Gene Literature Dashboard

Viewing June 2023 — 658 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← May 2023 July 2023 →
DCC
Also flagged:Colorectal Cancercancercolon cancerdistal colon cancerrectal cancerproximal colon cancer
Journal Article 2023-06-30 ✓ 3 Snippets Manandhar Shrestha R, Mizoue T, Islam Z, Kawakatsu Y, Ito H, Wada K, Nagata C, Zha L, Kitamura T, Sakata R, Kimura T, Sugawara Y, Tsuji I, Sato R, Sawada N, Tsugane S, Lin Y, Oze I, Abe SK, Inoue M.
In-Text Gene Mentions

…cancer, PCC, andDCC(Table 2 and…

…the association forDCCwas statistically significant…

…colon (PCC andDCC) differ in molecular,…

Show Full Abstract

<h4>Background</h4>While tall stature has been linked to an increase in the risk of colorectal cancer (CRC), its association with cancer in the colorectum and its subsites remains unclear among Asians.<h4>Methods</h4>We conducted a pooled analysis of 10 population-based cohort studies among adults in Japan. Each study estimated hazard ratios (HRs) and 95% confidence intervals (CIs) for CRC incidence associated with adult height were estimated using Cox proportional hazards regression with adjustment of the same set of covariates were then pooled to estimate summary HRs incidence using random-effect models.<h4>Results</h4>We identified 9,470 CRC incidences among 390,063 participants during 5,672,930 person-years of follow-up. Men and women with tall stature had a higher risk of CRC and colon cancer. HRs for CRC, colon cancer, and distal colon cancer for the highest versus lowest height categories were 1.23 (95% CI, 1.07-1.40), 1.22 (95% CI, 1.09-1.36), and 1.27 (95% CI, 1.08-1.49), respectively, in men and 1.21 (95% CI, 1.09-1.35), 1.23 (95% CI, 1.08-1.40), and 1.35 (95% CI, 1.003-1.81), respectively, in women. The association with proximal colon cancer and rectal cancer was less evident in both sexes.<h4>Conclusion</h4>This pooled analysis confirms the link between tall stature and a higher risk of CRC and colon cancer (especially distal colon) among the Japanese and adds evidence to support the use of adult height to identify those at a higher risk of CRC.

HTT
Also flagged:Alcoholismalcohol use disordersubstance useuse disordersbehavioralalcohol dependence
Journal Article 2023-06-30 ✓ 1 Snippet Johnson EC, Salvatore JE, Lai D, Merikangas AK, Nurnberger JI, Tischfield JA, Xuei X, Kamarajan C, Wetherill L, COGA Collaborators, Rice JP, Kramer JR, Kuperman S, Foroud T, Slesinger PA, Goate AM, Porjesz B, Dick DM, Edenberg HJ, Agrawal A.
In-Text Gene Mentions

…42 , 43HTT, 44 ,…

Show Full Abstract

This review describes the genetic approaches and results from the family-based Collaborative Study on the Genetics of Alcoholism (COGA). COGA was designed during the linkage era to identify genes affecting the risk for alcohol use disorder (AUD) and related problems, and was among the first AUD-focused studies to subsequently adopt a genome-wide association (GWAS) approach. COGA's family-based structure, multimodal assessment with gold-standard clinical and neurophysiological data, and the availability of prospective longitudinal phenotyping continues to provide insights into the etiology of AUD and related disorders. These include investigations of genetic risk and trajectories of substance use and use disorders, phenome-wide association studies of loci of interest, and investigations of pleiotropy, social genomics, genetic nurture, and within-family comparisons. COGA is one of the few AUD genetics projects that includes a substantial number of participants of African ancestry. The sharing of data and biospecimens has been a cornerstone of the COGA project, and COGA is a key contributor to large-scale GWAS consortia. COGA's wealth of publicly available genetic and extensive phenotyping data continues to provide a unique and adaptable resource for our understanding of the genetic etiology of AUD and related traits.

Also flagged:wound healingcapsaicininflammatory responseCAPCell migrationinterleukin 6
Journal Article 2023-06-30 No Snippets Huang CJ, Pu CM, Su SY, Lo SL, Lee CH, Yen YH.
Show Full Abstract

Wound healing is a complex biological process involving cytokines with four phases: Hemostasis, inflammation, proliferation and remodeling. Understanding the molecular mechanism of the inflammation phase could improve wound healing in the clinic as excess inflammation is a critical point for dysregulation of normal wound healing. Capsaicin (CAP), a major component of chili peppers, is known to exhibit anti‑inflammatory properties through a range of different pathways, such as the neurogenic inflammation and nociception pathways. To improve the understanding of the relationship between CAP and wound healing, it is crucial to elucidate the CAP‑related molecular panel involved in regulating inflammation. Therefore, the present study aimed to analyze the effects of CAP on wound healing using an <i>in vitro</i> cell model and an <i>in vivo</i> animal model. Cell migration, viability and inflammation were examined using fibroblasts, and wounds were evaluated in mice under CAP treatment. In the present study, it was found that 10 µM CAP increased cell migration and decreased interleukin 6 (IL‑6) expression in <i>in vitro</i> cell assays. In the <i>in vivo</i> animal experiments, the CAP‑treated wounds exhibited lower densities of polymorphonuclear neutrophils and monocytes/macrophages, as well as lower IL‑6 and C‑X‑C motif chemokine ligand 10 protein levels. Furthermore, in CAP‑treated wounds, CD31‑positive capillaries and collagen deposition at the late phase of wound healing were present at higher densities. In summary, an improvement in wound healing by CAP was shown through suppression of the inflammatory response and amelioration of the repair process. These findings suggest that CAP has potential as a natural therapeutic agent for the treatment of wound healing.

SERPINC1
Also flagged:HSPpeptidespeptideammoniumbicarbonatecysteine
Journal Article 2023-06-30 ✓ 1 Snippet Whelan SA, Hendricks N, Dwight ZL, Fu Q, Moradian A, Van Eyk JE, Mockus SM.
In-Text Gene Mentions

…C1R, SERPINF2, andSERPINC1, which were not…

Show Full Abstract

Telehealth, accessing healthcare and wellness remotely, should be a cost-effective and efficient way for individuals to receive care. The convenience of having a reliable remote collection device for blood tests will facilitate access to precision medicine and healthcare. Herein, we tested a 60-biomarker health surveillance panel (HSP), containing 35 FDA/LDT assays and covering at least 14 pathological states, on 8 healthy individuals' ability to collect their own capillary blood from a lancet finger prick and directly compared it to the traditional phlebotomist venous blood and plasma collection methods. All samples were spiked with 114 stable-isotope-labeled (SIL) HSP peptides and quantitatively analyzed by liquid chromatography-multiple reaction monitoring-mass spectrometry (LC/MRM-MS) scheduled method targeting 466 transitions from 114 HSP peptides and by a discovery data-independent acquisition mass spectrometry (DIA-MS) method. The average peak area ratio (PAR) of the HSP quantifier peptide transitions from all 8 volunteers' capillary blood (<i>n</i> = 48), venous blood (<i>n</i> = 48), and matched plasma (<i>n</i> = 24) was <20% coefficients of variation (CV). Heat map analysis of all 8 volunteers demonstrated that each individual had a unique biosignature. Biological replicates from capillary blood and venous blood clustered within each volunteer in <i>k</i>-means clustering analysis. Pearson statistical analysis of the three biofluids indicated that there was >90% similarity. Discovery DIA-MS analysis of the same samples using a plasma spectral library and a pan-human spectral library identified 1121 and 4661 total proteins, respectively. In addition, at least 122 FDA-approved biomarkers were identified. DIA-MS analysis reproducibly quantitated (<30% CV) ∼600-700 proteins in capillary blood, ∼800 proteins in venous blood, and ∼300-400 proteins in plasma, demonstrating that an expansive biomarker panel is possible with current mass spectrometry technology. Both targeted LC/MRM-MS and discovery DIA-MS analysis of whole blood collected on remote sampling devices are viable options for personal proteome biosignature stratification in precision medicine and precision health.

DCC
Also flagged:retinal diseasesdiabetic retinopathyage-related macular degenerationfluoresceinocular diseasesegmentation
Journal Article 2023-06-30 ✓ 1 Snippet Bonnin S, Kubach S, Négrier P, Lewis W, de Sisternes L, Couturier A, Erginay A, Nassisi M, Magazzeni S, Lavia C, Tadayoni R.
In-Text Gene Mentions

…the SCP andDCCscans ( Fig…

Show Full Abstract

<h4>Purpose</h4>To assess a new optical coherence tomography angiography (OCTA) technology and its contribution to retinal vascularization and choriocapillaris (CC) exploration.<h4>Methods</h4>A new module, named "Beam expander" (BE), which increases the lateral resolution of OCTA, was used in combination with a prototype software in the PLEX® Elite 9000 Swept-Source OCT instrument (ZEISS, Dublin, CA). This prospective study involved 22 healthy subjects imaged with and without BE. Qualitative analysis of superficial capillary plexus (SCP), deep capillary complex (DCC) retinal and CC angiograms were performed. Perfusion density (PD), vessel density (VD), and foveal avascular zone (FAZ) measurements were also compared.<h4>Results</h4>Qualitative analysis of single SCP and DCC retinal angiograms acquired with BE showed significantly better vessel sharpness (respectively, p = 0.0002, and p<0.0001), and greater peripheral image quality (p = 0.028 and p = 0.007) compared to standard OCTA images. Mean VD of whole retina single scans was significantly higher for BE angiograms compared to classic angiograms (28.16 ±1.29 mm-1 and 23.36 ±0.92 mm-1, respectively, p<0.0001). Repeatability of VD, PD and FAZ raw size were found to be similar between the two methods (intraclass correlation coefficient: 0.671, 0.604 and 0.994 with BE versus 0.764, 0.638 and 0.990 without BE). CC image quality was found to be significantly superior with BE, and flow deficits were more visible in all BE scans compared to standard scans.<h4>Conclusions</h4>An increase in lateral resolution of the OCT beam resulted in higher quality of retinal and choriocapillaris OCTA images in healthy subjects. These results provide significant insights into the future OCTA imaging enhancements.

NEGR1
Also flagged:Coronary artery diseasetype 2 diabetesdepressioncardiometabolic diseasesmajor depressioncholesterol
Journal Article 2023-06-30 ✓ 2 Snippets Baltramonaityte V, Pingault JB, Cecil CAM, Choudhary P, Järvelin MR, Penninx BWJH, Felix J, Sebert S, Milaneschi Y, Walton E, EarlyCause Consortium.
In-Text Gene Mentions

Three of these genes (NEGR1, TMEM106B, HNF1A) have been linked to each of the three diseases (CAD, T2D and depression) in previous studies [44,65–74], supporting their probable involvement in psycho-cardiometabolic multimorbidity.

…these genes (NEGR1, TMEM106B ,…

Show Full Abstract

Coronary artery disease (CAD), type 2 diabetes (T2D) and depression are among the leading causes of chronic morbidity and mortality worldwide. Epidemiological studies indicate a substantial degree of multimorbidity, which may be explained by shared genetic influences. However, research exploring the presence of pleiotropic variants and genes common to CAD, T2D and depression is lacking. The present study aimed to identify genetic variants with effects on cross-trait liability to psycho-cardiometabolic diseases. We used genomic structural equation modelling to perform a multivariate genome-wide association study of multimorbidity (Neffective = 562,507), using summary statistics from univariate genome-wide association studies for CAD, T2D and major depression. CAD was moderately genetically correlated with T2D (rg = 0.39, P = 2e-34) and weakly correlated with depression (rg = 0.13, P = 3e-6). Depression was weakly correlated with T2D (rg = 0.15, P = 4e-15). The latent multimorbidity factor explained the largest proportion of variance in T2D (45%), followed by CAD (35%) and depression (5%). We identified 11 independent SNPs associated with multimorbidity and 18 putative multimorbidity-associated genes. We observed enrichment in immune and inflammatory pathways. A greater polygenic risk score for multimorbidity in the UK Biobank (N = 306,734) was associated with the co-occurrence of CAD, T2D and depression (OR per standard deviation = 1.91, 95% CI = 1.74-2.10, relative to the healthy group), validating this latent multimorbidity factor. Mendelian randomization analyses suggested potentially causal effects of BMI, body fat percentage, LDL cholesterol, total cholesterol, fasting insulin, income, insomnia, and childhood maltreatment. These findings advance our understanding of multimorbidity suggesting common genetic pathways.

Also flagged:NSLNSL1NSL2NSL3chromatin
Journal Article 2023-06-30 No Snippets Iyer SS, Sun Y, Seyfferth J, Manjunath V, Samata M, Alexiadis A, Kulkarni T, Gutierrez N, Georgiev P, Shvedunova M, Akhtar A.
Show Full Abstract

The NSL complex is a transcriptional activator. Germline-specific knockdown of NSL complex subunits NSL1, NSL2, and NSL3 results in reduced piRNA production from a subset of bidirectional piRNA clusters, accompanied by widespread transposon derepression. The piRNAs most transcriptionally affected by NSL2 and NSL1 RNAi map to telomeric piRNA clusters. At the chromatin level, these piRNA clusters also show decreased levels of H3K9me3, HP1a, and Rhino after NSL2 depletion. Using NSL2 ChIP-seq in ovaries, we found that this protein specifically binds promoters of telomeric transposons <i>HeT-A</i>, <i>TAHRE</i>, and <i>TART</i> Germline-specific depletion of NSL2 also led to a reduction in nuclear Piwi in nurse cells. Our findings thereby support a role for the NSL complex in promoting the transcription of piRNA precursors from telomeric piRNA clusters and in regulating Piwi levels in the Drosophila female germline.

DCC
Also flagged:Chronic hepatitisinfectionacute infectionHepatitis Binfectious diseasecirrhosis
Journal Article 2023-06-30 ✓ 2 Snippets Sanai FM, Aljawad M, Alghamdi AS, Yehoshua A, Khathlan A, Alghamdi M, Kozma S, Smith N, El-Moustaid F, Jeyakumar S, Kachru N.
In-Text Gene Mentions

Abbreviations: CHB = chronic hepatitis B, ETV = entecavir, TAF = tenofovir alafenamide, CC = compensated cirrhosis, DCC = decompensated cirrhosis, HCC = hepatocellular carcinoma, LT = liver transplant

…5% reduction inDCC(89 vs 84),…

Show Full Abstract

<h4>Background</h4>Despite the success of current treatments, many chronic hepatitis B (CHB) patients still live with low-level viremia [LLV] resulting in liver disease progression. This study evaluated the long-term health and economic impact of switching to tenofovir alafenamide (TAF) from entecavir (ETV) in Saudi Arabia (SA) in chronic hepatitis B (CHB) LLV patients.<h4>Methods</h4>A hybrid decision tree Markov state-transition model was developed to simulate a cohort of patients with CHB LLV treated with ETV and switched to TAF over a lifetime horizon in SA. While on treatment, patients either achieved complete virologic response (CVR) or maintained LLV. CVR patients experienced slower progression to advanced liver disease stages as compared to LLV patients. Demographic data, transition probabilities, treatment efficacy, health state costs, and utilities were sourced from published literature. Treatment costs were sourced from publicly available databases.<h4>Results</h4>Base case analysis found that over a lifetime horizon, switching to TAF versus remaining on ETV increased the proportion of patients achieving CVR (76% versus 14%, respectively). Switching to TAF versus remaining on ETV resulted in a reduction in cases of compensated cirrhosis (-52%), decompensated cirrhosis (-5%), hepatocellular carcinoma (-22%), liver transplants (-12%), and a 37% reduction in liver-related deaths. Switching to TAF was cost-effective with an incremental cost-effectiveness ratio of $57,222, assuming a willingness-to-pay threshold of three times gross national income per capita [$65,790/QALY].<h4>Conclusions</h4>This model found that switching to TAF versus remaining on ETV in SA CHB LLV patients substantially reduced long-term CHB-related morbidity and mortality and was a cost-effective treatment strategy.

Also flagged:Covid-19 InfectionMethylationCOVID-19corticotropin releasing hormoneglucocorticoid receptoroxytocin
Journal Article 2023-06-30 No Snippets Urday P, Gayen Nee' Betal S, Sequeira Gomes R, Al-Kouatly HB, Solarin K, Chan JS, Li D, Rahman I, Addya S, Boelig RC, Aghai ZH.
Show Full Abstract

<h4>Background</h4>The global pandemic of coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). About 18.4% of total Covid-19 cases were reported in children. Even though vertical transmission from mother to infant is likely to occur at a low rate, exposure to COVID-19 during fetal life may alter DNA methylation patterns with potential long-term effects.<h4>Objective</h4>To determine if COVID-19 infection during pregnancy alters the DNA methylation patterns in umbilical cord blood cells from term infants and to identify potential pathways and genes affected by exposure to COVID-19 infection.<h4>Methods</h4>Umbilical cord blood was collected from 8 infants exposed to COVID-19 during pregnancy and 8 control infants with no COVID-19 exposure. Genomic DNA was isolated from umbilical cord blood cells and genome-wide DNA methylation was performed using Illumina Methylation EPIC Array.<h4>Results</h4>119 differentially methylated loci were identified at the FDR level of 0.20 (64 hypermethylated loci and 55 hypomethylated loci) in umbilical cord blood cells of COVID-19 exposed neonates compared to the control group. Important canonical pathways identified by Ingenuity Pathway Analysis (IPA) were related to stress response (corticotropin releasing hormone signaling, glucocorticoid receptor signaling, and oxytocin in brain signaling pathway), and cardiovascular disease and development (nitric oxide signaling in the cardiovascular system, apelin cardiomyocyte signaling pathways, factors promoting cardiogenesis, and renin-angiotensin signaling). The genes affected by the differential methylations were associated with cardiac, renal, hepatic, neurological diseases, developmental and immunological disorders.<h4>Conclusions</h4>COVID-19 induces differential DNA methylation in umbilical cord blood cells. The differentially methylated genes may contribute to hepatic, renal, cardiac, developmental and immunological disorders in offspring born to mothers with COVID-19 infection during pregnancy, and their developmental regulation.

SERPINC1
Also flagged:acute pulmonary embolismAcute pulmonary thromboembolismoxygencarbon dioxidemembranedeath
Journal Article 2023-06-30 ✓ 1 Snippet Kurachi A, Ishida Y.
In-Text Gene Mentions

…of 238 mg/dL,antithrombin-III(AT-III) of 107.9%,…

Show Full Abstract

Acute pulmonary thromboembolism (PTE), which carries a high mortality rate, is difficult to diagnose when it occurs intraoperatively. Therefore, patient prognosis depends on a prompt diagnosis by anesthesiologists. A 49-year-old woman underwent right lower extremity dissection due to a contusion of the right lower extremity caused by trauma. Eleven days after surgery, she underwent debridement for necrosis of the amputation wound. Intraoperatively, a drop in blood pressure and tachycardia were observed, and PTE was suspected based on a rapid deterioration in oxygen saturation and a drop in end-tidal carbon dioxide partial pressure. Transesophageal echocardiography (TEE) showed a thrombus filling the right pulmonary artery, and a diagnosis of PTE was made. The patient was treated using venoarterial extracorporeal membrane oxygenation, and thrombectomy was performed the next day to save her life. In this case, we were able to diagnose and treat the intraoperative acute PTE at an early stage. In addition, the appropriate choice of treatment saved the patient's life without complications.

Also flagged:infectionbone formationdegradationosteogenesisorthosilicic acidosteoblast proliferation
Journal Article 2023-06-30 No Snippets Elahpour N, Niesner I, Bossard C, Abdellaoui N, Montouillout V, Fayon F, Taviot-Guého C, Frankenbach T, Crispin A, Khosravani P, Holzapfel BM, Jallot E, Mayer-Wagner S, Lao J.
Show Full Abstract

A novel organic-inorganic hybrid, based on SiO<sub>2</sub>-CaO-ZnO bioactive glass (BG) and polycaprolactone (PCL), associating the highly bioactive and versatile bioactive glass with clinically established PCL was examined. The BG-PCL hybrid is obtained by acid-catalyzed silica sol-gel process inside PCL solution either by direct or indirect printing. Apatite-formation tests in simulated body fluid (SBF) confirm the ion release along with the hybrid's bone-like apatite forming. Kinetics differ significantly between directly and indirectly printed scaffolds, the former requiring longer periods to degrade, while the latter demonstrates faster calcium phosphate (CaP) formation. Remarkably, Zn diffusion and accumulation are observed at the surface within the newly formed active CaP layer. Zn release is found to be dependent on printing method and immersion medium. Investigation of BG at the atomic scale reveals the ambivalent role of Zn, capable of acting both as a network modifier and as a network former linking the BG silicate network. In addition, hMSCs viability assay proves no cytotoxicity of the Zn hybrid. LIVE/DEAD staining demonstrated excellent cell viability and proliferation for over seven weeks. Overall, this hybrid material either non-doped or doped with a metal trace element is a promising candidate to be translated to clinical applications for bone regeneration.

CCDC92
Also flagged:hydrolaseKDM4CTGFB2GOT2MMP12MMP13
Journal Article 2023-06-30 ✓ 5 Snippets Zhao Y, He S, Huang J, Liu M.
In-Text Gene Mentions

…identified as theCCDC92gene by gene…

…non-coding RNA ofCCDC92.…

CCDC92is a coiled-coil…

…been reported thatCCDC92was an unknown…

…] showed thatCCDC92affects the expression…

Show Full Abstract

pH was one of the important meat quality traits, which was an important factor affecting the storage/shelf life and quality of meat in meat production. In order to find a way to extend the storage/shelf life, the pH values (pH<sub>45min</sub>, pH<sub>24h</sub>, pH<sub>48h</sub> and pH<sub>72h</sub>) of the longissimus dorsi muscles in F<sub>2</sub> individuals of 462 Texel sheep × Altay sheep were determined, genotyping was performed using Illumina Ovine SNP 600 K BeadChip and whole genome resequencing technology, a genome-wide association analysis (GWAS) was used to screen the candidate genes and molecular markers for pH values related to the quality traits of mutton, and the effects of population stratification were detected by Q-Q plots. The results showed that the pH population stratification analysis did not find significant systemic bias, and there was no obvious population stratification effect. The results of the association analysis showed that 28 SNPs significantly associated with pH reached the level of genomic significance. The candidate gene associated with pH<sub>45min</sub> was identified as the <i>CCDC92</i> gene by gene annotation and a search of the literature. Candidate genes related to pH<sub>24h</sub> were <i>KDM4C</i>, <i>TGFB2</i> and <i>GOT2</i> genes. The candidate genes related to pH<sub>48h</sub> were <i>MMP12</i> and <i>MMP13</i> genes. The candidate genes related to pH<sub>72h</sub> were <i>HILPDA</i> and <i>FAT1</i> genes. Further bioinformatics analyses showed 24 gene ontology terms and five signaling pathways that were significantly enriched (<i>p</i> ≤ 0.05). Many terms and pathways were related to cellular components, processes of protein modification, the activity of protein dimerization and hydrolase activity. These identified SNPs and genes could provide useful information about meat and the storage/shelf life of meat, thereby extending the storage/shelf life and quality of meat.

Also flagged:cell growthcancergene expressiononcogenestumortranscription factors
Journal Article 2023-06-30 No Snippets Segal D, Dostie J.
Show Full Abstract

As a group of diseases characterized by uncontrollable cell growth, cancer is highly multifaceted in how it overrides checkpoints controlling proliferation. Amongst the regulators of these checkpoints, long non-coding RNAs (lncRNAs) can have key roles in why natural biological processes go haywire. LncRNAs represent a large class of regulatory transcripts that can localize anywhere in cells. They were found to affect gene expression on many levels from transcription to mRNA translation and even protein stability. LncRNA participation in such control mechanisms can depend on cell context, with given transcripts sometimes acting as oncogenes or tumor suppressors. Importantly, the tissue-specificity and low expression levels of lncRNAs make them attractive therapeutic targets or biomarkers. Here, we review the various cellular processes affected by lncRNAs and outline molecular strategies they use to control gene expression, particularly in cancer and in relation to transcription factors.

HFE
Also flagged:EPHEphrinLiver CancerTumorcell surface receptorspathogenesis
Journal Article 2023-06-30 ✓ 1 Snippet Papadakos SP, Stergiou IE, Gkolemi N, Arvanitakis K, Theocharis S.
In-Text Gene Mentions

…diabetes, nicotine use,hemochromatosis, and hereditary tyrosinaemia…

Show Full Abstract

Liver cancer is a complex and challenging disease with limited treatment options and dismal prognosis. Understanding the underlying molecular mechanisms driving liver cancer progression and metastasis is crucial for developing effective therapeutic strategies. The EPH/ephrin system, which comprises a family of cell surface receptors and their corresponding ligands, has been implicated in the pathogenesis of HCC. This review paper aims to provide an overview of the current understanding of the role of the EPH/ephrin system in HCC. Specifically, we discuss the dysregulation of EPH/ephrin signaling in HCC and its impact on various cellular processes, including cell proliferation, migration, and invasion. Overall, the EPH/ephrin signaling system emerges as a compelling and multifaceted player in liver cancer biology. Elucidating its precise mechanisms and understanding its implications in disease progression and therapeutic responses may pave the way for novel targeted therapies and personalized treatment approaches for liver cancer patients. Further research is warranted to unravel the full potential of the EPH/ephrin system in liver cancer and its clinical translation.

Also flagged:sarcomassoft-tissue sarcomaslocalizationssoft-tissue sarcomamalignant tumorstumor
Journal Article 2023-06-30 No Snippets Michot A, Lagarde P, Lesluyes T, Darbo E, Neuville A, Baud J, Perot G, Bonomo I, Maire M, Michot M, Coindre JM, Le Loarer F, Chibon F.
Show Full Abstract

<h4>Background</h4>The management of soft-tissue sarcoma (STS) relies on a multidisciplinary approach involving specialized oncological surgery combined with other adjuvant therapies to achieve optimal local disease control. Purpose and Results: Genomic and transcriptomic pseudocapsules of 20 prospective sarcomas were analyzed and revealed to be correlated with a higher risk of recurrence after surgery.<h4>Conclusions</h4>A peritumoral environment that has been remodeled and infiltrated by M2 macrophages, and is less expressive of healthy tissue, would pose a significant risk of relapse and require more aggressive treatment strategies.

SERPINC1
Also flagged:intrahepatic cholestasis of pregnancyhypothyroidismthrombophiliagestational diabetesgestational hypertensionpostpartum hemorrhage
Journal Article 2023-06-30 ✓ 1 Snippet Granese R, Calagna G, Alibrandi A, Martinelli C, Romeo P, Filomia R, Ferraro MI, Piccione E, Ercoli A, Saitta C.
In-Text Gene Mentions

…prot S, andATIII, reported in the…

Show Full Abstract

The aims of our study were to evaluate the maternal and fetal outcomes of intrahepatic cholestasis of pregnancy (ICP). In this observational, retrospective case-control study, we included all pregnant women who gave birth with a diagnosis of ICP between January 2010 and December 2020 at the Unit of Obstetrics and Gynecology, University Hospital of Messina. The data were compared with those from a control group of pregnant women who did not have ICP. One hundred twenty-nine and eighty-five patients were included, respectively, in the study and in the control group. There was a significant difference between the two groups in the incidence of hypothyroidism, thrombophilia, gestational diabetes, gestational hypertension, postpartum hemorrhage, and preterm delivery, which were more frequent in the ICP patients. No neonatal adverse events were recorded, although a significant difference in the meconium-stained amniotic fluid condition was noted. After a 24-month follow-up, 48/129 patients with ICP accepted to be reassessed by liver ultrasound, elastographic examination, and liver function blood tests. No patient showed signs of chronic liver disease. This study confirmed a higher probability of adverse short-term maternal outcomes in ICP pregnant patients, but a lower probability of adverse short-term fetal outcomes and the absence of a long-term maternal risk of chronic liver disease.

Also flagged:Cerebellar DegenerationMitochondrial Disordersphosphorylationglutamatemitochondrial disorderataxia
Journal Article 2023-06-30 No Snippets Fernández de la Torre M, Fiuza-Luces C, Laine-Menéndez S, Delmiro A, Arenas J, Martín MÁ, Lucia A, Morán M.
Show Full Abstract

By means of a proteomic approach, we assessed the pathways involved in cerebellar neurodegeneration in a mouse model <i>(Harlequin</i>, <i>Hq</i>) of mitochondrial disorder. A differential proteomic profile study (iTRAQ) was performed in cerebellum homogenates of male <i>Hq</i> and wild-type (WT) mice 8 weeks after the onset of clear symptoms of ataxia in the <i>Hq</i> mice (aged 5.2 ± 0.2 and 5.3 ± 0.1 months for WT and <i>Hq</i>, respectively), followed by a biochemical validation of the most relevant changes. Additional groups of 2-, 3- and 6-month-old WT and <i>Hq</i> mice were analyzed to assess the disease progression on the proteins altered in the proteomic study. The proteomic analysis showed that beyond the expected deregulation of oxidative phosphorylation, the cerebellum of <i>Hq</i> mice showed a marked astroglial activation together with alterations in Ca<sup>2+</sup> homeostasis and neurotransmission, with an up- and downregulation of GABAergic and glutamatergic neurotransmission, respectively, and the downregulation of cerebellar "long-term depression", a synaptic plasticity phenomenon that is a major player in the error-driven learning that occurs in the cerebellar cortex. Our study provides novel insights into the mechanisms associated with cerebellar degeneration in the <i>Hq</i> mouse model, including a complex deregulation of neuroinflammation, oxidative phosphorylation and glutamate, GABA and amino acids' metabolism.

SOX6
Also flagged:Diabetic kidney diseasediabetesend-stage renal diseaseglomerular sclerosisepithelial-mesenchymal transitionEMT
Journal Article 2023-06-30 ✓ 5 Snippets Liu Z, Liu J, Wang W, An X, Luo L, Yu D, Sun W.
In-Text Gene Mentions

…scription Factor 6 (SOX6), TGF-β1 and NF-κ…

…of circ_0123996 and SOX6 and decrease the ex…

…lls↑miR-203a-3p↓SOX6↑Proliferation↑I…

…ells↑miR-185-5p↓SOX6↑Apoptosis↑Infla…

…and CNC homology 1; Sox6, SRY-Box Transcript…

Show Full Abstract

Diabetic kidney disease (DKD) is a common microangiopathy in diabetic patients and the main cause of death in diabetic patients. The main manifestations of DKD are proteinuria and decreased renal filtration capacity. The glomerular filtration rate and urinary albumin level are two of the most important hallmarks of the progression of DKD. The classical treatment of DKD is controlling blood glucose and blood pressure. However, the commonly used clinical therapeutic strategies and the existing biomarkers only partially slow the progression of DKD and roughly predict disease progression. Therefore, novel therapeutic methods, targets and biomarkers are urgently needed to meet clinical requirements. In recent years, increasing attention has been given to the role of epigenetic modification in the pathogenesis of DKD. Epigenetic variation mainly includes DNA methylation, histone modification and changes in the noncoding RNA expression profile, which are deeply involved in DKD-related inflammation, oxidative stress, hemodynamics, and the activation of abnormal signaling pathways. Since DKD is reversible at certain disease stages, it is valuable to identify abnormal epigenetic modifications as early diagnosis and treatment targets to prevent the progression of end-stage renal disease (ESRD). Because the current understanding of the epigenetic mechanism of DKD is not comprehensive, the purpose of this review is to summarize the role of epigenetic modification in the occurrence and development of DKD and evaluate the value of epigenetic therapies in DKD.

SOX6
Also flagged:chromatinestrogen receptorERcell surfacetranscription factorTF
Journal Article 2023-06-30 ✓ 5 Snippets Song Y, Fioramonti M, Bouvencourt G, Dubois C, Blanpain C, Van Keymeulen A.
In-Text Gene Mentions

…among Sox TFs,Sox6[ 32 ]…

…all stages, whileSox6, Sox7 and Sox13…

…a role forSox6and suggests a…

…The role ofSox6in maintaining luminal…

…previously described asSox6overexpression maintains lumin…

Show Full Abstract

The mammary gland (MG) is composed of three main epithelial lineages, the basal cells (BC), the estrogen receptor (ER) positive luminal cells (ER+ LC), and the ER negative LC (ER- LC). Defining the cell identity of each lineage and how it is modulated throughout the different stages of life is important to understand how these cells function and communicate throughout life. Here, we used transgenic mice specifically labelling ER+ LC combined to cell surface markers to isolate with high purity the 3 distinct cell lineages of the mammary gland and defined their expression profiles and chromatin landscapes by performing bulk RNAseq and ATACseq of these isolated populations in puberty, adulthood and mid-pregnancy. Our analysis identified conserved genes, ligands and transcription factor (TF) associated with a specific lineage throughout life as well as genes, ligands and TFs specific for a particular stage of the MG. In summary, our study identified genes and TF network associated with the identity, function and cell-cell communication of the different epithelial lineages of the MG at different stages of life.

Also flagged:osteogenesis imperfectabisphosphonatesOI type IIEthylene GlycolMethacrylaterelated
Journal Article 2023-06-30 No Snippets Fus-Kujawa A, Mendrek B, Bajdak-Rusinek K, Diak N, Strzelec K, Gutmajster E, Janelt K, Kowalczuk A, Trybus A, Rozwadowska P, Wojakowski W, Gawron K, Sieroń AL.
Show Full Abstract

<b>Introduction:</b> The benefits of patient's specific cell/gene therapy have been reported in relation to numerous genetic related disorders including osteogenesis imperfecta (OI). In osteogenesis imperfecta particularly also a drug therapy based on the administration of bisphosphonates partially helped to ease the symptoms. <b>Methods:</b> In this controlled trial, fibroblasts derived from patient diagnosed with OI type II have been successfully reprogrammed into induced Pluripotent Stem cells (iPSCs) using Yamanaka factors. Those cells were subjected to repair mutations found in the <i>COL1A1</i> gene using homologous recombination (HR) approach facilitated with star polymer (STAR) as a carrier of the genetic material. <b>Results:</b> Delivery of the correct linear DNA fragment to the osteogenesis imperfecta patient's cells resulted in the repair of the DNA mutation with an 84% success rate. IPSCs showed 87% viability after STAR treatment and 82% with its polyplex. <b>Discussion:</b> The use of novel polymer Poly[N,N-Dimethylaminoethyl Methacrylate-co-Hydroxyl-Bearing Oligo(Ethylene Glycol) Methacrylate] Arms (P(DMAEMA-co-OEGMA-OH) with star-like structure has been shown as an efficient tool for nucleic acids delivery into cells (Funded by National Science Centre, Contract No. UMO-2020/37/N/NZ2/01125).

PRDX6
Also flagged:Heart diseasespathogenesisoxygenheart failuredeathheart disease
Journal Article 2023-06-30 ✓ 1 Snippet Zhu Z, Zhu P, Fan X, Mo X, Wu X.
In-Text Gene Mentions

…n cardiomyocytes through Pum2/PRDX6single pathway.…

Show Full Abstract

Mesenchymal stem cells (MSCs) are one of the most potent therapeutic strategies for repairing cardiac injury. It has been shown in the latest studies that MSCs cannot survive in the heart for a long time. Consequently, the exosomes secreted by MSCs may dominate the repair of heart injury and promote the restoration of cardiac cells, vascular proliferation, immune regulation, etc. Based on the current research, the progress of the acting mechanism, application prospects and challenges of exosomes, including non-coding RNA, in repairing cardiac injuries are summarised in this article.

Also flagged:methotrexatesystemic inflammatory diseasesinflammatory arthritisgene expressionphosphokinasecell cycle
Journal Article 2023-06-30 No Snippets Lang MB, Leung KY, Greene NDE, Malone KM, Saginc G, Randi AM, Kiprianos A, Maughan RT, Pericleous C, Mason JC.
Show Full Abstract

<h4>Objectives</h4>The disease-modifying anti-rheumatic drug methotrexate (MTX) is recognized to reduce cardiovascular risk in patients with systemic inflammatory diseases. However, the molecular basis for these cardioprotective effects remains incompletely understood. This study evaluated the actions of low-dose MTX on the vascular endothelium.<h4>Methods</h4>Human endothelial cells (EC) were studied under <i>in vitro</i> conditions relevant to inflammatory arthritis. These included culture in a pro-inflammatory microenvironment and exposure to fluid shear stress (FSS) using a parallel plate model. Respectively treated cells were analyzed by RNA sequencing and quantitative real-time PCR for gene expression, by immunoblotting for protein expression, by phosphokinase activity arrays, by flow cytometry for cell cycle analyses and by mass spectrometry to assess folate metabolite levels.<h4>Results</h4>In static conditions, MTX was efficiently taken up by EC and caused cell cycle arrest concurrent with modulation of cell signaling pathways. These responses were reversed by folinic acid (FA), suggesting that OCM is a predominant target of MTX. Under FSS, MTX did not affect cell proliferation or pro-inflammatory gene expression. Exposure to FSS downregulated endothelial one carbon metabolism (OCM) as evidenced by decreased expression of key OCM genes and metabolites.<h4>Conclusion</h4>We found that FSS significantly downregulated OCM and thereby rendered EC less susceptible to the effects of MTX treatment. The impact of shear stress on OCM suggested that MTX does not directly modulate endothelial function. The cardioprotective actions of MTX likely reflect direct actions on inflammatory cells and indirect benefit on the vascular endothelium.

ZNFX1
Also flagged:cancerproteinendoplasmic reticulumtumorsorafenibATF4
Journal Article 2023-06-30 ✓ 1 Snippet Guo H, Zhang S, Zhang B, Shang Y, Liu X, Wang M, Wang H, Fan Y, Tan K.
In-Text Gene Mentions

…the expression ofZNFX1antisense RNA 1…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is the most common type of cancer and causes a significant number of cancer-related deaths worldwide. The molecular mechanisms underlying the development of HCC are complex, and the heterogeneity of HCC has led to a lack of effective prognostic indicators and drug targets for clinical treatment of HCC. Previous studies have indicated that the unfolded protein response (UPR), a fundamental pathway for maintaining endoplasmic reticulum homeostasis, is involved in the formation of malignant characteristics such as tumor cell invasiveness and treatment resistance. The aims of our study are to identify new prognostic indicators and provide drug treatment targets for HCC in clinical treatment based on UPR-related genes (URGs).<h4>Methods</h4>Gene expression profiles and clinical information were downloaded from the TCGA, ICGC and GEO databases. Consensus cluster analysis was performed to classify the molecular subtypes of URGs in HCC patients. Univariate Cox regression and machine learning LASSO algorithm were used to establish a risk prognosis model. Kaplan-Meier and ROC analyses were used to evaluate the clinical prognosis of URGs. TIMER and XCell algorithms were applied to analyze the relationships between URGs and immune cell infiltration. Real time-PCR was performed to analyze the effect of sorafenib on the expression levels of four URGs.<h4>Results</h4>Most URGs were upregulated in HCC samples. According to the expression pattern of URGs, HCC patients were divided into two independent clusters. Cluster 1 had a higher expression level, worse prognosis, and higher expression of immunosuppressive factors than cluster 2. Patients in cluster 1 were more prone to immune escape during immunotherapy, and were more sensitive to chemotherapeutic drugs. Four key UPR genes (ATF4, GOSR2, PDIA6 and SRPRB) were established in the prognostic model and HCC patients with high risk score had a worse clinical prognosis. Additionally, patients with high expression of four URGs are more sensitive to sorafenib. Moreover, ATF4 was upregulated, while GOSR2, PDIA6 and SRPRB were downregulated in sorafenib-treated HCC cells.<h4>Conclusion</h4>The UPR-related prognostic signature containing four URGs exhibits high potential application value and performs well in the evaluation of effects of chemotherapy/immunotherapy and clinical prognosis.

SOX6
Also flagged:Prochlorperazinecalciummyosin heavy chainsMyHC IIBspinal cord injurypotassium-chloride co-transporter
Journal Article 2023-06-30 ✓ 3 Snippets Sharlo KA, Lvova ID, Tyganov SA, Sergeeva KV, Kalashnikov VY, Kalashnikova EP, Mirzoev TM, Kalamkarov GR, Shevchenko TF, Shenkman BS.
In-Text Gene Mentions

…the expression ofSOX6, a repressor of…

…mRNA expression ofSOX6was 20% higher…

…the content ofSOX6mRNA was lower…

Show Full Abstract

Skeletal muscle disuse leads to pathological muscle activity as well as to slow-to-fast fiber-type transformation. Fast-type fibers are more fatigable than slow-type, so this transformation leads to a decline in muscle function. Prochlorperazine injections previously were shown to attenuate autonomous rat soleus muscle electrical activity under unloading conditions. In this study, we found that prochlorperazine blocks slow-to-fast fiber-type transformation in disused skeletal muscles of rats, possibly through affecting calcium and ROS-related signaling.

Also flagged:calcium phosphatebone diseasemineralcalciumovipositionmetabolism
Journal Article 2023-06-30 No Snippets Abdul Rahman FS, Abdullah AM, Radhi A, Shahidan WNS, Abdullah JY.
Show Full Abstract

Goose bone is traditionally applied for many ailments including bone fractures. Goose bone that consists of calcium phosphate plays a major role in bone regeneration. In this study, the production of goose bone ash (GBA) was translated from a traditional process into one of a laboratory scale via thermal and mechanical methods. The GBA was thermally processed via calcination at 300 °C and 900 °C. The differences in physicochemical properties between studied GBA (SGBA) and commercial GBA (CGBA) were elucidated via Fourier transform infrared (FT-IR), X-ray fluorescence (XRF), X-ray diffraction (XRD) and electron diffraction X-Ray (EDX). The morphological properties of SGBA and CGBA were characterized using field emission scanning electron microscopy (FESEM) in which nano-sized particles were detected. The results showed that the SGBA of 300 °C had comparable physicochemical properties to those of CGBA. A high processing temperature was associated with decreasing organic compounds and increasing crystallinity. The finding from EDX suggests that sintering at 900 °C (SGBA 900) demonstrated the presence of hydroxyapatite in the mineralogical phase and had a Ca/P atomic ratio of 1.64 which is comparable to the ideal stoichiometric ratio of 1.67. Findings from this study could be used for the further exploration of GBA as a potential material for bone regeneration via the elucidation of their biological properties in the next experimental setting.

Also flagged:gene expressionbindingcancerreverse-transcriptionpolymerasepost-translational modifications
Journal Article 2023-06-30 No Snippets Piazzi M, Bavelloni A, Salucci S, Faenza I, Blalock WL.
Show Full Abstract

The advent of next generation sequencing (NGS) has fostered a shift in basic analytic strategies of a gene expression analysis in diverse pathologies for the purposes of research, pharmacology, and personalized medicine. What was once highly focused research on individual signaling pathways or pathway members has, from the time of gene expression arrays, become a global analysis of gene expression that has aided in identifying novel pathway interactions, the discovery of new therapeutic targets, and the establishment of disease-associated profiles for assessing progression, stratification, or a therapeutic response. But there are significant caveats to this analysis that do not allow for the construction of the full picture. The lack of timely updates to publicly available databases and the "hit and miss" deposition of scientific data to these databases relegate a large amount of potentially important data to "garbage", begging the question, "how much are we really missing?" This brief perspective aims to highlight some of the limitations that RNA binding/modifying proteins and RNA processing impose on our current usage of NGS technologies as relating to cancer and how not fully appreciating the limitations of current NGS technology may negatively affect therapeutic strategies in the long run.

TRIM38ZNFX1
Also flagged:Pathogenesismatrixgene expressioncytokineinterferonIFN
Journal Article 2023-06-30 ✓ 2 Snippets Velazquez-Salinas L, Medina GN, Valdez F, Zarate S, Collinson S, Zhu JJ, Rodriguez LL.
In-Text Gene Mentions

…IFIH1, RIG-I, andZNFX1[ 36 ,…

…21, TRIM26, andTRIM38) [ 46 ]…

Show Full Abstract

Vesicular stomatitis virus (VSV) is an emergent virus affecting livestock in the US. Previously, using a recombinant VSV carrying the M51R mutation in the matrix protein (rNJ0612NME6-M51R), we evaluated the pathogenesis of this virus in pigs. Our results indicated that rNJ0612NME6-M51R represented an attenuated phenotype in in-vivo and in ex-vivo in pig macrophages, resembling certain clinical features observed in field VSV isolates. In order to gain more insight into the molecular basis leading to the attenuation of rNJ0612NME6-M51R in pigs, we conducted a microarray analysis to assess the gene expression profiles of primary porcine macrophages infected with rNJ0612NME6-M51R compared to its parental virus (rNJ0612NME6). Our results showed an overall higher gene expression in macrophages infected with rNJ0612NME6-M51R. Specifically, we observed that the pathways related with immune cytokine signaling and interferon (IFN)-related responses (including activation, signaling, induction, and antiviral mechanisms) were the ones comprising most of the relevant genes identified during this study. Collectively, the results presented herein highlight the relevance of type I interferon during the pathogenesis of VSV in pigs. The information generated from this study may represent a framework for future studies intended to understand the molecular bases of the pathogenesis of field strains in livestock.

HTT
Also flagged:Autophagyphytoestrogenssteroidestradiolestrogen receptorsmenopause
Journal Article 2023-06-30 ✓ 1 Snippet Khater SI, Shalabi M, Alammash BB, Alrais AI, Al-Ahmadi D, Alqahtani LS, Khamis T, Abdelaziz S, Aldawy K.
In-Text Gene Mentions

Research studied the properties of genistein in a cellular model of HD comprising HEK-293 cells treated with a plasmid with a mutated HTT gene and found that the expression of mutated huntingtin and the quantity of aggregates were significantly reduced in the genistein-treated HD cell model.

Show Full Abstract

Phytoestrogens are non-steroid polyphenolic materials present in 300 plants. Regarding their structural similarities to estradiol, phytoestrogens attach to estrogen receptors and display anti- or pro-estrogenic activities. This review explored phytoestrogens' potential advantages and autophagy properties in light of their future application for disease management, highlighting how phytoestrogens could modulate autophagy. Research has examined the prospective benefits of phytoestrogens for the anticipation and management of various conditions, including signs of menopause, tumors, skin deterioration, osteoporosis, heart disease, neurodegenerative conditions, disorders of the immune system, and metabolic syndrome, owing to their therapeutic effects. As phytoestrogens can activate or inhibit autophagy, which has antioxidant, apoptotic, anti-mutagenic, anticancer, transcriptional, and genomic impacts on cancer and aging illnesses, phytoestrogens could influence diseases through the modulation of autophagy. The collaborative research on animal models, utilization of genetic techniques, and administration of pharmacologically active substances has indicated the possible therapeutic benefits of autophagy modulation in various illnesses. Further research is required to illustrate the pathways by which phytoestrogens modulate autophagy and the possible therapeutic effects on these diseases.

Also flagged:epithelial-mesenchymal transition factorSNAI1Ovarian cancergynecologic malignancyepithelial-mesenchymal transitioncancer
Journal Article 2023-06-30 No Snippets Suzuki T, Conant A, Curow C, Alexander A, Ioffe Y, Unternaehrer JJ.
Show Full Abstract

Ovarian cancer remains the most lethal gynecologic malignancy in the USA. For over twenty years, epithelial-mesenchymal transition (EMT) has been characterized extensively in development and disease. The dysregulation of this process in cancer has been identified as a mechanism by which epithelial tumors become more aggressive, allowing them to survive and invade distant tissues. This occurs in part due to the increased expression of the EMT transcription factor, <i>SNAI1</i> (Snail). In the case of epithelial ovarian cancer, Snail has been shown to contribute to cancer invasion, stemness, chemoresistance, and metabolic changes. Thus, in this review, we focus on summarizing current findings on the role of EMT (specifically, factors downstream of Snail) in determining ovarian cancer aggressiveness.

STAU1
Also flagged:immunosuppressioninfectionBursal DiseaseVP2Infectious bursal diseaseimmunosuppressive
Journal Article 2023-06-30 ✓ 1 Snippet Torabi S, Soleimani S, Mahravani H, Ebrahimi MM, Shahsavandi S.
In-Text Gene Mentions

STAU1

Show Full Abstract

Infectious bursal disease virus (IBDV) causes a highly contagious disease associated with immunosuppression in young chickens. Production of either egg-based or primary cell-based high-quality vaccines requires time-consuming and costly procedures. To determine a suitable cell line for IBDV replication, L929 cell line was a candidate for the growth kinetics processing of the virus. The L929 cells were proliferated in monolayer, and doubling time was calculated. Replication kinetics an IBDV isolate at the multiplicity of infection 0.1 PFU/cell were determined using virus titration. To adapt IBDV on L929 cells, seven consecutive passages were performed. Virus titer and levels of apoptosis were quantitatively analyzed at each passage. The viral <i>VP2</i> gene was amplified and sequenced in three passages. An average doubling time of 21 h was estimated for monolayers of L929 cells. Although during early passages, virus growth did not produce a clear cytopathic effect (CPE), an increase in IBDV titers was observed. Serial passages led to the evidence of marked CPEs and an increase in the virus titer in the third passage. During the fourth to seventh passages, consistent CPEs characterized by the formation of granulated and round cells were evident within 24 to 48 hours post-inoculation. The titer of the virus was increased in the third passage onwards to peak in the fourth and constant at 5.9 TCID<sub>50</sub> until the end passage. The IBDV replication in connection with DNA fragmentation and FITC, revealed the characteristic picture of apoptosis in a time-dependent manner. We found that the IBDV could easily be adapted to L929 cells, increasing virus yields by about two orders of magnitude. These results indicated that the cell line may be useful in the production of efficient virus particles.

HFE
Also flagged:behavioralsleepthyroid diseaseinfectiondepressionneurological disease
Journal Article 2023-06-30 ✓ 1 Snippet Schmidt MA, Jones JA, Mason CE.
In-Text Gene Mentions

…acid desaturase 1HFE hemochromatosishemochromatosis gene test…

Show Full Abstract

Humans operating in extreme environments often conduct their operations at the edges of the limits of human performance. Sometimes, they are required to push these limits to previously unattained levels. As a result, their margins for error in execution are much smaller than that found in the general public. These same small margins for error that impact execution may also impact risk, safety, health, and even survival. Thus, humans operating in extreme environments have a need for greater refinement in their preparation, training, fitness, and medical care. Precision medicine (PM) is uniquely suited to address the needs of those engaged in these extreme operations because of its depth of molecular analysis, derived precision countermeasures, and ability to match each individual (and his or her specific molecular phenotype) with any given operating context (environment). Herein, we present an overview of a systems approach to PM in extreme environments, which affords clinicians one method to contextualize the inputs, processes, and outputs that can form the basis of a formal practice. For the sake of brevity, this overview is focused on molecular dynamics, while providing only a brief introduction to the also important physiologic and behavioral phenotypes in PM. Moreover, rather than a full review, it highlights important concepts, while using only selected citations to illustrate those concepts. It further explores, by demonstration, the basic principles of using functionally characterized molecular networks to guide the practical application of PM in extreme environments. At its core, PM in extreme environments is about attention to incremental gains and losses in molecular network efficiency that can scale to produce notable changes in health and performance. The aim of this overview is to provide a conceptual overview of one approach to PM in extreme environments, coupled with a selected suite of practical considerations for molecular profiling and countermeasures.

bioRxiv 2023-06-30 Preprint (No Snippets API) Deforzh E, Kharel P, Karelin A, Ivanov P, Krichevsky AM.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Background</h4> The origin and genesis of highly malignant and heterogenous glioblastoma brain tumors remain unknown. We previously identified an enhancer-associated long non-coding RNA, LINC01116 (named HOXDeRNA here), that is absent in the normal brain but is commonly expressed in malignant glioma. HOXDeRNA has a unique capacity to transform human astrocytes into glioma-like cells. This work aimed to investigate molecular events underlying the genome-wide function of this lncRNA in glial cell fate and transformation. <h4>Results</h4> Using a combination of RNA-Seq, ChIRP-Seq, and ChIP-Seq, we now demonstrate that HOXDeRNA binds in trans to the promoters of genes encoding 44 glioma-specific transcription factors distributed throughout the genome and derepresses them by removing the Polycomb repressive complex 2 (PRC2). Among the activated transcription factors are the core neurodevelopmental regulators SOX2, OLIG2, POU3F2, and SALL2. This process requires an RNA quadruplex structure of HOXDeRNA that interacts with EZH2. Moreover, HOXDeRNA-induced astrocyte transformation is accompanied by the activation of multiple oncogenes such as EGFR, PDGFR, BRAF, and miR-21, and glioma-specific super-enhancers enriched for binding sites of glioma master transcription factors SOX2 and OLIG2. <h4>Conclusions</h4> Our results demonstrate that HOXDeRNA overrides PRC2 repression of glioma core regulatory circuitry with RNA quadruplex structure. These findings help reconstruct the sequence of events underlying the process of astrocyte transformation and suggest a driving role for HOXDeRNA and a unifying RNA-dependent mechanism of gliomagenesis.

SERPINC1
Also flagged:SynthesisHeparan SulfateAminoglycosidesHeparansulfatedisaccharide
Journal Article 2023-06-29 ✓ 1 Snippet Wakpal J, Pathiranage V, Walker AR, Nguyen HM.
In-Text Gene Mentions

ATIII

Show Full Abstract

Heparan sulfate (HS) contains variably repeating disaccharide units organized into high- and low-sulfated domains. This rich structural diversity enables HS to interact with many proteins and regulate key signaling pathways. Efforts to understand structure-function relationships and harness the therapeutic potential of HS are hindered by the inability to synthesize an extensive library of well-defined HS structures. We herein report a rational and expedient approach to access a library of 27 oligosaccharides from natural aminoglycosides as HS mimetics in 7-12 steps. This strategy significantly reduces the number of steps as compared to the traditional synthesis of HS oligosaccharides from monosaccharide building blocks. Combined with computational insight, we identify a new class of four trisaccharide compounds derived from the aminoglycoside tobramycin that mimic natural HS and have a strong binding to heparanase but a low affinity for off-target platelet factor-4 protein.

Also flagged:DOT1Lcell divisionhistone methyltransferaseneurogenesisEZH2PRC2
Journal Article 2023-06-29 No Snippets Appiah B, Fullio CL, Ossola C, Bertani I, Restelli E, Cheffer A, Polenghi M, Haffner C, Garcia-Miralles M, Zeis P, Treppner M, Bovio P, Schlichtholz L, Mas-Sanchez A, Zografidou L, Winter J, Binder H, Grün D, Kalebic N, Taverna E, Vogel T.
Show Full Abstract

Cortical neurogenesis depends on the balance between self-renewal and differentiation of apical progenitors (APs). Here, we study the epigenetic control of AP's division mode by focusing on the enzymatic activity of the histone methyltransferase DOT1L. Combining lineage tracing with single-cell RNA sequencing of clonally related cells, we show at the cellular level that DOT1L inhibition increases neurogenesis driven by a shift of APs from asymmetric self-renewing to symmetric neurogenic consumptive divisions. At the molecular level, DOT1L activity prevents AP differentiation by promoting transcription of metabolic genes. Mechanistically, DOT1L inhibition reduces activity of an EZH2/PRC2 pathway, converging on increased expression of asparagine synthetase (ASNS), a microcephaly associated gene. Overexpression of ASNS in APs phenocopies DOT1L inhibition, and also increases neuronal differentiation of APs. Our data suggest that DOT1L activity/PRC2 crosstalk controls AP lineage progression by regulating asparagine metabolism.

Also flagged:gilteritinibtyrosine kinaseFMS-like tyrosine kinaseFLT3acute myeloid leukemiabinding
Journal Article 2023-06-29 No Snippets Wang Z, An Y, Wang J, Lu J.
Show Full Abstract

FMS-like tyrosine kinase (FLT3) has become the legitimate molecular therapeutic target for acute myeloid leukemia therapy. Though FLT3 inhibitors have impact on disease progression, drug resistance induced by secondary point mutations is the primary mechanism and urgent to overcome. Herein, we sought to decipher the mechanism of HM43239 inhibiting the mutant F691L resistant to gilteritinib in FLT3. A series of molecular modeling studies, including molecular dynamics (MD) simulation, dynamic cross-correlation (DCC) analysis, binding free energy (MM-GBSA) and docking study were explored to elucidate the differential tolerance mechanisms of two inhibitors to the same mutant. The F691L mutation had relatively larger effect on gilteritinib than HM43239, which showed as the changed and fixed conformation, respectively. These observations rationalized that the binding affinity of gilteritinib decreased more than that of HM43239 in the F691L mutant.Communicated by Ramaswamy H. Sarma.

Also flagged:cytokineinfectionsIFN-γIL-1αTNF-αIL-6
Journal Article 2023-06-29 No Snippets Tran AT, Truong AD, Nguyen DTK, Nguyen HT, Nguyen TT, Tran HTT, Dang HV.
Show Full Abstract

Preliminary information about LSD virus isolated from the first outbreaks in Vietnam has been reported by our laboratory. In the current study, LSDV strain, LSDV/Vietnam/Langson/HL01(HL01) was further analyzed to provide a better understanding of this viral pathogen. HL01 LSDV strain was propagated at MOI 0.01 in MDBK cells and then given to cattle at dose of 10<sup>6.5</sup> TCID50/ml (2ml/animal). The production of proinflammatory (IFN-γ, IL-1α, and TNF-α) and anti-inflammatory (IL-6, IL-10, and TGF-ß1) cytokines were measured by real-time PCR, both In vitro and In vivo. The results demonstrated that HL01 strain caused the typical signs of LSD and LSDV In vitro and In vivo, respectively suggesting a virulent field LSDV strain. Additionally, different cytokine profiles were observed in these In vitro and In vivo studies. In MDBK cells, different cytokines profiles were observed in two phases: in the early phase, the expression levels of all examined cytokines were significantly increased at 6 h (p < 0.05). In the later phase, the peak levels of the cytokine secretion were recognized from 72 to 96 h, with the exception of IL-1α when compared to controls. In cattle, the expression levels of all six cytokines were significantly higher at day 7 following LSDV challenge (p < 0.05) when compared to controls, especially expression levels of TGF-β1 and IL-10. These findings suggest the important roles of these cytokines in protection against LSDV infections. Additionally, the data from diverse cytokine profiles followed by this LSDV strain challenge provides key understanding of the underlying cellular immune mechanisms in the host against LSDV infection In vitro and In vivo.

SERPINC1
Also flagged:Aurora kinase AAURKAmitochondrial ATP synthaseCancermetabolismtumors
Journal Article 2023-06-29 ✓ 1 Snippet Sharma RK, Chafik A, Bertolin G.
In-Text Gene Mentions

…20808) and rabbit anti-Cyclin C1C1 (# 68179),…

Show Full Abstract

Cancer cells often hijack metabolic pathways to obtain the energy required to sustain their proliferation. Understanding the molecular mechanisms underlying cancer cell metabolism is key to fine-tune the metabolic preference of specific tumors, and potentially offer new therapeutic strategies. Here, we show that the pharmacological inhibition of mitochondrial Complex V delays the cell cycle by arresting breast cancer cell models in the G0/G1 phase. Under these conditions, the abundance of the multifunctional protein Aurora kinase A/AURKA is specifically lowered. We then demonstrate that AURKA functionally interacts with the mitochondrial Complex V core subunits ATP5F1A and ATP5F1B. Altering the AURKA/ATP5F1A/ATP5F1B nexus is sufficient to trigger G0/G1 arrest, and this is accompanied by decreased glycolysis and mitochondrial respiration rates. Last, we discover that the roles of the AURKA/ATP5F1A/ATP5F1B nexus depend on the specific metabolic propensity of triple-negative breast cancer cell lines, where they correlate with cell fate. On one hand, the nexus induces G0/G1 arrest in cells relying on oxidative phosphorylation as the main source of energy. On the other hand, it allows to bypass cell cycle arrest and it triggers cell death in cells with a glycolytic metabolism. Altogether, we provide evidence that AURKA and mitochondrial Complex V subunits cooperate to maintain cell metabolism in breast cancer cells. Our work paves the way to novel anti-cancer therapies targeting the AURKA/ATP5F1A/ATP5F1B nexus to lower cancer cell metabolism and proliferation.

OLFM4
Also flagged:hematopoiesisgestationgranulesgelatinasesecretoryvesicles
Journal Article 2023-06-29 ✓ 1 Snippet Qu J, Jin J, Zhang M, Ng LG.
In-Text Gene Mentions

In healthy individuals, 45–65% of circulating neutrophils express CD177, and 20–25% express the glycoprotein olfactomedin 4 (OLFM4) [29–31], with the former being increased in abundance in a variety of inflammatory diseases [32–34], while the latter is associated with sepsis [35].

Show Full Abstract

Neutrophils, as the first defenders against external microbes and stimuli, are highly active and finely regulated innate immune cells. Emerging evidence has challenged the conventional dogma that neutrophils are a homogeneous population with a short lifespan that promotes tissue damage. Recent findings on neutrophil diversity and plasticity in homeostatic and disease states have centered on neutrophils in the circulation. In contrast, a comprehensive understanding of tissue-specialized neutrophils in health and disease is still lacking. This article will first discuss how multiomics advances have contributed to our understanding of neutrophil heterogeneity and diversification in resting and pathological settings. This discussion will be followed by a focus on the heterogeneity and role of neutrophils in solid organ transplantation and how neutrophils may contribute to transplant-related complications. The goal of this article is to provide an overview of the research on the involvement of neutrophils in transplantation, with the aim that this may draw attention to an underappreciated area of neutrophil research.

Also flagged:nucleotideretrotranspositionMAPTneurological diseasecanceroligonucleotide
Journal Article 2023-06-29 No Snippets Ahsan MU, Liu Q, Perdomo JE, Fang L, Wang K.
Show Full Abstract

As long-read sequencing technologies are becoming increasingly popular, a number of methods have been developed for the discovery and analysis of structural variants (SVs) from long reads. Long reads enable detection of SVs that could not be previously detected from short-read sequencing, but computational methods must adapt to the unique challenges and opportunities presented by long-read sequencing. Here, we summarize over 50 long-read-based methods for SV detection, genotyping and visualization, and discuss how new telomere-to-telomere genome assemblies and pangenome efforts can improve the accuracy and drive the development of SV callers in the future.

SUDS3
Also flagged:glucosepenicillinstreptomycinl -glutamineamino acidsAxon
Journal Article 2023-06-29 ✓ 1 Snippet Bernardini A, Mukherjee P, Scheer E, Kamenova I, Antonova S, Mendoza Sanchez PK, Yayli G, Morlet B, Timmers HTM, Tora L.
In-Text Gene Mentions

…subunit of theSAGA complexcomplex 27 —was…

Show Full Abstract

Large heteromeric multiprotein complexes play pivotal roles at every step of gene expression in eukaryotic cells. Among them, the 20-subunit basal transcription factor TFIID nucleates the RNA polymerase II preinitiation complex at gene promoters. Here, by combining systematic RNA-immunoprecipitation (RIP) experiments, single-molecule imaging, proteomics and structure-function analyses, we show that human TFIID biogenesis occurs co-translationally. We discovered that all protein heterodimerization steps happen during protein synthesis. We identify TAF1-the largest protein in the complex-as a critical factor for TFIID assembly. TAF1 acts as a flexible scaffold that drives the co-translational recruitment of TFIID submodules preassembled in the cytoplasm. Altogether, our data suggest a multistep hierarchical model for TFIID biogenesis that culminates with the co-translational assembly of the complex onto the nascent TAF1 polypeptide. We envision that this assembly strategy could be shared with other large heteromeric protein complexes.

SERPINC1
Also flagged:lipoproteincalciumsilicahydratecholesterollipid
Journal Article 2023-06-29 ✓ 1 Snippet Huang C, Zhang J, Huang J, Li H, Wen K, Bao J, Wu X, Sun R, Abudukeremu A, Wang Y, He Z, Chen Q, Huang X, Wang H, Zhang Y.
In-Text Gene Mentions

…C -I (APOC1),antithrombin-III(ANT3), PON1, alpha-2-antiplas…

Show Full Abstract

<h4>Background</h4>The previous study investigated whether the functions of small, medium, and large high density lipoprotein (S/M/L-HDL) are correlated with protein changes in mice. Herein, the proteomic and functional analyses of high density lipoprotein (HDL) subclasses were performed in humans and rats.<h4>Methods</h4>After purifying S/M/L-HDL subclasses from healthy humans (n = 6) and rats (n = 3) using fast protein liquid chromatography (FPLC) with calcium silica hydrate (CSH) resin, the proteomic analysis by mass spectrometry was conducted, as well as the capacities of cholesterol efflux and antioxidation was measured.<h4>Results</h4>Of the 120 and 106 HDL proteins identified, 85 and 68 proteins were significantly changed in concentration among the S/M/L-HDL subclasses in humans and rats, respectively. Interestingly, it was found that the relatively abundant proteins in the small HDL (S-HDL) and large HDL (L-HDL) subclasses did not overlap, both in humans and in rats. Next, by searching for the biological functions of the relatively abundant proteins in the HDL subclasses via Gene Ontology, it was displayed that the relatively abundant proteins involved in lipid metabolism and antioxidation were enriched more in the medium HDL (M-HDL) subclass than in the S/L-HDL subclasses in humans, whereas in rats, the relatively abundant proteins associated with lipid metabolism and anti-oxidation were enriched in M/L-HDL and S/M-HDL, respectively. Finally, it was confirmed that M-HDL and L-HDL had the highest cholesterol efflux capacity among the three HDL subclasses in humans and rats, respectively; moreover, M-HDL exhibited higher antioxidative capacity than S-HDL in both humans and rats.<h4>Conclusions</h4>The S-HDL and L-HDL subclasses are likely to have different proteomic components during HDL maturation, and results from the proteomics-based comparison of the HDL subclasses may explain the associated differences in function.

NEGR1
Also flagged:depressionobesitymetabolismadipocytokineslocalizationmetabolic disease
Journal Article 2023-06-29 ✓ 2 Snippets Fu X, Wang Y, Zhao F, Cui R, Xie W, Liu Q, Yang W.
In-Text Gene Mentions

brain derived neurotrophic factor; Iba-1, ionized calcium binding adapter molecule-1; GFAP, glial fibrillary acidic protein; SCFAs, short-chain fatty acids; LTP long-term potentiation, LTD, long-term depression; mPFC, medial prefrontal cortex; mTOR, mechanistic target of rapamycin; AMPK, AMP-activated protein kinase; TrkB, tyrosine kinase receptor B; PI3K, phosphatidylinositol 3-kinase; AKT, protein kinase B; MEK, MAPK/extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinases; ERK, extracellular signal-regulated kinase; CRH, corticotropin-releasing hormone; AVP, arginine vasopressin; ACTH, adrenocorticotropic hormone; NEGR1, neuronal growth regulator 1; CADM2, Cell adhesion molecule 2; PMAIP1, phorbol-12-myristate-13-acetate-induced protein 1; PARK2, E3 ubiquitin-protein ligase parkin; FTO, Fat mass and obesity-associated gene; GABA, gamma-aminobutyric acid; MC4R, melanocortin 4 receptor; dBNST, bed nucleus of the stria terminus.

In a cross-trait meta-analysis, Amare et al. identified 14 genetic loci (including NEGR1, CADM2, PMAIP1, and PARK2) linked to obesity and response to treatment with Selective serotonin reuptake inhibitors (SSRIs) [145].

Show Full Abstract

Depression and obesity are both common disorders currently affecting public health, frequently occurring simultaneously within individuals, and the relationship between these disorders is bidirectional. The association between obesity and depression is highly co-morbid and tends to significantly exacerbate metabolic and related depressive symptoms. However, the neural mechanism under the mutual control of obesity and depression is largely inscrutable. This review focuses particularly on alterations in systems that may mechanistically explain the <i>in vivo</i> homeostatic regulation of the obesity and depression link, such as immune-inflammatory activation, gut microbiota, neuroplasticity, HPA axis dysregulation as well as neuroendocrine regulators of energy metabolism including adipocytokines and lipokines. In addition, the review summarizes potential and future treatments for obesity and depression and raises several questions that need to be answered in future research. This review will provide a comprehensive description and localization of the biological connection between obesity and depression to better understand the co-morbidity of obesity and depression.

HTT
Also flagged:HuntingtinHAP40bindingbiotinluciferaseaxonal transport
Journal Article 2023-06-29 ✓ 5 Snippets Alteen MG, Deme JC, Alvarez CP, Loppnau P, Hutchinson A, Seitova A, Chandrasekaran R, Silva Ramos E, Secker C, Alqazzaz M, Wanker EE, Lea SM, Arrowsmith CH, Harding RJ.
In-Text Gene Mentions

…interaction partners andHTTknock out is…

…Interrogation ofHTTfunction is complicated…

…relationships within theHTT-HAP40 complex.…

…Summary The huntingtin (HTT) protein plays critical…

HTT

Show Full Abstract

The huntingtin (HTT) protein plays critical roles in numerous cellular pathways by functioning as a scaffold for its many interaction partners and HTT knock out is embryonic lethal. Interrogation of HTT function is complicated by the large size of this protein so we studied a suite of structure-rationalized subdomains to investigate the structure-function relationships within the HTT-HAP40 complex. Protein samples derived from the subdomain constructs were validated using biophysical methods and cryo-electron microscopy, revealing they are natively folded and can complex with validated binding partner, HAP40. Derivatized versions of these constructs enable protein-protein interaction assays in vitro, with biotin tags, and in cells, with luciferase two-hybrid assay-based tags, which we use in proof-of-principle analyses to further interrogate the HTT-HAP40 interaction. These open-source biochemical tools enable studies of fundamental HTT biochemistry and biology, will aid the discovery of macromolecular or small-molecule binding partners and help map interaction sites across this large protein.

Also flagged:ProteolysisdegradationE3 ubiquitin ligaseskinasechronic myeloid leukemiaamino acids
Journal Article 2023-06-29 No Snippets Zhang J, Ma C, Yu Y, Liu C, Fang L, Rao H.
Show Full Abstract

Proteolysis-targeting chimera (PROTAC) that specifically targets harmful proteins for destruction by hijacking the ubiquitin-proteasome system is emerging as a potent anticancer strategy. How to efficiently modulate the target degradation remains a challenging issue. In this study, we employ a single amino acid-based PROTAC, which uses the shortest degradation signal sequence as the ligand of the N-end rule E3 ubiquitin ligases to degrade the fusion protein BCR (breakpoint cluster region)-ABL (Abelson proto-oncogene), an oncogenic kinase that drives the progression of chronic myeloid leukemia. We find that the reduction level of BCR-ABL can be easily adjusted by substituting different amino acids. Furthermore, a single PEG linker is found to achieve the best proteolytic effect. Our efforts have resulted in effective degradation of BCR-ABL protein by the N-end rule pathway and efficient growth inhibition of K562 cells expressing BCR-ABL in vitro and blunted tumor growth in a K562 xenograft tumor model in vivo. The PROTAC presented has unique advantages including lower effective concentration, smaller molecular size, and modular degradation rate. Demonstrating the efficacy of the N-end rule-based PROTACs in vitro and in vivo, our study further expands the limited degradation pathways currently available for PROTACs in vivo and is easily adapted for broader applications in targeted protein degradation.

Also flagged:organizationcorneal disordersvisionphotoreceptionmitosiscell growth
Journal Article 2023-06-29 No Snippets Yam GH, Pi S, Du Y, Mehta JS.
Show Full Abstract

The limbus is a transition from the cornea to conjunctiva and sclera. In human eyes, this thin strip has a rich variation of tissue structures and composition, typifying a change from scleral irregularity and opacity to corneal regularity and transparency; a variation from richly vascularized conjunctiva and sclera to avascular cornea; the neural passage and drainage of aqueous humor. The limbal stroma is enriched with circular fibres running parallel to the corneal circumference, giving its unique role in absorbing small pressure changes to maintain corneal curvature and refractivity. It contains specific niches housing different types of stem cells for the corneal epithelium, stromal keratocytes, corneal endothelium, and trabecular meshwork. This truly reflects the important roles of the limbus in ocular physiology, and the limbal functionality is crucial for corneal health and the entire visual system. Since the anterior limbus containing epithelial structures and limbal epithelial stem cells has been extensively reviewed, this article is focused on the posterior limbus. We have discussed the structural organization and cellular components of the region beneath the limbal epithelium, the characteristics of stem cell types: namely corneal stromal stem cells, endothelial progenitors and trabecular meshwork stem cells, and recent advances leading to the emergence of potential cell therapy options to replenish their respective mature cell types and to correct defects causing corneal abnormalities. We have reviewed different clinical disorders associated with defects of the posterior limbus and summarized the available preclinical and clinical evidence about the developing topic of cell-based therapy for corneal disorders.

Also flagged:Nucleusaddictionmu opioid receptorsMORmorphineDRN
Journal Article 2023-06-29 No Snippets Welsch L, Colantonio E, Falconnier C, Champagnol-DiLiberti C, Allain F, Ben Hamida S, Darcq E, Lutz PE, Kieffer BL.
Show Full Abstract

<h4>Background</h4>Chronic opioid exposure leads to hedonic deficits and enhanced vulnerability to addiction, which are observed and even strengthen after a period of abstinence, but the underlying circuit mechanisms are poorly understood. In this study, using both molecular and behavioral approaches, we tested the hypothesis that neurons expressing mu opioid receptors (MORs) in the dorsal raphe nucleus (DRN) are involved in addiction vulnerability associated with morphine abstinence.<h4>Methods</h4>MOR-Cre mice were exposed to chronic morphine and then went through spontaneous withdrawal for 4 weeks, a well-established mouse model of morphine abstinence. We studied DRN-MOR neurons of abstinent mice using 1) viral translating ribosome affinity for transcriptome profiling, 2) fiber photometry to measure neuronal activity, and 3) an opto-intracranial self-stimulation paradigm applied to DRN-MOR neurons to assess responses related to addiction vulnerability including persistence to respond, motivation to obtain the stimulation, self-stimulation despite punishment, and cue-induced reinstatement.<h4>Results</h4>DRN-MOR neurons of abstinent animals showed a downregulation of genes involved in ion conductance and MOR-mediated signaling, as well as altered responding to acute morphine. Opto-intracranial self-stimulation data showed that abstinent animals executed more impulsive-like and persistent responses during acquisition and scored higher on addiction-like criteria.<h4>Conclusions</h4>Our data suggest that protracted abstinence to chronic morphine leads to reduced MOR function in DRN-MOR neurons and abnormal self-stimulation of these neurons. We propose that DRN-MOR neurons have partially lost their reward-facilitating properties, which in turn may lead to increased propensity to perform addiction-related behaviors.

BTN2A2DCC
Also flagged:Immune ResponseCaseous Lymphadenitispyogranulomaspathogenesisinfectiongene expression
Journal Article 2023-06-29 ✓ 2 Snippets Kyselová J, Tichý L, Sztankóová Z, Marková J, Kavanová K, Beinhauerová M, Mušková M.
In-Text Gene Mentions

…and immunoglobulin superfamilyDCCsubclass member 3…

…2, member A2,BTN2A2.…

Show Full Abstract

Caseous lymphadenitis (CL) is a chronic contagious disease that affects small ruminants and is characterized by the formation of pyogranulomas in lymph nodes and other organs. However, the pathogenesis of this disease and the response of the host genome to infection are not yet fully understood. This study aimed to investigate the whole blood transcriptome and evaluate differential gene expression during the later stages of CL in naturally infected ewes. The study included diseased, serologically positive (EP), exposed, serologically negative (EN) ewes from the same infected flock and healthy ewes (CN) from a different flock. RNA sequencing was performed using the Illumina NextSeq system, and differential gene expression was estimated using DESeq2 and Edge R approaches. The analysis identified 191 annotated differentially expressed genes (DEGs) in the EP group (102 upregulated and 89 downregulated) and 256 DEGs in the EN group (106 upregulated and 150 downregulated) compared to the CN group. Numerous immunoregulatory interactions between lymphoid and nonlymphoid cells were influenced in both EP and EN ewes. Immune DEGs were preferentially assigned to antigen presentation through the MHC complex, T lymphocyte-mediated immunity, and extracellular matrix interactions. Furthermore, the EP group showed altered regulation of cytokine and chemokine signaling and activation and recombination of B-cell receptors. Conversely, NF-kappa B signaling, apoptosis, and stress response were the main processes influenced in the EN group. In addition, statistically significant enrichment of the essential immune pathways of binding and uptake of ligands by scavenger receptors in EP and p53 signaling in the EN group was found. In conclusion, this study provides new insights into the disease course and host-pathogen interaction in naturally CL-infected sheep by investigating the blood transcriptome.

DCC
Also flagged:chondrogenesisossificationgene expressionosteosarcomacancertumor
Journal Article 2023-06-29 ✓ 1 Snippet Yang F, Wu J, Zhao M, Zheng H, Suo J, Liu X, Zheng D.
In-Text Gene Mentions

…in colorectal cancer (DCC) and uncoordinated-5 homolog…

Show Full Abstract

MicroRNAs (miRNAs) play a crucial role in maintaining the balance between the rapid growth and suppression of tumorigenesis during antler regeneration. This study investigated the role of a novel miRNA, PC-3p-2869 (miR-PC-2869), in antler growth and its therapeutic potential in human osteosarcoma and chondrosarcoma. Stem-loop RT-qPCR showed that miR-PC-2869 was expressed extensively in diverse layers of antler tissues. Overexpression of miR-PC-2869 suppressed the proliferation and migration of antler cartilage cells. Similarly, heterologous expression of miR-PC-2869 reduced the proliferation, colony formation, and migration of osteosarcoma cell line MG63 and U2OS and chondrosarcoma cell line SW1353. Moreover, 18 functional target genes of miR-PC-2869 in humans were identified based on the screening of the reporter library. Among them, 15 target genes, including CDK8, EEF1A1, and NTN1, possess conserved miR-PC-2869-binding sites between humans and red deer (<i>Cervus elaphus</i>). In line with this, miR-PC-2869 overexpression decreased the expression levels of CDK8, EEF1A1, and NTN1 in MG63, SW1353, and antler cartilage cells. As expected, the knockdown of CDK8, EEF1A1, or NTN1 inhibited the proliferation and migration of MG63, SW1353, and antler cartilage cells, demonstrating similar suppressive effects as miR-PC-2869 overexpression. Furthermore, we observed that CDK8, EEF1A1, and NTN1 mediated the regulation of c-myc and cyclin D1 by miR-PC-2869 in MG63, SW1353, and antler cartilage cells. Overall, our work uncovered the cellular functions and underlying molecular mechanism of antler-derived miR-PC-2869, highlighting its potential as a therapeutic candidate for bone cancer.

HTT
Also flagged:CREB Binding ProteinCREBLysineHistone 3CBPhistone
Journal Article 2023-06-29 ✓ 5 Snippets Arancibia-Opazo S, Contreras-Riquelme JS, Sánchez M, Cisternas-Olmedo M, Vidal RL, Martin AJM, Sáez MA.
In-Text Gene Mentions

Huntington’s disease (HD) is a disorder caused by an abnormal expansion of trinucleotide CAG repeats within the huntingtin (Htt) gene.

HD is an autosomal dominant neurodegenerative disorder caused by the expansion of the PolyQ segment equal to or greater than 36 triplet repeats in exon 1 of the Huntingtin gene (Htt), thereby producing a polyglutamine tract in the Huntingtin protein [4,5,6,7].

The expansion of 60 or more CAG segment repeats in the Htt gene results in juvenile HD, which usually develops under the age of 20 [8,11,14,15,16,17].

…within the huntingtin (Htt) gene.…

…However, mutantHttcauses depletion of…

Show Full Abstract

Huntington's disease (HD) is a disorder caused by an abnormal expansion of trinucleotide CAG repeats within the huntingtin (Htt) gene. Under normal conditions, the CREB Binding Protein interacts with CREB elements and acetylates Lysine 27 of Histone 3 to direct the expression of several genes. However, mutant Htt causes depletion of CBP, which in turn induces altered histone acetylation patterns and transcriptional deregulation. Here, we have studied a differential expression analysis and H3K27ac variation in 4- and 6-week-old R6/2 mice as a model of juvenile HD. The analysis of differential gene expression and acetylation levels were integrated into Gene Regulatory Networks revealing key regulators involved in the altered transcription cascade. Our results show changes in acetylation and gene expression levels that are related to impaired neuronal development, and key regulators clearly defined in 6-week-old mice are proposed to drive the downstream regulatory cascade in HD. Here, we describe the first approach to determine the relationship among epigenetic changes in the early stages of HD. We determined the existence of changes in pre-symptomatic stages of HD as a starting point for early onset indicators of the progression of this disease.

Also flagged:Primary familial brain calcificationPFBCmovement disordersdeficitspsychiatricmitochondrial
Journal Article 2023-06-29 No Snippets Chen SY, Ho CJ, Lu YT, Lin CH, Lan MY, Tsai MH.
Show Full Abstract

Primary familial brain calcification (PFBC), also known as Fahr's disease, is a rare inherited disorder characterized by bilateral calcification in the basal ganglia according to neuroimaging. Other brain regions, such as the thalamus, cerebellum, and subcortical white matter, can also be affected. Among the diverse clinical phenotypes, the most common manifestations are movement disorders, cognitive deficits, and psychiatric disturbances. Although patients with PFBC always exhibit brain calcification, nearly one-third of cases remain clinically asymptomatic. Due to advances in the genetics of PFBC, the diagnostic criteria of PFBC may need to be modified. Hitherto, seven genes have been associated with PFBC, including four dominant inherited genes (<i>SLC20A2</i>, <i>PDGFRB</i>, <i>PDGFB</i>, and <i>XPR1</i>) and three recessive inherited genes (<i>MYORG</i>, <i>JAM2</i>, and <i>CMPK2</i>). Nevertheless, around 50% of patients with PFBC do not have pathogenic variants in these genes, and further PFBC-associated genes are waiting to be identified. The function of currently known genes suggests that PFBC could be caused by the dysfunction of the neurovascular unit, the dysregulation of phosphate homeostasis, or mitochondrial dysfunction. An improved understanding of the underlying pathogenic mechanisms for PFBC may facilitate the development of novel therapies.

HFE
Also flagged:fulminant hepatitisabirateroneAbiraterone acetatecytochrome P450 17A1metastatic prostate cancerprostate adenocarcinoma
Journal Article 2023-06-29 ✓ 2 Snippets Akpokavie D, Gubert C, Abdelli I, Stern AO, Zender H.
In-Text Gene Mentions

…Ahemochromatosiswas possible in…

…mutation of theHFEgene was not…

Show Full Abstract

Abiraterone acetate is a steroidal inhibitor of cytochrome P450 17A1 indicated in the treatment of metastatic prostate cancer. This report examines the case of a 66-year-old patient diagnosed with prostate adenocarcinoma that had metastasized to the bones and lymph nodes. Treatment with abiraterone acetate and corticosteroid co-administration as well as LH-RH analog hormone therapy was initiated. Four and a half months later, the patient consulted for deterioration of general condition. Biologically, he developed a fulminant hepatitis of which he eventually died. An infectious or metabolic origin was ruled out. Oncological cause by either disease progression or second neoplastic process was eliminated by means of imaging. Hepatic toxicity was imputed to the treatment with abiraterone acetate. This case suggests that fulminant hepatitis on abiraterone acetate may be underestimated, and underscores the importance of regular monitoring of liver tests on this therapy.

TNFSF4
Also flagged:HLAautoimmune diseasesrheumatoid arthritisRAimmune-related diseasestumor necrosis factor superfamily member 4
Journal Article 2023-06-29 ✓ 5 Snippets Chen DP, Wen YH, Lin WT, Hsu FP, Yu KH.
In-Text Gene Mentions

A number of genes encoding proteins involved in regulating T-cell and B-cell function have been identified as rheumatoid arthritis (RA) susceptibility genes.<h4>Methods</h4>In this study, we investigated the association between RA and single-nucleotide polymorphisms (SNPs) of co-stimulatory or co-inhibitory molecules in 124 RA cases and 100 healthy controls without immune-related diseases [including tumor necrosis factor superfamily member 4 (TNFSF4), CD28, cytotoxic T-lymphocyte-associated protein 4 (CTLA4), and programmed cell death protein 1 (PDCD1)].<h4>Results</h4>The results showed that there were 13 SNPs associated with RA, including rs181758110 of TNFSF4 (CC vs. CT, <i>p</i> = 0.038); rs3181096 of CD28 (TT vs. CC + CT, <i>p</i> = 0.035; CC vs. TT, <i>p</i> = 0.047); rs11571315 (TT vs. CT, <i>p</i> = 0.045), rs733618 (CC vs. TT + CT, <i>p</i> = 0.043), rs4553808 (AA vs. AG vs. GG, <i>p</i> = 0.035), rs11571316 (GG vs. AG vs. AA, <i>p</i> = 0.048; GG vs. AG + AA, <i>p</i> = 0.026; GG vs. AG, <i>p</i> = 0.014), rs16840252 (CC vs. CT vs. TT, <i>p</i> = 0.007; CC vs. CT, <i>p</i> = 0.011), rs5742909 (CC vs. CT vs. TT, <i>p</i> = 0.040), and rs11571319 of CTLA4 (GG vs. AG vs. AA, <i>p</i> < 0.001; GG vs. AG + AA, <i>p</i> = 0.048; AA vs. GG + AG, <i>p</i> = 0.001; GG vs. AA, <i>p</i> = 0.008; GG vs. AG, <i>p</i> ≤ 0.001); and rs10204525 (TT vs. CT + CC, <i>p</i> = 0.024; TT vs. CT, <i>p</i> = 0.021), rs2227982 (AA vs. GG, <i>p</i> = 0.047), rs36084323 (TT vs. CT vs. CC, <i>p</i> = 0.022; TT vs. CT + CC, <i>p</i> = 0.013; CC vs. TT + CT, <i>p</i> = 0.048; TT vs. CC, <i>p</i> = 0.008), and rs5839828 of PDCD1 (DEL vs. DEL/G vs. GG, <i>p</i> = 0.014; DEL vs. DEL/G + GG, <i>p</i> = 0.014; GG vs. DEL + DEL/G, <i>p</i> = 0.025; DEL vs. GG, <i>p</i> = 0.007).<h4>Discussion</h4>Consequently, these SNPs may play an important role in immune regulation, and further research into the role of these SNPs of immune regulatory genes in the pathogenesis of RA is required.

…superfamily member 4 (TNFSF4), CD28, cytotoxic T-lymphocyt…

…including rs181758110 ofTNFSF4(CC vs. CT,…

…superfamily member 4 (TNFSF4and OX40L), CD28,…

…BothTNFSF4and CD28 stimulate…

Show Full Abstract

<h4>Introduction</h4>The human leukocyte antigen (HLA) has been linked to the majority of autoimmune diseases (ADs). However, non-HLA genes may be risk factors for ADs. A number of genes encoding proteins involved in regulating T-cell and B-cell function have been identified as rheumatoid arthritis (RA) susceptibility genes.<h4>Methods</h4>In this study, we investigated the association between RA and single-nucleotide polymorphisms (SNPs) of co-stimulatory or co-inhibitory molecules in 124 RA cases and 100 healthy controls without immune-related diseases [including tumor necrosis factor superfamily member 4 (TNFSF4), CD28, cytotoxic T-lymphocyte-associated protein 4 (CTLA4), and programmed cell death protein 1 (PDCD1)].<h4>Results</h4>The results showed that there were 13 SNPs associated with RA, including rs181758110 of TNFSF4 (CC vs. CT, <i>p</i> = 0.038); rs3181096 of CD28 (TT vs. CC + CT, <i>p</i> = 0.035; CC vs. TT, <i>p</i> = 0.047); rs11571315 (TT vs. CT, <i>p</i> = 0.045), rs733618 (CC vs. TT + CT, <i>p</i> = 0.043), rs4553808 (AA vs. AG vs. GG, <i>p</i> = 0.035), rs11571316 (GG vs. AG vs. AA, <i>p</i> = 0.048; GG vs. AG + AA, <i>p</i> = 0.026; GG vs. AG, <i>p</i> = 0.014), rs16840252 (CC vs. CT vs. TT, <i>p</i> = 0.007; CC vs. CT, <i>p</i> = 0.011), rs5742909 (CC vs. CT vs. TT, <i>p</i> = 0.040), and rs11571319 of CTLA4 (GG vs. AG vs. AA, <i>p</i> < 0.001; GG vs. AG + AA, <i>p</i> = 0.048; AA vs. GG + AG, <i>p</i> = 0.001; GG vs. AA, <i>p</i> = 0.008; GG vs. AG, <i>p</i> ≤ 0.001); and rs10204525 (TT vs. CT + CC, <i>p</i> = 0.024; TT vs. CT, <i>p</i> = 0.021), rs2227982 (AA vs. GG, <i>p</i> = 0.047), rs36084323 (TT vs. CT vs. CC, <i>p</i> = 0.022; TT vs. CT + CC, <i>p</i> = 0.013; CC vs. TT + CT, <i>p</i> = 0.048; TT vs. CC, <i>p</i> = 0.008), and rs5839828 of PDCD1 (DEL vs. DEL/G vs. GG, <i>p</i> = 0.014; DEL vs. DEL/G + GG, <i>p</i> = 0.014; GG vs. DEL + DEL/G, <i>p</i> = 0.025; DEL vs. GG, <i>p</i> = 0.007).<h4>Discussion</h4>Consequently, these SNPs may play an important role in immune regulation, and further research into the role of these SNPs of immune regulatory genes in the pathogenesis of RA is required.

Also flagged:infectionAIDStoHIV-1 infectioncreatininemood disorders
Journal Article 2023-06-29 No Snippets Gómez-Archila LG, Palomino-Schätzlein M, Zapata-Builes W, Rugeles MT, Galeano E.
Show Full Abstract

How the human body reacts to the exposure of HIV-1 is an important research goal. Frequently, HIV exposure leads to infection, but some individuals show natural resistance to this infection; they are known as HIV-1-exposed but seronegative (HESN). Others, although infected but without antiretroviral therapy, control HIV-1 replication and progression to AIDS; they are named controllers, maintaining low viral levels and an adequate count of CD4<sup>+</sup> T lymphocytes. Biological mechanisms explaining these phenomena are not precise. In this context, metabolomics emerges as a method to find metabolites in response to pathophysiological stimuli, which can help to establish mechanisms of natural resistance to HIV-1 infection and its progression. We conducted a cross-sectional study including 30 HESN, 14 HIV-1 progressors, 14 controllers and 30 healthy controls. Plasma samples (directly and deproteinized) were analyzed through Nuclear Magnetic Resonance (NMR) metabolomics to find biomarkers and altered metabolic pathways. The metabolic profile analysis of progressors, controllers and HESN demonstrated significant differences with healthy controls when a discriminant analysis (PLS-DA) was applied. In the discriminant models, 13 metabolites associated with HESN, 14 with progressors and 12 with controllers were identified, which presented statistically significant mean differences with healthy controls. In progressors, the metabolites were related to high energy expenditure (creatinine), mood disorders (tyrosine) and immune activation (lipoproteins), phenomena typical of the natural course of the infection. In controllers, they were related to an inflammation-modulating profile (glutamate and pyruvate) and a better adaptive immune system response (acetate) associated with resistance to progression. In the HESN group, with anti-inflammatory (lactate and phosphocholine) and virucidal (lactate) effects which constitute a protective profile in the sexual transmission of HIV. Concerning the significant metabolites of each group, we identified 24 genes involved in HIV-1 replication or virus proteins that were all altered in progressors but only partially in controllers and HESN. In summary, our results indicate that exposure to HIV-1 in HESN, as well as infection in progressors and controllers, affects the metabolism of individuals and that this affectation can be determined using NMR metabolomics.

HFE
Also flagged:Iron regulatory proteinscancerironcell proliferationtumorFerroptosis
Journal Article 2023-06-29 ✓ 2 Snippets Cardona CJ, Montgomery MR.
In-Text Gene Mentions

…Individuals withhemochromatosisare at increased…

…or poorly controlledhemochromatosis( Bradbear et…

Show Full Abstract

Cells require iron for essential functions like energy production and signaling. However, iron can also engage in free radical formation and promote cell proliferation thereby contributing to both tumor initiation and growth. Thus, the amount of iron within the body and in individual cells is tightly regulated. At the cellular level, iron homeostasis is maintained post-transcriptionally by iron regulatory proteins (IRPs). Ferroptosis is an iron-dependent form of programmed cell death with vast chemotherapeutic potential, yet while IRP-dependent targets have established roles in ferroptosis, our understanding of the contributions of IRPs themselves is still in its infancy. In this review, we present the growing circumstantial evidence suggesting that IRPs play critical roles in the adaptive response to ferroptosis and ferroptotic cell death and describe how this knowledge can be leveraged to target neoplastic iron dysregulation more effectively.

Also flagged:synthesisCyclodextrinswateracidificationazobenzenecyclodextrin glucanotransferase
Journal Article 2023-06-29 No Snippets Sørensen J, Hansen EL, Larsen D, Elmquist MA, Buchleithner A, Florean L, Beeren SR.
Show Full Abstract

Cyclodextrins (CDs) are important molecular hosts for hydrophobic guests in water and extensively employed in the pharmaceutical, food and cosmetic industries to encapsulate drugs, flavours and aromas. Compared with α- and β-CD, the wide-scale use of γ-CD is currently limited due to costly production processes. We show how the yield of γ-CD in the enzymatic synthesis of CDs can be increased 5-fold by adding a tetra-<i>ortho</i>-isopropoxy-substituted azobenzene template irradiated at 625 nm (to obtain the <i>cis</i>-(<i>Z</i>)-isomer) to direct the synthesis. Following the enzymatic reaction, the template can then be readily recovered from the product mixture for use in subsequent reaction cycles. Heating induces thermal <i>cis</i>-(<i>Z</i>) to <i>trans</i>-(<i>E</i>) relaxation and consequent dissociation from γ-CD whereupon the template can then be precipitated by acidification. For this study we designed and synthesised a set of three water-soluble azobenzene templates with different <i>ortho</i>-substituents and characterised their photoswitching behaviour using UV/vis and NMR spectroscopy. The templates were tested in cyclodextrin glucanotransferase-mediated dynamic combinatorial libraries (DCLs) of cyclodextrins while irradiating at different wavelengths to control the <i>cis</i>/<i>trans</i> ratios. To rationalise the behaviour of the DCLs, NMR titrations were carried out to investigate the binding interactions between α-, β- and γ-CD and the <i>cis</i> and <i>trans</i> isomers of each template.

CA10
Also flagged:immune responsecircadian rhythmmetabolismacidificationacclimationcarbon dioxide
Journal Article 2023-06-29 ✓ 1 Snippet Suresh S, Mirasole A, Ravasi T, Vizzini S, Schunter C.
In-Text Gene Mentions

…anhydrase 10 (CA10), which play…

Show Full Abstract

Ocean acidification (OA) is known to affect the physiology, survival, behaviour and fitness of various fish species with repercussions at the population, community and ecosystem levels. Some fish species, however, seem to acclimate rapidly to OA conditions and even thrive in acidified environments. The molecular mechanisms that enable species to successfully inhabit high CO<sub>2</sub> environments have not been fully elucidated especially in wild fish populations. Here, we used the natural CO<sub>2</sub> seep in Vulcano Island, Italy to study the effects of elevated CO<sub>2</sub> exposure on the brain transcriptome of the anemone goby, a species with high population density in the CO<sub>2</sub> seep and investigate their potential for acclimation. Compared to fish from environments with ambient CO<sub>2</sub>, gobies living in the CO<sub>2</sub> seep showed differences in the expression of transcripts involved in ion transport and pH homeostasis, cellular stress, immune response, circadian rhythm and metabolism. We also found evidence of potential adaptive mechanisms to restore the functioning of GABAergic pathways, whose activity can be affected by exposure to elevated CO<sub>2</sub> levels. Our findings indicate that gobies living in the CO<sub>2</sub> seep may be capable of mitigating CO<sub>2</sub>-induced oxidative stress and maintaining physiological pH while meeting the consequent increased energetic costs. The conspicuous difference in the expression of core circadian rhythm transcripts could provide an adaptive advantage by increasing the flexibility of physiological processes in elevated CO<sub>2</sub> conditions thereby facilitating acclimation. Our results show potential molecular processes of acclimation to elevated CO<sub>2</sub> in gobies enabling them to thrive in the acidified waters of Vulcano Island.

Also flagged:osteoporosisoxygentitaniumbone remodelingmetabolismsuperoxide
Journal Article 2023-06-29 No Snippets Vishnu J, Kesavan P, Shankar B, Dembińska K, Swiontek Brzezinska M, Kaczmarek-Szczepańska B.
Show Full Abstract

Prolonged inflammation induced by orthopedic metallic implants can critically affect the success rates, which can even lead to aseptic loosening and consequent implant failure. In the case of adverse clinical conditions involving osteoporosis, orthopedic trauma and implant corrosion-wear in peri-implant region, the reactive oxygen species (ROS) activity is enhanced which leads to increased oxidative stress. Metallic implant materials (such as titanium and its alloys) can induce increased amount of ROS, thereby critically influencing the healing process. This will consequently affect the bone remodeling process and increase healing time. The current review explores the ROS generation aspects associated with Ti-based metallic biomaterials and the various surface modification strategies developed specifically to improve antioxidant aspects of Ti surfaces. The initial part of this review explores the ROS generation associated with Ti implant materials and the associated ROS metabolism resulting in the formation of superoxide anion, hydroxyl radical and hydrogen peroxide radicals. This is followed by a comprehensive overview of various organic and inorganic coatings/materials for effective antioxidant surfaces and outlook in this research direction. Overall, this review highlights the critical need to consider the aspects of ROS generation as well as oxidative stress while designing an implant material and its effective surface engineering.

DCC
Also flagged:COVID-19deathanxietymetalsaluminum-19
Journal Article 2023-06-29 ✓ 1 Snippet Kumar S, Jain R, Narain, Balli F, Billah M.
In-Text Gene Mentions

DCC-GARCH t-Copula…

Show Full Abstract

No abstract available.

Also flagged:FerroptosisCancerdeathautophagynecroptosispyroptosis
Journal Article 2023-06-28 No Snippets Consoli V, Fallica AN, Sorrenti V, Pittalà V, Vanella L.
Show Full Abstract

<b><i>Significance:</i></b> The multifactorial nature of the mechanisms implicated in cancer development still represents a major issue for the success of established antitumor therapies. The discovery of ferroptosis, a novel form of programmed cell death distinct from apoptosis, along with the identification of the molecular pathways activated during its execution, has led to the uncovering of novel molecules characterized by ferroptosis-inducing properties. <b><i>Recent advances:</i></b> As of today, the ferroptosis-inducing properties of compounds derived from natural sources have been investigated and interesting findings have been reported both <i>in vitro</i> and <i>in vivo</i>. <b><i>Critical Issues:</i></b> Despite the efforts made so far, only a limited number of synthetic compounds have been identified as ferroptosis inducers, and their utilization is still limited to basic research. In this review, we analyzed the most important biochemical pathways involved in ferroptosis execution, with particular attention to the newest literature findings on canonical and non-canonical hallmarks, together with mechanisms of action of natural compounds identified as novel ferroptosis inducers. Compounds have been classified based on their chemical structure, and modulation of ferroptosis-related biochemical pathways has been reported. <b><i>Future Directions:</i></b> The outcomes herein collected represent a fascinating starting point from which to take hints for future drug discovery studies aimed at identifying ferroptosis-inducing natural compounds for anticancer therapies. <i>Antioxid. Redox Signal.</i> 40, 40-85.

Also flagged:Infectionsystemic infectionpathogenesisantibodiesmeaslesantibody
Journal Article 2023-06-28 No Snippets Laksono BM, Roelofs D, Comvalius AD, Schmitz KS, Rijsbergen LC, Geers D, Nambulli S, van Run P, Duprex WP, van den Brand JMA, de Vries RD, de Swart RL.
Show Full Abstract

Canine distemper virus (CDV) causes systemic infection resulting in severe and often fatal disease in a large spectrum of animal host species. The virus is closely related to measles virus and targets myeloid, lymphoid, and epithelial cells, but CDV is more virulent and the infection spreads more rapidly within the infected host. Here, we aimed to study the pathogenesis of wild-type CDV infection by experimentally inoculating ferrets with recombinant CDV (rCDV) based on an isolate directly obtained from a naturally infected raccoon. The recombinant virus was engineered to express a fluorescent reporter protein, facilitating assessment of viral tropism and virulence. In ferrets, this wild type-based rCDV infected myeloid, lymphoid, and epithelial cells, and the infection resulted in systemic dissemination to multiple tissues and organs, especially those of the lymphatic system. High infection percentages in immune cells resulted in depletion of these cells both from circulation and from lymphoid tissues. The majority of CDV-infected ferrets reached their humane endpoints within 20 d and had to be euthanized. In that period, the virus also reached the central nervous system in several ferrets, but we did not observe the development of neurological complications during the study period of 23 d. Two out of 14 ferrets survived CDV infection and developed neutralizing antibodies. We show for the first time the pathogenesis of a non-adapted wild type-based rCDV in ferrets. IMPORTANCE Infection of ferrets with recombinant canine distemper virus (rCDV) expressing a fluorescent reporter protein has been used as proxy to understand measles pathogenesis and immune suppression in humans. CDV and measles virus use the same cellular receptors, but CDV is more virulent, and infection is often associated with neurological complications. rCDV strains in current use have complicated passage histories, which may have affected their pathogenesis. Here, we studied the pathogenesis of the first wild type-based rCDV in ferrets. We used macroscopic fluorescence to identify infected cells and tissues; multicolor flow cytometry to determine viral tropism in immune cells; and histopathology and immunohistochemistry to characterize infected cells and lesions in tissues. We conclude that CDV often overwhelmed the immune system, resulting in viral dissemination to multiple tissues in the absence of a detectable neutralizing antibody response. This virus is a promising tool to study the pathogenesis of morbillivirus infections.

SERPINC1
Also flagged:gestationCOVID-19 pneumoniaacute respiratory distress syndromeARDSmembraneCOVID-19
Journal Article 2023-06-28 ✓ 1 Snippet Lee Y, Nassar K, Parikh A.
In-Text Gene Mentions

…platelet, stat functionATIII, fibrinogen, and d-dimer…

Show Full Abstract

A 35-year-old unvaccinated woman, pregnant with twins at 22 weeks and 5 days of gestation presented with worsening hypoxia, due to COVID-19 pneumonia (PNA) with acute respiratory distress syndrome (ARDS). The patient was placed on V-V ECMO (veno-venous extracorporeal membrane oxygenation) and delivered twin babies by cesarean section (C-section) at 23 weeks and 5 days of gestation. The patient was successfully weaned off ECMO 42 days after initiation, and the twins were also extubated in NICU.

TNFSF4
Also flagged:Narcolepsy type Imethylationgene expressionNarcolepsy type 1HLAHLA class II
Journal Article 2023-06-28 ✓ 1 Snippet Yoshida-Tanaka K, Shimada M, Honda Y, Fujimoto A, Tokunaga K, Honda M, Miyagawa T.
In-Text Gene Mentions

…une-related factors, includingTNFSF4, CTSH ,…

Show Full Abstract

Narcolepsy type 1 (NT1) is caused by a loss of hypothalamic orexin-producing cells, and autoreactive CD4<sup>+</sup> and CD8<sup>+</sup> T cells have been suggested to play a role in the autoimmune mechanism. Although NT1 showed a strong association with human leukocyte antigen (HLA)-DQB1*06:02, the responsible antigens remain unidentified. We analyzed array-based DNA methylation and gene expression data for the HLA region in CD4<sup>+</sup> and CD8<sup>+</sup> T cells that were separated from the peripheral blood mononuclear cells of Japanese subjects (NT1, N = 42; control, N = 42). As the large number of SNPs in the HLA region might interfere with the affinity of the array probes, we conducted a comprehensive assessment of the reliability of each probe. The criteria were based on a previous study reporting that the presence of frequent SNPs, especially on the 3' side of the probe, makes the probe unreliable. We confirmed that 90.3% of the probes after general filtering in the HLA region do not include frequent SNPs, and are thus suitable for analysis, particularly in Japanese subjects. We then performed an association analysis, and found that several CpG sites in the HLA class II region of the patients were significantly hypomethylated in CD4<sup>+</sup> and CD8<sup>+</sup> T cells. This association was not detected when the effect of HLA-DQB1*06:02 was considered, suggesting that the hypomethylation was possibly derived from HLA-DQB1*06:02. Further RNA sequencing revealed reduced expression levels of HLA-DQB1 alleles other than HLA-DQB1*06:02 in the patients with NT1. Our results suggest the involvement of epigenetic and expressional changes in HLA-DQB1 in the pathogenesis of NT1.

BTN3A3
Also flagged:nucleoproteinNP
Journal Article 2023-06-28 ✓ 5 Snippets Pinto RM, Bakshi S, Lytras S, Zakaria MK, Swingler S, Worrell JC, Herder V, Hargrave KE, Varjak M, Cameron-Ruiz N, Collados Rodriguez M, Varela M, Wickenhagen A, Loney C, Pei Y, Hughes J, Valette E, Turnbull ML, Furnon W, Gu Q, Orr L, Taggart A, Diebold O, Davis C, Boutell C, Grey F, Hutchinson E, Digard P, Monne I, Wootton SK, MacLeod MKL, Wilson SJ, Palmarini M.
In-Text Gene Mentions

BTN3A3evasion promotes the…

…we identified humanBTN3A3(butyrophilin subfamily 3…

…identified human BTN3A3 (butyrophilin subfamily 3 member A3subfamily 3 member…

…We determined thatBTN3A3is expressed in…

…We show thatBTN3A3restriction acts primarily…

Show Full Abstract

Spillover events of avian influenza A viruses (IAVs) to humans could represent the first step in a future pandemic<sup>1</sup>. Several factors that limit the transmission and replication of avian IAVs in mammals have been identified. There are several gaps in our understanding to predict which virus lineages are more likely to cross the species barrier and cause disease in humans<sup>1</sup>. Here, we identified human BTN3A3 (butyrophilin subfamily 3 member A3)<sup>2</sup> as a potent inhibitor of avian IAVs but not human IAVs. We determined that BTN3A3 is expressed in human airways and its antiviral activity evolved in primates. We show that BTN3A3 restriction acts primarily at the early stages of the virus life cycle by inhibiting avian IAV RNA replication. We identified residue 313 in the viral nucleoprotein (NP) as the genetic determinant of BTN3A3 sensitivity (313F or, rarely, 313L in avian viruses) or evasion (313Y or 313V in human viruses). However, avian IAV serotypes, such as H7 and H9, that spilled over into humans also evade BTN3A3 restriction. In these cases, BTN3A3 evasion is due to substitutions (N, H or Q) in NP residue 52 that is adjacent to residue 313 in the NP structure<sup>3</sup>. Thus, sensitivity or resistance to BTN3A3 is another factor to consider in the risk assessment of the zoonotic potential of avian influenza viruses.

Also flagged:chromatinCTCFcohesindegradationsister chromatidSMC1
Journal Article 2023-06-28 No Snippets Sun Y, Xu X, Zhao W, Zhang Y, Chen K, Li Y, Wang X, Zhang M, Xue B, Yu W, Hou Y, Wang C, Xie W, Li C, Kong D, Wang S, Sun Y.
Show Full Abstract

<h4>Background</h4>The ring-shaped cohesin complex is an important factor for the formation of chromatin loops and topologically associating domains (TADs) by loop extrusion. However, the regulation of association between cohesin and chromatin is poorly understood. In this study, we use super-resolution imaging to reveal the unique role of cohesin subunit RAD21 in cohesin loading and chromatin structure regulation.<h4>Results</h4>We directly visualize that up-regulation of RAD21 leads to excessive chromatin loop extrusion into a vermicelli-like morphology with RAD21 clustered into foci and excessively loaded cohesin bow-tying a TAD to form a beads-on-a-string-type pattern. In contrast, up-regulation of the other four cohesin subunits results in even distributions. Mechanistically, we identify that the essential role of RAD21 is attributed to the RAD21-loader interaction, which facilitates the cohesin loading process rather than increasing the abundance of cohesin complex upon up-regulation of RAD21. Furthermore, Hi-C and genomic analysis reveal how RAD21 up-regulation affects genome-wide higher-order chromatin structure. Accumulated contacts are shown at TAD corners while inter-TAD interactions increase after vermicelli formation. Importantly, we find that in breast cancer cells, the expression of RAD21 is aberrantly high with poor patient survival and RAD21 forms beads in the nucleus. Up-regulated RAD21 in HeLa cells leads to compartment switching and up-regulation of cancer-related genes.<h4>Conclusions</h4>Our results provide key insights into the molecular mechanism by which RAD21 facilitates the cohesin loading process and provide an explanation to how cohesin and loader work cooperatively to promote chromatin extrusion, which has important implications in construction of three-dimensional genome organization.

FBXL4
Also flagged:cognitionsleepagingbehavioralmetabolic disorderscalcium
Journal Article 2023-06-28 ✓ 1 Snippet Tabuchi M.
In-Text Gene Mentions

Fbxl4

Show Full Abstract

How do neurons encode the information that underlies cognition, internal states, and behavior? This review focuses on the neural circuit mechanisms underlying sleep in Drosophila and, to illustrate the power of addressing neural coding in this system, highlights a specific circuit mediating the circadian regulation of sleep quality. This circuit exhibits circadian cycling of sleep quality, which depends solely on the pattern (not the rate) of spiking. During the night, the stability of spike waveforms enhances the reliability of spike timing in these neurons to promote sleep quality. During the day, instability of the spike waveforms leads to uncertainty of spike timing, which remarkably produces synaptic plasticity to induce arousal. Investigation of the molecular and biophysical basis of these changes was greatly facilitated by its study in Drosophila, revealing direct connections between genes, molecules, spike biophysical properties, neural codes, synaptic plasticity, and behavior. Furthermore, because these patterns of neural activity change with aging, this model system holds promise for understanding the interplay between the circadian clock, aging, and sleep quality. It is proposed here that neurophysiological investigations of the Drosophila brain present an exceptional opportunity to tackle some of the most challenging questions related to neural coding.

MRPL39
Also flagged:Extracellular TrapsExtracellulartumorcancerchronic kidney diseaseTraps
Journal Article 2023-06-28 ✓ 2 Snippets Munsch G, Proust C, Labrouche-Colomer S, Aïssi D, Boland A, Morange PE, Roche A, de Chaisemartin L, Harroche A, Olaso R, Deleuze JF, James C, Emmerich J, Smadja DM, Jacqmin-Gadda H, Trégouët DA.
In-Text Gene Mentions

This genetic variant is in moderate linkage disequilibrium (pairwise D’ > 0.50) with several other nearby variants located in MRPL39, GABPA and APP, the latter having also been reported to be involved in NETs formation (51).

…variants located inMRPL39, GABPA and…

Show Full Abstract

Over the last years, there has been a considerable expansion of genome-wide association studies (GWAS) for discovering biological pathways underlying pathological conditions or disease biomarkers. These GWAS are often limited to binary or quantitative traits analyzed through linear or logistic models, respectively. In some situations, the distribution of the outcome may require more complex modeling, such as when the outcome exhibits a semicontinuous distribution characterized by an excess of zero values followed by a non-negative and right-skewed distribution. We here investigate three different modeling for semicontinuous data: Tobit, Negative Binomial and Compound Poisson-Gamma. Using both simulated data and a real GWAS on Neutrophil Extracellular Traps (NETs), an emerging biomarker in immuno-thrombosis, we demonstrate that Compound Poisson-Gamma was the most robust model with respect to low allele frequencies and outliers. This model further identified the MIR155HG locus as significantly (<i>P</i> = 1.4 × 10<sup>-8</sup>) associated with NETs plasma levels in a sample of 657 participants, a locus recently highlighted to be involved in NETs formation in mice. This work highlights the importance of the modeling strategy for GWAS of a semicontinuous outcome and suggests Compound Poisson-Gamma as an elegant but neglected alternative to Negative Binomial for modeling semicontinuous outcome in the context of genomic investigations.

HFE
Also flagged:Acute Hepatitis E InfectioninfectionHEV infectionzoonotic infectionAcutechronic hepatitis
Journal Article 2023-06-28 ✓ 1 Snippet Akpoigbe K, Culpepper-Morgan J, Akpoigbe O, Santogade P.
In-Text Gene Mentions

…antimitochondria antibody, andhemochromatosis, which were all…

Show Full Abstract

Acute hepatitis E virus (HEV) infection in the United States of America (U.S.A) is low. However, seroprevalence rate is about of 6%. Most cases of HEV infection have been reported from travelers from endemic countries with poor sanitary conditions. Evidence of HEV as a zoonotic infection has been reported from developed countries from swine and wild animals including boar and deer. There is no reported case of direct transmission from wild game to humans in the U.S.A. We report a case of HEV from butchering of deer meat.

DCC
Also flagged:cancertumorssolid tumorstumor
Journal Article 2023-06-28 ✓ 1 Snippet Fotinós J, Barberis L, Condat CA.
In-Text Gene Mentions

…evolving CSC andDCCpopulations.…

Show Full Abstract

The growth of many solid tumors has been found to be driven by chemo- and radiotherapy-resistant cancer stem cells (CSCs). A suitable therapeutic avenue in these cases may involve the use of a differentiating agent (DA) to force the differentiation of the CSCs and of conventional therapies to eliminate the remaining differentiated cancer cells (DCCs). To describe the effects of a DA that reprograms CSCs into DCCs, we adapt a differential equation model developed to investigate tumorspheres, which are assumed to consist of jointly evolving CSC and DCC populations. We analyze the mathematical properties of the model, finding the equilibria and their stability. We also present numerical solutions and phase diagrams to describe the system evolution and the therapy effects, denoting the DA strength by a parameter a<sub>dif</sub>. To obtain realistic predictions, we choose the other model parameters to be those determined previously from fits to various experimental datasets. These datasets characterize the progression of the tumor under various culture conditions. Typically, for small values of a<sub>dif</sub> the tumor evolves towards a final state that contains a CSC fraction, but a strong therapy leads to the suppression of this phenotype. Nonetheless, different external conditions lead to very diverse behaviors. For microchamber-grown tumorspheres, there is a threshold in therapy strength below which both subpopulations survive, while high values of a<sub>dif</sub> lead to the complete elimination of the CSC phenotype. For tumorspheres grown on hard and soft agar and in the presence of growth factors, the model predicts a threshold not only in the therapy strength, but also in its starting time, an early beginning being potentially crucial. In summary, our model shows how the effects of a DA depend critically not only on the dosage and timing of the drug application, but also on the tumor nature and its environment.

PRDX6
Also flagged:Ferrostatin-1subarachnoid hemorrhagephospholipase A2neurological disorderFerroptosisPeroxiredoxin6
Journal Article 2023-06-28 ✓ 5 Snippets Wang H, Zhou Y, Zhao M, Yu L, Lin Y, Kang D.
In-Text Gene Mentions

Fer-1 treatment reduces PRDX6 decline and lipid peroxidation in brain tissue after SAH.

SAH grading scores (a), Evan’s blue leakage experiment (b), and brain water content in the left hemisphere (c) were evaluated as previously after administration with si-PRDX6.

The induction of SAH reduced the expression of PRDX6, which could be alleviated by Fer-1.

Regarding distinguishing effects of Fer-1 on MDA accumulation and GSH deletion in SAH, we further investigated whether iPlA2 activity of PRDX6 mediated Fer-1 therapeutic efficacy in SAH.

All the above evidences suggest that PRDX6 may participate in the ferroptosis process of SAH.

Show Full Abstract

Subarachnoid hemorrhage (SAH) is an acute catastrophic neurological disorder with high morbidity and mortality. Ferroptosis is one of the pathophysiological processes during secondary brain injury of SAH, which could be inhibited by ferrostatin-1 (Fer-1) effectively. Peroxiredoxin6 (PRDX6) is an antioxidant protein and is currently proven to be associated with lipid peroxidation in ferroptosis except in GSH/GPX4 and FSP1/CoQ10 antioxidant systems. However, the alteration and function of PRDX6 in SAH are still unknown. In addition, whether PRDX6 is involved in the neuroprotection of Fer-1 in SAH is yet to be investigated. Endovascular perforation was employed to induce the SAH model. Fer-1 and in vivo siRNA aiming to knockdown PRDX6 were administrated intracerebroventricularly to investigate relevant regulation and mechanism. We confirmed the inhibition of ferroptosis and neuroprotection from brain injury by Fer-1 in SAH. The induction of SAH reduced the expression of PRDX6, which could be alleviated by Fer-1. Accordingly, dysregulated lipid peroxidation indicated by GSH and MDA was improved by Fer-1, which was counteracted by si-PRDX6. Similarly, the neuroprotection of Fer-1 in SAH was diminished by the knockdown of PRDX6 and the administration of a calcium-independent phospholipase A2 (iPLA2) inhibitor. PRDX6 is involved in ferroptosis induced by SAH and is associated with Fer-1 neuroprotection from brain injury via its iPLA2 activity.

Also flagged:translationalgenetic disorderschaperoneantibodiesoligonucleotidesgenetic diseases
Journal Article 2023-06-28 No Snippets Yoo HW.
Show Full Abstract

Most rare diseases (orphan diseases) still lack approved treatment options despite major advances in research providing the necessary tools to understand their molecular basis and legislation providing regulatory and economic incentives to expedite the development of specific therapies. Addressing this translational gap is a multifaceted challenge, a key aspect of which is the selection of an optimal therapeutic modality to translate advances in rare disease knowledge to potential medicines known as orphan drugs. There are several strategies for developing orphan drugs for rare genetic disorders, including protein replacement therapies, small-molecule therapies (e.g., substrate reduction, chemical chaperone, cofactor, expression modification, and read-through therapies), monoclonal antibodies, antisense oligonucleotides, small interfering RNA or exon skipping therapies, gene replacement and direct genome-editing therapies, mRNA therapy, cell therapy, and drug repurposing. Each strategy has its own strengths and limitations in orphan drug development. Furthermore, numerous hurdles are present in clinical trials of rare genetic diseases because of difficulty with patient recruitment, unknown molecular physiology, the natural history of the disease, ethical concerns regarding pediatric patients, and regulatory challenges. To address these barriers, the rare genetic diseases community, including academic institutions, industry, patient advocacy groups, foundations, payers, and government regulatory and research organizations, must become engaged in discussions about these issues.

Also flagged:MethylthiosulfonateCysteineAQPwaterthiolalkyl
Journal Article 2023-06-28 No Snippets Jeuken K, Jaeger E, Matthews E, Beitz E.
Show Full Abstract

(1) Background: Several members of the ubiquitous aquaporin family, AQP, of water and neutral solute channels carry a cysteine residue in the selectivity filter region. Traditionally, toxic mercury-containing compounds are used to bind to the cysteine as covalent AQP inhibitors for physiological studies or analysis of structure-function relationships. (2) Methods: We tested thiol-reactive methylthiosulfonate reagents, MTS, as alternative Cys modifiers for AQP inhibition. Three MTS reagents transferring S-alkyl moieties of increasing size, i.e., S-methyl, S-<i>n</i>-propyl, and S-benzyl, were used with yeast-expressed water-selective AQP1 and the aquaglyceroporin AQP9. Respective Cys-to-Ala variants and mouse erythrocytes that naturally express AQP1 and AQP9 served as controls. (3) Results: Both wildtype AQP isoforms were inhibited by the Cys modifiers in a size-dependent manner, whereas the Cys-to-Ala-variants exhibited resistance. Sub-millimolar concentrations and incubation times in the minute range were sufficient. The modifications were reversible by treatment with the thiol reagents acetylcysteine, ACC, and dithiothreitol, DTT. (4) Conclusions: MTS reagents represent a valid alternative of low toxicity for the inhibition of mercurial-sensitive AQPs.

HFE
Also flagged:Intrahepatic CholangiocarcinomaiCCAliver cancerhepatocellular carcinomaliver neoplasmstumor
Journal Article 2023-06-28 ✓ 1 Snippet Cerrito L, Ainora ME, Borriello R, Piccirilli G, Garcovich M, Riccardi L, Pompili M, Gasbarrini A, Zocco MA.
In-Text Gene Mentions

…or C), cirrhosis,hemochromatosis, or non-alcoholic fatty…

Show Full Abstract

Intrahepatic cholangiocarcinoma (iCCA) represents the second most common liver cancer after hepatocellular carcinoma, accounting for 15% of primary liver neoplasms. Its incidence and mortality rate have been rising during the last years, and total new cases are expected to increase up to 10-fold during the next two or three decades. Considering iCCA's poor prognosis and rapid spread, early diagnosis is still a crucial issue and can be very challenging due to the heterogeneity of tumor presentation at imaging exams and the need to assess a correct differential diagnosis with other liver lesions. Abdominal contrast-enhanced computed tomography (CT) and magnetic resonance imaging (MRI) plays an irreplaceable role in the evaluation of liver masses. iCCA's most typical imaging patterns are well-described, but atypical features are not uncommon at both CT and MRI; on the other hand, contrast-enhanced ultrasound (CEUS) has shown a great diagnostic value, with the interesting advantage of lower costs and no renal toxicity, but there is still no agreement regarding the most accurate contrastographic patterns for iCCA detection. Besides diagnostic accuracy, all these imaging techniques play a pivotal role in the choice of the therapeutic approach and eligibility for surgery, and there is an increasing interest in the specific imaging features which can predict tumor behavior or histologic subtypes. Further prognostic information may also be provided by the extraction of quantitative data through radiomic analysis, creating prognostic multi-parametric models, including clinical and serological parameters. In this review, we aim to summarize the role of contrast-enhanced imaging in the diagnosis and management of iCCA, from the actual issues in the differential diagnosis of liver masses to the newest prognostic implications.

SERPINC1
Also flagged:HMGA2Thyroid cancerendocrine malignant tumortumorpapillary thyroid carcinomathyroid
Journal Article 2023-06-28 ✓ 1 Snippet Van Branteghem C, Augenlicht A, Demetter P, Craciun L, Maenhaut C.
In-Text Gene Mentions

…EMT-related genes likeForkhead Box C1Box C1 (FOXC1),…

Show Full Abstract

Thyroid cancer is the most common endocrine malignant tumor with an increasing incidence rate. Although differentiated types of thyroid cancer generally present good clinical outcomes, some dedifferentiate into aggressive and lethal forms. However, the molecular mechanisms governing aggressiveness and dedifferentiation are still poorly understood. Aberrant expression of miRNAs is often correlated to tumor development, and miR-204-5p has previously been identified in papillary thyroid carcinoma as downregulated and associated with aggressiveness. This study aimed to explore its role in thyroid tumorigenesis. To address this, gain-of-function experiments were performed by transiently transfecting miR-204-5p in thyroid cancer cell lines. Then, the clinical relevance of our data was evaluated in vivo. We prove that this miRNA inhibits cell invasion by regulating several targets associated with an epithelial-mesenchymal transition, such as SNAI2, TGFBR2, SOX4 and HMGA2. HMGA2 expression is regulated by the MAPK pathway but not by the PI3K, IGF1R or TGFβ pathways, and the inhibition of cell invasion by miR-204-5p involves direct binding and repression of HMGA2. Finally, we confirmed in vivo the relationship between miR-204-5p and HMGA2 in human PTC and a corresponding mouse model. Our data suggest that HMGA2 inhibition offers promising perspectives for thyroid cancer treatment.

SERPINC1
Also flagged:hemophilia BF9gene expressionCRISPRCas9disease of
Journal Article 2023-06-28 ✓ 2 Snippets Soroka AB, Feoktistova SG, Mityaeva ON, Volchkov PY.
In-Text Gene Mentions

Fitusiran is a double-stranded small interfering RNA, with one strand binding a 23 nt region in the SERPINC1 gene after insertion into the RISC complex.

…region in theSERPINC1gene after insertion…

Show Full Abstract

In contrast to the standard enzyme-replacement therapy, administered from once per 7-14 days to 2-3 times a week in patients with severe hemophilia B, as a result of a single injection, gene therapy can restore F9 gene expression and maintain it for a prolonged time. In clinical research, the approach of delivering a functional copy of a gene using adeno-associated viral (AAV) vectors is widely used. The scientific community is actively researching possible modifications to improve delivery efficiency and expression. In preclinical studies, the possibility of genome editing using CRISPR/Cas9 technology for the treatment of hemophilia B is also being actively studied.

HFE
Also flagged:Hepcidinsickle cell diseaseirontransferrin receptordegradationintercellular adhesion molecule 1
Journal Article 2023-06-28 ✓ 1 Snippet Ahmad A, Kumari N, Afangbedji N, Nekhai S, Jerebtsova M.
In-Text Gene Mentions

…remains unaltered inhemochromatosismice [ 32…

Show Full Abstract

In patients with sickle cell disease (SCD), chronic hemolysis and frequent blood transfusions cause iron overload and accumulation in the kidneys. The iron deposition is found in the renal cortex and correlates with the severity of hemolysis. In this study, we observed a significant accumulation of iron in the renal cortex of a mouse model of SCD, and assessed the expression of the proteins involved in maintaining renal iron homeostasis. Despite the intracellular iron accumulation, the levels of the transferrin receptor in the kidneys were increased, but the levels of the iron exporter ferroportin were not altered in SCD mice. Ferroportin is regulated by hepcidin, which binds to it and promotes its degradation. We found reduced serum hepcidin levels but increased renal hepcidin production in SCD mice. Furthermore, we observed significant macrophage infiltration and increased expression of intercellular adhesion molecule 1 in the endothelial cells of the kidneys in SCD mice. These observations correlated with elevated levels of proinflammatory cytokines IL-1β and IL-6, which can potentially stimulate hepcidin expression. Taken together, our results demonstrate that in individuals with SCD, a renal inflammation state induces renal hepcidin production that blocks the upregulation of ferroportin levels, resulting in dysregulation of iron homeostasis in the kidney and iron deposition in the renal cortex.

HTT
Also flagged:Neurodegenerative DiseasesdeathAmyotrophic Lateral Sclerosisneurodegenerative disordersnucleotideamyloid-β
Journal Article 2023-06-28 ✓ 5 Snippets Ciurea AV, Mohan AG, Covache-Busuioc RA, Costin HP, Glavan LA, Corlatescu AD, Saceleanu VM.
In-Text Gene Mentions

As it was increasingly studied, it was shown that Huntington’s disease represents an autosomal dominant progressive neurodegenerative disorder, consisting of a repetitive set of (CAG)n trinucleotide sequences in a gene found on the chromosome 4p16.3, between D4S10 and D4S98 [115] (Gusella et al., 1983), called huntingtin (HTT), leading to a polyglutamine expansion.

Huntington’s disease begins early, before any symptoms have emerged, with transcriptional dysregulation taking place due to mutations of HTT that disrupt transcriptional machinery via interactions with transcription factors and molecular mediators such as CBP (cAMP response element-binding protein).

…1983), called huntingtin (HTT), leading to a…

…identified in theHTTgene beyond its…

…TheHTTmRNA exon 1…

Show Full Abstract

Neurodegenerative diseases are, according to recent studies, one of the main causes of disability and death worldwide. Interest in molecular genetics has started to experience exponential growth thanks to numerous advancements in technology, shifts in the understanding of the disease as a phenomenon, and the change in the perspective regarding gene editing and the advantages of this action. The aim of this paper is to analyze the newest approaches in genetics and molecular sciences regarding four of the most important neurodegenerative disorders: Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis. We intend through this review to focus on the newest treatment, diagnosis, and predictions regarding this large group of diseases, in order to obtain a more accurate analysis and to identify the emerging signs that could lead to a better outcome in order to increase both the quality and the life span of the patient. Moreover, this review could provide evidence of future possible novel therapies that target the specific genes and that could be useful to be taken into consideration when the classical approaches fail to shed light.

CACNA1E
Also flagged:mitochondrialcalciumoxygenmitochondrial complex Icytochrome cattention deficit-hyperactive disorder
Journal Article 2023-06-28 ✓ 1 Snippet Kessi M, Chen B, Pan L, Yang L, Yang L, Peng J, He F, Yin F.
In-Text Gene Mentions

…CACNA1I , andCACNA1Egenes ( Smith…

Show Full Abstract

<h4>Objective</h4>To investigate the pathogenesis of three novel <i>de novo CACNA1C</i> variants (p.E411D, p.V622G, and p.A272V) in causing neurodevelopmental disorders and arrhythmia.<h4>Methods</h4>Several molecular experiments were carried out on transfected human embryonic kidney 293 (HEK 293) and Chinese hamster ovary (CHO) cells to explore the effects of p.E411D, p.V622G, and p.A272V variants on electrophysiology, mitochondrial and lysosomal functions. Electrophysiological studies, RT-qPCR, western blot, apoptosis assay, mito-tracker fluorescence intensity, lyso-tracker fluorescence intensity, mitochondrial calcium concentration test, and cell viability assay were performed. Besides, reactive oxygen species (ROS) levels, ATP levels, mitochondrial copy numbers, mitochondrial complex I, II, and cytochrome c functions were measured.<h4>Results</h4>The p.E411D variant was found in a patient with attention deficit-hyperactive disorder (ADHD), and moderate intellectual disability (ID). This mutant demonstrated reduced calcium current density, mRNA, and protein expression, and it was localized in the nucleus, cytoplasm, lysosome, and mitochondria. It exhibited an accelerated apoptosis rate, impaired autophagy, and mitophagy. It also demonstrated compromised mitochondrial cytochrome c oxidase, complex I, and II enzymes, abnormal mitochondrial copy numbers, low ATP levels, abnormal mitochondria fluorescence intensity, impaired mitochondrial fusion and fission, and elevated mitochondrial calcium ions. The p.V622G variant was identified in a patient who presented with West syndrome and moderate global developmental delay. The p.A272V variant was found in a patient who presented with epilepsy and mild ID. Both mutants (p.V622G and p.A272V) exhibited reduced calcium current densities, decreased mRNA and protein expressions, and they were localized in the nucleus, cytoplasm, lysosome, and mitochondria. They exhibited accelerated apoptosis and proliferation rates, impaired autophagy, and mitophagy. They also exhibited abnormal mitochondrial cytochrome c oxidase, complex I and II enzymes, abnormal mitochondrial copy numbers, low ATP, high ROS levels, abnormal mitochondria fluorescence intensity, impaired mitochondrial fusion and fission, as well as elevated mitochondrial calcium ions.<h4>Conclusion</h4>The p.E411D, p.V622G and p.A272V mutations of human <i>CACNA1C</i> reduce the expression level of <i>CACNA1C</i> proteins, and impair mitochondrial and lysosomal functions. These effects induced by <i>CACNA1C</i> variants may contribute to the pathogenesis of <i>CACNA1C</i>-related disorders.

Also flagged:folatemetabolismneuropsychiatric disordersMTHFRfolatesglutamate-decarboxylase-65
Journal Article 2023-06-28 No Snippets Sadigurschi N, Schrift G, Hirrlinger J, Golan HM.
Show Full Abstract

<h4>Introduction</h4>The implications of folate deficiency in neuropsychiatric disorders were demonstrated in numerous studies. Genetic deficiency in a key folate metabolism enzyme, MTHFR, is an example of the interaction between genetic and environmental risk factors: the maternal MTHFR deficiency governs <i>in-utero</i> nutrient availability, and the embryo's <i>Mthfr</i> genotype influences its ability to metabolize folates. Here, we explore how the maternal and offspring <i>Mthfr</i> genotypes affect cortical interneuron densities and distributions, mouse social outcome, and the relation of the different interneuron patterns to cortical excitability.<h4>Methods</h4>Two experiments were conducted to examine the effects of maternal and offspring <i>Mthfr</i>-KO heterozygosity. Mice were tested for direct social interactions (DSIs), repetitive behavior and cortical laminar distribution of interneuron populations expressing glutamate-decarboxylase-65, parvalbumin and somatostatin. Susceptibility to seizure was tested by exposure to pentylenetetrazole (PTZ).<h4>Results</h4>Maternal <i>Mthfr+/-</i> genotype was associated with suppressed social activities and reduced interneuron densities in all layers of the retrosplenial cortex (RSC). Somatostatin density and the somatostatin/parvalbumin ratio in the RSC and frontal cortex positively correlated with social behavior in the mice. An interaction between maternal and offspring <i>Mthfr</i> genotypes resulted in higher susceptibility of wild-type offspring to PTZ induced seizure.<h4>Discussion</h4>Maternal folate metabolism was shown to be critical to interneuron ontogenesis. Our results demonstrate that interneurons have a specific susceptibility to folate deficiency that may mediate folate's involvement in neuropsychiatric disease. The relations between cortical somatostatin interneuron patterns and social behavior highlight this subpopulation of interneurons as a target for further research.

Also flagged:extracellularvesiclesneurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseamyotrophic lateral sclerosis
Journal Article 2023-06-28 No Snippets Giovannelli L, Bari E, Jommi C, Tartara F, Armocida D, Garbossa D, Cofano F, Torre ML, Segale L.
Show Full Abstract

Neurodegenerative diseases represent a growing burden on healthcare systems worldwide. Mesenchymal stem cells (MSCs) have shown promise as a potential therapy due to their neuroregenerative, neuroprotective, and immunomodulatory properties, which are, however, linked to the bioactive substances they release, collectively known as secretome. This paper provides an overview of the most recent research on the safety and efficacy of MSC-derived secretome and extracellular vesicles (EVs) in clinical (if available) and preclinical models of Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, Huntington's disease, acute ischemic stroke, and spinal cord injury. The article explores the biologically active substances within MSC-secretome/EVs, the mechanisms responsible for the observed therapeutic effects, and the strategies that may be used to optimize MSC-secretome/EVs production based on specific therapeutic needs. The review concludes with a critical discussion of current clinical trials and a perspective on potential future directions in translating MSC-secretome and EVs into the clinic, specifically regarding how to address the challenges associated with their pharmaceutical manufacturing, including scalability, batch-to-batch consistency, adherence to Good Manufacturing Practices (GMP) guidelines, formulation, and storage, along with quality controls, access to the market and relative costs, value for money and impact on total expenditure.

Also flagged:UreasePurinedegradationammoniumureacarbonyl phosphoric acid amide
Journal Article 2023-06-28 No Snippets Aliyeva-Schnorr L, Schuster C, Deising HB.
Show Full Abstract

The development of new anti-ureolytic compounds is of great interest due to the newly discovered role of urease inhibitors in crop protection. Purine degradation and the generation of ammonium by urease are required for the full virulence of biotrophic and hemibiotrophic fungal plant pathogens. Accordingly, chemicals displaying urease inhibitor activity may be used as a novel class of fungicides. Several urease inhibitors belonging to different chemical classes are known, and some compounds have been developed as urea fertilizer additives. We tested whether the natural urease inhibitors <i>p</i>-benzoquinone (<i>p</i>-HQ) and hydroquinone (HQ), as well as the synthetic inhibitors isopropoxy carbonyl phosphoric acid amide (iCPAA), benzyloxy carbonyl phosphoric acid amide (bCPAA), and dipropyl-hexamino-1,3 diphosphazenium chloride (DDC), prevent or delay plant infection caused by pathogens differing in lifestyles and host plants. <i>p</i>-BQ, HQ, and DCC not only protected maize from infection by the hemibiotroph <i>C. graminicola</i>, but also inhibited the infection process of biotrophs such as the wheat powdery mildew fungus <i>Blumeria graminis</i> f. sp. <i>tritici</i> and the broad bean rust fungus <i>Uromyces viciae-fabae</i>. Interestingly, the natural quinone-based compounds even reduced the symptom severity of the necrotrophic fungi, i.e., the grey mold pathogen <i>B. cinerea</i> and the Southern Leaf Spot fungus <i>C. heterostrophus</i>, to some extent. The urease inhibitors <i>p</i>-BQ, HQ, and DCC interfered with appressorial penetration and confirmed the appropriateness of urease inhibitors as novel fungicidal agents.

Also flagged:Osteogenesistitaniumaluminumgene expressioncollagen type 1coll-I
Journal Article 2023-06-28 No Snippets Ferro F, Azzolin F, Spelat R, Bevilacqua L, Maglione M.
Show Full Abstract

<h4>Background</h4>Individuals with pathologic conditions and restorative deficiencies might benefit from a combinatorial approach encompassing stem cells and dental implants; however, due to the various surface textures and coatings, the influence of titanium dental implants on cells exhibits extensive, wide variations. Three-dimensional (3D) cultures of stem cells on whole dental implants are superior in testing implant properties and were used to examine their capabilities thoroughly.<h4>Materials and methods</h4>The surface micro-topography of five titanium dental implants manufactured by sandblasting with titanium, aluminum, corundum, or laser sintered and laser machined was compared in this study. After characterization, including particle size distribution and roughness, the adhesion, proliferation, and viability of adipose-derived stem cells (ADSCs) cultured on the whole-body implants were tested at three time points (one to seven days). Finally, the capacity of the implant to induce ADSCs' spontaneous osteoblastic differentiation was examined at the same time points, assessing the gene expression of collagen type 1 (<i>coll-I</i>), osteonectin (<i>osn</i>), alkaline phosphatase (<i>alp</i>), and osteocalcin (<i>osc</i>).<h4>Results</h4>Laser-treated (Laser Mach and Laser Sint) implants exhibited the highest adhesion degree; however, limited proliferation was observed, except for Laser Sint implants, while viability differences were seen throughout the three time points, except for Ti Blast implants. Sandblasted surfaces (Al Blast, Cor Blast, and Ti Blast) outpaced the laser-treated ones, inducing higher amounts of <i>coll</i>-<i>I</i>, <i>osn</i>, and <i>alp</i>, but not <i>osc</i>. Among the sandblasted surfaces, Ti Blast showed moderate roughness and the highest superficial texture density, favoring the most significant spontaneous differentiation relative to all the other implant surfaces.<h4>Conclusions</h4>The results indicate that 3D cultures of stem cells on whole-body titanium dental implants is a practical and physiologically appropriate way to test the biological characteristics of the implants, revealing peculiar differences in ADSCs' adhesion, proliferation, and activity toward osteogenic commitment in the absence of specific osteoinductive cues. In addition, the 3D method would allow researchers to test various implant surfaces more thoroughly. Integrating with preconditioned stem cells would inspire a more substantial combinatorial approach to promote a quicker recovery for patients with restorative impairments.

Also flagged:Homeostasisextracellularsynthesiscollagenproteoglycans-collagen proteins
Journal Article 2023-06-28 No Snippets Michelacci YM, Baccarin RYA, Rodrigues NNP.
Show Full Abstract

Chondrocytes are the main cell type in articular cartilage. They are embedded in an avascular, abundant, and specialized extracellular matrix (ECM). Chondrocytes are responsible for the synthesis and turnover of the ECM, in which the major macromolecular components are collagen, proteoglycans, and non-collagen proteins. The crosstalk between chondrocytes and the ECM plays several relevant roles in the regulation of cell phenotype. Chondrocytes live in an avascular environment in healthy cartilage with a low oxygen supply. Although chondrocytes are adapted to anaerobic conditions, many of their metabolic functions are oxygen-dependent, and most cartilage oxygen is supplied by the synovial fluid. This review focuses on the transcription control and signaling responsible for chondrocyte differentiation, homeostasis, senescence, and cell death and the changes that occur in osteoarthritis. The effects of chondroitin sulfate and other molecules as anti-inflammatory agents are also approached and analyzed.

HFE
Also flagged:Acute Inflammatory ArthropathyHypercalcemiaPrimary HyperparathyroidismSarcoidosisCalcium pyrophosphate deposition diseasearthropathy
Journal Article 2023-06-28 ✓ 3 Snippets Larsen K, Guma J, Mehannek R, Guma M.
In-Text Gene Mentions

…th aging, hyperparathyroidism,hemochromatosis, hypophosphatemia, and hypoma…

…such as hyperparathyroidism,hemochromatosis, hypophosphatemia, and hypoma…

…association, followed byhemochromatosis.…

Show Full Abstract

Calcium pyrophosphate deposition disease (CPPD) is a crystal-induced arthropathy characterized by calcium pyrophosphate crystal deposition in joints and soft tissues. The diagnosis is suggested by the presence of chondrocalcinosis on x-ray but is most often diagnosed by synovial fluid analysis (SFA). CPPD is associated with aging and metabolic disorders such as hyperparathyroidism. In this case, we present an 87-year-old woman with known sarcoidosis who presented with acute arthropathy, hypercalcemia, and radiographic evidence of CPPD. Her hypercalcemia had been attributed to her sarcoidosis in the past without a full workup. Hypercalcemia in the setting of suspected CPPD led to a full workup for hypercalcemia and ultimately led to a diagnosis of primary hyperparathyroidism. This case highlights the importance of a complete evaluation for hypercalcemia in the setting of CPPD, even when another disease, such as sarcoidosis, could explain hypercalcemia. Ultimately, CPPD aided in diagnosing hyperparathyroidism in our patient with known sarcoidosis.

SERPINC1
Also flagged:Deep Vein ThrombosispreeclampsiaDVTpulmonary embolismPEenoxaparin
Journal Article 2023-06-28 ✓ 3 Snippets Jaramillo N, Raidah A, Pradas KF, Lev S, Ramanathan A.
In-Text Gene Mentions

…of antithrombin III (ATIII), indicating a possible…

…a possible acquiredATIIIdeficiency (commonly seen…

…RepeatATIIIlevel performed three…

Show Full Abstract

We describe the case of a 19-year-old woman with no significant medical history who developed progressive right-sided neck pain and palpitations one month following a pregnancy complicated by preeclampsia. Family history was significant for unprovoked deep vein thrombosis (DVT) and pulmonary embolism (PE) in her father at age 44. Systemic examination revealed mild swelling of the right upper extremity with pain on palpation. Computed tomography (CT) of the thorax with contrast demonstrated extensive occlusion of right upper extremity veins and collateralization of chest wall veins. Pulmonary emboli were present bilaterally in the segmental and subsegmental branches of the lower lobe pulmonary arteries. CT of the abdomen with contrast revealed thrombi in the left common and external iliac veins. Thrombophilia screening was normal. The patient was treated with enoxaparin and ampicillin/sulbactam. Her clinical condition improved, and she was discharged with an outpatient clinic follow-up appointment.

Also flagged:extracellulargelatinethylene glycolcollagenalginatedeath
Journal Article 2023-06-28 No Snippets Chu H, Zhang K, Rao Z, Song P, Lin Z, Zhou J, Yang L, Quan D, Bai Y.
Show Full Abstract

The printability of bioink and post-printing cell viability is crucial for extrusion-based bioprinting. A proper bioink not only provides mechanical support for structural fidelity, but also serves as suitable three-dimensional (3D) microenvironment for cell encapsulation and protection. In this study, a hydrogel-based composite bioink was developed consisting of gelatin methacryloyl (GelMA) as the continuous phase and decellularised extracellular matrix microgels (DMs) as the discrete phase. A flow-focusing microfluidic system was employed for the fabrication of cell-laden DMs in a high-throughput manner. After gentle mixing of the DMs and GelMA, both rheological characterisations and 3D printing tests showed that the resulting DM-GelMA hydrogel preserved the shear-thinning nature, mechanical properties, and good printability from GelMA. The integration of DMs not only provided an extracellular matrix-like microenvironment for cell encapsulation, but also considerable shear-resistance for high post-printing cell viability. The DM sizes and inner diameters of the 3D printer needles were correlated and optimised for nozzle-based extrusion. Furthermore, a proof-of-concept bioink composedg of RSC96 Schwann cells encapsulated DMs and human umbilical vein endothelial cell-laden GelMA was successfully bioprinted into 3D constructs, resulting in a modular co-culture system with distinct cells/materials distribution. Overall, the modular DM-GelMA bioink provides a springboard for future precision biofabrication and will serve in numerous biomedical applications such as tissue engineering and drug screening.

Also flagged:steatosissteatohepatitisenvelopelipidmetabolismnonalcoholic fatty liver disease
Journal Article 2023-06-27 No Snippets Upadhyay KK, Choi EK, Foisner R, Omary MB, Brady GF.
Show Full Abstract

There is increasing evidence for the importance of the nuclear envelope in lipid metabolism, nonalcoholic fatty liver disease (NAFLD), and nonalcoholic steatohepatitis (NASH). Human mutations in <i>LMNA</i>, encoding A-type nuclear lamins, cause early-onset insulin resistance and NASH, while hepatocyte-specific deletion of <i>Lmna</i> predisposes to NASH with fibrosis in male mice. Given that variants in the gene encoding LAP2α, a nuclear protein that regulates lamin A/C, were previously identified in patients with NAFLD, we sought to determine the role of LAP2α in NAFLD using a mouse genetic model. Hepatocyte-specific <i>Lap2α</i>-knockout (<i>Lap2α</i><sup>(ΔHep)</sup>) mice and littermate controls were fed normal chow or high-fat diet (HFD) for 8 wk or 6 mo. Unexpectedly, male <i>Lap2α</i><sup>(ΔHep)</sup> mice showed no increase in hepatic steatosis or NASH compared with controls. Rather, <i>Lap2α</i><sup>(ΔHep)</sup> mice demonstrated reduced hepatic steatosis, with decreased NASH and fibrosis after long-term HFD. Accordingly, pro-steatotic genes including <i>Cidea, Mogat1</i>, and <i>Cd36</i> were downregulated in <i>Lap2α</i><sup>(ΔHep)</sup> mice, along with concomitant decreases in expression of pro-inflammatory and pro-fibrotic genes. These data indicate that hepatocyte-specific <i>Lap2α</i> deletion protects against hepatic steatosis and NASH in mice and raise the possibility that LAP2α could become a potential therapeutic target in human NASH.<b>NEW & NOTEWORTHY</b> The nuclear envelope and lamina regulate lipid metabolism and susceptibility to nonalcoholic steatohepatitis (NASH), but the role of the nuclear lamin-binding protein LAP2α in NASH has not been explored. Our data demonstrate that hepatocyte-specific loss of LAP2α protects against diet-induced hepatic steatosis, NASH, and fibrosis in male mice, with downregulation of pro-steatotic, pro-inflammatory, and pro-fibrotic lamin-regulated genes. These findings suggest that targeting LAP2α could have future potential as a novel therapeutic avenue in NASH.

Also flagged:ACE2nucleuspeptide-2 infectionhistonemethylation
Journal Article 2023-06-27 No Snippets Tu WJ, Melino M, Dunn J, McCuaig RD, Bielefeldt-Ohmann H, Tsimbalyuk S, Forwood JK, Ahuja T, Vandermeide J, Tan X, Tran M, Nguyen Q, Zhang L, Nam A, Pan L, Liang Y, Smith C, Lineburg K, Nguyen TH, Sng JDJ, Tong ZWM, Chew KY, Short KR, Le Grand R, Seddiki N, Rao S.
Show Full Abstract

In vitro, ACE2 translocates to the nucleus to induce SARS-CoV-2 replication. Here, using digital spatial profiling of lung tissues from SARS-CoV-2-infected golden Syrian hamsters, we show that a specific and selective peptide inhibitor of nuclear ACE2 (NACE2i) inhibits viral replication two days after SARS-CoV-2 infection. Moreover, the peptide also prevents inflammation and macrophage infiltration, and increases NK cell infiltration in bronchioles. NACE2i treatment increases the levels of the active histone mark, H3K27ac, restores host translation in infected hamster bronchiolar cells, and leads to an enrichment in methylated ACE2 in hamster bronchioles and lung macrophages, a signature associated with virus protection. In addition, ACE2 methylation is increased in myeloid cells from vaccinated patients and associated with reduced SARS-CoV-2 spike protein expression in monocytes from individuals who have recovered from infection. This protective epigenetic scarring of ACE2 is associated with a reduced latent viral reservoir in monocytes/macrophages and enhanced immune protection against SARS-CoV-2. Nuclear ACE2 may represent a therapeutic target independent of the variant and strain of viruses that use the ACE2 receptor for host cell entry.

BTN2A2BTN3A3
Also flagged:Mouth ulcerspathogenesismouth ulcerIL12BBPIFAM213A
Journal Article 2023-06-27 ✓ 5 Snippets Wu Y, Song J, Liu M, Ma H, Zhang J.
In-Text Gene Mentions

Ultimately, we identified 6 potential risk genes (BTN3A3, IL12B, BPI, FAM213A, PLXNB2, and IL22RA2) of mouth ulcers with altered protein abundances in the blood.

However, only six genes (BTN3A3, IL12B, BPI, FAM213A, PLXNB2, and IL22RA2) assembled the criterion (PPH4 > 75%) in the analysis of mouth ulcers, indicating a shared single variant with mouth ulcers (Table 2).

⭐ same-sentence co-mention

The expression of several butyrophilin (BTN) and butyrophilin-like (BTNL) molecules was significantly altered by inflammation, including BTN1A1, BTN2A2, BTN3A3, and BTNL831, and associated with tumor development32–34.

In conclusion, we found strong evidence supporting six novel blood proteins (BTN3A3, IL12B, BPI, FAM213A, PLXNB2, and IL22RA2) associated with mouth ulcers.

Second, by using Bayesian colocalization, two correlated signals with common causal variants can be estimated at specific sites, and the causative proteins of oral ulcers (BTN3A3, IL12B, BPI, FAM213A, PLXNB2, and IL22RA2) were validated.

Show Full Abstract

Mouth ulcers have been associated with numerous loci in genome wide association studies (GWAS). Nonetheless, it remains unclear what mechanisms are involved in the pathogenesis of mouth ulcers at these loci, as well as what the most effective ulcer drugs are. Thus, we aimed to screen hub genes responsible for mouth ulcer pathogenesis. We conducted an imputed/in-silico proteome-wide association study to discover candidate genes that impact the development of mouth ulcers and affect the expression and concentration of associated proteins in the bloodstream. The integrative analysis revealed that 35 genes play a significant role in the development of mouth ulcers, both in terms of their protein and transcriptional levels. Following this analysis, the researchers identified 6 key genes, namely BTN3A3, IL12B, BPI, FAM213A, PLXNB2, and IL22RA2, which were related to the onset of mouth ulcers. By combining with multidimensional data, six genes were found to correlate with mouth ulcer pathogenesis, which can be useful for further biological and therapeutic research.

NEGR1
Also flagged:Calcific aortic valve diseaseCAVDaortic stenosisAScalciumlipid
Journal Article 2023-06-27 ✓ 1 Snippet Song GY, Guo XN, Yao J, Lu ZN, Xie JH, Wu F, He J, Fu ZL, Han J.
In-Text Gene Mentions

…ICAM5, IRX3, AGRN,NEGR1etc. )…

Show Full Abstract

<h4>Aim</h4>To evaluate the expression profile of long non-coding RNAs (lncRNAs) in calcific aortic valve disease (CAVD) and explore their potential mechanism of action.<h4>Methods</h4>The gene expression profiles (GSE153555, GSE148219, GSE199718) were downloaded from the Gene Expression Omnibus (GEO) database and FastQC was run for quality control checks. After filtering and classifying candidate lncRNAs by differentially expressed genes (DEGs) and weighted co-expression networks (WGCNA) in GSE153555, we predicted the potential cis- or trans-regulatory target genes of differentially expressed lncRNAs (DELs) by using FEELnc and established the competitive endogenous RNA (ceRNA) network by miRanda, more over functional enrichment was analyzed using the ClusterProfiler package in R Bioconductor. The hub cis- or trans-regulatory genes were verified in GSE148219 and GSE199718 respectively.<h4>Results</h4>There were 340 up-regulated lncRNAs identified in AS group compared with the control group (|log<sub>2</sub>Fold Change| ≥ 1.0 and P<sub>adj</sub> ≤ 0.05), and 460 down-regulated lncRNAs. Based on target gene prediction and co-expression network construction, twelve Long non-coding RNAs (CDKN2B-AS1, AC244453.2, APCDD1L-DT, SLC12A5-AS1, TGFB3, AC243829.4, MIR4435-2HG, FAM225A, BHLHE40-AS1, LINC01614, AL356417.2, LINC01150) were identified as the hub cis- or trans-regulatory genes in the pathogenesis of CAVD which were validated in GSE148219 and GSE19971. Additionally, we found that MIR4435-2HG was the top hub trans-acting lncRNA which also plays a crucial role by ceRNA pattern.<h4>Conclusion</h4>LncRNAs may play an important role in CAVD and may provide a new perspective on the pathogenesis, diagnosis, and treatment of this disease. Further studies are required to illuminate the underlying mechanisms and provide potential therapeutic targets.

POU3F2
Also flagged:cancertumorleukemiasolid tumorscolon cancerbreast cancer
Journal Article 2023-06-27 ✓ 1 Snippet Fan M, Shi Y, Zhao J, Li L.
In-Text Gene Mentions

In glioblastoma stem cells (GSCs), for example, the expression levels of key stemness-related TFs (POU3F2, SOX2, SALL2, and OLIG2) are significantly higher than those in more differentiated tumor cells.

Show Full Abstract

Cancer stem cells (CSCs) are considered to be responsible for tumor recurrence and metastasis. Therefore, clarification of the mechanisms involved in CSC stemness maintenance and cell fate determination would provide a new strategy for cancer therapy. Unregulated cellular energetics has been accepted as one of the hallmarks of cancer cells, but recent studies have revealed that mitochondrial metabolism can also actively determine CSC fate by affecting nuclear stemness gene expression. Herein, from the perspective of mito-nuclear communication, we review recent progress on the influence of mitochondria on CSC potential from four aspects: metabolism, dynamics, mitochondrial homeostasis, and reactive oxygen species (ROS). Video Abstract.

Also flagged:osteomyelitisstaphylococcus aureus infectionOMinflammatory bone diseaseS. aureus infectionGene Expression
Journal Article 2023-06-27 No Snippets Shi X, Ni H, Tang L, Li M, Wu Y, Xu Y.
Show Full Abstract

<h4>Background</h4>Staphylococcus aureus (S. aureus) infection-induced osteomyelitis (OM) is an inflammatory bone disease accompanied by persistent bone destruction, and the treatment is challenging because of its tendency to recur. Present study was aimed to explore the molecular subgroups of S. aureus infection-induced OM and to deepen the mechanistic understanding for molecularly targeted treatment of OM.<h4>Methods</h4>Integration of 164 OM samples and 60 healthy samples from three datasets of the Gene Expression Omnibus (GEO) database. OM patients were classified into different molecular subgroups based on unsupervised algorithms and correlations of clinical characteristics between subgroups were analyzed. Next, The CIBERSORT algorithm was used to evaluate the proportion of immune cell infiltration in different OM subgroups. Weighted gene co-expression analysis (WGCNA) was used to identify different gene modules and explore the relationship with clinical characteristics, and further annotated OM subgroups and gene modules by the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis.<h4>Results</h4>Two subgroups with excellent consistency were identified in this study, subgroup and hospital length of stay were independent predictors of OM. Compared with subgroup I, OM patients in subgroup II had longer hospital length of stay and more severe disease. Meanwhile, the infiltration proportions of monocytes and macrophages M0 were higher in patients of OM subgroup II. Finally, combined with the characteristics of the KEGG enrichment modules, the expression of osteoclast differentiation-related genes such as CTSK was upregulated in OM subgroup II, which may be closely associated with more severe OM patients.<h4>Conclusion</h4>The current study showed that OM subgroup II had longer hospital length of stay and more severe disease, the osteoclast differentiation pathway and the main target CTSK contribute to our deeper understanding for the molecular mechanisms associated with S. aureus infection-induced OM, and the construction of molecular subgroups suggested the necessity for different subgroups of patients to receive individualized treatment.

DCC
Also flagged:AdiponectinAPNadipocyte differentiationdiabetesatherosclerosisaging
Journal Article 2023-06-27 ✓ 2 Snippets Soh S, Han S, Ka HI, Mun SH, Kim W, Oh G, Yang Y.
In-Text Gene Mentions

The following antibodies and chemicals were used: HIF1α, STAT3, pSTAT3 (Y705), pGSK3β (S9), pAKT (S473), AKT, GSK3β, RhoA, Rock1, pMLC2 (T18/S19), MLC2, and MYLK (Cell Signaling Technology), β-actin (Santa Cruz Biotechnology), HIF1α inhibitor, vitexin (Sigma), GSK3β inhibitor, SB216763 (Sigma), c-KIT inhibitor, DCC-2618 (Sigma), STAT3 inhibitor, stattic (Sigma), HASs inhibitor, 4-Methylumbelliferone (Sigma).

Thus, we determined whether STAT3 activation was inhibited by c-KIT inhibitor, DCC-2618.

Show Full Abstract

<h4>Background</h4>Bone marrow (BM) is progressively filled with adipocytes during aging process. Thus, BM adipocytes-derived adiponectin (APN) affects the function of bone marrow-derived mesenchymal stem cells (BMSCs). However, little is known about the effect of APN on migration ability of BMSCs cultured under hypoxic conditions, which is similar to the BM microenvironment.<h4>Results</h4>We found that the population and migration ability of BMSCs from APN KO mice was higher than that of WT mice due to increased stability of hypoxia inducible factor 1α (HIF1α). Stem cell factor (SCF)-activated STAT3 stimulated the induction of HIF1α which further stimulated SCF production, indicating that the SCF/STAT3/HIF1α positive loop was highly activated in the absence of APN. It implies that APN negatively regulated this positive loop by stimulating HIF1α degradation via the inactivation of GSK3β. Furthermore, APN KO BMSCs were highly migratory toward EL-4 lymphoma, and the interaction between CD44 in BMSCs and hyaluronic acid (HA) from EL-4 enhanced the migration of BMSCs. On the other hand, the migrated BMSCs recruited CD8<sup>+</sup> T cells into the EL-4 tumor tissue, resulting in the retardation of tumor growth. Additionally, gradually increased APN in BM on the aging process affects migration and related functions of BMSCs, thus aged APN KO mice showed more significant suppression of EL-4 growth than young APN KO mice due to higher migration and recruitment of CD8<sup>+</sup> T cells.<h4>Conclusion</h4>APN deficiency enhances CD44-mediated migration ability of BMSCs in the hypoxic conditions by the SCF/STAT3/HIF1α positive loop and influences the migration ability of BMSCs for a longer time depending on the aging process. Video Abstract.

Also flagged:Leflunomidetriazolesmetacaspaseefflux pumpscalciumcandidiasis
Journal Article 2023-06-27 No Snippets Li X, Zhang N, Zhang L, Liu C, Zheng S, Lou H.
Show Full Abstract

<h4>Objective</h4>The global rise in the resistance of <i>Candida albicans</i> to conventional antifungals makes <i>Candida albicans</i> infections harder to treat. The main objective of this study was to investigate the antifungal effects and underlying mechanisms of leflunomide in combination with triazoles against resistant <i>Candida albicans</i>.<h4>Methods</h4>In this study, the microdilution method was used to determine the antifungal effects of leflunomide in combination with three triazoles on planktonic cells in vitro. The morphological transition from yeast to hyphae was observed under a microscope. The effects on ROS, metacaspase, efflux pumps, and intracellular calcium concentration were investigated, respectively.<h4>Results</h4>Our findings suggested that leflunomide + triazoles showed a synergistic effect against resistant <i>Candida albicans</i> in vitro. Further study concluded that the synergistic mechanisms were resulted from multiple factors, including the inhibited efflux of triazoles, the inhibition of yeast-to-hyphae transition, ROS increasing, metacaspase activation, and [Ca<sup>2+</sup>]<sub>i</sub> disturbance.<h4>Discussion</h4>Leflunomide appears to be a potential enhancer of current antifungal agents for treating candidiasis caused by resistant <i>Candida albicans</i>. This study can also serve as an example to inspire the exploration of new approaches to treating resistant <i>Candida albicans</i>.

POU3F2
Also flagged:GlioblastomaGBMgliomapathogenesisRNA binding proteinsbrain tumor
Journal Article 2023-06-27 ✓ 1 Snippet Zhang L, Zhang Y, Gao H, Li X, Li P.
In-Text Gene Mentions

POU3F2 has been reported to promote GBM development [97].

Show Full Abstract

Glioblastoma (GBM) is the most malignant form of glioma and is difficult to diagnose, leading to high mortality rates. Circular RNAs (circRNAs) are noncoding RNAs with a covalently closed loop structure. CircRNAs are involved in various pathological processes and have been revealed to be important regulators of GBM pathogenesis. CircRNAs exert their biological effects by 4 different mechanisms: serving as sponges of microRNAs (miRNAs), serving as sponges of RNA binding proteins (RBPs), modulating parental gene transcription, and encoding functional proteins. Among the 4 mechanisms, sponging miRNAs is predominant. Their good stability, broad distribution and high specificity make circRNAs promising biomarkers for GBM diagnosis. In this paper, we summarized the current understanding of the characteristics and action mechanisms of circRNAs, illustrated the underlying regulatory mechanisms of circRNAs in GBM progression and explored the possible diagnostic role of circRNAs in GBM.

Also flagged:ASXL3cell proliferationCongenital heart diseaseFgfr2RasERK
Journal Article 2023-06-27 No Snippets Liu Z, Jiang Y, Fang F, Li R, Han J, Yang X, Deng Q, Li LS, Lei TY, Li DZ, Liao C.
Show Full Abstract

Congenital heart disease (CHD) is a serious condition with unknown etiology. In a recent study, a compound heterozygous mutation (c.3526C > T [p.Arg1176Trp] and c.4643A > G [p.Asp1548Gly]) in the ASXL3 gene was identified, which is associated with CHD. This mutation was overexpressed in HL-1 mouse cardiomyocyte cells, leading to increased cell apoptosis and decreased cell proliferation. However, whether this effect is mediated by long noncoding RNAs (lncRNAs) is yet to be determined. We identified the differences among lncRNA and mRNA profiles in mouse heart tissues using sequencing to explore this issue. We detected HL-1 cell proliferation and apoptosis through CCK8 and flow cytometry. Fgfr2, lncRNA, and Ras/ERK signaling pathway expressions were evaluated using quantitative real time polymerase chain reaction (qRT-PCR) and western blot (WB) assays. We also conducted functional investigations by silencing lncRNA NONMMUT063967.2. The sequencing revealed significant changes in lncRNA and mRNA profiles, with the expression of lncRNA NONMMUT063967.2 being significantly promoted in the ASXL3 gene mutations group (MT) while the expression of Fgfr2 being downregulated. The <i>in vitro</i> experiments showed that ASXL3 gene mutations inhibited the proliferation of cardiomyocytes and accelerated cell apoptosis by promoting the expression of lncRNAs (NONMMUT063967.2, NONMMUT063918.2, and NONMMUT063891.2), suppressing the formation of FGFR2 transcripts, and inhibiting the Ras/ERK signaling pathway. The decrease in FGFR2 had the same effect on the Ras/ERK signaling pathway, proliferation, and apoptosis in mouse cardiomyocytes as ASXL3 mutations. Further mechanistic studies revealed that suppression of lncRNA NONMMUT063967.2 and overexpression of FGFR2 reversed the effects of the ASXL3 mutations on the Ras/ERK signaling pathway, proliferation, and apoptosis in mouse cardiomyocytes. Therefore, ASXL3 mutation decreases FGFR2 expression by upregulating lncRNA NONMMUT063967.2, inhibiting cell proliferation and promoting cell apoptosis in mouse cardiomyocytes.

SOX6
Also flagged:chromatinorganogenesisgastrulationtranscription factorsdevelopmental malformationssomitogenesis
Journal Article 2023-06-27 ✓ 1 Snippet Deng Q, Wang S, Huang Z, Lan Q, Lai G, Xu J, Yuan Y, Liu C, Lin X, Feng W, Ma W, Cheng M, Hao S, Duan S, Zheng H, Chen X, Hou Y, Luo Y, Liu L, Liu C.
In-Text Gene Mentions

…as lrx3 ,Sox6, Sox5 (…

Show Full Abstract

In mammals, early organogenesis begins soon after gastrulation, accompanied by specification of various type of progenitor/precusor cells. In order to reveal dynamic chromatin landscape of precursor cells and decipher the underlying molecular mechanism driving early mouse organogenesis, we performed single-cell ATAC-seq of E8.5-E10.5 mouse embryos. We profiled a total of 101,599 single cells and identified 41 specific cell types at these stages. Besides, by performing integrated analysis of scATAC-seq and public scRNA-seq data, we identified the critical <i>cis</i>-regulatory elements and key transcription factors which drving development of spinal cord and somitogenesis. Furthermore, we intersected accessible peaks with human diseases/traits-related loci and found potential clinical associated single nucleotide variants (SNPs). Overall, our work provides a fundamental source for understanding cell fate determination and revealing the underlying mechanism during postimplantation embryonic development, and expand our knowledge of pathology for human developmental malformations.

Also flagged:hematological malignanciessolid tumorstumorsolid cancersextracellularsolid malignancies
Journal Article 2023-06-27 No Snippets Meringa AD, Hernández-López P, Cleven A, de Witte M, Straetemans T, Kuball J, Beringer DX, Sebestyen Z.
Show Full Abstract

No abstract available.

Also flagged:titanium oxideshydroxyapatitesaltsozonesaltcarbon
Journal Article 2023-06-27 No Snippets Schwartz A, Kossenko A, Zinigrad M, Danchuk V, Sobolev A.
Show Full Abstract

The effect of various cleaning methods on coating morphology and their effectiveness in removing organic contaminants has been studied in this research. Bioactive coatings containing titanium oxides and hydroxyapatite (HAP) were obtained through plasma electrolytic oxidation in aqueous electrolytes and molten salts. The cleaning procedure for the coated surface was performed using autoclave (A), ultraviolet light (UV), radio frequency (RF), air plasma (P), and UV-ozone cleaner (O). The samples were characterized using scanning electron microscopy (SEM) with an EDS detector, X-ray photoelectron spectroscopy (XPS), X-ray phase analysis (XRD), and contact angle (CA) measurements. The conducted studies revealed that the samples obtained from molten salt exhibited a finer crystalline structure morphology (275 nm) compared to those obtained from aqueous electrolytes (350 nm). After applying surface cleaning methods, the carbon content decreased from 5.21 at.% to 0.11 at.% (XPS), which directly corresponds to a reduction in organic contaminations and a decrease in the contact angle as follows: A > UV > P > O. This holds true for both coatings obtained in molten salt (25.3° > 19.5° > 10.5° > 7.5°) and coatings obtained in aqueous electrolytes (35.2° > 28.3° > 26.1° > 16.6°). The most effective and moderate cleaning method is ozone treatment.

Also flagged:enveloperesistanceinfectionsmembranecell wallperiplasm
Journal Article 2023-06-27 No Snippets Kadeřábková N, Mahmood AJS, Furniss RCD, Mavridou DAI.
Show Full Abstract

Gram-negative bacteria are uniquely equipped to defeat antibiotics. Their outermost layer, the cell envelope, is a natural permeability barrier that contains an array of resistance proteins capable of neutralizing most existing antimicrobials. As a result, its presence creates a major obstacle for the treatment of resistant infections and for the development of new antibiotics. Despite this seemingly impenetrable armor, in-depth understanding of the cell envelope, including structural, functional and systems biology insights, has promoted efforts to target it that can ultimately lead to the generation of new antibacterial therapies. In this article, we broadly overview the biology of the cell envelope and highlight attempts and successes in generating inhibitors that impair its function or biogenesis. We argue that the very structure that has hampered antibiotic discovery for decades has untapped potential for the design of novel next-generation therapeutics against bacterial pathogens.

Also flagged:HCV infectionimmune responsesimmune responseco-infectionsCD8) infection
Journal Article 2023-06-27 No Snippets Maretti-Mira AC, Salomon MP, Hsu AM, Matsuba C, Golden-Mason L.
Show Full Abstract

<h4>Introduction</h4>Despite advancements in hepatitis C virus (HCV) infection treatment, HCV still represents a significant public health burden. Besides progressive hepatic damage, viral persistence has lasting effects on innate and adaptive immune responses. Lack of a complete understanding of the factors driving an effective HCV response contributes to the failure to develop a vaccine for prevention. This study advances the existing knowledge on HCV-specific CD8<sup>+</sup> T cells and describes the impact of current or past HCV infection on CD8<sup>+</sup> T cells specific for other viruses.<h4>Methods</h4>We used barcoded-dextramers to identify and sort CD8<sup>+</sup> T cells specific for HCV, cytomegalovirus, and influenza, and characterized them using single-cell RNA sequencing technology. Our cohort included chronic (cHCV), spontaneously resolved (rHCV), and subjects undergoing direct-acting antiviral (DAA) therapy.<h4>Results</h4>We show that HCV-specific CD8<sup>+</sup> T cells have cytotoxic features in patients with cHCV, which is progressively reduced with DAA therapy and persists 12 weeks after treatment completion. We also observe a shift in the CD8<sup>+</sup> T cell phenotype on DAA treatment, with decreased effector memory and exhausted cell signatures. In rHCV, we also detected a smaller proportion of effector memory cells compared to cHCV. The proportion of CD8<sup>+</sup> exhausted T cells in cHCV and rHCV subjects was comparable. Moreover, we also observed that non-HCV virus-specific CD8<sup>+</sup> T cells exhibit robust cytotoxic traits during cHCV infection.<h4>Discussion</h4>Altogether, our findings suggest that cHCV infection promotes cytotoxicity in CD8<sup>+</sup> T cells regardless of virus specificity. The immunological changes caused by cHCV infection in CD8<sup>+</sup> T cells may contribute to worsening the ongoing hepatic damage caused by HCV infection or exacerbate the immune response to possible co-infections. Our data provide a resource to groups exploring the underlying mechanisms of HCV-specific T cell spontaneous and treatment-induced resolution to inform the development of effective vaccines against HCV infection.

Also flagged:agingmitochondrialcancersleepdegenerative diseaseage-related chronic diseases
Journal Article 2023-06-27 No Snippets Maragkakis M, Malla S, Hatzoglou M, Trifunovic A, Glick AB, Finkel T, Longo VD, Kaushik S, Muñoz-Cánoves P, Lithgow GJ, Naidoo N, Booth LN, Payea MJ, Herman AB, de Cabo R, Wilson DM, Ferrucci L, Gorospe M.
Show Full Abstract

On April 28<sup>th</sup>, 2022, a group of scientific leaders gathered virtually to discuss molecular and cellular mechanisms of responses to stress. Conditions of acute, high-intensity stress are well documented to induce a series of adaptive responses that aim to promote survival until the stress has dissipated and then guide recovery. However, high-intensity or persistent stress that goes beyond the cell's compensatory capacity are countered with resilience strategies that are not completely understood. These adaptative strategies, which are an essential component of the study of aging biology, were the theme of the meeting. Specific topics discussed included mechanisms of proteostasis, such as the unfolded protein response (UPR) and the integrated stress response (ISR), as well as mitochondrial stress and lysosomal stress responses. Attention was also given to regulatory mechanisms and associated biological processes linked to age-related conditions, such as muscle loss and regeneration, cancer, senescence, sleep quality, and degenerative disease, with a general focus on the relevance of stress responses to frailty. We summarize the concepts and potential future directions that emerged from the discussion and highlight their relevance to the study of aging and age-related chronic diseases.

LRRC7
Also flagged:condensinscohesininterphasemitosissisterStructural Maintenance of Chromosomes
Journal Article 2023-06-26 ✓ 1 Snippet Batty P, Langer CC, Takács Z, Tang W, Blaukopf C, Peters JM, Gerlich DW.
In-Text Gene Mentions

Condensindepletion completely abrogated…

Show Full Abstract

Genetic information is stored in linear DNA molecules, which are highly folded inside cells. DNA replication along the folded template path yields two sister chromatids that initially occupy the same nuclear region in an intertwined arrangement. Dividing cells must disentangle and condense the sister chromatids into separate bodies such that a microtubule-based spindle can move them to opposite poles. While the spindle-mediated transport of sister chromatids has been studied in detail, the chromosome-intrinsic mechanics presegregating sister chromatids have remained elusive. Here, we show that human sister chromatids resolve extensively already during interphase, in a process dependent on the loop-extruding activity of cohesin, but not that of condensins. Increasing cohesin's looping capability increases sister DNA resolution in interphase nuclei to an extent normally seen only during mitosis, despite the presence of abundant arm cohesion. That cohesin can resolve sister chromatids so extensively in the absence of mitosis-specific activities indicates that DNA loop extrusion is a generic mechanism for segregating replicated genomes, shared across different Structural Maintenance of Chromosomes (SMC) protein complexes in all kingdoms of life.

LRRC7
Also flagged:secretioninfectionATPasehost cellsimmune responsescytoplasmic
Journal Article 2023-06-26 ✓ 1 Snippet Spencer BL, Job AM, Robertson CM, Hameed ZA, Serchejian C, Wiafe-Kwakye CS, Mendonça JC, Apolonio MA, Nagao PE, Neely MN, Korotkova N, Korotkov KV, Patras KA, Doran KS.
In-Text Gene Mentions

Lap1

Show Full Abstract

Type VIIb secretion systems (T7SSb) in Gram-positive bacteria facilitate physiology, interbacterial competition, and/or virulence via EssC ATPase-driven secretion of small ɑ-helical proteins and toxins. Recently, we characterized T7SSb in group B Streptococcus (GBS), a leading cause of infection in newborns and immunocompromised adults. GBS T7SS comprises four subtypes based on variation in the C-terminus of EssC and the repertoire of downstream effectors; however, the intraspecies diversity of GBS T7SS and impact on GBS-host interactions remains unknown. Bioinformatic analysis indicates that GBS T7SS loci encode subtype-specific putative effectors, which have low interspecies and inter-subtype homology but contain similar domains/motifs and therefore may serve similar functions. We further identify orphaned GBS WXG100 proteins. Functionally, we show that GBS T7SS subtype I and III strains secrete EsxA in vitro and that in subtype I strain CJB111, esxA1 appears to be differentially transcribed from the T7SS operon. Furthermore, we observe subtype-specific effects of GBS T7SS on host colonization, as CJB111 subtype I but not CNCTC 10/84 subtype III T7SS promotes GBS vaginal colonization. Finally, we observe that T7SS subtypes I and II are the predominant subtypes in clinical GBS isolates. This study highlights the potential impact of T7SS heterogeneity on host-GBS interactions.

PRDX6
Also flagged:Spns2S1Psepsisinfectionmetabolismimmune response
Journal Article 2023-06-26 ✓ 1 Snippet Fang C, Ren P, Bian G, Wang J, Bai J, Huang J, Ding Y, Li X, Li M, Hou Z.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Sepsis is a leading cause of in-hospital mortality resulting from a dysregulated response to infection. Novel immunomodulatory therapies targeting macrophage metabolism have emerged as an important focus for current sepsis research. However, understanding the mechanisms underlying macrophage metabolic reprogramming and how they impact immune response requires further investigation. Here, we identify macrophage-expressed Spinster homolog 2 (Spns2), a major transporter of sphingosine-1-phosphate (S1P), as a crucial metabolic mediator that regulates inflammation through the lactate-reactive oxygen species (ROS) axis. Spns2 deficiency in macrophages significantly enhances glycolysis, thereby increasing intracellular lactate production. As a key effector, intracellular lactate promotes pro-inflammatory response by increasing ROS generation. The overactivity of the lactate-ROS axis drives lethal hyperinflammation during the early phase of sepsis. Furthermore, diminished Spns2/S1P signaling impairs the ability of macrophages to sustain an antibacterial response, leading to significant innate immunosuppression in the late stage of infection. Notably, reinforcing Spns2/S1P signaling contributes to balancing the immune response during sepsis, preventing both early hyperinflammation and later immunosuppression, making it a promising therapeutic target for sepsis.

OLFM4
Also flagged:TrimethylamineDiarrheasecretioncarbohydratesanorexiaenteric infections
Journal Article 2023-06-26 ✓ 2 Snippets Beaumont M, Lencina C, Bertide A, Gallo L, Barilly C, Marrauld C, Cauquil L, Samson A, Combes S.
In-Text Gene Mentions

Interestingly, organoids treated with 10 mM TMA had a higher expression of a proliferation marker (olfactomedin 4 [OLFM4]) when compared to organoids treated with butyrate (Fig. 5B), while the opposite was observed for genes involved in epithelial barrier function (claudin 3 [CLDN3]; mucin 13 [MUC13]; dual oxidase 2 [DUOX2]; chemokine C-C motif ligand 5 [CCL5]) (Fig. 6A, B, D, and E).

…(olfactomedin 4 [OLFM4]) when compared…

Show Full Abstract

Postweaning diarrhea (PWD) in piglets impair welfare, induce economic losses and lead to overuse of antibiotics. The early life gut microbiota was proposed to contribute to the susceptibility to PWD. The objective of our study was to evaluate in a large cohort of 116 piglets raised in 2 separate farms whether the gut microbiota composition and functions during the suckling period were associated with the later development of PWD. The fecal microbiota and metabolome were analyzed by 16S rRNA gene amplicon sequencing and nuclear magnetic based resonance at postnatal day 13 in male and female piglets. The later development of PWD was recorded for the same animals from weaning (day 21) to day 54. The gut microbiota structure and α-diversity during the suckling period were not associated with the later development of PWD. There was no significant difference in the relative abundances of bacterial taxa in suckling piglets that later developed PWD. The predicted functionality of the gut microbiota and the fecal metabolome signature during the suckling period were not linked to the later development of PWD. Trimethylamine was the bacterial metabolite which fecal concentration during the suckling period was the most strongly associated with the later development of PWD. However, experiments in piglet colon organoids showed that trimethylamine did not disrupt epithelial homeostasis and is thus not likely to predispose to PWD through this mechanism. In conclusion, our data suggest that the early life microbiota is not a major factor underlying the susceptibility to PWD in piglets. <b>IMPORTANCE</b> This study shows that the fecal microbiota composition and metabolic activity are similar in suckling piglets (13 days after birth) that either later develop post-weaning diarrhea (PWD) or not, which is a major threat for animal welfare that also causes important economic losses and antibiotic treatments in pig production. The aim of this work was to study a large cohort of piglets raised in separates environments, which is a major factor influencing the early life microbiota. One of the main findings is that, although the fecal concentration of trimethylamine in suckling piglets was associated with the later development of PWD, this gut microbiota-derived metabolite did not disrupt the epithelial homeostasis in organoids derived from the pig colon. Overall, this study suggests that the gut microbiota during the suckling period is not a major factor underlying the susceptibility of piglets to PWD.

Also flagged:conjugationbeta-lactamcolistinextended-spectrum beta-lactamasemcr-1mcr-1.
Journal Article 2023-06-26 No Snippets Binsker U, Oelgeschläger K, Neumann B, Werner G, Käsbohrer A, Hammerl JA.
Show Full Abstract

Colistin is still commonly used and misused in animal husbandry driving the evolution and dissemination of transmissible plasmid-mediated colistin resistance (<i>mcr</i>). <i>mcr-1.26</i> is a rare variant and, so far, has only been detected in Escherichia coli obtained from a hospitalized patient in Germany in 2018. Recently, it was also notified in fecal samples from a pigeon in Lebanon. We report on the presence of 16 colistin-resistant, <i>mcr-1.26</i>-carrying extended-spectrum beta-lactamase (ESBL)-producing and commensal E. coli isolated from poultry samples in Germany, of which retail meat was the most common source. Short- and long-read genome sequencing and bioinformatic analyses revealed the location of <i>mcr-1.26</i> exclusively on IncX4 plasmids. <i>mcr-1.26</i> was identified on two different IncX4 plasmid types of 33 and 38 kb and was associated with an IS<i>6</i>-like element. Based on the genetic diversity of E. coli isolates, transmission of the <i>mcr-1.26</i> resistance determinant is mediated by horizontal transfer of IncX4 plasmids, as confirmed by conjugation experiments. Notably, the 33-kb plasmid is highly similar to the plasmid reported for the human sample. Furthermore, we identified the acquisition of an additional beta-lactam resistance linked to a Tn<i>2</i> transposon on the <i>mcr-1.26</i> IncX4 plasmids of three isolates, indicating progressive plasmid evolution. Overall, all described <i>mcr-1.26</i>-carrying plasmids contain a highly conserved core genome necessary for colistin resistance development, transmission, replication, and maintenance. Variations in the plasmid sequences are mainly caused by the acquisition of insertion sequences and alteration in intergenic sequences or genes of unknown function. <b>IMPORTANCE</b> Evolutionary events causing the emergence of new resistances/variants are usually rare and challenging to predict. Conversely, common transmission events of widespread resistance determinants are quantifiable and predictable. One such example is the transmissible plasmid-mediated colistin resistance. The main determinant, <i>mcr-1</i>, has been notified in 2016 but has successfully established itself in multiple plasmid backbones in diverse bacterial species across all One Health sectors. So far, 34 variants of <i>mcr-1</i> are described, of which some can be used for epidemiological tracing-back analysis to identify the origin and transmission dynamics of these genes. Here, we report the presence of the rare <i>mcr-1.26</i> gene in E. coli isolated from poultry since 2014. Based on the temporal occurrence and high similarity of the plasmids between poultry and human isolates, our study provides first indications for poultry husbandry as the primary source of <i>mcr-1.26</i> and its transmission between different niches.

HFE
Also flagged:NAFLDnon-alcoholic steatohepatitisNASHnon-alcoholic fatty liver diseasesimple steatosisgadoxetic acid
Journal Article 2023-06-26 ✓ 1 Snippet Bastati N, Perkonigg M, Sobotka D, Poetter-Lang S, Fragner R, Beer A, Messner A, Watzenboeck M, Pochepnia S, Kittinger J, Herold A, Kristic A, Hodge JC, Traussnig S, Trauner M, Ba-Ssalamah A, Langs G.
In-Text Gene Mentions

…autoimmune liver diseases,hemochromatosis, Wilson’s disease, α-1…

Show Full Abstract

<h4>Objective</h4>To compare unsupervised deep clustering (UDC) to fat fraction (FF) and relative liver enhancement (RLE) on Gd-EOB-DTPA-enhanced MRI to distinguish simple steatosis from non-alcoholic steatohepatitis (NASH), using histology as the gold standard.<h4>Materials and methods</h4>A derivation group of 46 non-alcoholic fatty liver disease (NAFLD) patients underwent 3-T MRI. Histology assessed steatosis, inflammation, ballooning, and fibrosis. UDC was trained to group different texture patterns from MR data into 10 distinct clusters per sequence on unenhanced T1- and Gd-EOB-DTPA-enhanced T1-weighted hepatobiliary phase (T1-Gd-EOB-DTPA-HBP), then on T1 in- and opposed-phase images. RLE and FF were quantified on identical sequences. Differences of these parameters between NASH and simple steatosis were evaluated with χ<sup>2</sup>- and t-tests, respectively. Linear regression and Random Forest classifier were performed to identify associations between histological NAFLD features, RLE, FF, and UDC patterns, and then determine predictors able to distinguish simple steatosis from NASH. ROC curves assessed diagnostic performance of UDC, RLE, and FF. Finally, we tested these parameters on 30 validation cohorts.<h4>Results</h4>For the derivation group, UDC-derived features from unenhanced and T1-Gd-EOB-DTPA-HBP, plus from T1 in- and opposed-phase, distinguished NASH from simple steatosis (p ≤ 0.001 and p = 0.02, respectively) with 85% and 80% accuracy, respectively, while RLE and FF distinguished NASH from simple steatosis (p ≤ 0.001 and p = 0.004, respectively), with 83% and 78% accuracy, respectively. On multivariate regression analysis, RLE and FF correlated only with fibrosis (p = 0.040) and steatosis (p ≤ 0.001), respectively. Conversely, UDC features, using Random Forest classifier predictors, correlated with all histologic NAFLD components. The validation group confirmed these results for both approaches.<h4>Conclusion</h4>UDC, RLE, and FF could independently separate NASH from simple steatosis. UDC may predict all histologic NAFLD components.<h4>Clinical relevance statement</h4>Using gadoxetic acid-enhanced MR, fat fraction (FF > 5%) can diagnose NAFLD, and relative liver enhancement can distinguish NASH from simple steatosis. Adding AI may let us non-invasively estimate the histologic components, i.e., fat, ballooning, inflammation, and fibrosis, the latter the main prognosticator.<h4>Key points</h4>• Unsupervised deep clustering (UDC) and MR-based parameters (FF and RLE) could independently distinguish simple steatosis from NASH in the derivation group. • On multivariate analysis, RLE could predict only fibrosis, and FF could predict only steatosis; however, UDC could predict all histologic NAFLD components in the derivation group. • The validation cohort confirmed the findings for the derivation group.

Also flagged:Respiratory infectionsrespiratory diseasesGroupGASpharyngitispolystyrene
Journal Article 2023-06-26 No Snippets Tu WC, McManamen AM, Su X, Jeacopello I, Takezawa MG, Hieber DL, Hassan GW, Lee UN, Anana EV, Locknane MP, Stephenson MW, Shinkawa VAM, Wald ER, DeMuri GP, Adams KN, Berthier E, Thongpang S, Theberge AB.
Show Full Abstract

Respiratory infections are common in children, and there is a need for user-friendly collection methods. Here, we performed the first human subjects study using the CandyCollect device, a lollipop-inspired saliva collection device .We showed that the CandyCollect device can be used to collect salivary bacteria from healthy adults using <i>Streptococcus mutans</i> and <i>Staphylococcus aureus</i> as proof-of-concept commensal bacteria. We enrolled healthy adults in a nationwide (USA) remote study in which participants were sent study packages containing CandyCollect devices and traditional commercially available oral swabs and spit tubes. Participants sampled themselves at home, completed usability and user preference surveys, and mailed the samples back to our laboratory for analysis by qPCR. Our results showed that for participants in which a given bacterium (<i>S. mutans</i> or <i>S. aureus</i>) was detected in one or both of the commercially available methods (oral swab and/or spit tubes), CandyCollect devices had a 100% concordance with the positive result (<i>n</i> = 14 participants). Furthermore, the CandyCollect device was ranked the highest preference sampling method among the three sampling methods by 26 participants surveyed (combining survey results across two enrollment groups). We also showed that the CandyCollect device has a shelf life of up to 1 year at room temperature, a storage period that is convenient for clinics or patients to keep the CandyCollect device and use it any time. Taken together, we have demonstrated that the CandyCollect is a user-friendly saliva collection tool that has the potential to be incorporated into diagnostic assays in clinic visits and telemedicine.

DCC
Also flagged:immune dysfunctionCD8intracellular infectionsinfectioncytokinechemokine
Journal Article 2023-06-26 ✓ 1 Snippet Heidarian M, Jensen IJ, Kannan SK, Pewe LL, Hassert M, Park S, Xue HH, Harty JT, Badovinac VP.
In-Text Gene Mentions

…adoptively transferred intoC57BL/six micemice, followed by…

Show Full Abstract

The increasing use of nuclear energy sources inevitably raises the risk of accidental or deliberate radiation exposure and associated immune dysfunction. However, the extent to which radiation exposure impacts memory CD8 T cells, potent mediators of immunity to recurring intracellular infections and malignancies, remains understudied. Using P14 CD8 T cell chimeric mice (P14 chimeras) with an lymphocytic choriomeningitis virus (LCMV) infection model, we observed that sublethal (5Gy) whole-body irradiation (WBI) induced a rapid decline in the number of naive (T<sub>N</sub>) and P14 circulating memory CD8 T cells (T<sub>CIRCM</sub>), with the former being more susceptible to radiation-induced numeric loss. While T<sub>N</sub> cell numbers rapidly recovered, as previously described, the number of P14 T<sub>CIRCM</sub> cells remained low at least 9 mo after radiation exposure. Additionally, the remaining P14 T<sub>CIRCM</sub> in irradiated hosts exhibited an inefficient transition to a central memory (CD62L<sup>+</sup>) phenotype compared to nonirradiated P14 chimeras. WBI also resulted in long-lasting T cell intrinsic deficits in memory CD8 T cells, including diminished cytokine and chemokine production along with impaired secondary expansion upon cognate Ag reencounter. Irradiated P14 chimeras displayed significantly higher bacterial burden after challenge with <i>Listeria monocytogenes</i> expressing the LCMV GP<sub>33-41</sub> epitope relative to nonirradiated controls, likely due to radiation-induced numerical and functional impairments. Taken together, our findings suggest that sublethal radiation exposure caused a long-term numerical, impaired differentiation, and functional dysregulation in preexisting T<sub>CIRCM</sub>, rendering previously protected hosts susceptible to reinfection.

HFE
Also flagged:Erythrophagocytosisuremiaadenineoxygenlipidmitochondria
Journal Article 2023-06-26 ✓ 1 Snippet Li Z, Yan M, Wang Z, An Y, Wei X, Li T, Xu M, Xia Y, Wang L, Gao C.
In-Text Gene Mentions

…overload in cardiomyopathy,hemochromatosis, and β-thalassemia.…

Show Full Abstract

<h4>Background</h4>Although thrombosis events are the leading complication of uremia, their mechanism is largely unknown. The interaction between endothelial cells (ECs) and red blood cells (RBCs) in uremic solutes and its prothrombotic role need to be investigated.<h4>Methods and results</h4>Here, we established an in vitro co-incubation model of uremic RBC and EC as well as a uremic rat model induced by adenine. Using flow cytometry, confocal microscopy, and electron microscopy, we found increased erythrophagocytosis by EC accompanied by increased reactive oxygen species, lipid peroxidation, and impairment of mitochondria, indicating that ECs undergo ferroptosis. Further investigations showed increased proteins' expression of heme oxygenase-1 and ferritin and labile iron pool accumulation in EC, which could be suppressed by deferoxamine (DFO). The ferroptosis-negative regulators glutathione peroxidase 4 and SLC7A11 were decreased in our erythrophagocytosis model and could be enhanced by ferrostatin-1 or DFO. In vivo, we observed that vascular EC phagocytosed RBC and underwent ferroptosis in the kidney of the uremic rat, which could be inhibited by blocking the phagocytic pathway or inhibiting ferroptosis. Next, we found that the high tendency of thrombus formation was accompanied by erythrophagocytosis-induced ferroptosis in vitro and in vivo. Importantly, we further revealed that upregulated TMEM16F expression mediated phosphatidylserine externalization on ferroptotic EC, which contributed to a uremia-associated hypercoagulable state.<h4>Conclusion</h4>Our results indicate that erythrophagocytosis-triggered ferroptosis followed by phosphatidylserine exposure of EC may play a key role in uremic thrombotic complications, which may be a promising target to prevent thrombogenesis of uremia.

PRDX6PEBP1
Also flagged:gene-expressiontype 2 diabetes mellitusgene expressioninsulindiabeteschronic diseases
Journal Article 2023-06-26 ✓ 2 Snippets Guzzi PH, Cortese F, Mannino GC, Pedace E, Succurro E, Andreozzi F, Veltri P.
In-Text Gene Mentions

…SMPD1, NUCB2, ATP2A2,PEBP1, SMAD7, PRDX2, RCAN1,…

…the following: COL8A2,PRDX6, LPL, PRCP, CD9,…

Show Full Abstract

The study of the relationship between type 2 diabetes mellitus (T2DM) disease and other pathologies (comorbidities), together with patient age variation, poses a challenge for medical research. There is evidence that patients affected by T2DM are more likely to develop comorbidities as they grow older. Variation of gene expression can be correlated to changes in T2DM comorbidities insurgence and progression. Understanding gene expression changes requires the analysis of large heterogeneous data at different scales as well as the integration of different data sources into network medicine models. Hence, we designed a framework to shed light on uncertainties related to age effects and comorbidity by integrating existing data sources with novel algorithms. The framework is based on integrating and analysing existing data sources under the hypothesis that changes in the basal expression of genes may be responsible for the higher prevalence of comorbidities in older patients. Using the proposed framework, we selected genes related to comorbidities from existing databases, and then analysed their expression with age at the tissues level. We found a set of genes that changes significantly in certain specific tissues over time. We also reconstructed the associated protein interaction networks and the related pathways for each tissue. Using this mechanistic framework, we detected interesting pathways related to T2DM whose genes change their expression with age. We also found many pathways related to insulin regulation and brain activities, which can be used to develop specific therapies. To the best of our knowledge, this is the first study that analyses such genes at the tissue level together with age variations.

CCPG1
Also flagged:cell adhesionCDC42TAGLNGSNColorectal cancersintestinal
Journal Article 2023-06-26 ✓ 1 Snippet Tabatabaei ES, Mazloomnejad R, Rejali L, Forouzesh F, Naderi-Noukabadi F, Khanabadi B, Salehi Z, Nazemalhosseini-Mojarad E.
In-Text Gene Mentions

…PRKCZ-AS1, SP2-, AS1, DNAAF4-CCPG1, NEAT1, MZF1-AS1, RPARP-AS1,…

Show Full Abstract

Colorectal cancers are derived from intestinal polyps. Normally, alterations in cell adhesion genes expression cause deviation from the normal cell cycle, leading to cancer development, progression, and invasion. The present study aimed to investigate the elusive expression pattern of CDC42, TAGLN, and GSN genes in patients with high and low-risk polyp samples, and also colorectal cancer patients and their adjacent normal tissues. In upcoming study, 40 biopsy samples from Taleghani Hospital (Tehran, Iran) were collected, consisting of 20 colon polyps and 20 paired adjacent normal tissues. The expression of the nominated genes CDC42, TAGLN, and GSN was analyzed using quantitative polymerase chain reaction (Q-PCR) and relative quantification was determined using the 2<sup>-ΔΔCt</sup> method. ROC curve analysis was performed to compare high-risk and low-risk polyps for the investigated genes. The expression of adhesion molecule genes was also evaluated using TCGA data and the correlation between adhesion molecule gene expression and immunophenotype was analyzed. The role of mi-RNAs and lncRNAs in overexpression of adhesion molecule genes was studied. Lastly, GO and KEGG were performed to identify pathways related to adhesion molecule genes expression in healthy, normal adjacent, and COAD tissues. The results showed that the expression patterns of these genes were significantly elevated in high-risk adenomas compared to low-risk polyps and normal tissues and were associated with various clinicopathological characteristics. The estimated AUC for CDC42, TAGLN, and GSN were 0.87, 0.77, and 0.80, respectively. The study also analyzed COAD cancer patient data and found that the selected gene expression in cancer patients was significantly reduced compared to high-risk polyps and healthy tissues. Survival analysis showed that while the expression level of the GSN gene had no significant relationship with survival rate, the expression of CDC42 and TAGLN genes did have a meaningful relationship, but with opposite effects, suggesting the potential use of these genes as diagnostic or prognostic markers for colorectal cancer. The present study's findings suggest that the expression pattern of CDC42, TAGLN, and GSN genes was significantly increased during the transformation of normal tissue to polyp lesions, indicating their potential as prognostic biomarkers for colorectal polyp development. Further results provide valuable insights into the potential use of these genes as diagnostic or prognostic markers for colorectal cancer. However, further studies are necessary to validate these findings in larger cohorts and to explore the underlying mechanisms of these genes in the development and progression of colorectal cancer.

Also flagged:reproductionsecretionthyroid-stimulating hormonetype 2 deiodinasedio2type 3 deiodinase
Journal Article 2023-06-26 No Snippets Liu J, Xu Y, Wang Y, Zhang J, Fu Y, Liufu S, Jiang D, Pan J, Ouyang H, Huang Y, Tian Y, Shen X.
Show Full Abstract

<h4>Background</h4>Domestic geese are seasonal breeders and have the lowest reproductive capacity among all poultry species. Magang geese is a topical short-day breeder, short photoperiod exposure stimulates its reproductive activity while long photoperiod inhibits. To explore epigenetic change that could influence reproductive activity, we performed whole genome bisulfite sequencing and transcriptome sequencing in the hypothalamus at three reproductive stages during long-light exposure in male Magang geese.<h4>Results</h4>A total number of 10,602 differentially methylated regions (DMRs) were identified among three comparison groups. We observed that the vast majority of DMRs were enriched in intron regions. By integrating the BS-sequencing and RNA-seq data, the correlation between methylation changes of CG DMRs and expression changes of their associated genes was significant only for genes containing CG DMRs in their intron. A total of 278 DMR-associated DEGs were obtained among the three stages. KEGG analysis revealed that the DMR-associated DEGs were mainly involved in 11 pathways. Among them, the neuroactive ligand-receptor interaction pathway was significantly enriched in both two comparisons (RA vs.RD and RD vs.RI); the Wnt signaling pathway, apelin signaling pathway, melanogenesis, calcium signaling pathway, focal adhesion, and adherens junction were significantly enriched in the RA vs. RI comparison. In addition, the expression level of two serotonin-metabolic genes was significantly altered during reproductive axis inactivation by the methylation status of their promoter region (TPH2) and intron region (SLC18A2), respectively. These results were confirmed by Bisulfite sequencing PCR (BSP), pyrosequencing, and real-time qPCR, indicating that serotonin metabolic signaling may play a key role in decreasing the reproductive activity of Magang geese induced by long-light exposure. Furthermore, we performed a metabolomics approach to investigate the concentration of neurotransmitters among the three stages, and found that 5-HIAA, the last product of the serotonin metabolic pathway, was significantly decreased in the hypothalamus during RI.<h4>Conclusions</h4>Our study reveals that the methylation status of the serotonin metabolic pathway in the hypothalamus is associated with reproductive inactivation, and provided new insight into the effect of DNA methylation on the reproductive regulation of the hypothalamus in Magang geese.

POU3F2
Also flagged:JAB1c-Jun activation domain binding protein-1AP-1COP9signalosomeoncoprotein
Journal Article 2023-06-26 ✓ 1 Snippet Yang Y, Song R, Gao Y, Yu H, Wang S.
In-Text Gene Mentions

…Brn-2 (Pou3f2)…

Show Full Abstract

c-Jun activation domain binding protein-1 (JAB1) is a multifunctional regulator that plays vital roles in diverse cellular processes. It regulates AP-1 transcriptional activity and also acts as the fifth component of the COP9 signalosome complex. While JAB1 is considered an oncoprotein that triggers tumor development, recent studies have shown that it also functions in neurological development and disorders. In this review, we summarize the general features of the JAB1 gene and protein, and present recent updates on the regulation of JAB1 expression. Moreover, we also highlight the functional roles and regulatory mechanisms of JAB1 in neurodevelopmental processes such as neuronal differentiation, synaptic morphogenesis, myelination, and hair cell development and in the pathogenesis of some neurological disorders such as Alzheimer's disease, multiple sclerosis, neuropathic pain, and peripheral nerve injury. Furthermore, current challenges and prospects are discussed, including updates on drug development targeting JAB1.

HTT
Also flagged:AluLTRLINEORFL2AL2B
Journal Article 2023-06-26 ✓ 5 Snippets Martelossi J, Nicolini F, Subacchi S, Pasquale D, Ghiselli F, Luchetti A.
In-Text Gene Mentions

…Horizontaltransposon transfer (HTT)can be a major source for the emergence of lineage-specific TE repertories, especially for aquatic species [ 23 , 58 ].…

…In bivalves, the most studied transposon, the LTR element Steamer—a retroposon initially linked to transmissible fatal leukemia-like disease [ 59 ]—is involved in multipleHTTevents [ 23 ].…

…The contribution ofHTTin the evolution of TE repertories can be exceptionally important for DNA transposons, while LINE elements are thought to be generally transmitted through vertical inheritance [ 58 , 60 , 61 ].…

…However, multiple cases ofHTTinvolving LINE elements have been described in the literature, also involving bivalves and other aquatic species [ 63 ].…

…Moreover,HTTevents involving Harbinger elements between bivalves and sea kraits have also been recently described by [ 64 ].…

Show Full Abstract

<h4>Background</h4>Transposable elements (TEs) can represent one of the major sources of genomic variation across eukaryotes, providing novel raw materials for species diversification and innovation. While considerable effort has been made to study their evolutionary dynamics across multiple animal clades, molluscs represent a substantially understudied phylum. Here, we take advantage of the recent increase in mollusc genomic resources and adopt an automated TE annotation pipeline combined with a phylogenetic tree-based classification, as well as extensive manual curation efforts, to characterize TE repertories across 27 bivalve genomes with a particular emphasis on DDE/D class II elements, long interspersed nuclear elements (LINEs), and their evolutionary dynamics.<h4>Results</h4>We found class I elements as highly dominant in bivalve genomes, with LINE elements, despite less represented in terms of copy number per genome, being the most common retroposon group covering up to 10% of their genome. We mined 86,488 reverse transcriptases (RVT) containing LINE coming from 12 clades distributed across all known superfamilies and 14,275 class II DDE/D-containing transposons coming from 16 distinct superfamilies. We uncovered a previously underestimated rich and diverse bivalve ancestral transposon complement that could be traced back to their most recent common ancestor that lived ~ 500 Mya. Moreover, we identified multiple instances of lineage-specific emergence and loss of different LINEs and DDE/D lineages with the interesting cases of CR1- Zenon, Proto2, RTE-X, and Academ elements that underwent a bivalve-specific amplification likely associated with their diversification. Finally, we found that this LINE diversity is maintained in extant species by an equally diverse set of long-living and potentially active elements, as suggested by their evolutionary history and transcription profiles in both male and female gonads.<h4>Conclusions</h4>We found that bivalves host an exceptional diversity of transposons compared to other molluscs. Their LINE complement could mainly follow a "stealth drivers" model of evolution where multiple and diversified families are able to survive and co-exist for a long period of time in the host genome, potentially shaping both recent and early phases of bivalve genome evolution and diversification. Overall, we provide not only the first comparative study of TE evolutionary dynamics in a large but understudied phylum such as Mollusca, but also a reference library for ORF-containing class II DDE/D and LINE elements, which represents an important genomic resource for their identification and characterization in novel genomes.

Also flagged:bradicardiaanginaCASHtestesBNPaneurismas
Journal Article 2023-06-26 No Snippets Marin-Neto JA, Rassi A, Oliveira GMM, Correia LCL, Ramos Júnior AN, Luquetti AO, Hasslocher-Moreno AM, Sousa AS, Paola AAV, Sousa ACS, Ribeiro ALP, Correia Filho D, Souza DDSM, Cunha-Neto E, Ramires FJA, Bacal F, Nunes MDCP, Martinelli Filho M, Scanavacca MI, Saraiva RM, Oliveira Júnior WA, Lorga-Filho AM, Guimarães AJBA, Braga ALL, Oliveira AS, Sarabanda AVL, Pinto AYDN, Carmo AALD, Schmidt A, Costa ARD, Ianni BM, Markman Filho B, Rochitte CE, Macêdo CT, Mady C, Chevillard C, Virgens CMBD, Castro CN, Britto CFPC, Pisani C, Rassi DDC, Sobral Filho DC, Almeida DR, Bocchi EA, Mesquita ET, Mendes FSNS, Gondim FTP, Silva GMSD, Peixoto GL, Lima GG, Veloso HH, Moreira HT, Lopes HB, Pinto IMF, Ferreira JMBB, Nunes JPS, Barreto-Filho JAS, Saraiva JFK, Lannes-Vieira J, Oliveira JLM, Armaganijan LV, Martins LC, Sangenis LHC, Barbosa MPT, Almeida-Santos MA, Simões MV, Yasuda MAS, Moreira MDCV, Higuchi ML, Monteiro MRCC, Mediano MFF, Lima MM, Oliveira MT, Romano MMD, Araujo NNSL, Medeiros PTJ, Alves RV, Teixeira RA, Pedrosa RC, Aras Junior R, Torres RM, Povoa RMDS, Rassi SG, Alves SMM, Tavares SBDN, Palmeira SL, Silva Júnior TLD, Rodrigues TDR, Madrini Junior V, Brant VMDC, Dutra WO, Dias JCP.
Show Full Abstract

No abstract available.

HFE
Also flagged:HbEHemoglobin Ehemoglobinopathypancytopeniamicrocytic anemiairon
Journal Article 2023-06-26 ✓ 2 Snippets Bhattarai U, Adhikari D, Gautam A, Anand A, Shah B, Sharma SK.
In-Text Gene Mentions

…suggestive of secondaryhemochromatosis, which resulted from…

…infarcts with secondaryhemochromatosis.…

Show Full Abstract

Hemoglobin E (HbE) is the most prevalent hemoglobinopathy in the eastern Indian subcontinent. We presented the case of a 53-year-old male from Nepal with a history of multiple blood transfusions who presented with abdominal fullness for 15 years and easy fatigability for 2 months. He had pallor and massive splenomegaly. Laboratory parameters showed pancytopenia with microcytic anemia, indirect hyperbilirubinemia, target cells in the peripheral smear and iron overload. A computed tomography scan of the abdomen showed multiple splenic infarcts. Hemoglobin electrophoresis was suggestive of HbE homozygous disease. Based on these findings, we made a diagnosis of HbE homozygous disease. We provided symptomatic treatment and folic acid supplementation and counseled him for splenectomy and genetic screening. Our case highlighted the uncommon presentation of Hb E disease.

HTT
Also flagged:Ironbrain diseasesstrokeneurodegenerative diseasesferroptosisdeath
Journal Article 2023-06-26 ✓ 1 Snippet Long H, Zhu W, Wei L, Zhao J.
In-Text Gene Mentions

On the one hand, It was demonstrated that mutation of HTT upregulates the protein related to iron import, such as IRP1, Tf, and TfR, leading to iron accumulation in the striatum and cortex of HD mice.211

Show Full Abstract

Brain iron homeostasis is maintained through the normal function of blood-brain barrier and iron regulation at the systemic and cellular levels, which is fundamental to normal brain function. Excess iron can catalyze the generation of free radicals through Fenton reactions due to its dual redox state, thus causing oxidative stress. Numerous evidence has indicated brain diseases, especially stroke and neurodegenerative diseases, are closely related to the mechanism of iron homeostasis imbalance in the brain. For one thing, brain diseases promote brain iron accumulation. For another, iron accumulation amplifies damage to the nervous system and exacerbates patients' outcomes. In addition, iron accumulation triggers ferroptosis, a newly discovered iron-dependent type of programmed cell death, which is closely related to neurodegeneration and has received wide attention in recent years. In this context, we outline the mechanism of a normal brain iron metabolism and focus on the current mechanism of the iron homeostasis imbalance in stroke, Alzheimer's disease, and Parkinson's disease. Meanwhile, we also discuss the mechanism of ferroptosis and simultaneously enumerate the newly discovered drugs for iron chelators and ferroptosis inhibitors.

BTN2A2
Also flagged:methylationtumorclear cell renal cell carcinomaccRCC-methylcytosine5-methylcytosine
Journal Article 2023-06-26 ✓ 1 Snippet Gui CP, Wei JH, Zhang C, Tang YM, Shu GN, Wu RP, Luo JH.
In-Text Gene Mentions

…BCL2, BIRC3 andBTN2A2, were highly…

Show Full Abstract

Clear cell Renal Cell Carcinoma (ccRCC) is a highly heterogeneous disease, making it challenging to predict prognosis and therapy efficacy. In this study, we aimed to explore the role of 5-methylcytosine (m5C) RNA modification in ccRCC and its potential as a predictor for therapy response and overall survival (OS). We established a novel 5-methylcytosine RNA modification-related gene index (M5CRMRGI) and studied its effect on the tumor microenvironment (TME) using single-cell sequencing data for in-depth analysis, and verified it using spatial sequencing data. Our results showed that M5CRMRGI is an independent predictor of OS in multiple datasets and exhibited outstanding performance in predicting the OS of ccRCC. Distinct mutation profiles, hallmark pathways, and infiltration of immune cells in TME were observed between high- and low-M5CRMRGI groups. Single-cell/spatial transcriptomics revealed that M5CRMRGI could reprogram the distribution of tumor-infiltrating immune cells. Moreover, significant differences in tumor immunogenicity and tumor immune dysfunction and exclusion (TIDE) were observed between the two risk groups, suggesting a better response to immune checkpoint blockade therapy of the high-risk group. We also predicted six potential drugs binding to the core target of the M5CRMRGI signature via molecular docking. Real-world treatment cohort data proved once again that high-risk patients were appropriate for immune checkpoint blockade therapy, while low-risk patients were appropriate for Everolimus. Our study shows that the m5C modification landscape plays a role in TME distribution. The proposed M5CRMRGI-guided strategy for predicting survival and immunotherapy efficacy, we reported here, might also be applied to more cancers other than ccRCC.

OLFM4
Also flagged:deathischemic strokeIS-ferroptosispyroptosis
Journal Article 2023-06-26 ✓ 2 Snippets Chen W, Chen Y, Wu L, Gao Y, Zhu H, Li Y, Ji X, Wang Z, Wang W, Han L, Zhu B, Wang H, Xu M.
In-Text Gene Mentions

…female ADEGs (namelyOLFM4, PDK4, CEACAM6, and…

…cells resting”, whileOLFM4and CEACAM6 were…

Show Full Abstract

<h4>Background</h4>Stroke is the second leading cause of death and the third leading cause of disability worldwide, with ischemic stroke (IS) being the most prevalent. A substantial number of irreversible brain cell death occur in the short term, leading to impairment or death in IS. Limiting the loss of brain cells is the primary therapy target and a significant clinical issue for IS therapy. Our study aims to establish the gender specificity pattern from immune cell infiltration and four kinds of cell-death perspectives to improve IS diagnosis and therapy.<h4>Methods</h4>Combining and standardizing two IS datasets (GSE16561 and GSE22255) from the GEO database, we used the CIBERSORT algorithm to investigate and compare the immune cell infiltration in different groups and genders. Then, ferroptosis-related differently expressed genes (FRDEGs), pyroptosis-related DEGs (PRDEGs), anoikis-related DEGs (ARDEGs), and cuproptosis-related DEGs (CRDEGs) between the IS patient group and the healthy control group were identified in men and women, respectively. Machine learning (ML) was finally used to generate the disease prediction model for cell death-related DEGs (CDRDEGs) and to screen biomarkers related to cell death involved in IS.<h4>Results</h4>Significant changes were observed in 4 types of immune cells in male IS patients and 10 types in female IS patients compared with healthy controls. In total, 10 FRDEGs, 11 PRDEGs, 3 ARDEGs, and 1 CRDEG were present in male IS patients, while 6 FRDEGs, 16 PRDEGs, 4 ARDEGs, and 1 CRDEG existed in female IS patients. ML techniques indicated that the best diagnostic model for both male and female patients was the support vector machine (SVM) for CDRDEG genes. SVM's feature importance analysis demonstrated that SLC2A3, MMP9, C5AR1, ACSL1, and NLRP3 were the top five feature-important CDRDEGs in male IS patients. Meanwhile, the PDK4, SCL40A1, FAR1, CD163, and CD96 displayed their overwhelming influence on female IS patients.<h4>Conclusion</h4>These findings contribute to a better knowledge of immune cell infiltration and their corresponding molecular mechanisms of cell death and offer distinct clinically relevant biological targets for IS patients of different genders.

HTT
Also flagged:ExtracellularvesiclesHuntington's diseaseHDsynapsesynaptopathy
Journal Article 2023-06-26 ✓ 3 Snippets Beatriz M, Rodrigues RJ, Vilaça R, Egas C, Pinheiro PS, Daley GQ, Schlaeger TM, Raimundo N, Rego AC, Lopes C.
In-Text Gene Mentions

Both wild type (WT) and mutant forms of huntingtin (HTT) were shown to interact with KCC2, a Cl- cotransporter that promotes GABAergic inhibitory signaling, with a decrease in its expression leading to an over-excitation in the hippocampus of an HD mouse model 11.

…the affinity ofHTT-associated protein 1protein 1 for…

…MAB1574, Millipore), and anti-HTT(1:150, #MAB2166, Millipore),…

Show Full Abstract

<b>Background:</b> Extracellular vesicles (EVs) carry bioactive molecules associated with various biological processes, including miRNAs. In both Huntington's disease (HD) models and human samples, altered expression of miRNAs involved in synapse regulation was reported. Recently, the use of EV cargo to reverse phenotypic alterations in disease models with synaptopathy as the end result of the pathophysiological cascade has become an interesting possibility. <b>Methods:</b> Here, we assessed the contribution of EVs to GABAergic synaptic alterations using a human HD model and studied the miRNA content of isolated EVs. <b>Results:</b> After differentiating human induced pluripotent stem cells into electrophysiologically active striatal-like GABAergic neurons, we found that HD-derived neurons displayed reduced density of inhibitory synapse markers and GABA receptor-mediated ionotropic signaling. Treatment with EVs secreted by control (CTR) fibroblasts reversed the deficits in GABAergic synaptic transmission and increased the density of inhibitory synapses in HD-derived neuron cultures, while EVs from HD-derived fibroblasts had the opposite effects on CTR-derived neurons. Moreover, analysis of miRNAs from purified EVs identified a set of differentially expressed miRNAs between manifest HD, premanifest, and CTR lines with predicted synaptic targets. <b>Conclusion:</b> The EV-mediated reversal of the abnormal GABAergic phenotype in HD-derived neurons reinforces the potential role of EV-miRNAs on synapse regulation.

LRRC7
Also flagged:Aquaporin 4Vasopressinastrocytic volume-regulated anion channelAQP4nucleusglial fibrillary acidic protein
Journal Article 2023-06-26 ✓ 1 Snippet Liu Y, Wang XR, Jiang YH, Li T, Ling S, Wang HY, Yu JW, Jia SW, Liu XY, Hou CM, Parpura V, Wang YF.
In-Text Gene Mentions

…mainly composed ofleucine-rich repeat-containing protein 8repeat-containing protein 8…

Show Full Abstract

We assessed interactions between the astrocytic volume-regulated anion channel (VRAC) and aquaporin 4 (AQP4) in the supraoptic nucleus (SON). Acute SON slices and cultures of hypothalamic astrocytes prepared from rats received hyposmotic challenge (HOC) with/without VRAC or AQP4 blockers. In acute slices, HOC caused an early decrease with a late rebound in the neuronal firing rate of vasopressin neurons, which required activity of astrocytic AQP4 and VRAC. HOC also caused a persistent decrease in the excitatory postsynaptic current frequency, supported by VRAC and AQP4 activity in early HOC; late HOC required only VRAC activity. These events were associated with the dynamics of glial fibrillary acidic protein (GFAP) filaments, the late retraction of which was mediated by VRAC activity; this activity also mediated an HOC-evoked early increase in AQP4 expression and late subside in GFAP-AQP4 colocalization. AQP4 activity supported an early HOC-evoked increase in VRAC levels and its colocalization with GFAP. In cultured astrocytes, late HOC augmented VRAC currents, the activation of which depended on AQP4 pre-HOC/HOC activity. HOC caused an early increase in VRAC expression followed by a late rebound, requiring AQP4 and VRAC, or only AQP4 activity, respectively. Astrocytic swelling in early HOC depended on AQP4 activity, and so did the early extension of GFAP filaments. VRAC and AQP4 activity supported late regulatory volume decrease, the retraction of GFAP filaments, and subside in GFAP-VRAC colocalization. Taken together, astrocytic morphological plasticity relies on the coordinated activities of VRAC and AQP4, which are mutually regulated in the astrocytic mediation of HOC-evoked modulation of vasopressin neuronal activity.

HFE
Also flagged:Hepatocellular CarcinomaTumoralpha-fetoproteinAFPtumorscirrhosis
Journal Article 2023-06-26 ✓ 1 Snippet Shaik MR, Sagar PR, Shaik NA, Randhawa N.
In-Text Gene Mentions

…and, less commonly,hemochromatosis, primary biliary cholangitis,…

Show Full Abstract

Hepatocellular carcinoma (HCC) is an aggressive malignancy with poor outcomes when diagnosed at an advanced stage. Current curative treatments are most effective in early-stage HCC, highlighting the importance of early diagnosis and intervention. However, existing diagnostic methods, such as radiological imaging, alpha-fetoprotein (AFP) testing, and biopsy, have limitations that hinder early diagnosis. AFP elevation is absent in a significant portion of tumors, and imaging may have low sensitivity for smaller tumors or in the presence of cirrhosis. Additionally, as our understanding of the molecular pathogenesis of HCC grows, there is an increasing need for molecular information about the tumors. Biopsy, although informative, is invasive and may not always be feasible depending on tumor location. In this context, liquid biopsy technology has emerged as a promising approach for early diagnosis, enabling molecular characterization and genetic profiling of tumors. This technique involves analyzing circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), or tumor-derived exosomes. CTCs are cancer cells shed from the primary tumor or metastatic sites and circulate in the bloodstream. Their presence not only allows for early detection but also provides insights into tumor metastasis and recurrence. By detecting CTCs in peripheral blood, real-time tumor-related information at the DNA, RNA, and protein levels can be obtained. This article provides an overview of CTCs and explores their clinical significance for early detection, prognosis, treatment selection, and monitoring treatment response in HCC, citing relevant literature.

HFE
Also flagged:sepsisnecrotizing fasciitisgastroenteritissoft tissue infectionwound infectionperitonitis
Journal Article 2023-06-26 ✓ 1 Snippet Alotaibi BS, Ajmal A, Hakami MA, Mahmood A, Wadood A, Hu J.
In-Text Gene Mentions

…disease, kidney disease,hemochromatosis, immune deficiency and…

Show Full Abstract

<i>Vibrio vulnificus</i> is a rod shape, Gram-negative bacterium that causes sepsis (with a greater than 50% mortality rate), necrotizing fasciitis, gastroenteritis, skin, and soft tissue infection, wound infection, peritonitis, meningitis, pneumonia, keratitis, and arthritis. Based on pathogenicity <i>V. vulnificus</i> is categorized into three biotypes. Type 1 and type 3 cause diseases in humans while biotype 2 causes diseases in eel and fish. Due to indiscriminate use of antibiotics <i>V. vulnificus</i> has developed resistance to many antibiotics so curing is dramatically a challenge. <i>V. vulnificus</i> is resistant to cefazolin, streptomycin, tetracycline, aztreonam, tobramycin, cefepime, and gentamycin. Subtractive genome analysis is the most effective method for drug target identification. The method is based on the subtraction of homologous proteins from both pathogen and host. By this process set of proteins present only in the pathogen and perform essential functions in the pathogen can be identified. The entire proteome of <i>Vibrio vulnificus</i> strain ATCC 27562 was reduced step by step to a single protein predicted as the drug target. AlphaFold2 is one of the applications of deep learning algorithms in biomedicine and is correctly considered the game changer in the field of structural biology. Accuracy and speed are the major strength of AlphaFold2. In the PDB database, the crystal structure of the predicted drug target was not present, therefore the Colab notebook was used to predict the 3D structure by the AlphaFold2, and subsequently, the predicted model was validated. Potent inhibitors against the new target were predicted by virtual screening and molecular docking study. The most stable compound ZINC01318774 tightly attaches to the binding pocket of bisphosphoglycerate-independent phosphoglycerate mutase. The time-dependent molecular dynamics simulation revealed compound ZINC01318774 was superior as compared to the standard drug tetracycline in terms of stability. The availability of <i>V. vulnificus</i> strain ATCC 27562 has allowed <i>in silico</i> identification of drug target which will provide a base for the discovery of specific therapeutic targets against <i>Vibrio vulnificus.</i>

DCC
Also flagged:Subclinical mastitismastitisC-reactive proteinCRPinflammatory diseaseChaetoglobosin U
Journal Article 2023-06-26 ✓ 1 Snippet Ali A, Rehman MU, Mushtaq S, Ahmad SB, Khan A, Karan A, Bashir Wani A, Ganie SA, Mir MUR.
In-Text Gene Mentions

…coefficient of variation;DCC: Delaval cell counter;…

Show Full Abstract

Subclinical mastitis (SCM) is a predominant form of mastitis wherein major visible signs of disease are absent. The present study aimed to determine acute phase proteins (APPs) like ferritin, C-reactive protein (CRP), and microalbumin (Malb) in 135 composite milk and serum samples of healthy (<i>n</i> = 25) and SCM (<i>n</i> = 110) cows. As bovine mastitis is an inflammatory disease, the present study also aimed at finding novel anti-inflammatory compounds from natural sources by repurposing approach using computational studies. The findings of the present study revealed substantial elevation (<i>p</i> < 0.001) in milk SCC and an increase in ferritin, CRP, and Malb (<i>p</i> < 0.001) in milk and sera of the SCM group as compared to healthy animals. Receiver operating characteristics of milk SCC, milk, and serum APPs unraveled statistically substantial alteration (<i>p</i> < 0.001). Further, SCC was correlated with milk APPs ferritin (r = 0.26 **, <i>p</i> < 0.002), CRP (r = 0.19 *, <i>p</i> < 0.02), and Malb (r = 0.21 *, <i>p</i> < 0.01). Additionally, milk SCC was correlated with serum ferritin (r = 0.28 **, <i>p</i> < 0.001), CRP (r = 0.16, <i>p</i> > 0.05), and Malb (r = 0.16, <i>p</i> > 0.05). The findings of molecular docking revealed that Chaetoglobosin U was the most effective molecule that showed the highest binding affinity (kcal/mol) of -10.1 and -8.5 against ferritin and albumin. The present study concluded that the estimation of cow-side tests, SCC, and APPs in milk/serum is suitable to detect SCM and screening herd community. Furthermore, Chaetoglobosin U could be developed as a promising anti-inflammatory inhibitor; however, further studies are required to validate these findings.

bioRxiv 2023-06-26 Preprint (No Snippets API) Bragg RM, Coffey SR, Cantle JP, Hu S, Singh S, Legg SR, McHugh CA, Toor A, Zeitlin SO, Kwak S, Howland D, Vogt TF, Monga SP, Carroll JB.
Show Full Abstract

Huntington’s disease arises from a toxic gain of function in the huntingtin ( HTT ) gene. As a result, many HTT-lowering therapies are being pursued in clinical studies, including those that reduce HTT RNA and protein expression in the liver. To investigate potential impacts, we characterized molecular, cellular, and metabolic impacts of chronic HTT lowering in mouse hepatocytes. Lifelong hepatocyte HTT loss is associated with multiple physiological changes, including increased circulating bile acids, cholesterol and urea, hypoglycemia, and impaired adhesion. HTT loss causes a clear shift in the normal zonal patterns of liver gene expression, such that pericentral gene expression is reduced. These alterations in liver zonation in livers lacking HTT are observed at the transcriptional, histological and plasma metabolite level. We have extended these phenotypes physiologically with a metabolic challenge of acetaminophen, for which the HTT loss results in toxicity resistance. Our data reveal an unexpected role for HTT in regulating hepatic zonation, and we find that loss of HTT in hepatocytes mimics the phenotypes caused by impaired hepatic β-catenin function. <h4>Graphical Abstract</h4>

Research Square 2023-06-26 Preprint (No Snippets API) Caminiti SP, Galli A, Jonghi-Lavarini L, Boccalini C, Nicastro N, Garibotto V, Perani D.
Show Full Abstract

<title>Abstract</title> <p><bold>Background:</bold> Early- and late-onset dementia with Lewy bodies (EO-DLB and LO-DLB) are similar in terms of core symptoms. However, LO-DLB presents with more amnestic deficits, while EO-DLB shows a rapid cognitive decline and more severe neuropsychiatric symptoms at onset. A contribution of neurotransmitter dysfunction was suggested but never explored, as a possible factor contributing to the reported clinical differences. By using FDG-PET brain metabolism imaging, we aimed to assess the differences between EO-DLB and LO-DLB regarding brain hypometabolism, related neurotransmitter functional topography, and metabolic connectivity. <bold>Methods:</bold> We included a total of 62 patients, 21 EO-DLB and 41 LO-DLB patients. Statistical parametric mapping (SPM) voxel-wise comparison with a validated dataset of healthy controls (N=112) provided brain hypometabolism patterns. A metabolic connectivity analysis assessed whole-brain and resting-state network (RSN) alterations. Furthermore, we used the JuSpace toolbox to evaluate the correlations between neurotransmitter pathways topography and brain hypometabolism. <bold>Results:</bold> Both EO- and LO-DLB groups showed typical bilateral occipito-parieto-frontal hypometabolism. Direct between-group comparison revealed a more severe hypometabolism in posterior cingulate cortex (PCC), precuneus, and occipital cortex for EO-DLB and a more severe hypometabolism in fronto-insular cortices for LO-DLB. Metabolic connectivity analysis showed significant reductions in posterior brain regions in both clinical groups compared to controls, as well as connectivity increases in the EO-DLB only. There were differences in the involvement of temporo-parietal and occipital pathological nodes. Specific RSN vulnerabilities were observed in the executive, default mode and limbic networks for EO-DLB and in the attentional network for LO-DLB. The spatial association analysis based on the metabolic differences in neurotransmission showed significant correlations with acetylcholine, gamma-aminobutyric acid (GABA), serotonin, dopamine maps, and hypometabolism in both EO and LO-DLB groups. Of note, the between-group comparison showed a higher correlation for the EO-DLB in the presynaptic serotonergic system. Overall, this indicates the biochemical involvement of metabolic impairment. <bold>Conclusions:</bold> This metabolic imaging study indicates similarities and differences between EO- and LO-DLB, both in terms of brain hypometabolism, across different neurotransmission networks, and altered connectivity, adding novel biological evidence to the DLB syndromes.</p>

bioRxiv 2023-06-26 Preprint (No Snippets API) Laundos TL, Li S, Cheang E, Santis RD, Piccolo FM, Brivanlou AH.
Show Full Abstract

Huntington’s disease (HD) remains an incurable and fatal neurodegenerative disease long after CAG-expansion mutation in the huntingtin gene (HTT) was identified as the cause. The underlying pathological mechanism, whether HTT loss of function or gain of toxicity results from mutation, remains a matter of debate. In this study, we genetically modulated wild-type or mutant HTT expression levels in isogenic human embryonic stem cells to systematically investigate their contribution to HD-specific phenotypes. Using highly reproducible and quantifiable in vitro micropattern-based assays, we observed comparable phenotypes with HD mutation and HTT depletion. However, halving endogenous wild-type HTT levels did not strongly recapitulate the HD phenotypes, arguing against a classical loss of function mechanism. Remarkably, expression of CAG-expanded HTT in non-HD cells induced HD-like phenotypes akin to HTT depletion. By corollary, these results indicate a dominant negative effect of mutated HTT on its wild-type counterpart. Complementation with additional copies of wild-type HTT ameliorated the HD-associated phenotypes, strongly supporting a classical dominant negative mechanism. Understanding the molecular basis of this dominant negative effect will guide the development of efficient clinical strategies to counteract the deleterious impact of mutant HTT on the wild-type protein.

OLFM4
Also flagged:olfactomedin 4olfactomedinPU.1 difference product 4PU.1transcription factorchromosome
Journal Article 2023-06-25 ✓ 5 Snippets Li H, Chaitankar V, Cui L, Chen W, Chin K, Zhu J, Liu W, Rodgers GP.
In-Text Gene Mentions

Studies using a conventional Olfm4 knockout mouse model have demonstrated that Olfm4 plays critical roles in innate immunity, inflammation, cancers, and obesity10–14.

It has been reported that OLFM4+ cells in the urethral luminal epithelium were increased in human benign prostatic hyperplasia (BPH) and survive treatment with 5-a-reductase inhibitor (5ARI), which inhibits the conversion of testosterone to dihydrotestosterone27.

Because of findings that OLFM4 is expressed in both mouse and human urethral luminal epithelial cells, Olfm4 mouse model may be useful for BPH preclinical studies.

The Olfm4eGFP reporter mouse model described here provides a novel tool for studying biological functions of Olfm4 in murine tissues and could be used to further understand the role of OLFM4+ cells during normal human development and disease progression, including in prostatic diseases such as BPH and prostate cancer.

…olfactomedin 4 (OLFM4) gene is…

Show Full Abstract

Olfactomedin4 (Olfm4) is expressed in normal mouse prostate. However, Olfm4+ cells in the murine prostate have not been well characterized. In this study, we generated an Olfm4<sup>eGFP</sup> reporter mouse line with C57BL/6 mice and investigated the distribution of Olfm4/eGFP-expressing cells during postnatal development from P1, P7, P14, P20, P42, P56 to adult male mouse prostate and urethral tube. We observed Olfm4/eGFP expression in urogenital and prostatic epithelial cells during early postnatal development, which persisted into adulthood in urethral-tube and anterior-prostate (AP) epithelium. We found Olfm4+ cells are E-cadherin+/CD44+/Foxa1+ and some of subpopulation are Ck8+/Ck5+/Sca-1-/Ck4-/Syn- in the adult mouse AP epithelium. Functional studies of single-cell preparations of Olfm4/eGFP-expressing cells isolated from adult Olfm4<sup>eGFP</sup> mouse prostate demonstrated that Olfm4+ cells can grow and form colonies, spheres, or organoids in culture. Bioinformatic analysis of Olfm4+ cells using single-cell RNA sequencing meta data in adult mouse urethra (GSE145865) identified upregulation of genes related to cell and tissue migration and development, as well as upregulation of xenobiotic metabolism signaling pathways. In conclusion, Olfm4<sup>eGFP</sup> mouse is a novel model to further study Olfm4's biological functions and Olfm4+ cells may contribute importantly to cellular processes supporting development and homeostasis of the epithelium in murine prostate and urethral tube.

Also flagged:α-Glucosidasesesquiterpenoidsethylacetatemansonone Uheliclactone
Journal Article 2023-06-25 No Snippets Le HTT, Hioki Y, Danova A, Nguyen VK, Duong TH, Kita M, Chavasiri W.
Show Full Abstract

Nine undescribed sesquiterpenoids, along with ten known compounds, were isolated from the ethyl acetate extract of Mansonia gagei heartwood. Their structures were determined by spectroscopic data analysis (FTIR, 1D, 2D NMR, and HRESIMS), and their absolute configurations were established by ECD calculation. The isolated compounds were evaluated for their inhibitory effect against α-glucosidase from yeast. The results showed that mansonone U, mansonialactam, heliclactone and mansonone S exhibited exceptionally potent activities when compared to the positive control, acarbose, with IC<sub>50</sub> values of 12.38 ± 0.71, 0.20 ± 0.05, 13.12 ± 2.85, and 12.05 ± 1.91 μM, respectively. Among them, mansonialactam possessed the most potent inhibitory activity against yeast α-glucosidase, and it showed an uncompetitive inhibition mode.

BTN2A2
Also flagged:Igpathogenesisautoimmune diseasesMultiple sclerosisMSautoimmune disease of the
Journal Article 2023-06-25 ✓ 5 Snippets Huang Y, Han F, Li J, Li Y, Gao J, Lai L, Luo P, Su M, Hu R.
In-Text Gene Mentions

Our studies not only provide new insights into the mechanisms by which BTN2A2-Ig affects T cells, but also have the potential to provide a new strategy to treat MS and other autoimmune diseases.

Although the recombinant BTN2A2-IgG2aFc (BTN2A2-Ig) fusion protein has been shown to inhibit T cell functions in vitro, it's unclear whether BTN2A2-Ig affects pathogenic Th17 cells and EAE development.

BTN2A2-Ig protein inhibits the differentiation of pathogenic Th17 cells and attenuates EAE in mice.

We show here that BTN2A2-Ig protein attenuates established EAE, as compared with control Ig protein treatment.

This is associated with reduced activation and proliferation of T cells in BTN2A2-Ig-treated EAE mice.

Show Full Abstract

Pathogenic Th17 cells play a key role in the pathogenesis of many autoimmune diseases. Multiple sclerosis (MS) is an autoimmune disease of the central nervous system (CNS). Experimental autoimmune encephalomyelitis (EAE) is the commonly used animal model for human MS and is characterized by autoreactive CD4<sup>+</sup>T cells attacking autoantigens in the CNS and causing myelin sheath damage. Although the recombinant BTN2A2-IgG2aFc (BTN2A2-Ig) fusion protein has been shown to inhibit T cell functions in vitro, it's unclear whether BTN2A2-Ig affects pathogenic Th17 cells and EAE development. We show here that BTN2A2-Ig protein attenuates established EAE, as compared with control Ig protein treatment. This is associated with reduced activation and proliferation of T cells in BTN2A2-Ig-treated EAE mice. Furthermore, BTN2A2-Ig protein inhibits the differentiation of CD4 naïve T cells into pathogenic Th17 cells and reduces the expression levels of Th1/Th17 cytokines and the Th1/Th17 pathway related genes and proteins but increases the expression levels of Th2-related genes and proteins. Our studies not only provide new insights into the mechanisms by which BTN2A2-Ig affects T cells, but also have the potential to provide a new strategy to treat MS and other autoimmune diseases.

TNFSF4
Also flagged:hepatocellular carcinomaimmune responseRRM2Cancergene expressionliver cancer
Journal Article 2023-06-25 ✓ 2 Snippets Li Q, Long X, Lin Y, Liang R, Li Y, Ge L.
In-Text Gene Mentions

…CD48 , andTNFSF4(P<0.001) ( Figure…

…CD86, CD48, andTNFSF4(P<0.001).…

Show Full Abstract

<h4>Background</h4>Radiomics can be used to noninvasively predict molecular markers to address the clinical dilemma that some patients cannot accept invasive procedures. This research evaluated the prognostic significance of the expression level of ribonucleotide reductase regulatory subunit M2 (<i>RRM2</i>) in individuals with hepatocellular carcinoma (HCC) and established a radiomics model for predicting the <i>RRM2</i> expression level.<h4>Methods</h4>Genomic data for HCC patients and corresponding computed tomography (CT) images were accessed at The Cancer Genome Atlas (TCGA) and The Cancer Imaging Archive (TCIA), which were utilized for prognosis analysis, radiomic feature extraction and model construction, respectively. The maximum relevance minimum redundancy algorithm (mRMR) and recursive feature elimination (RFE) were used for feature selection. Following feature extraction, a logistic regression algorithm was fitted to establish a dichotomous model that predicts <i>RRM2</i> gene expression. Establishment of the radiomics nomogram was carried out using the Cox regression model. Receiver operating characteristic (ROC) curve analysis was employed to assess the model performance. Clinical utility was determined by decision curve analysis (DCA).<h4>Results</h4>High <i>RRM2</i> expression acted as a risk factor for overall survival (OS) [hazard ratio (HR) =2.083, P<0.001] and was implicated in regulation of the immune response. Four optimal radiomics features were selected for prediction of <i>RRM2</i> expression. A predictive nomogram was established using the clinical variables and radiomics score (RS), and the areas under the ROC curve (AUCs) of the time-dependent ROC curve of the model were 0.836, 0.757, and 0.729 for the 1-, 3-, and 5-year periods, respectively. DCA confirmed that the nomogram had good clinical usefulness.<h4>Conclusions</h4>The <i>RRM2</i> expression level in HCC can considerably affect prognosis of these patients. Expression levels of <i>RRM2</i> and prognosis of HCC individuals can be predicted through radiomics features by utilizing CT scan data.

HFE
Also flagged:Ferritinsteroid-resistant nephrotic syndromeHDanemiaend-stage renal diseaseESRD
Journal Article 2023-06-25 ✓ 1 Snippet Onder AM, Ansari MAY, Deng F, Grinsell MM, Patterson L, Jetton J, Fathallah-Shaykh S, Ranch D, Aviles D, Copelovitch L, Ellis E, Chadha V, Elmaghrabi A, Lin JJ, Butani L, Haddad M, Marsenic O, Brakeman P, Quigley R, Shin HS, Garro R, Raina R, Langman CB.
In-Text Gene Mentions

…ncerns for dialysis-associatedhemochromatosisand dangerously elevated…

Show Full Abstract

Our objective was to examine serum ferritin trends after conversion to permanent vascular access (PVA) among children who started hemodialysis (HD) using tunneled cuffed catheters (TCC). Retrospective chart reviews were completed on 98 subjects from 20 pediatric HD centers. Serum ferritin levels were collected at the creation of PVA and for two years thereafter. There were 11 (11%) arteriovenous grafts (AVG) and 87 (89%) arteriovenous fistulae (AVF). Their mean TCC use was 10.4 ± 17.3 months. Serum ferritin at PVA creation was elevated at 562.64 ± 492.34 ng/mL, increased to 753.84 ± 561.54 ng/mL (<i>p</i> = < 0.001) in the first year and remained at 759.60 ± 528.11 ng/mL in the second year (<i>p</i> = 0.004). The serum ferritin levels did not show a statistically significant linear association with respective serum hematocrit values. In a multiple linear regression model, there were three predictors of serum ferritin during the first year of follow-up: steroid-resistant nephrotic syndrome as primary etiology (<i>p</i> = 0.035), being from a center that enrolled >10 cases (<i>p</i> = 0.049) and baseline serum ferritin level (<i>p</i> = 0.017). Increasing serum ferritin after conversion to PVA is concerning. This increase is not associated with serum hematocrit trends. Future studies should investigate the correlation of serum transferrin saturation and ferritin levels in pediatric HD patients.

HTT
Also flagged:Neurodegenerative DiseasesWntneurogenesiscell proliferationcalciumcell migration
Journal Article 2023-06-25 ✓ 1 Snippet Ramakrishna K, Nalla LV, Naresh D, Venkateswarlu K, Viswanadh MK, Nalluri BN, Chakravarthy G, Duguluri S, Singh P, Rai SN, Kumar A, Singh V, Singh SK.
In-Text Gene Mentions

…HEK293 cells withhtt-480-17Q, thereby increasing t…

Show Full Abstract

Wnt/β-catenin (WβC) signaling pathway is an important signaling pathway for the maintenance of cellular homeostasis from the embryonic developmental stages to adulthood. The canonical pathway of WβC signaling is essential for neurogenesis, cell proliferation, and neurogenesis, whereas the noncanonical pathway (WNT/Ca<sup>2+</sup> and WNT/PCP) is responsible for cell polarity, calcium maintenance, and cell migration. Abnormal regulation of WβC signaling is involved in the pathogenesis of several neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), and spinal muscular atrophy (SMA). Hence, the alteration of WβC signaling is considered a potential therapeutic target for the treatment of neurodegenerative disease. In the present review, we have used the bibliographical information from PubMed, Google Scholar, and Scopus to address the current prospects of WβC signaling role in the abovementioned neurodegenerative diseases.

HFE
Also flagged:CardiomyopathyAdrenal PheochromocytomaTakotsubo cardiomyopathystress cardiomyopathybroken heart syndromeleft ventricular dysfunction
Journal Article 2023-06-25 ✓ 1 Snippet Ahmad H, Jannat H, Khan U, Ahmad N.
In-Text Gene Mentions

…s, thyroid-related conditions,hemochromatosis, alcoholism, and toxic…

Show Full Abstract

Takotsubo cardiomyopathy (TTC), also known as stress cardiomyopathy or broken heart syndrome, is a condition characterized by transient left ventricular dysfunction resembling myocardial infarction but without obstructive coronary artery disease. We present a rare case of a 59-year-old patient with cardiogenic shock (CS) caused by reverse TTC triggered by an undiagnosed right adrenal pheochromocytoma tumor. The patient initially presented with chronic headaches and difficulty breathing, and their condition rapidly deteriorated, necessitating intubation and inotropic support. Diagnostic tests confirmed the diagnosis of reverse TTC, and further investigation revealed an actively growing adrenal mass suggestive of a pheochromocytoma. The patient responded well to treatments, including the use of intra-aortic balloon pump support and subsequent weaning. A right adrenalectomy confirmed the presence of a pheochromocytoma. This case highlights the association between pheochromocytoma and reverse TTC, emphasizing the need to consider this rare etiology in patients presenting with CS. Long-term monitoring is crucial due to the risk of recurrence, even after tumor removal.

GPR52
Also flagged:CyanotoxinsNonalcoholic Fatty Liver Diseasewaterunfolded protein responsemicrocystin-LRNOD
Journal Article 2023-06-25 ✓ 5 Snippets Niture S, Niture S, Gadi S, Qi Q, Rios-Colon L, Khatiwada S, Vandana, Fernando RA, Levine KE, Kumar D.
In-Text Gene Mentions

…SLAMF9, TTC-36 ,GPR52, CAPZA3 ,…

…upregulated TEC ,GPR52, GSC ,…

…, SLAMF9 ,GPR52, CAPZA3 ,…

…downregulated PRAMEF14 andGPR52genes.…

…downregulated PRAMEF14 ,GPR52, CAPZA3 ,…

Show Full Abstract

Freshwater prokaryotic cyanobacteria within harmful algal blooms produce cyanotoxins which are considered major pollutants in the aquatic system. Direct exposure to cyanotoxins through inhalation, skin contact, or ingestion of contaminated drinking water can target the liver and may cause hepatotoxicity. In the current study, we investigated the effect of low concentrations of cyanotoxins on cytotoxicity, inflammation, modulation of unfolded protein response (UPR), steatosis, and fibrosis signaling in human hepatocytes and liver cell models. Exposure to low concentrations of microcystin-LR (MC-LR), microcystin-RR (MC-RR), nodularin (NOD), and cylindrospermopsin (CYN) in human bipotent progenitor cell line HepaRG and hepatocellular carcinoma (HCC) cell lines HepG2 and SK-Hep1 resulted in increased cell toxicity. MC-LR, NOD, and CYN differentially regulated inflammatory signaling, activated UPR signaling and lipogenic gene expression, and induced cellular steatosis and fibrotic signaling in HCC cells. MC-LR, NOD, and CYN also regulated AKT/mTOR signaling and inhibited autophagy. Chronic exposure to MC-LR, NOD, and CYN upregulated the expression of lipogenic and fibrosis biomarkers. Moreover, RNA sequencing (RNA seq) data suggested that exposure of human hepatocytes, HepaRG, and HCC HepG2 cells to MC-LR and CYN modulated expression levels of several genes that regulate non-alcoholic fatty liver disease (NAFLD). Our data suggest that low concentrations of cyanotoxins can cause hepatotoxicity and cell steatosis and promote NAFLD progression.

Also flagged:infectious diseasestumorsinfectioncalcium phosphatespseudoarthrosishost
Journal Article 2023-06-25 No Snippets Chinnasami H, Dey MK, Devireddy R.
Show Full Abstract

Immobilization using external or internal splints is a standard and effective procedure to treat minor skeletal fractures. In the case of major skeletal defects caused by extreme trauma, infectious diseases or tumors, the surgical implantation of a bone graft from external sources is required for a complete cure. Practical disadvantages, such as the risk of immune rejection and infection at the implant site, are high in xenografts and allografts. Currently, an autograft from the iliac crest of a patient is considered the "gold standard" method for treating large-scale skeletal defects. However, this method is not an ideal solution due to its limited availability and significant reports of morbidity in the harvest site (30%) as well as the implanted site (5-35%). Tissue-engineered bone grafts aim to create a mechanically strong, biologically viable and degradable bone graft by combining a three-dimensional porous scaffold with osteoblast or progenitor cells. The materials used for such tissue-engineered bone grafts can be broadly divided into ceramic materials (calcium phosphates) and biocompatible/bioactive synthetic polymers. This review summarizes the types of materials used to make scaffolds for cryo-preservable tissue-engineered bone grafts as well as the distinct methods adopted to create the scaffolds, including traditional scaffold fabrication methods (solvent-casting, gas-foaming, electrospinning, thermally induced phase separation) and more recent fabrication methods (fused deposition molding, stereolithography, selective laser sintering, Inkjet 3D printing, laser-assisted bioprinting and 3D bioprinting). This is followed by a short summation of the current osteochondrogenic models along with the required scaffold mechanical properties for in vivo applications. We then present a few results of the effects of freezing and thawing on the structural and mechanical integrity of PLLA scaffolds prepared by the thermally induced phase separation method and conclude this review article by summarizing the current regulatory requirements for tissue-engineered products.

Also flagged:Hyaluronic AcidCyclodextrinCD44 receptor3propylaminepaclitaxel
Journal Article 2023-06-25 No Snippets Lee E, Lee ES.
Show Full Abstract

In this study, we fabricated γ-cyclodextrin (γCD)-based nanoparticles (NPs) for dual antitumor therapy. First, γCD (the backbone biopolymer) was chemically conjugated with low-molecular-weight hyaluronic acid (HA; a tumoral CD44 receptor-targeting molecule) and 3-(diethylamino)propylamine (DEAP; a pH-responsive molecule), termed as γCD-(DEAP/HA). The obtained γCD-(DEAP/HA) self-assembled in aqueous solution, producing the γCD-(DEAP/HA) NPs. These NPs efficiently entrapped paclitaxel (PTX; an antitumor drug) and triiron dodecacarbonyl (FeCO; an endogenous cytotoxic gas molecule) via hydrophobic interactions between PTX and FeCO with the unprotonated DEAP molecules in γCD-(DEAP/HA) and a possible host-guest interaction in the γCD rings. The release of PTX and FeCO from the NPs resulted from particle destabilization at endosomal pH, probably owing to the protonation of DEAP in the NPs. In vitro studies using MCF-7 tumor cells demonstrated that these NPs were efficiently internalized by the cells expressing CD44 receptors and enhanced PTX/FeCO-mediated tumor cell apoptosis. Importantly, local light irradiation of FeCO stimulated the generation of cytotoxic CO, resulting in highly improved tumor cell death. We expect that these NPs have potential as dual-modal therapeutic candidates with enhanced antitumor activity in response to acidic pH and local light irradiation.

Also flagged:antibodyMKI67major histocompatibility compleximmunoglobulin(Ig) Minterferon
Journal Article 2023-06-24 No Snippets Duan M, Nguyen DC, Joyner CJ, Saney CL, Tipton CM, Andrews J, Lonial S, Kim C, Hentenaar I, Kosters A, Ghosn E, Jackson A, Knechtle S, Maruthamuthu S, Chandran S, Martin T, Rajalingam R, Vincenti F, Breeden C, Sanz I, Gibson G, Lee FE.
Show Full Abstract

Human bone marrow (BM) plasma cells are heterogeneous, ranging from newly arrived antibody-secreting cells (ASCs) to long-lived plasma cells (LLPCs). We provide single-cell transcriptional resolution of 17,347 BM ASCs from five healthy adults. Fifteen clusters are identified ranging from newly minted ASCs (cluster 1) expressing MKI67 and high major histocompatibility complex (MHC) class II that progress to late clusters 5-8 through intermediate clusters 2-4. Additional ASC clusters include the following: immunoglobulin (Ig) M predominant (likely of extra-follicular origin), interferon responsive, and high mitochondrial activity. Late ASCs are distinguished by G2M checkpoints, mammalian target of rapamycin (mTOR) signaling, distinct metabolic pathways, CD38 expression, utilization of tumor necrosis factor (TNF)-receptor superfamily members, and two distinct maturation pathways involving TNF signaling through nuclear factor κB (NF-κB). This study provides a single-cell atlas and molecular roadmap of LLPC maturation trajectories essential in the BM microniche. Altogether, understanding BM ASC heterogeneity in health and disease enables development of new strategies to enhance protective ASCs and to deplete pathogenic ones.

OLFM4
Also flagged:colorectal cancertumorCancerreverse transcriptiontumorsMAPK
Journal Article 2023-06-24 ✓ 4 Snippets Ke H, Li Z, Li P, Ye S, Huang J, Hu T, Zhang C, Yuan M, Chen Y, Wu X, Lan P.
In-Text Gene Mentions

…for C05; andOLFM4for C06 (…

…epithelial cells, andOLFM4+ malignant epithelial…

…MKI67 + orOLFM4+ malignant epithelial…

…In addition,OLFM4+ malignant epithelial…

Show Full Abstract

<h4>Background</h4>Tumor heterogeneity is contributed by tumor cells and the microenvironment. Dynamics of tumor heterogeneity during colorectal cancer (CRC) progression have not been elucidated.<h4>Methods</h4>Eight single-cell RNA sequencing (scRNA-seq) data sets of CRC were included. Milo was utilized to reveal the differential abundance of cell clusters during progression. The differentiation trajectory was imputed by using the Palantir algorithm and metabolic states were assessed by using scMetabolism. Three spatial transcription sequencing (ST-seq) data sets of CRC were used to validate cell-type abundances and colocalization. Cancer-associated regulatory hubs were defined as communication networks affecting tumor biological behaviors. Finally, quantitative reverse transcription polymerase chain reaction and immunohistochemistry staining were performed for validation.<h4>Results</h4>TM4SF1<sup>+</sup>, SOX4<sup>+</sup>, and MKI67<sup>+</sup> tumor cells; CXCL12<sup>+</sup> cancer-associated fibroblasts; CD4<sup>+</sup> resident memory T cells; Treg; IgA<sup>+</sup> plasma cells; and several myeloid subsets were enriched in stage IV CRC, most of which were associated with overall survival of patients. Trajectory analysis indicated that tumor cells from patients with advanced-stage CRC were less differentiated, when metabolic heterogeneity showed a highest metabolic signature in terminal states of stromal cells, T cells, and myeloid cells. Moreover, ST-seq validated cell-type abundance in a spatial context and also revealed the correlation of immune infiltration between tertiary lymphoid structures and tumors followed by validation in our cohort. Importantly, analysis of cancer-associated regulatory hubs revealed a cascade of activated pathways including leukocyte apoptotic process, MAPK pathway, myeloid leukocyte differentiation, and angiogenesis during CRC progression.<h4>Conclusions</h4>Tumor heterogeneity was dynamic during progression, with the enrichment of immunosuppressive Treg, myeloid cells, and fibrotic cells. The differential state of tumor cells was associated with cancer staging. Assessment of cancer-associated regulatory hubs suggested impaired antitumor immunity and increased metastatic ability during CRC progression.

Also flagged:amikacinTigecyclineLinezolidImipeneminfectionnon-tuberculous mycobacterial pulmonary infections
Journal Article 2023-06-24 No Snippets Dedrick RM, Abad L, Storey N, Kaganovsky AM, Smith BE, Aull HA, Cristinziano M, Morkowska A, Murthy S, Loebinger MR, Hatfull GF, Satta G.
Show Full Abstract

<h4>Objectives</h4>Mycobacterium abscessus complex is responsible for 2.6-13.0% of all non-tuberculous mycobacterial pulmonary infections and these are notoriously difficult to treat due to the complex regimens required, drug resistance and adverse effects. Hence, bacteriophages have been considered in clinical practice as an additional treatment option. Here, we evaluated antibiotic and phage susceptibility profiles of M. abscessus clinical isolates. Whole-genome sequencing (WGS) revealed the phylogenetic relationships, dominant circulating clones (DCCs), the likelihood of patient-to-patient transmission and the presence of prophages.<h4>Methods</h4>Antibiotic susceptibility testing was performed using CLSI breakpoints (n = 95), and plaque assays were used for phage susceptibility testing (subset of n = 88, 35 rough and 53 smooth morphology). WGS was completed using the Illumina platform and analysed using Snippy/snp-dists and Discovery and Extraction of Phages Tool (DEPhT).<h4>Results</h4>Amikacin and Tigecycline were the most active drugs (with 2 strains resistant to amikacin, and one strain with Tigecycline MIC of 4 μg/mL). Most strains were resistant to all other drugs tested, with Linezolid and Imipenem showing the least resistance, at 38% (36/95) and 55% (52/95), respectively. Rough colony morphotype strains were more phage-susceptible than smooth strains (77%-27/35 versus 48%-25/53 in the plaque assays, but smooth strains are not killed efficiently by those phages in liquid infection assay). We have also identified 100 resident prophages, some of which were propagated lytically. DCC1 (20%-18/90) and DCC4 (22%-20/90) were observed to be the major clones and WGS identified 6 events of possible patient-to-patient transmission.<h4>Discussion</h4>Many strains of M. abscessus complex are intrinsically resistant to available antibiotics and bacteriophages represent an alternative therapeutic option, but only for strains with rough morphology. Further studies are needed to elucidate the role of hospital-borne M. abscessus transmission.

HTT
Also flagged:obsessive-compulsive disorderneuropsychiatric disordersBDNFCOMTMAOSMAD4
Journal Article 2023-06-24 ✓ 1 Snippet Wang L, Chen Y, Wang M, Zhao C, Qiao D.
In-Text Gene Mentions

…(BDNF, COMT, MAO,5-HTT, SMAD4, PGRN, and…

Show Full Abstract

<h4>Background</h4>Gene-environment interaction (G × E) refers to the change of genetic effects under the participation of environmental factors resulting in differences in genetic expression. G × E has been studied in the occurrence and development of many neuropsychiatric disorders, including obsessive-compulsive disorder (OCD).<h4>Aim</h4>A systematic review was conducted to investigate the role of G × E plays in OCD. This review explored the relationship between G × E and the susceptibility to OCD occurrence, disease progression, and treatment response.<h4>Methods</h4>This systematic literature search was performed using Web of Science, PubMed, Cochrane Library, and CNKI. Seven studies were selected, which included seven genes (BDNF, COMT, MAO, 5-HTT, SMAD4, PGRN, and SLC1A1) polymorphisms, polygenic risk score (PRS), and two environmental factors (childhood trauma and stressful life events).<h4>Results</h4>Information from this systematic review indicated that G × E increased the susceptibility to OCD, played a crucial role in the clinical characteristics, and had an inconsistent impact on treatment response of OCD.<h4>Future directions</h4>The multi-omics studies and the inclusion of G × E in future GWAS studies of OCD should be drawn more attention, which may contribute to a deeper understanding of the etiology of OCD as well as guide therapeutic interventions for the disease.

Also flagged:Mineralmineralizationhydroxyapatitewatertype I collagencollagen
Journal Article 2023-06-24 No Snippets Cisneros T, Sevostianov I, Drach B.
Show Full Abstract

The research focuses on the evaluation of the mechanical properties of osteonal cortical bone at the lamellar level. Elastic properties of the mid-diaphysis region of the bovine tibia are investigated via cantilever-based nanoindentation at the submicron length scale utilizing Atomic Force Microscopy, where the force-displacement curves are used for the elastic assessment using the Derjaguin-Muller-Toropov model to calculate indentation modulus. Variations of the modulus and the directional mechanical response of the osteonal bone at different distances from the Haversian canal are investigated. Additionally, the effects of demineralization on the indentation modulus are discussed. It was found that in the axial direction, the first and last untreated thick lamella layers show a significant indentation modulus difference compared to all other layers (4.26 ± 0.4 and 4.6 ± 0.3 GPa vs ∼3.5 GPa). On the other hand, the indentation modulus of transverse thick lamella layers shows a periodic variation between ∼3 ± 0.7 GPa and ∼4 ± 0.3 GPa from near the Haversian canal to near the interstitial bone. A periodic variation in the anisotropy ratio was found. Mineral content was quantified via energy-dispersive X-ray microanalysis at different levels of mineralization and shows a positive correlation with the indentation modulus.

Also flagged:Magnesiumtitaniumcobalt-chromiumdegradationmetals
Journal Article 2023-06-24 No Snippets Shunmugasamy VC, AbdelGawad M, Sohail MU, Ibrahim T, Khan T, Seers TD, Mansoor B.
Show Full Abstract

Magnesium alloys containing biocompatible components show tremendous promise for applications as temporary biomedical devices. However, to ensure their safe use as biodegradeable implants, it is essential to control their corrosion rates. In concentrated Mg alloys, a microgalvanic coupling between the α-Mg matrix and secondary precipitates exists which results in increased corrosion rate. To address this challenge, we engineered the microstructure of a biodegradable Mg-Zn-RE-Zr alloy by friction stir processing (FSP), improving its corrosion resistance and mechanical properties simultaneously. The FS processed alloy with refined grains and broken and uniformly distributed secondary precipitates showed a relatively uniform corrosion morphology accompanied with the formation of a stable passive layer on the alloy surface. In vivo corrosion evaluation of the processed alloy in a small animal model showed that the material was well-tolerated with no signs of inflammation or harmful by-products. Remarkably, the processed alloy supported bone until it healed till eight weeks with a low in vivo corrosion rate of 0.7 mm/year. Moreover, we analyzed blood and histology of the critical organs such as liver and kidney, which showed normal functionality and consistent ion and enzyme levels, throughout the 12-week study period. These results demonstrate that the processed Mg-Zn-RE-Zr alloy offers promising potential for osseointegration in bone tissue healing while also exhibiting controlled biodegradability due to its engineered microstructure. The results from the present study will have profound benefit for bone fracture management, particularly in pediatric and elderly patients.

OLFM4
Also flagged:tumorcolorectal liver metastasesCAIXcancerCD45
Journal Article 2023-06-24 ✓ 4 Snippets Andel D, Hagendoorn J, Alsultan AA, Lacle MM, Smits MLJ, Braat AJAT, Kranenburg O, Lam MGEH, Borel Rinkes IHM.
In-Text Gene Mentions

Using a machine learning scoring protocol, pathological response was correlated to tumor absorbed dose and expression of markers of radioresistance Ki-67 (proliferation), CAIX (hypoxia), Olfm4 (cancer stem cells) and CD45 (leukocytes).<h4>Results</h4>No linear association was found between tumor dose and response (ρ < 0.1, P = 0.73 (<sup>90</sup>Y), P = 0.92 (<sup>166</sup>Ho)).

Response did correlate with proliferation (ρ = 0.56, P = 0.012), and non-responsive lesions had large pools (>15%) of Olfm4 positive cancer stem cells (Fisher's exact test, P = 0.0037).

…roliferation), CAIX (hypoxia),Olfm4(cancer stem cells)…

…pools (>15%) ofOlfm4positive cancer stem…

Show Full Abstract

<h4>Background</h4>Radiation lobectomy is a therapeutic approach that involves targeted radiation delivery to induce future liver remnant hypertrophy and tumor control. In patients with colorectal liver metastases, only 30-40% have complete tumor regression. The importance of tumor biology in treatment response remains elusive.<h4>Methods</h4>Patients with colorectal liver metastases who received radiation lobectomy were selected from surgical pathology files. Using a machine learning scoring protocol, pathological response was correlated to tumor absorbed dose and expression of markers of radioresistance Ki-67 (proliferation), CAIX (hypoxia), Olfm4 (cancer stem cells) and CD45 (leukocytes).<h4>Results</h4>No linear association was found between tumor dose and response (ρ < 0.1, P = 0.73 (<sup>90</sup>Y), P = 0.92 (<sup>166</sup>Ho)). Response did correlate with proliferation (ρ = 0.56, P = 0.012), and non-responsive lesions had large pools (>15%) of Olfm4 positive cancer stem cells (Fisher's exact test, P = 0.0037). Responding lesions (regression grade ≤2) were highly hypoxic compared to moderate and non-responding lesions (P = 0.011). Non-responsive lesions had more tumor-infiltrating leukocytes (3240 cells/mm<sup>2</sup> versus 650 cells/mm<sup>2</sup>), although this difference was not significant (P = 0.08).<h4>Conclusion</h4>The aggressive phenotype of a subset of surviving cancer cells emphasizes the importance of prompt resection after radiation lobectomy.

SOX6
Also flagged:dwarfismarthritisepiphyseal dysplasiaossificationbone remodelingmetabolism
Journal Article 2023-06-24 ✓ 1 Snippet Deng Z, Rong S, Gan L, Wang F, Bao L, Cai F, Liao Z, Jin Y, Feng S, Feng Z, Wei Y, Chen R, Jin Y, Zhou Y, Zheng X, Huang L, Zhao L.
In-Text Gene Mentions

…g chondrocyte differentiation,SOX6, TWIST1 ,…

Show Full Abstract

Human epiphyseal development has been mainly investigated through radiological and histological approaches, uncovering few details of cellular temporal genetic alternations. Using single-cell RNA sequencing, we investigated the dynamic transcriptome changes during post-conception weeks (PCWs) 15-25 of human distal femoral epiphysis cells. We find epiphyseal cells contain multiple subtypes distinguished by specific markers, gene signatures, Gene Ontology (GO) enrichment analysis, and gene set variation analysis (GSVA). We identify the populations committed to cartilage or ossification at this time, although the secondary ossification centers (SOCs) have not formed. We describe the temporal alternation in transcriptional expression utilizing trajectories, transcriptional regulatory networks, and intercellular communication analyses. Moreover, we find the emergence of the ossification-committed population is correlated with the <i>COL2A1-(ITGA2/11+ITGB1)</i> signaling. <i>NOTCH</i> signaling may contribute to the formation of cartilage canals and ossification via <i>NOTCH</i> signaling. Our findings will advance the understanding of single-cell genetic changes underlying fetal epiphysis development.

Also flagged:SOX9digestiondetoxificationcell proliferationtranscription factorsSRY-related high-mobility group box 9
Journal Article 2023-06-24 No Snippets Shang T, Jiang T, Cui X, Pan Y, Feng X, Dong L, Wang H.
Show Full Abstract

The liver is the central organ for digestion and detoxification and has unique metabolic and regenerative capacities. The hepatobiliary system originates from the foregut endoderm, in which cells undergo multiple events of cell proliferation, migration, and differentiation to form the liver parenchyma and ductal system under the hierarchical regulation of transcription factors. Studies on liver development and diseases have revealed that SRY-related high-mobility group box 9 (SOX9) plays an important role in liver embryogenesis and the progression of hepatobiliary diseases. SOX9 is not only a master regulator of cell fate determination and tissue morphogenesis, but also regulates various biological features of cancer, including cancer stemness, invasion, and drug resistance, making SOX9 a potential biomarker for tumor prognosis and progression. This review systematically summarizes the latest findings of SOX9 in hepatobiliary development, homeostasis, and disease. We also highlight the value of SOX9 as a novel biomarker and potential target for the clinical treatment of major liver diseases.

bioRxiv 2023-06-24 Preprint (No Snippets API) Jiang A, You L, Handley RR, Hawkins V, Reid SJ, Jacobsen JC, Patassini S, Rudiger SR, Mclaughlan CJ, Kelly JM, Verma PJ, Bawden CS, Gusella JF, MacDonald ME, Waldvogel HJ, Faull RL, Lehnert K, Snell RG.
Show Full Abstract

<h4>Background</h4> Huntington’s disease (HD) is a neurodegenerative genetic disorder caused by an expansion in the CAG repeat tract of the huntingtin ( HTT ) gene resulting in a triad of behavioural, cognitive, and motor defects. Current knowledge of disease pathogenesis remains incomplete, and no disease course-modifying interventions are in clinical use. We have previously reported the development and characterisation of the OVT73 transgenic sheep model of HD. OVT73 captures an early prodromal phase of the disease with an absence of motor symptomatology even at 5-years of age and no detectable striatal cell loss. <h4>Methods</h4> To better understand the disease-initiating events we have undertaken a single nuclei transcriptome study of the striatum of an extensively studied cohort of 5-year-old OVT73 HD sheep and age matched wild-type controls. <h4>Results</h4> We have identified transcriptional upregulation of genes encoding N-methyl-D-aspartate (NMDA), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate receptors in OVT73 medium spiny neurons, the cell type preferentially lost early in HD. This observation supports the glutamate excitotoxicity hypothesis as an early neurodegeneration cascade-initiating process. Moreover, we also observed the downstream consequences of excitotoxic stress, including a downregulation of transcription of components for the oxidative phosphorylation complexes. We also found that pathways whose activity has been proposed to reduce excitotoxicity, including the CREB family of transcription factors ( CREB1 , ATF2, ATF4 and ATF7 ) were transcriptionally downregulated. <h4>Conclusions</h4> To our knowledge, the OVT73 model is the first large mammalian HD model that exhibits transcriptomic signatures of an excitotoxic process in the absence of neuronal loss. Our results suggest that glutamate excitotoxicity is a disease-initiating process. Addressing this biochemical defect early may prevent neuronal loss and avoid the more complex secondary consequences precipitated by cell death.

ARFGEF2
Also flagged:membraneRab4Rab11small GTPaseendosomesRab4a
Journal Article 2023-06-23 ✓ 1 Snippet Wilson B, Flett C, Gemperle J, Lawless C, Hartshorn M, Hinde E, Harrison T, Chastney M, Taylor S, Allen J, Norman JC, Zacharchenko T, Caswell PT.
In-Text Gene Mentions

…(BIG1, Rab11 only),ARFGEF2(BIG2, Rab4 longlist…

Show Full Abstract

Endocytic recycling controls the return of internalised cargoes to the plasma membrane to coordinate their positioning, availability and downstream signalling. The Rab4 and Rab11 small GTPase families regulate distinct recycling routes, broadly classified as fast recycling from early endosomes (Rab4) and slow recycling from perinuclear recycling endosomes (Rab11), and both routes handle a broad range of overlapping cargoes to regulate cell behaviour. We adopted a proximity labelling approach, BioID, to identify and compare the protein complexes recruited by Rab4a, Rab11a and Rab25 (a Rab11 family member implicated in cancer aggressiveness), revealing statistically robust protein-protein interaction networks of both new and well-characterised cargoes and trafficking machinery in migratory cancer cells. Gene ontological analysis of these interconnected networks revealed that these endocytic recycling pathways are intrinsically connected to cell motility and cell adhesion. Using a knock-sideways relocalisation approach, we were further able to confirm novel links between Rab11, Rab25 and the ESCPE-1 and retromer multiprotein sorting complexes, and identify new endocytic recycling machinery associated with Rab4, Rab11 and Rab25 that regulates cancer cell migration in the 3D matrix.

HTT
Also flagged:HDhippocampal atrophyHuntingtinHuntington diseaseimpairmentneurodegenerative disorder
Journal Article 2023-06-23 ✓ 3 Snippets Wibawa P, Walterfang M, Malpas CB, Glikmann-Johnston Y, Poudel G, Razi A, Hannan AJ, Velakoulis D, Georgiou-Karistianis N.
In-Text Gene Mentions

Huntington disease (HD) is an inherited neurodegenerative disorder, arising from an unstable trinucleotide CAG repeat expansion in the huntingtin (Htt) gene.

…in the huntingtin (Htt) gene.…

…MutantHttmay preferentially exert…

Show Full Abstract

<h4>Introduction</h4>While individuals with Huntington disease (HD) show memory impairment that indicates hippocampal dysfunction, the available literature does not consistently identify structural evidence for involvement of the whole hippocampus but rather suggests that hippocampal atrophy may be confined to certain hippocampal subregions.<h4>Methods</h4>We processed T1-weighted MRI from IMAGE-HD study using FreeSurfer 7.0 and compared the volumes of the hippocampal subfields among 36 early motor symptomatic (symp-HD), 40 pre-symptomatic (pre-HD), and 36 healthy control individuals across three timepoints over 36 months.<h4>Results</h4>Mixed-model analyses revealed significantly lower subfield volumes in symp-HD, compared with pre-HD and control groups, in the subicular regions of the perforant-pathway: presubiculum, subiculum, dentate gyrus, tail, and right molecular layer. These adjoining subfields aggregated into a single principal component, which demonstrated an accelerated rate of atrophy in the symp-HD. Volumes between pre-HD and controls did not show any significant difference. In the combined HD groups, CAG repeat length and disease burden score were associated with presubiculum, molecular layer, tail, and perforant-pathway subfield volumes. Hippocampal left tail and perforant-pathway subfields were associated with motor onset in the pre-HD group.<h4>Conclusions</h4>Hippocampal subfields atrophy in early symptomatic HD affects key regions of the perforant-pathway, which may implicate the distinctive memory impairment at this stage of illness. Their volumetric associations with genetic and clinical markers suggest the selective susceptibility of these subfields to mutant Huntingtin and disease progression.

HFE
Also flagged:16Ssepsisbubonic plaguepneumoniasepticemiaplague
Journal Article 2023-06-23 ✓ 2 Snippets Erly B, Fleck-Derderian S, Cooley KM, Meyer-Lee K, House J, VinHatton E, Nelson CA.
In-Text Gene Mentions

…evealed previously undiagnosedhemochromatosis.…

…overload due tohemochromatosismay have rendered…

Show Full Abstract

<b><i>Background:</i></b> Plague in humans and animals is caused by <i>Yersinia pestis</i>, a zoonotic gram-negative bacterium endemic in certain regions of Asia, Africa, and the United States. Coinfection with both <i>Y. pestis</i> and Streptococci species has been anecdotally reported in humans and associated with severe and rapidly fatal disease. <b><i>Methods:</i></b> This report presents two cases of patients who died following <i>Y. pestis</i> and <i>Streptococcus</i> coinfection. Additional cases of previously published <i>Y. pestis-Streptococcus</i> coinfection were identified and reviewed using a search of electronic databases. <b><i>Results:</i></b> The first case patient developed cough and dyspnea following 4 days of fever, malaise, and back pain and died before receiving medical care. Postmortem blood cultures were positive for <i>Y. pestis</i>, <i>Streptococcus pyogenes</i>, and <i>Streptococcus dysgalactiae</i>. The second case patient was hospitalized with fever, vomiting, diarrhea, and dyspnea and died of sepsis and respiratory failure on the day of admission. <i>Y. pestis</i> and <i>Streptococcus pneumoniae</i> were isolated from blood cultures drawn on admission. Seven additional cases of <i>Y. pestis</i> and <i>Streptococcus</i> coinfection were identified, dating between 1948 and 2009. These patients were healthy overall before their illness, with ages ranging from 9 to 60 years. The majority of patients had primary bubonic plague with associated pneumonia or septicemia. None of the patients who died received timely antimicrobial therapy directed against gram-negative pathogens. In every case but one, an occupational or environmental risk factor for plague was later identified. <b><i>Conclusion:</i></b> <i>Y. pestis</i> infection begins with a pre-inflammatory phase, during which <i>Y. pestis</i> and other pathogens can rapidly proliferate. Streptococci, which are frequently asymptomatic colonizers, may become invasive in this environment, leading to coinfection. The challenges of diagnosing <i>Y. pestis</i> in the context of coinfection may delay effective treatment. This case series and literature review illustrate the importance of clinicians remaining alert to environmental and occupational exposures in patients presenting with an infectious syndrome, especially in those who have an unexpectedly severe clinical presentation.

Also flagged:MIFApoptosis-InducingAIFcytokinecancersbinding
Journal Article 2023-06-23 No Snippets Chen D, Osipyan A, Adriana J, Kader M, Gureev M, Knol CWJ, Sigmund MC, Xiao Z, van der Wouden PE, Cool RH, Poelarends GJ, Dekker FJ.
Show Full Abstract

Macrophage migration inhibitory factor (MIF) is a multifunctional cytokine and essential signaling protein associated with inflammation and cancers. One of the newly described roles of MIF is binding to apoptosis-inducing factor (AIF) that "brings" cells to death in pathological conditions. The interaction between MIF and AIF and their nuclear translocation stands as a central event in parthanatos. However, classical competitive MIF tautomerase inhibitors do not interfere with MIF functions in parthanatos. In this study, we employed a pharmacophore-switch to provide allosteric MIF tautomerase inhibitors that interfere with the MIF/AIF co-localization. Synthesis and screening of a focused compound collection around the 1,2,3-triazole core enabled identification of the allosteric tautomerase MIF inhibitor <b>6y</b> with low micromolar potency (IC<sub>50</sub> = 1.7 ± 0.1 μM). This inhibitor prevented MIF/AIF nuclear translocation and protects cells from parthanatos. These findings indicate that alternative modes to target MIF hold promise to investigate MIF function in parthanatos-mediated diseases.

Also flagged:phosphorylationcancerHLA-B*0702acute myeloid leukemiapeptideMHC
Journal Article 2023-06-23 No Snippets Patskovsky Y, Natarajan A, Patskovska L, Nyovanie S, Joshi B, Morin B, Brittsan C, Huber O, Gordon S, Michelet X, Schmitzberger F, Stein RB, Findeis MA, Hurwitz A, Van Dijk M, Chantzoura E, Yague AS, Pollack Smith D, Buell JS, Underwood D, Krogsgaard M.
Show Full Abstract

Altered protein phosphorylation in cancer cells often leads to surface presentation of phosphopeptide neoantigens. However, their role in cancer immunogenicity remains unclear. Here we describe a mechanism by which an HLA-B*0702-specific acute myeloid leukemia phosphoneoantigen, pMLL<sub>747-755</sub> (EPR(pS)PSHSM), is recognized by a cognate T cell receptor named TCR27, a candidate for cancer immunotherapy. We show that the replacement of phosphoserine P<sub>4</sub> with serine or phosphomimetics does not affect pMHC conformation or peptide-MHC affinity but abrogates TCR27-dependent T cell activation and weakens binding between TCR27 and pMHC. Here we describe the crystal structures for TCR27 and cognate pMHC, map of the interface produced by nuclear magnetic resonance, and a ternary complex generated using information-driven protein docking. Our data show that non-covalent interactions between the epitope phosphate group and TCR27 are crucial for TCR specificity. This study supports development of new treatment options for cancer patients through target expansion and TCR optimization.

OLFM4
Also flagged:WNTATOH1+extracellularepithelial to mesenchymal transitionmembrane
Journal Article 2023-06-23 ✓ 3 Snippets Liu Y, Reyes E, Castillo-Azofeifa D, Klein OD, Nystul T, Barber DL.
In-Text Gene Mentions

…5'-CACTAGACA GCATGGGTAAGG-3');Olfm4forward (5'-TGAAGGAGATGCAAAAAC…

…(5'-TGAAGGAGATGCAAAAACTGG-3'),Olfm4reverse (5'-CTCCAGCTTCTCTACCAA…

…genes Hes1 andOlfm4in EIPA-treated organoids…

Show Full Abstract

Intracellular pH dynamics is increasingly recognized to regulate myriad cell behaviors. We report a finding that intracellular pH dynamics also regulates adult stem cell lineage specification. We identify an intracellular pH gradient in mouse small intestinal crypts, lowest in crypt stem cells and increasing along the crypt column. Disrupting this gradient by inhibiting H<sup>+</sup> efflux by Na<sup>+</sup>/H<sup>+</sup> exchanger 1 abolishes crypt budding and blocks differentiation of Paneth cells, which are rescued with exogenous WNT. Using single-cell RNA sequencing and lineage tracing we demonstrate that intracellular pH dynamics acts downstream of ATOH1, with increased pH promoting differentiation toward the secretory lineage. Our findings indicate that an increase in pH is required for the lineage specification that contributes to crypt maintenance, establishing a role for intracellular pH dynamics in cell fate decisions within an adult stem cell lineage.

SERPINC1
Also flagged:Babesia rossi infectionBabesiosisdeathlipidmetabolismhaemoprotozoan
Journal Article 2023-06-23 ✓ 1 Snippet Kuleš J, Rubić I, Farkaš V, Barić Rafaj R, Gotić J, Crnogaj M, Burchmore R, Eckersall D, Mrljak V, Leisewitz AL.
In-Text Gene Mentions

…serine protease inhibitors (SERPINC1(antithrombin III), SERPINA5,…

Show Full Abstract

Babesiosis is a disease of significant medically and veterinary importance with worldwide distribution. It is caused by intra-erythrocyte protozoal parasites, with Babesia rossi causing the most severe clinical signs of all the large Babesia parasites infecting dogs. The disease can be clinically classified into uncomplicated and complicated forms with a wide range of clinical presentations from a mild, subclinical illness to complicated forms and death. The aim of this study was to assess serum proteomic profiles from dogs with babesiosis and healthy dogs using a label-based proteomics approach. Altogether 32 dogs naturally infected with B. rossi (subdivided into 18 uncomplicated cases and 14 complicated cases of babesiosis) and 20 healthy dogs were included. There were 78 proteins with significantly different abundances between the three groups of dogs. Elucidation of proteins and pathways involved in canine babesiosis caused by B. rossi have revealed key differences associated with haemostasis, innate immune system, lipid metabolism and inflammation. Shotgun proteomic profiling allowed identification of potential serum biomarkers for differentiation of disease severity in canine babesiosis caused by B. rossi. These findings may be applicable to the study of host-parasite interactions and the development of novel therapeutic targets.

DNAH10
Also flagged:cancerdeathcolorectal cancercancerstumorstumor
Journal Article 2023-06-23 ✓ 1 Snippet Zhou W, He MM, Wang F, Xu RH, Wang F, Zhao Q.
In-Text Gene Mentions

…, VPS13B ,DNAH10, GLI3 ,…

Show Full Abstract

The molecular subtypes of colorectal cancer (CRC) represent a comprehensive dissection of CRC heterogeneity. However, molecular feature-based classification systems have limitations in accurately prognosticating stratification due to the inability to distinguish cancer-specific deaths. This study aims to establish a classification system that bridges clinical characteristics, cause-specific deaths, and molecular features. We adopted latent class analysis (LCA) on 491,107 first primary CRC patients from the Surveillance, Epidemiology, and End Results (SEER) database to reveal hidden profiles of CRC. The LCA-derived classification scheme was further applied to The Cancer Genome Atlas (TCGA) to assess its effectiveness in improving the accurate stratification of molecular-based subtypes of CRC. Four classes were identified based on latent class analysis integrating demographic and clinicopathological information of CRC patients. The LCA-derived Class 1 (LCAC1) and the LCAC2 showed a high risk of dying from non-CRC, while patients in LCAC3 had a risk of dying from CRC 1.41 times that of LCAC1 (95% confidence interval [CI] = 1.39-1.43). LCAC4 had the lowest probability to die from non-CRC (hazard ratio [HR] = 0.22, 95% CI = 0.21-0.24) compared with LCAC1. Since the LCA-derived classification can identify patients susceptible to CRC-specific death, adjusting for this classification allows molecular-based subtypes to achieve more accurate survival stratification. We provided a classification system capable of distinguish CRC-specific death, which will improve the accuracy of consensus molecular subtypes for CRC patients' survival stratification. Further studies are warranted to confirm the molecular features of LCA-derived classification to inform potential therapeutic strategies and treatment recommendations.

DCC
Also flagged:Netrin-1dopamineorganizationaggressionpolymerasetyrosine hydroxylase
Journal Article 2023-06-23 ✓ 5 Snippets Pantoja-Urbán AH, Richer S, Mittermaier A, Giroux M, Nouel D, Hernandez G, Flores C.
In-Text Gene Mentions

Mice were then assessed for changes in Netrin-1/DCC guidance cue expression in dopamine systems, for inhibitory control in adulthood using the Go/No-Go task, or for alterations in dopamine connectivity organization in the matured prefrontal cortex.<h4>Results</h4>Most adolescent females showed protection against stress-induced social avoidance, but in adulthood, these resilient females developed inhibitory control deficits and showed diminution of prefrontal cortex presynaptic dopamine sites.

AcSD did not alter Netrin-1/DCC in early adolescent females, contrary to previous findings with males.<h4>Conclusions</h4>Preserving prosocial behavior in adolescent females may be important for survival advantage but seems to come at the price of developing persistent cognitive and dopamine deficiencies.

…for changes in Netrin-1/DCCguidance cue expression…

…did not alter Netrin-1/DCCin early adolescent…

DCC

Show Full Abstract

<h4>Background</h4>Adolescence is a unique period of psychosocial growth during which social adversity can negatively influence mental health trajectories. Understanding how adolescent social stress impacts males and females and why some individuals are particularly affected is becoming increasingly urgent. Social defeat stress models for adolescent male mice have been effective in reproducing some physical/psychological aspects of bullying. Designing a model suitable for females has proven challenging.<h4>Methods</h4>We report a version of the adolescent male accelerated social defeat stress (AcSD) paradigm adapted for females. Early adolescent C57BL/6J female mice (N = 107) were exposed to our modified AcSD procedure twice a day for 4 days and categorized as resilient or susceptible based on a social interaction test 24 hours later. Mice were then assessed for changes in Netrin-1/DCC guidance cue expression in dopamine systems, for inhibitory control in adulthood using the Go/No-Go task, or for alterations in dopamine connectivity organization in the matured prefrontal cortex.<h4>Results</h4>Most adolescent females showed protection against stress-induced social avoidance, but in adulthood, these resilient females developed inhibitory control deficits and showed diminution of prefrontal cortex presynaptic dopamine sites. Female mice classified as susceptible were protected against cognitive and dopaminergic alterations. AcSD did not alter Netrin-1/DCC in early adolescent females, contrary to previous findings with males.<h4>Conclusions</h4>Preserving prosocial behavior in adolescent females may be important for survival advantage but seems to come at the price of developing persistent cognitive and dopamine deficiencies. The female AcSD paradigm produced findings comparable to those found in males, allowing mechanistic investigation in both sexes.

NEGR1
Also flagged:attention-deficit/hyperactivity disorderautism spectrum disorderADHDpathogenesisbehaviouralneurodevelopmental disorders
Journal Article 2023-06-23 ✓ 1 Snippet Yamashita M, Kagitani-Shimono K, Hirano Y, Hamatani S, Nishitani S, Yao A, Kurata S, Kosaka H, Jung M, Yoshida T, Sasaki T, Matsumoto K, Kato Y, Nakanishi M, Tachibana M, Mohri I, Tsuchiya KJ, Tsujikawa T, Okazawa H, Shimizu E, Taniike M, Tomoda A, Mizuno Y.
In-Text Gene Mentions

…those corresponding toneuronal growth regulator 1growth regulator 1,…

Show Full Abstract

<h4>Introduction</h4>Neuroimaging studies on attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorder (ASD) have demonstrated differences in extensive brain structure, activity and network. However, there remains heterogeneity and inconsistency across these findings, presumably because of the diversity of the disorders themselves, small sample sizes, and site and parameter differences in MRI scanners, and their overall pathogenesis remains unclear. To address these gaps in the literature, we will apply the travelling-subject approach to correct site differences in MRI scanners and clarify brain structure and network characteristics of children with ADHD and ASD using large samples collected in a multi-centre collaboration. In addition, we will investigate the relationship between these characteristics and genetic, epigenetic, biochemical markers, and behavioural and psychological measures.<h4>Methods and analysis</h4>We will collect resting-state functional MRI (fMRI) and T1-weighted and diffusion-weighted MRI data from 15 healthy adults as travelling subjects and 300 children (ADHD, n=100; ASD, n=100; and typical development, n=100) with multi-dimensional assessments. We will also apply data from more than 1000 samples acquired in our previous neuroimaging studies on ADHD and ASD.<h4>Ethics and dissemination</h4>The study protocol has been approved by the Research Ethics Committee of the University of Fukui Hospital (approval no: 20220601). Our study findings will be submitted to scientific peer-reviewed journals and conferences.

BTN2A2
Also flagged:autoimmune diseasesurface receptorsimmunoglobulincell activationmaturationautoimmunity
Journal Article 2023-06-23 ✓ 5 Snippets Frech M, Danzer H, Uchil P, Azizov V, Schmid E, Schälter F, Dürholz K, Mauro D, Rauber S, Muñoz L, Taher L, Ciccia F, Schober K, Irla M, Sarter K, Schett G, Zaiss MM.
In-Text Gene Mentions

Butyrophilin 2a2 (Btn2a2) expression on thymic epithelial cells promotes central T cell tolerance and prevents autoimmune disease.

…Butyrophilin 2a2 (Btn2a2) expression on thymic…

…cells, butyrophilin 2a2 (Btn2a2) has been shown…

…primary source ofBtn2a2are thymic epithelial…

…Absence ofBtn2a2alters thymic T…

Show Full Abstract

Butyrophilins are surface receptors belonging to the immunoglobulin superfamily. While several members of the butyrophilin family have been implicated in the development of unconventional T cells, butyrophilin 2a2 (Btn2a2) has been shown to inhibit conventional T cell activation. Here, we demonstrate that in steady state, the primary source of Btn2a2 are thymic epithelial cells (TEC). Absence of Btn2a2 alters thymic T cell maturation and bypasses central tolerance mechanisms. Furthermore, Btn2a2<sup>-/-</sup> mice develop spontaneous autoimmunity resembling human primary Sjögren's Syndrome (pSS), including formation of tertiary lymphoid structures (TLS) in target organs. Ligation of Btn2a2 on developing thymocytes is associated with reduced TCR signaling and CD5 levels, while absence of Btn2a2 results in increased TCR signaling and CD5 levels. These results define a novel role for Btn2a2 in promoting central tolerance by modulating TCR signaling strength and indicate a potential mechanism of pSS development.

HFE
Also flagged:belinostatangioimmunoblastic T‐cell lymphomaperipheral T‐cell lymphomasfollicular helper T‐cell lymphomaangioimmunoblastic‐typenon‐Hodgkin lymphomas
Journal Article 2023-06-23 ✓ 1 Snippet Camus V, Etancelin P, Drieux F, Veresezan EL, Picquenot JM, Penther D, Viennot M, Ruminy P, Contentin N, Lemasle E, Leprêtre S, Dubois S, Penichoux J, Stamatoullas A, Zduniak A, Lanic H, Jardin F.
In-Text Gene Mentions

… non‐severe post‐transfusionalhemochromatosis(ferritin, 3420 ng/mL)…

Show Full Abstract

<h4>Key clinical message</h4>This case report highlights the potential of belinostat for the treatment of relapsed/refractory peripheral T-cell lymphomas, for which effective therapies are still scarce.<h4>Abstract</h4>Peripheral T-cell lymphomas have an aggressive disease course associated with poor outcomes. We report a young patient with highly pretreated relapsed/refractory nodal follicular helper T-cell lymphoma (angioimmunoblastic-type [nTFHL-AI]), who successfully received an allogeneic stem cell transplantation following belinostat therapy. The complete hematologic response achieved has lasted more than 2 years.

Also flagged:photonbismuthdendritesmethyl salicylatebenzyl benzoategreen fluorescent protein
Journal Article 2023-06-23 No Snippets Akitegetse C, Charland T, Quémener M, Gora C, Rioux V, Piché M, De Koninck Y, Lévesque M, Côté DC.
Show Full Abstract

<h4>Significance</h4>Typical light sheet microscopes suffer from artifacts related to the geometry of the light sheet. One main inconvenience is the non-uniform thickness of the light sheet obtained with a Gaussian laser beam.<h4>Aim</h4>We developed a two-photon light sheet microscope that takes advantage of a thin and long Bessel-Gauss beam illumination to increase the sheet extent without compromising the resolution.<h4>Approach</h4>We use an axicon lens placed directly at the output of an amplified femtosecond laser to produce a long Bessel-Gauss beam on the sample. We studied the dopaminergic system and its projections in a whole cleared mouse brain.<h4>Results</h4>Our light sheet microscope allows an isotropic resolution of 2.4  μm in all three axes of the scanned volume while keeping a millimetric-sized field of view, and a fast acquisition rate of up to 34  mm2/s. With slight modifications to the optical setup, the sheet extent can be increased to 6 mm.<h4>Conclusion</h4>The proposed system's sheet extent and resolution surpass currently available systems, enabling the fast imaging of large specimens.

Also flagged:genetic disordersautosomal recessive disordersorganizationgeneticenvironmental disordersthalidomide embryopathy
Journal Article 2023-06-23 No Snippets Cardoso-Dos-Santos AC, Reales G, Schuler-Faccini L.
Show Full Abstract

<h4>Objective</h4>To map geographic clusters of rare disorders and congenital anomalies reported in South America.<h4>Methods</h4>Qualitative systematic review conducted in Medline/PubMed, Lilacs, and Scielo electronic databases to identify studies meeting eligibility criteria. The strategy resulted in 1 672 unique articles, from which 164 were selected for full reading by a pair of reviewers.<h4>Results</h4>Fifty-five articles reported at least one cluster of genetic disorders or congenital anomalies in South American territory. From these papers, 122 clusters were identified, of which half (61) were related to autosomal recessive disorders. Sixty-five (53.3%) of the clusters were located in Brazil.<h4>Conclusions</h4>The results of the review reinforce that rare diseases and congenital anomalies can occur in a non-random way in space, which is discussed in the perspective of the complex history of formation, social organization, and genetic structure of the South American population. Mapping clusters in population medical genetics can be an important public health tool, given that such places concentrate cases of rare diseases that frequently require multiprofessional, specialized care. Therefore, these results can support important agendas in public health related to rare diseases and congenital anomalies, such as health promotion and surveillance.

DCC
Also flagged:major depressive disorderCOVID-19coronavirus disease of 2019Cushing syndromeCOVID-19 infectionmental illness
Journal Article 2023-06-23 ✓ 2 Snippets Li Z, Dang W, Hao T, Zhang H, Yao Z, Zhou W, Deng L, Yu H, Wen Y, Liu L.
In-Text Gene Mentions

These genes include FYCO1, CXCR6, SLC6A20, CRHR1, RP11-105 N13.4, DCC, RP1-71H24.1, OAS3, NR1H2, NAPSA, IFNAR2, AP000295.9, CTB-191 K22.6, FLT1P1, NSF, ZSCAN31, RP5-874C20.6, RP5-874C20.3, ZKSCAN4, LINC00649, NKAPL, PGBD1, Wnt3, ACTR3P3, GRM5. Most of them have already been demonstrated to be novel risk factors for COVID-19 and/or MDD.

…RP11-105 N13.4 ,DCC, RP1-71H24.1 ,…

Show Full Abstract

<h4>Introduction</h4>The comorbidity between major depressive disorder (MDD) and coronavirus disease of 2019 (COVID-19) related traits have long been identified in clinical settings, but their shared genetic foundation and causal relationships are unknown. Here, we investigated the genetic mechanisms behind COVID-19 related traits and MDD using the cross-trait meta-analysis, and evaluated the underlying causal relationships between MDD and 3 different COVID-19 outcomes (severe COVID-19, hospitalized COVID-19, and COVID-19 infection).<h4>Methods</h4>In this study, we conducted a comprehensive analysis using the most up-to-date and publicly available GWAS summary statistics to explore shared genetic etiology and the causality between MDD and COVID-19 outcomes. We first used genome-wide cross-trait meta-analysis to identify the pleiotropic genomic SNPs and the genes shared by MDD and COVID-19 outcomes, and then explore the potential bidirectional causal relationships between MDD and COVID-19 outcomes by implementing a bidirectional MR study design. We further conducted functional annotations analyses to obtain biological insight for shared genes from the results of cross-trait meta-analysis.<h4>Results</h4>We have identified 71 SNPs located on 25 different genes are shared between MDD and COVID-19 outcomes. We have also found that genetic liability to MDD is a causal factor for COVID-19 outcomes. In particular, we found that MDD has causal effect on severe COVID-19 (OR = 1.832, 95% CI = 1.037-3.236) and hospitalized COVID-19 (OR = 1.412, 95% CI = 1.021-1.953). Functional analysis suggested that the shared genes are enriched in Cushing syndrome, neuroactive ligand-receptor interaction.<h4>Discussion</h4>Our findings provide convincing evidence on shared genetic etiology and causal relationships between MDD and COVID-19 outcomes, which is crucial to prevention, and therapeutic treatment of MDD and COVID-19.

Also flagged:AutophagyCancerdegradationPPT1liver canceratezolizumab
Journal Article 2023-06-23 No Snippets Bestion E, Raymond E, Mezouar S, Halfon P.
Show Full Abstract

Autophagy is a highly conserved and natural degradation process that helps maintain cell homeostasis through the elimination of old, worn, and defective cellular components, ensuring proper cell energy intake. The degradative pathway constitutes a protective barrier against diverse human diseases including cancer. Autophagy basal level has been reported to be completely dysregulated during the entire oncogenic process. Autophagy influences not only cancer initiation, development, and maintenance but also regulates cancer response to therapy. Currently, autophagy inhibitor candidates mainly target the early autophagy process without any successful preclinical/clinical development. Lessons learned from autophagy pharmaceutical manipulation as a curative option progressively help to improve drug design and to encounter new targets of interest. Combinatorial strategies with autophagy modulators are supported by abundant evidence, especially dealing with immune checkpoint inhibitors, for which encouraging preclinical results have been recently published. GNS561, a PPT1 inhibitor, is a promising autophagy modulator as it has started a phase 2 clinical trial in liver cancer indication, combined with atezolizumab and bevacizumab, an assessment without precedent in the field. This approach paves a new road, leading to the resurgence of anticancer autophagy inhibitors as an attractive therapeutic target in cancer.

Also flagged:Glioblastomabrain tumourtumourN6-methyladenosinegliomacancer
Journal Article 2023-06-23 No Snippets Deacon S, Walker L, Radhi M, Smith S.
Show Full Abstract

Glioblastoma is the most prevalent primary brain tumour and invariably confers a poor prognosis. The immense intra-tumoral heterogeneity of glioblastoma and its ability to rapidly develop treatment resistance are key barriers to successful therapy. As such, there is an urgent need for the greater understanding of the tumour biology in order to guide the development of novel therapeutics in this field. N6-methyladenosine (m6A) is the most abundant of the RNA modifications in eukaryotes. Studies have demonstrated that the regulation of this RNA modification is altered in glioblastoma and may serve to regulate diverse mechanisms including glioma stem-cell self-renewal, tumorigenesis, invasion and treatment evasion. However, the precise mechanisms by which m6A modifications exert their functional effects are poorly understood. This review summarises the evidence for the disordered regulation of m6A in glioblastoma and discusses the downstream functional effects of m6A modification on RNA fate. The wide-ranging biological consequences of m6A modification raises the hope that novel cancer therapies can be targeted against this mechanism.

Also flagged:Gynecological Cancerscancergynecological cancercervical cancergynecologic cancersnucleotide
Journal Article 2023-06-23 No Snippets Gonzalez-Bosquet J, McDonald ME, Bender DP, Smith BJ, Leslie KK, Goodheart MJ, Devor EJ.
Show Full Abstract

There are strong correlations between the microbiome and human disease, including cancer. However, very little is known about potential mechanisms associated with malignant transformation in microbiome-associated gynecological cancer, except for HPV-induced cervical cancer. Our hypothesis is that differences in bacterial communities in upper genital tract epithelium may lead to selection of specific genomic variation at the cellular level of these tissues that may predispose to their malignant transformation. We first assessed differences in the taxonomic composition of microbial communities and genomic variation between gynecologic cancers and normal samples. Then, we performed a correlation analysis to assess whether differences in microbial communities selected for specific single nucleotide variation (SNV) between normal and gynecological cancers. We validated these results in independent datasets. This is a retrospective nested case-control study that used clinical and genomic information to perform all analyses. Our present study confirms a changing landscape in microbial communities as we progress into the upper genital tract, with more diversity in lower levels of the tract. Some of the different genomic variations between cancer and controls strongly correlated with the changing microbial communities. Pathway analyses including these correlated genes may help understand the basis for how changing bacterial landscapes may lead to these cancers. However, one of the most important implications of our findings is the possibility of cancer prevention in women at risk by detecting altered bacterial communities in the upper genital tract epithelium.

HFE
Also flagged:Hypertrophic obstructive cardiomyopathyHOCMhematoxylinaortic outflow obstructionidiopathic hypertrophic subaortic stenosisIHSS
Journal Article 2023-06-23 ✓ 1 Snippet Murtha CM, Dobson JR, Olinger AB.
In-Text Gene Mentions

….e., amyloidosis, sarcoidosis,hemochromatosis).…

Show Full Abstract

Hypertrophic obstructive cardiomyopathy (HOCM) describes a pathologic state in which the subaortic region of the interventricular septum undergoes significant hypertrophy and fibrosis, resulting in septal bowing into the left ventricle. The reduced left ventricular chamber size and altered cardiac function impair diastolic filling, stroke volume, and cardiac output. This case report evaluates the cardiac tissue of a 36-year-old, formalin-embalmed cadaver affected by HOCM, with the goal of providing a comprehensive overview of the gross and pathologic findings associated with the condition. This donor's heart was found to be larger than average, weighing 510.1 g, which is 52% heavier than the predicted value of 335.6 g for a male of similar stature. The thickness of the interventricular septum, right ventricular free wall, and left ventricular free wall was comparable to other reports of HOCM. However, asymmetrical thickening of the left ventricular walls, which is characteristic of HOCM, was less prominent than expected. Histologic staining of the cadaveric tissue, with hematoxylin and eosin, trichrome, and desmin, further bolstered the diagnosis. Importantly, this also showed that histologic examination of embalmed tissue is effective and diagnostic, even 11 months after embalming. The report herein demonstrates that morphologic and histologic analysis of cadaveric cardiac tissue is sufficient to support a diagnosis of HOCM. To the researchers' knowledge, this is the first case report evaluating HOCM in a cadaver donated for medical education.

HFE
Also flagged:Type II Transmembrane Serine Proteasesmetabolismtrypsincell surfaceproteasesdigestion
Journal Article 2023-06-23 ✓ 1 Snippet Wu Q, Li S, Zhang X, Dong N.
In-Text Gene Mentions

…diseases, such ashemochromatosis[ 104 ].…

Show Full Abstract

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

ECI2
Also flagged:metabolismCars2AdtrpAcsl5Scp2Aldoa
Journal Article 2023-06-23 ✓ 2 Snippets Engelhard CA, Khani S, Derdak S, Bilban M, Kornfeld JW.
In-Text Gene Mentions

Among the genes with significant isoform switches between cold-activated BAT compared to the controls, we observed phosphodiesterase 4D (Pde4d), regulating levels of the signaling intermediate cAMP, which activates lipolysis, glucose uptake, and thermogenesis in brown adipocytes;45 the thermogenesis regulating hydrolase androgen dependent TFPI regulating protein (Adtrp)46 and regulators of fatty acid metabolism (acyl-CoA synthetase long-chain family member 5, Acsl5; Perilipin 5, Plin5), glycolysis (Aldolase A; Aldoa), protein sorting (endoplasmic reticulum-golgi intermediate compartment 1; Ergic1; Myosin light polypeptide 6; Myl6), lipid synthesis (MLX interacting protein-like, Mlxipl; choline phospotransferase 1, Chpt1), beta-oxidation (sterol carrier protein 2, liver, Scp2; Enoyl-CoA Delta Isomerase 2, Eci2) and protein cysteinylation (cysteinyl-tRNA synthetase 2; Cars247;Figures 7C–7E, S7, and S9).

…Delta Isomerase 2,Eci2) and protein…

Show Full Abstract

Alternative transcription increases transcriptome complexity by expression of multiple transcripts per gene. Annotation and quantification of transcripts using short-read sequencing is non-trivial. Long-read sequencing aims at overcoming these problems by sequencing full-length transcripts. Activation of brown adipose tissue (BAT) thermogenesis involves major transcriptomic remodeling and positively affects metabolism via increased energy expenditure. We benchmark Oxford Nanopore Technology (ONT) long-read sequencing protocols to Illumina short-read sequencing assessing alignment characteristics, gene and transcript detection and quantification, differential gene and transcript expression, transcriptome reannotation, and differential transcript usage (DTU). We find ONT sequencing is superior to Illumina for transcriptome reassembly, reducing the risk of false-positive events by unambiguously mapping reads to transcripts. We identified novel isoforms of genes undergoing DTU in cold-activated BAT including <i>Cars2</i>, <i>Adtrp</i>, <i>Acsl5</i>, <i>Scp2</i>, <i>Aldoa</i>, and <i>Pde4d</i>, validated by real-time PCR. The reannotated murine BAT transcriptome established here provides a framework for future investigations into the regulation of BAT.

bioRxiv 2023-06-23 Preprint (No Snippets API) Hannon E, Dempster EL, Chioza B, Davies JP, Blake GE, Burrage J, Policicchio S, Franklin A, Walker EM, Bamford RA, Schalkwyk LC, Mill J.
Show Full Abstract

<h4>Background</h4> Due to inter-individual variation in the cellular composition of the human cortex, it is essential that covariates that capture these differences are included in epigenome-wide association studies using bulk tissue. As experimentally derived cell counts are often unavailable, computational solutions have been adopted to estimate the proportion of different cell-types using DNA methylation data. Here, we validate and profile the use of an expanded reference DNA methylation dataset incorporating two neuronal- and three glial-cell subtypes for quantifying the cellular composition of the human cortex. <h4>Results</h4> We tested eight reference panels containing different combinations of neuronal- and glial-cell types and characterized their performance in deconvoluting cell proportions from computationally reconstructed or empirically-derived human cortex DNA methylation data. Our analyses demonstrate that these novel brain deconvolution models produce accurate estimates of cellular proportions from profiles generated on postnatal human cortex samples, they are not appropriate for the use in prenatal cortex or cerebellum tissue samples. Applying our models to an extensive collection of empirical datasets, we show that glial cells are twice as abundant as neuronal cells in the human cortex and identify significant associations between increased Alzheimer’s disease neuropathology and the proportion of specific cell types including a decrease in NeuNNeg/SOX10Neg nuclei and an increase of NeuNNeg/SOX10Pos nuclei. <h4>Conclusions</h4> Our novel deconvolution models produce accurate estimates for cell proportions in the human cortex. These models are available as a resource to the community enabling the control of cellular heterogeneity in epigenetic studies of brain disorders performed on bulk cortex tissue.

SUDS3
Also flagged:VDACmitochondrialorganellemetabolismVDAC1AML
Journal Article 2023-06-22 ✓ 1 Snippet Pappalardo XG, Risiglione P, Zinghirino F, Ostuni A, Luciano D, Bisaccia F, De Pinto V, Guarino F, Messina A.
In-Text Gene Mentions

…and associated withpolycomb repressorsrepressors (Table 1…

Show Full Abstract

<h4>Background</h4>Voltage-dependent anion selective channels (VDACs) are the most abundant mitochondrial outer membrane proteins, encoded in mammals by three genes, VDAC1, 2 and 3, mostly ubiquitously expressed. As 'mitochondrial gatekeepers', VDACs control organelle and cell metabolism and are involved in many diseases. Despite the presence of numerous VDAC pseudogenes in the human genome, their significance and possible role in VDAC protein expression has not yet been considered.<h4>Results</h4>We investigated the relevance of processed pseudogenes of human VDAC genes, both in physiological and in pathological contexts. Using high-throughput tools and querying many genomic and transcriptomic databases, we show that some VDAC pseudogenes are transcribed in specific tissues and pathological contexts. The obtained experimental data confirm an association of the VDAC1P8 pseudogene with acute myeloid leukemia (AML).<h4>Conclusions</h4>Our in-silico comparative analysis between the VDAC1 gene and its VDAC1P8 pseudogene, together with experimental data produced in AML cellular models, indicate a specific over-expression of the VDAC1P8 pseudogene in AML, correlated with a downregulation of the parental VDAC1 gene.

Also flagged:MIcell cycleCardiovascular diseaseCVDischemic heart diseasemyocardial infarction
Journal Article 2023-06-22 No Snippets Arolkar G, Kumar SK, Wang H, Gonzalez KM, Kumar S, Bishnoi B, Rios Coronado PE, Woo YJ, Red-Horse K, Das S.
Show Full Abstract

<h4>Background</h4>Collateral arteries act as natural bypasses which reroute blood flow to ischemic regions and facilitate tissue regeneration. In an injured heart, neonatal artery endothelial cells orchestrate a systematic series of cellular events, which includes their outward migration, proliferation, and coalescence into fully functional collateral arteries. This process, called artery reassembly, aids complete cardiac regeneration in neonatal hearts but is absent in adults. The reason for this age-dependent disparity in artery cell response is completely unknown. In this study, we investigated if regenerative potential of coronary arteries is dictated by their ability to dedifferentiate.<h4>Methods</h4>Single-cell RNA sequencing of coronary endothelial cells was performed to identify differences in molecular profiles of neonatal and adult endothelial cells in mice. Findings from this in silico analyses were confirmed with in vivo experiments using genetic lineage tracing, whole organ immunostaining, confocal imaging, and cardiac functional assays in mice.<h4>Results</h4>Upon coronary occlusion, neonates showed a significant increase in actively cycling artery cells and expressed prominent dedifferentiation markers. Data from in silico pathway analyses and in vivo experiments suggested that upon myocardial infarction, cell cycle reentry of preexisting neonatal artery cells, the subsequent collateral artery formation, and recovery of cardiac function are dependent on arterial VegfR2 (vascular endothelial growth factor receptor-2). This subpopulation of dedifferentiated and proliferating artery cells was absent in nonregenerative postnatal day 7 or adult hearts.<h4>Conclusions</h4>These data indicate that adult artery endothelial cells fail to drive collateral artery development due to their limited ability to dedifferentiate and proliferate.

Also flagged:bindingDeltaCOVID-19Scell-surfacereceptor
Journal Article 2023-06-22 No Snippets Le HT, Tran LH, Phung HTT.
Show Full Abstract

The COVID-19 pandemic sparked an unprecedented race in biotechnology in a search for effective therapies and a preventive vaccine. The continued appearance of SARS-CoV-2 variants of concern (VoCs) further swept the world. The entry of SARS-CoV-2 into cells is mediated by binding the receptor-binding domain (RBD) of the S protein to the cell-surface receptor, human angiotensin-converting enzyme 2 (hACE2). In this study, using a coarse-grained force field to parameterize the system, we employed steered-molecular dynamics (SMD) simulations to reveal the binding of SARS-CoV-2 Delta/Omicron RBD to hACE2. Our benchmarked results demonstrate a good correlation between computed rupture force and experimental binding free energy for known protein-protein systems. Moreover, our findings show that the Omicron RBD has a weaker binding affinity to hACE2, consistent with the respective experimental results. This indicates that our method can effectively be applied to other emerging SARS-CoV-2 strains.Communicated by Ramaswamy H. Sarma.

Also flagged:CALM1CALM2CALM3long QT syndromecatecholaminergic polymorphic ventricular tachycardiaATP7A
Journal Article 2023-06-22 No Snippets Miller DT, Lee K, Abul-Husn NS, Amendola LM, Brothers K, Chung WK, Gollob MH, Gordon AS, Harrison SM, Hershberger RE, Klein TE, Richards CS, Stewart DR, Martin CL, ACMG Secondary Findings Working Group. Electronic address: documents@acmg.net.
Show Full Abstract

No abstract available.

HTT
Also flagged:HDcognitioncognitive declineneurodegenerative disordercytosineadenine
Journal Article 2023-06-22 ✓ 5 Snippets Mühlbäck A, Mana J, Wallner M, Frank W, Lindenberg KS, Hoffmann R, Klempířová O, Klempíř J, Landwehrmeyer GB, Bezdicek O, REGISTRY investigators of the European Huntington’s Disease Network, the Enroll-HD investigators.
In-Text Gene Mentions

HD is an autosomal-dominant, progressive neurodegenerative disorder caused by an expansion of a trinucleotide cytosine-adenine-guanine (CAG) repeat in the huntingtin gene (htt) [1] impairing motor and cognitive performance and disrupting behavior [2].

…huntingtin gene (htt) [ 1 ]…

…participants carrying thehtt- expansion mutation, either…

…carry th ehttexpansion mutation, i.e.,…

…range at thehtt-gene by undisclosed…

Show Full Abstract

<h4>Background</h4>A declining cognitive performance is a hallmark of Huntington's disease (HD). The neuropsychological battery of the Unified HD Rating Scale (UHDRS'99) is commonly used for assessing cognition. However, there is a need to identify and minimize the impact of confounding factors, such as language, gender, age, and education level on cognitive decline.<h4>Objectives</h4>Aim is to provide appropriate, normative data to allow clinicians to identify disease-associated cognitive decline in diverse HD populations by compensating for the impact of confounding factors METHODS: Sample data, N = 3267 (60.5% females; mean age of 46.9 years (SD = 14.61, range 18-86) of healthy controls were used to create a normative dataset. For each neuropsychological test, a Bayesian generalized additive model with age, education, gender, and language as predictors was constructed to appropriately stratify the normative dataset.<h4>Results</h4>With advancing age, there was a non-linear decline in cognitive performance. In addition, performance was dependent on educational levels and language in all tests. Gender had a more limited impact. Standardized scores have been calculated to ease the interpretation of an individual's test outcome. A web-based online tool has been created to provide free access to normative data.<h4>Conclusion</h4>For defined neuropsychological tests, the impact of gender, age, education, and language as factors confounding disease-associated cognitive decline can be minimized at the level of a single patient examination.

Also flagged:GAFIRF1IFNαIFNγIFN-IIFN-II
Journal Article 2023-06-22 No Snippets Sekrecka A, Kluzek K, Sekrecki M, Boroujeni ME, Hassani S, Yamauchi S, Sada K, Wesoly J, Bluyssen HAR.
Show Full Abstract

To understand in detail the transcriptional and functional overlap of IFN-I- and IFN-II-activated responses, we used an integrative RNAseq-ChIPseq approach in Huh7.5 cells and characterized the genome-wide role of pSTAT1, pSTAT2, IRF9 and IRF1 in time-dependent ISG expression. For the first time, our results provide detailed insight in the timely steps of IFNα- and IFNγ-induced transcription, in which pSTAT1- and pSTAT2-containing ISGF3 and GAF-like complexes and IRF1 are recruited to individual or combined ISRE and GAS composite sites in a phosphorylation- and time-dependent manner. Interestingly, composite genes displayed a more heterogeneous expression pattern, as compared to GAS (early) and ISRE genes (late), with the time- and phosphorylation-dependent recruitment of GAF, ISGF3 and IRF1 after IFNα stimulation and GAF and IRF1 after IFNγ. Moreover, functional composite genes shared features of GAS and ISRE genes through transcription factor co-binding to closely located sites, and were able to sustain IFN responsiveness in STAT1-, STAT2-, IRF9-, IRF1- and IRF9/IRF1-mutant Huh7.5 cells compared to Wt cells. Thus, the ISRE + GAS composite site acted as a molecular switch, depending on the timely available components and transcription factor complexes. Consequently, STAT1, STAT2 and IRF9 were identified as functional composite genes that are part of a positive feedback loop controlling long-term IFNα and IFNγ responses. More important, in the absence of any one of the components, the positive feedback regulation of the ISGF3 and GAF components appeared to be preserved. Together, these findings provide further insight in the existence of a novel ISRE + GAS composite-dependent intracellular amplifier circuit prolonging ISG expression and controlling cellular responsiveness to different types of IFNs and subsequent antiviral activity. It also offers an explanation for the existing molecular and functional overlap between IFN-I- and IFN-II-activated ISG expression.

TAOK3
Also flagged:Obesitymetabolic disordertype 2 diabetes mellitushyperlipidemiahypertensioncancers
Journal Article 2023-06-22 ✓ 5 Snippets Maes B, Fayazpour F, Catrysse L, Lornet G, Van De Velde E, De Wolf C, De Prijck S, Van Moorleghem J, Vanheerswynghels M, Deswarte K, Descamps B, Vanhove C, Van der Schueren B, Vangoitsenhoven R, Hammad H, Janssens S, Lambrecht BN.
In-Text Gene Mentions

After an injection of a bolus of insulin, HFD-fed Taok3−/− mice displayed vastly improved insulin sensitivity, as reflected by a more marked and sustained drop in the blood glucose concentration (Fig. 4 B).

Absence of TAOK3 sustains Tregs in obesity and improves metabolic dysfunction.

To do so, TAOK3 kinase dead mice (Taok3KD mice) were generated, where a lysine is substituted with an alanine at amino acid position 53, inhibiting ATP binding to the kinase domain (Maes et al., 2022).

In Taok3+/+ mice, an HFD feeding led to higher fasted serum insulin concentrations compared with SD-fed mice, reflective of HFD-induced insulin resistance in this model.

To address the effects of diet-induced obesity (DIO), Taok3−/− mice and Taok3+/+ littermates were fed a standard diet (SD) or HFD for at least 10 wk.

Show Full Abstract

Healthy adipose tissue (AT) contains ST2+ Tregs, ILC2s, and alternatively activated macrophages that are lost in mice or humans on high caloric diet. Understanding how this form of type 2 immunity is regulated could improve treatment of obesity. The STE20 kinase Thousand And One amino acid Kinase-3 (TAOK3) has been linked to obesity in mice and humans, but its precise function is unknown. We found that ST2+ Tregs are upregulated in visceral epididymal white AT (eWAT) of Taok3-/- mice, dependent on IL-33 and the kinase activity of TAOK3. Upon high fat diet feeding, metabolic dysfunction was attenuated in Taok3-/- mice. ST2+ Tregs disappeared from eWAT in obese wild-type mice, but this was not the case in Taok3-/- mice. Mechanistically, AT Taok3-/- Tregs were intrinsically more responsive to IL-33, through higher expression of ST2, and expressed more PPARγ and type 2 cytokines. Thus, TAOK3 inhibits adipose tissue Tregs and regulates immunometabolism under excessive caloric intake.

Also flagged:gene expressionwaternitrogenacetonethymidineformamide
Journal Article 2023-06-22 No Snippets Fan Y, Andrusivová Ž, Wu Y, Chai C, Larsson L, He M, Luo L, Lundeberg J, Wang B.
Show Full Abstract

Capture array-based spatial transcriptomics methods have been widely used to resolve gene expression in tissues; however, their spatial resolution is limited by the density of the array. Here we present expansion spatial transcriptomics to overcome this limitation by clearing and expanding tissue prior to capturing the entire polyadenylated transcriptome with an enhanced protocol. This approach enables us to achieve higher spatial resolution while retaining high library quality, which we demonstrate using mouse brain samples.

HFE
Also flagged:diabetes mellituschronic metabolic disorderhyperglycemiainsulinsecretioninsulin resistance
Journal Article 2023-06-22 ✓ 1 Snippet Meng X, Liu X, Tan J, Sheng Q, Zhang D, Li B, Zhang J, Zhang F, Chen H, Cui T, Li M, Zhang S.
In-Text Gene Mentions

…as well ashemochromatosis[ 202 ].…

Show Full Abstract

Diabetes mellitus (DM) is a chronic metabolic disorder characterized by hyperglycemia resulting from insulin secretion defects or insulin resistance. The global incidence of DM has been gradually increasing due to improvements in living standards and changes in dietary habits, making it a major non-communicable disease that poses a significant threat to human health and life. The pathogenesis of DM remains incompletely understood till now, and current pharmacotherapeutic interventions are largely inadequate, resulting in relapses and severe adverse reactions. Although DM is not explicitly mentioned in traditional Chinese medicine (TCM) theory and clinical practice, it is often classified as "Xiaoke" due to similarities in etiology, pathogenesis, and symptoms. With its overall regulation, multiple targets, and personalized medication approach, TCM treatment can effectively alleviate the clinical manifestations of DM and prevent or treat its complications. Furthermore, TCM exhibits desirable therapeutic effects with minimal side effects and a favorable safety profile. This paper provides a comprehensive comparison and contrast of Xiaoke and DM by examining the involvement of TCM in their etiology, pathogenesis, treatment guidelines, and other relevant aspects based on classical literature and research reports. The current TCM experimental research on the treatment of DM by lowering blood glucose levels also be generalized. This innovative focus not only illuminates the role of TCM in DM treatment, but also underscores the potential of TCM in DM management.

Also flagged:leukodystrophymetabolismgluconeogenesisamino acidsphosphorylationleukodystrophies
Journal Article 2023-06-22 No Snippets Man JHK, van Gelder CAGH, Breur M, Molenaar D, Abbink T, Altelaar M, Bugiani M, van der Knaap MS.
Show Full Abstract

Vanishing white matter (VWM) is a leukodystrophy that primarily manifests in young children. In this disease, the brain white matter is differentially affected in a predictable pattern with telencephalic brain areas being most severely affected, while others remain allegedly completely spared. Using high-resolution mass spectrometry-based proteomics, we investigated the proteome patterns of the white matter in the severely affected frontal lobe and normal appearing pons in VWM and control cases to identify molecular bases underlying regional vulnerability. By comparing VWM patients to controls, we identified disease-specific proteome patterns. We showed substantial changes in both the VWM frontal and pons white matter at the protein level. Side-by-side comparison of brain region-specific proteome patterns further revealed regional differences. We found that different cell types were affected in the VWM frontal white matter than in the pons. Gene ontology and pathway analyses identified involvement of region specific biological processes, of which pathways involved in cellular respiratory metabolism were overarching features. In the VWM frontal white matter, proteins involved in glycolysis/gluconeogenesis and metabolism of various amino acids were decreased compared to controls. By contrast, in the VWM pons white matter, we found a decrease in proteins involved in oxidative phosphorylation. Taken together, our data show that brain regions are affected in parallel in VWM, but to different degrees. We found region-specific involvement of different cell types and discovered that cellular respiratory metabolism is likely to be differentially affected across white matter regions in VWM. These region-specific changes help explain regional vulnerability to pathology in VWM.

HFE
Also flagged:non-alcoholic steatohepatitis11-Dodecenoic acidNASHliver cirrhosishepatocellular carcinomalipid
Journal Article 2023-06-22 ✓ 1 Snippet Xu X, Qiu J, Li X, Chen J, Li Y, Huang X, Zang S, Ma X, Liu J.
In-Text Gene Mentions

…liver illnesses, includinghemochromatosis, alcohol-associated liver dis…

Show Full Abstract

<h4>Background</h4>Non-alcoholic steatohepatitis (NASH) is a major contributor to liver cirrhosis and hepatocellular carcinoma. There remains no effective pharmacological therapy. The hepatic lipid metabolism and fatty acid β-oxidation are regulated by Perilipin5 (Plin5). However, it is yet unknown how Plin5 affects NASH and the molecular process.<h4>Methods</h4>High-fat, high-cholesterol and high-fructose (HFHC) diets were used to mimic the progression of NASH in wild type (WT) mice and Plin5 knockout (Plin5 KO) mice. The degree of ferroptosis was measured by detecting the expression of key genes of ferroptosis and the level of lipid peroxide. The degree of NASH was judged by observing the morphology of the liver, detecting the expression of inflammation and fibrosis related genes of liver damage. Plin5 was overexpressed in the liver of mice by tail vein injection of adenovirus, and the process of NASH was simulated by methionine choline deficiency (MCD) diet. The occurrence of ferroptosis and NASH was detected by the same detection method. Targeted lipidomics sequencing was used to detect the difference in free fatty acid expression in the WT Plin5 KO group. Finally, it was verified in cell experiments to further study the effect of free fatty acids on ferroptosis of hepatocytes.<h4>Results</h4>In various NASH models, hepatic Plin5 was dramatically reduced. Plin5 knockout (KO) worsened NASH-associated characteristics in mice given a high-fat/high-cholesterol (HFHC) diet, such as lipid accumulation, inflammation and hepatic fibrosis. It has been shown that ferroptosis is involved in NASH progression. We revealed that Plin5 KO in mice aggravated the degree of ferroptosis in NASH models. Conversely, overexpression of Plin5 significantly alleviated ferroptosis and further ameliorated progression of MCD-induced NASH. Analysis of livers obtained from HFHC diet-fed mice by targeted lipidomics revealed that 11-Dodecenoic acid was significantly decreased in Plin5 KO mice. Addition of 11-Dodecenoia acid to Plin5 knockdown hepatocytes effectively prevented ferroptosis.<h4>Conclusion</h4>Our study demonstrates that Plin5 protects against NASH progression by increasing 11-Dodecenoic acid level and further inhibiting ferroptosis, suggesting that Plin5 has therapeutic potential as a target for the management of NASH.

PRDX6
Also flagged:breathing disordersPHOX2BHedgehogHOXpolyalanineneurogenic disorder
Journal Article 2023-06-22 ✓ 1 Snippet Lui KN, Li Z, Lai FP, Lau ST, Ngan ES.
In-Text Gene Mentions

…and r6 (PRDX6) ( Figures…

Show Full Abstract

Retrotrapezoid nucleus (RTN) neurons in the brainstem regulate the ventilatory response to hypercarbia. It is unclear how PHOX2B-polyalanine repeat mutations (PHOX2B-PARMs) alter the function of PHOX2B and perturb the formation of RTN neurons. Here, we generated human brainstem organoids (HBSOs) with RTN-like neurons from human pluripotent stem cells. Single-cell transcriptomics revealed that expression of PHOX2B+7Ala PARM alters the differentiation trajectories of the hindbrain neurons and hampers the formation of the RTN-like neurons in HBSOs. With the unguided cerebral organoids (HCOs), PHOX2B+7Ala PARM interrupted the patterning of PHOX2B+ neurons with dysregulation of Hedgehog pathway and HOX genes. With complementary use of HBSOs and HCOs with a patient and two mutant induced pluripotent stem cell lines carrying different polyalanine repetition in PHOX2B, we further defined the association between the length of polyalanine repetition and malformation of RTN-respiratory center and demonstrated the potential toxic gain of function of PHOX2B-PARMs, highlighting the uniqueness of these organoid models for disease modeling.

MRPL39
Also flagged:Facioscapulohumeral Muscular DystrophyFSHDmitochondrial respiratory complexesmitochondrial ribosomal proteinsoligonucleotidedouble homeobox 4
Journal Article 2023-06-22 ✓ 1 Snippet Nishimura Y, Bittel AJ, Stead CA, Chen YW, Burniston JG.
In-Text Gene Mentions

…FSHD myoblasts, includingMRPL39, MRPL27, MRPL37, MRPL24,…

Show Full Abstract

Proteomic studies in facioscapulohumeral muscular dystrophy (FSHD) could offer new insight into disease mechanisms underpinned by post-transcriptional processes. We used stable isotope (deuterium oxide; D<sub>2</sub>O) labeling and peptide mass spectrometry to investigate the abundance and turnover rates of proteins in cultured muscle cells from two individuals affected by FSHD and their unaffected siblings (UASb). We measured the abundance of 4420 proteins and the turnover rate of 2324 proteins in each (n = 4) myoblast sample. FSHD myoblasts exhibited a greater abundance but slower turnover rate of subunits of mitochondrial respiratory complexes and mitochondrial ribosomal proteins, which may indicate an accumulation of "older" less viable mitochondrial proteins in myoblasts from individuals affected by FSHD. Treatment with a 2'-O-methoxyethyl modified antisense oligonucleotide targeting exon 3 of the double homeobox 4 (DUX4) transcript tended to reverse mitochondrial protein dysregulation in FSHD myoblasts, indicating the effect on mitochondrial proteins may be a DUX4-dependent mechanism. Our results highlight the importance of post-transcriptional processes and protein turnover in FSHD pathology and provide a resource for the FSHD research community to explore this burgeoning aspect of FSHD.

ARFGEF2
Also flagged:methyladenosinemethylationmicroplasticscardiovascular diseaseMETTL3endocytosis
Journal Article 2023-06-22 ✓ 1 Snippet Zhang M, Shi J, Zhou J, Song L, Ding J, Deng HP, Weng L, Zhu Y, Xu Z.
In-Text Gene Mentions

…the expression of circ-Arfgef2and lncG3bp2 were…

Show Full Abstract

Owing to their potential adverse health effects, global contamination by microplastics (MPs) has attracted increased scientific and societal concerns. However, in vivo studies on MP toxicity, along with its effects and underlying mechanisms, remain limited. We recently found that non-coding RNA (ncRNAs) contribute to MP-mediated vascular toxicity. Moreover, previous studies have identified N6-methyladenosine (m6A) modifications in ncRNAs as influencing factors in cardiovascular disease. However, whether and how m6A modifications in ncRNAs are affected by MP-induced cardiotoxicity remain unknown. Herein, we profiled differentially expressed ncRNAs and their related m6A modification profiles in MP-exposed myocardial tissue using RNA sequencing (RNA-seq) and methylated RNA immunoprecipitation sequencing (MeRIP-seq). First, we observed that MPs accumulated in different organs and upregulated apoptosis in the heart, liver, spleen, and kidney cells. Furthermore, total m6A and METTL3 levels increased in the myocardium after exposure to MPs. RNA-seq results revealed that 392 lncRNAs and 302 circRNAs were differentially expressed in MP-treated mouse myocardium compared to the control group. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses showed that these altered lncRNAs and circRNAs were closely associated with endocytosis, cellular senescence, and cell cycle signaling pathways, which may cause cardiotoxicity. Furthermore, MeRIP-seq data showed different distributions and abundances of m6A modifications in lncRNAs and circRNAs. Additionally, we identified differentially m6A methylated lncRNAs and circRNAs through conjoint analysis of the two high-throughput sequencing datasets and found that both m6A modifications and the expression of circ-Arfgef2 and lncG3bp2 were upregulated after exposure to MPs. This suggests that MP-induced m6A modifications in ncRNAs are involved in cardiotoxicity. Our findings contribute to a better understanding of MP-induced cardiotoxicity and new molecular targets for treating cardiac injury.

TNFSF4
Also flagged:essential tremorneurological disorderETGene ExpressionAPOESENP6
Journal Article 2023-06-22 ✓ 3 Snippets Gao Y, Ding L, Liu J, Wang X, Meng Q.
In-Text Gene Mentions

The results revealed that CD47 and TNFSF4 exhibited high expression levels in patients with ET, while LGALS9, PDCD1, and TNFRSF14 were highly expressed in the normal group, as depicted in Figure 5c.

…that CD47 andTNFSF4exhibited high expression…

…was observed amongTNFSF4, TNFRSF14, and the…

Show Full Abstract

Essential tremor (ET) is a common neurological disorder with a difficult clinical diagnosis, primarily due to the lack of relevant biomarkers. The current study aims to identify possible biomarkers for ET by screening miRNAs using machine learning algorithms. In this investigation, public datasets and our own datasets were used to examine the ET disorder. The ET datasets originated from public sources. To generate our own dataset, high-throughput sequencing analyses were performed on ET and control samples from the First People's Hospital of Yunnan Province. Functional enrichment analysis was employed to identify the potential function of differentially expressed genes (DEGs). Using datasets from the Gene Expression Omnibus database, Lasso regression analysis and support vector machine recursive feature elimination were used to screen potential diagnostic genes for ET. To identify the genes responsible for the final diagnosis, area under the curves (AUCs) of the receiver operating characteristic was examined. Finally, an ssGSEA representing an ET immune landscape was created. The sample exhibited expression profiles that corresponded with six genes in the public database. Three diagnostic genes were discovered with AUCs >0.7 that can distinguish ET from normal data: APOE, SENP6, and ZNF148. Single-gene GSEA indicated that these diagnostic genes were closely associated with the cholinergic, GABAergic, and dopaminergic synapse networks. The immune microenvironment of ET was also affected by these diagnostic genes. According to the findings, these three DEGs (<i>APOE</i>, <i>SENP6</i>, and <i>ZNF148</i>) may successfully differentiate between samples from ET patients and normal controls, serving as a helpful diagnostic tool. This effort provided a theoretical foundation for elucidating the pathogenesis of ET and raised hopes of overcoming the diagnostic difficulty of ET clinically.

SERPINC1
Also flagged:antithrombin (AT) deficiency
Journal Article 2023-06-22 ✓ 2 Snippets Chen W, Wang Y, Shen L, Huang S, Yang X, Wu D.
In-Text Gene Mentions

…a mutation ofSERPINC1c.236G>A (p.R79H).…

…Mutation ofSERPINC1is related to…

Show Full Abstract

Mutation of SERPINC1 is related to the incidence of Inherited antithrombin (AT) deficiency. In this study, we generated a human induced pluripotent stem cell (iPSC) line from peripheral blood mononuclear cells of a patient with a mutation of SERPINC1 c.236G>A (p.R79H). The generated iPSCs express pluripotent cell markers with no mycoplasma contamination. Besides, it has a normal female karyotype and could differentiate into all three germ layers in vitro.

PRDX6
Also flagged:Peroxinredoxin 6autophagypathogenesischronic obstructive pulmonary diseaseCOPDPeroxiredoxin
Journal Article 2023-06-22 ✓ 5 Snippets Luo J, Wang X, Wei T, Lang K, Bao C, Yang D.
In-Text Gene Mentions

Third, it is necessary to investigate the roles of PRDX6 in specific signaling pathways, such as the PINK1/Parkin pathway, to further examine the mechanisms of PRDX6 in regulating autophagy and senescence in COPD.

…studies indicate thatPRDX6could activate autophagy…

…study investigated whetherPRDX6-regulated autophagy was invol…

…the knockdown ofPRDX6expression.…

…mRNA levels ofPRDX6, autophagy and senescence-ass…

Show Full Abstract

Cigarette smoke (CS)-induced accelerated senescence and insufficient autophagy has been implicated in the pathogenesis of chronic obstructive pulmonary disease (COPD). Peroxiredoxin (PRDX) 6 is a protein with prevalent antioxidant capacity. Previous studies indicate that PRDX6 could activate autophagy and alleviate senescence in other diseases. The present study investigated whether PRDX6-regulated autophagy was involved in the regulation of CS extract (CSE)-induced BEAS-2B cell senescence via the knockdown of PRDX6 expression. Furthermore, the present study evaluated the mRNA levels of PRDX6, autophagy and senescence-associated genes in the small airway epithelium from patients with COPD by analyzing the GSE20257 dataset from the Gene Expression Omnibus database. The results demonstrated that CSE reduced PRDX6 expression levels and transiently induced the activation of autophagy, followed by the accelerated senescence of BEAS-2B cells. Knockdown of PRDX6 induced autophagy degradation and accelerated senescence in CSE-treated BEAS-2B cells. Furthermore, autophagy inhibition by 3-Methyladenine increased P16 and P21 expression levels, while autophagy activation by rapamycin reduced P16 and P21 expression levels in CSE-treated BEAS-2B cells. The GSE20257 dataset revealed that patients with COPD had lower PRDX6, sirtuin (SIRT) 1 and SIRT6 mRNA levels, and higher P62 and P16 mRNA levels compared with non-smokers. P62 mRNA was significantly correlated with P16, P21 and SIRT1, which indicated that insufficient autophagic clearance of damaged proteins could be involved in accelerated cell senescence in COPD. In conclusion, the present study demonstrated a novel protective role for PRDX6 in COPD. Furthermore, a reduction in PRDX6 could accelerate senescence by inducing autophagy impairment in CSE-treated BEAS-2B cells.

SOX6
Also flagged:vitamin Cneurogenesissodium-dependent vitamin C transporter 2ascorbic aciddehydroascorbic acidtransporter
Journal Article 2023-06-22 ✓ 1 Snippet Salazar K, Jara N, Ramírez E, de Lima I, Smith-Ghigliotto J, Muñoz V, Ferrada L, Nualart F.
In-Text Gene Mentions

In addition, vitamin C induces the expression of miRNA that regulates the Kdm6b, Klf13 and Sox6 genes, which inhibits cell differentiation and development.

Show Full Abstract

Different studies have established the fundamental role of vitamin C in proliferation, differentiation, and neurogenesis in embryonic and adult brains, as well as in <i>in vitro</i> cell models. To fulfill these functions, the cells of the nervous system regulate the expression and sorting of sodium-dependent vitamin C transporter 2 (SVCT2), as well as the recycling of vitamin C between ascorbic acid (AA) and dehydroascorbic acid (DHA) via a bystander effect. SVCT2 is a transporter preferentially expressed in neurons and in neural precursor cells. In developmental stages, it is concentrated in the apical region of the radial glia, and in adult life, it is expressed preferentially in motor neurons of the cerebral cortex, starting on postnatal day 1. In neurogenic niches, SVCT2 is preferentially expressed in precursors with intermediate proliferation, where a scorbutic condition reduces neuronal differentiation. Vitamin C is a potent epigenetic regulator in stem cells; thus, it can induce the demethylation of DNA and histone H3K27m3 in the promoter region of genes involved in neurogenesis and differentiation, an effect mediated by Tet1 and Jmjd3 demethylases, respectively. In parallel, it has been shown that vitamin C induces the expression of stem cell-specific microRNA, including the Dlk1-Dio3 imprinting region and miR-143, which promotes stem cell self-renewal and suppresses <i>de novo</i> expression of the methyltransferase gene Dnmt3a. The epigenetic action of vitamin C has also been evaluated during gene reprogramming of human fibroblasts to induced pluripotent cells, where it has been shown that vitamin C substantially improves the efficiency and quality of reprogrammed cells. Thus, for a proper effect of vitamin C on neurogenesis and differentiation, its function as an enzymatic cofactor, modulator of gene expression and antioxidant is essential, as is proper recycling from DHA to AA by various supporting cells in the CNS.

DCC
Also flagged:extrahepatic cholangiocarcinomadistal cholangiocarcinomacancerS100hematoxylinnerve fibers
Journal Article 2023-06-22 ✓ 5 Snippets Ogasawara H, Yoshizawa T, Oshima K, Ogasawara K, Kubota S, Goto S, Morohashi S, Wakiya T, Kimura N, Ishido K, Kijima H, Hakamada K.
In-Text Gene Mentions

As shown in Figures 3F–I, DCC infiltrating along the thin nerve fibers was continuously branching and an area of thick nerve fibers transected by cancer was observed (Supplementary Movie S1).

…the parts ofDCCcloser to the…

DCCformed a tubular…

DCCexhibited continuous infiltrat…

…the PNI ofDCC, providing new insights…

Show Full Abstract

Perineural invasion (PNI) is a characteristic invasion pattern of distal cholangiocarcinoma (DCC). Conventional histopathologic examination is a challenging approach to analyze the spatial relationship between cancer and neural tissue in full-thickness bile duct specimens. Therefore, we used a tissue clearing method to examine PNI in DCC with three-dimensional (3D) structural analysis. The immunolabeling-enabled 3D imaging of solvent-cleared organs method was performed to examine 20 DCC specimens from five patients and 8 non-neoplastic bile duct specimens from two controls. The bile duct epithelium and neural tissue were labeled with CK19 and S100 antibodies, respectively. Two-dimensional hematoxylin/eosin staining revealed only PNI around thick nerve fibers in the deep layer of the bile duct, whereas PNI was not identified in the superficial layer. 3D analysis revealed that the parts of DCC closer to the mucosa exhibited more nerves than the normal bile duct. The nerve fibers were continuously branched and connected with thick nerve fibers in the deep layer of the bile duct. DCC formed a tubular structure invading from the epithelium and extending around thin nerve fibers in the superficial layer. DCC exhibited continuous infiltration around the thick nerve fibers in the deep layer. This is the first study using a tissue clearing method to examine the PNI of DCC, providing new insights into the underlying mechanisms.

DCC
Also flagged:colorectal cancercancerscancercolorectal cancerssecondprimary cancer
Journal Article 2023-06-22 ✓ 1 Snippet Li T, Liu Z, Bai F, Xiao H, Zhou H.
In-Text Gene Mentions

…segmental resection forDCCwas also associated…

Show Full Abstract

<h4>Background</h4>Second primary colorectal cancer (CRC) is attributed to a crucial component of the CRC population. Still, its treatments remain unclear due to the troublesome conditions originating from multiple primary cancers and the lack of quality evidence. This study aimed to determine that which type of surgical resection is the eligible treatment for second primary CRC among patients with a prior cancer history.<h4>Methods</h4>This cohort study retrospectively collected patients with second primary stage 0-III CRC in the Surveillance, Epidemiology, and End Results database from 2000 to 2017. Prevalence of surgical resection in second primary CRC, overall survival (OS) and disease-specific survival (DSS) of patients who received different surgical interventions were estimated.<h4>Results</h4>A total of 38,669 patients with second primary CRC were identified. Most of the patients (93.2%) underwent surgical resection as initial treatment. Approximately 39.2% of the second primary CRCs (<i>N</i> = 15,139) were removed with segmental resection, while 54.0% (<i>N</i> = 20,884) were removed through radical colectomy/proctectomy. Surgical resection was associated with a significantly favorable OS and DSS compared to those not receiving any surgical operations for second primary CRC [OS: adjusted Hazard ratios (adjusted HR): 0.35; 95% CI: 0.34-0.37, <i>p</i> < 0.001; DSS: adjusted HR: 0.27; 95% CI: 0.25-0.29, <i>p</i> < 0.001]. Segmental resection considerably outperformed radical resection in terms of OS and DSS (OS: adjusted HR: 0.97; 95% CI: 0.91-1.00, <i>p</i> = 0.07; DSS: adjusted HR: 0.92; 95% CI: 0.87-0.97, <i>p</i> = 0.002). Segmental resection was also associated with a significantly reduced cumulative mortality of postoperative non-cancer comorbidities.<h4>Conclusion</h4>Surgical resection demonstrated excellent oncological superiority for second primary CRC and was used to remove the vast majority of second primary CRCs. In comparison to radical resection, segmental resection offered a better prognosis and reduced postoperative non-cancer complications. The second primary colorectal cancers should be resected if the patients can afford surgical operations.

DCC
Also flagged:colorectal cancermalignant tumorscolorectal diseasecolorectal tumorssecretionbile acids
Journal Article 2023-06-22 ✓ 2 Snippets Dong Z, Shi R, Li P, Song X, Dong F, Zhu J, Wu R, Liang Z, Du M, Wang J, Yang Z.
In-Text Gene Mentions

Several specific and cumulative genetic changes occur during colorectal tumorigenesis, including mutation and activation of the cellular proto-oncogene Ki-ras and inactivation of tumor suppressor genes such as P53, hMSH2, APC, and DCC. If the above genetic alterations occur in colorectal epithelial cells (EC) in patients with cholelithiasis, the correlation between cholelithiasis and CRC can be evaluated in comparison with the healthy population without cholelithiasis (Werner et al., 1977).

…APC , andDCC.…

Show Full Abstract

With the increasing number of cholecystectomy and the high proportion of colorectal cancer in malignant tumors, the question of whether cholecystectomy is a risk factor for colorectal disease has been widely concerned. After reviewing the literature at home and abroad, the authors will summarize the research progress of the correlation between the occurrence of colorectal tumors after cholecystectomy, in order to provide help for the prevention and treatment of colorectal tumors.

DCC
Also flagged:pathogenesisCOVID-19SLEsystemic lupus erythematosusGene ExpressionTF
Journal Article 2023-06-22 ✓ 1 Snippet Zeng H, Zhuang Y, Li X, Yin Z, Huang X, Peng H.
In-Text Gene Mentions

…LCK, KLRF1, CDC6,DCC, CACNA1I, FASLG ,…

Show Full Abstract

<h4>Objective</h4>Evidences show that there may be a link between SLE and COVID-19. The purpose of this study is to screen out the diagnostic biomarkers of systemic lupus erythematosus (SLE) with COVID-19 and explore the possible related mechanisms by the bioinformatics approach.<h4>Methods</h4>SLE and COVID-19 datasets were extracted separately from the NCBI Gene Expression Omnibus (GEO) database. The limma package in <i>R</i> was used to obtain the differential genes (DEGs). The protein interaction network information (PPI) and core functional modules were constructed in the STRING database using Cytoscape software. The hub genes were identified by the Cytohubba plugin, and TF-gene together with TF-miRNA regulatory networks were constructed <i>via</i> utilizing the Networkanalyst platform. Subsequently, we generated subject operating characteristic curves (ROC) to verify the diagnostic capabilities of these hub genes to predict the risk of SLE with COVID-19 infection. Finally, a single-sample gene set enrichment (ssGSEA) algorithm was used to analyze immune cell infiltration.<h4>Results</h4>A total of 6 common hub genes (<i>CDC6, PLCG1, KIF15, LCK, CDC25C</i>, and <i>RASGRP1</i>) were identified with high diagnostic validity. These gene functional enrichments were mainly involved in cell cycle, and inflammation-related pathways. Compared to the healthy controls, abnormal infiltration of immune cells was found in SLE and COVID-19, and the proportion of immune cells linked to the 6 hub genes.<h4>Conclusion</h4>Our research logically identified 6 candidate hub genes that could predict SLE complicated with COVID-19. This work provides a foothold for further study of potential pathogenesis in SLE and COVID-19.

ZNFX1
Also flagged:Hemophagocytic Lymphohistiocytosisinfectionpathogenesisfamilial hemophagocytic lymphohistiocytosisHyperferritinemiaCXCL9
Journal Article 2023-06-22 ✓ 1 Snippet Chinnici A, Beneforti L, Pegoraro F, Trambusti I, Tondo A, Favre C, Coniglio ML, Sieni E.
In-Text Gene Mentions

Recently, heterozygous mutations in CD48 have also been associated to HLH (38) as well as biallelic ZNFX1 loss-of-function variants that have been reported in three families with HLH or HLH-like disease (39).

Show Full Abstract

Hemophagocytic Lymphohistiocytosis (HLH) is a rare clinical condition characterized by sustained but ineffective immune system activation, leading to severe and systemic hyperinflammation. It may occur as a genetic or sporadic condition, often triggered by an infection. The multifaceted pathogenesis results in a wide range of non-specific signs and symptoms, hampering early recognition. Despite a great improvement in terms of survival in the last decades, a considerable proportion of patients with HLH still die from progressive disease. Thus, prompt diagnosis and treatment are crucial for survival. Faced with the complexity and the heterogeneity of syndrome, expert consultation is recommended to correctly interpret clinical, functional and genetic findings and address therapeutic decisions. Cytofluorimetric and genetic analysis should be performed in reference laboratories. Genetic analysis is mandatory to confirm familial hemophagocytic lymphohistiocytosis (FHL) and Next Generation Sequencing is increasingly adopted to extend the spectrum of genetic predisposition to HLH, though its results should be critically discussed with specialists. In this review, we critically revise the reported laboratory tools for the diagnosis of HLH, in order to outline a comprehensive and widely available workup that allows to reduce the time between the clinical suspicion of HLH and its final diagnosis.

BTN2A1
Also flagged:B cell malignanciesantibodiesCD20cancerB-cell malignanciesB cell lymphoma
Journal Article 2023-06-22 ✓ 1 Snippet Rimailho L, Faria C, Domagala M, Laurent C, Bezombes C, Poupot M.
In-Text Gene Mentions

…cluding butyrophilins (BTN3A1/BTN2A1), the ABCA1 transporter,…

Show Full Abstract

Despite the advancements in therapy for B cell malignancies and the increase in long-term survival of patients, almost half of them lead to relapse. Combinations of chemotherapy and monoclonal antibodies such as anti-CD20 leads to mixed outcomes. Recent developments in immune cell-based therapies are showing many encouraging results. γδ T cells, with their potential of functional plasticity and their anti-tumoral properties, emerged as good candidates for cancer immunotherapies. The representation and the diversity of γδ T cells in tissues and in the blood, in physiological conditions or in B-cell malignancies such as B cell lymphoma, chronic lymphoblastic leukemia or multiple myeloma, provides the possibility to manipulate them with immunotherapeutic approaches for these patients. In this review, we summarized several strategies based on the activation and tumor-targeting of γδ T cells, optimization of expansion protocols, and development of gene-modified γδ T cells, using combinations of antibodies and therapeutic drugs and adoptive cell therapy with autologous or allogenic γδ T cells following potential genetic modifications.

Also flagged:Cancerbreast cancertumorsinvasive breast cancerCA125carcinoembryonic antigen
Journal Article 2023-06-22 No Snippets Sultana GNN, Akter F, Israfil SMH, Ray UC, Jahan RA, Ali MS, Din SA, Rahman S, Halim R, Alam MS.
Show Full Abstract

<h4>Introduction</h4>According to the GLOBOCAN (Global Cancer Observatory) 2020 report, 13,028 new cases of breast cancer (19%) were diagnosed in the United States, and 6,783 of them succumbed to the disease, making it the most common cancer among women. The clinical stage at the time of diagnosis is one of the most significant survival predictors in breast cancer. With delayed illness detection comes a lower survival rate. The prognosis of breast cancer may be predicted using circulating cell-free DNA (cfDNA), a non-invasive diagnosis technique.<h4>Objective</h4>This study aimed to determine the most sensitive and effective method for detecting changes in cfDNA levels and for using cfDNA as a diagnostic and prognostic marker of breast cancer.<h4>Methods</h4>The potential function of serum cfDNA levels as a marker for early breast cancer diagnosis was investigated using UV spectrophotometric, fluorometric, and real-time qPCR assays.<h4>Results</h4>This research suggests that the most successful way to measure the amount of cfDNA described decades ago could be used as a "liquid biopsy" to track cancer in real time. The RT-qPCR (ALU115) method produced the most statistically significant results (p=0.000). At the threshold concentration of 395.65 ng/ml of cfDNA, the ROC curve reflects the maximum AUC= 0.7607, with a sensitivity of 0.65 and specificity of 0.80.<h4>Conclusion</h4>For a preliminary assessment of total circulating cfDNA, a combination of all of the above techniques will be most efficacious. Based on our results, we conclude that the RT-qPCR technique combined with fluorometric measurement can identify a statistically significant difference in cfDNA levels between cohorts of breast cancer patients and healthy controls.

DCC
Also flagged:colorectal cancercancergold nanoparticleslipidendocytosisphagocytosis
Journal Article 2023-06-22 ✓ 1 Snippet Jain A, Bhattacharya S.
In-Text Gene Mentions

…KRAS, TP53 andDCCcontribute to the…

Show Full Abstract

Colorectal cancer (CRC) is a prevalent malignancy that affects a large percentage of the global population. The conventional treatments for CRC have a number of limitations. Nanoparticles have emerged as a promising cancer treatment method due to their ability to directly target cancer cells and regulate drug release, thereby enhancing therapeutic efficacy and minimizing side effects. This compilation examines the use of nanoparticles as drug delivery systems for CRC treatment. Different nanomaterials can be used to administer anticancer drugs, including polymeric nanoparticles, gold nanoparticles, liposomes, and solid lipid nanoparticles. In addition, we discuss recent developments in nanoparticle preparation techniques, such as solvent evaporation, salting-out, ion gelation, and nanoprecipitation. These methods have demonstrated high efficacy in penetrating epithelial cells, a prerequisite for effective drug delivery. This article focuses on the various targeting mechanisms utilized by CRC-targeted nanoparticles and their recent advancements in this field. In addition, the review offers descriptive information regarding numerous nano-preparative procedures for colorectal cancer treatments. We also discuss the outlook for innovative therapeutic techniques in the management of CRC, including the potential application of nanoparticles for targeted drug delivery. The review concludes with a discussion of current nanotechnology patents and clinical studies used to target and diagnose CRC. The results of this investigation suggest that nanoparticles have great potential as a method of drug delivery for the treatment of colorectal cancer.

Also flagged:ribosomeresponse to stresscancerribonucleoproteinendoplasmic reticulumcytoplasm
Journal Article 2023-06-22 No Snippets Nguyen T, Mills JC, Cho CJ.
Show Full Abstract

Diverse acute and chronic injuries induce damage responses in the gastrointestinal (GI) system, and numerous cell types in the gastrointestinal tract demonstrate remarkable resilience, adaptability, and regenerative capacity in response to stress. Metaplasias, such as columnar and secretory cell metaplasia, are well-known adaptations that these cells make, the majority of which are epidemiologically associated with an elevated cancer risk. On a number of fronts, it is now being investigated how cells respond to injury at the tissue level, where diverse cell types that differ in proliferation capacity and differentiation state cooperate and compete with one another to participate in regeneration. In addition, the cascades or series of molecular responses that cells show are just beginning to be understood. Notably, the ribosome, a ribonucleoprotein complex that is essential for translation on the endoplasmic reticulum (ER) and in the cytoplasm, is recognized as the central organelle during this process. The highly regulated management of ribosomes as key translational machinery, and their platform, rough endoplasmic reticulum, are not only essential for maintaining differentiated cell identity, but also for achieving successful cell regeneration after injury. This review will cover in depth how ribosomes, the endoplasmic reticulum, and translation are regulated and managed in response to injury (e.g., paligenosis), as well as why this is essential for the proper adaptation of a cell to stress. For this, we will first discuss how multiple gastrointestinal organs respond to stress through metaplasia. Next, we will cover how ribosomes are generated, maintained, and degraded, in addition to the factors that govern translation. Finally, we will investigate how ribosomes and translation machinery are dynamically regulated in response to injury. Our increased understanding of this overlooked cell fate decision mechanism will facilitate the discovery of novel therapeutic targets for gastrointestinal tract tumors, focusing on ribosomes and translation machinery.

Also flagged:Gliomagliomastumorangiogenesiscancerpiwi
Journal Article 2023-06-22 No Snippets Kciuk M, Yahya EB, Mohamed MMI, Abdulsamad MA, Allaq AA, Gielecińska A, Kontek R.
Show Full Abstract

Accumulating evidence supports that both long non-coding and micro RNAs (lncRNAs and miRNAs) are implicated in glioma tumorigenesis and progression. Poor outcome of gliomas has been linked to late-stage diagnosis and mostly ineffectiveness of conventional treatment due to low knowledge about the early stage of gliomas, which are not possible to observe with conventional diagnostic approaches. The past few years witnessed a revolutionary advance in biotechnology and neuroscience with the understanding of tumor-related molecules, including non-coding RNAs that are involved in the angiogenesis and progression of glioma cells and thus are used as prognostic biomarkers as well as novel therapeutic targets. The emerging research on lncRNAs and miRNAs highlights their crucial role in glioma progression, offering new insights into the disease. These non-coding RNAs hold significant potential as novel therapeutic targets, paving the way for innovative treatment approaches against glioma. This review encompasses a comprehensive discussion about the role of lncRNAs and miRNAs in gene regulation that is responsible for the promotion or the inhibition of glioma progression and collects the existing links between these key cancer-related molecules.

CACNA1E
Also flagged:Atrial fibrillationAFpersistent arrhythmiapersistent AFgene expressionion channel
Journal Article 2023-06-22 ✓ 1 Snippet Igarashi W, Takagi D, Okada D, Kobayashi D, Oka M, Io T, Ishii K, Ono K, Yamamoto H, Okamoto Y.
In-Text Gene Mentions

…Ca 2+ channel (CACNA1E), ion channel scaffold…

Show Full Abstract

Atrial fibrillation (AF) is the most frequent persistent arrhythmia. Many genes have been reported as a genetic background for AF. However, most transcriptome analyses of AF are limited to the atrial samples and have not been evaluated by multiple cardiac regions. In this study, we analyzed the expression levels of protein-coding and long noncoding RNAs (lncRNAs) in six cardiac regions by RNA-seq. Samples were donated from six subjects with or without persistent AF for left atria, left atrial appendages, right atria, sinoatrial nodes, left ventricles, right ventricles, and pulmonary veins (PVs), and additional four right atrial appendages samples were collected from patients undergoing mitral valve replacement. In total, 23 AF samples were compared to 23 non-AF samples. Surprisingly, the most influenced heart region in gene expression by AF was the PV, not the atria. The ion channel-related gene set was significantly enriched upon analysis of these significant genes. In addition, some significant genes are cancer-related lncRNAs in PV in AF. A co-expression network analysis could detect the functional gene clusters. In particular, the cancer-related lncRNA, such as <i>SAMMSON</i> and <i>FOXCUT</i>, belong to the gene network with the cancer-related transcription factor <i>FOXC1</i>. Thus, they may also play an aggravating role in the pathogenesis of AF, similar to carcinogenesis. In the least, this study suggests that (1) RNA alteration is most intense in PVs and (2) post-transcriptional gene regulation by lncRNA may contribute to the progression of AF. Through the screening analysis across the six cardiac regions, the possibility that the PV region can play a role other than paroxysmal triggering in the pathogenesis of AF was demonstrated for the first time. Future research with an increase in the number of PV samples will lead to a novel understanding of the pathophysiology of AF.

Also flagged:SynthesisNanoHydroxyapatitemineralscarbonateschlorides
Journal Article 2023-06-22 No Snippets Wu SC, Hsu HC, Wang HF, Liou SP, Ho WF.
Show Full Abstract

Hydroxyapatite (HA) is a major component of the inorganic minerals in the hard tissues of humans and has been widely used as a biomedical ceramic material in orthopedic and dentistry applications. Because human bone contains several impurities, including carbonates, chlorides, fluorides, magnesium, and strontium, human bone minerals differ from stoichiometric HA. Additionally, natural bone is composed of nano-sized HA, and the nanoscale particles exhibit a high level of biological activity. In this paper, HA is prepared via the hydrothermal process because its reaction conditions are easy to control and it has been shown to be quite feasible for large-scale production. Therefore, the hydrothermal process is an effective and convenient method for the preparation of HA. Furthermore, eggshell is adopted as a source of calcium, and mulberry leaf extract is selectively added to synthesize HA. The eggshell accounts for 11% of the total weight of a whole egg, and it consists of calcium carbonate, calcium phosphate, magnesium carbonate, and organic matter. Eggshell contains a variety of trace elements, such as magnesium and strontium, making the composition of the synthesized HA similar to that of the human skeleton. These trace elements exert considerable benefits for bone growth. Moreover, the use of eggshell as a raw material can permit the recycling of biowaste and a reduction in process costs. The purpose of this study is to prepare HA powder via the hydrothermal method and to explore the effects of hydrothermal conditions on the structure and properties of the synthesized HA. The room-temperature precipitation method is used for the control group. Furthermore, the results of an immersion test in simulated body fluid confirm that the as-prepared HA exhibits good apatite-forming bioactivity, which is an essential requirement for artificial materials to bond to living bones in the living body and promote bone regeneration. In particular, it is confirmed that the HA synthesized with the addition of the mulberry leaf extract exhibits good in vitro biocompatibility. The morphology, crystallite size, and composition of the carbonated nano-HA obtained herein are similar to those of natural bones. The carbonated nano-HA appears to be an excellent material for bioresorbable bone substitutes or drug delivery. Therefore, the nano-HA powder prepared in this study has great potential in biomedical applications.

Also flagged:Methoxylated Cinnamic EstersLung cancercancermalignant melanomascinnamic acid estersnon-small-cell lung cancer
Journal Article 2023-06-22 No Snippets Sampaio JG, Pressete CG, Costa AV, Martins FT, de Almeida Lima GD, Ionta M, Teixeira RR.
Show Full Abstract

Lung cancer is the leading cause of cancer mortality worldwide, and malignant melanomas are highly lethal owing to their elevated metastatic potential. Despite improvements in therapeutic approaches, cancer treatments are not completely effective. Thus, new drug candidates are continuously sought. We synthesized mono- and di-methoxylated cinnamic acid esters and investigated their antitumor potential. A cell viability assay was performed to identify promising substances against A549 (non-small-cell lung cancer) and SK-MEL-147 (melanoma) cells. (<i>E</i>)-2,5-dimethoxybenzyl 3-(4-methoxyphenyl)acrylate (<b>4m</b>), a monomethoxylated cinnamic acid derivative, was identified as the lead antitumor compound, and its antitumor potential was deeply investigated. Various approaches were employed to investigate the antiproliferative (clonogenic assay and cell cycle analysis), proapoptotic (annexin V assay), and antimigratory (wound-healing and adhesion assays) activities of <b>4m</b> on A549 cells. In addition, western blotting was performed to explore its mechanism of action. We demonstrated that <b>4m</b> inhibits the proliferation of A549 by promoting cyclin B downregulation and cell cycle arrest at G2/M. Antimigratory and proapoptotic activities of <b>4m</b> on A549 were also observed. The antitumor potential of <b>4m</b> involved its ability to modulate the mitogen-activated protein kinases/extracellular signal-regulated kinase (MAPK/ERK) signaling pathway once phosphorylated-ERK expression was considerably reduced in response to treatment. Our findings demonstrate that <b>4m</b> is a promising anticancer drug candidate.

B4GALT5
Also flagged:gene expressioncancercardiovascular diseasesmethylationfood allergynon-small cell lung cancer
Journal Article 2023-06-22 ✓ 1 Snippet Zheng Y, Jun J, Brennan K, Gevaert O.
In-Text Gene Mentions

…, B3GNT5 ,B4GALT5), and cytokine…

Show Full Abstract

DNA methylation (DNAme) is a major epigenetic factor influencing gene expression with alterations leading to cancer and immunological and cardiovascular diseases. Recent technological advances have enabled genome-wide profiling of DNAme in large human cohorts. There is a need for analytical methods that can more sensitively detect differential methylation profiles present in subsets of individuals from these heterogeneous, population-level datasets. We developed an end-to-end analytical framework named "EpiMix" for population-level analysis of DNAme and gene expression. Compared with existing methods, EpiMix showed higher sensitivity in detecting abnormal DNAme that was present in only small patient subsets. We extended the model-based analyses of EpiMix to <i>cis</i>-regulatory elements within protein-coding genes, distal enhancers, and genes encoding microRNAs and long non-coding RNAs (lncRNAs). Using cell-type-specific data from two separate studies, we discover epigenetic mechanisms underlying childhood food allergy and survival-associated, methylation-driven ncRNAs in non-small cell lung cancer.

Also flagged:FerroptosisStrokesdeathneurodegenerative diseasesironphospholipid
Journal Article 2023-06-21 No Snippets Wang Y, Wu S, Li Q, Sun H, Wang H.
Show Full Abstract

Emerging evidence suggests that ferroptosis, a unique regulated cell death modality that is morphologically and mechanistically different from other forms of cell death, plays a vital role in the pathophysiological process of neurodegenerative diseases, and strokes. Accumulating evidence supports ferroptosis as a critical factor of neurodegenerative diseases and strokes, and pharmacological inhibition of ferroptosis as a therapeutic target for these diseases. In this review article, the core mechanisms of ferroptosis are overviewed and the roles of ferroptosis in neurodegenerative diseases and strokes are described. Finally, the emerging findings in treating neurodegenerative diseases and strokes through pharmacological inhibition of ferroptosis are described. This review demonstrates that pharmacological inhibition of ferroptosis by bioactive small-molecule compounds (ferroptosis inhibitors) could be effective for treatments of these diseases, and highlights a potential promising therapeutic avenue that could be used to prevent neurodegenerative diseases and strokes. This review article will shed light on developing novel therapeutic regimens by pharmacological inhibition of ferroptosis to slow down the progression of these diseases in the future.

Also flagged:spermatogenesischromosomegene expressiongene silencingsex chromosomesdosage compensation
Journal Article 2023-06-21 No Snippets Vedanayagam J, Lin CJ, Papareddy R, Nodine M, Flynt AS, Wen J, Lai EC.
Show Full Abstract

Although the biological utilities of endogenous RNAi (endo-RNAi) have been largely elusive, recent studies reveal its critical role in the non-model fruitfly Drosophila simulans to suppress selfish genes, whose unchecked activities can severely impair spermatogenesis. In particular, hairpin RNA (hpRNA) loci generate endo-siRNAs that suppress evolutionary novel, X-linked, meiotic drive loci. The consequences of deleting even a single hpRNA (Nmy) in males are profound, as such individuals are nearly incapable of siring male progeny. Here, comparative genomic analyses of D. simulans and D. melanogaster mutants of the core RNAi factor dcr-2 reveal a substantially expanded network of recently-emerged hpRNA-target interactions in the former species. The de novo hpRNA regulatory network in D. simulans provides insight into molecular strategies that underlie hpRNA emergence and their potential roles in sex chromosome conflict. In particular, our data support the existence of ongoing rapid evolution of Nmy/Dox-related networks, and recurrent targeting of testis HMG-box loci by hpRNAs. Importantly, the impact of the endo-RNAi network on gene expression flips the convention for regulatory networks, since we observe strong derepression of targets of the youngest hpRNAs, but only mild effects on the targets of the oldest hpRNAs. These data suggest that endo-RNAi are especially critical during incipient stages of intrinsic sex chromosome conflicts, and that continual cycles of distortion and resolution may contribute to speciation.

HFE
Also flagged:hepatocellular carcinomatumor protein P53TP53catenin beta 1cyclin dependent kinase inhibitor 2ASMAD2
Journal Article 2023-06-21 ✓ 1 Snippet Chavda V, Zajac KK, Gunn JL, Balar P, Khadela A, Vaghela D, Soni S, Ashby CR, Tiwari AK.
In-Text Gene Mentions

…oholic steatohepatitis (NASH),hemochromatosis, and alpha‐1‐antitrypsin defi…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a leading cause of cancer-related death worldwide. The incidence of HCC is affected by genetic and non-genetic factors. Genetically, mutations in the genes, tumor protein P53 (TP53), catenin beta 1 (CTNNB1), AT-rich interaction domain 1A (ARIC1A), cyclin dependent kinase inhibitor 2A (CDKN2A), mannose 6-phosphate (M6P), smooth muscle action against decapentaplegic (SMAD2), retinoblastoma gene (RB1), cyclin D, antigen presenting cells (APC), AXIN1, and E-cadherin, have been shown to contribute to the occurrence of HCC. Non-genetic factors, including alcohol consumption, exposure to aflatoxin, age, gender, presence of hepatitis B (HBV), hepatitis C (HCV), and non-alcoholic fatty liver disease (NAFLD), increase the risk of HCC.<h4>Recent findings</h4>The severity of the disease and its occurrence vary based on geographical location. Furthermore, men and minorities have been shown to be disproportionately affected by HCC, compared with women and non-minorities. Ethnicity has been reported to significantly affect tumorigenesis and clinical outcomes in patients diagnosed with HCC. Generally, differences in gene expression and/or the presence of comorbid medical diseases affect or influence the progression of HCC. Non-Caucasian HCC patients are significantly more likely to have poorer survival outcomes, compared to their Caucasian counterparts. Finally, there are a number of factors that contribute to the success rate of treatments for HCC.<h4>Conclusion</h4>Assessment and treatment of HCC must be consistent using evidence-based guidelines and standardized outcomes, as well as international clinical practice guidelines for global consensus. Standardizing the assessment approach and method will enable comparison and improvement of liver cancer research through collaboration between researchers, healthcare providers, and advocacy groups. In this review, we will focus on discussing epidemiological factors that result in deviations and changes in treatment approaches for HCC.

CCPG1
Also flagged:cerebral ischemic strokeendoplasmic reticulumcognitive disorderdeathlysosomesPERK
Journal Article 2023-06-21 ✓ 1 Snippet Zhang Y, Lou H, Lu J, Tang X, Pang T, Lei S, Cong D, Wang Y, Sun L.
In-Text Gene Mentions

…progression gene 1 (CCPG1), SEC62 homologue (SEC62),…

Show Full Abstract

Cerebral ischemic stroke is a high-risk disease and imposes heavy burdens on patients in china. Acupuncture has been used for thousands of years to treat motor dysfunction, cognitive disorder and language barrier caused by cerebral ischemic stroke. Acupoint lines, vertex middle line and anterior oblique line of vertex temple, are always employed to treat cerebral ischemic stroke. However, the mechanism of the two acupoint lines in relieving cerebral ischemic stroke needs further exploration. In the present study, scalp acupuncture treatment alleviated the motor dysfunction, brain damage, and cell death induced by middle cerebral artery occlusion (MCAO) in rats. Proteomics analysis and ultrastructure observation indicated that endoplasmic reticulum and lysosomes might involve in the mechanism of the scalp acupuncture treatment in suppressing MCAO-triggered neural deficits. Effect of the scalp acupuncture treatment on ER stress was then investigated and found that the activation of ER stress mediators, including PERK, IRE1, and ATF6, was downregulated after the scalp acupuncture treatment. Co-localisation analysis of KDEL and CD63 showed that the engulfment of ER fragments by lysosomes was accelerated by the scalp acupuncture treatment. Moreover, expression of pro-apoptotic protein CHOP, phosphorylated-JNK, cleaved capases-3 and -9 also decreased after the scalp acupuncture. In conclusion, the present study showed that scalp acupuncture of vertex middle line and anterior oblique line of vertex temple may alleviate cerebral ischemic stroke by inhibiting ER stress-accelerated apoptosis.

Also flagged:chromosomecancerbladder cancertumourbladder cancersPD-1
Journal Article 2023-06-21 No Snippets Abdel-Hafiz HA, Schafer JM, Chen X, Xiao T, Gauntner TD, Li Z, Theodorescu D.
Show Full Abstract

Loss of the Y chromosome (LOY) is observed in multiple cancer types, including 10-40% of bladder cancers<sup>1-6</sup>, but its clinical and biological significance is unknown. Here, using genomic and transcriptomic studies, we report that LOY correlates with poor prognoses in patients with bladder cancer. We performed in-depth studies of naturally occurring LOY mutant bladder cancer cells as well as those with targeted deletion of Y chromosome by CRISPR-Cas9. Y-positive (Y<sup>+</sup>) and Y-negative (Y<sup>-</sup>) tumours grew similarly in vitro, whereas Y<sup>-</sup> tumours were more aggressive than Y<sup>+</sup> tumours in immune-competent hosts in a T cell-dependent manner. High-dimensional flow cytometric analyses demonstrated that Y<sup>-</sup> tumours promote striking dysfunction or exhaustion of CD8<sup>+</sup> T cells in the tumour microenvironment. These findings were validated using single-nuclei RNA sequencing and spatial proteomic evaluation of human bladder cancers. Of note, compared with Y<sup>+</sup> tumours, Y<sup>-</sup> tumours exhibited an increased response to anti-PD-1 immune checkpoint blockade therapy in both mice and patients with cancer. Together, these results demonstrate that cancer cells with LOY mutations alter T cell function, promoting T cell exhaustion and sensitizing them to PD-1-targeted immunotherapy. This work provides insights into the basic biology of LOY mutation and potential biomarkers for improving cancer immunotherapy.

SERPINC1
Also flagged:HeparinAL amyloidosisheparin-binding proteinsAT-IIIthrombinbivalirudin
Journal Article 2023-06-21 ✓ 3 Snippets van Ede ES, Hoeks MPA, Hofland J, Linssen VD, van Kuppevelt TH, Versteeg EM, Hafmans TG, Diepstra A, Kusters B, Vermorgen SMM.
In-Text Gene Mentions

…heparin binds toantithrombin-III(AT-III) potentiating its…

…1 for etiologiesantithrombin-III(AT-III) mediated and…

…of the refractory non-antithrombin-IIImediated heparin resistance…

Show Full Abstract

<h4>Background</h4>Non-AT-III mediated heparin-resistance during CPB occurs by complex-forming with heparin-binding proteins. Currently, there are no specific recommendations for non-AT-III mediated heparin-resistance.<h4>Case presentation</h4>We present a fatal case of a 70-yr-old male-patient undergoing cardiac-surgery in which refractory heparin-resistance was observed. The massive AL amyloidosis found at autopsy is thought to be responsible and illustrates that awareness and knowledge of the etiology and perioperative strategies of non-AT-III mediated heparin-resistance is important.<h4>Conclusion</h4>For anticoagulation during cardiopulmonary bypass surgery in case of a non-AT-III medicated heparin resistance, we refer to the decision tree added to this manuscript and if necessary to consider direct thrombin inhibitors, such as bivalirudin or argatroban, as it bypasses the complexing pathway.

Also flagged:Pulmonary hypertensionPHcardiopulmonary diseasePulmonary arterial hypertensionpulmonary vasoconstrictionright ventricular hypertrophy
Journal Article 2023-06-21 No Snippets Su H, Zhu H, Wang S, Li Y, Yan C, Wang J, Ying K.
Show Full Abstract

<h4>Background</h4>Pulmonary arterial hypertension (PAH) is a rare but fatal cardiopulmonary disease mainly characterized by pulmonary vascular remodeling. Aberrant expression of circRNAs has been reported to play a crucial role in pulmonary vascular remodeling. The existing literature predominantly centers on studies that examined the sponge mechanism of circRNAs. However, the mechanism of circRNAs in regulating PAH-related protein remains largely unknown. This study aimed to investigate the effect of circItgb5 on pulmonary vascular remodeling and the underlying functional mechanism.<h4>Materials and methods</h4>High-throughput circRNAs sequencing was used to detect circItgb5 expression in control and PDGF-BB-treated pulmonary arterial smooth muscle cells (PASMCs). Localization of circItgb5 in PASMCs was determined via the fluorescence in situ hybridization assay. Sanger sequencing was applied to analyze the circularization of Itgb5. The identification of proteins interacting with circItgb5 was achieved through a RNA pull-down assay. To assess the impact of circItgb5 on PASMCs proliferation, an EdU assay was employed. Additionally, the cell cycle of PASMCs was examined using a flow cytometry assay. Western blotting was used to detect biomarkers associated with the phenotypic switch of PASMCs. Furthermore, a monocrotaline (MCT)-induced PAH rat model was established to explore the effect of silencing circItgb5 on pulmonary vascular remodeling.<h4>Results</h4>CircItgb5 was significantly upregulated in PDGF-BB-treated PASMCs and was predominately localized in the cytoplasm of PASMCs. In vivo experiments revealed that the knockdown of circItgb5 attenuated MCT-induced pulmonary vascular remodeling and right ventricular hypertrophy. In vitro experiments revealed that circItgb5 promoted the transition of PASMCs to synthetic phenotype. Mechanistically, circItgb5 sponged miR-96-5p to increase mTOR level and interacted with Uba1 protein to activate the Ube2n/Mdm2/ACE2 pathway.<h4>Conclusions</h4>CircItgb5 promoted the transition of PASMCs to synthetic phenotype by interacting with miR-96-5p and Uba1 protein. Knockdown of circItgb5 mitigated pulmonary arterial pressure, pulmonary vascular remodeling and right ventricular hypertrophy. Overall, circItgb5 has the potential for application as a therapeutic target for PAH.

SOX6
Also flagged:MFAP5tumorcolorectal cancertumorsC1QCMIF
Journal Article 2023-06-21 ✓ 1 Snippet Peng Z, Ren Z, Tong Z, Zhu Y, Zhu Y, Hu K.
In-Text Gene Mentions

…known to expressSOX6and F3 […

Show Full Abstract

<h4>Background</h4>The therapeutic targeting of the tumor microenvironment (TME) in colorectal cancer (CRC) has not yet been fully developed and utilized because of the complexity of the cell-cell interactions within the TME. The further exploration of these interactions among tumor-specific clusters would provide more detailed information about these communication networks with potential curative value.<h4>Methods</h4>Single-cell RNA sequencing, spatial transcriptomics, and bulk RNA sequencing datasets were integrated in this study to explore the biological properties of MFAP5 + fibroblasts and their interactions with tumor-infiltrating myeloid cells in colorectal cancer. Immunohistochemistry and multiplex immunohistochemistry were performed to confirm the results of these analyses.<h4>Results</h4>We profiled heterogeneous single-cell landscapes across 27,414 cells obtained from tumors and adjacent tissues. We mainly focused on the pro-tumorigenic functions of the identified MFAP5 + fibroblasts. We demonstrated that tumor-resident MFAP5 + fibroblasts and myeloid cells (particularly C1QC + macrophages) were positively correlated in both spatial transcriptomics and bulk RNA-seq public cohorts. These cells and their interactions might shape the malignant behavior of CRC. Intercellular interaction analysis suggested that MFAP5 + fibroblasts could reciprocally communicate with C1QC + macrophages and other myeloid cells to remodel unfavorable conditions via MIF/CD74, IL34/CSF1R, and other tumor-promoting signaling pathways.<h4>Conclusion</h4>Our study has elucidated the underlying pro-tumor mechanisms of tumor-resident MFAP5 + fibroblasts and provided valuable targets for the disruption of their properties.

DNAH10
Also flagged:CFAP70teratozoospermiaOATinfertileOAT-associated proteinsQRICH2
Journal Article 2023-06-21 ✓ 2 Snippets Jin HJ, Wang JL, Geng XY, Wang CY, Wang BB, Chen SR.
In-Text Gene Mentions

…DNAH1, DNAH2, DNAH8,DNAH10, and DNAH17 are…

…, 65 DNAH2,DNAH10and DNAH17 are…

Show Full Abstract

<h4>Background</h4>Male infertility is a worldwide population health concern, but its aetiology remains largely understood. Although CFAP70 variants have already been reported in two oligo-astheno-teratozoospermia (OAT) individuals by sequencing, animal evidence to support CFAP70 as a credible OAT-pathogenic gene is lacking.<h4>Method</h4>Cfap70-KO mice were generated to explore the physiological role of CFAP70. CFAP70 variants were detected in infertile men with OAT by whole exome sequencing and Sanger sequencing confirmation. Cfap70-truncated mice were further generated to explore the pathogenicity of the nonsense variant of CFAP70 identified in the proband.<h4>Findings</h4>Here, we demonstrate that Cfap70-KO mice are sterile mainly due to OAT and further identify a Chinese infertile man carrying a homozygous nonsense variant (c.2962C > T/p.R988X) of CFAP70. Cfap70-truncated mice lacking 5-8 tetratricopeptide repeats (TPRs) mimic the patient's symptoms. CFAP70 is required for the biogenesis of spermatid flagella partially by regulating the expression of OAT-associated proteins (e.g., QRICH2), assisting the cytoplasmic preassembly of the calmodulin- and radial spoke-associated complex (CSC), and controlling the manchette localization of axoneme-related proteins. Moreover, we suggest that CFAP70-associated male infertility could be overcome by intracytoplasmic sperm injection (ICSI) treatment.<h4>Interpretation</h4>Overall, we demonstrate that CFAP70 is necessary to assemble spermatid flagella and that CFAP70 gene could be used as a diagnostic target for male infertility with OAT in the clinic.<h4>Funding</h4>This study was supported by the National Key Research and Development Project (2019YFA0802101 to S.C), Open Fund of Key Laboratory of Cell Proliferation and Regulation Biology, Ministry of Education (to S.C), Central Government to Guide Local Scientific and Technological Development (ZY21195023 to B.W), and Basic Research Projects of Central Scientific Research Institutes (to B.W).

Also flagged:ironmetabolismpapillary thyroid carcinomaPTCradioiodinecancer
Journal Article 2023-06-21 No Snippets Jin T, Ge L, Chen J, Wang W, Zhang L, Ge M.
Show Full Abstract

<h4>Background</h4>The thyroid cancer subtype that occurs more frequently is papillary thyroid carcinoma (PTC). Despite a good surgical outcome, treatment with traditional antitumor therapy does not offer ideal results for patients with radioiodine resistance, recurrence, and metastasis. The evidence for the connection between iron metabolism imbalance and cancer development and oncogenesis is growing. Nevertheless, the iron metabolism impact on PTC prognosis is still indefinite.<h4>Methods</h4>Herein, we acquired the medical data and gene expression of individuals with PTC from The Cancer Genome Atlas (TCGA) and the Gene Expression Omnibus (GEO) database. Typically, three predictive iron metabolism-related genes (IMRGs) were examined and employed to build a risk score (RS) model <i>via</i> the least absolute shrinkage and selection operator (LASSO) regression, univariate Cox, and differential gene expression analyses. Then we analyzed somatic mutation and immune cell infiltration among RS groups. We also validated the prognostic value of two IMRGs (SFXN3 and TFR2) by verifying their biological function through <i>in vitro</i> experiments.<h4>Results</h4>Based on RS, all patients with PTC were stratified into low- and high-risk groups, where Kaplan-Meier analysis indicated that disease-free survival (DFS) in the high-risk group was much lower than in the low-risk group (<i>P</i> < 0.0001). According to ROC analysis, the RS model successfully predicted the 1-, 3-, and 5-year DFS of individuals with PTC. Additionally, in the TCGA cohort, a nomogram model with RS was developed and exhibited a strong capability to anticipate PTC patients' DFS. In the high-risk group, the enriched pathological processes and signaling mechanisms were detected utilizing the gene set enrichment analysis (GSEA). Moreover, the high-risk group had a significantly higher level of BRAF mutation frequency, tumor mutation burden, and immune cell infiltration than the low-risk group. <i>In vitro</i> experiments found that silencing SFXN3 or TFR2 significantly reduced cell viability.<h4>Conclusion</h4>Collectively, our predictive model depended on IMRGs in PTC, which could be potentially utilized to predict the PTC patients' prognosis, schedule follow-up plans, and provide potential targets against PTC.

NEGR1BTN3A3
Also flagged:substance use disordersmethylationvitamin Dbipolar disordermajorchromosome
Journal Article 2023-06-21 ✓ 3 Snippets Gedik H, Nguyen TH, Peterson RE, Chatzinakos C, Vladimirov VI, Riley BP, Bacanu SA.
In-Text Gene Mentions

We also replicated the findings of Dall’Aglio et al. (2021) regarding MDD NEGR1 as it was the second most significant gene in our MDD blood TWAS.

…for blood (BTN3A3, BTN3A1, and MICB—…

…) regarding MDDNEGR1as it was…

Show Full Abstract

Neuropsychiatric and substance use disorders (NPSUDs) have a complex etiology that includes environmental and polygenic risk factors with significant cross-trait genetic correlations. Genome-wide association studies (GWAS) of NPSUDs yield numerous association signals. However, for most of these regions, we do not yet have a firm understanding of either the specific risk variants or the effects of these variants. Post-GWAS methods allow researchers to use GWAS summary statistics and molecular mediators (transcript, protein, and methylation abundances) infer the effect of these mediators on risk for disorders. One group of post-GWAS approaches is commonly referred to as transcriptome/proteome/methylome-wide association studies, which are abbreviated as T/P/MWAS (or collectively as XWAS). Since these approaches use biological mediators, the multiple testing burden is reduced to the number of genes (∼20,000) instead of millions of GWAS SNPs, which leads to increased signal detection. In this work, our aim is to uncover likely risk genes for NPSUDs by performing XWAS analyses in two tissues-blood and brain. First, to identify putative causal risk genes, we performed an XWAS using the Summary-data-based Mendelian randomization, which uses GWAS summary statistics, reference xQTL data, and a reference LD panel. Second, given the large comorbidities among NPSUDs and the shared cis-xQTLs between blood and the brain, we improved XWAS signal detection for underpowered analyses by performing joint concordance analyses between XWAS results i) across the two tissues and ii) across NPSUDs. All XWAS signals i) were adjusted for heterogeneity in dependent instruments (HEIDI) (non-causality) <i>p</i>-values and ii) used to test for pathway enrichment. The results suggest that there were widely shared gene/protein signals within the major histocompatibility complex region on chromosome 6 (<i>BTN3A2</i> and <i>C4A</i>) and elsewhere in the genome (<i>FURIN, NEK4, RERE,</i> and <i>ZDHHC5</i>). The identification of putative molecular genes and pathways underlying risk may offer new targets for therapeutic development. Our study revealed an enrichment of XWAS signals in vitamin D and omega-3 gene sets. So, including vitamin D and omega-3 in treatment plans may have a modest but beneficial effect on patients with bipolar disorder.

HTT
Also flagged:zoonotic diseasesplagueVector-borne diseasesinfectionsinfectious diseasestick-borne disease
Journal Article 2023-06-21 ✓ 1 Snippet Dong L, Li Y, Yang C, Gong J, Zhu W, Huang Y, Kong M, Zhao L, Wang F, Lu S, Pu J, Yang J.
In-Text Gene Mentions

…2018 ) anddelta-Coronaviruses(Zhu et al.,…

Show Full Abstract

<h4>Introduction</h4>Ticks and fleas, as blood-sucking arthropods, carry and transmit various zoonotic diseases. In the natural plague foci of China, monitoring of <i>Yersinia pestis</i> has been continuously conducted in <i>Marmota himalayana</i> and other host animals, whereas other pathogens carried by vectors are rarely concerned in the Qinghai-Tibet Plateau.<h4>Methods</h4>In this study, we investigated the microbiota of ticks and fleas sampling from <i>M. himalayana</i> in the <i>Qinghai-Tibet</i> Plateau, China by metataxonomics combined with metagenomic methods.<h4>Results</h4>By metataxonomic approach based on full-length 16S rDNA amplicon sequencing and operational phylogenetic unit (OPU) analyses, we described the microbiota community of ticks and fleas at the species level, annotated 1,250 OPUs in ticks, including 556 known species and 492 potentially new species, accounting for 48.50% and 41.71% of the total reads in ticks, respectively. A total of 689 OPUs were detected in fleas, consisting of 277 known species (40.62% of the total reads in fleas) and 294 potentially new species (56.88%). At the dominant species categories, we detected the <i>Anaplasma phagocytophilum</i> (OPU 421) and potentially pathogenic new species of <i>Wolbachia, Ehrlichia, Rickettsia</i>, and <i>Bartonella</i>. Using shotgun sequencing, we obtained 10 metagenomic assembled genomes (MAGs) from vector samples, including a known species (<i>Providencia heimbachae</i> DFT2), and six new species affliated to four known genera, i.e., <i>Wolbachia, Mumia, Bartonella</i>, and <i>Anaplasma</i>. By the phylogenetic analyses based on full-length 16S rRNA genes and core genes, we identified that ticks harbored pathogenic <i>A. phagocytophilum</i>. Moreover, these potentially pathogenic novel species were more closely related to <i>Ehrlichia muris, Ehrlichia muris</i> subsp. <i>eauclairensis, Bartonella rochalimae</i>, and <i>Rickettsia limoniae</i>, respectively. The OPU 422 Ehrlichia sp1 was most related to <i>Ehrlichia muris</i> and <i>Ehrlichia muris subsp. eauclairensis</i>. The OPU 230 <i>Bartonella</i> sp1 and <i>Bartonella</i> spp. (DTF8 and DTF9) was clustered with <i>Bartonella rochalimae</i>. The OPU 427 <i>Rickettsia</i> sp1 was clustered with <i>Rickettsia limoniae</i>.<h4>Discussion</h4>The findings of the study have advanced our understanding of the potential pathogen groups of vectors in marmot (<i>Marmota himalayana</i>) in the Qinghai-Tibet Plateau.

ZNF664
Also flagged:acute myeloid leukemiaAMLtumorCancerLeukemiaKIT
Journal Article 2023-06-21 ✓ 1 Snippet Li L, Ruan J, Zhang N, Dai J, Xu X, Tian X, Hu J.
In-Text Gene Mentions

…SETD2, TFIP11, ZNF484,ZNF664, KIT, WT1 ,…

Show Full Abstract

<h4>Background</h4>The representative gene mutation in the prognostic groups of acute myeloid leukemia (AML) patients is not yet known. The purpose of this study is to identify representative mutations that can help physicians better predict patient prognosis and thus develop better treatment plans.<h4>Methods</h4>The Cancer Genome Atlas (TCGA) database was queried for clinical and genetic information, and individuals with AML were classified into 3 groups based on their AML Cancer and Leukemia Group B (CALGB) cytogenetic risk category. Each group's differentially mutated genes (DMGs) were evaluated. Simultaneously, Gene Ontology (GO) function and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were used to assess the function of DMGs within the 3 distinct groups. We used the driver status and protein impact of DMGs as additional filters to narrow down the list of significant genes. Cox regression analysis was used to examine the survival features of gene mutations in these genes.<h4>Results</h4>A cohort of 197 AML patients were divided into 3 groups according to their prognostic subtype: favorable (n=38), intermediate (n=116) and poor (n=43). There were significant differences in age and tumor metastasis rates among the three groups of patients. Patients in the favorable group had the highest rate of tumor metastasis. Different prognosis groups' DMGs were detected. The DMGs were examined for the driver and harmful mutations. We considered the DMGs that had driver and harmful mutations and that affected the survival outcomes in the prognostic groups as the key gene mutations. The group with a favorable prognosis carried specific gene mutations for <i>KIT</i> and <i>WT1</i>. The intermediate prognostic group contained mutations in the genes <i>IDH2, NRAS, NPM1, FLT3, RUNX1, DNMT1A,</i> and <i>MUC16</i>. In the group with a poor prognosis, the representative genes were <i>KRAS, TP53, IDH1, IDH2</i>, and <i>DNMT3A</i>, with <i>TP53</i> mutations substantially correlated with overall patient survival.<h4>Conclusions</h4>We performed the systemic analysis of the gene mutation in patients with AML and identified representative and driver mutations between the prognostic group. identification of representative and driver mutations between the prognostic group can help predict the prognosis of patients with AML and guide treatment decisions.

OLFM4
Also flagged:OsteosarcomasImmune ResponseOsteosarcomaOSbone tumorTP53
Journal Article 2023-06-21 ✓ 1 Snippet Pires SF, Barros JS, Costa SSD, Carmo GBD, Scliar MO, Lengert AVH, Boldrini É, Silva SRMD, Vidal DO, Maschietto M, Krepischi ACV.
In-Text Gene Mentions

…, MIR1297 ,OLFM4, and PCDH8.…

Show Full Abstract

Osteosarcoma (OS) is the most prevalent type of bone tumor, but slow progress has been achieved in disentangling the full set of genomic events involved in its initiation and progression. We assessed by NGS the mutational spectrum of 28 primary OSs from Brazilian patients, and identified 445 potentially deleterious SNVs/indels and 1176 copy number alterations (CNAs). <i>TP53</i> was the most recurrently mutated gene, with an overall rate of ~60%, considering SNVs/indels and CNAs. The most frequent CNAs (~60%) were gains at 1q21.2q21.3, 6p21.1, and 8q13.3q24.22, and losses at 10q26 and 13q14.3q21.1. Seven cases presented CNA patterns reminiscent of complex events (chromothripsis and chromoanasynthesis). Putative <i>RB1</i> and <i>TP53</i> germline variants were found in five samples associated with metastasis at diagnosis along with complex genomic patterns of CNAs. <i>PTPRQ</i>, <i>KNL1</i>, <i>ZFHX4</i>, and <i>DMD</i> alterations were prevalent in metastatic or deceased patients, being potentially indicative of poor prognosis. <i>TNFRSF11B</i>, involved in skeletal system development and maintenance, emerged as a candidate for osteosarcomagenesis due to its biological function and a high frequency of copy number gains. A protein-protein network enrichment highlighted biological pathways involved in immunity and bone development. Our findings reinforced the high genomic OS instability and heterogeneity, and led to the identification of novel disrupted genes deserving further evaluation as biomarkers due to their association with poor outcomes.

HFE
Also flagged:NAFLDnon-alcoholic fatty liver diseaseobesitymetabolismmitochondrialnon-alcoholic steatohepatitis
Journal Article 2023-06-21 ✓ 1 Snippet Barrea L, Verde L, Savastano S, Colao A, Muscogiuri G.
In-Text Gene Mentions

…viral hepatitis patients,hemochromatosis, hepatic malignancy; Presence…

Show Full Abstract

Oxidative stress is considered one of the main determinants in the pathophysiology of non-alcoholic fatty liver disease (NAFLD) and obesity. The alterations of oxidant/antioxidant balance are related to chronic impairment of metabolism leading to mitochondrial dysfunction. Increased oxidative stress also triggers hepatocytes stress pathways, leading to inflammation and contributing to the progression of non-alcoholic steatohepatitis (NASH). Currently, the first-line therapeutic treatment of NAFLD is based on lifestyle interventions, suggesting the Mediterranean Diet (MD) as a preferable nutritional approach due to its antioxidant properties. However, it is still debated if adherence to MD could have a role in determining the risk of developing NAFLD directly or indirectly through its effect on weight. We enrolled 336 subjects (aged 35.87 ± 10.37 years; BMI 31.18 ± 9.66 kg/m<sup>2</sup>) assessing anthropometric parameters, lifestyle habits, metabolic parameters (fasting plasma glucose, fasting plasma insulin, triglycerides (TG), total cholesterol, low-density (LDL) and high-density lipoprotein (HDL) cholesterol, alanine transaminase (ALT), aspartate aminotransferase (AST), and γ-glutamyltransferase (γGT), cardio-metabolic indices [Homeostatic Model Assessment Insulin Resistance (HoMA-IR), visceral adipose index (VAI) and fatty liver index (FLI)] and adherence to MD [with the PREvención con DIetaMEDiterránea (PREDIMED) questionnaire]. Subjects with NAFLD had significantly higher anthropometric parameters, cardio-metabolic indices and lower adherence to MD than subjects without NAFLD. In a multiple regression analysis, PREDIMED score was the main predictor of FLI (<i>p</i> < 0.001) and came in first, followed by HoMA-IR, while VAI was not a predictor. A PREDIMED score value of <6 could serve as a threshold to identify patients who are more likely to have NAFLD (<i>p</i> < 0.001). In conclusion, high adherence to MD resulted in a lower risk of having NAFLD. Adherence to MD could have a direct role on the risk of developing NAFLD, regardless of visceral adipose tissue.

Also flagged:polyglutaminenanodiamondtetracyclineautolysosomesautolysosomeHD
Journal Article 2023-06-21 No Snippets Fan S, Nie L, Zhang Y, Ustyantseva E, Woudstra W, Kampinga HH, Schirhagl R.
Show Full Abstract

Huntington's disease (HD) is a well-studied yet rare disease caused by a specific mutation that results in the expression of polyglutamine (PolyQ). The formation of aggregates of PolyQ leads to disease and increases the level of free radicals. However, it is unclear where free radicals are generated and how they impact cells. To address this, a new method called relaxometry was used to perform nanoscale MRI measurements with a subcellular resolution. The method uses a defect in fluorescent nanodiamond (FND) that changes its optical properties based on its magnetic surroundings, allowing for sensitive detection of free radicals. To investigate if radical generation occurs near PolyQ aggregates, stable tetracycline (tet)-inducible HDQ119-EGFP-expressing human embryonic kidney cells (HEK PQ) were used to induce the PolyQ formation and Huntington aggregation. The study found that NDs are highly colocalized with PolyQ aggregates at autolysosomes, and as the amount of PolyQ aggregation increased, so did the production of free radicals, indicating a relationship between PolyQ aggregation and autolysosome dysfunction.

Also flagged:Redox HomeostasisWild-Type Isocitrate DehydrogenasesGlioblastomabrain tumoroxygentumors
Journal Article 2023-06-20 No Snippets Murnan KM, Horbinski C, Stegh AH.
Show Full Abstract

<b><i>Significance:</i></b> Glioblastoma is an aggressive and devastating brain tumor characterized by a dismal prognosis and resistance to therapeutic intervention. To support catabolic processes critical for unabated cellular growth and defend against harmful reactive oxygen species, glioblastoma tumors upregulate the expression of wild-type isocitrate dehydrogenases (IDHs). IDH enzymes catalyze the oxidative decarboxylation of isocitrate to α-ketoglutarate (α-KG), NAD(P)H, and CO<sub>2</sub>. On molecular levels, IDHs epigenetically control gene expression through effects on α-KG-dependent dioxygenases, maintain redox balance, and promote anaplerosis by providing cells with NADPH and precursor substrates for macromolecular synthesis. <b><i>Recent Advances:</i></b> While gain-of-function mutations in IDH1 and IDH2 represent one of the most comprehensively studied mechanisms of IDH pathogenic effects, recent studies identified wild-type IDHs as critical regulators of normal organ physiology and, when transcriptionally induced or down regulated, as contributing to glioblastoma progression. <b><i>Critical Issues:</i></b> Here, we will discuss molecular mechanisms of how wild-type IDHs control glioma pathogenesis, including the regulation of oxidative stress and <i>de novo</i> lipid biosynthesis, and provide an overview of current and future research directives that aim to fully characterize wild-type IDH-driven metabolic reprogramming and its contribution to the pathogenesis of glioblastoma. <b><i>Future Directions:</i></b> Future studies are required to further dissect mechanisms of metabolic and epigenomic reprogramming in tumors and the tumor microenvironment, and to develop pharmacological approaches to inhibit wild-type IDH function. <i>Antioxid. Redox Signal.</i> 39, 923-941.

ABT1
Also flagged:E3 ligaseATL5degradationUbiquitinationARABIDOPSIS TÓXICOS EN LEVADURA 5ACTIVATOR OF BASAL TRANSCRIPTION 1
Journal Article 2023-06-20 ✓ 5 Snippets He W, Wang R, Zhang Q, Fan M, Lyu Y, Chen S, Chen D, Chen X.
In-Text Gene Mentions

…the degradation ofABT1in Arabidopsis.…

…BASAL TRANSCRIPTION 1 (ABT1) in Arabidopsis.…

…two-hybrid screen identifiedABT1as an ATL5…

…and degradation ofABT1.…

…degradation of translatedABT1, and the degradation…

Show Full Abstract

Ubiquitination is a fundamental mechanism regulating the stability of target proteins in eukaryotes; however, the regulatory mechanism in seed longevity remains unknown. Here, we report that an uncharacterized E3 ligase, ARABIDOPSIS TÓXICOS EN LEVADURA 5 (ATL5), positively regulates seed longevity by mediating the degradation of ACTIVATOR OF BASAL TRANSCRIPTION 1 (ABT1) in Arabidopsis. Seeds in which ATL5 was disrupted showed faster accelerated aging than the wild-type, while expressing ATL5 in atl5-2 basically restored the defective phenotype. ATL5 was highly expressed in the embryos of seeds, and its expression could be induced by accelerated aging. A yeast two-hybrid screen identified ABT1 as an ATL5 interacting protein, which was further confirmed by bimolecular fluorescence complementary assay and co-immunoprecipitation analysis. In vitro and in vivo assays showed that ATL5 functions as an E3 ligase and mediates the polyubiquitination and degradation of ABT1. Disruption of ATL5 diminished the degradation of translated ABT1, and the degradation could be induced by seed ageing and occurred in a proteasome-dependent manner. Furthermore, disruption of ABT1 enhanced seed longevity. Taken together, our study reveals that ATL5 promotes the polyubiquitination and degradation of the ABT1 protein posttranslationally and positively regulates seed longevity in Arabidopsis.

CACNA1E
Also flagged:microtubuleschronic diseasestype 2 diabetesobesitycardiovascular diseaseschromosomes
Journal Article 2023-06-20 ✓ 2 Snippets Song Y, Lee D, Choi JE, Lee JW, Hong KW.
In-Text Gene Mentions

…[ rs192721285 ],CACNA1E[ rs3766982 ],…

…al., 2020 ),CACNA1E(Carvill, 2019 ),…

Show Full Abstract

<h4>Introduction</h4>Handedness is a conspicuous characteristic in human behavior, with a worldwide proportion of approximately 90% of people preferring to use the right hand for many tasks. In the Korean population, the proportion of left-handedness is relatively low at approximately 7%-10%, similar to that in other East-Asian cultures in which the use of the left hand for writing and other public activities has historically been oppressed.<h4>Methods</h4>In this study, we conducted two genome-wide association studies (GWASs) between right-handedness and left-handedness, and between right-handedness and ambidexterity using logistic regression analyses using a Korean community-based cohort. We also performed association analyses with previously reported variants and our findings.<h4>Results</h4>A total of 8806 participants were included for analysis, and the results identified 28 left-handedness-associated and 15 ambidexterity-associated loci; of these, two left-handedness loci (NEIL3 [rs11726465] and SVOPL [rs117495448]) and one ambidexterity locus (PDE8B/WDR41 [rs118077080]) showed near genome-wide significance. Association analyses with previously reported variants replicated ANKS1B (rs7132513) in left-handedness and ANKIB1 (rs2040498) in ambidexterity.<h4>Conclusion</h4>The variants and positional candidate genes identified and replicated in this study were largely associated with brain development, cerebral asymmetry, neurological processes, and neuropsychiatric diseases in line with previous findings. As the first East-Asian GWAS related to handedness, these results may provide an intriguing reference for further human neurologic research in the future.

CCPG1UNC13CSHISA6
Also flagged:CLN3-Battenneurodegenerative diseasetransmembraneNEFLCHIT1
Journal Article 2023-06-20 ✓ 3 Snippets Dang Do AN, Sleat DE, Campbell K, Johnson NL, Zheng H, Wassif CA, Dale RK, Porter FD.
In-Text Gene Mentions

UNC13C

SHISA6

CCPG1

Show Full Abstract

Syndromic CLN3-Batten is a fatal, pediatric, neurodegenerative disease caused by variants in <i>CLN3</i>, which encodes the endolysosomal transmembrane CLN3 protein. No approved treatment for CLN3 is currently available. The protracted and asynchronous disease presentation complicates the evaluation of potential therapies using clinical disease progression parameters. Biomarkers as surrogates to measure the progression and effect of potential therapeutics are needed. We performed proteomic discovery studies using cerebrospinal fluid (CSF) samples from 28 CLN3-affected and 32 age-similar non-CLN3 individuals. Proximal extension assay (PEA) of 1467 proteins and untargeted data-dependent mass spectrometry [MS; MassIVE FTP server (ftp://MSV000090147@massive.ucsd.edu)] were used to generate orthogonal lists of protein marker candidates. At an adjusted <i>p</i>-value of <0.1 and threshold CLN3/non-CLN3 fold-change ratio of 1.5, PEA identified 54 and MS identified 233 candidate biomarkers. Some of these (NEFL, CHIT1) have been previously linked with other neurologic conditions. Others (CLPS, FAM217B, QRICH2, KRT16, ZNF333) appear to be novel. Both methods identified 25 candidate biomarkers, including CHIT1, NELL1, and ISLR2 which had absolute fold-change ratios >2. NELL1 and ISLR2 regulate axonal development in neurons and are intriguing new candidates for further investigation in CLN3. In addition to identifying candidate proteins for CLN3 research, this study provides a comparison of two large-scale proteomic discovery methods in CSF.

Also flagged:bacteriochlorinsporphyrinmetal ionsporphyrinoidspositronsodium-channel
Journal Article 2023-06-20 No Snippets Hernández-Gil J, Chow CY, Chatras H, de Souza França PD, Samuels ZV, Cornejo M, King GF, Lewis JS, Reiner T, Gonzales J.
Show Full Abstract

We report an innovative approach to producing bacteriochlorins (bacs) via formal cycloaddition by subjecting a porphyrin to a trimolecular reaction. Bacs are near-infrared probes with the intrinsic ability to serve in multimodal imaging. However, despite their ability to fluoresce and chelate metal ions, existing bacs have thus offered limited ability to label biomolecules for target specificity or have lacked chemical purity, limiting their use in bio-imaging. In this work, bacs allowed a precise and controlled appending of clickable linkers, lending the porphyrinoids substantially more chemical stability, clickability, and solubility, rendering them more suitable for preclinical investigation. Our bac probes enable the targeted use of biomolecules in fluorescence imaging and Cerenkov luminescence for guided intraoperative imaging. Bacs' capacity for chelation provides opportunities for use in non-invasive positron emission tomography/computed tomography. Herein, we report the labeling of bacs with Hs1a, a (NaV1.7)-sodium-channel-binding peptide derived from the Chinese tarantula <i>Cyriopagopus schmidti</i> to yield Bac-Hs1a and radiolabeled Hs1a, which shuttles our bac sensor(s) to mouse nerves. In vivo, the bac sensor allowed us to observe high signal-to-background ratios in the nerves of animals injected with fluorescent Bac-Hs1a and radiolabeled Hs1a in all imaging modes. This study demonstrates that Bac-Hs1a and [<sup>64</sup>Cu]Cu-Bac-Hs1a accumulate in peripheral nerves, providing contrast and utility in the preclinical space. For the chemistry and bio-imaging fields, this study represents an exciting starting point for the modular manipulation of bacs, their development and use as probes for diagnosis, and their deployment as formidable multiplex nerve-imaging agents for use in routine imaging experiments.

HTT
Also flagged:trabecular thyroid adenomathyroid tumortrabecular adenomatumorpapillary thyroid carcinomamembrane
Journal Article 2023-06-20 ✓ 2 Snippets Hirokawa M, Matsuse M, Mitsutake N, Suzuki A, Higuchi M, Hayashi T, Kamma H, Miyauchi A, Akamizu T.
In-Text Gene Mentions

Recently, Marchiò et al. described that the presence of the PAX8–GLIS3 fusion in thyroid neoplasms may be used as an ancillary marker for the diagnosis of HTT [14].

In molecular testing, we analyzed common genetic alterations to FTA, FTC, PTC, HTT, PDTC, and MTC [3] using the next-generation sequencing custom targeted panel (Ion Torrent Genexus, Thermo Fisher Sci., MA, USA), including point mutations in BRAF, N/K/H-RAS, RET, TERT promoter, EIF1AX, AKT1, CTNNB1, PTEN, etc. We also analyzed the presence of PAX8/GLIS1 and PAX8/GLIS3 fusion genes, which are hallmarks of HTT, using RT-PCR (Nikiforova MN et al., PMID: 30,648,929).

Show Full Abstract

<h4>Background</h4>Only one thyroid follicular cell-derived tumor with a purely trabecular growth pattern has previously been described. This report aims to describe the histological, immunohistochemical, and molecular findings of our second case, propose a novel thyroid tumor, and discuss its diagnostic pitfalls.<h4>Case presentation</h4>A 68-year-old female presented with an encapsulated thyroid tumor composed of thin and long trabeculae. No papillary, follicular, solid, or insular patterns are observed. The tumor cells were elongated or fusiform and arranged perpendicular to the trabecular axis. No nuclear findings of papillary thyroid carcinoma and increased basement membrane material were found. Immunohistochemically, the tumor cells were positive for paired-box gene 8, thyroid transcription factor-1, and negative for thyroglobulin, calcitonin, and chromogranin A. Inter- and intra-trabecular accumulation of type IV collagen-positive materials was not demonstrated. None of PAX8/GLIS1 and PAX8/GLIS3 and mutations in BRAF, HRAS, KRAS, NRAS, TERT promoter, CTNNB1, PTEN, and RET were detected.<h4>Conclusions</h4>We report our case as a novel disease entity called non-hyalinizing trabecular thyroid adenoma, which has the diagnostic pitfalls of hyalinizing trabecular tumor and medullary thyroid carcinoma.

SERPINC1
Also flagged:coagulationantiphospholipid syndromepregnancy lossinfectioncoagulation factorsProtein C
Journal Article 2023-06-20 ✓ 5 Snippets Najjar AA, Hassouna I, Srour MA, Ibrahim HM, Assi RY, Abd El Latif HM.
In-Text Gene Mentions

…and anti-thrombin III (ATIII) are changed during…

…markers (PC, PS,ATIII, D-dimer), antiphospholipid a…

…PC, PS, LA,ATIII, and D-dimer; while…

ATIIIwas measured by…

…analyzed PC, PS,ATIIIand D-dimer.…

Show Full Abstract

<h4>Background</h4>Multiple etiologies contribute to recurrent pregnancy loss (RPL) including immunological, endocrine, anatomical, genetic and infection but more than 50% of cases remain unexplained. Evidences of thrombotic and inflammatory processes were observed at maternal-fetal interface and considered pathological findings in most RPL cases including unexplained cases. This study aimed to evaluate the association between RPL and several risk factors: platelet parameters, coagulation factors, antiphospholipid syndrome, and thyroid function.<h4>Methods</h4>This is an unmatched case-control study that included 100 RPL and 100 control women. Anthropometric and health data were collected and a gynecologist examined participants to assure fitting the inclusion criteria. Platelet parameters [including Mean Platelet Mass (MPM), Concentration (MPC) and Volume (MPV)] and ratios (MPV/Platelet, MPC/Platelet, MPM/Platelet, Platelet/Mononuclear cells), coagulation markers [Protein C (PC), Protein S (PS), Antithrombin III, D-dimer], antiphospholipid antibodies [Anti-phospholipid (APA), Anti-cardiolipin (ACA) and anti-B2-glycoprotein 1], Lupus anticoagulant, Antinuclear antibodies, and thyroid function (Thyroid stimulating hormone and anti-thyroid peroxidase) were measured.<h4>Results</h4>Mean ages of cases and controls at marriage were 22.5 years for both, and their current ages were 29.4 and 33.0, respectively. 92% of cases and 99% of controls aged blow 30 years at marriage. 75% of cases have 3-4 miscarriages and 9% have ≥ 7 miscarriages. Our results indicated significantly lower male/female age ratio (p = .019), PC (p = .036) and PS (p = .025) in cases compared to controls. Plasma D-dimer (p = .020) and antiphospholipid antibodies [ACA (IgM and IgG), APA (IgM)] were significantly higher in cases compared to controls. No significant differences were observed between cases and controls concerning APA (IgG), anti-B2-glycoprotein 1 (IgM and IgG), Lupus anticoagulant, Antinuclear antibodies, platelet parameters, thyroid markers, family history of miscarriage, consanguineous marriage, and other health data.<h4>Conclusions</h4>This is the first study that investigated the association between platelet, coagulation, antiphospholipid, autoimmune and thyroid parameters, and RPL in Palestinian women. Significant associations between male/female age ratio, PC, PS, D-dimer, ACA (IgM, IgG), APA (IgM) and RPL were observed. These markers could be used in evaluating RPL. These findings confirm the heterogeneous nature of RPL and emphasize the need for further studies to find out risk factors for RPL.

OLFM4
Also flagged:methylationOLFML2BtumorLINC01116TMSB15Avascular endothelial growth factor
Journal Article 2023-06-20 ✓ 1 Snippet Wang XK, Zhang XD, Luo K, Yu L, Huang S, Liu ZY, Li RF.
In-Text Gene Mentions

…with OLFM2 ,OLFM4and LPHN2 ,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a long-term malignancy that causes high morbidities and mortalities worldwide. Notably, long non-coding RNAs (LncRNAs) have been identified as candidate targets for malignancy treatments.<h4>Methods</h4>LncRNA LINC01116 and its Pearson-correlated genes (PCGs) were identified and analyzed in HCC patients. The diagnostic and prognostic value of the lncRNA was evaluated using data from The Cancer Genome Atlas (TCGA). Further, we explored the target drugs of LINC01116 for clinical application. Relationships between immune infiltration and PCGs, methylation and PCGs were explored. The diagnostic potentials were then validated by Oncomine cohorts.<h4>Results</h4>LINC01116 and the PCG OLFML2B are differentially and highly expressed in tumor tissues (both P ≤ 0.050). We found that LINC01116, TMSB15A, PLAU, OLFML2B, and MRC2 have diagnostic potentials (all AUC ≥ 0.700, all P ≤ 0.050) while LINC01116 and TMSB15A have prognostic significance (both adjusted P ≤ 0.050). LINC01116 was enriched in the vascular endothelial growth factor (VEGF) receptor signaling pathway, mesenchyme morphogenesis, etc. After that, candidate target drugs with potential clinical significance were identified: Thiamine, Cromolyn, Rilmenidine, Chlorhexidine, Sulindac_sulfone, Chloropyrazine, and Meprylcaine. Analysis of immune infiltration revealed that MRC2, OLFML2B, PLAU, and TMSB15A are negatively associated with the purity but positively associated with the specific cell types (all P < 0.050). Analysis of promoter methylation demonstrated that MRC2, OLFML2B, and PLAU have differential and high methylation levels in primary tumors (all P < 0.050). Validation results of the differential expressions and diagnostic potential of OLFML2B (Oncomine) were consistent with those obtained in the TCGA cohort (P < 0.050, AUC > 0.700).<h4>Conclusions</h4>Differentially expressed LINC01116 could be a candidate diagnostic and an independent prognostic signature in HCC. Besides, its target drugs may work for HCC therapy via the VEGF receptor signaling pathway. Differentially expressed OLFML2B could be a diagnostic signature involved in HCC via immune infiltrates.

LRRC7
Also flagged:PP1kinasephosphataseProtein Phosphatase 1phosphatasesmetaphase
Journal Article 2023-06-20 ✓ 1 Snippet Camlin NJ, Venkatachalam I, Evans JP.
In-Text Gene Mentions

Condensins

Show Full Abstract

Tightly controlled fluctuations in kinase and phosphatase activity play important roles in regulating M-phase transitions. Protein Phosphatase 1 (PP1) is one of these phosphatases, with oscillations in PP1 activity driving mitotic M-phase. Evidence from a variety of experimental systems also points to roles in meiosis. Here, we report that PP1 is important for M-phase transitions through mouse oocyte meiosis. We employed a unique small-molecule approach to inhibit or activate PP1 at distinct phases of mouse oocyte meiosis. These studies show that temporal control of PP1 activity is essential for the G2/M transition, metaphase I/anaphase I transition, and the formation of a normal metaphase II oocyte. Our data also reveal that inappropriate activation of PP1 is more deleterious at the G2/M transition than at prometaphase I-to-metaphase I, and that an active pool of PP1 during prometaphase is vital for metaphase I/anaphase I transition and metaphase II chromosome alignment. Taken together, these results establish that loss of oscillations in PP1 activity causes a range of severe meiotic defects, pointing to essential roles for PP1 in female fertility, and more broadly, M-phase regulation.

SOX6
Also flagged:transcription factorsParkinson's diseasePDtranscription factorMSX1dopaminergic transcription factor
Journal Article 2023-06-20 ✓ 5 Snippets Zhao Y, Qin L, Pan H, Song T, Wang Y, Zhou X, Xiang Y, Li J, Liu Z, Sun Q, Guo J, Yan X, Tang B, Xu Q.
In-Text Gene Mentions

…transcription factor 6 (SOX6), and SRY-box transcription…

…, EBF1 ,SOX6, and SOX2…

…PITX3 , andSOX6.…

…MSX1, NGN2, EBF1,SOX6, and SOX2.…

…maturation, whereas EBF1,SOX6, and SOX2 are…

Show Full Abstract

<h4>Background</h4>Genetic variants of dopaminergic transcription factor-encoding genes are suggested to be Parkinson's disease (PD) risk factors; however, no comprehensive analyses of these genes in patients with PD have been undertaken. Therefore, we aimed to genetically analyze 16 dopaminergic transcription factor genes in Chinese patients with PD.<h4>Methods</h4>Whole-exome sequencing (WES) was performed using a Chinese cohort comprising 1917 unrelated patients with familial or sporadic early-onset PD and 1652 controls. Additionally, whole-genome sequencing (WGS) was performed using another Chinese cohort comprising 1962 unrelated patients with sporadic late-onset PD and 1279 controls.<h4>Results</h4>We detected 308 rare and 208 rare protein-altering variants in the WES and WGS cohorts, respectively. Gene-based association analyses of rare variants suggested that MSX1 is enriched in sporadic late-onset PD. However, the significance did not pass the Bonferroni correction. Meanwhile, 72 and 1730 common variants were found in the WES and WGS cohorts, respectively. Unfortunately, single-variant logistic association analyses did not identify significant associations between common variants and PD.<h4>Conclusions</h4>Variants of 16 typical dopaminergic transcription factors might not be major genetic risk factors for PD in Chinese patients. However, we highlight the complexity of PD and the need for extensive research elucidating its etiology.

Also flagged:cannabinoidscachexiasleep disordersTourette syndromemultiple sclerosiscannabis use disorder
Journal Article 2023-06-20 No Snippets Piscura MK, Henderson-Redmond AN, Barnes RC, Mitra S, Guindon J, Morgan DJ.
Show Full Abstract

Cannabis has been used recreationally and medically for centuries, yet research into understanding the mechanisms of its therapeutic effects has only recently garnered more attention. There is evidence to support the use of cannabinoids for the treatment of chronic pain, muscle spasticity, nausea and vomiting due to chemotherapy, improving weight gain in HIV-related cachexia, emesis, sleep disorders, managing symptoms in Tourette syndrome, and patient-reported muscle spasticity from multiple sclerosis. However, tolerance and the risk for cannabis use disorder are two significant disadvantages for cannabinoid-based therapies in humans. Recent work has revealed prominent sex differences in the acute response and tolerance to cannabinoids in both humans and animal models. This review will discuss evidence demonstrating cannabinoid tolerance in rodents, non-human primates, and humans and our current understanding of the neuroadaptations occurring at the cannabinoid type 1 receptor (CB<sub>1</sub>R) that are responsible tolerance. CB<sub>1</sub>R expression is downregulated in tolerant animals and humans while there is strong evidence of CB<sub>1</sub>R desensitization in cannabinoid tolerant rodent models. Throughout the review, critical knowledge gaps are indicated and discussed, such as the lack of a neuroimaging probe to assess CB<sub>1</sub>R desensitization in humans. The review discusses the intracellular signaling pathways that are responsible for mediating CB<sub>1</sub>R desensitization and downregulation including the action of G protein-coupled receptor kinases, β-arrestin2 recruitment, c-Jun N-terminal kinases, protein kinase A, and the intracellular trafficking of CB<sub>1</sub>R. Finally, the review discusses approaches to reduce cannabinoid tolerance in humans based on our current understanding of the neuroadaptations and mechanisms responsible for this process.

Also flagged:extrapulmonary infectionspulmonary infectionsinusitispositronamikacinimipenem/cilastatin
Journal Article 2023-06-20 No Snippets Kaji M, Namkoong H, Nagao G, Azekawa S, Nakagawara K, Tanaka H, Morita A, Asakura T, Kamata H, Uwamino Y, Yoshida M, Fukunaga K, Hasegawa N.
Show Full Abstract

<h4>Background</h4><i>Mycobacterium abscessus</i> (<i>M. abscessus</i>) is a rapidly growing bacterium (RGM) that causes refractory pulmonary and extrapulmonary infections. However, studies investigating pharyngeal and laryngeal <i>M. abscessus</i> infections are limited.<h4>Case presentation</h4>A 41-year-old immunocompetent woman complaining of bloody sputum was referred to our hospital. Although her sputum culture tested positive for <i>M. abscessus</i> subsp. <i>abscessus</i>, radiological findings were not indicative of pulmonary infection or sinusitis. Further diagnostic workup, including laryngeal endoscopy and positron emission tomography/computed tomography (PET/CT), confirmed the presence of nasopharyngeal <i>M. abscessus</i> infection. The patient was initially treated with intravenous amikacin, imipenem/cilastatin, azithromycin, and clofazimine for 28 days, after which the patient was provided with amikacin, azithromycin, clofazimine, and sitafloxacin for four months. After the completion of antibiotic therapy, the patient showed negative results on sputum smear and culture and normal findings on PET/CT and laryngeal endoscopy. Whole-genome sequencing of this strain revealed that it belonged to the ABS-GL4 cluster, which has a functional erythromycin ribosomal methylase gene, although it is not a major lineage in non-cystic fibrosis (CF) patients in Japan and Taiwan and in CF patients in European countries. We conducted a literature review and identified seven patients who developed pharyngeal/laryngeal non-tuberculous mycobacterium (NTM) infection. Four of the eight patients had a history of immunosuppressant use, including steroids. Seven of the eight patients responded well to their treatment regimens.<h4>Conclusion</h4>Patients whose sputum culture tests are positive for NTM and who meet the diagnostic criteria for NTM infection but do not have intrapulmonary lesions should be evaluated for otorhinolaryngological infections. Our case series revealed that immunosuppressant use is a risk factor for pharyngeal/laryngeal NTM infection and that patients with pharyngeal/laryngeal NTM infections respond relatively well to antibiotic therapy.

Also flagged:Atopic dermatitisADchronic inflammatory skin diseaseatopic diseasesepidermal spongiosisgene expression
Journal Article 2023-06-20 No Snippets Bratu D, Boda D, Caruntu C.
Show Full Abstract

Atopic dermatitis (AD) is a chronic inflammatory skin disease with a high prevalence in the developed countries. It is associated with atopic and non-atopic diseases, and its close correlation with atopic comorbidities has been genetically demonstrated. One of the main roles of genetic studies is to comprehend the defects of the cutaneous barrier due to filaggrin deficit and epidermal spongiosis. Recently, epigenetic studies started to analyze the influence of the environmental factors on gene expression. The epigenome is considered to be a superior second code that controls the genome, which includes alterations of the chromatin. The epigenetic changes do not alter the genetic code, however, changes in the chromatin structure could activate or inhibit the transcription process of certain genes and consequently, the translation process of the new mRNA into a polypeptide chain. In-depth analysis of the transcriptomic, metabolomic and proteomic studies allow to unravel detailed mechanisms that cause AD. The extracellular space and lipid metabolism are associated with AD that is independent of the filaggrin expression. On the other hand, around 45 proteins are considered as the principal components in the atopic skin. Moreover, genetic studies based on the disrupted cutaneous barrier can lead to the development of new treatments targeting the cutaneous barrier or cutaneous inflammation. Unfortunately, at present, there are no target therapies that focus on the epigenetic process of AD. However, in the future, miR-143 could be an important objective for new therapies, as it targets the miR-335:SOX axis, thereby restoring the miR-335 expression, and repairing the cutaneous barrier defects.

Also flagged:osteoarthritisinjurypost-traumatic osteoarthritiscartilage injurystromalcell migration
Journal Article 2023-06-20 No Snippets Shigley C, Trivedi J, Meghani O, Owens BD, Jayasuriya CT.
Show Full Abstract

Current clinical strategies for restoring cartilage defects do not adequately consider taking the necessary steps to prevent the formation of hypertrophic tissue at injury sites. Chondrocyte hypertrophy inevitably causes both macroscopic and microscopic level changes in cartilage, resulting in adverse long-term outcomes following attempted restoration. Repairing/restoring articular cartilage while minimizing the risk of hypertrophic neo tissue formation represents an unmet clinical challenge. Previous investigations have extensively identified and characterized the biological mechanisms that regulate cartilage hypertrophy with preclinical studies now beginning to leverage this knowledge to help build better cartilage. In this comprehensive article, we will provide a summary of these biological mechanisms and systematically review the most cutting-edge strategies for circumventing this pathological hallmark of osteoarthritis.

BTN3A3
Also flagged:GeneralizedPustular PsoriasisPsoriasischronic inflammatory skin diseasePlaque psoriasispustular autoinflammatory skin disease
Journal Article 2023-06-20 ✓ 2 Snippets Yang SF, Lin MH, Chou PC, Hu SK, Shih SY, Yu HS, Yu S.
In-Text Gene Mentions

Subtype analysis revealed that both IL36RN and BTN3A3 were markedly linked to GPP alone and GPP with PV.

…MPO, SERPINA1, SERPINA3,BTN3A3, and TGFBR2.…

Show Full Abstract

Psoriasis is a chronic inflammatory skin disease characterized by the appearance of clearly demarcated erythematous and scaly plaques. It can be divided into various types, including plaque, nail, guttate, inverse, and pustular psoriasis. Plaque psoriasis is the most commonly occurring type, though there is another rare but severe pustular autoinflammatory skin disease called generalized pustular psoriasis (GPP), which manifests with acute episodes of pustulation and systemic symptoms. Though the etiopathogenesis of psoriasis is not yet fully understood, a growing body of literature has demonstrated that both genetic and environmental factors play a role. The discovery of genetic mutations associated with GPP has shed light on our comprehension of the mechanisms of the disease, promoting the development of targeted therapies. This review will summarize genetic determinants as known and provide an update on the current and potential treatments for GPP. The pathogenesis and clinical presentation of the disease are also included for a comprehensive discussion.

DNAH10
Also flagged:oral squamous cell carcinomaOSCCCholinemetabolismcancer-
Journal Article 2023-06-20 ✓ 2 Snippets Lin LH, Chang KW, Cheng HW, Liu CJ.
In-Text Gene Mentions

…, NEB ,DNAH10, SYNE2 ,…

…in KMT2D andDNAH10were significant after…

Show Full Abstract

The accurate diagnosis and treatment of oral squamous cell carcinoma (OSCC) requires an understanding of its genomic alterations. Liquid biopsies, especially cell-free DNA (cfDNA) analysis, are a minimally invasive technique used for genomic profiling. We conducted comprehensive whole-exome sequencing (WES) of 50 paired OSCC cell-free plasma with whole blood samples using multiple mutation calling pipelines and filtering criteria. Integrative Genomics Viewer (IGV) was used to validate somatic mutations. Mutation burden and mutant genes were correlated to clinico-pathological parameters. The plasma mutation burden of cfDNA was significantly associated with clinical staging and distant metastasis status. The genes <i>TTN</i>, <i>PLEC</i>, <i>SYNE1</i>, and <i>USH2A</i> were most frequently mutated in OSCC, and known driver genes, including <i>KMT2D</i>, <i>LRP1B</i>, <i>TRRAP,</i> and <i>FLNA</i>, were also significantly and frequently mutated. Additionally, the novel mutated genes <i>CCDC168</i>, <i>HMCN2, STARD9</i>, and <i>CRAMP1</i> were significantly and frequently present in patients with OSCC. The mutated genes most frequently found in patients with metastatic OSCC were <i>RORC</i>, <i>SLC49A3</i>, and <i>NUMBL.</i> Further analysis revealed that branched-chain amino acid (BCAA) catabolism, extracellular matrix-receptor interaction, and the hypoxia-related pathway were associated with OSCC prognosis. Choline metabolism in cancer, O-glycan biosynthesis, and protein processing in the endoplasmic reticulum pathway were associated with distant metastatic status. About 20% of tumors carried at least one aberrant event in BCAA catabolism signaling that could possibly be targeted by an approved therapeutic agent. We identified molecular-level OSCC that were correlated with etiology and prognosis while defining the landscape of major altered events of the OSCC plasma genome. These findings will be useful in the design of clinical trials for targeted therapies and the stratification of patients with OSCC according to therapeutic efficacy.

Also flagged:biopolymerscalcium phosphatespolyvinylpyrrolidonealginatecarbonatehydroxyapatite
Journal Article 2023-06-20 No Snippets Forysenkova AA, Fadeeva IV, Deyneko DV, Gosteva AN, Mamin GV, Shurtakova DV, Davydova GA, Yankova VG, Antoniac IV, Rau JV.
Show Full Abstract

An alternative approach for the currently used replacement therapy in dentistry is to apply materials that restore tooth tissue. Among them, composites, based on biopolymers with calcium phosphates, and cells can be applied. In the present work, a composite based on polyvinylpyrrolidone (PVP) and alginate (Alg) with carbonate hydroxyapatite (CHA) was prepared and characterized. The composite was investigated by X-ray diffraction, infrared spectroscopy, electron paramagnetic resonance (EPR) and scanning electron microscopy methods, and the microstructure, porosity, and swelling properties of the material were described. In vitro studies included the MTT test using mouse fibroblasts, and adhesion and survivability tests with human dental pulp stem cells (DPSC). The mineral component of the composite corresponded to CHA with an admixture of amorphous calcium phosphate. The presence of a bond between the polymer matrix and CHA particles was shown by EPR. The structure of the material was represented by micro- (30-190 μm) and nano-pores (average 8.71 ± 4.15 nm). The swelling measurements attested that CHA addition increased the polymer matrix hydrophilicity by 200%. <i>In vitro</i> studies demonstrated the biocompatibility of PVP-Alg-CHA (95 ± 5% cell viability), and DPSC located inside the pores. It was concluded that the PVP-Alg-CHA porous composite is promising for dentistry applications.

Also flagged:CD44LipidPolymerBreast Cancerhyaluronic acidcholesterol
Journal Article 2023-06-20 No Snippets Suksiriworapong J, Pongprasert N, Bunsupa S, Taresco V, Crucitti VC, Janurai T, Phruttiwanichakun P, Sakchaisri K, Wongrakpanich A.
Show Full Abstract

This study aimed to improve the anticancer effect of <i>Cordyceps militaris</i> herbal extract (CME) on breast cancer cells with hyaluronic acid (HYA) surface-decorated lipid polymer hybrid nanoparticles (LPNPs) and evaluate the applicability of a synthesized poly(glycerol adipate) (PGA) polymer for LPNP preparation. Firstly, cholesterol- and vitamin E-grafted PGA polymers (PGA-CH and PGA-VE, respectively) were fabricated, with and without maleimide-ended polyethylene glycol. Subsequently, CME, which contained an active cordycepin equaling 9.89% of its weight, was encapsulated in the LPNPs. The results revealed that the synthesized polymers could be used to prepare CME-loaded LPNPs. The LPNP formulations containing Mal-PEG were decorated with cysteine-grafted HYA via thiol-maleimide reactions. The HYA-decorated PGA-based LPNPs substantially enhanced the anticancer effect of CME against MDA-MB-231 and MCF-7 breast cancer cells by enhancing cellular uptake through CD44 receptor-mediated endocytosis. This study demonstrated the successful targeted delivery of CME to the CD44 receptors of tumor cells by HYA-conjugated PGA-based LPNPs and the new application of synthesized PGA-CH- and PGA-VE-based polymers in LPNP preparation. The developed LPNPs showed promising potential for the targeted delivery of herbal extracts for cancer treatment and clear potential for translation in in vivo experiments.

Also flagged:microcephalydevelopmental disorderstelomerase RNATERCgene expressionenzyme activity
Journal Article 2023-06-20 No Snippets Tokunaga M, Imamura T.
Show Full Abstract

Microcephaly is characterized as a small head circumference, and is often accompanied by developmental disorders. Several candidate risk genes for this disease have been described, and mutations in non-coding regions are occasionally found in patients with microcephaly. Various non-coding RNAs (ncRNAs), such as microRNAs (miRNAs), SINEUPs, telomerase RNA component (TERC), and promoter-associated lncRNAs (pancRNAs) are now being characterized. These ncRNAs regulate gene expression, enzyme activity, telomere length, and chromatin structure through RNA binding proteins (RBPs)-RNA interaction. Elucidating the potential roles of ncRNA-protein coordination in microcephaly pathogenesis might contribute to its prevention or recovery. Here, we introduce several syndromes whose clinical features include microcephaly. In particular, we focus on syndromes for which ncRNAs or genes that interact with ncRNAs may play roles. We discuss the possibility that the huge ncRNA field will provide possible new therapeutic approaches for microcephaly and also reveal clues about the factors enabling the evolutionary acquisition of the human-specific "large brain."

DCC
Also flagged:inflammatory responsescytokinesecretionCD28IL-6TGFβ
Journal Article 2023-06-20 ✓ 5 Snippets Sengun E, Wolfs TGAM, van Bruggen VLE, van Cranenbroek B, Simonetti ER, Ophelders D, de Jonge MI, Joosten I, van der Molen RG.
In-Text Gene Mentions

24 hours after activating PBMC with αCD3/CD28 beads, activated PBMC were exposed to UC-MSC in either direct cell-cell contact (DCC), transwell (TW) or with UC-MSC derived condition medium (CM) with a final volume of 25% or 50% (CM25% or CM50%, respectively).

Here, the effect of direct cell-cell contact (DCC) was examined by co-culturing αCD3/CD28 beads pre-stimulated PBMC with UC-MSC over a 5-day period.

…1 compared toDCC, but this effect…

…As compared toDCC, higher percentages of…

…also higher inDCC, compared to the…

Show Full Abstract

Inflammation is a physiological state where immune cells evoke a response against detrimental insults. Finding a safe and effective treatment for inflammation associated diseases has been a challenge. In this regard, human mesenchymal stem cells (hMSC), exert immunomodulatory effects and have regenerative capacity making it a promising therapeutic option for resolution of acute and chronic inflammation. T cells play a critical role in inflammation and depending on their phenotype, they can stimulate or suppress inflammatory responses. However, the regulatory effects of hMSC on T cells and the underlying mechanisms are not fully elucidated. Most studies focused on activation, proliferation, and differentiation of T cells. Here, we further investigated memory formation and responsiveness of CD4<sup>+</sup> T cells and their dynamics by immune-profiling and cytokine secretion analysis. Umbilical cord mesenchymal stem cells (UC-MSC) were co-cultured with either αCD3/CD28 beads, activated peripheral blood mononuclear cells (PBMC) or magnetically sorted CD4<sup>+</sup> T cells. The mechanism of immune modulation of UC-MSC were investigated by comparing different modes of action; transwell, direct cell-cell contact, addition of UC-MSC conditioned medium or blockade of paracrine factor production by UC-MSC. We observed a differential effect of UC-MSC on CD4<sup>+</sup> T cell activation and proliferation using PBMC or purified CD4<sup>+</sup> T cell co-cultures. UC-MSC skewed the effector memory T cells into a central memory phenotype in both co-culture conditions. This effect on central memory formation was reversible, since UC-MSC primed central memory cells were still responsive after a second encounter with the same stimuli. The presence of both cell-cell contact and paracrine factors were necessary for the most pronounced immunomodulatory effect of UC-MSC on T cells. We found suggestive evidence for a partial role of IL-6 and TGFβ in the UC-MSC derived immunomodulatory function. Collectively, our data show that UC-MSCs clearly affect T cell activation, proliferation and maturation, depending on co-culture conditions for which both cell-cell contact and paracrine factors are needed.

Also flagged:Carbohydratesimmune responsecarbohydratebindingglycanhost cells
Journal Article 2023-06-20 No Snippets Canner SW, Shanker S, Gray JJ.
Show Full Abstract

Carbohydrates dynamically and transiently interact with proteins for cell-cell recognition, cellular differentiation, immune response, and many other cellular processes. Despite the molecular importance of these interactions, there are currently few reliable computational tools to predict potential carbohydrate-binding sites on any given protein. Here, we present two deep learning (DL) models named CArbohydrate-Protein interaction Site IdentiFier (CAPSIF) that predicts non-covalent carbohydrate-binding sites on proteins: (1) a 3D-UNet voxel-based neural network model (CAPSIF:V) and (2) an equivariant graph neural network model (CAPSIF:G). While both models outperform previous surrogate methods used for carbohydrate-binding site prediction, CAPSIF:V performs better than CAPSIF:G, achieving test Dice scores of 0.597 and 0.543 and test set Matthews correlation coefficients (MCCs) of 0.599 and 0.538, respectively. We further tested CAPSIF:V on AlphaFold2-predicted protein structures. CAPSIF:V performed equivalently on both experimentally determined structures and AlphaFold2-predicted structures. Finally, we demonstrate how CAPSIF models can be used in conjunction with local glycan-docking protocols, such as GlycanDock, to predict bound protein-carbohydrate structures.

HTT
Also flagged:autosomal dominant neurodegenerative diseaseHDneurodegenerative diseasesphagocytosisspinecognitive decline
Journal Article 2023-06-20 ✓ 2 Snippets Gasser J, Gillet G, Valadas JS, Rouvière L, Kotian A, Fan W, Keaney J, Kadiu I.
In-Text Gene Mentions

…1 of theHTTgene.…

…expansion in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is an inherited autosomal dominant neurodegenerative disease caused by CAG repeats in exon 1 of the <i>HTT</i> gene. A hallmark of HD along with other psychiatric and neurodegenerative diseases is alteration in the neuronal circuitry and synaptic loss. Microglia and peripheral innate immune activation have been reported in pre-symptomatic HD patients; however, what "activation" signifies for microglial and immune function in HD and how it impacts synaptic health remains unclear. In this study we sought to fill these gaps by capturing immune phenotypes and functional activation states of microglia and peripheral immunity in the R6/2 model of HD at pre-symptomatic, symptomatic and end stages of disease. These included characterizations of microglial phenotypes at single cell resolution, morphology, aberrant functions such as surveillance and phagocytosis and their impact on synaptic loss <i>in vitro</i> and <i>ex vivo</i> in R6/2 mouse brain tissue slices. To further understand how relevant the observed aberrant microglial behaviors are to human disease, transcriptomic analysis was performed using HD patient nuclear sequencing data and functional assessments were conducted using induced pluripotent stem cell (iPSC)-derived microglia. Our results show temporal changes in brain infiltration of peripheral lymphoid and myeloid cells, increases in microglial activation markers and phagocytic functions at the pre-symptomatic stages of disease. Increases in microglial surveillance and synaptic uptake parallel significant reduction of spine density in R6/2 mice. These findings were mirrored by an upregulation of gene signatures in the endocytic and migratory pathways in disease-associated microglial subsets in human HD brains, as well as increased phagocytic and migratory functions of iPSC-derived HD microglia. These results collectively suggest that targeting key and specific microglial functions related to synaptic surveillance and pruning may be therapeutically beneficial in attenuating cognitive decline and psychiatric aspects of HD.

HFE
Also flagged:liver fibrosisCirrhosisliver diseasechronic liver diseasehepatocellular carcinomaportal hypertension
Journal Article 2023-06-20 ✓ 1 Snippet Lee MJ.
In-Text Gene Mentions

…teatohepatitis, phlebotomy forhemochromatosis, etc.)…

Show Full Abstract

Cirrhosis has traditionally been considered an irreversible process of end-stage liver disease. With new treatments for chronic liver disease, there is regression of fibrosis and cirrhosis, improvement in clinical parameters (i.e. liver function and hemodynamic markers, hepatic venous pressure gradient), and survival rates, demonstrating that fibrosis and fibrolysis are a dynamic process moving in two directions. Microscopically, hepatocytes push into thinning fibrous septa with eventual perforation leaving behind delicate periportal spikes in the portal tracts and loss of portal veins. Obliterated portal veins during progressive fibrosis and cirrhosis due to parenchymal extinction, vascular remodeling and thrombosis often leave behind a bile duct and hepatic artery within the portal tract. Traditional staging classification systems focused on a linear, progressive process; however, the Beijing classification system incorporates both the bidirectional nature for the progression and regression of fibrosis. However, even with regression, vascular lesions/remodeling, parenchymal extinction and a cumulative mutational burden place patients at an increased risk for developing hepatocellular carcinoma and should continue to undergo active clinical surveillance. It is more appropriate to consider cirrhosis as another stage in the evolution of chronic liver disease as a bidirectional process rather than an end-stage, irreversible state.

DCC
Also flagged:anomaliesACCgestationcystProud syndromeARX
Journal Article 2023-06-20 ✓ 1 Snippet Devi R, Chaurasia S, Priyadarshi M, Singh P, Basu S.
In-Text Gene Mentions

…, ZHFX1B ,Dcc, Gap43 ,…

Show Full Abstract

Agenesis of the corpus callosum (ACC) is one of the most common congenital brain anomalies with variable associations and outcomes. The incidence of ACC varies from 1.8 per 10,000 live births in normal children to as high as 600 per 10,000 in children with neurodevelopmental problems. Here, we report the case of a female neonate delivered in our institute at term gestation to a gravida 4 mother with partial ACC. The neonate was antenatally diagnosed with ACC. The mother had a previous fetus with a supratentorial cyst that was medically terminated. The neonate had a normal clinical examination, but the ultrasound of the cranium suggested ACC. Given the significant family history, a clinical exome sequencing test revealed a pathogenic frameshift mutation in the <i>ARX</i> gene that causes Proud syndrome. We discuss the relevant points in the diagnosis, workup, and prognosis of ACC through this case. This case highlights the importance of antenatal assessment for timely amniocentesis and a genetic diagnosis to guide the parental decision for continuation of the pregnancy, level 2 scans to detect associated anomalies, and postnatal assessment to determine the cause and prognosis of a neonate with ACC.

Also flagged:mental disorderspathogenesispsychiatric diseasesbehavioralmental disorderbrain dysfunction
Journal Article 2023-06-20 No Snippets Wang L, Liu F, Fang Y, Ma J, Wang J, Qu L, Yang Q, Wu W, Jin L, Sun D.
Show Full Abstract

As an important part in international disease, mental disorders seriously damage human health and social stability, which show the complex pathogenesis and increasing incidence year by year. In order to analyze the pathogenesis of mental disorders as soon as possible and to look for the targeted drug treatment for psychiatric diseases, a more reasonable animal model is imperious demands. Benefiting from its high homology with the human genome, its brain tissue is highly similar to that of humans, and it is easy to realize whole-body optical visualization and high-throughput screening; zebrafish stands out among many animal models of mental disorders. Here, valuable qualified zebrafish mental disorders models could be established through behavioral test and sociological analysis, which are simulated to humans, and combined with molecular analyses and other detection methods. This review focuses on the advances in the zebrafish model to simulate the human mental disorders; summarizes the various behavioral characterization means, the use of equipment, and operation principle; sums up the various mental disorder zebrafish model modeling methods; puts forward the current challenges and future development trend, which is to contribute the theoretical supports for the exploration of the mechanisms and treatment strategies of mental disorders.

T cells in health and disease.

BTN2A1
Also flagged:cell developmentinfectionstumorspathogenesisautoimmune diseasesinfectious disease
Journal Article 2023-06-19 ✓ 1 Snippet Sun L, Su Y, Jiao A, Wang X, Zhang B.
In-Text Gene Mentions

Human γδ T cell subtypes are usually defined by δ chain, that Vδ1-3 are the most used gene segments and used for γδ T cell type classification.980 Vδ1 and Vδ3 T cells are less frequent γδ T cell populations and share some similarities in peripheral tissue distribution, antigen recognition and antiviral function.981,982 Vδ2 T cells—frequently paired between TCR Vδ2 and Vγ9 chains (Vγ9Vδ2 T cells)—constitute a predominant γδ T cell population in human peripheral blood after infection and malignancy.983 The phosphoantigens recognized by Vγ9Vδ2 T cells are natural products from microorganisms or generated by mammalian cells through mevalonate pathway.981 The aberrant mevalonate pathway in tumor cells leads to accumulation of phosphoantigens and Vγ9Vδ2 T cell activation and expansion in TME.984 Vγ9Vδ2 T cells recognize phosphoantigens bound by BTN3A1/BTN2A1 heterodimers.985 Therefore, phosphoantigen stimulation and agonism by targeting BTN3A1 have been shown to promote Vγ9Vδ2 T cell activation and anti-tumor activity.986,987 Non-Vγ9Vδ2 T cells, including Vδ1 and Vδ3 T cells, recognize glycolipids presented by CD1d.988 Besides, human γδ T cells express a range of natural killer receptors (NKRs), such as NKG2D, DNAM-1, NKp30, NKp44, and NKp46, which promote their cytotoxic effector functions upon recognition of cognate ligands on tumor cells.982 Moreover, γδ T cells express various TLRs and can be activated by TLR agonists to enhance cytotoxic functions.989

Show Full Abstract

T cells are crucial for immune functions to maintain health and prevent disease. T cell development occurs in a stepwise process in the thymus and mainly generates CD4<sup>+</sup> and CD8<sup>+</sup> T cell subsets. Upon antigen stimulation, naïve T cells differentiate into CD4<sup>+</sup> helper and CD8<sup>+</sup> cytotoxic effector and memory cells, mediating direct killing, diverse immune regulatory function, and long-term protection. In response to acute and chronic infections and tumors, T cells adopt distinct differentiation trajectories and develop into a range of heterogeneous populations with various phenotype, differentiation potential, and functionality under precise and elaborate regulations of transcriptional and epigenetic programs. Abnormal T-cell immunity can initiate and promote the pathogenesis of autoimmune diseases. In this review, we summarize the current understanding of T cell development, CD4<sup>+</sup> and CD8<sup>+</sup> T cell classification, and differentiation in physiological settings. We further elaborate the heterogeneity, differentiation, functionality, and regulation network of CD4<sup>+</sup> and CD8<sup>+</sup> T cells in infectious disease, chronic infection and tumor, and autoimmune disease, highlighting the exhausted CD8<sup>+</sup> T cell differentiation trajectory, CD4<sup>+</sup> T cell helper function, T cell contributions to immunotherapy and autoimmune pathogenesis. We also discuss the development and function of γδ T cells in tissue surveillance, infection, and tumor immunity. Finally, we summarized current T-cell-based immunotherapies in both cancer and autoimmune diseases, with an emphasis on their clinical applications. A better understanding of T cell immunity provides insight into developing novel prophylactic and therapeutic strategies in human diseases.

Also flagged:immunodeficiencydevelopmental delayintellectual disabilityIDautismneurodevelopmental disorders
Journal Article 2023-06-19 No Snippets Bonini KE, Thomas-Wilson A, Marathe PN, Sebastin M, Odgis JA, Di Biase M, Kelly NR, Ramos MA, Insel BJ, Scarimbolo L, Rehman AU, Guha S, Okur V, Abhyankar A, Phadke S, Nava C, Gallagher KM, Elkhoury L, Edelmann L, Zinberg RE, Abul-Husn NS, Diaz GA, Greally JM, Suckiel SA, Horowitz CR, Kenny EE, Wasserstein M, Gelb BD, Jobanputra V.
Show Full Abstract

Copy number variations (CNVs) play a significant role in human disease. While chromosomal microarray has traditionally been the first-tier test for CNV detection, use of genome sequencing (GS) is increasing. We report the frequency of CNVs detected with GS in a diverse pediatric cohort from the NYCKidSeq program and highlight specific examples of its clinical impact. A total of 1052 children (0-21 years) with neurodevelopmental, cardiac, and/or immunodeficiency phenotypes received GS. Phenotype-driven analysis was used, resulting in 183 (17.4%) participants with a diagnostic result. CNVs accounted for 20.2% of participants with a diagnostic result (37/183) and ranged from 0.5 kb to 16 Mb. Of participants with a diagnostic result (n = 183) and phenotypes in more than one category, 5/17 (29.4%) were solved by a CNV finding, suggesting a high prevalence of diagnostic CNVs in participants with complex phenotypes. Thirteen participants with a diagnostic CNV (35.1%) had previously uninformative genetic testing, of which nine included a chromosomal microarray. This study demonstrates the benefits of GS for reliable detection of CNVs in a pediatric cohort with variable phenotypes.

TNFSF4
Also flagged:IgA nephropathyIgANkidney diseasekidney failureTNFSF18REL
Journal Article 2023-06-19 ✓ 2 Snippets Kiryluk K, Sanchez-Rodriguez E, Zhou XJ, Zanoni F, Liu L, Mladkova N, Khan A, Marasa M, Zhang JY, Balderes O, Sanna-Cherchi S, Bomback AS, Canetta PA, Appel GB, Radhakrishnan J, Trimarchi H, Sprangers B, Cattran DC, Reich H, Pei Y, Ravani P, Galesic K, Maixnerova D, Tesar V, Stengel B, Metzger M, Canaud G, Maillard N, Berthoux F, Berthelot L, Pillebout E, Monteiro R, Nelson R, Wyatt RJ, Smoyer W, Mahan J, Samhar AA, Hidalgo G, Quiroga A, Weng P, Sreedharan R, Selewski D, Davis K, Kallash M, Vasylyeva TL, Rheault M, Chishti A, Ranch D, Wenderfer SE, Samsonov D, Claes DJ, Akchurin O, Goumenos D, Stangou M, Nagy J, Kovacs T, Fiaccadori E, Amoroso A, Barlassina C, Cusi D, Del Vecchio L, Battaglia GG, Bodria M, Boer E, Bono L, Boscutti G, Caridi G, Lugani F, Ghiggeri G, Coppo R, Peruzzi L, Esposito V, Esposito C, Feriozzi S, Polci R, Frasca G, Galliani M, Garozzo M, Mitrotti A, Gesualdo L, Granata S, Zaza G, Londrino F, Magistroni R, Pisani I, Magnano A, Marcantoni C, Messa P, Mignani R, Pani A, Ponticelli C, Roccatello D, Salvadori M, Salvi E, Santoro D, Gembillo G, Savoldi S, Spotti D, Zamboli P, Izzi C, Alberici F, Delbarba E, Florczak M, Krata N, Mucha K, Pączek L, Niemczyk S, Moszczuk B, Pańczyk-Tomaszewska M, Mizerska-Wasiak M, Perkowska-Ptasińska A, Bączkowska T, Durlik M, Pawlaczyk K, Sikora P, Zaniew M, Kaminska D, Krajewska M, Kuzmiuk-Glembin I, Heleniak Z, Bullo-Piontecka B, Liberek T, Dębska-Slizien A, Hryszko T, Materna-Kiryluk A, Miklaszewska M, Szczepańska M, Szczepańska M, Dyga K, Machura E, Siniewicz-Luzeńczyk K, Pawlak-Bratkowska M, Tkaczyk M, Runowski D, Kwella N, Drożdż D, Habura I, Kronenberg F, Prikhodina L, van Heel D, Fontaine B, Cotsapas C, Wijmenga C, Franke A, Annese V, Gregersen PK, Parameswaran S, Weirauch M, Kottyan L, Harley JB, Suzuki H, Narita I, Goto S, Lee H, Kim DK, Kim YS, Park JH, Cho B, Choi M, Van Wijk A, Huerta A, Ars E, Ballarin J, Lundberg S, Vogt B, Mani LY, Caliskan Y, Barratt J, Abeygunaratne T, Kalra PA, Gale DP, Panzer U, Rauen T, Floege J, Schlosser P, Ekici AB, Eckardt KU, Chen N, Xie J, Lifton RP, Loos RJF, Kenny EE, Ionita-Laza I, Köttgen A, Julian BA, Novak J, Scolari F, Zhang H, Gharavi AG.
In-Text Gene Mentions

…were new, includingTNFSF4/TNFSF18 , REL ,…

TNFSF4

Show Full Abstract

IgA nephropathy (IgAN) is a progressive form of kidney disease defined by glomerular deposition of IgA. Here we performed a genome-wide association study of 10,146 kidney-biopsy-diagnosed IgAN cases and 28,751 controls across 17 international cohorts. We defined 30 genome-wide significant risk loci explaining 11% of disease risk. A total of 16 loci were new, including TNFSF4/TNFSF18, REL, CD28, PF4V1, LY86, LYN, ANXA3, TNFSF8/TNFSF15, REEP3, ZMIZ1, OVOL1/RELA, ETS1, IGH, IRF8, TNFRSF13B and FCAR. The risk loci were enriched in gene orthologs causing abnormal IgA levels when genetically manipulated in mice. We also observed a positive genetic correlation between IgAN and serum IgA levels. High polygenic score for IgAN was associated with earlier onset of kidney failure. In a comprehensive functional annotation analysis of candidate causal genes, we observed convergence of biological candidates on a common set of inflammatory signaling pathways and cytokine ligand-receptor pairs, prioritizing potential new drug targets.

Also flagged:intervertebral disc degenerationproteasesCSasthmachronic obstructive pulmonary diseaseCOPD
Journal Article 2023-06-19 No Snippets Tu J, Li W, Hansbro PM, Yan Q, Bai X, Donovan C, Kim RY, Galvao I, Das A, Yang C, Zou J, Diwan A.
Show Full Abstract

Although cigarette smoking (CS) and low back pain (LBP) are common worldwide, their correlations and the mechanisms of action remain unclear. We have shown that excessive activation of mast cells (MCs) and their proteases play key roles in CS-associated diseases, like asthma, chronic obstructive pulmonary disease (COPD), blood coagulation, and lung cancer. Previous studies have also shown that MCs and their proteases induce degenerative musculoskeletal disease. By using a custom-designed smoke-exposure mouse system, we demonstrated that CS results in intervertebral disc (IVD) degeneration and release of MC-restricted tetramer tryptases (TTs) in the IVDs. TTs were found to regulate the expression of methyltransferase 14 (METTL14) at the epigenetic level by inducing N6-methyladenosine (m<sup>6</sup>A) deposition in the 3' untranslated region (UTR) of the transcript that encodes dishevelled-axin (DIX) domain-containing 1 (DIXDC1). That reaction increases the mRNA stability and expression of Dixdc1. DIXDC1 functionally interacts with disrupted in schizophrenia 1 (DISC1) to accelerate the degeneration and senescence of nucleus pulposus (NP) cells by activating a canonical Wnt pathway. Our study demonstrates the association between CS, MC-derived TTs, and LBP. These findings raise the possibility that METTL14-medicated DIXDC1 m<sup>6</sup>A modification could serve as a potential therapeutic target to block the development of degeneration of the NP in LBP patients.

SERPINC1CSE1L
Also flagged:Lipoproteinslipoproteincoronavirus disease 2019COVID-19infectionsacute respiratory syndrome
Journal Article 2023-06-19 ✓ 3 Snippets Burnap SA, Ortega-Prieto AM, Jimenez-Guardeño JM, Ali H, Takov K, Fish M, Shankar-Hari M, Giacca M, Malim MH, Mayr M.
In-Text Gene Mentions

…kininogen-1 (KNG1) andantithrombin-III(SERPINC1, Fig. 1…

…(KNG1) and antithrombin-III (SERPINC1, Fig. 1 A…

…(ANTXR2), and exportin-2 (CSE1L), all within the…

Show Full Abstract

High-density lipoprotein (HDL) levels are reduced in patients with coronavirus disease 2019 (COVID-19), and the extent of this reduction is associated with poor clinical outcomes. While lipoproteins are known to play a key role during the life cycle of the hepatitis C virus, their influence on coronavirus (CoV) infections is poorly understood. In this study, we utilize cross-linking mass spectrometry (XL-MS) to determine circulating protein interactors of the severe acute respiratory syndrome (SARS)-CoV-2 spike glycoprotein. XL-MS of plasma isolated from patients with COVID-19 uncovered HDL protein interaction networks, dominated by acute-phase serum amyloid proteins, whereby serum amyloid A2 was shown to bind to apolipoprotein (Apo) D. XL-MS on isolated HDL confirmed ApoD to interact with SARS-CoV-2 spike but not SARS-CoV-1 spike. Other direct interactions of SARS-CoV-2 spike upon HDL included ApoA1 and ApoC3. The interaction between ApoD and spike was further validated in cells using immunoprecipitation-MS, which uncovered a novel interaction between both ApoD and spike with membrane-associated progesterone receptor component 1. Mechanistically, XL-MS coupled with data-driven structural modeling determined that ApoD may interact within the receptor-binding domain of the spike. However, ApoD overexpression in multiple cell-based assays had no effect upon viral replication or infectivity. Thus, SARS-CoV-2 spike can bind to apolipoproteins on HDL, but these interactions do not appear to alter infectivity.

KLHL20
Also flagged:GlioblastomaGBMbrain gliomasbrain tumorantigen receptorcholesterol
Journal Article 2023-06-19 ✓ 4 Snippets Chang H, Hou J, Shao Y, Xu M, Weng X, Du Y, Shi J, Zhang L, Cui H.
In-Text Gene Mentions

Moreover, the protein expression levels of MBI1 and KLHL20 in GBM cell lines were detected, and the results showed that MIB1 was remarkably reduced after SC treatment, whereas no obvious change in the KLHL20 protein expression was observed (Figure 5B,C).

…including MIB1 andKLHL20.…

…of MBI1 andKLHL20in GBM cell…

…change in theKLHL20protein expression was…

Show Full Abstract

Sanggenon C (SC), a herbal flavonoid extracted from Cortex Mori, has been mentioned to possess more than one treasured organic properties. However, the molecular mechanism of its anti-tumor impact in glioblastoma (GBM) remains unclear. In this study, we reported that SC displayed a GBM-suppressing impact in vitro and in vivo with no apparent organ toxicity. SC dramatically suppressed cell proliferation-induced cell apoptosis in GBM cells. Mechanistically, we unveiled that SC modulated the protein expression of death associated protain kinase 1 (DAPK1) by controlling the ubiquitination and degradation of DAPK1. Quantitative proteomic and Western blot analyses showed that SC improved DAPK1 protein degradation via decreasing the expression of E3 ubiquitin ligase Mindbomb 1 (MIB1). More importantly, the effects of SC on cell proliferation and apoptosis of GBM cells have been in part reversed through DAPK1 downregulation or MIB1 overexpression, respectively. These results indicated that SC might suppress cell proliferation and induce cell apoptosis by decreasing MIB1-mediated DAPK1 degradation. Furthermore, we found that SC acted synergistically with temozolomide (TMZ), an anti-cancer drug used in GBM, resulting in elevated chemotherapeutic sensitivity of GBM to TMZ. Collectively, our data suggest that SC might be a promising anti-cancer agent for GBM therapy.

OLFM4
Also flagged:nuclear structural proteinscytoskeletonextracellular trapsproteinshistoneschromatin
Journal Article 2023-06-19 ✓ 2 Snippets Reis LR, Souza Junior DR, Tomasin R, Bruni-Cardoso A, Di Mascio P, Ronsein GE.
In-Text Gene Mentions

…AZU1, and olfactomedin-4 (OLFM4) [ 50 ],…

OLFM4–…

Show Full Abstract

Neutrophil extracellular traps (NETs) are web-like structures of DNA coated with cytotoxic proteins and histones released by activated neutrophils through a process called NETosis. NETs release occurs through a sequence of highly organized events leading to chromatin expansion and rupture of nuclear and cellular membranes. In calcium ionophore-induced NETosis, the enzyme peptidylargine deiminase 4 (PAD4) mediates chromatin decondensation through histone citrullination, but the biochemical pathways involved in this process are not fully understood. Here we use live-imaging microscopy and proteomic studies of the neutrophil cellular fractions to investigate the early events in ionomycin-triggered NETosis. We found that before ionomycin-stimulated neutrophils release NETs, profound biochemical changes occur in and around their nucleus, such as, cytoskeleton reorganization, nuclear redistribution of actin-remodeling related proteins, and citrullination of actin-ligand and nuclear structural proteins. Ionomycin-stimulated neutrophils rapidly lose their characteristic polymorphic nucleus, and these changes are promptly communicated to the extracellular environment through the secretion of proteins related to immune response. Therefore, our findings revealed key biochemical mediators in the early process that subsequently culminates with nuclear and cell membranes rupture, and extracellular DNA release.

Also flagged:MagnesiumOsteogenesisangiogenesisaginghypersensitivityinfection
Journal Article 2023-06-19 No Snippets Hu J, Shao J, Huang G, Zhang J, Pan S.
Show Full Abstract

Bone is a highly vascularized tissue, and the ability of magnesium (Mg) to promote osteogenesis and angiogenesis has been widely studied. The aim of bone tissue engineering is to repair bone tissue defects and restore its normal function. Various Mg-enriched materials that can promote angiogenesis and osteogenesis have been made. Here, we introduce several types of orthopedic clinical uses of Mg; recent advances in the study of metal materials releasing Mg ions (pure Mg, Mg alloy, coated Mg, Mg-rich composite, ceramic, and hydrogel) are reviewed. Most studies suggest that Mg can enhance vascularized osteogenesis in bone defect areas. Additionally, we summarized some research on the mechanisms related to vascularized osteogenesis. In addition, the experimental strategies for the research of Mg-enriched materials in the future are put forward, in which clarifying the specific mechanism of promoting angiogenesis is the crux.

Also flagged:LIN28BDiffuse midline gliomahistoneRNA binding proteinoncogenesLIN28A
Journal Article 2023-06-19 No Snippets Knowles T, Huang T, Qi J, An S, Burket N, Cooper S, Nazarian J, Saratsis AM.
Show Full Abstract

Diffuse midline glioma (DMG) is the most lethal of all childhood cancers. DMGs are driven by histone-tail-mutation-mediated epigenetic dysregulation and partner mutations in genes controlling proliferation and migration. One result of this epigenetic and genetic landscape is the overexpression of LIN28B RNA binding protein. In other systems, LIN28B has been shown to prevent let-7 microRNA biogenesis; however, let-7, when available, faithfully suppresses tumorigenic pathways and induces cellular maturation by preventing the translation of numerous oncogenes. Here, we review the current literature on LIN28A/B and the let-7 family and describe their role in gliomagenesis. Future research is then recommended, with a focus on the mechanisms of LIN28B overexpression and localization in DMG.

Also flagged:PhospholipaseLung CancerneoplasmcancerMalignant lung tumorsnon-small-cell lung carcinoma
Journal Article 2023-06-19 No Snippets Salucci S, Aramini B, Bartoletti-Stella A, Versari I, Martinelli G, Blalock W, Stella F, Faenza I.
Show Full Abstract

Lung cancer (LC) is the second most common neoplasm in men and the third most common in women. In the last decade, LC therapies have undergone significant improvements with the advent of immunotherapy. However, the effectiveness of the available treatments remains insufficient due to the presence of therapy-resistant cancer cells. For decades, chemotherapy and radiotherapy have dominated the treatment strategy for LC; however, relapses occur rapidly and result in poor survival. Malignant lung tumors are classified as either small- or non-small-cell lung carcinoma (SCLC and NSCLC). Despite improvements in the treatment of LC in recent decades, the benefits of surgery, radiotherapy, and chemotherapy are limited, although they have improved the prognosis of LC despite the persistent low survival rate due to distant metastasis in the late stage. The identification of novel prognostic molecular markers is crucial to understand the underlying mechanisms of LC initiation and progression. The potential role of phosphatidylinositol in tumor growth and the metastatic process has recently been suggested by some researchers. Phosphatidylinositols are lipid molecules and key players in the inositol signaling pathway that have a pivotal role in cell cycle regulation, proliferation, differentiation, membrane trafficking, and gene expression. In this review, we discuss the current understanding of phosphoinositide-specific phospholipase enzymes and their emerging roles in LC.

HTT
Also flagged:Monoamine Oxidase ASerotonincardiac hypertrophydegradationmonoamine oxidasesReceptor
Journal Article 2023-06-19 ✓ 2 Snippets Knittel J, Itani N, Schreckenberg R, Heger J, Rohrbach S, Schulz R, Schlüter KD.
In-Text Gene Mentions

Nonspecific effects of 5-HT are linked to 5-HT uptake via the serotonin transporter 5-HTT, encoded by the gene SLC6A4, and serotonin metabolism by monoamine oxidases (MAO)s that metabolize 5-HT to 5-hydroxyindolacetaldehyde.

…the serotonin transporter5-HTT, encoded by the…

Show Full Abstract

Serotonin effects on cardiac hypertrophy, senescence, and failure are dependent either on activation of specific receptors or serotonin uptake and serotonin degradation by monoamine oxidases (MAOs). Receptor-dependent effects are specific for serotonin, but MAO-dependent effects are nonspecific as MAOs also metabolize other substrates such as catecholamines. Our study evaluates the role of MAO-A in serotonin- and norepinephrine-dependent cell damage. Experiments were performed in vivo to study the regulation of <i>MAOA</i> and <i>MAOB</i> expression and in vitro on isolated cultured adult rat ventricular cardiomyocytes (cultured for 24 h) to study the function of MAO-A. <i>MAOA</i> but not <i>MAOB</i> expression increased in maladaptive hypertrophic stages. Serotonin and norepinephrine induced morphologic cell damage (loss of rod-shaped cell structure). However, MAO-A inhibition suppressed serotonin-dependent but not norepinephrine-dependent damages. Serotonin but not norepinephrine caused a reduction in cell shortening in nondamaged cells. Serotonin induced mitochondria-dependent oxidative stress. In vivo, <i>MAOA</i> was induced during aging and hypertension but the expression of the corresponding serotonin uptake receptor (<i>SLC6A4</i>) was reduced and enzymes that reduce either oxidative stress (<i>CAT</i>) or accumulation of 5-hydroxyindolacetaldehyde (<i>ALDH2</i>) were induced. In summary, the data show that MAO-A potentially affects cardiomyocytes' function but that serotonin is not necessarily the native substrate.

Also flagged:TumorGastrointestinal CancerGastrointestinal (neoplasmcancerdeath
Journal Article 2023-06-19 No Snippets Lucarini V, Nardozi D, Angiolini V, Benvenuto M, Focaccetti C, Carrano R, Besharat ZM, Bei R, Masuelli L.
Show Full Abstract

Gastrointestinal (GI) cancers are the most frequent neoplasm, responsible for half of all cancer-related deaths. Metastasis is the leading cause of death from GI cancer; thus, studying the processes that regulate cancer cell migration is of paramount importance for the development of new therapeutic strategies. In this review, we summarize the mechanisms adopted by cancer cells to promote cell migration and the subsequent metastasis formation by highlighting the key role that tumor microenvironment components play in deregulating cellular pathways involved in these processes. We, therefore, provide an overview of the role of different microRNAs in promoting tumor metastasis and their role as potential biomarkers for the prognosis, monitoring, and diagnosis of GI cancer patients. Finally, we relate the possible use of nutraceuticals as a new strategy for targeting numerous microRNAs and different pathways involved in GI tumor invasiveness.

PRDX6
Also flagged:neovascular age-related macular degenerationvascular endothelial growth factorVEGFmacular diseaseAldolase Ctranslational
Journal Article 2023-06-19 ✓ 1 Snippet Künzel SE, Flesch LTM, Frentzel DP, Knecht VA, Rübsam A, Dreher F, Schütte M, Dubrac A, Lange B, Yaspo ML, Lehrach H, Joussen AM, Zeitz O.
In-Text Gene Mentions

…we detect peroxiredoxin-6 (PRDX6) as a biomarker…

Show Full Abstract

There is early evidence of extraocular systemic signals effecting function and morphology in neovascular age-related macular degeneration (nAMD). The prospective, cross-sectional BIOMAC study is an explorative investigation of peripheral blood proteome profiles and matched clinical features to uncover systemic determinacy in nAMD under anti-vascular endothelial growth factor intravitreal therapy (anti-VEGF IVT). It includes 46 nAMD patients stratified by the level of disease control under ongoing anti-VEGF treatment. Proteomic profiles in peripheral blood samples of every patient were detected with LC-MS/MS mass spectrometry. The patients underwent extensive clinical examination with a focus on macular function and morphology. In silico analysis includes unbiased dimensionality reduction and clustering, a subsequent annotation of clinical features, and non-linear models for recognition of underlying patterns. The model assessment was performed using leave-one-out cross validation. The findings provide an exploratory demonstration of the link between systemic proteomic signals and macular disease pattern using and validating non-linear classification models. Three main results were obtained: (1) Proteome-based clustering identifies two distinct patient subclusters with the smaller one (<i>n</i> = 10) exhibiting a strong signature for oxidative stress response. Matching the relevant meta-features on the individual patient's level identifies pulmonary dysfunction as an underlying health condition in these patients. (2) We identify biomarkers for nAMD disease features with Aldolase C as a putative factor associated with superior disease control under ongoing anti-VEGF treatment. (3) Apart from this, isolated protein markers are only weakly correlated with nAMD disease expression. In contrast, applying a non-linear classification model identifies complex molecular patterns hidden in a high number of proteomic dimensions determining macular disease expression. In conclusion, so far unconsidered systemic signals in the peripheral blood proteome contribute to the clinically observed phenotype of nAMD, which should be examined in future translational research on AMD.

Also flagged:AmantadineDysthymiachronic mood disorderdepressionsertralinemajor depressive episode
Journal Article 2023-06-19 No Snippets Krzystanek M, Martyniak E, Pałasz A, Skałacka K, Chwalba A, Wierzbiński P.
Show Full Abstract

Dysthymia is a common chronic mood disorder in which isolated symptoms of depression persist for at least 2 years. Despite the many medications recommended for the treatment of dysthymia, no recommendations have yet been made for the treatment of patients who fail to achieve clinical improvement. This justifies attempts to identify second-line drugs for the treatment of dysthymia. In an open and naturalistic case study, five patients diagnosed with dysthymia in whom at least one antidepressant treatment was ineffective were treated with amantadine. In the age- and gender-matched external control group, patients were treated with sertraline at 100 mg/day. Depressive symptoms were assessed using HDRS-17. Two men and three women were treated with 100 mg amantadine for 3 months with 3-5 months follow-up. After 1 month of treatment with amantadine, a significant reduction in the intensity of depressive symptoms was achieved in all patients, and the clinical improvement increased over the next 2 months of treatment. No deterioration in well-being was observed in any patient after discontinuation of amantadine. The effect of amantadine treatment was comparable to that of sertraline treatment in patients with dysthymia who improved with this drug. The present study indicates that amantadine is an effective and well-tolerated drug in the treatment of dysthymia. Amantadine may be associated with a quick improvement in symptoms in the treatment of dysthymia. Treatment with this drug seems to be associated with good tolerability and persistency of the therapeutic effect after the discontinuation of the treatment.

TNFSF4
Also flagged:epithelial mesenchymal transitionserous ovarian cancerovarian cancertumourGAS1SOC
Journal Article 2023-06-19 ✓ 1 Snippet Li Q, Xiao X, Feng J, Yan R, Xi J.
In-Text Gene Mentions

…CD276,TNFSF4, CX3CL1, TNFSF9, and…

Show Full Abstract

<h4>Background</h4>Ovarian cancer is the most lethal gynaecological malignancy, and serous ovarian cancer (SOC) is one of the more important pathological subtypes. Previous studies have reported a significant association of epithelial tomesenchymal transition (EMT) with invasive metastasis and immune modulation of SOC, however, there is a lack of prognostic and immune infiltration biomarkers reported for SOC based on EMT.<h4>Methods</h4>Gene expression data for ovarian cancer and corresponding patient clinical data were collected from the TCGA database and the GEO database, and cell type annotation and spatial expression analysis were performed on single cell sequencing data from the GEO database. To understand the cell type distribution of EMT-related genes in SOC single-cell data and the enrichment relationships of biological pathways and tumour functions. In addition, GO functional annotation analysis and KEGG pathway enrichment analysis were performed on mRNAs predominantly expressed with EMT to predict the biological function of EMT in ovarian cancer. The major differential genes of EMT were screened to construct a prognostic risk prediction model for SOC patients. Data from 173 SOC patient samples obtained from the GSE53963 database were used to validate the prognostic risk prediction model for ovarian cancer. Here we also analysed the direct association between SOC immune infiltration and immune cell modulation and EMT risk score. and calculate drug sensitivity scores in the GDSC database.In addition, we assessed the specific relationship between GAS1 gene and SOC cell lines.<h4>Results</h4>Single cell transcriptome analysis in the GEO database annotated the major cell types of SOC samples, including: T cell, Myeloid, Epithelial cell, Fibroblast, Endothelial cell, and Bcell. cellchat revealed several cell type interactions that were shown to be associated with EMT-mediated SOC invasion and metastasis. A prognostic stratification model for SOC was constructed based on EMT-related differential genes, and the Kapan-Meier test showed that this biomarker had significant prognostic stratification value for several independent SOC databases. The EMT risk score has good stratification and identification properties for drug sensitivity in the GDSC database.<h4>Conclusions</h4>This study constructed a prognostic stratification biomarker based on EMT-related risk genes for immune infiltration mechanisms and drug sensitivity analysis studies in SOC. This lays the foundation for in-depth clinical studies on the role of EMT in immune regulation and related pathway alterations in SOC. It is also hoped to provide effective potential solutions for early diagnosis and clinical treatment of ovarian cancer.

PRDX6
Also flagged:Mesophyllvanillincapsaicincell wallchitinpectin
Journal Article 2023-06-19 ✓ 1 Snippet Zha W, Li C, Wu Y, Chen J, Li S, Sun M, Wu B, Shi S, Liu K, Xu H, Li P, Liu K, Yang G, Chen Z, Xu D, Zhou L, You A.
In-Text Gene Mentions

…and LOC_Os01g73200 (PRDX6); these genes…

Show Full Abstract

The brown planthopper (BPH) (<i>Nilaparvata lugens</i>) sucks rice sap causing leaves to turn yellow and wither, often leading to reduced or zero yields. Rice co-evolved to resist damage by BPH. However, the molecular mechanisms, including the cells and tissues, involved in the resistance are still rarely reported. Single-cell sequencing technology allows us to analyze different cell types involved in BPH resistance. Here, using single-cell sequencing technology, we compared the response offered by the leaf sheaths of the susceptible (TN1) and resistant (YHY15) rice varieties to BPH (48 hours after infestation). We found that the 14,699 and 16,237 cells (identified <i>via</i> transcriptomics) in TN1 and YHY15 could be annotated using cell-specific marker genes into nine cell-type clusters. The two rice varieties showed significant differences in cell types (such as mestome sheath cells, guard cells, mesophyll cells, xylem cells, bulliform cells, and phloem cells) in the rice resistance mechanism to BPH. Further analysis revealed that although mesophyll, xylem, and phloem cells are involved in the BPH resistance response, the molecular mechanism used by each cell type is different. Mesophyll cell may regulate the expression of genes related to vanillin, capsaicin, and ROS production, phloem cell may regulate the cell wall extension related genes, and xylem cell may be involved in BPH resistance response by controlling the expression of chitin and pectin related genes. Thus, rice resistance to BPH is a complicated process involving multiple insect resistance factors. The results presented here will significantly promote the investigation of the molecular mechanisms underlying the resistance of rice to insects and accelerate the breeding of insect-resistant rice varieties.

DCC
Also flagged:cancerskin cutaneous melanomagene expressioncalciumRasPI3K
Journal Article 2023-06-19 ✓ 2 Snippets Wang F, Cheng F, Zheng F.
In-Text Gene Mentions

Netrin-1 encoded by NTN1 promotes the melanoma development coupled with its receptor DCC, which, in contrast, functioned as a tumor suppressor in intestinal cancer and lung metastasis by triggering cancer cell death (52).

…with its receptorDCC, which, in contrast,…

Show Full Abstract

<h4>Background</h4>Recent discoveries uncovered the complex cancer-nerve interactions in several cancer types including skin cutaneous melanoma (SKCM). However, the genetic characterization of neural regulation in SKCM is unclear.<h4>Methods</h4>Transcriptomic expression data were collected from the TCGA and GTEx portal, and the differences in cancer-nerve crosstalk-associated gene expressions between normal skin and SKCM tissues were analyzed. The cBioPortal dataset was utilized to implement the gene mutation analysis. PPI analysis was performed using the STRING database. Functional enrichment analysis was analyzed by the R package clusterProfiler. K-M plotter, univariate, multivariate, and LASSO regression were used for prognostic analysis and verification. The GEPIA dataset was performed to analyze the association of gene expression with SKCM clinical stage. ssGSEA and GSCA datasets were used for immune cell infiltration analysis. GSEA was used to elucidate the significant function and pathway differences.<h4>Results</h4>A total of 66 cancer-nerve crosstalk-associated genes were identified, 60 of which were up- or downregulated in SKCM and KEGG analysis suggested that they are mainly enriched in the calcium signaling pathway, Ras signaling pathway, PI3K-Akt signaling pathway, and so on. A gene prognostic model including eight genes (GRIN3A, CCR2, CHRNA4, CSF1, NTN1, ADRB1, CHRNB4, and CHRNG) was built and verified by independent cohorts GSE59455 and GSE19234. A nomogram was constructed containing clinical characteristics and the above eight genes, and the AUCs of the 1-, 3-, and 5-year ROC were 0.850, 0.811, and 0.792, respectively. Expression of CCR2, GRIN3A, and CSF1 was associated with SKCM clinical stages. There existed broad and strong correlations of the prognostic gene set with immune infiltration and immune checkpoint genes. CHRNA4 and CHRNG were independent poor prognostic genes, and multiple metabolic pathways were enriched in high CHRNA4 expression cells.<h4>Conclusion</h4>Comprehensive bioinformatics analysis of cancer-nerve crosstalk-associated genes in SKCM was performed, and an effective prognostic model was constructed based on clinical characteristics and eight genes (GRIN3A, CCR2, CHRNA4, CSF1, NTN1, ADRB1, CHRNB4, and CHRNG), which were widely related to clinical stages and immunological features. Our work may be helpful for further investigation in the molecular mechanisms correlated with neural regulation in SKCM, and in searching new therapeutic targets.

CA10
Also flagged:gene expressionWntcell cycletumorcolorectal cancerCTNNB1
Journal Article 2023-06-19 ✓ 1 Snippet Lu Y, Gu D, Zhao C, Sun Y, Li W, He L, Wang X, Kou Z, Su J, Guo F.
In-Text Gene Mentions

…, FTHL17 ,CA10, IL4 ,…

Show Full Abstract

<h4>Background</h4>Compared to other subtypes, the CMS4 subtype is associated with lacking of effective treatments and poorer survival rates.<h4>Methods</h4>A total of 24 patients with CRC were included in this study. DNA and RNA sequencing were performed to acquire somatic mutations and gene expression, respectively. MATH was used to quantify intratumoral heterogeneity. PPI and survival analyses were performed to identify hub DEGs. Reactome and KEGG analyses were performed to analyze the pathways of mutated or DEGs. Single-sample gene set enrichment analysis and Xcell were used to categorize the infiltration of immune cells.<h4>Results</h4>The CMS4 patients had a poorer PFS than CMS2/3. <i>CTNNB1</i> and <i>CCNE1</i> were common mutated genes in the CMS4 subtype, which were enriched in Wnt and cell cycle signaling pathways, respectively. The MATH score of CMS4 subtype was lower. <i>SLC17A6</i> was a hub DEG. M2 macrophages were more infiltrated in the tumor microenvironment of CMS4 subtype. The CMS4 subtype tended to have an immunosuppressive microenvironment.<h4>Conclusion</h4>This study suggested new perspectives for exploring therapeutic strategies for the CMS4 subtype CRC.

Also flagged:insulin resistanceIRglucoseprediabeteshyperglycemiasucrose
Journal Article 2023-06-19 No Snippets Chen L, Qin G, Liu Y, Li M, Li Y, Guo LZ, Du L, Zheng W, Wu PC, Chuang YH, Wang X, Wang TD, Ho JA, Liu TM.
Show Full Abstract

<b>Rationale:</b> Prediabetes can be reversed through lifestyle intervention, but its main pathologic hallmark, insulin resistance (IR), cannot be detected as conveniently as blood glucose testing. In consequence, the diagnosis of prediabetes is often delayed until patients have hyperglycemia. Therefore, developing a less invasive diagnostic method for rapid IR evaluation will contribute to the prognosis of prediabetes. Adipose tissue is an endocrine organ that plays a crucial role in the development and progression of prediabetes. Label-free visualizing the prediabetic microenvironment of adipose tissues provides a less invasive alternative for the characterization of IR and inflammatory pathology. <b>Methods:</b> Here, we successfully identified the differentiable features of prediabetic adipose tissues by employing the metabolic imaging of three endogenous fluorophores NAD(P)H, FAD, and lipofuscin-like pigments. <b>Results:</b> We discovered that 1040-nm excited lipofuscin-like autofluorescence could mark the location of macrophages. This unique feature helps separate the metabolic fluorescence signals of macrophages from those of adipocytes. In prediabetes fat tissues with IR, we found only adipocytes exhibited a low redox ratio of metabolic fluorescence and high free NAD(P)H fraction a<sub>1</sub>. This differential signature disappears for mice who quit the high-fat diet or high-fat-high-sucrose diet and recover from IR. When mice have diabetic hyperglycemia and inflamed fat tissues, both adipocytes and macrophages possess this kind of metabolic change. As confirmed with RNA-seq analysis and histopathology evidence, the change in adipocyte's metabolic fluorescence could be an indicator or risk factor of prediabetic IR. <b>Conclusion:</b> Our study provides an innovative approach to diagnosing prediabetes, which sheds light on the strategy for diabetes prevention.

Also flagged:ageingcell proliferationpolyesterdegradationbone lesionsbone injuries
Journal Article 2023-06-19 No Snippets Gharibshahian M, Salehi M, Beheshtizadeh N, Kamalabadi-Farahani M, Atashi A, Nourbakhsh MS, Alizadeh M.
Show Full Abstract

Population ageing and various diseases have increased the demand for bone grafts in recent decades. Bone tissue engineering (BTE) using a three-dimensional (3D) scaffold helps to create a suitable microenvironment for cell proliferation and regeneration of damaged tissues or organs. The 3D printing technique is a beneficial tool in BTE scaffold fabrication with appropriate features such as spatial control of microarchitecture and scaffold composition, high efficiency, and high precision. Various biomaterials could be used in BTE applications. PCL, as a thermoplastic and linear aliphatic polyester, is one of the most widely used polymers in bone scaffold fabrication. High biocompatibility, low cost, easy processing, non-carcinogenicity, low immunogenicity, and a slow degradation rate make this semi-crystalline polymer suitable for use in load-bearing bones. Combining PCL with other biomaterials, drugs, growth factors, and cells has improved its properties and helped heal bone lesions. The integration of PCL composites with the new 3D printing method has made it a promising approach for the effective treatment of bone injuries. The purpose of this review is give a comprehensive overview of the role of printed PCL composite scaffolds in bone repair and the path ahead to enter the clinic. This study will investigate the types of 3D printing methods for making PCL composites and the optimal compounds for making PCL composites to accelerate bone healing.

HTT
Also flagged:hereditary neurodegenerative disorderchoreacognitive declinelearningdevelopmental regressionbehavioral problems
Journal Article 2023-06-19 ✓ 3 Snippets Yu SY, Gough S, Niyibizi A, Sheikh M.
In-Text Gene Mentions

…equences within the HTT gene, which encodes…

… encodes for huntingtin protein (HTT) [7]. …

… inheritance of the HTT gene is governed by…

Show Full Abstract

Juvenile Huntington's Disease (JHD) is a rare variant of the hereditary neurodegenerative disorder Huntington's disease (HD). Clinical symptoms in JHD are broad and non-specific, making the initial diagnosis difficult. In this report, we describe a young Hispanic male who gradually developed cognitive decline, dystonia, and seizures. His diagnosis was delayed despite multiple visits to his pediatrician, developmental specialist, and neurologist. A history of developmental regression and unusual imaging findings prompted genetic testing, which led to the diagnosis of JHD. Though changes in the striatum on MRI are hallmarks of JHD, family and developmental history often provide the most important diagnostic clues. Careful history-taking in patients with non-specific neurological exam findings, as in patients with JHD, can prevent diagnostic delays and allow for early interventions to improve quality of life.

SERPINC1
Also flagged:schizophreniaclozapinechronic schizophreniahaloperidolneurological illnessespsychiatric disorders
Journal Article 2023-06-19 ✓ 1 Snippet Nandakumar D, Ganesh R, Deb KS, Jain R, Sood M.
In-Text Gene Mentions

…the score ofACE-III(ρ = -0.738,…

Show Full Abstract

<h4>Objectives</h4>To assess disability and quality of life (QOL) in treatment resistant schizophrenia (TRS) on long term clozapine therapy and assess their correlation with positive, negative and cognitive symptoms.<h4>Methodology</h4>Disability and QOL in forty patients with TRS (as per modified Kane's criteria) were assessed using World Health Organization Disability Assessment Schedule 2.0 and World Health Organization Quality of Life-BREF. Scale for assessment of positive symptoms, scale for assessment of negative symptoms and Addenbrooke's cognitive examination-III were used to assess positive, negative and cognitive symptoms. Medication adherence rating scale assessed medication adherence.<h4>Results</h4>Disability and QOL correlated significantly with medication adherence, negative and cognitive symptoms but not with positive symptoms. Subgroup analysis revealed significant difference between medication adherence (good vs poor) and cognitive (impairment vs non-impairment) groups.<h4>Conclusion</h4>Negative and cognitive symptoms, and medication adherence correlated with disability and QOL.

PRDX6
Also flagged:Alzheimer's diseaseADnucleusTauprion
Journal Article 2023-06-18 ✓ 5 Snippets Gonzalez-Rodriguez M, Villar-Conde S, Astillero-Lopez V, Villanueva-Anguita P, Ubeda-Banon I, Flores-Cuadrado A, Martinez-Marcos A, Saiz-Sanchez D.
In-Text Gene Mentions

…rocytes, and peroxiredoxin‐6 (PRDX6) to Aβ and…

…A1 (ANXA1) andPRDX6for astroglial evaluation…

…Concerning ANXA1 andPRDX6, dia‐PASEF analysis revealed…

…the other hand,PRDX6was associated with…

…ANXA5, CLIC1, andPRDX6may have a…

Show Full Abstract

Alzheimer's disease (AD) is characterized by the accumulation of pathological amyloid-β (Aβ) and Tau proteins. According to the prion-like hypothesis, both proteins can seed and disseminate through brain regions through neural connections and glial cells. The amygdaloid complex (AC) is involved early in the disease, and its widespread connections with other brain regions indicate that it is a hub for propagating pathology. To characterize changes in the AC as well as the involvement of neuronal and glial cells in AD, a combined stereological and proteomic analysis was performed in non-Alzheimer's disease and AD human samples. The synaptic alterations identified by proteomic data analysis could be related to the volume reduction observed in AD by the Cavalieri probe without neuronal loss. The pathological markers appeared in a gradient pattern with the medial region (cortical nucleus, Co) being more affected than lateral regions, suggesting the relevance of connections in the distribution of the pathology among different brain regions. Generalized astrogliosis was observed in every AC nucleus, likely related to deposits of pathological proteins. Astrocytes might mediate phagocytic microglial activation, whereas microglia might play a dual role since protective and toxic phenotypes have been described. These results highlight the potential participation of the amygdala in the disease spreading from/to olfactory areas, the temporal lobe and beyond. Proteomic data are available via ProteomeXchange with identifier PXD038322.

ABT1
Also flagged:Autophagyorganellesdegradationautophagy-relatedhydrolasesvacuole
Journal Article 2023-06-18 ✓ 1 Snippet Ding JL, Wei K, Feng MG, Ying SH.
In-Text Gene Mentions

…Nbr1 ( neighbor of BR CA1 gene 1of BR CA1…

Show Full Abstract

<h4>Introduction</h4>In yeast, the cytoplasm-to-vacuole targeting (Cvt) pathway acts as a biosynthetic autophagy-related process, in which vacuolar targeting of hydrolase is mediated by the machineries involved in the selective autophagy. However, the mechanistic insights into vacuolar targeting of hydrolases through the selective autophagy pathway still remain enigmatic in filamentous fungi.<h4>Objectives</h4>Our study aims to investigate the mechanisms involved in vacuolar targeting of hydrolases in filamentous fungi.<h4>Methods</h4>The filamentous entomopathogenic fungus Beauveria bassiana was used as a representative of filamentous fungi. We identified the homologs of yeast aminopeptidase I (Ape1) in B. bassiana by bioinformatic analyses and characterized their physiological roles by gene function analyses. Pathways for vacuolar targeting of hydrolases were investigated via molecular trafficking analyses.<h4>Results</h4>B. bassiana has two homologs of yeast aminopeptidase I (Ape1) which are designated as BbApe1A and BbApe1B. The two homologs of yeast Ape1 contribute to starvation tolerance, development, and virulence in B. bassiana. Significantly, BbNbr1 acts as a selective autophagy receptor to mediate the vacuolar targeting of the two Ape1 proteins, in which BbApe1B interacts with BbNbr1 also directly interacting with BbAtg8, and BbApe1A has an additional requirement of the scaffold protein BbAtg11 that interacts with BbNbr1 and BbAtg8. Protein processing occurs at both terminuses of BbApe1A and only at carboxyl terminus of BbApe1B, which is also dependent on the autophagy-related proteins. Together, the functions and translocation processes of the two Ape1 proteins are associated with autophagy in fungal lifecycle.<h4>Conclusion</h4>This study reveals the functions and translocation processes for vacuolar hydrolases in the insect-pathogenic fungi and improves our understandings of the Nbr1-mediated vacuolar targeting pathway in the filamentous fungi.

HFE
Also flagged:ceritinibdasatinibniraparibponatinibcabazitaxelgemtuzumab-ozogamicin
Journal Article 2023-06-18 ✓ 1 Snippet Papachristos A, Patel J, Vasileiou M, Patrinos GP.
In-Text Gene Mentions

As another example, UGT1A1*28, UGT1A1*60, and cytochrome P450 1A2 (CYP1A2) rs762551 were associated with a pazopanib-related increase in bilirubin, while SNPs in hereditary hemochromatosis gene (HFE) were associated with increased levels of ALT.

Show Full Abstract

Drugs' safety and effectiveness are evaluated in randomized, dose-ranging trials in most therapeutic areas. However, this is only sometimes feasible in oncology, and dose-ranging studies are mainly limited to Phase 1 clinical trials. Moreover, although new treatment modalities (e.g., small molecule targeted therapies, biologics, and antibody-drug conjugates) present different characteristics compared to cytotoxic agents (e.g., target saturation limits, wider therapeutic index, fewer off-target side effects), in most cases, the design of Phase 1 studies and the dose selection is still based on the Maximum Tolerated Dose (MTD) approach used for the development of cytotoxic agents. Therefore, the dose was not optimized in some cases and was modified post-marketing (e.g., ceritinib, dasatinib, niraparib, ponatinib, cabazitaxel, and gemtuzumab-ozogamicin). The FDA recognized the drawbacks of this approach and, in 2021, launched Project Optimus, which provides the framework and guidance for dose optimization during the clinical development stages of anticancer agents. Since dose optimization is crucial in clinical development, especially of targeted therapies, it is necessary to identify the role of pharmacological tools such as pharmacogenomics, therapeutic drug monitoring, and pharmacodynamics, which could be integrated into all phases of drug development and support dose optimization, as well as the chances of positive clinical outcomes.

HFE
Also flagged:Non-Alcoholic Fatty Liver DiseaseFibrosissteatosisLiver Fibrosismorbid obesityFatty Liver Disease
Journal Article 2023-06-18 ✓ 1 Snippet Głuszyńska P, Łukaszewicz A, Diemieszczyk I, Chilmończyk J, Reszeć J, Citko A, Szczerbiński Ł, Krętowski A, Razak Hady H.
In-Text Gene Mentions

…patitis, autoimmune hepatitis,hemochromatosis, alcoholic liver cirrhosis…

Show Full Abstract

<h4>Background</h4>Morbid obesity co-exists with non-alcoholic fatty liver disease in up to 90% of cases. Laparoscopic sleeve gastrectomy leads to a reduction in body mass and thus may improve the course of non-alcoholic fatty liver disease. The aim of this study was to evaluate the effect of laparoscopic sleeve gastrectomy on the resolution of non-alcoholic fatty liver disease.<h4>Methods</h4>The study included 55 patients with non-alcoholic fatty liver disease who underwent laparoscopic sleeve gastrectomy at a tertiary institution. The analysis consisted of preoperative liver biopsy, abdominal ultrasound, weight loss parameters, Non-Alcoholic Fatty Liver Fibrosis Score and selected laboratory parameters.<h4>Results</h4>Before the surgery, 6 patients were diagnosed with grade 1 liver steatosis, 33 patients with grade 2 and 16 patients with grade 3. One year after the surgery, only 21 patients had features of liver steatosis at ultrasound. All weight loss parameters showed statistically significant changes during the observation; the median percentage of total weight loss was 31.0% (IQR: 27.5; 34.5) with <i>p</i> = 0.0003, the median percentage of excess weight loss was 61.8% (IQR: 52.4; 72.3) with <i>p</i> = 0.0013 and the median percentage of excess body mass index loss was 71.0% (IQR: 61.3; 86.9) with <i>p</i> = 0.0036 12 months after laparoscopic sleeve gastrectomy. The median Non-Alcoholic Fatty Liver Fibrosis Score at baseline was 0.2 (IQR: -0.8; 1.0) and decreased to -1.6 (IQR: -2.4; -0.4) (<i>p</i> < 0.0001). Moderate negative correlations between Non-Alcoholic Fatty Liver Fibrosis Score and percentage of total weight loss (r = -0.434, <i>p</i> < 0.0001), percentage of excess weight loss (r = -0.456, <i>p</i> < 0.0001) and percentage of excess body mass index loss (r = -0.512, <i>p</i> < 0.0001) were found.<h4>Conclusions</h4>The study supports the thesis that laparoscopic sleeve gastrectomy is an effective method for treatment of non-alcoholic fatty liver disease in patients with morbid obesity.

Also flagged:deathimmune responsespathogenesislipomannanPEsecretion
Journal Article 2023-06-18 No Snippets Ramon-Luing LA, Palacios Y, Ruiz A, Téllez-Navarrete NA, Chavez-Galan L.
Show Full Abstract

<i>Mycobacterium tuberculosis</i> (Mtb) modulates diverse cell death pathways to escape the host immune responses and favor its dissemination, a complex process of interest in pathogenesis-related studies. The main virulence factors of Mtb that alter cell death pathways are classified according to their origin as either non-protein (for instance, lipomannan) or protein (such as the PE family and ESX secretion system). The 38 kDa lipoprotein, ESAT-6 (early antigen-secreted protein 6 kDa), and another secreted protein, tuberculosis necrotizing toxin (TNT), induces necroptosis, thereby allowing mycobacteria to survive inside the cell. The inhibition of pyroptosis by blocking inflammasome activation by Zmp1 and PknF is another pathway that aids the intracellular replication of Mtb. Autophagy inhibition is another mechanism that allows Mtb to escape the immune response. The enhanced intracellular survival (Eis) protein, other proteins, such as ESX-1, SecA2, SapM, PE6, and certain microRNAs, also facilitate Mtb host immune escape process. In summary, Mtb affects the microenvironment of cell death to avoid an effective immune response and facilitate its spread. A thorough study of these pathways would help identify therapeutic targets to prevent the survival of mycobacteria in the host.

HTT
Also flagged:parasitic diseasesCRISPR-CasCas9nucleaseszincDNA-binding protein
Journal Article 2023-06-18 ✓ 1 Snippet Ebrahimi S, Khosravi MA, Raz A, Karimipoor M, Parvizi P.
In-Text Gene Mentions

…mutation in theHTTgene.…

Show Full Abstract

Programmable nucleases are powerful genomic tools for precise genome editing. These tools precisely recognize, remove, or change DNA at a defined site, thereby, stimulating cellular DNA repair pathways that can cause mutations or accurate replacement or deletion/insertion of a sequence. CRISPR-Cas9 system is the most potent and useful genome editing technique adapted from the defense immune system of certain bacteria and archaea against viruses and phages. In the past decade, this technology made notable progress, and at present, it has largely been used in genome manipulation to make precise gene editing in plants, animals, and human cells. In this review, we aim to explain the basic principle, mechanisms of action, and applications of this system in different areas of medicine, with emphasizing on the detection and treatment of parasitic diseases.

Also flagged:community-acquired infectionsextracellularCaspofunginechinocandininfectionssynthesis
Journal Article 2023-06-17 No Snippets Pinto RM, Yazdani S, Seabra CL, De Jonge M, Izci M, Cruz R, Casal S, Soenen SJ, Reis S, Nunes C, Van Dijck P.
Show Full Abstract

Staphylococcus aureus is considered a high priority pathogen by the World Health Organization due to its high prevalence and the potential to form biofilms. Currently, the available treatments for S. aureus biofilm-associated infections do not target the extracellular polymeric substances (EPS) matrix. This matrix is a physical barrier to bactericidal agents, contributing to the increase of antimicrobial tolerance. The present work proposes the development of lipid nanoparticles encapsulating caspofungin (CAS) as a matrix-disruptive nanosystem. The nanoparticles were functionalized with D-amino acids to target the matrix. In a multi-target nano-strategy against S. aureus biofilms, CAS-loaded nanoparticles were combined with a moxifloxacin-loaded nanosystem, as an adjuvant to promote the EPS matrix disruption. In vitro and in vivo studies showed biofilm reduction after combining the two nanosystems. Besides, the combinatory therapy showed no signs of bacterial dissemination into vital organs of mice, while dissemination was observed for the treatment with the free compounds. Additionally, the in vivo biodistribution of the two nanosystems revealed their potential to reach and accumulate in the biofilm region, after intraperitoneal administration. Thus, this nano-strategy based on the encapsulation of matrix-disruptive and antibacterial agents is a promising approach to fight S. aureus biofilms.

PRDX6
Also flagged:chronic obstructive pulmonary diseaseCOPDperoxiredoxin6deathinflammatory responsecancer
Journal Article 2023-06-17 ✓ 5 Snippets Xiong M, Guo M, Huang D, Li J, Zhou Y.
In-Text Gene Mentions

Recently, they have identified 4 susceptibility loci that are associated with COPD, including 4q22 (FAM13A), 4q31 (HHIP), 15q25 (CHRNA3/CHRNA5/IREB2), and 19q13 (RAB4B, PRDX6, MIA, CYP2A6).8, 9, 10

…Effect ofPRDX6gene polymorphism on…

…in locus inPRDX6between patients with…

…rs33951697 locus inPRDX6gene carrier with…

…different genotypes ofPRDX6, rs4382766, and rs7314…

Show Full Abstract

<h4>Background</h4>To explore the relationship of peroxiredoxin6 (PRDX6) tag-single nucleotide polymorphisms (SNPs) with susceptibility to chronic obstructive pulmonary disease (COPD) in the Chinese Han population.<h4>Methods</h4>A total of 502 patients with COPD and 481 healthy controls from nine hospitals in China were enrolled in this study. The PRDX6 tag-SNPs were identified by linkage disequilibrium (LD) analysis in 30 healthy controls. The associations between identified tag-SNPs and COPD risk were further evaluated.<h4>Results</h4>Four PRDX6 tag-SNPs, including rs7314, rs34619706, rs33951697, and rs4382766, were identified in 30 healthy controls. Moreover, in the allele model, there was no statistical difference in locus in PRDX6 between patients with COPD and healthy controls (P > 0.05). However, in the recessive model, rs33951697 locus in PRDX6 gene carrier with T/T had an increased risk of COPD (odds ratio [OR] = 2.59, 95% CI = 1.06-6.33, P = 0.028). Furthermore, in the relevance analysis between genetic polymorphisms and smoking behavior and lung function indexes, we found that the number of smoked cigarettes per day and FEV1/FVC differed among different genotypes of PRDX6, rs4382766, and rs7314 (P < 0.05).<h4>Conclusion</h4>PRDX6 gene polymorphism with smoking status may contribute to the etiology of COPD in the Chinese Han population.

HTT
Also flagged:cholesterolHuntington's diseaseHDbiosynthesisbehavioralHuntingtin
Journal Article 2023-06-17 ✓ 5 Snippets Birolini G, Valenza M, Ottonelli I, Talpo F, Minoli L, Cappelleri A, Bombaci M, Caccia C, Canevari C, Trucco A, Leoni V, Passoni A, Favagrossa M, Nucera MR, Colombo L, Paltrinieri S, Bagnati R, Duskey JT, Caraffi R, Vandelli MA, Taroni F, Salmona M, Scanziani E, Biella G, Ruozi B, Tosi G, Cattaneo E.
In-Text Gene Mentions

To date, we worked to deliver/increase cholesterol level in the HD brain of the rapidly progressing R6/2 mouse model via four strategies, i.e. by ip injection of first-generation cholesterol-laden nanoparticles [16], [20] or via osmotic mini-pumps for its direct administration into the striatum [17] or - in a collaborative effort - by nose-to-brain delivery of liposomes [23] and also via gene therapy by overexpressing the active form of SREBP2 in R6/2 striatal astrocytes in vivo [18], to restore the transcription of genes in the cholesterol biosynthetic pathway in these cells as they produce most of the cholesterol present in the adult brain and show limited biosynthetic capacity in the presence of mutant HTT [30].

Among them is Huntington’s disease (HD), an autosomal dominant neurodegenerative disease whose symptoms typically occur in midlife and caused by the expansion of a polyglutamine-encoding cytosine adenine guanine (CAG) tract in exon 1 of the huntingtin (HTT) gene [2].

Mechanistically, exogenous cholesterol normalized the synaptic activity of MSNs by increasing the number of glutamatergic synapses and the number of docked GABAergic synaptic vesicles and counteracted the aggregation of mutant HTT (muHTT) by modulating lysosome-dependent pathways [17].

…of the huntingtin (HTT) gene [2] .…

…aggregation of mutantHTT(muHTT) by modulating…

Show Full Abstract

Evidence that Huntington's disease (HD) is characterized by impaired cholesterol biosynthesis in the brain has led to strategies to increase its level in the brain of the rapidly progressing R6/2 mouse model, with a positive therapeutic outcome. Here we tested the long-term efficacy of chronic administration of cholesterol to the brain of the slowly progressing zQ175DN knock-in HD mice in preventing ("early treatment") or reversing ("late treatment") HD symptoms. To do this we used the most advanced formulation of cholesterol loaded brain-permeable nanoparticles (NPs), termed hybrid-g7-NPs-chol, which were injected intraperitoneally. We show that one cycle of treatment with hybrid-g7-NPs-chol, administered in the presymptomatic ("early treatment") or symptomatic ("late treatment") stages is sufficient to normalize cognitive defects up to 5 months, as well as to improve other behavioral and neuropathological parameters. A multiple cycle treatment combining both early and late treatments ("2 cycle treatment") lasting 6 months generates therapeutic effects for more than 11 months, without severe adverse reactions. Sustained cholesterol delivery to the brain of zQ175DN mice also reduces mutant Huntingtin aggregates in both the striatum and cortex and completely normalizes synaptic communication in the striatal medium spiny neurons compared to saline-treated HD mice. Furthermore, through a meta-analysis of published and current data, we demonstrated the power of hybrid-g7-NPs-chol and other strategies able to increase brain cholesterol biosynthesis, to reverse cognitive decline and counteract the formation of mutant Huntingtin aggregates. These results demonstrate that cholesterol delivery via brain-permeable NPs is a therapeutic option to sustainably reverse HD-related behavioral decline and neuropathological signs over time, highlighting the therapeutic potential of cholesterol-based strategies in HD patients. DATA AVAILABILITY: This study does not include data deposited in public repositories. Data are available on request to the corresponding authors.

Also flagged:NanoHydroxyapatiteStrontiumNanohydroxyapatitemineralcalcium
Journal Article 2023-06-17 No Snippets Kontogianni GI, Coelho C, Gauthier R, Fiorilli S, Quadros P, Vitale-Brovarone C, Chatzinikolaidou M.
Show Full Abstract

Nanohydroxyapatite (nanoHA) is the major mineral component of bone. It is highly biocompatible, osteoconductive, and forms strong bonds with native bone, making it an excellent material for bone regeneration. However, enhanced mechanical properties and biological activity for nanoHA can be achieved through enrichment with strontium ions. Here, nanoHA and nanoHA with a substitution degree of 50 and 100% of calcium with strontium ions (Sr-nanoHA_50 and Sr-nanoHA_100, respectively) were produced via wet chemical precipitation using calcium, strontium, and phosphorous salts as starting materials. The materials were evaluated for their cytotoxicity and osteogenic potential in direct contact with MC3T3-E1 pre-osteoblastic cells. All three nanoHA-based materials were cytocompatible, featured needle-shaped nanocrystals, and had enhanced osteogenic activity in vitro. The Sr-nanoHA_100 indicated a significant increase in the alkaline phosphatase activity at day 14 compared to the control. All three compositions revealed significantly higher calcium and collagen production up to 21 days in culture compared to the control. Gene expression analysis exhibited, for all three nanoHA compositions, a significant upregulation of osteonectin and osteocalcin on day 14 and of osteopontin on day 7 compared to the control. The highest osteocalcin levels were found for both Sr-substituted compounds on day 14. These results demonstrate the great osteoinductive potential of the produced compounds, which can be exploited to treat bone disease.

DCC
Also flagged:metastatic melanomacancermelanomaBRAFMEKcutaneous melanoma
Journal Article 2023-06-17 ✓ 1 Snippet Fernandez MF, Choi J, Sosman J.
In-Text Gene Mentions

DCC-3116, a first-in-class, selective ULK1/2 inhibitor, is being combined with trametinib or binimetinib in a phase 1/2, multicenter, open-label, first-in-human study for patients with advanced or metastatic solid tumors with mutated RAS/MAPK pathways, including melanoma (NCT04892017).

Show Full Abstract

It was just slightly more than a decade ago when metastatic melanoma carried a dismal prognosis with few, if any, effective therapies. Since then, the evolution of cancer immunotherapy has led to new and effective treatment approaches for melanoma. However, despite these advances, a sizable portion of patients with advanced melanoma have de novo or acquired resistance to immune checkpoint inhibitors. At the same time, therapies (BRAF plus MEK inhibitors) targeting the <i>BRAF<sup>V600</sup></i> mutations found in 40-50% of cutaneous melanomas have also been critical for optimizing management and improving patient outcomes. Even though immunotherapy has been established as the initial therapy in most patients with cutaneous melanoma, subsequent effective therapy is limited to <i>BRAF<sup>V600</sup></i> melanoma. For all other melanoma patients, driver mutations have not been effectively targeted. Numerous efforts are underway to target melanomas with NRAS mutations, NF-1 LOF mutations, and other genetic alterations leading to activation of the MAP kinase pathway. In this era of personalized medicine, we will review the current genetic landscape, molecular classifications, emerging drug targets, and the potential for combination therapies for non-<i>BRAF<sup>V600</sup></i> melanoma.

Also flagged:MineralsOsteoporosisBMP-2Wntbone resorptionbone formation
Journal Article 2023-06-17 No Snippets Skalny AV, Aschner M, Silina EV, Stupin VA, Zaitsev ON, Sotnikova TI, Tazina SI, Zhang F, Guo X, Tinkov AA.
Show Full Abstract

The objective of the present study was to review recent epidemiological and clinical data on the association between selected minerals and trace elements and osteoporosis, as well as to discuss the molecular mechanisms underlying these associations. We have performed a search in the PubMed-Medline and Google Scholar databases using the MeSH terms "osteoporosis", "osteogenesis", "osteoblast", "osteoclast", and "osteocyte" in association with the names of particular trace elements and minerals through 21 March 2023. The data demonstrate that physiological and nutritional levels of trace elements and minerals promote osteogenic differentiation through the up-regulation of BMP-2 and Wnt/β-catenin signaling, as well as other pathways. miRNA and epigenetic effects were also involved in the regulation of the osteogenic effects of trace minerals. The antiresorptive effect of trace elements and minerals was associated with the inhibition of osteoclastogenesis. At the same time, the effect of trace elements and minerals on bone health appeared to be dose-dependent with low doses promoting an osteogenic effect, whereas high doses exerted opposite effects which promoted bone resorption and impaired bone formation. Concomitant with the results of the laboratory studies, several clinical trials and epidemiological studies demonstrated that supplementation with Zn, Mg, F, and Sr may improve bone quality, thus inducing antiosteoporotic effects.

Also flagged:Obesityheart diseasestroketype 2 diabetescancerdeath
Journal Article 2023-06-17 No Snippets Novelli G, Cassadonte C, Sbraccia P, Biancolella M.
Show Full Abstract

Obesity is a common, serious, and costly disease. More than 1 billion people worldwide are obese-650 million adults, 340 million adolescents, and 39 million children. The WHO estimates that, by 2025, approximately 167 million people-adults and children-will become less healthy because they are overweight or obese. Obesity-related conditions include heart disease, stroke, type 2 diabetes, and certain types of cancer. These are among the leading causes of preventable, premature death. The estimated annual medical cost of obesity in the United States was nearly $173 billion in 2019 dollars. Obesity is considered the result of a complex interaction between genes and the environment. Both genes and the environment change in different populations. In fact, the prevalence changes as the result of eating habits, lifestyle, and expression of genes coding for factors involved in the regulation of body weight, food intake, and satiety. Expression of these genes involves different epigenetic processes, such as DNA methylation, histone modification, or non-coding micro-RNA synthesis, as well as variations in the gene sequence, which results in functional alterations. Evolutionary and non-evolutionary (i.e., genetic drift, migration, and founder's effect) factors have shaped the genetic predisposition or protection from obesity in modern human populations. Understanding and knowing the pathogenesis of obesity will lead to prevention and treatment strategies not only for obesity, but also for other related diseases.

BTN3A3
Also flagged:Avian InfluenzaCOVID-19HACoronavirus diseasezoonotic diseasebehavioural
Journal Article 2023-06-17 ✓ 2 Snippets Meseko C, Milani A, Inuwa B, Chinyere C, Shittu I, Ahmed J, Giussani E, Palumbo E, Zecchin B, Bonfante F, Maniero S, Angot A, Niang M, Fusaro A, Gobbo F, Terregino C, Olasoju T, Monne I, Muhammad M.
In-Text Gene Mentions

…resistance to thebutyrophilin subfamily 3 member A3subfamily 3 member…

…3 member A3 (BTN3A3), a potent avian…

Show Full Abstract

In 2021, amidst the COVID-19 pandemic and global food insecurity, the Nigerian poultry sector was exposed to the highly pathogenic avian influenza (HPAI) virus and its economic challenges. Between 2021 and 2022, HPAI caused 467 outbreaks reported in 31 of the 37 administrative regions in Nigeria. In this study, we characterized the genomes of 97 influenza A viruses of the subtypes H5N1, H5N2, and H5N8, which were identified in different agro-ecological zones and farms during the 2021-2022 epidemic. The phylogenetic analysis of the HA genes showed a widespread distribution of the H5Nx clade 2.3.4.4b and similarity with the HPAI H5Nx viruses that have been detected in Europe since late 2020. The topology of the phylogenetic trees indicated the occurrence of several independent introductions of the virus into the country, followed by a regional evolution of the virus that was most probably linked to its persistent circulation in West African territories. Additional evidence of the evolutionary potential of the HPAI viruses circulating in this region is the identification in this study of a putative H5N1/H9N2 reassortant virus in a mixed-species commercial poultry farm. Our data confirm Nigeria as a crucial hotspot for HPAI virus introduction from the Eurasian territories and reveal a dynamic pattern of avian influenza virus evolution within the Nigerian poultry population.

HTT
Also flagged:Sudden infant death syndromeSIDSdeathsleepsleepingalcohol
Journal Article 2023-06-17 ✓ 1 Snippet Vincent A, Chu NT, Shah A, Avanthika C, Jhaveri S, Singh K, Limaye OM, Boddu H.
In-Text Gene Mentions

SIDS: Sudden infant death syndrome; 5-HTT: 5-hydroxytryptamine (serotonin) transporter; ANS: Autonomic nervous system.

Show Full Abstract

Sudden infant death syndrome (SIDS) continues to be one of the top causes of infant death in the U.S. Despite significant public health initiatives focused on high-risk populations to enhance sleep environments and techniques. The SIDS rate has remained stable in recent years. Risk factors and newer risk reduction strategies for SIDS are the focus of this review article. We conducted a comprehensive literature search on Medline, Cochrane, Embase, and Google Scholar until July 2022. The following search strings and Medical Subject Heading (MeSH) terms were used: "SIDS," "Sudden Infant Death" and "SUID". We explored the literature on SIDS for its epidemiology, pathophysiology, the role of various etiologies and their influence, associated complications leading to SIDS, and preventive and treatment modalities. Despite a more than 50% drop-in rates since the start of the "Back to Sleep" campaign in 1994, sudden infant death syndrome (SIDS) continues to be the top cause of post-neonatal mortality in the United States, despite continued educational initiatives that support safe sleep and other risk reduction strategies. The new American Academy of Pediatrics guidelines for lowering the risk of SIDS include a lot of emphasis on sleeping habits, bedding, and environment but also include elements that are frequently ignored (i.e., prenatal care, smoking, alcohol and drug use, and childhood vaccinations). This study highlights these less-frequently discussed aspects and identifies treatments that have produced beneficial behavioral shifts that benefit newborns as well as their mothers' health and wellbeing.

Also flagged:ferroptosisdeathironlipidcysteinemetabolism
Journal Article 2023-06-16 No Snippets Wang L, Wang H.
Show Full Abstract

Ferroptosis is a unique cell death modality triggered by iron-dependent lipid peroxidation, with cysteine metabolism and glutathione-dependent antioxidant defence responses as the primary triggering mechanisms. Ferroptosis is an independent tumour suppression mechanism and has been implicated in various disorders. In tumourigenesis, ferroptosis plays a dual role in promoting and inhibiting tumours. P53, NFE2L2, BAP1, HIF, and other tumour suppressor genes regulate ferroptosis, releasing damage-associated molecular patterns or lipid metabolites to influence cellular immune responses. Ferroptosis is also involved in tumour suppression and metabolism. The combination of amino acid, lipid, and iron metabolism is involved in the initiation and execution of ferroptosis, and metabolic regulatory mechanisms also play roles in malignancies. Most investigations into ferroptosis in gastric cancer are concentrated on predictive models, not the underlying processes. This review investigates the underlying mechanisms of ferroptosis, tumour suppressor genes, and the tumour microenvironment.

Also flagged:migrainefamilial hemiplegic migraineHeadachecalcium voltage-gated channel subunit alpha1 ACACNA1AATPase
Journal Article 2023-06-16 No Snippets Mangano GD, Capizzi MR, Mantuano E, Veneziano L, Santangelo G, Quatrosi G, Nardello R, Raieli V.
Show Full Abstract

<h4>Objective</h4>The aim of this study was to describe a cohort of pediatric patients with genetically confirmed familial hemiplegic migraine (FHM). The knowledge of genotype-phenotype correlations may suggest prognostic factors associated with severe phenotypes.<h4>Background</h4>Hemiplegic migraine is a rare disease and data concerning the pediatric population are even more rare as they are often extrapolated from mixed cohorts.<h4>Methods</h4>We selected patients who met International Classification of Headache Disorders, third edition criteria for FHM, who had a molecular diagnosis, and whose first attack occurred under the age of 18 years.<h4>Results</h4>We enrolled nine patients (seven males and two females) first referred to our three centers. Three of the nine (33%) patients had calcium voltage-gated channel subunit alpha1 A (CACNA1A) mutations, five (55%) had ATPase Na+/K+ transporting subunit alpha 2 (ATP1A2) mutations, and one had both genetic mutations. The patients experienced at least one aura feature other than hemiplegia during the first attack. The mean (SD) duration of HM attacks in the sample was 11.3 (17.1) h; 3.8 (6.1) h in the ATP1A2 group, and 24.3 (23.5) h in the CACNA1A group. The mean (SD, range) duration of follow-up was 7.4 (2.2, 3-10) years. During the first year from the disorder's onset, only four patients had additional attacks. Over the course of follow-up, the attack frequency overall was 0.4 attacks/year without a difference between the two groups (CACNA1A and ATP1A2).<h4>Conclusion</h4>The study data show that most of our patients with early-onset FHM experienced infrequent and non-severe attacks, which improved over time. Furthermore, the clinical course revealed neither the appearance of novel neurological disorders or a deterioration of basic neurological or cognitive functioning.

LRRC7CACNA1E
Also flagged:adhesion brain proteinssynaptosomebrain developmentsodium nitroprussidetrifluoroacetic acid-chloroacetic acid
Journal Article 2023-06-16 ✓ 3 Snippets Winnik WM, Padgett W, Pitzer EM, Herr DW.
In-Text Gene Mentions

CACNA1E

Leucine-rich repeat-containing protein 7

LRRC7

Show Full Abstract

Label-free quantitation (LFQ) was applied to proteome profiling of rat brain cortical development during the early postnatal period. Male and female rat brain extracts were prepared using a convenient, detergent-free sample preparation technique at postnatal days (PND) 2, 8, 15, and 22. The PND protein ratios were calculated using Proteome Discoverer, and the PND protein change profiles were constructed separately for male and female animals for key presynaptic, postsynaptic, and adhesion brain proteins. The profiles were compared to the analogous profiles assembled from the published mouse and rat cortex proteomic data, including the fractionated-synaptosome data. The PND protein-change trendlines, Pearson correlation coefficient (PCC), and linear regression analysis of the statistically significant PND protein changes were used in the comparative analysis of the datasets. The analysis identified similarities and differences between the datasets. Importantly, there were significant similarities in the comparison of the rat cortex PND (current work) vs mouse (previously published) PND profiles, although in general, a lower abundance of synaptic proteins in mice than in rats was found. The male and female rat cortex PND profiles were expectedly almost identical (98-99% correlation by PCC), which also substantiated this LFQ nanoflow liquid chromatography-high-resolution mass spectrometry approach.

POU3F2
Also flagged:Neuronal Histone MethyltransferaseEZH2histone methyltransferase enhancer of zeste 2polycomb repressive complex 2histoneneural stem cell proliferation
Journal Article 2023-06-16 ✓ 1 Snippet Zhang M, Zhang Y, Xu Q, Crawford J, Qian C, Wang GH, Qian J, Dong XZ, Pletnikov MV, Liu CM, Zhou FQ.
In-Text Gene Mentions

…factors, such asPou3f2and Neurogenin 1…

Show Full Abstract

The histone methyltransferase enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2)-mediated trimethylation of histone H3 lysine 27 (H3K27me3) regulates neural stem cell proliferation and fate specificity through silencing different gene sets in the central nervous system. Here, we explored the function of EZH2 in early post-mitotic neurons by generating a neuron-specific Ezh2 conditional knockout mouse line. The results showed that a lack of neuronal EZH2 led to delayed neuronal migration, more complex dendritic arborization, and increased dendritic spine density. Transcriptome analysis revealed that neuronal EZH2-regulated genes are related to neuronal morphogenesis. In particular, the gene encoding p21-activated kinase 3 (Pak3) was identified as a target gene suppressed by EZH2 and H3K27me3, and expression of the dominant negative Pak3 reversed Ezh2 knockout-induced higher dendritic spine density. Finally, the lack of neuronal EZH2 resulted in impaired memory behaviors in adult mice. Our results demonstrated that neuronal EZH2 acts to control multiple steps of neuronal morphogenesis during development, and has long-lasting effects on cognitive function in adult mice.

HTT
Also flagged:RESTneuron-restrictive silencer factorNRSFtranscriptional repressorembryogenesisneurotransmitter synthetases
Journal Article 2023-06-16 ✓ 5 Snippets Nassar A, Satarker S, Gurram PC, Upadhya D, Fayaz SM, Nampoothiri M.
In-Text Gene Mentions

…in the huntingtin (HTT) protein’s N-terminus […

…TheHTTprotein’s structural character…

…MutantHTT(mHTT) has a…

…REST’s binding toHTT, which was assisting…

HTTgene mutations cause…

Show Full Abstract

Neurodegenerative disorders (NDD) have grabbed significant scientific consideration due to their fast increase in prevalence worldwide. The specific pathophysiology of the disease and the amazing changes in the brain that take place as it advances are still the top issues of contemporary research. Transcription factors play a decisive role in integrating various signal transduction pathways to ensure homeostasis. Disruptions in the regulation of transcription can result in various pathologies, including NDD. Numerous microRNAs and epigenetic transcription factors have emerged as candidates for determining the precise etiology of NDD. Consequently, understanding by what means transcription factors are regulated and how the deregulation of transcription factors contributes to neurological dysfunction is important to the therapeutic targeting of pathways that they modulate. RE1-silencing transcription factor (REST) also named neuron-restrictive silencer factor (NRSF) has been studied in the pathophysiology of NDD. REST was realized to be a part of a neuroprotective element with the ability to be tuned and influenced by numerous microRNAs, such as microRNAs 124, 132, and 9 implicated in NDD. This article looks at the role of REST and the influence of various microRNAs in controlling REST function in the progression of Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD) disease. Furthermore, to therapeutically exploit the possibility of targeting various microRNAs, we bring forth an overview of drug-delivery systems to modulate the microRNAs regulating REST in NDD.

Also flagged:cardiac diseaselocalizationleft ventricular dysfunctionmitochondrialmetabolismphosphorylation
Journal Article 2023-06-16 No Snippets Damen FW, Gramling DP, Ahlf Wheatcraft D, Wilpan RY, Costa MW, Goergen CJ.
Show Full Abstract

The comprehensive characterization of cardiac structure and function is critical to better understanding various murine models of cardiac disease. We demonstrate here a multimodal analysis approach using high-frequency four-dimensional ultrasound (4DUS) imaging and proteomics to explore the relationship between regional function and tissue composition in a murine model of metabolic cardiomyopathy (<i>Nkx2-5<sup>183P/</sup></i><sup>+</sup>). The presented 4DUS analysis outlines a novel approach to mapping both circumferential and longitudinal strain profiles through a standardized framework. We then demonstrate how this approach allows for spatiotemporal comparisons of cardiac function and improved localization of regional left ventricular dysfunction. Guided by observed trends in regional dysfunction, our targeted Ingenuity Pathway Analysis (IPA) results highlight metabolic dysregulation in the <i>Nkx2-5<sup>183P/+</sup></i> model, including altered mitochondrial function and energy metabolism (i.e., oxidative phosphorylation and fatty acid/lipid handling). Finally, we present a combined 4DUS-proteomics <i>z</i>-score-based analysis that highlights IPA canonical pathways showing strong linear relationships with 4DUS biomarkers of regional cardiac dysfunction. The presented multimodal analysis methods aim to help future studies more comprehensively assess regional structure-function relationships in other preclinical models of cardiomyopathy.<b>NEW & NOTEWORTHY</b> A multimodal approach using both four-dimensional ultrasound (4DUS) and regional proteomics can help enhance our investigations of murine cardiomyopathy models. We present unique 4DUS-derived strain maps that provide a framework for both cross-sectional and longitudinal analysis of spatiotemporal cardiac function. We further detail and demonstrate an innovative 4DUS-proteomics <i>z</i>-score-based linear regression method, aimed at characterizing relationships between regional cardiac dysfunction and underlying mechanisms of disease.

PEBP1
Also flagged:SynthesisPhospholipidsDeathFerroptosiscancerpropidium iodide
Journal Article 2023-06-16 ✓ 5 Snippets Dar HH, Mikulska-Ruminska K, Tyurina YY, Luci DK, Yasgar A, Samovich SN, Kapralov AA, Souryavong AB, Tyurin VA, Amoscato AA, Epperly MW, Shurin GV, Standley M, Holman TR, St Croix CM, Watkins SC, VanDemark AP, Rana S, Zakharov AV, Simeonov A, Marugan J, Mallampalli RK, Wenzel SE, Greenberger JS, Rai G, Bayir H, Bahar I, Kagan VE.
In-Text Gene Mentions

…(0.4 µM) or 15LOX-2/PEBP1complex (1:1 ratio)…

…or 15-LOX2 andPEBP1protein purification) in…

…Global dynamics of 15LOX-2/PEBP1/ETE-PE complex in the…

…and Synthesis of 15LOX-2/PEBP1Inhibitors.…

…electively target the 15LOX-2/PEBP1complex, we used…

Show Full Abstract

Programmed ferroptotic death eliminates cells in all major organs and tissues with imbalanced redox metabolism due to overwhelming iron-catalyzed lipid peroxidation under insufficient control by thiols (Glutathione (GSH)). Ferroptosis has been associated with the pathogenesis of major chronic degenerative diseases and acute injuries of the brain, cardiovascular system, liver, kidneys, and other organs, and its manipulation offers a promising new strategy for anticancer therapy. This explains the high interest in designing new small-molecule-specific inhibitors against ferroptosis. Given the role of 15-lipoxygenase (15LOX) association with phosphatidylethanolamine (PE)-binding protein 1 (PEBP1) in initiating ferroptosis-specific peroxidation of polyunsaturated PE, we propose a strategy of discovering antiferroptotic agents as inhibitors of the 15LOX/PEBP1 catalytic complex rather than 15LOX alone. Here we designed, synthesized, and tested a customized library of 26 compounds using biochemical, molecular, and cell biology models along with redox lipidomic and computational analyses. We selected two lead compounds, FerroLOXIN-1 and 2, which effectively suppressed ferroptosis in vitro and in vivo without affecting the biosynthesis of pro-/anti-inflammatory lipid mediators in vivo. The effectiveness of these lead compounds is not due to radical scavenging or iron-chelation but results from their specific mechanisms of interaction with the 15LOX-2/PEBP1 complex, which either alters the binding pose of the substrate [eicosatetraenoyl-PE (ETE-PE)] in a nonproductive way or blocks the predominant oxygen channel thus preventing the catalysis of ETE-PE peroxidation. Our successful strategy may be adapted to the design of additional chemical libraries to reveal new ferroptosis-targeting therapeutic modalities.

Also flagged:GlycopeptideglycodipeptidewaterGFAPNestinMAP2
Journal Article 2023-06-16 No Snippets Castro VIB, Araújo AR, Duarte F, Sousa-Franco A, Reis RL, Pashkuleva I, Pires RA.
Show Full Abstract

We applied a bottom-up approach to develop biofunctional supramolecular hydrogels from an aromatic glycodipeptide. The self-assembly of the glycopeptide was induced by either temperature manipulation (heating-cooling cycle) or solvent (DMSO to water) switch. The sol-gel transition was salt-triggered in cell culture media and resulted in gels with the same chemical compositions but different mechanical properties. Human adipose derived stem cells (hASCs) cultured on these gels under basal conditions (i.e., without differentiation factors) overexpressed neural markers, such as GFAP, Nestin, MAP2, and βIII-tubulin, confirming the differentiation into neural lineages. The mechanical properties of the gels influenced the number and distribution of the adhered cells. A comparison with gels obtained from the nonglycosylated peptide showed that glycosylation is crucial for the biofunctionality of the hydrogels by capturing and preserving essential growth factors, e.g., FGF-2.

SERPINC1
Also flagged:Bufadienolidesaminessecretionsecretionssynthesisexcretion
Journal Article 2023-06-16 ✓ 1 Snippet Kowalski K, Marciniak P, Rychlik L.
In-Text Gene Mentions

Antithrombin-IIIregulates the blood…

Show Full Abstract

<h4>Background</h4>Parotoid gland secretion of bufonid toads is a rich source of toxic molecules that are used against predators, parasites and pathogens. Bufadienolides and biogenic amines are the principal compounds responsible for toxicity of parotoid secretion. Many toxicological and pharmacological analyses of parotoid secretions have been performed, but little is known about the processes related to poison production and secretion. Therefore, our aim was to investigate protein content in parotoids of the common toad, Bufo bufo, to understand the processes that regulate synthesis and excretion of toxins as well as functioning of parotoid macroglands.<h4>Results</h4>Applying a proteomic approach we identified 162 proteins in the extract from toad's parotoids that were classified into 11 categories of biological functions. One-third (34.6%) of the identified molecules, including acyl-CoA-binding protein, actin, catalase, calmodulin, and enolases, were involved in cell metabolism. We found many proteins related to cell division and cell cycle regulation (12.0%; e.g. histone and tubulin), cell structure maintenance (8.4%; e.g. thymosin beta-4, tubulin), intra- and extracellular transport (8.4%), cell aging and apoptosis (7.3%; e.g. catalase and pyruvate kinase) as well as immune (7.0%; e.g. interleukin-24 and UV excision repair protein) and stress (6.3%; including heat shock proteins, peroxiredoxin-6 and superoxide dismutase) response. We also identified two proteins, phosphomevalonate kinase and isopentenyl-diphosphate delta-isomerase 1, that are involved in synthesis of cholesterol which is a precursor for bufadienolides biosynthesis. STRING protein-protein interaction network predicted for identified proteins showed that most proteins are related to metabolic processes, particularly glycolysis, stress response and DNA repair and replication. The results of GO enrichment and KEGG analyses are also consistent with these findings.<h4>Conclusion</h4>This finding indicates that cholesterol may be synthesized in parotoids, and not only in the liver from which is then transferred through the bloodstream to the parotoid macroglands. Presence of proteins that regulate cell cycle, cell division, aging and apoptosis may indicate a high epithelial cell turnover in parotoids. Proteins protecting skin cells from DNA damage may help to minimize the harmful effects of UV radiation. Thus, our work extends our knowledge with new and important functions of parotoids, major glands involved in the bufonid chemical defence.

Also flagged:prehypertensionhypertensioncardiovascular diseasesCVDalcoholobesity
Journal Article 2023-06-16 No Snippets Vo HK, Nguyen DV, Vu TT, Tran HB, Nguyen HTT.
Show Full Abstract

<h4>Background</h4>Prehypertension (PHT) and hypertension (HTN) in young adults are essential risk factors for other cardiovascular diseases (CVD) in later years of life. However, there is a lack of knowledge about the burden and risk factors of PHT/HTN for Vietnamese youth. The aim of this study was to investigate the prevalence of PHT/HTN and risk factors among university students in Hanoi, Vietnam.<h4>Methods</h4>This study was designed as a cross-sectional investigation with 840 students (394 males and 446 females) randomly sampled from freshmen of Vietnam National University, Hanoi (VNU). Socio-demographic, anthropometric, and lifestyle data were collected using questionnaire forms and physical measurements. HTN was defined as blood pressure (BP) ≥ 140/90 mmHg and/or current treatment with antihypertensive medications. PHT was defined as a systolic BP from 120 to 139 mmHg and/or a diastolic BP from 80 to 89 mmHg. Body mass index (BMI) was classified according to the WHO diagnostic criteria for Asian adults: normal weight (BMI 18.5-22.9 kg/m<sup>2</sup>), underweight (BMI < 18.5 kg/m<sup>2</sup>), overweight (BMI 23-24.9 kg/m<sup>2</sup>), and obese (BMI ≥ 25 kg/m<sup>2</sup>). Bivariable and multivariable log-binomial regression analyses were conducted to explore the association of PHT/HTN with different risk factors.<h4>Results</h4>The overall prevalence of prehypertension and hypertension was 33.5% [95% CI: 30.3-36.8%] (54.1% in men and 15.3% in women) and 1.4% [95% CI: 0.7-2.5%] (2.5% in men and 0.5% in women), respectively. Regarding CVD major risk factors, 119 (14.2%) were identified as overweight/obese, 461 (54.9%) were physical inactivity, 29.4% of men and 8.1% of women reported consuming alcohol. The multivariable analysis indicated the male sex (adjusted prevalence ratio [aPR] = 3.07; 95% CI: 2.32-4.06), alcohol consumption (aPR = 1.28; 95% CI: 1.03-1.59) and obesity (aPR = 1.35; 95% CI: 1.08-1.68) as the independent risk factors for PHT/HTN.<h4>Conclusions</h4>The results revealed the high burden of prehypertension and hypertension among university freshmen in VNU. Male sex, alcohol consumption, and obesity were identified as important risk factors for PHT/HTN. Our study suggests an early screening program for PHT/HTN and campaigns to promote a healthy lifestyle for young adults in Vietnam.

Also flagged:atrial fibrillationAFgene expressionmitochondrialadherensdeath
Journal Article 2023-06-16 No Snippets Wass SY, Offerman EJ, Sun H, Hsu J, Rennison JH, Cantlay CC, McHale ML, Gillinov AM, Moravec C, Smith JD, Van Wagoner DR, Barnard J, Chung MK.
Show Full Abstract

<h4>Background</h4>Genomewide association studies have associated >100 genetic loci with atrial fibrillation (AF), but establishing causal genes contributing to AF remains challenging.<h4>Objective</h4>The purpose of this study was to determine candidate novel causal genes and mechanistic pathways associated with AF risk loci by incorporating gene expression and coexpression analyses and to provide a resource for functional studies and targeting of AF-associated genes.<h4>Methods</h4>Cis-expression quantitative trait loci were identified for candidate genes near AF risk variants in human left atrial tissues. Coexpression partners were identified for each candidate gene. Weighted gene coexpression network analysis (WGCNA) identified modules and modules with overrepresentation of candidate AF genes. Ingenuity pathway analysis (IPA) was applied to the coexpression partners of each candidate gene. IPA and gene set over representation analysis were applied to each WGCNA module.<h4>Results</h4>One hundred sixty-six AF-risk single nucleotide polymorphisms were located in 135 loci. Eighty-one novel genes not previously annotated as putative AF risk genes were identified. IPA identified mitochondrial dysfunction, oxidative stress, epithelial adherens junction signaling, and sirtuin signaling as the most frequent significant pathways. WGCNA characterized 64 modules (candidate AF genes overrepresented in 8), represented by cell injury, death, stress, developmental, metabolic/mitochondrial, transcription/translation, and immune activation/inflammation regulatory pathways.<h4>Conclusion</h4>Candidate gene coexpression analyses suggest significant roles for cellular stress and remodeling in AF, supporting a dual risk model for AF: Genetic susceptibility to AF may not manifest until later in life, when cellular stressors overwhelm adaptive responses. These analyses also provide a novel resource to guide functional studies on potential causal AF genes.

PTGIS
Also flagged:m6A demethylaseFTOgefitinibnon-small cell lung cancerFLRT3NSCLC
Journal Article 2023-06-16 ✓ 5 Snippets Wang Q, Zhang L, Su Z, Li W, Jia Y, Zhang J.
In-Text Gene Mentions

Serum exosomal m6A demethylase FTO promotes gefitinib resistance in non-small cell lung cancer by up-regulating FLRT3, PTGIS and SIRPα expression.

Overall, FTO m6A demethylase promotes gefitinib resistance in NSCLC patients by upregulating downstream FLRT3, PTGIS, and SIRPA expression, with these three downstream genes serving as strong prognostic indicators.

…by up-regulating FLRT3,PTGISand SIRPα expression.…

…downstream genes (FLRT3,PTGIS, and SIRPA).…

…found in FLRT3,PTGIS, and SIRPA genes,…

Show Full Abstract

This study investigates the molecular mechanism of FTO m6A demethylase in non-small cell lung cancer (NSCLC) and gefitinib resistance using GEO and TCGA databases. Differentially expressed genes (DEGs) were screened from RNA-seq data sets of serum exosomes of gefitinib-resistant NSCLC patients in the GEO database and the NSCLC data set in the GEPIA2 database. From this analysis, FTO m6A demethylase was found to be significantly upregulated in the serum exosomes of gefitinib-resistant NSCLC patients. To identify downstream genes affected by FTO m6A demethylase, weighted correlation network analysis and differential expression analysis were performed, resulting in the identification of three key downstream genes (FLRT3, PTGIS, and SIRPA). Using these genes, the authors constructed a prognostic risk assessment model. Patients with high-risk scores exhibited a significantly worse prognosis. The model could predict the prognosis of NSCLC with high accuracy measured by AUC values of 0.588, 0.608, and 0.603 at 1, 3, and 5 years respectively. Furthermore, m6A sites were found in FLRT3, PTGIS, and SIRPA genes, and FTO was significantly positively correlated with the expression of these downstream genes. Overall, FTO m6A demethylase promotes gefitinib resistance in NSCLC patients by upregulating downstream FLRT3, PTGIS, and SIRPA expression, with these three downstream genes serving as strong prognostic indicators.

PCDH17
Also flagged:Bladder cancermacrohematuriaadenocarcinomasarcomacancerNon-muscle invasive bladder cancer
Journal Article 2023-06-16 ✓ 1 Snippet Radosavljevic V, Milic N.
In-Text Gene Mentions

…63%), POU4F2 andPCDH17genes (sensitivity 90%…

Show Full Abstract

The objective of this study was to offer new approach for selection of persons with asymptomatic bladder cancer (BC) and highly risky persons for the BC occurrence. Also, it is a part of the BC screening protocol (study is ongoing). Study populations were 100 newly diagnosed (diagnosis maximum 1-year old) males with BC and 100 matched (by sex and age ±5 years) controls (not oncology patients from the same hospital). A hospital based, matched case-control study was done. Statistical analysis comprised of four steps: <i>t</i>-test, univariate logistic regression, multivariate logistic regression, and scoring. The fifth step comprised of two changes, deleting one variable and addition of another variable. Six variables were statistically significant: Caucasian men over 45 years age, tobacco smoking over 40 pack-years, occupational and/or environmental exposure to the proved BC carcinogens over 20 years, macrohematuria, difficulty urinating, BC in relatives up to fourth degree of kinships, and they were used for an easy and fast selection of the individuals with high risk for BC occurrence and BC asymptomatic patients (optimal selection at the population level). The final results showed highly significant probability (<i>p</i> < 0.001), with area under ROC curve of 0.913, negative predictive values of 89.7% (95% CI 10.3-100%), and a specificity of 78%. Positive predictive value was 80.5% (95% CI 19.5-100%) and a sensitivity of 91%. It is possible to recruit asymptomatic BC patients (primary prevention) by using this model, as well as persons with high risk for BC occurrence (primordial prevention). This study is the first part of the BC screening protocol and the second part of the BC screening protocol study is ongoing (urine analysis).

Also flagged:synthesisbiphenylvancomycinArylomycin Abiphenylsbenzene
Journal Article 2023-06-16 No Snippets Ali HA, Ismail MA, Fouda AES, Ghaith EA.
Show Full Abstract

This review provides recent developments in the current status and latest synthetic methodologies of biphenyl derivatives. Furthermore, this review investigates detailed discussions of several metalated chemical reactions related to biphenyl scaffolds such as Wurtz-Fittig, Ullmann, Bennett-Turner, Negishi, Kumada, Stille, Suzuki-Miyaura, Friedel-Crafts, cyanation, amination, and various electrophilic substitution reactions supported by their mechanistic pathways. Furthermore, the preconditions required for the existence of axial chirality in biaryl compounds are discussed. Furthermore, atropisomerism as a type of axial chirality in biphenyl molecules is discussed. Additionally, this review covers a wide range of biological and medicinal applications of the synthesized compounds involving patented approaches in the last decade corresponding to investigating the crucial role of the biphenyl structures in APIs.

POU3F2
Also flagged:Hepatocellular CarcinomacancerdeathPrimaryliver cancerchronic infection
Journal Article 2023-06-16 ✓ 2 Snippets Jiang W, Wang Y, Yu C, Sui D, Du G, Li Y.
In-Text Gene Mentions

For instance, BCYRN1/miR-490-3p/POU3F2 was suggested to promote tumor cell growth and metastasis of HCC.29 SNHG15/miR-490-3p/HDAC2 axis was demonstrated to promote HCC progression.30 In this analysis, XIST/hsa-miR-490-3p/VHLL axis was detected in the DElncRNA-DEmiRNA-DEmRNA regulatory network, suggesting its potential role in the progression of HCC.

…r instance, BCYRN1/miR-490-3p/POU3F2was suggested to…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a major cause of cancer death in the world. The aim of this study was to establish a new model to predict the prognosis of HCC.<h4>Materials and methods</h4>The mRNA, miRNA and lncRNA expression profiles of early (stage I-II) and late (stage III-IV) stage HCC patients were acquired from The Cancer Genome Atlas (TCGA) database. The differentially expressed mRNAs (DEmRNAs), miRNAs (DEmiRNAs) and lncRNAs (DElncRNAs) were identified between early and late stage HCC. Key molecules associated with the prognosis, and important immune cell types in HCC were identified. The nomogram based on incorporating age, gender, stage, and all important factors was constructed to predict the survival of HCC.<h4>Results</h4>A total of 1516 DEmRNAs, 97 DEmiRNAs and 87 DElncRNAs were identified. A DElncRNA-DEmiRNA-DEmRNA regulatory network including 78 mRNAs, 50 miRNAs and 1 lncRNA was established. Among the regulatory network, 11 molecules were significantly correlated with the prognosis of HCC based on Lasso regression analysis. Then, Preadipocytes and 3 survival-associated DEmRNAs were identified as crucial biomarkers. Subsequently, a nomogram with a differentiation degree of 0.758, including 1 immune cell, 11 mRNAs and 3 miRNAs, was generated.<h4>Conclusion</h4>Our study constructed a model by incorporating clinical information, significant biomarkers and immune cells to predict the survival of HCC, which achieved a good performance.

Also flagged:olfaction2-MethylbutanoateKairomonesmethyl isonicotinatep -anisaldehydeInsecticides
Journal Article 2023-06-16 No Snippets Chappuis CJF, Cléroux M, Descombes C, Barth Y, Lefort F.
Show Full Abstract

An understanding of insect olfaction allows for more specific alternative methods of pest control. We evaluated the responses of the western flower thrips (WFT, <i>Frankliniella occidentalis</i>) in a Y-olfactometer to estimate gas-phase concentrations of the aggregation pheromone neryl (<i>S</i>)-2-methylbutanoate and known kairomones such as methyl isonicotinate, (<i>S</i>)-(-)-verbenone, and <i>p</i>-anisaldehyde. The gas-phase concentrations of these compounds were obtained from the release rates measured in dynamic headspace cells. The compounds were collected from the headspace using dried solid-phase extraction (SPE) cartridges and analyzed with a triple quadrupole GC-MS/MS. We observed that the aggregation pheromone significantly attracted WFT females at doses of 10 and 100 µg, whereas methyl isonicotinate and <i>p</i>-anisaldehyde significantly attracted WFT females at the highest dose. Verbenone did not produce any significant results. A completely different picture was obtained when the gas-phase concentrations were considered. The minimal gas-phase concentrations of the pheromone required to attract WFT females was 0.027 ng/mL, at least 100 times lower than that of the other two compounds. The relevance and implications of our results are discussed in light of the insect's biology and pest management methods.

Also flagged:COVID-19infectionpenicillinscephalosporinsmonobactamsinfections
Journal Article 2023-06-16 No Snippets Mai HTT, Espinoza JL.
Show Full Abstract

Several studies have reported an increased frequency of colonization and/or infection with antibiotic-resistant bacteria (ARB) during the COVID-19 pandemic. Extended-spectrum beta-lactamase-producing <i>Enterobacterales</i> (ESBL-PE) are a group of bacteria with intrinsic resistance to multiple antibiotics, including penicillins, cephalosporins, and monobactams. These pathogens are easy to spread and can cause difficult-to-treat infections. Here, we summarize the available evidence on the impact of the COVID-19 pandemic on infections caused by ESBL-PE. Using specific criteria and keywords, we searched PubMed, MEDLINE, and EMBASE for articles published up to 30 March 2023 on potential changes in the epidemiology of ESBL-E since the beginning of the COVID-19 pandemic. We identified eight studies that documented the impact of COVID-19 on ESBL-E. Five studies were focused on assessing the frequency of ESBL-PE in patient-derived specimens, and three studies investigated the epidemiological aspects of ESBL-PE infections in the context of the COVID-19 pandemic. Some of the studies that were focused on patient specimens reported a decrease in ESBL-PE positivity during the pandemic, whereas the three studies that involved patient data (1829 patients in total) reported a higher incidence of ESBL-PE infections in patients hospitalized for COVID-19 compared with those with other conditions. There are limited data on the real impact of the COVID-19 pandemic on the epidemiology of ESBL-PE infections; however, patient-derived data suggest that the pandemic has exacerbated the spread of these pathogens.

Also flagged:FGFR2FGFRkinasekinasescancertumor
Journal Article 2023-06-16 No Snippets Zhang L, Zheng H, Xu L, You S, Shen Y, Han Y, Anderson S.
Show Full Abstract

FGFR fusions retaining the FGFR kinase domain are active kinases that are either overexpressed or constitutively activated throughout diverse cancer types. The presence of FGFR translocations enhances tumor cell proliferation and contributes to significant sensitivity to FGFR kinase inhibitors. FGFR2 as an actionable target in intrahepatic cholangiocarcinoma (iCCA) has been tested in many clinical trials. FISH (fluorescence in situ hybridization) and NGS (next-generation sequence) are well-known tools to investigate the translocations of FGFR with multiple or unknown translocation partners. A rapid and robust FISH assay was developed and validated to detect FGFR2 translocations from FFPE specimens in iCCA. The analytical performance of the FISH assay was evaluated for probe localization, probe sensitivity and specificity, and assay precision. Twenty-five archival FFPE specimens from local iCCA patients were tested for FGFR2 translocations. FISH results were correlated with that of NGS on some samples. Biallelic translocations and a novel FGFR2 translocation involving the partner gene, SHROOM3, t(4;10) (q21;q26), were identified in a local iCCA patient.

DCC
Also flagged:axonalextracellularaxonGFPaxon migrationresponse to
Journal Article 2023-06-16 ✓ 5 Snippets Teixeira-Castro A, Sousa JC, Vieira C, Pereira-Sousa J, Vilasboas-Campos D, Marques F, Pinto-do-Ó P, Maciel P.
In-Text Gene Mentions

In humans, these include some autism spectrum disorders and other neurodevelopmental disorders (reviewed in detail in [4]), and more specific disorders, such as horizontal gaze palsy with progressive scoliosis, caused by mutations in the slit ROBO3 receptor (OMIM 607313; [5]), congenital mirror movements that are associated with DCC mutations (OMIM 157600; [6]), congenital fibrosis of the extraocular muscles type 3, and TUBB3 syndromes, related to mutations in TUBB3 (beta-tubulin III, a subunit of microtubules) (OMIM 600638 [7]).

…or two receptors,DCC/UNC-40 and UNC-5H).…

…are associated withDCCmutations (OMIM 157600;…

…on two receptors (DCC/UNC-40 and UNC-5H, respective…

…in colorectal cancer (DCC)/neogenin, and UNC5A-D (previ…

Show Full Abstract

<h4>Aim</h4>Experimental models are a powerful aid in visualizing molecular phenomena. This work reports how the worm <i>Caenorhabditis elegans</i> (<i>C. elegans</i>) can be effectively explored for students to learn how molecular cues dramatically condition axonal guidance and define nervous system structure and behavior at the organism level. Summary of work: A loosely oriented observational activity preceded detailed discussions on molecules implied in axonal migration. <i>C. elegans</i> mutants were used to introduce second-year medical students to the deleterious effects of gene malfunctioning in neuron response to extracellular biochemical cues and to establish links between molecular function, nervous system structure, and animal behavior. Students observed <i>C. elegans</i> cultures and associated animal behavior alterations with the lack of function of specific axon guidance molecules (the soluble cue netrin/UNC-6 or two receptors, DCC/UNC-40 and UNC-5H). Microscopical observations of these strains, in combination with pan-neuronal GFP expression, allowed optimal visualization of severely affected neurons. Once the list of mutated genes in each strain was displayed, students could also relate abnormal patterns in axon migration/ventral and dorsal nerve cord neuron formation in <i>C. elegans</i> with mutated molecular components homologous to those in humans.<h4>Summary of results</h4>Students rated the importance and effectiveness of the activity very highly. Ninety-three percent found it helpful to grasp human axonal migration, and all students were surprised with the power of the model in helping to visualize the phenomenon.

ABT1
Also flagged:Spinal Muscular AtrophyIGHMBP2SMN1Spinal Muscular Atrophy with Muscular Distress type 1SMARD1pathogenesis
Journal Article 2023-06-16 ✓ 2 Snippets Sierra-Delgado JA, Sinha-Ray S, Kaleem A, Ganjibakhsh M, Parvate M, Powers S, Zhang X, Likhite S, Meyer K.
In-Text Gene Mentions

…], so far,ABT1is the only…

…only one gene,ABT1has been confirmed…

Show Full Abstract

Spinal Muscular Atrophy (SMA) is the leading genetic cause of infant mortality. The most common form of SMA is caused by mutations in the SMN1 gene, located on 5q (SMA). On the other hand, mutations in IGHMBP2 lead to a large disease spectrum with no clear genotype-phenotype correlation, which includes Spinal Muscular Atrophy with Muscular Distress type 1 (SMARD1), an extremely rare form of SMA, and Charcot-Marie-Tooth 2S (CMT2S). We optimized a patient-derived in vitro model system that allows us to expand research on disease pathogenesis and gene function, as well as test the response to the AAV gene therapies we have translated to the clinic. We generated and characterized induced neurons (iN) from SMA and SMARD1/CMT2S patient cell lines. After establishing the lines, we treated the generated neurons with AAV9-mediated gene therapy (AAV9.SMN (Zolgensma) for SMA and AAV9.IGHMBP2 for IGHMBP2 disorders (NCT05152823)) to evaluate the response to treatment. The iNs of both diseases show a characteristic short neurite length and defects in neuronal conversion, which have been reported in the literature before with iPSC modeling. SMA iNs respond to treatment with AAV9.SMN in vitro, showing a partial rescue of the morphology phenotype. For SMARD1/CMT2S iNs, we were able to observe an improvement in the neurite length of neurons after the restoration of IGHMBP2 in all disease cell lines, albeit to a variable extent, with some lines showing better responses to treatment than others. Moreover, this protocol allowed us to classify a variant of uncertain significance on IGHMBP2 on a suspected SMARD1/CMT2S patient. This study will further the understanding of SMA, and SMARD1/CMT2S disease in particular, in the context of variable patient mutations, and might further the development of new treatments, which are urgently needed.

Also flagged:Circadian RhythmExtracellularvesiclesCD9CD81TSG101
Journal Article 2023-06-16 No Snippets Saenz-de-Juano MD, Silvestrelli G, Ulbrich SE.
Show Full Abstract

Extracellular vesicles (EVs) and their microRNA (miRNA) cargo have been proposed as possible mammary gland health biomarkers in cattle. However, throughout the day, the biologically active milk components, such as miRNAs, may change due to the dynamic nature of milk. The current study aimed to evaluate the circadian fluctuation of milk EVs miRNA cargo to assess the feasibility of milk EVs as future biomarkers for mammary gland health management. Milk from four healthy dairy cows was collected for four consecutive days in the two daily milking sessions in the morning and the evening. The isolated EVs were heterogeneous, intact, and carried the EV protein markers CD9, CD81, and TSG101, as shown by transmission electron microscopy and western blot. The miRNA sequencing results demonstrate that the abundance of miRNA cargo in milk EVs remained stable, unlike other milk components, such as somatic cells, that changed during milking sessions. These findings indicated that the miRNA cargo within milk EVs remains stable irrespective of the time of day, suggesting their potential utility as diagnostic markers for mammary gland health.

Also flagged:Protein KinasesPhosphatasesPhosphorylationpost-translation modificationsKinaseskinase
Journal Article 2023-06-16 No Snippets Qin S, Kitty I, Hao Y, Zhao F, Kim W.
Show Full Abstract

DNA double-strand breaks (DSBs) are the most lethal DNA damages which lead to severe genome instability. Phosphorylation is one of the most important protein post-translation modifications involved in DSBs repair regulation. Kinases and phosphatases play coordinating roles in DSB repair by phosphorylating and dephosphorylating various proteins. Recent research has shed light on the importance of maintaining a balance between kinase and phosphatase activities in DSB repair. The interplay between kinases and phosphatases plays an important role in regulating DNA-repair processes, and alterations in their activity can lead to genomic instability and disease. Therefore, study on the function of kinases and phosphatases in DSBs repair is essential for understanding their roles in cancer development and therapeutics. In this review, we summarize the current knowledge of kinases and phosphatases in DSBs repair regulation and highlight the advancements in the development of cancer therapies targeting kinases or phosphatases in DSBs repair pathways. In conclusion, understanding the balance of kinase and phosphatase activities in DSBs repair provides opportunities for the development of novel cancer therapeutics.

Also flagged:polysaccharidespurslane polysaccharidespolysaccharidemalic acidglucosecalcium
Journal Article 2023-06-16 No Snippets Wang M, Li C, Li J, Hu W, Yu A, Tang H, Li J, Kuang H, Zhang H.
Show Full Abstract

<i>Portulaca oleracea</i> L. (purslane) is a widely distributed plant with a long history of cultivation and consumption. Notably, polysaccharides obtained from purslane exhibit surprising and satisfactory biological activities, which explain the various benefits of purslane on human health, including anti-inflammatory, antidiabetic, antitumor, antifatigue, antiviral and immunomodulatory effects. This article systematically reviews the extraction and purification methods, chemical structure, chemical modification, biological activity and other aspects of polysaccharides from purslane collected in the Chinese Pharmacopoeia, Flora of China, Web of Science, PubMed, Baidu Scholar, Google Scholar and CNKI databases in the last 14 years, using the keywords "<i>Portulaca oleracea</i> L. polysaccharides" and "purslane polysaccharides". The application of purslane polysaccharides in different fields is also summarized, and its application prospects are also discussed. This paper provides an updated and deeper understanding of purslane polysaccharides, which will provide useful guidance for the further optimization of polysaccharide structures and the development of purslane polysaccharides as a novel functional material, as well as a theoretical basis for its further research and application in human health and manufacturing development.

Also flagged:Hydroxyapatitenanosilicanitrogenanthocyaninsmineralswater
Journal Article 2023-06-16 No Snippets Paientko V, Oranska OI, Gun'ko VM, Skwarek E.
Show Full Abstract

In order to improve the properties and characteristics of rose clay composites with acai, hydroxyapatite (HA), and nanosilica, the systems were mechanically treated. This treatment provides the preparation of better nanostructured composites with natural and synthetic nanomaterials with improved properties. The materials were characterized using XRD, nitrogen adsorption and desorption, particle sizing, zeta potential, and surface charge density measurements. For the systems tested in the aqueous media, the pH value of the point of zero charge (pH<sub>PZC</sub>) ranges from 8 to 9.9. However, the isoelectric point (pH<sub>IEP</sub>) values for all composites are below pH 2. This large difference between pH<sub>PZC</sub> and pH<sub>IEP</sub> is due to the complexity of the electrical double layer (EDL) and the relation of these points to different layers of the EDL. The tested samples as composite/electrolyte solutions are colloidally unstable. The toxicity level of the ingredients and release of anthocyanins as bioactive substances from acai in the composites were determined. The composites demonstrate an enhanced release of anthocyanins. There are some regularities in the characteristics depending on the type of components, morphology, and textural features of solids. The morphological, electrochemical, and structural characteristics of the components have changed in composites. The release of anthocyanins is greater for the composites characterized by minimal confined space effects in comparison with rose clay alone. The morphological, electrochemical, and structural characteristics allow us to expect high efficiency of composites as bioactive systems that are interesting for practical applications in cosmetics.

Also flagged:post-translational modificationsglycoproteinscell adhesiontenascinproteolysislactation
Journal Article 2023-06-16 No Snippets Lu J, Zhang W, Ma C, Pang X, Dai Y, Zhu T, Liu J, Xing L, Zhang S, Lv J.
Show Full Abstract

<h4>Introduction</h4>Glycosylation is one of the essential post-translational modifications that influences the function of milk proteins.<h4>Methods</h4>In the present study, 998 proteins and 764 glycosylated sites from 402 glycoproteins were identified in human milk by TMT labeling proteomics. Compared to human milk proteins, the glycoproteins were mainly enriched in cell adhesion, proteolysis, and defense/immune process.<h4>Results</h4>The abundance of 353 glycosylated sites and their 179 parent proteins was quantified. After normalization to their parent protein's abundance, 78 glycosylated sites in 56 glycoproteins and 10 glycosylated sites in 10 glycoproteins were significantly higher in colostrum and mature milk, respectively. These changed glycoproteins were mainly related to host defense. Intriguingly, one glycosylated site (Asp144) in IgA and two glycosylated sites (Asp38 and Asp1079) in tenascin are significantly upregulated even though their protein abundance was downregulated during lactation.<h4>Discussion</h4>This study helps us figure out the critical glycosylated sites in proteins that might influence their biological function in an unbiased way.

SERPINC1
Also flagged:antibodiesautoantibodiesantibodycoagulationthrombosisautoimmune
Journal Article 2023-06-16 ✓ 1 Snippet Li X, Chen W, Liu T, Cai J, Wei S, Du Y, Liu C, Gong Z, Cheng L, Zhou X, Xiong M, Wang T, Li Y, Yang X, Lai F.
In-Text Gene Mentions

…CPS, Protein S;ATIII, Antithrombin III.…

Show Full Abstract

<h4>Background</h4>Previous studies have shown that abnormal increases in autoimmune antibodies in pregnant women may increase the risk of maternal thrombosis. However, at our hospital, two pregnant women presented with umbilical artery thrombosis and positive maternal autoantibodies were detected in both, which led us to consider whether maternal autoantibodies also played a role in umbilical artery thrombosis.<h4>Case presentation</h4>Case 1: Fetal ultrasound of a 34-year-old pregnant woman at 30<sup>+4</sup> weeks gestation showed two umbilical arteries, with an inner diameter of approximately 0.15 cm for the smaller was artery. However, only a single umbilical artery blood flow signal was detected. Due to fetal distress, which was noted on abnormal cardiotocography and Doppler ultrasound, an emergency cesarean section was performed at 31<sup>+1</sup> weeks gestation. The Apgar score of the newborn was 3-8-8. Umbilical cord examination detected thrombosis in the two umbilical arteries. Moreover, blood test results during pregnancy showed nRNP/Sm antibody (+) and SS antibody (+++). Case 2: The first systematic ultrasound of a 33-year-old twin pregnancy at 24<sup>+3</sup> weeks gestation was normal, but routine fetal ultrasound at 27<sup>+1</sup> weeks gestation showed only one umbilical artery between fetus A and the placenta. Blood test results showed that the patient was anti-nRNP/Sm antibody (+) in the rheumatoid immune activity test at 27<sup>+3</sup> weeks gestation. An emergency cesarean section was performed at 34<sup>+6</sup> weeks gestation because of the single umbilical artery and abnormal maternal coagulation. Both umbilical cords of fetus A and B blood test results showed anti-nRNP/Sm antibody (++). The pathological examination of the umbilical cord and placenta showed the presence of old thrombosis in one of the umbilical arteries of fetus A.<h4>Conclusions</h4>Abnormal maternal autoantibodies may be a risk factor for umbilical artery thrombosis. For these pregnant women, conducting more detailed ultrasound monitoring might get early detection of UAT formation and avoid the occurrence of adverse pregnancy outcomes.

HTT
Also flagged:Huntington diseaseHDbehavioralneurodegenerative disordercytosineadenine
Journal Article 2023-06-16 ✓ 1 Snippet Shiino S, van Wouwe NC, Wylie SA, Claassen DO, McDonell KE.
In-Text Gene Mentions

…repeat in theHTTgene on chromosome…

Show Full Abstract

<h4>Background</h4>Impulsivity is a common clinical feature of Huntington disease (HD), but the underlying cognitive dynamics of impulse control in this population have not been well-studied.<h4>Objective</h4>To investigate the temporal dynamics of action impulse control in HD patients using an inhibitory action control task.<h4>Methods</h4>Sixteen motor manifest HD patients and seventeen age-matched healthy controls (HC) completed the action control task. We applied the activation-suppression theoretical model and distributional analytic techniques to differentiate the strength of fast impulses from their top-down suppression.<h4>Results</h4>Overall, HD patients produced slower and less accurate reactions than HCs. HD patients also exhibited an exacerbated interference effect, as evidenced by a greater slowing of RT on non-corresponding compared to corresponding trials. HD patients made more fast, impulsive errors than HC, evidenced by significantly lower accuracy on their fastest reaction time trials. The slope reduction of interference effects as reactions slowed was similar between HD and controls, indicating preserved impulse suppression.<h4>Conclusion</h4>Our results indicate that patients with HD show a greater susceptibility to act rapidly on incorrect motor impulses but preserved proficiency of top-down suppression. Further research is needed to determine how these findings relate to clinical behavioral symptoms.

Also flagged:Breast cancercancertumorcell cycleepithelial to mesenchymal transitiondeath
Journal Article 2023-06-16 No Snippets Singh S, Saini H, Sharma A, Gupta S, Huddar VG, Tripathi R.
Show Full Abstract

With a high mortality rate that accounts for millions of cancer-related deaths each year, breast cancer is the second most common malignancy in women. Chemotherapy has significant potential in the prevention and spreading of breast cancer; however, drug resistance often hinders therapy in breast cancer patients. The identification and the use of novel molecular biomarkers, which can predict response to chemotherapy, might lead to tailoring breast cancer treatment. In this context, accumulating research has reported microRNAs (miRNAs) as potential biomarkers for early cancer detection, and are conducive to designing a more specific treatment plan by helping analyze drug resistance and sensitivity in breast cancer treatment. In this review, miRNAs are discussed in two alternative ways-as tumor suppressors to be used in miRNA replacement therapy to reduce oncogenesis and as oncomirs to lessen the translation of the target miRNA. Different miRNAs like miR-638, miR-17, miR-20b, miR-342, miR-484, miR-21, miR-24, miR-27, miR-23 and miR-200 are involved in the regulation of chemoresistance through diverse genetic targets. For instance, tumor-suppressing miRNAs like miR-342, miR-16, miR-214, and miR-128 and tumor-promoting miRNAs like miR101 and miR-106-25 cluster regulate the cell cycle, apoptosis, epithelial to mesenchymal transition and other pathways to impart breast cancer drug resistance. Hence, in this review, we have discussed the significance of miRNA biomarkers that could assist in providing novel therapeutic targets to overcome potential chemotherapy resistance to systemic therapy and further facilitate the design of tailored therapy for enhanced efficacy against breast cancer.

Also flagged:ORF3IRF1ORF2IRF2
Journal Article 2023-06-16 No Snippets Li Y, Tang B, Huang B, Xue X.
Show Full Abstract

Slope entropy (SlopEn) has been widely applied in fault diagnosis and has exhibited excellent performance, while SlopEn suffers from the problem of threshold selection. Aiming to further enhance the identifying capability of SlopEn in fault diagnosis, on the basis of SlopEn, the concept of hierarchy is introduced, and a new complexity feature, namely hierarchical slope entropy (HSlopEn), is proposed. Meanwhile, to address the problems of the threshold selection of HSlopEn and a support vector machine (SVM), the white shark optimizer (WSO) is applied to optimize both HSlopEn and an SVM, and WSO-HSlopEn and WSO-SVM are proposed, respectively. Then, a dual-optimization fault diagnosis method for rolling bearings based on WSO-HSlopEn and WSO-SVM is put forward. We conducted measured experiments on single- and multi-feature scenarios, and the experimental results demonstrated that whether single-feature or multi-feature, the WSO-HSlopEn and WSO-SVM fault diagnosis method has the highest recognition rate compared to other hierarchical entropies; moreover, under multi-features, the recognition rates are all higher than 97.5%, and the more features we select, the better the recognition effect. When five nodes are selected, the highest recognition rate reaches 100%.

Also flagged:renal cell carcinomatumorgene expressionorganizationRCClung cancer
Journal Article 2023-06-16 No Snippets Jones DC, Danaher P, Kim Y, Beechem JM, Gottardo R, Newell EW.
Show Full Abstract

A key step in spatial transcriptomics is identifying genes with spatially varying expression patterns. We adopt an information theoretic perspective to this problem by equating the degree of spatial coherence with the Jensen-Shannon divergence between pairs of nearby cells and pairs of distant cells. To avoid the notoriously difficult problem of estimating information theoretic divergences, we use modern approximation techniques to implement a computationally efficient algorithm designed to scale with <i>in situ</i> spatial transcriptomics technologies. In addition to being highly scalable, we show that our method, which we call maximization of spatial information (Maxspin), improves accuracy across several spatial transcriptomics platforms and a variety of simulations when compared with a variety of state-of-the-art methods. To further demonstrate the method, we generated <i>in situ</i> spatial transcriptomics data in a renal cell carcinoma sample using the CosMx Spatial Molecular Imager and used Maxspin to reveal novel spatial patterns of tumor cell gene expression.

Also flagged:hydrogenasespropanedithiolatemethylenediphosphineazadithiolatedithiolate
Journal Article 2023-06-16 No Snippets Zhang F, Woods TJ, Rauchfuss TB.
Show Full Abstract

Complexes of the type (diphosphine)Ni(<i>μ</i>-SR)<sub>2</sub>Fe(CO)<sub>3</sub> are investigated with azadithiolate (adt, HN(CH<sub>2</sub>S<sup>-</sup>)<sub>2</sub>) as the dithiolate. The resulting complexes are hybrid models for the active sites of the [NiFe]- and [FeFe]-hydrogenases. The key complex (dppv)Ni(<i>μ</i>-adt)Fe(CO)<sub>3</sub> <b>(3)</b> was prepared from the complex Ni[(SCH<sub>2</sub>)<sub>2</sub>NCbz](dppv), which contains a Cbz-protected adt ligand (Cbz = C(<i>O</i>)OCH<sub>2</sub>Ph, dppv = <i>cis</i>-1,2-(Ph<sub>2</sub>P)<sub>2</sub>C<sub>2</sub>H<sub>2</sub>). This complex combines with Fe<sub>2</sub>(CO)<sub>9</sub> to give (dppv)Ni[(<i>μ</i>-SCH<sub>2</sub>)<sub>2</sub>NCbz]Fe(CO)<sub>3</sub>, which is readily deprotected to give <b>3</b>. Complex <b>3</b> undergoes protonation at both Fe and N to give successively [(dppv)Ni(<i>μ</i>-adt)FeH(CO)<sub>3</sub>]<sup>+</sup> ([H<b>3</b>]<sup>+</sup>) and [(dppv)Ni(<i>μ</i>-adtH)FeH(CO)<sub>3</sub>]<sup>2+</sup> ([H3H]<sup>2+</sup>). The redox properties and dynamics of these complexes resemble previously reported analogues with propanedithiolate. Solutions of [H<b>3</b>]<sup>+</sup> readily degrade to [(dppv)Ni[(<i>μ</i>-SCH<sub>2</sub>)<sub>2</sub>NCH<sub>2</sub>]Fe(CO)<sub>3</sub>]<sup>+</sup> ([<b>4</b>]<sup>+</sup>), which features a methylene group linking N and Fe. Complex [<b>4</b>]<sup>+</sup> can be made in high yield by reaction of [H<b>3</b>]<sup>+</sup> with CH<sub>2</sub>O, and this conversion was also demonstrated with <sup>13</sup>CH<sub>2</sub>O. Complex [<b>4</b>]<sup>+</sup> undergoes hydrogenolysis by photochemical reaction with H<sub>2</sub> to give [(dppv)Ni[(<i>μ</i>-SCH<sub>2</sub>)<sub>2</sub>NMe]FeH(CO)<sub>3</sub>]<sup>+</sup>, the <i>N</i>-methylated analogue of [<b>H3</b>]<sup>+</sup>. Upon treatment ith Me<sub>3</sub>O<sup>+</sup>, [<b>4</b>]<sup>+</sup> undergoes quaternization, giving [(dppv)Ni[(<i>μ</i>-SCH<sub>2</sub>)<sub>2</sub>N(Me)CH<sub>2</sub>]Fe(CO)<sub>3</sub>]<sup>2+</sup>. In contrast with the lability of [H<b>3</b>]<sup>+</sup>, the phosphine-substituted derivative [(dppv)Ni(<i>μ</i>-adt)FeH(CO)<sub>2</sub>(PPh<sub>3</sub>)]<sup>+</sup> did not degrade. Most complexes were characterized by X-ray crystallography.

Also flagged:tuberculosisTBinfectious diseaseM. tuberculosis infectionTB infectioninfection
Journal Article 2023-06-15 No Snippets Thirunavukkarasu S, Ahmed M, Rosa BA, Boothby M, Cho SH, Rangel-Moreno J, Mbandi SK, Schreiber V, Gupta A, Zuniga J, Mitreva M, Kaushal D, Scriba TJ, Khader SA.
Show Full Abstract

The ADP ribosyltransferases (PARPs 1-17) regulate diverse cellular processes, including DNA damage repair. PARPs are classified on the basis of their ability to catalyze poly-ADP-ribosylation (PARylation) or mono-ADP-ribosylation (MARylation). Although PARP9 mRNA expression is significantly increased in progressive tuberculosis (TB) in humans, its participation in host immunity to TB is unknown. Here, we show that PARP9 mRNA encoding the MARylating PARP9 enzyme was upregulated during TB in humans and mice and provide evidence of a critical modulatory role for PARP9 in DNA damage, cyclic GMP-AMP synthase (cGAS) expression, and type I IFN production during TB. Thus, Parp9-deficient mice were susceptible to Mycobacterium tuberculosis infection and exhibited increased TB disease, cGAS and 2'3'-cyclic GMP-AMP (cGAMP) expression, and type I IFN production, along with upregulation of complement and coagulation pathways. Enhanced M. tuberculosis susceptibility is type I IFN dependent, as blockade of IFN α receptor (IFNAR) signaling reversed the enhanced susceptibility of Parp9-/- mice. Thus, in sharp contrast to PARP9 enhancement of type I IFN production in viral infections, this member of the MAR family plays a protective role by limiting type I IFN responses during TB.

Also flagged:Transient Receptor Potential Melastatin Ion ChannelPraziquantelTransient Receptor Potential MelastatinmetabolismcyclohexylTRPM
Journal Article 2023-06-15 No Snippets Friedrich L, Park SK, Ballard P, Ho Baeurle TH, Maillard D, Bödding M, Keiser J, Marchant JS, Spangenberg T.
Show Full Abstract

Praziquantel (PZQ) is an essential anthelmintic drug recently established to be an activator of a Transient Receptor Potential Melastatin (TRPM<sub>PZQ</sub> ) ion channel in trematode worms. Bioinformatic, mutagenesis and drug metabolism work indicate that the cyclohexyl ring of PZQ is a key pharmacophore for activation of trematode TRPM<sub>PZQ</sub> , as well as serving as the primary site of oxidative metabolism which results in PZQ being a short-lived drug. Based on our recent findings, the hydrophobic cleft in schistosome TRPM<sub>PZQ</sub> defined by three hydrophobic residues surrounding the cyclohexyl ring has little tolerance for polarity. Here we evaluate the in vitro and in vivo activities of PZQ analogues with improved metabolic stability relative to the challenge of maintaining activity on the channel. Finally, an estimation of the respective contribution to the overall activity of both the parent and the main metabolite of PZQ in humans is reported.

HFE
Also flagged:Polytetrafluoroethylenecirrhosisfactor 5 Leidenhemolytic anemiaportal hypertensionportal vein thrombosis
Journal Article 2023-06-15 ✓ 1 Snippet Barnhill M, Lizaola-Mayo B, Naidu SG, Shah S, Chascsa DMH.
In-Text Gene Mentions

…with history ofhemochromatosisand myeloproliferative (MF)…

Show Full Abstract

<h4>Background</h4>In the 1990s, transjugular intrahepatic portosystemic shunts (TIPS) were performed using bare metal stents, and stent-induced hemolysis was a complication noted in 10% of patients. This was due to the mechanical stress created by turbulent flow from the uncovered interstices. Polytetrafluoroethylene (PTFE) stents came into regular use in the early 2000s becoming the standard equipment for TIPS placements, which are predominately covered. Due to this, stent-induced hemolysis has become a rare phenomenon.<h4>Case presentation</h4>We describe a case of TIPS-induced hemolysis in a 53-years-old Caucasian female patient without cirrhosis. The patient had a history of heterozygous factor 5 Leiden mutation and abnormal lupus anticoagulant profile with development of a portal vein thrombus. She had undergone previous TIPS placement complicated by a TIPS thrombosis 3 years after initial placement requiring venoplasty and extension of the stent. Within one month, the patient developed hemolytic anemia with extensive evaluation that did not yield an alternative cause. Due to temporal association and clinical symptoms, the hemolytic anemia was attributed to the recent TIPS revision.<h4>Conclusion</h4>This particular case of TIPS-induced hemolysis in a patient who does not have cirrhosis has not been previously described in the literature. Our case highlights that TIPS-induced hemolysis should be considered in anyone who could have potential underlying red blood cell dysfunction, not just those with cirrhosis. Further, the case demonstrates an important point that mild hemolysis (i.e., not requiring blood transfusion) can likely be managed conservatively, without stent removal.

MLLT10
Also flagged:DOT1Lheterochromatinhistone methyltransferaselysinehistoneSMARCA5
Journal Article 2023-06-15 ✓ 1 Snippet Malla AB, Yu H, Farris D, Kadimi S, Lam TT, Cox AL, Smith ZD, Lesch BJ.
In-Text Gene Mentions

MLLT10

Show Full Abstract

Repetitive DNA elements are packaged in heterochromatin, but many require bursts of transcription to initiate and maintain long-term silencing. The mechanisms by which these heterochromatic genome features are transcribed remain largely unknown. Here, we show that DOT1L, a conserved histone methyltransferase that modifies lysine 79 of histone H3 (H3K79), has a specialized role in transcription of major satellite repeats to maintain pericentromeric heterochromatin and genome stability. We find that H3K79me3 is selectively enriched relative to H3K79me2 at repetitive elements in mouse embryonic stem cells (mESCs), that DOT1L loss compromises pericentromeric satellite transcription, and that this activity involves possible coordination between DOT1L and the chromatin remodeler SMARCA5. Stimulation of transcript production from pericentromeric repeats by DOT1L participates in stabilization of heterochromatin structures in mESCs and cleavage-stage embryos and is required for preimplantation viability. Our findings uncover an important role for DOT1L as a bridge between transcriptional activation of repeat elements and heterochromatin stability, advancing our understanding of how genome integrity is maintained and how chromatin state is set up during early development.

HTT
Also flagged:Serotonin transporterbehaviouralneurogenesisbehavioralSerotoningestation
Journal Article 2023-06-15 ✓ 5 Snippets Sunderji A, Gallant HD, Hall A, Davis AD, Pokhvisneva I, Meaney MJ, Silveira PP, Sassi RB, Hall GB.
In-Text Gene Mentions

…Serotonin transporter (5-HTT) gene network moderates…

5-HTTgene network moderates…

…the serotonin transporter (5-HTT) gene network can…

…experiences and the5-HTTgene network interact…

…(i.e. via altered5-HTT-ePRS function) from a…

Show Full Abstract

In utero, the developing brain is highly susceptible to the environment. For example, adverse maternal experiences during the prenatal period are associated with outcomes such as altered neurodevelopment and emotion dysregulation. Yet, the underlying biological mechanisms remain unclear. Here, we investigate whether the function of a network of genes co-expressed with the serotonin transporter in the amygdala moderates the impact of prenatal maternal adversity on the structure of the orbitofrontal cortex (OFC) in middle childhood and/or the degree of temperamental inhibition exhibited in toddlerhood. T1-weighted structural MRI scans were acquired from children aged 6-12 years. A cumulative maternal adversity score was used to conceptualize prenatal adversity and a co-expression based polygenic risk score (ePRS) was generated. Behavioural inhibition at 18 months was assessed using the Early Childhood Behaviour Questionnaire (ECBQ). Our results indicate that in the presence of a low functioning serotonin transporter gene network in the amygdala, higher levels of prenatal adversity are associated with greater right OFC thickness at 6-12 years old. The interaction also predicts temperamental inhibition at 18 months. Ultimately, we identified important biological processes and structural modifications that may underlie the link between early adversity and future deviations in cognitive, behavioural, and emotional development.

Also flagged:membranepore-formingtransmembraneKCNQ1KCNQ2KCNQ4
Journal Article 2023-06-15 No Snippets Manville RW, Hogenkamp D, Abbott GW.
Show Full Abstract

Voltage-gated potassium (Kv) channels in the KCNQ subfamily serve essential roles in the nervous system, heart, muscle and epithelia. Different heteromeric KCNQ complexes likely serve distinct functions in the brain but heteromer subtype-specific small molecules for research or therapy are lacking. Rosemary (Salvia rosmarinus) is an evergreen plant used medicinally for millennia for neurological and other disorders. Here, we report that rosemary extract is a highly efficacious opener of heteromeric KCNQ3/5 channels, with weak effects on KCNQ2/3. Using functional screening we find that carnosic acid, a phenolic diterpene from rosemary, is a potent, highly efficacious, PIP<sub>2</sub> depletion-resistant KCNQ3 opener with lesser effects on KCNQ5 and none on KCNQ1 or KCNQ2. Carnosic acid is also highly selective for KCNQ3/5 over KCNQ2/3 heteromers. Medicinal chemistry, in silico docking, and mutagenesis reveal that carboxylate-guanidinium ionic bonding with an S4-5 linker arginine underlies the KCNQ3 opening proficiency of carnosic acid, the effects of which on KCNQ3/5 suggest unique therapeutic potential and a molecular basis for ancient neurotherapeutic use of rosemary.

DCC
Also flagged:complexwaternitrogen dioxidenitrogen oxidechlorophyllanxiety disorders
Journal Article 2023-06-15 ✓ 5 Snippets Xu J, Liu N, Polemiti E, Garcia-Mondragon L, Tang J, Liu X, Lett T, Yu L, Nöthen MM, Feng J, Yu C, Marquand A, Schumann G, the environMENTAL Consortium.
In-Text Gene Mentions

…18q21.2 at theDCCand TCF4 gene…

…, DCAF5 ,DCC, EXD2 ,…

…= 1.71%) andDCC(EME = 1.51%)…

…the mainly subcorticalDCC, an adhesion…

…1 receptor geneDCCis associated with…

Show Full Abstract

Urban-living individuals are exposed to many environmental factors that may combine and interact to influence mental health. While individual factors of an urban environment have been investigated in isolation, no attempt has been made to model how complex, real-life exposure to living in the city relates to brain and mental health, and how this is moderated by genetic factors. Using the data of 156,075 participants from the UK Biobank, we carried out sparse canonical correlation analyses to investigate the relationships between urban environments and psychiatric symptoms. We found an environmental profile of social deprivation, air pollution, street network and urban land-use density that was positively correlated with an affective symptom group (r = 0.22, P<sub>perm</sub> < 0.001), mediated by brain volume differences consistent with reward processing, and moderated by genes enriched for stress response, including CRHR1, explaining 2.01% of the variance in brain volume differences. Protective factors such as greenness and generous destination accessibility were negatively correlated with an anxiety symptom group (r = 0.10, P<sub>perm</sub> < 0.001), mediated by brain regions necessary for emotion regulation and moderated by EXD3, explaining 1.65% of the variance. The third urban environmental profile was correlated with an emotional instability symptom group (r = 0.03, P<sub>perm</sub> < 0.001). Our findings suggest that different environmental profiles of urban living may influence specific psychiatric symptom groups through distinct neurobiological pathways.

Also flagged:SALL1bindingSpalt-like transcription factor 1organogenesisSMAD4gene expression
Journal Article 2023-06-15 No Snippets Fixsen BR, Han CZ, Zhou Y, Spann NJ, Saisan P, Shen Z, Balak C, Sakai M, Cobo I, Holtman IR, Warden AS, Ramirez G, Collier JG, Pasillas MP, Yu M, Hu R, Li B, Belhocine S, Gosselin D, Coufal NG, Ren B, Glass CK.
Show Full Abstract

Spalt-like transcription factor 1 (SALL1) is a critical regulator of organogenesis and microglia identity. Here we demonstrate that disruption of a conserved microglia-specific super-enhancer interacting with the Sall1 promoter results in complete and specific loss of Sall1 expression in microglia. By determining the genomic binding sites of SALL1 and leveraging Sall1 enhancer knockout mice, we provide evidence for functional interactions between SALL1 and SMAD4 required for microglia-specific gene expression. SMAD4 binds directly to the Sall1 super-enhancer and is required for Sall1 expression, consistent with an evolutionarily conserved requirement of the TGFβ and SMAD homologs Dpp and Mad for cell-specific expression of Spalt in the Drosophila wing. Unexpectedly, SALL1 in turn promotes binding and function of SMAD4 at microglia-specific enhancers while simultaneously suppressing binding of SMAD4 to enhancers of genes that become inappropriately activated in enhancer knockout microglia, thereby enforcing microglia-specific functions of the TGFβ-SMAD signaling axis.

HFE
Also flagged:chronic hepatitis Btenofovir disoproxil fumarateliver fibrosisChronic hepatitisvirusHBV) infection
Journal Article 2023-06-15 ✓ 1 Snippet Cho H, Lee YB, Ha Y, Chon YE, Kim MN, Lee JH, Park H, Rim KS, Hwang SG.
In-Text Gene Mentions

…of autoimmune hepatitis,hemochromatosis, or Wilson’s disease;…

Show Full Abstract

<h4>Background/aims</h4>Regression of liver fibrosis during antiviral therapy in chronic hepatitis B (CHB) patients has been demonstrated, but data on the influence of long-term treatment with tenofovir disoproxil fumarate (TDF) on liver stiffness (LS) measured by transient elastography are scarce. We aimed to investigate the changes in LS values during the 144-week TDF therapy in treatment-naïve CHB patients.<h4>Methods</h4>This prospective observational study was conducted from April 2015 to July 2020 at CHA Bundang Medical Center. Laboratory tests and LS measurements were performed at baseline and repeated at weeks 12, 24, 48, 96, and 144. A significant decline in LS was defined as ≥ 30% decrease in LS value at week 96 from baseline.<h4>Results</h4>A total of 48 treatment-naïve CHB patients initiating TDF therapy were screened, and 36 patients were included in the final analysis (median age, 46 [interquartile range, 34.5-55.8] years; 19 men [52.8%]). During TDF therapy, the median LS values decreased from 13.8 kPa at baseline to 8.7 kPa, 6.5 kPa, and 6.4 kPa at weeks 48, 96, and 144, respectively (all P < 0.001). At week 96, virological and biochemical responses were achieved in 34 (94.4%) patients and 20 (76.9%) patients, respectively. Moreover, 21 of 36 (58.3%) patients showed a significant decline in LS value. A higher baseline LS value was a single independent predictor for the reduction in LS value at week 96 from baseline (P < 0.001).<h4>Conclusions</h4>During the 144-week TDF therapy, LS values declined significantly in treatment-naïve CHB patients.

PEBP1
Also flagged:lung diseasesmineralpneumoconiosislipidmetabolism disorderrespiratory diseases
Journal Article 2023-06-15 ✓ 2 Snippets Shi L, Dai X, Yan F, Lin Y, Lin L, Zhang Y, Zeng Y, Chen X.
In-Text Gene Mentions

…PE binding toPebp1enhanced the interaction…

…the interaction ofPebp1with IKKα/β and…

Show Full Abstract

<h4>Background</h4>Pneumoconiosis is a group of occupational lung diseases caused by the inhalation of mineral dust in the lungs, leading to lung dysfunction. Patients with pneumoconiosis are usually accompanied by weight loss, which suggests a lipid metabolism disorder. Recent progress in lipidomics uncovered detailed lipid profiles that play important roles in respiratory diseases, such as asthma, lung cancer and lung injury. The purpose of this study was to shed light on the different expression of lipidome between pneumoconiosis and healthy, hoping to bring new ideas for the diagnosis and treatment of pneumoconiosis.<h4>Methodology</h4>This non-matching case-control study was performed among 96 subjects (48 outpatients with male pneumoconiosis and 48 healthy volunteers), data of clinical phenotypes were recorded, and plasma biochemistry (lipidomic profiles) was tested for both pneumoconiosis patients and healthy controls. A total of 426 species in 11 lipid classes were analyzed by high-performance liquid chromatography coupled with triple quadrupole tandem mass spectrometry (HPLC-QqQ-MS) for the cases and controls. We also analyzed the correlation of lipid profiles with clinical phenomes from pneumoconiosis patients by expression quantitative trait locus (eQTL) model to evaluate trans-nodules between lipidomic profiles and clinical phenomes. All visually re-checked data were analyzed using appropriate statistical tools (t-test or one-way ANOVA test) on SPSS.<h4>Results</h4>Compared with healthy people, 26 significantly increased (> 1.5-fold) and 30 decreased lipid elements (< 2/threefold) in patients with pneumoconiosis were identified (P values all < 0.05). The majority of those elevated lipid elements were phosphatidylethanolamines (PEs), and the minority were free fatty acids (FFAs), while phosphatidylcholines (PCs) and lysophosphatidylcholines (lysoPCs) declined in pneumoconiosis. Clinical trans-omics analyses demonstrated that phenomes in pneumoconiosis connections with multiple lipids, which showed that pH, lung function, mediastinal lymph node calcification, and complication were highly correlated with lipid elements. Furthermore, up-regulated PE was corresponded to pH, smoking history and mediastinal lymph node calcification. PC was corresponded to dust exposure history, BMI and mediastinal lymph node calcification.<h4>Conclusion</h4>We found altered lipid panels between male pneumoconiosis patients and healthy people by qualitatively and quantitatively measured plasma lipidomic profiles. The trans-omic analysis between clinical phenomes and lipidomes might have the potential to uncover the heterogeneity of lipid metabolism of pneumoconiosis patients and to screen out clinically significant phenome-based lipid panels.

Also flagged:Morphinehypersensitivitytoll-like receptor-4metastatic breast cancerbreast cancerTLR4
Journal Article 2023-06-15 No Snippets Thompson AL, Grenald SA, Ciccone HA, Mohty D, Smith AF, Coleman DL, Bahramnejad E, De Leon E, Kasper-Conella L, Uhrlab JL, Margolis DS, Salvemini D, Largent-Milnes TM, Vanderah TW.
Show Full Abstract

<h4>Abstract</h4>The propensity for breast cancer to metastasize to bone is coupled to the most common complaint among breast cancer patients: bone pain. Classically, this type of pain is treated using escalating doses of opioids, which lack long-term efficacy due to analgesic tolerance, opioid-induced hypersensitivity, and have recently been linked to enhanced bone loss. To date, the molecular mechanisms underlying these adverse effects have not been fully explored. Using an immunocompetent murine model of metastatic breast cancer, we demonstrated that sustained morphine infusion induced a significant increase in osteolysis and hypersensitivity within the ipsilateral femur through the activation of toll-like receptor-4 (TLR4). Pharmacological blockade with TAK242 (resatorvid) as well as the use of a TLR4 genetic knockout ameliorated the chronic morphine-induced osteolysis and hypersensitivity. Genetic MOR knockout did not mitigate chronic morphine hypersensitivity or bone loss. In vitro studies using RAW264.7 murine macrophages precursor cells demonstrated morphine-enhanced osteoclastogenesis that was inhibited by the TLR4 antagonist. Together, these data indicate that morphine induces osteolysis and hypersensitivity that are mediated, in part, through a TLR4 receptor mechanism.

OLFM4
Also flagged:Glutaminegastrointestinal diseasesWNTepithelial differentiationgastroenteritisnecrotizing enterocolitis
Journal Article 2023-06-15 ✓ 5 Snippets Tian J, Li Y, Bao X, Yang F, Tang X, Jiang Q, Yang C, Yin Y, Yao K.
In-Text Gene Mentions

…LGR5 and OLFACTOMEDIN-4 (OLFM4, an LGR5 co-expressed…

…weaning-induced decrease ofOLFM4-positive ISCs ( Figures…

…integrated density ofOLFM4-positive fluorescence in low-…

…protein level ofOLFM4induced by early…

…Next, we performedOLFM4immunostaining to compare…

Show Full Abstract

Early weaning usually causes small intestine epithelial development abnormality, increasing the risk of gastrointestinal diseases. Glutamine (Gln), enriching in plasma and milk, is widely reported to benefit intestinal health. However, whether Gln affects intestinal stem cell (ISC) activity in response to early weaning is unclear. Here, both the early weaning mice and intestinal organoids were used to study the role of Gln in regulating ISC activities. Results showed that Gln ameliorated early weaning-induced epithelial atrophy and augmented the ISC-mediated epithelial regeneration. Gln deprivation disabled ISC-mediated epithelial regeneration and crypt fission in vitro. Mechanistically, Gln augmented WNT signaling in a dose-dependent manner to regulate ISC activity, while WNT signaling blockage abolished the effects of Gln on ISCs. Together, Gln accelerates stem cell-mediated intestinal epithelial development associated with the augmentation of WNT signaling, which provides novel insights into the mechanism by which Gln promotes intestinal health.

PRDX6
Also flagged:epithelial-mesenchymal transitionage-related macular degenerationpathogenesisretinopathiesoxygenretinal degeneration
Journal Article 2023-06-15 ✓ 1 Snippet Yang YC, Chien Y, Yarmishyn AA, Lim LY, Tsai HY, Kuo WC, Tsai PH, Yang SH, Hong SI, Chen SJ, Hwang DK, Yang YP, Chiou SH.
In-Text Gene Mentions

…of peroxiredoxin 6 (PRDX6) [74] , an…

Show Full Abstract

<h4>Introduction</h4>Epithelial-mesenchymal transition (EMT) of retinal pigment epithelial (RPE) cells is related to the pathogenesis of various retinopathies including age-related macular degeneration (AMD). Oxidative stress is the major factor that induces degeneration of RPE cells associated with the etiology of AMD.<h4>Objectives</h4>Sodium iodate (NaIO<sub>3</sub>) generates intracellular reactive oxygen species (ROS) and is widely used to establish a model of AMD due to the selective induction of retinal degeneration. This study was performed to clarify the effects of multiple NaIO<sub>3</sub>-stimulated signaling pathways on EMT in RPE cells.<h4>Methods</h4>The EMT characteristics in NaIO<sub>3</sub>-treated human ARPE-19 cells and RPE cells of the mouse eyes were analyzed. Multiple oxidative stress-induced modulators were investigated and the effects of pre-treatment with Ca<sup>2+</sup> chelator, extracellular signal-related kinase (ERK) inhibitor, or epidermal growth factor receptor (EGFR) inhibitor on NaIO<sub>3</sub>-induced EMT were determined. The efficacy of post-treatment with ERK inhibitor on the regulation of NaIO<sub>3</sub>-induced signaling pathways was dissected and its role in retinal thickness and morphology was evaluated by using histological cross-sections and spectral domain optical coherence tomography.<h4>Results</h4>We found that NaIO<sub>3</sub> induced EMT in ARPE-19 cells and in RPE cells of the mouse eyes. The intracellular ROS, Ca<sup>2+</sup>, endoplasmic reticulum (ER) stress marker, phospho-ERK, and phospho-EGFR were increased in NaIO<sub>3</sub>-stimulated cells. Our results showed that pre-treatment with Ca<sup>2+</sup> chelator, ERK inhibitor, or EGFR inhibitor decreased NaIO<sub>3</sub>-induced EMT, interestingly, the inhibition of ERK displayed the most prominent effect. Furthermore, post-treatment with FR180204, a specific ERK inhibitor, reduced intracellular ROS and Ca<sup>2+</sup> levels, downregulated phospho-EGFR and ER stress marker, attenuated EMT of RPE cells, and prevented structural disorder of the retina induced by NaIO<sub>3</sub>.<h4>Conclusions</h4>ERK is a crucial regulator of multiple NaIO<sub>3</sub>-induced signaling pathways that coordinate EMT program in RPE cells. Inhibition of ERK may be a potential therapeutic strategy for the treatment of AMD.

VRK2
Also flagged:Urolithin Aneurodegenerative diseasecognitive impairmentADellagic acidellagitannin
Journal Article 2023-06-15 ✓ 1 Snippet Tu HJ, Su CJ, Peng CS, Lin TE, HuangFu WC, Hsu KC, Hwang TL, Pan SL.
In-Text Gene Mentions

…MKNK1, STK3 andVRK2.…

Show Full Abstract

Alzheimer's disease (AD) is a devastating neurodegenerative disease with more than 50 million people suffer from it. Unfortunately, none of the currently available drugs is able to improve cognitive impairment in AD patients. Urolithin A (UA) is a metabolite obtained from ellagic acid and ellagitannin through the intestinal flora, and it has antioxidant and anti-inflammatory properties. Previous reports found that UA had neuroprotective effects in an AD animal model, but the detailed mechanism still needs to be elucidated. In this study, we performed kinase-profiling to show that dual-specific tyrosine phosphorylation-regulated kinase 1A (DYRK1A) is the main target of UA. Studies showed that the level of DYRK1A in AD patients' brains was higher than that of healthy people, and it was closely related to the occurrence and progression of AD. Our results revealed that UA significantly reduced the activity of DYRK1A, which led to de-phosphorylation of tau and further stabilized microtubule polymerization. UA also provided neuroprotective effects by inhibiting the production of inflammatory cytokines caused by Aβ. We further showed that UA significantly improved memory impairment in an AD-like mouse model. In summary, our results indicate that UA is a DYRK1A inhibitor that may provide therapeutic advantages for AD patients.

Also flagged:Calcium Sulfatedegradationcell proliferationalizarin redmineralizationextracellular
Journal Article 2023-06-15 No Snippets Liu J, Wang Y, Liang Y, Zhu S, Jiang H, Wu S, Ge X, Li Z.
Show Full Abstract

Currently, platelet-rich plasma (PRP) is an attractive additive for bone repair materials. PRP could enhance the osteoconductive and osteoinductive of bone cement, as well as modulate the degradation rate of calcium sulfate hemihydrate (CSH). The focus of this study was to investigate the effect of different PRP ratios (P1: 20 vol%, P2: 40 vol%, and P3: 60 vol%) on the chemical properties and biological activity of bone cement. The injectability and compressive strength of the experimental group were significantly higher than those of the control. On the other hand, the addition of PRP decreased the crystal size of CSH and prolonged the degradation time. More importantly, the cell proliferation of L929 and MC3T3-E1 cells was promoted. Furthermore, qRT-PCR, alizarin red staining, and western blot analyses showed that the expressions of osteocalcin (<i>OCN</i>) and Runt-related transcription factor 2 (<i>Runx2</i>) genes and <i>β</i>-catenin protein were up-regulated, and mineralization of extracellular matrix was enhanced. Overall, this study provided insight into how to improve the biological activity of bone cement through PRP incorporation.

Also flagged:colorectal cancerhereditary cancer syndromesLynch syndromeobesityinflammatory bowel diseaseEarly-onset colorectal cancer
Journal Article 2023-06-15 No Snippets Ullah F, Pillai AB, Omar N, Dima D, Harichand S.
Show Full Abstract

Over the past decade, the incidence of colorectal cancer has increased in individuals under the age of 50 years. Meanwhile, the incidence has gradually decreased in the older population. As described herein, we reviewed the available literature to summarize the current landscape of early-onset colorectal cancer, including risk factors, clinicopathological presentation, genetic makeup of patients, and management. Currently, early-onset colorectal cancer is treated similarly as late-onset colorectal cancer, yet the available literature shows that early-onset colorectal cancer is more aggressive and different, and this remains a significant unmet need. A detailed understanding of early-onset colorectal cancer is needed to identify risk factors for the increased incidence and tailor treatments accordingly.

CSE1L
Also flagged:UbiquitinProteasomecapacitationmetabolismexocytosisfertilization
Journal Article 2023-06-15 ✓ 5 Snippets Zigo M, Kerns K, Sutovsky P.
In-Text Gene Mentions

Like CSE1L, increased expression of PFDN4 was reported in various types of cancerous tumors, such as colorectal cancer [100,101], hepatocellular carcinoma [102], gastric cancer [103], breast cancer [104], or epithelial ovarian cancer [105].

The CSE1L is an exosome/microvesicle membrane protein [96] with multiple roles in apoptosis, cell survival, chromosome assembly, nucleocytoplasmic transport, microvesicle formation, and cancer metastasis [97].

In this regard, CSE1L and PFDN4 could be novel, previously unrecognized cancer-testis antigens, which was partially supported in the case of CSE1L and its role in maintaining cell proliferation and division in seminomas [106].

Even though CSE1L is a proposed component of cAMP/PKA and Ras/ERK signaling pathways in melanoma cells [97] and CDK signaling pathway in spermatogonia and spermatocytes, the surface presence of CSE1L in pig spermatozoa implies a different, unique function in sperm physiology.

…The proteins NIF3L1,CSE1L, NDUFB7, PGLS, PPP4C,…

Show Full Abstract

Sperm capacitation is a complex process endowing biological and biochemical changes to a spermatozoon for a successful encounter with an oocyte. The present study focused on the role of the ubiquitin-proteasome system (UPS) in the remodeling of the sperm surface subproteome. The sperm surface subproteome from non-capacitated and in vitro capacitated (IVC) porcine spermatozoa, with and without proteasomal inhibition, was selectively isolated. The purified sperm surface subproteome was analyzed using high-resolution, quantitative liquid chromatography-mass spectrometry (LC-MS) in four replicates. We identified 1680 HUGO annotated proteins, out of which we found 91 to be at least 1.5× less abundant (<i>p</i> < 0.05) and 141 to be at least 1.5× more abundant (<i>p</i> < 0.05) on the surface of IVC spermatozoa. These proteins were associated with sperm capacitation, hyperactivation, metabolism, acrosomal exocytosis, and fertilization. Abundances of 14 proteins were found to be significantly different (<i>p</i> < 0.05), exceeding a 1.5-fold abundance between the proteasomally inhibited (100 µM MG132) and vehicle control (0.2% ethanol) groups. The proteins NIF3L1, CSE1L, NDUFB7, PGLS, PPP4C, STK39, and TPRG1L were found to be more abundant; while BPHL, GSN, GSPT1, PFDN4, STYXL1, TIMM10, and UBXN4 were found to be less abundant in proteasomally inhibited IVC spermatozoa. Despite the UPS having a narrow range of targets, it modulated sperm metabolism and binding by regulating susceptible surface proteins. Changes in CSE1L, PFDN4, and STK39 during in vitro capacitation were confirmed using immunocytochemistry, image-based flow cytometry, and Western blotting. The results confirmed the active participation of the UPS in the extensive sperm surface proteome remodeling that occurs during boar sperm capacitation. This work will help us to identify new pharmacological mechanisms to positively or negatively modulate sperm fertilizing ability in food animals and humans.

PEBP1
Also flagged:KinasePancreatic CancercancerPancreatic ductal adenocarcinomaPDACpancreatic cancers
Journal Article 2023-06-15 ✓ 3 Snippets Kim YN, Patil K, Ma J, Dufek GA, Pai SB.
In-Text Gene Mentions

PEBP1 has been reported in cancers of various tissue origins [58].

…hanolamine-binding protein 1 (PEBP1), also termed RKIP,…

PEBP1has been reported…

Show Full Abstract

Pancreatic cancer is one of the most aggressive forms of cancer and is the seventh leading cause of cancer deaths worldwide. Pancreatic ductal adenocarcinoma (PDAC) accounts for over 90% of pancreatic cancers. Most pancreatic cancers are recalcitrant to radiation, chemotherapy, and immunotherapy, highlighting the urgent need for novel treatment options for this deadly disease. To this end, we screened a library of kinase inhibitors in the PDAC cell lines PANC-1 and BxPC-3 and identified two highly potent molecules: Aurora kinase inhibitor AT 9283 (AT) and EGFR kinase inhibitor WZ 3146 (WZ). Both AT and WZ exhibited a dose-dependent inhibition of viability in both cell lines. Thus, we conducted an in-depth multilevel (cellular, molecular, and proteomic) analysis with AT and WZ in PANC-1 cells, which harbor KRAS mutation and exhibit quasimesenchymal properties representing pancreatic cancer cells as having intrinsic chemoresistance and the potential for differential response to therapy. Elucidation of the molecular mechanism of action of AT and WZ revealed an impact on the programmed cell death pathway with an increase in apoptotic, multicaspase, and caspase 3/7 positive cells. Additionally, the key survival molecule Bcl-2 was impacted. Moreover, cell cycle arrest was observed with both kinase inhibitors. Additionally, an increase in superoxide radicals was observed in the AT-treated group. Importantly, proteomic profiling revealed differentially regulated key entities with multifaceted effects, which could have a deleterious impact on PDAC. These findings suggest potential targets for efficacious treatment, including a possible increase in the efficacy of immunotherapy using PD-L1 antibody due to the upregulation of lactoferrin and radixin. Furthermore, combination therapy outcomes with gemcitabine/platinum drugs may also be more effective due to an increase in the NADH dehydrogenase complex. Notably, protein-protein interaction analysis (STRING) revealed possible enrichment of reactome pathway entities. Additionally, novel therapy options, such as vimentin-antibody--drug conjugates, could be explored. Therefore, future studies with the two kinases as monotherapy/combination therapy are warranted.

DCC
Also flagged:Head and Neck Cancertumorscanceroral cancerhypermethylationfolate
Journal Article 2023-06-15 ✓ 1 Snippet Lai TY, Ko YC, Chen YL, Lin SF.
In-Text Gene Mentions

Notably, in HCC1954 cells, the affected genes include tumor suppressors, e.g., the DNA repair gene MGMT, the deleted colorectal carcinoma gene DCC, and the deleted liver cancer gene DLC1 [36].

Show Full Abstract

Identifying and treating tumors early is the key to secondary prevention in cancer control. At present, prevention of oral cancer is still challenging because the molecular drivers responsible for malignant transformation of the 11 clinically defined oral potentially malignant disorders are still unknown. In this review, we focused on studies that elucidate the epigenetic alterations demarcating malignant and nonmalignant epigenomes and prioritized findings from clinical samples. Head and neck included, the genomes of many cancer types are largely hypomethylated and accompanied by focal hypermethylation on certain specific regions. We revisited prior studies that demonstrated that sufficient uptake of folate, the primary dietary methyl donor, is associated with oral cancer reduction. As epigenetically driven phenotypic plasticity, a newly recognized hallmark of cancer, has been linked to tumor initiation, cell fate determination, and drug resistance, we discussed prior findings that might be associated with this hallmark, including gene clusters (11q13.3, 19q13.43, 20q11.2, 22q11-13) with great potential for oral cancer biomarkers, and successful examples in screening early-stage nasopharyngeal carcinoma. Although one-size-fits-all approaches have been shown to be ineffective in most cancer therapies, the rapid development of epigenome sequencing methods raises the possibility that this nonmutagenic approach may be an exception. Only time will tell.

PRDX6
Also flagged:Type 2 Diabetesinsulin resistancesecretionGene expressionbindingGSTA5
Journal Article 2023-06-15 ✓ 5 Snippets Choi Y, Kwon HK, Park S.
In-Text Gene Mentions

The present study also revealed significant associations between T2DM and genetic variants in PRDX6, GPX1, GPX3, GSTA5, GCLC, GSR, and GGT1, all of which are critical components involved in glutathione metabolism within the antioxidant system.

…, peroxiredoxin-6 (PRDX6) , glutamate–cysteine ligase…

…were peroxiredoxin 6 (PRDX6_rs150751487) , GPX1_rs1050614…

…system, such asPRDX6_rs150751487, GPX1 _rs1050614,…

…genetic variants inPRDX6, GPX1 ,…

Show Full Abstract

Oxidative stress is associated with insulin resistance and secretion, and antioxidant systems are essential for preventing and managing type 2 diabetes (T2DM). This study aimed to explore the polygenic variants linked to oxidative stress and the antioxidant system among those associated with T2DM and the interaction of their polygenic risk scores (PRSs) with lifestyle factors in a large hospital-based cohort (<i>n</i> = 58,701). Genotyping, anthropometric, biochemical, and dietary assessments were conducted for all participants with an average body mass index of 23.9 kg/m<sup>2</sup>. Genetic variants associated with T2DM were searched through genome-wide association studies in participants with T2DM (<i>n</i> = 5383) and without T2DM (<i>n</i> = 53,318). The Gene Ontology database was searched for the antioxidant systems and oxidative stress-related genes among the genetic variants associated with T2DM risk, and the PRS was generated by summing the risk alleles of selected ones. Gene expression according to the genetic variant alleles was determined on the FUMA website. Food components with low binding energy to the GSTA5 protein generated from the wildtype and mutated <i>GSTA5</i>_<i>rs7739421</i> (missense mutation) genes were selected using in silico analysis. Glutathione metabolism-related genes, including glutathione peroxidase (<i>GPX)1</i> and <i>GPX3</i>, glutathione disulfide reductase (<i>GSR)</i>, peroxiredoxin-6 (<i>PRDX6)</i>, glutamate-cysteine ligase catalytic subunit (<i>GCLC)</i>, glutathione S-transferase alpha-5 (<i>GSTA5)</i>, and gamma-glutamyltransferase-1 (<i>GGT1</i>), were predominantly selected with a relevance score of >7. The PRS related to the antioxidant system was positively associated with T2DM (ORs = 1.423, 95% CI = 1.22-1.66). The active site of the GASTA proteins having valine or leucine at 55 due to the missense mutation (<i>rs7739421)</i> had a low binding energy (<-10 kcal/mol) similarly or differently to some flavonoids and anthocyanins. The PRS interacted with the intake of bioactive components (specifically dietary antioxidants, vitamin C, vitamin D, and coffee) and smoking status (<i>p</i> < 0.05). In conclusion, individuals with a higher PRS related to the antioxidant system may have an increased risk of T2DM, and there is a potential indication that exogenous antioxidant intake may alleviate this risk, providing insights for personalized strategies in T2DM prevention.

Also flagged:Chromosomechromosomesbehaviouraleye degenerationsecretedcalcium-binding phosphoprotein
Journal Article 2023-06-15 No Snippets Wu RX, Miao BB, Han FY, Niu SF, Liang YS, Liang ZB, Wang QH.
Show Full Abstract

Savalani hairtail <i>Lepturacanthus savala</i> is a widely distributed fish along the Indo-Western Pacific coast, and contributes substantially to trichiurid fishery resources worldwide. In this study, the first chromosome-level genome assembly of <i>L. savala</i> was obtained by PacBio SMRT-Seq, Illumina HiSeq, and Hi-C technologies. The final assembled <i>L. savala</i> genome was 790.02 Mb with contig N50 and scaffold N50 values of 19.01 Mb and 32.77 Mb, respectively. The assembled sequences were anchored to 24 chromosomes by using Hi-C data. Combined with RNA sequencing data, 23,625 protein-coding genes were predicted, of which 96.0% were successfully annotated. In total, 67 gene family expansions and 93 gene family contractions were detected in the <i>L. savala</i> genome. Additionally, 1825 positively selected genes were identified. Based on a comparative genomic analysis, we screened a number of candidate genes associated with the specific morphology, behaviour-related immune system, and DNA repair mechanisms in <i>L. savala</i>. Our results preliminarily revealed mechanisms underlying the special morphological and behavioural characteristics of <i>L. savala</i> from a genomic perspective. Furthermore, this study provides valuable reference data for subsequent molecular ecology studies of <i>L. savala</i> and whole-genome analyses of other trichiurid fishes.

Also flagged:endocytosismembraneslocalizationNucleic Acidsmembranevesicles
Journal Article 2023-06-15 No Snippets Timofeeva AM, Paramonik AP, Sedykh SS, Nevinsky GA.
Show Full Abstract

Exosomes are nanovesicles 40-120 nm in diameter secreted by almost all cell types and providing humoral intercellular interactions. Given the natural origin and high biocompatibility, the potential for loading various anticancer molecules and therapeutic nucleic acids inside, and the surface modification possibility for targeted delivery, exosomes are considered to be a promising means of delivery to cell cultures and experimental animal organisms. Milk is a unique natural source of exosomes available in semi-preparative and preparative quantities. Milk exosomes are highly resistant to the harsh conditions of the gastrointestinal tract. In vitro studies have demonstrated that milk exosomes have an affinity to epithelial cells, are digested by cells by endocytosis mechanism, and can be used for oral delivery. With milk exosome membranes containing hydrophilic and hydrophobic components, exosomes can be loaded with hydrophilic and lipophilic drugs. This review covers a number of scalable protocols for isolating and purifying exosomes from human, cow, and horse milk. Additionally, it considers passive and active methods for drug loading into exosomes, as well as methods for modifying and functionalizing the surface of milk exosomes with specific molecules for more efficient and specific delivery to target cells. In addition, the review considers various approaches to visualize exosomes and determine cellular localization and bio-distribution of loaded drug molecules in tissues. In conclusion, we outline new challenges for studying milk exosomes, a new generation of targeted delivery agents.

Also flagged:behaviouralorganizationorganisationsynthesisACP
Journal Article 2023-06-15 No Snippets Nguyen HTT, Nguyen HTT, Nguyen CV.
Show Full Abstract

This study examines the factors that facilitate or impede the voluntary adoption of International Financial Reporting Standards (IFRS) in an emerging market. We propose practical solutions that are necessary for successful IFRS implementation in enterprises. To collect research data, we surveyed 350 enterprises in Vietnam using a non-probability convenience sampling method. Using qualitative research methods (through case studies and expert surveys) combined with quantitative and structural equation modelling (SEM), this study analyses the causal relationship between the influencing factors and enterprises' willingness to apply IFRS voluntarily. Evidence indicates that compliance with accounting regulations and principles, qualifications and experience of accountants, accounting regimes and government circulars, capabilities and perceptions of managers, and the benefits of IFRS adoption positively impact the application of IFRS. In addition, the factors of firm size and audit activities have a positive effect on promoting the willingness of enterprises to apply IFRS, while tax pressure and accounting psychology negatively affect the application of IFRS. By contrast, tax pressure and accounting psychology harm the application of IFRS. The study has limitations regarding the sample size, geographical scope, and sampling method. Even so, together with other studies drawn in alternative contexts, our findings are helpful to account for policymakers, regulators and businesses in different emerging countries to adopt IFRS in their countries successfully. The new insights gained in this study can help overcome the limitations of the conventional IFRS approach and design appropriate policies and roadmaps to improve the applicability of IFRS. The present study contributes significantly to the theory and practice at the end of the preparatory phase and the beginning of the voluntary phase of IFRS adoption in Vietnam. This is also the period where Vietnamese policymakers have announced their strategic plan for full IFRS adoption by 2025.

Also flagged:neurodegenerative diseasesNeurodegenerative diseasealpha-synucleintauextracellularvesicles
Journal Article 2023-06-15 No Snippets Padmanabhan S, Manjithaya R.
Show Full Abstract

Neurodegenerative disease-causing proteins such as alpha-synuclein, tau, and huntingtin are known to traverse across cells via exosomes, extracellular vesicles and tunneling nanotubes (TNTs). There seems to be good synergy between exosomes and TNTs in intercellular communication. Interestingly, many of the known major neurodegenerative proteins/proteolytic products are leaderless and are also reported to be secreted out of the cell via unconventional protein secretion. Such classes contain intrinsically disordered proteins and regions (IDRs) within them. The dynamic behavior of these proteins is due to their heterogenic conformations that is exhibited owing to various factors that occur inside the cells. The amino acid sequence along with the chemical modifications has implications on the functional roles of IDRs inside the cells. Proteins that form aggregates resulting in neurodegeneration become resistant to degradation by the processes of autophagy and proteasome system thus leading to Tunneling nanotubes, TNT formation. The proteins that traverse across TNTs may or may not be dependent on the autophagy machinery. It is not yet clear whether the conformation of the protein plays a crucial role in its transport from one cell to another without getting degraded. Although there is some experimental data, there are many grey areas which need to be revisited. This review provides a different perspective on the structural and functional aspects of these leaderless proteins that get secreted outside the cell. In this review, attention has been focused on the characteristic features that lead to aggregation of leaderless secretory proteins (from structural-functional aspect) with special emphasis on TNTs.

Also flagged:Platelet formationhemostasiscalciumphospholipidcollagencytoskeleton
Journal Article 2023-06-15 No Snippets Tang L, Liu C, Rosenberger P.
Show Full Abstract

Platelets are anucleate blood cells derived from megakaryocytes. They link the fundamental functions of hemostasis, inflammation and host defense. They undergo intracellular calcium flux, negatively charged phospholipid translocation, granule release and shape change to adhere to collagen, fibrin and each other, forming aggregates, which are key to several of their functions. In all these dynamic processes, the cytoskeleton plays a crucial role. Neuronal guidance proteins (NGPs) form attractive and repulsive signals to drive neuronal axon navigation and thus refine neuronal circuits. By binding to their target receptors, NGPs rearrange the cytoskeleton to mediate neuron motility. In recent decades, evidence has indicated that NGPs perform important immunomodulatory functions and influence platelet function. In this review, we highlight the roles of NGPs in platelet formation and activation.

MRPL39
Also flagged:gene expressionimmune responsesjunction adhesion moleculeenteric diseasenecrotic enteritisabomasal disease
Journal Article 2023-06-15 ✓ 1 Snippet Kim HW, Kim NK, Thompson J, de Jesus M, Rehberger J, Rehberger T, Smith AH, Mackie RI.
In-Text Gene Mentions

…CMTM6, ERC1, andMRPL39were used as…

Show Full Abstract

Understanding the effects of dosing non-toxigenic Clostridia to cows is rare and has received little attention so far. In the present study, a total of eight lactating dairy cows were divided in two groups: control (<i>n</i> = 4) or Clostridia challenged (oral supplementation of five diverse strains of <i>Paraclostridium bifermentans</i>, <i>n</i> = 4). Bacterial communities were analyzed by qPCR and next-generation sequencing (NGS) in the buccal mucosa as well as digesta and mucosal samples of the gastrointestinal (GI) tract from rumen to rectum (10 compartments), as well as fecal samples. Transcriptomic analysis of barrier and immune-related gene expression was performed on rumen, jejunum, and liver samples. We observed increased microbial populations with the Clostridial challenge in the buccal tissues and the proximal GI tract (forestomach), correlating with Clostridial loads in the feed. Otherwise, there were no significant differences in microbial populations (<i>p</i> > 0.05) throughout the distal part of the GI tract. The NGS approach, however, revealed that the Clostridial challenge changed the relative abundance of gut and fecal microbiota. In particular, in the challenge group, no <i>Bifidobacterium</i> was observed in the mucosa-associated microbiota and abundance of Pseudomonadota increased in the feces. These results indicated potential adverse effects of Clostridia to cow health. In general, immune responses to the Clostridial challenge were weak. However, transcriptional analysis revealed the down-regulation of junction adhesion molecule encoding gene (-1.44 of log<sub>2</sub> fold-change), which might impact intestinal permeability.

CDK5RAP1
Also flagged:prolineglutamineosteosarcomaSplicing factormetabolismOS
Journal Article 2023-06-15 ✓ 1 Snippet Mao L, Jiang P, Lei X, Zhang B, Zhong X, Yin Z, Wang Y, Li D, Zhang Y, Zheng Q.
In-Text Gene Mentions

MYC box-dependent interacting protein 1

Show Full Abstract

Splicing factor proline- and glutamine-rich (SFPQ) regulates transcripts in skeletal muscle metabolism and tumorigenesis. As osteosarcoma (OS) is the most common malignant bone tumor characterized by genome instability, such as MYC amplification, this study aimed to investigate the role and mechanism of SFPQ in OS. Expression of SFPQ in OS cell lines and human OS tissues was detected using quantitative real-time PCR, western blot, and fluorescence <i>in situ</i> hybridization (FISH) analyses. The oncogenic role of SFPQ in OS cells and murine xenograft models and the underlying mechanism of SFPQ on the c-Myc signaling pathway were assessed <i>in vitro</i> and <i>in vivo</i>. Results showed that SFPQ expression was upregulated and correlated with poor prognosis in OS patients. SFPQ overexpression promoted the malignant biological behavior of OS cells, while its knockdown markedly reduced the oncogenic function of OS. Additionally, depletion of SFPQ inhibited OS growth and bone destruction in nude mice. SFPQ overexpression induced malignant biological behaviors, which could be rescued by the depletion of c-Myc. These results suggest an oncogenic role of SFPQ in OS, possibly through the c-Myc signaling pathway.

Also flagged:glioblastomaGBMreverse transcriptionpolymeraseGliomasynaptic transmission
Journal Article 2023-06-15 No Snippets Zeng ZM, Chen YY, Wen XC, Geng XC, Zhu YX, Hao LC, Dong ZS, Yang JF, Wang TT, Zhang RB, Sun ZW, Zhang YH, Zheng KB.
Show Full Abstract

<h4>Objectives</h4>To explore the key genes involved in the occurrence and development of glioblastoma (GBM) by analyzing whole-transcriptome sequencing and biologic data from GBM and normal cerebral cortex tissues and to search for important noncoding RNA (ncRNA) molecular markers based on the competitive endogenous RNA (ceRNA) network.<h4>Methods</h4>Ten GBM and normal cerebral cortex tissues were collected for full transcriptome sequencing, screened for differentially expressed (DE) mRNAs, miRNAs, lncRNAs, and circRNAs, and subjected to bioinformatic analysis. We constructed a Protein-Protein Interaction (PPI) network and a circRNA/lncRNA-miRNA-mRNA regulatory network and identified them using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Finally, The Cancer Genome Atlas (TCGA) and Chinese Glioma Genome Atlas (CGGA) databases were used to validate and conduct a survival analysis of the target genes.<h4>Results</h4>A total of 5341 DEmRNAs, 259 DEmiRNAs, 3122 DElncRNAs, and 2135 DEcircRNAs were identified. Enrichment analysis showed that target genes regulated by DEmiRNA, DElncRNA, and DEcircRNA were closely related to chemical synaptic transmission and ion transmembrane transport. A PPI network analysis screened 10 hub genes that directly participate in tumor cell mitosis regulation. In addition, the ceRNA composite network showed that hsa-miR-296-5p and hsa-miR-874-5p were the central nodes of the network, and the reliability of relevant key molecules was successfully verified through RT-qPCR identification and the TCGA database. The CGGA database survival analysis produced 8 DEmRNAs closely related to GBM patient survival prognosis.<h4>Conclusions</h4>This study revealed the important regulatory functions and molecular mechanisms of ncRNA molecules and identified hsa-miR-296-5p and hsa-miR-874-5p as key molecules in the ceRNA network. They may play an important role in GBM pathogenesis, treatment, and prognosis.

PEBP1
Also flagged:cuproptosislung cancerdeathLUADgluconeogenesisMYC
Journal Article 2023-06-15 ✓ 1 Snippet Cui Y, Zhang LJ, Xu YJ, Liu MY.
In-Text Gene Mentions

PEBP1

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is the leading histological subtype of lung cancer worldwide, causing high annual mortality. Tsvetkov et al. recently found a new form of regulated cell death, termed cuproptosis. The prognostic value of cuproptosis-related gene signature in LUAD remains uncertain.<h4>Methods</h4>A training cohort is identified by the TCGA-LUAD dataset, whereas validation cohorts one and two are identified by GSE72094 and GSE68465, respectively. GeneCard and GSEA were used to extract genes related to cuproptosis. Cox regression, Kaplan-Meier regression, and LASSO regression were used to construct a gene signature. The model's applicability was evaluated by Kaplan-Meier estimators, Cox models, ROC, and tAUC across two independent validation cohorts. We examined the model's connections with other forms of regulated cell death. The immunotherapy ability of the signature was demonstrated by applying TMB, immune relevant signatures, and TIDE. The GSEA and immune infiltration analysis offer a better understanding of how the signature functions and the role of immune cells in its prognostic power.<h4>Results</h4>A ten-gene signature was built and demonstrated owning prognostic power by being applied to the validation cohorts. The GSEA uncovered that the unfolded protein response, glycolysis/gluconeogenesis, and MYC were highly related to the gene signature. The ten-gene signature is closely related to related genes of apoptosis, necroptosis, pyroptosis, and ferroptosis. Our signature may have utility in predicting immunotherapy efficacy in LUADs. Mast cells were identified as key players that support the predicting capacity of the ten-gene signature through the immune infiltrating analysis.<h4>Conclusions</h4>The novel ten-gene signature associated with apoptosis in cuproptosis that we obtained may contribute to improved LUAD management strategies and the ability to predict response to LUAD immunotherapy. It is suggested that mast cell infiltration might be related to the prognostic power of this signature.

Also flagged:uric acidammonium aciduratecalcium oxalatepeptidescalcium
Journal Article 2023-06-15 No Snippets Khusid JA, Vasquez A, Sadiq AS, Stockert JA, Gallante B, Yaghoubian A, Shimonov R, Stock A, Atallah W, Kyprianou N, Yang W, Gupta M.
Show Full Abstract

<h4>Introduction</h4>Kidney stone matrix proteins may help explain cellular mechanisms of stone genesis. However, most existing proteomic studies have focused on calcium oxalate stones. Here, we present a comparative proteomic analysis of different kidney stone types.<h4>Methods</h4>Proteins were extracted from the stones of patients undergoing percutaneous nephrolithotomy (PCNL). Approximately 20 μg of protein was digested into tryptic peptides using filter aided sample preparation, followed by liquid chromatography tandem-mass-spectrometry using an EASY-nLC 1200 and Orbitrap Fusion Lumos mass spectrometer. A standard false discovery rate cutoff of 1% was used for protein identification. Stone analysis was used to organize stone samples into similar groups. We selected the top 5% of proteins based on total ion intensities and used DAVID and Ingenuity Pathway Analysis to identify and compare significantly enriched gene ontologies and pathways between groups.<h4>Results</h4>Six specimens were included and organized into the following four groups: 1) mixed uric acid (UA) and calcium-based, 2) pure UA, 3) pure ammonium acid urate (AAU), and 4) pure calcium-based. We identified 2,426 unique proteins (1,310-1,699 per sample), with 11-16 significantly enriched KEGG pathways identified per group and compared via heatmap. Based on number of unique proteins identified, this is the deepest proteomic study of kidney stones to date and the first such study of an AAU stone.<h4>Conclusions</h4>The results indicate that mixed UA and calcium-based kidney stones are more similar to pure UA stones than pure calcium-based stones. AAU stones appear more similar to pure calcium-based stones than UA containing stones and may be related to parasitic infections. Further research with larger cohorts and histopathologic correlation is warranted.

PRDX6ECI2
Also flagged:cardiomyopathymetabolic diseasestype 2 diabetesfatty acidsmitochondrialmetabolism
Journal Article 2023-06-15 ✓ 2 Snippets Mendez Garcia MF, Matsuzaki S, Batushansky A, Newhardt R, Kinter C, Jin Y, Mann SN, Stout MB, Gu H, Chiao YA, Kinter M, Humphries KM.
In-Text Gene Mentions

…and 6 (Prdx1,Prdx6), were elevated in…

…Acca2, Echs1, Eci1,Eci2, and Hadh) in…

Show Full Abstract

A healthy heart adapts to changes in nutrient availability and energy demands. In metabolic diseases like type 2 diabetes (T2D), increased reliance on fatty acids for energy production contributes to mitochondrial dysfunction and cardiomyopathy. A principal regulator of cardiac metabolism is 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFK-2), which is a central driver of glycolysis. We hypothesized that increasing PFK-2 activity could mitigate cardiac dysfunction induced by high-fat diet (HFD). Wild type (WT) and cardiac-specific transgenic mice expressing PFK-2 (Glyco<sup>Hi</sup>) were fed a low fat or HFD for 16 weeks to induce metabolic dysfunction. Metabolic phenotypes were determined by measuring mitochondrial bioenergetics and performing targeted quantitative proteomic and metabolomic analysis. Increasing cardiac PFK-2 had beneficial effects on cardiac and mitochondrial function. Unexpectedly, Glyco<sup>Hi</sup> mice also exhibited sex-dependent systemic protection from HFD, including increased glucose homeostasis. These findings support improving glycolysis via PFK-2 activity can mitigate mitochondrial and functional changes that occur with metabolic syndrome.

TNFSF4
Also flagged:extracellularvesiclesinfectionCXCL10OAS1IL7
Journal Article 2023-06-15 ✓ 1 Snippet Wu Y, Leyk S, Torabi H, Höhn K, Honecker B, Tauler MDPM, Cadar D, Jacobs T, Bruchhaus I, Metwally NG.
In-Text Gene Mentions

…super family 4 [TNFSF4]) ( Figures 5…

Show Full Abstract

<i>Plasmodium falciparum</i>, a human malaria parasite, develops in red blood cells (RBCs), which represent approximately 70% of all human blood cells. Additionally, RBC-derived extracellular vesicles (RBC-EVs) represent 7.3% of the total EV population. The roles of microRNAs (miRNAs) in the consequences of <i>P. falciparum</i> infection are unclear. Here, we analyzed the miRNA profiles of non-infected human RBCs (niRBCs), ring-infected RBCs (riRBCs), and trophozoite-infected RBCs (trRBCs), as well as those of EVs secreted from these cells. Hsa-miR-451a was the most abundant miRNA in all RBC and RBC-EV populations, but its expression level was not affected by <i>P. falciparum</i> infection. Overall, the miRNA profiles of RBCs and their EVs were altered significantly after infection. Most of the differentially expressed miRNAs were shared between RBCs and their EVs. A target prediction analysis of the miRNAs revealed the possible identity of the genes targeted by these miRNAs (CXCL10, OAS1, IL7, and CCL5) involved in immunomodulation.

bioRxiv 2023-06-15 Preprint (No Snippets API) Nickerson KR, Tom I, Cortés E, Abolafia JR, Özkan E, Gonzalez LC, Jaworski A.
Show Full Abstract

Axon pathfinding is controlled by attractive and repulsive molecular cues that activate receptors on the axonal growth cone, but the full repertoire of axon guidance molecules remains unknown. The vertebrate DCC receptor family contains the two closely related members DCC and Neogenin with prominent roles in axon guidance and three additional, divergent members – Punc, Nope, and Protogenin – for which functions in neural circuit formation have remained elusive. We identified a secreted Punc/Nope/Protogenin ligand, WFIKKN2, which guides mouse peripheral sensory axons through Nope-mediated repulsion. In contrast, WFIKKN2 attracts motor axons, but not via Nope. These findings identify WFIKKN2 as a bifunctional axon guidance cue that acts through divergent DCC family members, revealing a remarkable diversity of ligand interactions for this receptor family in nervous system wiring. <h4>One-Sentence Summary</h4> WFIKKN2 is a ligand for the DCC family receptors Punc, Nope, and Prtg that repels sensory axons and attracts motor axons.

bioRxiv 2023-06-15 Preprint (No Snippets API) le Floch AC, Imbert C, Boucherit N, Gorvel L, Fattori S, Orlanducci F, Le Roy A, Archetti L, Crescence L, Panicot-Dubois L, Dubois C, Vey N, Briantais A, Anastasio A, Cano CE, Guittard G, Frechin M, Olive D.
Show Full Abstract

Vγ9Vδ2 T cells are potent but elusive cytotoxic effectors. Means to stimulate their function could lead to powerful new cancer immunotherapies. BTN2A1, a surface protein has recently been shown to bind the Vγ9 chain of the γδ TCR but its precise role in modulating Vγ9Vδ2 T cells functions remains unknown. Here we show that 107G3B5, a monoclonal anti-BTN2A1 agonist antibody, significantly enhances Vγ9Vδ2 T cell functions against hematological or solid cell lines and against primary cells from adult acute lymphoblastic leukemia patients. New computer vision strategies applied to holotomographic microscopy videos show that 107G3B5 enhances the interaction between Vγ9Vδ2 T cells and target cells in a quantitative and qualitative manner. In addition, we provide evidence that Vγ9Vδ2 T cells activated by 107G3B5 induce caspase 3/7 activation in tumor cells, thereby triggering their death by pyroptosis. We thus demonstrate that targeting BTN2A1 with 107G3B5 enhances the Vγ9Vδ2 T cell antitumor response by triggering the pyroptosis-induced immunogenic cell death.

Also flagged:peptidesneuropsychiatric disorderspeptideamino acidlipopolysaccharidedexamethasone
Journal Article 2023-06-14 No Snippets Koss KM, Son T, Li C, Hao Y, Cao J, Churchward MA, Zhang ZJ, Wertheim JA, Derda R, Todd KG.
Show Full Abstract

Microglia are immune-derived cells critical to the development and healthy function of the brain and spinal cord, yet are implicated in the active pathology of many neuropsychiatric disorders. A range of functional phenotypes associated with the healthy brain or disease states has been suggested from in vivo work and were modeled in vitro as surveying, reactive, and primed sub-types of primary rat microglia and mixed microglia/astrocytes. It was hypothesized that the biomolecular profile of these cells undergoes a phenotypical change as well, and these functional phenotypes were explored for potential novel peptide binders using a custom 7 amino acid-presenting M13 phage library (SX7) to identify unique peptides that bind differentially to these respective cell types. Surveying glia were untreated, reactive were induced with a lipopolysaccharide treatment, recovery was modeled with a potent anti-inflammatory treatment dexamethasone, and priming was determined by subsequently challenging the cells with interferon gamma. Microglial function was profiled by determining the secretion of cytokines and nitric oxide, and expression of inducible nitric oxide synthase. After incubation with the SX7 phage library, populations of SX7-positive microglia and/or astrocytes were collected using fluorescence-activated cell sorting, SX7 phage was amplified in Escherichia coli culture, and phage DNA was sequenced via next-generation sequencing. Binding validation was done with synthesized peptides via in-cell westerns. Fifty-eight unique peptides were discovered, and their potential functions were assessed using a basic local alignment search tool. Peptides potentially originated from proteins ranging in function from a variety of supportive glial roles, including synapse support and pruning, to inflammatory incitement including cytokine and interleukin activation, and potential regulation in neurodegenerative and neuropsychiatric disorders.

Also flagged:Chronic Obstructive Pulmonary DiseaseCOPDPulmonary Arterial HypertensionCOVID-19coronavirus disease 2019infections
Journal Article 2023-06-14 No Snippets Tian Z, Cen L.
Show Full Abstract

Both pulmonary arterial hypertension (PAH) and chronic obstructive pulmonary disease (COPD) are risk factors for coronavirus disease 2019 (COVID-19). Patients with lung injury and altered pulmonary vascular anatomy or function are more susceptible to infections. The purpose of the study is to ascertain whether individuals with COPD or PAH are affected synergistically by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Data sources for the construction of a protein-protein interaction (PPI) network and the identification of differentially expressed genes (DEGs) included three RNA-seq datasets from the GEO database (GSE147507, GSE106986, and GSE15197). Then, relationships between miRNAs, common DEGs, and transcription factor (TF) genes were discovered. Functional analysis using Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and other databases, as well as the forecasting of antiviral medications for COPD and PAH patients infected with SARS-CoV-2, were also performed. Eleven common DEGs were found in the three datasets, and their biological functions were primarily enriched in the control of protein modification processes, particularly phosphorylation. Growth factor receptor binding reflects molecular function. KEGG analysis indicated that co-DEGs mainly activate Ras, and PI3K-Akt signaling pathways and act on focal adhesions. NFKB1 interacted with HSA-miR-942 in the TF-miRNA-DEGs synergistic regulatory network. Acetaminophen is considered an effective drug candidate. There are some connections between COPD and PAH and the development of COVID-19. This research could aid in developing COVID-19 vaccines and medication candidates that would work well as COVID-19 therapies.

Also flagged:cystic fibrosisCFneurodegenerative diseasesinfectionchronic pulmonary diseasesNontuberculous mycobacterial infections
Journal Article 2023-06-14 No Snippets Komiya K, Yoshida M, Uchida S, Takikawa S, Yamasue M, Matsumoto T, Morishige Y, Aono A, Hiramatsu K, Yamaoka Y, Nishizono A, Ato M, Kadota JI, Mitarai S.
Show Full Abstract

Nontuberculous mycobacterial infections are generally believed to be independently acquired from the environment. Although person-to-person transmission of nontuberculous mycobacteria, especially Mycobacterium abscessus subsp. <i>massiliense</i>, is a serious concern among individuals with cystic fibrosis (CF), evidence of its spread among patients without CF has never been established. We unexpectedly found a number of M. abscessus subsp. <i>massiliense</i> cases among patients without CF in a hospital. This study aimed to define the mechanism of M. abscessus subsp. <i>massiliense</i> infection among patients who were ventilator dependent and without CF who had progressive neurodegenerative diseases in our long-term care wards from 2014 to 2018 during suspected nosocomial outbreaks. We conducted whole-genome sequencing of M. abscessus subsp. <i>massiliense</i> isolates from 52 patients and environmental samples. Potential opportunities for in-hospital transmission were analyzed using epidemiological data. M. abscessus subsp. <i>massiliense</i> was isolated from one air sample obtained near a patient without CF who was colonized with M. abscessus subsp. <i>massiliense</i> but not from other potential sources. Phylogenetic analysis of the strains from these patients and the environmental isolate revealed clonal expansion of near-identical M. abscessus subsp. <i>massiliense</i> isolates, with the isolates generally differing by fewer than 22 single nucleotide polymorphisms (SNPs). Approximately half of the isolates differed by fewer than nine SNPs, indicating interpatient transmission. Whole-genome sequencing revealed a potential nosocomial outbreak among patients who were ventilator dependent and without CF. <b>IMPORTANCE</b> The isolation of M. abscessus subsp. <i>massiliense</i> from the air, but not from environmental fluid samples, may suggest airborne transmission. This was the first report to demonstrate person-to-person transmission of M. abscessus subsp. <i>massiliense</i>, even among patients without CF. M. abscessus subsp. <i>massiliense</i> may spread among patients who are ventilator dependent without CF through direct or indirect in-hospital transmission. The current infection control measures should address potential transmission among patients without CF, particularly in facilities that treat patients who are ventilator dependent and patients with preexisting chronic pulmonary diseases, such as CF.

Also flagged:amino acidspeptideamino-acidhelicasepeptidesHp
Journal Article 2023-06-14 No Snippets Chojnowski G.
Show Full Abstract

Sequence-register shifts remain one of the most elusive errors in experimental macromolecular models. They may affect model interpretation and propagate to newly built models from older structures. In a recent publication, it was shown that register shifts in cryo-EM models of proteins can be detected using a systematic reassignment of short model fragments to the target sequence. Here, it is shown that the same approach can be used to detect register shifts in crystal structure models using standard, model-bias-corrected electron-density maps (2mF<sub>o</sub> - DF<sub>c</sub>). Five register-shift errors in models deposited in the PDB detected using this method are described in detail.

Also flagged:PDGFRBNF-κBintracranial aneurysmssubarachnoid hemorrhageIAfusiform aneurysms
Journal Article 2023-06-14 No Snippets Shima Y, Sasagawa S, Ota N, Oyama R, Tanaka M, Kubota-Sakashita M, Kawakami H, Kobayashi M, Takubo N, Ozeki AN, Sun X, Kim YJ, Kamatani Y, Matsuda K, Maejima K, Fujita M, Noda K, Kamiyama H, Tanikawa R, Nagane M, Shibahara J, Tanaka T, Rikitake Y, Mataga N, Takahashi S, Kosaki K, Okano H, Furihata T, Nakaki R, Akimitsu N, Wada Y, Ohtsuka T, Kurihara H, Kamiguchi H, Okabe S, Nakafuku M, Kato T, Nakagawa H, Saito N, Nakatomi H.
Show Full Abstract

Intracranial aneurysms (IAs) are a high-risk factor for life-threatening subarachnoid hemorrhage. Their etiology, however, remains mostly unknown at present. We conducted screening for sporadic somatic mutations in 65 IA tissues (54 saccular and 11 fusiform aneurysms) and paired blood samples by whole-exome and targeted deep sequencing. We identified sporadic mutations in multiple signaling genes and examined their impact on downstream signaling pathways and gene expression in vitro and an arterial dilatation model in mice in vivo. We identified 16 genes that were mutated in at least one IA case and found that these mutations were highly prevalent (92%: 60 of 65 IAs) among all IA cases examined. In particular, mutations in six genes (<i>PDGFRB</i>, <i>AHNAK</i>, <i>OBSCN</i>, <i>RBM10</i>, <i>CACNA1E</i>, and <i>OR5P3</i>), many of which are linked to NF-κB signaling, were found in both fusiform and saccular IAs at a high prevalence (43% of all IA cases examined). We found that mutant PDGFRBs constitutively activated ERK and NF-κB signaling, enhanced cell motility, and induced inflammation-related gene expression in vitro. Spatial transcriptomics also detected similar changes in vessels from patients with IA. Furthermore, virus-mediated overexpression of a mutant <i>PDGFRB</i> induced a fusiform-like dilatation of the basilar artery in mice, which was blocked by systemic administration of the tyrosine kinase inhibitor sunitinib. Collectively, this study reveals a high prevalence of somatic mutations in NF-κB signaling pathway-related genes in both fusiform and saccular IAs and opens a new avenue of research for developing pharmacological interventions.

HTT
Also flagged:neurotransmitter receptorstransporterspositronpropofolsevofluraneketamine
Journal Article 2023-06-14 ✓ 3 Snippets Luppi AI, Hansen JY, Adapa R, Carhart-Harris RL, Roseman L, Timmermann C, Golkowski D, Ranft A, Ilg R, Jordan D, Bonhomme V, Vanhaudenhuyse A, Demertzi A, Jaquet O, Bahri MA, Alnagger NLN, Cardone P, Peattie ARD, Manktelow AE, de Araujo DB, Sensi SL, Owen AM, Naci L, Menon DK, Misic B, Stamatakis EA.
In-Text Gene Mentions

Overall, nine neurotransmitter and neuromodulatory systems (“neurotransmitters” for short) are covered: dopamine (D1, D2, and DAT), noradrenaline (NAT), serotonin (5-HT1A, 5-HT1B, 5-HT2A, 5-HT4, 5-HT6, and 5-HTT), acetylcholine (α4β2, M1, and VAChT), glutamate (mGluR5 and NMDA), GABA (GABAA), histamine (H3), cannabinoid (CB1), and opioid (MOR) (Fig. 1, A and B) (23).

These include dopamine (D1, D2, and DAT), noradrenaline (NAT), serotonin (5-HT1A, 5-HT1B, 5-HT2A, 5-HT4, 5-HT6, and 5-HTT), acetylcholine (α4β2, M1, and VAChT), glutamate (mGluR5 and NMDA), GABA (GABAA), histamine (H3), cannabinoid (CB1), and opioid (MOR).

…5-HT4, 5-HT6, and 5-HTT), acetylcholine (α4β2, M1,…

Show Full Abstract

To understand how pharmacological interventions can exert their powerful effects on brain function, we need to understand how they engage the brain's rich neurotransmitter landscape. Here, we bridge microscale molecular chemoarchitecture and pharmacologically induced macroscale functional reorganization, by relating the regional distribution of 19 neurotransmitter receptors and transporters obtained from positron emission tomography, and the regional changes in functional magnetic resonance imaging connectivity induced by 10 different mind-altering drugs: propofol, sevoflurane, ketamine, lysergic acid diethylamide (LSD), psilocybin, N,N-Dimethyltryptamine (DMT), ayahuasca, 3,4-methylenedioxymethamphetamine (MDMA), modafinil, and methylphenidate. Our results reveal a many-to-many mapping between psychoactive drugs' effects on brain function and multiple neurotransmitter systems. The effects of both anesthetics and psychedelics on brain function are organized along hierarchical gradients of brain structure and function. Last, we show that regional co-susceptibility to pharmacological interventions recapitulates co-susceptibility to disorder-induced structural alterations. Collectively, these results highlight rich statistical patterns relating molecular chemoarchitecture and drug-induced reorganization of the brain's functional architecture.

PRDX6
Also flagged:SNHG1hyperglycemiadiabetic nephropathyDNpathogenesisglucose
Journal Article 2023-06-14 ✓ 1 Snippet Fang X, Song J, Chen Y, Zhu S, Tu W, Ke B, Wu L.
In-Text Gene Mentions

…Besides,Prdx6overexpression prevented multi…

Show Full Abstract

<h4>Background</h4>Hyperglycemia accelerates the development of diabetic nephropathy (DN) by inducing renal tubular injury. Nevertheless, the mechanism has not been elaborated fully. Here, the pathogenesis of DN was investigated to seek novel treatment strategies.<h4>Methods</h4>A model of diabetic nephropathy was established in vivo, the levels of blood glucose, urine albumin creatinine ratio (ACR), creatinine, blood urea nitrogen (BUN), malondialdehyde (MDA), glutathione (GSH), and iron were measured. The expression levels were detected by qRT-PCR and Western blotting. H&E, Masson, and PAS staining were used to assess kidney tissue injury. The mitochondria morphology was observed by transmission electron microscopy (TEM). The molecular interaction was analyzed using a dual luciferase reporter assay.<h4>Results</h4>SNHG1 and ACSL4 were increased in kidney tissues of DN mice, but miR-16-5p was decreased. Ferrostatin-1 treatment or SNHG1 knockdown inhibited ferroptosis in high glucose (HG)-treated HK-2 cells and in db/db mice. Subsequently, miR-16-5p was confirmed to be a target for SNHG1, and directly targeted to ACSL4. Overexpression of ACSL4 greatly reversed the protective roles of SNHG1 knockdown in HG-induced ferroptosis of HK-2 cells.<h4>Conclusions</h4>SNHG1 knockdown inhibited ferroptosis via the miR-16-5p/ACSL4 axis to alleviate diabetic nephropathy, which provided some new insights for the novel treatment of diabetic nephropathy.

Also flagged:PolyoxazolinealbuminsynthesisethyloxazolinePSA
Journal Article 2023-06-14 No Snippets Okamoto W, Usui T, Hasegawa M, Kobayashi T, Fujisawa J, Taguchi K, Matsumoto K, Kohno M, Iwazaki M, Shimano S, Nagao I, Toyoda H, Matsumura N, Tomiyasu H, Tochinai R, Komatsu T.
Show Full Abstract

Veterinary medicine has made tremendous progress for domestic dogs, which are irreplaceable family members enriching human life. Nevertheless, no adequate supply system exists for their blood products. This study examined the synthesis, structure, safety, and efficacy of poly(2-ethyl-2-oxazoline)-conjugated porcine serum albumin (POx-PSA) as an artificial plasma expander for dogs. The aqueous POx-PSA solution showed moderately high colloid osmotic pressure and good blood cell compatibility. Actually, lyophilized powder stored for 1 year can regenerate into a homogeneous solution. The circulation half-life of POx-PSA in rats was 2.1-fold longer than that of naked PSA. Rats produced neither anti-PSA IgG antibody nor anti-POx IgG antibody, which suggests excellent immunological stealth properties of POx-PSA. Complete resuscitation of hemorrhagic shock in rats was achieved soon after injection of POx-PSA solution. Serum biochemistry tests and histopathological observations indicated no abnormality in the related organs. When POx-PSA was administered to dogs intravenously, (i) no serum biochemical or hematological alteration was observed, also (ii) no overt deterioration of animal health was observed. These results indicate that POx-PSA has potential as an artificial plasma expander for dogs.

Also flagged:synthesischromatintelomere synthesisRAD51Lengthening of TelomeresPCNA
Journal Article 2023-06-14 No Snippets Zhang T, Rawal Y, Jiang H, Kwon Y, Sung P, Greenberg RA.
Show Full Abstract

Break-induced telomere synthesis (BITS) is a RAD51-independent form of break-induced replication that contributes to alternative lengthening of telomeres<sup>1,2</sup>. This homology-directed repair mechanism utilizes a minimal replisome comprising proliferating cell nuclear antigen (PCNA) and DNA polymerase-δ to execute conservative DNA repair synthesis over many kilobases. How this long-tract homologous recombination repair synthesis responds to complex secondary DNA structures that elicit replication stress remains unclear<sup>3-5</sup>. Moreover, whether the break-induced replisome orchestrates additional DNA repair events to ensure processivity is also unclear. Here we combine synchronous double-strand break induction with proteomics of isolated chromatin segments (PICh) to capture the telomeric DNA damage response proteome during BITS<sup>1,6</sup>. This approach revealed a replication stress-dominated response, highlighted by repair synthesis-driven DNA damage tolerance signalling through RAD18-dependent PCNA ubiquitination. Furthermore, the SNM1A nuclease was identified as the major effector of ubiquitinated PCNA-dependent DNA damage tolerance. SNM1A recognizes the ubiquitin-modified break-induced replisome at damaged telomeres, and this directs its nuclease activity to promote resection. These findings show that break-induced replication orchestrates resection-dependent lesion bypass, with SNM1A nuclease activity serving as a critical effector of ubiquitinated PCNA-directed recombination in mammalian cells.

Also flagged:pathogenesiscoronary artery diseaseatherosclerotic diseasealcoholischemic heart diseasemyocardial ischemia
Journal Article 2023-06-14 No Snippets He S, Fu Y, Li C, Gan X, Wang Y, Zhou H, Jiang R, Zhang Q, Jia Q, Chen X, Jia EZ.
Show Full Abstract

<h4>Background</h4>Recent studies suggest that classical coronary risk factors play a significant role in the pathogenesis of coronary artery disease. Our study aims to explore the interaction of circRNA with classical coronary risk factors in coronary atherosclerotic disease.<h4>Method</h4>Combined analysis of RNA sequencing results from coronary segments and peripheral blood mononuclear cells of patients with coronary atherosclerotic disease was employed to identify critical circRNAs. Competing endogenous RNA networks were constructed by miRanda-3.3a and TargetScan7.0. The relative expression quantity of circRNA in peripheral blood mononuclear cells was determined by qRT-PCR in a large cohort including 256 patients and 49 controls. Spearman's correlation test, receiver operating characteristic curve analysis, multivariable logistic regression analysis, one-way analysis of variance, and crossover analysis were performed.<h4>Results</h4>A total of 34 circRNAs were entered into our study, hsa_circRPRD1A, hsa_circHERPUD2, hsa_circLMBR1, and hsa_circDHTKD1 were selected for further investigation. A circRNA-miRNA-mRNA network is composed of 20 microRNAs and 66 mRNAs. The expression of hsa_circRPRD1A (P = 0.004) and hsa_circHERPUD2 (P = 0.003) were significantly down-regulated in patients with coronary artery disease compared to controls. The area under the curve of hsa_circRPRD1A and hsa_circHERPUD2 is 0.689 and 0.662, respectively. Univariate and multivariable logistic regression analyses identified hsa_circRPRD1A (OR = 0.613, 95%CI:0.380-0.987, P = 0.044) as a protective factor for coronary artery disease. Based on the additive model, crossover analysis demonstrated that there was an antagonistic interaction between the expression of hsa_circHERPUD2 and alcohol consumption in subjects with coronary artery disease.<h4>Conclusion</h4>Our findings imply that hsa_circRPRD1A and hsa_circHERPUD2 could be used as biomarkers for the diagnosis of coronary artery disease and provide epidemiological support for the interactions between circRNAs and classical coronary risk factors.

Also flagged:methylationnucleotidesDNA polymerasedeoxynucleoside triphosphatespolymerasephosphates
Journal Article 2023-06-14 No Snippets Mastrorosa FK, Miller DE, Eichler EE.
Show Full Abstract

Advances in clinical genetic testing, including the introduction of exome sequencing, have uncovered the molecular etiology for many rare and previously unsolved genetic disorders, yet more than half of individuals with a suspected genetic disorder remain unsolved after complete clinical evaluation. A precise genetic diagnosis may guide clinical treatment plans, allow families to make informed care decisions, and permit individuals to participate in N-of-1 trials; thus, there is high interest in developing new tools and techniques to increase the solve rate. Long-read sequencing (LRS) is a promising technology for both increasing the solve rate and decreasing the amount of time required to make a precise genetic diagnosis. Here, we summarize current LRS technologies, give examples of how they have been used to evaluate complex genetic variation and identify missing variants, and discuss future clinical applications of LRS. As costs continue to decrease, LRS will find additional utility in the clinical space fundamentally changing how pathological variants are discovered and eventually acting as a single-data source that can be interrogated multiple times for clinical service.

Also flagged:NF-κBNucleotidebindingand leucine-rich repeat-containing receptorssignal transductionpro-inflammatory cytokines
Journal Article 2023-06-14 No Snippets Morrison HA, Trusiano B, Rowe AJ, Allen IC.
Show Full Abstract

A subset of Nucleotide-binding and leucine-rich repeat-containing receptors (NLRs) function to mitigate overzealous pro-inflammatory signaling produced by NF-κB activation. Under normal pathophysiologic conditions, proper signaling by these NLRs protect against potential autoimmune responses. These NLRs associate with several different proteins within both the canonical and noncanonical NF-κB signaling pathways to either prevent activation of the pathway or inhibit signal transduction. Inhibition of the NF-κB pathways ultimately dampens the production of pro-inflammatory cytokines and activation of other downstream pro-inflammatory signaling mechanisms. Dysregulation of these NLRs, including NLRC3, NLRX1, and NLRP12, have been reported in human inflammatory bowel disease (IBD) and colorectal cancer patients, suggesting the potential of these NLRs as biomarkers for disease detection. Mouse models deficient in these NLRs also have increased susceptibility to colitis and colitis-associated colorectal cancer. While current standard of care for IBD patients and FDA-approved therapeutics function to remedy symptoms associated with IBD and chronic inflammation, these negative regulatory NLRs have yet to be explored as potential drug targets. In this review, we describe a comprehensive overview of recent studies that have evaluated the role of NLRC3, NLRX1, and NLRP12 in IBD and colitis-associated colorectal cancer.

HFE
Also flagged:COVID-19cholangiopathic liver injurycoronavirus disease 2019injury-induced liver injuryDILI
Journal Article 2023-06-14 ✓ 3 Snippets Taj S, Sanekommu H, Johal A, Ravilla J, Imburgio S, Dandu S, Vedire A, Miller B, Hossain M.
In-Text Gene Mentions

…with concern forhemochromatosis(Figure 1 ).…

…variant of theHFEgene, along with…

…the possibility ofhemochromatosis.…

Show Full Abstract

Drug-induced liver injury is a serious adverse drug reaction that can result in acute liver injury or cholestatic injury affecting the bile ducts, known as cholangiopathic liver injury (CLI). Although CLI is not as familiar as the hepatocellular pattern, emerging evidence suggests that it may occur after coronavirus disease 2019 (COVID-19) vaccination. This case report focuses on an 89-year-old woman who developed CLI after receiving the tozinameran COVID-19 vaccine. The main aim of this report was to raise awareness of the possibility of developing CLI after COVID-19 vaccination and to underscore the critical significance of promptly identifying and managing this infrequent but severe side effect.

Also flagged:amino acidspeptidesdegradationbreast cancercancertrypsin
Journal Article 2023-06-14 No Snippets Insuasty-Cepeda DS, Barragán-Cárdenas AC, Ardila-Chantre N, Cárdenas-Martínez KJ, Rincón-Quiñones I, Vargas-Casanova Y, Ochoa-Zarzosa A, Lopez-Meza JE, Parra-Giraldo CM, Ospina-Giraldo LF, Fierro-Medina R, García-Castañeda JE, Rivera-Monroy ZJ.
Show Full Abstract

The dimeric peptide <sup>26</sup>[F]: (RRWQWR<b>F</b>KKLG)<sub>2</sub>-K-Ahx has exhibited a potent cytotoxic effect against breast cancer cell lines, with position 26 (F) being the most relevant for anti-cancer activity. In this investigation, six analogues of the <sup>26</sup>[F] peptide were synthesized in which the 26th position was replaced by non-natural hydrophobic amino acids, finding that some modifications increased the resistance to proteolytic degradation exerted by trypsin or pepsin. Additionally, these modifications increased the cytotoxic effect against breast cancer cells and generated cell death mediated by apoptosis pathways, activating caspases 8 and 9, and did not compromise the integrity of the cytoplasmic membrane. Finally, it was found that the modified peptides have a broad spectrum of action, since they also have a cytotoxic effect against the HeLa human cervical cancer cell line. Peptide <sup>26</sup>[F] was inoculated in mice by ip administration and the lethal dose 50 (LD<sub>50</sub>) was between 70 and 140 mg kg<sup>-1</sup>. While for the <sup>26</sup>[1-Nal]: (RRWQWR-1-Nal-KKLG)<sub>2</sub>-K-Ahx peptide, a dose-response test was performed, and the survival rate was 100%. These results suggested that these peptides are safe in this animal model and could be considered as promissory to develop a treatment against breast cancer.

NEGR1
Also flagged:Major depressive disordertotranslationaldepressionlaurylcarnitinelipid
Journal Article 2023-06-14 ✓ 2 Snippets Radford-Smith DE, Anthony DC, Benz F, Grist JT, Lyman M, Miller JJ, Probert F.
In-Text Gene Mentions

,17 Indeed, NEGR1 has also been associated with obesity through GWAS.18

…, 17 Indeed,NEGR1has also been…

Show Full Abstract

<h4>Background</h4>Socioeconomic pressures, sex, and physical health status strongly influence the development of major depressive disorder (MDD) and mask other contributing factors in small cohorts. Resilient individuals overcome adversity without the onset of psychological symptoms, but resilience, as for susceptibility, has a complex and multifaceted molecular basis. The scale and depth of the UK Biobank affords an opportunity to identify resilience biomarkers in rigorously matched, at-risk individuals. Here, we evaluated whether blood metabolites could prospectively classify and indicate a biological basis for susceptibility or resilience to MDD.<h4>Methods</h4>Using the UK Biobank, we employed random forests, a supervised, interpretable machine learning statistical method to determine the relative importance of sociodemographic, psychosocial, anthropometric, and physiological factors that govern the risk of prospective MDD onset (total n = 15,710). We then used propensity scores to rigorously match individuals with a history of MDD (n = 491) against a resilient subset of individuals without an MDD diagnosis (retrospectively or during follow-up; n = 491) using an array of key social, demographic, and disease-associated drivers of depression risk. 381 blood metabolites and clinical chemistry variables and 4 urine metabolites were integrated to generate a multivariate random forest-based algorithm using 10-fold cross-validation to predict prospective MDD risk and resilience.<h4>Outcomes</h4>In unmatched individuals, a first case of MDD, with a median time-to-diagnosis of 72 years, can be predicted using random forest classification probabilities with an area under the receiver operator characteristic curve (ROC AUC) of 0.89. Prospective resilience/susceptibility to MDD was then predicted with a ROC AUC of 0.72 (x˜ = 3.2 years follow-up) and 0.68 (x˜ = 7.2 years follow-up). Increased pyruvate was identified as a key biomarker of resilience to MDD and was validated retrospectively in the TwinsUK cohort.<h4>Interpretation</h4>Blood metabolites prospectively associate with substantially reduced MDD risk. Therapeutic targeting of these metabolites may provide a framework for MDD risk stratification and reduction.<h4>Funding</h4>New York Academy of Sciences' Interstellar Programme Award; Novo Fonden; Lincoln Kingsgate award; Clarendon Fund; Newton-Abraham studentship (University of Oxford). The funders had no role in the development of the present study.

PRDX6
Also flagged:Biogenesisvesiclescancerischemic heart diseaseliver fibrosisimmune response
Journal Article 2023-06-14 ✓ 1 Snippet Yuan YG, Wang JL, Zhang YX, Li L, Reza AMMT, Gurunathan S.
In-Text Gene Mentions

Additionally, the administration of BMSC-EXOs to animals receiving I/R therapy improved their cardiac function by preventing cardiomyocyte ferroptosis by altering the Pum2/PRDX6 axis.247 According to Gong et al angiogenesis is boosted by nano-sized EVs generated from genetically altered MSCs that overexpress GATA-4.248 When compared to exosomes from the cells of origin, those produced from multiple myeloma BM mesenchymal stromal cells (BM-MSCs) had larger concentrations of oncogenic proteins, cytokines, and adhesion molecules, which hindered the proliferation of MM cells.249 Exosomes from FNDC5-preconditioned BM-MSCs have been shown to have anti-inflammatory properties and to enhance M2 macrophage polarisation through the NF-B signalling pathway and Nrf2/HO-1 Axis.250 Exosomes from BM-MSCs, has been shown to have protective effects against myocardial ischemic injury.

Show Full Abstract

Exosomes are nanovesicles with a wide range of chemical compositions used in many different applications. Mesenchymal stem cell-derived exosomes (MSCs-EXOs) are spherical vesicles that have been shown to mediate tissue regeneration in a variety of diseases, including neurological, autoimmune and inflammatory, cancer, ischemic heart disease, lung injury, and liver fibrosis. They can modulate the immune response by interacting with immune effector cells due to the presence of anti-inflammatory compounds and are involved in intercellular communication through various types of cargo. MSCs-EXOs exhibit cytokine storm-mitigating properties in response to COVID-19. This review discussed the potential function of MSCs-EXOs in a variety of diseases including neurological, notably epileptic encephalopathy and Parkinson's disease, cancer, angiogenesis, autoimmune and inflammatory diseases. We provided an overview of exosome biogenesis and factors that regulate exosome biogenesis. Additionally, we highlight the functions and potential use of MSCs-EXOs in the treatment of the inflammatory disease COVID-19. Finally, we covered a strategies and challenges of MSCs-EXOs. Finally, we discuss conclusion and future perspectives of MSCs-EXOs.

SERPINC1
Also flagged:Antithrombin IIIvenous thromboembolism) deficiencydeep vein thrombosisDVTthrombosis
Journal Article 2023-06-14 ✓ 5 Snippets Bhatti UF, Dhillon NK, Mason R, Wang A, Hashim YM, Barmparas G, Ley EJ.
In-Text Gene Mentions

…acquired reduction inATIIIlevels and is…

…the relation betweenATIIIlevels and VTE…

…2018 who hadATIIIlevels drawn were…

…AnATIIIlevel below 80%…

…low levels ofATIII.…

Show Full Abstract

<h4>Objective</h4>Antithrombin III (ATIII) deficiency may result from hereditary or acquired reduction in ATIII levels and is associated with an increase in venous thromboembolism (VTE) in the general population. VTE is a potentially preventable complication in the critically ill surgical patients. The objective of this study was to evaluate the relation between ATIII levels and VTE in surgical intensive care unit (SICU) patients.<h4>Methods</h4>All patients admitted to the SICU from January 2017 to April 2018 who had ATIII levels drawn were included in the study. An ATIII level below 80% of normal was considered low. The rate of VTE during the same admission was compared among patients with normal and low levels of ATIII. Prolonged length of stay (LOS >10 days) and mortality were also measured.<h4>Results</h4>Of the 227 patients included, 59.9% were male. The median age was 60 years. Overall, 66.9% of patients had low ATIII levels. Trauma patients had a higher rate of normal ATIII levels, whereas those weighing more than 100 kg had a higher rate of low ATIII levels. Patients with low ATIII levels had higher VTE rates compared with those with normal ATIII levels (28.9% vs. 16%, p=0.04). Patients with low ATIII levels also had prolonged LOS (76.3% vs. 60%, p=0.01) and increased mortality (21.7% vs. 6.7%, p<0.01). Trauma patients with VTE were more likely to have normal ATIII levels (38.5% in low ATIII cohort vs. 61.5% VTE in normal ATIII cohort, p<0.01).<h4>Conclusion</h4>Critically ill surgical patients with low ATIII levels have higher incidence of VTE, longer LOS, and higher mortality. In contrast, critically ill trauma patients may have high incidence of VTE even with normal ATIII levels.<h4>Level of evidence</h4>III.

HFE
Also flagged:Obesitythyroid cancerbreast cancerbenign thyroid diseasemetabolic syndromePCOS
Journal Article 2023-06-14 ✓ 1 Snippet Pasqual E, O'Brien K, Rinaldi S, Sandler DP, Kitahara CM.
In-Text Gene Mentions

…a diagnosis ofhemochromatosis, liver cirrhosis, hyperthyroi…

Show Full Abstract

<h4>Background</h4>Thyroid cancer incidence has increased worldwide. Obesity trends may play a role, but the underlying biological pathways are not well-characterized. Therefore, we examined associations of excess adiposity and obesity-related metabolic conditions with thyroid cancer incidence.<h4>Methods</h4>From the Sister Study, a cohort of sisters of women with breast cancer, we included 47,739 women who were cancer-free at baseline (2003-2009). Height, weight, waist and hip circumference, and blood pressure were measured at baseline and medical history was self-reported. Cox proportional hazards regression models were adjusted for age (time scale), race/ethnicity, smoking, baseline history of benign thyroid disease, and frequency of routine healthcare visits.<h4>Findings</h4>During follow-up (median = 12.5; max = 15.9 years), 259 women reported incident thyroid cancer. Body mass index (BMI) (hazard ratio [HR]<sub>per-5 kg/m</sub><sup>2</sup> = 1.25, 95% CI = 1.14-1.37), waist circumference (HR<sub>per-5 cm increase</sub> = 1.11, 95% CI = 1.06-1.15), and waist-to-hip ratio (HR <sub>≥0.85-versus-<0.85</sub> = 1.49, 95% CI = 1.14-1.94) were positively associated with thyroid cancer incidence, as were metabolic syndrome (HR = 1.67, 95% CI = 1.24-2.25), dyslipidemia (HR = 1.46, 95% CI = 1.13-1.90), borderline diabetes (HR = 2.06, 95% CI = 1.15-3.69), hypertension (HR = 1.49, 95% CI = 1.12-1.96), and polycystic ovary syndrome (PCOS, HR = 2.10, 95% CI = 1.20-3.67). These associations were attenuated with additional BMI adjustment, although dyslipidemia (HR = 1.35, 95% CI = 1.04-1.75) and PCOS (HR = 1.86, 95% CI = 1.06-3.28) remained associated with thyroid cancer incidence. Hypothyroidism was not associated with thyroid cancer.<h4>Interpretation</h4>In this cohort of sisters of women diagnosed with breast cancer, excess adiposity and several obesity-related metabolic conditions were associated with thyroid cancer incidence. These findings provide insights into potential biological mechanisms linking obesity and thyroid cancer.<h4>Funding</h4>This research was supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute and National Institute of Environmental Health Sciences (Z01-ES044005).

Also flagged:Differentiated Thyroid CancercancerThyroid cancerPTCPDTCMTC
Journal Article 2023-06-14 No Snippets Kościuszko M, Buczyńska A, Krętowski AJ, Popławska-Kita A.
Show Full Abstract

Increased oxidative stress (OS) has been implicated as a relevant risk factor for cancer progression. Furthermore, patients diagnosed with differentiated thyroid cancer (DTC) have been characterized by an increased OS status. Therefore, assessing OS status could potentially be considered a useful tool in DTC clinical management. This measurement could be particularly valuable in personalizing treatment protocols and determining new potential medical targets to improve commonly used therapies. A literature review was conducted to gather new information on DTC clinical management, with a particular focus on evaluating the clinical utility of OS. These meta-analyses concentrate on novel approaches that employ the measurement of oxidative-antioxidant status, which could represent the most promising area for implementing clinical management.

PTGIS
Also flagged:β-Glucanβ-glucansimmune response,6-glucanscarbonsepticemia
Journal Article 2023-06-14 ✓ 1 Snippet Porter D, Naseer S, Peggs D, McGurk C, Martin SAM.
In-Text Gene Mentions

…prostaglandin I2 Synthase (PTGIS), Cys-Cys motif (C-C)…

Show Full Abstract

β-glucans are a commonly used immunostimulant/prebiotic in many aquaculture applications for boosting the immune status in fish. However, the method of action as an immunostimulant has not been fully deciphered. To determine the immunomodulatory effects of β-glucans on the innate immune response, we stimulated the rainbow trout spleen macrophage-like cell line (RTS11) with β-1,3/1,6-glucans for 4 h. This study uses a whole transcriptomic approach to analyse the immunomodulatory properties of β-glucans. Several proinflammatory pathways were found to be enriched after stimulation, demonstrating the immunomodulatory effects of β-glucan supplementation. Several pathways relating to responses to bacteria were also found to be enriched. This study clearly demonstrates the immunomodulatory effects of the supplementation of β-glucans within an aquaculture setting and further validates the use of cell lines as predictive models to interpret the responses caused by dietary intervention.

Also flagged:Selenocysteineselenoenzymespolypeptidetranslationalserineselenoproteins
Journal Article 2023-06-14 No Snippets Chaudière J.
Show Full Abstract

Selenocysteine is a catalytic residue at the active site of all selenoenzymes in bacteria and mammals, and it is incorporated into the polypeptide backbone by a co-translational process that relies on the recoding of a UGA termination codon into a serine/selenocysteine codon. The best-characterized selenoproteins from mammalian species and bacteria are discussed with emphasis on their biological function and catalytic mechanisms. A total of 25 genes coding for selenoproteins have been identified in the genome of mammals. Unlike the selenoenzymes of anaerobic bacteria, most mammalian selenoenzymes work as antioxidants and as redox regulators of cell metabolism and functions. Selenoprotein P contains several selenocysteine residues and serves as a selenocysteine reservoir for other selenoproteins in mammals. Although extensively studied, glutathione peroxidases are incompletely understood in terms of local and time-dependent distribution, and regulatory functions. Selenoenzymes take advantage of the nucleophilic reactivity of the selenolate form of selenocysteine. It is used with peroxides and their by-products such as disulfides and sulfoxides, but also with iodine in iodinated phenolic substrates. This results in the formation of Se-X bonds (X = O, S, N, or I) from which a selenenylsulfide intermediate is invariably produced. The initial selenolate group is then recycled by thiol addition. In bacterial glycine reductase and D-proline reductase, an unusual catalytic rupture of selenium-carbon bonds is observed. The exchange of selenium for sulfur in selenoproteins, and information obtained from model reactions, suggest that a generic advantage of selenium compared with sulfur relies on faster kinetics and better reversibility of its oxidation reactions.

Also flagged:SynthesisReceptorGABAARpsychiatric disordersdepressionanxiety
Journal Article 2023-06-14 No Snippets Sharmin D, Mian MY, Marcotte M, Prevot TD, Sibille E, Witkin JM, Cook JM.
Show Full Abstract

GABA mediates inhibitory actions through various GABA<sub>A</sub> receptor subtypes, including 19 subunits in human GABAAR. Dysregulation of GABAergic neurotransmission is associated with several psychiatric disorders, including depression, anxiety, and schizophrenia. Selective targeting of α2/3 GABAARs can treat mood and anxiety, while α5 GABAA-Rs can treat anxiety, depression, and cognitive performance. GL-II-73 and MP-III-022, α5-positive allosteric modulators have shown promising results in animal models of chronic stress, aging, and cognitive disorders, including MDD, schizophrenia, autism, and Alzheimer's disease. Described in this article is how small changes in the structure of imidazodiazepine substituents can greatly impact the subtype selectivity of benzodiazepine GABAAR. To investigate alternate and potentially more effective therapeutic compounds, modifications were made to the structure of imidazodiazepine <b>1</b> to synthesize different amide analogs. The novel ligands were screened at the NIMH PDSP against a panel of 47 receptors, ion channels, including hERG, and transporters to identify on- and off-target interactions. Any ligands with significant inhibition in primary binding were subjected to secondary binding assays to determine their K<sub>i</sub> values. The newly synthesized imidazodiazepines were found to have variable affinities for the benzodiazepine site and negligible or no binding to any off-target profile receptors that could cause other physiological problems.

HFE
Also flagged:CRISPRCas9Colon cancercancercancersclustered regularly interspaced short palindromic
Journal Article 2023-06-14 ✓ 1 Snippet Hillman T.
In-Text Gene Mentions

…in the inheritedhemochromatosis( 136 ).…

Show Full Abstract

Colon cancer is one of the leading causes of cancer in the United States. Colon cancer develops from the many gene mutations found in the genomes of colon cancer cells. Long non-coding RNAs (lncRNAs) can cause the development and progression of many cancers, including colon cancer. LncRNAs have been and could be corrected through the gene-editing technology of the clustered repeats of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated nuclease 9 (CRISPR/Cas9) system to reduce the proliferation of cancer cells in the colon. However, many current delivery systems for transporting CRISPR/Cas9-based therapeutics <i>in vivo</i> need more safety and efficiency. CRISPR/Cas9-based therapeutics require a safe and effective delivery system to more directly and specifically target cancer cells present in the colon. This review will present pertinent evidence for the increased efficiency and safety of using plant-derived exosome-like nanoparticles as nanocarriers for delivering CRISPR/Cas9-based therapeutics to target colon cancer cells directly.

Also flagged:ADnucleusChromatinbehavioralcognitive disabilitiessynapse
Journal Article 2023-06-14 No Snippets Vu TM, Hervé V, Ulfat AK, Lamontagne-Kam D, Brouillette J.
Show Full Abstract

The role of non-neuronal cells has been relatively overlooked in Alzheimer's disease (AD) neuropathogenesis compared to neuronal cells since the first characterization of the disease. Genome wide-association studies (GWAS) performed in the last few decades have greatly contributed to highlighting the critical impact of non-neuronal cells in AD by uncovering major genetic risk factors that are found largely in these cell types. The recent development of single cell or single nucleus technologies has revolutionized the way we interrogate the transcriptomic and epigenetic profiles of neurons, microglia, astrocytes, oligodendrocytes, pericytes, and endothelial cells simultaneously in the same sample and in an individual manner. Here, we review the latest advances in single-cell/nucleus RNA sequencing and Assay for Transposase-Accessible Chromatin (ATAC) sequencing to more accurately understand the function of non-neuronal cells in AD. We conclude by giving an overview of what still needs to be achieved to better appreciate the interconnected roles of each cell type in the context of AD.

DCC
Also flagged:Ischemic strokestrokedeathtissue plasminogen activatorinflammatory responsebrain injury
Journal Article 2023-06-14 ✓ 5 Snippets Yang X, Liu Y, Zhong W, Li Y, Zhang W.
In-Text Gene Mentions

…in Colorectal Cancer (DCC), Unc-5 netrin receptor…

…(ELM-NTN1; RayBiotech), mouseDCC(ELM-DCC; RayBiotech), mouse…

…RayBiotech), mouse DCC (ELM-DCC; RayBiotech), mouse UNC5a…

…receptors, which includeDCC, UNC5a, UNC5b, UNC5d…

…UNC5a, but notDCC, UNC5b, UNC5d, and…

Show Full Abstract

<h4>Introduction</h4>The current approaches that are used to treat ischemic stroke suffer from poor targeting, lack of effectiveness, and potential off-target effects, necessitating the development of new therapeutic strategies to enhance neuronal cell survival and regeneration. This study aimed to investigate the role of microglial Netrin-1 in ischemic stroke, a topic that has not been fully understood.<h4>Methods</h4>Netrin-1 levels and its primary receptor expressions were investigated in cerebral microglia from acute ischemic stroke patients and age-matched control subjects. A public database (GEO148350), which supplied RNAseq results for rat cerebral microglia in a middle cerebral artery occlusion (MCAO) model, was analyzed to assess the expression of Netrin-1, its major receptors, and genes related to macrophage function. A microglia-specific gene targeting approach and a delivery system allowing for crossing the blood-brain barrier were applied in a mouse model for ischemic stroke to investigate the role of microglial Netrin-1. Netrin-1 receptor signaling in microglia was observed and the effects on microglial phenotype, apoptosis, and migration were analyzed.<h4>Results</h4>Across human patients, rat and mouse models, activation of Netrin-1 receptor signaling was mainly conducted <i>via</i> its receptor UNC5a in microglia, which resulted in a shift in microglial phenotype towards an anti-inflammatory or M2-like state, leading to a reduction in apoptosis and migration of microglia. Netrin-1-induced phenotypic change in microglia exerted protective effects on neuronal cells <i>in vivo</i> during ischemic stroke.<h4>Conclusion</h4>Our study highlights the potential of targeting Netrin-1 and its receptors as a promising therapeutic strategy for promoting post-ischemic survival and functional recovery.

Also flagged:cytokineCytokinessecretionco-secretionimmune responseinfections
Journal Article 2023-06-14 No Snippets Portmann K, Linder A, Oelgarth N, Eyer K.
Show Full Abstract

Cytokines are important mediators of the immune system, and their secretion level needs to be carefully regulated, as an unbalanced activity may lead to cytokine release syndromes. Dysregulation can be induced by various factors, including immunotherapies. Therefore, the need for risk assessment during drug development has led to the introduction of cytokine release assays (CRAs). However, the current CRAs offer little insight into the heterogeneous cellular dynamics. To overcome this limitation, we developed an advanced single-cell microfluidic-based cytokine secretion platform to quantify cytokine secretion on the single-cell level dynamically. Our approach identified different dynamics, quantities, and phenotypically distinct subpopulations for each measured cytokine upon stimulation. Most interestingly, early measurements after only 1 h of stimulation revealed distinct stimulation-dependent secretion dynamics and cytokine signatures. With increased sensitivity and dynamic resolution, our platform provided insights into the secretion behavior of individual immune cells, adding crucial additional information about biological stimulation pathways to traditional CRAs.

Preprints.org 2023-06-14 Preprint (No Snippets API) Vukojević A, Vukojević M, Jukić T, Petriček I, Mandić K, Vukojević N.
Show Full Abstract

Hereditary hemochromatosis (HH) is an inherited iron metabolism disorder. It is caused by an autosomal recessive disorder resulting from a C28Y8 HFE gene mutation. Mutations in the HFE gene may result in iron accumulation and oxidative stress in the retina, resulting in macular degeneration. This article describes two patients with HH who developed vision difficulties. Both patients were subjected to a retinal exam, multimodal imaging, and electrodiagnostic techniques, which revealed structural and functional degeneration of the central macula. Fundus photography, fluorescein angiography (FA), and fundus autofluorescence (FAF) revealed changes at the level of the retinal pigment epithelium (RPE) in the center of the macula, while optical coherence tomography (OCT) revealed subfoveal accumulation of hyperreflective material at and below the RPE. The multifocal electroretinogram (mfERG) confirmed a decreased cone response, whereas the full-field electroretinogram (ERG) revealed no pathological findings. In addition, patients underwent genetic testing, which ruled out the possibility of hereditary macular dystrophy. Considering macula findings and the nature of the patients&#039; primary illness, we believe that the higher concentration and accumulation of iron and photoreceptor metabolic products have led to dysfunction in the RPE, which has led to morphological and functional changes in the macula.

HTT
Also flagged:oligonucleotideHuntington's diseaseantibodiesHDneurodegenerative diseasebehavioral
Journal Article 2023-06-13 ✓ 2 Snippets Yamamoto Y, Sanwald Ducray P, Björnsson M, Smart K, Grimsey P, Vatakuti S, Portron A, Massonnet B, Norris DA, Silber Baumann HE.
In-Text Gene Mentions

Given the monogenic nature of HD, huntingtin protein (HTT)‐lowering approaches are believed to alleviate HD pathogenesis.8

…HD, huntingtin protein (HTT)‐lowering approaches are beli…

Show Full Abstract

Tominersen is an intrathecally administered antisense oligonucleotide targeting huntingtin mRNA which leads to a dose-dependent, reversible lowering of cerebrospinal fluid (CSF) mutant huntingtin protein concentration in individuals with Huntington's disease. Nonlinear mixed-effect population pharmacokinetic (PopPK) modeling was conducted to characterize the CSF and plasma pharmacokinetics (PK) of tominersen, and to identify and quantify the covariates that affect tominersen PKs. A total of 750 participants from five clinical studies with a dose range from 10 to 120 mg contributed CSF (n = 6302) and plasma (n = 5454) PK samples. CSF PK was adequately described by a three-compartment model with first-order transfer from CSF to plasma. Plasma PK was adequately described by a three-compartment model with first-order elimination from plasma. Baseline total CSF protein, age, and antidrug antibodies (ADAs) were the significant covariates for CSF clearance. Body weight was a significant covariate for clearances and volumes in plasma. ADAs and sex were significant covariates for plasma clearance. The developed PopPK model was able to describe tominersen PK in plasma and CSF after intrathecal administration across a range of dose levels, and relevant covariate relationships were identified. This model has been applied to guide dose selection for future clinical trials of tominersen in patients with Huntington's disease.

Also flagged:SchizophreniaAAOmental disordersattention-deficit/hyperactivity disordercomplexcognition
Journal Article 2023-06-13 No Snippets Sada-Fuente E, Aranda S, Papiol S, Heilbronner U, Moltó MD, Aguilar EJ, González-Peñas J, Andreu-Bernabeu Á, Arango C, Crespo-Facorro B, González-Pinto A, Fañanás L, Arias B, Bobes J, Costas J, Martorell L, Schulze TG, Kalman JL, Vilella E, Muntané G.
Show Full Abstract

Schizophrenia (SCZ) is a complex disorder that typically arises in late adolescence or early adulthood. Age at onset (AAO) of SCZ is associated with long-term outcomes of the disease. We explored the genetic architecture of AAO with a genome-wide association study (GWAS), heritability, polygenic risk score (PRS), and copy number variant (CNV) analyses in 4 740 subjects of European ancestry. Although no genome-wide significant locus was identified, SNP-based heritability of AAO was estimated to be between 17 and 21%, indicating a moderate contribution of common variants. We also performed cross-trait PRS analyses with a set of mental disorders and identified a negative association between AAO and common variants for SCZ, childhood maltreatment and attention-deficit/hyperactivity disorder. We also investigated the role of copy number variants (CNVs) in AAO and found an association with the length and number of deletions (P-value = 0.03), whereas the presence of CNVs previously reported in SCZ was not associated with earlier onset. To our knowledge, this is the largest GWAS of AAO of SCZ to date in individuals from European ancestry, and the first study to determine the involvement of common variants in the heritability of AAO. Finally, we evidenced the role played by higher SCZ load in determining AAO but discarded the role of pathogenic CNVs. Altogether, these results shed light on the genetic architecture of AAO, which needs to be confirmed with larger studies.

HFE
Also flagged:genetic disorderMendelian disordersmale infertilitygenetic disordersreproductiongenetic disease
Journal Article 2023-06-13 ✓ 1 Snippet Benammar A, Munnich A, Poulain M, Magnan F, Racowsky C, Ayoubi JM.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Purpose</h4>To assess the value of having an onsite genetic counseling service integrated into an assisted reproductive technology (ART) center.<h4>Methods</h4>Since January 2021, we have offered genetic counseling at our ART center for couples whose medical history suggests risk of transmission of a genetic disorder. The percentage of couples referred for genetic counseling, the distribution of couples according to reasons for consultation, the mode of transmission in cases of Mendelian disorders, and the frequency of mutations for those with identified genetic disorders were determined.<h4>Results</h4>In an 18-month period, 150 of 1340 couples (11.2%) enrolled for ART treatment were referred to the genetic counseling unit. Two-thirds (99/150, 66.0%) were referred for a known genetic risk, a family history of a genetic disorder or chromosomal abnormality, a serious condition of unknown cause, or consanguinity. The remaining couples had a putative genetic risk (diminished ovarian reserve, high incidence of oocyte immaturity, recurrent abortion, or severe male infertility). Of the 99 with known genetic risk, 62 (62.7%), were approved for ART treatment, 23 (23.2%) were recommended prenatal or preimplantation testing, and 14 (14.1%) were referred for further testing before undergoing ART.<h4>Conclusions</h4>Our findings reveal great value in having an on-site genetic counseling unit for referral of ART patients. Such a unit makes the ART process smoother and safer for couples, and it lightens the burden of ART staff by removing responsibilities for which they are neither trained, nor should they have to assume.

OLFM4
Also flagged:PLAGL2ASCL2IGF2Wntcolorectal cancertumor
Journal Article 2023-06-13 ✓ 1 Snippet Fischer AD, Veronese Paniagua DA, Swaminathan S, Kashima H, Rubin DC, Madison BB.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Colorectal cancer (CRC) tumorigenesis and progression are linked to common oncogenic mutations, especially in the tumor suppressor <i>APC</i>, whose loss triggers the deregulation of TCF4/β-Catenin activity. CRC tumorigenesis is also driven by multiple epimutational modifiers such as transcriptional regulators. We describe the common (and near-universal) activation of the zinc finger transcription factor and Let-7 target PLAGL2 in CRC and find that it is a key driver of intestinal epithelial transformation. PLAGL2 drives proliferation, cell cycle progression, and anchorage-independent growth in CRC cell lines and nontransformed intestinal cells. Investigating effects of PLAGL2 on downstream pathways revealed very modest effects on canonical Wnt signaling. Alternatively, we find pronounced effects on the direct PLAGL2 target genes <i>IGF2</i>, a fetal growth factor, and <i>ASCL2</i>, an intestinal stem cell-specific bHLH transcription factor. Inactivation of PLAGL2 in CRC cell lines has pronounced effects on ASCL2 reporter activity. Furthermore, ASCL2 expression can partially rescue deficits of proliferation and cell cycle progression caused by depletion of PLAGL2 in CRC cell lines. Thus, the oncogenic effects of PLAGL2 appear to be mediated via core stem cell and onco-fetal pathways, with minimal effects on downstream Wnt signaling.<b>NEW & NOTEWORTHY</b> A Let-7 target called PLAGL2 drives oncogenic transformation via Wnt-independent pathways. This work illustrates the robust effects of this zinc finger transcription factor in colorectal cancer (CRC) cell lines and nontransformed intestinal epithelium, with effects mediated, in part, via the direct target genes ASCL2 and IGF2. This has implications for the role of PLAGL2 in activation of onco-fetal and onco-stem cell pathways, contributing to immature and highly proliferative phenotypes in CRC.

Also flagged:diabetesFenofibratedyslipidaemiahypertriglyceridaemiadiabetic retinopathytype 2 diabetes
Journal Article 2023-06-13 No Snippets Kataoka SY, Lois N, Kawano S, Kataoka Y, Inoue K, Watanabe N.
Show Full Abstract

<h4>Background</h4>Diabetic retinopathy (DR) remains a major cause of sight loss worldwide, despite new therapies and improvements in the metabolic control of people living with diabetes. Therefore, DR creates a physical and psychological burden for people, and an economic burden for society. Preventing the development and progression of DR, or avoiding the occurrence of its sight-threatening complications is essential, and must be pursued to save sight. Fenofibrate may be a useful strategy to achieve this goal, by reversing diabetes' effects and reducing inflammation in the retina, as well as improving dyslipidaemia and hypertriglyceridaemia.  OBJECTIVES: To investigate the benefits and harms of fenofibrate for preventing the development and progression of diabetic retinopathy in people with type 1 (T1D) or type 2 diabetes (T2D), compared with placebo or observation.<h4>Search methods</h4>We searched CENTRAL, MEDLINE, Embase, and three trials registers (February 2022).<h4>Selection criteria</h4>We included randomised controlled trials (RCTs) that included people with T1D or T2D, when these compared fenofibrate with placebo or with observation, and assessed the effect of fenofibrate on the development or progression of DR (or both).<h4>Data collection and analysis</h4>We used standard Cochrane methods for data extraction and analysis. Our primary outcome was progression of DR, a composite outcome of 1) incidence of overt retinopathy for participants who did not have DR at baseline, or 2) advancing two or more steps on the Early Treatment Diabetic Retinopathy Study (ETDRS) severity scale for participants who had any DR at baseline (or both), based on the evaluation of stereoscopic or non-stereoscopic fundus photographs, during the follow-up period. Overt retinopathy was defined as the presence of any DR observed on stereoscopic or non-stereoscopic colour fundus photographs. Secondary outcomes included the incidence of overt retinopathy, reduction in visual acuity of participants with a reduction in visual acuity of 10 ETDRS letters or more, proliferative diabetic retinopathy, and diabetic macular oedema; mean vision-related quality of life, and serious adverse events of fenofibrate. We used GRADE to assess the certainty of evidence.<h4>Main results</h4>We included two studies and their eye sub-studies (15,313 participants) in people with T2D. The studies were conducted in the US, Canada, Australia, Finland, and New Zealand; follow-up period was four to five years. One was funded by the government, the other by industry. Compared to placebo or observation, fenofibrate likely results in little to no difference in progression of DR (risk ratio (RR) 0.86; 95% confidence interval (CI) 0.60 to 1.25; 1 study, 1012 participants; moderate-certainty evidence) in a population with and without overt retinopathy at baseline. Those without overt retinopathy at baseline showed little or no progression (RR 1.00, 95% CI 0.68 to 1.47; 1 study, 804 participants); those with overt retinopathy at baseline found that their DR progressed slowly (RR 0.21, 95% CI 0.06 to 0.71; 1 study, 208 people; test for interaction P = 0.02). Compared to placebo or observation, fenofibrate likely resulted in little to no difference in either the incidence of overt retinopathy (RR 0.91; 95% CI 0.76 to 1.09; 2 studies, 1631 participants; moderate-certainty evidence); or the incidence of diabetic macular oedema (RR 0.39; 95% CI 0.12 to 1.24; 1 study, 1012 participants; moderate-certainty evidence). The use of fenofibrate increased severe adverse effects (RR 1.55; 95% CI 1.05 to 2.27; 2 studies, 15,313 participants; high-certainty evidence). The studies did not report on incidence of a reduction in visual acuity of 10 ETDRS letters or more, incidence of proliferative diabetic retinopathy, or mean vision-related quality of life.<h4>Authors' conclusions</h4>Current, moderate-certainty evidence suggests that in a mixed group of people with and without overt retinopathy, who live with T2D, fenofibrate likely results in little to no difference in progression of diabetic retinopathy. However, in people with overt retinopathy who live with T2D, fenofibrate likely reduces the progression. Serious adverse events were rare, but the risk of their occurrence was increased by the use of fenofibrate. There is no evidence on the effect of fenofibrate in people with T1D. More studies, with larger sample sizes, and participants with T1D are needed. They should measure outcomes that are important to people with diabetes, e.g. change in vision, reduction in visual acuity of 10 ETDRS letters or more, developing proliferative diabetic retinopathy; and evaluating the requirement of other treatments, e.g. injections of anti-vascular endothelial growth factor therapies, steroids.

Also flagged:pathogenesishematologic disordershematologic malignanciesmyelodysplastic syndromeneoplasmjuvenile myelomonocytic leukemia
Journal Article 2023-06-13 No Snippets Liu YC, Geyer JT.
Show Full Abstract

Pediatric hematologic malignancies often show genetic features distinct from their adult counterparts, which reflect the differences in their pathogenesis. Advances in the molecular diagnostics including the widespread use of next-generation sequencing technology have revolutionized the diagnostic workup for hematologic disorders and led to the identification of new disease subgroups as well as prognostic information that impacts the clinical treatment. The increasing recognition of the importance of germline predisposition in various hematologic malignancies also shapes the disease models and management. Although germline predisposition variants can occur in patients with myelodysplastic syndrome/neoplasm (MDS) of all ages, the frequency is highest in the pediatric patient population. Therefore, evaluation for germline predisposition in the pediatric group can have significant clinical impact. This review discusses the recent advances in juvenile myelomonocytic leukemia, pediatric acute myeloid leukemia, B-lymphoblastic leukemia/lymphoma, and pediatric MDS. This review also includes a brief discussion of the updated classifications from the International Consensus Classification (ICC) and the 5th edition World Health Organization (WHO) classification regarding these disease entities.

SOX6
Also flagged:bone remodelingbone resorptionbone formationosteonecrosisosteoporosisarthritis
Journal Article 2023-06-13 ✓ 5 Snippets Wahyuningtyas ED, Triwardhani A, Ardani IGAW, Surboyo MDC.
In-Text Gene Mentions

…3, Runx2, andSox6expressions, osteocalcin, phos…

…inflammation through increasedSox6expression.…

…TheSOX6expression takes place…

…53Sox6is the major…

…sox family, Sox5,Sox6, and Sox9, is…

Show Full Abstract

Herbal medicine has an important part in promoting and maintaining human health. One of them was grape seed extract (GSE). Various potentials of GSE in human health have been explored, and its potential for maintaining bone health is promising. Some initial research has provided evidence that the GSE was able to affect bone remodeling (bone resorption and bone formation). This scoping review analyzed and discussed all the reports on the effect of GSE on bone healing and bone remodeling in animals in the alveolar bone, jaw bone, and skeletal bone. The further purpose is to give an opportunity to research and development of supplementation of GSE for humans.The Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) 2020 guidelines were used to compose this scoping review through database on Scopus, PubMed, Science Direct, Web of Science, Embase, and manual search until December 2022. The inclusion criteria were a study that analyzed the effect of supplementation GSE on all bones.All included study was <i>in vivo</i> study with supplementation of GSE. The supplementation of GSE affects the alveolar bone, jaw bones, and skeletal bone by promoting bone formation and inhibiting bone resorption by suppressing inflammation, apoptosis pathways, and osteoclastogenesis. It not only supports bone remodeling in bone inflammation, osteonecrosis, osteoporosis, and arthritis but also the GSE increases bone health by increasing the density and mineral deposition in trabecula and cortical bone.The supplementation of GSE supports bone remodeling by interfering with the inflammation process and bone formation not only by preventing bone resorption but also by maintaining bone density.

SERPINC1
Also flagged:degradationbindingGFPcalciumgene expressionprotein degradation
Journal Article 2023-06-13 ✓ 1 Snippet Zhang D, Chen Z, Du Z, Bao B, Su N, Chen X, Ge Y, Lin Q, Yang L, Hua Y, Wang S, Hua X, Zuo F, Li N, Liu R, Jiang L, Bao C, Zhao Y, Loscalzo J, Yang Y, Zhu L.
In-Text Gene Mentions

…cytochrome c oxidase (Cox-VIII) to the N-terminal…

Show Full Abstract

Naturally occurring fluorescent proteins (FPs) are the most widely used tools for tracking cellular proteins and sensing cellular events. Here, we chemically evolved the self-labeling SNAP-tag into a palette of SNAP-tag mimics of fluorescent proteins (SmFPs) that possess bright, rapidly inducible fluorescence ranging from cyan to infrared. SmFPs are integral chemical-genetic entities based on the same fluorogenic principle as FPs, i.e., induction of fluorescence of non-emitting molecular rotors by conformational locking. We demonstrate the usefulness of these SmFPs in real-time tracking of protein expression, degradation, binding interactions, trafficking, and assembly, and show that these optimally designed SmFPs outperform FPs like GFP in many important ways. We further show that the fluorescence of circularly permuted SmFPs is sensitive to the conformational changes of their fusion partners, and that these fusion partners can be used for the development of single SmFP-based genetically encoded calcium sensors for live cell imaging.

Also flagged:cancermetastatic cancerssolid cancersBTNBTN-likeantibodies
Journal Article 2023-06-13 No Snippets Zlatareva I, Wu Y.
Show Full Abstract

Rapid bench-to-bedside translation of basic immunology to cancer immunotherapy has revolutionised the clinical practice of oncology over the last decade. Immune checkpoint inhibitors targeting αβ T cells now offer durable remissions and even cures for some patients with hitherto treatment-refractory metastatic cancers. Unfortunately, these treatments only benefit a minority of patients and efforts to improve efficacy through combination therapies utilising αβ T cells have seen diminishing returns. Alongside αβ T cells and B cells, γδ T cells are a third lineage of adaptive lymphocytes. Less is known about these cells, and they remain relatively untested in cancer immunotherapy. Whilst preclinical evidence supports their utility, the few early-phase trials involving γδ T cells have failed to demonstrate convincing efficacy in solid cancers. Here we review recent progress in our understanding of how these cells are regulated, especially locally within tissues, and the potential for translation. In particular, we focus on the latest advances in the field of butyrophilin (BTN) and BTN-like (BTNL) regulation of γδ T cells and speculate on how these advances may address the limitations of historical approaches in utilising these cells, as well as how they may inform novel approaches in deploying these cells for cancer immunotherapy.

SERPINC1
Also flagged:COPDdeathchronic respiratory diseasechemotaxisinfectionhumoral response
Journal Article 2023-06-13 ✓ 1 Snippet Liu P, Zhang M, Gao H, Han S, Liu J, Sun X, Zhao L.
In-Text Gene Mentions

…Ligase Homolog (DTL),Kinesin Family Member C1Family Member C1…

Show Full Abstract

<h4>Background</h4>Chronic obstructive pulmonary disease (COPD) is one of the world's leading causes of death and a major chronic respiratory disease. Aerobic exercise, the cornerstone of pulmonary rehabilitation, improves prognosis of COPD patients; however, few studies have comprehensively examined the changes in RNA transcript levels and the crosstalk between various transcripts in this context. This study identified the expression of RNA transcripts in COPD patients who engaged in aerobic exercise training for 12 weeks, and further constructions of the possible RNAs networks were made.<h4>Methods</h4>Peripheral blood samples for all four COPD patients who benefited from 12 weeks of PR were collected pre- and post-aerobic exercises and evaluated for the expression of mRNA, miRNA, lncRNA, and circRNA with high-throughput RNA sequencing followed by GEO date validation. In addition, enrichment analyses were conducted on different expressed mRNAs. LncRNA-mRNA and circRNA-mRNA coexpression networks, as well as lncRNA-miRNA-mRNA and circRNA-miRNA-mRNA competing expression networks (ceRNAs) in COPD were constructed.<h4>Results</h4>We identified and analyzed the differentially expressed mRNAs and noncoding RNAs in the peripheral blood of COPD patients' post-exercise. Eighty-six mRNAs, 570 lncRNAs, 8 miRNAs, and 2087 circRNAs were differentially expressed. Direct function enrichment analysis and Gene Set Variation Analysis showed that differentially expressed RNAs(DE-RNAs) correlated with several critical biological processes such as chemotaxis, DNA replication, anti-infection humoral response, oxidative phosphorylation, and immunometabolism, which might affect the progression of COPD. Some DE-RNAs were validated by Geo databases and RT-PCR, and the results were highly correlated with RNA sequencing. We constructed ceRNA networks of DE-RNAs in COPD.<h4>Conclusions</h4>The systematic understanding of the impact of aerobic exercise on COPD was achieved using transcriptomic profiling. This research offers a number of potential candidates for clarifying the regulatory mechanisms that exercise has on COPD, which could ultimately help in understanding the pathophysiology of COPD.

DNAH10
Also flagged:Dynein axonemal heavy chain 10primary ciliary dyskinesiaciliopathyinner arm dynein heavy chainaxonemesinusitis
Journal Article 2023-06-13 ✓ 5 Snippets Wang R, Yang D, Tu C, Lei C, Ding S, Guo T, Wang L, Liu Y, Lu C, Yang B, Ouyang S, Gong K, Tan Z, Deng Y, Tan Y, Qing J, Luo H.
In-Text Gene Mentions

Subsequently, animal models of Dnah10-knockin mice harboring missense variants and Dnah10-knockout mice recapitulated the phenotypes of PCD, including chronic respiratory infection, male infertility, and hydrocephalus.

To the best of our knowledge, this study is the first to report DNAH10 deficiency related to PCD in human and mouse models, which suggests that DNAH10 recessive mutation is causative of PCD.

Using exome sequencing, we identified a novel DNAH10 homozygous variant (c.589C > T, p.R197W) in a patient with PCD from a consanguineous family.

…heavy chain 10 (DNAH10) encodes a subunit…

…and sperm flagella,DNAH10variants are likely…

Show Full Abstract

Primary ciliary dyskinesia (PCD) is a congenital, motile ciliopathy with pleiotropic symptoms. Although nearly 50 causative genes have been identified, they only account for approximately 70% of definitive PCD cases. Dynein axonemal heavy chain 10 (DNAH10) encodes a subunit of the inner arm dynein heavy chain in motile cilia and sperm flagella. Based on the common axoneme structure of motile cilia and sperm flagella, DNAH10 variants are likely to cause PCD. Using exome sequencing, we identified a novel DNAH10 homozygous variant (c.589C > T, p.R197W) in a patient with PCD from a consanguineous family. The patient manifested sinusitis, bronchiectasis, situs inversus, and asthenoteratozoospermia. Immunostaining analysis showed the absence of DNAH10 and DNALI1 in the respiratory cilia, and transmission electron microscopy revealed strikingly disordered axoneme 9+2 architecture and inner dynein arm defects in the respiratory cilia and sperm flagella. Subsequently, animal models of Dnah10-knockin mice harboring missense variants and Dnah10-knockout mice recapitulated the phenotypes of PCD, including chronic respiratory infection, male infertility, and hydrocephalus. To the best of our knowledge, this study is the first to report DNAH10 deficiency related to PCD in human and mouse models, which suggests that DNAH10 recessive mutation is causative of PCD.

HTT
Also flagged:LAMP2Achaperoneautophagyfatty acidmetabolismage-associated diseases
Journal Article 2023-06-13 ✓ 1 Snippet Zhang KK, Zhang P, Kodur A, Erturk I, Burns CM, Kenyon C, Miller RA, Endicott SJ.
In-Text Gene Mentions

…including SNCA, MAPT,HTT, APP, LRRK2, and…

Show Full Abstract

Chaperone-mediated autophagy (CMA) selectively degrades proteins that are crucial for glycolysis, fatty acid metabolism, and the progression of several age-associated diseases. Several previous studies, each of which evaluated males of a single inbred mouse or rat strain, have reported that CMA declines with age in many tissues, attributed to an age-related loss of LAMP2A, the primary and indispensable component of the CMA translocation complex. This has led to a paradigm in the field of CMA research, stating that the age-associated decline in LAMP2A in turn decreases CMA, contributing to the pathogenesis of late-life disease. We assessed LAMP2A levels and CMA substrate uptake in both sexes of the genetically heterogeneous UM-HET3 mouse stock, which is the current global standard for the evaluation of anti-aging interventions. We found no evidence for age-related changes in LAMP2A levels, CMA substrate uptake, or whole liver levels of CMA degradation targets, despite identifying sex differences in CMA.

ZNFX1
Also flagged:reproductionBARD1AFPFGL2immune responseAHSG
Journal Article 2023-06-13 ✓ 1 Snippet Devadasan MJ, Ramesha KP, Ramesh P, Kootimole CN, Jeyakumar S, Ashwitha A, Ammankallu S, Rai AB, Kumaresan A, Vedamurthy VG, Raju R, Das DN, Kataktalware MA, Prasad TSK.
In-Text Gene Mentions

…of FGL2 andZNFX1that modulates the…

Show Full Abstract

Improving reproductive performance of cattle is of paramount importance for sustainable dairy farming. Poor reproduction performance (RP) hinders the genetic improvement of important Bos indicus cattle breeds. It is well known that incorporation of molecular information along with conventional breeding method is far better than use of conventional method alone for the genetic improvement of reproductive performance traits in cattle. Therefore, the present study sought to investigate the plasma proteome of the Deoni cows in cyclical (n = 6) and pregnant (n = 6) reproductive phases with varying reproductive performance (high and low). High-throughput data independent acquisition (DIA) based proteomics was performed to understand corresponding proteome. We identified a total of 430 plasma proteins. Among cyclic cows, twenty proteins were differentially regulated in low RP as compared to high RP. BARD1 and AFP proteins were observed upregulated in cyclical cows whose upregulation reported to affect reproductive performance in cattle. Among the pregnant cows, thirty-five proteins were differentially regulated, including the downregulation of FGL2 and ZNFX1 that modulates the maternal immune response mechanism which is required for successful implantation of the embryo. Also, proteins such as AHSG, CLU and SERPINA6 were upregulated in the pregnant cows whose upregulation reported to reduced reproductive performance. The results of this study will be helpful in establishing a framework for future research on the aspect of improving reproductive performance in Bos indicus cattle breeds. SIGNIFICANCE: The Indian subcontinent is the center of domestication for Bos indicus cattle breeds and they are known for their disease resistance, heat tolerance, ability to survive in low input regime and harsh climatic conditions. In recent times, population of many important Bos indicus breeds including Deoni cattle is declining due to various factors, especially due to reproductive performance. Traditional breeding methods are not sufficient enough to understand and improve the reproductive performance traits in important Bos indicus cattle breeds. Proteomics approach is a promising technology to understand the complex biological factors which leads to poor reproductive performance in cattle. The present study utilized DIA based LC- MS/MS analysis to identify the plasma proteins associated with reproductive performance in cyclical and pregnant cows. This study if improved further, can be used to develop potential protein markers associated with reproductive performance which is useful for the selection and genetic improvement of important Bos indicus breeds.

Also flagged:Neurobiological disordersgene expressionneurobiological diseaseepilepsycognitive disorderssubstance use disorders
Journal Article 2023-06-13 No Snippets Walter TJ, Suter RK, Ayad NG.
Show Full Abstract

Neurobiological disorders are highly prevalent medical conditions that contribute to significant morbidity and mortality. Single-cell RNA sequencing (scRNA-seq) is a technique that measures gene expression in individual cells. In this review, we survey scRNA-seq studies of tissues from patients suffering from neurobiological disease. This includes postmortem human brains and organoids derived from peripheral cells. We highlight a range of conditions, including epilepsy, cognitive disorders, substance use disorders, and mood disorders. These findings provide new insights into neurobiological disease in multiple ways, including discovering novel cell types or subtypes involved in disease, proposing new pathophysiological mechanisms, uncovering novel drug targets, or identifying potential biomarkers. We discuss the quality of these findings and suggest potential future directions and areas open for additional research, including studies of non-cortical brain regions and additional conditions such as anxiety disorders, mood disorders, and sleeping disorders. We argue that additional scRNA-seq of tissues from patients suffering from neurobiological disease could advance our understanding and treatment of these conditions.

HTT
Also flagged:nucleotideGTPaseB3GNTL1UBE2L3TRAF2TMEM9
Journal Article 2023-06-13 ✓ 3 Snippets Salehian-Dehkordi H, Huang JH, Pirany N, Mehrban H, Lv XY, Sun W, Esmailizadeh A, Lv FH.
In-Text Gene Mentions

…damaged DNA (e.g.,HTT), GTPase activity…

…genes such asHTTthat play an…

…RASGRP2 , andHTTfor repairing damaged…

Show Full Abstract

Sheep show characteristics of phenotypic diversity and adaptation to diverse climatic regions. Previous studies indicated associations between copy number variations (CNVs) and climate-driven adaptive evolution in humans and other domestic animals. Here, we constructed a genomic landscape of CNVs (<i>n</i> = 39,145) in 47 old autochthonous populations genotyped at a set of high-density (600 K) SNPs to detect environment-driven signatures of CNVs using a multivariate regression model. We found 136 deletions and 52 duplications that were significantly (<i>P</i><sub>adj.</sub> < 0.05) associated with climatic variables. These climate-mediated selective CNVs are involved in functional candidate genes for heat stress and cold climate adaptation (e.g., <i>B3GNTL1</i>, <i>UBE2L3</i>, and <i>TRAF2</i>), coat and wool-related traits (e.g., <i>TMEM9</i>, <i>STRA6</i>, <i>RASGRP2</i>, and <i>PLA2G3</i>), repairing damaged DNA (e.g., <i>HTT</i>), GTPase activity (e.g., <i>COPG</i>), fast metabolism (e.g., <i>LMF2</i> and <i>LPIN3</i>), fertility and reproduction (e.g., <i>SLC19A1</i> and <i>CCDC155</i>), growth-related traits (e.g., <i>ADRM1</i> and <i>IGFALS</i>), and immune response (e.g., <i>BEGAIN</i> and <i>RNF121</i>) in sheep. In particular, we identified significant (<i>P</i><sub>adj.</sub> < 0.05) associations between probes in deleted/duplicated CNVs and solar radiation. Enrichment analysis of the gene sets among all the CNVs revealed significant (<i>P</i><sub>adj.</sub> < 0.05) enriched gene ontology terms and pathways related to functions such as nucleotide, protein complex, and GTPase activity. Additionally, we observed overlapping between the CNVs and 140 known sheep QTLs. Our findings imply that CNVs can serve as genomic markers for the selection of sheep adapted to specific climatic conditions.

HTT
Also flagged:PathophysiologyDepressionPDsodium-dependent serotonin transporterdopamine receptor D3mitochondrial
Journal Article 2023-06-13 ✓ 1 Snippet Angelopoulou E, Bougea A, Paudel YN, Georgakopoulou VE, Papageorgiou SG, Piperi C.
In-Text Gene Mentions

…the SLC6A4 gene (5-HTT-linked polymorphic region, kn…

Show Full Abstract

<i>Background and Objectives</i>: Parkinson's disease (PD) is a clinically heterogeneous disorder with poorly understood pathological contributing factors. Depression presents one of the most frequent non-motor PD manifestations, and several genetic polymorphisms have been suggested that could affect the depression risk in PD. Therefore, in this review we have collected recent studies addressing the role of genetic factors in the development of depression in PD, aiming to gain insights into its molecular pathobiology and enable the future development of targeted and effective treatment strategies. <i>Materials and Methods</i>: we have searched PubMed and Scopus databases for peer-reviewed research articles published in English (pre-clinical and clinical studies as well as relevant reviews and meta-analyses) investigating the genetic architecture and pathophysiology of PD depression. <i>Results</i>: in particular, polymorphisms in genes related to the serotoninergic pathway (sodium-dependent serotonin transporter gene, <i>SLC6A4</i>, tryptophan hydrolase-2 gene, <i>TPH2</i>), dopamine metabolism and neurotransmission (dopamine receptor D3 gene, <i>DRD3</i>, aldehyde dehydrogenase 2 gene, <i>ALDH2)</i>, neurotrophic factors (brain-derived neurotrophic factor gene, <i>BDNF</i>), endocannabinoid system (cannabinoid receptor gene, CNR1), circadian rhythm (thyrotroph embryonic factor gene, <i>TEF</i>), the sodium-dependent neutral amino acid transporter B(0)AT2 gene, <i>SLC6A15</i>), and <i>PARK16</i> genetic locus were detected as altering susceptibility to depression among PD patients. However, polymorphisms in the dopamine transporter gene (<i>SLC6A3</i>), monoamine oxidase A (<i>MAOA</i>) and B (<i>MAOB</i>) genes, catechol-O-methyltransferase gene (<i>COMT</i>), <i>CRY1</i>, and <i>CRY2</i> have not been related to PD depression. <i>Conclusions</i>: the specific mechanisms underlying the potential role of genetic diversity in PD depression are still under investigation, however, there is evidence that they may involve neurotransmitter imbalance, mitochondrial impairment, oxidative stress, and neuroinflammation, as well as the dysregulation of neurotrophic factors and their downstream signaling pathways.

HFE
Also flagged:ironcoronary heart diseaseCVDorganizationcoronary atherosclerosisAS
Journal Article 2023-06-13 ✓ 4 Snippets Liu F, Liu Y, Xu S, Wang Q, Xu F, Liu Y.
In-Text Gene Mentions

Moreover, compared to HFE wild-type study participants, C282Y-positive participants had lower total cholesterol and LDL-C levels (34).

…rs1799945 in theHFEgene, and rs855791…

…in the geneHFEinclude rs1800562 (also…

…Moreover, compared toHFEwild-type study participants,…

Show Full Abstract

<h4>Background</h4>Growing observational studies have shown that abnormal systemic iron status is associated with Coronary heart disease (CHD). However, these results from observational studies was not entirely consistent.It remains unclear whether this relationship represents causality.It is necessary to explore the causal relationship between iron status and CHD and related cardiovascular diseases (CVD).<h4>Objective</h4>We aimed to investigate the potential casual relationship between serum iron status and CHD and related CVD using a two-sample Mendelian randomization (MR) approach.<h4>Methods</h4>Genetic statistics for single nucleotide polymorphisms (SNPs) between four iron status parameters were identified in a large-scale genome-wide association study (GWAS) conducted by the Iron Status Genetics organization. Three independent single nucleotide polymorphisms (SNPs) (rs1800562, rs1799945, and rs855791) aligned with four iron status biomarkers were used as instrumental variables. CHD and related CVD genetic statistics We used publicly available summary-level GWAS data. Five different MR methods random effects inverse variance weighting (IVW), MR Egger, weighted median, weighted mode, and Wald ratio were used to explore the causal relationship between serum iron status and CHD and related CVD.<h4>Results</h4>In the MR analysis, we found that the causal effect of serum iron (OR = 0.995, 95% CI = 0.992-0.998, <i>p</i> = 0.002) was negatively associated with the odds of coronary atherosclerosis (AS). Transferrin saturation (TS) (OR = 0.885, 95% CI = 0.797-0.982, <i>p</i> = 0.02) was negatively associated with the odds of Myocardial infarction (MI).<h4>Conclusion</h4>This MR analysis provides evidence for a causal relationship between whole-body iron status and CHD development. Our study suggests that a high iron status may be associated with a reduced risk of developing CHD.

HFE
Also flagged:Non-alcoholic fatty liver diseasefamilial hypobetalipoproteinemiaFHBLlipidhypocholesterolemiadyslipidemia
Journal Article 2023-06-13 ✓ 1 Snippet Molk N, Bitenc M, Urlep D, Zerjav Tansek M, Bertok S, Trebusak Podkrajsek K, Sustar U, Kovac J, Battelino T, Debeljak M, Groselj U.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, drug-induced liver steatosis…

Show Full Abstract

<h4>Background</h4>Familial hypobetalipoproteinemia (FHBL) is an autosomal semi-dominant disorder usually caused by variants in the <i>APOB</i> gene that frequently interferes with protein length. Clinical manifestations include malabsorption, non-alcoholic fatty liver disease, low levels of lipid-soluble vitamins, and neurological, endocrine, and hematological dysfunction.<h4>Methods</h4>Genomic DNA was isolated from the blood samples of the pediatric patient with hypocholesterolemia and his parents and brother. Next-generation sequencing (NGS) was performed, and an expanded dyslipidemia panel was employed for genetic analysis. In addition, a systematic review of the literature on FHBL heterozygous patients was performed.<h4>Case report</h4>Genetic investigation revealed the presence of a heterozygous variant in the <i>APOB</i> (NM_000384.3) gene c.6624dup[=], which changes the open reading frame and leads to early termination of translation into the p.Leu2209IlefsTer5 protein (NP_000375.3). The identified variant was not previously reported. Familial segregation analysis confirmed the variant in the mother of the subject, who also has a low level of low-density lipoprotein and non-alcoholic fatty liver disease. We have introduced therapy that includes limiting fats in the diet and adding lipid-soluble vitamins E, A, K, and D and calcium carbonate. We reported 35 individuals with <i>APOB</i> gene variations linked to FHBL in the systematic review.<h4>Conclusion</h4>We have identified a novel pathogenic variant in the <i>APOB</i> gene causing FHBL in pediatric patients with hypocholesterolemia and fatty liver disease. This case illustrates the importance of genetic testing for dyslipidemias in patients with significant decreases in plasma cholesterol as we can avoid damaging neurological and ophthalmological effects by sufficient vitamin supplementation and regular follow-ups.

HFE
Also flagged:ironanemiaIron deficiency anaemiamicronutrient deficienciesanaemiabinding
Journal Article 2023-06-13 ✓ 1 Snippet Naz N, Khan MR, Shabbir MA, Faisal MN.
In-Text Gene Mentions

…of iron orhemochromatosis( 25 ).…

Show Full Abstract

<h4>Introduction</h4>Micronutrients such as minerals and vitamins are required in a minute quantity but play a pivotal role in the functioning of the body. Therefore, deficiency in one of them can lead to lethal health conditions. Iron deficiency anaemia is one of the most common micronutrient deficiencies across the world and is affecting women and children.<h4>Methods</h4>The present study aimed to investigate the anti-anaemic effect of fortified jamun leather on anaemia biomarkers and haematology in anaemic female Sprague Dawley rats. A total of 40 Sprague Dawley rats were used in 4 groups. Iron deficiency anaemia was induced by oral administration of the Asunra drug. The treatments were fed at two dosage levels i.e., 40 and 60% iron-fortified leather. All animals were treated for 60 days and the parameters including biochemical, and histopathology of the kidney and liver were examined.<h4>Results</h4>The experiment's findings showed that the group fed with iron-fortified leather (G<sub>3</sub>) succeeded significantly (<i>P</i> < 0.05) in restoring the serum iron (98.68 ± 2.88 μg/dL), haemoglobin (12.41 ± 0.32 g/dL), ferritin (24.54 ± 1.98 ng/mL) and haematocrit levels (39.30 ± 1.66%) at the end of the 60 days period. Additionally, the treated group's mean values for transferrin and total iron binding capacity were lower than those of the anaemic rats, indicating an improvement in iron levels. The microscopic analysis revealed that treatments had no toxic effects on the kidney and liver tissues, except in the diseased group, which had necrosis and irregular cell structure.<h4>Conclusion</h4>Conclusively, iron-fortified jamun leather helped improve iron deficiency biomarkers and imparted a non-toxic effect on tissues in rats.

CSE1LSTAU1
Also flagged:RNA-binding proteinsColorectal adenocarcinomacancercolon cancerCOADrectal cancer
Journal Article 2023-06-13 ✓ 5 Snippets García-Cárdenas JM, Armendáriz-Castillo I, García-Cárdenas N, Pesantez-Coronel D, López-Cortés A, Indacochea A, Guerrero S.
In-Text Gene Mentions

Interestingly, STAU1 was the most altered RBP in both carcinomas, and yet it has never been correlated with COAD or READ; however, it has been associated with prostate cancer (Marcellus et al., 2021).

Thus, we unraveled new putative roles of NOP56, RBM12, NAT10, FKBP1A, EMG1, and CSE1L in COAD and READ progression.

Our data mining strategy (Figure 1) allowed us to identify four proteins in COAD (NAT10, NOP56, RBM12, and FKBP1A) and two in READ (CSE1L and EMG1) (Figure 7).

Previously prioritized RBPs in (A) colon cancer (NAT10, NOP56, RBM12, and FKBP1A) and (B) rectal cancer (CSE1L and EMG1) were correlated with cancer genes by networking analysis using the HumanNet v3 database (Kim et al., 2022).

In summary, we analyzed and integrated data from 488 COAD and 155 READ patients, 102 cancer cell lines, more than 15,000 immunostainings, and ∼10,000 raw associations between RBPs and cancer genes to unravel new RBPs involved in COAD (NOP56, NAT10, RBM12, and FKBP1A) and READ (EMG1 and CSE1L).

Show Full Abstract

Colorectal adenocarcinoma (COREAD) is the second most deadly cancer and third most frequently encountered malignancy worldwide. Despite efforts in molecular subtyping and subsequent personalized COREAD treatments, multidisciplinary evidence suggests separating COREAD into colon cancer (COAD) and rectal cancer (READ). This new perspective could improve diagnosis and treatment of both carcinomas. RNA-binding proteins (RBPs), as critical regulators of every hallmark of cancer, could fulfill the need to identify sensitive biomarkers for COAD and READ separately. To detect new RBPs involved in COAD and READ progression, here we used a multidata integration strategy to prioritize tumorigenic RBPs. We analyzed and integrated 1) RBPs genomic and transcriptomic alterations from 488 COAD and 155 READ patients, 2) ∼ 10,000 raw associations between RBPs and cancer genes, 3) ∼ 15,000 immunostainings, and 4) loss-of-function screens performed in 102 COREAD cell lines. Thus, we unraveled new putative roles of NOP56, RBM12, NAT10, FKBP1A, EMG1, and CSE1L in COAD and READ progression. Interestingly, FKBP1A and EMG1 have never been related with any of these carcinomas but presented tumorigenic features in other cancer types. Subsequent survival analyses highlighted the clinical relevance of FKBP1A, NOP56, and NAT10 mRNA expression to predict poor prognosis in COREAD and COAD patients. Further research should be performed to validate their clinical potential and to elucidate their molecular mechanisms underlying these malignancies.

HFE
Also flagged:IronHemochromatosis Type 4SLC40A1iron export proteinferroportin diseaseautosomal dominant iron overload disorder
Journal Article 2023-06-13 ✓ 4 Snippets Uguen K, Ka C, Collod-Béroud G, Le Tertre M, Guellec J, Férec C, Béroud C, Callebaut I, Le Gac G.
In-Text Gene Mentions

…condition that resemblesHFE-related hemochromatosis and…

…resembles HFE -relatedhemochromatosisand is associated…

…atypical form ofhemochromatosis(HC) and now…

…natural history ofHFE-related HC; hence,…

Show Full Abstract

SLC40A1 is the sole iron export protein reported in mammals and is a key player in both cellular and systemic iron homeostasis. This unique iron exporter, which belongs to the major facilitator superfamily, is predominantly regulated by the hyposideremic hormone hepcidin. SLC40A1 dysfunction causes ferroportin disease, and autosomal dominant iron overload disorder characterized by cellular iron retention, principally in reticuloendothelial cells, correlating with high serum ferritin and low to normal transferrin saturation. Resistant to hepcidin, SLC40A1 mutations are rather associated with elevated plasma iron and parenchymal iron deposition, a condition that resembles <i>HFE</i>-related hemochromatosis and is associated with more clinical complications. With very few exceptions, only missense variations are reported at the <i>SLC40A1</i> locus; this situation increasingly limits the establishment of pathogenicity. In this mutation update, we provide a comprehensive review of all the pathogenic or likely pathogenic variants, variants of unknown significance, and benign or likely benign <i>SLC40A1</i> variants. The classification is essentially determined using functional, structural, segregation, and recurrence data. We furnish new information on genotype-phenotype correlations for loss-of-function, gain-of-function, and other <i>SLC40A1</i> variants, confirming the existence of wide clinical heterogeneity and the potential for misdiagnosis. All information is recorded in a locus-specific online database.

Also flagged:tuberculosisleprosydiphtheriaBuruli ulcernon-tuberculous mycobacterialenvelope
Journal Article 2023-06-12 No Snippets Dzigba P, Rylski AK, Angera IJ, Banahene N, Kavunja HW, Greenlee-Wacker MC, Swarts BM.
Show Full Abstract

Mycobacteria and other organisms in the order Mycobacteriales cause a range of significant human diseases, including tuberculosis, leprosy, diphtheria, Buruli ulcer, and non-tuberculous mycobacterial (NTM) disease. However, the intrinsic drug tolerance engendered by the mycobacterial cell envelope undermines conventional antibiotic treatment and contributes to acquired drug resistance. Motivated by the need to augment antibiotics with novel therapeutic approaches, we developed a strategy to specifically decorate mycobacterial cell surface glycans with antibody-recruiting molecules (ARMs), which flag bacteria for binding to human-endogenous antibodies that enhance macrophage effector functions. Mycobacterium-specific ARMs consisting of a trehalose targeting moiety and a dinitrophenyl hapten (Tre-DNPs) were synthesized and shown to specifically incorporate into outer-membrane glycolipids of <i>Mycobacterium smegmatis</i> via trehalose metabolism, enabling recruitment of anti-DNP antibodies to the mycobacterial cell surface. Phagocytosis of Tre-DNP-modified <i>M. smegmatis</i> by macrophages was significantly enhanced in the presence of anti-DNP antibodies, demonstrating proof-of-concept that our strategy can augment the host immune response. Because the metabolic pathways responsible for cell surface incorporation of Tre-DNPs are conserved in all Mycobacteriales organisms but absent from other bacteria and humans, the reported tools may be enlisted to interrogate host-pathogen interactions and develop immune-targeting strategies for diverse mycobacterial pathogens.

HFE
Also flagged:chronic granulomatous diseaseinfectionSARS-CoV2 infectionCOVID-19 AssociatedPulmonary aspergillosisCAPA
Journal Article 2023-06-12 ✓ 2 Snippets Ribeiro HAL, Scindia Y, Mehrad B, Laubenbacher R.
In-Text Gene Mentions

Hemochromatosismice Hfe-/- mice…

…Hemochromatosis miceHfe-/- mice had more…

Show Full Abstract

The opportunistic fungus Aspergillus fumigatus infects the lungs of immunocompromised hosts, including patients undergoing chemotherapy or organ transplantation. More recently however, immunocompetent patients with severe SARS-CoV2 have been reported to be affected by COVID-19 Associated Pulmonary Aspergillosis (CAPA), in the absence of the conventional risk factors for invasive aspergillosis. This paper explores the hypothesis that contributing causes are the destruction of the lung epithelium permitting colonization by opportunistic pathogens. At the same time, the exhaustion of the immune system, characterized by cytokine storms, apoptosis, and depletion of leukocytes may hinder the response to A. fumigatus infection. The combination of these factors may explain the onset of invasive aspergillosis in immunocompetent patients. We used a previously published computational model of the innate immune response to infection with Aspergillus fumigatus. Variation of model parameters was used to create a virtual patient population. A simulation study of this virtual patient population to test potential causes for co-infection in immunocompetent patients. The two most important factors determining the likelihood of CAPA were the inherent virulence of the fungus and the effectiveness of the neutrophil population, as measured by granule half-life and ability to kill fungal cells. Varying these parameters across the virtual patient population generated a realistic distribution of CAPA phenotypes observed in the literature. Computational models are an effective tool for hypothesis generation. Varying model parameters can be used to create a virtual patient population for identifying candidate mechanisms for phenomena observed in actual patient populations.

SOX6
Also flagged:NucleosomePioneer transcription factorschromatinbindingSoxSHL2
Journal Article 2023-06-12 ✓ 5 Snippets Ozden B, Boopathi R, Barlas AB, Lone IN, Bednar J, Petosa C, Kale S, Hamiche A, Angelov D, Dimitrov S, Karaca E.
In-Text Gene Mentions

Typically, the Sox6 HMG domain was mixed with DNA or a nucleosome(50 nM) in a 20 μL reaction containing 1× binding buffer(10 mM Tris, pH 7.4, 75 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol (DTT),100 mg/mL bovine serum albumin (BSA), 0.01% NP40 and 5% glycerol).The naked DNA was supplemented with carrier nucleosomes to a finalconcentration equal to those of labeled nucleosomes.

The HMG domainof the human Sox6 (618–697 amino acids) gene was cloned inthe pET28b vector in between NdeI and XhoI restriction sites.

For a givenbinding site, these bands were normalized to the ′′internalstandard′′ bands, belonging to four to five other guanines withinthe respective DNA ladder in the absence of Sox6.

…for Sox11 andSox6), we performed a…

…homology model ofSox6.…

Show Full Abstract

Pioneer transcription factors (PTFs) have the remarkable ability to directly bind to chromatin to stimulate vital cellular processes. In this work, we dissect the universal binding mode of Sox PTF by combining extensive molecular simulations and physiochemistry approaches, along with DNA footprinting techniques. As a result, we show that when Sox consensus DNA is located at the solvent-facing DNA strand, Sox binds to the compact nucleosome without imposing any significant conformational changes. We also reveal that the base-specific Sox:DNA interactions (base reading) and Sox-induced DNA changes (shape reading) are concurrently required for sequence-specific nucleosomal DNA recognition. Among three different nucleosome positions located on the positive DNA arm, a sequence-specific reading mechanism is solely satisfied at the superhelical location 2 (SHL2). While SHL2 acts transparently for solvent-facing Sox binding, among the other two positions, SHL4 permits only shape reading. The final position, SHL0 (dyad), on the other hand, allows no reading mechanism. These findings demonstrate that Sox-based nucleosome recognition is essentially guided by intrinsic nucleosome properties, permitting varying degrees of DNA recognition.

DCC
Also flagged:memorieslong-termprotein synthesissynapsescAMP response element-binding proteinCREB
Journal Article 2023-06-12 ✓ 1 Snippet Sgammeglia N, Widmer YF, Kaldun JC, Fritsch C, Bruggmann R, Sprecher SG.
In-Text Gene Mentions

…of Netrin-1 toDCCseems to be…

Show Full Abstract

The formation of long-term memories requires changes in the transcriptional program and de novo protein synthesis. One of the critical regulators for long-term memory (LTM) formation and maintenance is the transcription factor CREB. Genetic studies have dissected the requirement of CREB activity within memory circuits, however less is known about the genetic mechanisms acting downstream of CREB and how they may contribute defining LTM phases. To better understand the downstream mechanisms, we here used a targeted DamID approach (TaDa). We generated a CREB-Dam fusion protein using the fruit fly Drosophila melanogaster as model. Expressing CREB-Dam in the mushroom bodies (MBs), a brain center implicated in olfactory memory formation, we identified genes that are differentially expressed between paired and unpaired appetitive training paradigm. Of those genes we selected candidates for an RNAi screen in which we identified genes causing increased or decreased LTM.

SERPINC1
Also flagged:Venous thromboembolismdeathcancersolid tumourscervical cancerCC
Journal Article 2023-06-12 ✓ 1 Snippet Neto BV, Tavares V, da Silva JB, Liz-Pimenta J, Marques IS, Carvalho L, Salgado L, Pereira D, Medeiros R.
In-Text Gene Mentions

…, PROS1 andSERPINC1), but mainly…

Show Full Abstract

Venous thromboembolism (VTE) is a leading cause of death among cancer patients. Khorana score (KS) is the most studied tool to predict cancer-related VTE, however, it exerts poor sensitivity. Several single-nucleotide polymorphisms (SNPs) have been associated with VTE risk in the general population, but whether they are predictors of cancer-related VTE is a matter of discussion. Compared to other solid tumours, little is known about VTE in the setting of cervical cancer (CC) and whether thrombogenesis-related polymorphisms could be valuable biomarkers in patients with this neoplasia. This study aims to analyse the effect of VTE occurrence on the prognosis of CC patients, explore the predictive capability of KS and the impact of thrombogenesis-related polymorphisms on CC-related VTE incidence and patients' prognosis regardless of VTE. A profile of eight SNPs was evaluated. A retrospective hospital-based cohort study was conducted with 400 CC patients under chemoradiotherapy. SNP genotyping was carried on by using TaqMan® Allelic Discrimination methodology. Time to VTE occurrence and overall survival were the two measures of clinical outcome evaluated. The results indicated that VTE occurrence (8.5%) had a significant impact on the patient's survival (log-rank test, P < 0.001). KS showed poor performance (KS ≥ 3, χ<sup>2</sup>, P = 0.191). PROCR rs10747514 and RGS7 rs2502448 were significantly associated with the risk of CC-related VTE development (P = 0.021 and P = 0.006, respectively) and represented valuable prognostic biomarkers regardless of VTE (P = 0.004 and P = 0.010, respectively). Thus, thrombogenesis-related genetic polymorphisms may constitute valuable biomarkers among CC patients allowing a more personalized clinical intervention.

ECI2
Also flagged:CancerIrg1AlbinsulinglucoseNAFLD
Journal Article 2023-06-12 ✓ 2 Snippets Weiss JM, Palmieri EM, Gonzalez-Cotto M, Bettencourt IA, Megill EL, Snyder NW, McVicar DW.
In-Text Gene Mentions

…, Echs1 andEci2) in the…

…, Echs1 ,Eci2and Hadha )…

Show Full Abstract

Itaconate, the product of the decarboxylation of cis-aconitate, regulates numerous biological processes. We and others have revealed itaconate as a regulator of fatty acid β-oxidation, generation of mitochondrial reactive oxygen species and the metabolic interplay between resident macrophages and tumors. In the present study, we show that itaconic acid is upregulated in human non-alcoholic steatohepatitis and a mouse model of non-alcoholic fatty liver disease. Male mice deficient in the gene responsible for itaconate production (immunoresponsive gene (Irg)-1) have exacerbated lipid accumulation in the liver, glucose and insulin intolerance and mesenteric fat deposition. Treatment of mice with the itaconate derivative, 4-octyl itaconate, reverses dyslipidemia associated with high-fat diet feeding. Mechanistically, itaconate treatment of primary hepatocytes reduces lipid accumulation and increases their oxidative phosphorylation in a manner dependent upon fatty acid oxidation. We propose a model whereby macrophage-derived itaconate acts in trans upon hepatocytes to modulate the liver's ability to metabolize fatty acids.

Also flagged:mesothelinMSLNsolid tumorschimeric antigen receptorcytokinerelease syndrome
Journal Article 2023-06-12 No Snippets Haas AR, Golden RJ, Litzky LA, Engels B, Zhao L, Xu F, Taraszka JA, Ramones M, Granda B, Chang WJ, Jadlowsky J, Shea KM, Runkle A, Chew A, Dowd E, Gonzalez V, Chen F, Liu X, Fang C, Jiang S, Davis MM, Sheppard NC, Zhao Y, Fraietta JA, Lacey SF, Plesa G, Melenhorst JJ, Mansfield K, Brogdon JL, Young RM, Albelda SM, June CH, Tanyi JL.
Show Full Abstract

Multiple clinical studies have treated mesothelin (MSLN)-positive solid tumors by administering MSLN-directed chimeric antigen receptor (CAR) T cells. Although these products are generally safe, efficacy is limited. Therefore, we generated and characterized a potent, fully human anti-MSLN CAR. In a phase 1 dose-escalation study of patients with solid tumors, we observed two cases of severe pulmonary toxicity following intravenous infusion of this product in the high-dose cohort (1-3 × 10<sup>8</sup> T cells per m<sup>2</sup>). Both patients demonstrated progressive hypoxemia within 48 h of infusion with clinical and laboratory findings consistent with cytokine release syndrome. One patient ultimately progressed to grade 5 respiratory failure. An autopsy revealed acute lung injury, extensive T cell infiltration, and accumulation of CAR T cells in the lungs. RNA and protein detection techniques confirmed low levels of MSLN expression by benign pulmonary epithelial cells in affected lung and lung samples obtained from other inflammatory or fibrotic conditions, indicating that pulmonary pneumocyte and not pleural expression of mesothelin may lead to dose-limiting toxicity. We suggest patient enrollment criteria and dosing regimens of MSLN-directed therapies consider the possibility of dynamic expression of mesothelin in benign lung with a special concern for patients with underlying inflammatory or fibrotic conditions.

HTT
Also flagged:neurofilament lightaxonalHDneurodegenerative disorderHuntingtinbehavioural
Journal Article 2023-06-12 ✓ 4 Snippets Parkin GM, Thomas EA, Corey-Bloom J.
In-Text Gene Mentions

Huntington’s Disease (HD) is a genetic, neurodegenerative disorder caused by an autosomal dominant mutation in the Huntingtin (HTT) gene, which results in an expansion of a trinucleotide (CAG) repeats in exon one.

…in the Huntingtin (HTT) gene, which results…

…Carriers of theHTTgene mutation with…

…of inheriting theHTTmutation, were recruited…

Show Full Abstract

<h4>Background</h4>The recently proposed Huntington's Disease Integrated Staging System (HD-ISS) categorises individuals with the Huntintin genetic mutation into disease progression cohorts based on quantitative neuroimaging, cognitive, and functional markers for research purposes. Unfortunately, many research studies do not collect quantitative neuroimaging data, and so the authors of the HD-ISS have subsequently provided approximated cohort thresholds based on disease and clinical data alone. However, these are rough proxies that aim to maximise stage separation, and should not be considered as 1:1 substitutes for the HD-ISS. Notably, no wet biomarker met the stringent criteria required to be considered a landmark for HD-ISS categorisation. We have previously shown that levels of plasma neurofilament light (NfL), a neuronal marker associated with axonal injury, are associated with predicted years to clinical motor diagnosis (CMD). Our objective in the current study was to determine whether HD-ISS categorisation, particularly for stages prior to CMD, could be improved with consideration of plasma NfL levels.<h4>Methods</h4>A total of 290 blood samples, and clinical measures, were collected from participants across all HD-ISS stages: n = 50 [Stage 0], n = 64 [Stage 1], n = 63 [Stage 2], n = 63 [Stage 3], as well as 50 healthy controls. Plasma NfL levels were measured using a Meso Scale Discovery assay.<h4>Findings</h4>Cohorts differed by age, cognitive function, CAG repeat length, and select UHDRS measures. Plasma NfL levels also differed significantly across cohorts. Approximately 50% of Stage 1 participants had plasma NfL levels indicative of predicted CMD within ten years.<h4>Interpretation</h4>Our findings suggest that plasma NfL levels may have use in enriching Stage 1 membership into sub-groups that are less than, and within, predicted 10 years until CMD.<h4>Funding</h4>This work was supported by the National Institutes of Health (NS111655 to E.A.T.); the UCSD Huntington's Disease Society of America Center of Excellence; and the UCSD Shiley-Marcos Alzheimer's Disease Research Center (NIH-NIA P30 AG062429).

Also flagged:chromosomenucleuswaterethanolsaltagarose
Journal Article 2023-06-12 No Snippets Barría A, Peñaloza C, Papadopoulou A, Mahmuddin M, Doeschl-Wilson A, Benzie JAH, Houston RD, Wiener P.
Show Full Abstract

Nile tilapia (<i>Oreochromis niloticus</i>) is among the most farmed finfish worldwide, distributed across different environmental conditions. Its wide distribution has mainly been facilitated by several breeding programs and widespread dissemination of genetically improved strains. In the first Nile tilapia study exploiting a whole-genome pooled sequencing (Poolseq) approach, we identified the genetic structure and signatures of selection in diverse, farmed Nile tilapia populations, with a particular focus on the GIFT strain, developed in the 1980s, and currently managed by WorldFish (<i>GIFTw</i>). We also investigated important farmed strains from The Philippines and Africa. Using both SNP array data and Poolseq SNPs, we characterized the population structure of these samples. We observed the greatest separation between the Asian and African populations and greater admixture in the Asian populations than in the African ones. We also established that the SNP array data were able to successfully resolve relationships between these diverse Nile tilapia populations. The Poolseq data identified genomic regions with high levels of differentiation (<i>F</i> <sub>ST</sub>) between <i>GIFTw</i> and the other populations. Gene ontology terms associated with mesoderm development were significantly enriched in the genes located in these regions. A region on chromosome <i>Oni06</i> was genetically differentiated in pairwise comparisons between <i>GIFTw</i> and all other populations. This region contains genes associated with muscle-related traits and overlaps with a previously published QTL for fillet yield, suggesting that these traits may have been direct targets for selection on GIFT. A nearby region was also identified using XP-EHH to detect genomic differentiation using the SNP array data. Genomic regions with high or extended homozygosity within each population were also identified. This study provides putative genomic landmarks associated with the recent domestication process in several Nile tilapia populations, which could help to inform their genetic management and improvement.

PEBP1
Also flagged:PEBP-like ProteinPhosphatidylethanolamine-binding proteinPEBPHRYbindingphosphatidylethanolamine
Journal Article 2023-06-12 ✓ 2 Snippets Cheng B, Tao N, Ma Y, Chai H, Liu P, Chen W, Zhao Y.
In-Text Gene Mentions

…] and namedPEBP1due to its…

PEBP1is widely involved…

Show Full Abstract

Phosphatidylethanolamine-binding protein (PEBP) is widely involved in various physiological behaviors, such as the transition from vegetative growth to reproductive growth in plants, tumorigenesis in the human, etc. However, few functional studies have examined <i>pebp</i> genes affecting the development of fungi. In this study, <i>Capebp2</i> was cloned from <i>Cyclocybe aegerita</i> AC0007 strains based on the genome sequence and gene prediction, and the sequence alignment of CaPEBP2 with other PEBP proteins from other biological sources including plant, animal, fungi, and bacteria indicated that PEBP had low sequence similarity in fungi, whereas all protein sequences had some conserved motifs such as DPDAP and HRY. Expression analysis showed the transcription level of <i>Capebp2</i> increased approximately 20-fold in fruiting bodies compared with mycelia. To uncover the function of <i>Capebp2</i> in <i>C. aegetita</i> development, <i>Capebp2</i> was cloned into a pATH vector driven by the <i>actin</i> promoter for obtaining overexpression transformant lines. Fruiting experiments showed the transformed strains overexpressing <i>Capebp2</i> exhibited redifferentiation of the cap on their surface, including intact fruiting bodies or partial lamella during fruiting development stage, and the longitudinal section indicated that all regenerated bodies or lamella sprouted from the flesh and shared the epidermis with the mother fruiting bodies. In summary, the sequence characterization of <i>Capebp2</i>, expression level during different development stages, and function on fruiting body development were documented in this study, and these findings provided a reference to study the role of <i>pebp</i> in the development process of basidiomycetes. Importantly, gene mining of <i>pebp</i>, function characterization, and the regulating pathways involved need to be uncovered in further studies.

Also flagged:Transcription FactorX-linked deafnesshereditaryhearing lossdeafnesshearing
Journal Article 2023-06-12 No Snippets Bernardinelli E, Huber F, Roesch S, Dossena S.
Show Full Abstract

X-linked deafness (DFNX) is estimated to account for up to 2% of cases of hereditary hearing loss and occurs in both syndromic and non-syndromic forms. <i>POU3F4</i> is the gene most commonly associated with X-linked deafness (DFNX2, DFN3) and accounts for about 50% of the cases of X-linked non-syndromic hearing loss. This gene codes for a transcription factor of the POU family that plays a major role in the development of the middle and inner ear. The clinical features of POU3F4-related hearing loss include a pathognomonic malformation of the inner ear defined as incomplete partition of the cochlea type 3 (IP-III). Often, a perilymphatic gusher is observed upon stapedectomy during surgery, possibly as a consequence of an incomplete separation of the cochlea from the internal auditory canal. Here we present an overview of the pathogenic gene variants of <i>POU3F4</i> reported in the literature and discuss the associated clinical features, including hearing loss combined with additional phenotypes such as cognitive and motor developmental delays. Research on the transcriptional targets of POU3F4 in the ear and brain is in its early stages and is expected to greatly advance our understanding of the pathophysiology of POU3F4-linked hearing loss.

Also flagged:aortic aneurysmchromosomeslocalizationdegradationtranscriptional regulatorsMBL
Journal Article 2023-06-12 No Snippets Lichołai S, Studzińska D, Plutecka H, Gubała T, Sanak M.
Show Full Abstract

Non-coding RNAs constitute a heterogeneous group of molecules that lack the ability to encode proteins but retain the potential ability to influence cellular processes through a regulatory mechanism. Of these proteins, microRNAs, long non-coding RNAs, and more recently, circular RNAs have been the most extensively described. However, it is not entirely clear how these molecules interact with each other. For circular RNAs, the basics of their biogenesis and properties are also lacking. Therefore, in this study we performed a comprehensive analysis of circular RNAs in relation to endothelial cells. We identified the pool of circular RNAs present in the endothelium and showed their spectrum and expression across the genome. Using different computational strategies, we proposed approaches to search for potentially functional molecules. In addition, using data from an in vitro model that mimics conditions in the endothelium of an aortic aneurysm, we demonstrated altered expression levels of circRNAs mediated by microRNAs.

HFE
Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDnonalcoholic steatohepatitiscirrhosishepatocellular carcinomadeath
Journal Article 2023-06-12 ✓ 1 Snippet Schreiner AD, Sattar N.
In-Text Gene Mentions

…antibody), a serologichemochromatosisassessment (ferritin and…

Show Full Abstract

Despite its increasing prevalence, nonalcoholic fatty liver disease (NAFLD) remains under-diagnosed in primary care. Timely diagnosis is critical, as NAFLD can progress to nonalcoholic steatohepatitis, fibrosis, cirrhosis, hepatocellular carcinoma, and death; furthermore, NAFLD is also a risk factor linked to cardiometabolic outcomes. Identifying patients with NAFLD, and particularly those at risk of advanced fibrosis, is important so that healthcare practitioners can optimize care delivery in an effort to prevent disease progression. This review debates the practical issues that primary care physicians encounter when managing NAFLD, using a patient case study to illustrate the challenges and decisions that physicians face. It explores the pros and cons of different diagnostic strategies and tools that physicians can adopt in primary care settings, depending on how NAFLD presents and progresses. We discuss the importance of prescribing lifestyle changes to achieve weight loss and mitigate disease progression. A diagnostic and management flow chart is provided, showing the key points of assessment for primary care physicians. The advantages and disadvantages of advanced fibrosis risk assessments in primary care settings and the factors that influence patient referral to a hepatologist are also reviewed.

Also flagged:mitochondriametalsoxidesgoldironsilver
Journal Article 2023-06-12 No Snippets Misra SK, Rosenholm JM, Pathak K.
Show Full Abstract

<b>Background:</b> The application of metallic nanoparticles as a novel therapeutic tool has significant potential to facilitate the treatment and diagnosis of mitochondria-based disorders. Recently, subcellular mitochondria have been trialed to cure pathologies that depend on their dysfunction. Nanoparticles made from metals and their oxides (including gold, iron, silver, platinum, zinc oxide, and titanium dioxide) have unique modi operandi that can competently rectify mitochondrial disorders. <b>Materials:</b> This review presents insight into the recent research reports on exposure to a myriad of metallic nanoparticles that can alter the dynamic ultrastructure of mitochondria (via altering metabolic homeostasis), as well as pause ATP production, and trigger oxidative stress. The facts and figures have been compiled from more than a hundred PubMed, Web of Science, and Scopus indexed articles that describe the essential functions of mitochondria for the management of human diseases. <b>Result:</b> Nanoengineered metals and their oxide nanoparticles are targeted at the mitochondrial architecture that partakes in the management of a myriad of health issues, including different cancers. These nanosystems not only act as antioxidants but are also fabricated for the delivery of chemotherapeutic agents. However, the biocompatibility, safety, and efficacy of using metal nanoparticles is contested among researchers, which will be discussed further in this review.

Also flagged:hepatoblastomaHBliver tumorcancerUBE2Ccell cycle
Journal Article 2023-06-12 No Snippets Nousiainen R, Eloranta K, Isoaho N, Cairo S, Wilson DB, Heikinheimo M, Pihlajoki M.
Show Full Abstract

Hepatoblastoma (HB) is the most common malignant liver tumor among children. To gain insight into the pathobiology of HB, we performed RNA sequence analysis on 5 patient-derived xenograft lines (HB-243, HB-279, HB-282, HB-284, HB-295) and 1 immortalized cell line (HUH6). Using cultured hepatocytes as a control, we found 2,868 genes that were differentially expressed in all of the HB lines on mRNA level. The most upregulated genes were <i>ODAM</i>, <i>TRIM71</i>, and <i>IGDCC3</i>, and the most downregulated were <i>SAA1</i>, <i>SAA2</i>, and <i>NNMT</i>. Protein-protein interaction analysis identified ubiquitination as a key pathway dysregulated in HB. <i>UBE2C</i>, encoding an E2 ubiquitin ligase often overexpressed in cancer cells, was markedly upregulated in 5 of the 6 HB cell lines. Validation studies confirmed UBE2C immunostaining in 20 of 25 HB tumor specimens <i>versus</i> 1 of 6 normal liver samples. The silencing of <i>UBE2C</i> in two HB cell models resulted in decreased cell viability. RNA sequencing analysis showed alterations in cell cycle regulation after <i>UBE2C</i> knockdown. <i>UBE2C</i> expression in HB correlated with inferior patient survival. We conclude that <i>UBE2C</i> may hold prognostic utility in HB and that the ubiquitin pathway is a potential therapeutic target in this tumor.

FBXL4
Also flagged:metabolic disordersmitochondrialrespiratory chaingenetic diseasesmitochondrial diseaseslimb-girdle muscular dystrophy
Journal Article 2023-06-12 ✓ 4 Snippets Gedikbasi A, Toksoy G, Karaca M, Gulec C, Balci MC, Gunes D, Gunes S, Aslanger AD, Unverengil G, Karaman B, Basaran S, Demirkol M, Gokcay GF, Uyguner ZO.
In-Text Gene Mentions

…AARS2, EARS2, ECHS1,FBXL4, MICOS13, NDUFAF6, OXCT1,…

…ing/mitochondrial biogenesis (FBXL4, NDUFAF6, MICOS13, POLG,…

…TheFBXL4gene encodes a…

…(c.1444C>T/p.(R482W)) in theFBXL4gene and the…

Show Full Abstract

<b>Background:</b> Mitochondrial diseases are the most common group of inherited metabolic disorders, causing difficulties in definite diagnosis due to clinical and genetic heterogeneity. Clinical components are predominantly associated with pathogenic variants shown in nuclear or mitochondrial genomes that affect vital respiratory chain function. The development of high-throughput sequencing technologies has accelerated the elucidation of the genetic etiology of many genetic diseases that previously remained undiagnosed. <b>Methods:</b> Thirty affected patients from 24 unrelated families with clinical, radiological, biochemical, and histopathological evaluations considered for mitochondrial diseases were investigated. DNA isolated from the peripheral blood samples of probands was sequenced for nuclear exome and mitochondrial DNA (mtDNA) analyses. MtDNA sequencing was also performed from the muscle biopsy material in one patient. For segregation, Sanger sequencing is performed for pathogenic alterations in five other affected family members and healthy parents. <b>Results:</b> Exome sequencing revealed 14 different pathogenic variants in nine genes encoding mitochondrial function peptides (<i>AARS2, EARS2, ECHS1, FBXL4, MICOS13, NDUFAF6, OXCT1, POLG</i>, and <i>TK2</i>) in 12 patients from nine families and four variants in genes encoding important for muscle structure (<i>CAPN3, DYSF,</i> and <i>TCAP</i>) in six patients from four families. Three probands carried pathogenic mtDNA variations in two genes (<i>MT-ATP6</i> and <i>MT-TL1</i>). Nine variants in five genes are reported for the first time with disease association: (<i>AARS2</i>: c.277C>T/p.(R93*), c.845C>G/p.(S282C); <i>EARS2</i>: c.319C>T/p.(R107C), c.1283delC/p.(P428Lfs*); <i>ECHS1</i>: c.161G>A/p.(R54His); c.202G>A/p.(E68Lys); <i>NDUFAF6</i>: c.479delA/p.(N162Ifs*27); and <i>OXCT1</i>: c.1370C>T/p.(T457I), c.1173-139G>T/p.(?). <b>Conclusion:</b> Bi-genomic DNA sequencing clarified genetic etiology in 67% (16/24) of the families. Diagnostic utility by mtDNA sequencing in 13% (3/24) and exome sequencing in 54% (13/24) of the families prioritized searching for nuclear genome pathologies for the first-tier test. Weakness and muscle wasting observed in 17% (4/24) of the families underlined that limb-girdle muscular dystrophy, similar to mitochondrial myopathy, is an essential point for differential diagnosis. The correct diagnosis is crucial for comprehensive genetic counseling of families. Also, it contributes to making treatment-helpful referrals, such as ensuring early access to medication for patients with mutations in the TK2 gene.

SUDS3
Also flagged:osteosarcomabone cancermetastatic diseasetumorscell cycle checkpointschromosome
Journal Article 2023-06-12 ✓ 1 Snippet da Costa MEM, Droit R, Khneisser P, Gomez-Brouchet A, Adam-de-Beaumais T, Nolla M, Signolles N, Torrejon J, Lombard B, Loew D, Ayrault O, Scoazec JY, Geoerger B, Vassal G, Marchais A, Gaspar N.
In-Text Gene Mentions

…derived models, NCOR1 (histone desacethylase complexdesacethylase complex) and…

Show Full Abstract

Osteosarcoma is a rare bone cancer in adolescents and young adults with a dismal prognosis because of metastatic disease and chemoresistance. Despite multiple clinical trials, no improvement in outcome has occurred in decades. There is an urgent need to better understand resistant and metastatic disease and to generate <i>in vivo</i> models from relapsed tumors. We developed eight new patient-derived xenograft (PDX) subcutaneous and orthotopic/paratibial models derived from patients with recurrent osteosarcoma and compared the genetic and transcriptomic landscapes of the disease progression at diagnosis and relapse with the matching PDX. Whole exome sequencing showed that driver and copy-number alterations are conserved from diagnosis to relapse, with the emergence of somatic alterations of genes mostly involved in DNA repair, cell cycle checkpoints, and chromosome organization. All PDX patients conserve most of the genetic alterations identified at relapse. At the transcriptomic level, tumor cells maintain their ossification, chondrocytic, and trans-differentiation programs during progression and implantation in PDX models, as identified at the radiological and histological levels. A more complex phenotype, like the interaction with immune cells and osteoclasts or cancer testis antigen expression, seemed conserved and was hardly identifiable by histology. Despite NSG mouse immunodeficiency, four of the PDX models partially reconstructed the vascular and immune-microenvironment observed in patients, among which the macrophagic TREM2/TYROBP axis expression, recently linked to immunosuppression. Our multimodal analysis of osteosarcoma progression and PDX models is a valuable resource to understand resistance and metastatic spread mechanisms, as well as for the exploration of novel therapeutic strategies for advanced osteosarcoma.

Also flagged:SARS‑COV2 infectionAcute pancreatitisillnesscoronavirus disease 2019COVID-19pancreatitis
Journal Article 2023-06-12 No Snippets Pădureanu V, Caragea DC, Florescu MM, Vladu IM, Rădulescu PM, Florescu DN, Rădulescu D, Pădureanu R, Efrem IC.
Show Full Abstract

Acute pancreatitis is characterized as an inflammatory illness that is life-threatening and causes necrosis as well as simple edema when pancreatic enzymes are activated intraglandularly. It is not known whether severe acute respiratory syndrome coronavirus 2 causes acute pancreatitis. Patients with acute pancreatitis who test positive for coronavirus disease 2019 (COVID-19) frequently have biliary or alcoholic causes. It is unclear how common acute pancreatitis is in patients with COVID-19. By contrast with patients without COVID-19, however, COVID-19-positive patients with acute pancreatitis have a higher mortality as well as a higher risk of necrosis and admission to an intensive care unit. The most common cause of mortality in COVID-19-positive individuals with concurrent severe pancreatitis is acute respiratory distress syndrome. The present study discussed research on the link between COVID-19 infection and acute pancreatitis.

Also flagged:colorectal cancercancerdeathgene expressiontranscription factorstumor
Journal Article 2023-06-12 No Snippets Guo M, Li X, Li J, Li B.
Show Full Abstract

Colorectal cancer (CRC) is the third most diagnosed malignancy and the second leading cause of cancer death. The objective was to identify novel hub genes that were helpful for prognosis and targeted therapy in CRC. GSE23878, GSE24514, GSE41657, GSE81582 were filtered from the gene expression omnibus (GEO). Differentially expressed genes (DEGs) were identified through GEO2R, which were enriched in the GO term and KEGG pathway in DAVID. PPI network was constructed and analyzed using STRING and hub genes were screened out. The relationships between hub genes and prognoses in CRC were evaluated in GEPIA based on the cancer genome atlas (TCGA) and genotype-tissue expression (GTEx). The transcription factors and miRNA-mRNA interaction networks for hub genes were performed using miRnet and miRTarBase. The relationship between hub genes and tumor-infiltrating lymphocytes were analyzed in TIMER. The protein levels of hub genes were identified in HPA. The expression levels of hub gene in CRC and its effect on the biological effect of CRC cells were identified <i>in vitro</i>. As hub genes, the mRNA levels of BIRC5, CCNB1, KIF20A, NCAPG, and TPX2 were highly expressed in CRC and had excellent prognostic value. The BIRC5, CCNB1, KIF20A, NCAPG, and TPX2 were closely associated with transcription factors, miRNAs, tumor-infiltrating lymphocytes, suggesting their involvement in the regulation of CRC. BIRC5 highly expressed in CRC tissues and cells, and promoted the proliferation, migration, and invasion of CRC cells. BIRC5, CCNB1, KIF20A, NCAPG, and TPX2 are hub genes that serve as promising prognostic biomarkers in CRC. BIRC5 plays an important role in the development and progression of CRC.

HFE
Also flagged:NorethisteroneLiver Injurygynecological disordersmenorrhagiabreast cancerhepatitis
Journal Article 2023-06-12 ✓ 2 Snippets Rather JI, Maqsood Wani M, Lone KBM, Rasheed R.
In-Text Gene Mentions

…for Wilson’s disease,hemochromatosis, and autoimmune hepatitis…

…Screening forhemochromatosiswas negative.…

Show Full Abstract

Norethisterone, a commonly used oral contraceptive, and treatment for various gynecological disorders such as menorrhagia, abnormal uterine bleeding, and breast cancer, has been associated with multiple liver injuries. These injuries can manifest as hepatitis or cholestatic types of injury, benign neoplasms, peliosis hepatis, sinusoidal obstruction syndrome, and enlargement of existing hemangiomas. This report presents three cases in which liver enzyme levels were elevated due to norethisterone intake. Two of the cases were individuals undergoing evaluation as potential kidney donors in the nephrology department for their spouses, while the third case involved a patient with chronic kidney disease (CKD) stage-5 on maintenance hemodialysis. Regular follow-up of these patients, particularly due to the significance of two being kidney donors and one having advanced CKD, allowed for early detection of asymptomatic liver enzyme elevation and prompt discontinuation of norethisterone. Prescribing norethisterone is common in gynecological settings, including ours. To assess gynecologists' knowledge regarding norethisterone-related side effects, we conducted an online survey, the results of which are discussed in this report.

bioRxiv 2023-06-12 Preprint (No Snippets API) Shaker MR, Slonchak A, Al-mhanawi B, Morrison SD, Sng JDJ, Cooper-White J, Khromykh AA, Wolvetang EJ.
Show Full Abstract

<h4>ABSTRACT</h4> Why individuals with Down Syndrome (DS, trisomy 21) are particularly susceptible to SARS CoV-2 induced neuropathology remains largely unclear. Since the choroid plexus (CP) performs important barrier and immune-interface functions, secretes the cerebrospinal fluid and strongly expresses the ACE2 receptor and the chromosome 21 encoded TMPRSS2 protease, we hypothesized that the CP could play a role in establishing SARS-CoV-2 infection in the brain. To investigate the role of the choroid plexus in SARS-CoV-2 central nervous system infection in DS, we established a new type of brain organoid from DS and isogenic euploid control iPSC that consists of a core of appropriately patterned functional cortical neuronal cell types that is surrounded by a patent and functional choroid plexus (CPCOs). Remarkably, DS-CPCOs not only recapitulated abnormal features of DS cortical development but also revealed defects in ciliogenesis and epithelial cell polarity of the developing choroid plexus. We next demonstrate that the choroid plexus layer facilitates SARS-CoV-2 replication and infection of cortical neuronal cells, and that this is increased in DS-CPCOs. We further show that inhibition of TMPRSS2 and Furin activity inhibits SARS-CoV-2 replication in DS CPCOs to the level observed in euploid organoids. We conclude that CPCOs are a useful model for dissecting the role of the choroid plexus in euploid and DS forebrain development and enables screening for therapeutics that can inhibit SARS-CoV-2 induced neuro-pathogenesis.

PEBP1
Also flagged:Alzheimer's diseaseADsecretionextracellularorganization
Journal Article 2023-06-11 ✓ 3 Snippets Matafora V, Gorb A, Yang F, Noble W, Bachi A, Perez-Nievas BG, Jimenez-Sanchez M.
In-Text Gene Mentions

…example, ALDHL1 orPEBP1, whose secretion is…

…COL1A2, PCOLCE, PDIA3,PEBP1, PPIA, PPIB, PREP,…

PEBP1, PTGDS, SOD3, CHGA,…

Show Full Abstract

Astrocytes associate with amyloid plaques in Alzheimer's disease (AD). Astrocytes react to changes in the brain environment, including increasing concentrations of amyloid-β (Aβ). However, the precise response of astrocytes to soluble small Aβ oligomers at concentrations similar to those present in the human brain has not been addressed. In this study, we exposed astrocytes to media from neurons that express the human amyloid precursor protein (APP) transgene with the double Swedish mutation (APPSwe), and which contains APP-derived fragments, including soluble human Aβ oligomers. We then used proteomics to investigate changes in the astrocyte secretome. Our data show dysregulated secretion of astrocytic proteins involved in the extracellular matrix and cytoskeletal organization and increase secretion of proteins involved in oxidative stress responses and those with chaperone activity. Several of these proteins have been identified in previous transcriptomic and proteomic studies using brain tissue from human AD and cerebrospinal fluid (CSF). Our work highlights the relevance of studying astrocyte secretion to understand the brain response to AD pathology and the potential use of these proteins as biomarkers for the disease.

DDX27
Also flagged:colorectal cancerMETTL3RNase Repithelial-mesenchymal transitionDEAD-box helicase 27insulin-like growth factor 2 mRNA-binding protein 1
Journal Article 2023-06-11 ✓ 5 Snippets Chen M, Tian B, Hu G, Guo Y.
In-Text Gene Mentions

Moreover, the loss of DDX27 mRNA in response to actinomycin D evidently declined after circUHRF2 silencing (Figure 6E).

DDX27 is a member of the RNA helicase family and is highly expressed in several cancers, including breast cancer [35] and CRC [36].

…DEAD-box helicase 27 (DDX27) protein via promoting…

DDX27knockdown repressed CRC…

…metastasis via repressingDDX27protein expression.…

Show Full Abstract

Increasing evidence has implicated that circular RNAs (circRNAs) exert important roles in colorectal cancer (CRC) occurrence and progression. However, the role of a novel circRNA, <i>circUHRF2</i>, remains unknown in CRC. Our work aimed at identifying the functional roles of <i>circUHRF2</i> in CRC and illustrating the potential mechanisms. As assessed by quantitative real-time PCR (qRT-PCR), <i>circUHRF2</i> and methyltransferase-like 3 (METTL3) were highly expressed in CRC specimens and cells. Sanger sequencing and RNase R assays were performed to verify the ring structure of <i>circUHRF2</i>. Notably, aberrantly increased expression of <i>circUHRF2</i> was positively correlated with poor prognosis of CRC patients. Functional experiments indicated that CRC stemness, migration, and epithelial-mesenchymal transition (EMT) were suppressed by the knockdown of <i>circUHRF2</i> or METTL3. Mechanistically, METTL3 enhanced <i>circUHRF2</i> expression through N6-methyladenine (m<sup>6</sup>A) modification. Rescue experiments showed that overexpression of <i>circUHRF2</i> reversed the repressive effect of METTL3 silencing on CRC progression. Moreover, <i>circUHRF2</i> inhibited the loss of DEAD-box helicase 27 (DDX27) protein via promoting the interaction between insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) and <i>DDX27</i> mRNA. DDX27 knockdown repressed CRC malignant properties, which was counteracted by <i>circUHRF2</i> overexpression. The in vivo assays in nude mice demonstrated that <i>circUHRF2</i> or METTL3 silencing exerted a suppressive effect on CRC growth and liver metastasis via repressing DDX27 protein expression. Taken together, METTL3-mediated m<sup>6</sup>A modification upregulated <i>circUHRF2</i> and subsequently inhibited loss of DDX27 protein via recruitment of IGF2BP1, which conferred CRC stemness and metastasis. These findings shed light on CRC pathogenesis and suggest <i>circUHRF2</i> as a novel target for CRC treatment.

Also flagged:CancerTumours of thetumourstumourTumours of the central nervous systemsolid tumours
Journal Article 2023-06-11 No Snippets Han YP, Lin HW, Li H.
Show Full Abstract

Cancer stem cells (CSCs) are a subgroup of cells found in various kinds of tumours with stem cell characteristics, such as self-renewal, induced differentiation, and tumourigenicity. The existence of CSCs is regarded as a major source of tumour recurrence, metastasis, and resistance to conventional chemotherapy and radiation treatment. Tumours of the central nervous system (CNS) are the most common solid tumours in children, which have many different types including highly malignant embryonal tumours and midline gliomas, and low-grade gliomas with favourable prognoses. Stem cells from the CNS tumours have been largely found and reported by researchers in the last decade and their roles in tumour biology have been deeply studied. However, the cross-talk of CSCs among different CNS tumour types and their clinical impacts have been rarely discussed. This article comprehensively reviews the achievements in research on CSCs in paediatric CNS tumours. Biological functions, diagnostic values, and therapeutic perspectives are reviewed in detail. Further investigations into CSCs are warranted to improve the clinical practice in treating children with CNS tumours.

Also flagged:Extracellular Vesiclesextracellular vesiclelipidextracellular spacenucleotidessynthesis
Journal Article 2023-06-11 No Snippets Maqueda JJ, Giovanazzi A, Rocha AM, Rocha S, Silva I, Saraiva N, Bonito N, Carvalho J, Maia L, Wauben MHM, Oliveira C.
Show Full Abstract

Small RNA (sRNA) profiling of Extracellular Vesicles (EVs) by Next-Generation Sequencing (NGS) often delivers poor outcomes, independently of reagents, platforms or pipelines used, which contributes to poor reproducibility of studies. Here we analysed pre/post-sequencing quality controls (QC) to predict issues potentially biasing biological sRNA-sequencing results from purified human milk EVs, human and mouse EV-enriched plasma and human paraffin-embedded tissues. Although different RNA isolation protocols and NGS platforms were used in these experiments, all datasets had samples characterized by a marked removal of reads after pre-processing. The extent of read loss between individual samples within a dataset did not correlate with isolated RNA quantity or sequenced base quality. Rather, cDNA electropherograms revealed the presence of a constant peak whose intensity correlated with the degree of read loss and, remarkably, with the percentage of adapter dimers, which were found to be overrepresented sequences in high read-loss samples. The analysis through a QC pipeline, which allowed us to monitor quality parameters in a step-by-step manner, provided compelling evidence that adapter dimer contamination was the main factor causing batch effects. We concluded this study by summarising peer-reviewed published workflows that perform consistently well in avoiding adapter dimer contamination towards a greater likelihood of sequencing success.

Also flagged:gene expressiongenetic diseasesmotor neuron 2SMN2oligonucleotidesspinal muscular atrophy
Journal Article 2023-06-10 No Snippets Uriostegui-Arcos M, Mick ST, Shi Z, Rahman R, Fiszbein A.
Show Full Abstract

Transcription and splicing are intrinsically coupled. Alternative splicing of internal exons can fine-tune gene expression through a recently described phenomenon called exon-mediated activation of transcription starts (EMATS). However, the association of this phenomenon with human diseases remains unknown. Here, we develop a strategy to activate gene expression through EMATS and demonstrate its potential for treatment of genetic diseases caused by loss of expression of essential genes. We first identified a catalog of human EMATS genes and provide a list of their pathological variants. To test if EMATS can be used to activate gene expression, we constructed stable cell lines expressing a splicing reporter based on the alternative splicing of motor neuron 2 (SMN2) gene. Using small molecules and antisense oligonucleotides (ASOs) currently used for treatment of spinal muscular atrophy, we demonstrated that increase of inclusion of alternative exons can trigger an activation of gene expression up to 45-fold by enhancing transcription in EMATS-like genes. We observed the strongest effects in genes under the regulation of weak human promoters located proximal to highly included skipped exons.

HTT
Also flagged:copperzincHuntington's diseaserutinmetalsneurodegenerative diseases
Journal Article 2023-06-10 ✓ 2 Snippets Cordeiro LM, Soares MV, da Silva AF, Dos Santos LV, de Souza LI, da Silveira TL, Baptista FBO, de Oliveira GV, Pappis C, Dressler VL, Arantes LP, Zheng F, Soares FAA.
In-Text Gene Mentions

HD is caused by an autosomal dominantly inherited CAG trinucleotide repeat expansion in the huntingtin (HTT) gene.

…in the huntingtin (HTT) gene.…

Show Full Abstract

Copper (Cu) and Zinc (Zn) are required in small concentrations for metabolic functions, but are also toxic. There is a great concern about soil pollution by heavy metals, which may exposure the population to these toxicants, either by inhalation of dust or exposure to toxicants through ingestion of food derived from contaminated soils. In addition, the toxicity of metals in combination is questionable, as soil quality guidelines only assess them separately. It is well known that metal accumulation is often found in the pathologically affected regions of many neurodegenerative diseases, including Huntington's disease (HD). HD is caused by an autosomal dominantly inherited CAG trinucleotide repeat expansion in the huntingtin (HTT) gene. This results in the formation of a mutant huntingtin (mHTT) protein with an abnormally long polyglutamine (polyQ) repeat. The pathology of HD results in loss of neuronal cells, motor changes, and dementia. Rutin is a flavonoid found in various food sources, and previous studies indicate it has protective effects in HD models and acts as a metal chelator. However, further studies are needed to unravel its effects on metal dyshomeostasis and to discern the underlying mechanisms. In the present study, we investigated the toxic effects of long-term exposure to copper, zinc, and their mixture, and the relationship with the progression of neurotoxicity and neurodegeneration in a C. elegans-based HD model. Furthermore, we investigated the effects of rutin post metal exposure. Overall, we demonstrate that chronic exposure to the metals and their mixture altered body parameters, locomotion, and developmental delay, in addition to increasing polyQ protein aggregates in muscles and neurons causing neurodegeneration. We also propose that rutin has protective effects acting through mechanisms involving antioxidant and chelating properties. Altogether, our data provides new indications about the higher toxicity of metals in combination, the chelating potential of rutin in the C. elegans model of HD and possible strategies for future treatments of neurodegenerative diseases caused by the aggregation of proteins related to metals.

Also flagged:Polypyrrolesalicylatemolybdategraphene oxidesaltcarbon
Journal Article 2023-06-10 No Snippets Hung HM, Thi TM, Van Khoe L, Duc LM, Lan HTT, Hoan LT, Xuan VT, Viet NTB, Luong NX, Thuy Chinh N, Hoang T, Hương VT, Trung VQ.
Show Full Abstract

In this work, polypyrrole-based nanocomposites doped with graphene oxide, molybdate, and salicylate (PPy/GO/Mo/Sal) were synthesized via <i>in</i> <i>situ</i> electrochemical polymerization to enhance the anti-corrosion protection performance of polymer coatings. The morphology and structures of the coatings were characterized by SEM, EDX, FTIR, Raman spectroscopy, and XRD. The protection abilities of coatings against corrosion were investigated in 0.1 M NaCl solution with EIS potentiodynamic polarization, salt spray test, and open-circuit potential (OCP) measurements. The results showed that with the presence of both molybdate/salicylate and GO in the PPy matrix, the nanocomposite coating exhibited an excellent protection ability against corrosion for low-carbon steel, better than that with only GO as filler. Compared to the nanocomposites doped with only salicylate or salicylate/GO, the one doped with both molybdate/salicylate and GO exhibited the longest protection plateau (ca. 100 h) on the OCP-time curves with some fluctuation points known as the self-healing action of molybdate dopant. It also resulted in a decrease in the corrosion current (Tafel plots), a higher impedance (Bode plot), and a better protection performance in salt spray tests. In this case, the anti-corrosion ability of the coatings was provided through a barrier and self-healing mechanism.

SERPINC1
Also flagged:Immune ResponseCoagulationCOVID-19complementCD5LA1BG
Journal Article 2023-06-10 ✓ 5 Snippets di Flora DC, Dionizio A, Pereira HABS, Garbieri TF, Grizzo LT, Dionisio TJ, Leite AL, Silva-Costa LC, Buzalaf NR, Reis FN, Pereira VBR, Rosa DMC, Dos Santos CF, Buzalaf MAR.
In-Text Gene Mentions

In addition, other proteins that could be employed in therapies against COVID-19 but that so far have not been associated with the disease are CD5L, VDBP, A1BG, C4BPA, PGLYRP2, SERPINC1, and APOH.

Other proteins that could potentially be employed in therapies against COVID-19 but that so far have not been associated with the disease are CD5L, VDBP, A1BG, C4BPA, PGLYRP2, SERPINC1, and APOH.

…A1BG, C4BPA, PGLYRP2,SERPINC1, and APOH.…

…S-glycoprotein (P02765; AHSG),Antithrombin-III(P01008; SERPINC1), Beta-2-gly…

…SG), Antithrombin-III (P01008;SERPINC1), Beta-2-glycoprotein 1 (P027…

Show Full Abstract

The development of new approaches allowing for the early assessment of COVID-19 cases that are likely to become critical and the discovery of new therapeutic targets are urgently required. In this prospective cohort study, we performed proteomic and laboratory profiling of plasma from 163 COVID-19 patients admitted to Bauru State Hospital (Brazil) between 4 May 2020 and 4 July 2020. Plasma samples were collected upon admission for routine laboratory analyses and shotgun quantitative label-free proteomics. Based on the course of the disease, the patients were divided into three groups: (a) mild (<i>n</i> = 76) and (b) severe (<i>n</i> = 56) symptoms, whose patients were discharged without or with admission to an intensive care unit (ICU), respectively, and (c) critical (<i>n</i> = 31), a group consisting of patients who died after admission to an ICU. Based on our data, potential therapies for COVID-19 should target proteins involved in inflammation, the immune response and complement system, and blood coagulation. Other proteins that could potentially be employed in therapies against COVID-19 but that so far have not been associated with the disease are CD5L, VDBP, A1BG, C4BPA, PGLYRP2, SERPINC1, and APOH. Targeting these proteins' pathways might constitute potential new therapies or biomarkers of prognosis of the disease.

Also flagged:transposonschromosomechromosomeshost genomepeptideamino acids
Journal Article 2023-06-10 No Snippets Zhang C, Wang L, Dou L, Yue B, Xing J, Li J.
Show Full Abstract

Noctuidae is known to have high species diversity, although the genomic diversity of Noctuidae species has yet to be studied extensively. Investigation of transposable elements (TEs) in this family can improve our understanding of the genomic diversity of Noctuidae. In this study, we annotated and characterized genome-wide TEs in ten noctuid species belonging to seven genera. With multiple annotation pipelines, we constructed a consensus sequence library containing 1038-2826 TE consensus. The genome content of TEs showed high variation in the ten Noctuidae genomes, ranging from 11.3% to 45.0%. The relatedness analysis indicated that the TE content, especially the content of LINEs and DNA transposons, is positively correlated with the genome size (r = 0.86, <i>p</i>-value = 0.001). We identified SINE/<i>B2</i> as a lineage-specific subfamily in <i>Trichoplusia ni,</i> a species-specific expansion of the LTR/<i>Gypsy</i> subfamily in <i>Spodoptera exigua</i>, and a recent expansion of SINE/<i>5S</i> subfamily in <i>Busseola fusca.</i> We further revealed that of the four TE classes, only LINEs showed phylogenetic signals with high confidence. We also examined how the expansion of TEs contributed to the evolution of noctuid genomes. Moreover, we identified 56 horizontal transfer TE (HTT) events among the ten noctuid species and at least three HTT events between the nine Noctuidae species and 11 non-noctuid arthropods. One of the HTT events of a <i>Gypsy</i> transposon might have caused the recent expansion of the <i>Gypsy</i> subfamily in the <i>S. exigua</i> genome. By determining the TE content, dynamics, and HTT events in the Noctuidae genomes, our study emphasized that TE activities and HTT events substantially impacted the Noctuidae genome evolution.

SOX6
Also flagged:Down Syndromechromosomal disorder of chromosomeintellectual disabilitytranscription repressorRESTgene expression
Journal Article 2023-06-10 ✓ 2 Snippets Huang T, Fakurazi S, Cheah PS, Ling KH.
In-Text Gene Mentions

…The transcription repressor,Repressor Element-1 Silencing Transcription factorElement-1 Silencing Transcript…

…he transcriptional repressor “Repressor Element-1 Silencing Transcription factorElement-1 Silencing Transcript…

Show Full Abstract

Down syndrome (DS) is the most frequently diagnosed chromosomal disorder of chromosome 21 (HSA21) aneuploidy, characterized by intellectual disability and reduced lifespan. The transcription repressor, Repressor Element-1 Silencing Transcription factor (REST), which acts as an epigenetic regulator, is a crucial regulator of neuronal and glial gene expression. In this study, we identified and investigated the role of REST-target genes in human brain tissues, cerebral organoids, and neural cells in Down syndrome. Gene expression datasets generated from healthy controls and DS samples of human brain tissues, cerebral organoids, NPC, neurons, and astrocytes were retrieved from the Gene Ontology (GEO) and Sequence Read Archive (SRA) databases. Differential expression analysis was performed on all datasets to produce differential expression genes (DEGs) between DS and control groups. REST-targeted DEGs were subjected to functional ontologies, pathways, and network analyses. We found that REST-targeted DEGs in DS were enriched for the JAK-STAT and HIF-1 signaling pathways across multiple distinct brain regions, ages, and neural cell types. We also identified REST-targeted DEGs involved in nervous system development, cell differentiation, fatty acid metabolism and inflammation in the DS brain. Based on the findings, we propose REST as the critical regulator and a promising therapeutic target to modulate homeostatic gene expression in the DS brain.

ZNFX1
Also flagged:Interstitial PneumonitisPeripheral Monocytosisinterferonchronic infectionsinterferon-stimulated genesstress granules
Journal Article 2023-06-09 ✓ 5 Snippets Al-Saud B, KFSHRC Physicians & Researchers Consortium, Alshareef T, Al-Alwan M, Alazami AM.
In-Text Gene Mentions

ZNFX1Deficiency in a…

ZNFX1is an ISG…

…Additionally, humanZNFX1is recruited in…

…clinical phenotype forZNFX1-deficient patients is variabl…

…inflammation due toZNFX1deficiency [ 3…

Show Full Abstract

No abstract available.

Also flagged:movement disordersnutritionalLatah syndromeMinamata diseaseβ-fluoroethylacetate
Journal Article 2023-06-09 No Snippets Ibrahim NM, Jagota P, Pal PK, Bhidayasiri R, Lim SY, Ugawa Y, Aldaajani Z, Jeon B, Fujioka S, Lee JY, Kukkle PL, Shang H, Phokaewvarangkul O, Diesta C, Shambetova C, Lin CH.
Show Full Abstract

Nongenetic movement disorders are common throughout the world. The movement disorders encountered may vary depending on the prevalence of certain disorders across various geographical regions. In this paper, we review historical and more common nongenetic movement disorders in Asia. The underlying causes of these movement disorders are diverse and include, among others, nutritional deficiencies, toxic and metabolic causes, and cultural Latah syndrome, contributed by geographical, economic, and cultural differences across Asia. The industrial revolution in Japan and Korea has led to diseases related to environmental toxin poisoning, such as Minamata disease and β-fluoroethyl acetate-associated cerebellar degeneration, respectively, while religious dietary restriction in the Indian subcontinent has led to infantile tremor syndrome related to vitamin B12 deficiency. In this review, we identify the salient features and key contributing factors in the development of these disorders.

Also flagged:Parkinson diseasePDtranslationalpathogenesismitochondrialgene expression
Journal Article 2023-06-09 No Snippets Barnett DGS, Lechner SA, Gammie SC, Kelm-Nelson CA.
Show Full Abstract

<h4>Objectives and hypothesis</h4>Vocal dysfunction, including hypophonia, in Parkinson disease (PD) manifests in the prodromal period and significantly impacts an individual's quality of life. Data from human studies suggest that pathology leading to vocal deficits may be structurally related to the larynx and its function. The Pink1-/- rat is a translational model used to study pathogenesis in the context of early-stage mitochondrial dysfunction. The primary objective of this work was to identify differentially expressed genes in the thyroarytenoid muscle and examine the dysregulated biological pathways in the female rat.<h4>Methods</h4>RNA sequencing was used to determine thyroarytenoid (TA) muscle gene expression in adult female Pink1-/- rats compared with controls. A bioinformatic approach and the ENRICHR gene analysis tool were used to compare the sequencing dataset with biological pathways and processes, disease relationships, and drug-repurposing compounds. Weighted Gene Co-expression Network Analysis was used to construct biological network modules. The data were compared with a previously published dataset in male rats.<h4>Results</h4>Significant upregulated pathways in female Pink1-/- rats included fatty acid oxidation and muscle contraction, synaptic transmission, and neuromuscular processes. Downregulated pathways included anterograde transsynaptic signaling, chemical synaptic transmission, and ion release. Several drug treatment options including cetuximab, fluoxetine, and resveratrol are hypothesized to reverse observed genetic dysregulation.<h4>Conclusions</h4>Data presented here are useful for identifying biological pathways that may underlie the mechanisms of peripheral dysfunction including neuromuscular synaptic transmission to the TA muscle. These experimental biomarkers have the potential to be targeted as sites for improving the treatment for hypophonia in early-stage PD.<h4>Level of evidence</h4>NA Laryngoscope, 133:3412-3421, 2023.

Also flagged:HuntingtinProteostasisHuntington's diseaseHDmitochondrialdeath
Journal Article 2023-06-09 No Snippets Jain S, Roy I.
Show Full Abstract

Aggregation of mutant huntingtin is a pathological hallmark of Huntington's disease (HD). Protein aggregation results in various cellular dysfunctions, such as increase in oxidative stress, mitochondrial damage, proteostasis imbalance, etc., which finally cause cell death. Previously, specific RNA aptamers with high affinity for mutant huntingtin were selected. In the current study, we show that the selected aptamer inhibits aggregation of mutant huntingtin (EGFP-74Q) in HEK293 and Neuro 2a cell models of HD. The presence of aptamer decreases sequestration of chaperones and increases their cellular levels. This is accompanied by improved mitochondrial membrane permeability, reduced oxidative stress, and increased cell survival. Thus, RNA aptamers can be explored further as inhibitors of protein aggregation in protein misfolding diseases.

Also flagged:Synthesis1,3-diacylpyrrolesα-amino acidsalkylarylheteroaryl
Journal Article 2023-06-09 No Snippets Evans C, Berkey WJ, Jones CW, France S.
Show Full Abstract

A Zr-catalyzed synthesis of tetrasubstituted 1,3-diacylpyrroles is reported that employs the direct use of <i>N</i>-acyl α-aminoaldehydes with 1,3-dicarbonyl compounds. The products were formed in up to 88% yield and shown to be hydrolytically and configurationally stable under the reaction conditions (THF/1,4-dioxane and H<sub>2</sub>O). The <i>N</i>-acyl α-aminoaldehydes were readily prepared from the corresponding α-amino acids. The reaction tolerates a wide array of substrate types including alkyl-, aryl-, heteroaryl-, and heteroatom-containing groups on the aminoaldehyde side chain. A variety of 1,3-dicarbonyls proved amenable to the reaction along with an aldehyde derived from a l,l-dipeptide, an aldehyde generated <i>in situ</i>, and an <i>N</i>-acylated glucosamine.

Also flagged:NucleotideGrp94molecular chaperonemembraneBiPbinding
Journal Article 2023-06-09 No Snippets Alao JP, Obaseki I, Amankwah YS, Nguyen Q, Sugoor M, Unruh E, Popoola HO, Tehver R, Kravats AN.
Show Full Abstract

Grp94, an ER-localized molecular chaperone, is required for the folding and activation of many membrane and secretory proteins. Client activation by Grp94 is mediated by nucleotide and conformational changes. In this work, we aim to understand how microscopic changes from nucleotide hydrolysis can potentiate large-scale conformational changes of Grp94. We performed all-atom molecular dynamics simulations on the ATP-hydrolysis competent state of the Grp94 dimer in four different nucleotide bound states. We found that Grp94 was the most rigid when ATP was bound. ATP hydrolysis or nucleotide removal enhanced mobility of the N-terminal domain and ATP lid, resulting in suppression of interdomain communication. In an asymmetric conformation with one hydrolyzed nucleotide, we identified a more compact state, similar to experimental observations. We also identified a potential regulatory role of the flexible linker, as it formed electrostatic interactions with the Grp94 M-domain helix near the region where BiP is known to bind. These studies were complemented with normal-mode analysis of an elastic network model to investigate Grp94's large-scale conformational changes. SPM analysis identified residues that are important in signaling conformational change, many of which have known functional relevance in ATP coordination and catalysis, client binding, and BiP binding. Our findings suggest that ATP hydrolysis in Grp94 alters allosteric wiring and facilitates conformational changes.

HTT
Also flagged:palmitatecysteineslipidneurodegenerative diseasesacylbiotin
Journal Article 2023-06-09 ✓ 2 Snippets Sardana S, Nederstigt AE, Baggelaar MP.
In-Text Gene Mentions

Approximately 41%of synaptic proteins have been identified as S-palmitoylated,including APP, BACE1, and Huntingtin (HTT), which are involved inAlzheimer’s and Huntington’s disease (HD).14,15 To better understand the role of S-palmitoylationin the CNS in health and disease, it is crucial to study how S-palmitoylation is regulated in neurons.

…BACE1, and Huntingtin (HTT), which are involved…

Show Full Abstract

<i>S</i>-Palmitoylation is the covalent attachment of C14:0-C22:0 fatty acids (mainly C16:0 palmitate) to cysteines via thioester bonds. This lipid modification is highly abundant in neurons, where it plays a role in neuronal development and is implicated in neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, and Huntington's disease. The knowledge of <i>S</i>-palmitoylation in neurodevelopment is limited due to technological challenges in analyzing this highly hydrophobic protein modification. Here, we used two orthogonal methods, acyl-biotin exchange (ABE) and lipid metabolic labeling (LML), to identify <i>S</i>-palmitoylated proteins and sites during retinoic acid-induced neuronal differentiation of SH-SY5Y cells. We identified 2002 putative <i>S</i>-palmitoylated proteins in total, of which 650 were found with both methods. Significant changes in the abundance of <i>S</i>-palmitoylated proteins were detected, in particular for several processes and protein classes that are known to be important for neuronal differentiation, which include proto-oncogene tyrosine-protein kinase receptor (RET) signal transduction, SNARE protein-mediated exocytosis, and neural cell adhesion molecules. Overall, <i>S</i>-palmitoylation profiling by employing ABE and LML in parallel during RA-induced differentiation of SH-SY5Y cells revealed a subset of high confidence bona fide <i>S</i>-palmitoylated proteins and suggested an important role for <i>S</i>-palmitoylation in neuronal differentiation.

TNFSF4
Also flagged:hepatocellular carcinomatumorCOXPD-1SorafenibLapatinib
Journal Article 2023-06-09 ✓ 1 Snippet Yang D, Zhao F, Su Y, Zhou Y, Shen J, Yu B, Zhao K, Ding Y.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Background</h4>Prognostic modeling of NK cell marker genes in patients with hepatocellular carcinoma based on single cell sequencing and transcriptome data analysis.<h4>Methods</h4>Marker genes of NK cells were analyzed according to single cell sequencing data of hepatocellular carcinoma. Univariate Cox regression, lasso regression analysis, and multivariate Cox regression were performed to estimate the prognostic value of NK cell marker genes. TCGA, GEO and ICGC transcriptomic data were applied to build and validate the model. Patients were divided into high and low risk groups based on the median risk score. XCELL, timer, quantitative sequences, MCP counter, EPIC, CIBERSORT and CIBERSORT-abs were performed to explore the relationship between risk score and tumor microenvironment in hepatocellular carcinoma. Finally the sensitivity of the model to chemotherapeutic agents was predicted.<h4>Results</h4>Single-cell sequencing identified 207 marker genes for NK cells in hepatocellular carcinoma. Enrichment analysis suggested that NK cell marker genes were mainly involved in cellular immune function. Eight genes were selected for prognostic modeling after multifactorial COX regression analysis. The model was validated in GEO and ICGC data. Immune cell infiltration and function were higher in the low-risk group than in the high-risk group. The low-risk group was more suitable for ICI and PD-1 therapy. Half-maximal inhibitory concentrations of Sorafenib, Lapatinib, Dabrafenib, and Axitinib were significantly different on the two risk groups.<h4>Conclusion</h4>A new signature of hepatocyte NK cell marker genes possesses a powerful ability to predict prognosis and immunotherapeutic response in patients with hepatocellular carcinoma.

POU3F2
Also flagged:CancertumorYY2hepatocarcinomaliver cancermitochondrial
Journal Article 2023-06-09 ✓ 2 Snippets Wei M, Nurjanah U, Li J, Luo X, Hosea R, Li Y, Zeng J, Duan W, Song G, Miyagishi M, Kasim V, Wu S.
In-Text Gene Mentions

Heatmap analysis of gene expression in adherent cells and stem‐like tumor spheres (Figure 1D) revealed a negative correlation between YY2 and stem‐related factors, including CD44, SOX9, SALL2, KLF15, OCT4 (also known as POU class 5 homeobox 1 or POU5F1), MYC, ASCL1, and POU3F2.

…MYC, ASCL1, andPOU3F2.…

Show Full Abstract

Cancer stem cells (CSCs) are associated with tumor progression, recurrence, and therapeutic resistance. To maintain their pool while promoting tumorigenesis, CSCs divide asymmetrically, producing a CSC and a highly proliferative, more differentiated transit-amplifying cell. Exhausting the CSC pool has been proposed as an effective antitumor strategy; however, the mechanism underlying CSC division remains poorly understood, thereby largely limiting its clinical application. Here, through cross-omics analysis, yin yang 2 (YY2) is identified as a novel negative regulator of CSC maintenance. It is shown that YY2 is downregulated in stem-like tumor spheres formed by hepatocarcinoma cells and in liver cancer, in which its expression is negatively correlated with disease progression and poor prognosis. Furthermore, it is revealed that YY2 overexpression suppressed liver CSC asymmetric division, leading to depletion of the CSC pool and decreased tumor-initiating capacity. Meanwhile, YY2 knock-out in stem-like tumor spheres caused enrichment in mitochondrial functions. Mechanistically, it is revealed that YY2 impaired mitochondrial fission, and consequently, liver CSC asymmetric division, by suppressing the transcription of dynamin-related protein 1. These results unravel a novel regulatory mechanism of mitochondrial dynamic-mediated CSCs asymmetric division and highlight the role of YY2 as a tumor suppressor and a therapeutic target in antitumor treatment.

Also flagged:alkaloidhomoharringtonineinsulinoma associated-1neuroblastomaNBchildhood cancer
Journal Article 2023-06-09 No Snippets Chen C, Wu J, Hicks C, Lan MS.
Show Full Abstract

High-risk neuroblastoma (NB) is a heterogeneous and malignant childhood cancer that is frequently characterized by MYCN proto-oncogene amplification or elevated N-Myc protein (N-Myc) expression. An N-Myc downstream target gene, insulinoma associated-1 (INSM1) has emerged as a biomarker that plays a critical role in facilitating NB tumor cell growth and transformation. N-Myc activates endogenous INSM1 gene expression through binding to the E2-box of the INSM1 proximal promoter in NB. We identified a plant alkaloid, homoharringtonine (HHT), from a chemical library screening showing potent inhibition of INSM1 promoter activity. This positive-hit plant alkaloid exemplifies an effective screening approach for repurposed compound targeting INSM1 expression in NB cancer therapy. The elevated N-Myc and INSM1 expression in NB constitutes a positive-loop through INSM1 activation that promotes N-Myc stability. In the present study, the biological effects and anti-tumor properties of HHT against NB were examined. HHT either down regulates and/or interferes with the binding of N-Myc to the E2-box of the INSM1 promoter and the inhibition of PI3K/AKT-mediated N-Myc stability could lead to the NB cell apoptosis. HHT inhibition of NB cell proliferation is consistent with the INSM1 expression as higher level of INSM1 exhibits a more sensitive IC<sub>50</sub> value. The combination treatment of HHT and A674563 provides a better option of increasing potency and reducing cellular cytotoxicity than HHT or A674563 treatment alone. Taken together, the suppression of the INSM1-associated signaling pathway axis promotes the inhibition of NB tumor cell growth. This study developed a feasible approach for repurposing an effective anti-NB drug.

Also flagged:albuminchitosancalciumcalcium phosphatesBSAsilver
Journal Article 2023-06-09 No Snippets Inkret S, Erceg I, Ćurlin M, Kalčec N, Peranić N, Vinković Vrček I, Domazet Jurašin D, Dutour Sikirić M.
Show Full Abstract

The precipitation of calcium phosphates (CaPs) in the presence of more than one type of additive is of interest both from a fundamental point of view and as a possible biomimetic route for the preparation of multicomponent composites in which the activity of the components is preserved. In this study, the effect of bovine serum albumin (BSA) and chitosan (Chi) on the precipitation of CaPs in the presence of silver nanoparticles (AgNPs) stabilized with sodium bis(2-ethylhexyl)sulfosuccinate (AOT-AgNPs), poly(vinylpyrrolidone) (PVP-AgNPs), and citrate (cit-AgNPs) was investigated. In the control system, the precipitation of CaPs occurred in two steps. Amorphous calcium phosphate (ACP) was the first precipitated solid, which transformed into a mixture of calcium-deficient hydroxyapatite (CaDHA) and a smaller amount of octacalcium phosphate (OCP) after 60 min of ageing. Both biomacromolecules inhibited ACP transformation, with Chi being a stronger inhibitor due to its flexible molecular structure. As the concentration of the biomacromolecules increased, the amount of OCP decreased both in the absence and presence of AgNPs. In the presence of cit-AgNPs and two highest BSA concentrations, a change in the composition of the crystalline phase was observed. Calcium hydrogen phosphate dihydrate was formed in the mixture with CaDHA. An effect on the morphology of both the amorphous and crystalline phases was observed. The effect depended on the specific combination of biomacromolecules and differently stabilized AgNP. The results obtained suggest a simple method for fine-tuning the properties of precipitates using different classes of additives. This could be of interest for the biomimetic preparation of multifunctional composites for bone tissue engineering.

PRDX6
Also flagged:FerroptosisDiabetic nephropathyDNdiabetesdeathend-stage renal disease
Journal Article 2023-06-09 ✓ 1 Snippet Wei M, Liu X, Tan Z, Tian X, Li M, Wei J.
In-Text Gene Mentions

…RNAs, COX-2, ALOX15,Prdx6, ZIP14, HMGB1, Nrf2,…

Show Full Abstract

Diabetic nephropathy (DN) is a serious microvascular complication of diabetes. It has become a leading cause of death in patients with diabetes and end-stage renal disease. Ferroptosis is a newly discovered pattern of programmed cell death. Its main manifestation is the excessive accumulation of intracellular iron ion-dependent lipid peroxides. Recent studies have shown that ferroptosis is an important driving factor in the onset and development of DN. Ferroptosis is closely associated with renal intrinsic cell (including renal tubular epithelial cells, podocytes, and mesangial cells) damage in diabetes. Chinese herbal medicine is widely used in the treatment of DN, with a long history and definite curative effect. Accumulating evidence suggests that Chinese herbal medicine can modulate ferroptosis in renal intrinsic cells and show great potential for improving DN. In this review, we outline the key regulators and pathways of ferroptosis in DN and summarize the herbs, mainly monomers and extracts, that target the inhibition of ferroptosis.

HTT
Also flagged:Glycogen synthase kinase 3βGSK3βPSaxonskinasescancer
Journal Article 2023-06-09 ✓ 5 Snippets Banerjee R, Gunawardena S.
In-Text Gene Mentions

In Huntington’s disease (HD), JNK3 activated by pathogenic HTT phosphorylated the conserved S175 in the motor domain of mouse kinesin-1A (Morfini et al., 2009a; Morfini et al., 2009b), inhibiting anterograde trafficking.

…hosphorylation of huntingtin (HTT) and huntingtin-associated pr…

…kt-mediated phosphorylation ofHTTat S421 can…

…the scaffolding proteinHTT( Colin et…

…GSK3β, and phosphorylateHTTto recruit kinesin-1…

Show Full Abstract

It has been a quarter century since the discovery that molecular motors are phosphorylated, but fundamental questions still remain as to how specific kinases contribute to particular motor functions, particularly <i>in vivo</i>, and to what extent these processes have been evolutionarily conserved. Such questions remain largely unanswered because there is no cohesive strategy to unravel the likely complex spatial and temporal mechanisms that control motility <i>in vivo</i>. Since diverse cargoes are transported simultaneously within cells and along narrow long neurons to maintain intracellular processes and cell viability, and disruptions in these processes can lead to cancer and neurodegeneration, there is a critical need to better understand how kinases regulate molecular motors. Here, we review our current understanding of how phosphorylation can control kinesin-1 motility and provide evidence for a novel regulatory mechanism that is governed by a specific kinase, glycogen synthase kinase 3β (GSK3β), and a scaffolding protein presenilin (PS).

TNFSF4
Also flagged:AntibodyTNFCostimulatory TNF Receptorstumor necrosis factor receptorTNFRcancer
Journal Article 2023-06-09 ✓ 2 Snippets Nagai H, Azuma M, Sato A, Shibui N, Ogawara S, Tsutsui Y, Suzuki A, Wakaizumi T, Ito A, Matsuyama S, Morita M, Hikosaka Kuniishi M, Ishii N, So T.
In-Text Gene Mentions

…superfamily (TNFSF), OX40L (TNFSF4), 4-1BBL (TNFSF9), CD27L…

…mouse Ox40l (Tnfsf4) was previously…

Show Full Abstract

The costimulatory signal regulated by the members of the tumor necrosis factor receptor (TNFR) superfamily expressed by T cells plays essential roles for T cell responses and has emerged as a promising target for cancer immunotherapy. However, it is unclear how the difference in TNFR costimulation contributes to T cell responses. In this study, to clarify the functional significance of four different TNFRs, OX40, 4-1BB, CD27 and GITR, we prepared corresponding single-chain TNF ligand proteins (scTNFLs) connected to IgG Fc domain with beneficial characteristics, i.e., Fc-scOX40L, Fc-sc4-1BBL, Fc-scCD27L (CD70) and Fc-scGITRL. Without intentional cross-linking, these soluble Fc-scTNFL proteins bound to corresponding TNFRs induced NF-kB signaling and promoted proliferative and cytokine responses in CD4<sup>+</sup> and CD8<sup>+</sup> T cells with different dose-dependencies in vitro. Mice injected with one of the Fc-scTNFL proteins displayed significantly augmented delayed-type hypersensitivity responses, showing in vivo activity. The results demonstrate that each individual Fc-scTNFL protein provides a critical costimulatory signal and exhibits quantitatively distinct activity toward T cells. Our findings provide important insights into the TNFR costimulation that would be valuable for investigators conducting basic research in cancer immunology and also have implications for T cell-mediated immune regulation by designer TNFL proteins.

HFE
Also flagged:Congenital dyserythropoietic anemia type IICDA IIrecessive blood disordererythropoiesisanemiairon
Journal Article 2023-06-09 ✓ 3 Snippets Musri MM, Venturi V, Ferrer-Cortès X, Romero-Cortadellas L, Hernández G, Leoz P, Ricard Andrés MP, Morado M, Fernández Valle MDC, Beneitez Pastor D, Ortuño Cabrero A, Moreno Gamiz M, Senent Peris L, Perez-Valencia AI, Pérez-Montero S, Tornador C, Sánchez M.
In-Text Gene Mentions

…hemolytic anemia, andhemochromatosis.…

Hemochromatosis-related genotype—i.e., HFE ge…

…matosis-related genotype—i.e.,HFEgenes—was excluded.…

Show Full Abstract

Congenital dyserythropoietic anemia type II (CDA II) is an inherited autosomal recessive blood disorder which belongs to the wide group of ineffective erythropoiesis conditions. It is characterized by mild to severe normocytic anemia, jaundice, and splenomegaly owing to the hemolytic component. This often leads to liver iron overload and gallstones. CDA II is caused by biallelic mutations in the <i>SEC23B</i> gene. In this study, we report 9 new CDA II cases and identify 16 pathogenic variants, 6 of which are novel. The newly reported variants in SEC23B include three missenses (p.Thr445Arg, p.Tyr579Cys, and p.Arg701His), one frameshift (p.Asp693GlyfsTer2), and two splicing variants (c.1512-2A>G, and the complex intronic variant c.1512-3delinsTT linked to c.1512-16_1512-7delACTCTGGAAT in the same allele). Computational analyses of the missense variants indicated a loss of key residue interactions within the beta sheet and the helical and gelsolin domains, respectively. Analysis of SEC23B protein levels done in patient-derived lymphoblastoid cell lines (LCLs) showed a significant decrease in SEC23B protein expression, in the absence of SEC23A compensation. Reduced <i>SEC23B</i> mRNA expression was only detected in two probands carrying nonsense and frameshift variants; the remaining patients showed either higher gene expression levels or no expression changes at all. The skipping of exons 13 and 14 in the newly reported complex variant c.1512-3delinsTT/c.1512-16_1512-7delACTCTGGAAT results in a shorter protein isoform, as assessed by RT-PCR followed by Sanger sequencing. In this work, we summarize a comprehensive spectrum of <i>SEC23B</i> variants, describe nine new CDA II cases accounting for six previously unreported variants, and discuss innovative therapeutic approaches for CDA II.

Also flagged:phytohormonescarotenoidbutenolideenoletherstrigol
Journal Article 2023-06-09 No Snippets Wang C, Guo B, Yang Z, Du L, Yu C, Zhou Y, Zhao H, Wang Y, Duan L.
Show Full Abstract

Strigolactones (SLs) are a class of plant hormones and rhizosphere communication signals of great interest. They perform diverse biological functions including the stimulation of parasitic seed germination and phytohormonal activity. However, their practical use is limited by their low abundance and complex structure, which requires simpler SL analogues and mimics with maintained biological function. Here, new, hybrid-type SL mimics were designed, derived from Cinnamic amide, a new potential plant growth regulator with good germination and rooting-promoting activities. Bioassay results indicated that compound <b>6</b> not only displayed good germination activity against the parasitic weed <i>O. aegyptiaca</i> with an EC<sub>50</sub> value of 2.36 × 10<sup>-8</sup> M, but also exhibited significant inhibitory activity against <i>Arabidopsis</i> root growth and lateral root formation, as well as promoting root hair elongation, similar to the action of GR24. Further morphological experiments on <i>Arabidopsis max2-1</i> mutants revealed that <b>6</b> possessed SL-like physiological functions. Furthermore, molecular docking studies indicated that the binding mode of <b>6</b> was similar to that of GR24 in the active site of OsD14. This work provides valuable clues for the discovery of novel SL mimics.

HTT
Also flagged:neurodegenerative diseasehuntingtinmovement disorderschoreaaspiration pneumoniaacute respiratory distress syndrome
Journal Article 2023-06-09 ✓ 2 Snippets Kresojević N, Perović I, Stanković I, Tomić A, Lukic MJ, Marković V, Stojković T, Mandić G, Janković M, Marjanović A, Branković M, Novaković I, Petrović I, Dragašević N, Stefanova E, Svetel M, Kostić V.
In-Text Gene Mentions

…tide repeats in the HTT gene, which encodes…

… CAG repeats in the HTT gene is between 10 …

Show Full Abstract

No abstract available.

HFE
Also flagged:Hereditary Hemochromatosisironhomoeostatic iron regulator proteinHHDiabetes MellitusTransferrin
Journal Article 2023-06-09 ✓ 5 Snippets Lockhart M, Salehmohamed MR, Kumar D, Cummiskey AG, Seong KC, Sreenan S, McDermott J.
In-Text Gene Mentions

Previous studies provided contradictory information regarding the utility of routine screening for HH in patients with DM.6, 7, 8, 9, 10, 11, 12, 13, 14 Many of these studies were carried out in the era prior to the discovery of the HFE gene mutation, and the patients studied were attending for routine clinic review of established diabetes, which may have confounded the results.

Through the mid-20th century, diabetes was observed in almost 80% of patients with HH,16 with almost 90% of such cases attributable to the C282Y gene mutation in the HFE gene.7

Furthermore, the discovery of the HFE gene mutation, by allowing for improved screening of first-degree relatives of an index case, has resulted in earlier diagnosis of HH, prior to development of degrees of iron overload sufficient to cause DM.

…regulator protein (HFE) gene mutations.…

…hemochromatosis (HH) withHFEgene analysis.…

Show Full Abstract

<h4>Aims</h4>Hereditary hemochromatosis (HH) is the most common inherited disease in European populations. It is particularly common in people of Irish heritage, approximately 2% of whom will be at risk of iron overload as a result of human homoeostatic iron regulator protein (<i>HFE</i>) gene mutations. We aimed to evaluate the utility of screening for HH in newly referred patients with DM of Irish heritage in a prospective study.<h4>Methods</h4>Of 575 patients newly referred between March 2018 and March 2021, 556 attended for blood testing, to include fasting transferrin saturations, prior to their first clinic visit. Patients with elevated transferrin saturations were further screened for hereditary hemochromatosis (HH) with <i>HFE</i> gene analysis.<h4>Results</h4>Transferrin saturations were elevated in 13 of 556 patients (2.3%), 3 of whom had a preexisting diagnosis of HH. Of the remaining 10 patients, 7 had <i>HFE</i> gene mutations suggestive of HH (2 C282Y homozygous, 3 C282Y/H63D compound heterozygous, and 2 H63D homozygous), 1 was a HH carrier (C282Y heterozygous), and 2 had normal genetics.<h4>Conclusions</h4>The prevalence of HH of 1.8% in this screened DM population is lower than the reported incidence of HH in the Irish population, suggesting a limited utility of routine screening for HH in newly referred patients with DM.

Research Square 2023-06-09 Preprint (No Snippets API) Duan L, Maki CG.
Show Full Abstract

p53 represses transcription by activating p21 expression and promoting formation of RB1-E2F1 and RBL1/RBL2-DREAM transcription repressor complexes. The DREAM complex is composed of DP1, RB-family proteins RBL1 or RBL2 (p107/p130), E2F4/5, and MuvB. We recently reported RBL2-DREAM contributes to improved therapy responses in p53 wild-type NSCLC cells and improved outcomes in NSCLC patients whose tumors express wild-type p53. In the current study we identified CSE1L as a novel inhibitor of the RBL2-DREAM pathway and target to activate RBL2-DREAM in NSCLC cells. CSE1L is an oncoprotein that promotes nuclear accumulation of histone deacetylases HDACs 1, 2, and 8 to repress gene transcription. Mocetinostat is a HDAC inhibitor in clinical trials with selectivity against HDACs 1 and 2. Knockdown of CSE1L in NSCLC cells or treatment with mocetinostat increased p21, activated RB1 and RBL2, repressed DREAM target genes, and induced toxicity in a manner that required wild-type p53. Lastly, we found high levels of CSE1L and specific DREAM-target genes are candidate markers to identify p53 wild-type NSCLCs most responsive to mocetinostat. Thus, we identified CSE1L as a critical negative regulator of the RB-DREAM pathway in p53 wild-type NSCLC that can be indirectly targeted with HDAC1/2 inhibitors (mocetinostat) in current clinical trials. High expression of CSE1L and DREAM target genes could serve as a biomarker to identify p53 wild-type NSCLCs most responsive to this HDAC1/2 inhibitor.

Preprints.org 2023-06-09 Preprint (No Snippets API) Stoian M, Scarlat G.
Show Full Abstract

The concept of &ldquo;hyperferritinemic syndrome&rdquo; defines a complex pathophysiological and clinical entity, characterized by a systemic hyperinflammatory state, generally associated with elevated levels of proinflammatory cytokines (hypercytokinemia) and high serum levels of ferritin (hyperferritinemia), traditionally recognized as an iron-binding plasma protein involved in the storage of iron in a biologically available form for different physiological cellular processes. Recent studies have shown that ferritin has other important functions as well, operating both as a proinflammatory mediator and as a immunosupressive agent, its elevated levels in the serum being detected in various conditions associated with inflammatory states, such as infectious diseases, autoimmune and autoinflammatory disorders and, in some cases, in malignancies. Catastrophic antiphospholipid syndrome (cAPS), systemic juvenile idiopathic arthritis (sJIA) and adult-onset Still&rsquo;s disease (AOSD) and acquired forms of hemophagocytic lymphohistiocytosis (HLH), which includes macrophage activation syndrome (MAS), have been associated with hyperinflammatory states and dramatic elevations of serum ferritin, generating hyperferritinemic syndromes. Severe forms of coronavirus disease-2019 (COVID-19), in which MAS may frequently develop, has also been linked to the development of a hyperferritinemic syndrome. This review offers several insights into the physiological and pathophysiological roles of ferritin in several (hyper-)inflammatory diseases, but also into the causal entities, the underlying pathophysiological mechanisms, clinical manifestations and diagnostic features of somewhat obscure, yet potentially fatal pathological conditions, reunited under the concept of hyperferritinemic syndromes.

PEBP1
Also flagged:immune dysregulationcardiovascular diseasessystemic inflammationC-reactive proteinIL-6CD14
Journal Article 2023-06-08 ✓ 1 Snippet Vadaq N, Zhang Y, Vos WA, Groenendijk AL, Blaauw MJ, van Eekeren LE, Jacobs-Cleophas M, van de Wijer L, Dos Santos JC, Gasem MH, Joosten LA, Netea MG, de Mast Q, Fu J, van der Ven AJ, Matzaraki V.
In-Text Gene Mentions

…P = 0.01],PEBP1[OR, 3.1; P…

Show Full Abstract

BACKGROUNDPeople living with HIV (PLHIV) receiving antiretroviral therapy (ART) exhibit persistent immune dysregulation and microbial dysbiosis, leading to development of cardiovascular diseases (CVDs). We initially compared plasma proteomic profiles between 205 PLHIV and 120 healthy control participants (HCs) and validated the results in an independent cohort of 639 PLHIV and 99 HCs. Differentially expressed proteins (DEPs) were then associated to microbiome data. Finally, we assessed which proteins were linked with CVD development in PLHIV.METHODSProximity extension assay technology was used to measure 1,472 plasma proteins. Markers of systemic inflammation (C-reactive protein, D-dimer, IL-6, soluble CD14, and soluble CD163) and microbial translocation (IFABP) were measured by ELISA, and gut bacterial species were identified using shotgun metagenomic sequencing. Baseline CVD data were available for all PLHIV, and 205 PLHIV were recorded for development of CVD during a 5-year follow-up.RESULTSPLHIV receiving ART had systemic dysregulation of protein concentrations, compared with HCs. Most of the DEPs originated from the intestine and lymphoid tissues and were enriched in immune- and lipid metabolism-related pathways. DEPs originating from the intestine were associated with specific gut bacterial species. Finally, we identified upregulated proteins in PLHIV (GDF15, PLAUR, RELT, NEFL, COL6A3, and EDA2R), unlike most markers of systemic inflammation, associated with the presence and risk of developing CVD during 5-year follow-up.CONCLUSIONOur findings suggest a systemic dysregulation of protein concentrations in PLHIV; some proteins were associated with CVD development. Most DEPs originated from the gut and were related to specific gut bacterial species.TRIAL REGISTRATIONClinicalTrials.gov NCT03994835.FUNDINGAIDS-fonds (P-29001), ViiV healthcare grant (A18-1052), Spinoza Prize (NWO SPI94-212), European Research Council (ERC) Advanced grant (grant 833247), and Indonesia Endowment Fund for Education.

PTGIS
Also flagged:HHTvascular disorderANG2Tyr kinaseIgEGF
Journal Article 2023-06-08 ✓ 1 Snippet Zhou X, Pucel JC, Nomura-Kitabayashi A, Chandakkar P, Guidroz AP, Jhangiani NL, Bao D, Fan J, Arthur HM, Ullmer C, Klein C, Marambaud P, Meadows SM.
In-Text Gene Mentions

Ptgis

Show Full Abstract

<h4>Background</h4>Hereditary hemorrhagic telangiectasia (HHT) is a vascular disorder characterized by arteriovenous malformations and blood vessel enlargements. However, there are no effective drug therapies to combat arteriovenous malformation formation in patients with HHT. Here, we aimed to address whether elevated levels of ANG2 (angiopoietin-2) in the endothelium is a conserved feature in mouse models of the 3 major forms of HHT that could be neutralized to treat brain arteriovenous malformations and associated vascular defects. In addition, we sought to identify the angiogenic molecular signature linked to HHT.<h4>Methods</h4>Cerebrovascular defects, including arteriovenous malformations and increased vessel calibers, were characterized in mouse models of the 3 common forms of HHT using transcriptomic and dye injection labeling methods.<h4>Results</h4>Comparative RNA sequencing analyses of isolated brain endothelial cells revealed a common, but unique proangiogenic transcriptional program associated with HHT. This included a consistent upregulation in cerebrovascular expression of ANG2 and downregulation of its receptor Tyr kinase with Ig and EGF homology domains (TIE2/TEK) in HHT mice compared with controls. Furthermore, in vitro experiments revealed TEK signaling activity was hampered in an HHT setting. Pharmacological blockade of ANG2 improved brain vascular pathologies in all HHT models, albeit to varying degrees. Transcriptomic profiling further indicated that ANG2 inhibition normalized the brain vasculature by impacting a subset of genes involved in angiogenesis and cell migration processes.<h4>Conclusions</h4>Elevation of ANG2 in the brain vasculature is a shared trait among the mouse models of the common forms of HHT. Inhibition of ANG2 activity can significantly limit or prevent brain arteriovenous malformation formation and blood vessel enlargement in HHT mice. Thus, ANG2-targeted therapies may represent a compelling approach to treat arteriovenous malformations and vascular pathologies related to all forms of HHT.

HTT
Also flagged:Huntington's DiseasecytosineadenineguaninechoreaMovement Disorders
Journal Article 2023-06-08 ✓ 2 Snippets Heinzmann A, Sayah S, Lejeune FX, Hahn V, Teichmann M, Monin ML, Marchionni E, Gérard F, Charles P, Pariente J, Durr A.
In-Text Gene Mentions

<h4>Background</h4>Carriers of small cytosine-adenine-guanine (CAG) repeats below 39 in the HTT gene are traditionally associated with milder Huntington's disease, but their clinical profile has not been extensively studied.<h4>Objective</h4>To study the phenotype of CAG<sub>36-38</sub> repeat carriers.<h4>Methods</h4>We included 35 patients and premanifest carriers of CAG<sub>36-38</sub> repeats.

…39 in theHTTgene are traditionally…

Show Full Abstract

<h4>Background</h4>Carriers of small cytosine-adenine-guanine (CAG) repeats below 39 in the HTT gene are traditionally associated with milder Huntington's disease, but their clinical profile has not been extensively studied.<h4>Objective</h4>To study the phenotype of CAG<sub>36-38</sub> repeat carriers.<h4>Methods</h4>We included 35 patients and premanifest carriers of CAG<sub>36-38</sub> repeats. We compared clinical and neuropsychological profiles of 11 CAG<sub>36-38</sub> patients with 11 matched CAG<sub>40-42</sub> patients. In addition, we analyzed 243 CAG<sub>36-38</sub> individuals from the ENROLL study to complete the phenotype description.<h4>Results</h4>Global cognitive efficiency and performance in different cognitive subdomains were similar in small CAG<sub>36-38</sub> and typically CAG<sub>40-42</sub> expanded individuals. Chorea as the first symptom was significantly less frequent for CAG<sub>36-38</sub> patients (P = 0.04) despite similar total motor scores at first visit. Total motor score at last visit was significantly lower in CAG<sub>36-38</sub> carriers (P = 0.003). The similar cognitive and different motor profile of CAG<sub>36-38</sub> (n = 243) and CAG<sub>40-42</sub> (n = 4675) carriers was confirmed in the ENROLL database. Additionally, clinicians were significantly less confident in diagnosing Huntington's disease (P = 2.4e-8) and diagnosis happened significantly later in CAG<sub>36-38</sub> (P = 2.2e-6) despite a similar age at symptom onset (P = 0.29).<h4>Conclusions</h4>We showed that small CAG<sub>36-38</sub> expansion carriers had a similar cognitive profile to those with the more common CAG<sub>40-42</sub> expansions. These individuals may evade molecular diagnosis because of the absence of chorea rather than because of a low penetrance of symptoms. This finding should encourage neurologists to consider Huntington's disease in cognitively impaired elderly patients without typical chorea and anticipate consequences for genetic counseling in their offspring. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

PRDX6
Also flagged:inherited diseasescorneal oedemavisionendothelium dysfunctionCD44CD105
Journal Article 2023-06-08 ✓ 4 Snippets Català P, Groen N, LaPointe VLS, Dickman MM.
In-Text Gene Mentions

…markers ALCAM (CD166),PRDX6, SLC4A11 ,…

…the expression ofPRDX6, a known…

…markers ALCAM ,PRDX6, and COL4A3.…

…ALCAM , andPRDX6.…

Show Full Abstract

The cornea is a transparent and avascular tissue located in front of the eye. Its inner surface is lined by a monolayer of corneal endothelial cells (CECs), which maintain the cornea transparency. CECs remain arrested in a non-proliferative state and damage to these cells can compromise their function leading to corneal opacity. The primary culture of donor-derived CECs is a promising cell therapy. It confers the potential to treat multiple patients from a single donor, alleviating the global donor shortage. Nevertheless, this approach has limitations preventing its adoption, particularly culture protocols allow limited expansion of CECs and there is a lack of clear parameters to identify therapy-grade CECs. To address this limitation, a better understanding of the molecular changes arising from the primary culture of CECs is required. Using single-cell RNA sequencing on primary cultured CECs, we identify their variable transcriptomic fingerprint at the single cell level, provide a pseudo-temporal reconstruction of the changes arising from primary culture, and suggest markers to assess the quality of primary CEC cultures. This research depicts a deep transcriptomic understanding of the cellular heterogeneity arising from the primary expansion of CECs and sets the basis for further improvement of culture protocols and therapies.

HTT
Also flagged:OxycodoneHDAC1HDAC2physical dependenceaddiction disordersgene expression
Journal Article 2023-06-08 ✓ 1 Snippet Pryce KD, Serafini RA, Ramakrishnan A, Nicolais A, Giosan IM, Polizu C, Torres-Berrío A, Vuppala S, Kronman H, Ruiz A, Gaspari S, Peña CJ, Sakloth F, Mitsi V, van Duzer J, Mazitschek R, Jarpe M, Shen L, Nestler EJ, Zachariou V.
In-Text Gene Mentions

HTT

Show Full Abstract

The development of physical dependence and addiction disorders due to misuse of opioid analgesics is a major concern with pain therapeutics. We developed a mouse model of oxycodone exposure and subsequent withdrawal in the presence or absence of chronic neuropathic pain. Oxycodone withdrawal alone triggered robust gene expression adaptations in the nucleus accumbens, medial prefrontal cortex and ventral tegmental area, with numerous genes and pathways selectively affected by oxycodone withdrawal in mice with peripheral nerve injury. Pathway analysis predicted that histone deacetylase (HDAC) 1 is a top upstream regulator in opioid withdrawal in nucleus accumbens and medial prefrontal cortex. The novel HDAC1/HDAC2 inhibitor, Regenacy Brain Class I HDAC Inhibitor (RBC1HI), attenuated behavioral manifestations of oxycodone withdrawal, especially in mice with neuropathic pain. These findings suggest that inhibition of HDAC1/HDAC2 may provide an avenue for patients with chronic pain who are dependent on opioids to transition to non-opioid analgesics.

PRDX6
Also flagged:neurological diseasesinnate immunitytype I interferoncoagulationfibrinogenbinding
Journal Article 2023-06-08 ✓ 1 Snippet Mendiola AS, Yan Z, Dixit K, Johnson JR, Bouhaddou M, Meyer-Franke A, Shin MG, Yong Y, Agrawal A, MacDonald E, Muthukumar G, Pearce C, Arun N, Cabriga B, Meza-Acevedo R, Alzamora MDPS, Zamvil SS, Pico AR, Ryu JK, Krogan NJ, Akassoglou K.
In-Text Gene Mentions

…example, Hmox1 ,Prdx6and Txnrd1 ),…

Show Full Abstract

Blood protein extravasation through a disrupted blood-brain barrier and innate immune activation are hallmarks of neurological diseases and emerging therapeutic targets. However, how blood proteins polarize innate immune cells remains largely unknown. Here, we established an unbiased blood-innate immunity multiomic and genetic loss-of-function pipeline to define the transcriptome and global phosphoproteome of blood-induced innate immune polarization and its role in microglia neurotoxicity. Blood induced widespread microglial transcriptional changes, including changes involving oxidative stress and neurodegenerative genes. Comparative functional multiomics showed that blood proteins induce distinct receptor-mediated transcriptional programs in microglia and macrophages, such as redox, type I interferon and lymphocyte recruitment. Deletion of the blood coagulation factor fibrinogen largely reversed blood-induced microglia neurodegenerative signatures. Genetic elimination of the fibrinogen-binding motif to CD11b in Alzheimer's disease mice reduced microglial lipid metabolism and neurodegenerative signatures that were shared with autoimmune-driven neuroinflammation in multiple sclerosis mice. Our data provide an interactive resource for investigation of the immunology of blood proteins that could support therapeutic targeting of microglia activation by immune and vascular signals.

TNFSF4
Also flagged:coppercelldeathcuproptosiscancercancers
Journal Article 2023-06-08 ✓ 1 Snippet Wang L, Xiao K, Dong Z, Meng T, Cheng X, Xu Y.
In-Text Gene Mentions

…HAVCR2, CD27, KIR3DL1,TNFSF4, BTLA, CD200R1, CD244,…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) is one of the most important malignancies and has a poor prognosis. Copper-induced cell death, recently termed cuproptosis, may directly affect the outcome of GC. Long noncoding RNAs (lncRNAs), possessing stable structures, can influence the prognosis of cancer and may serve as potential prognostic prediction factors for various cancers. However, the role of copper cell death-related lncRNAs (CRLs) in GC has not been thoroughly investigated. Here, we aim to elucidate the role of CRLs in predicting prognosis, diagnosis, and immunotherapy in GC patients.<h4>Methods</h4>RNA expression data for 407 GC patients from The Cancer Genome Atlas (TCGA) were gathered, and differentially expressed CRLs were identified. Subsequently, the researchers applied univariate, LASSO, and multivariate Cox regression to construct a prognostic signature consisting of 5 lncRNAs based on the CRLs. Stratified by the median CRLSig risk score, Kaplan-Meier analysis was utilized to compare overall survival (OS) between the high- and low-risk groups. Among the two groups, gene set enrichment analysis (GSEA), tumor microenvironment (TME), drug sensitivity analysis, and immune checkpoint analysis were conducted. In addition, consensus clustering and nomogram analysis were performed to predict OS. Cell experiments and 112 human serum samples were employed to verify the effect of lncRNAs on GC. Furthermore, the diagnostic value of the CRLSig in the serum of GC patients was analyzed by the receiver operating characteristic (ROC) curve.<h4>Results</h4>A prognostic signature for GC patients was constructed based on CRLs, composed of AC129926.1, AP002954.1, AC023511.1, LINC01537, and TMEM75. According to the K-M survival analysis, high-risk GC patients had a lower OS rate and progression-free survival rate than low-risk GC patients. Further support for the model's accuracy was provided by ROC, principal component analysis, and the validation set. The area under the curve (AUC) of 0.772 for GC patients showed a better prognostic value than any other clinicopathological variable. Furthermore, immune infiltration analysis showed that the high-risk group had greater antitumor immune responses in the tumor microenvironment. In the high-risk subgroup, 23 immune checkpoint genes had significantly higher expression levels than in the low-risk subgroup (p < 0.05). The half-maximal inhibitory concentrations (IC50) of 86 drugs were found to be significantly different in the two groups. Accordingly, the model is capable of predicting the effectiveness of immunotherapy. In addition, the five CRLs in GC serum exhibited statistically significant expression levels. The AUC of this signature in GC serum was 0.894, with a 95% CI of 0.822-0.944. Moreover, lncRNA AC129926.1 was significantly overexpressed in GC cell lines and the serum of GC patients. Importantly, colony formation, wound healing, and transwell assays further confirmed the oncogenic role of AC129926.1 in GC.<h4>Conclusion</h4>In this study, a prognostic signature model consisting of five CRLs was developed to improve OS prediction accuracy in GC patients. The model also has the potential to predict immune infiltration and immunotherapy effectiveness. Furthermore, the CRLSig might serve as a novel serum biomarker to differentiate GC patients from healthy individuals.

Also flagged:melanomacancer of theskin cancercutaneous malignant melanomamelanomasmole
Journal Article 2023-06-08 No Snippets Grafanaki K, Grammatikakis I, Ghosh A, Gopalan V, Olgun G, Liu H, Kyriakopoulos GC, Skeparnias I, Georgiou S, Stathopoulos C, Hannenhalli S, Merlino G, Marie KL, Day CP.
Show Full Abstract

Melanoma, the cancer of the melanocyte, is the deadliest form of skin cancer with an aggressive nature, propensity to metastasize and tendency to resist therapeutic intervention. Studies have identified that the re-emergence of developmental pathways in melanoma contributes to melanoma onset, plasticity, and therapeutic response. Notably, it is well known that noncoding RNAs play a critical role in the development and stress response of tissues. In this review, we focus on the noncoding RNAs, including microRNAs, long non-coding RNAs, circular RNAs, and other small RNAs, for their functions in developmental mechanisms and plasticity, which drive onset, progression, therapeutic response and resistance in melanoma. Going forward, elucidation of noncoding RNA-mediated mechanisms may provide insights that accelerate development of novel melanoma therapies.

B4GALT5
Also flagged:N-glycosylationFollicle-stimulating hormoneglycoproteinglycansecretionsugars
Journal Article 2023-06-08 ✓ 1 Snippet McDonald R, Larsen M, Liu Z, Southekal S, Eudy J, Guda C, Kumar TR.
In-Text Gene Mentions

B4galt5

Show Full Abstract

Follicle-stimulating hormone (FSH) is a glycoprotein that is assembled as a heterodimer of α/β subunits in gonadotropes. Each subunit contains two N-glycan chains. Our previous in vivo genetic studies identified that at least one N-glycan chain must be present on the FSHβ subunit for efficient FSH dimer assembly and secretion. Moreover, macroheterogeneity observed uniquely on human FSHβ results in ratiometric changes in age-specific FSH glycoforms, particularly during menopausal transition. Despite the recognition of many prominent roles of sugars on FSH including dimer assembly and secretion, serum half-life, receptor binding and signal transduction, the N-glycosylation machinery in gonadotropes has never been defined. Here, we used a mouse model in which gonadotropes are GFP-labeled in vivo and achieved rapid purification of GFP<sup>+</sup> gonadotropes from pituitaries of female mice at reproductively young, middle, and old ages. We identified by RNA-seq analysis 52 mRNAs encoding N-glycosylation pathway enzymes expressed in 3- and 8-10-month-old mouse gonadotropes. We hierarchically mapped and localized the enzymes to distinct subcellular organelles within the N-glycosylation biosynthetic pathway. Of the 52 mRNAs, we found 27 mRNAs are differentially expressed between the 3- and 8-10-month old mice. We subsequently selected 8 mRNAs which showed varying changes in expression for confirmation of abundance in vivo via qPCR analysis, using more expanded aging time points with distinct 8-month and 14-month age groups. Real time qPCR analysis indicated dynamic changes in expression of N-glycosylation pathway enzyme-encoding mRNAs across the life span. Notably, computational analysis predicted the promoters of genes encoding these 8 mRNAs contain multiple high probability binding sites for estrogen receptor-1 and progesterone receptor. Collectively, our studies define the N-glycome and identify age-specific dynamic changes in mRNAs encoding N-glycosylation pathway enzymes in mouse gonadotropes. Our studies suggest the age-related decline in ovarian steroids may regulate expression of N-glycosylation enzymes in mouse gonadotropes and explain the age-related N-glycosylation shift previously observed on human FSHβ subunit in pituitaries of women.

HFE
Also flagged:Systolic Heart Failureischemic HFsepsisepinephrinenorepinephrinecardiomyopathy
Journal Article 2023-06-08 ✓ 1 Snippet Souki FG, Raveh Y, Sancassani R, Livingstone J, Shatz V, Ashrafi B, Shuman M, Nicolau-Raducu R.
In-Text Gene Mentions

…s portopulmonary hypertension,hemochromatosis, and cirrhotic cardiomyopathy…

Show Full Abstract

New-onset systolic heart failure (HF) after liver transplantation (LT) is a significant cause of morbidity and mortality; however, its characteristics are still insufficiently delineated. HF may involve the left ventricle (LV), right ventricle (RV), or both ventricles. We explored the incidence, characteristics, etiologies, risks, involved cardiac chambers, and outcomes of HF after LT.<h4>Methods</h4>This study included 528 adult patients with preoperative LV ejection fraction ≥ 55% who underwent LT between 2016 and 2020. The primary outcome was new-onset systolic HF, defined by the presence of clinical signs, symptoms, and echocardiographic evidence of reduced LVejection fraction <50% and RV dysfunction within the first year after LT.<h4>Results</h4>Thirty-one patients (6%) developed systolic HF within a median of 9 d (1-364). Of those, 23% of patients had ischemic HF, whereas 77% had nonischemic HF. Nonischemic HF was caused by stress (11), sepsis (8), or other factors (5). Nonischemic HF was secondary to isolated LV failure in 58% of patients or RV ± LV failure in 42% of patients. Recursive partitioning identified subgroups with varying risks and uncovered interaction between variables. HF risk increased from 4.2% to 13% when epinephrine and/or norepinephrine drips were used intraoperatively (<i>P</i> < 0.01). When no epinephrine and/or norepinephrine were used, HF risk increased from 3.1% to 38.5% if baseline hemoglobin was <7.2 g/dL (<i>P</i> < 0.01). When baseline hemoglobin was ≥7.2 g/dL, HF risk increased from 0% to 5.2% when ≥3500 mL crystalloid was used intraoperatively (<i>P</i> < 0.01). Posttransplant first-year survival and reversibility of HF depended on the etiology (stress, sepsis, ischemia, etc) and cardiac chamber involvement (isolated LV or RV ± LV). RV dysfunction was associated with inferior recovery of cardiac function and poorer survival than nonischemic isolated LV dysfunction (50% versus 70%, respectively).<h4>Conclusions</h4>Posttransplant new-onset HF is mostly nonischemic in nature and is associated with increased morbidity and mortality.

HFE
Also flagged:Liver Fibrosisnonalcoholic fatty liver diseaseNAFLDtype 2 diabetes mellitusobesityAF
Journal Article 2023-06-08 ✓ 1 Snippet Caussy C, Telliam C, Al-Nuaimi B, Maynard-Muet M, Dumortier J, Zoulim F, Disse E, Colin C, Levrero M, Moulin P.
In-Text Gene Mentions

…last 10 years),hemochromatosis, Wilson disease, medications…

Show Full Abstract

<h4>Purpose</h4>A systematic screening for the presence of nonalcoholic fatty liver disease (NAFLD)-related advanced fibrosis is currently recommended in patients with type 2 diabetes mellitus (T2DM) and obesity. However, real-world data of such liver fibrosis risk stratification pathway from diabetology and nutrition clinics towards hepatology clinics are scarce. Therefore, we compared data from two pathways with or without transient elastography (TE) performed in diabetology and nutrition clinics.<h4>Patients and methods</h4>This is a retrospective study comparing the proportion of patients with intermediate/high risk of advanced fibrosis (AF) as defined by a liver stiffness measurement (LSM) ≥8kPa, among patients referred in hepatology from two diabetology-nutrition departments at Lyon University Hospital, France between November 1st 2018 to December 31st 2019.<h4>Results</h4>Among the two diabetology and nutrition departments using TE or not, 27.5% (62/225) versus 44.2% (126/285) were referred to hepatology, respectively. The pathway using TE in diabetology and nutrition referred to hepatology a higher proportion of patients with intermediate/high risk of AF compared to the pathway without TE: 77.4% versus 30.9%, p<0.001. In the pathway with TE, the odds of patients with intermediate/high risk of AF referred to hepatology was significantly higher: OR: 7.7, 95% CI: 3.6-16.7, p<0.001 after adjustment for age, sex and presence of obesity and T2D compared to the pathway without TE in diabetology and nutrition clinics. However, among the patients not referred, 29.4% had an intermediate/high risk of AF.<h4>Conclusion</h4>A pathway-referral using TE performed in diabetology and nutrition clinics, significantly improves the liver fibrosis risk stratification and avoids over-referral. However, collaboration between diabetologist, nutritionists and hepatologists is needed to avoid under-referral.

HTT
Also flagged:ironHDpathogenesisferroptosisneurodegenerative diseaseneurodegenerative disorder
Journal Article 2023-06-08 ✓ 2 Snippets van de Zande NA, Bulk M, Najac C, van der Weerd L, de Bresser J, Lewerenz J, Ronen I, de Bot ST.
In-Text Gene Mentions

Neuroinflammation is also increasingly recognized as a strong component of HD pathogenesis that causes disease progression, via the cell-autonomous proinflammatory activation of microglia due to the expression of mutant HTT (Pavese et al., 2006, Sapp et al., 2001, Crotti and Glass, 2015, Möller, 2010, Silvestroni et al., 2009, Simmons et al., 2007, Tai et al., 2007, Tai et al., 2007).

…1 in theHTTgene on chromosome…

Show Full Abstract

<h4>Introduction</h4>Strong evidence suggests a significant role for iron accumulation in the brain in addition to the well-documented neurodegenerative aspects of Huntington's disease (HD). The putative mechanisms by which iron is linked to the HD pathogenesis are multiple, including oxidative stress, ferroptosis and neuroinflammation. However, no previous study in a neurodegenerative disease has linked the observed increase of brain iron accumulation as measured by MRI with well-established cerebrospinal fluid (CSF) and blood biomarkers for iron accumulation, or with associated processes such as neuroinflammation. This study is designed to link quantitative data from iron levels and neuroinflammation metabolites obtained from 7T MRI of HD patients, with specific and well-known clinical biofluid markers for iron accumulation, neurodegeneration and neuroinflammation. Biofluid markers will provide quantitative measures of overall iron accumulation, neurodegeneration and neuroinflammation, while MRI measurements on the other hand will provide quantitative spatial information on brain pathology, neuroinflammation and brain iron accumulation, which will be linked to clinical outcome measures.<h4>Methods</h4>This is an observational cross-sectional study, IMAGINE-HD, in HD gene expansion carriers and healthy controls. We include premanifest HD gene expansion carriers and patients with manifest HD in an early or moderate stage. The study includes a 7T MRI scan of the brain, clinical evaluation, motor, functional, and neuropsychological assessments, and sampling of CSF and blood for the detection of iron, neurodegenerative and inflammatory markers. Quantitative Susceptibility Maps will be reconstructed using T2* weighted images to quantify brain iron levels and Magnetic Resonance Spectroscopy will be used to obtain information about neuroinflammation by measuring cell-specific intracellular metabolites' level and diffusion. Age and sex matched healthy subjects are included as a control group.<h4>Discussion</h4>Results from this study will provide an important basis for the evaluation of brain iron levels and neuroinflammation metabolites as an imaging biomarker for disease stage in HD and their relationship with the salient pathomechanisms of the disease on the one hand, and with clinical outcome on the other.

Also flagged:sepsisGene Expressionseptic shockoxygenphosphatidylinositol 3-kinasesPI3K
Journal Article 2023-06-08 No Snippets Kong C, Zhu Y, Xie X, Wu J, Qian M.
Show Full Abstract

<h4>Background</h4>Septic shock occurs when sepsis is related to severe hypotension and leads to a remarkable high number of deaths. The early diagnosis of septic shock is essential to reduce mortality. High-quality biomarkers can be objectively measured and evaluated as indicators to accurately predict disease diagnosis. However, single-gene prediction efficiency is inadequate; therefore, we identified a risk-score model based on gene signature to elevate predictive efficiency.<h4>Methods</h4>The gene expression profiles of GSE33118 and GSE26440 were downloaded from the Gene Expression Omnibus (GEO) database. These two datasets were merged, and the differentially expressed genes (DEGs) were identified using the limma package in R software. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichments of DEGs were performed. Subsequently, Lasso regression and Boruta feature selection algorithm were combined to identify the hub genes of septic shock. GSE9692 was then subjected to weighted gene co-expression network analysis (WGCNA) to identify the septic shock-related gene modules. Subsequently, the genes within such modules that matched with septic shock-related DEGs were identified as the hub genes of septic shock. To further understand the function and signaling pathways of hub genes, we performed gene set variation analysis (GSVA) and then used the CIBERSORT tool to analyze the immune cell infiltration pattern of diseases. The diagnostic value of hub genes in septic shock was determined using receiver operating characteristic (ROC) analysis and verified using quantitative PCR (qPCR) and Western blotting in our hospital patients with septic shock.<h4>Results</h4>A total of 975 DEGs in the GSE33118 and GSE26440 databases were obtained, of which 30 DEGs were remarkably upregulated. With the use of Lasso regression and Boruta feature selection algorithm, six hub genes (<i>CD177</i>, <i>CLEC5A</i>, <i>CYSTM1</i>, <i>MCEMP1</i>, <i>MMP8</i>, and <i>RGL4</i>) with expression differences in septic shock were screened as potential diagnostic markers for septic shock among the significant DEGs and were further validated in the GSE9692 dataset. WGCNA was used to identify the co-expression modules and module-trait correlation. Enrichment analysis showed significant enrichment in the reactive oxygen species pathway, hypoxia, phosphatidylinositol 3-kinases (PI3K)/Protein Kinase B (AKT)/mammalian target of rapamycin (mTOR) signaling, nuclear factor-κβ/tumor necrosis factor alpha (NF-κβ/TNF-α), and interleukin-6 (IL-6)/Janus Kinase (JAK)/Signal Transducers and Activators of Transcription 3 (STAT3) signaling pathways. The receiver operating characteristic curve (ROC) of these signature genes was 0.938, 0.914, 0.939, 0.956, 0.932, and 0.914, respectively. In the immune cell infiltration analysis, the infiltration of M0 macrophages, activated mast cells, neutrophils, CD8 T cells, and naive B cells was more significant in the septic shock group. In addition, higher expression levels of <i>CD177, CLEC5A, CYSTM1, MCEMP1, MMP8</i>, and <i>RGL4</i> messenger RNA (mRNA) were observed in peripheral blood mononuclear cells (PBMCs) isolated from septic shock patients than from healthy donors. Higher expression levels of CD177 and MMP8 proteins were also observed in the PBMCs isolated from septic shock patients than from control participants.<h4>Conclusions</h4><i>CD177</i>, <i>CLEC5A</i>, <i>CYSTM1</i>, <i>MCEMP1</i>, <i>MMP8</i>, and <i>RGL4</i> were identified as hub genes, which were of considerable value in the early diagnosis of septic shock patients. These preliminary findings are of great significance for studying immune cell infiltration in the pathogenesis of septic shock, which should be further validated in clinical studies and basic studies.

PCDH17
Also flagged:IgGFc-binding proteinMUC2mucinmucus-associated proteinFCGBPto
Journal Article 2023-06-08 ✓ 1 Snippet Gorman H, Moreau F, Dufour A, Chadee K.
In-Text Gene Mentions

…NPAS4, adhesion molecules (PCDH17and CDHR5) and…

Show Full Abstract

The colonic mucus bilayer is the first line of innate host defense that at the same time houses and nourishes the commensal microbiota. The major components of mucus secreted by goblet cells are MUC2 mucin and the mucus-associated protein, FCGBP (IgGFc-binding protein). In this study, we determine if FCGBP and MUC2 mucin were biosynthesized and interacted together to spatially enhance the structural integrity of secreted mucus and its role in epithelial barrier function. MUC2 and FCGBP were coordinately regulated temporally in goblet-like cells and in response to a mucus secretagogue but not in CRISPR-Cas9 gene-edited <i>MUC2 KO</i> cells. Whereas ~85% of MUC2 was colocalized with FCGBP in mucin granules, ~50% of FCGBP was diffusely distributed in the cytoplasm of goblet-like cells. STRING-db v11 analysis of the mucin granule proteome revealed no protein-protein interaction between MUC2 and FCGBP. However, FCGBP interacted with other mucus-associated proteins. FCGBP and MUC2 interacted via N-linked glycans and were non-covalently bound in secreted mucus with cleaved low molecular weight FCGBP fragments. In <i>MUC2 KO</i>, cytoplasmic FCGBP was significantly increased and diffusely distributed in wounded cells that healed by enhanced proliferation and migration within 2 days, whereas, in WT cells, MUC2 and FCGBP were highly polarized at the wound margin which impeded wound closure by 6 days. In DSS colitis, restitution and healed lesions in <i>Muc2<sup>+/+</sup></i> but not <i>Muc2<sup>-/-</sup></i> littermates, were accompanied by a rapid increase in <i>Fcgbp</i> mRNA and delayed protein expression at 12- and 15-days post DSS, implicating a potential novel endogenous protective role for FCGBP in wound healing to maintain epithelial barrier function.

Also flagged:cytochrome P450 enzymelactose intolerancemetabolismcytochrome P450glucose-6-phosphate dehydrogenasefemale cancer
Journal Article 2023-06-08 No Snippets Lee M, Han JM, Lee J, Oh JY, Kim JS, Gwak HS, Choi KH.
Show Full Abstract

Pharmacogenomics, which is defined as the study of changes in the properties of DNA and RNA associated with drug response, enables the prediction of the efficacy and adverse effects of drugs based on patients' specific genetic mutations. For the safe and effective use of drugs, it is important that pharmacogenomic information is easily accessible to clinical experts and patients. Therefore, we examined the pharmacogenomic information provided on drug labels in Korea, Europe, Japan, and the United States (US). The selection of drugs that include pharmacogenomic information was based on the drug list that includes genetic information from the Korea Ministry of Food and Drug Safety (MFDS) and US Food and Drug Administration (FDA) websites. Drug labels were retrieved from the sites of MFDS, FDA, European Medicines Agency, and Japanese Pharmaceuticals and Medical Devices Agency. Drugs were classified as per the Anatomical Therapeutic Chemical code, and the biomarkers, labeling sections, and necessity of genetic tests were determined. In total, 348 drugs were selected from 380 drugs with available pharmacogenomic information in Korea and the US after applying the inclusion and exclusion criteria. Of these drugs, 137, 324, 169, and 126 were with pharmacogenomics information in Korea, the US, Europe, and Japan, respectively. The most commonly represented drug class was antineoplastic and immunomodulating agents. Regarding the classification as per the mentioned biomarkers, the cytochrome P450 enzyme was the most frequently mentioned information, and the targeted anticancer drugs most commonly required genetic biomarker testing. The reasons for differences in drug labeling information based on country include differences in mutant alleles according to ethnicity, frequencies at which drug lists are updated, and pharmacogenomics-related guidelines. Clinical experts must continuously strive to identify and report mutations that can explain drug efficacy or side effects for safe drug use.

HTT
Also flagged:cholesterolsphingolipidmetabolismneurodegenerative disorderssynapseaxon
Journal Article 2023-06-08 ✓ 2 Snippets Pathak D, Sriram K.
In-Text Gene Mentions

An expanded chain of polyglutamine in the huntingtin protein (HTT) is the hallmark of HD (Khakh and Sofroniew, 2015), where aggregation and accumulation of intracellular mutant HTT (mHTT) occurs.

…the huntingtin protein (HTT) is the hallmark…

Show Full Abstract

Astrocytes are an abundantly distributed population of glial cells in the central nervous system (CNS) that perform myriad functions in the normal and injured/diseased brain. Astrocytes exhibit heterogeneous phenotypes in response to various insults, a process known as astrocyte reactivity. The accuracy and precision of brain signaling are primarily based on interactions involving neurons, astrocytes, oligodendrocytes, microglia, pericytes, and dendritic cells within the CNS. Astrocytes have emerged as a critical entity within the brain because of their unique role in recycling neurotransmitters, actively modulating the ionic environment, regulating cholesterol and sphingolipid metabolism, and influencing cellular crosstalk in diverse neural injury conditions and neurodegenerative disorders. However, little is known about how an astrocyte functions in synapse formation, axon specification, neuroplasticity, neural homeostasis, neural network activity following dynamic surveillance, and CNS structure in neurological diseases. Interestingly, the tripartite synapse hypothesis came to light to fill some knowledge gaps that constitute an interaction of a subpopulation of astrocytes, neurons, and synapses. This review highlights astrocytes' role in health and neurological/neurodegenerative diseases arising from the omnidirectional signaling between astrocytes and neurons at the tripartite synapse. The review also recapitulates the disruption of the tripartite synapse with a focus on perturbations of the homeostatic astrocytic function as a key driver to modulate the molecular and physiological processes toward neurodegenerative diseases.

HFEMMS22L
Also flagged:AMPD1CDKN1AMYBPC3NFIAAS2PPARA
Journal Article 2023-06-08 ✓ 2 Snippets Semenova EA, Hall ECR, Ahmetov II.
In-Text Gene Mentions

…LRPPRC rs10186876 A,MMS22Lrs9320823 T, PHACTR1…

…CDKN1A rs236448 A,HFErs1799945 G, MYBPC3…

Show Full Abstract

Phenotypes of athletic performance and exercise capacity are complex traits influenced by both genetic and environmental factors. This update on the panel of genetic markers (DNA polymorphisms) associated with athlete status summarises recent advances in sports genomics research, including findings from candidate gene and genome-wide association (GWAS) studies, meta-analyses, and findings involving larger-scale initiatives such as the UK Biobank. As of the end of May 2023, a total of 251 DNA polymorphisms have been associated with athlete status, of which 128 genetic markers were positively associated with athlete status in at least two studies (41 endurance-related, 45 power-related, and 42 strength-related). The most promising genetic markers include the <i>AMPD1</i> rs17602729 C, <i>CDKN1A</i> rs236448 A, <i>HFE</i> rs1799945 G, <i>MYBPC3</i> rs1052373 G, <i>NFIA-AS2</i> rs1572312 C, <i>PPARA</i> rs4253778 G, and <i>PPARGC1A</i> rs8192678 G alleles for endurance; <i>ACTN3</i> rs1815739 C, <i>AMPD1</i> rs17602729 C, <i>CDKN1A</i> rs236448 C, <i>CPNE5</i> rs3213537 G, <i>GALNTL6</i> rs558129 T, <i>IGF2</i> rs680 G, <i>IGSF3</i> rs699785 A, <i>NOS3</i> rs2070744 T, and <i>TRHR</i> rs7832552 T alleles for power; and <i>ACTN3</i> rs1815739 C, <i>AR</i> ≥21 CAG repeats, <i>LRPPRC</i> rs10186876 A, <i>MMS22L</i> rs9320823 T, <i>PHACTR1</i> rs6905419 C, and <i>PPARG</i> rs1801282 G alleles for strength. It should be appreciated, however, that elite performance still cannot be predicted well using only genetic testing.

Also flagged:transient receptor potential vanilloid 1TRPV1transient receptor potential fixed hormone isoformTRPA1taste receptorchannel
Journal Article 2023-06-08 No Snippets He W, Liang L, Zhang Y.
Show Full Abstract

The perception of pungency can be attributed to the combination of pain and heat, and it has critical impacts on food flavor and food consumption preferences. Many studies have reported a variety of pungent ingredients with different Scoville heat units (SHU), and the mechanism of pungent perception was revealed in vivo and in vitro. The worldwide use of spices containing pungent ingredients has led to an increasing awareness of their effects on basic tastes. However, the interaction between basic tastes and pungency perception based on structure-activity relationship, taste perception mechanism and neurotransmission lacks review and summary, considering its brighter prospects in food flavor. Thus, in this review, common pungency substances and pungency evaluation methods, and the mechanism of pungency perception is presented, and the interaction between basic tastes and pungency perception and the possible factors of their interaction are reviewed in detail. Pungent stimuli are mainly transduced through transient receptor potential vanilloid 1 (TRPV1) and transient receptor potential fixed hormone isoform (TRPA1) activated by stimulants. Using modern detection techniques combined with sensory standards, different substances produce different degrees of pungent stimulation, ranging from 10<sup>4</sup> to 10<sup>7</sup> SHU/g. Pungent stimuli can affect taste receptor or channel protein conformation and regulate taste bud cell sensitivity by producing neurotransmission products. The products of neurotransmission and taste receptor cell activation in turn act on taste perception. When there are simultaneous effects of taste perception, pungency stimulation may enhance the perception of salty at a certain concentration, with a mutual inhibition effect with sour, sweet, and bitter taste, while its interaction with umami taste is not obvious. However, due to the complexity of perception and the uncertainty of many perceptual receptors or channels, the current studies of interactions are still controversial. Based on the understanding of the mechanism and influencing factors, the availability of pungency substances is proposed in the perspective of food industry in order to achieve new development.

CACNA1E
Also flagged:Tinnitushearinglossanxietydepressionsleep
Journal Article 2023-06-08 ✓ 1 Snippet Singh A, Smith PF, Zheng Y.
In-Text Gene Mentions

They identified CACNA1E, NAV2 and TMEM132D as potential genes that may play a role in contributing to severe tinnitus [13].

Show Full Abstract

Tinnitus is originally derived from the Latin verb <i>tinnire</i>, which means "to ring". Tinnitus, a complex disorder, is a result of sentient cognizance of a sound in the absence of an external auditory stimulus. It is reported in children, adults, and older populations. Patients suffering from tinnitus often present with hearing loss, anxiety, depression, and sleep disruption in addition to a hissing and ringing in the ear. Surgical interventions and many other forms of treatment have been only partially effective due to heterogeneity in tinnitus patients and a lack of understanding of the mechanisms of tinnitus. Although researchers across the globe have made significant progress in understanding the underlying mechanisms of tinnitus over the past few decades, tinnitus is still deemed to be a scientific enigma. This review summarises the role of the limbic system in tinnitus development and provides insight into the development of potential target-specific tinnitus therapies.

Also flagged:Diffuse midline gliomamalignant tumors of thePontine tumorsDiffuse intrinsic pontine gliomaDIPGCNS tumors
Journal Article 2023-06-08 No Snippets El Malki K, Wehling P, Alt F, Sandhoff R, Zahnreich S, Ustjanzew A, Wilzius C, Brockmann MA, Wingerter A, Russo A, Beck O, Sommer C, Ottenhausen M, Frauenknecht KBM, Paret C, Faber J.
Show Full Abstract

H3K27M mutant (mut) diffuse midline glioma (DMG) is a lethal cancer with no effective cure. The glycosphingolipids (GSL) metabolism is altered in these tumors and could be exploited to develop new therapies. We tested the effect of the glucosylceramide synthase inhibitors (GSI) miglustat and eliglustat on cell proliferation, alone or in combination with temozolomide or ionizing radiation. Miglustat was included in the therapy protocol of two pediatric patients. The effect of H3.3K27 trimethylation on GSL composition was analyzed in ependymoma. GSI reduced the expression of the ganglioside GD2 in a concentration and time-dependent manner and increased the expression of ceramide, ceramide 1-phosphate, sphingosine, and sphingomyelin but not of sphingosine 1-phosphate. Miglustat significantly increased the efficacy of irradiation. Treatment with miglustat according to dose recommendations for patients with Niemann-Pick disease was well tolerated with manageable toxicities. One patient showed a mixed response. In ependymoma, a high concentration of GD2 was found only in the presence of the loss of H3.3K27 trimethylation. In conclusion, treatment with miglustat and, in general, targeting GSL metabolism may offer a new therapeutic opportunity and can be administered in close proximity to radiation therapy. Alterations in H3K27 could be useful to identify patients with a deregulated GSL metabolism.

HFE
Also flagged:Ironmetabolismiron deficiencychemokinedesferrioxaminetransferrin receptor 1
Journal Article 2023-06-08 ✓ 1 Snippet Pandur E, Pap R, Jánosa G, Horváth A, Sipos K.
In-Text Gene Mentions

…1/transferrin receptor 2 (HFE/TfR1/TfR2) iron sensor system…

Show Full Abstract

Iron is a crucial element in the human body. Endometrial iron metabolism is implicated in endometrium receptivity and embryo implantation. Disturbances of the maternal as well as the endometrial iron homeostasis, such as iron deficiency, can contribute to the reduced development of the fetus and could cause an increased risk of adverse pregnancy outcomes. Fractalkine is a unique chemokine that plays a role in the communication between the mother and the fetus. It has been demonstrated that FKN is involved in the development of endometrial receptivity and embryo implantation, and it functions as a regulator of iron metabolism. In the present study, we examined the effect of FKN on the iron metabolism of HEC-1A endometrial cells in a state of iron deficiency mediated by desferrioxamine treatment. Based on the findings, FKN enhances the expression of iron metabolism-related genes in iron deficiency and modifies the iron uptake via transferrin receptor 1 and divalent metal transporter-1, and iron release via ferroportin. FKN can activate the release of iron from heme-containing proteins by elevating the level of heme oxygenase-1, contributing to the redistribution of intracellular iron content. It was revealed that the endometrium cells express both mitoferrin-1 and 2 and that their levels are not dependent on the iron availability of the cells. FKN may also contribute to maintaining mitochondrial iron homeostasis. FKN can improve the deteriorating effect of iron deficiency in HEC-1A endometrium cells, which may contribute to the development of receptivity and/or provide iron delivery towards the embryo.

Also flagged:chitosancollagenstarchbiopolymerimmunological responsesextracellular
Journal Article 2023-06-08 No Snippets Vach Agocsova S, Culenova M, Birova I, Omanikova L, Moncmanova B, Danisovic L, Ziaran S, Bakos D, Alexy P.
Show Full Abstract

This article provides a thorough overview of the available resorbable biomaterials appropriate for producing replacements for damaged tissues. In addition, their various properties and application possibilities are discussed as well. Biomaterials are fundamental components in tissue engineering (TE) of scaffolds and play a critical role. They need to exhibit biocompatibility, bioactivity, biodegradability, and non-toxicity, to ensure their ability to function effectively with an appropriate host response. With ongoing research and advancements in biomaterials for medical implants, the objective of this review is to explore recently developed implantable scaffold materials for various tissues. The categorization of biomaterials in this paper includes fossil-based materials (e.g., PCL, PVA, PU, PEG, and PPF), natural or bio-based materials (e.g., HA, PLA, PHB, PHBV, chitosan, fibrin, collagen, starch, and hydrogels), and hybrid biomaterials (e.g., PCL/PLA, PCL/PEG, PLA/PEG, PLA/PHB PCL/collagen, PCL/chitosan, PCL/starch, and PLA/bioceramics). The application of these biomaterials in both hard and soft TE is considered, with a particular focus on their physicochemical, mechanical, and biological properties. Furthermore, the interactions between scaffolds and the host immune system in the context of scaffold-driven tissue regeneration are discussed. Additionally, the article briefly mentions the concept of in situ TE, which leverages the self-renewal capacities of affected tissues and highlights the crucial role played by biopolymer-based scaffolds in this strategy.

Also flagged:Zinc Phthalocyanineoxygenmembranescell wallsynthesismembrane
Journal Article 2023-06-08 No Snippets Liu D, Jiang L, Chen J, Chen Z, Yuan C, Lin D, Huang M.
Show Full Abstract

Photodynamic therapy (PDT) is recognized as a powerful method to inactivate cells. However, the photosensitizer (PS), a key component of PDT, has suffered from undesired photobleaching. Photobleaching reduces reactive oxygen species (ROS) yields, leading to the compromise of and even the loss of the photodynamic effect of the PS. Therefore, much effort has been devoted to minimizing photobleaching in order to ensure that there is no loss of photodynamic efficacy. Here, we report that a type of PS aggregate showed neither photobleaching nor photodynamic action. Upon direct contact with bacteria, the PS aggregate was found to fall apart into PS monomers and thus possessed photodynamic inactivation against bacteria. Interestingly, the disassembly of the bound PS aggregate in the presence of bacteria was intensified by illumination, generating more PS monomers and leading to an enhanced antibacterial photodynamic effect. This demonstrated that on a bacterial surface, the PS aggregate photo-inactivated bacteria via PS monomer during irradiation, where the photodynamic efficiency was retained without photobleaching. Further mechanistic studies showed that PS monomers disrupted bacterial membranes and affected the expression of genes related to cell wall synthesis, bacterial membrane integrity, and oxidative stress. The results obtained here are applicable to other types of PSs in PDT.

Also flagged:demineralizationtooth cariescariesmineralizationDental cariesacids
Journal Article 2023-06-08 No Snippets Yu K, Zhang Q, Dai Z, Zhu M, Xiao L, Zhao Z, Bai Y, Zhang K.
Show Full Abstract

Smart dental materials are designed to intelligently respond to physiological changes and local environmental stimuli to protect the teeth and promote oral health. Dental plaque, or biofilms, can substantially reduce the local pH, causing demineralization that can then progress to tooth caries. Progress has been made recently in developing smart dental materials that possess antibacterial and remineralizing capabilities in response to local oral pH in order to suppress caries, promote mineralization, and protect tooth structures. This article reviews cutting-edge research on smart dental materials, their novel microstructural and chemical designs, physical and biological properties, antibiofilm and remineralizing capabilities, and mechanisms of being smart to respond to pH. In addition, this article discusses exciting and new developments, methods to further improve the smart materials, and potential clinical applications.

SERPINC1
Also flagged:CBSischemic strokemultisystem diseasesstrokesystemic diseasespathogenesis
Journal Article 2023-06-08 ✓ 5 Snippets Jiang X, Shen D, Yang X, Lu Z, Huang H, Zhang B, Ma H.
In-Text Gene Mentions

In addition, another variation in SERPINC1 at nucleotide 719 in the coding region changed from adenine to guanine, inducing amino acid 240 to change from asparagine to serine (c.719A>G, p.N240S) (Figure 4C).

The young patient in this case developed venous thrombosis due to a mutation in SERPINC1.

Consistent with this, in cases of CBS mutation combined with SERPINC1 mutation, and those in which the main pathogenic factors are blood homocysteine and hypercoagulability, long-term secondary prevention after discharge is still mainly an etiological treatment without antiplatelet therapy.

Although there are various reports on hyperhomocysteinemia caused by CBS mutation, there are only a few reports about the concurrent mutations of CBS and SERPINC1. A study has reported that patients with CBS deficiency have lower antithrombin levels and severe hyperhomocysteinemia (16).

…CBS andSERPINC1mutation-induced ischemic stro…

Show Full Abstract

No abstract available.

HFE
Also flagged:liver diseasecoagulationclot formationobesitypreeclampsialow platelet syndrome
Journal Article 2023-06-08 ✓ 1 Snippet Fiol AG, Yoo J, Yanez D, Fardelmann KL, Salimi N, Alian M, Mancini P, Alian A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Point-of-care testing provides a representation of the patient's coagulability status during effective postpartum hemorrhage management. Baseline values of rotational thromboelastometry (ROTEM) have not yet been reported in a heterogeneous obstetric population. This study aimed to establish a baseline for a diverse population representative of the United States. The secondary aim was to evaluate the association of these hematologic parameters with comorbidities, race, and socioeconomic factors.<h4>Methods</h4>The study was a retrospective review of collected ROTEM values of women undergoing vaginal or cesarean delivery with a history of or at risk for postpartum hemorrhage. Patients were divided into healthy and comorbid groups. Exclusion criteria for both groups included active or recent bleeding, receipt of blood products or clot-enhancing factors, and liver disease. Mean values of ROTEM by race and comorbidities were included. Median values were reported for intrinsic pathway thromboelastometry (INTEM), extrinsic pathway thromboelastometry (EXTEM), and fibrin polymerization thromboelastometry (FIBTEM) amplitude at 10 minutes (A10) and 20 minutes (A20), coagulation time, clot formation time, and maximum clot firmness.<h4>Results</h4>A total of 681 records were reviewed; 485 met inclusion criteria, and 267 met healthy criteria. The mean (standard deviation) demographics for maternal age (years), body mass index (kg/m<sup>2</sup>), and gestational age (weeks) were 32.2 (5.7), 34 (7.3), and 35.4 (5), respectively. The median INTEM, EXTEM, and FIBTEM A10 were 63, 65, and 23 mm. The mean for INTEM, EXTEM, and FIBTEM A10 was increased for those who were Black or obese, whereas a decreased FIBTEM and EXTEM A10 was noted in those who were Asian or those who had the hemolysis, elevated liver enzymes, low platelet syndrome.<h4>Conclusions</h4>Our heterogeneous population presents ROTEM values within the interquartile range of those previously reported in European studies. Black race, obesity, and preeclampsia were associated with hypercoagulable profiles.

SERPINC1
Also flagged:COVID-19ACEmajor neurocognitive disorderdementiamild neurocognitive disordersubjective cognitive decline
Journal Article 2023-06-08 ✓ 4 Snippets Saini G, Malhotra S, Rajan R, Vishnu VY, Mani K, Bhatia R, Bhushan M, Srivastava MVP, Gupta A.
In-Text Gene Mentions

ACE-IIItakes ~ 15–20…

…VTC and FTF-administeredACE-III.…

…successful administration ofACE-IIIvirtually.…

…first one testingACE-IIIas the assessment…

Show Full Abstract

<h4>Objective</h4>To determine the feasibility, reliability, and acceptability of video teleconference (VTC)-based neuropsychological assessment using Addenbrooke's cognitive examination-III (ACE-III).<h4>Methods</h4>This study was performed from January 2022 to April 2022, during the third wave of the COVID-19 pandemic in India. We administered ACE-III using video-teleconferencing and compared the scores to face-to-face (FTF) testing for the eligible participants. We also conducted a participant's satisfaction survey of VTC-administered ACE-III compared to FTF-administered ACE-III, using a 7-point Likert scale.<h4>Results</h4>We screened 37 participants and 24 (64.9%) successfully underwent ACE-III testing through VTC. We included 20 patients (mean age: 62.7 ± 10 years, mean education: 12.0 ± 4.6 years, 85% men) for final analysis, (who completed both VTC and FTF-administered ACE-III). Nine patients had major neurocognitive disorder (dementia), eight had mild neurocognitive disorder (MCI), and three had subjective cognitive decline (SCD). The two tests were administered at a median gap of 36 (18,74.5) days. The Intraclass correlation coefficients (ICC) of ACE-3 total scores (0.97) and the subdomain scores was high (>0.8). There was "very low" to "no" bias on the Bland-Altman plots, across all domains. The mean overall satisfaction score was 4.1, indicating that VTC is "as good as" FTF.<h4>Conclusions</h4>Results support the feasibility and acceptability of remote administration of ACE-III via VTC. There is a good agreement between the ACE-III scores across VTC and in-person conditions.

Also flagged:rheumatoid arthritispsoriasisinflammatory bowel diseaseantibodiesTNFαcytokine
Journal Article 2023-06-07 No Snippets Boesveld S, Kittel Y, Luo Y, Jans A, Oezcifci B, Bartneck M, Preisinger C, Rommel D, Haraszti T, Centeno SP, Boersma AJ, De Laporte L, Trautwein C, Kuehne AJC, Strnad P.
Show Full Abstract

Therapeutic antibodies are the key treatment option for various cytokine-mediated diseases, such as rheumatoid arthritis, psoriasis, and inflammatory bowel disease. However, systemic injection of these antibodies can cause side effects and suppress the immune system. Moreover, clearance of therapeutic antibodies from the blood is limiting their efficacy. Here, water-swollen microgels are produced with a size of 25 µm using droplet-based microfluidics. The microgels are functionalized with TNFα antibodies to locally scavenge the pro-inflammatory cytokine TNFα. Homogeneous distribution of TNFα-antibodies is shown throughout the microgel network and demonstrates specific antibody-antigen binding using confocal microscopy and FLIM-FRET measurements. Due to the large internal accessibility of the microgel network, its capacity to bind TNFα is extremely high. At a TNFα concentration of 2.5 µg mL<sup>-1</sup> , the microgels are able to scavenge 88% of the cytokine. Cell culture experiments reveal the therapeutic potential of these microgels by protecting HT29 colorectal adenocarcinoma cells from TNFα toxicity and resulting in a significant reduction of COX II and IL8 production of the cells. When the microgels are incubated with stimulated human macrophages, to mimic the in vivo situation of inflammatory bowel disease, the microgels scavenge almost all TNFα that is produced by the cells.

HTT
Also flagged:nanomaterialsgrapheneblack phosphorustransition metal dichalcogenidesneurological diseasesneurodegenerative diseases
Journal Article 2023-06-07 ✓ 5 Snippets Li K, Ji Q, Liang H, Hua Z, Hang X, Zeng L, Han H.
In-Text Gene Mentions

Jin et al. [144] prepared a small, single-layer GO nanomaterial that enhanced the clearance of mutant huntingtin (Htt), the aggregate-prone protein involved in HD pathogenesis.

…of mutant huntingtin (Htt), the aggregate-prone protein…

…of LC3-II andHtt, activated class III…

…Furthermore, GO increasedHtt’s ubiquitination, which is…

…is necessary forHtt’s clearance.…

Show Full Abstract

Two-dimensional (2D) nanomaterials, such as graphene, black phosphorus and transition metal dichalcogenides, have attracted increasing attention in biology and biomedicine. Their high mechanical stiffness, excellent electrical conductivity, optical transparency, and biocompatibility have led to rapid advances. Neuroscience is a complex field with many challenges, such as nervous system is difficult to repair and regenerate, as well as the early diagnosis and treatment of neurological diseases are also challenged. This review mainly focuses on the application of 2D nanomaterials in neuroscience. Firstly, we introduced various types of 2D nanomaterials. Secondly, due to the repairment and regeneration of nerve is an important problem in the field of neuroscience, we summarized the studies of 2D nanomaterials applied in neural repairment and regeneration based on their unique physicochemical properties and excellent biocompatibility. We also discussed the potential of 2D nanomaterial-based synaptic devices to mimic connections among neurons in the human brain due to their low-power switching capabilities and high mobility of charge carriers. In addition, we also reviewed the potential clinical application of various 2D nanomaterials in diagnosing and treating neurodegenerative diseases, neurological system disorders, as well as glioma. Finally, we discussed the challenge and future directions of 2D nanomaterials in neuroscience.

NEGR1
Also flagged:AlcoholAlcohol Use Disorderpsychiatric disordersAlcohol Use DisorderstranslationalZNF804A
Journal Article 2023-06-07 ✓ 1 Snippet Kember RL, Vickers-Smith R, Zhou H, Xu H, Jennings M, Dao C, Davis L, Sanchez-Roige S, Justice AC, Gelernter J, Vujkovic M, Kranzler HR.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Objective</h4>Recent genome-wide association studies (GWASs) of alcohol-related phenotypes have uncovered key differences in the underlying genetic architectures of alcohol consumption and alcohol use disorder (AUD), with the two traits having opposite genetic correlations with psychiatric disorders. Understanding the genetic factors that underlie the transition from heavy drinking to AUD has important theoretical and clinical implications.<h4>Methods</h4>The authors used longitudinal data from the cross-ancestry Million Veteran Program sample to identify 1) novel loci associated with AUD and alcohol consumption (measured by the score on the consumption subscale of the Alcohol Use Disorders Identification Test [AUDIT-C]), 2) the impact of phenotypic variation on genetic discovery, and 3) genetic variants with direct effects on AUD that are not mediated through alcohol consumption.<h4>Results</h4>The authors identified 26 loci associated with AUD and 22 loci associated with AUDIT-C score, including ancestry-specific and novel loci. In secondary GWASs that excluded individuals who report abstinence, the authors identified seven additional loci for AUD and eight additional loci for AUDIT-C score. Although the heterogeneity of the abstinent group biases the GWAS findings, unique variance between alcohol consumption and disorder remained after the abstinent group was excluded. Finally, using mediation analysis, the authors identified a set of variants with effects on AUD that are not mediated through alcohol consumption.<h4>Conclusions</h4>Differences in genetic architecture between alcohol consumption and AUD are consistent with their having different biological contributions. Genetic variants with direct effects on AUD are potentially relevant to understanding the transition from heavy alcohol consumption to AUD and may be targets for translational prevention and treatment efforts.

DCC
Also flagged:Multiple Myelomaneoplasiamyelomanociceptioninnervationgene expression
Journal Article 2023-06-07 ✓ 1 Snippet Diaz-delCastillo M, Palasca O, Nemler TT, Thygesen DM, Chávez-Saldaña NA, Vázquez-Mora JA, Ponce Gomez LY, Jensen LJ, Evans H, Andrews RE, Mandal A, Neves D, Mehlen P, Caruso JP, Dougherty PM, Price TJ, Chantry A, Lawson MA, Andersen TL, Jimenez-Andrade JM, Heegaard AM.
In-Text Gene Mentions

DCC

Show Full Abstract

Multiple myeloma (MM) is a neoplasia of B plasma cells that often induces bone pain. However, the mechanisms underlying myeloma-induced bone pain (MIBP) are mostly unknown. Using a syngeneic MM mouse model, we show that periosteal nerve sprouting of calcitonin gene-related peptide (CGRP<sup>+</sup>) and growth associated protein 43 (GAP43<sup>+</sup>) fibers occurs concurrent to the onset of nociception and its blockade provides transient pain relief. MM patient samples also showed increased periosteal innervation. Mechanistically, we investigated MM induced gene expression changes in the dorsal root ganglia (DRG) innervating the MM-bearing bone of male mice and found alterations in pathways associated with cell cycle, immune response and neuronal signaling. The MM transcriptional signature was consistent with metastatic MM infiltration to the DRG, a never-before described feature of the disease that we further demonstrated histologically. In the DRG, MM cells caused loss of vascularization and neuronal injury, which may contribute to late-stage MIBP. Interestingly, the transcriptional signature of a MM patient was consistent with MM cell infiltration to the DRG. Overall, our results suggest that MM induces a plethora of peripheral nervous system alterations that may contribute to the failure of current analgesics and suggest neuroprotective drugs as appropriate strategies to treat early onset MIBP.<b>SIGNIFICANCE STATEMENT</b> Multiple myeloma (MM) is a painful bone marrow cancer that significantly impairs the quality of life of the patients. Analgesic therapies for myeloma-induced bone pain (MIBP) are limited and often ineffective, and the mechanisms of MIBP remain unknown. In this manuscript, we describe cancer-induced periosteal nerve sprouting in a mouse model of MIBP, where we also encounter metastasis to the dorsal root ganglia (DRG), a never-before described feature of the disease. Concomitant to myeloma infiltration, the lumbar DRGs presented blood vessel damage and transcriptional alterations, which may mediate MIBP. Explorative studies on human tissue support our preclinical findings. Understanding the mechanisms of MIBP is crucial to develop targeted analgesic with better efficacy and fewer side effects for this patient population.

DNAH10
Also flagged:complement factor H related 5Venous thromboembolismCFHR5complement activationthrombinplatelet activation
Journal Article 2023-06-07 ✓ 5 Snippets Iglesias MJ, Sanchez-Rivera L, Ibrahim-Kosta M, Naudin C, Munsch G, Goumidi L, Farm M, Smith PM, Thibord F, Kral-Pointner JB, Hong MG, Suchon P, Germain M, Schrottmaier W, Dusart P, Boland A, Kotol D, Edfors F, Koprulu M, Pietzner M, Langenberg C, Damrauer SM, Johnson AD, Klarin DM, Smith NL, Smadja DM, Holmström M, Magnusson M, Silveira A, Uhlén M, Renné T, Martinez-Perez A, Emmerich J, Deleuze JF, Antovic J, Soria Fernandez JM, Assinger A, Schwenk JM, Souto Andres JC, Morange PE, Butler LM, Trégouët DA, Odeberg J.
In-Text Gene Mentions

However, only two, JMJD1C_rs7916868 and DNAH10_rs7133378, showed patterns of association with VTE that are compatible with the association of increased CFHR5 plasma levels with VTE risk.

…4.39E-09) on 8q24.13,DNAH10(rs7133378, p =…

…JMJD1C _rs7916868 andDNAH10_rs7133378, showed patterns…

…CFHR5 plasma levels:DNAH10, HNF1A, HNF4A, JMJD1C…

DNAH10is also known…

Show Full Abstract

Venous thromboembolism (VTE) is a common, multi-causal disease with potentially serious short- and long-term complications. In clinical practice, there is a need for improved plasma biomarker-based tools for VTE diagnosis and risk prediction. Here we show, using proteomics profiling to screen plasma from patients with suspected acute VTE, and several case-control studies for VTE, how Complement Factor H Related 5 protein (CFHR5), a regulator of the alternative pathway of complement activation, is a VTE-associated plasma biomarker. In plasma, higher CFHR5 levels are associated with increased thrombin generation potential and recombinant CFHR5 enhanced platelet activation in vitro. GWAS analysis of ~52,000 participants identifies six loci associated with CFHR5 plasma levels, but Mendelian randomization do not demonstrate causality between CFHR5 and VTE. Our results indicate an important role for the regulation of the alternative pathway of complement activation in VTE and that CFHR5 represents a potential diagnostic and/or risk predictive plasma biomarker.

Also flagged:signal transductionpattern recognition receptorsinterferonnuclear factor-κBNF-κBtype I interferon
Journal Article 2023-06-07 No Snippets Guan J, Fan Y, Wang S, Zhou F.
Show Full Abstract

Immune signal transduction is crucial to the body's defense against viral infection. Recognition of pathogen-associated molecular patterns by pattern recognition receptors (PRRs) activates the transcription of interferon regulators and nuclear factor-κB (NF-κB); this promotes the release of interferons and inflammatory factors. Efficient regulation of type I interferon and NF-κB signaling by members of the mitogen-activated protein (MAP) kinase kinase kinase (MAP3K) family plays an important role in antiviral immunity. Elucidating the specific roles of MAP3K activation during viral infection is essential to develop effective antiviral therapies. In this review, we outline the specific regulatory mechanisms of MAP3Ks in antiviral immunity and discuss the feasibility of targeting MAP3Ks for the treatment of virus-induced diseases.

DCC
Also flagged:carbonwaterdegradationCOVID-19transportationconjugations
Journal Article 2023-06-07 ✓ 3 Snippets Ha LT.
In-Text Gene Mentions

…three of theDCC-APGARCH, DCC-T-GARCH, and DCC…

…of the DCC-APGARCH,DCC-T-GARCH, and DCC-GJR-GARCH mo…

…DCC-APGARCH, DCC-T-GARCH, andDCC-GJR-GARCH models and the…

Show Full Abstract

The study explores the inter-relations between green and renewable energy and carbon risk. Key market participants with varying time horizons include traders, authorities, and other financial entities. This research examines these relationships and frequency dimensions from February 7, 2017, to June 13, 2022, using novel multivariate wavelet analysis approaches, such as partial wavelet coherency and partial wavelet gain. The multiple coherencies between green bond, clean energy, and carbon emission futures imply that these regions were situated at low frequencies (relating to approximately 124-day frequency) and run from the beginning of 2017 to the beginning of 2018, in the first half of 2020, and from the beginning of 2022 to the end of the sample. The relationship between the solar energy index, envitec biogas, biofuels, geothermal energy, and carbon emission futures, is significant in the low-frequency band starting from early 2020 to middle 2022 and in the high-frequency band starting from early 2022 to middle 2022. Our research demonstrates the partial coherencies between these indicators during the Russia-Ukraine conflict. The partial coherency between the S&P green bond index and carbon risk suggests that carbon risk pushes anti-phase connectedness. The partial phase difference S&P global clean energy index and carbon emission futures (from early April 2022 to the end of April 2022) recommend that indicators are in-phase with carbon risk pushing and the phase (from early May 2022 to middle June 2022), suggesting that carbon emission futures are in-phase with S&P global clean energy index pushing.

Also flagged:Myeloid sarcomaMSmyeloid neoplasmstumouracute myeloid leukaemiaAML
Journal Article 2023-06-07 No Snippets Loscocco GG, Vannucchi AM.
Show Full Abstract

Myeloid sarcoma (MS) is a distinct entity among myeloid neoplasms defined as a tumour mass of myeloid blasts occurring at an anatomical site other than the bone marrow, in most cases concomitant with acute myeloid leukaemia (AML), rarely without bone marrow involvement. MS may also represent the blast phase of chronic myeloproliferative neoplasms (MPN) and myelodysplastic syndromes (MDS). However, the clinical and molecular heterogeneity of AML, as highlighted by the 2022 World Health Organization (WHO) and International Consensus (ICC) classifications, indirectly define MS more as a set of heterogeneous and proteiform diseases, rather than a homogeneous single entity. Diagnosis is challenging and relies mainly on histopathology, immunohistochemistry, and imaging. Molecular and cytogenetic analysis of MS tissue, particularly in isolated cases, should be performed to refine the diagnosis, and thus assign prognosis guiding treatment decisions. If feasible, systemic therapies used in AML remission induction should be employed, even in isolated MS. Role and type of consolidation therapy are not univocally acknowledged, and systemic therapies, radiotherapy, or allogeneic hematopoietic stem cell transplantation (allo-HSCT) should be considered. In the present review, we discuss recent information on MS, focusing on diagnosis, molecular findings, and treatments also considering targetable mutations by recently approved AML drugs.

Also flagged:InjuryIschemic cardiomyopathyMyocardial ischemia-reperfusion injuryinflammatory responseimmune responsemetabolism
Journal Article 2023-06-07 No Snippets Chang C, Cai RP, Su YM, Wu Q, Su Q.
Show Full Abstract

Ischemic cardiomyopathy is treated mainly with thrombolytic drugs, percutaneous coronary intervention, and coronary artery bypass grafting to recanalize blocked vessels. Myocardial ischemia-reperfusion injury (MIRI) is an unavoidable complication of obstructive revascularization. Compared with those of myocardial ischemic injury, few effective therapeutic options are available for MIRI treatment. The pathophysiological mechanisms of MIRI involve the inflammatory response, the immune response, oxidative stress, apoptosis, intracellular Ca<sup>2+</sup> overload, and cardiomyocyte energy metabolism. These mechanisms exacerbate MIRI. Mesenchymal stem cell-derived exosomes (MSC-EXOs) can alleviate MIRI through these mechanisms and, to some extent, prevent the limitations caused by direct MSC administration. Therefore, using MSC-EXOs instead of MSCs to treat MIRI is a potentially beneficial cell-free treatment strategy. In this review, we describe the mechanism of action of MSC-EXO-derived noncoding RNAs in the treatment of MIRI and discuss the advantages and limitations of this strategy, as well as possible future research directions.

PEBP1
Also flagged:ferroptosissevofluranegestationironglutathione peroxidase 4GPX4
Journal Article 2023-06-07 ✓ 5 Snippets Jiang Q, Wang C, Gao Q, Wu Z, Zhao P.
In-Text Gene Mentions

After heat‐mediated antigen retrieval with citrate buffer, sections were cultured with 10% fetal bovine serum for 30 min at room temperature and then incubated at 4°C with anti‐PTGS2 antibody (1:200, 66351‐1‐Ig, Proteintech), anti‐15LO2 antibody (1:200, sc‐376795, Santa Cruz) and anti‐PEBP1 antibody (1:200, ab76582, Santa Cruz) overnight, respectively.

Enhancement of 15LO2‐PEBP1 and activation of ATM and P53/SAT1 signaling potentially contributed to sevoflurane‐induced ferroptosis.

This study proposes that 15LO2‐mediated ferroptosis might contribute to neurotoxicity induced by maternal sevoflurane anesthesia during the mid‐trimester in the offspring and its mechanism may be ascribed to hyperactivation of ATM and enhancement of 15LO2‐PEBP1 interaction, indicating a potential therapeutic target for ameliorating sevoflurane‐induced neurotoxicity.

In addition, Co‐IP demonstrated that the direct interaction of 15LO2‐PEBP1 was enhanced by sevoflurane (Figure 3B).

Maternal multiple sevoflurane exposures led to enhancement of the interaction of 15LO2‐PEBP1 in the fetal rat brain.

Show Full Abstract

<h4>Aims</h4>Mid-gestational sevoflurane exposure may induce notable long-term neurocognitive impairment in offspring. This study was designed to investigate the role and potential mechanism of ferroptosis in developmental neurotoxicity induced by sevoflurane in the second trimester.<h4>Methods</h4>Pregnant rats on day 13 of gestation (G13) were treated with or without 3.0% sevoflurane, Ferrostatin-1 (Fer-1), PD146176, or Ku55933 on three consecutive days. Mitochondrial morphology, ferroptosis-relative proteins, malondialdehyde (MDA) levels, total iron content, and glutathione peroxidase 4 (GPX4) activities were measured. Hippocampal neuronal development in offspring was also examined. Subsequently, 15-lipoxygenase 2 (15LO2)-phosphatidylethanolamine binding protein 1 (PEBP1) interaction and expression of Ataxia telangiectasia mutated (ATM) and its downstream proteins were also detected. Furthermore, Morris water maze (MWM) and Nissl's staining were applied to estimate the long-term neurotoxic effects of sevoflurane.<h4>Results</h4>Ferroptosis mitochondria were observed after maternal sevoflurane exposures. Sevoflurane elevated MDA and iron levels while inhibiting GPX4 activity, and resultant long-term learning and memory dysfunction, which were alleviated by Fer-1, PD146176, and Ku55933. Sevoflurane could enhance 15LO2-PEBP1 interaction and activate ATM and its downstream P53/SAT1 pathway, which might be attributed to excessive p-ATM nuclear translocation.<h4>Conclusion</h4>This study proposes that 15LO2-mediated ferroptosis might contribute to neurotoxicity induced by maternal sevoflurane anesthesia during the mid-trimester in the offspring and its mechanism may be ascribed to hyperactivation of ATM and enhancement of 15LO2-PEBP1 interaction, indicating a potential therapeutic target for ameliorating sevoflurane-induced neurotoxicity.

SOX6
Also flagged:ear dysfunction-cell communicationInner ear disordershearing lossbalance disordersSensorineural hearing loss
Journal Article 2023-06-07 ✓ 1 Snippet van der Valk WH, van Beelen ESA, Steinhart MR, Nist-Lund C, Osorio D, de Groot JCMJ, Sun L, van Benthem PPG, Koehler KR, Locher H.
In-Text Gene Mentions

…( MATN4, COL9A1,SOX6, SOX9, COL2A1 )…

Show Full Abstract

Inner ear disorders are among the most common congenital abnormalities; however, current tissue culture models lack the cell type diversity to study these disorders and normal otic development. Here, we demonstrate the robustness of human pluripotent stem cell-derived inner ear organoids (IEOs) and evaluate cell type heterogeneity by single-cell transcriptomics. To validate our findings, we construct a single-cell atlas of human fetal and adult inner ear tissue. Our study identifies various cell types in the IEOs including periotic mesenchyme, type I and type II vestibular hair cells, and developing vestibular and cochlear epithelium. Many genes linked to congenital inner ear dysfunction are confirmed to be expressed in these cell types. Additional cell-cell communication analysis within IEOs and fetal tissue highlights the role of endothelial cells on the developing sensory epithelium. These findings provide insights into this organoid model and its potential applications in studying inner ear development and disorders.

Also flagged:Kawasaki DiseaseMIS-Cventricular dysfunctionCOVID-19Multisystem Inflammatory Syndrome2 infection
Journal Article 2023-06-07 No Snippets Harahsheh AS, Shah S, Dallaire F, Manlhiot C, Khoury M, Lee S, Fabi M, Mauriello D, Tierney ESS, Sabati AA, Dionne A, Dahdah N, Choueiter N, Thacker D, Giglia TM, Truong DT, Jain S, Portman M, Orr WB, Harris TH, Szmuszkovicz JR, Farid P, McCrindle BW, International Kawasaki Disease Registry (IKDR).
Show Full Abstract

<h4>Background</h4>Patients with multisystem inflammatory syndrome in children (MIS-C) and Kawasaki disease (KD) have overlapping clinical features. We compared demographics, clinical presentation, management, and outcomes of patients according to evidence of previous SARS-CoV-2 infection.<h4>Methods</h4>The International Kawasaki Disease Registry (IKDR) enrolled KD and MIS-C patients from sites in North, Central, and South America, Europe, Asia, and the Middle East. Evidence of previous infection was defined as: Positive (household contact or positive polymerase chain reaction [PCR]/serology), Possible (suggestive clinical features of MIS-C and/or KD with negative PCR or serology but not both), Negative (negative PCR and serology and no known exposure), and Unknown (incomplete testing and no known exposure).<h4>Results</h4>Of 2345 enrolled patients SARS-CoV-2 status was Positive for 1541 (66%) patients, Possible for 89 (4%), Negative for 404 (17%) and Unknown for 311 (13%). Clinical outcomes varied significantly among the groups, with more patients in the Positive/Possible groups presenting with shock, having admission to intensive care, receiving inotropic support, and having longer hospital stays. Regarding cardiac abnormalities, patients in the Positive/Possible groups had a higher prevalence of left ventricular dysfunction, and patients in the Negative and Unknown groups had more severe coronary artery abnormalities.<h4>Conclusions</h4>There appears to be a spectrum of clinical features from MIS-C to KD with a great deal of heterogeneity, and one primary differentiating factor is evidence for previous acute SARS-CoV-2 infection/exposure. SARS-CoV-2 Positive/Possible patients had more severe presentations and required more intensive management, with a greater likelihood of ventricular dysfunction but less severe coronary artery adverse outcomes, in keeping with MIS-C.

Also flagged:inflammatory disorderpathogenesisantigen recognition receptorsimmune-mediated disorderaphthous ulcersulcers
Journal Article 2023-06-07 No Snippets Al-Obeidi AF, Nowatzky J.
Show Full Abstract

Behçet's disease (BD) is a multi-system inflammatory disorder with vasculitic features. It does not suit any of the current pathogenesis-driven disease classifications well, a unifying concept of its pathogenesis is not unanimously conceivable at present, and its etiology is obscure. Still, evidence from immunogenetic and other studies supports the notion of a complex-polygenic disease with robust innate effector responses, reconstitution of regulatory T cells upon successful treatment, and first clues to the role of an, as of yet, underexplored adaptive immune system and its antigen recognition receptors. Without an attempt to be comprehensive, this review aims to collect and organize impactful parts of this evidence in a way that allows the reader to appreciate the work done and define the efforts needed now. The focus is on literature and notions that drove the field into new directions, whether recent or more remote.

MLLT10
Also flagged:ENLAF9acute leukemiasMLLRNA polymerase IIhistones
Journal Article 2023-06-07 ✓ 1 Snippet Hu H, Muntean AG.
In-Text Gene Mentions

MLLT10

Show Full Abstract

Recent studies have uncovered similarities and differences between 2 highly homologous epigenetic reading proteins, namely, ENL (MLLT1) and AF9 (MLLT3) with therapeutic implications. The importance of these proteins has traditionally been exemplified by their involvement in chromosomal translocations with the mixed-lineage leukemia gene (MLL; aka KMT2a). MLL rearrangements occur in a subset of acute leukemias and generate potent oncogenic MLL-fusion proteins that impact epigenetic and transcriptional regulation. Leukemic patients with MLL rearrangements display intermediate-to-poor prognoses, necessitating further mechanistic research. Several protein complexes involved in regulating RNA polymerase II transcription and the epigenetic landscape are hijacked in MLL-r leukemia, which include ENL and AF9. Recent biochemical studies have defined a highly homologous YEATS domain in ENL and AF9 that binds acylated histones, which aids in the localization and retention of these proteins to transcriptional targets. In addition, detailed characterization of the homologous ANC-1 homology domain (AHD) on ENL and AF9 revealed differential association with transcriptional activating and repressing complexes. Importantly, CRISPR knockout screens have demonstrated a unique role for wild-type ENL in leukemic stem cell function, whereas AF9 appears important for normal hematopoietic stem cells. In this perspective, we examine the ENL and AF9 proteins with attention to recent work characterizing the epigenetic reading YEATS domains and AHD on both wild-type proteins and when fused to MLL. We summarized the drug development efforts and their therapeutic potential and assess ongoing research that has refined our understanding of how these proteins function, which continues to reveal new therapeutic avenues.

Also flagged:TumorcancerCRISPRCas9compensationMSN2
Journal Article 2023-06-07 No Snippets Xin Y, Zhang Y.
Show Full Abstract

Tumor cells can result from gene mutations and over-expression. Synthetic lethality (SL) offers a desirable setting where cancer cells bearing one mutated gene of an SL gene pair can be specifically targeted by disrupting the function of the other genes, while leaving wide-type normal cells unharmed. Paralogs, a set of homologous genes that have diverged from each other as a consequence of gene duplication, make the concept of SL feasible as the loss of one gene does not affect the cell's survival. Furthermore, homozygous loss of paralogs in tumor cells is more frequent than singletons, making them ideal SL targets. Although high-throughput CRISPR-Cas9 screenings have uncovered numerous paralog-based SL pairs, the unclear mechanisms of targeting these gene pairs and the difficulty in finding specific inhibitors that exclusively target a single but not both paralogs hinder further clinical development. Here, we review the potential mechanisms of paralog-based SL given their function and genetic combination, and discuss the challenge and application prospects of paralog-based SL in cancer therapeutic discovery.

HTT
Also flagged:EAAT2cognitive impairmentExcitatory amino acid transporter 2glutamate transporterglutamateHD
Journal Article 2023-06-07 ✓ 5 Snippets Bhatnagar A, Parmar V, Barbieri N, Bearoff F, Elefant F, Kortagere S.
In-Text Gene Mentions

In the Htt(128Q) larvae with vehicle treatment, we observed a deficit in learning as compared to our wildtype control, therefore recapitulating cognitive decline in HD patients.

Additionally, evidence from several HD transgenic models demonstrates mutant htt expression selectively downregulates EAAT2 mRNA and protein levels that ultimately results in extracellular glutamate accumulation, excitotoxicity, and neuronal cell death (Behrens et al., 2002; Liévens et al., 2005; Shin et al., 2005; Bradford et al., 2009; Meunier et al., 2016).

The pan-neuronal driver fly line (elavC155) was used to target expression of human full-length huntingtin gene with 128 glutamine repeats [Htt(128Q)] in all neurons.

Huntington’s disease (HD) is a chronic inherited neurodegenerative disease caused by CAG trinucleotide repeat expansion in the huntingtin (htt) gene on chromosome 4 (Bates et al., 2015; Jimenez-Sanchez et al., 2017).

A robust and widely used model for HD has been generated by expressing full-length human huntingtin gene (htt) with 128 poly-Q repeats (128Q) pan-neuronally using Gal4/UAS targeted gene expression system (Romero et al., 2008).

Show Full Abstract

<h4>Introduction</h4>Glutamate excitotoxicity is causal in striatal neurodegeneration underlying motor dysfunction and cognitive deficits in Huntington's disease (HD). Excitatory amino acid transporter 2 (EAAT2), the predominant glutamate transporter accounting for >90% of glutamate transport, plays a key role in preventing excitotoxicity by clearing excess glutamate from the intrasynaptic cleft. Accordingly, EAAT2 has emerged as a promising therapeutic target for prevention of neuronal excitotoxicity underlying HD and other neurodegenerative diseases.<h4>Methods</h4>We have previously designed novel EAAT2 positive allosteric modulator GT951, GTS467, and GTS551, with low nanomolar efficacy in glutamate uptake and favorable pharmacokinetic properties. In this study, we test the neuroprotective abilities of these novel EAAT2 activators <i>in vivo</i> using the robust <i>Drosophila</i> HD transgenic model expressing human huntingtin gene with expanded repeats (Htt128Q).<h4>Results</h4>All three compounds significantly restored motor function impaired under HD pathology over a wide dose range. Additionally, treatment with all three compounds significantly improved HD-associated olfactory associative learning and short-term memory defects, while GT951 and GTS551 also improved middle-term memory in low-performing group. Similarly, treatment with GT951 and GTS551 partially protected against early mortality observed in our HD model. Further, treatment with all three EAAT2 activators induced epigenetic expression of EAAT2 <i>Drosophila</i> homolog and several cognition-associated genes.<h4>Conclusion</h4>Together, these results highlight the efficacy of GT951, GTS467 and GTS551 in treating motor and cognitive impairments under HD pathology and support their development for treatment of HD.

Also flagged:gestationplacental insufficiencyCD34hemoglobinpolycythemiabilirubin
Journal Article 2023-06-07 No Snippets Kilicdag H, Anuk Ince D, Ecevit A.
Show Full Abstract

No abstract available.

PTGIS
Also flagged:Tumormetabolismarachidonic acidprostaglandinscancersteroid
Journal Article 2023-06-07 ✓ 1 Snippet Nie JZ, Wang MT, Nie D.
In-Text Gene Mentions

In an in silico analysis using multiple datasets from Oncomine, it was found that the expression of PGI2 synthase (PTGIS) was associated with the infiltration of tumor-associated macrophages and Treg cells [66].

Show Full Abstract

Prostaglandins, the bioactive lipids generated from the metabolism of arachidonic acid through cyclooxygenases, have potent effects on many constituents of tumor microenvironments. In this review, we will describe the formation and activities of prostaglandins in the context of the tumor microenvironment. We will discuss the regulation of cancer-associated fibroblasts and immune constituents by prostaglandins and their roles in immune escapes during tumor progression. The review concludes with future perspectives on improving the efficacy of immunotherapy through repurposing non-steroid anti-inflammatory drugs and other prostaglandin modulators.

OLFM4
Also flagged:IFanatomical disordersshort bowel syndromeSBSmotility disorderchronic intestinal pseudo-obstruction
Journal Article 2023-06-07 ✓ 1 Snippet Yan J, Zhao Y, Jiang L, Wang Y, Cai W.
In-Text Gene Mentions

…Olfactomedin 4 (OLFM4) and SRY-Box Transcription…

Show Full Abstract

Pediatric intestinal failure (IF) is the reduction in gut function to below the minimum necessary for the absorption of macronutrients and/or water and electrolytes, such that intravenous supplementation is required to maintain health and/or growth. The overall goal in treating IF is to achieve intestinal adaptation; however, the underlying mechanisms have not been fully understood. In this study, by performing single-cell RNA sequencing in pediatric IF patients, we found that decreased Kruppel-Like Factor 4 (KLF4) may serve as the hub gene responsible for the functional deficit in mature enterocytes in IF patients, leading to the downregulation of solute carrier (SLC) family transporters (e.g., SLC7A9) and, consequently, nutrient malabsorption. We also found that inducible KLF4 was highly sensitive to the loss of certain enteral nutrients: in a rodent model of total parenteral nutrition mimicking the deprivation of enteral nutrition, the expression of KLF4 dramatically decreased only at the tip of the villus and not at the bottom of crypts. By using IF patient-derived intestinal organoids and Caco-2 cells as in vitro models, we demonstrated that the supplementation of decanoic acid (DA) could significantly induce the expression of KLF4 along with SLC6A4 and SLC7A9, suggesting that DA may function as a potential therapeutic strategy to promote cell maturation and functional improvement. In summary, this study provides new insights into the mechanism of intestinal adaptation depending on KLF4, and proposed potential strategies for nutritional management using DA.

TNFSF4
Also flagged:N7-methylguanosinetumorm7Ghepatocellular carcinomamethylguanosinemethyl
Journal Article 2023-06-07 ✓ 1 Snippet Li Y, Zhao K, Wu R, Wang J, Wang Q, Xiong Q, Xie F, Lei H, Feng P.
In-Text Gene Mentions

…VTCN1, TNFRSF8, HHLA2,TNFSF4, TNFSF9, LAIR1, TIGIT,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is one of the most common malignancies in the world. The N7-methylguanosine (m7G) modification is related to the biological processes and regulation of various diseases. This study investigated the role and predictive value of m7G-related long non-coding RNAs (lncRNAs) in HCC.<h4>Methods</h4>HCC patients were clustered by consensus clustering, and a prognostic signature was developed using Least Absolute Shrinkage and Selection Operator (LASSO)-Cox regression analysis. The immune landscape and clinicopathological features of the distinct clusters and subgroups were investigated.<h4>Results</h4>A total of 32 m7G-related lncRNAs were confirmed to be prognostic lncRNAs. Two molecular clusters showed significant differences in terms of their clinicopathological features, prognoses, and immune checkpoint gene (ICG) expression levels. Cluster II was associated with upregulated ICG expression and poor overall survival (OS). The Cancer Genome Atlas training cohort was then used to create an m7G-related lncRNA signature for predicting OS. The signature exhibited excellent predictive performance in the training, test, and all cohorts. The high-risk patients had worse clinical outcomes than the low-risk patients. Further study revealed that this signature was an independent prognostic indicator, and a predictive nomogram was developed based on the clinicopathological features and risk score. In addition, we discovered that this model was correlated with ICG expression and tumor immune cell infiltration.<h4>Conclusions</h4>Our findings demonstrated that m7G-related lncRNAs are associated with the tumor immune landscape and prognosis and can serve as independent prognostic markers for HCC. These findings provide new insights into the functions of m7G-related lncRNAs in HCC.

STAU1
Also flagged:RNG105caprin1cytoplasmicFUSTDP-43neurodegenerative diseases
Journal Article 2023-06-07 ✓ 5 Snippets Horio T, Ishikura Y, Ohashi R, Shiina N.
In-Text Gene Mentions

…including FMRP, Staufen1 (Stau1), Stau2, Pumilio2 (Pum2),…

…of Pum2 andStau1restored its localization…

…RNG105, FMRP, Pum2,Stau1, Stau2, FUS ΔNLS…

…FMRP, Pum2, andStau1/2 resulted in their…

…of Pum2 andStau1/2 was reduced or…

Show Full Abstract

In neurodegenerative diseases, the condensation of FUS and TDP-43 with RNA granules in neurons is linked to pathology, including synaptic disorders. However, the effects of FUS and TDP-43 on RNA granule factors remain unclear. Here, using primary cultured neurons from the mouse cerebral cortex, we show that excess cytoplasmic FUS and TDP-43 accumulated in dendritic RNA granules, where they increased the dynamics of a scaffold protein RNG105/caprin1 and dissociated it from the granules. This coincided with reduced levels of mRNA and translation around the granules and synaptic loss in dendrites. These defects were suppressed by non-dissociable RNG105, suggesting that RNG105 dissociation mediated the defects. In contrast to the model where FUS and TDP-43 co-aggregate with RNA granule factors to repress their activity, our findings provide a novel pathogenic mechanism whereby FUS and TDP-43 dissociate RNA scaffold proteins from RNA granules which are required for local translation that regulates synapse formation.

This Week in The Journal

HTT
Also flagged:Myelinationlearningbrain developmentVGLUT3Huntington's Diseaseneurodegenerative disease
Journal Article 2023-06-07 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

HTT

Show Full Abstract

No abstract available.

bioRxiv 2023-06-07 Preprint (No Snippets API) Moin AT, Rani NA, Ullah MA, Patil RB, Robin TB, Nawal N, Zubair T, Mahamud SI, Sakib MN, Islam NN, Khaleque MA, Absar N, Shohael AM.
Show Full Abstract

Human T-lymphotropic virus (HTLV), a retrovirus belonging to the oncovirus family, has long been linked to be associated with various inflammatory and immunosuppressive disorders. To combat the devastating impact of this virus, our study employed a reverse vaccinology approach to design a multi-epitope-based vaccine targeting the highly virulent subtypes of HTLV. We conducted a comprehensive analysis of the molecular interactions between the vaccine and Toll-like receptors (TLRs), providing valuable insights for future research on preventing and managing HTLV-related diseases and any possible outbreaks. The vaccine was designed by focusing on the envelope glycoprotein gp62, a crucial protein involved in the infectious process and immune mechanisms of HTLV inside the human body. Epitope mapping identified T cell and B cell epitopes with low binding energies, ensuring their immunogenicity and safety. Linkers and adjuvants were incorporated to enhance the vaccine’s stability, antigenicity, and immunogenicity. Two vaccine constructs were developed, both exhibiting high antigenicity and conferring safety. Vaccine construct 2 demonstrated expected solubility and structural stability after disulfide engineering. Molecular docking analyses revealed strong binding affinity between the vaccine construct 2 and both TLR2 and TLR4. Molecular dynamics simulations indicated that the TLR2-vaccine complex displayed enhanced stability, compactness, and consistent hydrogen bond formation, suggesting a favorable affinity. Contact analysis, Gibbs free energy landscapes, and DCC analysis further supported the stability of the TLR2-vaccine complex, while DSSP analysis confirmed stable secondary structures. MM-PBSA analysis revealed a more favorable binding affinity of the TLR4-vaccine complex, primarily due to lower electrostatic energy. In conclusion, our study successfully designed a multi-epitope-based vaccine targeting HTLV subtypes and provided valuable insights into the molecular interactions between the vaccine and TLRs. These findings should contribute to the development of effective preventive and treatment approaches against HTLV-related diseases.

bioRxiv 2023-06-07 Preprint (No Snippets API) Fischer K, Bradlerova M, Decker T, Supper V.
Show Full Abstract

Intracellular bacteria produce antigens, which serve as potent activators of γδ T cells. Phosphoantigens are presented via a complex of Butyrophilins (BTN) to signal infection to human Vγ9+Vδ2+ T cells. Here, we established an in vitro system allowing for studies of Vγ9+Vδ2+ T cell activity in coculture with epithelial cells infected with the intracellular bacterial pathogen Listeria monocytogenes . We report that the Vγ9+Vδ2+ T cells efficiently purge such cultures from infected cells. This effector function requires the expression of members of the BTN3A family on epithelial cells. Specifically, the BTN3A1 and BTN3A3 are redundant in their ability to present antigen to Vγ9+Vδ2+ T cells. Since BTN3A1 is the only BTN3A associated with phosphoantigen presentation our study suggests that BTN3A3 may present different classes of antigens to mediate Vγ9+Vδ2+ T cell effector function against L. monocytogenes-infected epithelia.

CDK5RAP1
Also flagged:hearinglossage-related hearing lossmitochondrialAHLMitochondria
Journal Article 2023-06-06 ✓ 5 Snippets Miwa T, Katsuno T, Wei FY, Tomizawa K.
In-Text Gene Mentions

Previous studies have revealed that age-related hearing loss (AHL) in Cdk5 regulatory subunit-associated protein 1 (Cdk5rap1)-knockout mice is associated with pathology in the cochlea.

Here, we aimed to identify mitochondrial alterations in the cochlea of Cdk5rap1-knockout mice with AHL.

…the cochlea ofCdk5rap1-knockout mice with age-relate…

…loss (AHL) inCdk5 regulatory subunit-associated protein 1regulatory subunit-associated …

…subunit-associated protein 1 (Cdk5rap1)-knockout mice is associated…

Show Full Abstract

Previous studies have revealed that age-related hearing loss (AHL) in Cdk5 regulatory subunit-associated protein 1 (Cdk5rap1)-knockout mice is associated with pathology in the cochlea. Here, we aimed to identify mitochondrial alterations in the cochlea of Cdk5rap1-knockout mice with AHL. Mitochondria in the spiral ganglion neurons (SGNs) and hair cells (HCs) were normal despite senescence; however, the mitochondria of types I, II, and IV spiral ligament fibrocytes were ballooned, damaged, and ballooned, respectively, in the stria vascularis. Our results suggest that the accumulation of dysfunctional mitochondria in the lateral wall, rather than the loss of HCs and SGNs, leads to the onset of AHL. Our results provide valuable information regarding the underlying mechanisms of AHL and the relationship between aberrant tRNA modification-induced hearing loss and mitochondrial dysfunction.

GPR52
Also flagged:medium-chain fatty acid-sensing receptorGPR84G protein-coupled receptorGPCRmetabolismlipid
Journal Article 2023-06-06 ✓ 1 Snippet Liu H, Zhang Q, He X, Jiang M, Wang S, Yan X, Cheng X, Liu Y, Nan FJ, Xu HE, Xie X, Yin W.
In-Text Gene Mentions

…self-activation mechanism ofGPR52, 5-HT 1A R…

Show Full Abstract

GPR84 is an orphan class A G protein-coupled receptor (GPCR) that is predominantly expressed in immune cells and plays important roles in inflammation, fibrosis, and metabolism. Here, we present cryo-electron microscopy (cryo-EM) structures of Gα<sub>i</sub> protein-coupled human GPR84 bound to a synthetic lipid-mimetic ligand, LY237, or a putative endogenous ligand, a medium-chain fatty acid (MCFA) 3-hydroxy lauric acid (3-OH-C12). Analysis of these two ligand-bound structures reveals a unique hydrophobic nonane tail -contacting patch, which forms a blocking wall to select MCFA-like agonists with the correct length. We also identify the structural features in GPR84 that coordinate the polar ends of LY237 and 3-OH-C12, including the interactions with the positively charged side chain of R172 and the downward movement of the extracellular loop 2 (ECL2). Together with molecular dynamics simulations and functional data, our structures reveal that ECL2 not only contributes to direct ligand binding, but also plays a pivotal role in ligand entry from the extracellular milieu. These insights into the structure and function of GPR84 could improve our understanding of ligand recognition, receptor activation, and Gα<sub>i</sub>-coupling of GPR84. Our structures could also facilitate rational drug discovery against inflammation and metabolic disorders targeting GPR84.

Also flagged:polycythemianeonatal hyperbilirubinemiapostpartum hemorrhageiron deficiencymaternal anemiaanemia
Journal Article 2023-06-06 No Snippets Chaudhary P, Priyadarshi M, Singh P, Chaurasia S, Chaturvedi J, Basu S.
Show Full Abstract

Delayed cord clamping (DCC) at delivery has well-recognized benefits; however, current scientific guidelines lack uniformity in its definition. This parallel-group, three-arm assessor-blinded randomized controlled trial compared the effects of three different timings of DCC at 30, 60, and 120 s on venous hematocrit and serum ferritin levels in late preterm and term neonates not requiring resuscitation. Eligible newborns (n = 204) were randomized to DCC 30 (n = 65), DCC 60 (n = 70), and DCC 120 (n = 69) groups immediately after delivery. The primary outcome variable was venous hematocrit at 24 ± 2 h. Secondary outcome variables were respiratory support, axillary temperature, vital parameters, incidences of polycythemia, neonatal hyperbilirubinemia (NNH), need and duration of phototherapy, and postpartum hemorrhage (PPH). Additionally, serum ferritin levels, the incidence of iron deficiency, exclusive breastfeeding (EBF) rate, and anthropometric parameters were assessed during post-discharge follow-up at 12 ± 2 weeks. Over one-third of the included mothers were anemic. DCC 120 was associated with a significant increase in the mean hematocrit by 2%, incidence of polycythemia, and duration of phototherapy, compared to DCC30 and DCC60; though the incidence of NNH and need for phototherapy was similar. No other serious neonatal or maternal adverse events including PPH were observed. No significant difference was documented in serum ferritin, incidences of iron deficiency, and growth parameters at 3 months even in the presence of a high EBF rate.   Conclusion: The standard recommendation of DCC at 30-60 s may be considered a safe and effective intervention in the busy settings of low-middle-income countries with a high prevalence of maternal anemia.   Trial registration: Clinical trial registry of India (CTRI/2021/10/037070). What is Known: • The benefits of delayed cord clamping (DCC) makes it an increasingly well-accepted practice in the delivery room. • However, uncertainty continues regarding the optimal timing of clamping; this may be of concern both in the neonate and the mother. What is New: • DCC at 120 s led to higher hematocrit, polycythemia and longer duration of phototherapy, without any difference in serum ferritin, and incidence of iron deficiency. • DCC at 30-60 s may be considered a safe and effective intervention in LMICs.

Also flagged:chronic enteropathiesgastrointestinal diseaseTHBS1chronic inflammatory enteropathyThrombospondin‐1Chronic enteropathy
Journal Article 2023-06-06 No Snippets Yu J, Boland L, Catt M, Puk L, Wong N, Krockenberger M, Bennett P, Ruaux C, Wasinger VC.
Show Full Abstract

<h4>Background</h4>Serum protein biomarkers are used to diagnose, monitor treatment response, and to differentiate various forms of chronic enteropathies (CE) in humans. The utility of liquid biopsy proteomic approaches has not been examined in cats.<h4>Hypothesis/objectives</h4>To explore the serum proteome in cats to identify markers differentiating healthy cats from cats with CE.<h4>Animals</h4>Ten cats with CE with signs of gastrointestinal disease of at least 3 weeks duration, and biopsy-confirmed diagnoses, with or without treatment and 19 healthy cats were included.<h4>Methods</h4>Cross-sectional, multicenter, exploratory study with cases recruited from 3 veterinary hospitals between May 2019 and November 2020. Serum samples were analyzed and evaluated using mass spectrometry-based proteomic techniques.<h4>Results</h4>Twenty-six proteins were significantly (P < .02, ≥5-fold change in abundance) differentially expressed between cats with CE and controls. Thrombospondin-1 (THBS1) was identified with >50-fold increase in abundance in cats with CE (P < 0.001) compared to healthy cats.<h4>Conclusions and clinical importance</h4>Damage to the gut lining released marker proteins of chronic inflammation that were detectable in serum samples of cats. This early-stage exploratory study strongly supports THBS1 as a candidate biomarker for chronic inflammatory enteropathy in cats.

HTT
Also flagged:synaptic cleftsynapsesHDphotondendritic spinesneurodegenerative disorders
Journal Article 2023-06-06 ✓ 1 Snippet Villanueva CB, Stephensen HJT, Mokso R, Benraiss A, Sporring J, Goldman SA.
In-Text Gene Mentions

Huntington’s disease (HD) is a neurodegenerative disorder in which abnormally long CAG repeat expansions in the first exon of the huntingtin (HTT) gene result in a mutant form of the gene (mHTT), which disrupts glial as well as neuronal physiology, leading to dysfunction first evident in neostriatal medium spiny neurons (MSNs) (1).

Show Full Abstract

Astroglial dysfunction contributes to the pathogenesis of Huntington's disease (HD), and glial replacement can ameliorate the disease course. To establish the topographic relationship of diseased astrocytes to medium spiny neuron (MSN) synapses in HD, we used 2-photon imaging to map the relationship of turboRFP-tagged striatal astrocytes and rabies-traced, EGFP-tagged coupled neuronal pairs in R6/2 HD and wild-type (WT) mice. The tagged, prospectively identified corticostriatal synapses were then studied by correlated light electron microscopy followed by serial block-face scanning EM, allowing nanometer-scale assessment of synaptic structure in 3D. By this means, we compared the astrocytic engagement of single striatal synapses in HD and WT brains. R6/2 HD astrocytes exhibited constricted domains, with significantly less coverage of mature dendritic spines than WT astrocytes, despite enhanced engagement of immature, thin spines. These data suggest that disease-dependent changes in the astroglial engagement and sequestration of MSN synapses enable the high synaptic and extrasynaptic levels of glutamate and K<sup>+</sup> that underlie striatal hyperexcitability in HD. As such, these data suggest that astrocytic structural pathology may causally contribute to the synaptic dysfunction and disease phenotype of those neurodegenerative disorders characterized by network overexcitation.

LRRC7
Also flagged:Chromosomescell cyclechromosomemitosischromatincondensins
Journal Article 2023-06-06 ✓ 1 Snippet Spicer MFD, Gerlich DW.
In-Text Gene Mentions

Condensin-mediated cross-linking impose…

Show Full Abstract

Chromosomes transform during the cell cycle, allowing transcription and replication during interphase and chromosome segregation during mitosis. Morphological changes are thought to be driven by the combined effects of DNA loop extrusion and a chromatin solubility phase transition. By extruding the chromatin fibre into loops, condensins enrich at an axial core and provide resistance to spindle pulling forces. Mitotic chromosomes are further compacted by deacetylation of histone tails, rendering chromatin insoluble and resistant to penetration by microtubules. Regulation of surface properties by Ki-67 allows independent chromosome movement in early mitosis and clustering during mitotic exit. Recent progress has provided insight into how the extraordinary material properties of chromatin emerge from these activities, and how these properties facilitate faithful chromosome segregation.

LRRC7
Also flagged:lung adenocarcinomaLUADKRASCD8human leukocyte antigenantigen presentation
Journal Article 2023-06-06 ✓ 1 Snippet Peng X, Xia Z, Guo Y, Li Y.
In-Text Gene Mentions

…especially ATM, STK11,LRRC7, CES1, ARHGEF11, CNTNAP2,…

Show Full Abstract

The heterogeneity of lung adenocarcinoma (LUAD) indicated that target therapies and immunotherapies may not be effective in all patients. The exploration of the feature of the immune landscape of different gene mutations may provide novel perspectives. In this study, we obtained LUAD samples from The Cancer Genome Atlas. By applying ESTIMATE and ssGSEA, KRAS-mutated group was discovered to be associated with lower immune infiltration, lower expression of immune checkpoints, especially, a lower abundance of B cell, CD8+ T cell, dendritic cell, natural killer cell, and macrophage, higher abundance of neutrophil and endothelial cell. Through ssGSEA, we found that the process of antigen-presenting cell co-inhibition and co-stimulation were inhibited, cytolytic activity and human leukocyte antigen molecules were downregulated in the KRAS-mutated group. And KRAS mutation is negatively related to antigen presentation and procession, cytotoxic lymphocyte activity, cytolytic activities, and cytokine interaction signaling pathway via gene function enrichment analysis. Finally, 24 immune-related genes were identified to establish an immune-related gene signature with excellent prognostic prediction capacity, whose 1-, 3- and 5-year AUCs were 0.893, 0.986, and 0.999. Our findings elucidate the features of the immune landscape of KRAS-mutated groups and successfully established a prognostic signature on the basis of immune-related genes in LUAD.

HFE
Also flagged:ferroptosisnonalcoholic steatohepatitisHyperglycemiaNASHliver fibrosisdeath
Journal Article 2023-06-06 ✓ 2 Snippets Gong Y, Liu Z, Zhang Y, Zhang J, Zheng Y, Wu Z.
In-Text Gene Mentions

Consistently, NASH patients with a mutation in the HFE gene, which can lead to iron overload, have more severe hepatic fibrosis than those without this mutation [57].

…mutation in theHFEgene, which can…

Show Full Abstract

Hyperglycemia is an independent risk factor for the rapid progression of nonalcoholic steatohepatitis (NASH) to liver fibrosis with an incompletely defined mechanism. Ferroptosis is a novel form of programmed cell death that has been identified as a pathogenic mechanism in various diseases. However, the role of ferroptosis in the development of liver fibrosis in NASH with type 2 diabetes mellitus (T2DM) is unclear. Here, we observed the histopathological features of the progression of NASH to liver fibrosis as well as hepatocyte epithelial-mesenchymal transition (EMT) in a mouse model of NASH with T2DM and high-glucose-cultured steatotic human normal liver (LO2) cells. The distinctive features of ferroptosis, including iron overload, decreased antioxidant capacity, the accumulation of reactive oxygen species, and elevated lipid peroxidation products, were confirmed in vivo and in vitro. Liver fibrosis and hepatocyte EMT were markedly alleviated after treatment with the ferroptosis inhibitor ferrostatin-1. Furthermore, a decrease in the gene and protein levels of AGE receptor 1 (AGER1) was detected in the transition from NASH to liver fibrosis. Overexpression of AGER1 dramatically reversed hepatocyte EMT in high-glucose-cultured steatotic LO2 cells, whereas the knockdown of AGER1 had the opposite effect. The mechanisms underlying the phenotype appear to be associated with the inhibitory effects of AGER1 on ferroptosis, which is dependent on the regulation of sirtuin 4. Finally, in vivo adeno-associated virus-mediated AGER1 overexpression effectively relieved liver fibrosis in a murine model. Collectively, these findings suggest that ferroptosis participates in the pathogenesis of liver fibrosis in NASH with T2DM by promoting hepatocyte EMT. AGER1 could reverse hepatocyte EMT to ameliorate liver fibrosis by inhibiting ferroptosis. The results also suggest that AGER1 may be a potential therapeutic target for the treatment of liver fibrosis in patients with NASH with T2DM. Chronic hyperglycemia is associated with increased advanced glycation end products, resulting in the downregulation of AGER1. AGER1 deficiency downregulates Sirt4, which disturbs key regulators of ferroptosis (TFR-1, FTH, GPX4, and SLC7A11). These lead to increased iron uptake, decreasing the antioxidative capacity and enhanced lipid ROS production, ultimately leading to ferroptosis, which further promotes hepatocyte epithelial-mesenchymal transition and fibrosis progression in NASH with T2DM.

Also flagged:ChromatinorganizationCTCFbindingnucleuschromosome
Journal Article 2023-06-06 No Snippets Harris HL, Gu H, Olshansky M, Wang A, Farabella I, Eliaz Y, Kalluchi A, Krishna A, Jacobs M, Cauer G, Pham M, Rao SSP, Dudchenko O, Omer A, Mohajeri K, Kim S, Nichols MH, Davis ES, Gkountaroulis D, Udupa D, Aiden AP, Corces VG, Phanstiel DH, Noble WS, Nir G, Di Pierro M, Seo JS, Talkowski ME, Aiden EL, Rowley MJ.
Show Full Abstract

Nuclear compartments are prominent features of 3D chromatin organization, but sequencing depth limitations have impeded investigation at ultra fine-scale. CTCF loops are generally studied at a finer scale, but the impact of looping on proximal interactions remains enigmatic. Here, we critically examine nuclear compartments and CTCF loop-proximal interactions using a combination of in situ Hi-C at unparalleled depth, algorithm development, and biophysical modeling. Producing a large Hi-C map with 33 billion contacts in conjunction with an algorithm for performing principal component analysis on sparse, super massive matrices (POSSUMM), we resolve compartments to 500 bp. Our results demonstrate that essentially all active promoters and distal enhancers localize in the A compartment, even when flanking sequences do not. Furthermore, we find that the TSS and TTS of paused genes are often segregated into separate compartments. We then identify diffuse interactions that radiate from CTCF loop anchors, which correlate with strong enhancer-promoter interactions and proximal transcription. We also find that these diffuse interactions depend on CTCF's RNA binding domains. In this work, we demonstrate features of fine-scale chromatin organization consistent with a revised model in which compartments are more precise than commonly thought while CTCF loops are more protracted.

OLFM4
Also flagged:Major depressive disorderpsychiatric disorderdepressionpathogenesisLRFN5olfactomedin 4
Journal Article 2023-06-06 ✓ 5 Snippets Xu K, Zheng P, Zhao S, Wang J, Feng J, Ren Y, Zhong Q, Zhang H, Chen X, Chen J, Xie P.
In-Text Gene Mentions

Here, we examined serum concentrations of LRFN5 and OLFM4 in 99 drug-naive MDD patients, 90 drug-treatment MDD patients, and 81 healthy controls (HCs) using ELISA methods.

Serum levels of LRFN5 and OLFM4 between MDD and HCs groups

Meanwhile, significantly lower levels of LRFN5 and OLFM4 in the DT-MDD group than in the DN-MDD group were found, which indicated that their levels might be partially reversed by antidepressant therapy.

In conclusion, our study first evaluated the levels of LRFN5 and OLFM4 in the serum of MDD patients.

Therefore, future studies are needed to find out whether LRFN5 and OLFM4 are involved in the pathogenesis of MDD by regulating neuroinflammation.

Show Full Abstract

Evidences have shown that both LRFN5 and OLFM4 can regulate neural development and synaptic function. Recent genome-wide association studies on major depressive disorder (MDD) have implicated LRFN5 and OLFM4, but their expressions and roles in MDD are still completely unclear. Here, we examined serum concentrations of LRFN5 and OLFM4 in 99 drug-naive MDD patients, 90 drug-treatment MDD patients, and 81 healthy controls (HCs) using ELISA methods. The results showed that both LRFN5 and OLFM4 levels were considerably higher in MDD patients compared to HCs, and were significantly lower in drug-treatment MDD patients than in drug-naive MDD patients. However, there were no significant differences between MDD patients who received a single antidepressant and a combination of antidepressants. Pearson correlation analysis showed that they were associated with the clinical data, including Hamilton Depression Scale score, age, duration of illness, fasting blood glucose, serum lipids, and hepatic, renal, or thyroid function. Moreover, these two molecules both yielded fairly excellent diagnostic performance in diagnosing MDD. In addition, a combination of LRFN5 and OLFM4 demonstrated a better diagnostic effectiveness, with an area under curve of 0.974 in the training set and 0.975 in the testing set. Taken together, our data suggest that LRFN5 and OLFM4 may be implicated in the pathophysiology of MDD and the combination of LRFN5 and OLFM4 may offer a diagnostic biomarker panel for MDD.

Also flagged:Autism Spectrum Disordercongenital heart disorderautismZNF536MSL2HDAC9
Journal Article 2023-06-06 No Snippets Costa CIS, da Silva Campos G, da Silva Montenegro EM, Wang JYT, Scliar M, Monfardini F, Zachi EC, Lourenço NCV, Chan AJS, Pereira SL, Engchuan W, Thiruvahindrapuram B, Zarrei M, Scherer SW, Passos-Bueno MR.
Show Full Abstract

De novo variants (DNVs) analysis has proven to be a powerful approach to gene discovery in Autism Spectrum Disorder (ASD), which has not yet been shown in a Brazilian ASD cohort. The relevance of inherited rare variants has also been suggested, particularly in oligogenic models. We hypothesized that three-generation analyses of DNVs could provide new insights into the relevance of de novo and inherited variants across generations. To accomplish this goal, we performed whole-exome sequencing of 33 septet families composed of probands, parents, and grandparents (n = 231 individuals) and compared DNV rates (DNVr) between generations and those from two control cohorts. The DNVr in the probands (DNVr = 1.16) was marginally higher than in parents (DNVr = 0.60; p = 0.054), and in controls (DNVr = 0.68; p = 0.035, congenital heart disorder and DNVr = 0.70; p = 0.047, unaffected ASD siblings from Simons Simplex Collection). Moreover, most of the DNVs were found to have paternal origin in both generations (84.6%). Finally, we observed that 40% (6/15) of the DNVs in parents transmitted for probands are in ASD or ASD candidate genes, representing recently emerged risk variants to ASD in their families and suggest ZNF536, MSL2 and HDAC9 as ASD candidate genes. We did not observe an enrichment of risk variants nor sex bias of transmitted variants in the three generations, that can be due to sample size. These results further reinforce the relevance of de novo variants in ASD.

BTN3A3
Also flagged:arterial diseaseoriginal disease of the kidneyextracellularvesiclesreverse transcriptioncalcineurin
Journal Article 2023-06-06 ✓ 1 Snippet Harada H, Fukuzawa N, Abe T, Imamura R, Masaki N, Fujiyama N, Sato S, Hatakeyama S, Nishimura K, Kishikawa H, Iwami D, Hotta K, Miura M, Ide K, Nakamura M, Kosoku A, Uchida J, Murakami T, Tsuji T.
In-Text Gene Mentions

…ALDOB, ANXA1, B4GALT1,BTN3A3, CCL5, CD3E, CD48,…

Show Full Abstract

<h4>Background</h4>Non-invasive, prompt, and proper detection tools for kidney graft injuries (KGIs) are awaited to ensure graft longevity. We screened diagnostic biomarkers for KGIs following kidney transplantation using extracellular vesicles (EVs; exosomes and microvesicles) from the urine samples of patients.<h4>Methods</h4>One hundred and twenty-seven kidney recipients at 11 Japanese institutions were enrolled in this study; urine samples were obtained prior to protocol/episode biopsies. EVs were isolated from urine samples, and EV RNA markers were assayed using quantitative reverse transcription polymerase chain reaction. Diagnostic performance of EV RNA markers and diagnostic formulas comprising these markers were evaluated by comparison with the corresponding pathological diagnoses.<h4>Results</h4>EV CXCL9, CXCL10, and UMOD were elevated in T-cell-mediated rejection samples compared with other KGI samples, while SPNS2 was elevated in chronic antibody-mediated rejection (cABMR) samples. A diagnostic formula developed through Sparse Logistic Regression analysis using EV RNA markers allowed us to accurately (with an area under the receiver operator characteristic curve [AUC] of 0.875) distinguish cABMR from other KGI samples. EV B4GALT1 and SPNS2 were also elevated in cABMR, and a diagnostic formula using these markers was able to distinguish between cABMR and chronic calcineurin toxicity accurately (AUC 0.886). In interstitial fibrosis and tubular atrophy (IFTA) urine samples and those with high Banff chronicity score sums (BChS), POTEM levels may reflect disease severity, and diagnostic formulas using POTEM detected IFTA (AUC 0.830) and high BChS (AUC 0.850).<h4>Conclusions</h4>KGIs could be diagnosed with urinary EV mRNA analysis with relatively high accuracy.

DCC
Also flagged:COVID-19-19transportationcarbonmetalsplatinum
Journal Article 2023-06-06 ✓ 1 Snippet Li Y, Umair M.
In-Text Gene Mentions

DCC-GARCH model…

Show Full Abstract

This research explores gold's safe-haven properties amid oil price instability, focusing on the COVID-19 pandemic. The study examines how gold hedges against oil price swings in the context of the pandemic's exceptional market circumstances. A VAR (Vector Autoregressive) model analyzes gold and oil prices from 2006 through 2021. The VAR model reflects the dynamic interactions and interdependencies between these two essential commodities in the context of oil price volatility and the COVID-19 pandemic. This analysis shows that gold protects against oil price volatility and the COVID-19 pandemic-gold buffers against oil price swings due to its strong inverse association with oil prices. Gold offers investors security and asset preservation during significant oil price volatility. In light of oil price volatility and the COVID-19 pandemic, the study helps explain gold's importance as a diversification tool and haven asset. Investors, policymakers, and market players should consider gold as a hedge against oil price volatility and economic instability.

Also flagged:Naphthalenepeptidepeptidessynthesisdehydrodipeptidesnaphthaloyl
Journal Article 2023-06-06 No Snippets Vilaça H, Carvalho A, Castro T, Castanheira EMS, Hilliou L, Hamley I, Melle-Franco M, Ferreira PMT, Martins JA.
Show Full Abstract

Self-assembled peptide-based hydrogels are archetypical nanostructured materials with a plethora of foreseeable applications in nanomedicine and as biomaterials. N-protected di- and tri-peptides are effective minimalist (molecular) hydrogelators. Independent variation of the capping group, peptide sequence and side chain modifications allows a wide chemical space to be explored and hydrogel properties to be tuned. In this work, we report the synthesis of a focused library of dehydrodipeptides N-protected with 1-naphthoyl and 2-naphthylacetyl groups. The 2-naphthylacetyl group was extensively reported for preparation of peptide-based self-assembled hydrogels, whereas the 1-naphthaloyl group was largely overlooked, owing presumably to the lack of a methylene linker between the naphthalene aromatic ring and the peptide backbone. Interestingly, dehydrodipeptides N-capped with the 1-naphthyl moiety afford stronger gels, at lower concentrations, than the 2-naphthylacetyl-capped dehydrodipeptides. Fluorescence and circular dichroism spectroscopy showed that the self-assembly of the dehydrodipeptides is driven by intermolecular aromatic π-π stacking interactions. Molecular dynamics simulations revealed that the 1-naphthoyl group allows higher order aromatic π-π stacking of the peptide molecules than the 2-naphthylacetyl group, together with hydrogen bonding of the peptide scaffold. The nanostructure of the gel networks was studied by TEM and STEM microscopy and was found to correlate well with the elasticity of the gels. This study contributes to understanding the interplay between peptide and capping group structure on the formation of self-assembled low-molecular-weight peptide hydrogels. Moreover, the results presented here add the 1-naphthoyl group to the palette of capping groups available for the preparation of efficacious low-molecular-weight peptide-based hydrogels.

SOX6
Also flagged:myelinforminggene expressionchromatintranscription factorsEp400
Journal Article 2023-06-06 ✓ 5 Snippets Waldhauser V, Baroti T, Fröb F, Wegner M.
In-Text Gene Mentions

Spinal cord and forebrain tissue underwent fixation in 4% paraformaldehyde, cryoprotection in 30% sucrose, embedding in Tissue Freezing Medium (Leica, Wetzlar, Germany) and cryotome sectioning at 10 μm thickness, before staining with the following primary antibodies: anti-Olig2 mouse antibody (Millipore, Darmstadt, Germany, #3756534, 1:1000), anti-Olig2 rabbit antibody (Millipore, #AB9610, 1:1000 dilution), anti-Bcas1 rabbit antibody (Synaptic System, Göttingen, Germany, #445-003, 1:1000 dilution), anti-Myrf rabbit antibody (self-made, 1:1000 dilution) [23], anti-Iba1 rabbit antibody (Wako, Osaka, Japan, #019-19741, 1:250 dilution), anti-cleaved caspase 3 rabbit antibody (Cell Signaling Technology, Danvers, MA, USA #9661, 1:200 dilution), anti-Mcm2 rabbit antibody (Cell Signaling Technology, #4007, 1:100 dilution), anti-Pdgfra rabbit antibody (Santa Cruz, Dallas, TX, USA, #E-1210, 1:300 dilution), anti-Pdgfra goat antibody (R&D Systems, Minneapolis, MN, USA, #AF1062, 1:100 dilution), anti-Sox10 goat antibody (1:3000 dilution) [24], anti-Sox10 guinea pig antibody (self-made, 1:1000 dilution) [25], anti-Sox6 guinea pig antibody (self-made, 1:1000 dilution) [26], anti-Pbrm1 guinea pig antibody (self-made, 1:5000 dilution) [21], anti-Ki67 rat antibody (Invitrogen, Waltham, MA, USA, #14-5698-82, 1:500 dilution) and anti-MBP rat monoclonal antibody (Bio-Rad, Hercules, CA, USA, #MCA409S, 1:500 dilution).

…[ 25 ], anti-Sox6guinea pig antibody…

…As with Pdgfra,Sox6is present in…

…this expression pattern,Sox6-positive cell numbers in…

…significant difference inSox6-positive cells became apparen…

Show Full Abstract

Oligodendrocyte development is accompanied by defined changes in the state of chromatin that are brought about by chromatin remodeling complexes. Many such remodeling complexes exist, but only a few have been studied for their impact on oligodendrocytes as the myelin-forming cells of the central nervous system. To define the role of the PBAF remodeling complex, we focused on Pbrm1 as an essential subunit of the PBAF complex and specifically deleted it in the oligodendrocyte lineage at different times of development in the mouse. Deletion in late oligodendrocyte progenitor cells did not lead to substantial changes in the ensuing differentiation and myelination processes. However, when Pbrm1 loss had already occurred in oligodendrocyte progenitor cells shortly after their specification, fewer cells entered the pre-myelinating state. The reduction in pre-myelinating cells later translated into a comparable reduction in myelinating oligodendrocytes. We conclude that Pbrm1 and, by inference, the activity of the PBAF complex is specifically required at the transition from oligodendrocyte progenitor to pre-myelinating oligodendrocyte and ensures the generation of normal numbers of myelinating oligodendrocytes.

SERPINC1
Also flagged:Extracellular VesiclesBoroncancerneutronsdeathextracellular
Journal Article 2023-06-06 ✓ 5 Snippets Perico D, Tong Y, Chen L, Imamichi S, Sanada Y, Ishiai M, Suzuki M, Masutani M, Mauri P.
In-Text Gene Mentions

In addition, serpins were associated with head and neck cancer; in particular, it has been reported that SERPINA1 is associated with tumor progression [54,55], while SERPINC1 [56] and SERPINF2 [57] are correlated with a good response to radiotherapy, and these data are in good agreement with our results.

…while POLE andSERPINC1were up-regulated in…

…BPA+ condition, whileSERPINC1, TRAJ56, ARSJ and…

…response (SERPINF2 andSERPINC1) and DNA repair…

…A2M, POLE, ANKRD12,SERPINC1, SERPINF1 and MCMDC2…

Show Full Abstract

Boron neutron capture therapy (BNCT) is a selective radiotherapy based on nuclear reaction that occurs when <sup>10</sup>B atoms accumulated in cancer cells are irradiated by thermal neutrons, triggering a nuclear fission response leading to cell death. Despite its growing importance in cancer treatment, molecular characterization of its effects is still lacking. In this context, proteomics investigation can be useful to study BNCT effect and identify potential biomarkers. Hence, we performed proteomic analysis with nanoLC-MS/MS (liquid chromatography coupled to tandem mass spectrometry) on extracellular vesicles (EVs) isolated from SAS cultures treated or not with <sup>10</sup>B-boronophenylalanine (BPA) and different doses of neutron irradiation, to study the cellular response related to both boron administration and neutrons action. Despite the interference of fetal bovine serum in the medium, we were able to stratify BPA- and BPA+ conditions and to identify EVs-derived proteins characterizing pathways potentially related to a BNCT effect such as apoptosis, DNA repair and inflammatory response. In particular, KLF11, SERPINA1 and SERPINF2 were up-regulated in BPA+, while POLE and SERPINC1 were up-regulated in BPA-. These results provide the first proteomic investigation of EVs treated with BNCT in different conditions and highlight the potentiality of proteomics for improving biomarkers identification and mechanisms understanding of BNCT.

SOX6
Also flagged:TRIM28Zinc-Finger ProteinsGene ExpressionKAP1Posttranslational modificationsphosphorylation
Journal Article 2023-06-06 ✓ 2 Snippets Chang YJ, Lin S, Kang ZF, Shen BJ, Tsai WH, Chen WC, Lu HP, Su YL, Chou SJ, Lin SY, Lin SW, Huang YJ, Wang HH, Chang CJ.
In-Text Gene Mentions

…fetal globin repressorSOX6, the maternally…

…demonstrated that bothSOX6and MAGEC2 were…

Show Full Abstract

TRIM28/KAP1/TIF1β is a crucial epigenetic modifier. Genetic ablation of <i>trim28</i> is embryonic lethal, although RNAi-mediated knockdown in somatic cells yields viable cells. Reduction in TRIM28 abundance at the cellular or organismal level results in polyphenism. Posttranslational modifications such as phosphorylation and sumoylation have been shown to regulate TRIM28 activity. Moreover, several lysine residues of TRIM28 are subject to acetylation, but how acetylation of TRIM28 affects its functions remains poorly understood. Here, we report that, compared with wild-type TRIM28, the acetylation-mimic mutant TRIM28-K304Q has an altered interaction with Krüppel-associated box zinc-finger proteins (KRAB-ZNFs). The <i>TRIM28</i>-K304Q knock-in cells were created in K562 erythroleukemia cells by CRISPR-Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein nuclease 9) gene editing method. Transcriptome analysis revealed that <i>TRIM28</i>-K304Q and <i>TRIM28</i> knockout K562 cells had similar global gene expression profiles, yet the profiles differed considerably from wild-type K562 cells. The expression levels of embryonic-related globin gene and a platelet cell marker integrin-beta 3 were increased in <i>TRIM28</i>-K304Q mutant cells, indicating the induction of differentiation. In addition to the differentiation-related genes, many zinc-finger-proteins genes and imprinting genes were activated in <i>TRIM28</i>-K304Q cells; they were inhibited by wild-type TRIM28 via binding with KRAB-ZNFs. These results suggest that acetylation/deacetylation of K304 in TRIM28 constitutes a switch for regulating its interaction with KRAB-ZNFs and alters the gene regulation as demonstrated by the acetylation mimic TRIM28-K304Q.

Also flagged:osteoporosisagingNutritional disorderscalciumpolyphenolsmineral
Journal Article 2023-06-06 No Snippets Zhang Q.
Show Full Abstract

Bone health includes the health of bone minerals, mass, geometry, and microstructure [...].

Also flagged:degradationhepatocellular carcinomalysosometumoroxygenlipase
Journal Article 2023-06-06 No Snippets Liu MX, Xu L, Jiang JY, Dong HC, Zhu PF, Cao L, Chen J, Zhang XL.
Show Full Abstract

High positive charge-induced toxicity, easy lysosomal degradation of nucleic acid drugs, and poor lesion sites targeting are major problems faced in the development of gene carriers. Herein, we proposed the concept of self-escape non-cationic gene carriers for targeted delivery and treatment of photocontrolled hepatocellular carcinoma (HCC) with sufficient lysosome escape and multiple response capacities. Functional DNA was bound to the surface of biotin-PEG<sub>2000</sub>-modified graphitic carbon nitride (Bio-PEG-CN) nanosheets to form non-cationic nanocomplexes Bio-PEG-CN/DNA. These nanocomposites could actively target HCC tissue. Once these nanocomplexes were taken up by tumor cells, the accumulated reactive oxygen species (ROS) generated by Bio-PEG-CN under LED irradiation would disrupt the lysosome structure, thereby facilitating nanocomposites escape. Due to the acidic microenvironment and lipase in the HCC tissue, the reversible release of DNA could be promoted to complete the transfection process. Meanwhile, the fluorescence signal of Bio-PEG-CN could be monitored in real time by fluorescence imaging technology to investigate the transfection process and mechanism. In vitro and in vivo results further demonstrated that these nanocomplexes could remarkably upregulate the expression of tumor suppressor protein P53, increased tumor sensitivity to ROS generated by nanocarriers, and realized effective gene therapy for HCC via loading <i>P53</i> gene.

Also flagged:chronic progressive lung diseaseusual interstitial pneumoniainterstitial lung diseaseidiopathic pulmonary fibrosischroniclung disease
Journal Article 2023-06-05 No Snippets Wang Q, Xie Z, Wan N, Yang L, Jin Z, Jin F, Huang Z, Chen M, Wang H, Feng J.
Show Full Abstract

<h4>Abstract</h4>Idiopathic pulmonary fibrosis (IPF) is a chronic progressive lung disease characterized by progressive lung fibrogenesis and histological features of usual interstitial pneumonia. IPF has a poor prognosis and presents a spectrum of disease courses ranging from slow evolving disease to rapid deterioration; thus, a differential diagnosis remains challenging. Several biomarkers have been identified to achieve a differential diagnosis; however, comprehensive reviews are lacking. This review summarizes over 100 biomarkers which can be divided into six categories according to their functions: differentially expressed biomarkers in the IPF compared to healthy controls; biomarkers distinguishing IPF from other types of interstitial lung disease; biomarkers differentiating acute exacerbation of IPF from stable disease; biomarkers predicting disease progression; biomarkers related to disease severity; and biomarkers related to treatment. Specimen used for the diagnosis of IPF included serum, bronchoalveolar lavage fluid, lung tissue, and sputum. IPF-specific biomarkers are of great clinical value for the differential diagnosis of IPF. Currently, the physiological measurements used to evaluate the occurrence of acute exacerbation, disease progression, and disease severity have limitations. Combining physiological measurements with biomarkers may increase the accuracy and sensitivity of diagnosis and disease evaluation of IPF. Most biomarkers described in this review are not routinely used in clinical practice. Future large-scale multicenter studies are required to design and validate suitable biomarker panels that have diagnostic utility for IPF.

PEBP1
Also flagged:necroptosiscarcinomahepatocellular carcinomainfectionhyperglycemiaobesity
Journal Article 2023-06-05 ✓ 5 Snippets Cheng Y, Zhang Z, Gao P, Lai H, Zhong W, Feng N, Yang Y, Yu H, Zhang Y, Han Y, Dong J, He Z, Huang R, Zhai Q.
In-Text Gene Mentions

AAV induces hepatic necroptosis and carcinoma in diabetic and obese mice dependent on Pebp1 pathway

Prednisone administration or knockdown of Pebp1, highly expressed in db/db mice, alleviated hepatic injury and necroptosis induced by recombinant AAV in mice with diabetes and obesity.

Both prednisone treatment and targeting Pebp1 pathway are promising strategies to alleviate inflammation and necroptosis that occurred in AAV gene therapy or related diseases.

As expected, after a single injection of rAAV for 2 months, all the mice showed similar body weight and blood glucose levels, while serum ALT and AST activities were significantly decreased in the mice injected with rAAV‐si‐Pebp1 compared with those injected with rAAV‐si‐NC (Fig 6B–E).

Among the top 15 genes upregulated in db/db mice, Cyp4a14 plays an important role in the development and progression of NAFLD (Zhang et al, 2017), Pebp1 is an inflammatory and immune system modulator (Lai et al, 2017; Gabriela‐Freitas et al, 2019), and Tat plays an important suppressive role in the development and progression of HCC (Fu et al, 2010).

Show Full Abstract

Obesity and diabetes are risk factors for hepatocellular carcinoma (HCC); however, the underlying mechanisms are yet to be elucidated. Adeno-associated virus (AAV) frequently infects humans and has been widely used in gene therapy, but the risk of AAV infection such as HCC should be further evaluated. Here, we show that recombinant AAV injection caused liver injury, hepatic necroptosis, and HCC in db/db or high-fat diet-induced hyperglycemic and obese mice, but not in mice with only hyperglycemia or obesity. Prednisone administration or knockdown of Pebp1, highly expressed in db/db mice, alleviated hepatic injury and necroptosis induced by recombinant AAV in mice with diabetes and obesity. Inhibition of Pebp1 pathway also attenuated inflammation and necroptosis in vitro. Our findings show that AAV infection is a critical risk factor for HCC in patients with diabetes and obesity, and AAV gene therapy for these patients should be carefully evaluated. Both prednisone treatment and targeting Pebp1 pathway are promising strategies to alleviate inflammation and necroptosis that occurred in AAV gene therapy or related diseases.

FBXL4
Also flagged:mitophagymitochondriaBNIP3NIXmtDNA depletion syndromemitochondrial
Journal Article 2023-06-05 ✓ 2 Snippets Wilhelm LP, Ganley IG.
In-Text Gene Mentions

…reveal the disease‐associatedFBXL4protein as an…

… depletion syndrome‐associatedFBXL4protein as a…

Show Full Abstract

How mitophagy is turned on to remove damaged or excess mitochondria from cells has been well-studied, but less is known about how the pathway is turned off to avoid "over-eating" of mitochondria under basal conditions. Three new studies now reveal the disease-associated FBXL4 protein as an important negative regulator of constitutive mitophagy, controlling the stability of mitophagy receptors BNIP3 and NIX.

HFE
Also flagged:InsulinCell Surfaceligand-receptorcell growthcell surface-associated proteinsCNNM3
Journal Article 2023-06-05 ✓ 1 Snippet Li Y, Wang Y, Fang Z, Liu Y, Zhu H, Yao Y, You X, Qin H, Ye M, Wang H.
In-Text Gene Mentions

…regulatory proteins (LDLR,HFE, ECE1, MRC2, CORO1C,…

Show Full Abstract

The ligand-receptor signaling occurring on the cell surface governs cell growth, proliferation, and survival via rapidly triggering a cascade of events. Here, we for the first time report an <i>in situ</i> perturbation-free and rapid surface proteomic profiling at a temporal resolution of ten seconds. By this innovation, about 1022 cell surface-associated proteins were reproducibly identified and quantified. It is noteworthy that, upon a model ligand insulin stimulus, a few rapid-responding proteins at 10 s to 2 min were identified, e.g., CNNM3. Moreover, temporal response patterns were established for the members of GLUT4 storage vesicles (GSVs; responsible for glucose transportation) and confirmed with five known GSV proteins. This pattern was then exploited to uncover seven new regulatory proteins (LDLR, HFE, ECE1, MRC2, CORO1C, CPD, and BST2). Collectively, we showed a powerful surface proteomic tool to decipher rapid signaling of cell-surface proteins and to uncover new subunits involved in rapidly trafficking vesicles.

Also flagged:SNRPA1spliceosomecancersLUADcell proliferationwound healing
Journal Article 2023-06-05 No Snippets Yang JJ, Yang YJ, Gu YL, Tong L, Liu YF, Zhang JG.
Show Full Abstract

<h4>Objective</h4>SNRPA1, a subunit of spliceosome complex, has been implicated in diverse cancers, while its biological effect in LUAD remains elusive. Therefore, we sought to decipher the relationship between SNRPA1 expression and the prognosis of patients with LUAD and reveal the underlying molecular mechanism.<h4>Materials and methods</h4>Based on the clinical data from TCGA databases, the multivariate Cox model was constructed to screen the prognostic value of SNRPA1. qRT-PCR and immunohistochemical staining were used to examine SNRPA1 mRNA and protein expression in LUAD. The effect of SNRPA1 on LUAD cell proliferation, migration, and epithelial mesenchymal transformation were examined using colony formation assays, wound healing, and western blot assays, respectively. Finally, the influence of SNRPA1 on LUAD immune microenvironment were validated from the Tumor Immune Estimation Resource database.<h4>Results</h4>SNRPA1 was significantly upregulated in both LUAD tissues and cell lines, and highly expressed SNRPA1 contributed to poor prognosis of LUAD patients. In vitro, SNRPA1 knockdown inhibited the proliferation and migration, as well as delayed the EMT differentiation of LUAD cells. Lastly, SNRPA1 was found to be positively associated with immune infiltration and some immune-check-point markers.<h4>Conclusions</h4>Our findings indicate that SNRPA1 may be a new biomarker for prognostic prediction and a potential therapeutic target in the treatment of LUAD.

SLC2A14
Also flagged:immune responseimmune responsesNOD-likeC-type lectinToll-likecomplement receptor
Journal Article 2023-06-05 ✓ 1 Snippet Häder A, Schäuble S, Gehlen J, Thielemann N, Buerfent BC, Schüller V, Hess T, Wolf T, Schröder J, Weber M, Hünniger K, Löffler J, Vylkova S, Panagiotou G, Schumacher J, Kurzai O.
In-Text Gene Mentions

…GLUT5 ) andSLC2A14( GLUT14 )…

Show Full Abstract

Innate immune responses vary by pathogen and host genetics. We analyze quantitative trait loci (eQTLs) and transcriptomes of monocytes from 215 individuals stimulated by fungal, Gram-negative or Gram-positive bacterial pathogens. We identify conserved monocyte responses to bacterial pathogens and a distinct antifungal response. These include 745 response eQTLs (reQTLs) and corresponding genes with pathogen-specific effects, which we find first in samples of male donors and subsequently confirm for selected reQTLs in females. reQTLs affect predominantly upregulated genes that regulate immune response via e.g., NOD-like, C-type lectin, Toll-like and complement receptor-signaling pathways. Hence, reQTLs provide a functional explanation for individual differences in innate response patterns. Our identified reQTLs are also associated with cancer, autoimmunity, inflammatory and infectious diseases as shown by external genome-wide association studies. Thus, reQTLs help to explain interindividual variation in immune response to infection and provide candidate genes for variants associated with a range of diseases.

TNFSF4
Also flagged:Pancreatic cancertumorimmunosuppressionPLAULDHAPKM
Journal Article 2023-06-05 ✓ 1 Snippet Wu Y, Kou Q, Sun L, Hu X.
In-Text Gene Mentions

…found that CD276,TNFSF4, CD44, CD80, CD70,…

Show Full Abstract

Pancreatic cancer has one of the worst prognoses in the world, which suggests that the tumor microenvironment, which is characterized by hypoxia and immunosuppression, plays a significant role in the prognosis and progression of pancreatic cancer. We identified PLAU, LDHA, and PKM as key genes involved in pancreatic cancer hypoxia through GO/KEGG enrichment related hypoxia pathways and cox regression, established prognostic models, and studied their relationship to immune invasion through bioinformatics using R and related online databases. We verified the high expression of PLAU, LDHA, and PKM in pancreatic cancer cells using qPCR in vitro, and we also discovered that the expression of PLAU, LDHA, and PKM in hypoxic pancreatic cancer cells differed from that in normal cultured pancreatic cancer cells. Finally, we discovered that our prognostic model accurately predicted postrain in pancreatic cancer patients with hypoxia and immune infiltration.

SOX6
Also flagged:myosin heavy chainsmyosinmyosin heavy chainhormonegene expressionmyogenesis
Journal Article 2023-06-05 ✓ 5 Snippets Hoh JFY.
In-Text Gene Mentions

It is hypothesized that expression of β-slow MyHC in the absence of CLFS in denervated fast muscle and in hypothyroidism is due to the reversion to the mechanism of β-slow MyHC expression of slow primary myotubes sustained by Sox6/MEF-2C pathway (Taglietti et al. 2016), in common with soleus fibres of slow primary ontotype.

…Embryonic myoblasts expressSox6, a member of…

…the function ofSox6from stimulation of…

…a complex withSox6and binds to…

…sustained by theSox6/MEF-2C pathway (Taglietti et…

Show Full Abstract

The kinetics of myosin controls the speed and power of muscle contraction. Mammalian skeletal muscles express twelve kinetically different myosin heavy chain (MyHC) genes which provides a wide range of muscle speeds to meet different functional demands. Myogenic progenitors from diverse craniofacial and somitic mesoderm specify muscle allotypes with different repertoires for MyHC expression. This review provides a brief synopsis on the historical and current views on how cell lineage, neural impulse patterns, and thyroid hormone influence MyHC gene expression in muscles of the limb allotype during development and in adult life and the molecular mechanisms thereof. During somitic myogenesis, embryonic and foetal myoblast lineages form slow and fast primary and secondary myotube ontotypes which respond differently to postnatal neural and thyroidal influences to generate fully differentiated fibre phenotypes. Fibres of a given phenotype may arise from myotubes of different ontotypes which retain their capacity to respond differently to neural and thyroidal influences during postnatal life. This gives muscles physiological plasticity to adapt to fluctuations in thyroid hormone levels and patterns of use. The kinetics of MyHC isoforms vary inversely with animal body mass. Fast 2b fibres are specifically absent in muscles involved in elastic energy saving in hopping marsupials and generally absent in large eutherian mammals. Changes in MyHC expression are viewed in the context of the physiology of the whole animal. The roles of myoblast lineage and thyroid hormone in regulating MyHC gene expression are phylogenetically the most ancient while that of neural impulse patterns the most recent.

HTT
Also flagged:neoplasmcancertumourglioblastomacytoplasmicribosomal proteins
Journal Article 2023-06-05 ✓ 1 Snippet Quddusi DM, Bajcinca N.
In-Text Gene Mentions

…defective huntingtin gene (HTT) from at least…

Show Full Abstract

Glioblastoma is a grade IV pernicious neoplasm occurring in the supratentorial region of brain. As its causes are largely unknown, it is essential to understand its dynamics at the molecular level. This necessitates the identification of better diagnostic and prognostic molecular candidates. Blood-based liquid biopsies are emerging as a novel tool for cancer biomarker discovery, guiding the treatment and improving its early detection based on their tumour origin. There exist previous studies focusing on the identification of tumour-based biomarkers for glioblastoma. However, these biomarkers inadequately represent the underlying pathological state and incompletely illustrate the tumour because of non-recursive nature of this approach to monitor the disease. Also, contrary to the tumour biopsies, liquid biopsies are non-invasive and can be performed at any interval during the disease span to surveil the disease. Therefore, in this study, a unique dataset of blood-based liquid biopsies obtained primarily from tumour-educated blood platelets (TEP) is utilised. This RNA-seq data from ArrayExpress is acquired comprising human cohort with 39 glioblastoma subjects and 43 healthy subjects. Canonical and machine learning approaches are applied for identification of the genomic biomarkers for glioblastoma and their crosstalks. In our study, 97 genes appeared enriched in 7 oncogenic pathways (RAF-MAPK, P53, PRC2-EZH2, YAP conserved, MEK-MAPK, ErbB2 and STK33 signalling pathways) using GSEA, out of which 17 have been identified participating actively in crosstalks. Using PCA, 42 genes are found enriched in 7 pathways (cytoplasmic ribosomal proteins, translation factors, electron transport chain, ribosome, Huntington's disease, primary immunodeficiency pathways, and interferon type I signalling pathway) harbouring tumour when altered, out of which 25 actively participate in crosstalks. All the 14 pathways foster well-known cancer hallmarks and the identified DEGs can serve as genomic biomarkers, not only for the diagnosis and prognosis of Glioblastoma but also in providing a molecular foothold for oncogenic decision making in order to fathom the disease dynamics. Moreover, SNP analysis for the identified DEGs is performed to investigate their roles in disease dynamics in an elaborated manner. These results suggest that TEPs are capable of providing disease insights just like tumour cells with an advantage of being extracted anytime during the course of disease in order to monitor it.

Also flagged:agingtelomerechronic diseasescognitive dysfunctiondeathobesity
Journal Article 2023-06-05 No Snippets Chen Z, Chen Z, Jin X.
Show Full Abstract

It is reported that overweight may lead to accelerated aging. However, there is still a lack of evidence on the causal effect of overweight and aging. We collected genetic variants associated with overweight, age proxy indicators (telomere length, frailty index and facial aging), etc., from genome-wide association studies datasets. Then we performed MR analyses to explore associations between overweight and age proxy indicators. MR analyses were primarily conducted using the inverse variance weighted method, followed by various sensitivity and validation analyses. MR analyses indicated that there were significant associations of overweight on telomere length, frailty index, and facial aging (β = -0.018, 95% CI = -0.033 to -0.003, p = 0.0162; β = 0.055, 95% CI = 0.030-0.079, p < 0.0001; β = 0.029, 95% CI = 0.013-0.046, p = 0.0005 respectively). Overweight also had a significant negative causality with longevity expectancy (90th survival percentile, β = -0.220, 95% CI = -0.323 to -0.118, p < 0.0001; 99th survival percentile, β = -0.389, 95% CI = -0.652 to -0.126, p = 0.0038). Moreover, the findings tend to favor causal links between body fat mass/body fat percentage on aging proxy indicators, but not body fat-free mass. This study provides evidence of the causality between overweight and accelerated aging (telomere length decreased, frailty index increased, facial aging increased) and lower longevity expectancy. Accordingly, the potential significance of weight control and treatment of overweight in combating accelerated aging need to be emphasized.

SOX6
Also flagged:anemiainfectionerythropoiesisdisorderscancerHeme
Journal Article 2023-06-05 ✓ 2 Snippets Lee SJ, Jung C, Oh JE, Kim S, Lee S, Lee JY, Yoon YS.
In-Text Gene Mentions

…MYB, together withSOX6and GATA1, regulates…

…family member 1SOX6SRY-box transcription factor…

Show Full Abstract

Red blood cell (RBC) transfusion is a lifesaving medical procedure that can treat patients with anemia and hemoglobin disorders. However, the shortage of blood supply and risks of transfusion-transmitted infection and immune incompatibility present a challenge for transfusion. The in vitro generation of RBCs or erythrocytes holds great promise for transfusion medicine and novel cell-based therapies. While hematopoietic stem cells and progenitors derived from peripheral blood, cord blood, and bone marrow can give rise to erythrocytes, the use of human pluripotent stem cells (hPSCs) has also provided an important opportunity to obtain erythrocytes. These hPSCs include both human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs). As hESCs carry ethical and political controversies, hiPSCs can be a more universal source for RBC generation. In this review, we first discuss the key concepts and mechanisms of erythropoiesis. Thereafter, we summarize different methodologies to differentiate hPSCs into erythrocytes with an emphasis on the key features of human definitive erythroid lineage cells. Finally, we address the current limitations and future directions of clinical applications using hiPSC-derived erythrocytes.

Also flagged:Vitamin Dinfectionvitamin D deficiencyinflammatory diseasesautoimmune diseasesinfectious diseases
Journal Article 2023-06-05 No Snippets Russo C, Valle MS, Malaguarnera L, Romano IR, Malaguarnera L.
Show Full Abstract

Over the last few years, we have experienced the infection generated by severe respiratory syndrome coronavirus 2 (SARS-CoV-2) often resulting in an exaggerated immune reaction and systemic inflammation. The preferred treatments against SARS-CoV-2 were those that mitigated immunological/inflammatory dysfunction. A variety of observational epidemiological studies have reported that vitamin D deficiency is often a crucial factor in many inflammatory diseases and autoimmune diseases, as well as the susceptibility to contract infectious diseases, including acute respiratory infections. Similarly, resveratrol regulates immunity, modifying the gene expression and the release of proinflammatory cytokines in the immune cells. Therefore, it plays an immunomodulatory role that can be beneficial in the prevention and development of non-communicable diseases associated with inflammation. Since both vitamin D and resveratrol also act as immunomodulators in inflammatory pathologies, many studies have paid particular attention to an integrated treatment of either vitamin D or resveratrol in the immune reaction against SARS-CoV-2 infections. This article offers a critical evaluation of published clinical trials that have examined the use of vitamin D or resveratrol as adjuncts in COVID-19 management. Furthermore, we aimed to compare the anti-inflammatory and antioxidant properties linked to the modulation of the immune system, along with antiviral properties of both vitamin D and resveratrol.

PRDX6
Also flagged:Ferroptosis-associated gene CISD2colon cancerferroptosistumorscolon adenocarcinomaCOAD
Journal Article 2023-06-05 ✓ 1 Snippet Xu Y, Tang Q, Ding N, Zhang T, Luo H.
In-Text Gene Mentions

…HSPB1, HNF4A, andPRDX6( Fig. 7A…

Show Full Abstract

<h4>Background</h4>Despite the association of ferroptosis with various tumors, the specific mechanism by which it influences colon adenocarcinoma (COAD) microenvironmental equilibrium remains elusive. This study aims to elucidate how ferroptosis affects COAD microenvironmental homeostasis and its potential impact on COAD research.<h4>Objective</h4>By employing genetic screening and single-cell analysis of tumor data, we investigated the role of ferroptosis genes in COAD microenvironmental homeostasis. The genes were correlated with immune cell infiltration in tissue samples and patient outcomes.<h4>Methods</h4>Ferroptosis-associated genes were initially identified through the FerrDb database. Utilizing the tidyverse and Seurat packages, genes with substantial expression differences were extracted, and clustering analysis was performed on the single-cell data. A Venn diagram depicted shared differential genes for ferroptosis and tumors. To screen key ferroptosis genes, further enrichment analysis and immune cell infiltration analysis were conducted. Lastly, human COAD cell lines were employed to overexpress CDGSH iron sulfur domain 2 (CISD2) through cellular assays to validate its function in COAD.<h4>Results</h4>Following screening of The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases, 414 COAD patient samples and 341 normal samples were included. Through the FerrDb database, 259 ferroptosis genes were identified. Clustering the single-cell data revealed 911 tumor marker genes, of which 18 were ferroptosis genes. Analysis of variance (ANOVA) and univariate regression analysis determined that only CISD2 was statistically significantly associated with clinical outcomes. Additionally, CISD2 was found to positively correlate with activated memory T cells and negatively correlate with regulatory T cells (Tregs) and plasma cells in COAD, as well as being significantly associated with several immune-related and cancer-related pathways. CISD2 expression was elevated in most tumors, likely due to cell cycle regulation and immune system activation. Moreover, CISD2 upregulation inhibited COAD cell proliferation and enhanced 5-fluorouracil (5-FU) sensitivity. Our findings indicate, for the first time, that CISD2 governs the cell cycle and stimulates the immune system to impede COAD progression.<h4>Conclusion</h4>By modulating the cell cycle and mediating immune infiltration, CISD2 may inhibit COAD development by influencing tumor immune microenvironment equilibrium, providing valuable insights into the relevance and potential impact of the research results on the COAD research field.

Also flagged:alcoholNonalcoholic fatty liver diseaseNAFLDalcohol-related liver diseasecancershepatocellular carcinoma
Journal Article 2023-06-05 No Snippets Kulkarni AV, Sarin SK.
Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD), once considered a benign condition, has been associated with several cardiometabolic complications over the past two decades. The worldwide prevalence of NAFLD is as high as 30%. NAFLD requires the absence of a "significant alcohol intake." Conflicting reports have suggested that moderate alcohol consumption may be protective; therefore, the diagnosis of NAFLD previously relied on negative criteria. However, there has been a significant increase in alcohol consumption globally. Apart from the rise in alcohol-related liver disease (ARLD), alcohol, a major toxin, is associated with an increased risk of several cancers, including hepatocellular carcinoma. Alcohol misuse is a significant contributor to disability-adjusted life years. Recently, the term metabolic dysfunction-associated fatty liver disease (MAFLD) was proposed instead of NAFLD to include the metabolic dysfunction responsible for the major adverse outcomes in patients with fatty liver disease. MAFLD, dependent on the "positive diagnostic criteria" rather than previous exclusion criteria, may identify individuals with poor metabolic health and aid in managing patients at increased risk of all-cause and cardiovascular mortality. Although MAFLD is less stigmatizing than NAFLD, excluding alcohol intake may increase the risk of already existing underreported alcohol consumption in this subgroup of patients. Therefore, alcohol consumption may increase the prevalence of fatty liver disease and its associated complications in patients with MAFLD. This review discusses the effects of alcohol intake and MAFLD on fatty liver disease.

NEGR1
Also flagged:gene expressionsurface proteinlocalizationtranscription factorTFglioblastoma
Journal Article 2023-06-05 ✓ 4 Snippets Caliskan A, Caliskan D, Rasbach L, Yu W, Dandekar T, Breitenbach T.
In-Text Gene Mentions

The seventh PFA gene, neuronal growth regulator 1 (NEGR1), is the only PFA gene that was associated with ASPCs in our analysis, and while it is also expressed in adipose tissue, it is primarily expressed in the brain [54] and has only recently been associated with a possible role in human obesity [59] and interaction with CD36 [60].

…seventh PFA gene,neuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1), is the only…

…emerged [58] andNEGR1, whose participation in…

Show Full Abstract

Machine learning techniques are excellent to analyze expression data from single cells. These techniques impact all fields ranging from cell annotation and clustering to signature identification. The presented framework evaluates gene selection sets how far they optimally separate defined phenotypes or cell groups. This innovation overcomes the present limitation to objectively and correctly identify a small gene set of high information content regarding separating phenotypes for which corresponding code scripts are provided. The small but meaningful subset of the original genes (or feature space) facilitates human interpretability of the differences of the phenotypes including those found by machine learning results and may even turn correlations between genes and phenotypes into a causal explanation. For the feature selection task, the principal feature analysis is utilized which reduces redundant information while selecting genes that carry the information for separating the phenotypes. In this context, the presented framework shows explainability of unsupervised learning as it reveals cell-type specific signatures. Apart from a Seurat preprocessing tool and the PFA script, the pipeline uses mutual information to balance accuracy and size of the gene set if desired. A validation part to evaluate the gene selection for their information content regarding the separation of the phenotypes is provided as well, binary and multiclass classification of 3 or 4 groups are studied. Results from different single-cell data are presented. In each, only about ten out of more than 30000 genes are identified as carrying the relevant information. The code is provided in a GitHub repository at https://github.com/AC-PHD/Seurat_PFA_pipeline.

TNFSF4
Also flagged:MYCosteosarcomamalignant tumortumormalignant tumorscell migration
Journal Article 2023-06-05 ✓ 1 Snippet Gong D, Zhao Q, Liu J, Zhao S, Yi C, Lv J, Yu H, Bian E, Tian D.
In-Text Gene Mentions

…of HAVCR2, TNFRSF9,TNFSF4, SIGLEC15, LAG3, PTPRC,…

Show Full Abstract

Osteosarcoma is a primary malignant tumor found mainly in teenagers and young adults. Patients have very little long-term survival. <i>MYC</i> controls tumor initiation and progression by regulating the expression of its target genes; thus, constructing a risk signature of osteosarcoma <i>MYC</i> target gene set will benefit the evaluation of both treatment and prognosis. In this paper, we used GEO data to download the ChIP-seq data of <i>MYC</i> to obtain the <i>MYC</i> target gene. Then, a risk signature consisting of 10 <i>MYC</i> target genes was developed using Cox regression analysis. The signature indicates that patients in the high-risk group performed poorly. After that, we verified it in the GSE21257 dataset. In addition, the difference in tumor immune function among the low- and high-risk populations was compared by single sample gene enrichment analysis. Immunotherapy and prediction of response to the anticancer drug have shown that the risk signature of the <i>MYC</i> target gene set was positively correlated with immune checkpoint response and drug sensitivity. Functional analysis has demonstrated that these genes are enriched in malignant tumors. Finally, <i>STX10</i> was selected for functional experimentation. <i>STX10</i> silence has limited osteosarcoma cell migration, invasion, and proliferation. Therefore, these findings indicated that the <i>MYC</i> target gene set risk signature could be used as a potential therapeutic target and prognostic indicator in patients with osteosarcoma.

HFE
Also flagged:Non-alcoholic fatty liver diseasediabetestype 2 diabetesNAFLDenzymesneuropathy
Journal Article 2023-06-05 ✓ 1 Snippet Deravi N, Dehghani Firouzabadi F, Moosaie F, Asadigandomani H, Arab Bafrani M, Yoosefi N, Poopak A, Dehghani Firouzabadi M, Poudineh M, Rabizadeh S, Kamel I, Nakhjavani M, Esteghamati A.
In-Text Gene Mentions

…as autoimmune hepatitis,hemochromatosis, Wilson’s disease, primary…

Show Full Abstract

<h4>Objective</h4>To investigate the association between non-alcoholic fatty liver disease (NAFLD) and liver enzymes with the incidence of microvascular complications (neuropathy, retinopathy, and nephropathy) in a cohort of Iranian patients with type 2 diabetes.<h4>Methods</h4>For a total population of 3123 patients with type 2 diabetes, a prospective study was designed for 1215 patients with NAFLD and 1908 gender and age-matched control patients without NAFLD. The two groups were followed for a median duration of 5 years for the incidence of microvascular complications. The association between having NAFLD, the level of liver enzymes, aspartate aminotransferase to platelet ratio index (APRI), Fibrosis-4 (FIB-4) value, and the incidence risk of diabetic retinopathy, neuropathy, and nephropathy were assessed through logistic regression analysis.<h4>Results</h4>NAFLD was found to be associated with incidence of diabetic neuropathy and nephropathy (Odds ratio: 1.338 (95% confidence interval: 1.091-1.640) and 1.333 (1.007-1.764), respectively). Alkaline-phosphatase enzyme was found to be associated with higher risks of diabetic neuropathy and nephropathy ((Risk estimate: 1.002 (95% CI: 1.001-1.003) and 1.002 (1.001-1.004), respectively)). Moreover, gamma-glutamyl transferase was associated with a higher risk of diabetic nephropathy (1.006 (1.002-1.009). Aspartate aminotransferase and alanine aminotransferase were inversely associated with the risk of diabetic retinopathy (0.989 (0.979-0.998) and 0.990 (0.983-0.996), respectively). Furthermore, ARPI_T (1), ARPI_T (2), and ARPI_T (3) were shown to be associated with NAFLD (1.440 (1.061-1.954), 1.589 (1.163-2.171), and 2.673 (1.925, 3.710), respectively). However, FIB-4 score was not significantly associated with risk of microvascular complications.<h4>Conclusion</h4>Despite the benign nature of NAFLD, patients with type 2 diabetes should be always assessed for NAFLD to ensure early diagnosis and entry into proper medical care. Regular screenings of microvascular complications of diabetes is also suggested for these patients.

HTTBTN3A3
Also flagged:programmed cell deathovarian cancertumorPCDCOXgene expression
Journal Article 2023-06-05 ✓ 4 Snippets Lian X, Liu B, Wang C, Wang S, Zhuang Y, Li X.
In-Text Gene Mentions

…MTOR with MADD,HTT, SMG1, DIDO1, VPS13C,…

…for ISG20, UBD,BTN3A3, and AADAC as…

…1-0.187*ISG20-0.103*UBD-0.247*BTN3A3- 0.208*AADAC+0.16*PI3 + 0.259…

…factors ISG20, UBD,BTN3A3, and AADAC decreased…

Show Full Abstract

<h4>Background</h4>Programmed cell death (PCD) is an overwhelming factor affecting tumor cell metastasis, but the mechanism of PCD in ovarian cancer (OV) is still uncertain.<h4>Methods</h4>To define the molecular subtypes of OV, we performed unsupervised clustering based on the expression level of prognosis related PCD genes in the Cancer Genome Atlas (TCGA)-OV. COX and least absolute shrinkage and selection operator (LASSO) COX analysis were used to identify the OV prognostic related PCD genes, and the genes identified according to the minimum Akaike information criterion (AIC) were the OV prognostic characteristic genes. According to the regression coefficient in the multivariate COX analysis and gene expression data, the Risk Score of OV prognosis was constructed. Kaplan-Meier analysis was conducted to assess the prognostic status of OV patients, and receiver operating characteristic (ROC) curves were conducted to assess the clinical value of Risk Score. Moreover, RNA-Seq date of OV patient derived from Gene Expression Omnibus (GEO, GSE32062) and the International Cancer Genome Consortium (ICGC) database (ICGC-AU), verifying the robustness of the Risk Score <i>via</i> Kaplan-Meier and ROC analysis.Pathway features were performed by gene set enrichment analysis and single sample gene set enrichment analysis. Finally, Risk Score in terms of chemotherapy drug sensitivity and immunotherapy suitability was also evaluated in different groups.<h4>Results</h4>9-gene composition Risk Score system was finally determined by COX and LASSO COX analysis. Patients in the low Risk Score group possessed improved prognostic status, immune activity. PI3K pathway activity was increased in the high Risk Score group. In the chemotherapy drug sensitivity analysis, we found that the high Risk Score group might be more suitable for treatment with PI3K inhibitors Taselisib and Pictilisib. In addition, we found that patients in the low-risk group responded better to immunotherapy.<h4>Conclusion</h4>Risk Score of 9-gene composition of PCD signature possesses promising clinical potential in OV prognosis, immunotherapy, immune microenvironment activity, and chemotherapeutic drug selection, and our study provides the basis for an in-depth investigation of the PCD mechanism in OV.

OLFM4
Also flagged:rheumatoid arthritisRAmultiple sclerosisgene expressionautoimmune diseasesglobin
Journal Article 2023-06-05 ✓ 5 Snippets Wright ML, Goin DE, Smed MK, Jewell NP, Nelson JL, Olsen J, Hetland ML, Zoffmann V, Jawaheer D.
In-Text Gene Mentions

…TLR1/4/6/8, PADI2/4, MMP1/25,OLFM4, FOXQ1 and numerous…

…(n=150; for example,OLFM4, CD24, CD177, CAMP,…

…(vs T3) includedOLFM4, MMP8/9, CD177, DEFA1/3/4,…

…(such as CD177,OLFM4, CEACAM6/8, DEFA1/3/4, S100A8…

…DEFA4, S100A12 andOLFM4, among others, and…

Show Full Abstract

<h4>Background</h4>Pregnancy is known to induce extensive biological changes in the healthy mother. Little is known, however, about what these changes are at the molecular level. We have examined systemic expression changes in protein-coding genes and long non-coding (lnc) RNAs during and after pregnancy, compared to before pregnancy, among healthy women with term pregnancies.<h4>Methods</h4>Blood samples were collected from 14 healthy women enrolled in our prospective pregnancy cohort at 7 time-points (before, during and after pregnancy). Total RNA from frozen whole blood was used for RNA sequencing. Following raw read alignment and assembly, gene-level counts were obtained for protein-coding genes and long non-coding RNAs. At each time-point, cell type proportions were estimated using deconvolution. To examine associations between pregnancy status and gene expression over time, Generalized Estimating Equation (GEE) models were fitted, adjusting for age at conception, and with and without adjusting for changes in cell type proportions. Fold-changes in expression at each trimester were examined relative to the pre-pregnancy baseline.<h4>Results</h4>Numerous immune-related genes demonstrated pregnancy-associated expression, in a time-dependent manner. The genes that demonstrated the largest changes in expression included several that were neutrophil-related (over-expressed) and numerous immunoglobulin genes (under-expressed). Estimated cell proportions revealed a marked increase in neutrophils, and less so of activated CD4 memory T cells, during pregnancy, while most other cell type proportions decreased or remained unchanged. Adjusting for cell type proportions in our model revealed that although most of the expression changes were due to changes in cell type proportions in the bloodstream, transcriptional regulation was also involved, especially in down-regulating expression of type I interferon inducible genes.<h4>Conclusion</h4>Compared to a pre-pregnancy baseline, there were extensive systemic changes in cell type proportions, gene expression and biological pathways associated with different stages of pregnancy and postpartum among healthy women. Some were due to changes in cell type proportions and some due to gene regulation. In addition to providing insight into term pregnancy among healthy women, these findings also provide a "normal" reference for abnormal pregnancies and for autoimmune diseases that improve or worsen during pregnancy, to assess deviations from normal.

Also flagged:Type 2 diabetesADbindinginsulincholesterolmetabolism
Journal Article 2023-06-05 No Snippets Boukhalfa W, Jmel H, Kheriji N, Gouiza I, Dallali H, Hechmi M, Kefi R.
Show Full Abstract

<h4>Introduction</h4>Alzheimer's disease (AD) and Type 2 diabetes (T2D) are both age-associated diseases. Identification of shared genes could help develop early diagnosis and preventive strategies. Although genetic background plays a crucial role in these diseases, we noticed an underrepresentation tendency of North African populations in omics studies.<h4>Materials and methods</h4>First, we conducted a comprehensive review of genes and pathways shared between T2D and AD through PubMed. Then, the function of the identified genes and variants was investigated using annotation tools including PolyPhen2, RegulomeDB, and miRdSNP. Pathways enrichment analyses were performed with g:Profiler and EnrichmentMap. Next, we analyzed variant distributions in 16 worldwide populations using PLINK2, R, and STRUCTURE software. Finally, we performed an inter-ethnic comparison based on the minor allele frequency of T2D-AD common variants.<h4>Results</h4>A total of 59 eligible papers were included in our study. We found 231 variants and 363 genes shared between T2D and AD. Variant annotation revealed six single nucleotide polymorphisms (SNP) with a high pathogenic score, three SNPs with regulatory effects on the brain, and six SNPs with potential effects on miRNA-binding sites. The miRNAs affected were implicated in T2D, insulin signaling pathways, and AD. Moreover, replicated genes were significantly enriched in pathways related to plasma protein binding, positive regulation of amyloid fibril deposition, microglia activation, and cholesterol metabolism. Multidimensional screening performed based on the 363 shared genes showed that main North African populations are clustered together and are divergent from other worldwide populations. Interestingly, our results showed that 49 SNP associated with T2D and AD were present in North African populations. Among them, 11 variants located in <i>DNM3</i>, <i>CFH</i>, <i>PPARG</i>, <i>ROHA</i>, <i>AGER</i>, <i>CLU</i>, <i>BDNF1</i>, <i>CST9</i>, and <i>PLCG1</i> genes display significant differences in risk allele frequencies between North African and other populations.<h4>Conclusion</h4>Our study highlighted the complexity and the unique molecular architecture of North African populations regarding T2D-AD shared genes. In conclusion, we emphasize the importance of T2D-AD shared genes and ethnicity-specific investigation studies for a better understanding of the link behind these diseases and to develop accurate diagnoses using personalized genetic biomarkers.

Also flagged:COVID-19pneumoniamacrophage activation syndromehemophagocytic syndromeHydroxychloroquineTocilizumab
Journal Article 2023-06-05 No Snippets Nandi S, Granata G, Jana S, Ghorui N, Mondal SP, Bhaumik M.
Show Full Abstract

The breakout of the pandemic COVID-19 has affected numerous countries and territories worldwide. As COVID-19 specific medicines yet to be invented, at present the treatment is case specific, hence identification and evaluation of different prevalent treatment options based on various criteria and attributes are very important not only from the point of view of present pandemic but also for futuristic pandemic preparedness. The present study focuses on identifying, evaluation and ranking of treatment options using Multi Criteria Decision Making (MCDM). In this regard, the existing literature, doctors and scientist were interviewed to know the current treatment options in vogue and the scale of their importance with respect to the criteria. The criteria taken are side effect, regime cost, treatment duration, plasma stability, plasma turnover, time of suppression, ease of application, drug-drug interaction, compliance, fever, pneumonia, intensive care, organ failure, macrophage activation syndrome, hemophagocytic syndrome, pregnancy, kidney problem, age. This study extended Hesitant Fuzzy Set (HFS) to Generalized Hesitant Fuzzy Sets (GHFS). Generalized Hesitant Pentagonal Fuzzy Number (GHPFN) is developed. The properties of GHPFN are demonstrated. Two types of GHPFN has been described. The GHPFN (2nd type) along with MCDM tool Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) has been applied to rank the treatment options. The result of the study ranked 'Hydroxychloroquine' as the first alternative followed by, 'Plasma Exchange', 'Tocilizumab', 'Remdesivir' and 'Favipravir'. To check the robustness and steadiness of the proposed methodology, comparative analysis and sensitivity analysis has been conducted.

HFE
Also flagged:NASHNonalcoholic steatohepatitischronic liver diseasefibroblast growth factor 21FGF21pioglitazone
Journal Article 2023-06-05 ✓ 1 Snippet Chen YQ.
In-Text Gene Mentions

PNPLA3 I148M, patatin-like phospholipase domain containing three amino acids 148 I to M mutation; TM6SF2 E167K, transmembrane 6 superfamily member two amino acid 167 E to K mutation; ENPP1 K121Q, ectonucleotide pyrophosphatase one amino acid 121 K to Q mutation; IRS1 Q972R, insulin receptor substrate one amino acid 972 Q to R mutation; GCKR P446L, glucokinase regulator amino acid 446 P to L mutation; HFE C282Y, homeostatic iron regulator amino acid 282 C to Y mutation; MBOAT7, membrane bound O-acyltransferase domain containing 7; HSD17B13, hydroxysteroid 17-beta dehydrogenase 13; Lnc18q22.2, liver cell viability associated long noncoding RNA; Blnc1, brown fat long noncoding RNA 1; MHO, metabolically healthy obesity; MUO, metabolically unhealthy obesity.

Show Full Abstract

Nonalcoholic steatohepatitis (NASH) is a chronic liver disease affecting a large population worldwide. No clinically approved drugs are available. In this minireview, we discuss the heterogeneous nature of NASH and lack of consensus in outcome measures among clinical trials. We summarize NASH therapeutic targets and candidate drugs. We compare the efficacy of 33 published clinical trials that evaluated noninvasive biomarkers and liver biopsy. Currently, phase II trial results of fibroblast growth factor 21 (FGF21) and phase III trial results of resmetirom and pioglitazone are encouraging.

medRxiv 2023-06-05 Preprint (No Snippets API) Modarres MH, Kalafatis C, Apostolou P, Tabet N, Khaligh-Razavi S.
Show Full Abstract

<h4>Background</h4> Current primary care cognitive assessment tools are either crude or time-consuming instruments that can only detect cognitive impairment when it is well established. This leads to unnecessary or late referrals to memory services, by which time the disease may have already progressed into more severe stages. Due to the COVID-19 pandemic, some memory services have adapted to the new environment by shifting to remote assessments of patients to meet service user demand. However, the use of remote cognitive assessments has been inconsistent, and there has been little evaluation of the outcome of such a change in clinical practice. Emerging research has highlighted computerised cognitive tests, such as the Integrated Cognitive Assessment (ICA), as the leading candidates for adoption in clinical practice. This is true both during the pandemic and in the post-COVID-19 era as part of healthcare innovation. <h4>Objectives</h4> The Accelerating Dementias Pathways Technologies (ADePT) Study was initiated in order to address this challenge and develop a real-world evidence basis to support the adoption of ICA as an inexpensive screening tool for the detection of cognitive impairment and improving the efficiency of the dementia care pathway. <h4>Methods</h4> Ninety-nine patients aged 55-90 who have been referred to a memory clinic by a general practitioner (GP) were recruited. Participants completed the ICA either at home or in the clinic along with medical history and usability questionnaires. The GP referral and ICA outcome were compared with the specialist diagnosis obtained at the memory clinic. Participants were given the option to carry out a retest visit where they were again given the chance to take the ICA test either remotely or face-to-face. <h4>Results</h4> The primary outcome of the study compared GP referral with specialist diagnosis of MCI/dementia. Of those the GP referred to memory clinics, 78% were necessary referrals, with ∼22% unnecessary referrals, or patients who should have been referred to other services as they had disorders other than MCI/dementia. In the same population the ICA was able to correctly identify cognitive impairment in ∼90% of patients, with approximately 9% of patients being false negatives. From the subset of unnecessary GP referrals, the ICA classified ∼72% of those as not having cognitive impairment, suggesting that these unnecessary referrals may not have been made if the ICA was in use. <h4>Conclusions</h4> The results from this study demonstrate the potential of the ICA as a screening tool, which can be used to support accurate referrals from primary care settings, along with the work conducted in memory clinics and in secondary care.

medRxiv 2023-06-05 Preprint (No Snippets API) Petrozziello T, Huntress SS, Castillo-Torres AL, Quinn JP, Connors TR, Auger CA, Mills AN, Kim SE, Liu S, Mahmood F, Boudi A, Wu M, Sapp E, Kivisäkk P, Sunderesh SR, Pouladi MA, Arnold SE, Hyman BT, Rosas HD, DiFiglia M, Pinto RM, Kegel-Gleason K, Sadri-Vakili G.
Show Full Abstract

<h4>Background</h4> To date, it is still controversial whether tau phosphorylation plays a role in Huntington’s disease (HD), as previous studies demonstrated either no alterations or increases in phosphorylated tau (pTau) in HD post-mortem brain and mouse models. <h4>Objectives</h4> The goal of this study was to determine whether total tau and pTau levels are altered in HD. <h4>Methods</h4> Immunohistochemistry, cellular fractionations, and western blots were used to measure tau and pTau levels in a large cohort of HD and control post-mortem prefrontal cortex (PFC). Furthermore, western blots were performed to assess tau, and pTau levels in HD and control isogenic embryonic stem cell (ESC)-derived cortical neurons and neuronal stem cells (NSCs). Similarly, western blots were used to assess tau and pTau in Htt Q111 and transgenic R6/2 mice. Lastly, total tau levels were assessed in HD and healthy control plasma using Quanterix Simoa assay. <h4>Results</h4> Our results revealed that, while there was no difference in tau or pTau levels in HD PFC compared to controls, tau phosphorylated at S396 levels were increased in PFC samples from HD patients 60 years or older at time of death. Additionally, tau and pTau levels were not changed in HD ESC-derived cortical neurons and NSCs. Similarly, tau or pTau levels were not altered in Htt Q111 and transgenic R6/2 mice compared to wild-type littermates. Lastly, tau levels were not changed in plasma from a small cohort of HD patients compared to controls. <h4>Conclusion</h4> Together these findings demonstrate that pTau-S396 levels increase significantly with age in HD PFC.

Also flagged:GlycolipidsParkinson's diseaseGlycolipidPDpathogenesisaging
Journal Article 2023-06-04 No Snippets Spanos F, Deleidi M.
Show Full Abstract

Glycolipid balance is key to normal body function, and its alteration can lead to a variety of diseases involving multiple organs and tissues. Glycolipid disturbances are also involved in Parkinson's disease (PD) pathogenesis and aging. Increasing evidence suggests that glycolipids affect cellular functions beyond the brain, including the peripheral immune system, intestinal barrier, and immunity. Hence, the interplay between aging, genetic predisposition, and environmental exposures could initiate systemic and local glycolipid changes that lead to inflammatory reactions and neuronal dysfunction. In this review, we discuss recent advances in the link between glycolipid metabolism and immune function and how these metabolic changes can exacerbate immunological contributions to neurodegenerative diseases, with a focus on PD. Further understanding of the cellular and molecular mechanisms that control glycolipid pathways and their impact on both peripheral tissues and the brain will help unravel how glycolipids shape immune and nervous system communication and the development of novel drugs to prevent PD and promote healthy aging.

CCPG1
Also flagged:FOXO3Inflammatory bowel diseasecolon cancerLipidtranscription factormetabolism
Journal Article 2023-06-04 ✓ 2 Snippets Ghimire J, Iftikhar R, Penrose HM, Snarski P, Ruiz E, Savkovic SD.
In-Text Gene Mentions

…MCAM, CDKN1A, RALBP1,CCPG1, PLA2G7 ) are…

…gene 1 (CCPG1), which is…

Show Full Abstract

Inflammatory bowel disease (IBD), characterized by infiltration of polymorphonuclear neutrophils (PMNs), increases the risk of colon cancer. PMN activation corresponds to the accumulation of intracellular Lipid Droplets (LDs). As increased LDs are negatively regulated by transcription factor Forkhead Box O3 (FOXO3), we aim to determine the significance of this regulatory network in PMN-mediated IBD and tumorigenesis. Affected tissue of IBD and colon cancer patients, colonic and infiltrated immune cells, have increased LDs' coat protein, PLIN2. Mouse peritoneal PMNs with stimulated LDs and FOXO3 deficiency have elevated transmigratory activity. Transcriptomic analysis of these FOXO3-deficient PMNs showed differentially expressed genes (DEGs; FDR < 0.05) involved in metabolism, inflammation, and tumorigenesis. Upstream regulators of these DEGs, similar to colonic inflammation and dysplasia in mice, were linked to IBD and human colon cancer. Additionally, a transcriptional signature representing FOXO3-deficient PMNs (PMN-FOXO3<sub>389</sub>) separated transcriptomes of affected tissue in IBD (<i>p</i> = 0.00018) and colon cancer (<i>p</i> = 0.0037) from control. Increased PMN-FOXO3<sub>389</sub> presence predicted colon cancer invasion (lymphovascular <i>p</i> = 0.015; vascular <i>p</i> = 0.046; perineural <i>p</i> = 0.03) and poor survival. Validated DEGs from PMN-FOXO3<sub>389</sub> (<i>P2RX1, MGLL, MCAM, CDKN1A, RALBP1, CCPG1, PLA2G7</i>) are involved in metabolism, inflammation, and tumorigenesis (<i>p</i> < 0.05). These findings highlight the significance of LDs and FOXO3-mediated PMN functions that promote colonic pathobiology.

bioRxiv 2023-06-04 Preprint (No Snippets API) Lisowski P, Lickfett S, Rybak-Wolf A, Le S, Dykstra W, Mlody B, Menacho C, Roth P, Richter Y, Kulka LAM, Glazar P, Wu H, Meierhofer D, Legnini I, Otto M, Miller D, Neuendorf N, Hahn T, Telugu NS, Böddrich A, Mayatepek E, Diecke S, Olzscha H, Kirstein J, Kühn R, Cambridge S, Rajewsky N, Wanker EE, Priller J, Metzger JJ, Prigione A.
Show Full Abstract

Expansion of the glutamine tract (poly-Q) in the protein Huntingtin (HTT) causes the neurodegenerative disorder Huntington’s disease (HD). Emerging evidence suggests that mutant HTT (mHTT) disrupts brain development. To gain mechanistic insights into the neurodevelopmental impact of human mHTT, we engineered induced pluripotent stem cells to introduce a biallelic or monoallelic mutant 70Q expansion or to remove the poly-Q tract of HTT. 70Q introduction caused aberrant development of cerebral organoids with loss of neural progenitor organization. The early neurodevelopmental signature of mHTT highlighted the dysregulation of the protein coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2), a transcription factor involved in mitochondrial integrated stress response. CHCHD2 repression was associated with abnormal mitochondrial morpho-dynamics and elevated resting energy expenditure. Elimination of the poly-Q tract of HTT normalized CHCHD2 expression and mitochondrial defects. Hence, mHTT-mediated disruption of human neurodevelopment is paralleled by aberrant neurometabolic programming mediated by dysregulation of CHCHD2, which could then serve as an early intervention target for HD.

MMS22L
Also flagged:LIN28Bcanceroncogeneshepatocellular carcinomamethylationtumours
Journal Article 2023-06-03 ✓ 1 Snippet Lynch-Sutherland CF, McDougall LI, Stockwell PA, Almomani SN, Weeks RJ, Ludgate JL, Gamage TKJB, Chatterjee A, James JL, Eccles MR, Macaulay EC.
In-Text Gene Mentions

…MS22-Like DNA-Repair Protein (MMS22L) genes are all…

Show Full Abstract

Transposable elements (TEs) are genetic elements that have evolved as crucial regulators of human development and cancer, functioning as both genes and regulatory elements. When TEs become dysregulated in cancer cells, they can serve as alternate promoters to activate oncogenes, a process known as onco-exaptation. This study aimed to explore the expression and epigenetic regulation of onco-exaptation events in early human developmental tissues. We discovered co-expression of some TEs and oncogenes in human embryonic stem cells and first trimester and term placental tissues. Previous studies identified onco-exaptation events in various cancer types, including an AluJb SINE element-LIN28B interaction in lung cancer cells, and showed that the TE-derived LIN28B transcript is associated with poor patient prognosis in hepatocellular carcinoma. This study further characterized the AluJb-LIN28B transcript and confirmed that its expression is restricted to the placenta. Targeted DNA methylation analysis revealed differential methylation of the two LIN28B promoters between placenta and healthy somatic tissues, indicating that some TE-oncogene interactions are not cancer-specific but arise from the epigenetic reactivation of developmental TE-derived regulatory events. In conclusion, our findings provide evidence that some TE-oncogene interactions are not limited to cancer and may originate from the epigenetic reactivation of TE-derived regulatory events that are involved in early development. These insights broaden our understanding of the role of TEs in gene regulation and suggest the potential importance of targeting TEs in cancer therapy beyond their conventional use as cancer-specific markers.

HFE
Also flagged:Sickle cell diseaseacute leukemiachromosomeTP53acute myeloid leukemiaautosomal recessive hemoglobinopathy
Journal Article 2023-06-03 ✓ 1 Snippet Cannas G, Poutrel S, Heiblig M, Labussière H, Larcher MV, Thomas X, Hot A.
In-Text Gene Mentions

…hemolysis and secondaryhemochromatosismay cause increased…

Show Full Abstract

Population-based studies and case reports suggest that there may be an increased risk of acute leukemia associated with sickle cell disease (SCD). Following the description of a new case report, an extensive review of the literature identified 51 previously described cases. Most cases study showed myelodysplastic features confirmed, when available, by genetic markers such as chromosome 5 and/or chromosome 7 abnormalities and TP53 gene mutations. The increased risk of leukemogenesis is certainly multifactorial and related to the pathophysiologic mechanisms of the clinical manifestations of SCD. Chronic hemolysis and secondary hemochromatosis may cause increased chronic inflammation, resulting in persistent marrow stress, which could potentially compromise the genomic stability of the hematopoietic stem cells generating genomic damage and somatic mutations over the course of SCD and its treatment, resulting in a clone that led to acute myeloid leukemia.

Also flagged:CRISPRCasCas9cancerinfectious diseaseshematologic disorders
Journal Article 2023-06-03 No Snippets Morshedzadeh F, Ghanei M, Lotfi M, Ghasemi M, Ahmadi M, Najari-Hanjani P, Sharif S, Mozaffari-Jovin S, Peymani M, Abbaszadegan MR.
Show Full Abstract

The CRISPR/Cas system, an innovative gene-editing tool, is emerging as a promising technique for genome modifications. This straightforward technique was created based on the prokaryotic adaptive immune defense mechanism and employed in the studies on human diseases that proved enormous therapeutic potential. A genetically unique patient mutation in the process of gene therapy can be corrected by the CRISPR method to treat diseases that traditional methods were unable to cure. However, introduction of CRISPR/Cas9 into the clinic will be challenging because we still need to improve the technology's effectiveness, precision, and applications. In this review, we first describe the function and applications of the CRISPR-Cas9 system. We next delineate how this technology could be utilized for gene therapy of various human disorders, including cancer and infectious diseases and highlight the promising examples in the field. Finally, we document current challenges and the potential solutions to overcome these obstacles for the effective use of CRISPR-Cas9 in clinical practice.

Also flagged:hydrocarbondegradationGPRsilverCOVID-19depression
Journal Article 2023-06-03 No Snippets Reivan-Ortiz GG, Cong PT, Wong WK, Ali A, Thu HTT, Akhter S.
Show Full Abstract

The tourism industry is vulnerable to a range of economic and political factors, which can have both short-term and long-term impacts on tourist arrivals. The study aims to investigate the temporal dynamics of these factors and their impact on tourist arrivals. The method employed is a panel data regression analysis, using data from BRICS economies over a period of 1980-2020. The dependent variable is the number of tourist arrivals, while the independent variables are geopolitical risk, currency fluctuation, and economic policy. Control variables such as GDP, exchange rate, and distance to major tourist destinations are also included. The results show that geopolitical risk and currency fluctuation have a significant negative impact on tourist arrivals, while economic policy has a positive impact. The study also finds that the impact of geopolitical risk is stronger in the short term, while the impact of economic policy is stronger in the long term. Additionally, the study shows that the effects of these factors on tourist arrivals vary across BRICS countries. The policy implications of this study suggest that BRICS economies need to develop proactive economic policies that promote stability and encourage investment in the tourism industry.

Also flagged:insulinsecretiondiabetesglucosemetabolismtype 1
Journal Article 2023-06-03 No Snippets Aldous N, Moin ASM, Abdelalim EM.
Show Full Abstract

Recent studies reported that pancreatic β-cells are heterogeneous in terms of their transcriptional profiles and their abilities for insulin secretion. Sub-populations of pancreatic β-cells have been identified based on the functionality and expression of specific surface markers. Under diabetes condition, β-cell identity is altered leading to different β-cell sub-populations. Furthermore, cell-cell contact between β-cells and other endocrine cells within the islet play an important role in regulating insulin secretion. This highlights the significance of generating a cell product derived from stem cells containing β-cells along with other major islet cells for treating patients with diabetes, instead of transplanting a purified population of β-cells. Another key question is how close in terms of heterogeneity are the islet cells derived from stem cells? In this review, we summarize the heterogeneity in islet cells of the adult pancreas and those generated from stem cells. In addition, we highlight the significance of this heterogeneity in health and disease conditions and how this can be used to design a stem cell-derived product for diabetes cell therapy.

DCC
Also flagged:Colorectal cancercancerdeathmethylationageingtumours
Journal Article 2023-06-03 ✓ 2 Snippets Joo JE, Mahmood K, Walker R, Georgeson P, Candiloro I, Clendenning M, Como J, Joseland S, Preston S, Graversen L, Wilding M, Field M, Lemon M, Wakeling J, Marfan H, Susman R, Isbister J, Edwards E, Bowman M, Kirk J, Ip E, McKay L, Antill Y, Hopper JL, Boussioutas A, Macrae FA, Dobrovic A, Jenkins MA, Rosty C, Winship IM, Buchanan DD.
In-Text Gene Mentions

…genes ( ACVR2A,DCC, RNF43, TCF7, B2M…

…infrequent mutations inDCC, RNF43, TCF7, B2M…

Show Full Abstract

<h4>Background</h4>MLH1 epimutation is characterised by constitutional monoallelic MLH1 promoter hypermethylation, which can cause colorectal cancer (CRC). Tumour molecular profiles of MLH1 epimutation CRCs were used to classify germline MLH1 promoter variants of uncertain significance and MLH1 methylated early-onset CRCs (EOCRCs). Genome-wide DNA methylation and somatic mutational profiles of tumours from two germline MLH1: c.-11C > T and one MLH1: c.-[28A > G; 7C > T] carriers and three MLH1 methylated EOCRCs (< 45 years) were compared with 38 reference CRCs. Methylation-sensitive droplet digital PCR (ddPCR) was used to detect mosaic MLH1 methylation in blood, normal mucosa and buccal DNA.<h4>Results</h4>Genome-wide methylation-based Consensus Clustering identified four clusters where the tumour methylation profiles of germline MLH1: c.-11C > T carriers and MLH1 methylated EOCRCs clustered with the constitutional MLH1 epimutation CRCs but not with the sporadic MLH1 methylated CRCs. Furthermore, monoallelic MLH1 methylation and APC promoter hypermethylation in tumour were observed in both MLH1 epimutation and germline MLH1: c.-11C > T carriers and MLH1 methylated EOCRCs. Mosaic constitutional MLH1 methylation in MLH1: c.-11C > T carriers and 1 of 3 MLH1 methylated EOCRCs was identified by methylation-sensitive ddPCR.<h4>Conclusions</h4>Mosaic MLH1 epimutation underlies the CRC aetiology in MLH1: c.-11C > T germline carriers and a subset of MLH1 methylated EOCRCs. Tumour profiling and ultra-sensitive ddPCR methylation testing can be used to identify mosaic MLH1 epimutation carriers.

CCDC92
Also flagged:atrial fibrillationAFheart failurecardiovascular diseaseCVDtranslational
Journal Article 2023-06-03 ✓ 1 Snippet Patel KK, Venkatesan C, Abdelhalim H, Zeeshan S, Arima Y, Linna-Kuosmanen S, Ahmed Z.
In-Text Gene Mentions

One example of the missense variants is SNP rs11057401 on gene CCDC92 which was correlated with coronary artery disease [86].

Show Full Abstract

Atrial fibrillation (AF) and heart failure (HF) contribute to about 45% of all cardiovascular disease (CVD) deaths in the USA and around the globe. Due to the complex nature, progression, inherent genetic makeup, and heterogeneity of CVDs, personalized treatments are believed to be critical. To improve the deciphering of CVD mechanisms, we need to deeply investigate well-known and identify novel genes that are responsible for CVD development. With the advancements in sequencing technologies, genomic data have been generated at an unprecedented pace to foster translational research. Correct application of bioinformatics using genomic data holds the potential to reveal the genetic underpinnings of various health conditions. It can help in the identification of causal variants for AF, HF, and other CVDs by moving beyond the one-gene one-disease model through the integration of common and rare variant association, the expressed genome, and characterization of comorbidities and phenotypic traits derived from the clinical information. In this study, we examined and discussed variable genomic approaches investigating genes associated with AF, HF, and other CVDs. We collected, reviewed, and compared high-quality scientific literature published between 2009 and 2022 and accessible through PubMed/NCBI. While selecting relevant literature, we mainly focused on identifying genomic approaches involving the integration of genomic data; analysis of common and rare genetic variants; metadata and phenotypic details; and multi-ethnic studies including individuals from ethnic minorities, and European, Asian, and American ancestries. We found 190 genes associated with AF and 26 genes linked to HF. Seven genes had implications in both AF and HF, which are SYNPO2L, TTN, MTSS1, SCN5A, PITX2, KLHL3, and AGAP5. We listed our conclusion, which include detailed information about genes and SNPs associated with AF and HF.

Also flagged:digestioncollagenaseDNAsewaterantibodiesGFP
Journal Article 2023-06-03 No Snippets Dowbaj AM, Kohler TN, Cordero-Espinoza L, Hollfelder F, Huch M.
Show Full Abstract

Within the peri-portal region of the adult liver, portal fibroblasts exist in close proximity to epithelial ductal/cholangiocyte cells. However, the cellular interactions between them are poorly understood. Here, we provide two co-culture techniques to incorporate liver portal mesenchyme into ductal cell organoids, which recapitulate aspects of their cellular interactions in vitro. We integrate several techniques from mesenchyme isolation and expansion to co-culture by microfluidic cell co-encapsulation or 2D-Matrigel layer. The protocol is easily adaptable to other cells from other organs. For complete information on the generation and use of this protocol, please refer to Cordero-Espinoza et al.<sup>1</sup>.

HFE
Also flagged:COVID-19COVID-19 infectionacetyl cysteineCOVID 19Coronavirus disease 2019transaminitis
Journal Article 2023-06-03 ✓ 1 Snippet Iqbal P, Karki P, Abdelmottaleb W, Al-Khazraji Y, Mirza Fawad A, Madani K, Ahmed F, Nawaz S, Jamshaid MB, Fernando QM.
In-Text Gene Mentions

…Parvovirus, and HSV),hemochromatosis(serum ferritin and…

Show Full Abstract

COVID-19 associated severe acute liver injury in a young healthy patient has not been reported much in the literature. And currently, there are no standard management guidelines. We want to report a case of acute liver injury of mixed pattern in a young healthy female with asymptomatic COVID-19 infection. She presented with abdominal pain, nausea, vomiting and yellowish discoloration of her skin. Further laboratory investigations revealed mixed pattern liver injury with highly raised liver enzymes. She was managed with N-acetyl cysteine protocol and monitoring of her liver enzymes. Other causes of acute liver injury were ruled out. She remained stable during her hospital stay and follow up. Our aim is to highlight the significance of acute liver injury in COVID 19 patients that may lead to fatal outcomes if not managed and monitored accordingly.

HFE
Also flagged:Maternal AnemiaironIDAIron deficiency anemiaAnemiahemoglobinopathies
Journal Article 2023-06-03 ✓ 1 Snippet Smith LA, Young BC.
In-Text Gene Mentions

…include patients withhemochromatosis, sickle cell anemia,…

Show Full Abstract

<h4>Purpose of review</h4>Our review focuses on the appropriate use of intravenous iron to increase the likelihood of achieving target hemoglobin levels prior to delivery to reduce maternal morbidity.<h4>Recent findings</h4>Iron deficiency anemia (IDA) is a leading contributor to severe maternal morbidity and mortality. Prenatal treatment of IDA has been demonstrated to reduce the likelihood of adverse maternal outcomes. Recent investigations of intravenous iron supplementation have demonstrated superior efficacy and high tolerability for the treatment of IDA in the third trimester, compared against oral regimens. However, it is unknown whether this treatment is cost-effective, available to clinicians, or acceptable to patients.<h4>Summary</h4>Intravenous iron is superior to the oral treatment of IDA; however, its use is limited by the lack of implementation data.

SHISA6
Also flagged:Psychological Stresscancerbehavioralcancerstranslationalmetabolism
Journal Article 2023-06-03 ✓ 1 Snippet Zapata I, Eyre AW, Alvarez CE.
In-Text Gene Mentions

…( ESR1 ,SHISA6, PRKG2 ,…

Show Full Abstract

Although there is evidence that psychological stress may be associated with increased cancer risk, the effect of stress on cancer risk is difficult to study, both in humans, due to socioeconomic factors, and in animal models, due to questionable biological relevance. Here, we test whether heritable canine temperament that increases psychological stress is associated with cancer risk. The study data are breed-specific averages of incidences of multiple cancer types and of temperament classes. The latter are derived from a latent class analysis of behavioral questionnaires completed by owners (C-BARQ). We thus classified the dogs according to whether they are calm vs. reactive within and across breeds. Using meta-analysis approaches, we modeled the risk of multiple cancer types in calm vs. reactive dogs. We adjusted for breed averages of body mass and lifespan, which are common confounders that impact cancer. Our study confirms that body size has a significant effect of on risk of multiple types of cancers in dogs and shows for the first time that temperament also has a moderate effect. These findings suggest dog models of heritable psychological stress are suitable for molecular epidemiological and translational studies on its effects on cancer risk.

HFE
Also flagged:COVID-19addictionglucoseD-dimerlactic dehydrogenaseinfectious disease
Journal Article 2023-06-03 ✓ 1 Snippet Gomes J, de Freitas Barbosa V, de Santana M, de Lima C, Calado R, Júnior C, de Almeida Albuquerque J, de Souza R, de Araújo R, Moreno G, Soares L, Júnior L, de Souza R, dos Santos W.
In-Text Gene Mentions

…infarction, leukemia, andhemochromatosis.…

Show Full Abstract

No abstract available.

bioRxiv 2023-06-03 Preprint (No Snippets API) Yang Y, Scott AA, Kneuper H, Alcock F, Palmer T.
Show Full Abstract

Successful colonisation by the opportunistic pathogen Staphylococcus aureus depends on its ability to interact with other microorganisms. S. aureus strains harbour a T7b-subtype type VII secretion system (T7SSb), a protein secretion system found in a wide variety of Bacillota which functions in bacterial antagonism and virulence. Assessment of T7SSb activity in S. aureus has been hampered by low secretion activity under laboratory conditions, and the lack of a sensitive assay to measure secretion. Here we have utilised NanoLuc Binary Technology to develop a simple assay to monitor protein secretion via detection of bioluminescence. Fusion of the 11 amino acid NanoLuc fragment to the conserved substrate EsxA permits its extracellular detection upon supplementation with the large NanoLuc fragment and luciferase substrate. Following miniaturisation of the assay to 384 well format, we use high-throughput analysis to demonstrate that T7SSb-dependent protein secretion differs across strains and growth temperature. We further show that the same assay can be used to monitor secretion of the surface-associated toxin substrate TspA. Using this approach we identify three conserved accessory proteins required to mediate TspA secretion. Co-purification experiments confirm that all three proteins form a complex with TspA.

Also flagged:pancreatic cancertumorANGPTL4cancerSTAT3lipid
Journal Article 2023-06-02 No Snippets Cai Z, Li Y, Ma M, Wang L, Wang H, Liu M, Jiang C.
Show Full Abstract

Locally advanced and metastatic pancreatic cancer (PC) frequently grows in adipose tissue and has a poor prognosis. Although adipose tissue is largely composed of adipocytes, the mechanisms by which adipocytes impact PC are poorly understood. Using an <i>in vitro</i> coculture model, it was shown that adipocytes promoted tumor progression, and an intricate metabolic network between PC cells and adipocytes was identified and elucidated. First, the proteome of Panc‑1 PC cells cultured with or without mature adipocytes was identified. This revealed activated hypoxia signaling in cocultured Panc‑1 cells, which was confirmed by the increased expression of factors downstream of hypoxia signaling, such as ANGPTL4 and glycolytic genes, as determined by reverse transcription‑quantitative PCR and western blot analysis. In addition, it was demonstrated that coculture with cancer cells activated STAT3 and induced an insulin‑resistant phenotype in adipocytes. Furthermore, enhanced fatty acid β‑oxidation and increased lipid droplets (LDs) were observed in the cocultured cancer cells. In contrast, downregulated lipid metabolism and a decrease in the size of LDs were found in cocultured adipocytes. Finally, it was shown that the increase in LDs contributed to the increased metastatic capacity of the cocultured PC cells. These data demonstrated that interrupting the mechanisms of lipid uptake from adipocytes in the microenvironment may offer a potential strategy for attenuating PC metastasis.

HTT
Also flagged:SleepCircadian BehaviorAutophagyCircadianHuntington's diseaseHD
Journal Article 2023-06-02 ✓ 5 Snippets Sharma A, Narasimha K, Manjithaya R, Sheeba V.
In-Text Gene Mentions

Overall, our study suggests that, in the presence of mutant HTT protein, <i>Atg8a</i> induces autophagy and improves the functioning of circadian and sleep circuits.<b>SIGNIFICANCE STATEMENT</b> Defects in sleep and circadian rhythms are well documented in Huntington's disease.

We found that targeted overexpression of an autophagy gene, <i>Atg8a</i> in male flies, induces autophagy pathway and partially rescues several HTT-induced behavioral defects, including sleep fragmentation, a key hallmark of many neurodegenerative disorders.

…of mutant Huntingtin (HTT) protein.…

…expressed human mutantHTTprotein in a…

Htt

Show Full Abstract

Circadian and sleep defects are well documented in Huntington's disease (HD). Modulation of the autophagy pathway has been shown to mitigate toxic effects of mutant Huntingtin (HTT) protein. However, it is not clear whether autophagy induction can also rescue circadian and sleep defects. Using a genetic approach, we expressed human mutant HTT protein in a subset of <i>Drosophila</i> circadian neurons and sleep center neurons. In this context, we examined the contribution of autophagy in mitigating toxicity caused by mutant HTT protein. We found that targeted overexpression of an autophagy gene, <i>Atg8a</i> in male flies, induces autophagy pathway and partially rescues several HTT-induced behavioral defects, including sleep fragmentation, a key hallmark of many neurodegenerative disorders. Using cellular markers and genetic approaches, we demonstrate that indeed the autophagy pathway is involved in behavioral rescue. Surprisingly, despite behavioral rescue and evidence for the involvement of the autophagy pathway, the large visible aggregates of mutant HTT protein were not eliminated. We show that the rescue in behavior is associated with increased mutant protein aggregation and possibly enhanced output from the targeted neurons, resulting in the strengthening of downstream circuits. Overall, our study suggests that, in the presence of mutant HTT protein, <i>Atg8a</i> induces autophagy and improves the functioning of circadian and sleep circuits.<b>SIGNIFICANCE STATEMENT</b> Defects in sleep and circadian rhythms are well documented in Huntington's disease. Recent literature suggests that circadian and sleep disturbances can exacerbate neurodegenerative phenotypes. Hence, identifying potential modifiers that can improve the functioning of these circuits could greatly improve disease management. We used a genetic approach to enhance cellular proteostasis and found that overexpression of a crucial autophagy gene, <i>Atg8a</i>, induces the autophagy pathway in the <i>Drosophila</i> circadian and sleep neurons and rescues sleep and activity rhythm. We demonstrate that the <i>Atg8a</i> improves synaptic function of these circuits by possibly enhancing the aggregation of the mutant protein in neurons. Further, our results suggest that differences in basal levels of protein homeostatic pathways is a factor that determines selective susceptibility of neurons.

Also flagged:BPobesityHypertensioncardiovascular diseaserenal diseaseCVD
Journal Article 2023-06-02 No Snippets Kurniansyah N, Goodman MO, Khan AT, Wang J, Feofanova E, Bis JC, Wiggins KL, Huffman JE, Kelly T, Elfassy T, Guo X, Palmas W, Lin HJ, Hwang SJ, Gao Y, Young K, Kinney GL, Smith JA, Yu B, Liu S, Wassertheil-Smoller S, Manson JE, Zhu X, Chen YI, Lee IT, Gu CC, Lloyd-Jones DM, Zöllner S, Fornage M, Kooperberg C, Correa A, Psaty BM, Arnett DK, Isasi CR, Rich SS, Kaplan RC, Redline S, Mitchell BD, Franceschini N, Levy D, Rotter JI, Morrison AC, Sofer T.
Show Full Abstract

We assess performance and limitations of polygenic risk scores (PRSs) for multiple blood pressure (BP) phenotypes in diverse population groups. We compare "clumping-and-thresholding" (PRSice2) and LD-based (LDPred2) methods to construct PRSs from each of multiple GWAS, as well as multi-PRS approaches that sum PRSs with and without weights, including PRS-CSx. We use datasets from the MGB Biobank, TOPMed study, UK biobank, and from All of Us to train, assess, and validate PRSs in groups defined by self-reported race/ethnic background (Asian, Black, Hispanic/Latino, and White). For both SBP and DBP, the PRS-CSx based PRS, constructed as a weighted sum of PRSs developed from multiple independent GWAS, perform best across all race/ethnic backgrounds. Stratified analysis in All of Us shows that PRSs are better predictive of BP in females compared to males, individuals without obesity, and middle-aged (40-60 years) compared to older and younger individuals.

PRDX6
Also flagged:peptidepeptidesbreast cancerFN1VWFPRG4
Journal Article 2023-06-02 ✓ 3 Snippets Kim SS, Shin H, Ahn KG, Park YM, Kwon MC, Lim JM, Oh EK, Kim Y, Han SM, Noh DY.
In-Text Gene Mentions

…PRG4, MMP9, CLU,PRDX6, PPBP, APOC1, and…

…PRG4, MMP9, CLU,PRDX6, PPBP, CHL1, and…

…CLU 21 ,PRDX622 , PPBP…

Show Full Abstract

Mass spectrometry (MS) based proteomics is widely used for biomarker discovery. However, often, most biomarker candidates from discovery are discarded during the validation processes. Such discrepancies between biomarker discovery and validation are caused by several factors, mainly due to the differences in analytical methodology and experimental conditions. Here, we generated a peptide library which allows discovery of biomarkers in the equal settings as the validation process, thereby making the transition from discovery to validation more robust and efficient. The peptide library initiated with a list of 3393 proteins detectable in the blood from public databases. For each protein, surrogate peptides favorable for detection in mass spectrometry was selected and synthesized. A total of 4683 synthesized peptides were spiked into neat serum and plasma samples to check their quantifiability in a 10 min liquid chromatography-MS/MS run time. This led to the PepQuant library, which is composed of 852 quantifiable peptides that cover 452 human blood proteins. Using the PepQuant library, we discovered 30 candidate biomarkers for breast cancer. Among the 30 candidates, nine biomarkers, FN1, VWF, PRG4, MMP9, CLU, PRDX6, PPBP, APOC1, and CHL1 were validated. By combining the quantification values of these markers, we generated a machine learning model predicting breast cancer, showing an average area under the curve of 0.9105 for the receiver operating characteristic curve.

SERPINC1
Also flagged:congenital heart diseasethrombosisprothrombin complexmembraneIntracardiac thrombosisarch
Journal Article 2023-06-02 ✓ 2 Snippets Yang Y, Lv J, Li Y, Gan C, Ji P.
In-Text Gene Mentions

…(TAFI), and decreasedATIIIare associated the…

…and antithrombin III (ATIII) found no congenital…

Show Full Abstract

<h4>Background</h4>Intracardiac thrombosis (ICT) is a rare complication after the cardiopulmonary surgery for interrupted aortic arch (IAA) or total anomalous pulmonary venous connection (TAPVC) without previous records. There are still no general guidelines regarding as the mechanism or management of postoperative ICT in neonates and younger infants.<h4>Case presentation</h4>We reported the conservative and surgical therapies in two neonates with intra-ventricular and intra-atrial thrombosis after the anatomical repair for IAA and TAPVC, respectively. There were no risk factors for ICT in both patients, except for the use of blood product and prothrombin complex concentrate. The surgery was indicated after TAPVC correction due to the worsening respiratory status and rapidly decreased mixed venous saturation. Anticoagulation combined with antiplatelet therapies was adopted in another patient. These two were both finally recovered, and three-month, six-month, and one-year follow-up echocardiography revealed no abnormality.<h4>Conclusions</h4>ICT is uncommon in pediatric population after the surgery for congenital heart disease. Single ventricle palliation, heart transplantation, longer central line use, post-extracorporeal membrane oxygenation, and massive blood product use are major risk factors for postcardiotomy thrombosis. The causes of postoperative ICT are multifactorial, and the immaturity of thrombolytic and fibrinolytic system in neonates may serve as a prothrombotic factor. However, no consensus reached regarding as the therapies for postoperative ICT, and the large-scale prospective cohort study or randomized clinical trial is needed.

Also flagged:cancerbladder cancerbreast cancertumorAKTantibody
Journal Article 2023-06-02 No Snippets Joo JI, Park HJ, Cho KH.
Show Full Abstract

Accumulated genetic alterations in cancer cells distort cellular stimulus-response (or input-output) relationships, resulting in uncontrolled proliferation. However, the complex molecular interaction network within a cell implicates a possibility of restoring such distorted input-output relationships by rewiring the signal flow through controlling hidden molecular switches. Here, a system framework of analyzing cellular input-output relationships in consideration of various genetic alterations and identifying possible molecular switches that can normalize the distorted relationships based on Boolean network modeling and dynamics analysis is presented. Such reversion is demonstrated by the analysis of a number of cancer molecular networks together with a focused case study on bladder cancer with in vitro experiments and patient survival data analysis. The origin of reversibility from an evolutionary point of view based on the redundancy and robustness intrinsically embedded in complex molecular regulatory networks is further discussed.

HFE
Also flagged:steatosisASTNASHNAFLDProtonnon-alcoholic fatty liver disease
Journal Article 2023-06-02 ✓ 1 Snippet Kim BK, Bernstein N, Huang DQ, Tamaki N, Imajo K, Yoneda M, Sutter N, Jung J, Nguyen K, Nguyen L, Le T, Madamba E, Richards L, Valasek MA, Behling C, Sirlin CB, Nakajima A, Loomba R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Magnetic resonance imaging-proton density fat fraction (MRI-PDFF) is an excellent biomarker for the non-invasive quantification of hepatic steatosis.<h4>Aim</h4>To examine clinical and histologic factors associated with discordance between steatosis grade determined by histology and MRI-PDFF in patients with non-alcoholic fatty liver disease (NAFLD) METHODS: We included 728 patients with biopsy-proven NAFLD from UC San Diego (n = 414) and Yokohama City University (n = 314) who underwent MRI-PDFF and liver biopsy. Patients were stratified by steatosis, and matched with MRI-PDFF cut-points for each steatosis grade: 0 (MRI-PDFF < 6.4%), 1 (MRI-PDFF: 6.4%-17.4%), 2 (MRI-PDFF: 17.4%-22.1%), 3 (MRI-PDFF ≥ 22.1%). Primary outcome was major discordance defined as ≥2 steatosis grade difference determined by histology and MRI-PDFF.<h4>Results</h4>Mean (±SD) age and BMI were 55.3 (±13.8) years and 29.9 (±4.9) kg/m<sup>2</sup> , respectively. The distributions of histology and MRI-PDFF-determined steatosis were 5.5% grade 0 (n = 40), 44.8% 1 (n = 326, 44.8%), 33.9% 2 (n = 247), and 15.8% 3 (n = 115) vs. 23.5% grade 0 (n = 171), 49.7% 1 (n = 362), 12.9% 2 (n = 94), and 13.9% 3 (n = 101). Major discordance rate was 6.6% (n = 48). Most cases with major discordance had greater histology-determined steatosis grade (n = 40, 88.3%), higher serum AST and liver stiffness, and greater likelihood of fibrosis ≥2, ballooning ≥1 and lobular inflammation ≥2 (all p < 0.05).<h4>Conclusion</h4>Histology overestimates steatosis grade compared to MRI-PDFF. Patients with advanced NASH are likely to be upgraded on steatosis grade by histology. These data have important implications for steatosis estimation and reporting on histology in clinical practice and trials, especially in patients with stage 2 fibrosis.

Also flagged:membrane magnesium transporter 1MMGT1infectiontriacylglycerolsynthesisdroplet formation
Journal Article 2023-06-02 No Snippets Kalam H, Chou CH, Kadoki M, Graham DB, Deguine J, Hung DT, Xavier RJ.
Show Full Abstract

The ability of Mycobacterium tuberculosis (Mtb) to establish latency affects disease and response to treatment. The host factors that influence the establishment of latency remain elusive. We engineered a multi-fluorescent Mtb strain that reports survival, active replication, and stressed non-replication states and determined the host transcriptome of the infected macrophages in these states. Additionally, we conducted a genome-wide CRISPR screen to identify host factors that modulated the phenotypic state of Mtb. We validated hits in a phenotype-specific manner and prioritized membrane magnesium transporter 1 (MMGT1) for a detailed mechanistic investigation. Mtb infection of MMGT1-deficient macrophages promoted a switch to persistence, upregulated lipid metabolism genes, and accumulated lipid droplets during infection. Targeting triacylglycerol synthesis reduced both droplet formation and Mtb persistence. The orphan G protein-coupled receptor GPR156 is a key inducer of droplet accumulation in ΔMMGT1 cells. Our work uncovers the role of MMGT1-GPR156-lipid droplets in the induction of Mtb persistence.

Also flagged:ZincHydroxyapatitemembraneinflammatory responsecell adhesionF-actin
Journal Article 2023-06-02 No Snippets Badea MA, Balas M, Popa M, Borcan T, Bunea AC, Predoi D, Dinischiotu A.
Show Full Abstract

This study aimed to investigate the biological response induced by hydroxyapatite (HAp) and zinc-doped HAp (ZnHAp) in human gingival fibroblasts and to explore their antimicrobial activity. The ZnHAp (with xZn = 0.00 and 0.07) powders, synthesized by the sol-gel method, retained the crystallographic structure of pure HA without any modification. Elemental mapping confirmed the uniform dispersion of zinc ions in the HAp lattice. The size of crystallites was 18.67 ± 2 nm for ZnHAp and 21.54 ± 1 nm for HAp. The average particle size was 19.38 ± 1 nm for ZnHAp and 22.47 ± 1 nm for HAp. Antimicrobial studies indicated an inhibition of bacterial adherence to the inert substrate. In vitro biocompatibility was tested on various doses of HAp and ZnHAp after 24 and 72 h of exposure and revealed that cell viability decreased after 72 h starting with a dose of 31.25 µg/mL. However, cells retained membrane integrity and no inflammatory response was induced. High doses (such as 125 µg/mL) affected cell adhesion and the architecture of F-actin filaments, while in the presence of lower doses (such as 15.625 µg/mL), no modifications were observed. Cell proliferation was inhibited after treatment with HAp and ZnHAp, except the dose of 15.625 µg/mL ZnHAp at 72 h of exposure, when a slight increase was observed, proving an improvement in ZnHAp activity due to Zn doping.

Also flagged:Sirtuin 6SIRT6cell nucleusmitochondriacytoplasmaging
Journal Article 2023-06-02 No Snippets Dzidek A, Czerwińska-Ledwig O, Żychowska M, Pilch W, Piotrowska A.
Show Full Abstract

Sirtuins, in mammals, are a group of seven enzymes (SIRT1-SIRT7) involved in the post-translational modification of proteins-they are considered longevity proteins. SIRT6, classified as class IV, is located on the cell nucleus; however, its action is also connected with other regions, e.g., mitochondria and cytoplasm. It affects many molecular pathways involved in aging: telomere maintenance, DNA repair, inflammatory processes or glycolysis. A literature search for keywords or phrases was carried out in PubMed and further searches were carried out on the ClinicalTrials.gov website. The role of SIRT6 in both premature and chronological aging has been pointed out. SIRT6 is involved in the regulation of homeostasis-an increase in the protein's activity has been noted in calorie-restriction diets and with significant weight loss, among others. Expression of this protein is also elevated in people who regularly exercise. SIRT6 has been shown to have different effects on inflammation, depending on the cells involved. The protein is considered a factor in phenotypic attachment and the migratory responses of macrophages, thus accelerating the process of wound healing. Furthermore, exogenous substances will affect the expression level of <i>SIRT6</i>: resveratrol, sirtinol, flavonoids, cyanidin, quercetin and others. This study discusses the importance of the role of SIRT6 in aging, metabolic activity, inflammation, the wound healing process and physical activity.

Also flagged:PiplartineChagas diseaseCDtropical diseasesphenylpropanoidimide
Journal Article 2023-06-02 No Snippets Filho CSMB, de Menezes RRPPB, Magalhães EP, Castillo YP, Martins AMC, de Sousa DP.
Show Full Abstract

Chagas disease (CD) is one of the main neglected tropical diseases that promote relevant socioeconomic impacts in several countries. The therapeutic options for the treatment of CD are limited, and parasite resistance has been reported. Piplartine is a phenylpropanoid imide that has diverse biological activities, including trypanocidal action. Thus, the objective of the present work was to prepare a collection of thirteen esters analogous to piplartine (<b>1</b>-<b>13</b>) and evaluate their trypanocidal activity against <i>Trypanosoma cruzi.</i> Of the tested analogues, compound <b>11</b> ((<i>E</i>)-furan-2-ylmethyl 3-(3,4,5-trimethoxyphenyl)acrylate) showed good activity with IC<sub>50</sub> values = 28.21 ± 5.34 μM and 47.02 ± 8.70 μM, against the epimastigote and trypomastigote forms, respectively. In addition, it showed a high rate of selectivity to the parasite. The trypanocidal mechanism of action occurs through the induction of oxidative stress and mitochondrial damage. In addition, scanning electron microscopy showed the formation of pores and leakage of cytoplasmic content. Molecular docking indicated that <b>11</b> probably produces a trypanocidal effect through a multi-target mechanism, including affinity with proteins CRK1, MPK13, GSK3B, AKR, UCE-1, and UCE-2, which are important for the survival of the parasite. Therefore, the results suggest chemical characteristics that can serve for the development of new trypanocidal prototypes for researching drugs against Chagas disease.

SERPINC1
Also flagged:COVID-19pulmonary diseasedysfunctionsorgan diseasesVitamin K-dependent protein Shematological disorders
Journal Article 2023-06-02 ✓ 5 Snippets Bandyopadhyay S, Rajan MV, Kaur P, Hariprasad G.
In-Text Gene Mentions

PROS1 and SERPINC1 are mainly implicated in hematological manifestations such as thrombotic disorders arising either due to coagulation factor deficiencies or hereditary mediated conditions.

PROS1 and SERPINC1 qualify as potential biomarkers to flag thrombotic disorder in COVID-19 patients.

…protein S andAntithrombin-IIIfor hematological disorders;…

…proteins are PROS1,SERPINC1, VDAC1, TUBB4B and…

…Among theseSERPINC1had a sensitivity…

Show Full Abstract

SARS-CoV-2 causes substantial extrapulmonary manifestations in addition to pulmonary disease. Some of the major organs affected are cardiovascular, hematological and thrombotic, renal, neurological, and digestive systems. These types of muti-organ dysfunctions make it difficult and challenging for clinicians to manage and treat COVID-19 patients. The article focuses to identify potential protein biomarkers that can flag various organ systems affected in COVID-19. Publicly reposited high throughput proteomic data from human serum (HS), HEK293T/17 (HEK) and Vero E6 (VE) kidney cell culture were downloaded from ProteomeXchange consortium. The raw data was analyzed in Proteome Discoverer 2.4 to delineate the complete list of proteins in the three studies. These proteins were analyzed in Ingenuity Pathway Analysis (IPA) to associate them to various organ diseases. The shortlisted proteins were analyzed in MetaboAnalyst 5.0 to shortlist potential biomarker proteins. These were then assessed for disease-gene association in DisGeNET and validated by Protein-protein interactome (PPI) and functional enrichment studies (GO_BP, KEGG and Reactome pathways) in STRING. Protein profiling resulted in shortlisting 20 proteins in 7 organ systems. Of these 15 proteins showed at least 1.25-fold changes with a sensitivity and specificity of 70%. Association analysis further shortlisted 10 proteins with a potential association with 4 organ diseases. Validation studies established possible interacting networks and pathways affected, confirmingh the ability of 6 of these proteins to flag 4 different organ systems affected in COVID-19 disease. This study helps to establish a platform to seek protein signatures in different clinical phenotypes of COVID-19. The potential biomarker candidates that can flag organ systems involved are: (a) Vitamin K-dependent protein S and Antithrombin-III for hematological disorders; (b) Voltage-dependent anion-selective channel protein 1 for neurological disorders; (c) Filamin-A for cardiovascular disorder and, (d) Peptidyl-prolyl <i>cis</i>-trans isomerase A and Peptidyl-prolyl <i>cis</i>-trans isomerase FKBP1A for digestive disorders.

HTT
Also flagged:TRP channelsneurodegenerative diseasesTRPTransient receptor potential) channelsintegral membrane proteinscation
Journal Article 2023-06-02 ✓ 1 Snippet Rather MA, Khan A, Wang L, Jahan S, Rehman MU, Makeen HA, Mohan S.
In-Text Gene Mentions

In HD, various channels alter the K+ homeostasis in mutant HTT protein, such as the Kir4.1 channel causes hyperexcitability in HD motor neurons by disintegrating the extracellular K+ homeostasis.

Show Full Abstract

TRP (Transient receptor potential) channels are integral membrane proteins consisting of a superfamily of cation channels that allow permeability of both monovalent and divalent cations. TRP channels are subdivided into six subfamilies: TRPC, TRPV, TRPM, TRPP, TRPML, and TRPA, and are expressed in almost every cell and tissue. TRPs play an instrumental role in the regulation of various physiological processes. TRP channels are extensively represented in brain tissues and are present in both prokaryotes and eukaryotes, exhibiting responses to several mechanisms, including physical, chemical, and thermal stimuli. TRP channels are involved in the perturbation of Ca<sup>2+</sup> homeostasis in intracellular calcium stores, both in neuronal and non-neuronal cells, and its discrepancy leads to several neuronal disorders such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and Amyotrophic lateral sclerosis (ALS). TRPs participate in neurite outgrowth, receptor signaling, and excitotoxic cell death in the central nervous system. Understanding the mechanism of TRP channels in neurodegenerative diseases may extend to developing novel therapies. Thus, this review articulates TRP channels' physiological and pathological role in exploring new therapeutic interventions in neurodegenerative diseases.

Also flagged:GlucoseInsulinOxygenSerotoninmaternal obesitygestational diabetes mellitus
Journal Article 2023-06-02 No Snippets Perić M, Horvatiček M, Tandl V, Bečeheli I, Majali-Martinez A, Desoye G, Štefulj J.
Show Full Abstract

Serotonin signaling plays an important role in regulating development and functions of the placenta. We hypothesized that metabolic disturbances associated with maternal obesity and/or gestational diabetes mellitus (GDM) affect placental serotonin homeostasis. Therefore, we examined the effects of high glucose (25 mM) and insulin (10 nM)-two hallmarks of maternal obesity and GDM-on mRNA expression of key regulators of serotonin homeostasis, including serotonin transporter (<i>SERT</i>), tryptophan hydroxylase 1 (<i>TPH1</i>), and monoamine oxidase A (<i>MAOA</i>), in the first-trimester trophoblast cell line ACH-3P, focusing on oxygen levels characteristic of early human placental development. Glucose downregulated expression of <i>SERT</i> and <i>MAOA</i> independently of oxygen level and upregulated expression of <i>TPH1</i> at 6.5% oxygen but not at 2.5% oxygen. Compared to 6.5% oxygen, 2.5% oxygen upregulated <i>SERT</i> and downregulated <i>TPH1</i> expression, with no effect on <i>MAOA</i> expression. Insulin upregulated <i>SERT</i> only at 2.5% oxygen but had no effect on <i>TPH1</i> and <i>MAOA</i> expression. These results suggest that maternal metabolic alterations in early pregnancy may be a driving force for changes in placental serotonin homeostasis.

CACNA1EUNC13C
Also flagged:TumorDeathlung adenocarcinomaLUADcancerLung cancer
Journal Article 2023-06-02 ✓ 3 Snippets He X, Zhao D, Zhang X, Ma Y, Zhang R, Huang Z, Wang G, Guo G, Wang W, Wen Y, Zhang L.
In-Text Gene Mentions
⭐ same-sentence co-mention

In addition, 21 mutated genes including SMARCA4, KEAP1, UNC13C, KCNU1, FCGBP, DNAH11, SYNE1, ASTN1, RYR2, DNAH5, SLITRK3, CDH18, COL19A1, ASTN2, KCNT2, PRUNE2, COL11A1, ASXL3, CNTNAP2, TPTE, and CACNA1E were observed to be more frequent in the high ICDrisk subtype of LUAD patients.

…including SMARCA4, KEAP1,UNC13C, KCNU1, FCGBP, DNAH11,…

…CNTNAP2, TPTE, andCACNA1Ewere observed to…

Show Full Abstract

Recent studies have highlighted the combination of activation of host immunogenic cell death (ICD) and tumor-directed cytotoxic strategies. However, overall multiomic analysis of the intrinsic ICD property in lung adenocarcinoma (LUAD) has not been performed. Therefore, the aim of this study was to develop an ICD-based risk scoring system to predict overall survival (OS) and immunotherapeutic efficacy in patients. In our study, both weighted gene co-expression network analysis (WGCNA) and LASSO-Cox analysis were utilized to identify ICDrisk subtypes (ICDrisk). Moreover, we identify genomic alterations and differences in biological processes, analyze the immune microenvironment, and predict the response to immunotherapy in patients with pan-cancer. Importantly, immunogenicity subgroup typing was performed based on the immune score (IS) and microenvironmental tumor neoantigens (meTNAs). Our results demonstrate that ICDrisk subtypes were identified based on 16 genes. Furthermore, high ICDrisk was proved to be a poor prognostic factor in LUAD patients and indicated poor efficacy of immune checkpoint inhibitor (ICI) treatment in patients with pan-cancer. The two ICDrisk subtypes displayed distinct clinicopathologic features, tumor-infiltrating immune cell patterns, and biological processes. The IS<sup>low</sup>meTNA<sup>high</sup> subtype showed low intratumoral heterogeneity (ITH) and immune-activated phenotypes and correlated with better survival than the other subtypes within the high ICDrisk group. This study suggests effective biomarkers for the prediction of OS in LUAD patients and immunotherapeutic response across Pan-cancer and contributes to enhancing our understanding of intrinsic immunogenic tumor cell death.

Also flagged:chromosomal microdeletion syndromesFOXP2alcoholhearingForkhead Box P2OTOF
Journal Article 2023-06-02 No Snippets Singh R.
Show Full Abstract

Over the past decades, many machine-learning- and artificial-intelligence-based technologies have been created to deduce biometric or bio-relevant parameters of speakers from their voice. These voice profiling technologies have targeted a wide range of parameters, from diseases to environmental factors, based largely on the fact that they are known to influence voice. Recently, some have also explored the prediction of parameters whose influence on voice is not easily observable through data-opportunistic biomarker discovery techniques. However, given the enormous range of factors that can possibly influence voice, more informed methods for selecting those that may be potentially deducible from voice are needed. To this end, this paper proposes a simple path-finding algorithm that attempts to find links between vocal characteristics and perturbing factors using cytogenetic and genomic data. The links represent reasonable selection criteria for use by computational by profiling technologies only, and are not intended to establish any unknown biological facts. The proposed algorithm is validated using a simple example from medical literature-that of the clinically observed effects of specific chromosomal microdeletion syndromes on the vocal characteristics of affected people. In this example, the algorithm attempts to link the genes involved in these syndromes to a single example gene (FOXP2) that is known to play a broad role in voice production. We show that in cases where strong links are exposed, vocal characteristics of the patients are indeed reported to be correspondingly affected. Validation experiments and subsequent analyses confirm that the methodology could be potentially useful in predicting the existence of vocal signatures in naïve cases where their existence has not been otherwise observed.

Also flagged:dementiaataxiahereditary ataxiasTBPSTUB1spinocerebellar ataxia types
Journal Article 2023-06-02 No Snippets Linares AJ, Fogel BL.
Show Full Abstract

<h4>Purpose of review</h4>Late-onset genetic cerebellar ataxias are clinically heterogenous with variable phenotypes. Several of these conditions are commonly associated with dementia. Recognition of the relationship between ataxia and dementia can guide clinical genetic evaluation.<h4>Recent findings</h4>Spinocerebellar ataxias often present with variable phenotypes that may include dementia. Genomic studies have begun to identify links between incomplete penetrance and such variable phenotypes in certain hereditary ataxias. Recent studies evaluating the interaction of TBP repeat expansions and STUB1 sequence variants provide a framework to understand how genetic interactions influence disease penetrance and dementia risk in spinocerebellar ataxia types 17 and 48. Further advances in next generation sequencing methods will continue to improve diagnosis and create new insights into the expressivity of existing disorders.<h4>Summary</h4>The late-onset hereditary ataxias are a clinically heterogenous group of disorders with complex presentations that can include cognitive impairment and/or dementia. Genetic evaluation of late-onset ataxia patients with dementia follows a systemic testing approach that often utilizes repeat expansion testing followed by next-generation sequencing. Advances in bioinformatics and genomics is improving both diagnostic evaluation and establishing a basis for phenotypic variability. Whole genome sequencing will likely replace exome sequencing as a more comprehensive means of routine testing.

Also flagged:curcumintumortricalciumosteosarcomacancerinfection
Journal Article 2023-06-02 No Snippets Bhattacharjee A, Bose S.
Show Full Abstract

The lack of site-specific chemotherapeutic agents after osteosarcoma surgeries often induces severe side effects. We propose the utilization of curcumin as an alternative natural chemo-preventive drug for tumor-specific delivery systems with 3D printed tricalcium phosphate (TCP) based artificial bone grafts. The poor bioavailability and hydrophobic nature of curcumin restrict its clinical use. We have used polydopamine (PDA) coating with Zn<sup>2+</sup> functionalization to enhance the curcumin release in the biological medium. The obtained PDA-Zn<sup>2+</sup> complex is characterized by X-ray photoelectron spectroscopy (XPS). The presence of PDA-Zn<sup>2+</sup> coating leads to ~2 times enhancement in curcumin release. We have computationally predicted and validated the optimized surface composition by a novel multi-objective optimization method. The experimental validation of the predicted compositions indicates that the PDA-Zn<sup>2+</sup> coated curcumin immobilized delivery system leads to a ~12 folds decrease in osteosarcoma viability on day 11 as compared to only TCP. The osteoblast viability shows ~1.4 folds enhancement. The designed surface shows the highest ~90 % antibacterial efficacy against gram-positive and gram-negative bacteria. This unique strategy of curcumin delivery with PDA-Zn<sup>2+</sup> coating is expected to find application in low-load bearing critical-sized tumor-resection sites.

bioRxiv 2023-06-02 Preprint (No Snippets API) Ayoubi R, Ryan J, Biddle MS, Alshafie W, Fotouhi M, Bolivar SG, Moleon VR, Eckmann P, Worrall D, McDowell I, Southern K, Reintsch W, Durcan TM, Brown CM, Bandrowski A, Virk HS, Edwards AM, McPherson PS, Laflamme C.
Show Full Abstract

Antibodies are critical reagents to detect and characterize proteins. It is commonly understood that many commercial antibodies do not recognize their intended targets, but information on the scope of the problem remains largely anecdotal, and as such, feasibility of the goal of at least one potent and specific antibody targeting each protein in a proteome cannot be assessed. Focusing on antibodies for human proteins, we have scaled a standardized characterization approach using parental and knockout cell lines (Laflamme et al., 2019) to assess the performance of 614 commercial antibodies for 65 neuroscience-related proteins. Side-by-side comparisons of all antibodies against each target, obtained from multiple commercial partners, demonstrates that: i) more than 50% of all antibodies failed in one or more tests, ii ) yet, ∼50-75% of the protein set was covered by at least one high-performing antibody, depending on application, suggesting that coverage of human proteins by commercial antibodies is significant; and iii ) recombinant antibodies performed better than monoclonal or polyclonal antibodies. The hundreds of underperforming antibodies identified in this study were found to have been used in a large number of published articles, which should raise alarm. Encouragingly, more than half of the underperforming commercial antibodies were reassessed by the manufacturers, and many had alterations to their recommended usage or were removed from the market. This first such study helps demonstrate the scale of the antibody specificity problem but also suggests an efficient strategy toward achieving coverage of the human proteome; mine the existing commercial antibody repertoire, and use the data to focus new renewable antibody generation efforts.

Also flagged:TRIM67oligodendrogliomasRho GTPaseastrocytomaschromosomeIDH
Journal Article 2023-06-01 No Snippets Demirdizen E, Al-Ali R, Narayanan A, Sun X, Varga JP, Steffl B, Brom M, Krunic D, Schmidt C, Schmidt G, Bestvater F, Taranda J, Turcan Ş.
Show Full Abstract

<h4>Background</h4>IDH mutant gliomas are grouped into astrocytomas or oligodendrogliomas depending on the codeletion of chromosome arms 1p and 19q. Although the genomic alterations of IDH mutant gliomas have been well described, transcriptional changes unique to either tumor type have not been fully understood. Here, we identify Tripartite Motif Containing 67 (TRIM67), an E3 ubiquitin ligase with essential roles during neuronal development, as an oncogene distinctly upregulated in oligodendrogliomas.<h4>Methods</h4>We used several cell lines, including patient-derived oligodendroglioma tumorspheres, to knock down or overexpress TRIM67. We coupled high-throughput assays, including RNA sequencing, total lysate-mass spectrometry (MS), and coimmunoprecipitation (co-IP)-MS with functional assays including immunofluorescence (IF) staining, co-IP, and western blotting (WB) to assess the in vitro phenotype associated with TRIM67. Patient-derived oligodendroglioma tumorspheres were orthotopically implanted in mice to determine the effect of TRIM67 on tumor growth and survival.<h4>Results</h4>TRIM67 overexpression alters the abundance of cytoskeletal proteins and induces membrane bleb formation. TRIM67-associated blebbing was reverted with the nonmuscle class II myosin inhibitor blebbistatin and selective ROCK inhibitor fasudil. NOGO-A/Rho GTPase/ROCK2 signaling is altered upon TRIM67 ectopic expression, pointing to the underlying mechanism for TRIM67-induced blebbing. Phenotypically, TRIM67 expression resulted in higher cell motility and reduced cell adherence. In orthotopic implantation models of patient-derived oligodendrogliomas, TRIM67 accelerated tumor growth, reduced overall survival, and led to increased vimentin expression at the tumor margin.<h4>Conclusions</h4>Taken together, our results demonstrate that upregulated TRIM67 induces blebbing-based rounded cell morphology through Rho GTPase/ROCK-mediated signaling thereby contributing to glioma pathogenesis.

DARS2
Also flagged:cognitive impairmentdevelopmental retardationstrokeataxiamovement disordersperipheral neuropathy
Journal Article 2023-06-01 ✓ 2 Snippets Wu C, Wang M, Wang X, Li W, Li S, Chen B, Niu S, Tai H, Pan H, Zhang Z.
In-Text Gene Mentions

…, AARS2 ,DARS2, Mt DNA…

…heterozygous mutations inDARS2( Supplementary Table…

Show Full Abstract

Genetic leukoencephalopathies (gLEs) are a highly heterogeneous group of rare genetic disorders. The spectrum of gLEs varies among patients of different ages. Distinct from the relatively more abundant studies of gLEs in children, only a few studies that explore the spectrum of adult gLEs have been published, and it should be noted that the majority of these excluded certain gLEs. Thus, to date, no large study has been designed and conducted to characterize the genetic and phenotypic spectra of gLEs in adult patients. We recruited a consecutive series of 309 adult patients clinically suspected of gLEs from Beijing Tiantan Hospital between January 2014 and December 2021. Whole-exome sequencing, mitochondrial DNA sequencing and repeat analysis of NOTCH2NLC, FMR1, DMPK and ZNF9 were performed for patients. We describe the genetic and phenotypic spectra of the set of patients with a genetically confirmed diagnosis and summarize their clinical and radiological characteristics. A total of 201 patients (65%) were genetically diagnosed, while 108 patients (35%) remained undiagnosed. The most frequent diseases were leukoencephalopathies related to NOTCH3 (25%), NOTCH2NLC (19%), ABCD1 (9%), CSF1R (7%) and HTRA1 (5%). Based on a previously proposed pathological classification, the gLEs in our cohort were divided into leukovasculopathies (35%), leuko-axonopathies (31%), myelin disorders (21%), microgliopathies (7%) and astrocytopathies (6%). Patients with NOTCH3 mutations accounted for 70% of the leukovasculopathies, followed by HTRA1 (13%) and COL4A1/2 (9%). The leuko-axonopathies contained the richest variety of associated genes, of which NOTCH2NLC comprised 62%. Among myelin disorders, demyelinating leukoencephalopathies (61%)-mainly adrenoleukodystrophy and Krabbe disease-accounted for the majority, while hypomyelinating leukoencephalopathies (2%) were rare. CSF1R was the only mutated gene detected in microgliopathy patients. Leukoencephalopathy with vanishing white matter disease due to mutations in EIF2B2-5 accounted for half of the astrocytopathies. We characterized the genetic and phenotypic spectra of adult gLEs in a large Chinese cohort. The most frequently mutated genes were NOTCH3, NOTCH2NLC, ABCD1, CSF1R and HTRA1.

Also flagged:Cdk5cell cyclemitochondrialdeathpathogenesisc-Jun N-terminal kinases
Journal Article 2023-06-01 No Snippets Requejo-Aguilar R.
Show Full Abstract

Neurodegenerative diseases are caused by the progressive loss of specific neurons. The exact mechanisms of action of these diseases are unknown, and many studies have focused on pathways related to abnormal accumulation and processing of proteins, mitochondrial dysfunction, and oxidative stress leading to apoptotic death. However, a growing body of evidence indicates that aberrant cell cycle re-entry plays a major role in the pathogenesis of neurodegeneration. The activation of the cell cycle in mature neurons could be promoted by several signaling mechanisms, including c-Jun N-terminal kinases, p38 mitogen-activated protein kinases, and mitogen-activated protein kinase/extracellular signal-regulated kinase cascades; post-translational modifications such as Tau-phosphorylation; and DNA damage response. In all these events, implicated Cdk5, a proline-directed serine/threonine protein kinase, seems to be responsible for several cellular processes in neurons including axon growth, neurotransmission, synaptic plasticity, neuronal migration, and maintenance of neuronal survival. However, under pathological conditions, Cdk5 dysregulation may lead to cell cycle re-entry in post-mitotic neurons. Thus, Cdk5 hyperactivation, by its physiologic activator p25, hyper-phosphorylates downstream substrates related to neurodegenerative diseases. This review summarizes factors such as oxidative stress, DNA damage response, signaling pathway disturbance, and Ubiquitin proteasome malfunction contributing to cell cycle re-entry in post-mitotic neurons. It also describes how all these factors are linked to a greater or lesser extent with Cdk5. Thus, it offers a global vision of the function of cell cycle-related proteins in mature neurons with a focus on Cdk5 and how this protein contributes to the development of Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease by cell cycle activation.

HTT
Also flagged:gene expressionnucleotidesneurodegenerative disordersneurodegenerative diseasesamyotrophic lateral sclerosischromatin
Journal Article 2023-06-01 ✓ 1 Snippet Ruffo P, De Amicis F, Giardina E, Conforti FL.
In-Text Gene Mentions

An increase in the copy number of CAG trinucleotide repeats in the first exon of the HTT (Huntingtin) gene, that encodes polyglutamine, causes HD (Jimenez-Sanchez et al., 2017).

Show Full Abstract

The growing and rapid development of high-throughput sequencing technologies have allowed a greater understanding of the mechanisms underlying gene expression regulation. Editing the epigenome and epitranscriptome directs the fate of the transcript influencing the functional outcome of each mRNA. In this context, non-coding RNAs play a decisive role in addressing the expression regulation at the gene and chromosomal levels. Long-noncoding RNAs, consisting of more than 200 nucleotides, have been shown to act as epigenetic regulators in several key molecular processes involving neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and Huntington's disease. Long-noncoding RNAs are abundantly expressed in the central nervous system, suggesting that their deregulation could trigger neuronal degeneration through RNA modifications. The evaluation of their diagnostic significance and therapeutic potential could lead to new treatments for these diseases for which there is no cure.

Also flagged:Neuronal nitric oxide synthaseoxygendeathneuropathologicalepilepsygenetic epilepsy
Journal Article 2023-06-01 No Snippets Xu XX, Shi RX, Fu Y, Wang JL, Tong X, Zhang SQ, Wang N, Li MX, Tong Y, Wang W, He M, Liu BY, Chen GL, Guo F.
Show Full Abstract

Dysfunction of neuronal nitric oxide synthase contributes to neurotoxicity, which triggers cell death in various neuropathological diseases, including epilepsy. Studies have shown that inhibition of neuronal nitric oxide synthase activity increases the epilepsy threshold, that is, has an anticonvulsant effect. However, the exact role and potential mechanism of neuronal nitric oxide synthase in seizures are still unclear. In this study, we performed RNA sequencing, functional enrichment analysis, and weighted gene coexpression network analysis of the hippocampus of tremor rats, a rat model of genetic epilepsy. We found damaged hippocampal mitochondria and abnormal succinate dehydrogenase level and Na<sup>+</sup>-K<sup>+</sup>-ATPase activity. In addition, we used a pilocarpine-induced N2a cell model to mimic epileptic injury. After application of neuronal nitric oxide synthase inhibitor 7-nitroindazole, changes in malondialdehyde, lactate dehydrogenase and superoxide dismutase, which are associated with oxidative stress, were reversed, and the increase in reactive oxygen species level was reversed by 7-nitroindazole or reactive oxygen species inhibitor N-acetylcysteine. Application of 7-nitroindazole or N-acetylcysteine downregulated the expression of caspase-3 and cytochrome c and reversed the apoptosis of epileptic cells. Furthermore, 7-nitroindazole or N-acetylcysteine downregulated the abnormally high expression of NLRP3, gasdermin-D, interleukin-1β and interleukin-18. This indicated that 7-nitroindazole and N-acetylcysteine each reversed epileptic cell death. Taken together, our findings suggest that the neuronal nitric oxide synthase/reactive oxygen species pathway is involved in pyroptosis of epileptic cells, and inhibiting neuronal nitric oxide synthase activity or its induced oxidative stress may play a neuroprotective role in epilepsy.

Also flagged:peripheral neuropathiesCharcot-Marie-Tooth-1A-Marie-Tooth-myelinationaxonogenesisresponse to oxidative stress
Journal Article 2023-06-01 No Snippets Msheik Z, Durand S, Pinault E, Caillaud M, Vignaud L, Billet F, El Massry M, Desmouliere A.
Show Full Abstract

The sensorimotor and histological aspects of peripheral neuropathies were already studied by our team in two rat models: the sciatic nerve crush and the Charcot-Marie-Tooth-1A disease. In this study, we sought to highlight and compare the protein signature of these two pathological situations. Indeed, the identification of protein profiles in diseases can play an important role in the development of pharmacological targets. In fact, Charcot-Marie-Tooth-1A rats develop motor impairments that are more severe in the hind limbs. Therefore, for the first time, protein expression in sciatic nerve of Charcot-Marie-Tooth-1A rats was examined. First, distal sciatic nerves were collected from Charcot-Marie-Tooth-1A and uninjured wild-type rats aged 3 months. After protein extraction, sequential window acquisition of all theoretical fragment ion spectra liquid chromatography and mass spectrometry was employed. 445 proteins mapped to Swiss-Prot or trEMBL Uniprot databases were identified and quantified. Of these, 153 proteins showed statistically significant differences between Charcot-Marie-Tooth-1A and wild-type groups. The majority of these proteins were overexpressed in Charcot-Marie-Tooth-1A. Hierarchical clustering and functional enrichment using Gene Ontology were used to group these proteins based on their biological effects concerning Charcot-Marie-Tooth-1A pathophysiology. Second, proteomic characterization of wild-type rats subjected to sciatic nerve crush was performed sequential window acquisition of all theoretical fragment ion spectra liquid chromatography and mass spectrometry. One month after injury, distal sciatic nerves were collected and analyzed as described above. Out of 459 identified proteins, 92 showed significant differences between sciatic nerve crush and the uninjured wild-type rats used in the first study. The results suggest that young adult Charcot-Marie-Tooth-1A rats (3 months old) develop compensatory mechanisms at the level of redox balance, protein folding, myelination, and axonogenesis. These mechanisms seem insufficient to hurdle the progress of the disease. Notably, response to oxidative stress appears to be a significant feature of Charcot-Marie-Tooth-1A, potentially playing a role in the pathological process. In contrast to the first experiment, the majority of the proteins that differed from wild-type were downregulated in the sciatic nerve crush group. Functional enrichment suggested that neurogenesis, response to axon injury, and oxidative stress were important biological processes. Protein analysis revealed an imperfect repair at this time point after injury and identified several distinguishable proteins. In conclusion, we suggest that peripheral neuropathies, whether of a genetic or traumatic cause, share some common pathological pathways. This study may provide directions for better characterization of these models and/or identifying new specific therapeutic targets.

HTT
Also flagged:Huntington's diseaseHuntingtinbehaviouralsucrosecognitionacetyl aspartate
Journal Article 2023-06-01 ✓ 5 Snippets Thomson SB, Stam A, Brouwers C, Fodale V, Bresciani A, Vermeulen M, Mostafavi S, Petkau TL, Hill A, Yung A, Russell-Schulz B, Kozlowski P, MacKay A, Ma D, Beg MF, Evers MM, Vallès A, Leavitt BR.
In-Text Gene Mentions

Huntingtin (HTT)-lowering therapies show great promise in treating Huntington's disease.

Dose-dependent changes in AAV5 vector DNA level, miHTT expression and mutant HTT were observed in striatum and cortex of AAV5-miHTT-treated Huntington's disease model mice.

…Huntingtin (HTT)-lowering therapies show grea…

…expression and mutantHTTwere observed in…

HTT

Show Full Abstract

Huntingtin (HTT)-lowering therapies show great promise in treating Huntington's disease. We have developed a microRNA targeting human HTT that is delivered in an adeno-associated serotype 5 viral vector (AAV5-miHTT), and here use animal behaviour, MRI, non-invasive proton magnetic resonance spectroscopy and striatal RNA sequencing as outcome measures in preclinical mouse studies of AAV5-miHTT. The effects of AAV5-miHTT treatment were evaluated in homozygous Q175FDN mice, a mouse model of Huntington's disease with severe neuropathological and behavioural phenotypes. Homozygous mice were used instead of the more commonly used heterozygous strain, which exhibit milder phenotypes. Three-month-old homozygous Q175FDN mice, which had developed acute phenotypes by the time of treatment, were injected bilaterally into the striatum with either formulation buffer (phosphate-buffered saline + 5% sucrose), low dose (5.2 × 109 genome copies/mouse) or high dose (1.3 × 1011 genome copies/mouse) AAV5-miHTT. Wild-type mice injected with formulation buffer served as controls. Behavioural assessments of cognition, T1-weighted structural MRI and striatal proton magnetic resonance spectroscopy were performed 3 months after injection, and shortly afterwards the animals were sacrificed to collect brain tissue for protein and RNA analysis. Motor coordination was assessed at 1-month intervals beginning at 2 months of age until sacrifice. Dose-dependent changes in AAV5 vector DNA level, miHTT expression and mutant HTT were observed in striatum and cortex of AAV5-miHTT-treated Huntington's disease model mice. This pattern of microRNA expression and mutant HTT lowering rescued weight loss in homozygous Q175FDN mice but did not affect motor or cognitive phenotypes. MRI volumetric analysis detected atrophy in four brain regions in homozygous Q175FDN mice, and treatment with high dose AAV5-miHTT rescued this effect in the hippocampus. Like previous magnetic resonance spectroscopy studies in Huntington's disease patients, decreased total N-acetyl aspartate and increased myo-inositol levels were found in the striatum of homozygous Q175FDN mice. These neurochemical findings were partially reversed with AAV5-miHTT treatment. Striatal transcriptional analysis using RNA sequencing revealed mutant HTT-induced changes that were partially reversed by HTT lowering with AAV5-miHTT. Striatal proton magnetic resonance spectroscopy analysis suggests a restoration of neuronal function, and striatal RNA sequencing analysis shows a reversal of transcriptional dysregulation following AAV5-miHTT in a homozygous Huntington's disease mouse model with severe pathology. The results of this study support the use of magnetic resonance spectroscopy in HTT-lowering clinical trials and strengthen the therapeutic potential of AAV5-miHTT in reversing severe striatal dysfunction in Huntington's disease.

Also flagged:gene expressioncardiovascular diseasesAPAcardiovascular diseasedinucleotideadenosine nucleotides
Journal Article 2023-06-01 No Snippets Cao J, Kuyumcu-Martinez MN.
Show Full Abstract

Cleavage and polyadenylation of pre-mRNAs is a necessary step for gene expression and function. Majority of human genes exhibit multiple polyadenylation sites, which can be alternatively used to generate different mRNA isoforms from a single gene. Alternative polyadenylation (APA) of pre-mRNAs is important for the proteome and transcriptome landscape. APA is tightly regulated during development and contributes to tissue-specific gene regulation. Mis-regulation of APA is linked to a wide range of pathological conditions. APA-mediated gene regulation in the heart is emerging as a new area of research. Here, we will discuss the impact of APA on gene regulation during heart development and in cardiovascular diseases. First, we will briefly review how APA impacts gene regulation and discuss molecular mechanisms that control APA. Then, we will address APA regulation during heart development and its dysregulation in cardiovascular diseases. Finally, we will discuss pre-mRNA targeting strategies to correct aberrant APA patterns of essential genes for the treatment or prevention of cardiovascular diseases. The RNA field is blooming due to advancements in RNA-based technologies. RNA-based vaccines and therapies are becoming the new line of effective and safe approaches for the treatment and prevention of human diseases. Overall, this review will be influential for understanding gene regulation at the RNA level via APA in the heart and will help design RNA-based tools for the treatment of cardiovascular diseases in the future.

HFE
Also flagged:Insulintype 2 diabetes mellitusprocollagentype I collagenType 2 Diabetesglucose
Journal Article 2023-06-01 ✓ 1 Snippet Nasser MI, Stidsen JV, Højlund K, Nielsen JS, Eastell R, Frost M.
In-Text Gene Mentions

…(history of pancreatitis,hemochromatosis, cystic fibrosis, or…

Show Full Abstract

<h4>Context</h4>Bone turnover markers (BTMs) are lower in type 2 diabetes mellitus (T2D). The relationships between bone turnover, β-cell function, and insulin sensitivity in T2D are uncertain.<h4>Objective</h4>To investigate if fasting levels of BTMs in persons with T2D are associated with β-cell function or insulin sensitivity.<h4>Methods</h4>We defined three T2D phenotypes, the insulinopenic (low β-cell function, high insulin sensitivity), the classical (low β-cell function, low insulin sensitivity), and the hyperinsulinemic (high β-cell function, low insulin sensitivity) phenotypes, in the Danish Centre for Strategic Research T2D cohort using the homeostatic model assessment. We selected age- and gender-matched subgroups to represent the three T2D phenotypes, yielding 326 glucose-lowering treatment-naïve persons with T2D. Median values of BTMs between the three T2D phenotypes were compared. Regression models were applied to assess the association between BTMs, β-cell function, and insulin sensitivity adjusted for potential confounders.<h4>Results</h4>Median serum levels of procollagen type I N-terminal propeptide, C-terminal telopeptide of type I collagen, and osteocalcin were higher in the insulinopenic phenotype (52.3 μg/L, IQR 41.6, 63.3; 259.4 ng/L, IQR 163.4, 347.7; and 18.0 μg/L, IQR 14.4, 25.2, respectively) compared with the classical (41.4, IQR 31.0, 51.4; 150.4 IQR 103.5, 265.1; 13.1, IQR 10.0, 17.6, respectively) and the hyperinsulinemic (43.7, IQR 32.3, 57.3; 163.3, IQR 98.9, 273.1; 15.7 IQR 10.2, 20.8, respectively) phenotypes (all P < .01). These differences persisted after adjustment for age, sex, waist to hip ratio, or fasting plasma glucose (P < .01).<h4>Conclusion</h4>BTMs are lower in newly diagnosed persons with T2D characterized by low insulin sensitivity.

HFE
Also flagged:SarcopeniaobesityDepressioncardiovascular diseasehigh blood pressureangina
Journal Article 2023-06-01 ✓ 1 Snippet Veronese N, Koyanagi A, Barbagallo M, Dominguez LJ, Maggi S, Soysal P, Bolzetta F, Ruotolo G, Castagna A, Smith L.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Pain and sarcopenia are common in older people. Cross-sectional studies have reported a significant association between these two conditions, but cohort studies exploring pain as a potential risk factor for sarcopenia are scarce. Given this background, the aim of the present work was to investigate the association between pain (and its severity) at baseline, and the incidence of sarcopenia over 10 years of follow-up in a large representative sample of the English older adult population.<h4>Methods</h4>Pain was diagnosed using self-reported information and categorized as mild to severe pain at four sites (low back, hip, knee, and feet). Incident sarcopenia was defined as having low handgrip strength and low skeletal muscle mass during the follow-up period. The association between pain at baseline and incident sarcopenia was assessed using an adjusted logistic regression analysis, and reported as odds ratios (ORs) with their 95% confidence intervals (CIs).<h4>Results</h4>The 4 102 participants without sarcopenia at baseline had a mean ± standard deviation age of 69.7 ± 7.2 years, and they were mainly male (55.6%). Pain was present in 35.3% of the sample. Over 10 years of follow-up, 13.9% of the participants developed sarcopenia. After adjusting for 12 potential confounders, people with pain reported a significantly higher risk of sarcopenia (OR = 1.46: 95% CI: 1.18-1.82). However, only severe pain was significantly associated with incident sarcopenia, without significant differences across the four sites assessed.<h4>Conclusions</h4>The presence of pain, particularly severe pain, was associated with a significantly higher risk of incident sarcopenia.

Also flagged:Histone Lysine DemethylasesCancersacute myeloid leukemiaAMLgliomaIDH
Journal Article 2023-06-01 No Snippets Gunn K, Myllykoski M, Cao JZ, Ahmed M, Huang B, Rouaisnel B, Diplas BH, Levitt MM, Looper R, Doench JG, Ligon KL, Kornblum HI, McBrayer SK, Yan H, Duy C, Godley LA, Koivunen P, Losman JA.
Show Full Abstract

Oncogenic mutations in isocitrate dehydrogenase 1 (IDH1) and IDH2 occur in a wide range of cancers, including acute myeloid leukemia (AML) and glioma. Mutant IDH enzymes convert 2-oxoglutarate (2OG) to (R)-2-hydroxyglutarate [(R)-2HG], an oncometabolite that is hypothesized to promote cellular transformation by dysregulating 2OG-dependent enzymes. The only (R)-2HG target that has been convincingly shown to contribute to transformation by mutant IDH is the myeloid tumor suppressor TET2. However, there is ample evidence to suggest that (R)-2HG has other functionally relevant targets in IDH-mutant cancers. Here, we show that (R)-2HG inhibits KDM5 histone lysine demethylases and that this inhibition contributes to cellular transformation in IDH-mutant AML and IDH-mutant glioma. These studies provide the first evidence of a functional link between dysregulation of histone lysine methylation and transformation in IDH-mutant cancers.<h4>Significance</h4>Mutant IDH is known to induce histone hypermethylation. However, it is not known if this hypermethylation is functionally significant or is a bystander effect of (R)-2HG accumulation in IDH-mutant cells. Here, we provide evidence that KDM5 inhibition by (R)-2HG contributes to mutant IDH-mediated transformation in AML and glioma. This article is highlighted in the In This Issue feature, p. 1275.

DCC
Also flagged:JMJD6tumorANXA1Breast cancercancerluminal breast cancer
Journal Article 2023-06-01 ✓ 1 Snippet Cioni B, Ratti S, Piva A, Tripodi I, Milani M, Menichetti F, Langella T, Botti L, De Cecco L, Chiodoni C, Lecis D, Colombo MP.
In-Text Gene Mentions

…medium supplemented withDCC( Fig. 1C…

Show Full Abstract

Breast cancer is the most common type of cancer in women worldwide, with the luminal subtype being the most widespread. Although characterized by better prognosis compared with other subtypes, luminal breast cancer is still considered a threatening disease due to therapy resistance, which occurs via both cell- and non-cell-autonomous mechanisms. Jumonji domain-containing 6, arginine demethylase and lysine hydroxylase (JMJD6) is endowed with a negative prognostic value in luminal breast cancer and, via its epigenetic activity, it is known to regulate many intrinsic cancer cell pathways. So far, the effect of JMJD6 in molding the surrounding microenvironment has not been explored.Here, we describe a novel function of JMJD6 showing that its genetic inhibition in breast cancer cells suppresses lipid droplet formation and ANXA1 expression, via estrogen receptor alpha and PPARα modulation. Reduction of intracellular ANXA1 results in decreased release in the tumor microenvironment (TME), ultimately preventing M2-type macrophage polarization and tumor aggressiveness.<h4>Implications</h4>Our findings identify JMJD6 as a determinant of breast cancer aggressiveness and provide the rationale for the development of inhibitory molecules to reduce disease progression also through the remodeling of TME composition.

TNFSF4
Also flagged:p38MAPKαBreast CancerMetastatic breast cancertumorCD4IFNγ
Journal Article 2023-06-01 ✓ 1 Snippet Faget DV, Luo X, Inkman MJ, Ren Q, Su X, Ding K, Waters MR, Raut GK, Pandey G, Dodhiawala PB, Ramalho-Oliveira R, Ye J, Cole T, Murali B, Zheleznyak A, Shokeen M, Weiss KR, Monahan JB, DeSelm CJ, Lee AV, Oesterreich S, Weilbaecher KN, Zhang J, DeNardo DG, Stewart SA.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Metastatic breast cancer is an intractable disease that responds poorly to immunotherapy. We show that p38MAPKα inhibition (p38i) limits tumor growth by reprogramming the metastatic tumor microenvironment in a CD4+ T cell-, IFNγ-, and macrophage-dependent manner. To identify targets that further increased p38i efficacy, we utilized a stromal labeling approach and single-cell RNA sequencing. Thus, we combined p38i and an OX40 agonist that synergistically reduced metastatic growth and increased overall survival. Intriguingly, patients with a p38i metastatic stromal signature had better overall survival that was further improved by the presence of an increased mutational load, leading us to ask if our approach would be effective in antigenic breast cancer. The combination of p38i, anti-OX40, and cytotoxic T-cell engagement cured mice of metastatic disease and produced long-term immunologic memory. Our findings demonstrate that a detailed understanding of the stromal compartment can be used to design effective antimetastatic therapies.<h4>Significance</h4>Immunotherapy is rarely effective in breast cancer. We dissected the metastatic tumor stroma, which revealed a novel therapeutic approach that targets the stromal p38MAPK pathway and creates an opportunity to unleash an immunologic response. Our work underscores the importance of understanding the tumor stromal compartment in therapeutic design. This article is highlighted in the In This Issue feature, p. 1275.

MMS22L
Also flagged:Sister chromatidchromosomecohesinSMC1SMC3RAD21
Journal Article 2023-06-01 ✓ 5 Snippets Zhang J, Li L, Miao Y, Liu X, Sun H, Jiang M, Li X, Li Z, Liu C, Liu B, Xu X, Cao Q, Hou W, Chen C, Lou H.
In-Text Gene Mentions

Third, we overexpressed FLAG-MMS22L in HEK293T cells and detected its oligomeric status by in vivo crosslinking with glutaraldehyde (GA).

…PCNA and CRL4MMS22Lin yeast and…

…acetylation through CRL4MMS22L.…

…phosphorylate Thr105 inMMS22L(Thr127 in yeast…

…of both CRL4MMS22Land ESCO2 exclusively…

Show Full Abstract

Besides entrapping sister chromatids, cohesin drives other high-order chromosomal structural dynamics like looping, compartmentalization and condensation. ESCO2 acetylates a subset of cohesin so that cohesion must be established and only be established between nascent sister chromatids. How this process is precisely achieved remains unknown. Here, we report that GSK3 family kinases provide higher hierarchical control through an ESCO2 regulator, CRL4MMS22L. GSK3s phosphorylate Thr105 in MMS22L, resulting in homo-dimerization of CRL4MMS22L and ESCO2 during S phase as evidenced by single-molecule spectroscopy and several biochemical approaches. A single phospho-mimicking mutation on MMS22L (T105D) is sufficient to mediate their dimerization and rescue the cohesion defects caused by GSK3 or MMS22L depletion, whereas non-phosphorylable T105A exerts dominant-negative effects even in wildtype cells. Through cell fractionation and time-course measurements, we show that GSK3s facilitate the timely chromatin association of MMS22L and ESCO2 and subsequently SMC3 acetylation. The necessity of ESCO2 dimerization implicates symmetric control of cohesion establishment in eukaryotes.

HFE
Also flagged:IronPolycythemia veramyeloproliferative neoplasmJAK2erythropoiesisGP130 coupled receptors
Journal Article 2023-06-01 ✓ 5 Snippets Bennett C, Jackson VE, Pettikiriarachchi A, Hayman T, Schaeper U, Moir-Meyer G, Fielding K, Ataide R, Clucas D, Baldi A, Garnham AL, Li-Wai-Suen CSN, Loughran SJ, Baxter EJ, Green AR, Alexander WS, Bahlo M, Burbury K, Ng AP, Pasricha SR.
In-Text Gene Mentions

Given the established role of HFE in hepcidin regulation, we reasoned that the ultimate mechanism for the genetic association with disease phenotype was via changes in hepcidin, and, hence, we dissected the role of hepcidin in PV using preclinical models.

Given the overrepresentation of AA genotypes in PV cases and the established role of homozygous C282Y variants in disease, we reexamined the HFE locus for associations with PV under a recessive model.

•Homozygous HFE mutations are overrepresented in patients with PV.

…known to causehemochromatosisare highly associated…

HFEinfluences the expression…

Show Full Abstract

Polycythemia vera (PV) is a myeloproliferative neoplasm driven by activating mutations in JAK2 that result in unrestrained erythrocyte production, increasing patients' hematocrit and hemoglobin concentrations, placing them at risk of life-threatening thrombotic events. Our genome-wide association study of 440 PV cases and 403 351 controls using UK Biobank data showed that single nucleotide polymorphisms in HFE known to cause hemochromatosis are highly associated with PV diagnosis, linking iron regulation to PV. Analysis of the FinnGen dataset independently confirmed overrepresentation of homozygous HFE variants in patients with PV. HFE influences the expression of hepcidin, the master regulator of systemic iron homeostasis. Through genetic dissection of mouse models of PV, we show that the PV erythroid phenotype is directly linked to hepcidin expression: endogenous hepcidin upregulation alleviates erythroid disease whereas hepcidin ablation worsens it. Furthermore, we demonstrate that in PV, hepcidin is not regulated by expanded erythropoiesis but is likely governed by inflammatory cytokines signaling via GP130-coupled receptors. These findings have important implications for understanding the pathophysiology of PV and offer new therapeutic strategies for this disease.

ZNF322
Also flagged:gene expressioncell differentiationDNasechromatinbindingtranscriptional repressors
Journal Article 2023-06-01 ✓ 1 Snippet Hussain S, Sadouni N, van Essen D, Dao LTM, Ferré Q, Charbonnier G, Torres M, Gallardo F, Lecellier CH, Sexton T, Saccani S, Spicuglia S.
In-Text Gene Mentions

…for KZFPs, includingZNF322, ZNF410 and ZNF263…

Show Full Abstract

The action of cis-regulatory elements with either activation or repression functions underpins the precise regulation of gene expression during normal development and cell differentiation. Gene activation by the combined activities of promoters and distal enhancers has been extensively studied in normal and pathological contexts. In sharp contrast, gene repression by cis-acting silencers, defined as genetic elements that negatively regulate gene transcription in a position-independent fashion, is less well understood. Here, we repurpose the STARR-seq approach as a novel high-throughput reporter strategy to quantitatively assess silencer activity in mammals. We assessed silencer activity from DNase hypersensitive I sites in a mouse T cell line. Identified silencers were associated with either repressive or active chromatin marks and enriched for binding motifs of known transcriptional repressors. CRISPR-mediated genomic deletions validated the repressive function of distinct silencers involved in the repression of non-T cell genes and genes regulated during T cell differentiation. Finally, we unravel an association of silencer activity with short tandem repeats, highlighting the role of repetitive elements in silencer activity. Our results provide a general strategy for genome-wide identification and characterization of silencer elements.

OLFM4
Also flagged:Intestinal metaplasia in the esophagusgastric adenocarcinomaBEatrophic gastritisGastric Intestinal MetaplasiaBarrett's Esophagus
Journal Article 2023-06-01 ✓ 3 Snippets Nowicki-Osuch K, Zhuang L, Cheung TS, Black EL, Masqué-Soler N, Devonshire G, Redmond AM, Freeman A, di Pietro M, Pilonis N, Januszewicz W, O'Donovan M, Tavaré S, Shields JD, Fitzgerald RC.
In-Text Gene Mentions

C, Coimmunofluorescent staining of the esophagus with BE with BE-IM and GIM shows coexpression of intestinal and gastric markers in both types of IM using lineage markers MUC5AC (gastric) and GPA33 (intestinal), and progenitor markers MUC6 (gastric) and OLFM4 (intestinal).

…types, we usedOLFM4and LGR5 as…

…(MUC6) and intestinal (OLFM4) progenitor cells, respective…

Show Full Abstract

Intestinal metaplasia in the esophagus (Barrett's esophagus IM, or BE-IM) and stomach (GIM) are considered precursors for esophageal and gastric adenocarcinoma, respectively. We hypothesize that BE-IM and GIM follow parallel developmental trajectories in response to differing inflammatory insults. Here, we construct a single-cell RNA-sequencing atlas, supported by protein expression studies, of the entire gastrointestinal tract spanning physiologically normal and pathologic states including gastric metaplasia in the esophagus (E-GM), BE-IM, atrophic gastritis, and GIM. We demonstrate that BE-IM and GIM share molecular features, and individual cells simultaneously possess transcriptional properties of gastric and intestinal epithelia, suggesting phenotypic mosaicism. Transcriptionally E-GM resembles atrophic gastritis; genetically, it is clonal and has a lower mutational burden than BE-IM. Finally, we show that GIM and BE-IM acquire a protumorigenic, activated fibroblast microenvironment. These findings suggest that BE-IM and GIM can be considered molecularly similar entities in adjacent organs, opening the path for shared detection and treatment strategies.<h4>Significance</h4>Our data capture the gradual molecular and phenotypic transition from a gastric to intestinal phenotype (IM) in the esophagus and stomach. Because BE-IM and GIM can predispose to cancer, this new understanding of a common developmental trajectory could pave the way for a more unified approach to detection and treatment. See related commentary by Stachler, p. 1291. This article is highlighted in the In This Issue feature, p. 1275.

Also flagged:14-3-3Acute myocardial infarctionET-1Ang II14-3-3 protein-zetacardiac hypertrophy
Journal Article 2023-06-01 No Snippets Mahmud J, Thi My Ong H, Ates E, Seo HS, Kang MJ.
Show Full Abstract

Acute myocardial infarction (AMI) is a multifaceted syndrome influenced by the functions of various extrinsic and intrinsic pathways and pathological processes, which can be detected in circulation using biomarkers. In this study, we investigated the secretome protein profile of induced-hypertrophy cardiomyocytes to identify next-generation biomarkers for AMI diagnosis and management. Hypertrophy was successfully induced in immortalized human cardiomyocytes (T0445) by 200 nM ET-1 and 1 μM Ang II. The protein profiles of hypertrophied cardiomyocyte secretomes were analyzed by nano-liquid chromatography with tandem mass spectrometry and differentially expressed proteins that have been identified by Ingenuity Pathway Analysis. The levels of 32 proteins increased significantly (>1.4 fold), whereas 17 proteins (<0.5 fold) showed a rapid decrease in expression. Proteomic analysis showed significant upregulation of six 14-3-3 protein isoforms in hypertrophied cardiomyocytes compared to those in control cells. Multi-reaction monitoring results of human plasma samples showed that 14-3-3 protein-zeta levels were significantly elevated in patients with AMI compared to those of healthy controls. These findings elucidated the role of 14-3-3 protein-zeta in cardiac hypertrophy and cardiovascular disorders and demonstrated its potential as a novel biomarker and therapeutic strategy. [BMB Reports 2023; 56(6): 341-346].

PTGIS
Also flagged:coronavirus disease-19COVID-19infectionslung diseaseendotheliitisbinding
Journal Article 2023-06-01 ✓ 2 Snippets Sykes RA, Neves KB, Alves-Lopes R, Caputo I, Fallon K, Jamieson NB, Kamdar A, Legrini A, Leslie H, McIntosh A, McConnachie A, Morrow A, McFarlane RW, Mangion K, McAbney J, Montezano AC, Touyz RM, Wood C, Berry C.
In-Text Gene Mentions

…and prostacyclin synthase (PTGIS; Figure 3 C…

…= 0.032) andPTGIS( P =…

Show Full Abstract

<h4>Background</h4>In post-coronavirus disease-19 (post-COVID-19) conditions (long COVID), systemic vascular dysfunction is implicated, but the mechanisms are uncertain, and the treatment is imprecise.<h4>Methods and results</h4>Patients convalescing after hospitalization for COVID-19 and risk factor matched controls underwent multisystem phenotyping using blood biomarkers, cardiorenal and pulmonary imaging, and gluteal subcutaneous biopsy (NCT04403607). Small resistance arteries were isolated and examined using wire myography, histopathology, immunohistochemistry, and spatial transcriptomics. Endothelium-independent (sodium nitroprusside) and -dependent (acetylcholine) vasorelaxation and vasoconstriction to the thromboxane A2 receptor agonist, U46619, and endothelin-1 (ET-1) in the presence or absence of a RhoA/Rho-kinase inhibitor (fasudil), were investigated. Thirty-seven patients, including 27 (mean age 57 years, 48% women, 41% cardiovascular disease) 3 months post-COVID-19 and 10 controls (mean age 57 years, 20% women, 30% cardiovascular disease), were included. Compared with control responses, U46619-induced constriction was increased (P = 0.002) and endothelium-independent vasorelaxation was reduced in arteries from COVID-19 patients (P < 0.001). This difference was abolished by fasudil. Histopathology revealed greater collagen abundance in COVID-19 arteries {Masson's trichrome (MT) 69.7% [95% confidence interval (CI): 67.8-71.7]; picrosirius red 68.6% [95% CI: 64.4-72.8]} vs. controls [MT 64.9% (95% CI: 59.4-70.3) (P = 0.028); picrosirius red 60.1% (95% CI: 55.4-64.8), (P = 0.029)]. Greater phosphorylated myosin light chain antibody-positive staining in vascular smooth muscle cells was observed in COVID-19 arteries (40.1%; 95% CI: 30.9-49.3) vs. controls (10.0%; 95% CI: 4.4-15.6) (P < 0.001). In proof-of-concept studies, gene pathways associated with extracellular matrix alteration, proteoglycan synthesis, and viral mRNA replication appeared to be upregulated.<h4>Conclusion</h4>Patients with post-COVID-19 conditions have enhanced vascular fibrosis and myosin light change phosphorylation. Rho-kinase activation represents a novel therapeutic target for clinical trials.

SUDS3
Also flagged:FRDAErythropoietingene expressionmitochondrialribosometranslational
Journal Article 2023-06-01 ✓ 1 Snippet Indelicato E, Kirchmair A, Amprosi M, Steixner S, Nachbauer W, Eigentler A, Wahl N, Apostolova G, Krogsdam A, Schneider R, Wanschitz J, Trajanoski Z, Boesch S.
In-Text Gene Mentions

…HDAC7, TCF25, SFMBT1,SUDS3).…

Show Full Abstract

<h4>Objective</h4>In Friedreich's ataxia (FRDA), the most affected tissues are not accessible to sampling and available transcriptomic findings originate from blood-derived cells and animal models. Herein, we aimed at dissecting for the first time the pathophysiology of FRDA by means of RNA-sequencing in an affected tissue sampled in vivo.<h4>Methods</h4>Skeletal muscle biopsies were collected from seven FRDA patients before and after treatment with recombinant human Erythropoietin (rhuEPO) within a clinical trial. Total RNA extraction, 3'-mRNA library preparation and sequencing were performed according to standard procedures. We tested for differential gene expression with DESeq2 and performed gene set enrichment analysis with respect to control subjects.<h4>Results</h4>FRDA transcriptomes showed 1873 genes differentially expressed from controls. Two main signatures emerged: (1) a global downregulation of the mitochondrial transcriptome as well as of ribosome/translational machinery and (2) an upregulation of genes related to transcription and chromatin regulation, especially of repressor terms. Downregulation of the mitochondrial transcriptome was more profound than previously shown in other cellular systems. Furthermore, we observed in FRDA patients a marked upregulation of leptin, the master regulator of energy homeostasis. RhuEPO treatment further enhanced leptin expression.<h4>Interpretation</h4>Our findings reflect a double hit in the pathophysiology of FRDA: a transcriptional/translational issue and a profound mitochondrial failure downstream. Leptin upregulation in the skeletal muscle in FRDA may represent a compensatory mechanism of mitochondrial dysfunction, which is amenable to pharmacological boosting. Skeletal muscle transcriptomics is a valuable biomarker to monitor therapeutic interventions in FRDA.

TNFSF4
Also flagged:gene expressionreverse transcriptionpolymerasechromosomesp53signal transduction
Journal Article 2023-06-01 ✓ 1 Snippet Abend M, Amundson SA, Badie C, Brzoska K, Kriehuber R, Lacombe J, Lopez-Riego M, Lumniczky K, Endesfelder D, O'Brien G, Doucha-Senf S, Ghandhi SA, Hargitai R, Kis E, Lundholm L, Oskamp D, Ostheim P, Schüle S, Schwanke D, Shuryak I, Siebenwith C, Unverricht-Yeboah M, Wojcik A, Yang J, Zenhausern F, Port M.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Early and high-throughput individual dose estimates are essential following large-scale radiation exposure events. In the context of the Running the European Network for Biodosimetry and Physical Dosimetry (RENEB) 2021 exercise, gene expression assays were conducted and their corresponding performance for dose-assessment is presented in this publication. Three blinded, coded whole blood samples from healthy donors were exposed to 0, 1.2 and 3.5 Gy X-ray doses (240 kVp, 1 Gy/min) using the X-ray source Yxlon. These exposures correspond to clinically relevant groups of unexposed, low dose (no severe acute health effects expected) and high dose exposed individuals (requiring early intensive medical health care). Samples were sent to eight teams for dose estimation and identification of clinically relevant groups. For quantitative reverse transcription polymerase chain reaction (qRT-PCR) and microarray analyses, samples were lysed, stored at 20°C and shipped on wet ice. RNA isolations and assays were run in each laboratory according to locally established protocols. The time-to-result for both rough early and more precise later reports has been documented where possible. Accuracy of dose estimates was calculated as the difference between estimated and reference doses for all doses (summed absolute difference, SAD) and by determining the number of correctly reported dose estimates that were defined as ±0.5 Gy for reference doses <2.5 Gy and ±1.0 Gy for reference doses >3 Gy, as recommended for triage dosimetry. We also examined the allocation of dose estimates to clinically/diagnostically relevant exposure groups. Altogether, 105 dose estimates were reported by the eight teams, and the earliest report times on dose categories and estimates were 5 h and 9 h, respectively. The coefficient of variation for 85% of all 436 qRT-PCR measurements did not exceed 10%. One team reported dose estimates that systematically deviated several-fold from reported dose estimates, and these outliers were excluded from further analysis. Teams employing a combination of several genes generated about two-times lower median SADs (0.8 Gy) compared to dose estimates based on single genes only (1.7 Gy). When considering the uncertainty intervals for triage dosimetry, dose estimates of all teams together were correctly reported in 100% of the 0 Gy, 50% of the 1.2 Gy and 50% of the 3.5 Gy exposed samples. The order of dose estimates (from lowest to highest) corresponding to three dose categories (unexposed, low dose and highest exposure) were correctly reported by all teams and all chosen genes or gene combinations. Furthermore, if teams reported no exposure or an exposure >3.5 Gy, it was always correctly allocated to the unexposed and the highly exposed group, while low exposed (1.2 Gy) samples sometimes could not be discriminated from highly (3.5 Gy) exposed samples. All teams used FDXR and 78.1% of correct dose estimates used FDXR as one of the predictors. Still, the accuracy of reported dose estimates based on FDXR differed considerably among teams with one team's SAD (0.5 Gy) being comparable to the dose accuracy employing a combination of genes. Using the workflow of this reference team, we performed additional experiments after the exercise on residual RNA and cDNA sent by six teams to the reference team. All samples were processed similarly with the intention to improve the accuracy of dose estimates when employing the same workflow. Re-evaluated dose estimates improved for half of the samples and worsened for the others. In conclusion, this inter-laboratory comparison exercise enabled (1) identification of technical problems and corrections in preparations for future events, (2) confirmed the early and high-throughput capabilities of gene expression, (3) emphasized different biodosimetry approaches using either only FDXR or a gene combination, (4) indicated some improvements in dose estimation with FDXR when employing a similar methodology, which requires further research for the final conclusion and (5) underlined the applicability of gene expression for identification of unexposed and highly exposed samples, supporting medical management in radiological or nuclear scenarios.

Also flagged:Ubiquitin LigasesSiah1atumorlung adenocarcinomaLUADStat3
Journal Article 2023-06-01 No Snippets Scortegagna M, Du Y, Bradley LM, Wang K, Molinolo A, Ruppin E, Murad R, Ronai ZA.
Show Full Abstract

Cellular components of the tumor microenvironment, including myeloid cells, play important roles in the progression of lung adenocarcinoma (LUAD) and its response to therapy. Here, we characterize the function of the ubiquitin ligases Siah1a/2 in regulating the differentiation and activity of alveolar macrophages (AM) and assess the implication of Siah1a/2 control of AMs for carcinogen-induced LUAD. Macrophage-specific genetic ablation of Siah1a/2 promoted accumulation of AMs with an immature phenotype and increased expression of protumorigenic and pro-inflammatory Stat3 and β-catenin gene signatures. Administration of urethane to wild-type mice promoted enrichment of immature-like AMs and lung tumor development, which was enhanced by macrophage-specific Siah1a/2 ablation. The profibrotic gene signature seen in Siah1a/2-ablated immature-like macrophages was associated with increased tumor infiltration of CD14+ myeloid cells and poorer survival of patients with LUAD. Single-cell RNA-seq confirmed the presence of a cluster of immature-like AMs expressing a profibrotic signature in lungs of patients with LUAD, a signature enhanced in smokers. These findings identify Siah1a/2 in AMs as gatekeepers of lung cancer development.<h4>Significance</h4>The ubiquitin ligases Siah1a/2 control proinflammatory signaling, differentiation, and profibrotic phenotypes of alveolar macrophages to suppress lung carcinogenesis.

Also flagged:Transcription factorosteogenesisRenal osteodystrophyRODmetabolismchronic kidney disease
Journal Article 2023-06-01 No Snippets Martinez-Calle M, Courbon G, Hunt-Tobey B, Francis C, Spindler J, Wang X, Dos Reis LM, Martins CS, Salusky IB, Malluche H, Nickolas TL, Moyses RM, Martin A, David V.
Show Full Abstract

Renal osteodystrophy (ROD) is a disorder of bone metabolism that affects virtually all patients with chronic kidney disease (CKD) and is associated with adverse clinical outcomes including fractures, cardiovascular events, and death. In this study, we showed that hepatocyte nuclear factor 4α (HNF4α), a transcription factor mostly expressed in the liver, is also expressed in bone, and that osseous HNF4α expression was dramatically reduced in patients and mice with ROD. Osteoblast-specific deletion of Hnf4α resulted in impaired osteogenesis in cells and mice. Using multi-omics analyses of bones and cells lacking or overexpressing Hnf4α1 and Hnf4α2, we showed that HNF4α2 is the main osseous Hnf4α isoform that regulates osteogenesis, cell metabolism, and cell death. As a result, osteoblast-specific overexpression of Hnf4α2 prevented bone loss in mice with CKD. Our results showed that HNF4α2 is a transcriptional regulator of osteogenesis, implicated in the development of ROD.

POU3F2SOX6
Also flagged:transcription factorSOX17gene expressiontranscription factorsembryogenesisSry
Journal Article 2023-06-01 ✓ 2 Snippets Trinh LT, Osipovich AB, Liu B, Shrestha S, Cartailler JP, Wright CVE, Magnuson MA.
In-Text Gene Mentions

Sox6

Pou3f2

Show Full Abstract

During early embryogenesis, the transcription factor SOX17 contributes to hepato-pancreato-biliary system formation and vascular-hematopoietic emergence. To better understand Sox17 function in the developing endoderm and endothelium, we developed a dual-color temporal lineage-tracing strategy in mice combined with single-cell RNA sequencing to analyze 6934 cells from Sox17-expressing lineages at embryonic days 9.0-9.5. Our analyses showed 19 distinct cellular clusters combined from all 3 germ layers. Differential gene expression, trajectory and RNA-velocity analyses of endothelial cells revealed a heterogenous population of uncommitted and specialized endothelial subtypes, including 2 hemogenic populations that arise from different origins. Similarly, analyses of posterior foregut endoderm revealed subsets of hepatic, pancreatic, and biliary progenitors with overlapping developmental potency. Calculated gene-regulatory networks predict gene regulons that are dominated by cell type-specific transcription factors unique to each lineage. Vastly different Sox17 regulons found in endoderm versus endothelial cells support the differential interactions of SOX17 with other regulatory factors thereby enabling lineage-specific regulatory actions.

Also flagged:chromosomeethanolnitrogenchromatinchromosomesnucleotide
Journal Article 2023-06-01 No Snippets MacGuigan DJ, Krabbenhoft TJ, Harrington RC, Wainwright DK, Backenstose NJC, Near TJ.
Show Full Abstract

Geographic isolation is the primary driver of speciation in many vertebrate lineages. This trend is exemplified by North American darters, a clade of freshwater fishes where nearly all sister species pairs are allopatric and separated by millions of years of divergence. One of the only exceptions is the Lake Waccamaw endemic Etheostoma perlongum and its riverine sister species Etheostoma maculaticeps, which have no physical barriers to gene flow. Here we show that lacustrine speciation of E. perlongum is characterized by morphological and ecological divergence likely facilitated by a large chromosomal inversion. While E. perlongum is phylogenetically nested within the geographically widespread E. maculaticeps, there is a sharp genetic and morphological break coinciding with the lake-river boundary in the Waccamaw River system. Despite recent divergence, an active hybrid zone, and ongoing gene flow, analyses using a de novo reference genome reveal a 9 Mb chromosomal inversion with elevated divergence between E. perlongum and E. maculaticeps. This region exhibits striking synteny with known inversion supergenes in two distantly related fish lineages, suggesting deep evolutionary convergence of genomic architecture. Our results illustrate that rapid, ecological speciation with gene flow is possible even in lineages where geographic isolation is the dominant mechanism of speciation.

Also flagged:DiabetesmitochondrialSMAD5PTPMT1INSNFKB1
Journal Article 2023-06-01 No Snippets RADIANT Study Group.
Show Full Abstract

<h4>Objective</h4>The Rare and Atypical Diabetes Network (RADIANT) will perform a study of individuals and, if deemed informative, a study of their family members with uncharacterized forms of diabetes.<h4>Research design and methods</h4>The protocol includes genomic (whole-genome [WGS], RNA, and mitochondrial sequencing), phenotypic (vital signs, biometric measurements, questionnaires, and photography), metabolomics, and metabolic assessments.<h4>Results</h4>Among 122 with WGS results of 878 enrolled individuals, a likely pathogenic variant in a known diabetes monogenic gene was found in 3 (2.5%), and six new monogenic variants have been identified in the SMAD5, PTPMT1, INS, NFKB1, IGF1R, and PAX6 genes. Frequent phenotypic clusters are lean type 2 diabetes, autoantibody-negative and insulin-deficient diabetes, lipodystrophic diabetes, and new forms of possible monogenic or oligogenic diabetes.<h4>Conclusions</h4>The analyses will lead to improved means of atypical diabetes identification. Genetic sequencing can identify new variants, and metabolomics and transcriptomics analysis can identify novel mechanisms and biomarkers for atypical disease.

BTN2A1
Also flagged:triple-negative breast cancerbreast cancercancersolid tumorstumorPD-1
Journal Article 2023-06-01 ✓ 5 Snippets Raute K, Strietz J, Parigiani MA, Andrieux G, Thomas OS, Kistner KM, Zintchenko M, Aichele P, Hofmann M, Zhou H, Weber W, Boerries M, Swamy M, Maurer J, Minguet S.
In-Text Gene Mentions

The correlation between the mRNA levels of BTN2A1 and BTN3A1 does not change between mammary healthy tissue (0.5988) and TNBC patient-derived samples (0.5924).

Gene set enrichment analysis of TCGA data revealed that patients with TNBC clustered by high (top quartile) average expression of BTN2A1, BTN3A1, Fas, MICB, and ICAM-1 exhibited higher expression of BCSC genes and gene signatures associated to immune response, inflammation, IFNγ and IFNα responses, cytokine and chemokine signaling and immune-mediated cytotoxicity (Supplementary Fig. S7) suggesting a favorable tumor immune microenvironment.

To deepen into this observation, we applied the “deep deconvolution” CIBERSORT algorithm to TCGA data to deduce the immune cell composition (45) and compared the patients with TNBC with high versus low average expression of BTN2A1, BTN3A1, Fas, MICB, and ICAM-1 (Supplementary Fig. S8).

We clustered patients with TCGA TNBC by the expression levels of both BTN2A1 and BTN3A1 and found that high expression of both proteins significantly correlated with increased survival.

Indeed, these human γδ T cell–specific genes were clearly upregulated in those patients with TNBC clustered by high (top quartile) average expression of BTN2A1, BTN3A1, Fas, MICB, and ICAM-1 (Supplementary Fig. S8).

Show Full Abstract

There are no targeted therapies for patients with triple-negative breast cancer (TNBC). TNBC is enriched in breast cancer stem cells (BCSC), which play a key role in metastasis, chemoresistance, relapse, and mortality. γδ T cells hold great potential in immunotherapy against cancer and might provide an approach to therapeutically target TNBC. γδ T cells are commonly observed to infiltrate solid tumors and have an extensive repertoire of tumor-sensing mechanisms, recognizing stress-induced molecules and phosphoantigens (pAgs) on transformed cells. Herein, we show that patient-derived triple-negative BCSCs are efficiently recognized and killed by ex vivo expanded γδ T cells from healthy donors. Orthotopically xenografted BCSCs, however, were refractory to γδ T-cell immunotherapy. We unraveled concerted differentiation and immune escape mechanisms: xenografted BCSCs lost stemness, expression of γδ T-cell ligands, adhesion molecules, and pAgs, thereby evading immune recognition by γδ T cells. Indeed, neither promigratory engineered γδ T cells, nor anti-PD-1 checkpoint blockade, significantly prolonged overall survival of tumor-bearing mice. BCSC immune escape was independent of the immune pressure exerted by the γδ T cells and could be pharmacologically reverted by zoledronate or IFNα treatment. These results pave the way for novel combinatorial immunotherapies for TNBC.

OLFM4
Also flagged:LGR5translationalcolorectal cancergene expressionCas9APC
Journal Article 2023-06-01 ✓ 5 Snippets Schaaf CR, Polkoff KM, Carter A, Stewart AS, Sheahan B, Freund J, Ginzel J, Snyder JC, Roper J, Piedrahita JA, Gonzalez LM.
In-Text Gene Mentions

Similar OLFM4 expression in both human and porcine colon could be important for future improved modeling of intestinal diseases such as CRC where OLFM4 is a known marker for a subset of cancer cells and potential metastasis.56, 70, 71

…FISH, similar LGR5,OLFM4, HOPX, LYZ ,…

…ATA; R- ATTTCTTTCCCAGGGAGTGG),OLFM4(F- GTCAGCAAACCGGCTATTGT; R-…

…LYZ , andOLFM4mRNA or a…

…by LGR5 andOLFM4expression.…

Show Full Abstract

Intestinal epithelial stem cells (ISCs) are responsible for intestinal epithelial barrier renewal; thereby, ISCs play a critical role in intestinal pathophysiology research. While transgenic ISC reporter mice are available, advanced translational studies lack a large animal model. This study validates ISC isolation in a new porcine Leucine Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5) reporter line and demonstrates the use of these pigs as a novel colorectal cancer (CRC) model. We applied histology, immunofluorescence, fluorescence-activated cell sorting, flow cytometry, gene expression quantification, and 3D organoid cultures to whole tissue and single cells from the duodenum, jejunum, ileum, and colon of LGR5-H2B-GFP and wild-type pigs. Ileum and colon LGR5-H2B-GFP, healthy human, and murine biopsies were compared by mRNA fluorescent in situ hybridization (FISH). To model CRC, adenomatous polyposis coli (APC) mutation was induced by CRISPR/Cas9 editing in porcine LGR5-H2B-GFP colonoids. Crypt-base, green fluorescent protein (GFP) expressing cells co-localized with ISC biomarkers. LGR5-H2B-GFP<sup>hi</sup> cells had significantly higher LGR5 expression (p < .01) and enteroid forming efficiency (p < .0001) compared with LGR5-H2B-GFP<sup>med/lo/neg</sup> cells. Using FISH, similar LGR5, OLFM4, HOPX, LYZ, and SOX9 expression was identified between human and LGR5-H2B-GFP pig crypt-base cells. LGR5-H2B-GFP/APC<sup>null</sup> colonoids had cystic growth in WNT/R-spondin-depleted media and significantly upregulated WNT/β-catenin target gene expression (p < .05). LGR5<sup>+</sup> ISCs are reproducibly isolated in LGR5-H2B-GFP pigs and used to model CRC in an organoid platform. The known anatomical and physiologic similarities between pig and human, and those shown by crypt-base FISH, underscore the significance of this novel LGR5-H2B-GFP pig to translational ISC research.

Also flagged:TryptophanMetabolismCentral Nervous System DiseasesL-tryptophanof thekynurenine
Journal Article 2023-06-01 No Snippets Huang Y, Zhao M, Chen X, Zhang R, Le A, Hong M, Zhang Y, Jia L, Zang W, Jiang C, Wang J, Fan X, Wang J.
Show Full Abstract

The metabolism of L-tryptophan (TRP) regulates homeostasis, immunity, and neuronal function. Altered TRP metabolism has been implicated in the pathophysiology of various diseases of the central nervous system. TRP is metabolized through two main pathways, the kynurenine pathway and the methoxyindole pathway. First, TRP is metabolized to kynurenine, then kynurenic acid, quinolinic acid, anthranilic acid, 3-hydroxykynurenine, and finally 3-hydroxyanthranilic acid along the kynurenine pathway. Second, TRP is metabolized to serotonin and melatonin along the methoxyindole pathway. In this review, we summarize the biological properties of key metabolites and their pathogenic functions in 12 disorders of the central nervous system: schizophrenia, bipolar disorder, major depressive disorder, spinal cord injury, traumatic brain injury, ischemic stroke, intracerebral hemorrhage, multiple sclerosis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease. Furthermore, we summarize preclinical and clinical studies, mainly since 2015, that investigated the metabolic pathway of TRP, focusing on changes in biomarkers of these neurologic disorders, their pathogenic implications, and potential therapeutic strategies targeting this metabolic pathway. This critical, comprehensive, and up-to-date review helps identify promising directions for future preclinical, clinical, and translational research on neuropsychiatric disorders.

SOX6
Also flagged:Neurodegenerative DiseasesSIRT1SIRT7metabolismdeacylaseadenosine diphosphate (ADP)-ribosyltransferase
Journal Article 2023-06-01 ✓ 1 Snippet Xu H, Liu YY, Li LS, Liu YS.
In-Text Gene Mentions

…the activity ofSox6[ 250 ,…

Show Full Abstract

Sirtuins (SIRT1-SIRT7), a family of nicotinamide adenine dinucleotide (NAD<sup>+</sup>)-dependent enzymes, are key regulators of life span and metabolism. In addition to acting as deacetylates, some sirtuins have the properties of deacylase, decrotonylase, adenosine diphosphate (ADP)-ribosyltransferase, lipoamidase, desuccinylase, demalonylase, deglutarylase, and demyristolyase. Mitochondrial dysfunction occurs early on and acts causally in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD). Sirtuins are implicated in the regulation of mitochondrial quality control, which is highly associated with the pathogenesis of neurodegenerative diseases. There is growing evidence indicating that sirtuins are promising and well-documented molecular targets for the treatment of mitochondrial dysfunction and neurodegenerative disorders by regulating mitochondrial quality control, including mitochondrial biogenesis, mitophagy, mitochondrial fission/fusion dynamics, and mitochondrial unfolded protein responses (mtUPR). Therefore, elucidation of the molecular etiology of sirtuin-mediated mitochondrial quality control points to new prospects for the treatment of neurodegenerative diseases. However, the mechanisms underlying sirtuin-mediated mitochondrial quality control remain obscure. In this review, we update and summarize the current understanding of the structure, function, and regulation of sirtuins with an emphasis on the cumulative and putative effects of sirtuins on mitochondrial biology and neurodegenerative diseases, particularly their roles in mitochondrial quality control. In addition, we outline the potential therapeutic applications for neurodegenerative diseases of targeting sirtuin-mediated mitochondrial quality control through exercise training, calorie restriction, and sirtuin modulators in neurodegenerative diseases.

Also flagged:endocrine diseasegrowth disordersmetabolic bone diseasetype 1type 2diabetes mellitus
Journal Article 2023-06-01 No Snippets Diaz-Thomas AM, Golden SH, Dabelea DM, Grimberg A, Magge SN, Safer JD, Shumer DE, Stanford FC.
Show Full Abstract

Endocrine care of pediatric and adult patients continues to be plagued by health and health care disparities that are perpetuated by the basic structures of our health systems and research modalities, as well as policies that impact access to care and social determinants of health. This scientific statement expands the Society's 2012 statement by focusing on endocrine disease disparities in the pediatric population and sexual and gender minority populations. These include pediatric and adult lesbian, gay, bisexual, transgender, queer, intersex, and asexual (LGBTQIA) persons. The writing group focused on highly prevalent conditions-growth disorders, puberty, metabolic bone disease, type 1 (T1D) and type 2 (T2D) diabetes mellitus, prediabetes, and obesity. Several important findings emerged. Compared with females and non-White children, non-Hispanic White males are more likely to come to medical attention for short stature. Racially and ethnically diverse populations and males are underrepresented in studies of pubertal development and attainment of peak bone mass, with current norms based on European populations. Like adults, racial and ethnic minority youth suffer a higher burden of disease from obesity, T1D and T2D, and have less access to diabetes treatment technologies and bariatric surgery. LGBTQIA youth and adults also face discrimination and multiple barriers to endocrine care due to pathologizing sexual orientation and gender identity, lack of culturally competent care providers, and policies. Multilevel interventions to address these disparities are required. Inclusion of racial, ethnic, and LGBTQIA populations in longitudinal life course studies is needed to assess growth, puberty, and attainment of peak bone mass. Growth and development charts may need to be adapted to non-European populations. In addition, extension of these studies will be required to understand the clinical and physiologic consequences of interventions to address abnormal development in these populations. Health policies should be recrafted to remove barriers in care for children with obesity and/or diabetes and for LGBTQIA children and adults to facilitate comprehensive access to care, therapeutics, and technological advances. Public health interventions encompassing collection of accurate demographic and social needs data, including the intersection of social determinants of health with health outcomes, and enactment of population health level interventions will be essential tools.

NEGR1DNAH10CCDC92
Also flagged:thyroid hormone transporterSLC17A4hormone metabolising enzymeAADATthyroxinegene expression
Journal Article 2023-06-01 ✓ 4 Snippets Pereira Ciochetti N, Lugli-Moraes B, Santos da Silva B, Rovaris DL.
In-Text Gene Mentions

neuronal growth regulator 1

NEGR1

CCDC92

DNAH10

Show Full Abstract

Physiological systems are subject to interindividual variation encoded by genetics. Genome-wide association studies (GWAS) operate by surveying thousands of genetic variants from a substantial number of individuals and assessing their association to a trait of interest, be it a physiological variable, a molecular phenotype (e.g. gene expression), or even a disease or condition. Through a myriad of methods, GWAS downstream analyses then explore the functional consequences of each variant and attempt to ascertain a causal relationship to the phenotype of interest, as well as to delve into its links to other traits. This type of investigation allows mechanistic insights into physiological functions, pathological disturbances and shared biological processes between traits (i.e. pleiotropy). An exciting example is the discovery of a new thyroid hormone transporter (SLC17A4) and hormone metabolising enzyme (AADAT) from a GWAS on free thyroxine levels. Therefore, GWAS have substantially contributed with insights into physiology and have been shown to be useful in unveiling the genetic control underlying complex traits and pathological conditions; they will continue to do so with global collaborations and advances in genotyping technology. Finally, the increasing number of trans-ancestry GWAS and initiatives to include ancestry diversity in genomics will boost the power for discoveries, making them also applicable to non-European populations.

PEBP1
Also flagged:secretionoxygenP. micra infectionscancer of themalignant tumourP. micra infection
Journal Article 2023-06-01 ✓ 1 Snippet Hatta MNA, Mohamad Hanif EA, Chin SF, Low TY, Neoh HM.
In-Text Gene Mentions

…own-regulated proteins (PRDX1,PEBP1, FLNA, EPS8, YWHAG,…

Show Full Abstract

The gut microbiota Parvimonas micra has been found to be enriched in gut mucosal tissues and fecal samples of colorectal cancer (CRC) patients compared with non-CRC controls. In the present study, we investigated the tumorigenic potential of P. micra and its regulatory pathways in CRC using HT-29, a low-grade CRC intestinal epithelial cell. For every P. micra-HT-29 interaction assay, HT-29 was co-cultured anaerobically with P. micra at an MOI of 100:1 (bacteria: cells) for 2 h. We found that P. micra increased HT-29 cell proliferation by 38.45% (P=0.008), with the highest wound healing rate at 24 h post-infection (P=0.02). In addition, inflammatory marker expression (IL-5, IL-8, CCL20, and CSF2) was also significantly induced. Shotgun proteomics profiling analysis revealed that P. micra affects the protein expression of HT-29 (157 up-regulated and 214 down-regulated proteins). Up-regulation of PSMB4 protein and its neighbouring subunits revealed association of the ubiquitin-proteasome pathway (UPP) in CRC carcinogenesis; whereas down-regulation of CUL1, YWHAH, and MCM3 signified cell cycle dysregulation. Moreover, 22 clinically relevant epithelial-mesenchymal transition (EMT)-markers were expressed in HT-29 infected with P. micra. Overall, the present study elucidated exacerbated oncogenic properties of P. micra in HT-29 via aberrant cell proliferation, enhanced wound healing, inflammation, up-regulation of UPPs, and activation of EMT pathways.

HTT
Also flagged:translation factorselectron transportobesitychildhood obesitymetabolic disorderssugar
Journal Article 2023-06-01 ✓ 1 Snippet Murashov AK, Pak ES, Mar J, O'Brien K, Fisher-Wellman K, Bhat KM.
In-Text Gene Mentions

Htt

Show Full Abstract

Several lines of evidence indicate that ancestral diet might play an important role in determining offspring's metabolic traits. However, it is not yet clear whether ancestral diet can affect offspring's food choices and feeding behavior. In the current study, taking advantage of Drosophila model system, we demonstrate that paternal Western diet (WD) increases offspring food consumption up to the fourth generation. Paternal WD also induced alterations in F1 offspring brain proteome. Using enrichment analyses of pathways for upregulated and downregulated proteins, we found that upregulated proteins had significant enrichments in terms related to translation and translation factors, whereas downregulated proteins displayed enrichments in small molecule metabolic processes, TCA cycles, and electron transport chain (ETC). Using MIENTURNET miRNA prediction tool, dme-miR-10-3p was identified as the top conserved miRNA predicted to target proteins regulated by ancestral diet. RNAi-based knockdown of miR-10 in the brain significantly increased food consumption, implicating miR-10 as a potential factor in programming feeding behavior. Together, these findings suggest that ancestral nutrition may influence offspring feeding behavior through alterations in miRNAs.

OLFM4
Also flagged:agingangiotensin converting enzymesACEACE2angiotensinsAT1 receptor
Journal Article 2023-06-01 ✓ 2 Snippets Chittimalli K, Jahan J, Sakamuri A, McAdams ZL, Ericsson AC, Jarajapu YPR.
In-Text Gene Mentions

Olfactomedin-4

Olfm4

Show Full Abstract

Compromised barrier function of colon epithelium with aging is largely due to gut microbial dysbiosis. Recent studies implicate an important role for angiotensin converting enzymes, ACE and ACE2, angiotensins, and the receptors, AT1 receptor (AT1R) and Mas receptor (MasR), in the regulation of colon functions. The present study tested the hypothesis that leaky gut in aging is associated with an imbalance in ACE2/ACE and that the treatment with angiotenisn-(1-7) (Ang-(1-7)) will restore gut barrier integrity and microbiome. Studies were carried out in Young (3-4 months) and old (20-24 months) male mice. Ang-(1-7) was administered by using osmotic pumps. Outcome measures included expressions of ACE, ACE2, AT1R, and MasR, intestinal permeability by using FITC-dextran, and immunohistochemistry of claudin 1 and occludin, and intestinal stem cells (ISCs). ACE2 protein and activity were decreased in Old group while that of ACE were unchanged. Increased intestinal permeability and plasma levels of zonulin-1 in the Old group were normalized by Ang-(1-7). Epithelial disintegrity, reduced number of goblet cells and ISCs in the old group were restored by Ang-(1-7). Expression of claudin 1 and occludin in the aging colon was increased by Ang-(1-7). Infiltration of CD11b+ or F4/80+ inflammatory cells in the old colons were decreased by Ang-(1-7). Gut microbial dysbiosis in aging was evident by decreased richness and altered beta diversity that were reversed by Ang-(1-7) with increased abundance of Lactobacillus or Lachnospiraceae. The present study shows that Ang-(1-7) restores gut barrier integrity and reduces inflammation in the aging colon by restoring the layer of ISCs and by restructuring the gut microbiome.

Also flagged:major depressive disordergeneralized anxiety disorderneuroticismpsychiatric illnessesschizophreniaattention-deficit/hyperactivity disorder
Journal Article 2023-06-01 No Snippets Jung K, Yoon J, Ahn Y, Kim S, Shim I, Ko H, Jung SH, Kim J, Kim H, Lee DJ, Cha S, Lee H, Kim B, Cho MY, Cho H, Kim DS, Kim J, Park WY, Park TH, O Connell KS, Andreassen OA, Myung W, Won HH.
Show Full Abstract

Irritability is a heritable core mental trait associated with several psychiatric illnesses. However, the genomic basis of irritability is unclear. Therefore, this study aimed to 1) identify the genetic variants associated with irritability and investigate the associated biological pathways, genes, and tissues as well as single-nucleotide polymorphism (SNP)-based heritability; 2) explore the relationships between irritability and various traits, including psychiatric disorders; and 3) identify additional and shared genetic variants for irritability and psychiatric disorders. We conducted a genome-wide association study (GWAS) using 379,506 European samples (105,975 cases and 273,531 controls) from the UK Biobank. We utilized various post-GWAS analyses, including linkage disequilibrium score regression, the bivariate causal mixture model (MiXeR), and conditional and conjunctional false discovery rate approaches. This GWAS identified 15 independent loci associated with irritability; the total SNP heritability estimate was 4.19%. Genetic correlations with psychiatric disorders were most pronounced for major depressive disorder (MDD) and bipolar II disorder (BD II). MiXeR analysis revealed polygenic overlap with schizophrenia (SCZ), bipolar I disorder (BD I), and MDD. Conditional false discovery rate analyses identified additional loci associated with SCZ (number [n] of additional SNPs = 105), BD I (n = 54), MDD (n = 107), and irritability (n = 157). Conjunctional false discovery rate analyses identified 85, 41, and 198 shared loci between irritability and SCZ, BD I, and MDD, respectively. Multiple genetic loci were associated with irritability and three main psychiatric disorders. Given that irritability is a cross-disorder trait, these findings may help to elucidate the genomics of psychiatric disorders.

Also flagged:Arp2brain disordersCyfip1Sra1Nap1Nckap1
Journal Article 2023-06-01 No Snippets Han KA, Ko J.
Show Full Abstract

The WAVE regulatory complex (WRC), composed of five components-Cyfip1/Sra1, WAVE/Scar, Abi, Nap1/Nckap1, and Brk1/HSPC300-is essential for proper actin cytoskeletal dynamics and remodeling in eukaryotic cells, likely by matching various patterned signals to Arp2/3-mediated actin nucleation. Accumulating evidence from recent studies has revealed diverse functions of the WRC in neurons, demonstrating its crucial role in dictating the assembly of molecular complexes for the patterning of various trans-synaptic signals. In this review, we discuss recent exciting findings on the physiological role of the WRC in regulating synaptic properties and highlight the involvement of WRC dysfunction in various brain disorders.

HTT
Also flagged:axonalorganellescell bodysynapseendosomesautophagosomes
Journal Article 2023-06-01 ✓ 5 Snippets Berth SH, Lloyd TE.
In-Text Gene Mentions

Additionally, Htt is regulated via PTMs, and altered PTM regulation of mutant Htt may play an important role in HD pathogenesis.

HD is thought to be caused by gain-of-function and dominant-negative effects of mutant Htt, in addition to loss of wild-type Htt function (92).

Htt is phosphorylated by the kinase Akt at S421 to promote anterograde trafficking of APP, and this Akt/Htt pathway has been shown to be downregulated in HD brains (107).

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG repeat expansions in the huntingtin gene (HTT), leading to degeneration initially in the striatum that spreads to cortical areas in the brain.

Furthermore, Htt is dimethylated by protein arginine methyltransferase 6 (PRMT6) to facilitate axonal transport, and S-adenosylhomocysteine, which regulates PRMT6, is downregulated in HD models.

Show Full Abstract

Neurons are markedly compartmentalized, which makes them reliant on axonal transport to maintain their health. Axonal transport is important for anterograde delivery of newly synthesized macromolecules and organelles from the cell body to the synapse and for the retrograde delivery of signaling endosomes and autophagosomes for degradation. Dysregulation of axonal transport occurs early in neurodegenerative diseases and plays a key role in axonal degeneration. Here, we provide an overview of mechanisms for regulation of axonal transport; discuss how these mechanisms are disrupted in neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, Huntington's disease, hereditary spastic paraplegia, amyotrophic lateral sclerosis, and Charcot-Marie-Tooth disease; and discuss therapeutic approaches targeting axonal transport.

Also flagged:capsulecapsulesbariumalginateBarium chloridesodium alginate
Journal Article 2023-06-01 No Snippets Tan ZL, Yasuura M, Horiguchi Y, Ashiba H, Fukuda T.
Show Full Abstract

Droplet digital PCR (ddPCR) is accurate in nucleic acid quantification owing to its linearity and high sensitivity. Amplification of nucleic acid in droplets, however, is limited by the stability of droplets against thermal cycling. While the use of fluorinated oil or supplementation of surfactant could improve the stability of droplets, this process has also greatly increased the cost of ddPCR and limited post-PCR analysis. Here, we report a novel method known as gel capsule-based digital PCR (gc-dPCR) which includes a method to prepare hydrogel capsules encapsulating the PCR reaction mix, conducting PCR reaction, and readout by either quantitative PCR (qPCR) system or fluorescence microplate reader. We have compared the developed method to vortex ddPCR. Our approach results in higher fluorescence intensity compared to ddPCR suggesting higher sensitivity of the system. As hydrogel capsules are more stable than droplets in fluorinated oil throughout thermal cycling, all partitions can be quantified, thus preventing loss of information from low-concentration samples. The new approach should extend to all droplet-based PCR methods. It has greatly improved ddPCR by increasing droplets stability and sensitivity, and reducing the cost of ddPCR, which help to remove the barrier of ddPCR in settings with limited resources.

HTT
Also flagged:Acute Coronary SyndromesticagrelorclopidogrelAspirinthrombotic diseaseThrombosis
Journal Article 2023-06-01 ✓ 1 Snippet Shpigelman J, Proshkina A, Daly MJ, Cox D, Cox D.
In-Text Gene Mentions

For instance, a common variant of the serotonin transporter (5-HTT), one of whose role is to take up serotonin into platelets for storage in dense granules, appears to attenuate the response to aspirin by increasing basal platelet activity [114].

Show Full Abstract

<h4>Purpose of review</h4>Dual antiplatelet therapy (DAPT)-aspirin in conjunction with a P2Y<sub>12</sub> inhibitor-is the cornerstone of managing patients with acute coronary syndromes post-revascularization, but the clinical response is highly variable, with potentially devastating consequences. Herein, we review the mechanisms underpinning said variability and explore emerging approaches to normalizing therapeutic benefit.<h4>Recent findings</h4>The potent P2Y<sub>12</sub> inhibitors, prasugrel and ticagrelor, exhibit minimal inter-individual variability, replacing clopidogrel in DAPT and achieving greater rates of therapeutic response. However, these benefits decline in later phases when bleeding risk begins to supersede that of ischemia. Guided de-escalation of P2Y<sub>12</sub> inhibition as well as shortening DAPT duration have emerged as strategies that retain antithrombotic efficacy while reducing bleeding risk. Aspirin is the other component of DAPT but is also used in isolation for secondary prevention of thrombotic disease. In contrast to the P2Y<sub>12</sub> inhibitors, genetic influences on aspirin non-response appear to be outweighed by a triad of clinical factors: non-adherence, enteric aspirin use, and inappropriate dosing according to bodyweight and BMI. Multiple de-escalation strategies for DAPT have been shown to mitigate bleeding risk, but it remains unclear which approach is ideal, necessitating head-to-head investigations to determine which exhibits the most favorable cost-to-benefit ratio. However, there is likely a role for more than one approach in clinical practice, depending on patient risk profile. Our approach to aspirin use is also in need of reassessment: strategies to improve adherence, avoidance of enteric aspirin in cardiac patients, and dose adjustment according to bodyweight and/or BMI are all likely to improve rates of therapeutic response. Moreover, platelet function testing may have a role in identifying patients expected to benefit from primary prophylactic aspirin.

HTT
Also flagged:E.2deathzoonosesinfluenzaother infectious diseasesformalin
Journal Article 2023-06-01 ✓ 4 Snippets Unknown Authors
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disease caused by CAG trinucleotide repeats in the huntingtin (HTT) gene on chromosome 4.

… in the huntingtin (HTT) gene on chromosome…

…or mutations in the HTT gene is anti-sense …

…h leads to a reduced amount of mutant HTT. …

Show Full Abstract

No abstract available.

OLFM4
Also flagged:immune responsesSmad4dextran sulfate sodiumazoxymethanestem cell proliferationSmad2
Journal Article 2023-06-01 ✓ 1 Snippet Liu L, Wang Y, Yu S, Liu H, Li Y, Hua S, Chen YG.
In-Text Gene Mentions

…expanded number ofOlfm4+ stem cells…

Show Full Abstract

Transforming growth factor beta (TGF-β), a multifunctional cytokine, plays critical roles in immune responses. However, the precise role of TGF-β in colitis and colitis-associated cancer remains poorly defined. Here, it is demonstrated that TGF-β promotes the colonic inflammation and related tumorigenesis in the absence of Smad family member 4 (Smad4). Smad4 loss in intestinal epithelium aggravates colitis and colitis-associated neoplasia induced by dextran sulfate sodium (DSS) and azoxymethane/dextran sulfate sodium (AOM/DSS), leading to over-activated immune responses and increased TGF-β1 levels. In Smad4-deficient organoids, TGF-β1 stimulates spheroid formation and impairs intestinal stem cell proliferation and lineage specification. YAP, whose expression is directly upregulated by TGF-β1 after Smad4 deletion, mediates the effect of TGF-β1 by interacting with Smad2/3. Attenuation of YAP/TAZ prevents TGF-β1-induced spheroid formation in Smad4<sup>-/-</sup> organoids and alleviates colitis and colitis-associated cancer in Smad4-deficient mice. Collectively, these results highlight an integral role of the TGF-β/Smad4 axis in restraining intestinal inflammation and tumorigenesis and suggest TGF-β or YAP signaling as therapeutic targets for these gastrointestinal diseases intervention.

OLFM4
Also flagged:inflammatory diseasesepsisInflammatory Bowel DiseasecytokineUlcerative colitisCD
Journal Article 2023-06-01 ✓ 2 Snippets Marr EE, Mulhern TJ, Welch M, Keegan P, Caballero-Franco C, Johnson BG, Kasaian M, Azizgolshani H, Petrie T, Charest J, Wiellette E.
In-Text Gene Mentions

…LGR5, KI67, andOLFM4(Fig. 2 C;…

…(ASCL2, KI67, LGR5,OLFM4).…

Show Full Abstract

The intestinal epithelium comprises diverse cell types and executes many specialized functions as the primary interface between luminal contents and internal organs. A key function provided by the epithelium is maintenance of a barrier that protects the individual from pathogens, irritating luminal contents, and the microbiota. Disruption of this barrier can lead to inflammatory disease within the intestinal mucosa, and, in more severe cases, to sepsis. Animal models to study intestinal permeability are costly and not entirely predictive of human biology. Here we present a model of human colon barrier function that integrates primary human colon stem cells into Draper's PREDICT96 microfluidic organ-on-chip platform to yield a high-throughput system appropriate to predict damage and healing of the human colon epithelial barrier. We have demonstrated pharmacologically induced barrier damage measured by both a high throughput molecular permeability assay and transepithelial resistance. Using these assays, we developed an Inflammatory Bowel Disease-relevant model through cytokine induced damage that can support studies of disease mechanisms and putative therapeutics.

SUDS3CDK5RAP1
Also flagged:PSAProstate-specific antigenprostate cancertumorscanceradult diseases
Journal Article 2023-06-01 ✓ 3 Snippets Kachuri L, Hoffmann TJ, Jiang Y, Berndt SI, Shelley JP, Schaffer KR, Machiela MJ, Freedman ND, Huang WY, Li SA, Easterlin R, Goodman PJ, Till C, Thompson I, Lilja H, Van Den Eeden SK, Chanock SJ, Haiman CA, Conti DV, Klein RJ, Mosley JD, Graff RE, Witte JS.
In-Text Gene Mentions

…novel findings includedCDK5RAP1(rs291671, P =…

…10 −13 ),SUDS3(rs1045542, P =…

…, HMGA2 andSUDS3.…

Show Full Abstract

Prostate-specific antigen (PSA) screening for prostate cancer remains controversial because it increases overdiagnosis and overtreatment of clinically insignificant tumors. Accounting for genetic determinants of constitutive, non-cancer-related PSA variation has potential to improve screening utility. In this study, we discovered 128 genome-wide significant associations (P < 5 × 10<sup>-8</sup>) in a multi-ancestry meta-analysis of 95,768 men and developed a PSA polygenic score (PGS<sub>PSA</sub>) that explains 9.61% of constitutive PSA variation. We found that, in men of European ancestry, using PGS-adjusted PSA would avoid up to 31% of negative prostate biopsies but also result in 12% fewer biopsies in patients with prostate cancer, mostly with Gleason score <7 tumors. Genetically adjusted PSA was more predictive of aggressive prostate cancer (odds ratio (OR) = 3.44, P = 6.2 × 10<sup>-14</sup>, area under the curve (AUC) = 0.755) than unadjusted PSA (OR = 3.31, P = 1.1 × 10<sup>-12</sup>, AUC = 0.738) in 106 cases and 23,667 controls. Compared to a prostate cancer PGS alone (AUC = 0.712), including genetically adjusted PSA improved detection of aggressive disease (AUC = 0.786, P = 7.2 × 10<sup>-4</sup>). Our findings highlight the potential utility of incorporating PGS for personalized biomarkers in prostate cancer screening.

POU3F2MMS22L
Also flagged:inflammatory responsesanti-inflammatory cytokineIl10cystic fibrosisasthmachronic obstructive pulmonary disease
Journal Article 2023-06-01 ✓ 5 Snippets Chung CJ, Hermes BM, Gupta Y, Ibrahim S, Belheouane M, Baines JF.
In-Text Gene Mentions
⭐ same-sentence co-mention

However, several genes are found within the confidence interval, including Pou3f2 and Mms22l. POU family transcription factors were previously shown to be highly expressed in small-cell lung carcinoma (SCLC) cell lines and to contribute to neuroendorcrine differentiation in non-small cell lung carcinoma (NSCLC) cell lines[63].

⭐ same-sentence co-mention

Based on these observations, both Pou3f2 and Mms22l might serve as cancer therapy targets, which could be aided by the mechanistic understanding of a possible interaction with Pelomonas.

MMS22L was found to be over-expressed in clinical and esophageal cancers, playing a role in growth and survival of cancer cells [64].

Additionally, POU transcription factors are specifically expressed in small cell lung cancer (SCLC), contributing to accelerating cell growth, and POU3F2 was revealed to maintain the proneuronal/neuroendocrine phenotype of SCLC [125].

⭐ same-sentence co-mention

…confidence interval, includingPou3f2and Mms22l .…

Show Full Abstract

<h4>Background</h4>Mammalian lungs comprise a complex microbial ecosystem that interacts with host physiology. Previous research demonstrates that the environment significantly contributes to bacterial community structure in the upper and lower respiratory tract. However, the influence of host genetics on the makeup of lung microbiota remains ambiguous, largely due to technical difficulties related to sampling, as well as challenges inherent to investigating low biomass communities. Thus, innovative approaches are warranted to clarify host-microbe interactions in the mammalian lung.<h4>Results</h4>Here, we aimed to characterize host genomic regions associated with lung bacterial traits in an advanced intercross mouse line (AIL). By performing quantitative microbial profiling (QMP) using the highly precise method of droplet digital PCR (ddPCR), we refined 16S rRNA gene amplicon-based traits to identify and map candidate lung-resident taxa using a QTL mapping approach. In addition, the two abundant core taxa Lactobacillus and Pelomonas were chosen for independent microbial phenotyping using genus-specific primers. In total, this revealed seven significant loci involving eight bacterial traits. The narrow confidence intervals afforded by the AIL population allowed us to identify several promising candidate genes related to immune and inflammatory responses, cell apoptosis, DNA repair, and lung functioning and disease susceptibility. Interestingly, one genomic region associated with Lactobacillus abundance contains the well-known anti-inflammatory cytokine Il10, which we confirmed through the analysis of Il10 knockout mice.<h4>Conclusions</h4>Our study provides the first evidence for a role of host genetic variation contributing to variation in the lung microbiota. This was in large part made possible through the careful curation of 16S rRNA gene amplicon data and the incorporation of a QMP-based methods. This approach to evaluating the low biomass lung environment opens new avenues for advancing lung microbiome research using animal models.

DCC
Also flagged:5-Azacytidineretinoic-acidcancerchromatinmethylationretinoic acid receptor
Journal Article 2023-06-01 ✓ 5 Snippets Singh DK, Singh DK, Carcamo S, Farias EF, Hasson D, Zheng W, Sun D, Huang X, Cheung J, Nobre AR, Kale N, Sosa MS, Bernstein E, Aguirre-Ghiso JA.
In-Text Gene Mentions

…tly, genetically heterogeneousDCCpopulations appear to…

…events, and thusDCCbiology, may be…

…inducing and maintainingDCCdormancy.…

…showed that TGF-β2-inducedDCCdormancy in the…

…previously implicated inDCCdormancy in the…

Show Full Abstract

Disseminated cancer cells (DCCs) in secondary organs can remain dormant for years to decades before reactivating into overt metastasis. Microenvironmental signals leading to cancer cell chromatin remodeling and transcriptional reprogramming appear to control onset and escape from dormancy. Here, we reveal that the therapeutic combination of the DNA methylation inhibitor 5-azacytidine (AZA) and the retinoic acid receptor ligands all-trans retinoic acid (atRA) or AM80, an RARα-specific agonist, promotes stable dormancy in cancer cells. Treatment of head and neck squamous cell carcinoma (HNSCC) or breast cancer cells with AZA+atRA induces a SMAD2/3/4-dependent transcriptional program that restores transforming growth factor β (TGF-β)-signaling and anti-proliferative function. Significantly, either combination, AZA+atRA or AZA+AM80, strongly suppresses HNSCC lung metastasis formation by inducing and maintaining solitary DCCs in a SMAD4<sup>+</sup>/NR2F1<sup>+</sup> non-proliferative state. Notably, SMAD4 knockdown is sufficient to drive resistance to AZA+atRA-induced dormancy. We conclude that therapeutic doses of AZA and RAR agonists may induce and/or maintain dormancy and significantly limit metastasis development.

Also flagged:airway diseasecystic fibrosis transmembrane conductance regulatorCFTRchromatinimmune responselung disease
Journal Article 2023-06-01 No Snippets Kerschner JL, Paranjapye A, Harris A.
Show Full Abstract

The airway epithelial cell line, 16HBE14o<sup>-</sup> , is an important cell model for studying airway disease. 16HBE14o<sup>-</sup> cells were originally generated from primary human bronchial epithelial cells by SV40-mediated immortalization, a process that is associated with genomic instability through long-term culture. Here, we explore the heterogeneity of these cells, with respect to expression of the cystic fibrosis transmembrane conductance regulator (CFTR) transcript and protein. We isolate clones of 16HBE14o<sup>-</sup> with stably higher and lower levels of CFTR in comparison to bulk 16HBE14o<sup>-</sup> , designated CFTR<sup>high</sup> and CFTR<sup>low</sup> . Detailed characterization of the CFTR locus in these clones by ATAC-seq and 4C-seq showed open chromatin profiles and higher order chromatin structure that correlate with CFTR expression levels. Transcriptomic profiling of CFTR<sup>high</sup> and CFTR<sup>low</sup> cells showed that the CFTR<sup>high</sup> cells had an elevated inflammatory/innate immune response phenotype. These results encourage caution in interpreting functional data from clonal lines of 16HBE14o<sup>-</sup> cells, generated after genomic or other manipulations.

Also flagged:bindingcarbonmacromoleculetranslationalamino acidprotein tyrosine phosphatase
Journal Article 2023-06-01 No Snippets Maschietto F, Allen B, Kyro GW, Batista VS.
Show Full Abstract

Many biological processes are regulated by allosteric mechanisms that communicate with distant sites in the protein responsible for functionality. The binding of a small molecule at an allosteric site typically induces conformational changes that propagate through the protein along allosteric pathways regulating enzymatic activity. Elucidating those communication pathways from allosteric sites to orthosteric sites is, therefore, essential to gain insights into biochemical processes. Targeting the allosteric pathways by mutagenesis can allow the engineering of proteins with desired functions. Furthermore, binding small molecule modulators along the allosteric pathways is a viable approach to target reactions using allosteric inhibitors/activators with temporal and spatial selectivity. Methods based on network theory can elucidate protein communication networks through the analysis of pairwise correlations observed in molecular dynamics (MD) simulations using molecular descriptors that serve as proxies for allosteric information. Typically, single atomic descriptors such as α-carbon displacements are used as proxies for allosteric information. Therefore, allosteric networks are based on correlations revealed by that descriptor. Here, we introduce a Python software package that provides a comprehensive toolkit for studying allostery from MD simulations of biochemical systems. MDiGest offers the ability to describe protein dynamics by combining different approaches, such as correlations of atomic displacements or dihedral angles, as well as a novel approach based on the correlation of Kabsch-Sander electrostatic couplings. MDiGest allows for comparisons of networks and community structures that capture physical information relevant to allostery. Multiple complementary tools for studying essential dynamics include principal component analysis, root mean square fluctuation, as well as secondary structure-based analyses.

Also flagged:CRISPRCas9 nucleasesCRISPR type IInucleasesSpCas9nuclease
Journal Article 2023-06-01 No Snippets Alexander LM, Aliaga Goltsman DS, Liu J, Lin JL, Temoche-Diaz MM, Laperriere SM, Neerincx A, Bednarski C, Knyphausen P, Cohnen A, Albers J, Gonzalez-Osorio L, Fregoso Ocampo R, Oki J, Devoto AE, Castelle CJ, Lamothe RC, Cost GJ, Butterfield CN, Thomas BC, Brown CT.
Show Full Abstract

Type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 nucleases have been extensively used in biotechnology and therapeutics. However, many applications are not possible owing to the size, targetability, and potential off-target effects associated with currently known systems. In this study, we identified thousands of CRISPR type II effectors by mining an extensive, genome-resolved metagenomics database encompassing hundreds of thousands of microbial genomes. We developed a high-throughput pipeline that enabled us to predict tracrRNA sequences, to design single guide RNAs, and to demonstrate nuclease activity <i>in vitro</i> for 41 newly described subgroups. Active systems represent an extensive diversity of protein sequences and guide RNA structures and require diverse protospacer adjacent motifs (PAMs) that collectively expand the known targeting capability of current systems. Several nucleases showed activity levels comparable to or significantly higher than SpCas9, despite being smaller in size. In addition, top systems exhibited low levels of off-target editing in mammalian cells, and PAM-interacting domain engineered chimeras further expanded their targetability. These newly discovered nucleases are attractive enzymes for translation into many applications, including therapeutics.

HFE
Also flagged:transportersironmetalsbindingtransporterABC transporters
Journal Article 2023-06-01 ✓ 1 Snippet Ray S, Gaudet R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

A repertoire of transporters plays a crucial role in maintaining homeostasis of biologically essential transition metals, manganese, and iron, thus ensuring cell viability. Elucidating the structure and function of many of these transporters has provided substantial understanding into how these proteins help maintain the optimal cellular concentrations of these metals. In particular, recent high-resolution structures of several transporters bound to different metals enable an examination of how the coordination chemistry of metal ion-protein complexes can help us understand metal selectivity and specificity. In this review, we first provide a comprehensive list of both specific and broad-based transporters that contribute to cellular homeostasis of manganese (Mn2+) and iron (Fe2+ and Fe3+) in bacteria, plants, fungi, and animals. Furthermore, we explore the metal-binding sites of the available high-resolution metal-bound transporter structures (Nramps, ABC transporters, P-type ATPase) and provide a detailed analysis of their coordination spheres (ligands, bond lengths, bond angles, and overall geometry and coordination number). Combining this information with the measured binding affinity of the transporters towards different metals sheds light into the molecular basis of substrate selectivity and transport. Moreover, comparison of the transporters with some metal scavenging and storage proteins, which bind metal with high affinity, reveal how the coordination geometry and affinity trends reflect the biological role of individual proteins involved in the homeostasis of these essential transition metals.

CDK5RAP1
Also flagged:amino acidsriboflavinsexual reproductionhemenucleotidesgall
Journal Article 2023-06-01 ✓ 2 Snippets Fiutek N, Couger MB, Pirro S, Roy SW, de la Torre JR, Connor EF.
In-Text Gene Mentions

…that the geneCDK5RAP1in animals is…

…homologs of theCDK5RAP1gene are widespread…

Show Full Abstract

We explored the genome of the <i>Wolbachia</i> strain, <i>w</i>Esol, symbiotic with the plant-gall-inducing fly <i>Eurosta solidaginis</i> with the goal of determining if <i>w</i>Esol contributes to gall induction by its insect host. Gall induction by insects has been hypothesized to involve the secretion of the phytohormones cytokinin and auxin and/or proteinaceous effectors to stimulate cell division and growth in the host plant. We sequenced the metagenome of <i>E. solidaginis</i> and <i>w</i>Esol and assembled and annotated the genome of <i>w</i>Esol. The <i>w</i>Esol genome has an assembled length of 1.66 Mbp and contains 1878 protein-coding genes. The <i>w</i>Esol genome is replete with proteins encoded by mobile genetic elements and shows evidence of seven different prophages. We also detected evidence of multiple small insertions of <i>w</i>Esol genes into the genome of the host insect. Our characterization of the genome of <i>w</i>Esol indicates that it is compromised in the synthesis of dimethylallyl pyrophosphate (DMAPP) and S-adenosyl L-methionine (SAM), which are precursors required for the synthesis of cytokinins and methylthiolated cytokinins. <i>w</i>Esol is also incapable of synthesizing tryptophan, and its genome contains no enzymes in any of the known pathways for the synthesis of indole-3-acetic acid (IAA) from tryptophan. <i>w</i>Esol must steal DMAPP and L-methionine from its host and therefore is unlikely to provide cytokinin and auxin to its insect host for use in gall induction. Furthermore, in spite of its large repertoire of predicted Type IV secreted effector proteins, these effectors are more likely to contribute to the acquisition of nutrients and the manipulation of the host's cellular environment to contribute to growth and reproduction of <i>w</i>Esol than to aid <i>E. solidaginis</i> in manipulating its host plant. Combined with earlier work that shows that <i>w</i>Esol is absent from the salivary glands of <i>E. solidaginis</i>, our results suggest that <i>w</i>Esol does not contribute to gall induction by its host.

Also flagged:togene expressionregulation ofchromatinmethylationhistone
Journal Article 2023-06-01 No Snippets Recio-Vega R, Facio-Campos RA, Hernández-González SI, Olivas-Calderón E.
Show Full Abstract

The rapid growth of genomics techniques has revolutionized and impacted, greatly and positively, the knowledge of toxicology, ushering it into a "new era": the era of genomic technology (GT). This great advance permits us to analyze the whole genome, to know the gene response to toxicants and environmental stressors, and to determine the specific profiles of gene expression, among many other approaches. The aim of this work was to compile and narrate the recent research on GT during the last 2 years (2020-2022). A literature search was managed using the PubMed and Medscape interfaces on the Medline database. Relevant articles published in peer-reviewed journals were retrieved and their main results and conclusions are mentioned briefly. It is quite important to form a multidisciplinary taskforce on GT with the aim of designing and implementing a comprehensive, collaborative, and a strategic work plan, prioritizing and assessing the most relevant diseases, so as to decrease human morbimortality due to exposure to environmental chemicals and stressors.

HTT
Also flagged:PolyglutaminetransportationnucleuscytoplasmbindingPQBP1
Journal Article 2023-06-01 ✓ 5 Snippets Shimada MK.
In-Text Gene Mentions

A polyQ-containing protein, huntingtin (HTT), is known to be causative of HD.

…ntaining protein, huntingtin (HTT), is known to…

HTTis a hub…

…function of theHTTprotein [ 9…

…The information thatHTTadopts both nuclear…

Show Full Abstract

Length polymorphisms of polyglutamine (polyQs) in triplet-repeat-disease-causing genes have diversified during primate evolution despite them conferring a risk of human-specific diseases. To explain the evolutionary process of this diversification, there is a need to focus on mechanisms by which rapid evolutionary changes can occur, such as alternative splicing. Proteins that can bind polyQs are known to act as splicing factors and may provide clues about the rapid evolutionary process. PolyQs are also characterized by the formation of intrinsically disordered (ID) regions, so I hypothesized that polyQs are involved in the transportation of various molecules between the nucleus and cytoplasm to regulate mechanisms characteristic of humans such as neural development. To determine target molecules for empirical research to understand the evolutionary change, I explored protein-protein interactions (PPIs) involving the relevant proteins. This study identified pathways related to polyQ binding as hub proteins scattered across various regulatory systems, including regulation via PQBP1, VCP, or CREBBP. Nine ID hub proteins with both nuclear and cytoplasmic localization were found. Functional annotations suggested that ID proteins containing polyQs are involved in regulating transcription and ubiquitination by flexibly changing PPI formation. These findings explain the relationships among splicing complex, polyQ length variations, and modifications in neural development.

B4GALT5
Also flagged:Cleftcleft palatePax9Gli2Osr2Msx1
Journal Article 2023-06-01 ✓ 2 Snippets Chen X, Li N, Hu P, Li L, Li D, Liu H, Zhu L, Xiao J, Liu C.
In-Text Gene Mentions

…I), galactosyltransferase II (GalT-II), and β1,3-glucuronyltransfer…

…of galactosyltransferase II (GalT-II), an enzyme necessary…

Show Full Abstract

Cleft palate is one of the most common birth defects. Previous studies revealed that multiple factors, including impaired intracellular or intercellular signals, and incoordination of oral organs led to cleft palate, but were little concerned about the contribution of the extracellular matrix (ECM) during palatogenesis. Proteoglycans (PGs) are one of the important macromolecules in the ECM. They exert biological functions through one or more glycosaminoglycan (GAG) chains attached to core proteins. The family with sequence similarity 20 member b (Fam20b) are newly identified kinase-phosphorylating xylose residues that promote the correct assembly of the tetrasaccharide linkage region by creating a premise for GAG chain elongation. In this study, we explored the function of GAG chains in palate development through <i>Wnt1-Cre; Fam20b<sup>f/f</sup></i> mice, which exhibited complete cleft palate, malformed tongue, and micrognathia. In contrast, <i>Osr2-Cre; Fam20b<sup>f/f</sup></i> mice, in which <i>Fam20b</i> was deleted only in palatal mesenchyme, showed no abnormality, suggesting that failed palatal elevation in <i>Wnt1-Cre; Fam20b<sup>f/f</sup></i> mice was secondary to micrognathia. In addition, the reduced GAG chains promoted the apoptosis of palatal cells, primarily resulting in reduced cell density and decreased palatal volume. The suppressed BMP signaling and reduced mineralization indicated an impaired osteogenesis of palatine, which could be rescued partially by constitutively active <i>Bmpr1a</i>. Together, our study highlighted the key role of GAG chains in palate morphogenesis.

HFE
Also flagged:IronFerroptosisNeurodegenerationcognitive dysfunctionmovement disordersmetabolism
Journal Article 2023-06-01 ✓ 2 Snippets Cerasuolo M, Di Meo I, Auriemma MC, Trojsi F, Maiorino MI, Cirillo M, Esposito F, Polito R, Colangelo AM, Paolisso G, Papa M, Rizzo MR.
In-Text Gene Mentions

It has been demonstrated that mutations in HFE are associated with neurodegenerative diseases by increasing the production of free radicals in the brain, favoring neuroinflammation [54,55].

Given the presence and location of the HFE protein at the interface between the brain and the vasculature and the cerebrospinal fluid (CSF), where it can influence brain iron uptake [54,55], it is not a surprise that the mutant forms of HFE could contribute to iron overload in neurodegenerative disorders.

Show Full Abstract

Neurodegeneration is a multifactorial process that involves multiple mechanisms. Examples of neurodegenerative diseases are Parkinson's disease, multiple sclerosis, Alzheimer's disease, prion diseases such as Creutzfeldt-Jakob's disease, and amyotrophic lateral sclerosis. These are progressive and irreversible pathologies, characterized by neuron vulnerability, loss of structure or function of neurons, and even neuron demise in the brain, leading to clinical, functional, and cognitive dysfunction and movement disorders. However, iron overload can cause neurodegeneration. Dysregulation of iron metabolism associated with cellular damage and oxidative stress is reported as a common event in several neurodegenerative diseases. Uncontrolled oxidation of membrane fatty acids triggers a programmed cell death involving iron, ROS, and ferroptosis, promoting cell death. In Alzheimer's disease, the iron content in the brain is significantly increased in vulnerable regions, resulting in a lack of antioxidant defenses and mitochondrial alterations. Iron interacts with glucose metabolism reciprocally. Overall, iron metabolism and accumulation and ferroptosis play a significant role, particularly in the context of diabetes-induced cognitive decline. Iron chelators improve cognitive performance, meaning that brain iron metabolism control reduces neuronal ferroptosis, promising a novel therapeutic approach to cognitive impairment.

HFE
Also flagged:PioglitazoneMetforminType 2 Diabetesnonalcoholic fatty liver diseasefatty liverlipid
Journal Article 2023-06-01 ✓ 1 Snippet Jianfang F, Wanxia X, Xiling G, Jing X, Wenjuan Y, Jianrong L, Qingzhen H, Kaiyan M, Jingxuan L, Taixiong C, Qian X, Mengying L, Jie M, Qiuhe J.
In-Text Gene Mentions

…or C), alcoholism,hemochromatosis, alpha-1 antitrypsin deficien…

Show Full Abstract

<h4>Objective</h4>The aim of study was to evaluate the effect and safety of pioglitazone-metformin combined treatment in the newly diagnosed type 2 diabetes patients with nonalcoholic fatty liver disease.<h4>Methods</h4>A total of 120 newly diagnosed type 2 diabetes patients with nonalcoholic fatty liver disease from 8 centers were randomly divided into the control group (metformin hydrochloride) and the test group (pioglitazone hydrochloride and metformin hydrochloride).<h4>Results</h4>Compared to the control group, after treatment, the proportion of people with mild and moderate fatty liver increased, and the proportion of people with severe fatty liver decreased, and this change was more obvious in the population with moderate and severe fatty liver. The level of <i>γ</i>-GT decreased in both groups before and after treatment, which was statistically significant, and there was also a statistically significant difference in the level of <i>γ</i>-GT between the two groups after 24 weeks. There were no significant statistically differences in blood lipid, body weight, and waist circumference between the test group and the control group. Logistic regression analysis found that BMI is one of the risk factors for fatty liver. There was also no significant difference in the incidence of serious adverse events between the two groups (control group: 10.00% and test group: 6.67%, <i>P</i> = 0.74).<h4>Conclusion</h4>Combined treatment with pioglitazone-metformin can effectively reduce liver fat content and gamma-GT level in newly diagnosed diabetic patients with nonalcoholic fatty liver disease, and adverse events do not increase compared with the control group, showing good safety and tolerance. This trial is registered with ClinicalTrials.gov NCT03796975.

HTT
Also flagged:Sorafenibhepatocellular carcinomaskin reactioncancerdeathcancers
Journal Article 2023-06-01 ✓ 1 Snippet Nguyen DT, Nguyen DH, Nguyen VTH.
In-Text Gene Mentions

Complete responses are very rare among international studies on sorafenib monotherapy for advanced HCC.14,15 The partial response rate of the current study was 9.2%, which was higher than that of the SHARP trial (2%),7 the Asia-Pacific trial (3.3%)5 and HTT Nguyen’s study (4.5%).8 The stable disease rate was 48.0% in the current study, which was lower than the SHARP trial (71%),7 the Asia-Pacific trial (54%)5 and HTT Nguyen’s study (54.5%).8 The disease progression rate in the current study (42.9%) was higher than the SHARP trial (27%),7 the Asia-Pacific (30.7%)5 and HTT Nguyen’s study (41%).8 The overall disease control rate (57.1%) in the current study was similar to that of the study of HTT Nguyen in Vietnam (59%)8 and higher than that of the SHARP trial conducted in the US and Europe (43%).7

Show Full Abstract

<h4>Objective</h4>To evaluate the clinical outcomes following first-line treatment with sorafenib in patients with primary hepatocellular carcinoma (HCC).<h4>Methods</h4>This retrospective cohort study enrolled patients with primary HCC that had been treated with sorafenib. Their data were collected from the hospital medical records database at three time-points: after three cycles, after six cycles and at the end of the sorafenib treatment regimen. The starting dose was 800 mg/day sorafenib but this could be reduced to 600 mg/day or 400 mg/day if patients developed adverse events (AEs).<h4>Results</h4>A total of 98 patients participated in the study. Of these, nine (9.2%) had a partial response, 47 patients (48.0%) had stable disease and 42 patients (42.9%) had progressive disease. The overall disease control rate was 57.1% (56 of 98 patients). Median progression-free survival for the overall cohort was 4.7 months. The most common AEs were hand-foot skin reaction (49 of 98 patients; 50.0%), fatigue (41 of 98 patients; 41.8%), appetite loss (39 of 98 patients; 39.8%) and hepatotoxicity/transaminitis (24 of 98 patients; 24.5%). The majority of the AEs were toxicity grades 1 and 2.<h4>Conclusion</h4>Sorafenib as a first-line treatment for primary HCC patients provided survival benefits and the AEs were well tolerated by patients.

Also flagged:translationalubiquitylationubiquitinubiquitin ligasesdegradationproteasome
Journal Article 2023-06-01 No Snippets Gregor JB, Xu D, French ME.
Show Full Abstract

Protein ubiquitylation is an essential post-translational modification that regulates nearly all aspects of eukaryotic cell biology. A diverse collection of ubiquitylation signals, including an extensive repertoire of polymeric ubiquitin chains, leads to a range of different functional outcomes for the target protein. Recent studies have shown that ubiquitin chains can be branched and that branched chains have a direct impact on the stability or the activity of the target proteins they are attached to. In this mini review, we discuss the mechanisms that control the assembly and disassembly of branched chains by the enzymes of the ubiquitylation and deubiquitylation machinery. Existing knowledge regarding the activities of chain branching ubiquitin ligases and the deubiquitylases responsible for cleaving branched chains is summarized. We also highlight new findings concerning the formation of branched chains in response to small molecules that induce the degradation of otherwise stable proteins and examine the selective debranching of heterotypic chains by the proteasome-bound deubiquitylase UCH37.

DNAH10
Also flagged:asthenoteratozoospermiamitochondrialmale infertilitytetratricopeptide repeat domain 12TTC12reproduction
Journal Article 2023-06-01 ✓ 2 Snippets Meng L, Liu Q, Tan C, Xu X, He W, Hu T, Tu C, Li Y, Du J, Zhang Q, Lu G, Fan LQ, Lin G, Nie H, Zhang H, Tan YQ.
In-Text Gene Mentions

…2021 ), andDNAH10( Tu et…

…ODA), DNAH3 andDNAH10(markers of IDA),…

Show Full Abstract

<b>Introduction:</b> Tracing the genetic causes for male infertility due to asthenoteratozoospermia has revealed at least 40 causative genes, which provides valuable reference for the genetic testing of asthenoteratozoospermia in clinical practice. To identify deleterious variants in the human tetratricopeptide repeat domain 12 (TTC12) gene in a large cohort of infertile Chinese males with asthenoteratozoospermia. <b>Methods:</b> A total of 314 unrelated asthenoteratozoospermia-affected men were recruited for whole exome sequencing. The effects of the identified variants were evaluated by <i>in silico</i> analysis, and confirmed by <i>in vitro</i> experiments. Intracytoplasmic sperm injection (ICSI) was used to evaluate the efficiency of assisted reproduction technique therapy. <b>Results and Discussion:</b> Novel homozygous <i>TTC12</i> variants (c.1467_1467delG (p.Asp490Thrfs*14), c.1139_1139delA (p.His380Profs*4), and c.1117G>A (p.Gly373Arg)) were identified in three (0.96%) of the 314 cases. Three mutants were indicated to be damaging using <i>in silico</i> prediction tools, and were further confirmed by <i>in vitro</i> functional analysis. Hematoxylin and eosin staining and ultrastructural observation of the spermatozoa revealed multiple morphological abnormalities of flagella, with the absence of outer and inner dynein arms. Notably, significant mitochondrial sheath malformations were also observed in the sperm flagella. Immunostaining assays indicated that TTC12 is present throughout the flagella, and was strongly concentrated in the mid-piece in control spermatozoa. However, spermatozoa from <i>TTC12</i>-mutated individuals exhibited almost no staining intensity of TTC12 and outer and inner dynein arms components. The three men accepted ICSI treatment using their ejaculated spermatozoa, and two female partners successfully delivered healthy babies. Our findings provide direct genetic evidence that homozygous variants in <i>TTC12</i> cause male infertility with asthenoteratozoospermia by causing dynein arm complex defects and mitochondrial sheath malformations in the flagellar. We also demonstrated that TTC12 deficiency-mediated infertility could be overcome by ICSI technology.

Also flagged:acute megakaryoblastic leukemiaDown syndromeacute myeloid leukemiaAMLGATA1hematological malignancy
Journal Article 2023-06-01 No Snippets Li J, Kalev-Zylinska ML.
Show Full Abstract

Acute megakaryoblastic leukemia (AMKL) is a rare subtype of acute myeloid leukemia (AML) in which leukemic blasts have megakaryocytic features. AMKL makes up 4%-15% of newly diagnosed pediatric AML, typically affecting young children (less than 2 years old). AMKL associated with Down syndrome (DS) shows <i>GATA1</i> mutations and has a favorable prognosis. In contrast, AMKL in children without DS is often associated with recurrent and mutually exclusive chimeric fusion genes and has an unfavorable prognosis. This review mainly summarizes the unique features of pediatric non-DS AMKL and highlights the development of novel therapies for high-risk patients. Due to the rarity of pediatric AMKL, large-scale multi-center studies are needed to progress molecular characterization of this disease. Better disease models are also required to test leukemogenic mechanisms and emerging therapies.

HFE
Also flagged:Glucagon-like peptide-1 receptortype 2 diabetesHereditary hemochromatosisHHironarthritis
Journal Article 2023-06-01 ✓ 4 Snippets Bain SC, Carstensen B, Hyveled L, Seremetis S, Flindt Kreiner F, Amadid H, Clark A.
In-Text Gene Mentions

…2 diabetes andhemochromatosis: a nationwide register-based…

…mutations in theHFE(High FE 2+…

…current duration ofhemochromatosis, ddur the current…

…the date ofhemochromatosis.…

Show Full Abstract

No abstract available.

Also flagged:multiple sclerosismyelinautoimmune chronic disease of theMSmyelin sheathsgene expression
Journal Article 2023-06-01 No Snippets Maciak K, Dziedzic A, Saluk J.
Show Full Abstract

Remyelination relies on the repair of damaged myelin sheaths, involving microglia cells, oligodendrocyte precursor cells (OPCs), and mature oligodendrocytes. This process drives the pathophysiology of autoimmune chronic disease of the central nervous system (CNS), multiple sclerosis (MS), leading to nerve cell damage and progressive neurodegeneration. Stimulating the reconstruction of damaged myelin sheaths is one of the goals in terms of delaying the progression of MS symptoms and preventing neuronal damage. Short, noncoding RNA molecules, microRNAs (miRNAs), responsible for regulating gene expression, are believed to play a crucial role in the remyelination process. For example, studies showed that miR-223 promotes efficient activation and phagocytosis of myelin debris by microglia, which is necessary for the initiation of remyelination. Meanwhile, miR-124 promotes the return of activated microglia to the quiescent state, while miR-204 and miR-219 promote the differentiation of mature oligodendrocytes. Furthermore, miR-138, miR-145, and miR-338 have been shown to be involved in the synthesis and assembly of myelin proteins. Various delivery systems, including extracellular vesicles, hold promise as an efficient and non-invasive way for providing miRNAs to stimulate remyelination. This article summarizes the biology of remyelination as well as current challenges and strategies for miRNA molecules in potential diagnostic and therapeutic applications.

CACNA1E
Also flagged:PDRGene expressionangiogenesisTranscription Factortranscription factorspenicillin
Journal Article 2023-06-01 ✓ 5 Snippets Yin Y, Wu S, Niu L, Huang S.
In-Text Gene Mentions

Collectively, CACNA1A, CACNA1E, PDE1B, and CHRM3 may participate in the pathogenesis of PDR by regulating the calcium signaling pathway.

Four key genes (CACNA1A, CACNA1E, PDE1B, and CHRM3) related to PDR were identified in the grey module.

…3 D, CACNA1A,CACNA1E, phosphodiesterase 1B (PDE1B)…

…Collectively, CACNA1A,CACNA1E, PDE1B, and CHRM3…

…identified, including CACNA1A,CACNA1E, PDE1B, and CHRM3,…

Show Full Abstract

<h4>Purpose</h4>Proliferative diabetic retinopathy (PDR) is characterized by retinal new vessel formation, pointing to the importance of the antiangiogenic treatment in PDR. Hepatocyte nuclear factor 4A (HNF4A) has been highlighted to inhibit vascular endothelial growth factor (VEGF)-stimulated in vitro angiogenesis. Therefore, this study aims to elucidate the potential antiangiogenic mechanisms of HNF4A in PDR.<h4>Methods</h4>PDR-related high-throughput sequencing datasets (GSE94019, GSE102485, and GSE191210) were obtained from the Gene Expression Omnibus (GEO) database, followed by the screening of differentially expressed genes (DEGs). The protein-protein interaction (PPI) network of the candidate DEGs was constructed based on gene set enrichment analysis (GSEA) data and Search Tool for the Retrieval of Interacting Genes (STRING) data. In addition, the key genes and pathways related to angiogenesis were screened by functional enrichment analysis. Furthermore, human retinal microvascular cells were used for further in vitro validation.<h4>Results</h4>Four key genes (CACNA1A, CACNA1E, PDE1B, and CHRM3) related to PDR were identified in the grey module. CACNA1A affected angiogenesis in PDR by regulating vascular endothelial growth factor A (VEGFA) expression. Furthermore, HNF4A participated in angiogenesis in PDR by activating CACNA1A. In vitro experiments further identified that inhibition of HNF4A reduced CACNA1A expression and increased VEGFA expression, thus promoting angiogenesis in PDR.<h4>Conclusions</h4>In conclusion, the obtained findings suggest that antiangiogenic HNF4A activates the CACNA1A/VEGFA axis in PDR. Our work provides new insights into the angiogenic mechanism of PDR and offers potential targets for translational applications.

SERPINC1
Also flagged:Abdominal Aortic AneurysmThrombocythemiaessential thrombocythemiaETchronic myeloproliferative disordervenous thrombosis
Journal Article 2023-06-01 ✓ 1 Snippet Yamamoto N, Onoda K.
In-Text Gene Mentions

…200–400 mg/dL), andantithrombin-III(AT-III) of 83%…

Show Full Abstract

We report perioperative management and open surgery to treat a case of infrarenal abdominal aortic aneurysm with essential thrombocythemia (ET), a chronic myeloproliferative disorder associated with arterial or venous thrombosis, idiopathic bleeding, and heparin-resistant diathesis. Following careful preoperative management, including assessment of heparin resistance, open surgery was successfully performed to treat the aortic aneurysm of our patient. This report shows that optimal preparation for surgery is important to safely perform abdominal aortic aneurysm repair and prevent perioperative thrombosis and bleeding in patients with abdominal aortic aneurysm with ET.

SERPINC1
Also flagged:Renal Vein ThrombosisPeripheral venous thromboembolismvisceral vein thrombosisleft renal vein thrombosisheparinedoxaban
Journal Article 2023-06-01 ✓ 1 Snippet Miyahara T, Nishino Y, Ozaki M, Ogiwara M.
In-Text Gene Mentions

…C, protein S,antithrombin-III, and immunologic analysis…

Show Full Abstract

Peripheral venous thromboembolism is a well-known complication of hormonal contraception, but reports on its association with visceral vein thrombosis is limited. We report the case of left renal vein thrombosis (RVT) associated with oral contraceptives (OCs) and concurrent smoking. The clinical presentation of this patient was acute left flank pain. Computed tomography revealed left RVT. The OC was discontinued, and we initiated anticoagulation with heparin and switched to edoxaban. Computed tomography 6 months later showed complete resolution of the thrombosis. This report alerts us regarding the importance of OCs as a risk factor for RVT.

RABGAP1L
Also flagged:GlycogenGLUT4starchprotein kinaseglucoseGLUT3
Journal Article 2023-06-01 ✓ 1 Snippet Valberg SJ, Velez-Irizarry D, Williams ZJ, Pagan JD, Mesquita V, Waldridge B, Maresca-Fichter H.
In-Text Gene Mentions

…tions, translocation enhancersRABGAP13(−0.46, adj p…

Show Full Abstract

Horses have a slow rate of muscle glycogen repletion relative to other species for unknown reasons. Our aim was to determine the expression of glucose transporters (<i>GLUT</i>) and genes impacting GLUT4 expression and translocation in the gluteal muscle. Five fit Thoroughbred horses performed glycogen-depleting exercises on high-starch (HS, 2869 g starch/day) and low-starch, high-fat diets (LS-HF, 358 g starch/d) with gluteal muscle biopsies obtained before and after depletion and during repletion. Muscle glycogen declined by ≈30% on both diets with little increase during repletion on LS-HF. Transcriptomic analysis identified differential expression (DE) of only 2/12 genes impacting GLUT4 translocation (two subunits of AMP protein kinase) and only at depletion on LS-HF. Only 1/13 genes encoding proteins that promote <i>GLUT4</i> transcription had increased DE (<i>PPARGC1A</i> at depletion LS-HF). <i>GLUT4</i> comprised ≈30% of total <i>GLUT</i> mRNA expression at rest. Remarkably, by 72 h of repletion expression of <i>GLUT3</i>, <i>GLUT6</i> and <i>GLUT10</i> increased to ≈25% of total <i>GLUT</i> mRNA. Expression of <i>GLUT6</i> and <i>GLUT10</i> lagged from 24 h of repletion on HS to 72 h on LS-HF. Lacking an increase in <i>GLUT4</i> gene expression in response to glycogen-depleting exercise, equine muscle increases <i>GLUT3</i>, <i>GLUT6</i> and <i>GLUT10</i> expression potentially to enhance glucose transport, resembling responses observed in resistance trained GLUT4-null mice.

PEBP1
Also flagged:extracellularvesiclesbladder cancernon-muscle-invasive bladder cancerNMIBCtumor
Journal Article 2023-06-01 ✓ 5 Snippets Jordaens S, Oeyen E, Willems H, Ameye F, De Wachter S, Pauwels P, Mertens I.
In-Text Gene Mentions

In addition, PEBP1, also known as Raf kinase inhibitory protein (RKIP), was downregulated in sEVs of bladder cancer patients in this study.

As in this biomarker discovery study, downregulated expression of PEBP1 is observed in many cancers as they progress, including bladder cancer [52,77,78,79,80,81].

…binding protein 1 (PEBP1), kininogen-1 (KNG1), alpha-1…

…In addition,PEBP1, also known as…

…downregulated expression ofPEBP1is observed in…

Show Full Abstract

Urinary extracellular vesicles (EVs) are an attractive source of bladder cancer biomarkers. Here, a protein biomarker discovery study was performed on the protein content of small urinary EVs (sEVs) to identify possible biomarkers for the primary diagnosis and recurrence of non-muscle-invasive bladder cancer (NMIBC). The sEVs were isolated by ultrafiltration (UF) in combination with size-exclusion chromatography (SEC). The first part of the study compared healthy individuals with NMIBC patients with a primary diagnosis. The second part compared tumor-free patients with patients with a recurrent NMIBC diagnosis. The separated sEVs were in the size range of 40 to 200 nm. Based on manually curated high quality mass spectrometry (MS) data, the statistical analysis revealed 69 proteins that were differentially expressed in these sEV fractions of patients with a first bladder cancer tumor vs. an age- and gender-matched healthy control group. When the discriminating power between healthy individuals and first diagnosis patients is taken into account, the biomarkers with the most potential are MASP2, C3, A2M, CHMP2A and NHE-RF1. Additionally, two proteins (HBB and HBA1) were differentially expressed between bladder cancer patients with a recurrent diagnosis vs. tumor-free samples of bladder cancer patients, but their biological relevance is very limited.

ABT1
Also flagged:InterferonsMelanomaIFNsskin cancerssquamous cell carcinomabasal cell carcinoma
Journal Article 2023-06-01 ✓ 1 Snippet Weir SA, Kc K, Shoaib S, Yusuf N.
In-Text Gene Mentions

…transducer and theactivator of transcription 1of transcription 1…

Show Full Abstract

Interferons (IFNs) have demonstrated therapeutic potential in various skin cancers, specifically squamous cell carcinoma (SCC), basal cell carcinoma (BCC), and melanoma. The precise mechanism through which type I IFNs exert their antitumor effects in skin cancers is still being studied. However, intralesional type I IFN can be used as an alternative to surgery for select patient populations, and high-dose systemic IFN therapy has been shown to be promising in patients with operable high-risk or metastatic melanoma. Despite the therapeutic potential of IFNs in skin cancer treatment, the toxicity profile often prevents the completion of treatment and further expansion of its clinical application. Type I and III IFNs use the same Janus Kinases (JAKs) for signal transduction, which are pathways initiated at a cell surface receptor that mediates the activation of target genes in the nucleus, based on this shared signaling pathway. Due to selective tumor targeting and the ability to generate both innate and adaptive immune responses, we concluded that type III IFNs have minimal side effects compared with established treatments due to selective tumor targeting. While IFN-λ, a type III IFN, shows therapeutic potential as stand-alone or in combination with another IFN, further studies need to be conducted to explore the therapeutic potential of IFN-λ in skin cancer and the underlying physiological roles and mechanisms of action. In this review, we evaluate whether treatment of skin cancer with type III IFN will have minimal side effects compared with established treatments.

OLFM4
Also flagged:necrotizing enterocolitisNECwaterolfactomedinproliferating cell nuclear antigenGpr81
Journal Article 2023-06-01 ✓ 5 Snippets Cuna A, Nsumu M, Menden HL, Chavez-Bueno S, Sampath V.
In-Text Gene Mentions

…(CLDN3), olfactomedin 4 (OLFM4), proliferating cell nuclear…

…with primary rabbit anti-OLFM4, rabbit anti-PCNA, or…

…of crypts expressingOLFM4( Figure 2…

…as reduced totalOLFM4gene expression (…

…crypts positive forOLFM4and PCNA with…

Show Full Abstract

Peripartum antibiotics can negatively impact the developing gut microbiome and are associated with necrotizing enterocolitis (NEC). The mechanisms by which peripartum antibiotics increase the risk of NEC and strategies that can help mitigate this risk remain poorly understood. In this study, we determined mechanisms by which peripartum antibiotics increase neonatal gut injury and evaluated whether probiotics protect against gut injury potentiated by peripartum antibiotics. To accomplish this objective, we administered broad-spectrum antibiotics or sterile water to pregnant C57BL6 mice and induced neonatal gut injury to their pups with formula feeding. We found that pups exposed to antibiotics had reduced villus height, crypt depth, and intestinal olfactomedin 4 and proliferating cell nuclear antigen compared to the controls, indicating that peripartum antibiotics impaired intestinal proliferation. When formula feeding was used to induce NEC-like injury, more severe intestinal injury and apoptosis were observed in the pups exposed to antibiotics compared to the controls. Supplementation with the probiotic <i>Lactobacillus rhamnosus</i> GG (LGG) reduced the severity of formula-induced gut injury potentiated by antibiotics. Increased intestinal proliferating cell nuclear antigen and activation of the Gpr81-Wnt pathway were noted in the pups supplemented with LGG, suggesting partial restoration of intestinal proliferation by probiotics. We conclude that peripartum antibiotics potentiate neonatal gut injury by inhibiting intestinal proliferation. LGG supplementation decreases gut injury by activating the Gpr81-Wnt pathway and restoring intestinal proliferation impaired by peripartum antibiotics. Our results suggest that postnatal probiotics may be effective in mitigating the increased risk of NEC associated with peripartum antibiotic exposure in preterm infants.

Also flagged:ADH1CALDH2Alcohol abuseAlcoholic Cirrhosiscirrhosisliver cancer
Journal Article 2023-06-01 No Snippets Hoang YTT, Nguyen YT, Vu LT, Bui HTT, Nguyen QV, Vu NP, Nguyen TD, Nguyen HH.
Show Full Abstract

<h4>Objective</h4>Alcohol abuse can cause developing cirrhosis, even liver cancer. Several single nucleotide polymorphisms (SNPs) of ADH1B, ADH1C, and ALDH2 genes have been reported to be associated with alcohol abuse and alcoholic cirrhosis (ALC). This study investigated the association between three SNPs of ADH1B rs1229984, ADH1C rs698, and ALDH2 rs671 with alcohol abuse and ALC in people living in the Northeast region of Vietnam.<h4>Methods</h4>306 male participants were recruited including 206 alcoholics (106 ALC, 100 without ALC) and 100 healthy non-alcoholics. Clinical characteristics were collected by clinicians. Genotypes were identified by Sanger sequencing. Chi-Square (χ2) and Fisher-exact tests were used to assess the differences in age and clinical characteristics, Child-Pugh score, frequencies of alleles and genotypes.<h4>Result</h4>Our data showed that the frequency of ALDH2*1 was significantly higher in alcoholics (88.59%) and ALC groups (93.40%) than that of healthy non-alcoholics (78.50%) with p=0.0009 and non-ALC group (83.50%) with p=0.002, respectively. We detected opposite results when examined ALDH2*2. Frequency of combined genotypes with high acetaldehyde accumulation were significantly lower in alcoholics and ALC group than those of control groups with p=0.005 and p=0.008, respectively. Meanwhile, the proportion of combined genotypes with non-acetaldehyde accumulation were significantly two times higher in the ALC group (19.98%) than those of the non-ALC group (8%) with p=0.035. These combined genotypes showed a decreasing trend in the Child-Pugh score from likely phenotype causing risk for non-acetaldehyde accumulation to high acetaldehyde accumulation.<h4>Conclusion</h4>The ALDH2*1 allele was found as a risk factor for alcohol abuse and ALC, and combined genotypes of ADH1B rs1229984, ADH1C rs698, and ALDH2 rs671 with non-acetaldehyde accumulation increase ALC risk. In contrast, ALDH2*2 and the genotype combinations related to high acetaldehyde accumulation were protective factors against alcohol abuse and ALC.

Genetics of diabetes.

PTGIS
Also flagged:Diabetes mellituscerebrovascular diseasecardiovascular diseaseperipheral vascular diseaseretinopathynephropathy
Journal Article 2023-06-01 ✓ 1 Snippet Goyal S, Rani J, Bhat MA, Vanita V.
In-Text Gene Mentions

On the other hand, Wu et al[63] identified 23 SNPs in four genes: CTIF, CDH18, PTGIS, and SYNPR to be associated with GDM.

Show Full Abstract

Diabetes mellitus is a complicated disease characterized by a complex interplay of genetic, epigenetic, and environmental variables. It is one of the world's fastest-growing diseases, with 783 million adults expected to be affected by 2045. Devastating macrovascular consequences (cerebrovascular disease, cardiovascular disease, and peripheral vascular disease) and microvascular complications (like retinopathy, nephropathy, and neuropathy) increase mortality, blindness, kidney failure, and overall quality of life in individuals with diabetes. Clinical risk factors and glycemic management alone cannot predict the development of vascular problems; multiple genetic investigations have revealed a clear hereditary component to both diabetes and its related complications. In the twenty-first century, technological advancements (genome-wide association studies, next-generation sequencing, and exome-sequencing) have led to the identification of genetic variants associated with diabetes, however, these variants can only explain a small proportion of the total heritability of the condition. In this review, we address some of the likely explanations for this "missing heritability", for diabetes such as the significance of uncommon variants, gene-environment interactions, and epigenetics. Current discoveries clinical value, management of diabetes, and future research directions are also discussed.

HFE
Also flagged:Amiodaroneventricular arrhythmiasatrial fibrillationsupra-ventricular arrhythmiasiodineliver dysfunction
Journal Article 2023-06-01 ✓ 1 Snippet Tun MM, Pandey S, Adhikari S, Mainali A, Thapa A, Bisural R, Bista PB, Htet SY, Chhetri B, Panigrahi K.
In-Text Gene Mentions

…saturation: 43%) madehemochromatosisunlikely.…

Show Full Abstract

Amiodarone, a class III antiarrhythmic drug, is commonly used for the management of life-threatening ventricular arrhythmias, atrial fibrillation, and other refractory supra-ventricular arrhythmias. Factors like a large volume of distribution, lipophilic property, deposition in tissues in large amounts, etc. have led to the development of amiodarone-induced multisystem adverse events. We report a case of amiodarone-induced hepatic attenuation on computed tomography (CT) of the abdomen in an elderly female patient. Amiodarone with a composition of 40% iodine by weight deposits in the liver, leading to characteristically increased radiodensity reported as increased attenuation on CT scan. Surprisingly, the severity and extent of hepatic attenuation on CT scans do not necessarily correlate with the total exposure to amiodarone over time. Individual factors may influence the liver's response to the drug, leading to varying degrees of hepatic changes. To minimize the risk of adverse events associated with amiodarone, clinicians should carefully adjust the dosage to the lowest effective level and regularly monitor liver function tests in patients. This proactive approach enables early detection of liver dysfunction and facilitates timely adjustments or discontinuation of amiodarone, thereby reducing potential harm.

HTT
Also flagged:MethylationPDneuroblastomaneurological disordersAKT1ITPR1
Journal Article 2023-06-01 ✓ 2 Snippets Magalingam KB, Somanath SD, Radhakrishnan AK.
In-Text Gene Mentions

Aberrant Ca2+ levels in neurons affected by dysregulated ITPR1 has been identified as one of the possible mechanisms linking polyglutamine expansion of Huntingtin (Htt) protein and degeneration of GABAergic medium spiny striatal neurons in Huntington’s disease [35].

…expansion of Huntingtin (Htt) protein and degeneration…

Show Full Abstract

A cell-based model of Parkinson's disease (PD) is a well-established <i>in vitro</i> experimental prototype to investigate the disease mechanism and therapeutic approach for a potential anti-PD drug. The SH-SY5Y human neuroblastoma cells and 6-OHDA combo is one of the many neurotoxininduced neuronal cell models employed in numerous neuroscience-related research for discovering neuroprotective drug compounds. Emerging studies have reported a significant correlation between PD and epigenetic alterations, particularly DNA methylation. However, the DNA methylation changes of PD-related CpG sites on the 6-OHDA-induced toxicity on human neuronal cells have not yet been reported. We performed a genome-wide association study (GWAS) using Infinium Epic beadchip array surveying 850000 CpG sites in differentiated human neuroblastoma cells exposed to 6-OHDA. We identified 236 differentially methylated probes (DMPs) or 163 differentially methylated regions (DMRs) in 6-OHDA treated differentiated neuroblastoma cells than the untreated reference group with p<0.01, Δbeta cut-off of 0.1. Among 236 DMPs, hypermethylated DMPs are 110 (47%), whereas 126 (53%) are hypomethylated. Our bioinformatic analysis revealed 3 DMRs that are significantly hypermethylated and associated with neurological disorders, namely AKT1, ITPR1 and GNG7. This preliminary study demonstrates the methylation status of PD-related CpGs in the 6-OHDA-induced toxicity in the differentiated neuroblastoma cells model.

Also flagged:cyanidealkenenitromethanesynthesisGlycopyranosyl aldehydesglycoconjugates
Journal Article 2023-06-01 No Snippets Kumar S, Khatri V, Mangla P, Chhatwal RJ, Parmar VS, Prasad AK.
Show Full Abstract

Herein, we have summarized the vast array of synthetic processes that have been developed for the synthesis of <i>C</i>-glycopyranosyl aldehydes and diverse <i>C</i>-glycoconjugates derived from them by covering the literature reported from 1979 to 2023. Notwithstanding its challenging chemistry, <i>C</i>-glycosides are considered stable pharmacophores and are used as important bioactive molecules. The discussed synthetic methodologies to access <i>C</i>-glycopyranosyl aldehydes take advantage of seven key intermediates, <i>viz.</i> allene, thiazole, dithiane, cyanide, alkene, and nitromethane. Furthermore, the integration of complex <i>C</i>-glycoconjugates derived from varied <i>C</i>-glycopyranosyl aldehydes involves nucleophilic addition/substitution, reduction, condensation, oxidation, cyclo condensation, coupling, and Wittig reactions. In this review, we have categorized the synthesis of <i>C</i>-glycopyranosyl aldehydes and <i>C</i>-glycoconjugates on the basis of the methodology used for their synthesis and on types of <i>C</i>-glycoconjugates, respectively.

Also flagged:carbonRBDelectron transferhydroxyapatitelanthanumstrontium
Journal Article 2023-06-01 No Snippets Hartati YW, Devi MJ, Irkham, Zulqaidah S, Noviyanti AR, Rochani S, Topkaya SN, Einaga Y.
Show Full Abstract

The hydroxyapatite-lanthanum strontium cobalt ferrite (HA-LSCF) composite showed a good response on a screen-printed carbon electrode (SPCE) electrochemical aptasensor to detect SARS-CoV-2. SPCE/HA-LSCF with a thiolated aptamer has a strong affinity for the SARS-CoV-2 spike RBD protein. This occurs due to the binding of -SH to the HA-positive region. In the presence of LSCF, which is conductive, an increase in electron transfer from the redox system [Fe(CN)<sub>6</sub>]<sup>3-/4-</sup> occurs. The interaction of the aptamer with the RBD protein can be observed based on the decrease in the electron transfer process. As a result, the developed biosensor is highly sensitive to the SARS-CoV-2 spike RBD protein with a linear range of 0.125 to 2.0 ng mL<sup>-1</sup>, a detection limit of 0.012 ng mL<sup>-1</sup>, and a quantification limit of 0.040 ng mL<sup>-1</sup>. The analytical application of the aptasensor demonstrates its feasibility in the analysis of saliva or swab samples.

HFE
Also flagged:cirrhosis diseasesliver fibrosiscirrhosisLiver Cirrhosishepatic cirrhosishepatocellular carcinoma
Journal Article 2023-06-01 ✓ 1 Snippet Zhang D, Liu BW, Liang XQ, Liu FQ.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosis[ 48 ].…

Show Full Abstract

<h4>Background</h4>Cirrhosis results from persistent liver injury that leads to liver fibrosis. Immunological factors play important regulatory roles in the development and progression of cirrhosis. Bibliometrics is one of the most commonly used methods for systematic evaluation of a field of study. To date, there are no bibliometric studies on the role of immunological factors in cirrhosis.<h4>Aim</h4>To provide a comprehensive overview of the knowledge structure and research hotspots of immunological factors in cirrhosis.<h4>Methods</h4>We retrieved publications related to immunological factors in cirrhosis between 2003 to 2022 from the Web of Science Core Collection database on December 7, 2022. The search strategy was TS = ((Liver Cirrhosis OR hepatic cirrhosis OR liver fibrosis) AND (Immunologic* Factor* OR Immune Factor* OR Immunomodulator* OR Biological Response Modifier* OR Biomodulator*)). Only original articles and reviews were included. A total of 2873 publications were analyzed using indicators of publication and citation metrics, countries, institutes, authors, journals, references, and keywords by CiteSpace and VOSviewer.<h4>Results</h4>A total of 5104 authors from 1173 institutions across 51 countries published 2873 papers on cirrhosis and immunological factors in 281 journals. In the past 20 years, the increasing number of related annual publications and citations indicates that research on immunological factors in cirrhosis has become the focus of attention and has entered a period of accelerated development. The United States (781/27.18%), China (538/18.73%), and Germany (300/10.44%) were the leading countries in this field. Most of the top 10 authors were from the United States (4) and Germany (3), with Gershwin ME contributing the most related articles (42). <i>World Journal of Gastroenterology</i> was the most productive journal, whereas <i>Hepatology</i> was the most co-cited journal. Current research hotspots regarding immunological factors in cirrhosis include fibrosis, cirrhosis, inflammation, liver fibrosis, expression, hepatocellular carcinoma, activation, primary biliary cirrhosis, disease, and hepatic stellate cells. Burst keywords (<i>e.g.</i>, epidemiology, gut microbiota, and pathways) represent research frontiers that have attracted the interest of researchers in recent years.<h4>Conclusion</h4>This bibliometric study comprehensively summarizes the research developments and directions of immunological factors in cirrhosis, providing new ideas for promoting scientific research and clinical applications.

SERPINC1
Also flagged:infectionlumenprotein Sdeep venous thrombosisDVTpulmonary embolism
Journal Article 2023-06-01 ✓ 1 Snippet Samuel M, Nahab B, Chadalavada S.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

A potential complication of complex endovascular procedures is retained foreign bodies such as fragmented catheters, wires, stents, or sheaths in the intravascular space. Different techniques are available for retrieval of intravascular foreign bodies including snares, forceps, baskets, tip-deflecting wires, and balloon catheters. The aim of this article is to describe our experience in which a lost large intravascular sheath was retrieved using balloon assistance. We also provide a review of different techniques used for intravascular large sheath retrieval and methods to avoid this complication during endovascular procedures such as complex inferior vena cava filter removal.

Also flagged:tumorsoral squamous cell carcinomaOSCCmethylationmethylguanosinehead and neck squamous cell carcinoma
Journal Article 2023-06-01 No Snippets Sun D, Song N, Li M, Chen X, Zhang X, Yu Y, Ying J, Xu M, Zheng W, Han C, Ji H, Jiang Y.
Show Full Abstract

N7-methylguanosine (m7G) modification is closely related to the occurrence of tumors. However, the m7G modification of circRNAs in oral squamous cell carcinoma (OSCC) remains to be investigated. Methylated RNA immunoprecipitation sequencing (MeRIP-seq) was used to measure the methylation levels of m7G and identify m7G sites in circRNAs in human OSCC and normal tissues. The host genes of differentially methylated and differentially expressed circRNAs were analyzed by Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, and circRNA-miRNA-mRNA networks were predicted using the miRanda and miRDB databases. The analysis identified 2348 m7G peaks in 624 circRNAs in OSCC tissues. In addition, the source of m7G-methylated circRNAs in OSCC was mainly the sense overlap region compared with normal tissues. The most conserved m7G motif in OSCC tissues was CCUGU, whereas the most conserved motif in normal tissues was RCCUG (R = G/A). Importantly, GO enrichment and KEGG pathway analysis showed that the host genes of differentially methylated and differentially expressed circRNAs were involved in many cellular biological functions. Furthermore, the significantly differentially expressed circRNAs were analyzed to predict the circRNA-miRNA-mRNA networks. This study revealed the whole profile of circRNAs of differential m7G methylation in OSCC and suggests that m7G-modified circRNAs may impact the development of OSCC.

NEGR1
Also flagged:addictionreward deficiencyalcoholismAlcohol Use Disorderheroin dependencedepression
Journal Article 2023-06-01 ✓ 1 Snippet Blum K, Bowirrat A, Elman I, Baron D, Thanos PK, Gold MS, Hanna C, Makale MT, Sunder K, Jafari N, Zeine F, Murphy KT, Makale M, Badgaiyan RD.
In-Text Gene Mentions

…the expression ofNEGR1(a dopamine regulatory…

Show Full Abstract

Since 1990, published addiction psychiatry articles have exceeded 11,495. Several from Blum et al. showed the clinical relevance of the Genetic Addiction Risk Severity (GARS) test in identifying risk for reward deficiency behaviors in cohorts from polysubstance and pain clinics, post-surgical bariatrics, and DWI offenders facing prison time. Since Blum <i>et al</i> first published in JAMA (1990) concerning the association of the <i>DRD2</i> gene polymorphism and severe alcoholism, confirmation has been mixed and controversial. More recently, however, a meta-analysis of 62 studies showed a significant association between <i>DRD2</i> rs 1800497 and Alcohol Use Disorder (AUD). Other studies from Yale University showed that a haplotype block of the <i>DRD2</i> gene A1 allele was associated with AUD and heroin dependence. GWAS studies of depression and suicide in 1.2 million veterans confirmed the first psychiatric candidate gene study finding from Blum et al. 1990; a significant association between the minor <i>DRD2</i> allele, Taq A1 (rs 1800497 C>T) and severe alcoholism. Additionally, the <i>DRD2</i> rs1800497 is associated with suicide behaviors robustly at P=1.77 × 10<sup>-7</sup>. Furthermore, DNA polymorphic alleles underlying SUD with multiple substances were mapped via chromatin refolding, revealed that the <i>DRD2</i> gene and associated polymorphism(s) was the top gene signal (DRD2, P=7.9 × 10<sup>-12</sup>). Additionally, based on these investigations, we conclude that GWAS should end the controversy about the <i>DRD2</i> gene being at least one determinant of Reward Deficiency Syndrome (RDS) first reported in the Royal Society of Medicine journaling 1996.

PTGIS
Also flagged:MetabolismOvarian Cancer-associated genestumorOCAOC3
Journal Article 2023-06-01 ✓ 1 Snippet Jian D, Lianghao Z, Yunge G, Ligang C, Biliang C, Xiaohui L.
In-Text Gene Mentions

…composed of 3-MAGs (PTGIS, AOC3, and IDO1).…

Show Full Abstract

Metabolism-associated genes (MAGs) are important regulators of tumor progression and can affect a variety of physiological processes. In this study, we focused on the relationship between MAGs and Ovarian cancer (OC) prognosis.<h4>Method</h4>Metabolism-related genes were extracted from the Cancer Genome Atlas (TCGA) database. Through univariate COX and lasso regression models, a dynamic risk model based on MAGs was established. Compared with other clinical factors, demonstrated the ability of the model to predict the prognosis of patients with OC. The clinical samples were used to verify the expression of these MAGs.<h4>Results</h4>A metabolism-associated gene signature was constructed by LASSO Cox regression analysis in OC, which was composed of 3-MAGs (PTGIS, AOC3, and IDO1). The signature was used to classify the OC patients into high-risk and low-risk groups. The overall survival of the low-risk group was significantly better than that of the high-risk group. The analysis of the therapeutic effect of bevacizumab showed that bevacizumab was not conducive to improving the prognosis of the low-risk group.<h4>Conclusions</h4>We constructed a prognostic model of MAGs in OC, which can be used to predict the prognosis of OC patients and may have a good guiding significance in the individualized treatment of patients.

TNFSF4
Also flagged:aporphinealkaloidTLR2Toll-like receptor 2immune responsesynthesis
Journal Article 2023-06-01 ✓ 1 Snippet Yang J, Pan Y, Zeng X, Liu S, Chen Z, Cheng K.
In-Text Gene Mentions

…TNFSF18, CXCL5 andTNFSF4( Fig. 4…

Show Full Abstract

Toll-like receptor 2 (TLR2) mediated macrophages regulate the protective immune response to infectious microorganisms, but the aberrant activation of macrophages often leads to pathological inflammation, including tissue damage. In this study, we identified antagonists of TLR2 by screening 2100 natural products and subsequently identified Taspine, an aporphine alkaloid, as an excellent candidate. Furthermore, analysis of the 10 steps chemical synthesis route and structural optimization yielded the Taspine derivative SMU-Y6, which has higher activity, better solubility, and improved drug-feasible property. Mechanistic studies and seq-RNA analysis revealed that SMU-Y6 inhibited TLR2 over other TLRs, hindered the formation of TLR2/MyD88 complex, and blocked the downstream NF-<i>κ</i>B and MAPK signaling pathway, thus suppressing the release of inflammatory cytokines. SMU-Y6 could stabilize TLR2 and bind to TLR2 protein with a <i>K</i><sub>d</sub> of 0.18 μmol/L. Additionally, SMU-Y6 could efficiently reverse the M1 phenotype macrophage polarization, reduce the production of cytokines as well as infiltration of neutrophiles and alleviate the local inflammation in mice with acute paw edema and colitis. Collectively, we reported the first aporphine alkaloid derivative that selectively inhibits TLR2 with high binding affinity and superior drug-feasible property, thus providing an urgently-needed molecular probe and potential drug candidate for inflammatory and autoimmune disease therapy.

Also flagged:agingneurodegenerative diseaseschromatinmethylationcell differentiationgene expression
Journal Article 2023-06-01 No Snippets Fernández-Moya SM, Ganesh AJ, Plass M.
Show Full Abstract

The development of highly parallel and affordable high-throughput single-cell transcriptomics technologies has revolutionized our understanding of brain complexity. These methods have been used to build cellular maps of the brain, its different regions, and catalog the diversity of cells in each of them during development, aging and even in disease. Now we know that cellular diversity is way beyond what was previously thought. Single-cell transcriptomics analyses have revealed that cell types previously considered homogeneous based on imaging techniques differ depending on several factors including sex, age and location within the brain. The expression profiles of these cells have also been exploited to understand which are the regulatory programs behind cellular diversity and decipher the transcriptional pathways driving them. In this review, we summarize how single-cell transcriptomics have changed our view on the cellular diversity in the human brain, and how it could impact the way we study neurodegenerative diseases. Moreover, we describe the new computational approaches that can be used to study cellular differentiation and gain insight into the functions of individual cell populations under different conditions and their alterations in disease.

HTT
Also flagged:ResveratrolNeurodegenerationNeurodegenerative DiseasesMitochondriasynthesisadenosine triphosphate
Journal Article 2023-06-01 ✓ 2 Snippets Danışman B, Ercan Kelek S, Aslan M.
In-Text Gene Mentions

Resveratrol significantly improved motor and cognitive impairments by inhibiting cyclooxygenase-1 activity in the HD model.62 In addition, it protects against the cytotoxicity of mutant polyglutamine Htt through SIRT1 activation.

The protein called huntingtin (Htt) is thought to be essential for normal embryonic and neuronal development and is important in many cellular pathways, ion transport, vesicular trafficking, and production and transport of brain-derived neurotrophic factor.27 One of the important mechanisms involved in the pathogenesis of HD is mitochondrial dysfunction.28 Mitochondrial homeostasis and dynamics must be intact for continued ATP generation, calcium homeostasis, and antioxidant effects.

Show Full Abstract

Neurodegeneration is a process leading to the progressive loss of structure and functions of neurons. Many neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Huntington's disease have shown many common points at the subcellular level. Neurons are metabolically active cells and need a high amount of energy. Mitochondria are known as the energy synthesis center for cells, involved in the synthesis of adenosine triphosphate by oxidative phosphorylation. Rather than just being an energy synthesis center, it has critical importance for many cellular functions such as calcium homeostasis, cell proliferation, cell growth, and apoptosis. In the process of mitochondrial dysfunction, cellular functions are disrupted and cells enter the apoptotic or necrotic pathway. Resveratrol (trans-3,5,4-trihydoxystilbene), a plant-derived polyphenol found in the seed of grapes, berries, peanuts, and wine, has many biological effects such as inhibition of lipid peroxidation, scavenging of free radicals, changes in eicosanoid synthesis, inhibition of platelet aggregation, anti-inflammatory and anticancer activity, and regulation of lipid metabolism. Through the reviewed literature, the current study investigated the protective role of resveratrol in neurodegenerative diseases. Studies show that resveratrol moderates mitochondrial function, redox status, and cellular dynamics in both <i>in vivo</i> and <i>in vitro</i> experimental models of neurodegeneration. Resveratrol suppresses reactive oxygen species production by reducing the activity of complex III due to its competition effect with coenzyme Q. In the present work, we discussed the protective effects of resveratrol on neurodegeneration, neurodegenerative diseases, and the redox biology of the mitochondria.

Also flagged:gene expressioncancertranscription factorstype I diabetesmultiple sclerosisFTO
Journal Article 2023-06-01 No Snippets Gong H, Chen Z, Tang Y, Li M, Zhang S, Zhang X, Chen Y.
Show Full Abstract

<h4>Background</h4>As parts of the cis-regulatory mechanism of the human genome, interactions between distal enhancers and proximal promoters play a crucial role. Enhancers, promoters, and enhancer-promoter interactions (EPIs) can be detected using many sequencing technologies and computation models. However, a systematic review that summarizes these EPI identification methods and that can help researchers apply and optimize them is still needed.<h4>Results</h4>In this review, we first emphasize the role of EPIs in regulating gene expression and describe a generic framework for predicting enhancer-promoter interaction. Next, we review prediction methods for enhancers, promoters, loops, and enhancer-promoter interactions using different data features that have emerged since 2010, and we summarize the websites available for obtaining enhancers, promoters, and enhancer-promoter interaction datasets. Finally, we review the application of the methods for identifying EPIs in diseases such as cancer.<h4>Conclusions</h4>The advance of computer technology has allowed traditional machine learning, and deep learning methods to be used to predict enhancer, promoter, and EPIs from genetic, genomic, and epigenomic features. In the past decade, models based on deep learning, especially transfer learning, have been proposed for directly predicting enhancer-promoter interactions from DNA sequences, and these models can reduce the parameter training time required of bioinformatics researchers. We believe this review can provide detailed research frameworks for researchers who are beginning to study enhancers, promoters, and their interactions.

medRxiv 2023-06-01 Preprint (No Snippets API) Tierney BT, Foox J, Ryon KA, Butler D, Damle N, Young BG, Mozsary C, Babler KM, Yin X, Carattini Y, Andrews D, Solle NS, Kumar N, Shukla B, Vidovic D, Currall B, Williams SL, Schürer SC, Stevenson M, Amirali A, Beaver CC, Kobetz E, Boone MM, Reding B, Laine J, Comerford S, Lamar WE, Tallon JJ, Hirschberg JW, Proszynski J, Sharkey ME, Church GM, Grills GS, Solo-Gabriele HM, Mason CE.
Show Full Abstract

Wastewater, which contains everything from pathogens to pollutants, is a geospatially-and temporally-linked microbial fingerprint of a given population. As a result, it can be leveraged for monitoring multiple dimensions of public health across locales and time. Here, we integrate targeted and bulk RNA sequencing (n=1,419 samples) to track the viral, bacterial, and functional content over geospatially distinct areas within Miami Dade County from 2020-2022. First, we used targeted amplicon sequencing (n=966) to track diverse SARS-CoV-2 variants across space and time, and we found a tight correspondence with clinical caseloads from University students (N = 1,503) and Miami-Dade County hospital patients (N = 3,939 patients), as well as an 8-day earlier detection of the Delta variant in wastewater vs. in patients. Additionally, in 453 metatranscriptomic samples, we demonstrate that different wastewater sampling locations have clinically and public-health-relevant microbiota that vary as a function of the size of the human population they represent. Through assembly, alignment-based, and phylogenetic approaches, we also detect multiple clinically important viruses (e.g., norovirus ) and describe geospatial and temporal variation in microbial functional genes that indicate the presence of pollutants. Moreover, we found distinct profiles of antimicrobial resistance (AMR) genes and virulence factors across campus buildings, dorms, and hospitals, with hospital wastewater containing a significant increase in AMR abundance. Overall, this effort lays the groundwork for systematic characterization of wastewater to improve public health decision making and a broad platform to detect emerging pathogens.