2, AC021860.1, HCG11, METTL21B, MRPL10, GSTM4, PAQR6, RP11-617D20.1, SNX8, METTL21B, ANKRD27, CBWD2, and TSFM) associated with measles at a Bonferroni-corrected threshold of p < 0.05; 15 significant genes (MTOR, LAMC1, TRIM38, U91328.21, POLR2J, SCRN2, Smpd4, UBN1, CNTROB, SCRN2, HOXB-AS1, SLC14A1, AC007566.10, AC093668.2, and CPD) associated with mumps at a Bonferroni-corrected threshold of p < 0.05; and 13 significant genes (JAGN1, RRP12, RP11-452K12.7, CASP7, AP3S2, IL17RC, FAM86HP, AMACR, RRP12, PPP2R1B, C11orf1, DLAT, and TMEM117) associated with rubella at a Bonferroni-corrected threshold of p < 0.05.…
Results)
…In mumps, we found six significant genes, namely, MTOR (padjusted = 0.029), LAMC1 (padjusted = 0.021), TRIM38 (padjusted = 0.014), U91328.21 (padjusted = 0.014), POLR2J (padjusted = 0.018), and SCRN2 (padjusted = 0.031) in the whole blood; similarly, in the lung tissue, we found Smpd4 (padjusted = 0.022), UBN1 (padjusted = 0.049), CNTROB (padjusted = 0.046), SCRN2 (padjusted = 0.008), HOXB-AS1 (padjusted = 0.048), and SLC14A1 (padjusted = 0.027) as mumps-related genes, while in the transformed fibroblast cells, we found AC007566.10 (padjusted = 0.023), AC093668.2 (padjusted = 0.047), and CPD (padjusted = 0.005) as significantly associated with mumps.…
<b>Objective:</b> We explore the candidate susceptibility genes for influenza A virus (IAV), measles, rubella, and mumps and their underlying biological mechanisms. <b>Methods:</b> We downloaded the genome-wide association study summary data of four virus-specific immunoglobulin G (IgG) level data sets (anti-IAV IgG, anti-measles IgG, anti-rubella IgG, and anti-mumps virus IgG levels) and integrated them with reference models of three potential tissues from the Genotype-Tissue Expression (GTEx) project, namely, whole blood, lung, and transformed fibroblast cells, to identify genes whose expression is predicted to be associated with IAV, measles, mumps, and rubella. <b>Results:</b> We identified 19 significant genes (ULK4, AC010132.11, SURF1, NIPAL2, TRAP1, TAF1C, AC000078.5, RP4-639F20.1, RMDN2, ATP1B3, SRSF12, RP11-477D19.2, TFB1M, XXyac-YX65C7_A.2, TAF1C, PCGF2, and BNIP1) associated with IAV at a Bonferroni-corrected threshold of <i>p</i> < 0.05; 14 significant genes (SOAT1, COLGALT2, AC021860.1, HCG11, METTL21B, MRPL10, GSTM4, PAQR6, RP11-617D20.1, SNX8, METTL21B, ANKRD27, CBWD2, and TSFM) associated with measles at a Bonferroni-corrected threshold of <i>p</i> < 0.05; 15 significant genes (MTOR, LAMC1, TRIM38, U91328.21, POLR2J, SCRN2, Smpd4, UBN1, CNTROB, SCRN2, HOXB-AS1, SLC14A1, AC007566.10, AC093668.2, and CPD) associated with mumps at a Bonferroni-corrected threshold of <i>p</i> < 0.05; and 13 significant genes (JAGN1, RRP12, RP11-452K12.7, CASP7, AP3S2, IL17RC, FAM86HP, AMACR, RRP12, PPP2R1B, C11orf1, DLAT, and TMEM117) associated with rubella at a Bonferroni-corrected threshold of <i>p</i> < 0.05. <b>Conclusions:</b> We have identified several candidate genes for IAV, measles, mumps, and rubella in multiple tissues. Our research may further our understanding of the pathogenesis of infectious respiratory diseases.
Also flagged:proteostasisHsp70AAA ATPase Hsp100chaperonesdegradationprotein homeostasis
Journal Article2023-03-20No SnippetsKohler V, Andréasson C.
Show Full Abstract
While proteins populating their native conformations constitute the functional entities of cells, protein aggregates are traditionally associated with cellular dysfunction, stress and disease. During recent years, it has become clear that large aggregate-like protein condensates formed <i>via</i> liquid-liquid phase separation age into more solid aggregate-like particles that harbor misfolded proteins and are decorated by protein quality control factors. The constituent proteins of the condensates/aggregates are disentangled by protein disaggregation systems mainly based on Hsp70 and AAA ATPase Hsp100 chaperones prior to their handover to refolding and degradation systems. Here, we discuss the functional roles that condensate formation/aggregation and disaggregation play in protein quality control to maintain proteostasis and why it matters for understanding health and disease.
Also flagged:pediatric respiratory system diseasesgene expressionimmune responseacquired pulmonary disordersInflammatory Responselung diseases
Journal Article2023-03-20No SnippetsBarzaghini B, Carelli S, Messa L, Rey F, Avanzini MA, Jacchetti E, Maghraby E, Berardo C, Zuccotti G, Raimondi MT, Cereda C, Calcaterra V, Pelizzo G.
Show Full Abstract
<h4>Purpose</h4>Mesenchymal stem cells (MSCs) represent a promising source for stem cell therapies in numerous diseases, including pediatric respiratory system diseases. Characterized by low immunogenicity, high anti-inflammatory, and immunoregulatory features, MSCs demonstrated an excellent therapeutic profile in numerous in vitro and preclinical models. MSCs reside in a specialized physiologic microenvironment, characterized by a unique combination of biophysical, biochemical, and cellular properties. The exploitation of the 3D micro-scaffold Nichoid, which simulates the native niche, enhanced the anti-inflammatory potential of stem cells through mechanical stimulation only, overcoming the limitation of biochemical and xenogenic growth factors application.<h4>Materials and methods</h4>In this work, we expanded pediatric bone marrow MSCs (BM-MSCs) inside the Nichoid and performed a complete cellular characterization with different approaches including viability assays, immunofluorescence analyses, RNA sequencing, and gene expression analysis.<h4>Results</h4>We demonstrated that BM-MSCs inside the scaffold remain in a stem cell quiescent state mimicking the condition of the in vivo environment. Moreover, the gene expression profile of these cells shows a significant up-regulation of genes involved in immune response when compared with the flat control.<h4>Conclusion</h4>The significant changes in the expression profile of anti-inflammatory genes could potentiate the therapeutic effect of BM-MSCs, encouraging the possible clinical translation for the treatment of pediatric congenital and acquired pulmonary disorders, including post-COVID lung manifestations.<h4>Lay summary</h4>Regenerative medicine is the research field integrating medicine, biology, and biomedical engineering. In this context, stem cells, which are a fundamental cell source able to regenerate tissues and restore damage in the body, are the key component for a regenerative therapeutic approach. When expanded outside the body, stem cells tend to differentiate spontaneously and lose regenerative potential due to external stimuli. For this reason, we exploit the scaffold named Nichoid, which mimics the in vivo cell niche architecture. In this scaffold, mesenchymal stem cells "feel at home" due to the three-dimensional mechanical stimuli, and our findings could be considered as an innovative culture system for the in vitro expansion of stem cells for clinical translation.<h4>Future perspective</h4>The increasing demand of safe and effective cell therapies projects our findings toward the possibility of improving cell therapies based on the use of BM-MSCs, particularly for their clinical translation in lung diseases.<h4>Graphical abstract</h4>
Also flagged:chronic hepatitis BHBV) infectionliver cirrhosishepatocellular carcinomacirrhosisinfectious diseases
Journal Article2023-03-20No SnippetsZhang L, Liu H, Zou Z, Su S, Ong JJ, Ji F, Cui F, Chan PL, Ning Q, Li R, Shen M, Fairley CK, Liu L, Seto WK, Wong WCW.
Show Full Abstract
<h4>Background</h4>We evaluate the impact and cost-effectiveness of shared primary-specialty chronic hepatitis B (CHB) care models in China.<h4>Methods</h4>We constructed a decision-tree Markov model to simulate hepatitis B virus (HBV) disease progression in a cohort of 100,000 CHB individuals aged ≥18 years over their lifetime (aged 80). We evaluated the population impacts and cost-effectiveness in three scenarios: (1) <i>status quo</i>; (2) shared-care model with HBV testing and routine CHB follow-ups in primary care and antiviral treatment initiation in specialty care; and (3) shared-care model with HBV testing, treatment initiation and routine CHB follow-up in primary care and treatment for predetermined conditions in specialty care. We evaluated from a healthcare provider's perspective with 3% discounting rate and a willingness-to-pay (WTP) threshold of 1-time China's GDP.<h4>Findings</h4>Compared with <i>status quo</i>, scenario 2 would result in an incremental cost of US$5.79-132.43m but a net gain of 328-16,993 quality-adjusted life years (QALYs) and prevention of 39-1935 HBV-related deaths over cohort's lifetime. Scenario 2 was not cost-effective with a WTP of 1-time GDP per capita, but became cost-effective when treatment initiation rate increased to 70%. In contrast, compared with <i>status quo</i>, secnario 3 would save US$144.59-192.93m in investment and achieve a net gain of 23,814-30,476 QALYs and prevention of 3074-3802 HBV-related deaths. Improving HBV antiviral treatment initiation among eligible CHB individuals substantially improved the cost-effectiveness of the shared-care models.<h4>Interpretation</h4>Shared-care models with HBV testing, follow up and referring of predetermined conditions to specialty care at an appropriate time, especially antiviral treatment initiation in primary care, are highly effective and cost-effective in China.<h4>Funding</h4>National Natural Science Foundation of China.
Also flagged:periventricular nodular heterotopiaNEDD4LPVNH7pathogenesiscleft palateprotein degradation
Journal Article2023-03-19✓ 1 SnippetLiu J, Hu J, Duan Y, Qin R, Guo C, Zhou H, Liu H, Liu C.
In-Text Gene Mentions
Discussion)
…pathological genes includeARFGEF2, FAT4 ,…
Show Full Abstract
<h4>Background</h4>Neurodevelopmental disorders associated with periventricular nodular heterotopia (PVNH) are characterized by phenotypic and genetic heterogeneity. NEDD4L mutation can lead to PVNH7. However, at present, only eight NEDD4L pathogenic variants have been identified across 15 cases of PVNH7 worldwide. Given this dearth of evidence, the precise correlations between genetic pathogenesis and phenotypes remain to be determined.<h4>Methods</h4>This report discusses the case of a 19-month-old male child with cleft palate, seizures, psychomotor retardation, and hypotonia, for whom we verified the genetic etiology using Trio-whole-exome and Sanger sequencing to analyze the potential pathogenicity of the mutant protein structure. Mutant plasmids were constructed for in vitro analyses. After transfection into human 293 T cells, the mutant transcription process was analyzed using real-time PCR (RT-PCR), and levels of mutant protein expression were examined using western blotting (WB) and immunofluorescence (IF) experiments.<h4>Results</h4>Genetic analyses revealed a novel missense mutation Gln900Arg, located in the homologous to E6-APC terminal (HECT) domain of NEDD4L and that the parents were wild-type, suggestive of a de novo mutation. The variant was predicted to be pathogenic by bioinformatics software, which also suggested alterations in the structural stability of the mutant protein. RT-PCR results indicated that the mutation did not affect mRNA expression, whereas WB and IF results indicated that the level of mutant protein was significantly reduced by 41.07%.<h4>Conclusion</h4>Functional experiments demonstrated that Gln900Arg probably did not lead to transcriptional abnormalities in this patient, instead leading to increased ubiquitination activity owing to the constitutive activation of the HECT domain, thereby promoting protein degradation. Extensive clinical reports should be generated for patients presenting with PVNH and/or polymicrogyria, developmental delay, syndactyly, and hypotonia to increase the pool of evidence related to NEDD4L.
Also flagged:gastric cancerdeathtumorN7-methylguanosinegene expressioncancer
Journal Article2023-03-19✓ 1 SnippetZhao B, Fang F, Liao Y, Chen Y, Wang F, Ma Y, Wei C, Zhao J, Ji H, Wang D, Tang D.
In-Text Gene Mentions
Results)
…TNFSF14, TNFSF18, andTNFSF4was found in…
Show Full Abstract
Presenting with a poor prognosis, gastric cancer (GC) remains one of the leading causes of disease and death worldwide. Long non-coding RNAs (lncRNAs) regulate tumor formation and have been long used to predict tumor prognosis. N7-methylguanosine (m7G) is the most prevalent RNA modification. m7G-lncRNAs regulate GC onset and progression, but their precise mechanism in GC is unclear. The objective of this research was the development of a new m7G-related lncRNA signature as a biomarker for predicting GC survival rate and guiding treatment. The Cancer Genome Atlas database helped extract gene expression data and clinical information for GC. Pearson correlation analysis helped point out m7G-related lncRNAs. Univariate Cox analysis helped in identifying m7G-related lncRNA with predictive capability. The Lasso-Cox method helped point out seven lncRNAs for the purpose of establishing an m7G-related lncRNA prognostic signature (m7G-LPS), followed by the construction of a nomogram. Kaplan-Meier analysis, univariate and multivariate Cox regression analysis, calibration plot of the nomogram model, receiver operating characteristic curve and principal component analysis were utilized for the verification of the risk model's reliability. Furthermore, q-PCR helped verify the lncRNAs expression of m7G-LPS in-vitro. The study subjects were classified into high and low-risk groups based on the median value of the risk score. Gene enrichment analysis confirmed the constructed m7G-LPS' correlation with RNA transcription and translation and multiple immune-related pathways. Analysis of the clinicopathological features revealed more progressive features in the high-risk group. CIBERSORT analysis showed the involvement of m7G-LPS in immune cell infiltration. The risk score was correlated with immune checkpoint gene expression, immune cell and immune function score, immune cell infiltration, and chemotherapy drug sensitivity. Therefore, our study shows that m7G-LPS constructed using seven m7G-related lncRNAs can predict the survival time of GC patients and guide chemotherapy and immunotherapy regimens as biomarker.
Also flagged:SucrosePrediabetesObesitychronic kidney diseaseinsulin resistancelipid
Journal Article2023-03-19✓ 5 SnippetsMéndez L, Muñoz S, Barros L, Miralles-Pérez B, Romeu M, Ramos-Romero S, Torres JL, Medina I.
In-Text Gene Mentions
Results)
…Deregulated Pebp1 has been implicated in diabetic nephropathy through the inhibition of NF-κB activation [76].…
Results)
…hanolamine-binding protein 1 (Pebp1), superoxide dismutase 2…
Results)
…relevant targets wasPebp1, belonging to PEBP…
Results)
…DeregulatedPebp1has been implicated…
Results)
…of carbonylation ofPebp1could partially explain…
Show Full Abstract
Obesity has been recognized as a major risk factor for chronic kidney disease, insulin resistance being an early common metabolic feature in patients suffering from this syndrome. This study aims to investigate the mechanism underlying the induction of kidney dysfunction and the concomitant onset of insulin resistance by long-term high-fat and sucrose diet feeding in Sprague Dawley rats. To achieve this goal, our study analyzed renal carbonylated protein patterns, ectopic lipid accumulation and fatty acid profiles and correlated them with biometrical and biochemical measurements and other body redox status parameters. Rats fed the obesogenic diet developed a prediabetic state and incipient kidney dysfunction manifested in increased plasma urea concentration and superior levels of renal fat deposition and protein carbonylation. An obesogenic diet increased renal fat by preferentially promoting the accumulation of saturated fat, arachidonic, and docosahexaenoic fatty acids while decreasing oleic acid. Renal lipotoxicity was accompanied by selectively higher carbonylation of proteins involved in the blood pH regulation, i.e., bicarbonate reclamation and synthesis, amino acid, and glucose metabolisms, directly related to the onset of insulin resistance. This study also tested the combination of antioxidant properties of fish oil with the anti-diabetic properties of buckwheat D-Fagomine to counteract diet-induced renal alterations. Results demonstrated that bioactive compounds combined attenuated lipotoxicity, induced more favorable lipid profiles and counteracted the excessive carbonylation of proteins associated with pH regulation in the kidneys, resulting in an inhibition of the progression of the prediabetes state and kidney disease.
Also flagged:nanomaterialslayered double hydroxidesLDHsilicatemontmorillonitegraphitic carbon nitride
Journal Article2023-03-19No SnippetsYu S, Choi G, Choy JH.
Show Full Abstract
Two-dimensional nanomaterials, particularly layered double hydroxides (LDHs), have been widely applied in the biomedical field owing to their biocompatibility, biodegradability, controllable drug release/loading ability, and enhanced cellular permeability. Since the first study analyzing intercalative LDHs in 1999, numerous studies have investigated their biomedical applications, including drug delivery and imaging; recent research has focused on the design and development of multifunctional LDHs. This review summarizes the synthetic strategies and in-vivo and in-vitro therapeutic actions and targeting properties of single-function LDH-based nanohybrids and recently reported (from 2019 to 2023) multifunctional systems developed for drug delivery and/or bio-imaging.
Also flagged:Carnosinesecretionmuscle cell differentiationl -histidineimidazole dipeptideAlzheimer
Journal Article2023-03-19✓ 1 SnippetIshibashi A, Udono M, Sato M, Katakura Y.
In-Text Gene Mentions
Results)
…in colorectal cancer (DCC), receptors for Netrin-1,…
Show Full Abstract
Carnosine is known to improve brain function. The molecular basis for the carnosine-mediated interaction between intestinal cells and neuronal cells is that carnosine acts on intestinal cells and stimulates exosome secretion, which can induce neurite outgrowth in neuronal cells. This study aimed to infer the carnosine-mediated interaction between muscle cells and neuronal cells. The results revealed that carnosine induces muscle cell differentiation, as well as the secretion of exosomes and myokines that can act on neuronal cells. Carnosine acts not only on intestinal cells but also on muscle cells, stimulating the secretion of secretory factors including exosomes that induce neurite outgrowth in neuronal cells, as well as myokines known to be involved in neuronal cell activation. As the miRNAs in exosomes secreted from intestinal cells and muscle cells upon carnosine treatment are different, it could be assumed that carnosine acts on each cell to interact with neuronal cell through separate factors and mechanisms.
Also flagged:HydroxyapatitechitosancadmiumwatersynthesisAdsorption
Journal Article2023-03-19No SnippetsEl Kaim Billah R, Ayouch I, Abdellaoui Y, Kassab Z, Khan MA, Agunaou M, Soufiane A, Otero M, Jeon BH.
Show Full Abstract
A novel polymer bio-composite based on nano-hydroxyapatite (n-Hap) and chitosan (CS) (CS/n-Hap) was synthesized to effectively address toxic cadmium ions removal from water. The composition and structure of CS/n-Hap bio-composite were analyzed through different characterization techniques. XRD patterns affirmed that the crystalline structure of n-Hap remained unaltered during CS/n-Hap synthesis, while FT-IR spectrum sustained all the characteristic peaks of both CS and n-Hap, affirming the successful synthesis of CS/n-Hap. Adsorption studies, including pH, adsorbent dosage, contact time, initial Cd(II) concentration, and temperature, were carried out to explain and understand the adsorption mechanism. Comparatively, CS/n-Hap bio-composite exhibited better Cd(II) adsorption capacity than pristine CS, with an experimental maximum uptake of 126.65 mg/g under optimized conditions. In addition, the kinetic data were well fitted to the pseudo-second-order model, indicating the formation of chemical bonds between Cd(II) and CS/n-Hap during adsorption. Furthermore, the thermodynamic study suggested that Cd(II) adsorption onto CS/n-Hap was endothermic and spontaneous. The regeneration study showed only about a 3% loss in Cd(II) uptake by CS/n-Hap after five consecutive cycles. Thus, a simple and facile approach was here developed to synthesize an eco-friendly and cost-effective material that can be successfully employed for the removal of toxic heavy metal ions from water.
Coronavirus disease 2019 (COVID-19) has inflicted significant mortality and morbidity worldwide since the virus was first detected towards the end of 2019. Though it primarily affects the respiratory system, COVID-19 has been shown to have a multisystem effect. There have been literature on liver injury associated with COVID-19 in general but liver injury specific to certain risk and age groups needs to be looked into. Thus, we aim to discuss the liver injury associated with COVID-19 in various age and risk groups and revisit pathophysiology, biochemical markers and their correlation with outcomes, and current management recommendations.
Also flagged:ubiquitin-likeautophagyautophagy-relatedAutophagosomekinaseAtg1
Journal Article2023-03-19No SnippetsRogov VV, Nezis IP, Tsapras P, Zhang H, Dagdas Y, Noda NN, Nakatogawa H, Wirth M, Mouilleron S, McEwan DG, Behrends C, Deretic V, Elazar Z, Tooze SA, Dikic I, Lamark T, Johansen T.
Show Full Abstract
The Atg8 family of ubiquitin-like proteins play pivotal roles in autophagy and other processes involving vesicle fusion and transport where the lysosome/vacuole is the end station. Nuclear roles of Atg8 proteins are also emerging. Here, we review the structural and functional features of Atg8 family proteins and their protein-protein interaction modes in model organisms such as yeast, <i>Arabidopsis, C. elegans</i> and <i>Drosophila</i> to humans. Although varying in number of homologs, from one in yeast to seven in humans, and more than ten in some plants, there is a strong evolutionary conservation of structural features and interaction modes. The most prominent interaction mode is between the LC3 interacting region (LIR), also called Atg8 interacting motif (AIM), binding to the LIR docking site (LDS) in Atg8 homologs. There are variants of these motifs like "half-LIRs" and helical LIRs. We discuss details of the binding modes and how selectivity is achieved as well as the role of multivalent LIR-LDS interactions in selective autophagy. A number of LIR-LDS interactions are known to be regulated by phosphorylation. New methods to predict LIR motifs in proteins have emerged that will aid in discovery and analyses. There are also other interaction surfaces than the LDS becoming known where we presently lack detailed structural information, like the N-terminal arm region and the UIM-docking site (UDS). More interaction modes are likely to be discovered in future studies.
The development and survival of adult-born neurons are believed to be driven by sensory signaling. Here, in vivo analyses of motility, morphology and Ca<sup>2+</sup> signaling, as well as transcriptome analyses of adult-born juxtaglomerular cells with reduced endogenous excitability (via cell-specific overexpression of either Kv1.2 or Kir2.1 K<sup>+</sup> channels), revealed a pronounced impairment of migration, morphogenesis, survival, and functional integration of these cells into the mouse olfactory bulb, accompanied by a reduction in cytosolic Ca<sup>2+</sup> fluctuations, phosphorylation of CREB and pCREB-mediated gene expression. Moreover, K<sup>+</sup> channel overexpression strongly downregulated genes involved in neuronal migration, differentiation, and morphogenesis and upregulated apoptosis-related genes, thus locking adult-born cells in an immature and vulnerable state. Surprisingly, cells deprived of sensory-driven activity developed normally. Together, the data reveal signaling pathways connecting the endogenous intermittent neuronal activity/Ca<sup>2+</sup> fluctuations as well as enhanced Kv1.2/Kir2.1 K<sup>+</sup> channel function to migration, maturation, and survival of adult-born neurons.
Also flagged:Glioneuronal tumorATRXkinasebrain tumorGlioneuronal tumorsCNS neoplasms
Journal Article2023-03-18✓ 1 SnippetBogumil H, Sill M, Schrimpf D, Ismer B, Blume C, Rahmanzade R, Hinz F, Cherkezov A, Banan R, Friedel D, Reuss DE, Selt F, Ecker J, Milde T, Pajtler KW, Schittenhelm J, Hench J, Frank S, Boldt HB, Kristensen BW, Scheie D, Melchior LC, Olesen V, Sehested A, Boué DR, Abdullaev Z, Satgunaseelan L, Kurth I, Seidlitz A, White CL, Ng HK, Shi ZF, Haberler C, Deckert M, Timmer M, Goldbrunner R, Tauziède-Espariat A, Varlet P, Brandner S, Alexandrescu S, Snuderl M, Aldape K, Korshunov A, Witt O, Herold-Mende C, Unterberg A, Wick W, Pfister SM, von Deimling A, Jones DTW, Sahm F, Sievers P.
In-Text Gene Mentions
Results)
…, NACC2 ,SOX6, KIF5B ,…
Show Full Abstract
Glioneuronal tumors are a heterogenous group of CNS neoplasms that can be challenging to accurately diagnose. Molecular methods are highly useful in classifying these tumors-distinguishing precise classes from their histological mimics and identifying previously unrecognized types of tumors. Using an unsupervised visualization approach of DNA methylation data, we identified a novel group of tumors (n = 20) that formed a cluster separate from all established CNS tumor types. Molecular analyses revealed ATRX alterations (in 16/16 cases by DNA sequencing and/or immunohistochemistry) as well as potentially targetable gene fusions involving receptor tyrosine-kinases (RTK; mostly NTRK1-3) in all of these tumors (16/16; 100%). In addition, copy number profiling showed homozygous deletions of CDKN2A/B in 55% of cases. Histological and immunohistochemical investigations revealed glioneuronal tumors with isomorphic, round and often condensed nuclei, perinuclear clearing, high mitotic activity and microvascular proliferation. Tumors were mainly located supratentorially (84%) and occurred in patients with a median age of 19 years. Survival data were limited (n = 18) but point towards a more aggressive biology as compared to other glioneuronal tumors (median progression-free survival 12.5 months). Given their molecular characteristics in addition to anaplastic features, we suggest the term glioneuronal tumor with ATRX alteration, kinase fusion and anaplastic features (GTAKA) to describe these tumors. In summary, our findings highlight a novel type of glioneuronal tumor driven by different RTK fusions accompanied by recurrent alterations in ATRX and homozygous deletions of CDKN2A/B. Targeted approaches such as NTRK inhibition might represent a therapeutic option for patients suffering from these tumors.
Also flagged:liver steatosisMIER1lipidcell proliferationmesoderm induction early response 1cell cycle
Journal Article2023-03-18✓ 2 SnippetsChen Y, Chen L, Wu X, Zhao Y, Wang Y, Jiang D, Liu X, Zhou T, Li S, Wei Y, Liu Y, Hu C, Zhou B, Qin J, Ying H, Ding Q.
In-Text Gene Mentions
Methods)
…Ccpg1-ChIP-F: CCTGGCAGGTGTTAGGCG…
Methods)
…Ccpg1-ChIP-R: CACGCGGCATCTCAGCATA…
Show Full Abstract
The early phase lipid accumulation is essential for liver regeneration. However, whether this acute lipid accumulation can serve as signals to direct liver regeneration rather than simply providing building blocks for cell proliferation remains unclear. Through in vivo CRISPR screening, we identify MIER1 (mesoderm induction early response 1) as a key epigenetic regulator that bridges the acute lipid accumulation and cell cycle gene expression during liver regeneration in male animals. Physiologically, liver acute lipid accumulation induces the phosphorylation of EIF2S1(eukaryotic translation initiation factor 2), which consequently attenuated Mier1 translation. MIER1 downregulation in turn promotes cell cycle gene expression and regeneration through chromatin remodeling. Importantly, the lipids-EIF2S1-MIER1 pathway is impaired in animals with chronic liver steatosis; whereas MIER1 depletion significantly improves regeneration in these animals. Taken together, our studies identify an epigenetic mechanism by which the early phase lipid redistribution from adipose tissue to liver during regeneration impacts hepatocyte proliferation, and suggest a potential strategy to boost liver regeneration.
Also flagged:Endothelial dysfunctionglycocalyxheparansulfateclotlipopolysaccharide
Journal Article2023-03-18✓ 2 SnippetsMilusev A, Despont A, Shaw J, Rieben R, Sorvillo N.
In-Text Gene Mentions
Introduction)
…like antithrombin III (ATIII), C1-inhibitor or factor…
Introduction)
…hand, binding ofATIIIto the endothelial…
Show Full Abstract
Endothelial dysfunction is an early event of vascular injury defined by a proinflammatory and procoagulant endothelial cell (EC) phenotype. Although endothelial glycocalyx disruption is associated with vascular damage, how various inflammatory stimuli affect the glycocalyx and whether arterial and venous cells respond differently is unknown. Using a 3D round-channel microfluidic system we investigated the endothelial glycocalyx, particularly heparan sulfate (HS), on porcine arterial and venous ECs. Heparan sulfate (HS)/glycocalyx expression was observed already under static conditions on venous ECs while it was flow-dependent on arterial cells. Furthermore, analysis of HS/glycocalyx response after stimulation with inflammatory cues revealed that venous, but not arterial ECs, are resistant to HS shedding. This finding was observed also on isolated porcine vessels. Persistence of HS on venous ECs prevented complement deposition and clot formation after stimulation with tumor necrosis factor α or lipopolysaccharide, whereas after xenogeneic activation no glycocalyx-mediated protection was observed. Contrarily, HS shedding on arterial cells, even without an inflammatory insult, was sufficient to induce a proinflammatory and procoagulant phenotype. Our data indicate that the dimorphic response of arterial and venous ECs is partially due to distinct HS/glycocalyx dynamics suggesting that arterial and venous thrombo-inflammatory disorders require targeted therapies.
<h4>Purpose</h4>Neuropathic pain (NP) is a chronic pain state with a complex etiology that currently lacks effective treatment in clinical practice. Studies have found that exercise training can alleviate NP hyperalgesia, but the specific mechanism remains unclear. Here, we sought to identify proteins and signaling pathways critical for mediating the effects of treadmill training on NP in a mouse model of spared nerve injury (SNI).<h4>Methods</h4>We used Tandem Mass Tag (TMT) technology for proteins and signaling pathways identification. Functional enrichment analyses were conducted using DAVID and Metascape software. Ingenuity pathway analysis was used to conduct functional annotation and analyze alterations in canonical pathways and molecular networks. Reverse transcription quantitative PCR (RT-qPCR) was used to confirm the results of proteomics analysis.<h4>Results</h4>A total of 270 differentially expressed proteins were screened in the detrained and trained groups (<i>P</i> ≤0.05). Enrichment and ingenuity pathway analysis revealed the effects of treadmill training on autophagy, cAMP-mediated signaling, calcium signaling and NP signaling in dorsal horn nerves. Treadmill training reduced the expression of <i>Akt3, Atf2, Gsk3b, Pik3c3, Ppp2ca</i>, and <i>Sqstm1</i>, and increased the expression of <i>Pik3cb</i> in the autophagic pathway.<h4>Conclusion</h4>Our results suggest that treadmill training may alleviate nociceptive hyperalgesia in NP mice by modulating the autophagic pathway, providing unique mechanistic insights into the analgesic effects of exercise.
Also flagged:ITGB2Epithelial ovarian cancerovarian cancerGene ExpressionVEGFACLDN4
Journal Article2023-03-18✓ 1 SnippetLi C, Deng T, Cao J, Zhou Y, Luo X, Feng Y, Huang H, Liu J.
In-Text Gene Mentions
Discussion)
…monstrated that the ITGB2/FAK/SOX6(focal adhesion kinase/SRY-box…
Show Full Abstract
Epithelial ovarian cancer is by far the most lethal gynecological malignancy. The exploration of promising immunomarkers to predict prognosis in ovarian cancer patients remains challenging. In our research, we carried out an integrated bioinformatic analysis of genome expressions and their immune characteristics in the ovarian cancer microenvironment with validation in different experiments. We filtrated 332 differentially expressed genes with 10 upregulated hub genes from the Gene Expression Omnibus database. These genes were closely related to ovarian tumorigenesis. Subsequently, the survival and immune infiltration analysis demonstrated that the upregulation of five candidate genes, ITGB2, VEGFA, CLDN4, OCLN, and SPP1, were correlated with an unfavorable clinical outcome and increased immune cell infiltration in ovarian cancer. Of these genes, ITGB2 tended to be the gene most correlated with various immune cell infiltrations and had a strong correlation with significant M2 macrophages infiltration (r = 0.707, <i>p</i> = 4.71 × 10<sup>-39</sup>), while it had a moderate correlation with CD4+/CD8+ T cells and B cells. This characteristic explains why the high expression of ITGB2 was accompanied by immune activation but did not reverse carcinogenesis. Additionally, we confirmed that ITGB2 was over-expressed in ovarian cancer tissues and was mainly located in cytoplasm, detected by Western blotting and the immunohistochemical method. In summary, ITGB2 may serve as a prognostic immunomarker for ovarian cancer patients.
Also flagged:tumourorganellescancersynthesiscyclin-dependent kinasegossypol
Journal Article2023-03-18No SnippetsBrewer K, Bai F, Blencowe A.
Show Full Abstract
The use of pH-responsive polymeric micelles is a promising approach to afford the targeted, pH-mediated delivery of hydrophobic drugs within the low-pH tumour milieu and intracellular organelles of cancer cells. However, even for a common pH-responsive polymeric micelle system-e.g., those utilising poly(ethylene glycol)-<i>b</i>-poly(2-vinylpyridine) (PEG-<i>b</i>-PVP) diblock copolymers-there is a lack of available data describing the compatibility of hydrophobic drugs, as well as the relationships between copolymer microstructure and drug compatibility. Furthermore, synthesis of the constituent pH-responsive copolymers generally requires complex temperature control or degassing procedures that limit their accessibility. Herein we report the facile synthesis of a series of diblock copolymers via visible-light-mediated photocontrolled reversible addition-fragmentation chain-transfer polymerisation, with a constant PEG block length (90 repeat units (RUs)) and varying PVP block lengths (46-235 RUs). All copolymers exhibited narrow dispersity values (<i>Đ</i> ≤ 1.23) and formed polymeric micelles with low polydispersity index (PDI) values (typically <0.20) at physiological pH (7.4), within a suitable size range for passive tumour targeting (<130 nm). The encapsulation and release of three hydrophobic drugs (cyclin-dependent kinase inhibitor (CDKI)-73, gossypol, and doxorubicin) were investigated in vitro at pH 7.4-4.5 to simulate drug release within the tumour milieu and cancer cell endosome. Marked differences in drug encapsulation and release were observed when the PVP block length was increased from 86 to 235 RUs. With a PVP block length of 235 RUs, the micelles exhibited differing encapsulation and release properties for each drug. Minimal release was observed for doxorubicin (10%, pH 4.5) and CDKI-73 exhibited moderate release (77%, pH 4.5), whereas gossypol exhibited the best combination of encapsulation efficiency (83%) and release (91% pH 4.5) overall. These data demonstrate the drug selectivity of the PVP core, where both the block molecular weight and hydrophobicity of the core (and accordingly the hydrophobicity of the drug) have a significant effect on drug encapsulation and release. These systems remain a promising means of achieving targeted, pH-responsive drug delivery-albeit for select, compatible hydrophobic drugs-which warrants their further investigation to develop and evaluate clinically relevant micelle systems.
bioRxiv2023-03-18Preprint (No Snippets API)Gazorpak M, Hugentobler KM, Paul D, Germain P, Matthis K, Rudolf R, Barrenechea SM, Kretschmer M, Fischer V, Xue X, Privitera M, Ivanova I, Hierlemann A, Meijer OC, Carreira EM, Bohacek J, Gapp K.
Show Full Abstract
Counteracting the overactivation of glucocorticoid receptors (GR) is an important therapeutic goal in stress-related psychiatry and beyond. The only clinically approved GR antagonist lacks selectivity and induces unwanted side effects. To complement existing tools of small-molecule-based inhibitors, we present a highly potent, novel catalytically-driven GR degrader, KH-103, based on proteolysis-targeting chimera technology. This selective degrader enables immediate and reversible GR depletion that is independent of genetic manipulation and circumvents transcriptional adaptations to inhibition. KH-103 achieves passive inhibition, preventing agonistic induction of gene expression, and significantly averts the GR’s genomic effects compared to two currently available inhibitors. Application in primary-neuron cultures revealed the dependency of a glucocorticoid-induced increase in spontaneous calcium activity on GR. Finally, we present a proof of concept for application in-vivo. KH-103 opens opportunities for a more lucid interpretation of GR functions with translational potential.
bioRxiv2023-03-18Preprint (No Snippets API)Gilan O, Bell CC, Talarmain L, Neville D, Knezevic K, Ferguson D, Boudes M, Chan Y, Davidovich C, Lam EY, Dawson MA.
Show Full Abstract
<h4>Summary</h4> The regulation of all chromatin-templated processes involves the selective recruitment of chromatin factors to facilitate DNA repair, replication, and transcription. Chromatin immunoprecipitation (ChIP) is a critical experimental method used to provide spatiotemporal evidence for the coordination of these chromatin-based events including the dynamic regulation of chromatin modifications at cis-regulatory elements. However, obtaining a global appreciation of all the factors that influence a specific chromatin event has remained challenging. Here, as a proof of concept we demonstrate the utility of coupling unbiased functional genomics with ChIP to identify the factors associated with active transcription. Specifically, we use this method to identify the major chromatin factors associated with the catalysis of two evolutionarily conserved histone modifications; H3K4me3 present at the transcriptional start site and H3K79me2 present through the gene body of actively transcribed genes. With CRISPR-ChIP, we identify all the non-redundant COMPASS complex members required for H3K4me3 and demonstrate that RNA polymerase II is dispensable for the maintenance of H3K4me3. As H3K79me2 has a putative oncogenic function in leukaemia cells driven by MLL-translocations, using CRISPR-ChIP we reveal a functional partitioning of H3K79 methylation into two distinct regulatory units. An oncogenic DOT1L complex, where the malignant driver directs the catalytic activity of DOT1L at MLL-Fusion target genes and a separate endogenous DOT1L complex, where catalytic activity is directed by MLLT10. This functional demarcation provides an explanation for the observed synergy with Menin and DOT1L inhibitors and why Menin inhibition surprisingly controls methylation of H3K79 at a critical subset of genes that sustain MLL-fusion leukaemia. Overall, CRISPR-ChIP provides a powerful tool for the unbiased interrogation of the mechanisms underpinning chromatin regulation.
Also flagged:Indiumhydroxypyridinoneshydroxypyridinonemethyleneacetamideamide
Journal Article2023-03-17✓ 1 SnippetRivas C, Jackson JA, Rigby A, Jarvis JA, White AJP, Blower PJ, Phanopoulos A, Ma MT.
In-Text Gene Mentions
Introduction)
…3+ , inhemochromatosisor iron-overload disease,…
Show Full Abstract
Chelators based on hydroxypyridinones have utility in incorporating radioactive metal ions into diagnostic and therapeutic agents used in nuclear medicine. Over the course of our hydroxypyridinone studies, we have prepared two novel chelators, consisting of a cyclen (1,4,7,10-tetraazacyclododecane) ring bearing two pendant hydroxypyridinone groups, appended via methylene acetamide motifs at either the 1,4-positions (<b>L</b><sup><b>1</b></sup>) or 1,7-positions (<b>L</b><sup><b>2</b></sup>) of the cyclen ring. In radiolabeling reactions of <b>L</b><sup><b>1</b></sup> or <b>L</b><sup><b>2</b></sup> with the γ-emitting radioisotope, [<sup>111</sup>In]In<sup>3+</sup>, we have observed radiometal-mediated hydrolysis of a single amide group of either <b>L</b><sup><b>1</b></sup> or <b>L</b><sup><b>2</b></sup>. The reaction of either [<sup>111</sup>In]In<sup>3+</sup> or [<sup>nat</sup>In]In<sup>3+</sup> with either <b>L</b><sup><b>1</b></sup> or <b>L</b><sup><b>2</b></sup>, in aqueous alkaline solutions at 80 °C, initially results in formation of [In(<b>L</b><sup><b>1</b></sup>)]<sup>+</sup> or [In(<b>L</b><sup><b>2</b></sup>)]<sup>+</sup>, respectively. Over time, each of these species undergoes In<sup>3+</sup>-mediated hydrolysis of a single amide group to yield species in which In<sup>3+</sup> remains coordinated to the resultant chelator, which consists of a cyclen ring bearing a single hydroxypyridinone group and a single carboxylate group. The reactivity toward hydrolysis is higher for the <b>L</b><sup><b>1</b></sup> complex compared to that for the <b>L</b><sup><b>2</b></sup> complex. Density functional theory calculations corroborate these experimental findings and importantly indicate that the activation energy required for the hydrolysis of <b>L</b><sup><b>1</b></sup> is significantly lower than that required for <b>L</b><sup><b>2</b></sup>. This is the first reported example of a chelator undergoing radiometal-mediated hydrolysis to form a radiometalated complex. It is possible that metal-mediated amide bond cleavage is a source of instability in other radiotracers, particularly those in which radiometal complexation occurs in aqueous, basic solutions at high temperatures. This study highlights the importance of appropriate characterization of radiolabeled products.
Also flagged:dopamineautismschizophreniasubstance use disordersaxon guidanceneurodevelopmental disorders
Journal Article2023-03-17✓ 5 SnippetsCline MM, Juarez B, Hunker A, Regiarto EG, Hariadi B, Soden ME, Zweifel LS.
In-Text Gene Mentions
Discussion)
…Mutations in NTN1 (netrin-1) and DCC in humans have been associated with several dopamine-associated psychiatric conditions, including neurodevelopmental disorders such as schizophrenia (Wang et al., 2018; Tang et al., 2019; Grant et al., 2012) and major depressive disorder (Tang et al., 2019; Zeng et al., 2017; Vosberg et al., 2020; Torres-Berrío et al., 2020), as well as multiple neurodegenerative disorders (Lesnick et al., 2007; Lesnick et al., 2008; Lin et al., 2009).…
Introduction)
…These results suggest a potential role for Ntn1 signaling through Dcc in regulating excitatory tone in the adult dopamine system.…
Introduction)
…Within the VTA, Dcc expression levels in adult mice are significantly upregulated following amphetamine exposure (Yetnikoff et al., 2010), and Dcc haploinsufficient mice display blunted locomotor response to amphetamine (Flores et al., 2005), consistent with increased excitatory synaptic strength in the VTA following amphetamine treatment (Saal et al., 2003).…
Introduction)
…Within the VTA,Dccexpression levels in…
Introduction)
…2010 ), andDcchaploinsufficient mice display…
Show Full Abstract
The axonal guidance cue netrin-1 serves a critical role in neural circuit development by promoting growth cone motility, axonal branching, and synaptogenesis. Within the adult mouse brain, expression of the gene encoding (<i>Ntn1</i>) is highly enriched in the ventral midbrain where it is expressed in both GABAergic and dopaminergic neurons, but its function in these cell types in the adult system remains largely unknown. To address this, we performed viral-mediated, cell-type specific CRISPR-Cas9 mutagenesis of <i>Ntn1</i> in the ventral tegmental area (VTA) of adult mice. <i>Ntn1</i> loss-of-function in either cell type resulted in a significant reduction in excitatory postsynaptic connectivity. In dopamine neurons, the reduced excitatory tone had a minimal phenotypic behavioral outcome; however, reduced glutamatergic tone on VTA GABA neurons induced behaviors associated with a hyperdopaminergic phenotype. Simultaneous loss of <i>Ntn1</i> function in both cell types largely rescued the phenotype observed in the GABA-only mutagenesis. These findings demonstrate an important role for Ntn1 in maintaining excitatory connectivity in the adult midbrain and that a balance in this connectivity within two of the major cell types of the VTA is critical for the proper functioning of the mesolimbic system.
Also flagged:synthesisL-homoserine lactoneALTlacIaraCtetR
Journal Article2023-03-17No SnippetsGaniga Prabhakar R, Fan G, Alnahhas RN, Hirning AJ, Bennett MR, Shamoo Y.
Show Full Abstract
Spatial structure within microbial communities can provide nearly limitless opportunities for social interactions and are an important driver for evolution. As metabolites are often molecular signals, metabolite diffusion within microbial communities can affect the composition and dynamics of the community in a manner that can be challenging to deconstruct. We used encapsulation of a synthetic microbial community within microdroplets to investigate the effects of spatial structure and metabolite diffusion on population dynamics and to examine the effects of cheating by one member of the community. The synthetic community was composed of three strains: a "Producer" that makes the diffusible quorum sensing molecule (<i>N</i>-(3-oxododecanoyl)-l-homoserine lactone, C12-oxo-HSL) or AHL; a "Receiver" that is killed by AHL; and a Non-Producer or "cheater" that benefits from the extinction of the Receivers, but without the costs associated with the AHL synthesis. We demonstrate that despite rapid diffusion of AHL between microdroplets, the spatial structure imposed by the microdroplets allows a more efficient but transient enrichment of more rare and slower-growing Producer subpopulations. Eventually, the Non-Producer population drove the Producers to extinction. By including fluorescence-activated microdroplet sorting and providing sustained competition by the Receiver strain, we demonstrate a strategy for indirect enrichment of a rare and unlabeled Producer. The ability to screen and enrich metabolite Producers from a much larger population under conditions of rapid diffusion provides an important framework for the development of applications in synthetic ecology and biotechnology.
Also flagged:sodium chloridepolysorbatehistidineargininesucrosepeptides
Journal Article2023-03-17No SnippetsErkamp NA, Oeller M, Sneideris T, Ausserwoger H, Levin A, Welsh TJ, Qi R, Qian D, Lorenzen N, Zhu H, Sormanni P, Vendruscolo M, Knowles TPJ.
Show Full Abstract
Protein-based biologics are highly suitable for drug development as they exhibit low toxicity and high specificity for their targets. However, for therapeutic applications, biologics must often be formulated to elevated concentrations, making insufficient solubility a critical bottleneck in the drug development pipeline. Here, we report an ultrahigh-throughput microfluidic platform for protein solubility screening. In comparison with previous methods, this microfluidic platform can make, incubate, and measure samples in a few minutes, uses just 20 μg of protein (>10-fold improvement), and yields 10,000 data points (1000-fold improvement). This allows quantitative comparison of formulation excipients, such as sodium chloride, polysorbate, histidine, arginine, and sucrose. Additionally, we can measure how solubility is affected by the combinatorial effect of multiple additives, find a suitable pH for the formulation, and measure the impact of mutations on solubility, thus enabling the screening of large libraries. By reducing material and time costs, this approach makes detailed multidimensional solubility optimization experiments possible, streamlining drug development and increasing our understanding of biotherapeutic solubility and the effects of excipients.
Also flagged:Serotonin Receptor 2Bpulmonary arterial hypertensionvalvular heart diseasecardiopathies5-HT5-HT 2B
Journal Article2023-03-17✓ 1 SnippetBender AM, Valentine MS, Bauer JA, Days E, Lindsley CW, Merryman WD.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
Antagonists of the serotonin receptor 2B (5-HT<sub>2B</sub>) have shown great promise as therapeutics for the treatment of pulmonary arterial hypertension, valvular heart disease, and related cardiopathies. Herein, we describe a high-throughput screen campaign that led to the identification of highly potent and selective 5-HT<sub>2B</sub> antagonists. Furthermore, selected compounds were profiled for their predicted ability to cross the blood-brain barrier. Two exemplary compounds, VU0530244 and VU0631019, were predicted to have very limited potential for brain penetration in human subjects, a critical profile for the development of 5-HT<sub>2B</sub> antagonists devoid of centrally-mediated adverse effects.
Also flagged:STE20-type kinaseTAOK1chronic liver diseaseNASHNAFLDhepatic steatosis
Journal Article2023-03-17✓ 5 SnippetsXia Y, Andersson E, Anand SK, Cansby E, Caputo M, Kumari S, Porosk R, Kilk K, Nair S, Marschall HU, Blüher M, Mahlapuu M.
In-Text Gene Mentions
Results)
…Our previous studies by screening a genome-wide yeast 2-hybrid (Y2H) cDNA library derived from primary human hepatocytes, identified STE20-type kinase TAOK3 as a binding partner for STK2516—an LD-coating protein controlling both liver lipid synthesis and utilization.7–9,11,14,15,39 Importantly, the prey fragment of TAOK3 that interacts with STK25 (amino acids 1 to 447; harbors the N-terminal kinase domain and serine-rich domain of unknown function16) is highly conserved compared with TAOK1 (75% similarity in amino acid sequence).…
Discussion)
…Notably, in addition to TAOK1 and TAOK3, the human GCKVIII subfamily of STE20-type kinases also includes TAOK2 (also known as MAP3K17 or PSK1), which shares about 90% amino acid identity with TAOK1/TAOK3 in the N-terminal protein kinase domain and displays about 60%–70% similarity in the central serine-rich and C-terminal regulatory domains.…
Introduction)
…In NAFLD, hydrophobic neutral lipids [primarily triacylglycerols (TAGs) and cholesteryl esters] accumulate within intrahepatocellular lipid droplets (LDs), covered by a monolayer of phospholipids and associated proteins.4 Notably, the best-characterized genetic risk factors controlling the susceptibility of NAFLD—PNPLA3 and HSD17B13—both encode proteins anchored to the hepatic LDs.5,6 Moreover, our recent studies have provided several lines of evidence that various STE20-type kinases—STK25, MST3, MST4, and TAOK3—bind to LDs and critically regulate the dynamic balance of lipid storage versus lipid utilization within the liver, contributing to the pathogenesis of NAFLD.7–16 Consequently, hepatic LD-associated proteins have emerged as potential targets for combating NAFLD and related metabolic disorders.…
Discussion)
…Our recent studies in cultured human hepatocytes and mouse models have revealed that STK25 deficiency protects against liver steatosis by shifting the metabolic balance from lipid anabolism towards lipid catabolism.7–9,11,14,15 This raises the possibility that TAOK1/TAOK3 and STK25 function in the same signaling pathway and that interaction with STK25 may play a part in the molecular mechanism of action of TAOK1/TAOK3 in the regulation of hepatocellular lipotoxic milieu.…
Introduction)
…MST3, MST4, andTAOK3—bind to LDs and…
Show Full Abstract
<h4>Background</h4>NAFLD has become the leading cause of chronic liver disease worldwide afflicting about one quarter of the adult population. NASH is a severe subtype of NAFLD, which in addition to hepatic steatosis connotes liver inflammation and hepatocyte ballooning. In light of the exponentially increasing prevalence of NAFLD, it is imperative to gain a better understanding of its molecular pathogenesis. The aim of this study was to examine the potential role of STE20-type kinase TAOK1 -a hepatocellular lipid droplet-associated protein-in the regulation of liver lipotoxicity and NAFLD etiology.<h4>Methods</h4>The correlation between TAOK1 mRNA expression in liver biopsies and the severity of NAFLD was evaluated in a cohort of 62 participants. Immunofluorescence microscopy was applied to describe the subcellular localization of TAOK1 in human and mouse hepatocytes. Metabolic reprogramming and oxidative/endoplasmic reticulum stress were investigated in immortalized human hepatocytes, where TAOK1 was overexpressed or silenced by small interfering RNA, using functional assays, immunofluorescence microscopy, and colorimetric analysis. Migration, invasion, and epithelial-mesenchymal transition were examined in TAOK1-deficient human hepatoma-derived cells. Alterations in hepatocellular metabolic and pro-oncogenic signaling pathways were assessed by immunoblotting.<h4>Results</h4>We observed a positive correlation between the TAOK1 mRNA abundance in human liver biopsies and key hallmarks of NAFLD (i.e., hepatic steatosis, inflammation, and ballooning). Furthermore, we found that TAOK1 protein fully colocalized with intracellular lipid droplets in human and mouse hepatocytes. The silencing of TAOK1 alleviated lipotoxicity in cultured human hepatocytes by accelerating lipid catabolism (mitochondrial β-oxidation and triacylglycerol secretion), suppressing lipid anabolism (fatty acid influx and lipogenesis), and mitigating oxidative/endoplasmic reticulum stress, and the opposite changes were detected in TAOK1-overexpressing cells. We also found decreased proliferative, migratory, and invasive capacity, as well as lower epithelial-mesenchymal transition in TAOK1-deficient human hepatoma-derived cells. Mechanistic studies revealed that TAOK1 knockdown inhibited ERK and JNK activation and repressed acetyl-CoA carboxylase (ACC) protein abundance in human hepatocytes.<h4>Conclusions</h4>Together, we provide the first experimental evidence supporting the role of hepatic lipid droplet-decorating kinase TAOK1 in NAFLD development through mediating fatty acid partitioning between anabolic and catabolic pathways, regulating oxidative/endoplasmic reticulum stress, and modulating metabolic and pro-oncogenic signaling.
Also flagged:Kidney fibrosisChronic kidney diseaseextracellularglomerulosclerosismethylationchromatin
Journal Article2023-03-17No SnippetsHuang R, Fu P, Ma L.
Show Full Abstract
Chronic kidney disease (CKD) is estimated to affect 10-14% of global population. Kidney fibrosis, characterized by excessive extracellular matrix deposition leading to scarring, is a hallmark manifestation in different progressive CKD; However, at present no antifibrotic therapies against CKD exist. Kidney fibrosis is identified by tubule atrophy, interstitial chronic inflammation and fibrogenesis, glomerulosclerosis, and vascular rarefaction. Fibrotic niche, where organ fibrosis initiates, is a complex interplay between injured parenchyma (like tubular cells) and multiple non-parenchymal cell lineages (immune and mesenchymal cells) located spatially within scarring areas. Although the mechanisms of kidney fibrosis are complicated due to the kinds of cells involved, with the help of single-cell technology, many key questions have been explored, such as what kind of renal tubules are profibrotic, where myofibroblasts originate, which immune cells are involved, and how cells communicate with each other. In addition, genetics and epigenetics are deeper mechanisms that regulate kidney fibrosis. And the reversible nature of epigenetic changes including DNA methylation, RNA interference, and chromatin remodeling, gives an opportunity to stop or reverse kidney fibrosis by therapeutic strategies. More marketed (e.g., RAS blockage, SGLT2 inhibitors) have been developed to delay CKD progression in recent years. Furthermore, a better understanding of renal fibrosis is also favored to discover biomarkers of fibrotic injury. In the review, we update recent advances in the mechanism of renal fibrosis and summarize novel biomarkers and antifibrotic treatment for CKD.
Also flagged:butylisothiocyanate3-nitropropionic acidmitochondrialHDmembrane
Journal Article2023-03-17✓ 2 SnippetsKaur P, Attri S, Singh D, Rashid F, Singh S, Kumar A, Kaur H, Bedi N, Arora S.
In-Text Gene Mentions
Introduction)
…Huntington's disease (HD) is a progressive, terminal, incurable NDD caused by an extended repeat of CAG codon in the Huntingtin gene that encodes an abnormally long sequence of polyglutamine in the Huntingtin protein (Htt)3,4.…
Introduction)
…the Huntingtin protein (Htt) 3 , 4…
Show Full Abstract
Mitochondrial impairment, energetic crisis and elevated oxidative stress have been demonstrated to play a pivotal role in the pathological processes of Huntington's disease (HD). 3-Nitropropionic acid (3-NPA) is a natural neurotoxin that mimics the neurological dysfunctions, mitochondrial impairments and oxidative imbalance of HD. The current investigation was undertaken to demonstrate the neuroprotective effect of 4-(methylthio)butyl isothiocyanate (4-MTBITC) against the 3-NPA induced neurotoxicity in human dopaminergic SH-SY5Y cells. The experimental evidence of oxidative DNA damage by 3-NPA was elucidated by pBR322 DNA nicking assay. In contrast, the 4-MTBITC considerably attenuated the DNA damage, suggesting its free radical scavenging action against 3-NPA and Fenton's reagent. The dose and time-dependent increase of 3-NPA revealed its neurotoxic dose as 0.5 mM after 24 h of treatment of SH-SY5Y cells in MTT assay. In order to determine the optimal dose at which 4-MTBITC protects cell death, the 3-NPA (IC<sub>50</sub>) induced cells were pretreated with different concentrations of 4-MTBITC for 1 h. The neuroprotective dose of 4-MTBITC against 3-NPA was found to be 0.25 μM. Additionally, the elevated GSH levels in cells treated with 4-MTBITC indicate its propensity to eliminate reactive species generated as a result of 3-NPA-induced mitochondrial dysfunction. Likewise, it was determined through microscopic and flow cytometric experiments that 3-NPA's induced overproduction of reactive species and a decline in mitochondrial membrane potential (MMP) could be efficiently prevented by pre-treating cells with 4-MTBITC. To elucidate the underlying molecular mechanism, the RT-qPCR analysis revealed that the pre-treatment of 4-MTBITC effectively protected neuronal cells against 3-NPA-induced cell death by preventing Caspase-3 activation, Brain-derived neurotrophic factor (BDNF) upregulation, activation of cAMP response element-binding protein (CREB) and Nrf2 induction. Together, our findings lend credence to the idea that pre-treatment with 4-MTBITC reduced 3-NPA-induced neurotoxicity by lowering redox impairment, apoptotic state, and mitochondrial dysfunction. The present work, in conclusion, presented the first proof that the phytoconstituent 4-MTBITC supports the antioxidant system, BDNF/TrkB/CREB signaling, and neuronal survival in dopaminergic SH-SY5Y cells against 3-NPA-induced oxidative deficits.
Also flagged:HonokiolAMPKnon-alcoholic fatty liver diseasemetabolic syndromeNAFLDlipid
Journal Article2023-03-17No SnippetsTian R, Yang J, Wang X, Liu S, Dong R, Wang Z, Yang Z, Zhang Y, Cai Z, Yang H, Hu Y, She ZG, Li H, Zhou J, Zhang XJ.
Show Full Abstract
<h4>Background</h4>Non-alcoholic fatty liver (NAFLD) and its related metabolic syndrome have become major threats to human health, but there is still a need for effective and safe drugs to treat these conditions. Here we aimed to identify potential drug candidates for NAFLD and the underlying molecular mechanisms.<h4>Methods</h4>A drug repositioning strategy was used to screen an FDA-approved drug library with approximately 3000 compounds in an in vitro hepatocyte model of lipid accumulation, with honokiol identified as an effective anti-NAFLD candidate. We systematically examined the therapeutic effect of honokiol in NAFLD and metabolic syndrome in multiple in vitro and in vivo models. Transcriptomic examination and biotin-streptavidin binding assays were used to explore the underlying molecular mechanisms, confirmed by rescue experiments.<h4>Results</h4>Honokiol significantly inhibited metabolic syndrome and NAFLD progression as evidenced by improved hepatic steatosis, liver fibrosis, adipose inflammation, and insulin resistance. Mechanistically, the beneficial effects of honokiol were largely through AMPK activation. Rather than acting on the classical upstream regulators of AMPK, honokiol directly bound to the AMPKγ1 subunit to robustly activate AMPK signaling. Mutation of honokiol-binding sites of AMPKγ1 largely abolished the protective capacity of honokiol against NAFLD.<h4>Conclusion</h4>These findings clearly demonstrate the beneficial effects of honokiol in multiple models and reveal a previously unappreciated signaling mechanism of honokiol in NAFLD and metabolic syndrome. This study also provides new insights into metabolic disease treatment by targeting AMPKγ1 subunit-mediated signaling activation.
Also flagged:endocannabinoiddepressionendocannabinoidsanandamide2-arachidonylglycerol(CB) 1 receptor
Journal Article2023-03-17No SnippetsEmons B, Arning L, Makulla VE, Suchy MT, Tsikas D, Lücke T, Epplen JT, Juckel G, Roser P.
Show Full Abstract
<h4>Background</h4>The serotonergic and the endocannabinoid system are involved in the etiology of depression. Depressive patients exhibit low serotonergic activity and decreased level of the endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2AG). Since the cannabinoid (CB) 1 receptor is activated by endogenous ligands such as AEA and 2AG, whose concentration are controlled by the fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase, respectively, we investigated the effects on serotonergic utilization. In this study, we investigated the impact of the rs1049353 single-nucleotide polymorphism (SNP) of the cannabinoid receptor 1 (CNR1) gene, which codes the endocannabinoid CB1 receptor, and the rs324420 SNP of the FAAH gene on the serotonergic and endocannabinoid system in 59 healthy volunteers.<h4>Methods</h4>Serotonergic activity was measured by loudness dependence of auditory-evoked potentials (LDAEP). Plasma concentrations of AEA, 2AG and its inactive isomer 1AG were determined by mass spectrometry. Genotyping of two SNPs (rs1049353, rs344420) was conducted by polymerase chain reaction (PCR) and differential enzymatic analysis with the PCR restriction fragment length polymorphism method.<h4>Results</h4>Genotype distributions by serotonergic activity or endocannabinoid concentration showed no differences. However, after detailed consideration of the CNR1-A-allele-carriers, a reduced AEA (A-allele-carrier M = 0.66, SD = 0.24; GG genotype M = 0.72, SD = 0.24) and 2AG (A-allele-carriers M = 0.70, SD = 0.33; GG genotype M = 1.03, SD = 0.83) plasma concentration and an association between the serotonergic activity and the concentrations of AEA and 2AG has been observed.<h4>Conclusions</h4>Our results suggest that carriers of the CNR1-A allele may be more susceptible to developing depression.
Also flagged:differentiationporecell differentiationproteasePapainnanofiber
Journal Article2023-03-17No Snippetsvon der Bey M, De Cicco S, Zach S, Hengerer B, Ercan-Herbst E.
Show Full Abstract
Developing an in vitro platform to study neuron-oligodendrocyte interaction, particularly myelination, is essential to understand aberrant myelination in neuropsychiatric and neurodegenerative diseases. Here, we provide a controlled, direct co-culture protocol for human induced-pluripotent-stem-cell (hiPSC)-derived neurons and oligodendrocytes on three-dimensional (3D) nanomatrix plates. We describe steps to differentiate hiPSCs into cortical neurons and oligodendrocyte lineage cells on 3D nanofibers. We then detail the detachment and isolation of the oligodendrocyte lineage cells, followed by neuron-oligodendrocyte co-culture in this 3D microenvironment.
Also flagged:agingretrotranspositionchromatinneurodegenerative disordersamyotrophic lateral sclerosislocomotion
Journal Article2023-03-17No SnippetsCopley KE, Shorter J.
Show Full Abstract
Repetitive elements (REs), such as transposable elements (TEs) and satellites, comprise much of the genome. Here, we review how TEs and (peri)centromeric satellite DNA may contribute to aging and neurodegenerative disorders, including amyotrophic lateral sclerosis (ALS). Alterations in RE expression, retrotransposition, and chromatin microenvironment may shorten lifespan, elicit neurodegeneration, and impair memory and movement. REs may cause these phenotypes via DNA damage, protein sequestration, insertional mutagenesis, and inflammation. We discuss several TE families, including gypsy, HERV-K, and HERV-W, and how TEs interact with various factors, including transactive response (TAR) DNA-binding protein 43 kDa (TDP-43) and the siRNA and piwi-interacting (pi)RNA systems. Studies of TEs in neurodegeneration have focused on Drosophila and, thus, further examination in mammals is needed. We suggest that therapeutic silencing of REs could help mitigate neurodegenerative disorders.
Journal Article2023-03-17✓ 1 SnippetDourthe ME, Courtois L, Andrieu GP, Simonin M, Touzart A, Lhermitte L, Petit A, Boissel N, Baruchel A, Asnafi V, Macintyre E.
In-Text Gene Mentions
S I O 001029)
…The rare PICALM-MLLT10 predominated in IM0/δ/γ and TCRγδ T-ALLs (9/145; 6.2% versus 4/281; 1.4% in αβ-lineage T-ALLs, P = 0.01).…
Also flagged:Gingerolplatelet aggregation6-gingerolCOX-1watermetabolic syndrome
Journal Article2023-03-17No SnippetsAhmed SHH, Gonda T, Agbadua OG, Girst G, Berkecz R, Kúsz N, Tsai MC, Wu CC, Balogh GT, Hunyadi A.
Show Full Abstract
Ginger (<i>Zingiber officinale</i>) is widely used as a spice and a traditional medicine. Many bioactivities have been reported for its extracts and the isolated compounds, including cardiovascular protective effects. Different pathways were suggested to contribute to these effects, like the inhibition of platelet aggregation. In this study, we synthesised fourteen 6-gingerol derivatives, including eight new compounds, and studied their antiplatelet, COX-1 inhibitor, and antioxidant activities. In silico docking of selected compounds to <i>h</i>-COX-1 enzyme revealed favourable interactions. The investigated 6-gingerol derivatives were also characterised by in silico and experimental physicochemical and blood-brain barrier-related parameters for lead and preclinical candidate selection. 6-Shogaol (<b>2</b>) was identified as the best overall antiplatelet lead, along with compounds <b>3</b> and <b>11</b> and the new compound <b>17</b>, which require formulation to optimize their water solubility. Compound <b>5</b> was identified as the most potent antioxidant that is also promising for use in the central nervous system (CNS).
Also flagged:FerritinObstructive sleep apneachronic inflammatory diseasesironC-reactive proteinCRP
Journal Article2023-03-17✓ 2 SnippetsSeifen C, Pordzik J, Huppertz T, Hackenberg B, Schupp C, Matthias C, Simon P, Gouveris H.
In-Text Gene Mentions
Introduction)
…as seen inhemochromatosis, can cause a…
Discussion)
…malignancies, iron deficiency,hemochromatosis, or dysthyroidism were…
Show Full Abstract
Obstructive sleep apnea (OSA) has been associated with various acute and chronic inflammatory diseases, as has serum ferritin, an intracellular iron storage protein. Little is known about the relationship between severity of OSA and serum ferritin levels in otherwise healthy subjects. In this study, all polysomnographic recordings, serum levels of ferritin, C-reactive protein (CRP), and hemoglobin, as well as patient files from 90 consecutive, otherwise healthy individuals with suspected OSA who presented to a tertiary sleep medical center were retrospectively analyzed. For comparison, three groups were formed based on apnea-hypopnea index (AHI; none or mild OSA: <15/h vs. moderate OSA: 15-30/h vs. severe OSA: >30/h). Serum ferritin levels were significantly positively correlated with AHI (r = 0.3240, <i>p</i> = 0.0020). A clear trend of higher serum ferritin levels was found when patients with severe OSA were compared to those without or with mild OSA. Serum CRP and serum hemoglobin levels did not differ significantly among OSA severity groups. Age and body-mass index (BMI) tended to be higher with increasing OSA severity. The BMI was significant higher in patients with severe OSA compared to those without or with mild (<i>p</i> < 0.001). Therefore, serum ferritin levels may provide a biochemical surrogate marker for OSA severity.
Also flagged:B-cell lymphomaAIDS-NHLAIDSBurkitt lymphomaBL
Journal Article2023-03-17✓ 3 SnippetsDaniels-Wells TR, Candelaria PV, Kranz E, Wen J, Wang L, Kamata M, Almagro JC, Martínez-Maza O, Penichet ML.
In-Text Gene Mentions
Introduction)
…We have previously developed a mouse/human chimeric IgG3 antibody specific for TfR1 (ch128.1/IgG3) that does not cross-react with TfR2, nor does it interfere with the binding of the TfR1 ligands transferrin or the hemochromatosis protein (HFE) to the receptor [20,21,22].…
Introduction)
…transferrin or thehemochromatosisprotein (HFE) to…
Introduction)
…the hemochromatosis protein (HFE) to the receptor…
Show Full Abstract
Transferrin receptor 1 (TfR1), also known as CD71, is a transmembrane protein involved in the cellular uptake of iron and the regulation of cell growth. This receptor is expressed at low levels on a variety of normal cells, but is upregulated on cells with a high rate of proliferation, including malignant cells and activated immune cells. Infection with the human immunodeficiency virus (HIV) leads to the chronic activation of B cells, resulting in high expression of TfR1, B-cell dysfunction, and ultimately the development of acquired immunodeficiency syndrome-related B-cell non-Hodgkin lymphoma (AIDS-NHL). Importantly, TfR1 expression is correlated with the stage and prognosis of NHL. Thus, it is a meaningful target for antibody-based NHL therapy. We previously developed a mouse/human chimeric IgG3 specific for TfR1 (ch128.1/IgG3) and showed that this antibody exhibits antitumor activity in an in vivo model of AIDS-NHL using NOD-SCID mice challenged intraperitoneally with 2F7 human Burkitt lymphoma (BL) cells that harbor the Epstein-Barr virus (EBV). We have also developed an IgG1 version of ch128.1 that shows significant antitumor activity in SCID-Beige mouse models of disseminated multiple myeloma, another B-cell malignancy. Here, we aim to explore the utility of ch128.1/IgG1 and its humanized version (hu128.1) in mouse models of AIDS-NHL. To accomplish this goal, we used the 2F7 cell line variant 2F7-BR44, which is more aggressive than the parental cell line and forms metastases in the brain of mice after systemic (intravenous) administration. We also used the human BL cell line JB, which in contrast to 2F7, is EBV-negative, allowing us to study both EBV-infected and non-infected NHL tumors. Treatment with ch128.1/IgG1 or hu128.1 of SCID-Beige mice challenged locally (subcutaneously) with 2F7-BR44 or JB cells results in significant antitumor activity against different stages of disease. Treatment of mice challenged systemically (intravenously) with either 2F7-BR44 or JB cells also showed significant antitumor activity, including long-term survival. Taken together, our results suggest that targeting TfR1 with antibodies, such as ch128.1/IgG1 or hu128.1, has potential as an effective therapy for AIDS-NHL.
Also flagged:Cutaneous Squamous Cell CarcinomatumorSimple Summaryskin cancercancerskin cancers
Journal Article2023-03-17✓ 1 SnippetTsang DA, Tam SYC, Oh CC.
In-Text Gene Mentions
Results)
…non-PNI samples includedPTGIS, THBS4 ,…
Show Full Abstract
The characterization of cutaneous squamous cell carcinoma (cSCC) at the molecular level is lacking in the current literature due to the high mutational burden of this disease. Immunosuppressed patients afflicted with cSCC experience considerable morbidity and mortality. In this article, we review the molecular profile of cSCC among the immunosuppressed and immunocompetent populations at the genetic, epigenetic, transcriptomic, and proteometabolomic levels, as well as describing key differences in the tumor immune microenvironment between these two populations. We feature novel biomarkers from the recent literature which may serve as potential targets for therapy.
<h4>Background</h4>Autoimmune hepatitis (AIH) is a rare entity; in addition, single-nucleotide polymorphisms (SNPs) may impact its course and outcome. We investigated liver-related SNPs regarding its activity, as well as in relation to its stage and treatment response in a Central European AIH cohort.<h4>Methods</h4>A total of 113 AIH patients (i.e., 30 male/83 female, median 57.9 years) were identified. In 81, genotyping of PNPLA3-rs738409, MBOAT7-rs626238, TM6SF2-rs58542926, and HSD17B13-rs72613567:TA, as well as both biochemical and clinical data at baseline and follow-up, were available.<h4>Results</h4>The median time of follow-up was 2.8 years; five patients died and one underwent liver transplantation. The PNPLA3-G/G homozygosity was linked to a worse treatment response when compared to wildtype [wt] (ALT 1.7 vs. 0.6 × ULN, <i>p</i> < 0.001). The MBOAT7-C/C homozygosity was linked to non-response vs. wt and heterozygosity (<i>p</i> = 0.022). Male gender was associated with non-response (OR 14.5, <i>p</i> = 0.012) and a higher prevalence of PNPLA3 (G/G vs. C/G vs. wt 41.9/40.0/15.0% males, <i>p</i> = 0.03). The MBOAT7 wt was linked to less histological fibrosis (<i>p</i> = 0.008), while no effects for other SNPs were noted. A polygenic risk score was utilized comprising all the SNPs and correlated with the treatment response (<i>p</i> = 0.04).<h4>Conclusions</h4>Our data suggest that genetic risk variants impact the treatment response of AIH in a gene-dosage-dependent manner. Furthermore, MBOAT7 and PNPLA3 mediated most of the observed effects, the latter explaining, in part, the predisposition of male subjects to worse treatment responses.
Noninvasive risk stratification is a challenging issue in the management of patients with nonalcoholic fatty liver disease (NAFLD). This study aimed to identify multiomics-based predictors of NAFLD progression, as assessed by changes in serial FibroScan-aspartate aminotransferase (FAST) scores during lifestyle modification. A total of 266 patients with available metabolomics and genotyping data were included. The follow-up sub-cohort included patients with paired laboratory and transient elastography results (n = 160). The baseline median FAST score was 0.37. The <i>PNPLA3</i> rs738409 genotype was significantly associated with a FAST score > 0.35. Circulating metabolomics significantly associated with a FAST score > 0.35 included SM C24:0 (odds ratio [OR] = 0.642; 95% confidence interval [CI], 0.463-0.891), PC ae C40:6 (OR = 0.477; 95% CI, 0.340-0.669), lysoPC a C18:2 (OR = 0.570; 95% CI, 0.417-0.779), and tyrosine (OR = 2.743; 95% CI, 1.875-4.014). A combination of these metabolites and <i>PNPLA3</i> genotype yielded a c-index = 0.948 for predicting a FAST score > 0.35. In the follow-up sub-cohort (median follow-up = 23.7 months), 47/76 patients (61.8%) with a baseline FAST score > 0.35 had a follow-up FAST score ≤ 0.35. An improved FAST score at follow-up was significantly associated with age, serum alanine aminotransferase, and tyrosine. In conclusion, baseline risk stratification in NAFLD patients may be assisted using a multiomics-based model. Particularly, patients with increased tyrosine may benefit from an earlier switch to pharmacologic approaches.
Also flagged:PolysaccharidesCalcium Phosphatesagingmetabolic bone diseasesosteoporosisalginate
Journal Article2023-03-17No SnippetsCojocaru FD, Gardikiotis I, Dodi G, Rotaru A, Balan V, Rezus E, Verestiuc L.
Show Full Abstract
The tendency of population aging is continuously increasing, which is directly correlated with a significative number of associated pathologies. Several metabolic bone diseases such as osteoporosis or chronic kidney disease-mineral and bone disorders involve a high risk of fractures. Due to the specific fragility, bones will not self-heal and supportive treatments are necessary. Implantable bone substitutes, a component of bone tissue engineering (BTE) strategy, proved to be an efficient solution for this issue. The aim of this study was to develop composites beads (CBs) with application in the complex field of BTE, by assembling the features of both biomaterials' classes: biopolymers (more specific, polysaccharides: alginate and two different concentrations of guar gum/carboxymethyl guar gum) and ceramics (more specific, calcium phosphates), in a combination described for the first time in the literature. The CBs prepared by double crosslinking (ionic and physically) showed adequate physico-chemical characteristics and capabilities (morphology, chemical structure and composition, mechanical strength, and in vitro behaviour in four different acellular simulated body fluids) for bone tissue repair. Moreover, preliminary in vitro studies on cell cultures highlighted that the CBs were free of cytotoxicity and did not affect the morphology and density of cells. The results indicated that the beads based on a higher concentration of guar gum have superior properties than those with carboxymetilated guar, especially in terms of mechanical properties and behaviour in simulated body fluids.
<h4>Background</h4>Systemic inflammation, diagnostically ascribed by measuring serum levels of the acute phase reactant C-reactive protein (CRP), has consistently been correlated with poor outcomes across cancer types. CRP exists in two structurally and functionally distinct isoforms, circulating pentameric CRP (pCRP) and the highly pro-inflammatory monomeric isoform (mCRP). The aim of this pilot study was to map the pattern of mCRP distribution in a previously immunologically well-defined colon cancer (CC) cohort and explore possible functional roles of mCRP within the tumor microenvironment (TME).<h4>Methods</h4>Formalin-fixed, paraffin-embedded (FFPE) tissue samples from 43 stage II and III CC patients, including 20 patients with serum CRP 0-1 mg/L and 23 patients with serum CRP >30 mg/L were immunohistochemically (IHC) stained with a conformation-specific mCRP antibody and selected immune and stromal markers. A digital analysis algorithm was developed for evaluating mCRP distribution within the primary tumors and adjacent normal colon mucosa.<h4>Results</h4>mCRP was abundantly present within tumors from patients with high serum CRP (>30 mg/L) diagnostically interpreted as being systemically inflamed, whereas patients with CRP 0-1 mg/L exhibited only modest mCRP positivity (median mCRP per area 5.07‰ (95%CI:1.32-6.85) vs. 0.02‰ (95%CI:0.01-0.04), p<0.001). Similarly, tissue-expressed mCRP correlated strongly with circulating pCRP (Spearman correlation 0.81, p<0.001). Importantly, mCRP was detected exclusively within tumors, whereas adjacent normal colon mucosa showed no mCRP expression. Double IHC staining revealed colocalization of mCRP with endothelial cells and neutrophils. Intriguingly, some tumor cells also colocalized with mCRP, suggesting a direct interaction or mCRP expression by the tumor itself.<h4>Conclusion</h4>Our data show that the pro-inflammatory mCRP isoform is expressed in the TME of CC, primarily in patients with high systemic pCRP values. This strengthens the hypothesis that CRP might not only be an inflammatory marker but also an active mediator within tumors.
Also flagged:thoracic tumorthiazolebisphosphonatecell surfaceeuropiumluciferase
Journal Article2023-03-17✓ 1 SnippetUmeyama Y, Taniguchi H, Gyotoku H, Senju H, Tomono H, Takemoto S, Yamaguchi H, Tagod MSO, Iwasaki M, Tanaka Y, Mukae H.
In-Text Gene Mentions
Discussion)
…that BTN3A1 andBTN2A1play an essential…
Show Full Abstract
<h4>Introduction</h4>Malignant pleural mesothelioma (MPM) is a rare and highly aggressive thoracic tumor with poor prognosis and limited therapeutic options. Although immune checkpoint inhibitors exhibit a promising effect in some patients with unresectable MPM in clinical trials, the majority of MPM patients show only modest response rates to the currently available treatments. It is thus imperative to develop novel and innovative therapeutic modalities for MPM, including immune effector cell-based therapies.<h4>Methods</h4>γδ T cells were expanded using tetrakis-pivaloyloxymethyl 2-(thiazole-2-ylamino) ethylidene-1,1-bisphosphonate (PTA) and interleukin-2, and the therapeutic potential of γδ T cells was examined through analyzing cell surface markers and cellular cytotoxicity against MPM in vitro using a europium chelate-based time-resolved fluorescence assay system and a luciferase-based luminescence assay system.<h4>Results and discussion</h4>We successfully expanded γδ T cells from peripheral blood mononuclear cells of healthy donors and MPM patients. γδ T cells expressed natural killer receptors such as NKG2D and DNAM-1 and exhibited a moderate level of cytotoxicity to MPM cells in the absence of antigens. The inclusion of PTA, (<i>E</i>)-4-hydroxy-3- methylbut-2-enyl diphosphate (HMBPP) or zoledronic acid (ZOL) induced a TCR-dependent cytotoxicity in γδ T cells and secreted interferon-γ (IFN-γ). In addition, γδ T cells expressing CD16 exhibited a significant level of cytotoxicity against MPM cells in the presence of an anti-epidermal growth factor receptor (EGFR) mAb, at lower concentrations than in clinical settings, whereas a detectable level of IFN-γ was not produced. Taken together, γδ T cells showed cytotoxic activity against MPM in three distinct mechanisms through NK receptors, TCRs and CD16. Since major histocompatibility complex (MHC) molecules are not involved in the recognition, both autologous and allogeneic γδ T cells could be used for the development of γδ T cell-based adoptive immunotherapy for MPM.
Also flagged:semaglutideempagliflozinwaterglucosephosphoproteinspeptides
Journal Article2023-03-17No SnippetsChen X, Chen S, Li Z, Zhu R, Jia Z, Ban J, Zhen R, Chen X, Pan X, Ren Q, Yue L, Niu S.
Show Full Abstract
<b>Objective:</b> Based on the 4D label-free phosphoproteomic technique, we examined the differences in cognitive function and hippocampal phosphorylated protein expression in high-fat diet-induced obese mice after the intervention of semaglutide and empagliflozin, as well as the effects of both on protein activity and function in obese mice's hippocampal tissues and the signaling pathways involved. <b>Methods:</b> Thirty-two C57BL/6JC male mice were assigned to two groups randomly: A control group (group C, 10% of energy is from fat, n = 8) and a high-fat diet group (group H, 60% of energy is from fat, n = 24). The high-fat diet-induced obese mice were screened after 12 weeks of feeding based on the criterion that the bodyweight of mice in fat rich diet group was greater than or equal to 20% of the average body weight of the mice in the blank control group. Group H separate into group H (n = 8), group Semaglutide (group S, n = 8), and group empagliflozin (group E, n = 8). For a total of 12 weeks, group S received 30 nmol/kg/d bodyweight of semaglutide intraperitoneally, group E received 10 mg/kg/d bodyweight of empagliflozin <i>via</i> gavage, and groups C and H received equal amounts of saline by intraperitoneal injection and gavage. At the end of treatment, the mice were appraised for cognitive function employing the Morris water maze (MWM), and serum fasting glucose, lipids, and inflammatory parameters were measured. The 4D label-free phosphoproteomics method was employed to screen the differential phosphoproteins and loci in hippocampal tissues of mice in different treatment groups, and bioinformatics was used to analyze the biological processes, signaling pathways, and related protein-protein interaction (PPI) network analysis of these differentially phosphorylated proteins. <b>Results:</b> In comparison to normal controls, The escape latency of obese mice induced by high-fat diet was prolonged, the percentage of swimming time in the target quadrant was reduced, and the number of times of crossing the platform was reduced, whereas semaglutide and empagliflozin treatment reduced escape latency, increase the percentage of swim time in the target quadrant and increase the frequency of passing through the platform area, although there is little difference in the effect of the two drugs. The phosphoproteomic results showed 20,493 unique phosphorylated peptides, representing 21,239 phosphorylation sites and 4,290 phosphorylated proteins. Further analysis revealed that the proteins corresponding to these differentially phosphorylated sites are jointly distributed in signaling pathways such as dopaminergic synapses and axon guidance, and are involved in biological processes such as neuronal projection development, synaptic plasticity, and axonogenesis. Notably, the key factors voltage-dependent L-type calcium channel subunit alpha-1D (CACNA1D), voltage-dependent P/Q-type calcium channel subunit alpha-1A (CACNA1A), and voltage-dependent N-type calcium channel subunit alpha-1B (CACNA1B) were all found to be involved in the dopaminergic synapse pathway, and their expression was upregulated by semaglutide and empagliflozin. <b>Conclusion:</b> We found for the first time that a high-fat diet decreased CACNA1D, CACNA1A, and CACNA1B protein serine phosphorylation, which may affect neuronal development, synaptic plasticity, and cognitive function in mice. Notably, semaglutide and empagliflozin increased the phosphorylation of these proteins.
Also flagged:agingwaterextracellular matrixsynthesiscollagenchondrogenesis
Journal Article2023-03-17✓ 1 SnippetKhalid S, Ekram S, Ramzan F, Salim A, Khan I.
In-Text Gene Mentions
Introduction)
…genes including Sox9,Sox6, and Sox5…
Show Full Abstract
<h4>Background</h4>Intervertebral disc (IVD) shows aging and degenerative changes earlier than any other body connective tissue. Its repair and regeneration provide a considerable challenge in regenerative medicine due to its high degree of infrastructure and mechanical complexity. Mesenchymal stem cells, due to their tissue resurfacing potential, represent many explanatory pathways to regenerate a tissue breakdown.<h4>Methods</h4>This study was undertaken to evaluate the co-regulation of <i>Sox9</i> and <i>TGF</i>β<i>1</i> in differentiating human umbilical cord mesenchymal stem cells (hUC-MSC) into chondrocytes. The combinatorial impact of <i>Sox9</i> and <i>TGF</i>β<i>1</i> on hUC-MSCs was examined <i>in vitro</i> by gene expression and immunocytochemical staining. In <i>in vivo</i>, an animal model of IVD degeneration was established under a fluoroscopic guided system through needle puncture of the caudal disc. Normal and transfected MSCs were transplanted. Oxidative stress, pain, and inflammatory markers were evaluated by qPCR. Disc height index (DHI), water content, and gag content were analyzed. Histological examinations were performed to evaluate the degree of regeneration.<h4>Results</h4>hUC-MSC transfected with <i>Sox9</i>+<i>TGF</i>β<i>1</i> showed a noticeable morphological appearance of a chondrocyte, and highly expressed chondrogenic markers (<i>aggrecan, Sox9, TGF</i>β<i>1, TGF</i>β<i>2</i>, and type II collagens) after transfection. Histological observation demonstrated that cartilage regeneration, extracellular matrix synthesis, and collagen remodeling were significant upon staining with H&E, Alcian blue, and Masson's trichrome stain on day 14. Additionally, oxidative stress, pain, and inflammatory markers were positively downregulated in the animals transplanted with <i>Sox9</i> and <i>TGF</i>β<i>1</i> transfected MSCs.<h4>Conclusion</h4>These findings indicate that the combinatorial effect of <i>Sox9</i> and <i>TGF</i>β<i>1</i> substantially accelerates the chondrogenesis in hUC-MSCs. Cartilage regeneration and matrix synthesis were significantly enhanced. Therefore, a synergistic effect of <i>Sox9</i> and <i>TGF</i>β<i>1</i> could be an immense therapeutic combination in the tissue engineering of cartilaginous joint bio-prostheses and a novel candidate for cartilage stabilization.
Also flagged:behavioralzoonotic diseaseschronic liver failuretumorLGR5transmembrane protein
Journal Article2023-03-17No SnippetsPenning LC, van den Boom R.
Show Full Abstract
First year medical and veterinary students are made very aware that drugs can have very different effects in various species or even in breeds of one specific species. On the other hand, the "One Medicine" concept implies that therapeutic and technical approaches are exchangeable between man and animals. These opposing views on the (dis)similarities between human and veterinary medicine are magnified in regenerative medicine. Regenerative medicine promises to stimulate the body's own regenerative capacity <i>via</i> activation of stem cells and/or the application of instructive biomaterials. Although the potential is enormous, so are the hurdles that need to be overcome before large scale clinical implementation is realistic. It is in the advancement of regenerative medicine that veterinary regenerative medicine can play an instrumental and crucial role. This review describes the discovery of (adult) stem cells in domesticated animals, mainly cats and dogs. The promise of cell-mediated regenerative veterinary medicine is compared to the actual achievements, and this will lead to a set of unanswered questions (controversies, research gaps, potential developments in relation to fundamental, pre-clinical, and clinical research). For veterinary regenerative medicine to have impact, either for human medicine and/or for domesticated animals, answering these questions is pivotal.
Also flagged:oligodendrocyte differentiationmyelininjury(ET)-1endothelin receptor BET-1
Journal Article2023-03-17✓ 1 SnippetDu M, Wang N, Xin X, Yan CL, Gu Y, Wang L, Shen Y.
In-Text Gene Mentions
Introduction)
…as Sox2 andSox6, inhibit their…
Show Full Abstract
Preterm cerebral white matter injury (WMI), a major form of prenatal brain injury, may potentially be treated by oligodendrocyte (OL) precursor cell (OPC) transplantation. However, the defective differentiation of OPCs during WMI seriously hampers the clinical application of OPC transplantation. Thus, improving the ability of transplanted OPCs to differentiate is critical to OPC transplantation therapy for WMI. We established a hypoxia-ischemia-induced preterm WMI model in mice and screened the molecules affected by WMI using single-cell RNA sequencing. We revealed that endothelin (ET)-1 and endothelin receptor B (ETB) are a pair of signaling molecules responsible for the interaction between neurons and OPCs and that preterm WMI led to an increase in the number of ETB-positive OPCs and premyelinating OLs. Furthermore, the maturation of OLs was reduced by knocking out ETB but promoted by stimulating ET-1/ETB signaling. Our research reveals a new signaling module for neuron-OPC interaction and provides new insight for therapy targeting preterm WMI.
Also flagged:colorectal cancertumorcancerOxaliplatin5-Fluorouraciltumors
Journal Article2023-03-17✓ 1 SnippetCao S, Chang W, Wan C, Lu X, Dang P, Zhou X, Zhu H, Chen J, Li B, Zang Y, Wang Y, Zhang C.
In-Text Gene Mentions
Text
…ARFGEF2…
Show Full Abstract
The cells of colorectal cancer (CRC) in their microenvironment experience constant stress, leading to dysregulated activity in the tumor niche. As a result, cancer cells acquire alternative pathways in response to the changing microenvironment, posing significant challenges for the design of effective cancer treatment strategies. While computational studies on high-throughput omics data have advanced our understanding of CRC subtypes, characterizing the heterogeneity of this disease remains remarkably complex. Here, we present a novel computational Pipeline for Characterizing Alternative Mechanisms (PCAM) based on biclustering to gain a more detailed understanding of cancer heterogeneity. Our application of PCAM to large-scale CRC transcriptomics datasets suggests that PCAM can generate a wealth of information leading to new biological understanding and predictive markers of alternative mechanisms. Our key findings include: 1) A comprehensive collection of alternative pathways in CRC, associated with biological and clinical factors. 2) Full annotation of detected alternative mechanisms, including their enrichment in known pathways and associations with various clinical outcomes. 3) A mechanistic relationship between known clinical subtypes and outcomes on a consensus map, visualized by the presence of alternative mechanisms. 4) Several potential novel alternative drug resistance mechanisms for Oxaliplatin, 5-Fluorouracil, and FOLFOX, some of which were validated on independent datasets. We believe that gaining a deeper understanding of alternative mechanisms is a critical step towards characterizing the heterogeneity of CRC. The hypotheses generated by PCAM, along with the comprehensive collection of biologically and clinically associated alternative pathways in CRC, could provide valuable insights into the underlying mechanisms driving cancer progression and drug resistance, which could aid in the development of more effective cancer therapies and guide experimental design towards more targeted and personalized treatment strategies. The computational pipeline of PCAM is available in GitHub (https://github.com/changwn/BC-CRC).
<h4>Aim of the study</h4>In the treatment of chronic hepatitis C, the need for non-invasive methods, other than invasive methods, is increasing for the detection of fibrosis before and after treatment. In our study, we aimed to determine the changes in histological response with post-treatment biochemical scoring in patients treated with direct-acting antivirals.<h4>Material and methods</h4>Between June 1, 2016, and January 1, 2020, 125 patients followed up with a diagnosis of chronic hepatitis C, who presented to Haseki Training and Research Hospital, were enrolled in the study. Scores of APRI, Fibro Q, Fibrosis-4 (FIB-4) index, Doha score, Fibro alpha, and fibrosis-cirrhosis index were used to evaluate the liver fibrosis of the patients with examinations before treatment, at the end of treatment and at the 12<sup>th</sup> week, first year, and third year after treatment. The study was conducted as a retrospective observational case series.<h4>Results</h4>One hundred twenty-five patients were enrolled in the study. The mean age was 55.5 ±15.9 years. Patients were divided into two groups according to their baseline FIB-4 values: cirrhotic/noncirrhotic. Seven (5.6%) patients had compensated cirrhosis; there were no decompensated cirrhotic patients. There was a statistically significant decrease in scores of APRI, FIB-4, Fibro Q, and Doha score calculated during the end-of-treatment three-year follow-up period.<h4>Conclusions</h4>It was shown that serum fibrosis scores, such as APRI, FIB-4, Fibro Q, and Doha score, could be used to detect fibrosis before treatment and to follow histological improvement after treatment with direct-acting antivirals (DAA) in chronic hepatitis C patients.
Also flagged:Bevacizumabgene expressioncolorectal adenocarcinomacell adhesioncell migrationextracellular
Journal Article2023-03-17No SnippetsCesare S, Tiziano L, Elena L, Alessandro RF, Luca V, Annarosa A.
Show Full Abstract
A bioinformatic approach was applied to evaluate the effect of treatment with Bevacizumab on the gene expression profile of colorectal adenocarcinoma cells. The transcriptomic profile of Bevacizumab-adapted HCT-116 (Bev/A) colorectal adenocarcinoma cells was determined and compared with that of the corresponding control cell line by Agilent microarray analysis. Raw data were preprocessed, normalized, filtered, and subjected to a differential expression analysis using standard R/Bioconductor packages (i.e., limma, RankProd). As consequence of Bevacizumab adaptation, 166 differentially expressed genes (DEGs) emerged, most of them (123) resulted downregulated and 43 overexpressed. The list of statistically significant dysregulated genes was used as an input for functional overrepresentation analysis using ToppFun web tool. Such analysis pointed at cell adhesion, cell migration, extracellular matrix organization and angiogenesis as the main dysregulated biological process involved in Bevacizumab-adaptation of HCT116 cells. In addition, gene set enrichment analysis was performed using GSEA, searching for enriched terms within the Hallmarks (H), Canonical Pathways (CP), and Gene Ontology (GO) gene sets. GO terms that showed significant enrichment included: transportome, vascularization, cell adhesion and cytoskeleton, extra cellular matrix (ECM), differentiation and epithelial-mesenchymal transition (EMT), inflammation and immune response. Raw and normalized microarray data were deposited in the Gene Expression Omnibus (GEO) public repository with accession number GSE221948.
Also flagged:Tumor Necrosis Factor-αCD1ACD1EGuillain-Barré Syndromepathogenesisimmune response
Journal Article2023-03-17No SnippetsChakraborty R, Verma R, Jain A, Garg RK, Atam V, Malhotra HS, Sharma PK, Prakash S, Kumar N, Pandey S, Uniyal R, Rizvi I.
Show Full Abstract
<h4>Background</h4>Guillain-Barré Syndrome (GBS) is an acute acquired autoimmune inflammatory disorder of peripheral nerves and roots. The pathogenesis is essentially an aberrant post-infectious immune response in a genetically susceptible host milieu. Single nucleotide polymorphisms (SNP) in genes encoding the inflammatory mediators like TNF-α, CD1A and CD1E can influence their expression and level and the susceptibility and clinical course of disease in GBS.<h4>Objective</h4>We tried to study the susceptibility of single nucleotide polymorphisms of TNF-α and CD1 genes in Guillain-Barré Syndrome in Indian population and determine the association in terms of genotype, allele and haplotype distribution along with individual subtype, severity and clinical outcome.<h4>Methodology</h4>In this case-control study, we investigated the single nucleotide polymorphism pattern in the promoter region of TNF-α (-308 G/A), TNF-α (-863C/A), CD1A and CD1E genes using real-time polymerase chain reaction in 75 GBS patients and analysed in comparison with 75 age and sex-matched healthy controls.<h4>Results</h4>The findings revealed that the allelic distribution of TNF-α (-308 G/A) *A allele was associated with GBS (<i>P</i> value 0.04, Odds Ratio 2.03, 95% Confidence Interval 1.01-4.07). There was no association found with genotype, haplotype combination and other allele distribution for GBS in the study. CD1A and CD1E SNPs did not reveal any susceptibility for GBS. The subtype analysis did not reveal any statistical significance, except for CD1A *G allele with AMAN subtype (<i>P</i> value 0.026). The haplotypic combinations and mutant allele of TNF-α (-308 G/A), TNF-α (-863C/A), CD1A and CD1E were significantly associated with severe GBS in the study. However, there was no association of any SNP for mortality and survival of GBS in the study.<h4>Conclusion</h4>TNF-α (-308 G/A)*A allele might confer genetic susceptibility for GBS in Indian population. CD1 genetic polymorphism could not be considered for susceptibility to GBS. TNF-α and CD1 genetic polymorphism did not affect mortality in GBS.
Research Square2023-03-17Preprint (No Snippets API)Schreurs R, Koulis A, Booiman T, Boeser-Nunnink B, Cloherty A, Rader A, Patel K, Kootstra N, Ribeiro C.
Show Full Abstract
<title>Abstract</title> <p>Chronic HIV-1 infection is characterized by T-cell dysregulation that is only partly restored by antiretroviral therapy. Here, we demonstrate a protective role for autophagy in HIV-1 disease pathogenesis. Targeted analysis of genetic variation in core autophagy gene <italic>ATG16L1 </italic>revealed a previously unidentified polymorphism, which correlated functionally with enhanced autophagy and clinically with improved survival of untreated HIV-1-infected individuals. Intrinsically-enhanced autophagy in homozygous minor T-cells resulted in superior antiviral immunity, evidenced by increased proliferation, revamped immune responsiveness, and suppressed exhaustion/immunosenescence features. In-depth flow-cytometric and transcriptional T-helper-profiling revealed signatures unique to minor genotyped individuals with enriched regulation of pro-inflammatory networks and skewing towards immunoregulatory T-cell-phenotype. Treatment with autophagy-enhancing pharmaceuticals reprogrammed T-cells to exhibit the protective traits observed in homozygous minor donors. These data underscore the <italic>in vivo</italic> relevance of autophagy for longer-lasting T-cell-mediated HIV-1 control, with implications towards development of host-directed therapeutics targeting autophagy to restore immune function in chronic HIV-1 infection.</p>
Also flagged:acute lymphoblastic leukemiaALLKMT2ATCF3PBX1Ph-like
Journal Article2023-03-16✓ 1 SnippetSun K, Wang J, Chen WM, Xu N, Long LY, Wang X, Jiang H, Jiang Q, Huang XJ, Qin YZ.
In-Text Gene Mentions
Methods)
…, KMT2A-MLLT3 , KMT2A-MLLT10, KMT2A-MLLT1 ,…
Show Full Abstract
More clinical studies are needed to clarify the risk stratification by the integration of all fusion genes in adult B-cell precursor acute lymphoblastic leukemia (BCP-ALL). A total of 320 consecutive adult Ph-negative BCP-ALL patients who had been tested classical fusions (KMT2A rearrangement and TCF3-PBX1) at diagnosis were further retrospectively screened novel fusion genes (Ph-like, ZNF384 and MEF2D fusions) by multiplex real-time quantitative PCR (RQ-PCR). Classical fusions were identified in 12.5% of patients, while 4.4%, 17.2% and 3.8% of patients were identified Ph-like, ZNF384 and MEF2D fusions, respectively. 1-course CR rate, relapse-free survival (RFS) and overall survival (OS) rates tended to show or showed statistically significant differences among fusion-defined subgroups (P = 0.084, 0.001 and 0.0093, respectively). Based on individual outcomes, patients with KMT2A rearrangement, TCF3-PBX1, Ph-like, and MEF2D fusions were classified into fusion-defined high-risk group (n = 66, 20.6%). High-risk group had significantly lower 3-year RFS and 3-year OS rates than standard-risk group (P 0.001 and = 0.0022), and was an independent adverse prognostic factor for RFS in the entire cohort (P 0.001). In conclusion, the spectrum of fusion genes in the current Chinese cohort was distinct from that in reports from western countries. Detection of fusion genes improved risk stratification in adult Ph-negative BCP-ALL patients.
Also flagged:fatty acidgestationmetabolismintrauterine growth restrictionIUGRcholesterol
Journal Article2023-03-16✓ 1 SnippetZimmerman KD, Chan J, Glenn JP, Birnbaum S, Li C, Nathanielsz PW, Olivier M, Cox LA.
In-Text Gene Mentions
Results)
…ENOX1, LOC103886823, EBF3,LRRC7), and all of…
Show Full Abstract
Fetal liver tissue collected from a nonhuman primate (NHP) baboon model of maternal nutrient reduction (MNR) at four gestational time points (90, 120, 140, and 165 days gestation [dG], term in the baboon is ∼185 dG) was used to quantify MNR effects on the fetal liver transcriptome. 28 transcripts demonstrated different expression patterns between MNR and control livers during the second half of gestation, a developmental period when the fetus undergoes rapid weight gain and fat accumulation. Differentially expressed transcripts were enriched for fatty acid oxidation and RNA splicing-related pathways. Increased RNA splicing activity in MNR was reflected in greater abundances of transcript splice variant isoforms in the MNR group. It can be hypothesized that the increase in splice variants is deployed in an effort to adapt to the poor <i>in utero</i> environment and ensure near-normal development and energy metabolism. This study is the first to study developmental programming across four critical gestational stages during primate fetal liver development and reveals a potentially novel cellular response mechanism mediating fetal programming in response to MNR.
In poultry production, there has been a trend of continuous increase in cost of feed ingredients which represents the major proportion of the production costs. Feed costs can be reduced by improving feed efficiency traits which increase the possibility of using various indigestible feed sources and decrease the environmental impact of the enhanced poultry production. Therefore, feed efficiency has been used as one of the most important economic traits of selection in the breeding program of chickens. Recently, many OMICs experimental studies have been designed to characterize biological differences between the high and low feed efficiency chicken phenotypes. Biological complexity cannot be fully captured by main individual OMICs such as genomics, transcriptomics, proteomics and metabolomics. Therefore, researchers have combined multiple assays from the same set of samples to create multi-OMICs datasets. OMICs findings are crucial in improving existing approaches to poultry breeding. The current review aimed to highlight the components of feed efficiency and general OMICs approaches and technologies. Besides, individual and multi-OMICs based understanding of chicken feed efficiency traits and the application of the acquired knowledge in the chicken breeding program were addressed.
Also flagged:polymerhomopolymershomopolymernucleotidepolymerspore
Journal Article2023-03-16No SnippetsDunn T, Blaauw D, Das R, Narayanasamy S.
Show Full Abstract
Despite recent improvements in nanopore basecalling accuracy, germline variant calling of small insertions and deletions (INDELs) remains poor. Although precision and recall for single nucleotide polymorphisms (SNPs) now exceeds 99.5%, INDEL recall remains below 80% for standard R9.4.1 flow cells. We show that read phasing and realignment can recover a significant portion of false negative INDELs. In particular, we extend Needleman-Wunsch affine gap alignment by introducing new gap penalties for more accurately aligning repeated n-polymer sequences such as homopolymers ([Formula: see text]) and tandem repeats ([Formula: see text]). At the same precision, haplotype phasing improves INDEL recall from 63.76 to [Formula: see text] and nPoRe realignment improves it further to [Formula: see text].
Also flagged:behavioralAddictiondepressionCPmental health disorderstransportation
Journal Article2023-03-16No SnippetsMayhew M, Balderson BH, Cook AJ, Dickerson JF, Elder CR, Firemark AJ, Haller IV, Justice M, Keefe FJ, McMullen CK, O'Keeffe-Rosetti MC, Owen-Smith AA, Rini C, Schneider JL, Von Korff M, Wandner LD, DeBar LL.
Show Full Abstract
<h4>Background</h4>Cognitive behavioral therapy for chronic pain (CBT-CP) is an effective but underused treatment for high-impact chronic pain. Increased access to CBT-CP services for pain is of critical public health importance, particularly for rural and medically underserved populations who have limited access due to these services being concentrated in urban and high income areas. Making CBT-CP widely available and more affordable could reduce barriers to CBT-CP use.<h4>Methods</h4>As part of the National Institutes of Health Helping to End Addiction Long-term® (NIH HEAL) initiative, we designed and implemented a comparative effectiveness, 3-arm randomized control trial comparing remotely delivered telephonic/video and online CBT-CP-based services to usual care for patients with high-impact chronic pain. The RESOLVE trial is being conducted in 4 large integrated healthcare systems located in Minnesota, Georgia, Oregon, and Washington state and includes demographically diverse populations residing in urban and rural areas. The trial compares (1) an 8-session, one-on-one, professionally delivered telephonic/video CBT-CP program; and (2) a previously developed and tested 8-session online CBT-CP-based program (painTRAINER) to (3) usual care augmented by a written guide for chronic pain management. Participants are followed for 1 year post-allocation and are assessed at baseline, and 3, 6, and 12 months post-allocation. The primary outcome is minimal clinically important difference (MCID; ≥ 30% reduction) in pain severity (composite of pain intensity and pain-related interference) assessed by a modified 11-item version of the Brief Pain Inventory-Short Form at 3 months. Secondary outcomes include pain severity, pain intensity, and pain-related interference scores, quality of life measures, and patient global impression of change at 3, 6, and 12 months. Cost-effectiveness is assessed by incremental cost per additional patient with MCID in primary outcome and by cost per quality-adjusted life year achieved. Outcome assessment is blinded to group assignment.<h4>Discussion</h4>This large-scale trial provides a unique opportunity to rigorously evaluate and compare the clinical and cost-effectiveness of 2 relatively low-cost and scalable modalities for providing CBT-CP-based treatments to persons with high-impact chronic pain, including those residing in rural and other medically underserved areas with limited access to these services.<h4>Trial registration</h4>ClinicalTrials.gov NCT04523714. This trial was registered on 24 August 2020.
Also flagged:Spengene expressionX-chromosomecancerbindingRRM
Journal Article2023-03-16No SnippetsAppel LM, Benedum J, Engl M, Platzer S, Schleiffer A, Strobl X, Slade D.
Show Full Abstract
Since it was first described >20 yr ago, the SPOC domain (Spen paralog and ortholog C-terminal domain) has been identified in many proteins all across eukaryotic species. SPOC-containing proteins regulate gene expression on various levels ranging from transcription to RNA processing, modification, export, and stability, as well as X-chromosome inactivation. Their manifold roles in controlling transcriptional output implicate them in a plethora of developmental processes, and their misregulation is often associated with cancer. Here, we provide an overview of the biophysical properties of the SPOC domain and its interaction with phosphorylated binding partners, the phylogenetic origin of SPOC domain proteins, the diverse functions of mammalian SPOC proteins and their homologs, the mechanisms by which they regulate differentiation and development, and their roles in cancer.
Also flagged:CD34acute myeloid leukemiaCEP70COMMD7DNMT3BECE1
Journal Article2023-03-16✓ 1 SnippetPogosova-Agadjanyan EL, Hua X, Othus M, Appelbaum FR, Chauncey TR, Erba HP, Fitzgibbon MP, Jenkins IC, Fang M, Lee SC, Moseley A, Naru J, Radich JP, Smith JL, Willborg BE, Willman CL, Wu F, Meshinchi S, Stirewalt DL.
In-Text Gene Mentions
Abstract)
…, LNX2 ,NEGR1, PIK3C2B ,…
Show Full Abstract
<h4>Background</h4>Studies have not systematically compared the ability to verify performance of prognostic transcripts in paired bulk mononuclear cells versus viable CD34-expressing leukemic blasts from patients with acute myeloid leukemia. We hypothesized that examining the homogenous leukemic blasts will yield different biological information and may improve prognostic performance of expression biomarkers.<h4>Methods</h4>To assess the impact of cellular heterogeneity on expression biomarkers in acute myeloid leukemia, we systematically examined paired mononuclear cells and viable CD34-expressing leukemic blasts from SWOG diagnostic specimens. After enrichment, patients were assigned into discovery and validation cohorts based on availability of extracted RNA. Analyses of RNA sequencing data examined how enrichment impacted differentially expressed genes associated with pre-analytic variables, patient characteristics, and clinical outcomes.<h4>Results</h4>Blast enrichment yielded significantly different expression profiles and biological pathways associated with clinical characteristics (e.g., cytogenetics). Although numerous differentially expressed genes were associated with clinical outcomes, most lost their prognostic significance in the mononuclear cells and blasts after adjusting for age and ELN risk, with only 11 genes remaining significant for overall survival in both cell populations (CEP70, COMMD7, DNMT3B, ECE1, LNX2, NEGR1, PIK3C2B, SEMA4D, SMAD2, TAF8, ZNF444). To examine the impact of enrichment on biomarker verification, these 11 candidate biomarkers were examined by quantitative RT/PCR in the validation cohort. After adjusting for ELN risk and age, expression of 4 genes (CEP70, DNMT3B, ECE1, and PIK3CB) remained significantly associated with overall survival in the blasts, while none met statistical significance in mononuclear cells.<h4>Conclusions</h4>This study provides insights into biological information gained/lost by examining viable CD34-expressing leukemic blasts versus mononuclear cells from the same patient and shows an improved verification rate for expression biomarkers in blasts.
Also flagged:coronary artery diseaseadhesion proteinsE-selectinICAM1VCAM1nitric oxide
Journal Article2023-03-16✓ 5 SnippetsWünnemann F, Fotsing Tadjo T, Beaudoin M, Lalonde S, Lo KS, Kleinstiver BP, Lettre G.
In-Text Gene Mentions
Results)
…We used the endothelial marker gene CDH5 to identify a cluster of endothelial cells and confirmed that these cells express DHX38, MAT2A, CCDC92, FES and FURIN, prompting future efforts to dissect the role of these genes in this cell type in atherosclerosis (Fig 6C).…
Methods)
…vectors containing theCCDC92ORF from John…
Results)
…CNNM2 (rs78260931) andZNF664(rs12311848) ( Fig…
Results)
…the expression ofZNF664but the expression…
Results)
…the expression ofCCDC92, a gene…
Show Full Abstract
Genome-wide association studies have identified >250 genetic variants associated with coronary artery disease (CAD), but the causal variants, genes and molecular mechanisms remain unknown at most loci. We performed pooled CRISPR screens to test the impact of sequences at or near CAD-associated genetic variants on vascular endothelial cell functions. Using CRISPR knockout, inhibition and activation, we targeted 1998 variants at 83 CAD loci to assess their effect on three adhesion proteins (E-selectin, ICAM1, VCAM1) and three key endothelial functions (nitric oxide and reactive oxygen species production, calcium signalling). At a false discovery rate ≤10%, we identified significant CRISPR perturbations near 42 variants located within 26 CAD loci. We used base editing to validate a putative causal variant in the promoter of the FES gene. Although a few of the loci include genes previously characterized in endothelial cells (e.g. AIDA, ARHGEF26, ADAMTS7), most are implicated in endothelial dysfunction for the first time. Detailed characterization of one of these new loci implicated the RNA helicase DHX38 in vascular endothelial cell senescence. While promising, our results also highlighted several limitations in using CRISPR perturbations to functionally dissect GWAS loci, including an unknown false negative rate and potential off-target effects.
Also flagged:proteaseCoronavirus Disease 2019COVID-19spike proteininfectionpp1a
Journal Article2023-03-16✓ 1 SnippetHuang C, Shuai H, Qiao J, Hou Y, Zeng R, Xia A, Xie L, Fang Z, Li Y, Yoon C, Huang Q, Hu B, You J, Quan B, Zhao X, Guo N, Zhang S, Ma R, Zhang J, Wang Y, Yang R, Zhang S, Nan J, Xu H, Wang F, Lei J, Chu H, Yang S.
In-Text Gene Mentions
Discussion)
…like SARS-CoV-1 andMERS-CoV-1.…
Show Full Abstract
Emerging SARS-CoV-2 variants, particularly the Omicron variant and its sublineages, continually threaten the global public health. Small molecule antivirals are an effective treatment strategy to fight against the virus. However, the first-generation antivirals either show limited clinical efficacy and/or have some defects in pharmacokinetic (PK) properties. Moreover, with increased use of these drugs across the globe, they face great pressure of drug resistance. We herein present the discovery and characterization of a new generation antiviral drug candidate (SY110), which is a potent and selective inhibitor of SARS-CoV-2 main protease (M<sup>pro</sup>). This compound displayed potent in vitro antiviral activity against not only the predominant SARS-CoV-2 Omicron sublineage BA.5, but also other highly pathogenic human coronaviruses including SARS-CoV-1 and MERS-CoV. In the Omicron-infected K18-hACE2 mouse model, oral treatment with SY110 significantly lowered the viral burdens in lung and alleviated the virus-induced pathology. Importantly, SY110 possesses favorable PK properties with high oral drug exposure and oral bioavailability, and also an outstanding safety profile. Furthermore, SY110 exhibited sensitivity to several drug-resistance M<sup>pro</sup> mutations. Collectively, this investigation provides a promising new drug candidate against Omicron and other variants of SARS-CoV-2.
Nonalcoholic fatty liver disease (NAFLD) has been linked with a number of extra hepatic diseases and could be a potential risk factor of decreasing bone mineral density. To determine whether Upper Egyptian patients with NAFLD are at risk of developing osteoporosis. Cross sectional study was done on a total 100 individuals; 50 patients diagnosed with NAFLD (based on ultrasound imaging) crossed-matched with 50 individuals without NAFLD based on age, sex and body mass index. Bone mineral density, serum calcium and phosphorus levels, serum parathyroid hormone, serum vitamin D and fasting insulin level were assessed. Osteoporosis was prevalent in NAFLD patients versus to controls (19/50 vs. 0/50; P < 0.001). There was significant decrease in bone mineral density in NAFLD patients than controls (- 2.29 ± 0.4 vs. - 1.53 ± 0.1; P < 0.001). There was a statistical significance decrease in serum vitamin D and calcium levels in NAFLD patients than controls. Furthermore, vitamin D levels in the NAFLD group was a predictor for osteoporosis (OR 0.614; 95% CI 0.348-0.825). Patients with NAFLD tend to have a significant decrease in bone density, vitamin D, and serum calcium levels than controls.
…Leucine-rich repeat-containing protein 8repeat-containing protein 8…
Show Full Abstract
Leucine-rich repeat-containing protein 8 (LRRC8) family members form volume-regulated anion channels activated by hypoosmotic cell swelling. LRRC8 channels are ubiquitously expressed in vertebrate cells as heteromeric assemblies of LRRC8A (SWELL1) and LRRC8B-E subunits. Channels of different subunit composition have distinct properties that explain the functional diversity of LRRC8 currents across cell types. However, the basis for heteromeric LRRC8 channel assembly and function is unknown. Here we leverage a fiducial-tagging strategy to determine single-particle cryo-EM structures of heterohexameric LRRC8A:C channels in multiple conformations. Compared to homomers, LRRC8A:C channels show pronounced differences in architecture due to heterotypic LRR interactions that displace subunits away from the conduction axis and poise the channel for activation. Structures and functional studies further reveal that lipids embedded in the channel pore block ion conduction in the closed state. These results provide insight into determinants for heteromeric LRRC8 channel assembly, activity and gating by lipids.
Also flagged:aginginflammation-relatedobesitydiabetesjoint disordersrespiratory diseases
Journal Article2023-03-16✓ 1 SnippetYe Y, Noche RB, Szejko N, Both CP, Acosta JN, Leasure AC, Brown SC, Sheth KN, Gill TM, Zhao H, Falcone GJ.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Frailty is an aging-related clinical phenotype defined as a state in which there is an increase in a person's vulnerability for dependency and/or mortality when exposed to a stressor. While underlying mechanisms leading to the occurrence of frailty are complex, the importance of genetic factors has not been fully investigated. We conducted a large-scale genome-wide association study (GWAS) of frailty, as defined by the five criteria (weight loss, exhaustion, physical activity, walking speed, and grip strength) captured in the Fried Frailty Score (FFS), in 386,565 European descent participants enrolled in the UK Biobank (mean age 57 [SD 8] years, 208,481 [54%] females). We identified 37 independent, novel loci associated with the FFS (p < 5 × 10<sup>-8</sup>), including seven loci without prior described associations with other traits. The variants associated with FFS were significantly enriched in brain tissues as well as aging-related pathways. Our post-GWAS bioinformatic analyses revealed significant genetic correlations between FFS and cardiovascular-, neurological-, and inflammation-related diseases/traits, and subsequent Mendelian Randomization analyses identified causal associations with chronic pain, obesity, diabetes, education-related traits, joint disorders, and depressive/neurological, metabolic, and respiratory diseases. The GWAS signals were replicated in the Health and Retirement Study (HRS, n = 9,720, mean age 73 [SD 7], 5,582 [57%] females), where the polygenic risk score built from UKB GWAS was significantly associated with the FFS in HRS individuals (OR per SD of the score 1.27, 95% CI 1.22-1.31, p = 1.3 × 10<sup>-11</sup>). These results provide new insight into the biology of frailty by comprehensively evaluating its genetic architecture.
Also flagged:rheumatoid arthritissystemic lupus erythematosusRASLEsystemic inflammatory autoimmune diseasespathogenesis
Journal Article2023-03-16No SnippetsTyagi N, Mehla K, Gupta D.
Show Full Abstract
Rheumatoid Arthritis (RA) and Systemic Lupus Erythematosus (SLE) are the two highly prevalent debilitating and sometimes life-threatening systemic inflammatory autoimmune diseases. The etiology and pathogenesis of RA and SLE are interconnected in several ways, with limited knowledge about the underlying molecular mechanisms. With the motivation to better understand shared biological mechanisms and determine novel therapeutic targets, we explored common molecular disease signatures by performing a meta-analysis of publicly available microarray gene expression datasets of RA and SLE. We performed an integrated, multi-cohort analysis of 1088 transcriptomic profiles from 14 independent studies to identify common gene signatures. We identified sixty-two genes common among RA and SLE, out of which fifty-nine genes (21 upregulated and 38 downregulated) had similar expression profiles in the diseases. However, antagonistic expression profiles were observed for ACVR2A, FAM135A, and MAPRE1 genes. Thirty genes common between RA and SLE were proposed as robust gene signatures, with persistent expression in all the studies and cell types. These gene signatures were found to be involved in innate as well as adaptive immune responses, bone development and growth. In conclusion, our analysis of multicohort and multiple microarray datasets would provide the basis for understanding the common mechanisms of pathogenesis and exploring these gene signatures for their diagnostic and therapeutic potential.
Also flagged:tumorsneuroendocrine neoplasmsparagangliomamiddle ear neuroendocrine tumormiddle ear adenomamedullary thyroid carcinoma
Journal Article2023-03-16No SnippetsLott Limbach A, Chute DJ.
Show Full Abstract
<h4>Background</h4>Nested is defined as "cellular clusters arranged in small groupings with intervening vascular or stromal networks, lacking lumens or glandular formation." Using this definition, multiple neoplastic and non-neoplastic lesions of the head and neck come into the differential. We have broadly organized the differential diagnosis of "nested" tumors into entities with neuroendocrine differentiation, squamous differentiation, thyroid follicular cell differentiation, and other lesions.<h4>Methods</h4>Review.<h4>Results</h4>Many different entities have a nested appearance and the morphologic, immunohistochemical, clinical, and radiographic features contribute to the differential diagnosis. The different tumors covered in this review include neuroendocrine neoplasms, paraganglioma, middle ear neuroendocrine tumor (formerly known as middle ear adenoma), medullary thyroid carcinoma, poorly differentiated thyroid carcinoma, olfactory neuroblastoma, ectopic pituitary neuroendocrine tumor, hyalinizing trabecular tumor, solid subtype of papillary thyroid carcinoma, solid cell nests/C-cell hyperplasia, necrotizing sialometaplasia, and meningioma.<h4>Conclusion</h4>In this review, we discuss the morphologic and immunohistochemical features of the covered entities as a guide to differential diagnosis when nested-patterned head and neck lesions are encountered.
Also flagged:Erythroblast Transformation Specifictranscription factorERGprimary lymphoedematransforming growth factor-βGPR156
Journal Article2023-03-16✓ 3 SnippetsGreene D, Genomics England Research Consortium, Pirri D, Frudd K, Sackey E, Al-Owain M, Giese APJ, Ramzan K, Riaz S, Yamanaka I, Boeckx N, Thys C, Gelb BD, Brennan P, Hartill V, Harvengt J, Kosho T, Mansour S, Masuno M, Ohata T, Stewart H, Taibah K, Turner CLS, Imtiaz F, Riazuddin S, Morisaki T, Ostergaard P, Loeys BL, Morisaki H, Ahmed ZM, Birdsey GM, Freson K, Mumford A, Turro E.
In-Text Gene Mentions
Discussion)
…For example, LRRC7, which we identified to be associated with intellectual disability, encodes a brain-specific protein in postsynaptic densities37, and LRRC7-deficient mice exhibit a neurobehavioral phenotype38.…
Discussion)
…For example,LRRC7, which we…
Discussion)
…37 , andLRRC7-deficient mice exhibit a…
Show Full Abstract
The genetic etiologies of more than half of rare diseases remain unknown. Standardized genome sequencing and phenotyping of large patient cohorts provide an opportunity for discovering the unknown etiologies, but this depends on efficient and powerful analytical methods. We built a compact database, the 'Rareservoir', containing the rare variant genotypes and phenotypes of 77,539 participants sequenced by the 100,000 Genomes Project. We then used the Bayesian genetic association method BeviMed to infer associations between genes and each of 269 rare disease classes assigned by clinicians to the participants. We identified 241 known and 19 previously unidentified associations. We validated associations with ERG, PMEPA1 and GPR156 by searching for pedigrees in other cohorts and using bioinformatic and experimental approaches. We provide evidence that (1) loss-of-function variants in the Erythroblast Transformation Specific (ETS)-family transcription factor encoding gene ERG lead to primary lymphoedema, (2) truncating variants in the last exon of transforming growth factor-β regulator PMEPA1 result in Loeys-Dietz syndrome and (3) loss-of-function variants in GPR156 give rise to recessive congenital hearing impairment. The Rareservoir provides a lightweight, flexible and portable system for synthesizing the genetic and phenotypic data required to study rare disease cohorts with tens of thousands of participants.
…12p13.31 encompassing SLC2A3,SLC2A14, and NANOGP1 modifies…
Show Full Abstract
Turner syndrome (TS) is a chromosomal disorder caused by complete or partial loss of the second sex chromosome and exhibits phenotypic heterogeneity, even after accounting for mosaicism and karyotypic variation. Congenital heart defects (CHD) are found in up to 45 percent of girls with TS and span a phenotypic continuum of obstructive left-sided lesions, with bicuspid aortic valve (BAV) being the most common. Several recent studies have demonstrated a genome-wide impact of X chromosome haploinsufficiency, including global hypomethylation and altered RNA expression. The presence of such broad changes to the TS epigenome and transcriptome led others to hypothesize that X chromosome haploinsufficiency sensitizes the TS genome, and several studies have demonstrated that a second genetic hit can modify disease susceptibility in TS. The objective of this study was to determine whether genetic variants in known heart developmental pathways act synergistically in this setting to increase the risk for CHD, specifically BAV, in TS. We analyzed 208 whole exomes from girls and women with TS and performed gene-based variant enrichment analysis and rare-variant association testing to identify variants associated with BAV in TS. Notably, rare variants in CRELD1 were significantly enriched in individuals with TS who had BAV compared to those with structurally normal hearts. CRELD1 is a protein that functions as a regulator of calcineurin/NFAT signaling, and rare variants in CRELD1 have been associated with both syndromic and non-syndromic CHD. This observation supports the hypothesis that genetic modifiers outside the X chromosome that lie in known heart development pathways may influence CHD risk in TS.
Also flagged:Bcr-AblosteoarthritisRIPK1RIPK3kinasesOA
Journal Article2023-03-16✓ 5 SnippetsPiao L, Wu D, Rui C, Yang Y, Liu S, Liu J, Jin Z, Zhang H, Feng X, Bai L.
In-Text Gene Mentions
Title)
…The Bcr-Abl inhibitor DCC-2036 inhibits necroptosis and ameliorates osteoarthritis by targeting RIPK1 and RIPK3 kinases.…
Abstract)
…In summary, our research suggests that DCC-2036, a new necroptosis inhibitor targeting RIPK1 and RIPK3 kinase activity, may be useful for the clinical treatment of OA and provides a new direction for the research and treatment of OA.…
…found that oralDCC-2036inhibited chondrocyte damage…
Show Full Abstract
Osteoarthritis (OA) is a chronic progressive degenerative joint disease. Owing to its complex pathogenesis, OA treatment is typically challenging. Necroptosis is a form of programmed cell death mainly mediated by the serine/threonine kinases, RIPK1 and RIPK3, and mixed lineage kinase-like domain (MLKL). In this study, we found that the multi-targeted kinase inhibitor DCC-2036 can inhibit TSZ (TNF-α, Smac mimetic, and z-VAD-FMK)-induced necroptosis of chondrocytes and synovial fibroblast cells (SFs). In addition, we found that oral DCC-2036 inhibited chondrocyte damage in a rat model of OA induced by intra-articular injection of monosodium iodoacetate (MIA). A mechanistic study showed that DCC-2036 directly inhibited the activities of RIPK1 and RIPK3 kinases to block necroptosis, inhibiting the inflammatory response and protecting chondrocytes. In summary, our research suggests that DCC-2036, a new necroptosis inhibitor targeting RIPK1 and RIPK3 kinase activity, may be useful for the clinical treatment of OA and provides a new direction for the research and treatment of OA.
Huntington's disease is caused by a polyglutamine (polyQ) expansion in the huntingtin protein. Huntingtin exon 1 (Httex1), as well as other naturally occurring N-terminal huntingtin fragments with expanded polyQ are prone to aggregation, forming potentially cytotoxic oligomers and fibrils. Antibodies and other N-terminal huntingtin binders are widely explored as biomarkers and possible aggregation-inhibiting therapeutics. A monoclonal antibody, MW1, is known to preferentially bind to huntingtin fragments with expanded polyQ lengths, but the molecular basis of the polyQ length specificity remains poorly understood. Using solution NMR, electron paramagnetic resonance, and other biophysical methods, we investigated the structural features of the Httex1-MW1 interaction. Rather than recognizing residual α-helical structure, which is promoted by expanded Q-lengths, MW1 caused the formation of a new, non-native, conformation in which the entire polyQ is largely extended. This non-native polyQ structure allowed the formation of large mixed Httex1-MW1 multimers (600-2900 kD), when Httex1 with pathogenic Q-length (Q46) was used. We propose that these multivalent, entropically favored interactions, are available only to proteins with longer Q-lengths and represent a major factor governing the Q-length preference of MW1. The present study reveals that it is possible to target proteins with longer Q-lengths without having to stabilize a natively favored conformation. Such mechanisms could be exploited in the design of other Q-length specific binders.
Also flagged:Ironhereditary hemochromatosischronic liver diseasesTFR2HJVHAMP
Journal Article2023-03-16✓ 5 SnippetsKurata N, Shizuku M, Jobara K, Ishizu Y, Ishigami M, Ogura Y.
In-Text Gene Mentions
Abstract)
…typical mutations inHFE, TFR2, HJV, HAMP,…
Introduction)
…been identified, includingHFE, HJV, and HAMP…
I A O 0000613)
…no mutations inHFE, TFR2, HJV, HAMP,…
I A O 0000613)
…representative of hereditaryhemochromatosisand ferroportin disease.…
Acknowledgments)
…advice in hereditaryhemochromatosis.…
Show Full Abstract
Recently, magnetic resonance imaging (MRI) has been developed as a widely available and noninvasive method for detecting and evaluating hepatic iron overload. This case report presents a successful living donor liver transplantation (LDLT) in which the donor was suspected to have hepatic iron deposition by MRI evaluation. A preoperative donor liver biopsy and genetic examination were performed to exclude hereditary hemochromatosis and other chronic liver diseases. A liver biopsy showed an almost normal liver specimen with a slight deposition of iron in 2-3% of hepatocytes, and a genetic examination of hereditary hemochromatosis revealed no typical mutations in HFE, TFR2, HJV, HAMP, or SLC40A1. Despite the traumatic hemothorax complication caused by the liver biopsy, the liver transplant eligibility was confirmed. Two months after the hemothorax complication, an LDLT donor operation was performed. The donor was discharged from the hospital on postoperative day (POD) #17 with favorable liver function. The recipient's posttransplant clinical course was generally favorable except for acute cellular rejection and biliary complications, and the recipient was discharged from the hospital on POD #87 with excellent graft function. A one-year follow-up liver biopsy of the recipient demonstrated almost normal liver with iron deposition in less than 1% of the hepatocytes, and no iron deposition was identified in the liver graft by MRI examination. Liver biopsy and genetic examination are effective methods to evaluate the eligibility of liver transplant donors with suspected hepatic iron deposition. The living donor with slight hepatic iron deposition, if hereditary hemochromatosis was ruled out, can donate partial liver safely.
Also flagged:chronic diseasesagingbone tumormetalsextracellularglycosaminoglycans
Journal Article2023-03-16No SnippetsModrák M, Trebuňová M, Balogová AF, Hudák R, Živčák J.
Show Full Abstract
The goal of this review is to map the current state of biodegradable materials that are used in tissue engineering for a variety of applications. At the beginning, the paper briefly identifies typical clinical indications in orthopedics for the use of biodegradable implants. Subsequently, the most frequent groups of biodegradable materials are identified, classified, and analyzed. To this end, a bibliometric analysis was applied to evaluate the evolution of the scientific literature in selected topics of the subject. The special focus of this study is on polymeric biodegradable materials that have been widely used for tissue engineering and regenerative medicine. Moreover, to outline current research trends and future research directions in this area, selected smart biodegradable materials are characterized, categorized, and discussed. Finally, pertinent conclusions regarding the applicability of biodegradable materials are drawn and recommendations for future research are suggested to drive this line of research forward.
Also flagged:COMMD10copper metabolism MURR1 domain containingCOMMD1coppercholesterolmetabolism
Journal Article2023-03-16✓ 1 SnippetPhan KP, Pelargos P, Tsytsykova AV, Tsitsikov EN, Wiley G, Li C, Bebak M, Dunn IF.
In-Text Gene Mentions
Results)
…[ 32 ],Pou3f2[ 33 ,…
Show Full Abstract
The COMMD (copper metabolism MURR1 domain containing) family includes ten structurally conserved proteins (COMMD1 to COMMD10) in eukaryotic multicellular organisms that are involved in a diverse array of cellular and physiological processes, including endosomal trafficking, copper homeostasis, and cholesterol metabolism, among others. To understand the role of COMMD10 in embryonic development, we used <i>Commd10<sup>Tg(Vav1-icre)A2Kio</sup></i>/J mice, where the <i>Vav1-cre</i> transgene is integrated into an intron of the <i>Commd10</i> gene, creating a functional knockout of <i>Commd10</i> in homozygous mice. Breeding heterozygous mice produced no COMMD10-deficient <i>(Commd10<sup>Null</sup>)</i> offspring, suggesting that COMMD10 is required for embryogenesis. Analysis of <i>Commd10<sup>Null</sup></i> embryos demonstrated that they displayed stalled development by embryonic day 8.5 (E8.5). Transcriptome analysis revealed that numerous neural crest-specific gene markers had lower expression in mutant versus wild-type (WT) embryos. Specifically, <i>Commd10<sup>Null</sup></i> embryos displayed significantly lower expression levels of a number of transcription factors, including a major regulator of the neural crest, <i>Sox10</i>. Moreover, several cytokines/growth factors involved in early embryonic neurogenesis were also lower in mutant embryos. On the other hand, <i>Commd10<sup>Null</sup></i> embryos demonstrated higher expression of genes involved in tissue remodeling and regression processes. Taken together, our findings show that <i>Commd10<sup>Null</sup></i> embryos die by day E8.5 due to COMMD10-dependent neural crest failure, revealing a new and critical role for COMMD10 in neural development.
Also flagged:Telomeretelomericchromosomeheterochromatinchromatintranscriptional
Journal Article2023-03-16✓ 1 SnippetCaslini C, Serna A.
In-Text Gene Mentions
Introduction)
…), AF10 (MLLT10), ELL, and…
Show Full Abstract
Telomere transcription into telomeric repeat-containing RNA (TERRA) is an integral component of all aspects of chromosome end protection consisting of telomerase- or recombination-dependent telomere elongation, telomere capping, and the preservation of the (sub)telomeric heterochromatin structure. The chromatin modifier and transcriptional regulator MLL binds to telomeres and regulates TERRA transcription in telomere length homeostasis and response to telomere dysfunction. MLL fusion proteins (MLL-FPs), the product of <i>MLL</i> rearrangements in leukemia, also bind to telomeric chromatin. However, an effect on telomere transcription in <i>MLL</i>-rearranged (<i>MLL</i>-r) leukemia has not yet been evaluated. Here, we show increased UUAGGG repeat-containing RNA levels in <i>MLL</i>-r acute lymphoblastic leukemia (ALL) when compared to non-<i>MLL</i>-r ALL and myeloid leukemia. <i>MLL</i> rearrangements do not affect telomere length and UUAGGG repeat-containing RNA levels correlate with mean telomere length and reflect increased levels of TERRA. Furthermore, high levels of TERRA in <i>MLL</i>-r ALL occur in the presence of telomerase activity and are independent of ploidy, an underestimated source of variation on the overall transcriptome size in a cell. This <i>MLL</i> rearrangement-dependent and lymphoid lineage-associated increase in levels of TERRA supports a sustained telomere transcription by MLL-FPs that correlates with marked genomic stability previously reported in pediatric <i>MLL</i>-r ALL.
<h4>Background & aims</h4>An international panel proposed a diagnostic framework for metabolic-associated fatty liver disease (MAFLD) in children. The aim was to compare the clinical features of MAFLD and nonalcoholic fatty liver disease (NAFLD) in children.<h4>Methods</h4>The characteristic differences between NAFLD and MAFLD in children were compared with the National Health and Nutrition Examination Survey (NHANES) 2017-2018 in the U.S. and the Comprehensive Prevention Project for Overweight and Obese Adolescents (CPOOA) study in China.<h4>Results</h4>In NHANES 2017-2018, regardless of which criteria were implemented, participants with hepatic steatosis were more likely to have higher BMI z-scores, a higher prevalence of hypertension or higher metabolic indices and higher non-invasive liver fibrosis scores (all <i>p</i> < 0.05). The cases diagnosed by those two definitions had a similarity of over 75%. More obese children were diagnosed with MAFLD than NAFLD (<i>p</i> < 0.001). However, approximately 19% of children with NAFLD present with normal weight and fasting glucose levels and cannot be diagnosed with MAFLD. The CPOOA study excluded viral infected liver disease and certain kinds of congenital causes of liver steatosis patients, resulting in children with NAFLD being identical with MAFLD children.<h4>Conclusions</h4>Most clinical features were similar between children with MAFLD and children with NAFLD, and more than 75% of children with NAFLD can also be diagnosed with MAFLD. However, approximately 19% of children with NAFLD cannot be categorized as MAFLD. Therefore, to gain greater benefits from renaming NAFLD to MAFLD in pediatrics, the prevalence of different causes of hepatic steatosis in children needs to be understood.
Also flagged:hepatocellular carcinomalocalizationSynthesisGalliumtetrabromophthaleinpositron
Journal Article2023-03-16✓ 1 SnippetWerner A, Freesmeyer M, Kühnel C, Drescher R, Greiser J.
In-Text Gene Mentions
Results)
…liver disease, andhemochromatosis).…
Show Full Abstract
Hepatobiliary scintigraphy is a well-established nuclear imaging method for evaluating liver function and displaying the biliary system, but the spatial and temporal resolution is limited, and, there is still no established PET equivalent. Adapted from the work of Schuhmacher et al. in 1983, the production of a <sup>68</sup>Gallium-labeled substitute, tetrabromophthalein ([<sup>68</sup>Ga]Ga-BP-IDA), was undertaken according to current Good Manufacturing Practice (GMP) standards and proved feasible and reproducible. PET/CT with the radiotracer was performed in two complex patients with hepatocellular carcinoma in preparation for transarterial radioembolization. Due to its high spatial and temporal resolution, localization of areas with impaired liver function and visualization of the biliary system were possible. We could demonstrate that this <sup>68</sup>Gallium-labeled, IDA-based PET tracer is feasible and could advance hepatic and biliary function PET imaging.
Also flagged:cell surfacetumorcancercell-matrix adhesionangiogenesispathogenesis
Journal Article2023-03-16✓ 1 SnippetMotta JM, Hassan H, Ibrahim SA.
In-Text Gene Mentions
S I O 001029)
…The metastasis suppressor Raf-1 kinase inhibitory protein (RKIP/PEBP1) downregulated SDC2 mediated by the suppression of the high mobility group AT-hook 2 (HMGA2) in a miR-200b-independent manner, leading to blunted breast tumor growth and metastasis and enhanced apoptosis in a mouse xenograft model of breast cancer [41].…
Show Full Abstract
Syndecans (SDC1 to 4), a family of cell surface heparan sulfate proteoglycans, are frequently expressed in mammalian tissues. SDCs are aberrantly expressed either on tumor or stromal cells, influencing cancer initiation and progression through their pleiotropic role in different signaling pathways relevant to proliferation, cell-matrix adhesion, migration, invasion, metastasis, cancer stemness, and angiogenesis. In this review, we discuss the key roles of SDCs in the pathogenesis of breast cancer, the most common malignancy in females worldwide, focusing on the prognostic significance and molecular regulators of SDC expression and localization in either breast tumor tissue or its microenvironmental cells and the SDC-dependent epithelial-mesenchymal transition program. This review also highlights the molecular mechanisms underlying the roles of SDCs in regulating breast cancer cell behavior via modulation of nuclear hormone receptor signaling, microRNA expression, and exosome biogenesis and functions, as well as summarizing the potential of SDCs as promising candidate targets for therapeutic strategies against breast cancer.
Also flagged:ObesityMelanomatumorcancersmelanomas-node metastases
Journal Article2023-03-16✓ 1 SnippetAlmeida Oliveira F, Klose J, Schulze HJ, Ribeiro Teixeira M, Dermietzel A, Wellenbrock S, Herter-Sprie GS, Hirsch T, Kueckelhaus M.
In-Text Gene Mentions
Discussion)
…the FTO, MAP2K5,NEGR1, FLJ35779, ETV5, CADM2,…
Show Full Abstract
(1) Background: While obesity is a known independent risk factor in the development of melanoma, there is no consensus on its influence on melanoma prognosis. (2) Methods: In a monocentric retrospective study, data was collected from patients who underwent sentinel lymph node (SLN) biopsy for stage IB-IIC melanoma between 2013 and 2018. Patients were divided into groups according to their body mass index (BMI). The association between BMI and melanoma features, as well as the risk factors for metastases in SLN were examined. (3) Results: Of the 1001 patients, 336 had normal weight (BMI < 25), 402 were overweight (BMI >= 25 and <30), 173 obese (BMI >= 30 and <35) and 90 extremely obese (BMI >= 35). Overweightness and obesity were associated with higher tumor thicknesses at time of diagnosis. Ulceration was not influenced by the patient's weight. Metastases in sentinel lymph node was almost twice more likely in extremely obese patients than in normal weight patients. Independent risk factors for metastases in SLN in our study were tumor thickness, ulceration, and BMI > 35. (4) Conclusions: This is the first study to show higher metastases rates in high-BMI patients with melanoma, raising important questions regarding the screening and treatment of this specific patient population.
Also flagged:Synthesisplatinumcisplatinoxaliplatinovarian carcinomacell cycle
Journal Article2023-03-16No SnippetsBarth MC, Häfner N, Runnebaum IB, Weigand W.
Show Full Abstract
The research on the anticancer potential of platinum(IV) complexes represents one strategy to circumvent the deficits of approved platinum(II) drugs. Regarding the role of inflammation during carcinogenesis, the effects of non-steroidal anti-inflammatory drug (NSAID) ligands on the cytotoxicity of platinum(IV) complexes is of special interest. The synthesis of cisplatin- and oxaliplatin-based platinum(IV) complexes with four different NSAID ligands is presented in this work. Nine platinum(IV) complexes were synthesized and characterized by use of nuclear magnetic resonance (NMR) spectroscopy (<sup>1</sup>H, <sup>13</sup>C, <sup>195</sup>Pt, <sup>19</sup>F), high-resolution mass spectrometry, and elemental analysis. The cytotoxic activity of eight compounds was evaluated for two isogenic pairs of cisplatin-sensitive and -resistant ovarian carcinoma cell lines. Platinum(IV) fenamato complexes with a cisplatin core showed especially high in vitro cytotoxicity against the tested cell lines. The most promising complex, <b>7</b>, was further analyzed for its stability in different buffer solutions and behavior in cell cycle and cell death experiments. Compound <b>7</b> induces a strong cytostatic effect and cell line-dependent early apoptotic or late necrotic cell death processes. Gene expression analysis suggests that compound <b>7</b> acts through a stress-response pathway integrating p21, CHOP, and ATF3.
Also flagged:mineralglassdental cariescariesremineralizationminerals
Journal Article2023-03-16No SnippetsKandil H, Ahmed E, Fouad N, Ali Dabbous O, Niazy M, Mohamed T.
Show Full Abstract
<i>Introduction</i>: The purpose of this study is to investigate and compare the effects of the antimicrobial agents <i>Moringa oleifera</i> and bioactive glass nanoparticles activated by femtosecond laser light on the biomimetic dentin remineralization using teeth having carious dentin ICDAS code 3. <i>Methods and Materials</i>: A total of 27 dentin surface samples were divided into three groups: the first group was treated with a <i>Moringa oleifera</i> extract, while the second group was treated with bioactive glass nanoparticles, and as for the control group, the third group received no additional agent. All groups were subjected to femtosecond laser light at three different wavelengths: 390 nm, 445 nm, and 780 nm. The photoactivation of each sample was achieved using the femtosecond laser light for 5 min with an average power rating of 300 mW, a pulse duration of 100 fs, and a pulse repetition rate of 80 Hz. The mineral content of the samples was obtained and analyzed using the laser-induced breakdown spectroscopy (LIBS). The LIBS analysis was conducted with the following laser light parameters: average power of ~215 mW, wavelength of 532 nm, pulse duration of 10 ns, and a pulse repetition rate of 10 Hz. <i>Results</i>: Most studied samples exhibited a relative increase in the mineral content that may enhance biomimetic remineralization. <i>Moringa oleifera</i> photoactivated by femtosecond laser light at 445 nm achieved a significant increase in mineral content. <i>Conclusion</i>: Using the femtosecond laser light to activate the relatively cheap and commercially available antimicrobial agent <i>Moringa oleifera</i> supports the strategy of minimal invasive approaches for the treatment and biomimetic remineralization of carious dentin ICDAS code 3.
Also flagged:CancerdeathColorectal cancerscolon canceranemiatumor
Journal Article2023-03-16No SnippetsSripetthong S, Eze FN, Sajomsang W, Ovatlarnporn C.
Show Full Abstract
This work aimed at preparing nanomicelles from <i>N</i>-benzyl-<i>N</i>,<i>O</i>-succinyl chitosan (NBSCh) loaded with a curcumin analog, 2,6-bis((3-methoxy-4-hydroxyphenyl) methylene) cyclohexanone, a.k.a. cyqualone (CL), for antineoplastic colon cancer chemotherapy. The CL-loaded NBSCh micelles were spherical and less than 100 nm in size. The entrapment efficiency of CL in the micelles ranged from 13 to 39%. Drug release from pristine CL was less than 20% in PBS at pH 7.4, whereas the release from CL-NBSCh micelles was significantly higher. The release study of CL-NBSCh revealed that around 40% of CL content was released in simulated gastric fluid at pH 1.2; 79 and 85% in simulated intestinal fluids at pH 5.5 and 6.8, respectively; and 75% in simulated colonic fluid at pH 7.4. CL-NBSCh showed considerably high selective cytotoxicity towards mucosal epithelial human colon cancer (HT-29) cells and lower levels of toxicity towards mouse connective tissue fibroblasts (L929). CL-NBSCh was also more cytotoxic than the free CL. Furthermore, compared to free CL, CL-NBSCh micelles were found to be more efficient at arresting cell growth at the G2/M phase, and induced apoptosis earlier in HT-29 cells. Collectively, these results indicate the high prospective potential of CL-loaded NBSCh micelles as an oral therapeutic intervention for colon cancer.
Also flagged:Neurological diseasesDepressionMultiple SclerosisMDpathogenesiscentral nervous system diseases
Journal Article2023-03-16✓ 1 SnippetKurowska A, Ziemichód W, Herbet M, Piątkowska-Chmiel I.
In-Text Gene Mentions
Methods)
…the increase inACE-IIIvalues was not…
Show Full Abstract
Neurological diseases are recognized as major causes of disability and mortality worldwide. Due to the dynamic progress of diseases such as Alzheimer's disease (AD), Parkinson's Disease (PD), Schizophrenia, Depression, and Multiple Sclerosis (MD), scientists are mobilized to look for new and more effective methods of interventions. A growing body of evidence suggests that inflammatory processes and an imbalance in the composition and function of the gut microbiome, which play a critical role in the pathogenesis of various neurological diseases and dietary interventions, such as the Mediterranean diet the DASH diet, or the ketogenic diet can have beneficial effects on their course. The aim of this review was to take a closer look at the role of diet and its ingredients in modulating inflammation associated with the development and/or progression of central nervous system diseases. Presented data shows that consuming a diet abundant in fruits, vegetables, nuts, herbs, spices, and legumes that are sources of anti-inflammatory elements such as omega-3 fatty acids, polyphenols, vitamins, essential minerals, and probiotics while avoiding foods that promote inflammation, create a positive brain environment and is associated with a reduced risk of neurological diseases. Personalized nutritional interventions may constitute a non-invasive and effective strategy in combating neurological disorders.
Also flagged:hepatocellular carcinomaextracellularvesiclesimmune responsetumorliver cancer
Journal Article2023-03-16✓ 1 SnippetLu X, Li Y, Li Y, Zhang X, Shi J, Feng H, Gao Y, Yu Z.
In-Text Gene Mentions
Results)
…“VWF, LGALS3BP, TGFB1,SERPINC1, HPX, HP, HBA1,…
Show Full Abstract
Due to the lack of distinct early symptoms and specific biomarkers, most patients with hepatocellular carcinoma (HCC) are usually diagnosed at advanced stages, rendering the treatment ineffective and useless. Therefore, recognition of the malady at precancerous lesions and early stages is particularly important for improving patient outcomes. The interest in extracellular vesicles (EVs) has been growing in recent years with the accumulating knowledge of their multiple cargoes and related multipotent roles in the modulation of immune response and tumor progression. By virtue of the rapid advancement of high-throughput techniques, multiple omics, including genomics/transcriptomics, proteomics, and metabolomics/lipidomics, have been widely integrated to analyze the role of EVs. Comprehensive analysis of multi-omics data will provide useful insights for discovery of new biomarkers and identification of therapeutic targets. Here, we review the attainment of multi-omics analysis to the finding of the potential role of EVs in early diagnosis and the immunotherapy in HCC.
Also flagged:tumorPCaGene Expressionprostate adenocarcinomaPRADSTX4
Journal Article2023-03-16✓ 2 SnippetsXie LY, Huang HY, Hao YL, Yu M, Zhang W, Wei E, Gao C, Wang C, Zeng L.
In-Text Gene Mentions
Discussion)
…The UBE2S protein plays an oncogenic role in various tumors, including urinary bladder cancer (Tang et al., 2021), breast cancer (Ayesha et al., 2016), endometrial cancer (Lin et al., 2019), ovarian cancer (Hu et al., 2021), lung cancer (Liu and Xu, 2018; Qin et al., 2020), colorectal cancer (Li et al., 2018), hepatocellular carcinoma (Gui et al., 2021), and melanoma (Wang et al., 2021), via the activation of the mTOR pathway (Tang et al., 2021), SOX6/β-Catenin signaling pathway (Lin et al., 2019), and Wnt/β-catenin signaling pathway (Qin et al., 2020; Hu et al., 2021).…
Discussion)
…al., 2021 ),SOX6/β-Catenin signaling pathway (…
Show Full Abstract
<b>Introduction:</b> Prostate cancer (PCa) is the second most common malignancy in men. Despite multidisciplinary treatments, patients with PCa continue to experience poor prognoses and high rates of tumor recurrence. Recent studies have shown that tumor-infiltrating immune cells (TIICs) are associated with PCa tumorigenesis. <b>Methods:</b> The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) datasets were used to derive multi-omics data for prostate adenocarcinoma (PRAD) samples. The CIBERSORT algorithm was used to calculate the landscape of TIICs. Weighted gene co-expression network analysis (WGCNA) was performed to determine the candidate module most significantly associated with TIICs. LASSO Cox regression was applied to screen a minimal set of genes and construct a TIIC-related prognostic gene signature for PCa. Then, 78 PCa samples with CIBERSORT output <i>p</i>-values of less than 0.05 were selected for analysis. WGCNA identified 13 modules, and the MEblue module with the most significant enrichment result was selected. A total of 1143 candidate genes were cross-examined between the MEblue module and active dendritic cell-related genes. <b>Results:</b> According to LASSO Cox regression analysis, a risk model was constructed with six genes (STX4, UBE2S, EMC6, EMD, NUCB1 and GCAT), which exhibited strong correlations with clinicopathological variables, tumor microenvironment context, antitumor therapies, and tumor mutation burden (TMB) in TCGA-PRAD. Further validation showed that the UBE2S had the highest expression level among the six genes in five different PCa cell lines. <b>Discussion:</b> In conclusion, our risk-score model contributes to better predicting PCa patient prognosis and understanding the underlying mechanisms of immune responses and antitumor therapies in PCa.
Also flagged:ironosteoarthritisbindingknee osteoarthritisOAhip OA
Journal Article2023-03-16✓ 5 SnippetsRuan G, Ying Y, Lu S, Zhu Z, Chen S, Zeng M, Lu M, Xue S, Zhu J, Cao P, Chen T, Wang X, Li S, Li J, Liu Y, Liu Y, Zhang Y, Ding C.
In-Text Gene Mentions
Methods)
…While HFE and TMPRSS6 involve the signaling cascade of iron homeostasis directly (Bell et al., 2021), these three SNPs may have a vertical effect from iron to the potential confounding factors, namely glycosylated hemoglobin, low-density lipoprotein, and total cholesterol mentioned in the Supplementary Tables.…
Methods)
…, rs1799945 fromHFE, and rs1800562…
Methods)
…and rs1800562 fromHFEhere since they…
Methods)
…of TMPRSS6 orHFE.…
Methods)
…WhileHFEand TMPRSS6 involve…
Show Full Abstract
<b>Objective:</b> To assess the causal effect of systemic iron status by using four biomarkers (serum iron; transferrin saturation; ferritin; total iron-binding capacity) on knee osteoarthritis (OA), hip OA, total knee replacement, and total hip replacement using 2-sample Mendelian randomization (MR) design. <b>Methods:</b> Three instrument sets were used to construct the genetic instruments for the iron status: Liberal instruments (variants associated with one of the iron biomarkers), sensitivity instruments (liberal instruments exclude variants associated with potential confounders), and conservative instruments (variants associated with all four iron biomarkers). Summary-level data for four OA phenotypes, including knee OA, hip OA, total knee replacement, and total hip replacement were obtained from the largest genome-wide meta-analysis with 826,690 individuals. Inverse-variance weighted based on the random-effect model as the main approach was conducted. Weighted median, MR-Egger, and Mendelian randomization pleiotropy residual sum and outlier methods were used as sensitivity MR approaches. <b>Results:</b> Based on liberal instruments, genetically predicted serum iron and transferrin saturation were significantly associated with hip OA and total hip replacement, but not with knee OA and total knee replacement. Statistical evidence of heterogeneity across the MR estimates indicated that mutation rs1800562 was the SNP significantly associated with hip OA in serum iron (odds ratio, OR = 1.48), transferrin saturation (OR = 1.57), ferritin (OR = 2.24), and total-iron binding capacity (OR = 0.79), and hip replacement in serum iron (OR = 1.45), transferrin saturation (OR = 1.25), ferritin (OR = 1.37), and total-iron binding capacity (OR = 0.80). <b>Conclusion:</b> Our study suggests that high iron status might be a causal factor of hip OA and total hip replacement where rs1800562 is the main contributor.
…was co-expressed withPRDX6-2(Cluster-28897.20416) and CAD-…
Show Full Abstract
Dodders (<i>Cuscuta australis</i> R. Br.) are holo-parasitic stem angiosperms with an extensive host range that have significant ecological and economic potential impact on the ecosystem and the agricultural system. However, how the host plant responds to this biotic stress remains mostly unexplored. To identify the defense-related genes and the pathways in white clover (<i>Trifolium repens</i> L.) induced by dodder parasitism, we performed a comparative transcriptome analysis of the leaf and root tissues from white clover with and without dodder infection by high throughput sequencing. We identified 1,329 and 3,271 differentially expressed genes (DEGs) in the leaf and root tissues, respectively. Functional enrichment analysis revealed that plant-pathogen interaction, plant hormone signal transduction, and phenylpropanoid biosynthesis pathways were significantly enriched. Eight WRKY, six AP2/ERF, four bHLH, three bZIP, three MYB, and three NAC transcription factors showed a close relationship with lignin synthesis-related genes, which defended white clover against dodder parasitism. Real-time quantitative PCR (RT-qPCR) for nine DEGs, further validated the data obtained from transcriptome sequencing. Our results provide new insights into understanding the complex regulatory network behind these parasite-host plant interactions.
Also flagged:asthmapathogenesiscalciumchronic obstructive pulmonary diseaseovalbuminiron
Journal Article2023-03-16✓ 1 SnippetCarroll OR, Pillar AL, Brown AC, Feng M, Chen H, Donovan C.
In-Text Gene Mentions
S I O 001029)
…Genetically-induced changes to iron status provide invaluable enhancements to our understanding of physiological changes from altered iron status and are essential in modeling genetic disorders, such as hereditary hemochromatosis, which is an iron overload disorder that is caused by mutations in the Homeostatic Iron Regulator (HFE) gene.…
Show Full Abstract
Recent advances in mouse models of experimental asthma coupled with vast improvements in systems that assess respiratory physiology have considerably increased the accuracy and human relevance of the outputs from these studies. In fact, these models have become important pre-clinical testing platforms with proven value and their capacity to be rapidly adapted to interrogate emerging clinical concepts, including the recent discovery of different asthma phenotypes and endotypes, has accelerated the discovery of disease-causing mechanisms and increased our understanding of asthma pathogenesis and the associated effects on lung physiology. In this review, we discuss key distinctions in respiratory physiology between asthma and severe asthma, including the magnitude of airway hyperresponsiveness and recently discovered disease drivers that underpin this phenomenon such as structural changes, airway remodeling, airway smooth muscle hypertrophy, altered airway smooth muscle calcium signaling, and inflammation. We also explore state-of-the-art mouse lung function measurement techniques that accurately recapitulate the human scenario as well as recent advances in precision cut lung slices and cell culture systems. Furthermore, we consider how these techniques have been applied to recently developed mouse models of asthma, severe asthma, and asthma-chronic obstructive pulmonary disease overlap, to examine the effects of clinically relevant exposures (including ovalbumin, house dust mite antigen in the absence or presence of cigarette smoke, cockroach allergen, pollen, and respiratory microbes) and to increase our understanding of lung physiology in these diseases and identify new therapeutic targets. Lastly, we focus on recent studies that examine the effects of diet on asthma outcomes, including high fat diet and asthma, low iron diet during pregnancy and predisposition to asthma development in offspring, and environmental exposures on asthma outcomes. We conclude our review with a discussion of new clinical concepts in asthma and severe asthma that warrant investigation and how we could utilize mouse models and advanced lung physiology measurement systems to identify factors and mechanisms with potential for therapeutic targeting.
Also flagged:synthesisfurfurylaminehydroxyapatitefurfuralorganic acidoxalic acid
Journal Article2023-03-16No SnippetsHe W, He YC, Ye J.
Show Full Abstract
The objective of this work was to develop an efficient approach for chemoenzymatically transforming biomass to furfurylamine by bridging chemocatalysis and biocatalysis in a deep eutectic solvent of EaCl:Gly-water. Using hydroxyapatite (HAP) as support, heterogeneous catalyst SO<sub>4</sub> <sup>2-</sup>/SnO<sub>2</sub>-HAP was synthesized for transforming lignocellulosic biomass into furfural using organic acid as a co-catalyst. The turnover frequency (TOF) was correlated with the pKa value of the used organic acid. Corncob was transformed by oxalic acid (pKa = 1.25) (0.4 wt%) plus SO<sub>4</sub> <sup>2-</sup>/SnO<sub>2</sub>-HAP (2.0 wt%) to produce furfural with a yield of 48.2% and a TOF of 6.33 h<sup>-1</sup> in water. In deep eutectic solvent EaCl:Gly-water (1:2, v/v), co-catalysis with SO<sub>4</sub> <sup>2-</sup>/SnO<sub>2</sub>-HAP and oxalic acid was utilized to transform corncob, rice straw, reed leaf, and sugarcane bagasse for the production of furfural with the yield of 42.4%-59.3% (based on the xylan content) at 180°C after 10 min. The formed furfural could be efficiently aminated to furfurylamine with <i>E. coli</i> CCZU-XLS160 cells in the presence of NH<sub>4</sub>Cl (as an amine donor). As a result of the biological amination of furfural derived from corncob, rice straw, reed leaf, and sugarcane bagasse for 24 h, the yields of furfurylamine reached >99%, with a productivity of 0.31-0.43 g furfurylamine per g xylan. In EaCl:Gly-water, an efficient chemoenzymatic catalysis strategy was employed to valorize lignocellulosic biomass into valuable furan chemicals.
Currently, porcine coronaviruses are prevalent in pigs, and due to the outbreak of COVID-19, porcine coronaviruses have become a research hotspot. porcine epidemic diarrhea virus (PEDV), Transmissible Gastroenteritis Virus (TGEV), and Porcine Deltacoronavirus (PDCoV) mentioned in this study mainly cause diarrhea in pigs. These viruses cause significant economic losses and pose a potential public health threat. In this study, specific primers and probes were designed according to the <i>M</i> gene of PEDV, the <i>S</i> gene of TGEV, and the <i>M</i> gene of PDCoV, respectively, and TaqMan probe-based multiplex real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was developed for the simultaneous detection of PEDV, TGEV, and PDCoV. This method has high sensitivity and specificity, and the detection limit of each virus can reach 2.95 × 10<sup>0</sup> copies/μl. An assay of 160 clinical samples from pigs with diarrhea showed that the positive rates of PEDV, TGEV, and PDCoV were 38.13, 1.88, and 5.00%; the coinfection rates of PEDV+TGEV, PEDV+PDCoV, TGEV+PDCoV, PEDV+TGEV+PDCoV were 1.25, 1.25, 0, 0.63%, respectively. The positive coincidence rates of the multiplex qRT-PCR and single-reaction qRT-PCR were 100%. This method is of great significance for clinical monitoring of the porcine enteric diarrhea virus and helps reduce the loss of the breeding industry and control the spread of the disease.
Also flagged:ERKCREBTRPsynthesisExtracellular Signal-Regulated KinaseCAMP
Journal Article2023-03-16No SnippetsZhen W, Zhen H, Wang Y, Chen L, Niu X, Zhang B, Yang Z, Peng D.
Show Full Abstract
Research has long centered on the pathophysiology of pain. The Transient Receiver Potential (TRP) protein family is well known for its function in the pathophysiology of pain, and extensive study has been done in this area. One of the significant mechanisms of pain etiology and analgesia that lacks a systematic synthesis and review is the ERK/CREB (Extracellular Signal-Regulated Kinase/CAMP Response Element Binding Protein) pathway. The ERK/CREB pathway-targeting analgesics may also cause a variety of adverse effects that call for specialized medical care. In this review, we systematically compiled the mechanism of the ERK/CREB pathway in the process of pain and analgesia, as well as the potential adverse effects on the nervous system brought on by the inhibition of the ERK/CREB pathway in analgesic drugs, and we suggested the corresponding solutions.
Also flagged:mitochondrialIRpathogenesistype 2 diabetes mellitusGlucosehistone
Journal Article2023-03-16✓ 1 SnippetLi C, Li N, Zhang Z, Song Y, Li J, Wang Z, Bo H, Zhang Y.
In-Text Gene Mentions
Discussion)
…as MEF2C, PPARA,SOX6and NFATC2, as…
Show Full Abstract
<h4>Introduction</h4>Skeletal muscle insulin resistance (IR) plays an important role in the pathogenesis of type 2 diabetes mellitus. Skeletal muscle is a heterogeneous tissue composed of different muscle fiber types that contribute distinctly to IR development. Glucose transport shows more protection in slow-twitch muscles than in fast-twitch muscles during IR development, while the mechanisms involved remain unclear. Therefore, we investigated the role of the mitochondrial unfolded protein response (UPRmt) in the distinct resistance of two types of muscle in IR.<h4>Methods</h4>Male Wistar rats were divided into high-fat diet (HFD) feeding and control groups. We measured glucose transport, mitochondrial respiration, UPRmt and histone methylation modification of UPRmt-related proteins to examine the UPRmt in the slow fiber-enriched soleus (Sol) and fast fiber-enriched tibialis anterior (TA) under HFD conditions.<h4>Results</h4>Our results indicate that 18 weeks of HFD can cause systemic IR, while the disturbance of Glut4-dependent glucose transport only occurred in fast-twitch muscle. The expression levels of UPRmt markers, including ATF5, HSP60 and ClpP, and the UPRmt-related mitokine MOTS-c were significantly higher in slow-twitch muscle than in fast-twitch muscle under HFD conditions. Mitochondrial respiratory function is maintained only in slow-twitch muscle. Additionally, in the Sol, histone methylation at the ATF5 promoter region was significantly higher than that in the TA after HFD feeding.<h4>Conclusion</h4>The expression of proteins involved in glucose transport in slow-twitch muscle remains almost unaltered after HFD intervention, whereas a significant decline of these proteins was observed in fast-twitch muscle. Specific activation of the UPRmt in slow-twitch muscle, accompanied by higher mitochondrial respiratory function and MOTS-c expression, may contribute to the higher resistance to HFD in slow-twitch muscle. Notably, the different histone modifications of UPRmt regulators may underlie the specific activation of the UPRmt in different muscle types. However, future work applying genetic or pharmacological approaches should further uncover the relationship between the UPRmt and insulin resistance.
Journal Article2023-03-16✓ 1 SnippetMulzer LM, Reutter H, Jüngert J, Knisely AS, Schmid M, Hoerning A, Morhart P.
In-Text Gene Mentions
Introduction)
…most patients toHFEvariants ), NH…
Show Full Abstract
Gestational alloimmune liver disease (GALD) is a rare neonatal disorder with high mortality and morbidity. The patients come to caregivers' attention aged a few hours or days. The disease manifests as acute liver failure with or without siderosis. The differential diagnosis of neonatal acute liver failure (NALF) is broad, including mainly immunologic, infectious, metabolic and toxic disorders. The most common cause, however, is GALD followed by herpes simplex virus (HSV) infection. The best suited pathophysiological paradigm of GALD is that of a maternofetal alloimmune disorder. State of the art treatment combines intravenously administered immunoglobulin (IVIG) with exchange transfusion (ET). We report an infant born at 35 + 2 weeks' gestation in whom GALD had a favorable course, of interest because premature birth in our patient may have exerted protective aspects and lessened morbidity in that intrauterine exposure to maternal complement-fixing antibodies was shortened. The diagnosis of GALD was challenging and difficult. We suggest a modified diagnostic algorithm combining clinical findings with histopathologic findings in liver and lip mucosa and, if available, on abdominal magnetic resonance imaging-study focusing on the liver, spleen, and pancreas. This diagnostic workup must be followed by ET and subsequent administration of IVIG without delay.
Also flagged:Intervertebral disc degenerationnucleusSERPINA1ORM2FGGCOL1A1
Journal Article2023-03-16✓ 5 SnippetsYang X, Lu Y, Zhou H, Jiang HT, Chu L.
In-Text Gene Mentions
Methods)
…Enrichment Analysis ofSERPINC1…
Methods)
…potential function ofSERPINC1.…
Methods)
…into low- and high-SERPINC1groups according to…
Methods)
…median expression ofSERPINC1.…
Results)
…C3, ACTB, VCAN,SERPINC1, SERPINA1, and ORM2…
Show Full Abstract
Low back pain (LBP) is a prevalent health problem worldwide that affects over 80% of adults during their lifetime. Intervertebral disc degeneration (IDD) is a well-recognized leading cause of LBP. IDD is classified into five grades according to the Pfirrmann classification system. The purpose of this study was to identify potential biomarkers in different IDD grades through an integrated analysis of proteome sequencing (PRO-seq), bulk RNA sequencing (bRNA-seq) and single-cell RNA sequencing (scRNA-seq) data. Eight cases of grade I-IV IDD were obtained. Grades I and II were considered non-degenerative discs (relatively normal), whereas grades III and IV were considered degenerative discs. PRO-seq analysis was performed to identify differentially expressed proteins (DEPs) in various IDD grades. Variation analysis was performed on bRNA-seq data to differentiate expressed genes (DEGs) in normal and degenerated discs. In addition, scRNA-seq was performed to validate DEGs in degenerated and non-degenerated nucleus pulposus (NP). Machine learning (ML) algorithms were used to screen hub genes. The receiver operating characteristic (ROC) curve was used to validate the efficiency of the screened hub genes to predict IDD. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to analyze function enrichment and signaling pathways. Protein-protein interaction (PPI) network was used to prioritize disease-related proteins. SERPINA1, ORM2, FGG and COL1A1 were identified through PRO-seq as the hub proteins involved in regulating IDD. ML algorithms selected ten hub genes, including IBSP, COL6A2, MMP2, SERPINA1, ACAN, FBLN7, LAMB2, TTLL7, COL9A3, and THBS4 in bRNA-seq. Since serine protease inhibitor clade A member 1 (SERPINA1) was the only common gene, its accuracy in degenerated and non-degenerated NP cells was validated using scRNA-seq. Then, the rat degeneration model of caudal vertebra was established. The expression of SERPINA1 and ORM2 was detected using immunohistochemical staining of human and rat intervertebral discs. The results showed that SERPINA1 was poorly expressed in the degenerative group. We further explored the potential function of SERPINA1 by Gene Set Enrichment Analysis (GSEA) and cell-cell communication. Therefore, SERPINA1 can be used as a biomarker to regulate or predict the progress of disc degeneration.
Also flagged:graphene oxidesilver nanoparticlereverse transcriptionpolymerasereproductiongraphene
Journal Article2023-03-16No SnippetsYuan YG, Xing YT, Liu SZ, Li L, Reza AMMT, Cai HQ, Wang JL, Wu P, Zhong P, Kong IK.
Show Full Abstract
The widespread use of graphene oxide-silver nanoparticle nanocomposites (GO-AgNPs) in biomedical sciences is increasing the chances of human and animal exposure to its chronic non-toxic doses. Exposure to AgNPs-related nanomaterials may result in the negative effect on the dam, fetus and offspring. However, there are only little available information for profound understanding of the epigenetic alteration in the cells and animals caused by low-dose chronic exposure of GO-AgNPs. The present study investigated the effect of 0.5 μg/mL GO-AgNPs for 10 weeks on the differential expression of circular RNAs (circRNAs) in caprine fetal fibroblast cells (CFFCs), and this dose of GO-AgNPs did not affect cell viability and ROS level. We predicted the functions of those differentially expressed (DE) circRNAs in CFFCs by bioinformatics analysis. Furthermore, we validated the expression of ten DE circRNAs using quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) to ensure the reliability of the sequencing data. Our results showed that the DE circRNAs may potentially regulate the GO-AgNPs-inducing epigenetic toxicity through a regulatory network consisted of circRNAs, miRNAs and messenger RNAs (mRNAs). Therefore, the epigenetics toxicity is essential to assess the biosafety level of GO-AgNPs.
Hereditary hyperferritinemia-cataract syndrome (HHCS) is a rare genetic condition characterized by persistent hyperferritinemia (usually ferritin >1,000 ng/mL) without tissue iron overload, with or without early-onset slow-progressing bilateral nuclear cataract. It was first identified as a new genetic disorder in 1995, and since then genetic sequencing studies have been carried out to identify associated mutations in affected families. New mutations around the world are still being reported in the iron-responsive element (IRE) of the L-ferritin gene (<i>FTL</i>) to this day. Many clinicians remain unaware of this rare condition. The co-occurrence of <i>FTL</i> mutations and hereditary hemochromatosis (HH) mutations, especially H63D, on the <i>HFE</i> gene has been reported in the literature, which often leads to a diagnosis of HH, missed diagnosis of HHCS, incorrect treatment with phlebotomies and the occurrence of associated iatrogenic iron deficiency anemia. We herein report the case of a 40-year-old woman with spontaneous facial freckling, bilateral cataracts, homozygosity for <i>HFE</i> H63D mutation, iron deficiency anemia, and hyperferritinemia, who has been treated with phlebotomy and iron chelation therapy to no avail. Eleven years after being diagnosed and treated for HH, a reevaluation of her clinical presentation, laboratory results, medical imaging, and family history led to the recognition that her case is explained not by HH, but by an alternative diagnosis, HHCS. Our main objective in this report is to increase clinical awareness about HHCS, an often-unknown differential diagnosis of hyperferritinemia without iron overload, and to prevent adverse medical interventions in HHCS patients.
bioRxiv2023-03-16Preprint (No Snippets API)Mahdavi L, Goodrow H, Alikarami F, Lenard A, Riedel SS, Libbrecht C, Bowser I, Tasian SK, Falkenstein CD, Manning B, Skuli S, Carroll MP, Wertheim G, Cai SF, McGeehan G, Xie HM, Bernt KM.
Show Full Abstract
Inhibitors of the Menin-KMT2A interaction are promising agents for the treatment of KMT2A -rearranged ( KMT2A -r) leukemias. We evaluated Menin inhibition in patient derived xenografts of KMT2A-r leukemias with high-risk features. Three AMLs with high-risk fusion partners ( MLLT10, MLLT4 ) and two infant ALL samples were sensitive to Menin inhibition. We also evaluated serial samples from two patients with multiply relapsed ALL. We found that highly pretreated KMT2A-AFF1 ALL samples were much less sensitive compared to cells obtained earlier in the same patients’ disease course. Since none of the patients had been treated with a Menin inhibitor, resistance in these highly pretreated samples was acquired in the absence to Menin inhibitor exposure. Transcriptomic analysis documented sustained on-target efficacy towards the canonical targets in the Menin-inhibitor in resistant cells. Targeted genomic analysis documented the emergence of multiple co-mutations, including RAS pathway and TP53 mutations, although neither was sufficient to induce Menin-inhibitor resistance in vitro. Downregulation of KMT3D may account for resistance in one patients; inactivation of KMT2C/D had previously been reported to result in Menin inhibitor resistance. Future studies will need to clarify more broadly which genomic/epigenomic alterations drive upfront resistance. Regardless of mechanism, our data supports using Menin-inhibitors upfront or in early lines of therapy before substantial genomic or epigenomic evolution has occurred.
bioRxiv2023-03-16Preprint (No Snippets API)Pop RT, Pisante A, Nagy D, Martin PCN, Mikheeva LA, Hayat A, Ficz G, Zabet NR.
Show Full Abstract
Transcription factors (TFs) are proteins that affect gene expression by binding to regulatory regions of DNA in a sequence specific manner. The binding of TFs to DNA is controlled by many factors, including the DNA sequence, concentration of TF, chromatin accessibility and co-factors. Here, we systematically investigated the binding mechanism of hundreds of TFs by analysing ChIP-seq data with our explainable statistical model, ChIPanalyser. This tool uses as inputs the DNA sequence binding motif; the capacity to distinguish between strong and weak binding sites; the concentration of TF; and chromatin accessibility. We asked whether TFs preferred to bind to DNA in open or dense chromatin conformation and found that approximately one third of TFs are predicted to bind the genome in a DNA accessibility independent fashion. Our model predicted this to be the case when the TF binds to its strongest binding regions in the genome, and only a small number of TFs have the capacity to bind dense chromatin at their weakest binding regions, such as CTCF USF2 and CEBPB. Our study demonstrated that the binding of hundreds of human and mouse TFs is predicted by ChIPanalyser with high accuracy and showed that many TFs can bind dense chromatin.
Also flagged:frontotemporal dementiafrontotemporal lobar degenerationFTLDgap junction proteinGJA1lipid-binding protein APOE
Journal Article2023-03-15✓ 1 SnippetMarsan E, Velmeshev D, Ramsey A, Patel RK, Zhang J, Koontz M, Andrews MG, de Majo M, Mora C, Blumenfeld J, Li AN, Spina S, Grinberg LT, Seeley WW, Miller BL, Ullian EM, Krummel MF, Kriegstein AR, Huang EJ.
In-Text Gene Mentions
Results)
…as BDNF ,DCC, ROBO1 ,…
Show Full Abstract
Mutations in the human progranulin (GRN) gene are a leading cause of frontotemporal lobar degeneration (FTLD). While previous studies implicate aberrant microglial activation as a disease-driving factor in neurodegeneration in the thalamocortical circuit in Grn-/- mice, the exact mechanism for neurodegeneration in FTLD-GRN remains unclear. By performing comparative single-cell transcriptomics in the thalamus and frontal cortex of Grn-/- mice and patients with FTLD-GRN, we have uncovered a highly conserved astroglial pathology characterized by upregulation of gap junction protein GJA1, water channel AQP4, and lipid-binding protein APOE, and downregulation of glutamate transporter SLC1A2 that promoted profound synaptic degeneration across the two species. This astroglial toxicity could be recapitulated in mouse astrocyte-neuron cocultures and by transplanting induced pluripotent stem cell-derived astrocytes to cortical organoids, where progranulin-deficient astrocytes promoted synaptic degeneration, neuronal stress, and TDP-43 proteinopathy. Together, these results reveal a previously unappreciated astroglial pathology as a potential key mechanism in neurodegeneration in FTLD-GRN.
…Cholesterol-modification of siRNAs has been used to facilitate incorporation into and onto the surface of EVs to silence the huntingtin gene (Htt) in primary cortical neurons in the brains of an HD mouse model [162] (Fig. 4c).…
S I O 001029)
…After IV administration, these modified vesicles increased delivery of specific siRNAs into brain regions to reduce Huntington gene (Htt) expression in an HD mouse model [67].…
Show Full Abstract
Diseases of the central nervous system (CNS) are challenging to treat, mainly due to the blood-brain barrier (BBB), which restricts drugs in circulation from entering target regions in the brain. To address this issue extracellular vesicles (EVs) have gained increasing scientific interest as carriers able to cross the BBB with multiplex cargos. EVs are secreted by virtually every cell, and their escorted biomolecules are part of an intercellular information gateway between cells within the brain and with other organs. Scientists have undertaken efforts to safeguard the inherent features of EVs as therapeutic delivery vehicles, such as protecting and transferring functional cargo, as well as loading them with therapeutic small molecules, proteins, and oligonucleotides and targeting them to specific cell types for the treatment of CNS diseases. Here, we review current emerging approaches that engineer the EV surface and cargo to improve targeting and functional responses in the brain. We summarize existing applications of engineered EVs as a therapeutic delivery platform for brain diseases, some of which have been evaluated clinically.
Also flagged:obesitycomplexchronic diseaseshypertensionleptininsulin
Journal Article2023-03-15✓ 1 SnippetFernández-Rhodes L, McArdle CE, Rao H, Wang Y, Martinez-Miller EE, Ward JB, Cai J, Sofer T, Isasi CR, North KE.
In-Text Gene Mentions
Text
…NEGR1…
Show Full Abstract
<h4>Objective</h4>In the United States, Hispanic/Latino adults face a high burden of obesity; yet, not all individuals are equally affected, partly due in part to this ethnic group's marked sociocultural diversity. We sought to analyze the modification of body mass index (BMI) genetic effects in Hispanic/Latino adults by their level of acculturation, a complex biosocial phenomenon that remains understudied.<h4>Methods</h4>Among 11,747 Hispanic/Latinos adults in the Hispanic Community Health Study/Study of Latinos aged 18 to 76 years from four urban communities (2008-2011), we a) tested our hypothesis that the effect of a genetic risk score (GRS) for increased BMI may be exacerbated by higher levels of acculturation and b) examined if GRS acculturation interactions varied by gender or Hispanic/Latino background group. All genetic modeling controlled for relatedness, age, gender, principal components of ancestry, center, and complex study design within a generalized estimated equation framework.<h4>Results</h4>We observed a GRS increase of 0.34 kg/m 2 per risk allele in weighted mean BMI. The estimated main effect of GRS on BMI varied both across acculturation level and across gender. The difference between high and low acculturation ranged from 0.03 to 0.23 kg/m 2 per risk allele, but varied across acculturation measure and gender.<h4>Conclusions</h4>These results suggest the presence of effect modification by acculturation, with stronger effects on BMI among highly acculturated individuals and female immigrants. Future studies of obesity in the Hispanic/Latino community should account for sociocultural environments and consider their intersection with gender to better target obesity interventions.
Also flagged:cancerblood circulationnanogelsdoxorubicintumoursolid tumors
Journal Article2023-03-15No SnippetsLi Z, Zhu Y, Zeng H, Wang C, Xu C, Wang Q, Wang H, Li S, Chen J, Xiao C, Yang X, Li Z.
Show Full Abstract
Nanomedicine has been developed for cancer therapy over several decades, while rapid clearance from blood circulation by reticuloendothelial system (RES) severely limits nanomedicine antitumour efficacy. We design a series of nanogels with distinctive stiffness and investigate how nanogel mechanical properties could be leveraged to overcome RES. Stiff nanogels are injected preferentially to abrogate uptake capacity of macrophages and temporarily block RES, relying on inhibition of clathrin and prolonged liver retention. Afterwards, soft nanogels deliver doxorubicin (DOX) with excellent efficiency, reflected in high tumour accumulation, deep tumour penetration and outstanding antitumour efficacy. In this work, we combine the advantage of stiff nanogels in RES-blockade with the superiority of soft nanogels in drug delivery leads to the optimum tumour inhibition effect, which is defined as mechano-boosting antitumour strategy. Clinical implications of stiffness-dependent RES-blockade are also confirmed by promoting antitumour efficacy of commercialized nanomedicines, such as Doxil and Abraxane.
Also flagged:CaspaseReceptor Tyrosine KinasesDependence receptorsdependenceRETHER2
Journal Article2023-03-15✓ 2 SnippetsPark GH, Kang YK, Paek SM, Shin CY, Han SY.
In-Text Gene Mentions
S I O 001029)
…The prototype dependence receptors such as DCC (Deleted in Colorectal Carcinoma) and UNC5H3 are considered tumor suppressors.…
Introduction)
…in colorectal carcinoma (DCC), uncoordinated five homologs…
Show Full Abstract
Dependence receptors are a group of receptor proteins with shared characteristics of transducing two different signals within cells. They can transduce a positive signal of survival and differentiation in the presence of ligands. On the other hand, dependence receptors can transduce an apoptosis signal in the absence of ligands. The function of these receptors depends on the availability of their ligands. Several receptor tyrosine kinases (RTKs) have been reported as dependence receptors. When cells undergo apoptosis by dependence receptors, the intracellular domain of some RTKs is cleaved by the caspases. Among the RTKs that belong to dependence receptors, we focused on eight RTKs (RET, HER2, MET, ALK, TrkC, EphA4, EphB3, and c-KIT) that are cleaved by caspases. In this review, we describe the features of the receptors, their cleavage sites, and the fate of the cleaved products, as well as recent implications on them being used as potential therapeutics for cancer treatment.
To address large gaps in our understanding of the molecular regulation of articular and growth plate cartilage development in humans, we used our directed differentiation approach to generate these distinct cartilage tissues from human embryonic stem cells. The resulting transcriptomic profiles of hESC-derived articular and growth plate chondrocytes were similar to fetal epiphyseal and growth plate chondrocytes, with respect to genes both known and previously unknown to cartilage biology. With the goal to characterize the regulatory landscapes accompanying these respective transcriptomes, we mapped chromatin accessibility in hESC-derived chondrocyte lineages, and mouse embryonic chondrocytes, using ATAC-sequencing. Integration of the expression dataset with the differentially accessible genomic regions revealed lineage-specific gene regulatory networks. We validated functional interactions of two transcription factors (TFs) (RUNX2 in growth plate chondrocytes and RELA in articular chondrocytes) with their predicted genomic targets. The maps we provide thus represent a framework for probing regulatory interactions governing chondrocyte differentiation. This work constitutes a substantial step towards comprehensive and comparative molecular characterizations of distinct chondrogenic lineages and sheds new light on human cartilage development and biology.
Secreted proteins fulfill a vast array of functions, including immunity, signaling, and extracellular matrix remodeling. In the trans-Golgi network, proteins destined for constitutive secretion are sorted into post-Golgi carriers which fuse with the plasma membrane. The molecular machinery involved is poorly understood. Here, we have used kinetic trafficking assays and transient CRISPR-KO to study biosynthetic sorting from the Golgi to the plasma membrane. Depletion of all canonical exocyst subunits causes cargo accumulation in post-Golgi carriers. Exocyst subunits are recruited to and co-localize with carriers. Exocyst abrogation followed by kinetic trafficking assays of soluble cargoes results in intracellular cargo accumulation. Unbiased secretomics reveals impairment of soluble protein secretion after exocyst subunit knockout. Importantly, in specialized cell types, the loss of exocyst prevents constitutive secretion of antibodies in lymphocytes and of leptin in adipocytes. These data identify exocyst as the functional tether of secretory post-Golgi carriers at the plasma membrane and an essential component of the mammalian constitutive secretory pathway.
<h4>Objective</h4>To examine the feasibility of human cardiac MR (CMR) at 14.0 T using high-density radiofrequency (RF) dipole transceiver arrays in conjunction with static and dynamic parallel transmission (pTx).<h4>Materials and methods</h4>RF arrays comprised of self-grounded bow-tie (SGBT) antennas, bow-tie (BT) antennas, or fractionated dipole (FD) antennas were used in this simulation study. Static and dynamic pTx were applied to enhance transmission field (B<sub>1</sub><sup>+</sup>) uniformity and efficiency in the heart of the human voxel model. B<sub>1</sub><sup>+</sup> distribution and maximum specific absorption rate averaged over 10 g tissue (SAR<sub>10g</sub>) were examined at 7.0 T and 14.0 T.<h4>Results</h4>At 14.0 T static pTx revealed a minimum B<sub>1</sub><sup>+</sup><sub>ROI</sub> efficiency of 0.91 μT/√kW (SGBT), 0.73 μT/√kW (BT), and 0.56 μT/√kW (FD) and maximum SAR<sub>10g</sub> of 4.24 W/kg, 1.45 W/kg, and 2.04 W/kg. Dynamic pTx with 8 kT points indicate a balance between B<sub>1</sub><sup>+</sup><sub>ROI</sub> homogeneity (coefficient of variation < 14%) and efficiency (minimum B<sub>1</sub><sup>+</sup><sub>ROI</sub> > 1.11 µT/√kW) at 14.0 T with a maximum SAR<sub>10g</sub> < 5.25 W/kg.<h4>Discussion</h4>MRI of the human heart at 14.0 T is feasible from an electrodynamic and theoretical standpoint, provided that multi-channel high-density antennas are arranged accordingly. These findings provide a technical foundation for further explorations into CMR at 14.0 T.
…both Regnase-1 andRoquin-1increases function further…
Show Full Abstract
A fundamental limitation of T cell therapies in solid tumors is loss of inflammatory effector functions, such as cytokine production and proliferation. Here, we target a regulatory axis of T cell inflammatory responses, Regnase-1 and Roquin-1, to enhance antitumor responses in human T cells engineered with two clinical-stage immune receptors. Building on previous observations of Regnase-1 or Roquin-1 knockout in murine T cells or in human T cells for hematological malignancy models, we found that knockout of either Regnase-1 or Roquin-1 alone enhances antitumor function in solid tumor models, but that knockout of both Regnase-1 and Roquin-1 increases function further than knockout of either regulator alone. Double knockout of Regnase-1 and Roquin-1 increased resting T cell inflammatory activity and led to at least an order of magnitude greater T cell expansion and accumulation in xenograft mouse models, increased cytokine activity, and persistence. However double knockout of Regnase-1 and Roguin-1 also led to a lymphoproliferative syndrome and toxicity in some mice. These results suggest that regulators of immune inflammatory functions may be interesting targets to modulate to improve antitumor responses.
Due to climate changes, there has been a large expansion of emerging tick-borne zoonotic viruses, including Heartland bandavirus (HRTV) and Dabie bandavirus (DBV). As etiologic agents of hemorrhagic fever with high fatality, HRTV and DBV have been recognized as dangerous viral pathogens that likely cause future wide epidemics. Despite serious health concerns, the mechanisms underlying viral infection are largely unknown. HRTV and DBV Gn and Gc are viral surface glycoproteins required for early entry events during infection. Glycosphingolipids, including galactosylceramide (GalCer), glucosylceramide (GlcCer) and lactosylceramide (LacCer), are a class of membrane lipids that play essential roles in membrane structure and viral lifecycle. Here, our genome-wide CRISPR/Cas9 knockout screen identifies that glycosphingolipid biosynthesis pathway is essential for HRTV and DBV infection. The deficiency of UDP-glucose ceramide glucosyltransferase (UGCG) that produces GlcCer resulted in the loss of infectivity of recombinant viruses pseudotyped with HRTV or DBV Gn/Gc glycoproteins. Conversely, exogenous supplement of GlcCer, but not GalCer or LacCer, recovered viral entry of UGCG-deficient cells in a dose-dependent manner. Biophysical analyses showed that GlcCer targeted the lipid-head-group binding pocket of Gc to form a stable protein-lipid complex, which allowed the insertion of Gc protein into host lysosomal membrane lipid bilayers for viral fusion. Mutagenesis showed that D841 residue at the Gc lipid binding pocket was critical for GlcCer interaction and thereby, viral entry. These findings reveal detailed mechanism of GlcCer glycosphingolipid in HRTV and DBV Gc-mediated membrane fusion and provide a potential therapeutic target for tickborne virus infection.
Also flagged:ALOX5ferroptosisdeathHuntington's diseaseHDpolyglutamine
Journal Article2023-03-15✓ 4 SnippetsSong S, Su Z, Kon N, Chu B, Li H, Jiang X, Luo J, Stockwell BR, Gu W.
In-Text Gene Mentions
Discussion)
…HdhQ111 knock-in mice express 111-glutamine mutant huntingtin from the mouse HTT endogenous locus and exhibit early dominant abnormalities selective for medium spiny striatal neurons, including nuclear retention of full-length mutant huntingtin (Wheeler et al. 2000).…
Discussion)
…There are several additional mouse models of HD, including the knock-in and BAC transgenic mice that express full-length mutant HTT.…
S I O 001029)
…HD is caused by a CAG trinucleotide repeat expansion in exon 1 of the HTT gene, which results in an expanded polyglutamine (polyQ) tract in the encoded huntingtin protein, referred to as mutant huntingtin (mHTT).…
Discussion)
…from the mouseHTTendogenous locus and…
Show Full Abstract
Although it is well established that Huntington's disease (HD) is mainly caused by polyglutamine-expanded mutant huntingtin (mHTT), the molecular mechanism of mHTT-mediated actions is not fully understood. Here, we showed that expression of the N-terminal fragment containing the expanded polyglutamine (HTTQ94) of mHTT is able to promote both the ACSL4-dependent and the ACSL4-independent ferroptosis. Surprisingly, inactivation of the ACSL4-dependent ferroptosis fails to show any effect on the life span of Huntington's disease mice. Moreover, by using RNAi-mediated screening, we identified ALOX5 as a major factor required for the ACSL4-independent ferroptosis induced by HTTQ94. Although ALOX5 is not required for the ferroptotic responses triggered by common ferroptosis inducers such as erastin, loss of ALOX5 expression abolishes HTTQ94-mediated ferroptosis upon reactive oxygen species (ROS)-induced stress. Interestingly, ALOX5 is also required for HTTQ94-mediated ferroptosis in neuronal cells upon high levels of glutamate. Mechanistically, HTTQ94 activates ALOX5-mediated ferroptosis by stabilizing FLAP, an essential cofactor of ALOX5-mediated lipoxygenase activity. Notably, inactivation of the <i>Alox5</i> gene abrogates the ferroptosis activity in the striatal neurons from the HD mice; more importantly, loss of ALOX5 significantly ameliorates the pathological phenotypes and extends the life spans of these HD mice. Taken together, these results demonstrate that ALOX5 is critical for mHTT-mediated ferroptosis and suggest that ALOX5 is a potential new target for Huntington's disease.
Also flagged:tumortumorsolfactomedin 4cancerprimary tumorwound-healing
Journal Article2023-03-15✓ 5 SnippetsZou Y, Kamada N, Seong SY, Seo SU.
In-Text Gene Mentions
Discussion)
…OLFM4 is often overexpressed in normal tissue and early-stage tumors but downregulated in advanced tumor stages52,53.…
Discussion)
…OLFM4+ PMN expanded during experimental sepsis and an OLFM4 deficiency ameliorated the disease9.…
Discussion)
…The neutrophilic OLFM4+ subset in cancer was investigated in a more recent study using mice in which OLFM4 was selectively deficient in myeloid cells51.…
Results)
…Although TB mice significantly downregulated expression of neutrophil-related genes (MPO, Olfm4, MMP9, NGP, and CAMP) compared to mice without tumors (Fig. 6d), Olfm4 expression levels were not affected by DT treatment in any mouse group (Fig. 6e).…
Discussion)
…Low expression of OLFM4 promoted lymph node and distant metastasis resulting in a poor prognosis of triple-negative breast cancer patients and low expression of OLFM4 in early gastric cancer was associated with lymph node metastasis54,55.…
Show Full Abstract
Myeloid-derived suppressor cells (MDSCs) consist of monocytic (M-) MDSCs and polymorphonuclear (PMN-) MDSCs that contribute to an immunosuppressive environment in tumor-bearing hosts. However, research on the phenotypic and functional heterogeneity of MDSCs in tumor-bearing hosts and across different disease stage is limited. Here we subdivide M-MDSCs based on CD115 expression and report that CD115<sup>-</sup> M-MDSCs are functionally distinct from CD115<sup>+</sup> M-MDSCs. CD115<sup>-</sup> M-MDSCs increased in bone marrow and blood as tumors progressed. Transcriptome analysis revealed that CD115<sup>-</sup> M-MDSCs expressed higher levels of neutrophil-related genes. Moreover, isolated CD115<sup>-</sup> M-MDSCs had higher potential to be differentiated into PMN-MDSCs compared with CD115<sup>+</sup> M-MDSCs. Of note, CD115<sup>-</sup> M-MDSCs were able to differentiate into both olfactomedin 4 (OLFM4)<sup>hi</sup> and OLFM4<sup>lo</sup> PMN-MDSCs, whereas CD115<sup>+</sup> M-MDSCs differentiated into a smaller proportion of OLFM4<sup>lo</sup> PMN-MDSCs. In vivo, M-MDSC to PMN-MDSC differentiation occurred most frequently in bone marrow while M-MDSCs preferentially differentiated into tumor-associated macrophages in the tumor mass. Our study reveals the presence of previously unrecognized subtypes of CD115<sup>-</sup> M-MDSCs in tumor-bearing hosts and demonstrates their cellular plasticity during tumorigenesis.
Also flagged:celltissue injuriescell cyclecell-cyclecell differentiationcell senescence
Journal Article2023-03-15No Snippetsde Morree A, Rando TA.
Show Full Abstract
Adult stem cells are important for mammalian tissues, where they act as a cell reserve that supports normal tissue turnover and can mount a regenerative response following acute injuries. Quiescent stem cells are well established in certain tissues, such as skeletal muscle, brain, and bone marrow. The quiescent state is actively controlled and is essential for long-term maintenance of stem cell pools. In this Review, we discuss the importance of maintaining a functional pool of quiescent adult stem cells, including haematopoietic stem cells, skeletal muscle stem cells, neural stem cells, hair follicle stem cells, and mesenchymal stem cells such as fibro-adipogenic progenitors, to ensure tissue maintenance and repair. We discuss the molecular mechanisms that regulate the entry into, maintenance of, and exit from the quiescent state in mice. Recent studies revealed that quiescent stem cells have a discordance between RNA and protein levels, indicating the importance of post-transcriptional mechanisms, such as alternative polyadenylation, alternative splicing, and translation repression, in the control of stem cell quiescence. Understanding how these mechanisms guide stem cell function during homeostasis and regeneration has important implications for regenerative medicine.
Also flagged:oxygenbronchopulmonary dysplasialung inflammationCell cycleembryo developmentphosphorylation
Journal Article2023-03-15✓ 2 SnippetsStorti M, Faietti ML, Murgia X, Catozzi C, Minato I, Tatoni D, Cantarella S, Ravanetti F, Ragionieri L, Ciccimarra R, Zoboli M, Vilanova M, Sánchez-Jiménez E, Gay M, Vilaseca M, Villetti G, Pioselli B, Salomone F, Ottonello S, Montanini B, Ricci F.
In-Text Gene Mentions
Results)
…PRDX6), catalase (CAT), glutathione…
Discussion)
…enzymes (PRDX1, CAT,PRDX6, GPX1, SOD1, TXN,…
Show Full Abstract
<h4>Background</h4>Premature birth, perinatal inflammation, and life-saving therapies such as postnatal oxygen and mechanical ventilation are strongly associated with the development of bronchopulmonary dysplasia (BPD); these risk factors, alone or combined, cause lung inflammation and alter programmed molecular patterns of normal lung development. The current knowledge on the molecular regulation of lung development mainly derives from mechanistic studies conducted in newborn rodents exposed to postnatal hyperoxia, which have been proven useful but have some limitations.<h4>Methods</h4>Here, we used the rabbit model of BPD as a cost-effective alternative model that mirrors human lung development and, in addition, enables investigating the impact of premature birth per se on the pathophysiology of BPD without further perinatal insults (e.g., hyperoxia, LPS-induced inflammation). First, we characterized the rabbit's normal lung development along the distinct stages (i.e., pseudoglandular, canalicular, saccular, and alveolar phases) using histological, transcriptomic and proteomic analyses. Then, the impact of premature birth was investigated, comparing the sequential transcriptomic profiles of preterm rabbits obtained at different time intervals during their first week of postnatal life with those from age-matched term pups.<h4>Results</h4>Histological findings showed stage-specific morphological features of the developing rabbit's lung and validated the selected time intervals for the transcriptomic profiling. Cell cycle and embryo development, oxidative phosphorylation, and WNT signaling, among others, showed high gene expression in the pseudoglandular phase. Autophagy, epithelial morphogenesis, response to transforming growth factor β, angiogenesis, epithelium/endothelial cells development, and epithelium/endothelial cells migration pathways appeared upregulated from the 28th day of gestation (early saccular phase), which represents the starting point of the premature rabbit model. Premature birth caused a significant dysregulation of the inflammatory response. TNF-responsive, NF-κB regulated genes were significantly upregulated at premature delivery and triggered downstream inflammatory pathways such as leukocyte activation and cytokine signaling, which persisted upregulated during the first week of life. Preterm birth also dysregulated relevant pathways for normal lung development, such as blood vessel morphogenesis and epithelial-mesenchymal transition.<h4>Conclusion</h4>These findings establish the 28-day gestation premature rabbit as a suitable model for mechanistic and pharmacological studies in the context of BPD.
Also flagged:bone morphogenetic proteinBMPWntmorphogenesisLgr5CD34
Journal Article2023-03-15✓ 1 SnippetMcCarthy N, Tie G, Madha S, He R, Kraiczy J, Maglieri A, Shivdasani RA.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
Wnt and Rspondin (RSPO) signaling drives proliferation, and bone morphogenetic protein inhibitors (BMPi) impede differentiation, of intestinal stem cells (ISCs). Here, we identify the mouse ISC niche as a complex, multi-layered structure that encompasses distinct mesenchymal and smooth muscle populations. In young and adult mice, diverse sub-cryptal cells provide redundant ISC-supportive factors; few of these are restricted to single cell types. Niche functions refine during postnatal crypt morphogenesis, in part to oppose the dense aggregation of differentiation-promoting BMP+ sub-epithelial myofibroblasts at crypt-villus junctions. Muscularis mucosae, a specialized muscle layer, first appears during this period and supplements neighboring RSPO and BMPi sources. Components of this developing niche are conserved in human fetuses. The in vivo ablation of mouse postnatal smooth muscle increases BMP signaling activity, potently limiting a pre-weaning burst of crypt fission. Thus, distinct and progressively specialized mesenchymal cells together create the milieu that is required to propagate crypts during rapid organ growth and to sustain adult ISCs.
<h4>Background</h4>The bioactive peptide hormone hepcidin-25 regulates iron levels by inhibiting iron transport to plasma via ferroportin. Hepcidin-25 is synthesized in the liver where the 84 amino acids pro-hepcidin is cleaved into the bioactive hepcidin-25. A patient admitted to the hospital presented with infertility and fatigue.<h4>Methods</h4>Genomic DNA was purified from whole blood using the Maxwell 16 system (Promega). MLPA analysis was performed to detect large genomic rearrangements using the SALSA MLPA kit # P347, Hemochromatosis (MRC Holland, Holland). Plasma hepcidin measurements were performed using liquid chromatography/tandem mass spectrometry (LC-MS/MS).<h4>Results</h4>A novel HAMP mutation (homozygous one base deletion in c.215delG, p.Cys72Serfs*?) was detected. The deletion in nucleotide 215 causes a frameshift altering the predicted protein sequence from cysteine13 in mature peptide. Whether this leads to nonsense mediated decay of the mRNA or synthesis of an aberrant peptide in unknown, but bioactive hepcidin-25 was undetectable in plasma. The patient had massive iron overload with ferritin up to 8360 µg/L. He was anaemic with a Hb at 7.0 mmol/L (11.3 g/dL) and suffered from hypogonadotropic hypogonadism with a total testosterone of 1.2 nmol/l. Continued treatment with venesection and gonadotropins led to reduced fatigue, reduction in iron overload, a normalized Hb and improvement of semen quality.<h4>Conclusion</h4>A novel hepcidin mutation was detected in a patient with massive iron overload, fatigue and hypogonadotropic hypogonadism.
We elucidated the BNIP3L/Nix and SQSTM1/p62 molecular mechanisms in sodium arsenite (NaAR)-induced cytotoxicity. Considerable changes in the morphology and adhesion of H460 cells were observed in response to varying NaAR concentrations. NaAR exposure induced DNA damage-mediated apoptosis and Nix accumulation via proteasome inhibition. Nix targets the endoplasmic reticulum (ER), inducing ER stress responses. p62 and Nix were colocalized and their expressions were inversely correlated. Autophagy inhibition upregulated Nix, p62, cell cycle progression gene 1 (CCPG1), heme oxygenase (HO)- 1, and calnexin expression. Nix knockdown decreased the NaAR-induced ER stress and microtubule-associated protein 1 A/1B light-chain 3 (LC3) B-II levels and increased the CCPG1 and calnexin levels. p62 knockdown upregulated Nix, LC3-II, and CCPG1 expressions and the ER stress responses, indicating that p62 regulates Nix levels. Nix downstream pathways were mitigated by Ca<sup>2+</sup> chelators. We demonstrate the critical roles of Nix and p62 in ER stress and ER-phagy in response to NaAR.
Autophagy is a cellular homeostasis mechanism that fuels the proliferation and survival of advanced cancers by degrading and recycling organelles and proteins. Preclinical studies have identified that within an established tumor, tumor cell autophagy and host cell autophagy conspire to support tumor growth. A growing body of evidence suggests that autophagy inhibition can augment the efficacy of chemotherapy, targeted therapy, or immunotherapy to enhance tumor shrinkage. First-generation autophagy inhibition trials in cancer using the lysosomal inhibitor hydroxychloroquine (HCQ) have produced mixed results but have guided the way for the development of more potent and specific autophagy inhibitors in clinical trials. In this review, we will discuss the role of autophagy in cancer, newly discovered molecular mechanisms of the autophagy pathway, the effects of autophagy modulation in cancer and host cells, and novel autophagy inhibitors that are entering clinical trials.
Also flagged:degenerative joint disorderOAIL-1βADAMTS9reverse transcriptionpolymerase
Journal Article2023-03-15✓ 3 SnippetsLi Y, Duan J, Lin W, Liu J.
In-Text Gene Mentions
Introduction)
…the expression ofSox6, which may be…
Discussion)
…example, ADSC-exos increasedPrdx6expression in OA…
Discussion)
…with IL-1β- andPrdx6-protected OA chondrocytes aga…
Show Full Abstract
Osteoarthritis (OA) is a type of common degenerative joint disorder, in which adipose mesenchymal stem cells (ADSCs) and the secreted exosomes play an important role. The purpose of this study was to investigate the role and mechanism of exosomes derived from ADSCs (ADSC-exos) in OA. The gradient of IL-1β concentration was designed to construct the articular chondrocyte model of arthritic mice. The expression of miR-93-5p and ADAMTS9 in articular chondrocytes was detected by reverse transcription quantitative polymerase chain reaction. Dual luciferase reporter gene assay was performed to verify the interaction between them. Monodansylcadaverine staining was used to visualize the autophagosome formation and cell apoptosis was analyzed by flow cytometry. ADSC-exos were authenticated by transmission electron microscope and western blot assay. miR-93-5p was found to be downregulated in IL-1β-treated articular chondrocytes compared with OA cartilage while ADAMTS9 was upregulated, which was identified as a direct target gene of miR-93-5p. Silencing of ADAMTS9 attenuated the effects of miR-93-5p. Exosomal miR-93-5p can reduce the release of inflammatory factors in mouse arthritis cell models. This study first described the mechanism under that ADSC-exos inhibited inflammation and alleviated OA through the innovative targets miR-93-5p/ADAMTS9 signal axis. This provided a new method for the treatment of OA.
Also flagged:coronary heart diseaseendoplasmic reticulumautophagyatherosclerosisblood stasis syndrome(IL)-8
Journal Article2023-03-15No SnippetsGuan S, Yu YN, Li B, Gu H, Chen L, Wang N, Wang B, Liu X, Liu J, Wang Z.
Show Full Abstract
<h4>Background</h4>The Xueyu Zheng (XYZ) phenome is central to coronary heart disease (CHD), but efforts to detect genetic associations in the XYZ phenome have been disappointing.<h4>Methods</h4>The phenomic alteration-related genes (PARGs) for the XYZ phenome were screened using |<i>ρ</i>| > 0.4 and p < 0.05 after treatment with Danhong injection at day 14 and day 30. Then, the driver genes for the Protein-Protein Interaction (PPI) networks of the PARGs established using STRING 11.0 were detected using a personalized network control algorithm (PNC). Finally, the molecular correlations of the driver genes with the XYZ phenome were analyzed with the Gene Ontology (GO) biological processes and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways from a holistic viewpoint.<h4>Results</h4>A total of 525 and 309 PARGs in the XYZ phenome at day 14 and day 30 were identified. These genes were separately enriched in 48 and 35 pathways. Furthermore, five driver genes were detected. These genes were mainly correlated with endoplasmic reticulum stress-mediated apoptosis and autophagy regulation, which could suppress atherosclerosis progression.<h4>Conclusion</h4>Our study detected the drug-responsive PARGs of the XYZ phenome in CHD and provides an exemplary strategy to investigate the genetic associations among this common phenome and its component symptoms in patients with CHD.<h4>Trial registration</h4>ClinicalTrials.gov, NCT01681316; registered on September 7, 2012.
Also flagged:dilated cardiomyopathyhypertensiondiabetesalcoholcocainedeath
Journal Article2023-03-15✓ 1 SnippetMicolonghi C, Fabiani M, Pagannone E, Savio C, Ricci M, Caroselli S, Gambioli V, Musumeci B, Germani A, Tini G, Autore C, Pizzuti A, Visco V, Rubattu S, Petrucci S, Piane M.
In-Text Gene Mentions
Introduction)
…nne/Becker muscular dystrophy,hemochromatosis, and mitochondrial DCM…
Show Full Abstract
Both genetic and environmental factors contribute to the development of dilated cardiomyopathy. Among the genes involved, <i>TTN</i> mutations, including truncated variants, explain 25% of DCM cases. We performed genetic counseling and analysis on a 57-year-old woman diagnosed with severe DCM and presenting relevant acquired risk factors for DCM (hypertension, diabetes, smoking habit, and/or previous alcohol and cocaine abuse) and with a family history of both DCM and sudden cardiac death. The left ventricular systolic function, as assessed by standard echocardiography, was 20%. The genetic analysis performed using TruSight Cardio panel, including 174 genes related to cardiac genetic diseases, revealed a novel nonsense <i>TTN</i> variant (<i>TTN:</i>c.103591A > T, p.Lys34531*), falling within the M-band region of the titin protein. This region is known for its important role in maintaining the structure of the sarcomere and in promoting sarcomerogenesis. The identified variant was classified as likely pathogenic based on ACMG criteria. The current results support the need of genetic analysis in the presence of a family history, even when relevant acquired risk factors for DCM may have contributed to the severity of the disease.
Also flagged:and Epileptic Encephalopathiesepilepsyepileptic encephalopathiesdevelopmental disabilitiesencephalopathiesepilepsies
Journal Article2023-03-15✓ 1 SnippetChang YT, Hong SY, Lin WD, Lin CH, Lin SS, Tsai FJ, Chou IC.
In-Text Gene Mentions
Title)
…novo variants ofCACNA1Ehave been recognized…
Show Full Abstract
Advances in disease-related gene discovery have led to tremendous innovations in the field of epilepsy genetics. Identification of genetic mutations that cause epileptic encephalopathies has opened new avenues for the development of targeted therapies. Clinical testing using extensive gene panels, exomes, and genomes is currently accessible and has resulted in higher rates of diagnosis and better comprehension of the disease mechanisms underlying the condition. Children with developmental disabilities have a higher risk of developing epilepsy. As our understanding of the mechanisms underlying encephalopathies and epilepsies improves, there may be greater potential to develop innovative therapies tailored to an individual's genotype. This article provides an overview of the significant progress in epilepsy genomics in recent years, with a focus on developmental and epileptic encephalopathies in children. The aim of this review is to enhance comprehension of the clinical utilization of genetic testing in this particular patient population. The development of effective and precise therapeutic strategies for epileptic encephalopathies may be facilitated by a comprehensive understanding of their molecular pathogenesis.
Also flagged:chronic myeloproliferative neoplasmhematopoiesisacute leukemiapathogenesisoncogeneshematopoietic stem cell differentiation
Journal Article2023-03-15✓ 2 SnippetsVisani G, Etebari M, Fuligni F, Di Guardo A, Isidori A, Loscocco F, Paolini S, Navari M, Piccaluga PP.
In-Text Gene Mentions
Results)
…To identify potentially actionable genes, a further analysis of the above-mentioned genes was carried out with Cognoscente, revealing JAK2, FGFR2, and PTGIS as the main candidate drug targets for PMF, which were connected to therapies such as ruxolitinib, tofacitinib, palifermin, ponatinib and epoprostenol (Supplementary Figure S2B).…
Results)
…JAK2, FGFR2, andPTGISas the main…
Show Full Abstract
Primary myelofibrosis (PMF) is a chronic myeloproliferative neoplasm (MPN) characterized by progressive bone marrow sclerosis, extra-medullary hematopoiesis, and possible transformation to acute leukemia. In the last decade, the molecular pathogenesis of the disease has been largely uncovered. Particularly, genetic and genomic studies have provided evidence of deregulated oncogenes in PMF as well as in other MPNs. However, the mechanisms through which transformation to either the myeloid or lymphoid blastic phase remain obscure. Particularly, it is still debated whether the disease has origins in a multi-potent hematopoietic stem cells or instead in a commissioned myeloid progenitor. In this study, we aimed to shed light upon this issue by using next generation sequencing (NGS) to study both myeloid and lymphoid cells as well as matched non-neoplastic DNA of PMF patients. Whole exome sequencing revealed that most somatic mutations were the same between myeloid and lymphoid cells, such findings being confirmed by Sanger sequencing. Particularly, we found 126/146 SNVs to be the e same (including <i>JAK2V617F</i>), indicating that most genetic events likely to contribute to disease pathogenesis occurred in a non-commissioned precursor. In contrast, only 9/27 InDels were similar, suggesting that this type of lesion contributed instead to disease progression, occurring at more differentiated stages, or maybe just represented "passenger" lesions, not contributing at all to disease pathogenesis. In conclusion, we showed for the first time that genetic lesions characteristic of PMF occur at an early stage of hematopoietic stem cell differentiation, this being in line with the possible transformation of the disease in either myeloid or lymphoid acute leukemia.
…HD is caused by mutation in the gene encoding huntingtin (Htt), resulting in an expansion of the CAG trinucleotide on the short arm of chromosome 4p16.3 [6].…
Introduction)
…gene encoding huntingtin (Htt), resulting in an…
Introduction)
…mutation in theHttgene leads to…
Discussion)
…that wild typeHttplays an important…
Discussion)
…where wild typeHttcould act as…
Show Full Abstract
Huntington's disease (HD) is a progressive neurodegenerative disease characterized by mutations in the huntingtin gene (mHtt), causing an unstable repeat of the CAG trinucleotide, leading to abnormal long repeats of polyglutamine (poly-Q) in the N-terminal region of the huntingtin, which form abnormal conformations and aggregates. Alterations in Ca<sup>2+</sup> signaling are involved in HD models and the accumulation of mutated huntingtin interferes with Ca<sup>2+</sup> homeostasis. Lysosomes are intracellular Ca<sup>2+</sup> storages that participate in endocytic and lysosomal degradation processes, including autophagy. Nicotinic acid adenine dinucleotide phosphate (NAADP) is an intracellular second messenger that promotes Ca<sup>2+</sup> release from the endo-lysosomal system via Two-Pore Channels (TPCs) activation. Herein, we show the impact of lysosomal Ca<sup>2+</sup> signals on mHtt aggregation and autophagy blockade in murine astrocytes overexpressing mHtt-Q74. We observed that mHtt-Q74 overexpression causes an increase in NAADP-evoked Ca<sup>2+</sup> signals and mHtt aggregation, which was inhibited in the presence of Ned-19, a TPC antagonist, or BAPTA-AM, a Ca<sup>2+</sup> chelator. Additionally, TPC2 silencing revert the mHtt aggregation. Furthermore, mHtt has been shown co-localized with TPC2 which may contribute to its effects on lysosomal homeostasis. Moreover, NAADP-mediated autophagy was also blocked since its function is dependent on lysosomal functionality. Taken together, our data show that increased levels of cytosolic Ca<sup>2+</sup> mediated by NAADP causes mHtt aggregation. Additionally, mHtt co-localizes with the lysosomes, where it possibly affects organelle functions and impairs autophagy.
Photodynamic therapy (PDT) is broadly used to treat different tumors, and it is a rapidly developing approach to inactivating or inhibiting the replication of fungi, bacteria, and viruses. Herpes simplex virus 1 (HSV-1) is an important human pathogen and a frequently used model to study the effects of PDT on enveloped viruses. Although many photosensitizers (PSs) have been tested for their antiviral properties, analyses are usually limited to assessing the reduction in viral yield, and thus the molecular mechanisms of photodynamic inactivation (PDI) remain poorly understood. In this study, we investigated the antiviral properties of TMPyP3-C<sub>17</sub>H<sub>35</sub>, a tricationic amphiphilic porphyrin-based PS with a long alkyl chain. We show that light-activated TMPyP3-C<sub>17</sub>H<sub>35</sub> can efficiently block virus replication at certain nM concentrations without exerting obvious cytotoxicity. Moreover, we show that the levels of viral proteins (immediate-early, early, and late genes) were greatly reduced in cells treated with subtoxic concentrations of TMPyP3-C<sub>17</sub>H<sub>35</sub>, resulting in markedly decreased viral replication. Interestingly, we observed a strong inhibitory effect of TMPyP3-C<sub>17</sub>H<sub>35</sub> on the virus yield only when cells were treated before or shortly after infection. In addition to the antiviral activity of the internalized compound, we show that the compound dramatically reduces the infectivity of free virus in the supernatant. Overall, our results demonstrate that activated TMPyP3-C<sub>17</sub>H<sub>35</sub> effectively inhibits HSV-1 replication and that it can be further developed as a potential novel treatment and used as a model to study photodynamic antimicrobial chemotherapy.
Also flagged:yellow feverInfectionnitrogenYFV infectionsynthesisDNA polymerase
Journal Article2023-03-15No Snippetsde Oliveira CH, Andrade MS, Campos FS, da C Cardoso J, Gonçalves-Dos-Santos ME, Oliveira RS, Aquino-Teixeira SM, Campos AA, Almeida MA, Simonini-Teixeira D, da P Sevá A, Temponi AOD, Magalhães FM, da Silva Menezes AS, Lopes BT, Almeida HP, Pedroso AL, Gonçalves GP, Chaves DCC, de Menezes GG, Bernal-Valle S, Müller NF, Janssen L, Dos Santos E, Mares-Guia MA, Albuquerque GR, Romano AP, Franco AC, Ribeiro BM, Roehe PM, Lourenço-de-Oliveira R, de Abreu FVS.
Show Full Abstract
In recent decades, waves of yellow fever virus (YFV) from the Amazon Rainforest have spread and caused outbreaks in other regions of Brazil, including the Cerrado, a savannah-like biome through which YFV usually moves before arriving at the Atlantic Forest. To identify the vectors involved in the maintenance of the virus in semiarid environments, an entomological survey was conducted after confirmation of yellow fever (YF) epizootics at the peak of the dry season in the Cerrado areas of the state of Minas Gerais. In total, 917 mosquitoes from 13 taxa were collected and tested for the presence of YFV. Interestingly, mosquitoes of the <i>Sabethes</i> genus represented 95% of the diurnal captured specimens, displaying a peak of biting activity never previously recorded, between 4:30 and 5:30 p.m. Molecular analysis identified three YFV-positive pools, two from <i>Sabethes chloropterus</i>-from which near-complete genomes were generated-and one from <i>Sa. albiprivus</i>, whose low viral load prevented sequencing. <i>Sa. chloropterus</i> was considered the primary vector due to the high number of copies of YFV RNA and the high relative abundance detected. Its bionomic characteristics allow its survival in dry places and dry time periods. For the first time in Brazil, <i>Sa. albiprivus</i> was found to be naturally infected with YFV and may have played a role as a secondary vector. Despite its high relative abundance, fewer copies of viral RNA were found, as well as a lower Minimum Infection Rate (MIR). Genomic and phylogeographic analysis showed that the virus clustered in the sub-lineage YFV<sub>PA-MG</sub>, which circulated in Pará in 2017 and then spread into other regions of the country. The results reported here contribute to the understanding of the epidemiology and mechanisms of YFV dispersion and maintenance, especially in adverse weather conditions. The intense viral circulation, even outside the seasonal period, increases the importance of surveillance and YFV vaccination to protect human populations in affected areas.
Also flagged:cancerdeathliver cancertumorHepatocellular carcinomaprimary
Journal Article2023-03-15✓ 2 SnippetsChi H, Zhao S, Yang J, Gao X, Peng G, Zhang J, Xie X, Song G, Xu K, Xia Z, Chen S, Zhao J.
In-Text Gene Mentions
Discussion)
…TNFSF4 is overexpressed in HCC and contributes to poor prognosis by activating multiple immunosuppressive pathways (49).…
Discussion)
…TNFSF4is overexpressed in…
Show Full Abstract
<h4>Background</h4>Hepatocellular carcinoma (HCC), the third most prevalent cause of cancer-related death, is a frequent primary liver cancer with a high rate of morbidity and mortality. T-cell depletion (TEX) is a progressive decline in T-cell function due to continuous stimulation of the TCR in the presence of sustained antigen exposure. Numerous studies have shown that TEX plays an essential role in the antitumor immune process and is significantly associated with patient prognosis. Hence, it is important to gain insight into the potential role of T cell depletion in the tumor microenvironment. The purpose of this study was to develop a trustworthy TEX-based signature using single-cell RNA-seq (scRNA-seq) and high-throughput RNA sequencing, opening up new avenues for evaluating the prognosis and immunotherapeutic response of HCC patients.<h4>Methods</h4>The International Cancer Genome Consortium (ICGC) and The Cancer Genome Atlas (TCGA) databases were used to download RNA-seq information for HCC patients. The 10x scRNA-seq. data of HCC were downloaded from GSE166635, and UMAP was used for clustering descending, and subgroup identification. TEX-related genes were identified by gene set variance analysis (GSVA) and weighted gene correlation network analysis (WGCNA). Afterward, we established a prognostic TEX signature using LASSO-Cox analysis. External validation was performed in the ICGC cohort. Immunotherapy response was assessed by the IMvigor210, GSE78220, GSE79671, and GSE91061cohorts. In addition, differences in mutational landscape and chemotherapy sensitivity between different risk groups were investigated. Finally, the differential expression of TEX genes was verified by qRT-PCR.<h4>Result</h4>11 TEX genes were thought to be highly predictive of the prognosis of HCC and substantially related to HCC prognosis. Patients in the low-risk group had a greater overall survival rate than those in the high-risk group, according to multivariate analysis, which also revealed that the model was an independent predictor of HCC. The predictive efficacy of columnar maps created from clinical features and risk scores was strong.<h4>Conclusion</h4>TEX signature and column line plots showed good predictive performance, providing a new perspective for assessing pre-immune efficacy, which will be useful for future precision immuno-oncology studies.
Also flagged:metabolismimmune responseMyD88p38 MAPKmorphogenesisPTHrP
Journal Article2023-03-15No SnippetsDeng Y, Luo N, Xie M, He L, Jiang R, Hu N, Wen J, Jiang X.
Show Full Abstract
<h4>Objectives</h4>Periodontium regeneration remains a significant challenge in clinics and research, and it is essential to understand the stage-specific biological process in situ. However, differing findings have been reported, and the mechanism has yet to be elucidated. The periodontium of adult mice molars is considered to be stable remodeling tissue. At the same time, the continuously growing incisors and the developing dental follicle (DF) of postnatal mice highly represent fast remodeling tissue. In this study, we attempted to explore different clues of temporal and spatial comparisons to provide improved references for periodontal regeneration.<h4>Methods</h4>Periodontal tissues from the developing periodontium (DeP) of postnatal mice, and continuously growing periodontium (CgP) and stable remodeling periodontium (ReP) of adult mice were isolated and compared using RNA sequencing. Based on the Dep and CgP separately compared with the ReP, differentially expressed genes and signaling pathways were analyzed using GO, KEGG databases, and Ingenuity Pathway Analysis (IPA). The results and validation were obtained by immunofluorescence staining and RT-PCR assays. Data were expressed as means ± standard deviation (SD) and analyzed by GraphPad Prism 8 software package, and one-way ANOVA was used to test multiple groups.<h4>Results</h4>Principal component analysis showed that the three groups of periodontal tissue were successfully isolated and had distinct expression profiles. A total of 792 and 612 DEGs were identified in the DeP and CgP groups compared with the ReP. Upregulated DEGs in the DeP were closely related to developmental processes, while the CgP showed significantly enhanced cellular energy metabolism. The DeP and CgP showed a common downregulation of the immune response, with activation, migration, and recruitment of immune cells. IPA and further validation jointly suggested that the MyD88/p38 MAPK pathway played an essential regulatory role in periodontium remodeling.<h4>Conclusion</h4>Tissue development, energy metabolism, and immune response were critical regulatory processes during periodontal remodeling. Developmental and adult stages of periodontal remodeling showed different expression patterns. These results contribute to a deeper understanding of periodontal development and remodeling and may provide references for periodontal regeneration.
Also flagged:cancermicropeptidesnucleotidestranscriptionalbiologychromatin
Journal Article2023-03-15No SnippetsKhan MR, Avino M, Wellinger RJ, Laurent B.
Show Full Abstract
Alternative splicing (AS) of RNA molecules is a key contributor to transcriptome diversity. In humans, 90%-95% of multi-exon genes produce alternatively spliced RNA transcripts. Therefore, every single gene has the opportunity of producing multiple splice variants, including long non-coding RNA (lncRNA) genes that undergo RNA maturation steps such as conventional and alternative splicing. Emerging evidence suggests significant roles for these lncRNA splice variants in many aspects of cell biology. Differential changes in expression of specific lncRNA splice variants have also been associated with many diseases including cancer. This review covers the current knowledge on this emerging topic of investigation. We provide exclusive insights on the AS landscape of lncRNAs and also describe at the molecular level the functional relevance of lncRNA splice variants, i.e., RNA-based differential functions, production of micropeptides, and generation of circular RNAs. Finally, we discuss exciting perspectives for this emerging field and outline the work required to further develop research endeavors in this field.
Also flagged:protein degradationcancersProteolysisubiquitinproteasomecancer
Journal Article2023-03-15No SnippetsLi J, Chen X, Lu A, Liang C.
Show Full Abstract
Targeted protein degradation (TPD) is emerging as a strategy to overcome the limitations of traditional small-molecule inhibitors. Proteolysis-targeting chimera (PROTAC) technology can be used to target proteins by hijacking the ubiquitin-proteasome system. Conceptually, PROTAC aims to target the "undruggable" majority of proteins in the human proteome. Through constant exploration and optimization of PROTACs and the exploitation of other TPD strategies over two decades, TPD has expanded from theoretical studies to clinical strategies, with practical applications in oncological, immunological, and other diseases. In this review, we introduce the mechanisms, features, and molecular targets of orthodox PROTACs and summarize the PROTAC drugs under study as cancer therapeutics in clinical trials. We also discuss PROTAC derivatives and other TPD strategies, such as lysosome-targeting chimeras, autophagy-targeting chimeras, and molecular glue strategies. Collectively, the studies summarized herein support the full potential of TPD in the biomedical industry.
Also flagged:hepatocellular carcinomalung adenocarcinomaLUADcuproptosischromosomecell cycle
Journal Article2023-03-15✓ 5 SnippetsLiu XS, Zeng J, Zhang YH, Zhang Y, Gao Y, Liu C, Pei ZJ.
In-Text Gene Mentions
Abstract)
…DARS2 is a potential reliable prognostic biomarker of LUAD.…
Abstract)
…The differential expression of DARS2 was detected by genomics and in vitro experiments, and the effect of DARS2 expression on LUAD cell activity was analyzed.…
Abstract)
…ROC curves showed that DARS2 overexpression could accurately diagnose LUAD and lead to a significant decline in the survival rates of OS, DSS, and PFI in LUAD.…
Title)
…DARS2 is a prognostic biomarker and correlated with immune infiltrates and cuproptosis in lung adenocarcinoma.…
Abstract)
…DARS2 expression is increased in LUAD patients and is closely associated with LUAD immune cell infiltration, modification of m6A, and cuproptosis.…
Show Full Abstract
Overexpression of DARS2 may enhance the progression of hepatocellular carcinoma (HCC). However, there are few extensive reports on DARS2 function in lung adenocarcinoma (LUAD). The differential expression of DARS2 was detected by genomics and in vitro experiments, and the effect of DARS2 expression on LUAD cell activity was analyzed. Functional enrichment analysis was performed to explore possible signal pathways involved in the biological functions of DARS2 and its co-expressed genes. Utilizing TIMER and GEPIA datasets, the association between DARS2 expression and immunological infiltrating cells was analyzed. At the same time, the association between DARS2 expression pattern and LUAD m6A modification and cuproptosis was examined utilizing TCGA and GEO datasets. The level of DARS2 in LUAD increased, and inhibition of DARS2 expression could significantly inhibit the proliferation of LUAD cells. ROC curves showed that DARS2 overexpression could accurately diagnose LUAD and lead to a significant decline in the survival rates of OS, DSS, and PFI in LUAD. Enrichment analysis showed that DARS2 and its co-expressed genes were closely associated with chromosome segregation and the cell cycle. TIMER and GEPIA database analysis demonstrated that the DARS2 expression pattern was adversely correlated with the infiltration of B cells and Tfh cells. TCGA and GEO dataset examination revealed that DARS2 expression was significantly linked to four m6A-related genes and one cuproptosis-related gene. DARS2 expression is increased in LUAD patients and is closely associated with LUAD immune cell infiltration, modification of m6A, and cuproptosis. DARS2 is a potential reliable prognostic biomarker of LUAD.
Also flagged:tumor necrosis factorkeloidsmethylationGene Expressionchemotaxisdendritic cell chemotaxis
Journal Article2023-03-15✓ 5 SnippetsXia Y, Wang Y, Hao Y, Shan M, Liu H, Liang Z.
In-Text Gene Mentions
Abstract)
…Mesenchymal fibroblasts expressing TNFSF4 significantly upregulated gene expression in extracellular matrix organization and wound healing processes.<h4>Conclusions</h4>Our study revealed upregulation of the immune molecule TNFSF4 in keloids at the multi-omics level and its effects on intercellular crosstalk and transcriptional profiles of mesenchymal fibroblasts.…
Abstract)
…<h4>Objectives</h4>To identify aberrantly expressed immune molecules in keloids and to explore their possible biologic significance.<h4>Methods</h4>Immune molecules with abnormal expression were identified based on immune gene sequencing of keloids, microarray datasets and high-throughput sequencing datasets and methylation microarray datasets from the Gene Expression Omnibus (GEO) database, and real-time quantitative PCR analysis.<h4>Results</h4>Upregulation of tumor necrosis factor superfamily member 4 (TNFSF4) in keloids was identified.…
Abstract)
…Investigation of TNFSF4 as an immune checkpoint molecule may represent a new direction for keloid treatment research.…
Abstract)
…superfamily member 4 (TNFSF4) in keloids was…
Abstract)
…found that highTNFSF4expression was associated…
Show Full Abstract
<h4>Objectives</h4>To identify aberrantly expressed immune molecules in keloids and to explore their possible biologic significance.<h4>Methods</h4>Immune molecules with abnormal expression were identified based on immune gene sequencing of keloids, microarray datasets and high-throughput sequencing datasets and methylation microarray datasets from the Gene Expression Omnibus (GEO) database, and real-time quantitative PCR analysis.<h4>Results</h4>Upregulation of tumor necrosis factor superfamily member 4 (TNFSF4) in keloids was identified. Enrichment analysis found that high TNFSF4 expression was associated with immune processes, such as regulation of neutrophil chemotaxis, dendritic cell chemotaxis, and antigen processing and presentation. Single-cell RNA sequencing (scRNA) results suggested that TNFSF4 was upregulated in mesenchymal fibroblasts, which are the critical cells in skin fibrosis. This high expression of TNFSF4 enhanced cell-to-cell interactions in fibrosis-related pathways, including the fibronectin 1 (FN1) and collagen pathways. Mesenchymal fibroblasts expressing TNFSF4 significantly upregulated gene expression in extracellular matrix organization and wound healing processes.<h4>Conclusions</h4>Our study revealed upregulation of the immune molecule TNFSF4 in keloids at the multi-omics level and its effects on intercellular crosstalk and transcriptional profiles of mesenchymal fibroblasts. Investigation of TNFSF4 as an immune checkpoint molecule may represent a new direction for keloid treatment research.
Also flagged:extra-hepatic portal vein thrombosisthrombophiliacoagulation disorderpropranololthrombophilic disorderportal vein thrombosis
Journal Article2023-03-15✓ 1 SnippetAbdel-Ghaffar TY, Zakaria HM, Naghi SE, Elsayed SM, Haseeb A, Sobhy GA.
In-Text Gene Mentions
Results)
…C, S andantithrombin-IIIdeficiency, 1 had…
Show Full Abstract
<h4>Aim of the study</h4>We aimed to discuss our experience in management of children with extra-hepatic portal vein thrombosis (EHPVT).<h4>Material and methods</h4>This retrospective cohort study included 62 children with EHPVT. All patients' records were reviewed. The patients' socio-demographic data, post-natal history, disease presentation and clinical examination were collected. Data from laboratory investigations - complete blood count, liver function tests, renal function tests, abdominal ultrasound/Doppler studies, upper endoscopic findings and treatment regimens - were collected whenever available.<h4>Results</h4>Of the 62 patients, 62.9% were male and 37.1% were female. The mean age at disease presentation was 3.5 ±2.7 years. The main initial clinical presentation of the disease was hematemesis and/or melena (30 cases; 48.4%). History of umbilical catheterization (UVC) was present in 60% of cases. The thrombophilia profile was assessed in 17 patients, of whom 12 (70.6%) were found to have a coagulation disorder. Splenomegaly was present in 91.7% of the patients. Hematological abnormalities in the form of cytopenias were present in most cases. Ultrasound revealed the presence of collaterals in 76.2%. Upper endoscopy showed the presence of varices in 45 cases, all of which needed endoscopic intervention, while in 11 cases the varices were either low grade or absent and thus were subjected only to medical treatment with propranolol and 6 cases were lost to follow-up. Splenectomy was done in only one case and 2 cases underwent the Rex operation.<h4>Conclusions</h4>Variceal bleeding is the most common clinical presentation of EHPVT in children. UVC is still the main etiological factor of EHPVT in our cohort especially with presence of thrombophilic disorder.
Also flagged:haemochromatosisirontransaminasesmenstruationalcoholmetabolic syndrome
Journal Article2023-03-15✓ 2 SnippetsCathcart J, Mukhopadhya A.
In-Text Gene Mentions
Text
…HFE…
Text
…HFE haemochromatosis…
Show Full Abstract
The European Association for the Study of the Liver has recently updated guidance on haemochromatosis with a more extensive discussion on investigation and management.[ The new guidance focuses on non-invasive methods for fibrosis assessment and early diagnosis to include more extensive genetic testing if needed. Early diagnosis and treatment is vital as it reduces morbidity and mortality. We review this guideline and offer key updated messages with a focus on new developments since the last guidance and key aspects of current practice.
Also flagged:cytoplasmicvesiclesextracellularmembranemultivesicular bodieslumen
Journal Article2023-03-15✓ 1 SnippetRacchetti G, Meldolesi J.
In-Text Gene Mentions
Introduction)
…its downstream effectorRas GTPase-activating-like protein 1GTPase-activating-like protein…
Show Full Abstract
In all cells, generation and release of specific vesicles are the initial steps of back-and-forth intercellular communication. These processes are critical in normal physiology and pathophysiology. Vesicles have particular functions appropriate to their targets. When stimulated, they are released into the extracellular space. Four cytoplasmic membrane-bound structures generate their particular vesicles. Among these structures, multivesicular bodies (MVBs) can accumulate many small vesicles in their lumen; release occurs upon MVB exocytosis. Ectosomes are larger vesicles characterized by their responses and are generated directly and released independently from specific microdomains pre-established in the thickness of the plasma membrane. Most lysosomes do not generate vesicles. However, unique components of a minor form, the endo-lysosome, constitute the third class of structures that release a few vesicles by exocytosis with molecules and structures inducing changes in the extracellular environment. The autophagosome, the fourth structure, releases several heterogeneous vesicles by exocytosis with malformed bio-molecules, assembled structures, and damaged organelles. Interestingly, the frequent interaction of autophagosomes with MVBs and their exosomes contributes to the regulation and intensity of their action. The specificity and function of released vesicles depend on their membranes' and luminal cargoes' composition and dynamics. An ongoing investigation of the various vesicles reveals new properties regarding their generation, release, and resulting extracellular processes. The growth of information about structures and their vesicles progressively extends the knowledge base regarding cell communication and contributes to their clinical applications.
SSRN2023-03-15Preprint (No Snippets API)Chen K, Ong W.
Show Full Abstract
In this study, we document the properties of emerging futures assets and empirically investigate their dynamic correlation among Bitcoin, carbon emission, oil, and gold futures. This study also analyzes whether Bitcoin, carbon emission, oil, and gold futures have the ability to hedge against risky assets. Overall, it is evident that the volatility of Bitcoin as well as other emerging futures’ returns exhibit an asymmetric response to good and bad news. In addition, we evaluate the hedge potential benefits of these emerging futures assets for market participants. More importantly, our analysis of portfolios’ performance show that carbon emission futures are diversification benefit products in most of the considered cases. The evidence also supports the idea that the leading cryptocurrency-Bitcoin futures can be suitable hedge instrument after COVID-19 pandemic outbreak. Crucially, these findings provide insightful information to cryptocurrency enthusiasts, investors and portfolio managers regarding optimal futures holdings, hedging, diversification, and risk aversion.
Research Square2023-03-15Preprint (No Snippets API)Yang Y, Wu T, Lu N, Huang K, Zhao Z, Li H, Du Y.
Show Full Abstract
<h4>Background: </h4> Evidence of direct-acting antiviral (DAA) treatment for refractory chronic hepatitis C (CHC) patients was limited. We aimed to evaluate the effectiveness and safety of Sofosbuvir/Velpatasvir (SOF/VEL) plus Ribavirin (RBV) in cirrhotic patients with hepatitis C virus genotype 3 (GT3) with or without HIV or HBV coinfection. <h4>Methods: </h4> From June 2019 to December 2022, CHC GT3 patients who received SOF/VEL plus RBV (dosage of RBV depended on weight) for 12 weeks were enrolled. Liver cirrhosis was diagnosed by clinical presentation . The primary endpoint was sustained virologic response at 12 weeks off-therapy (SVR12). Adverse events (AE)were assessed during treatment. <h4>Results: </h4> In total, 285 treatment-naive patients were recruited at the Kunming Third People’s Hospital. Mean age was 48.18±8.27 years-old and 74.04% (211/285) were male. All patients had GT3 HCV infection including 44 patients with GT3a and 241 patients with hepatitis C virus genotype 3b (GT3b) . Among these patients, 39 with HCV/HIV,10 with HBV/HCV, and 1 with HBV/HCV/HIV coinfection. All patients had liver cirrhosis, and 46.67% (133/285) of patients had compensated cirrhosis (CC), while 53.33% (152/285) of patients had decompensated cirrhosis (DCC). 98.95% (282/285) patients achieved SVR12 with SOF/VEL plus RBV treatment for 12 weeks, including 97.72% (43/44) in GT3a and 99.17% (239/241) in GT3b. According to the condition for 285 patients with liver cirrhosis, the SVR12 rate in the CC group was : 99.25% (132/133), the SVR12 rate in the DCC group was: 98.68% (150/152). After 12 weeks of treatment, the APRI score and FIB-4 score in CC group and DCC group were improved, and the improvement in the compensated cirrhosis group was better than that in decompensated cirrhosis group (PAPRI=0.001, PFIB-4=0.001). Mean ALT (from 74±27.23U/L to 39.31±12.22U/L, p<0.05) and AST (from 73.98±25.54U/L to 44.17±15.56U/L, p<0.05) also significantly declined after treatment.1 patient had serious AE of hemolysis but recovered after 2-3 days of interruption of RBV. Most AEs were consistent with clinical sequelae of advanced liver disease or known toxicities of RBV. <h4>Conclusion: </h4> : SOF/VEL combined with RBV for cirrhotic GT3 hepatitis C patients all obtained high SVR12 (>95%), improved liver function during treatment, and for cirrhotic GT3 hepatitis C patients treatment with SOF/VEL combined with RBV is recommended as early as possible.
Research Square2023-03-15Preprint (No Snippets API)Wang J, Liu Z, Cao D, Liu J, Li F, Han H, Han H, Lei Q, Liu W, Li D, Wang J, Zhou Y.
Show Full Abstract
<title>Abstract</title><p><bold>Background:</bold>Egg-laying rate is the trait with the highest economic weight in breeding programs for laying hens. Egg-laying rate is associated with a clutch, which is defined as consecutive days of oviposition. Clutch traits can be used to describe the individual laying pattern and has been considered as a trait for selection. However, little is known about the uniformity of clutch traits.<bold>Methods:</bold>In this study, after estimating the genetic parameters for age at first egg (afe), body weight at first egg (bwfe), longest clutch until 52 week of age (maxC), the first week when the longest clutch starts (fwlCs), the last week of longest clutch ends (lwlCe), number of clutches (numC), the longest number of days without egg-laying until 52 week of age (lndwel), we identified single nucleotide polymorphisms (SNPs) and potential candidate genes associated with clutch traits in Laiwu Black chicken (a native Chinese breed). The restricted maximum likelihood (REML)method was employed for estimation of genetic parameters of clutch pattern in 399 Laiwu Black hens, using the GCTA software.<bold>Results:</bold>The results showed that SNP-based heritability estimates of clutch traits ranged from 0.06 to 0.59. A genome-wide association study (GWAS) was performed based on a mixed linear model (MLM) implemented in the EMMAX software. Genotyping data were obtained from whole genome re-sequencing data (399 individuals were re-sequenced at 7× coverage). After quality control, a total of 10,810,544 SNPs remained to be analyzed. The GWAS results revealed that 401 significant SNPs responsible for clutch traits were scattered on chicken chromosomes 1-14, 17-19, 21-25, 28 and Z. Among the annotated genes, neural EGFL like 2 (<italic>NELL2</italic>), SET And MYND domain containing 3 (<italic>SMYD3</italic>), and phospholipase D1 (<italic>PLCL1</italic>)were the most promising candidates for clutch traits in Laiwu Black chicken.<bold>Conclusion:</bold>The clutch traits showed moderate to high heritability, and the GWAS results identified an array of genes associated with the clutch traits. The findings of this study provide critical insight into the genetic basis of clutch traits.</p>
Research Square2023-03-15Preprint (No Snippets API)shihao g, Lian W, Bai Y, Wang L, Zhao F, Li H, Wang D, Pang Q.
Show Full Abstract
<title>Abstract</title><p>Background Andrographolide is a diterpenoid derived from Andrographis paniculate, which has anti-inflammatory, antibacterial, antiviral and hepatoprotective activities. Gram-negative bacterial infections can cause varying degrees of liver injury in chickens, although andrographolide has been shown to have a protective effect on the liver, its underlying mechanism of action and effects on liver proteins are not known. Methods The toxicity of andrographolide on the viability of LMH cells at different concentrations and times was analyzed by CCK-8 assays. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in the culture supernatants were measured using an automatic biochemical analyzer to evaluate the protective effect of androscopolide on LPS-induced injury of LMH cells. Subsequently, TMT proteomics analysis were performed on the NC, LPS, and LPS-Andro groups, and bioinformatics analysis was performed on the differentially expressed proteins (DEPs). Results It was found that andrographolide reduced ALT and AST levels in the cell supernatant and alleviated LPS-induced injury in LMH cells. Proteomic analysis identified 50 and 166 differentially expressed proteins in the LPS vs NC group and LPS-Andro vs LPS group, respectively. Andrographolide may be involved in steroid metabolic processes, negative regulation of MAPK cascade, oxidative stress, and other processes to protect against LPS-induced liver injury. Conclusions Andrographolide protects against LPS-induced liver injury, HMGCS1, HMGCR, FDPS, PBK, CAV1, PRDX1, PRDX4, and PRDX6, which were identified by differential proteomics, may be the targets of andrographolide. Our study may provide new theoretical support for andrographolide protection against liver injury.</p>
The regenerative capacity of the mammalian heart is poor, with one potential reason being that adult cardiomyocytes cannot proliferate at sufficient levels to replace lost tissue. During development and neonatal stages, cardiomyocytes can successfully divide under injury conditions; however, as these cells mature their ability to proliferate is lost. Therefore, understanding the regulatory programs that can induce post-mitotic cardiomyocytes into a proliferative state is essential to enhance cardiac regeneration. Here, we report that the forkhead transcription factor Foxm1 is required for cardiomyocyte proliferation after injury through transcriptional regulation of cell cycle genes. Transcriptomic analysis of injured zebrafish hearts revealed that foxm1 expression is increased in border zone cardiomyocytes. Decreased cardiomyocyte proliferation and expression of cell cycle genes in foxm1 mutant hearts was observed, suggesting it is required for cell cycle checkpoints. Subsequent analysis of a candidate Foxm1 target gene, cenpf, revealed that this microtubule and kinetochore binding protein is also required for cardiac regeneration. Moreover, cenpf mutants show increased cardiomyocyte binucleation. Thus, foxm1 and cenpf are required for cardiomyocytes to complete mitosis during zebrafish cardiac regeneration.
Also flagged:MFN2calciumlung adenocarcinomatransmembrane GTPasemitochondrialmitochondria
Journal Article2023-03-14✓ 2 SnippetsZhang J, Pan L, Zhang Q, Zhao Y, Wang W, Lin N, Zhang S, Wu Q.
In-Text Gene Mentions
Discussion)
…have reported thatCACNA1Eis a functional…
Discussion)
…calcium concentration viaCACNA1Eor other calcium…
Show Full Abstract
Mitofusin-2 (MFN2) is a transmembrane GTPase that regulates mitochondrial fusion and thereby modulates mitochondrial function. However, the role of MFN2 in lung adenocarcinoma remains controversial. Here, we investigated the effect of MFN2 regulation on mitochondria in lung adenocarcinoma. We found that MFN2 deficiency resulted in decreased UCP4 expression and mitochondrial dysfunction in A549 and H1975 cells. UCP4 overexpression restored ATP and intracellular calcium concentration, but not mtDNA copy number, mitochondrial membrane potential or reactive oxygen species level. Furthermore, mass spectrometry analysis identified 460 overlapping proteins after independent overexpression of MFN2 and UCP4; these proteins were significantly enriched in the cytoskeleton, energy production, and calponin homology (CH) domains. Moreover, the calcium signaling pathway was confirmed to be enriched in KEGG pathway analysis. We also found by protein-protein interaction network analysis that PINK1 may be a key regulator of MFN2- and UCP4-mediated calcium homeostasis. Furthermore, PINK1 increased MFN2/UCP4-mediated intracellular Ca<sup>2+</sup> concentration in A549 and H1975 cells. Finally, we demonstrated that low expression levels of MFN2 and UCP4 in lung adenocarcinoma are associated with poor clinical prognosis. In conclusion, our data suggest not only a potential role of MFN2 and UCP4 in co-regulating calcium homeostasis in lung adenocarcinoma but also their potential use as therapeutic targets in lung cancer.
Also flagged:neurodegenerative diseaseHDsynapseszinc finger repressor proteinacetylcholinecognition
Journal Article2023-03-14✓ 5 SnippetsPancani T, Day M, Tkatch T, Wokosin DL, González-Rodríguez P, Kondapalli J, Xie Z, Chen Y, Beaumont V, Surmeier DJ.
In-Text Gene Mentions
Methods)
…PCR analysis ofHttmRNA expression…
Methods)
…Mut and wild-typeHtt_rv*: TTCACACGGTCTTTCTTGGTGG (…
Methods)
…(*wild-type and mutantHttshare the same…
Results)
…11 , wild-typeHttmRNA abundance was…
Results)
…mHtt or wild-typeHttcontralateral to the…
Show Full Abstract
Huntington's disease (HD) is a progressive, neurodegenerative disease caused by a CAG triplet expansion in huntingtin. Although corticostriatal dysfunction has long been implicated in HD, the determinants and pathway specificity of this pathophysiology are not fully understood. Here, using a male zQ175<sup>+/-</sup> knock-in mouse model of HD we carry out optogenetic interrogation of intratelencephalic and pyramidal tract synapses with principal striatal spiny projection neurons (SPNs). These studies reveal that the connectivity of intratelencephalic, but not pyramidal tract, neurons with direct and indirect pathway SPNs increased in early symptomatic zQ175<sup>+/-</sup> HD mice. This enhancement was attributable to reduced pre-synaptic inhibitory control of intratelencephalic terminals by striatal cholinergic interneurons. Lowering mutant huntingtin selectively in striatal cholinergic interneurons with a virally-delivered zinc finger repressor protein normalized striatal acetylcholine release and intratelencephalic functional connectivity, revealing a node in the network underlying corticostriatal pathophysiology in a HD mouse model.
Also flagged:carboxylic acidsDecarboxylation-phenylpropanoic acidcarboxylatecarbanionnucleoside triphosphates
Journal Article2023-03-14No SnippetsDel Giudice D, Di Stefano S.
Show Full Abstract
ConspectusThe achievement of artificial systems capable of being maintained in out-of-equilibrium states featuring functional properties is a main goal of current chemical research. Absorption of electromagnetic radiation or consumption of a chemical species (a "chemical fuel") are the two strategies typically employed to reach such out-of-equilibrium states, which have to persist as long as one of the above stimuli is present. For this reason such systems are often referred to as "dissipative systems". In the simplest scheme, the dissipative system is initially found in a resting, equilibrium state. The addition of a chemical fuel causes the system to shift to an out-of-equilibrium state. When the fuel is exhausted, the system reverts to the initial, equilibrium state. Thus, from a mechanistic standpoint, the dissipative system turns out to be a catalyst for the fuel consumption. It has to be noted that, although very simple, this scheme implies the chance to temporally control the dissipative system. In principle, modulating the nature and/or the amount of the chemical fuel added, one can have full control of the time spent by the system in the out-of-equilibrium state.In 2016, we found that 2-cyano-2-phenylpropanoic acid (<b>1a</b>), whose decarboxylation proceeds smoothly under mild basic conditions, could be used as a chemical fuel to drive the back and forth motion of a catenane-based molecular switch. The acid donates a proton to the catenane that passes from the neutral state A to the transient protonated state B. Decarboxylation of the resulting carboxylate (<b>1a</b>cb), generates a carbanion, which, being a strong base, retakes the proton from the protonated catenane that, consequently, returns to the initial state A. The larger the amount of the added fuel, the longer the time spent by the catenane in the transient, out-of-equilibrium state. Since then, acid <b>1a</b> and other activated carboxylic acids (ACAs) have been used to drive the operation of a large number of dissipative systems based on the acid-base reaction, from molecular machines to host-guest systems, from catalysts to smart materials, and so on. This Account illustrates such systems with the purpose to show the wide applicability of ACAs as chemical fuels. This generality is due to the simplicity of the idea underlying the operation principle of ACAs, which always translates into simple experimental requirements.
Also flagged:myeloid sarcomaextramedullary tumorMStumorRUNX1RUNX1T1
Journal Article2023-03-14✓ 5 SnippetsYang Y, Shu Y, Tang Y, Zhao S, Jia Y, Jia Y, Ji J, Ma H, Lin T, Zheng K, Xu H, Wu Y.
In-Text Gene Mentions
Results)
…Five identified fusions were previously reported as recurrent fusion genes in AML, including the common fusion genes RUNX1‐RUNX1T1 and CBFβ‐MYH11, as well as the rare fusion genes ETV6‐MECOM, FUS‐ERG, and PICALM‐MLLT10.19…
<h4>Background</h4>Myeloid sarcoma (MS) is a rare, extramedullary tumor consisting of myeloid blasts. Little is known about the genetic background of MS and the prognostic value of genetic abnormalities in MS. In particular, the broad variety of gene fusions that occur in MS is marginally covered by traditional testing methods due to lack of fresh tumor specimens.<h4>Methods</h4>Here, we analyzed the clinical and genetic features of 61 MS cases. We performed RNA sequencing (RNA-seq) on formalin-fixed paraffin-embedded (FFPE) or fresh samples to analyze fusion genes in 26 cases. In addition, we performed genetic abnormalities-based risk stratification using fusion genes and gene mutations.<h4>Results</h4>A total of 305 fusion genes were identified in 22 cases, including the following five recurrent fusion genes: RUNX1-RUNX1T1, CBFβ-MYH11, ETV6-MECOM, FUS-ERG, and PICALM-MLLT10. The prognosis in the adverse-risk group was significantly worse than that in the favorable/intermediate-risk group (median survival: 12 months vs. not reached; p = 0.0004).<h4>Conclusion</h4>These results indicated the efficacy of RNA-seq using FFPE-derived RNA as a clinical routine for detecting fusion genes, which can be used as markers for risk stratification in MS.
Also flagged:chromosomesmitosischromatinchromosomehistone chaperoneASF1
Journal Article2023-03-14✓ 2 SnippetsSun M, Amiri H, Tong AB, Shintomi K, Hirano T, Bustamante C, Heald R.
In-Text Gene Mentions
Abstract)
…of core histones,linker histoneshistones, or condensins…
Discussion)
…significantly from somaticlinker histoneshistones since its…
Show Full Abstract
DNA compaction is required for the condensation and resolution of chromosomes during mitosis, but the relative contribution of individual chromatin factors to this process is poorly understood. We developed a physiological, cell-free system using high-speed <i>Xenopus</i> egg extracts and optical tweezers to investigate real-time mitotic chromatin fiber formation and force-induced disassembly on single DNA molecules. Compared to interphase extract, which compacted DNA by ~60%, metaphase extract reduced DNA length by over 90%, reflecting differences in whole-chromosome morphology under these two conditions. Depletion of the core histone chaperone ASF1, which inhibits nucleosome assembly, decreased the final degree of metaphase fiber compaction by 29%, while depletion of linker histone H1 had a greater effect, reducing total compaction by 40%. Compared to controls, both depletions reduced the rate of compaction, led to more short periods of decompaction, and increased the speed of force-induced fiber disassembly. In contrast, depletion of condensin from metaphase extract strongly inhibited fiber assembly, resulting in transient compaction events that were rapidly reversed under high force. Altogether, these findings support a speculative model in which condensin plays the predominant role in mitotic DNA compaction, while core and linker histones act to reduce slippage during loop extrusion and modulate the degree of DNA compaction.
Also flagged:HDHuntington's diseaseorganizationmyelinnucleusatrophy
Journal Article2023-03-14No SnippetsEstevez-Fraga C, Elmalem MS, Papoutsi M, Durr A, Rees EM, Hobbs NZ, Roos RAC, Landwehrmeyer B, Leavitt BR, Langbehn DR, Scahill RI, Rees G, Tabrizi SJ, Gregory S.
Show Full Abstract
<h4>Background</h4>Whole-brain longitudinal diffusion studies are crucial to examine changes in structural connectivity in neurodegeneration. Here, we investigated the longitudinal alterations in white matter (WM) microstructure across the timecourse of Huntington's disease (HD).<h4>Methods</h4>We examined changes in WM microstructure from premanifest to early manifest disease, using data from two cohorts with different disease burden. The TrackOn-HD study included 67 controls, 67 premanifest, and 10 early manifest HD (baseline and 24-month data); the PADDINGTON study included 33 controls and 49 early manifest HD (baseline and 15-month data). Longitudinal changes in fractional anisotropy (FA), mean diffusivity (MD), axial diffusivity, and radial diffusivity from baseline to last study visit were investigated for each cohort using tract-based spatial statistics. An optimized pipeline was employed to generate participant-specific templates to which diffusion tensor imaging maps were registered and change maps were calculated. We examined longitudinal differences between HD expansion-carriers and controls, and correlations with clinical scores, including the composite UHDRS (cUHDRS).<h4>Results</h4>HD expansion-carriers from TrackOn-HD, with lower disease burden, showed a significant longitudinal decline in FA in the left superior longitudinal fasciculus and an increase in MD across subcortical WM tracts compared to controls, while in manifest HD participants from PADDINGTON, there were significant widespread longitudinal increases in diffusivity compared to controls. Baseline scores in clinical scales including the cUHDRS predicted WM microstructural change in HD expansion-carriers.<h4>Conclusion</h4>The present study showed significant longitudinal changes in WM microstructure across the HD timecourse. Changes were evident in larger WM areas and across more metrics as the disease advanced, suggesting a progressive alteration of WM microstructure with disease evolution.
Also flagged:soft tissue sarcomatumorWNTPI3KAKTEPS8L2
Journal Article2023-03-14✓ 2 SnippetsXu N, Yu Y, Duan C, Wei J, Sun W, Jiang C, Jian B, Cao W, Jia L, Ma X.
In-Text Gene Mentions
Results)
…Of note, seventeen of thirty-nine proteins are reported as urine biomarkers in different diseases, of which eight proteins (PEBP1, EPS8L2, SERPINA1, FGA, SPINT1, CD55, SPARC, and GINM1) are related to neoplastic disease in urine specimens (Additional file 7: Table S7).…
<h4>Background</h4>Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma with poor prognosis in children. The 5-year survival rate for early RMS has improved, whereas it remains unsatisfactory for advanced patients. Urine can rapidly reflect changes in the body and identify low-abundance proteins. Early screening of tumor markers through urine in RMS allows for earlier treatment, which is associated with better outcomes.<h4>Methods</h4>RMS patients under 18 years old, including those newly diagnosed and after surgery, were enrolled. Urine samples were collected at the time points of admission and after four cycles of chemotherapy during follow-up. Then, a two-stage workflow was established. (1) In the discovery stage, differential proteins (DPs) were initially identified in 43 RMS patients and 12 healthy controls (HCs) using a data-independent acquisition method. (2) In the verification stage, DPs were further verified as biomarkers in 54 RMS patients and 25 HCs using parallel reaction monitoring analysis. Furthermore, a receiver operating characteristic (ROC) curve was used to construct the protein panels for the diagnosis of RMS. Gene Ontology (GO) and Ingenuity Pathway Analysis (IPA) software were used to perform bioinformatics analysis.<h4>Results</h4>A total of 251 proteins were significantly altered in the discovery stage, most of which were enriched in the head, neck and urogenital tract, consistent with the most common sites of RMS. The most overrepresented biological processes from GO analysis included immunity, inflammation, tumor invasion and neuronal damage. Pathways engaging the identified proteins revealed 33 common pathways, including WNT/β-catenin signaling and PI3K/AKT signaling. Finally, 39 proteins were confirmed as urinary biomarkers for RMS, and a diagnostic panel composed of 5 candidate proteins (EPS8L2, SPARC, HLA-DRB1, ACAN, and CILP) was constructed for the early screening of RMS (AUC: 0.79, 95%CI = 0.66 ~ 0.92).<h4>Conclusions</h4>These findings provide novel biomarkers in urine that are easy to translate into clinical diagnosis of RMS and illustrate the value of global and targeted urine proteomics to identify and qualify candidate biomarkers for noninvasive molecular diagnosis.
Also flagged:waterphosphorusdetoxificationaromatic amino acidterpenemetabolism
Journal Article2023-03-14No SnippetsFaist H, Trognitz F, Antonielli L, Symanczik S, White PJ, Sessitsch A.
Show Full Abstract
<h4>Background</h4>Due to climate change and reduced use of fertilizers combined stress scenarios are becoming increasingly frequent in crop production. In a field experiment we tested the effect of combined water and phosphorus limitation on the growth performance and plant traits of eight tetraploid and two diploid potato varieties as well as on root-associated microbiome diversity and functional potential. Microbiome and metagenome analysis targeted the diversity and potential functions of prokaryotes, fungi, plasmids, and bacteriophages and was linked to plant traits like tuber yield or timing of canopy closure.<h4>Results</h4>The different potato genotypes responded differently to the combined stress and hosted distinct microbiota in the rhizosphere and the root endosphere. Proximity to the root, stress and potato genotype had significant effects on bacteria, whereas fungi were only mildly affected. To address the involvement of microbial functions, we investigated well and poorly performing potato genotypes (Stirling and Desirée, respectively) under stress conditions and executed a metagenome analysis of rhizosphere microbiomes subjected to stress and no stress conditions. Functions like ROS detoxification, aromatic amino acid and terpene metabolism were enriched and in synchrony with the metabolism of stressed plants. In Desirée, Pseudonocardiales had the genetic potential to take up assimilates produced in the fast-growing canopy and to reduce plant stress-sensing by degrading ethylene, but overall yield losses were high. In Stirling, Xanthomonadales had the genetic potential to reduce oxidative stress and to produce biofilms, potentially around roots. Biofilm formation could be involved in drought resilience and nutrient accessibility of Stirling and explain the recorded low yield losses. In the rhizosphere exposed to combined stress, the relative abundance of plasmids was reduced, and the diversity of phages was enriched. Moreover, mobile elements like plasmids and phages were affected by combined stresses in a genotype-specific manner.<h4>Conclusion</h4>Our study gives new insights into the interconnectedness of root-associated microbiota and plant stress responses in the field. Functional genes in the metagenome, phylogenetic composition and mobile elements play a role in potato stress adaption. In a poor and a well performing potato genotype grown under stress conditions, distinct functional genes pinpoint to a distinct stress sensing, water availability and compounds in the rhizospheres.
Also flagged:SHCBP1cancerSHC SH2 domain-binding protein 1cancerstumorstumor
Journal Article2023-03-14✓ 2 SnippetsJiang F, Shi Y, Wang Y, Ge C, Zhu J, Fang H, Zhang Y, Zhang Y, Jian H, Lei T, Lan S, Cao L, Yu H, Fang D.
In-Text Gene Mentions
Results)
…CD276, VEGFA, TNFRSF9, TNFSF4, and HMGB1 play important immune roles in various tumors (Figure 5A).…
Results)
…CD276, VEGFA, TNFRSF9,TNFSF4, and HMGB1 play…
Show Full Abstract
<h4>Background</h4>Previous studies have revealed the significant roles of SHC SH2 domain-binding protein 1 (SHCBP1) in occurrence and progression of cancers, but there is no pan-cancer analysis of SHCBP1.<h4>Methods</h4>In this study, we explored the potential carcinogenic role of SHCBP1 across 33 tumors from the TCGA and GTEx databases. We investigated SHCBP1 expression, prognosis, genetic alterations, tumor mutational burden (TMB) score, microsatellite instability (MSI) and tumor microenvironment from TIMER2, GEPIA2, UALCAN and cBioPortal databases. Moreover, the cellular functions and potential mechanisms were evaluated by GO and KEGG analysis. Besides, the mRNA expression of SHCBP1 was examined using qRT-PCR assay in gastrointestinal cancers.<h4>Results</h4>SHCBP1 was significantly upregulated in various cancers, and apparent relationship existed between SHCBP1 and survival prognosis in patients. The TMB, MSI, and tumor microenvironment analysis indicated that SHCBP1 was closely related to immune checkpoints, immune targets, as well as CD4+ naive T cell, CD8+ T cell, and neutrophil. Moreover, the cellular functions of SHCBP1 were mainly in regulating cell cycle motor protein activity. In addition, we validated that SHCBP1 mRNA expression was over-expressed in gastrointestinal cancers.<h4>Conclusions</h4>This study was the first to systematically determine the prognostic value of SHCBP1, providing a forward-looking perspective on immunotherapy and cellular processes in pan-cancer.
Also flagged:type II interferonSTATSTAT1innate immunitystructural proteinVP3
Journal Article2023-03-14✓ 1 SnippetWu X, Chen L, Sui C, Hu Y, Jiang D, Yang F, Miller LC, Li J, Cong X, Hrabchenko N, Lee C, Du Y, Qi J.
In-Text Gene Mentions
Introduction)
…3C pro degradedPRDX6through its proteolytic…
Show Full Abstract
Foot-and-mouth disease virus (FMDV) has developed various strategies to antagonize the host innate immunity. FMDV L<sup>pro</sup> and 3C<sup>pro</sup> interfere with type I IFNs through different mechanisms. The structural protein VP3 of FMDV degrades Janus kinase 1 to suppress IFN-γ signaling transduction. Whether non-structural proteins of FMDV are involved in restraining type II IFN signaling pathways is unknown. In this study, it was shown that FMDV replication was resistant to IFN-γ treatment after the infection was established and FMDV inhibited type II IFN induced expression of IFN-γ-stimulated genes (ISGs). We also showed for the first time that FMDV non-structural protein 3C antagonized IFN-γ-stimulated JAK-STAT signaling pathway by blocking STAT1 nuclear translocation. 3C<sup>pro</sup> expression significantly reduced the ISGs transcript levels and palindromic gamma-activated sequences (GAS) promoter activity, without affecting the protein level, tyrosine phosphorylation, and homodimerization of STAT1. Finally, we provided evidence that 3C protease activity played an essential role in degrading KPNA1 and thus inhibited ISGs mRNA and GAS promoter activities. Our results reveal a novel mechanism by which an FMDV non-structural protein antagonizes host type II IFN signaling.
Also flagged:cognitionCognitive impairmentschizophreniasynapticcognitive impairmentstranslational
Journal Article2023-03-14No SnippetsSantarriaga S, Gerlovin K, Layadi Y, Karmacharya R.
Show Full Abstract
Cognitive impairment is the strongest predictor of functional outcomes in schizophrenia and is hypothesized to result from synaptic dysfunction. However, targeting synaptic plasticity and cognitive deficits in patients remains a significant clinical challenge. A comprehensive understanding of synaptic plasticity and the molecular basis of learning and memory in a disease context can provide specific targets for the development of novel therapeutics targeting cognitive impairments in schizophrenia. Here, we describe the role of synaptic plasticity in cognition, summarize evidence for synaptic dysfunction in schizophrenia and demonstrate the use of patient derived induced-pluripotent stem cells for studying synaptic plasticity in vitro. Lastly, we discuss current advances and future technologies for bridging basic science research of synaptic dysfunction with clinical and translational research that can be used to predict treatment response and develop novel therapeutics.
Also flagged:lactatehypoglycemiasepticemiapolycythemiahyperbilirubinemiaanemia
Journal Article2023-03-14✓ 2 SnippetsYan J, Ren JD, Zhang J, Li J, Zhang X, Ma Y, Gao L.
In-Text Gene Mentions
I A O 0000615)
…Although the incidence of respiratory distress between the two groups of subjects in this study had no statistical difference, the absolute value of BE and the level of lactic acid in the peripheral arterial blood gas in DCC group were significantly lower than those in ECC group, and HCO3 was significantly higher than those in ECC group.…
Discussion)
…A previous study30 revealed that a DCC group had a higher mean peak hematocrit value and polycythemia incidence than an ECC group, and no significant difference in the peak bilirubin level between the two groups was reported.…
Show Full Abstract
<h4>Objective</h4>To explore the effect of delayed cord clamping on preterm infants.<h4>Methods</h4>A retrospective analysis was conducted using the clinical data of 163 preterm infants with a gestational age of 34-36 weeks + 6 who were admitted to the neonatology department within 2 hours after birth. The blood routine examination indices within 2 hours and at 3-5 days after birth, the biochemical indices and arterial blood gas (ABG) indices within 2 hours after birth, and the hemoglobin level 5-6 months after birth were compared between the early cord clamping (ECC) group and the delayed cord clamping (DCC) group.<h4>Results</h4>Compared with the ECC group, the DCC group had significantly higher venous blood levels of red blood cells, hemoglobin, and hematocrit within 2 hours and at 3-5 days after birth. The ABG bicarbonate (HCO<sub>3</sub>) level within 2 hours after birth was obviously higher in the DCC group than in the ECC group, and the ABG absolute base excess(BE) and lactate levels were lower in the DCC group than in the ECC group (<i>P</i> < 0.05). There was no significant difference between the two groups in the incidence of hypothermia, hypoglycemia, respiratory distress, septicemia, feeding intolerance, polycythemia, and hyperbilirubinemia requiring phototherapy during hospitalization (<i>P</i> > 0.05). Compared with the ECC group, the DCC group had a significantly higher venous blood hemoglobin level 5-6 months after birth. The incidence of anemia in the DCC group was significantly lower than in the ECC group (<i>P</i> < 0.05).<h4>Conclusion</h4>Delayed cord clamping can significantly increase the hemoglobin levels of preterm infants at birth and at 5-6 months after birth and can improve the oxygen circulation supply to the organs of such infants. Therefore, delayed cord clamping can improve the prognosis of preterm infants.
Also flagged:SynthesisPolyamideOligonucleotidepolyamidesaminoguanine
Journal Article2023-03-14No SnippetsKamaike K, Sano M, Sakata D, Nishihara Y, Amino H, Ohtsuki A, Okada Y, Miyakawa T, Kogawara M, Tsutsumi M, Takahashi M, Kawashima E, Ota K, Miyaoka H.
Show Full Abstract
MGB polyamide-oligonucleotide conjugates <b>ON 1</b>-<b>4</b> with linked MGB polyamides at the 2-exocyclic amino group of a guanine base using aminoalkyl linkers were synthesized and evaluated in terms of binding affinity for complementary DNA containing the MGB polyamide binding sequence using <i>T</i> <sub>m</sub> and CD analyses. The MGB polyamides comprised pyrrole polyamides (Py<sub>4</sub>- and Py<sub>3</sub>-), which possess binding affinity for A-T base pairs, and imidazole (Im<sub>3</sub>-) and pyrrole-<i>γ</i>-imidazole (Py<sub>3</sub>-<i>γ</i>-Im<sub>3</sub>-) polyamide hairpin motifs, which possess binding affinity for C-G base pairs. It was found that the stability of modified dsDNA was greatly influenced by the linker length. Py<sub>4</sub>- and Py<sub>3</sub>-oligonucleotide conjugates (<b>ON 1</b> (<i>n</i> = 4) and <b>ON 2</b> (<i>n</i> = 4)) containing the 4-aminobutyl linker formed stable dsDNA with complementary DNA. Although Im<sub>3</sub>-oligonucleotide conjugate <b>ON 3</b> (<i>n</i> = 4) containing the 4-aminobutyl linker formed stable dsDNA with complementary DNA, stabilization of dsDNA by the imidazole amide moiety of <b>ON 3</b> (<i>n</i> = 4) was lower compared with the pyrrole amide moiety of <b>ON 2</b> (<i>n</i> = 4). The Py<sub>3</sub>-<i>γ</i>-Im<sub>3</sub>-oligonucleotide conjugate <b>ON 4</b> (<i>n</i> = 2), which possesses binding affinity for C-G base pairs via a pyrrole/imidazole combination and contains a 2-aminoethyl linker, showed high binding ability for complementary DNA. Furthermore, the DNA sequence recognition of MGB polyamide-oligonucleotide conjugates was investigated using single-base mismatch DNAs, which possess a mismatch base in the MGB polyamide binding sequence. The Py<sub>3</sub>-<i>γ</i>-Im<sub>3</sub>-oligonucleotide conjugate <b>ON 4</b> (<i>n</i> = 2) showed high sequence recognition ability for complementary DNA.
Also flagged:NG2Multiple SclerosisNerve glial antigen 2MSdemyelinating disease of the central nervous systemmetalloproteases
Journal Article2023-03-14No SnippetsFerrara G.
Show Full Abstract
On behalf of the BraYn Association Ets, we are pleased to present the Abstracts of the Fifth Brainstorming Research Assembly for Young Neuroscientists, which was held in Rome, Italy from 28-30 September 2022. We congratulate all the presenters on their research work and contribution.
Also flagged:Hydroxyapatitecalcium phosphatefluorapatiteFAPdegradationbone resorption
Journal Article2023-03-14No SnippetsKazimierczak P, Wessely-Szponder J, Palka K, Barylyak A, Zinchenko V, Przekora A.
Show Full Abstract
Hydroxyapatite (HAP) is the most common calcium phosphate ceramic that is used in biomedical applications, e.g., as an inorganic component of bone scaffolds. Nevertheless, fluorapatite (FAP) has gained great attention in the area of bone tissue engineering in recent times. The aim of this study was a comprehensive comparative evaluation of the biomedical potential of fabricated HAP- and FAP-based bone scaffolds, to assess which bioceramic is better for regenerative medicine applications. It was demonstrated that both biomaterials had a macroporous microstructure, with interconnected porosity, and were prone to slow and gradual degradation in a physiological environment and in acidified conditions mimicking the osteoclast-mediated bone resorption process. Surprisingly, FAP-based biomaterial revealed a significantly higher degree of biodegradation than biomaterial containing HAP, which indicated its higher bioabsorbability. Importantly, the biomaterials showed a similar level of biocompatibility and osteoconductivity regardless of the bioceramic type. Both scaffolds had the ability to induce apatite formation on their surfaces, proving their bioactive property, that is crucial for good implant osseointegration. In turn, performed biological experiments showed that tested bone scaffolds were non-toxic and their surfaces promoted cell proliferation and osteogenic differentiation. Moreover, the biomaterials did not exert a stimulatory effect on immune cells, since they did not generate excessive amounts of reactive oxygen species (ROS) and reactive nitrogen species (RNS), indicating a low risk of inflammatory response after implantation. In conclusion, based on the obtained results, both FAP- and HAP-based scaffolds have an appropriate microstructure and high biocompatibility, being promising biomaterials for bone regeneration applications. However, FAP-based biomaterial has higher bioabsorbability than the HAP-based scaffold, which is a very important property from the clinical point of view, because it enables a progressive replacement of the bone scaffold with newly formed bone tissue.
Also flagged:mTORMAPKWntbeta-catenintranscription factorsCIN
Journal Article2023-03-14✓ 2 SnippetsPai EL, Stafford AM, Vogt D.
In-Text Gene Mentions
S I O 001029)
…The MGE is the most studied region, with TFs such as Sox6, Mafb/cMaf, and Satb1 genetically downstream of Lhx6 that specify distinct aspects of CIN development (Zhao et al., 2008; Azim et al., 2009; Batista-Brito et al., 2009; Close et al., 2012; Denaxa et al., 2012; Vogt et al., 2014; Pai et al., 2019, 2020).…
Introduction)
…TFs such asSox6, Mafb/cMaf ,…
Show Full Abstract
The development and maturation of cortical GABAergic interneurons has been extensively studied, with much focus on nuclear regulation <i>via</i> transcription factors. While these seminal events are critical for the establishment of interneuron developmental milestones, recent studies on cellular signaling cascades have begun to elucidate some potential contributions of cell signaling during development. Here, we review studies underlying three broad signaling families, mTOR, MAPK, and Wnt/beta-catenin in cortical interneuron development. Notably, each pathway harbors signaling factors that regulate a breadth of interneuron developmental milestones and properties. Together, these events may work in conjunction with transcriptional mechanisms and other events to direct the complex diversity that emerges during cortical interneuron development and maturation.
Also flagged:angiogenesiscancerlung adenocarcinomaLUADGene ExpressionLINC00857
Journal Article2023-03-14✓ 1 SnippetGong Q, Huang X, Chen X, Zhang L, Zhou C, Li S, Song T, Zhuang L.
In-Text Gene Mentions
Results)
…CD40LG, TNFSF15, andTNFSF4et al. (…
Show Full Abstract
<b>Background:</b> There is increasing evidence that long non-coding RNAs (lncRNAs) can be used as potential prognostic factors for cancer. This study aimed to develop a prognostic model for lung adenocarcinoma (LUAD) using angiogenesis-related long non-coding RNAs (lncRNAs) as potential prognostic factors. <b>Methods:</b> Transcriptome data from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) were analyzed to identify aberrantly expressed angiogenesis-related lncRNAs in LUAD. A prognostic signature was constructed using differential expression analysis, overlap analysis, Pearson correlation analysis, and Cox regression analysis. The model's validity was assessed using K-M and ROC curves, and independent external validation was performed in the GSE30219 dataset. Prognostic lncRNA-microRNA (miRNA)-messenger RNA (mRNA) competing endogenous RNA (ceRNA) networks were identified. Immune cell infiltration and mutational characteristics were also analyzed. The expression of four human angiogenesis-associated lncRNAs was quantified using quantitative real-time PCR (qRT-PCR) gene arrays. <b>Results:</b> A total of 26 aberrantly expressed angiogenesis-related lncRNAs in LUAD were identified, and a Cox risk model based on LINC00857, RBPMS-AS1, SYNPR-AS1, and LINC00460 was constructed, which may be an independent prognostic predictor for LUAD. The low-risk group had a significant better prognosis and was associated with a higher abundance of resting immune cells and a lower expression of immune checkpoint molecules. Moreover, 105 ceRNA mechanisms were predicted based on the four prognostic lncRNAs. qRT-PCR results showed that LINC00857, SYNPR-AS1, and LINC00460 were significantly highly expressed in tumor tissues, while RBPMS-AS1 was highly expressed in paracancerous tissues. <b>Conclusion:</b> The four angiogenesis-related lncRNAs identified in this study could serve as a promising prognostic biomarker for LUAD patients.
Also flagged:liver diseasesFerroptosisdeathironlipidLiver disease
Journal Article2023-03-14No SnippetsXiang X, Gao J, Su D, Shi D.
Show Full Abstract
Ferroptosis is a type of regulated cell death caused by iron overload and lipid peroxidation, and its core is an imbalance of redox reactions. Recent studies showed that ferroptosis played a dual role in liver diseases, that was, as a therapeutic target and a pathogenic factor. Therefore, herein, we summarized the role of ferroptosis in liver diseases, reviewed the part of available targets, such as drugs, small molecules, and nanomaterials, that acted on ferroptosis in liver diseases, and discussed the current challenges and prospects.
Also flagged:Myocardial infarctionMIcardiovascular diseasedeathbasic fibroblast growth factorbFGF
Journal Article2023-03-14No SnippetsGhamkhari A, Tafti HA, Rabbani S, Ghorbani M, Ghiass MA, Akbarzadeh F, Abbasi F.
Show Full Abstract
Myocardial infarction (MI) is known as a main cardiovascular disease that leads to extensive cell death by destroying vasculature in the affected cardiac muscle. The development of ultrasound-mediated microbubble destruction has inspired extensive interest in myocardial infarction therapeutics, targeted delivery of drugs, and biomedical imaging. In this work, we describe a novel therapeutic ultrasound system for the targeted delivery of biocompatible microstructures containing basic fibroblast growth factor (bFGF) to the MI region. The microspheres were fabricated using poly(lactic-<i>co</i>-glycolic acid)-heparin-polyethylene glycol- cyclic arginine-glycine-aspartate-platelet (PLGA-HP-PEG-cRGD-platelet). The micrometer-sized core-shell particles consisting of a perfluorohexane (PFH)-core and a PLGA-HP-PEG-cRGD-platelet-shell were prepared using microfluidics. These particles responded adequately to ultrasound irradiation by triggering the vaporization and phase transition of PFH from liquid to gas in order to achieve microbubbles. Ultrasound imaging, encapsulation efficiency cytotoxicity, and cellular uptake of bFGF-MSs were evaluated using human umbilical vein endothelial cells (HUVECs) <i>in vitro</i>. <i>In vivo</i> imaging demonstrated effective accumulation of platelet- microspheres injected into the ischemic myocardium region. The results revealed the potential use of bFGF-loaded microbubbles as a noninvasive and effective carrier for MI therapy.
Also flagged:Down Syndromechromosomegene expressionwaterPde6bfertilization
Journal Article2023-03-14No SnippetsGuedj F, Kane E, Bishop LA, Pennings JLA, Herault Y, Bianchi DW.
Show Full Abstract
<h4>Background</h4>Despite successful preclinical treatment studies to improve neurocognition in the Ts65Dn mouse model of Down syndrome, translation to humans has failed. This raises questions about the appropriateness of the Ts65Dn mouse as the gold standard. We used the novel Ts66Yah mouse that carries an extra chromosome and the identical segmental Mmu16 trisomy as Ts65Dn without the Mmu17 non-Hsa21 orthologous region.<h4>Methods</h4>Forebrains from embryonic day 18.5 Ts66Yah and Ts65Dn mice, along with euploid littermate controls, were used for gene expression and pathway analyses. Behavioral experiments were performed in neonatal and adult mice. Because male Ts66Yah mice are fertile, parent-of-origin transmission of the extra chromosome was studied.<h4>Results</h4>Forty-five protein-coding genes mapped to the Ts65Dn Mmu17 non-Hsa21 orthologous region; 71%-82% are expressed during forebrain development. Several of these genes are uniquely overexpressed in Ts65Dn embryonic forebrain, producing major differences in dysregulated genes and pathways. Despite these differences, the primary Mmu16 trisomic effects were highly conserved in both models, resulting in commonly dysregulated disomic genes and pathways. Delays in motor development, communication, and olfactory spatial memory were present in Ts66Yah but more pronounced in Ts65Dn neonates. Adult Ts66Yah mice showed milder working memory deficits and sex-specific effects in exploratory behavior and spatial hippocampal memory, while long-term memory was preserved.<h4>Conclusions</h4>Our findings suggest that triplication of the non-Hsa21 orthologous Mmu17 genes significantly contributes to the phenotype of the Ts65Dn mouse and may explain why preclinical trials that used this model have unsuccessfully translated to human therapies.
Also flagged:SchizophreniaP-gpPsychiatric DisordersG protein-coupled
receptorMDR1adenosine monophosphate
Journal Article2023-03-14✓ 4 SnippetsPoulter S, Austin N, Armstrong R, Barnes M, Bucknell SJ, Higueruelo A, Banerjee J, Mead A, Mould R, MacSweeney C, O'Brien MA, Stott LA, Watson SP.
In-Text Gene Mentions
Title)
…The Identification of GPR52 Agonist HTL0041178, a Potential Therapy for Schizophrenia and Related Psychiatric Disorders.…
Title)
…The Identification ofGPR52Agonist HTL0041178, a…
Abstract)
…), a potentGPR52agonist with a…
Text
…GPR52…
Show Full Abstract
HTL0041178 (<b>1</b>), a potent GPR52 agonist with a promising pharmacokinetic profile and exhibiting oral activity in preclinical models, has been identified. This molecule was the outcome of a judicious molecular property-based optimization approach, focusing on balancing potency against metabolic stability, solubility, permeability, and P-gp efflux.
Also flagged:diabetic retinopathyblindnessproliferative diabetic retinopathyPDRthyroid receptor-interacting protein 11TRIP11
Journal Article2023-03-14No SnippetsUlhaq ZS, Hasan YTN, Rosyidin NK, Istifiani LA, Pamungkas SA, Soraya GV.
Show Full Abstract
<h4>Purpose</h4>Diabetic retinopathy (DR) is a leading cause of irreversible blindness worldwide. Identifying risk factors associated with DR development and progression is crucial for improving treatment efficacy. Although proteomic changes in DR have been extensively studied, the results remain equivocal. Hence, this study aims to summarize and identify potential diagnostic or prognostic markers for DR. In addition, the upstream regulator responsible for protein deregulation of this disease was also validated.<h4>Methods</h4>We systematically analyzed the current literature on proteomic profile changes in DR, followed by pathway analysis identification. To validate the protein level changes, ELISA was performed from serum samples collected from 27 patients with DR and 25 healthy controls.<h4>Results</h4>Our analysis revealed that 1 candidate marker (afamin [AFM]) distinguished non-proliferative diabetic retinopathy (NPDR) from type 2 diabetic patients with no diabetic retinopathy/controls, 65 candidate markers distinguished proliferative diabetic retinopathy (PDR) from NPDR, 1 candidate marker (thyroid receptor-interacting protein 11 [TRIP11]) distinguished PDR from PDR-DME/DME, and 3 candidate markers for therapeutic evaluation of PDR. Our results pinpoint that inflammatory response, which IL-6 mainly modulated, is responsible for the changes of proteomic profiles identified in DR. This was also validated by ELISA analysis, indicating that IL-6 could be potentially useful for diagnosing DR.<h4>Conclusion</h4>We report a comprehensive patient-based proteomic approach to identify potential biomarkers for DR diagnosis, prognosis, and treatment evaluation.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s40200-023-01204-6.
Journal Article2023-03-14No SnippetsGarcía-Medina A, Aguayo-Moreno E.
Show Full Abstract
In the present work, the volatility of the leading cryptocurrencies is predicted through generalised autoregressive conditional heteroskedasticity (GARCH) models, multilayer perceptron (MLP), long short-term memory (LSTM), and hybrid models of the type LSTM and GARCH, where parameters of the GARCH family are included as features of LSTM models. The study period covered the scenario of the World Health Organization pandemic declaration around March 2020 at hourly frequency. We have found that the different variants of deep neural network models outperform those of the GARCH family in the sense of the hetorerocedastic error, and absolute and squared error (HSE). Under the sharpe ratio, the volatility forecasting of a uniform portfolio at long horizons systematically outperforms the stablecoin Tether, which is considered here as the risk-free asset. Also, including transaction volume helps reduce the value at risk or loss probability for the uniform portfolio. Moreover, in a minimum variance portfolio, it is observed that before the pandemic declaration, a large proportion of the capital was allocated to bitcoin (BTC). In contrast, after March 2020, the portfolio is more diversified with short positions for BTC. Moreover, the MLP models give the best predictive results, although not statistically different in accuracy compared to the LSTM and LSTM-GARCH versions under the Diebold-Mariano test. In sum, MLP models outperform most stylised financial models and are less computationally expensive than more complex neural networks. Therefore, simple learning models are suggested in highly non-linear time series volatility forecasts as it is the cryptocurrency market.
Also flagged:beta 2 glycoprotein Iantibodyhyperhomocysteinemiachronic kidney diseasesantibodiesglomerulosclerosis
Journal Article2023-03-13✓ 1 SnippetDu X, Ma X, Tan Y, Shao F, Li C, Zhao Y, Miao Y, Han L, Dang G, Song Y, Yang D, Deng Z, Wang Y, Jiang C, Kong W, Feng J, Wang X.
In-Text Gene Mentions
Discussion)
…hanolamine binding protein-1 (PEBP1) complex.…
Show Full Abstract
Hyperhomocysteinemia (HHcy) is a risk factor for chronic kidney diseases (CKDs) that affects about 85% CKD patients. HHcy stimulates B cells to secrete pathological antibodies, although it is unknown whether this pathway mediates kidney injury. In HHcy-treated 2-kidney, 1-clip (2K1C) hypertensive murine model, HHcy-activated B cells secreted anti-beta 2 glycoprotein I (β<sub>2</sub>GPI) antibodies that deposited in glomerular endothelial cells (GECs), exacerbating glomerulosclerosis and reducing renal function. Mechanistically, HHcy 2K1C mice increased phosphatidylethanolamine (PE) (18:0/20:4, 18:0/22:6, 16:0/20:4) in kidney tissue, as determined by lipidomics. GECs oxidative lipidomics validated the increase of oxidized phospholipids upon Hcy-activated B cells culture medium (Hcy-B CM) treatment, including PE (18:0/20:4 + 3[O], PE (18:0a/22:4 + 1[O], PE (18:0/22:4 + 2[O] and PE (18:0/22:4 + 3[O]). PE synthases ethanolamine kinase 2 (etnk2) and ethanolamine-phosphate cytidylyltransferase 2 (pcyt2) were increased in the kidney GECs of HHcy 2K1C mice and facilitated polyunsaturated PE synthesis to act as lipid peroxidation substrates. In HHcy 2K1C mice and Hcy-B CM-treated GECs, the oxidative environment induced by iron accumulation and the insufficient clearance of lipid peroxides caused by transferrin receptor (TFR) elevation and down-regulation of SLC7A11/glutathione peroxidase 4 (GPX4) contributed to GECs ferroptosis of the kidneys. In vivo, pharmacological depletion of B cells or inhibition of ferroptosis mitigated the HHcy-aggravated hypertensive renal injury. Consequently, our findings uncovered a novel mechanism by which B cell-derived pathogenic anti-β<sub>2</sub>GPI IgG generated by HHcy exacerbated hypertensive kidney damage by inducing GECs ferroptosis. Targeting B cells or ferroptosis may be viable therapeutic strategies for ameliorating lipid peroxidative renal injury in HHcy patients with hypertensive nephropathy.
Also flagged:catalytic activitylipaseLipasestriacylglycerol acyl hydrolasestriglyceridesmonoglycerides
Journal Article2023-03-13No SnippetsZhang Z, Long M, Zheng N, Lü X, Zhu C, Osire T, Xia X.
Show Full Abstract
Cavities are created by hydrophobic interactions between residue side chain atoms during the folding of enzymes. Redesigning cavities can improve the thermostability and catalytic activity of the enzyme; however, the synergistic effect of cavities remains unclear. In this study, Rhizomucor miehei lipase (RML) was used as a model to explore volume fluctuation and spatial distribution changes of the internal cavities, which could reveal the roles of internal cavities in the thermostability and catalytic activity. We present an inside out cavity engineering (CE) strategy based on computational techniques to explore how changes in the volumes and spatial distribution of cavities affect the thermostability and catalytic activity of the enzyme. We obtained 12 single-point mutants, among which the melting temperatures (<i>T<sub>m</sub></i>) of 8 mutants showed an increase of more than 2°C. Sixteen multipoint mutations were further designed by spatial distribution rearrangement of internal cavities. The <i>T<sub>m</sub></i> of the most stable triple variant, with mutations including T21V (a change of T to V at position 21), S27A, and T198L (T21V/S27A/T198L), was elevated by 11.0°C, together with a 28.7-fold increase in the half-life at 65°C and a specific activity increase of 9.9-fold (up to 5,828 U mg<sup>-1</sup>), one of the highest lipase activities reported. The possible mechanism of decreased volumes and spatial rearrangement of the internal cavities improved the stability of the enzyme, optimizing the outer substrate tunnel to improve the catalytic efficiency. Overall, the inside out computational redesign of cavities method could help to deeply understand the effect of cavities on enzymatic stability and activity, which would be beneficial for protein engineering efforts to optimize natural enzymes. <b>IMPORTANCE</b> In the present study, R. miehei lipase, which is widely used in various industries, provides an opportunity to explore the effects of internal cavities on the thermostability and catalytic activity of enzymes. Here, we execute high hydrostatic pressure molecular dynamics (HP-MD) simulations to screen the critical internal cavity and reshape the internal cavities through site-directed mutation. We show that as the global internal cavity volume decreases, cavity rearrangement can improve the stability of the protein while optimizing the substrate channel to improve the catalytic efficiency. Our results provide significant insights into understanding the mechanism of action of the internal cavity. Our strategy is expected to be applied to other enzymes to promote increases in thermostability and catalytic activity.
Also flagged:Voriconazoleimmunosuppressionlung diseasesinvasive aspergillosis infectionsazolesazole
Journal Article2023-03-13No SnippetsScott J, Valero C, Mato-López Á, Donaldson IJ, Roldán A, Chown H, Van Rhijn N, Lobo-Vega R, Gago S, Furukawa T, Morogovsky A, Ben Ami R, Bowyer P, Osherov N, Fontaine T, Goldman GH, Mellado E, Bromley M, Amich J.
Show Full Abstract
<i>Aspergillus fumigatus</i> is a filamentous fungus that can infect the lungs of patients with immunosuppression and/or underlying lung diseases. The mortality associated with chronic and invasive aspergillosis infections remain very high, despite availability of antifungal treatments. In the last decade, there has been a worrisome emergence and spread of resistance to the first-line antifungals, the azoles. The mortality caused by resistant isolates is even higher, and patient management is complicated as the therapeutic options are reduced. Nevertheless, treatment failure is also common in patients infected with azole-susceptible isolates, which can be due to several non-mutually exclusive reasons, such as poor drug absorption. In addition, the phenomena of tolerance or persistence, where susceptible pathogens can survive the action of an antimicrobial for extended periods, have been associated with treatment failure in bacterial infections, and their occurrence in fungal infections already proposed. Here, we demonstrate that some isolates of <i>A. fumigatus</i> display persistence to voriconazole. A subpopulation of the persister isolates can survive for extended periods and even grow at low rates in the presence of supra-MIC of voriconazole and seemingly other azoles. Persistence cannot be eradicated with adjuvant drugs or antifungal combinations and seemed to reduce the efficacy of treatment for certain individuals in a <i>Galleria mellonella</i> model of infection. Furthermore, persistence implies a distinct transcriptional profile, demonstrating that it is an active response. We propose that azole persistence might be a relevant and underestimated factor that could influence the outcome of infection in human aspergillosis. <b>IMPORTANCE</b> The phenomena of antibacterial tolerance and persistence, where pathogenic microbes can survive for extended periods in the presence of cidal drug concentrations, have received significant attention in the last decade. Several mechanisms of action have been elucidated, and their relevance for treatment failure in bacterial infections demonstrated. In contrast, our knowledge of antifungal tolerance and, in particular, persistence is still very limited. In this study, we have characterized the response of the prominent fungal pathogen <i>Aspergillus fumigatus</i> to the first-line therapy antifungal voriconazole. We comprehensively show that some isolates display persistence to this fungicidal antifungal and propose various potential mechanisms of action. In addition, using an alternative model of infection, we provide initial evidence to suggest that persistence may cause treatment failure in some individuals. Therefore, we propose that azole persistence is an important factor to consider and further investigate in <i>A. fumigatus</i>.
Also flagged:Fluoridebone formationType 1 collagenhydroxyapatitesaltshydroxyl
Journal Article2023-03-13No SnippetsSavisto N, Grönroos TJ, Oikonen V, Rajander J, Löyttyniemi E, Bergman J, Forsback S, Solin O, Haaparanta-Solin M.
Show Full Abstract
<h4>Background</h4>In the development of new <sup>18</sup>F-labelled tracers, it is important to assess the amount of released [<sup>18</sup>F]fluoride taken up in the bones of experimental animals because all <sup>18</sup>F-labelled PET-tracers are prone, to lesser or higher degree, to undergo defluorination, with subsequent release of [<sup>18</sup>F]fluoride during scanning. However, the pharmacokinetics of [<sup>18</sup>F]fluoride in bones and other organs of healthy rats have not been well documented in a comprehensive manner. We aimed to study pharmacokinetics of [<sup>18</sup>F]NaF in rats in order to increase our understanding of the biodistribution of [<sup>18</sup>F]fluoride originating from defluorination of <sup>18</sup>F-labelled tracers. We studied [<sup>18</sup>F]fluoride uptake in Sprague Dawley rat bones, including the epiphyseal parts of the tibia and radius, the mandible, ilium, lumbar vertebrae, costochondral joints, tibia, radius, and ribs, with 60-min in vivo PET/CT imaging. Kinetic parameters, K<sub>1</sub>, K<sub>i</sub>, K<sub>i</sub>/K<sub>1</sub>, and k<sub>3</sub> were calculated with a three-compartment model. In addition, separate groups of male and female rats were studied with ex vivo bone and soft tissue harvesting and gamma counting over a 6-h period.<h4>Results</h4>[<sup>18</sup>F]fluoride perfusion and uptake varied among the different bones. [<sup>18</sup>F]fluoride uptake was higher in trabecular bones, due to high perfusion and osteoblastic activity, compared to cortical bones. In soft tissues, the organ-to-blood uptake ratios increased over time in the eyes, lungs, brain, testes, and ovaries during the 6 h study period.<h4>Conclusion</h4>Understanding the pharmacokinetics of [<sup>18</sup>F]fluoride in various bones and soft tissues is highly useful for assessing <sup>18</sup>F-labelled radiotracers that release [<sup>18</sup>F]fluoride.
Also flagged:cell movementcell movementsgene expressionNFκBNFκ-Btranscription factor
Journal Article2023-03-13✓ 2 SnippetsXue Y, Krishnan A, Chahda JS, Schweickart RA, Sousa-Neves R, Mizutani CM.
In-Text Gene Mentions
Results)
…Cancer gene (DCC) and encodes…
Results)
…FRA/DCCwas previously implicated…
Show Full Abstract
Morphogenetic gradients specify distinct cell populations within tissues. Originally, morphogens were conceived as substances that act on a static field of cells, yet cells usually move during development. Thus, the way cell fates are defined in moving cells remains a significant and largely unsolved problem. Here, we investigated this issue using spatial referencing of cells and 3D spatial statistics in the Drosophila blastoderm to reveal how cell density responds to morphogenetic activity. We show that the morphogen decapentaplegic (DPP) attracts cells towards its peak levels in the dorsal midline, whereas dorsal (DL) stalls them ventrally. We identified frazzled and GUK-holder as the downstream effectors regulated by these morphogens that constrict cells and provide the mechanical force necessary to draw cells dorsally. Surprisingly, GUKH and FRA modulate the DL and DPP gradient levels and this regulation creates a very precise mechanism of coordinating cell movement and fate specification.
Journal Article2023-03-13✓ 1 SnippetPallichankandy S, Thayyullathil F, Cheratta AR, Subburayan K, Alakkal A, Sultana M, Drou N, Arshad M, Tariq S, Galadari S.
In-Text Gene Mentions
Results)
…PRDX1, PRDX4, PRDX5,PRDX6, GSR, and TXN…
Show Full Abstract
Oxeiptosis is a recently identified reactive oxygen species (ROS)-sensitive, caspase independent, non-inflammatory regulated cell death pathway. The activation of Kelch-like ECH-associated protein 1-Phosphoglycerate mutase 5-Apoptosis inducing factor mitochondria associated 1 (KEAP1-PGAM5-AIFM1) pathway is the key signaling event in the execution of oxeiptosis. In the present study, we demonstrate that sanguinarine (SNG), a quaternary benzophenanthridine alkaloid, induces oxeiptosis in human colorectal cancer (CRC) cells via ROS, specifically hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>)-dependent activation of KEAP1-PGAM5-AIFM1 signaling axis. Whilst, knockdown of KEAP1, PGAM5, and AIFM1 largely abolishes SNG-induced oxeiptosis, hence reinforcing the importance of the role of this pathway in the SNG-mediated cytotoxicity. Moreover, extracellular addition of H<sub>2</sub>O<sub>2</sub> sensitizes SNG-induced oxeiptosis in CRC cells, while removal of intracellular ROS by ROS scavengers, not only alleviated the overproduction of ROS caused by SNG, but also reversed the biochemical events associated with oxeiptosis. Finally, in vivo study demonstrates that SNG effectively reduces the tumor growth in HT-29 xenograft mouse model through features associated with oxeiptosis. This study highlights oxeiptosis as a novel tumor suppressive mechanism and further investigation of the role of oxeiptosis in cancer treatment is warranted.
Also flagged:primary Sjögren syndromesiccaToll-like receptorinterferonantigen presentationautoimmune disease
Journal Article2023-03-13No SnippetsThorlacius GE, Björk A, Wahren-Herlenius M.
Show Full Abstract
In primary Sjögren syndrome (pSS), chronic inflammation of exocrine glands results in tissue destruction and sicca symptoms, primarily of the mouth and eyes. Fatigue, arthralgia and myalgia are also common symptoms, whereas extraglandular manifestations that involve the respiratory, nervous and vascular systems occur in a subset of patients. The disease predominantly affects women, with an estimated female to male ratio of 14 to 1. The aetiology of pSS, however, remains incompletely understood, and effective treatment is lacking. Large-scale genetic and epigenetic investigations have revealed associations between pSS and genes in both innate and adaptive immune pathways. The genetic variants mediate context-dependent effects, and both sex and environmental factors can influence the outcome. As such, genetic and epigenetic studies can provide insight into the dysregulated molecular mechanisms, which in turn might reveal new therapeutic possibilities. This Review discusses the genetic and epigenetic features that have been robustly connected with pSS, putting them into the context of cellular function, carrier sex and environmental challenges. In all, the observations point to several novel opportunities for early detection, treatment development and the pathway towards personalized medicine.
Also flagged:pathogenesisbrain diseasesnucleusmajor depressive disorderbehavioralAD
Journal Article2023-03-13✓ 2 SnippetsHuang Y, Wu J, Zhang H, Li Y, Wen L, Tan X, Cheng K, Liu Y, Pu J, Liu L, Wang H, Li W, Perry SW, Wong ML, Licinio J, Zheng P, Xie P.
Clinical and animal studies have shown that gut microbiome disturbances can affect neural function and behaviors via the microbiota-gut-brain axis, and may be implicated in the pathogenesis of several brain diseases. However, exactly how the gut microbiome modulates nervous system activity remains obscure. Here, using a single-cell nucleus sequencing approach, we sought to characterize the cell type-specific transcriptomic changes in the prefrontal cortex and hippocampus derived from germ-free (GF), specific pathogen free, and colonized-GF mice. We found that the absence of gut microbiota resulted in cell-specific transcriptomic changes. Furthermore, microglia transcriptomes were preferentially influenced, which could be effectively reversed by microbial colonization. Significantly, the gut microbiome modulated the mutual transformation of microglial subpopulations in the two regions. Cross-species analysis showed that the transcriptome changes of these microglial subpopulations were mainly associated with Alzheimer's disease (AD) and major depressive disorder (MDD), which were further supported by animal behavioral tests. Our findings demonstrate that gut microbiota mainly modulate the mutual transformation of microglial subtypes, which may lead to new insights into the pathogenesis of AD and MDD.
Also flagged:Heart diseasecardiomyopathiescardiomyopathydeathferroptosisautophagy
Journal Article2023-03-13No SnippetsSheng SY, Li JM, Hu XY, Wang Y.
Show Full Abstract
Heart disease is a worldwide health menace. Both intractable primary and secondary cardiomyopathies contribute to malignant cardiac dysfunction and mortality. One of the key cellular processes associated with cardiomyopathy is cardiomyocyte death. Cardiomyocytes are terminally differentiated cells with very limited regenerative capacity. Various insults can lead to irreversible damage of cardiomyocytes, contributing to progression of cardiac dysfunction. Accumulating evidence indicates that majority of cardiomyocyte death is executed by regulating molecular pathways, including apoptosis, ferroptosis, autophagy, pyroptosis, and necroptosis. Importantly, these forms of regulated cell death (RCD) are cardinal features in the pathogenesis of various cardiomyopathies, including dilated cardiomyopathy, diabetic cardiomyopathy, sepsis-induced cardiomyopathy, and drug-induced cardiomyopathy. The relevance between abnormity of RCD with adverse outcome of cardiomyopathy has been unequivocally evident. Therefore, there is an urgent need to uncover the molecular and cellular mechanisms for RCD in order to better understand the pathogenesis of cardiomyopathies. In this review, we summarize the latest progress from studies on RCD pathways in cardiomyocytes in context of the pathogenesis of cardiomyopathies, with particular emphasis on apoptosis, necroptosis, ferroptosis, autophagy, and pyroptosis. We also elaborate the crosstalk among various forms of RCD in pathologically stressed myocardium and the prospects of therapeutic applications targeted to various cell death pathways.
Also flagged:endometriosisinfertilityovarian endometriosismethylationosteoarthritismigraine
Journal Article2023-03-13✓ 3 SnippetsRahmioglu N, Mortlock S, Ghiasi M, Møller PL, Stefansdottir L, Galarneau G, Turman C, Danning R, Law MH, Sapkota Y, Christofidou P, Skarp S, Giri A, Banasik K, Krassowski M, Lepamets M, Marciniak B, Nõukas M, Perro D, Sliz E, Sobalska-Kwapis M, Thorleifsson G, Topbas-Selcuki NF, Vitonis A, Westergaard D, Arnadottir R, Burgdorf KS, Campbell A, Cheuk CSK, Clementi C, Cook J, De Vivo I, DiVasta A, Dorien O, Donoghue JF, Edwards T, Fontanillas P, Fung JN, Geirsson RT, Girling JE, Harkki P, Harris HR, Healey M, Heikinheimo O, Holdsworth-Carson S, Hostettler IC, Houlden H, Houshdaran S, Irwin JC, Jarvelin MR, Kamatani Y, Kennedy SH, Kepka E, Kettunen J, Kubo M, Kulig B, Kurra V, Laivuori H, Laufer MR, Lindgren CM, MacGregor S, Mangino M, Martin NG, Matalliotaki C, Matalliotakis M, Murray AD, Ndungu A, Nezhat C, Olsen CM, Opoku-Anane J, Padmanabhan S, Paranjpe M, Peters M, Polak G, Porteous DJ, Rabban J, Rexrode KM, Romanowicz H, Saare M, Saavalainen L, Schork AJ, Sen S, Shafrir AL, Siewierska-Górska A, Słomka M, Smith BH, Smolarz B, Szaflik T, Szyłło K, Takahashi A, Terry KL, Tomassetti C, Treloar SA, Vanhie A, Vincent K, Vo KC, Werring DJ, Zeggini E, Zervou MI, DBDS Genomic Consortium, FinnGen Study, FinnGen Endometriosis Taskforce, Celmatix Research Team, 23andMe Research Team, Adachi S, Buring JE, Ridker PM, D'Hooghe T, Goulielmos GN, Hapangama DK, Hayward C, Horne AW, Low SK, Martikainen H, Chasman DI, Rogers PAW, Saunders PT, Sirota M, Spector T, Strapagiel D, Tung JY, Whiteman DC, Giudice LC, Velez-Edwards DR, Uimari O, Kraft P, Salumets A, Nyholt DR, Mägi R, Stefansson K, Becker CM, Yurttas-Beim P, Steinthorsdottir V, Nyegaard M, Missmer SA, Montgomery GW, Morris AP, Zondervan KT.
In-Text Gene Mentions
Abstract)
…SRP14/BMF , GDAP1,MLLT10, BSN, NGF) .…
Text
…MLLT10…
Text
…OLFM4…
Show Full Abstract
Endometriosis is a common condition associated with debilitating pelvic pain and infertility. A genome-wide association study meta-analysis, including 60,674 cases and 701,926 controls of European and East Asian descent, identified 42 genome-wide significant loci comprising 49 distinct association signals. Effect sizes were largest for stage 3/4 disease, driven by ovarian endometriosis. Identified signals explained up to 5.01% of disease variance and regulated expression or methylation of genes in endometrium and blood, many of which were associated with pain perception/maintenance (SRP14/BMF, GDAP1, MLLT10, BSN and NGF). We observed significant genetic correlations between endometriosis and 11 pain conditions, including migraine, back and multisite chronic pain (MCP), as well as inflammatory conditions, including asthma and osteoarthritis. Multitrait genetic analyses identified substantial sharing of variants associated with endometriosis and MCP/migraine. Targeted investigations of genetically regulated mechanisms shared between endometriosis and other pain conditions are needed to aid the development of new treatments and facilitate early symptomatic intervention.
Also flagged:silicatumorTfpentose phosphatephosphorylationsynthesis
Journal Article2023-03-13✓ 2 SnippetsAragoneses-Cazorla G, Vallet-Regí M, Gómez-Gómez MM, González B, Luque-Garcia JL.
In-Text Gene Mentions
Discussion)
…SLC2A5, SLC2A10, andSLC2A14).…
Discussion)
…The transporterSLC2A14(GLUT14), which has…
Show Full Abstract
A combination of omics techniques (transcriptomics and metabolomics) has been used to elucidate the mechanisms responsible for the antitumor action of a nanosystem based on a Ag core coated with mesoporous silica on which transferrin has been anchored as a targeting ligand against tumor cells (Ag@MSNs-Tf). Transcriptomics analysis has been carried out by gene microarrays and RT-qPCR, while high-resolution mass spectrometry has been used for metabolomics. This multi-omics strategy has enabled the discovery of the effect of this nanosystem on different key molecular pathways including the glycolysis, the pentose phosphate pathway, the oxidative phosphorylation and the synthesis of fatty acids, among others.
Also flagged:ALKhistiocytosislocalized diseasesmediastinal neoplasmcytoplasmCD68
Journal Article2023-03-13✓ 5 SnippetsLiu W, Liu HJ, Wang WY, Tang Y, Zhao S, Zhang WY, Yan JQ, Liu WP.
In-Text Gene Mentions
Discussion)
…The VRK2-ALK and DCTN1-ALK fusion thus may lead to activation of ALK gene driving the tumorigenesis in the ALK-positive histiocytosis.…
Abstract)
…both DCTN1-ALK andVRK2-ALK fusions were detected…
Methods)
…Case 3 -VRK2-ALK gene fusion with…
Methods)
…with breakpoints atVRK2exon 11 and…
Results)
…VRK2-ALK and DCTN1-ALK were…
Show Full Abstract
<h4>Background</h4>Anaplastic lymphoma kinase (ALK)-positive histiocytosis, a novel rare histiocytic proliferation, was first described in 2008; it occurs in early infancy with liver and hematopoietic involvement. The spectrum was subsequently broadened to include localized diseases in older children and young adults. However, its full clinicopathological features and molecular lineage have not been fully elucidated.<h4>Results</h4>Here, we report four cases of multisystem ALK-positive histiocytosis without hematopoietic involvement. Clinically, three patients were adults aged between 32 and 51 years. Two patients', whose main manifestations were intracranial mass and numerous micronodules in the thoracoabdominal cavity organs and skin papules respectively, had a partial response to ALK inhibitors after surgery. One patient presented with mediastinal neoplasm without surgical treatment, and progressive disease occurred after two years of ALK inhibitor therapy. The fourth patient was a 17-month-old male with a large intracranial mass and presented with a poor response to ALK inhibitor and chemoradiotherapy; he died eight months after surgery. Pathologically, the histiocytes were large, with abundant eosinophilic cytoplasm, and mixed with variable numbers of foamy cells and Touton giant cells. Interstitial fibrosis was also observed. Histiocytes were positive for macrophage markers (CD68 and CD163) and ALK. KIF5B-ALK fusions were detected in two cases, EML4-ALK in one, and both DCTN1-ALK and VRK2-ALK fusions were detected in one case.<h4>Conclusions</h4>We observed that ALK inhibitors present robust and durable responses in adult patients but a poor response in young children with central nervous system involvement. There is no consensus on the optimal treatment regimen and long-term prognosis requires further observation. Moreover, every unusual histiocytic proliferative lesion, especially unresectable and multisystem involvement, should be routinely tested for ALK immunohistochemical staining to identify this rare disease.
Hypoxia develops during the growth of solid tumors and influences tumoral activity in multiple ways. Low oxygen tension is also present in the bone microenvironment where Ewing sarcoma (EwS) - a highly aggressive pediatric cancer - mainly arises. Hypoxia inducible factor 1 subunit alpha (HIF-1-a) is the principal molecular mediator of the hypoxic response in cancer whereas EWSR1::FLI1 constitutes the oncogenic driver of EwS. Interaction of the two proteins has been shown in EwS. Although a growing body of studies investigated hypoxia and HIFs in EwS, their precise role for EwS pathophysiology is not clarified to date. This review summarizes and structures recent findings demonstrating that hypoxia and HIFs play a role in EwS at multiple levels. We propose to view hypoxia and HIFs as independent protagonists in the story of EwS and give a perspective on their potential clinical relevance as prognostic markers and therapeutic targets in EwS treatment.
<h4>Background</h4>The incidence and mortality of gastric cancer ranks fifth and fourth worldwide among all malignancies, respectively. Accumulating evidences have revealed the close relationship between mitochondrial dysfunction and the initiation and progression of stomach cancer. However, rare prognostic models for mitochondrial-related gene risk have been built up in stomach cancer.<h4>Methods</h4>In current study, the expression and prognostic value of mitochondrial-related genes in stomach adenocarcinoma (STAD) patients were systematically analyzed to establish a mitochondrial-related risk model based on available TCGA and GEO databases. The tumor microenvironment (TME), immune cell infiltration, tumor mutation burden, and drug sensitivity of gastric adenocarcinoma patients were also investigated using R language, GraphPad Prism 8 and online databases.<h4>Results</h4>We established a mitochondrial-related risk prognostic model including NOX4, ALDH3A2, FKBP10 and MAOA and validated its predictive power. This risk model indicated that the immune cell infiltration in high-risk group was significantly different from that in the low-risk group. Besides, the risk score was closely related to TME signature genes and immune checkpoint molecules, suggesting that the immunosuppressive tumor microenvironment might lead to poor prognosis in high-risk groups. Moreover, TIDE analysis demonstrated that combined analysis of risk score and immune score, or stromal score, or microsatellite status could more effectively predict the benefit of immunotherapy in STAD patients with different stratifications. Finally, rapamycin, PD-0325901 and dasatinib were found to be more effective for patients in the high-risk group, whereas AZD7762, CEP-701 and methotrexate were predicted to be more effective for patients in the low-risk group.<h4>Conclusions</h4>Our results suggest that the mitochondrial-related risk model could be a reliable prognostic biomarker for personalized treatment of STAD patients.
Also flagged:epinephrinecardiac arrestIHCAcatecholaminespulmonary hypertensionto
Journal Article2023-03-13No SnippetsMorgan RW, Berg RA, Reeder RW, Carpenter TC, Franzon D, Frazier AH, Graham K, Meert KL, Nadkarni VM, Naim MY, Tilford B, Wolfe HA, Yates AR, Sutton RM, ICU-RESUS and the Eunice Kennedy Shriver National Institute of Child Health and Human Development Collaborative Pediatric Critical Care Research Network Investigator Groups.
Show Full Abstract
<h4>Background</h4>Epinephrine is provided during cardiopulmonary resuscitation (CPR) to increase systemic vascular resistance and generate higher diastolic blood pressure (DBP) to improve coronary perfusion and attain return of spontaneous circulation (ROSC). The DBP response to epinephrine during pediatric CPR and its association with outcomes have not been well described. Thus, the objective of this study was to measure the association between change in DBP after epinephrine administration during CPR and ROSC.<h4>Methods</h4>This was a prospective multicenter study of children receiving ≥ 1 min of CPR with ≥ 1 dose of epinephrine and evaluable invasive arterial BP data in the 18 ICUs of the ICU-RESUS trial (NCT02837497). Blood pressure waveforms underwent compression-by-compression quantitative analysis. The mean DBP before first epinephrine dose was compared to mean DBP two minutes post-epinephrine. Patients with ≥ 5 mmHg increase in DBP were characterized as "responders."<h4>Results</h4>Among 147 patients meeting inclusion criteria, 66 (45%) were characterized as responders and 81 (55%) were non-responders. The mean increase in DBP with epinephrine was 4.4 [- 1.9, 11.5] mmHg (responders: 13.6 [7.5, 29.3] mmHg versus non-responders: - 1.5 [- 5.0, 1.5] mmHg; p < 0.001). After controlling for a priori selected covariates, epinephrine response was associated with ROSC (aRR 1.60 [1.21, 2.12]; p = 0.001). Sensitivity analyses identified similar associations between DBP response thresholds of ≥ 10, 15, and 20 mmHg and ROSC; DBP responses of ≥ 10 and ≥ 15 mmHg were associated with higher aRR of survival to hospital discharge and survival with favorable neurologic outcome (Pediatric Cerebral Performance Category score of 1-3 or no worsening from baseline).<h4>Conclusions</h4>The change in DBP following epinephrine administration during pediatric in-hospital CPR was associated with return of spontaneous circulation.
<h4>Background</h4>Cuproptosis, as a copper-induced mitochondrial cell death, has attracted extensive attention recently, especially in cancer. Although some key regulatory genes have been identified in cuproptosis, the related lncRNAs have not been further studied. Exploring the prognostic and diagnostic value of cuproptosis-related lncRNAs (CRLs) in colon adenocarcinoma and providing guidance for individualized immunotherapy for patients are of great significance.<h4>Results</h4>A total of 2003 lncRNAs were correlated with cuproptosis genes and considered as CRLs. We screened 33 survival-associated CRLs and established a prognostic signature base on 7 CRLs in the training group. The patients in the low-risk group had better outcomes in both training group (P < 0.001) and test group (P = 0.016). More exciting, our model showed good prognosis prediction in both stage I-II (P = 0.020) and stage III-IV (P = 0.001). The nomogram model could further improve the accuracy of prognosis prediction. Interestingly, glucose-related metabolic pathways, which were closely related to cuproptosis, were enriched in the low-risk group. Meanwhile, the immune infiltration scores were lower in the high-risk group. The high-risk group was more sensitive to OSI.906 and ABT.888, while low-risk group was more sensitive to Sorafenib. Three lncRNAs, FALEC, AC083967.1 and AC010997.4, were highly expressed in serum of COAD patients, and the AUC was 0.772, 0.726 and 0.714, respectively, indicating their valuable diagnostic value.<h4>Conclusions</h4>Our research constructed a prognostic signature based on 7 CRLs and found three promising diagnostic markers for COAD patients. Our results provided a reference to the personalized immunotherapy strategies.
Also flagged:visionAlzheimercell differentiationcell-deathTranscription Factors
Journal Article2023-03-13✓ 1 SnippetPeignier S, Calevro F.
In-Text Gene Mentions
Results)
…74 ], andPOU3F2, a TF plying…
Show Full Abstract
Self-expressiveness is a mathematical property that aims at characterizing the relationship between instances in a dataset. This property has been applied widely and successfully in computer-vision tasks, time-series analysis, and to infer underlying network structures in domains including protein signaling interactions and social-networks activity. Nevertheless, despite its potential, self-expressiveness has not been explicitly used to infer gene networks. In this article, we present Generalizable Gene Self-Expressive Networks, a new, interpretable, and generalization-aware formalism to model gene networks, and we propose two methods: GXN•EN and GXN•OMP, based respectively on ElasticNet and OMP (Orthogonal Matching Pursuit), to infer and assess Generalizable Gene Self-Expressive Networks. We evaluate these methods on four Microarray datasets from the DREAM5 benchmark, using both internal and external metrics. The results obtained by both methods are comparable to those obtained by state-of-the-art tools, but are fast to train and exhibit high levels of sparsity, which make them easier to interpret. Moreover we applied these methods to three complex datasets containing RNA-seq informations from different mammalian tissues/cell-types. Lastly, we applied our methodology to compare a normal vs. a disease condition (Alzheimer), which allowed us to detect differential expression of genes' sub-networks between these two biological conditions. Globally, the gene networks obtained exhibit a sparse and modular structure, with inner communities of genes presenting statistically significant over/under-expression on specific cell types, as well as significant enrichment for some anatomical GO terms, suggesting that such communities may also drive important functional roles.
Also flagged:ADCY7HPV Infectioncervical cancerAdenylate cyclase 7cervical intraepithelial neoplasiainfection
Journal Article2023-03-13✓ 2 SnippetsChen L, Huang L, Dong B, Gu Y, Cang W, Li C, Sun P, Xiang Y.
In-Text Gene Mentions
Results)
…(rho = 0.246),TNFSF4(rho = 0.156),…
Discussion)
…ICOS, CD276, andTNFSF4.…
Show Full Abstract
The effect of cervical cancer immunotherapy is limited. Combination therapy will be a new direction for cervical cancer. Thus, it is essential to discover a novel and available predictive biomarker to stratify patients who may benefit from immunotherapy for cervical cancer. In this study, 563 participants were enrolled. Adenylate cyclase 7 (ADCY7) mRNA was detected by real-time quantitative PCR (qPCR) with cervical cytology specimens. The relationship between ADCY7 and cervical intraepithelial neoplasia in grade 2 and higher (CIN2+) was analyzed, and the optimal cut-off values of the relative expression of ADCY7 mRNA to predict CIN2+ were calculated. In addition, the clinical significance of ADCY7 in cervical cancer was determined by the Kaplan-Meier Cox regression based on the TCGA database. The mean ADCY7 mRNA expression increased significantly with cervical lesion development, especially compared with CIN2+ (<i>p</i> < 0.05). Moreover, the expression of ADCY7 increased significantly in high-risk human papillomavirus (HR-HPV) infection but not in HPV-A5/6 species. The area under the receiver operating characteristic curve (AUC) of ADCY7 was 0.897, and an optimal cut-off was 0.435. Furthermore, ADCY7 had the highest OR (OR= 8.589; 95% CI (2.281-22.339)) for detecting CIN 2+, followed by HPV genotyping, TCT, and age (OR = 4.487, OR = 2.071, and OR = 1.345; 95% CI (1.156-10.518), (0.370-8.137), and (0.171-4.694), respectively). Moreover, this study indicated that higher ADCY7 levels could be a suitable predictor for poor prognosis in cervical cancer due to immune cell infiltration. A new auxiliary predictor of CIN2+ in cervical cytology specimens is ADCY7 ≥ 0.435. Furthermore, it may be a promising prognosis predictor and potential immunotherapy target for the combined treatment of cervical cancer and possibly further block HR-HPV persistent infection.
Also flagged:IFN-Inducible SerpinA5STAT1infectious diseasestype I interferonIFNSTAT
Journal Article2023-03-13✓ 1 SnippetWang C, Liu Y, Liu X, Zhao J, Lang B, Wu F, Wen Z, Sun C.
In-Text Gene Mentions
Discussion)
…In addition,Serpin C1C1 (antithrombin III)…
Show Full Abstract
Deeply understanding virus-host interactions is a prerequisite for developing effective strategies to control frequently emerging infectious diseases, which have become a serious challenge for global public health. The type I interferon (IFN)-mediated JAK/STAT pathway is well known for playing an essential role in host antiviral immunity, but the exact regulatory mechanisms of various IFN-stimulated genes (ISGs) are not yet fully understood. We herein reported that SerpinA5, as a novel ISG, played a previously unrecognized role in antiviral activity. Mechanistically, SerpinA5 can upregulate the phosphorylation of STAT1 and promote its nuclear translocation, thus effectively activating the transcription of IFN-related signaling pathways to impair viral infections. Our data provide insights into SerpinA5-mediated innate immune signaling during virus-host interactions.
Also flagged:PhosphorusEnzyme ActivityPhosphatasealkaline phosphatasephosphodiesterasemineralization
Journal Article2023-03-13No SnippetsUrlić B, Dumičić G, Radić T, Goreta Ban S, Romić M.
Show Full Abstract
Plant adaptations to low soil phosphorus (P) availability have been intensively studied in <i>Brassica</i> sp. in an attempt to identify the mechanisms involved in P uptake and utilization. The present pot experiment was conducted to evaluate the relationships between plant shoot and root growth, P uptake and use efficiency parameters, and P fractions and enzyme activity, in two species grown in three soil types. The aim of this study was to determine whether adaptation mechanisms are soil-dependent. Two kale species were grown in soils typical for coastal Croatia (terra rossa, rendzina, and fluvisol) with low P availability. Plants grown in fluvisol had the highest shoot biomass and accumulated most P, whereas plants developed the longest roots in terra rossa. Phosphatase activity differed among soils. P use efficiency differed among soils and species. Genotype IJK 17 showed better adaptation to low P availability, which was related to better uptake efficiency. In general, soils differed in inorganic and organic P fractions in rhizosphere soil, but no difference between genotypes was found. The activities of alkaline phosphatase and phosphodiesterase were negatively correlated with most organic P fractions, suggesting their function in the mineralization of soil organic P. Kale species activate different mechanisms of P uptake and utilization when grown in contrasting soil types, suggesting that specific responses to the soil type were more important than the genotypic difference.
Also flagged:midazolammorphinebupivacaineflumazenilmeloxicamgestation
Journal Article2023-03-13✓ 1 SnippetTal S, Shilo-Benjamini Y.
In-Text Gene Mentions
Introduction)
…disorders, such ashemochromatosis, a frequent cause…
Show Full Abstract
The purpose of this report is to describe the anesthetic and analgesic management and the surgical procedures of gonadectomy in six (four females and two males) healthy adult Egyptian fruit bats (<i>Rousettus aegyptiacus</i>). Bats were anesthetized with a combination of alfaxalone, midazolam, and morphine administered subcutaneously. Incisional line infiltration using bupivacaine was administered in all bats, and additional bilateral intratesticular injection was administered in the males. Ovariectomy was performed <i>via</i> a dorsal approach, by bilateral midline skin incisions at the paralumbar fossa level. Orchiectomy was performed <i>via</i> a ventral approach, by bilateral midline incisions of scrotal skin above the testes. Following surgery, all bats were administered flumazenil for midazolam reversal, and meloxicam for postoperative analgesia, subcutaneously. All bats recovered from anesthesia uneventfully. Bats were monitored for complications up to 10 days following surgery, when skin sutures were removed. No morbidities or mortalities occurred during this period in any of the bats. In conclusion, ventral approach orchiectomy and dorsal approach ovariectomy using the injectable combination alfaxalone-midazolam-morphine in conjunction with local anesthesia and meloxicam are feasible procedures in Egyptian fruit bats and can be performed with relative ease. However, further studies using these techniques in a larger group of bats should be performed to establish their safety.
Journal Article2023-03-13No SnippetsChen L, Yang Y, Zhao Z, Lu S, Lu Q, Cui C, Parry MAJ, Hu YG.
Show Full Abstract
Compared to C<sub>3</sub> species, C<sub>4</sub> plants showed higher photosynthetic capacity as well as water and nitrogen use efficiency due to the presence of the C<sub>4</sub> photosynthetic pathway. Previous studies have shown that all genes required for the C<sub>4</sub> photosynthetic pathway exist in the genomes of C<sub>3</sub> species and are expressed. In this study, the genes encoding six key C<sub>4</sub> photosynthetic pathway enzymes (β-CA, PEPC, ME, MDH, RbcS, and PPDK) in the genomes of five important gramineous crops (C<sub>4</sub>: maize, foxtail millet, and sorghum; C<sub>3</sub>: rice and wheat) were systematically identified and compared. Based on sequence characteristics and evolutionary relationships, their C<sub>4</sub> functional gene copies were distinguished from non-photosynthetic functional gene copies. Furthermore, multiple sequence alignment revealed important sites affecting the activities of PEPC and RbcS between the C<sub>3</sub> and C<sub>4</sub> species. Comparisons of expression characteristics confirmed that the expression patterns of non-photosynthetic gene copies were relatively conserved among species, while C<sub>4</sub> gene copies in C<sub>4</sub> species acquired new tissue expression patterns during evolution. Additionally, multiple sequence features that may affect C<sub>4</sub> gene expression and subcellular localization were found in the coding and promoter regions. Our work emphasized the diversity of the evolution of different genes in the C<sub>4</sub> photosynthetic pathway and confirmed that the specific high expression in the leaf and appropriate intracellular distribution were the keys to the evolution of C<sub>4</sub> photosynthesis. The results of this study will help determine the evolutionary mechanism of the C<sub>4</sub> photosynthetic pathway in Gramineae and provide references for the transformation of C<sub>4</sub> photosynthetic pathways in wheat, rice, and other major C<sub>3</sub> cereal crops.
Also flagged:cancertropomyosin 4TPM4gastric cancerwound healingcancers
Journal Article2023-03-13✓ 3 SnippetsGuo Q, Zhao L, Yan N, Li Y, Guo C, Dang S, Shen X, Han J, Luo Y.
In-Text Gene Mentions
Discussion)
…Following this, 15 genes, including ABCA12, DOCK3, NALCN, PCDH17, and KRAS, were found to exhibit high mutation frequencies within the TPM4 high- and low-expression cohorts of STAD.…
Results)
…ABCA12, DOCK3, NALCN,PCDH17, and KRAS (…
Discussion)
…ABCA12, DOCK3, NALCN,PCDH17, and KRAS, were…
Show Full Abstract
<h4>Objective</h4>To investigate the function of tropomyosin 4 (TPM4) using pan-cancer data, especially in gastric cancer (GC), using comprehensive bioinformatics analysis and molecular experiments.<h4>Methods</h4>We used UCSC Xena, The Cancer Genome Atlas (TCGA), Genotype-Tissue Expression Project (GTEx), TIMER2.0, GEPIA, cBioPortal, Xiantao tool, and UALCAN websites and databases for the extraction of pan-cancer data on TPM4. TPM4 expression was investigated with respect to prognosis, genetic alterations, epigenetic alterations, and immune infiltration. RNA22, miRWalk, miRDB, Starbase 2.0, and Cytoscape were used for identifying and constructing the regulatory networks of lncRNAs, miRNAs, and TPM4 in GC. Data from GSCALite, drug bank databases, and Connectivity Map (CMap) were used to analyze the sensitivity of drugs dependent on TPM4 expression. Gene Ontology (GO), enrichment analyses of the Kyoto Encyclopedia of Genes and Genomes (KEGG), wound healing assays, and (Matrigel) transwell experiments were used to investigate the biological functions of TPM4 in GC.<h4>Result</h4>The findings of the comprehensive pan-cancer analysis revealed that TPM4 has a certain diagnostic and prognosis value in most cancers. Alterations in the expression of TPM4, including duplications and deep mutations, and epigenetic alterations revealed that TPM4 expression is related to the expression of DNA methylation inhibitors and RNA methylation regulators at high concentrations. Besides, TPM4 expression was found to correlate with immune cell infiltration, immune checkpoint (ICP) gene expression, the tumor mutational burden (TMB), and microsatellite instability (MSI). Neoantigens (NEO) were also found to influence its response to immunotherapy. A lncRNA-miRNA -TPM4 network was found to regulate GC development and progression. TPM4 expression was related to docetaxel,5-fluorouracil, and eight small molecular targeted drugs sensitivity. Gene function enrichment analyses revealed that genes that were co-expressed with TPM4 were enriched within the extracellular matrix (ECM)-related pathways. Wound-healing and (Matrigel) transwell assays revealed that TPM4 promotes cell migration and invasion. TPM4, as an oncogene, plays a biological role, perhaps <i>via</i> ECM remodeling in GC.<h4>Conclusions</h4>TPM4 is a prospective marker for the diagnosis, treatment outcome, immunology, chemotherapy, and small molecular drugs targeted for pan-cancer treatment, including GC treatment. The lncRNA-miRNA-TPM4network regulates the mechanism underlying GC progression. TPM4 may facilitate the invasion and migration of GC cells, possibly through ECM remodeling.
Also flagged:envelope proteinsmonkeypoxzoonoticB6RvirionH3L
Journal Article2023-03-13No SnippetsTan C, Zhu F, Pan P, Wu A, Li C.
Show Full Abstract
<h4>Background</h4>Since May 2022, cases of monkeypox, a zoonotic disease caused by the monkeypox virus (MPXV), have been increasingly reported worldwide. There are, however, no proven therapies or vaccines available for monkeypox. In this study, several multi-epitope vaccines were designed against the MPXV using immunoinformatics approaches.<h4>Methods</h4>Three target proteins, A35R and B6R, enveloped virion (EV) form-derived antigens, and H3L, expressed on the mature virion (MV) form, were selected for epitope identification. The shortlisted epitopes were fused with appropriate adjuvants and linkers to vaccine candidates. The biophysical andbiochemical features of vaccine candidates were evaluated. The Molecular docking and molecular dynamics(MD) simulation were run to understand the binding mode and binding stability between the vaccines and Toll-like receptors (TLRs) and major histocompatibility complexes (MHCs). The immunogenicity of the designed vaccines was evaluated via immune simulation.<h4>Results</h4>Five vaccine constructs (MPXV-1-5) were formed. After the evaluation of various immunological and physicochemical parameters, MPXV-2 and MPXV-5 were selected for further analysis. The results of molecular docking showed that the MPXV-2 and MPXV-5 had a stronger affinity to TLRs (TLR2 and TLR4) and MHC (HLA-A*02:01 and HLA-DRB1*02:01) molecules, and the analyses of molecular dynamics (MD) simulation have further confirmed the strong binding stability of MPXV-2 and MPXV-5 with TLRs and MHC molecules. The results of the immune simulation indicated that both MPXV-2 and MPXV-5 could effectively induce robust protective immune responses in the human body.<h4>Conclusion</h4>The MPXV-2 and MPXV-5 have good efficacy against the MPXV in theory, but further studies are required to validate their safety and efficacy.
Also flagged:canceratopic dermatitisADpathogenesisatopic eczemachronic inflammatory skin disease
Journal Article2023-03-13No SnippetsZheng C, Shi Y, Zou Y.
Show Full Abstract
The use of immune checkpoint inhibitors (ICIs) targeting the T cell inhibitory pathways has revolutionized cancer treatment. However, ICIs might induce progressive atopic dermatitis (AD) by affecting T cell reactivation. The critical role of T cells in AD pathogenesis is widely known. T cell co-signaling pathways regulate T cell activation, where co-signaling molecules are essential for determining the magnitude of the T cell response to antigens. Given the increasing use of ICIs in cancer treatment, a timely overview of the role of T cell co-signaling molecules in AD is required. In this review, we emphasize the importance of these molecules involved in AD pathogenesis. We also discuss the potential of targeting T cell co-signaling pathways to treat AD and present the unresolved issues and existing limitations. A better understanding of the T cell co-signaling pathways would aid investigation of the mechanism, prognosis evaluation, and treatment of AD.
Also flagged:IRAK1BP1cancertumorslung cancertumorlung adenocarcinoma
Journal Article2023-03-13✓ 2 SnippetsGuo L, Zhou W, Xu Z, Cao X, Wan S, Zhang YY, Zhang J, Lu H.
In-Text Gene Mentions
Results)
…Figure 1A demonstrates the workflow of RNA-seq data collection from mouse organoids with or without the in vitro induced activation of KRASG12D (10) or EGFRT790M/L858R (11), which are two of the most predominant oncogenic mutations in NSCLC (17); this was then followed by DEG analysis to find genes aberrantly expressed in tumor organoids by comparing the transcriptomic profiles of tumor versus normal (control) organoids. Data collected for a total of six organoid types were analyzed for our study (Figure 1A). Lists of DEGs for each dataset were then compared to find 9 DEGs that were common to all six organoid models of LUAD (Figures 1A-C). Genes that were consistently up-regulated across all LUAD organoid types include Wnt7a, Unc13c, Rap1gap, and Ank1 (Figure 1B, upper heatmap), while genes consistently down-regulated were Gstm1, Gpx2, Acox2, Irak1bp1, and Erich2 (Figure 1B, bottom heatmap). The log fold change (log2FC) for each DEG was displayed in Figure 1D, showing that these 9 genes were indeed consistently up- or down-regulated in all 6 organoid types that were analyzed.…
Results)
…include Wnt7a ,Unc13c, Rap1gap ,…
Show Full Abstract
<h4>Introduction</h4>Lung cancer is one of the major causes of cancer-related mortality worldwide. High-throughput RNA sequencing (RNA-seq) of surgically removed tumors has been used to identify new biomarkers of lung cancer; however, contamination by non-tumor cells in the tumor microenvironment significantly interferes with the search for novel biomarkers. Tumor organoids, as a pre-clinical cancer model, exhibit similar molecular characteristics with tumor samples while minimizing the interference from other cells.<h4>Methods and results</h4>Here we analyzed six RNA-seq datasets collected from different organoid models, in which cells with oncogenic mutations were reprogrammed to mimic lung adenocarcinoma (LUAD) tumorigenesis. We uncovered 9 LUAD-specific biomarker genes by integrating transcriptomic data from multiple sources, and identified IRAK1BP1 as a novel predictor of LUAD disease outcome. Validation with RNA-seq and microarray data collected from multiple patient cohorts, as well as patient-derived xenograft (PDX) and lung cancer cell line models confirmed that IRAK1BP1 expression was significantly lower in tumor cells, and had no correlation with known markers oflung cancer prognosis. In addition, loss of IRAK1BP1 correlated with the group of LUAD patients with worse survival; and gene-set enrichment analysis using tumor and cell line data implicated that high IRAK1BP1 expression was associated with suppression of oncogenic pathways.<h4>Discussion</h4>In conclusion, we demonstrate that IRAK1BP1 is a promising biomarker of LUAD prognosis.
Also flagged:pathogenesiscoronavirus infectionacute respiratory syndromeinfectionCOVID-19immune response
Journal Article2023-03-13No SnippetsSameni M, Mirmotalebisohi SA, Dehghan Z, Abooshahab R, Khazaei-Poul Y, Mozafar M, Zali H, Zali H.
Show Full Abstract
The world has recently been plagued by a new coronavirus infection called SARS-CoV-2. This virus may lead to severe acute respiratory syndrome followed by multiple organ failure. SARS-CoV-2 has approximately 80-90% genetic similarity to SARS-CoV. Given the limited omics data available for host response to the viruses (more limited data for SARS-CoV-2), we attempted to unveil the crucial molecular mechanisms underlying the SARS-CoV-2 pathogenesis by comparing its regulatory network motifs with SARS-CoV. We also attempted to identify the non-shared crucial molecules and their functions to predict the specific mechanisms for each infection and the processes responsible for their different manifestations. Deciphering the crucial shared and non-shared mechanisms at the molecular level and signaling pathways underlying both diseases may help shed light on their pathogenesis and pave the way for other new drug repurposing against COVID-19. We constructed the GRNs for host response to SARS-CoV and SARS-CoV-2 pathogens (in vitro) and identified the significant 3-node regulatory motifs by analyzing them topologically and functionally. We attempted to identify the shared and non-shared regulatory elements and signaling pathways between their host responses. Interestingly, our findings indicated that <i>NFKB1</i>, <i>JUN</i>, <i>STAT1</i>, <i>FOS</i>, <i>KLF4</i>, and <i>EGR1</i> were the critical shared TFs between motif-related subnetworks in both SARS and COVID-1, which are considered genes with specific functions in the immune response. Enrichment analysis revealed that the NOD-like receptor signaling, TNF signaling, and influenza A pathway were among the first significant pathways shared between SARS and COVID-19 up-regulated DEGs networks, and the term "metabolic pathways" (hsa01100) among the down-regulated DEGs networks. WEE1, PMAIP1, and TSC22D2 were identified as the top three hubs specific to SARS. However, <i>MYPN</i>, <i>SPRY4</i>, <i>and</i> <i>APOL6</i> were the tops specific to COVID-19 in vitro. The term "Complement and coagulation cascades" pathway was identified as the first top non-shared pathway for COVID-19 and the MAPK signaling pathway for SARS. We used the identified crucial DEGs to construct a drug-gene interaction network to propose some drug candidates. Zinc chloride, Fostamatinib, Copper, Tirofiban, Tretinoin, and Levocarnitine were the six drugs with higher scores in our drug-gene network analysis.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s13205-023-03518-x.
Also flagged:carbohydratesamino acidsshort-chain fatty acidsulcerative colitisCystic fibrosisVitamin D
Journal Article2023-03-13No SnippetsWang T, Wang XW, Lee-Sarwar KA, Litonjua AA, Weiss ST, Sun Y, Maslov S, Liu YY.
Show Full Abstract
Characterizing the metabolic profile of a microbial community is crucial for understanding its biological function and its impact on the host or environment. Metabolomics experiments directly measuring these profiles are difficult and expensive, while sequencing methods quantifying the species composition of microbial communities are well-developed and relatively cost-effective. Computational methods that are capable of predicting metabolomic profiles from microbial compositions can save considerable efforts needed for metabolomic profiling experimentally. Yet, despite existing efforts, we still lack a computational method with high prediction power, general applicability, and great interpretability. Here we develop a method - mNODE (Metabolomic profile predictor using Neural Ordinary Differential Equations), based on a state-of-the-art family of deep neural network models. We show compelling evidence that mNODE outperforms existing methods in predicting the metabolomic profiles of human microbiomes and several environmental microbiomes. Moreover, in the case of human gut microbiomes, mNODE can naturally incorporate dietary information to further enhance the prediction of metabolomic profiles. Besides, susceptibility analysis of mNODE enables us to reveal microbe-metabolite interactions, which can be validated using both synthetic and real data. The presented results demonstrate that mNODE is a powerful tool to investigate the microbiome-diet-metabolome relationship, facilitating future research on precision nutrition.
bioRxiv2023-03-13Preprint (No Snippets API)George JE, Manna R, Roy S, Kumari S, Paul D.
Show Full Abstract
Step emulsification (SE), which generates droplets by a sharp change in confinement, has emerged as a potential alternative to flow-focusing technology. Water/dispersed phase is continuously pumped through a shallow inlet channel into a deep chamber pre-filled with the oil/continuous phase. The need for one or more pumps to maintain a continuous flow for droplet generation, and the consequent use of high sample volumes, limit this technique to research labs. Here, we report a pumpfree SE technique for rapid and high-throughput generation of monodisperse hydrogel (agarose) beads using <40 µ l sample volume. Instead of using syringe pumps, we sequentially pipetted oil and liquid agarose into a microfluidic SE device to generate between 20000 and 80000 agarose beads in ∼ 2 min. We also demonstrated the encapsulation of loop-mediated isothermal amplification mixture inside these beads at the time of their formation. Finally, using these beads as reaction chambers, we amplified nucleic acids from P. falciparum and SARS-CoV-2 inside them. The pump-free operation, tiny sample volume, and high-throughput generation of droplets by SE make our technique suitable for point-of-care diagnostics.
Research Square2023-03-13Preprint (No Snippets API)LE TH, Le XTK, Do RT, Doan HTT, Nguyen KT, Pham LTK.
Show Full Abstract
<title>Abstract</title> <p>The unified genotypic classification scheme (genotypes A0, A1–A8, and B1–B5) was proposed and applied for the classification of the infectious bursal disease virus (IBDV). Since 1987, IBDVs have circulated and evolved in Vietnam, but little is known about the genotypes present. The IBDV samples were collected in 1987, 2001–2006, 2008, 2011, 2015–2019, and 2021 in 18 provinces. We conducted phylogenotyping analysis based on the alignment of 143 VP2-HVR (439 bp, nt 628–1066; aa 210–355 in VP2), including 64 Vietnamese isolates and two vaccines, and 82 VP1 B-marker (725 bp, nt 13–737; aa 4–245 in VP1) sequences, including four Vietnamese isolates and one vaccine. The analysis revealed three A-genotypes, A1, A3, and A7, and two B-genotypes, B1 and B3, among the Vietnamese IBDVs. The IBDV strains showed the lowest average evolutionary distance at 8.6% between A1 and A3 and the highest (21.7%) between A5 and A7, while 14% was between B1 and B3 and 17% between B3 and B2. The signature residues <sup>222</sup>T - <sup>253</sup>Q - <sup>256</sup>V - <sup>294</sup>L - <sup>299</sup>(S/N) appeared to be unique for the genotype A2; the <sup>222</sup>A - <sup>253</sup>Q - <sup>256</sup>I - <sup>294</sup>I - <sup>299</sup>S for the A3, the <sup>222</sup>T - <sup>253</sup>Q - <sup>256</sup>V - <sup>294</sup>L - <sup>299</sup>N for the A5, the <sup>222</sup>Q - <sup>253</sup>E - <sup>256</sup>K - <sup>294</sup>L - <sup>299</sup>S for the A6, and the <sup>222</sup>A - <sup>253</sup>Q - <sup>256</sup>A - <sup>294</sup>L - <sup>299</sup>S for the A8, and each of these could be the genotypical motif for genotypic discrimination. The timeline statistical summary revealed that the A3-genotype predominated (79.8% presence) in Vietnam from 1987 to 2021 and that it has remained dominant in circulating IBDVs over the last five years (2016–2021).</p>
Also flagged:Interleukin-10RGS1Spindle Cell Variant Diffuse Large B-Cell LymphomaDiffuse large B-cell lymphomaspindlecytoplasms
Journal Article2023-03-12No SnippetsCarreras J, Kikuti YY, Miyaoka M, Hiraiwa S, Tomita S, Ikoma H, Kondo Y, Ito A, Nagase S, Miura H, Roncador G, Colomo L, Hamoudi R, Campo E, Nakamura N.
Show Full Abstract
Diffuse large B-cell lymphoma with spindle cell morphology is a rare variant. We present the case of a 74-year-old male who initially presented with a right supraclavicular (lymph) node enlargement. Histological analysis showed a proliferation of spindle-shaped cells with narrow cytoplasms. An immunohistochemical panel was used to exclude other tumors, such as melanoma, carcinoma, and sarcoma. The lymphoma was characterized by a cell-of-origin subtype of germinal center B-cell-like (GCB) based on Hans' classifier (CD10-negative, BCL6-positive, and MUM1-negative); EBER negativity, and the absence of <i>BCL2</i>, <i>BCL6</i>, and <i>MYC</i> rearrangements. Mutational profiling using a custom panel of 168 genes associated with aggressive B-cell lymphomas confirmed mutations in <i>ACTB</i>, <i>ARID1B</i>, <i>DUSP2</i>, <i>DTX1</i>, <i>HLA-B</i>, <i>PTEN</i>, and <i>TNFRSF14</i>. Based on the LymphGen 1.0 classification tool, this case had an ST2 subtype prediction. The immune microenvironment was characterized by moderate infiltration of M2-like tumor-associated macrophages (TMAs) with positivity of CD163, CSF1R, CD85A (LILRB3), and PD-L1; moderate PD-1 positive T cells, and low FOXP3 regulatory T lymphocytes (Tregs). Immunohistochemical expression of PTX3 and TNFRSF14 was absent. Interestingly, the lymphoma cells were positive for HLA-DP-DR, IL-10, and RGS1, which are markers associated with poor prognosis in DLBCL. The patient was treated with R-CHOP therapy, and achieved a metabolically complete response.
Also flagged:segmentationbiofilm formationspolysaccharidesorganizationpersistent infectionsinfections
Journal Article2023-03-12No SnippetsCesaria M, Calcagnile M, Alifano P, Cataldo R.
Show Full Abstract
Biofilms are key bacterial communities in genetic and adaptive resistance to antibiotics as well as disease control strategies. The mature high-coverage biofilm formations of the <i>Vibrio campbellii</i> strains (wild type BB120 and isogenic derivatives JAF633, KM387, and JMH603) are studied here through the unstraightforward digital processing of morphologically complex images without segmentation or the unrealistic simplifications used to artificially simulate low-density formations. The main results concern the specific mutant- and coverage-dependent short-range orientational correlation as well as the coherent development of biofilm growth pathways over the subdomains of the image. These findings are demonstrated to be unthinkable based only on a visual inspection of the samples or on methods such as Voronoi tessellation or correlation analyses. The presented approach is general, relies on measured rather than simulated low-density formations, and could be employed in the development of a highly efficient screening method for drugs or innovative materials.
Also flagged:Neurodegenerative diseasessynapsesdendritesmyelinMitochondrial dysfunctionmitochondrial
Journal Article2023-03-12No SnippetsSuárez-Rivero JM, López-Pérez J, Muela-Zarzuela I, Pastor-Maldonado C, Cilleros-Holgado P, Gómez-Fernández D, Álvarez-Córdoba M, Munuera-Cabeza M, Talaverón-Rey M, Povea-Cabello S, Suárez-Carrillo A, Piñero-Pérez R, Reche-López D, Romero-Domínguez JM, Sánchez-Alcázar JA.
Show Full Abstract
Neurodegenerative diseases are characterized by the progressive loss of neurons, synapses, dendrites, and myelin in the central and/or peripheral nervous system. Actual therapeutic options for patients are scarce and merely palliative. Although they affect millions of patients worldwide, the molecular mechanisms underlying these conditions remain unclear. Mitochondrial dysfunction is generally found in neurodegenerative diseases and is believed to be involved in the pathomechanisms of these disorders. Therefore, therapies aiming to improve mitochondrial function are promising approaches for neurodegeneration. Although mitochondrial-targeted treatments are limited, new research findings have unraveled the therapeutic potential of several groups of antibiotics. These drugs possess pleiotropic effects beyond their anti-microbial activity, such as anti-inflammatory or mitochondrial enhancer function. In this review, we will discuss the controversial use of antibiotics as potential therapies in neurodegenerative diseases.
Also flagged:agarosecapsulepeptidewound healingalginatecalcium chloride
Journal Article2023-03-12No SnippetsNguyen-Le TA, Zhao X, Bachmann M, Ruelens P, Visser JAGM, Baraban L.
Show Full Abstract
Bacteria primarily live in structured environments, such as colonies and biofilms, attached to surfaces or growing within soft tissues. They are engaged in local competitive and cooperative interactions impacting our health and well-being, for example, by affecting population-level drug resistance. Our knowledge of bacterial competition and cooperation within soft matrices is incomplete, partly because we lack high-throughput tools to quantitatively study their interactions. Here, we introduce a method to generate a large amount of agarose microbeads that mimic the natural culture conditions experienced by bacteria to co-encapsulate two strains of fluorescence-labeled <i>Escherichia coli</i>. Focusing specifically on low bacterial inoculum (1-100 cells/capsule), we demonstrate a study on the formation of colonies of both strains within these 3D scaffolds and follow their growth kinetics and interaction using fluorescence microscopy in highly replicated experiments. We confirmed that the average final colony size is inversely proportional to the inoculum size in this semi-solid environment as a result of limited available resources. Furthermore, the colony shape and fluorescence intensity per colony are distinctly different in monoculture and co-culture. The experimental observations in mono- and co-culture are compared with predictions from a simple growth model. We suggest that our high throughput and small footprint microbead system is an excellent platform for future investigation of competitive and cooperative interactions in bacterial communities under diverse conditions, including antibiotics stress.
Journal Article2023-03-12No SnippetsO'Boyle NM, Helesbeux JJ, Meegan MJ, Sasse A, O'Shaughnessy E, Qaisar A, Clancy A, McCarthy F, Marchand P.
Show Full Abstract
The Group for the Promotion of Pharmaceutical Chemistry in Academia (GP<sub>2</sub>A) held their 30th annual conference in August 2022 in Trinity College Dublin, Ireland. There were 9 keynote presentations, 10 early career researcher presentations and 41 poster presentations.
Also flagged:Copolymercopolymethacrylatesphenyl benzoatebenzoic acidcinnamateorganization
Journal Article2023-03-12No SnippetsNakajima G, Kondo M, Sakamoto M, Sasaki T, Ono H, Kawatsuki N.
Show Full Abstract
Copolymer films of photoalignable liquid crystalline (LC) copolymethacrylates comprised of a phenyl benzoate mesogen connected with <i>N</i>-benzylideneaniline end moiety (NBA2) and benzoic acid (BA) side groups exhibit a photoinduced reorientation behavior. Significant thermally stimulated molecular reorientation attains a dichroism (<i>D</i>) greater than 0.7 for all copolymer films and a birefringence of 0.113-0.181. In situ thermal hydrolysis of the oriented NBA2 groups decreases the birefringence to 0.111-0.128. However, the oriented structures of the film are maintained, demonstrating a photo-durability, even though the NBA2 side groups photo-react. The hydrolyzed oriented films show higher photo-durability without changing their optical properties.
bioRxiv2023-03-12Preprint (No Snippets API)Sneideris T, Erkamp NA, Ausserwöger H, Saar KL, Welsh TJ, Qian D, Johncock MLLY, Krainer G, Borodavka A, Knowles TPJ.
Show Full Abstract
Antimicrobial peptides (AMPs) are a vital part of the immune system that helps combat bacterial infections by disrupting the bacterial cell membrane or interacting with intracellular targets. However, the mechanisms by which AMPs act on intracellular targets are not well understood. Using machine learning-based sequence analysis, we have discovered that a significant number of AMPs have a strong tendency to form liquid-like condensates in the presence of nucleic acids, a process known as phase separation. We have demonstrated that this phase separation propensity is linked to the effectiveness of the AMPs in inhibiting transcription and translation in vitro, as well as their ability to compact nucleic acids and form clusters with bacterial nucleic acids in bacterial cells. We propose that the AMP-driven compaction of nucleic acids and modulation of their phase transitions constitute a previously unrecognised mechanism by which AMPs exert their antibacterial effects. These findings open up exciting possibilities for the development of antimicrobials that target nucleic acid phase transitions.
Also flagged:1,2-dithiolanesdisulfidelipoic aciddithiolanealkenesdegradation
Journal Article2023-03-11No SnippetsNelson BR, Kirkpatrick BE, Miksch CE, Davidson MD, Skillin NP, Hach GK, Khang A, Hummel SN, Fairbanks BD, Burdick JA, Bowman CN, Anseth KS.
Show Full Abstract
While many hydrogels are elastic networks crosslinked by covalent bonds, viscoelastic hydrogels with adaptable crosslinks are increasingly being developed to better recapitulate time and position-dependent processes found in many tissues. In this work, 1,2-dithiolanes are presented as dynamic covalent photocrosslinkers of hydrogels, resulting in disulfide bonds throughout the hydrogel that respond to multiple stimuli. Using lipoic acid as a model dithiolane, disulfide crosslinks are formed under physiological conditions, enabling cell encapsulation via an initiator-free light-induced dithiolane ring-opening photopolymerization. The resulting hydrogels allow for multiple photoinduced dynamic responses including stress relaxation, stiffening, softening, and network functionalization using a single chemistry, which can be supplemented by permanent reaction with alkenes to further control network properties and connectivity using irreversible thioether crosslinks. Moreover, complementary photochemical approaches are used to achieve rapid and complete sample degradation via radical scission and post-gelation network stiffening when irradiated in the presence of reactive gel precursor. The results herein demonstrate the versatility of this material chemistry to study and direct 2D and 3D cell-material interactions. This work highlights dithiolane-based hydrogel photocrosslinking as a robust method for generating adaptable hydrogels with a range of biologically relevant mechanical and chemical properties that are varied on demand.
Also flagged:COPDhypoxanthinecadherin 5CDH5bronchiectasismetabolic syndrome
Journal Article2023-03-11✓ 3 SnippetsZhang Z, Wang J, Li Y, Liu F, Chen L, He S, Lin F, Wei X, Fang Y, Li Q, Zhou J, Lu W.
In-Text Gene Mentions
Discussion)
…Moreover, SOD1, PRDX2, CAT, PRDX6, HBB, GSTO1, and HBA1 were highly expressed in COPD-MD.…
Results)
…We found that the subtype II was enriched in metabolic pathways, biosynthesis of antibiotics, carbon metabolism, biosynthesis of amino acids, and glycolysis/gluconeogenesis, and the involved proteins included SOD1, PRDX2, CAT, PRDX6, HBB, GSTO1, and HBA1.…
Results)
…SOD1, PRDX2, CAT,PRDX6, HBB, GSTO1, and…
Show Full Abstract
<h4>Background</h4>Chronic obstructive pulmonary disease (COPD) is a complex and heterogeneous disease with high morbidity and mortality, especially in advanced patients. We aimed to develop multi-omics panels of biomarkers for the diagnosis and explore its molecular subtypes.<h4>Methods</h4>A total of 40 stable patients with advanced COPD and 40 controls were enrolled in the study. Proteomics and metabolomics techniques were applied to identify potential biomarkers. An additional 29 COPD and 31 controls were enrolled for validation of the obtained proteomic signatures. Information on demographic, clinical manifestation, and blood test were collected. The ROC analyses were carried out to evaluate the diagnostic performance, and experimentally validated the final biomarkers on mild-to-moderate COPD. Next, molecular subtyping was performed using proteomics data.<h4>Results</h4>Theophylline, palmitoylethanolamide, hypoxanthine, and cadherin 5 (CDH5) could effectively diagnose advanced COPD with high accuracy (auROC = 0.98, sensitivity of 0.94, and specificity of 0.95). The performance of the diagnostic panel was superior to that of other single/combined results and blood tests. Proteome based stratification of COPD revealed three subtypes (I-III) related to different clinical outcomes and molecular feature: simplex COPD, COPD co-existing with bronchiectasis, and COPD largely co-existing with metabolic syndrome, respectively. Two discriminant models were established using the auROC of 0.96 (Principal Component Analysis, PCA) and 0.95 (the combination of RRM1 + SUPV3L1 + KRT78) in differentiating COPD and COPD with co-morbidities. Theophylline and CDH5 were exclusively elevated in advanced COPD but not in its mild form.<h4>Conclusions</h4>This integrative multi-omics analysis provides a more comprehensive understanding of the molecular landscape of advanced COPD, which may suggest molecular targets for specialized therapy.
Also flagged:nanohydroxyapatitevinylextracellularosteogenesisangiogenesismineral
Journal Article2023-03-11No SnippetsTong L, Pu X, Liu Q, Li X, Chen M, Wang P, Zou Y, Lu G, Liang J, Fan Y, Zhang X, Sun Y.
Show Full Abstract
Nanostructured biomaterials that replicate natural bone architecture are expected to facilitate bone regeneration. Here, nanohydroxyapatite (nHAp) with vinyl surface modification is acquired by silicon-based coupling agent and photointegrated with methacrylic anhydride-modified gelatin to manufacture a chemically integrated 3D-printed hybrid bone scaffold (75.6 wt% solid content). This nanostructured procedure significantly increases its storage modulus by 19.43-fold (79.2 kPa) to construct a more stable mechanical structure. Furthermore, biofunctional hydrogel with biomimetic extracellular matrix is anchored onto the filament of 3D-printed hybrid scaffold (HGel-g-nHAp) by polyphenol-mediated multiple chemical reactions, which contributes to initiate early osteogenesis and angiogenesis by recruiting endogenous stem cells in situ. Significant ectopic mineral deposition is also observed in subcutaneously implanted nude mice with storage modulus enhancement of 25.3-fold after 30 days. Meanwhile, HGel-g-nHAp realizes substantial bone reconstruction in the rabbit cranial defect model, achieving 61.3% breaking load strength and 73.1% bone volume fractions in comparison to natural cranium 15 weeks after implantation. This optical integration strategy of vinyl modified nHAp provides a prospective structural design for regenerative 3D-printed bone scaffold.
Journal Article2023-03-11✓ 1 SnippetGeorge N, Bhandari P, Shruptha P, Jayaram P, Chaudhari S, Satyamoorthy K.
In-Text Gene Mentions
S I O 001029)
…Studies have also shown that SOX6 is a downstream target of MAPK4 that triggers autophagy in CC and it functions through the inhibition of the PI3K-AKT-mTOR pathway and activation of the MAPK/ERK pathway [234].…
Show Full Abstract
Cervical cancer being one of the primary causes of high mortality rates among women is an area of concern, especially with ineffective treatment strategies. Extensive studies are carried out to understand various aspects of cervical cancer initiation, development and progression; however, invasive cervical squamous cell carcinoma has poor outcomes. Moreover, the advanced stages of cervical cancer may involve lymphatic circulation with a high risk of tumor recurrence at distant metastatic sites. Dysregulation of the cervical microbiome by human papillomavirus (HPV) together with immune response modulation and the occurrence of novel mutations that trigger genomic instability causes malignant transformation at the cervix. In this review, we focus on the major risk factors as well as the functionally altered signaling pathways promoting the transformation of cervical intraepithelial neoplasia into invasive squamous cell carcinoma. We further elucidate genetic and epigenetic variations to highlight the complexity of causal factors of cervical cancer as well as the metastatic potential due to the changes in immune response, epigenetic regulation, DNA repair capacity, and cell cycle progression. Our bioinformatics analysis on metastatic and non-metastatic cervical cancer datasets identified various significantly and differentially expressed genes as well as the downregulation of potential tumor suppressor microRNA miR-28-5p. Thus, a comprehensive understanding of the genomic landscape in invasive and metastatic cervical cancer will help in stratifying the patient groups and designing potential therapeutic strategies.
Also flagged:glioblastomatranslationaltemozolomidemethylationandrogen receptorAR
Journal Article2023-03-11No SnippetsSchnöller LE, Piehlmaier D, Weber P, Brix N, Fleischmann DF, Nieto AE, Selmansberger M, Heider T, Hess J, Niyazi M, Belka C, Lauber K, Unger K, Orth M.
Show Full Abstract
Despite intensive basic scientific, translational, and clinical efforts in the last decades, glioblastoma remains a devastating disease with a highly dismal prognosis. Apart from the implementation of temozolomide into the clinical routine, novel treatment approaches have largely failed, emphasizing the need for systematic examination of glioblastoma therapy resistance in order to identify major drivers and thus, potential vulnerabilities for therapeutic intervention. Recently, we provided proof-of-concept for the systematic identification of combined modality radiochemotherapy treatment vulnerabilities via integration of clonogenic survival data upon radio(chemo)therapy with low-density transcriptomic profiling data in a panel of established human glioblastoma cell lines. Here, we expand this approach to multiple molecular levels, including genomic copy number, spectral karyotyping, DNA methylation, and transcriptome data. Correlation of transcriptome data with inherent therapy resistance on the single gene level yielded several candidates that were so far underappreciated in this context and for which clinically approved drugs are readily available, such as the androgen receptor (AR). Gene set enrichment analyses confirmed these results, and identified additional gene sets, including reactive oxygen species detoxification, mammalian target of rapamycin complex 1 (MTORC1) signaling, and ferroptosis/autophagy-related regulatory circuits to be associated with inherent therapy resistance in glioblastoma cells. To identify pharmacologically accessible genes within those gene sets, leading edge analyses were performed yielding candidates with functions in thioredoxin/peroxiredoxin metabolism, glutathione synthesis, chaperoning of proteins, prolyl hydroxylation, proteasome function, and DNA synthesis/repair. Our study thus confirms previously nominated targets for mechanism-based multi-modal glioblastoma therapy, provides proof-of-concept for this workflow of multi-level data integration, and identifies novel candidates for which pharmacological inhibitors are readily available and whose targeting in combination with radio(chemo)therapy deserves further examination. In addition, our study also reveals that the presented workflow requires mRNA expression data, rather than genomic copy number or DNA methylation data, since no stringent correlation between these data levels could be observed. Finally, the data sets generated in the present study, including functional and multi-level molecular data of commonly used glioblastoma cell lines, represent a valuable toolbox for other researchers in the field of glioblastoma therapy resistance.
Also flagged:gestationchromosomal anomaliescardiac defectsatrial septal defectventricular septal defectductus arteriosus
Journal Article2023-03-11No SnippetsKatheria A, Mercer J, Poeltler D, Morales A, Torres N, Lakshminrusimha S, Singh Y.
Show Full Abstract
<h4>Objective</h4>To assess the hemodynamic safety and efficacy of umbilical cord milking (UCM) compared with early cord clamping (ECC) in nonvigorous newborn infants enrolled in a large multicenter randomized cluster-crossover trial.<h4>Study design</h4>Two hundred twenty-seven nonvigorous term or near-term infants who were enrolled in the parent UCM vs ECC trial consented for this substudy. An echocardiogram was performed at 12 ± 6 hours of age by ultrasound technicians blinded to randomization. The primary outcome was left ventricular output (LVO). Prespecified secondary outcomes included measured superior vena cava (SVC) flow, right ventricular output (RVO), peak systolic strain, and peak systolic velocity by tissue Doppler examination of the RV lateral wall and the interventricular septum.<h4>Results</h4>Nonvigorous infants receiving UCM had increased hemodynamic echocardiographic parameters as measured by higher LVO (225 ± 64 vs 187 ± 52 mL/kg/min; P < .001), RVO (284 ± 88 vs 222 ± 96 mL/kg/min; P < .001), and SVC flow (100 ± 36 vs 86 ± 40 mL/kg/min; P < .001) compared with the ECC group. Peak systolic strain was lower (-17 ± 3 vs -22 ± 3%; P < .001), but there was no difference in peak tissue Doppler flow (0.06 m/s [IQR, 0.05-0.07 m/s] vs 0.06 m/s [IQR, 0.05-0.08 m/s]).<h4>Conclusions</h4>UCM increased cardiac output (as measured by LVO) compared with ECC in nonvigorous newborns. Overall increases in measures of cerebral and pulmonary blood flow (as measured by SVC and RVO flow, respectively) may explain improved outcomes associated with UCM (less cardiorespiratory support at birth and fewer cases of moderate-to-severe hypoxic ischemic encephalopathy) among nonvigorous newborn infants.
Exosomes are a subtype of extracellular vesicles (EVs) with a size range between 30 and 150 nm, which can be released by the majority of cell types and circulate in body fluid. They function as a long-distance cell-to-cell communication mechanism that modulates the gene expression profile and fate of target cells. Increasing evidence has indicated exosomes' central role in regulating various complex reproductive processes. However, to our knowledge, a review that focally and vividly describes the role of exosomes in reproductive development is still lacking. This review highlights our knowledge about the contribution of exosomes to early mammalian reproduction, such as gametogenesis, fertilization, early embryonic development, implantation, placentation and pregnancy. The discussion is primarily drawn from literature pertaining to the mammalian lineage with emphasis on the roles of exosomes in human reproduction and laboratory and livestock models.
Also flagged:Homeobox Transcription FactorsGscTFChordinChrdWnt
Journal Article2023-03-11✓ 2 SnippetsKumar V, Umair Z, Lee U, Kim J.
In-Text Gene Mentions
Discussion)
…in switching thesox6gene for craniofacial…
Discussion)
…chrd, nog, andsox6during vertebrate embryonic…
Show Full Abstract
The reciprocal inhibition between two signaling centers, the Spemann organizer (dorsal mesoderm) and ventral region (mesoderm and ectoderm), collectively regulate the overall development of vertebrate embryos. Each center expresses key homeobox transcription factors (TFs) that directly control target gene transcription. Goosecoid (Gsc) is an organizer (dorsal mesoderm)-specific TF known to induce dorsal fate and inhibit ventral/ectodermal specification. Ventx1.1 (downstream of Bmp signaling) induces the epidermal lineage and inhibits dorsal organizer-specific genes from the ventral region. Chordin (Chrd) is an organizer-specific secreted Bmp antagonist whose expression is primarily activated by Gsc. Alternatively, <i>chrd</i> expression is repressed by Bmp/Ventx1.1 in the ventral/epidermal region. However, the regulatory mechanisms underlying the transcription mediated by Gsc and Ventx1.1 remain elusive. Here, we found that the <i>chrd</i> promoter contained two cis-acting response elements that responded negatively to Ventx1.1 and positively to Gsc. In the ventral/ectodermal region, Ventx1.1 was directly bound to the Ventx1.1 response element (VRE) and inhibited <i>chrd</i> transcription. In the organizer region, Gsc was bound to the Gsc response elements (GRE) to activate <i>chrd</i> transcription. The Gsc-mediated positive response on the <i>chrd</i> promoter completely depended on another adjacent Wnt response cis-acting element (WRE), which was the TCF7 (also known as Tcf1) binding element. Site-directed mutagenesis of VRE, GRE, or WRE completely abolished the repressive or activator activity of Ventx1.1 and Gsc, respectively. The ChIP-PCR results confirmed the direct binding of Ventx1.1 and Gsc/Tcf7 to VRE and GRE/WRE, respectively. These results demonstrated that <i>chrd</i> expression is oppositely modulated by homeobox TFs, Ventx1.1, and Gsc/Tcf7 during the embryonic patterning of <i>Xenopus</i> gastrula.
…The single discrepant case was a new myelomonocytic AML in which 18% and 20% blasts were detected by 200-cell and 500-cell DCC, respectively.…
Introduction)
…IP) for BMADCC, secondly, to contrast…
Introduction)
…two levels ofDCC(200- vs 500-cell…
Introduction)
…(200- vs 500-cellDCC), and finally, to…
Methods)
…BMADCCwas performed according…
Show Full Abstract
Despite a lack of evidence, a bone marrow aspirate differential of 500 cells is commonly used in the clinical setting. We aimed to test the performance of 200-cell counts for daily hematological workup. In total, 660 consecutive samples were analyzed recording differentials at 200 and 500 cells. Additionally, immunophenotype results and preanalytical issues were also evaluated. Clinical and statistical differences between both cutoffs and both methods were checked. An independent control group of 122 patients was included. All comparisons between both cutoffs and both methods for all relevant types of cells did not show statistically significant differences. No significant diagnostic discrepancies were demonstrated in the contingency table analysis. This is a real-life study, and some limitations may be pointed out, such as a different sample sizes according to the type of cell in the immunophenotype analysis, the lack of standardization of some preanalytical events, and the relatively small sample size of the control group. The comparisons of differentials by morphology on 200 and 500 cells, as well as by morphology (both cutoffs) and by immunophenotype, are equivalent from the clinical and statistical point of view. The preanalytical issues play a critical role in the assessment of bone marrow aspirate samples.
Journal Article2023-03-11No SnippetsSkopek R, Palusińska M, Kaczor-Keller K, Pingwara R, Papierniak-Wyglądała A, Schenk T, Lewicki S, Zelent A, Szymański Ł.
Show Full Abstract
Immortalized cell lines are widely used in vitro tools in oncology and hematology research. While these cell lines represent artificial systems and may accumulate genetic aberrations with each passage, they are still considered valuable models for pilot, preliminary, and screening studies. Despite their limitations, cell lines are cost-effective and provide repeatable and comparable results. Choosing the appropriate cell line for acute myeloid leukemia (AML) research is crucial for obtaining reliable and relevant results. Several factors should be considered when selecting a cell line for AML research, such as specific markers and genetic abnormalities associated with different subtypes of AML. It is also essential to evaluate the karyotype and mutational profile of the cell line, as these can influence the behavior and response to the treatment of the cells. In this review, we evaluate immortalized AML cell lines and discuss the issues surrounding them concerning the revised World Health Organization and the French-American-British classifications.
<i>Helicobacter pylori</i> (<i>H. pylori</i>) has been associated with cardiovascular diseases. The pro-inflammatory <i>H. pylori</i> virulence factor cytotoxin-associated gene A (CagA) has been detected in serum exosomes of <i>H. pylori</i>-infected subjects and may exert systemic effects throughout the cardiovascular system. The role of <i>H. pylori</i> and CagA in vascular calcification was hitherto unknown. The aim of this study was to determine the vascular effects of CagA through human coronary artery smooth muscle cell (CASMC) osteogenic and pro-inflammatory effector gene expression as well as interleukin 1β secretion and cellular calcification. CagA upregulated bone morphogenic protein 2 (BMP-2) associated with an osteogenic CASMC phenotype switch and induced increased cellular calcification. Furthermore, a pro-inflammatory response was observed. These results support that <i>H. pylori</i> may contribute to vascular calcification through CagA rendering CASMCs osteogenic and inducing calcification.
Also flagged:Coagulationproteasesclottinghemostasiscoagulation disordershemophilia
Journal Article2023-03-11✓ 1 SnippetChung D, Bakshi S, van der Graaf PH.
In-Text Gene Mentions
Introduction)
…vitamin K cycle,antithrombin-III(AT-III), and tissue…
Show Full Abstract
Despite the numerous therapeutic options to treat bleeding or thrombosis, a comprehensive quantitative mechanistic understanding of the effects of these and potential novel therapies is lacking. Recently, the quality of quantitative systems pharmacology (QSP) models of the coagulation cascade has improved, simulating the interactions between proteases, cofactors, regulators, fibrin, and therapeutic responses under different clinical scenarios. We aim to review the literature on QSP models to assess the unique capabilities and reusability of these models. We systematically searched the literature and BioModels database reviewing systems biology (SB) and QSP models. The purpose and scope of most of these models are redundant with only two SB models serving as the basis for QSP models. Primarily three QSP models have a comprehensive scope and are systematically linked between SB and more recent QSP models. The biological scope of recent QSP models has expanded to enable simulations of previously unexplainable clotting events and the drug effects for treating bleeding or thrombosis. Overall, the field of coagulation appears to suffer from unclear connections between models and irreproducible code as previously reported. The reusability of future QSP models can improve by adopting model equations from validated QSP models, clearly documenting the purpose and modifications, and sharing reproducible code. The capabilities of future QSP models can improve from more rigorous validation by capturing a broader range of responses to therapies from individual patient measurements and integrating blood flow and platelet dynamics to closely represent in vivo bleeding or thrombosis risk.
…conditions such ashemochromatosisand α-1-antitrypsin deficiency…
Show Full Abstract
Autoimmune hepatitis (AIH) arises as a result of environmental and immunological interactions. Herbal and dietary supplements (HDS) are known triggers, and approximately half of the U.S. adult population consumes them, even though they are restricted. Therefore, the importance of recognizing potential triggers of AIH is considered relevant. The mechanism behind HDS Camellia Sinensis inducing AIH is related to its compounds, catechins, which induce reactive oxygen species leading to a liver immune-mediated response. We present here a challenging case of a middle-aged woman with AIH following the consumption of a weight-loss Mexican green tea containing Camellia Sinensis.
bioRxiv2023-03-11Preprint (No Snippets API)Larsson I, Held F, Popova G, Koc A, Jörnsten R, Nelander S.
Show Full Abstract
Nervous system cancers contain a large spectrum of transcriptional cell states, reflecting processes active during normal development, injury response and growth. However, we lack a good understanding of these states’ regulation and pharmacological importance. Here, we describe the integrated reconstruction of such cellular regulatory programs and their therapeutic targets from extensive collections of single-cell RNA sequencing data (scRNA-seq) from both tumors and developing tissues. Our method, termed single-cell Regulatory-driven Clustering ( scRegClust ), predicts essential kinases and transcription factors in little computational time thanks to a new efficient optimization strategy. Using this method, we analyze scRNA-seq data from both adult and childhood brain cancers to identify transcription factors and kinases that regulate distinct tumor cell states. In adult glioblastoma, our model predicts that blocking the activity of PDGFRA , DDR1 , ERBB3 or SOX6 , or increasing YBX1 -activity, would potentiate temozolomide treatment. We further perform an integrative study of scRNA-seq data from both cancer and the developing brain to uncover the regulation of emerging meta-modules. We find a meta-module regulated by the transcription factors SPI1 and IRF8 and link it to an immune-mediated mesenchymal-like state. Our algorithm is available as an easy-to-use R package and companion visualization tool that help uncover the regulatory programs underlying cell plasticity in cancer and other diseases.
Also flagged:ACADVLmethylationtranslationalgadoliniummyocardial fibrosissingle-cell migration
Journal Article2023-03-10No SnippetsHsu CC, Wang JS, Shyu YC, Fu TC, Juan YH, Yuan SS, Wang CH, Yeh CH, Liao PC, Wu HY, Hsu PH.
Show Full Abstract
<h4>Background</h4>Emerging evidence suggests that DNA methylation can be affected by physical activities and is associated with cardiac fibrosis. This translational research examined the implications of DNA methylation associated with the high-intensity interval training (HIIT) effects on cardiac fibrosis in patients with heart failure (HF).<h4>Methods</h4>Twelve HF patients were included and received cardiovascular magnetic resonance imaging with late gadolinium enhancement for cardiac fibrosis severity and a cardiopulmonary exercise test for peak oxygen consumption ([Formula: see text]O<sub>2peak</sub>). Afterwards, they underwent 36 sessions of HIIT at alternating 80% and 40% of [Formula: see text]O<sub>2peak</sub> for 30 min per session in 3-4 months. Human serum from 11 participants, as a means to link cell biology to clinical presentations, was used to investigate the exercise effects on cardiac fibrosis. Primary human cardiac fibroblasts (HCFs) were incubated in patient serum, and analyses of cell behaviour, proteomics (n = 6) and DNA methylation profiling (n = 3) were performed. All measurements were conducted after completing HIIT.<h4>Results</h4>A significant increase (p = 0.009) in [Formula: see text]O<sub>2peak</sub> (pre- vs. post-HIIT = 19.0 ± 1.1 O<sub>2</sub> ml/kg/min vs. 21.8 ± 1.1 O<sub>2</sub> ml/kg/min) was observed after HIIT. The exercise strategy resulted in a significant decrease in left ventricle (LV) volume by 15% to 40% (p < 0.05) and a significant increase in LV ejection fraction by approximately 30% (p = 0.010). LV myocardial fibrosis significantly decreased from 30.9 ± 1.2% to 27.2 ± 0.8% (p = 0.013) and from 33.4 ± 1.6% to 30.1 ± 1.6% (p = 0.021) in the middle and apical LV myocardium after HIIT, respectively. The mean single-cell migration speed was significantly (p = 0.044) greater for HCFs treated with patient serum before (2.15 ± 0.17 μm/min) than after (1.11 ± 0.12 μm/min) HIIT. Forty-three of 1222 identified proteins were significantly involved in HIIT-induced altered HCF activities. There was significant (p = 0.044) hypermethylation of the acyl-CoA dehydrogenase very long chain (ACADVL) gene with a 4.474-fold increase after HIIT, which could activate downstream caspase-mediated actin disassembly and the cell death pathway.<h4>Conclusions</h4>Human investigation has shown that HIIT is associated with reduced cardiac fibrosis in HF patients. Hypermethylation of ACADVL after HIIT may contribute to impeding HCF activities. This exercise-associated epigenetic reprogramming may contribute to reduce cardiac fibrosis and promote cardiorespiratory fitness in HF patients.<h4>Trial registration</h4>NCT04038723. Registered 31 July 2019, https://clinicaltrials.gov/ct2/show/NCT04038723 .
<h4>Introduction</h4>Thyroid nodules are common diseases of the endocrine system, with a 5% prevalence rate in the general population. This study aimed to identify prevalence, clinical, cytological and ultrasonographic features of incidental thyroid cancer and its associated factors in Vietnam.<h4>Methods</h4>This cross-sectional descriptive study consisted of 208 patients with incidental thyroid nodules detected by ultrasound at the Endocrinology Department, Bach Mai Hospital, Hanoi, Vietnam between November 2019 and August 2020. Clinical information, sonography characteristics of thyroid nodules, results of fine-needle aspiration biopsy (FNAB), postoperative pathology and lymph node metastasis were collected. A multiple logistic regression model was used to estimate factors associated with thyroid cancer.<h4>Results</h4>A total of 272 thyroid nodules (from 208 participants) were included in this study. The mean age was 47.2 ± 12.0 (years). The rate of incidental thyroid cancer patients detected was 17.3%. Nodules <1 cm in size were significantly more prevalent for malignant nodules. The size of more than half of thyroid cancer nodules was 0.50-0.99 cm. Postoperative pathology of all nodules with Bethesda V and VI was papillary thyroid cancer which was consistent with cytological results. 33.3% of thyroid cancer patients have lymph node metastasis. The regression model showed that thyroid cancer was more likely to occur at a younger age (≤ 45 years vs. >45 years, OR 2.8; 95% CI: 1.3-6.1), taller-than-wide nodules (OR 6.8; 95% CI: 2.3-20.2) and hypo-echoic nodules (OR 5.2; 95% CI: 1.7-15.9).<h4>Conclusion</h4>The study showed that the prevalence of incidental thyroid cancers was 17.3%, of which 100% was papillary carcinoma. People under the age of 45 and the presence of ultrasound characteristics, such as taller-than-wide and hypoechoic nodules increased risk for malignancy.
Also flagged:ALSamyotrophic lateral sclerosisANGSOD1TARDBPVAPB
Journal Article2023-03-10No SnippetsDilliott AA, Al Nasser A, Elnagheeb M, Fifita J, Henden L, Keseler IM, Lenz S, Marriott H, Mccann E, Mesaros M, Opie-Martin S, Owens E, Palus B, Ross J, Wang Z, White H, Al-Chalabi A, Andersen PM, Benatar M, Blair I, Cooper-Knock J, Harrington EA, Heckmann J, Landers J, Moreno C, Nel M, Rampersaud E, Roggenbuck J, Rouleau G, Traynor B, Van Blitterswijk M, Van Rheenen W, Veldink J, Weishaupt J, Drury L, Harms MB, Farhan SMK, Amyotrophic lateral sclerosis spectrum disorders Gene Curation Expert Panel.
Show Full Abstract
<i>Objective</i>: In 2021, the Clinical Genome Resource (ClinGen) amyotrophic lateral sclerosis (ALS) spectrum disorders Gene Curation Expert Panel (GCEP) was established to evaluate the strength of evidence for genes previously reported to be associated with ALS. Through this endeavor, we will provide standardized guidance to laboratories on which genes should be included in clinical genetic testing panels for ALS. In this manuscript, we aimed to assess the heterogeneity in the current global landscape of clinical genetic testing for ALS. <i>Methods</i>: We reviewed the National Institutes of Health (NIH) Genetic Testing Registry (GTR) and members of the ALS GCEP to source frequently used testing panels and compare the genes included on the tests. <i>Results</i>: 14 clinical panels specific to ALS from 14 laboratories covered 4 to 54 genes. All panels report on <i>ANG</i>, <i>SOD1</i>, <i>TARDBP</i>, and <i>VAPB</i>; 50% included or offered the option of including <i>C9orf72</i> hexanucleotide repeat expansion (HRE) analysis. Of the 91 genes included in at least one of the panels, 40 (44.0%) were included on only a single panel. We could not find a direct link to ALS in the literature for 14 (15.4%) included genes. <i>Conclusions</i>: The variability across the surveyed clinical genetic panels is concerning due to the possibility of reduced diagnostic yields in clinical practice and risk of a missed diagnoses for patients. Our results highlight the necessity for consensus regarding the appropriateness of gene inclusions in clinical genetic ALS tests to improve its application for patients living with ALS and their families.
Constantly stimulated by the tumor microenvironment (TME), programmed death 1 (PD‑1) is elevated, and it interacts with PD ligand 1 (PD‑L1), rendering chimeric antigen receptor (CAR)‑T cells dysfunctional. Hence, CAR‑T cells immune to PD‑1‑induced immunosuppression were constructed to improve the function of CAR‑T cells in hepatocellular carcinoma (HCC). Double‑target CAR‑T cells, targeting glypican‑3 (GPC3) [a tumour-associated antigen (TAA)] and hindering PD‑1‑PD‑L1 binding, were established. The expression of GPC3, PD‑L1, and inhibitory receptors was measured using flow cytometry. The cytotoxicity, cytokine release, and differentiation level of CAR‑T cells were determined using lactate dehydrogenase release assay, enzyme‑linked immunosorbent assay, and flow cytometry, respectively. HCC cells were targeted and eliminated by double‑target CAR‑T cells. These double‑target CAR‑T cells limit PD‑1‑PD‑L1 binding and sustain cytotoxicity to PD‑L1<sup>+</sup> HCC cells. The relatively low IR expression and differentiation level in double‑target CAR‑T cells in tumour tissues induced tumour‑suppression and extended survival in PD‑L1<sup>+</sup> HCC TX models, as opposed to their single‑target counterparts. The results of the present study suggested that the newly constructed double‑target CAR‑T cells exhibit stronger tumour‑suppressing effects in HCC than their single‑target counterparts, which are common, suggesting the potential of strengthening CAR‑T cell activity in HCC treatment.
Also flagged:mitochondrialSCFubiquitin E3 ligaseBNIP3NIXmitophagy
Journal Article2023-03-10✓ 5 SnippetsCao Y, Zheng J, Wan H, Sun Y, Fu S, Liu S, He B, Cai G, Cao Y, Huang H, Li Q, Ma Y, Chen S, Wang F, Jiang H.
In-Text Gene Mentions
Abstract)
…Here, via a mitochondria-targeted genetic screen, we found that knockout (KO) of FBXL4, a mitochondrial disease gene, hyperactivates mitophagy at basal conditions.…
Abstract)
…Together, beyond identifying SCF-FBXL4 as a novel mitochondrial ubiquitin E3 ligase restraining basal mitophagy, our results reveal hyperactivated mitophagy as a cause of mitochondrial disease and suggest therapeutic strategies.…
Title)
…A mitochondrial SCF-FBXL4 ubiquitin E3 ligase complex degrades BNIP3 and NIX to restrain mitophagy and prevent mitochondrial disease.…
Title)
…A mitochondrial SCF-FBXL4ubiquitin E3 ligase…
Abstract)
…knockout (KO) ofFBXL4, a mitochondrial disease…
Show Full Abstract
Mitophagy is a fundamental quality control mechanism of mitochondria. Its regulatory mechanisms and pathological implications remain poorly understood. Here, via a mitochondria-targeted genetic screen, we found that knockout (KO) of FBXL4, a mitochondrial disease gene, hyperactivates mitophagy at basal conditions. Subsequent counter screen revealed that FBXL4-KO hyperactivates mitophagy via two mitophagy receptors BNIP3 and NIX. We determined that FBXL4 functions as an integral outer-membrane protein that forms an SCF-FBXL4 ubiquitin E3 ligase complex. SCF-FBXL4 ubiquitinates BNIP3 and NIX to target them for degradation. Pathogenic FBXL4 mutations disrupt SCF-FBXL4 assembly and impair substrate degradation. Fbxl4<sup>-/-</sup> mice exhibit elevated BNIP3 and NIX proteins, hyperactive mitophagy, and perinatal lethality. Importantly, knockout of either Bnip3 or Nix rescues metabolic derangements and viability of the Fbxl4<sup>-/-</sup> mice. Together, beyond identifying SCF-FBXL4 as a novel mitochondrial ubiquitin E3 ligase restraining basal mitophagy, our results reveal hyperactivated mitophagy as a cause of mitochondrial disease and suggest therapeutic strategies.
<h4>Background</h4>CD73 promotes progression in several malignancies and is considered as a novel immune checkpoint. However, the function of CD73 in intrahepatic cholangiocarcinoma (ICC) remains uncertain. In this study, we aim to investigate the role of CD73 in ICC.<h4>Methods</h4>Multi-omics data of 262 ICC patients from the FU-iCCA cohort were analyzed. Two single-cell datasets were downloaded to examine the expression of CD73 at baseline and in response to immunotherapy. Functional experiments were performed to explore the biological functions of CD73 in ICC. The expression of CD73 and HHLA2 and infiltrations of CD8 + , Foxp3 + , CD68 + , and CD163 + immune cells were evaluated by immunohistochemistry in 259 resected ICC samples from Zhongshan Hospital. The prognostic value of CD73 was assessed by Cox regression analysis.<h4>Results</h4>CD73 correlated with poor prognosis in two ICC cohorts. Single-cell atlas of ICC indicated high expression of CD73 on malignant cells. TP53 and KRAS gene mutations were more frequent in patients with high CD73 expression. CD73 promoted ICC proliferation, migration, invasion, and epithelial-mesenchymal transition. High CD73 expression was associated with a higher ratio of Foxp3 + /CD8 + tumor-infiltrating lymphocytes (TILs) and CD163 + /CD68 + tumor-associated macrophages (TAMs). A positive correlation between CD73 and CD44 was observed, and patients with high CD73 expression showed elevated expression of HHLA2. CD73 expression in malignant cells was significantly upregulated in response to immunotherapy.<h4>Conclusions</h4>High expression of CD73 is associated with poor prognosis and a suppressive tumor immune microenvironment in ICC. CD73 could potentially be a novel biomarker for prognosis and immunotherapy in ICC.
Also flagged:cancerdeathoesophageal cancertumourpneumoniaGastric Cancer
Journal Article2023-03-10No SnippetsKlotz R, Diener MK, Schmidt T, Hackert T, Graf S, Fuchs HF, Grimminger P, Egberts JH, Gockel I, van der Sluis PC, Doerr-Harim C, Klose C, Feißt M, Mihaljevic AL.
Show Full Abstract
<h4>Background</h4>Oesophageal cancer (EC) is the sixth leading cause of cancer death worldwide. Oesophageal resection is the only curative treatment option for EC which is frequently performed via an abdominal and right thoracic approach (Ivor-Lewis operation). This 2-cavity operation is associated with a high risk of major complications. To reduce postoperative morbidity, several minimally invasive techniques have been developed that can be broadly classified into either hybrid oesophagectomy (HYBRID-E) via laparoscopic/robotic abdominal and open thoracic surgery or total minimally invasive oesophagectomy (MIN-E). Both, HYBIRD-E and MIN-E, compare favourable to open oesophagectomy. However, there is still an evidence gap comparing HYBRID-E with MIN-E with regard to postoperative morbidity.<h4>Methods</h4>The MICkey trial is a multicentre randomized controlled superiority trial with two parallel study groups. A total of 152 patients with oesophageal cancer scheduled for elective oesophagectomy will be randomly assigned 1:1 to the control group (HYBRID-E) or to the intervention group (MIN-E). The primary endpoint will be overall postoperative morbidity assessed via the comprehensive complication index (CCI) within 30 days after surgery. Specific perioperative parameters, as well as patient-reported and oncological outcomes, will be analysed as secondary outcomes.<h4>Discussion</h4>The MICkey trial will address the yet unanswered question whether the total minimally invasive oesophagectomy (MIN-E) is superior to the HYBRID-E procedure regarding overall postoperative morbidity.<h4>Trial registration</h4>DRKS00027927 U1111-1277-0214. Registered on 4th July 2022.
Also flagged:neurodegenerative disorderpolyglutamineHDCRISPRCasinherited diseases
Journal Article2023-03-10✓ 1 SnippetDuan W, Urani E, Mattson MP.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder caused by a trinucleotide repeat expansion in the huntingtin gene resulting in long stretches of polyglutamine repeats in the huntingtin protein. The disease involves progressive degeneration of neurons in the striatum and cerebral cortex resulting in loss of control of motor function, psychiatric problems, and cognitive deficits. There are as yet no treatments that can slow disease progression in HD. Recent advances in gene editing using clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) systems and demonstrations of their ability to correct gene mutations in animal models of a range of diseases suggest that gene editing may prove effective in preventing or ameliorating HD. Here we describe (i) potential CRISPR-Cas designs and cellular delivery methods for the correction of mutant genes that cause inherited diseases, and (ii) recent preclinical findings demonstrating the efficacy of such gene-editing approaches in animal models, with a focus on HD.
…TEX264, RTN3L, orCCPG1, even under thapsigargin-indu…
Show Full Abstract
ER-phagy is a form of autophagy that is mediated by ER-phagy receptors and selectively degrades endoplasmic reticulum (ER). Coronaviruses have been shown to use the ER as a membrane source to establish their double-membrane vesicles (DMVs). However, whether viruses modulate ER-phagy to drive viral DMV formation and its underlying molecular mechanisms remains largely unknown. Here, we demonstrate that coronavirus subverts ER-phagy by hijacking the ER-phagy receptors FAM134B and ATL3 into p62 condensates, resulting in increased viral replication. Mechanistically, we show that viral protein ORF8 binds to and undergoes condensation with p62. FAM134B and ATL3 interact with homodimer of ORF8 and are aggregated into ORF8/p62 liquid droplets, leading to ER-phagy inhibition. ORF8/p62 condensates disrupt ER-phagy to facilitate viral DMV formation and activate ER stress. Together, our data highlight how coronavirus modulates ER-phagy to drive viral replication by hijacking ER-phagy receptors.
Also flagged:deathWntNotchBMPcytoplasmantimicrobial peptides
Journal Article2023-03-10✓ 2 SnippetsCui C, Wang F, Zheng Y, Wei H, Peng J.
In-Text Gene Mentions
I A O 0000326)
…olfactomedin 4 (Olfm4) ( 29…
I A O 0000326)
…cell number andOlfm4expression level (a…
Show Full Abstract
Paneth cells are a group of unique intestinal epithelial cells, and they play an important role in host-microbiota interactions. At the origin of Paneth cell life, several pathways such as Wnt, Notch, and BMP signaling, affect the differentiation of Paneth cells. After lineage commitment, Paneth cells migrate downward and reside in the base of crypts, and they possess abundant granules in their apical cytoplasm. These granules contain some important substances such as antimicrobial peptides and growth factors. Antimicrobial peptides can regulate the composition of microbiota and defend against mucosal penetration by commensal and pathogenic bacteria to protect the intestinal epithelia. The growth factors derived from Paneth cells contribute to the maintenance of the normal functions of intestinal stem cells. The presence of Paneth cells ensures the sterile environment and clearance of apoptotic cells from crypts to maintain the intestinal homeostasis. At the end of their lives, Paneth cells experience different types of programmed cell death such as apoptosis and necroptosis. During intestinal injury, Paneth cells can acquire stem cell features to restore the intestinal epithelial integrity. In view of the crucial roles of Paneth cells in the intestinal homeostasis, research on Paneth cells has rapidly developed in recent years, and the existing reviews on Paneth cells have mainly focused on their functions of antimicrobial peptide secretion and intestinal stem cell support. This review aims to summarize the approaches to studying Paneth cells and introduce the whole life experience of Paneth cells from birth to death.
Also flagged:hypertensionflavonoid aglyconesterpene lactonesunsaturated fatty acidpyruvatebile acid
Journal Article2023-03-10No SnippetsLiang H, Yao J, Miao Y, Sun Y, Gao Y, Sun C, Li R, Xiao H, Feng Q, Qin G, Lu X, Liu Z, Zhang G, Li F, Shao M.
Show Full Abstract
As a potential drug candidate for the treatment of hypertension and complications, it is speculated that the component-based Chinese medicine of <i>Ginkgo biloba</i> leaves (GBCCM) which mainly composed of flavonoid aglycones (FAs) and terpene lactones (TLs) may have different pharmacological effects at different doses or ratios. Taking the normal mice as the study object, metabonomics was conducted by giving different doses of GBCCM. Based on the components of GBCCM absorbed into the blood, the network pharmacological prediction was carried out. By integrating the results of metabonomics and network pharmacology, predict the possible pharmacological effects of GBCCM and conduct experimental verification. It was found that eight of the 19 compounds in GBCCM could be absorbed into the blood. GBCCM mainly affected the signal pathways of unsaturated fatty acid, pyruvate, bile acid, melanin and stem cells. It was speculated that GBCCM might have activities such as lowering blood pressure, regulating stem cell proliferation and melanogenesis. By establishing the models of mushroom tyrosinase, rat bone marrow mesenchymal stem cells (BMSCs) and spontaneously hypertensive rats (SHRs), we found that FAs and TLs showed synergistic effect in hypertension and tyrosinase models, and the optimal ratio was 3:2 (4.4 mg/kg) and 1:1 (0.4 mg/ml), respectively. As effective substances, FAs significantly promoted the proliferation of rat BMSCs on the third and fifth days at the concentration of 0.2 μg/ml (<i>p</i> < 0.05). GBCCM showed a variety of pharmacological effects at different doses and ratios, which provided an important reference for the druggability of GBCCM.
Also flagged:anthracyclineAnthracyclinescardiomyopathyheart failureACEretinoic acid
Journal Article2023-03-10No SnippetsMoossavi M, Lu X, Herrmann J, Xu X.
Show Full Abstract
Anthracyclines are among the most potent chemotherapeutics; however, cardiotoxicity significantly restricts their use. Indeed, anthracycline-induced cardiotoxicity (AIC) fares among the worst types of cardiomyopathy, and may only slowly and partially respond to standard heart failure therapies including β-blockers and ACE inhibitors. No therapy specifically designed to treat anthracycline cardiomyopathy at present, and neither is it known if any such strategy could be developed. To address this gap and to elucidate the molecular basis of AIC with a therapeutic goal in mind, zebrafish has been introduced as an <i>in vivo</i> vertebrate model about a decade ago. Here, we first review our current understanding of the basic molecular and biochemical mechanisms of AIC, and then the contribution of zebrafish to the AIC field. We summarize the generation of embryonic zebrafish AIC models (eAIC) and their use for chemical screening and assessment of genetic modifiers, and then the generation of adult zebrafish AIC models (aAIC) and their use for discovering genetic modifiers <i>via</i> forward mutagenesis screening, deciphering spatial-temporal-specific mechanisms of modifier genes, and prioritizing therapeutic compounds <i>via</i> chemical genetic tools. Several therapeutic target genes and related therapies have emerged, including a retinoic acid (RA)-based therapy for the early phase of AIC and an autophagy-based therapy that, for the first time, is able to reverse cardiac dysfunction in the late phase of AIC. We conclude that zebrafish is becoming an important <i>in vivo</i> model that would accelerate both mechanistic studies and therapeutic development of AIC.
…virus; those withhemochromatosis, acromegaly, or cancers,…
Show Full Abstract
<h4>Background/aims</h4>The implications of extracellular nicotinamide phosphoribosyltransferase (eNAMPT), a cancer metabokine, in colonic polyps remain uncertain.<h4>Methods</h4>A 2-year prospective cohort study of patients who underwent colonoscopy was conducted. Biochemical parameters and serum eNAMPT levels were analyzed at baseline and every 24 weeks postpolypectomy. NAMPT-associated single-nucleotide polymorphisms (SNPs), including rs61330082, rs2302559, rs10953502, and rs23058539, were assayed.<h4>Results</h4>Of 532 patients, 80 (15%) had prominent malignant potential (PMP) in colonic polyps, including villous adenomas (n = 18, 3.3%), adenomas with high-grade dysplasia (n = 33, 6.2%), and adenocarcinomas (n = 29, 5.5%). Baseline associations were as follows: colonic polyp pathology (<i>p</i> < 0.001), total cholesterol (<i>p</i> = 0.019), and neutrophil-to-lymphocyte ratio (<i>p</i> = 0.023) with eNAMPT levels; and age (<i>p</i> < 0.001), polyp size (<i>p</i> < 0.001), and eNAMPT levels (<i>p</i> < 0.001) with polyp pathology. Higher baseline eNAMPT levels were noted in patients harboring polyps with PMP than in patients without PMP (<i>p</i> < 0.001), and baseline eNAMPT levels significantly predicted PMP (cutoff: >4.238 ng/mL, <i>p</i> < 0.001). Proportions of eNAMPT-positive glandular and stromal cells were higher in polyps with PMP than in polyps without PMP (64.55 ± 11.94 vs. 14.82 ± 11.45%, <i>p</i> = 0.025). eNAMPT levels decreased within 48 weeks postpolypectomy (<i>p</i> = 0.01) and remained stable afterward regardless of PMP until 96 weeks postpolypectomy. However, those with PMP had a higher degree of eNAMPT decline within 24 weeks (<i>p</i> = 0.046). All investigated SNPs were in linkage disequilibrium with each other but were not associated with eNAMPT levels.<h4>Conclusion</h4>With a link to inflammation and lipid metabolism, along with its decreasing trend after polypectomy, serum eNAMPT may serve as a surrogate marker of PMP in colonic polyps. In situ probing of the NAMPT-associated pathway holds promise in attenuating PMP, as much of the eNAMPT likely originates from colonic polyps.
Also flagged:BRAFRASKITCutaneous MelanomamelanomaNRAS
Journal Article2023-03-10No SnippetsPipek O, Vizkeleti L, Doma V, Alpár D, Bödör C, Kárpáti S, Timar J.
Show Full Abstract
The genetic makeup of the triple-wild-type melanoma (BRAF, NRAS and NF1) has been known for some time, but those studies grouped together rare histopathological versions with common ones, as well as mucosal and even uveal ones. Here we used whole genome sequencing to genetically characterize the triple-wild-type melanoma (TWM), termed here as BRAF, RAS and KIT wild type (the most frequent oncogenic drivers of skin melanoma), using the most common histological forms and excluding rare ones. All these tumors except one were clearly induced by UV based on the mutational signature. The tumor mutational burden was low in TWM, except in the NF1 mutant forms, and a relatively high frequency of elevated LOH scores suggested frequent homologue recombination deficiency, but this was only confirmed by the mutation signature in one case. Furthermore, all these TWMs were microsatellite-stabile. In this driverless setting, we revealed rare oncogenic drivers known from melanoma or other cancer types and identified rare actionable tyrosine kinase mutations in NTRK1, RET and VEGFR1. Mutations of TWM identified genes involved in antitumor immunity (negative and positive predictors of immunotherapy), Ca<sup>++</sup> and BMP signaling. The two regressed melanomas of this cohort shared a 17-gene mutation signature, containing genes involved in antitumor immunity and several cell surface receptors. Even with this comprehensive genomic approach, a few cases remained driverless, suggesting that unrecognized drivers are hiding among passenger mutations.
Also flagged:oxygencyclemenopausehypoxia-inducible factor(HIF)-1heat shock protein 70
Journal Article2023-03-10No SnippetsAlbertus-Cámara I, Rochel-Vera C, Lomas-Albaladejo JL, Ferrer-López V, Martínez-González-Moro I.
Show Full Abstract
<h4>Introduction</h4>Tolerance to breathing in conditions with a decreased oxygen ratio is subject-specific. A normobaric hypoxia tolerance test (NHTT) is performed to assess the ability of each individual, as this may be influenced by genetic or personal factors such as age or gender. The aim of this study is to test the influence of deep breathing on hypoxia tolerance time.<h4>Material and methods</h4>A total of 45 subjects (21 parachutists and 24 students) performed two NHTTs at 5050 m altitude (iAltitude). Arterial (SatO<sub>2</sub>) and muscle (SmO<sub>2</sub>) oxygen saturation were monitored with the Humon Hex<sup>®</sup> device. The first NHTT was performed with free breathing, without any instructions; and the second NHTT was performed with wide, slow, diaphragmatic breathing. The NHTT was terminated at the end of 10 min or when a value of less than 83% was obtained.<h4>Results</h4>The first NHTT was completed by 38.1% of parachutist and 33.3% of students while the second NHTT was completed by 85.7% and 75%, respectively. In the second NHTT, both parachutists and students had a significantly (<i>p</i> = 0.001) longer duration compared to the first NHTT. SmO<sub>2</sub> and SatO<sub>2</sub> values also increased significantly (<i>p</i> < 0.001) in both groups (<i>p</i> < 0.05).<h4>Conclusion</h4>Performing controlled diaphragmatic breathing is successful in increasing hypoxia tolerance time and/or SatO<sub>2</sub> values.
Also flagged:Lactosylceramide SynthaseLactosylceramidebiosynthesisglycosphingolipidsgalactosyltransferasesB4GALT6
Journal Article2023-03-10✓ 5 SnippetsDei Cas M, Montavoci L, Casati S, Malagolini N, Dall'Olio F, Trinchera M.
In-Text Gene Mentions
Abstract)
…It is synthesized by the action of galactosyltransferases B4GALT5 and B4GALT6, which transfer galactose from UDP-galactose to glucosylceramide.…
Introduction)
…B4GALT5 was found to be modulated in several cancers, including colorectal [10], breast [11], and hepatocellular carcinoma [12], as well as in acute myeloid leukemia [13].…
Abstract)
…tion of galactosyltransferasesB4GALT5and B4GALT6, which…
Introduction)
…as LacCer synthases:B4GALT5and B4GALT6 […
Introduction)
…(KO) animals forb4galt5, b4galt6 ,…
Show Full Abstract
Lactosylceramide is necessary for the biosynthesis of almost all classes of glycosphingolipids and plays a relevant role in pathways involved in neuroinflammation. It is synthesized by the action of galactosyltransferases B4GALT5 and B4GALT6, which transfer galactose from UDP-galactose to glucosylceramide. Lactosylceramide synthase activity was classically determined in vitro by a method based on the incorporation of radiolabeled galactose followed by the chromatographic separation and quantitation of the product by liquid scintillation counting. Here, we used deuterated glucosylceramide as the acceptor substrate and quantitated the deuterated lactosylceramide product by liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS). We compared this method with the classical radiochemical method and found that the reactions have similar requirements and provide comparable results in the presence of high synthase activity. Conversely, when the biological source lacked lactosylceramide synthase activity, as in the case of a crude homogenate of human dermal fibroblasts, the radiochemical method failed, while the other provided a reliable measurement. In addition to being very accurate and sensitive, the proposed use of deuterated glucosylceramide and LC-MS/MS for the detection of lactosylceramide synthase in vitro has the relevant advantage of avoiding the costs and discomforts of managing radiochemicals.
Also flagged:CXCL5Hepatocellular Carcinomachemotactic cytokinespathogenesisliver cirrhosiscytokine
Journal Article2023-03-10✓ 1 SnippetLaschtowitz A, Lambrecht J, Puengel T, Tacke F, Mohr R.
In-Text Gene Mentions
Methods)
…induced liver injury,hemochromatosis, and cryptogenic liver…
Show Full Abstract
Chemokines or chemotactic cytokines play a pivotal role in the immune pathogenesis of liver cirrhosis and hepatocellular carcinoma (HCC). Nevertheless, comprehensive cytokine profiling data across different etiologies of liver diseases are lacking. Chemokines might serve as diagnostic and prognostic biomarkers. In our study, we analyzed serum concentrations of 12 inflammation-related chemokines in a cohort of patients (<i>n</i> = 222) with cirrhosis of different etiologies and/or HCC. We compared 97 patients with cirrhosis and treatment-naïve HCC to the chemokine profile of 125 patients with cirrhosis but confirmed absence of HCC. Nine out of twelve chemokines were significantly elevated in sera of cirrhotic patients with HCC compared to HCC-free cirrhosis controls (CCL2, CCL11, CCL17, CCL20, CXCL1, CXCL5, CXCL9, CXCL10, CXCL11). Among those, CXCL5, CXCL9, CXCL10, and CXCL11 were significantly elevated in patients with early HCC according to the Barcelona Clinic Liver Cancer (BCLC) stages 0/A compared to cirrhotic controls without HCC. In patients with HCC, CXCL5 serum levels were associated with tumor progression, and levels of CCL20 and CXCL8 with macrovascular invasion. Importantly, our study identified CXCL5, CXCL9, and CXCL10 as universal HCC markers, independent from underlying etiology of cirrhosis. In conclusion, regardless of the underlying liver disease, patients with cirrhosis share an HCC-specific chemokine profile. CXCL5 may serve as a diagnostic biomarker in cirrhotic patients for early HCC detection as well as for tumor progression.
Also flagged:ion transportersSLC9C1cyclic nucleotidebindingacrosomal granulesmembrane
Journal Article2023-03-10✓ 5 SnippetsGardner CC, James PF.
In-Text Gene Mentions
Results)
…We also sequenced a full-length SLC9C2 clone from a human testis (Transomics Technologies) and found that it contained an ORF predicted to code for a 1124 amino acid protein (Figure S1).…
Abstract)
…SLC9C2, which encodes the…
Abstract)
…we show thatSLC9C2exhibits testis/sperm-restrict…
Title)
…TheSLC9C2Gene Product (Na…
Introduction)
…subfamily (SLC9C1 andSLC9C2, which encode NHE10,…
Show Full Abstract
Na<sup>+</sup>/H<sup>+</sup> exchangers (NHEs) are a family of ion transporters that regulate the pH of various cell compartments across an array of cell types. In eukaryotes, NHEs are encoded by the SLC9 gene family comprising 13 genes. SLC9C2, which encodes the NHE11 protein, is the only one of the SLC9 genes that is essentially uncharacterized. Here, we show that SLC9C2 exhibits testis/sperm-restricted expression in rats and humans, akin to its paralog SLC9C1 (NHE10). Similar to NHE10, NHE11 is predicted to contain an NHE domain, a voltage sensing domain, and finally an intracellular cyclic nucleotide binding domain. An immunofluorescence analysis of testis sections reveals that NHE11 localizes with developing acrosomal granules in spermiogenic cells in both rat and human testes. Most interestingly, NHE11 localizes to the sperm head, likely the plasma membrane overlaying the acrosome, in mature sperm from rats and humans. Therefore, NHE11 is the only known NHE to localize to the acrosomal region of the head in mature sperm cells. The physiological role of NHE11 has yet to be demonstrated but its predicted functional domains and unique localization suggests that it could modulate intracellular pH of the sperm head in response to changes in membrane potential and cyclic nucleotide concentrations that are a result of sperm capacitation events. If NHE11 is shown to be important for male fertility, it will be an attractive target for male contraceptive drugs due to its exclusive testis/sperm-specific expression.
Craniosynostosis is a birth defect where calvarial sutures close prematurely, as part of a genetic syndrome or independently, with unknown cause. This study aimed to identify differences in gene expression in primary calvarial cell lines derived from patients with four phenotypes of single-suture craniosynostosis, compared to controls. Calvarial bone samples (N = 388 cases/85 controls) were collected from clinical sites during reconstructive skull surgery. Primary cell lines were then derived from the tissue and used for RNA sequencing. Linear models were fit to estimate covariate adjusted associations between gene expression and four phenotypes of single-suture craniosynostosis (lambdoid, metopic, sagittal, and coronal), compared to controls. Sex-stratified analysis was also performed for each phenotype. Differentially expressed genes (DEGs) included 72 genes associated with coronal, 90 genes associated with sagittal, 103 genes associated with metopic, and 33 genes associated with lambdoid craniosynostosis. The sex-stratified analysis revealed more DEGs in males (98) than females (4). There were 16 DEGs that were homeobox (HOX) genes. Three TFs (SUZ12, EZH2, AR) significantly regulated expression of DEGs in one or more phenotypes. Pathway analysis identified four KEGG pathways associated with at least one phenotype of craniosynostosis. Together, this work suggests unique molecular mechanisms related to craniosynostosis phenotype and fetal sex.
Also flagged:Nucleotideautoimmune diseasessystemic lupus erythematosusCD28gene expressionPDCD1
Journal Article2023-03-10✓ 5 SnippetsChen DP, Wen YH, Wang WT, Lin WT.
In-Text Gene Mentions
Introduction)
…We previously discussed the association between SNPs of the CD28, TNFSF4, and PDCD1 genes and the outcomes of post-cord blood transplantation (CBT) and HSCT and the development of SLE [28,29,30], finding that many SNPs located in the promoter region had statistically significant differences.…
Discussion)
…Regarding TNFSF4, it was discovered that rs1234314 and rs45454293 of TNSFS4 were associated with post-HSCT GVHD III-IV in acute myeloid leukemia (AML) patients in our previously published HSCT (including bone marrow transplantation and peripheral blood stem cell transplantation) research analysis [29].…
Discussion)
…Furthermore, Tripathi et al. discovered in 2019 that the OX40L(TNFSF4)-OX40 interaction on T cells was linked to the induction and development of acute GVHD (aGVHD) in HSCT, and that treatment with anti-human OX40L mAb could effectively prevent and reduce the severity of aGVHD [36].…
Methods)
…In a previous study, the promoter regions of CD28, PDCD1, and TNFSF4 were amplified to investigate the relationship between SNPs in these regions and HSCT, CBT, and SLE.…
Introduction)
…In addition, TNFSF4 (OX40L) interacts with its receptor (OX40) and can also provide signals to promote T-cell activation, with previous research showing that OX40L is capable of stimulating T-cell response as well as promoting the pathogenesis of SLE [27].…
Show Full Abstract
In a prior study, we discovered that hematopoietic stem cell transplantation (HSCT) and/or autoimmune diseases, such as systemic lupus erythematosus, were associated with the rs1234314 C/G and rs45454293 C/T polymorphisms of <i>TNFSF4</i>, the rs5839828 C > del and rs36084323 C > T polymorphisms of <i>PDCD1</i>, and the rs28541784C/T, rs200353921A/T, rs3181096C/T, and rs3181098 G/A polymorphisms of <i>CD28</i>. However, the association does not imply causation. These single nucleotide polymorphisms (SNPs) are all located in the promoter region of these genes, so we used the dual-luminescence reporter assay to explore the effect of single nucleotide polymorphisms (SNPs) on transcriptional activity. For each promoter-reporter with a single SNP mutation, more than 10 independent experiments were carried out, and the difference in transcription activity was compared using one-way ANOVA and Tukey's honestly significant difference test. The results showed that the G-allele of rs1234314 had 0.32 ± 0.09 times the average amount of relative light units (RLU) compared to the C-allele (<i>p</i> = 0.003), the T-allele of rs45454293 had 4.63 ± 0.92 times the average amount of RLU compared to the C-allele (<i>p</i> < 0.001), the del-allele of rs5839828 had 1.37 ± 0.24 times the average amount of RLU compared to the G-allele (<i>p</i> < 0.001), and the T-allele of rs36084323 had 0.68 ± 0.07 times the average amount of RLU compared to the C-allele (<i>p</i> < 0.001). The CD28 SNPs studied here did not affect transcriptional activity. In conclusion, the findings of this study could only confirm that the SNP had a bio-functional effect on gene expression levels. According to the findings, several SNPs in the same gene have bio-functions that affect transcriptional activity. However, some increase transcriptional activity while others decrease it. Consequently, we inferred that the final protein level should be the integration result of the co-regulation of all the SNPs with the effect on transcriptional activity.
<h4>Background</h4>While non-alcoholic fatty liver disease (NAFLD) is a wide-spread liver disease, only some patients progress towards steatohepatitis and cirrhosis.<h4>Aim</h4>We comparatively analyzed the methacetin breath test (MBT) for the microsomal function of the liver and the octanoate breath test (OBT) for mitochondrial activity, in detecting patients with steatohepatitis and estimating fibrosis.<h4>Methods</h4>81 patients with histologically proven NAFLD (SAF score) were evaluated. The parameters used for both breath tests were the dose/h and the cumulative dose recovery at multiple timepoints. The statistical association between histological diagnosis and breath test results used Independent Samples <i>t</i> Test. The accuracy for diagnosis was evaluated using area under the receiver operator characteristic (AUROC) and the sensitivity and specificity were assessed using the Youden J method.<h4>Results</h4>Both MBT and OBT were able to differentiate patients with simple steatosis from NASH and to stratify patients with significant fibrosis and cirrhosis (<i>p</i>-values < 0.001 for most analyzed timepoints). The best parameter for NASH diagnosis was OBT dose at 30 min. In the case of significant fibrosis, the most accurate test was MBT cumulative dose at 30 min.<h4>Conclusions</h4>Both MBR and OBT tests are potentially useful tools in assessing patients with NAFLD.
Also flagged:BDNFFTOSLC6A4COVID-19psychiatric disorderphysical disorder
Journal Article2023-03-10✓ 1 SnippetBednarova A, Habalova V, Iannaccone SF, Tkac I, Jarcuskova D, Krivosova M, Marcatili M, Hlavacova N.
In-Text Gene Mentions
Discussion)
…variations of the5-HTTgene promoter comparing…
Show Full Abstract
Since suicide and suicidal behavior are considered highly heritable phenotypes, the identification of genetic markers that can predict suicide risk is a clinically important topic. Several genes studied for possible associations between genetic polymorphisms and suicidal behaviors had mostly inconsistent and contradictory findings. The aim of this case-control study was to evaluate the associations between completed suicide and polymorphisms in genes <i>BDNF</i> (rs6265, rs962369), <i>SLC6A4</i> (<i>5-HTTLPR</i>), and <i>FTO</i> (rs9939609) in relation to sex and BMI. We genotyped 119 completed suicide victims and 137 control subjects that were age, sex, and ethnicity matched. A significant association with completed suicide was found for <i>BDNF</i> rs962369. This variant could play a role in completed suicide, as individuals with the CC genotype were more often found among suicides than in control subjects. After sex stratification, the association remained significant only in males. A nominally significant association between the gene variant and BMI was observed for <i>BDNF</i> rs962369 under the overdominant model. Heterozygotes with the TC genotype showed a lower average BMI than homozygotes with TT or CC genotypes. <i>FTO</i> polymorphism (rs9939609) did not affect BMI in the group of Slovak suicide completers, but our findings follow an inverse association between BMI and completed suicide.
Also flagged:MSP1InfectionMalariainfectious diseaseantibodiesmalaria infection
Journal Article2023-03-10No SnippetsRodríguez ZJ, Melo FL, Torres A, Agrawal N, Cortés-Vecino JA, Lozano JM.
Show Full Abstract
(1) Background: Malaria, a vector-borne infectious disease, is caused by parasites of the <i>Plasmodium</i> genus, responsible for increased extreme morbidity and mortality rates. Despite advances in approved vaccines, full protection has not yet been achieved upon vaccination, thus the development of more potent and safe immuno-stimulating agents for malaria prevention is a goal to be urgently accomplished. We have focused our research on a strategy to identify <i>Plasmodium</i> spp. epitopes by naturally acquired human antibodies and rodent malaria infection models immunized with site-directed non-natural antigens. (2) Methods: Some predictive algorithms and bioinformatics tools resembling different biological environments, such as phagosome-lysosome proteolytic degradation, affinity, and the high frequency of malaria-resistant and -sensitive HLA-II alleles were regarded for the proper selection of epitopes and potential testing. Each epitope's binding profile to both host cells and HLA-II molecules was considered for such initial screening. (3) Results: Once selected, we define each epitope-peptide to be synthesized in terms of size and hydrophobicity, and introduced peptide-bond surrogates and non-natural amino acids in a site-directed fashion, and then they were produced by solid-phase peptide synthesis. Molecules were then tested by their antigenic and immunogenic properties compared to human sera from Colombian malaria-endemic areas. The antigenicity and protective capacity of each epitope-peptide in a rodent infection model were examined. The ability of vaccinated mice after being challenged with <i>P. berghei</i> ANKA and <i>P. yoelii</i> 17XL to control malaria led to the determination of an immune stimulation involving Th1 and Th1/Th2 mechanisms. In silico molecular dynamics and modeling provided some interactions insights, leading to possible explanations for protection due to immunization. (4) Conclusions: We have found evidence for proposing MSP1-modified epitopes to be considered as neutralizing antibody stimulators that are useful as probes for the detection of <i>Plasmodium</i> parasites, as well as for sub-unit components of a site-directed designed malaria vaccine candidate.
Also flagged:magnesium8-hydroxyquinolinepolycaprolactonedegradationdichloromethaneosteogenesis
Journal Article2023-03-10No SnippetsGnedenkov AS, Filonina VS, Sinebryukhov SL, Gnedenkov SV.
Show Full Abstract
The increase of corrosion resistance of magnesium and its alloys by forming the smart self-healing hybrid coatings was achieved in this work in two steps. In the first step, using the plasma electrolytic oxidation (PEO) treatment, a ceramic-like bioactive coating was synthesized on the surface of biodegradable MA8 magnesium alloy. During the second step, the formed porous PEO layer was impregnated with a corrosion inhibitor 8-hydroxyquinoline (8-HQ) and bioresorbable polymer polycaprolactone (PCL) in different variations to enhance the protective properties of the coating. The composition, anticorrosion, and antifriction properties of the formed coatings were studied. 8-HQ allows controlling the rate of material degradation due to the self-healing effect of the smart coating. PCL treatment of the inhibitor-containing layer significantly improves the corrosion and wear resistance and retains an inhibitor in the pores of the PEO layer. It was revealed that the corrosion inhibitor incorporation method (including the number of steps, impregnation, and the type of solvent) significantly matters to the self-healing mechanism. The hybrid coatings obtained by a 1-step treatment in a dichloromethane solution containing 6 wt.% polycaprolactone and 15 g/L of 8-HQ are characterized by the best corrosion resistance. This coating demonstrates the lowest value of corrosion current density (3.02 × 10<sup>-7</sup> A cm<sup>-2</sup>). The formation of the hybrid coating results in the corrosion rate decrease by 18 times (0.007 mm year<sup>-1</sup>) as compared to the blank PEO layer (0.128 mm year<sup>-1</sup>). An inhibitor efficiency was established to be 83.9%. The mechanism of corrosion protection of Mg alloy via smart hybrid coating was revealed.
…The immune checkpoints (TNFSF4, CD70, ICOSLG, PDCD1LG2), followed by cytokines (IL2, IFNL2, CXCL10), markers of DC differentiation (CD80, CD86), and signaling signature (SEMAD4), are upregulated in both co-infection and single IAV but downregulated under Sars-CoV-2 infection.…
…(e.g., ICOS-LG, TNFSF9,TNFSF4, CD70), two inhibitory…
I A O 0000613)
…TNFRSF4 (receptor forTNFSF4), and TNFRSF9 (receptor…
Show Full Abstract
Dendritic cells (DCs) are professional antigen-presenting cells (APCs) with the unique ability to mediate inflammatory responses of the immune system. Given the critical role of DCs in shaping immunity, they present an attractive avenue as a therapeutic target to program the immune system and reverse immune disease disorders. To ensure appropriate immune response, DCs utilize intricate and complex molecular and cellular interactions that converge into a seamless phenotype. Computational models open novel frontiers in research by integrating large-scale interaction to interrogate the influence of complex biological behavior across scales. The ability to model large biological networks will likely pave the way to understanding any complex system in more approachable ways. We developed a logical and predictive model of DC function that integrates the heterogeneity of DCs population, APC function, and cell-cell interaction, spanning molecular to population levels. Our logical model consists of 281 components that connect environmental stimuli with various layers of the cell compartments, including the plasma membrane, cytoplasm, and nucleus to represent the dynamic processes within and outside the DC, such as signaling pathways and cell-cell interactions. We also provided three sample use cases to apply the model in the context of studying cell dynamics and disease environments. First, we characterized the DC response to Sars-CoV-2 and influenza co-infection by <i>in-silico</i> experiments and analyzed the activity level of 107 molecules that play a role in this co-infection. The second example presents simulations to predict the crosstalk between DCs and T cells in a cancer microenvironment. Finally, for the third example, we used the Kyoto Encyclopedia of Genes and Genomes enrichment analysis against the model's components to identify 45 diseases and 24 molecular pathways that the DC model can address. This study presents a resource to decode the complex dynamics underlying DC-derived APC communication and provides a platform for researchers to perform <i>in-silico</i> experiments on human DC for vaccine design, drug discovery, and immunotherapies.
Also flagged:abortionspontaneous abortionrecurrent pregnancy lossmetabolic disordersthrombophiliagene expression
Journal Article2023-03-10✓ 2 SnippetsWang X, Xing Y, Wang Y, Du Z, Zhang C, Gao J.
In-Text Gene Mentions
Discussion)
…containing gene 6 (SOX6) can recruit c-terminal…
Discussion)
…embryonic tissues andSOX6was identified as…
Show Full Abstract
Numerous studies have reported single nucleotide polymorphisms (SNPs) in microRNAs (miRNAs) associated with unexplained recurrent spontaneous abortion (URSA). The present study aimed to conduct an updated meta-analysis to confirm a pooled effect size of the association between miRNA SNPs and URSA. The relevant literature was searched on PubMed, EMBASE, Web of Science and Cochrane Library before July 2022 to identify case-control studies. The pooled odds ratio and confidence intervals at 95% of the eligible studies were extracted and evaluated under five genetic models. A total of 18 studies involving 3,850 cases and 4,312 controls were included. miR499a rs3746444 A>G, miR-149 rs2292832 T>C, miR-125a rs41275794 G>A and miR-10a rs3809783 A>T may enhance the risk of recurrent spontaneous abortion (RSA) under various genetic models. Although no separate association was found between the miR-125a rs12976445 C>T and miR-27a rs895819 A>G polymorphisms and RSA, statistical significance was found in certain ethnic groups only. The current analysis suggests a high significance of an up-to-date meta-analysis for screening out and preventing URSA among high-risk women by testing miRNA SNPs and RSA susceptibility.
medRxiv2023-03-10Preprint (No Snippets API)Soulé A, Ma W, Liu KY, Allard C, Qureshi S, Tremblay K, Emad A, Rousseau S.
Show Full Abstract
Systemic inflammation in critically ill patients can lead to serious consequences such as acute respiratory distress syndrome (ARDS), a condition characterized by the presence of lung inflammation, edema, and impaired gas exchange, associated with poor survival. Understanding molecular pathobiology is essential to improve critical care of these patients. To this end, we use multimodal profiles of SARS-CoV-2 infected hospitalized participants to the Biobanque Québécoise de la COVID-19 (BQC-19) to characterize endophenotypes associated with different degrees of disease severity. Proteomic, metabolomic, and genomic characterization supported a role for neutrophil-associated procoagulant activity in severe COVID-19 ARDS that is inversely correlated with sphinghosine-1 phosphate plasma levels. Fibroblast Growth Factor Receptor (FGFR) and SH2-containing transforming protein 4 (SHC4) signaling were identified as molecular features associated with endophenotype 6 (EP6). Mechanical ventilation in EP6 was associated with alterations in lipoprotein metabolism. These findings help define the molecular mechanisms related to specific severe outcomes, that can be used to identify early unfavorable clinical trajectories and treatable traits to improve the survival of critically ill patients.
Also flagged:Spinocerebellar ataxia type 11SCA11TTBK2autosomal dominant cerebellar ataxiacerebellar ataxiakinase
Journal Article2023-03-09No SnippetsFelício D, Santos M.
Show Full Abstract
Spinocerebellar ataxia type 11 (SCA11) is a rare type of autosomal dominant cerebellar ataxia, mainly characterized by progressive cerebellar ataxia, abnormal eye signs and dysarthria. SCA11 is caused by variants in TTBK2, which encodes tau tubulin kinase 2 (TTBK2) protein. Only a few families with SCA11 were described to date, all harbouring small deletions or insertions that result in frameshifts and truncated TTBK2 proteins. In addition, TTBK2 missense variants were also reported but they were either benign or still needed functional validation to ascertain their pathogenic potential in SCA11. The mechanisms behind cerebellar neurodegeneration mediated by TTBK2 pathogenic alleles are not clearly established. There is only one neuropathological report and a few functional studies in cell or animal models published to date. Moreover, it is still unclear whether the disease is caused by TTBK2 haploinsufficiency of by a dominant negative effect of TTBK2 truncated forms on the normal allele. Some studies point to a lack of kinase activity and mislocalization of mutated TTBK2, while others reported a disruption of normal TTBK2 function caused by SCA11 alleles, particularly during ciliogenesis. Although TTBK2 has a proven function in cilia formation, the phenotype caused by heterozygous TTBK2 truncating variants are not clearly typical of ciliopathies. Thus, other cellular mechanisms may explain the phenotype seen in SCA11. Neurotoxicity caused by impaired TTBK2 kinase activity against known neuronal targets, such as tau, TDP-43, neurotransmitter receptors or transporters, may contribute to neurodegeneration in SCA11.
Also flagged:gene expressionsystemic diseasechromosomesystemic infectionchromosomestranscriptional repressor
Journal Article2023-03-09No SnippetsKakade P, Sircaik S, Maufrais C, Ene IV, Bennett RJ.
Show Full Abstract
Aneuploidy is a frequent occurrence in fungal species where it can alter gene expression and promote adaptation to a variety of environmental cues. Multiple forms of aneuploidy have been observed in the opportunistic fungal pathogen <i>Candida albicans,</i> which is a common component of the human gut mycobiome but can escape this niche and cause life-threatening systemic disease. Using a barcode sequencing (Bar-seq) approach, we evaluated a set of diploid <i>C. albicans</i> strains and found that a strain carrying a third copy of chromosome (Chr) 7 was associated with increased fitness during both gastrointestinal (GI) colonization and systemic infection. Our analysis revealed that the presence of a Chr 7 trisomy resulted in decreased filamentation, both in vitro and during GI colonization, relative to isogenic euploid controls. A target gene approach demonstrated that <i>NRG1</i>, encoding a negative regulator of filamentation located on Chr 7, contributes to increased fitness of the aneuploid strain due to inhibition of filamentation in a gene dosage-dependent fashion. Together, these experiments establish how aneuploidy enables the reversible adaptation of <i>C. albicans</i> to its host via gene dosage-dependent regulation of morphology.
Also flagged:α-defensinscholineL-amino acidnonalcoholic steatohepatitisNASHchronic liver disease
Journal Article2023-03-09✓ 5 SnippetsNakamura S, Nakamura K, Yokoi Y, Shimizu Y, Ohira S, Hagiwara M, Song Z, Gan L, Aizawa T, Hashimoto D, Teshima T, Ouellette AJ, Ayabe T.
In-Text Gene Mentions
Discussion)
…Among ER stress markers, Pdia3, whose expression increases in NASH patients35, increased at 3 wk, followed by elevation of Perk and Chop. In addition, Nox2 increased, whereas Prdx6 decreased, and autophagy-related genes including Atg3, Atg12, and Lc3b decreased in the CDAHFD group, suggesting excessive diet-induced oxidative stress and impairment of autophagy.…
Nonalcoholic steatohepatitis (NASH) is a chronic liver disease characterized by fibrosis that develops from fatty liver. Disruption of intestinal microbiota homeostasis, dysbiosis, is associated with fibrosis development in NASH. An antimicrobial peptide α-defensin secreted by Paneth cells in the small intestine is known to regulate composition of the intestinal microbiota. However, involvement of α-defensin in NASH remains unknown. Here, we show that in diet-induced NASH model mice, decrease of fecal α-defensin along with dysbiosis occurs before NASH onset. When α-defensin levels in the intestinal lumen are restored by intravenous administration of R-Spondin1 to induce Paneth cell regeneration or by oral administration of α-defensins, liver fibrosis is ameliorated with dissolving dysbiosis. Furthermore, R-Spondin1 and α-defensin improved liver pathologies together with different features in the intestinal microbiota. These results indicate that decreased α-defensin secretion induces liver fibrosis through dysbiosis, further suggesting Paneth cell α-defensin as a potential therapeutic target for NASH.
Also flagged:noradrenalinbehavioralnoradrenalineserotoninglutamatenociception
Journal Article2023-03-09No SnippetsGu X, Zhang YZ, O'Malley JJ, De Preter CC, Penzo M, Hoon MA.
Show Full Abstract
Supraspinal brain regions modify nociceptive signals in response to various stressors including stimuli that elevate pain thresholds. The medulla oblongata has previously been implicated in this type of pain control, but the neurons and molecular circuits involved have remained elusive. Here we identify catecholaminergic neurons in the caudal ventrolateral medulla that are activated by noxious stimuli in mice. Upon activation, these neurons produce bilateral feed-forward inhibition that attenuates nociceptive responses through a pathway involving the locus coeruleus and norepinephrine in the spinal cord. This pathway is sufficient to attenuate injury-induced heat allodynia and is required for counter-stimulus induced analgesia to noxious heat. Our findings define a component of the pain modulatory system that regulates nociceptive responses.
Genetic mechanisms of alternative mRNA splicing have been shown in the brain for a variety of neuropsychiatric traits, but not substance use disorders. Our study utilized RNA-sequencing data on alcohol use disorder (AUD) in four brain regions (n = 56; ages 40-73; 100% 'Caucasian'; PFC, NAc, BLA and CEA) and genome-wide association data on AUD (n = 435,563, ages 22-90; 100% European-American). Polygenic scores of AUD were associated with AUD-related alternative mRNA splicing in the brain. We identified 714 differentially spliced genes between AUD vs controls, which included both putative addiction genes and novel gene targets. We found 6463 splicing quantitative trait loci (sQTLs) that linked to the AUD differentially spliced genes. sQTLs were enriched in loose chromatin genomic regions and downstream gene targets. Additionally, the heritability of AUD was enriched for DNA variants in and around differentially spliced genes associated with AUD. Our study also performed splicing transcriptome-wide association studies (TWASs) of AUD and other drug use traits that unveiled specific genes for follow-up and splicing correlations across SUDs. Finally, we showed that differentially spliced genes between AUD vs control were also associated with primate models of chronic alcohol consumption in similar brain regions. Our study found substantial genetic contributions of alternative mRNA splicing in AUD.
Also flagged:cannabinoidsOlivetolcannabidiolcyclodextrinhypersensitivitymetal-
Journal Article2023-03-09No SnippetsRodríguez-Martínez J, Sánchez-Martín MJ, Valiente M.
Show Full Abstract
Olivetol (OLV), as a cannabidiol (CBD) analog, was incorporated in γ-cyclodextrin metal-organic frameworks (γ-CD-MOFs) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) liposomes as potential analgesic drug delivery systems (DDS) for dental hypersensitivity (DH) treatment. These DDS have been scarcely employed in oral health, being the first time in case of MOFs loaded with cannabinoids. In vitro experiments using bovine teeth were performed to verify if the drug is able to reach the dentin, where it can flow to the pulp tissues and exert its analgesic effect; enamel and dentin regions were analyzed by synchrotron radiation-based FTIR microspectroscopy. Principal component analysis (PCA) was used to process the spectroscopic data as a powerful chemometric tool, and it revealed a similar behavior in both regions. The studied DDS have been characterized by different techniques, and is was demonstrated that DDS is an efficient way to carry the drug through dental tissues without compromising their structure.
Also flagged:Ataxin-2Spinocerebellar ataxia type 2SCA2autosomal dominantly inheritedneurodegenerative diseaseATXN2
Journal Article2023-03-09✓ 1 SnippetBux J, Sen NE, Klink IM, Hauser S, Synofzik M, Schöls L, Auburger G, Riess O, Hübener-Schmid J.
In-Text Gene Mentions
Discussion)
…On mRNA level,HTT(huntingtin, 5.990 TPM),…
Show Full Abstract
Spinocerebellar ataxia type 2 (SCA2) is an autosomal dominantly inherited neurodegenerative disease, which belongs to the trinucleotide repeat disease group with a CAG repeat expansion in exon 1 of the ATXN2 gene resulting in an ataxin-2 protein with an expanded polyglutamine (polyQ)-stretch. The disease is late manifesting leading to early death. Today, therapeutic interventions to cure the disease or even to decelerate disease progression are not available yet. Furthermore, primary readout parameter for disease progression and therapeutic intervention studies are limited. Thus, there is an urgent need for quantifiable molecular biomarkers such as ataxin-2 becoming even more important due to numerous potential protein-lowering therapeutic intervention strategies. The aim of this study was to establish a sensitive technique to measure the amount of soluble polyQ-expanded ataxin-2 in human biofluids to evaluate ataxin-2 protein levels as prognostic and/or therapeutic biomarker in SCA2. Time-resolved fluorescence energy transfer (TR-FRET) was used to establish a polyQ-expanded ataxin-2-specific immunoassay. Two different ataxin-2 antibodies and two different polyQ-binding antibodies were validated in three different concentrations and tested in cellular and animal tissue as well as in human cell lines, comparing different buffer conditions to evaluate the best assay conditions. We established a TR-FRET-based immunoassay for soluble polyQ-expanded ataxin-2 and validated measurements in human cell lines including iPSC-derived cortical neurons. Additionally, our immunoassay was sensitive enough to monitor small ataxin-2 expression changes by siRNA or starvation treatment. We successfully established the first sensitive ataxin-2 immunoassay to measure specifically soluble polyQ-expanded ataxin-2 in human biomaterials.
Also flagged:Gene expressionfemale reproductive diseasespreeclampsiamiscarriageendometriosisadenomyosis
Journal Article2023-03-09No SnippetsHuang E, Chen L.
Show Full Abstract
Gene expression and posttranscriptional regulation can be strongly influenced by epigenetic modifications. N<sup>6</sup>-methyladenosine, the most extensive RNA modification, has been revealed to participate in many human diseases. Recently, the role of RNA epigenetic modifications in the pathophysiological mechanism of female reproductive diseases has been intensively studied. RNA m<sup>6</sup>A modification is involved in oogenesis, embryonic growth, and foetal development, as well as preeclampsia, miscarriage, endometriosis and adenomyosis, polycystic ovary syndrome, premature ovarian failure, and common gynaecological tumours such as cervical cancer, endometrial cancer, and ovarian cancer. In this review, we provide a summary of the research results of m<sup>6</sup>A on the female reproductive biology and pathophysiology in recent years and aim to discuss future research directions and clinical applications of m<sup>6</sup>A-related targets. Hopefully, this review will add to our understanding of the cellular mechanisms, diagnostic biomarkers, and underlying therapeutic strategies of female reproductive system diseases. Video Abstract.
Also flagged:TAF15breast cancerMAPK6MAPKmalignant tumortumor
Journal Article2023-03-09✓ 3 SnippetsWang B, Chen H, Deng Y, Chen H, Xing L, Guo Y, Wang M, Chen J.
In-Text Gene Mentions
Introduction)
…cells via theSTAU1-mediated mRNA degradation […
Discussion)
…with UBE3C andPEBP1proteins and promotes…
Discussion)
…promotes the UBE3C-mediatedPEBP1ubiquitination, thereby activa…
Show Full Abstract
<h4>Background</h4>Breast cancer (BC) is a common malignant tumor in women worldwide. Circular RNA (circRNA) has been proven to play a critical role in BC progression. However, the exact biological functions and underlying mechanisms of circRNAs in BC remain largely unknown.<h4>Methods</h4>Here, we first screened for differentially expressed circRNAs in 4 pairs of BC tissues and adjacent non-tumor tissues using a circRNA microarray. Functionally, gain- and loss-of-function experiments in vitro and in vivo showed that circDNAJC11 promoted BC cell proliferation, migration, invasion, and tumor growth. Mechanistically, RNA pull-down, mass spectrum, RNA immunoprecipitation, fluorescence in situ hybridization assays, and rescue experiments were executed.<h4>Results</h4>We found that circDNAJC11 was significantly upregulated in triple-negative breast cancer tissues and cells. Clinical data revealed that the high expression of circDNAJC11 was closely correlated with a poor prognosis of BC patients and could be an independent risk factor for BC prognosis. Functionally, gain- and loss-of-function experiments in vitro and in vivo showed that circDNAJC11 promoted BC cell proliferation, migration, invasion, and tumor growth. Mechanistically, RNA pull-down, mass spectrum, RNA immunoprecipitation, fluorescence in situ hybridization assays, and rescue experiments were executed. We demonstrated that circDNAJC11 combined with TAF15 to promote BC progression via stabilizing MAPK6 mRNA and activating the MAPK signaling pathway.<h4>Conclusions</h4>The circDNAJC11/TAF15/MAPK6 axis played a crucial role in the progression and development of BC, suggesting that circDNAJC11 might be a novel biomarker and therapeutical target for BC.
Also flagged:nucleotideOACASP5RASGEF1ACYP4B1secretion
Journal Article2023-03-09✓ 4 SnippetsXu R, Jin Y, Tang S, Wang W, Sun YE, Liu Y, Zhang W, Hou B, Huang Y, Ma Z.
In-Text Gene Mentions
Discussion)
…For example, DCC, which encodes the DCC receptor, is highly expressed in dopamine cells and interacts with Netrin-1, which plays an important role in regulating synaptic development.…
Discussion)
…For example,DCC, which encodes…
Discussion)
…which encodes theDCC receptorreceptor, is highly…
Discussion)
…results, polymorphism ofDCCshowed a significant…
Show Full Abstract
<h4>Background</h4>Hip or knee osteoarthritis (OA) is one of the main causes of disability worldwide and occurs mostly in the older adults. Total hip or knee arthroplasty is the most effective method to treat OA. However, severe postsurgical pain leading to a poor prognosis. So, investigating the population genetics and genes related to severe chronic pain in older adult patients after lower extremity arthroplasty is helpful to improve the quality of treatment.<h4>Methods</h4>We collected blood samples from elderly patients who underwent lower extremity arthroplasty from September 2020 to February 2021 at the Drum Tower Hospital Affiliated to Nanjing University Medical School. The enrolled patients provided measures of pain intensity using the numerical rating scale on the 90th day after surgery. Patients were divided into the case group (Group A) and the control group (Group B) including 10 patients respectively by the numerical rating scale. DNA was isolated from the blood samples of the two groups for whole-exome sequencing.<h4>Results</h4>In total, 661 variants were identified in the 507 gene regions that were significantly different between both groups (P < 0.05), including CASP5, RASGEF1A, CYP4B1, etc. These genes are mainly involved in biological processes, including cell-cell adhesion, ECM-receptor interaction, metabolism, secretion of bioactive substances, ion binding and transport, regulation of DNA methylation, and chromatin assembly.<h4>Conclusions</h4>The current study shows some variants within genes are significantly associated with severe postsurgical chronic pain in older adult patients after lower extremity arthroplasty, indicating a genetic predisposition for chronic postsurgical pain. The study was registered according to ICMJE guidelines. The trial registration number is ChiCTR2000031655 and registration date is April 6th, 2020.
Also flagged:TNIP1autophagyorganellesmitophagybindingLC3
Journal Article2023-03-09✓ 1 SnippetLe Guerroué F, Bunker EN, Rosencrans WM, Nguyen JT, Basar MA, Werner A, Chou TF, Wang C, Youle RJ.
In-Text Gene Mentions
Text
…CCPG1…
Show Full Abstract
Mitophagy is a form of selective autophagy that disposes of superfluous and potentially damage-inducing organelles in a tightly controlled manner. While the machinery involved in mitophagy induction is well known, the regulation of the components is less clear. Here, we demonstrate that TNIP1 knockout in HeLa cells accelerates mitophagy rates and that ectopic TNIP1 negatively regulates the rate of mitophagy. These functions of TNIP1 depend on an evolutionarily conserved LIR motif as well as an AHD3 domain, which are required for binding to the LC3/GABARAP family of proteins and the autophagy receptor TAX1BP1, respectively. We further show that phosphorylation appears to regulate its association with the ULK1 complex member FIP200, allowing TNIP1 to compete with autophagy receptors, which provides a molecular rationale for its inhibitory function during mitophagy. Taken together, our findings describe TNIP1 as a negative regulator of mitophagy that acts at the early steps of autophagosome biogenesis.
Decades of work on the spatiotemporal organization of mammalian DNA replication timing (RT) continues to unveil novel correlations with aspects of transcription and chromatin organization but, until recently, mechanisms regulating RT and the biological significance of the RT program had been indistinct. We now know that the RT program is both influenced by and necessary to maintain chromatin structure, forming an epigenetic positive feedback loop. Moreover, the discovery of specific cis-acting elements regulating mammalian RT at both the domain and the whole-chromosome level has revealed multiple cell-type-specific and developmentally regulated mechanisms of RT control. We review recent evidence for diverse mechanisms employed by different cell types to regulate their RT programs and the biological significance of RT regulation during development.
Acute megakaryoblastic leukemia (AMKL) is a rare subtype of acute myeloid leukemia (AML) characterized by abnormal megakaryoblasts expressing platelet-specific surface antigens. 4%-16% of childhood AMLs are AMKL. Childhood AMKL is usually associated with Down syndrome (DS). It is 500 times more common in patients with DS when compared to the general population. In contrast, non-DS-AMKL is much rarer. We describe a case of de novo non-DS-AMKL in a teenage girl child who presented with a history of excessive tiredness, fever, abdominal pain for three months, and vomiting for four days. She had lost appetite, and weight. On examination she was pale; there was no clubbing, hepatosplenomegaly or lymphadenopathy. There were no dysmorphic features or neurocutaneous markers. Laboratory tests showed bicytopenia (Hb: 6.5g/dL, total WBC count: 700/µL, platelet count: 216,000/ µL, Reticulocyte %: 0.42) and 14% blasts on the peripheral blood smear. Platelet clumps and anisocytosis were also noted. Bone marrow aspirate showed a few hypocellular particles with dilute cell trails but showed 42% blasts. Mature megakaryocytes showed marked dyspoiesis. Flow cytometry on bone marrow aspirate showed myeloblasts and megakaryoblasts. Karyotyping showed 46 XX. Hence, a final diagnosis of non-DS-AMKL was established. She was treated symptomatically. However, she was discharged on request. Interestingly, the expression of erythroid markers such as CD36 and lymphoid markers like CD7 is usually seen in DS-AMKL and not in non-DS-AMKL. AMKL is treated with AML-directed chemotherapies. Although complete remission rates are similar to other AML subtypes, overall survival is only about 18-40 weeks.
Also flagged:gene expressionmitochondrialmitochondriaendoplasmic reticulumschizophreniabipolar disorder
Journal Article2023-03-09No SnippetsKathuria A, Lopez-Lengowski K, McPhie D, Cohen BM, Karmacharya R.
Show Full Abstract
We compared transcriptomic profiles of cerebral organoids differentiated from induced pluripotent stem cells of eight schizophrenia and eight bipolar disorder patients to identify genes that were differentially expressed in cerebral organoids between two disorders. Gene ontology analysis showed relative up-regulation in schizophrenia organoids of genes related to response to cytokines, antigen binding and clathrin-coated vesicles, while showing up-regulation in bipolar disorder of genes involved in calcium binding. Gene set enrichment analysis revealed enrichment in schizophrenia of genes involved in mitochondrial and oxidative phosphorylation while showing enrichment in bipolar disorder of genes involved in long term potentiation and neuro-transporters. We compared mitochondrial function in cerebral organoids from schizophrenia and bipolar disorder subjects and found that while schizophrenia organoids showed deficits in basal oxygen consumption rate and ATP production when compared to healthy control organoids, while bipolar disorder organoids did not show these deficits. Gene ontology analyses also revealed enrichment in bipolar disorder of genes in ion binding and regulation of transport. Experiments examining the interaction between mitochondria and endoplasmic reticulum in cortical neurons from bipolar disorder subjects showed a significantly lower number of contact sites between mitochondria and endoplasmic reticulum when compared to cortical neurons from schizophrenia patients. These results point to disease-specific deficits in mitochondrial respiration in schizophrenia and in mitochondrial-endoplasmic reticulum interactions in bipolar disorder.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s44192-023-00031-8.
Also flagged:Rock1Rock2primary immunodeficienciesRho-kinasesmitosiscell cycle
Journal Article2023-03-09✓ 1 SnippetSambandam A, Storm E, Tauc H, Hackney JA, Garfield D, Caplazi P, Liu J, Zhang J, Zhang H, Duggan J, Jeet S, Gierke S, Chang P, Wu X, Newman R, Tam L, Alcantar T, Wang L, Roose-Girma M, Modrusan Z, Lee WP, Jasper H, de Sauvage F, Pappu R.
In-Text Gene Mentions
Results)
…Axin2 , andOlfm4genes ( Fig.…
Show Full Abstract
The ability of stem cells to rapidly proliferate and differentiate is integral to the steady-state maintenance of tissues with high turnover such as the blood and intestine. Mutations that alter these processes can cause primary immunodeficiencies, malignancies and defects in barrier function. The Rho-kinases, Rock1 and Rock2, regulate cell shape and cytoskeletal rearrangement, activities essential to mitosis. Here, we use inducible gene targeting to ablate <i>Rock1</i> and <i>Rock2</i> in adult mice, and identify an obligate requirement for these enzymes in the preservation of the hematopoietic and gastrointestinal systems. Hematopoietic cell progenitors devoid of Rho-kinases display cell cycle arrest, blocking the differentiation to mature blood lineages. Similarly, these mice exhibit impaired epithelial cell renewal in the small intestine, which is ultimately fatal. Our data reveal a novel role for these kinases in the proliferation and viability of stem cells and their progenitors, which is vital to maintaining the steady-state integrity of these organ systems.
Also flagged:pulmonary tuberculosisTBGene Expressionpathogenesisinfectious diseaseTuberculosis
Journal Article2023-03-09✓ 5 SnippetsZhu Q, Liu J.
In-Text Gene Mentions
Results)
…The heatmap revealed that CACNA1E and C1QC were upregulated in the PTB group, while the remaining 9 genes were downregulated (Figure 5C).…
Discussion)
…Therefore, the upregulation of CACNA1E in PTB may result in the activation of calcium channels and lead to the pathogenesis of PTB.…
Results)
…Subunit Alpha1 E (CACNA1E), Oxysterol Binding Protein…
Results)
…heatmap revealed thatCACNA1Eand C1QC were…
Discussion)
…TheCACNA1Eprotein can mediate…
Show Full Abstract
<b>Background:</b> Pulmonary tuberculosis (PTB) is a chronic infectious disease and is the most common type of TB. Although the sputum smear test is a gold standard for diagnosing PTB, the method has numerous limitations, including low sensitivity, low specificity, and insufficient samples. <b>Methods:</b> The present study aimed to identify specific biomarkers of PTB and construct a model for diagnosing PTB by combining random forest (RF) and artificial neural network (ANN) algorithms. Two publicly available cohorts of TB, namely, the GSE83456 (training) and GSE42834 (validation) cohorts, were retrieved from the Gene Expression Omnibus (GEO) database. A total of 45 and 61 differentially expressed genes (DEGs) were identified between the PTB and control samples, respectively, by screening the GSE83456 cohort. An RF classifier was used for identifying specific biomarkers, following which an ANN-based classification model was constructed for identifying PTB samples. The accuracy of the ANN model was validated using the receiver operating characteristic (ROC) curve. The proportion of 22 types of immunocytes in the PTB samples was measured using the CIBERSORT algorithm, and the correlations between the immunocytes were determined. <b>Results:</b> Differential analysis revealed that 11 and 22 DEGs were upregulated and downregulated, respectively, and 11 biomarkers specific to PTB were identified by the RF classifier. The weights of these biomarkers were determined and an ANN-based classification model was subsequently constructed. The model exhibited outstanding performance, as revealed by the area under the curve (AUC), which was 1.000 for the training cohort. The AUC of the validation cohort was 0.946, which further confirmed the accuracy of the model. <b>Conclusion:</b> Altogether, the present study successfully identified specific genetic biomarkers of PTB and constructed a highly accurate model for the diagnosis of PTB based on blood samples. The model developed herein can serve as a reliable reference for the early detection of PTB and provide novel perspectives into the pathogenesis of PTB.
Also flagged:colon adenocarcinomaperoxiredoxin4PRDX4COADcell growthperoxiredoxin
Journal Article2023-03-09✓ 5 SnippetsZhou H, Li L, Chen J, Hou S, Zhou T, Xiong Y.
In-Text Gene Mentions
Discussion)
…In addition, PRDX1, PRDX2, and PRDX6 have also been reported to be overexpressed in oral squamous cell carcinoma (30–32).…
Introduction)
…They can be further divided into three subgroups: 2-cysteine (PRDX1-4), atypical 2-cysteine (PRDX5), and 1-cysteine (PRDX6), according to the mechanism of response to cysteine dependence.…
Introduction)
…mammalian cells, namely PRDX1-PRDX6.…
Introduction)
…(PRDX5), and 1-cysteine (PRDX6), according to the…
Results)
…PRDX6was highly expressed…
Show Full Abstract
<h4>Background</h4>The peroxiredoxin family, a crucial regulator of redox reactions, is strongly associated with various tumorigenesis. However, the role of peroxiredoxin4 (PRDX4) in colon adenocarcinoma (COAD) remains poorly understood.<h4>Methods</h4>Multicenter databases, including GEPIA, HPA, UALCAN, cBioPortal, cancerSEA, STRING, CCLE, and LinkedOmics, comprehensively analyzed transcriptional expression, prognostic value, genetic alterations, signaling pathways, and associated genes of the PRDXs in COAD patients. Colony formation, transwell, flow cytometry, sphere formation, and xenograft assays were performed to validate further <i>in vitro</i> and <i>in vivo</i>.<h4>Results</h4>Members of the PRDX family were differentially expressed in COAD, with each member showing varying degrees of genetic alterations. Intriguingly, only PRDX4 significantly correlated with COAD prognosis and stage. The single-cell sequencing suggested that PRDX4 is positively correlated with proliferation, apoptosis, and invasion, whereas negatively correlated with stemness. Moreover, PRDX4 involved in a series of critical biological processes, such as cell growth. Furthermore, <i>in vivo</i> and <i>in vitro</i> analyses indicated that knocking down PRDX4 inhibits the proliferation and invasion of HCT116 cells while promoting apoptosis and stemness.<h4>Conclusions</h4>We identified PRDX4 expression as a novel potential prognostic marker in COAD.
Also flagged:transcription factorsT-betGATA3STATsBatfIkaros
Journal Article2023-03-09No SnippetsKorchagina AA, Shein SA, Koroleva E, Tumanov AV.
Show Full Abstract
Innate lymphoid cells (ILCs) are heterogeneous innate immune cells which participate in host defense, mucosal repair and immunopathology by producing effector cytokines similarly to their adaptive immune cell counterparts. The development of ILC1, 2, and 3 subsets is controlled by core transcription factors: T-bet, GATA3, and RORγt, respectively. ILCs can undergo plasticity and transdifferentiate to other ILC subsets in response to invading pathogens and changes in local tissue environment. Accumulating evidence suggests that the plasticity and the maintenance of ILC identity is controlled by a balance between these and additional transcription factors such as STATs, Batf, Ikaros, Runx3, c-Maf, Bcl11b, and Zbtb46, activated in response to lineage-guiding cytokines. However, how interplay between these transcription factors leads to ILC plasticity and the maintenance of ILC identity remains hypothetical. In this review, we discuss recent advances in understanding transcriptional regulation of ILCs in homeostatic and inflammatory conditions.
Also flagged:AQP4antibodyMOGoptic neuritisaquaporin 4 antibodyON
Journal Article2023-03-09✓ 1 SnippetChen X, Cheng L, Pan Y, Chen P, Luo Y, Li S, Zou W, Wang K.
In-Text Gene Mentions
Results)
…, CXCL1 andCACNA1Ewere significantly increased,…
Show Full Abstract
<h4>Purpose</h4>To compare the different immunological mechanisms between aquaporin 4 antibody-associated optic neuritis (AQP4-ON) and myelin oligodendrocyte glycoprotein antibody-associated optic neuritis (MOG-ON) based on RNA sequencing (RNA-seq) of whole blood.<h4>Methods</h4>Whole blood was collected from seven healthy volunteers, 6 patients with AQP4-ON and 8 patients with MOG-ON, and used for RNA-seq analysis. An examination of immune cell infiltration was performed using the CIBERSORTx algorithm to identify infiltrated immune cells.<h4>Results</h4>RNA-seq analysis showed that the inflammatory signaling was mainly activated by <i>TLR2</i>, <i>TLR5</i>, <i>TLR8</i> and <i>TLR10</i> in AQP4-ON patients, while which was mainly activated by <i>TLR1</i>, <i>TLR2</i>, <i>TLR4</i>, <i>TLR5</i> and <i>TLR8</i> in MOG-ON patients. Biological function identification of differentially expressed genes (DEGs) based on Gene Ontology (GO) term and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis, as well as Disease Ontology (DO) analysis, showed that the inflammation in AQP4-ON was likely mediated by damage-associated molecular pattern (DAMP), while which in MOG-ON was likely mediated by pathogen-associated molecular pattern (PAMP). Analysis of immune cell infiltration showed that the proportion of immune cell infiltration was related to patients' vision. The infiltration ratios of monocytes (rs=0.69, <i>P</i>=0.006) and M0 macrophages (rs=0.66, <i>P</i>=0.01) were positively correlated with the BCVA (LogMAR), and the infiltration ratio of neutrophils was negatively correlated with the BCVA (LogMAR) (rs=0.65, <i>P</i>=0.01).<h4>Conclusion</h4>This study reveals different immunological mechanisms between AQP4-ON and MOG-ON based on transcriptomics analysis of patients' whole blood, which may expand the current knowledge regarding optic neuritis.
Also flagged:ConnexinsMicrogliamembraneneurotrophic factorscytoplasmgap junctions
Journal Article2023-03-09✓ 3 SnippetsCaruso G, Di Pietro L, Caraci F.
In-Text Gene Mentions
Methods)
…Moreover, in Huntington’s disease, increased Cx43 GJs have been related to the mitochondrial fragmentation deriving from the abnormally long polyglutamine found in the HTT protein [223].…
S I O 001029)
…This event occurs when microglial cells are exposed to a stimulus, such as the accumulation of aberrant and/or misfolded proteins, like amyloid-β (Aβ) and huntingtin (HTT) during ageing [45], or ROS, or even viral infections.…
Methods)
…found in theHTTprotein [ 223…
Show Full Abstract
Microglia represent the immune system of the brain. Their role is central in two phenomena, neuroinflammation and oxidative stress, which are at the roots of different pathologies related to the central nervous system (CNS). In order to maintain the homeostasis of the brain and re-establish the equilibrium after a threatening imbalance, microglia communicate with each other and other cells within the CNS by receiving specific signals through membrane-bound receptors and then releasing neurotrophic factors into either the extracellular <i>milieu</i> or directly into the cytoplasm of nearby cells, such as astrocytes and neurons. These last two mechanisms rely on the activity of protein structures that enable the formation of channels in the membrane, namely, connexins and pannexins, that group and form gap junctions, hemichannels, and pannexons. These channels allow the release of gliotransmitters, such as adenosine triphosphate (ATP) and glutamate, together with calcium ion (Ca<sup>2+</sup>), that seem to play a pivotal role in inter-cellular communication. The aim of the present review is focused on the physiology of channel protein complexes and their contribution to neuroinflammatory and oxidative stress-related phenomena, which play a central role in neurodegenerative disorders. We will then discuss how pharmacological modulation of these channels can impact neuroinflammatory phenomena and hypothesize that currently available nutraceuticals, such as carnosine and <i>N</i>-acetylcysteine, can modulate the activity of connexins and pannexins in microglial cells and reduce oxidative stress in neurodegenerative disorders.
Also flagged:Barrier-to-autointegration factorBAFnuclear laminagene expressioncell cycleamino acid
Journal Article2023-03-09✓ 2 SnippetsMarcelot A, Rodriguez-Tirado F, Cuniasse P, Joiner ML, Miron S, Soshnev AA, Fang M, Pufall MA, Mathews KD, Moore SA, Zinn-Justin S, Geyer PK.
In-Text Gene Mentions
Discussion)
…Additionally, variation of the gene encoding a second BAF kinase, VRK2, is associated with several neurological disorders [56].…
Discussion)
…second BAF kinase,VRK2, is associated…
Show Full Abstract
Barrier-to-autointegration factor (BAF) is an essential component of the nuclear lamina. Encoded by <i>BANF1</i>, this DNA binding protein contributes to the regulation of gene expression, cell cycle progression, and nuclear integrity. A rare recessive BAF variant, Ala12Thr, causes the premature aging syndrome, Néstor-Guillermo progeria syndrome (NGPS). Here, we report the first dominant pathogenic BAF variant, Gly16Arg, identified in a patient presenting with progressive neuromuscular weakness. Although disease variants carry nearby amino acid substitutions, cellular and biochemical properties are distinct. In contrast to NGPS, Gly16Arg patient fibroblasts show modest changes in nuclear lamina structure and increases in repressive marks associated with heterochromatin. Structural studies reveal that the Gly16Arg substitution introduces a salt bridge between BAF monomers, reducing the conformation ensemble available to BAF. We show that this structural change increases the double-stranded DNA binding affinity of BAF Gly16Arg. Together, our findings suggest that BAF Gly16Arg has an increased chromatin occupancy that leads to epigenetic changes and impacts nuclear functions. These observations provide a new example of how a missense mutation can change a protein conformational equilibrium to cause a dominant disease and extend our understanding of mechanisms by which BAF function impacts human health.
…As an example, we detected a DDX3X::MLLT10 fusion in a female AML patient.…
S I O 001029)
…Besides DDX3X::MLLT10 fusion, other aberrations, such as a SUZ12 deletion, that are more common in ALL were detected by OGM in one such patient.…
Show Full Abstract
The classification and risk stratification of acute myeloid leukemia (AML) is based on reliable genetic diagnostics. A broad and expanding variety of relevant aberrations are structural variants beyond single-nucleotide variants. Optical Genome Mapping is an unbiased, genome-wide, amplification-free method for the detection of structural variants. In this review, the current knowledge of Optical Genome Mapping (OGM) with regard to diagnostics in hematological malignancies in general, and AML in specific, is summarized. Furthermore, this review focuses on the ability of OGM to expand the use of cytogenetic diagnostics in AML and perhaps even replace older techniques such as chromosomal-banding analysis, fluorescence in situ hybridization, or copy number variation microarrays. Finally, OGM is compared to amplification-based techniques and a brief outlook for future directions is given.
Also flagged:Epilepsyneurological disorderpathogenesistranslationalmitochondrialmetabolism
Journal Article2023-03-09No SnippetsShevlyakov AD, Kolesnikova TO, de Abreu MS, Petersen EV, Yenkoyan KB, Demin KA, Kalueff AV.
Show Full Abstract
Epilepsy is a highly prevalent, severely debilitating neurological disorder characterized by seizures and neuronal hyperactivity due to an imbalanced neurotransmission. As genetic factors play a key role in epilepsy and its treatment, various genetic and genomic technologies continue to dissect the genetic causes of this disorder. However, the exact pathogenesis of epilepsy is not fully understood, necessitating further translational studies of this condition. Here, we applied a computational in silico approach to generate a comprehensive network of molecular pathways involved in epilepsy, based on known human candidate epilepsy genes and their established molecular interactors. Clustering the resulting network identified potential key interactors that may contribute to the development of epilepsy, and revealed functional molecular pathways associated with this disorder, including those related to neuronal hyperactivity, cytoskeletal and mitochondrial function, and metabolism. While traditional antiepileptic drugs often target single mechanisms associated with epilepsy, recent studies suggest targeting downstream pathways as an alternative efficient strategy. However, many potential downstream pathways have not yet been considered as promising targets for antiepileptic treatment. Our study calls for further research into the complexity of molecular mechanisms underlying epilepsy, aiming to develop more effective treatments targeting novel putative downstream pathways of this disorder.
Also flagged:malignant diseasesleukemiaacute lymphoblasticmyeloid leukemiachronic graft versus host diseaseHLA
Journal Article2023-03-09✓ 3 SnippetsIlan U, Brivio E, Algeri M, Balduzzi A, Gonzalez-Vincent M, Locatelli F, Zwaan CM, Baruchel A, Lindemans C, Bautista F.
In-Text Gene Mentions
Results)
…that antithrombin III (ATIII) has anti-inflammatory proper…
Results)
…prophylactic or therapeuticATIIIhave produced contradictory…
Results)
…has evaluated theATIIIeffect on children…
Show Full Abstract
Hematopoietic stem cell transplantation (HSCT) is often the only curative treatment option for patients suffering from various types of malignant diseases and some non-cancerous conditions. Nevertheless, it is associated with a high risk of complications leading to transplant-related mortality and long-term morbidity. An increasing number of therapeutic and prevention strategies have been developed over the last few years to tackle the complications arising in patients receiving an HSCT. These strategies have been mainly carried out in adults and some are now being translated into children. In this manuscript, we review the recent advancements in the development and implementation of treatment options for post-HSCT non-infectious complications in pediatric patients with leukemia and other non-malignant conditions, with a special attention on the new agents available within clinical trials. We focused on the following conditions: graft failure, prevention of relapse and early interventions after detection of minimal residual disease positivity following HSCT in acute lymphoblastic and myeloid leukemia, chronic graft versus host disease, non-infectious pulmonary complications, and complications of endothelial origin.
Also flagged:PolyphenolicsSynthesesFlavonoidsIsoflavonoidsNeoflavonoidssynthesis
Journal Article2023-03-09No SnippetsUmer SM, Shamim S, Khan KM, Saleem RSZ.
Show Full Abstract
Flavonoids, isoflavonoids, neoflavonoids, and their various subcategories are polyphenolics-an extensive class of natural products. These compounds are bioactive and display multiple activities, including anticancer, antibacterial, antiviral, antioxidant, and neuroprotective activities. Thus, these compounds can serve as leads for therapeutic agents or targets for complex synthesis; they are coveted and routinely isolated, characterized, biologically evaluated, and synthesized. However, data regarding the compounds' sources, isolation procedures, structural novelties, bioactivities, and synthetic schemes are often dispersed and complex, a dilemma this review aims to address. To serve as an easily accessible guide for researchers wanting to apprise themselves of the latest advancements in this subfield, this review summarizes seventy-six (76) articles published between 2016 and 2022 that detail the isolation and characterization of two hundred and forty-nine (249) novel compounds, the total and semisyntheses of thirteen (13) compounds, and reappraisals of the structures of twenty (20) previously reported compounds and their bioactivities. This article also discusses new synthetic methods and enzymes capable of producing or modifying flavonoids, isoflavonoids, or neoflavonoids.
Also flagged:calcium phosphatetricalciummanganesehydroxyapatitepolyurethanemangiferin
Journal Article2023-03-09No SnippetsSwain S, Koduru JR, Rautray TR.
Show Full Abstract
Biphasic calcium phosphate (BCP) containing β-tricalcium phosphate and manganese (Mn)-substituted hydroxyapatite (HAP) was synthesized. Biomedical scaffolds were prepared using this synthesized powder on a sacrificial polyurethane sponge template after the incorporation of mangiferin (MAN). Mn was substituted at a concentration of 5% and 10% in HAP to examine the efficacy of Mn at various concentrations. The phase analysis of the as-formed BCP scaffold was carried out by X-ray diffraction analysis, while the qualitative observation of morphology and the osteoblast cell differentiation were carried out by scanning electron microscopy and confocal laser scanning microscopy techniques. Gene expressions of osteocalcin, collagen 1, and RUNX2 were carried out using qRT-PCR analyses. Significantly higher (<i>p</i> < 0.05) levels of ALP activity were observed with extended osteoblast induction on the mangiferin-incorporated BCP scaffolds. After characterization of the specimens, it was found that the scaffolds with 10% Mn-incorporated BCP with mangiferin showed better osteogenicity and simultaneously the same scaffolds exhibited higher anti-bacterial properties as observed from the bacterial viability test. This study was carried out to evaluate the efficacy of Mn and MAN in BCP for osteogenicity and antibacterial action.
Also flagged:Asthmamucusimmune responsecytokineinflammatory cytokineallergic asthma
Journal Article2023-03-09✓ 1 SnippetTuri KN, Michel CR, Manke J, Doenges KA, Reisdorph N, Bauer AK.
In-Text Gene Mentions
Results)
…, Repin1 ,Rabgap1l, Pask ,…
Show Full Abstract
Allergy and asthma pathogenesis are associated with the dysregulation of metabolic pathways. To understand the effects of allergen sensitization on metabolic pathways, we conducted a multi-omics study using BALB/cJ mice sensitized to house dust mite (HDM) extract or saline. Lung tissue was used to perform untargeted metabolomics and transcriptomics while both lung tissue and plasma were used for targeted lipidomics. Following statistical comparisons, an integrated pathway analysis was conducted. Histopathological changes demonstrated an allergic response in HDM-sensitized mice. Untargeted metabolomics showed 391 lung tissue compounds were significantly different between HDM and control mice (adjusted <i>p</i> < 0.05); with most compounds mapping to glycerophospholipid and sphingolipid pathways. Several lung oxylipins, including 14-HDHA, 8-HETE, 15-HETE, 6-keto-PGF1α, and PGE2 were significantly elevated in HDM-sensitized mice (<i>p</i> < 0.05). Global gene expression analysis showed upregulated calcium channel, G protein-signaling, and mTORC1 signaling pathways. Genes related to oxylipin metabolism such as <i>Cox</i>, <i>Cyp450</i>s, and <i>cPla2</i> trended upwards. Joint analysis of metabolomics and transcriptomics supported a role for glycerophospholipid and sphingolipid metabolism following HDM sensitization. Collectively, our multi-omics results linked decreased glycerophospholipid and sphingolipid compounds and increased oxylipins with allergic sensitization; concurrent upregulation of associated gene pathways supports a role for bioactive lipids in the pathogenesis of allergy and asthma.
Journal Article2023-03-09✓ 2 SnippetsLi T, Wang L, Wu L, Xie Y, Chang M, Wang D, Yi L, Zhu X, Mi M.
In-Text Gene Mentions
Discussion)
…Wu et al. found that myricetin administration to mice altered skeletal muscle type and improved exercise performance by modulating the miR-499/Sox6 axis [43].…
Discussion)
…by modulating the miR-499/Sox6axis [ 43…
Show Full Abstract
Cardiovascular adverse effects caused by high-intensity exercise (HIE) have become a public health problem of widespread concern. The therapeutic effect and metabolic regulation mechanism of myricetin, a phytochemical with potential therapeutic effects, have rarely been studied. In this study, we established mice models of different doses of myricetin intervention with 1 week of HIE after intervention. Cardiac function tests, serology, and pathological examinations were used to evaluate the protective effect of myricetin on the myocardium. The possible therapeutic targets of myricetin were obtained using an integrated analysis of metabolomics and network pharmacology and verified using molecular docking and RT-qPCR experiments. Different concentrations of myricetin improved cardiac function, significantly reduced the levels of myocardial injury markers, alleviated myocardial ultrastructural damage, reduced the area of ischemia/hypoxia, and increased the content of CX43. We obtained the potential targets and regulated metabolic network of myricetin by combined network pharmacology and metabolomics analysis and validated them by molecular docking and RT-qPCR. In conclusion, our findings suggest that myricetin exerts anti-cardiac injury effects of HIE through the downregulation of PTGS2 and MAOB and the upregulation of MAP2K1 and EGFR while regulating the complicated myocardial metabolic network.
…FOG1, SRY-box 6 (SOX6), the nucleosome remodeling…
Show Full Abstract
Investigations to understand the function and control of the globin genes have led to some of the most exciting molecular discoveries and biomedical breakthroughs of the 20th and 21st centuries. Extensive characterization of the globin gene locus, accompanied by pioneering work on the utilization of viruses as human gene delivery tools in human hematopoietic stem and progenitor cells (HPSCs), has led to transformative and successful therapies via autologous hematopoietic stem-cell transplant with gene therapy (HSCT-GT). Due to the advanced understanding of the β-globin gene cluster, the first diseases considered for autologous HSCT-GT were two prevalent β-hemoglobinopathies: sickle cell disease and β-thalassemia, both affecting functional β-globin chains and leading to substantial morbidity. Both conditions are suitable for allogeneic HSCT; however, this therapy comes with serious risks and is most effective using an HLA-matched family donor (which is not available for most patients) to obtain optimal therapeutic and safe benefits. Transplants from unrelated or haplo-identical donors carry higher risks, although they are progressively improving. Conversely, HSCT-GT utilizes the patient's own HSPCs, broadening access to more patients. Several gene therapy clinical trials have been reported to have achieved significant disease improvement, and more are underway. Based on the safety and the therapeutic success of autologous HSCT-GT, the U.S. Food and Drug Administration (FDA) in 2022 approved an HSCT-GT for β-thalassemia (Zynteglo™). This review illuminates the β-globin gene research journey, adversities faced, and achievements reached; it highlights important molecular and genetic findings of the β-globin locus, describes the predominant globin vectors, and concludes by describing promising results from clinical trials for both sickle cell disease and β-thalassemia.
Also flagged:Hepatocellular Carcinomamalignant neoplasm of the liverhepatitismetastatic diseaseprimary tumorcancer
Journal Article2023-03-09✓ 1 SnippetKaramitsou P, Skliris JP, Gougousis S, Karamitsou A, Poutoglidis A.
In-Text Gene Mentions
Introduction)
…primary biliary cholangitis,hemochromatosis, and alpha-1 antitrypsin…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the most dominant malignant neoplasm of the liver and constitutes the majority of all primary malignancies. Most reported cases of HCC occur in the developing world and are mainly associated with chronic hepatitis B and C viruses. Both hematogenous and lymphatic spreading is common in HCC. Patients with HCC might manifest extra-hepatic metastases and the lungs are the most common potential site of metastatic deposits. Rare sites of metastatic disease have also been described. Oropharyngeal metastases of HCC are rare and there are few reports available in the literature. We report a rare case of extra-hepatic metastasis of HCC to the right tonsil in an 84-year-old patient. The clinical appearance of metastatic oral lesions could be easily underestimated, and diagnosis of the primary tumor might delay. A biopsy of the oral lesion is important for an accurate diagnosis. Metastasis in the oral cavity and oropharynx of an HCC is usually evidence of widespread disease and predisposes to an ominous prognosis.
Also flagged:serine proteaseserine protease inhibitor A1SERPINA1SERPINA3chymotrypsinglycoprotein
Journal Article2023-03-09✓ 5 SnippetsWu D, Guo M, Robinson CV.
In-Text Gene Mentions
Results)
…Therefore, we examined the crystal structure of the SERPINC1-thrombin-heparin complex to inform the oligosaccharide regulation of the SERPINA1/A3-protease interactions (Figure 5).33…
…structure of theSERPINC1-thrombin-heparin complex to i…
Results)
…33SERPINC1is an endogenous…
Results)
…D to regulateSERPINC1-thrombin interactions via two…
Show Full Abstract
Understanding the combined impacts of genetic variances and post-translational modifications requires new approaches. Here, we delineate proteoforms of plasma serine protease inhibitors and relate specific proteoforms to their interactions in complexes through the use of native mass spectrometry (MS). First, we dissect the proteoform repertoire of an acute-phase plasma protein, serine protease inhibitor A1 (SERPINA1), resolving four SERPINA1 variants (M1V, M1A, M2, and M3) with common single-nucleotide polymorphisms (SNPs). Investigating the glycosylation status of these variants and their ability to form complexes with a serine protease, elastase, we find that fucosylation stabilizes the interaction of the SERPINA1 M1V variant through its core fucosylation on Asn271. In contrast, antennary fucosylation on Asn271 destabilizes SERPINA1-elastase interactions. We unveil the same opposing effects of core and antennary fucosylation on SERPINA3 interactions with chymotrypsin. Together, our native MS results highlight the modulating effects of fucosylation with different linkages on glycoprotein interactions.
Also flagged:LocalizationMDinner ear diseasesotosclerosishearingloss
Journal Article2023-03-09No SnippetsArambula AM, Gu S, Warnecke A, Schmitt HA, Staecker H, Hoa M.
Show Full Abstract
<h4>Hypothesis</h4>Proteins enriched in the perilymph proteome of Meńier̀e disease (MD) patients may identify affected cell types. Utilizing single-cell transcriptome datasets from the mammalian cochlea, we hypothesize that these enriched perilymph proteins can be localized to specific cochlear cell types.<h4>Background</h4>The limited understanding of human inner ear pathologies and their associated biomolecular variations hinder efforts to develop disease-specific diagnostics and therapeutics. Perilymph sampling and analysis is now enabling further characterization of the cochlear microenvironment. Recently, enriched inner ear protein expression has been demonstrated in patients with MD compared to patients with other inner ear diseases. Localizing expression of these proteins to cochlear cell types can further our knowledge of potential disease pathways and subsequent development of targeted therapeutics.<h4>Methods</h4>We compiled previously published data regarding differential perilymph proteome profiles amongst patients with MD, otosclerosis, enlarged vestibular aqueduct, sudden hearing loss, and hearing loss of undefined etiology (controls). Enriched proteins in MD were cross-referenced against published single-cell/single-nucleus RNA-sequencing datasets to localize gene expression to specific cochlear cell types.<h4>Results</h4>In silico analysis of single-cell transcriptomic datasets demonstrates enrichment of a unique group of perilymph proteins associated with MD in a variety of intracochlear cells, and some exogeneous hematologic and immune effector cells. This suggests that these cell types may play an important role in the pathology associated with late MD, suggesting potential future areas of investigation for MD pathophysiology and treatment.<h4>Conclusions</h4>Perilymph proteins enriched in MD are expressed by specific cochlear cell types based on in silico localization, potentially facilitating development of disease-specific diagnostic markers and therapeutics.
Also flagged:GnRHgonadotropin-releasing hormoneaxonsCongenital hypogonadotropic hypogonadismKallmann syndromegenetic disorders
Journal Article2023-03-08✓ 1 SnippetCotellessa L, Marelli F, Duminuco P, Adamo M, Papadakis GE, Bartoloni L, Sato N, Lang-Muritano M, Troendle A, Dhillo WS, Morelli A, Guarnieri G, Pitteloud N, Persani L, Bonomi M, Giacobini P, Vezzoli V.
In vertebrate species, fertility is controlled by gonadotropin-releasing hormone (GnRH) neurons. GnRH cells arise outside the central nervous system, in the developing olfactory pit, and migrate along olfactory/vomeronasal/terminal nerve axons into the forebrain during embryonic development. Congenital hypogonadotropic hypogonadism (CHH) and Kallmann syndrome are rare genetic disorders characterized by infertility, and they are associated with defects in GnRH neuron migration and/or altered GnRH secretion and signaling. Here, we documented the expression of the jagged-1/Notch signaling pathway in GnRH neurons and along the GnRH neuron migratory route both in zebrafish embryos and in human fetuses. Genetic knockdown of the zebrafish ortholog of JAG1 (jag1b) resulted in altered GnRH migration and olfactory axonal projections to the olfactory bulbs. Next-generation sequencing was performed in 467 CHH unrelated probands, leading to the identification of heterozygous rare variants in JAG1. Functional in vitro validation of JAG1 mutants revealed that 7 out of the 9 studied variants exhibited reduced protein levels and altered subcellular localization. Together our data provide compelling evidence that Jag1/Notch signaling plays a prominent role in the development of GnRH neurons, and we propose that JAG1 insufficiency may contribute to the pathogenesis of CHH in humans.
Also flagged:COVID-19immune responselymphocyte activationneutrophil activationS100A9ANXA3
Journal Article2023-03-08✓ 1 SnippetFuzo CA, Fraga-Silva TFC, Maruyama SR, Bastos VAF, Rogerio LA, Takamiya NT, da Silva-Neto PV, Pimentel VE, Toro DM, Pérez MM, de Carvalho JCS, Carmona-Garcia I, Oliveira CNS, Degiovani AM, Ostini FM, Constant LF, de Amorim AP, Vilar FC, Feitosa MR, Parra RS, da Rocha JJR, Feres O, Gaspar GG, Viana AL, Fernandes APM, Santos IKFM, Russo EMS, Cardoso CRB, Sorgi CA, Faccioli LH, Bonato VLD, Dias-Baruffi M, ImmunoCOVID study group.
In-Text Gene Mentions
Abstract)
…ANXA3, CEACAM6, VNN1,OLFM4, IL1R2, TCN1 and…
Show Full Abstract
COVID-19 has a broad spectrum of clinical manifestations associated with the host immune response heterogeneity. Despite the advances in COVID-19 research, it is still crucial to seek a panel of molecular markers that enable accurate stratification of COVID-19 patients. Here, we performed a study that combined analysis of blood transcriptome, demographic data, clinical aspects and laboratory findings from 66 participants classified into different degrees of COVID-19 severity and healthy subjects. We identified a perturbation in blood-leukocyte transcriptional profile associated with COVID-19 aggravation, which was mainly related to processes that disfavoured lymphocyte activation and favoured neutrophil activation. This transcriptional profile stratified patients according to COVID-19 severity. Hence, it enabled identification of a turning point in transcriptional dynamics that distinguished disease outcomes and non-hospitalized from hospitalized moderate patients. Central genes of this unique neutrophil signature were S100A9, ANXA3, CEACAM6, VNN1, OLFM4, IL1R2, TCN1 and CD177. Our study indicates the molecular changes that are linked with the differing clinical aspects presented by humans when suffering from COVID-19, which involve neutrophil activation.
Also flagged:glomerular filtrationsickle cell diseaseChronic kidney diseasecreatinineESRDHb
Journal Article2023-03-08No SnippetsBelisário AR, Simões E Silva AC, Moura ICG, Carneiro-Proietti AB, Sabino EC, Loureiro P, Máximo C, Flor-Park MV, Rodrigues DOW, Ozahata MC, Mota RA, Dinardo CL, Kelly S, Custer B, Recipient Epidemiology and Donor Evaluation Study (REDS-III) International Component Brazil.
Show Full Abstract
Chronic kidney disease (CKD) has a significant impact on sickle cell disease (SCD) morbidity and mortality. Early identification of individuals at highest risk of developing CKD may allow therapeutic intervention to prevent worse outcomes. This study aimed to evaluate the prevalence and risk factors for reduced estimated glomerular filtration rate (eGFR) among adults with SCD in Brazil. Participants in the REDS-III multicenter SCD cohort with more severe genotypes aged ≥ 18 years with at least two serum creatinine values were analyzed. The eGFR was calculated using the Jamaica Sickle Cell Cohort Study GFR equation. The eGFR categories were defined according to the K/DOQI. Participants with eGFR ≥ 90 were compared to those with those with eGFR < 90. Among the 870 participants, 647 (74.4%) had eGFR ≥ 90, 211 (24.3%) had eGFR 60 to 89, six (0.7%) had eGFR 30 to 59, and six (0.7%) had ESRD. Male sex (OR: 37.3; 95%CI: 22.4-65.1), higher age (OR: 1.04; 95%CI: 1.02-1.06), higher diastolic blood pressure (OR: 1.03; 95%CI: 1.009-1.06), lower Hb (OR: 0.80; 95%CI: 0.68-0.93), and lower reticulocytes (OR: 0.94; 95%CI: 0.89-0.99) levels were independently associated with eGFR < 90. There was a trend towards higher odds of death in participants with eGFR < 90 (OR: 1.8; 95%CI: 0.95-3.32; p = 0.065). In turn, participants with eGFR < 60 had a 12.2 (95%CI: 2.1-96.9) times higher odds for death when compared to those with eGFR ≥ 60. In this study, eGFR < 90 was observed in one-quarter of adults. Older age, male sex, higher diastolic blood pressure, lower hemoglobin, and lower reticulocyte levels were associated with occurrence of eGFR < 90. Estimated GFR < 60 increased the risk of mortality.
Also flagged:globinthalassemiaβ-thalassemiaβ-hemoglobinopathiesHBS1Lγ-globin
Journal Article2023-03-08✓ 1 SnippetChumchuen S, Sripichai O, Jearawiriyapaisarn N, Fucharoen S, Peerapittayamongkol C.
In-Text Gene Mentions
Introduction)
…to BCL11A andSOX6has been shown…
Show Full Abstract
Imbalanced globin chain output contributes to thalassemia pathophysiology. Hence, induction of fetal hemoglobin in β-thalassemia and other β-hemoglobinopathies are of continuing interest for therapeutic approaches. Genome-wide association studies have identified three common genetic loci: namely β-globin (HBB), an intergenic region between MYB and HBS1L, and BCL11A underlying quantitative fetal hemoglobin production. Here, we report that knockdown of HBS1L (all known variants) using shRNA in early erythroblast obtained from β0-thalassemia/HbE patients triggers an upregulation of γ-globin mRNA 1.69 folds. There is modest perturbation of red cell differentiation assessed by flow cytometry and morphology studies. The levels of α- and β-globin mRNAs are relatively unaltered. Knockdown of HBS1L also increases the percentage of fetal hemoglobin around 16.7 folds when compared to non-targeting shRNA. Targeting HBS1L is attractive because of the potent induction of fetal hemoglobin and the modest effect on cell differentiation.
Also flagged:neurodegenerative syndromedyslexiadevelopmental speech disordersAlzheimer diseasemicrotubuletau
Journal Article2023-03-08✓ 1 SnippetNassan M, Piras IS, Rogalski E, Geula C, Mesulam MM, Huentelman M.
In-Text Gene Mentions
Text
…ABT1…
Show Full Abstract
<h4>Background and objectives</h4>Primary progressive aphasia (PPA) is a neurodegenerative syndrome of progressive language decline. PPA has 3 main subtypes: logopenic, semantic, and agrammatic. Observational studies suggested an association between language-related neurodevelopmental phenotypes and an increased risk of PPA. We sought to assess such relationships through Mendelian randomization (MR) approach, which can suggest potentially causal associations.<h4>Methods</h4>Genome-wide significant single-nucleotide polymorphisms (SNPs) associated with dyslexia (42 SNPs), developmental speech disorders (29 SNPs), and left-handedness (41 SNPs) were used as genetic proxies for the exposures. Eighteen of 41 SNPs of left-handedness were associated with structural asymmetry of the cerebral cortex. Genome-wide association study summary statistics were obtained from publicly available databases for semantic (308 cases/616 controls) and agrammatic PPA (269 cases/538 controls). The logopenic PPA (324 cases/3,444 controls) was approximated by proxy through the rubric of clinically diagnosed Alzheimer disease with salient language impairment. Inverse-weighted variance MR was performed as the main analysis for testing the relationship between the exposures and outcomes. Sensitivity analyses were completed to test the robustness of the results.<h4>Results</h4>Dyslexia, developmental speech disorders, and left-handedness were not associated with any PPA subtype (<i>p</i> > 0.05). The genetic proxy of cortical asymmetry in left-handedness was significantly associated with agrammatic PPA (β = 4.3, <i>p</i> = 0.007), but not with other PPA subtypes. This association was driven by microtubule-related genes, primarily by a variant that is in complete linkage disequilibrium with <i>MAPT</i> gene. Sensitivity analyses were overall consistent with the primary analyses.<h4>Discussion</h4>Our results do not support a causal association between dyslexia, developmental speech disorders, and handedness with any of the PPA subtypes. Our data suggest a complex association between cortical asymmetry genes and agrammatic PPA. Whether the additional association with left-handedness is necessary remains to be determined but is unlikely, given the absence of association between left-handedness and PPA. Genetic proxy of brain asymmetry (regardless of handedness) was not tested as an exposure due to lack of suitable genetic proxy. Furthermore, the genes related to cortical asymmetry associated with agrammatic PPA are implicated in microtubule-related proteins (<i>TUBA1B</i>, <i>TUBB</i>, and <i>MAPT</i>), which is keeping with the association of tau-related neurodegeneration in this PPA variant.
Also flagged:KTN1schizophreniapathogenesiskinectin 1psychiatric disorderdelusions
Journal Article2023-03-08✓ 1 SnippetMao Q, Lin X, Yin Q, Liu P, Zhang Y, Qu S, Xu J, Cheng W, Luo X, Kang L, Taximaimaiti R, Zheng C, Zhang H, Wang X, Ren H, Cao Y, Lin J, Luo X.
In-Text Gene Mentions
Introduction)
…( KTN1 ,DCC, BCL2L1 and…
Show Full Abstract
Cortical and subcortical structural alteration has been extensively reported in schizophrenia, including the unusual expansion of gray matter volumes (GMVs) of basal ganglia (BG), especially putamen. Previous genome-wide association studies pinpointed kinectin 1 gene (KTN1) as the most significant gene regulating the GMV of putamen. In this study, the role of KTN1 variants in risk and pathogenesis of schizophrenia was explored. A dense set of SNPs (n = 849) covering entire KTN1 was analyzed in three independent European- or African-American samples (n = 6704) and one mixed European and Asian Psychiatric Genomics Consortium sample (n = 56,418 cases vs. 78,818 controls), to identify replicable SNP-schizophrenia associations. The regulatory effects of schizophrenia-associated variants on the KTN1 mRNA expression in 16 cortical or subcortical regions in two European cohorts (n = 138 and 210, respectively), the total intracranial volume (ICV) in 46 European cohorts (n = 18,713), the GMVs of seven subcortical structures in 50 European cohorts (n = 38,258), and the surface areas (SA) and thickness (TH) of whole cortex and 34 cortical regions in 50 European cohorts (n = 33,992) and eight non-European cohorts (n = 2944) were carefully explored. We found that across entire KTN1, only 26 SNPs within the same block (r<sup>2</sup> > 0.85) were associated with schizophrenia across ≥ 2 independent samples (7.5 × 10<sup>-5</sup> ≤ p ≤ 0.048). The schizophrenia-risk alleles, which increased significantly risk for schizophrenia in Europeans (q < 0.05), were all minor alleles (f < 0.5), consistently increased (1) the KTN1 mRNA expression in 12 brain regions significantly (5.9 × 10<sup>-12</sup> ≤ p ≤ 0.050; q < 0.05), (2) the ICV significantly (6.1 × 10<sup>-4</sup> ≤ p ≤ 0.008; q < 0.05), (3) the SA of whole (9.6 × 10<sup>-3</sup> ≤ p ≤ 0.047) and two regional cortices potentially (2.5 × 10<sup>-3</sup> ≤ p ≤ 0.042; q > 0.05), and (4) the TH of eight regional cortices potentially (0.006 ≤ p ≤ 0.050; q > 0.05), and consistently decreased (1) the BG GMVs significantly (1.8 × 10<sup>-19</sup> ≤ p ≤ 0.050; q < 0.05), especially putamen GMV (1.8 × 10<sup>-19</sup> ≤ p ≤ 1.0 × 10<sup>-4</sup>; q < 0.05, (2) the SA of four regional cortices potentially (0.010 ≤ p ≤ 0.048), and (3) the TH of four regional cortices potentially (0.015 ≤ p ≤ 0.049) in Europeans. We concluded that we identified a significant, functional, and robust risk variant block covering entire KTN1 that might play a critical role in the risk and pathogenesis of schizophrenia.
Also flagged:autism spectrum disorderneurological developmental disordercomplementcoagulationdigestioncholesterol
Journal Article2023-03-08✓ 2 SnippetsZhang H, Tang X, Feng C, Gao Y, Hong Q, Zhang J, Zhang X, Zheng Q, Lin J, Liu X, Shen L.
In-Text Gene Mentions
Abstract)
…complement pathway (PLG,SERPINC1, and A2M) and…
Abstract)
…pathway (CD5L, ATRN,SERPINC1, and A2M) were…
Show Full Abstract
Autism spectrum disorder (ASD) is a complex neurological developmental disorder in children, and is associated with social isolation and restricted interests. The etiology of this disorder is still unknown. There is neither any confirmed laboratory test nor any effective therapeutic strategy to diagnose or cure it. We performed data independent acquisition (DIA) and multiple reaction monitoring (MRM) analysis of plasma from children with ASD and controls. The result showed that 45 differentially expressed proteins (DEPs) were identified between autistic subjects and controls. Among these, only one DEP was down-regulated in ASD; other DEPs were up-regulated in ASD children's plasma. These proteins are found associated with complement and coagulation cascades, vitamin digestion and absorption, cholesterol metabolism, platelet degranulation, selenium micronutrient network, extracellular matrix organization and inflammatory pathway, which have been reported to be related to ASD. After MRM verification, five key proteins in complement pathway (PLG, SERPINC1, and A2M) and inflammatory pathway (CD5L, ATRN, SERPINC1, and A2M) were confirmed to be significantly up-regulated in ASD group. Through the screening of machine learning model and MRM verification, we found that two proteins (biotinidase and carbonic anhydrase 1) can be used as early diagnostic markers of ASD (AUC = 0.8, p = 0.0001). SIGNIFICANCE: ASD is the fastest growing neurodevelopmental disorder in the world and has become a major public health problem worldwide. Its prevalence has been steadily increasing, with a global prevalence rate of 1%. Early diagnosis and intervention can achieve better prognosis. In this study, data independent acquisition (DIA) and multiple reaction monitoring (MRM) analysis was applied to analyze the plasma proteome of ASD patients (31 (±5) months old), and 378 proteins were quantified. 45 differentially expressed proteins (DEPs) were identified between the ASD group and the control group. They mainly were associated with platelet degranulation, ECM proteoglycar, complement and coagulation cascades, selenium micronutrient network, regulation of insulin-like growth factor (IGF) transport and uptake by insulin-like growth factor binding proteins (IGFBPs), cholesterol metabolism, vitamin metabolism, and inflammatory pathway. Through the integrated machine learning methods and the MRM verification of independent samples, it is considered that biotinidase and carbon anhydrase 1 have the potential to become biomarkers for the early diagnosis of ASD. These results complement proteomics database of the ASD patients, broaden our understanding of ASD, and provide a panel of biomarkers for the early diagnosis of ASD.
Also flagged:Bcg l16 Smitochondrial ribosomalmtDNAnDNAnuclear rDNA
Journal Article2023-03-08No SnippetsChambers EA, Tarvin RD, Santos JC, Ron SR, Betancourth-Cundar M, Hillis DM, Matz MV, Cannatella DC.
Show Full Abstract
Restriction-site-associated DNA sequencing (RADseq) has become an accessible way to obtain genome-wide data in the form of single-nucleotide polymorphisms (SNPs) for phylogenetic inference. Nonetheless, how differences in RADseq methods influence phylogenetic estimation is poorly understood because most comparisons have largely relied on conceptual predictions rather than empirical tests. We examine how differences in ddRAD and 2bRAD data influence phylogenetic estimation in two non-model frog groups. We compare the impact of method choice on phylogenetic information, missing data, and allelic dropout, considering different sequencing depths. Given that researchers must balance input (funding, time) with output (amount and quality of data), we also provide comparisons of laboratory effort, computational time, monetary costs, and the repeatability of library preparation and sequencing. Both 2bRAD and ddRAD methods estimated well-supported trees, even at low sequencing depths, and had comparable amounts of missing data, patterns of allelic dropout, and phylogenetic signal. Compared to ddRAD, 2bRAD produced more repeatable datasets, had simpler laboratory protocols, and had an overall faster bioinformatics assembly. However, many fewer parsimony-informative sites per SNP were obtained from 2bRAD data when using native pipelines, highlighting a need for further investigation into the effects of each pipeline on resulting datasets. Our study underscores the importance of comparing RADseq methods, such as expected results and theoretical performance using empirical datasets, before undertaking costly experiments.
Also flagged:urticariaautoimmune hepatitisprimary biliary cholangitischronic liver diseasesystemic lupus erythematosusoverlap syndrome
Journal Article2023-03-08✓ 1 SnippetToujani S, El Ouni A, Mestiri S, Toujani E, Belhassen A, Meddeb Z, Bouslama K.
In-Text Gene Mentions
Discussion)
…cirrhosis due tohemochromatosis.…
Show Full Abstract
Yellow urticaria is a variant of urticaria that is rarely reported in the literature. It usually occurs in the setting of a chronic liver disease and reflects the accumulation of bilirubin in the skin tissues. We report a case of yellow urticaria that occurred in a 33-year-old female patient suffering from systemic lupus erythematosus and overlap syndrome of autoimmune hepatitis and primary biliary cholangitis revealed by a migratory pruritic yellowish urticarial eruption on the trunk and limbs. Yellow urticaria may be an important clue to previously unknown liver or biliary disease as it generally occurs in the setting of hyperbilirubinemia.
Also flagged:AMHAnti-Müllerian hormonefertilizationinfertilityfollicle-stimulating hormoneovarian hyperstimulation
Journal Article2023-03-08✓ 1 SnippetWang K, Guan Y, Zhang Y, Jia R, Wu S, Yao Z, Zhang M, Li Z.
In-Text Gene Mentions
Discussion)
…PRDX2, PRDX4, andPRDX6) in young patients…
Show Full Abstract
<h4>Objective</h4>To explore the cumulative outcomes and influencing factors of patients with discrepancies between age and Anti-Müllerian hormone (AMH) levels in the early follicular phase prolonged protocol.<h4>Methods</h4>A total of 1282 cycles of in-vitro fertilization (IVF)/intracytoplasmic sperm injection (ICSI) assisted pregnancy with the early follicular phase prolonged protocol in the Reproductive Medicine Center of the Third Affiliated Hospital of Zhengzhou University from September 2015 to December 2020 were retrospectively analyzed. They were divided into the young low-AMH group (n=1076) and the older high-AMH group (n=206). The primary outcomes included cumulative clinical pregnancy rate (CCPR) and cumulative live birth rate (CLBR). Secondary outcomes included the number of oocytes retrieved, number of available embryos, clinical pregnancy rate (CPR), live birth rate (LBR), miscarriage rate (MR), pregnancy complications, and neonatal outcomes.<h4>Results</h4>The CPR (68.7% vs. 59.4%) and the LBR (60.7% vs. 43.1%) in the young low-AMH group were higher than those in the older high-AMH group. In contrast, the number of oocytes retrieved (11 vs. 17), number of available embryos (5 vs. 8), and MR (10.6% vs. 18.3%) in the young low-AMH group were lower. There was no significant difference between the two groups in the CCPR, CLBR, pregnancy complications, and neonatal outcomes. Logistic regression analysis showed that infertility duration, basal follicle-stimulating hormone (FSH), and antral follicle count (AFC) correlated with CCPR, while maternal age, type of infertility, basal FSH, AFC, and infertility duration correlated with CLBR. The area under the receiver operating characteristic curves (ROC) curve for the combined model of infertility duration, AFC, and basal FSH to predict cumulative pregnancy was 0.629 (95%CI:0.592-0.666), while the combined model of maternal age, AFC, basal FSH, infertility duration, and type of infertility to predict cumulative live birth was 0.649 (95%CI:0.615-0.682).<h4>Conclusion</h4>Although AMH levels are low by contrast, young patients have a favorable outcome after IVF/ICSI. In patients with discrepancies between age and AMH levels in the early follicular phase prolonged protocol, maternal age correlates better with cumulative live birth. The model that combines maternal age and other factors can help predict cumulative live birth, but its value is limited.
Also flagged:ferroptosisdeathironlipidpre-eclampsiagestational diabetes mellitus
Journal Article2023-03-08No SnippetsXu J, Zhou F, Wang X, Mo C.
Show Full Abstract
Ferroptosis is a form of regulated cell death characterized by iron overload, overwhelming lipid peroxidation, and disruption of antioxidant systems. Emerging evidence suggests that ferroptosis is associated with pregnancy related diseases, such as spontaneous abortion, pre-eclampsia, gestational diabetes mellitus, intrahepatic cholestasis of pregnancy, and spontaneous preterm birth. According to these findings, inhibiting ferroptosis might be a potential option to treat pregnancy related diseases. This review summarizes the mechanisms and advances of ferroptosis, the pathogenic role of ferroptosis in pregnancy related diseases and the potential medicines for its treatment.
Also flagged:focal adhesiongastric cancerGene Expressionextracellular matrix (ECM) receptorCD44HLA-DOA
Journal Article2023-03-08✓ 1 SnippetZhao G, Luo T, Liu Z, Li J.
In-Text Gene Mentions
Results)
…TNFRSF4, TNFRSF8, TNFSF18,TNFSF4, and VTCN1 in…
Show Full Abstract
<b>Background:</b> This study aims to build a focal adhesion-related genes-based prognostic signature (FAS) to accurately predict gastric cancer (GC) prognosis and identify key prognostic genes related to gastric cancer. <b>Results:</b> Gene expression and clinical data of gastric cancer patients were sourced from Gene Expression Omnibus and The Cancer Genome Atlas. Subsequently, the GEO dataset was randomly distributed into training and test cohorts. The TCGA dataset was used to validate the external cohort. Lasso Cox regression was used to detect OS-related genes in the GEO cohort. A risk score model was established according to the screened genes. A nomogram, based on the clinical characteristics and risk score, was generated to predict the prognosis of gastric cancer patients. Using time-dependent receiver operating characteristic (ROC) and calibration performances, we evaluated the models' validity. The patients were grouped into a high- or low-risk group depending on the risk score. Low-risk patients exhibited higher OS than high-risk patients (entire cohort: <i>p</i> < 0.001; training cohort: <i>p</i> < 0.001, test cohort: <i>p</i> < 0.001). Furthermore, we found a correlation between high-risk gastric cancer and extracellular matrix (ECM) receptor interaction, high infiltration of macrophages, CD44, and HLA-DOA. <b>Conclusion:</b> The generated model based on the genetic characteristics of the focal adhesion prognostic gene can aid in the prognosis of gastric cancer patients in the future.
Also flagged:HAR1waterNeurogenesisbrain developmentsynapseslong-term synaptic potentiation
Journal Article2023-03-08No SnippetsZhang L, Lin S, Huang K, Chen A, Li N, Shen S, Zheng Z, Shi X, Sun J, Kong J, Chen M.
Show Full Abstract
<b>Background:</b> <i>HAR1</i> is a 118-bp segment that lies in a pair of novel non-coding RNA genes. It shows a dramatic accelerated change with an estimated 18 substitutions in the human lineage since the human-chimpanzee ancestor, compared with the expected 0.27 substitutions based on the slow rate of change in this region in other amniotes. Mutations of <i>HAR1</i> lead to a different HAR1 secondary structure in humans compared to that in chimpanzees. <b>Methods:</b> We cloned <i>HAR1</i> into the EF-1α promoter vector to generate transgenic mice. Morris water maze tests and step-down passive avoidance tests were conducted to observe the changes in memory and cognitive abilities of mice. RNA-seq analysis was performed to identify differentially expressed genes (DEGs) between the experimental and control groups. Systematic bioinformatics analysis was used to confirm the pathways and functions that the DEGs were involved in. <b>Results:</b> Memory and cognitive abilities of the transgenic mice were significantly improved. The results of Gene Ontology (GO) analysis showed that Neuron differentiation, Dentate gyrus development, Nervous system development, Cerebral cortex neuron differentiation, Cerebral cortex development, Cerebral cortex development and Neurogenesis are all significant GO terms related to brain development. The DEGs enriched in these terms included <i>Lhx2</i>, <i>Emx2</i>, <i>Foxg1</i>, <i>Nr2e1</i> and <i>Emx1</i>. All these genes play an important role in regulating the functioning of Cajal-Retzius cells (CRs). The DEGs were also enriched in glutamatergic synapses, synapses, memory, and the positive regulation of long-term synaptic potentiation. In addition, "cellular response to calcium ions" exhibited the second highest rich factor in the GO analysis. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of the DEGs showed that the neuroactive ligand-receptor interaction pathway was the most significantly enriched pathway, and DEGs also notably enriched in neuroactive ligand-receptor interaction, axon guidance, and cholinergic synapses. <b>Conclusion:</b> <i>HAR1</i> overexpression led to improvements in memory and cognitive abilities of the transgenic mice. The possible mechanism for this was that the long non-coding RNA (lncRNA) <i>HAR1A</i> affected brain development by regulating the function of CRs. Moreover, <i>HAR1A</i> may be involved in ligand-receptor interaction, axon guidance, and synapse formation, all of which are important in brain development and evolution. Furthermore, cellular response to calcium may play an important role in those processes.
Also flagged:Leiomyosarcomasoft tissue sarcomasanthracyclinegemcitabineleiomyosarcoma tumormetabolism
Journal Article2023-03-08✓ 1 SnippetLacuna K, Bose S, Ingham M, Schwartz G.
In-Text Gene Mentions
S I O 000419)
…A Phase 1b Dose Escalation and Dose Expansion Study of a CSF1R Inhibitor (DCC-3014) Administered Concurrently With an Anti-PD-L1 Antibody (Avelumab) in Patients With Advanced High-grade Sarcoma…
Show Full Abstract
Leiomyosarcoma is an aggressive mesenchymal malignancy and represents one of the most common subtypes of soft tissue sarcomas. It is characterized by significant disease heterogeneity with variable sites of origin and diverse genomic profiles. As a result, the treatment of advanced leiomyosarcoma is challenging. First-line therapy for metastatic and/or unresectable leiomyosarcoma includes anthracycline or gemcitabine based regimens, which provide a median progression-free survival time of about 5 months and overall survival time between 14-16 months. Effective later-line therapies are limited. Molecular profiling has enhanced our knowledge of the pathophysiology driving leiomyosarcoma, providing potential targets for treatment. In this review, we explore recent advances in our understanding of leiomyosarcoma tumor biology and implications for novel therapeutics. We describe the development of clinical trials based on such findings and discuss available published results. To date, the most promising approaches for advanced leiomyosarcoma include targeting DNA damage repair pathways and aberrant metabolism associated with oncogenesis, as well as novel chemotherapy combinations. This review highlights the recent progress made in the treatment of advanced leiomyosarcoma. Ongoing progress is contingent upon further development of clinical trials based on molecular findings, with careful consideration for clinical trial design, strong academic collaborations, and prospective correlative analyses.
Journal Article2023-03-08✓ 5 SnippetsAbdalla IM, Hui J, Nazar M, Arbab AAI, Xu T, Abdu SMN, Mao Y, Yang Z, Lu X.
In-Text Gene Mentions
Abstract)
…, AIP ,DCC, SQOR ,…
Results)
…kb) to theDCC netrin 1 receptornetrin 1 receptor…
Results)
…receptor gene (DCC), and the…
Discussion)
…close to theDCCgene.…
Discussion)
…variations identified theDCCgene to be…
Show Full Abstract
Body size is one of the most economically important traits of dairy cattle, as it is significantly associated with cow longevity, production, health, fertility, and environmental adaptation. The identification and application of genetic variants using a novel genetic approach, such as genome-wide association studies (GWASs), may give more insights into the genetic architecture of complex traits. The identification of genes, single nucleotide polymorphisms (SNPs), and pathways associated with the body size traits may offer a contribution to genomic selection and long-term planning for selection in dairy cows. In this study, we performed GWAS analysis to identify the genetic markers and genes associated with four body size traits (body height, body depth, chest width, and angularity) in 1000 Chinese Holstein cows. We performed SNPs genotyping in 1000 individuals, based on the GeneSeek Genomic Profiler Bovine 100 K. In total, we identified 11 significant SNPs in association with body size traits at the threshold of Bonferroni correction (5.90 × 10<sup>-7</sup>) using the fixed and random model circulating probability unification (FarmCPU) model. Several genes within 200 kb distances (upstream or downstream) of the significant SNPs were identified as candidate genes, including <i>MYH15</i>, <i>KHDRBS3</i>, <i>AIP</i>, <i>DCC</i>, <i>SQOR</i>, and <i>UBAP1L</i>. Moreover, genes within 200 kb of the identified SNPs were significantly enriched (<i>p</i> ≤ 0.05) in 25 Gene Ontology terms and five Kyoto Encyclopedia of Genes and Genomes pathways. We anticipate that these results provide a foundation for understanding the genetic architecture of body size traits. They will also contribute to breeding programs and genomic selection work on Chinese Holstein cattle.
Also flagged:chromosomeacute myeloid leukemiaAMLacute lymphoblastic leukemiaALLleukemia
Journal Article2023-03-08No SnippetsGórecki M, Kozioł I, Kopystecka A, Budzyńska J, Zawitkowska J, Lejman M.
Show Full Abstract
The <i>KMT2A</i> (formerly <i>MLL</i>) encodes the histone lysine-specific N-methyltransferase 2A and is mapped on chromosome 11q23. <i>KMT2A</i> is a frequent target for recurrent translocations in acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), or mixed lineage (biphenotypic) leukemia (MLL). Over 90 <i>KMT2A</i> fusion partners have been identified until now, including the most recurring ones-<i>AFF1</i>, <i>MLLT1</i>, and <i>MLLT3</i>-which encode proteins regulating epigenetic mechanisms. The presence of distinct <i>KMT2A</i> rearrangements is an independent dismal prognostic factor, while very few <i>KMT2A</i> rearrangements display either a good or intermediate outcome. <i>KMT2A-</i>rearranged (<i>KMT2A</i>-r) ALL affects more than 70% of new ALL diagnoses in infants (<1 year of age), 5-6% of pediatric cases, and 15% of adult cases. <i>KMT2A</i>-rearranged (<i>KMT2A</i>-r) ALL is characterized by hyperleukocytosis, a relatively high incidence of central nervous system (CNS) involvement, an aggressive course with early relapse, and early relapses resulting in poor prognosis. The exact pathways of fusions and the effects on the final phenotypic activity of the disease are still subjects of much research. Future trials could consider the inclusion of targeted immunotherapeutic agents and prioritize the identification of prognostic factors, allowing for the less intensive treatment of some infants with <i>KMT2A</i> ALL. The aim of this review is to summarize our knowledge and present current insight into the mechanisms of <i>KMT2A</i>-r ALL, portray their characteristics, discuss the clinical outcome along with risk stratification, and present novel therapeutic strategies.
Also flagged:AMLAcute promyelocytic leukemiapathogenesisacute myeloid leukemiaRARAPML
Journal Article2023-03-08✓ 1 SnippetBorkovskaia A, Bogacheva S, Konyukhova T, Dadakhanova E, Gaskova M, Soldatkina O, Dubrovina M, Popov A, Mikhailova E, Inushkina E, Kazanov M, Matveev E, Novichkova G, Maschan M, Maschan A, Olshanskaya Y, Zerkalenkova E.
In-Text Gene Mentions
Results)
…, AFDN ,MLLT10, MLLT6 and…
Show Full Abstract
Acute promyelocytic leukemia (APL) pathogenesis is based on <i>RARA</i> gene translocations, which are of high importance in the diagnosis of and proper therapy selection for APL. However, in some cases acute myeloid leukemia (AML) demonstrates APL-like morphological features such as atypical promyelocytes accumulation. This type of AML is characterized by the involvement of other <i>RAR</i> family members or completely different genes. In the present study, we used conventional karyotyping, FISH and high-throughput sequencing in a group of 271 de novo AML with atypical promyelocytes accumulation. Of those, 255 cases were shown to carry a typical chromosomal translocation t(15;17)(q24;q21) with <i>PML::RARA</i> chimeric gene formation (94.1%). Other <i>RARA</i>-positive cases exhibited cryptic <i>PML::RARA</i> fusion without t(15;17)(q24;q21) (1.8%, <i>n</i> = 5) and variant t(5;17)(q35;q21) translocation with <i>NPM1::RARA</i> chimeric gene formation (1.5%, <i>n</i> = 4). However, 7 <i>RARA</i>-negative AMLs with atypical promyelocytes accumulation were also discovered. These cases exhibited <i>TBL1XR1::RARB</i> and <i>KMT2A::SEPT6</i> fusions as well as mutations, e.g., <i>NPM1</i> insertion and non-recurrent chromosomal aberrations. Our findings demonstrate the genetic diversity of AML with APL-like morphological features, which is of high importance for successful therapy implementation.
Journal Article2023-03-08✓ 2 SnippetsBigorra Mir M, Charlebois E, Tsyplenkova S, Fillebeen C, Pantopoulos K.
In-Text Gene Mentions
Abstract)
…a model ofhemochromatosisdue to suppression…
Discussion)
…a model ofhemochromatosischaracterized by iron…
Show Full Abstract
Hepcidin is a liver-derived hormone that controls systemic iron traffic. It is also expressed in the heart, where it acts locally. We utilized cell and mouse models to study the regulation, expression, and function of cardiac hepcidin. Hepcidin-encoding <i>Hamp</i> mRNA was induced upon differentiation of C2C12 cells to a cardiomyocyte-like phenotype and was not further stimulated by BMP6, BMP2, or IL-6, the major inducers of hepatic hepcidin. The mRNAs encoding hepcidin and its upstream regulator hemojuvelin (Hjv) are primarily expressed in the atria of the heart, with ~20-fold higher <i>Hamp</i> mRNA levels in the right vs. left atrium and negligible expression in the ventricles and apex. Hjv<sup>-/-</sup> mice, a model of hemochromatosis due to suppression of liver hepcidin, exhibit only modest cardiac <i>Hamp</i> deficiency and minor cardiac dysfunction. Dietary iron manipulations did not significantly affect cardiac <i>Hamp</i> mRNA in the atria of wild-type or Hjv<sup>-/-</sup> mice. Two weeks following myocardial infarction, <i>Hamp</i> was robustly induced in the liver and heart apex but not atria, possibly in response to inflammation. We conclude that cardiac <i>Hamp</i> is predominantly expressed in the right atrium and is partially regulated by Hjv; however, it does not respond to iron and other inducers of hepatic hepcidin.
Journal Article2023-03-08No SnippetsBalmorez T, Sakazaki A, Murakami S.
Show Full Abstract
Human genomic analysis and genome-wide association studies (GWAS) have identified genes that are risk factors for early and late-onset Alzheimer's disease (AD genes). Although the genetics of aging and longevity have been extensively studied, previous studies have focused on a specific set of genes that have been shown to contribute to or are a risk factor for AD. Thus, the connections among the genes involved in AD, aging, and longevity are not well understood. Here, we identified the genetic interaction networks (referred to as pathways) of aging and longevity within the context of AD by using a gene set enrichment analysis by Reactome that cross-references more than 100 bioinformatic databases to allow interpretation of the biological functions of gene sets through a wide variety of gene networks. We validated the pathways with a threshold of <i>p</i>-value < 1.00 × 10<sup>-5</sup> using the databases to extract lists of 356 AD genes, 307 aging-related (AR) genes, and 357 longevity genes. There was a broad range of biological pathways involved in AR and longevity genes shared with AD genes. AR genes identified 261 pathways within the threshold of <i>p</i> < 1.00 × 10<sup>-5</sup>, of which 26 pathways (10% of AR gene pathways) were further identified by overlapping genes among AD and AR genes. The overlapped pathways included gene expression (<i>p</i> = 4.05 × 10<sup>-11</sup>) including ApoE, SOD2, TP53, and TGFB1 (<i>p</i> = 2.84 × 10<sup>-10</sup>); protein metabolism and SUMOylation, including E3 ligases and target proteins (<i>p</i> = 1.08 × 10<sup>-7</sup>); ERBB4 signal transduction (<i>p</i> = 2.69 × 10<sup>-6</sup>); the immune system, including IL-3 and IL-13 (<i>p</i> = 3.83 × 10<sup>-6</sup>); programmed cell death (<i>p</i> = 4.36 × 10<sup>-6</sup>); and platelet degranulation (<i>p</i> = 8.16 × 10<sup>-6</sup>), among others. Longevity genes identified 49 pathways within the threshold, of which 12 pathways (24% of longevity gene pathways) were further identified by overlapping genes among AD and longevity genes. They include the immune system, including IL-3 and IL-13 (<i>p</i> = 7.64 × 10<sup>-8</sup>), plasma lipoprotein assembly, remodeling and clearance (<i>p</i> < 4.02 × 10<sup>-6</sup>), and the metabolism of fat-soluble vitamins (<i>p</i> = 1.96 × 10<sup>-5</sup>). Thus, this study provides shared genetic hallmarks of aging, longevity, and AD backed up by statistical significance. We discuss the significant genes involved in these pathways, including TP53, FOXO, SUMOylation, IL4, IL6, APOE, and CEPT, and suggest that mapping the gene network pathways provide a useful basis for further medical research on AD and healthy aging.
Also flagged:SynthesisTriazoleLigninPyrone-4,6-dicarboxylic acidPDCazide
Journal Article2023-03-08No SnippetsJin Y, Joshi M, Araki T, Kamimura N, Masai E, Nakamura M, Michinobu T.
Show Full Abstract
2-Pyrone-4,6-dicarboxylic acid (PDC) is a chemically stable metabolic intermediate of lignin that can be produced on a large scale by transforming bacteria. Novel biomass-based polymers based on PDC were synthesized by Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) and fully characterized by nuclear magnetic resonance, infrared spectroscopies, thermal analysis, and tensile lap shear strength measurements. The onset decomposition temperatures of these PDC-based polymers were all above 200 °C. In addition, the PDC-based polymers exhibited strong adhesive properties to various metal plates, with the highest adhesion to a copper plate of 5.73 MPa. Interestingly, this result was in contrast to our previous findings that PDC-based polymers weakly adhere to copper. Furthermore, when bifunctional alkyne and azide monomers were polymerized in situ under hot-press conditions for 1 h, the resulting PDC-based polymer displayed a similar adhesion to a copper plate of 4.18 MPa. The high affinity of the triazole ring to copper ions improved the adhesive ability and selectivity of the PDC-based polymers to copper while still maintaining the strong adhesive ability to other metals, which is conducive to enhancing the versatility of PDC-based polymers as adhesives.
Also flagged:TumorINPP4BretinoblastomaRBocular childhood diseaseinositol polyphosphate 4-phosphatase type II
Journal Article2023-03-08✓ 5 SnippetsMiroschnikov N, Dräger O, Van Meenen D, Metz K, Budeus B, Dünker N, Busch MA.
In-Text Gene Mentions
Discussion)
…Higher levels of TNFSF4 were likewise detected in breast and bladder carcinoma as well as in serum and tumor tissues of lung adenocarcinoma patients, and it has been shown that stress-induced induction of TNFSF4 in cancer-associated fibroblasts alleviates the resistance of lung adenocarcinomas against chemotherapeutics by inhibiting tumor cell apoptosis [65–67].…
Discussion)
…Additionally, we identified an upregulation of the tumor necrosis factor superfamily member 4 (TNFSF4) after INPP4B overexpression in etoposide-resistant RB355 cells.…
Discussion)
…superfamily member 4 (TNFSF4) after INPP4B overexpression…
The chemotherapy of retinoblastoma (RB), a malignant ocular childhood disease, is often limited by the development of resistance against commonly used drugs. We identified inositol polyphosphate 4-phosphatase type II (INPP4B) as a differentially regulated gene in etoposide-resistant RB cell lines, potentially involved in the development of RB resistances. INPP4B is controversially discussed as a tumor suppressor and an oncogenic driver in various cancers, but its role in retinoblastoma in general and chemoresistant RB in particular is yet unknown. In the study presented, we investigated the expression of INPP4B in RB cell lines and patients and analyzed the effect of INPP4B overexpression on etoposide resistant RB cell growth <i>in vitro</i> and <i>in vivo</i>. INPP4B mRNA levels were significantly downregulated in RB cells lines compared to the healthy human retina, with even lower expression levels in etoposide-resistant compared to the sensitive cell lines. Besides, a significant increase in INPP4B expression was observed in chemotherapy-treated RB tumor patient samples compared to untreated tumors. INPP4B overexpression in etoposide-resistant RB cells resulted in a significant reduction in cell viability with reduced growth, proliferation, anchorage-independent growth, and <i>in ovo</i> tumor formation. Caspase-3/7-mediated apoptosis was concomitantly increased, suggesting a tumor suppressive role of INPP4B in chemoresistant RB cells. No changes in AKT signaling were discernible, but p-SGK3 levels increased following INPP4B overexpression, indicating a potential regulation of SGK3 signaling in etoposide-resistant RB cells. RNAseq analysis of INPP4B overexpressing, etoposide-resistant RB cell lines revealed differentially regulated genes involved in cancer progression, mirroring observed <i>in vitro</i> and <i>in vivo</i> effects of INPP4B overexpression and strengthening INPP4B's importance for cell growth control and tumorigenicity.
Research Square2023-03-08Preprint (No Snippets API)Anwar MY, Graff M, Highland HM, Smit R, Wang Z, Buchanan VL, Young KL, Kenny EE, Fernandez-Rhodes L, Liu S, Assimes T, Garcia DO, Daeeun K, Gignoux CR, Justice AE, Haiman CA, Buyske S, Peters U, Loos R, Kooperberg C, North KE.
Show Full Abstract
<title>Abstract</title> <p>Inadequate representation of non-European ancestry populations in genome-wide association studies (GWAS) has limited opportunities to isolate functional variants. Fine-mapping in multi-ancestry populations should improve the efficiency of prioritizing variants for functional interrogation. To evaluate this hypothesis, we leveraged ancestry architecture to perform comparative GWAS and fine-mapping of obesity related phenotypes in European ancestry populations from the UK Biobank (UKBB) and multi-ancestry samples from the Population Architecture for Genetic Epidemiology (PAGE) consortium with comparable sample sizes. In 10 of the investigated regions with genome wide significant associations for obesity related traits, fine-mapping in our ancestrally diverse sample led to 95% and 99% credible sets (CS) with fewer variants than in the European ancestry sample. Lead fine-mapped variants in PAGE regions had higher average coding scores, and higher average posterior probabilities for causality compared to UKBB. Importantly, 99% CS in PAGE loci contained strong expression quantitative trait loci (eQTLs) in adipose tissues or harbored more variants in tighter linkage disequilibrium (LD) with eQTLs. Results also suggested three novel candidates for functional effect on waist-to-hip ratio adjusted for BMI (WHRBMI-adj) (rs5781117 near gene <italic>RP11-392O17.1</italic>, rs10187501 in gene <italic>COBLL1</italic>, and rs1964599 near gene <italic>CCDC92</italic>), all within the 99% CS. Leveraging ancestrally diverse populations with heterogeneous ancestry architectures, coupled with functional annotation, increased fine mapping efficiency and performance, and reduced the set of candidate variants for consideration for future functional studies. Significant overlap in genetic causal variants across populations suggest generalizability of genetic mechanisms underpinning obesity related traits across populations.</p>
…LBSL is a rare GLE caused by autosomal recessive mutations in the mitochondrial DARS2 gene [88].…
Introduction)
…synthetase 2 (DARS2) mutations.…
Introduction)
…in the mitochondrialDARS2gene [ 88…
Introduction)
…2 of theDARS2gene.…
Show Full Abstract
Genetic leukoencephalopathies (GLEs) are a group of white matter abnormalities with heterogeneous radiological and phenotypic features. Although these conditions have mostly been described in children, adult-onset cases are increasingly recognized owing to the widespread use of neuroimaging and advances in molecular genetic testing. The disease course is often progressive with a varied spectrum of presentations, trapping neurologists in the dilemma of differential diagnosis. Movement disorders are among the most common symptoms, and their diversity makes diagnosis challenging. In this review, we focus on adult-onset GLEs with movement disorders and offer a step-by-step diagnostic approach by clarifying the phenomenology of movement, advising investigations for acquired causes, describing the clinical and radiological clues to each disease, emphasizing the limitations of advanced molecular testing, and discussing the future application of artificial intelligence. We provide a list summarizing the leukoencephalopathies associated with different categories of movement disorders. In addition to guiding clinicians on how to narrow the list of differential diagnoses with the tools currently available, another aim of this review is to emphasize the inevitable trend toward applying advanced technology in diagnosing these difficult diseases.
Also flagged:vasoconstrictionnitric oxideadrenergic receptorsendothelial receptorscell adhesion moleculespeptidases
Journal Article2023-03-07No SnippetsMarzoog BA.
Show Full Abstract
Undeniably, endothelial cells (EC) contribute to the maintenance of the homeostasis of the organism through modulating cellular physiology, including signaling pathways, through the release of highly active molecules as well as the response to a myriad of extrinsic and intrinsic signaling factors. Review the data from the current literature on the EC role in norm and disease. Endothelium maintains a precise balance between the released molecules, where EC dysfunction arises when the endothelium actions shift toward vasoconstriction, the proinflammatory, prothrombic properties after the alteration of nitric oxide (NO) production and oxidative stress. The functions of the EC are regulated by the negative/positive feedback from the organism, through EC surface receptors, and the crosstalk between NO, adrenergic receptors, and oxidative stress. More than a hundred substances can interact with EC. The EC dysfunction is a hallmark in the emergence and progression of vascular-related pathologies. The paper concisely reviews recent advances in EC (patho) physiology. Grasping EC physiology is crucial to gauge their potential clinical utility and optimize the current therapies as well as to establish novel nanotherapeutic molecular targets include; endothelial receptors, cell adhesion molecules, integrins, signaling pathways, enzymes; peptidases.
Also flagged:cancertumorimmune responsedisseminated cancerslocalized cancerstumors
Journal Article2023-03-07✓ 1 SnippetJavid H, Sharbaf Mashhad A, Yazdani S, Akbari Oryani M, Akbari S, Rezagholinejad N, Tajaldini M, Karimi-Shahri M.
In-Text Gene Mentions
S I O 000419)
…Tumor‐selective; Expressing human OX40 ligand (OX40L, CD252, TNFSF4); Interactions in OX40 and OX40L; T‐cell activation…
Show Full Abstract
Despite great medical advances, oncological research is still looking for novel therapeutic approaches due to the limitation of conventional therapeutic agents. Virotherapy is one of these new emerging therapeutic approaches that attract attention with their widespread applications. Virotherapy use lives oncolytic viruses or genetically engineered viruses that selectively infect the tumor cells, replicate, and disrupt the cancerous cells that also induce their anticancer activity by stimulating the host antitumor immune response. Moreover, viruses are widely used as target delivery vectors for specifically delivering different genes, therapeutic agents, and immune-stimulating agents. In addition to having antitumor activity by themselves in combination with conventional therapeutic agents like immune therapy and chemotherapy, Virotherapy agents also elicit promising outcomes. Therefore, in addition to their promising result in monotherapy use, virotherapy agents can also be used in combination with conventional cancer therapy, epigenetic modulators, and even microRNAs without any cross-resistance, which allows the patient not to be deprived of her routine medicine. Still, this combination therapy reduces the adverse effect of the conventional therapies. All together suggest that virotherapy agents as novel potential agents in the field of cancer therapy.
Also flagged:Microcystinscyclic heptapeptideALTASTALPSOD
Journal Article2023-03-07No SnippetsWang Y, Guo Y, Liu H, Du X, Shi L, Wang W, Zhang S.
Show Full Abstract
Microcystins (MCs) is a class of cyclic heptapeptide compounds with biological activity. There is no effective treatment for liver injury caused by MCs. Hawthorn is a medicinal and edible plant traditional Chinese medicine with hypolipidemic, reducing inflammation and oxidative stress in the liver. This study discussed the protective effect of hawthorn fruit extract (HFE) on liver damage caused by MC-LR and the underlying molecular mechanism. After MC-LR exposure, pathological changes were observed and hepatic activity of ALT, AST and ALP were increased obviously, but they were remarkably restored with HFE administration. In addition, MC-LR could significantly reduce SOD activity and increase MDA content. Importantly, MC-LR treatment resulted in mitochondrial membrane potential decreased, and Cytochrome C release, eventually leading to cell apoptosis rate increase. HFE pretreatment could significantly alleviate the above abnormal phenomena. To examine the mechanism of protection, the expression of critical molecules in the mitochondrial apoptosis pathway was examined. The levels of Bcl-2 was inhibited, and the levels of Bax, Caspase-9, Cleaved Caspase-9, and Cleaved caspase-3 were upregulated after MC-LR treatment. HFE reduced MC-LR-induced apoptosis via reversing the expression of key proteins and genes in the mitochondrial apoptotic pathway. Hence, HFE could alleviate MC-LR induced hepatotoxicity by reducing oxidative stress and apoptosis.
Also flagged:inflammatory responsessucroseobesityatherosclerosisinflammatory bowel diseasecarbohydrate
Journal Article2023-03-07✓ 2 SnippetsWang YC, Cao Y, Pan C, Zhou Z, Yang L, Lusis AJ.
In-Text Gene Mentions
Results)
…, Axin2 ,Olfm4, Gkn3 ,…
Results)
…, Dmbt1 ,Olfm4, and Dmbt1…
Show Full Abstract
The small intestine plays a key role in immunity and mediates inflammatory responses to high fat diets. We have used single-cell RNA-sequencing (scRNA-seq) and statistical modeling to examine gaps in our understanding of the dynamic properties of intestinal cells and underlying cellular mechanisms. Our scRNA-seq and flow cytometry studies of different layers of intestinal cells revealed new cell subsets and modeled developmental trajectories of intestinal intraepithelial lymphocytes, lamina propria lymphocytes, conventional dendritic cells, and enterocytes. As compared to chow-fed mice, a high-fat high-sucrose (HFHS) "Western" diet resulted in the accumulation of specific immune cell populations and marked changes to enterocytes nutrient absorption function. Utilizing ligand-receptor analysis, we profiled high-resolution intestine interaction networks across all immune cell and epithelial structural cell types in mice fed chow or HFHS diets. These results revealed novel interactions and communication hubs among intestinal cells, and their potential roles in local as well as systemic inflammation.
Also flagged:VEGF-AVascular endothelial growth factor-AangiogenesisphosphorylationVEGF-A-165phosphopeptides
Journal Article2023-03-07✓ 1 SnippetAbhinand CS, Galipon J, Mori M, Ramesh P, Prasad TSK, Raju R, Sudhakaran PR, Tomita M.
In-Text Gene Mentions
Text
…ARFGEF2…
Show Full Abstract
Vascular endothelial growth factor-A (VEGF-A) is one of the primary factors promoting angiogenesis in endothelial cells. Although defects in VEGF-A signaling are linked to diverse pathophysiological conditions, the early phosphorylation-dependent signaling events pertinent to VEGF-A signaling remain poorly defined. Hence, a temporal quantitative phosphoproteomic analysis was performed in human umbilical vein endothelial cells (HUVECs) treated with VEGF-A-165 for 1, 5 and 10 min. This led to the identification and quantification of 1971 unique phosphopeptides corresponding to 961 phosphoproteins and 2771 phosphorylation sites in total. Specifically, 69, 153, and 133 phosphopeptides corresponding to 62, 125, and 110 phosphoproteins respectively, were temporally phosphorylated at 1, 5, and 10 min upon addition of VEGF-A. These phosphopeptides included 14 kinases, among others. This study also captured the phosphosignaling events directed through RAC, FAK, PI3K-AKT-MTOR, ERK, and P38 MAPK modules with reference to our previously assembled VEGF-A/VEGFR2 signaling pathway map in HUVECs. Apart from a significant enrichment of biological processes such as cytoskeleton organization and actin filament binding, our results also suggest a role of AAK1-AP2M1 in the regulation of VEGFR endocytosis. Taken together, the temporal quantitative phosphoproteomics analysis of VEGF signaling in HUVECs revealed early signaling events and we believe that this analysis will serve as a starting point for the analysis of differential signaling across VEGF members toward the full elucidation of their role in the angiogenesis processes. Workflow for the identification of early phosphorylation events induced by VEGF-A-165 in HUVEC cells.
Also flagged:antisynthetase syndromeASSmyopathiesmyositismyopathologyinclusion body myositis
Journal Article2023-03-07No SnippetsTanboon J, Inoue M, Hirakawa S, Tachimori H, Hayashi S, Noguchi S, Okiyama N, Fujimoto M, Suzuki S, Nishino I.
Show Full Abstract
Identification of antisynthetase syndrome (ASS) could be challenging due to inaccessibility and technical difficulty of the serology test for the less common non-Jo-1 antibodies. This study aimed to describe ASS antibody-specific myopathology and evaluate the diagnostic utility of myofiber HLA-DR expression. We reviewed 212 ASS muscle biopsies and compared myopathologic features among subtypes. Additionally, we compared their HLA-DR staining pattern with 602 non-ASS myositis and 140 genetically confirmed myopathies known to have an inflammatory component. We used t-test and Fisher's exact for comparisons and used sensitivity, specificity, positive and negative predictive values to assess the utility of HLA-DR expression for ASS diagnosis. RNAseq performed from a subset of myositis cases and histologically normal muscle biopsies was used to evaluate interferon (IFN)-signaling pathway-related genes. Anti-OJ ASS showed prominent myopathology with higher scores in muscle fiber (4.6 ± 2.0 vs. 2.8 ± 1.8, p = 0.001) and inflammatory domains (6.8 ± 3.2 vs. 4.5 ± 2.9, p = 0.006) than non-OJ ASS. HLA-DR expression and IFN-γ-related genes upregulation were prominent in ASS and inclusion body myositis (IBM). When dermatomyositis and IBM were excluded, HLA-DR expression was 95.4% specific and 61.2% sensitive for ASS with a positive predictive value of 85.9% and a negative predictive value of 84.2%; perifascicular HLA-DR pattern is common in anti-Jo-1 ASS than non-Jo-1 ASS (63.1% vs. 5.1%, p < 0.0001). In the appropriate clinicopathological context, myofiber HLA-DR expression help support ASS diagnosis. The presence of HLA-DR expression suggests involvement of IFN-γ in the pathogenesis of ASS, though the detailed mechanisms have yet to be elucidated.
Also flagged:hepatocellular carcinomaliver cancerorganizationVitronectinthrombinfibrinolysis
Journal Article2023-03-07✓ 1 SnippetHosseiniyan Khatibi SM, Najjarian F, Homaei Rad H, Ardalan M, Teshnehlab M, Zununi Vahed S, Pirmoradi S.
In-Text Gene Mentions
Introduction)
…, 5 ,hemochromatosis6 , and…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the most frequent type of primary liver cancer. Early-stage detection plays an essential role in making treatment decisions and identifying dominant molecular mechanisms. We utilized machine learning algorithms to find significant mRNAs and microRNAs (miRNAs) at the early and late stages of HCC. First, pre-processing approaches, including organization, nested cross-validation, cleaning, and normalization were applied. Next, the t-test/ANOVA methods and binary particle swarm optimization were used as a filter and wrapper method in the feature selection step, respectively. Then, classifiers, based on machine learning and deep learning algorithms were utilized to evaluate the discrimination power of selected features (mRNAs and miRNAs) in the classification step. Finally, the association rule mining algorithm was applied to selected features for identifying key mRNAs and miRNAs that can help decode dominant molecular mechanisms in HCC stages. The applied methods could identify key genes associated with the early (e.g., Vitronectin, thrombin-activatable fibrinolysis inhibitor, lactate dehydrogenase D (LDHD), miR-590) and late-stage (e.g., SPRY domain containing 4, regucalcin, miR-3199-1, miR-194-2, miR-4999) of HCC. This research could establish a clear picture of putative candidate genes, which could be the main actors at the early and late stages of HCC.
Also flagged:PIWIreproductioncancerscancermethylationmethyladenosine
Journal Article2023-03-07No SnippetsZhang Q, Zhu Y, Cao X, Tan W, Yu J, Lu Y, Kang R, Wang X, Li E.
Show Full Abstract
PIWI proteins have a strong correlation with PIWI-interacting RNAs (piRNAs), which are significant in development and reproduction of organisms. Recently, emerging evidences have indicated that apart from the reproductive function, PIWI/piRNAs with abnormal expression, also involve greatly in varieties of human cancers. Moreover, human PIWI proteins are usually expressed only in germ cells and hardly in somatic cells, so the abnormal expression of PIWI proteins in different types of cancer offer a promising opportunity for precision medicine. In this review, we discussed current researches about the biogenesis of piRNA, its epigenetic regulatory mechanisms in human cancers, such as N6-methyladenosine (m<sup>6</sup>A) methylation, histone modifications, DNA methylation and RNA interference, providing novel insights into the markers for clinical diagnosis, treatment and prognosis in human cancers.
Also flagged:cysteinemitochondrialintermembrane spaceperoxideoxygenhydrogen
Journal Article2023-03-07✓ 1 SnippetKisty EA, Falco JA, Weerapana E.
In-Text Gene Mentions
Text
…PRDX6…
Show Full Abstract
Reactive oxygen species (ROS) can modulate protein function through cysteine oxidation. Identifying protein targets of ROS can provide insight into uncharacterized ROS-regulated pathways. Several redox-proteomic workflows, such as oxidative isotope-coded affinity tags (OxICAT), exist to identify sites of cysteine oxidation. However, determining ROS targets localized within subcellular compartments and ROS hotspots remains challenging with existing workflows. Here, we present a chemoproteomic platform, PL-OxICAT, which combines proximity labeling (PL) with OxICAT to monitor localized cysteine oxidation events. We show that TurboID-based PL-OxICAT can monitor cysteine oxidation events within subcellular compartments such as the mitochondrial matrix and intermembrane space. Furthermore, we use ascorbate peroxidase (APEX)-based PL-OxICAT to monitor oxidation events within ROS hotspots by using endogenous ROS as the source of peroxide for APEX activation. Together, these platforms further hone our ability to monitor cysteine oxidation events within specific subcellular locations and ROS hotspots and provide a deeper understanding of the protein targets of endogenous and exogenous ROS.
Also flagged:Doxorubicinmatrix metalloproteinase-2polyethylene glycolcancercolorectal cancerMMP-2
Journal Article2023-03-07No SnippetsAskarizadeh A, Mashreghi M, Mirhadi E, Mirzavi F, Shargh VH, Badiee A, Alavizadeh SH, Arabi L, Jaafari MR.
Show Full Abstract
<h4>Background</h4>Colorectal cancer is one of the prominent leading causes of fatality worldwide. Despite recent advancements within the field of cancer therapy, the cure rates and long-term survivals of patients suffering from colorectal cancer have changed little. The application of conventional chemotherapeutic agents like doxorubicin is limited by some drawbacks such as cardiotoxicity and hematotoxicity. Therefore, nanotechnology has been exploited as a promising solution to address these problems. In this study, we synthesized and compared the anticancer efficacy of doxorubicin-loaded liposomes that were surface engineered with the 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-matrix metalloproteinase-2 (MMP-2) cleavable peptide-polyethylene glycol (PEG) conjugate. The peptide linker was used to cleave in response to the upregulated MMP-2 in the tumor microenvironment, thus exposing a positive charge via PEG-deshielding and enhancing liposomal uptake by tumor cells/vasculature. Liposomal formulations were characterized in terms of size, surface charge and morphology, drug loading, release properties, cell binding and uptake, and cytotoxicity.<h4>Results</h4>The formulations had particle sizes of ~ 100-170 nm, narrow distribution (PDI ˂ 0.2), and various surface charges (- 10.2 mV to + 17.6 mV). MMP-2 overexpression was shown in several cancer cell lines (C26, 4T1, and B16F10) as compared to the normal NIH-3T3 fibroblast cells by gelatin zymography and qRT-PCR. In vitro results demonstrated enhanced antitumor efficacy of the PEG-cleavable cationic liposomes (CLs) as compared to the commercial Caelyx<sup>®</sup> (up to fivefold) and the chick chorioallantoic membrane assay showed their great antiangiogenesis potential to target and suppress tumor neovascularization. The pharmacokinetics and efficacy studies also indicated higher tumor accumulation and extended survival rates in C26 tumor-bearing mice treated with the MMP-2 cleavable CLs as compared to the non-cleavable CLs with no remarkable sign of toxicity in healthy tissues.<h4>Conclusion</h4>Altogether, the MMP-2-cleavable CLs have great potency to improve tumor-targeted drug delivery and cellular/tumor-vasculature uptake which merits further investigation.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1186/s12645-023-00169-8.
Also flagged:COVID-19viral infectionsinfectionsdeath-19viral infection
Journal Article2023-03-07✓ 2 SnippetsPhiri A, Anyikwa I, Moyo C.
In-Text Gene Mentions
Methods)
…DCC-GARCH model…
Results)
…DCC-GARCH result…
Show Full Abstract
In our study, we employ DCC-GARCH and Wavelet coherence analysis to examine the co-movement between global covid-19 indicators (cases, recoveries and deaths) and stock returns of main equity markets in G20 countries using daily data spanning between February 2, 2020 and August 28, 2021. Our empirical results show that the co-movement between COVID-19 and G20 stock returns has been switching between negative and positive correlations across the entire time window. The wavelet coherence analysis further reveal that negative (positive) co-movements predominantly exist as lower (higher frequencies) for cases and deaths and are more mixed for recoveries. The findings also show that the short-frequency components correspond to periods around the initial announcement of the initial pandemic and also around the announced of subsequent variants of the COVID-19 virus. Policy and market implications from our study are also discussed.
Also flagged:pathogenesisneurodevelopmental disordersAutismAutism Spectrum Disorderintellectual disabilityPSMC3
Journal Article2023-03-07No SnippetsAkter H, Rahman MM, Sarker S, Basiruzzaman M, Islam MM, Rahaman MA, Rahaman MA, Eshaque TB, Dity NJ, Sarker S, Amin MR, Hossain MM, Lopa M, Jahan N, Hossain S, Islam A, Mondol A, Faruk MO, Saha N, Kundu GK, Kanta SI, Kazal RK, Fatema K, Rahman MA, Hasan M, Hossain Mollah MA, Hosen MI, Karuvantevida N, Begum G, Zehra B, Nassir N, Nabi AHMN, Uddin KMF, Uddin M.
Show Full Abstract
<b>Introduction:</b> Copy number variations (CNVs) play a critical role in the pathogenesis of neurodevelopmental disorders (NDD) among children. In this study, we aim to identify clinically relevant CNVs, genes and their phenotypic characteristics in an ethnically underrepresented homogenous population of Bangladesh. <b>Methods:</b> We have conducted chromosomal microarray analysis (CMA) for 212 NDD patients with male to female ratio of 2.2:1.0 to identify rare CNVs. To identify candidate genes within the rare CNVs, gene constraint metrics [i.e., "Critical-Exon Genes (CEGs)"] were applied to the population data. Autism Diagnostic Observation Schedule-Second Edition (ADOS-2) was followed in a subset of 95 NDD patients to assess the severity of autism and all statistical tests were performed using the R package. <b>Results:</b> Of all the samples assayed, 12.26% (26/212) and 57.08% (121/212) patients carried pathogenic and variant of uncertain significance (VOUS) CNVs, respectively. While 2.83% (6/212) patients' pathogenic CNVs were found to be located in the subtelomeric regions. Further burden test identified females are significant carriers of pathogenic CNVs compared to males (OR = 4.2; <i>p</i> = 0.0007). We have observed an increased number of Loss of heterozygosity (LOH) within cases with 23.85% (26/109) consanguineous parents. Our analyses on imprinting genes show, 36 LOH variants disrupting 69 unique imprinted genes and classified these variants as VOUS. ADOS-2 subset shows severe social communication deficit (<i>p</i> = 0.014) and overall ASD symptoms severity (<i>p</i> = 0.026) among the patients carrying duplication CNV compared to the CNV negative group. Candidate gene analysis identified 153 unique CEGs in pathogenic CNVs and 31 in VOUS. Of the unique genes, 18 genes were found to be in smaller (<1 MB) focal CNVs in our NDD cohort and we identified <i>PSMC3</i> gene as a strong candidate gene for Autism Spectrum Disorder (ASD). Moreover, we hypothesized that <i>KMT2B</i> gene duplication might be associated with intellectual disability. <b>Conclusion:</b> Our results show the utility of CMA for precise genetic diagnosis and its integration into the diagnosis, therapy and management of NDD patients.
Also flagged:psychiatric disordersbehaviouralmajor depression disordermajor depressionattention deficit hyperactivity disorderADHD
Journal Article2023-03-07✓ 1 SnippetKootbodien T, London L, Martin LJ, Defo J, Ramesar R.
In-Text Gene Mentions
Results)
…(rs11665242 on theDCCgene and rs589914…
Show Full Abstract
<b>Background:</b> Suicidal behaviour (SB) refers to behaviours, ranging from non-fatal suicidal behaviour, such as suicidal ideation and attempt, to completed suicide. Despite recent advancements in genomic technology and statistical methods, it is unclear to what extent the spectrum of suicidal behaviour is explained by shared genetic aetiology. <b>Methods:</b> We identified nine genome-wide association statistics of suicidal behaviour (sample sizes, <i>n</i>, ranging from 62,648 to 125,844), ten psychiatric traits [<i>n</i> up to 386,533] and collectively, nine summary datasets of anthropometric, behavioural and socioeconomic-related traits [<i>n</i> ranging from 58,610 to 941,280]. We calculated the genetic correlation among these traits and modelled this using genomic structural equation modelling, identified shared biological processes and pathways between suicidal behaviour and psychiatric disorders and evaluated potential causal associations using Mendelian randomisation. <b>Results:</b> Among populations of European ancestry, we observed strong positive genetic correlations between suicide ideation, attempt and self-harm (rg range, 0.71-1.09) and moderate to strong genetic correlations between suicidal behaviour traits and a range of psychiatric disorders, most notably, major depression disorder (rg = 0.86, <i>p</i> = 1.62 × 10<sup>-36</sup>). Multivariate analysis revealed a common factor structure for suicidal behaviour traits, major depression, attention deficit hyperactivity disorder (ADHD) and alcohol use disorder. The derived common factor explained 38.7% of the shared variance across the traits. We identified 2,951 genes and 98 sub-network hub genes associated with the common factor, including pathways associated with developmental biology, signal transduction and RNA degradation. We found suggestive evidence for the protective effects of higher household income level on suicide attempt [OR = 0.55 (0.44-0.70), <i>p</i> = 1.29 × 10<sup>-5</sup>] and while further investigation is needed, a nominal significant effect of smoking on suicide attempt [OR = 1.24 (1.04-1.44), <i>p</i> = 0.026]. <b>Conclusion:</b> Our findings provide evidence of shared aetiology between suicidal behaviour and psychiatric disorders and indicate potential common molecular mechanisms contributing to the overlapping pathophysiology. These findings provide a better understanding of the complex genetic architecture of suicidal behaviour and have implications for the prevention and treatment of suicidal behaviour.
Also flagged:tumorhepatocellular carcinomac-kitlinCD127CCL5
Journal Article2023-03-07✓ 1 SnippetSong P, Cao K, Mao Y, Ai S, Sun F, Hu Q, Liu S, Wang M, Lu X, Guan W, Shen X.
In-Text Gene Mentions
Results)
…high expression ofTNFSF4(encoding OX40 ligand)…
Show Full Abstract
<h4>Introduction</h4>Innate lymphoid cells (ILCs) are key components of the immune system, yet the similarity and distinction of the properties across tissues under homeostasis, inflammation and tumor process remain elusive.<h4>Methods</h4>Here we performed integrative inference of ILCs to reveal their transcriptional profiles and heterogeneity from single-cell genomics. We collected a large number of ILCs from human six different tissues which can represent unique immune niches (circulation, lymphoid tissue, normal and inflamed mucosa, tumor microenvironment), to systematically address the transcriptional imprinting.<h4>Results</h4>ILCs are profoundly imprinted by their organ of residence, and tissue-specific distinctions are apparent under pathological conditions. In the hepatocellular carcinoma microenvironment, we identified intermediate c-kit<sup>+</sup> ILC2 population, and lin<sup>-</sup>CD127<sup>-</sup> NK-like cells that expressed markers of cytotoxicity including <i>CCL5</i> and <i>IFNG</i>. Additionally, CD127<sup>+</sup>CD94<sup>+</sup> ILC1s were preferentially enriched in inflamed ileum from patients with Crohn's disease.<h4>Discussion</h4>These analyses depicted a comprehensive characterization of ILC anatomical distribution and subset heterogeneity, and provided a base line for future temporal or spatial studies focused on tissue-specific ILC-mediated immunity.
Also flagged:Amino AcidsPeptidesPeptideheterocyclesconjugationinfectious diseases
Journal Article2023-03-07No SnippetsGattu R, Ramesh SS, Nadigar S, D CG, Ramesh S.
Show Full Abstract
Peptide-based drugs are gaining significant momentum in the modern drug discovery, which is witnessed by the approval of new drugs by the FDA in recent years. On the other hand, small molecules-based drugs are an integral part of drug development since the past several decades. Peptide-containing drugs are placed between small molecules and the biologics. Both the peptides as well as the small molecules (mainly heterocycles) pose several drawbacks as therapeutics despite their success in curing many diseases. This gap may be bridged by utilising the so called 'conjugation chemistry', in which both the partners are linked to one another through a stable chemical bond, and the resulting conjugates are found to possess attracting benefits, thus eliminating the stigma associated with the individual partners. Over the past decades, the field of molecular hybridisation has emerged to afford us new and efficient molecular architectures that have shown high promise in medicinal chemistry. Taking advantage of this and also considering our experience in this field, we present herein a review concerning the molecules obtained by the conjugation of peptides (amino acids) to small molecules (heterocycles as well as bioactive compounds). More than 125 examples of the conjugates citing nearly 100 references published during the period 2000 to 2022 having therapeutic applications in curing infectious diseases have been covered.
Myopia is a globally emerging concern accompanied by multiple medical and socio-economic burdens with no well-established causal treatment to control thus far. The study of the genomics and transcriptomics of myopia treatment is crucial to delineate disease pathways and provide valuable insights for the design of precise and effective therapeutics. A strong understanding of altered biochemical pathways and underlying pathogenesis leading to myopia may facilitate early diagnosis and treatment of myopia, ultimately leading to the development of more effective preventive and therapeutic measures. In this review, we summarize current data about the genomics and transcriptomics of myopia in human and animal models. We also discuss the potential applicability of these findings to precision medicine for myopia treatment.
…Interestingly, huntingtin (HTT), the polyglutamine-expanded protein in HD, also binds to PQBP1 in its expanded polyglutamine form [125], so the same mechanism of impaired transcription might occur in HD, although no evidence for that impairment has been reported so far.…
Show Full Abstract
Unstable DNA repeat expansions and insertions have been found to cause more than 50 neurodevelopmental, neurodegenerative, and neuromuscular disorders. One of the main hallmarks of repeat expansion diseases is the formation of abnormal RNA or protein aggregates in the neuronal cells of affected individuals. Recent evidence indicates that alterations of the dynamic or material properties of biomolecular condensates assembled by liquid/liquid phase separation are critical for the formation of these aggregates. This is a thermodynamically-driven and reversible local phenomenon that condenses macromolecules into liquid-like compartments responsible for compartmentalizing molecules required for vital cellular processes. Disease-associated repeat expansions modulate the phase separation properties of RNAs and proteins, interfering with the composition and/or the material properties of biomolecular condensates and resulting in the formation of abnormal aggregates. Since several repeat expansions have arisen in genes encoding crucial players in transcription, this raises the hypothesis that wide gene expression dysregulation is common to multiple repeat expansion diseases. This review will cover the impact of these mutations in the formation of aberrant aggregates and how they modify gene transcription.
Also flagged:Systemic Lupus ErythematosusPulmonary HypertensionPHSLEcardiorespiratory disordersthromboembolic diseases
Journal Article2023-03-07No SnippetsParperis K, Velidakis N, Khattab E, Gkougkoudi E, Kadoglou NPE.
Show Full Abstract
Pulmonary Hypertension (PH) is a common manifestation in patients with Systemic Lupus Erythematosus (SLE) and varies from asymptomatic to life-threatening disease. PH can result not only from immune system dysregulation, but also from various conditions, including cardiorespiratory disorders and thromboembolic diseases. Most commonly, SLE-related PH presents with non-specific symptoms, such as progressive dyspnea on exertion, generalized fatigue and weakness and eventually dyspnea at rest. Prompt diagnosis of SLE-related PH and early identification of the underlying pathogenetic mechanisms is demanded in order to introduce targeted therapy to prevent irreversible pulmonary vascular damage. In most cases the management of PH in SLE patients is similar to idiopathic pulmonary arterial hypertension (PAH). Furthermore, specific diagnostic tools like biomarkers or screening protocols, to establish early diagnosis seem to be not available yet. Although, the survival rates for patients with SLE-related PH vary between studies, it is evident that PH presence negatively affects the survival of SLE patients.
Also flagged:Secretinpancreatic cancerMYCSTAT1CDH10cancer
Journal Article2023-03-07✓ 2 SnippetsLevink IJM, Srebniak MI, De Valk WG, van Veghel-Plandsoen MM, Wagner A, Cahen DL, Fuhler GM, Bruno MJ.
In-Text Gene Mentions
Results)
…A third gene of interest in this region is DCC, a gene that codes for the netrin-1 receptor, which has been elaboratively investigated as a tumor suppressor gene for colorectal cancer and has been associated with tumor stage in PC [38].…
Results)
…this region isDCC, a gene…
Show Full Abstract
Secretin-stimulated pancreatic juice (PJ), collected from the duodenum, presents a valuable biomarker source for the (earlier) detection of pancreatic cancer (PC). Here, we evaluate the feasibility and performance of shallow sequencing to detect copy number variations (CNVs) in cell-free DNA (cfDNA) from PJ for PC detection. First, we confirmed the feasibility of shallow sequencing in PJ (n = 4), matched plasma (n = 3) and tissue samples (n = 4, microarray). Subsequently, shallow sequencing was performed on cfDNA from PJ of 26 cases (25 sporadic PC, 1 high-grade dysplasia) and 19 controls with a hereditary or familial increased risk of PC. 40 of the 45 PJ samples met the quality criteria for cfDNA analysis. Nine individuals had an 8q24 gain (oncogene MYC; 23%; eight cases (33%) and one control (6%), <i>p</i> = 0.04); six had both a 2q gain (STAT1) and 5p loss (CDH10; 15%; four cases (7%) and two controls (13%), <i>p</i> = 0.72). The presence of an 8q24 gain differentiated the cases and controls, with a sensitivity of 33% (95% CI 16-55%) and specificity of 94% (95% CI 70-100%). The presence of either an 8q24 or 2q gain with a 5p loss was related to a sensitivity of 50% (95% CI 29-71%) and specificity of 81% (95% CI 54-96%). Shallow sequencing of PJ is feasible. The presence of an 8q24 gain in PJ shows promise as a biomarker for the detection of PC. Further research is required with a larger sample size and consecutively collected samples in high-risk individuals prior to implementation in a surveillance cohort.
Also flagged:Extracellular Vesiclesfailureinfectionnon-communicable diseasesorgan failureimmune response
Journal Article2023-03-07No SnippetsRomero-García N, Huete-Acevedo J, Mas-Bargues C, Sanz-Ros J, Dromant M, Badenes R, Borrás C.
Show Full Abstract
Solid organ transplantation (SOT) is a life-saving treatment for end-stage organ failure, but it comes with several challenges, the most important of which is the existing gap between the need for transplants and organ availability. One of the main concerns in this regard is the lack of accurate non-invasive biomarkers to monitor the status of a transplanted organ. Extracellular vesicles (EVs) have recently emerged as a promising source of biomarkers for various diseases. In the context of SOT, EVs have been shown to be involved in the communication between donor and recipient cells and may carry valuable information about the function of an allograft. This has led to an increasing interest in exploring the use of EVs for the preoperative assessment of organs, early postoperative monitoring of graft function, or the diagnosis of rejection, infection, ischemia-reperfusion injury, or drug toxicity. In this review, we summarize recent evidence on the use of EVs as biomarkers for these conditions and discuss their applicability in the clinical setting.
Also flagged:FolateGold NanoparticlesLocalizationfolic acidgoldfolate receptor
Journal Article2023-03-07No SnippetsDaniele R, Brazzale C, Arpac B, Tognetti F, Pesce C, Malfanti A, Sayers E, Mastrotto F, Jones AT, Salmaso S, Caliceti P.
Show Full Abstract
The cell interaction, mechanism of cell entry and intracellular fate of surface decorated nanoparticles are known to be affected by the surface density of targeting agents. However, the correlation between nanoparticles multivalency and kinetics of the cell uptake process and disposition of intracellular compartments is complicated and dependent on a number of physicochemical and biological parameters, including the ligand, nanoparticle composition and colloidal properties, features of targeted cells, etc. Here, we have carried out an in-depth investigation on the impact of increasing folic acid density on the kinetic uptake process and endocytic route of folate (FA)-targeted fluorescently labelled gold nanoparticles (AuNPs). A set of AuNPs (15 nm mean size) produced by the Turkevich method was decorated with 0-100 FA-PEG<sub>3.5kDa</sub>-SH molecules/particle, and the surface was saturated with about 500 rhodamine-PEG<sub>2kDa</sub>-SH fluorescent probes. In vitro studies carried out using folate receptor overexpressing KB cells (KB<sup>FR-high</sup>) showed that the cell internalization progressively increased with the ligand surface density, reaching a plateau at 50:1 FA-PEG<sub>3.5kDa</sub>-SH/particle ratio. Pulse-chase experiments showed that higher FA density (50 FA-PEG<sub>3.5kDa</sub>-SH molecules/particle) induces more efficient particle internalization and trafficking to lysosomes, reaching the maximum concentration in lysosomes at 2 h, than the lower FA density of 10 FA-PEG<sub>3.5kDa</sub>-SH molecules/particle. Pharmacological inhibition of endocytic pathways and TEM analysis showed that particles with high folate density are internalized predominantly by a clathrin-independent process.
Also flagged:chronic diseasescancertumorchemokinescancersinfectious diseases
Journal Article2023-03-07✓ 4 SnippetsLundstrom K.
In-Text Gene Mentions
S I O 001029)
…Administration of AAV5-miHTT suppressed mutant HTT mRNA, resulting in almost complete prevention of mutant HTT aggregate formation and suppression of DARPP-32-associated neuronal dysfunction in a rat model for Huntington’s disease [226].…
S I O 001029)
…Huntington’s disease, caused by a mutation in the huntingtin (HTT) gene, has been explored for AAV-based gene silencing with miRNAs targeting HTT [226].…
S I O 000419)
…Reduced mutant HTT mRNA and protein in transgenic HD minipig brain [227]…
S I O 001029)
…Moreover, AAV5-miHTT significantly decreased mutant HTT mRNA and protein levels in the brain of transgenic HD minipigs [227].…
Show Full Abstract
Viral vectors have been used for a broad spectrum of gene therapy for both acute and chronic diseases. In the context of cancer gene therapy, viral vectors expressing anti-tumor, toxic, suicide and immunostimulatory genes, such as cytokines and chemokines, have been applied. Oncolytic viruses, which specifically replicate in and kill tumor cells, have provided tumor eradication, and even cure of cancers in animal models. In a broader meaning, vaccine development against infectious diseases and various cancers has been considered as a type of gene therapy. Especially in the case of COVID-19 vaccines, adenovirus-based vaccines such as ChAdOx1 nCoV-19 and Ad26.COV2.S have demonstrated excellent safety and vaccine efficacy in clinical trials, leading to Emergency Use Authorization in many countries. Viral vectors have shown great promise in the treatment of chronic diseases such as severe combined immunodeficiency (SCID), muscular dystrophy, hemophilia, β-thalassemia, and sickle cell disease (SCD). Proof-of-concept has been established in preclinical studies in various animal models. Clinical gene therapy trials have confirmed good safety, tolerability, and therapeutic efficacy. Viral-based drugs have been approved for cancer, hematological, metabolic, neurological, and ophthalmological diseases as well as for vaccines. For example, the adenovirus-based drug Gendicine<sup>®</sup> for non-small-cell lung cancer, the reovirus-based drug Reolysin<sup>®</sup> for ovarian cancer, the oncolytic HSV T-VEC for melanoma, lentivirus-based treatment of ADA-SCID disease, and the rhabdovirus-based vaccine Ervebo against Ebola virus disease have been approved for human use.
Also flagged:Protein homeostasisprotein synthesisdegradationAgingproteostasisneurodegenerative diseases
Journal Article2023-03-07No SnippetsMainali N, Ayyadevara S, Ganne A, Shmookler Reis RJ, Mehta JL.
Show Full Abstract
Protein homeostasis, the balance between protein synthesis and degradation, requires the clearance of misfolded and aggregated proteins and is therefore considered to be an essential aspect of establishing a physiologically effective proteome. Aging alters this balance, termed "proteostasis", resulting in the progressive accumulation of misfolded and aggregated proteins. Defective proteostasis leads to the functional deterioration of diverse regulatory processes during aging and is implicated in the etiology of multiple pathological conditions underlying a variety of neurodegenerative diseases and in age-dependent cardiovascular disease. Detergent-insoluble protein aggregates have been reported by us in both aged and hypertensive hearts. The protein constituents were found to overlap with protein aggregates seen in neurodegenerative diseases such as Alzheimer's disease. Therefore, targeting these protein components of aggregates may be a promising therapeutic strategy for cardiovascular pathologies associated with aging, ischemia, and/or hypertension.
…hypertension caused byhemochromatosissecondary to osteopetrosis.…
Title)
…caused by secondaryhemochromatosis…
Discussion)
…mainly caused byhemochromatosissecondary to osteopetrosis…
Discussion)
…overload caused secondaryhemochromatosis.…
Discussion)
…caused by secondaryhemochromatosisand had been…
Show Full Abstract
We report a patient with refractory ascites because of portal hypertension caused by hemochromatosis secondary to osteopetrosis. To our knowledge, this is the first well-documented case of this association. A 46-year-old male patient who was repeatedly infused with red blood cells for anemia secondary to osteopetrosis suffered from refractory ascites. The serum-ascites albumin gradient was 29.9 g/L. Abdominal computed tomography (CT) showed a large amount of ascites, hepatomegaly, and splenomegaly. Bone marrow biopsy showed a small bone marrow cavity with no hematopoietic tissue. A peripheral blood smear showed tear drop red blood cells and metarubricytes. Serum ferritin was 8,855.0 ng/mL. Therefore, we considered that the ascites resulted from portal hypertension caused by hemochromatosis secondary to osteopetrosis. We simultaneously performed the transjungular intrahepatic portal-systemic shunt (TIPS) and obtained a transjungular liver biopsy. The portal pressure gradient before TIPS was 28 mmHg, and iron staining was strongly positive on liver biopsy, which confirmed our diagnosis. After TIPS, both abdominal distention and ascites gradually resolved, and no recurrence as observed after the 12-month postoperative follow-up was observed. This case indicated that regular monitoring of iron load is important for patients with osteopetrosis. TIPS is safe and effective for portal hypertension complications due to osteopetrosis.
Also flagged:Gastric cancerpathogenesisAutophagybiomacromoleculesorganellesmicroautophagy
Journal Article2023-03-07No SnippetsYu QY, Han Y, Lu JH, Sun YJ, Liao XH.
Show Full Abstract
Gastric cancer possesses high lethality rate, and its complex molecular mechanisms of pathogenesis lead to irrational treatment outcomes. Autophagy plays a dual role in cancer by both promoting and suppressing the cancer. However, the role of autophagy in gastric cancer is still vague. Therefore, in this study, we first obtained autophagy-related genes from the Human Autophagy Database, and then applied consensus clustering analysis to analyse the molecular subtypes of gastric cancer samples in the TCGA database. The genes obtained after subtyping were then applied to construct risk prognostic model. Following this, PCA and tSNE assessed risk scores with good discriminatory ability for gastric cancer samples. The results of Cox regression analysis and time-dependent ROC curve analysis indicated that the model had good risk prediction ability. Finally, NRP1 was selected as the final study subject in the context of expression pairwise analysis, Kaplan-Meier curves and external validation of the GEO dataset. <i>In vitro</i> experiments showed that NRP1 has the ability to regulate the proliferation and autophagy of gastric cancer cells by affecting the Wnt/β-catenin signalling pathway. Similarly, <i>in vivo</i> experiments have shown that NRP1 can affect tumour growth <i>in vivo</i>. We therefore propose that NRP1 can be used as both a prognostic factor and a therapeutic target through the regulation of autophagy in gastric cancer.
Research Square2023-03-07Preprint (No Snippets API)Zhang X, Chen Z, Che J, Zhang Y, Liu Y, Tan W.
Show Full Abstract
<h4>Background: </h4> HCC (hepatocellular carcinoma) is the most common type of hepatic cancers with an overall poor prognosis and an alarming rising incidence. There is an urgent need to explore novel therapeutic targets for HCC treatment. <h4>Methods: </h4>: QRT-PCR (quantitative real-time PCR) was applied to analyze the expression level of circSLC1A4 in HCC cell lines. Database analysis, ChIP (chromatin immunoprecipitation), DNA pulldown, RIP (RNA-binding protein immunoprecipitation) and RNA pulldown assays were implemented to investigate the molecular mechanism of circSLC1A4 in HCC. Co-IP (Co-immunoprecipitation) and GST (glutathione S-transferase) pulldown assays were performed to detect the protein-protein interactions. <h4>Results: </h4>: B4GALT5 (beta-1,4-galactosyltransferase 5) promotes cell migration, invasion and EMT (epithelial-mesenchymal transition) in HCC. In addition, the characteristics of circSLC1A4 in HCC were explored. Functionally, circSLC1A4 acts as a tumor-propeller in HCC via regulating B4GALT5. Specifically, circSLC1A4 recruits FOXH1 (forkhead box H1) to stimulate the transcription of B4GALT5 and recruits DDX3X (DEAD-box helicase 3 X-linked) to stabilize B4GALT5 mRNA (messenger RNA). Besides, circSLC1A4 mediates B4GALT5-induced N -glycosylation of MUC13 (mucin 13) and activates Wnt/β-catenin signaling via MUC13. <h4>Conclusion: </h4> Our study manifested that circSLC1A4 mediates N -glycosylation of MUC13 to promote HCC cell migration, invasion and EMT via up-regulating B4GALT5, offering insight into HCC treatment.
Research Square2023-03-07Preprint (No Snippets API)Koseki S, Hong L, Yudistyra V, Stan T, Tysinger E, Silverstein R, Kramme C, Amrani N, Savic N, Pacesa M, Rodriguez T, Ponnapati M, Jacobson J, Church G, Truant R, Jinek M, Kleinstiver B, Sontheimer E, Chatterjee P.
Show Full Abstract
<title>Abstract</title> <p>CRISPR enzymes require a defined protospacer adjacent motif (PAM) flanking a guide RNA-programmed target site, limiting their sequence accessibility for robust genome editing applications. In this study, we recombine the PAM-interacting domain of SpRY, a broad-targeting Cas9 possessing an NRN > NYN PAM preference, with the N-terminus of Sc++, a Cas9 with simultaneously broad, efficient, and accurate NNG editing capabilities, to generate a chimeric enzyme with highly flexible PAM preference: SpRYc. We demonstrate that SpRYc leverages properties of both enzymes to specifically edit diverse NNN PAMs and disease-related loci for potential therapeutic applications. In total, the unique approaches to generate SpRYc, coupled with its robust flexibility, highlight the power of integrative protein design for Cas9 engineering and motivate downstream editing applications that require precise genomic positioning.</p>
Also flagged:Melatoninendoplasmic reticulumCervical spondylotic myelopathyintervertebral disc degenerationspinal cord injuryprotein kinase R
Journal Article2023-03-06✓ 1 SnippetYao M, Pu PM, Li ZY, Zhu K, Zhou LY, Sun YL, Dai YX, Cui XJ, Wang YJ.
In-Text Gene Mentions
Abstract)
…FAM134B,CCPG1, RTN3, and Sec.…
Show Full Abstract
Cervical spondylotic myelopathy (CSM) refers to a chronic injury of the cervical cord caused by cervical intervertebral disc degeneration. Endoplasmic reticulum (ER) homeostasis is essential to counteract neuronal apoptosis. ER stress, an integral part of ER homeostasis, was observed in a rat model of chronic cervical cord compression in our previous study. However, the correlation between ER homeostasis and CSM remains unknown. The antioxidant melatonin is known to exert therapeutic effects in acute spinal cord injury, but the specific effects and their potential mechanisms in the pathological processes of CSM require further exploration. The present study hypothesized that ER homeostasis is essential for neuronal apoptosis in the CSM and that melatonin maintains this homeostasis. The results showed that ER stress led to neuronal apoptosis in rats with chronic cervical cord compression. Conversely, melatonin attenuates protein kinase R-like ER kinase-eukaryotic initiation factor 2α-C/EBP-homologous protein, inositol-requiring enzyme 1, and transcription factor 6 signaling pathways to release ER stress and prevents Bax translocation to the mitochondrion, thereby promoting motor recovery and protecting neurons in vivo. It also rescued primary rat cortical neurons from ER stress-induced glutamate toxicity in vitro. Moreover, melatonin remodels the ER morphology and restores homeostasis via ER-phagy in injured neurons. FAM134B, CCPG1, RTN3, and Sec. 62 are four known ER-phagy receptors. In this study, Sec. 62 was identified as a key melatonin factor in promoting ER-phagy and restoring ER homeostasis in damaged neurons in vivo and in vitro. In conclusion, melatonin suppresses neuronal apoptosis by reducing ER stress and promoting ER-phagy to restore ER morphology and homeostasis. The current results suggested that melatonin is a promising treatment for CSM owing to its restorative effect on ER homeostasis; however, well-designed randomized controlled trials must be carried out to further investigate its clinical effects.
Also flagged:localizationspindlechromosomesmitosisspindlesmicrotubule
Journal Article2023-03-06✓ 1 SnippetRemsburg CM, Konrad KD, Song JL.
In-Text Gene Mentions
Text
…STAU1…
Show Full Abstract
Mitosis is a fundamental and highly regulated process that acts to faithfully segregate chromosomes into two identical daughter cells. Localization of gene transcripts involved in mitosis to the mitotic spindle might be an evolutionarily conserved mechanism to ensure that mitosis occurs in a timely manner. We identified many RNA transcripts that encode proteins involved in mitosis localized at the mitotic spindles in dividing sea urchin embryos and mammalian cells. Disruption of microtubule polymerization, kinesin-1 or dynein results in lack of spindle localization of these transcripts in the sea urchin embryo. Furthermore, results indicate that the cytoplasmic polyadenylation element (CPE) within the 3'UTR of the Aurora B transcript, a recognition sequence for CPEB, is essential for RNA localization to the mitotic spindle in the sea urchin embryo. Blocking this sequence results in arrested development during early cleavage stages, suggesting that RNA localization to the mitotic spindle might be a regulatory mechanism of cell division that is important for early development.
Also flagged:prostate cancerHK2PCaTrigred motif 36TRIM36TRIM
Journal Article2023-03-06✓ 2 SnippetsZhao X, Zhou T, Wang Y, Bao M, Ni C, Ding L, Sun S, Dong H, Li J, Liang C.
In-Text Gene Mentions
Results)
…(Slc7a11), Peroxiredoxin 6 (Prdx6), and GPx4 protein…
Results)
…while Slc7a11 andPrdx6were not related…
Show Full Abstract
Neuroendocrine prostate cancer (NEPC), the most lethal subtype of castration-resistant prostate cancer (PCa), may evolve from the neuroendocrine differentiation (NED) of PCa cells. However, the molecular mechanism that triggers NED is unknown. Trigred motif 36 (TRIM36), a member of the TRIM protein family, exhibits oncogenic or anti-oncogenic roles in various cancers. We have previously reported that TRIM36 is highly expressed to inhibit the invasion and proliferation of PCa. In the present study, we first found that TRIM36 was lowly expressed in NEPC and its overexpression suppressed the NED of PCa. Next, based on proteomic analysis, we found that TRIM36 inhibited the glycolysis pathway through suppressing hexokinase 2 (HK2), a crucial glycolytic enzyme catalyzing the conversion of glucose to glucose-6-phosphate. TRIM36 specifically bound to HK2 through lysine 48 (lys48)-mediated ubiquitination of HK2. Moreover, TRIM36-mediated ubiquitination degradation of HK2 downregulated the level of glutathione peroxidase 4 (GPx4), a process that contributed to ferroptosis. In conclusion, TRIM36 can inhibit glycolysis via lys48-mediated HK2 ubiquitination to reduce GPX4 expression and activate ferroptosis, thereby inhibiting the NED in PCa. Targeting TRIM36 might be a promising approach to retard NED and treat NEPC.
Also flagged:metastatic cancerscancerextracellularsolid cancerssolid tumorstumor
Journal Article2023-03-06✓ 1 SnippetKryza D, Wischhusen J, Richaud M, Hervieu M, Sidi Boumedine J, Delcros JG, Besse S, Baudier T, Laval PA, Breusa S, Boutault E, Clermidy H, Rama N, Ducarouge B, Devouassoux-Shisheboran M, Chezal JM, Giraudet AL, Walter T, Mehlen P, Sarrut D, Gibert B.
In-Text Gene Mentions
Introduction)
…in colorectal carcinoma (DCC), members of the…
Show Full Abstract
Targeted radionuclide therapy is a revolutionary tool for the treatment of highly spread metastatic cancers. Most current approaches rely on the use of vectors to deliver radionuclides to tumor cells, targeting membrane-bound cancer-specific moieties. Here, we report the embryonic navigation cue netrin-1 as an unanticipated target for vectorized radiotherapy. While netrin-1, known to be re-expressed in tumoral cells to promote cancer progression, is usually characterized as a diffusible ligand, we demonstrate here that netrin-1 is actually poorly diffusible and bound to the extracellular matrix. A therapeutic anti-netrin-1 monoclonal antibody (NP137) has been preclinically developed and was tested in various clinical trials showing an excellent safety profile. In order to provide a companion test detecting netrin-1 in solid tumors and allowing the selection of therapy-eligible patients, we used the clinical-grade NP137 agent and developed an indium-111-NODAGA-NP137 single photon emission computed tomography (SPECT) contrast agent. NP137-<sup>111</sup> In provided specific detection of netrin-1-positive tumors with an excellent signal-to-noise ratio using SPECT/CT imaging in different mouse models. The high specificity and strong affinity of NP137 paved the way for the generation of lutetium-177-DOTA-NP137, a novel vectorized radiotherapy, which specifically accumulated in netrin-1-positive tumors. We demonstrate here, using tumor cell-engrafted mouse models and a genetically engineered mouse model, that a single systemic injection of NP137-<sup>177</sup> Lu provides important antitumor effects and prolonged mouse survival. Together, these data support the view that NP137-<sup>111</sup> In and NP137-<sup>177</sup> Lu may represent original and unexplored imaging and therapeutic tools against advanced solid cancers.
Also flagged:Hematopoiesisligand-receptorcell differentiationlocalizationorganizationCa2+
Journal Article2023-03-06No SnippetsLi H, Bräunig S, Dhapolar P, Karlsson G, Lang S, Scheding S.
Show Full Abstract
Hematopoiesis is regulated by the bone marrow (BM) stroma. However, cellular identities and functions of the different BM stromal elements in humans remain poorly defined. Based on single-cell RNA sequencing (scRNAseq), we systematically characterized the human non-hematopoietic BM stromal compartment and we investigated stromal cell regulation principles based on the RNA velocity analysis using scVelo and studied the interactions between the human BM stromal cells and hematopoietic cells based on ligand-receptor (LR) expression using CellPhoneDB. scRNAseq led to the identification of six transcriptionally and functionally distinct stromal cell populations. Stromal cell differentiation hierarchy was recapitulated based on RNA velocity analysis and in vitro proliferation capacities and differentiation potentials. Potential key factors that might govern the transition from stem and progenitor cells to fate-committed cells were identified. In situ localization analysis demonstrated that different stromal cells were localized in different niches in the bone marrow. In silico cell-cell communication analysis further predicted that different stromal cell types might regulate hematopoiesis through distinct mechanisms. These findings provide the basis for a comprehensive understanding of the cellular complexity of the human BM microenvironment and the intricate stroma-hematopoiesis crosstalk mechanisms, thus refining our current view on human hematopoietic niche organization.
Also flagged:Paclitaxeltaxanemicrotubulestubulinbindingbaccatin III
Journal Article2023-03-06No SnippetsProta AE, Lucena-Agell D, Ma Y, Estevez-Gallego J, Li S, Bargsten K, Josa-Prado F, Altmann KH, Gaillard N, Kamimura S, Mühlethaler T, Gago F, Oliva MA, Steinmetz MO, Fang WS, Díaz JF.
Show Full Abstract
Paclitaxel (Taxol) is a taxane and a chemotherapeutic drug that stabilizes microtubules. While the interaction of paclitaxel with microtubules is well described, the lack of high-resolution structural information on a tubulin-taxane complex precludes a comprehensive description of the binding determinants that affect its mechanism of action. Here, we solved the crystal structure of baccatin III the core moiety of paclitaxel-tubulin complex at 1.9 Å resolution. Based on this information, we engineered taxanes with modified C13 side chains, solved their crystal structures in complex with tubulin, and analyzed their effects on microtubules (X-ray fiber diffraction), along with those of paclitaxel, docetaxel, and baccatin III. Further comparison of high-resolution structures and microtubules' diffractions with the apo forms and molecular dynamics approaches allowed us to understand the consequences of taxane binding to tubulin in solution and under assembled conditions. The results sheds light on three main mechanistic questions: (1) taxanes bind better to microtubules than to tubulin because tubulin assembly is linked to a βM-loopconformational reorganization (otherwise occludes the access to the taxane site) and, bulky C13 side chains preferentially recognize the assembled conformational state; (2) the occupancy of the taxane site has no influence on the straightness of tubulin protofilaments and; (3) longitudinal expansion of the microtubule lattices arises from the accommodation of the taxane core within the site, a process that is no related to the microtubule stabilization (baccatin III is biochemically inactive). In conclusion, our combined experimental and computational approach allowed us to describe the tubulin-taxane interaction in atomic detail and assess the structural determinants for binding.
Also flagged:Infectionrespiratory diseaseEV-D68acute flaccid myelitissialic acidsglycans
Journal Article2023-03-06✓ 1 SnippetPoelaert KCK, van Kleef RGDM, Liu M, van Vliet A, Lyoo H, Gerber LS, Narimatsu Y, Büll C, Clausen H, de Vries E, Westerink RHS, van Kuppeveld FJM.
In-Text Gene Mentions
Methods)
…We employed glycoengineered HEK293 cells that express sialic acids (both α2-3 and α2-6) only on glycolipids (HEK293ΔMGAT1/COSMC), only on N-glycans (HEK293ΔCOSMC/B4GALT5/6), or only on O-glycans (HEK293ΔMGAT1/B4GALT5/6), because the key glycosyltransferase genes required for elongation of these glycosylation pathways were knocked out.…
Show Full Abstract
Enterovirus D68 (EV-D68) is an emerging pathogen associated with mild to severe respiratory disease. Since 2014, EV-D68 is also linked to acute flaccid myelitis (AFM), causing paralysis and muscle weakness in children. However, it remains unclear whether this is due to an increased pathogenicity of contemporary EV-D68 clades or increased awareness and detection of this virus. Here, we describe an infection model of primary rat cortical neurons to study the entry, replication, and functional consequences of different EV-D68 strains, including historical and contemporary strains. We demonstrate that sialic acids are important (co)receptors for infection of both neurons and respiratory epithelial cells. Using a collection of glycoengineered isogenic HEK293 cell lines, we show that sialic acids on either N-glycans or glycosphingolipids can be used for infection. Additionally, we show that both excitatory glutamatergic and inhibitory GABA-ergic neurons are susceptible and permissive to historical and contemporary EV-D68 strains. EV-D68 infection of neurons leads to the reorganization of the Golgi-endomembranes forming replication organelles, first in the soma and later in the processes. Finally, we demonstrate that the spontaneous neuronal activity of EV-D68-infected neuronal network cultured on microelectrode arrays (MEA) is decreased, independent of the virus strain. Collectively, our findings provide novel insights into neurotropism and -pathology of different EV-D68 strains, and argue that it is unlikely that increased neurotropism is a recently acquired phenotype of a specific genetic lineage. <b>IMPORTANCE</b> Acute flaccid myelitis (AFM) is a serious neurological illness characterized by muscle weakness and paralysis in children. Since 2014, outbreaks of AFM have emerged worldwide, and they appear to be caused by nonpolio enteroviruses, particularly enterovirus-D68 (EV-D68), an unusual enterovirus that is known to mainly cause respiratory disease. It is unknown whether these outbreaks reflect a change of EV-D68 pathogenicity or are due to increased detection and awareness of this virus in recent years. To gain more insight herein, it is crucial to define how historical and circulating EV-D68 strains infect and replicate in neurons and how they affect their physiology. This study compares the entry and replication in neurons and the functional consequences on the neural network upon infection with an old "historical" strain and contemporary "circulating" strains of EV-D68.
Also flagged:chromodomain proteinschromatinorganizationchromodomainhistonemethyl
Journal Article2023-03-06✓ 1 SnippetHou X, Xu M, Zhu C, Gao J, Li M, Chen X, Sun C, Nashan B, Zang J, Zhou Y, Guang S, Feng X.
In-Text Gene Mentions
Discussion)
…specific histone variants,linker histoneshistones, and nonhistone…
Show Full Abstract
The chromatin organization modifier domain (chromodomain) is an evolutionally conserved motif across eukaryotic species. The chromodomain mainly functions as a histone methyl-lysine reader to modulate gene expression, chromatin spatial conformation and genome stability. Mutations or aberrant expression of chromodomain proteins can result in cancer and other human diseases. Here, we systematically tag chromodomain proteins with green fluorescent protein (GFP) using CRISPR/Cas9 technology in C. elegans. By combining ChIP-seq analysis and imaging, we delineate a comprehensive expression and functional map of chromodomain proteins. We then conduct a candidate-based RNAi screening and identify factors that regulate the expression and subcellular localization of the chromodomain proteins. Specifically, we reveal an H3K9me1/2 reader, CEC-5, both by in vitro biochemistry and in vivo ChIP assays. MET-2, an H3K9me1/2 writer, is required for CEC-5 association with heterochromatin. Both MET-2 and CEC-5 are required for the normal lifespan of C. elegans. Furthermore, a forward genetic screening identifies a conserved Arginine124 of CEC-5's chromodomain, which is essential for CEC-5's association with chromatin and life span regulation. Thus, our work will serve as a reference to explore chromodomain functions and regulation in C. elegans and allow potential applications in aging-related human diseases.
Also flagged:Calcein AMalbuminBSACalceinSynthesisacrylamide
Journal Article2023-03-06No SnippetsClark IC, Fontanez KM, Meltzer RH, Xue Y, Hayford C, May-Zhang A, D'Amato C, Osman A, Zhang JQ, Hettige P, Ishibashi JSA, Delley CL, Weisgerber DW, Replogle JM, Jost M, Phong KT, Kennedy VE, Peretz CAC, Kim EA, Song S, Karlon W, Weissman JS, Smith CC, Gartner ZJ, Abate AR.
Show Full Abstract
Current single-cell RNA-sequencing approaches have limitations that stem from the microfluidic devices or fluid handling steps required for sample processing. We develop a method that does not require specialized microfluidic devices, expertise or hardware. Our approach is based on particle-templated emulsification, which allows single-cell encapsulation and barcoding of cDNA in uniform droplet emulsions with only a vortexer. Particle-templated instant partition sequencing (PIP-seq) accommodates a wide range of emulsification formats, including microwell plates and large-volume conical tubes, enabling thousands of samples or millions of cells to be processed in minutes. We demonstrate that PIP-seq produces high-purity transcriptomes in mouse-human mixing studies, is compatible with multiomics measurements and can accurately characterize cell types in human breast tissue compared to a commercial microfluidic platform. Single-cell transcriptional profiling of mixed phenotype acute leukemia using PIP-seq reveals the emergence of heterogeneity within chemotherapy-resistant cell subsets that were hidden by standard immunophenotyping. PIP-seq is a simple, flexible and scalable next-generation workflow that extends single-cell sequencing to new applications.
Also flagged:Heparan sulfatesproteoglycanscell surfaceblood coagulationpathogenesisbinding
Journal Article2023-03-06✓ 5 SnippetsFerreira A, Timmerman E, Staes A, Vuylsteke M, De Muynck L, Gevaert K.
In-Text Gene Mentions
Abstract)
…Validating our approach,ATIII, a known 3S-HS…
Introduction)
…Antithrombin III (ATIII) 4 , herpes…
Introduction)
…ATIIIwas identified as…
Methods)
…other one anATIII-like binding site (3S-HS…
Methods)
…profile plot ofATIII(Fig. 4a ),…
Show Full Abstract
Heparan sulfates (HS) proteoglycans are commonly found on the cell surface and mediate many processes. Binding of HS ligands is determined by the sulfation code on the HS chain that can be N-/2-O/6-O- or 3-O-sulfated, generating heterogenous sulfation patterns. 3-O sulfated HS (3S-HS) play a role in several (patho)physiological processes such as blood coagulation, viral pathogenesis and binding and internalization of tau in Alzheimer's disease. However, few 3S-HS-specific interactors are known. Thus, our insight into the role of 3S-HS in health and disease is limited, especially in the central nervous system. Using human CSF, we determined the interactome of synthetic HS with defined sulfation patterns. Our affinity-enrichment mass spectrometry studies expand the repertoire of proteins that may interact with (3S-)HS. Validating our approach, ATIII, a known 3S-HS interactor, was found to require GlcA-GlcNS6S3S for binding, similar to what has been reported. Our dataset holds novel, potential HS and 3S-HS protein ligands, that can be explored in future studies focusing on molecular mechanisms that depend on 3S-HS in (patho)physiological conditions.
Also flagged:amino acidtranscription factorforkhead box P2FOXP2amino acidslong-term
Journal Article2023-03-06✓ 2 SnippetsBornschein U, Zeberg H, Enard W, Hevers W, Pääbo S.
In-Text Gene Mentions
Discussion)
…to this site,POU3F2(also called BRN2),…
Discussion)
…efficiency with whichPOU3F2dimers bind to…
Show Full Abstract
The transcription factor forkhead box P2 (FOXP2) is involved in the development of language and speech in humans. Two amino acid substitutions (T303N, N325S) occurred in the human FOXP2 after the divergence from the chimpanzee lineage. It has previously been shown that when they are introduced into the FOXP2 protein of mice they alter striatal synaptic plasticity by increasing long-term depression in medium spiny neurons. Here we introduce each of these amino acid substitutions individually into mice and analyze their effects in the striatum. We find that long-term depression in medium spiny neurons is increased in mice carrying only the T303N substitution to the same extent as in mice carrying both amino acid substitutions. In contrast, the N325S substitution has no discernable effects.
Severe hypertriglyceridemia (sHTG) is an established risk factor for acute pancreatitis. Current therapeutic approaches for sHTG are often insufficient to reduce triglycerides and prevent acute pancreatitis. This phase 2 trial ( NCT03452228 ) evaluated evinacumab (angiopoietin-like 3 inhibitor) in three cohorts of patients with sHTG: cohort 1, familial chylomicronemia syndrome with bi-allelic loss-of-function lipoprotein lipase (LPL) pathway mutations (n = 17); cohort 2, multifactorial chylomicronemia syndrome with heterozygous loss-of-function LPL pathway mutations (n = 15); and cohort 3, multifactorial chylomicronemia syndrome without LPL pathway mutations (n = 19). Fifty-one patients (males, n = 27; females, n = 24) with a history of hospitalization for acute pancreatitis were randomized 2:1 to intravenous evinacumab 15 mg kg<sup>-1</sup> or placebo every 4 weeks over a 12-week double-blind treatment period, followed by a 12-week single-blind treatment period. The primary end point was the mean percent reduction in triglycerides from baseline after 12 weeks of evinacumab exposure in cohort 3. Evinacumab reduced triglycerides in cohort 3 by a mean (s.e.m.) of -27.1% (37.4) (95% confidence interval -71.2 to 84.6), but the prespecified primary end point was not met. No notable differences in adverse events between evinacumab and placebo treatment groups were seen during the double-blind treatment period. Although the primary end point of a reduction in triglycerides did not meet the prespecified significance level, the observed safety and changes in lipid and lipoprotein levels support the further evaluation of evinacumab in larger trials of patients with sHTG. Trial registration number: ClinicalTrials.gov NCT03452228 .
Also flagged:liver diseaseLiver diseasesdetoxificationinflammatory responsesalcoholobesity
Journal Article2023-03-06✓ 1 SnippetBarouki R, Samson M, Blanc EB, Colombo M, Zucman-Rossi J, Lazaridis KN, Miller GW, Coumoul X.
In-Text Gene Mentions
S I O 001029)
…The commonest form of haemochromatosis in Caucasians is due to homozygous HFE(C282Y) mutations, but the exact disease penetrance is dependent on age and sex.131 Congenital iron overload disease also occurs in individuals with alpha and beta thalassemia, syndromic and non-syndromic congenital sideroblastic anaemia, congenital dyserythropoietic anaemia, hypotransferrinaemia and in diseases related to divalent metal transporter 1 mutations.…
Show Full Abstract
Since the initial development of the exposome concept, much effort has been devoted to the characterisation of the exposome through analytical, epidemiological, and toxicological/mechanistic studies. There is now an urgent need to link the exposome to human diseases and to include exposomics in the characterisation of environment-linked pathologies together with genomics and other omics. Liver diseases are particularly well suited for such studies since major functions of the liver include the detection, detoxification, and elimination of xenobiotics, as well as inflammatory responses. It is well known that several liver diseases are associated with i) addictive behaviours such as alcohol consumption, smoking, and to a certain extent dietary imbalance and obesity, ii) viral and parasitic infections, and iii) exposure to toxins and occupational chemicals. Recent studies indicate that environmental exposures are also significantly associated with liver diseases, and these include air pollution (particulate matter and volatile chemicals), contaminants such as polyaromatic hydrocarbons, bisphenol A and per-and poly-fluorinated substances, and physical stressors such as radiation. Furthermore, microbial metabolites and the "gut-liver" axis play a major role in liver diseases. Exposomics is poised to play a major role in the field of liver pathology. Methodological advances such as the exposomics-metabolomics framework, the determination of risk factors' genomic and epigenomic signatures, and cross-species biological pathway analysis should further delineate the impact of the exposome on the liver, opening the way for improved prevention, as well as the identification of new biomarkers of exposure and effects, and additional therapeutic targets.
Also flagged:COPDGene ExpressionemphysemaChronic Obstructive Lung Diseaseubiquitinproteolysis
Journal Article2023-03-06✓ 1 SnippetJiang J, Chen S, Yu T, Chang C, Liu J, Ren X, Niu H, Huang K, Li B, Wang C, Yang T.
In-Text Gene Mentions
Results)
…, SVEP1 ,RABGAP1L, HIF3A ,…
Show Full Abstract
<h4>Aims</h4>Oxidative stress is an important amplifying mechanism in COPD; however, it is unclear how oxidative stress changes and what its exact amplification mechanism is in the pathological process. We aimed to dynamically analyse the progression of COPD and further elucidate the characteristics of each developmental stage and unveil the underlying mechanisms.<h4>Methods</h4>We performed a holistic analysis by integrating Gene Expression Omnibus microarray datasets related to smoking, emphysema and Global Initiative for Chronic Obstructive Lung Disease (GOLD) classification based on the concept of gene, environment and time (GET). Gene ontology (GO), protein-protein interaction (PPI) networks and gene set enrichment analysis (GSEA) were used to explore the changing characteristics and potential mechanisms. Lentivirus was used to promote <i>HIF3A</i> overexpression.<h4>Results</h4>In smokers <i>versus</i> nonsmokers, the GO term mainly enriched in "negative regulation of apoptotic process". In later transitions between stages, the main enriched terms were continuous progression of "oxidation-reduction process" and "cellular response to hydrogen peroxide". Logistic regression showed that these core differentially expressed genes (DEGs) had diagnostic accuracy in test (area under the curve (AUC)=0.828) and validation (AUC=0.750) sets. GSEA and PPI networks showed that one of the core DEGs, <i>HIF3A</i>, strongly interacted with the ubiquitin-mediated proteolysis pathway. Overexpression of <i>HIF3A</i> restored superoxide dismutase levels and alleviated the reactive oxygen species accumulation caused by cigarette smoke extract treatment.<h4>Conclusion</h4>Oxidative stress was continuously intensified from mild emphysema to GOLD 4; thus, special attention should be paid to the identification of emphysema. Furthermore, the downregulated <i>HIF3A</i> may play an important role in the intensified oxidative stress in COPD.
Also flagged:developmental dysplasia of the hiposteoarthritisferroptosisOAtitaniumgrowth differential factor 5
Journal Article2023-03-06✓ 1 SnippetMori Y, Ueno K, Chiba D, Hashimoto K, Kawai Y, Baba K, Tanaka H, Aki T, Ogasawara M, Shibasaki N, Tokunaga K, Aizawa T, Nagasaki M.
In-Text Gene Mentions
Results)
…intronic region ofSHISA6.…
Show Full Abstract
This study examined the association between developmental dysplasia of the hip (DDH) and disease-associated loci in a Japanese cohort. A genome-wide association study (GWAS) of 238 Japanese patients with DDH and 2044 healthy individuals was performed. As a replicate, GWAS was also conducted on the UK Biobank data with 3315 cases and matched 74,038 controls. Gene set enrichment analyses (GSEAs) of both the genetics and transcriptome of DDH were performed. Transcriptome analysis of cartilage specimens from DDH-associated osteoarthritis and femoral neck fractures was performed as a control. Most of the lead variants were very low-frequency ones in the UK, and variants in the Japanese GWAS could not be replicated with the UK GWAS. We assigned DDH-related candidate variants to 42 and 81 genes from the Japanese and UK GWASs, respectively, using functional mapping and annotation. GSEA of gene ontology, disease ontology, and canonical pathways identified the most enriched pathway to be the ferroptosis signaling pathway, both in the Japanese gene set as well as the Japanese and UK merged set. Transcriptome GSEA also identified significant downregulation of genes in the ferroptosis signaling pathway. Thus, the ferroptosis signaling pathway may be associated with the pathogenic mechanism of DDH.
Also flagged:Myelodysplastic Syndromehematopoietic neoplasmhematopoiesisacute myeloid leukemiaAMLvenetoclax
Journal Article2023-03-06No SnippetsZavras PD, Sinanidis I, Tsakiroglou P, Karantanos T.
Show Full Abstract
Myelodysplastic syndrome (MDS) is a clonal hematopoietic neoplasm characterized by bone marrow dysplasia, failure of hematopoiesis and variable risk of progression to acute myeloid leukemia (AML). Recent large-scale studies have demonstrated that distinct molecular abnormalities detected at earlier stages of MDS alter disease biology and predict progression to AML. Consistently, various studies analyzing these diseases at the single-cell level have identified specific patterns of progression strongly associated with genomic alterations. These pre-clinical results have solidified the conclusion that high-risk MDS and AML arising from MDS or AML with MDS-related changes (AML-MRC) represent a continuum of the same disease. AML-MRC is distinguished from de novo AML by the presence of certain chromosomal abnormalities, such as deletion of 5q, 7/7q, 20q and complex karyotype and somatic mutations, which are also present in MDS and carry crucial prognostic implications. Recent changes in the classification and prognostication of MDS and AML by the International Consensus Classification (ICC) and the World Health Organization (WHO) reflect these advances. Finally, a better understanding of the biology of high-risk MDS and the mechanisms of disease progression have led to the introduction of novel therapeutic approaches, such as the addition of venetoclax to hypomethylating agents and, more recently, triplet therapies and agents targeting specific mutations, including FLT3 and IDH1/2. In this review, we analyze the pre-clinical data supporting that high-risk MDS and AML-MRC share the same genetic abnormalities and represent a continuum, describe the recent changes in the classification of these neoplasms and summarize the advances in the management of patients with these neoplasms.
Also flagged:antithrombin deficiencytype I deficiencynucleotidethrombophiliagenetic disordersdeficiency
Journal Article2023-03-06✓ 5 SnippetsCifuentes R, Padilla J, de la Morena-Barrio ME, de la Morena-Barrio B, Bravo-Pérez C, Garrido-Rodríguez P, Llamas M, Miñano A, Vicente V, Lozano ML, Corral J.
In-Text Gene Mentions
Results)
…Because current molecular diagnostic algorithms terminate once a potential causative defect is detected in SERPINC1 after sequencing, SVs are not evaluated in cases with a pathogenic or probably pathogenic SNV or INDEL identified by sequencing methods, particularly if segregation analysis in family studies supports a link between the SERPINC1 mutation and antithrombin deficiency [4,6].…
Introduction)
…In this study, we analyzed the usefulness and limitations of MLPA in antithrombin deficiency, focusing on the search for potential SVs that might be obscured by the current algorithm designed to characterize the molecular basis of this severe thrombophilia, which restricts the analysis of potential SVs by MLPA only to cases with type I deficiency and no pathogenic genetic variants identified by the sequencing of SERPINC1.…
Abstract)
…Multiplex ligation-dependent probe amplification (MLPA) identifies genetic structural variants in SERPINC1 in 5% of cases with antithrombin deficiency (ATD), the most severe congenital thrombophilia.…
Discussion)
…MLPA detects all SVs affecting SERPINC1 exons regardless of their type (deletion or duplication) [12], but this method does not detect SVs affecting introns of this gene, such as deletions [8], or retrotransposon insertions [9], despite the fact that these defects also cause antithrombin deficiency.…
Introduction)
…In SERPINC1, from the available data of the Human Gene Mutation Database (HGMD), 90.4% most of the defects causing antithrombin deficiency are SNVs and INDELs SERPINC1.…
Show Full Abstract
Multiplex ligation-dependent probe amplification (MLPA) identifies genetic structural variants in <i>SERPINC1</i> in 5% of cases with antithrombin deficiency (ATD), the most severe congenital thrombophilia. Our aim was to unravel the utility and limitations of MLPA in a large cohort of unrelated patients with ATD (N = 341). MLPA identified 22 structural variants (SVs) causing ATD (6.5%). MLPA did not detect SVs affecting introns (four cases), and the diagnosis was inaccurate in two cases according to long-range PCR or nanopore sequencing. MLPA was used to detect possible hidden SVs in 61 cases with type I deficiency with single nucleotide variations (SNVs) or small insertion/deletion (INDEL). One case had a false deletion of exon 7, as the 29-bp deletion affected an MLPA probe. We evaluated 32 variants affecting MLPA probes: 27 SNVs and 5 small INDELs. In three cases, MLPA gave false-positive results, all diagnosed as deletions of the affected exon: a small INDEL complex, and two SNVs affecting MLPA probes. Our study confirms the utility of MLPA to detect SVs in ATD, but also shows some limitations in detecting intronic SVs. MLPA renders imprecise and false-positive results for genetic defects which affect MLPA probes. Our results encourage the validation of MLPA results.
Also flagged:tumortricarboxylic acidmitochondriaSDHSDHASDHB
Journal Article2023-03-06✓ 1 SnippetNan H, Guo P, Fan J, Zeng W, Hu C, Zheng C, Pan B, Cao Y, Ge Y, Xue X, Li W, Lin K.
In-Text Gene Mentions
Methods)
…TNFSF13B, TNFSF14, TNFSF15,TNFSF4, and TNFSF9 were…
Show Full Abstract
<h4>Background</h4>Succinate dehydrogenase (SDH), one of the key enzymes in the tricarboxylic acid cycle, is mainly found in the mitochondria. SDH consists of four subunits encoding SDHA, SDHB, SDHC, and SDHD. The biological function of SDH is significantly related to cancer progression. Colorectal cancer (CRC) is one of the most common malignant tumors globally, whose most common histological subtype is colon adenocarcinoma (COAD). However, the correlation between SDH factors and COAD remains unclear.<h4>Methods</h4>The data on pan-cancer was obtained from The Cancer Genome Atlas (TCGA) database. Kaplan-Meier survival analysis showed the prognostic ability of SDHs. The cBioPortal database reflected genetic variations of SDHs. The correlation analysis was conducted between SDHs and mitochondrial energy metabolism genes (MMGs) and the protein-protein interaction (PPI) network was built. Consequently, Univariate and Multivariate Cox Regression Analysis on SDHs and other clinical characteristics were conducted. A nomogram was established. The ssGSEA analysis visualized the association between SDHs and immune infiltration. Immunophenoscore (IPS) explored the correlation between SDHs and immunotherapy, and the correlation between SDHs and targeted therapy was investigated through Genomics of Drug Sensitivity in Cancer. Finally, qPCR and immunohistochemistry detected SDHs' expression.<h4>Results</h4>After assessing SDHs differential expression in pan-cancer, we found that SDHB, SDHC, and SDHD benefit COAD patients. The cBioPortal database demonstrated that SDHA was the top gene in mutation frequency rank. Correlation analysis mirrored a strong link between SDHs and MMGs. We formulated a nomogram and found that SDHB, SDHC, SDHD, and clinical characteristics correlated with COAD patients' survival. For T helper cells, Th2 cells, and Tem, SDHA, SDHB, SDHC, and SDHD were significantly enriched in the high expression group. Moreover, COAD patients with high SDHA expression were more suitable for immunotherapy. And COAD patients with different SDHs' expression have different sensitivity to targeted drugs. Further verifying the gene and protein expression levels of SDHs, we found that the tissues were consistent with the bioinformatics analysis.<h4>Conclusions</h4>Our study analyzed the expression and prognostic value of SDHs in COAD, explored the pathway mechanisms involved, and the immune cell correlations, indicating that SDHs might be biomarkers for COAD patients.
Also flagged:juvenile polyposis syndromehamartomatous polyp syndromejuvenilegastric polypsjuvenile polyposis syndrome of thecolon cancer
Journal Article2023-03-06No SnippetsLiu Y, Wang Z, Zhang Z, Sun Y, Zhang Y, Yang J.
Show Full Abstract
<h4>Background</h4>Juvenile polyposis syndrome (JPS) is a rare autosomal dominant disorder that is a type of hamartomatous polyp syndrome, and its incidence rate is approximately 1/100000. The main clinical feature is the presence of multiple juvenile polyps in the gastrointestinal tract, most often in the colorectal tract. We present a case of juvenile polyposis syndrome with massive gastric polyposis.<h4>Case presentation</h4>A 50-year-old male was admitted to the hospital due to abdominal distension and poor appetite. Gastroscopy revealed a large number of gastric polyps. Pathological findings revealed gastric juvenile polyps. Genetic testing revealed that he and his brother both carried <i>SMAD4</i>: c.266_269del germline pathogenic variant. The final diagnosis was juvenile polyposis syndrome of the stomach. He once suffered from colon cancer and bladder cancer. One of his brothers died of colon cancer, and the other brother suffered from colon polyps.<h4>Conclusions</h4>Gastric involvement in juvenile polyposis syndrome is relatively rare. When massive gastric polyposis is found, gene detection should be carried out as soon as possible, so that rapid diagnosis and treatment can be obtained.
Also flagged:Protocatechuic AcidMelanomaagingpigmentationalkyl estersmelanin
Journal Article2023-03-06No SnippetsCho J, Jung H, Kang DY, Sp N, Shin W, Lee J, Park BG, Kang YA, Jang KJ, Bae SW.
Show Full Abstract
The skin is the most voluminous organ of the human body and is exposed to the outer environment. Such exposed skin suffers from the effects of various intrinsic and extrinsic aging factors. Skin aging is characterized by features such as wrinkling, loss of elasticity, and skin pigmentation. Skin pigmentation occurs in skin aging and is caused by hyper-melanogenesis and oxidative stress. Protocatechuic acid (PCA) is a natural secondary metabolite from a plant-based source widely used as a cosmetic ingredient. We chemically designed and synthesized PCA derivatives conjugated with alkyl esters to develop effective chemicals that have skin-whitening and antioxidant effects and enhance the pharmacological activities of PCA. We identified that melanin biosynthesis in B16 melanoma cells treated with alpha-melanocyte-stimulating hormone (α-MSH) is decreased by PCA derivatives. We also found that PCA derivatives effectively have antioxidant effects in HS68 fibroblast cells. In this study, we suggest that our PCA derivatives are potent ingredients for developing cosmetics with skin-whitening and antioxidant effects.
Also flagged:Sodium-Glucose Cotransporter 2Myelodysplastic Syndrome-Related AnemiaChronic Kidney Diseasehypoxia-inducible factorprolyl hydroxylasedapagliflozin
Journal Article2023-03-06✓ 1 SnippetYamasaki S, Horiuchi T.
In-Text Gene Mentions
I A O 0000613)
…failure and secondaryhemochromatosis, resulting in a…
Show Full Abstract
Although daprodustat, a hypoxia-inducible factor prolyl hydroxylase inhibitor, and dapagliflozin, a sodium-glucose cotransporter 2 inhibitor, have been approved for the treatment of renal anemia in Japan, their efficacy and safety for patients aged 80 years or older with low-risk myelodysplastic syndrome (MDS)-related anemia have not been demonstrated. Our case series comprised two men and one woman aged >80 years with low-risk MDS-related anemia and diabetic mellitus (DM)-related chronic kidney disease who were dependent on red blood cell transfusions and in whom erythropoiesis-stimulating agents had been insufficient. All three patients received daprodustat and additional dapagliflozin achieved red blood cell transfusion independence and were followed up for >6 months. Daily oral daprodustat was well tolerated. There were no fatalities or progression to acute myeloid leukemia during the >6-month follow-up after daprodustat initiation. On the basis of these outcomes, we consider 24 mg of daprodustat combined with 10 mg of dapagliflozin daily an effective form of treatment for low-risk MDS-related anemia. Further studies are required to clarify the synergistic effects of daprodustat and dapagliflozin, which correct chronic kidney disease-related anemia by promoting endogenous erythropoietin production and normalizing iron metabolism to manage low-risk MDS in the long term.
Also flagged:NeurotoxicityoxygenMitochondriamitochondrialneurodegenerative diseasessulfur
Journal Article2023-03-06No SnippetsZhou L, Wang Q.
Show Full Abstract
Neurotoxicity is induced by different toxic substances, including environmental chemicals, drugs, and pathogenic toxins, resulting in oxidative damage and neurodegeneration in mammals. The nervous system is extremely vulnerable to oxidative stress because of its high oxygen demand. Mitochondria are the main source of ATP production in the brain neuron, and oxidative stress-caused mitochondrial dysfunction is implicated in neurodegenerative diseases. H<sub>2</sub>S was initially identified as a toxic gas; however, more recently, it has been recognized as a neuromodulator as well as a neuroprotectant. Specifically, it modulates mitochondrial activity, and H<sub>2</sub>S oxidation in mitochondria produces various reactive sulfur species, thus modifying proteins through sulfhydration. This review focused on highlighting the neuron modulation role of H<sub>2</sub>S in regulating neurodegenerative diseases through anti-oxidative, anti-inflammatory, anti-apoptotic and S-sulfhydration, and emphasized the importance of H<sub>2</sub>S as a therapeutic molecule for neurological diseases.
Also flagged:fertilizationcell proliferationTGF-betaWNTCHD2CDC42
Journal Article2023-03-06No SnippetsYang L, Cai J, Rong L, Yang S, Li S.
Show Full Abstract
The development regulation of the uterine-vaginal junction (UVJ) epithelial folds during the sexual maturation of female birds played crucial roles in the adults' sperm storage duration and fertilization capability. However, there is a lack of studies on it in the breeding field of laying hens. In this study, White Leghorn was used for the morphological and developmental studies. According to the morphological characteristics, the development of the UVJ epithelial folds was classified into 4 stages (morphological stage T1-T4). Significant individual differences were observed simultaneously, which is one of the factors leading to the adults' UVJ morphological differences. Bulk RNA-seq suggested the different regulations of UVJ epithelial folds were classified into 3 stages (developmental stage S1-S3). Genes enriched in cell proliferation, differentiation, polarity, migration, adhesion and junction were supposed to regulate UVJ epithelial fold formation. Single-cell RNA-sequencing (scRNA-seq) showed significant differences between different types of cells within UVJ at the developmental stage S2. Immunohistochemical studies confirmed that the different proliferation rates between the epithelium and nonepithelium were one of the key factors leading to the formation of UVJ epithelial folds. Genes in the TGF-beta and WNT pathways may play roles in regulating the proliferation and differentiation of epithelium. Some factors, such as CHD2, CDC42, and carbonic anhydrases, were important participants in forming UVJ epithelial folds. This study will provide new thoughts on the differential regulation of fertilization traits from the developmental biology perspective.
Also flagged:Apolipoprotein L1interferonkidney failureglomerular filtrationcreatinineNeurological Disorders
Journal Article2023-03-06No SnippetsIlori TO, Brooks MS, Desai PN, Cheung KL, Judd SE, Crews DC, Cushman M, Winkler CA, Shlipak MG, Kopp JB, Naik RP, Estrella MM, Gutiérrez OM, Kramer H.
Show Full Abstract
<h4>Rationale & objective</h4>Dietary factors may impact inflammation and interferon production, which could influence phenotypic expression of Apolipoprotein1 (<i>APOL1</i>) genotypes. We investigated whether associations of dietary patterns with kidney outcomes differed by <i>APOL1</i> genotypes.<h4>Study design</h4>Prospective cohort.<h4>Settings & participants</h4>5,640 Black participants in the Reasons for Geographic and Racial Differences in Stroke (REGARDS).<h4>Exposures</h4>Five dietary patterns derived from food frequency questionnaires: Convenience foods, Southern, Sweets and Fats, Plant-based, and Alcohol/Salads.<h4>Outcomes</h4>Incident chronic kidney disease (CKD), CKD progression, and kidney failure. Incident CKD was defined as a change in estimated glomerular filtration rate (eGFR) to <60 mL/min/1.73 m<sup>2</sup> accompanied by a ≥25% decline from baseline eGFR or development of kidney failure among those with baseline eGFR ≥60 mL/1.73 m<sup>2</sup> body surface area. CKD progression was defined as a composite of 40% reduction in eGFR from baseline or development of kidney failure in the subset of participants who had serum creatinine levels at baseline and completed a second in-home visit/follow-up visit.<h4>Analytical approach</h4>We examined associations of dietary pattern quartiles with incident CKD (n=4,188), CKD progression (n=5,640), and kidney failure (n=5,640). We tested for statistical interaction between dietary patterns and <i>APOL1</i> genotypes for CKD outcomes and explored stratified analyses by <i>APOL1</i> genotypes.<h4>Results</h4>Among 5,640 Black REGARDS participants, mean age was 64 years (standard deviation = 9), 35% were male, and 682 (12.1%) had high-risk <i>APOL1</i> genotypes. Highest versus lowest quartiles (Q4 vs Q1) of Southern dietary pattern were associated with higher adjusted odds of CKD progression (OR, 1.28; 95% CI, 1.01-1.63) but not incident CKD (OR, 0.92; 95% CI, 0.74-1.14) or kidney failure (HR, 1.48; 95% CI, 0.90-2.44). No other dietary patterns showed significant associations with CKD. There were no statistically significant interactions between <i>APOL1</i> genotypes and dietary patterns. Stratified analysis showed no consistent associations across genotypes, although Q3 and Q4 versus Q1 of Plant-based and Southern patterns were associated with lower odds of CKD progression among <i>APOL1</i> high- but not low-risk genotypes.<h4>Limitations</h4>Included overlapping dietary patterns based on a single time point and multiple testing.<h4>Conclusions</h4>In Black REGARDS participants, Southern dietary pattern was associated with increased risk of CKD progression. Analyses stratified by <i>APOL1</i> genotypes suggest associations may differ by genetic background, but these findings require confirmation in other cohorts.
Also flagged:neurogenesispsychiatric illnessesagingneurodegenerative diseasesneurotrophic factorsbrain-derived neurotrophic factor
Journal Article2023-03-06No SnippetsNishanth MJ, Jha S.
Show Full Abstract
<h4>Background</h4>Adult hippocampal neurogenesis (AHN) is a clinically significant neural phenomenon. Understanding its molecular regulation would be important. In this regard, most studies have focused on transcriptional regulators (TRs), epigenetic modifiers, or non-coding RNAs. RNA-binding proteins (RBPs) have emerged as dominant molecular regulators. It would be significant to understand the potential cross-talk between RBPs and TRs, which could influence AHN.<h4>Methods</h4>The present study employed computational analyses to identify RBPs and TRs regulating AHN, followed by the analysis of their interaction networks and detection of hub proteins. Next, the potential mutual regulation of hub TRs and RBPs was analyzed. Additionally, hippocampal genes differentially expressed upon exercise were analyzed for potential regulation by the identified TRs and RBPs.<h4>Results</h4>105 TRs and 26 RBPs were found to influence AHN, which could also form interactive networks. Polycomb complex proteins were among the TR network hubs, while HNRNP and SRSF family members were among the hub RBPs. Further, the polycomb complex proteins and SRSF1 could have a mutual regulatory relationship, suggesting a cross-talk between epigenetic/transcriptional and post-transcriptional regulatory pathways. A number of exercise-induced hippocampal genes were also found to be potential targets of the identified TRs and RBPs.<h4>Conclusion</h4>SRSF1 may influence post-transcriptional stability, localization, and alternative splicing patterns of polycomb complex transcripts, and the polycomb proteins may in turn epigenetically influence the SRSF1. Further experimental validation of these regulatory loops/networks could provide novel insights into the molecular regulation of AHN, and unravel new targets for disease-treatment.
<h4>Background</h4>Brain microvascular endothelial cell (BMEC) injury can affect neuronal survival by modulating immune responses through the microenvironment. Exosomes are important vehicles of transport between cells. However, the regulation of the subtypes of microglia by BMECs through the exosome transport of microRNAs (miRNAs) has not been established.<h4>Methods</h4>In this study, exosomes from normal and oxygen-glucose deprivation (OGD)-cultured BMECs were collected, and differentially expressed miRNAs were analyzed. BMEC proliferation, migration, and tube formation were analyzed using MTS, transwell, and tube formation assays. M1 and M2 microglia and apoptosis were analyzed using flow cytometry. miRNA expression was analyzed using real-time polymerase chain reaction (RT-qPCR), and IL-1β, iNOS, IL-6, IL-10, and RC3H1 protein concentrations were analyzed using western blotting.<h4>Results</h4>We found that miR-3613-3p was enriched in BMEC exosome by miRNA GeneChip assay and RT-qPCR analysis. miR-3613-3p knockdown enhanced cell survival, migration, and angiogenesis in the OGD-treated BMECs. In addition, BMECs secrete miR-3613-3p to transfer into microglia via exosomes, and miR-3613-3p binds to the RC3H1 3' untranslated region (UTR) to reduce RC3H1 protein levels in microglia. Exosomal miR-3613-3p promotes microglial M1 polarization by inhibiting RC3H1 protein levels. BMEC exosomal miR-3613-3p reduces neuronal survival by regulating microglial M1 polarization.<h4>Conclusions</h4>miR-3613-3p knockdown enhances BMEC functions under OGD conditions. Interfering with miR-3613-3p expression in BMSCs reduced the enrichment of miR-3613-3p in exosomes and enhanced M2 polarization of microglia, which contributed to reduced neuronal apoptosis.
Also flagged:MYH1myopathygene expressioncarbonPMCHIGF-1
Journal Article2023-03-05✓ 5 SnippetsTan X, Liu R, Zhao D, He Z, Li W, Zheng M, Li Q, Wang Q, Liu D, Feng F, Zhu D, Zhao G, Wen J.
In-Text Gene Mentions
Results)
…In summary, we found that SOX6 had a crucial influence on myopathy and meat quality related traits.…
I A O 0000615)
…The SOX6–MYH1s axis and causal gene SOX6 for BrW, BrP, and myopathy will facilitate selection aimed at high meat yield in chickens.…
S I O 001029)
…Our study provides a comprehensive atlas comprising the typical genomic variants and transcriptional characteristics for muscle development and suggests a new regulatory target (SOX6–MYH1s axis) for breast muscle yield and myopathy, which could aid in the development of genome-scale selective breeding aimed at high meat yield in broiler chickens.…
S I O 001029)
…Furthermore, we found that the causal gene SOX6 influenced breast muscle yield and also related to myopathy occurrences.…
Abstract)
…the causal geneSOX6influenced breast muscle…
Show Full Abstract
<h4>Introduction</h4>Investigating the genetic markers and genomic signatures related to chicken meat production by combing multi-omics methods could provide new insights into modern chicken breeding technology systems.<h4>Object</h4>Chicken is one of the most efficient and environmentally friendly livestock, especially the fast-growing white-feathered chicken (broiler), which is well known for high meat yield, but the underlying genetic basis is poorly understood.<h4>Method</h4>We generated whole-genome resequencing of three purebred broilers (n = 748) and six local breeds/lines (n = 114), and sequencing data of twelve chicken breeds (n = 199) were obtained from the NCBI database. Additionally, transcriptome sequencing of six tissues from two chicken breeds (n = 129) at two developmental stages was performed. A genome-wide association study combined with cis-eQTL mapping and the Mendelian randomization was applied.<h4>Result</h4>We identified > 17 million high-quality SNPs, of which 21.74% were newly identified, based on 21 chicken breeds/lines. A total of 163 protein-coding genes underwent positive selection in purebred broilers, and 83 genes were differentially expressed between purebred broilers and local chickens. Notably, muscle development was proven to be the major difference between purebred broilers and local chickens, or ancestors, based on genomic and transcriptomic evidence from multiple tissues and stages. The MYH1 gene family showed the top selection signatures and muscle-specific expression in purebred broilers. Furthermore, we found that the causal gene SOX6 influenced breast muscle yield and also related to myopathy occurrences. A refined haplotype was provided, which had a significant effect on SOX6 expression and phenotypic changes.<h4>Conclusion</h4>Our study provides a comprehensive atlas comprising the typical genomic variants and transcriptional characteristics for muscle development and suggests a new regulatory target (SOX6-MYH1s axis) for breast muscle yield and myopathy, which could aid in the development of genome-scale selective breeding aimed at high meat yield in broiler chickens.
Also flagged:nasopharyngeal carcinomatumorplatinumdocetaxelcisplatin5‐fluorouracil
Journal Article2023-03-05No SnippetsLi Y, Bi J, Pi G, He H, Li Y, Zheng D, Wei Z, Han G.
Show Full Abstract
<h4>Background and purpose</h4>The optimal number of cycles of induction chemotherapy (IC) in locoregionally advanced nasopharyngeal carcinoma (LANPC) remains unresolved. This study aimed to quantitatively assess the changes in gross tumor volumes (GTVs) and to select the most optimal number of IC cycles.<h4>Methods</h4>We analyzed 54 patients who received a three-cycle IC before commencing radiotherapy, with the tumor and nodal responses assessed by a CT scan before IC and after each IC cycle. The gross tumor volumes of the nasopharynx primary lesion (GTV_T), involved retropharyngeal lymph node (GTV_RP), and involved cervical lymph node (GTV_N) were contoured on each scan. The volume change following each IC cycle was evaluated with Wilcoxon signed-rank test. The three-dimensional vector displacements of target centers were also calculated and compared.<h4>Results</h4>The volume reductions of GTVs following IC varied across different patients and showed different trends for the three GTV types. GTV_T and GTV_RP did not display further volume reduction after two IC cycles, whereas GTV_N showed monotonic volume decreases. For GTV_T and GTV_RP following the three IC cycles, the total volume reduction relative to the initial volume before IC was 12.0%, 22.5%, and 20.1% and 26.0%, 44.1%, and 42.2%, respectively. In contrast, for GTV_N, continuing volume reduction was observed with a total reduction of 25.3%, 43.2%, and 54.7% following the three cycles, and the reductions were all significant. Average displacements of the GTVs were <1.5 mm in all directions; their average three-dimensional displacements were 2.6, 4.0, and 1.7 mm, respectively. Acceptable toxicity was observed in most patients.<h4>Conclusion</h4>This study supports two cycles of IC before radiotherapy for patients with LANPC if the initial metastatic cervical lymph node volume is not dominating. Otherwise, three cycles of IC is recommended to further reduce the cervical node volume.
Since its emergence at the end of 2019, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused the infection of more than 600 million people worldwide and has significant damage to global medical, economic, and political structures. Currently, a highly mutated variant of concern, SARS-CoV-2 Omicron, has evolved into many different subvariants mainly including BA.1, BA.2, BA.3, BA.4/5, and the recently emerging BA.2.75.2, BA.2.76, BA.4.6, BA.4.7, BA.5.9, BF.7, BQ.1, BQ.1.1, XBB, XBB.1, etc. Mutations in the N-terminal domain (NTD) of the spike protein, such as A67V, G142D, and N212I, alter the antigenic structure of Omicron, while mutations in the spike receptor binding domain (RBD), such as R346K, Q493R, and N501Y, increase the affinity for angiotensin-converting enzyme 2 (ACE2). Both types of mutations greatly increase the capacity of Omicron to evade immunity from neutralizing antibodies, produced by natural infection and/or vaccination. In this review, we systematically assess the immune evasion capacity of SARS-CoV-2, with an emphasis on the neutralizing antibodies generated by different vaccination regimes. Understanding the host antibody response and the evasion strategies employed by SARS-CoV-2 variants will improve our capacity to combat newly emerging Omicron variants.
Also flagged:neurodegenerative diseaseschronic disordersneurodegenerative disordersneurodegenerativeADPD
Journal Article2023-03-05✓ 5 SnippetsRoussos A, Kitopoulou K, Borbolis F, Palikaras K.
In-Text Gene Mentions
S I O 001029)
…Although there is no HTT ortholog in C. elegans, several HD models have been generated, carrying variable lengths of polyQ-repeats with or without fusion with fluorescent proteins.…
S I O 001029)
…HD is caused by a CAG expansion in the huntingtin (HTT) gene, resulting in the production of a mutant HTT protein that carries extended polyglutamine repeats (polyQs) in its N-terminus, triggering neuronal death [153,154].…
Introduction)
…in the huntingtin (HTT) gene, resulting in…
Introduction)
…of a mutantHTTprotein that carries…
Introduction)
…there is noHTTortholog in C.…
Show Full Abstract
In recent years, advances in science and technology have improved our quality of life, enabling us to tackle diseases and increase human life expectancy. However, longevity is accompanied by an accretion in the frequency of age-related neurodegenerative diseases, creating a growing burden, with pervasive social impact for human societies. The cost of managing such chronic disorders and the lack of effective treatments highlight the need to decipher their molecular and genetic underpinnings, in order to discover new therapeutic targets. In this effort, the nematode <i>Caenorhabditis elegans</i> serves as a powerful tool to recapitulate several disease-related phenotypes and provides a highly malleable genetic model that allows the implementation of multidisciplinary approaches, in addition to large-scale genetic and pharmacological screens. Its anatomical transparency allows the use of co-expressed fluorescent proteins to track the progress of neurodegeneration. Moreover, the functional conservation of neuronal processes, along with the high homology between nematode and human genomes, render <i>C. elegans</i> extremely suitable for the study of human neurodegenerative disorders. This review describes nematode models used to study neurodegeneration and underscores their contribution in the effort to dissect the molecular basis of human diseases and identify novel gene targets with therapeutic potential.
Hereditary spherocytosis (HS) refers to the group of the most frequently occurring non-immune hereditary hemolytic anemia in people of Caucasian central or northern European ancestry. HS is mainly associated with pathogenic variants of genes encoding defects in five membrane proteins, including anion exchanger 1 encoded by the <i>SLC4A1</i> gene. In this study, in a family affected with HS, we identified a hitherto unreported AE1 defect, variant p.G720W. The result of it is most likely the HS phenotype. Molecular dynamics simulation study of the AE1 transmembrane domain may indicate reasonable changes in AE1 domain structure, i.e., significant displacement of the tryptophan residue towards the membrane surface connected with possible changes in AE1 function. The WES analysis verified by classical sequencing in conjunction with biochemical analysis and molecular simulation studies shed light on the molecular mechanism underlying this case of hereditary spherocytosis, for which the newly discovered AE1 variant p.G720W seems crucial.
…genes coding forvariable histonehistone family proteins,…
Show Full Abstract
Multiple microRNAs (miRs) are associated with systemic autoimmune disease susceptibility/phenotype, including systemic lupus erythematosus (SLE). With this work, we aimed to unravel the association of the miR-27a gene (MIR27A) rs11671784G/A variant with SLE risk/severity. One-hundred sixty-three adult patients with SLE and matched controls were included. A TaqMan allelic discrimination assay was applied for MIR27A genotyping. Logistic regression models were run to test the association with SLE susceptibility/risk. Genotyping of 326 participants revealed that the heterozygote form was the most common genotype among the study cohort, accounting for 72% of the population (n = 234), while A/A and G/G represented 15% (n = 49) and 13% (n = 43), respectively. Similarly, the most prevalent genotype among cases was the A/G genotype, which was present in approximately 93.3% of cases (n = 152). In contrast, only eight and three patients had A/A and G/G genotypes, respectively. The MIR27A rs11671784 variant conferred protection against the development of SLE in several genetic models, including heterozygous (G/A vs. A/A; OR = 0.10, 95% CI = 0.05-0.23), dominant (G/A + G/G vs. AA; OR = 0.15, 95% CI = 0.07-0.34), and overdominant (G/A vs. A/A + G/G; OR = 0.07, 95% CI = 0.04-0.14) models. However, the G/G genotype was associated with increased SLE risk in the recessive model (G/G vs. A/A+ G/G; OR = 17.34, 95% CI = 5.24-57.38). Furthermore, the variant showed significant associations with musculoskeletal and mucocutaneous manifestations in the patient cohort (<i>p</i> = 0.035 and 0.009, respectively) and platelet and white blood cell counts (<i>p</i> = 0.034 and 0.049, respectively). In conclusion, the MIR27A rs11671784 variant showed a potentially significant association with SLE susceptibility/risk in the studied population. Larger-scale studies on multiethnic populations are recommended to verify the results.
The Ataxia Global Initiative (AGI) is a worldwide multi-stakeholder research platform to systematically enhance trial-readiness in degenerative ataxias. The next-generation sequencing (NGS) working group of the AGI aims to improve methods, platforms, and international standards for ataxia NGS analysis and data sharing, ultimately allowing to increase the number of genetically ataxia patients amenable for natural history and treatment trials. Despite extensive implementation of NGS for ataxia patients in clinical and research settings, the diagnostic gap remains sizeable, as approximately 50% of patients with hereditary ataxia remain genetically undiagnosed. One current shortcoming is the fragmentation of patients and NGS datasets on different analysis platforms and databases around the world. The AGI NGS working group in collaboration with the AGI associated research platforms-CAGC, GENESIS, and RD-Connect GPAP-provides clinicians and scientists access to user-friendly and adaptable interfaces to analyze genome-scale patient data. These platforms also foster collaboration within the ataxia community. These efforts and tools have led to the diagnosis of > 500 ataxia patients and the discovery of > 30 novel ataxia genes. Here, the AGI NGS working group presents their consensus recommendations for NGS data sharing initiatives in the ataxia field, focusing on harmonized NGS variant analysis and standardized clinical and metadata collection, combined with collaborative data and analysis tool sharing across platforms.
Diffuse invasion is an important factor leading to treatment resistance and a poor prognosis in gliomas. Herein, we found that expression of the tripartite motif containing 56 (TRIM56), a RING-finger domain containing E3 ubiquitin ligase, was markedly higher in glioma than in normal brain tissue, and was significantly correlated with malignant phenotypes and a poor prognosis. In vitro and in vivo experimental studies revealed that TRIM56 promoted the migration and invasion of glioma cells. Mechanistically, TRIM56 was transcriptionally regulated by SP1 and promoted the K48-K63-linked poly-ubiquitination transition of IQGAP1 at Lys-1230 by interacting with it, which in turn promoted CDC42 activation. This mechanism was confirmed to mediate glioma migration and invasion. In conclusion, our study provides insights into the mechanisms through which TRIM56 promotes glioma motility, i.e., by regulating IQGAP1 ubiquitination to promote CDC42 activation, which might be clinically targeted for the treatment of glioma.
Also flagged:Methylationcancermethyladenine-methylcytosine-methyladeninetumor
Journal Article2023-03-04✓ 1 SnippetHuang Y, Zhang W, Li Q, Wang Z, Yang X.
In-Text Gene Mentions
Results)
…, CD274 ,TNFSF4, HHLA2 ,…
Show Full Abstract
Methylation of RNA plays an important role in cancer. Classical forms of such modifications include N6-methyladenine (m6A), 5-methylcytosine (m5C), and N1-methyladenine (m1A). Methylation-regulated long non-coding (lnc) RNAs are involved in various biological processes, such as tumor proliferation, apoptosis, immune escape, invasion, and metastasis. Therefore, we performed an analysis of transcriptomic and clinical data of pancreatic cancer samples in The Cancer Genome Atlas (TCGA). Using the co-expression method, we summarized 44 m6A/m5C/m1A-related genes and obtained 218 methylation-associated lncRNAs. Next, with COX regression, we screened 39 lncRNAs that are strongly associated with prognosis and found that their expression differed significantly between normal tissues and pancreatic cancer samples (P < 0.001). We then used the least absolute shrinkage and selection operator (LASSO) to construct a risk model comprising seven lncRNAs. In validation set, the nomogram generated by combining clinical characteristics accurately predicted the survival probability of pancreatic cancer patients at 1, 2, and 3 years after diagnosis (AUC = 0.652, 0.686, and 0.740, respectively). Tumor microenvironment analysis showed that the high-risk group had significantly more resting memory CD4 T cells, M0 macrophages, and activated dendritic cells and fewer naïve B cells, plasma cells, and CD8 T cells than the low-risk group (both P < 0.05). Most immune-checkpoint genes were significantly different between the high- and low-risk groups (P < 0.05). The Tumor Immune Dysfunction and Exclusion score showed that high-risk patients benefited more from treatment with immune checkpoint inhibitors (P < 0.001). Overall survival was also lower in high-risk patients with more tumor mutations than in low-risk patients with fewer mutations (P < 0.001). Finally, we explored the sensitivity of the high- and low-risk groups to seven candidate drugs. Our findings indicated that m6A/m5C/m1A-associated lncRNAs are potentially useful biomarkers for the early diagnosis and estimating the prognosis of, and ascertaining the responses to immunotherapy in, patients with pancreatic cancer.
Also flagged:cell homeostasiscolitisFibrosisinflammatory bowel diseaseLGR5membrane
Journal Article2023-03-04✓ 4 SnippetsHe S, Lei P, Kang W, Cheung P, Xu T, Mana M, Park CY, Wang H, Imada S, Russell JO, Wang J, Wang R, Zhou Z, Chetal K, Stas E, Mohad V, Bruun-Rasmussen P, Sadreyev RI, Hodin RA, Zhang Y, Breault DT, Camargo FD, Yilmaz ÖH, Fredberg JJ, Saeidi N.
In-Text Gene Mentions
Abstract)
…stem cell marker,OLFM4, became dominant in…
Abstract)
…the extension ofOLFM4+ cells into…
Text
…Olfactomedin-4…
Text
…OLFM4…
Show Full Abstract
<h4>Background & aims</h4>Fibrosis and tissue stiffening are hallmarks of inflammatory bowel disease (IBD). We have hypothesized that the increased stiffness directly contributes to the dysregulation of the epithelial cell homeostasis in IBD. Here, we aim to determine the impact of tissue stiffening on the fate and function of the intestinal stem cells (ISCs).<h4>Methods</h4>We developed a long-term culture system consisting of 2.5-dimensional intestinal organoids grown on a hydrogel matrix with tunable stiffness. Single-cell RNA sequencing provided stiffness-regulated transcriptional signatures of the ISCs and their differentiated progeny. YAP-knockout and YAP-overexpression mice were used to manipulate YAP expression. In addition, we analyzed colon samples from murine colitis models and human IBD samples to assess the impact of stiffness on ISCs in vivo.<h4>Results</h4>We demonstrated that increasing the stiffness potently reduced the population of LGR5<sup>+</sup> ISCs and KI-67<sup>+</sup>-proliferating cells. Conversely, cells expressing the stem cell marker, olfactomedin-4, became dominant in the crypt-like compartments and pervaded the villus-like regions. Concomitantly, stiffening prompted the ISCs to preferentially differentiate toward goblet cells. Mechanistically, stiffening increased the expression of cytosolic YAP, driving the extension of olfactomedin-4<sup>+</sup> cells into the villus-like regions, while it induced the nuclear translocation of YAP, leading to preferential differentiation of ISCs toward goblet cells. Furthermore, analysis of colon samples from murine colitis models and patients with IBD demonstrated cellular and molecular remodeling reminiscent of those observed in vitro.<h4>Conclusions</h4>Collectively, our findings highlight that matrix stiffness potently regulates the stemness of ISCs and their differentiation trajectory, supporting the hypothesis that fibrosis-induced gut stiffening plays a direct role in epithelial remodeling in IBD.
Also flagged:adipocyte differentiationperoxisome proliferator-activated receptor γPPARγbindinglipidmetabolism
Journal Article2023-03-04✓ 5 SnippetsJiang S, Meng X, Gu H, Sun J, Sun J, Chen S, Chen Z, Liu D, Liang X.
In-Text Gene Mentions
Abstract)
…We further demonstrated that STAU1 can regulate the alternative splicing of Pparγ2 pre-mRNA and affect the splicing of exon E1 through RNA immuno-precipitation, photoactivatable ribonucleotide enhanced crosslinking and immunoprecipitation, and sucrose density gradient centrifugation assays.…
Title)
…STAU1promotes adipogenesis by…
Abstract)
…sites for STAUFEN1 (STAU1), which can affect…
Abstract)
…we hypothesized thatSTAU1might regulate the…
Abstract)
…we found thatSTAU1affects the differentiation…
Show Full Abstract
During adipocyte differentiation, specific genes such as peroxisome proliferator-activated receptor γ (PPARγ) are transcribed and post-transcriptional pre-mRNA is processed into mature mRNA. Since Pparγ2 pre-mRNAs contain putative binding sites for STAUFEN1 (STAU1), which can affect the alternative splicing of pre-mRNA, we hypothesized that STAU1 might regulate the alternative splicing of Pparγ2 pre-mRNA. In this study, we found that STAU1 affects the differentiation of 3 T3-L1 pre-adipocytes. Through RNA-seq analysis, we confirmed that STAU1 can regulate alternative splicing events during adipocyte differentiation, mainly through exon skipping, which suggests that STAU1 is mainly involved in exon splicing. In addition, gene annotation and cluster analysis revealed that the genes affected by alternative splicing were enriched in lipid metabolism pathways. We further demonstrated that STAU1 can regulate the alternative splicing of Pparγ2 pre-mRNA and affect the splicing of exon E1 through RNA immuno-precipitation, photoactivatable ribonucleotide enhanced crosslinking and immunoprecipitation, and sucrose density gradient centrifugation assays. Finally, we confirmed that STAU1 can regulate the alternative splicing of Pparγ2 pre-mRNA in stromal vascular fraction cells. In summary, this study improves our understanding of the function of STAU1 in adipocyte differentiation and the regulatory network of adipocyte differentiation-related gene expression.
Ferroptosis is a form of regulated cell death that is intricately linked to cellular metabolism. In the forefront of research on ferroptosis, the peroxidation of polyunsaturated fatty acids has emerged as a key driver of oxidative damage to cellular membranes leading to cell death. Here, we review the involvement of polyunsaturated fatty acids (PUFAs), monounsaturated fatty acids (MUFAs), lipid remodeling enzymes and lipid peroxidation in ferroptosis, highlighting studies revealing how using the multicellular model organism <i>Caenorhabditis elegans</i> contributes to the understanding of the roles of specific lipids and lipid mediators in ferroptosis.
Also flagged:Breast Cancermetastatic diseasemetastatic cancercancerimmune responseTumor
Journal Article2023-03-04✓ 5 SnippetsRuggieri L, Moretti A, Berardi R, Cona MS, Dalu D, Villa C, Chizzoniti D, Piva S, Gambaro A, La Verde N.
In-Text Gene Mentions
Introduction)
…In humans, only indirect observations suggest that DCC initiates metastasis in BC.…
Introduction)
…Furthermore, when inoculated into mice, the outgrowth of BC stem cells with metastasizing capacity depends on the expression of specific factors in the host tissues, so the invasion of different sites is mainly related to the DCC adaptability to organ-specific niches [27].…
A significant proportion of patients treated for early breast cancer develop medium-term and late distant recurrence. The delayed manifestation of metastatic disease is defined as "dormancy". This model describes the aspects of the clinical latency of isolated metastatic cancer cells. Dormancy is regulated by extremely complex interactions between disseminated cancer cells and the microenvironment where they reside, the latter in turn influenced directly by the host. Among these entangled mechanisms, inflammation and immunity may play leading roles. This review is divided into two parts: the first describes the biological underpinnings of cancer dormancy and the role of the immune response, in particular, for breast cancer; the second provides an overview of the host-related factors that may influence systemic inflammation and immune response, subsequently impacting the dynamics of breast cancer dormancy. The aim of this review is to provide physicians and medical oncologists a useful tool to understand the clinical implications of this relevant topic.
All-trans-retinoic Acid (atRA) is the principal active metabolite of Vitamin A, essential for various biological processes. The activities of atRA are mediated by nuclear RA receptors (RARs) to alter gene expression (canonical activities) or by cellular retinoic acid binding protein 1 (CRABP1) to rapidly (minutes) modulate cytosolic kinase signaling, including calcium calmodulin-activated kinase 2 (CaMKII) (non-canonical activities). Clinically, atRA-like compounds have been extensively studied for therapeutic applications; however, RAR-mediated toxicity severely hindered the progress. It is highly desirable to identify CRABP1-binding ligands that lack RAR activity. Studies of CRABP1 knockout (CKO) mice revealed CRABP1 to be a new therapeutic target, especially for motor neuron (MN) degenerative diseases where CaMKII signaling in MN is critical. This study reports a P19-MN differentiation system, enabling studies of CRABP1 ligands in various stages of MN differentiation, and identifies a new CRABP1-binding ligand C32. Using the P19-MN differentiation system, the study establishes C32 and previously reported C4 as CRABP1 ligands that can modulate CaMKII activation in the P19-MN differentiation process. Further, in committed MN cells, elevating CRABP1 reduces excitotoxicity-triggered MN death, supporting a protective role for CRABP1 signaling in MN survival. C32 and C4 CRABP1 ligands were also protective against excitotoxicity-triggered MN death. The results provide insight into the potential of signaling pathway-selective, CRABP1-binding, atRA-like ligands in mitigating MN degenerative diseases.
Also flagged:cell adhesionmetalsaluminahydroxyapatitedegradationbinding
Journal Article2023-03-04No SnippetsVaiani L, Boccaccio A, Uva AE, Palumbo G, Piccininni A, Guglielmi P, Cantore S, Santacroce L, Charitos IA, Ballini A.
Show Full Abstract
A growing interest in creating advanced biomaterials with specific physical and chemical properties is currently being observed. These high-standard materials must be capable to integrate into biological environments such as the oral cavity or other anatomical regions in the human body. Given these requirements, ceramic biomaterials offer a feasible solution in terms of mechanical strength, biological functionality, and biocompatibility. In this review, the fundamental physical, chemical, and mechanical properties of the main ceramic biomaterials and ceramic nanocomposites are drawn, along with some primary related applications in biomedical fields, such as orthopedics, dentistry, and regenerative medicine. Furthermore, an in-depth focus on bone-tissue engineering and biomimetic ceramic scaffold design and fabrication is presented.
bioRxiv2023-03-04Preprint (No Snippets API)Soylu-Kucharz R, Adlesic N, Davidsson M, Björklund T, Björkqvist M, Petersén Å.
Show Full Abstract
Huntington’s disease is a fatal neurodegenerative disorder caused by an expanded CAG triplet repeat in the huntingtin (HTT) gene. Previous research focused on neuropathology in the striatum and its association with a typical movement disorder. Direct effects of mutant HTT (mHTT) in the striatum may cause neuropathology, although non-cell autonomous effects have also been suggested. Important non-motor features of HD include psychiatric symptoms and metabolic dysfunction, which may be linked to hypothalamic neuropathology. As hypothalamic neurons project to the ventral striatum, we hypothesized that expression of mHTT in the hypothalamus leads to disrupted neurotransmission in the ventral striatum and causes pathology. The overall aim of this study was to investigate the impact of mHTT expression in the hypothalamus on ventral striatal neuropathology and its contribution to non-HD motor symptoms. We demonstrate that selective expression of mHTT in the hypothalamus leads to the loss of dopamine and cAMP-regulated phosphoprotein (DARPP-32) immunopositive neurons in the ventral striatum in mice. Contrary to the effects of direct expression of mHTT in the hypothalamus, selective overexpression of mHTT in the ventral striatum does not affect body weight. Selective expression of mHTT in the ventral striatum leads to mHTT inclusion formation and loss of DARPP-32 neurons without affecting motor activity or anxiety-like behavior. We show that DARPP-32 neuron loss in the ventral striatum is recapitulated in the R6/2 mouse model of HD. Chemogenetic activation of hypothalamic neurons projecting to the ventral striatum had a blunted response in the R6/2 mice compared to wild-type mice, indicating a disrupted hypothalamus-ventral striatal circuitry. In summary, the expression of mHTT in the hypothalamus may impact the development of ventral striatal pathology in mice. This opens the possibility that non-cell-autonomous effects in the reward circuitry play a role in HD.
…Only Brn2 (N-Oct-3, POU3F2) protein, a known repressor of MITF (36), noticeably decreased in five of six cell lines, suggesting that its transcription may also be regulated by the HH pathway in most melanomas.…
Results)
…Only Brn2 (N-Oct-3,POU3F2) protein, a known…
Show Full Abstract
In melanoma and other cancers, invasion, epithelial-to-mesenchymal transition, metastasis and cancer stem cell maintenance are regulated by transcription factors including the Snail family. Slug (Snail2) protein generally supports migration and apoptosis resistance. However, its role in melanoma is not completely understood. The present study investigated the transcriptional regulation of the <i>SLUG</i> gene in melanoma. It demonstrated that <i>SLUG</i> is under the control of the Hedgehog/GLI signaling pathway and is activated predominantly by the transcription factor GLI2. The <i>SLUG</i> gene promoter contains a high number of GLI-binding sites. Slug expression is activated by GLI factors in reporter assays and inhibited by GANT61 (GLI inhibitor) and cyclopamine (SMO inhibitor). <i>SLUG</i> mRNA levels are lowered by GANT61 as assessed by reverse transcription-quantitative PCR. Chromatin immunoprecipitation revealed abundant binding of factors GLI1-3 in the four subregions of the proximal SLUG promoter. Notably, melanoma-associated transcription factor (MITF) is an imperfect activator of the <i>SLUG</i> promoter in reporter assays, and downregulation of MITF had no effect on endogenous Slug protein levels. Immunohistochemical analysis confirmed the above findings and showed MITF-negative regions in metastatic melanoma that were positive for GLI2 and Slug. Taken together, the results demonstrated a previously unrecognized transcriptional activation mechanism of the <i>SLUG</i> gene, which may represent its main regulation of expression in melanoma cells.
Also flagged:peptidevirionsbindingcyclic peptidereceptor binding proteinsantibody
Journal Article2023-03-03No SnippetsWang R, Li HD, Cao Y, Wang ZY, Yang T, Wang JH.
Show Full Abstract
Viruses are changing the biosensing and biomedicine landscape due to their multivalency, orthogonal reactivities, and responsiveness to genetic modifications. As the most extensively studied phage model for constructing a phage display library, M13 phage has received much research attention as building blocks or viral scaffolds for various applications including isolation/separation, sensing/probing, and in vivo imaging. Through genetic engineering and chemical modification, M13 phages can be functionalized into a multifunctional analysis platform with various functional regions conducting their functionality without mutual disturbance. Its unique filamentous morphology and flexibility also promoted the analytical performance in terms of target affinity and signal amplification. In this review, we mainly focused on the application of M13 phage in the analytical field and the benefit it brings. We also introduced several genetic engineering and chemical modification approaches for endowing M13 with various functionalities, and summarized some representative applications using M13 phages to construct isolation sorbents, biosensors, cell imaging probes, and immunoassays. Finally, current issues and challenges remaining in this field were discussed and future perspectives were also proposed.
Also flagged:Tumor suppressor p53heat shock factor 1transcription factorscell proliferationcancercancers
Journal Article2023-03-03✓ 3 SnippetsMansky RH, Greguske EA, Yu D, Zarate N, Intihar TA, Tsai W, Brown TG, Thayer MN, Kumar K, Gomez-Pastor R.
In-Text Gene Mentions
Abstract)
…Using cellular and animal models of HD, we show that mutant HTT stabilized p53 by abrogating the interaction between p53 and E3 ligase MDM2.…
Text
…HTT…
Text
…Abt1…
Show Full Abstract
p53 and HSF1 are two major transcription factors involved in cell proliferation and apoptosis, whose dysregulation contributes to cancer and neurodegeneration. Contrary to most cancers, p53 is increased in Huntington's disease (HD) and other neurodegenerative diseases, while HSF1 is decreased. p53 and HSF1 reciprocal regulation has been shown in different contexts, but their connection in neurodegeneration remains understudied. Using cellular and animal models of HD, we show that mutant HTT stabilized p53 by abrogating the interaction between p53 and E3 ligase MDM2. Stabilized p53 promotes protein kinase CK2 alpha prime and E3 ligase FBXW7 transcription, both of which are responsible for HSF1 degradation. Consequently, p53 deletion in striatal neurons of zQ175 HD mice restores HSF1 abundance and decrease HTT aggregation and striatal pathology. Our work shows the mechanism connecting p53 stabilization with HSF1 degradation and pathophysiology in HD and sheds light on the broader molecular differences and commonalities between cancer and neurodegeneration.
Also flagged:Gallbladder Cancercisplatingemcitabine5-fluorouracilDNA damage repair-related proteinsCHK1
Journal Article2023-03-03✓ 1 SnippetLai J, Yang S, Lin Z, Huang W, Li X, Li R, Tan J, Wang W.
In-Text Gene Mentions
S I O 001029)
…CRT knockdown not only inhibits GBC cell proliferation and promotes apoptosis, but also increases the sensitivity of gallbladder carcinomas to GEM.17 Upregulated SSTR5-AS1 promotes GEM resistance in GBC by inhibiting apoptosis.20 MiR-1231 overexpression attenuates the proliferative potential of GBC cells and both induces apoptosis and enhances GBC sensitivity to docetaxel.38 OLFM4 downregulation reduces the expression of ARL6IP1, an antiapoptotic factor, and sensitizes GBC cells to cisplatin in vitro and in vivo.36 while XRCC1 knockdown significantly increases the sensitivity of CD133+ GBC cells to 5-FU by promoting apoptosis.40…
Show Full Abstract
<h4>Objective</h4>Gallbladder cancer (GBC) mortality remains high and chemoresistance is increasing. This review consolidates what is known about the mechanisms of chemoresistance to inform and accelerate the development of novel GBC-specific chemotherapies.<h4>Methods</h4>Studies related to GBC-related chemoresistance were systematically screened in PubMed using the advanced search function. Search terms included GBC, chemotherapy, and signaling pathway.<h4>Results</h4>Analysis of existing studies showed that GBC has poor sensitivity to cisplatin, gemcitabine (GEM), and 5-fluorouracil. DNA damage repair-related proteins, including CHK1, V-SCR, and H2AX, are involved in tumor adaptation to drugs. GBC-specific chemoresistance is often accompanied by changes in the apoptosis and autophagy-related molecules, BCL-2, CRT, and GBCDRlnc1. CD44 + and CD133 + GBC cells are less resistant to GEM, indicating that tumor stem cells are also involved in chemoresistance. In addition, glucose metabolism, fat synthesis, and glutathione metabolism can influence the development of drug resistance. Finally, chemosensitizers such as lovastatin, tamoxifen, chloroquine, and verapamil are able improve the therapeutic effect of cisplatin or GEM in GBC.<h4>Conclusions</h4>This review summarizes recent experimental and clinical studies of the molecular mechanisms of chemoresistance, including autophagy, DNA damage, tumor stem cells, mitochondrial function, and metabolism, in GBC. Information on potential chemosensitizers is also discussed. The proposed strategies to reverse chemoresistance should inform the clinical use of chemosensitizers and gene-based targeted therapy for this disease.
Also flagged:ARFMYCMYCNMedulloblastomapediatric brain tumorp53
Journal Article2023-03-03✓ 1 SnippetMainwaring OJ, Weishaupt H, Zhao M, Rosén G, Borgenvik A, Breinschmid L, Verbaan AD, Richardson S, Thompson D, Clifford SC, Hill RM, Annusver K, Sundström A, Holmberg KO, Kasper M, Hutter S, Swartling FJ.
In-Text Gene Mentions
Results)
…factors, such asPou3f2, Sall2 ,…
Show Full Abstract
Medulloblastoma, the most common malignant pediatric brain tumor, often harbors MYC amplifications. Compared to high-grade gliomas, MYC-amplified medulloblastomas often show increased photoreceptor activity and arise in the presence of a functional ARF/p53 suppressor pathway. Here, we generate an immunocompetent transgenic mouse model with regulatable MYC that develop clonal tumors that molecularly resemble photoreceptor-positive Group 3 medulloblastoma. Compared to MYCN-expressing brain tumors driven from the same promoter, pronounced ARF silencing is present in our MYC-expressing model and in human medulloblastoma. While partial Arf suppression causes increased malignancy in MYCN-expressing tumors, complete Arf depletion promotes photoreceptor-negative high-grade glioma formation. Computational models and clinical data further identify drugs targeting MYC-driven tumors with a suppressed but functional ARF pathway. We show that the HSP90 inhibitor, Onalespib, significantly targets MYC-driven but not MYCN-driven tumors in an ARF-dependent manner. The treatment increases cell death in synergy with cisplatin and demonstrates potential for targeting MYC-driven medulloblastoma.
Also flagged:netrin-1glycosaminoglycanaxoncell migrationheparansulfate proteoglycans
Journal Article2023-03-03✓ 5 SnippetsMeier M, Gupta M, Akgül S, McDougall M, Imhof T, Nikodemus D, Reuten R, Moya-Torres A, To V, Ferens F, Heide F, Padilla-Meier GP, Kukura P, Huang W, Gerisch B, Mörgelin M, Poole K, Antebi A, Koch M, Stetefeld J.
In-Text Gene Mentions
Methods)
…NET1ΔC consisting of domains LN and LE (a.k.a. VI and V domains), full-length NET1 and the dependence receptors DCC, neogenin and UNC5B were expressed using the inducible sleeping beauty transposon system in human embryonic kidney (HEK) 293 T cells with a BM40 signal peptide and a N- or C-terminal Twin-Strep-tag or 8 histidine tag (Gallus gallus full length NET1 NP_990750 aa 26-606, Gallus gallus NET1ΔC NP_990750 aa 26-458, Gallus gallus NET1ΔC R350 R351 NP_990750 aa 26-458 R350A R351A, Gallus gallus NET1ΔC loop ab NP_990750 aa 26-458 R350A R351A R353A N355A, Gallus gallus NET1ΔC loop abcd NP_990750 aa 26-458 R350A R351A R353A N355A R374A H375A K395A H399A R400A K401A, Gallus gallus NET1ΔC loop cd NP_990750 aa 26-458 R374A H375A K395A H399A R400A K401A, Mus musculus NET1ΔC NP_032770 aa 24-457, Mus musculus NET1ΔC NP_032770 aa 24-457 R348A R349A, UNC5B NP_001346202 aa 25-304, Rattus norvegicus DCC short XP_017456347 aa 26-1077, DCC short NP_031857.2 aa 530-1024, Rattus norvegicus DCC long NP_036973.1 aa 26-1097, DCC long NP_031857.2 aa 530-1044, Mus musculus neogenin short NP_001036217.1 aa 42-1069, Mus musculus neogenin short NP_001036217.1 aa 573-1069, Mus musculus neogenin long NP_032710.2 aa 42-1085, Mus musculus neogenin long NP_032710.2 aa 573-1087, testican-1 NP_033288 aa 22-442, testican-2 NP_443720 aa 23-423, SMOC-1 NP_071711 aa 26-452, SMOC-2 NP_071710 22-447, syndecan-2 NP_032330 aa 19-146, syndecan-3 XP_017175579 aa 22-361, glypican-3 AF185614 aa 25-557 R357A, glypican-5 NP_780709 aa 25-549)21,29,49.…
Netrin-1 is a bifunctional chemotropic guidance cue that plays key roles in diverse cellular processes including axon pathfinding, cell migration, adhesion, differentiation, and survival. Here, we present a molecular understanding of netrin-1 mediated interactions with glycosaminoglycan chains of diverse heparan sulfate proteoglycans (HSPGs) and short heparin oligosaccharides. Whereas interactions with HSPGs act as platform to co-localise netrin-1 close to the cell surface, heparin oligosaccharides have a significant impact on the highly dynamic behaviour of netrin-1. Remarkably, the monomer-dimer equilibrium of netrin-1 in solution is abolished in the presence of heparin oligosaccharides and replaced with highly hierarchical and distinct super assemblies leading to unique, yet unknown netrin-1 filament formation. In our integrated approach we provide a molecular mechanism for the filament assembly which opens fresh paths towards a molecular understanding of netrin-1 functions.
Also flagged:ribonucleoside monophosphatesRNase H2ribonucleotidereplication forkscell cycleTop1
Journal Article2023-03-03✓ 1 SnippetSchindler N, Tonn M, Kellner V, Fung JJ, Lockhart A, Vydzhak O, Juretschke T, Möckel S, Beli P, Khmelinskii A, Luke B.
In-Text Gene Mentions
Discussion)
…MRN, RAD51, andMMS22L-TONSL were found to…
Show Full Abstract
Single ribonucleoside monophosphates (rNMPs) are transiently present in eukaryotic genomes. The RNase H2-dependent ribonucleotide excision repair (RER) pathway ensures error-free rNMP removal. In some pathological conditions, rNMP removal is impaired. If these rNMPs hydrolyze during, or prior to, S phase, toxic single-ended double-strand breaks (seDSBs) can occur upon an encounter with replication forks. How such rNMP-derived seDSB lesions are repaired is unclear. We expressed a cell cycle phase restricted allele of RNase H2 to nick at rNMPs in S phase and study their repair. Although Top1 is dispensable, the RAD52 epistasis group and Rtt101<sup>Mms1-Mms22</sup> dependent ubiquitylation of histone H3 become essential for rNMP-derived lesion tolerance. Consistently, loss of Rtt101<sup>Mms1-Mms22</sup> combined with RNase H2 dysfunction leads to compromised cellular fitness. We refer to this repair pathway as nick lesion repair (NLR). The NLR genetic network may have important implications in the context of human pathologies.
Also flagged:HOXC13skin injurygene expressionwound healingkeratinocyte differentiationEGFR
Journal Article2023-03-03✓ 1 SnippetZhang L, Piipponen M, Liu Z, Li D, Bian X, Niu G, Geara J, Toma MA, Sommar P, Xu Landén N.
In-Text Gene Mentions
Discussion)
…binds to theSTAU1protein, thus stabilizing…
Show Full Abstract
After a skin injury, keratinocytes switch from a state of homeostasis to one of regeneration leading to the reconstruction of the epidermal barrier. The regulatory mechanism of gene expression underpinning this key switch during human skin wound healing is enigmatic. Long noncoding RNAs (lncRNAs) constitute a new horizon in the understanding of the regulatory programs encoded in the mammalian genome. By comparing the transcriptome of an acute human wound and skin from the same donor as well as keratinocytes isolated from these paired tissue samples, we generated a list of lncRNAs showing changed expression in keratinocytes during wound repair. Our study focused on HOXC13-AS, a recently evolved human lncRNA specifically expressed in epidermal keratinocytes, and we found that its expression was temporally downregulated during wound healing. In line with its enrichment in suprabasal keratinocytes, HOXC13-AS was found to be increasingly expressed during keratinocyte differentiation, but its expression was reduced by EGFR signaling. After HOXC13-AS knockdown or overexpression in human primary keratinocytes undergoing differentiation induced by cell suspension or calcium treatment and in organotypic epidermis, we found that HOXC13-AS promoted keratinocyte differentiation. Moreover, RNA pull-down assays followed by mass spectrometry and RNA immunoprecipitation analysis revealed that mechanistically HOXC13-AS sequestered the coat complex subunit alpha (COPA) protein and interfered with Golgi-to-endoplasmic reticulum (ER) molecular transport, resulting in ER stress and enhanced keratinocyte differentiation. In summary, we identified HOXC13-AS as a crucial regulator of human epidermal differentiation.
Also flagged:type 2 diabetespathogenesisglucoseinsulinC-peptidehyperglycemia
Journal Article2023-03-03✓ 2 SnippetsDa'as SI, Ahmed I, Hasan WH, Abdelrahman DA, Aliyev E, Nisar S, Bhat AA, Joglekar MV, Hardikar AA, Fakhro KA, Akil ASA.
In-Text Gene Mentions
Introduction)
…SRY-box 6 (SOX6) signaling […
Discussion)
…via Foxo1 andSox6signaling cascades […
Show Full Abstract
<h4>Background</h4>Type 2 diabetes (T2D) is a critical healthcare challenge and priority in Qatar which is listed amongst the top 10 countries in the world, with its prevalence presently at 17% double the global average. MicroRNAs (miRNAs) are implicated in the pathogenesis of (T2D) and long-term microvascular complications including diabetic retinopathy (DR).<h4>Methods</h4>In this study, a T2D cohort that accurately matches the characteristics of the general population was employed to find microRNA (miRNA) signatures that are correlated with glycemic and β cell function measurements. Targeted miRNA profiling was performed in (471) T2D individuals with or without DR and (491) (non-diabetic) healthy controls from the Qatar Biobank. Discovery analysis identified 20 differentially expressed miRNAs in T2D compared to controls, of which miR-223-3p was significantly upregulated (fold change:5.16, p = 3.6e-02) and positively correlated with glucose and hemoglobin A1c (HbA1c) levels (p-value = 9.88e-04 and 1.64e-05, respectively), but did not show any significant associations with insulin or C-peptide. Accordingly, we performed functional validation using a miR-223-3p mimic (overexpression) under control and hyperglycemia-induced conditions in a zebrafish model.<h4>Results</h4>Over-expression of miR-223-3p alone was associated with significantly higher glucose (42.7 mg/dL, n = 75 vs 38.7 mg/dL, n = 75, p = 0.02) and degenerated retinal vasculature, and altered retinal morphology involving changes in the ganglion cell layer and inner and outer nuclear layers. Assessment of retinal angiogenesis revealed significant upregulation in the expression of vascular endothelial growth factor and its receptors, including kinase insert domain receptor. Further, the pancreatic markers, pancreatic and duodenal homeobox 1, and the insulin gene expressions were upregulated in the miR-223-3p group.<h4>Conclusion</h4>Our zebrafish model validates a novel correlation between miR-223-3p and DR development. Targeting miR-223-3p in T2D patients may serve as a promising therapeutic strategy to control DR in at-risk individuals.
Also flagged:methylationcardiovascular diseaseDBPNotchp53glucose
Journal Article2023-03-03✓ 1 SnippetWang W, Yao J, Li W, Wu Y, Duan H, Xu C, Tian X, Li S, Tan Q, Zhang D.
In-Text Gene Mentions
Introduction)
…, ATP2B1 ,SOX6, CHIC2 ,…
Show Full Abstract
<h4>Background</h4>Hypertension is a crucial risk factor for developing cardiovascular disease and reducing life expectancy. We aimed to detect DNA methylation (DNAm) variants potentially related to systolic blood pressure (SBP) and diastolic blood pressure (DBP) by conducting epigenome-wide association studies in 60 and 59 Chinese monozygotic twin pairs, respectively.<h4>Methods</h4>Genome-wide DNA methylation profiling in whole blood of twins was performed using Reduced Representation Bisulfite Sequencing, yielding 551,447 raw CpGs. Association between DNAm of single CpG and blood pressure was tested by applying generalized estimation equation. Differentially methylated regions (DMRs) were identified by comb-P approach. Inference about Causation through Examination of Familial Confounding was utilized to perform the causal inference. Ontology enrichment analysis was performed using Genomic Regions Enrichment of Annotations Tool. Candidate CpGs were quantified using Sequenom MassARRAY platform in a community population. Weighted gene co-expression network analysis (WGCNA) was conducted using gene expression data.<h4>Results</h4>The median age of twins was 52 years (95% range 40, 66). For SBP, 31 top CpGs (p < 1 × 10<sup>-4</sup>) and 8 DMRs were identified, with several DMRs within NFATC1, CADM2, IRX1, COL5A1, and LRAT. For DBP, 43 top CpGs (p < 1 × 10<sup>-4</sup>) and 12 DMRs were identified, with several DMRs within WNT3A, CNOT10, and DAB2IP. Important pathways, such as Notch signaling pathway, p53 pathway by glucose deprivation, and Wnt signaling pathway, were significantly enriched for SBP and DBP. Causal inference analysis suggested that DNAm at top CpGs within NDE1, MYH11, SRRM1P2, and SMPD4 influenced SBP, while SBP influenced DNAm at CpGs within TNK2. DNAm at top CpGs within WNT3A influenced DBP, while DBP influenced DNAm at CpGs within GNA14. Three CpGs mapped to WNT3A and one CpG mapped to COL5A1 were validated in a community population, with a hypermethylated and hypomethylated direction in hypertension cases, respectively. Gene expression analysis by WGCNA further identified some common genes and enrichment terms.<h4>Conclusion</h4>We detect many DNAm variants that may be associated with blood pressure in whole blood, particularly the loci within WNT3A and COL5A1. Our findings provide new clues to the epigenetic modification underlying hypertension pathogenesis.
Also flagged:constipationMotilinghrelinserotoninacetylcholinenitric oxide
Journal Article2023-03-03✓ 5 SnippetsArslan B, Dogan G, Orenay-Boyacioglu S, Caliskan M, Elevli M.
In-Text Gene Mentions
Discussion)
…For example, no difference was found in terms of polymorphism in the integral membrane protein SLC6A4 (5-HTT) involved in the presynaptic neuronal transfer of serotonin from the synaptic area in irritable bowel disease15.…
Methods)
…In the study, polymorphisms [motilin-MLN (rs2281820), serotonin receptor-HTR3A (rs1062613), serotonin transporter-5-HTT (rs1042173), ghrelin-GHRL (rs27647), and ghrelin receptor-GHSR (rs572169)] that are thought to be related to patients diagnosed with functional constipation and are found to be associated with some gastrointestinal diseases were selected.…
<h4>Objective</h4>Functional constipation is the most common form of constipation, and its exact aetiology is still unclear. However, it is known that deficiencies in hormonal factors cause constipation by changing physiological mechanisms. Motilin, ghrelin, serotonin acetylcholine, nitric oxide, and vasoactive intestinal polypeptide are factors that play a role in colon motility. There are a limited number of studies in the literature where hormone levels and gene polymorphisms of serotonin and motilin are examined. Our study aimed to investigate the role of motilin, ghrelin, and serotonin gene/receptor/transporter polymorphisms in constipation pathogenesis in patients diagnosed with functional constipation according to the Rome 4 criteria.<h4>Methods</h4>Sociodemographic data, symptom duration, accompanying findings, the presence of constipation in the family, Rome 4 criteria, and clinical findings according to Bristol scale of 200 cases (100 constipated patients and 100 healthy control) who applied to Istanbul Haseki Training and Research Hospital, Pediatric Gastroenterology Outpatient Clinic, between March and September 2019 (6-month period) were recorded. Polymorphisms of motilin-MLN (rs2281820), serotonin receptor-HTR3A (rs1062613), serotonin transporter-5-HTT (rs1042173), ghrelin-GHRL (rs27647), and ghrelin receptor-GHSR (rs572169) were detected by real-time PCR.<h4>Results</h4>There was no difference between the two groups in terms of sociodemographic characteristics. Notably, 40% of the constipated group had a family history of constipation. The number of patients who started to have constipation under 24 months was 78, and the number of patients who started to have constipation after 24 months was 22. There was no significant difference between constipation and control groups in terms of genotype and allele frequencies in MLN, HTR3A, 5-HTT, GHRL, and GHSR polymorphisms (p<0.05). Considering only the constipated group, the rates of gene polymorphism were similar among those with/without a positive family history of constipation, constipation onset age, those with/without fissures, those with/without skin tag, and those with type 1/type 2 stool types according to the Bristol stool scale.<h4>Conclusion</h4>Our study results showed that gene polymorphisms of these three hormones may not be related to constipation in children.
Accumulating evidence has revealed many clues that regular aerobic exercise benefits brain health and behaviors. The aims of this study were to explore the effect of aerobic exercise on ejaculatory behaviors, as well as to make a preliminary assessment of aerobic exercise as a complementary strategy to dapoxetine treatment in rapid ejaculators. Copulatory tests of rats and a treadmill training protocol were performed in this study. In total, 12 rapid ejaculators were selected on the basis of ejaculation distribution theory and randomly assigned to 4 groups: control (Ctrol) group, aerobic exercise (Ex) group, dapoxetine (Dapo) group, and Ex+Dapo group. We evaluated the changes in ejaculatory parameters in the 4 groups. Variations in biological markers, including serum corticosterone, serotonin (5-HT), and brain-derived neurotrophic factor (BDNF) of the raphe nucleus, were determined by enzyme-linked immunosorbent assay (ELISA). The primary finding of our study was that both aerobic exercise and acute dapoxetine could enhance ejaculation control and prolong ejaculation latency in rapid ejaculator rats. The ejaculation delay effect of aerobic exercise was nearly equivalent to that of acute dapoxetine. In addition, both aerobic exercise and dapoxetine treatment could lead to increased expression of BDNF and 5-HT in the raphe nucleus of rapid ejaculators. Moreover, the two interventions, when applied together, may further upregulate the expression of BDNF-5-HT duo in a complementary manner. This study highlights the positive effects of aerobic exercise on ejaculation control. Regular aerobic exercise might be a promising complementary treatment to dapoxetine in rats.
Also flagged:metabolismgene expressiondigestionRPS15RPS23HMGCS2
Journal Article2023-03-03✓ 5 SnippetsMin Q, Yang L, Wang Y, Liu Y, Jiang M.
In-Text Gene Mentions
Abstract)
…RPS15 ,MRPL39, and RPS23…
Abstract)
…that RPS15 ,MRPL39and RPS23 are…
Abstract)
…combining RPS15 ,MRPL39and RPS23 as…
Methods)
…protein L39 (MRPL39) and TATA…
Results)
…, PPP1R11 ,MRPL39and TBP were…
Show Full Abstract
Efficient nutritional assimilation and energy metabolism in the stomachs of yaks contribute to their adaption to harsh environments. Accurate gene expression profile analysis will help further reveal the molecular mechanism of nutrient and energy metabolism in the yak stomach. RT-qPCR is regarded as an accurate and dependable method for analyzing gene expression. The selection of reference genes is essential to obtain meaningful RT-qPCR results, especially in longitudinal gene expression studies of tissues and organs. Our objective was to select and validate optimal reference genes from across the transcriptome as internal controls for longitudinal gene expression studies in the yak stomach. In this study, 15 candidate reference genes (CRGs) were determined according to transcriptome sequencing (RNA-seq) results and the previous literature. The expression levels of these 15 CRGs were quantified using RT-qPCR in the yak stomach, including the rumen, reticulum, omasum and abomasum at five stages: 0 days, 20 days, 60 days, 15 months and three years old (adult). Subsequently, the expression stabilities of these 15 CRGs were evaluated via four algorithms: geNorm, NormFinder, BestKeeper and the comparative C<sub>T</sub> method. Furthermore, RefFinder was employed to obtain a comprehensive ranking of the stability of CRGs. The analysis results indicate that <i>RPS15</i>, <i>MRPL39</i> and <i>RPS23</i> are the most stable genes in the yak stomach throughout the growth cycle. In addition, to verify the reliability of the selected CRGs, the relative expression levels of <i>HMGCS2</i> were quantified via RT-qPCR using the three most stable or the three least stable CRGs. Overall, we recommend combining <i>RPS15</i>, <i>MRPL39</i> and <i>RPS23</i> as reference genes for the normalization of RT-qPCR data in the yak stomach throughout the growth cycle.
Also flagged:VRK1 KinaseHistone H4K16chromatinorganizationhistonemodifications
Journal Article2023-03-03✓ 1 SnippetMonte-Serrano E, Lazo PA.
In-Text Gene Mentions
Results)
…lesser extent forVRK2[ 41 ,…
Show Full Abstract
The accessibility of DNA to different cellular functions requires a dynamic regulation of chromatin organization that is mediated by different epigenetic modifications, which regulate chromatin accessibility and degree of compaction. These epigenetic modifications, particularly the acetylation of histone H4 in lysine 14 (H4K16ac), determine the degree of chromatin accessibility to different nuclear functions, as well as to DNA damage drugs. H4K16ac is regulated by the balance between two alternative histone modifications, acetylation and deacetylation, which are mediated by acetylases and deacetylases. Tip60/KAT5 acetylates, and SIRT2 deacetylates histone H4K16. However, the balance between these two epigenetic enzymes is unknown. VRK1 regulates the level of H4K16 acetylation by activating Tip60. We have shown that the VRK1 and SIRT2 are able to form a stable protein complex. For this work, we used in vitro interaction, pull-down and in vitro kinase assays. In cells, their interaction and colocalization were detected by immunoprecipitation and immunofluorescence. The kinase activity of VRK1 is inhibited by a direct interaction of its N-terminal kinase domain with SIRT2 in vitro. This interaction causes a loss of H4K16ac similarly to the effect of a novel VRK1 inhibitor (VRK-IN-1) or VRK1 depletion. The use of specific SIRT2 inhibitors in lung adenocarcinoma cells induces H4K16ac, contrary to the novel VRK-IN-1 inhibitor, which prevents H4K16ac and a correct DNA damage response. Therefore, the inhibition of SIRT2 can cooperate with VRK1 in the accessibility of drugs to chromatin in response to DNA damage caused by doxorubicin.
Also flagged:HistoneReplicationnucleosomepathogenesiscancerposttranslational modifications
Journal Article2023-03-03No SnippetsZhang Y, Zhang Q, Zhang Y, Han J.
Show Full Abstract
Histone modification regulates replication-coupled nucleosome assembly, DNA damage repair, and gene transcription. Changes or mutations in factors involved in nucleosome assembly are closely related to the development and pathogenesis of cancer and other human diseases and are essential for maintaining genomic stability and epigenetic information transmission. In this review, we discuss the role of different types of histone posttranslational modifications in DNA replication-coupled nucleosome assembly and disease. In recent years, histone modification has been found to affect the deposition of newly synthesized histones and the repair of DNA damage, further affecting the assembly process of DNA replication-coupled nucleosomes. We summarize the role of histone modification in the nucleosome assembly process. At the same time, we review the mechanism of histone modification in cancer development and briefly describe the application of histone modification small molecule inhibitors in cancer therapy.
Also flagged:ethanolbehavioralchromatinmethylationhistoneRNA Polymerase II
Journal Article2023-03-03✓ 1 SnippetBrocato ER, Wolstenholme JT.
In-Text Gene Mentions
Results)
…Grm7, Brsk1, Ep300,Httand eight genes…
Show Full Abstract
Adolescence is marked in part by the ongoing development of the prefrontal cortex (PFC). Binge ethanol use during this critical stage in neurodevelopment induces significant structural changes to the PFC, as well as cognitive and behavioral deficits that can last into adulthood. Previous studies showed that adolescent binge ethanol causes lasting deficits in working memory, decreases in the expression of chromatin remodeling genes responsible for the methylation of histone 3 lysine 36 (H3K36), and global decreases in H3K36 in the PFC. H3K36me3 is present within the coding region of actively-transcribed genes, and safeguards against aberrant, cryptic transcription by RNA Polymerase II. We hypothesize that altered methylation of H3K36 could play a role in adolescent binge ethanol-induced memory deficits. To investigate this at the molecular level, ethanol (4 g/kg, i.g.) or water was administered intermittently to adolescent mice. RNA-and ChIP-sequencing were then performed within the same tissue to determine gene expression changes and identify genes and loci where H3K36me3 was disrupted by ethanol. We further assessed ethanol-induced changes at the transcription level with differential exon-use and cryptic transcription analysis - a hallmark of decreased H3K36me3. Here, we found ethanol-induced changes to the gene expression and H3K36me3-regulation of synaptic-related genes in all our analyses. Notably, H3K36me3 was differentially trimethylated between ethanol and control conditions at synaptic-related genes, and <i>Snap25</i> and <i>Cplx1</i> showed evidence of cryptic transcription in males and females treated with ethanol during adolescence. Our results provide preliminary evidence that ethanol-induced changes to H3K36me3 during adolescent neurodevelopment may be linked to synaptic dysregulation at the transcriptional level, which may explain the reported ethanol-induced changes to PFC synaptic function.
Also flagged:pulmonary hypertensionheart diseaseleft heart diseasePHpostcapillary pulmonary hypertensionleft ventricular dysfunction
Journal Article2023-03-03✓ 2 SnippetsXiao M, Lai D, Yu Y, Wu Q, Zhang C.
In-Text Gene Mentions
Introduction)
…the 5-HT transporter (5-HTT) are involved in…
Introduction)
…primarily dependent on 5-HTTand 5-HT2A receptors.…
Show Full Abstract
Pulmonary hypertension has high disability and mortality rates. Among them, pulmonary hypertension caused by left heart disease (PH-LHD) is the most common type. According to the 2022 ESC/ERS Guidelines for the diagnosis and treatment of pulmonary hypertension, PH-LHD is classified as group 2 pulmonary hypertension. PH-LHD belongs to postcapillary pulmonary hypertension, which is distinguished from other types of pulmonary hypertension because of its elevated pulmonary artery wedge pressure. PH-LHD includes PH due to systolic or diastolic left ventricular dysfunction, mitral or aortic valve disease and congenital left heart disease. The primary strategy in managing PH-LHD is optimizing treatment of the underlying cardiac disease. Recent clinical studies have found that mechanical unloading of left ventricle by an implantable non-pulsatile left ventricular assist device with continuous flow properties can reverse pulmonary hypertension in patients with heart failure. However, the specific therapies for PH in LHD have not yet been identified. Treatments that specifically target PH in LHD could slow its progression and potentially improve disease severity, leading to far better clinical outcomes. Therefore, exploring the current research on the pathogenesis of PH-LHD is important. This paper summarizes and classifies the research articles on the pathogenesis of PH-LHD to provide references for the mechanism research and clinical treatment of PH-LHD, particularly molecular targeted therapy.
Also flagged:PolyphenolsIronbindingHomeostasispolyphenolmetabolism
Journal Article2023-03-03✓ 1 SnippetScarano A, Laddomada B, Blando F, De Santis S, Verna G, Chieppa M, Santino A.
In-Text Gene Mentions
Introduction)
…conditions, such ashemochromatosis, metabolism dysfunction, and…
Show Full Abstract
In the past decades, many studies have widely examined the effects of dietary polyphenols on human health. Polyphenols are well known for their antioxidant properties and for their chelating abilities, by which they can be potentially employed in cases of pathological conditions, such as iron overload. In this review, we have highlighted the chelating abilities of polyphenols, which are due to their structural specific sites, and the differences for each class of polyphenols. We have also explored how the dietary polyphenols and their iron-binding abilities can be important in inflammatory/immunomodulatory responses, with a special focus on the involvement of macrophages and dendritic cells, and how they might contribute to reshape the gut microbiota into a healthy profile. This review also provides evidence that the axes "polyphenol-iron metabolism-inflammatory responses" and "polyphenol-iron availability-gut microbiota" have not been very well explored so far, and the need for further investigation to exploit such a potential to prevent or counteract pathological conditions.
Also flagged:Triacylglycerol Estolide IsomersTriacylglycerol estolidesfatty acid esterhydroxy fatty acidAmmoniumlithium
Journal Article2023-03-03No SnippetsCudlman L, Machara A, Vrkoslav V, Polášek M, Bosáková Z, Blanksby SJ, Cvačka J.
Show Full Abstract
Triacylglycerol estolides (TG-EST) are biologically active lipids extensively studied for their anti-inflammatory and anti-diabetic properties. In this work, eight standards of TG-EST were synthesized and systematically investigated by nanoelectrospray tandem mass spectrometry. Mass spectra of synthetic TG-EST were studied with the purpose of enabling the unambiguous identification of these lipids in biological samples. TG-EST glycerol <i>sn</i>-regioisomers and isomers with the fatty acid ester of hydroxy fatty acid (FAHFA) subunit branched in the ω-, α-, or 10-position were used. Ammonium, lithium, and sodium adducts of TG-EST formed by nanoelectrospray ionization were subjected to collision-induced dissociation (CID) and higher-energy collisional dissociation (HCD). Product ion spectra allowed for identification of fatty acid (FA) and FAHFA subunits originally linked to the glycerol backbone and distinguished the α-branching site of the FAHFA from other estolide-branching isomers. The ω- and 10-branching sites were determined by combining CID with ozone-induced dissociation (OzID). Lithium adducts provided the most informative product ions, enabling characterization of FA, hydroxy fatty acid (HFA), and FAHFA subunits. Glycerol <i>sn</i>-regioisomers were distinguished based on the relative abundance of product ions and unambiguously identified using CID/OzID of lithium and sodium adducts.
Also flagged:Neuropathicsynaptic transmissionbindingnucleotidesNeuropathic Paindiabetes
Journal Article2023-03-03No SnippetsMorchio M, Sher E, Collier DA, Lambert DW, Boissonade FM.
Show Full Abstract
Neuropathic pain is a debilitating condition affecting around 8% of the adult population in the UK. The pathophysiology is complex and involves a wide range of processes, including alteration of neuronal excitability and synaptic transmission, dysregulated intracellular signalling and activation of pro-inflammatory immune and glial cells. In the past 15 years, multiple miRNAs-small non-coding RNA-have emerged as regulators of neuropathic pain development. They act by binding to target mRNAs and preventing the translation into proteins. Due to their short sequence (around 22 nucleotides in length), they can have hundreds of targets and regulate several pathways. Several studies on animal models have highlighted numerous miRNAs that play a role in neuropathic pain development at various stages of the nociceptive pathways, including neuronal excitability, synaptic transmission, intracellular signalling and communication with non-neuronal cells. Studies on animal models do not always translate in the clinic; fewer studies on miRNAs have been performed involving human subjects with neuropathic pain, with differing results depending on the specific aetiology underlying neuropathic pain. Further studies using human tissue and liquid samples (serum, plasma, saliva) will help highlight miRNAs that are relevant to neuropathic pain diagnosis or treatment, as biomarkers or potential drug targets.
Also flagged:nonalcoholic fatty liver diseaseNAFLDchronic liver diseasemetabolic disordersasobesity
Journal Article2023-03-03✓ 1 SnippetCucoranu DC, Pop M, Niculescu R, Vunvulea V, Kosovski IB, Togănel RO, Russu E, Mureșan AV, Licu RA, Bacârea A.
In-Text Gene Mentions
Methods)
…or C viruses,hemochromatosis, documented alcoholism, and…
Show Full Abstract
<i>Background</i>: With a growing frequency, nonalcoholic fatty liver disease (NAFLD) is the most prevalent chronic liver disease worldwide. NAFLD has a strong correlation with other metabolic disorders, such as obesity, particularly abdominal obesity, even though the underlying causes or risk factors are not entirely understood. This study aims to investigate correlations between abdominal anthropometric measurements and the presence and intensity of liver steatosis as assessed by unenhanced computed tomography (CT). <i>Methods</i>: One hundred and nineteen patients (male/female, 66/53; mean age 54.54 +/- 12.90 years) underwent abdominal non-contrast-enhanced CT. CT images were examined to determine the attenuation of liver parenchyma, subcutaneous fat depth, and waist circumference (WC). <i>Results</i>: Among all patients, WC (r = -0.78, <i>p</i> < 0.0001), infraumbilical subcutaneous fat thicknesses (r = -0.51, <i>p</i> < 0.0001), right paraumbilical subcutaneous fat thicknesses (r = -0.62, <i>p</i> < 0.0001), and left paraumbilical subcutaneous fat thicknesses (r = -0.53, <i>p</i> < 0.0001) had a high inverse correlation with the liver attenuation values. The presence of T2D (OR: 2.40, <i>p</i> = 0.04), WC (OR: 11.45, <i>p</i> < 0.001), right paraumbilical (OR: 10.09, <i>p</i> < 0.001), left paraumbilical (OR: 2.81, <i>p</i> = 0.01), and infraumbilical (OR: 3.06, <i>p</i> = 0.007) were strongly independent predictors of NAFLD risk. Moreover, regarding the laboratory parameters, only the higher value of GGT (OR: 2.84, <i>p</i> = 0.009) is a predictor of NAFLD risk. <i>Conclusions</i>: Our data show that higher baseline values of all abdominal anthropometric measurements are correlated with liver attenuation and act as predictors of NAFLD risk.
Also flagged:synthesiskibdelomycingyrase Btopoisomerase IVaminoalkyldecalin
Journal Article2023-03-03No SnippetsSchriefer MG, Treiber L, Schobert R.
Show Full Abstract
A convergent total synthesis of bacterial gyrase B/topoisomerase IV inhibitor kibdelomycin (a.k.a. amycolamicin) (1) was devised starting from inexpensive d-mannose and l-rhamnose, which were converted in new efficient ways to an <i>N</i>-acylated amycolose and an amykitanose derivative as late building blocks. For the former, we developed an expeditious, general method for the introduction of an α-aminoalkyl linkage into sugars <i>via</i> 3-Grignardation. The decalin core was built up in seven steps <i>via</i> an intramolecular Diels-Alder reaction. These building blocks could be assembled as published previously, making for a formal total synthesis of 1 in 2.8% overall yield. An alternative order of connecting the essential fragments was also made possible by the first protocol for the direct <i>N</i>-glycosylation of a 3-acyltetramic acid.
Increased alcohol intake over decades leads to progressive alcohol-related liver disease (ALD) and contributes to increased mortality. It is characterized by reduced platelet count. Platelets have a role in protecting vascular integrity and involved in liver regeneration. Alcohol affects the platelet count and its function. Platelet function is regulated by their proteins, released during pathophysiological conditions. Therefore, platelet proteome plays a vital role during ALD. This preliminary study consists of 10 patients with ALD. It includes the preparation of human platelets for the proteomic approach. We performed liquid chromatography-mass spectrometry for the samples. A total of 536 proteins were identified in patients with ALD of which 31 proteins were mentioned as a candidate based on their clinical significance. The advancement of diagnostic or therapeutic tools based on the application of platelet proteins in ALD is still far off. Platform for platelet and its proteome research may give diagnostic and prognostic insights into ALD. Platelet proteomes could possibly be concluded as therapeutic and potential diagnostic or prognostic markers in ALD.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s12291-023-01120-9.
Also flagged:Primary congenital hydrocephalusbrain hemorrhagehydrocephalusprimary ciliumCongenital hydrocephalusCH
Journal Article2023-03-02✓ 1 SnippetJacquemin V, Versbraegen N, Duerinckx S, Massart A, Soblet J, Perazzolo C, Deconinck N, Brischoux-Boucher E, De Leener A, Revencu N, Janssens S, Moorgat S, Blaumeiser B, Avela K, Touraine R, Abou Jaoude I, Keymolen K, Saugier-Veber P, Lenaerts T, Abramowicz M, Pirson I.
In-Text Gene Mentions
Introduction)
…7 ], andAP-1 complexcomplex sigma-2 subunit…
Show Full Abstract
<h4>Background</h4>Congenital hydrocephalus is characterized by ventriculomegaly, defined as a dilatation of cerebral ventricles, and thought to be due to impaired cerebrospinal fluid (CSF) homeostasis. Primary congenital hydrocephalus is a subset of cases with prenatal onset and absence of another primary cause, e.g., brain hemorrhage. Published series report a Mendelian cause in only a minority of cases. In this study, we analyzed exome data of PCH patients in search of novel causal genes and addressed the possibility of an underlying oligogenic mode of inheritance for PCH.<h4>Materials and methods</h4>We sequenced the exome in 28 unrelated probands with PCH, 12 of whom from families with at least two affected siblings and 9 of whom consanguineous, thereby increasing the contribution of genetic causes. Patient exome data were first analyzed for rare (MAF < 0.005) transmitted or de novo variants. Population stratification of unrelated PCH patients and controls was determined by principle component analysis, and outliers identified using Mahalanobis distance 5% as cutoff. Patient and control exome data for genes biologically related to cilia (SYScilia database) were analyzed by mutation burden test.<h4>Results</h4>In 18% of probands, we identify a causal (pathogenic or likely pathogenic) variant of a known hydrocephalus gene, including genes for postnatal, syndromic hydrocephalus, not previously reported in isolated PCH. In a further 11%, we identify mutations in novel candidate genes. Through mutation burden tests, we demonstrate a significant burden of genetic variants in genes coding for proteins of the primary cilium in PCH patients compared to controls.<h4>Conclusion</h4>Our study confirms the low contribution of Mendelian mutations in PCH and reports PCH as a phenotypic presentation of some known genes known for syndromic, postnatal hydrocephalus. Furthermore, this study identifies novel Mendelian candidate genes, and provides evidence for oligogenic inheritance implicating primary cilia in PCH.
Also flagged:Elastin-like proteinextracellularELPhydrazinealdehydebenzaldehyde
Journal Article2023-03-02✓ 1 SnippetShayan M, Huang MS, Navarro R, Chiang G, Hu C, Oropeza BP, Johansson PK, Suhar RA, Foster AA, LeSavage BL, Zamani M, Enejder A, Roth JG, Heilshorn SC, Huang NF.
In-Text Gene Mentions
Abstract)
…To decouple the effects of stress relaxation rate from substrate stiffness on EC behavior, we engineered elastin-like protein (ELP) hydrogels in which dynamic covalent chemistry (DCC) was used to crosslink hydrazine-modified ELP (ELP-HYD) and aldehyde/benzaldehyde-modified polyethylene glycol (PEG-ALD/PEG-BZA).…
Show Full Abstract
Mechanical cues from the extracellular matrix (ECM) regulate vascular endothelial cell (EC) morphology and function. Since naturally derived ECMs are viscoelastic, cells respond to viscoelastic matrices that exhibit stress relaxation, in which a cell-applied force results in matrix remodeling. To decouple the effects of stress relaxation rate from substrate stiffness on EC behavior, we engineered elastin-like protein (ELP) hydrogels in which dynamic covalent chemistry (DCC) was used to crosslink hydrazine-modified ELP (ELP-HYD) and aldehyde/benzaldehyde-modified polyethylene glycol (PEG-ALD/PEG-BZA). The reversible DCC crosslinks in ELP-PEG hydrogels create a matrix with independently tunable stiffness and stress relaxation rate. By formulating fast-relaxing or slow-relaxing hydrogels with a range of stiffness (500-3300 Pa), we examined the effect of these mechanical properties on EC spreading, proliferation, vascular sprouting, and vascularization. The results show that both stress relaxation rate and stiffness modulate endothelial spreading on two-dimensional substrates, on which ECs exhibited greater cell spreading on fast-relaxing hydrogels up through 3 days, compared with slow-relaxing hydrogels at the same stiffness. In three-dimensional hydrogels encapsulating ECs and fibroblasts in coculture, the fast-relaxing, low-stiffness hydrogels produced the widest vascular sprouts, a measure of vessel maturity. This finding was validated in a murine subcutaneous implantation model, in which the fast-relaxing, low-stiffness hydrogel produced significantly more vascularization compared with the slow-relaxing, low-stiffness hydrogel. Together, these results suggest that both stress relaxation rate and stiffness modulate endothelial behavior, and that the fast-relaxing, low-stiffness hydrogels supported the highest capillary density in vivo.
Also flagged:Myosin-XMYO10GFPRAPH1localizationbinding
Journal Article2023-03-02✓ 1 SnippetPopović A, Miihkinen M, Ghimire S, Saup R, Grönloh MLB, Ball NJ, Goult BT, Ivaska J, Jacquemet G.
In-Text Gene Mentions
Introduction)
…date, with thenetrin DCC receptorDCC receptor (…
Show Full Abstract
Myosin-X (MYO10), a molecular motor localizing to filopodia, is thought to transport various cargo to filopodia tips, modulating filopodia function. However, only a few MYO10 cargoes have been described. Here, using GFP-Trap and BioID approaches combined with mass spectrometry, we identified lamellipodin (RAPH1) as a novel MYO10 cargo. We report that the FERM domain of MYO10 is required for RAPH1 localization and accumulation at filopodia tips. Previous studies have mapped the RAPH1 interaction domain for adhesome components to its talin-binding and Ras-association domains. Surprisingly, we find that the RAPH1 MYO10-binding site is not within these domains. Instead, it comprises a conserved helix located just after the RAPH1 pleckstrin homology domain with previously unknown functions. Functionally, RAPH1 supports MYO10 filopodia formation and stability but is not required to activate integrins at filopodia tips. Taken together, our data indicate a feed-forward mechanism whereby MYO10 filopodia are positively regulated by MYO10-mediated transport of RAPH1 to the filopodium tip.
Also flagged:phagocytosisvesiclesorganellesphagosomelysosomesArp2
Journal Article2023-03-02✓ 1 SnippetWang Y, Arnold ML, Smart AJ, Wang G, Androwski RJ, Morera A, Nguyen KCQ, Schweinsberg PJ, Bai G, Cooper J, Hall DH, Driscoll M, Grant BD.
In-Text Gene Mentions
Introduction)
…case of HuntingtinHTT-Q128 protein expression, neur…
Show Full Abstract
<i>Caenorhabditis elegans</i> neurons under stress can produce giant vesicles, several microns in diameter, called exophers. Current models suggest that exophers are neuroprotective, providing a mechanism for stressed neurons to eject toxic protein aggregates and organelles. However, little is known of the fate of the exopher once it leaves the neuron. We found that exophers produced by mechanosensory neurons in <i>C. elegans</i> are engulfed by surrounding hypodermal skin cells and are then broken up into numerous smaller vesicles that acquire hypodermal phagosome maturation markers, with vesicular contents gradually degraded by hypodermal lysosomes. Consistent with the hypodermis acting as an exopher phagocyte, we found that exopher removal requires hypodermal actin and Arp2/3, and the hypodermal plasma membrane adjacent to newly formed exophers accumulates dynamic F-actin during budding. Efficient fission of engulfed exopher-phagosomes to produce smaller vesicles and degrade their contents requires phagosome maturation factors SAND-1/Mon1, GTPase RAB-35, the CNT-1 ARF-GAP, and microtubule motor-associated GTPase ARL-8, suggesting a close coupling of phagosome fission and phagosome maturation. Lysosome activity was required to degrade exopher contents in the hypodermis but not for exopher-phagosome resolution into smaller vesicles. Importantly, we found that GTPase ARF-6 and effector SEC-10/exocyst activity in the hypodermis, along with the CED-1 phagocytic receptor, is required for efficient production of exophers by the neuron. Our results indicate that the neuron requires specific interaction with the phagocyte for an efficient exopher response, a mechanistic feature potentially conserved with mammalian exophergenesis, and similar to neuronal pruning by phagocytic glia that influences neurodegenerative disease.
<h4>Purpose</h4>Hepatocellular carcinoma (HCC) is a common and deadly form of liver cancer. Combination atezolizumab and bevacizumab has improved the outcomes for patients with advanced disease. We sought to determine the impact of etiology on outcomes of patients treated with atezolizumab and bevacizumab.<h4>Methods</h4>This study used a real-world database. The primary outcome was overall survival (OS) by etiology of HCC; the secondary outcome was real-world time to treatment discontinuation (rwTTD). Time-to-event analyses was performed by the Kaplan-Meier method; the log-rank test to assess for differences by etiology from date of first receipt of atezolizumab and bevacizumab. The Cox proportional hazards model was used to calculate hazard ratios.<h4>Results</h4>In total, 429 patients were included (n = 216 Viral-HCC; n = 68 Alcohol-HCC; n = 145, NASH-HCC). The median overall survival for the entire cohort was 9.4 months (95% CI 7.1-10.9). Compared with Viral-HCC, the hazard ratio (HR) of death was 1.11 (95% CI 0.74-1.68, p = 0.62) for Alcohol-HCC and was 1.34 (95% CI 0.96-1.86, p = 0.08) for NASH-HCC. The median rwTTD for the entire cohort was 5.7 months (95% CI 5.0-7.0 months). The HR of rwTTD was 1.24 (95% CI 0.86-1.77, p = 0.25) for Alcohol-HCC and was 1.31 (95% CI 0.98-1.75, p = 0.06) in reference to TTD with Viral-HCC.<h4>Conclusions</h4>In this real-world cohort of patients with HCC receiving first-line atezolizumab and bevacizumab, we did not identify an association between etiology and OS or rwTTD. This suggests that the efficacy of atezolizumab and bevacizumab may be similar across HCC etiologies. Further prospective studies are needed to confirm these findings.
Carbon dots (CDs) or CDs/polymer composites have been applied in numerous fields. Here, novel CDs were synthesized by carbonization of egg yolk, and characterized by TEM, FTIR, XPS and photoluminescence spectra. The CDs were found to be approximate sphere in shape with an average size of 4.46 ± 1.17 nm, and emitted bright blue photoluminescence under UV irradiation. The photoluminescence of CDs was found selectively quenched by Fe<sup>3+</sup> in a linear manner in the range of 0.05-0.45 mM, meaning they could be applied for Fe<sup>3+</sup> detection in solution. Moreover, the CDs could be uptaken by HepG2 cells to exhibit bright blue photoluminescence. The intensity could reflect the level of intracellular Fe<sup>3+</sup>, indicating they could be further used for cell imaging and intracellular Fe<sup>3+</sup> monitoring. Next, dopamine was polymerized on the surface of CDs to obtain the polydopamine (PDA)-coated CDs (CDs@PDA). We found PDA coating could quench the photoluminescence of CDs via inner filter effect, and the degree of quenching was linearly related to the logarithm of DA concentration (Log C<sub>DA</sub>). Also, the selectivity experiment indicated the method had a high selectivity for DA over a number of possible interfering species. This indicated the CDs in combination with Tris buffer could be potentially applied as the assay kit of dopamine. At last, the CDs@PDA exhibited excellent photothermal conversion capability, and they could efficiently kill HepG2 cells under NIR laser irradiation. Overall, the CDs and CDs@PDA in this work exhibited many excellent advantages, and could be potentially used for multi-applications, such as Fe<sup>3+</sup> sensor in solution and cellular, cell imaging, dopamine assay kit, as well as photothermal agents for cancer therapy.
Also flagged:hydrocarbonsmineralsiliconedecanealbuminBSA
Journal Article2023-03-02No SnippetsPayne EM, Taraji M, Murray BE, Holland-Moritz DA, Moore JC, Haddad PR, Kennedy RT.
Show Full Abstract
Droplet microfluidics enables high-throughput experimentation and screening by encapsulating chemical and biochemical samples in aqueous droplets segmented by an immiscible fluid. In such experiments, it is critical that each droplet remains chemically distinct. A common approach is to use fluorinated oils with surfactants to stabilize droplets. However, some small molecules have been observed to transport between droplets under these conditions. Attempts to study and mitigate this effect have relied on evaluating crosstalk using fluorescent molecules, which inherently limits the analyte scope and conclusions drawn about the mechanism of the effect. In this work, transport of low molecular weight compounds between droplets was investigated using electrospray ionization mass spectrometry (ESI-MS) for measurement. The use of ESI-MS significantly expands the scope of analytes that can be tested. We tested 36 structurally diverse analytes that were found to exhibit crosstalk ranging from negligible to complete transfer using HFE 7500 as the carrier fluid and 008-fluorosurfactant as a surfactant. Using this data set, we developed a predictive tool showing that high log <i>P</i> and log <i>D</i> values correlate with high crosstalk, and high polar surface area and log <i>S</i> correlate with low crosstalk. We then investigated several carrier fluids, surfactants, and flow conditions. It was discovered that transport is strongly dependent on all of these factors and that experimental design and surfactant tailoring can reduce carryover. We present evidence for mixed crosstalk mechanisms including both micellar and oil partitioning transfer. By understanding the driving mechanisms, surfactant and oil compositions can be designed to better reduce chemical transport for screening workflows.
Also flagged:alkylpolyfluoroalkylperfluorooctanesulfonic acidfluorinetrifluoromethylhydrogen
Journal Article2023-03-02No SnippetsRichard AM, Lougee R, Adams M, Hidle H, Yang C, Rathman J, Magdziarz T, Bienfait B, Williams AJ, Patlewicz G.
Show Full Abstract
The term PFAS encompasses diverse per- and polyfluorinated alkyl (and increasingly aromatic) chemicals spanning industrial processes, commercial uses, environmental occurrence, and potential concerns. With increased chemical curation, currently exceeding 14,000 structures in the PFASSTRUCTV5 inventory on EPA's CompTox Chemicals Dashboard, has come increased motivation to profile, categorize, and analyze the PFAS structure space using modern cheminformatics approaches. Making use of the publicly available ToxPrint chemotypes and ChemoTyper application, we have developed a new PFAS-specific fingerprint set consisting of 129 TxP_PFAS chemotypes coded in CSRML, a chemical-based XML-query language. These are split into two groups, the first containing 56 mostly bond-type ToxPrints modified to incorporate attachment to either a CF group or F atom to enforce proximity to the fluorinated portion of the chemical. This focus resulted in a dramatic reduction in TxP_PFAS chemotype counts relative to the corresponding ToxPrint counts (averaging 54%). The remaining TxP_PFAS chemotypes consist of various lengths and types of fluorinated chains, rings, and bonding patterns covering indications of branching, alternate halogenation, and fluorotelomers. Both groups of chemotypes are well represented across the PFASSTRUCT inventory. Using the ChemoTyper application, we show how the TxP_PFAS chemotypes can be visualized, filtered, and used to profile the PFASSTRUCT inventory, as well as to construct chemically intuitive, structure-based PFAS categories. Lastly, we used a selection of expert-based PFAS categories from the OECD Global PFAS list to evaluate a small set of analogous structure-based TxP_PFAS categories. TxP_PFAS chemotypes were able to recapitulate the expert-based PFAS category concepts based on clearly defined structure rules that can be computationally implemented and reproducibly applied to process large PFAS inventories without need to consult an expert. The TxP_PFAS chemotypes have the potential to support computational modeling, harmonize PFAS structure-based categories, facilitate communication, and allow for more efficient and chemically informed exploration of PFAS chemicals moving forward.
Also flagged:PIEZO1KCNN4Hereditary stomatocytosiscongenital hemolytic anemiacationmembranes
Journal Article2023-03-02✓ 2 SnippetsNakahara E, Yamamoto KS, Ogura H, Aoki T, Utsugisawa T, Azuma K, Akagawa H, Watanabe K, Muraoka M, Nakamura F, Kamei M, Tatebayashi K, Shinozuka J, Yamane T, Hibino M, Katsura Y, Nakano-Akamatsu S, Kadowaki N, Maru Y, Ito E, Ohga S, Yagasaki H, Morioka I, Yamamoto T, Kanno H.
In-Text Gene Mentions
Methods)
…with stomatocytosis andhemochromatosisnot due to…
Hereditary stomatocytosis (HSt) is a type of congenital hemolytic anemia caused by abnormally increased cation permeability of erythrocyte membranes. Dehydrated HSt (DHSt) is the most common subtype of HSt and is diagnosed based on clinical and laboratory findings related to erythrocytes. PIEZO1 and KCNN4 have been recognized as causative genes, and many related variants have been reported. We analyzed the genomic background of 23 patients from 20 Japanese families suspected of having DHSt using a target capture sequence and identified pathogenic/likely pathogenic variants of PIEZO1 or KCNN4 in 12 families.
Also flagged:TACC3breast cancersCentrosomecancercentrosomesmitosis
Journal Article2023-03-02✓ 1 SnippetSaatci O, Akbulut O, Cetin M, Sikirzhytski V, Uner M, Lengerli D, O'Quinn EC, Romeo MJ, Caliskan B, Banoglu E, Aksoy S, Uner A, Sahin O.
In-Text Gene Mentions
Abstract)
…interacts with theKinesin Family Member C1Family Member C1…
Show Full Abstract
Centrosome amplification (CA) is a hallmark of cancer that is strongly associated with highly aggressive disease and worse clinical outcome. Clustering extra centrosomes is a major coping mechanism required for faithful mitosis of cancer cells with CA that would otherwise undergo mitotic catastrophe and cell death. However, its underlying molecular mechanisms have not been fully described. Furthermore, little is known about the processes and players triggering aggressiveness of cells with CA beyond mitosis. Here, we identified Transforming Acidic Coiled-Coil Containing Protein 3 (TACC3) to be overexpressed in tumors with CA, and its high expression is associated with dramatically worse clinical outcome. We demonstrated, for the first time, that TACC3 forms distinct functional interactomes regulating different processes in mitosis and interphase to ensure proliferation and survival of cancer cells with CA. Mitotic TACC3 interacts with the Kinesin Family Member C1 (KIFC1) to cluster extra centrosomes for mitotic progression, and inhibition of this interaction leads to mitotic cell death via multipolar spindle formation. Interphase TACC3 interacts with the nucleosome remodeling and deacetylase (NuRD) complex (HDAC2 and MBD2) in nucleus to inhibit the expression of key tumor suppressors (e.g., p21, p16 and APAF1) driving G1/S progression, and its inhibition blocks these interactions and causes p53-independent G1 arrest and apoptosis. Notably, inducing CA by p53 loss/mutation increases the expression of TACC3 and KIFC1 via FOXM1 and renders cancer cells highly sensitive to TACC3 inhibition. Targeting TACC3 by guide RNAs or small molecule inhibitors strongly inhibits growth of organoids and breast cancer cell line- and patient-derived xenografts with CA by induction of multipolar spindles, mitotic and G1 arrest. Altogether, our results show that TACC3 is a multifunctional driver of highly aggressive breast tumors with CA and that targeting TACC3 is a promising approach to tackle this disease.
Also flagged:Huntington's diseaseneurodegenerative disorderpolyglutamineglutaminesglutaminehydrogen
Journal Article2023-03-02✓ 1 SnippetElena-Real CA, Sagar A, Urbanek A, Popovic M, Morató A, Estaña A, Fournet A, Doucet C, Lund XL, Shi ZD, Costa L, Thureau A, Allemand F, Swenson RE, Milhiet PE, Crehuet R, Barducci A, Cortés J, Sinnaeve D, Sibille N, Bernadó P.
In-Text Gene Mentions
Abstract)
…exon of theHTTgene, resulting in…
Show Full Abstract
Huntington's disease is a neurodegenerative disorder caused by a CAG expansion in the first exon of the HTT gene, resulting in an extended polyglutamine (poly-Q) tract in huntingtin (httex1). The structural changes occurring to the poly-Q when increasing its length remain poorly understood due to its intrinsic flexibility and the strong compositional bias. The systematic application of site-specific isotopic labeling has enabled residue-specific NMR investigations of the poly-Q tract of pathogenic httex1 variants with 46 and 66 consecutive glutamines. Integrative data analysis reveals that the poly-Q tract adopts long α-helical conformations propagated and stabilized by glutamine side chain to backbone hydrogen bonds. We show that α-helical stability is a stronger signature in defining aggregation kinetics and the structure of the resulting fibrils than the number of glutamines. Our observations provide a structural perspective of the pathogenicity of expanded httex1 and pave the way to a deeper understanding of poly-Q-related diseases.
Also flagged:genetic diseasesDraxinautism spectrum disorderPRKAR1ABBS9intellectual disability
Journal Article2023-03-02✓ 2 SnippetsArslan A, Fang Z, Wang M, Tan Y, Cheng Z, Chen X, Guan Y, J Pisani L, Yoo B, Bejerano G, Peltz G.
In-Text Gene Mentions
S I O 001029)
…B) The full length draxin protein has 343 amino acids, but this frameshift deletion generates a termination codon at amino acid 160; this eliminates the Netrin and DCC binding domains from BTBR Draxin that are essential for its neurodevelopmental function.…
Results)
…axonal guidance receptorDCC[ 38 ,…
Show Full Abstract
<h4>Background</h4>'Long read' sequencing methods have been used to identify previously uncharacterized structural variants that cause human genetic diseases. Therefore, we investigated whether long read sequencing could facilitate genetic analysis of murine models for human diseases.<h4>Results</h4>The genomes of six inbred strains (BTBR T + Itpr3tf/J, 129Sv1/J, C57BL/6/J, Balb/c/J, A/J, SJL/J) were analyzed using long read sequencing. Our results revealed that (i) Structural variants are very abundant within the genome of inbred strains (4.8 per gene) and (ii) that we cannot accurately infer whether structural variants are present using conventional short read genomic sequence data, even when nearby SNP alleles are known. The advantage of having a more complete map was demonstrated by analyzing the genomic sequence of BTBR mice. Based upon this analysis, knockin mice were generated and used to characterize a BTBR-unique 8-bp deletion within Draxin that contributes to the BTBR neuroanatomic abnormalities, which resemble human autism spectrum disorder.<h4>Conclusion</h4>A more complete map of the pattern of genetic variation among inbred strains, which is produced by long read genomic sequencing of the genomes of additional inbred strains, could facilitate genetic discovery when murine models of human diseases are analyzed.
Also flagged:autosomal dominant neurodegenerative diseaseHDextracellularneurotransmitterneurodegenerative disorderspathogenesis
Journal Article2023-03-02✓ 2 SnippetsKhakh BS, Goldman SA.
In-Text Gene Mentions
Abstract)
…in the huntingtin (HTT) gene that results…
Text
…HTT…
Show Full Abstract
Huntington's disease (HD) is a fatal, monogenic, autosomal dominant neurodegenerative disease caused by a polyglutamine-encoding CAG expansion in the huntingtin (HTT) gene that results in mutant huntingtin proteins (mHTT) in cells throughout the body. Although large parts of the central nervous system (CNS) are affected, the striatum is especially vulnerable and undergoes marked atrophy. Astrocytes are abundant within the striatum and contain mHTT in HD, as well as in mouse models of the disease. We focus on striatal astrocytes and summarize how they participate in, and contribute to, molecular pathophysiology and disease-related phenotypes in HD model mice. Where possible, reference is made to pertinent astrocyte alterations in human HD. Astrocytic dysfunctions related to cellular morphology, extracellular ion and neurotransmitter homeostasis, and metabolic support all accompany the development and progression of HD, in both transgenic mouse and human cellular and chimeric models of HD. These findings reveal the potential for the therapeutic targeting of astrocytes so as to restore synaptic as well as tissue homeostasis in HD. Elucidation of the mechanisms by which astrocytes contribute to HD pathogenesis may inform a broader understanding of the role of glial pathology in neurodegenerative disorders and, by so doing, enable new strategies of glial-directed therapeutics.
Myeloid cells, comprised of macrophages, dendritic cells, monocytes, and granulocytes, represent a major component of the tumor microenvironment (TME) and are critically involved in regulation of tumor progression and metastasis. In recent years, single-cell omics technologies have identified multiple phenotypically distinct subpopulations. In this review, we discuss recent data and concepts suggesting that the biology of myeloid cells is largely defined by a very limited number of functional states that transcend the narrowly defined cell populations. These functional states are primarily centered around classical and pathological states of activation, with the latter state commonly defined as myeloid-derived suppressor cells. We discuss the concept that lipid peroxidation of myeloid cells represents a major mechanism that governs their pathological state of activation in the TME. Lipid peroxidation is associated with ferroptosis mediating suppressive activity of these cells and thus could be considered an attractive target for therapeutic intervention.
Also flagged:DAXXhistonechaperoneshistonesbiosynthesisco-chaperone
Journal Article2023-03-02✓ 5 SnippetsCarraro M, Hendriks IA, Hammond CM, Solis-Mezarino V, Völker-Albert M, Elsborg JD, Weisser MB, Spanos C, Montoya G, Rappsilber J, Imhof A, Nielsen ML, Groth A.
In-Text Gene Mentions
Results)
…C4), and the TONSL-MMS22Lcomplex was only…
Discussion)
…H3.1 specificity of TONSL-MMS22L, which has important…
Discussion)
…required to restrict TONSL-MMS22Lfunction in homologous…
Discussion)
…would not support TONSL-MMS22Lrecruitment.…
Discussion)
…recognition and aMMS22Lplant homolog has…
Show Full Abstract
A multitude of histone chaperones are required to support histones from their biosynthesis until DNA deposition. They cooperate through the formation of histone co-chaperone complexes, but the crosstalk between nucleosome assembly pathways remains enigmatic. Using exploratory interactomics, we define the interplay between human histone H3-H4 chaperones in the histone chaperone network. We identify previously uncharacterized histone-dependent complexes and predict the structure of the ASF1 and SPT2 co-chaperone complex, expanding the role of ASF1 in histone dynamics. We show that DAXX provides a unique functionality to the histone chaperone network, recruiting histone methyltransferases to promote H3K9me3 catalysis on new histone H3.3-H4 prior to deposition onto DNA. Hereby, DAXX provides a molecular mechanism for de novo H3K9me3 deposition and heterochromatin assembly. Collectively, our findings provide a framework for understanding how cells orchestrate histone supply and employ targeted deposition of modified histones to underpin specialized chromatin states.
Also flagged:Serum response factorSRFmyocardinSmooth muscletranscription factorsActa2
Journal Article2023-03-02✓ 1 SnippetGoodwin K, Lemma B, Zhang P, Boukind A, Nelson CM.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
It has been proposed that smooth muscle differentiation may physically sculpt airway epithelial branches in mammalian lungs. Serum response factor (SRF) acts with its co-factor myocardin to activate the expression of contractile smooth muscle markers. In the adult, however, smooth muscle exhibits a variety of phenotypes beyond contractile, and these are independent of SRF/myocardin-induced transcription. To determine whether a similar phenotypic plasticity is exhibited during development, we deleted Srf from the mouse embryonic pulmonary mesenchyme. Srf-mutant lungs branch normally, and the mesenchyme displays mechanical properties indistinguishable from controls. scRNA-seq identified an Srf-null smooth muscle cluster, wrapping the airways of mutant lungs, which lacks contractile smooth muscle markers but retains many features of control smooth muscle. Srf-null embryonic airway smooth muscle exhibits a synthetic phenotype, compared with the contractile phenotype of mature wild-type airway smooth muscle. Our findings identify plasticity in embryonic airway smooth muscle and demonstrate that a synthetic smooth muscle layer promotes airway branching morphogenesis.
Journal Article2023-03-02✓ 1 SnippetLameris R, Ruben JM, Iglesias-Guimarais V, de Jong M, Veth M, van de Bovenkamp FS, de Weerdt I, Kater AP, Zweegman S, Horbach S, Riedl T, Winograd B, Roovers RC, Adang AEP, de Gruijl TD, Parren PWHI, van der Vliet HJ.
In-Text Gene Mentions
Results)
…to lack ofBTN2A1-BTN3A1 expression in mice.…
Show Full Abstract
Bispecific T cell engagers (bsTCEs) hold great promise for cancer treatment but face challenges due to the induction of cytokine release syndrome (CRS), on-target off-tumor toxicity, and the engagement of immunosuppressive regulatory T cells that limit efficacy. The development of Vγ9Vδ2-T cell engagers may overcome these challenges by combining high therapeutic efficacy with limited toxicity. By linking a CD1d-specific single-domain antibody (VHH) to a Vδ2-TCR-specific VHH, we create a bsTCE with trispecific properties, which engages not only Vγ9Vδ2-T cells but also type 1 NKT cells to CD1d<sup>+</sup> tumors and triggers robust proinflammatory cytokine production, effector cell expansion, and target cell lysis in vitro. We show that CD1d is expressed by the majority of patient MM, (myelo)monocytic AML, and CLL cells and that the bsTCE triggers type 1 NKT and Vγ9Vδ2-T cell-mediated antitumor activity against these patient tumor cells and improves survival in in vivo AML, MM, and T-ALL mouse models. Evaluation of a surrogate CD1d-γδ bsTCE in NHPs shows Vγ9Vδ2-T cell engagement and excellent tolerability. Based on these results, CD1d-Vδ2 bsTCE (LAVA-051) is now evaluated in a phase 1/2a study in patients with therapy refractory CLL, MM, or AML.
Also flagged:TumorColorectal Cancergene expressioncancercell proliferation-cell communication
Journal Article2023-03-02✓ 3 SnippetsAtanasova VS, de Jesus Cardona C, Hejret V, Tiefenbacher A, Mair T, Tran L, Pfneissl J, Draganić K, Binder C, Kabiljo J, Clement J, Woeran K, Neudert B, Wohlhaupter S, Haase A, Domazet S, Hengstschläger M, Mitterhauser M, Müllauer L, Tichý B, Bergmann M, Schweikert G, Hartl M, Dolznig H, Egger G.
In-Text Gene Mentions
Results)
…, CD44 ,OLFM4, SPINK4 ,…
Results)
…OLFM4showed variable expression…
Discussion)
…as CEACAM1, TFF3,OLFM4, and MUC1 and…
Show Full Abstract
<h4>Background & aims</h4>Patient-derived organoid cancer models are generated from epithelial tumor cells and reflect tumor characteristics. However, they lack the complexity of the tumor microenvironment, which is a key driver of tumorigenesis and therapy response. Here, we developed a colorectal cancer organoid model that incorporates matched epithelial cells and stromal fibroblasts.<h4>Methods</h4>Primary fibroblasts and tumor cells were isolated from colorectal cancer specimens. Fibroblasts were characterized for their proteome, secretome, and gene expression signatures. Fibroblast/organoid co-cultures were analyzed by immunohistochemistry and compared with their tissue of origin, as well as on gene expression levels compared with standard organoid models. Bioinformatics deconvolution was used to calculate cellular proportions of cell subsets in organoids based on single-cell RNA sequencing data.<h4>Results</h4>Normal primary fibroblasts, isolated from tumor adjacent tissue, and cancer associated fibroblasts retained their molecular characteristics in vitro, including higher motility of cancer associated compared with normal fibroblasts. Importantly, both cancer-associated fibroblasts and normal fibroblasts supported cancer cell proliferation in 3D co-cultures, without the addition of classical niche factors. Organoids grown together with fibroblasts displayed a larger cellular heterogeneity of tumor cells compared with mono-cultures and closely resembled the in vivo tumor morphology. Additionally, we observed a mutual crosstalk between tumor cells and fibroblasts in the co-cultures. This was manifested by considerably deregulated pathways such as cell-cell communication and extracellular matrix remodeling in the organoids. Thrombospondin-1 was identified as a critical factor for fibroblast invasiveness.<h4>Conclusion</h4>We developed a physiological tumor/stroma model, which will be vital as a personalized tumor model to study disease mechanisms and therapy response in colorectal cancer.
Also flagged:Ichthyosissphingosine 1-phosphate lyaseadrenal insufficiencysteroid-resistant nephrotic syndromehypothyroidismneurological disease
Journal Article2023-03-02✓ 1 SnippetSmith CJ, Williams JL, Hall C, Casas J, Caley MP, O'Toole EA, Prasad R, Metherell LA.
In-Text Gene Mentions
Text
…ECI2…
Show Full Abstract
Sphingosine 1-phosphate lyase (SGPL1) insufficiency (SPLIS) is a syndrome which presents with adrenal insufficiency, steroid-resistant nephrotic syndrome, hypothyroidism, neurological disease, and ichthyosis. Where a skin phenotype is reported, 94% had abnormalities such as ichthyosis, acanthosis, and hyperpigmentation. To elucidate the disease mechanism and the role SGPL1 plays in the skin barrier we established clustered regularly interspaced short palindromic repeats-Cas9 SGPL1 KO and a lentiviral-induced SGPL1 overexpression (OE) in telomerase reverse-transcriptase immortalised human keratinocytes (N/TERT-1) and thereafter organotypic skin equivalents. Loss of SGPL1 caused an accumulation of S1P, sphingosine, and ceramides, while its overexpression caused a reduction of these species. RNAseq analysis showed perturbations in sphingolipid pathway genes, particularly in SGPL1_KO, and our gene set enrichment analysis revealed polar opposite differential gene expression between SGPL1_KO and _OE in keratinocyte differentiation and Ca<sup>2+</sup> signaling genesets. SGPL1_KO upregulated differentiation markers, while SGPL1_OE upregulated basal and proliferative markers. The advanced differentiation of SGPL1_KO was confirmed by 3D organotypic models that also presented with a thickened and retained stratum corneum and a breakdown of E-cadherin junctions. We conclude that SPLIS associated ichthyosis is a multifaceted disease caused possibly by sphingolipid imbalance and excessive S1P signaling, leading to increased differentiation and an imbalance of the lipid lamellae throughout the epidermis.
Journal Article2023-03-02✓ 2 SnippetsNaveed HM, HongXing Y, Memon BA, Ali S, Alhussam MI, Sohu JM.
In-Text Gene Mentions
Results)
…t-negative association betweenDCCand TFDC respectively.…
Results)
…t-negative association betweenDCCand CER respectively.…
Show Full Abstract
The COVID-19 pandemic is a serious global issue destroying financial markets awfully. The proper estimation effect of COVID-19 pandemic on dynamic emerging financial markets is a big challenge due to a complex multidimensional data. However, the present study proposes a Deep Neural Network (DNN)-based multivariate regression approach with backpropagation algorithm and structural learning-based Bayesian network with constraint-based algorithm to investigate the influence of COVID-19 pandemic on the currency and derivatives markets of an emerging economy. The output shows that the COVID-19 pandemic has negatively influenced the financial markets as indicated by sharply depreciating currency value around 10 % to 12 % and reducing short-position of futures derivatives around 3 % to 5 % for currency risk hedging. The robustness estimation shows that there have probabilistic distributed between Traded Futures Derivatives Contracts (TFDC), Currency Exchange Rate (CER), and Daily Covid Cases (DCC) and Daily Covid Deaths (DCD). Moreover, the output represents that the futures derivatives market conditionally depends on the currency market volatility given percentage of COVID-19 pandemic. This study may help to policymakers of financial markets in decision-making to control CER volatility that may promote currency market stability to enhance currency market activities and boost confidence of foreign investors in extreme financial crisis circumstances.
Also flagged:Micrandilactone CNortriterpenoidSTAT3neurodegenerative disease3-nitropropionic acidHD
Journal Article2023-03-02✓ 5 SnippetsJang M, Choi JH, Jang DS, Cho IH, Cho IH.
In-Text Gene Mentions
Discussion)
…It is known that 3-NPA can induce striatal degeneration by neurotoxic activity in rodents and result in gait abnormalities, which mimics the behavioral dysfunction and pathology caused by mutant Htt in animal models for HD and its patients.…
Introduction)
…Neurodegeneration in HD is caused by an expansion of a CAG trinucleotide repeat in the huntingtin (Htt) gene.…
Introduction)
…the huntingtin (Htt) gene.…
Discussion)
…caused by mutantHttin animal models…
Discussion)
…do with mutantHttexpression [ 5…
Show Full Abstract
Huntington's disease (HD) is a neurodegenerative disease that affects the motor control system of the brain. Its pathological mechanism and therapeutic strategies have not been fully elucidated yet. The neuroprotective value of micrandilactone C (MC), a new schiartane nortriterpenoid isolated from the roots of Schisandra chinensis, is not well-known either. Here, the neuroprotective effects of MC were demonstrated in 3-nitropropionic acid (3-NPA)-treated animal and cell culture models of HD. MC mitigated neurological scores and lethality following 3-NPA treatment, which is associated with decreases in the formation of a lesion area, neuronal death/apoptosis, microglial migration/activation, and mRNA or protein expression of inflammatory mediators in the striatum. MC also inhibited the activation of the signal transducer and activator of transcription 3 (STAT3) in the striatum and microglia after 3-NPA treatment. As expected, decreases in inflammation and STAT3-activation were reproduced in a conditioned medium of lipopolysaccharide-stimulated BV2 cells pretreated with MC. The conditioned medium blocked the reduction in NeuN expression and the enhancement of mutant huntingtin expression in ST<i>Hdh</i><sup>Q111/Q111</sup> cells. Taken together, MC might alleviate behavioral dysfunction, striatal degeneration, and immune response by inhibiting microglial STAT3 signaling in animal and cell culture models for HD. Thus, MC may be a potential therapeutic strategy for HD.
Also flagged:Co-Expressionshort-chain fatty acidsinfectionpropionatevaleratePPAR
Journal Article2023-03-02No SnippetsWang Q, Thiam M, Barreto Sánchez AL, Wang Z, Zhang J, Li Q, Wen J, Zhao G.
Show Full Abstract
<i>Salmonella</i> negatively impacts the poultry industry and threatens animals' and humans' health. The gastrointestinal microbiota and its metabolites can modulate the host's physiology and immune system. Recent research demonstrated the role of commensal bacteria and short-chain fatty acids (SCFAs) in developing resistance to <i>Salmonella</i> infection and colonization. However, the complex interactions among chicken, <i>Salmonella</i>, host-microbiome, and microbial metabolites remain unelucidated. Therefore, this study aimed to explore these complex interactions by identifying the driver and hub genes highly correlated with factors that confer resistance to <i>Salmonella</i>. Differential gene expression (DEGs) and dynamic developmental genes (DDGs) analyses and weighted gene co-expression network analysis (WGCNA) were performed using transcriptome data from the cecum of <i>Salmonella</i> Enteritidis-infected chicken at 7 and 21 days after infection. Furthermore, we identified the driver and hub genes associated with important traits such as the heterophil/lymphocyte (H/L) ratio, body weight post-infection, bacterial load, propionate and valerate cecal contents, and <i>Firmicutes</i>, <i>Bacteroidetes</i>, and <i>Proteobacteria</i> cecal relative abundance. Among the multiple genes detected in this study, <i>EXFABP</i>, <i>S100A9/12</i>, <i>CEMIP</i>, <i>FKBP5</i>, <i>MAVS</i>, <i>FAM168B</i>, <i>HESX1</i>, <i>EMC6</i>, and others were found as potential candidate gene and transcript (co-) factors for resistance to <i>Salmonella</i> infection. In addition, we found that the PPAR and oxidative phosphorylation (OXPHOS) metabolic pathways were also involved in the host's immune response/defense against <i>Salmonella</i> colonization at the earlier and later stage post-infection, respectively. This study provides a valuable resource of transcriptome profiles from chicken cecum at the earlier and later stage post-infection and mechanistic understanding of the complex interactions among chicken, <i>Salmonella</i>, host-microbiome, and associated metabolites.
Also flagged:Colorectal cancercancercarbonglycosyltransferasestranscription factorsTF
Journal Article2023-03-02✓ 1 SnippetWang D, Wang D, Kuzyk V, Madunić K, Zhang T, Mayboroda OA, Wuhrer M, Lageveen-Kammeijer GSM.
In-Text Gene Mentions
Results)
…other TFs (e.g.,MLLT10, MSX1, SIX4, ZNF286A,…
Show Full Abstract
Colorectal cancer (CRC) is the third most commonly diagnosed cancer and the second leading cause of cancer deaths worldwide. A well-known hallmark of cancer is altered glycosylation. Analyzing the <i>N</i>-glycosylation of CRC cell lines may provide potential therapeutic or diagnostic targets. In this study, an in-depth <i>N</i>-glycomic analysis of 25 CRC cell lines was conducted using porous graphitized carbon nano-liquid chromatography coupled to electrospray ionization mass spectrometry. This method allows for the separation of isomers and performs structural characterization, revealing profound <i>N</i>-glycomic diversity among the studied CRC cell lines with the elucidation of a number of 139 <i>N</i>-glycans. A high degree of similarity between the two <i>N</i>-glycan datasets measured on the two different platforms (porous graphitized carbon nano-liquid chromatography electrospray ionization tandem mass spectrometry (PGC-nano-LC-ESI-MS) and matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF-MS)) was discovered. Furthermore, we studied the associations between glycosylation features, glycosyltransferases (GTs), and transcription factors (TFs). While no significant correlations between the glycosylation features and GTs were found, the association between TF CDX1 and (s)Le antigen expression and relevant GTs FUT3/6 suggests that CDX1 contributes to the expression of the (s)Le antigen through the regulation of FUT3/6. Our study provides a comprehensive characterization of the <i>N</i>-glycome of CRC cell lines, which may contribute to the future discovery of novel glyco-biomarkers of CRC.
Also flagged:Pulmonary vein stenosispulmonary hypertensionPHendothelial dysfunctionfatty acidmetabolism
Journal Article2023-03-02✓ 1 SnippetSen P, Shashikadze B, Flenkenthaler F, Van de Kamp E, Tian S, Meng C, Gigl M, Fröhlich T, Merkus D.
In-Text Gene Mentions
Results)
…The metabolite chondroitin sulfate, a major component of the extracellular matrix (ECM), is upregulated in the upper lobe of the PVB group and formed a network with proteins important for wound healing such as serpinc1, serpinD1, F12, PROC, VTN, AMBP and TNC.…
Show Full Abstract
Pulmonary vein stenosis (PVS) causes a rare type of pulmonary hypertension (PH) by impacting the flow and pressure within the pulmonary vasculature, resulting in endothelial dysfunction and metabolic changes. A prudent line of treatment in this type of PH would be targeted therapy to relieve the pressure and reverse the flow-related changes. We used a swine model in order to mimic PH after PVS using pulmonary vein banding (PVB) of the lower lobes for 12 weeks to mimic the hemodynamic profile associated with PH and investigated the molecular alterations that provide an impetus for the development of PH. Our current study aimed to employ unbiased proteomic and metabolomic analyses on both the upper and lower lobes of the swine lung to identify regions with metabolic alterations. We detected changes in the upper lobes for the PVB animals mainly pertaining to fatty acid metabolism, reactive oxygen species (ROS) signaling and extracellular matrix (ECM) remodeling and small, albeit, significant changes in the lower lobes for purine metabolism.
…The HTT gene was the first disease-associated gene mapped to a chromosome, but the pathophysiological mechanisms, genes, proteins or miRNAs involved in HD remain poorly understood.…
Discussion)
…Although mutant HTT (mHTT) is the contributing factor to HD pathogenesis, little is known regarding the mechanism by which cytotoxic mHTT is removed from neurons [23].…
Introduction)
…HD is largely caused by an inherited CAG trinucleotide repeat expansion on the huntingtin (HTT) gene that is located on exon 1 of chromosome 4 [3,4].…
Abstract)
…Huntington’s Disease (HD) is a progressive neurodegenerative disease caused by CAG repeat expansion in the huntingtin gene (HTT).…
Abstract)
…the huntingtin gene (HTT).…
Show Full Abstract
Huntington's Disease (HD) is a progressive neurodegenerative disease caused by CAG repeat expansion in the huntingtin gene (HTT). The HTT gene was the first disease-associated gene mapped to a chromosome, but the pathophysiological mechanisms, genes, proteins or miRNAs involved in HD remain poorly understood. Systems bioinformatics approaches can divulge the synergistic relationships of multiple omics data and their integration, and thus provide a holistic approach to understanding diseases. The purpose of this study was to identify the differentially expressed genes (DEGs), HD-related gene targets, pathways and miRNAs in HD and, more specifically, between the pre-symptomatic and symptomatic HD stages. Three publicly available HD datasets were analysed to obtain DEGs for each HD stage from each dataset. In addition, three databases were used to obtain HD-related gene targets. The shared gene targets between the three public databases were compared, and clustering analysis was performed on the common shared genes. Enrichment analysis was performed on (i) DEGs identified for each HD stage in each dataset, (ii) gene targets from the public databases and (iii) the clustering analysis results. Furthermore, the hub genes shared between the public databases and the HD DEGs were identified, and topological network parameters were applied. Identification of HD-related miRNAs and their gene targets was obtained, and a miRNA-gene network was constructed. Enriched pathways identified for the 128 common genes revealed pathways linked to multiple neurodegeneration diseases (HD, Parkinson's disease, Spinocerebellar ataxia), MAPK and HIF-1 signalling pathways. Eighteen HD-related hub genes were identified based on network topological analysis of MCC, degree and closeness. The highest-ranked genes were <i>FoxO3</i> and <i>CASP3</i>, <i>CASP3</i> and <i>MAP2</i> were found for betweenness and eccentricity and <i>CREBBP</i> and <i>PPARGC1A</i> were identified for the clustering coefficient. The miRNA-gene network identified eleven miRNAs (mir-19a-3p, mir-34b-3p, mir-128-5p, mir-196a-5p, mir-34a-5p, mir-338-3p, mir-23a-3p and mir-214-3p) and eight genes (<i>ITPR1</i>, <i>CASP3</i>, <i>GRIN2A</i>, <i>FoxO3</i>, <i>TGM2</i>, <i>CREBBP, MTHFR</i> and <i>PPARGC1A</i>). Our work revealed that various biological pathways seem to be involved in HD either during the pre-symptomatic or symptomatic stages of HD. This may offer some clues for the molecular mechanisms, pathways and cellular components underlying HD and how these may act as potential therapeutic targets for HD.
The simultaneous administration of three antiplatelet agents has been proposed as an efficient strategy for the secondary prevention of atherothrombotic events and is included in the European guidelines. However, this strategy presented an increased risk of bleeding; therefore, the identification of new antiplatelet agents, with improved efficacy and diminished side effects, is of great importance. In silico studies, UPLC/MS Q-TOF plasma stability, in vitro platelet aggregation experiments, and pharmacokinetic studies were exploited. In the present study, it has been predicted that the flavonoid apigenin could target different platelet activation pathways, including P2Y12, protease-activated receptor-1 (PAR-1), and cyclooxygenase 1 (COX-1). To enhance apigenin's potency, hybridization with docosahexaenoic acid (DHA) was performed, as fatty acids have illustrated potent efficacy against cardiovascular diseases (CVDs). The new molecular hybrid, termed 4'-DHA-apigenin, demonstrated enhanced inhibitory activity against platelet aggregation induced by thrombin receptor activator peptide-6 (TRAP-6), adenosine diphosphate (ADP), and arachidonic acid (AA), with respect to the parent apigenin. The 4'-DHA-apigenin hybrid illustrated an almost 2-fold enhanced inhibitory activity, with respect to apigenin, and an almost 3-fold enhanced inhibitory activity, with respect to DHA, for the ADP-induced platelet aggregation. Additionally, the hybrid presented a more than 12-fold enhanced inhibitory activity with respect to DHA for the TRAP-6 induced platelet aggregation. Furthermore, a 2-fold enhanced inhibitory activity was recorded for the 4'-DHA-apigenin hybrid for the AA-induced platelet aggregation with respect to apigenin. To surmount the reduced LC-MS based plasma stability, a novel dosage form in olive oil has been developed. The 4'-DHA-apigenin olive oil-based formulation presented an enhanced antiplatelet inhibitory effect in three activation pathways. To further explore the pharmacokinetic profile of 4'-DHA-apigenin in olive oil formulations, a UPLC/MS Q-TOF protocol has been established to quantify the serum levels of apigenin after oral administration to C57BL/6J wild type mice. The olive oil-based formulation of 4'-DHA-apigenin demonstrated an increase in apigenin bioavailability of 262 %. This study may offer a new therapeutic strategy tailored to improve the treatment of CVDs.
Also flagged:Phosphoruswatersynthesisphosphopolymersethylphosphazene
Journal Article2023-03-02No SnippetsKracíková L, Androvič L, Potočková I, Ziółkowska N, Vít M, Červený D, Jirák D, Laga R.
Show Full Abstract
The visualization of organs and tissues using <sup>31</sup>P magnetic resonance (MR) imaging represents an immense challenge. This is largely due to the lack of sensitive biocompatible probes required to deliver a high-intensity MR signal that can be distinguished from the natural biological background. Synthetic water-soluble phosphorus-containing polymers appear to be suitable materials for this purpose due to their adjustable chain architecture, low toxicity, and favorable pharmacokinetics. In this work, we carried out a controlled synthesis, and compared the MR properties, of several probes consisting of highly hydrophilic phosphopolymers differing in composition, structure, and molecular weight. Based on our phantom experiments, all probes with a molecular weight of ~3-400 kg·mol<sup>-1</sup>, including linear polymers based on poly(2-methacryloyloxyethyl phosphorylcholine) (PMPC), poly(ethyl ethylenephosphate) (PEEP), and poly[bis(2-(2-(2-methoxyethoxy)ethoxy)ethoxy)]phosphazene (PMEEEP) as well as star-shaped copolymers composed of PMPC arms grafted onto poly(amidoamine) dendrimer (PAMAM-<i>g</i>-PMPC) or cyclotriphosphazene-derived cores (CTP-<i>g</i>-PMPC), were readily detected using a 4.7 T MR scanner. The highest signal-to-noise ratio was achieved by the linear polymers PMPC (210) and PMEEEP (62) followed by the star polymers CTP-<i>g</i>-PMPC (56) and PAMAM-g-PMPC (44). The <sup>31</sup>P <i>T</i><sub>1</sub> and <i>T</i><sub>2</sub> relaxation times for these phosphopolymers were also favorable, ranging between 1078 and 2368 and 30 and 171 ms, respectively. We contend that select phosphopolymers are suitable for use as sensitive <sup>31</sup>P MR probes for biomedical applications.
Also flagged:deathnitrogenamphetaminesbarbituratesbenzodiazepinescannabinoids
Journal Article2023-03-02✓ 1 SnippetLynch KL.
In-Text Gene Mentions
I A O 0000613)
…asparyl-tRNA sythetase 2 (DARS2) mutation which causes…
Show Full Abstract
<h4>Introduction</h4>Drug testing typically follows a one-size-fits-all approach that is inadequate in some clinical scenarios, such as child maltreatment, neglect, and unintentional drug exposure. Results from immunoassay-based testing, which are non-specific, insensitive, and far from comprehensive, can lead to unintended consequences for children and their families.<h4>Objectives</h4>The objective of this retrospective case series study is to evaluate the utility of real-time (0-1 day) comprehensive drug testing as an alternative to immunoassay-based testing in the pediatric acute care setting.<h4>Methods</h4>Comprehensive drug testing results obtained by mass spectrometry testing and associated medical data for all pediatric cases (0-12 years) at one institution from 2019 to 2022 were included in the analysis. The final case series (n = 7) included all cases from patients <3 years with comprehensive drug testing results that were inconsistent with medication history and/or toxicology results by immunoassay.<h4>Results</h4>Comprehensive drug testing by mass spectrometry was ordered for 174 urine and blood samples representing 97 patients (0-12 years) from 2019 to 2022. Of these, 76 cases were from patients <3 years old; results were consistent with medication history and confirmatory for immunoassay results (n = 34), consistent with medication history (n = 14), confirmatory for immunoassay results (n = 10), negative (n = 9), or medical history was incomplete (n = 2). The remaining 7 cases were included in the final case series.<h4>Conclusions</h4>The cases highlight the value of real-time comprehensive drug testing in acute pediatric cases. Testing results can rule out toxic exposure from the diagnostic differential when negative, and lead to appropriate medical and social interventions when positive.
Also flagged:p21-activated kinaseneurodevelopmental disordersintellectual disabilityIDp21-activated kinasesPAK1
Journal Article2023-03-02✓ 2 SnippetsDobrigna M, Poëa-Guyon S, Rousseau V, Vincent A, Toutain A, Barnier JV.
In-Text Gene Mentions
S I O 001029)
…PAK1-mediated oligomerization of Huntingtin (HTT), which is independent of PAK1 kinase activity, is associated with Huntington’s disease (Luo et al., 2008).…
S I O 001029)
…Furthermore, HTT negatively regulates PAK2 apoptotic functions by preventing PAK2 cleavage via caspases: this protective function is retained by mutated HTT. These studies suggest that PAK1 and PAK2 have completely different associations with Huntington disease, PAK1 increases the toxicity of mutated HTT while PAK2 possibly has protective effects (Luo and Rubinsztein, 2009).…
Show Full Abstract
Although the identification of numerous genes involved in neurodevelopmental disorders (NDDs) has reshaped our understanding of their etiology, there are still major obstacles in the way of developing therapeutic solutions for intellectual disability (ID) and other NDDs. These include extensive clinical and genetic heterogeneity, rarity of recurrent pathogenic variants, and comorbidity with other psychiatric traits. Moreover, a large intragenic mutational landscape is at play in some NDDs, leading to a broad range of clinical symptoms. Such diversity of symptoms is due to the different effects DNA variations have on protein functions and their impacts on downstream biological processes. The type of functional alterations, such as loss or gain of function, and interference with signaling pathways, has yet to be correlated with clinical symptoms for most genes. This review aims at discussing our current understanding of how the molecular changes of group I <i>p21-activated kinases</i> (<i>PAK1</i>, <i>2</i> and <i>3</i>), which are essential actors of brain development and function; contribute to a broad clinical spectrum of NDDs. Identifying differences in <i>PAK</i> structure, regulation and spatio-temporal expression may help understanding the specific functions of each group I <i>PAK</i>. Deciphering how each variation type affects these parameters will help uncover the mechanisms underlying mutation pathogenicity. This is a prerequisite for the development of personalized therapeutic approaches.
Depression (major depressive disorder, MDD) is a common and serious medical illness. Globally, it is estimated that 5% of adults suffer from depression. Recently, imaging genetics receives growing attention and become a powerful strategy for discoverying the associations between genetic variants (e.g., single-nucleotide polymorphisms, SNPs) and multi-modality brain imaging data. However, most of the existing MDD imaging genetic research studies conducted by clinicians usually utilize simple statistical analysis methods and only consider single-modality brain imaging, which are limited in the deeper discovery of the mechanistic understanding of MDD. It is therefore imperative to utilize a powerful and efficient technology to fully explore associations between genetic variants and multi-modality brain imaging. In this study, we developed a novel imaging genetic association framework to mine the multi-modality phenotype network between genetic risk variants and multi-stage diagnosis status. Specifically, the multi-modality phenotype network consists of voxel node features and connectivity edge features from structural magnetic resonance imaging (sMRI) and resting-state functional magnetic resonance imaging (rs-fMRI). Thereafter, an association model based on multi-task learning strategy was adopted to fully explore the relationship between the MDD risk SNP and the multi-modality phenotype network. The multi-stage diagnosis status was introduced to further mine the relation among the multiple modalities of different subjects. A multi-modality brain imaging data and genotype data were collected by us from two hospitals. The experimental results not only demonstrate the effectiveness of our proposed method but also identify some consistent and stable brain regions of interest (ROIs) biomarkers from the node and edge features of multi-modality phenotype network. Moreover, four new and potential risk SNPs associated with MDD were discovered.
Also flagged:Autophagy-related geneLAPTM4Brenal clear cell carcinomaRenal cell carcinomaRCC
Journal Article2023-03-02No SnippetsWang H, Wang Q, Wu Y, Lou J, Zhu S, Xu Y.
Show Full Abstract
Renal cell carcinoma (RCC) is a common urologic disease. Currently, surgery is the primary treatment for renal cancer; immunotherapy is not as effective a treatment strategy as expected. Hence, understanding the mechanism in the tumor immune microenvironment (TME) and exploring novel immunotherapeutic targets are considered important. Recent studies have demonstrated that autophagy could affect the immune environment of renal cell carcinoma and induce proliferation and apoptosis of cancer cells. By comparing lysosomal genes and regulating autophagy genes, we identified the LAPTM4B gene to be related to RCC autophagy. By analyzing the TCGA-KIRC cohort using bioinformatics, we found M2 macrophages associated with tumor metastasis to be significantly increased in the immune microenvironment of patients with high expression of LAPTM4B. GO/KEGG/GSEA/GSVA results showed significant differences in tumor autophagy- and metastasis-related pathways. Single-cell sequencing was used to compare the expression of LAPTM4B in different cell types and obtain the differences in lysosomal and autophagy pathway activities in different ccRCC cells. Subsequently, we confirmed the differential expression of LAPTM4B in renal cell carcinoma of different Fuhrman grades using western blotting. Downregulation of LAPTM4B expression significantly reduced the proliferation of renal cell carcinoma cells and promoted cell apoptosis through cell experiments. Overall, our study demonstrated that the autophagy-related gene LAPTM4B plays a critical role in the TME of RCC, and suggested that LAPTM4B is a potential therapeutic target for RCC immunotherapy.
Also flagged:methylationpathogenesisthyroid cancertumorBRAFcancer
Journal Article2023-03-02✓ 2 SnippetsJasmine F, Aschebrook-Kilfoy B, Rahman MM, Zaagman G, Grogan RH, Kamal M, Ahsan H, Kibriya MG.
In-Text Gene Mentions
Discussion)
…In a study of PTC, correlations between the methylation status of four genes (TIMP3, RASSF1A, RARβ2, and DCC) and the BRAF V600E mutation were studied.…
Discussion)
…RASSF1A, RARβ2, andDCC) and the…
Show Full Abstract
The <i>BRAF</i> V600E mutation and DNA promoter methylation play important roles in the pathogenesis of thyroid cancer (TC). However, the association of these genetic and epigenetic alterations is not clear. In this study, using paired tumor and surrounding normal tissue from the same patients, on a genome-wide scale we tried to identify (a) any association between <i>BRAF</i> mutation and DNA promoter methylation, and (b) if the molecular findings may provide a basis for therapeutic intervention. We included 40 patients with TC (female = 28, male = 12) without distant metastasis. <i>BRAF</i> mutation was present in 18 cases. We identified groups of differentially methylated loci (DML) that are found in (a) both <i>BRAF</i> mutant and wild type, (b) only in <i>BRAF</i> mutant tumors, and (c) only in <i>BRAF</i> wild type. BRAF mutation-specific promoter loci were more frequently hypomethylated, whereas BRAF wild-type-specific loci were more frequently hypermethylated. Common DML were enriched in cancer-related pathways, including the mismatch repair pathway and Wnt-signaling pathway. Wild-type-specific DML were enriched in RAS signaling. Methylation status of checkpoint signaling genes, as well as the T-cell inflamed genes, indicated an opportunity for the potential use of <i>PDL1</i> inhibitors in BRAF mutant TC. Our study shows an association between <i>BRAF</i> mutation and methylation in TC that may have biological significance.
Also flagged:myopiaestrogenatropineTead1refractive disordervision
Journal Article2023-03-02✓ 2 SnippetsCui Z, Huang Y, Chen X, Chen T, Hou X, Yu N, Li Y, Qiu J, Chen P, Yu K, Zhuang J.
In-Text Gene Mentions
Results)
…6a (Actl6a), huntingtin (Htt), G protein subunit…
Results)
…gene markers includedHtt, Creb1 and Mecp2.…
Show Full Abstract
Animal models have been indispensable in shaping the understanding of myopia mechanisms, with form-deprivation myopia (FDM) and lens-induced myopia (LIM) being the most utilized. Similar pathological outcomes suggest that these two models are under the control of shared mechanisms. miRNAs play an important role in pathological development. Herein, based on two miRNA datasets (GSE131831 and GSE84220), we aimed to reveal the general miRNA changes involved in myopia development. After a comparison of the differentially expressed miRNAs, miR-671-5p was identified as the common downregulated miRNA in the retina. miR-671-5p is highly conserved and related to 40.78% of the target genes of all downregulated miRNAs. Moreover, 584 target genes of miR-671-5p are related to myopia, from which we further identified 8 hub genes. Pathway analysis showed that these hub genes are enriched in visual learning and extra-nuclear estrogen signaling. Furthermore, two of the hub genes are also targeted by atropine, which strongly supports a key role of miR-671-5p in myopic development. Finally, Tead1 was identified as a possible upstream regulator of miR-671-5p in myopia development. Overall, our study identified the general regulatory role of miR-671-5p in myopia as well as its upstream and downstream mechanisms and provided novel treatment targets, which might inspire future studies.
Also flagged:Diabetic RetinopathydiabetesIRMAVBPDRNon-
Journal Article2023-03-02✓ 1 SnippetPearce E, Sivaprasad S, Broadgate S, Kiire C, Downes SM, Halford S, Chong V.
In-Text Gene Mentions
Discussion)
…These includeHFE, SLMAP, VDR, TGF-b1,…
Show Full Abstract
Diabetic Retinopathy (DR) is a leading cause of preventable visual impairment in the working age population. Despite the increasing prevalence of DR, there remain gaps in our understanding of its pathophysiology. This is a prospective case-control study comparing the genetic profiles of patients with no DR vs. non-proliferative DR (NPDR) focusing on intraretinal microvascular abnormalities (IRMA) and venous beading (VB) in Caucasians. A total of 596 participants were recruited to the study; 199 with moderate/severe NPDR and 397 with diabetes for at least 5 years without DR. Sixty-four patients were excluded due to technical issues. In total, 532 were analysed; 181 and 351 were in the NPDR group and no DR group, respectively. Those with severe IRMA and VB had distinctly different genetic profiles from each other and from the no DR group, which further supports the theory that these two features of DR might have different etiologies. This also suggests that IRMA and VB are independent risk factors for the development of PDR and may have different pathophysiologies. If these findings are confirmed in larger studies, this could pave the way for personalised treatment options for those more at risk of developing different features of NPDR.
Also flagged:endoplasmic reticulapolypeptideprotein degradationwatermetamorphosismolt-inhibiting hormone
Journal Article2023-03-02✓ 2 SnippetsLiu D, Hong Z, Gui L, Zhao L, Wang Y, Sun S, Li M.
In-Text Gene Mentions
Discussion)
…To explain the regulatory mechanism underlying DEGs in protein processing in the endoplasmic reticulum, a LncRNA and mRNA co-expression network analysis was performed to find differentially expressed LncRNAs that regulate transcription of DEGs in the nervous system, such as LncRNAs, DLX6-AS1, ZNFX1-AS1, and HULC, which have been reported to play critical roles in promoting oncogenic phenotypes of cancer cell lines [51,52].…
Discussion)
…as LncRNAs, DLX6-AS1,ZNFX1-AS1, and HULC, which…
Show Full Abstract
<i>Macrobrachium rosenbergii</i> is an important aquaculture prawn that exhibits sexual dimorphism in growth, with males growing much faster than females. However, the mechanisms controlling these complex traits are not well understood. The nervous system plays an important role in regulating life functions. In the present work, we applied PacBio RNA-seq to obtain and characterize the full-length transcriptomes of the brains and thoracic ganglia of female and male prawns, and we performed comparative transcriptome analysis of female and male prawns. A total of 159.1-Gb of subreads were obtained with an average length of 2175 bp and 93.2% completeness. A total of 84,627 high-quality unigenes were generated and annotated with functional databases. A total of 6367 transcript factors and 6287 LncRNAs were predicted. In total, 5287 and 6211 significantly differentially expressed genes (DEGs) were found in the brain and thoracic ganglion, respectively, and confirmed by qRT-PCR. Of the 435 genes associated with protein processing pathways in the endoplasmic reticula, 42 DEGs were detected, and 21/26 DEGs with upregulated expression in the male brain/thoracic ganglion. The DEGs in this pathway are regulated by multiple LncRNAs in polypeptide folding and misfolded protein degradation in the different organs and sexes of the prawn. Our results provide novel theories and insights for studying the nervous system, sexual control, and growth dimorphism.
Also flagged:Hypoxia Inducible Factor 1-αDeferoxamineOsteonecrosisosteonecrosis of the jawzoledronic acidgelatin
Journal Article2023-03-02✓ 1 SnippetYalcin-Ülker GM, Günbatan M, Duygu G, Soluk-Tekkesin M, Özcakir-Tomruk C.
In-Text Gene Mentions
Discussion)
…iron poisoning andhemochromatosis.…
Show Full Abstract
This experimental study investigates the prophylactic effect of deferoxamine (DFO) on medication-related osteonecrosis of the jaw (MRONJ). Thirty-six female Sprague Dawley rats received zoledronic acid (ZA) for eight weeks to create an osteonecrosis model. DFO was locally applied into the extraction sockets with gelatin sponge (GS) carriers to prevent MRONJ. The specimens were histopathologically and histomorphometrically evaluated. Hypoxia-inducible factor 1-alpha (HIF-1α) protein levels in the extraction sockets were quantified. New bone formation rate differed significantly between groups (<i>p</i> = 0.005). Newly formed bone ratios in the extraction sockets did not differ significantly between the control group and the GS (<i>p</i> = 1), GS/DFO (<i>p</i> = 0.749), ZA (<i>p</i> = 0.105), ZA-GS (<i>p</i> = 0.474), and ZA-GS/DFO (<i>p</i> = 1) groups. While newly formed bone rates were higher in the ZA-GS and ZA-GS/DFO groups than in the ZA group, the differences were not significant. HIF-1α levels differed significantly between groups (<i>p</i> < 0.001) and were significantly higher in the DFO and ZA-GS/DFO groups than in the control group (<i>p</i> = 0.001 and <i>p</i> = 0.004, respectively). While HIF-1α levels were higher in the ZA-GS/DFO group than in the ZA group, the difference was not significant. While HIF-1α protein levels and new bone formation rate were elevated in the DFO-treated group, the effect was not significant. Further large-scale studies are needed to understand DFO's preventative effects on MRONJ and the role of HIF-1α in MRONJ pathogenesis.
Also flagged:Zeb2Bindingtranscription factorchromatindevelopmental disordersMowat-Wilson syndrome
Journal Article2023-03-02✓ 1 SnippetBirkhoff JC, Korporaal AL, Brouwer RWW, Nowosad K, Milazzo C, Mouratidou L, van den Hout MCGN, van IJcken WFJ, Huylebroeck D, Conidi A.
In-Text Gene Mentions
Introduction)
…( Ntf3 ,Sox6), as well…
Show Full Abstract
Functional perturbation and action mechanism studies have shown that the transcription factor Zeb2 controls cell fate decisions, differentiation, and/or maturation in multiple cell lineages in embryos and after birth. In cultured embryonic stem cells (ESCs), Zeb2's mRNA/protein upregulation is necessary for the exit from primed pluripotency and for entering general and neural differentiation. We edited mouse ESCs to produce Flag-V5 epitope-tagged Zeb2 protein from one endogenous allele. Using chromatin immunoprecipitation coupled with sequencing (ChIP-seq), we mapped 2432 DNA-binding sites for this tagged Zeb2 in ESC-derived neuroprogenitor cells (NPCs). A new, major binding site maps promoter-proximal to <i>Zeb2</i> itself. The homozygous deletion of this site demonstrates that autoregulation of <i>Zeb2</i> is necessary to elicit the appropriate Zeb2-dependent effects in ESC-to-NPC differentiation. We have also cross-referenced all the mapped Zeb2 binding sites with previously obtained transcriptome data from Zeb2 perturbations in ESC-derived NPCs, GABAergic interneurons from the ventral forebrain of mouse embryos, and stem/progenitor cells from the post-natal ventricular-subventricular zone (V-SVZ) in mouse forebrain, respectively. Despite the different characteristics of each of these neurogenic systems, we found interesting target gene overlaps. In addition, our study also contributes to explaining developmental disorders, including Mowat-Wilson syndrome caused by <i>ZEB2</i> deficiency, and also other monogenic syndromes.
Also flagged:PreeclampsiaPEobstetric disorderthrombocytopenialiverpulmonary edema
Journal Article2023-03-02No SnippetsWang X, Shields CA, Ekperikpe U, Amaral LM, Williams JM, Cornelius DC.
Show Full Abstract
Preeclampsia (PE) is a multisystem obstetric disorder that affects 2-10% of pregnancies worldwide and it is a leading cause of maternal and fetal morbidity and mortality. The etiology of PE development is not clearly delineated, but since delivery of the fetus and placenta often leads to symptom resolution in the most cases of PE, it is hypothesized that the placenta is the inciting factor of the disease. Current management strategies for PE focus on treating the maternal symptoms to stabilize the mother in an attempt to prolong the pregnancy. However, the efficacy of this management strategy is limited. Therefore, identification of novel therapeutic targets and strategies is needed. Here, we provide a comprehensive overview of the current state of knowledge regarding mechanisms of vascular and renal pathophysiology during PE and discuss potential therapeutic targets directed at improving maternal vascular and renal function.
Research Square2023-03-02Preprint (No Snippets API)Socrates A, Mullins N, Gur R, Gur R, Stahl E, O’Reilly P, Reichenberg A, Jones H, Zammit S, Velthorst E.
Show Full Abstract
<title>Abstract</title> <p>Social-isolation has been linked to a range of psychiatric issues, but the behavioral component that drives it is not well understood. Here, a GWAS is carried out to identify genetic variants which contribute to Social-isolation behaviors in up to 449,609 participants from the UK Biobank. 17 loci were identified at genome-wide significance, contributing to a 4% SNP heritability estimate. Using the Social-isolation GWAS, polygenic risk scores (PRS) were derived in ALSPAC, an independent, developmental cohort, and used to test for association with friendship quality. At age 18, friendship scores were associated with the Social-isolation PRS, demonstrating that the genetic factors are able to predict related social traits. LD score regression using the GWAS demonstrated genetic correlation with autism spectrum disorder, schizophrenia, and major depressive disorder. However, no evidence of causality was found using a conservative Mendelian randomization approach other than that of autism spectrum disorder on Social-isolation. Our results show that Social-isolation has a small heritable component which may drive those behaviors which is associated genetically with other social traits such as friendship satisfaction as well as psychiatric disorders.</p>
bioRxiv2023-03-02Preprint (No Snippets API)Sedighi F, Skeens A, Adegbuyiro A, Bard J, Siriwardhana C, Donley E, Geldenhuys WJ, Legleiter J.
Show Full Abstract
<h4>ABSTRACT</h4> Huntingtin disease (HD) is a neurodegenerative disease caused by expansion of a polyglutamine (polyQ) tract within the huntingtin (htt) protein, leading to aggregation into a variety of species ranging from small oligomers to large fibrils. A consensus concerning which of these aggregate states are primarily responsible for toxicity associated with mutant htt remains elusive. Htt directly binds and damages a variety of membranous surfaces within cells. Here, the ability of different aggregation states of htt to interact with and damage lipid membranes was determined. Oligomers represented the most active lipid binding species, whereas, fibril formation severely limited membrane binding. Thus, strategies to stabilize oligomers were implemented, and conformational flexibility appeared to play a key role in the oligomer/membrane interaction. In particular, stabilizing oligomers with covalent crosslinking with 1,5-difluoro-2,4-dinitrobenzene (DFDNB) effectively eliminated the ability of oligomers to bind lipid membranes and reduced their associated cellular toxicity.
Also flagged:Alzheimer's diseaseibudilastphosphodiesterasetoll-like receptor 4TLR4kinases
Journal Article2023-03-01✓ 1 SnippetOliveros G, Wallace CH, Chaudry O, Liu Q, Qiu Y, Xie L, Rockwell P, Figueiredo-Pereira ME, Serrano PA.
In-Text Gene Mentions
Text
…TAOK3…
Show Full Abstract
Alzheimer's disease is a multifactorial disease that exhibits cognitive deficits, neuronal loss, amyloid plaques, neurofibrillary tangles and neuroinflammation in the brain. Hence, a multi-target drug would improve treatment efficacy. We applied a new multi-scale predictive modelling framework that integrates machine learning with biophysics and systems pharmacology to screen drugs for Alzheimer's disease using patients' tissue samples. Our predictive modelling framework identified ibudilast as a drug with repurposing potential to treat Alzheimer's disease. Ibudilast is a multi-target drug, as it is a phosphodiesterase inhibitor and toll-like receptor 4 (TLR4) antagonist. In addition, we predict that ibudilast inhibits off-target kinases (e.g. IRAK1 and GSG2). In Japan and other Asian countries, ibudilast is approved for treating asthma and stroke due to its anti-inflammatory potential. Based on these previous studies and on our predictions, we tested for the first time the efficacy of ibudilast in Fisher transgenic 344-AD rats. This transgenic rat model is unique as it exhibits hippocampal-dependent spatial learning and memory deficits and Alzheimer's disease pathology, including hippocampal amyloid plaques, tau paired-helical filaments, neuronal loss and microgliosis, in a progressive age-dependent manner that mimics the pathology observed in Alzheimer's disease patients. Following long-term treatment with ibudilast, transgenic rats were evaluated at 11 months of age for spatial memory performance and Alzheimer's disease pathology. We demonstrate that ibudilast-treatment of transgenic rats mitigated hippocampal-dependent spatial memory deficits, as well as hippocampal (hilar subregion) amyloid plaque and tau paired-helical filament load, and microgliosis compared to untreated transgenic rat. Neuronal density analysed across all hippocampal regions was similar in ibudilast-treated transgenic compared to untreated transgenic rats. Interestingly, RNA sequencing analysis of hippocampal tissue showed that ibudilast-treatment affects gene expression levels of the TLR and ubiquitin-proteasome pathways differentially in male and female transgenic rats. Based on the TLR4 signalling pathway, our RNA sequencing data suggest that ibudilast-treatment inhibits IRAK1 activity by increasing expression of its negative regulator IRAK3, and/or by altering TRAF6 and other TLR-related ubiquitin ligase and conjugase levels. Our results support that ibudilast can serve as a repurposed drug that targets multiple pathways including TLR signalling and the ubiquitin/proteasome pathway to reduce cognitive deficits and pathology relevant to Alzheimer's disease.
Also flagged:movement disordersX-linked dystonia-parkinsonismneurodegenerative diseaseMSH3PMS2Cas9
Journal Article2023-03-01✓ 1 SnippetTrinh J, Lüth T, Schaake S, Laabs BH, Schlüter K, Laβ J, Pozojevic J, Tse R, König I, Jamora RD, Rosales RL, Brüggemann N, Saranza G, Diesta CCE, Kaiser FJ, Depienne C, Pearson CE, Westenberger A, Klein C.
In-Text Gene Mentions
Discussion)
…A pure HTT (CAG)n tract can hasten disease by 13–29 years, whereas a multiply-interrupted tract can delay disease by 3–6 years.18 AGG interruptions polarized to the 5′-end of the (CGG)n of FMR1, is associated with FXS, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency.…
Show Full Abstract
While many genetic causes of movement disorders have been identified, modifiers of disease expression are largely unknown. X-linked dystonia-parkinsonism (XDP) is a neurodegenerative disease caused by a SINE-VNTR-Alu(AGAGGG)n retrotransposon insertion in TAF1, with a polymorphic (AGAGGG)n repeat. Repeat length and variants in MSH3 and PMS2 explain ∼65% of the variance in age at onset (AAO) in XDP. However, additional genetic modifiers are conceivably at play in XDP, such as repeat interruptions. Long-read nanopore sequencing of PCR amplicons from XDP patients (n = 202) was performed to assess potential repeat interruption and instability. Repeat-primed PCR and Cas9-mediated targeted enrichment confirmed the presence of identified divergent repeat motifs. In addition to the canonical pure SINE-VNTR-Alu-5'-(AGAGGG)n, we observed a mosaic of divergent repeat motifs that polarized at the beginning of the tract, where the divergent repeat interruptions varied in motif length by having one, two, or three nucleotides fewer than the hexameric motif, distinct from interruptions in other disease-associated repeats, which match the lengths of the canonical motifs. All divergent configurations occurred mosaically and in two investigated brain regions (basal ganglia, cerebellum) and in blood-derived DNA from the same patient. The most common divergent interruption was AGG [5'-SINE-VNTR-Alu(AGAGGG)2AGG(AGAGGG)n], similar to the pure tract, followed by AGGG [5'-SINE-VNTR-Alu(AGAGGG)2AGGG(AGAGGG)n], at median frequencies of 0.425 (IQR: 0.42-0.43) and 0.128 (IQR: 0.12-0.13), respectively. The mosaic AGG motif was not associated with repeat number (estimate = -3.8342, P = 0.869). The mosaic pure tract frequency was associated with repeat number (estimate = 45.32, P = 0.0441) but not AAO (estimate = -41.486, P = 0.378). Importantly, the mosaic frequency of the AGGG negatively correlated with repeat number after adjusting for age at sampling (estimate = -161.09, P = 3.44 × 10-5). When including the XDP-relevant MSH3/PMS2 modifier single nucleotide polymorphisms into the model, the mosaic AGGG frequency was associated with AAO (estimate = 155.1063, P = 0.047); however, the association dissipated after including the repeat number (estimate = -92.46430, P = 0.079). We reveal novel mosaic divergent repeat interruptions affecting both motif length and sequence (DRILS) of the canonical motif polarized within the SINE-VNTR-Alu(AGAGGG)n repeat. Our study illustrates: (i) the importance of somatic mosaic genotypes; (ii) the biological plausibility of multiple modifiers (both germline and somatic) that can have additive effects on repeat instability; and (iii) that these variations may remain undetected without assessment of single molecules.
Also flagged:Schizophreniamental disorderbrain function disordersDeleted inColorectal Carcinomabehavioral
Journal Article2023-03-01✓ 1 SnippetSong X, Li R, Wang K, Bai Y, Xiao Y, Wang YP.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
The imaging genetics approach generates large amount of high dimensional and multi-modal data, providing complementary information for comprehensive study of Schizophrenia, a complex mental disease. However, at the same time, the variety of these data in structures, resolutions, and formats makes their integrative study a forbidding task. In this paper, we propose a novel model called Joint Sparse Collaborative Regression (JSCoReg), which can extract class-specific features from different health conditions/disease classes. We first evaluate the performance of feature selection in terms of Receiver operating characteristic curve and the area under the ROC curve in the simulation experiment. We demonstrate that the JSCoReg model can achieve higher accuracy compared with similar models including Joint Sparse Canonical Correlation Analysis and Sparse Collaborative Regression. We then applied the JSCoReg model to the analysis of schizophrenia dataset collected from the Mind Clinical Imaging Consortium. The JSCoReg enables us to better identify biomarkers associated with schizophrenia, which are verified to be both biologically and statistically significant.
Also flagged:male pubertyembryogenesissynaptogenesisgonadotropin releasing hormoneGnRHsynthesis
Journal Article2023-03-01No SnippetsAkram M, Raza Rizvi SS, Qayyum M, Handelsman DJ.
Show Full Abstract
Puberty is a pivotal biological process that completes sexual maturation to achieve full reproductive capability. It is a major transformational period of life, whose timing is strongly affected by genetic makeup of the individual, along with various internal and external factors. Although the exact mechanism for initiation of the cascade of molecular events that culminate in puberty is not yet known, the process of pubertal onset involves interaction of numerous complex signaling pathways of hypothalamo-pituitary-testicular (HPT) axis. We developed a classification of the mechanisms involved in male puberty that allowed placing many genes into physiological context. These include (i) hypothalamic development during embryogenesis, (ii) synaptogenesis where gonadotropin releasing hormone (GnRH) neurons form neuronal connections with suprahypothalamic neurons, (iii) maintenance of neuron homeostasis, (iv) regulation of synthesis and secretion of GnRH, (v) appropriate receptors/proteins on neurons governing GnRH production and release, (vi) signaling molecules activated by the receptors, (vii) the synthesis and release of GnRH, (viii) the production and release of gonadotropins, (ix) testicular development, (x) synthesis and release of steroid hormones from testes, and (xi)the action of steroid hormones in downstream effector tissues. Defects in components of this system during embryonic development, childhood/adolescence, or adulthood may disrupt/nullify puberty, leading to long-term male infertility and/or hypogonadism. This review provides a list of 598 genes involved in the development of HPT axis and classified according to this schema. Furthermore, this review identifies a subset of 75 genes for which genetic mutations are reported to delay or disrupt male puberty.
Also flagged:COVID-19idiopathic pulmonary fibrosisacute respiratory distress syndromeARDShaemostasisfibrotic lung disease
Journal Article2023-03-01✓ 1 Snippetde Rooij LPMH, Becker LM, Teuwen LA, Boeckx B, Jansen S, Feys S, Verleden S, Liesenborghs L, Stalder AK, Libbrecht S, Van Buyten T, Philips G, Subramanian A, Dumas SJ, Meta E, Borri M, Sokol L, Dendooven A, Truong AK, Gunst J, Van Mol P, Haslbauer JD, Rohlenova K, Menter T, Boudewijns R, Geldhof V, Vinckier S, Amersfoort J, Wuyts W, Van Raemdonck D, Jacobs W, Ceulemans LJ, Weynand B, Thienpont B, Lammens M, Kuehnel M, Eelen G, Dewerchin M, Schoonjans L, Jonigk D, van Dorpe J, Tzankov A, Wauters E, Mazzone M, Neyts J, Wauters J, Lambrechts D, Carmeliet P.
In-Text Gene Mentions
Results)
…expression of CPE,PTGISand NRG1 ;…
Show Full Abstract
<h4>Aims</h4>Severe acute respiratory syndrome coronavirus-2 infection causes COVID-19, which in severe cases evokes life-threatening acute respiratory distress syndrome (ARDS). Transcriptome signatures and the functional relevance of non-vascular cell types (e.g. immune and epithelial cells) in COVID-19 are becoming increasingly evident. However, despite its known contribution to vascular inflammation, recruitment/invasion of immune cells, vascular leakage, and perturbed haemostasis in the lungs of severe COVID-19 patients, an in-depth interrogation of the endothelial cell (EC) compartment in lethal COVID-19 is lacking. Moreover, progressive fibrotic lung disease represents one of the complications of COVID-19 pneumonia and ARDS. Analogous features between idiopathic pulmonary fibrosis (IPF) and COVID-19 suggest partial similarities in their pathophysiology, yet, a head-to-head comparison of pulmonary cell transcriptomes between both conditions has not been implemented to date.<h4>Methods and results</h4>We performed single-nucleus RNA-sequencing on frozen lungs from 7 deceased COVID-19 patients, 6 IPF explant lungs, and 12 controls. The vascular fraction, comprising 38 794 nuclei, could be subclustered into 14 distinct EC subtypes. Non-vascular cell types, comprising 137 746 nuclei, were subclustered and used for EC-interactome analyses. Pulmonary ECs of deceased COVID-19 patients showed an enrichment of genes involved in cellular stress, as well as signatures suggestive of dampened immunomodulation and impaired vessel wall integrity. In addition, increased abundance of a population of systemic capillary and venous ECs was identified in COVID-19 and IPF. COVID-19 systemic ECs closely resembled their IPF counterparts, and a set of 30 genes was found congruently enriched in systemic ECs across studies. Receptor-ligand interaction analysis of ECs with non-vascular cell types in the pulmonary micro-environment revealed numerous previously unknown interactions specifically enriched/depleted in COVID-19 and/or IPF.<h4>Conclusions</h4>This study uncovered novel insights into the abundance, expression patterns, and interactomes of EC subtypes in COVID-19 and IPF, relevant for future investigations into the progression and treatment of both lethal conditions.
Ferroptosis, a new non-necrotizing programmed cell death (PCD), is driven by iron-dependent phospholipid peroxidation. Ferroptosis plays a key role in secondary traumatic brain injury and secondary spinal cord injury and is closely related to inflammation, immunity, and chronic injuries. The inhibitors against ferroptosis effectively improve iron homeostasis, lipid metabolism, redox stabilization, neuronal remodeling, and functional recovery after trauma. In this review, we elaborate on the latest molecular mechanisms of ferroptosis, emphasize its role in secondary central nervous trauma, and update the medicines used to suppress ferroptosis following injuries.
Also flagged:prostate cancerPCasecreted frizzled-related protein 4tumorcancerBCR
Journal Article2023-03-01No SnippetsFeng DC, Zhu WZ, Shi X, Xiong Q, You J, Wei Q, Yang L.
Show Full Abstract
We identified distinct senescence-related molecular subtypes and critical genes among prostate cancer (PCa) patients undergoing radical prostatectomy (RP) or radical radiotherapy (RT). We conducted all analyses using R software and its suitable packages. Twelve genes, namely, secreted frizzled-related protein 4 (SFRP4), DNA topoisomerase II alpha (TOP2A), pleiotrophin (PTN), family with sequence similarity 107 member A (FAM107A), C-X-C motif chemokine ligand 14 (CXCL14), prostate androgen-regulated mucin-like protein 1 (PARM1), leucine zipper protein 2 (LUZP2), cluster of differentiation 38 (CD38), cartilage oligomeric matrix protein (COMP), vestigial-like family member 3 (VGLL3), apolipoprotein E (APOE), and aldehyde dehydrogenase 2 family member (ALDH2), were eventually used to subtype PCa patients from The Cancer Genome Atlas (TCGA) database and GSE116918, and the molecular subtypes showed good correlations with clinical features. In terms of the tumor immune environment (TME) analysis, compared with cluster 1, cancer-associated fibroblasts (CAFs) scored significantly higher, while endothelial cells scored lower in cluster 2 in TCGA database. There was a statistically significant correlation between both CAFs and endothelial cells with biochemical recurrence (BCR)-free survival for PCa patients undergoing RP. For the GSE116918 database, cluster 2 had significantly lower levels of CAFs and tumor purity and higher levels of stromal, immune, and Estimation of STromal and Immune cells in MAlignant Tumor tissues using Expression data (ESTIMATE) scores than cluster 1; in addition, patients with high levels of CAFs, stromal scores, immune scores, and ESTIMATE scores and low levels of tumor purity tended to suffer from BCR. Based on the median of differentially expressed checkpoints, high expression of CD96, hepatitis A virus cellular receptor 2 (HAVCR2), and neuropilin 1 (NRP1) in GSE116918 and high expression of CD160 and tumor necrosis factor (ligand) superfamily member 18 (TNFSF18) in TCGA database were associated with a significantly higher risk of BCR than their counterparts. In conclusion, we first constructed distinct molecular subtypes and critical genes for PCa patients undergoing RP or RT from the fresh perspective of senescence.
Also flagged:Huntington diseaseHDautosomal dominant neurodegenerative disorderchromosomesglutamineproline
Journal Article2023-03-01✓ 5 SnippetsRuiz de Sabando A, Urrutia Lafuente E, Galbete A, Ciosi M, García Amigot F, García Solaesa V, Spanish HD Collaborative group, Monckton DG, Ramos-Arroyo MA.
In-Text Gene Mentions
Introduction)
…Huntington disease (HD; OMIM 143 100) is an autosomal dominant neurodegenerative disorder caused by a pathogenic expansion of the CAG trinucleotide in the huntingtin (HTT) gene.…
S I O 000419)
…HTT gene molecular characteristics of Huntington disease families with intergenerational changes of > 5 CAGs…
Title)
…SpanishHTTgene study reveals…
Abstract)
…analysis of theHTTgene in a…
Introduction)
…the huntingtin (HTT) gene.…
Show Full Abstract
We aimed to determine the genetic diversity and molecular characteristics of the Huntington disease (HD) gene (HTT) in Spain. We performed an extended haplotype and exon one deep sequencing analysis of the HTT gene in a nationwide cohort of population-based controls (n = 520) and families with symptomatic individuals referred for HD genetic testing. This group included 331 HD cases and 140 carriers of intermediate alleles. Clinical and family history data were obtained when available. Spanish normal alleles are enriched in C haplotypes (40.1%), whereas A1 (39.8%) and A2 (31.6%) prevail among intermediate and expanded alleles, respectively. Alleles ≥ 50 CAG repeats are primarily associated with haplotypes A2 (38.9%) and C (32%), which are also present in 50% and 21.4%, respectively, of HD families with large intergenerational expansions. Non-canonical variants of exon one sequence are less frequent, but much more diverse, in alleles of ≥27 CAG repeats. The deletion of CAACAG, one of the six rare variants not observed among smaller normal alleles, is associated with haplotype C and appears to correlate with larger intergenerational expansions and early onset of symptoms. Spanish HD haplotypes are characterized by a high genetic diversity, potentially admixed with other non-Caucasian populations, with a higher representation of A2 and C haplotypes than most European populations. Differences in haplotype distributions across the CAG length range support differential germline expansion dynamics, with A2 and C showing the largest intergenerational expansions. This haplotype-dependent germline instability may be driven by specific cis-elements, such as the CAACAG deletion.
Also flagged:olfactionKallmann syndromeKSsecretionpubertyLH
Journal Article2023-03-01No SnippetsDwyer AA, Stamou MI, Anghel E, Hornstein S, Chen D, Salnikov KB, McDonald IR, Plummer L, Seminara SB, Balasubramanian R.
Show Full Abstract
<h4>Context</h4>Isolated hypogonadotropic hypogonadism (IHH) is phenotypically and genetically heterogeneous.<h4>Objective</h4>This work aimed to determine the correlation between genotypic severity with pubertal and neuroendocrine phenotypes in IHH men.<h4>Methods</h4>A retrospective study was conducted (1980-2020) examining olfaction (Kallmann syndrome [KS] vs normosmic IHH [nHH]), baseline testicular volume (absent vs partial puberty), neuroendocrine profiling (pulsatile vs apulsatile luteinizing hormone [LH] secretion), and genetic variants in 62 IHH-associated genes through exome sequencing (ES).<h4>Results</h4>In total, 242 men (KS: n = 131 [54%], nHH: n = 111 [46%]) were included. Men with absent puberty had significantly lower gonadotropin levels (P < .001) and were more likely to have undetectable LH (P < .001). Logistic regression showed partial puberty as a statistically significant predictor of pulsatile LH secretion (R2 = 0.71, P < .001, OR: 10.8; 95% CI, 3.6-38.6). Serum LH of 2.10 IU/L had a 95% true positive rate for predicting LH pulsatility. Genetic analyses in 204 of 242 IHH men with ES data available revealed 36 of 204 (18%) men carried protein-truncating variants (PTVs) in 12 IHH genes. Men with absent puberty and apulsatile LH were enriched for oligogenic PTVs (P < .001), with variants in ANOS1 being the predominant PTV in this genotype-phenotype association. Men with absent puberty were enriched for ANOS1 PTVs compared to partial puberty counterparts (P = .002). PTVs in other IHH genes imparted more variable reproductive phenotypic severity.<h4>Conclusion</h4>Partial puberty and LH greater than or equal to 2.10 IU/L are proxies for pulsatile LH secretion. ANOS1 PTVs confer severe reproductive phenotypes. Variable phenotypic severity in the face of severe genetic variants in other IHH genes point to significant neuroendocrine plasticity of the HPG axis in IHH men.
Also flagged:RIPK1GVHDgraft-versus-host diseasereceptor-interacting protein kinase-3RIPK3mixed lineage kinase domain-like protein
Journal Article2023-03-01✓ 4 SnippetsYu X, Ma H, Li B, Ji Y, Du Y, Liu S, Li Z, Hao Y, Tian S, Zhao C, Du Q, Jin Z, Zhu X, Tian Y, Chen X, Sun X, Yang C, Zhu F, Ju J, Zheng Y, Zhang W, Wang J, Yang T, Wang X, Li J, Xu X, Du S, Lu H, Ma F, Zhang H, Zhang Y, Zhang X, Hu S, He S.
In-Text Gene Mentions
Results)
…,41,42 Three-dimensional imaging showed that both Ripk3−/− and Vil-cre Ripk3fl/fl recipients had markedly increased number of OLFM4+ ISCs and lysozyme+ Paneth cells in the small intestine compared with WT recipients, indicating that inhibiting IEC RIPK3 significantly protects the crypt base compartment against GVHD (Figure 1F-G; supplemental Figure 1K).…
Results)
…GVHD is associated with the loss of intestinal stem cells (ISCs, marked by OLFM4) and their niche Paneth cells (marked by lysozyme).10…
Results)
…(ISCs, marked byOLFM4) and their niche…
Results)
…increased number ofOLFM4+ ISCs and…
Show Full Abstract
Intestinal epithelial cells (IECs) are implicated in the propagation of T-cell-mediated inflammatory diseases, including graft-versus-host disease (GVHD), but the underlying mechanism remains poorly defined. Here, we report that IECs require receptor-interacting protein kinase-3 (RIPK3) to drive both gastrointestinal (GI) tract and systemic GVHD after allogeneic hematopoietic stem cell transplantation. Selectively inhibiting RIPK3 in IECs markedly reduces GVHD in murine intestine and liver. IEC RIPK3 cooperates with RIPK1 to trigger mixed lineage kinase domain-like protein-independent production of T-cell-recruiting chemokines and major histocompatibility complex (MHC) class II molecules, which amplify and sustain alloreactive T-cell responses. Alloreactive T-cell-produced interferon gamma enhances this RIPK1/RIPK3 action in IECs through a JAK/STAT1-dependent mechanism, creating a feed-forward inflammatory cascade. RIPK1/RIPK3 forms a complex with JAK1 to promote STAT1 activation in IECs. The RIPK1/RIPK3-mediated inflammatory cascade of alloreactive T-cell responses results in intestinal tissue damage, converting the local inflammation into a systemic syndrome. Human patients with severe GVHD showed highly activated RIPK1 in the colon epithelium. Finally, we discover a selective and potent RIPK1 inhibitor (Zharp1-211) that significantly reduces JAK/STAT1-mediated expression of chemokines and MHC class II molecules in IECs, restores intestinal homeostasis, and arrests GVHD without compromising the graft-versus-leukemia (GVL) effect. Thus, targeting RIPK1/RIPK3 in IECs represents an effective nonimmunosuppressive strategy for GVHD treatment and potentially for other diseases involving GI tract inflammation.
…The expression of miR-19b-3p and SOX6 in umbilical blood of HIE patients was detected by qRT-PCR assay.…
Title)
…MiR-19b-3p Inhibits Hypoxia-Ischemia Encephalopathy by Inhibiting SOX6 Expression via Activating Wnt/β-catenin Pathway.…
Abstract)
…MiR-19b-3p expression was once down-regulated, whilst SOX6 expression was up-regulated in HIE patients.…
Title)
…Encephalopathy by InhibitingSOX6Expression via Activating…
Abstract)
…of miR-19b-3p andSOX6in umbilical blood…
Show Full Abstract
Hypoxic-ischemic encephalopathy (HIE) is a detrimental factor in infant death and chronic disease. The specific pathogenesis is not entirely clear. Therefore, exploring the pathogenesis of HIE is critical. The expression of miR-19b-3p and SOX6 in umbilical blood of HIE patients was detected by qRT-PCR assay. HT22 cells were triggered with oxygen-glucose deprivation/reoxygenation (OGD/R) to construct the HIE cell model. Cell Counting Kit-8 (CCK-8) assay was used to estimate viability. SOD and MDA levels were detected by enzyme linked immunosorbent assay. Flow cytometry was implemented to ascertain neurocyte apoptosis. Cellular β-catenin immunofluorescence staining was used to detect the expression and distribution of β-catenin protein. Wnt signaling pathway activation was detected by TOPFlash/FOPFlash luciferase reporter assay. The targeting correlation of SOX6 and miR-19b-3p was corroborated by dual-luciferase reporter gene assay and RNA pull-down assay. MiR-19b-3p expression was once down-regulated, whilst SOX6 expression was up-regulated in HIE patients. MiR-19b-3p overexpression promoted cell proliferation, repressed cell apoptosis, oxidative stress response, and Wnt/β-catenin pathway activation in OGD/R-triggered HT22 cells. MiR-19b-3p negatively regulated SOX6 expression. SOX6 knockdown improved OGD/R-triggered HT22 cells injury via Wnt/β-catenin pathway activation. MiR-19b-3p overexpression suppressed OGD/R-triggered HT22 cell injury via inhibiting SOX6 expression via activating Wnt/β-catenin pathway.
Also flagged:Bace1β-secretaseβ-amyloidpeptidesnucleusThy-1
Journal Article2023-03-01✓ 2 SnippetsBenoit MR, Darboe M, Das B, Ge Y, Zhou J, Yao A, He W, Yan R, Hu X.
In-Text Gene Mentions
Abstract)
…decrease in neuronalPCDH17, potentially affecting commun…
Text
…PCDH17…
Show Full Abstract
Beta amyloid cleaving enzyme 1 (BACE1) is largely expressed by neurons and is the sole β-secretase for initiating the production of neuronal β-amyloid peptides (Aβ). To fully understand the physiological functions of neuronal BACE1, we used mouse genetic approach coupled with unbiased single nucleus RNA sequencing (snRNAseq) to investigate how targeted deletion of Bace1 in neurons, driven by Thy-1-Cre recombinase, would affect functions in the nervous system. Our transcriptome results revealed that BACE1 is essential for maturation of neural precursor cells and oligodendrocytes in mice. RNA velocity analysis confirmed deficit in the trajectory of neuroblasts in reaching the immature granule neuron state in young Bace1fl/fl; Thy1-cre mice. Further analysis of differential gene expression indicated changes in genes important for SNARE signaling, tight junction signaling, synaptogenesis and insulin secretion pathways. Morphological studies revealed a hypomyelination in Bace1fl/fl;Thy1-cre sciatic nerves, but no detectable myelination changes in the corpus callosum, despite clear reduction in myelination proteins in the brain. Functional studies showed reduction in long-term potential, defects in synaptogenesis and learning behavioral. Altogether, our results show that neuronal BACE1 is critical for optimal development of central and peripheral nervous system, and inhibition of neuronal BACE1 will result in deficits in synaptic functions and cognitive behaviors.
Also flagged:NucleosomeTumorprostate cancersandrogen receptorhistonetranscription factor
Journal Article2023-03-01No SnippetsDe Sarkar N, Patton RD, Doebley AL, Hanratty B, Adil M, Kreitzman AJ, Sarthy JF, Ko M, Brahma S, Meers MP, Janssens DH, Ang LS, Coleman IM, Bose A, Dumpit RF, Lucas JM, Nunez TA, Nguyen HM, McClure HM, Pritchard CC, Schweizer MT, Morrissey C, Choudhury AD, Baca SC, Berchuck JE, Freedman ML, Ahmad K, Haffner MC, Montgomery RB, Corey E, Henikoff S, Nelson PS, Ha G.
Show Full Abstract
Advanced prostate cancers comprise distinct phenotypes, but tumor classification remains clinically challenging. Here, we harnessed circulating tumor DNA (ctDNA) to study tumor phenotypes by ascertaining nucleosome positioning patterns associated with transcription regulation. We sequenced plasma ctDNA whole genomes from patient-derived xenografts representing a spectrum of androgen receptor active (ARPC) and neuroendocrine (NEPC) prostate cancers. Nucleosome patterns associated with transcriptional activity were reflected in ctDNA at regions of genes, promoters, histone modifications, transcription factor binding, and accessible chromatin. We identified the activity of key phenotype-defining transcriptional regulators from ctDNA, including AR, ASCL1, HOXB13, HNF4G, and GATA2. To distinguish NEPC and ARPC in patient plasma samples, we developed prediction models that achieved accuracies of 97% for dominant phenotypes and 87% for mixed clinical phenotypes. Although phenotype classification is typically assessed by IHC or transcriptome profiling from tumor biopsies, we demonstrate that ctDNA provides comparable results with diagnostic advantages for precision oncology.<h4>Significance</h4>This study provides insights into the dynamics of nucleosome positioning and gene regulation associated with cancer phenotypes that can be ascertained from ctDNA. New methods for classification in phenotype mixtures extend the utility of ctDNA beyond assessments of somatic DNA alterations with important implications for molecular classification and precision oncology. This article is highlighted in the In This Issue feature, p. 517.
Also flagged:COVID-19SARS-CoV-2 infectionIL-8CXCR2neutrophiliaacute respiratory distress syndrome
Journal Article2023-03-01✓ 1 SnippetEddins DJ, Yang J, Kosters A, Giacalone VD, Pechuan-Jorge X, Chandler JD, Eum J, Babcock BR, Dobosh BS, Hernández MR, Abdulkhader F, Collins GL, Orlova DY, Ramonell RP, Sanz I, Moussion C, Eun-Hyung Lee F, Tirouvanziam RM, Ghosn EEB.
In-Text Gene Mentions
Results)
…, RETN ,OLFM4, DEFA3 ,…
Show Full Abstract
Troubling disparities in COVID-19-associated mortality emerged early, with nearly 70% of deaths confined to Black/African American (AA) patients in some areas. However, targeted studies on this vulnerable population are scarce. Here, we applied multiomics single-cell analyses of immune profiles from matching airways and blood samples of Black/AA patients during acute SARS-CoV-2 infection. Transcriptional reprogramming of infiltrating IFITM2+/S100A12+ mature neutrophils, likely recruited via the IL-8/CXCR2 axis, leads to persistent and self-sustaining pulmonary neutrophilia with advanced features of acute respiratory distress syndrome (ARDS) despite low viral load in the airways. In addition, exacerbated neutrophil production of IL-8, IL-1β, IL-6, and CCL3/4, along with elevated levels of neutrophil elastase and myeloperoxidase, were the hallmarks of transcriptionally active and pathogenic airway neutrophilia. Although our analysis was limited to Black/AA patients and was not designed as a comparative study across different ethnicities, we present an unprecedented in-depth analysis of the immunopathology that leads to acute respiratory distress syndrome in a well-defined patient population disproportionally affected by severe COVID-19.
…such protein istransient receptor potential channel of canonical subfamily, member 6receptor potential channel…
Show Full Abstract
For some molecular players in red blood cells (RBCs), the functional indications and molecular evidence are discrepant. One such protein is transient receptor potential channel of canonical subfamily, member 6 (TRPC6). Transcriptome analysis of reticulocytes revealed the presence of TRPC6 in mouse RBCs and its absence in human RBCs. We transfused TRPC6 knockout RBCs into wild-type mice and performed functional tests. We observed the "rescue" of TRPC6 within 10 days; however, the "rescue" was slower in splenectomized mice. The latter finding led us to mimic the mechanical challenge with the cantilever of an atomic force microscope and simultaneously carry out imaging by confocal (3D) microscopy. We observed the strong interaction of RBCs with the opposed surface at around 200 pN and the formation of tethers. The results of both the transfusion experiments and the atomic force spectroscopy suggest mechanically stimulated protein transfer to RBCs as a protein source in the absence of the translational machinery. This protein transfer mechanism has the potential to be utilized in therapeutic contexts, especially for hereditary diseases involving RBCs, such as hereditary xerocytosis or Gárdos channelopathy.
Also flagged:Head and Neck CancertumortumorsTP53MYO18BKMT2D
Journal Article2023-03-01✓ 3 SnippetsMezghani N, Yao A, Vasilyeva D, Kaplan N, Shackelford A, Yoon A, Phillipone E, Dubey S, Schwartz GK, Taylor AM, Momen-Heravi F.
In-Text Gene Mentions
Abstract)
…MYO18B, KMT2D, andUNC13Cmutations while a…
Text
…UNC13C…
Text
…SERPINC1…
Show Full Abstract
<h4>Purpose</h4>The purpose of this study was to better understand the complex molecular biomarkers and signatures of head and neck cancer (HNC) among Black patients and identify possible molecular changes associated with HNC disparities.<h4>Experimental design</h4>Molecular subtypes and genomic changes in HNC samples from patients of African and European ancestry in The Cancer Genome Atlas, Memorial Sloan Kettering Cancer Center, Broad Institute, MD Anderson Cancer Center, and John Hopkins University were identified. Molecular features (genomic, proteomic, transcriptomic) associated with race and genomic alterations associated with clinical outcomes were determined. An independent cohort of HNC tumor specimens was used to validate the primary findings using IHC.<h4>Results</h4>Black patients were found to have a younger age at diagnosis, more aggressive tumor types, higher rates of metastasis, and worse survival compared with White patients. Black patients had fewer human papillomavirus-positive tumor types and higher frequencies of laryngeal subtype tumors. Higher frequencies of TP53, MYO18B, KMT2D, and UNC13C mutations and a lower frequency of PIK3CA mutations were observed in Black patients. Tumors of Black patients showed significant enrichment of c-MYC and RET-tyrosine signaling and amplifications. A significant increase in tumor expression of c-MYC in Black patients was observed and was associated with poor survival outcomes in the independent cohort.<h4>Conclusions</h4>Novel genomic modifications and molecular signatures may be related to environmental, social, and behavioral factors associated with racial disparities in HNC. Unique tumor mutations and biological pathways have potential clinical utility in providing more targeted and individualized screening, diagnostic, and treatment modalities to improve health outcomes.
Also flagged:Prostate Cancerprostate cancer tumortumorgene expressioninflammatory responsecancers
Journal Article2023-03-01✓ 1 SnippetMa C, Zhou Y, Fanelli GN, Stopsack KH, Fiorentino M, Zadra G, Mucci LA, Loda M, Tyekucheva S, Penney KL.
In-Text Gene Mentions
Text
…VSIG10…
Show Full Abstract
Prostate cancer has a heterogeneous prognosis. Most previous studies have focused on the identification of prognostic biomarkers in the prostate cancer tumor. However, it is increasingly recognized that the tumor microenvironment contributes to prostate cancer aggressiveness and progression. We therefore examined whole transcriptome expression of the prostate stroma and associations with aggressive and lethal prostate cancer. We performed RNA sequencing (Illumina TruSeq Exome Capture) of 272 tumor-adjacent and 120 benign-adjacent macrodissected prostate stromal samples from 293 men with prostate cancer from the Health Professionals Follow-up Study and Physicians' Health Study. We performed differential expression analysis comparing gene expression and pathways by Gleason score and lethal outcome. We also tested a previously developed stromal gene signature of Gleason score in these datasets. Comparing high- with low-Gleason score cancers, 26 genes (P < 0.001) and 12 pathways (FDR < 0.20) were significantly differentially expressed in tumor-adjacent stroma, including pathways related to stroma composition remodeling and DNA repair, with 73 genes and 65 pathways significant in benign-adjacent stroma. Comparing lethal with nonlethal prostate cancer, 11 genes were differentially expressed in tumor-adjacent and 15 genes in benign-adjacent stroma, and pathways involved in inflammatory response were differentially enriched in both tumor and benign-adjacent stroma. In addition, our previously identified Gleason stromal gene signature was validated to be associated with Gleason score in these data. Implications: Our study uncovers stroma-specific genes and pathways that are differentially enriched with high Gleason score and lethal prostate cancer, demonstrating that the molecular investigation of the tumor microenvironment can provide additional information about prostate cancer prognosis.
Also flagged:cell adhesion moleculesCAMsynapsesaxonlocalizationCelsr1
Journal Article2023-03-01✓ 2 SnippetsSakai N, Sun P, Kim B, Emmons SW.
In-Text Gene Mentions
Abstract)
…in mutants of UNC-40/DCC, SAX-3/ROBO, and FMI-1/Flamin…
Introduction)
…that mutations in unc-40/DCCand sax-3/ROBO prevented…
Show Full Abstract
For proper functioning of the nervous system, it is crucial that neurons find their appropriate partners and build the correct neural connection patterns. Although cell adhesion molecules (CAMs) have been studied for many years as essential players in neural connections, we have yet to unravel the code by which CAMs encode synaptic specificity. We analyzed the effects of mutations in CAM genes on the morphology and synapses of a set of sensory neurons in the Caenorhabditis elegans male tail. B-type ray sensory neurons express 10 genes encoding CAMs. We examined the effect on axon trajectory and localization of pre-synaptic components in viable mutants of nine of these. We found axon trajectory defects in mutants of UNC-40/DCC, SAX-3/ROBO, and FMI-1/Flamingo/Celsr1. None of the mutations caused loss of pre-synaptic components in axons, and in several the level even appeared to increase, suggesting possible accumulation of pre-synapses. B-type sensory neurons fasciculate with a second type of ray sensory neuron, the A-type, in axon commissures. We found a CAM expressed in A-type functions additively with a CAM expressed in B-type in axon guidance, and lack of a CAM expressed in B-type affected A-type axon guidance. Overall, single and multiple mutants of CAM genes had limited effects on ray neuron trajectories and accumulation of synaptic components.
Also flagged:HDautosomal dominant disorderchromosomemovement disorderanxietydepression
Journal Article2023-03-01✓ 2 SnippetsLi E, Choi J, Sim HR, Kim J, Jun JH, Kyung J, Ha N, Kim S, Ryu KH, Chung SS, Kim HS, Lee S, Seol W, Song J.
In-Text Gene Mentions
Introduction)
…Rather thanHTTfragments, the YAC128…
Abstract)
…aggregation of mutantHTTproteins.…
Show Full Abstract
Huntington's disease (HD) is a neurodegenerative disorder, of which pathogenesis is caused by a polyglutamine expansion in the amino-terminus of huntingtin gene that resulted in the aggregation of mutant HTT proteins. HD is characterized by progressive motor dysfunction, cognitive impairment and neuropsychiatric disturbances. Histone deacetylase 6 (HDAC6), a microtubule-associated deacetylase, has been shown to induce transport- and release-defect phenotypes in HD models, whilst treatment with HDAC6 inhibitors ameliorates the phenotypic effects of HD by increasing the levels of α-tubulin acetylation, as well as decreasing the accumulation of mutant huntingtin (mHTT) aggregates, suggesting HDAC6 inhibitor as a HD therapeutics. In this study, we employed in vitro neural stem cell (NSC) model and in vivo YAC128 transgenic (TG) mouse model of HD to test the effect of a novel HDAC6 selective inhibitor, CKD-504, developed by Chong Kun Dang (CKD Pharmaceutical Corp., Korea). We found that treatment of CKD-504 increased tubulin acetylation, microtubule stabilization, axonal transport, and the decrease of mutant huntingtin protein in vitro. From in vivo study, we observed CKD-504 improved the pathology of Huntington's disease: alleviated behavioral deficits, increased axonal transport and number of neurons, restored synaptic function in corticostriatal (CS) circuit, reduced mHTT accumulation, inflammation and tau hyperphosphorylation in YAC128 TG mouse model. These novel results highlight CKD-504 as a potential therapeutic strategy in HD. [BMB Reports 2023; 56(3): 178-183].
Also flagged:PhagocytosisGliomaTumorglioblastomaGBMimmune-checkpoint proteins
Journal Article2023-03-01✓ 2 SnippetsWu M, Wu L, Wu W, Zhu M, Li J, Wang Z, Li J, Ding R, Liang Y, Li L, Zhang T, Huang B, Cai Y, Li K, Li L, Zhang R, Hu B, Lin F, Wang X, Zheng S, Chen J, You Y, Jiang T, Zhang J, Chen H, Wang Q.
Tumor-associated macrophages (TAM) play a crucial role in immunosuppression. However, how TAMs are transformed into immunosuppressive phenotypes and influence the tumor microenvironment (TME) is not fully understood. Here, we utilized single-cell RNA sequencing and whole-exome sequencing data of glioblastoma (GBM) tissues and identified a subset of TAMs dually expressing macrophage and tumor signatures, which were termed double-positive TAMs. Double-positive TAMs tended to be bone marrow-derived macrophages (BMDM) and were characterized by immunosuppressive phenotypes. Phagocytosis of glioma cells by BMDMs in vitro generated double-positive TAMs with similar immunosuppressive phenotypes to double-positive TAMs in the GBM TME of patients. The double-positive TAMs were transformed into M2-like macrophages and drove immunosuppression by expressing immune-checkpoint proteins CD276, PD-L1, and PD-L2 and suppressing the proliferation of activated T cells. Together, glioma cell phagocytosis by BMDMs in the TME leads to the formation of double-positive TAMs with enhanced immunosuppressive phenotypes, shedding light on the processes driving TAM-mediated immunosuppression in GBM.<h4>Significance</h4>Bone marrow-derived macrophages phagocytose glioblastoma cells to form double-positive cells, dually expressing macrophage and tumor signatures that are transformed into M2-like macrophages and drive immunosuppression.
Also flagged:CD161alcoholtumorsHPV infectionCD161 receptorimmune response
Journal Article2023-03-01✓ 1 SnippetWei Y, Xu T, Li C, Zhou X, Qian W, Shen C, Wang Q, Xing X, Ou X, He X, Yin H, Hu C, Wang Y, Ji Q, Su F, Lu X.
In-Text Gene Mentions
Methods)
…related signature (CA10, ITGA1 ,…
Show Full Abstract
Human papillomavirus (HPV)-driven oropharyngeal carcinoma (OPSCC) is distinct from tobacco- or alcohol-associated OPSCC and has a unique immune landscape. Studies have supported the heterogeneity of T cells, accompanied by a broad repertoire of T-cell responses, within tumors driven by HPV infection. However, the phenotype and function of these HPV-related T cells remain unclear. Using a combination of single-cell RNA sequencing, flow cytometry, pharmacologic inhibition, and immunofluorescence staining, we explored the prognostic implication of HPV-related T cells and further validated our findings in two independent cohorts. Cytotoxic T lymphocytes (CTL) within OPSCC displayed a spectrum of transcriptional signatures. Among which, we identified CD161 receptor, encoded by KLRB1, as a potential marker to distinguish the CTL subsets in HPV-positive OPSCC with a divergent evolutionary trajectory. In-depth analysis revealed that CD161+ CTLs exhibited a more robust immune response over the CD161- counterparts and a T cell-inflamed phenotype that could be further reinvigorated by immune-checkpoint blockade. Despite the high expression of exhaustion markers, reinforcement of CD161+ CTL reactivity was expected to boost immune responses, considering their functional reversibility. We further confirmed that the high level of intratumoral CD161+ CTLs associated with a favorable treatment response and prolonged overall survival. Therefore, our research not only provides an insight into the immune landscape of HPV-driven OPSCC but also sheds light on a special subset of CTLs with prognostic and therapeutic significance.
Also flagged:KDM6ACell Proliferationhistone lysine demethylasebladder cancerFOXA1binding
Journal Article2023-03-01✓ 1 SnippetQiu H, Makarov V, Bolzenius JK, Halstead A, Parker Y, Wang A, Iyer GV, Wise H, Kim D, Thayaparan V, Lindner DJ, Haber GP, Ting AH, Ren B, Chan TA, Arora V, Solit DB, Lee BH.
In-Text Gene Mentions
Text
…chromatin modifiers…
Show Full Abstract
Disruption of KDM6A, a histone lysine demethylase, is one of the most common somatic alternations in bladder cancer. Insights into how KDM6A mutations affect the epigenetic landscape to promote carcinogenesis could help reveal potential new treatment approaches. Here, we demonstrated that KDM6A loss triggers an epigenetic switch that disrupts urothelial differentiation and induces a neoplastic state characterized by increased cell proliferation. In bladder cancer cells with intact KDM6A, FOXA1 interacted with KDM6A to activate genes instructing urothelial differentiation. KDM6A-deficient cells displayed simultaneous loss of FOXA1 target binding and genome-wide redistribution of the bZIP transcription factor ATF3, which in turn repressed FOXA1-target genes and activated cell-cycle progression genes. Importantly, ATF3 depletion reversed the cell proliferation phenotype induced by KDM6A deficiency. These data establish that KDM6A loss engenders an epigenetic state that drives tumor growth in an ATF3-dependent manner, creating a potentially targetable molecular vulnerability.<h4>Significance</h4>A gain-of-function epigenetic switch that disrupts differentiation is triggered by inactivating KDM6A mutations in bladder cancer and can serve as a potential target for novel therapies.
Also flagged:autoimmune diseaselupusimmune responsesphosphorylationIgGCD40
Journal Article2023-03-01No SnippetsRaparia C, Quach TD, Zeumer-Spataro L, Choi SC, Yi Z, Zhang W, Morel L, Davidson A.
Show Full Abstract
Systemic lupus erythematosus is a complex autoimmune disease with significant morbidity that demands further examination of tolerance-inducing treatments. Short-term treatment of lupus-prone NZB/WF1 mice with combination CTLA4Ig and anti-CD40 ligand, but not single treatment alone, suppresses disease for >6 mo via modulation of B and T cell function while maintaining immune responses to exogenous Ags. Three months after a 2-wk course of combination costimulatory blockade, we found a modest decrease in the number of activated T and B cells in both combination and single-treatment cohorts compared with untreated controls. However, only combination treatment mice showed a 50% decrease in spare respiratory capacity of splenic B and T cells. RNA sequencing and gene set enrichment analysis of germinal center (GC) B cells confirmed a reduction in the oxidative phosphorylation signature in the combination treatment cohort. This cohort also manifested increased expression of BCR-associated signaling molecules and increased phosphorylation of PLCγ in GC B cells after stimulation with anti-IgG and anti-CD40. GC B cells from combination treatment mice also displayed a signature involving remodeling of GPI-linked surface proteins. Accordingly, we found a decrease in cell surface expression of the inhibitory molecule CD24 on class-switched memory B cells from aged NZB/W mice that corrected in the combination treatment cohort. Because both a profound decrease in BCR signaling and remodeled immune cell metabolism enhance loss of tolerance in lupus-prone mice, our findings help to explain the restoration of tolerance observed after short-term combination costimulatory blockade.
Also flagged:cell differentiationretinaltranscription factorAtoh7Neurog2Foxn4
Journal Article2023-03-01✓ 1 SnippetGe Y, Chen X, Nan N, Bard J, Wu F, Yergeau D, Liu T, Wang J, Mu X.
In-Text Gene Mentions
Results)
…as Elavl4 ,Dcc, Vav3 and…
Show Full Abstract
How the diverse neural cell types emerge from multipotent neural progenitor cells during central nervous system development remains poorly understood. Recent scRNA-seq studies have delineated the developmental trajectories of individual neural cell types in many neural systems including the neural retina. Further understanding of the formation of neural cell diversity requires knowledge about how the epigenetic landscape shifts along individual cell lineages and how key transcription factors regulate these changes. In this study, we dissect the changes in the epigenetic landscape during early retinal cell differentiation by scATAC-seq and identify globally the enhancers, enriched motifs, and potential interacting transcription factors underlying the cell state/type specific gene expression in individual lineages. Using CUT&Tag, we further identify the enhancers bound directly by four key transcription factors, Otx2, Atoh7, Pou4f2 and Isl1, including those dependent on Atoh7, and uncover the sequential and combinatorial interactions of these factors with the epigenetic landscape to control gene expression along individual retinal cell lineages such as retinal ganglion cells (RGCs). Our results reveal a general paradigm in which transcription factors collaborate and compete to regulate the emergence of distinct retinal cell types such as RGCs from multipotent retinal progenitor cells (RPCs).
The intestinal epithelial regeneration is driven by intestinal stem cells under homeostatic conditions. Differentiated intestinal epithelial cells, such as Paneth cells, are capable of acquiring multipotency and contributing to regeneration upon the loss of intestinal stem cells. Paneth cells also support intestinal stem cell survival and regeneration. We report here that depletion of an RNA-binding protein named polypyrimidine tract binding protein 1 (PTBP1) in mouse intestinal epithelial cells causes intestinal stem cell death and epithelial regeneration failure. Mechanistically, we show that PTBP1 inhibits neuronal-like splicing programs in intestinal crypt cells, which is critical for maintaining intestinal stem cell stemness. This function is achieved at least in part through promoting the non-productive splicing of its paralog PTBP2. Moreover, PTBP1 inhibits the expression of an AKT inhibitor PHLDA3 in Paneth cells and permits AKT activation, which presumably maintains Paneth cell plasticity and function in supporting intestinal stem cell niche. We show that PTBP1 directly binds to a CU-rich region in the 3' UTR of Phlda3, which we demonstrate to be critical for downregulating the mRNA and protein levels of Phlda3. Our results thus reveal the multifaceted in vivo regulation of intestinal epithelial regeneration by PTBP1 at the post-transcriptional level.
Apolipoprotein E (APOE) is a lipid transporter produced predominantly by astrocytes in the brain. The ε4 variant of APOE (APOE4) is the strongest and most common genetic risk factor for Alzheimer's disease (AD). Although the molecular mechanisms of this increased risk are unclear, APOE4 is known to alter immune signaling and lipid and glucose metabolism. Astrocytes provide various forms of support to neurons, including regulating neuronal metabolism and immune responses through cytokine signaling. Changes in astrocyte function because of APOE4 may therefore decrease neuronal support, leaving neurons more vulnerable to stress and disease insults. To determine whether APOE4 alters astrocyte neuronal support functions, we measured glycolytic and oxidative metabolism of neurons treated with conditioned media from APOE4 or APOE3 (the common, risk-neutral variant) primary astrocyte cultures. We found that APOE4 neurons treated with conditioned media from resting APOE4 astrocytes had similar metabolism to APOE3 neurons treated with media from resting APOE3 astrocytes, but treatment with astrocytic conditioned media from astrocytes challenged with amyloid-β (Aβ), a key pathological protein in AD, caused APOE4 neurons to increase their basal mitochondrial and glycolytic metabolic rates more than APOE3 neurons. These changes were not because of differences in astrocytic lactate production or glucose utilization, but instead correlated with increased glycolytic ATP production and a lack of cytokine secretion in response to Aβ. Additionally, we identified that astrocytic cytokine signatures could predict basal metabolism of neurons treated with the astrocytic conditioned media. Together, these findings suggest that in the presence of Aβ, APOE4 astrocytes alter immune and metabolic functions that result in a compensatory increase in neuronal metabolic stress.
Also flagged:cancerprogrammed death ligand-1Programmed cell death protein-1PD-1PD-L1antibody
Journal Article2023-03-01No SnippetsZou W, Luo X, Gao M, Yu C, Wan X, Yu S, Wu Y, Wang A, Fenical W, Wei Z, Zhao Y, Lu Y.
Show Full Abstract
Programmed cell death protein-1 (PD-1)/programmed death ligand-1 (PD-L1) immune checkpoint blockade as a breakthrough in cancer immunotherapy has shown unprecedented positive outcomes in the clinic. However, the overall effectiveness of PD-L1 antibody is less than expected. An increasing number of studies have demonstrated that PD-L1 is widely distributed and expressed not only on the cell membrane but also on the inside of the cells as well as on the extracellular vesicles secreted by tumour cells. Both endogenous and exogenous PD-L1 play significant roles in influencing the therapeutic effect of anti-tumour immunity. Herein, we mainly focused on the distribution and function of PD-L1 and further summarized the potential targeted therapeutic strategies. More importantly, in addition to taking the overall expression abundance of PD-L1 as a predictive indicator for selecting corresponding PD-1/PD-L1 monoclonal antibodies (mAbs), we also proposed that personalized combination therapies based on the different distribution of PD-L1 are worth attention to achieve more efficient and effective therapeutic outcomes in cancer patients. LINKED ARTICLES: This article is part of a themed issue on Cancer Microenvironment and Pharmacological Interventions. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v181.2/issuetoc.
Also flagged:Wntgene expressionpigmentationchromosomebehavioralwater
Journal Article2023-03-01No SnippetsMack KL, Square TA, Zhao B, Miller CT, Fraser HB.
Show Full Abstract
Cis-regulatory changes are thought to play a major role in adaptation. Threespine sticklebacks have repeatedly colonized freshwater habitats in the Northern Hemisphere, where they have evolved a suite of phenotypes that distinguish them from marine populations, including changes in physiology, behavior, and morphology. To understand the role of gene regulatory evolution in adaptive divergence, here we investigate cis-regulatory changes in gene expression between marine and freshwater ecotypes through allele-specific expression (ASE) in F1 hybrids. Surveying seven ecologically relevant tissues, including three sampled across two developmental stages, we identified cis-regulatory divergence affecting a third of genes, nearly half of which were tissue-specific. Next, we compared allele-specific expression in dental tissues at two timepoints to characterize cis-regulatory changes during development between marine and freshwater fish. Applying a genome-wide test for selection on cis-regulatory changes, we find evidence for lineage-specific selection on several processes between ecotypes, including the Wnt signaling pathway in dental tissues. Finally, we show that genes with ASE, particularly those that are tissue-specific, are strongly enriched in genomic regions of repeated marine-freshwater divergence, supporting an important role for these cis-regulatory differences in parallel adaptive evolution of sticklebacks to freshwater habitats. Altogether, our results provide insight into the cis-regulatory landscape of divergence between stickleback ecotypes across tissues and during development, and support a fundamental role for tissue-specific cis-regulatory changes in rapid adaptation to new environments.
Also flagged:CDK4breast cancerCDKCyclinkinasepalbociclib
Journal Article2023-03-01✓ 1 SnippetMouron S, Bueno MJ, Muñoz M, Torres R, Rodríguez S, Apala JV, Silva J, Sánchez-Bayona R, Manso L, Guerra J, Rodriguez-Lajusticia L, Malon D, Malumbres M, Quintela-Fandino M.
In-Text Gene Mentions
S I O 001029)
…A) Western blots of CDK2 (upper panels) and CDK4 (lower panels) pull-downs from V/V and G/G clones, in untreated (FBS [Fetal Bovine Serum]) or treated (DCC [Dextran-Coated Charcoal], DCC plus palbociclib or palbociclib) conditions, showing an increased amount of CDK2/Cyclin A, CDK2/Cyclin E, and CDK4/Cyclin D1 complex formation in both.…
Show Full Abstract
CDK4/6 inhibitors benefit a minority of patients who receive them in the breast cancer adjuvant setting. p27Kip1 is a protein that inhibits CDK/Cyclin complexes. We hypothesized that single-nucleotide polymorphisms that impaired p27Kip1 function could render patients refractory to endocrine therapy but responsive to CDK4/6 inhibitors, narrowing the patient subpopulation that requires CDK4/6 inhibitors. We found that the p27Kip1 V109G single-nucleotide polymorphism is homozygous in approximately 15% of hormone-positive breast cancer patients. Polymorphic patients experience rapid failure in response to endocrine monotherapy compared with wild-type or heterozygous patients in the first-line metastatic setting (progression-free survival: 92 vs 485 days, P < .001); when CDK4/6 inhibitors are added, the differences disappear (progression-free survival: 658 vs 761 days, P = .92). As opposed to wild-type p27Kip1, p27Kip1 V109G is unable to suppress the kinase activity of CDK4 in the presence of endocrine inhibitors; however, palbociclib blocks CDK4 kinase activity regardless of the p27Kip1 status. p27Kip1 genotyping could constitute a tool for treatment selection.
Also flagged:ProteostasisDeathmetabolismagingribonucleoproteinage-
Journal Article2023-03-01No SnippetsLim SM, Nahm M, Kim SH.
Show Full Abstract
The cellular homeostasis of proteins (proteostasis) and RNA metabolism (ribostasis) are essential for maintaining both the structure and function of the brain. However, aging, cellular stress conditions, and genetic contributions cause disturbances in proteostasis and ribostasis that lead to protein misfolding, insoluble aggregate deposition, and abnormal ribonucleoprotein granule dynamics. In addition to neurons being primarily postmitotic, nondividing cells, they are more susceptible to the persistent accumulation of abnormal aggregates. Indeed, defects associated with the failure to maintain proteostasis and ribostasis are common pathogenic components of age-related neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. Furthermore, the neuronal deposition of misfolded and aggregated proteins can cause both increased toxicity and impaired physiological function, which lead to neuronal dysfunction and cell death. There is recent evidence that irreversible liquid-liquid phase separation (LLPS) is responsible for the pathogenic aggregate formation of disease-related proteins, including tau, α-synuclein, and RNA-binding proteins, including transactive response DNA-binding protein 43, fused in sarcoma, and heterogeneous nuclear ribonucleoprotein A1. Investigations of LLPS and its control therefore suggest that chaperone/disaggregase, which reverse protein aggregation, are valuable therapeutic targets for effective treatments for neurological diseases. Here we review and discuss recent studies to highlight the importance of understanding the common cell death mechanisms of proteostasis and ribostasis in neurodegenerative diseases.
Also flagged:age-related orthopedic diseasesFerroptosisdeathironlipidmetabolism
Journal Article2023-03-01No SnippetsRu Q, Li Y, Xie W, Ding Y, Chen L, Xu G, Wu Y, Wang F.
Show Full Abstract
Ferroptosis, a unique type of cell death, is characterized by iron-dependent accumulation and lipid peroxidation. It is closely related to multiple biological processes, including iron metabolism, polyunsaturated fatty acid metabolism, and the biosynthesis of compounds with antioxidant activities, including glutathione. In the past 10 years, increasing evidence has indicated a potentially strong relationship between ferroptosis and the onset and progression of age-related orthopedic diseases, such as osteoporosis and osteoarthritis. Therefore, in-depth knowledge of the regulatory mechanisms of ferroptosis in age-related orthopedic diseases may help improve disease treatment and prevention. This review provides an overview of recent research on ferroptosis and its influences on bone and cartilage homeostasis. It begins with a brief overview of systemic iron metabolism and ferroptosis, particularly the potential mechanisms of ferroptosis. It presents a discussion on the role of ferroptosis in age-related orthopedic diseases, including promotion of bone loss and cartilage degradation and the inhibition of osteogenesis. Finally, it focuses on the future of targeting ferroptosis to treat age-related orthopedic diseases with the intention of inspiring further clinical research and the development of therapeutic strategies.
Also flagged:ADAM12osteoarthritisOsteoarthritis of theOAchronic progressive joint diseaseaging
Journal Article2023-03-01✓ 1 SnippetYang S, Wang YP, Li XY, Han PY, Han PF.
In-Text Gene Mentions
Discussion)
…SOX9, L-SOX5, andSOX6) [ 47 ],…
Show Full Abstract
<h4>Background</h4>Osteoarthritis of the knee is an irreversible disease that causes great pain, and genetic factors play an important role in its occurrence and development. There have been many studies on the correlation between ADAM12 polymorphisms and genetic susceptibility to osteoarthritis, but the results remain inconclusive.<h4>Methods</h4>Papers from PubMed, Web of Science, EMbase, Springer, SCOPUS, Google Scholar and other databases were systematically retrieved with a cut-off of January 2022. All case-control studies on ADAM12 rs3740199, rs1871054, rs1044122, and rs1278279 polymorphisms and osteoarthritis were searched. Fixed or random effects models were used for pooled analysis with OR values and 95% confidence intervals (CI), and publication bias was assessed. In addition, the false-positive reporting probability test was used to assess the confidence of a statistically significant association.<h4>Results</h4>Eleven articles were included, which included 3332 patients with osteoarthritis and 5108 healthy controls. Meta-analysis showed that the rs1871054 polymorphism of ADAM12 was associated with osteoarthritis in dominant, recessive, allelic, and homozygote genetic models [C vs. T: OR = 1.34 95% CI (1.05, 1.71), P < 0.001]. Our subgroup analysis revealed an association between the ADAM12 polymorphism rs1871054 in Asians and osteoarthritis [C vs. T: OR = 1.61, 95% CI (1.25, 2.08), P < 0.001], albeit this was only for three studies. In addition, the ADAM12 polymorphism rs1871054 is associated with osteoarthritis in patients younger than 60 years of age [C vs. T: OR = 1.39, 95% CI (1.01, 1.92), P = 0.289]; however, the ADAM12 gene rs3740199, rs1044122, and rs1278279 site polymorphisms were not significantly. Furthermore, when assessing the confidence of the positive results, the positive results were found to be credible (except for Age < 60).<h4>Conclusion</h4>Polymorphism at the rs1871054 site of ADAM12 is associated with genetic susceptibility to osteoarthritis, but rs3740199, rs1044122, and rs1278279 site polymorphisms are not.
Also flagged:cancerheterotrimeric GTPaseGIVGirdincancersGTPases
Journal Article2023-03-01No SnippetsQiao L, Sinha S, Abd El-Hafeez AA, Lo IC, Midde KK, Ngo T, Aznar N, Lopez-Sanchez I, Gupta V, Farquhar MG, Rangamani P, Ghosh P.
Show Full Abstract
Cancers represent complex autonomous systems, displaying self-sufficiency in growth signaling. Autonomous growth is fueled by a cancer cell's ability to "secrete-and-sense" growth factors (GFs): a poorly understood phenomenon. Using an integrated computational and experimental approach, here we dissect the impact of a feedback-coupled GTPase circuit within the secretory pathway that imparts secretion-coupled autonomy. The circuit is assembled when the Ras-superfamily monomeric GTPase Arf1, and the heterotrimeric GTPase Giαβγ and their corresponding GAPs and GEFs are coupled by GIV/Girdin, a protein that is known to fuel aggressive traits in diverse cancers. One forward and two key negative feedback loops within the circuit create closed-loop control, allow the two GTPases to coregulate each other, and convert the expected switch-like behavior of Arf1-dependent secretion into an unexpected dose-response alignment behavior of sensing and secretion. Such behavior translates into cell survival that is self-sustained by stimulus-proportionate secretion. Proteomic studies and protein-protein interaction network analyses pinpoint GFs (e.g., the epidermal GF) as key stimuli for such self-sustenance. Findings highlight how the enhanced coupling of two biological switches in cancer cells is critical for multiscale feedback control to achieve secretion-coupled autonomy of growth factors.
Also flagged:nucleuslentiviral infectionWntTNIKbindingdegenerative disease
Journal Article2023-03-01No SnippetsShi X, Tian S, Tian Y.
Show Full Abstract
<h4>Objectives</h4>To preliminarily explore miR-503 in human degenerative disc nucleus pulposus cell effects as well as mechanisms.<h4>Methods</h4>We utilized bioinformatics analysis to determine the miRNA differential expression as well as key signal pathways existing in human nucleus pulposus cells of the degenerative intervertebral discs. Human degenerative disc nucleus pulposus cell model was cultured and established <i>in vitro</i>. miR-503 and TNIK-related genes are knocked down and overexpressed by lentiviral infection, then we added Wnt signaling pathway agonists; CCK-8, ELISA, RT-PCR, Western blot were used to detect proliferation, apoptosis, and activity of cells.<h4>Results</h4>Bioinformatics results demonstrated that miR-503 was significantly down-regulated in human nucleus pulposus cells of the degenerated intervertebral discs. The targeted differentially expressed genes were mainly enriched in Wnt signaling pathway. However, after screening differential genes in the Wnt pathway, it was demonstrated that miR-503 mainly regulates TNIK to achieve Wnt pathway regulation. Cell experiments in vitro showed that cell activity and function were decreased while apoptosis was increased in the degenerative cell model.<h4>Conclusions</h4>miR-503 can improve the function and activity of human nucleus pulposus cells of degenerated intervertebral disc by inhibiting Wnt expression. miR-503 mainly regulates the Wnt pathway through targeted binding with TNIK.
Also flagged:bone diseasesextracellularcell surface receptorscollagenhydroxyapatiteproteoglycans
Journal Article2023-03-01No SnippetsHeng BC, Bai Y, Li X, Meng Y, Lu Y, Zhang X, Deng X.
Show Full Abstract
Understanding the bioelectrical properties of bone tissue is key to developing new treatment strategies for bone diseases and injuries, as well as improving the design and fabrication of scaffold implants for bone tissue engineering. The bioelectrical properties of bone tissue can be attributed to the interaction of its various cell lineages (osteocyte, osteoblast and osteoclast) with the surrounding extracellular matrix, in the presence of various biomechanical stimuli arising from routine physical activities; and is best described as a combination and overlap of dielectric, piezoelectric, pyroelectric and ferroelectric properties, together with streaming potential and electro-osmosis. There is close interdependence and interaction of the various electroactive and electrosensitive components of bone tissue, including cell membrane potential, voltage-gated ion channels, intracellular signaling pathways, and cell surface receptors, together with various matrix components such as collagen, hydroxyapatite, proteoglycans and glycosaminoglycans. It is the remarkably complex web of interactive cross-talk between the organic and non-organic components of bone that define its electrophysiological properties, which in turn exerts a profound influence on its metabolism, homeostasis and regeneration in health and disease. This has spurred increasing interest in application of electroactive scaffolds in bone tissue engineering, to recapitulate the natural electrophysiological microenvironment of healthy bone tissue to facilitate bone defect repair.
Progress in ovarian cancer treatment lags behind other tumor types. With diagnosis usually at an advanced stage, there is a high demand for reliable prognostic biomarkers capable of the selection of effective chemo- and targeted therapies. Our goal was to establish a large-scale transcriptomic database and use it to uncover and rank survival-associated genes. Ovarian cancer cohorts with transcriptome-level gene expression data and clinical follow-up were identified from public repositories. All samples were normalized and entered into an integrated database. Cox univariate survival analysis was performed for all genes and was followed by multivariate analysis for selected genes involving clinical and pathological variables. False discovery rate was computed for multiple hypothesis testing and a 1% cutoff was used to determine statistical significance. The complete integrated database comprises 1816 samples from 17 datasets. Altogether, 2468 genes were correlated to progression-free survival (PFS), and 704 genes were correlated with overall survival (OS). The most significant genes were WBP1L, ASAP3, CNNM2, and NCAPH2 for progression-free survival and CSE1L, NUAK1, ALPK2, and SHKBP1 for overall survival. Genes significant for PFS were also preferentially significant for predicting OS as well. All data including HR and p values as well as the used cutoff values for all genes for both PFS and OS are provided to enable the ranking of future biomarker candidates across all genes. Our results help to prioritize genes and to neglect those which are most likely to fail in studies aiming to establish new clinically useful biomarkers and therapeutic targets in serous ovarian cancer.
Also flagged:RNA binding proteinDND1chromatintranslationalgerm cell differentiationGFP
Journal Article2023-03-01No SnippetsRuthig VA, Hatkevich T, Hardy J, Friedersdorf MB, Mayère C, Nef S, Keene JD, Capel B.
Show Full Abstract
DND1 is essential to maintain germ cell identity. Loss of Dnd1 function results in germ cell differentiation to teratomas in some inbred strains of mice or to somatic fates in zebrafish. Using our knock-in mouse line in which a functional fusion protein between DND1 and GFP is expressed from the endogenous locus (Dnd1GFP), we distinguished two male germ cell (MGC) populations during late gestation cell cycle arrest (G0), consistent with recent reports of heterogeneity among MGCs. Most MGCs express lower levels of DND1-GFP (DND1-GFP-lo), but some MGCs express elevated levels of DND1-GFP (DND1-GFP-hi). A RNA-seq time course confirmed high Dnd1 transcript levels in DND1-GFP-hi cells along with 5-10-fold higher levels for multiple epigenetic regulators. Using antibodies against DND1-GFP for RNA immunoprecipitation (RIP)-sequencing, we identified multiple epigenetic and translational regulators that are binding targets of DND1 during G0 including DNA methyltransferases (Dnmts), histone deacetylases (Hdacs), Tudor domain proteins (Tdrds), actin dependent regulators (Smarcs), and a group of ribosomal and Golgi proteins. These data suggest that in DND1-GFP-hi cells, DND1 hosts coordinating mRNA regulons that consist of functionally related and localized groups of epigenetic enzymes and translational components.
The physiological functions of the rhomboid-related protein 4 (RHBDL4) are emerging, but their molecular details remain unclear. Because increased expression of RHBDL4 has been clinically linked to poorer outcomes in cancer patients, this association urgently demands a better understanding of RHBDL4. To elucidate the molecular interactions and pathways that RHBDL4 may be involved in, we conducted proximity-dependent biotin identification (BioID) assays. Our analyses corroborated several of the expected protein interactors such as the transitional endoplasmic reticulum (ER) ATPase VCP/p97 (TERA), but they also described novel putative interactors including IRS4, PGAM5, and GORS2. Using proximity-ligation assays, we validated VCP/p97, COPB, and VRK2 as proteins that are in proximity to RHBDL4. Overall, our results support the emerging functions of RHBDL4 in ER quality control and also point toward putative RHBDL4 functions in protein membrane insertion and membrane organization and trafficking.
Also flagged:borneolwet age-related macular degenerationrheinbaicaleincoumarin-6neovascular AMD
Journal Article2023-03-01No SnippetsSu W, Liu C, Jiang X, Lv Y, Chen Q, Shi J, Zhang H, Ma Q, Ge C, Kong F, Li X, Liu Y, Chen Y, Qu D.
Show Full Abstract
Sustained retina drug delivery and rational drug combination are considered essential for enhancing the efficacy of therapy for wet age-related macular degeneration (wAMD) due to the conservative structure of the posterior ocular segment and the multi-factorial pathological mechanism. Designing a drug co-delivery system that can simultaneously achieve deep penetration and long-lasting retention in the vitreous is highly desired, yet remains a huge challenge. In this study, we fabricated Bor/RB-M@TRG as an intravitreal-injectable hydrogel depot for deep penetration into the posterior ocular segment and long-lasting distribution in the retinal pigment epithelium (RPE) layer. The Bor/RB-M@TRG consisted of borneol-decorated rhein and baicalein-coloaded microemulsions (Bor/RB-M, the therapy entity) and a temperature-responsive hydrogel matrix (the intravitreal depot). Bor/RB-M exhibited the strongest in vitro anti-angiogenic effects among all the groups studied, which is potentially associated with improved cellular uptake, as well as the synergism of rhein and baicalein, acting via anti-angiogenic and anti-oxidative stress pathways, respectively. Importantly, a single intravitreal (IVT) injection with Bor/RB-M@TRG displayed significant inhibition against the CNV of wAMD model mice, compared to all other groups. Particularly, coumarin-6-labeled Bor/RB-M@TRG (Bor/C6-M@TRG) could not only deeply penetrate into the retina but also stably accumulate in the RPE layer for at least 14 days. Our design integrates the advantages of borneol-decorated microemulsions and hydrogel depots, offering a promising new approach for clinically-translatable retinal drug delivery and synergistic anti-wAMD treatment.
<h4>Background</h4>In newborns with hypoxic-ischemic encephalopathy (HIE), the correlation between neonatal neuroimaging and the degree of neurodevelopmental impairment (NDI) is unclear.<h4>Methods</h4>Infants with HIE enrolled in a randomized controlled trial underwent neonatal MRI/MR spectroscopy (MRS) using a harmonized protocol at 4-6 days of age. The severity of brain injury was measured with a validated scoring system. Using proportional odds regression, we calculated adjusted odds ratios (aOR) for the associations between MRI/MRS measures of injury and primary ordinal outcome (i.e., normal, mild NDI, moderate NDI, severe NDI, or death) at age 2 years.<h4>Results</h4>Of 451 infants with MRI/MRS at a median age of 5 days (IQR 4.5-5.8), outcomes were normal (51%); mild (12%), moderate (14%), severe NDI (13%); or death (9%). MRI injury score (aOR 1.06, 95% CI 1.05, 1.07), severe brain injury (aOR 39.6, 95% CI 16.4, 95.6), and MRS lactate/n-acetylaspartate (NAA) ratio (aOR 1.6, 95% CI 1.4,1.8) were associated with worse primary outcomes. Infants with mild/moderate MRI brain injury had similar BSID-III cognitive, language, and motor scores as infants with no injury.<h4>Conclusion</h4>In the absence of severe injury, brain MRI/MRS does not accurately discriminate the degree of NDI. Given diagnostic uncertainty, families need to be counseled regarding a range of possible neurodevelopmental outcomes.<h4>Impact</h4>Half of all infants with hypoxic-ischemic encephalopathy (HIE) enrolled in a large clinical trial either died or had neurodevelopmental impairment at age 2 years despite receiving therapeutic hypothermia. Severe brain injury and a global pattern of brain injury on MRI were both strongly associated with death or neurodevelopmental impairment. Infants with mild or moderate brain injury had similar mean BSID-III cognitive, language, and motor scores as infants with no brain injury on MRI. Given the prognostic uncertainty of brain MRI among infants with less severe degrees of brain injury, families should be counseled regarding a range of possible neurodevelopmental outcomes.
Also flagged:ferroptosisasthmagene expressionNAV3ITGA10SYT4
Journal Article2023-03-01✓ 2 SnippetsZheng Y, Fan J, Jiang X.
In-Text Gene Mentions
Discussion)
…For example, the 15-LO1/PEBP1 complex, which can produce hydroperoxyl-phospholipids, drive ferroptosis and enhance type 2 inflammation-related signaling pathways, is found in the airway epithelial cells of asthmatic patients.[28] In addition, the HIF-1 signaling pathway is the main regulatory pathway for oxygen homeostasis.[29] Under inflammatory conditions, HIF-1α in goblet cells of the airway epithelium can promote the expression of mucin 5AC, which interferes with the mucociliary clearance mechanisms of the airway.[30,31] Additionally, ferroptosis may cause renal tubular damage via the HIF-1α pathway in diabetic kidney disease.[32] Thus, ferroptosis may be involved in the functional changes of asthma airway epithelial cells through multiple ways and may contribute to the development of type 2 inflammation.…
Discussion)
…For example, the 15-LO1/PEBP1complex, which can…
Show Full Abstract
It has been reported that airway epithelial cells and ferroptosis have certain effect on asthma. However, the action mechanism of ferroptosis-related genes in airway epithelial cells of asthmatic patients is still unclear. Firstly, the study downloaded the GSE43696 training set, GSE63142 validation set and GSE164119 (miRNA) dataset from the gene expression omnibus database. 342 ferroptosis-related genes were downloaded from the ferroptosis database. Moreover, differentially expressed genes (DEGs) between asthma and control samples in the GSE43696 dataset were screened by differential analysis. Consensus clustering analysis was performed on asthma patients to classify clusters, and differential analysis was performed on clusters to obtain inter-cluster DEGs. Asthma-related module was screened by weighted gene co-expression network analysis. Then, DEGs between asthma and control samples, inter-cluster DEGs and asthma-related module were subjected to venn analysis for obtaining candidate genes. The last absolute shrinkage and selection operator and support vector machines were respectively applied to the candidate genes to screen for feature genes, and functional enrichment analysis was performed. Finally, a competition endogenetic RNA network was constructed and drug sensitivity analysis was conducted. There were 438 DEGs (183 up-regulated and 255 down-regulated) between asthma and control samples. 359 inter-cluster DEGs (158 up-regulated and 201 down-regulated) were obtained by screening. Then, the black module was significantly and strongly correlated with asthma. The venn analysis yielded 88 candidate genes. 9 feature genes (NAV3, ITGA10, SYT4, NOX1, SNTG2, RNF182, UPK1B, POSTN, SHISA2) were screened and they were involved in proteasome, dopaminergic synapse etc. Besides, 4 mRNAs, 5 miRNAs, and 2 lncRNAs collectively formed competition endogenetic RNA regulatory network, which included RNF182-hsa-miR-455-3p-LINC00319 and so on. The predicted therapeutic drug network map contained NAV3-bisphenol A and other relationship pairs. The study investigated the potential molecular mechanisms of NAV3, ITGA10, SYT4, NOX1, SNTG2, RNF182, UPK1B, POSTN, SHISA2 in airway epithelial cells of asthmatic patients through bioinformatics analysis, providing a reference for the research of asthma and ferroptosis.
Also flagged:brain developmentneurodevelopmental disorderscognitionaxonogenesisvitamin Dasthma
Journal Article2023-03-01No SnippetsSun Z, Lee-Sarwar K, Kelly RS, Lasky-Su JA, Litonjua AA, Weiss ST, Liu YY.
Show Full Abstract
<h4>Background</h4>It has been widely recognized that a critical time window for neurodevelopment occurs in early life and the host's gut microbiome plays an important role in neurodevelopment. Following recent demonstrations that the maternal prenatal gut microbiome influences offspring brain development in murine models, we aim to explore whether the critical time window for the association between the gut microbiome and neurodevelopment is prenatal or postnatal for human.<h4>Methods</h4>Here we leverage a large-scale human study and compare the associations between the gut microbiota and metabolites from mothers during pregnancy and their children with the children's neurodevelopment. Specifically, using multinomial regression integrated in Songbird, we assessed the discriminating power of the maternal prenatal and child gut microbiome for children's neurodevelopment at early life as measured by the Ages & Stages Questionnaires (ASQ).<h4>Findings</h4>We show that the maternal prenatal gut microbiome is more relevant than the children's gut microbiome to the children's neurodevelopment in the first year of life (maximum Q<sup>2</sup> = 0.212 and 0.096 separately using the taxa at the class level). Moreover, we found that Fusobacteriia is more associated with high fine motor skills in ASQ in the maternal prenatal gut microbiota but become more associated with low fine motor skills in the infant gut microbiota (rank = 0.084 and -0.047 separately), suggesting the roles of the same taxa with respect to neurodevelopment can be opposite at the two stages of fetal neurodevelopment.<h4>Interpretation</h4>These findings shed light, especially in terms of timing, on potential therapeutic interventions to prevent neurodevelopmental disorders.<h4>Funding</h4>This work was supported by the National Institutes of Health (grant numbers: R01AI141529, R01HD093761, RF1AG067744, UH3OD023268, U19AI095219, U01HL089856, R01HL141826, K08HL148178, K01HL146980), and the Charles A. King Trust Postdoctoral Fellowship.
Also flagged:Inflammatory Bowel DiseaseGene expressionPD-1MCP-1ulcerative colitisCXCL10
Journal Article2023-03-01✓ 1 SnippetAnbazhagan M, Geem D, Venkateswaran S, Pelia R, Kolachala VL, Dodd A, Maddipatla SC, Cutler DJ, Matthews JD, Chinnadurai R, Kugathasan S.
In-Text Gene Mentions
Results)
…associated with IBD:B4GALT5, 26 GMDS…
Show Full Abstract
Therapy with mesenchymal stromal cells (MSCs) has shown promise in inflammatory bowel disease-leveraging their immunosuppressive and regenerative properties. However, the potential immunogenic complications of allogenic MSCs sourced from different tissues raise concern. Thus, we assessed the fitness and functionality of autologous intestinal MSCs as a potential platform for cellular therapy. Mucosal biopsy-derived MSCs from Crohn's disease (n = 11), ulcerative colitis (n = 12), and controls (n = 14) were analyzed by microscopy and flow cytometry for doubling-time, morphology, differentiation potential, and immunophenotype. Gene expression, cell-subtype composition, along with surface marker and secretome changes after IFN-γ priming were measured by bulk and single-cell RNA sequencing coupled with a 30-plex Luminex panel. MSCs expanded ex vivo demonstrate canonical MSC markers, similar growth kinetics, and tripotency regardless of the patient phenotype. Global transcription patterns were similar at baseline though inflammatory bowel disease (IBD) rectal MSCs showed changes in select immunomodulatory genes. IFN-γ priming resulted in upregulation of shared immunoregulatory genes (particularly in PD-1 signaling) and overrode the transcriptional differences observed at baseline. Furthermore, MSCs secrete key immunomodulatory molecules at baseline and in response to IFN-γ including CXCL10, CXCL9, and MCP-1. Overall, MSCs from IBD patients have normal transcriptional and immunomodulatory properties with therapeutic potential and can be sufficiently expanded.
Also flagged:insulin resistancesecretioninsulinglucosenucleotidesgene expression
Journal Article2023-03-01No SnippetsKaragiannopoulos A, Cowan E, Eliasson L.
Show Full Abstract
Type 2 diabetes (T2D) develops due to insulin resistance and an inability of the pancreatic β-cells to increase secretion of insulin and reduce elevated blood glucose levels. Diminished β-cell function and mass have been implicated in impaired β-cell secretory capacity and several microRNAs (miRNAs) have been reported to be involved in regulating β-cell processes. We believe miRNAs are nodes in important miRNA-mRNA networks regulating β-cell function and that miRNAs therefore can be targets for the treatment of T2D. MicroRNAs are short (≈19-23 nucleotides [nt]) endogenous noncoding RNAs which regulate gene expression by directly binding to the mRNA of their target genes. Under normal circumstances, miRNAs act as rheostats to keep expression of their gene targets at optimal levels for different β-cell outputs. In T2D, levels of some miRNAs are altered as part of the compensatory mechanism to improve insulin secretion. Other miRNAs are differentially expressed as part of the process of T2D pathogenesis, which results in reduced insulin secretion and increased blood glucose. In this review, we present recent findings concerning miRNAs in islets and in insulin-secreting cells, and their differential expression in diabetes, with a specific focus on miRNAs involved in β-cell apoptosis/proliferation and glucose-stimulated insulin secretion. We present thoughts around miRNA-mRNA networks and miRNAs as both therapeutic targets to improve insulin secretion and as circulating biomarkers of diabetes. Overall, we hope to convince you that miRNAs in β-cells are essential for regulating β-cell function and can in the future be of clinical use in the treatment and/or prevention of diabetes.
Also flagged:paroxysmal movement disordershyperkinetic disordersataxiachoreadystoniaballism
Journal Article2023-03-01✓ 1 SnippetGarg D, Mohammad S, Shukla A, Sharma S.
In-Text Gene Mentions
S I O 001029)
…Variants in DARS2, which encodes a mitochondrial aspartyl-tRNA synthetase, are associated with leukoencephalopathy with brainstem and spinal cord involvement and brain lactate elevation (LBSL).…
Show Full Abstract
Episodic or paroxysmal movement disorders (PxMD) are conditions, which occur episodically, are transient, usually have normal interictal periods, and are characterized by hyperkinetic disorders, including ataxia, chorea, dystonia, and ballism. Broadly, these comprise paroxysmal dyskinesias (paroxysmal kinesigenic and non-kinesigenic dyskinesia [PKD/PNKD], paroxysmal exercise-induced dyskinesias [PED]) and episodic ataxias (EA) types 1-9. Classification of paroxysmal dyskinesias has traditionally been clinical. However, with advancement in genetics and the discovery of the molecular basis of several of these disorders, it is becoming clear that phenotypic pleiotropy exists, that is, the same variant may give rise to a variety of phenotypes, and the classical understanding of these disorders requires a new paradigm. Based on molecular pathogenesis, paroxysmal disorders are now categorized as synaptopathies, transportopathies, channelopathies, second-messenger related disorders, mitochondrial or others. A genetic paradigm also has an advantage of identifying potentially treatable disorders, such as glucose transporter 1 deficiency syndromes, which necessitates a ketogenic diet, and <i>ADCY5</i>-related disorders, which may respond to caffeine. Clues for a primary etiology include age at onset below 18 years, presence of family history and fixed triggers and attack duration. Paroxysmal movement disorder is a network disorder, with both the basal ganglia and the cerebellum implicated in pathogenesis. Abnormalities in the striatal cAMP turnover pathway may also be contributory. Although next-generation sequencing has restructured the approach to paroxysmal movement disorders, the genetic underpinnings of several entities remain undiscovered. As more genes and variants continue to be reported, these will lead to enhanced understanding of pathophysiological mechanisms and precise treatment.
Large-scale multiple perturbation experiments have the potential to reveal a more detailed understanding of the molecular pathways that respond to genetic and environmental changes. A key question in these studies is which gene expression changes are important for the response to the perturbation. This problem is challenging because (i) the functional form of the nonlinear relationship between gene expression and the perturbation is unknown and (ii) identification of the most important genes is a high-dimensional variable selection problem. To deal with these challenges, we present here a method based on the model-X knockoffs framework and Deep Neural Networks to identify significant gene expression changes in multiple perturbation experiments. This approach makes no assumptions on the functional form of the dependence between the responses and the perturbations and it enjoys finite sample false discovery rate control for the selected set of important gene expression responses. We apply this approach to the Library of Integrated Network-Based Cellular Signature data sets which is a National Institutes of Health Common Fund program that catalogs how human cells globally respond to chemical, genetic and disease perturbations. We identified important genes whose expression is directly modulated in response to perturbation with anthracycline, vorinostat, trichostatin-a, geldanamycin and sirolimus. We compare the set of important genes that respond to these small molecules to identify co-responsive pathways. Identification of which genes respond to specific perturbation stressors can provide better understanding of the underlying mechanisms of disease and advance the identification of new drug targets.
Increasing evidence suggests that natural antisense transcriptional lncRNAs regulate their adjacent coding genes to mediate diverse aspects of biology. Bioinformatics analysis of the previously identified antiviral gene ZNFX1 revealed neighboring lncRNA ZFAS1 transcribed on the opposite strand from ZNFX1. Whether ZFAS1 exerts antiviral function via regulating the dsRNA sensor ZNFX1 is unknown. Here we found that ZFAS1 was upregulated by RNA and DNA viruses and type I IFNs (IFN-I) dependent on Jak-STAT signaling, similar to the transcription regulation of ZNFX1. Knockdown of endogenous ZFAS1 partially facilitated viral infection, while ZFAS1 overexpression showed opposite effects. In addition, mice were more resistant to VSV infection with the delivery of human ZFAS1. We further observed that ZFAS1 knockdown significantly inhibited IFNB1 expression and IFR3 dimerization, whereas ZFAS1 overexpression positively regulated antiviral innate immune pathways. Mechanistically, ZFAS1 positively regulated ZNFX1 expression and antiviral function by enhancing the protein stability of ZNFX1, thereby establishing a positive feedback loop to enhance antiviral immune activation status. In short, ZFAS1 is a positive regulator of antiviral innate immune response via regulating its neighbor gene ZNFX1, adding new mechanistic insight into lncRNA-mediated regulation of signaling in innate immunity.
Also flagged:cancerscancernon-small cell lung cancerNSCLClung cancerGene Expression
Journal Article2023-03-01✓ 1 SnippetChen Z, Yu F, Zhu B, Li Q, Yu Y, Zong F, Liu W, Zhang M, Wu S.
In-Text Gene Mentions
Results)
…ADH7, KCNN4, SLC1A1,DCC, UCK2, PRKCE ,…
Show Full Abstract
<h4>Background</h4>Lung cancer is one of the most prevalent cancers and the leading cause of cancer-related deaths worldwide; non-small cell lung cancer (NSCLC) comprises approximately 80% of all lung cancer cases. This study aimed to construct a competing endogenous RNA (ceRNA) network and identify prognostic signatures in elderly patients with NSCLC.<h4>Methods</h4>We extracted data from elderly patients with NSCLC from The Cancer Genome Atlas and identified differentially expressed (DE) messenger RNAs (mRNAs), microRNAs (miRNAs), and long non-coding RNAs (lncRNAs). Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were performed to investigate the functions of DEmRNAs. The interactions between RNAs were predicted using starBase, TargetScan, miRTarBase, and miRanda. Cytoscape version 3.0 was used to construct and visualize the lncRNA-miRNA-mRNA ceRNA network. The association between the expression levels of DERNAs in the constructed ceRNA network and overall survival was determined using the survival package in R software. Furthermore, another Gene Expression Omnibus cohort was studied to externally validate the ceRNA network.<h4>Results</h4>In total, 2865 DEmRNAs, 62 DEmiRNAs, and 131 DElncRNAs were identified. Dysregulated mRNAs are enriched in cancer-related processes and pathways. A ceRNA network was constructed using 38 miRNAs, 61 lncRNAs, and 164 mRNAs. Of these, 3 lncRNAs, 3 miRNAs, and 16 mRNAs were closely related to overall survival. The MIR99AHG-hsa-miR-31-5p-PRKCE axis has been identified as a potential ceRNA network involved in the development of NSCLC in elderly individuals. External validation of the MIR99AHG-hsa-miR-31-5p-PRKCE axis in the GSE19804 cohort showed that PRKCE was downregulated and that MIR99AHG was upregulated in the tumor tissues of elderly patients with NSCLC compared with normal lung tissues.<h4>Conclusions</h4>This study provides novel insights into the lncRNA-miRNA-mRNA ceRNA network and reveals potential biomarkers for the diagnosis and prognosis of elderly patients with NSCLC.
Also flagged:Hypertrophic cardiomyopathycardiomyopathiesdeathgenetic diseasethick and thin myofilament proteinsmyosin heavy chain 7
Journal Article2023-03-01✓ 2 SnippetsMoore J, Ewoldt J, Venturini G, Pereira AC, Padilha K, Lawton M, Lin W, Goel R, Luptak I, Perissi V, Seidman CE, Seidman J, Chin MT, Chen C, Emili A.
In-Text Gene Mentions
Results)
…The HCM patient samples exhibited significant decreases in the cell redox homeostasis pathway from GSEA, which included decreased expression of peroxiredoxin-6 (PRDX6) and mitochondrial thioredoxin (TXN2), important enzymes for reducing cellular peroxide levels (Supplementary Table S4, Supplementary Figure S2) [64].…
Results)
…xpression of peroxiredoxin-6 (PRDX6) and mitochondrial thioredoxi…
Show Full Abstract
Hypertrophic cardiomyopathy is one of the most common inherited cardiomyopathies and a leading cause of sudden cardiac death in young adults. Despite profound insights into the genetics, there is imperfect correlation between mutation and clinical prognosis, suggesting complex molecular cascades driving pathogenesis. To investigate this, we performed an integrated quantitative multi-omics (proteomic, phosphoproteomic, and metabolomic) analysis to illuminate the early and direct consequences of mutations in myosin heavy chain in engineered human induced pluripotent stem-cell-derived cardiomyocytes relative to late-stage disease using patient myectomies. We captured hundreds of differential features, which map to distinct molecular mechanisms modulating mitochondrial homeostasis at the earliest stages of pathobiology, as well as stage-specific metabolic and excitation-coupling maladaptation. Collectively, this study fills in gaps from previous studies by expanding knowledge of the initial responses to mutations that protect cells against the early stress prior to contractile dysfunction and overt disease.
Also flagged:Extracellular VesiclesSeveretraumatic brain injuryextracellularsynthesisCD81
Journal Article2023-03-01✓ 1 SnippetSeršić LV, Alić VK, Biberić M, Zrna S, Jagoić T, Tarčuković J, Grabušić K.
In-Text Gene Mentions
Results)
…of Prdx2 andPrdx6in d1–2 followed…
Show Full Abstract
Severe traumatic brain injury (sTBI) is an intracranial damage triggered by external force, most commonly due to falls and traffic accidents. The initial brain injury can progress into a secondary injury involving numerous pathophysiological processes. The resulting sTBI dynamics makes the treatment challenging and prompts the improved understanding of underlying intracranial processes. Here, we analysed how extracellular microRNAs (miRNAs) are affected by sTBI. We collected thirty-five cerebrospinal fluids (CSF) from five sTBI patients during twelve days (d) after the injury and combined them into d1-2, d3-4, d5-6 and d7-12 CSF pools. After miRNA isolation and cDNA synthesis with added quantification spike-ins, we applied a real-time PCR-array targeting 87 miRNAs. We detected all of the targeted miRNAs, with totals ranging from several nanograms to less than a femtogram, with the highest levels found at d1-2 followed by decreasing levels in later CSF pools. The most abundant miRNAs were miR-451a, miR-16-5p, miR-144-3p, miR-20a-5p, let-7b-5p, miR-15a-5p, and miR-21-5p. After separating CSF by size-exclusion chromatography, most miRNAs were associated with free proteins, while miR-142-3p, miR-204-5p, and miR-223-3p were identified as the cargo of CD81-enriched extracellular vesicles, as characterised by immunodetection and tunable resistive pulse sensing. Our results indicate that miRNAs might be informative about both brain tissue damage and recovery after sTBI.
Also flagged:chromatinzinc-finger nucleasetranscription activator-like effectornucleaseclustered regulatory interspaced short palindromic repeatsCRISPR)-associated protein
Journal Article2023-03-01✓ 4 SnippetsUeda J, Yamazaki T, Funakoshi H.
In-Text Gene Mentions
Methods)
…In particular, Garriga-Canut et al. used zinc-finger and KRAB to specifically repress the mutant huntingtin gene (htt) in the brain tissue from an animal model of Huntington’s disease [14].…
Methods)
…Zeitler et al. also used zinc-finger and KRAB to specifically suppress the mutant htt gene in cells derived from patients with Huntington’s disease, as well as in an animal disease model [15].…
Methods)
…huntingtin gene (htt) in the…
Methods)
…suppress the mutanthttgene in cells…
Show Full Abstract
The advancement in epigenetics research over the past several decades has led to the potential application of epigenome-editing technologies for the treatment of various diseases. In particular, epigenome editing is potentially useful in the treatment of genetic and other related diseases, including rare imprinted diseases, as it can regulate the expression of the epigenome of the target region, and thereby the causative gene, with minimal or no modification of the genomic DNA. Various efforts are underway to successfully apply epigenome editing in vivo, such as improving target specificity, enzymatic activity, and drug delivery for the development of reliable therapeutics. In this review, we introduce the latest findings, summarize the current limitations and future challenges in the practical application of epigenome editing for disease therapy, and introduce important factors to consider, such as chromatin plasticity, for a more effective epigenome editing-based therapy.
Also flagged:secretionperoxisomeslocalizationcatalasedigestionexcretion
Journal Article2023-03-01No SnippetsWatermann C, Meyer MT, Wagner S, Wittekindt C, Klussmann JP, Erguen S, Baumgart-Vogt E, Karnati S.
Show Full Abstract
The parotid gland is one of the major salivary glands producing a serous secretion, and it plays an essential role in the digestive and immune systems. Knowledge of peroxisomes in the human parotid gland is minimal; furthermore, the peroxisomal compartment and its enzyme composition in the different cell types of the human parotid gland have never been subjected to a detailed investigation. Therefore, we performed a comprehensive analysis of peroxisomes in the human parotid gland's striated duct and acinar cells. We combined biochemical techniques with various light and electron microscopy techniques to determine the localization of parotid secretory proteins and different peroxisomal marker proteins in parotid gland tissue. Moreover, we analyzed the mRNA of numerous gene encoding proteins localized in peroxisomes using real-time quantitative PCR. The results confirm the presence of peroxisomes in all striated duct and acinar cells of the human parotid gland. Immunofluorescence analyses for various peroxisomal proteins showed a higher abundance and more intense staining in striated duct cells compared to acinar cells. Moreover, human parotid glands comprise high quantities of catalase and other antioxidative enzymes in discrete subcellular regions, suggesting their role in protection against oxidative stress. This study provides the first thorough description of parotid peroxisomes in different parotid cell types of healthy human tissue.
Also flagged:IronThalassemiablood disordersglobincirrhosishepatocellular cancer
Journal Article2023-03-01✓ 1 SnippetXu F, Tang C, Huang Y, Liang L, Huang F, Yang G, Peng P.
In-Text Gene Mentions
Discussion)
…animal model withhemochromatosisusing 120kVp and…
Show Full Abstract
<h4>Background</h4>To explore the feasibility and accuracy of liver iron deposition based on dual-energy CT in thalassemia patients.<h4>Materials and methods</h4>105 thalassemia patients were examined with dual-energy CT and MR liver scanning. Dual-energy CT was performed to measure CT values on 80kVp, 140kVp, and virtual iron content (VIC) imaging; ΔH was figured out by the difference in CT values between 80kVp and 140kVp. Using the liver iron concentration (LIC) obtained by FerriScan as a gold standard, the correlation between CT measurements and LIC was evaluated. Receiver operating characteristic (ROC) analysis was used to evaluate the diagnostic performance for dual-energy CT in liver iron quantification and stratification.<h4>Results</h4>The correlation analysis between CT measurements and LIC showed that 80kVp, 140kVp, VIC, and ΔH all had a high positive correlation with LIC (<i>P</i><0.001). The correlation analysis among different degree groups of VIC, ΔH, and LIC showed that the normal, moderate, and severe groups of VIC and ΔH had moderate or high positive correlations with that of LIC (<i>P</i><0.01), but the mild group had no correlation (<i>P</i>>0.05). ROC analysis revealed that the corresponding optimal cutoff value of VIC was -2.8, 6.3,11.9 HU (corresponds to 3.2,7.0,15.0 mg/g dry weight) respectively, while the ΔH were 5.1, 8.4, 17.8HU, respectively. The area under the receiver operating characteristic curves (AUCs) for both VIC and ΔH increased with LIC thresholds.<h4>Conclusion</h4>Dual-energy CT can accurately quantify and stratify liver iron deposition, contributing to predicting the status of liver iron deposition in thalassemia patients.
Also flagged:LOXL3Stickler syndromemyopiadiffuse choroidal atrophyLRPAP1early-onset high myopia
Journal Article2023-03-01✓ 2 SnippetsJiang Y, Zhou L, Wang Y, Ouyang J, Li S, Xiao X, Jia X, Wang J, Yi Z, Sun W, Jiao X, Wang P, Hejtmancik JF, Zhang Q.
In-Text Gene Mentions
Discussion)
…Through whole-exome sequencing and whole-genome sequencing, rare variants in several genes including ARR3, LOXL3, LRPAP1, CCDC111, NDUFAF7, P4HA2, SCO2, UNC5D, BSG, SLC39A5, CTSH, and ZNF644, have been identified to cause myopia.3…
Discussion)
…CTSH , andZNF644, have been…
Show Full Abstract
<h4>Purpose</h4>In previous studies, biallelic LOXL3 variants have been shown to cause autosomal recessive Stickler syndrome in one Saudi Arabian family or autosomal recessive early-onset high myopia (eoHM, MYP28) in two Chinese families. The current study aims to elucidate the clinical and genetic features of LOXL3-associated MYP28 in seven new families and two previously published families.<h4>Methods</h4>LOXL3 variants were detected based on the exome sequencing data of 8389 unrelated probands with various ocular conditions. Biallelic variants were identified through multiple online bioinformatic tools, comparative analysis, and co-segregation analysis. The available clinical data were summarized.<h4>Results</h4>Biallelic LOXL3 variants were exclusively identified in nine of 1226 families with eoHM but in none of the 7163 families without eoHM (P = 2.97 × 10-8, Fisher's exact test), including seven new and two previously reported families. Seven pathogenic variants were detected, including one nonsense (c.1765C>T/p.Arg589*), three frameshift (c.39dupG/p.Leu14Alafs*21; c.544delC/p.Leu182Cysfs*3, c.594delG/p.Gln199Lysfs*35), and three missense (c.371G>A/p.Cys124Tyr; c.1051G>A/p.Gly351Arg; c.1669G>A/p.Glu557Lys) variants. Clinical data of nine patients from nine unrelated families revealed myopia at the first visit at about 5 years of age, showing slow progression with age. Visual acuity at the last visit ranged from 0.04 to 0.9 (median age at last visit = 5 years, range 3.5-15 years). High myopic fundus changes, observed in all nine patients, were classified as tessellated fundus (C1) in five patients and diffuse choroidal atrophy (C2) in four patients. Electroretinograms showed mildly reduced cone responses and normal rod responses. Except for high myopia, no other specific features were shared by these patients.<h4>Conclusions</h4>Biallelic LOXL3 variants exclusively presenting in nine unrelated patients with eoHM provide firm evidence implicating MYP28, with an estimated prevalence of 7.3 × 10-3 in eoHM and of about 7.3 × 10-5 in the general population for LOXL3-associated eoHM. So far, MYP28 represents a common type of autosomal recessive extreme eoHM, with a frequency comparable to LRPAP1-associated MYP23.
The gene pool of the indigenous population of Siberia is a unique system for studying population and evolutionary genetic processes, analyzing genetic diversity, and reconstructing the genetic history of populations. High ethnic diversity is a feature of Siberia, as one of the regions of the peripheral settlement of modern human. The vast expanses of this region and the small number of aboriginal populations contributed to the formation of significant territorial and genetic subdivision. About 40 indigenous peoples are settled on the territory of the Siberian historical and ethnographic province. Within the framework of this work, a large-scale population study of the gene pool of the indigenous peoples of Siberia was carried out for the first time at the level of high-density biochips. This makes it possible to fill in a significant gap in the genogeographic picture of the Eurasian population. For this, DNA fragments were analyzed, which had been inherited without recombination by each pair of individuals from their recent common ancestor, that is, segments (blocks) identical by descent (IBD). The distribution of IBD blocks in the populations of Siberia is in good agreement with the geographical proximity of the populations and their linguistic affiliation. Among the Siberian populations, the Chukchi, Koryaks, and Nivkhs form a separate cluster from the main Siberian group, with the Chukchi and Koryaks being more closely related. Separate subclusters of Evenks and Yakuts, Kets and Chulyms are formed within the Siberian cluster. Analysis of SNPs that fell into more IBD segments of the analyzed populations made it possible to compile a list of 5358 genes. According to the calculation results, biological processes enriched with these genes are associated with the detection of a chemical stimulus involved in the sensory perception of smell. Enriched for the genes found, molecular pathways are associated with the metabolism of linoleic, arachidonic, tyrosic acids and by olfactory transduction. At the same time, an analysis of the literature data showed that some of the selected genes, which were found in a larger number of IBD blocks in several populations at once, can play a role in genetic adaptation to environmental factors.
Also flagged:OX40pembrolizumabIgG1pleural effusionmyocarditistumor
Journal Article2023-03-01No SnippetsPostel-Vinay S, Lam VK, Ros W, Bauer TM, Hansen AR, Cho DC, Stephen Hodi F, Schellens JHM, Litton JK, Aspeslagh S, Autio KA, Opdam FL, McKean M, Somaiah N, Champiat S, Altan M, Spreafico A, Rahma O, Paul EM, Ahlers CM, Zhou H, Struemper H, Gorman SA, Watmuff M, Yablonski KM, Yanamandra N, Chisamore MJ, Schmidt EV, Hoos A, Marabelle A, Weber JS, Heymach JV.
Show Full Abstract
<h4>Background</h4>The phase I first-in-human study ENGAGE-1 evaluated the humanized IgG1 OX40 agonistic monoclonal antibody GSK3174998 alone (Part 1 (P1)) or in combination with pembrolizumab (Part 2 (P2)) in patients with advanced solid tumors.<h4>Methods</h4>GSK3174998 (0.003-10 mg/kg) ± pembrolizumab (200 mg) was administered intravenously every 3 weeks using a continuous reassessment method for dose escalation. Primary objectives were safety and tolerability; secondary objectives included pharmacokinetics, immunogenicity, pharmacodynamics, and clinical activity.<h4>Results</h4>138 patients were enrolled (45 (P1) and 96 (P2, including 3 crossovers)). Treatment-related adverse events occurred in 51% (P1) and 64% (P2) of patients, fatigue being the most common (11% and 24%, respectively). No dose-toxicity relationship was observed, and maximum-tolerated dose was not reached. Dose-limiting toxicities (P2) included Grade 3 (G3) pleural effusion and G1 myocarditis with G3 increased troponin. GSK3174998 ≥0.3 mg/kg demonstrated pharmacokinetic linearity and >80% receptor occupancy on circulating T cells; 0.3 mg/kg was selected for further evaluation. Limited clinical activity was observed for GSK3174998 (P1: disease control rate (DCR) ≥24 weeks 9%) and was not greater than that expected for pembrolizumab alone (P2: overall response rate 8%, DCR ≥24 weeks 28%). Multiplexed immunofluorescence data from paired biopsies suggested that increased infiltration of natural killer (NK)/natural killer T (NKT) cells and decreased regulatory T cells (Tregs) in the tumor microenvironment may contribute to clinical responses: CD16+CD56-CD134+ NK /NKT cells and CD3+CD4+FOXP3+CD134+ Tregs exhibited the largest magnitude of change on treatment, whereas CD3+CD8+granzyme B+PD-1+CD134+ cytotoxic T cells were the least variable. Tumor gene expression profiling revealed an upregulation of inflammatory responses, T-cell proliferation, and NK cell function on treatment with some inflammatory cytokines upregulated in peripheral blood. However, target engagement, evidenced by pharmacologic activity in peripheral blood and tumor tissue, did not correlate with clinical efficacy. The low number of responses precluded identifying a robust biomarker signature predictive of response.<h4>Conclusions</h4>GSK3174998±pembrolizumab was well tolerated over the dose range tested and demonstrated target engagement. Limited clinical activity does not support further development of GSK3174998±pembrolizumab in advanced cancers.<h4>Trial registration number</h4>NCT02528357.
Also flagged:mitochondrial disorderseclampsiapreeclampsiastillbirthdeathdisease
Journal Article2023-03-01✓ 4 SnippetsFinsterer J.
In-Text Gene Mentions
Results)
…Mutations in FBXL4 cause mitochondrial myopathy.[15] In a retrospective review of 300 patients with proven respiratory chain defects, polyhydramnion was found in 30% of the cases and oligoamnions in 10% of the cases.[13]…
Results)
…postmortem genetic work-up by exome sequencing revealed the nonsense mutations c.292C > T (p.[Arg98*]) and c.1303 C > T (p.[Arg435*]) in FBXL4 (Table 2).[15] The corresponding gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box.…
Results)
…T (p.[Arg435*]) inFBXL4(Table 2 ).…
Results)
…Mutations inFBXL4cause mitochondrial myopathy.…
Show Full Abstract
This is the first review about obstetric involvement in mitochondrial disorders (MIDs). The purpose of the review was to discuss recent advances and knowledge about the type and frequency of obstetric complications in MIDs. A narrative review for preferred reporting items was performed in MEDLINE, Current Contents, EMBASE, Web of Science, Web of Knowledge, LILACS, SCOPUS, and Google Scholar. The author searched for studies examining obstetric complications in patients with a definite MID. Obstetric complications described in MIDs include eclampsia, preeclampsia, intra uterine growth retardation, polyhydramnion, oligoamnion, decreased fetal movements, premature delivery, stillbirth, blow weakness, dystocia, breech presentation, retained placenta, postnatal hemorrhage, low birth weight, and early postnatal death. The most common of these complications are polyhydramnion, stillbirth, premature delivery, and low birth weight. The data show that some obstetric complications are more common in MIDs than in healthy females. MIDs can be associated with various obstetric complications. Some of these complications are more common in pregnant females with MID compared with healthy pregnant females. Obstetricians should be aware of MIDs and should know that pregnant females with a MID have an increased risk of developing complications during pregnancy or delivery.
Also flagged:ironHepcidininfectionliver diseasesliver diseaseTf
Journal Article2023-03-01✓ 1 SnippetZheng H, Yang F, Deng K, Wei J, Liu Z, Zheng YC, Xu H.
In-Text Gene Mentions
S I O 001029)
…Deferasirox is a novel iron removal drug that has been proven to eliminate iron overload in patients with HFE-related hemochromatosis effectively, but it has some side effects on the liver and kidney.[103] Studies have shown that the deferasirox combination can enhance the efficacy of sorafenib in the treatment of liver cancer.[88] In the future, strategies employing iron-chelating agents combined with iron-related targeted drugs may become a new trend in treatment.…
Show Full Abstract
Iron is essential to organisms, the liver plays a vital role in its storage. Under pathological conditions, iron uptake by the intestine or hepatocytes increases, allowing excess iron to accumulate in liver cells. When the expression of hepcidin is abnormal, iron homeostasis in humans cannot be regulated, and resulting in iron overload. Hepcidin also regulates the release of iron from siderophores, thereby regulating the concentration of iron in plasma. Important factors related to hepcidin and systemic iron homeostasis include plasma iron concentration, body iron storage, infection, inflammation, and erythropoietin. This review summarizes the mechanism and regulation of iron overload caused by hepcidin, as well as related liver diseases caused by iron overload and treatment.
Also flagged:cell surfaceCD24THY1EGFRPDGFRAcell-surface
Journal Article2023-03-01No SnippetsLiu DD, He JQ, Sinha R, Eastman AE, Toland AM, Morri M, Neff NF, Vogel H, Uchida N, Weissman IL.
Show Full Abstract
The human brain undergoes rapid development at mid-gestation from a pool of neural stem and progenitor cells (NSPCs) that give rise to the neurons, oligodendrocytes, and astrocytes of the mature brain. Functional study of these cell types has been hampered by a lack of precise purification methods. We describe a method for prospectively isolating ten distinct NSPC types from the developing human brain using cell-surface markers. CD24<sup>-</sup>THY1<sup>-/lo</sup> cells were enriched for radial glia, which robustly engrafted and differentiated into all three neural lineages in the mouse brain. THY1<sup>hi</sup> cells marked unipotent oligodendrocyte precursors committed to an oligodendroglial fate, and CD24<sup>+</sup>THY1<sup>-/lo</sup> cells marked committed excitatory and inhibitory neuronal lineages. Notably, we identify and functionally characterize a transcriptomically distinct THY1<sup>hi</sup>EGFR<sup>hi</sup>PDGFRA<sup>-</sup> bipotent glial progenitor cell (GPC), which is lineage-restricted to astrocytes and oligodendrocytes, but not to neurons. Our study provides a framework for the functional study of distinct cell types in human neurodevelopment.
Also flagged:microcephalychromosomegestationphototransductionfibroblast growth factorbinding
Journal Article2023-03-01✓ 1 SnippetLiao XF, Liao BJ, Tan WH, Wang L, Wang DD, Tang EF, Li FG, Pan XF, Ji LH, She Q.
In-Text Gene Mentions
Abstract)
…interact with CTBP1,HTTand ASPM gene.…
Show Full Abstract
<b>Objective:</b> To explore the diagnostic value of chromosome karyotype analysis, chromosomal microarray analysis (CMA) and whole exome sequencing (WES) in microcephaly. <b>Methods:</b> A total of 9 cases of microcephaly fetuses diagnosed by prenatal ultrasound or children with microcephaly diagnosed after birth were selected from the Sixth Affiliated Hospital of Guangzhou Medical University from January 2014 to August 2022.Karyotype analysis and/or CMA were used to detect. The cases with negative karyotype analysis and CMA results were further sequenced by trio-based WES (Trio-WES). Then the coding genes contained in the pathogenic copy number variation (CNV) fragments were analyzed by gene ontology (GO) enrichment. The genes related to the development of the central nervous system contained in the pathogenic CNV and the pathogenic genes found by Trio-WES were combined for gene interaction network analysis. <b>Results:</b> In this study, 9 cases of microcephaly were recruited, with the time of diagnosis ranged from 23 weeks of gestation to 7 years after birth, and the head circumference of fetus or children ranged from 18.3 to 42.5 cm (-7SD to -2SD). Karyotype analysis was detected in all 9 cases and no abnormality result was found. Eight cases were detected by CMA, and one abnormal was found. Five cases were detected by Trio-WES, and two cases were detected with likely pathogenic genes. The GO enrichment analysis of the coding gene in the 4p16.3 microdeletion (pathogenic CNV) region showed that: in biological process, it was mainly concentrated in phototransduction, visible light; in terms of molecular function, it was mainly concentrated in fibroblast growth factor binding; in terms of cell components, it was mainly concentrated in rough endoplasmic reticulum. Gene interaction network analysis suggested that CDC42 gene could interact with CTBP1, HTT and ASPM gene. <b>Conclusions:</b> CMA could be used as a first-line detection technique for microcephaly. When the results of chromosome karyotype analysis and/or CMA are negative, Trio-WES could improve the detection rate of pathogenicity of microcephaly.
Also flagged:tumourbreast cancerENPEPCCDC102BFEZ1NOS2
Journal Article2023-03-01No SnippetsXiao B, Li M, Cui M, Yin C, Zhang B.
Show Full Abstract
<h4>Purpose</h4>The aim of this study was to systematically establish a comprehensive tumour microenvironment (TME)-relevant prognostic gene and target miRNA network for breast cancer patients.<h4>Methods</h4>Based on a large-scale screening of TME-relevant prognostic genes (760 genes) for breast cancer patients, the prognostic model was established. The primary TME prognostic genes were selected from the constructing database and verified in the testing database. The internal relationships between the potential TME prognostic genes and the prognosis of breast cancer patients were explored in depth. The associated miRNAs for the TME prognostic genes were generated, and the functions of each primary TME member were investigated in the breast cancer cell line.<h4>Results</h4>Compared with sibling controls, breast cancer patients showed 55 differentially expressed TME prognostic genes, of which 31 were considered as protective genes, while the remaining 24 genes were considered as risk genes. According to the lambda values of the LASSO Cox analysis, the 15 potential TME prognostic genes were as follows: ENPEP, CCDC102B, FEZ1, NOS2, SCG2, RPLP2, RELB, RGS3, EMP1, PDLIM4, EPHA3, PCDH9, VIM, GFI1, and IRF1. Among these, there was a remarkable linear internal relationship for CCDC102B but non-linear relationships for others with breast cancer patient prognosis. Using the siRNA technique, we silenced the expression of each TME prognostic gene. Seven of the 15 TME prognostic genes (NOS2, SCG2, RGS3, EMP1, PDLIM4, PCDH9, and GFI1) were involved in enhancing cell proliferation, destroying cell apoptosis, promoting cell invasion, or migration in breast cancer. Six of them (CCDC102B, RPLP2, RELB, EPHA3, VIM, and IRF1) were favourable for maintaining cell invasion or migration. Only two of them (ENPEP and FEZ1) were favourable for the processes of cell proliferation and apoptosis.<h4>Conclusions</h4>This integrated study hypothesised an innovative TME-associated genetic functional network for breast cancer patients. The external relationships between these TME prognostic genes and the disease were measured. Meanwhile, the internal molecular mechanisms were also investigated.
Also flagged:indolenonalcoholic fatty liver diseaseNAFLDshort-chain fatty acidstryptophanbile acids
Journal Article2023-03-01✓ 1 SnippetYoon SJ, Yu JS, Min BH, Gupta H, Won SM, Park HJ, Han SH, Kim BY, Kim KH, Kim BK, Joung HC, Park TS, Ham YL, Lee DY, Suk KT.
Emerging evidences about gut-microbial modulation have been accumulated in the treatment of nonalcoholic fatty liver disease (NAFLD). We evaluated the effect of <i>Bifidobacterium breve</i> and <i>Bifidobacterium longum</i> on the NAFLD pathology and explore the molecular mechanisms based on multi-omics approaches. Human stool analysis [healthy subjects (<i>n</i> = 25) and NAFLD patients (<i>n</i> = 32)] was performed to select NAFLD-associated microbiota. Six-week-old male C57BL/6 J mice were fed a normal chow diet (NC), Western diet (WD), and WD with <i>B. breve</i> (BB) or <i>B. longum</i> (BL; 109 CFU/g) for 8 weeks. Liver/body weight ratio, histopathology, serum/tool analysis, 16S rRNA-sequencing, and metabolites were examined and compared. The BB and BL groups showed improved liver histology and function based on liver/body ratios (WD 7.07 ± 0.75, BB 5.27 ± 0.47, and BL 4.86 ± 0.57) and NAFLD activity scores (WD 5.00 ± 0.10, BB 1.89 ± 1.45, and BL 1.90 ± 0.99; <i>p</i> < 0.05). Strain treatment showed ameliorative effects on gut barrier function. Metagenomic analysis showed treatment-specific changes in taxonomic composition. The community was mainly characterized by the significantly higher composition of the <i>Bacteroidetes</i> phylum among the NC and probiotic-feeding groups. Similarly, the gut metabolome was modulated by probiotics treatment. In particular, short-chain fatty acids and tryptophan metabolites were reverted to normal levels by probiotics, whereas bile acids were partially normalized to those of the NC group. The analysis of gene expression related to lipid and glucose metabolism as well as the immune response indicated the coordinative regulation of β-oxidation, lipogenesis, and systemic inflammation by probiotic treatment. BB and BL attenuate NAFLD by improving microbiome-associated factors of the gut-liver axis.
Also flagged:Ovarian cancergynecological cancersdeathmetabolismepithelial high-grade serous ovarian cancertumor
Journal Article2023-03-01✓ 5 SnippetsKoc ZC, Sollars VE, Bou Zgheib N, Rankin GO, Koc EC.
In-Text Gene Mentions
Results)
…Interestingly, the TUFM and DARS2 protein expressions were much higher and significant, P<0.05 and P<0.005, respectively, in tumor biopsies (Figures 3A, B).…
Results)
…The lower DARS2 expression in OVCAR-3 cell lines is noteworthy and possibly attributable to the reduced aspartate levels in HGSOC (57).…
Methods)
…OR); mitochondrial NDUSF2,DARS2, TUFM, and TFAM…
Results)
…aspartyl-tRNA synthetase 2 (DARS2), in HGSOC biopsies…
Results)
…the TUFM andDARS2protein expressions were…
Show Full Abstract
<h4>Introduction</h4>Ovarian cancer is one of the leading causes of death for women with cancer worldwide. Energy requirements for tumor growth in epithelial high-grade serous ovarian cancer (HGSOC) are fulfilled by a combination of aerobic glycolysis and oxidative phosphorylation (OXPHOS). Although reduced OXPHOS activity has emerged as one of the significant contributors to tumor aggressiveness and chemoresistance, up-regulation of mitochondrial antioxidant capacity is required for matrix detachment and colonization into the peritoneal cavity to form malignant ascites in HGSOC patients. However, limited information is available about the mitochondrial biogenesis regulating OXPHOS capacity and generation of mitochondrial reactive oxygen species (mtROS) in HGSOC.<h4>Methods</h4>To evaluate the modulation of OXPHOS in HGSOC tumor samples and ovarian cancer cell lines, we performed proteomic analyses of proteins involved in mitochondrial energy metabolism and biogenesis and formation of mtROS by immunoblotting and flow cytometry, respectively.<h4>Results and discussion</h4>We determined that the increased steady-state expression levels of mitochondrial- and nuclear-encoded OXPHOS subunits were associated with increased mitochondrial biogenesis in HGSOC tumors and ovarian cancer cell lines. The more prominent increase in MT-COII expression was in agreement with significant increase in mitochondrial translation factors, TUFM and DARS2. On the other hand, the ovarian cancer cell lines with reduced OXPHOS subunit expression and mitochondrial translation generated the highest levels of mtROS and significantly reduced SOD2 expression. Evaluation of mitochondrial biogenesis suggested that therapies directed against mitochondrial targets, such as those involved in transcription and translation machineries, should be considered in addition to the conventional chemotherapies in HGSOC treatment.
Epithelial-mesenchymal transition (EMT) is a biological process that transforms epithelial cells into a mesenchymal phenotype, conferring cell migration and invasion capabilities. EMT is involved in the progression and metastasis of colorectal cancer (CRC). Recently, emerging evidence has shown dysregulation of non-coding RNA (ncRNA) was linked to EMT. ncRNAs, including long non-coding RNA (lncRNA), regulate the transcription of downstream target genes (mRNA) through interaction with microRNAs (miRNAs); these are termed competitive endogenous RNA (ceRNA) networks. CeRNA dysregulation-induced EMT, which is linked to the progression and prognosis of CRC, has attracted wide attention. However, understanding the role of the regulation of the ceRNA network in the EMT of CRC remains limited. We discuss the molecular functions of lncRNA, the ceRNA networks related to miRNAs and mRNAs in EMT, as well as EMT transcription factors, such as the zinc finger E-box binding homeobox 1/2 (ZEB1/2), SNAIL, SLUG, and TWIST1/2. In addition, miRNAs and lncRNAs that directly target genes, thereby initiating different signaling pathways to promote EMT in CRC, were summarized. Clarifying the role of these molecules in EMT is critical for understanding molecular mechanisms and exploring the potential therapeutic targets of CRC.
Also flagged:Activating Transcription Factor 3Follicle-Stimulating Hormone-βFollicle-Stimulating Hormoneglycoproteinspermatogenesisgonadotropin-releasing hormone
Journal Article2023-03-01No SnippetsAlonso CAI, David CD, Toufaily C, Wang Y, Zhou X, Ongaro L, Nudelman G, Nair VD, Ruf-Zamojski F, Boehm U, Sealfon SC, Bernard DJ.
Show Full Abstract
Follicle-stimulating hormone (FSH), a dimeric glycoprotein produced by pituitary gonadotrope cells, regulates spermatogenesis in males and ovarian follicle growth in females. Hypothalamic gonadotropin-releasing hormone (GnRH) stimulates FSHβ subunit gene (Fshb) transcription, though the underlying mechanisms are poorly understood. To address this gap in knowledge, we examined changes in pituitary gene expression in GnRH-deficient mice (hpg) treated with a regimen of exogenous GnRH that increases pituitary Fshb but not luteinizing hormone β (Lhb) messenger RNA levels. Activating transcription factor 3 (Atf3) was among the most upregulated genes. Activating transcription factor 3 (ATF3) can heterodimerize with members of the activator protein 1 family to regulate gene transcription. Co-expression of ATF3 with JunB stimulated murine Fshb, but not Lhb, promoter-reporter activity in homologous LβT2b cells. ATF3 also synergized with a constitutively active activin type I receptor to increase endogenous Fshb expression in these cells. Nevertheless, FSH production was intact in gonadotrope-specific Atf3 knockout [conditional knockout (cKO)] mice. Ovarian follicle development, ovulation, and litter sizes were equivalent between cKOs and controls. Testis weights and sperm counts did not differ between genotypes. Following gonadectomy, increases in LH secretion were enhanced in cKO animals. Though FSH levels did not differ between genotypes, post-gonadectomy increases in pituitary Fshb and gonadotropin α subunit expression were more pronounced in cKO than control mice. These data indicate that ATF3 can selectively stimulate Fshb expression in vitro but is not required for FSH production in vivo.
Journal Article2023-03-01No SnippetsAvtaar Singh SS, Das De S, Al-Adhami A, Singh R, Hopkins PM, Curry PA.
Show Full Abstract
Lung transplantation is the treatment of choice for patients with end-stage lung disease. Currently, just under 5000 lung transplants are performed worldwide annually. However, a major scourge leading to 90-d and 1-year mortality remains primary graft dysfunction. It is a spectrum of lung injury ranging from mild to severe depending on the level of hypoxaemia and lung injury post-transplant. This review aims to provide an in-depth analysis of the epidemiology, patho physiology, risk factors, outcomes, and future frontiers involved in mitigating primary graft dysfunction. The current diagnostic criteria are examined alongside changes from the previous definition. We also highlight the issues surrounding chronic lung allograft dysfunction and identify the novel therapies available for ex-vivo lung perfusion. Although primary graft dysfunction remains a significant contributor to 90-d and 1-year mortality, ongoing research and development abreast with current technological advancements have shed some light on the issue in pursuit of future diagnostic and therapeutic tools.
Also flagged:BEThistonecell cyclebrain developmentneuropsychiatric disordersRett syndrome
Journal Article2023-03-01✓ 1 SnippetMartella N, Pensabene D, Varone M, Colardo M, Petraroia M, Sergio W, La Rosa P, Moreno S, Segatto M.
In-Text Gene Mentions
S I O 001029)
…Concerning epigenetic changes, it has been postulated that Htt mutation severely affects HAT enzymatic activity; for this reason, it is believed that alterations in HAT functionality may represent a crucial phenomenon in transcriptional deregulation observed in HD [161].…
Show Full Abstract
BET proteins function as histone code readers of acetylated lysins that determine the positive regulation in transcription of genes involved in cell cycle progression, differentiation, inflammation, and many other pathways. In recent years, thanks to the development of BET inhibitors, interest in this protein family has risen for its relevance in brain development and function. For example, experimental evidence has shown that BET modulation affects neuronal activity and the expression of genes involved in learning and memory. In addition, BET inhibition strongly suppresses molecular pathways related to neuroinflammation. These observations suggest that BET modulation may play a critical role in the onset and during the development of diverse neurodegenerative and neuropsychiatric disorders, such as Alzheimer's disease, fragile X syndrome, and Rett syndrome. In this review article, we summarize the most recent evidence regarding the involvement of BET proteins in brain physiology and pathology, as well as their pharmacological potential as targets for therapeutic purposes.
Also flagged:Amino AcidMetabolismNeurodegenerative DiseasesagingmitochondrialAD
Journal Article2023-03-01✓ 5 SnippetsMaszka P, Kwasniak-Butowska M, Cysewski D, Slawek J, Smolenski RT, Tomczyk M.
In-Text Gene Mentions
S I O 001029)
…It can be concluded that tyrosine may be a specific biomarker of HD because it has an affinity to binding to the wild-type HTT protein to thyroid hormone receptor-α1 [206,207,208,209].…
S I O 001029)
…HD results from a mutation in the IT15 gene, which is located on the short arm of chromosome 4, leading to multiple trinucleotide repeats of the N-terminal region of the huntingtin (Htt) protein [180].…
S I O 001029)
…Taken together, alanine might be an important metabolite to modulate HTT protein aggregation in HD and, therefore, HD progression markers.…
S I O 001029)
…However, in experimental studies, the addition of glutamine in the yeast model of HD led to the significantly increased aggregation of HTT protein.…
Introduction)
…of the huntingtin (Htt) protein [ 180…
Show Full Abstract
The prevalence of neurodegenerative diseases (NDs) is increasing due to the aging population and improved longevity. They are characterized by a range of pathological hallmarks, including protein aggregation, mitochondrial dysfunction, and oxidative stress. The aim of this review is to summarize the alterations in brain energy and amino acid metabolism in Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD). Based on our findings, we proposed a group of selected metabolites related to disturbed energy or mitochondrial metabolism as potential indicators or predictors of disease. We also discussed the hidden challenges of metabolomics studies in NDs and proposed future directions in this field. We concluded that biochemical parameters of brain energy metabolism disruption (obtained with metabolomics) may have potential application as a diagnostic tool for the diagnosis, prediction, and monitoring of the effectiveness of therapies for NDs. However, more studies are needed to determine the sensitivity of the proposed candidates. We suggested that the most valuable biomarkers for NDs studies could be groups of metabolites combined with other neuroimaging or molecular techniques. To attain clinically applicable results, the integration of metabolomics with other "omic" techniques might be required.
IgG-4-related autoimmune hepatitis (IgG4-AIH) is a rare disease. We report here a case of IgG4-AIH in an elderly male patient who was admitted to hospital because of unexplained hepatic insufficiency. After excluding viral hepatitis, alcoholic liver disease, drug-induced liver disease, parasitic infection, hepatolenticular degeneration and other diseases, and observing elevated levels of IgG-4, humoral immunity index, abnormal liver disease antibody spectrum and liver biopsy results, we made a diagnosis of IgG4-AIH. Following treatment with prednisone and ursodeoxycholic acid, the patient's liver function improved significantly and the patient was discharged from hospital.
<h4>Background</h4>The treatment of tuberculosis (TB) is known to cause liver injury, however, there is limited data to guide optimal treatment for patients with chronic liver disease.<h4>Methods</h4>We undertook a retrospective case series of patients with chronic liver disease and TB disease. The primary objective was to determine if there was a difference in the incidence of drug-induced liver injury (DILI) in patients with cirrhosis versus those with chronic hepatitis. Additionally, we sought to compare TB treatment outcomes, type and duration of therapy, and incidence of adverse events.<h4>Results</h4>We included 56 patients (chronic hepatitis 40; cirrhosis 16). There were 33 patients (58.9%) who experienced DILI requiring treatment modification, with no significant difference between groups (65% versus 43.8%, <i>p</i> = 0.23). Patients with chronic hepatitis were more likely to receive treatment with standard first-line intensive phase therapy that included a combination of rifampin (RIF), isoniazid, and pyrazinamide (80.8% versus 19.2%, <i>p</i> = 0.03) and any regimen than included isoniazid (92.5% versus 68.8%, <i>p</i> = 0.04). The risk of DILI was higher when more hepatotoxic TB medications were used. Overall treatment success in this cohort was low (55.4%), with no significant difference between groups (62.5% versus 37.5%, <i>p</i> = 0.14). Most patients with treatment success (97%) were able to tolerate a rifamycin.<h4>Conclusions</h4>The risk of DILI is high, especially with the use of isoniazid, in patients with TB and chronic liver disease. This risk can be effectively mitigated with no difference in treatment outcomes in the presence of cirrhosis.
…- Alteration in chromosome number or structure, loss of heterozygosity and aneuploidy[158]; - Mutations in the APC gene, a negative regulator of β-catenin-dependent Wnt signaling pathway (in 70%-80% of cases)[158]; - Mutations in TP53, KRAS, and PIK3CA genes and tumor suppressor genes SMAD2, SMAD4, and DCC[157,158]; - 20%-60% of tumors are CIN-H[158]…
Show Full Abstract
In 2020, the International Agency for Research on Cancer and the World Health Organization's GLOBOCAN database ranked colorectal cancer (CRC) as the third most common cancer in the world. Most cases of CRC (> 95%) are sporadic and develop from colorectal polyps that can progress to intramucosal carcinoma and CRC. Increasing evidence is accumulating that the gut microbiota can play a key role in the initiation and progression of CRC, as well as in the treatment of CRC, acting as an important metabolic and immunological regulator. Factors that may determine the microbiota role in CRC carcinogenesis include inflammation, changes in intestinal stem cell function, impact of bacterial metabolites on gut mucosa, accumulation of genetic mutations and other factors. In this review, I discuss the major mechanisms of the development of sporadic CRC, provide detailed characteristics of the bacteria that are most often associated with CRC, and analyze the role of the microbiome and microbial metabolites in inflammation initiation, activation of proliferative activity in intestinal epithelial and stem cells, and the development of genetic and epigenetic changes in CRC. I consider long-term studies in this direction to be very important, as they open up new opportunities for the treatment and prevention of CRC.
Also flagged:Budd-Chiari syndromemyeloproliferative neoplasmsdisordersprimary myelofibrosispathogenesisextracellular traps
Journal Article2023-03-01✓ 1 SnippetGăman MA, Cozma MA, Manan MR, Srichawla BS, Dhali A, Ali S, Nahian A, Elton AC, Simhachalam Kutikuppala LV, Suteja RC, Diebel S, Găman AM, Diaconu CC.
In-Text Gene Mentions
Results)
…granulomatous liver disease,hemochromatosis, and alcoholic liver…
Show Full Abstract
Myeloproliferative neoplasms (MPNs) are defined as clonal disorders of the hematopoietic stem cell in which an exaggerated production of terminally differentiated myeloid cells occurs. Classical, Philadelphia-negative MPNs, <i>i.e.</i>, polycythemia vera, essential thrombocythemia and primary myelofibrosis, exhibit a propensity towards the development of thrombotic complications that can occur in unusual sites, <i>e.g.</i>, portal, splanchnic or hepatic veins, the placenta or cerebral sinuses. The pathogenesis of thrombotic events in MPNs is complex and requires an intricate mechanism involving endothelial injury, stasis, elevated leukocyte adhesion, integrins, neutrophil extracellular traps, somatic mutations (<i>e.g.</i>, the V617F point mutation in the <i>JAK2</i> gene), microparticles, circulating endothelial cells, and other factors, to name a few. Herein, we review the available data on Budd-Chiari syndrome in Philadelphia-negative MPNs, with a particular focus on its epidemiology, pathogenesis, histopathology, risk factors, classification, clinical presentation, diagnosis, and management.
<h4>Background</h4>6:1 Fluorotelomer alcohol (6:1 FTOH) is a member of the per- and polyfluoroalkyl class of compounds to which humans are widely exposed. Toxicological information on this class of chemicals is sparse. A short-term, in vivo transcriptomic study was used to assess the biological potency of 6:1 FTOH.<h4>Methods</h4>A short-term in vivo biological potency study on 6:1 FTOH in adult male and female Sprague Dawley (Hsd:Sprague Dawley® SD®) rats was conducted. 6:1 FTOH was formulated in corn oil and administered once daily for 5 consecutive days by gavage (study days 0–4). 6:1 FTOH was administered at 10 doses (0, 0.15, 0.5, 1.4, 4, 12, 37, 111, 333, and 1,000 mg/kg body weight [mg/kg]). Blood was collected from animals dedicated for internal dose assessment in the 4 and 37 mg/kg groups. On study day 5, the day after the final dose was administered, animals were euthanized, standard toxicological measures were assessed, and the liver and kidney were assayed in gene expression studies using the TempO-Seq assay. Modeling was conducted to identify the benchmark doses (BMDs) associated with apical toxicological endpoints and transcriptional changes in the liver and kidney. A benchmark response of one standard deviation was used to model all endpoints.<h4>Results</h4>Several clinical pathology and organ weight measurements showed dose-related changes from which BMD values were calculated. In male rats, the effects included significantly decreased total thyroxine concentration, increased relative liver weight, increased albumin concentration, increased relative left kidney weight, increased aspartate aminotransferase activity, increased absolute liver weight, increased alanine aminotransferase activity, increased alkaline phosphatase activity, and increased creatinine concentration. The BMDs and benchmark dose lower confidence limits (BMDLs) were 3.19 (1.774), 12.122 (9.527), 13.365 (4.084), 20.907 (4.272), 28.117 (19.352), 28.507 (15.286), 36.116 (21.468), 89.383 (74.114), and 97.38 (32.365) mg/kg, respectively. In female rats, the effects included significantly decreased reticulocyte count, increased large unstained cell count, decreased total triiodothyronine concentration, increased monocyte count, increased thyroid stimulating hormone concentration, and increased aspartate aminotransferase activity. The BMDs (BMDLs) were 15.578 (3.622), 54.339 (15.759), 161.48 (122.215), 257.111 (160.613), 356.61 (268.917), and 497.046 (340.458) mg/kg, respectively. Average 6:1 FTOH plasma concentrations at 2 hours postdose were lower in female rats than in male rats. At 24 hours postdose, the concentration fell below the limit of detection of the analytical method in both male and female rats, suggesting short plasma half-lives of 6:1 FTOH in rats. In the liver of male and female rats, no Gene Ontology biological process or individual genes had BMD median values below the lower limit of extrapolation (<0.050 mg/kg). The most sensitive gene sets in male rats for which a reliable estimate of the BMD could be made were cellular response to epidermal growth factor stimulus and response to epidermal growth factor with median BMDs of 0.368 and 0.690 mg/kg and median BMDLs of 0.103 and 0.456 mg/kg, respectively. The most sensitive gene sets in female rats for which a reliable estimate of the BMD could be made were positive regulation of phagocytosis and regulation of phagocytosis with median BMDs of 44.730 and 48.555 mg/kg and median BMDLs of 22.260 and 27.154 mg/kg, respectively. The most sensitive upregulated genes in male rats with reliable BMD estimates included Acot2, Eci1, Loc100911558/Spink1l, Spink1, Ehhadh, Crot, Acaa1a, and Acaa1b with BMDs (BMDLs) of 1.012 (0.809), 1.013 (0.769), 1.270 (0.542), 1.270 (0.542), 1.280 (1.047), 1.411 (1.092), 1.874 (1.524), and 1.874 (1.524) mg/kg, respectively. The most sensitive downregulated genes in male rats with reliable BMD estimates were Myc and Zfp36 with BMDs (BMDLs) of 0.186 (0.103) and 0.368 (0.097) mg/kg, respectively. In female rats, the top 10 most sensitive individual genes were upregulated. These genes were Gdf15, Igfbp1, Eci1, Etfdh, Cyp2b1, Loc108348266/Cyp2b1, Dhrs7, Dhrs7l1, Slc27a2, and Vnn1 with BMDs (BMDLs) of 17.724 (8.696), 18.792 (7.230), 32.546 (27.162), 34.846 (26.297), 35.483 (29.479), 35.483 (29.479), 35.986 (10.630), 35.986 (10.630), 36.103 (26.571), and 37.026 (30.688) mg/kg, respectively. In the kidney of male rats, two Gene Ontology biological processes had BMD median values <0.050 mg/kg, which relate to astrocyte activation and negative regulation of response to biotic stimulus. The most sensitive gene sets in male rats for which a reliable estimate of the BMD could be made were acetyl-CoA metabolic process and acyl-CoA metabolic process with median BMDs of 1.346 and 1.928 mg/kg and median BMDLs of 0.541 and 1.305 mg/kg, respectively. No gene sets in the kidney of female rats had estimated BMD median values <0.050 mg/kg. The most sensitive gene sets in female rats for which a reliable estimate of the BMD could be made were fatty acid beta-oxidation and fatty acid oxidation with median BMDs of 21.079 and 27.058 mg/kg and median BMDLs of 13.312 and 13.877 mg/kg, respectively. No individual kidney genes in male rats had median BMD values <0.050 mg/kg. The most sensitive upregulated genes in male rats with reliable BMD estimates included Decr1, Vnn1, Hmgcs2, Ehhadh, Eci2, Acaa2, Acot1, Cyp4a1, and Ech1 with BMDs (BMDLs) of 0.680 (0.505), 0.705 (0.488), 0.804 (0.541), 0.953 (0.671), 0.989 (0.643), 1.346 (0.539), 1.363 (0.938), 1.593 (1.021), and 2.055 (1.124) mg/kg, respectively. One gene, Acmsd, was downregulated with a BMD (BMDL) of 0.775 (0.183) mg/kg. In female rats, the top 10 most sensitive individual genes were upregulated. One individual gene, Plod3, had a BMD value <0.050 mg/kg. The next most sensitive upregulated genes with reliable BMD estimates included Eci1, Vnn1, Hmgcs2, Ehhadh, Eci2, Acaa1a, Acaa1b, Ech1, and Acaa2 with BMDs (BMDLs) of 9.486 (7.353), 10.025 (7.993), 11.644 (9.266), 12.212 (9.437), 12.789 (9.488), 13.850 (11.009), 13.850 (11.009), 19.820 (14.141), and 22.339 (13.614) mg/kg, respectively.<h4>Summary</h4>Taken together, in male rats, the most sensitive gene set BMD (BMDL) median, individual gene BMD (BMDL), and apical endpoint BMD (BMDL) values that could be reliably determined occurred at 0.368 (0.103), 0.186 (0.103), and 3.19 (1.774) mg/kg, respectively. The BMDs (BMDLs) could not be determined for two gene sets and were estimated to be <0.050 mg/kg. In female rats, the most sensitive gene set BMD (BMDL) median, individual gene BMD (BMDL), and apical endpoint BMD (BMDL) values that could be reliably determined occurred at 21.079 (13.312), 9.486 (7.353), and 15.578 (3.622) mg/kg, respectively. The BMD (BMDL) could not be determined for one individual gene and was estimated to be <0.050 mg/kg. Future studies investigating lower doses would be helpful to obtain more accurate estimates of BMD values for the most sensitive gene sets.
<h4>Background</h4>Accurate prognosis is important either after acute infection or during long-term follow-up of patients infected by severe acute respiratory syndrome coronavirus 2. This study aims to predict coronavirus disease 2019 (COVID-19) severity based on clinical and biological indicators, and to identify biomarkers for prognostic assessment.<h4>Methods</h4>We included 261 Vietnamese COVID-19 patients, who were classified into moderate and severe groups. Disease severity prediction based on biomarkers and clinical parameters was performed by applying machine learning and statistical methods using the combination of clinical and biological data.<h4>Results</h4>The random forest model could predict with 97% accuracy the likelihood of COVID-19 patients who subsequently worsened to the severe condition. The most important indicators were interleukin (IL)-6, ferritin and D-dimer. The model could still predict with 92% accuracy after removing IL-6 from the analysis to generalise the applicability of the model to hospitals with limited capacity for IL-6 testing. The five most effective indicators were C-reactive protein (CRP), D-dimer, IL-6, ferritin and dyspnoea. Two different sets of biomarkers (D-dimer, IL-6 and ferritin, and CRP, D-dimer and IL-6) are applicable for the assessment of disease severity and prognosis. The two biomarker sets were further tested through machine learning algorithms and relatively validated on two Danish COVID-19 patient groups (n=32 and n=100). The results indicated that various biomarker sets combined with clinical data can be used for detection of the potential to develop the severe condition.<h4>Conclusion</h4>This study provided a simple and reliable model using two different sets of biomarkers to assess disease severity and predict clinical outcomes in COVID-19 patients in Vietnam.
Also flagged:ArgatrobanCerebral Venous Sinus ThrombosisATAT deficiencyheparinsystemic hemorrhage
Journal Article2023-03-01✓ 5 SnippetsMa H, Zhang Q, Gu Y, Ji X, Duan J.
In-Text Gene Mentions
Abstract)
…Argatroban may be effective for thrombophilia caused by <i>SERPINC1</i> mutation.…
Title)
…Sinus Thrombosis WithSERPINC1Mutation…
Abstract)
…deficiency due toSERPINC1mutation does not…
Abstract)
…thrombophilia caused bySERPINC1mutation.…
Abstract)
…ResultsSERPINC1mutation (exon1, c.40delA:…
Show Full Abstract
<h4>Objectives</h4>Anticoagulation therapy for cerebral venous sinus thrombosis (CVST) with antithrombin (AT) deficiency due to <i>SERPINC1</i> mutation does not often yield the expected outcomes. Argatroban may be effective for thrombophilia caused by <i>SERPINC1</i> mutation. However, argatroban resistance deserves attention.<h4>Methods</h4>We report a case of a 19-year-old man who was admitted to the hospital with sudden headache, nausea, vomiting, and eye swelling for 3 days. Brain MRI on admission showed multifocal CVST.<h4>Results</h4><i>SERPINC1</i> mutation (exon1, c.40delA: [p.R14Gfs*17]) combined with hereditary AT deficiency (AT activity was 50% [reference range: 80%-120%]) was detected in this patient. A high dose of anticoagulation treatment with argatroban did not improve the activated partial thromboplastin time (APTT) level to the target range (1.5-3 times over the initial baseline level) for this case. We chose adjunctive anticoagulation (argatroban-combined low-molecular-weight heparin), and the APTT gradually reached the target level. At 3-month follow-up, no recurrence of headache or any systemic hemorrhage was found and the ultrasonography of the optic nerve sheath showed normal. Magnetic resonance black blood thrombosis imaging suggested thrombus absorption.<h4>Discussion</h4>Argatroban resistance may be associated with thrombin receptor saturation and deserves attention. The use of adjunctive anticoagulants may be the optimum strategy during acute and subacute phases of CVST with AT deficiency due to <i>SERPINC1</i> mutation.
<h4>Background & aims</h4>Bleeding from gastric fundal varices (isolated gastric varices type 1/gastroesophageal varices type 2) represents a major problem because of a high incidence of rebleeding and death with standard-of-care therapy (endoscopic obliteration with tissue adhesives plus pharmacological therapy). Transjugular intrahepatic portosystemic shunts (TIPSs) are recommended as a rescue therapy. Pre-emptive 'early' TIPS (pTIPS) significantly improves control of bleeding and survival in patients at high-risk of dying or rebleeding from esophageal varices.<h4>Methods</h4>This randomised controlled trial investigate whether the use of pTIPS improves rebleeding-free survival in patients with gastric fundal varices (isolated gastric varices type 1 and/or gastroesophageal varices type 2) compared with standard therapy.<h4>Results</h4>The study did not achieve the predefined sample size because of low recruitment. Nevertheless, pTIPS (n = 11) was more effective compared with combined endoscopic and pharmacological therapy (n = 10) in improving rebleeding-free survival (per protocol analysis: 100 <i>vs</i>. 28%; <i>p</i> = 0.017). This was mainly because of a better outcome in patients with Child-Pugh B or C scores. There were no differences in serious adverse events or in the incidence of hepatic encephalopathy among the different cohorts.<h4>Conclusion</h4>The use of pTIPS should be considered in patients with Child-Pugh B or C scores bleeding from gastric fundal varices.<h4>Impact and implications</h4>The first-line treatment of gastric fundal varices (GOV2 and/or IGV1) is the combination of pharmacological therapy and endoscopic obliteration with glue. TIPS is considered the main rescue therapy. Recent data suggest that, in patients at high-risk of dying or rebleeding (Child-Pugh C or B scores + active bleeding at endoscopy) from esophageal varices, the use of pTIPS, performed during the first 72 h from admission, results in an increased rate of control of bleeding and survival compared with combined endoscopic and pharmacological therapy. Herein, we present a randomised controlled trial comparing pTIPS with combined endoscopic (injection of glue) and pharmacological therapy (first, somatostatin or terlipressin; carvedilol after discharge) in the treatment of patients bleeding from GOV2 and/or IGV1. Although we were not able to include the calculated sample size because of the scarcity of these patients, our results show that the use of pTIPS is associated with a significantly higher actuarial rebleeding-free survival when analysed as per protocol. This is because of the greater efficacy of this treatment in patients with Child-Pugh B or C scores.
Also flagged:aginghead and neck squamous carcinomatumorhead and neck squamous cell carcinomaHNSCCLINC00861
Journal Article2023-03-01No SnippetsGao Q, Shi Y, Sun Y, Zhou S, Liu Z, Sun X, DI X.
Show Full Abstract
Aging is highly associated with tumor formation and progression. However, little research has explored the association of aging-related lncRNAs (ARLs) with the prognosis and tumor immune microenvironment (TIME) of head and neck squamous cell carcinoma (HNSCC). RNA sequences and clinicopathological data of HNSCC patients and normal subjects were downloaded from The Cancer Genome Atlas. In the training group, we used Pearson correlation, univariate Cox regression, least absolute shrinkage/selection operator regression analyses, and multivariate Cox regression to build a prognostic model. In the test group, we evaluated the model. Multivariate Cox regression was done to screen out independent prognostic factors, with which we constructed a nomogram. Afterward, we demonstrated the predictive value of the risk scores based on the model and the nomogram using time-dependent receiver operating characteristics. Gene set enrichment analysis, immune correlation analysis, and half-maximal inhibitory concentration were also performed to reveal the different landscapes of TIME between risk groups and to predict immuno- and chemo-therapeutic responses. The most important LINC00861 in the model was examined in HNE1, CNE1, and CNE2 nasopharyngeal carcinoma cell lines and transfected into the cell lines CNE1 and CNE2 using the LINC00861-pcDNA3.1 construct plasmid. In addition, CCK-8, Edu, and SA-β-gal staining assays were conducted to test the biofunction of LINC00861 in the CNE1 and CNE2 cells. The signature based on nine ARLs has a good predictive value in survival time, immune infiltration, immune checkpoint expression, and sensitivity to multiple drugs. LINC00861 expression in CNE2 was significantly lower than in the HNE1 and CNE1 cells, and LINC00861 overexpression significantly inhibited the proliferation and increased the senescence of nasopharyngeal carcinoma cell lines. This work built and verified a new prognostic model for HNSCC based on ARLs and mapped the immune landscape in HNSCC. LINC00861 is a protective factor for the development of HNSCC.
<h4>Aim</h4>Many pivotal trials in advanced hepatocellular carcinoma (HCC) require participants to have Child-Pugh A disease. However, many patients in real-world practice are Child-Pugh B or C. This study examined treatment patterns and clinical outcomes in patients with advanced HCC treated with first-line systemic therapy.<h4>Materials & methods</h4>In this retrospective study, patients with HCC treated with first-line systemic therapy (2010-2017) were identified from US Oncology Network records. Outcomes included overall survival and progression-free survival, by Child-Pugh Class and prior liver-directed therapy.<h4>Results</h4>Of 352 patients, 78.7% were Child-Pugh A or B, 96.6% received first-line sorafenib, and 33.8% received first-line-prior liver-directed therapy. Survival outcomes were similar for Child-Pugh A or B, and longer after first-line prior liver-directed therapy.<h4>Conclusion</h4>First-line systemic therapy is beneficial in patients with Child-Pugh A or B, and after first-line prior liver-directed therapy. These findings may help position systemic therapy in the community setting.
Also flagged:mucormycosisCOVID- 19opportunistic fungal infectionsCOVID-19corticosteroidsvision
Journal Article2023-03-01✓ 1 SnippetRaychaudhuri S, Taneja J, Sasidharan J, Pujani M, Singh K, Chatterjee T, Jain M, Chandoke R, Rai A, Abbas Z, Das A.
In-Text Gene Mentions
Discussion)
…with iron overload,hemochromatosis, des-ferrioxamine therapy, se…
Show Full Abstract
<h4>Background and purpose</h4>Morbidity and mortality of opportunistic fungal infections in COVID-19 patients are less studied and defined. The patients receiving immunosuppressive therapy, broad-spectrum antibiotics, corticosteroids, and invasive and non-invasive ventilation are the high-risk groups.<h4>Materials and methods</h4>The demographic profile as well as clinical and radiological findings of all the patients with COVID-19 suspected of Mucormycosis (MM) were recorded. The tissue samples from all the patients were sent for microbiological (KOH mount and culture) and histopathological analysis for confirmation of MM.<h4>Results</h4>In total, 45 COVID-19 patients suspected of MM were included in the study and MM was confirmed in 42 patients. The mean age of the patients was 50.30±14.17 years with a female: male ratio of 1.1:1. The most common symptom was headache (52.38%) followed by purulent nasal discharge (38.09%) and facial pain in 33.33% of the cases. The ocular symptoms included a diminution of vision (33.33%) and redness of the eye (2.38%). The most common site of involvement was rhino-orbital (42.85%) followed by sinonasal (23.80%) and rhino cerebral (19.04%). Majority (38.09%) of the patients were diagnosed with stage II of Rhino-orbital-cerebral Mucormycosis (ROCM) based on radiology. A history of diabetes mellitus and steroids was present in 97.61% and 85.71% of the cases, respectively. Moreover, KOH was positive for MM in 97.61% of the cases while the culture was positive in only 35.71% of the cases. In addition, on histopathology, MM was confirmed in 64.28 % of the cases. Mixed growth with <i>Aspergillus</i> species and <i>Rhizopus</i> species was observed in 14.28% of the cases in culture and 11.90% of the cases in histopathology test. Furthermore, angioinvasion was found in 23.80% of the cases according to the histopathology test.<h4>Conclusion</h4>Based on the results, the most common conditions associated with MM in COVID-19 patients were diabetes mellitus and steroid therapy. A high level of clinical suspicion aided with diagnostic tests, including KOH mount, culture, histopathology, and radiology which helped the early detection of opportunistic fungal infection in COVID-19 patients to ensure timely treatment.
medRxiv2023-03-01Preprint (No Snippets API)Li Y, Dang X, Chen R, Wang J, Li S, Mitchell BL, Yao Y, Li M, Li T, Zhang Z, Luo X.
Show Full Abstract
Deciphering the genetic architecture of depression is pivotal for characterizing the associated pathophysiological processes and development of new therapeutics. Here we conducted a cross-ancestry genome-wide meta-analysis on depression (416,437 cases and 1,308,758 controls) and identified 287 risk loci, of which 140 are new. Variant-level fine-mapping prioritized potential causal variants and functional genomic analysis identified variants that regulate the binding of transcription factors. We validated that 80% of the identified functional variants are regulatory variants and expression quantitative trait loci (eQTL) analysis uncovered the potential target genes regulated by the prioritized risk variants. Gene-level analysis, including transcriptome-wide association study (TWAS), proteome-wide association study (PWAS), colocalization and Mendelian randomization-based analyses, prioritized potential causal genes and drug targets. Combining evidence from different analyses revealed likely causal genes, including TMEM106B, CTNND1, EPHB2, AREL1, CSE1L, RAB27B, SATU1, TMEM258, DCC, etc . Pathway analysis showed significant enrichment of depression risk genes in synapse-related pathways. Finally, we showed that Tmem106b knockdown resulted in depression-like behaviors in mice, supporting involvement of Tmem106b in depression. Our study identified new risk loci, likely causal variants and genes for depression, providing important insights into the genetic architecture of depression and potential therapeutic targets.