Gene Literature Dashboard

Viewing August 2023 — 653 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← July 2023 September 2023 →
Also flagged:hypoxia-inducible factorAxlHIFbodyreceptor tyrosine kinasephenylhexyl
Journal Article 2023-08-31 No Snippets Wu J, Uchida K, Yoshikawa A, Hashimoto M, Kondo M, Nihei K, Ishii M, Choi JH, Miwa Y, Shoda C, Lee D, Nakai A, Kurihara T, D'Alessandro-Gabazza CN, Toda M, Yasuma T, Gabazza EC, Hirai H, Kawagishi H.
Show Full Abstract

In general, mushroom-forming fungi secrete liquid on the surface of mycelia just before fruiting-body formation. However, no researchers in mushroom science have paid attention to the liquid until now. We formulated a hypothesis that the liquid plays an important role(s) in the formation of the fruiting body and produces various bioactive compounds and named it the "fruiting liquid (FL)". Four novel compounds (<b>1</b>-<b>4</b>) were isolated from FL of <i><i>Hypholoma lateritium</i></i> and <i><i>Hericium erinaceus</i></i>. The structures of <b>1</b>-<b>4</b> except for their stereochemistry were determined by interpretation of MS and NMR data. The absolute configurations of compounds <b>1</b>-<b>4</b> were determined by quantum chemical calculation of the ECD spectrum, by single-crystal X-ray diffraction analyses, or by chemical syntheses. Compounds <b>1</b>, <b>3</b>, and <b>4</b> induced fruiting body formation of <i><i>Flammulina velutipes</i></i>. Compound <b>4</b> inhibited the activity of hypoxia-inducible factor, and compounds <b>2</b>-<b>4</b> suppressed receptor tyrosine kinase (Axl) expression.

DCC
Also flagged:adenosquamous carcinoma of the breastmetaplastic carcinoma of the breastMBCslymph node metastatic tumorsquamous cell carcinomaTP53
Journal Article 2023-08-31 ✓ 5 Snippets Kawachi K, Tang X, Kasajima R, Yamanaka T, Shimizu E, Katayama K, Yamaguchi R, Yokoyama K, Yamaguchi K, Furukawa Y, Miyano S, Imoto S, Yoshioka E, Washimi K, Okubo Y, Sato S, Yokose T, Miyagi Y.
In-Text Gene Mentions

Analysis of SMAD4::DCC fusion and SMAD4 expression in low-grade adenosquamous carcinoma and its associated high-grade metaplastic carcinoma

One of the most frequent regions with LOH in breast cancer is 18q, and SMAD4 and DCC located at 18q21 are inactivating tumor-suppressor gene candidates [27].

…The frequency of SMAD4::DCCfusion due to…

…Presence of the SMAD4::DCCfusion transcript in…

…presence of the SMAD4::DCCchimeric protein was…

Show Full Abstract

<h4>Purpose</h4>Low-grade adenosquamous carcinoma (LGASC) is a rare type of metaplastic carcinoma of the breast (MBC) with an indolent clinical course. A few LGASC cases with high-grade transformation have been reported; however, the genetics underlying malignant progression of LGASC remain unclear.<h4>Methods</h4>We performed whole-genome sequencing analysis on five MBCs from four patients, including one case with matching primary LGASC and a lymph node metastatic tumor consisting of high-grade MBC with a predominant metaplastic squamous cell carcinoma component (MSC) that progressed from LGASC and three cases of independent de novo MSC.<h4>Results</h4>Unlike de novo MSC, LGASC and its associated MSC showed no TP53 mutation and tended to contain fewer structural variants than de novo MSC. Both LGASC and its associated MSC harbored the common GNAS c.C2530T:p.Arg844Cys mutation, which was more frequently detected in the cancer cell fraction of MSC. MSC associated with LGASC showed additional pathogenic deletions of multiple tumor-suppressor genes, such as KMT2D and BTG1. Copy number analysis revealed potential 18q loss of heterozygosity in both LGASC and associated MSC. The frequency of SMAD4::DCC fusion due to deletions increased with progression to MSC; however, chimeric proteins were not detected. SMAD4 protein expression was already decreased at the LGASC stage due to unknown mechanisms.<h4>Conclusion</h4>Not only LGASC but also its associated high-grade MBC may be genetically different from de novo high-grade MBC. Progression from LGASC to high-grade MBC may involve the concentration of driver mutations caused by clonal selection and inactivation of tumor-suppressor genes.

GPR52
Also flagged:Orphan G-Protein-Coupled ReceptorG-protein-coupled receptorsorphan receptorsG-protein-coupled receptor 52cyclic adenosine monophosphatebinding
Journal Article 2023-08-31 ✓ 5 Snippets Wu Z, Han Z, Tao L, Sun X, Su J, Hu J, Li C.
In-Text Gene Mentions

The G-protein-coupled receptor 52 (GPR52) is a unique orphan receptor that constitutively increases cellular 5'-cyclic adenosine monophosphate (cAMP) levels without binding any exogenous agonists and has been identified as a promising therapeutic target for central nervous system disorders.

…han G-Protein-Coupled ReceptorGPR52.…

…-protein-coupled receptor 52 (GPR52) is a unique…

…inactive states ofGPR52, the mechanism of…

…self-activation pathway forGPR52was proposed through…

Show Full Abstract

Within over 800 members of G-protein-coupled receptors, there are numerous orphan receptors whose endogenous ligands are largely unknown, providing many opportunities for novel drug discovery. However, the lack of an in-depth understanding of the intrinsic working mechanism for orphan receptors severely limits the related rational drug design. The G-protein-coupled receptor 52 (GPR52) is a unique orphan receptor that constitutively increases cellular 5'-cyclic adenosine monophosphate (cAMP) levels without binding any exogenous agonists and has been identified as a promising therapeutic target for central nervous system disorders. Although recent structural biology studies have provided snapshots of both active and inactive states of GPR52, the mechanism of the conformational transition between these states remains unclear. Here, an acceptable self-activation pathway for GPR52 was proposed through 6 μs Gaussian accelerated molecular dynamics (GaMD) simulations, in which the receptor spontaneously transitions from the active state to that matching the inactive crystal structure. According to the three intermediate states of the receptor obtained by constructing a reweighted potential of mean force, how the allosteric regulation occurs between the extracellular orthosteric binding pocket and the intracellular G-protein-binding site is revealed. Combined with the independent gradient model, several important microswitch residues and the allosteric communication pathway that directly links the two regions are both identified. Transfer entropy calculations not only reveal the complex allosteric signaling within GPR52 but also confirm the unique role of ECL2 in allosteric regulation, which is mutually validated with the results of GaMD simulations. Overall, this work elucidates the allosteric mechanism of GPR52 at the atomic level, providing the most detailed information to date on the self-activation of the orphan receptor.

HTT
Also flagged:serotonin-cognitionsleep5-HT transporterextracellular
Journal Article 2023-08-31 ✓ 5 Snippets Conradi J, E Svensson J, V Larsen S, Frokjaer VG.
In-Text Gene Mentions

Similarly, Reimold et al. 2011 [32] saw a negative association between the dexamethasone-corticotropin challenge and thalamic 5-HTT binding in patients with OCD, unipolar depression, and healthy controls.

Our group has previously observed that prefrontal serotonin transporter (5-HTT) binding, imaged with positron emission tomography (PET), is positively associated with the cortisol awakening response (CAR), an index of HPA axis stress hormone dynamics.

…The 5-HT transporter (5-HTT) is the primary…

…antidepressants, which block5-HTT[ 2 ].…

…binds selectively to5-HTT, was prepared as…

Show Full Abstract

<h4>Background</h4>Serotonergic brain signaling is considered critical for an appropriate and dynamic adaptation to stress, seemingly through modulating limbic system functions, such as the hypothalamic-pituitary-adrenal (HPA)-axis. This interplay is of great interest since it holds promise as a target for preventing stress-related brain disorders, e.g., major depression. Our group has previously observed that prefrontal serotonin transporter (5-HTT) binding, imaged with positron emission tomography (PET), is positively associated with the cortisol awakening response (CAR), an index of HPA axis stress hormone dynamics. The aim of this cross-sectional study was to replicate the previous finding in a larger independent group of healthy individuals.<h4>Methods</h4>Molecular imaging and cortisol data were available for 90 healthy individuals. Prefrontal 5-HTT binding was imaged with [11C]DASB brain PET. Non-displaceable 5-HTT binding potential (BPND) was quantified using the Multilinear Reference Tissue Model 2 (MRTM2) with cerebellum as the reference region. CAR was based on five serial salivary cortisol samples within the first hour upon awakening. The association between CAR and prefrontal 5-HTT BPND was evaluated using a multiple linear regression model adjusted for age and sex. Further, we tested for sex differences in the association. Finally, an exploratory analysis of the association, was performed in 8 additional brain regions.<h4>Results</h4>We observed no statistically significant association between 5-HTT binding and CAR corrected for age and sex in the prefrontal cortex (β = -0.28, p = 0.26). We saw no interaction with sex on the association (p = 0.99).<h4>Conclusion</h4>We could not confirm a positive association between CAR and prefrontal 5-HTT BPND in this independent dataset. Also, sex differences in the association were not apparent. Our data do not exclude that the serotonin transporter system is involved in the regulation of stress responses in at-risk or manifest depressed states.

Also flagged:EpilepsyHuntington diseaseoral motor dysfunctionHDchromosomechorea
Journal Article 2023-08-31 No Snippets Lammert DB, Bang J, Stafstrom CE.
Show Full Abstract

Pediatric-onset Huntington disease (PoHD) presents differently from adult-onset disease. Children typically exhibit regression in school performance, psychiatric features such as inattention, and oral motor dysfunction. Unlike adult-onset HD, in which seizures occur at approximately the rate of the general public, at least half of children with HD develop epilepsy, and seizures can be a presenting feature of PoHD. Here we present the case of a 10-year-old boy with a history of language delay, motor regression, oral motor dysfunction, and tremor who presented with a first lifetime seizure. Given a family history of Huntington disease in his father, PoHD was considered, and a pathogenic allele with 88 repeats was confirmed in the child. As symptoms progressed, history alone could not differentiate abnormal movements from seizures. Continuous video electroencephalography helped to demonstrate epileptic myoclonic jerks and guide treatment.

VRK2
Also flagged:epilepsylocalizationdeath_EpilepsyHLAautoimmune epilepsy
Journal Article 2023-08-31 ✓ 1 Snippet International League Against Epilepsy Consortium on Complex Epilepsies.
In-Text Gene Mentions

…where we implicatedVRK2or FANCL 24…

Show Full Abstract

Epilepsy is a highly heritable disorder affecting over 50 million people worldwide, of which about one-third are resistant to current treatments. Here we report a multi-ancestry genome-wide association study including 29,944 cases, stratified into three broad categories and seven subtypes of epilepsy, and 52,538 controls. We identify 26 genome-wide significant loci, 19 of which are specific to genetic generalized epilepsy (GGE). We implicate 29 likely causal genes underlying these 26 loci. SNP-based heritability analyses show that common variants explain between 39.6% and 90% of genetic risk for GGE and its subtypes. Subtype analysis revealed markedly different genetic architectures between focal and generalized epilepsies. Gene-set analyses of GGE signals implicate synaptic processes in both excitatory and inhibitory neurons in the brain. Prioritized candidate genes overlap with monogenic epilepsy genes and with targets of current antiseizure medications. Finally, we leverage our results to identify alternate drugs with predicted efficacy if repurposed for epilepsy treatment.

TNFSF4
Also flagged:endoplasmic reticulumPDACmalignant tumorsERSHMOX1TGFB1
Journal Article 2023-08-31 ✓ 2 Snippets Liu S, Hu Q, Xie Z, Chen S, Li Y, Quan N, Huang K, Li R, Fang L.
In-Text Gene Mentions

The results showed that immune suppressive molecules, such as PDCD1, TNFSF9, TNFSF4, TNFSF14, TNFRSF8, TNFRSF4, TNFRSF18, TMIGD2, PDCD1LG2, CD86, CD70, CD274 (PD-L1), CD276 (B7-H3), CD244, BTNL2 and ADORA2A, were elevated in the high-risk group, suggesting that patients in the high-risk group have a worse anti-tumor immune response (Fig. 10e).

…as PDCD1, TNFSF9,TNFSF4, TNFSF14, TNFRSF8, TNFRSF4,…

Show Full Abstract

<h4>Purpose</h4>Pancreatic ductal adenocarcinoma (PDAC) is one of the most malignant tumors. Endoplasmic reticulum stress (ERS) plays an essential role in PDAC progression. Here, we aim to identify the ERS-related genes in PDAC and build reliable risk models for diagnosis, prognosis and immunotherapy response of PDAC patients as well as investigate the potential mechanism.<h4>Methods</h4>We obtained PDAC cohorts with transcriptional profiles and clinical data from the ArrayExpress, The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases. Univariate Cox regression, LASSO regression and multivariate Cox regression analyses were used to construct an ERS-related prognostic signature. The CIBERSORT and ssGSEA algorithms were applied to explore the correlation between the prognostic signature and immune cell infiltration and immune-related pathways. The GDSC database and TIDE algorithm were used to predict responses to chemotherapy and immunotherapy, identifying potential drugs for treating patients with PDAC.<h4>Results</h4>We established and validated an ERS-related prognostic signature comprising eight genes (HMOX1, TGFB1, JSRP1, GAPDH, CAV1, CHRNE, CD74 and ERN2). Patients with higher risk scores displayed worse outcomes than those with lower risk scores. PDAC patients in low-risk groups might benefit from immunotherapy. Dasatinib and lapatinib might have potential therapeutic implications in high-risk PDAC patients.<h4>Conclusion</h4>We established and validated an ERS-related prognostic signature comprising eight genes to predict the overall survival outcome of PDAC patients, which closely correlating with the response to immunotherapy and sensitivity to anti-tumor drugs, as well as could be beneficial for formulating clinical strategies and administering individualized treatments.

PRDX6
Also flagged:metforminPCOSmetabolic disordersglucagon-like peptide-1 receptorcyproteroneacetate
Journal Article 2023-08-31 ✓ 5 Snippets Liao M, Li X, Zhang H, Zhou L, Shi L, Li W, Shen R, Peng G, Zhao H, Shao J, Wang X, Sun Z, Zheng H, Long M.
In-Text Gene Mentions

The novel plasma biomarkers PRDX6, FN1, and SERPINB9, might be indicators and targets for PCOS treatment.

In summary, our findings showed that these plasma candidate markers, including PRDX6, FN1, and SERPINB9, may participate in PCOS development or drug management in response to reactive oxygen species, cellular oxidant detoxification, platelet degranulation, and immune response processes.

Plasma proteomics analyses shed light on potential molecular mechanisms and suggested several candidate biomarkers, such as PRDX6, FN1, and SERPINB9, for the clinical prevention, diagnosis, or management of overweight PCOS patients.

In short, circulating proteins such as PRDX6, FN1 and SERPINB9 provide further clues for exploring the effective molecular mechanism of treatment and might be reference candidate biomarkers for assisting with choosing the most suitable drugs for overweight/obese PCOS patients.

…xygen species detoxification (PRDX6, GSTO1, GSTP1, GSTM2),…

Show Full Abstract

<h4>Purpose</h4>Polycystic ovary syndrome (PCOS) is characterized by reproductive dysfunctions and metabolic disorders. This study aims to compare the therapeutic effectiveness of glucagon-like peptide-1 receptor agonist (GLP-1RA) + Metformin (Met) versus cyproterone acetate/ethinylestradiol (CPA/EE) + Met in overweight PCOS women and identify potential proteomic biomarkers of disease risk in women with PCOS.<h4>Methods</h4>In this prospective, open-label randomized controlled trial, we recruited 60 overweight PCOS women into two groups at a 1:1 ratio to receive CPA/EE (2 mg/day: 2 mg cyproterone acetate and 35-μg ethinylestradiol,) +Met (1500 mg/day) or GLP-1 RA (liraglutide, 1.2-1.8 mg/day) +Met (1500 mg/day) for 12 weeks. The clinical effectiveness and adverse effects were evaluated, followed by plasma proteomic analysis and verification of critical biomarkers by ELISA.<h4>Results</h4>Eighty(80%) patients completed the study. Both interventions improved menstrual cycle, polycystic ovaries, LH(luteinizing hormone) and HbA1c(hemoglobin A1c) levels after the 12-week treatment. GLP-1RA + Met was more effective than CPA/EE + Met in reducing body weight, BMI (Body Mass Index), and waist circumference, FBG(fasting blood glucose), AUCI(area under curve of insulin),TC (Total Cholesterol), IL-6(Interleukin-6) and improving insulin sensitivity, and ovulation in overweight women with PCOS, with acceptable short-term side effects. CPA/EE + Met was more effective in improving hyperandrogenemia, including T(total testosterone), LH, LH/FSH(Luteinizing hormone/follicle-stimulating hormone), SHBG(sex hormone-binding globulin) and FAI (free androgen index). By contract, GLP-1RA+Met group only improved LH. Plasma proteomic analysis revealed that the interventions altered proteins involved in reactive oxygen species detoxification (PRDX6, GSTO1, GSTP1, GSTM2), platelet degranulation (FN1), and the immune response (SERPINB9).<h4>Conclusions</h4>Both CPA/EE+Met and GLP-1RA + Met treatment improved reproductive functions in overweight PCOS women. GLP-1RA + Met was more effective than CPA/EE + Met in reducing body weight, BMI, and waist, and improving metabolism, and ovulation in overweight women with PCOS, with acceptable short-term side effects. CPA/EE + Met was more effective in reducing hyperandrogenemia. The novel plasma biomarkers PRDX6, FN1, and SERPINB9, might be indicators and targets for PCOS treatment. TRIAL REGISTRATION CLINICALTIALS.<h4>Gov trial no</h4>NCT03151005. Registered 12 May, 2017, https://clinicaltrials.gov/ct2/show/NCT03151005 .

PEBP1
Also flagged:agingADNeurodegenerative Disorderspeptidepeptidesurea
Journal Article 2023-08-31 ✓ 2 Snippets Wingo AP, Liu Y, Gerasimov ES, Vattathil SM, Liu J, Cutler DJ, Epstein MP, Blokland GAM, Thambisetty M, Troncoso JC, Duong DM, Bennett DA, Levey AI, Seyfried NT, Wingo TS.
In-Text Gene Mentions

In line with these results, among the two schizophrenia causal genes with sb-pQTLs we identified, PEBP1 is involved in neural development38.

…sb-pQTLs we identified,PEBP1is involved in…

Show Full Abstract

Most complex human traits differ by sex, but we have limited insight into the underlying mechanisms. Here, we investigated the influence of biological sex on protein expression and its genetic regulation in 1,277 human brain proteomes. We found that 13.2% (1,354) of brain proteins had sex-differentiated abundance and 1.5% (150) of proteins had sex-biased protein quantitative trait loci (sb-pQTLs). Among genes with sex-biased expression, we found 67% concordance between sex-differentiated protein and transcript levels; however, sex effects on the genetic regulation of expression were more evident at the protein level. Considering 24 psychiatric, neurologic and brain morphologic traits, we found that an average of 25% of their putatively causal genes had sex-differentiated protein abundance and 12 putatively causal proteins had sb-pQTLs. Furthermore, integrating sex-specific pQTLs with sex-stratified genome-wide association studies of six psychiatric and neurologic conditions, we uncovered another 23 proteins contributing to these traits in one sex but not the other. Together, these findings begin to provide insights into mechanisms underlying sex differences in brain protein expression and disease.

Also flagged:TRIM695-FluorouracilPD-1colorectal cancerCOADCancer
Journal Article 2023-08-31 No Snippets Chi XJ, Song YB, Liu DH, Wei LQ, Zhao AR, An X, Feng ZZ, Lan XH, Lv YM, Li HJ, Lan D, He HM.
Show Full Abstract

<h4>Background</h4>Several proteins in the tripartite-motif (TRIM) family are associated with the development of colorectal cancer (CRC), but research on the role of TRIM69 was lacking. The present study examined the correlation between TRIM69 expression and colon adenocarcinoma (COAD).<h4>Methods</h4>mRNA sequencing data for COAD patients was extracted from The Cancer Genome Atlas to analyze correlations between TRIM69 expression and patients' clinical features as well as survival. Potential associations with immune cells and chemosensitivity also were predicted using various algorithms in the TIMER, Limma, clusterProfiler, GeneMANIA, and Gene Set Cancer Analysis platforms. Subsequently, polymerase chain reaction analysis and immunohistochemical staining were used to detect TRIM69 expression in COAD tissue samples from real-world patients.<h4>Results</h4>TRIM69 expression was lower in COAD tissues than in normal tissues and correlated with the pathologic stage and metastasis (M category). Additionally, TRIM69 was found to be involved in several immune-related pathways, notably the NOD-like signaling pathway. These results suggest that high TRIM69 expression has the potential to enhance tumor sensitivity to 5-fluorouracil and programmed cell death protein 1 (PD-1) blockers.<h4>Conclusions</h4>From our findings that TRIM69 expression was significantly reduced in COAD compared with non-cancer tissues and associated with pathologic stage and metastasis, we conclude that increasing TRIM69 expression and/or activity may help to improve therapeutic outcomes. Accordingly, TRIM69 represents a potentially valuable marker of metastasis and target for adjuvant therapy in COAD.

HTT
Also flagged:BMAL1circadian rhythmsmyelinmultiple sclerosisMSsleep
Journal Article 2023-08-31 ✓ 1 Snippet Rojo D, Dal Cengio L, Badner A, Kim S, Sakai N, Greene J, Dierckx T, Mehl LC, Eisinger E, Ransom J, Arellano-Garcia C, Gumma ME, Soyk RL, Lewis CM, Lam M, Weigel MK, Damonte VM, Yalçın B, Jones SE, Ollila HM, Nishino S, Gibson EM.
In-Text Gene Mentions

Htt

Show Full Abstract

Myelination depends on the maintenance of oligodendrocytes that arise from oligodendrocyte precursor cells (OPCs). We show that OPC-specific proliferation, morphology, and BMAL1 are time-of-day dependent. Knockout of Bmal1 in mouse OPCs during development disrupts the expression of genes associated with circadian rhythms, proliferation, density, morphology, and migration, leading to changes in OPC dynamics in a spatiotemporal manner. Furthermore, these deficits translate into thinner myelin, dysregulated cognitive and motor functions, and sleep fragmentation. OPC-specific Bmal1 loss in adulthood does not alter OPC density at baseline but impairs the remyelination of a demyelinated lesion driven by changes in OPC morphology and migration. Lastly, we show that sleep fragmentation is associated with increased prevalence of the demyelinating disorder multiple sclerosis (MS), suggesting a link between MS and sleep that requires further investigation. These findings have broad mechanistic and therapeutic implications for brain disorders that include both myelin and sleep phenotypes.

Also flagged:COVID-19GNprimary minimal change diseasefocal segmental glomerulosclerosismembranous nephropathyglomerular filtration
Journal Article 2023-08-31 No Snippets Wang CS, Glenn DA, Helmuth M, Smith AR, Bomback AS, Canetta PA, Coppock GM, Khalid M, Tuttle KR, Bou-Matar R, Greenbaum LA, Robinson BM, Holzman LB, Smoyer WE, Rheault MN, Gipson D, Mariani LH, Cure Glomerulonephropathy (CureGN) Study Consortium.
Show Full Abstract

<h4>Rationale & objective</h4>Patients with glomerular disease (GN) may be at increased risk of severe COVID-19, yet concerns over vaccines causing disease relapse may lead to vaccine hesitancy. We examined the associations of COVID-19 with longitudinal kidney function and proteinuria and compared these with similar associations with COVID-19 vaccination.<h4>Study design</h4>Observational cohort study from July 1, 2021, to January 1, 2023.<h4>Setting & participants</h4>A prospective observational study network of 71 centers from North America and Europe (CureGN) with children and adults with primary minimal change disease, focal segmental glomerulosclerosis, membranous nephropathy, or IgA nephropathy.<h4>Exposure</h4>COVID-19 and COVID-19 vaccination.<h4>Outcome</h4>Repeated measure of estimated glomerular filtration rate (eGFR); recurrent time-to-event outcome of GN disease worsening as defined by doubling of the urinary protein-creatinine ratio (UPCR) to at least 1.5g/g or increase in dipstick urine protein by 2 ordinal levels to 3+(300mg/dL) or above.<h4>Analytical approach</h4>Interrupted time series analysis for eGFR. Prognostic matched sequential stratification recurrent event analysis for GN disease worsening.<h4>Results</h4>Among 2,055 participants, 722 (35%) reported COVID-19 infection; of these, 92 (13%) were hospitalized, and 3 died (<1%). The eGFR slope before COVID-19 infection was-1.40mL/min/1.73m<sup>2</sup> (± 0.29 SD); within 6 months after COVID-19 infection, the eGFR slope was-4.26mL/min/1.73m<sup>2</sup> (± 3.02 SD), which was not significantly different (P=0.34). COVID-19 was associated with increased risk of worsening GN disease activity (HR, 1.35 [95% CI, 1.01-1.80]). Vaccination was not associated with a change in eGFR (-1.34mL/min/1.73m<sup>2</sup>±0.15 SD vs-2.16mL/min/1.73m<sup>2</sup>±1.74 SD; P=0.6) or subsequent GN disease worsening (HR 1.02 [95% CI, 0.79-1.33]) in this cohort.<h4>Limitations</h4>Infrequent or short follow-up.<h4>Conclusions</h4>Among patients with primary GN, COVID-19 infection was severe for 1 in 8 cases and was associated with subsequent worsening of GN disease activity, as defined by proteinuria. By contrast, vaccination against COVID-19 was not associated with change in disease activity or kidney function decline. These results support COVID-19 vaccination for patients with GN.<h4>Plain-language summary</h4>In this cohort study of 2,055 patients with minimal change disease, focal segmental glomerulosclerosis, membranous nephropathy, or IgA nephropathy, COVID-19 resulted in hospitalization or death for 1 in 8 cases and was associated with a 35% increase in risk for worsening proteinuria. By contrast, vaccination did not appear to adversely affect kidney function or proteinuria. Our data support vaccination for COVID-19 in patients with glomerular disease.

Also flagged:TP53p53cutaneous melanomaCDKN2AmelanomaMDM4
Journal Article 2023-08-31 No Snippets Khan SU, Ullah Z, Shaukat H, Unab S, Jannat S, Ali W, Ali A, Irfan M, Khan MF, Cervantes-Villagrana RD.
Show Full Abstract

The present study was the first comprehensive investigation of genetic mutation and expression levels of the p53 signaling genes in cutaneous melanoma through various genetic databases providing large datasets. The mutational landscape of p53 and its signaling genes was higher than expected, with <i>TP53</i> followed by <i>CDKN2A</i> being the most mutated gene in cutaneous melanoma. Furthermore, the expression analysis showed <i>that TP53</i>, <i>MDM2</i>, <i>CDKN2A</i>, and <i>TP53BP1</i> were overexpressed, while <i>MDM4</i> and <i>CDKN2B</i> were under-expressed in cutaneous melanoma. Overall, TCGA data revealed that among all the other p53 signaling proteins, CDKN2A was significantly higher in both sun and non-sun-exposed healthy tissues than in melanoma. Likewise, MDM4 and TP53BP1 expressions were markedly greater in non-sun-exposed healthy tissues compared to other groups. However, CDKN2B expression was higher in the sun-exposed healthy tissues than in other tissues. In addition, various genes were expressed significantly differently among males and females. In addition, <i>CDKN2A</i> was highly expressed in the SK-MEL-30 skin cancer cell line, whereas, Immune cell type expression analysis revealed that the <i>MDM4</i> was highly expressed in naïve B-cells. Furthermore, all six genes were significantly overexpressed in extraordinarily overweight or obese tumor tissues compared to healthy tissues. <i>MDM2</i> expression and tumor stage were closely related. There were differences in gene expression across patient age groups and positive nodal status. <i>TP53</i> showed a positive correlation with B cells, <i>MDM2</i> with CD8+<i>T</i> cells, macrophages and neutrophils, and <i>MDM4</i> with neutrophils. <i>CDKN2A/B</i> had a non-significant correlation with all six types of immune cells. However, <i>TP53BP1</i> was positively correlated with all five types of immune cells except B cells. Only <i>TP53, MDM2</i>, and <i>CDKN2A</i> had a role in cutaneous melanoma-specific tumor immunity. All TP53 and its regulating genes may be predictive for prognosis. The results of the present study need to be validated through future screening, in vivo, and in vitro studies.

Also flagged:Colorectal Cancercancermetabolismbile acidsresveratrolpolyphenols
Journal Article 2023-08-31 No Snippets Celiberto F, Aloisio A, Girardi B, Pricci M, Iannone A, Russo F, Riezzo G, D'Attoma B, Ierardi E, Losurdo G, Di Leo A.
Show Full Abstract

Colorectal cancer (CRC) is one of the leading causes of mortality for cancer in industrialized countries. The link between diet and CRC is well-known, and presumably CRC is the type of cancer which is most influenced by dietary habits. In Western countries, an inadequate dietary intake of fibers is endemic, and this could be a driving factor in the increase of CRC incidence. Indeed, several epidemiologic studies have elucidated an inverse relationship between daily fiber intake and risk of CRC. Long-term prognosis in CRC survivors is also dependent on dietary fibers. Several pathogenetic mechanisms may be hypothesized. Fibers may interfere with the metabolism of bile acids, which may promote colon carcinogenesis. Further, fibers are often contained in vegetables which, in turn, contain large amounts of antioxidant agents like resveratrol, polyphenols, or phytoestrogens. Moreover, fibers can be digested by commensal flora, thus producing compounds such as butyrate, which exerts an antiproliferative effect. Finally, fibers may modulate gut microbiota, whose composition has shown to be associated with CRC onset. In this regard, dietary interventions based on high-fiber-containing diets are ongoing to prevent CRC development, especially in patients with high potential for this type of tumor. Despite the fact that outcomes are preliminary, encouraging results have been observed.

Also flagged:secretionextracellular matrixECM) proteinsECMimmune responseexocytosis
Journal Article 2023-08-31 No Snippets Naudot M, Le Ber J, Marcelo P.
Show Full Abstract

Mesenchymal stem cells (MSCs) are an attractive therapeutic tool for tissue engineering and regenerative medicine owing to their regenerative and trophic properties. The best-known and most widely used are bone marrow MSCs, which are currently being harvested and developed from a wide range of adult and perinatal tissues. MSCs from different sources are believed to have different secretion potentials and production, which may influence their therapeutic effects. To confirm this, we performed a quantitative proteomic analysis based on the TMT technique of MSCs from three different sources: Wharton's jelly (WJ), dental pulp (DP), and bone marrow (BM). Our analysis focused on MSC biological properties of interest for tissue engineering. We identified a total of 611 differentially expressed human proteins. WJ-MSCs showed the greatest variation compared with the other sources. WJ produced more extracellular matrix (ECM) proteins and ECM-affiliated proteins and proteins related to the inflammatory and immune response processes. BM-MSCs expressed more proteins involved in osteogenic, adipogenic, neuronal, or muscular differentiation and proteins involved in paracrine communication. Compared to the other sources, DP-MSCs overexpressed proteins involved in the exocytosis process. The results obtained confirm the existence of differences between WJ, DP, and BM-MSCs and the need to select the MSC origin according to the therapeutic objective sought.

HFE
Also flagged:Post-traumatic stress disorderPTSDanxiety disorderanxietymemoriescognitive impairment
Journal Article 2023-08-31 ✓ 5 Snippets Park HR, Cai M, Yang EJ.
In-Text Gene Mentions

Although there are no reports on the detection of ectopic DGCs in animal models of PTSD, we observed that the levels of DCX+ and Prox1+ cells in the hilus were significantly increased in mice in the SPS+FS group, which was significantly reduced by HFE treatment.

However, HFE treatment significantly reduced the number of c-fos+ and c-fos+/Prox1+ cells in the DG of mice with PTSD (Figure 4A,B).

To determine the effect of HFE in SPS+FS-induced DGC activity in mice with PTSD, we examined the expression of c-fos, an indicator of the neuronal activity of DGCs in the DG.

3.1. Effects of HFE Administration on Serum Corticosterone Levels in PTSD Mice

Overall, these findings suggest that the psychopharmacological mechanism of HFE is mediated through regulation of the Kv4.2/ERK/CREB pathway to restore the hippocampal dysfunction and behavioral abnormalities in SPS+FS-treated mice, suggesting that HFE is a potential treatment for PTSD.

Show Full Abstract

Post-traumatic stress disorder (PTSD) is an anxiety disorder caused by traumatic or frightening events, with intensified anxiety, fear memories, and cognitive impairment caused by a dysfunctional hippocampus. Owing to its complex phenotype, currently prescribed treatments for PTSD are limited. This study investigated the psychopharmacological effects of novel COMBINATION herbal medicines on the hippocampus of a PTSD murine model induced by combining single prolonged stress (SPS) and foot shock (FS). We designed a novel herbal formula extract (HFE) from <i>Chaenomeles sinensis</i>, <i>Glycyrrhiza uralensis</i>, and <i>Atractylodes macrocephala</i>. SPS+FS mice were administered HFE (500 and 1000 mg/kg) once daily for 14 days. The effects of HFE of HFE on the hippocampus were analyzed using behavioral tests, immunostaining, Golgi staining, and Western blotting. HFE alleviated anxiety-like behavior and fear response, improved short-term memory, and restored hippocampal dysfunction, including hippocampal neurogenesis alteration and aberrant migration and hyperactivation of dentate granule cells in SPS+FS mice. HFE increased phosphorylation of the Kv4.2 potassium channel, extracellular signal-regulated kinase, and cAMP response element-binding protein, which were reduced in the hippocampus of SPS+FS mice. Therefore, our study suggests HFE as a potential therapeutic drug for PTSD by improving behavioral impairment and hippocampal dysfunction and regulating Kv4.2 potassium channel-related pathways in the hippocampus.

Also flagged:Calcium phosphatesilicon dioxideHydroxyapatitetricalcium phosphateBioglasssilicon
Journal Article 2023-08-31 No Snippets Kaimonov MR, Safronova TV.
Show Full Abstract

Calcium phosphate materials and materials based on silicon dioxide have been actively studied for more than 50 years due to their high biocompatibility and bioactivity. Hydroxyapatite and tricalcium phosphate are the most known among calcium phosphate materials, and Bioglass 45S5 is the most known material in the Na<sub>2</sub>O-CaO-SiO<sub>2</sub>-P<sub>2</sub>O<sub>5</sub> system. Each of these materials has its application limits; however, some of them can be eliminated by obtaining composites based on calcium phosphate and bioglass. In this article, we provide an overview of the role of silicon and its compounds, including Bioglass 45S5, consider calcium phosphate materials, talk about the limits of each material, demonstrate the potential of the composites based on them, and show the other ways of obtaining composite ceramics in the Na<sub>2</sub>O-CaO-SiO<sub>2</sub>-P<sub>2</sub>O<sub>5</sub> system.

DCC
Also flagged:colony-stimulating factor-1 receptorCSF1RcancerCSF1R kinaseedicotinibdovitinib
Journal Article 2023-08-31 ✓ 3 Snippets Azhar Z, Grose RP, Raza A, Raza Z.
In-Text Gene Mentions

This led to drug screening and the discovery of DCC-3014 which inhibits CSF1R with an IC50 of 3.7 nmol/L [44].

Docked structure of CSF1R kinase domain with small molecule multikinase inhibitor, DCC-3014 (left: 2D and right: 3D) in which interacting residues are depicted as balls colored according to the type of interaction.

Vimseltinib (DCC-3014) is thus termed a selective switch-control CSF1R inhibitor [44].

Show Full Abstract

<h4>Aim</h4>Delineate structure-based inhibition of colony-stimulating factor-1 receptor (CSF1R) by small molecule CSF1R inhibitors in clinical development for target identification and potential lead optimization in cancer therapeutics since CSF1R is a novel predictive biomarker for immunotherapy in cancer.<h4>Methods</h4>Compounds were <i>in silico</i> modelled by induced fit docking protocol in a molecular operating environment (MOE, MOE.v.2015). The 3-dimensional (3D) X-ray crystallized structure of CSF1R kinase (Protein Databank, ID 4R7H) was obtained from Research Collaboratory for Structural Bioinformatics (RSCB) Protein Databank. The 3D conformers of edicotinib, DCC-3014, ARRY-382, BLZ-945, chiauranib, dovitinib, and sorafenib were obtained from PubChem Database. These structures were modelled in Amber10:EHT molecular force field, and quick prep application was used to correct and optimize the structures for missing residues, H-counts, termini capping, and alternates. The binding site was defined within the vicinity of the co-crystallized ligand of CSF1R kinase. The compounds were docked by the triangular matcher placement method and ranked by the London dG scoring function. The docked poses were further refined by the induced fit method. The pose with the lowest binding score (ΔG) was used to model the ligand interaction profile in Discovery Studio Visualizer v17.2. The co-crystallized ligand was docked in its apo conformation, and root-mean-square deviation was computed to validate the docking protocol.<h4>Results</h4>All 7 CSF1R inhibitors interact with residue Met637 exhibiting selectivity except for edicotinib. The inhibitors maintain CSF1R in an auto-inhibitory conformation by interacting with Asp797 of the Asp-Phe-Gly (DFG) motif and/or hindering the conserved salt bridge formed between Glu633 and Lys616 thus stabilizing the activation loop, or interacting with tryptophan residue (Trp550) in the juxtamembrane domain. DCC-3014, ARRY-382, BLZ-945, and sorafenib bind with the lowest binding energy with CSF1R kinase.<h4>Conclusions</h4>Pyrimidines are potent inhibitors that interact with CSF1R residues. DCC-3014 and ARRY-382 exhibit exceptional pharmaceutical potential exhibiting great structural stability and affinity.

Also flagged:microtubuledeathbreast canceracrylamidevinyl pyrrolidoneacrylic acid
Journal Article 2023-08-31 No Snippets Kauser S, Mughees M, Mangangcha IR, Swami S, Wajid S.
Show Full Abstract

<h4>Introduction</h4><i>Artemisia absinthium</i> (wormwood) exhibits anticancer properties by inhibiting proliferation and causing cell death in breast cancer. Targeted drug delivery of <i>A. absinthium</i> nanoformulation using N-isopropyl acrylamide, N-vinyl pyrrolidone, and acrylic acid-based polymeric nanoparticles (NVA-AA NPs) was ensured by utilizing features of the tumor microenvironment, although their mechanism of action involved in cytotoxicity remains unknown.<h4>Methods</h4>The present study employed nano LC-MS/MS to identify differences in secretory protein expression associated with the treatment of breast cancer cell lines (MCF-7; MDA-MB-231) by NVA-AA NPs for the determination of affected pathways and easily accessible therapeutic targets. Different bioinformatics tools were used to identify signature differentially expressed proteins (DEPs) using survival analysis by GENT2 and correlation analysis between their mRNA expressions and sensitivity toward small-molecule drugs as well as immune cell infiltration by GSCA.<h4>Results</h4>Analysis by GENT2 revealed 22 signature DEPs with the most significant change in their expression regulation, namely, gelsolin, alpha-fetoprotein, complement component C3, C7, histone H2B type 1-K, histone H2A.Z, H2AX, heat shock cognate 71 kDa protein, heat shock 70 kDa protein 1-like, cytochrome c somatic, GTP-binding nuclear protein Ran, tubulin beta chain, tubulin alpha-1B chain, tubulin alpha-1C chain, phosphoglycerate mutase 1, kininogen 1, carboxypeptidase N catalytic chain, fibulin-1, peroxiredoxins 4, lactate dehydrogenase C, SPARC, and SPARC-like protein 1. Correlation analysis between their mRNA expressions versus immune cell infiltrates showed a positive correlation with antitumor immune response elicited by these NPs as well as a correlation with drug response shown by the GDSC and CTRP drugs in different cancer cells.<h4>Discussion</h4>Our results suggest that NVA-AA NPs were able to invade the tumor microenvironment; transformed the communication network between the cancer cells; affected potential drivers of microtubular integrity, nucleosome assembly, and cell cycle; and eventually caused cell death.

DCC
Also flagged:tumorssolid tumorscolorectal cancerstumorcancersHNSCC
Journal Article 2023-08-31 ✓ 1 Snippet González-Castrillón LM, Wurmser M, Öhlund D, Wilson SI.
In-Text Gene Mentions

…/Robo, Eph/Ephrin, and Netrin/DCC/Unc pathways among other…

Show Full Abstract

<b>Background:</b> High nerve density in tumors and metastasis via nerves (perineural invasion-PNI) have been reported extensively in solid tumors throughout the body including pancreatic, head and neck, gastric, prostate, breast, and colorectal cancers. Ablation of tumor nerves results in improved disease outcomes, suggesting that blocking nerve-tumor communication could be a novel treatment strategy. However, the molecular mechanisms underlying this remain poorly understood. Thus, the aim here was to identify molecular pathways underlying nerve-tumor crosstalk and to determine common molecular features between PNI-associated cancers. <b>Results:</b> Analysis of head and neck (HNSCC), pancreatic, and gastric (STAD) cancer Gene Expression Omnibus datasets was used to identify differentially expressed genes (DEGs). This revealed extracellular matrix components as highly dysregulated. To enrich for pathways associated with PNI, genes previously correlated with PNI in STAD and in 2 HNSCC studies where tumor samples were segregated by PNI status were analyzed. Neurodevelopmental genes were found to be enriched with PNI. In datasets where tumor samples were not segregated by PNI, neurodevelopmental pathways accounted for 12%-16% of the DEGs. Further dysregulation of axon guidance genes was common to all cancers analyzed. By examining paralog genes, a clear pattern emerged where at least one family member from several axon guidance pathways was affected in all cancers examined. Overall 17 different axon guidance gene families were disrupted, including the ephrin-Eph, semaphorin-neuropilin/plexin, and slit-robo pathways. These findings were validated using The Cancer Genome Atlas and cross-referenced to other cancers with a high incidence of PNI including colon, cholangiocarcinoma, prostate, and breast cancers. Survival analysis revealed that the expression levels of neurodevelopmental gene families impacted disease survival. <b>Conclusion:</b> These data highlight the importance of the tumor as a source of signals for neural tropism and neural plasticity as a common feature of cancer. The analysis supports the hypothesis that dysregulation of neurodevelopmental programs is a common feature associated with PNI. Furthermore, the data suggested that different cancers may have evolved to employ alternative genetic strategies to disrupt the same pathways<i>.</i> Overall, these findings provide potential druggable targets for novel therapies of cancer management and provide multi-cancer molecular biomarkers.

SERPINC1
Also flagged:neurological disordersWDcognitive impairmentcognitionBrain atrophynucleus
Journal Article 2023-08-31 ✓ 1 Snippet Wang G, Jin P, Ma X, Hong X, Zhang L, Lin K, Wen X, Bai X, Han Y.
In-Text Gene Mentions

…Comparison ofACE-III, BBS, and POMA…

Show Full Abstract

<h4>Background</h4>Cognitive and motor dual-tasks play important roles in daily life. Dual-task interference impacting gait performance has been observed not only in healthy subjects but also in subjects with neurological disorders. Approximately 44-75% of Wilson's disease (WD) patients have gait disturbance. According to our earlier research, 59.7% of WD patients have cognitive impairment. However, there are few studies on how cognition affects the gait in WD. Therefore, this study aims to explore the influence of cognitive impairment on gait and its neural mechanism in WD patients and to provide evidence for the clinical intervention of gait disturbance.<h4>Methods</h4>We recruited 63 patients who were divided into two groups based on their scores on the Addenbrooke's cognitive examination III (ACE-III) scale: a non-cognitive impairment group and a cognitive impairment group. In addition to performing the timed up and go (TUG) single task and the cognitive and motor dual-task digital calculation and animal naming tests, the Tinetti Balance and Gait Assessment (POMA), Berg Balance Scale (BBS), and brain MRI severity scale of WD (bMRIsc-WD) were evaluated. The dual-task cost (DTC) was also computed. Between the two groups, the results of the enhanced POMA, BBS, and bMRIsc-WD scales, as well as gait performance measures such as TUG step size, pace speed, pace frequency, and DTC value, were compared.<h4>Results</h4>(1) Among the 63 patients with WD, 30 (47.6%) patients had gait disturbance, and the single task TUG time was more than 10 s. A total of 43 patients had cognitive impairment, the incidence rate is 44.4%. Furthermore, 28 (44.4%) patients had cognitive impairment, 39 (61.9%) patients had abnormal brain MRI. (2) The Tinetti gait balance scale and Berg balance scale scores of patients with cognitive impairment were lower than those of patients without cognitive impairment (<i>p</i> < 0.05), and the pace, step size, and pace frequency in the single task TUG were slower than those of patients without cognitive impairment (<i>p</i> < 0.05). There was no change in the pace frequency between the dual-task TUG and the non-cognitive impairment group, but the pace speed and step size in the dual-task TUG were smaller than non-cognitive impairment group (<i>p</i> < 0.05). There was no difference in DTC values between cognitive impairment group and non-cognitive impairment group when performing dt-TUG number calculation and animal naming respectively (<i>p</i> > 0.05). However, regardless of cognitive impairment or not, the DTC2 values of number calculation tasks is higher than DTC1 of animal naming tasks in dt-TUG (<i>p</i> < 0.05). (3) Pace speed and step size were related to the total cognitive score, memory, language fluency, language understanding, and visual space factor score of the ACE-III (<i>p</i> < 0.05), and step frequency was correlated with memory and language comprehension factors (<i>p</i> < 0.05). There was no correlation between the attention factor scores of the ACE-III and TUG gait parameters of different tasks (<i>p</i> > 0.05). Brain atrophy, the thalamus, caudate nucleus, and cerebellum were correlated with cognitive impairment (<i>p</i> < 0.05), the lenticular nucleus was related to the step size, brain atrophy was related to the pace speed, and the thalamus, caudate nucleus, and midbrain were involved in step frequency in WD patients (<i>p</i> < 0.05).<h4>Conclusion</h4>WD patients had a high incidence of cognitive impairment and gait disorder, the pace speed and step size can reflect the cognitive impairment of WD patients, cognitive impairment affects the gait disorder of WD patients, and the different cognitive and motor dual-tasks were involved in affecting gait parameters. The joint participation of cognitive impairment and lesion brain area may be the principal neural mechanism of gait abnormality in WD patients.

PRDX6
Also flagged:immune responsesdeathAfrican swine fever virus infectionviral diseaseASFV infectioninfection
Journal Article 2023-08-31 ✓ 1 Snippet Cao S, Jia P, Wu Z, Lu H, Cheng Y, Chen C, Zhou M, Zhu S.
In-Text Gene Mentions

…PSAT1, FTL, ANO6,PRDX6, BNIP3, SCD, TFRC,…

Show Full Abstract

The African swine fever virus is a virulent and communicable viral disease that can be transmitted by infected swine, contaminated pork products, or soft tick vectors. Nonstructural proteins encoded by ASFV regulate viral replication, transcription, and evasion. However, the mechanisms underlying the host response to ASFV infection remain incompletely understood. In order to enhance comprehension of the biology and molecular mechanisms at distinct time intervals (6, 12, 24 h) post infection, transcriptome analyses were executed to discern differentially expressed genes (DEGs) between ASFV and mock-infected PAMs. The transcriptomic analysis unveiled a total of 1,677, 2,122, and 2,945 upregulated DEGs and 933, 1,148, and 1,422 downregulated DEGs in ASFV- and mock-infected groups at 6, 12, and 24 h.p.i.. The results of the transcriptomic analysis demonstrated that the infection of ASFV significantly stimulated host metabolism pathways while concurrently inhibiting the expression of various immune responses and cell death pathways. Our study offers crucial mechanistic insights into the comprehension of ASFV viral pathogenesis and the multifaceted host immune responses. The genes that were dysregulated may serve as potential candidates for further exploration of anti-ASFV strategies.

HTT
Also flagged:Neurodegenerative diseasesinclusion bodiesmitochondrialcalciumautophagyautophagosomes
Journal Article 2023-08-31 ✓ 2 Snippets de Wet S, Theart R, Loos B.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by mutations in the huntingtin (HTT) gene and characterized by the initial loss of neurons along the striatum that slowly progresses into other brain regions including the cerebral cortex and hypothalamus (Vonsattel et al., 1985; DiFiglia et al., 1997; Tebbenkamp et al., 2011).

Molecularly, HD has been shown to be as a result of a mutation that causes the expansion of polyQ repeats at the NH2-terminal of the Htt protein (MacDonald et al., 1993).

Show Full Abstract

Neurodegenerative diseases are often characterized by hydrophobic inclusion bodies, and it may be the case that the aggregate-prone proteins that comprise these inclusion bodies are in fact the cause of neurotoxicity. Indeed, the appearance of protein aggregates leads to a proteostatic imbalance that causes various interruptions in physiological cellular processes, including lysosomal and mitochondrial dysfunction, as well as break down in calcium homeostasis. Oftentimes the approach to counteract proteotoxicity is taken to merely upregulate autophagy, measured by an increase in autophagosomes, without a deeper assessment of contributors toward effective turnover through autophagy. There are various ways in which autophagy is regulated ranging from the mammalian target of rapamycin (mTOR) to acetylation status of proteins. Healthy mitochondria and the intracellular energetic charge they preserve are key for the acidification status of lysosomes and thus ensuring effective clearance of components through the autophagy pathway. Both mitochondria and lysosomes have been shown to bear functional protein complexes that aid in the regulation of autophagy. Indeed, it may be the case that minimizing the proteins associated with the respective neurodegenerative pathology may be of greater importance than addressing molecularly their resulting inclusion bodies. It is in this context that this review will dissect the autophagy signaling pathway, its control and the manner in which it is molecularly and functionally connected with the mitochondrial and lysosomal system, as well as provide a summary of the role of autophagy dysfunction in driving neurodegenerative disease as a means to better position the potential of rapamycin-mediated bioactivities to control autophagy favorably.

Also flagged:mitochondriacytosolmembraneketoisocaproateinsulin
Journal Article 2023-08-31 No Snippets Ježek P.
Show Full Abstract

Redox signaling from mitochondria (mt) to the cytosol and plasma membrane (PM) has been scarcely reported, such as in the case of hypoxic cell adaptation or (2-oxo-) 2-keto-isocaproate (KIC) β-like-oxidation stimulating insulin secretion in pancreatic β-cells. Mutual redox state influence between mitochondrial major compartments, the matrix and the intracristal space, and the cytosol is therefore derived theoretically in this article to predict possible conditions, when mt-to-cytosol and mt-to-PM signals may occur, as well as conditions in which the cytosolic redox signaling is not overwhelmed by the mitochondrial antioxidant capacity. Possible peroxiredoxin 3 participation in mt-to-cytosol redox signaling is discussed, as well as another specific case, whereby mitochondrial superoxide release is diminished, whereas the matrix MnSOD is activated. As a result, the enhanced conversion to H<sub>2</sub>O<sub>2</sub> allows H<sub>2</sub>O<sub>2</sub> diffusion into the cytosol, where it could be a predominant component of the H<sub>2</sub>O<sub>2</sub> release. In both of these ways, mt-to-cytosol and mt-to-PM signals may be realized. Finally, the use of redox-sensitive probes is discussed, which disturb redox equilibria, and hence add a surplus redox-buffering to the compartment, where they are localized. Specifically, when attempts to quantify net H<sub>2</sub>O<sub>2</sub> fluxes are to be made, this should be taken into account.

HTT
Also flagged:translationalbehavioralproprioceptionhearinglocomotion-ocular reflex
Journal Article 2023-08-31 ✓ 1 Snippet Alwood JS, Mulavara AP, Iyer J, Mhatre SD, Rosi S, Shelhamer M, Davis C, Jones CW, Mao XW, Desai RI, Whitmire AM, Williams TJ.
In-Text Gene Mentions

Choroidal plexus: TTR (independent of radiation exposure). CSF: Glutamate, GABA, Acetylcholine, Norepinephrine, Dopamine, Serotonin, Vasopressin, Orexin. Tissue: MAPT, HTT, Presenelin-1, APP (independent of radiation exposure), glial and synaptic dysfunction

Show Full Abstract

Biomarkers, ranging from molecules to behavior, can be used to identify thresholds beyond which performance of mission tasks may be compromised and could potentially trigger the activation of countermeasures. Identification of homologous brain regions and/or neural circuits related to operational performance may allow for translational studies between species. Three discussion groups were directed to use operationally relevant performance tasks as a driver when identifying biomarkers and brain regions or circuits for selected constructs. Here we summarize small-group discussions in tables of circuits and biomarkers categorized by (a) sensorimotor, (b) behavioral medicine and (c) integrated approaches (e.g., physiological responses). In total, hundreds of biomarkers have been identified and are summarized herein by the respective group leads. We hope the meeting proceedings become a rich resource for NASA's Human Research Program (HRP) and the community of researchers.

HTT
Also flagged:infectious diseaseinfectionacute encephalomyelitisrabieszoonosisnucleoprotein
Journal Article 2023-08-31 ✓ 1 Snippet Podgoreanu P, Petre A, Tănasă RI, Dinu S, Oprea M, Marandiuc IM, Vlase E.
In-Text Gene Mentions

Pan-lyssavirusdegenerate primers […

Show Full Abstract

The rabies virus is a major zoonosis that causes severe nervous disease in humans, leading to paralysis and death. The world's second anti-rabies center was established in 1888 by Victor Babeș, in Bucharest, where an eponymous strain of rabies was isolated and used to develop a method for immunization. The Babeș strain of the rabies virus was used for over 100 years in Romania to produce a rabies vaccine for human use, based on animal nerve tissue, thus having a proven history of prophylactic use. The present study aimed to sequence the whole genome of the Babeș strain and to explore its genetic relationships with other vaccine strains as well as to characterize its relevant molecular traits. After being adapted for multiplication in cell lines and designated BAB-TMP, 99% of the viral genome was sequenced. The overall organization of the genome is similar to that of other rabies vaccine strains. Phylogenetic analysis indicated that the BAB-TMP strain is closely related to the Russian RV-97 vaccine strain, and both seem to have a common ancestor. The nucleoprotein gene of the investigated genome was the most conserved, and the glycoprotein showed several unique amino acid substitutions within the major antigenic sites and linear epitopes.

DCC
Also flagged:COVID-19GPRlocalizationslocalization
Journal Article 2023-08-31 ✓ 1 Snippet Asafo-Adjei E, Qabhobho T, Adam AM.
In-Text Gene Mentions

DCC-GARCH connectedness…

Show Full Abstract

World economies have experienced rise in uncertainties which has caused misalignments in the already existing nexus between inflation and economic growth. In addition to this, the presence of nonlinearities, asymmetry, heterogeneity, and structural shocks in time series data concerning substantial fluctuations that span systemic crises have rendered time and/or frequency connectedness worthy of investigation. Due to limited studies in this regard, the authors investigated the risk synchronisation among Gross Domestic Product (GDP), Consumer Price Index (CPI), Economic Policy Uncertainty (EPU) and Geopolitical Risk with insights from G8 countries. To achieve the study's purpose, estimation techniques employed included the wavelet approaches (bi-wavelet and partial wavelet), and the wavelet multiple as well as the DCC-GARCH Connectedness approach as robustness. A sample period from January 1997 to August 2021 restricted by consistent data availability was considered. It was discovered that most G8 nations have a comparable relationship between their GDP and CPI. Additionally, significant co-movements between the G8 nations' GDP and CPI straddle crises. Furthermore, the relationship between Russia's GDP and CPI was significantly conditionally influenced by geopolitical risk factors. Own country economic policy uncertainty was the main source of shocks for nations like Canada, France, and the US, whereas, in Germany, Italy, and the UK, Global EPU was a crucial conduit for reducing the lead-lag relationship between GDP and CPI. Outcomes from this study imply that uncertainties pose a more persistent and dynamic challenge to the G8 countries' efforts to achieve sustained economic growth, lessen the negative effects of inflation and deflation, and improve national and regional economic integration.

Also flagged:AnemiaIroniron deficiencybrain developmentmyelinationgestation
Journal Article 2023-08-31 No Snippets Gisslen T, Rao R, Georgieff MK.
Show Full Abstract

The developing brain is particularly vulnerable to extrinsic environmental events such as anemia and iron deficiency during periods of rapid development. Studies of infants with postnatal iron deficiency and iron deficiency anemia clearly demonstrated negative effects on short-term and long-term brain development and function. Randomized interventional trials studied erythropoiesis-stimulating agents and hemoglobin-based red blood cell transfusion thresholds to determine how they affect preterm infant neurodevelopment. Studies of red blood cell transfusion components are limited in preterm neonates. A biomarker strategy measuring brain iron status and health in the preanemic period is desirable to evaluate treatment options and brain response.

bioRxiv 2023-08-31 Preprint (No Snippets API) Greener JG.
Show Full Abstract

Implicit solvent force fields are computationally efficient but can be unsuitable for running molecular dynamics on disordered proteins. Here I improve the a99SB- disp force field and the GBNeck2 implicit solvent model to better describe disordered proteins. Differentiable molecular simulations with 5 ns trajectories are used to jointly optimise 108 parameters to better match explicit solvent trajectories. Simulations with the improved force field better reproduce the radius of gyration and secondary structure content seen in experiments, whilst showing slightly degraded performance on folded proteins and protein complexes. The force field, called GB99dms, reproduces the results of a small molecule binding study and improves agreement to experiment for the aggregation of amyloid peptides. GB99dms, which can be used in OpenMM, is available at https://github.com/greener-group/GB99dms . This work is the first to show that gradients can be obtained directly from nanosecond-length differentiable simulations of biomolecules and highlights the effectiveness of this approach to training whole force fields to match desired properties.

Research Square 2023-08-31 Preprint (No Snippets API) Zhang T, Cheng N, Shao W, Chen M, Liu J.
Show Full Abstract

<h4>Background: </h4> Cardioembolic stroke (CS) and atherosclerosis (AS) are closely linked diseases. However, the pathophysiological mechanisms underlying their coexistence are not yet fully understood. This study sought to investigate the hub genes and pathways involved in the development of both diseases. <h4>Method: </h4> CS (GSE58294) and AS (GSE20129) datasets were downloaded from the Gene Expression Omnibus (GEO) database and a ferroptosis-related gene dataset was downloaded from the Ferroptosis Database (FRDB). Ferroptosis-related differentially expressed genes (FRDEGs) were analyzed using the R ‘edgeR’ and ‘limma’ packages. Gene Ontology and Kyoto Encyclopedia analyses were used to explore the functions of common FRDEGs. Two machine learning algorithms, Least Absolute Shrinkage and Selection Operator (LASSO) regression and Support Vector Machine Recursive Feature Elimination (SVM-RFE), were used to screen for overlapping FRDEGs in CS and AS. Protein-protein interaction (PPI) networks were established using the Search Tool for the Retrieval of Interacting Genes (STRING) database and visualized with Cytoscape. Hub genes were selected using the ‘cytoHubba’ plugin. A total of 69 and 39 FRDEGs were identified in CS and AS, respectively. <h4>Result: </h4> The hub genes, CIRBP, CREB5, MAPK14, PEBP1 , and PTGS2 were screened using multiple methods. The area under the curve was > 0.7 for both models constructed using the CS and AS datasets. In order to verify the prediction results, blood samples from healthy controls, CS patients and AS were collected for qRT-PCR, and the correlation between biomarkers and clinical features was further discussed. There was a high correlation between neutrophils and hub genes. Pathways relating to immune processes, including inflammation, cell migration, and cardiomyocyte apoptosis, were highly related to CIRBP, CREB5, MAPK14, PEBP1 , and PTGS2 . Thus, these genes were defined as hub genes for both CS and AS. <h4>Conclusions: </h4> Inflammation and immune regulation modulated by neutrophil infiltration were found to play a central role in the development of these diseases and may serve as targets for diagnosis and treatment. The findings provide new insights into the pathogenesis of these CS and AS.

Also flagged:polyethylene glycolcancerHER2phospholipidsbindingtumors
Journal Article 2023-08-30 No Snippets Canato E, Grigoletto A, Zanotto I, Tedeschini T, Campara B, Quaglio G, Toffoli G, Mandracchia D, Dinarello A, Tiso N, Argenton F, Sayaf K, Guido M, Gabbia D, De Martin S, Pasut G.
Show Full Abstract

Liposomes play an important role in the field of drug delivery by virtue of their biocompatibility and versatility as carriers. Stealth liposomes, obtained by surface decoration with hydrophilic polyethylene glycol (PEG) molecules, represent an important turning point in liposome technology, leading to significant improvements in the pharmacokinetic profile compared to naked liposomes. Nevertheless, the generation of effective targeted liposomes-a central issue for cancer therapy-has faced several difficulties and clinical phase failures. Active targeting remains a challenge for liposomes. In this direction, a new Super Stealth Immunoliposomes (SSIL2) composed of a PEG-bi-phospholipids derivative is designed that stabilizes the polymer shielding over the liposomes. Furthermore, its counterpart, conjugated to the fragment antigen-binding of trastuzumab (Fab'<sub>TRZ</sub> -PEG-bi-phospholipids), is firmly anchored on the liposomes surface and correctly orients outward the targeting moiety. Throughout this study, the performances of SSIL2 are evaluated and compared to classic stealth liposomes and stealth immunoliposomes in vitro in a panel of cell lines and in vivo studies in zebrafish larvae and rodent models. Overall, SSIL2 shows superior in vitro and in vivo outcomes, both in terms of safety and anticancer efficacy, thus representing a step forward in targeted cancer therapy, and valuable for future development.

DCC
Also flagged:suicidal thoughtssleepanxiety disorderspathogenesispsychiatric disordersschizophrenia
Journal Article 2023-08-30 ✓ 1 Snippet Yuan M, Yang B, Rothschild G, Mann JJ, Sanford LD, Tang X, Huang C, Wang C, Zhang W.
In-Text Gene Mentions

…cue receptor geneDCCin mouse models…

Show Full Abstract

Major depressive disorder (MDD) is a chronic, generally episodic and debilitating disease that affects an estimated 300 million people worldwide, but its pathogenesis is poorly understood. The heritability estimate of MDD is 30-40%, suggesting that genetics alone do not account for most of the risk of major depression. Another factor known to associate with MDD involves environmental stressors such as childhood adversity and recent life stress. Recent studies have emerged to show that the biological impact of environmental factors in MDD and other stress-related disorders is mediated by a variety of epigenetic modifications. These epigenetic modification alterations contribute to abnormal neuroendocrine responses, neuroplasticity impairment, neurotransmission and neuroglia dysfunction, which are involved in the pathophysiology of MDD. Furthermore, epigenetic marks have been associated with the diagnosis and treatment of MDD. The evaluation of epigenetic modifications holds promise for further understanding of the heterogeneous etiology and complex phenotypes of MDD, and may identify new therapeutic targets. Here, we review preclinical and clinical epigenetic findings, including DNA methylation, histone modification, noncoding RNA, RNA modification, and chromatin remodeling factor in MDD. In addition, we elaborate on the contribution of these epigenetic mechanisms to the pathological trait variability in depression and discuss how such mechanisms can be exploited for therapeutic purposes.

Also flagged:ALScoagulationsynaptogenesisglucosemetabolismRBP4
Journal Article 2023-08-30 No Snippets Vu L, Garcia-Mansfield K, Pompeiano A, An J, David-Dirgo V, Sharma R, Venugopal V, Halait H, Marcucci G, Kuo YH, Uechi L, Rockne RC, Pirrotte P, Bowser R.
Show Full Abstract

<h4>Objective</h4>Amyotrophic lateral sclerosis (ALS) is a heterogeneous disease with a complex etiology that lacks biomarkers predicting disease progression. The objective of this study was to use longitudinal cerebrospinal fluid (CSF) samples to identify biomarkers that distinguish fast progression (FP) from slow progression (SP) and assess their temporal response.<h4>Methods</h4>We utilized mass spectrometry (MS)-based proteomics to identify candidate biomarkers using longitudinal CSF from a discovery cohort of SP and FP ALS patients. Immunoassays were used to quantify and validate levels of the top biomarkers. A state-transition mathematical model was created using the longitudinal MS data that also predicted FP versus SP.<h4>Results</h4>We identified a total of 1148 proteins in the CSF of all ALS patients. Pathway analysis determined enrichment of pathways related to complement and coagulation cascades in FPs and synaptogenesis and glucose metabolism in SPs. Longitudinal analysis revealed a panel of 59 candidate markers that could segregate FP and SP ALS. Based on multivariate analysis, we identified three biomarkers (F12, RBP4, and SERPINA4) as top candidates that segregate ALS based on rate of disease progression. These proteins were validated in the discovery and a separate validation cohort. Our state-transition model determined that the overall variance of the proteome over time was predictive of the disease progression rate.<h4>Interpretation</h4>We identified pathways and protein biomarkers that distinguish rate of ALS disease progression. A mathematical model of the CSF proteome determined that the change in entropy of the proteome over time was predictive of FP versus SP.

Also flagged:EGFRtumorcancerbinding5-fluorouracilthiol
Journal Article 2023-08-30 No Snippets Morese PA, Anthony N, Bodnarchuk M, Jennings C, Martin MP, Noble RA, Phillips N, Thomas HD, Wang LZ, Lister A, Noble MEM, Ward RA, Wedge SR, Stewart HL, Waring MJ.
Show Full Abstract

A major drawback of cytotoxic chemotherapy is the lack of selectivity toward noncancerous cells. The targeted delivery of cytotoxic drugs to tumor cells is a longstanding goal in cancer research. We proposed that covalent inhibitors could be adapted to deliver cytotoxic agents, conjugated to the β-position of the Michael acceptor, via an addition-elimination mechanism promoted by covalent binding. Studies on model systems showed that conjugated 5-fluorouracil (5FU) could be released upon thiol addition in relevant time scales. A series of covalent epidermal growth factor receptor (EGFR) inhibitors were synthesized as their 5FU derivatives. Achieving the desired release of 5FU was demonstrated to depend on the electronics and geometry of the compounds. Mass spectrometry and NMR studies demonstrated an anilinoquinazoline acrylate ester conjugate bound to EGFR with the release of 5FU. This work establishes that acrylates can be used to release conjugated molecules upon covalent binding to proteins and could be used to develop targeted therapeutics.

Also flagged:ZNF322Alung cancerZinc finger protein ZNF322Atranscription factorcancerangiogenesis
Journal Article 2023-08-30 No Snippets Huang SH, Hsieh HC, Shieh JM, Su WC, Wang YC.
Show Full Abstract

Zinc finger protein ZNF322A is an oncogenic transcription factor. Overexpression of ZNF322A activates pro-metastasis, cancer stemness, and neo-angiogenesis-related genes to enhance lung cancer progression. However, the upstream regulator of ZNF322A is not well defined. Dysregulation of microRNAs (miRNAs) can mediate cancer cell growth, migration, and invasion to promote tumorigenesis. Here, we uncover the mechanism of miRNA-mediated transcriptional regulation in ZNF322A-driven oncogenic events. ZNF322A harbors several putative miRNA-binding sites in the 3'-untranslated region (UTR). We validated that miR-326 downregulated ZNF322A-3'-UTR luciferase activity and mRNA expression. Furthermore, miR-326 suppressed the expression of ZNF322A-driven cancer-associated genes such as cyclin D1 and alpha-adducin. Reconstitution experiments by ectopic overexpression of ZNF322A abolished miR-326-suppressed cancer cell proliferation and cell migration capacity. Moreover, miR-326 attenuated ZNF322A-induced tumor growth and lung tumor metastasis in vivo. Clinically, the expression of miR-326 negatively correlated with ZNF322A mRNA expression in surgically resected tissues from 120 non-small cell lung cancer (NSCLC) patients. Multivariate Cox regression analysis demonstrated that NSCLC patients with low miR-326/high ZNF322A profile showed poor overall survival. Our results reveal that the deregulated expression of miR-326 leads to hyperactivation of ZNF322A-driven oncogenic signaling. Targeting the miR-326/ZNF322A axis would provide new therapeutic strategies for lung cancer patients.

OLFM4
Also flagged:inflammatory bowel diseaseinfectionorganizationcholesterolsynthesismetabolism
Journal Article 2023-08-30 ✓ 1 Snippet Bao W, You Y, Ni J, Hou H, Lyu J, Feng G, Wang Y, You K, Zhang S, Zhang L, Cao X, Wang X, Li H, Li H, Xu J, Liu C, Luo X, Du P, Chen D, Shen X.
In-Text Gene Mentions

…CBC stem cells (OLFM4+ ) (…

Show Full Abstract

Intestinal stem cell (ISC) is a promising therapeutic target for inflammatory bowel disease. Cholesterol availability is critical for ISC stemness. Low plasma cholesterol is a typical feature of Crohn's disease (CD); however, its impact on mucosal healing remains unclear. Here, we identified an essential role of sorting nexin 10 (SNX10) in maintaining the stemness of ISCs. SNX10 expression in intestinal tissues positively correlates with the severity of human CD and mouse colitis. Conditional SNX10 knockout in intestinal epithelial cells or ISCs promotes intestinal mucosal repair by maintaining the ISC population associated with increased intracellular cholesterol synthesis. Disassociation of ERLIN2 with SCAP by SNX10 deletion enhances the activation of SREBP2, resulting in increased cholesterol biosynthesis. DC-SX029, a small-molecule inhibitor of SNX10, was used to verify the druggable potential of SNX10 for the treatment of patients with CD. Our study provides a strategy for mucosal healing through SREBP2-mediated stemness restoration of ISCs.

HFE
Also flagged:Heart failureageingobesitydiabetes mellitushypertensionsodium–glucose cotransporter 2
Journal Article 2023-08-30 ✓ 1 Snippet Chai K, Luo Y, Zhang M, Liu Y, Li Y, Cheng Y, Zhu W, Meng C, Yang J, Wang H.
In-Text Gene Mentions

…of myocardial amyloidosis,hemochromatosis, Fabry disease, cardiomyopath…

Show Full Abstract

<h4>Introduction</h4>Heart failure (HF) with preserved ejection fraction (HFpEF) has become the main type of HF worldwide. Although large randomised controlled studies have demonstrated the beneficial effects of sodium-glucose cotransporter 2 inhibitors among patients with HFpEF, the mechanisms remain unclear. Basic research suggests that empagliflozin inhibits myocardial fibrosis. Myocardial extracellular volume (ECV) can be calculated using cardiac MRI (CMRI), which can reflect the degree of diffuse myocardial fibrosis. Studies show that empagliflozin can reduce ECV and left ventricular mass (LVM) assessed by CMRI in patients with diabetes with coronary heart disease and patients without diabetes with HF with reduced ejection fraction. However, whether empagliflozin reduces ECV and LVM among patients with HFpEF is unclear. This study intends to use CMRI to evaluate ECV and LVM, combined with echocardiography and an assessment of related biomarkers, to determine whether empagliflozin can improve myocardial fibrosis and left ventricular remodelling in patients with HFpEF.<h4>Methods and analysis</h4>This report describes the study design of a prospective, multicentre, randomised, double-blind, placebo-controlled and parallel-group clinical study. A total of 180 participants with HFpEF aged 40-80 years old who meet the inclusion and exclusion criteria will be randomly divided into an empagliflozin treatment group or a placebo control group. The empagliflozin treatment group will receive 10 mg of empagliflozin per day for 6 months in addition to guideline-directed medical treatment, while the control group will receive placebo oral administration with guideline-directed medical therapy for 6 months. The primary outcomes are ECV and LVM changes measured by CMRI after 6 months of treatment.<h4>Ethics and dissemination</h4>The study design is approved by the ethical committee of Beijing Hospital (2022BJYYEC-070-02). The trial is registered at the Chinese Clinical Trial Registry (http://www.chictr.org.cn). The trial results will be published in peer-reviewed journals and conferences.<h4>Trial registration number</h4>Chinese Clinical Trial Registry (ChiCTR2200060862).

PRDX6
Also flagged:Liver fibrosisNucleophosminNPMnucleolar phosphorylated proteincell proliferationcirrhosis
Journal Article 2023-08-30 ✓ 5 Snippets Ding X, Zhu XL, Xu DH, Li S, Yang Q, Feng X, Wei YG, Li H, Yang L, Zhang YJ, Deng XL, Liu KC, Shi SL.
In-Text Gene Mentions

Therefore, NPM decreased ROS in HSCs by activating Akt or by upregulating PRDX6, thus protecting the activated HSCs from apoptosis and promoting liver fibrosis.

…by antioxidant proteinPRDX6in tumor cells…

…and by regulatingPRDX6expression, thereby promoting…

…the antioxidant proteinPRDX6, thus protecting cells…

…or by upregulatingPRDX6, thus protecting the…

Show Full Abstract

Liver fibrosis is caused by a variety of chronic liver injuries and has caused significant morbidity and mortality in the world with increasing tendency. Elucidation of the molecular mechanism of liver fibrosis is the basis for intervention of this pathological process and drug development. Nucleophosmin (NPM) is a widely expressed nucleolar phosphorylated protein, which is particularly important for cell proliferation, differentiation and survival. The biological role of NPM in liver fibrosis remains unknown. Here we show that NPM promotes liver fibrosis through multiple pathways. Our study found that NPM was up-regulated in cirrhosis tissues and activated in hepatic stellate cells (HSCs). NPM inhibition reduced liver fibrosis markers expression in HSCs and inhibited the HSCs proliferation and migration. In mice model, NPM knockdown in HSCs or application of specific NPM inhibitor can remarkably attenuate hepatic fibrosis. Mechanistic analysis showed that NPM promotes hepatic fibrosis by inhibiting HSCs apoptosis through Akt/ROS pathway and by upregulating TGF-β2 through Akt-induced lncMIAT. LncMIAT up-regulated TGF-β2 mRNA by competitively sponging miR-16-5p. In response to liver injury, hepatocytes, Kupffer cells and HSCs up-regulated NPM to increase TGF-β2 secretion to activate HSCs in a paracrine or autocrine manner, leading to increased liver fibrosis. Our study demonstrated that NPM regulated hepatotoxin-induced fibrosis through Akt/ROS-induced apoptosis of HSCs and via the Akt/lncMIAT-up-regulated TGF-β2. Inhibition of NPM or application of NPM inhibitor CIGB300 remarkably attenuated liver fibrosis. NPM serves a potential new drug target for liver fibrosis.

DCC
Also flagged:cognitionorganizationSMADNGN2polyethylenimineborate
Journal Article 2023-08-30 ✓ 3 Snippets Habibollahi F, Kagan BJ, Kagan BJ, Burkitt AN, French C.
In-Text Gene Mentions

…was found betweenDCCand H/M ratio…

…10 −3 forDCCin the Motor…

…variation in meanDCCbetween different feedback…

Show Full Abstract

Understanding how brains process information is an incredibly difficult task. Amongst the metrics characterising information processing in the brain, observations of dynamic near-critical states have generated significant interest. However, theoretical and experimental limitations associated with human and animal models have precluded a definite answer about when and why neural criticality arises with links from attention, to cognition, and even to consciousness. To explore this topic, we used an in vitro neural network of cortical neurons that was trained to play a simplified game of 'Pong' to demonstrate Synthetic Biological Intelligence (SBI). We demonstrate that critical dynamics emerge when neural networks receive task-related structured sensory input, reorganizing the system to a near-critical state. Additionally, better task performance correlated with proximity to critical dynamics. However, criticality alone is insufficient for a neuronal network to demonstrate learning in the absence of additional information regarding the consequences of previous actions. These findings offer compelling support that neural criticality arises as a base feature of incoming structured information processing without the need for higher order cognition.

BTN2A1
Also flagged:cancertumoursbutyrophilin 2A1tumourcell surfaceAMPK
Journal Article 2023-08-30 ✓ 5 Snippets Mamedov MR, Vedova S, Freimer JW, Sahu AD, Ramesh A, Arce MM, Meringa AD, Ota M, Chen PA, Chen PA, Hanspers K, Nguyen VQ, Takeshima KA, Rios AC, Pritchard JK, Kuball J, Sebestyen Z, Adams EJ, Marson A.
In-Text Gene Mentions

Vγ9Vδ2 T cells-the most abundant subset of human γδ T cells<sup>4</sup>-recognize a protein complex containing butyrophilin 2A1 (BTN2A1) and BTN3A1 (refs. <sup>6-8</sup>), a widely expressed cell surface protein that is activated by phosphoantigens abundantly produced by tumour cells.

…both BTN3A andBTN2A1during metabolic crises…

…expression of theBTN2A1-BTN3A complex and increased…

…containing butyrophilin 2A1 (BTN2A1) and BTN3A1 6…

BTN2A1

Show Full Abstract

γδ T cells are potent anticancer effectors with the potential to target tumours broadly, independent of patient-specific neoantigens or human leukocyte antigen background<sup>1-5</sup>. γδ T cells can sense conserved cell stress signals prevalent in transformed cells<sup>2,3</sup>, although the mechanisms behind the targeting of stressed target cells remain poorly characterized. Vγ9Vδ2 T cells-the most abundant subset of human γδ T cells<sup>4</sup>-recognize a protein complex containing butyrophilin 2A1 (BTN2A1) and BTN3A1 (refs. <sup>6-8</sup>), a widely expressed cell surface protein that is activated by phosphoantigens abundantly produced by tumour cells. Here we combined genome-wide CRISPR screens in target cancer cells to identify pathways that regulate γδ T cell killing and BTN3A cell surface expression. The screens showed previously unappreciated multilayered regulation of BTN3A abundance on the cell surface and triggering of γδ T cells through transcription, post-translational modifications and membrane trafficking. In addition, diverse genetic perturbations and inhibitors disrupting metabolic pathways in the cancer cells, particularly ATP-producing processes, were found to alter BTN3A levels. This induction of both BTN3A and BTN2A1 during metabolic crises is dependent on AMP-activated protein kinase (AMPK). Finally, small-molecule activation of AMPK in a cell line model and in patient-derived tumour organoids led to increased expression of the BTN2A1-BTN3A complex and increased Vγ9Vδ2 T cell receptor-mediated killing. This AMPK-dependent mechanism of metabolic stress-induced ligand upregulation deepens our understanding of γδ T cell stress surveillance and suggests new avenues available to enhance γδ T cell anticancer activity.

FBXL4
Also flagged:waterhomeostasisenergy homeostasisATRHIF1ANbehavioral
Journal Article 2023-08-30 ✓ 1 Snippet Peng X, Cheng J, Li H, Feijó A, Xia L, Ge D, Wen Z, Yang Q.
In-Text Gene Mentions

…( AASS andFBXL4), lipid metabolism…

Show Full Abstract

<h4>Background</h4>Environmental conditions vary among deserts across the world, spanning from hyper-arid to high-elevation deserts. However, prior genomic studies on desert adaptation have focused on desert and non-desert comparisons overlooking the complexity of conditions within deserts. Focusing on the adaptation mechanisms to diverse desert environments will advance our understanding of how species adapt to extreme desert environments. The hairy-footed jerboas are well adapted to diverse desert environments, inhabiting high-altitude arid regions, hyper-arid deserts, and semi-deserts, but the genetic basis of their adaptation to different deserts remains unknown.<h4>Results</h4>Here, we sequenced the whole genome of 83 hairy-footed jerboas from distinct desert zones in China to assess how they responded under contrasting conditions. Population genomics analyses reveal the existence of three species in hairy-footed jerboas distributed in China: Dipus deasyi, Dipus sagitta, and Dipus sowerbyi. Analyses of selection between high-altitude desert (elevation ≥ 3000m) and low-altitude desert (< 500m) populations identified two strongly selected genes, ATR and HIF1AN, associated with intense UV radiation and hypoxia in high-altitude environments. A number of candidate genes involved in energy and water homeostasis were detected in the comparative genomic analyses of hyper-arid desert (average annual precipitation < 70mm) and arid desert (< 200mm) populations versus semi-desert (> 360mm) populations. Hyper-arid desert animals also exhibited stronger adaptive selection in energy homeostasis, suggesting water and resource scarcity may be the main drivers of desert adaptation in hairy-footed jerboas.<h4>Conclusions</h4>Our study challenges the view of deserts as homogeneous environments and shows that distinct genomic adaptations can be found among desert animals depending on their habitats.

TNFSF4
Also flagged:hepatocellular carcinomatumorPD1CTLA4liver cancerHBV infection
Journal Article 2023-08-30 ✓ 1 Snippet Feng Q, Huang Z, Song L, Wang L, Lu H, Wu L.
In-Text Gene Mentions

…TNFRSF18, CD44, TNFRSF9,TNFSF4and BTNL2 expression…

Show Full Abstract

<h4>Background</h4>The application of molecular targeting therapy and immunotherapy has notably prolonged the survival of patients with hepatocellular carcinoma (HCC). However, multidrug resistance and high molecular heterogeneity of HCC still prevent the further improvement of clinical benefits. Dysfunction of tumor-infiltrating natural killer (NK) cells was strongly related to HCC progression and survival benefits of HCC patients. Hence, an NK cell-related prognostic signature was built up to predict HCC patients' prognosis and immunotherapeutic response.<h4>Methods</h4>NK cell markers were selected from scRNA-Seq data obtained from GSE162616 data set. A consensus machine learning framework including a total of 77 algorithms was developed to establish the gene signature in TCGA-LIHC data set, GSE14520 data set, GSE76427 data set and ICGC-LIRI-JP data set. Moreover, the predictive efficacy on ICI response was externally validated by GSE91061 data set and PRJEB23709 data set.<h4>Results</h4>With the highest C-index among 77 algorithms, a 11-gene signature was established by the combination of LASSO and CoxBoost algorithm, which classified patients into high- and low-risk group. The prognostic signature displayed a good predictive performance for overall survival rate, moderate to high predictive accuracy and was an independent risk factor for HCC patients' prognosis in TCGA, GEO and ICGC cohorts. Compared with high-risk group, low-risk patients showed higher IPS-PD1 blocker, IPS-CTLA4 blocker, common immune checkpoints expression but lower TIDE score, which indicated low-risk patients might be prone to benefiting from ICI treatment. Moreover, a real-world cohort, PRJEB23709, also revealed better immunotherapeutic response in low-risk group.<h4>Conclusions</h4>Overall, the present study developed a gene signature based on NK cell-related genes, which offered a novel platform for prognosis and immunotherapeutic response evaluation of HCC patients.

SERPINC1
Also flagged:Middle Eastern Respiratory SyndromeSevere Acute Respiratory Syndromecriticalrespiratory disordersCOVID-19angiotensin-converting enzyme2
Journal Article 2023-08-30 ✓ 1 Snippet Tyagi K, Rai P, Gautam A, Kaur H, Kapoor S, Suttee A, Jaiswal PK, Sharma A, Singh G, Barnwal RP.
In-Text Gene Mentions

…and antithrombin III (ATIII) is a prognostic…

Show Full Abstract

<h4>Background</h4>Coronaviruses such as Severe Acute Respiratory Syndrome coronavirus (SARS), Middle Eastern Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) are associated with critical illnesses, including severe respiratory disorders. SARS-CoV-2 is the causative agent of the deadly COVID-19 illness, which has spread globally as a pandemic. SARS-CoV-2 may enter the human body through olfactory lobes and interact with the angiotensin-converting enzyme2 (ACE2) receptor, further facilitating cell binding and entry into the cells. Reports have shown that the virus can pass through the blood-brain barrier (BBB) and enter the central nervous system (CNS), resulting in various disorders. Cell entry by SARS-CoV-2 largely relies on TMPRSS2 and cathepsin L, which activate S protein. TMPRSS2 is found on the cell surface of respiratory, gastrointestinal and urogenital epithelium, while cathepsin-L is a part of endosomes.<h4>Aim</h4>The current review aims to provide information on how SARS-CoV-2 infection affects brain function.. Furthermore, CNS disorders associated with SARS-CoV-2 infection, including ischemic stroke, cerebral venous thrombosis, Guillain-Barré syndrome, multiple sclerosis, meningitis, and encephalitis, are discussed. The many probable mechanisms and paths involved in developing cerebrovascular problems in COVID patients are thoroughly detailed.<h4>Main body</h4>There have been reports that the SARS-CoV-2 virus can cross the blood-brain barrier (BBB) and enter the central nervous system (CNS), where it could cause a various illnesses. Patients suffering from COVID-19 experience a range of neurological complications, including sleep disorders, viral encephalitis, headaches, dysgeusia, and cognitive impairment. The presence of SARS-CoV-2 in the cerebrospinal fluid (CSF) of COVID-19 patients has been reported. Health experts also reported its presence in cortical neurons and human brain organoids. The possible mechanism of virus infiltration into the brain can be neurotropic, direct infiltration and cytokine storm-based pathways. The olfactory lobes could also be the primary pathway for the entrance of SARS-CoV-2 into the brain.<h4>Conclusions</h4>SARS-CoV-2 can lead to neurological complications, such as cerebrovascular manifestations, motor movement complications, and cognitive decline. COVID-19 infection can result in cerebrovascular symptoms and diseases, such as strokes and thrombosis. The virus can affect the neural system, disrupt cognitive function and cause neurological disorders. To combat the epidemic, it is crucial to repurpose drugs currently in use quickly and develop novel therapeutics.

Also flagged:degradationmacroautophagymicroautophagymetabolismagingcell cycle
Journal Article 2023-08-30 No Snippets Yao R, Shen J.
Show Full Abstract

Chaperone-mediated autophagy (CMA) is a lysosomal degradation pathway that eliminates substrate proteins through heat-shock cognate protein 70 recognition and lysosome-associated membrane protein type 2A-assisted translocation. It is distinct from macroautophagy and microautophagy. In recent years, the regulatory mechanisms of CMA have been gradually enriched, including the newly discovered NRF2 and p38-TFEB signaling, as positive and negative regulatory pathways of CMA, respectively. Normal CMA activity is involved in the regulation of metabolism, aging, immunity, cell cycle, and other physiological processes, while CMA dysfunction may be involved in the occurrence of neurodegenerative disorders, tumors, intestinal disorders, atherosclerosis, and so on, which provides potential targets for the treatment and prediction of related diseases. This article describes the general process of CMA and its role in physiological activities and summarizes the connection between CMA and macroautophagy. In addition, human diseases that concern the dysfunction or protective role of CMA are discussed. Our review deepens the understanding of the mechanisms and physiological functions of CMA and provides a summary of past CMA research and a vision of future directions.

HFE
Also flagged:Metabolic SyndromeMetabolic-dysfunction-associatedsteatotic liver diseaseliver diseaseLiver fibrosisaspartate aminotransferase
Journal Article 2023-08-30 ✓ 1 Snippet Solomon A, Cipăian CR, Negrea MO, Boicean A, Mihaila R, Beca C, Popa ML, Grama SM, Teodoru M, Neamtu B.
In-Text Gene Mentions

…and autoimmune hepatitis,hemochromatosis, Wilson disease, celiac…

Show Full Abstract

Metabolic-dysfunction-associated steatotic liver disease (MASLD) and metabolic syndrome (MetS) are inextricably linked conditions, both of which are experiencing an upward trend in prevalence, thereby exerting a substantial clinical and economic burden. The presence of MetS should prompt the search for metabolic-associated liver disease. Liver fibrosis is the main predictor of liver-related morbidity and mortality. Non-invasive tests (NIT) such as the Fibrosis-4 index (FIB4), aspartate aminotransferase-to-platelet ratio index (APRI), aspartate aminotransferase-to-alanine aminotransferase ratio (AAR), hepatic steatosis index (HIS), transient elastography (TE), and combined scores (AGILE3+, AGILE4) facilitate the detection of liver fibrosis or steatosis. Our study enrolled 217 patients with suspected MASLD, 109 of whom were diagnosed with MetS. We implemented clinical and biological evaluations complemented by transient elastography (TE) to discern the most robust predictors for liver disease manifestation patterns. Patients with MetS had significantly higher values of FIB4, APRI, HSI, liver stiffness, and steatosis parameters measured by TE, as well as AGILE3+ and AGILE4 scores. Machine-learning algorithms enhanced our evaluation. A two-step cluster algorithm yielded three clusters with reliable model quality. Cluster 1 contained patients without significant fibrosis or steatosis, while clusters 2 and 3 showed a higher prevalence of significant liver fibrosis or at least moderate steatosis as measured by TE. A decision tree algorithm identified age, BMI, liver enzyme levels, and metabolic syndrome characteristics as significant factors in predicting cluster membership with an overall accuracy of 89.4%. Combining NITs improves the accuracy of detecting patterns of liver involvement in patients with suspected MASLD.

Also flagged:fibroidleiomyomastumorsfibroidsPGR-Aprogesterone
Journal Article 2023-08-30 No Snippets Chuang TD, Ton N, Rysling S, Quintanilla D, Boos D, Gao J, McSwiggin H, Yan W, Khorram O.
Show Full Abstract

The objective of this study was to determine if the aberrant expression of select genes could form the basis for the racial disparity in fibroid characteristics. The next-generation RNA sequencing results were analyzed as fold change [leiomyomas/paired myometrium, also known as differential expression (DF)], comparing specimens from White (n = 7) and Black (n = 12) patients. The analysis indicated that 95 genes were minimally changed in tumors from White (DF ≈ 1) but were significantly altered by more than 1.5-fold (up or down) in Black patients. Twenty-one novel genes were selected for confirmation in 69 paired fibroids by qRT-PCR. Among these 21, coding of transcripts for the differential expression of <i>FRAT2</i>, <i>SOX4</i>, <i>TNFRSF19</i>, <i>ACP7</i>, <i>GRIP1</i>, <i>IRS4</i>, <i>PLEKHG4B</i>, <i>PGR</i>, <i>COL24A1</i>, <i>KRT17</i>, <i>MMP17</i>, <i>SLN</i>, <i>CCDC177</i>, <i>FUT2</i>, <i>MYO5B</i>, <i>MYOG</i>, <i>ZNF703</i>, <i>CDC25A</i>, and <i>CDCA7</i> was significantly higher, while the expression of <i>DAB2</i> and <i>CAV2</i> was significantly lower in tumors from Black or Hispanic patients compared with tumors from White patients. Western blot analysis revealed a greater differential expression of PGR-A and total progesterone (PGR-A and PGR-B) in tumors from Black compared with tumors from White patients. Collectively, we identified a set of genes uniquely expressed in a race/ethnicity-dependent manner, which could form the underlying mechanisms for the racial disparity in fibroids and their associated symptoms.

HFE
Also flagged:Ironcardiometabolic disordersneurological disorderscancersoxygenmyoglobin
Journal Article 2023-08-30 ✓ 5 Snippets Zeitoun T, El-Sohemy A.
In-Text Gene Mentions

A third common SNP in the HFE gene responsible for HH is rs1800730, which is characterized by an adenine-to-tyrosine (A→T) substitution at nucleotide 193, where serine is replaced by cytosine at position 65 of the protein and is known as the S65C polymorphism [29,30].

MR analyses have also been conducted assessing the role of iron in sarcopenia, using HFE C282Y and H63D genotypes and TMPRSS6 rs855791.

Findings from [54], and others also demonstrate an association between the risk variant of HFE C282Y and higher risk of type 2 diabetes, indicating that higher iron levels may not be protective against type 2 diabetes [54,55].

Primary haemochromatosis, also known as hereditary haemochromatosis (HH), is typically caused by a mutation in the haemostatic iron regulator (HFE) gene, which results in an excessive build-up of iron in the body and is the most common form of haemochromatosis [12].

Results from a previous meta-analysis shows an association between HFE C282Y and a higher risk of breast cancer, colorectal cancer, hepatocellular carcinoma, and total cancer in over 87,000 participants [75].

Show Full Abstract

Iron has been shown to play a dual role in health and disease, with either a protective or harmful effect. Some of the contradictory findings from observational studies may be due to reverse causation, residual confounding, or small sample size. One approach that may overcome these limitations without the high cost of randomized control trials is the use of Mendelian randomization to examine the long-term role of iron in a variety of health outcomes. As there is emerging evidence employing Mendelian randomization as a method of assessing the role of micronutrients in health and disease, this narrative review will highlight recent Mendelian randomization findings examining the role of iron in cardiometabolic disorders, inflammation, neurological disorders, different cancers, and a number of other health-related outcomes.

Also flagged:neurodegenerative diseasesagingFXTASneurodegenerative disorderfragile X messenger ribonucleoprotein 1FMR1
Journal Article 2023-08-30 No Snippets Zafarullah M, Li J, Salemi MR, Phinney BS, Durbin-Johnson BP, Hagerman R, Hessl D, Rivera SM, Tassone F.
Show Full Abstract

Fragile X-associated Tremor/Ataxia Syndrome (FXTAS) is a neurodegenerative disorder associated with the <i>FMR1</i> premutation. Currently, it is not possible to determine when and if individual premutation carriers will develop FXTAS. Thus, with the aim to identify biomarkers for early diagnosis, development, and progression of FXTAS, along with associated dysregulated pathways, we performed blood proteomic profiling of premutation carriers (PM) who, as part of an ongoing longitudinal study, emerged into two distinct groups: those who developed symptoms of FXTAS (converters, CON) over time (at subsequent visits) and those who did not (non-converters, NCON). We compared these groups to age-matched healthy controls (HC). We assessed CGG repeat allele size by Southern blot and PCR analysis. The proteomic profile was obtained by liquid chromatography mass spectrometry (LC-MS/MS). We identified several significantly differentiated proteins between HC and the PM groups at Visit 1 (V1), Visit 2 (V2), and between the visits. We further reported the dysregulated protein pathways, including sphingolipid and amino acid metabolism. Our findings are in agreement with previous studies showing that pathways involved in mitochondrial bioenergetics, as observed in other neurodegenerative disorders, are significantly altered and appear to contribute to the development of FXTAS. Lastly, we compared the blood proteome of the PM who developed FXTAS over time with the CSF proteome of the FXTAS patients recently reported and found eight significantly differentially expressed proteins in common. To our knowledge, this is the first report of longitudinal proteomic profiling and the identification of unique biomarkers and dysregulated protein pathways in FXTAS.

OLFM4
Also flagged:Biliary obstructiongallstonestumorsdamageinfectionsmalnutrition
Journal Article 2023-08-30 ✓ 5 Snippets Li Z, Dong H, Bian S, Wu H, Song W, Jia X, Chen J, Zhu X, Zhao L, Xuan Z, Jin C, Zhou M, Zheng S, Song P.
In-Text Gene Mentions

…( Lgr5 andOlfm4) was significantly…

…including Lgr5 andOlfm4( Figure 2…

…The number ofOlfm4-positive cells significantly …

…The loss ofOlfm4-positive stem cells in…

…the expression ofOlfm4was significantly higher…

Show Full Abstract

Biliary obstruction diseases are often complicated by an impaired intestinal barrier, which aggravates liver injury. Treatment of the intestinal barrier is often neglected. To investigate the mechanism by which intestinal bile acid deficiency mediates intestinal barrier dysfunction after biliary obstruction and identify a potential therapeutic modality, we mainly used a bile duct ligation (BDL) mouse model to simulate biliary obstruction and determine the important role of the bile acid receptor FXR in maintaining intestinal barrier function and stemness. Through RNA-seq analysis of BDL and sham mouse crypts and qRT-PCR performed on intestinal epithelial-specific <i>Fxr</i> knockout (<i>Fxr</i><sup>ΔIEC</sup>) and wild-type mouse crypts, we found that FXR might maintain intestinal stemness by regulating CYP11A1 expression. Given the key role of CYP11A1 during glucocorticoid production, we also found that FXR activation could promote intestinal corticosterone (CORT) synthesis by ELISA. Intestinal organoid culture showed that an FXR agonist or corticosterone increased crypt formation and organoid growth. Further animal experiments showed that corticosterone gavage treatment could maintain intestinal barrier function and stemness, decrease LPS translocation, and attenuate liver injury in BDL mice. Our study hopefully provides a new theoretical basis for the prevention of intestinal complications and alleviation of liver injury after biliary obstruction.

Also flagged:Zinc IonsYY1transcription factorcancerstumorzinc
Journal Article 2023-08-30 No Snippets Figiel M, Górka AK, Górecki A.
Show Full Abstract

YY1 is widely recognized as an intrinsically disordered transcription factor that plays a role in development of many cancers. In most cases, its overexpression is correlated with tumor progression and unfavorable patient outcomes. Our latest research focusing on the role of zinc ions in modulating YY1's interaction with DNA demonstrated that zinc enhances the protein's multimeric state and affinity to its operator. In light of these findings, changes in protein concentration appear to be just one element relevant to modulating YY1-dependent processes. Thus, alterations in zinc ion concentration can directly and specifically impact the regulation of gene expression by YY1, in line with reports indicating a correlation between zinc ion levels and advancement of certain tumors. This review concentrates on other potential consequences of YY1 interaction with zinc ions that may act by altering charge distribution, conformational state distribution, or oligomerization to influence its interactions with molecular partners that can disrupt gene expression patterns.

SERPINC1
Also flagged:waterclot formationCoagulationWound HealingKeratinizationsalt
Journal Article 2023-08-30 ✓ 5 Snippets Hoen L, Pfeffer D, Schmidt JR, Kraft J, Hildebrand J, Kalkhof S.
In-Text Gene Mentions

…Prothrombin andAntithrombin-IIIwere significantly lower…

…Certainly,Antithrombin-III(ATIII) is also…

…Certainly, Antithrombin-III (ATIII) is also less…

…the measurement ofATIII[ 30 ].…

…that could influenceATIIIlevels, whereas four…

Show Full Abstract

Due to multifactorial reasons, such as decreased thirst and decreased total body water, elderly patients are vulnerable to dehydration. The study aims to investigate whether moderate dehydration or hyperhydration affects the blood proteome. Blood samples, medication, and bioelectrical impedance analysis (BIA) details were collected from 131 geriatric patients (77 women and 54 men aged 81.1 ± 7.2 years). Based on an evaluation by Bioelectrical Impedance Vector Analyses (BIVAs) of this cohort, for each hydration status (dehydrated, hyperhydrated, and control), five appropriate blood plasma samples for both males and females were analyzed by liquid chromatography-mass spectrometry (LC-MS). Overall, 262 proteins for female patients and 293 proteins for male patients could be quantified. A total of 38 proteins had significantly different abundance, showing that hydration status does indeed affect the plasma proteome. Protein enrichment analysis of the affected proteins revealed "Wound Healing" and "Keratinization" as the two main biological processes being dysregulated. Proteins involved in clot formation are especially affected by hydration status.

Also flagged:MagnesiumHydroxyapatitemineralsynthesiscalciumcalcium phosphates
Journal Article 2023-08-30 No Snippets Bystrov VS, Paramonova EV, Avakyan LA, Eremina NV, Makarova SV, Bulina NV.
Show Full Abstract

Hydroxyapatite (HAP) is the main mineral component of bones and teeth. It is widely used in medicine as a bone filler and coating for implants to promote new bone growth. Ion substitutions into the HAP structure highly affect its properties. One of the most important substituents is magnesium. This paper presents new results obtained using high-precision hybrid density functional theory calculations for Mg/Ca substitutions in HAP in a wide magnesium concentration range within a 2 × 2 × 2 supercell model. Experimental data on the mechanochemical synthesis of HAP-Mg samples with different Mg concentrations are also presented. A comparison between the experiment and the theory showed good agreement: the HAP-Mg unit cell parameters and volume decreased with increasing degree of Mg/Ca substitution. The changes in the distances between the Ca and O, Ca and H, and Mg and O ions upon Mg/Ca substitution in different calcium positions was analyzed. The resulting asymmetry and distortion of the cell parameters were evaluated. It was shown that bulk modulus, energy levels, and band gap depend on the degree of Mg substitutions in the Ca1 and Ca2 positions. The formation energies of Mg/Ca substitutions showed non-monotonic behavior that was different for Ca1 and Ca2 positions. The Ca2 position had a slightly higher probability (~5 meV/f.u.) of substitution than Ca1 position at a Mg concentration x = 0.5. At x = 1, substitution in both positions can coexist. The simulated IR spectra for different Mg/Ca substitutions showed that Mg in the Ca2 position changes the IR spectrum more significantly than Mg in the Ca1 position. Similar changes were recorded in the IR spectra of the synthesized samples. The electronic structure is shown to be sensitive to the number and position of substitutions, which may be used to tweak the optical properties of the HAP-Mg material.

PEBP1
Also flagged:end-stage liver diseaseliver cancerhepatocellular carcinomarecurrentchronic kidney diseaseIS
Journal Article 2023-08-30 ✓ 1 Snippet Berenguer M, de Martin E, Hessheimer AJ, Levitsky J, Maluf DG, Mas VR, Selzner N, Hernàndez-Èvole H, Lutu A, Wahid N, Zubair H.
In-Text Gene Mentions

…, MIF ,PEBP1, SOCS1 ,…

Show Full Abstract

Currently, one-year survival following liver transplantation (LT) exceeds 90% in large international registries, and LT is considered definitive treatment for patients with end-stage liver disease and liver cancer. Recurrence of disease, including hepatocellular carcinoma (HCC), significantly hampers post-LT outcomes. An optimal approach to immunosuppression (IS), including safe weaning, may benefit patients by mitigating the effect on recurrent diseases, as well as reducing adverse events associated with over-/under-IS, including chronic kidney disease (CKD). Prediction of these outcome measures-disease recurrence, CKD, and immune status-has long been based on relatively inaccurate clinical models. To address the utility of new biomarkers in predicting these outcomes in the post-LT setting, the European Society of Organ Transplantation (ESOT) and International Liver Transplant Society (ILTS) convened a working group of experts to review literature pertaining to primary disease recurrence, development of CKD, and safe weaning of IS. Summaries of evidence were presented to the group of panelists and juries to develop guidelines, which were discussed and voted in-person at the Consensus Conference in Prague November 2022. The consensus findings and recommendations of the Liver Working Group on new biomarkers in LT, clinical applicability, and future needs are presented in this article.

RABGAP1L
Also flagged:PTPRCCIITAsplicing factorstranscription factorssepsislocalization
Journal Article 2023-08-30 ✓ 5 Snippets Ner-Gaon H, Peleg R, Gazit R, Reiner-Benaim A, Shay T.
In-Text Gene Mentions

…three genes (TNK2,RABGAP1Land WARS1) were…

…was AFE, andRABGAP1Lwas also assigned…

…genes (TNK2, WARS1,RABGAP1L) are known to…

…is shown forRABGAP1Lin neutrophils in…

…S12 , whereRABGAP1Lis one of…

Show Full Abstract

Most human genes code for more than one transcript. Different ratios of transcripts of the same gene can be found in different cell types or states, indicating differential use of transcription start sites or differential splicing. Such differential transcript use (DTUs) events provide an additional layer of regulation and protein diversity. With the exceptions of PTPRC and CIITA, there are very few reported cases of DTU events in the immune system. To rigorously map DTUs between different human immune cell types, we leveraged four publicly available RNA sequencing datasets. We identified 282 DTU events between five human healthy immune cell types that appear in at least two datasets. The patterns of the DTU events were mostly cell-type-specific or lineage-specific, in the context of the five cell types tested. DTUs correlated with the expression pattern of potential regulators, namely, splicing factors and transcription factors. Of the several immune related conditions studied, only sepsis affected the splicing of more than a few genes and only in innate immune cells. Taken together, we map the DTUs landscape in human peripheral blood immune cell types, and present hundreds of genes whose transcript use changes between cell types or upon activation.

Also flagged:metabolismextracellularmembraneorganizationmucusanchoring
Journal Article 2023-08-30 No Snippets Sanahuja I, Fernandez-Alacid L, Torrecillas S, Ruiz A, Vallejos-Vidal E, Firmino JP, Reyes-Lopez FE, Tort L, Tovar-Ramirez D, Ibarz A, Gisbert E.
Show Full Abstract

The present study explores the effects of two supplementation levels of <i>Debaryomyces hansenii</i> (1.1% and 2.2%) as a probiotic in a reference low fish meal-based diet on the skin mucosal tissue in <i>Sparus aurata</i>. This study includes the evaluation of fish performance coupled with a holistic study of the skin mucosa: i) a transcriptomic study of the skin tissue, and ii) the evaluation of its secreted mucus both in terms of skin mucosal-associated biomarkers and its defensive capacity by means of co-culture analysis with two pathogenic bacteria. Results showed that after 70 days of diet administration, fish fed the diet supplemented with <i>D. hansenii</i> at 1.1% presented increased somatic growth and a better feed conversion ratio, compared to fish fed the control diet. In contrast, fish fed the diet including 2.2% of the probiotic presented intermediate values. Regarding gene regulation, the probiotic administration at 1.1% resulted in 712 differentially expressed genes (DEGs), among which 53.4% and 46.6% were up- and down-regulated, respectively. In particular, <i>D. hansenii</i> modulated some skin biological processes related to immunity and metabolism. Specifically, <i>D. hansenii</i> administration induced a strong modulation of some immune biological-related processes (61 DEGs), mainly involved in B- and T-cell regulatory pathways. Furthermore, dietary <i>D. hansenii</i> promoted the skin barrier function by the upregulation of anchoring junction genes (23 DEGs), which reinforces the physical defense against potential skin damage. In contrast, the skin showed modulated genes related to extracellular exosome and membrane organization (50 DEGs). This modulated functioning is of great interest, particularly in relation to the increased skin mucus defensive capacity observed in the bacterial co-culture <i>in vitro</i> trials, which could be related to the increased modulation and exudation of the innate immune components from the skin cells into the mucus. In summary, the modulation of innate immune parameters coupled with increased skin barrier function and cell trafficking potentiates the skin's physical barrier and mucus defensive capacity, while maintaining the skin mucosa's homeostatic immune and metabolic status. These findings confirmed the advantages of <i>D. hansenii</i> supplementation in low fish meal-based diets, demonstrating the probiotic benefits on cultured marine species.

ZNF644
Also flagged:obesitycancercolon cancerGene ExpressionTYROBPCD44
Journal Article 2023-08-30 ✓ 1 Snippet Zhang XL, Zhang XF, Fang Y, Li ML, Shu R, Gong Y, Luo HY, Tian Y.
In-Text Gene Mentions

…factors POLR2H andZNF644both interact with…

Show Full Abstract

<h4>Object</h4>There is mounting clinical evidence that an increase in obesity is linked to an increase in cancer incidence and mortality. Although studies have shown a link between obesity and colon cancer, the particular mechanism of the interaction between obesity and colon cancer in females remains unknown. The goal of this work is to use bioinformatics to elucidate the genetic link between obesity and colon cancer in females and to investigate probable molecular mechanisms.<h4>Methods</h4>GSE44076 and GSE199063 microarray datasets were obtained from the Gene Expression Omnibus (GEO) database. In the two microarray datasets and healthy controls, the online tool GEO2R was utilized to investigate the differential genes between obesity and colon cancer. The differential genes (DEGs) identified in the two investigations were combined. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment studies were performed on the DEGs. The STRING database and Cytoscape software were then used to build protein-protein interaction (PPI) networks to discover hub genes. NetworkAnalyst was also used to build networks of target microRNAs (miRNAs) and hub genes, as well as networks of transcriptions.<h4>Results</h4>Between the two datasets, 146 DEGs were shared. The DEGs are primarily enriched in inflammatory and immune-related pathways, according to GO analysis and KEGG. 14 hub genes were identified via PPI building using the Cytoscape software's MCODE and CytoNCA plug-ins: TYROBP, CD44, BGN, FCGR3A, CD53, CXCR4, FN1, SPP1, IGF1, CCND1, MMP9, IL2RG, IL6 and CTGF. Key transcription factors for these hub genes include WRNIP1, ATF1, CBFB, and NR2F6. Key miRNAs for these hub genes include hsa-mir-1-3p, hsa-mir-26b-5p, hsa-mir-164a-5p and hsa-mir-9-5p.<h4>Conclusion</h4>Our research provides evidence that changed genes are shared by female patients with colon cancer and obesity. Through pathways connected to inflammation and the immune system, these genes play significant roles in the emergence of both diseases. We created a network between hub genes and miRNAs that target transcription factors, which may offer suggestions for future research in this area.

HTT
Also flagged:CytokineIgGAntibodyCOVID-19Coronavirus disease 2019antibodies
Journal Article 2023-08-30 ✓ 1 Snippet Pratedrat P, Intharasongkroh D, Chansaenroj J, Vichaiwattana P, Srimuan D, Thatsanatorn T, Klinfueng S, Nilyanimit P, Chirathaworn C, Kupatawintu P, Chaiwanichsiri D, Wanlapakorn N, Poovorawan Y.
In-Text Gene Mentions

…with H1N1, SARS-CoV-1,MERS-CoV-1, Ebolavirus, and SARS-CoV-2…

Show Full Abstract

Coronavirus disease 2019 (COVID-19) is a contagious illness worldwide. While guidelines for the treatment of COVID-19 have been established, the understanding of the relationship among neutralizing antibodies, cytokines, and the combined use of antiviral medications, steroid drugs, and convalescent plasma therapy remains limited. Here, we investigated the connection between the immunological response and the efficacy of convalescent plasma therapy in COVID-19 patients with moderate-to-severe pneumonia. The study included a retrospective analysis of 49 patients aged 35 to 57. We conducted clinical assessments to determine antibody levels, biochemical markers, and cytokine levels. Among the patients, 48 (98%) were discharged, while one died. We observed significantly higher levels of anti-nucleocapsid, anti-spike, and neutralizing antibodies on days 3, 7, and 14 after the transfusion compared to before treatment. Serum CRP and D-dimer levels varied significantly across these four time points. Moreover, convalescent plasma therapy demonstrated an immunoregulatory effect on cytokine parameters, with significant differences in IFN-β, IL-6, IL-10, and IFN-α levels observed at different sampling times. Evaluating the cytokine signature, along with standard clinical and laboratory parameters, may help to identify the onset of a cytokine storm in COVID-19 patients and determine the appropriate indication for anti-cytokine treatment.

TNFSF4
Also flagged:Systemic lupus erythematosusSLErheumatoid arthritisRAautoantibodiesthyroid dysfunction
Journal Article 2023-08-30 ✓ 2 Snippets Chu YC, Yu KH, Lin WT, Wang WT, Chen DP.
In-Text Gene Mentions

Because these autoimmune diseases are caused by abnormal immune regulation, we explored the SNPs of the co-stimulatory molecule genes, which are involved in the regulation of T-cell activation, including CTLA4, CD28, PDCD1, TNFSF4, and ICOS.

…, PDCD1 ,TNFSF4, and ICOS…

Show Full Abstract

In clinical practice, it is found that autoimmune thyroid disease often additionally occurs with systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA). In addition, several studies showed that eye-specific autoimmune diseases may have a strong relationship with systemic autoimmune diseases. We focused on Graves' disease (GD) with ocular conditions, also known as Graves' ophthalmopathy (GO), trying to find out the potential genetic background related to GO, RA, and SLE. There were 40 GO cases and 40 healthy controls enrolled in this study. The association between single-nucleotide polymorphisms (SNPs) of the co-stimulatory molecule genes and GO was analyzed using a chi-square test. It showed that rs11571315, rs733618, rs4553808, rs11571316, rs16840252, and rs11571319 of <i>CTLA4</i>, rs3181098 of <i>CD28</i>, rs36084323 and rs10204525 of <i>PDCD1</i>, and rs11889352 and rs4675379 of <i>ICOS</i> were significantly associated with GO based on genotype analysis and/or allele analysis (<i>p</i> < 0.05). After summarizing the GO data and the previously published SLE and RA data, it was found that rs11571315, rs733618, rs4553808, rs16840252, rs11571319, and rs36084323 were shared in these three diseases. Furthermore, the bio-function was confirmed by dual-luciferase reporter assay. It was shown that rs733618 T > C and rs4553808 A > G significantly decreased the transcriptional activity (both <i>p</i> < 0.001). This study is the first to confirm that these three diseases share genetically predisposing factors, and our results support the proposal that rs733618 T > C and rs4553808 A > G have bio-functional effects on the transcriptional activity of the <i>CTLA4</i> gene.

HFE
Also flagged:organizationCYP2C19clopidogrelmetabolismHuman leukocyte antigenCancer
Journal Article 2023-08-30 ✓ 1 Snippet Dolin R, Heale BSE, Gupta R, Alvarez C, Aronson J, Boxwala A, Gothi SR, Husami A, Shalaby J, Babb L, Wagner A, Chamala S.
In-Text Gene Mentions

…diagnostic implication ofhemochromatosis; annotating CYP2C19 *1/*2…

Show Full Abstract

<h4>Introduction</h4>Variant annotation is a critical component in next-generation sequencing, enabling a sequencing lab to comb through a sea of variants in order to hone in on those likely to be most significant, and providing clinicians with necessary context for decision-making. But with the rapid evolution of genomics knowledge, reported annotations can quickly become out-of-date. Under the ONC Sync for Genes program, our team sought to standardize the sharing of dynamically annotated variants (e.g., variants annotated on demand, based on current knowledge). The computable biomedical knowledge artifacts that were developed enable a clinical decision support (CDS) application to surface up-to-date annotations to clinicians.<h4>Methods</h4>The work reported in this article relies on the Health Level 7 Fast Healthcare Interoperability Resources (FHIR) Genomics and Global Alliance for Genomics and Health (GA4GH) Variant Annotation (VA) standards. We developed a CDS pipeline that dynamically annotates patient's variants through an intersection with current knowledge and serves up the FHIR-encoded variants and annotations (diagnostic and therapeutic implications, molecular consequences, population allele frequencies) via FHIR Genomics Operations. ClinVar, CIViC, and PharmGKB were used as knowledge sources, encoded as per the GA4GH VA specification.<h4>Results</h4>Primary public artifacts from this project include a GitHub repository with all source code, a Swagger interface that allows anyone to visualize and interact with the code using only a web browser, and a backend database where all (synthetic and anonymized) patient data and knowledge are housed.<h4>Conclusions</h4>We found that variant annotation varies in complexity based on the variant type, and that various bioinformatics strategies can greatly improve automated annotation fidelity. More importantly, we demonstrated the feasibility of an ecosystem where genomic knowledge bases have standardized knowledge (e.g., based on the GA4GH VA spec), and CDS applications can dynamically leverage that knowledge to provide real-time decision support, based on current knowledge, to clinicians at the point of care.

CA10
Also flagged:polyaromatic hydrocarbonN-heterocyclic aromatic compoundsDioxinspolychlorinated dibenzo- p -dioxinsdibenzofuranspolychlorinated biphenyls
Journal Article 2023-08-30 ✓ 5 Snippets Dinh MTN, Nguyen VT, Nguyen LTH.
In-Text Gene Mentions

Since catechol, formed from carbazole, is metabolized through the ortho cleavage pathway encoded by the chromosomal cat operon, it is believed that strain CA10 acquired a metabolic capacity for dioxins and carbazole by recruitment of pCAR1 (Nojiri et al. 2002).

Another carbazole degrader, P. stutzeri strain OM1, exhibits an identical car gene cluster structure to that of strain CA10, but with the notable difference that it is located on its chromosome (Ouchiyama et al. 1998; Shintani et al. 2003).

Genetic analysis of carbazole-degrading bacteria has revealed that many strains belonging to the genera Pseudomonas, Burkholderia, and Janthinobacterium possess nearly identical carbazole degradation genes with car gene cluster from P. resinovorans CA10 (Nojiri and Omori 2007).

…of carbazole degraderPseudomonas sp. CA10sp. CA10, for…

…The carbazole degraders,Pseudomonas sp. strain CA10sp. strain CA10…

Show Full Abstract

Extensive research has been conducted over the years on the bacterial degradation of dioxins and their related compounds including carbazole, because these chemicals are highly toxic and has been widely distributed in the environment. There is a pressing need to explore and develop more bacterial strains with unique catabolic features to effectively remediate dioxin-polluted sites. Carbazole has a chemical structure similar to dioxins, and the degradation pathways of these two chemicals are highly homologous. Some carbazole-degrading bacterial strains have been demonstrated to have the ability to degrade dioxins, such as Pseudomonas sp. strain CA10 và Sphingomonas sp. KA1. The introduction of strain KA1 into dioxin-contaminated model soil resulted in the degradation of 96% and 70% of 2-chlorodibenzo-p-dioxin (2-CDD) and 2,3-dichlorodibenzo-p-dioxin (2,3-DCDD), respectively, after 7-day incubation period. These degradation rates were similar to those achieved with strain CA10, which removed 96% of 2-CDD and 80% of 2,3-DCDD from the same model soil. Therefore, carbazole-degrading bacteria hold significant promise as potential candidates for dioxin bioremediation. This paper overviews the connection between the bacterial degradation of dioxins and carbazole, highlighting the potential for dioxin biodegradation by carbazole-degrading bacterial strains.

Research Square 2023-08-30 Preprint (No Snippets API) Ssemuyiga C, Ssemanda P, Pius EM, Kasoma AN, Ntambi S.
Show Full Abstract

<title>Abstract</title> <p>Cases of the monkeypox virus have been recorded in non-endemic nations and have continued to be reported in several endemic nations since early May 2022 [1]. In this study, we modeled MPXV Thymidylate Kinase (TMPK) and scaffolding protein (D13), and these models and their templates were taken for small molecule screening against 602,413 small molecules using pharmacophore modeling and molecular docking methods. ADMET properties were also computed followed by Molecular simulation dynamics studies. All presented hits had superior molecular docking scores to used reference standards of Cidofovir and Rifampicin. TMPK compounds displayed better ADMET profiles than D13 compounds, hence the latter may necessitate optimization. Following molecular dynamics simulation, calculations of the RMSDs, RMSFs, Hydrogen Bonds, SASA, Radius of Gyration, MM-GBSA energy, PCA, and DCC revealed that all generated complexes were stable, with the ligands NPC275538, NPC244454, 135566871, and CHEBI compounds outperforming other Hits. These compounds still presented higher docking scores against cidofovir-resistant TMPK and Rifampicin-resistant D13 proteins. Compounds 447970, 446595, and 54723327 were most selective against human TMPK. The conserved interaction patterns of these compounds among Vaccinia and Monkeypox virus proteins with the fact that studied proteins are highly conserved across Orthopoxviruses (OPV) is appealing to the fact these hits should be studied across OPV. Therefore, these compounds should be subjected to laboratory testing to prove their antipox capability. Since there are currently no approved MPXV antivirals, this discovery significantly aids in developing new drugs for treating monkeypox.</p>

Also flagged:poly(ethylene glycoldegradationrutheniumpolypyridylproteasewater
Journal Article 2023-08-29 No Snippets Rapp TL, DeForest CA.
Show Full Abstract

Photodynamic hydrogel biomaterials have demonstrated great potential for user-triggered therapeutic release, patterned organoid development, and four-dimensional control over advanced cell fates in vitro. Current photosensitive materials are constrained by their reliance on high-energy ultraviolet light (<400 nm) that offers poor tissue penetrance and limits access to the broader visible spectrum. Here, we report a family of three photolabile material crosslinkers that respond rapidly and with unique tricolor wavelength-selectivity to low-energy visible light (400-617 nm). We show that when mixed with multifunctional poly(ethylene glycol) macromolecular precursors, ruthenium polypyridyl- and ortho-nitrobenzyl (oNB)-based crosslinkers yield cytocompatible biomaterials that can undergo spatiotemporally patterned, uniform bulk softening, and multiplexed degradation several centimeters deep through complex tissue. We demonstrate that encapsulated living cells within these photoresponsive gels show high viability and can be successfully recovered from the hydrogels following photodegradation. Moving forward, we anticipate that these advanced material platforms will enable new studies in 3D mechanobiology, controlled drug delivery, and next-generation tissue engineering applications.

HFE
Also flagged:Lupus NephritisSLEimmunologic diseaselupuslupus hepatitisautoimmune hepatitis
Journal Article 2023-08-29 ✓ 1 Snippet Chaudhary FS, Sureen A, Yousaf MN, Rao DS, Siva C.
In-Text Gene Mentions

…ohol-associated liver disease,hemochromatosis, Wilson disease, and…

Show Full Abstract

BACKGROUND Systemic lupus erythematosus (SLE) is a multiorgan immunologic disease which commonly results in systemic manifestations by involving joints, kidneys, skin, heart, hematologic cell lines, pulmonary and central nervous systems. The hepatic involvement of lupus is relatively less common, which creates diagnostic challenges, as the clinical presentations of lupus hepatitis and autoimmune hepatitis (AIH) are similar. CASE REPORT A 51-year-old woman presented for multiple joint pain that began 2 years ago. Her work-up, including kidney biopsy, was consistent with a diagnosis of class V lupus nephritis. Subsequently, within a few months, she was admitted with acute elevation of liver enzymes and high immunoglobulin IgG level, and a liver biopsy demonstrated impressive interface hepatitis with many plasma cells and lymphocytes, suggestive of chronic hepatitis with high histological activity. This case illustrates the co-presentation of lupus nephritis and AIH, which is a rare association. The patient was managed with a tapering dose of prednisone, hydroxychloroquine initially, and later with mycophenolate mofetil, with complete resolution of liver enzyme abnormalities by 4-month follow-up. CONCLUSIONS Lupus hepatitis is hepatic involvement of SLE, which should be distinguished from AIH. Accurate diagnosis is important, as management and prognosis of these immunologic conditions can differ. Although both entities share clinical and biochemical markers, the presence of anti-ribosomal P antibodies and liver histology features of predominant lymphoid infiltrates with lobular inflammation favor lupus hepatitis. A multidisciplinary approach involving rheumatologists, hepatologists, and pathologists can improve disease outcomes by properly differentiating the 2 entities and guiding the selection of appropriate immunosuppressive therapy.

TNFSF4
Also flagged:CDC45Immune ResponsesKidney Renal Clear Cell Carcinomatumorrenal cell carcinomaRCC
Journal Article 2023-08-29 ✓ 1 Snippet Zhang X, Zhou J, Wang Y, Wang X, Zhu B, Xing Q.
In-Text Gene Mentions

…as PDCD1, PDCD1LG2,TNFSF4, in KIRC (all…

Show Full Abstract

The main objective of this paper is to analyze the prognostic and immunological value of CDC45 in kidney renal clear cell carcinoma (KIRC) using single-cell and bulk RNA-sequencing approaches. The expression of CDC45 in KIRC was evaluated by the HPA database, the TCGA-KIRC dataset and verified by PCR analysis and single-cell RNA-sequencing. The ability of CDC45 to independently predict prognosis in KIRC was confirmed by univariate/multivariate regression analysis. Gene set enrichment analysis (GSEA) was employed to explore CDC45-related pathways in KIRC. In addition, Relationships between CDC45 and immunity were also examined. Elevated CDC45 expression in KIRC was demonstrated at mRNA and protein levels. The results of the correlation analysis showed that as CDC45 expression increased, so did the histological grade, clinical stage, and TNM stage of the patients (p < 0.05). Univariate/multivariate regression analysis suggested CDC45 as an independent prognostic factor for KIRC. Seven pathways related to CDC45 were screened through GSEA. Meanwhile, we found that CDC45 was correlated with tumor mutational burden (TMB) and microsatellite instability (MSI) but not tumor neoantigen burden (TNB). Regarding immunity, CDC45 exhibited correlations with the tumor microenvironment, immune cell infiltration, and immune checkpoints. Besides, low CDC45 expression was shown to be associated with a better response to immunotherapy. Single-cell RNA-sequencing revealed that CDC45 was differently expressed in T cells (p < 0.05). CDC45 showed potential as a prognostic biomarker and therapeutic target for KIRC. Meanwhile, the CDC45 low expression group was more sensitive to immunotherapy.

OLFM4
Also flagged:Grp78Krascolorectal cancermetabolismlocalizationtransmembrane proteins
Journal Article 2023-08-29 ✓ 2 Snippets Spaan CN, de Boer RJ, Smit WL, van der Meer JH, van Roest M, Vermeulen JL, Koelink PJ, Becker MA, Go S, Silva J, Faller WJ, van den Brink GR, Muncan V, Heijmans J.
In-Text Gene Mentions

…reverse CAGCGTCTTCACCTCCTACC),Olfm4(forward AACATCACCCCAGGCTACAG,…

…markers Lgr5 andOlfm4was observed compared…

Show Full Abstract

In development of colorectal cancer, mutations in <i>APC</i> are often followed by mutations in oncogene <i>KRAS</i> The latter changes cellular metabolism and is associated with the Warburg phenomenon. Glucose-regulated protein 78 (<i>Grp78</i>) is an important regulator of the protein-folding machinery, involved in processing and localization of transmembrane proteins. We hypothesize that targeting <i>Grp78</i> in <i>Apc</i> and <i>Kras</i> (<i>AK</i>)-mutant intestines interferes with the metabolic phenotype imposed by <i>Kras</i> mutations. In mice with intestinal epithelial mutations in <i>Apc</i>, <i>Kras</i> <sup><i>G12D</i></sup> and heterozygosity for <i>Grp78</i> (<i>AK-Grp78</i> <sup><i>HET</i></sup> ) adenoma number and size is decreased compared with <i>AK-Grp78</i> <sup><i>WT</i></sup> mice. Organoids from <i>AK-Grp78</i> <sup><i>WT</i></sup> mice exhibited a glycolysis metabolism which was completely rescued by <i>Grp78</i> heterozygosity. Expression and correct localization of glucose transporter GLUT1 was diminished in <i>AK-Grp78</i> <sup><i>HET</i></sup> cells. GLUT1 inhibition restrained the increased growth observed in <i>AK</i>-mutant organoids, whereas <i>AK-Grp78</i> <sup><i>HET</i></sup> organoids were unaffected. We identify <i>Grp78</i> as a critical factor in <i>Kras-</i>mutated adenomagenesis. This can be attributed to a critical role for <i>Grp78</i> in GLUT1 expression and localization, targeting glycolysis and the Warburg effect.

PTGIS
Also flagged:prostacyclinangiogenesissynthesisPGI2 receptorPTGIRgene expression
Journal Article 2023-08-29 ✓ 5 Snippets Szymanska M, Blitek A.
In-Text Gene Mentions

To examine the effect of (1) NCS on pEETH cell proliferation, (2) iloprost on G1410 cell proliferation, or (3) PTGIS knock-down on G1410 cell proliferation and mRNA and protein expression, a paired t-test was used. Data from Experiment 6 were log transformed due to variability between experimental sets. All numerical data are presented as means ± SEM.

Experiment 5: Effect of iloprost or PTGIS silencing on G1410 cell proliferation

To verify the importance of endogenous PGI2 for endothelial cells, iloprost-stimulated genes from Experiment 2 were examined in G1410 cells with a knock-down of PTGIS. As shown in Fig. 3C, PTGIS-silenced G1410 cells expressed lower abundance of KDR, FGFR2, and ANGPT2 transcripts as compared with scrambled siRNA (siNC)-transfected cells (p < 0.05).

…membrane-bound PGI2 synthase (PTGIS) rearranges PGH2 to…

PTGISis mainly localized…

Show Full Abstract

Angiogenesis is important for endometrial remodeling in mature females. The endometrium synthesizes high amounts of prostacyclin (PGI2) but the role of PGI2 in angiogenesis-related events in this tissue was not fully described. In the present study, porcine endometrial endothelial (pEETH) cells and/or a swine umbilical vein endothelial cell line (G1410 cells) were used to determine the regulation of PGI2 synthesis and PGI2 receptor (PTGIR) expression by cytokines and to evaluate the effect of PGI2 on pro-angiogenic gene expression, intracellular signaling activation, cell proliferation and migration, cell cycle distribution, and capillary-like structure formation. We found that IL1β, IFNγ, and/or TNFα increased PGI2 secretion and PTGIR expression in pEETH cells. Iloprost (a PGI2 analogue) acting through PTGIR enhanced the transcript abundance of KDR, FGFR2, and ANGPT2 and increased proliferation of pEETH cells. This latter was mediated by PI3K and mTOR activation. In support, transfection of G1410 cells with siRNA targeting PGI2 synthase decreased pro-angiogenic gene expression and cell proliferation. Furthermore, iloprost accelerated the gap closure and promoted cell cycle progression. Intriguingly, the formation of capillary-like structures was inhibited but not completely blocked by iloprost. These findings point to a complex pleiotropic role of PGI2 in angiogenesis-related events in the porcine uterus.

TNFSF4
Also flagged:Fosextracellularphagocytosisparvalbuminmajor depressive disorderrumination
Journal Article 2023-08-29 ✓ 1 Snippet Smail MA, Smith BL, Shukla R, Alganem K, Eby HM, Bollinger JL, Parikh RK, Chambers JB, Reigle JK, Moloney RD, Nawreen N, Wohleb ES, Pantazopoulos H, McCullumsmith RE, Herman JP.
In-Text Gene Mentions

…EE (e.g., CCL24,TNFSF4, CXCR5).…

Show Full Abstract

Psychological loss is a common experience that erodes well-being and negatively impacts quality of life. The molecular underpinnings of loss are poorly understood. Here, we investigate the mechanisms of loss using an environmental enrichment removal (ER) paradigm in male rats. The basolateral amygdala (BLA) was identified as a region of interest, demonstrating differential Fos responsivity to ER and having an established role in stress processing and adaptation. A comprehensive multi-omics investigation of the BLA, spanning multiple cohorts, platforms, and analyses, revealed alterations in microglia and the extracellular matrix (ECM). Follow-up studies indicated that ER decreased microglia size, complexity, and phagocytosis, suggesting reduced immune surveillance. Loss also substantially increased ECM coverage, specifically targeting perineuronal nets surrounding parvalbumin interneurons, suggesting decreased plasticity and increased inhibition within the BLA following loss. Behavioral analyses suggest that these molecular effects are linked to impaired BLA salience evaluation, leading to a mismatch between stimulus and reaction intensity. These loss-like behaviors could be rescued by depleting BLA ECM during the removal period, helping us understand the mechanisms underlying loss and revealing novel molecular targets to ameliorate its impact.

SOX6
Also flagged:malignant gliomaGBMtumorgliomareverse transcriptionluciferase
Journal Article 2023-08-29 ✓ 5 Snippets Tan C, Wei J, Li Z, Tian N, Wang Z, Wang G, Han L, Tian Y.
In-Text Gene Mentions

…circ_0021350 and linearSOX6mRNA was detected…

…(242 bp) ofSOX6(Fig. 2 C).…

…gDNA, whereas linearSOX6was amplified by…

…but not linearSOX6, was enriched, and…

…and 11 ofSOX6.…

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) is the most malignant glioma, with poor survival rates and prognosis. Several studies have reported the abnormal expression of circular RNAs (circRNAs) and their functions in the malignant biological behavior of GBM. However, such research is still in the preliminary stages, and further study is needed to confirm the therapeutic potential of circRNAs in GBM.<h4>Methods</h4>RNA-seq was performed using four tumor tissues from patients with GBM and their adjacent non-tumor brain tissues to screen differentially expressed circRNAs. Fluorescence in situ hybridization assay was used to examine the location of circ_0021350 in glioma cells. In addition, a series of biological function assays were employed to verify the oncogenic role of circ_0021350 in GBM. Quantitative reverse transcription PCR was used to examine circular, micro- (miRNA), and messenger RNA (mRNA) levels. Furthermore, dual-luciferase reporter, RNA pull-down, and RNA binding protein immunoprecipitation assays were applied to verify the interaction between circ_0021350 and its downstream effectors.<h4>Results</h4>Circ_0021350 was significantly elevated in GBM tissues and glioma cells. Overexpression of circ_0021350 promoted glioma cell proliferation and metastatic ability; silencing of circ_0021350 had the opposite effect. Mechanistic analysis revealed that circ_0021350 sponged miR-1207-3p to regulate PIK3R3, whose overexpression reversed the reduction in the malignant biological behavior of glioma cells caused by silencing circ_0021350.<h4>Conclusion</h4>Our findings suggest that circ_0021350 is an oncogenic circRNA in GBM, and the circ_0021350/miR-1207-3p/PIK3R3 axis may serve as a potential therapeutic target in GBM treatment.

TNFSF4
Also flagged:breast cancertumorCD4HLAEMILIN2SURF4
Journal Article 2023-08-29 ✓ 1 Snippet Liu G, Wang L, Ji L, He D, Zeng L, Zhuo G, Zhang Q, Wang D, Pan Y.
In-Text Gene Mentions

…TNFSF14, TNFSF15, TNFSF18,TNFSF4, and TNFSF9 ,…

Show Full Abstract

To gain deeper insights into the microenvironment of breast cancer, we utilized GeoMx Digital Spatial Profiling (DSP) technology to analyze transcripts from 107 regions of interest in 65 untreated breast cancer tissue samples. Our study revealed spatial heterogeneity in the expression of marker genes in tumor cell enriched, immune cell enriched, and normal epithelial areas. We evaluated a total of 55 prognostic markers in tumor cell enriched regions and 15 in immune cell enriched regions, identifying that tumor cell enriched regions had higher levels of follicular helper T cells, resting dendritic cells, and plasma cells than immune cell enriched regions, while the levels of resting CD4 memory in T cells and regulatory (Treg) T cells were lower. Additionally, we analyzed the heterogeneity of HLA gene families, immunological checkpoints, and metabolic genes in these areas. Through univariate Cox analysis, we identified 5 prognosis-related metabolic genes. Furthermore, we conducted immunostaining experiments, including EMILIN2, SURF4, and LYPLA1, to verify our findings. Our investigation into the spatial heterogeneity of the breast cancer tumor environment has led to the discovery of specific diagnostic and prognostic markers in breast cancer.

TRIM38
Also flagged:sex hormone-binding globulinrheumatoid arthritisSHBGRAgene expressionautoimmune disorders
Journal Article 2023-08-29 ✓ 2 Snippets Jiang Y, Liu Q, Alfredsson L, Klareskog L, Kockum I, Jiang X.
In-Text Gene Mentions

…SNN, TMEM258, TRAF1,TRIM38, UBE2L3, and YDJC)…

TRIM38and ZSCAN23 are…

Show Full Abstract

<h4>Background</h4>Our study aims to investigate an intrinsic link underlying sex hormone-binding globulin (SHBG) and rheumatoid arthritis (RA), which remains inconclusive in observational settings.<h4>Methods</h4>Summary statistics were collected from the largest GWAS(s) on SHBG adjusted for BMI (SHBG<sub>adj</sub>BMI; N<sub>overall</sub> = 368,929; N<sub>men</sub> = 180,094; N<sub>women</sub> = 188,908), crude SHBG (N<sub>overall</sub> = 370,125; N<sub>men</sub> = 180,726; N<sub>women</sub> = 189,473), and RA (N<sub>case</sub> = 22,350; N<sub>control</sub> = 74,823). A genome-wide cross-trait design was performed to quantify global and local genetic correlation, identify pleiotropic loci, and infer a causal relationship.<h4>Results</h4>Among the overall population, a significant global genetic correlation was observed for SHBG<sub>adj</sub>BMI and RA ([Formula: see text] = 0.11, P = 1.0 × 10<sup>-4</sup>) which was further supported by local signal (1q25.2). A total of 18 independent pleiotropic SNPs were identified, of which three were highly likely causal variants and four were found to have effects on both traits through gene expression mediation. A putative causal association of SHBG<sub>adj</sub>BMI on RA was demonstrated (OR = 1.20, 95% CI = 1.01-1.43) without evidence of reverse causality (OR = 0.999, 95% CI = 0.997-1.000). Sex-specific analyses revealed distinct shared genetic regions (men: 1q32.1-q32.2 and 5p13.1; women: 1q25.2 and 22q11.21-q11.22) and diverse pleiotropic SNPs (16 in men and 18 in women, nearly half were sex-specific) underlying SHBG<sub>adj</sub>BMI and RA, demonstrating biological disparities between sexes. Replacing SHBG<sub>adj</sub>BMI with crude SHBG, a largely similar yet less significant pattern of results was observed.<h4>Conclusion</h4>Our cross-trait analysis suggests an intrinsic, as well as a sex-specific, link underlying SHBG and RA, providing novel insights into disease etiology.

Also flagged:phosphorusquartzmonopotassiumphosphatemineralphosphates
Journal Article 2023-08-29 No Snippets Bazhenov M, Litvinov D, Karlov G, Divashuk M.
Show Full Abstract

<h4>Background</h4>Phosphorus nutrition is important for obtaining high yields of crop plants. However, wheat plants are known to be almost incapable of taking up phosphorus from insoluble phosphate sources, and reduced height genes are supposed to decrease this ability further.<h4>Methods</h4>We performed a pot experiment using <i>Triticum durum</i> Desf. tall spring variety LD222, its near-isogenic semidwarf line carrying <i>Rht17</i> (<i>Reduced height 17</i>) gene, and winter rye (<i>Secale cereale</i> L.) variety Chulpan. The individual plants were grown in quartz sand. The phosphorus was provided either as phosphate rock powder mixed with sand, or as monopotassium phosphate solution (normal nutrition control) or was not supplemented at all (no-phosphorus control). Other nutrients were provided in soluble form. During experiment the plants were assessed using the TraitFinder (Phenospex Ltd., Heerlen, Netherlands) digital phenotyping system for a standard set of parameters. Double scan with 90 degrees turns of pots around vertical axis <i>vs</i>. single scan were compared for accuracy of phenotyping.<h4>Results</h4>The phenotyping showed that at least 20 days of growth after seedling emergence were necessary to get stable differences between genotypes. After this initial period, phenotyping confirmed poor ability of wheat to grow on substrate with phosphate rock as the only source of phosphorus compared to rye; however, <i>Rht17</i> did not cause an additional reduction in growth parameters other than plant height under this variant of substrate. The agreement between digital phenotyping and conventionally measured traits was at previously reported level for grasses (R<sup>2</sup> = 0.85 and 0.88 for digital biomass and 3D leaf area <i>vs</i>. conventionally measured biomass and leaf area, single scan). Among vegetation indices, only the normalized differential vegetation index (NDVI) and the green leaf index (GLI) showed significant correlations with manually measured traits, including the percentage of dead leaves area. The double scan improved phenotyping accuracy, but not substantially.

HTT
Also flagged:Melaninprogesteronekeratinizationcollagenmetalloproteinaseextracellular
Journal Article 2023-08-29 ✓ 2 Snippets Song F, Wang Y, Wei XG, Yang N, Sun W, Li K, Ma H, Mu J.
In-Text Gene Mentions

…proteins mainly beingHTT, FECH, PAIP1, PDK3,…

…the proteins CASP6,HTT, NFATC1, PAIP1, PDK3,…

Show Full Abstract

<h4>Objective</h4>In this study, we analyzed the differential expression and key signaling pathways of proteins in the skin of guinea pigs with melanin deposition caused by two different modeling methods by utilizing proteomics techniques.<h4>Methods</h4>Guinea pig skin melanin deposition models were: (1) induced by ultraviolet (UV) irradiation alone (U group), (2) induced by UV combined with progesterone injection (P group), and guinea pigs treated without any treatment were used as blank group (B group). H&E staining and Masson staining were used to observe the extent of skin damage and melanin deposition in guinea pigs. The differentially expressed proteins (DEPs) in the skin tissues of melanin-deposited guinea pigs were screened by proteomic techniques, the functions of DEPs were analyzed, and a protein-protein interaction network (PPI) was constructed.<h4>Results</h4>There was a significant difference in grayscale between the U and P groups of guinea pig skin before and after modeling (<i>P</i> < 0.01). H&E and Masson staining showed that the U and P groups both exhibited incomplete keratinization of the stratum corneum, increased proliferation of epidermal cells with large nuclei and disordered arrangement, neovascularization of the dermis, and increased the number of melanin particles in the epidermis of the U and P groups of guinea pigs compared with the B group. Proteomics analysis showed that there were 171 DEPs between the U and P groups. These DEPs focused on biological processes such as fibrillar collagen trimer, extracellular matrix containing collagen proteins, metalloproteinase activity, and peroxidase activity.<h4>Conclusion</h4>The melanin pigmentation model induced solely by UV radiation negatively regulates biological processes such as extracellular matrix and collagen synthesis, while inducing significant skin photoaging. The combination of progesterone injections and UV radiation-induced melanin pigmentation model can cause abnormal protein expression in fatty acid and phospholipid metabolism, possibly being closer to the environment of melasma formation.

DCC
Also flagged:cancertumorsecretionextracellularvesiclesmethylation
Journal Article 2023-08-29 ✓ 1 Snippet Rapado-González Ó, Rodríguez-Ces AM, López-López R, Suárez-Cunqueiro MM.
In-Text Gene Mentions

In the same line, Mydlarz et al. evaluated on the one hand, the methylation levels of EDRB, DCC, and p16 genes in serum samples from 100 HNSCC and 50 healthy controls observing amplification of EDNRB in 10% of HNSCC patients but in none of the healthy controls.

Show Full Abstract

In the era of 'precision medicine', liquid biopsies based on cell-free DNA (cfDNA) have emerged as a promising tool in the oncology field. cfDNA from cancer patients is a mixture of tumoral (ctDNA) and non-tumoral DNA originated from healthy, cancer and tumor microenvironmental cells. Apoptosis, necrosis, and active secretion from extracellular vesicles represent the main mechanisms of cfDNA release into the physiological body fluids. Focused on HNC, two main types of cfDNA can be identified: the circulating cfDNA (ccfDNA) and the salivary cfDNA (scfDNA). Numerous studies have reported on the potential of cfDNA analysis as potential diagnostic, prognostic, and monitoring biomarker for HNC. Thus, ctDNA has emerged as an attractive strategy to detect cancer specific genetic and epigenetic alterations including DNA somatic mutations and DNA methylation patterns. This review aims to provide an overview of the up-to-date studies evaluating the value of the analysis of total cfDNA, cfDNA fragment length, and ctDNA analysis at DNA mutation and methylation level in HNC patients.

HFE
Also flagged:Chronic central serous chorioretinopathyvisionirregular pigment epithelial detachmentcorticosteroidseplerenonechoroidal neovascularization
Journal Article 2023-08-29 ✓ 1 Snippet Esteban-Floría O, Pérez-Rivasés G, Honrubia-Grijalbo A, Bartolomé-Sesé I, Díaz-Barreda MD, Boned-Murillo A, Cisneros-Arias P, Mateo-Gabás J, Ascaso-Puyelo FJ.
In-Text Gene Mentions

…a form oftype 1 neovascularization1 neovascularization involving…

Show Full Abstract

<b>Purpose</b>: To assess the clinical course, structural changes, and choroidal neovascularization detection by SS-OCTA in long-standing and resolved patients with chronic central serous chorioretinopathy (cCSC) after successful half-fluence photodynamic therapy (hf-PDT) treatment. <b>Methods:</b> Twenty-four eyes presenting with cCSC were examined with SS-OCTA and were classified as choroidal neovascular (CNV) or non-choroidal neovascular (non-CNV) cCSC depending on the vascular pattern detected by SS-OCTA after one, two, and three years after hf-PDT. Two groups were compared based on the following clinical findings: demographic characteristics, time of clinical signs, best corrected visual acuity (BCVA), central retinal thickness (CRT), central choroidal thickness (CFT), subretinal fluid (SRF), flat, irregular pigment epithelial detachment (FIPED), and features of fluorescein angiography (FA) and vascular pattern by SS-OCTA. <b>Results:</b> All patients showed resolved cCSC during follow-up after hf-PDT. A total of 5 of 24 (20.8%) eyes showed a neovascular pattern by SS-OCTA. No differences between BCVA, CRT, SRF, FIPED, or FA features were found between both groups (<i>p</i> > 0.05). However, CFT and older age were associated with a neovascular pattern by SS-OCTA (<i>p</i> < 0.05) in follow-up. No signs of neovascular activity were detected by SS-OCT during follow-up in CNV cCSC patients, and no antiVEGF treatment was required for three-year follow-ups. <b>Conclusions:</b> Despite patients with cCSC showing a favorable clinical response after hf-PDT, lower foveal thickness and older age were associated with CNV patterns by SS-OCTA during follow-up.

KLHL20
Also flagged:COVID-19COVID syndromethyroidACE2 receptorTMPRSS2cathepsin L
Journal Article 2023-08-29 ✓ 3 Snippets Linkova N, Khavinson V, Diatlova A, Petukhov M, Vladimirova E, Sukhareva M, Ilina A.
In-Text Gene Mentions

In these clusters, proteins have been associated with various biological processes, such as immune response (CASP1, CYSLTR1, IL10, IL10RA, IL10RB, IL1B, IL1R1, IL1R2, IL1RAP, IL2, IL2RA, IL2RB, IL2RG, IL4, IL4R, IL6, IL6R, IL6ST, TNF, TNFRSF1A, TNFRSF1B, TRADD), multivesicular body assembly/viral budding via host ESCRT complex (CHMP3, CHMP4A, CHMP4B, CHMP4C, CHMP6, CHMP7, PDCD6IP, SNF8, STAMBP, VPS25, VPS28, VPS36), protein ubiquitination (CUL3, KCTD5, KEAP1, KLHL12, KLHL13, KLHL20, KLHL22, KLHL3, NEDD8, RBX1, SPOP), regulation of immune system and apoptotic processes (AKT1, AKT2, APPL1, FOXO3, HSP90AA1, MTOR, NOS3, PHLPP1), spliceosomal SNRNP assembly (DDX20, GEMIN2, GEMIN4, SMN1, SMN2), protein n-linked glycosylation via asparagine (DAD1, DDOST, RPN1, RPN2, STT3A), positive regulation of the production of miRNAs (DDX5, DROSHA, TP53), regulation of synaptic growth at the neuromuscular junction (AGRN, DAG1, MUSK), and the WP4846 SARS-CoV-2 and COVID-19 pathway (ACE2, SLC6A19) (Figure 3).

In these clusters, proteins have been associated with various biological processes, such as cytokine-mediated signaling pathways (AKT1, AKT2, APPL1, AXIN1, CASP1, CHUK, CSNK1A1, FOXO3, HSP90AA1, IKBKG, IL10, IL10RA, IL10RB, IL1B, IL1R1, IL1R2, IL1RAP, IL2, IL2RA, IL2RB, IL2RG, IL4, IL4R, IL6, IL6R, IL6ST, MDM2, MTOR, NFKB1, NFKB2, NFKBIA, NOS3, PHLPP1, RELB, TNF, TNFRSF1A, TNFRSF1B, TRADD, TRAF2), protein ubiquitination (CUL3, KCTD10, KCTD5, KEAP1, KLHL12, KLHL13, KLHL20, KLHL22, KLHL3, NEDD8, RBX1, SPOP), midbody abscission (CHMP2A, CHMP2B, CHMP3, CHMP4B, ENSP00000474823, PDCD6IP), protein n-linked glycosylation via asparagine (DAD1, DDOST, RPN1, RPN2, STT3A), and the regulation of synaptic growth at neuromuscular junctions (AGRN, DAG1, MUSK) (Figure 4).

…KEAP1, KLHL12, KLHL13,KLHL20, KLHL22, KLHL3, NEDD8,…

Show Full Abstract

Thymalin is an immunomodulatory drug containing a polypeptide extract of thymus that has demonstrated efficacy in the therapy of acute respiratory distress syndrome and chronic obstructive pulmonary disease, as well as in complex therapy related to severe COVID-19 in middle-aged and elderly patients.. KE and EW dipeptides are active substances of Thymalin. There is evidence that KE stimulates cellular immunity and nonspecific resistance in organisms, exerting an activating effect on macrophages, blood lymphocytes, thymocytes, and neutrophils, while EW reduces angiotensin-induced vasoconstriction and preserves endothelium-dependent vascular relaxation by inhibiting ACE2, the target protein of SARS-CoV-2. However, the mechanism of the immunomodulatory action of Thymalin, KE, and EW during COVID-19 remains unclear. To identify the potential mechanism of action underlying the immunomodulatory activity of Thymalin and its active components, EW and KE dipeptides, we assessed inflammatory response in the context of COVID-19. Interactions between EW and KE dipeptides and double-stranded DNA (dsDNA) were investigated by molecular modeling and docking using ICM-Pro. Analysis of the possible effect of EW and KE dipeptides on gene expression and protein synthesis involved in the pathogenesis of COVID-19 was conducted through the use of bioinformatics methods, including a search for promoter sequences in the Eukaryotic Promoter Database, the determination of genes associated with the development of COVID-19 using the PathCards database of human biological pathways (pathway unification database), identification of the relationship between proteins through cluster analysis in the STRING database ('Search Tool for Retrieval of Interacting Genes/Proteins'), and assessment of the functional enrichment of protein-protein interaction (PPI) using the terms of gene ontology (GO) and the Markov cluster algorithm (MCL). After that, in vitro studying of a lipopolysaccharide (LPS)-induced model of inflammation using human peripheral blood mononuclear cells was performed. ELISA was applied to assess the level of cytokines (IL-1β, IL-6, TNFα) in the supernatant of cells with or without the impact of EW and KE peptides. Blood samples were obtained from four donors; for each cytokine, ELISA was performed 2-4 times, with two parallel experimental or control samples for each experiment (experiments to assess the effects of peptides on LPS-stimulated cells were repeated four times, while additional experiments with unstimulated cells were performed two times). Using molecular docking, GGAG was found to be the best dsDNA sequence in the classical B-form for binding the EW dipeptide, while GCGC is the preferred dsDNA sequence in the curved nucleosomal form for the KE dipeptide. Cluster analysis revealed that potential target genes for the EW and KE peptides encode the AKT1 and AKT2 proteins involved in the development of the cytokine storm. The specific targets for the EW peptide are the <i>ACE2</i> and <i>CYSLTR1</i> genes, and specific target for the KE peptide is the <i>CHUK</i> gene. Protein products of the <i>ACE2</i>, <i>CYSLTR1</i>, and <i>CHUK</i> genes are functionally associated with IL-1β, IL-6, TNF-α, IL-4, and IL-10 cytokines. An in vitro model of an inflammatory reaction demonstrated that Thymalin and EW and KE dipeptides reduced the synthesis of IL-1β, IL-6, and TNF-α cytokines in human peripheral blood mononuclear cells by 1.4-6.0 times. The immunomodulatory effect of Thymalin under the inflammatory response conditions in COVID-19 is based on the potential ability of its active components, EW and KE dipeptides, to regulate protein synthesis involved in the development of the cytokine storm.

SOX6
Also flagged:tumourcancercancersmammary tumoursBrca1p53
Journal Article 2023-08-29 ✓ 2 Snippets Ordonez L, Tornillo G, Kendrick H, Hay T, Smalley MJ.
In-Text Gene Mentions

qrtPCR analysis of the tumours was carried out using a panel of genes associated with the three main mammary epithelial cell lineages (basal: Fzd7, Id4, Jag1, Jag2, Krt14, Krt15, Notch4, Runx2 and Tp63; luminal ER negative: Foxc1 and Sox6; luminal ER positive: Esr1, Foxa1 and Msx2; and both luminal populations: Cd24a, Notch1, Notch2, Notch3 and Krt18) [15] and with NOTCH signalling (Dtx1, Fabp7, Fbxw7, Jag1, Jag2, Hes1, Hes2, Heyl, Notch1-4 and Nrarp).

…negative: Foxc1 andSox6; luminal ER…

Show Full Abstract

A better understanding of the mechanisms generating tumour heterogeneity will allow better targeting of current therapies, identify potential resistance mechanisms and highlight new approaches for therapy. We have previously shown that in genetically modified mouse models carrying conditional oncogenic alleles, mammary tumour histotype varies depending on the combination of alleles, the cell type to which they are targeted and, in some cases, reproductive history. This suggests that tumour heterogeneity is not a purely stochastic process; rather, differential activation of signalling pathways leads to reproducible differences in tumour histotype. We propose the NOTCH signalling pathway as one such pathway. Here, we have crossed conditional knockout <i>Notch1</i> or <i>Notch2</i> alleles into an established mouse mammary tumour model. <i>Notch1/2</i> deletion had no effect on tumour-specific survival; however, loss of <i>Notch</i> alleles resulted in a dose-dependent increase in metaplastic adenosquamous carcinomas (ASQCs). ASQCs and adenomyoepitheliomas (AMEs) also demonstrated a significant increase in AKT signalling independent of <i>Notch</i> status. Therefore, the NOTCH pathway is a suppressor of the ASQC phenotype, while increased PI3K/AKT signalling is associated with ASQC and AME tumours. We propose a model in which PI3K/AKT and NOTCH signalling act interact to determine mouse mammary tumour histotype.

Also flagged:Dendrimeric and branchedpeptidespolypeptidesantimicrobialpeptidedendrimer
Journal Article 2023-08-29 No Snippets To J, Zhang X, Tam JP.
Show Full Abstract

Dendrimeric and branched peptides are polypeptides formed by diverse types of scaffolds to give them different forms. Previously, we reported a cascade-type, Lys-scaffolded antimicrobial peptide dendrimer D4R tethered with four RLYR tetrapeptides. Antimicrobial D4R is broad-spectrum, salt insensitive, and as potent as the natural-occurring tachyplesins, displaying minimum inhibitory concentrations (MIC) < 1 μM. However, the relationships between scaffolds and antimicrobial potency remain undefined. Here, we report the design of four novel types of peptide antimicrobials whose scaffolded backbones are lysine (Lys), iso-Lys, ornithine (Orn), or iso-Orn tethered with RLYR on their α- or sidechain-amines to give ε-, δ-, and their α-branched peptides. When assayed against ten microorganisms, the Lys-scaffolded α- and ε-branched peptides are broadly active, salt insensitive, and as potent as D4R and tachyplesins, whereas the corresponding Orn-scaffolded α- and δ-branched peptides are salt sensitive and much less potent, displaying MICs ranging from 1 to >500 μM. Structure-activity relationship studies suggested that Lys-scaffolds, but not Orn-scaffolds, can support a reverse turn to organize RLYR tetrapeptides as parallel β-strands to form an amphipathic structure with Leu-Tyr as a hydrophobic core. Together, these results provide a structural approach for designing potent and salt-insensitive dendrimeric or branched peptide antimicrobials.

OLFM4
Also flagged:Acute graft-versus-host diseaseGvHDMHC class IdeathIFNγreceptor
Journal Article 2023-08-29 ✓ 5 Snippets Matthe DM, Dinkel M, Schmid B, Vogler T, Neurath MF, Poeck H, Neufert C, Büttner-Herold M, Hildner K.
In-Text Gene Mentions

…: CGAGTAGGTTGTAAGACAAATCTAGC),Olfm4(Mm_Olfm4_2_SG QuantiTect Prim…

…genes ( Lgr5,Olfm4), the expression…

…Employing Lgr5 andOlfm4, two molecular…

…both Lgr5 andOlfm4upon co-culture with…

…recovered Lgr5 andOlfm4expression levels (…

Show Full Abstract

Acute graft-versus-host disease (GvHD) remains the biggest clinical challenge and prognosis-determining complication after allogeneic hematopoietic stem cell transplantation (allo-HSCT). Donor T cells are acceptedly key mediators of alloreactivity against host tissues and here especially the gut. In support of previous studies, we found that the intestinal intra-epithelial lymphocyte (IEL) compartment was dynamically regulated in the course of MHC class I full mismatch allo-HSCT. However, while intestinal epithelial cell (IEC) damage endangers the integrity of the intestinal barrier and is a core signature of intestinal GvHD, the question whether and to what degree IELs are contributing to IEC dysregulation is poorly understood. To study lymphoepithelial interaction, we employed a novel <i>ex vivo</i> T cell/organoid co-culture model system. Here, allogeneic intra-epithelial T cells were superior in inducing IEC death compared to syngeneic IEL and allogeneic non-IEL T cells. The ability to induce IEC death was predominately confined to TCRβ+ T cells and was executed in a largely IFNγ-dependent manner. Alloreactivity required a diverse T cell receptor (TCR) repertoire since IELs genetically modified to express a TCR restricted to a single, non-endogenous antigen failed to mediate IEC pathology. Interestingly, minor histocompatibility antigen (miHA) mismatch was sufficient to elicit IEL-driven IEC damage. Finally, advanced live cell imaging analyses uncovered that alloreactive IELs patrolled smaller areas within intestinal organoids compared to syngeneic controls, indicating their unique migratory properties within allogeneic IECs. Together, we provide here experimental evidence for the utility of a co-culture system to model the cellular and molecular characteristics of the crosstalk between IELs and IEC in an allogeneic setting <i>ex vivo</i>. In the light of the emerging concept of dysregulated immune-epithelial homeostasis as a core aspect of intestinal GvHD, this approach represents a novel experimental system to e.g. screen therapeutic strategies for their potential to normalize T cell/IEC- interaction. Hence, analyses in pre-clinical <i>in vivo</i> allo-HSCT model systems may be restricted to hereby positively selected, promising approaches.

Also flagged:peptidespro-apoptotic proteinSmacDIABLOtumorcancer
Journal Article 2023-08-29 No Snippets Di Giorgio E, Ferino A, Huang W, Simonetti S, Xodo L, De Marco R.
Show Full Abstract

The refractoriness of tumor cells to apoptosis represents the main mechanism of resistance to chemotherapy. Smac/DIABLO mimetics proved to be effective in overcoming cancer-acquired resistance to apoptosis as a consequence of overexpression of the anti-apoptotic proteins XIAP, cIAP1, and cIAP2. In this work, we describe a dual-targeting peptide capable of selectively activating apoptosis in cancer cells. The complex consists of a fluorescent periodic mesoporous organosilica nanoparticle that carries the short sequences of Smac/DIABLO bound to the αvβ3-integrin ligand. The dual-targeting peptide @PMO shows significantly higher toxicity in αvβ3-positive HeLa cells with respect to αvβ3-negative Ht29 cells. @PMO exhibited synergistic effects in combination with oxaliplatin in a panel of αvβ3-positive cancer cells, while its toxicity is overcome by XIAP overexpression or integrin β3 silencing. The successful uptake of the molecule by αvβ3-positive cells makes @PMO promising for the re-sensitization to apoptosis of many cancer types.

Also flagged:localizationmitochondriamitochondrialUCP2estrogensorganelles
Journal Article 2023-08-29 No Snippets Maes ME, Colombo G, Schoot Uiterkamp FE, Sternberg F, Venturino A, Pohl EE, Siegert S.
Show Full Abstract

Mitochondrial networks remodel their connectivity, content, and subcellular localization to support optimized energy production in conditions of increased environmental or cellular stress. Microglia rely on mitochondria to respond to these stressors, however our knowledge about mitochondrial networks and their adaptations in microglia <i>in vivo</i> is limited. Here, we generate a mouse model that selectively labels mitochondria in microglia. We identify that mitochondrial networks are more fragmented with increased content and perinuclear localization <i>in vitro</i> vs. <i>in vivo</i>. Mitochondrial networks adapt similarly in microglia closest to the injury site after optic nerve crush. Preventing microglial UCP2 increase after injury by selective knockout induces cellular stress. This results in mitochondrial hyperfusion in male microglia, a phenotype absent in females due to circulating estrogens. Our results establish the foundation for mitochondrial network analysis of microglia <i>in vivo</i>, emphasizing the importance of mitochondrial-based sex effects of microglia in other pathologies.

Also flagged:hydroxyapatitepolylactic acidcollagenmineralizationosteogenesispore
Journal Article 2023-08-29 No Snippets Liu X, Gao J, Cui X, Nie S, Wu X, Zhang L, Tang P, Liu J, Li M.
Show Full Abstract

The treatment of critical-size bone defects remains a complicated clinical challenge. Recently, bone tissue engineering has emerged as a potential therapeutic approach for defect repair. This study examined the biocompatibility and repair efficacy of hydroxyapatite-mineralized bionic polylactic acid (PLA) scaffolds, which were prepared through a combination of 3D printing technology, plasma modification, collagen coating, and hydroxyapatite mineralization coating techniques. Physicochemical analysis, mechanical testing, and in vitro and animal experiments were conducted to elucidate the impact of structural design and microenvironment on osteogenesis. Results indicated that the PLA scaffold exhibited a porosity of 84.1% and a pore size of 350 μm, and its macrostructure was maintained following functionalization modification. The functionalized scaffold demonstrated favorable hydrophilicity and biocompatibility and promoted cell adhesion, proliferation, and the expression of osteogenic genes such as ALP, OPN, Col-1, OCN, and RUNX2. Moreover, the scaffold was able to effectively repair critical-size bone defects in the rabbit radius, suggesting a novel strategy for the treatment of critical-size bone defects.

Also flagged:polysaccharidesmetalspolysaccharidemonosaccharidesmonosaccharidehydroxyl
Journal Article 2023-08-29 No Snippets Visan AI, Cristescu R.
Show Full Abstract

Therapeutic polysaccharide-based coatings have recently emerged as versatile strategies to transform a conventional medical implant into a drug delivery system. However, the translation of these polysaccharide-based coatings into the clinic as drug delivery systems still requires a deeper understanding of their drug degradation/release profiles. This claim is supported by little or no data. In this review paper, a comprehensive description of the benefits and challenges generated by the polysaccharide-based coatings is provided. Moreover, the latest advances made towards the application of the most important representative coatings based on polysaccharide types for drug delivery are debated. Furthermore, suggestions/recommendations for future research to speed up the transition of polysaccharide-based drug delivery systems from the laboratory testing to clinical applications are given.

HTT
Also flagged:trabecular tumorthyroid glandneoplasmPapillary Thyroid CarcinomaMedullary CarcinomaFollicular Neoplasm
Journal Article 2023-08-29 ✓ 1 Snippet Nielsen L, Gallardo AMC, Alonso PP, Medina LO, García EL, Del Arco CD, Jiménez RB, García LA, Blanco MC, González JV, Serrano MT, Fernández-Aceñero MJ.
In-Text Gene Mentions

A BRAF mutation would exclude this entity favoring a PTC.[21-24] The immunohistochemical characteristics and molecular alterations of HTT and PTC are summarized in [Table 3].

Show Full Abstract

<h4>Objectives</h4>The hyalinizing trabecular tumor (HTT) is a rare benign neoplasm of the thyroid gland. This neoplasm has overlapping cytological features with Papillary Thyroid Carcinoma, Medullary Carcinoma and Follicular Neoplasm with Nuclear Features of Papillary Carcinoma. This can lead to misdiagnosis of malignancy in fine needle aspiration (FNA) cytology specimens with unnecessary total thyroidectomy. The aim of this study is to determine if there are some cytological features that could help us to suspect HTT on FNA specimens and avoid radical surgery.<h4>Material and methods</h4>With this purpose we have collected 6 cases diagnosed of HTT in Hospital Clínico San Carlos of Madrid (Spain) in the last 10 years and reviewed the cytological specimens.<h4>Result</h4>We conclude that the presence of hyaline material in FNA specimens of HTT is a constant feature being a diagnostic clue. We must be cautious not to confuse it with dense colloid or amyloid material, the latter seen in Medullary Carcinoma. Papillary architecture and fibrovascular cores are not present in a HTT. Special stains as ki-67, calcitonin and Congo Red staining could help us in achieving the correct diagnosis.<h4>Conclusion</h4>We feel the cytopathologists must be aware of the distinguishing features of this lesion, mainly the typical hyaline material to achieve a proper diagnosis and be able to reduce unnecessary aggressive management of these patients.

PRDX6
Also flagged:NOX1hepatocellular carcinomaNADPH oxidase 1p22phoxNOXO1NOXA1
Journal Article 2023-08-29 ✓ 5 Snippets Lagal DJ, Bárcena JA, Requejo-Aguilar R, Padilla CA, Leto TL.
In-Text Gene Mentions

NOX1 and PRDX6 synergistically support migration and invasiveness of hepatocellular carcinoma cells through enhanced NADPH oxidase activity.

Overall, these results demonstrate a clear functional cooperation between NOX1 and PRDX6 catalytic activities which generate higher levels of ROS production, resulting in a more aggressive tumor phenotype.

…NOX1 andPRDX6synergistically support migrat…

…the peroxiredoxin 6 (PRDX6)-NOX1 enzyme interaction lead…

…peroxidase activities ofPRDX6were abolished by…

Show Full Abstract

The NADPH oxidase 1 (NOX1) complex formed by proteins NOX1, p22phox, NOXO1, NOXA1, and RAC1 plays an important role in the generation of superoxide and other reactive oxygen species (ROS) which are involved in normal and pathological cell functions due to their effects on diverse cell signaling pathways. Cell migration and invasiveness are at the origin of tumor metastasis during cancer progression which involves a process of cellular de-differentiation known as the epithelial-mesenchymal transition (EMT). During EMT cells lose their polarized epithelial phenotype and express mesenchymal marker proteins that enable cytoskeletal rearrangements promoting cell migration, expression and activation of matrix metalloproteinases (MMPs), tissue remodeling, and cell invasion during metastasis. In this work, we explored the importance of the peroxiredoxin 6 (PRDX6)-NOX1 enzyme interaction leading to NOXA1 protein stabilization and increased levels of superoxide produced by NOX in hepatocarcinoma cells. This increase was accompanied by higher levels of N-cadherin and MMP2, correlating with a greater capacity for cell migration and invasiveness of SNU475 hepatocarcinoma cells. The increase in superoxide and the associated downstream effects on cancer progression were suppressed when phospholipase A<sub>2</sub> or peroxidase activities of PRDX6 were abolished by site-directed mutagenesis, reinforcing the importance of these catalytic activities in supporting NOX1-based superoxide generation. Overall, these results demonstrate a clear functional cooperation between NOX1 and PRDX6 catalytic activities which generate higher levels of ROS production, resulting in a more aggressive tumor phenotype.

HTT
Also flagged:Neurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseHuntington's diseaseamyotrophic lateral sclerosisimmune response
Journal Article 2023-08-29 ✓ 3 Snippets Lee MY, Kim M.
In-Text Gene Mentions

HD is an autosomal dominant genetic disease caused by an abnormal repeat in the CAG sequence of the HTT, which that encodes the HTT protein, on the short arm of chromosome 4.

The expression of mutant HTT (mHTT) also activates the NF-κB pathway and is involved in neuroinflammation in HD.

HD is a fatal neurodegenerative disease accompanied by abnormal involuntary movement disorder, psychiatric and cognitive disorders, and dementia owing to mutation and aggregation of the huntingtin (HTT) protein [93].

Show Full Abstract

Red ginseng (RG) is widely used as a herbal medicine. As the human lifespan has increased, numerous diseases have developed, and RG has also been used to treat various diseases. Neurodegenerative diseases are major problems that modern people face through their lives. Neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis are featured by progressive nerve system damage. Recently, neuroinflammation has emerged as a degenerative factor and is an immune response in which cytokines with nerve cells that constitute the nervous system. RG, a natural herbal medicine with fewer side effects than chemically synthesized drugs, is currently in the spotlight. Therefore, we reviewed studies reporting the roles of RG in treating neuroinflammation and neurodegenerative diseases and found that RG might help alleviate neurodegenerative diseases by regulating neuroinflammation.

bioRxiv 2023-08-29 Preprint (No Snippets API) Carpentier R, Capizzi M, Kim H, Novion-Ducassou J, Denarier E, Blot B, Couté Y, Arnal I, Song J, Humbert S.
Show Full Abstract

Huntingtin (HTT) is a large protein whose best-known function being the facilitation of intracellular dynamics along the microtubule network by scaffolding molecular motors complexes. Our recent finding that the defective axonal growth in HD was due to altered growth cone architecture led us to ask whether HTT also influences the cytoskeleton itself. In developing neurons, we found that a large proportion of HTT associates with F-actin in growth cones. Using cell free system and purified recombinant proteins, we observed that HTT binds directly filamentous actin (F-actin) and organizes filaments into bundles. Transmission electron microscopy shows that HTT dimers crosslink adjacent filaments 20 nm apart. We also provide evidence that HTT binding on F-actin modulates the association of other proteins to this cytoskeleton. Notably, HTT limits the association of the growth cone protein Drebrin1 with F-actin. HTT depletion leads to abnormal cytoskeletal organization, localization of Drebrin1 in growth cones, and axonal growth. HTT therefore serves a scaffolding function for the cytoskeleton itself, what might be relevant for HD pathophysiology.

Research Square 2023-08-29 Preprint (No Snippets API) Panda P, Sarohi V, Basak T, Kasturi P.
Show Full Abstract

Huntington's disease (HD) is one of the prominent neurodegenerative diseases, characterized by the progressive decline of neuronal function, due to the accumulation and aggregation of misfolded proteins. Pathological progression of HD is hallmarked by the aberrant aggregation of the huntingtin protein (HTT) and subsequent neurotoxicity. Molecular chaperones (heat shock proteins, HSPs) play a pivotal role in maintaining proteostasis by facilitating protein refolding, degradation, or sequestration to limit the accumulation of misfolded proteins during neurotoxicity. However, the role of post-translational modifications such as ubiquitination among HSPs during HD is less known. In this study, we aimed to elucidate HSPs ubiquitin code in the context of HD pathogenesis. In a comprehensive proteomic analysis, we identified site-specific ubiquitination events in HSPs associated with HTT in HD-affected brain regions. To assess the impact of ubiquitination on HSPs during HD, we quantified the abundance of ubiquitinated lysine sites in both the rat cortex/striatum and in the mice primary cortical neurons. Strikingly, we observed highly tissue-specific alterations in the relative ubiquitination levels of HSPs under HD conditions, emphasizing the importance of spatial perturbed post-translational modifications (PTMs) in shaping disease pathology. These ubiquitination events, combined with other PTMs on HSPs, are likely to influence the phase-transitions of HTT. In conclusion, our study uncovered differential site-specific ubiquitination of molecular chaperones and offers a comprehensive view of the intricate relationship between protein aggregation, and PTMs in the context of Huntington's disease.

PCDH17
Also flagged:urinary bladder cancerarsenicwateraromatic amineschronic urinary infectionscancer
Journal Article 2023-08-28 ✓ 2 Snippets Wong K, Abascal F, Ludwig L, Aupperle-Lellbach H, Grassinger J, Wright CW, Allison SJ, Pinder E, Phillips RM, Romero LP, Gal A, Roady PJ, Pires I, Guscetti F, Munday JS, Peleteiro MC, Pinto CA, Carvalho T, Cota J, Du Plessis EC, Constantino-Casas F, Plog S, Moe L, de Brot S, Bemelmans I, Amorim RL, Georgy SR, Prada J, Del Pozo J, Heimann M, de Carvalho Nunes L, Simola O, Pazzi P, Steyl J, Ubukata R, Vajdovich P, Priestnall SL, Suárez-Bonnet A, Roperto F, Millanta F, Palmieri C, Ortiz AL, Barros CSL, Gava A, Söderström ME, O'Donnell M, Klopfleisch R, Manrique-Rincón A, Martincorena I, Ferreira I, Arends MJ, Wood GA, Adams DJ, van der Weyden L.
In-Text Gene Mentions

In canine UC, we identified 9 significantly mutated genes (BRAF, CSMD3, CDH12, ARID1A, PCDH17, KMD6A, ZNF804B, PCDH9, and GPRASP1; Additional file 7: Table S5).

…, ARID1A ,PCDH17, KMD6A ,…

Show Full Abstract

<h4>Background</h4>In humans, muscle-invasive bladder cancer (MIBC) is highly aggressive and associated with a poor prognosis. With a high mutation load and large number of altered genes, strategies to delineate key driver events are necessary. Dogs and cats develop urothelial carcinoma (UC) with histological and clinical similarities to human MIBC. Cattle that graze on bracken fern also develop UC, associated with exposure to the carcinogen ptaquiloside. These species may represent relevant animal models of spontaneous and carcinogen-induced UC that can provide insight into human MIBC.<h4>Results</h4>Whole-exome sequencing of domestic canine (n = 87) and feline (n = 23) UC, and comparative analysis with human MIBC reveals a lower mutation rate in animal cases and the absence of APOBEC mutational signatures. A convergence of driver genes (ARID1A, KDM6A, TP53, FAT1, and NRAS) is discovered, along with common focally amplified and deleted genes involved in regulation of the cell cycle and chromatin remodelling. We identify mismatch repair deficiency in a subset of canine and feline UCs with biallelic inactivation of MSH2. Bovine UC (n = 8) is distinctly different; we identify novel mutational signatures which are recapitulated in vitro in human urinary bladder UC cells treated with bracken fern extracts or purified ptaquiloside.<h4>Conclusion</h4>Canine and feline urinary bladder UC represent relevant models of MIBC in humans, and cross-species analysis can identify evolutionarily conserved driver genes. We characterize mutational signatures in bovine UC associated with bracken fern and ptaquiloside exposure, a human-linked cancer exposure. Our work demonstrates the relevance of cross-species comparative analysis in understanding both human and animal UC.

Also flagged:Vigabatrintuberous sclerosis complexinfantile spasmsspasmsTuberous Sclerosisdrug
Journal Article 2023-08-28 No Snippets Bebin EM, Peters JM, Porter BE, McPherson TO, O'Kelley S, Sahin M, Taub KS, Rajaraman R, Randle SC, McClintock WM, Koenig MK, Frost MD, Northrup HA, Werner K, Nolan DA, Wong M, Krefting JL, Biasini F, Peri K, Cutter G, Krueger DA, PREVeNT Study Group.
Show Full Abstract

<h4>Objective</h4>This study was undertaken to test the hypothesis that early vigabatrin treatment in tuberous sclerosis complex (TSC) infants improves neurocognitive outcome at 24 months of age.<h4>Methods</h4>A phase IIb multicenter randomized double-blind placebo-controlled trial was conducted of vigabatrin at first epileptiform electroencephalogram (EEG) versus vigabatrin at seizure onset in infants with TSC. Primary outcome was Bayley Scales of Infant and Toddler Development, Third Edition (Bayley-III) cognitive assessment score at 24 months. Secondary outcomes were prevalence of drug-resistant epilepsy, additional developmental outcomes, and safety of vigabatrin.<h4>Results</h4>Of 84 infants enrolled, 12 were screen failures, 4 went straight to open label vigabatrin, and 12 were not randomized (normal EEG throughout). Fifty-six were randomized to early vigabatrin (n = 29) or placebo (n = 27). Nineteen of 27 in the placebo arm transitioned to open label vigabatrin, with a median delay of 44 days after randomization. Bayley-III cognitive composite scores at 24 months were similar for participants randomized to vigabatrin or placebo. Additionally, no significant differences were found between groups in overall epilepsy incidence and drug-resistant epilepsy at 24 months, time to first seizure after randomization, and secondary developmental outcomes. Incidence of infantile spasms was lower and time to spasms after randomization was later in the vigabatrin group. Adverse events were similar across groups.<h4>Interpretation</h4>Preventative treatment with vigabatrin based on EEG epileptiform activity prior to seizure onset does not improve neurocognitive outcome at 24 months in TSC children, nor does it delay onset or lower the incidence of focal seizures and drug-resistant epilepsy at 24 months. Preventative vigabatrin was associated with later time to onset and lower incidence of infantile spasms. ANN NEUROL 2023.

Also flagged:adaptive immunitychronic infectionscancersautoimmune diseaseschronic viral infectionscell migration
Journal Article 2023-08-28 No Snippets Li C, Hou Y, He M, Lv L, Zhang Y, Sun S, Zhao Y, Liu X, Ma P, Wang X, Zhou Q, Zhan L.
Show Full Abstract

Immunotherapy using dendritic cell (DC)-based vaccination is an established approach for treating cancer and infectious diseases; however, its efficacy is limited. Therefore, targeting the restricted migratory capacity of the DCs may enhance their therapeutic efficacy. In this study, the effect of laponite (Lap) on DCs, which can be internalized into lysosomes and induce cytoskeletal reorganization via the lysosomal reprogramming-calcium flicker axis, is evaluated, and it is found that Lap dramatically improves the in vivo homing ability of these DCs to lymphoid tissues. In addition, Lap improves antigen cross-presentation by DCs and increases DC-T-cell synapse formation, resulting in enhanced antigen-specific CD8<sup>+</sup> T-cell activation. Furthermore, a Lap-modified cocktail (Lap@cytokine cocktail [C-C]) is constructed based on the gold standard, C-C, as an adjuvant for DC vaccines. Lap@C-C-adjuvanted DCs initiated a robust cytotoxic T-cell immune response against hepatitis B infection, resulting in > 99.6% clearance of viral DNA and successful hepatitis B surface antigen seroconversion. These findings highlight the potential value of Lap as a DC vaccine adjuvant that can regulate DC homing, and provide a basis for the development of effective DC vaccines.

Also flagged:G-CSFconjugationdipeptidetransglutaminaseTGasealdehyde
Journal Article 2023-08-28 No Snippets Grigoletto A, Marotti V, Tedeschini T, Campara B, Marigo I, Ingangi V, Pasut G.
Show Full Abstract

In this study, a circular conjugate of granulocyte colony-stimulating factor (G-CSF) was prepared by conjugating the two end-chains of poly(ethylene glycol) (PEG) to two different sites of the protein. For the orthogonal conjugation, a heterobifunctional PEG chain was designed and synthesized, bearing the dipeptide ZGln-Gly (ZQG) at one end-chain, for transglutaminase (TGase) enzymatic selective conjugation at Lys41 of G-CSF, and an aldehyde group at the opposite end-chain, for N-terminal selective reductive alkylation of the protein. The cPEG-Nter/K41-G-CSF circular conjugate was characterized by physicochemical methods and compared with native G-CSF and the corresponding linear monoconjugates of G-CSF, PEG-Nter-G-CSF, and PEG-K41-G-CSF. The results demonstrated that the circular conjugate had improved physicochemical and thermal stability, prolonged pharmacokinetic interaction, and retained the biological activity of G-CSF. The PEGylation strategy employed in this study has potential applications in the design of novel protein-based therapeutics.

Also flagged:synaptogenesisextracellularreticular laminamitosiscell cycleCDKN1B
Journal Article 2023-08-28 No Snippets Ebeid M, Kishimoto I, Roy P, Zaidi MAA, Cheng AG, Huh SH.
Show Full Abstract

The mammalian cochlea is composed of sensory hair cells as well as multiple different types of non-sensory supporting cells. Pillar cells are one type of supporting cell that form the tunnel of Corti and include two morphologically and functionally distinct subtypes: inner pillar cells (IPCs) and outer pillar cells (OPCs). The processes of specification and differentiation of inner versus outer pillar cells are still unclear. Here, we show that β-Catenin is required for establishing IPC identity in the mammalian cochlea. To differentiate the transcriptional and adhesion roles of β-Catenin in establishing IPC identity, we examined two different models of β-Catenin deletion; one that deletes both transcriptional and structural functions and one which retains cell adhesion function but lacks transcriptional function. Here, we show that cochleae lacking β-Catenin transcriptional function lost IPCs and displayed extranumerary OPCs, indicating its requirement for establishing IPC identity. Overexpression of β-Catenin induced proliferation within IPCs but not ectopic IPCs. Single-cell transcriptomes of supporting cells lacking β-Catenin transcriptional function show a loss of the IPC and gain of OPC signatures. Finally, targeted deletion of β-Catenin in IPCs also led to the loss of IPC identity, indicating a cell autonomous role of β-Catenin in establishing IPC identity. As IPCs have the capacity to regenerate sensory hair cells in the postnatal cochlea, our results will aid in future IPC-based hair cell regeneration strategies.

PRDX6
Also flagged:cancerliver carcinomatumorchromosomemechanotransductioncell differentiation
Journal Article 2023-08-28 ✓ 1 Snippet Brun C, Allain C, Ferron PJ, Younoussa H, Colicchio B, Jeandidier E, M'Kacher R, Guguen-Guillouzo C, Bertile F.
In-Text Gene Mentions

…GSTA2, SOD2, andPRDX6), those involved in…

Show Full Abstract

The characteristics and fate of cancer cells partly depend on their environmental stiffness, i.e., the local mechanical cues they face. HepaRG progenitors are liver carcinoma cells exhibiting transdifferentiation properties; however, the underlying mechanisms remain unknown. To evaluate the impact of external physical forces mimicking the tumor microenvironment, we seeded them at very high density for 20 h, keeping the cells round and unanchored to the substrate. Applied without corticoids, spatial confinement due to very high density induced reprogramming of HepaRG cells into stable replicative stem-like cells after replating at normal density. Redifferentiation of these stem-like cells into cells very similar to the original HepaRG cells was then achieved using the same stress but in the presence of corticoids. This demonstrates that the cells retained the memory required to run the complete hepatic differentiation program, after bypassing the Hayflick limit twice. We show that physical stress improved chromosome quality and genomic stability, through greater efficiency of DNA repair and restoration of telomerase activity, thus enabling cells to escape progression to a more aggressive cancer state. We also show the primary importance of high-density seeding, possibly triggering compressive stress, in these processes, rather than that of cell roundness or intracellular tensional signals. The HepaRG-derived lines established here considerably extend the lifespan and availability of this surrogate cell system for mature human hepatocytes. External physical stress is a promising way to create a variety of cell lines, and it paves the way for the development of strategies to improve cancer prognosis.

Also flagged:wound healinghemostasisbone morphogenetic proteinsBMPsdipyridamoleadenosine A 2A receptor
Journal Article 2023-08-28 No Snippets Nayak VV, Slavin B, Bergamo ETP, Boczar D, Slavin BR, Runyan CM, Tovar N, Witek L, Coelho PG.
Show Full Abstract

Bone tissue regeneration is a complex process that proceeds along the well-established wound healing pathway of hemostasis, inflammation, proliferation, and remodeling. Recently, tissue engineering efforts have focused on the application of biological and technological principles for the development of soft and hard tissue substitutes. Aim is directed towards boosting pathways of the healing process to restore form and function of tissue deficits. Continued development of synthetic scaffolds, cell therapies, and signaling biomolecules seeks to minimize the need for autografting. Despite being the current gold standard treatment, it is limited by donor sites' size and shape, as well as donor site morbidity. Since the advent of computer-aided design/computer-aided manufacturing (CAD/CAM) and additive manufacturing (AM) techniques (3D printing), bioengineering has expanded markedly while continuing to present innovative approaches to oral and craniofacial skeletal reconstruction. Prime examples include customizable, high-strength, load bearing, bioactive ceramic scaffolds. Porous macro- and micro-architecture along with the surface topography of 3D printed scaffolds favors osteoconduction and vascular in-growth, as well as the incorporation of stem and/or other osteoprogenitor cells and growth factors. This includes platelet concentrates (PCs), bone morphogenetic proteins (BMPs), and some pharmacological agents, such as dipyridamole (DIPY), an adenosine A 2A receptor indirect agonist that enhances osteogenic and osteoinductive capacity, thus improving bone formation. This two-part review commences by presenting current biological and engineering principles of bone regeneration utilized to produce 3D-printed ceramic scaffolds with the goal to create a viable alternative to autografts for craniofacial skeleton reconstruction. Part II comprehensively examines recent preclinical data to elucidate the potential clinical translation of such 3D-printed ceramic scaffolds.

RABGAP1LZNFX1
Also flagged:COVID-19pathogenesislung infectionimmune responsedeathinterferon
Journal Article 2023-08-28 ✓ 3 Snippets Oh T, Kim G, Baek SH, Woo Y, Koo BS, Hwang EH, Shim K, An YJ, Kim Y, Won J, Lee Y, Lim KS, Park JH, Hong JJ.
In-Text Gene Mentions

…TIMP1 , andZNFX1, was observed…

…, PPP1CA ,RABGAP1L, ST14 ,…

…Interestingly,RABGAP1L, which enhances…

Show Full Abstract

Characterizing the host response to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) at the molecular level is necessary to understand viral pathogenesis and identify clinically relevant biomarkers. However, in humans, the pulmonary host response during disease onset remains poorly understood. Herein, we utilized a spatial transcriptome atlas to identify pulmonary microstructure-specific COVID-19 gene signatures during the acute phase of lung infection in cynomolgus macaques. The innate immune response to virus-induced cell death was primarily active in the alveolar regions involving activated macrophage infiltration. Inflamed vascular regions exhibited prominent upregulation of interferon and complement pathway genes that mediate antiviral activity and tissue damage response. Furthermore, known biomarker genes were significantly expressed in specific microstructures, and some of them were universally expressed across all microstructures. These findings underscore the importance of identifying key drivers of disease progression and clinically applicable biomarkers by focusing on pulmonary microstructures appearing during SARS-CoV-2 infection.

Also flagged:methylationgene expressionresponse to heat stresscell divisionglycosaminoglycandegradation
Journal Article 2023-08-28 No Snippets Liu A, Zeng F, Wang L, Zhen H, Xia X, Pei H, Dong C, Zhang Y, Ding J.
Show Full Abstract

<h4>Background</h4>DNA methylation plays an important role in life processes by affecting gene expression, but it is still unclear how DNA methylation is controlled and how it regulates gene transcription under high temperature stress conditions in Strongylocentrotus intermedius. The potential link between DNA methylation variation and gene expression changes in response to heat stress in S. intermedius was investigated by MethylRAD-seq and RNA-seq analysis. We screened DNA methylation driver genes in order to comprehensively elucidate the regulatory mechanism of its high temperature adaptation at the DNA/RNA level.<h4>Results</h4>The results revealed that high temperature stress significantly affected not only the DNA methylation and transcriptome levels of S. intermedius (P < 0.05), but also growth. MethylRAD-seq analysis revealed 12,129 CG differential methylation sites and 966 CWG differential methylation sites, and identified a total of 189 differentially CG methylated genes and 148 differentially CWG methylated genes. Based on KEGG enrichment analysis, differentially expressed genes (DEGs) are mostly enriched in energy and cell division, immune, and neurological damage pathways. Further RNA-seq analysis identified a total of 1968 DEGs, of which 813 genes were upregulated and 1155 genes were downregulated. Based on the joint MethylRAD-seq and RNA-seq analysis, metabolic processes such as glycosaminoglycan degradation, oxidative phosphorylation, apoptosis, glutathione metabolism, thermogenesis, and lysosomes are regulated by DNA methylation.<h4>Conclusions</h4>High temperature affected the DNA methylation and expression levels of genes such as MOAP-1, GGT1 and RDH8, which in turn affects the metabolism of HPSE, Cox, glutathione, and retinol, thereby suppressing the immune, energy metabolism, and antioxidant functions of the organism and finally manifesting as stunted growth. In summary, the observations in the present study improve our understanding of the molecular mechanism of the response to high temperature stress in sea urchin.

CA10
Also flagged:Histone H3cancerMidline GliomaALDHALDH1A3histone
Journal Article 2023-08-28 ✓ 1 Snippet Sharma M, Barravecchia I, Magnuson B, Ferris SF, Apfelbaum A, Mbah NE, Cruz J, Krishnamoorthy V, Teis R, Kauss M, Koschmann C, Lyssiotis CA, Ljungman M, Galban S.
In-Text Gene Mentions

…KO cells wereCA10, CNTNAP5, HIST1H3J, KNL1,…

Show Full Abstract

Therapeutic resistance remains a major obstacle to preventing progression of H3K27M-altered Diffuse Midline Glioma (DMG). Resistance is driven in part by ALDH-positive cancer stem cells (CSC), with high ALDH1A3 expression observed in H3K27M-mutant DMG biopsies. We hypothesized that ALDH-mediated stemness and resistance may in part be driven by the oncohistone itself. Upon deletion of H3K27M, ALDH1A3 expression decreased dramatically and was accompanied by a gain in astrocytic marker expression and a loss of neurosphere forming potential, indicative of differentiation. Here we show that the oncohistone regulates histone acetylation through ALDH1A3 in a Wnt-dependent manner and that loss of H3K27M expression results in sensitization of DMGs to radiotherapy. The observed elevated Wnt signaling in H3K27M-altered DMG likely stems from a dramatic suppression of mRNA and protein expression of the Wnt inhibitor EYA4 driven by the oncohistone. Thus, our findings identify EYA4 as a bona fide tumor suppressor in DMG that upon suppression, results in aberrant Wnt signaling to orchestrate stemness and differentiation. Future studies will explore whether overexpression of EYA4 in DMG can impede growth and invasion. In summary, we have gained mechanistic insight into H3K27M-mediated regulation of cancer stemness and differentiation, which provides rationale for exploring new therapeutic targets for DMG.

DCC
Also flagged:aging
Journal Article 2023-08-28 ✓ 1 Snippet Kelley ML.
In-Text Gene Mentions

…By 2021, theDCCmodel has evolved…

Show Full Abstract

The purpose of this article is to share a Canadian model called <i>Developing a Compassionate Community (DCC)</i> in which aging, dying, caregiving, and grieving are everyone's responsibility. The model provides a research-informed practice guide for people who choose to adopt a community capacity development approach to developing a compassioante community. Based on 30 years of Canadian research by the author in rural, urban, First Nations communities, and long-term care homes, the <i>DCC</i> model offers a practice theory and practical tool. The model incorporates the principles of community capacity development which are as follows: change is incremental and in phases, but nonlinear and dynamic; the change process takes time; development is essentially about developing people; development builds on existing resources (assets); development cannot be imposed from the outside; and development is ongoing (never-ending). Community capacity development starts with citizens who want to make positive changes in their lives and their community. They become empowered by gaining the knowledge, skills, and resources they need. The community mobilizes around finding solutions rather than discussing problems. Passion propels their action and commitment drives the process. The strategy for change is engaging, empowering, and educating community members to act on their own behalf. It requires mobilizing networks of families, friends, and neighbors across the community, wherever people live, work, or play. Community networks are encouraged to prepare for later life, and for giving and getting help among themselves. This Canadian model offers communities one approach to developing a compassionate community and is a resource for implementing a public health approach to end-of-life care in Canada. The model is also available to be evaluated for its applicability beyond Canada and is designed to be adapted to new contexts if desired.

DCC
Also flagged:cystdysgenesis of corpus callosuminterhemispheric cystdysgenesisAVMof the
Journal Article 2023-08-28 ✓ 3 Snippets Dhakal P, Aryal AB, Dev A, Dhakal S, Kandel D.
In-Text Gene Mentions

DCC, on the other…

…AVM, IHC, andDCCis not well…

…with AVM andDCC[1] and environmental…

Show Full Abstract

AVID (Asymmetric ventriculomegaly, interhemispheric cyst, and dysgenesis of corpus callosum) spectrum is a rare phenomenon as such in its whole and the defects are not exclusive to the condition. Each may occur in isolation or together and have characteristic clinical and imaging findings. The vast array of mimics coexisting with the condition makes it a harder diagnosis to make and requires a great length of experience and observation which may explain the limited recordings of AVID. Sonography and fetal magnetic resonance imaging goes a long way and provide accurate diagnosis ruling out the mimics and aiding in prenatal visualization of the defects. Accurate diagnosis aids in effective management and counseling regarding outcomes and the potential timeline of the severity of the symptoms. In its rarity, this case report of AVID is one of the first report of its kind reported from Nepal.

Also flagged:GlaucomaNeurodegenerative Diseasesneurodegenerative disorderAmyotrophic Lateral SclerosisnucleotidesAD
Journal Article 2023-08-28 No Snippets Vasconcelos CFM, Ribas VT, Petrs-Silva H.
Show Full Abstract

Advances in RNA-sequencing technologies have led to the identification of molecular biomarkers for several diseases, including neurodegenerative diseases, such as Alzheimer's, Parkinson's, Huntington's diseases and Amyotrophic Lateral Sclerosis. Despite the nature of glaucoma as a neurodegenerative disorder with several similarities with the other above-mentioned diseases, transcriptional data about this disease are still scarce. microRNAs are small molecules (~17-25 nucleotides) that have been found to be specifically expressed in the CNS as major components of the system regulating the development signatures of neurodegenerative diseases and the homeostasis of the brain. In this review, we sought to identify similarities between the functional mechanisms and the activated pathways of the most common neurodegenerative diseases, as well as to discuss how those mechanisms are regulated by miRNAs, using RNA-Seq as an approach to compare them. We also discuss therapeutically suitable applications for these disease hallmarks in clinical future studies.

RABGAP1L
Also flagged:oncogenestumorE-cadherincolon tumorsc-Foscell proliferation
Journal Article 2023-08-28 ✓ 1 Snippet Cui W, Subramani A, Fonseca P, Zhang Y, Tong L, Zhang Y, Egevad L, Lundqvist A, Holmgren L.
In-Text Gene Mentions

…alpha-catenin, vinculin, andRas GTPase-activating-like protein 1GTPase-activating-like protein…

Show Full Abstract

Preserving an accurate cell count is crucial for maintaining homeostasis. Apical extrusion, a process in which redundant cells are eliminated by neighboring cells, plays a key role in this regard. Recent studies have revealed that apical extrusion can also be triggered in cells transformed by oncogenes, suggesting it may be a mechanism through which tumor cells escape their microenvironment. In previous work, we demonstrated that p60AmotL2 modulates the E-cadherin function by inhibiting its connection to radial actin filaments. This isoform of AmotL2 is expressed in invasive breast and colon tumors and promotes invasion in vitro and in vivo. Transcriptionally regulated by c-Fos, p60AmotL2 is induced by local stress signals such as severe hypoxia. In this study, we investigated the normal role of p60AmotL2 in epithelial tissues. We found that this isoform is predominantly expressed in the gut, where cells experience rapid turnover. Through time-lapse imaging, we present evidence that cells expressing p60AmotL2 are extruded by their normal neighboring cells. Based on these findings, we hypothesize that tumor cells exploit this pathway to detach from normal epithelia and invade surrounding tissues.

Also flagged:nitric oxideApoptosis ofendothelial cells5-hydroxytryptaminehistamineangiotensin
Journal Article 2023-08-28 No Snippets Wu S, Ootawa T, Sekio R, Smith H, Islam MZ, Nguyen HTT, Uno Y, Shiraishi M, Miyamoto A.
Show Full Abstract

The basilar arterial endothelium mediates blood vessel relaxation partly through the release of nitric oxide (NO). Apoptosis of cerebrovascular endothelial cells is linked to a high mortality rate in chickens infected with the highly pathogenic avian influenza virus, but interestingly, ducks exhibit a greater resistance to this virus. In this study, we examined the responsiveness of duck basilar arteries (BAs) to various vasoactive substances, including 5-hydroxytryptamine (5-HT), histamine (His), angiotensin (Ang) II, noradrenaline (NA), acetylcholine (ACh), and avian bradykinin ornithokinin (OK), aiming to characterize the receptor subtypes involved and the role of endothelial NO in vitro. Our findings suggest that arterial contraction is mediated with 5-HT<sub>1</sub> and H<sub>1</sub> receptors, while relaxation is induced with β<sub>3</sub>-adrenergic and M<sub>3</sub> receptors. Additionally, OK elicited a biphasic response in duck BAs, and Ang II had no effect. Endothelial NO appears to be crucial in relaxation mediated with M<sub>3</sub> and OK receptors but not β<sub>3</sub>-adrenergic receptors in the duck BA. The reduced endothelial NO involvement in the receptor-mediated relaxation response in duck BAs represents a clear difference from the corresponding response reported in chicken BAs. This physiological difference may explain the differences in lethality between ducks and chickens when vascular endothelial cells are infected with the virus.

Also flagged:pattern-recognition receptorscell surfacecytosolextracellulartype-I interferonIFN
Journal Article 2023-08-28 No Snippets Zhou J, Zhuang Z, Li J, Feng Z.
Show Full Abstract

The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway plays a significant role in health and disease. In this pathway, cGAS, one of the major cytosolic DNA sensors in mammalian cells, regulates innate immunity and the STING-dependent production of pro-inflammatory cytokines, including type-I interferon. Moreover, the cGAS-STING pathway is integral to other cellular processes, such as cell death, cell senescence, and autophagy. Activation of the cGAS-STING pathway by "self" DNA is also attributed to various infectious diseases and autoimmune or inflammatory conditions. In addition, the cGAS-STING pathway activation functions as a link between innate and adaptive immunity, leading to the inhibition or facilitation of tumorigenesis; therefore, research targeting this pathway can provide novel clues for clinical applications to treat infectious, inflammatory, and autoimmune diseases and even cancer. In this review, we focus on the cGAS-STING pathway and its corresponding cellular and molecular mechanisms in health and disease.

PRDX6
Also flagged:ferroptosiscancerslung adenocarcinomaLUADlung cancerslipid
Journal Article 2023-08-28 ✓ 5 Snippets Yang L, Fan X, Zhou C, Wang Z, Cui Z, Wu X, Xu Z, Yang J, Zhang X.
In-Text Gene Mentions

Additionally, peroxiredoxin-6 (PRDX6) and acyl-CoA synthetase long chain family member 3 (ACSL3) were upregulated in LUAD tissues.

ACSL3 and PRDX6 protein expressions were upregulated in LUADs compared to paired normal controls with WB and quantification analysis (Figure 6A,6B).

ACSL3, Acyl Coenzyme A Synthetase Long-Chain Family, Member 3; PRDX6, Peroxiredoxin 6; LUAD, lung adenocarcinoma; N, non-carcinoma samples; T, tumor samples; WB, western blot; IHC, immunohistochemistry.

The high expression of ACSL3 and PRDX6 associated with worse outcomes of LUAD (Figure S1A,S1B) may partially depend on its ferroptosis-related features.

To further verification of its role in the ferroptosis of lung cancer, we demonstrated the higher expression of ACSL3 and PRDX6 in paired LUAD tumors and non-cancer samples.

Show Full Abstract

<h4>Background</h4>Lung cancer has the highest prevalence and mortality of all cancers, and lung adenocarcinoma (LUAD) occupies the largest proportion of lung cancers. Herein, this study is aimed at constructing a ferroptosis-related prognostic signature for LUAD and conducting functional analysis based on the signature, highlighting the importance of ferroptosis in LUAD.<h4>Methods</h4>We employed RNA-sequencing (RNA-seq) and clinical data from The Cancer Genome Atlas (TCGA) database. Univariate Cox regression, Least Absolute Shrinkage and Selection Operator (LASSO) regression analysis were conducted to build the ferroptosis-related genes (FRGs) prognostic signature. The efficacy of this FRG signature was further analyzed with Kaplan-Meier (KM) plot, multivariate Cox regression, and the receiver operating characteristic (ROC) curves. Enrichment analysis was used to evaluate key pathways. The expression of immunomodulators, immune infiltration status, and drug sensitivity correlation were explored to predict the response to various therapies. The expression of FRGs was validated in LUAD samples with western blot (WB) and immunohistochemistry (IHC) staining. Cell viability assay and lipid peroxidation detection were measured after small interfering RNA (siRNA) knockdown of two FRGs in lung cancer cell lines.<h4>Results</h4>A seven-gene signature was constructed and used to divide LUAD patients into high- and low-risk groups. High-risk patients were notably related to shorter overall survival (OS), and multivariate Cox regression demonstrated that our signature was an independent predictor of OS. ROC curve analysis presented a maximum area under the curve (AUC) value of 0.740 for the experimental cohort and 0.705 for the validation cohort. The low-risk group showed higher levels of plasma cell infiltration and higher expression of programmed cell death protein 1 (<i>PDCD1</i>) and cytotoxic T-lymphocyte-associated protein 4 (<i>CTLA4</i>). Ferroptosis inducers such as talazoparib or cisplatin had lower IC50 values in the high-risk group, while navitoclax (BCL-2 gene family inhibition and apoptosis inducer) had higher IC50 values in the high-risk group. Additionally, peroxiredoxin-6 (PRDX6) and acyl-CoA synthetase long chain family member 3 (ACSL3) were upregulated in LUAD tissues. Lipid peroxide assay showed that silencing <i>PRDX6</i> or <i>ACSL3</i> promoted lipid peroxidation and ferroptosis in lung cancer cells.<h4>Conclusions</h4>Our novel ferroptosis-related signature shows potential clinical and functional importance in LUAD patients, and further research on ferroptosis as a therapeutic target in LUAD is warranted.

Also flagged:Psoriasischronic inflammatory skin diseasepsoriasis vulgarispathogenesisskingene expression
Journal Article 2023-08-28 No Snippets Madaan P, Sharma U, Tyagi N, Brar BK, Bansal S, Kushwaha HR, Kapoor HS, Jain A, Jain M.
Show Full Abstract

Psoriasis is a chronic inflammatory skin disease with keratinocyte hyperproliferation and T cells as key mediators of lesional and systemic inflammatory changes. To date, no suitable differential biomarkers are available for the disease diagnosis. More recently, microRNAs have been identified as critical regulators of lesional and systemic immune changes in psoriasis with diagnostic potential. We have performed expression profiling of T cell-specific miRNAs in 38 plasma samples from psoriasis vulgaris patients and an equal number of age- and gender-matched healthy subjects. Our findings have identified a panel of five blood-based circulatory miRNAs with a significant change in their expression levels, comprising miR-215, miR-148a, miR-125b-5p, miR-223, and miR-142-3p, which can differentiate psoriasis vulgaris patients from healthy individuals. The receiver operating characteristic (ROC) curves for all five miRNAs individually and in combination exhibited a significant disease discriminatory area under the curve with an AUC of 0.762 and a <i>p</i> < 0.0001 for all the miRNAs together. Statistically, all five miRNAs in combination depicted the best-fit model in relation to disease severity (PASI) compared with individual miRNAs, with the highest R<sup>2</sup> value of 0.94 and the lowest AIC score of 131.8. Each of the miRNAs also exhibited a significant association with at least one of the other miRNAs in the panel. Importantly, the five miRNAs in the panel regulate one or more immune-inflammation pathways based on target prediction, pathway network analysis, and validated roles in the literature. The miRNA panel provides a rationalized combination of biomarkers that can be tested further on an expanded cohort of patients for their diagnostic value.

TNFSF4
Also flagged:ferroptosisdeathcancerbladder cancerBLCAmethyladenosine
Journal Article 2023-08-28 ✓ 1 Snippet Li W, Xiong Y, Zhu J, Jin X, Meng J, He W.
In-Text Gene Mentions

…TMIGD2, NRP1, TNFSF15,TNFSF4, and LGALS9 in…

Show Full Abstract

<h4>Background</h4>Ferroptosis is a distinct form of cell death that has the potential to supersede the drug resistance that is commonly observed with current chemotherapeutic agents. As a result, ferroptosis presents a new and innovative therapeutic pathway for cancer treatment. The current understanding regarding the expression of genes associated with ferroptosis in bladder cancer (BLCA) and their prognostic implications remains unclear. Consequently, this study aimed to examine the potential prognostic value of ferroptosis-associated long non-coding RNAs (lncRNAs) in BLCA.<h4>Methods</h4>The Cancer Genome Atlas (TCGA) was accessed to download RNA sequencing data and clinicopathological features of BLCA while accessing the FerrDb database to download ferroptosis-associated genes. The study calculated risk scores for ferroptosis-associated lncRNAs, and subsequently divided patients with BLCA into two groups, namely high- and low-risk, on the basis of the median risk score. Moreover, Kaplan-Meier (K-M) curves, Cox regression analysis, and column plots were utilized for evaluating the risk score prognostic value. Subsequently, the involvement of ferroptosis-associated mRNA, N6-methyladenosine (m6A) mRNA status, and immune responses was investigated for BLCA prognosis.<h4>Results</h4>Thirty-six lncRNAs were identified to be differently expressed and linked to the prognosis of BLCA. The findings from the K-M curve analysis indicated a significant association between a high-risk lncRNA profile and poor BLCA prognosis. The area under curve (AUC) value of the receiver operating characteristic (ROC) curve was 0.810. The risk assessment model exhibited superior performance in predicting prognosis for BLCA compared to conventional clinicopathological features.<h4>Conclusions</h4>Thirty-six lncRNAs were found to be linked to ferroptosis for the prognosis of patients with BLCA, and these results may provide new insights for treating BLCA.

SOX6
Also flagged:Prostate cancerPCacancerSOX1SOX21SOX30
Journal Article 2023-08-28 ✓ 2 Snippets Li Z, Wang F.
In-Text Gene Mentions

A retrospective study suggested SOX6/12 as prognostic biomarkers for RCC (5).

…retrospective study suggestedSOX6/12 as prognostic biomarkers…

Show Full Abstract

<h4>Background</h4>Prostate cancer (PCa) remains a major prevalent cancer worldwide and has a poor prognosis. The sex-determining region Y (SRY)-related high-mobility group (HMG) box (SOX) family is a series of transcription factors (TFs) involved in regulating many biological processes (BPs). In tumors, however, SOX genes are frequently deregulated. Tumorigenic deregulation took place at the transcriptional, translational, and posttranslational levels. This leads them to be correlated to tumor progression and poor clinical outcomes in PCa. Nevertheless, the SOX family prognostic role in PCa still needs further investigation.<h4>Methods</h4>A SOX family-related prognostic signature was developed by performing LASSO (Least absolute shrinkage and selection operator) Cox regression analysis. The construction of a lncRNA-miRNA-mRNA regulatory axis for PCa was performed using a ceRNA network.<h4>Results</h4>Upregulation was observed in the expression of SOX4/8/11/12/14, while downregulation was observed for SOX2/5/7/13/15/30 in PCa. Consensus clustering identified four clusters of PCa patients based on these differentially expressed SOX family members. The constructed SOX family-related prognostic signature, which includes five SOX family members (SOX5/8/11/12/30), performed well in predicting PCa-patient prognosis. B cells, CD4+ T cells, CD8+ T cells, neutrophils, macrophages, and dendritic cell immune infiltration levels had a significant association with PCa-patient risk scores. Based on additional analysis, a significant association was also suggested between SOX family expression and tumor mutational burden (TMB), microsatellite instability (MSI), and drug sensitivity. By constructing a ceRNA network, a lncRNA SGMS1-AS1/miR-194-5p/SOX5 regulatory axis was developed for PCa.<h4>Conclusions</h4>Herein, a SOX family-related prognostic signature was identified and was found to perform well in predicting PCa-patient prognosis. A lncRNA SGMS1-AS1/miR-194-5p/SOX5 regulatory axis was also identified for PCa progression.

POU3F2
Also flagged:hemostasiscoagulationfibrinolysisTAFI55-kDa carboxypeptidase BCPB2
Journal Article 2023-08-28 ✓ 1 Snippet Rouka E, Zarogiannis SG, Hatzoglou C, Gourgoulianis KI, Malli F.
In-Text Gene Mentions

…Of note,POU3F2, a TF associated…

Show Full Abstract

Thrombin-Activatable Fibrinolysis Inhibitor (TAFI) is a carboxypeptidase B-like proenzyme encoded by the <i>CPB2</i> gene. After thrombin activation, TAFI downregulates fibrinolysis, thus linking the latter with coagulation. TAFI has been shown to play a role in venous and arterial thrombotic diseases, yet, data regarding the molecular mechanisms underlying its function have been conflicting. In this study, we focused on the prediction and functional enrichment analysis (FEA) of the TAFI interaction network and the microRNAs (miRNAs) targeting the members of this network in an attempt to identify novel components and pathways of TAFI-related thrombosis. To this end, we used nine bioinformatics software tools. We found that the TAFI interactome consists of 28 unique genes mainly involved in hemostasis. Twenty-four miRNAs were predicted to target these genes. Co-annotation analysis of the predicted interactors with respect to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and transcription factors (TFs) pointed to the complement and coagulation cascades as well as neutrophil extracellular trap formation. Cancer, stroke, and intracranial aneurysm were among the top 20 significant diseases related to the identified miRNAs. We reason that the predicted biomolecules should be further studied in the context of TAFI-related thrombosis.

Also flagged:aza-heterocyclesheterocyclicviral diseasesinfectionscardiovascular diseasesviral infections
Journal Article 2023-08-28 No Snippets Manna S, Das K, Santra S, Nosova EV, Zyryanov GV, Halder S.
Show Full Abstract

Antiviral properties of different oxa- and aza-heterocycles are identified and properly correlated with their structural features and discussed in this review article. The primary objective is to explore the activity of such ring systems as antiviral agents, as well as their synthetic routes and biological significance. Eventually, the <i>structure-activity relationship</i> (SAR) of the heterocyclic compounds, along with their salient characteristics are exhibited to build a suitable platform for medicinal chemists and biotechnologists. The synergistic conclusions are extremely important for the introduction of a newer tool for the future drug discovery program.

HFE
Also flagged:COVID-19cirrhosisacute kidney injuryencephalopathyhepatorenal syndromeHRS
Journal Article 2023-08-28 ✓ 1 Snippet Hindosh Z, Potharaju A.
In-Text Gene Mentions

…studies ruled outhemochromatosis, with normal ferritin…

Show Full Abstract

A 66-year-old Caucasian female with a recent history of COVID-19 (about one month prior to the current admission) and cirrhosis, presented with acute kidney injury (AKI) and worsening encephalopathy. Initial management focused on addressing her AKI, initially suspected to be secondary to volume depletion or hepatorenal syndrome (HRS) and confusion from hepatic encephalopathy. However, further evaluation unveiled a persistent serum protein gap, hypercalcemia, and significant non-albumin proteinuria, prompting a more comprehensive diagnostic approach. Subsequent investigations revealed a high serum free light chain ratio, positive serum protein electrophoresis, and monoclonal gammopathy, indicative of a plasma cell disorder. A bone survey did not indicate aggressive bone lesions, but a bone marrow biopsy confirmed multiple myeloma with approximately 10% kappa light chain-restricted plasma cells. Despite appropriate treatment, the patient's health continued to decline, and the patient was subsequently transitioned to comfort care. While the relationship between cirrhosis and multiple myeloma remains to be fully understood, our case report explores four potential explanations: coincidental coexistence, cirrhosis as a risk factor for multiple myeloma, multiple myeloma as a risk factor for cirrhosis, or a shared predisposing condition.

TNFSF4
Also flagged:Protein Arginine MethyltransferasesClear Cell Renal Cell CarcinomaTumorccRCCurological cancerpost-translational modification
Journal Article 2023-08-28 ✓ 1 Snippet Ye S, Tian X, Anwaier A, Wei S, Liu W, Su J, Zhu S, Dai B, Gu J, Qu Y, Xu W, Zhang H, Ye D.
In-Text Gene Mentions

…CD40, CD44, PDCD1LG2,TNFSF4, NRP1, TNFRSF18, HAVCR2,…

Show Full Abstract

<b>Background:</b> Clear cell renal cell carcinoma (ccRCC) is an aggressive urological cancer that originates from the proximal tubular epithelium. As one of the most common post-translational modification, protein arginine methylation plays a pivotal role in various cancer-associated biological functions, especially in cancer immunity. Therefore, constructing a protein arginine methylation-related prognostic signature would be beneficial in guiding better personalized clinical management for patients with ccRCC. <b>Methods:</b> Based on the multi-omics profiling of the expression levels of eight protein arginine methyltransferases (PRMTs) in 763 ccRCC samples (from TCGA, CPTAC, EMBL, and ICGC databases), we established a scoring system with machine-learning algorithms to quantify the modification patterns on clinical and immunological characterizations of individual ccRCC patient, which was termed as PRMTScore. Moreover, we utilized two external clinical cohorts receiving immunotherapy (n=302) to validate the reliability of the PRMTScore system. Multiplex immunohistochemistry (mIHC) was performed to characterize the cellular composition of 30 paired ccRCC samples. The proteomic profiling of 232 ccRCC samples obtained from Fudan University Shanghai Cancer Center (FUSCC) was analyzed to validate the protein expression of PRMT5 in ccRCC. Finally, CCK-8, transwell, and wound healing assays were conducted to elucidate the role of PRMT5 in ccRCC in vitro. <b>Results:</b> A total of 763 ccRCC patients with available multi-omics profiling were stratified into two clusters (PRMTCluster A and B) with distinctive prognosis, genomic alterations, tumor microenvironment (TME) characteristics, and fundamental biological mechanisms. Subsequently, protein arginine methylation-related prognostic signature (PRMTScore) was constructed and consisted of <i>SLC16A12, HRH2, F2RL3,</i> and <i>SAA1</i>. The PRMTScore showed remarkable differences in outcomes, immune and stromal fractions, expressions of immune checkpoints, the abundance of immune cells, and immunotherapy response in ccRCC patients. Additionally, preliminary insights unveiled the tumor-suppressive role of PRMT5 in ccRCC, and the signal of PRMT5<sup>low</sup> significantly predicted aggressive prognosis and the high abundance of PD1<sup>+</sup> CD8<sup>+</sup> cells in ccRCC. <b>Conclusion:</b> We constructed a PRMTScore system, which showed the potent ability to assess the prognosis, TME characteristics, and immunotherapy response for patients with ccRCC. Moreover, this is the first study to propose that PRMT5 acts as a cancer suppressor in ccRCC.

DARS2
Also flagged:Replicationbiosynthesiscell physiologycell-cycleDnaAgene expression
Journal Article 2023-08-28 ✓ 1 Snippet Fu H, Xiao F, Jun S.
In-Text Gene Mentions

…of DARS1 andDARS2(types of D…

Show Full Abstract

Balanced biosynthesis is the hallmark of bacterial cell physiology, where the concentrations of stable proteins remain steady. However, this poses a conceptual challenge to modeling the cell-cycle and cell-size controls in bacteria, as prevailing concentration-based eukaryote models are not directly applicable. In this study, we revisit and significantly extend the initiator-titration model, proposed 30 years ago, and we explain how bacteria precisely and robustly control replication initiation based on the mechanism of protein copy-number sensing. Using a mean-field approach, we first derive an analytical expression of the cell size at initiation based on three biological mechanistic control parameters for an extended initiator-titration model. We also study the stability of our model analytically and show that initiation can become unstable in multifork replication conditions. Using simulations, we further show that the presence of the conversion between active and inactive initiator protein forms significantly represses initiation instability. Importantly, the two-step Poisson process set by the initiator titration step results in significantly improved initiation synchrony with CV~1/N scaling rather than the standard 1/N scaling in the Poisson process, where N is the total number of initiators required for initiation. Our results answer two long-standing questions in replication initiation: (i) Why do bacteria produce almost two orders of magnitude more DnaA, the master initiator proteins, than required for initiation? (ii) Why does DnaA exist in active (DnaA-ATP) and inactive (DnaA-ADP) forms if only the active form is competent for initiation? The mechanism presented in this work provides a satisfying general solution to how the cell can achieve precision control without sensing protein concentrations, with broad implications from evolution to the design of synthetic cells.

SOX6
Also flagged:SRCRAPGEF1keratinocyte proliferationSkp2Msi2mitosis
Journal Article 2023-08-27 ✓ 2 Snippets Golebiewski C, Gastaldi C, Vieu DL, Mari B, Rezzonico R, Bernerd F, Marionnet C.
In-Text Gene Mentions

Several other direct targets of miR-203 were identified in modified or pathological skin contexts, in which miR-203 expression is altered, with for example RAN and RAPH1 in wound healing18, SOCS3, IL 8, SOX6, TNF and IL24 in the context of inflammation and psoriasis8, 19, 20, as well as c-jun and c-myc in basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) respectively21, 22.

…SOCS3, IL 8,SOX6, TNF and IL24…

Show Full Abstract

The epidermis is mostly composed of keratinocytes and forms a protecting barrier against external aggressions and dehydration. Epidermal homeostasis is maintained by a fine-tuned balance between keratinocyte proliferation and differentiation. In the regulation of this process, the keratinocyte-specific miR-203 microRNA is of the outmost importance as it promotes differentiation, notably by directly targeting and down-regulating mRNA expression of genes involved in keratinocyte proliferation, such as ΔNp63, Skp2 and Msi2. We aimed at identifying new miR-203 targets involved in the regulation of keratinocyte proliferation/differentiation balance. To this end, a transcriptome analysis of human primary keratinocytes overexpressing miR-203 was performed and revealed that miR-203 overexpression inhibited functions like proliferation, mitosis and cell cycling, and activated differentiation, apoptosis and cell death. Among the down-regulated genes, 24 putative target mRNAs were identified and 8 of them were related to proliferation. We demonstrated that SRC and RAPGEF1 were direct targets of miR-203. Moreover, both were down-regulated during epidermal morphogenesis in a 3D reconstructed skin model, while miR-203 was up-regulated. Finally silencing experiments showed that SRC or RAPGEF1 contributed to keratinocyte proliferation and regulated their differentiation. Preliminary results suggest their involvement in skin carcinoma hyperproliferation. Altogether this data indicates that RAPGEF1 and SRC could be new mediators of miR-203 in epidermal homeostasis regulation.

HFE
Also flagged:Loeys-Dietz-Syndromebeta thalassemia minorsinus valsalva aneurysmaortic regurgitationaneurysmaneurysms
Journal Article 2023-08-27 ✓ 1 Snippet Kainz FM, Freystaetter K, Podesser BK, Holzinger C.
In-Text Gene Mentions

…can lead tohemochromatosis, accompanied by cardiomyopath…

Show Full Abstract

We report the case of a 36-year-old European female patient presenting with a sinus valsalva aneurysm of 47 mm with moderate aortic regurgitation. Additionally, an aneurysm of the brachiocephalic trunk and multiple aneurysms of the right internal mammary artery were identified. Previous medical history included Loeys-Dietz syndrome (LDS) Type RII due to a TGF-beta receptor mutation, and beta thalassemia minor with a baseline hemoglobin of 9,3 g/dL on admission.Reconstruction of the aortic root and hemiarch replacement was performed in circulatory arrest under moderate hypothermia. During surgery, hypothermia was required as part of the cerebral protection strategy. We aim to highlight special considerations and discuss the effects of cooling, rewarming and the use of cardiopulmonary bypass (CPB) during extensive surgery in a patient with LDS and beta thalassemia minor.

Also flagged:nanomaterialsfracture healingdegradationtumorsinfectious diseasesinfection
Journal Article 2023-08-27 No Snippets Zhang M, Xu F, Cao J, Dou Q, Wang J, Wang J, Yang L, Chen W.
Show Full Abstract

The bone fracture cases have been increasing yearly, accompanied by the increased number of patients experiencing non-union or delayed union after their bone fracture. Although clinical materials facilitate fracture healing (e.g., metallic and composite materials), they cannot fulfill the requirements due to the slow degradation rate, limited osteogenic activity, inadequate osseointegration ability, and suboptimal mechanical properties. Since early 2000, nanomaterials successfully mimic the nanoscale features of bones and offer unique properties, receiving extensive attention. This paper reviews the achievements of nanomaterials in treating bone fracture (e.g., the intrinsic properties of nanomaterials, nanomaterials for bone defect filling, and nanoscale drug delivery systems in treating fracture delayed union). Furthermore, we discuss the perspectives on the challenges and future directions of developing nanomaterials to accelerate fracture healing.

Also flagged:Parylenebiofilm formationParylene CsiliconoxideEncrustation
Journal Article 2023-08-27 No Snippets Buchwalder S, Hersberger M, Rebl H, Seemann S, Kram W, Hogg A, Tvedt LGW, Clausen I, Burger J.
Show Full Abstract

Recent developments in urological implants have focused on preventive strategies to mitigate encrustation and biofilm formation. Parylene, a conformal, pinhole-free polymer coating, has gained attention due to its high biocompatibility and chemical resistance, excellent barrier properties, and low friction coefficient. This study aims to evaluate the effectiveness of parylene C in comparison to a parylene VT4 grade coating in preventing encrustation on a urinary bladder pressure MEMS sensor system. Additionally, silicon oxide (SiO<sub>x</sub>) applied as a finish coating was investigated for further improvements. An in vitro encrustation system mimicking natural urine flow was used to quantify the formation of urinary stones. These stones were subsequently analyzed using Fourier transform infrared spectrometry (FTIR). Encrustation results were then discussed in relation to coating surface chemical properties. Parylene C and VT4 grades demonstrated a very low encrustation mass, making them attractive options for encrustation prevention. The best performance was achieved after the addition of a hydrophilic SiO<sub>x</sub> finish coating on parylene VT4 grade. Parylene-based encapsulation proved to be an outstanding solution to prevent encrustation for urological implants.

bioRxiv 2023-08-27 Preprint (No Snippets API) Chan DKH, Mandal A, Zhou Y, Collins SD, Owen R, Bundred J, Fuchs H, James S, Vendrell I, Flannery S, Fawkner-Corbett D, Househam J, Graham TA, Fischer R, Simmons A, Lu X, Buczacki SJA.
Show Full Abstract

Somatic driver mutations, in genes such as FBXW7, have been discovered in phenotypically normal colonic tissue, however their role in cancer initiation remains elusive. Using normal and gene-edited patient-derived human colon organoids as models of early tumour evolution we observed that FBXW7-/- mutations exerted an epistatic effect on subsequent transcription depending on the mutational background of the cell. Specifically, the timing of acquiring an FBXW7-/- mutation respective to an APC mutation, led to profound phenotypic and transcriptomic differences. When FBXW7 was mutated before APC, a near-normal cell state was maintained alongside repression of the APC transcriptional response. However, when APC was mutated before FBXW7, cells acquired classical cancer-stem cell features. Single-cell RNA sequencing revealed that mutation of FBXW7 in normal tissue subtly switched cells from adult to a foetal/regenerative stem cell state. Further analysis using transposase-accessible chromatin sequencing identified this cellular plasticity was driven by changes in chromatin accessibility of transcriptional start site regions associated with TEAD, SNAI1 and AP-1 motifs, which in turn activate the foetal-like state. Taken together, we demonstrate a critical role of FBXW7 mutations in preventing colorectal cancer initiation and provide exemplar evidence for the importance of epistasis and mutational order in cancer biology.

DARS2
Also flagged:LUADcell proliferationtumorSLC2A1lung adenocarcinomaGPI
Journal Article 2023-08-26 ✓ 5 Snippets Liu XS, Yuan LL, Gao Y, Ming X, Zhang YH, Zhang Y, Liu ZY, Yang Y, Pei ZJ.
In-Text Gene Mentions

The Matrigel invasion assay revealed that the suppression of DARS2 expression significantly inhibited the invasive capability of LUAD cells (Fig. 4C, D).

We further analyzed the clinical sample information of TCGA LUAD dataset, and studied the relationship between the expression of DARS2 and pathological stage and patient prognosis.

By comparing PET metabolic parameter values and DARS2 IHC scores of LUAD patients, we found that high and low DARS2 IHC scores were statistically different from high and low SUVmax (p < 0.001), SUVmean (p = 0.005) and TLG (p = 0.025), but not from high and low MTV (p = 1) (Table 2).

In this study, we found through GSEA that changes in DARS2 in the LUAD patient dataset resulted in a significant enrichment of glycolysis pathways in tumor cells.

DARS2 has recently aroused the interest of researchers and has been found to be up-regulated in HCC [16], BLCA [13–15] and high-grade serous ovarian cancer [34].

Show Full Abstract

<h4>Background</h4>This study investigated the correlation between the expression of DARS2 and metabolic parameters of <sup>18</sup>F-FDG PET/CT, and explored the potential mechanisms of DARS2 affecting the proliferation and glycolysis of lung adenocarcinoma (LUAD) cells.<h4>Methods</h4>This study used genomics and proteomics to analyze the difference in DARS2 expression between LUAD samples and control samples. An analysis of 62 patients with LUAD who underwent <sup>18</sup>F-FDG PET/CT examinations before surgery was conducted retrospectively. The correlation between DARS2 expression and PET/CT metabolic parameters, including SUVmax, SUVmean, MTV, and TLG, was examined by Spearman correlation analysis. In addition, the molecular mechanism of interfering with DARS2 expression in inhibiting LUAD cell proliferation and glycolysis was analyzed through in vitro cell experiments.<h4>Results</h4>DARS2 expression was significantly higher in LUAD samples than in control samples (p < 0.001). DARS2 has high specificity (98.4%) and sensitivity (95.2%) in the diagnosis of LUAD. DARS2 expression was positively correlated with SUVmax, SUVmean, and TLG (p < 0.001). At the same time, the sensitivity and specificity of SUVmax in predicting DARS2 overexpression in LUAD were 88.9% and 65.9%, respectively. In vitro cell experiments have shown that interfering with DARS2 expression can inhibit the proliferation and migration of LUAD cells, promote cell apoptosis, and inhibit the glycolytic activity of tumor cells by inhibiting the expression of glycolytic related genes SLC2A1, GPI, ALDOA, and PGAM1.<h4>Conclusions</h4>Overexpression of DARS2 is associated with metabolic parameters on <sup>18</sup>F-FDG PET/CT, which can improve LUAD diagnosis accuracy. DARS2 may be a useful biomarker to diagnose, prognosis, and target treatment of LUAD patients.

Also flagged:malignant tumorsesophageal adenocarcinomatumorimmune dysfunctioncancertumors
Journal Article 2023-08-26 No Snippets Yang C, Cao F, He Y.
Show Full Abstract

BACKGROUND Immune checkpoint inhibitor (ICI) therapy has attracted wide attention in the treatment of malignant tumors. This study was designed to build a prognostic model based on immune-related genes for esophageal adenocarcinoma (EAC). MATERIAL AND METHODS The expression of immune-related differentially-expressed genes (IRDEGs) between EAC and normal samples from The Cancer Genome Atlas database was analyzed. Univariate and multivariate Cox regressions were used to identify the prognostic IRDEGs and construct an immune-related gene signature (IRGS) to predict the overall survival (OS) of EAC patients. Then, the molecular mechanisms and immune characteristics were comprehensively analyzed. RESULTS A total of 111 IRDEGs were obtained from the weighted gene co-expression network analysis. Univariate Cox regression analysis showed that 12 IRDEGs (P<0.05 for all) were linked with OS in the EAC patients. Four genes were used to construct the IRGS based on the multivariate Cox regression analysis. Patients in the high-risk group showed worse OS than those in the low-risk group (P<0.001). A high-risk score was related to DNA replication relevant pathways, an increase in mutation rate, and an increase in activated mast cell infiltration. Patients with high-risk scores had lower tumor immune dysfunction and exclusion scores (P<0.001). CONCLUSIONS IRDEGs may be involved in the progression of EAC. The high-risk group is more suitable for immunotherapy, which may provide a reference value for the treatment of clinical EAC patients. Therefore, it is possible to identify the patients who are better suited for ICI therapy.

TNFSF4
Also flagged:tumorpancreatic ductal adenocarcinomaPDACpancreatic cancertumourcancer
Journal Article 2023-08-26 ✓ 1 Snippet Oh K, Yoo YJ, Torre-Healy LA, Rao M, Fassler D, Wang P, Caponegro M, Gao M, Kim J, Sasson A, Georgakis G, Powers S, Moffitt RA.
In-Text Gene Mentions

…(PDL2) 51 andTNFSF4(OX40L) 52 were…

Show Full Abstract

Bulk analyses of pancreatic ductal adenocarcinoma (PDAC) samples are complicated by the tumor microenvironment (TME), i.e. signals from fibroblasts, endocrine, exocrine, and immune cells. Despite this, we and others have established tumor and stroma subtypes with prognostic significance. However, understanding of underlying signals driving distinct immune and stromal landscapes is still incomplete. Here we integrate 92 single cell RNA-seq samples from seven independent studies to build a reproducible PDAC atlas with a focus on tumor-TME interdependence. Patients with activated stroma are synonymous with higher myofibroblastic and immunogenic fibroblasts, and furthermore show increased M2-like macrophages and regulatory T-cells. Contrastingly, patients with 'normal' stroma show M1-like recruitment, elevated effector and exhausted T-cells. To aid interoperability of future studies, we provide a pretrained cell type classifier and an atlas of subtype-based signaling factors that we also validate in mouse data. Ultimately, this work leverages the heterogeneity among single-cell studies to create a comprehensive view of the orchestra of signaling interactions governing PDAC.

DCC
Also flagged:Netrin-1tumorcancerandovary cancersantibody
Journal Article 2023-08-26 ✓ 1 Snippet Ducarouge B, Redavid AR, Victoor C, Chira R, Fonseca A, Hervieu M, Bergé R, Lengrand J, Vieugué P, Neves D, Goddard I, Richaud M, Laval PA, Rama N, Goldschneider D, Paradisi A, Gourdin N, Chabaud S, Treilleux I, Gadot N, Ray-Coquard I, Depil S, Decaudin D, Némati F, Marangoni E, Mery-Lamarche E, Génestie C, Tabone-Eglinger S, Devouassoux-Shisheboran M, Moore KJ, Gibert B, Mehlen P, Bernet A.
In-Text Gene Mentions

DCC

Show Full Abstract

Drug resistance and cancer relapse represent significant therapeutic challenges after chemotherapy or immunotherapy, and a major limiting factor for long-term cancer survival. Netrin-1 was initially identified as a neuronal navigation cue but has more recently emerged as an interesting target for cancer therapy, which is currently clinically investigated. We show here that netrin-1 is an independent prognostic marker for clinical progression of breast and ovary cancers. Cancer stem cells (CSCs)/Tumor initiating cells (TICs) are hypothesized to be involved in clinical progression, tumor relapse and resistance. We found a significant correlation between netrin-1 expression and cancer stem cell (CSC) markers levels. We also show in different mice models of resistance to chemotherapies that netrin-1 interference using a therapeutic netrin-1 blocking antibody alleviates resistance to chemotherapy and triggers an efficient delay in tumor relapse and this effect is associated with CSCs loss. We also demonstrate that netrin-1 interference limits tumor resistance to immune checkpoint inhibitor and provide evidence linking this enhanced anti-tumor efficacy to a decreased recruitment of a subtype of myeloid-derived suppressor cells (MDSCs) called polymorphonuclear (PMN)-MDSCs. We have functionally demonstrated that these immune cells promote CSCs features and, consequently, resistance to anti-cancer treatments. Together, these data support the view of both a direct and indirect contribution of netrin-1 to cancer stemness and we propose that this may lead to therapeutic opportunities by combining conventional chemotherapies and immunotherapies with netrin-1 interfering drugs.

Also flagged:Tst2TRPV1peptidedisulfidepeptidesion channels
Journal Article 2023-08-26 No Snippets Elnahriry KA, Wai DCC, Ashwood LM, Naseem MU, Szanto TG, Guo S, Panyi G, Prentis PJ, Norton RS.
Show Full Abstract

Sea anemone venoms are complex mixtures of biologically active compounds, including disulfide-rich peptides, some of which have found applications as research tools, and others as therapeutic leads. Our recent transcriptomic and proteomic studies of the Australian sea anemone Telmatactis stephensoni identified a transcript for a peptide designated Tst2. Tst2 is a 38-residue peptide showing sequence similarity to peptide toxins known to interact with a range of ion channels (Na<sub>V</sub>, TRPV1, K<sub>V</sub> and Ca<sub>V</sub>). Recombinant Tst2 (rTst2, which contains an additional Gly at the N-terminus) was produced by periplasmic expression in Escherichia coli, enabling the production of both unlabelled and uniformly <sup>13</sup>C,<sup>15</sup>N-labelled peptide for functional assays and structural studies. The LC-MS profile of the recombinant Tst2 showed a pure peak with molecular mass 6 Da less than that of the reduced form of the peptide, indicating the successful formation of three disulfide bonds from its six cysteine residues. The solution structure of rTst2 was determined using multidimensional NMR spectroscopy and revealed that rTst2 adopts an inhibitor cystine knot (ICK) structure. rTst2 was screened using various functional assays, including patch-clamp electrophysiological and cytotoxicity assays. rTst2 was inactive against voltage-gated sodium channels (Na<sub>V</sub>) and the human voltage-gated proton (hHv1) channel. rTst2 also did not possess cytotoxic activity when assessed against Drosophila melanogaster flies. However, the recombinant peptide at 100 nM showed >50% inhibition of the transient receptor potential subfamily V member 1 (TRPV1) and slight (∼10%) inhibition of transient receptor potential subfamily A member 1 (TRPA1). Tst2 is thus a novel ICK inhibitor of the TRPV1 channel.

SOX6
Also flagged:Myocardial InfarctionMIdeathheart failureangiogenesiscardiovascular diseases
Journal Article 2023-08-26 ✓ 1 Snippet Salvatori F, D'Aversa E, Serino ML, Singh AV, Secchiero P, Zauli G, Tisato V, Gemmati D.
In-Text Gene Mentions

…the expression ofSOX6, activating accordingly the…

Show Full Abstract

Myocardial infarction (MI) is one of the leading causes of death in Western countries. An early diagnosis decreases subsequent severe complications such as wall remodeling or heart failure and improves treatments and interventions. Novel therapeutic targets have been recognized and, together with the development of direct and indirect epidrugs, the role of non-coding RNAs (ncRNAs) yields great expectancy. ncRNAs are a group of RNAs not translated into a product and, among them, microRNAs (miRNAs) are the most investigated subgroup since they are involved in several pathological processes related to MI and post-MI phases such as inflammation, apoptosis, angiogenesis, and fibrosis. These processes and pathways are finely tuned by miRNAs via complex mechanisms. We are at the beginning of the investigation and the main paths are still underexplored. In this review, we provide a comprehensive discussion of the recent findings on epigenetic changes involved in the first phases after MI as well as on the role of the several miRNAs. We focused on miRNAs function and on their relationship with key molecules and cells involved in healing processes after an ischemic accident, while also giving insight into the discrepancy between males and females in the prognosis of cardiovascular diseases.

HTT
Also flagged:Brain-Derived 11S RegulatorHydrolysispolyglutamineneurodegenerative disordersproteolysisproteasome
Journal Article 2023-08-26 ✓ 1 Snippet Kriachkov VA, Gotmanova NN, Tashlitsky VN, Bacheva AV.
In-Text Gene Mentions

…Thus, ubiquitinatedHttcan be recognized…

Show Full Abstract

Proteins with extended polyglutamine regions are associated with several neurodegenerative disorders, including Huntington's disease. Intracellular proteolytic processing of these proteins is not well understood. In particular, it is unclear whether long polyglutamine fragments resulting from the proteolysis of these proteins can be potentially cleaved by the proteasome. Here, we studied the susceptibility of the glutamine-glutamine bond to proteolysis by the proteasome using oligoglutamine-containing peptides with a fluorophore/quencher pair. We found that the addition of the 11S proteasomal regulator (also known as PA28) significantly accelerated the hydrolysis of oligoglutamine-containing peptides by the 20S proteasome. Unexpectedly, a similar effect was observed for the 26S proteasome in the presence of the 11S regulator. LC/MS data revealed that the hydrolysis of our peptides with both 20S and 26S proteasomes leads to N-terminal fragments containing two or three glutamine residues and that the hydrolysis site does not change after the addition of the 11S regulator. This was confirmed by the docking experiment, which shows that the preferred hydrolysis site is located after the second/third glutamine residue. Inhibitory analysis revealed that trypsin-like specificity is mainly responsible for the proteasomal hydrolysis of the glutamine-glutamine bond. Together, our results indicate that both 20S and 26S proteasomes are capable of degrading the N-terminal part of oligoglutamine fragments, while the 11S regulator significantly accelerates the hydrolysis without changing its specificity. This data suggests that proteasome activity may be enhanced in relation to polyglutamine substrates present in neurons in the early stages of polyglutamine disorders.

Also flagged:Methylationhistoneshistonesynthesisgene expressionaging
Journal Article 2023-08-25 No Snippets Liu R, Zhao E, Yu H, Yuan C, Abbas MN, Cui H.
Show Full Abstract

The proper transfer of genetic information from DNA to RNA to protein is essential for cell-fate control, development, and health. Methylation of DNA, RNAs, histones, and non-histone proteins is a reversible post-synthesis modification that finetunes gene expression and function in diverse physiological processes. Aberrant methylation caused by genetic mutations or environmental stimuli promotes various diseases and accelerates aging, necessitating the development of therapies to correct the disease-driver methylation imbalance. In this Review, we summarize the operating system of methylation across the central dogma, which includes writers, erasers, readers, and reader-independent outputs. We then discuss how dysregulation of the system contributes to neurological disorders, cancer, and aging. Current small-molecule compounds that target the modifiers show modest success in certain cancers. The methylome-wide action and lack of specificity lead to undesirable biological effects and cytotoxicity, limiting their therapeutic application, especially for diseases with a monogenic cause or different directions of methylation changes. Emerging tools capable of site-specific methylation manipulation hold great promise to solve this dilemma. With the refinement of delivery vehicles, these new tools are well positioned to advance the basic research and clinical translation of the methylation field.

PEBP1
Also flagged:MembranephospholipidParkinson's diseaseneurodegenerative disorderpsychological stressPD
Journal Article 2023-08-25 ✓ 5 Snippets Lin XM, Pan MH, Sun J, Wang M, Huang ZH, Wang G, Wang R, Gong HB, Huang RT, Huang F, Sun WY, Liu HZ, Kurihara H, Li YF, Duan WJ, He RR.
In-Text Gene Mentions

Collectively, the mechanism of stress that contributes to the susceptibility to PD is identified by triggering the release of the stress hormone CORT, which facilitates the interaction between ALOX15 and PEBP1 and causes lipid peroxidation in the plasma membrane, resulting in susceptibility to ferroptosis of the dopamine neurons.

Leonurine attenuates phospholipid peroxidation by preventing the assembly of the ALOX15/PEBP1 complex, thereby alleviating chronic stress‐induced Parkinson's disease susceptibility.

Synergistically, blocking the assembly of the ALOX15/PEBP1 complex through leonurine attenuates phospholipid peroxidation, thereby reducing chronic stress‐induced susceptibility to Parkinson's disease.

Also, this finding was supported by the observation that CORT dose‐dependently increased PEBP1 and ERK phosphorylation, a phenomenon which was readily reversed by the PKC inhibitor staurosporine (STS) (Figure 3f,g).

…of inhibiting the ALOX15/PEBP1interaction and thereby…

Show Full Abstract

Parkinson's disease (PD) is a neurodegenerative disorder associated with α-synuclein aggregation and dopaminergic neuron loss in the midbrain. There is evidence that psychological stress promotes PD progression by enhancing glucocorticoids-related oxidative damage, however, the mechanisms involved are unknown. The present study demonstrated that plasma membrane phospholipid peroxides, as determined by phospholipidomics, triggered ferroptosis in dopaminergic neurons, which in turn contributed to stress exacerbated PD-like motor disorder in mice overexpressing mutant human α-synuclein. Using hormonomics, we identified that stress stimulated corticosteroid release and promoted 15-lipoxygenase-1 (ALOX15)-mediated phospholipid peroxidation. ALOX15 was upregulated by α-synuclein overexpression and acted as a fundamental risk factor in the development of chronic stress-induced parkinsonism and neurodegeneration. Further, we demonstrated the mechanism by which corticosteroids activated the PKC pathway and induced phosphatidylethanolamine-binding protein-1 (PEBP1) to form a complex with ALOX15, thereby facilitating ALOX15 to locate on the plasma membrane phospholipids. A natural product isolated from herbs, leonurine, was screened with activities of inhibiting the ALOX15/PEBP1 interaction and thereby attenuating membrane phospholipid peroxidation. Collectively, our findings demonstrate that stress increases the susceptibility of PD by driving membrane lipid peroxidation of dopaminergic neurons and suggest the ALOX15/PEBP1 complex as a potential intervention target.

Also flagged:nuclear exportimport receptorscancerliquid tumoursKaryopherinsoluble
Journal Article 2023-08-25 No Snippets Newell S, van der Watt PJ, Leaner VD.
Show Full Abstract

Systemic modalities are crucial in the management of disseminated malignancies and liquid tumours. However, patient responses and tolerability to treatment are generally poor and those that enter remission often return with refractory disease. Combination therapies provide a methodology to overcome chemoresistance mechanisms and address dose-limiting toxicities. A deeper understanding of tumorigenic processes at the molecular level has brought a targeted therapy approach to the forefront of cancer research, and novel cancer biomarkers are being identified at a rapid rate, with some showing potential therapeutic benefits. The Karyopherin superfamily of proteins is soluble receptors that mediate nucleocytoplasmic shuttling of proteins and RNAs, and recently, nuclear transport receptors have been recognized as novel anticancer targets. Inhibitors against nuclear export have been approved for clinical use against certain cancer types, whereas inhibitors against nuclear import are in preclinical stages of investigation. Mechanistically, targeting nucleocytoplasmic shuttling has shown to abrogate oncogenic signalling and restore tumour suppressor functions through nuclear sequestration of relevant proteins and mRNAs. Hence, nuclear transport inhibitors display broad spectrum anticancer activity and harbour potential to engage in synergistic interactions with a wide array of cytotoxic agents and other targeted agents. This review is focussed on the most researched nuclear transport receptors in the context of cancer, XPO1 and KPNB1, and highlights how inhibitors targeting these receptors can enhance the therapeutic efficacy of standard of care therapies and novel targeted agents in a combination therapy approach. Furthermore, an updated review on the therapeutic targeting of lesser characterized karyopherin proteins is provided and resistance to clinically approved nuclear export inhibitors is discussed.

TNFSF4
Also flagged:Senescence-associatedprostate cancercancer-associatedPCaSASP
Journal Article 2023-08-25 ✓ 1 Snippet Feng D, Wang J, Li D, Wu R, Wei W, Zhang C.
In-Text Gene Mentions

…TNFRSF9, TNFSF14, CD200R1,TNFSF4, CD276 and CD47…

Show Full Abstract

<h4>Background</h4>Cellular senescence is growing in popularity in cancer. A dual function is played by the senescence-associated secretory phenotype (SASP) that senescent cells produce in the development of pro-inflammatory niches, tissue regeneration or destruction, senescence propagation, and malignant transformation. In this study, we conducted thorough bioinformatic analysis and meta-analysis to discover detrimental and beneficial subtypes and prognostic index for prostate cancer (PCa) patients using the experimentally confirmed SASP genes.<h4>Methods</h4>We identified differentially expressed and prognosis-related SASP genes and used them to construct two molecular subtypes and risk score. Another two external cohorts were used to confirm the prognostic effect of the above subtypes and risk score and meta-analysis was further conducted. Additionally, functional analysis, tumor stemness and heterogeneity and tumor microenvironment were also evaluated. We completed analyses using software R 3.6.3 and its suitable packages. Meta-analysis was performed by software Stata 14.0.<h4>Results</h4>Through multivariate Cox regression analysis and consensus clustering analysis, we used VGF, IGFBP3 and ANG to establish detrimental and beneficial subtypes in the TCGA cohort, which was validated through other two independent cohorts. Meta-analysis showed that detrimental SASP group had significantly higher risk of biochemical recurrence (BCR) than beneficial SASP group (HR: 2.48). Moreover, we also constructed and validated risk score based on these genes to better guide clinical practice. DNA repair, MYC target, oxidative phosphorylation, proteasome and ribosome were highly enriched in detrimental SASP group. Detrimental SASP group had significantly higher levels of B cells, CD8+ T cells, homologous recombination deficiency, loss of heterozygosity, microsatellite instability, purity, tumor mutation burden, mRNAsi, differentially methylated probes and epigenetically regulated RNA expression than beneficial SASP group. The top mutation genes between detrimental and beneficial SASP groups were SPOP, FOXA1, KMT2C, APC, BSN, DNAH17, MYH6, EPPK1, ZNF536 and ZC3H13 with statistical significance.<h4>Conclusions</h4>From perspective of SASP, we found detrimental and beneficial tumor subtypes which were closely associated with BCR-free survival for PCa patients, which might be important for the furture research in the field of PCa.

Also flagged:Chronic kidney diseasebone disordercalciumparathyroid hormonevitamin Dmineralization
Journal Article 2023-08-25 No Snippets Lalayiannis AD, Soeiro EMD, Moysés RMA, Shroff R.
Show Full Abstract

Chronic kidney disease (CKD) mineral and bone disorder (MBD) comprises a triad of biochemical abnormalities (of calcium, phosphate, parathyroid hormone and vitamin D), bone abnormalities (turnover, mineralization and growth) and extra-skeletal calcification. Mineral dysregulation leads to bone demineralization causing bone pain and an increased fracture risk compared to healthy peers. Vascular calcification, with hydroxyapatite deposition in the vessel wall, is a part of the CKD-MBD spectrum and, in turn, leads to vascular stiffness, left ventricular hypertrophy and a very high cardiovascular mortality risk. While the growing bone requires calcium, excess calcium can deposit in the vessels, such that the intake of calcium, calcium- containing medications and high calcium dialysate need to be carefully regulated. Normal physiological bone mineralization continues into the third decade of life, many years beyond the rapid growth in childhood and adolescence, implying that skeletal calcium requirements are much higher in younger people compared to the elderly. Much of the research into the link between bone (de)mineralization and vascular calcification in CKD has been performed in older adults and these data must not be extrapolated to children or younger adults. In this article, we explore the physiological changes in bone turnover and mineralization in children and young adults, the pathophysiology of mineral bone disease in CKD and a potential link between bone demineralization and vascular calcification.

SERPINC1
Also flagged:Helicase-like transcription factorHLTFcancerscolorectal cancerE3 ubiquitin ligasePCNA
Journal Article 2023-08-25 ✓ 4 Snippets Kaur G, Helmer RA, Martinez-Marin D, Sennoune SR, Washburn RL, Martinez-Zaguilan R, Dufour JM, Chilton BS.
In-Text Gene Mentions

The first, decreased transcriptional availability (log2 FC -4.036, p = 0.001) of serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1 (SerpinC1) that encodes a serine protease inhibitor antithrombin III (ATIII), the extracellular inhibitor of GzmA.

…inhibitor antithrombin III (ATIII), the extracellular inhibitor…

…downregulation of theSerpinc1gene that encodes…

…nscriptional downregulation ofSerpinc1gene that encodes…

Show Full Abstract

Epigenetic mechanisms are integral to pancreatic β cell function. Promoter hypermethylation of the helicase like-transcription factor (HLTF) gene-a component of the cellular DNA damage response that contributes to genome stability-has been implicated in age-associated changes in β cells. To study HLTF, we generated global and β cell-specific (β) Hltf knockout (KO) immune competent (IC) and immune deficient (ID) Rag2-/IL2- mice. IC global and β Hltf KO mice were neonatal lethal whereas ID global and β Hltf KO newborn mice had normal survival. This focused our investigation on the effects of Rag2 interruption with common gamma chain interruption on β cell function/survival. Three-way transcriptomic (RNAseq) analyses of whole pancreata from IC and ID newborn β Hltf KO and wild type (Hltf +/+) controls combined with spatially resolved transcriptomic analysis of formalin fixed paraffin embedded tissue, immunohistochemistry and laser scanning confocal microscopy showed DNA damage caused by β Hltf KO in IC mice upregulated the Hmgb1-Rage axis and a gene signature for innate immune cells. Perforin-delivered granzyme A (GzmA) activation of DNase, Nme1, showed damaged nuclear single-stranded DNA (γH2AX immunostaining). This caspase-independent method of cell death was supported by transcriptional downregulation of Serpinc1 gene that encodes a serine protease inhibitor of GzmA. Increased transcriptional availability of complement receptors C3ar1 and C5ar1 likely invited crosstalk with Hmgb1 to amplify inflammation. This study explores the complex dialog between β cells and immune cells during development. It has implications for the initiation of type I diabetes in utero when altered gene expression that compromises genome stability invokes a localized inflammatory response.

Also flagged:Verruculogensalkaloidsendoperoxidesynthesisrhodiumverruculogen synthase
Journal Article 2023-08-25 No Snippets Yang J, Singh B, Cohen G, Ting CP.
Show Full Abstract

Verruculogens are rare fumitremorgin alkaloids that contain a highly unusual eight-membered endoperoxide. In this paper, we report a concise chemoenzymatic synthesis of 13-oxoverruculogen using enzymatic C-H peroxidation and rhodium-catalyzed C-C bond activation reactions to install the eight-membered endoperoxide and the pentacyclic core of the natural product, respectively. Our strategy involves the use of 13-<i>epi</i>-fumitremorgin B as a substrate analog for endoperoxidation by verruculogen synthase, FtmOx1. The resulting product, 13-<i>epi</i>-verruculogen, is the first unnatural endoperoxide generated by FtmOx1 and is used in the first synthesis of 13-oxoverruculogen. This strategy enables a 10-step synthesis of this natural product from commercially available starting materials and illustrates a hybrid approach utilizing biocatalytic and transition-metal-catalyzed reactions to access challenging alkaloid architectures. Moreover, this work demonstrates the use of native enzyme promiscuity as a viable strategy for the chemoenzymatic synthesis of natural products.

TNFSF4
Also flagged:cutaneous squamous cell carcinomaprecancerousactinic keratosismalignant invasive cutaneous squamous cell carcinomametastatic diseaseepidermal
Journal Article 2023-08-25 ✓ 1 Snippet Bailey P, Ridgway RA, Cammareri P, Treanor-Taylor M, Bailey UM, Schoenherr C, Bone M, Schreyer D, Purdie K, Thomson J, Rickaby W, Jackstadt R, Campbell AD, Dimonitsas E, Stratigos AJ, Arron ST, Wang J, Blyth K, Proby CM, Harwood CA, Sansom OJ, Leigh IM, Inman GJ.
In-Text Gene Mentions

…, 14 andTNFSF4, 9 ,…

Show Full Abstract

The molecular basis of disease progression from UV-induced precancerous actinic keratosis (AK) to malignant invasive cutaneous squamous cell carcinoma (cSCC) and potentially lethal metastatic disease remains unclear. DNA sequencing studies have revealed a massive mutational burden but have yet to illuminate mechanisms of disease progression. Here we perform RNAseq transcriptomic profiling of 110 patient samples representing normal sun-exposed skin, AK, primary and metastatic cSCC and reveal a disease continuum from a differentiated to a progenitor-like state. This is accompanied by the orchestrated suppression of master regulators of epidermal differentiation, dynamic modulation of the epidermal differentiation complex, remodelling of the immune landscape and an increase in the preponderance of tumour specific keratinocytes. Comparative systems analysis of human cSCC coupled with the generation of genetically engineered murine models reveal that combinatorial sequential inactivation of the tumour suppressor genes Tgfbr2, Trp53, and Notch1 coupled with activation of Ras signalling progressively drives cSCC progression along a differentiated to progenitor axis. Taken together we provide a comprehensive map of the cSCC disease continuum and reveal potentially actionable events that promote and accompany disease progression.

CCPG1
Also flagged:organellesendoplasmic reticulummitochondriaautophagyE3 ubiquitin ligaseParkin
Journal Article 2023-08-25 ✓ 1 Snippet Wang R, Fortier TM, Chai F, Miao G, Shen JL, Restrepo LJ, DiGiacomo JJ, Velentzas PD, Baehrecke EH.
In-Text Gene Mentions

CCPG1

Show Full Abstract

Selective clearance of organelles, including endoplasmic reticulum (ER) and mitochondria, by autophagy plays an important role in cell health. Here, we describe a developmentally programmed selective ER clearance by autophagy. We show that Parkinson's disease-associated PINK1, as well as Atl, Rtnl1, and Trp1 receptors, regulate ER clearance by autophagy. The E3 ubiquitin ligase Parkin functions downstream of PINK1 and is required for mitochondrial clearance while having the opposite function in ER clearance. By contrast, Keap1 and the E3 ubiquitin ligase Cullin3 function downstream of PINK1 to regulate ER clearance by influencing Rtnl1 and Atl. PINK1 regulates a change in Keap1 localization and Keap1-dependent ubiquitylation of the ER-phagy receptor Rtnl1 to facilitate ER clearance. Thus, PINK1 regulates the selective clearance of ER and mitochondria by influencing the balance of Keap1- and Parkin-dependent ubiquitylation of substrates that determine which organelle is removed by autophagy.

HTT
Also flagged:Huntington's diseaseHDautosomalneurodegenerative disease
Journal Article 2023-08-25 ✓ 1 Snippet Piechota M, Latoszek E, Liszewska E, Hansíková H, Klempíř J, Mühlbäck A, Landwehrmeyer GB, Kuźnicki J, Czeredys M.
In-Text Gene Mentions

…mutation in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by a mutation in the HTT gene. To generate human-induced pluripotent stem cells (hiPSCs), we used dermal fibroblasts from 1 healthy adult control (K-Pic2), 1 HD manifest patient (M-T2), 1 healthy juvenile control (jK-N1), and 1 juvenile HD patient (jHD-V1). HD stage of patients was assessed by neurological tests and donors were without comorbidities and were non-smokers. Characterization showed that the obtained hiPSCs have the same number of CAG repeats as the parental fibroblast lines, express pluripotency markers and have the ability to differentiate into all 3 germ layers.

Also flagged:Yin Yang 1YY1transcription factorGLIbindingfactor
Journal Article 2023-08-25 No Snippets Jung M, Bui I, Bonavida B.
Show Full Abstract

Cancer is a leading cause of death among the various diseases encountered in humans. Cancer is not a single entity and consists of numerous different types and subtypes that require various treatment regimens. In the last decade, several milestones in cancer treatments were accomplished, such as specific targeting agents or revitalizing the dormant anti-tumor immune response. These milestones have resulted in significant positive clinical responses as well as tumor regression and the prolongation of survival in subsets of cancer patients. Hence, in non-responding patients and non-responding relapsed patients, cancers develop intrinsic mechanisms of resistance to cell death via the overexpression of anti-apoptotic gene products. In parallel, the majority of resistant cancers have been reported to overexpress a transcription factor, Yin Yang 1 (YY1), which regulates the chemo-immuno-resistance of cancer cells to therapeutic anticancer cytotoxic agents. The relationship between the overexpression of YY1 and several anti-apoptotic gene products, such as B-cell lymphoma 2 protein (Bcl-2), B-cell lymphoma extra-large (Bcl-xL), myeloid cell leukemia 1 (Mcl-1) and survivin, is investigated in this paper. The findings demonstrate that these anti-apoptotic gene products are regulated, in part, by YY1 at the transcriptional, epigenetic, post-transcriptional and translational levels. While targeting each of the anti-apoptotic gene products individually has been examined and clinically tested for some, this targeting strategy is not effective due to compensation by other overexpressed anti-apoptotic gene products. In contrast, targeting YY1 directly, through small interfering RNAs (siRNAs), gene editing or small molecule inhibitors, can be therapeutically more effective and generalized in YY1-overexpressed resistant cancers.

HFE
Also flagged:Vitamin EAminotransferasesNon-Alcoholic Fatty Liver DiseaseNAFLDΝon-alcoholic fatty liver diseaseliver disease
Journal Article 2023-08-25 ✓ 1 Snippet Vogli S, Naska A, Marinos G, Kasdagli MI, Orfanos P.
In-Text Gene Mentions

…-1-antitrypsin deficiency, andhemochromatosis) and intervention through…

Show Full Abstract

Νon-alcoholic fatty liver disease (NAFLD) is a common cause of end-stage liver disease in developed countries. Oxidative stress plays a key role during the course of the disease and vitamin E supplementation has shown to be beneficial due to its antioxidative properties. We aim to investigate the effect of vitamin E supplementation on serum aminotransferase levels in patients with NAFLD. Three electronic databases (MEDLINE, CENTRAL, and Embase) were reviewed for randomized trials that tested vitamin E supplementation versus placebo or no intervention in patients with NAFLD, published until April 2023. A total of 794 patients from 12 randomized trials were included in this meta-analysis. Notwithstanding the studies' heterogeneity and moderate internal validity in certain cases, among studies testing vitamin E supplementation at 400 IU/day and above, the values of alanine aminotransferase (ALT) were reduced compared with placebo or no intervention [ALT Mean Difference (MD) = -6.99 IU/L, 95% CI (-9.63, -4.35), for studies conducted in Asian countries and MD = -9.57 IU/L, 95% CI (-12.20, -6.95) in non-Asian countries]. Regarding aspartate aminotransferase (AST), patients in the experimental group experienced a reduction in serum levels, though smaller in absolute values [AST MD = -4.65 IU/L, 95% CI (-7.44, -1.86) in studies conducted in Asian populations] and of lower precision in non-Asian studies [MD = -5.60 IU/L, 95% CI (-11.48, 0.28)].

HFE
Also flagged:class-switchingALCAMCD6rheumatoid arthritisRAtumor necrosis factor
Journal Article 2023-08-25 ✓ 1 Snippet Kenney HM, Rangel-Moreno J, Peng Y, Chen KL, Bruno J, Embong A, Pritchett E, Fox JI, Becerril-Villanueva E, Gamboa-Domínguez A, Quataert S, Muthukrishnan G, Wood RW, Korman BD, Anolik JH, Xing L, Ritchlin CT, Schwarz EM, Wu CL.
In-Text Gene Mentions

…Analysis ofHfe+ / Cx3cr1…

Show Full Abstract

<h4>Introduction</h4>Defective lymphatic drainage and translocation of B-cells in inflamed (Bin) joint-draining lymph node sinuses are pathogenic phenomena in patients with severe rheumatoid arthritis (RA). However, the molecular mechanisms underlying this lymphatic dysfunction remain poorly understood. Herein, we utilized multi-omic spatial and single-cell transcriptomics to evaluate altered cellular composition (including lymphatic endothelial cells, macrophages, B-cells, and T-cells) in the joint-draining lymph node sinuses and their associated phenotypic changes and cell-cell interactions during RA development using the tumor necrosis factor transgenic (TNF-Tg) mouse model.<h4>Methods</h4>Popliteal lymph nodes (PLNs) from wild-type (n=10) and TNF-Tg male mice with "Early" (5 to 6-months of age; n=6) and "Advanced" (>8-months of age; n=12) arthritis were harvested and processed for spatial transcriptomics. Single-cell RNA sequencing (scRNAseq) was performed in PLNs from the TNF-Tg cohorts (n=6 PLNs pooled/cohort). PLN histopathology and ELISPOT along with ankle histology and micro-CT were evaluated. Histopathology of human lymph nodes and synovia was performed for clinical correlation.<h4>Results</h4>Advanced PLN sinuses exhibited an increased <i>Ighg2b/Ighm</i> expression ratio (Early 0.5 ± 0.1 vs Advanced 1.4 ± 0.5 counts/counts; <i>p<0.001</i>) that significantly correlated with reduced talus bone volumes in the afferent ankle (R<sup>2 =</sup> 0.54, <i>p<0.001</i>). Integration of single-cell and spatial transcriptomics revealed the increased IgG2b<sup>+</sup> plasma cells localized in MARCO<sup>+</sup> peri-follicular medullary sinuses. A concomitant decreased <i>Fth1</i> expression (Early 2.5 ± 0.74 vs Advanced 1.0 ± 0.50 counts, <i>p<0.001</i>) within Advanced PLN sinuses was associated with accumulation of iron-laden Prussian blue positive macrophages in lymph nodes and synovium of Advanced TNF-Tg mice, and further validated in RA clinical samples. T-cells were increased 8-fold in Advanced PLNs, and bioinformatic pathway assessment identified the interaction between ALCAM<sup>+</sup> macrophages and CD6<sup>+</sup> T-cells as a plausible co-stimulatory mechanism to promote IgG2b class-switching.<h4>Discussion</h4>Collectively, these data support a model of flare in chronic TNF-induced arthritis in which loss of lymphatic flow through affected joint-draining lymph nodes facilitates the interaction between effluxing macrophages and T-cells via ALCAM-CD6 co-stimulation, initiating IgG2b class-switching and plasma cell differentiation of the expanded Bin population. Future work is warranted to investigate immunoglobulin clonality and potential autoimmune consequences, as well as the efficacy of anti-CD6 therapy to prevent these pathogenic events.

MLLT10
Also flagged:leukemic oncogeneDOT1LMLL-AF4leukemiaMLLAF4
Journal Article 2023-08-25 ✓ 1 Snippet Johannessen JA, Formica M, Haukeland ALC, Bråthen NR, Al Outa A, Aarsund M, Therrien M, Enserink JM, Knævelsrud H.
In-Text Gene Mentions

… (ENL)/MLLT1, AF9/MLLT3, AF10/MLLT10or eleven-nineteen lysine-rich…

Show Full Abstract

<i>MLL</i>-rearranged (<i>MLL</i>-r) leukemias are among the leukemic subtypes with poorest survival, and treatment options have barely improved over the last decades. Despite increasing molecular understanding of the mechanisms behind these hematopoietic malignancies, this knowledge has had poor translation into the clinic. Here, we report a <i>Drosophila melanogaster</i> model system to explore the pathways affected in <i>MLL</i>-r leukemia. We show that expression of the human leukemic oncogene MLL-AF4 in the <i>Drosophila</i> hematopoietic system resulted in increased levels of circulating hemocytes and an enlargement of the larval hematopoietic organ, the lymph gland. Strikingly, depletion of <i>Drosophila</i> orthologs of known interactors of MLL-AF4, such as DOT1L, rescued the leukemic phenotype. In agreement, treatment with small-molecule inhibitors of DOT1L also prevented the MLL-AF4-induced leukemia-like phenotype. Taken together, this model provides an <i>in vivo</i> system to unravel the genetic interactors involved in leukemogenesis and offers a system for improved biological understanding of <i>MLL</i>-r leukemia.

Also flagged:translationalcardiovascular diseaseAtherosclerosisdeathacute coronary syndromefibroblast proliferation
Journal Article 2023-08-25 No Snippets Kabłak-Ziembicka A, Badacz R, Okarski M, Wawak M, Przewłocki T, Podolec J.
Show Full Abstract

MicroRNAs are small non-coding post-translational biomolecules which, when expressed, modify their target genes. It is estimated that microRNAs regulate production of approximately 60% of all human proteins and enzymes that are responsible for major physiological processes. In cardiovascular disease pathophysiology, there are several cells that produce microRNAs, including endothelial cells, vascular smooth muscle cells, macrophages, platelets, and cardiomyocytes. There is a constant crosstalk between microRNAs derived from various cell sources. Atherosclerosis initiation and progression are driven by many pro-inflammatory and pro-thrombotic microRNAs. Atherosclerotic plaque rupture is the leading cause of cardiovascular death resulting from acute coronary syndrome (ACS) and leads to cardiac remodeling and fibrosis following ACS. MicroRNAs are powerful modulators of plaque progression and transformation into a vulnerable state, which can eventually lead to plaque rupture. There is a growing body of evidence which demonstrates that following ACS, microRNAs might inhibit fibroblast proliferation and scarring, as well as harmful apoptosis of cardiomyocytes, and stimulate fibroblast reprogramming into induced cardiac progenitor cells. In this review, we focus on the role of cardiomyocyte-derived and cardiac fibroblast-derived microRNAs that are involved in the regulation of genes associated with cardiomyocyte and fibroblast function and in atherosclerosis-related cardiac ischemia. Understanding their mechanisms may lead to the development of microRNA cocktails that can potentially be used in regenerative cardiology.

HFE
Also flagged:stressgene expressioncytoplasmicstress granulespyroptosisnecroptosis
Journal Article 2023-08-25 ✓ 1 Snippet Lamichhane PP, Samir P.
In-Text Gene Mentions

…accumulation (as inhemochromatosis) also sensitizes cells…

Show Full Abstract

Cellular stress response activates a complex program of an adaptive response called integrated stress response (ISR) that can allow a cell to survive in the presence of stressors. ISR reprograms gene expression to increase the transcription and translation of stress response genes while repressing the translation of most proteins to reduce the metabolic burden. In some cases, ISR activation can lead to the assembly of a cytoplasmic membraneless compartment called stress granules (SGs). ISR and SGs can inhibit apoptosis, pyroptosis, and necroptosis, suggesting that they guard against uncontrolled regulated cell death (RCD) to promote organismal homeostasis. However, ISR and SGs also allow cancer cells to survive in stressful environments, including hypoxia and during chemotherapy. Therefore, there is a great need to understand the molecular mechanism of the crosstalk between ISR and RCD. This is an active area of research and is expected to be relevant to a range of human diseases. In this review, we provided an overview of the interplay between different cellular stress responses and RCD pathways and their modulation in health and disease.

HTT
Also flagged:HDbipolar disordersbipolar disordertype 2 bipolar disorderchromosomepsychiatric disorders
Journal Article 2023-08-25 ✓ 5 Snippets Ferrari C, Capacci E, Bagnoli S, Ingannato A, Sorbi S, Nacmias B.
In-Text Gene Mentions

Although psychiatric symptoms may often precede the motor phase of HD, only three previous studies evaluated the frequency of the pathological expansion in the HTT gene in psychiatric cohorts [24,25,30]: two studies in patients affected by major depression [24,25] and one study in a Brazilian cohort affected by bipolar disorder [30].

Regardless, beyond the interpretation of the role played by the HTT gene in the development of bipolar symptoms, the identification of IA carriers among this Italian cohort of bipolar patients has important implications for both patients and their families: patients can be at risk of developing a complete HD phenotype [11,13], and family members should be made aware of their increased risk of developing behavioral disturbances [10] or inheriting a pathological expanded HTT gene [6].

Although the HTT gene with less than 36 CAG repeats is considered to be normal, a growing number of studies have reported that subjects carrying IA are at higher risk of behavioral problems and can even develop the clinical phenotype of HD [9,10,11,12,13].

In the present study, we analyzed the HTT gene in a psychiatric cohort of patients affected by bipolar disorder in order to identify pre-motor HD patients and evaluate whether the length of CAG repeats may influence or contribute to the development of bipolar disorder.

Expansion of CAG triplets in the huntingtin gene (HTT) on chromosome 4 is responsible for Huntington’s disease (HD).

Show Full Abstract

<h4>Background and objectives</h4>Huntington's disease (HD) is characterized by motor, cognitive and psychiatric manifestations and caused by an expansion of CAG repeats over 35 triplets on the huntingtin (<i>HTT</i>) gene. However, expansions in the range 27-35 repeats (intermediate allele) can be associated with pathological phenotypes. The onset of HD is conventionally defined by the onset of motor symptoms, but psychiatric disturbances can precede the motor phase by up to twenty years. The aims of the present study are to identify HD patients in the pre-motor phase of the disease among patients diagnosed with bipolar disorders and evaluate any differences between bipolar patients carrying the normal <i>HTT</i> allele and patients with the expanded <i>HTT</i> gene.<h4>Methods</h4>We assessed the <i>HTT</i> genotype in an Italian cohort of 69 patients who were affected by either type 1 or type 2 bipolar disorder.<h4>Results</h4>No patient was found to be a carrier of the pathological <i>HTT</i> allele, but 10% of bipolar subjects carried an intermediate allele. Carriers of the intermediate allele were older at the onset of psychiatric symptoms than non-carriers.<h4>Conclusion</h4>The pathological <i>HTT</i> gene was not associated with bipolar disorder, while we found a higher frequency of the intermediate allele among the bipolar population with respect to healthy controls. The identification of this subset of bipolar subjects has implications for the clinical management of patients and their family members and promotes further investigation into possible pathological mechanisms common to both HD and bipolar disorder.

SERPINC1
Also flagged:Gene Expressiontranscription factortroponin ITNNI1myosin light chain 9MYL9
Journal Article 2023-08-25 ✓ 5 Snippets Yang Y, Wang X, Wang S, Chen Q, Li M, Lu S.
In-Text Gene Mentions

To the sex-specific biomarkers (Figure 7B), TNNI1 was significantly associated with estrogen_response_late (p < 0.05); MYL9 was positively correlated with complement, apoptosis, and androgen response (p < 0.05); and SERPINC1 was not observed with significant correlation with hallmark gene sets (p > 0.05).

…C member 1(SERPINC1)) and high-IMF…

…= 264), andSERPINC1(score = 230)…

…MYL9 , andSERPINC1, the six…

…MYL9 , andSERPINC1, as potential…

Show Full Abstract

Intramuscular fat (IMF) content is a key determinant of pork quality. Controlling the genetic and physiological factors of IMF and the expression patterns of various genes is important for regulating the IMF content and improving meat quality in pig breeding. Growing evidence has suggested the role of genetic factors and breeds in IMF deposition; however, research on the sex factors of IMF deposition is still lacking. The present study aimed to identify potential sex-specific biomarkers strongly associated with IMF deposition in low- and high-IMF pig populations. The GSE144780 expression dataset of IMF deposition-related genes were obtained from the Gene Expression Omnibus. Initially, differentially expressed genes (DEGs) were detected in male and female low-IMF (162 DEGs, including 64 up- and 98 down-regulated genes) and high-IMF pigs (202 DEGs, including 147 up- and 55 down-regulated genes). Moreover, hub genes were screened via PPI network construction. Furthermore, hub genes were screened for potential sex-specific biomarkers using the least absolute shrinkage and selection operator machine learning algorithm, and sex-specific biomarkers in low-IMF (troponin I (<i>TNNI1</i>), myosin light chain 9(<i>MYL9</i>), and serpin family C member 1(<i>SERPINC1</i>)) and high-IMF pigs (<i>CD4</i> molecule (<i>CD4</i>), <i>CD2</i> molecule (<i>CD2</i>), and amine oxidase copper-containing 2(<i>AOC2</i>)) were identified, and then verified by quantitative real-time PCR (qRT-PCR) in semimembranosus muscles. Additionally, the gene set enrichment analysis and single-sample gene set enrichment analysis of hallmark gene sets were collectively performed on the identified biomarkers. Finally, the transcription factor-biomarker and lncRNA-miRNA-mRNA (biomarker) networks were predicted. The identified potential sex-specific biomarkers may provide new insights into the molecular mechanisms of IMF deposition and the beneficial foundation for improving meat quality in pig breeding.

HTT
Also flagged:Fluoxetinenorfluoxetinedepressionserotonin5-hydroxytryptaminemajor depression
Journal Article 2023-08-25 ✓ 1 Snippet Frey M, Smigielski L, Tini E, Fekete S, Fleischhaker C, Wewetzer C, Karwautz A, Correll CU, Gerlach M, Taurines R, Plener PL, Malzahn U, Kornbichler S, Weninger L, Brockhaus M, Reuter-Dang SY, Reitzle K, Rock H, Imgart H, Heuschmann P, Unterecker S, Briegel W, Banaschewski T, Fegert JM, Hellenschmidt T, Kaess M, Kölch M, Renner T, Rexroth C, Walitza S, Schulte-Körne G, Romanos M, Egberts KM.
In-Text Gene Mentions

…of serotonin transporters (5-HTT) is necessary for…

Show Full Abstract

Fluoxetine is the recommended first-line antidepressant in many therapeutic guidelines for children and adolescents. However, little is known about the relationships between drug dose and serum level as well as the therapeutic serum reference range in this age group. Within a large naturalistic observational prospective multicenter clinical trial ("TDM-VIGIL"), a transdiagnostic sample of children and adolescents (<i>n</i> = 138; mean age, 15; range, 7-18 years; 24.6% males) was treated with fluoxetine (10-40 mg/day). Analyses of both the last timepoint and all timepoints (<i>n</i> = 292 observations), utilizing (multiple) linear regressions, linear mixed-effect models, and cumulative link (mixed) models, were used to test the associations between dose, serum concentration, outcome, and potential predictors. The receiver operating curve and first to third interquartile methods, respectively, were used to examine concentration cutoff and reference values for responders. A strong positive relationship was found between dose and serum concentration of fluoxetine and its metabolite. Higher body weight was associated with lower serum concentrations, and female sex was associated with lower therapeutic response. The preliminary reference ranges for the active moiety (fluoxetine+norfluoxetine) were 208-328 ng/mL (transdiagnostically) and 201.5-306 ng/mL (depression). Most patients showed marked (45.6%) or minimal (43.5%) improvements and reported no adverse effects (64.9%). This study demonstrated a clear linear dose-serum level relationship for fluoxetine in youth, with the identified reference range being within that established for adults.

DCC
Also flagged:adherens junctionsnucleusWntneurogenesisadherensaxon growth
Journal Article 2023-08-24 ✓ 5 Snippets Herrera A, Menendez A, Ochoa A, Bardia L, Colombelli J, Pons S.
In-Text Gene Mentions

…nce signals, including Netrin/DCC, Slit/Robo, sonic hedgehog…

…to BOC andDCCon pre-crossing commissural…

…1, such asDCC, UNC5C, Neo1 and…

…which netrin 1,DCCor Robo3 are…

…caused by deletingDCC( Xu et…

Show Full Abstract

Here, we show that, in the developing spinal cord, after the early Wnt-mediated Tcf transcription activation that confers dorsal identity to neural stem cells, neurogenesis redirects β-catenin from the adherens junctions to the nucleus to stimulate Tcf-dependent transcription in a Wnt-independent manner. This new β-catenin activity regulates genes implicated in several aspects of contralateral axon growth, including axon guidance and adhesion. Using live imaging of ex-vivo chick neural tube, we showed that the nuclear accumulation of β-catenin and the rise in Tcf-dependent transcription both initiate before the dismantling of the adherens junctions and remain during the axon elongation process. Notably, we demonstrated that β-catenin activity in post-mitotic cells depends on TCF7L2 and is central to spinal commissural axon growth. Together, our results reveal Wnt-independent Tcf/β-catenin regulation of genes that control the growth and guidance of commissural axons in chick spinal cord.

HFE
Also flagged:cirrhosisliver cirrhosisalcohol-related liver diseaseviral hepatitisportal-vein thrombosishepatocellular carcinoma
Journal Article 2023-08-24 ✓ 1 Snippet Schwarz M, Schwarz C, Burghart L, Pfisterer N, Bauer D, Hübl W, Mandorfer M, Gschwantler M, Reiberger T.
In-Text Gene Mentions

…liver injury (DILI),hemochromatosis, and cryptogenic liver…

Show Full Abstract

<h4>Introduction</h4>Liver cirrhosis accounts for considerable morbidity and mortality worldwide and late presentation limits therapeutic options. We aimed to assess characteristics of patients with liver cirrhosis at the time of first presentation and during their clinical course.<h4>Methods</h4>Patients with cirrhosis as evident by presence of varices at endoscopy, liver stiffness ≥15kPa at elastography, or ascites requiring paracentesis between Q1/2015-Q2/2020 were retrospectively included. Clinical, laboratory, and imaging data were collected from medical records at presentation and last follow-up.<h4>Results</h4>476 patients were included (alcohol-related liver disease, ALD: 211, 44.3%; viral hepatitis: 163, 34.2%). Of these, 106 patients (22.3%) and 160 patients (33.6%) presented already with Child-Pugh C and MELD >15, respectively, and decompensation events were registered in 50% (238 patients) at baseline, and even in 75.4% of ALD patients. During a median follow-up of 11.0 (IQR 4-24) months, 116 patients died. Two-year survival was worse for patients with ALD than for viral hepatitis (71.1% vs. 90.2%, log rank p<0.001). We observed the highest percentage of portal-vein thrombosis (30.0%), hepatocellular carcinoma (15.0%), and death (45.0%) in the MAFLD group (n = 20). Patients cured from hepatitis C showed significant improvements in platelet count (147 to 169 G/L, p<0.001) and liver stiffness (26.2 to 17.7 kPa, p<0.001), while ALD patients improved in Child-Pugh score (8.6 to 7.6, p<0.001) during follow-up. With increasing Child Pugh score and MELD, we found increasing serum concentrations of CRP (p<0.001) and an inverse correlation with serum HDL (Spearman's ρ = -0.573 and -0.529, respectively, p<0.001).<h4>Conclusion</h4>Half of the patients with cirrhosis had decompensated cirrhosis at presentation. This calls for increased awareness and strategies for earlier diagnosis of chronic liver disease and cirrhosis.

SUDS3
Also flagged:IKAROSchromatinorganizationtranscription factoracute lymphocytic leukemialymphoma
Journal Article 2023-08-24 ✓ 1 Snippet Affar M, Bottardi S, Quansah N, Lemarié M, Ramón AC, Affar EB, Milot E.
In-Text Gene Mentions

histone modifying complexes

Show Full Abstract

IKAROS is a master regulator of cell fate determination in lymphoid and other hematopoietic cells. This transcription factor orchestrates the association of epigenetic regulators with chromatin, ensuring the expression pattern of target genes in a developmental and lineage-specific manner. Disruption of IKAROS function has been associated with the development of acute lymphocytic leukemia, lymphoma, chronic myeloid leukemia and immune disorders. Paradoxically, while IKAROS has been shown to be a tumor suppressor, it has also been identified as a key therapeutic target in the treatment of various forms of hematological malignancies, including multiple myeloma. Indeed, targeted proteolysis of IKAROS is associated with decreased proliferation and increased death of malignant cells. Although the molecular mechanisms have not been elucidated, the expression levels of IKAROS are variable during hematopoiesis and could therefore be a key determinant in explaining how its absence can have seemingly opposite effects. Mechanistically, IKAROS collaborates with a variety of proteins and complexes controlling chromatin organization at gene regulatory regions, including the Nucleosome Remodeling and Deacetylase complex, and may facilitate transcriptional repression or activation of specific genes. Several transcriptional regulatory functions of IKAROS have been proposed. An emerging mechanism of action involves the ability of IKAROS to promote gene repression or activation through its interaction with the RNA polymerase II machinery, which influences pausing and productive transcription at specific genes. This control appears to be influenced by IKAROS expression levels and isoform production. In here, we summarize the current state of knowledge about the biological roles and mechanisms by which IKAROS regulates gene expression. We highlight the dynamic regulation of this factor by post-translational modifications. Finally, potential avenues to explain how IKAROS destruction may be favorable in the treatment of certain hematological malignancies are also explored.

Also flagged:tumorcancermalignant tumorslymph node metastasisdendrimersglutathione
Journal Article 2023-08-24 No Snippets He P, Tang H, Zheng Y, Xiong Y, Cheng H, Li J, Zhang Y, Liu G.
Show Full Abstract

Lymph nodes play a pivotal role in tumor progression as key components of the lymphatic system. However, the unique physiological structure of lymph nodes has traditionally constrained the drug delivery efficiency. Excitingly, nanomedicines have shown tremendous advantages in lymph node-specific delivery, enabling distinct recognition and diagnosis of lymph nodes, and hence laying the foundation for efficient tumor therapies. In this review, we comprehensively discuss the key factors affecting the specific enrichment of nanomedicines in lymph nodes, and systematically summarize nanomedicines for precise lymph node drug delivery and therapeutic application, including the lymphatic diagnosis and treatment nanodrugs and lymph node specific imaging and identification system. Notably, we delve into the critical challenges and considerations currently facing lymphatic nanomedicines, and futher propose effective strategies to address these issues. This review encapsulates recent findings, clinical applications, and future prospects for designing effective nanocarriers for lymphatic system targeting, with potential implications for improving cancer treatment strategies.

Also flagged:Bovine tuberculosisTuberculosisTBMycobacterium infectionszoonotic diseaseinfection
Journal Article 2023-08-24 No Snippets Banos G.
Show Full Abstract

Bovine tuberculosis (bTB) persists in many countries having a significant impact on public health and livestock industry finances. The incidence and prevalence of new cases in parts of the UK and elsewhere over the past decades warrant intensified efforts towards achieving Officially Tuberculosis Free (OTF) status in the respective regions. Genetic selection aiming to identify and remove inherently susceptible animals from breeding has been proposed as an additional measure in ongoing programmes towards controlling the disease. The presence of genetic variation among individual animals in their capacity to respond to Mycobacterium bovis exposure has been documented and heritability estimates of 0.06-0.18 have been reported. Despite their moderate magnitude, these estimates suggest that host resistance to bTB is amenable to improvement with selective breeding. Although relatively slow, genetic progress can be constant, cumulative and permanent, thereby complementing ongoing disease control measures. Importantly, mostly no antagonistic genetic correlations have been found between bTB resistance and other animal traits suggesting that carefully incorporating the former in breeding decisions should not adversely affect bovine productivity. Simulation studies have demonstrated the potential impact of genetic selection on reducing the probability of a breakdown to occur or the duration and severity of a breakdown that has already been declared. Furthermore, research on the bovine genome has identified multiple genomic markers and genes associated with bTB resistance. Nevertheless, the combined outcomes of these studies suggest that host resistance to bTB is a complex, polygenic trait, with no single gene alone explaining the inherent differences between resistant and susceptible animals. Such results support the development of accurate genomic breeding values that duly capture the collective effect of multiple genes to underpin selective breeding programmes. In addition to improving host resistance to bTB, scientists and practitioners have considered the possibility of reducing host infectivity. Ongoing studies have suggested the presence of genetic variation for infectivity and confirmed that bTB eradication would be accelerated if selective breeding considered both host resistance and infectivity traits. In conclusion, research activity on bTB genetics has generated knowledge and insights to support selective breeding as an additional measure towards controlling and eradicating the disease.

SOX6
Also flagged:nucleusaxonsynapsePax7gene expressionsleep
Journal Article 2023-08-24 ✓ 2 Snippets Choi JS, Ayupe AC, Beckedorff F, Catanuto P, McCartan R, Levay K, Park KK.
In-Text Gene Mentions

…we observed thatSox6expression remains high…

…the notion thatSox6maintains the precursor…

Show Full Abstract

The superior colliculus (SC) is a sensorimotor structure in the midbrain that integrates input from multiple sensory modalities to initiate motor commands. It undergoes well-characterized steps of circuit assembly during development, rendering the mouse SC a popular model to study establishment of neural connectivity. Here we perform single-nucleus RNA-sequencing analysis of the mouse SC isolated at various developmental time points. Our study provides a transcriptomic landscape of the cell types that comprise the SC across murine development with particular emphasis on neuronal heterogeneity. We report a repertoire of genes differentially expressed across the different postnatal ages, many of which are known to regulate axon guidance and synapse formation. Using these data, we find that Pax7 expression is restricted to a subset of GABAergic neurons. Our data provide a valuable resource for interrogating the mechanisms of circuit development and identifying markers for manipulating specific SC neuronal populations and circuits.

SOX6
Also flagged:somatostatincell-cycleSst
Journal Article 2023-08-24 ✓ 5 Snippets Munguba H, Nikouei K, Hochgerner H, Oberst P, Kouznetsova A, Ryge J, Muñoz-Manchado AB, Close J, Batista-Brito R, Linnarsson S, Hjerling-Leffler J.
In-Text Gene Mentions

…We conditionally removedSox6(Sox6-cKO) in migrating…

…conditionally removed Sox6 (Sox6-cKO) in migrating somatostati…

…absent in theSox6-cKO cortex without a…

Sox6-cKO cells displayed electroph…

…Conversely,Sox6removal at postnatal…

Show Full Abstract

Although cardinal cortical interneuron identity is established upon cell-cycle exit, it remains unclear whether specific interneuron subtypes are pre-established, and if so, how their identity is maintained prior to circuit integration. We conditionally removed Sox6 (Sox6-cKO) in migrating somatostatin (Sst<sup>+</sup>) interneurons and assessed the effects on their mature identity. In adolescent mice, five of eight molecular Sst<sup>+</sup> subtypes were nearly absent in the Sox6-cKO cortex without a reduction in cell number. Sox6-cKO cells displayed electrophysiological maturity and expressed genes enriched within the broad class of Sst<sup>+</sup> interneurons. Furthermore, we could infer subtype identity prior to cortical integration (embryonic day 18.5), suggesting that the loss in subtype was due to disrupted subtype maintenance. Conversely, Sox6 removal at postnatal day 7 did not disrupt marker expression in the mature cortex. Therefore, Sox6 is necessary during migration for maintenance of Sst<sup>+</sup> subtype identity, indicating that subtype maintenance requires active transcriptional programs.

PTGIS
Also flagged:lipidmetabolismtumorimmune responsebladder cancerBLCA
Journal Article 2023-08-24 ✓ 1 Snippet Tan Z, Fu S, Zuo J, Wang J, Wang H.
In-Text Gene Mentions

…among PTGS1, CAV1,PTGIS, etc.…

Show Full Abstract

<h4>Background</h4>Numerous types of research revealed that long noncoding RNAs (lncRNAs) played a significant role in immune response and the tumor microenvironment of bladder cancer (BLCA). Dysregulated lipid metabolism is considered to be one of the major risk factors for BLCA, the study aimed to detect the lipid metabolism-related lncRNAs (LMRLs) along with their potential prognostic values and immune correlations in BLCA.<h4>Methods</h4>We collected lipid metabolism-related genes, expression profiles, and clinical information on BLCA from the Molecular Signature Database (MSigDB) and the TCGA database, respectively. Differentially expressed lipid metabolism genes (DE-LMRGs) and differentially expressed long non-coding RNAs (DE-lncRNAs) were selected using the limma package. Spearman correlation analysis was employed to explore the correlations between DE-lncRNAs and DE-LMRGs and to further develop protein-protein interaction (PPI) networks and perform mutational analysis. The least absolute shrinkage and selection operator (LASSO) and univariate Cox analysis were then employed to construct a prognostic risk model. The performance of the model was evaluated using Kaplan-Meier survival analysis, receiver operating characteristic (ROC) curves, and consistency indices. In addition, we downloaded the GSE31684 dataset for external validation of the prognostic signature. Moreover, we explored the association of the risk model with immune cell infiltration and chemotherapy response analysis to reveal the tumor immune microenvironment of BLCA. Finally, RT-qPCR was utilized to validate the expression of prognostic genes.<h4>Results</h4>A total of 48 DE-LncRNAs and 33 DE-LMRGs were found to be robustly correlated, and were used to construct a lncRNA-mRNA co-expression network, in which ACACB, ACOX2, and BCHE showed high mutation rates. Then, a risk model based on three LMRLs (RP11-465B22.8, MIR100HG, and LINC00865) was constructed. The risk model effectively distinguished between the clinical outcomes of BLCA patients, with high-risk scores indicating a worse prognosis and with substantial prognostic prediction accuracy. The model's results were consistent in the GSE31684 dataset. In addition, a nomogram was constructed based on the risk score, age, pathological T-stage, and pathological N-stage, which showed robust predictive power. Immune landscape analysis indicated that the risk model was significantly associated with T-cell CD4 memory activation, M1 macrophage, M2 macrophage, dendritic cell activation, and T-cell regulatory. We predicted that 49 drugs would perform satisfactorily in the high-risk group. Additionally, we found five m6A regulators associated with the high- and low-risk groups, suggesting that upstream regulation of LncRNA could be a novel target for BLCA treatment. Finally, RT-qPCR showed that RP11-465B22.8 was highly expressed in BLCA, while MIR100HG and LINC00865 were downregulated in BLCA.<h4>Conclusion</h4>Our findings suggest that the three LMRLs may serve as potential prognostic and immunotherapeutic biomarkers in BLCA. In addition, our study provides new ideas for understanding the pathogenic mechanisms and developing therapeutic strategies for BLCA patients.

PRDX6
Also flagged:peroxiredoxin 6peptidemultiple sclerosisperoxidasephospholipase A2experimental autoimmune encephalomyelitis
Journal Article 2023-08-24 ✓ 5 Snippets Lunin SM, Novoselova EG, Glushkova OV, Parfenyuk SB, Kuzekova AA, Novoselova TV, Sharapov MG, Mubarakshina EK, Goncharov RG, Khrenov MO.
In-Text Gene Mentions

The simultaneous administration of thymulin and Prdx6 resulted in complete symptomatic restoration of mice with EAE.

Prdx6 did not induce significant immunomodulatory effects but abruptly decreased EAE-induced NOX1 and NOX4 gene expression in brain tissue, which may be one of the possible mechanisms of its beneficial effects on BBB conditions and health status.

This study aimed to assess the effects of the immunomodulator thymulin, a thymic peptide with anti-inflammatory effects, and peroxiredoxin 6 (Prdx6), an antioxidant enzyme with dual peroxidase and phospholipase A2 activities, on the blood‒brain barrier (BBB) condition and general health status of animals with relapsing-remitting experimental autoimmune encephalomyelitis (EAE), which is a model of multiple sclerosis in humans.

Both thymulin and Prdx6 significantly improved the condition of the BBB, which was impaired by EAE induction, as measured by Evans blue dye accumulation, tight-junction protein loss in brain tissue, and lymphocyte infiltration through the BBB.

…and peroxiredoxin 6 (Prdx6), an antioxidant enzyme…

Show Full Abstract

This study aimed to assess the effects of the immunomodulator thymulin, a thymic peptide with anti-inflammatory effects, and peroxiredoxin 6 (Prdx6), an antioxidant enzyme with dual peroxidase and phospholipase A2 activities, on the blood‒brain barrier (BBB) condition and general health status of animals with relapsing-remitting experimental autoimmune encephalomyelitis (EAE), which is a model of multiple sclerosis in humans. Both thymulin and Prdx6 significantly improved the condition of the BBB, which was impaired by EAE induction, as measured by Evans blue dye accumulation, tight-junction protein loss in brain tissue, and lymphocyte infiltration through the BBB. The effect was associated with significant amelioration of EAE symptoms. Thymulin treatment was accompanied by a decrease in immune cell activation as judged by interleukin-6, -17, and interferon-gamma cytokine levels in serum and NF-kappaB cascade activation in splenocytes of mice with EAE. Prdx6 did not induce significant immunomodulatory effects but abruptly decreased EAE-induced NOX1 and NOX4 gene expression in brain tissue, which may be one of the possible mechanisms of its beneficial effects on BBB conditions and health status. The simultaneous administration of thymulin and Prdx6 resulted in complete symptomatic restoration of mice with EAE. The results demonstrate prospective strategies for multiple sclerosis treatment.

Also flagged:Huntington's DiseaseOculomotor apraxiaHuntington'sHDchoreahypokinetic‐rigid syndrome
Journal Article 2023-08-24 No Snippets Innes EA, Qiu J, Morales-Briceño H, Farrar MA, Mohammad SS.
Show Full Abstract

No abstract available.

Also flagged:cancertumortumorstranslationaldeathwound healing
Journal Article 2023-08-24 No Snippets Song X, Lan Y, Zheng X, Zhu Q, Liao X, Liu K, Zhang W, Peng Q, Zhu Y, Zhao L, Chen X, Shu Y, Yang K, Hu J.
Show Full Abstract

Drug resistance remains the greatest challenge in improving outcomes for cancer patients who receive chemotherapy and targeted therapy. Surmounting evidence suggests that a subpopulation of cancer cells could escape intense selective drug treatment by entering a drug-tolerant state without genetic variations. These drug-tolerant cells (DTCs) are characterized with a slow proliferation rate and a reversible phenotype. They reside in the tumor region and may serve as a reservoir for resistant phenotypes. The survival of DTCs is regulated by epigenetic modifications, transcriptional regulation, mRNA translation remodeling, metabolic changes, antiapoptosis, interactions with the tumor microenvironment, and activation of signaling pathways. Thus, targeting the regulators of DTCs opens a new avenue for the treatment of therapy-resistant tumors. In this review, we first provide an overview of common characteristics of DTCs and the regulating networks in DTCs development. We also discuss the potential therapeutic opportunities to target DTCs. Last, we discuss the current challenges and prospects of the DTC-targeting approach to overcome acquired drug resistance. Reviewing the latest developments in DTC research could be essential in discovering of methods to eliminate DTCs, which may represent a novel therapeutic strategy for preventing drug resistance in the future.

Also flagged:mental illnessanxietymental disordersdepressive disordersanxiety disordersCOVID-19
Journal Article 2023-08-24 No Snippets Felsky D, Cannitelli A, Pipitone J.
Show Full Abstract

The growing global burden of mental illness has prompted calls for innovative research strategies. Theoretical models of mental health include complex contributions of biological, psychosocial, experiential, and other environmental influences. Accordingly, neuropsychiatric research has self-organized into largely isolated disciplines working to decode each individual contribution. However, research directly modeling objective biological measurements in combination with cognitive, psychological, demographic, or other environmental measurements is only now beginning to proliferate. This review aims to (1) to describe the landscape of modern mental health research and current movement towards integrative study, (2) to provide a concrete framework for quantitative integrative research, which we call Whole Person Modeling, (3) to explore existing and emerging techniques and methods used in Whole Person Modeling, and (4) to discuss our observations about the scarcity, potential value, and untested aspects of highly transdisciplinary research in general. Whole Person Modeling studies have the potential to provide a better understanding of multilevel phenomena, deliver more accurate diagnostic and prognostic tests to aid in clinical decision making, and test long standing theoretical models of mental illness. Some current barriers to progress include challenges with interdisciplinary communication and collaboration, systemic cultural barriers to transdisciplinary career paths, technical challenges in model specification, bias, and data harmonization, and gaps in transdisciplinary educational programs. We hope to ease anxiety in the field surrounding the often mysterious and intimidating world of transdisciplinary, data-driven mental health research and provide a useful orientation for students or highly specialized researchers who are new to this area.

TNFSF4
Also flagged:breast cancermalignant tumordeathFerroptosisironlipid
Journal Article 2023-08-24 ✓ 1 Snippet Li Q, Liu H, Jin Y, Yu Y, Wang Y, Wu D, Guo Y, Xi L, Ye D, Pan Y, Zhang X, Li J.
In-Text Gene Mentions

…NCR3LG1, NECTIN3, PVR, SLAMF9,TNFSF4, and BTN1A1.…

Show Full Abstract

Breast cancer, which is the most common malignant tumor among women worldwide and an important cause of death in women. The existing prognostic model for patients with breast cancer is not accurate as breast cancer is resistant to commonly used antitumor drugs. Ferroptosis is a novel mechanism of programmed cell death that depends on iron accumulation and lipid peroxidation. Various studies have confirmed the role of ferroptosis in tumor regulation and ferroptosis is now considered to play an important role in breast cancer development. At present, the association between breast cancer prognosis and ferroptosis-related gene expression remains unclear. Further exploration of this research area may optimize the evaluation and prediction of prognosis of patients with breast cancer and finding of new therapeutic targets. In this study, clinical factors and the expression of multiple genes were evaluated in breast cancer samples from the Cancer Genome Atlas (TCGA) database and Gene Expression Omnibus (GEO) database database. Eleven prognostication-related genes (TP63, IFNG, MT3, ANO6, FLT3, PTGS2, SLC1A4, JUN, SLC7A5, CHAC1, and TF) were identified from differentially expressed genes to construct a survival prediction model, which showed a good prediction ability. KEGG pathway analysis revealed that immune-related pathways were the primary pathways. ssGSEA analysis showed significant differences in the distribution of certain immune-related cell subsets, such as CD8<sup>+</sup>T cells and B cells, and in the expression of multiple immune genes, including type II IFN response and APC coinhibition. In addition, 10 immune targets related to ferroptosis in breast cancer were found: CD276, CD80, HHLA2, LILRA2, NCR3LG1, NECTIN3, PVR, SLAMF9,TNFSF4, and BTN1A1. Using TCGA, new ferroptosis genes related to breast cancer prognosis were identified, a new reliable and accurate prognosis model was developed, and 10 new potential therapeutic targets different from the traditional targeted drugs were identified to provide a reference for improving the poor prognosis of patients with breast cancer.

Also flagged:Silanehydroxyapatitedegradationpro-inflammatory cytokineslactideinflammatory responses
Journal Article 2023-08-24 No Snippets Shiroud Heidari B, Lopez EM, Chen P, Ruan R, Vahabli E, Davachi SM, Granero-Moltó F, De-Juan-Pardo EM, Zheng M, Doyle B.
Show Full Abstract

The interface tissue between bone and soft tissues, such as tendon and ligament (TL), is highly prone to injury. Although different biomaterials have been developed for TL regeneration, few address the challenges of the TL-bone interface. Here, we aim to develop novel hybrid nanocomposites based on poly(<i>p</i>-dioxanone) (PDO), poly(lactide-<i>co</i>-caprolactone) (LCL), and hydroxyapatite (HA) nanoparticles suitable for TL-bone interface repair. Nanocomposites, containing 3-10% of both unmodified and chemically modified hydroxyapatite (mHA) with a silane coupling agent. We then explored biocompatibility through <i>in vitro</i> and <i>in vivo</i> studies using a subcutaneous mouse model. Through different characterisation tests, we found that mHA increases tensile properties, creates rougher surfaces, and reduces crystallinity and hydrophilicity. Morphological observations indicate that mHA nanoparticles are attracted by PDO rather than LCL phase, resulting in a higher degradation rate for mHA group. We found that adding the 5% of nanoparticles gives a balance between the properties. <i>In vitro</i> experiments show that osteoblasts' activities are more affected by increasing the nanoparticle content compared with fibroblasts. Animal studies indicate that both HA and mHA nanoparticles (10%) can reduce the expression of pro-inflammatory cytokines after six weeks of implantation. In summary, this work highlights the potential of PDO/LCL/HA nanocomposites as an excellent biomaterial for TL-bone interface tissue engineering applications.

NEGR1
Also flagged:Acute Lymphoblastic LeukemiaALLcancerleukemiapathogenesishematologic
Journal Article 2023-08-24 ✓ 2 Snippets Kourti M, Aivaliotis M, Hatzipantelis E.
In-Text Gene Mentions

…adhesion molecule (NRCAM),neuronal growth regulator 1growth regulator 1,…

…growth regulator 1, (NEGR1) and secretogranin-3 (SCG3,)…

Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most common cancer in children and one of the success stories in cancer therapeutics. Risk-directed therapy based on clinical, biologic and genetic features has played a significant role in this accomplishment. Despite the observed improvement in survival rates, leukemia remains one of the leading causes of cancer-related deaths. Implementation of next-generation genomic and transcriptomic sequencing tools has illustrated the genomic landscape of ALL. However, the underlying dynamic changes at protein level still remain a challenge. Proteomics is a cutting-edge technology aimed at deciphering the mechanisms, pathways, and the degree to which the proteome impacts leukemia subtypes. Advances in mass spectrometry enable high-throughput collection of global proteomic profiles, representing an opportunity to unveil new biological markers and druggable targets. The purpose of this narrative review article is to provide a comprehensive overview of studies that have utilized applications of proteomics in an attempt to gain insight into the pathogenesis and identification of biomarkers in childhood ALL.

Also flagged:Hydroxyapatitedegenerative diseasesapatitesynthesiscalcium phosphatemineral
Journal Article 2023-08-24 No Snippets Radulescu DE, Vasile OR, Andronescu E, Ficai A.
Show Full Abstract

Bone tissue engineering has attracted great interest in the last few years, as the frequency of tissue-damaging or degenerative diseases has increased exponentially. To obtain an ideal treatment solution, researchers have focused on the development of optimum biomaterials to be applied for the enhancement of bioactivity and the regeneration process, which are necessary to support the proper healing process of osseous tissues. In this regard, hydroxyapatite (HA) has been the most widely used material in the biomedical field due to its great biocompatibility and similarity with the native apatite from the human bone. However, HA still presents some deficiencies related to its mechanical properties, which are essential for HA to be applied in load-bearing applications. Bioactivity is another vital property of HA and is necessary to further improve regeneration and antibacterial activity. These drawbacks can be solved by doping the material with trace elements, adapting the properties of the material, and, finally, sustaining bone regeneration without the occurrence of implant failure. Considering these aspects, in this review, we have presented some general information about HA properties, synthesis methods, applications, and the necessity for the addition of doping ions into its structure. Also, we have presented their influence on the properties of HA, as well as the latest applications of doped materials in the biomedical field.

SUDS3
Also flagged:Switch/sucrose non-fermentableSWI/SNFcell developmentchromatinorganizationSMARCA4
Journal Article 2023-08-24 ✓ 1 Snippet Tessier-Cloutier B.
In-Text Gene Mentions

…known as thepolycomb repressiverepressive complex […

Show Full Abstract

Dedifferentiated and undifferentiated endometrial and ovarian carcinomas (DDC/UDC) are aggressive malignancies defined by morphologic and molecular undifferentiation, and associated with core SWI/SNF deficiency. Their main differential diagnoses include high-grade endometrial and ovarian carcinomas that often show overlapping morphologic and molecular profiles. Loss of cell lineage markers expression by immunohistochemistry (IHC) is commonly used to assist diagnosis, but it has poor specificity, while core SWI/SNF deficiency is much more specific. Approximately half of SWI/SNF-deficient DDC/UDC are associated with loss of ARID1B expression, yet, unlike the other core SWI/SNF proteins (SMARCA4 and SMARCB1), this test is rarely available, even in tertiary centers. Mutational testing for ARID1B is increasingly common among targeted DNA sequencing panels, but it is difficult to interpret in the absence of IHC results. Overall, the importance of including ARID1B IHC as part of the routine panel for undifferentiated gynecologic malignancies should be emphasized, especially as SWI/SNF inactivation is becoming a necessary biomarker for diagnostics, clinical management, and clinical trial enrollment.

HTT
Also flagged:SeleniumNeurodegenerative DiseasepathogenesisMSamyotrophic lateral sclerosisAD
Journal Article 2023-08-24 ✓ 2 Snippets Zhou J, Zhang W, Cao Z, Lian S, Li J, Nie J, Huang Y, Zhao K, He J, Liu C.
In-Text Gene Mentions

HD, a dominantly inherited neurodegenerative disorder that results from the expansion of polyglutamine repeat in the huntingtin (HTT) gene [92].

…in the huntingtin (HTT) gene [ 92…

Show Full Abstract

<h4>Background</h4>Neurodegenerative diseases (NDs) have posed significant challenges to public health, and it is crucial to understand their mechanisms in order to develop effective therapeutic strategies. Recent studies have highlighted the potential role of selenium in ND pathogenesis, as it plays a vital role in maintaining cellular homeostasis and preventing oxidative damage. However, a comprehensive analysis of the association between selenium and NDs is still lacking.<h4>Method</h4>Five public databases, namely PubMed, Web of Science, EMBASE, Cochrane and Clinical Trials, were searched in our research. Random model effects were chosen, and Higgins inconsistency analyses (<i>I</i><sup>2</sup>), Cochrane's Q test and Tau2 were calculated to evaluate the heterogeneity.<h4>Result</h4>The association of selenium in ND patients with Alzheimer's disease (AD), Parkinson's disease (PD), multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS) and Huntington's disease (HD) was studied. A statistically significant relationship was only found for AD patients (SMD = -0.41, 95% CI (-0.64, -0.17), <i>p</i> < 0.001), especially for erythrocytes. However, no significant relationship was observed in the analysis of the other four diseases.<h4>Conclusion</h4>Generally, this meta-analysis indicated that AD patients are strongly associated with lower selenium concentrations compared with healthy people, which may provide a clinical reference in the future. However, more studies are urgently needed for further study and treatment of neurodegenerative diseases.

Also flagged:Biodegradationcardiovascular diseasescell adhesiontitaniumcobaltchromium
Journal Article 2023-08-24 No Snippets Oleksy M, Dynarowicz K, Aebisher D.
Show Full Abstract

The introduction of new materials for the production of various types of constructs that can connect directly to tissues has enabled the development of such fields of science as medicine, tissue, and regenerative engineering. The implementation of these types of materials, called biomaterials, has contributed to a significant improvement in the quality of human life in terms of health. This is due to the constantly growing availability of new implants, prostheses, tools, and surgical equipment, which, thanks to their specific features such as biocompatibility, appropriate mechanical properties, ease of sterilization, and high porosity, ensure an improvement of living. Biodegradation ensures, among other things, the ideal rate of development for regenerated tissue. Current tissue engineering and regenerative medicine strategies aim to restore the function of damaged tissues. The current gold standard is autografts (using the patient's tissue to accelerate healing), but limitations such as limited procurement of certain tissues, long operative time, and donor site morbidity have warranted the search for alternative options. The use of biomaterials for this purpose is an attractive option and the number of biomaterials being developed and tested is growing rapidly.

SERPINC1
Also flagged:nephrotic syndromecorticosteroidhypoalbuminemiasinovenous thrombosiscerebral sinovenous thrombosisNS
Journal Article 2023-08-24 ✓ 4 Snippets Konopásek P, Piteková B, Krejčová V, Zieg J.
In-Text Gene Mentions

…Decreased antithrombin III (ATIII) < 70% and…

…patients, while decreasedATIIIand elevated fibrinogen…

…antithrombotic proteins likeATIIIand PS are…

…> 6 g/L,ATIII< 70%) (…

Show Full Abstract

<h4>Aim</h4>The aim of this review is to provide clinicians with characteristics of children with nephrotic syndrome and cerebral sinovenous thrombosis (CSVT).<h4>Methods</h4>We have reviewed 37 articles of pediatric cases and provided 1 new case. PRISMA guidelines were followed.<h4>Results</h4>Sixty-two patients were included in the review. CSVT was more common in males, usually occurred within 6 months of nephrotic syndrome onset and was found more often in outpatients. The superior sagittal sinus was the most common sinus affected. Non-contrast computed tomography was the most frequent radiologic study performed, with 30% of results negative for CSVT. Headache and vomiting were the most common symptoms while neurologic symptoms were less frequent. Anticoagulation treatment was strongly inconsistent throughout the literature. Thrombosis outcomes were favorable. The most common possible risk factors were corticosteroid treatment, proteinuria and hypoalbuminemia. Four children had a genetic predisposition diagnosed after thrombosis. No markers for anticoagulation prophylaxis seemed to be relevant for the majority of thrombosis occurring in outpatients.<h4>Conclusion</h4>Prophylactic anticoagulation does not seem reasonable to prevent CSVT. Knowledge of nonspecific symptoms and of nephrotic syndrome being a state of hypercoagulation and early use of appropriate radiologic study seem to be of major importance.

TNFSF4
Also flagged:lactatemetabolismcolorectal cancertumorMPC1COQ2
Journal Article 2023-08-24 ✓ 1 Snippet Zhang E, Zhou X, Fan X, Li S, Ding C, Hong H, Aikemu B, Yang G, Yesseyeva G, Yang X, Ma J, Zheng M.
In-Text Gene Mentions

…IFNG, IL12B, CD274,TNFSF4, HAVCR2, PDCD1LG2, TNFSF18,…

Show Full Abstract

<b>Introduction:</b> Metabolic dysregulation is a widely acknowledged contributor for the development and tumorigenesis of colorectal cancer (CRC), highlighting the need for reliable prognostic biomarkers in this malignancy. <b>Methods:</b> Herein, we identified key genes relevant to CRC metabolism through a comprehensive analysis of lactate metabolism-related genes from GSEA MsigDB, employing univariate Cox regression analysis and random forest algorithms. Clinical prognostic analysis was performed following identification of three key genes, and consistent clustering enabled the classification of public datasets into three patterns with significant prognostic differences. The molecular pathways and tumor microenvironment (TME) of these patterns were then investigated through correlation analyses. Quantitative PCR was employed to quantify the mRNA expression levels of the three pivotal genes in CRC tissue. Single-cell RNA sequencing data and fluorescent multiplex immunohistochemistry were utilized to analyze relevant T cells and validate the correlation between key genes and CD4<sup>+</sup> T cells. <b>Results:</b> Our analysis revealed that MPC1, COQ2, and ADAMTS13 significantly stratify the cohort into three patterns with distinct prognoses. Additionally, the immune infiltration and molecular pathways were significantly different for each pattern. Among the key genes, MPC1 and COQ2 were positively associated with good prognosis, whereas ADAMTS13 was negatively associated with good prognosis. Single-cell RNA sequencing (scRNA-seq) data illustrated that the relationship between three key genes and T cells, which was further confirmed by the results of fluorescent multiplex immunohistochemistry demonstrating a positive correlation between MPC1 and COQ2 with CD4<sup>+</sup> T cells and a negative correlation between ADAMTS13 and CD4<sup>+</sup> T cells. <b>Discussion:</b> These findings suggest that the three key lactate metabolism genes, MPC1, COQ2, and ADAMTS13, may serve as effective prognostic biomarkers and support the link between lactate metabolism and the immune microenvironment in CRC.

PRDX6
Also flagged:PTCthyroid cancerbenign thyroid lesionoxygenglutathione peroxidasesuperoxide dismutase
Journal Article 2023-08-24 ✓ 5 Snippets Eng ZH, Abdul Aziz A, Ng KL, Mat Junit S.
In-Text Gene Mentions

(B) The relative expression of OGG1 and PRDX6 in PTC lesions against BTG lesions after normalisation to the β-actin expression.

(A) Western blot gel image of β-actin, OGG1 and PRDX6 in BTG lesions and PTC lesions of the patients.

Furthermore, peroxiredoxins (PRDXs), particularly PRDX1 and PRDX6, have been implicated in PTC tumourigenesis, highlighting their significance within the antioxidant enzyme system (Nicolussi et al., 2014).

Protein expression analysis of OGG1 and PRDX6 in the BTG and PTC lesions from six PTC patients through Western blotting.

…particularly PRDX1 andPRDX6, have been implicated…

Show Full Abstract

<b>Introduction:</b> Papillary thyroid cancer (PTC) accounts for approximately 80% of all thyroid cancer cases. The mechanism of PTC tumourigenesis is not fully understood, but oxidative imbalance is thought to play a role. To gain further insight, this study evaluated antioxidant status, DNA repair capacity and genetic alterations in individuals diagnosed with benign thyroid lesion in one lobe (BTG) and PTC lesion in another. <b>Methods:</b> Individuals with coexisting BTG and PTC lesions in their thyroid lobes were included in this study. Reactive oxygen species (ROS) level, ABTS radical scavenging activity, ferric reducing antioxidant capacity, glutathione peroxidase and superoxide dismutase activities were measured in the thyroid tissue lysate. The expression of selected genes and proteins associated with oxidative stress defence and DNA repair were analysed through quantitative real-time PCR and Western blotting. Molecular alterations in genomic DNA were analysed through whole-exome sequencing and the potentially pathogenic driver genes filtered through Cancer-Related Analysis of Variants Toolkit (CRAVAT) analysis were subjected to pathway enrichment analysis using Metascape. <b>Results:</b> Significantly higher ROS level was detected in the PTC compared to the BTG lesions. The PTC lesions had significantly higher expression of <i>GPX1</i>, <i>SOD2</i> and <i>OGG1</i> but significantly lower expression of <i>CAT</i> and <i>PRDX1</i> genes than the BTG lesions. Pathway enrichment analysis identified "regulation of MAPK cascade," "positive regulation of ERK1 and ERK2 cascade" and "negative regulation of reactive oxygen species metabolic process" to be significantly enriched in the PTC lesions only. Four pathogenic genetic variants were identified in the PTC lesions; <i>BRAF</i> <sup>V600E</sup>, <i>MAP2K7</i>-rs2145142862, <i>BCR</i>-rs372013175 and <i>CD24</i> NM_001291737.1:p.Gln23fs while <i>MAP3K9</i> and <i>G6PD</i> were among 11 genes that were mutated in both BTG and PTC lesions. <b>Conclusion:</b> Our findings provided further insight into the connection between oxidative stress, DNA damage, and genetic changes associated with BTG-to-PTC transformation. The increased oxidative DNA damage due to the heightened ROS levels could have heralded the BTG-to-PTC transformation, potentially through mutations in the genes involved in the MAPK signalling pathway and stress-activated MAPK/JNK cascade. Further <i>in-vitro</i> functional analyses and studies involving a larger sample size would need to be carried out to validate the findings from this pilot study.

DNAH10
Also flagged:behavioralreproductionsexualitydisorders of sex developmentDSDchromosome
Journal Article 2023-08-24 ✓ 1 Snippet Bragazzi NL, Converti M, Crapanzano A, Zerbetto R, Siri A, Khamisy-Farah R.
In-Text Gene Mentions

…5) rs7964186 atDNAH10(dynein, axonemal, heavy…

Show Full Abstract

Whether human sexuality is the result of nature or nurture (or their complex interplay) represents a hot, often ideologically driven, and highly polarized debate with political and social ramifications, and with varying, conflicting findings reported in the literature. A number of heritability and behavioral genetics studies, including pedigree-based investigations, have hypothesized inheritance patterns of human sexual behaviors. On the other hand, in most twin, adoption, and nuclear family studies, it was not possible to disentangle between underlying genetic and shared environmental sources. Furthermore, these studies were not able to estimate the precise extent of genetic loading and to shed light both on the number and nature of the putative inherited factors, which remained largely unknown. Molecular genetic studies offer an unprecedented opportunity to overcome these drawbacks, by dissecting the molecular basis of human sexuality and allowing a better understanding of its biological roots if any. However, there exists no systematic review of the molecular genetics of human sexuality. Therefore, we undertook this critical systematic review and appraisal of the literature, with the ambitious aims of filling in these gaps of knowledge, especially from the methodological standpoint, and providing guidance to future studies. Sixteen studies were finally retained and overviewed in the present systematic review study. Seven studies were linkage studies, four studies utilized the candidate gene approach, and five studies were GWAS investigations. Limitations of these studies and implications for further research are discussed.

Also flagged:Bicalcium Phosphatebone resorptionhydroxyapatite-tricalciumcalciumapatite
Journal Article 2023-08-24 No Snippets Maheshwari S, Taori T, Bajaj P, Reche A.
Show Full Abstract

After a loss of a tooth, alveolar bone resorption is immutable, leaving the area devoid of sufficient bone quality and mass for a successful and satisfactory implant or any other dental treatment. To treat this problem of irreversible bone loss, bone grafting is the primary solution and a well-accepted technique. The use of bone grafting procedures has increased in recent years. This review is about the various bone grafting techniques and best-situated material available currently along with their trump cards and limitations. In the thorough discussion regarding bone grafting materials and their substitutes, one alloplastic material has shown unbeaten and the most satisfactory properties than any other material, "bicalcium phosphate" (BCP). BCP is a mixture of hydroxyapatite (HA) and beta-tricalcium phosphate (B-TCP) usually obtained through sintering calcium-deficient apatite (CDA) at or above 700°C or by other methods such as hydrolysis or precipitation. The review also shows comparative studies done to understand the effect, most adequate balance, and impact of ratios of HA/B-TCP on the properties, structure, and success rate of this material. The objective of the review is to enlighten the principal characteristic of the most likely used bone graft material presently, i.e., BCP. The most impeccable characteristic of BCP is its capability to osteointegrate, which results in a superior interface. This interface depicts a dynamic process that includes physicochemical reactions, crystal-protein interactions, cell and tissue colonization, and bone remodeling. BCP has certain essential properties that could be put forth as its advantage over any other substitute. These properties include bioactivity, osteointegration, osteoinduction, osteogenesis, and biodegradation, which are mostly governed by modifying the HA/B-TCP ratio. Other applications of BCP are feasible, such as in drug administration and scaffolds for tissue engineering.

HTT
Also flagged:brain developmentneurodevelopmental disordersneurological disordersneurodegenerative disorderssuberoylanilide hydroxamic acidVorinostat
Journal Article 2023-08-24 ✓ 1 Snippet Verrillo L, Di Palma R, de Bellis A, Drongitis D, Miano MG.
In-Text Gene Mentions

Of particular interest are the results obtained in R6/2 mice, a model for Huntington’s disease (HD) with CAG repeat expansions in Huntingtin (HTT) gene, in which SAHA treatment reinstates transcriptional repression—via global histone acetylation [15]—and reduces HTT-expanded aggregates with the restoration of BDNF levels in the cortex [58].

Show Full Abstract

Neuroplasticity is a crucial property of the central nervous system to change its activity in response to intrinsic or extrinsic stimuli. This is mainly achieved through the promotion of changes in the epigenome. One of the epi-drivers priming this process is suberoylanilide hydroxamic acid (SAHA or Vorinostat), a pan-histone deacetylase inhibitor that modulates and promotes neuroplasticity in healthy and disease conditions. Knowledge of the specific molecular changes induced by this epidrug is an important area of neuro-epigenetics for the identification of new compounds to treat cognition impairment and/or epilepsy. In this review, we summarize the findings obtained in cellular and animal models of various brain disorders, highlighting the multiple mechanisms activated by SAHA, such as improvement of memory, learning and behavior, and correction of faulty neuronal functioning. Supporting this evidence, <i>in vitro</i> and <i>in vivo</i> data underline how SAHA positively regulates the expression of neuronal genes and microtubule dynamics, induces neurite outgrowth and spine density, and enhances synaptic transmission and potentiation. In particular, we outline studies regarding neurodevelopmental disorders with pharmaco-resistant seizures and/or severe cognitive impairment that to date lack effective drug treatments in which SAHA could ameliorate defective neuroplasticity.

SOX6
Also flagged:MAPKoxygencalciumneurodegenerationimmune responsechromosome
Journal Article 2023-08-24 ✓ 1 Snippet Feng J, Zhu W, Shi H, Peng D, Zang L, Wang Y, ZhaXi L, BaiMa J, Amevor FK, Wang X, Ma X, Zhao X.
In-Text Gene Mentions

…, PAR3 ,SOX6, GPC1 and…

Show Full Abstract

<h4>Background</h4>The Tibetan chicken has adapted well to high altitudes genetically after its long-term habitation in the plateau. In this study, we analyzed the selection signal of Tibetan black chickens (TBCs) and discovered genes associated with the characteristics of germplasm.<h4>Methods</h4>Whole-genome sequencing (WGS) was used to identify the single-nucleotide polymorphism (SNP) markers and genetic structures in the genome of Tibetan black chickens. Further, we performed a comparative population genomics analysis between the genomic data obtained in this present study and the genomic data for five wild red jungle fowls (RJFs) accessed from the NCBI database (GenBank accession number PRJNA241474). Thereafter, the Fst and <i>Pi</i> selections were used to identify genes under positive selection in the Tibetan black chicken genome.<h4>Results</h4>A total of 9,490,690 SNPs were identified in the Tibetan black chickens. In addition, the results from the gene ontology (GO) analysis showed that 732 genes of TBCs were enriched in a total of 210 GO terms with specific molecular functions such as regulation of cellular catabolic process, the MAPK signaling pathway, regulation of ion transport, growth, morphogenesis and lung alveolus development which may provide a better mechanism to facilitate oxygen transport and utilization in TBCs. Moreover, the results from the KEGG analysis showed that 732 genes of the TBCs were significantly enriched in the calcium signaling pathway, circadian entrainment (<i>ADCY1</i>, <i>GNG7</i> and <i>PER3</i>), oxytocin signaling pathway and pathways of multiple neurodegeneration diseases. In addition, the CD86 antigen (<i>CD86</i>) was identified as a gene associated with the immune response in chickens. It was also revealed that genes such as <i>TRIT1</i>, <i>HPCAL4</i>, <i>NT5C1A</i> and <i>HEYL</i> were discovered under selection in Tibetan black chickens on chromosome 23. These genes may be related to the local adaptive characteristics of Tibetan black chickens, for instance, <i>NT5C1A</i> and <i>HEYL</i> may be involved in the high-altitude adaption of oxygen delivery in Tibetan black chickens.<h4>Conclusions</h4>In summary, we found that selection mainly affects the disease resistance and cold acclimatization of Tibetan black chickens. Hence, these results may provide important genetic information for the evolution and breeding of Tibetan black chickens.

Also flagged:cytoplasmnucleoplasmribosomeProcessing bodiesmembraneribonucleoprotein
Journal Article 2023-08-24 No Snippets Wilby EL, Weil TT.
Show Full Abstract

<i>Drosophila</i> has been a premier model organism for over a century and many discoveries in flies have furthered our understanding of human disease. Flies have been successfully applied to many aspects of health-based research spanning from behavioural addiction, to dysplasia, to RNA dysregulation and protein misfolding. Recently, <i>Drosophila</i> tissues have been used to study biomolecular condensates and their role in multicellular systems. Identified in a wide range of plant and animal species, biomolecular condensates are dynamic, non-membrane-bound sub-compartments that have been observed and characterised in the cytoplasm and nuclei of many cell types. Condensate biology has exciting research prospects because of their diverse roles within cells, links to disease, and potential for therapeutics. In this review, we will discuss processing bodies (P bodies), a conserved biomolecular condensate, with a particular interest in how <i>Drosophila</i> can be applied to advance our understanding of condensate biogenesis and their role in disease.

NEGR1BTN3A3
Also flagged:Intervertebral disc degenerationextracellular matrixmetabolismnucleusimmune responseferroptosis
Journal Article 2023-08-24 ✓ 2 Snippets Li Y, Wang B, Sun W, Kong C, Ding J, Hu F, Li J, Chen X, Lu S.
In-Text Gene Mentions

…RUNX1T1, PAG1, OSCAR,BTN3A3, CCNT1, CCDC80, ACVR2A,…

…CCDC80, ACVR2A, RIF1,NEGR1, POU2AF1, DPP8, CXCL100),…

Show Full Abstract

<h4>Background</h4>Low back pain (LBP) is the main factor of global disease burden. Intervertebral disc degeneration (IVDD) has long been known as the leading reason of LBP. Increasing studies have verified that circular RNAs (circRNAs)-microRNAs (miRNAs)-mRNAs network is widely involved in the pathological processes of IVDD. However, no study was made to demonstrate the circRNAs-mediated ferroptosis, oxidative stress, extracellular matrix metabolism, and immune response in IVDD.<h4>Methods</h4>We collected 3 normal and 3 degenerative nucleus pulposus tissues to conduct RNA-sequencing to identify the key circRNAs and miRNAs in IVDD. Bioinformatics analysis was then conducted to construct circRNAs-miRNAs-mRNAs interaction network associated with ferroptosis, oxidative stress, extracellular matrix metabolism, and immune response. We also performed animal experiments to validate the therapeutic effects of key circRNAs in IVDD.<h4>Results</h4>We found that circ_0015435 was most obviously upregulated and circ_0071922 was most obviously downregulated in IVDD using RNA-sequencing. Then we observed that hsa-miR-15a-5p was the key downstream of circ_0071922, and hsa-miR-15a-5p was the top upregulated miRNA in IVDD. Bioinformatics analysis was conducted to predict that 56 immunity-related genes, 29 ferroptosis-related genes, 23 oxidative stress-related genes and 8 ECM-related genes are the targets mRNAs of hsa-miR-15a-5p. Then we constructed a ceRNA network encompassing 24 circRNAs, 6 miRNAs, and 101 mRNAs. Additionally, we demonstrated that overexpression of circ_0071922 can alleviate IVDD progression in a rat model.<h4>Conclusions</h4>The findings of this study suggested that circ_0071922-miR-15a-5p-mRNA signaling network might affect IVDD by modulating the nucleus pulposus cells ferroptosis, oxidative stress, ECM metabolism, and immune response, which is an effective therapeutic targets of IVDD.

Also flagged:anorexia nervosamental health disorderseating disordermental illnesscognitionsbehavioural
Journal Article 2023-08-23 No Snippets Zhu J, Hay PJ, Yang Y, Le Grange D, Lacey JH, Lujic S, Smith C, Touyz S.
Show Full Abstract

<h4>Background</h4>Anorexia nervosa is a psychological condition characterised by self-starvation and fear or wait gain or other body image disturbance. The first line of treatment is specific psychological therapy; however, there is no consensus on best practice for treating people who develop severe and enduring anorexia nervosa (SEAN). Notably, there is no universal definition of SEAN.<h4>Objectives</h4>To evaluate the benefits and harms of specific psychological therapies for severe and enduring anorexia nervosa compared with other specific therapies, non-specific therapies, no treatment/waiting list, antidepressant medication, dietary counselling alone, or treatment as usual.<h4>Search methods</h4>We used standard, extensive Cochrane search methods. The last search date was 22 July 2022.<h4>Selection criteria</h4>We included parallel randomised controlled trials (RCTs) of people (any age) with anorexia nervosa of at least three years' duration. Eligible experimental interventions were any specific psychological therapy for improved physical and psychological health in anorexia nervosa, conducted in any treatment setting with no restrictions in terms of number of sessions, modality, or duration of therapy. Eligible comparator interventions included any other specific psychological therapy for anorexia nervosa, non-specific psychological therapy for mental health disorders, no treatment or waiting list, antipsychotic treatment (with or without psychological therapy), antidepressant treatment (with or without psychological therapy), dietary counselling, and treatment as usual as defined by the individual trials.<h4>Data collection and analysis</h4>We used standard methodological procedures expected by Cochrane. Our primary outcomes were clinical improvement (weight restoration to within the normal weight range for participant sample) and treatment non-completion. Results were presented using the GRADE appraisal tool.<h4>Main results</h4>We found two eligible studies, but only one study provided usable data. This was a parallel-group RCT of 63 adults with SEAN who had an illness duration of at least seven years. The trial compared outpatient cognitive behaviour therapy for SEAN (CBT-SEAN) with specialist supportive clinical management for SEAN (SSCM-SE) over eight months. It is unclear if there is any difference between the effect of CBT-SEAN versus SSCM-SE on clinical improvement at 12 months (risk ratio (RR) 1.42, 95% confidence interval (CI) 0.66 to 3.05) or treatment non-completion (RR 1.72, 95% CI 0.45 to 6.59). There were no reported data on adverse effects. The trial was at high risk of performance and detection bias. We rated the GRADE level of evidence as very low-certainty for both primary outcomes, downgrading for imprecision and risk of bias concerns.<h4>Authors' conclusions</h4>This review reports evidence from one trial that evaluated CBT-SEAN versus SSCM-SE. There was very low-certainty evidence of little or no difference in clinical improvement and treatment non-completion between the two therapies. There is a need for larger high-quality trials to determine the benefits of specific psychological therapies for people with SEAN. These should take into account the duration of illness as well as participants' previous experience with evidence-based psychological therapy for anorexia nervosa.

Also flagged:spermatogenesisgene expressionGfra1ID4RetEomes
Journal Article 2023-08-23 No Snippets Wang Z, Jin C, Li P, Li Y, Tang J, Yu Z, Jiao T, Ou J, Wang H, Zou D, Li M, Mang X, Liu J, Lu Y, Li K, Zhang N, Yu J, Miao S, Wang L, Song W.
Show Full Abstract

In adult mammals, spermatogenesis embodies the complex developmental process from spermatogonial stem cells (SSCs) to spermatozoa. At the top of this developmental hierarchy lie a series of SSC subpopulations. Their individual identities as well as the relationships with each other, however, remain largely elusive. Using single-cell analysis and lineage tracing, we discovered both in mice and humans the quiescent adult SSC subpopulation marked specifically by forkhead box protein C2 (FOXC2). All spermatogenic progenies can be derived from FOXC2<sup>+</sup> SSCs and the ablation of FOXC2<sup>+</sup> SSCs led to the depletion of the undifferentiated spermatogonia pool. During germline regeneration, FOXC2<sup>+</sup> SSCs were activated and able to completely restore the process. Germ cell-specific <i>Foxc2</i> knockout resulted in an accelerated exhaustion of SSCs and eventually led to male infertility. Furthermore, FOXC2 prompts the expressions of negative regulators of cell cycle thereby ensures the SSCs reside in quiescence. Thus, this work proposes that the quiescent FOXC2<sup>+</sup> SSCs are essential for maintaining the homeostasis and regeneration of spermatogenesis in adult mammals.

Also flagged:colorectal cancertumorcancergastrointestinal tumorsneural growthtumors
Journal Article 2023-08-23 No Snippets Wang H, Huo R, He K, Cheng L, Zhang S, Yu M, Zhao W, Li H, Xue J.
Show Full Abstract

<h4>Background</h4>In recent years, the significance of the nervous system in the tumor microenvironment has gained increasing attention. The bidirectional communication between nerves and cancer cells plays a critical role in tumor initiation and progression. Perineural invasion (PNI) occurs when tumor cells invade the nerve sheath and/or encircle more than 33% of the nerve circumference. PNI is a common feature in various malignancies and is associated with tumor invasion, metastasis, cancer-related pain, and unfavorable clinical outcomes. The colon and rectum are highly innervated organs, and accumulating studies support PNI as a histopathologic feature of colorectal cancer (CRC). Therefore, it is essential to investigate the role of nerves in CRC and comprehend the mechanisms of PNI to impede tumor progression and improve patient survival.<h4>Conclusion</h4>This review elucidates the clinical significance of PNI, summarizes the underlying cellular and molecular mechanisms, introduces various experimental models suitable for studying PNI, and discusses the therapeutic potential of targeting this phenomenon. By delving into the intricate interactions between nerves and tumor cells, we hope this review can provide valuable insights for the future development of CRC treatments.

RC3H1
Also flagged:HistidinemethyltransferaseCARNMT1C3H zinc finger proteinscarnosine N-methyltransferase 1dipeptide
Journal Article 2023-08-23 ✓ 1 Snippet Shimazu T, Yoshimoto R, Kotoshiba K, Suzuki T, Matoba S, Hirose M, Akakabe M, Sohtome Y, Sodeoka M, Ogura A, Dohmae N, Shinkai Y.
In-Text Gene Mentions

…(also known asRC3H1), and Regnase-1 (also…

Show Full Abstract

Histidine (His) residues are methylated in various proteins, but their roles and regulation mechanisms remain unknown. Here, we show that carnosine N-methyltransferase 1 (CARNMT1), a known His methyltransferase of dipeptide carnosine (βAla-His), is a major His N1-position-specific methyltransferase. We found that 52 His sites in 20 proteins underwent CARNMT1-mediated methylation. The consensus methylation site for CARNMT1 was identified as Cx(F/Y)xH, a C3H zinc finger (C3H ZF) motif. CARNMT1-deficient and catalytically inactive mutant mice showed embryonic lethality. Among the CARNMT1 target C3H ZF proteins, RNA degradation mediated by Roquin and tristetraprolin (TTP) was affected by CARNMT1 and its enzymatic activity. Furthermore, the recognition of the 3' splice site of the CARNMT1 target C3H ZF protein U2AF1 was perturbed, and pre-mRNA alternative splicing (AS) was affected by CARNMT1 deficiency. These findings indicate that CARNMT1-mediated protein His methylation, which is essential for embryogenesis, plays roles in diverse aspects of RNA metabolism by targeting C3H ZF-type RNA-binding proteins and modulating their functions, including pre-mRNA AS and mRNA degradation regulation.

PEBP1
Also flagged:lipidmetabolic disordersendocannabinoidsbile acidssteroidsAD
Journal Article 2023-08-23 ✓ 5 Snippets Borkowski K, Seyfried NT, Arnold M, Lah JJ, Levey AI, Hales CM, Dammer EB, Blach C, Louie G, Kaddurah-Daouk R, Newman JW.
In-Text Gene Mentions

…and cell proliferation (PEBP1); and Cluster 3…

…PKM, ALDOA andPEBP1as most representative…

…and cell proliferation (PEBP1); Cluster 3, containing…

…cell proliferation regulatingPEBP1, all highly correlated…

…ycolysis, cell proliferation (PEBP1) and protection from…

Show Full Abstract

Integration of the omics data, including metabolomics and proteomics, provides a unique opportunity to search for new associations within metabolic disorders, including Alzheimer's disease. Using metabolomics, we have previously profiled oxylipins, endocannabinoids, bile acids, and steroids in 293 CSF and 202 matched plasma samples from AD cases and healthy controls and identified both central and peripheral markers of AD pathology within inflammation-regulating cytochrome p450/soluble epoxide hydrolase pathway. Additionally, using proteomics, we have identified five cerebrospinal fluid protein panels, involved in the regulation of energy metabolism, vasculature, myelin/oligodendrocyte, glia/inflammation, and synapses/neurons, affected in AD, and reflective of AD-related changes in the brain. In the current manuscript, using metabolomics-proteomics data integration, we describe new associations between peripheral and central lipid mediators, with the above-described CSF protein panels. Particularly strong associations were observed between cytochrome p450/soluble epoxide hydrolase metabolites, bile acids, and proteins involved in glycolysis, blood coagulation, and vascular inflammation and the regulators of extracellular matrix. Those metabolic associations were not observed at the gene-co-expression level in the central nervous system. In summary, this manuscript provides new information regarding Alzheimer's disease, linking both central and peripheral metabolism, and illustrates the necessity for the "omics" data integration to uncover associations beyond gene co-expression.

Also flagged:deathinfectionnecroptosisferroptosiscell deathcancer
Journal Article 2023-08-23 No Snippets Lee E, Song CH, Bae SJ, Ha KT, Karki R.
Show Full Abstract

Pyroptosis, apoptosis, necroptosis, and ferroptosis, which are the most well-studied regulated cell death (RCD) pathways, contribute to the clearance of infected or potentially neoplastic cells, highlighting their importance in homeostasis, host defense against pathogens, cancer, and a wide range of other pathologies. Although these four RCD pathways employ distinct molecular and cellular processes, emerging genetic and biochemical studies have suggested remarkable flexibility and crosstalk among them. The crosstalk among pyroptosis, apoptosis and necroptosis pathways is more evident in cellular responses to infection, which has led to the conceptualization of PANoptosis. In this review, we provide a brief overview of the molecular mechanisms of pyroptosis, apoptosis, necroptosis, and ferroptosis and their importance in maintaining homeostasis. We discuss the intricate crosstalk among these RCD pathways and the current evidence supporting PANoptosis, focusing on infectious diseases and cancer. Understanding the fundamental processes of various cell death pathways is crucial to inform the development of new therapeutics against many diseases, including infection, sterile inflammation, and cancer.

Also flagged:lipidmetabolismFerroptosisdeathironcardiovascular diseases
Journal Article 2023-08-23 No Snippets Kim JW, Lee JY, Oh M, Lee EW.
Show Full Abstract

Ferroptosis is a form of regulated cell death characterized by iron-dependent lipid peroxidation. This process contributes to cellular and tissue damage in various human diseases, such as cardiovascular diseases, neurodegeneration, liver disease, and cancer. Although polyunsaturated fatty acids (PUFAs) in membrane phospholipids are preferentially oxidized, saturated/monounsaturated fatty acids (SFAs/MUFAs) also influence lipid peroxidation and ferroptosis. In this review, we first explain how cells differentially synthesize SFA/MUFAs and PUFAs and how they control fatty acid pools via fatty acid uptake and β-oxidation, impacting ferroptosis. Furthermore, we discuss how fatty acids are stored in different lipids, such as diacyl or ether phospholipids with different head groups; triglycerides; and cholesterols. Moreover, we explain how these fatty acids are released from these molecules. In summary, we provide an integrated view of the diverse and dynamic metabolic processes in the context of ferroptosis by revisiting lipidomic studies. Thus, this review contributes to the development of therapeutic strategies for ferroptosis-related diseases.

Also flagged:microbial infectionssynthesis2-benzofuranylacetic acid amidesbenzofuranyl acetic acid amidesbenzofuranyl acetic acidpathogenesis
Journal Article 2023-08-23 No Snippets Mahecha-Mahecha C, Borrego-Muñoz P, Pombo LM, Gamba-Sánchez D.
Show Full Abstract

Crop losses caused by microbial infections are a significant global issue, especially in tropical regions. The development of novel antimicrobial agents, particularly antifungal agents, has been explored from various perspectives, including chemical synthesis. However, conventional approaches typically involve synthesizing new and potent compounds on a small scale (a few milligrams), making the scale-up of the reaction a major challenge. In this manuscript, we present a method for the synthesis of new and active (against <i>Fusarium oxysporum</i>) benzofuranyl acetic acid amides. Our strategy allows us to synthesize the key precursor on the gram scale, enabling the production of sufficient quantities of other active compounds within short timeframes for conducting biological studies. All the reactions used in this manuscript are recognized by their industrial application.

BTN2A2BTN2A1
Also flagged:BTNL3colon cancersCCpathogenesisimmune responses
Journal Article 2023-08-23 ✓ 5 Snippets Kim JW, Rim D, Ann CH, Lee SH.
In-Text Gene Mentions
⭐ same-sentence co-mention

Our study revered that butyrophilin family genes BTN2A1, BTN2A2, and BTNL3 harbored multiple levels of gene alterations at frameshift mutations, RHMs, and expression losses in CCs, suggesting that butyrophilin family genes could contribute to CC pathogenesis by altering immune responses.

In immunohistochemistry, BTNL3 expression was lost in approximately 30% of CCs, and BTN2A2 loss was minimal in CCs (around 3%) irrespective of the MSI status.

⭐ same-sentence co-mention

In the present study, we analyzed three butyrophilin genes, BTN2A1 (immune-stimulatory), BTN2A2 (inhibitory), and BTNL3 (stimulatory) genes in sporadic colon cancers (CCs).

⭐ same-sentence co-mention

…mutations of immunomodulatoryBTN2A1, BTN2A2, and BTNL3…

⭐ same-sentence co-mention

…of immunomodulatory BTN2A1,BTN2A2, and BTNL3 genes…

Show Full Abstract

The butyrophilin family genes are immunoregulatory genes with either immune stimulatory or inhibitory functions. In the present study, we analyzed three butyrophilin genes, BTN2A1 (immune-stimulatory), BTN2A2 (inhibitory), and BTNL3 (stimulatory) genes in sporadic colon cancers (CCs). By the mutation analysis, we identified the frameshift mutations of BTN2A1, BTN2A2, and BTNL3 genes in 2, 4, and 8 CCs in microsatellite instability-high (MSI-H) CCs (2.1-8.4% of MSI-H), respectively, but not the microsatellite stable (MSS) CCs. Four of 16 MSI-H CCs (25%) exhibited regional heterogeneous mutations (RHM) of BTN2A1, BTN2A2, and BTNL3 genes. In immunohistochemistry, BTNL3 expression was lost in approximately 30% of CCs, and BTN2A2 loss was minimal in CCs (around 3%) irrespective of the MSI status. Our study revered that butyrophilin family genes BTN2A1, BTN2A2, and BTNL3 harbored multiple levels of gene alterations at frameshift mutations, RHMs, and expression losses in CCs, suggesting that butyrophilin family genes could contribute to CC pathogenesis by altering immune responses.

SERPINC1
Also flagged:protein Cprotein Stissue factorfibrinogenprothrombinasethrombin
Journal Article 2023-08-23 ✓ 1 Snippet Li X, Song X, Mahmood DFD, Sim MMS, Bidarian SJ, Wood JP.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

<h4>Introduction</h4>Thrombin, the enzyme which converts fibrinogen into a fibrin clot, is produced by the prothrombinase complex, composed of factor Xa (FXa) and factor Va (FVa). Down-regulation of this process is critical, as excess thrombin can lead to life-threatening thrombotic events. FXa and FVa are inhibited by the anticoagulants tissue factor pathway inhibitor alpha (TFPIα) and activated protein C (APC), respectively, and their common cofactor protein S (PS). However, prothrombinase is resistant to either of these inhibitory systems in isolation.<h4>Materials and methods</h4>We hypothesized that these anticoagulants function best together, and tested this hypothesis using purified proteins and plasma-based systems.<h4>Results</h4>In plasma, TFPIα had greater anticoagulant activity in the presence of APC and PS, maximum PS activity required both TFPIα and APC, and antibodies against TFPI and APC had an additive procoagulant effect, which was mimicked by an antibody against PS alone. In purified protein systems, TFPIα dose-dependently inhibited thrombin activation by prothrombinase, but only in the presence of APC, and this activity was enhanced by PS. Conversely, FXa protected FVa from cleavage by APC, even in the presence of PS, and TFPIα reversed this protection. However, prothrombinase assembled on platelets was still protected from inhibition, even in the presence of TFPIα, APC, and PS.<h4>Conclusions</h4>We propose a model of prothrombinase inhibition through combined targeting of both FXa and FVa, and that this mechanism enables down-regulation of thrombin activation outside of a platelet clot. Platelets protect prothrombinase from inhibition, however, supporting a procoagulant environment within the clot.

Also flagged:carbon fixationasthmainflammatory bowel diseasedegradationnitrogenallergies
Journal Article 2023-08-23 No Snippets Katagiri S, Ohsugi Y, Shiba T, Yoshimi K, Nakagawa K, Nagasawa Y, Uchida A, Liu A, Lin P, Tsukahara Y, Iwata T, Tohara H.
Show Full Abstract

Enteral nutrition for children is supplied through nasogastric or gastrostomy tubes. Diet not only influences nutritional intake but also interacts with the composition and function of the gut microbiota. Homemade blenderized tube feeding has been administered to children receiving enteral nutrition, in addition to ready-made tube feeding. The purpose of this study was to evaluate the oral/gut microbial communities in children receiving enteral nutrition with or without homemade blenderized tube feeding. Among a total of 30 children, 6 receiving mainly ready-made tube feeding (RTF) and 5 receiving mainly homemade blenderized tube feeding (HBTF) were analyzed in this study. Oral and gut microbiota community profiles were evaluated through 16S rRNA sequencing of saliva and fecal samples. The α-diversity representing the number of observed features, Shannon index, and Chao1 in the gut were significantly increased in HBTF only in the gut microbiome but not in the oral microbiome. In addition, the relative abundances of the phylum <i>Proteobacteria</i>, class <i>Gammaproteobacteria</i>, and genus <i>Escherichia-Shigella</i> were significantly low, whereas that of the genus <i>Ruminococcus</i> was significantly high in the gut of children with HBTF, indicating HBTF altered the gut microbial composition and reducing health risks. Metagenome prediction showed enrichment of carbon fixation pathways in prokaryotes at oral and gut microbiomes in children receiving HBTF. In addition, more complex network structures were observed in the oral cavity and gut in the HBTF group than in the RTF group. In conclusion, HBTF not only provides satisfaction and enjoyment during meals with the family but also alters the gut microbial composition to a healthy state.

CCPG1
Also flagged:Src family kinaseSrc family kinasesLckLynlymphocyte developmentkinases
Journal Article 2023-08-23 ✓ 1 Snippet Koutras N, Morfos V, Konnaris K, Kouvela A, Shaukat AN, Stathopoulos C, Stamatopoulou V, Nika K.
In-Text Gene Mentions

…agy receptors RETREG1/FAM134B,CCPG1and CALCOCO1 and…

Show Full Abstract

The Src family kinases (SFKs) Lck and Lyn are crucial for lymphocyte development and function. Albeit tissue-restricted expression patterns the two kinases share common functions; the most pronounced one being the phosphorylation of ITAM motifs in the cytoplasmic tails of antigenic receptors. Lck is predominantly expressed in T lymphocytes; however, it can be ectopically found in B-1 cell subsets and numerous pathologies including acute and chronic B-cell leukemias. The exact impact of Lck on the B-cell signaling apparatus remains enigmatic and is followed by the long-lasting question of mechanisms granting selectivity among SFK members. In this work we sought to investigate the mechanistic basis of ectopic Lck function in B-cells and compare it to events elicited by the predominant B-cell SFK, Lyn. Our results reveal substrate promiscuity displayed by the two SFKs, which however, is buffered by their differential susceptibility toward regulatory mechanisms, revealing a so far unappreciated aspect of SFK member-specific fine-tuning. Furthermore, we show that Lck- and Lyn-generated signals suffice to induce transcriptome alterations, reminiscent of B-cell activation, in the absence of receptor/co-receptor engagement. Finally, our analyses revealed a yet unrecognized role of SFKs in tipping the balance of cellular stress responses, by promoting the onset of ER-phagy, an as yet completely uncharacterized process in B lymphocytes.

Also flagged:ubiquitin
Journal Article 2023-08-23 No Snippets Fletcher AJ, Mabbitt PD.
Show Full Abstract

No abstract available.

Also flagged:LHhCGluteinizing hormoneovulationRunx2Egfr
Journal Article 2023-08-23 No Snippets Chakravarthi VP, Hung WT, Yellapu NK, Gunewardena S, Christenson LK.
Show Full Abstract

Ovarian follicles undergo a series of dynamic changes following the ovulatory surge of luteinizing hormone including cumulus expansion, oocyte maturation, ovulation, and luteinization. Post-transcriptional gene regulatory events are critical for mediating LH follicular responses, and among all RNA isoforms, circular RNA (circRNA) is one of the most abundant forms present in cells, yet they remain the least studied. Functionally, circRNA can act as miRNA sponges, protein sponges/decoys, and regulators of transcription and translation. In the context of ovarian follicular development, the identity and roles of circRNA are relatively unknown. In the present study, high throughput RNA sequencing of granulosa cells immediately prior to and 4-h after the LH/hCG surge identified 42,381 circRNA originating from 7712 genes. A total of 54 circRNA were identified as differentially expressed between 0-h and 4-h time points (Fold Change ± 1.5, FDR ≤ 0.1), among them 42 circRNA were upregulated and 12 circRNA were downregulated. All differentially expressed circRNA between the 0-h and 4-h groups were subjected to circinteractome analysis and identified networks of circRNA-protein and circRNA-miRNA were further subjected to "micro-RNA target filter analysis" in Ingenuity Pathway Analyses, which resulted in the identification of miRNA targeted mRNAs. A comparison of these circRNA target mRNAs with LH-induced mRNAs identified Runx2, Egfr, Areg, Sult1el, Cyp19a1, Cyp11a1, and Hsd17b1 as targets of circKif2, circVcan, circMast4, and circMIIt10. These newly identified LH/hCG-induced circRNA, their target miRNA and protein networks provide new insights into the complex interactions associated with periovulatory follicular development.

Also flagged:FLHSmetabolismlipidflavonoidsphenolsobesity
Journal Article 2023-08-23 No Snippets Chen F, Huang J, Zhao N, Jin F, Fan Q, Du E, Wei J.
Show Full Abstract

Fatty liver hemorrhagic syndrome (FLHS) is the most common metabolic disease in laying hens. Morus alba L. (mulberry) leaf has the effect of regulating lipid metabolism. We evaluated the effects of dietary 3% mulberry leaf (MUL) supplementation in production performance, egg quality, and liver lipid deposition in laying hens. Differentially expressed genes and circRNAs in the liver were identified using whole-transcriptome sequencing. We also evaluated the effects of the MUL extract using an in vitro model of primary hepatocytes induced by free fatty acids and explored the role of key circRNAs in this process. Dietary supplementation with 3% MUL alleviated liver steatosis in laying hens, as shown by decreased fatty liver color score, relative liver weight (P < 0.01), and triglyceride levels (P < 0.05), and showed a tendency to reduce the mortality rate of laying hens (P = 0.09). In addition, mulberry leaf supplementation significantly reduced cholesterol content in egg yolk (P < 0.01). Dietary mulberry leaf supplementation downregulated the expression of genes involved in fatty acid and cholesterol biosynthesis, and upregulated the expression of fatty acid oxidation-related genes in the liver. CircACACA, which is derived from exons 2 and 3 of the acetyl-CoA carboxylase alpha (ACACA) pre-mRNA, was significantly reduced in the MUL group (P < 0.01). Upregulation of circACACA expression reversed the lipid-lowering effect of mulberry leaf extract by upregulating sterol regulatory element-binding proteins 1 c (SREBP-1c) and fatty acid synthase (FASN) (P < 0.05). Overall, mulberry leaf is an effective therapeutic strategy for FLHS in hens and can improve liver lipid metabolism by downregulating circACACA.

TNFSF4
Also flagged:Oclacitinibrhabdomyosarcomassoft tissue sarcomassarcomacancersoft tissue sarcoma
Journal Article 2023-08-23 ✓ 1 Snippet Ashton LV, Weishaar KM, Séguin B, MacNeill AL.
In-Text Gene Mentions

…IFNα7,TNFSF4, TNFSF13, IL-1β, and…

Show Full Abstract

Human rhabdomyosarcomas are rarely cured by surgical resection alone. This is also true for high-grade soft tissue sarcomas in dogs. Dogs with spontaneous sarcoma are good models for clinical responses to new cancer therapies. Strategic combinations of immunotherapy and oncolytic virotherapy (OV) could improve treatment responses in canine and human cancer patients. To develop an appropriate combination of immunotherapy and OV for dogs with soft tissue sarcoma (STS), canine cancer cells were inoculated with myxoma viruses (MYXVs) and gene transcripts were quantified. Next, the cytokine concentrations in the canine cancer cells were altered to evaluate their effect on MYXV replication. These studies indicated that, as in murine and human cells, type I interferons (IFN) play an important role in limiting MYXV replication in canine cancer cells. To reduce type I IFN production during OV, oclacitinib (a JAK1 inhibitor) was administered twice daily to dogs for 14 days starting ~7 days prior to surgery. STS tumors were excised, and MYXV deleted for serp2 (MYXV∆SERP2) was administered at the surgical site at two time points post-operatively to treat any remaining microscopic tumor cells. Tumor regrowth in dogs treated with OV was decreased relative to historical controls. However, regrowth was not further inhibited in patients given combination therapy.

SOX6ZNFX1
Also flagged:esophageal squamous cell carcinomaESCCalcoholtumorSUMO1 Pseudogene 3polymerase
Journal Article 2023-08-23 ✓ 4 Snippets Zhang T, Yue G, Tian X, Xu Y, Li Z.
In-Text Gene Mentions

Specifically, lncRNA ZNFX1 Antisense RNA 1 (ZFAS1) has been discovered to bind with miR-124 to elevate expression of signal transducer and activator of transcription 3 (STAT3), thus exacerbating ESCC cell malignant behaviors [7].

Moreover, lncRNA prostate androgen regulated transcript 1 (PART1) was claimed to suppress ESCC cell proliferation and invasion via miR-18a-5p/SRY-box transcription factor 6 (SOX6) axis 【33432363】.

…Specifically, lncRNAZNFX1 Antisense RNA 1Antisense RNA 1…

…transcription factor 6 (SOX6) axis 【33432363】.…

Show Full Abstract

<h4>Background</h4>Esophageal squamous cell carcinoma (ESCC) is a malignancy usually associated with smoking or alcohol consumption. The involvement of long noncoding RNAs (lncRNAs) in the regulation of tumor development and metastasis through molecular mechanisms has been unveiled by accumulating evidence. However, the function of lncRNA SUMO1 Pseudogene 3 (lncSUMO1P3) essential to ESCC development remains obscure.<h4>Methods</h4>Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) and Western blot (WB) analysis were done to measure RNA and protein levels. Functional assays were carried out to examine the changes in ESCC cell phenotype. Supported by bioinformatics analysis, mechanism assays were done for assessment of putative interactions among different genes.<h4>Results</h4>LlncSUMO1P3 was aberrantly up-regulated in ESCC cell lines, and lncSUMO1P3 deficiency could hamper cell proliferation, migration and invasion as well as epithelial-mesenchymaltransition (EMT) in ESCC while lncSUMO1P3 overexpression led to the opposite consequences. LncSUMO1P3 could competitively bind to microRNA-486-5p (miR-486-5p) or PHD finger protein 8 (PHF8) to modulate CD151 expression. CD151 was also verified to regulate ESCC cell biological behaviors.<h4>Conclusion</h4>Our study revealed that lncSUMO1P3, up-regulated in ESCC cells, could sponge miR-486-5p and recruit PHF8 to up-regulate CD151, thus influencing the malignant behaviors of ESCC cells.

SERPINC1
Also flagged:infectionCOVID-19immune responseISG15C-X-C motif chemokine ligand 10CXCL10
Journal Article 2023-08-23 ✓ 1 Snippet Mizuno H, Murakami N.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

<h4>Purpose of review</h4>Multi-omics approach has advanced our knowledge on transplantation-associated clinical outcomes, such as acute rejection and infection, and emerging omics data are becoming available in kidney transplant and COVID-19. Herein, we discuss updated findings of multi-omics data on kidney transplant outcomes, as well as COVID-19 and kidney transplant.<h4>Recent findings</h4>Transcriptomics, proteomics, and metabolomics revealed various inflammation pathways associated with kidney transplantation-related outcomes and COVID-19. Although multi-omics data on kidney transplant and COVID-19 is limited, activation of innate immune pathways and suppression of adaptive immune pathways were observed in the active phase of COVID-19 in kidney transplant recipients.<h4>Summary</h4>Multi-omics analysis has led us to a deeper exploration and a more comprehensive understanding of key biological pathways in complex clinical settings, such as kidney transplantation and COVID-19. Future multi-omics analysis leveraging multi-center biobank collaborative will further advance our knowledge on the precise immunological responses to allograft and emerging pathogens.

bioRxiv 2023-08-23 Preprint (No Snippets API) Jacobson DH, Pan S, Fisher J, Secrier M.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Background</h4> Homologous recombination is a robust, broadly error-free mechanism of double strand break repair, and deficiencies cause reliance on alternative repair processes, leading to sensitivity to PARP inhibitors. Patients displaying homologous recombination deficiency can be identified using ‘mutational signatures’. However, these patterns are difficult to reliably infer from exome sequencing. Additionally, as mutational signatures are a historical record of mutagenic processes, this limits their utility in describing the current status of a tumour. <h4>Results</h4> Here, we apply two methods for classifying homologous recombination deficiency in breast cancer to explore the features and heterogeneity associated with this phenotype. Firstly, we apply a likelihood-based method which leverages small insertions and deletions to improve classification of homologous recombination deficiency in exome sequenced breast cancers. We find that whilst BRCA+ homologous recombination deficient samples display strong similarities to those harbouring BRCA defects, they deviate in microenvironmental features such as hypoxic signalling. Secondly, using this classification we develop a 228-gene transcriptional signature which simultaneously characterises homologous recombination deficiency and BRCA1/2-defect status, and is linked with PARP inhibitor response. Finally, we apply this signature to single-cell RNA-sequenced breast cancer cohorts to study homologous recombination deficiency at single cell resolution and demonstrate that these cells present a distinct milieu of interactions with immune cells in their microenvironment compared to their HR proficient counterparts, which could inform checkpoint blockade for HRD tumours. <h4>Conclusions</h4> We apply multi-scale approaches to characterise homologous recombination deficiency in breast cancer through the development of mutational and transcriptional signatures. We show that indels, even at low levels, can improve homologous recombination deficiency classification. Additionally, we demonstrate the heterogeneity of homologous recombination deficiency, especially in relation to BRCA status, and show that indications of this feature can be captured at a single-cell level, enabling further investigations into interactions between DNA repair deficient cells and their tumour microenvironment.

Research Square 2023-08-23 Preprint (No Snippets API) Wang L, Chen K, Wu W, Ding J, Zhou Y, Wan L, Wang X, Zhang Z.
Show Full Abstract

<h4>Background: </h4> Targeted therapy plays an important role in the treatment of breast cancer. However, more biomarkers are still needed to distinguish breast cancer subgroups and further achieve precise targeted therapy. <h4>Methods: </h4> This study analyzed the mutation database of breast cancer and found the gene DNAH10 with high mutation frequency and significant impact on prognosis. The differential genes between the DNAH10 mutant group and the wild-type group were further analyzed, and independent prognostic factors were identified from them. <h4>Results: </h4> A prognostic model was established based on CCL8, FLT3, KLHDC7B, DCD, and GBP2 genes. This model divides breast cancer patients into high-risk group and low-risk group, which has a good predictive value for the prognosis of patients. In addition, analysis of tumor immune microenvironment infiltration revealed that memory B cells, CD8 + T cells, monocytes had higher infiltration scores in the low-risk group than in the high-risk group. And both MHC I and MHC II were higher in the low-risk group. It is suggested that the low-risk group may respond better to immunotherapy. Different DNAH10 copy number variants were also associated with tumor immune microenvironment infiltration. It was further verified by in vitro experiments that DNAH10 mutation promoted tumor proliferation, invasion and migration. <h4>Conclusion: </h4> Our predictive model may be an effective tool for precise diagnosis and treatment of breast cancer, helping to select populations susceptible to chemotherapy and immunotherapy.

TNFSF4
Also flagged:Panscleroticpathogenesistype II IFNIFN-γTGF-βCXCL9
Journal Article 2023-08-22 ✓ 2 Snippets Xing E, Ma F, Wasikowski R, Billi AC, Gharaee-Kermani M, Fox J, Dobry C, Victory A, Sarkar MK, Xing X, Plazyo O, Chen HW, Barber G, Jacobe H, Tsou PS, Modlin RL, Varga J, Kahlenberg JM, Tsoi LC, Gudjonsson JE, Khanna D.
In-Text Gene Mentions

…via IL7 ,TNFSF4, TNFSF12 ,…

…including IL7 ,TNFSF4, TNFSF12 ,…

Show Full Abstract

Pansclerotic morphea (PSM) is a rare, devastating disease characterized by extensive soft tissue fibrosis, secondary contractions, and significant morbidity. PSM pathogenesis is unknown, and aggressive immunosuppressive treatments rarely slow disease progression. We aimed to characterize molecular mechanisms driving PSM and to identify therapeutically targetable pathways by performing single-cell and spatial RNA-Seq on 7 healthy controls and on lesional and nonlesional skin biopsies of a patient with PSM 12 months apart. We then validated our findings using immunostaining and in vitro approaches. Fibrotic skin was characterized by prominent type II IFN response, accompanied by infiltrating myeloid cells, B cells, and T cells, which were the main IFN-γ source. We identified unique CXCL9+ fibroblasts enriched in PSM, characterized by increased chemokine expression, including CXCL9, CXCL10, and CCL2. CXCL9+ fibroblasts were related to profibrotic COL8A1+ myofibroblasts, which had enriched TGF-β response. In vitro, TGF-β and IFN-γ synergistically increased CXCL9 and CXCL10 expression, contributing to the perpetuation of IFN-γ responses. Furthermore, cell-to-cell interaction analyses revealed cDC2B DCs as a key communication hub between CXCL9+ fibroblasts and COL8A1+ myofibroblasts. These results define PSM as an inflammation-driven condition centered on type II IFN responses. This work identified key pathogenic circuits between T cells, cDC2Bs, and myofibroblasts, and it suggests that JAK1/2 inhibition is a potential therapeutic option in PSM.

PTGIS
Also flagged:extracellularmyogenesiscollagen Ifibronectinlaminintranslational
Journal Article 2023-08-22 ✓ 2 Snippets Chan AHP, Jain I, Oropeza BP, Zhou T, Nelsen B, Geisse NA, Huang NF.
In-Text Gene Mentions

In agreement with higher myogenesis on collagen I, the gene set enrichment analysis showed downregulation of categories associated with cell cycle, compared to laminin, as withdrawal from cell cycle is required for myogenesis (Fig. 2D).29Since prostaglandin E2, notch, and PPARG (peroxisome proliferator activated receptor gamma) are also important myogenesis pathway genes, we observed that collagen I shows significant upregulation in a subset of genes from these pathways such as Pparg, Ppargc1a, Igf1, Ptgis, Jag1 compared to C + F + L under static conditions.30–33

…, Igf1 ,Ptgis, Jag1 compared…

Show Full Abstract

Skeletal muscle regeneration remains a clinical unmet need for volumetric muscle loss and atrophy where muscle function cannot be restored to prior capacity. Current experimental approaches do not account for the complex microenvironmental factors that modulate myogenesis. In this study we developed a biomimetic tissue chip platform to systematically study the combined effects of the extracellular matrix (ECM) microenvironment and mechanical strain on myogenesis of murine myoblasts. Using stretchable tissue chips composed of collagen I (C), fibronectin (F) and laminin (L), as well as their combinations thereof, we tested the addition of mechanical strain regimens on myogenesis at the transcriptomic and translational levels. Our results show that ECMs have a significant effect on myotube formation in C2C12 murine myoblasts. Under static conditions, laminin substrates induced the longest myotubes, whereas fibronectin produced the widest myotubes. Combinatorial ECMs showed non-intuitive effects on myotube formation. Genome-wide analysis revealed the upregulation in actin cytoskeletal related genes that are suggestive of myogenesis. When mechanical strain was introduced to C + F + L combinatorial ECM substrates in the form of constant or intermittent uniaxial strain at low (5%) and high (15%) levels, we observed synergistic enhancements in myotube width, along with transcriptomic upregulation in myosin heavy chain genes. Together, these studies highlight the complex role of microenvironmental factors such as ECM interactions and strain on myotube formation and the underlying signaling pathways.

Also flagged:Butyratemethacrylamidebutyryl esterphenyl estermannosylcytokine
Journal Article 2023-08-22 No Snippets Lauterbach AL, Slezak AJ, Wang R, Cao S, Raczy MM, Watkins EA, Jimenez CJM, Hubbell JA.
Show Full Abstract

Butyrate is a key bacterial metabolite that plays an important and complex role in modulation of immunity and maintenance of epithelial barriers. Its translation to clinic is limited by poor bioavailability, pungent smell, and the need for high doses, and effective delivery strategies have yet to realize clinical potential. Here, a novel polymeric delivery platform for tunable and sustainable release of butyrate consisting of a methacrylamide backbone with butyryl ester or phenyl ester side chains as well as mannosyl side chains, which is also applicable to other therapeutically relevant metabolites is reported. This platform's utility in the treatment of non-healing diabetic wounds is explored. This butyrate-containing material modulated immune cell activation in vitro and induced striking changes in the milieu of soluble cytokine and chemokine signals present within the diabetic wound microenvironment in vivo. This novel therapy shows efficacy in the treatment of non-healing wounds through the modulation of the soluble signals present within the wound, and importantly accommodates the critical temporal regulation associated with the wound healing process. Currently, the few therapies to address non-healing wounds demonstrate limited efficacy. This novel platform is positioned to address this large unmet clinical need and improve the closure of otherwise non-healing wounds.

Also flagged:congenital diaphragmatic herniapulmonary hypertensiongene expressionvitamin AcoagulationTNF-alpha
Journal Article 2023-08-22 No Snippets Lingappan K, Olutoye OO, Cantu A, Cantu Gutierrez ME, Cortes-Santiago N, Hammond JD, Gilley J, Quintero JR, Li H, Polverino F, Gleghorn JP, Keswani SG.
Show Full Abstract

Abnormal pulmonary vascular development and function in congenital diaphragmatic hernia (CDH) is a significant factor leading to pulmonary hypertension. The lung is a very heterogenous organ and has marked cellular diversity that is differentially responsive to injury and therapeutic agents. Spatial transcriptomics provides the unmatched capability of discerning the differences in the transcriptional signature of these distinct cell subpopulations in the lung with regional specificity. We hypothesized that the distal lung parenchyma (selected as a region of interest) would show a distinct transcriptomic profile in the CDH lung compared with control (normal lung). We subjected lung sections obtained from male and female CDH and control neonates to spatial transcriptomics using the Nanostring GeoMx platform. Spatial transcriptomic analysis of the human CDH and control lung revealed key differences in the gene expression signature. Increased expression of alveolar epithelial-related genes (<i>SFTPA1</i> and <i>SFTPC</i>) and angiogenesis-related genes (<i>EPAS1</i> and <i>FHL1</i>) was seen in control lungs compared with CDH lungs. Response to vitamin A was enriched in the control lungs as opposed to abnormality of the coagulation cascade and TNF-alpha signaling via NF-kappa B in the CDH lung parenchyma. In male patients with CDH, higher expression of <i>COL1A1</i> (ECM remodeling) and CD163 was seen. Increased type 2 alveolar epithelial cells (AT-2) and arterial and lung capillary endothelial cells were seen in control lung samples compared with CDH lung samples. To the best of our knowledge, this is the first use of spatial transcriptomics in patients with CDH that identifies the contribution of different lung cellular subpopulations in CDH pathophysiology and highlights sex-specific differences.<b>NEW & NOTEWORTHY</b> This is the first use of spatial transcriptomics in patients with congenital diaphragmatic hernia (CDH) that identifies the contribution of different lung cellular subpopulations in CDH pathophysiology and highlights sex-specific differences.

CA10
Also flagged:methylationcervical precancercancercervical intraepithelial neoplasiaCINcervical cancer
Journal Article 2023-08-22 ✓ 2 Snippets El-Zein M, Cheishvili D, Szyf M, Franco EL.
In-Text Gene Mentions

CA10, DPP10, FMN2 and HAS1 (discovery set: 54 normal, 50 CIN1, 40 CIN2, 42 CIN3) were evaluated by targeted bisulfite next generation sequencing (NGS) (Illumina MiSeq platform) in 258 (training set: 100 normal, 50 CIN1, 50 CIN2, 50 CIN3, 8 cancers) and 373 (validation set: 100 normal, 57 CIN1, 61 CIN2, 53 CIN3, 102 cancers) physician-collected samples (PreservCyt).

CA10, DPP10, FMN2 and…

Show Full Abstract

We have recently identified, using a genome-wide approach, new methylation markers which were evaluated among various cervical intraepithelial neoplasia (CIN) grades and cervical cancer. We herein validate the methylated state of these genes in independent study populations, based on histology ascertained outcomes regardless of human papillomavirus status. CA10, DPP10, FMN2 and HAS1 (discovery set: 54 normal, 50 CIN1, 40 CIN2, 42 CIN3) were evaluated by targeted bisulfite next generation sequencing (NGS) (Illumina MiSeq platform) in 258 (training set: 100 normal, 50 CIN1, 50 CIN2, 50 CIN3, 8 cancers) and 373 (validation set: 100 normal, 57 CIN1, 61 CIN2, 53 CIN3, 102 cancers) physician-collected samples (PreservCyt). Using targeted amplification NGS data from the training set for 94 normal and eight cancer samples, we calculated for each gene the median methylation value. These were summed and normalized to compute a four-gene Marker Polygenic Score (MPS). We compared the relationship between MPS and progression from normal through CIN grades and cancer, separately in the training and validation sets, and tested its clinical performance via receiver-operating characteristic curves. MPS increased with increasing CIN grade, and accurately predicted cervical cancer in the training (area under the curve, AUC = 0.9950) and validation (AUC = 0.9337) sets, comparing normal to cancer. Using the highest threshold of 100% specificity, sensitivity for detection of cervical cancer was 67.7%; whereas reducing specificity to 95% increased sensitivity to 84.3%. Further evaluation of these biomarkers is warranted in prospective studies.

Also flagged:Lyme diseaseburgdorferi infectioninfectionLyme borreliosisvector-borne diseaseospC
Journal Article 2023-08-22 No Snippets Zinck CB, Raveendram Thampy P, Uhlemann EE, Adam H, Wachter J, Suchan D, Cameron ADS, Rego ROM, Brisson D, Bouchard C, Ogden NH, Voordouw MJ.
Show Full Abstract

Pathogen life history theory assumes a positive relationship between pathogen load in host tissues and pathogen transmission. Empirical evidence for this relationship is surprisingly rare due to the difficulty of measuring transmission for many pathogens. The comparative method, where a common host is experimentally infected with a set of pathogen strains, is a powerful approach for investigating the relationships between pathogen load and transmission. The validity of such experimental estimates of strain-specific transmission is greatly enhanced if they can predict the pathogen population strain structure in nature. Borrelia burgdorferi is a multi-strain, tick-borne spirochete that causes Lyme disease in North America. This study used 11 field-collected strains of B. burgdorferi, a rodent host (Mus musculus, C3H/HeJ) and its tick vector (Ixodes scapularis) to determine the relationship between pathogen load in host tissues and lifetime host-to-tick transmission (HTT). Mice were experimentally infected via tick bite with 1 of 11 strains. Lifetime HTT was measured by infesting mice with I. scapularis larval ticks on 3 separate occasions. The prevalence and abundance of the strains in the mouse tissues and the ticks were determined by qPCR. We used published databases to obtain estimates of the frequencies of these strains in wild I. scapularis tick populations. Spirochete loads in ticks and lifetime HTT varied significantly among the 11 strains of B. burgdorferi. Strains with higher spirochete loads in the host tissues were more likely to infect feeding larval ticks, which molted into nymphal ticks that had a higher probability of B. burgdorferi infection (i.e., higher HTT). Our laboratory-based estimates of lifetime HTT were predictive of the frequencies of these strains in wild I. scapularis populations. For B. burgdorferi, the strains that establish high abundance in host tissues and that have high lifetime transmission are the strains that are most common in nature.

OLFM4
Also flagged:transcription factorschromatinAntimicrobialpeptidesbile acid dependent transcription factorsBile acids
Journal Article 2023-08-22 ✓ 1 Snippet Wang Y, Yu Y, Li L, Zheng M, Zhou J, Gong H, Feng B, Wang X, Meng X, Cui Y, Xia Y, Chu S, Lin L, Chang H, Zhou R, Ma M, Li Z, Ji R, Lu M, Yang X, Zuo X, Li S, Li Y.
In-Text Gene Mentions

…immature enterocytes (OLFM4, DMBT1 )…

Show Full Abstract

Antimicrobial peptides (AMPs) are important mediators of intestinal immune surveillance. However, the regional heterogeneity of AMPs and its regulatory mechanisms remain obscure. Here, we clarified the regional heterogeneity of intestinal AMPs at the single-cell level, and revealed a cross-lineages AMP regulation mechanism that bile acid dependent transcription factors (BATFs), NR1H4, NR1H3 and VDR, regulate AMPs through a ligand-independent manner. Bile acids regulate AMPs by perturbing cell differentiation rather than activating BATFs signaling. Chromatin accessibility determines the potential of BATFs to regulate AMPs at the pre-transcriptional level, thus shaping the regional heterogeneity of AMPs. The BATFs-AMPs axis also participates in the establishment of intestinal antimicrobial barriers of fetuses and the defects of antibacterial ability during Crohn's disease. Overall, BATFs and chromatin accessibility play essential roles in shaping the regional heterogeneity of AMPs at pre- and postnatal stages, as well as in maintenance of antimicrobial immunity during homeostasis and disease.

KLHL20
Also flagged:USP5Atg1degradationubiquitinproteasomeautophagy
Journal Article 2023-08-22 ✓ 1 Snippet Pai YL, Lin YJ, Peng WH, Huang LT, Chou HY, Wang CH, Chien CT, Chen GC.
In-Text Gene Mentions

…the NEDD4L and Cul3-KLHL20ubiquitin ligases ubiquitylate…

Show Full Abstract

Accumulating evidence has shown that the quality of proteins must be tightly monitored and controlled to maintain cellular proteostasis. Misfolded proteins and protein aggregates are targeted for degradation through the ubiquitin proteasome (UPS) and autophagy-lysosome systems. The ubiquitination and deubiquitinating enzymes (DUBs) have been reported to play pivotal roles in the regulation of the UPS system. However, the function of DUBs in the regulation of autophagy remain to be elucidated. In this study, we found that knockdown of Leon/USP5 caused a marked increase in the formation of autophagosomes and autophagic flux under well-fed conditions. Genetic analysis revealed that overexpression of Leon suppressed Atg1-induced cell death in Drosophila. Immunoblotting assays further showed a strong interaction between Leon/USP5 and the autophagy initiating kinase Atg1/ULK1. Depletion of Leon/USP5 led to increased levels of Atg1/ULK1. Our findings indicate that Leon/USP5 is an autophagic DUB that interacts with Atg1/ULK1, negatively regulating the autophagic process.

HFE
Also flagged:Type 2 diabetes mellitusdiabetesType 2 DiabetesT1DMinsulinglucose
Journal Article 2023-08-22 ✓ 1 Snippet Ordoñez-Guillen NE, Gonzalez-Compean JL, Lopez-Arevalo I, Contreras-Murillo M, Aldana-Bobadilla E.
In-Text Gene Mentions

…cystic fibrosis, andhemochromatosis) [ 30 ].…

Show Full Abstract

<h4>Purpose</h4>Data-driven diabetes research has increased its interest in exploring the heterogeneity of the disease, aiming to support in the development of more specific prognoses and treatments within the so-called precision medicine. Recently, one of these studies found five diabetes subgroups with varying risks of complications and treatment responses. Here, we tackle the development and assessment of different models for classifying Type 2 Diabetes (T2DM) subtypes through machine learning approaches, with the aim of providing a performance comparison and new insights on the matter.<h4>Methods</h4>We developed a three-stage methodology starting with the preprocessing of public databases NHANES (USA) and ENSANUT (Mexico) to construct a dataset with N = 10,077 adult diabetes patient records. We used N = 2,768 records for training/validation of models and left the remaining (N = 7,309) for testing. In the second stage, groups of observations -each one representing a T2DM subtype- were identified. We tested different clustering techniques and strategies and validated them by using internal and external clustering indices; obtaining two annotated datasets Dset A and Dset B. In the third stage, we developed different classification models assaying four algorithms, seven input-data schemes, and two validation settings on each annotated dataset. We also tested the obtained models using a majority-vote approach for classifying unseen patient records in the hold-out dataset.<h4>Results</h4>From the independently obtained bootstrap validation for Dset A and Dset B, mean accuracies across all seven data schemes were [Formula: see text] ([Formula: see text]) and [Formula: see text] ([Formula: see text]), respectively. Best accuracies were [Formula: see text] and [Formula: see text]. Both validation setting results were consistent. For the hold-out dataset, results were consonant with most of those obtained in the literature in terms of class proportions.<h4>Conclusion</h4>The development of machine learning systems for the classification of diabetes subtypes constitutes an important task to support physicians for fast and timely decision-making. We expect to deploy this methodology in a data analysis platform to conduct studies for identifying T2DM subtypes in patient records from hospitals.

Also flagged:venous thromboembolismvenous thrombosisprotein CPROCTHBDreproduction
Journal Article 2023-08-22 No Snippets Liu C, Hou J, Li W, Chen J, Li Y, Zhang J, Zhou W, Zhang W, Deng F, Wang Y, Chen L, Qin S, Meng X, Lu S.
Show Full Abstract

<h4>Background</h4>Venous thromboembolism (VTE) has both environmental and genetic risk factors. It is regulated by polygenes and multisites. The polygenic risk score (PRS) has been widely used because any single genetic biomarker failed to accurately predict the genetic risk of VTE. However, no polygenic risk model has been proposed for VTE in the Chinese population. Thus, we aimed to construct a PRS model for the first episode of VTE in the Chinese population.<h4>Methods</h4>First, single nucleotide polymorphisms (SNPs) associated with VTE in genome-wide association studies, meta-analyses, and candidate gene studies were screened as variables for the PRS. The logarithm of the odds ratio was used to weight the variables. Second, a training set with simulated data from 1000 cases of VTE and 1000 controls was created with different genotypes and frequencies. Finally, we calculated the area under the receiver operating characteristic curve (AUC) to evaluate the discriminatory ability of the PRS model.<h4>Results</h4>We screened 53 SNPs potentially associated with the first episode of VTE in the Chinese population. The AUC of the PRS-53 model (containing 53 SNPs) was 0.748 (95% confidence interval, 0.727-0.770) in the training set. From the largest weight to the smallest weight, SNPs were incrementally added to the model to calculate the AUC for model optimization. The AUC of the PRS-10 model (containing 10 SNPs) was 0.718 (95% confidence interval, 0.696-0.740), with no statistically significant difference from the AUC for the PRS-53 model.<h4>Conclusions</h4>The PRS-10 and PRS-53 models showed similar predictive abilities and satisfactory discriminatory power and can be used to predict the genetic risk of the first episode of VTE in the Chinese population. The simplified PRS-10 model is more efficient in clinical practice.

Also flagged:Dimethylsulfoxideethylene glycoltype I and III collagengene expressionC-kitBax
Journal Article 2023-08-22 No Snippets Gomes FDR, Ñaupas LVS, Palomino GJQ, Celiz RHY, Sá NAR, Novaes MAS, Ferreira ACA, Brito DCC, Freitas VJF, Costa BN, Lucci CM, Fernandes CCL, Rondina D, Figueiredo JR, Tetaping GM, Rodrigues APR.
Show Full Abstract

This study aims to define the best method (slow freezing or vitrification) and fragment size (1, 5, or 9 mm³) for prepubertal goat testis cryopreservation, as well as to evaluate testicular morphological integrity after cryopreservation and in vitro culture (IVC). Initially (experiment I), 1, 5, or 9 mm³ testis fragments were cryopreserved by slow freezing using a Mr. Frosty container with 20% Dimethylsulfoxide (DMSO) or vitrified using the Ovarian Tissue Cryosystem (OTC) device, (Equilibration solution - ES: 10% DMSO and 10% ethylene glycol - EG; Vitrification solution - VS: 20% DMSO and 20% EG) and then subjected to morphological analysis, type I and III collagen quantification and gene expression (Oct4, C-kit, Bax, and Bcl-2). Subsequently, (experiment II), fresh or cryopreserved by slow freezing testis fragments were cultured in vitro and submitted to morphological analysis by scanning electron microscopy. The data from the experiment I revealed fewer morphological alterations in 1 and 5 mm³ fragments after vitrification and slow freezing, respectively. The percentage of type I collagen fibers in 5 and 9 mm³ frozen was higher than in fresh or vitrified fragments. For type III collagen, fresh or frozen fragments of 1 and 5 mm<sup>3</sup> showed a higher percentage than fragments of 9 mm<sup>3</sup>. Gene expression for Oct4 and C-kit after slow freezing or vitrification in the 5 mm<sup>3</sup> fragments was lower than that observed in the fresh fragments. The Bax:Bcl-2 ratio in the 1 and 9 mm³ fragments was lower than in the 5 mm³ fragments for fresh fragments or after freezing. In experiment II, fragments cultured in vitro, previously frozen or not, showed more morphological alterations than fresh or frozen fragments. We concluded that slow freezing of 5 mm³ fragments was the best protocol for cryopreserving prepubertal goat testis and although the results of IVC are encouraging, it still needs improvement to restore testicular function after cryopreservation.

Also flagged:RAGENADPH oxidasefluorosisfluoridewaterhydrogen
Journal Article 2023-08-22 No Snippets Ma YL, Deng J, Zhang T, Li HM, Liang QZ, Zhang KL.
Show Full Abstract

This investigation was designed to examine the potential involvement of RAGE/NADPH oxidase signaling in the damage to the brain caused by chronic fluorosis. Sprague-Dawley rats were divided randomly into 9 groups each containing 20 animals, Controls (C); rats receiving low (i.e., 10 ppm) (LF) or high does ( i.e., 50 ppm) (HF) of fluoride in their drinking water; and these same groups injected with FPS-ZM1, an inhibitor of RAGE, (CF, LFF and HFF, respectively) or administered EGb761, an active ingredient of Ginkgo biloba extract, intragastrically (CE, LFE, and HFE). Following 3 and 6 months of such treatment, the spatial learning and memory of the animals were assessed with the Morris water maze test; the levels of malondialdehyde (MDA), hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) and superoxide dismutase (SOD) assayed by biochemical methods; and the levels of proteins related to the RAGE/NADPH pathway determined by Western blot and of the corresponding mRNAs by qPCR. After 6 months, the spatial learning and memory of the LF and HF groups had declined; their brain contents of MDA and H<sub>2</sub>O<sub>2</sub> increased and SOD activity decreased; and the levels of the RAGE, gp91, P47, phospho-P47phox and P22 proteins and corresponding mRNAs in their brains were all elevated. Interestingly, all of these pathological changes caused by fluorosis could be attenuated by both FPS-ZM1 and EGb761. These findings indicate that the brain damage induced by fluorosis may be caused, at least in part, by enhanced RAGE/NADPH oxidase signaling and that FPS-ZM1 or EGb761 might be of clinical value in connection with the treatment of this condition.

Also flagged:CRISPR-Cas ribonucleoproteinsCRISPR-CasphotosynthesisCRISPRCasbasal bodies
Journal Article 2023-08-22 No Snippets Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G.
Show Full Abstract

CRISPR-Cas genome engineering in the unicellular green algal model <i>Chlamydomonas reinhardtii</i> has until now been primarily applied to targeted gene disruption, whereas scarless knockin transgenesis has generally been considered difficult in practice. We have developed an efficient homology-directed method for knockin mutagenesis in Chlamydomonas by delivering CRISPR-Cas ribonucleoproteins and a linear double-stranded DNA (dsDNA) donor into cells by electroporation. Our method allows scarless integration of fusion tags and sequence modifications of proteins without the need for a preceding mutant line. We also present methods for high-throughput crossing of transformants and a custom quantitative PCR (qPCR)-based high-throughput screening of mutants as well as meiotic progeny. We demonstrate how to use this pipeline to facilitate the generation of mutant lines without residual selectable markers by co-targeted insertion. Finally, we describe how insertional cassettes can be erroneously mutated during insertion and suggest strategies to select for lines that are modified as designed.

Also flagged:cancerbicyclic diterpenoidssynthesisent -halimic acidethyl acetate
Journal Article 2023-08-22 No Snippets Roncero AM, Tobal IE, Moro RF, Diez D, Marcos IS.
Show Full Abstract

The development of new anti-cancer agents is an urgent necessity nowadays, as it is one of the major causes of mortality worldwide. Many drugs currently used are derived from natural products. Halimanes are a class of bicyclic diterpenoids present in various plants and microorganisms. Many of them exhibit biological activities such as antitumor, antimicrobial, or anti-inflammatory. Among them, <i>ent</i>-halimic acid is an easily accessible compound, in large quantities, from the ethyl acetate extract of the plant <i>Halimium viscosum</i>, and it has been used as a starting material in a number of bioactive molecules. In this work, we review all the natural halimanes with antitumor and related activities until date as well as the synthesis of antitumor compounds using <i>ent</i>-halimic acid as a starting material.

HFE
Also flagged:non-alcoholic fatty liver diseaseNAFLDtype 2 diabetes mellitusdiabetestriglyceridescholesterol
Journal Article 2023-08-22 ✓ 1 Snippet Salavatizadeh M, Soltanieh S, Ataei Kachouei A, Abdollahi Fallahi Z, Kord-Varkaneh H, Poustchi H, Mansour A, Khamseh ME, Alaei-Shahmiri F, Santos HO, Hekmatdoost A.
In-Text Gene Mentions

…Wilson’s disease) andhemochromatosis, and using toxins…

Show Full Abstract

<h4>Objective</h4>Managing dietary glycemic index (GI) deserves further attention in the interplay between non-alcoholic fatty liver disease (NAFLD) and type 2 diabetes mellitus (T2DM). This study aimed to evaluate the relationship between dietary GI and the odds of NAFLD in patients with T2DM.<h4>Methods</h4>A cross-sectional study was carried out between April 2021 and February 2022, including 200 participants with T2DM aged 18-70 years, of which 133 had NAFLD and 67 were in the non-NAFLD group. Cardiometabolic parameters were analyzed using standard biochemical kits and dietary intake was assessed using a validated food frequency questionnaire. Binary logistic regression was applied to explore odds ratios (ORs) and 95% confidence intervals (CIs) for NAFLD according to tertiles of dietary GI.<h4>Results</h4>Highest vs. lowest tertile (< 57 vs. > 60.89) of energy-adjusted GI was not associated with the odds of having NAFLD (OR 1.25, 95% CI = 0.6-2.57; P-trend = 0.54) in the crude model. However, there was an OR of 3.24 (95% CI = 1.03-10.15) accompanied by a significant trend (P-trend = 0.04) after full control for potential confounders (age, gender, smoking status, duration of diabetes, physical activity, waist circumference, HbA1c, triglycerides, total cholesterol, dietary intake of total carbohydrates, simple carbohydrates, fat, and protein).<h4>Conclusion</h4>High dietary GI is associated with increased odds of NAFLD in subjects with T2DM. However, interventional and longitudinal cohort studies are required to confirm these findings.

HFE
Also flagged:immune responsecancerlymphocyte migrationcomplement activationextracellular matrix-relatedcollagen
Journal Article 2023-08-22 ✓ 1 Snippet Jafari N, Gheitasi R, Khorasani HR, Golpour M, Mehri M, Nayeri K, Pourbagher R, Mostafazadeh M, Kalali B, Mostafazadeh A.
In-Text Gene Mentions

…included HLA-B ,HFE, A2M ,…

Show Full Abstract

Emerging evidence indicates that fibroblasts play pivotal roles in immunoregulation by producing various proteins under health and disease states. In the present study, for the first time, we compared the proteomes of serum-starved human skin fibroblasts and peripheral blood mononuclear cells (PBMCs) using Nano-LC-ESI-tandem mass spectrometry. This analysis contributes to a better understanding of the underlying molecular mechanisms of chronic inflammation and cancer, which are intrinsically accompanied by growth factor deficiency.The proteomes of starved fibroblasts and PBMCs consisted of 307 and 294 proteins, respectively, which are involved in lymphocyte migration, complement activation, inflammation, acute phase response, and immune regulation. Starved fibroblasts predominantly produced extracellular matrix-related proteins such as collagen/collagenase, while PBMCs produced focal adhesion-related proteins like beta-parvin and vinculin which are involved in lymphocyte migration. PBMCs produced a more diverse set of inflammatory molecules like heat shock proteins, while fibroblasts produced human leukocytes antigen-G and -E that are known as main immunomodulatory molecules. Fifty-four proteins were commonly found in both proteomes, including serum albumin, amyloid-beta, heat shock cognate 71 kDa, and complement C3. GeneMANIA bioinformatic tool predicted 418 functions for PBMCs, including reactive oxygen species metabolic processes and 241 functions for starved fibroblasts such as antigen processing and presentation including non-classical MHC -Ib pathway, and negative regulation of the immune response. Protein-protein interactions network analysis indicated the immunosuppressive function for starved fibroblasts-derived human leucocytes antigen-G and -E. Moreover, in an <i>in vitro</i> model of allogeneic transplantation, the immunosuppressive activity of starved fibroblasts was experimentally documented.<h4>Conclusion</h4>Under serum starvation-induced metabolic stress, both PBMCs and fibroblasts produced molecules like heat shock proteins and amyloid-beta, which can have pathogenic roles in auto-inflammatory diseases such as rheumatoid arthritis, type 1 diabetes mellitus, systemic lupus erythematosus, aging, and cancer. However, starved fibroblasts showed immunosuppressive activity in an <i>in vitro</i> model of allogeneic transplantation, suggesting their potential to modify such adverse reactions by down-regulating the immune system.

HTT
Also flagged:Neurodegenerative DiseasesdeathmitochondrialpathogenesisMitochondriaadenosine triphosphate
Journal Article 2023-08-22 ✓ 1 Snippet Grel H, Woznica D, Ratajczak K, Kalwarczyk E, Anchimowicz J, Switlik W, Olejnik P, Zielonka P, Stobiecka M, Jakiela S.
In-Text Gene Mentions

HD is caused by an abnormal expansion of CAG repeats in the huntingtin gene (HTT) [23].

Show Full Abstract

Neurodegenerative diseases (NDs) are a diverse group of disorders characterized by the progressive degeneration and death of neurons, leading to a range of neurological symptoms. Despite the heterogeneity of these conditions, a common denominator is the implication of mitochondrial dysfunction in their pathogenesis. Mitochondria play a crucial role in creating biomolecules, providing energy through adenosine triphosphate (ATP) generated by oxidative phosphorylation (OXPHOS), and producing reactive oxygen species (ROS). When they're not functioning correctly, becoming fragmented and losing their membrane potential, they contribute to these diseases. In this review, we explore how mitochondria fuse and undergo fission, especially in the context of NDs. We discuss the genetic and protein mutations linked to these diseases and how they impact mitochondrial dynamics. We also look at the key regulatory proteins in fusion (MFN1, MFN2, and OPA1) and fission (DRP1 and FIS1), including their post-translational modifications. Furthermore, we highlight potential drugs that can influence mitochondrial dynamics. By unpacking these complex processes, we aim to direct research towards treatments that can improve life quality for people with these challenging conditions.

HTT
Also flagged:Huntingtin Interacting Proteinshuntingtin-associated protein 1HAP1HIP1HDproteasome
Journal Article 2023-08-22 ✓ 5 Snippets Liu L, Tong H, Sun Y, Chen X, Yang T, Zhou G, Li XJ, Li S.
In-Text Gene Mentions

It would be interesting to conduct a comprehensive study on HAP1 and HTT using a relevant HD model, such as the HD knock-in pig model [106], or a more precise monkey HD model that can replicate the selective neuropathology observed in human patients.

HYPK binds to the first 17 amino acids of the N-terminus of HTT (HTT-N17), inhibiting the formation of mHtt aggregates and reducing neuronal cell death caused by mHtt [71,72].

The primary cause of HD is the CAG expansion mutation of the huntingtin (HTT) gene, which is located on chromosome 4p16 in humans, resulting in the clinical manifestation of HD [1].

Most of the HTT-interacting proteins were found in mouse or cell models of HD.

The amino acid sequence of HTT contains significant post-translational modification sites, such as ubiquitination/sumoylation, phosphorylation, palmitoylation, acetylation, and proteolysis [14].

Show Full Abstract

Huntington's disease (HD) is caused by an expansion of a CAG repeat in the gene that encodes the huntingtin protein (HTT). The exact function of HTT is still not fully understood, and previous studies have mainly focused on identifying proteins that interact with HTT to gain insights into its function. Numerous HTT-interacting proteins have been discovered, shedding light on the functions and structure of HTT. Most of these proteins interact with the N-terminal region of HTT. Among the various HTT-interacting proteins, huntingtin-associated protein 1 (HAP1) and HTT-interacting protein 1 (HIP1) have been extensively studied. Recent research has uncovered differences in the distribution of HAP1 in monkey and human brains compared with mice. This finding suggests that there may be species-specific variations in the regulation and function of HTT-interacting proteins. Understanding these differences could provide crucial insights into the development of HD. In this review, we will focus on the recent advancements in the study of HTT-interacting proteins, with particular attention to the differential distributions of HTT and HAP1 in larger animal models.

NEGR1
Also flagged:Cardiovascular Diseasescoronary heart diseasestrokeheart failureatrial fibrillationAF
Journal Article 2023-08-22 ✓ 2 Snippets Feng Q, Grant AJ, Yang Q, Burgess S, Bešević J, Conroy M, Omiyale W, Sun Y, Allen N, Lacey B.
In-Text Gene Mentions

The mechanisms were possibly additionally mediated by their expression in and/or regulation of lipid metabolism (rs17714824 [EBF1, FABP6], rs33947258 [PCDH1], rs12190945 [ME1], rs78940216 [DPYSLS], rs17075255 [MAT2B], rs11608727 [MVK]) and protein and/or glucose metabolism (rs6975898 [FOXK1], rs11209780 [NEGR1], rs57221424 [DPY19L2], rs6079589 [MACROD2]).

…[FOXK1] , rs11209780 [NEGR1] , rs57221424 [DPY19L2]…

Show Full Abstract

<h4>Background</h4>The associations between vegetable intake and cardiovascular diseases have been demonstrated in observational studies, but less sufficiently in randomized trials. Mendelian randomization has been considered a promising alternative in causal inference. The separate effects of cooked and raw vegetable intake remain unclear. This study aimed to investigate the associations between cooked and raw vegetable intake with cardiovascular outcomes using MR.<h4>Methods</h4>We identified 15 and 28 genetic variants statistically and biologically associated with cooked and raw vegetable intake, respectively, from previous genome-wide association studies, which were used as instrumental variables to estimate associations with coronary heart disease (CHD), stroke, heart failure (HF), and atrial fibrillation (AF). The independent effects of genetically predicted cooked and raw vegetable intake were examined using multivariable MR analysis. We performed one-sample and two-sample MR analyses and combined their results using meta-analysis. Bonferroni correction was applied for multiple comparisons. We performed two-sample MR analysis for cardiometabolic risk factors (serum lipids, blood pressure, body mass index, and glycemic traits) to explore the potential mechanisms.<h4>Results</h4>In the MR meta-analysis of 1.2 million participants, we found null evidence for associations between genetically predicted cooked and raw vegetable intake with CHD, HF, or AF. Raw vegetable intake was nominally associated with stroke (odds ratio [95% confidence interval] 0.82 [0.69-0.98] per 1 daily serving increase, <i>p</i> = 0.03), but this association did not pass the corrected significance level. We found consistently null evidence for associations with serum lipids, blood pressure, body mass index, or glycemic traits.<h4>Conclusions</h4>We found null evidence for associations between genetically predicted vegetable intake with CHD, AF, HF, or cardiometabolic risk factors in this MR study. Raw vegetable intake may reduce risk of stroke, but this warrants more research. True associations between vegetable intake and CVDs cannot be completely ruled out, and future investigations are required for causal inference in nutritional research.

bioRxiv 2023-08-22 Preprint (No Snippets API) Huber A, Jose S, Kassam A, Weghorn KN, Powers-Fletcher M, Sharma D, Mukherjee A, Mathew A, Kulkarni N, Chandramouli S, Alder MN, Madan R.
Show Full Abstract

Neutrophils are key first responders to Clostridioides difficile infection (CDI). Excessive tissue and blood neutrophils are associated with worse histopathology and adverse outcomes, however their functional role during CDI remains poorly defined. Utilizing intestinal epithelial cell (IEC)-neutrophil co-cultures and a pre-clinical animal model of CDI, we show that neutrophils exacerbate C. difficile -induced IEC injury. We utilized cutting-edge single-cell transcriptomics to illuminate neutrophil subtypes and biological pathways that could exacerbate CDI-associated IEC damage. As such, we have established the first transcriptomics atlas of bone marrow (BM), blood, and colonic neutrophils after CDI. We found that CDI altered the developmental trajectory of BM and blood neutrophils towards populations that exhibit gene signatures associated with pro-inflammatory responses and neutrophil-mediated tissue damage. Similarly, the transcriptomic signature of colonic neutrophils was consistent with hyper-inflammatory and highly differentiated cells that had amplified expression of cytokine-mediated signaling and degranulation priming genes. One of the top 10 variable features in colonic neutrophils was the gene for neutrophil glycoprotein, Olfactomedin 4 (OLFM4). CDI enhanced OLFM4 mRNA and protein expression in neutrophils, and OLFM4 + cells aggregated to areas of severe IEC damage. Compared to uninfected controls, both humans and mice with CDI had higher concentrations of circulating OLFM4; and in mice, OLFM4 deficiency resulted in faster recovery and better survival after infection. Collectively, these studies provide novel insights into neutrophil-mediated pathology after CDI and highlight the pathogenic role of OLFM4 + neutrophils in regulating CDI-induced IEC damage. <h4>One Sentence Summary</h4> Utilizing single-cell transcriptomics, IEC-epithelial co-cultures, and pre-clinical models of CDI, we have identified a subset of neutrophils that are marked by OLFM4 expression as pathogenic determinants of IEC barrier damage after CDI.

POU3F2
Also flagged:SWI/SNFcell proliferationtranscription factorscell-cycleneuralembryogenesis
Journal Article 2023-08-21 ✓ 3 Snippets Ovadia S, Cui G, Elkon R, Cohen-Gulkar M, Zuk-Bar N, Tuoc T, Jing N, Ashery-Padan R.
In-Text Gene Mentions

…, Ascl1 ,Pou3f2), axonogenesis, and…

…, Onecut2 andPou3f2– were upregulated…

…the proneural genesPou3f2and Ngn2 ,…

Show Full Abstract

During embryonic development, tissue-specific transcription factors and chromatin remodelers function together to ensure gradual, coordinated differentiation of multiple lineages. Here, we define this regulatory interplay in the developing retinal pigmented epithelium (RPE), a neuroectodermal lineage essential for the development, function and maintenance of the adjacent retina. We present a high-resolution spatial transcriptomic atlas of the developing mouse RPE and the adjacent ocular mesenchyme obtained by geographical position sequencing (Geo-seq) of a single developmental stage of the eye that encompasses young and more mature ocular progenitors. These transcriptomic data, available online, reveal the key transcription factors and their gene regulatory networks during RPE and ocular mesenchyme differentiation. Moreover, conditional inactivation followed by Geo-seq revealed that this differentiation program is dependent on the activity of SWI/SNF complexes, shown here to control the expression and activity of RPE transcription factors and, at the same time, inhibit neural progenitor and cell proliferation genes. The findings reveal the roles of the SWI/SNF complexes in controlling the intersection between RPE and neural cell fates and the coupling of cell-cycle exit and differentiation.

Also flagged:synthesisglycoconjugatescarbohydratescarboncarbohydratephenyl
Journal Article 2023-08-21 No Snippets Wu J, Jia P, Kuniyil R, Liu P, Tang W.
Show Full Abstract

Chemical synthesis of glycoconjugates is essential for studying the biological functions of carbohydrates. We herein report an efficient approach for the stereoselective synthesis of challenging α-linked glycoconjugates via a Rh<sup>II</sup> /chiral phosphoric acid (CPA)-cocatalyzed dynamic kinetic anomeric O-alkylation of sugar-derived lactols via carbenoid insertion to the anomeric OH bond. Notably, we observed excellent anomeric selectivity, excellent diastereoselectivity, broad substrate scope, and high efficiency for this glycosylation reaction by exploring various parameters of the cocatalytic system. DFT calculations suggested that the anomeric selectivity was mainly determined by steric interactions between the C2-carbon of the carbohydrate and the phenyl group of the metal carbenoid, while π/π interactions with the C2-OBn substituent on the carbohydrate substrate play a significant role for diastereoselectivity at the newly generated stereogenic center.

PEBP1
Also flagged:respiratory-related diseasesCHglutamate receptorinterleukin-1ßgene expressionimmune response
Journal Article 2023-08-21 ✓ 1 Snippet Grams KJ, Neumueller SE, Mouradian GC, Burgraff NJ, Hodges MR, Pan L, Forster HV.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Chronic hypercapnia (CH) is a hallmark of respiratory-related diseases, and the level of hypercapnia can acutely or progressively become more severe. Previously, we have shown time-dependent adaptations in steady-state physiology during mild (arterial Pco<sub>2</sub> ∼55 mmHg) and moderate (∼60 mmHg) CH in adult goats, including transient (mild CH) or sustained (moderate CH) suppression of acute chemosensitivity suggesting limitations in adaptive respiratory control mechanisms as the level of CH increases. Changes in specific markers of glutamate receptor plasticity, interleukin-1ß, and serotonergic modulation within key nodes of cardiorespiratory control do not fully account for the physiological adaptations to CH. Here, we used an unbiased approach (bulk tissue RNA sequencing) to test the hypothesis that mild or moderate CH elicits distinct gene expression profiles in important brain stem regions of cardiorespiratory control, which may explain the contrasting responses to CH. Gene expression profiles from the brain regions validated the accuracy of tissue biopsy methodology. Differential gene expression analyses revealed greater effects of CH on brain stem sites compared with the medial prefrontal cortex. Mild CH elicited an upregulation of predominantly immune-related genes and predicted activation of immune-related pathways and functions. In contrast, moderate CH broadly led to downregulation of genes and predicted inactivation of cellular pathways related to the immune response and vascular function. These data suggest that mild CH leads to a steady-state activation of neuroinflammatory pathways within the brain stem, whereas moderate CH drives the opposite response. Transcriptional shifts in immune-related functions may underlie the cardiorespiratory network's capability to respond to acute, more severe hypercapnia when in a state of progressively increased CH.<b>NEW & NOTEWORTHY</b> Mild chronic hypercapnia (CH) broadly upregulated immune-related genes and a predicted activation of biological pathways related to immune cell activity and the overall immune response. In contrast, moderate CH primarily downregulated genes related to major histocompatibility complex signaling and vasculature function that led to a predicted inactivation of pathways involving the immune response and vascular endothelial function. The severity-dependent effect on immune responses suggests that neuroinflammation has an important role in CH and may be important in the maintenance of proper ventilatory responses to acute and chronic hypercapnia.

SOX6
Also flagged:dimethylcutaneous melanomatumordigestionpeptidesinterphase
Journal Article 2023-08-21 ✓ 1 Snippet Thielert M, Itang EC, Ammar C, Rosenberger FA, Bludau I, Schweizer L, Nordmann TM, Skowronek P, Wahle M, Zeng WF, Zhou XX, Brunner AD, Richter S, Levesque MP, Theis FJ, Steger M, Mann M.
In-Text Gene Mentions

…family, STAT1‐3 andSOX6, which range over…

Show Full Abstract

Single-cell proteomics aims to characterize biological function and heterogeneity at the level of proteins in an unbiased manner. It is currently limited in proteomic depth, throughput, and robustness, which we address here by a streamlined multiplexed workflow using data-independent acquisition (mDIA). We demonstrate automated and complete dimethyl labeling of bulk or single-cell samples, without losing proteomic depth. Lys-N digestion enables five-plex quantification at MS1 and MS2 level. Because the multiplexed channels are quantitatively isolated from each other, mDIA accommodates a reference channel that does not interfere with the target channels. Our algorithm RefQuant takes advantage of this and confidently quantifies twice as many proteins per single cell compared to our previous work (Brunner et al, PMID 35226415), while our workflow currently allows routine analysis of 80 single cells per day. Finally, we combined mDIA with spatial proteomics to increase the throughput of Deep Visual Proteomics seven-fold for microdissection and four-fold for MS analysis. Applying this to primary cutaneous melanoma, we discovered proteomic signatures of cells within distinct tumor microenvironments, showcasing its potential for precision oncology.

VSIG10
Also flagged:intrahepatic cholestasisresponse to-induced liver injuryDILIacute liver failureinduced intrahepatic cholestasis
Journal Article 2023-08-21 ✓ 1 Snippet Jiang J, van Ertvelde J, Ertaylan G, Peeters R, Jennen D, de Kok TM, Vinken M.
In-Text Gene Mentions

…structural similarity withVSIG10(Zhou et al.…

Show Full Abstract

Drug-induced intrahepatic cholestasis (DIC) is a main type of hepatic toxicity that is challenging to predict in early drug development stages. Preclinical animal studies often fail to detect DIC in humans. In vitro toxicogenomics assays using human liver cells have become a practical approach to predict human-relevant DIC. The present study was set up to identify transcriptomic signatures of DIC by applying machine learning algorithms to the Open TG-GATEs database. A total of nine DIC compounds and nine non-DIC compounds were selected, and supervised classification algorithms were applied to develop prediction models using differentially expressed features. Feature selection techniques identified 13 genes that achieved optimal prediction performance using logistic regression combined with a sequential backward selection method. The internal validation of the best-performing model showed accuracy of 0.958, sensitivity of 0.941, specificity of 0.978, and F1-score of 0.956. Applying the model to an external validation set resulted in an average prediction accuracy of 0.71. The identified genes were mechanistically linked to the adverse outcome pathway network of DIC, providing insights into cellular and molecular processes during response to chemical toxicity. Our findings provide valuable insights into toxicological responses and enhance the predictive accuracy of DIC prediction, thereby advancing the application of transcriptome profiling in designing new approach methodologies for hazard identification.

FBXL4
Also flagged:genetic diseasesmitochondrial diseasedystoniaataxiacardiomyopathyfertilization
Journal Article 2023-08-21 ✓ 1 Snippet Sharma S, Magnitsky S, Reesey E, Schwartz M, Haroon S, Lavorato M, Chan S, Xiao R, Wilkins BJ, Martinez D, Seiler C, Falk MJ.
In-Text Gene Mentions

FBXL4

Show Full Abstract

Zebrafish (<i>Danio rerio</i>) is a widely used vertebrate animal for modeling genetic diseases by targeted editing strategies followed by gross phenotypic and biomarker characterization. While larval transparency permits microscopic detection of anatomical defects, histological adult screening for organ-level defects remains invasive, tedious, inefficient, and subject to technical artifact. Here, we describe a noninvasive magnetic resonance imaging (MRI) approach to systematically screen adult zebrafish for anatomical growth defects. An anatomical atlas of wild-type (WT) zebrafish at 5-31 months post-fertilization was created <i>by ex vivo</i> MRI with a 9.4 T magnet. Volumetric growth over time was measured of animals and major organs, including the brain, spinal cord, heart, eyes, optic nerve, ear, liver, kidneys, and swim bladder. Subsequently, <i>surf1<sup>-/-</sup></i>, <i>fbxl4<sup>-/-</sup></i>, and <i>opa1<sup>+/-</sup></i> mitochondrial disease mutant adult zebrafish were quantitatively studied to compare organ volumes with age-matched WT zebrafish. Results demonstrated that MRI enabled noninvasive, high-resolution, rapid screening of mutant adult zebrafish for overall and organ-specific growth abnormalities. Detailed volumetric analyses of three mitochondrial disease mutants delineated specific organ differences, including significantly increased brain growth in <i>surf1<sup>-/-</sup></i> and <i>opa1<sup>+/-</sup></i>, and marginally significant decreased heart and spinal cord volumes in <i>surf1<sup>-/-</sup></i> mutants. This is interesting as we know neurological involvement can be seen in <i>SURF1<sup>-</sup></i><sup>/-</sup> patients with ataxia, dystonia, and lesions in basal ganglia, as well as in <i>OPA1</i><sup>+/-</sup> patients with spasticity, ataxia, and hyperreflexia indicative of neuropathology. Similarly, cardiomyopathy is a known sequelae of cardiac pathology in patients with <i>SURF1<sup>-</sup></i><sup>/-</sup>-related disease. Future studies will define MRI signaling patterns of organ dysfunction to further delineate specific pathology.

CCPG1
Also flagged:reticulophagydeathhepatocellular carcinomaferroptosisautophagyferritinophagy
Journal Article 2023-08-21 ✓ 1 Snippet Bi T, Lu Q, Pan X, Dong F, Hu Y, Xu Z, Xiu P, Liu Z, Li J.
In-Text Gene Mentions

CCPG1

Show Full Abstract

Ferroptosis is an important mode of regulated cell death (RCD). Its inhibition is closely related to therapeutic resistance and poor prognosis in hepatocellular carcinoma (HCC). Previous reports have demonstrated ferroptosis as a biological process highly dependent on selective autophagy, such as ferritinophagy, lipophagy, and clockophagy. Our study also revealed a role for ER-phagy-mediated ferroptosis in HCC cells treated with multi-targeted tyrosine kinase inhibitors (TKIs). In the current study, we found that the homologous circular RNA (circRNA) of the family with sequence similarity 134, member B (<i>FAM134B</i>), hsa_circ_0128505 (was abbreviated as <i>circFAM134B</i> in the present study), was identified to specifically target ER-phagy to promote lenvatinib (LV)-induced ferroptosis using reactive oxygen species (ROS), Fe<sup>2+</sup>, malondialdehyde (MDA), and western blot (WB) assays in HCC cells. RNA pull-down and mass spectrometry analyses suggested that <i>circFAM134B</i> and <i>FAM134B</i> mRNA were enriched with several common interacting proteins. Among them, poly (A) binding protein cytoplasmic 4 (PABPC4) was identified as the most enriched binding partner. It was proven to be a novel antagonist against the nonsense-mediated mRNA decay (NMD) mechanism. We then applied RNA immunoprecipitation (RIP), RNA pull-down, luciferase reporter, and NMD reporter gene assays to further explore the exact role and underlying mechanism of <i>circFAM134B-</i>PABPC4-FAM134B axis in HCC cells. <i>circFAM134B</i> was confirmed as a sponge that competitively interacted with PABPC4, thereby influencing <i>FAM134B</i> mRNA nonsense decay. Our results provide novel evidences and strategies for the comprehensive treatment of HCC.

Also flagged:HydroxyapatiteSeleniumcopperbone formationcardiovascular diseasecancer
Journal Article 2023-08-21 No Snippets Korowash SI, Keskin-Erdogan Z, Hemdan BA, Barrios Silva LV, Ibrahim DM, Chau DY.
Show Full Abstract

Atomic substitution or doping of a bioceramic material hydroxyapatite (HA) with specific ions is an appealing approach for improving its biocompatibility and activity, as well as imparting antibacterial properties. In this study, selenium- and/or copper-substituted hydroxyapatite powders were synthesized by an aqueous precipitation method and using the freeze-drying technique. The molar concentrations of constituents were calculated based on the proposed mechanism whereby selenium (Se<sup>4+</sup>) ions partially substitute phosphorus (P<sup>5+</sup>) sites, and copper (Cu<sup>2+</sup>) ions partially substitute (Ca<sup>2+</sup>) sites in the HA lattice. Dried precipitated samples were characterized using Inductively coupled plasma optical emission spectroscopy (ICP-OES), X-ray diffraction analysis (XRD), Fourier-transform infrared spectroscopy (FTIR) and Field-emission scanning electron microscopy with energy dispersive X-ray spectroscopy (FESEM-EDX). Accordingly, substitution of Se<sup>4+</sup> and/or Cu<sup>2+</sup> ions took place in the crystal lattice of HA without the formation of any impurities. The presence of sulphur (S<sup>2-</sup>) ions in the hydroxyapatite was detected by ICP-OES in all samples with copper substituted in the lattice. The cytotoxicity of the powders on osteoblastic (MC3T3-E1) cells was evaluated in vitro. Selenium substituted hydroxyapatite (SeHA), at the concentration (200 μg/mL), demonstrated higher populations of the live cells than that of control (cells without powders), suggesting that selenium may stimulate the proliferation of these cells. In addition, the copper substituted hydroxyapatite (CuHA) and the selenium and copper substituted hydroxyapatite (SeCuHA) at the concentrations (200 and 300 μg/mL) and (200 μg/mL), respectively demonstrated better results than the unsubstituted HA. Antimicrobial activity was assessed using a well-diffusion method against <i>Streptococcus mutans</i> and <i>Candida albicans</i>, and superior results has obtained with SeCuHA <i>samples</i>. Presented findings imply that selenium and/or copper substituted modified hydroxyapatite nanoparticles, may be an attractive antimicrobial and cytocompatible substrate to be considered for use in a range of translational applications.

SOX6
Also flagged:c-JUNdeathTNNT2chromatinRBBP5SETD1B
Journal Article 2023-08-21 ✓ 1 Snippet Zhong H, Zhang R, Li G, Huang P, Zhang Y, Zhu J, Kuang J, Hutchins AP, Qin D, Zhu P, Pei D, Li D.
In-Text Gene Mentions

…genes SOX9 /SOX6were enriched in…

Show Full Abstract

Loss of c-JUN leads to early mouse embryonic death, possibly because of a failure to develop a normal cardiac system. How c-JUN regulates human cardiomyocyte cell fate remains unknown. Here, we used the in vitro differentiation of human pluripotent stem cells into cardiomyocytes to study the role of c-JUN. Surprisingly, the knockout of c-JUN improved cardiomyocyte generation, as determined by the number of TNNT2+ cells. ATAC-seq data showed that the c-JUN defect led to increased chromatin accessibility on critical regulatory elements related to cardiomyocyte development. ChIP-seq data showed that the knockout c-JUN increased RBBP5 and SETD1B expression, leading to improved H3K4me3 deposition on key genes that regulate cardiogenesis. The c-JUN KO phenotype could be copied using the histone demethylase inhibitor CPI-455, which also up-regulated H3K4me3 levels and increased cardiomyocyte generation. Single-cell RNA-seq data defined three cell branches, and knockout c-JUN activated more regulons that are related to cardiogenesis. In summary, our data demonstrated that c-JUN could regulate cardiomyocyte cell fate by modulating H3K4me3 modification and chromatin accessibility and shed light on how c-JUN regulates heart development in humans.

TNFSF4
Also flagged:phospholipidmetabolismlipidcancerpancreatic cancerpancreatic tumor
Journal Article 2023-08-21 ✓ 4 Snippets Wang H, Guo H, Sun J, Wang Y.
In-Text Gene Mentions

…HAVCR2,TNFSF4, TNFRSF9, PDCD1LG2, CD80,…

…CD274, CD80, TNFRSF14,TNFSF4, TNFRSF9, and CD70…

…HAVCR2, PDCD1LG2, TNFRSF4,TNFSF4, TNFRSF9, and CD70…

…and ICGs (HAVCR2,TNFSF4, TNFRSF9, PDCD1LG2, CD80,…

Show Full Abstract

Oxidative stress (OS), which impacts lipid metabolic reprogramming, can affect the biological activities of cancer cells. How oxidative stress and phospholipid metabolism (OSPM) influence the prognosis of pancreatic cancer (PC) needs to be elucidated. The metabolic data of 35 pancreatic tumor samples, 34 para-carcinoma samples, and 31 normal pancreatic tissues were obtained from the previously published literature. Pan-cancer samples were obtained from The Cancer Genome Atlas (TCGA). And the Gene Expression Omnibus (GEO), International Cancer Genome Consortium (ICGC), ArrayExpress, and the Genotype-Tissue Expression (GTEx) databases were searched for more PC and normal pancreatic samples. The metabolites in PC were compared with normal and para-carcinoma tissues. The characteristics of the key OSPM genes were summarized in pan-cancer. The random survival forest analysis and multivariate Cox regression analysis were utilized to construct an OSPM-related signature. Based on this signature, PC samples were divided into high- and low-risk subgroups. The dysregulations of the tumor immune microenvironment were further investigated. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was conducted to investigate the expression of genes in the signature in PC and normal tissues. The protein levels of these genes were further demonstrated. In PC, metabolomic studies revealed the alteration of PM, while transcriptomic studies showed different expressions of OSPM-related genes. Then 930 PC samples were divided into three subtypes with different prognoses, and an OSPM-related signature including eight OSPM-related genes (i.e., SLC2A1, MMP14, TOP2A, MBOAT2, ANLN, ECT2, SLC22A3, and FGD6) was developed. High- and low-risk subgroups divided by the signature showed different prognoses, expression levels of immune checkpoint genes, immune cell infiltration, and tumor microenvironment. The risk score was negatively correlated with the proportion of TIL, pDC, Mast cell, and T cell co-stimulation. The expression levels of genes in the signature were verified in PC and normal samples. The protein levels of SLC2A1, MMP14, TOP2A, MBOAT2, ANLN, and SLC22A3 showed up-regulation in PC samples compared with normal tissues. After integrating metabolomics and transcriptomics data, the alterations in OSPM in PC were investigated, and an OSPM-related signature was developed, which was helpful for the prognostic assessment and individualized treatment for PC.

TNFSF4
Also flagged:tumorlung adenocarcinomaLUADPLK1LDHAFURIN
Journal Article 2023-08-21 ✓ 1 Snippet Li C, Yuan Y, Jiang X, Wang Q.
In-Text Gene Mentions

…point blockade-related genes (TNFSF4, PDCD1LG2, LAG3, CTLA4,…

Show Full Abstract

Mounting evidence has found that tumor microenvironment (TME) plays an important role in the tumor progression of lung adenocarcinoma (LUAD). However, the roles of tumor microenvironment-related genes in immunotherapy and clinical outcomes remain unclear. In this study, 6 TME-related genes (PLK1, LDHA, FURIN, FSCN1, RAB27B, and MS4A1) were identified to construct the prognostic model. The established risk scores were able to predict outcomes at 1, 3, and 5 years with greater accuracy than previously known models. Moreover, the risk score was closely associated with immune cell infiltration and the immunoregulatory genes including T cell exhaustion markers. In conclusion, the TME risk score can function as an independent prognostic biomarker and a predictor for evaluating immunotherapy response in LUAD patients, which provides recommendations for improving patients' response to immunotherapy and promoting personalized tumor immunotherapy in the future.

Also flagged:Folic acidliver tumorscancertumorlivertumors
Journal Article 2023-08-21 No Snippets Soleymani M, Poorkhani A, Khalighfard S, Velashjerdi M, Khori V, Khodayari S, Khodayari H, Dehghan M, Alborzi N, Agah S, Alizadeh AM.
Show Full Abstract

Successful cancer treatment using magnetic hyperthermia therapy (MHT) strongly depends on biocompatible magnetic nanoparticles (NPs). They can effectively accumulate in tumor tissues after systemic injection and generate heat in the therapeutic temperature range (42-48 °C) by exposure to an AC magnetic field (AMF). For this purpose, folic acid-conjugated dextran-coated Zn<sub>0.6</sub>Mn<sub>0.4</sub>Fe<sub>2</sub>O<sub>4</sub> (FA-Dex-ZMF) NPs were synthesized as smart nano heaters with self-regulating temperatures for MHT of liver tumors. Animal studies on BALB/c mice showed that the prepared NPs did not cause acute toxicity upon administration up to 100 mg kg<sup>-1</sup>. Likewise, no significant changes in hematological and biochemical factors were observed. FA-Dex-ZMF NPs were studied by exposing them to different safe AC magnetic fields (f = 150 kHz, H = 6, 8, and 10 kA m<sup>-1</sup>). Calorimetric experiments revealed that the NPs reached the desired temperature range (42-48 °C), which was suitable for MHT. Moreover, the efficacy of FA-Dex-ZMF NPs in MHT of liver tumors was investigated in vivo in liver-tumor-bearing mice. The obtained results revealed that the average volume of tumors in the control group increased 2.2 times during the study period. In contrast, the tumor volume remained almost constant during treatment in the MHT group. The results indicated that folic acid-conjugated dextran-coated Zn<sub>0.6</sub>Mn<sub>0.4</sub>Fe<sub>2</sub>O<sub>4</sub> NPs with self-regulating temperature could be a promising tool for systemically delivered MHT.

ARFGEF2
Also flagged:BSNTBL2MLXIPLPHF20RBM39DCAF5
Journal Article 2023-08-21 ✓ 4 Snippets Pallotti S, Picciolini M, Antonini M, Renieri C, Napolioni V.
In-Text Gene Mentions

…RNAD-AUC, LOC116284365, RBM39,ARFGEF2, DCAF5, EXD2, HSPB11,…

…during lactation, asARFGEF2and FZD9 which…

…were found inARFGEF2, a candidate…

…In fact,ARFGEF2was found to…

Show Full Abstract

<h4>Background</h4>Alpaca (Vicugna pacos), llama (Lama glama), vicugna (Vicugna vicugna) and guanaco (Lama guanicoe), are the camelid species distributed over the Andean high-altitude grasslands, the Altiplano, and the Patagonian arid steppes. Despite the wide interest on these animals, most of the loci under selection are still unknown. Using whole-genome sequencing (WGS) data we investigated the occurrence and the distribution of Runs Of Homozygosity (ROHs) across the South American Camelids (SACs) genome to identify the genetic relationship between the four species and the potential signatures of selection.<h4>Results</h4>A total of 37 WGS samples covering the four species was included in the final analysis. The multi-dimensional scaling approach showed a clear separation between the four species; however, admixture analysis suggested a strong genetic introgression from vicugna and llama to alpaca. Conversely, very low genetic admixture of the guanaco with the other SACs was found. The four species did not show significant differences in the number, length of ROHs (100-500 kb) and genomic inbreeding values. Longer ROHs (> 500 kb) were found almost exclusively in alpaca. Seven overlapping ROHs were shared by alpacas, encompassing nine loci (FGF5, LOC107034918, PRDM8, ANTXR2, LOC102534792, BSN, LOC116284892, DAG1 and RIC8B) while nine overlapping ROHs were found in llama with twenty-five loci annotated (ERC2, FZD9, BAZ1B, BCL7B, LOC116284208, TBL2, MLXIPL, PHF20, TRNAD-AUC, LOC116284365, RBM39, ARFGEF2, DCAF5, EXD2, HSPB11, LRRC42, LDLRAD1, TMEM59, LOC107033213, TCEANC2, LOC102545169, LOC116278408, SMIM15, NDUFAF2 and RCOR1). Four overlapping ROHs, with three annotated loci (DLG1, KAT6B and PDE4D) and three overlapping ROHs, with seven annotated genes (ATP6V1E1, BCL2L13, LOC116276952, BID, KAT6B, LOC116282667 and LOC107034552), were detected for vicugna and guanaco, respectively.<h4>Conclusions</h4>The signatures of selection revealed genomic areas potentially selected for production traits as well as for natural adaptation to harsh environment. Alpaca and llama hint a selection driven by environment as well as by farming purpose while vicugna and guanaco showed selection signals for adaptation to harsh environment. Interesting, signatures of selection on KAT6B gene were identified for both vicugna and guanaco, suggesting a positive effect on wild populations fitness. Such information may be of interest to further ecological and animal production studies.

Also flagged:Dendrimerisotretinoinskin diseasesacneskin disorders13-cis retinoic acid
Journal Article 2023-08-21 No Snippets Zhao T, Zhou M, Wu R, Wang H, Zouboulis CC, Zhu M, Lee M.
Show Full Abstract

<h4>Background</h4>In the present study, we aimed to develop a novel isotretinoin delivery model for treating skin diseases, revealing its potential advantages in drug delivery and targeted therapy. Using a self-assembly strategy, we grafted a dendrimer, based on a well-defined branched structure for nanomedical devices, with a well-defined nanoarchitecture, yielding spherical, highly homogeneous molecules with multiple surface functionalities. Accordingly, a self-assembled dendrimer-conjugated system was developed to achieve the transdermal delivery of isotretinoin (13cRA-D).<h4>Results</h4>Herein, 13cRA-D showed remarkable controlled release, characterized by slow release in normal tissues but accelerated release in tissues with low pH, such as sites of inflammation. These release characteristics could abrogate the nonteratogenic side effects of isotretinoin and allow efficient skin permeation. Moreover, 13cRA-D exhibited high therapeutic efficacy in acne models. Based on in vitro and in vivo experimental results, 13cRA-D afforded better skin penetration than isotretinoin and allowed lesion targeting. Additionally, 13cRA-D induced minimal skin irritation.<h4>Conclusion</h4>Our findings suggest that 13cRA-D is a safe and effective isotretinoin formulation for treating patients with skin disorders.

B4GALT5
Also flagged:ferroptosisCOVID-19ischemic strokeISribosomeprimary immunodeficiency
Journal Article 2023-08-21 ✓ 5 Snippets Zhao X, Liang Q, Li H, Jing Z, Pei D.
In-Text Gene Mentions

Therefore, B4GALT5, CRISPLD2 and F5 may be potent targets for the treatment of COVID-19-associated IS.

Importantly, as shown in Figure 6E, B4GALT5 was found to have a positive correlation with xenobiotic metabolism, TNFA signaling via NFKB, reactive oxygen species pathway, p53 pathway, myogenesis, inflammatory response, IL6 JAK STAT3 signaling, hypoxia, heme metabolism, estrogen response early, epithelial mesenchymal transition, coagulation, cholesterol homeostasis, angiogenesis and adipogenesis (p < 0.05), and a negative correlation with WNT beta catenin signaling, unfolded protein response, MYC targets, DNA repair and allograft rejection (p < 0.05).

Single gene analysis of ssGSEA was performed, and the results showed glycosphingolipid biosynthesis, phenylalanine metabolism, and PPAR signaling pathway were enriched in B4GALT5 high expression samples, while allograft rejection, autoimmune thyroid disease, graft–versus–host disease, intestinal immune network and primary immunodeficiency were enriched in B4GALT5 low expression samples (Figure 6A).

Here, a positive correlation was found between B4GALT5 and xenobiotic metabolism, TNFA signaling via NFKB, reactive oxygen species, p53 signaling, myogenesis, inflammation, IL6 JAK STAT3 signaling, hypoxia, heme metabolism, estrogen response early, epithelial mesenchymal transition, coagulation, cholesterol homeostasis, angiogenesis and adipogenesis (p < 0.05).

We then analyzed the mRNA expression of 9 genes (Supplementary Figures 1, 2), and 3 genes (B4GALT5, CRISPLD2, F5) were found up-regulated in both COVID-19 and IS (p < 0.001, Figure 5D–5I).

Show Full Abstract

<h4>Background</h4>Since December 2019, Coronavirus disease 2019 (COVID-19) induced by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has resulted in significant morbidity and mortality worldwide. There is an increased risk of ischemic stroke (IS) associated with COVID-19. However, few studies have been reported to explain the potential correlation between COVID-19 and IS.<h4>Methods</h4>We investigated the relationship and relevant mechanisms between COVID-19 and IS using single-cell RNA sequencing and multiple bioinformatics approaches.<h4>Results</h4>By intersecting differentially expressed genes and WGCNA critical module genes, we obtained 73 COVID-19-related IS genes. According to the KEGG pathway analysis, the COVID-19-related IS disease genes were significantly enriched in the hematopoietic cell lineage pathway, ribosome pathway, COVID-19 pathway and primary immunodeficiency pathway. Finally, three genes associated with immunity (B4GALT5, CRISPLD2, F5) and two genes associated with ferroptosis (ACSL1, CREB5) were identified up-regulated in COVID-19-related IS. Significantly, it was found that all five genes were highly expressed in monocytes by single cell RNA sequencing.<h4>Conclusion</h4>We believe these genes (B4GALT5, CRISPLD2, F5, ACSL1, CREB5) may regulate the immune response and ferroptosis of multiple immune cells, mainly including monocytes, which may contribute to the development of COVID-19-related IS. In addition, these genes may be potential targets for the treatment of COVID-19-related IS.

MMS22L
Also flagged:PARylationpoly(ADP-ribose) polymerasespost-translational modificationsPARbindingPARP
Journal Article 2023-08-21 ✓ 1 Snippet Beneyton A, Nonfoux L, Gagné JP, Rodrigue A, Kothari C, Atalay N, Hendzel MJ, Poirier GG, Masson JY.
In-Text Gene Mentions

…DNA repair geneMMS22L, whose loss hypersensitized…

Show Full Abstract

Poly(ADP-ribosylation) (PARylation) by poly(ADP-ribose) polymerases (PARPs) is a highly regulated process that consists of the covalent addition of polymers of ADP-ribose (PAR) through post-translational modifications of substrate proteins or non-covalent interactions with PAR via PAR binding domains and motifs, thereby reprogramming their functions. This modification is particularly known for its central role in the maintenance of genomic stability. However, how genomic integrity is controlled by an intricate interplay of covalent PARylation and non-covalent PAR binding remains largely unknown. Of importance, PARylation has caught recent attention for providing a mechanistic basis of synthetic lethality involving PARP inhibitors (PARPi), most notably in homologous recombination (HR)-deficient breast and ovarian tumors. The molecular mechanisms responsible for the anti-cancer effect of PARPi are thought to implicate both catalytic inhibition and trapping of PARP enzymes on DNA. However, the relative contribution of each on tumor-specific cytotoxicity is still unclear. It is paramount to understand these PAR-dependent mechanisms, given that resistance to PARPi is a challenge in the clinic. Deciphering the complex interplay between covalent PARylation and non-covalent PAR binding and defining how PARP trapping and non-trapping events contribute to PARPi anti-tumour activity is essential for developing improved therapeutic strategies. With this perspective, we review the current understanding of PARylation biology in the context of the DNA damage response (DDR) and the mechanisms underlying PARPi activity and resistance.

OLFM4
Also flagged:Olfactomedin 4nonalcoholic fatty liver diseaseP62mitophagyglycoproteinobesity
Journal Article 2023-08-21 ✓ 5 Snippets Chen S, Wang X, Liu Z, Wang J, Guo Y, Wang Q, Huang H, Li Y, Yu C, Xu C.
In-Text Gene Mentions

Cell lines deficient in or overexpressing OLFM4 and Olfm4<sup>-/-</sup> mice were established to study its role in NAFLD.

<h4>Background & aims</h4>Olfactomedin 4 (OLFM4) is a glycoprotein that is related to obesity and insulin resistance.

OLFM4 deficiency significantly aggravated diet-induced hepatic steatosis and inflammation, while re-expression of OLFM4 ameliorated diet-induced hepatic steatosis and inflammation in mice.

We also show that blocking the P62-ZZ-domain using XRK3F2 prevented diet-induced NAFLD in Olfm4<sup>-/-</sup> mice.<h4>Conclusion</h4>OLFM4 is significantly upregulated in NAFLD, and OLFM4 deletion exacerbates NAFLD through P62-dependent mitophagy.

This study aims to investigate the role and mechanisms of OLFM4 in nonalcoholic fatty liver disease (NAFLD).<h4>Approach & results</h4>OLFM4 expression levels were significantly increased in liver samples from NAFLD patients and in cellular and mouse models of NAFLD.

Show Full Abstract

<h4>Background & aims</h4>Olfactomedin 4 (OLFM4) is a glycoprotein that is related to obesity and insulin resistance. This study aims to investigate the role and mechanisms of OLFM4 in nonalcoholic fatty liver disease (NAFLD).<h4>Approach & results</h4>OLFM4 expression levels were significantly increased in liver samples from NAFLD patients and in cellular and mouse models of NAFLD. Cell lines deficient in or overexpressing OLFM4 and Olfm4<sup>-/-</sup> mice were established to study its role in NAFLD. OLFM4 deficiency significantly aggravated diet-induced hepatic steatosis and inflammation, while re-expression of OLFM4 ameliorated diet-induced hepatic steatosis and inflammation in mice. Mechanistically, OLFM4 deficiency disrupted mitochondrial structure and decreased mitophagy in hepatocytes, thereby aggravating hepatic lipogenesis, inflammation, and insulin resistance. Moreover, OLFM4 directly interacted with P62, and OLFM4 deficiency decreased mitophagy in both cellular and mouse models of NAFLD through a P62-dependent mechanism. We also show that blocking the P62-ZZ-domain using XRK3F2 prevented diet-induced NAFLD in Olfm4<sup>-/-</sup> mice.<h4>Conclusion</h4>OLFM4 is significantly upregulated in NAFLD, and OLFM4 deletion exacerbates NAFLD through P62-dependent mitophagy.

HTT
Also flagged:Pathogenesisneurodegenerative genetic disorderHDdominantnucleusbehavioural
Journal Article 2023-08-21 ✓ 5 Snippets Jiang A, Handley RR, Lehnert K, Snell RG.
In-Text Gene Mentions

HD mouse models have been extensively used and include early toxin-induced models (Quinolinic acid, 3-Nitropropionic), N-terminal HTT models (R6/2, N171-82Q/N118-82Q/N586-82Q, HD94, shortstop, HD150QG/HD190QG), and more recent full-length HTT (BACHD, YAC72/128, Hu97/18) and knock-in models (HdhQ50/92/111/140/150, zQ175) (overview of HD models in Table 2).

First 67 amino acids of human HTT cDNA fused to EGFPHuman HTT promoter

HD is caused by a single mutation in the huntingtin (HTT) gene, located at chromosome 4p16.3, that encodes the protein huntingtin.

The protein encoded by HTT (wild-type polyglutamine repeat length of 23 CAG) consists of 3144 amino acids with a molecular weight of 348 kD [105].

Huntington’s disease (HD) is a debilitating neurodegenerative genetic disorder caused by an expanded polyglutamine-coding (CAG) trinucleotide repeat in the huntingtin (HTT) gene.

Show Full Abstract

Huntington's disease (HD) is a debilitating neurodegenerative genetic disorder caused by an expanded polyglutamine-coding (CAG) trinucleotide repeat in the huntingtin (<i>HTT</i>) gene. HD behaves as a highly penetrant dominant disorder likely acting through a toxic gain of function by the mutant huntingtin protein. Widespread cellular degeneration of the medium spiny neurons of the caudate nucleus and putamen are responsible for the onset of symptomology that encompasses motor, cognitive, and behavioural abnormalities. Over the past 150 years of HD research since George Huntington published his description, a plethora of pathogenic mechanisms have been proposed with key themes including excitotoxicity, dopaminergic imbalance, mitochondrial dysfunction, metabolic defects, disruption of proteostasis, transcriptional dysregulation, and neuroinflammation. Despite the identification and characterisation of the causative gene and mutation and significant advances in our understanding of the cellular pathology in recent years, a disease-modifying intervention has not yet been clinically approved. This review includes an overview of Huntington's disease, from its genetic aetiology to clinical presentation and its pathogenic manifestation. An updated view of molecular mechanisms and the latest therapeutic developments will also be discussed.

CCPG1
Also flagged:Learning Disordersneurobiological disorderdyslexiadysgraphiadyscalculiabehavioral
Journal Article 2023-08-21 ✓ 5 Snippets Calì F, Di Blasi FD, Avola E, Vinci M, Musumeci A, Gloria A, Greco D, Raciti DR, Zagami A, Rizzo B, Città S, Federico C, Vetri L, Saccone S, Buono S.
In-Text Gene Mentions

According to the current literature, rare variants have been reported in few studies, significantly associated with SLD; a translocation breakpoint at 15q21 in the CCPG1 (previously called DYX1C1) gene was reported as the first gene to be implicated in dyslexia [51], further to other large deletions/insertions at chromosome 15 that were found [52].

…15 candidate genes:CCPG1, CYP19A1 ,…

…progression 1 (CCPG1); (2) Cytochrome…

…the following genes:CCPG1(previously called DYX1C1…

…15q21 in theCCPG1(previously called DYX1C1…

Show Full Abstract

<i>Background and Objectives</i>: Specific Learning Disorder (SLD) is a complex neurobiological disorder characterized by a persistent difficult in reading (dyslexia), written expression (dysgraphia), and mathematics (dyscalculia). The hereditary and genetic component is one of the underlying causes of SLD, but the relationship between genes and the environment should be considered. Several genetic studies were performed in different populations to identify causative genes. <i>Materials and Methods</i>: Here, we show the analysis of 9 multiplex families with at least 2 individuals diagnosed with SLD per family, with a total of 37 persons, 21 of whom are young subjects with SLD, by means of Next-Generation Sequencing (NGS) to identify possible causative mutations in a panel of 15 candidate genes: <i>CCPG1</i>, <i>CYP19A1</i>, <i>DCDC2</i>, <i>DGKI</i>, <i>DIP2A</i>, <i>DYM</i>, <i>GCFC2</i>, <i>KIAA0319</i>, <i>MC5R</i>, <i>MRPL19</i>, <i>NEDD4L</i>, <i>PCNT</i>, <i>PRMT2</i>, <i>ROBO1</i>, and <i>S100B</i>. <i>Results:</i> We detected, in eight families out nine, SNP variants in the <i>DGKI</i>, <i>DIP2A</i>, <i>KIAA0319</i>, and <i>PCNT</i> genes, even if in silico analysis did not show any causative effect on this behavioral condition. In all cases, the mutation was transmitted by one of the two parents, thus excluding the case of de novo mutation. Moreover, the parent carrying the allelic variant transmitted to the children, in six out of seven families, reports language difficulties. <i>Conclusions</i>: Although the present results cannot be considered conclusive due to the limited sample size, the identification of genetic variants in the above genes can provide input for further research on the same, as well as on other genes/mutations, to better understand the genetic basis of this disorder, and from this perspective, to better understand also the neuropsychological and social aspects connected to this disorder, which affects an increasing number of young people.

Also flagged:peptidesMultiple sclerosisMSchronic inflammatory neurologic diseasepeptidemyelin proteolipid protein
Journal Article 2023-08-21 No Snippets Dong X, Sun S, Li J, Shen S, Chen W, Li T, Li X.
Show Full Abstract

Multiple sclerosis (MS) is a chronic inflammatory neurologic disease characterized by the demyelinating injury of the central nervous system (CNS). It was reported that the mutant peptide came from myelin proteolipid protein (PLP) and myelin basic protein (MBP) might play a critical role in immunotherapy function of MS. However, endogenous peptides in demyelinating brain tissue of MS and their role in the pathologic process of MS have not been revealed. Here, we performed peptidomic analysis of freshly isolated <i>corpus</i> callosum (CC) from the brains of CPZ-treated mice and normal diet controls of male C57BL/6 mice by LC-MS/MS. Identified a total of 217 peptides were expressed at different levels in MS mice model compared with controls. By performed GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis, we found that the precursor protein of these differently expressed peptides (DEPs) were associated with myelin sheath and oxidative phosphorylation. Our study is the first brain peptidomic of MS mice model, revealing the distinct features of DEPs in demyelination brain tissue. These DPEs may provide further insight into the pathogenesis and complexity of MS, which would facilitate the discovery of the potential novel and effective strategy for the treatment of MS.

Also flagged:HistonemethylationChromatinpost-translational modificationsgene expressioncell cycle
Journal Article 2023-08-21 No Snippets Agredo A, Kasinski AL.
Show Full Abstract

Chromatin is a vital and dynamic structure that is carefully regulated to maintain proper cell homeostasis. A great deal of this regulation is dependent on histone proteins which have the ability to be dynamically modified on their tails via various post-translational modifications (PTMs). While multiple histone PTMs are studied and often work in concert to facilitate gene expression, here we focus on the tri-methylation of histone H4 on lysine 20 (H4K20me3) and its function in chromatin structure, cell cycle, DNA repair, and development. The recent studies evaluated in this review have shed light on how H4K20me3 is established and regulated by various interacting partners and how H4K20me3 and the proteins that interact with this PTM are involved in various diseases. Through analyzing the current literature on H4K20me3 function and regulation, we aim to summarize this knowledge and highlights gaps that remain in the field.

HFE
Also flagged:deathcluster of differentiation-14transforming growth factor b1TGF-b1HCV infectioncirrhosis
Journal Article 2023-08-21 ✓ 1 Snippet Elabd WK, Elbakry MMM, Hassany M, Baki AA, Seoudi DM, El Azeem EMA.
In-Text Gene Mentions

…autoimmune disorders, orhemochromatosis.…

Show Full Abstract

<h4>Aim of the study</h4>Liver cancer (hepatocellular carcinoma - HCC) remains a serious health challenge; it is the fourth leading cause of death worldwide. Egypt ranks fifteenth worldwide and the third in Africa in terms of HCC burden. The present study aimed to assess some microRNAs (miRNAs) including miRNA-7, miRNA-10, and miRNA-21, serum markers such as cluster of differentiation-14 (CD-14) and transforming growth factor b1 (TGF-b1), and other biochemical parameters as non-invasive tools for HCC diagnosis.<h4>Material and methods</h4>The study included 100 participants divided into five groups: group I (20 normal subjects as a healthy group), group II (20 participants with chronic HCV infection but non-cirrhotic), group III (20 volunteers with chronic HCV infection and compensated cirrhosis), group IV (20 patients with chronic HCV infection and decompensated cirrhosis), and group V (20 participants with HCC). Levels of miR-7, miR-10, and miR-21 were evaluated using qRT-PCR. Serum ALT, AST, total bilirubin, total protein, albumin, PT, INR, and platelet count were determined. FIB-4 and APRI test levels were also calculated. CD-14 and TGF-β1 serum levels were estimated using enzyme-linked immunosorbent assay (ELISA) kits.<h4>Results</h4>The expression levels of miR-21 followed by miR-10 showed high sensitivity and specificity in predicting HCC. Serum CD-14 and TGF-b1 levels were significantly increased in all patient groups.<h4>Conclusions</h4>From the study, it is concluded that the expression level of miR-21 has the highest sensitivity and specificity, followed by miR-10, which has high sensitivity and low specificity as non-invasive markers for HCC detection, while miR-7 exhibits high sensitivity and reasonable specificity in fibrosis detection.

Also flagged:pulmonary diseasepulmonary infectious diseaseCFTRion homeostasisNontuberculousMycobacterial Pulmonary Disease
Journal Article 2023-08-21 No Snippets Namkoong H, Holland SM.
Show Full Abstract

Nontuberculous mycobacteria (NTM) pulmonary disease is a chronic progressive pulmonary infectious disease caused by low virulence pathogens. The existence of host susceptibility to NTM infection has been recognized from a high incidence among Asians compared to other populations in the United States, a high incidence among slender, middle-aged women, and the presence of familial clusters. Recent whole exome sequencing and genome-wide association studies have identified immune, CFTR, cilia, connective tissue and ion homeostasis genes as host susceptibility genes. Large-scale international collaborative studies and functional analyses are expected to elucidate host susceptibility in the future.

bioRxiv 2023-08-21 Preprint (No Snippets API) Hassan NT, Galbraith JD, Adelson DL.
Show Full Abstract

Horizontal transfer of transposable elements (HTT) has been reported across many species and the impact of such events on genome structure and function has been well described. However, few studies have focused on reptilian genomes, especially HTT events in Testudines (turtles). Here, we investigated the repetitive content of Malaclemys terrapin terrapin (Diamondback turtle) and found a high similarity hAT-6 DNA transposon shared between other turtle species, ray-finned fishes, and a frog. hAT-6 was notably absent in taxa closely related to turtles, such as crocodiles and birds. Successful invasion of DNA transposons into new genomes requires the conservation of specific residues in the encoded transposase, and through structural analysis, these residues were identified indicating retention of functional transposition activity. We document a rare and recent HTT event of a DNA transposon between turtles which are known to have a low genomic evolutionary rate and ancient repeats.

Also flagged:Alzheimer DiseaseIron DeficiencyNeurodegenerationChlorosisirontau
Journal Article 2023-08-20 No Snippets LeVine SM.
Show Full Abstract

Chlorosis in azaleas is characterized by an interveinal yellowing of leaves that is typically caused by a deficiency of iron. This condition is usually due to the inability of cells to properly acquire iron as a consequence of unfavorable conditions, such as an elevated pH, rather than insufficient iron levels. The causes and effects of chlorosis were found to have similarities with those pertaining to a recently presented hypothesis that describes a pathogenic process in Alzheimer disease. This hypothesis states that iron becomes sequestered (e.g., by amyloid β and tau), causing a functional deficiency of iron that disrupts biochemical processes leading to neurodegeneration. Additional mechanisms that contribute to iron becoming unavailable include iron-containing structures not undergoing proper recycling (e.g., disrupted mitophagy and altered ferritinophagy) and failure to successfully translocate iron from one compartment to another (e.g., due to impaired lysosomal acidification). Other contributors to a functional deficiency of iron in patients with Alzheimer disease include altered metabolism of heme or altered production of iron-containing proteins and their partners (e.g., subunits, upstream proteins). A review of the evidence supporting this hypothesis is presented. Also, parallels between the mechanisms underlying a functional iron-deficient state in Alzheimer disease and those occurring for chlorosis in plants are discussed. Finally, a model describing the generation of a functional iron deficiency in Alzheimer disease is put forward.

bioRxiv 2023-08-20 Preprint (No Snippets API) Mannens CC, Hu L, Lönnerberg P, Schipper M, Reagor C, Li X, He X, Barker RA, Sundström E, Posthuma D, Linnarsson S.
Show Full Abstract

The human brain is capable of highly complex functions that develops through a tightly organized cascade of patterning events, expressed transcription factors and changes in chromatin accessibility. While extensive datasets exist describing gene expression across the developing brain with single-cell resolution, similar atlases of chromatin accessibility have been primarily focused on the forebrain. Here, we focus on the chromatin landscape and paired gene expression across the developing human brain to provide a comprehensive single cell atlas during the first trimester (6 - 13 post-conceptional weeks). We identified 135 clusters across half a million nuclei and using the multiomic measurements linked candidate cis- regulatory elements (cCREs) to gene expression. We found an increase in the number of accessible regions driven both by age and neuronal differentiation. Using a convolutional neural network we identified putative functional TF-binding sites in enhancers characterizing neuronal subtypes and we applied this model to cCREs upstream of ESRRB to elucidate its activation mechanism. Finally, by linking disease-associated SNPs to cCREs we validated putative pathogenic mechanisms in several diseases and identified midbrain-derived GABAergic neurons as being the most vulnerable to major depressive disorder related mutations. Together, our findings provide a higher degree of detail to some key gene regulatory mechanisms underlying the emergence of cell types during the first trimester. We anticipate this resource to be a valuable reference for future studies related to human neurodevelopment, such as identifying cell type specific enhancers that can be used for highly specific targeting in in vitro models.

ECI2
Also flagged:glucagon receptordiabetic cardiomyopathyGCGRimmunoglobulin Gcarnitine palmitoyltransferase 1Boptic atrophy type 1
Journal Article 2023-08-19 ✓ 1 Snippet Wang P, Wei R, Cui X, Jiang Z, Yang J, Zu L, Hong T.
In-Text Gene Mentions

…ACAA2, ACAT1, ECI1,ECI2, and EHHADH), whereas…

Show Full Abstract

<h4>Introduction</h4>The role of cardiac microvascular endothelial cells (CMECs) in diabetic cardiomyopathy is not fully understood. We aimed to investigate whether a glucagon receptor (GCGR) monoclonal antibody (mAb) ameliorated diabetic cardiomyopathy and clarify whether and how CMECs participated in the process.<h4>Research design and methods</h4>The db/db mice were treated with GCGR mAb or immunoglobulin G (as control) for 4 weeks. Echocardiography was performed to evaluate cardiac function. Immunofluorescent staining was used to determine microvascular density. The proteomic signature in isolated primary CMECs was analyzed by using tandem mass tag-based quantitative proteomic analysis. Some target proteins were verified by using western blot.<h4>Results</h4>Compared with db/m mice, cardiac microvascular density and left ventricular diastolic function were significantly reduced in db/db mice, and this reduction was attenuated by GCGR mAb treatment. A total of 199 differentially expressed proteins were upregulated in db/db mice versus db/m mice and downregulated in GCGR mAb-treated db/db mice versus db/db mice. The enrichment analysis demonstrated that fatty acid β-oxidation and mitochondrial fusion were the key pathways. The changes of the related proteins carnitine palmitoyltransferase 1B, optic atrophy type 1, and mitofusin-1 were further verified by using western blot. The levels of these three proteins were upregulated in db/db mice, whereas this upregulation was attenuated by GCGR mAb treatment.<h4>Conclusion</h4>GCGR antagonism has a protective effect on CMECs and cardiac diastolic function in diabetic mice, and this beneficial effect may be mediated via inhibiting fatty acid β-oxidation and mitochondrial fusion in CMECs.

HFE
Also flagged:oxygenagingnitrogensignal transductionNuclear factor-κBNF-κB
Journal Article 2023-08-19 ✓ 1 Snippet Jomova K, Raptova R, Alomar SY, Alwasel SH, Nepovimova E, Kuca K, Valko M.
In-Text Gene Mentions

…homeostasis, such ashemochromatosis(iron overload) and…

Show Full Abstract

A physiological level of oxygen/nitrogen free radicals and non-radical reactive species (collectively known as ROS/RNS) is termed oxidative eustress or "good stress" and is characterized by low to mild levels of oxidants involved in the regulation of various biochemical transformations such as carboxylation, hydroxylation, peroxidation, or modulation of signal transduction pathways such as Nuclear factor-κB (NF-κB), Mitogen-activated protein kinase (MAPK) cascade, phosphoinositide-3-kinase, nuclear factor erythroid 2-related factor 2 (Nrf2) and other processes. Increased levels of ROS/RNS, generated from both endogenous (mitochondria, NADPH oxidases) and/or exogenous sources (radiation, certain drugs, foods, cigarette smoking, pollution) result in a harmful condition termed oxidative stress ("bad stress"). Although it is widely accepted, that many chronic diseases are multifactorial in origin, they share oxidative stress as a common denominator. Here we review the importance of oxidative stress and the mechanisms through which oxidative stress contributes to the pathological states of an organism. Attention is focused on the chemistry of ROS and RNS (e.g. superoxide radical, hydrogen peroxide, hydroxyl radicals, peroxyl radicals, nitric oxide, peroxynitrite), and their role in oxidative damage of DNA, proteins, and membrane lipids. Quantitative and qualitative assessment of oxidative stress biomarkers is also discussed. Oxidative stress contributes to the pathology of cancer, cardiovascular diseases, diabetes, neurological disorders (Alzheimer's and Parkinson's diseases, Down syndrome), psychiatric diseases (depression, schizophrenia, bipolar disorder), renal disease, lung disease (chronic pulmonary obstruction, lung cancer), and aging. The concerted action of antioxidants to ameliorate the harmful effect of oxidative stress is achieved by antioxidant enzymes (Superoxide dismutases-SODs, catalase, glutathione peroxidase-GPx), and small molecular weight antioxidants (vitamins C and E, flavonoids, carotenoids, melatonin, ergothioneine, and others). Perhaps one of the most effective low molecular weight antioxidants is vitamin E, the first line of defense against the peroxidation of lipids. A promising approach appears to be the use of certain antioxidants (e.g. flavonoids), showing weak prooxidant properties that may boost cellular antioxidant systems and thus act as preventive anticancer agents. Redox metal-based enzyme mimetic compounds as potential pharmaceutical interventions and sirtuins as promising therapeutic targets for age-related diseases and anti-aging strategies are discussed.

Also flagged:Nod-like receptorsinnate immune receptorsorganellestranscription factorspathogenesisrheumatoid arthritis
Journal Article 2023-08-19 No Snippets Madahar SS, Gideon A, Abdul-Sater AA.
Show Full Abstract

Nod-like receptors (NLRs) are innate immune receptors that play a key role in sensing components from pathogens and from damaged cells or organelles. NLRs form signaling complexes that can lead to activation of transcription factors or effector caspases - by means of inflammasome activation -Inflammatory arthritis (IA) culminating in promoting inflammation. An increasing body of research supports the role of NLRs in driving pathogenesis of IA, a collection of diseases that include rheumatoid arthritis (RA), psoriatic arthritis (PsA), ankylosing spondylitis, and pediatric arthritis. In this review, we briefly discuss the main drivers of IA diseases and dive into the evidence for - and against - various NLRs in driving these diseases. We also review the studies examining the use of NLR and inflammasome inhibitors as potential therapies for IA.

Also flagged:Caffeic acidcarbonpathogenesisneurodegenerative disorderscaffeic-acidPD
Journal Article 2023-08-19 No Snippets Kumar J, Delgado SA, Sarma H, Narayan M.
Show Full Abstract

Environmental agents such as pesticides, weedicides and herbicides (collectively referred to as pesticides) are associated with the onset and pathogenesis of neurodegenerative disorders such as Parkinson's (PD) and Alzheimer's (AD) diseases. The development of blood-brain barrier (BBB)-penetrating therapeutic candidates to both prevent and treat the aforementioned xenotoxicant-induced neurodegenerative disorders remains an unmet need. Here, we examine whether caffeic-acid based Carbon Quantum Dots (CACQDs) can intervene in pesticide-associated onset and progress of the PD phenotype. Pulse-chase fluorescence analyses revealed that CACQDs intervene in the soluble-to-toxic transformation of the amyloid-forming protein model Hen Egg White Lysozyme (HEWL). The sp2-rich CACQDs also scavenged free radicals, a milestone along the PD trajectory. In-vitro, CACQDs introduced into a human neuroblastoma-derived cell line (SH-SY5Y) demonstrated negligible cytotoxicity up to 5 mg/mL and protected the cell line against oxidative stress-induced neuronal injury induced by the pesticide and potent neurotoxin, paraquat. Our findings suggest that the potentially BBB-penetrating CACQDs derived from caffeic acid hold promise for mitigating neurodegenerative disorders associated with environmental pesticides and xenobiotic neurotoxicants. Importantly, CACQDs sourced from coffee, coupled with their facile synthesis, represent a sustainable, green chemistry platform for generating interventional candidates in neurodegeneration.

SOX6
Also flagged:metabolismoxygenproteoglycansynthesisextracellular matrixRIF1
Journal Article 2023-08-19 ✓ 1 Snippet Ni W, Zhang H, Mei Z, Hongyi Z, Wu Y, Xu W, Ma Y, Yang W, Liang Y, Gu T, Su Y, Fan S, Shen S, Hu Z.
In-Text Gene Mentions

…sites for PITX1,SOX6, STAT1, JUNB, RUNX1,…

Show Full Abstract

Cartilage homeostasis is essential for chondrocytes to maintain proper phenotype and metabolism. Because adult articular cartilage is avascular, chondrocytes must survive in low oxygen conditions, and changing oxygen tension can significantly affect metabolism and proteoglycan synthesis in these cells. However, whether long noncoding RNA participate in cartilage homeostasis under hypoxia has not been reported yet. Here, we first identified LncZFHX2 as a lncRNA upregulated under physiological hypoxia in cartilage, specifically by HIF-1α. LncZFHX2 knockdown simultaneously accelerated cellular senescence, targeted multiple components of extracellular matrix metabolism, and increased DNA damage in chondrocytes. Through a series of in vitro and in vivo experiments, we identified that LncZFHX2 performed a novel function that regulated RIF1 expression through forming a transcription complex with KLF4 and promoting chondrocyte DNA repair. Moreover, chondrocyte-conditional knockout of LncZFHX2 accelerated injury-induced cartilage degeneration in vivo. In conclusion, we identified a hypoxia-activated DNA repair pathway that maintains matrix homeostasis in osteoarthritis cartilage.

PRDX6
Also flagged:inseminationcarbohydratemetabolismgluconeogenesisPPARRas
Journal Article 2023-08-19 ✓ 1 Snippet Zhang R, Chen Y, Bao P, Wu F, Liang C, Guo X, Chu M, Yan P.
In-Text Gene Mentions

…tase (SOD1), peroxiredoxin-6 (PRDX6), and Parkinson disease…

Show Full Abstract

Sperm cryodamage caused by cryopreservation limits the use of frozen yak spermatozoa in artificial insemination (AI). However, the proteomic changes involved in the cryodamage of yak spermatozoa have not been investigated to date. Therefore, this study aimed to identify proteins related to freezing tolerance. Tandem mass tag (TMT) were used in combination with liquid chromatography-tandem mass spectrometry (LC-MS/MS) for identifying differentially expressed proteins (DEPs) between high-motility (HM) and low-motility (LM) frozen-thawed yak spermatozoa. A total of 116 DEPs were identified (>1.5-fold, P < 0.05); of which, 104 proteins were upregulated in HM spermatozoa and 12 proteins were upregulated in LM spermatozoa. The results of functional annotation analysis revealed that the DEPs were mainly involved in metabolic processes. A total of 20 DEPs that were abundantly expressed in HM spermatozoa were strongly associated with carbohydrate metabolism. The results of KEGG analysis revealed that the DEPs were enriched in glycolysis/gluconeogenesis, PPAR signaling pathway, and Ras signaling pathway. In addition, many antioxidant enzymes such as superoxide dismutase (SOD1), peroxiredoxin-6 (PRDX6), and Parkinson disease protein 7 (PARK7) were upregulated in HM spermatozoa, suggesting that these enzymes affect the motility of spermatozoa by regulating the levels of reactive oxygen species (ROS) in frozen-thawed spermatozoa. Altogether, the findings of this study elucidate the mechanisms through which cryopreservation affects the movement of yak spermatozoa and offer a novel basis for refining freezing techniques and modifying cryopreservation extender components.

DARS2
Also flagged:gene expressionpairingcancerpathogenesistumorcell cycle
Journal Article 2023-08-19 ✓ 1 Snippet Moldogazieva NT, Zavadskiy SP, Astakhov DV, Sologova SS, Margaryan AG, Safrygina AA, Smolyarchuk EA.
In-Text Gene Mentions

Also, upregulation of mitochondrial aspartyl-tRNA synthetase-2 (DARS2) and downregulation of both miR-30e-5p and nuclear factor of activated T-cells 5, the osmoregulatory transcription factor, have been observed in HCC [55].

Show Full Abstract

The vast majority of human transcriptome is represented by various types of small RNAs with little or no protein-coding capability referred to as non-coding RNAs (ncRNAs). Functional ncRNAs include microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs), which are expressed at very low, but stable and reproducible levels in a variety of cell types. ncRNAs regulate gene expression due to miRNA capability of complementary base pairing with mRNAs, whereas lncRNAs and circRNAs can sponge miRNAs off their target mRNAs to act as competitive endogenous RNAs (ceRNAs). Each miRNA can target multiple mRNAs and a single mRNA can interact with several miRNAs, thereby creating miRNA-mRNA, lncRNA-miRNA-mRNA, and circRNA-miRNA-mRNA regulatory networks. Over the past few years, a variety of differentially expressed miRNAs, lncRNAs, and circRNAs (DEMs, DELs, and DECs, respectively) have been linked to cancer pathogenesis. They can exert both oncogenic and tumor suppressor roles. In this review, we discuss the recent advancements in uncovering the roles of DEMs, DELs, and DECs and their networks in aberrant cell signaling, cell cycle, transcription, angiogenesis, and apoptosis, as well as tumor microenvironment remodeling and metabolic reprogramming during hepatocarcinogenesis. We highlight the potential and challenges in the use of differentially expressed ncRNAs as biomarkers for liver cancer diagnosis and prognosis.

HTT
Also flagged:methylationgene expressionserotoninreuptakepanic disorderPD
Journal Article 2023-08-19 ✓ 1 Snippet Zou ZL, Zhang Y, Huang YL, Wang JY, Zhou B, Chen HF.
In-Text Gene Mentions

…studies focusing on5-HTT, 5-HTR1A ,…

Show Full Abstract

<h4>Background</h4>Antidepressants, particularly selective serotonin reuptake inhibitors, are currently considered the first-line treatment for panic disorder (PD). However, little is known about the relationship between the biomarkers that may predict better treatment.<h4>Aim</h4>To compare genome-wide methylation and gene expression patterns between responsive and non-responsive patients with PD after 4 wk of escitalopram treatment.<h4>Methods</h4>Thirty patients with PD were enrolled in this study (responders = 13; non-responders = 17). All patients were assessed using the PD Severity Scale-Chinese version before and after treatment. The Illumina Infinium MethylationEPIC (850k) BeadChip for genome-wide methylation screening and mRNA sequencing was used in all patients with PD.<h4>Results</h4>A total of 701 differentially methylated positions (DMPs) were found between responders and non-responders (|Δβ| ≥ 0.06, <i>q</i> < 0.05), and the hyper- and hypomethylated CpG sites were 511 (72.9%) and 190 (27.1%), respectively. Relative to non-responders, there were 59 differential transcripts, of which 20 were downregulated and 39 were upregulated (<i>q</i> < 0.05). However, no differentially expressed genes were identified by mRNA sequencing after correcting for multiple testing (|log2(FC)| > 1, <i>q</i> > 0.05).<h4>Conclusion</h4>This preliminary study showed that DMPs might be associated with the treatment response to escitalopram in PD; however, these DMPs need to be verified in large samples.

PCDH17
Also flagged:IL1RAPL1CADM2NELL1XYLT1NCAPGLCORL
Journal Article 2023-08-19 ✓ 5 Snippets Wang H, Zhao X, Wen J, Wang C, Zhang X, Ren X, Zhang J, Li H, Muhatai G, Qu L.
In-Text Gene Mentions

…chickens, while thePCDH17and CADM2 genes…

…protocadherin 17 (PCDH17) and cell…

…ST = 0.245997),PCDH17(GGA1: 164790000–164800000, F…

PCDH17has 90 SNPs…

…the cadherin superfamily,PCDH17is expressed by…

Show Full Abstract

Body weight of chicken is a typical quantitative trait, which shows phenotypic variations due to selective breeding. Despite some QTL loci have been obtained, the body weight of native chicken breeds in different geographic regions varies greatly, its genetic basis remains unresolved questions. To address this issue, we analyzed 117 Chinese indigenous chickens from 10 breeds (Huiyang Bearded, Xinhua, Hotan Black, Baicheng You, Liyang, Yunyang Da, Jining Bairi, Lindian, Beijing You, Tibetan). We applied fixation index (F<sub>ST</sub>) analysis to find selected genomic regions and genes associated with body weight traits. Our study suggests that NELL1, XYLT1, and NCAPG/LCORL genes are strongly selected in the body weight trait of Chinese indigenous chicken breeds. In addition, the IL1RAPL1 gene was strongly selected in large body weight chickens, while the PCDH17 and CADM2 genes were strongly selected in small body weight chickens. This result suggests that the patterns of genetic variation of native chicken and commercial chicken, and/or distinct local chicken breeds may follow different evolutionary mechanisms.

Also flagged:bindingSV2AMRbrain disordersSynaptic vesicle glycoprotein 2AUCB-J
Journal Article 2023-08-19 No Snippets Koole M, Lacroix B, Tang C, Chanteux H, Maguire RP, Van Laere K.
Show Full Abstract

<h4>Introduction</h4>Integrated PET-MR scanners can measure simultaneously tracer binding, downstream cerebral blood flow (CBF) and neuronal activation. An integrated GE Signa PET-MR system was used to combine [<sup>11</sup>C]-UCB-J PET scanning with MR Arterial Spin Labeling (ASL) measurements to evaluate the effects of padsevonil (PSL) on SV2A occupancy and CBF simultaneously.<h4>Methods</h4>PET-MR scanning was performed in 10 healthy controls (8M/2F; 27.6 ​± ​10.0 ​yrs) at baseline, and at two timepoints (post1: 2-24h and post2: 6-30h) after administration of a single PSL dose (6.2-100 ​mg). Dynamic [<sup>11</sup>C]-UCB-J PET scanning with arterial blood sampling was performed to estimate distribution volumes and corresponding SV2A occupancies. Simultaneously, MR ASL data were acquired and spatially normalized to Montreal Neurological Institute (MNI) space for voxel wise analysis while brain Volume-Of-Interest (VOI) were defined using a simplified Hammers atlas.<h4>Results</h4>PET measurements showed a SV2A occupancy range of 57-98% and 16-63% and a corresponding PSL plasma concentration range of 3.6-189.23 ​ng/mL and 1.3-9.8 ​ng/mL for post1 and post2, respectively. When comparing post1 to baseline ASL measurements, a VOI-based analysis detected a significant CBF decrease in thalamus, insula, cerebellum, posterior cingulate cortex, and brain stem, which was confirmed by a voxel-wise analysis comparing baseline and post1 ASL measurements and identifying significantly different clusters covering the same brain regions. In addition, we demonstrated CBF recovery in these brain regions for the post2 ASL measurements compared to baseline measurements. For the thalamus, a VOI-based correlation analysis detected a significant correlation between PSL plasma concentration and CBF decrease relative to baseline conditions.<h4>Discussion</h4>A pattern of local and dose dependent CBF decrease was demonstrated following PSL administration. More generally, these findings present the potential of simultaneous PET and ASL measurements to follow the time course of drug effects and to differentiate between the efficacy of different drugs in patient groups.

HTT
Also flagged:synthesisdegradationagingmitochondrialage-related neurological disordersNicotinamide Adenine Dinucleotide
Journal Article 2023-08-18 ✓ 1 Snippet Bresque M, Esteve D, Pehar M, Vargas MR.
In-Text Gene Mentions

HTT

Show Full Abstract

<b><i>Significance:</i></b> Nicotinamide adenine dinucleotide (NAD<sup>+</sup>) participates in redox reactions and NAD<sup>+</sup>-dependent signaling processes, which couples the enzymatic degradation of NAD<sup>+</sup> to posttranslational modifications of proteins or the production of second messengers. Cellular NAD<sup>+</sup> levels are dynamically controlled by synthesis and degradation, and dysregulation of this balance has been associated with acute and chronic neuronal dysfunction. <b><i>Recent Advances:</i></b> A decline in NAD<sup>+</sup> has been observed during normal aging and since aging is the primary risk factor for many neurological disorders, NAD<sup>+</sup> metabolism has become a promising therapeutic target and prolific research field in recent years. <b><i>Critical Issues:</i></b> In many neurological disorders, either as a primary feature or as consequence of the pathological process, neuronal damage is accompanied by dysregulated mitochondrial homeostasis, oxidative stress, or metabolic reprogramming. Modulating NAD<sup>+</sup> availability appears to have a protective effect against such changes observed in acute neuronal damage and age-related neurological disorders. Such beneficial effects could be, at least in part, due to the activation of NAD<sup>+</sup>-dependent signaling processes. <b><i>Future Directions:</i></b> While in many instances the protective effect has been ascribed to the activation of sirtuins, approaches that directly test the role of sirtuins or that target the NAD<sup>+</sup> pool in a cell-type-specific manner may be able to provide further mechanistic insight. Likewise, these approaches may afford greater efficacy to strategies aimed at harnessing the therapeutic potential of NAD<sup>+</sup>-dependent signaling in neurological disorders. <i>Antioxid. Redox Signal</i>. 39, 1150-1166.

Also flagged:behavioralmembrane-beatingNa + /K + pumpNa ++
Journal Article 2023-08-18 No Snippets Erazo-Toscano R, Fomenko M, Core S, Calabrese RL, Cymbalyuk G.
Show Full Abstract

Life-supporting rhythmic motor functions like heart-beating in invertebrates and breathing in vertebrates require an indefatigable generation of a robust rhythm by specialized oscillatory circuits, central pattern generators (CPGs). These CPGs should be sufficiently flexible to adjust to environmental changes and behavioral goals. Continuous self-sustained operation of bursting neurons requires intracellular Na<sup>+</sup> concentration to remain in a functional range and to have checks and balances of the Na<sup>+</sup> fluxes met on a cycle-to-cycle basis during bursting. We hypothesize that at a high excitability state, the interaction of the Na<sup>+</sup>/K<sup>+</sup> pump current, I<sub>pump</sub>, and persistent Na<sup>+</sup> current, I<sub>NaP</sub>, produces a mechanism supporting functional bursting. I<sub>NaP</sub> is a low voltage-activated inward current that initiates and supports the bursting phase. This current does not inactivate and is a significant source of Na<sup>+</sup> influx. I<sub>pump</sub> is an outward current activated by [Na<sup>+</sup>]<sub>i</sub> and is the major source of Na<sup>+</sup> efflux. Both currents are active and counteract each other between and during bursts. We apply a combination of electrophysiology, computational modeling, and dynamic clamp to investigate the role of I<sub>pump</sub> and I<sub>NaP</sub> in the leech heartbeat CPG interneurons (HN neurons). Applying dynamic clamp to introduce additional I<sub>pump</sub> and I<sub>NaP</sub> into the dynamics of living synaptically isolated HN neurons in real time, we show that their joint increase produces transition into a new bursting regime characterized by higher spike frequency and larger amplitude of the membrane potential oscillations. Further increase of I<sub>pump</sub> speeds up this rhythm by shortening burst duration (BD) and interburst interval (IBI).

SOX6
Also flagged:Pcgf1transcription factorsPolycomb group RING finger protein 1neurogenesissomatostatinSst
Journal Article 2023-08-18 ✓ 2 Snippets Putra BP, Ito K, Cirillo C, Sunardi M, Koseki H, Uesaka T, Enomoto H.
In-Text Gene Mentions

…factors, Pbx3 ,Sox6, and Tbx3…

…as Pbx3 ,Sox6, and Tbx3…

Show Full Abstract

The enteric nervous system (ENS) regulates gut functions independently from the central nervous system (CNS) by its highly autonomic neural circuit that integrates diverse neuronal subtypes. Although several transcription factors are shown to be necessary for the generation of some enteric neuron subtypes, the mechanisms underlying neuronal subtype specification in the ENS remain elusive. In this study, we examined the biological function of Polycomb group RING finger protein 1 (PCGF1), one of the epigenetic modifiers, in the development and differentiation of the ENS by disrupting the Pcgf1 gene selectively in the autonomic-lineage cells. Although ENS precursor migration and enteric neurogenesis were largely unaffected, neuronal differentiation was impaired in the Pcgf1-deficient mice, with the numbers of neurons expressing somatostatin (Sst<sup>+</sup> ) decreased in multiple gut regions. Notably, the decrease in Sst<sup>+</sup> neurons was associated with the corresponding increase in calbindin<sup>+</sup> neurons in the proximal colon. These findings suggest that neuronal subtype conversion may occur in the absence of PCGF1, and that epigenetic mechanism is primarily involved in specification of some enteric neuron subtypes.

Also flagged:oxygengene expressionhematopoiesismetabolismcoagulationcoagulation proteins
Journal Article 2023-08-18 No Snippets Goh I, Botting RA, Rose A, Webb S, Engelbert J, Gitton Y, Stephenson E, Quiroga Londoño M, Mather M, Mende N, Imaz-Rosshandler I, Yang L, Horsfall D, Basurto-Lozada D, Chipampe NJ, Rook V, Lee JTH, Ton ML, Keitley D, Mazin P, Vijayabaskar MS, Hannah R, Gambardella L, Green K, Ballereau S, Inoue M, Tuck E, Lorenzi V, Kwakwa K, Alsinet C, Olabi B, Miah M, Admane C, Popescu DM, Acres M, Dixon D, Ness T, Coulthard R, Lisgo S, Henderson DJ, Dann E, Suo C, Kinston SJ, Park JE, Polanski K, Marioni J, van Dongen S, Meyer KB, de Bruijn M, Palis J, Behjati S, Laurenti E, Wilson NK, Vento-Tormo R, Chédotal A, Bayraktar O, Roberts I, Jardine L, Göttgens B, Teichmann SA, Haniffa M.
Show Full Abstract

The extraembryonic yolk sac (YS) ensures delivery of nutritional support and oxygen to the developing embryo but remains ill-defined in humans. We therefore assembled a comprehensive multiomic reference of the human YS from 3 to 8 postconception weeks by integrating single-cell protein and gene expression data. Beyond its recognized role as a site of hematopoiesis, we highlight roles in metabolism, coagulation, vascular development, and hematopoietic regulation. We reconstructed the emergence and decline of YS hematopoietic stem and progenitor cells from hemogenic endothelium and revealed a YS-specific accelerated route to macrophage production that seeds developing organs. The multiorgan functions of the YS are superseded as intraembryonic organs develop, effecting a multifaceted relay of vital functions as pregnancy proceeds.

BTN2A1
Also flagged:tumormajor histocompatibility complexMHCimmune responsesolid tumorsmajor histocompatibility
Journal Article 2023-08-18 ✓ 2 Snippets Zhao Y, Dong P, He W, Zhang J, Chen H.
In-Text Gene Mentions

…chain directly recognizesBTN2A1, which is associated…

…which enables theBTN2A1–BTN3A1 complex to bind…

Show Full Abstract

<h4>Abstract</h4>γδ T cells are a kind of innate immune T cell. They have not attracted sufficient attention because they account for only a small proportion of all immune cells, and many basic factors related to these cells remain unclear. However, in recent years, with the rapid development of tumor immunotherapy, γδ T cells have attracted increasing attention because of their ability to exert cytotoxic effects on most tumor cells without major histocompatibility complex (MHC) restriction. An increasing number of basic studies have focused on the development, antigen recognition, activation, and antitumor immune response of γδ T cells. Additionally, γδ T cell-based immunotherapeutic strategies are being developed, and the number of clinical trials investigating such strategies is increasing. This review mainly summarizes the progress of basic research and the clinical application of γδ T cells in tumor immunotherapy to provide a theoretical basis for further the development of γδ T cell-based strategies in the future.

SOX6
Also flagged:OestrogenneurogenesissynaptogenesisPSD95IGF1behavioural
Journal Article 2023-08-18 ✓ 1 Snippet Sharma DR, Cheng B, Sahu R, Zhang X, Mehdizadeh R, Singh D, Iacobas D, Ballabh P.
In-Text Gene Mentions

…maturation (such asSOX6, SRY‐box transcription…

Show Full Abstract

Prematurely-born infants cared for in the neonatal units suffer from memory and learning deficits. Prematurity diminishes neurogenesis and synaptogenesis in the hippocampal dentate gyrus (DG). This dysmaturation of neurons is attributed to elevated PSD95, NMDR2A, and IGF1 levels. Since oestrogen treatment plays key roles in the development and plasticity of DG, we hypothesized that 17β-estradiol (E2) treatment would ameliorate neurogenesis and synaptogenesis in the DG, reversing cognitive deficits in premature newborns. Additionally, E2-induced recovery would be mediated by IGF1 signalling. These hypotheses were tested in a rabbit model of prematurity and nonmaternal care, in which premature kits were gavage-fed and reared by laboratory personnel. We compared E2- and vehicle-treated preterm kits for morphological, molecular, and behavioural parameters. We also treated kits with oestrogen degrader, RAD1901, and assessed IGF1 signalling. We found that E2 treatment increased the number of Tbr2<sup>+</sup> and DCX<sup>+</sup> neuronal progenitors and increased the density of glutamatergic synapses in the DG. E2 treatment restored PSD95 and NMDAR2A levels and cognitive function in preterm kits. Transcriptomic analyses showed that E2 treatment contributed to recovery by influencing interactions between IGF1R and neurodegenerative, as well as glutamatergic genes. ERα expression was reduced on completion of E2 treatment at D7, followed by D30 elevation. E2-induced fluctuation in ERα levels was associated with a reciprocal elevation in IGF1/2 expression at D7 and reduction at D30. ERα degradation by RAD1901 treatment enhanced IGF1 levels, suggesting ERα inhibits IGF1 expression. E2 treatment alleviates the prematurity-induced maldevelopment of DG and cognitive dysfunctions by regulating ERα and IGF1 levels.

OLFM4
Also flagged:tocellbindinghost cellsmembranesdental caries
Journal Article 2023-08-18 ✓ 1 Snippet Lamont RJ, Hajishengallis G, Koo H.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Microbial species colonizing host ecosystems in health or disease rarely do so alone. Organisms conglomerate into dynamic heterotypic communities or biofilms in which interspecies and interkingdom interactions drive functional specialization of constituent species and shape community properties, including nososymbiocity or pathogenic potential. Cell-to-cell binding, exchange of signaling molecules, and nutritional codependencies can all contribute to the emergent properties of these communities. Spatial constraints defined by community architecture also determine overall community function. Multilayered interactions thus occur between individual pairs of organisms, and the relative impact can be determined by contextual cues. Host responses to heterotypic communities and impact on host surfaces are also driven by the collective action of the community. Additionally, the range of interspecies interactions can be extended by bacteria utilizing host cells or host diet to indirectly or directly influence the properties of other organisms and the community microenvironment. In contexts where communities transition to a dysbiotic state, their quasi-organismal nature imparts adaptability to nutritional availability and facilitates resistance to immune effectors and, moreover, exploits inflammatory and acidic microenvironments for their persistence.

TNFSF4
Also flagged:gastric cancerchronic atrophic gastritisgene expressionCDKG1 phaseMCM7
Journal Article 2023-08-18 ✓ 1 Snippet Selvan TG, Gollapalli P, Kumar SHS, Ghate SD.
In-Text Gene Mentions

…ABHD11, PLOD3, MCM7,TNFSF4, P4HB, CACNA1A, CIDEC,…

Show Full Abstract

<h4>Purpose</h4>It is important to comprehend how the molecular mechanisms shift when gastric cancer in its early stages (GC). We employed integrative bioinformatics approaches to locate various biological signalling pathways and molecular fingerprints to comprehend the pathophysiology of the GC. To facilitate the discovery of their possible biomarkers, a rapid diagnostic may be made, which leads to an improved diagnosis and improves the patient's prognosis.<h4>Methods</h4>Through protein-protein interaction networks, functional differentially expressed genes (DEGs), and pathway enrichment studies, we examined the gene expression profiles of individuals with chronic atrophic gastritis and GC.<h4>Results</h4>A total of 17 DEGs comprising 8 upregulated and 9 down-regulated genes were identified from the microarray dataset from biopsies with chronic atrophic gastritis and GC. These DEGs were primarily enriched for CDK regulation of DNA replication and mitotic M-M/G1 phase pathways, according to KEGG analysis (p > 0.05). We discovered two hub genes, MCM7 and CDC6, in the protein-protein interaction network we obtained for the 17 DEGs (expanded with increased maximum interaction with 110 nodes and 2103 edges). MCM7 was discovered to be up-regulated in GC tissues following confirmation using the GEPIA and Human Protein Atlas databases.<h4>Conclusion</h4>The elevated expression of MCM7 in both chronic atrophic gastritis and GC, as shown by our comprehensive investigation, suggests that this protein may serve as a promising biomarker for the early detection of GC.

OLFM4
Also flagged:organ developmentorganizationcell proliferationlumenWingless-relatedWNT
Journal Article 2023-08-18 ✓ 4 Snippets Zheng X, Betjes MA, Ender P, Goos YJ, Huelsz-Prince G, Clevers H, van Zon JS, Tans SJ.
In-Text Gene Mentions

…Dako, #A0099), rabbit anti-Olfm4(1:500; Cell Signaling…

…TheOlfm4staining was measured…

…Consistently,Olfm4+ cells were…

…correlated with measuredOlfm4staining intensities (fig.…

Show Full Abstract

Organoids are a major new tool to study tissue renewal. However, characterizing the underlying differentiation dynamics remains challenging. Here, we developed TypeTracker, which identifies cell fates by AI-enabled cell tracking and propagating end point fates back along the branched lineage trees. Cells that ultimately migrate to the villus commit to their new type early, when still deep inside the crypt, with important consequences: (i) Secretory cells commit before terminal division, with secretory fates emerging symmetrically in sister cells. (ii) Different secretory types descend from distinct stem cell lineages rather than an omnipotent secretory progenitor. (iii) The ratio between secretory and absorptive cells is strongly affected by proliferation after commitment. (iv) Spatial patterning occurs after commitment through type-dependent cell rearrangements. This "commit-then-sort" model contrasts with the conventional conveyor belt picture, where cells differentiate by moving up the crypt-villus axis and hence raises new questions about the underlying commitment and sorting mechanisms.

Also flagged:HER2ferroptosisdeathxCT transporterGPX4luminal breast cancer
Journal Article 2023-08-18 No Snippets Park SY, Jeong KJ, Poire A, Zhang D, Tsang YH, Blucher AS, Mills GB.
Show Full Abstract

Ferroptosis, a form of programed cell death, can be promoted by inhibitors of the xCT transporter (erastin) or GPX4 (RSL3). We found that GPX4, but not the xCT transporter, is selectively elevated in luminal breast cancer. Consistent with this observation, the majority of luminal breast cancer cell lines are exquisitely sensitive to RSL3 with limited sensitivity to erastin. In RSL3-resistant, but not sensitive, luminal breast cancer cell lines, RSL3 induces HER2 pathway activation. Irreversible HER2 inhibitors including neratinib reversed RSL3 resistance in constitutively RSL3-resistant cell lines. Combination treatment with RSL3 and neratinib increases ferroptosis through mitochondrial iron-dependent reactive oxygen species production and lipid peroxidation. RSL3 also activated replication stress and concomitant S phase and G2/M blockade leading to sensitivity to targeting the DNA damage checkpoint. Together, our data support the exploration of RSL3 combined with irreversible HER2 inhibitors in clinical trials.

HFE
Also flagged:granulesorganellesthrombotic diseasestranscription factorFOG2platelet formation
Journal Article 2023-08-18 ✓ 1 Snippet Akbari P, Vuckovic D, Stefanucci L, Jiang T, Kundu K, Kreuzhuber R, Bao EL, Collins JH, Downes K, Grassi L, Guerrero JA, Kaptoge S, Knight JC, Meacham S, Sambrook J, Seyres D, Stegle O, Verboon JM, Walter K, Watkins NA, Danesh J, Roberts DJ, Di Angelantonio E, Sankaran VG, Frontini M, Burgess S, Kuijpers T, Peters JE, Butterworth AS, Ouwehand WH, Soranzo N, Astle WJ.
In-Text Gene Mentions

…cell traits (e.g.HFE, TFRC ) and…

Show Full Abstract

Blood cells contain functionally important intracellular structures, such as granules, critical to immunity and thrombosis. Quantitative variation in these structures has not been subjected previously to large-scale genetic analysis. We perform genome-wide association studies of 63 flow-cytometry derived cellular phenotypes-including cell-type specific measures of granularity, nucleic acid content and reactivity-in 41,515 participants in the INTERVAL study. We identify 2172 distinct variant-trait associations, including associations near genes coding for proteins in organelles implicated in inflammatory and thrombotic diseases. By integrating with epigenetic data we show that many intracellular structures are likely to be determined in immature precursor cells. By integrating with proteomic data we identify the transcription factor FOG2 as an early regulator of platelet formation and α-granularity. Finally, we show that colocalisation of our associations with disease risk signals can suggest aetiological cell-types-variants in IL2RA and ITGA4 respectively mirror the known effects of daclizumab in multiple sclerosis and vedolizumab in inflammatory bowel disease.

Also flagged:ironerythropoiesisgestationIron deficiencyanemiachronic disease
Journal Article 2023-08-18 No Snippets Bahr TM, Tan S, Smith E, Beauman SS, Schibler KR, Grisby CA, Lowe JR, Bell EF, Laptook AR, Shankaran S, Carlton DP, Rau C, Baserga MC, Flibotte J, Zaterka-Baxter K, Walsh MC, Das A, Christensen RD, Ohls RK, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objectives</h4>To compare serum ferritin and RET-He values among extremely low gestational age neonates ELGANs with other markers of iron-deficient erythropoiesis.<h4>Study design</h4>This is a secondary analysis of the NICHD Darbepoetin Trial. Study data from placebo recipients who had a serum ferritin, a RET-He, and a mean corpuscular volume (MCV) measurement within a 24-hour period were analyzed for correlation.<h4>Results</h4>Mixed linear regression models showed no association between ferritin and RET-He at both early (β = 0.0016, p = 0.40) and late (β = -0.0001, p = 0.96) time points. Positive associations were observed between RET-He and MCV at baseline, early, and late time points (p < 0.01, =0.01, <0.001, respectively), while ferritin was not associated with MCV at any time point.<h4>Conclusions</h4>Our study shows that RET-He is better correlated with MCV as a marker of iron-limited erythropoiesis than ferritin. The results suggest that ferritin is limited as a marker of iron sufficiency in premature infants.<h4>Study identification</h4>FDA IND Number 100138; ClinicalTrials.gov number NCT03169881; NRN ID number NICHD-NRN-0058 (Darbe).

POU3F2
Also flagged:tumorZIC2NFE2FOXJ1KLF15SPIB
Journal Article 2023-08-18 ✓ 5 Snippets Wu Q, Tao X, Luo Y, Zheng S, Lin N, Xie X.
In-Text Gene Mentions

Literature evidences have revealed that down-regulation of POU3F2 could remarkably inhibit the increasing trends of proliferation, clone formation, invasion, and migration abilities induced by BCYRN1 in hepatocellular carcinoma (HCC) cells [45]; transcription factor NFE2-related factor 2 (NRF2) could activate antioxidant programs and influence tumorigenesis and metastasis [46]; FOXJ1 could promote bladder cancer cell growth and regulates warburg effect [47]; KLF15 could inhibit the proliferation and migration of gastric cancer cells via regulating the TFAP2A-AS1/NISCH axis [48]; SPIB acted as a tumor suppressor by activating the NFkB and JNK signaling pathways through MAP4K1 in colorectal cancer cells [49].

…NFE2, FOXJ1, KLF15,POU3F2and SPIB) to…

…model, comprised ofPOU3F2, NFE2, FOXJ1, KLF15,…

…was comprised ofPOU3F2, NFE2, FOXJ1, KLF15,…

…that down-regulation ofPOU3F2could remarkably inhibit…

Show Full Abstract

<h4>Background</h4>This study targeted at developing a robust, prognostic signature based on super-enhancer-related genes (SERGs) to reveal survival prognosis and immune microenvironment of breast cancer.<h4>Methods</h4>RNA-sequencing data of breast cancer were retrieved from The Cancer Genome Atlas (TCGA), 1069 patients of which were randomly assigned into training or testing set in 1:1 ratio. SERGs were downloaded from Super-Enhancer Database (SEdb). After which, a SERGs signature was established based on the training set, with its prognostic value further validated in the testing set. Subsequently, we identified the potential function enrichment and tumor immune infiltration of the model. Moreover, in vitro experiments were completed to further explore the biological functions of ZIC2 gene (one of the risk genes in the prognostic model) in breast cancer.<h4>Results</h4>A risk score system of prognostic value was constructed with 6 SERGs (ZIC2, NFE2, FOXJ1, KLF15, POU3F2 and SPIB) to find patients in high-risk group with significantly worse prognosis in both training and testing sets. In addition, a multivariate regression was established via integrating the 6 genes with age and N stage, indicating well performance by calibration, time-dependent receiver operating characteristic (ROC) analysis and decision curve analysis (DCA). Further analysis demonstrated that tumor-associated pathological processes and pathways were significantly enriched in the high-risk group. In general, the novel SERGs signature could be applied to screen breast cancer with immunosuppressive microenvironment for the risk score was negatively correlated with ESTIMATE score, tumor-infiltration lymphocytes (such as CD4 + and CD8 + T cell), immune checkpoints and chemotactic factors. Furthermore, down-regulation of ZIC2 gene expression inhibited the cell viability, cellular migration and cell cycle of breast cancer cells.<h4>Conclusions</h4>The novel SERGs signature could predict the prognosis of breast cancer; and SERGs might serve as potential therapeutic targets for breast cancer.

SERPINC1
Also flagged:HELLPALTASTLDHFibfetal growth restriction
Journal Article 2023-08-18 ✓ 2 Snippets Jiao Y, Liu Y, Li H, Song Z, Wang S, Zhang J, Li J, Liu J, Wang P, Chen Y.
In-Text Gene Mentions

…(APTT), antithrombin III (ATIII), serum creatinine (Scr),…

…FIB, APTT andATIII, which represent abnormal…

Show Full Abstract

<h4>Background</h4>HELLP syndrome refers to a group of clinical syndromes characterized by hemolysis, elevated liver enzymes and low platelet, and the evidence on the association between proteinuria and the severity of HELLP and its maternal and neonatal outcomes is rare.<h4>Methods</h4>106 pregnant women were assigned to the proteinuric group (24-hUPro ≥ 0.3 g, 79 cases) and the non-proteinuric group (24-hUPro < 0.3 g, 27 cases). The proteinuric group was further divided into three subgroups: mild group (24-hUPro:0.3-2.0 g, 33 cases), moderate group (24-hUPro:2.0-5.0 g, 21 cases) and severe group (24-hUPro: ≥5.0 g, 25 cases). The general clinical data, laboratory indexes, complications and pregnancy outcome and adverse neonatal outcomes of HELLP with or without proteinuric were analyzed.<h4>Results</h4>Compared with proteinuric group, the non-albuminuric group or in the three proteinuric subgroups of HELLP pregnant women's, increased proteinuria was associated with earlier onset gestations, higher incidence of abdominal pain, skin jaundice, headache, blurred vision (p < 0.05 respectively), and also the higher levels of ALT, AST, LDH, Fib, APTT, ATII, proportions of tubular urine and lower levels of ALB, PLT (p < 0.05 respectively). In the three subgroups of the proteinuric group, the ratio of fetal growth restriction, cesarean section and postpartum hemorrhage were compared, and the difference was statistically significant (p < 0.05 respectively). Compared with the proteinuric group, the non-proteinuric group had higher birth weight, birth length, and lower SGA, admission rate in NICU (p < 0.05 respectively). In the three subgroups of the proteinuric group, significant differences were identified in the adverse outcomes of newborns (p < 0.05 respectively), and the incidence of adverse outcomes in neonates tended to be higher. Significant differences were identified in birth weight, birth length, and lower SGA and NICU occupancy rate among the three subgroups (p < 0.05 respectively).<h4>Conclusions</h4>HELLP syndrome is a severe complication of pregnancy, involving multiple systems of the whole body. It has posed a great challenge to obstetricians for its acute onset, dangerous condition, rapid progress, and great harm. Thus, insights into HELLP syndrome should be gained, and early diagnosis, early treatment and timely termination of pregnancy should be conducted to reduce the incidence of maternal and fetal adverse outcomes and improve maternal and fetal prognosis.

CDK5RAP1
Also flagged:PI3KAKTTGF-βMAPKBreast cancerCytokine
Journal Article 2023-08-18 ✓ 1 Snippet Maharati A, Moghbeli M.
In-Text Gene Mentions

…of EGR-1 andCDK5RAP1promoters that up…

Show Full Abstract

Breast cancer (BC) as one of the most common causes of human deaths among women, is always considered one of the global health challenges. Despite various advances in diagnostic and therapeutic methods, a significant percentage of BC patients have a poor prognosis due to the lack of therapeutic response. Therefore, investigating the molecular mechanisms involved in BC progression can improve the therapeutic and diagnostic strategies in these patients. Cytokine and growth factor-dependent signaling pathways play a key role during BC progression. In addition to cytokines and growth factors, long non-coding RNAs (lncRNAs) have also important roles in regulation of such signaling pathways. Therefore, in the present review we discussed the role of lncRNAs in regulation of PI3K/AKT, MAPK, and TGF-β signaling pathways in breast tumor cells. It has been shown that lncRNAs mainly have an oncogenic role through the promotion of these signaling pathways in BC. This review can be an effective step in introducing the lncRNAs inhibition as a probable therapeutic strategy to reduce tumor growth by suppression of PI3K/AKT, MAPK, and TGF-β signaling pathways in BC patients. In addition, considering the oncogenic role and increased levels of lncRNAs expressions in majority of the breast tumors, lncRNAs can be also considered as the reliable diagnostic markers in BC patients.

Also flagged:gene expressionbindinghost genomeretrotransposonstransposonsreverse transcriptase
Journal Article 2023-08-18 No Snippets Gebrie A.
Show Full Abstract

Interspersed repetitions called transposable elements (TEs), commonly referred to as mobile elements, make up a significant portion of the genomes of higher animals. TEs contribute in controlling the expression of genes locally and even far away at the transcriptional and post-transcriptional levels, which is one of their significant functional effects on gene function and genome evolution. There are different mechanisms through which TEs control the expression of genes. First, TEs offer cis-regulatory regions in the genome with their inherent regulatory features for their own expression, making them potential factors for controlling the expression of the host genes. Promoter and enhancer elements contain cis-regulatory sites generated from TE, which function as binding sites for a variety of trans-acting factors. Second, a significant portion of miRNAs and long non-coding RNAs (lncRNAs) have been shown to have TEs that encode for regulatory RNAs, revealing the TE origin of these RNAs. Furthermore, it was shown that TE sequences are essential for these RNAs' regulatory actions, which include binding to the target mRNA. By being a member of cis-regulatory and regulatory RNA sequences, TEs therefore play essential regulatory roles. Additionally, it has been suggested that TE-derived regulatory RNAs and cis-regulatory regions both contribute to the evolutionary novelty of gene regulation. Additionally, these regulatory systems arising from TE frequently have tissue-specific functions. The objective of this review is to discuss TE-mediated gene regulation, with a particular emphasis on the processes, contributions of various TE types, differential roles of various tissue types, based mostly on recent studies on humans.

SUDS3
Also flagged:small cell lung cancersp53SCLCDNA methyltransferase 1DNMT1transcription factor
Journal Article 2023-08-18 ✓ 1 Snippet Biswas S, Kang K, Ng KP, Radivoyevitch T, Schalper K, Zhang H, Lindner DJ, Thomas A, MacPherson D, Gastman B, Schrump DS, Wong KK, Velcheti V, Saunthararajah Y.
In-Text Gene Mentions

…cell lines; meanwhile,cohesin coactivatorscoactivators that oppose…

Show Full Abstract

Small cell lung cancers (SCLCs) rapidly resist cytotoxic chemotherapy and immune checkpoint inhibitor (ICI) treatments. New, non-cross-resistant therapies are thus needed. SCLC cells are committed into neuroendocrine lineage then maturation arrested. Implicating DNA methyltransferase 1 (DNMT1) in the maturation arrests, we find (1) the repression mark methylated CpG, written by DNMT1, is retained at suppressed neuroendocrine-lineage genes, even as other repression marks are erased; (2) DNMT1 is recurrently amplified, whereas Ten-Eleven-Translocation 2 (TET2), which functionally opposes DNMT1, is deleted; (3) DNMT1 is recruited into neuroendocrine-lineage master transcription factor (ASCL1, NEUROD1) hubs in SCLC cells; and (4) DNMT1 knockdown activated ASCL1-target genes and released SCLC cell-cycling exits by terminal lineage maturation, which are cycling exits that do not require the p53/apoptosis pathway used by cytotoxic chemotherapy. Inhibiting DNMT1/corepressors with clinical compounds accordingly extended survival of mice with chemorefractory and ICI-refractory, p53-null, disseminated SCLC. Lineage commitment of SCLC cells can hence be leveraged into non-cytotoxic therapy able to treat chemo/ICI-refractory SCLC.

HFE
Also flagged:Anemiacanceriron deficiencyIDchronic disease anemiamicronutrient deficiencies
Journal Article 2023-08-18 ✓ 1 Snippet Osmola M, Gierej B, Mleczko-Sanecka K, Jończy A, Ciepiela O, Kraj L, Ziarkiewicz-Wróblewska B, Basak GW.
In-Text Gene Mentions

…liver sample withhemochromatosiswas used.…

Show Full Abstract

Anemia and iron deficiency (ID) are common complications in patients with pancreatic ductal adenocarcinoma (PDAC), but their underlying causes remain unclear. This study investigated the incidence and characteristics of anemia and micronutrient deficiencies in PDAC patients before initiating chemotherapy. A total of 103 PDAC patients were included, comprising 67 in the palliative and 36 in the adjuvant groups. The overall incidence of anemia was 42.7% (<i>n</i> = 44), with comparable rates in both groups. Normocytic and normochromic anemia were predominant, with mild and moderate cases observed in 32% and 10.7% of the cohort, respectively. ID was evident in 51.4% of patients, with absolute ID more frequent in the adjuvant than in the palliative group (19.4% vs. 13.4%). Functional ID occurred more often in the palliative than in the adjuvant group (41.8% vs. 25%). Vitamin B12 and folate deficiency occurred in <5% (<i>n</i> = 5) of patients. Furthermore, 8.7% (<i>n</i> = 9) of patients had chronic kidney disease and anemia. To elucidate mechanisms of iron deficiency, the study explored the expression of iron regulators (hepcidin (HEP), ferroportin (FPN), and ZIP14 protein) and mitochondrial mass in PDAC tissue with immunohistochemical (IHC) staining and Perl's Prussian blue to detect iron deposits on available tumor samples (<i>n</i> = 56). ZIP14 expression was significantly higher in less advanced tumors (<i>p</i> = 0.01) and correlated with mitochondrial mass (<i>p</i> < 0.001), potentially indicating its role in local iron homeostasis. However, no significant impact of tissue iron regulators on patient survival was observed. Perl's Prussian blue staining revealed iron deposits within macrophages, but not in pancreatic duct cells. Furthermore, the GEPIA database was used to compare mRNA expression of iron regulators (HEP, FPN, and ZIP14) and other genes encoding iron transport and storage, including Transferrin Receptor Protein 1 (TfR1) and both ferritin chain subunits (FTH and FTL), in PDAC and normal pancreatic samples. FPN, TfR1, FTH, and FTL showed higher expression in tumor tissues, indicating increased iron usage by cancer. ZIP14 expression was higher in the pancreas than in PDAC and was correlated with FPN expression. The study highlights the importance of baseline iron status assessment in managing PDAC patients due to the high incidence of anemia and iron deficiency. Furthermore, ZIP14, in addition to HEP and FPN, may play a crucial role in local iron homeostasis in PDAC patients, providing valuable insights into the underlying mechanisms of iron dysregulation.

HTT
Also flagged:HDcorticosteronemetabolismpyrralineinsulin resistanceexcretion
Journal Article 2023-08-18 ✓ 5 Snippets Speziale R, Montesano C, Di Pietro G, Cicero DO, Summa V, Monteagudo E, Orsatti L.
In-Text Gene Mentions

Huntington’s disease (HD) is caused by a dominant mutation in the huntingtin (HTT) gene, which consists of an abnormal expansion of a gene’s CAG repeat [1,2,3].

This HD model has the floxed neo-cassette removed resulting in a ~2-fold increase in mutant HTT protein in the brain of zQ175DN mice.

The gene mutation codes for an abnormally long glutamine stretch (polyQ) in the huntingtin (HTT) N-terminal sequence (exon 1), leading to the devastating neurodegenerative disease.

…the huntingtin (HTT) gene, which…

…have the mouseHTTexon 1 replaced…

Show Full Abstract

Huntington's disease (HD) is caused by the expansion of a polyglutamine (polyQ)-encoding tract in exon 1 of the huntingtin gene to greater than 35 CAG repeats. It typically has a disease course lasting 15-20 years, and there are currently no disease-modifying therapies available. Thus, there is a need for faithful mouse models of HD to use in preclinical studies of disease mechanisms, target validation, and therapeutic compound testing. A large variety of mouse models of HD were generated, none of which fully recapitulate human disease, complicating the selection of appropriate models for preclinical studies. Here, we present the urinary liquid chromatography-high-resolution mass spectrometry analysis employed to identify metabolic alterations in transgenic R6/2 and zQ175DN knock-in mice. In R6/2 mice, the perturbation of the corticosterone metabolism and the accumulation of pyrraline, indicative of the development of insulin resistance and the impairment of pheromone excretion, were observed. Differently from R6/2, zQ175DN mice showed the accumulation of oxidative stress metabolites. Both genotypes showed alterations in the tryptophan metabolism. This approach aims to improve our understanding of the molecular mechanisms involved in HD neuropathology, facilitating the selection of appropriate mouse models for preclinical studies. It also aims to identify potential biomarkers specific to HD.

HFE
Also flagged:IronDeferoxamineDiabetic NephropathyDNdiabetic microvascular complicationsmetabolism
Journal Article 2023-08-18 ✓ 1 Snippet Feng Y, Jia L, Ma W, Tian C, Du H.
In-Text Gene Mentions

…disease, such ashemochromatosis[ 11 ].…

Show Full Abstract

Diabetic nephropathy (DN) is one of the most devastating diabetic microvascular complications. It has previously been observed that iron metabolism levels are abnormal in diabetic patients. However, the mechanism by which iron metabolism levels affect DN is poorly understood. This study was designed to evaluate the role of iron-chelator deferoxamine (DFO) in the improvement of DN. Here, we established a DN rat model induced by diets high in carbohydrates and fat and streptozotocin (STZ) injection. Our data demonstrated that DFO treatment for three weeks greatly attenuated renal dysfunction as evidenced by decreased levels of urinary albumin, blood urea nitrogen, and serum creatinine, which were elevated in DN rats. Histopathological observations showed that DFO treatment improved the renal structures of DN rats and preserved podocyte integrity by preventing the decrease of transcripts of nephrin and podocin. In addition, DFO treatment reduced the overexpression of fibronectin 1, collagen I, IL-1β, NF-κB, and MCP-1 in DN rats, as well as inflammatory cell infiltrates and collagenous fibrosis. Taken together, our findings unveiled that iron chelation via DFO injection had a protective impact on DN by alleviating inflammation and fibrosis, and that it could be a potential therapeutic strategy for DN.

Also flagged:CD105CD73OCT4NANOGSOX2MYC
Journal Article 2023-08-18 No Snippets Ma L, He X, Wu Q.
Show Full Abstract

Wharton's jelly-derived mesenchymal stem cells (WJ-MSCs) are isolated from Wharton's jelly tissue of umbilical cords. They possess the ability to differentiate into lineage cells of three germ layers. WJ-MSCs have robust proliferative ability and strong immune modulation capacity. They can be easily collected and there are no ethical problems associated with their use. Therefore, WJ-MSCs have great tissue engineering value and clinical application prospects. The identity and functions of WJ-MSCs are regulated by multiple interrelated regulatory mechanisms, including transcriptional regulation and epigenetic modifications. In this article, we summarize the latest research progress on the genetic/epigenetic regulation mechanisms and essential signaling pathways that play crucial roles in pluripotency and differentiation of WJ-MSCs.

Also flagged:Astragaloside IVtetracyclictriterpenoidsaponinlanolin ester alcohollymphocyte proliferation
Journal Article 2023-08-18 No Snippets Liang Y, Chen B, Liang D, Quan X, Gu R, Meng Z, Gan H, Wu Z, Sun Y, Liu S, Dou G.
Show Full Abstract

Astragaloside IV (AS-IV) is one of the main active components extracted from the Chinese medicinal herb Astragali and serves as a marker for assessing the herb's quality. AS-IV is a tetracyclic triterpenoid saponin in the form of lanolin ester alcohol and exhibits various biological activities. This review article summarizes the chemical structure of AS-IV, its pharmacological effects, mechanism of action, applications, future prospects, potential weaknesses, and other unexplored biological activities, aiming at an overall analysis. Papers were retrieved from online electronic databases, such as PubMed, Web of Science, and CNKI, and data from studies conducted over the last 10 years on the pharmacological effects of AS-IV as well as its impact were collated. This review focuses on the pharmacological action of AS-IV, such as its anti-inflammatory effect, including suppressing inflammatory factors, increasing T and B lymphocyte proliferation, and inhibiting neutrophil adhesion-associated molecules; antioxidative stress, including scavenging reactive oxygen species, cellular scorching, and regulating mitochondrial gene mutations; neuroprotective effects, antifibrotic effects, and antitumor effects.

Also flagged:Pancreatic cancercancermalignant tumorsexcretiontumorpeptide
Journal Article 2023-08-18 No Snippets Wang S, Qi G, Zhang Z, Yin Q, Li N, Li Z, Shi G, Hu H, Hao L.
Show Full Abstract

Clinically, magnetic resonance imaging (MRI) often uses contrast agents (CAs) to improve image contrast, but single-signal MRI CAs are often susceptible to calcification, hemorrhage, and magnetic sensitivity. Herein, iron acetylacetone and gadolinium acetylacetone were used as raw materials to synthesize a T<sub>1</sub>-T<sub>2</sub> dual-mode imaging gadolinium-doped iron oxide (GdIO) nanocluster. Moreover, to endow the nanoclusters with targeting properties and achieve antitumor effects, the cyclic Arg-Gly-Asp (cRGD) peptide and docetaxel (DTX) were attached to the nanocluster surface, and the efficacy of the decorated nanoclusters against pancreatic cancer was evaluated. The final synthesized material cRGD-GdIO-DTX actively targeted α<sub>v</sub>β<sub>3</sub> on the surface of Panc-1 pancreatic cancer cells. Compared with conventional passive targeting, the enrichment of cRGD-GdIO-DTX in tumor tissues improved, and the diagnostic accuracy was significantly enhanced. Moreover, the acidic tumor microenvironment triggered the release of DTX from cRGD-GdIO-DTX, thus achieving tumor treatment. The inhibition of the proliferation of SW1990 and Panc-1 pancreatic cancer cells by cRGD-GdIO-DTX was much stronger than that by the untargeted GdIO-DTX and free DTX in vitro. In addition, in a human pancreatic cancer xenograft model, cRGD-GdIO-DTX considerably slowed tumor development and demonstrated excellent magnetic resonance enhancement. Our results suggest that cRGD-GdIO-DTX has potential applications for the precise diagnosis and efficient treatment of pancreatic cancer.

Also flagged:Dichloromethanedihydrosanguinarineα2-adrenoreceptorsGABA A receptorseye infectionsdermatoses
Journal Article 2023-08-18 No Snippets Yáñez-Barrientos E, Barragan-Galvez JC, Hidalgo-Figueroa S, Reyes-Luna A, Gonzalez-Rivera ML, Cruz Cruz D, Isiordia-Espinoza MA, Deveze-Álvarez MA, Villegas Gómez C, Alonso-Castro AJ.
Show Full Abstract

<i>Argemone ochroleuca</i> Sweet (Papaveraceae) is used in folk medicine as a sedative and hypnotic agent. This study aimed to evaluate the anxiolytic-like, sedative, antidepressant-like, and anticonvulsant activities of a dichloromethane extract of <i>A. ochroleuca</i> stems (AOE), chemically standardized using gas chromatography-mass spectrometry (GC-MS), and its active compound dihydrosanguinarine (DHS). The anxiolytic-like, sedative, antidepressant-like, and anticonvulsant activities of the AOE (0.1-50 mg/kg p.o.) and DHS (0.1-10 mg/kg p.o.) were evaluated using murine models. A possible mechanism for the neurological actions induced by the AOE or DHS was assessed using inhibitors of neurotransmission pathways and molecular docking. Effective dose 50 (ED<sub>50</sub>) values were calculated by a linear regression analysis. The AOE showed anxiolytic-like activity in the cylinder exploratory test (ED<sub>50</sub> = 33 mg/kg), and antidepressant-like effects in the forced swimming test (ED<sub>50</sub> = 3 mg/kg) and the tail suspension test (ED<sub>50</sub> = 23 mg/kg), whereas DHS showed anxiolytic-like activity (ED<sub>50</sub> = 2 mg/kg) in the hole board test. The AOE (1-50 mg/kg) showed no locomotive affectations or sedation in mice. A docking study revealed the affinity of DHS for α2-adrenoreceptors and GABA<sub>A</sub> receptors. The anxiolytic-like and anticonvulsant effects of the AOE are due to GABAergic participation, whereas the antidepressant-like effects of the AOE are due to the noradrenergic system. The noradrenergic and GABAergic systems are involved in the anxiolytic-like actions of DHS.

Also flagged:chromosomesAIM1FOXO3SLC36A4INTUTDRD5
Journal Article 2023-08-18 No Snippets Fang X, Ye H, Zhang S, Guo L, Xu Y, Zhang D, Nie Q.
Show Full Abstract

Yellow-feather broilers take a large portion of poultry industry in China due to its meat characteristics. Improving the growth traits of yellow-feathered broilers will have great significance for the Chinese poultry market. The current study was designed to investigate the potential genetic factors using the weighted single-step genome-wide association study (wssGWAS) method, which takes consideration of more factors including pedigree, sex, environment and has more accuracy than traditional GWAS. The yellow-feather dwarf chickens from Wens Nanfang Poultry Breeding Co. Ltd. were revolved to recode 9 growth traits: Average daily gain (ADG), body weight (BW) at 45 d, 49 d, 56 d, 63 d, 70 d, 77 d, 84 d, 91 d for analysis. For the results, the region 4.63 to 5.03 Mb on chromosome 15, which was the QTL overlapped in BW45, BW49, BW56, BW63, BW84, might be the crucial genetic region for growth traits. Seven GO terms and 3 KEGG pathways, GO:0005200, GO:0005882, GO:0045111, GO:0099513, GO:0099081, GO:0099512, GO:0099080, KEGG:gga04020, KEGG:gga04540, KEGG:gga04210, were detected to relevant with growth traits. The genes enriched in these biological processes (NRAS, TUBB1, ADORA2B, NTRK3, NGF, TNNC2, F-KER, LOC429492, LOC431325, LOC431324, LOC396480) might have the function in growth of yellow-feather broilers.

TNFSF4
Also flagged:tumorcolorectal cancercancerspolymeraseRNASE1F13A1
Journal Article 2023-08-18 ✓ 1 Snippet Gao H, Ma L, Zou Q, Hu B, Cai K, Sun Y, Lu L, Ren D.
In-Text Gene Mentions

…with VTCN1, TNFSF9,TNFSF4, PDCD1LG2, NRP1, LAIR1,…

Show Full Abstract

<h4>Background</h4>Accumulating research substantiated that tumor-associated macrophages (TAMs) have a significant impact on the tumorigenesis, progression, and distant metastasis, representing a novel target for various cancers. However, the underlying dynamic changes and interactions between TAMs and tumor cells remain largely elusive in colorectal cancer (CRC).<h4>Methods</h4>We depicted the dynamic changes of macrophages using sing-cell RNA-seq data and extracted TAM differentiation-related genes. Next, we utilized the weighted gene co-expression network analysis (WGCNA) to acquire CMS-related modular genes using bulk RNA-seq data. Finally, we utilized univariate Cox and Lasso Cox regression analyses to identify TAM differentiation-related biomarkers and established a novel risk signature model. We employed quantitative real-time polymerase chain reaction (qRT-PCR) on CRC tissue samples and used immunohistochemistry (IHC) data frome the HPA database to validate the mRNA and protein expression of prognostic genes. The interaction of TAMs and each consensus molecular subtype (CMS) subpopulation was analyzed at the cellular level.<h4>Results</h4>A total of 47,285 cells from single-cell dataset and 1197 CRC patients from bulk dataset were obtained. Among those, 6400 myeloid cells were re-clustered and annotated. RNASE1, F13A1, DAPK1, CLEC10A, RPN2, REG4 and RGS19 were identified as prognostic genes and the risk signature model was established based on the above genes. The qRT-PCR analysis indicated that the expression of RNASE1 and DAPK1 were significantly up-regulated in CRC tumor tissues. The cell-cell communication analysis demonstrated complex interactions between TAMs and CMS malignant cell subpopulations.<h4>Conclusion</h4>This study presents an in-depth dissection of the dynamic features of TAMs in the tumor microenvironment and provides promising therapeutic targets for CRC.

Also flagged:methylationtelomeressodiumphosphatasedepressioncognitive impairment
Journal Article 2023-08-18 No Snippets Van Assche E, Hohoff C, Zang J, Knight MJ, Baune BT.
Show Full Abstract

<h4>Introduction</h4>The etiology of major depressive disorder (MDD) involves the interaction between genes and environment, including treatment. Early molecular signatures for treatment response and remission are relevant in a context of personalized medicine and stratification and reduce the time-to-decision. Therefore, we focused the analyses on patients that responded or remitted following a cognitive intervention of 8 weeks.<h4>Methods</h4>We used data from a randomized controlled trial (RCT) with MDD patients (<i>N</i> = 112) receiving a cognitive intervention. At baseline and 8 weeks, blood for DNA methylation (Illumina Infinium MethylationEPIC 850k BeadChip) was collected, as well as MADRS. First, responders (<i>N</i> = 24; MADRS-reduction of at least 50%) were compared with non-responders (<i>N</i> = 60). Then, we performed longitudinal within-individual analyses, for response (<i>N</i> = 21) and for remission (<i>N</i> = 18; MADRS smaller or equal to 9 and higher than 9 at baseline), respectively, as well as patients with no change in MADRS over time. At 8 weeks the sample comprised 84 individuals; 73 patients had DNA methylation for both time-points. The RnBeads package (R) was used for data cleaning, quality control, and differential DNA-methylation (limma). The within-individual paired longitudinal analysis was performed using Welch's <i>t</i>-test. Subsequently gene-ontology (GO) pathway analyses were performed.<h4>Results</h4>No CpG was genome-wide significant CpG (<i>p</i> < 5 × 10<sup>-8</sup>). The most significant CpG in the differential methylation analysis comparing response versus non-response was in the <i>IQSEC1</i> gene (cg01601845; <i>p</i> = 1.53 × 10<sup>-6</sup>), linked to neurotransmission. The most significant GO-terms were linked to telomeres. The longitudinal response analysis returned 67 GO pathways with a <i>p</i> < 0.05. Two of the three most significant pathways were linked to sodium transport. The analysis for remission returned 46 GO terms with a <i>p</i>-value smaller than 0.05 with pathways linked to phosphatase regulation and synaptic functioning. The analysis with stable patients returned mainly GO-terms linked to basic cellular processes.<h4>Discussion</h4>Our result suggest that DNA methylation can be suitable to capture early signs of treatment response and remission following a cognitive intervention in depression. Despite not being genome-wide significant, the CpG locations and GO-terms returned by our analysis comparing patients with and without cognitive impairment, are in line with prior knowledge on pathways and genes relevant for depression treatment and cognition. Our analysis provides new hypotheses for the understanding of how treatment for depression can act through DNA methylation and induce response and remission.

NEGR1
Also flagged:obesitynon-communicable diseasesSynthesiscommunicable diseasescardiovascular diseasetype 2 diabetes
Journal Article 2023-08-18 ✓ 5 Snippets Pledger SL, Ahmadizar F.
In-Text Gene Mentions

…between TMEM18 ,neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1) , FTO…

…FTO, TMEM18 andNEGR1gene variants to…

…TMEM18 rs7561317 andNEGR1rs2815752 ( 37…

…NCD, non-communicable disease;NEGR1, neuronal growth regulator…

Show Full Abstract

<h4>Background</h4>Obesity represents a major and preventable global health challenge as a complex disease and a modifiable risk factor for developing other non-communicable diseases. In recent years, obesity prevalence has risen more rapidly in low- and middle-income countries (LMICs) compared to high-income countries (HICs). Obesity traits are shown to be modulated by an interplay of genetic and environmental factors such as unhealthy diet and physical inactivity in studies from HICs focused on populations of European descent; however, genetic heterogeneity and environmental differences prevent the generalisation of study results to LMICs. Primary research investigating gene-environment interactions (GxE) on obesity in LMICs is limited but expanding. Synthesis of current research would provide an overview of the interactions between genetic variants and environmental factors that underlie the obesity epidemic and identify knowledge gaps for future studies.<h4>Methods</h4>Three databases were searched systematically using a combination of keywords such as "genes", "obesity", "LMIC", "diet", and "physical activity" to find all relevant observational studies published before November 2022.<h4>Results</h4>Eighteen of the 1,373 articles met the inclusion criteria, of which one was a genome-wide association study (GWAS), thirteen used a candidate gene approach, and five were assigned as genetic risk score studies. Statistically significant findings were reported for 12 individual SNPs; however, most studies were small-scale and without replication.<h4>Conclusion</h4>Although the results suggest significant GxE interactions on obesity in LMICs, updated robust statistical techniques with more precise and standardised exposure and outcome measurements are necessary for translatable results. Future research should focus on improved quality replication efforts, emphasising large-scale and long-term longitudinal study designs using multi-ethnic GWAS.

HTT
Also flagged:Huntingtinstriatal atrophysegmentationbrain atrophyprionnucleus
Journal Article 2023-08-18 ✓ 5 Snippets Liu CF, Younes L, Tong XJ, Hinkle JT, Wang M, Phatak S, Xu X, Bu X, Looi V, Bang J, Tabrizi SJ, Scahill RI, Paulsen JS, Georgiou-Karistianis N, Faria AV, Miller MI, Ratnanather JT, Ross CA.
In-Text Gene Mentions

Huntington’s disease (HD) is caused by a CAG repeat expansion in the Huntingtin gene (HTT) on chromosome 4, which codes for polyglutamine in the Huntingtin protein (Htt).

These results support (but certainly do not prove) the hypothesis of circuit-based spread of pathology in Huntington’s disease, possibly due to spread of mutant Htt protein, though other connection-based mechanisms are possible.

Huntington’s disease is caused by a CAG repeat expansion in the Huntingtin gene (HTT), coding for polyglutamine in the Huntingtin protein, with longer CAG repeats causing earlier age of onset.

The age of onset of HD is strongly influenced by the length of the CAG trinucleotide expansion within the Huntingtin (HTT) gene.

These results support (though certainly do not prove) the hypothesis of circuit-based spread of pathology in HD, possibly due to spread of mutant Htt protein, supporting therapeutic targets related to prion-like spread of pathology or other connection-based mechanisms.

Show Full Abstract

Huntington's disease is caused by a CAG repeat expansion in the Huntingtin gene (<i>HTT</i>), coding for polyglutamine in the Huntingtin protein, with longer CAG repeats causing earlier age of onset. The variable 'Age' × ('CAG'-L), where 'Age' is the current age of the individual, 'CAG' is the repeat length and L is a constant (reflecting an approximation of the threshold), termed the 'CAG Age Product' (CAP) enables the consideration of many individuals with different CAG repeat expansions at the same time for analysis of any variable and graphing using the CAG Age Product score as the X axis. Structural MRI studies have showed that progressive striatal atrophy begins many years prior to the onset of diagnosable motor Huntington's disease, confirmed by longitudinal multicentre studies on three continents, including PREDICT-HD, TRACK-HD and IMAGE-HD. However, previous studies have not clarified the relationship between striatal atrophy, atrophy of other basal ganglia structures, and atrophy of other brain regions. The present study has analysed all three longitudinal datasets together using a single image segmentation algorithm and combining data from a large number of subjects across a range of CAG Age Product score. In addition, we have used a strategy of normalizing regional atrophy to atrophy of the whole brain, in order to determine which regions may undergo preferential degeneration. This made possible the detailed characterization of regional brain atrophy in relation to CAG Age Product score. There is dramatic selective atrophy of regions involved in the basal ganglia circuit-caudate, putamen, nucleus accumbens, globus pallidus and substantia nigra. Most other regions of the brain appear to have slower but steady degeneration. These results support (but certainly do not prove) the hypothesis of circuit-based spread of pathology in Huntington's disease, possibly due to spread of mutant Htt protein, though other connection-based mechanisms are possible. Therapeutic targets related to prion-like spread of pathology or other mechanisms may be suggested. In addition, they have implications for current neurosurgical therapeutic approaches, since delivery of therapeutic agents solely to the caudate and putamen may miss other structures affected early, such as nucleus accumbens and output nuclei of the striatum, the substantia nigra and the globus pallidus.

HFE
Also flagged:hepatocellular carcinomapathogenesisliver cirrhosisAFPALTAST
Journal Article 2023-08-17 ✓ 1 Snippet Abdo SM, Shousha WG, Mohamed AA, Elshobaky M, Saleh M, Ali MMA.
In-Text Gene Mentions

…disorders such ashemochromatosisand α1-antitrypsin deficiency…

Show Full Abstract

<h4>Background</h4>Up to date, a well-defined microRNAs (miRNAs) profile involved in hepatocellular carcinoma (HCC) pathogenesis remains indecisive. Thus, employing miRNAs for HCC diagnosis is demanded for early therapeutic interventions. We aimed to evaluate the usage of miRNAs set related to the SuperPath: miRNAs involved in DNA damage response pathway as effective biomarkers for HCV-related HCC diagnosis.<h4>Results</h4>The study enrolled 97 patients with HCV-related HCC, 84 with hepatitis C virus (HCV), 97 with liver cirrhosis (LC), and 84 healthy individuals. Serum miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 were quantified using qRT-PCR experiments, AFP and routine LFTs were estimated via standard techniques. Pathway enrichment analysis along with the construction of miRNAs regulatory network were performed. With respect to healthy individuals, miRNA-203, miRNA-100-5p, and miRNA-16 were significantly downregulated in HCC, HCV, and LC groups, while miRNA-23a showed significant upregulation (p < 0.001). miRNAs exhibited significant correlations with AFP, ALT, AST, and albumin. Also, elevated levels of miRNA-23a were recognized in patients with multiple focal lesions and/or lesion size > 5 cm. Additionally, the diagnostic performance of miRNA-23a expression level at a selected cut-off value of 3.99 overtakes AFP, while expressions of miR-203, miRNA-100-5p, and miRNA-16 represent poor diagnostic outcomes.<h4>Conclusions</h4>Keeping in mind the individual variability and high level of heterogeneity in HCC, our data revealed the diagnostic value of miRNA-23a expression in HCV-related HCC patients. Further extra in silico HCC-specific microRNAs sets are demanded in diagnosis.

Also flagged:Sickle Cell DiseaseArgininevaso-occlusive episodesL-arginineopioidmitochondrial
Journal Article 2023-08-17 No Snippets Rees CA, Brousseau DC, Cohen DM, Villella A, Dampier C, Brown K, Campbell A, Chumpitazi CE, Airewele G, Chang T, Denton C, Ellison A, Thompson A, Ahmad F, Bakshi N, Coleman KD, Leibovich S, Leake D, Hatabah D, Wilkinson H, Robinson M, Casper TC, Vichinsky E, Morris CR, SCD Arginine Study Group and PECARN.
Show Full Abstract

<h4>Background</h4>Despite substantial illness burden and healthcare utilization conferred by pain from vaso-occlusive episodes (VOE) in children with sickle cell disease (SCD), disease-modifying therapies to effectively treat SCD-VOE are lacking. The aim of the Sickle Cell Disease Treatment with Arginine Therapy (STArT) Trial is to provide definitive evidence regarding the efficacy of intravenous arginine as a treatment for acute SCD-VOE among children, adolescents, and young adults.<h4>Methods</h4>STArT is a double-blind, placebo-controlled, randomized, phase 3, multicenter trial of intravenous arginine therapy in 360 children, adolescents, and young adults who present with SCD-VOE. The STArT Trial is being conducted at 10 sites in the USA through the Pediatric Emergency Care Applied Research Network (PECARN). Enrollment began in 2021 and will continue for 5 years. Within 12 h of receiving their first dose of intravenous opioids, enrolled participants are randomized 1:1 to receive either (1) a one-time loading dose of L-arginine (200 mg/kg with a maximum of 20 g) administered intravenously followed by a standard dose of 100 mg/kg (maximum 10 g) three times a day or (2) a one-time placebo loading dose of normal saline followed by normal saline three times per day at equivalent volumes and duration as the study drug. Participants, research staff, and investigators are blinded to the participant's randomization. All clinical care is provided in accordance with the institution-specific standard of care for SCD-VOE based on the 2014 National Heart, Lung, and Blood Institute guidelines. The primary outcome is time to SCD-VOE pain crisis resolution, defined as the time (in hours) from study drug delivery to the last dose of parenteral opioid delivery. Secondary outcomes include total parental opioid use and patient-reported outcomes. In addition, the trial will characterize alterations in the arginine metabolome and mitochondrial function in children with SCD-VOE.<h4>Discussion</h4>Building on the foundation of established relationships between emergency medicine providers and hematologists in a multicenter research network to ensure adequate participant accrual, the STArT Trial will provide definitive information about the efficacy of intravenous arginine for the treatment of SCD-VOE for children.<h4>Trial registration</h4>The STArT Trial was registered in ClinicalTrials.gov on April 9, 2021, and enrollment began on June 21, 2021 (NCT04839354).

Also flagged:Endometrial cancergynaecologicalendometrioid tumourscarcinosarcomasmetaplastic tumoursTumour
Journal Article 2023-08-17 No Snippets Brown M, Leon A, Kedzierska K, Moore C, Belnoue-Davis HL, Flach S, Lydon JP, DeMayo FJ, Lewis A, Bosse T, Tomlinson I, Church DN.
Show Full Abstract

High-risk endometrial cancer has poor prognosis and is increasing in incidence. However, understanding of the molecular mechanisms which drive this disease is limited. We used genetically engineered mouse models (GEMM) to determine the functional consequences of missense and loss of function mutations in Fbxw7, Pten and Tp53, which collectively occur in nearly 90% of high-risk endometrial cancers. We show that Trp53 deletion and missense mutation cause different phenotypes, with the latter a substantially stronger driver of endometrial carcinogenesis. We also show that Fbxw7 missense mutation does not cause endometrial neoplasia on its own, but potently accelerates carcinogenesis caused by Pten loss or Trp53 missense mutation. By transcriptomic analysis, we identify LEF1 signalling as upregulated in Fbxw7/FBXW7-mutant mouse and human endometrial cancers, and in human isogenic cell lines carrying FBXW7 mutation, and validate LEF1 and the additional Wnt pathway effector TCF7L2 as novel FBXW7 substrates. Our study provides new insights into the biology of high-risk endometrial cancer and suggests that targeting LEF1 may be worthy of investigation in this treatment-resistant cancer subgroup.

Also flagged:transitionrutheniumvesiclesmembraneorganellesorganelle
Journal Article 2023-08-17 No Snippets Oerlemans RAJF, Shao J, van Stevendaal MHME, Wu H, Patiño Padial T, Abdelmohsen LKEA, van Hest JCM.
Show Full Abstract

The application of transition-metal catalysts in living cells presents a promising approach to facilitate reactions that otherwise would not occur in nature. However, the usage of metal complexes is often restricted by their limited biocompatibility, toxicity, and susceptibility to inactivation and loss of activity by the cell's defensive mechanisms. This is especially relevant for ruthenium-mediated reactions, such as ring-closing metathesis. In order to address these issues, we have incorporated the second-generation Hoveyda-Grubbs catalyst (HGII) into polymeric vesicles (polymersomes), which were composed of biodegradable poly(ethylene glycol)-<i>b</i>-poly(caprolactone-<i>g</i>-trimethylene carbonate) [PEG-<i>b</i>-P(CL-<i>g</i>-TMC)] block copolymers. The catalyst was either covalently or non-covalently introduced into the polymersome membrane. These polymersomes were able to act as artificial organelles that promote endosomal ring-closing metathesis for the intracellular generation of a fluorescent dye. This is the first example of the use of a polymersome-based artificial organelle with an active ruthenium catalyst for carbon-carbon bond formation.

Also flagged:melanomaglycoproteincancerinfectious diseasesmelanomastumor
Journal Article 2023-08-17 No Snippets Rodrigues EG, Dobroff AS, Arruda DC, Tada DB, Paschoalin T, Polonelli L.
Show Full Abstract

Luiz Rodolpho Travassos, a Brazilian scientist recognized in several areas of research, began his studies in the field of oncology in the late 1970s when he took a sabbatical at the Memorial Sloan Kettering Cancer Center, NY, USA. At that time, the discovery and characterization of human melanoma glycoprotein antigens yielded important publications. This experience allowed 16 years later, and Dr. Travassos founded UNONEX, significantly contributing with discoveries in the area of oncology and training of researchers. This review will address all the contributions of team of researchers who, together with Dr. Travassos, collaborated with investigations into molecules and processes that lead to the development of melanoma.

Also flagged:grapheneCoVID-19bindingSpike proteinplatinumbiotin
Journal Article 2023-08-17 No Snippets Moreira G, Qian H, Datta SPA, Bliznyuk N, Carpenter J, Dean D, McLamore E, Vanegas D.
Show Full Abstract

SARS-CoV-2 virus induced CoVID-19 pandemic has accelerated the development of diagnostic tools. Devices integrated with electrochemical biosensors may be an interesting alternative to respond to the high demand for testing, particularly in contexts where access to standard detection technologies is lacking. Aptamers as recognition elements are useful due to their stability, specificity, and sensitivity to binding target molecules. We have developed a non-invasive electrochemical aptamer-based biosensor targeting SARS-CoV-2 in human saliva. The aptamer is expected to detect the Spike protein of SARS-CoV-2 wildtype and its variants. Laser-induced graphene (LIG) electrodes coated with platinum nanoparticles were biofunctionalized with a biotin-tagged aptamer. Electrochemical Impedance Spectroscopy (EIS) for BA.1 sensing was conducted in sodium chloride/sodium bicarbonate solution supplemented with pooled saliva. To estimate sensing performance, the aptasensor was tested with contrived samples of UV-attenuated virions from 10 to 10,000 copies/ml. Selectivity was assessed by exposing the aptasensor to non-targeted viruses (hCoV-OC43, Influenza A, and RSV-A). EIS data outputs were further used to select a suitable response variable and cutoff frequency. Capacitance increases in response to the gradual loading of the attenuated BA.1. The aptasensor was sensitive and specific for BA.1 at a lower viral load (10-100 copies/ml) and was capable of discriminating between negative and positive contrived samples (with strain specificity against other viruses: OC43, Influenza A, and RSV-A). The aptasensor detected SARS-CoV-2 with an estimated LOD of 1790 copies/ml in contrived samples. In human clinical samples, the aptasensor presents an accuracy of 72%, with 75% of positive percent of agreement and 67% of negative percent of agreement. Our results show that the aptasensor is a promising candidate to detect SARS-CoV-2 during early stages of infection when virion concentrations are low, which may be useful for preventing the asymptomatic spread of CoVID-19.

HTT
Also flagged:Huntington diseaseHDneurodegenerative disordermethoxybindingHuntingtin
Journal Article 2023-08-17 ✓ 3 Snippets Bertoglio D, Weiss AR, Liguore W, Martin LD, Hobbs T, Templon J, Srinivasan S, Dominguez C, Munoz-Sanjuan I, Khetarpal V, Verhaeghe J, Staelens S, Link J, Liu L, Bard JA, McBride JL.
In-Text Gene Mentions

Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by an expanded polyglutamine (CAG) repeat in exon 1 of the huntingtin (HTT) gene (1,2).

Huntington disease (HD) is a neurodegenerative disorder caused by an expanded polyglutamine (CAG) trinucleotide expansion in the huntingtin (HTT) gene that encodes the mutant huntingtin protein (mHTT).

…the huntingtin (HTT) gene that…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disorder caused by an expanded polyglutamine (CAG) trinucleotide expansion in the huntingtin (<i>HTT</i>) gene that encodes the mutant huntingtin protein (mHTT). Visualization and quantification of cerebral mHTT will provide a proxy for target engagement and a means to evaluate therapeutic interventions aimed at lowering mHTT in the brain. Here, we validated the novel radioligand <sup>11</sup>C-labeled 6-(5-((5-methoxypyridin-2-yl)methoxy)benzo[d]oxazol-2-yl)-2-methylpyridazin-3(2H)-one (<sup>11</sup>C-CHDI-180R) using PET imaging to quantify cerebral mHTT aggregates in a macaque model of HD. <b>Methods:</b> Rhesus macaques received MRI-guided intrastriatal delivery of a mixture of AAV2 and AAV2.retro viral vectors expressing an HTT fragment bearing 85 CAG repeats (85Q, <i>n</i> = 5), a control HTT fragment bearing 10 CAG repeats (10Q, <i>n</i> = 4), or vector diluent only (phosphate-buffered saline, <i>n</i> = 5). Thirty months after surgery, 90-min dynamic PET/CT imaging was used to investigate <sup>11</sup>C-CHDI-180R brain kinetics, along with serial blood sampling to measure input function and stability of the radioligand. The total volume of distribution was calculated using a 2-tissue-compartment model as well as Logan graphical analysis for regional quantification. Immunostaining for mHTT was performed to corroborate the in vivo findings. <b>Results:</b> <sup>11</sup>C-CHDI-180R displayed good metabolic stability (51.4% ± 4.0% parent in plasma at 60 min after injection). Regional time-activity curves displayed rapid uptake and reversible binding, which were described by a 2-tissue-compartment model. Logan graphical analysis was associated with the 2-tissue-compartment model (<i>r</i> <sup>2</sup> = 0.96, <i>P</i> < 0.0001) and used to generate parametric volume of distribution maps. Compared with controls, animals administered the 85Q fragment exhibited significantly increased <sup>11</sup>C-CHDI-180R binding in several cortical and subcortical brain regions (group effect, <i>P</i> < 0.0001). No difference in <sup>11</sup>C-CHDI-180R binding was observed between buffer and 10Q animals. The presence of mHTT aggregates in the 85Q animals was confirmed histologically. <b>Conclusion:</b> We validated <sup>11</sup>C-CHDI-180R as a radioligand to visualize and quantify mHTT aggregated species in a HD macaque model. These findings corroborate our previous work in rodent HD models and show that <sup>11</sup>C-CHDI-180R is a promising tool to assess the mHTT aggregate load and the efficacy of therapeutic strategies.

Also flagged:reproductionestrogensglucoseglucose intoleranceinsulin resistanceobesity
Journal Article 2023-08-17 No Snippets Sacharidou A, Chambliss K, Peng J, Barrera J, Tanigaki K, Luby-Phelps K, Özdemir İ, Khan S, Sirsi SR, Kim SH, Katzenellenbogen BS, Katzenellenbogen JA, Kanchwala M, Sathe AA, Lemoff A, Xing C, Hoyt K, Mineo C, Shaul PW.
Show Full Abstract

The estrogen receptor (ER) designated ERα has actions in many cell and tissue types that impact glucose homeostasis. It is unknown if these include mechanisms in endothelial cells, which have the potential to influence relative obesity, and processes in adipose tissue and skeletal muscle that impact glucose control. Here we show that independent of impact on events in adipose tissue, endothelial ERα promotes glucose tolerance by enhancing endothelial insulin transport to skeletal muscle. Endothelial ERα-deficient male mice are glucose intolerant and insulin resistant, and in females the antidiabetogenic actions of estradiol (E2) are absent. The glucose dysregulation is due to impaired skeletal muscle glucose disposal that results from attenuated muscle insulin delivery. Endothelial ERα activation stimulates insulin transcytosis by skeletal muscle microvascular endothelial cells. Mechanistically this involves nuclear ERα-dependent upregulation of vesicular trafficking regulator sorting nexin 5 (SNX5) expression, and PI3 kinase activation that drives plasma membrane recruitment of SNX5. Thus, coupled nuclear and non-nuclear actions of ERα promote endothelial insulin transport to skeletal muscle to foster normal glucose homeostasis.

SOX6
Also flagged:chromatinPolycomb Repressive Complex 2PRC2enhancer of Zeste homolog 2Ezh2suppressor of zeste 12
Journal Article 2023-08-17 ✓ 2 Snippets Mangoni D, Simi A, Lau P, Armaos A, Ansaloni F, Codino A, Damiani D, Floreani L, Di Carlo V, Vozzi D, Persichetti F, Santoro C, Pandolfini L, Tartaglia GG, Sanges R, Gustincich S.
In-Text Gene Mentions

…, Lhfpl3 ,Sox6, Rgcc ,…

…, Sox3 ,Sox6, Sox7 ,…

Show Full Abstract

Long Interspersed Nuclear Elements-1s (L1s) are transposable elements that constitute most of the genome's transcriptional output yet have still largely unknown functions. Here we show that L1s are required for proper mouse brain corticogenesis operating as regulatory long non-coding RNAs. They contribute to the regulation of the balance between neuronal progenitors and differentiation, the migration of post-mitotic neurons and the proportions of different cell types. In cortical cultured neurons, L1 RNAs are mainly associated to chromatin and interact with the Polycomb Repressive Complex 2 (PRC2) protein subunits enhancer of Zeste homolog 2 (Ezh2) and suppressor of zeste 12 (Suz12). L1 RNA silencing influences PRC2's ability to bind a portion of its targets and the deposition of tri-methylated histone H3 (H3K27me3) marks. Our results position L1 RNAs as crucial signalling hubs for genome-wide chromatin remodelling, enabling the fine-tuning of gene expression during brain development and evolution.

TNFSF4
Also flagged:pyroptosistumorgastric cancerdeathimmune responseimmune responses
Journal Article 2023-08-17 ✓ 1 Snippet Huang K, Lin Y, Qiu G, Wang S, Feng L, Zheng Z, Gao Y, Fan X, Zheng W, Zhuang J, Luo F, Feng S.
In-Text Gene Mentions

…BTNL2, C10orf54, CD200R1,TNFSF4, CD200 and NRP1)…

Show Full Abstract

<h4>Objective</h4>Pyroptosis is a form of programmed cell death that is essential for immunity. Herein, this study was conducted to uncover the implication of pyroptosis in immunomodulation and tumor microenvironment (TME) in gastric cancer.<h4>Methods</h4>Prognostic pyroptosis-related genes were extracted to identify different pyroptosis phenotypes and pyroptosis genomic phenotypes via unsupervised clustering analysis in the gastric cancer meta-cohort cohort (GSE15459, GSE62254, GSE84437, GSE26253 and TCGA-STAD). The activation of hallmark gene sets was quantified by GSVA and immune cell infiltration was estimated via ssGSEA and CIBERSORT. Through PCA algorithm, pyroptosis score was conducted. The predictors of immune response (TMB and IPS) and genetic mutations were evaluated. The efficacy of pyroptosis score in predicting immune response was verified in two anti-PD-1 therapy cohorts.<h4>Results</h4>Three different pyroptosis phenotypes with different prognosis, biological pathways and tumor immune microenvironment were established among 1275 gastric cancer patients, corresponding to three immune phenotypes: immune-inflamed, immune-desert, and immune-excluded. According to the pyroptosis score, patients were separated into high and low pyroptosis score groups. Low pyroptosis score indicated favorable survival outcomes, enhanced immune responses, and increased mutation frequency. Moreover, low pyroptosis score patients displayed more clinical benefits from anti-PD-1 and prolonged survival time.<h4>Conclusion</h4>Our findings uncovered a nonnegligible role of pyroptosis in immunomodulation and TME multiformity and complicacy in gastric cancer. Quantifying the pyroptosis score in individual tumors may tailor more effective immunotherapeutic strategies.

Also flagged:cardiometabolic diseasesCardiometabolic DisordersInter-related DisordersCardiovascular diseasemetabolic dysregulationsmetabolic syndrome
Journal Article 2023-08-17 No Snippets Doumatey AP, Bentley AR, Akinyemi R, Olanrewaju TO, Adeyemo A, Rotimi C.
Show Full Abstract

The past two decades have been characterized by a substantial global increase in cardiometabolic diseases, but the prevalence and incidence of these diseases and related traits differ across populations. African ancestry populations are among the most affected yet least included in research. Populations of African descent manifest significant genetic and environmental diversity and this under-representation is a missed opportunity for discovery and could exacerbate existing health disparities and curtail equitable implementation of precision medicine. Here, we discuss cardiometabolic diseases and traits in the context of African descent populations, including both genetic and environmental contributors and emphasizing novel discoveries. We also review new initiatives to include more individuals of African descent in genomics to address current gaps in the field.

Also flagged:Nucleosideviral polymeraseinfluenzaCOVID-19translationalhost cells
Journal Article 2023-08-17 No Snippets Kamzeeva PN, Aralov AV, Alferova VA, Korshun VA.
Show Full Abstract

The search for new drugs has been greatly accelerated by the emergence of new viruses and drug-resistant strains of known pathogens. Nucleoside analogues (NAs) are a prospective class of antivirals due to known safety profiles, which are important for rapid repurposing in the fight against emerging pathogens. Recent improvements in research methods have revealed new unexpected details in the mechanisms of action of NAs that can pave the way for new approaches for the further development of effective drugs. This review accounts advanced techniques in viral polymerase targeting, new viral and host enzyme targeting approaches, and prodrug-based strategies for the development of antiviral NAs.

HFE
Also flagged:AnthracyclineBreast cancercancernon-metastatic breast cancerAnthracyclinesdoxorubicin
Journal Article 2023-08-17 ✓ 1 Snippet Balaji S, Antony AK, Tonchev H, Scichilone G, Morsy M, Deen H, Mirza I, Ali MM, Mahmoud AM.
In-Text Gene Mentions

Also, a cohort of Lithuanian breast cancer patients revealed that the rs1799945 H63D variant of the homeostatic iron regulator gene, HFE, results in the substitution of aspartate for histidine at position 63 and is associated with anthracycline-induced cardiotoxicity [120].

Show Full Abstract

Breast cancer has become the most common cancer in the US and worldwide. While advances in early detection and treatment have resulted in a 40% reduction in breast cancer mortality, this reduction has not been achieved uniformly among racial groups. A large percentage of non-metastatic breast cancer mortality is related to the cardiovascular effects of breast cancer therapies. These effects appear to be more prevalent among patients from historically marginalized racial/ethnic backgrounds, such as African American and Hispanic individuals. Anthracyclines, particularly doxorubicin and daunorubicin, are the first-line treatments for breast cancer patients. However, their use is limited by their dose-dependent and cumulative cardiotoxicity, manifested by cardiomyopathy, ischemic heart disease, arrhythmias, hypertension, thromboembolic disorders, and heart failure. Cardiotoxicity risk factors, such as genetic predisposition and preexisting obesity, diabetes, hypertension, and heart diseases, are more prevalent in racial/ethnic minorities and undoubtedly contribute to the risk. Yet, beyond these risk factors, racial/ethnic minorities also face unique challenges that contribute to disparities in the emerging field of cardio-oncology, including socioeconomic factors, food insecurity, and the inability to access healthcare providers, among others. The current review will address genetic, clinical, and social determinants that potentially contribute to this disparity.

B4GALT5
Also flagged:gene expressionmethylationhistoneX-chromosomecancermethyl
Journal Article 2023-08-17 ✓ 5 Snippets Jevšinek Skok D, Hauptman N.
In-Text Gene Mentions

Previous research has shown that B4GALT5 is regulated by Ets family transcription factors, including Ets-1 and Ets-2, in cancer cells [22,23,24].

…-1,4-galactosyltransferase 5 (B4GALT5), choline dehydrogenase…

…observed in geneB4GALT5with an estimated…

…5hmC of geneB4GALT5were also observed…

…among which geneB4GALT5exhibited the highest…

Show Full Abstract

Cell-free DNA (cfDNA) from patient blood is emerging as a noninvasive diagnostic avenue for various cancers. We aimed to identify reliable biomarkers in cfDNA by investigating genes exhibiting significant differences between colorectal cancer and control samples. Our objective was to identify genes that showed a positive difference between cancer and control samples. To achieve this, we conducted an in silico analysis to identify genes that exhibit no significant variation in methylation between genomic DNA (gDNA) and cfDNA. We collected experimental data from publicly available repositories, which included 5-hydroxymethylcytosine (5hmC) profiles of gDNA and cfDNA samples from both cancer patients and healthy individuals. By comparing and overlapping these two groups, we identified 187 genes of interest, of which 53 genes had a positive difference among colon cancer patients and healthy individuals. Next, we performed an ANOVA test on these genes, resulting in the identification of 12 genes that showed statistically significant higher levels of 5hmC in cfDNA and gDNA from cancer patients compared to healthy individuals. Additionally, we compared the 5hmC status of these genes between cfDNA and gDNA from cancer patients. Interestingly, we found that the 5hmC of the toll like receptor 4 (<i>TLR4</i>) gene was not statistically different between cfDNA and gDNA from cancer patients, indicating consistency between cfDNA and gDNA. These findings have important implications, not only for experimental validation but also for the development of more sensitive and robust noninvasive methods to improve diagnostic, prognostic, and treatment options for colon cancer.

BTN2A1
Also flagged:tumorextracellularMelanomacancerendothelial–mesenchymal transitionT cell receptor
Journal Article 2023-08-17 ✓ 5 Snippets Hajdara A, Çakır U, Érsek B, Silló P, Széky B, Barna G, Faqi S, Gyöngy M, Kárpáti S, Németh K, Mayer B.
In-Text Gene Mentions

BTN3A1-stimulating antibodies or IPP transformed the immunosuppressive molecule conformation of BTN3A1 into an immunostimulatory one and elicited coordinated restoration of αβ T cell effector activity and BTN2A1-dependent γδ T lymphocyte cytotoxicity against BTN3A1+ cancer cells [46].

On the other hand, Payne and colleagues reported that, in its spontaneous conformation without BTN2A1, BTN3A1 inhibited tumor-reactive αβ T cell activation.

Current studies have shown that BTN2A1 expression on target (cancer) cells is correlated with γδ T cell cytotoxicity [30,43].

…direct involvement ofBTN2A1and γδ TCR,…

…γδ TCR, an anti-BTN2A1(Cat no: HPA019208,…

Show Full Abstract

The tumor microenvironment (TME) has gained considerable scientific attention by playing a role in immunosuppression and tumorigenesis. Besides tumor cells, TME is composed of various other cell types, including cancer-associated fibroblasts (CAFs or MAFs when referring to melanoma-derived CAFs) and tumor-infiltrating lymphocytes (TILs), a subpopulation of which is labeled as γδ T cells. Since the current anti-cancer therapies using γδ T cells in various cancers have exhibited mixed treatment responses, to better understand the γδ T cell biology in melanoma, our research group aimed to investigate whether activated γδ T cells are capable of killing MAFs. To answer this question, we set up an in vitro platform using freshly isolated Vδ2-type γδ T cells and cultured MAFs that were biobanked from our melanoma patients. This study proved that the addition of zoledronic acid (1-2.5 µM) to the γδ T cells was necessary to drive MAFs into apoptosis. The MAF cytotoxicity of γδ T cells was further enhanced by using the stimulatory clone 20.1 of anti-BTN3A1 antibody but was reduced when anti-TCR γδ or anti-BTN2A1 antibodies were used. Since the administration of zoledronic acid is safe and tolerable in humans, our results provide further data for future clinical studies on the treatment of melanoma.

Also flagged:hydroxyapatitemagnesiumdegradationhydrogendiamondminerals
Journal Article 2023-08-17 No Snippets Lu W, Zhang Y, Wang T.
Show Full Abstract

Recently, Mg-Zn/hydroxyapatite (HA) composites have attracted much attention as potential candidates for use in bone implants. In this paper, the MgZn/HA composites were prepared using powder metallurgy (PM) and the merging mechanism of MgZn and HA particles was investigated by adjusting the weight ratio of the HA powder. The evolution of the HA distribution in the matrix was examined using SEM and micro-CT images. Afterward, the mechanical properties and biocompatibility of the composites were discussed in detail. The results revealed that the mechanical properties and biocompatibility of the Mg-Zn/HA composites were significantly affected by the HA content. Composites with a low HA content showed increased porosity, improved mechanical strength, and enhanced corrosion resistance after ball milling and cold pressing. These results underscore the importance of optimizing the HA content in Mg-Zn/HA composites for bone implants. Based on our findings, PM Mg-Zn/HA composites with a moderate HA content demonstrate the most promising characteristics as bone implants. The insights gained from this work contribute to the advancement of bone implant materials and hold great potential for enhancing orthopedic surgery outcomes.

HFE
Also flagged:Palladiumcationbindingacetonitrilecationsions
Journal Article 2023-08-17 ✓ 1 Snippet Martins CDF, Raposo MMM, Costa SPG.
In-Text Gene Mentions

…disorders, including anaemia,hemochromatosis, and neurodegenerative diseas…

Show Full Abstract

Industrial activity has raised significant concerns regarding the widespread pollution caused by metal ions, contaminating ecosystems and causing adverse effects on human health. Therefore, the development of sensors for selective and sensitive detection of these analytes is extremely important. In this regard, an azo dye, Dabcyl <b>2</b>, was synthesised and investigated for sensing metal ions with environmental and industrial relevance. The cation binding character of <b>2</b> was evaluated by colour changes as seen by the naked eye, UV-Vis and <sup>1</sup>H NMR titrations in aqueous mixtures of SDS (0.02 M, pH 6) solution with acetonitrile (99:1, <i>v</i>/<i>v</i>). Out of the several cations tested, chemosensor <b>2</b> had a selective response for Pd<sup>2+</sup>, Sn<sup>2+</sup> and Fe<sup>3+</sup>, showing a remarkable colour change visible to the naked eye and large bathochromic shifts in the UV-Vis spectrum of <b>2</b>. This compound was very sensitive for Pd<sup>2+</sup>, Sn<sup>2+</sup> and Fe<sup>3+</sup>, with a detection limit as low as 5.4 × 10<sup>-8</sup> M, 1.3 × 10<sup>-7</sup> M and 5.2 × 10<sup>-8</sup> M, respectively. Moreover, comparative studies revealed that chemosensor <b>2</b> had high selectivity towards Pd<sup>2+</sup> even in the presence of other metal ions in SDS aqueous mixtures.

BTN2A2BTN2A1
Also flagged:telomeregliomastumorgliomacancersynaptic transmission
Journal Article 2023-08-17 ✓ 2 Snippets Han X, Yan Z, Fan K, Guan X, Hu B, Li X, Ou Y, Cui B, An L, Zhang Y, Gong J.
In-Text Gene Mentions
⭐ same-sentence co-mention

…checkpoint genes, includingBTN2A1, BTN2A2, CD274, CD276,…

⭐ same-sentence co-mention

…genes, including BTN2A1,BTN2A2, CD274, CD276, CD86,…

Show Full Abstract

<h4>Background</h4>Gliomas, the most prevalent primary malignant tumors of the central nervous system in adults, exhibit slow growth in lower-grade gliomas (LGG). However, the majority of LGG cases progress to high-grade gliomas, posing challenges for prognostication. The tumor microenvironment (TME), characterized by telomere-related genes and immune cell infiltration, strongly influences glioma growth and therapeutic response. Therefore, our objective was to develop a Telomere-TME (TM-TME) classifier that integrates telomere-related genes and immune cell landscape to assess prognosis and therapeutic response in glioma.<h4>Methods</h4>This study encompassed LGG patients from the TCGA and CCGA databases. TM score and TME score were derived from the expression signatures of telomere-related genes and the presence of immune cells in LGG, respectively. The TM-TME classifier was established by combining TM and TME scores to effectively predict prognosis. Subsequently, we conducted Kaplan-Meier survival estimation, univariate Cox regression analysis, and receiver operating characteristic curves to validate the prognostic prediction capacity of the TM-TME classifier across multiple cohorts. Gene Ontology (GO) analysis, biological processes, and proteomaps were performed to annotate the functional aspects of each subgroup and visualize the cellular signaling pathways.<h4>Results</h4>The TM_low+TME_high subgroup exhibited superior prognosis and therapeutic response compared to other subgroups (P<0.001). This finding could be attributed to distinct tumor somatic mutations and cancer cellular signaling pathways. GO analysis indicated that the TM_low+TME_high subgroup is associated with the neuronal system and modulation of chemical synaptic transmission. Conversely, the TM_high+TME_low subgroup showed a strong association with cell cycle and DNA metabolic processes. Furthermore, the classifier significantly differentiated overall survival in the TCGA LGG cohort and served as an independent prognostic factor for LGG patients in both the TCGA cohort (P<0.001) and the CGGA cohort (P<0.001).<h4>Conclusion</h4>Overall, our findings underscore the significance of the TM-TME classifier in predicting prognosis and immune therapeutic response in glioma, shedding light on the complex immune landscape within each subgroup. Additionally, our results suggest the potential of integrating risk stratification with precision therapy for LGG.

POU3F2
Also flagged:prostate cancerProstate adenocarcinomacancerandrogen receptorARdihydrotestosterone
Journal Article 2023-08-17 ✓ 1 Snippet Thakur N, Quazi S, Naik B, Jha SK, Singh P.
In-Text Gene Mentions

In androgen-insensitive tumors, some genes show a vital and a crucial role like as EZH2, AURKA, BRN2 (also called POU3F2), MYCN, and SOX2, monotherapy targets the gene or combination therapy with inhibitor of EZH2 (EPZ-6438 or GSK126) and in preclinical studies the therapeutic benefits were shown via enzalutamide.

Show Full Abstract

Prostate adenocarcinoma accounts for more than 20% of deaths among males due to cancer. It is the fifth-leading cancer diagnosed in males across the globe. The mortality rate is quite high due to prostate cancer. Despite the fact that advancements in diagnostics and therapeutics have been made, there is a lack of effective drugs. Metabolic pathways are altered due to the triggering of androgen receptor (AR) signaling pathways, and elevated levels of dihydrotestosterone are produced due to defects in AR signaling that accelerate the growth of prostate cancer cells. Further, PI3K/AKT/mTOR pathways interact with AR signaling pathway and act as precursors to promote prostate cancer. Prostate cancer therapy has been classified into luminal A, luminal B, and basal subtypes. Therapeutic drugs inhibiting dihydrotestosterone and PI3K have shown to give promising results to combat prostate cancer. Many second-generation Androgen receptor signaling antagonists are given either as single agent or with the combination of other drugs. In order to develop a cure for metastasized prostate cancer cells, Androgen deprivation therapy (ADT) is applied by using surgical or chemical methods. In many cases, Prostatectomy or local radiotherapy are used to control metastasized prostate cancer. However, it has been observed that after 1.5 years to 2 years of Prostatectomy or castration, there is reoccurrence of prostate cancer and high incidence of castration resistant prostate cancer is seen in population undergone ADT. It has been observed that Androgen derivation therapy combined with drugs like abiraterone acetate or docetaxel improve overall survival rate in metastatic hormone sensitive prostate cancer (mHSPC) patients. Scientific investigations have revealed that drugs inhibiting poly ADP Ribose polymerase (PARP) are showing promising results in clinical trials in the prostate cancer population with mCRPC and DNA repair abnormalities. Recently, RISUG adv (reversible inhibition of sperm under guidance) has shown significant results against prostate cancer cell lines and MTT assay has validated substantial effects of this drug against PC3 cell lines. Current review paper highlights the advancements in prostate cancer therapeutics and new drug molecules against prostate cancer. It will provide detailed insights on the signaling pathways which need to be targeted to combat metastasized prostate cancer and castration resistant prostate cancer.

Also flagged:Biliary tract cancercholangiocarcinomagallbladder cancerampulla of Vater cancerobstructive jaundicealbumin
Journal Article 2023-08-17 No Snippets Liu Z, Zhou H, Zhou Y, Yu M, Cheng Y, Li J.
Show Full Abstract

<h4>Background</h4>Biliary tract cancer (BTC) is a malignancy associated with unfavorable outcomes. Advanced BTC patients have a propensity to experience compromised immune and nutritional status as a result of obstructive jaundice and biliary inflammation. Currently, there is a lack of consensus on the impact of the Controlling Nutritional Status (CONUT) score in the context of BTC prognosis. The purpose of this study is to conduct a meta-analysis on the association between CONUT and the prognosis of patients suffering from BTC.<h4>Methods</h4>A defined search strategy was implemented to search the PubMed, Embase, and Web of Science databases for eligible studies published until March 2023, with a focus on overall survival (OS), relapse-free survival/recurrence-free survival(RFS), and relevant clinical characteristics. The prognostic potential of the CONUT score was evaluated using hazard ratios (HRs) or odds ratios (ORs) with 95% confidence intervals (CIs).<h4>Results</h4>In this meta-analysis, a total of 1409 patients from China and Japan were involved in 9 studies. The results indicated that the CONUT score was significantly correlated with worse OS (HR=2.13, 95% CI 1.61-2.82, <i>P</i><0.0001) and RFS (HR=1.83, 95% CI 1.44-2.31, <i>P</i><0.0001) in patients with BTC. And, the analysis showed that a high CONUT score was significantly associated with clinical characteristics such as jaundice (OR=1.60, 95% CI=1.14-2.25, <i>P</i>=0.006), poorly differentiated tumor (OR=1.43, 95% CI=1.03-1.99, <i>P</i>=0.03), pT3 and 4 stage of the tumor (OR=1.87, 95% CI=1.30-2.68, <i>P</i>=0.0007), and complications of Clavien-Dindo classification grade IIIa or higher (OR=1.79, 95% CI=1.03-3.12, <i>P</i>=0.04).<h4>Conclusion</h4>This meta-analysis indicates that a high CONUT score can serve as a significant prognostic indicator for survival outcomes among patients diagnosed with BTC.

HTT
Also flagged:exocytosissynapticvesiclespresynaptic terminalsneurodegenerative diseasecytosine
Journal Article 2023-08-17 ✓ 2 Snippets Xu C, Chen S, Chen X, Ho KH, Park C, Yoo H, Lee SH, Park H.
In-Text Gene Mentions

Huntington disease (HD) is a progressive dominantly inherited neurodegenerative disease caused by abnormally expanded cytosine-adenine-guanine (CAG) trinucleotide repeats in the first exon in the huntingtin (HTT) gene (The Huntington’s Disease Collaborative Research Group, 1993), which encodes an anomalously expanded polyglutamine (polyQ) tract in the huntingtin protein.

…the huntingtin (HTT) gene (…

Show Full Abstract

Huntington's disease (HD) is a progressive dominantly inherited neurodegenerative disease caused by the expansion of a cytosine-adenine-guanine (CAG) trinucleotide repeat in the <i>huntingtin</i> gene, which encodes the mutant huntingtin protein containing an expanded polyglutamine tract. One of neuropathologic hallmarks of HD is selective degeneration in the striatum. Mechanisms underlying selective neurodegeneration in the striatum of HD remain elusive. Neurodegeneration is suggested to be preceded by abnormal synaptic transmission at the early stage of HD. However, how mutant huntingtin protein affects synaptic vesicle exocytosis at single presynaptic terminals of HD striatal neurons is poorly understood. Here, we measured synaptic vesicle exocytosis at single presynaptic terminals of cultured striatal neurons (mainly inhibitory neurons) in a knock-in mouse model of HD (zQ175) during electrical field stimulation using real-time imaging of FM 1-43 (a lipophilic dye). We found a significant decrease in bouton density and exocytosis of synaptic vesicles at single presynaptic terminals in cultured striatal neurons. Real-time imaging of VGAT-CypHer5E (a pH sensitive dye conjugated to an antibody against vesicular GABA transporter (VGAT)) for inhibitory synaptic vesicles revealed a reduction in bouton density and exocytosis of inhibitory synaptic vesicles at single presynaptic terminals of HD striatal neurons. Thus, our results suggest that the mutant huntingtin protein decreases bouton density and exocytosis of inhibitory synaptic vesicles at single presynaptic terminals of striatal neurons, causing impaired inhibitory synaptic transmission, eventually leading to the neurodegeneration in the striatum of HD.

bioRxiv 2023-08-17 Preprint (No Snippets API) Liu Y, Ye Z, Chen L, Cheung AKL.
Show Full Abstract

Epstein-Barr virus is highly associated with nasopharyngeal carcinoma (NPC) with genes expressed for tumor transformation or maintenance of viral latency, but there are certain genes that can modulate immune molecules. Butyrophilin 2A1 (BTN2A1) is an important activating protein for presenting phosphoantigen presentation for recognition by Vγ9Vδ2 T cells to achieve anti-tumor activities. We have previously shown that Vγ9Vδ2 T cells achieve efficacy against NPC when BTN2A1 and BTN3A1 are upregulated by stimulating EBV gene expression, particularly LMP1. Whilst BTN3A1 can be induced by LMP1 mediated IFN-γ/JNK/NLRC5 pathway, the viral gene that can regulate BTN2A1 remains elusive. Here, we showed that BTN2A1 expression is directly mediated by EBV BRRF1, which can trigger BTN2A1 promoter and downstream JAK3-STAT3 pathway in NPC43 cells as enlightened by RNA-seq data and verified by inhibitor experiments. Further, BRRF1 downregulated IL-22 binding protein (IL-22RA2) to complement the EBNA1-targeting probe (P 4 ) induced IL-22 expression. These functions act in concordance to enhance the expression of BTN2A1, which likely lead to increased tumor cell killing by Vγ9Vδ2 T cells. Overall, this study elucidated a new mechanism of stimulating BTN2A1 expression in nasopharyngeal carcinoma cells by the EBV gene BRRF1. <h4>Summary statement</h4> This study demonstrated a new function Epstein-Barr Virus BRRF1 to induce BTN2A1 in nasopharyngeal carcinoma via the IL-22/JAK3-STAT3 pathway, which potentiates Vγ9Vδ2 T cells against NPC.

Also flagged:carbonsynthesisenmein diterpenoidsenmeinent -kaurene diterpenoiddegradation
Journal Article 2023-08-16 No Snippets Xu Z, Li X, Rose JA, Herzon SB.
Show Full Abstract

Covering: up to 2022Tricyclic bridgehead carbon centers (TBCCs) are a synthetically challenging substructure found in many complex natural products. Here we review the syntheses of ten representative families of TBCC-containing isolates, with the goal of outlining the strategies and tactics used to install these centers, including a discussion of the evolution of the successful synthetic design. We provide a summary of common strategies to inform future synthetic endeavors.

TNFSF4
Also flagged:TSLPcell proliferationinflammatory diseasesvitamin D3thymic stromal lymphopoietinTSLP receptor
Journal Article 2023-08-16 ✓ 1 Snippet Tanaka Y, Yokoyama Y, Kambayashi T.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Therapeutic strategies that enhance regulatory T (Treg) cell proliferation or suppressive function hold promise for the treatment of autoimmune and inflammatory diseases. We previously reported that the topical application of the vitamin D3 analog MC903 systemically expands Treg cells by stimulating the production of thymic stromal lymphopoietin (TSLP) from the skin. Using mice lacking TSLP receptor expression by dendritic cells (DCs), we hereby show that TSLP receptor signaling in DCs is required for this Treg expansion in vivo. Topical MC903 treatment of ear skin selectively increased the number of migratory DCs in skin-draining lymph nodes (LNs) and upregulated their expression of co-stimulatory molecules. Accordingly, DCs isolated from skin-draining LNs but not mesenteric LNs or spleen of MC903-treated mice showed an enhanced ability to promote Treg proliferation, which was driven by co-stimulatory signals through CD80/CD86 and OX40 ligand. Among the DC subsets in the skin-draining LNs of MC903-treated mice, migratory XCR1<sup>-</sup> CD11b<sup>+</sup> type 2 and XCR1<sup>-</sup> CD11b<sup>-</sup> double negative conventional DCs promoted Treg expansion. Together, these data demonstrate that vitamin D3 stimulation of skin induces TSLP expression, which stimulates skin migratory DCs to expand Treg cells. Thus, topical MC903 treatment could represent a convenient strategy to treat inflammatory disorders by engaging this pathway.

Also flagged:bindingACE2ACE2 receptorspike glycoproteinhost cellshost cell surface
Journal Article 2023-08-16 No Snippets Verkhivker G, Alshahrani M, Gupta G, Xiao S, Tao P.
Show Full Abstract

In this study, we systematically examine the conformational dynamics, binding and allosteric communications in the Omicron BA.1, BA.2, BA.3 and BA.4/BA.5 spike protein complexes with the ACE2 host receptor using molecular dynamics simulations and perturbation-based network profiling approaches. Microsecond atomistic simulations provided a detailed characterization of the conformational landscapes and revealed the increased thermodynamic stabilization of the BA.2 variant which can be contrasted with the BA.4/BA.5 variants inducing a significant mobility of the complexes. Using the dynamics-based mutational scanning of spike residues, we identified structural stability and binding affinity hotspots in the Omicron complexes. Perturbation response scanning and network-based mutational profiling approaches probed the effect of the Omicron mutations on allosteric interactions and communications in the complexes. The results of this analysis revealed specific roles of Omicron mutations as conformationally plastic and evolutionary adaptable modulators of binding and allostery which are coupled to the major regulatory positions through interaction networks. Through perturbation network scanning of allosteric residue potentials in the Omicron variant complexes performed in the background of the original strain, we characterized regions of epistatic couplings that are centered around the binding affinity hotspots N501Y and Q498R. Our results dissected the vital role of these epistatic centers in regulating protein stability, efficient ACE2 binding and allostery which allows for accumulation of multiple Omicron immune escape mutations at other sites. Through integrative computational approaches, this study provides a systematic analysis of the effects of Omicron mutations on thermodynamics, binding and allosteric signaling in the complexes with ACE2 receptor.

HTT
Also flagged:mitophagyMitochondriaorganellesnecrotic celldeathmetabolism
Journal Article 2023-08-16 ✓ 1 Snippet Wang S, Long H, Hou L, Feng B, Ma Z, Wu Y, Zeng Y, Cai J, Zhang DW, Zhao G.
In-Text Gene Mentions

The etiology of HD is related to mutations in the gene encoding Huntington (Htt), mainly characterized by an extra stretch of polyglutamine (polyQ) repeats at the N-terminus of the htt protein.206 Expanded polyQ repeats interact abnormally with glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a dehydrogenase implicated in glycolysis), reducing the activation of GAPDH-induced mitophagy.176 Furthermore, expanded polyQ repeats interfere with the formation of ULK1/PtdIns3K and interaction with OPTN/NDP52, thereby affecting the trigger of mitophagy and the recruitment of LC3 to mitochondria.207 Defects in mitophagy result in the accretion of damaged mitochondria and increased cell demise, promoting the progression of HD.

Show Full Abstract

Mitochondria are dynamic organelles with multiple functions. They participate in necrotic cell death and programmed apoptotic, and are crucial for cell metabolism and survival. Mitophagy serves as a cytoprotective mechanism to remove superfluous or dysfunctional mitochondria and maintain mitochondrial fine-tuning numbers to balance intracellular homeostasis. Growing evidences show that mitophagy, as an acute tissue stress response, plays an important role in maintaining the health of the mitochondrial network. Since the timely removal of abnormal mitochondria is essential for cell survival, cells have evolved a variety of mitophagy pathways to ensure that mitophagy can be activated in time under various environments. A better understanding of the mechanism of mitophagy in various diseases is crucial for the treatment of diseases and therapeutic target design. In this review, we summarize the molecular mechanisms of mitophagy-mediated mitochondrial elimination, how mitophagy maintains mitochondrial homeostasis at the system levels and organ, and what alterations in mitophagy are related to the development of diseases, including neurological, cardiovascular, pulmonary, hepatic, renal disease, etc., in recent advances. Finally, we summarize the potential clinical applications and outline the conditions for mitophagy regulators to enter clinical trials. Research advances in signaling transduction of mitophagy will have an important role in developing new therapeutic strategies for precision medicine.

RABGAP1L
Also flagged:MYRFcongenital heart diseaseCas9cardiac-urogenital syndromenucleotidecytosine
Journal Article 2023-08-16 ✓ 1 Snippet Doering L, Cornean A, Thumberger T, Benjaminsen J, Wittbrodt B, Kellner T, Hammouda OT, Gorenflo M, Wittbrodt J, Gierten J.
In-Text Gene Mentions

…12 genes (RABGAP1L, MAPRE2 ,…

Show Full Abstract

High-throughput DNA sequencing studies increasingly associate DNA variants with congenital heart disease (CHD). However, functional modeling is a crucial prerequisite for translating genomic data into clinical care. We used CRISPR-Cas9-mediated targeting of 12 candidate genes in the vertebrate model medaka (Oryzias latipes), five of which displayed a novel cardiovascular phenotype spectrum in F0 (crispants): mapre2, smg7, cdc42bpab, ankrd11 and myrf, encoding a transcription factor recently linked to cardiac-urogenital syndrome. Our myrf mutant line showed particularly prominent embryonic cardiac defects recapitulating phenotypes of pediatric patients, including hypoplastic ventricle. Mimicking human mutations, we edited three sites to generate specific myrf single-nucleotide variants via cytosine and adenine base editors. The Glu749Lys missense mutation in the conserved intramolecular chaperon autocleavage domain fully recapitulated the characteristic myrf mutant phenotype with high penetrance, underlining the crucial function of this protein domain. The efficiency and scalability of base editing to model specific point mutations accelerate gene validation studies and the generation of human-relevant disease models.

Also flagged:peptidesamino acidsflavonoidstumorsinfectionsdegenerative disorders
Journal Article 2023-08-16 No Snippets Szwed-Georgiou A, Płociński P, Kupikowska-Stobba B, Urbaniak MM, Rusek-Wala P, Szustakiewicz K, Piszko P, Krupa A, Biernat M, Gazińska M, Kasprzak M, Nawrotek K, Mira NP, Rudnicka K.
Show Full Abstract

Novel tissue regeneration strategies are constantly being developed worldwide. Research on bone regeneration is noteworthy, as many promising new approaches have been documented with novel strategies currently under investigation. Innovative biomaterials that allow the coordinated and well-controlled repair of bone fractures and bone loss are being designed to reduce the need for autologous or allogeneic bone grafts eventually. The current engineering technologies permit the construction of synthetic, complex, biomimetic biomaterials with properties nearly as good as those of natural bone with good biocompatibility. To ensure that all these requirements meet, bioactive molecules are coupled to structural scaffolding constituents to form a final product with the desired physical, chemical, and biological properties. Bioactive molecules that have been used to promote bone regeneration include protein growth factors, peptides, amino acids, hormones, lipids, and flavonoids. Various strategies have been adapted to investigate the coupling of bioactive molecules with scaffolding materials to sustain activity and allow controlled release. The current manuscript is a thorough survey of the strategies that have been exploited for the delivery of biomolecules for bone regeneration purposes, from choosing the bioactive molecule to selecting the optimal strategy to synthesize the scaffold and assessing the advantages and disadvantages of various delivery strategies.

POU3F2
Also flagged:Hmgb1brain developmenthigh-mobility group box 1aquaporin-4cytoskeletonangiogenesis
Journal Article 2023-08-16 ✓ 2 Snippets Freitas-Andrade M, Comin CH, Van Dyken P, Ouellette J, Raman-Nair J, Blakeley N, Liu QY, Leclerc S, Pan Y, Liu Z, Carrier M, Thakur K, Savard A, Rurak GM, Tremblay MÈ, Salmaso N, da F Costa L, Coppola G, Lacoste B.
In-Text Gene Mentions

…Abcam, Cat# ab18465), -Pou3f2(1:200, Cell Signaling…

…(NeuN, CTIP2 andPOU3F2) was performed to…

Show Full Abstract

Astrocytes are intimately linked with brain blood vessels, an essential relationship for neuronal function. However, astroglial factors driving these physical and functional associations during postnatal brain development have yet to be identified. By characterizing structural and transcriptional changes in mouse cortical astrocytes during the first two postnatal weeks, we find that high-mobility group box 1 (Hmgb1), normally upregulated with injury and involved in adult cerebrovascular repair, is highly expressed in astrocytes at birth and then decreases rapidly. Astrocyte-selective ablation of Hmgb1 at birth affects astrocyte morphology and endfoot placement, alters distribution of endfoot proteins connexin43 and aquaporin-4, induces transcriptional changes in astrocytes related to cytoskeleton remodeling, and profoundly disrupts endothelial ultrastructure. While lack of astroglial Hmgb1 does not affect the blood-brain barrier or angiogenesis postnatally, it impairs neurovascular coupling and behavior in adult mice. These findings identify astroglial Hmgb1 as an important player in postnatal gliovascular maturation.

Also flagged:kappa light chain variableimmunoglobulinstranslation initiationspinal cord injuryKappa variable light chainsmembrane receptor
Journal Article 2023-08-16 No Snippets Capuz A, Osien S, Cardon T, Karnoub MA, Aboulouard S, Raffo-Romero A, Duhamel M, Cizkova D, Trerotola M, Devos D, Kobeissy F, Vanden Abeele F, Bonnefond A, Fournier I, Rodet F, Salzet M.
Show Full Abstract

The dogma "One gene, one protein" is clearly obsolete since cells use alternative splicing and generate multiple transcripts which are translated into protein isoforms, but also use alternative translation initiation sites (TISs) and termination sites on a given transcript. Alternative open reading frames for individual transcripts give proteins originate from the 5'- and 3'-UTR mRNA regions, frameshifts of mRNA ORFs or from non-coding RNAs. Longtime considered as non-coding, recent in-silico translation prediction methods enriched the protein databases allowing the identification of new target structures that have not been identified previously. To gain insight into the role of these newly identified alternative proteins in the regulation of cellular functions, it is crucial to assess their dynamic modulation within a framework of altered physiological modifications such as experimental spinal cord injury (SCI). Here, we carried out a longitudinal proteomic study on rat SCI from 12 h to 10 days. Based on the alternative protein predictions, it was possible to identify a plethora of newly predicted protein hits. Among these proteins, some presented a special interest due to high homology with variable chain regions of immunoglobulins. We focus our interest on the one related to Kappa variable light chains which is similarly highly produced by B cells in the Bence jones disease, but here expressed in astrocytes. This protein, name Heimdall is an Intrinsically disordered protein which is secreted under inflammatory conditions. Immunoprecipitation experiments showed that the Heimdall interactome contained proteins related to astrocyte fate keepers such as "NOTCH1, EPHA3, IPO13" as well as membrane receptor protein including "CHRNA9; TGFBR, EPHB6, and TRAM". However, when Heimdall protein was neutralized utilizing a specific antibody or its gene knocked out by CRISPR-Cas9, sprouting elongations were observed in the corresponding astrocytes. Interestingly, depolarization assays and intracellular calcium measurements in Heimdall KO, established a depolarization effect on astrocyte membranes KO cells were more likely that the one found in neuroprogenitors. Proteomic analyses performed under injury conditions or under lipopolysaccharides (LPS) stimulation, revealed the expression of neuronal factors, stem cell proteins, proliferation, and neurogenesis of astrocyte convertor factors such as EPHA4, NOTCH2, SLIT3, SEMA3F, suggesting a role of Heimdall could regulate astrocytic fate. Taken together, Heimdall could be a novel member of the gatekeeping astrocyte-to-neuroprogenitor conversion factors.

MLLT10
Also flagged:methylationendometriosisinfertilitycyclemenstrual cyclepathogenesis
Journal Article 2023-08-16 ✓ 1 Snippet Mortlock S, Houshdaran S, Kosti I, Rahmioglu N, Nezhat C, Vitonis AF, Andrews SV, Grosjean P, Paranjpe M, Horne AW, Jacoby A, Lager J, Opoku-Anane J, Vo KC, Manvelyan E, Sen S, Ghukasyan Z, Collins F, Santamaria X, Saunders P, Kober K, McRae AF, Terry KL, Vallvé-Juanico J, Becker C, Rogers PAW, Irwin JC, Zondervan K, Montgomery GW, Missmer S, Sirota M, Giudice L.
In-Text Gene Mentions

…promoter regions forMLLT10and a bidirectional…

Show Full Abstract

Endometriosis is a leading cause of pain and infertility affecting millions of women globally. Herein, we characterize variation in DNA methylation (DNAm) and its association with menstrual cycle phase, endometriosis, and genetic variants through analysis of genotype data and methylation in endometrial samples from 984 deeply-phenotyped participants. We estimate that 15.4% of the variation in endometriosis is captured by DNAm and identify significant differences in DNAm profiles associated with stage III/IV endometriosis, endometriosis sub-phenotypes and menstrual cycle phase, including opening of the window for embryo implantation. Menstrual cycle phase was a major source of DNAm variation suggesting cellular and hormonally-driven changes across the cycle can regulate genes and pathways responsible for endometrial physiology and function. DNAm quantitative trait locus (mQTL) analysis identified 118,185 independent cis-mQTLs including 51 associated with risk of endometriosis, highlighting candidate genes contributing to disease risk. Our work provides functional evidence for epigenetic targets contributing to endometriosis risk and pathogenesis. Data generated serve as a valuable resource for understanding tissue-specific effects of methylation on endometrial biology in health and disease.

DCC
Also flagged:gene expressioncancerpathogenesisribonucleasescytoplasmicviral genomes
Journal Article 2023-08-16 ✓ 1 Snippet Pisignano G, Michael DC, Visal TH, Pirlog R, Ladomery M, Calin GA.
In-Text Gene Mentions

…transcribed from theDCCgene and end-joined…

Show Full Abstract

To date, thousands of highly abundant and conserved single-stranded RNA molecules shaped into ring structures (circRNAs) have been identified. CircRNAs are multifunctional molecules that have been shown to regulate gene expression transcriptionally and post-transcriptionally and exhibit distinct tissue- and development-specific expression patterns associated with a variety of normal and disease conditions, including cancer pathogenesis. Over the past years, due to their intrinsic stability and resistance to ribonucleases, particular attention has been drawn to their use as reliable diagnostic and prognostic biomarkers in cancer diagnosis, treatment, and prevention. However, there are some critical caveats to their utility in the clinic. Their circular shape limits their annotation and a complete functional elucidation is lacking. This makes their detection and biomedical application still challenging. Herein, we review the current knowledge of circRNA biogenesis and function, and of their involvement in tumorigenesis and potential utility in cancer-targeted therapy.

TNFSF4
Also flagged:hepatocellular carcinomamTORC1Tumorcancermammalian target of the rapamycin complex 1PAG1
Journal Article 2023-08-16 ✓ 1 Snippet Chen E, Mo Y, Yi J, Liu J, Luo T, Li Z, Lin Z, Hu Y, Zou Z, Liu J.
In-Text Gene Mentions

…IDO1, LAG3, PDCD1,TNFSF4, and VTCN1 in…

Show Full Abstract

Tumor oncogenesis, cancer metastasis, and immune evasion were substantially impacted by the mammalian target of the rapamycin complex 1 (mTORC1) pathway. However, in hepatocellular carcinoma (HCC), no mTORC1 signaling-based gene signature has ever been published. mTORC1 scores were computed employing a single sample gene set enrichment analysis based on databases including the International Cancer Genome Consortium (ICGC) and The Cancer Genome Atlas (TCGA). The PAG1, LHFPL2, and FABP5 expression levels were obtained to construct a mTORC1 pathway-related model. In two databases, the overall survival (OS) rate was shorter for high-mTORC1 score patients compared to those with low scores. The activation of TFs in the group with high risk was enhanced, such as the HIF-1 pathway. Additionally, it was discovered that a high mTORC1 score was linked to an immune exclusion phenotype and enhanced immunosuppressive cell infiltration. Notably, it was discovered that high-mTORC1 scores patients had poorer immunotherapeutic results and might not gain benefit from immunotherapy. When compared to the low HCC metastatic cell lines, the high HCC metastatic cell lines have overexpressed levels of PAG1, LHFPL2, and FABP5 expression. The expression of PAG1, LHFPL2, and FABP5 was inhibited by the MAPK and mTORC1 pathway inhibitors. Our study identified mTORC1 score signature can aid in the development of individualized immunotherapy protocols and predict the HCC patients' prognoses.

SOX6
Also flagged:waterplacodespecificationlocalizationmatingsmating
Journal Article 2023-08-16 ✓ 1 Snippet Jacob T, Annusver K, Czarnewski P, Dalessandri T, Kalk C, Levra Levron C, Campamà Sanz N, Kastriti ME, Mikkola ML, Rendl M, Lichtenberger BM, Donati G, Björklund ÅK, Kasper M.
In-Text Gene Mentions

Sox6

Show Full Abstract

A wealth of specialized cell populations within the skin facilitates its hair-producing, protective, sensory, and thermoregulatory functions. How the vast cell-type diversity and tissue architecture develops is largely unexplored. Here, with single-cell transcriptomics, spatial cell-type assignment, and cell-lineage tracing, we deconstruct early embryonic mouse skin during the key transitions from seemingly uniform developmental precursor states to a multilayered, multilineage epithelium, and complex dermal identity. We identify the spatiotemporal emergence of hair-follicle-inducing, muscle-supportive, and fascia-forming fibroblasts. We also demonstrate the formation of the panniculus carnosus muscle (PCM), sprouting blood vessels without pericyte coverage, and the earliest residence of mast and dendritic immune cells in skin. Finally, we identify an unexpected epithelial heterogeneity within the early single-layered epidermis and a signaling-rich periderm layer. Overall, this cellular and molecular blueprint of early skin development-which can be explored at https://kasperlab.org/tools-establishes histological landmarks and highlights unprecedented dynamic interactions among skin cells.

Also flagged:Chemotherapy-induced peripheral neuropathyCIPNCD4transcription factorsPeripheral NeuropathyCdh1
Journal Article 2023-08-16 No Snippets Cao F, Wang X, Ye Q, Yan F, Lu W, Xie J, Bi B, Wang X.
Show Full Abstract

Chemotherapy-induced peripheral neuropathy (CIPN) is a frequent and severe side effect of first-line chemotherapeutic agents. The association between circular RNAs (circRNAs) and CIPN remains unclear. In this study, CIPN models were constructed with Taxol, while 134 differentially expressed circRNAs, 353 differentially expressed long non-coding RNAs, and 86 differentially expressed messenger RNAs (mRNAs) were identified utilizing RNA sequencing. CircRNA-targeted microRNAs (miRNAs) were predicted using miRanda, and miRNA-targeted mRNAs were predicted using TargetScan and miRDB. The intersection of sequencing and mRNA prediction results was selected to establish the circRNA-miRNA-mRNA networks, which include 15 circRNAs, 18 miRNAs, and 11 mRNAs. Functional enrichment pathway analyses and immune infiltration analyses revealed that differentially expressed mRNAs were enriched in the immune system, especially in T cells, monocytes, and macrophages. <i>Cdh1</i>, <i>Satb2</i>, <i>Fas</i>, <i>P2ry2</i>, and <i>Zfhx2</i> were further identified as hub genes and validated by RT-qPCR, correlating with macrophages, plasmacytoid dendritic cells, and central memory CD4 T cells in CIPN. Additionally, we predicted the associated diseases, 36 potential transcription factors (TFs), and 30 putative drugs for hub genes using the DisGeNET, TRRUST, and DGIdb databases, respectively. Our results indicated the crucial role of circRNAs, and the immune microenvironment played in CIPN, providing novel insights for further research.

DCC
Also flagged:Asthmarespiratory diseaserecurrent airway obstructionneutrophilic disordersSEAneutrophil
Journal Article 2023-08-16 ✓ 1 Snippet Morini M, Gobbo F, Rinnovati R, Romagnoli N, Peli A, Massarenti C, Spadari A, Pietra M.
In-Text Gene Mentions

…poor agreement ofDCCresults for all…

Show Full Abstract

Equine asthma is a common respiratory disease that may affect horses of any age. The diagnosis of severe equine asthma (SEA) (historically referred as recurrent airway obstruction or RAO) is based mainly on the history of the animal and clinical signs, which are further supported by the cytological examination of the bronchoalveolar lavage (BAL). This can also be helpful in monitoring the inflammation of the lower airways in response to environmental management and medication. The cytocentrifugated preparation is usually considered the method of choice for BAL cytological interpretation. The aim of this study was to compare the results in terms of differential cell counts (DCC) in BAL cytology performed on sedimented smears and cytocentrifugated preparations. To carry this out, 48 BAL samples were collected from six horses with SEA that were subjected to a process of exacerbation of the disease by environmental stimuli, which was later followed by the appropriate treatment. Each collected BAL fluid was equally divided into duplicate portions: one processed by cytocentrifugation and one by sediment smear from simple centrifugation. Cytologic examination of all BAL by both methods showed poor concordance in DCC, although it was still able to allow diagnostic recognition of severe lung neutrophilic disorders. These results suggest that sediment smear preparation, although remaining a useful method in general equine practice associated with clinical assessments in the diagnosis of SEA under conditions where there is no possibility of using a cytocentrifuge, cannot be considered a comparable alternative.

HTT
Also flagged:Brain-Derived Neurotrophic FactorBDNFneurotrophinpathogenesisneurological disorderscognitive impairments
Journal Article 2023-08-16 ✓ 2 Snippets Speidell A, Bin Abid N, Yano H.
In-Text Gene Mentions

Therefore, the loss of a functional HTT allele in HD likely contributes to the simultaneous exacerbation of decrements of BDNF expression and neurotrophin signaling at the synapse.

…the huntingtin (HTT) gene on…

Show Full Abstract

Brain-derived neurotrophic factor (BDNF) is a major neurotrophin whose loss or interruption is well established to have numerous intersections with the pathogenesis of progressive neurological disorders. There is perhaps no greater example of disease pathogenesis resulting from the dysregulation of BDNF signaling than Huntington's disease (HD)-an inherited neurodegenerative disorder characterized by motor, psychiatric, and cognitive impairments associated with basal ganglia dysfunction and the ultimate death of striatal projection neurons. Investigation of the collection of mechanisms leading to BDNF loss in HD highlights this neurotrophin's importance to neuronal viability and calls attention to opportunities for therapeutic interventions. Using electronic database searches of existing and forthcoming research, we constructed a literature review with the overarching goal of exploring the diverse set of molecular events that trigger BDNF dysregulation within HD. We highlighted research that investigated these major mechanisms in preclinical models of HD and connected these studies to those evaluating similar endpoints in human HD subjects. We also included a special focus on the growing body of literature detailing key transcriptomic and epigenetic alterations that affect BDNF abundance in HD. Finally, we offer critical evaluation of proposed neurotrophin-directed therapies and assessed clinical trials seeking to correct BDNF expression in HD individuals.

HFE
Also flagged:NRF1E2F4transcription factorsliver diseasenuclear respiratory factor-1E2F transcription factor 4
Journal Article 2023-08-16 ✓ 3 Snippets Paluschinski M, Schira-Heinen J, Pellegrino R, Heij LR, Bednarsch J, Neumann UP, Longerich T, Stuehler K, Luedde T, Castoldi M.
In-Text Gene Mentions

Notably, the distribution on polyribosimal fractions of hemochromatosis (HFE), hemojuvelin (HJV), and hepcidin (HAMP) transcripts, all genes that were previously reported to respond to miR-122 [3], was found to be affected by the modulation of miR-122 levels (Supplementary Figure S1).

…polyribosimal fractions ofhemochromatosis(HFE), hemojuvelin (HJV),…

…fractions of hemochromatosis (HFE), hemojuvelin (HJV), and…

Show Full Abstract

MicroRNA miR-122 plays a pivotal role in liver function. Despite numerous studies investigating this miRNA, the global network of genes regulated by miR-122 and its contribution to the underlying pathophysiological mechanisms remain largely unknown. To gain a deeper understanding of miR-122 activity, we employed two complementary approaches. Firstly, through transcriptome analysis of polyribosome-bound RNAs, we discovered that miR-122 exhibits potential antagonistic effects on specific transcription factors known to be dysregulated in liver disease, including nuclear respiratory factor-1 (NRF1) and the E2F transcription factor 4 (E2F4). Secondly, through proteome analysis of hepatoma cells transfected with either miR-122 mimic or antagomir, we discovered changes in several proteins associated with increased malignancy. Interestingly, many of these proteins were reported to be transcriptionally regulated by NRF1 and E2F4, six of which we validated as miR-122 targets. Among these, a negative correlation was observed between miR-122 and glucose-6-phosphate dehydrogenase levels in the livers of patients with hepatitis B virus-associated hepatocellular carcinoma. This study provides novel insights into potential alterations of molecular pathway occurring at the early stages of liver disease, driven by the dysregulation of miR-122 and its associated genes.

Also flagged:Tumorcancerimmunoglobulinspeptidesmembraneextracellular vesicles
Journal Article 2023-08-16 No Snippets Zheng J, Jiang J, Pu Y, Xu T, Sun J, Zhang Q, He L, Liang X.
Show Full Abstract

Targeting tumor-associated macrophages (TAMs) has emerged as a promising approach in cancer therapy. This article provides a comprehensive review of recent advancements in the field of nanomedicines targeting TAMs. According to the crucial role of TAMs in tumor progression, strategies to inhibit macrophage recruitment, suppress TAM survival, and transform TAM phenotypes are discussed as potential therapeutic avenues. To enhance the targeting capacity of nanomedicines, various approaches such as the use of ligands, immunoglobulins, and short peptides are explored. The utilization of live programmed macrophages, macrophage cell membrane-coated nanoparticles and macrophage-derived extracellular vesicles as drug delivery platforms is also highlighted, offering improved biocompatibility and prolonged circulation time. However, challenges remain in achieving precise targeting and controlled drug release. The heterogeneity of TAMs and the variability of surface markers pose hurdles in achieving specific recognition. Furthermore, the safety and clinical applicability of these nanomedicines requires further investigation. In conclusion, nanomedicines targeting TAMs hold great promise in cancer therapy, offering enhanced specificity and reduced side effects. Addressing the existing limitations and expanding our understanding of TAM biology will pave the way for the successful translation of these nano-therapies into clinical practice.

Also flagged:ether ether ketonepsychological distresstitaniumtumorsinfectionmetals
Journal Article 2023-08-16 No Snippets Su Q, Qiao Y, Xiao Y, Yang S, Wu H, Li J, He X, Hu X, Yang H, Yong X.
Show Full Abstract

The clinical challenge of bone defects in the craniomaxillofacial region, which can lead to significant physiological dysfunction and psychological distress, persists due to the complex and unique anatomy of craniomaxillofacial bones. These critical-sized defects require the use of bone grafts or substitutes for effective reconstruction. However, current biomaterials and methods have specific limitations in meeting the clinical demands for structural reinforcement, mechanical support, exceptional biological performance, and aesthetically pleasing reconstruction of the facial structure. These drawbacks have led to a growing need for novel materials and technologies. The growing development of 3D printing can offer significant advantages to address these issues, as demonstrated by the fabrication of patient-specific bioactive constructs with controlled structural design for complex bone defects in medical applications using this technology. Poly (ether ether ketone) (PEEK), among a number of materials used, is gaining recognition as a feasible substitute for a customized structure that closely resembles natural bone. It has proven to be an excellent, conformable, and 3D-printable material with the potential to replace traditional autografts and titanium implants. However, its biological inertness poses certain limitations. Therefore, this review summarizes the distinctive features of craniomaxillofacial bones and current methods for bone reconstruction, and then focuses on the increasingly applied 3D printed PEEK constructs in this field and an update on the advanced modifications for improved mechanical properties, biological performance, and antibacterial capacity. Exploring the potential of 3D printed PEEK is expected to lead to more cost-effective, biocompatible, and personalized treatment of craniomaxillofacial bone defects in clinical applications.

BTN3A3
Also flagged:cancerlung adenocarcinomaLUADGene ExpressionCBFA2T3DENND3
Journal Article 2023-08-16 ✓ 2 Snippets Wang X, Luo X, Wang Z, Wang Y, Zhao J, Bian L.
In-Text Gene Mentions

In breast cancer, binding of LSECtin on the surface of macrophages to the cancer cell receptor BTN3A3 subsequently activates downstream signaling, promotes breast cancer development and increases the stemness of cancer cells [15].

…cancer cell receptorBTN3A3subsequently activates downstr…

Show Full Abstract

<h4>Objective</h4>Cancer stemness and M2 macrophages are intimately linked to the prognosis of lung adenocarcinoma (LUAD). For this reason, this investigation sought to identify the key genes relevant to cancer stemness and M2 macrophages, explore the relationship between these genes and clinical characteristics, and determine the potential mechanism.<h4>Methods</h4>LUAD transcriptomic data was analyzed from The Cancer Genome Atlas (TCGA) as well as the Gene Expression Omnibus databases. Differential expression analysis was performed to discern abnormally expressed genes between LUAD and control samples in TCGA cohort. The Cell type Identification by Estimating Relative Subsets of RNA Transcripts (CIBERSORT) algorithm was applied to determine varyingly infiltrated immune cells in LUAD compared with the control samples in TCGA cohort. Weighted correlation network analysis (WGCNA) was performed to identify genes associated with mRNA expression-based stemness index (mRNAsi) and M2 macrophages. Least absolute shrinkage and selection operator (LASSO), RandomForest (RF) and support vector machine-recursive feature elimination (SVM-RFE) machine learning methods were conducted to detect gene signatures. Global survival evaluation (Kaplan-Meier curve) was applied to investigate the relationship between gene signatures and the survival time of LUAD patients. Receiver operating characteristic (ROC) curves were produced to define biomarkers relevant to diagnosis. Gene Set Enrichment Analysis (GSEA) was performed to probe the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways related to diagnostic biomarkers. The public single-cell dataset of LUAD (GSE123902) was used to investigate the expression differences of diagnostic biomarkers in various cell types in LUAD. Real-time quantitative PCR (qRT-PCR) was performed to confirm key genes in lung adenocarcinoma cells.<h4>Results</h4>A total of 5,410 differentialy expressed genes (DEGs) as well as 15 differentially infiltrated immune cells were identified between LUAD and control sepcimens in TCGA cohort. Thirty-seven DEGs were associated with both M2 macrophages and mRNAsi according to the WGCNA analysis. Sixteen common gene signatures were obtained using three diverse algorithms. CBFA2T3, DENND3 and FCAMR were correlated to overall and disease-free survival of LUAD patients. ROC curves revealed that CBFA2T3 and DENND3 expression accurately classified LUAD and control samples. The results of single cell related analysis showed that two diagnostic biomarkers expressions were differed between the different tissue sources in M2-like macrophages. QRT-PCR demonstrated the mRNA expressions of CBFA2T3 and DENND3 were upregulated in lung adenocarcinoma cells A549 and H2122.<h4>Conclusion</h4>Our study identified CBFA2T3 and DENND3 as key genes associated with mRNAsi and M2 macrophages in LUAD and investigated the potential molecular mechanisms underlying this relationship.

Also flagged:Nucleic acidcentral nervous system disordersCNS disordersneurodegenerative diseasesepilepsystroke
Journal Article 2023-08-16 No Snippets McCartan R, Khorkova O, Volmar CH, Wahlestedt C.
Show Full Abstract

Nucleic acid-based therapeutics (NBTs) are an emerging class of drugs with potential for the treatment of a wide range of central nervous system conditions. To date, pertaining to CNS indications, there are two commercially available NBTs and a large number of ongoing clinical trials. However, these NBTs are applied directly to the brain due to very low blood brain barrier permeability. In this review, we outline recent advances in chemical modifications of NBTs and NBT delivery techniques intended to promote brain exposure, efficacy, and possible future systemic application.

Also flagged:COVID-19CoV-2 infectionACE2-2 infectionimmune responseSARS-CoV-2 infection
Journal Article 2023-08-16 No Snippets Zhang X, Ahn S, Qiu P, Datta S.
Show Full Abstract

The COVID-19 pandemic caused by SARS-CoV-2 has resulted in millions of confirmed cases and deaths worldwide. Understanding the biological mechanisms of SARS-CoV-2 infection is crucial for the development of effective therapies. This study conducts differential expression (DE) analysis, pathway analysis, and differential network (DN) analysis on RNA-seq data of four lung cell lines, NHBE, A549, A549.ACE2, and Calu3, to identify their common and unique biological features in response to SARS-CoV-2 infection. DE analysis shows that cell line A549.ACE2 has the highest number of DE genes, while cell line NHBE has the lowest. Among the DE genes identified for the four cell lines, 12 genes are overlapped, associated with various health conditions. The most significant signaling pathways varied among the four cell lines. Only one pathway, "cytokine-cytokine receptor interaction", is found to be significant among all four cell lines and is related to inflammation and immune response. The DN analysis reveals considerable variation in the differential connectivity of the most significant pathway shared among the four lung cell lines. These findings help to elucidate the mechanisms of SARS-CoV-2 infection and potential therapeutic targets.

Also flagged:Retinoic acid-inducible gene-I like receptorRetinoic acid-inducible gene-IRIG-I) like receptorRLRinfectioncancer
Journal Article 2023-08-16 No Snippets Du G, Xing Z, Zhou J, Cui C, Liu C, Liu Y, Li Z.
Show Full Abstract

Retinoic acid-inducible gene-I (RIG-I) like receptor (RLR) pathway is one of the most significant pathways supervising aberrant RNA in cells. In predominant conditions, the RLR pathway initiates anti-infection function via activating inflammatory effects, while recently it is discovered to be involved in cancer development as well, acting as a virus-mimicry responder. On one hand, the product IFNs induces tumor elimination. On the other hand, the NF-κB pathway is activated which may lead to tumor progression. Emerging evidence demonstrates that a wide range of modifications are involved in regulating RLR pathways in cancer, which either boost tumor suppression effect or prompt tumor development. This review summarized current epigenetic modulations including DNA methylation, histone modification, and ncRNA interference, as well as post-transcriptional modification like m6A and A-to-I editing of the upstream ligand dsRNA in cancer cells. The post-translational modulations like phosphorylation and ubiquitylation of the pathway's key components were also discussed. Ultimately, we provided an overview of the current therapeutic strategies targeting the RLR pathway in cancers.

B4GALT5
Also flagged:glycosyltransferasetumorGene Expressiongliomasgliomahepatitis A virus cellular receptor 2
Journal Article 2023-08-16 ✓ 3 Snippets Zhang C, Zhou W.
In-Text Gene Mentions

…glycosyltransferase 2 (EXT2),B4GALT5, beta-1,4-N-acetyl-galactosam…

…EXT2, EXT1, CHSY1,B4GALT5, B4GALT4, B4GALT1, B3GNT9,…

…GALNT10, EXT2, EXT1,B4GALT5, B4GALT4, B4GALT1, and…

Show Full Abstract

<b>Background:</b> Glycosyltransferase participates in glycosylation modification, and glycosyltransferase alterations are involved in carcinogenesis, progression, and immune evasion, leading to poor outcomes. However, in-depth studies on the influence of glycosyltransferase on clinical outcomes and treatments are lacking. <b>Methods:</b> The analysis of differentially expressed genes was performed using the Gene Expression Profiling Interactive Analysis 2 database. A total of 10 machine learning algorithms were introduced, namely, random survival forest, elastic network, least absolute shrinkage and selection operator, Ridge, stepwise Cox, CoxBoost, partial least squares regression for Cox, supervised principal components, generalized boosted regression modeling, and survival support vector machine. Gene Set Enrichment Analysis was performed to explore signaling pathways regulated by the signature. Cell-type identification by estimating relative subsets of RNA transcripts was used for estimating the fractions of immune cell types. <b>Results:</b> Here, we analyzed the genomic and expressive alterations in glycosyltransferase-related genes in gliomas. A combination of 80 machine learning algorithms was introduced to establish the glycosyltransferase-related mRNA signature (GRMS) based on 2,030 glioma samples from The Cancer Genome Atlas Program, Chinese Glioma Genome Atlas, Rembrandt, Gravendeel, and Kamoun cohorts. The GRMS was identified as an independent hazardous factor for overall survival and exhibited stable and robust performance. Notably, gliomas in the high-GRMS subgroup exhibited abundant tumor-infiltrating lymphocytes and tumor mutation burden values, increased expressive levels of hepatitis A virus cellular receptor 2 and CD274, and improved progression-free survival when subjected to anti-tumor immunotherapy. <b>Conclusion:</b> The GRMS may act as a powerful and promising biomarker for improving the clinical prognosis of glioma patients.

Also flagged:gastric cancertumorlymph node metastasiscancerlymph node metastasesdeath
Journal Article 2023-08-16 No Snippets Miccichè F, Rizzo G, Casà C, Leone M, Quero G, Boldrini L, Bulajic M, Corsi DC, Tondolo V.
Show Full Abstract

<h4>Introduction</h4>Gastric cancer (GC) is an aggressive and clinically heterogeneous tumor, and better risk stratification of lymph node metastasis (LNM) could lead to personalized treatments. The role of radiomics in the prediction of nodal involvement in GC has not yet been systematically assessed. This study aims to assess the role of radiomics in the prediction of LNM in GC.<h4>Methods</h4>A PubMed/MEDLINE systematic review was conducted to assess the role of radiomics in LNM. The inclusion criteria were as follows: i. original articles, ii. articles on radiomics, and iii. articles on LNM prediction in GC. All articles were selected and analyzed by a multidisciplinary board of two radiation oncologists and one surgeon, under the supervision of one radiation oncologist, one surgeon, and one medical oncologist.<h4>Results</h4>A total of 171 studies were obtained using the search strategy mentioned on PubMed. After the complete selection process, a total of 20 papers were considered eligible for the analysis of the results. Radiomics methods were applied in GC to assess the LNM risk. The number of patients, imaging modalities, type of predictive models, number of radiomics features, TRIPOD classification, and performances of the models were reported.<h4>Conclusions</h4>Radiomics seems to be a promising approach for evaluating the risk of LNM in GC. Further and larger studies are required to evaluate the clinical impact of the inclusion of radiomics in a comprehensive decision support system (DSS) for GC.

SERPINC1
Also flagged:angioedemaangiotensin converting enzymeC4C1lymphoproliferative disordersmonoclonal gammopathy
Journal Article 2023-08-16 ✓ 1 Snippet Pinto AR, Carolino F.
In-Text Gene Mentions

…AcquiredC1 InhibitorInhibitor Deficiency…

Show Full Abstract

<h4>Introduction</h4>Acquired angioedema (AAE), a rare cause of adult-onset non-urticarial mucocutaneous angioedema, can present as acute abdomen, a frequent complaint in the emergency room (ER), often leading to unnecessary and potentially harmful procedures.<h4>Case presentation</h4>We report a 47-year-old hypertense male, controlled with an angiotensin converting enzyme inhibitor (ACEI), who presented in the ER with progressively worsening abdominal pain, nausea, and vomiting, and a radiologic workup revealing small intestine thickening, initially diagnosed with ACEI-induced angioedema. However, further investigation revealed low serum levels of C4, C1q, and C1 inhibitors, with an abnormal function of the latter, favoring the diagnosis of AAE instead. The frequent association of this condition with lymphoproliferative disorders encouraged further studies, which unveiled a monoclonal gammopathy IgM/Kappa, representing an increased risk of Waldenström macroglobulinemia, non-Hodgkin lymphoma, and multiple myeloma.<h4>Discussion</h4>AAE should be regarded as an important differential diagnosis in patients presenting with acute abdomen in the ER, especially when more common causes are excluded. A correct and early diagnosis may represent a chance for a better prognosis of underlying diseases.

medRxiv 2023-08-16 Preprint (No Snippets API) Schmidt AF, Finan C, Chopade S, Ellmerich S, Rossor MN, Hingorani AD, Pepys MB.
Show Full Abstract

The direct causes of neurodegeneration underlying Alzheimer’s disease (AD) and many other dementias, are not known. Here we identify serum amyloid P component (SAP), a constitutive plasma protein normally excluded from the brain, as a potential drug target. After meta-analysis of three genome-wide association studies, comprising 44,288 participants, cis -Mendelian randomization showed that genes responsible for higher plasma SAP values are significantly associated with AD, Lewy body dementia and plasma tau concentration. These genetic findings are consistent with experimental evidence of SAP neurotoxicity and the strong, independent association of neocortex SAP content with dementia at death. Depletion of SAP from the blood and from the brain, as is provided by the safe, well tolerated, experimental drug, miridesap, may therefore contribute to treatment of neurodegeneration.

bioRxiv 2023-08-16 Preprint (No Snippets API) Ralli S, Vira T, Robles-Espinoza CD, Adams DJ, Brooks-Wilson AR.
Show Full Abstract

Identifying genetic susceptibility factors for complex disorders remains a challenging task. We have developed a weights-based pipeline to prioritize variants and genes in collections of small and large pedigrees where genetic heterogeneity is likely, but biological commonalities are plausible. The W eights-based v A riant R anking in P edigrees (WARP) pipeline prioritizes variants using 5 weights: disease incidence rate, number of cases in a family, genome fraction shared amongst cases in a family, allele frequency and variant deleteriousness. Weights, except for the population allele frequency weight, are normalized between 0 to 1. Weights are combined multiplicatively to produce family-specific-variant weights that are then averaged across all families in which the variant is observed to generate a multifamily weight. Sorting multifamily weights in descending order creates a ranked list of variants and genes for further investigation. WARP was validated using familial melanoma sequence data from the European Genome-phenome Archive. The pipeline identified variation in known germline melanoma genes POT1, MITF and BAP1 in 4 out of 13 families (31%). Analysis of the other 9 families identified several interesting genes, some of which might have a role in melanoma. WARP provides an approach to identify disease predisposing genes in studies with small and large pedigrees.

LRRC7
Also flagged:CIZ1chromosomecancerscondensationchromatinmethyltransferase
Journal Article 2023-08-15 ✓ 1 Snippet Dobbs OG, Wilson RHC, Newling K, Ainscough JF, Coverley D.
In-Text Gene Mentions

Condensinshave been associated…

Show Full Abstract

<h4>Background</h4>Cip1-interacting zinc finger protein 1 (CIZ1) forms RNA-dependent protein assemblies that stabilise epigenetic state, notable at the inactive X chromosome in females. CIZ1 has been linked with a range of human cancers and in mice genetic deletion of CIZ1 manifests as hyperproliferative lymphoid lineages in females. This suggests that its role in maintenance of epigenetic stability is linked with disease.<h4>Results</h4>Here, we show that male and female CIZ1-null primary murine fibroblasts have reduced H4K20me1 and that this compromises nuclear condensation on entry to quiescence. Global transcriptional repression remains intact in condensation-deficient CIZ1-null cells; however, a subset of genes linked with chromatin condensation and homology-directed DNA repair are perturbed. Failure to condense is phenotypically mimicked by manipulation of the H4K20me1 methyltransferase, SET8, in WT cells and partially reverted in CIZ1-null cells upon re-expression of CIZ1. Crucially, during exit from quiescence, nuclear decondensation remains active, so that repeated entry and exit cycles give rise to expanded nuclei susceptible to mechanical stress, DNA damage checkpoint activation, and downstream emergence of transformed proliferative colonies.<h4>Conclusions</h4>Our results demonstrate a role for CIZ1 in chromatin condensation on entry to quiescence and explore the consequences of this defect in CIZ1-null cells. Together, the data show that CIZ1's protection of the epigenome guards against genome instability during quiescence cycles. This identifies loss of CIZ1 as a potentially devastating vulnerability in cells that undergo cycles of quiescence entry and exit.

Also flagged:cysteinethioesteramideesterdegradationmethoxy
Journal Article 2023-08-15 No Snippets Hebels ER, van Steenbergen MJ, Haegebaert R, Seinen CW, Mesquita BS, van den Dikkenberg A, Remaut K, Rijcken CJF, van Ravensteijn BGP, Hennink WE, Vermonden T.
Show Full Abstract

Core-crosslinked polymeric micelles (CCPMs) are an attractive class of nanocarriers for drug delivery. Two crosslinking approaches to form CCPMs exist: either via a low-molecular-weight crosslinking agent to connect homogeneous polymer chains with reactive handles or via cross-reactive handles on polymers to link them to each other (complementary polymers). Previously, CCPMs based on methoxy poly(ethylene glycol)-<i>b</i>-poly[<i>N</i>-(2-hydroxypropyl) methacrylamide-lactate] (mPEG-<i>b</i>-PHPMAmLac<i><sub>n</sub></i>) modified with thioesters were crosslinked via native chemical ligation (NCL, a reaction between a cysteine residue and thioester resulting in an amide bond) using a bifunctional cysteine containing crosslinker. These CCPMs are degradable under physiological conditions due to hydrolysis of the ester groups present in the crosslinks. The rapid onset of degradation observed previously, as measured by the light scattering intensity, questions the effectiveness of crosslinking via a bifunctional agent. Particularly due to the possibility of intrachain crosslinks that can occur using such a small crosslinker, we investigated the degradation mechanism of CCPMs generated via both approaches using various analytical techniques. CCPMs based on complementary polymers degraded slower at pH 7.4 and 37 °C than CCPMs with a crosslinker (the half-life of the light scattering intensity was approximately 170 h versus 80 h, respectively). Through comparative analysis of the degradation profiles of the two different CCPMs, we conclude that partially ineffective intrachain crosslinks are likely formed using the small crosslinker, which contributed to more rapid CCPM degradation. Overall, this study shows that the type of crosslinking approach can significantly affect degradation kinetics, and this should be taken into consideration when developing new degradable CCPM platforms.

Also flagged:Biliary Atresialiver diseaseidiopathicpanbiliary cholangiopathycholestasisdevelopmental cholangiopathy
Journal Article 2023-08-15 No Snippets Hellen DJ, Karpen SJ.
Show Full Abstract

Biliary atresia (BA) is the most prevalent serious liver disease of infancy and childhood, and the principal indication for liver transplantation in pediatrics. BA is best considered as an idiopathic panbiliary cholangiopathy characterized by obstruction of bile flow and consequent cholestasis presenting during fetal and perinatal periods. While several etiologies have been proposed, each has significant drawbacks that have limited understanding of disease progression and the development of effective treatments. Recently, modern genetic analyses have uncovered gene variants contributing to BA, thereby shifting the paradigm for explaining the BA phenotype from an acquired etiology (e.g., virus, toxin) to one that results from genetically altered cholangiocyte development and function. Herein we review recently reported genetic contributions to BA, highlighting the enhanced representation of variants in biological pathways involving ciliary function, cytoskeletal structure, and inflammation. Finally, we blend these findings as a new framework for understanding the resultant BA phenotype as a developmental cholangiopathy.

Also flagged:translationalcytoplasmgene expressionribosomesribosomeorganelles
Journal Article 2023-08-15 No Snippets Meydan S, Guydosh NR.
Show Full Abstract

It is known that mRNAs and the machinery that translates them are not uniformly distributed throughout the cytoplasm. As a result, the expression of some genes is localized to particular parts of the cell and this makes it possible to carry out important activities, such as growth and signaling, in three-dimensional space. However, the functions of localized gene expression are not fully understood, and the underlying mechanisms that enable localized expression have not been determined in many cases. One consideration that could help in addressing these challenges is the role of quality control (QC) mechanisms that monitor translating ribosomes. On a global level, QC pathways are critical for detecting aberrant translation events, such as a ribosome that stalls while translating, and responding by activating stress pathways and resolving problematic ribosomes and mRNAs at the molecular level. However, it is unclear how these pathways, even when uniformly active throughout the cell, affect local translation. Importantly, some QC pathways have themselves been reported to be enriched in the proximity of particular organelles, but the extent of such localized activity remains largely unknown. Here, we describe the major QC pathways and review studies that have begun to explore their roles in localized translation. Given the limited data in this area, we also pose broad questions about the possibilities and limitations for how QC pathways could facilitate localized gene expression in the cell with the goal of offering ideas for future experimentation.

CSE1L
Also flagged:paclitaxelbreast cancerNanomaterialstumorperfluoropentanePANP
Journal Article 2023-08-15 ✓ 2 Snippets Zhang L, Ren Z, Lü J, Mo X, Lin J, Li Y, Ma W, Liu P, Shen Y, Zhao Q, Qian L, Cheng X, Yu Z, Zhang B.
In-Text Gene Mentions

CSE1L/CAS, a microtubule-associated protein, inhibits PTX-induced apoptosis but enhances cancer cell apoptosis induced by various chemotherapeutic drugs [12].

CSE1L/CAS, a microtubule-associated…

Show Full Abstract

Nanomaterials have been well demonstrated to have the potential to be used for tumor cell-targeted drug delivery. Targeted inhibition of miR-221 was proved to promote the sensitivity of triple genitive breast cancer (TNBC) cells to chemo-drugs. In order to improve the chemotherapeutic effect in TNBC, herein, we developed a novel kind of nanoparticles shelled with PLGA and loaded with perfluoropentane (PFP), paclitaxel (PTX), and anti-miR-221 inhibitor, which was named PANP. Ultrasound-triggered vaporization of PFP in PANPs was utilized for real-time imaging track of the nanoparticles in vivo. In addition, macrophages were applied for the internalization of PANPs to form RAW-PANP with strong chemotaxis to accumulate around cancer cells. Nanoparticles with different contents did not cause M2 polarization compared with the control group but caused polarization toward M1. We compared the inherent tumor-homing behavior of macrophages containing different contents with that of normal macrophages and no significant abnormalities were observed. After injection into the tumor-burden mice, RAW-PANPs showed enrichment within tumor tissues. Upon the ultrasound cavitation-triggered burst, PTX was released in the tumor. Meanwhile, the release of anti-miR-221 improved the sensitivity of tumor cells to PTX. As a result, RAW-PANPs showed high efficiency in suppressing TNBC cell proliferation in vitro and inhibiting tumor growth and progression in vivo. The treatments did not induce liver, heart, or kidney injury. In conclusion, the current study not only developed a macrophage-carried, ultrasound-triggered, cancer cell-targeted chemotherapeutic system, but also demonstrated a miRNA-based technique to promote drug sensitivity of cancer cells, which holds strong potential to treat patients with TNBC, especially for those suffering drug-resistance. The innovation of this study is to use macrophages to deliver nanoparticles to the tumors and then use ultrasound locally to burst the nanoparticles to release the miRNA and PTX.

SOX6
Also flagged:RNA polymerase IIcell cycleSUPT5Hβ-thalassemiaerythropoiesisgene expression
Journal Article 2023-08-15 ✓ 1 Snippet Martell DJ, Merens HE, Caulier A, Fiorini C, Ulirsch JC, Ietswaart R, Choquet K, Graziadei G, Brancaleoni V, Cappellini MD, Scott C, Roberts N, Proven M, Roy NBA, Babbs C, Higgs DR, Sankaran VG, Churchman LS.
In-Text Gene Mentions

SOX6

Show Full Abstract

Controlled release of promoter-proximal paused RNA polymerase II (RNA Pol II) is crucial for gene regulation. However, studying RNA Pol II pausing is challenging, as pause-release factors are almost all essential. In this study, we identified heterozygous loss-of-function mutations in SUPT5H, which encodes SPT5, in individuals with β-thalassemia. During erythropoiesis in healthy human cells, cell cycle genes were highly paused as cells transition from progenitors to precursors. When the pathogenic mutations were recapitulated by SUPT5H editing, RNA Pol II pause release was globally disrupted, and as cells began transitioning from progenitors to precursors, differentiation was delayed, accompanied by a transient lag in erythroid-specific gene expression and cell cycle kinetics. Despite this delay, cells terminally differentiate, and cell cycle phase distributions normalize. Therefore, hindering pause release perturbs proliferation and differentiation dynamics at a key transition during erythropoiesis, identifying a role for RNA Pol II pausing in temporally coordinating the cell cycle and erythroid differentiation.

HTT
Also flagged:Huntington's diseaseaxonsmyelin sheathsbrain developmentpathogenesisneurodegenerative diseases
Journal Article 2023-08-15 ✓ 2 Snippets Ferrari Bardile C, Radulescu CI, Pouladi MA.
In-Text Gene Mentions

…expansion in huntingtin (HTT), which results in…

…contributions of mutantHTT(mHTT).…

Show Full Abstract

Oligodendrocytes (OLGs), highly specialized glial cells that wrap axons with myelin sheaths, are critical for brain development and function. There is new recognition of the role of OLGs in the pathogenesis of neurodegenerative diseases (NDDs), including Huntington's disease (HD), a prototypic NDD caused by a polyglutamine tract expansion in huntingtin (HTT), which results in gain- and loss-of-function effects. Clinically, HD is characterized by a constellation of motor, cognitive, and psychiatric disturbances. White matter (WM) structures, representing myelin-rich regions of the brain, are profoundly affected in HD, and recent findings reveal oligodendroglia dysfunction as an early pathological event. Here, we focus on mechanisms that underlie oligodendroglial deficits and dysmyelination in the progression of the disease, highlighting the pathogenic contributions of mutant HTT (mHTT). We also discuss potential therapeutic implications involving these molecular pathways.

HFE
Also flagged:Ankle ArthropathyHereditary hemochromatosisHHbleeding disorderironliver disease
Journal Article 2023-08-15 ✓ 3 Snippets Calori S, Comisi C, Mascio A, Fulchignoni C, Pataia E, Maccauro G, Greco T, Perisano C.
In-Text Gene Mentions

…mutations in theHFEgene, which is…

…iron regulator protein (HFEprotein), which controls…

…ankle arthropathy inhemochromatosis, as well as…

Show Full Abstract

Hereditary hemochromatosis (HH) is an autosomal recessive bleeding disorder characterized by tissue overload of iron. Clinical systemic manifestations in HH include liver disease, cardiomyopathy, skin pigmentation, diabetes mellitus, erectile dysfunction, hypothyroidism, and arthropathy. Arthropathy with joint pain is frequently reported at diagnosis and mainly involves the metacarpophalangeal and ankle joints, and more rarely, the hip and knee. Symptoms in ankle joints are in most cases non-specific, and they can range from pain and swelling of the ankle to deformities and joint destruction. Furthermore, the main radiological signs do not differ from those of primary osteoarthritis (OA). Limited data are available in the literature regarding treatment; surgery seems to be the gold standard for ankle arthropathy in HH. Pharmacological treatments used to maintain iron homeostasis can also be undertaken to prevent the arthropathy, but conclusive data are not yet available. This review aimed to assess the ankle arthropathy in the context of HH, including all its aspects: epidemiology, physiopathology, clinical and imaging presentation, and all the treatments available to the current state of knowledge.

Also flagged:genetic disordersmetabolismprotein kinasesSteroidsbile acidsamines
Journal Article 2023-08-15 No Snippets Zhang Y, Barupal DK, Fan S, Gao B, Zhu C, Flenniken AM, McKerlie C, Nutter LMJ, Lloyd KCK, Fiehn O.
Show Full Abstract

Although metabolic alterations are observed in many monogenic and complex genetic disorders, the impact of most mammalian genes on cellular metabolism remains unknown. Understanding the effect of mouse gene dysfunction on metabolism can inform the functions of their human orthologues. We investigated the effect of loss-of-function mutations in 30 unique gene knockout (KO) lines on plasma metabolites, including genes coding for structural proteins (11 of 30), metabolic pathway enzymes (12 of 30) and protein kinases (7 of 30). Steroids, bile acids, oxylipins, primary metabolites, biogenic amines and complex lipids were analyzed with dedicated mass spectrometry platforms, yielding 827 identified metabolites in male and female KO mice and wildtype (WT) controls. Twenty-two percent of 23,698 KO versus WT comparison tests showed significant genotype effects on plasma metabolites. Fifty-six percent of identified metabolites were significantly different between the sexes in WT mice. Many of these metabolites were also found to have sexually dimorphic changes in KO lines. We used plasma metabolites to complement phenotype information exemplified for Dhfr, Idh1, Mfap4, Nek2, Npc2, Phyh and Sra1. The association of plasma metabolites with IMPC phenotypes showed dramatic sexual dimorphism in wildtype mice. We demonstrate how to link metabolomics to genotypes and (disease) phenotypes. Sex must be considered as critical factor in the biological interpretation of gene functions.

Also flagged:NotchSUMOylationESROestrogen ReceptorBreast CancerER
Journal Article 2023-08-15 No Snippets Corsaro L, Gentilini D, Calzari L, Gambino VS.
Show Full Abstract

Oestrogen receptor expression in breast cancer (BC) cells is a marker of high cellular differentiation and allows the identification of two BC groups (ER-positive and ER-negative) that, although not completely homogeneous, differ in biological characteristics, clinical behaviour, and therapeutic options. The study, based on three publicly available EWAS (Epigenetic Wide Association Study) datasets, focuses on the comparison between these two groups of breast cancer using an epimutation score. The score is calculated not only based on the presence of the epimutation, but also on the deviation amplitude of the methylation outlier value. For each dataset, we performed a functional analysis based first on the functional gene region of each annotated gene (we aggregated the data per gene region TSS1500, TSS200, first-exon, and body-gene identified by the information from the Illumina Data Sheet), and then, we performed a pathway enrichment analysis through the REACTOME database based on the genes with the highest epimutation score. Thus, we blended our results and found common pathways for all three datasets. We found that a higher and significant epimutation score due to hypermethylation in ER-positive BC is present in the promoter region of the genes belonging to the SUMOylation pathway, the Notch pathway, the IFN-γ signalling pathway, and the deubiquitination protease pathway, while a higher and significant level of epimutation due to hypomethylation in ER-positive BC is present in the promoter region of the genes belonging to the ESR-mediated pathway. The presence of this state of promoter hypomethylation in the ESR-mediated signalling genes is consistent and coherent with an active signalling pathway mediated by oestrogen function in the group of ER-positive BC. The SUMOylation and Notch pathways are associated with BC pathogenesis and have been found to play distinct roles in the two BC subgroups. We speculated that the altered methylation profile may play a role in regulating signalling pathways with specific functions in the two subgroups of ER BC.

PRDX6
Also flagged:Transferrincancerglutathionethioredoxinprostate cancercell cycle
Journal Article 2023-08-15 ✓ 2 Snippets Sebastian S, Hoffmann MK, Howard D, Young C, Washington J, Unterweger H, Alexiou C, Turnbull T, D'Andrea R, Hoffmann P, Kempson I.
In-Text Gene Mentions

PRDX6is actively involved…

…PRDX1, PRDX3, andPRDX6.…

Show Full Abstract

Nanoparticle-based therapeutics are being clinically translated for treating cancer. Even when thought to be biocompatible, nanoparticles are being increasingly identified as altering cell regulation and homeostasis. Antioxidant pathways are important for maintaining cell redox homeostasis and play important roles by maintaining ROS levels within tolerable ranges. Here, we sought to understand how a model of a relatively inert nanoparticle without any therapeutic agent itself could antagonize a cancer cell lines' antioxidant mechanism. A label-free protein expression approach was used to assess the glutathione-thioredoxin antioxidative pathway in a prostate cancer cell line (PC-3) after exposure to gold nanoparticles conjugated with a targeting moiety (transferrin). The impact of the nanoparticles was also corroborated through morphological analysis with TEM and classification of pro-apoptotic cells by way of the sub-G0/G1 population via the cell cycle and annexin V apoptosis assay. After a two-hour exposure to nanoparticles, major proteins associated with the glutathione-thioredoxin antioxidant pathway were downregulated. However, this response was acute, and in terms of protein expression, cells quickly recovered within 24 h once nanoparticle exposure ceased. The impact on PRDX-family proteins appears as the most influential factor in how these nanoparticles induced an oxidative stress response in the PC-3 cells. An apparent adaptive response was observed if exposure to nanoparticles continued. Acute exposure was observed to have a detrimental effect on cell viability compared to continuously exposed cells. Nanoparticle effects on cell regulation likely provide a compounding therapeutic advantage under some circumstances, in addition to the action of any cytotoxic agents; however, any therapeutic advantage offered by nanoparticles themselves with regard to vulnerabilities specific to the glutathione-thioredoxin antioxidative pathway is highly temporal.

HFE
Also flagged:Bacterial InfectionsBacterialintra-abdominal infectionsinfectionsliver diseasesinfection
Journal Article 2023-08-15 ✓ 1 Snippet Taddei R, Riccardi N, Tiseo G, Galfo V, Biancofiore G.
In-Text Gene Mentions

…high MELD score,hemochromatosis, ascites, obesity, prior…

Show Full Abstract

Despite recent advances in the transplant field, infectious complications after orthotopic liver transplantation (OLT) are major causes of morbidity and mortality. Bacterial intra-abdominal infections (IAIs) are predominant during the first month post-transplantation and affect patient and graft survival. Recently, the emergence of multidrug resistant bacteria has generated great concern in OLT patients. We performed this narrative review of the literature in order to propose a "ready-to-use" flowchart for reasoned empirical antibiotic therapy in the case of suspected post-OLT IAIs. The review was ultimately organized into four sections: "Epidemiology and predisposing factors for IAI"; "Surgical-site infections and perioperative prophylaxis"; "MDRO colonization and infections"; and "Reasoned-empirical antibiotic therapy in early intra-abdominal infections post OLT and source control". Multidisciplinary teamwork is warranted to individualize strategies for the prevention and treatment of IAIs in OLT recipients, taking into account each patient's risk factors, the surgical characteristics, and the local bacterial epidemiology.

DCC
Also flagged:extracellulargrowth conesaxonsNetrinlamininaxonal
Journal Article 2023-08-15 ✓ 3 Snippets Mahadik SS, Lundquist EA.
In-Text Gene Mentions

…cytoplasmic tail of UNC-40/DCCand is involved…

… UNC-6/Netrin receptor UNC-40/DCChas a dual…

…this polarity, the UNC-40/DCC receptorreceptor stimulates growth…

Show Full Abstract

<b>Introduction:</b> UNC-6/Netrin is a conserved bi-functional guidance cue which regulates dorsal-ventral axon guidance in <i>C. elegans</i>. In the Polarity/Protrusion model of UNC-6/Netrin mediated dorsal growth away from UNC-6/Netrin, The UNC-5 receptor first polarizes the VD growth cone such that filopodial protrusions are biased dorsally. Based on this polarity, the UNC-40/DCC receptor stimulates growth cone lamellipodial and filopodial protrusion dorsally. The UNC-5 receptor maintains dorsal polarity of protrusion, and inhibits growth cone protrusion ventrally, resulting in net dorsal growth cone advance. <b>Methods:</b> Growth cone imaging in mutants, combined with Cas9 genome editing and genetic analysis, were used to analyze the role of a novel short isoform on <i>unc-5</i> in growth cone polarity and protrusion. <b>Results:</b> Work presented here demonstrates a novel role of a previously undescribed, conserved short isoform of UNC-5 (UNC-5B). UNC-5B lacks the cytoplasmic domains of UNC-5 long, including the DEATH domain, the UPA/DB domain, and most of the ZU5 domain. Mutations that specifically affect only the <i>unc-5</i> long isoforms were hypomorphic, suggesting a role of <i>unc-5B</i> short. A mutation specifically affecting <i>unc-5B</i> caused loss of dorsal polarity of protrusion and reduced growth cone filopodial protrusion, the opposite of <i>unc-5</i> long mutations. Transgenic expression of <i>unc-5B</i> partially rescued <i>unc-5</i> axon guidance defects, and resulted in large growth cones. Tyrosine 482 (Y482) in the cytoplasmic juxtamembrane region has been shown to be important for UNC-5 function, and is present in both UNC-5 long and UNC-5B short. Results reported here show that Y482 is required for the function of UNC-5 long and for some functions of UNC-5B short. Finally, genetic interactions with <i>unc-40</i> and <i>unc-6</i> suggest that UNC-5B short acts in parallel to UNC-6/Netrin to ensure robust growth cone lamellipodial protrusion. <b>Discussion:</b> These results demonstrate a previously-undescribed role for the UNC-5B short isoform, which is required for dorsal polarity of growth cone filopodial protrusion and to stimulate growth cone protrusion, in contrast to the previously-described role of UNC-5 long in inhibiting growth cone protrusion.

STAU1
Also flagged:major depressive disorderendoplasmic reticulumpathogenesisERSKCNE1PDIA4
Journal Article 2023-08-15 ✓ 5 Snippets Huang S, Li Y, Shen J, Liang W, Li C.
In-Text Gene Mentions

…genes: KCNE1, PDIA4,STAU1, TMED4, MGST1, RCN1,…

…): KCNE1, PDIA4,STAU1, TMED4, MGST1, RCN1,…

…model: KCNE1, PDIA4,STAU1, TMED4, MGST1, RCN1…

…Staufen 1 (STAU1) is generally expressed…

…currents, suggesting thatSTAU1is important for…

Show Full Abstract

<h4>Subject</h4>Major depressive disorder (MDD) negatively affects patients' behaviours and daily lives. Due to the high heterogeneity and complex pathological features of MDD, its diagnosis remains challenging. Evidence suggests that endoplasmic reticulum stress (ERS) is involved in the pathogenesis of MDD; however, relevant diagnostic markers have not been well studied. This study aimed to screen for ERS genes with potential diagnostic value in MDD.<h4>Methods</h4>Gene expression data on MDD samples were downloaded from the GEO database, and ERS-related genes were obtained from the GeneCards and MSigDB databases. Differentially expressed genes (DEGs) in MDD patients and healthy subjects were identified and then integrated with ERS genes. ERS diagnostic model and nomogram were developed based on biomarkers screened using the LASSO method. The diagnostic performance of this model was evaluated. ERS-associated subtypes were identified. CIBERSORT and GSEA were used to explore the differences between the different subtypes. Finally, WGCNA was performed to identify hub genes related to the subtypes.<h4>Results</h4>A diagnostic model was developed based on seven ERS genes: KCNE1, PDIA4, STAU1, TMED4, MGST1, RCN1, and SHC1. The validation analysis showed that this model had a good diagnostic performance. KCNE1 expression was positively correlated with M0 macrophages and negatively correlated with resting CD4+ memory T cells. Two subtypes (SubA and SubB) were identified, and these two subtypes showed different ER score. The SubB group showed higher immune infiltration than the SubA group. Finally, NCF4, NCF2, CSF3R, and FPR2 were identified as hub genes associated with ERS molecular subtypes.<h4>Conclusion</h4>Our current study provides novel diagnostic biomarkers for MDD from an ERS perspective, and these findings further facilitate the use of precision medicine in MDD.

Also flagged:AMLAcute myeloid leukemiamyeloid neoplasmshematologic malignanciesacute lymphoid leukemiamyeloma
Journal Article 2023-08-15 No Snippets Kent A, Crump LS, Davila E.
Show Full Abstract

Acute myeloid leukemia (AML) remains an elusive disease to treat, let alone cure, even after highly intensive therapies such as stem cell transplants. Adoptive cell therapeutic strategies based on conventional alpha beta (αβ)T cells are an active area of research in myeloid neoplasms given their remarkable success in other hematologic malignancies, particularly B-cell-derived acute lymphoid leukemia, myeloma, and lymphomas. Several limitations have hindered clinical application of adoptive cell therapies in AML including lack of leukemia-specific antigens, on-target-off-leukemic toxicity, immunosuppressive microenvironments, and leukemic stem cell populations elusive to immune recognition and destruction. While there are promising T cell-based therapies including chimeric antigen receptor (CAR)-T designs under development, other cytotoxic lymphocyte cell subsets have unique phenotypes and capabilities that might be of additional benefit in AML treatment. Of particular interest are the natural killer (NK) and unconventional T cells known as invariant natural killer T (iNKT) and gamma delta (γδ) T cells. NK, iNKT, and γδT cells exhibit intrinsic anti-malignant properties, potential for alloreactivity, and human leukocyte-antigen (HLA)-independent function. Here we review the biology of each of these unconventional cytotoxic lymphocyte cell types and compare and contrast their strengths and limitations as the basis for adoptive cell therapies for AML.

Also flagged:glucocorticoid receptorsteroidsGRdexamethasonecortisolcortivazol
Journal Article 2023-08-15 No Snippets Toso A, Boulahtouf A, Escande A, Garoche C, Balaguer P.
Show Full Abstract

<h4>Introduction</h4>The action of environmental steroids on the human glucocorticoid receptor (hGR) has been pointed out with the risk to impair physiological immune and metabolic processes regulated by this nuclear receptor. However, there is still a lack of mechanistic information regarding their ability to interact with GR in aquatic species.<h4>Methods</h4>To investigate ligand activation differences between hGR and zebrafish GR (zfGR), we tested several natural and synthetic steroids using reporter cell lines expressing hGR or zfGR.<h4>Results and discussion</h4>Almost all the glucocorticoids tested (dexamethasone, cortisol, bimedrazol, medrol, cortivazol and fluticasone) are agonists of the two receptors with similar potencies. The dissociated glucocorticoids, RU24782 and RU24858 are agonists of both zfGR and hGR but with a better potency for the latter. On the other hand, the synthetic glucocorticoid forbimenol and the mineralocorticoid aldosterone are agonist on hGR but antagonist on zfGR. The other steroids tested, androgens and progestins, are all antagonists of both GRs with equal or lower potency on zfGR than on hGR. Surprisingly, the lower efficacy and potency on zfGR of aldosterone, forbimenol and the dissociated glucocorticoids is not related to their affinity for the receptors which would suggest that it could be related to less efficacious recruitment of coactivators by zfGR compared to hGR.

HFE
Also flagged:Hepatic Angiosarcomaangiosarcomaneoplasmliver tumorshepatocellular carcinomacryptogenic cirrhosis
Journal Article 2023-08-15 ✓ 1 Snippet Anguiano-Albarran R, Cain D, Obi F, Pradeep S, Cimo M, Mehta S.
In-Text Gene Mentions

…al contraceptives, phenelzine,hemochromatosis, and von Recklinghausen…

Show Full Abstract

Primary hepatic angiosarcoma (PHA) is an exceedingly rare and aggressive neoplasm of mesenchymal origin. PHA makes a very small portion of primary liver tumors and conveys a poor prognosis. Symptomatology can be vague and often mimics primary hepatocellular carcinoma upon presentation. Diagnosis requires careful immunohistopathologic confirmation. We present a case of PHA in a patient with abdominal pain and suspected underlying cryptogenic cirrhosis.

ECI2
Also flagged:Parkinson's diseasemetabolismPDbile acidomega-3 fatty acidlipoic acid
Journal Article 2023-08-14 ✓ 1 Snippet Odongo R, Bellur O, Abdik E, Çakır T.
In-Text Gene Mentions

…patterns for CBR1,ECI2, BDH2, CYP27A1, ALDH1B1,…

Show Full Abstract

Alterations in brain metabolism are closely associated with the molecular hallmarks of Parkinson's disease (PD). A clear understanding of the main metabolic perturbations in PD is therefore important. Here, we retrospectively analysed the expression of metabolic genes from 34 PD-control post-mortem human brain transcriptome data comparisons from literature, spanning multiple brain regions. We found high metabolic correlations between the Substantia nigra (SN)- and cerebral cortex-derived tissues. Moreover, three clusters of PD patient cohorts were identified based on perturbed metabolic processes in the SN - each characterised by perturbations in (a) bile acid metabolism (b) omega-3 fatty acid metabolism, and (c) lipoic acid and androgen metabolism - metabolic themes not comprehensively addressed in PD. These perturbations were supported by concurrence between transcriptome and proteome changes in the expression patterns for CBR1, ECI2, BDH2, CYP27A1, ALDH1B1, ALDH9A1, ADH5, ALDH7A1, L1CAM, and PLXNB3 genes, providing a valuable resource for drug targeting and diagnosis. Also, we analysed 58 PD-control transcriptome data comparisons from <i>in vivo</i>/<i>in vitro</i> disease models and identified experimental PD models with significant correlations to matched human brain regions. Collectively, our findings suggest metabolic alterations in several brain regions, heterogeneity in metabolic alterations between study cohorts for the SN tissues and the need to optimize current experimental models to advance research on metabolic aspects of PD.

DNAH10
Also flagged:DNAH17male infertilityasthenozoospermiaasthenoteratospermiaprimary ciliary dyskinesiateratozoospermia
Journal Article 2023-08-14 ✓ 1 Snippet Song B, Yang T, Shen Q, Liu Y, Wang C, Li G, Gao Y, Cao Y, He X.
In-Text Gene Mentions

DNAH10

Show Full Abstract

<h4>Purpose</h4>To identify new mutations in DNAH17 that cause male infertility and analyze intracytoplasmic sperm injection (ICSI) outcomes in patients with DNAH17 mutations.<h4>Methods</h4>A total of five cases of new DNAH17 mutations exhibiting the multiple morphological abnormalities of the sperm flagella (MMAF) phenotype were identified through semen analysis and genetic testing. They were recruited at our reproductive medicine center from September 2018 to July 2022. Information on DNAH17 genetic mutations and ICSI outcomes was systematically explored following a literature review.<h4>Results</h4>Three novel compound mutations in DNAH17 were identified in patients with male infertility caused by MMAF. This study and previous publications included 21 patients with DNAH17 mutations. DNAH17 has been associated with asthenozoospermia and male infertility, but different types of DNAH17 variants appear to be involved in different sperm phenotypes. In 11 couples of infertile patients with DNAH17 mutations, there were 17 ICSI cycles and 13 embryo transplantation cycles. Only three men with DNAH17 variants ultimately achieved clinical pregnancy with their partners through ICSI combined with assisted oocyte activation (AOA).<h4>Conclusions</h4>Loss-of-function mutations in DNAH17 can lead to severe sperm flagellum defects and male infertility. Patients with MMAF-harboring DNAH17 mutations generally have worse pregnancy outcomes following ICSI. ICSI combined with AOA may improve the outcome of assisted reproductive techniques (ARTs) for men with DNAH17 variants.

OLFM4
Also flagged:cyclooxygenasehomeostasisprostaglandin E2COXwaterPGE2
Journal Article 2023-08-14 ✓ 2 Snippets Wei S, Li M, Song W, Liu J, Yu S, Wang Y, Zhang M, Du H, Liu Y, Liu H, Fu W, Li B, Chen YG.
In-Text Gene Mentions

…(Abcam, 1:300); rabbit anti-Olfm4(CST, 1:300).…

…6 D) andOlfm4+ stem cells…

Show Full Abstract

Paracrine signals play pivotal roles in organ homeostasis. Mesenchymal stromal cells (MSCs) play a key role in regulating epithelium homeostasis in the intestine while their paracrine effects are poorly characterized. Here, we identified prostaglandin E2 (PGE2) secreted by cyclooxygenase (COX)-expressing MSCs as a vital factor to maintain the intestinal mucosal barrier. We found that MSCs-induced organoid swelling through paracrine effect in vitro, a process due to enhanced water adsorption and is mediated by the COX-PGE2-EP4 axis. To further explore the regulatory effect of this axis on the intestinal epithelial barrier in vivo, we established the conditional knockout mouse model to specifically delete COX in MSCs and found that PGE2 reduction downregulated the gene Muc2 and induced a gastric metaplasia-like phenotype. Moreover, PGE2 defects increased the susceptibility of intestinal epithelium to colitis. Our study uncovers the paracrine signaling of COX-expressing MSCs in intestinal mucosal barrier maintenance, providing a basis for understanding the role of mesenchymal cells in the pathophysiological function of the intestine.

Also flagged:erythropoiesisironoxygensynthesismetabolismanemia
Journal Article 2023-08-14 No Snippets Ginzburg Y, An X, Rivella S, Goldfarb A.
Show Full Abstract

Erythroblasts possess unique characteristics as they undergo differentiation from hematopoietic stem cells. During terminal erythropoiesis, these cells incorporate large amounts of iron in order to generate hemoglobin and ultimately undergo enucleation to become mature red blood cells, ultimately delivering oxygen in the circulation. Thus, erythropoiesis is a finely tuned, multifaceted process requiring numerous properly timed physiological events to maintain efficient production of 2 million red blood cells per second in steady state. Iron is required for normal functioning in all human cells, the erythropoietic compartment consuming the majority in light of the high iron requirements for hemoglobin synthesis. Recent evidence regarding the crosstalk between erythropoiesis and iron metabolism sheds light on the regulation of iron availability by erythroblasts and the consequences of insufficient as well as excess iron on erythroid lineage proliferation and differentiation. In addition, significant progress has been made in our understanding of dysregulated iron metabolism in various congenital and acquired malignant and non-malignant diseases. Finally, we report several actual as well as theoretical opportunities for translating the recently acquired robust mechanistic understanding of iron metabolism regulation to improve management of patients with disordered erythropoiesis, such as anemia of chronic inflammation, β-thalassemia, polycythemia vera, and myelodysplastic syndromes.

HTT
Also flagged:movement disorderHuntingtinHDhepatoma-derived growth factorHDGFcytoplasmic
Journal Article 2023-08-14 ✓ 5 Snippets Voelkl K, Gutiérrez-Ángel S, Keeling S, Koyuncu S, da Silva Padilha M, Feigenbutz D, Arzberger T, Vilchez D, Klein R, Dudanova I.
In-Text Gene Mentions

In addition to the early-onset transgenic R6/2 model, which expresses an N-terminal fragment of mHTT, we investigated the consequences of HDGF overexpression in the late-onset zQ175DN knock-in mouse model (Menalled et al, 2012; Southwell et al, 2016) that expresses full-length mHTT from the endogenous murine Htt locus and, therefore, more faithfully reproduces human HD.

To test whether HDGF is neuroprotective in the context of HD, we first used an inducible stable neuron-like PC12 cell line with pathologically expanded HTT-exon1-Q74 fused to EGFP and a control PC12 cell line with non-pathogenic HTT-exon1-Q23–EGFP (Fig 1A) (Wyttenbach et al, 2001).

…1:500; Abcam), mouse anti-HTT(EM48, MAB5374, 1:500;…

…the endogenous murineHttlocus and, therefore,…

…the nucleus, whereasHTT-exon1-Q97-mCherry inclusions …

Show Full Abstract

Huntington's disease (HD) is a movement disorder caused by a mutation in the Huntingtin gene that leads to severe neurodegeneration. Molecular mechanisms of HD are not sufficiently understood, and no cure is currently available. Here, we demonstrate neuroprotective effects of hepatoma-derived growth factor (HDGF) in cellular and mouse HD models. We show that HD-vulnerable neurons in the striatum and cortex express lower levels of HDGF than resistant ones. Moreover, lack of endogenous HDGF exacerbated motor impairments and reduced the life span of R6/2 Huntington's disease mice. AAV-mediated delivery of HDGF into the brain reduced mutant Huntingtin inclusion load, but had no significant effect on motor behavior or life span. Interestingly, both nuclear and cytoplasmic versions of HDGF were efficient in rescuing mutant Huntingtin toxicity in cellular HD models. Moreover, extracellular application of recombinant HDGF improved viability of mutant Huntingtin-expressing primary neurons and reduced mutant Huntingtin aggregation in neural progenitor cells differentiated from human patient-derived induced pluripotent stem cells. Our findings provide new insights into the pathomechanisms of HD and demonstrate neuroprotective potential of HDGF in neurodegeneration.

NEGR1
Also flagged:bipolar disordermood instabilitybipolar disordersMood disordersneurogenesisanxiety
Journal Article 2023-08-14 ✓ 1 Snippet Wang J, Lu T, Gui Y, Zhang X, Cao X, Li Y, Li C, Liu L, Ding Z.
In-Text Gene Mentions

For example, AHN was compromised when negr1 knockout mice developed anxiety- and depression-like behaviors, whereas AHN restoration rescued the mood disorders [8].

Show Full Abstract

Mood instability, a subjective emotional state defined as rapid mood oscillations of up and down, is a symptom that occurs in several psychiatric disorders, particularly major depressive disorder and bipolar disorder. Heat shock protein A12A (HSPA12A) shows decreased expression in the brains of schizophrenia patients. However, the causal effects of HSPA12A in any psychiatric disorders are completely unknown. To investigate whether HSPA12A affects mood stability, Hspa12a-knockout mice (Hspa12a<sup>-</sup><sup>/-</sup>) and wild-type (WT) littermates were subjected to tests of open field, forced swimming, elevated plus maze, and sucrose preference. Cerebral lactate levels were measured in cerebrospinal fluid (CSF). Adult hippocampal neurogenesis (AHN) was assessed by BrdU labeling. We found that acute mood stress increased hippocampal HSPA12A expression and CSF lactate levels in mice. However, Hspa12a<sup>-</sup><sup>/-</sup> mice exhibited behaviors of mood instability (anhedonia, lower locomotor activity, antidepression, and anxiety), which were accompanied by impaired AHN, decreased CSF lactate levels, and downregulated hippocampal glycolytic enzyme expression. By contrast, HSPA12A overexpression increased lactate production and glycolytic enzyme expression of primary hippocampal neurons. Intriguingly, lactate administration alleviated the mood instability and AHN impairment in Hspa12a<sup>-</sup><sup>/-</sup> mice. Further analyses revealed that HSPA12A was necessary for sustaining cerebral lactate homeostasis, which could be mediated by inhibiting GSK3β in hippocampal neurons, to maintain AHN and mood stabilization. Taken together, HSPA12A is defined as a novel regulator of mood stability and exerts therapeutic potential for mood disorder. Our findings establish a framework for determining mood disorder and AHN relevance of cerebral lactate homeostasis. HSPA12A is a novel mood stabilizer through inhibiting GSK3β in hippocampal neurons, thereby sustaining glycolysis-generated lactate to maintain cerebral lactate homeostasis, which ultimately leading to maintenance of hippocampal neurogenesis and mood stabilization.

CCPG1
Also flagged:pathogenesisacute pancreatitisinflammatory disease of theorganellemacroautophagyautophagy
Journal Article 2023-08-14 ✓ 1 Snippet Wang TT, Zhang LC, Qin Z, Chen SJ, Zeng JM, Li JY, An L, Wang CY, Gao Y, Wang LM, Zhao ZX, Liu ZQ, Wang SG.
In-Text Gene Mentions

CCPG1

Show Full Abstract

Acute pancreatitis (AP) is an inflammatory disease of the exocrine pancreas. Disruptions in organelle homeostasis, including macroautophagy/autophagy dysfunction and endoplasmic reticulum (ER) stress, have been implicated in human and rodent pancreatitis. Syntaxin 17 (STX17) belongs to the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) subfamily. The Qa-SNARE STX17 is an autophagosomal SNARE protein that interacts with SNAP29 (Qbc-SNARE) and the lysosomal SNARE VAMP8 (R-SNARE) to drive autophagosome-lysosome fusion. In this study, we investigated the role of STX17 in the pathogenesis of AP in male mice or rats induced by repeated intraperitoneal injections of cerulein. We showed that cerulein hyperstimulation induced AP in mouse and rat models, which was characterized by increased serum amylase and lipase activities, pancreatic edema, necrotic cell death and the infiltration of inflammatory cells, as well as markedly decreased pancreatic STX17 expression. A similar reduction in STX17 levels was observed in primary and AR42J pancreatic acinar cells treated with CCK (100 nM) in vitro. By analyzing autophagic flux, we found that the decrease in STX17 blocked autophagosome-lysosome fusion and autophagic degradation, as well as the activation of ER stress. Pancreas-specific STX17 knockdown using adenovirus-shSTX17 further exacerbated pancreatic edema, inflammatory cell infiltration and necrotic cell death after cerulein injection. These data demonstrate a critical role of STX17 in maintaining pancreatic homeostasis and provide new evidence that autophagy serves as a protective mechanism against AP.

Also flagged:Chromatin remodeling factorINO80PMAIP1histonemodificationsmethylation
Journal Article 2023-08-14 No Snippets Miura R, Mimura I, Saigusa H, Yamazaki T, Tanemoto F, Kurata Y, Sato D, Tanaka T, Nangaku M.
Show Full Abstract

Epigenetic modifications such as DNA methylation, histone modifications, and chromatin structures in the kidney contribute towards the progression of chronic kidney disease (CKD). In this study, the role of chromatin remodeling factor inositol requiring 80 (INO80) was investigated. Although INO80 regulates transcription by altering the chromatin structure at the nucleosome level, its role in the kidney remains unknown. We demonstrated that the expression of INO80 in impaired kidneys decreased in rats with unilateral urethral obstruction. We investigated INO80 expression in a proximal tubular cell line and observed that its expression decreased under hypoxic condition. Additionally, INO80 knockdown promoted apoptosis, suggesting that INO80 plays a role in inhibiting tubular cell apoptosis. We identified downstream target genes of INO80 via genome-wide analysis using RNA-sequences and found that the expression of apoptosis-related genes, such as TP53 and E2F1, and pro-apoptotic genes, such as PMAIP1, increased upon INO80 knockdown. ChIP-qPCR of the loci of PMAIP1 showed that the amount of H2A.Z. increased instead of decreasing the amount of H2A when INO80 was knocked down. These results indicated that INO80 plays a role in the exchange of H2A.Z. for H2A in the promoter region of PMAIP1 in tubular cells to inhibit apoptosis during CKD progression.

OLFM4
Also flagged:colorectal canceradenosylhomocysteinasetumour suppressorsKRAStumourmethionine
Journal Article 2023-08-14 ✓ 1 Snippet Vande Voorde J, Steven RT, Najumudeen AK, Ford CA, Dexter A, Gonzalez-Fernandez A, Nikula CJ, Xiang Y, Ford L, Maneta Stavrakaki S, Gilroy K, Zeiger LB, Pennel K, Hatthakarnkul P, Elia EA, Nasif A, Murta T, Manoli E, Mason S, Gillespie M, Lannagan TRM, Vlahov N, Ridgway RA, Nixon C, Raven A, Mills M, Athineos D, Kanellos G, Nourse C, Gay DM, Hughes M, Burton A, Yan B, Sellers K, Wu V, De Ridder K, Shokry E, Huerta Uribe A, Clark W, Clark G, Kirschner K, Thienpont B, Li VSW, Maddocks ODK, Barry ST, Goodwin RJA, Kinross J, Edwards J, Yuneva MO, Sumpton D, Takats Z, Campbell AD, Bunch J, Sansom OJ.
In-Text Gene Mentions

…Lgr5 (312178) andOlfm4(311838; both from…

Show Full Abstract

The genomic landscape of colorectal cancer (CRC) is shaped by inactivating mutations in tumour suppressors such as APC, and oncogenic mutations such as mutant KRAS. Here we used genetically engineered mouse models, and multimodal mass spectrometry-based metabolomics to study the impact of common genetic drivers of CRC on the metabolic landscape of the intestine. We show that untargeted metabolic profiling can be applied to stratify intestinal tissues according to underlying genetic alterations, and use mass spectrometry imaging to identify tumour, stromal and normal adjacent tissues. By identifying ions that drive variation between normal and transformed tissues, we found dysregulation of the methionine cycle to be a hallmark of APC-deficient CRC. Loss of Apc in the mouse intestine was found to be sufficient to drive expression of one of its enzymes, adenosylhomocysteinase (AHCY), which was also found to be transcriptionally upregulated in human CRC. Targeting of AHCY function impaired growth of APC-deficient organoids in vitro, and prevented the characteristic hyperproliferative/crypt progenitor phenotype driven by acute deletion of Apc in vivo, even in the context of mutant Kras. Finally, pharmacological inhibition of AHCY reduced intestinal tumour burden in Apc<sup>Min/+</sup> mice indicating its potential as a metabolic drug target in CRC.

TNFSF4
Also flagged:Listeria monocytogenes infectionscytokinemTORmetabolisminfectionimmune depression
Journal Article 2023-08-14 ✓ 1 Snippet Siracusa F, Schaltenberg N, Kumar Y, Lesker TR, Steglich B, Liwinski T, Cortesi F, Frommann L, Diercks BP, Bönisch F, Fischer AW, Scognamiglio P, Pauly MJ, Casar C, Cohen Y, Pelczar P, Agalioti T, Delfs F, Worthmann A, Wahib R, Jagemann B, Mittrücker HW, Kretz O, Guse AH, Izbicki JR, Lassen KG, Strowig T, Schweizer M, Villablanca EJ, Elinav E, Huber S, Heeren J, Gagliani N.
In-Text Gene Mentions

…cell activation (Tnfsf4, Lat ,…

Show Full Abstract

Omnivorous animals, including mice and humans, tend to prefer energy-dense nutrients rich in fat over plant-based diets, especially for short periods of time, but the health consequences of this short-term consumption of energy-dense nutrients are unclear. Here, we show that short-term reiterative switching to 'feast diets', mimicking our social eating behavior, breaches the potential buffering effect of the intestinal microbiota and reorganizes the immunological architecture of mucosa-associated lymphoid tissues. The first dietary switch was sufficient to induce transient mucosal immune depression and suppress systemic immunity, leading to higher susceptibility to Salmonella enterica serovar Typhimurium and Listeria monocytogenes infections. The ability to respond to antigenic challenges with a model antigen was also impaired. These observations could be explained by a reduction of CD4<sup>+</sup> T cell metabolic fitness and cytokine production due to impaired mTOR activity in response to reduced microbial provision of fiber metabolites. Reintroducing dietary fiber rewired T cell metabolism and restored mucosal and systemic CD4<sup>+</sup> T cell functions and immunity. Finally, dietary intervention with human volunteers confirmed the effect of short-term dietary switches on human CD4<sup>+</sup> T cell functionality. Therefore, short-term nutritional changes cause a transient depression of mucosal and systemic immunity, creating a window of opportunity for pathogenic infection.

Also flagged:Acute myocardial infarctiondeathcoronary heart diseasevesiclesmyocardial infarctioncoronary artery disease
Journal Article 2023-08-14 No Snippets Liu Y, Wang M, Yu Y, Li C, Zhang C.
Show Full Abstract

Acute myocardial infarction has long been the leading cause of death in coronary heart disease, which is characterized by irreversible cardiomyocyte death and restricted blood supply. Conventional reperfusion therapy can further aggravate myocardial injury. Stem cell therapy, especially with mesenchymal stem cells (MSCs), has emerged as a promising approach to promote cardiac repair and improve cardiac function. MSCs may induce these effects by secreting exosomes containing therapeutically active RNA, proteins and lipids. Notably, normal cardiac function depends on intracardiac paracrine signaling via exosomes, and exosomes secreted by cardiac cells can partially reflect changes in the heart during disease, so analyzing these vesicles may provide valuable insights into the pathology of myocardial infarction as well as guide the development of new treatments. The present review examines how exosomes produced by MSCs and cardiac cells may influence injury after myocardial infarction and serve as therapies against such injury. Video Abstract.

Also flagged:dyslipidemialipidSORT1PSRC1CELSR2PCSK9
Journal Article 2023-08-14 No Snippets Kim MS, Song M, Kim B, Shim I, Kim DS, Natarajan P, Do R, Won HH.
Show Full Abstract

Drug targets with genetic support are several-fold more likely to succeed in clinical trials. We introduce a genetic-driven approach based on causal inferences that can inform drug target prioritization, repurposing, and adverse effects of using lipid-lowering agents. Given that a multi-trait approach increases the power to detect meaningful variants/genes, we conduct multi-omics and multi-trait analyses, followed by network connectivity investigations, and prioritize 30 potential therapeutic targets for dyslipidemia, including SORT1, PSRC1, CELSR2, PCSK9, HMGCR, APOB, GRN, HFE2, FJX1, C1QTNF1, and SLC5A8. 20% (6/30) of prioritized targets from our hypothesis-free drug target search are either approved or under investigation for dyslipidemia. The prioritized targets are 22-fold higher in likelihood of being approved or under investigation in clinical trials than genome-wide association study (GWAS)-curated targets. Our results demonstrate that the genetic-driven approach used in this study is a promising strategy for prioritizing targets while informing about the potential adverse effects and repurposing opportunities.

HFE
Also flagged:HypertensionFatty Liver Diseasenon-alcoholic fatty liver diseaseNAFLDobesitySteatosis
Journal Article 2023-08-14 ✓ 1 Snippet Chambergo-Michilot D, Rodrigo-Gallardo PK, Huaman MR, Vasquez-Chavesta AZ, Salinas-Sedo G, Toro-Huamanchumo CJ.
In-Text Gene Mentions

…liver diseases, hemosiderosis,hemochromatosis, chronic consumption of…

Show Full Abstract

<h4>Background</h4>Cardiovascular diseases are responsible for the majority of deaths resulting from non-alcoholic fatty liver disease (NAFLD). NAFLD is associated with hypertension and this is a key predictor of severe liver outcomes and an indicator of nonspecific portal fibrosis.<h4>Aim</h4>To assess the association between hypertension and NAFLD severity.<h4>Methods</h4>We conducted a secondary analysis of data from Peruvian adults with obesity and NAFLD who attended a Peruvian bariatric center. The severity of NAFLD was assessed using the Fatty Liver Inhibition of Progression algorithm / Steatosis, Activity and Fibrosis score. Hypertension was determined by either being recorded in the medical records or if the patient had a systolic pressure ≥ 140 mmHg or diastolic pressure ≥ 90 mmHg. To evaluate the association of interest, we calculated crude and adjusted prevalence ratios (aPR) using Poisson generalized linear models with logarithmic link function and robust variances. For the multivariable models, we adjusted for age, sex, physical activity and smoking.<h4>Results</h4>Our study included 234 participants. The prevalence of hypertension was 19.2%, while the prevalence of severe NAFLD was 46.2%. After adjusting for confounders, the prevalence of hypertension was found to be significantly higher in the severe NAFLD group compared to the non-severe group (aPR = 1.33; 95% CI: 1.03-1.74). When stratified by the presence of metabolic syndrome (MetS), the association remained significant only in the group without MetS (aPR = 1.80; 95% CI: 1.05-3.11).<h4>Conclusion</h4>We found an association between hypertension and severe NAFLD in adults with obesity, particularly in those without MetS.

HTT
Also flagged:neurodegenerative disordersprion diseaseagingchaperonesubiquitinproteasome
Journal Article 2023-08-14 ✓ 2 Snippets Grosfeld EV, Beizer AY, Dergalev AA, Agaphonov MO, Alexandrov AI.
In-Text Gene Mentions

…a polyproline stretch (Htt-polyPro-Q103-RFP) ( Figure 2…

…The colocalization withHtt-polyPro-Q103-RFP was partial,…

Show Full Abstract

Protein misfolding is a common feature of aging, various diseases and stresses. Recent work has revealed that misfolded proteins can be gathered into specific compartments, which can limit their deleterious effects. Chaperones play a central role in the formation of these misfolded protein deposits and can also be used to mark them. While studying chimeric yeast Hsp70 (Ssa1-GFP), we discovered that this protein was prone to the formation of large insoluble deposits during growth on non-fermentable carbon sources under mild heat stress. This was mitigated by the addition of antioxidants, suggesting that either Ssa1 itself or some other proteins were affected by oxidative damage. The protein deposits colocalized with a number of other chaperones, as well as model misfolded proteins, and could be disassembled by the Hsp104 chaperone. Notably, the wild-type protein, as well as a fusion protein of Ssa1 to the fluorescent protein Dendra2, were much less prone to forming similar foci, indicating that this phenomenon was related to the perturbation of Ssa1 function by fusion to GFP. This was also confirmed by monitoring Hsp104-GFP aggregates in the presence of known Ssa1 point mutants. Our data indicate that impaired Ssa1 function can favor the formation of large misfolded protein deposits under various conditions.

Also flagged:morphogenesisembryogenesispathogenesisangiogenesislipidwound healing
Journal Article 2023-08-14 No Snippets Cherkashina OL, Morgun EI, Rippa AL, Kosykh AV, Alekhnovich AV, Stoliarzh AB, Terskikh VV, Vorotelyak EA, Kalabusheva EP.
Show Full Abstract

Most of the knowledge about human skin homeostasis, development, wound healing, and diseases has been accumulated from human skin biopsy analysis by transferring from animal models and using different culture systems. Human-to-mouse xenografting is one of the fundamental approaches that allows the skin to be studied in vivo and evaluate the ongoing physiological processes in real time. Humanized animals permit the actual techniques for tracing cell fate, clonal analysis, genetic modifications, and drug discovery that could never be employed in humans. This review recapitulates the novel facts about mouse skin self-renewing, regeneration, and pathology, raises issues regarding the gaps in our understanding of the same options in human skin, and postulates the challenges for human skin xenografting.

SERPINC1
Also flagged:COVID-19Coagulopathycoronavirus infectionendotheliumdysfunctionobesity
Journal Article 2023-08-14 ✓ 5 Snippets Szilveszter M, Pál S, Simon-Szabó Z, Akácsos-Szász OZ, Moldován M, Réger B, Dénes L, Faust Z, Tilinca MC, Nemes-Nagy E.
In-Text Gene Mentions

…resistance, antithrombin III (ATIII) deficiency, low heparin…

…a deficiency ofATIII.…

…by binding toATIII, and the lack…

ATIIIdeficiency could occur…

…of heparin toATIII, causing a low…

Show Full Abstract

The course of COVID-19 is highly dependent on the associated cardiometabolic comorbidities of the patient, which worsen the prognosis of coronavirus infection, mainly due to systemic inflammation, endothelium dysfunction, and thrombosis. A search on the recent medical literature was performed in five languages, using the PubMed, Embase, Cochrane, and Google Scholar databases, for the review of data regarding the management of patients with a high risk for severe COVID-19, focusing on the associated coagulopathy. Special features of COVID-19 management are presented, based on the underlying conditions (obesity, diabetes mellitus, and cardiovascular diseases), emphasizing the necessity of a modern, holistic approach to thromboembolic states. The latest findings regarding the most efficient therapeutic approaches are included in the article, offering guidance for medical professionals in severe, complicated cases of SARS-CoV-2 infection. We can conclude that severe COVID-19 is closely related to vascular inflammation and intense cytokine release leading to hemostasis disorders. Overweight, hyperglycemia, cardiovascular diseases, and old age are important risk factors for severe outcomes of coronavirus infection, involving a hypercoagulable state. Early diagnosis and proper therapy in complicated SARS-CoV-2-infected cases could reduce mortality and the need for intensive care during hospitalization in patients with cardiometabolic comorbidities.

STAU1
Also flagged:post-synaptic density, PSD-95/disc large,bindingimmune responseE-proteinGFPamino
Journal Article 2023-08-14 ✓ 1 Snippet Ávila-Flores A, Sánchez-Cabezón JJ, Ochoa-Echeverría A, Checa AI, Rosas-García J, Téllez-Araiza M, Casado S, Liébana R, Santos-Mendoza T, Mérida I.
In-Text Gene Mentions

…(MOV10A, RAE1, andSTAU1).…

Show Full Abstract

Proteins containing PDZ (post-synaptic density, PSD-95/disc large, Dlg/zonula occludens, ZO-1) domains assemble signaling complexes that orchestrate cell responses. Viral pathogens target host PDZ proteins by coding proteins containing a PDZ-binding motif (PBM). The presence of a PBM in the SARS-CoV-2 E protein contributes to the virus's pathogenicity. SARS-CoV-2 infects epithelia, but also cells from the innate immune response, including monocytes and alveolar macrophages. This process is critical for alterations of the immune response that are related to the deaths caused by SARS-CoV-2. Identification of E-protein targets in immune cells might offer clues to understanding how SARS-CoV-2 alters the immune response. We analyzed the interactome of the SARS-CoV-2 E protein in human monocytes. The E protein was expressed fused to a GFP tag at the amino terminal in THP-1 monocytes, and associated proteins were identified using a proteomic approach. The E-protein interactome provided 372 partners; only 8 of these harbored PDZ domains, including the cell polarity protein ZO-2, the chemoattractant IL-16, and syntenin. We addressed the expression and localization of the identified PDZ proteins along the differentiation of primary and THP-1 monocytes towards macrophages and dendritic cells. Our data highlight the importance of identifying the functions of PDZ proteins in the maintenance of immune fitness and the viral alteration of inflammatory response.

HFE
Also flagged:acute-on-chronic liver failurecamrelizumabhepatocellular carcinomaliver failurecirrhosishepatitis B surface antigen
Journal Article 2023-08-14 ✓ 1 Snippet Li F, Wang T, Tang F, Liang J.
In-Text Gene Mentions

…atolenticular degeneration andhemochromatosis.…

Show Full Abstract

In the last few years, immune checkpoint inhibitors (ICIs) have become major therapeutic agents for the treatment of advanced hepatocellular carcinoma (HCC). However, immunotherapy can activate hepatitis B virus (HBV), and immune clearance may lead to liver failure and even life-threatening conditions. Here we report a case of HCC with HBV-related cirrhosis that caused severe liver injury and rapidly progressed to fatal acute-on-chronic liver failure (ACLF) after only once application of camrelizumab; the patient underwent serological conversion of hepatitis B surface antigen (HBsAg) with liver injury. The patient's condition progressed rapidly. We added corticosteroids and applied plasma dialysis, along with tenofovir alafenamide (TAF) to control HBV. However, the patient eventually died of liver failure. To our knowledge, there are few reports of HBsAg clearance due to ICIs accompanied by fatal acute-on-chronic liver failure shortly after ICIs initiation. These results suggest that ICIs can cause fatal liver injury in a short term; in patients with chronic HBV infection, ICIs use may promote serological conversion of HBsAg.

Also flagged:BRAFnon-small cell lung cancerLung cancercancerKRASEpidermal Growth Factor Receptor
Journal Article 2023-08-14 No Snippets Puri M, Gawri K, Dawar R.
Show Full Abstract

Lung cancer is the leading cause of cancer related deaths. Among the two broad types of lung cancer, non-small cell lung cancer accounts for 85% of the cases. The study of the genetic alteration has facilitated the development of targeted therapeutic interventions. Some of the molecular alterations which are important targets for drug therapy include Kirsten rat sarcoma (KRAS), Epidermal Growth Factor Receptor (EGFR), V-RAF murine sarcoma viral oncogene homolog B (BRAF), anaplastic lymphoma kinase gene (ALK). In the setting of extensive on-going clinical trials, it is imperative to periodically review the advancements and the newer drug therapies being available. Among all mutations, BRAF mutation is common with incidence being 8% overall and 1.5 - 4% in NSCLC. Here, we have summarized the BRAF mutation types and reviewed the various drug therapy available - for both V600 and nonV600 group; the mechanism of resistance to BRAF inhibitors and strategies to overcome it; the significance of comprehensive profiling of concurrent mutations, and the role of immune checkpoint inhibitor in BRAF mutated NSCLC. We have also included the currently ongoing clinical trials and recent advancements including combination therapy that would play a role in improving the overall survival and outcome of NSCLC.

Also flagged:extracellularvesiclessystemic diseasestumor necrosis factorTNFIL-10
Journal Article 2023-08-14 No Snippets Zhang W, Wang T, Xue Y, Zhan B, Lai Z, Huang W, Peng X, Zhou Y.
Show Full Abstract

There is growing evidence that mesenchymal stem cell-derived extracellular vesicles and exosomes can significantly improve the curative effect of oxidative stress-related diseases. Mesenchymal stem cell extracellular vesicles and exosomes (MSC-EVs and MSC-Exos) are rich in bioactive molecules and have many biological regulatory functions. In this review, we describe how MSC-EVs and MSC-Exos reduce the related markers of oxidative stress and inflammation in various systemic diseases, and the molecular mechanism of MSC-EVs and MSC-Exos in treating apoptosis and vascular injury induced by oxidative stress. The results of a large number of experimental studies have shown that both local and systemic administration can effectively inhibit the oxidative stress response in diseases and promote the survival and regeneration of damaged parenchymal cells. The mRNA and miRNAs in MSC-EVs and MSC-Exos are the most important bioactive molecules in disease treatment, which can inhibit the apoptosis, necrosis and oxidative stress of lung, heart, kidney, liver, bone, skin and other cells, and promote their survive and regenerate.

HFE
Also flagged:Hereditary Hemochromatosistransaminitisviral hepatitismetabolic liver diseasealcoholIron
Journal Article 2023-08-14 ✓ 5 Snippets Peesapati VSR, Varanasi P, Patel H, Akella SL.
In-Text Gene Mentions

…Subsequent diagnosis revealedhemochromatosis.…

…high iron gene (HFE) mutation is associated…

…is associated withhemochromatosis, fewer patients present…

…Many patients withhemochromatosis, however, do have…

…the suspicion ofhemochromatosis.…

Show Full Abstract

An annual physical examination within a primary care setting, including evaluation of liver enzymes and abnormal serology, is incidental and often asymptomatic. Fatty liver is the most common etiology for transaminitis. Hepatobiliary imaging studies, viral hepatitis serology, evaluation of metabolic liver disease, and alcohol consumption history should be performed for transaminitis evaluation. In patients with prior history of excessive alcohol consumption, transaminitis is often assumed to be alcohol-related. It is prudent to evaluate other infectious and metabolic etiologies, which can change patient management. Iron studies, including ferritin and transferrin saturation, are performed to evaluate hereditary hemochromatosis (HH). We present the case of a 46-year-old patient who visited the clinic for a routine health checkup, during which elevated ferritin levels were detected. Subsequent diagnosis revealed hemochromatosis. The patient underwent phlebotomy, resulting in a reduction of ferritin levels.

Also flagged:agingneurological diseasescircadian rhythmspro-inflammatory cytokinescircadian rhythmmetabolism
Journal Article 2023-08-14 No Snippets Wang Y, Du W, Hu X, Yu X, Guo C, Jin X, Wang W.
Show Full Abstract

The blood-brain barrier (BBB) impairment plays a crucial role in the pathological processes of aging-accompanied neurological diseases (AAND). Meanwhile, circadian rhythms disruption and gut microbiota dysbiosis are associated with increased morbidity of neurological diseases in the accelerated aging population. Importantly, circadian rhythms disruption and gut microbiota dysbiosis are also known to induce the generation of toxic metabolites and pro-inflammatory cytokines, resulting in disruption of BBB integrity. Collectively, this provides a new perspective for exploring the relationship among circadian rhythms, gut microbes, and the BBB in aging-accompanied neurological diseases. In this review, we focus on recent advances in the interplay between circadian rhythm disturbances and gut microbiota dysbiosis, and their potential roles in the BBB disruption that occurs in AAND. Based on existing literature, we discuss and propose potential mechanisms underlying BBB damage induced by dysregulated circadian rhythms and gut microbiota, which would serve as the basis for developing potential interventions to protect the BBB in the aging population through targeting the BBB by exploiting its links with gut microbiota and circadian rhythms for treating AAND.

Research Square 2023-08-14 Preprint (No Snippets API) Yang j, Liu J, Deng Y, Wang A, Liu B, Zhou X, Yin T, Wang Y, Tang T, Qiu Y, Chen J.
Show Full Abstract

<title>Abstract</title> <p>Maternal-fetal interface shares similarities with tumor tissues in terms of immune microenvironment. Normal pregnancy is maintained due to the immunosuppressed state, but pyroptosis induced by MITA can trigger the body's immune response and disrupt the immunosuppressed state of the maternal-fetal interface, leading to abortion. In this study, we explored the role of MITA and TRIM38 in regulating pyroptosis and maintaining the immune tolerance of the maternal-fetal interface during pregnancy. Our findings show that the interaction between MITA and TRIM38 plays a crucial role in maintaining the immunosuppressed state of the maternal-fetal interface. Specifically, we observed that TRIM38-mediated K48 ubiquitination of MITA was higher in M2 macrophages, leading to low expression levels of MITA and thus, inhibiting pyroptosis. Conversely, in M1 macrophages, the ubiquitination of K48 was lower, resulting in higher expression levels of MITA and promoting pyroptosis. Our results also indicated that pyroptosis played a significant role in hindering the transformation of M1 to M2 and maintaining the immunosuppressed state of the maternal-fetal interface. The discoveries presented offer significant understanding into the mechanisms that support the preservation of the immune tolerance microenvironment at the maternal-fetal interface, playing a vital role in ensuring successful pregnancy results.</p>

OLFM4
Also flagged:dermatomyositisinterferonCXCL10ISG15OAS1CLEC4A
Journal Article 2023-08-13 ✓ 1 Snippet Ward JM, Ambatipudi M, O'Hanlon TP, Smith MA, de Los Reyes M, Schiffenbauer A, Rahman S, Zerrouki K, Miller FW, Sanjuan MA, Li JL, Casey KA, Rider LG.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Objective</h4>Transcript and protein expression were interrogated to examine gene locus and pathway regulation in the peripheral blood of active adult dermatomyositis (DM) and juvenile DM patients receiving immunosuppressive therapies.<h4>Methods</h4>Expression data from 14 DM and 12 juvenile DM patients were compared to matched healthy controls. Regulatory effects at the transcript and protein level were analyzed by multi-enrichment analysis for assessment of affected pathways within DM and juvenile DM.<h4>Results</h4>Expression of 1,124 gene loci were significantly altered at the transcript or protein levels across DM or juvenile DM, with 70 genes shared. A subset of interferon-stimulated genes was elevated, including CXCL10, ISG15, OAS1, CLEC4A, and STAT1. Innate immune markers specific to neutrophil granules and neutrophil extracellular traps were up-regulated in both DM and juvenile DM, including BPI, CTSG, ELANE, LTF, MPO, and MMP8. Pathway analysis revealed up-regulation of PI3K/AKT, ERK, and p38 MAPK signaling, whose central components were broadly up-regulated in DM, while peripheral upstream and downstream components were differentially regulated in both DM and juvenile DM. Up-regulated components shared by DM and juvenile DM included cytokine:receptor pairs LGALS9:HAVCR2, LTF/NAMPT/S100A8/HSPA1A:TLR4, CSF2:CSF2RA, EPO:EPOR, FGF2/FGF8:FGFR, several Bcl-2 components, and numerous glycolytic enzymes. Pathways unique to DM included sirtuin signaling, aryl hydrocarbon receptor signaling, protein ubiquitination, and granzyme B signaling.<h4>Conclusion</h4>The combination of proteomics and transcript expression by multi-enrichment analysis broadened the identification of up- and down-regulated pathways among active DM and juvenile DM patients. These pathways, particularly those which feed into PI3K/AKT and MAPK signaling and neutrophil degranulation, may be potential therapeutic targets.

PRDX6
Also flagged:paclitaxelspermatogenesisembryo developmentHSPA2HSPA4Lgerm cell proliferation protein PCNA
Journal Article 2023-08-13 ✓ 4 Snippets Zhang Y, Liu Y, Teng Z, Wang Z, Zhu P, Wang Z, Liu F, Liu X.
In-Text Gene Mentions

…CAT, SOD1, andPRDX6was significantly decreased,…

…D221245; Peroxiredoxin 6 (PRDX6), D121159, BBI, Shanghai,…

…CAT, SOD1, andPRDX6using Western blotting…

…CAT, SOD1, andPRDX6expression was significantly…

Show Full Abstract

Chemotherapeutic drugs can cause reproductive damage by affecting sperm quality and other aspects of male fertility. Stem cells are thought to alleviate the damage caused by chemotherapy drugs and to play roles in reproductive protection and treatment. This study aimed to explore the effects of human umbilical cord mesenchymal stem cells (hUC-MSCs) on alleviating paclitaxel (PTX)-induced spermatogenesis and male fertility defects. An in vivo PTX-induced mice model was constructed to evaluate the reproductive toxicity and protective roles of hUC-MSCs in male fertility improvement. A 14 day PTX treatment regimen significantly attenuated mice spermatogenesis and sperm quality, including affecting spermatogenesis, reducing sperm counts, and decreasing sperm motility. hUC-MSCs treatment could significantly improve sperm functional indicators. Mating experiments with normal female mice and examination of embryo development at 7.5 days post-coitum (dpc) showed that hUC-MSCs restored male mouse fertility that was reduced by PTX. In IVF experiments, PTX impaired sperm fertility and blastocyst development, but hUC-MSCs treatment rescued these indicators. hUC-MSCs' protective role was also displayed through the increased expression of the fertility-related proteins HSPA2 and HSPA4L in testes with decreased expression in the PTX-treated group. These changes might be related to the PTX-induced decreases in expression of the germ cell proliferation protein PCNA and the meiosis proteins SYCP3, MLH1, and STRA8, which were restored after hUC-MSCs treatment. In the PTX-treated group, the expression of testicular antioxidant proteins SIRT1, NRF2, CAT, SOD1, and PRDX6 was significantly decreased, but hUC-MSCs could maintain these expressions and reverse PTX-related increases in BAX/BCL2 ratios. hUC-MSCs may be a promising agent with antioxidant and anti-apoptosis characteristics that can maintain sperm quality following chemotherapy treatment.

Also flagged:spiroterpenoidglucosidase
Journal Article 2023-08-13 No Snippets Dong PS, Phan HV, Sichaem J, Nguyen-Si HV, Tran TN, Hoang LT, Huynh TM, Le HTT, Mai DT, Ngo TL, Le TD, Nguyen VK.
Show Full Abstract

A new spiroterpenoid, namely tinctorin (<b>1</b>), along with one known compound, norreticulatin (<b>2</b>), were isolated from the lichen <i>Parmotrema tinctorum</i> (Despr. ex Nyl.) Hale. Their structures were elucidated by extensive spectroscopic analyses and electronic circular dichroism (ECD) calculations. The absolute configuration of <b>2</b> was established for the first time. Compound <b>1</b> was evaluated for its inhibitory activity against <i>α-</i>glucosidase and found to be inactive.

Also flagged:Co-infectionsBrucella ceti InfectionBrucella ceti infectionsB. ceti infectionsuppurative meningoencephalitismeningitis
Journal Article 2023-08-13 No Snippets Grattarola C, Petrella A, Lucifora G, Di Francesco G, Di Nocera F, Pintore A, Cocumelli C, Terracciano G, Battisti A, Di Renzo L, Farina D, Di Francesco CE, Crescio MI, Zoppi S, Dondo A, Iulini B, Varello K, Mignone W, Goria M, Mattioda V, Giorda F, Di Guardo G, Janowicz A, Tittarelli M, De Massis F, Casalone C, Garofolo G.
Show Full Abstract

<i>Brucella ceti</i> infections have been increasingly reported in cetaceans. In this study, we analyzed all cases of <i>B. ceti</i> infection detected in striped dolphins stranded along the Italian coastline between 2012 and 2021 (<i>N</i> = 24). We focused on the pathogenic role of <i>B. ceti</i> through detailed pathological studies, and ad hoc microbiological, biomolecular, and serological investigations, coupled with a comparative genomic analysis of the strains. Neurobrucellosis was observed in 20 animals. The primary histopathologic features included non-suppurative meningoencephalitis (<i>N</i> = 9), meningitis (<i>N</i> = 6), and meningoencephalomyelitis (<i>N</i> = 5), which was also associated with typical lesions in other tissues (<i>N</i> = 8). Co-infections were detected in more than half of the cases, mostly involving Cetacean Morbillivirus (CeMV). The 24 <i>B. ceti</i> isolates were assigned primarily to sequence type 26 (ST26) (<i>N</i> = 21) and, in a few cases, ST49 (<i>N</i> = 3). The multilocus sequence typing (cgMLST) based on whole genome sequencing (WGS) data showed that strains from Italy clustered into four genetically distinct clades. Plotting these clades onto a geographic map suggests a link between their phylogeny and the topographical distribution. These results support the role of <i>B. ceti</i> as a primary neurotropic pathogen for striped dolphins and highlight the utility of WGS data in understanding the evolution of this emerging pathogen.

Also flagged:Mitochondrial DiseasePMDsmitochondrialsubacute necrotizing encephalomyelopathyLeigh syndromePrimary mitochondrial diseases
Journal Article 2023-08-12 No Snippets McCormick EM, Keller K, Taylor JP, Coffey AJ, Shen L, Krotoski D, Harding B, NICHD ClinGen U24 Mitochondrial Disease Gene Curation Expert Panel, Gai X, Gai X, Falk MJ, Zolkipli-Cunningham Z, Rahman S.
Show Full Abstract

<h4>Objective</h4>Primary mitochondrial diseases (PMDs) are heterogeneous disorders caused by inherited mitochondrial dysfunction. Classically defined neuropathologically as subacute necrotizing encephalomyelopathy, Leigh syndrome spectrum (LSS) is the most frequent manifestation of PMD in children, but may also present in adults. A major challenge for accurate diagnosis of LSS in the genomic medicine era is establishing gene-disease relationships (GDRs) for this syndrome with >100 monogenic causes across both nuclear and mitochondrial genomes.<h4>Methods</h4>The Clinical Genome Resource (ClinGen) Mitochondrial Disease Gene Curation Expert Panel (GCEP), comprising 40 international PMD experts, met monthly for 4 years to review GDRs for LSS. The GCEP standardized gene curation for LSS by refining the phenotypic definition, modifying the ClinGen Gene-Disease Clinical Validity Curation Framework to improve interpretation for LSS, and establishing a scoring rubric for LSS.<h4>Results</h4>The GDR with LSS across the nuclear and mitochondrial genomes was classified as definitive for 31 of 114 GDRs curated (27%), moderate for 38 (33%), limited for 43 (38%), and disputed for 2 (2%). Ninety genes were associated with autosomal recessive inheritance, 16 were maternally inherited, 5 were autosomal dominant, and 3 were X-linked.<h4>Interpretation</h4>GDRs for LSS were established for genes across both nuclear and mitochondrial genomes. Establishing these GDRs will allow accurate variant interpretation, expedite genetic diagnosis of LSS, and facilitate precision medicine, multisystem organ surveillance, recurrence risk counseling, reproductive choice, natural history studies, and determination of eligibility for interventional clinical trials. ANN NEUROL 2023;94:696-712.

HFE
Also flagged:hepatic steatosischronic liver diseasealcohol abusechronic hepatitiscirrhosissteatosis
Journal Article 2023-08-12 ✓ 2 Snippets De Robertis R, Spoto F, Autelitano D, Guagenti D, Olivieri A, Zanutto P, Incarbone G, D'Onofrio M.
In-Text Gene Mentions

…chronic viral hepatitis,hemochromatosis, cirrhosis, or jaundice;…

…the following causes:hemochromatosis( N =…

Show Full Abstract

<h4>Purpose</h4>To compare ultrasound (US) and US-derived fat fraction (UDFF) with magnetic resonance proton density fat fraction (MRI-PDFF) for the detection of hepatic steatosis and quantification of liver fat content.<h4>Materials and methods</h4>Between October and December 2022, 149 patients scheduled for an abdominal MRI agreed to participate in this study and underwent MRI-PDFF, US and UDFF. Inclusion criteria were: (a) no chronic liver disease or jaundice; (b) no MRI motion artifacts; (c) adequate liver examination at US. Exclusion criteria were: (a) alcohol abuse, chronic hepatitis, cirrhosis, or jaundice; (b) MRI artifacts or insufficient US examination. The median of 10 MRI-PDFF and UDFF measurements in the right hepatic lobe was analyzed. UDFF and MRI-PDFF were compared by Bland-Altman difference plot and Pearson's test. Sensitivity, specificity, positive and negative predictive values, accuracy, and area under the receiver-operator curve (AUC-ROC) of US and UDFF were calculated using an MRI-PDFF cut-off value of 5%. p values ≤ 0.05 were statistically significant.<h4>Results</h4>122 patients were included (61 men, mean age 60 years, standard deviation 15 years). The median MRI-PDFF value was 4.1% (interquartile range 2.9-6); 37.7% patients had a median MRI-PDFF value ≥ 5%. UDFF and MRI-PDFF had high agreement (p = 0.11) and positive correlation (⍴ = 0.81, p < 0.001). UDFF had a higher diagnostic value than US for the detection of steatosis, with AUC-ROCs of 0.75 (95% CI 0.65, 0.84) and 0.53 (95% CI 0.42, 0.64), respectively.<h4>Conclusions</h4>UDFF reliably quantifies liver fat content and improves the diagnostic value of US for the detection of hepatic steatosis.

SERPINC1
Also flagged:watercoagulopathyheparincoagulation factorsXIthrombin
Journal Article 2023-08-12 ✓ 5 Snippets Xu T, Ji H, Xu L, Cheng S, Liu X, Li Y, Zhong R, Zhao W, Kizhakkedathu JN, Zhao C.
In-Text Gene Mentions

…to antithrombin III (ATIII) 16 , and…

…of sponge onATIIIand HCII…

…ForATIII, 10 mg MS@D-HMP…

…with 100 μLATIII-deficient plasma (BioMedica D…

…added into theATIII-deficient plasma at a…

Show Full Abstract

Clinical use of intraoperative auto-transfusion requires the removal of platelets and plasma proteins due to pump-based suction and water-soluble anticoagulant administration, which causes dilutional coagulopathy. Herein, we develop a carboxylated and sulfonated heparin-mimetic polymer-modified sponge with spontaneous blood adsorption and instantaneous anticoagulation. We find that intrinsic coagulation factors, especially XI, are inactivated by adsorption to the sponge surface, while inactivation of thrombin in the sponge-treated plasma effectively inhibits the common coagulation pathway. We show whole blood auto-transfusion in trauma-induced hemorrhage, benefiting from the multiple inhibitory effects of the sponge on coagulation enzymes and calcium depletion. We demonstrate that the transfusion of collected blood favors faster recovery of hemostasis compared to traditional heparinized blood in a rabbit model. Our work not only develops a safe and convenient approach for whole blood auto-transfusion, but also provides the mechanism of action of self-anticoagulant heparin-mimetic polymer-modified surfaces.

ZNFX1
Also flagged:FGFR1FGFR2Glioblastomabrain cancertumorstumor
Journal Article 2023-08-12 ✓ 2 Snippets Alshahrany N, Begum A, Siebzehnrubl D, Jimenez-Pascual A, Siebzehnrubl FA.
In-Text Gene Mentions

…YARS1, YBX3, ZNF81,ZNFX1) showing significant changes…

…CDC5L, FLNB, SUCLG2,ZNFX1) are predicted ZEB1…

Show Full Abstract

Glioblastoma is the most lethal brain cancer in adults. These incurable tumors are characterized by profound heterogeneity, therapy resistance, and diffuse infiltration. These traits have been linked to cancer stem cells, which are important for glioblastoma tumor progression and recurrence. The fibroblast growth factor receptor 1 (FGFR1) signaling pathway is a known regulator of therapy resistance and cancer stemness in glioblastoma. FGFR1 expression shows intertumoral heterogeneity and higher FGFR1 expression is associated with a significantly poorer survival in glioblastoma patients. The role of FGFR1 in tumor invasion has been studied in many cancers, but whether and how FGFR1 mediates glioblastoma invasion remains to be determined. Here, we investigated the distribution and functional relevance of FGFR1 and FGFR2 in human glioblastoma xenograft models. We found FGFR1, but not FGFR2, expressed in invasive glioblastoma cells. Loss of FGFR1, but not FGFR2, significantly reduced cell migration in vitro and tumor invasion in human glioblastoma xenografts. Comparative analysis of RNA-sequencing data of FGFR1 and FGFR2 knockdown glioblastoma cells revealed a FGFR1-specific gene regulatory network associated with tumor invasion. Our study reveals new gene candidates linked to FGFR1-mediated glioblastoma invasion.

HTT
Also flagged:SerotoninbehavioralFear conditioning5-hydroxytryptamine5-HT receptors5-HT
Journal Article 2023-08-12 ✓ 5 Snippets Tortora F, Hadipour AL, Battaglia S, Falzone A, Avenanti A, Vicario CM.
In-Text Gene Mentions

Glotzbach-Schoon et al. [141] investigated the influence of 5-HTT polymorphism and the neuropeptide S (NPS), which has been reported to affect arousal, fear, and anxiety responses, on potential vulnerability to anxiety disorders.

…the 5-HT transporter (5-HTT) and their interaction…

…the impact of5-HTTand monoamine oxidase…

…protein activities and5-HTTgenotypes.…

…alleles of the5-HTT-linked promoter region (5-HTT…

Show Full Abstract

Fear is characterized by distinct behavioral and physiological responses that are essential for the survival of the human species. Fear conditioning (FC) serves as a valuable model for studying the acquisition, extinction, and expression of fear. The serotonin (5-hydroxytryptamine, 5-HT) system is known to play a significant role in emotional and motivational aspects of human behavior, including fear learning and expression. Accumulating evidence from both animal and human studies suggests that brain regions involved in FC, such as the amygdala, hippocampus, and prefrontal cortex, possess a high density of 5-HT receptors, implicating the crucial involvement of serotonin in aversive learning. Additionally, studies exploring serotonin gene polymorphisms have indicated their potential influence on FC. Therefore, the objective of this work was to review the existing evidence linking 5-HT with fear learning and memory in humans. Through a comprehensive screening of the PubMed and Web of Science databases, 29 relevant studies were included in the final review. These studies investigated the relationship between serotonin and fear learning using drug manipulations or by studying 5-HT-related gene polymorphisms. The results suggest that elevated levels of 5-HT enhance aversive learning, indicating that the modulation of serotonin 5-HT2A receptors regulates the expression of fear responses in humans. Understanding the role of this neurochemical messenger in associative aversive learning can provide insights into psychiatric disorders such as anxiety and post-traumatic stress disorder (PTSD), among others.

HFE
Also flagged:Non-Alcoholic SteatohepatitisNASHnon-alcoholic fatty liversphingolipidsceramidesfatty acids
Journal Article 2023-08-12 ✓ 1 Snippet Kalopitas G, Mouskeftara T, Liapikos T, Arvanitakis K, Ioannidis A, Malandris K, Theocharidou E, Chourdakis M, Sinakos E, Gika H, Germanidis G.
In-Text Gene Mentions

…diseases, Wilson’s disease,hemochromatosis, a-1-antitrypsin deficiency, …

Show Full Abstract

Patients with non-alcoholic steatohepatitis (NASH) show significantly faster progress in the stages of fibrosis compared to those with non-alcoholic fatty liver (NAFL) disease. The non-invasive diagnosis of NASH remains an unmet clinical need. Preliminary data have shown that sphingolipids, especially ceramides, fatty acids, and other lipid classes may be related to the presence of NASH and the histological activity of the disease. The aim of our study was to assess the association of certain plasma lipid classes, such as fatty acids, acylcarnitines, and ceramides, with the histopathological findings in patients with NASH. The study included three groups: patients with NASH (N = 12), NAFL (N = 10), and healthy [non non-alcoholic fatty liver disease (NAFLD)] controls (N = 15). Plasma samples were collected after 12 h of fasting, and targeted analyses for fatty acids, acylcarnitines, and ceramides were performed. Baseline clinical and demographic characteristics were collected. There was no significant difference in baseline characteristics across the three groups or between NAFL and NASH patients. Patients with NASH had increased levels of several fatty acids, including, among others, fatty acid (FA) 14:0, FA 15:0, FA 18:0, FA 18:3n3, as well as Cer(d18:1/16:0), compared to NAFL patients and healthy controls. No significant difference was found between NAFL patients and healthy controls. In conclusion, patients with NASH exhibited a distinctive plasma lipid profile that can differentiate them from NAFL patients and non-NAFLD populations. More data from larger cohorts are needed to validate these findings and examine possible implications for diagnostic and management strategies of the disease.

Also flagged:sleepinsomniadepressionanxietyinsomnia disorderasleep
Journal Article 2023-08-12 No Snippets Türkarslan KK, Canel Çınarbaş D, Nicassio PM.
Show Full Abstract

<h4>Purpose</h4>The aim of the present study was to examine the psychometric properties of the Turkish version of the Pre-sleep Arousal Scale (PSAS), which measures pre-sleep arousal, a significant predictor of insomnia symptoms.<h4>Methods</h4>651 participants were recruited via social media and the Internet. Confirmatory factor analysis was conducted in the total sample (65.28% females; <i>M</i><sub>age1</sub> = 28.09 ± 14.00). Convergent, divergent, incremental, and known-groups validity and internal consistency coefficients were assessed in a subsample of 556 participants (62.77% females; <i>M</i><sub>age2</sub> = 29.25 ± 14.81). A second separate sample of 88 participants (80.68% females; <i>M</i><sub>age3</sub> = 22.19 ± 4.98) was used to evaluate three-week test-retest reliability.<h4>Results</h4>The results of factor analysis confirmed the two-factor structure of the Turkish PSAS with cognitive (PSAS-C) and somatic (PSAS-S), similar to the original scale. The correlations of the PSAS with convergent and divergent measures showed that the Turkish form had good convergent and acceptable divergent validity. PSAS-C and PSAS-S were able to explain an 18% additional variance in insomnia severity beyond depression and anxiety, an 18% additional variance in depression beyond insomnia severity, and a 35% additional variance in anxiety beyond insomnia severity. Moreover, insomnia patients had significantly higher PSAS-C and PSAS-S scores than good sleepers. Finally, the PSAS, PSAS-C, and PSAS-S had satisfactory internal consistency coefficients (α = 0.92, 0.91, and 0.86, respectively) and three-week test-retest correlations (ICC = 0.82, 0.82, and 0.71, respectively).<h4>Conclusion</h4>The Turkish form of the PSAS was a valid and reliable measure of pre-sleep arousal and can be utilized in sleep studies.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s41105-023-00483-z.

TRIM38
Also flagged:non-small cell lung cancerNSCLCAMPKNF-κBNLRP3tripartite motif protein 38
Journal Article 2023-08-11 ✓ 5 Snippets Zhang K, Lin G, Nie Z, Jin S, Bing X, Li Z, Li M.
In-Text Gene Mentions

The inhibitory effects of TRIM38 overexpression on migration, proliferation, invasion, and EMT of NSCLC cells were reversed by overexpression of NLRP3.

Tumor lung tissues of mice and NSCLC cells showed low protein and mRNA expression of TRIM38.

TRIM38 regulated the AMPK/NF-κB/NLRP3 pathway to suppress the NSCLC's progression and development.

With respect to the mechanism, in vivo experiments, the inhibitory effects of TRIM38 overexpression on tumor nodules, and EMT were reversed by AMPK inhibitor.

Concurrently, AMPK inhibitor enhanced the TRIM38-overexpressed NSCLC cell's abilities in migration, clone formation, invasion, and proliferation.

Show Full Abstract

Accumulating data have revealed the pivotal function of tripartite motif protein 38 (TRIM38) in tumors. In view of this, this investigation aims to explore the function and potential mechanism of TRIM38 in non-small cell lung cancer (NSCLC). A xenotypic tumor model was established in vivo by subcutaneously injecting NSCLC cells (2 × 10<sup>6</sup> cells) in tail vein of each mouse. Relative expression of TRIM38 mRNA was detected via quantitative real-time polymerase chain reaction (qRT-PCR). For exploring the role of TRIM38 in vivo and in vitro, mice or NSCLC cells were divided into two groups: the vector group and the TRIM38 overexpression group. Also, protein expression levels of TRIM38, Vimentin, E-cadherin, and N-cadherin were determined using western blotting and immunohistochemistry staining. Tumor nodules of mouse lung tissues were assessed via performing H&E staining. Moreover, proliferation of NSCLC cells was evaluated through colony formation and CCK-8 assays. Further, migration and invasion of NSCLC cells were assessed through wound healing and transwell assays. Protein levels of pathway-related proteins including p-p65, p65, IκB, p-IκB, p-AMPK, AMPK, and NLRP3 were examined through western blotting analysis. Tumor lung tissues of mice and NSCLC cells showed low protein and mRNA expression of TRIM38. Functionally, up-regulation of TRIM38 reduced the number of tumor nodules and suppressed epithelial-to-mesenchymal transition (EMT) in lung tissues of mice. Furthermore, up-regulation of TRIM38 in NSCLC cells inhibited migration, invasion, EMT, and proliferation. With respect to the mechanism, in vivo experiments, the inhibitory effects of TRIM38 overexpression on tumor nodules, and EMT were reversed by AMPK inhibitor. In vitro experiments, TRIM38 overexpression caused down-regulation of p-IκB and p-p65 as well as up-regulation of p-AMPK. The inhibitory effects of TRIM38 overexpression on migration, proliferation, invasion, and EMT of NSCLC cells were reversed by overexpression of NLRP3. Concurrently, AMPK inhibitor enhanced the TRIM38-overexpressed NSCLC cell's abilities in migration, clone formation, invasion, and proliferation. TRIM38 regulated the AMPK/NF-κB/NLRP3 pathway to suppress the NSCLC's progression and development.

MRPL39
Also flagged:methylationribosomecell cyclepeptideamidebiosynthesis
Journal Article 2023-08-11 ✓ 1 Snippet Eldem V, Zararsız G, Erkan M.
In-Text Gene Mentions

…genes such asmrpl39(mitochondrial ribosomal prote…

Show Full Abstract

European anchovy is a multiple-spawning and highly fecundate pelagic fish with high economic and ecological significance. Although fecundity is influenced by nutrition, temperature and weight of spawners, high reproductive capacity is related to molecular processes in the ovary. The ovary is an essential and complex reproductive organ composed of various somatic and germ cells, which interact to facilitate the development of the ovary and functional oocytes. Revealing the ovarian transcriptome profile of highly fecundate fishes provides insights into oocyte production in teleosts. Here we use a comprehensive tissue-specific RNA sequencing which yielded 102.3 billion clean bases to analyze the transcriptional profiles of the ovary compared with other organs (liver, kidney, ovary, testis, fin, cauda and gill) and juvenile tissues of European anchovy. We conducted a comparative transcriptome and positive selection analysis of seven teleost species with varying fecundity rates to identify genes potentially involved in oogenesis and oocyte development. Of the 2,272 single copies of orthologous genes found, up to 535 genes were under positive selection in European anchovy and these genes are associated with a wide spectrum of cellular and molecular functions, with enrichments such as RNA methylation and modification, ribosome biogenesis, DNA repair, cell cycle processing and peptide/amide biosynthesis. Of the 535 positively selected genes, 55 were upregulated, and 45 were downregulated in the ovary, most of which were related to RNA and DNA transferase, developmental transcription factors, protein kinases and replication factors. Overall, our analysis of the transcriptome level in the ovarian tissue of a teleost will provide further insights into molecular processes and deepen our genetic understanding of egg production in highly fecund fish.

HTT
Also flagged:cancersnucleotidenucleotidesFMR1fragile X syndrometumor
Journal Article 2023-08-11 ✓ 1 Snippet Wang N, Khan S, Elo LL.
In-Text Gene Mentions

For examples, the expansion of a CAG trinucleotide repeat in the HTT gene can causes Huntington’s disease, and an increased copy number of a CGG trinucleotide repeat in the FMR1 gene can causes fragile X syndrome [14–16].

Show Full Abstract

The sequence contexts of genomic variants play important roles in understanding biological significances of variants and potential sequencing related variant calling issues. However, methods for assessing the diverse sequence contexts of genomic variants such as tandem repeats and unambiguous annotations have been limited. Herein, we describe the Variant Sequence Context Annotation Tool (VarSCAT) for annotating the sequence contexts of genomic variants, including breakpoint ambiguities, flanking bases of variants, wildtype/mutated DNA sequences, variant nomenclatures, distances between adjacent variants, tandem repeat regions, and custom annotation with user customizable options. Our analyses demonstrate that VarSCAT is more versatile and customizable than the currently available methods or strategies for annotating variants in short tandem repeat (STR) regions or insertions and deletions (indels) with breakpoint ambiguity. Variant sequence context annotations of high-confidence human variant sets with VarSCAT revealed that more than 75% of all human individual germline and clinically relevant indels have breakpoint ambiguities. Moreover, we illustrate that more than 80% of human individual germline small variants in STR regions are indels and that the sizes of these indels correlated with STR motif sizes. VarSCAT is available from https://github.com/elolab/VarSCAT.

LRRC7UNC13CDCCPTGIS
Also flagged:visionnucleusoptic neuritisONretinitis pigmentosaage-related macular degeneration
Journal Article 2023-08-11 ✓ 4 Snippets Monavarfeshani A, Yan W, Pappas C, Odenigbo KA, He Z, Segrè AV, van Zyl T, Hageman GS, Sanes JR.
In-Text Gene Mentions
⭐ same-sentence co-mention

…in C0, andLRRC7and DCC, enriched…

⭐ same-sentence co-mention

…and LRRC7 andDCC, enriched in C2…

…by C31; andPTGISand COL12A1 by…

…multiple genes includingUNC13C, RGS6 , and…

Show Full Abstract

Although the visual system extends through the brain, most vision loss originates from defects in the eye. Its central element is the neural retina, which senses light, processes visual signals, and transmits them to the rest of the brain through the optic nerve (ON). Surrounding the retina are numerous other structures, conventionally divided into anterior and posterior segments. Here, we used high-throughput single-nucleus RNA sequencing (snRNA-seq) to classify and characterize cells in six extraretinal components of the posterior segment: ON, optic nerve head (ONH), peripheral sclera, peripapillary sclera (PPS), choroid, and retinal pigment epithelium (RPE). Defects in each of these tissues are associated with blinding diseases-for example, glaucoma (ONH and PPS), optic neuritis (ON), retinitis pigmentosa (RPE), and age-related macular degeneration (RPE and choroid). From ~151,000 single nuclei, we identified 37 transcriptomically distinct cell types, including multiple types of astrocytes, oligodendrocytes, fibroblasts, and vascular endothelial cells. Our analyses revealed a differential distribution of many cell types among distinct structures. Together with our previous analyses of the anterior segment and retina, the data presented here complete a "Version 1" cell atlas of the human eye. We used this atlas to map the expression of >180 genes associated with the risk of developing glaucoma, which is known to involve ocular tissues in both anterior and posterior segments as well as the neural retina. Similar methods can be used to investigate numerous additional ocular diseases, many of which are currently untreatable.

FBXL4
Also flagged:mitophagyBNIP3BNIP3LmitochondrialMitochondriaorganelles
Journal Article 2023-08-11 ✓ 5 Snippets Chen Y, Jiao D, Liu Y, Xu X, Wang Y, Luo X, Saiyin H, Li Y, Gao K, Chen Y, Zhao SM, Ma L, Wang C.
In-Text Gene Mentions

FBXL4 mutations cause excessive mitophagy via BNIP3/BNIP3L accumulation leading to mitochondrial DNA depletion syndrome.

Mutations in FBXL4, a substrate-binding adaptor of Cullin 1-RING ubiquitin ligase complex (CRL1), are associated with MTDPS, type 13 (MTDPS13).

FBXL4mutations cause excessive…

…Mutations inFBXL4, a substrate-binding adaptor…

…we demonstrate that,FBXL4directly interacts with…

Show Full Abstract

Mitochondria are essential organelles found in eukaryotic cells that play a crucial role in ATP production through oxidative phosphorylation (OXPHOS). Mitochondrial DNA depletion syndrome (MTDPS) is a group of genetic disorders characterized by the reduction of mtDNA copy number, leading to deficiencies in OXPHOS and mitochondrial functions. Mutations in FBXL4, a substrate-binding adaptor of Cullin 1-RING ubiquitin ligase complex (CRL1), are associated with MTDPS, type 13 (MTDPS13). Here, we demonstrate that, FBXL4 directly interacts with the mitophagy cargo receptors BNIP3 and BNIP3L, promoting their degradation through the ubiquitin-proteasome pathway via the assembly of an active CRL1<sup>FBXL4</sup> complex. However, MTDPS13-associated FBXL4 mutations impair the assembly of an active CRL1<sup>FBXL4</sup> complex. This results in a notable accumulation of BNIP3/3L proteins and robust mitophagy even at basal levels. Excessive mitophagy was observed in Knockin (KI) mice carrying a patient-derived FBXL4 mutation and cortical neurons (CNs)-induced from MTDPS13 patient human induced pluripotent stem cells (hiPSCs). In summary, our findings suggest that abnormal activation of BNIP3/BNIP3L-dependent mitophagy impairs mitochondrial homeostasis and underlies FBXL4-mutated MTDPS13.

HFE
Also flagged:agingmenopauseosteoporosissystemic skeletal diseasecalciumvitamin D
Journal Article 2023-08-11 ✓ 1 Snippet Malekmirzaei E, Farshbaf-Khalili A, Pakpour V.
In-Text Gene Mentions

…ases (hemophilia, thalassemia,hemochromatosis), endocrine diseases (Cushing…

Show Full Abstract

<h4>Background</h4>Osteoporosis is a common complication of aging and menopause. Self-care and health literacy are among the factors affecting health status. The purpose of this research was to determine the preventive roles of self-care behaviors and health literacy in older women with osteoporosis.<h4>Methods</h4>This cross‑sectional analytical research was conducted on 250 postmenopausal women consisting of 125 osteoporotic and 125 healthy people aged 60-70. They were selected by purposive sampling in Tabriz Sina Hospital from September 2021 to December 2021. Data collection instruments were a demographic questionnaire, a Menopausal Self‑Care Questionnaire, and a European Health Literacy Survey Questionnaire. Data were analyzed using SPSS 23 software.<h4>Results</h4>The mean (SD) total score of self-care in healthy women was 118.97 (19.92) and in women with osteoporosis was 84.7 (14.98) (p < 0.001). Also, healthy women all had sufficient health literacy (100%), but 52.8% of women with osteoporosis had insufficient health literacy. The odds of osteoporosis decreased significantly with the rise in the total score of self-care behaviors [Odds ratio 95% confidence interval (95% CI); p: 0.909 (0.880 to 0.939); p < 0.001] and its subdomains as well as with increasing health literacy level [OR (95% CI); p: 0.322 (0.266 to 0.383); p < 0.001]. There was a significant positive correlation between self-care behaviors and health literacy (r = 0.616, p < 0.001).<h4>Conclusions</h4>Self-care in aged women is particularly important in reducing the risk of osteoporosis, and empowering women in the field of health literacy is an important factor in improving self-care behaviors and ultimately the health of these people.

OLFM4
Also flagged:gastrointestinal syndromelethal gastrointestinal syndromesepsisdeathIRcell proliferation
Journal Article 2023-08-11 ✓ 1 Snippet Dushime H, Moreno SG, Linard C, Adrait A, Couté Y, Peltzer J, Messiaen S, Torres C, Bensemmane L, Lewandowski D, Romeo PH, Petit V, Gault N.
In-Text Gene Mentions

…stem cells (Lgr5,Olfm4, Ascl2) and Paneth…

Show Full Abstract

<h4>Background</h4>Human multilineage-differentiating stress enduring (Muse) cells are nontumorigenic endogenous pluripotent-like stem cells that can be easily obtained from various adult or fetal tissues. Regenerative effects of Muse cells have been shown in some disease models. Muse cells specifically home in damaged tissues where they exert pleiotropic effects. Exposition of the small intestine to high doses of irradiation (IR) delivered after radiotherapy or nuclear accident results in a lethal gastrointestinal syndrome (GIS) characterized by acute loss of intestinal stem cells, impaired epithelial regeneration and subsequent loss of the mucosal barrier resulting in sepsis and death. To date, there is no effective medical treatment for GIS. Here, we investigate whether Muse cells can prevent lethal GIS and study how they act on intestinal stem cell microenvironment to promote intestinal regeneration.<h4>Methods</h4>Human Muse cells from Wharton's jelly matrix of umbilical cord (WJ-Muse) were sorted by flow cytometry using the SSEA-3 marker, characterized and compared to bone-marrow derived Muse cells (BM-Muse). Under gas anesthesia, GIS mice were treated or not through an intravenous retro-orbital injection of 50,000 WJ-Muse, freshly isolated or cryopreserved, shortly after an 18 Gy-abdominal IR. No immunosuppressant was delivered to the mice. Mice were euthanized either 24 h post-IR to assess early small intestine tissue response, or 7 days post-IR to assess any regenerative response. Mouse survival, histological stainings, apoptosis and cell proliferation were studied and measurement of cytokines, recruitment of immune cells and barrier functional assay were performed.<h4>Results</h4>Injection of WJ-Muse shortly after abdominal IR highly improved mouse survival as a result of a rapid regeneration of intestinal epithelium with the rescue of the impaired epithelial barrier. In small intestine of Muse-treated mice, an early enhanced secretion of IL-6 and MCP-1 cytokines was observed associated with (1) recruitment of monocytes/M2-like macrophages and (2) proliferation of Paneth cells through activation of the IL-6/Stat3 pathway.<h4>Conclusion</h4>Our findings indicate that a single injection of a small quantity of WJ-Muse may be a new and easy therapeutic strategy for treating lethal GIS.

HTT
Also flagged:Biliary atresiaciliogenesisAFAP1TUSC3BAtube formation
Journal Article 2023-08-11 ✓ 1 Snippet Glessner JT, Ningappa MB, Ngo KA, Zahid M, So J, Higgs BW, Sleiman PMA, Narayanan T, Ranganathan S, March M, Prasadan K, Vaccaro C, Reyes-Mugica M, Velazquez J, Salgado CM, Ebrahimkhani MR, Schmitt L, Rajasundaram D, Paul M, Pellegrino R, Gittes GK, Li D, Wang X, Billings J, Squires R, Ashokkumar C, Sharif K, Kelly D, Dhawan A, Horslen S, Lo CW, Shin D, Subramaniam S, Hakonarson H, Sindhi R.
In-Text Gene Mentions

…with ≥2 wereHTT, PLEC, DYSF, CC2D2A…

Show Full Abstract

<h4>Background & aims</h4>Biliary atresia (BA) is poorly understood and leads to liver transplantation (LT), with the requirement for and associated risks of lifelong immunosuppression, in most children. We performed a genome-wide association study (GWAS) to determine the genetic basis of BA.<h4>Methods</h4>We performed a GWAS in 811 European BA cases treated with LT in US, Canadian and UK centers, and 4,654 genetically matched controls. Whole-genome sequencing of 100 cases evaluated synthetic association with rare variants. Functional studies included whole liver transcriptome analysis of 64 BA cases and perturbations in experimental models.<h4>Results</h4>A GWAS of common single nucleotide polymorphisms (SNPs), i.e. allele frequencies >1%, identified intronic SNPs rs6446628 in AFAP1 with genome-wide significance (p = 3.93E-8) and rs34599046 in TUSC3 at sub-threshold genome-wide significance (p = 1.34E-7), both supported by credible peaks of neighboring SNPs. Like other previously reported BA-associated genes, AFAP1 and TUSC3 are ciliogenesis and planar polarity effectors (CPLANE). In gene-set-based GWAS, BA was associated with 6,005 SNPs in 102 CPLANE genes (p = 5.84E-15). Compared with non-CPLANE genes, more CPLANE genes harbored rare variants (allele frequency <1%) that were assigned Human Phenotype Ontology terms related to hepatobiliary anomalies by predictive algorithms, 87% vs. 40%, p <0.0001. Rare variants were present in multiple genes distinct from those with BA-associated common variants in most BA cases. AFAP1 and TUSC3 knockdown blocked ciliogenesis in mouse tracheal cells. Inhibition of ciliogenesis caused biliary dysgenesis in zebrafish. AFAP1 and TUSC3 were expressed in fetal liver organoids, as well as fetal and BA livers, but not in normal or disease-control livers. Integrative analysis of BA-associated variants and liver transcripts revealed abnormal vasculogenesis and epithelial tube formation, explaining portal vein anomalies that co-exist with BA.<h4>Conclusions</h4>BA is associated with polygenic susceptibility in CPLANE genes. Rare variants contribute to polygenic risk in vulnerable pathways via unique genes.<h4>Impact and implications</h4>Liver transplantation is needed to cure most children born with biliary atresia, a poorly understood rare disease. Transplant immunosuppression increases the likelihood of life-threatening infections and cancers. To improve care by preventing this disease and its progression to transplantation, we examined its genetic basis. We find that this disease is associated with both common and rare mutations in highly specialized genes which maintain normal communication and movement of cells, and their organization into bile ducts and blood vessels during early development of the human embryo. Because defects in these genes also cause other birth defects, our findings could lead to preventive strategies to lower the incidence of biliary atresia and potentially other birth defects.

OLFM4
Also flagged:NLRX1mitochondrialNLRNod-like receptorantiviraloxygen
Journal Article 2023-08-11 ✓ 1 Snippet Bi PY, Killackey SA, Schweizer L, Girardin SE.
In-Text Gene Mentions

Furthermore, following stimulation with TNF, intestinal organoid developed from Nlrx1ΔIEC mice displayed elevated expression levels of transcription factor Myb and transit-amplifying (TA) zone stem cell marker Olfm4, which have been linked to the development of cancer [68].

Show Full Abstract

NLRX1 is a member of the of the Nod-like receptor (NLR) family, and it represents a unique pattern recognition molecule (PRM) as it localizes to the mitochondrial matrix in resting conditions. Over the past fifteen years, NLRX1 has been proposed to regulate multiple cellular processes, including antiviral immunity, apoptosis, reactive oxygen species (ROS) generation and mitochondrial metabolism. Similarly, in vivo models have shown that NLRX1 was associated with the control of a number of diseases, including multiple sclerosis, colorectal cancer and ischemia-reperfusion injury. This apparent versatility in function hinted that a common and general overarching role for NLRX1 may exist. Recent evidence has suggested that NLRX1 controls mitophagy through the detection of a specific "danger signal", namely the defective import of proteins into mitochondria, or mitochondrial protein import stress (MPIS). In this review article, we propose that mitophagy regulation may represent the overarching process detected by NLRX1, which could in turn impact on a number of diseases if dysfunctional.

DNAH10
Also flagged:Infertilitymale infertilityAsthenoteratospermiamitochondrialmitochondriaaxoneme
Journal Article 2023-08-11 ✓ 2 Snippets Shao ZM, Zhu YT, Gu M, Guo SC, Yu H, Li KK, Tang DD, Xu YP, Lv MR.
In-Text Gene Mentions

…chain 10 [DNAH10], 14 dynein…

…), 32 andDNAH10.…

Show Full Abstract

Variations in the dynein axonemal heavy chain gene, dynein axonemal heavy chain 6 ( DNAH6 ), lead to multiple morphological abnormalities of the flagella. Recent studies have reported that these deficiencies may result in sperm head deformation. However, whether DNAH6 is also involved in human acrosome biogenesis remains unknown. The purpose of this study was to investigate DNAH6 gene variants and their potential functions in the formation of defective sperm heads and flagella. Whole-exome sequencing was performed on a cohort of 375 patients with asthenoteratozoospermia from the First Affiliated Hospital of Anhui Medical University (Hefei, China). Hematoxylin and eosin staining, scanning electron microscopy, and transmission electron microscopy were performed to analyze the sperm morphology and ultrastructure. Immunofluorescence staining and Western blot analysis were conducted to examine the effects of genetic variants. We identified three novel deleterious variants in DNAH6 among three unrelated families. The absence of inner dynein arms and radial spokes was observed in the sperm of patients with DNAH6 variants. Additionally, deficiencies in the acrosome, abnormal chromatin compaction, and vacuole-containing sperm heads were observed in these patients with DNAH6 variants. The decreased levels of the component proteins in these defective structures were further confirmed in sperm from patients with DNAH6 variants using Western blot. After intracytoplasmic sperm injection (ICSI) treatment, the partner of one patient with a DNAH6 variant achieved successful pregnancy. Overall, novel variants in DNAH6 genes that contribute to defects in the sperm head and flagella were identified, and the findings indicated ICSI as an effective clinical treatment for such patients.

Also flagged:MitochondrialMetabolismcancerorganellessynthesismitochondria
Journal Article 2023-08-11 No Snippets Behnam B, Taghizadeh-Hesary F.
Show Full Abstract

Energy is needed by cancer cells to stay alive and communicate with their surroundings. The primary organelles for cellular metabolism and energy synthesis are mitochondria. Researchers recently proved that cancer cells can steal immune cells' mitochondria using nanoscale tubes. This finding demonstrates the dependence of cancer cells on normal cells for their living and function. It also denotes the importance of mitochondria in cancer cells' biology. Emerging evidence has demonstrated how mitochondria are essential for cancer cells to survive in the harsh tumor microenvironments, evade the immune system, obtain more aggressive features, and resist treatments. For instance, functional mitochondria can improve cancer resistance against radiotherapy by scavenging the released reactive oxygen species. Therefore, targeting mitochondria can potentially enhance oncological outcomes, according to this notion. The tumors' responses to anticancer treatments vary, ranging from a complete response to even cancer progression during treatment. Therefore, personalized cancer treatment is of crucial importance. So far, personalized cancer treatment has been based on genomic analysis. Evidence shows that tumors with high mitochondrial content are more resistant to treatment. This paper illustrates how mitochondrial metabolism can participate in cancer resistance to chemotherapy, immunotherapy, and radiotherapy. Pretreatment evaluation of mitochondrial metabolism can provide additional information to genomic analysis and can help to improve personalized oncological treatments. This article outlines the importance of mitochondrial metabolism in cancer biology and personalized treatments.

HFE
Also flagged:Acute Kidney Injurycreatinineureaextracellularcell-cycle arrestmitochondrial
Journal Article 2023-08-11 ✓ 1 Snippet Pejchinovski I, Turkkan S, Pejchinovski M.
In-Text Gene Mentions

…but also inhemochromatosis[ 35 ].…

Show Full Abstract

Acute Kidney Injury (AKI) is currently recognized as a life-threatening disease, leading to an exponential increase in morbidity and mortality worldwide. At present, AKI is characterized by a significant increase in serum creatinine (SCr) levels, typically followed by a sudden drop in glomerulus filtration rate (GFR). Changes in urine output are usually associated with the renal inability to excrete urea and other nitrogenous waste products, causing extracellular volume and electrolyte imbalances. Several molecular mechanisms were proposed to be affiliated with AKI development and progression, ultimately involving renal epithelium tubular cell-cycle arrest, inflammation, mitochondrial dysfunction, the inability to recover and regenerate proximal tubules, and impaired endothelial function. Diagnosis and prognosis using state-of-the-art clinical markers are often late and provide poor outcomes at disease onset. Inappropriate clinical assessment is a strong disease contributor, actively driving progression towards end stage renal disease (ESRD). Proteins, as the main functional and structural unit of the cell, provide the opportunity to monitor the disease on a molecular level. Changes in the proteomic profiles are pivotal for the expression of molecular pathways and disease pathogenesis. Introduction of highly-sensitive and innovative technology enabled the discovery of novel biomarkers for improved risk stratification, better and more cost-effective medical care for the ill patients and advanced personalized medicine. In line with those strategies, this review provides and discusses the latest findings of proteomic-based biomarkers and their prospective clinical application for AKI management.

Also flagged:CNS diseasesneurological disorderspsychiatric diseasessecretionAQP-4transcription factors
Journal Article 2023-08-11 No Snippets Brandl S, Reindl M.
Show Full Abstract

The blood-brain barrier, which is formed by tightly interconnected microvascular endothelial cells, separates the brain from the peripheral circulation. Together with other central nervous system-resident cell types, including pericytes and astrocytes, the blood-brain barrier forms the neurovascular unit. Upon neuroinflammation, this barrier becomes leaky, allowing molecules and cells to enter the brain and to potentially harm the tissue of the central nervous system. Despite the significance of animal models in research, they may not always adequately reflect human pathophysiology. Therefore, human models are needed. This review will provide an overview of the blood-brain barrier in terms of both health and disease. It will describe all key elements of the in vitro models and will explore how different compositions can be utilized to effectively model a variety of neuroinflammatory conditions. Furthermore, it will explore the existing types of models that are used in basic research to study the respective pathologies thus far.

HTT
Also flagged:neurological disordersserotoninorgan developmentcognitionneurodegenerative disordersCNS disorders
Journal Article 2023-08-11 ✓ 1 Snippet Chaudhry TS, Senapati SG, Gadam S, Mannam HPSS, Voruganti HV, Abbasi Z, Abhinav T, Challa AB, Pallipamu N, Bheemisetty N, Arunachalam SP.
In-Text Gene Mentions

…al. show thatHTTpromoter alleles alone…

Show Full Abstract

The association and interaction between the central nervous system (CNS) and enteric nervous system (ENS) is well established. Essentially ENS is the second brain, as we call it. We tried to understand the structure and function, to throw light on the functional aspect of neurons, and address various disease manifestations. We summarized how various neurological disorders influence the gut via the enteric nervous system and/or bring anatomical or physiological changes in the enteric nervous system or the gut and vice versa. It is known that stress has an effect on Gastrointestinal (GI) motility and causes mucosal erosions. In our literature review, we found that stress can also affect sensory perception in the central nervous system. Interestingly, we found that mutations in the neurohormone, serotonin (5-HT), would result in dysfunctional organ development and further affect mood and behavior. We focused on the developmental aspects of neurons and cognition and their relation to nutritional absorption via the gastrointestinal tract, the development of neurodegenerative disorders in relation to the alteration in gut microbiota, and contrariwise associations between CNS disorders and ENS. This paper further summarizes the synergetic relation between gastrointestinal and neuropsychological manifestations and emphasizes the need to include behavioral therapies in management plans.

Also flagged:SynthesisArylation1,3-dicyclohexylureaPalladium,3boronic acids
Journal Article 2023-08-11 No Snippets Maqbool T, Younas H, Bilal M, Rasool N, Bajaber MA, Mubarik A, Parveen B, Ahmad G, Ali Shah SA.
Show Full Abstract

In this study, we reported the synthesis of 1-(4-bromobenzoyl)-1,3-dicyclohexylurea by the reaction of DCC (<i>N</i>,<i>N</i>'-dicyclohexylcarbodiimide) with 4-bromobenzoic acid. Subsequently, we further synthesized a new series of 1-(4-arylbenzoyl)-1,3-dicyclohexylurea (<b>5a</b>-<b>g</b>) derivatives using a Suzuki cross-coupling reaction between 1-(4-bromobenzoyl)-1,3-dicyclohexylurea (<b>3</b>) and various aryl/heteroaryl boronic acids (<b>4</b>). Thus, density functional theory (DFT) calculations have been performed to examine the electronic structure of the synthesized compounds (<b>3</b>, <b>5a</b>-<b>g</b>) and to calculate their spectroscopic data. Moreover, optimized geometries and thermodynamic properties, such as frontier molecular orbitals (HOMO, LUMO), molecular electrostatic potential surfaces, and reactivity descriptors, were also calculated at the PBE0-D3BJ/def2-TZVP/SMD<sub>1,4-dioxane</sub> level of theory to validate the structures of the synthesized compounds.

PLCL1
Also flagged:tumorclear cell renal cell carcinomaccRCClactylationHIBCHM6A
Journal Article 2023-08-11 ✓ 1 Snippet Yang L, Wang X, Liu J, Liu X, Li S, Zheng F, Dong Q, Xu S, Xiong J, Fu B.
In-Text Gene Mentions

…+ TMEM25*(-0.202) +PLCL1*(-0.116) + PRUNE2*(-0.055) +…

Show Full Abstract

<h4>Background</h4>Both lactylation and m6A modification have important implications for the development of clear cell renal cell carcinoma (ccRCC), and we aimed to use crosstalk genes of both to reveal the prognostic and immunological features of ccRCC.<h4>Methods</h4>Our first step was to look for lactylation-related genes that differed between normal and tumor tissues, and then by correlation analysis, we found the genes associated with M6A. Following that, ccRCC subtypes will be identified and risk models will be constructed to compare the prognosis and tumor microenvironment among different subgroups. A nomogram was constructed to predict the prognosis of ccRCC, and <i>in vitro</i>, experiments were conducted to validate the expression and function of key genes.<h4>Results</h4>We screened 100 crosstalk genes and identified 2 ccRCC subtypes. A total of 11 prognostic genes were screened for building a risk model. we observed higher immune scores, elevated tumor mutational burden, and microsatellite instability scores in the high-risk group. Therefore, individuals classified as high-risk would derive greater benefits from immunotherapy. The nomogram's ability to predict overall survival with a 1-year AUC of 0.863 demonstrates its significant practical utility. In addition, HIBCH was identified as a potential therapeutic target and its expression and function were verified by <i>in vitro</i> experiments.<h4>Conclusion</h4>In addition to developing a precise prognostic nomogram for patients with ccRCC, our study also discovered the potential of HIBCH as a biomarker for the disease.

Also flagged:tuberculosisTBdeathinfectious diseaseinterferon-γIFN-γ
Journal Article 2023-08-11 No Snippets Kim H, Choi HG, Shin SJ.
Show Full Abstract

Although tuberculosis (TB) remains one of the leading causes of death from an infectious disease worldwide, the development of vaccines more effective than bacille Calmette-Guérin (BCG), the only licensed TB vaccine, has progressed slowly even in the context of the tremendous global impact of TB. Most vaccine candidates have been developed to strongly induce interferon-γ (IFN-γ)-producing T-helper type 1 (Th1) cell responses; however, accumulating evidence has suggested that other immune factors are required for optimal protection against <i>Mycobacterium tuberculosis</i> (Mtb) infection. In this review, we briefly describe the five hurdles that must be overcome to develop more effective TB vaccines, including those with various purposes and tested in recent promising clinical trials. In addition, we discuss the current knowledge gaps between preclinical experiments and clinical studies regarding peripheral versus tissue-specific immune responses, different underlying conditions of individuals, and newly emerging immune correlates of protection. Moreover, we propose how recently discovered TB risk or susceptibility factors can be better utilized as novel biomarkers for the evaluation of vaccine-induced protection to suggest more practical ways to develop advanced TB vaccines. Vaccines are the most effective tools for reducing mortality and morbidity from infectious diseases, and more advanced technologies and a greater understanding of host-pathogen interactions will provide feasibility and rationale for novel vaccine design and development.

Also flagged:SHOX2prostate cancergene expressiontumorsPCanephronophthisis type 4
Journal Article 2023-08-11 No Snippets Yang W, Chen H, Ma L, Dong J, Wei M, Xue X, Li Y, Jin Z, Xu W, Ji Z.
Show Full Abstract

The transcription factor SHOX2 gene is critical in regulating gene expression and the development of tumors, but its biological role in prostate cancer (PCa) remains unclear. In this study, we found that SHOX2 expression was significantly raised in PCa tissues and was associated with clinicopathological features as well as disease-free survival (DFS) of PCa patients. Phenotypic tests showed that the absence of SHOX2 inhibited PCa growth and invasion, while SHOX2 overexpression promoted these effects. Mechanistically, SHOX2 was found to activate the transcription of nephronophthisis type 4 (NPHP4), a gene located downstream of SHOX2. Further analysis revealed that SHOX2 could potentially interfere with the Hippo-YAP signaling pathway through NPHP4 activation, facilitating the oncogenic behavior of PCa cells. These findings highlight SHOX2 as an oncogene in PCa and provide a basis for developing potential therapeutic approaches against this disease.

ARFGEF2
Also flagged:epilepsyperiventricular nodular heterotopiageneralized tonic-clonic seizuresleepneuronal migrationmyelin
Journal Article 2023-08-11 ✓ 1 Snippet Kim SA, Ivanov AO, Halepa AA, Sysoeva AA, Gunenko GA.
In-Text Gene Mentions

…mutation in theARFGEF2gene.[…

Show Full Abstract

<h4>Background</h4>Periventricular nodular heterotopia (PNH) is a rare pathological condition characterized by the presence of nodules of gray matter located along the lateral ventricles of the brain. The condition typically presents with seizures and other neurological symptoms, and various methods of surgical treatment and postoperative outcomes have been described in the literature.<h4>Case description</h4>We present a case study of a 17-year-old patient who has been experiencing seizures since the age of 13. The patient reported episodes of loss of consciousness and periodic freezing with preservation of posture. Two years later, the patient experienced his first generalized tonic-clonic seizure during nocturnal sleep and was subsequently admitted to a neurological department. A magnetic resonance imaging scan of the brain with an epilepsy protocol (3 Tesla) confirmed the presence of an extended bilateral subependymal nodular heterotopy at the level of the temporal and occipital horns of the lateral ventricles, which was larger on the left side, and a focal subcortical heterotopy of the right cerebellar hemisphere. The patient underwent a posterior quadrant disconnection surgery, which aimed to isolate the extensive epileptogenic zone in the left temporal, parietal, and occipital lobes using standard techniques. As of today, 6 months have passed since the surgery and there have been no registered epileptic seizures during this period following the surgical treatment.<h4>Conclusion</h4>Although PNHs can be extensive and located bilaterally, surgical intervention may still be an effective way to achieve seizure control in selected cases.

bioRxiv 2023-08-11 Preprint (No Snippets API) Kong D, Maganzini N, Thompson IA, Eisenstein M, Soh HT.
Show Full Abstract

The development of receptors suitable for the continuous detection of analytes in complex, interferent-rich samples remains challenging. Antibodies are highly sensitive but difficult to engineer in order to introduce signaling functionality, while aptamer switches are easy to construct but often yield only modest target sensitivity. We present here the programmable antibody and DNA aptamer switch (PANDAS), which combines the best features of both systems by using a nucleic acid tether to link an analyte-specific antibody to an internal strand-displacement (ISD)-based aptamer switch that recognizes the same target. The monoclonal antibody mediates initial analyte binding due to its higher affinity; the resulting increase in local analyte concentration then leads to cooperative binding and signaling by the ISD switch. We developed a PANDAS sensor for the clotting protein thrombin and show that this design achieves 100-fold enhanced sensitivity compared to using an aptamer alone. This design also exhibits reversible binding, enabling repeated measurements with temporal resolution of ∼10 minutes, and retains excellent sensitivity even in interferent-rich samples. With future development, this PANDAS approach could enable the adaptation of existing protein-binding aptamers with modest affinity into sensors that deliver excellent sensitivity and minute-scale resolution in minimally prepared biological specimens.

Research Square 2023-08-11 Preprint (No Snippets API) Attaallah B, Petitet P, Zambellas R, Toniolo S, Maio M, Ganse-Dumrath A, Irani S, Manohar S, Husain M.
Show Full Abstract

<title>Abstract</title> <p>The role of the hippocampus in decision making is poorly understood. Because of its prospective and inferential functions, we hypothesized that it might be required specifically when decisions involve evaluation of uncertain values. Here, a group of individuals with autoimmune limbic encephalitis (ALE) – a condition known to focally affect the hippocampus – was tested on how they evaluate reward against uncertainty compared to evaluation of reward against another key attribute – physical effort. Across four experiments requiring participants to make trade-offs between reward, uncertainty and effort, ALE patients demonstrated blunted sensitivity to reward and effort whenever uncertainty was considered, despite demonstrating intact uncertainty sensitivity. By contrast, valuation of these two attributes (reward and effort) was intact on uncertainty-free tasks. Reduced sensitivity to changes in reward under uncertainty correlated with severity of hippocampal damage. Together, these findings provide evidence for a context-sensitive role of the hippocampus in value-based decision making, apparent specifically under conditions of uncertainty.</p>

TRIM38
Also flagged:SARS-CoV-2 infection-CoV-2 infectioninfectionWT1transcription factorWnt
Journal Article 2023-08-10 ✓ 1 Snippet Yedidya Y, Davis D, Drier Y.
In-Text Gene Mentions

…of negative regulators:TRIM38, TNIP1, and HSPB1.…

Show Full Abstract

Despite extensive studies on the effects of SARS-CoV-2 infection, there is still a lack of understanding of the downstream epigenetic and regulatory alterations in infected cells. In this study, we investigated changes in enhancer acetylation in epithelial lung cells infected with SARS-CoV-2 and their influence on transcriptional regulation and pathway activity. To achieve this, we integrated and reanalyzed data of enhancer acetylation, ex-vivo infection and single cell RNA-seq data from human patients. Our findings revealed coordinated changes in enhancers and transcriptional networks. We found that infected cells lose the WT1 transcription factor and demonstrate disruption of WT1-bound enhancers and of their associated target genes. Downstream targets of WT1 are involved in the regulation of the Wnt signaling and the mitogen-activated protein kinase cascade, which indeed exhibit increased activation levels. These findings may provide a potential explanation for the development of pulmonary fibrosis, a lethal complication of COVID-19. Moreover, we revealed over-acetylated enhancers associated with upregulated genes involved in cell adhesion, which could contribute to cell-cell infection of SARS-CoV-2. Furthermore, we demonstrated that enhancers may play a role in the activation of pro-inflammatory cytokines and contribute to excessive inflammation in the lungs, a typical complication of COVID-19. Overall, our analysis provided novel insights into the cell-autonomous dysregulation of enhancer regulation caused by SARS-CoV-2 infection, a step on the path to a deeper molecular understanding of the disease.

HFE
Also flagged:guanine nucleotide-binding proteinsRASH-RASN-RASK-RASextracellularly
Journal Article 2023-08-10 ✓ 1 Snippet Zheng K, Hao F, Medrano-Garcia S, Chen C, Guo F, Morán-Blanco L, Rodríguez-Perales S, Torres-Ruiz R, Peligros MI, Vaquero J, Bañares R, Gómez Del Moral M, Regueiro JR, Martínez-Naves E, Mohamed MR, Gallego-Durán R, Maya D, Ampuero J, Romero-Gómez M, Gilbert-Ramos A, Guixé-Muntet S, Fernández-Iglesias A, Gracia-Sancho J, Coll M, Graupera I, Ginès P, Ciudin A, Rivera-Esteban J, Pericàs JM, Frutos MD, Ramos Molina B, Herranz JM, Ávila MA, Nevzorova YA, Fernández-Malavé E, Cubero FJ.
In-Text Gene Mentions

…disorders, autoimmune disease,hemochromatosis, Wilson’s disease, familial/g…

Show Full Abstract

Progressive hepatic damage and fibrosis are major features of chronic liver diseases of different etiology, yet the underlying molecular mechanisms remain to be fully defined. N-RAS, a member of the RAS family of small guanine nucleotide-binding proteins also encompassing the highly homologous H-RAS and K-RAS isoforms, was previously reported to modulate cell death and renal fibrosis; however, its role in liver damage and fibrogenesis remains unknown. Here, we approached this question by using N-RAS deficient (N-RAS<sup>-/-</sup>) mice and two experimental models of liver injury and fibrosis, namely carbon tetrachloride (CCl<sub>4</sub>) intoxication and bile duct ligation (BDL). In wild-type (N-RAS<sup>+/+</sup>) mice both hepatotoxic procedures augmented N-RAS expression in the liver. Compared to N-RAS<sup>+/+</sup> counterparts, N-RAS<sup>-/-</sup> mice subjected to either CCl<sub>4</sub> or BDL showed exacerbated liver injury and fibrosis, which was associated with enhanced hepatic stellate cell (HSC) activation and leukocyte infiltration in the damaged liver. At the molecular level, after CCl<sub>4</sub> or BDL, N-RAS<sup>-/-</sup> livers exhibited augmented expression of necroptotic death markers along with JNK1/2 hyperactivation. In line with this, N-RAS ablation in a human hepatocytic cell line resulted in enhanced activation of JNK and necroptosis mediators in response to cell death stimuli. Of note, loss of hepatic N-RAS expression was characteristic of chronic liver disease patients with fibrosis. Collectively, our study unveils a novel role for N-RAS as a negative controller of the progression of liver injury and fibrogenesis, by critically downregulating signaling pathways leading to hepatocyte necroptosis. Furthermore, it suggests that N-RAS may be of potential clinical value as prognostic biomarker of progressive fibrotic liver damage, or as a novel therapeutic target for the treatment of chronic liver disease.

DARS2
Also flagged:intellectual disabilityKallmann syndromeKSIDneurological disorderTSPAN11
Journal Article 2023-08-10 ✓ 4 Snippets Ben-Mahmoud A, Kishikawa S, Gupta V, Leach NT, Shen Y, Moldovan O, Goel H, Hopper B, Ranguin K, Gruchy N, Maas SM, Lacassie Y, Kim SH, Kim WY, Quade BJ, Morton CC, Kim CH, Layman LC, Kim HG.
In-Text Gene Mentions

On the protein level, ETFBKMT interacts with TUBB2A (Tubulin, Beta-2A, MIM 615101)90, TUBB4A (Tubulin, Beta-4A, MIM 602662)90, DARS2 (Aspartyl-tRNA Synthetase 2, MIM 610956)55, and GLS (Glutaminase, MIM 138280)91, all of which are associated with NDDs.

DARS2 is genetically linked to leukoencephalopathy with brain stem and spinal cord involvement94,95.

…602662) 90 ,DARS2(Aspartyl-tRNA Synthetase 2,…

DARS2is genetically linked…

Show Full Abstract

In a patient diagnosed with both Kallmann syndrome (KS) and intellectual disability (ID), who carried an apparently balanced translocation t(7;12)(q22;q24)dn, array comparative genomic hybridization (aCGH) disclosed a cryptic heterozygous 4.7 Mb deletion del(12)(p11.21p11.23), unrelated to the translocation breakpoint. This novel discovery prompted us to consider the possibility that the combination of KS and neurological disorder in this patient could be attributed to gene(s) within this specific deletion at 12p11.21-12p11.23, rather than disrupted or dysregulated genes at the translocation breakpoints. To further support this hypothesis, we expanded our study by screening five candidate genes at both breakpoints of the chromosomal translocation in a cohort of 48 KS patients. However, no mutations were found, thus reinforcing our supposition. In order to delve deeper into the characterization of the 12p11.21-12p11.23 region, we enlisted six additional patients with small copy number variations (CNVs) and analyzed eight individuals carrying small CNVs in this region from the DECIPHER database. Our investigation utilized a combination of complementary approaches. Firstly, we conducted a comprehensive phenotypic-genotypic comparison of reported CNV cases. Additionally, we reviewed knockout animal models that exhibit phenotypic similarities to human conditions. Moreover, we analyzed reported variants in candidate genes and explored their association with corresponding phenotypes. Lastly, we examined the interacting genes associated with these phenotypes to gain further insights. As a result, we identified a dozen candidate genes: TSPAN11 as a potential KS candidate gene, TM7SF3, STK38L, ARNTL2, ERGIC2, TMTC1, DENND5B, and ETFBKMT as candidate genes for the neurodevelopmental disorder, and INTS13, REP15, PPFIBP1, and FAR2 as candidate genes for KS with ID. Notably, the high-level expression pattern of these genes in relevant human tissues further supported their candidacy. Based on our findings, we propose that dosage alterations of these candidate genes may contribute to sexual and/or cognitive impairments observed in patients with KS and/or ID. However, the confirmation of their causal roles necessitates further identification of point mutations in these candidate genes through next-generation sequencing.

DARS2
Also flagged:Leukoencephalopathylactateneurological disordermitochondrialaspartyl-tRNA synthetaseLBSL
Journal Article 2023-08-10 ✓ 5 Snippets Guang S, O'Brien BM, Fine AS, Ying M, Fatemi A, Nemeth CL.
In-Text Gene Mentions

Based on our findings at the time point examined, even in LBSL patients with the same mutations, the dominant DARS2 transcripts and final DARS2 protein level expressed in cells may be random, resulting in phenotype differences among cells and individuals.

In this study we generated hCOs for seven LBSL patients and three healthy controls and performed scRNA-seq (SMART-seq2) on all samples with the hypothesis that there may be non-canonical functions of DARS2 that may be altered in LBSL.

With BRIE2, DARS2 (exon 3) was identified as one of the DSEs associated with LBSL, a finding verified by PCR and RT-qPCR which shows that exon 3 exclusion was significantly increased in LBSL cells.

DARS2-related leukoencephalopathy, also called Leukoencephalopathy with Brainstem and Spinal cord involvement and Lactate elevation (LBSL), is a rare neurological disorder with a wide phenotypic spectrum.

To date, there have been various conditional Dars2 knock-out mouse models for studying LBSL pathogenesis.

Show Full Abstract

Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) is a rare neurological disorder caused by the mutations in the DARS2 gene, which encodes the mitochondrial aspartyl-tRNA synthetase. The objective of this study was to understand the impact of DARS2 mutations on cell processes through evaluation of LBSL patient stem cell derived cerebral organoids and neurons. We generated human cerebral organoids (hCOs) from induced pluripotent stem cells (iPSCs) of seven LBSL patients and three healthy controls using an unguided protocol. Single cells from 70-day-old hCOs were subjected to SMART-seq2 sequencing and bioinformatic analysis to acquire high-resolution gene and transcript expression datasets. Global gene expression analysis demonstrated dysregulation of a number of genes involved in mRNA metabolism and splicing processes within LBSL hCOs. Importantly, there were distinct and divergent gene expression profiles based on the nature of the DARS2 mutation. At the transcript level, pervasive differential transcript usage and differential spliced exon events that are involved in protein translation and metabolism were identified in LBSL hCOs. Single-cell analysis of DARS2 (exon 3) showed that some LBSL cells exclusively express transcripts lacking exon 3, indicating that not all LBSL cells can benefit from the "leaky" nature common to splice site mutations. At the gene- and transcript-level, we uncovered that dysregulated RNA splicing, protein translation and metabolism may underlie at least some of the pathophysiological mechanisms in LBSL. To confirm hCO findings, iPSC-derived neurons (iNs) were generated by overexpressing Neurogenin 2 using lentiviral vector to study neuronal growth, splicing of DARS2 exon 3 and DARS2 protein expression. Live cell imaging revealed neuronal growth defects of LBSL iNs, which was consistent with the finding of downregulated expression of genes related to neuronal differentiation in LBSL hCOs. DARS2 protein was downregulated in iNs compared to iPSCs, caused by increased exclusion of exon 3. The scope and complexity of our data imply that DARS2 is potentially involved in transcription regulation beyond its canonical role of aminoacylation. Nevertheless, our work highlights transcript-level dysregulation as a critical, and relatively unexplored, mechanism linking genetic data with neurodegenerative disorders.

Also flagged:metabolic diseasesInborn metabolic diseasesarthritishereditary hemochromatosisalkaptonuriamucopolysaccharidosis
Journal Article 2023-08-10 No Snippets Loret A, Jacob C, Mammou S, Bigot A, Blasco H, Audemard-Verger A, Schwartz IV, Mulleman D, Maillot F.
Show Full Abstract

Inborn metabolic diseases (IMD) are rare conditions that can be diagnosed during adulthood. Patients with IMD may have joint symptoms and the challenge is to establish an early diagnosis in order to institute appropriate treatment and prevent irreversible damage. This review describes the joint manifestations of IMD that may be encountered in adults. The clinical settings considered were arthralgia and joint stiffness as well as arthritis. Unspecific arthralgias are often the first symptoms of hereditary hemochromatosis, chronic low back pain may reveal an intervertebral disc calcification in relation with alkaptonuria, and progressive joint stiffness may correspond to a mucopolysaccharidosis or mucolipidosis. Gaucher disease is initially revealed by painful acute attacks mimicking joint pain described as "bone crises". Some IMD may induce microcrystalline arthropathy. Beyond classical gout, there are also gouts in connection with purine metabolism disorders known as "enzymopathic gouts". Pyrophosphate arthropathy can also be part of the clinical spectrum of Gitelman syndrome or hypophosphatasia. Oxalate crystals arthritis can reveal a primary hyperoxaluria. Destructive arthritis may be indicative of Wilson's disease. Non-destructive arthritis may be seen in mevalonate kinase deficiency and familial hypercholesterolemia.

Also flagged:endometrial carcinomatumorspeptidesMYCmetforminPIK3R1
Journal Article 2023-08-10 No Snippets Dou Y, Katsnelson L, Gritsenko MA, Hu Y, Reva B, Hong R, Wang YT, Kolodziejczak I, Lu RJ, Tsai CF, Bu W, Liu W, Guo X, An E, Arend RC, Bavarva J, Chen L, Chu RK, Czekański A, Davoli T, Demicco EG, DeLair D, Devereaux K, Dhanasekaran SM, Dottino P, Dover B, Fillmore TL, Foxall M, Hermann CE, Hiltke T, Hostetter G, Jędryka M, Jewell SD, Johnson I, Kahn AG, Ku AT, Kumar-Sinha C, Kurzawa P, Lazar AJ, Lazcano R, Lei JT, Li Y, Liao Y, Lih TM, Lin TT, Martignetti JA, Masand RP, Matkowski R, McKerrow W, Mesri M, Monroe ME, Moon J, Moore RJ, Nestor MD, Newton C, Omelchenko T, Omenn GS, Payne SH, Petyuk VA, Robles AI, Rodriguez H, Ruggles KV, Rykunov D, Savage SR, Schepmoes AA, Shi T, Shi Z, Tan J, Taylor M, Thiagarajan M, Wang JM, Weitz KK, Wen B, Williams CM, Wu Y, Wyczalkowski MA, Yi X, Zhang X, Zhao R, Mutch D, Chinnaiyan AM, Smith RD, Nesvizhskii AI, Wang P, Wiznerowicz M, Ding L, Mani DR, Zhang H, Anderson ML, Rodland KD, Zhang B, Liu T, Fenyö D, Clinical Proteomic Tumor Analysis Consortium.
Show Full Abstract

We characterized a prospective endometrial carcinoma (EC) cohort containing 138 tumors and 20 enriched normal tissues using 10 different omics platforms. Targeted quantitation of two peptides can predict antigen processing and presentation machinery activity, and may inform patient selection for immunotherapy. Association analysis between MYC activity and metformin treatment in both patients and cell lines suggests a potential role for metformin treatment in non-diabetic patients with elevated MYC activity. PIK3R1 in-frame indels are associated with elevated AKT phosphorylation and increased sensitivity to AKT inhibitors. CTNNB1 hotspot mutations are concentrated near phosphorylation sites mediating pS45-induced degradation of β-catenin, which may render Wnt-FZD antagonists ineffective. Deep learning accurately predicts EC subtypes and mutations from histopathology images, which may be useful for rapid diagnosis. Overall, this study identified molecular and imaging markers that can be further investigated to guide patient stratification for more precise treatment of EC.

LRRC7
Also flagged:chromosomesnucleosomeschromosomeloop extrusiontopoisomerase IItopo II
Journal Article 2023-08-10 ✓ 2 Snippets Yamamoto T, Kinoshita K, Hirano T.
In-Text Gene Mentions

Condensin-mediated loop extrusion is…

Condensin

Show Full Abstract

Condensin-mediated loop extrusion is now considered as the main driving force of mitotic chromosome assembly. Recent experiments have shown, however, that a class of mutant condensin complexes deficient in loop extrusion can assemble chromosome-like structures in Xenopus egg extracts, although these structures are somewhat different from those assembled by wild-type condensin complexes. In the absence of topoisomerase II (topo II), the mutant condensin complexes produce an unusual round-shaped structure termed a bean, which consists of a DNA-dense central core surrounded by a DNA-sparse halo. The mutant condensin complexes accumulate in the core, whereas histones are more concentrated in the halo than in the core. We consider that this peculiar structure serves as a model system to study how DNA entanglements, nucleosomes, and condensin functionally crosstalk with each other. To gain insight into how the bean structure is formed, here we construct a theoretical model. Our theory predicts that the core is formed by attractive interactions between mutant condensin complexes, whereas the halo is stabilized by the energy reduction through the selective accumulation of nucleosomes. The formation of the halo increases the elastic free energy due to the DNA entanglement in the core, but the latter free energy is compensated by condensin complexes that suppress the assembly of nucleosomes.

DCC
Also flagged:Adamtsl3synapsetransmembrane receptordeleted in colorectal cancerNetrin-1synapses
Journal Article 2023-08-10 ✓ 5 Snippets Cramer TML, Pinan-Lucarre B, Cavaccini A, Damilou A, Tsai YC, Bhat MA, Panzanelli P, Rama N, Mehlen P, Benke D, Karayannis T, Bessereau JL, Tyagarajan SK.
In-Text Gene Mentions

These findings might be particularly relevant for schizophrenia because genetic variants in Adamtsl3 and DCC have been independently linked with schizophrenia in patients.

…Adamtsl3 mediatesDCCsignaling to selectively…

…the transmembrane receptorDCC(deleted in colorectal…

…Traditionally,DCCfunction has been…

…in neurons impairsDCCprotein expression, causing…

Show Full Abstract

The molecular code that controls synapse formation and maintenance in vivo has remained quite sparse. Here, we identify that the secreted protein Adamtsl3 functions as critical hippocampal synapse organizer acting through the transmembrane receptor DCC (deleted in colorectal cancer). Traditionally, DCC function has been associated with glutamatergic synaptogenesis and plasticity in response to Netrin-1 signaling. We demonstrate that early post-natal deletion of Adamtsl3 in neurons impairs DCC protein expression, causing reduced density of both glutamatergic and GABAergic synapses. Adult deletion of Adamtsl3 in either GABAergic or glutamatergic neurons does not interfere with DCC-Netrin-1 function at glutamatergic synapses but controls DCC signaling at GABAergic synapses. The Adamtsl3-DCC signaling unit is further essential for activity-dependent adaptations at GABAergic synapses, involving DCC phosphorylation and Src kinase activation. These findings might be particularly relevant for schizophrenia because genetic variants in Adamtsl3 and DCC have been independently linked with schizophrenia in patients.

DCC
Also flagged:synapsesbehaviorallocomotiongene expressionorganizationneurological disease
Journal Article 2023-08-10 ✓ 1 Snippet Salzberg Y, Haque R, Oren-Suissa M.
In-Text Gene Mentions

…The netrin receptor UNC-40/DCCacts locally in…

Show Full Abstract

Many animal behaviors are manifested differently in the two sexes of a given species, but how such sexual dimorphism is imprinted in the nervous system is not always clear. One mechanism involved is synaptic dimorphism, by which the same neurons exist in the two sexes, but form synapses that differ in features such as anatomy, molecular content or fate. While some evidence for synaptic dimorphism exists in humans and mammals, identifying these mechanisms in invertebrates has proven simpler, due to their smaller nervous systems and absence of external regulation by sex hormones. This review aims to present the current status of the field in invertebrates, the available toolkit for the study of synaptic dimorphism, and the standing questions that still remain incompletely answered.

HTT
Also flagged:Fetal Alcohol Spectrum DisordersAlcohol Spectrum DisordersAlcoholismFASDAlcohol Abuseattachment
Journal Article 2023-08-10 ✓ 1 Snippet Petrenko CLM, Hamre KM, Brigman JL, Parnell S.
In-Text Gene Mentions

Htt

Show Full Abstract

The 2022 Fetal Alcohol Spectrum Disorders Study Group (FASDSG) meeting was held in coordination with the 45th annual Research Society on Alcoholism conference on June 25th, 2022. The theme of the meeting was "Enhancing the Relevance of Research for the Community." The program began with a moderated panel discussion on the value of community-engaged research, which included two self-advocates and a clinical and pre-clinical researcher. Invited plenary speakers included Jill Locke, Ph.D., who provided an engaging introduction to implementation science, and Jared Young, Ph.D., who discussed cross-species domain task specificity. The meeting also included updates from three government agencies, short presentations by junior and senior investigators showcasing late-breaking FASD research, trainee award winners, and a presentation on the Toward Health Outcomes intervention roadmap by Jacqueline Pei, Ph.D.

UNC13C
Also flagged:TCF4RIMBP2transcription factorsynaptic transmissionPTHStranscription factor 4
Journal Article 2023-08-10 ✓ 1 Snippet Davis BA, Chen HY, Ye Z, Ostlund I, Tippani M, Das D, Sripathy SR, Wang Y, Martin JM, Shim G, Panchwagh NM, Moses RL, Farinelli F, Bohlen JF, Li M, Luikart BW, Jaffe AE, Maher BJ.
In-Text Gene Mentions

UNC13C

Show Full Abstract

<h4>Background</h4>Genetic variation in the TCF4 (transcription factor 4) gene is associated with risk for a variety of developmental and psychiatric conditions, which includes a syndromic form of autism spectrum disorder called Pitt-Hopkins syndrome (PTHS). TCF4 encodes an activity-dependent transcription factor that is highly expressed during cortical development and in animal models has been shown to regulate various aspects of neuronal development and function. However, our understanding of how disease-causing mutations in TCF4 confer pathophysiology in a human context is lacking.<h4>Methods</h4>To model PTHS, we differentiated human cortical neurons from human induced pluripotent stem cells that were derived from patients with PTHS and neurotypical individuals. To identify pathophysiology and disease mechanisms, we assayed cortical neurons with whole-cell electrophysiology, Ca<sup>2+</sup> imaging, multielectrode arrays, immunocytochemistry, and RNA sequencing.<h4>Results</h4>Cortical neurons derived from patients with TCF4 mutations showed deficits in spontaneous synaptic transmission, network excitability, and homeostatic plasticity. Transcriptomic analysis indicated that these phenotypes resulted in part from altered expression of genes involved in presynaptic neurotransmission and identified the presynaptic binding protein RIMBP2 as the most differentially expressed gene in PTHS neurons. Remarkably, TCF4-dependent deficits in spontaneous synaptic transmission and network excitability were rescued by increasing RIMBP2 expression in presynaptic neurons.<h4>Conclusions</h4>Taken together, these results identify TCF4 as a critical transcriptional regulator of human synaptic development and plasticity and specifically identifies dysregulation of presynaptic function as an early pathophysiology in PTHS.

TNFSF4
Also flagged:OlaparibCisplatinDurvalumabhead and neck squamous cell carcinomatumorProgrammed death ligand 1
Journal Article 2023-08-10 ✓ 1 Snippet Moutafi M, Koliou GA, Papaxoinis G, Economopoulou P, Kotsantis I, Gkotzamanidou M, Anastasiou M, Pectasides D, Kyrodimos E, Delides A, Giotakis E, Papadimitriou NG, Panayiotides IG, Perisanidis C, Fernandez AI, Xirou V, Poulios C, Gagari E, Yaghoobi V, Gavrielatou N, Shafi S, Aung TN, Kougioumtzopoulou A, Kouloulias V, Palialexis K, Gkolfinopoulos S, Strati A, Lianidou E, Fountzilas G, Rimm DL, Foukas PG, Psyrri A.
In-Text Gene Mentions

…Costimulatory moleculeTNFSF4(OX40L) was significantly…

Show Full Abstract

<h4>Purpose</h4>We conducted a phase II randomized noncomparative window of opportunity (WOO) trial to evaluate the inhibition of cellular proliferation and the modulation of immune microenvironment after treatment with olaparib alone or in combination with cisplatin or durvalumab in patients with operable head and neck squamous cell carcinoma (HNSCC).<h4>Experimental design</h4>Forty-one patients with HNSCC were randomized to cisplatin plus olaparib (arm A), olaparib alone (arm B), no treatment (arm C) or durvalumab plus olaparib (arm D). The primary endpoint was to evaluate the percentage of patients in each arm that achieved a reduction of at least 25% in Ki67. Secondary endpoints included objective response rate (ORR), safety, and pathologic complete response (pCR) rate. Paired baseline and resection tumor biopsies and blood samples were evaluated for prespecified biomarkers.<h4>Results</h4>A decrease in Ki67 of at least 25% was observed in 44.8% of treated patients, as measured by quantitative immunofluorescence. The ORR among treated patients was 12.1%. pCR was observed in 2 patients. Two serious adverse events occurred in 2 patients.Programmed death ligand 1 (PD-L1) levels [combined positive score (CPS)] were significantly higher after treatment in arms A and D. Expression of <i>CD163</i> and colony-stimulating factor 1 receptor (<i>CSF1R</i>) genes, markers of M2 macrophages, increased significantly posttreatment whereas the expression of <i>CD80</i>, a marker of M1 macrophages, decreased.<h4>Conclusion</h4>Preoperative olaparib with cisplatin or alone or with durvalumab was safe in the preoperative setting and led to decrease in Ki67 of at least 25% in 44.8% of treated patients. Olaparib-based treatment modulates the tumor microenvironment leading to upregulation of PD-L1 and induction of protumor features of macrophages.<h4>Significance</h4>HNSCC is characterized by defective DNA repair pathways and immunosuppressive tumor microenvironment. PARP inhibitors, which promote DNA damage and "reset" the inflammatory tumor microenvironment, can establish an effective antitumor response. This phase II WOO trial in HNSCC demonstrated the immunomodulatory effects of PARP inhibitor-induced DNA damage. In this chemo-naïve population, PARP inhibitor-based treatment, reduced tumor cell proliferation and modulated tumor microenvironment. After olaparib upregulation of PD-L1 and macrophages, suggests that combinatorial treatment might be beneficial.<h4>Synopsis</h4>Our WOO study demonstrates that preoperative olaparib results in a reduction in Ki67, upregulation of PD-L1 CPS, and induction of protumor features of macrophages in HNSCC.

HFE
Also flagged:CarvedilolPropranololVariceal Bleedingportal hypertensionliver cirrhosischronic liver disease
Journal Article 2023-08-10 ✓ 1 Snippet Dardari L, Taha M, Dahat P, Toriola S, Satnarine T, Zohara Z, Adelekun A, Seffah KD, Salib K, Arcia Franchini AP.
In-Text Gene Mentions

…disorders such ashemochromatosisand Wilson's disease…

Show Full Abstract

The most common cause of portal hypertension is liver cirrhosis. Portal hypertension causes many complications in cirrhotic patients; a significant complication is the formation of varices and the subsequent life-threatening variceal bleeding due to elevated portal venous pressures. Hepatic venous pressure gradient (HVPG) is the gold standard for measuring portal hypertension and guides management. Pharmacological treatments lower the HVPG, preventing the progression of varices and subsequent variceal bleeding. The pharmacological treatments frequently used in primary and secondary prophylaxis of a variceal bleed are nonselective beta (β)-adrenergic blockers. Propranolol was the first nonselective β-adrenergic blocker used for lowering HVPG and has been well studied. However, in the past decade, clinical trials have shown that carvedilol has been more effective. This study aims to establish whether carvedilol is more effective than propranolol in reducing the hepatic venous pressure gradient and decreasing the risk of variceal bleeding in adult cirrhotic patients. A systematic review has been conducted to gather relevant clinical trials comparing drugs and their effects on HVPG. Four databases: PubMed (Medical Literature Analysis and Retrieval System Online (MEDLINE)), Google Scholar, the Cochrane Library, and ScienceDirect, were analyzed, and records from January 1, 1999, to January 1, 2023, were chosen. There were a total of 1,235 potentially eligible records across the four databases. Using the eligibility criteria for this systematic review, seven studies of 533 patients were included. Across all seven clinical trials, it was found that carvedilol reduced HVPG more than propranolol and decreased the risk of variceal bleeding in adult cirrhotic patients.

Also flagged:MethyladenosineAutophagyN6-methyladeninemethyltransferasesdemethylasesmethylation-binding proteins
Journal Article 2023-08-10 No Snippets Suga N, Ikeda Y, Yoshikawa S, Taniguchi K, Sawamura H, Matsuda S.
Show Full Abstract

Changes in epitranscriptome with N6-methyladenine (m6A) modification could be involved in the development of multiple diseases, which might be a prevalent modification of messenger RNAs (mRNAs) in eukaryotes. The m6A modification might be performed through the action of methyltransferases, demethylases, and methylation-binding proteins. Importantly, the m6A methylation may be associated with various neurological disorders including Alzheimer's disease (AD), Parkinson's disease (PD), depression, aging-related diseases, and/or aging itself. In addition, the m6A methylation might functionally regulate the eukaryotic transcriptome by influencing the splicing, export, subcellular localization, translation, stability, and decay of mRNAs. Neurodegenerative diseases may possess a wide variety of phenotypes, depending on the neurons that degenerate on occasion. Interestingly, an increasing amount of evidence has indicated that m6A modification could modulate the expression of autophagy-related genes and promote autophagy in neuronal cells. Oxidative stresses such as reactive oxygen species (ROS) could stimulate the m6A RNA methylation, which may also be related to the regulation of autophagy and/or the development of neurodegenerative diseases. Both m6A modification and autophagy could also play critical roles in regulating the health condition of neurons. Therefore, a comprehensive understanding of the m6A and autophagy relationship in human diseases may benefit in developing therapeutic strategies in the future. This paper reviews advances in the understanding of the regulatory mechanisms of m6A modification in the occurrence and development of neurodegenerative diseases and/or aging, discussing the possible therapeutic procedures related to mechanisms of m6A RNA methylation and autophagy.

HTT
Also flagged:neurodegenerative disordersorganellesMitochondriamembranecalciumpathogenesis
Journal Article 2023-08-10 ✓ 4 Snippets Giménez-Bejarano A, Alegre-Cortés E, Yakhine-Diop SMS, Gómez-Suaga P, Fuentes JM.
In-Text Gene Mentions

…in the hungtintin (HTT) gene, located on…

HTTcodes for a…

…Of note,HTTparticipates in the…

…of autofagosome formation,HTTis involved in…

Show Full Abstract

Repeat expansion diseases are a group of neuromuscular and neurodegenerative disorders characterized by expansions of several successive repeated DNA sequences. Currently, more than 50 repeat expansion diseases have been described. These disorders involve diverse pathogenic mechanisms, including loss-of-function mechanisms, toxicity associated with repeat RNA, or repeat-associated non-ATG (RAN) products, resulting in impairments of cellular processes and damaged organelles. Mitochondria, double membrane organelles, play a crucial role in cell energy production, metabolic processes, calcium regulation, redox balance, and apoptosis regulation. Its dysfunction has been implicated in the pathogenesis of repeat expansion diseases. In this review, we provide an overview of the signaling pathways or proteins involved in mitochondrial functioning described in these disorders. The focus of this review will be on the analysis of published data related to three representative repeat expansion diseases: Huntington's disease, <i>C9orf72</i>-frontotemporal dementia/amyotrophic lateral sclerosis, and myotonic dystrophy type 1. We will discuss the common effects observed in all three repeat expansion disorders and their differences. Additionally, we will address the current gaps in knowledge and propose possible new lines of research. Importantly, this group of disorders exhibit alterations in mitochondrial dynamics and biogenesis, with specific proteins involved in these processes having been identified. Understanding the underlying mechanisms of mitochondrial alterations in these disorders can potentially lead to the development of neuroprotective strategies.

PRDX6PCDH17CA10
Also flagged:HomeoboxGene Expressiontranscription factorsembryogenesistumorcancers
Journal Article 2023-08-10 ✓ 4 Snippets Chin FW, Chan SC, Veerakumarasivam A.
In-Text Gene Mentions

A 5-gene panel was identified (NKX6-2, CA10, DBC1, MYO3A, and PENK or SOX11) and the panel had an 85% sensitivity and a 95% specificity for the detection of bladder cancer.

Eight genes (NKX6-2, A2BP1, CA10, DBC1, MYO3A, NPTX2, PENK, and SOX11) were significantly highly methylated in the urine sediments of bladder cancer patients as compared to that of control subjects.

In urine samples, the methylation status of a urinary biomarker panel (HOXA9, ONECUT2, PCDH17, PENK, TWIST1, VIM, and ZNF154) showed great prediction accuracy in predicting bladder cancer in patients with hematuria [54].

In another study, seven ferroptosis-related genes (ZEB1, G6PD, PRDX6, SCD, SLC38A1, SRC, and TFRC) were identified as a prognostic signature for bladder cancer.

Show Full Abstract

Homeobox genes serve as master regulatory transcription factors that regulate gene expression during embryogenesis. A homeobox gene may have either tumor-promoting or tumor-suppressive properties depending on the specific organ or cell lineage where it is expressed. The dysregulation of homeobox genes has been reported in various human cancers, including bladder cancer. The dysregulated expression of homeobox genes has been associated with bladder cancer clinical outcomes. Although bladder cancer has high risk of tumor recurrence and progression, it is highly challenging for clinicians to accurately predict the risk of tumor recurrence and progression at the initial point of diagnosis. Cystoscopy is the routine surveillance method used to detect tumor recurrence. However, the procedure causes significant discomfort and pain that results in poor surveillance follow-up amongst patients. Therefore, the development of reliable non-invasive biomarkers for the early detection and monitoring of bladder cancer is crucial. This review provides a comprehensive overview of the diagnostic and prognostic potential of homeobox gene expression dysregulation in bladder cancer.

CACNA1E
Also flagged:MethylationBreast CancerTumorsfibroadenomabreast cancer tumorsMAST1
Journal Article 2023-08-10 ✓ 5 Snippets Krasnyi AM, Sadekova AA, Kometova VV, Rodionov VV, Yarotskaya EL, Sukhikh GT.
In-Text Gene Mentions

Significant differences in the validation set of samples were found for seven genes; the combination of the four genes GCM2, ITPRIPL1, CACNA1E, DLGAP2 (AUC = 0.99) showed the highest diagnostic value based on logistic regression for all breast cancer samples.

The methylation levels of the 15 genes MAST1, PRDM14, ZNF177, DNM2, SSH1, AP2M1, CACNA1E, CPEB4, DLGAP2, CCDC181, GCM2, ITPRIPL1, POM121L2, KCNQ1, and TIMP3 were studied by modified MS–HRM in small malignant breast tumor (test set, n = 48), fibroadenoma (n = 24), and healthy tissue from patients with fibroadenoma (n = 24).

The correlation analysis in our study showed that LumB- is characterized by the methylation of two genes—PRDM14 and CACNA1E—which could be considered a potential prognostic marker of tumor progression.

Correlation analysis showed that the methylation of the PRDM14, CACNA1E, CCDC181, and GCM2 genes correlated with tumor size.

In our study, we used a set of 96 tumor samples of less than 2 cm; in this set, the assessment of the methylation of the GCM2, ITPRIPL1, CACNA1E, and DLGAP2 genes most accurately distinguished cancer from healthy tissues.

Show Full Abstract

The DNA methylation profile of breast cancer differs from that in healthy tissues and can be used as a diagnostic and prognostic biomarker. Aim of this study: To compare the levels of gene methylation in small malignant breast cancer tumors (<2 cm), in healthy tissue, and in fibroadenoma, and to evaluate the effectiveness of the modified Methylation Sensitive-High Resolution Melting (MS-HRM) method for this analysis. Analysis was performed using the modified MS-HRM method. For validation, the methylation levels of five genes were confirmed by pyrosequencing. The main study group included 96 breast cancer samples and the control group included 24 fibroadenoma samples and 24 healthy tissue samples obtained from patients with fibroadenoma. Breast cancer samples were divided into two subgroups (test set and validation set). The methylation of the following 15 genes was studied: <i>MAST1</i>, <i>PRDM14</i>, <i>ZNF177</i>, <i>DNM2</i>, <i>SSH1</i>, <i>AP2M1</i>, <i>CACNA1E</i>, <i>CPEB4</i>, <i>DLGAP2</i>, <i>CCDC181</i>, <i>GCM2</i>, <i>ITPRIPL1</i>, <i>POM121L2</i>, <i>KCNQ1</i>, and <i>TIMP3</i>. Significant differences in the validation set of samples were found for seven genes; the combination of the four genes <i>GCM2</i>, <i>ITPRIPL1</i>, <i>CACNA1E</i>, <i>DLGAP2</i> (AUC = 0.99) showed the highest diagnostic value based on logistic regression for all breast cancer samples. Our modified MS-HRM method demonstrated that small breast cancer tumors have a specific DNA methylation profile that distinguishes them from healthy tissues and benign proliferative lesions.

HFE
Also flagged:Ironpathogenesisliver diseaseschronic liver diseasesflavonoidGallic acid
Journal Article 2023-08-10 ✓ 1 Snippet Ncume PV, Salau VF, Mtshali S, Olofinsan KA, Erukainure OL, Matsabisa MG.
In-Text Gene Mentions

…viral hepatitis, andhemochromatosis.…

Show Full Abstract

Oxidative stress plays a vital role in the pathogenesis and progression of various liver diseases. Traditional medicinal herbs have been used worldwide for the treatment of chronic liver diseases due to their high phytochemical constituents. The present study investigated the phytochemical properties of <i>Croton gratissimus</i> (lavender croton) leaf herbal tea and its hepatoprotective effect on oxidative injury in Chang liver cells, using an in vitro and in silico approach. <i>C. gratissimus</i> herbal infusion was screened for total phenolic and total flavonoid contents as well as in vitro antioxidant capacity using ferric reducing antioxidant power (FRAP) and 2,2-diphenyl-1-picryl-hydrazyl (DPPH) methods. Oxidative hepatic injury was induced by incubating 0.007 M FeSO<sub>4</sub> with Chang liver cells which has been initially incubated with or without different concentrations (15-240 μg/mL) of <i>C. gratissimus</i> infusion or the standard antioxidants (Gallic acid and ascorbic acid). <i>C. gratissimus</i> displayed significantly high scavenging activity and ferric reducing capacity following DPPH and FRAP assays, respectively. It had no cytotoxic effect on Chang liver cells. <i>C. gratissimus</i> also significantly elevated the level of hepatic reduced glutathione (GSH), superoxide dismutase (SOD), and catalase activities as well as suppressed the malondialdehyde (MDA) level in oxidative hepatic injury. Liquid Chromatography-Mass Spectrometry (LC-MS) analysis of the herbal tea revealed the presence of 8-prenylnaringenin, flavonol 3-O-D-galactoside, caffeine, spirasine I, hypericin, pheophorbide-a, and 4-methylumbelliferone glucuronide. In silico oral toxicity prediction of the identified phytochemicals revealed no potential hepatotoxicity. Molecular docking revealed potent molecular interactions of the phytochemicals with SOD and catalase. The results suggest the hepatoprotective and antioxidative potentials of <i>C. gratissimus</i> herbal tea against oxidative hepatic injury.

Also flagged:Carboranesboronboron clusterscancerneutrondendrimers
Journal Article 2023-08-10 No Snippets Caminade AM, Milewski M, Hey-Hawkins E.
Show Full Abstract

The presence of a large number of boron atoms in boron clusters make them attractive tools for the treatment of cancer using boron neutron capture therapy (BNCT). Since the quantity of boron atoms present in the target cell directly affects the effectiveness of BNCT, the idea of gathering a high number of boron atoms in a single entity has emerged many years ago. In this perspective, using hyper-branched macromolecules such as dendrimers appears as an interesting solution. In this review, we will first present the synthesis of diverse dendritic entities (dendrimers, dendrons, and Janus dendrimers) that incorporate boron clusters, in particular carboranes, anywhere in their structure. Four parts of this review present the synthesis of dendrimers having boron clusters on the surface, or inside their structure, of dendrons and of Janus dendrimers, bearing boron clusters. Practically all these boronated dendritic structures were synthesized with the objective to study their biological properties, but in fact only a few of them have been tested against cancerous cells, and even a smaller number was tested in BNCT experiments. The biological experiments are discussed in the fifth part of this review. A good efficiency is generally observed with the boronated dendrimers, even in animal models, with an increase in their mean survival time (MST).

HTT
Also flagged:attention deficit/hyperactivity disorderADHDneurodevelopmental disorderssynaptosomal-associated protein 25SNAP-25Attention-deficit/hyperactivity disorder
Journal Article 2023-08-10 ✓ 3 Snippets Huang W, Fateh AA, Zhao Y, Zeng H, Yang B, Fang D, Zhang L, Meng X, Hassan M, Wen F.
In-Text Gene Mentions

Similarly, serotonin-related genes, such as the serotonin transporter (5-HTT) gene and the serotonin 2A receptor (HTR2A) gene, have also been examined, as imbalances in the serotonergic system are thought to contribute to ADHD (Oades, 2007).

…the serotonin transporter (5-HTT) gene and the…

…polymorphism of the5-HTTgene and the…

Show Full Abstract

<h4>Objectives</h4>Attention-deficit/hyperactivity disorder (ADHD) is one of the most widespread and highly heritable neurodevelopmental disorders affecting children worldwide. Although synaptosomal-associated protein 25 (SNAP-25) is a possible gene hypothesized to be associated with working memory deficits in ADHD, little is known about its specific impact on the hippocampus. The goal of the current study was to determine how variations in ADHD's SNAP-25 Mnll polymorphism (rs3746544) affect hippocampal functional connectivity (FC).<h4>Methods</h4>A total of 88 boys between the ages of 7 and 10 years were recruited for the study, including 60 patients with ADHD and 28 healthy controls (HCs). Data from resting-state functional magnetic resonance imaging (rs-fMRI) and clinical information were acquired and assessed. Two single nucleotide polymorphisms (SNP) in the SNAP-25 gene were genotyped, according to which the study's findings separated ADHD patients into two groups: TT homozygotes (TT = 35) and G-allele carriers (TG = 25).<h4>Results</h4>Based on the rs-fMRI data, the FC of the right hippocampus and left frontal gyrus was evaluated using group-based comparisons. The corresponding sensitivities and specificities were assessed. Following comparisons between the patient groups, different hippocampal FCs were identified. When compared to TT patients, children with TG had a lower FC between the right precuneus and the right hippocampus, and a higher FC between the right hippocampus and the left middle frontal gyrus.<h4>Conclusion</h4>The fundamental neurological pathways connecting the SNAP-25 Mnll polymorphism with ADHD via the FC of the hippocampus were newly revealed in this study. As a result, the hippocampal FC may further serve as an imaging biomarker for ADHD.

Also flagged:tetracyclinetuberculosisrifapentinemembranemineralbinding
Journal Article 2023-08-10 No Snippets Liang Q, Zhang P, Zhang L, Luan H, Li X, Xiang H, Jing S, Song X.
Show Full Abstract

<b>Background:</b> Since the poor response to existing anti-tuberculosis drugs and low drug concentration in local bone tissues, the traditional drug therapy does not result in satisfactory treatment of osteoarticular tuberculosis. Thus, we report a rifapentine release system with imparted bone targeting potential using tetracycline (TC) -modified nanoparticles (NPs). <b>Methods:</b> TC was conjugated to PLGA-PEG copolymer via a DCC/NHS technique. Rifapentine-loaded NPs were prepared by premix membrane emulsification technique. The resulting NPs were characterized in terms of physicochemical characterization, hemolytic study, cytotoxicity, bone mineral binding ability, <i>in vitro</i> drug release, stability test and antitubercular activity. The pharmacokinetic and biodistribution studies were also performed in mice. <b>Results:</b> Rifapentine loaded TC-PLGA-PEG NPs were proved to be 48.8 nm in size with encapsulation efficiency and drug loading of 83.3% ± 5.5% and 8.1% ± 0.4%, respectively. The release of rifapentine from NPs could be maintained for more than 60 h. Most (68.0%) TC-PLGA-PEG NPs could bind to HAp powder <i>in vitro</i>. The cellular studies revealed that NPs were safe for intravenous administration. <i>In vivo</i> evaluations also revealed that the drug concentration of bone tissue in TC-PLGA-PEG group was significantly higher than that in other groups at all time (<i>p</i> < 0.05). Both NPs could improve pharmacokinetic parameters without evident organ toxicity. The minimal inhibitory concentration of NPs was 0.094 μg/mL, whereas this of free rifapentine was 0.25 μg/mL. <b>Conclusion:</b> Rifapentine loaded TC-PLGA-PEG NPs could increase the amount of rifapentine in bone tissue, prolong drug release in systemic circulation, enhance anti-tuberculosis activity, and thereby reducing dose and frequency of drug therapy for osteoarticular tuberculosis.

Also flagged:Synthesis5-Fluorouracilmagnesiumhydroxyapatite-cyclodextrincolorectal cancer
Journal Article 2023-08-10 No Snippets Abukhadra MR, Okasha AT, Al Othman SI, Alfassam HE, Alenazi NA, AlHammadi AA, Allam AA.
Show Full Abstract

An advanced form of magnesium-doped hydroxyapatite (Mg·HAP) was integrated in composite with β-cyclodextrin producing a safe biocomposite (β-CD/HAP) as an enhanced delivery structure of traditional 5-fluorouracil (5-FU) chemotherapy during the treatment stages of colorectal cancer cells. The qualifications of β-CD/HAP as a carrier for 5-FU were followed based on the loading, release, and cytotoxicity as compared to Mg·HAP. β-CD/HAP composite exhibits notably higher 5-FU encapsulation capacity (272.3 mg/g) than Mg·HAP phase (164.9 mg/g). The 5-FU encapsulation processes into β-CD/HAP display the isotherm behavior of the Freundlich model (<i>R</i><sup>2</sup> = 0.99) and kinetic assumptions of pseudo-first order kinetic (<i>R</i><sup>2</sup> > 0.95). The steric studies reflect a strong increment in the quantities of the free sites after the β-CD integration steps (Nm = 61.2 mg/g) as compared to pure Mg·HAP (Nm = 42.4 mg/g). Also, the capacity of each site was enhanced to be loaded by 5 of 5-FU molecules (<i>n</i> = 4.45) in a vertical orientation. The 5-FU encapsulation energy into β-CD/HAP (<40 kJ/mol) reflects physical encapsulation reactions involving van der Waals forces and hydrogen bonding. The 5-FU release profiles of β-CD/HAP exhibit slow and controlled properties for about 80 h either in gastric fluid (pH 1.2) or in intestinal fluid (pH 7.4). The release kinetics and diffusion exponent (>0.45) signify non-Fickian transport and complex erosion/diffusion release mechanism. The free β-CD/HAP particles display a considerable cytotoxic effect on the HCT-116 cancer cells (33.62% cell viability) and its 5-FU-loaded product shows a strong cytotoxic effect (2.91% cell viability).

HTT
Also flagged:HDRas homolog enriched in the striatumGTP-binding proteindopamineautophagyCas9
Journal Article 2023-08-10 ✓ 5 Snippets Pan Y, Tang B, Li XJ, Li S, Liu Q.
In-Text Gene Mentions

Huntington’s disease (HD) is a neurodegenerative disorder caused by the expansion of CAG trinucleotide repeats in the Huntingtin (HTT) gene (The Huntington’s Disease Collaborative Research Group, 1993; Ross and Tabrizi, 2011).

Selective neurodegeneration in the striatum is prominent in HD, despite widespread expression of mutant HTT (mHTT).

The use of different mouse models with varying genetic backgrounds, transgenic or knock-in models, and different HTT constructs (exon1 or full-length) may contribute to the discrepancies observed in previous studies regarding the role of Rhes in HD.

…expression of mutantHTT(mHTT).…

…in the Huntingtin (HTT) gene ( The…

Show Full Abstract

<h4>Introduction</h4>Huntington's disease (HD) is caused by CAG trinucleotide repeats in the HTT gene. Selective neurodegeneration in the striatum is prominent in HD, despite widespread expression of mutant HTT (mHTT). Ras homolog enriched in the striatum (Rhes) is a GTP-binding protein enriched in the striatum, involved in dopamine-related behaviors and autophagy regulation. Growing evidence suggests Rhes plays a critical role in the selective striatal degeneration in HD, but its specific function in this context remains complex and controversial.<h4>Methods</h4>In this study, we utilized CRISPR/Cas9 to knockdown Rhes at different disease stages through adeno-associated virus (AAV) transduction in HD knock-in (KI) mice. Immunoblotting and immunofluorescence were employed to assess the impact of Rhes depletion on mHTT levels, neuronal loss, astrogliosis and autophagy activity.<h4>Results</h4>Rhes depletion in 22-week-old HD KI mice (representing the presymptomatic stage) led to mHTT accumulation, reduced neuronal cell staining, and increased astrogliosis. However, no such effects were observed in 36-week-old HD KI mice (representing the symptomatic stage). Additionally, Rhes deletion in 22-week-old HD KI mice resulted in increased P62 levels, reduced LC3-II levels, and unchanged phosphorylation of mTOR and beclin-1, unchanged mTOR protein level, except for a decrease in beclin-1.<h4>Discussion</h4>Our findings suggest that knockdown Rhes promotes striatal aggregation of mutant huntingtin by reducing autophagy activity in a mTOR-independent manner. Rhes plays a protective role during the presymptomatic stage of HD KI mice.

NEGR1
Also flagged:gene expressioncell-cycleccRCCIFN-βISG15IFIT1
Journal Article 2023-08-10 ✓ 1 Snippet Wang L, Nie R, Zhang Z, Gu W, Wang S, Wang A, Zhang J, Cai J.
In-Text Gene Mentions

…NRXN1 35 andNEGR1, 37 this…

Show Full Abstract

Multiple-source single-cell datasets have accumulated quickly and need computational methods to integrate and decompose into meaningful components. Here, we present inClust (integrated clustering), a flexible deep generative framework that enables embedding auxiliary information, latent space vector arithmetic, and clustering. All functional parts are relatively modular, independent in implementation but interrelated at runtime, resulting in an all-in general framework that could work in supervised, semi-supervised, or unsupervised mode. We show that inClust is superior to most data integration methods in benchmark datasets. Then, we demonstrate the capability of inClust in the tasks of conditional out-of-distribution generation in supervised mode, label transfer in semi-supervised mode, and spatial domain identification in unsupervised mode. In these examples, inClust could accurately express the effect of each covariate, distinguish the query-specific cell types, or segment spatial domains. The results support that inClust is an excellent general framework for multiple-task harmonization and data decomposition.

HFE
Also flagged:ChronicCPpathogenesisobesityarthritisdiabetes mellitus
Journal Article 2023-08-10 ✓ 1 Snippet Hébert HL, Pascal MMV, Smith BH, Wynick D, Bennett DLH.
In-Text Gene Mentions

Homozygote HFE C282Y mutations (which is associated with excessive iron absorption) associated with CP in older men. HFE C282Y associated with knee, hip, and back pain in older women

Show Full Abstract

Chronic pain (CP) is a common and often debilitating disorder that has major social and economic impacts. A subset of patients develop CP that significantly interferes with their activities of daily living and requires a high level of healthcare support. The challenge for treating physicians is in preventing the onset of refractory CP or effectively managing existing pain. To be able to do this, it is necessary to understand the risk factors, both genetic and environmental, for the onset of CP and response to treatment, as well as the pathogenesis of the disorder, which is highly heterogenous. However, studies of CP, particularly pain with neuropathic characteristics, have been hindered by a lack of consensus on phenotyping and data collection, making comparisons difficult. Furthermore, existing cohorts have suffered from small sample sizes meaning that analyses, especially genome-wide association studies, are insufficiently powered. The key to overcoming these issues is through the creation of large consortia such as DOLORisk and PAINSTORM and biorepositories, such as UK Biobank, where a common approach can be taken to CP phenotyping, which allows harmonisation across different cohorts and in turn increased study power. This review describes the approach that was used for studying neuropathic pain in DOLORisk and how this has informed current projects such as PAINSTORM, the rephenotyping of UK Biobank, and other endeavours. Moreover, an overview is provided of the outputs from these studies and the lessons learnt for future projects.

Research Square 2023-08-10 Preprint (No Snippets API) Luo T, Wu Y, Chen Z, Tai Y, Zhang F, Chen W, Lei K, Zhou Q.
Show Full Abstract

<h4>Background: </h4> As a member of the Tumor Necrosis Factor (TNF) family, Tumor Necrosis Factor Superfamily 4 ( TNFSF4 ) participated in various immune-related processes. Nevertheless, much is yet to be elucidated regarding the biological function of TNFSF4 in pan-cancer. Methods RNA-seq and corresponding clinical variables were gained from the Cancer Genome Atlas (TCGA). Immunotherapy cohorts were retrieved and downloaded from Gene Expression Omnibus (GEO). Tumor Immune Estimation Resource (TIMER) was used to evaluate tumor-infiltrating immune cell level in tumors. The Tumor Immune Single-cell Hub 2 (TISCH2) database was utilized to examine the expression of TNFSF4 across various tumor cell subsets. Gene Set Enrichment Analysis (GSEA) was utilized to explore related signaling pathways of TNFSF4 . Results We utilized bioinformatic methods to analyze the TNFSF4 across TCGA cancers and found that TNFSF4 expression was highly increased in cancers compared to normal tissues. Further immunohistochemistry staining of multiple tumors validated this finding. Univariate Cox regression and survival analyses revealed that TNFSF4 served as a risk factor for a majority of cancer. Furthermore, TNFSF4 expression increased with the progression of tumor stage in multiple cancers. In the two immunotherapy cohorts from the GEO database, the proportion of PR/CR patients was higher in the TNFSF4 low-expression group. Through integrating single-cell data from the TISCH database, we found that TNFSF4 expression was predominantly observed in proliferative T cells and exhausted T cells. Correlation analysis demonstrated that TNFSF4 was positively associated with a range of immunomodulatory genes. Ultimately, analysis of GSEA revealed that TNFSF4 was related to immune response and EMT pathways. Conclusions We identified the function of TNFSF4 as a valuable molecule for cancer, and its capacity to predict response of immunotherapy. Importantly, our work revealed a robust association between TNFSF4 and exhausted T cells within the tumor microenvironment, which indicated TNFSF4 may be a promising biomarker for cancer treatment.

DCC
Also flagged:sugarcyclodextrinlidocaineosteoarthritisHMGB1TLR4
Journal Article 2023-08-09 ✓ 1 Snippet Xu W, Xiao Y, Zhao M, Zhu J, Wang Y, Wang W, Wang P, Meng H.
In-Text Gene Mentions

…Eight‐week‐old femaleC57BL/six micemice were used…

Show Full Abstract

A nano-enabled drug delivery acupuncture technology (nd-Acu) is developed that is based on traditional acupuncture needles where the stainless-steel surface is designed to deliver various payload molecules. To create the nd-Acu platform, an electrochemistry procedure is used to attach methyl salicylate-modified cyclodextrin in which the sugar rings allow the encapsulation of structurally defined single or multiple payload molecules via an inclusion complexation process. Drug loading and release profile are first studied using fluorescent dyes abiotically and at intact animal level. nd-Acu allows more efficient dye loading and time-dependent release compared to pristine needles without cyclodextrin modification. Subsequently, a proof-of-principle efficacy study is conducted using the platform to load a local anesthetic, lidocaine, for the treatment of knee osteoarthritis (KOA) in mice. It is demonstrated that lidocaine-laden nd-Acu can effectively alleviate pain, reduce inflammation, and slow down KOA development biochemically and histologically. Hypothesis-driven and proteomic approaches are utilized to investigate the working mechanisms of lidocaine nd-Acu, indicating that the therapeutic outcome is attributed to the in vivo modulation of the HMGB1/TLR4 signaling pathway. The study also obtained preliminary evidence suggesting the involvement of mitochondria as well as small GTPase such as cdc42 during the treatment by lidocaine nd-Acu.

Also flagged:ubiquitinpathogenesispost‐translationalhostcelltranslational
Journal Article 2023-08-09 No Snippets Roberts CG, Franklin TG, Pruneda JN.
Show Full Abstract

Regulation through post-translational ubiquitin signaling underlies a large portion of eukaryotic biology. This has not gone unnoticed by invading pathogens, many of which have evolved mechanisms to manipulate or subvert the host ubiquitin system. Bacteria are particularly adept at this and rely heavily upon ubiquitin-targeted virulence factors for invasion and replication. Despite lacking a conventional ubiquitin system of their own, many bacterial ubiquitin regulators loosely follow the structural and mechanistic rules established by eukaryotic ubiquitin machinery. Others completely break these rules and have evolved novel structural folds, exhibit distinct mechanisms of regulation, or catalyze foreign ubiquitin modifications. Studying these interactions can not only reveal important aspects of bacterial pathogenesis but also shed light on unexplored areas of ubiquitin signaling and regulation. In this review, we discuss the methods by which bacteria manipulate host ubiquitin and highlight aspects that follow or break the rules of ubiquitination.

DCC
Also flagged:cytoplasmicdendritecytoskeletonDendrite morphogenesismembraneextracellular
Journal Article 2023-08-09 ✓ 1 Snippet Kramer DA, Narvaez-Ortiz HY, Patel U, Shi R, Shen K, Nolen BJ, Roche J, Chen B.
In-Text Gene Mentions

…as SYG-1, Robo,DCC, Neogenin, TMEM132, neuroligi…

Show Full Abstract

Dendrite morphogenesis is essential for neural circuit formation, yet the molecular mechanisms underlying complex dendrite branching remain elusive. Previous studies on the highly branched <i>Caenorhabditis elegans</i> PVD sensory neuron identified a membrane co-receptor complex that links extracellular signals to intracellular actin remodeling machinery, promoting high-order dendrite branching. In this complex, the claudin-like transmembrane protein HPO-30 recruits the WAVE regulatory complex (WRC) to dendrite branching sites, stimulating the Arp2/3 complex to polymerize actin. We report here our biochemical and structural analysis of this interaction, revealing that the intracellular domain (ICD) of HPO-30 is intrinsically disordered and employs two distinct mechanisms to regulate the actin cytoskeleton. First, HPO-30 ICD binding to the WRC requires dimerization and involves the entire ICD sequence, rather than a short linear peptide motif. This interaction enhances WRC activation by the GTPase Rac1. Second, HPO-30 ICD directly binds to the sides and barbed end of actin filaments. Binding to the barbed end requires ICD dimerization and inhibits both actin polymerization and depolymerization, resembling the actin capping protein CapZ. These dual functions provide an intriguing model of how membrane proteins can integrate distinct mechanisms to fine-tune local actin dynamics.

PTGIS
Also flagged:endometriosistranscription factorTFrofecoxibretinoic acidGene Expression
Journal Article 2023-08-09 ✓ 2 Snippets Hosseini M, Hammami B, Kazemi M.
In-Text Gene Mentions

…NFASC , andPTGIS) that its…

PTGIS

Show Full Abstract

<h4>Purpose</h4>Endometriosis (EMs) is a major gynecological condition in women. Due to the absence of definitive symptoms, its early detection is very challenging; thus, it is crucial to find biomarkers to ease its diagnosis and therapy. Here, we aimed to identify potential diagnostic and therapeutic targets for EMs by constructing a regulatory network and using machine learning approaches.<h4>Methods</h4>Three Gene Expression Omnibus (GEO) datasets were merged, and differentially expressed genes (DEGS) were identified after preprocessing steps. Using the DEGs, a transcription factor (TF)-mRNA-miRNA regulatory network was constructed, and hub genes were detected based on four different algorithms in CytoHubba. The hub genes were used to build a GaussianNB diagnostic model and also in docking analysis that were performed using Discovery Studio and AutoDock Vina software.<h4>Results</h4>A total of 119 DEGs were identified between EMs and non-EMs samples. A regulatory network consisting of 52 mRNAs, 249 miRNAs, and 37 TFs was then constructed. The diagnostic model was introduced using the hub genes selected from the network (GATA6, HMOX1, HS3ST1, NFASC, and PTGIS) that its area under the curve (AUC) was 0.98 and 0.92 in the training and validation cohorts, respectively. Based on docking analysis, two chemical compounds, rofecoxib and retinoic acid, had potential therapeutic effects on EMs.<h4>Conclusion</h4>In conclusion, this study identified potential diagnostic and therapeutic targets for EMs which demand more experimental confirmations.

Also flagged:juvenile-onset systemic lupus erythematosusSystemic lupus erythematosusSLEinflammatory diseasejuvenile-onset SLEjSLE
Journal Article 2023-08-09 No Snippets Natoli V, Charras A, Hahn G, Hedrich CM.
Show Full Abstract

Systemic lupus erythematosus (SLE) is a rare autoimmune/inflammatory disease with significant morbidity and mortality. Approximately 15-20% of SLE patients develop the disease during childhood or adolescence (juvenile-onset SLE/jSLE). Patients with jSLE exhibit more variable and severe disease when compared to patients with disease-onset during adulthood. Neuropsychiatric (NP) involvement is a clinically heterogenous and potentially severe complication. Published reports on the incidence and prevalence of NP-jSLE are scarce, and the exact pathophysiology is poorly understood.This manuscript provides a review of the existing literature, suggesting NP involvement in 13.5-51% of jSLE patients. Among patients with NP-jSLE affecting the CNS, we propose two main subgroups: (i) a chronic progressive, predominantly type 1 interferon-driven form that poorly responds to currently used treatments, and (ii) an acutely aggressive form that usually presents early during the disease that may be primarily mediated by auto-reactive effector lymphocytes. While this hypothesis requires to be tested in large collaborative international cohort studies, it may offer future patient stratification and individualised care.

HFE
Also flagged:Sickle Cell Anemiabeta globinbiliary obstructionhematomasickle hepatic crisisvaso-occlusive crisis
Journal Article 2023-08-09 ✓ 1 Snippet Vadlapudi SS, Srivastava A, Rai P, Singh RK, Sarma MS, Poddar U, Yadav RR.
In-Text Gene Mentions

…viral hepatitis andhemochromatosisdue to multiple…

Show Full Abstract

Sickle cell anemia (SCA) is an autosomal recessive disorder caused by a mutation in beta globin gene. Hepatobiliary system is affected in 10-40% of patients with SCA and has a multifactorial etiology. The authors present a child with SCA and conjugated hyperbilirubinemia due to biliary obstruction. He underwent endoscopic retrograde cholangiopancreatography (ERCP) and biliary stenting, had complications of post sphincterotomy bleed, retroperitoneal hematoma and post laparoscopic cholecystectomy sepsis with acute sickle hepatic crisis. He was managed successfully and is doing well on follow-up. Here authors discuss a stepwise approach in management of jaundice in a patient with SCA. Patients with SCA are prone to develop vaso-occlusive crisis (VOC) during periods of stress. VOC affects the liver as acute sickle hepatic crisis, acute hepatic sequestration or sickle cell intrahepatic cholestasis and is collectively termed as sickle cell hepatopathy. Hemolysis due to sickling results in cholelithiasis with its associated complications. These patients are vulnerable to viral hepatitis and hemochromatosis due to multiple blood transfusions. There may be a concomitant acute viral hepatitis, drug induced liver injury, Budd-Chiari syndrome or other chronic liver diseases. These conditions have considerable clinical overlap and may coexist, making the evaluation more challenging. Detailed history, examination and investigations are required for differentiation of etiology. Periods of stress must be tackled with proper hydration, oxygen supplementation, maintaining hemoglobin >10 g/dL, and a low hemoglobin S fraction. Patients with SCA and conjugated hyperbilirubinemia are "high-risk" and best managed by a multidisciplinary team. Preventive strategies like timely vaccinations, chelation, etc. must be practised.

PRDX6
Also flagged:Peroxiredoxin 6A1Amyotrophic Lateral SclerosisALSneurodegenerative diseasesecretion
Journal Article 2023-08-09 ✓ 5 Snippets Yamamuro-Tanabe A, Mukai Y, Kojima W, Zheng S, Matsumoto N, Takada S, Mizuhara M, Kosuge Y, Ishimaru Y, Yoshioka Y.
In-Text Gene Mentions

In this study, we observed that the expression of peroxiredoxin 6 (PRDX6), a member of the peroxiredoxin family, was markedly upregulated in astrocytes of the lumbar spinal cord of SOD1<sup>G93A</sup> mice model for ALS.

Our results suggest that the expression of PRDX6 in astrocytes plays an important role in the induction of A1 astrocytes and expression of inflammatory cytokines in the ALS mice model.

…of peroxiredoxin 6 (PRDX6), a member of…

…Additionally, whenPRDX6was transiently transfected…

…cells stably expressingPRDX6, and the increased…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a severe neurodegenerative disease with selective degeneration of motor neurons. It has been reported that an increase in the levels of inflammatory cytokines and glial cells such as reactive astrocytes is closely involved in the pathological progression of ALS. Recently, the levels of neuropathic cytotoxic (A1) astrocytes among reactive astrocytes have reportedly increased in the central nervous system of ALS mice, which induce motor neuron degeneration through the production of inflammatory cytokines and secretion of neuropathic factors. Hence, elucidating the induction mechanism of A1 astrocytes in ALS is important to understand the mechanism of disease progression in ALS. In this study, we observed that the expression of peroxiredoxin 6 (PRDX6), a member of the peroxiredoxin family, was markedly upregulated in astrocytes of the lumbar spinal cord of SOD1<sup>G93A</sup> mice model for ALS. Additionally, when PRDX6 was transiently transfected into the mouse astrocyte cell line C8-D1A and human astrocytoma cell line U-251 MG, the mRNA expression of complement C3 (a marker for A1 astrocyte phenotype) and inflammatory cytokines was increased. Furthermore, the mRNA expression of C3 and inflammatory cytokine was increased in C8-D1A and U-251 MG cells stably expressing PRDX6, and the increased mRNA expression was significantly suppressed by MJ33 (lithium[1-hexadecoxy-3-(2,2,2-trifluoroethoxy) propan-2-yl] methyl phosphate), an inhibitor of the phospholipase A<sub>2</sub> activity of PRDX6. Our results suggest that the expression of PRDX6 in astrocytes plays an important role in the induction of A1 astrocytes and expression of inflammatory cytokines in the ALS mice model.

CCDC92
Also flagged:tumortumorsBRCAbreast cancerGene expressioncancer
Journal Article 2023-08-09 ✓ 1 Snippet Wang Y, Wang Y, Zhou J, Ying P, Wang Z, Wu Y, Hao M, Qiu S, Jin H, Wang X.
In-Text Gene Mentions

CCDC92

Show Full Abstract

<h4>Purpose</h4>Breast cancer (BRCA) is a prevalent tumor worldwide. The association between the coiled-coil domain-containing (CCDC) protein family and different tumors has been established. However, the prognostic significance of this protein family in breast cancer remains uncertain.<h4>Methods</h4>Gene expression and clinical data were obtained from the TCGA, METABRIC, and GEO databases. Prognosis genes were identified using univariate Cox and LASSO Cox regression, leading to the establishment of a prognostic signature. Subsequently, the risk model was conducted based on survival and clinical feature analyses, and a nomogram for prognosis prediction was developed. Furthermore, analyses of biological function, immune characteristics, and drug sensitivity were performed. Finally, single-cell sequencing data were utilized to uncover the expression patterns of genes in the risk model.<h4>Results</h4>Five genes were identified and utilized for risk modeling. The model demonstrated excellent prognostic value as indicated by ROC and Kaplan-Meier analysis. The high-risk group exhibited shorter survival time and higher likelihood of recurrence. Functional annotation indicated a correlation between the risk score and immune pathways. Conversely, the low-risk group displayed a greater enrichment in immune pathways and exhibited more active immune microenvironment characteristics. Additionally, drug sensitivity analysis using both public and our sequencing data revealed that the risk model possessed a broad range of predictive values.<h4>Conclusions</h4>We have developed a gene signature and have verified that patients with low-risk are more likely to have better prognosis and respond positively to therapy. This finding offers a valuable point of reference for BRCA individualized treatment.

HTT
Also flagged:serotonin transporterdepressionmental health disorderspsychiatric disordersimpairmentSLC6A4
Journal Article 2023-08-09 ✓ 3 Snippets Simonyte S, Grabauskyte I, Macijauskiene J, Lesauskaite V, Lesauskaite V, Kvaal KS, Stewart R.
In-Text Gene Mentions

5-HTT is a main regulator of serotonergic neurotransmission and is a target of the widely used pharmacological treatment such as selective serotonin reuptake inhibitors (SSRIs).

…the serotonin transporter (5-HTT) encoding gene (…

5-HTTis a main…

Show Full Abstract

Late-life depression (LLD) is a multifactorial disorder, with susceptibility and vulnerability potentially influenced by gene-environment interaction. The aim of this study was to investigate whether the 5-HTTLPR polymorphism is associated with LLD. The sample of 353 participants aged 65 years and over was randomly selected from the list of Kaunas city inhabitants by Residents' Register Service of Lithuania. Depressive symptoms were ascertained using the EURO-D scale. The List of Threatening Events Questionnaire was used to identify stressful life events that happened over the last 6 months and during lifetime. A 5-HTTLPR and lifetime stressful events interaction was indicated by higher odds of depression in those with s/s genotype who experienced high stress compared to l/l carriers with low or medium stress, while 5-HTTLPR and current stressful events interaction analysis revealed that carriers of either one or two copies of the s allele had increased odds of depressive symptoms associated with stress compared to participants with the l/l genotype not exposed to stressful situations. Although no significant direct association was found between the 5-HTTLPR short allele and depression, our findings demonstrated that lifetime or current stressful life events and their modification by 5-HTTLPR genotype are risk factors for late-life depression.

TNFSF4
Also flagged:lung adenocarcinomaCENPOcentromereLUADCell proliferationcancers
Journal Article 2023-08-09 ✓ 2 Snippets Wang Y, Ye D, Li Y, Lv F, Shen W, Li H, Tian L, Fan Z, Li Y, Wang Y, Li F, Chen Y.
In-Text Gene Mentions

…as CD276, CD274,TNFSF4, TNFRSF9, and LAG3.…

…immune checkpoint CD276,TNFSF4, TNFSF9, CD247, and…

Show Full Abstract

<h4>Background</h4>The centromere protein O (CENPO) is an important member of the centromere protein family. However, the role of CENPO in pan-cancer and immune infiltration has not been reported. Here, we investigated the role of CENPO in pan-cancer and further validated its role in lung adenocarcinoma (LUAD) by in vitro experiments.<h4>Method</h4>The UCSC Xena database and The Cancer Genome Atlas (TCGA)-LUAD data were used to assess the expression levels of CENPO. The potential value of CENPO as a diagnostic and prognostic biomarker for pan-cancer was evaluated using TCGA data and the GEPIA database. The -expression profiles of LUAD patients and the corresponding clinical data were downloaded for correlation analysis. The role of CENPO in immune infiltration was investigated using the UCSC Xena database. Subsequently, qRT-PCR was performed to detect the expression of CENPO. Cell proliferation, migration, and invasion were determined using CCK-8, wound-healing assay, and transwell assay, respectively.<h4>Results</h4>CENPO is highly expressed in most cancers, and the upregulation of CENPO is associated with poor prognosis in many cancers. CENPO expression correlates with age, TNM stage, N stage, T stage, and receipt of radiotherapy in LUAD patients, and LUAD patients with high CENPO expression have poorer overall survival (OS) and disease-free survival (DFS). In addition, CENPO expression is associated with immune cell infiltration and immune checkpoint inhibitors. Moreover, the expression of CENPO was closely related to the expression of tumor mutational load and microsatellite instability. In vitro experiments showed that CENPO expression was increased in LUAD cell lines and that knockdown of CENPO significantly inhibited the proliferation, cell invasion, and migration ability of LUAD cells.<h4>Conclusion</h4>CENPO may be a potential pan-cancer biomarker and oncogene, especially in LUAD. In addition, CENPO is associated with immune cell infiltration and may serve as a new molecular therapeutic target and effective prognostic marker for LUAD.

HFE
Also flagged:cancersolid tumorsironbreast cancerapoptosis-related proteinstumor
Journal Article 2023-08-09 ✓ 1 Snippet Menghini S, Vizovisek M, Enders J, Schuerle S.
In-Text Gene Mentions

…iron such ashemochromatosis[ 28 ,…

Show Full Abstract

The use of bacteria in cancer immunotherapy has the potential to bypass many shortcomings of conventional treatments. The ability of anaerobic bacteria to preferentially accumulate and replicate in hypoxic regions of solid tumors, as a consequence of bacterial metabolic needs, is particularly advantageous and key to boosting their immunostimulatory therapeutic actions in situ. While several of these bacterial traits are well-studied, little is known about their competition for nutrients and its effect on cancer cells which could serve as another potent and innate antineoplastic action. Here, we explored the consequences of the iron-scavenging abilities of a particular species of bacteria, Magnetospirillum magneticum, which has been studied as a potential new class of bacteria for magnetically targeted bacterial cancer therapy. We investigated their influence in hypoxic regions of solid tumors by studying the consequential metabolic effects exerted on cancer cells. To do so, we established an in vitro co-culture system consisting of the bacterial strain AMB-1 incubated under hypoxic conditions with human breast cancer cells MDA-MB-231. We first quantified the number of viable cells after incubation with magnetotactic bacteria demonstrating a lower rate of cellular proliferation that correlated with increasing bacteria-to-cancer cells ratio. Further experiments showed increasing populations of apoptotic cells when cancer cells were incubated with AMB-1 over a period of 24 h. Analysis of the metabolic effects induced by bacteria suggest an increase in the activation of executioner caspases as well as changes in levels of apoptosis-related proteins. Finally, the level of several human apoptosis-related proteins was investigated, confirming a bacteria-dependent triggering of apoptotic pathways in breast cancer cells. Overall, our findings support that magnetotactic bacteria could act as self-replicating iron-chelating agents and indicate that they interfere with proliferation and lead to increased apoptosis of cancer cells. This bacterial feature could serve as an additional antineoplastic mechanism to reinforce current bacterial cancer therapies.

DCC
Also flagged:tumourhead and neck squamous cell carcinomaHead and Neck cancersupper aero-digestive tract cancercancerssquamous
Journal Article 2023-08-09 ✓ 2 Snippets Huang X, Duijf PHG, Sriram S, Perera G, Vasani S, Kenny L, Leo P, Punyadeera C.
In-Text Gene Mentions

Mydlarz et al. detected EDNRB, p16 and DCC methylation by analyzing serum DNA from HNSCC patients and revealed that serum EDNRB hypermethylation was highly specific for HNSCC but it was not sensitive [102].

…, p16 andDCCmethylation by analyzing…

Show Full Abstract

Head and Neck cancers (HNC) are a heterogeneous group of upper aero-digestive tract cancer and account for 931,922 new cases and 467,125 deaths worldwide. About 90% of these cancers are of squamous cell origin (HNSCC). HNSCC is associated with excessive tobacco and alcohol consumption and infection with oncogenic viruses. Genotyping tumour tissue to guide clinical decision-making is becoming common practice in modern oncology, but in the management of patients with HNSCC, cytopathology or histopathology of tumour tissue remains the mainstream for diagnosis and treatment planning. Due to tumour heterogeneity and the lack of access to tumour due to its anatomical location, alternative methods to evaluate tumour activities are urgently needed. Liquid biopsy approaches can overcome issues such as tumour heterogeneity, which is associated with the analysis of small tissue biopsy. In addition, liquid biopsy offers repeat biopsy sampling, even for patients with tumours with access limitations. Liquid biopsy refers to biomarkers found in body fluids, traditionally blood, that can be sampled to provide clinically valuable information on both the patient and their underlying malignancy. To date, the majority of liquid biopsy research has focused on blood-based biomarkers, such as circulating tumour DNA (ctDNA), circulating tumour cells (CTCs), and circulating microRNA. In this review, we will focus on ctDNA as a biomarker in HNSCC because of its robustness, its presence in many body fluids, adaptability to existing clinical laboratory-based technology platforms, and ease of collection and transportation. We will discuss mechanisms of ctDNA release into circulation, technological advances in the analysis of ctDNA, ctDNA as a biomarker in HNSCC management, and some of the challenges associated with translating ctDNA into clinical and future perspectives. ctDNA provides a minimally invasive method for HNSCC prognosis and disease surveillance and will pave the way in the future for personalized medicine, thereby significantly improving outcomes and reducing healthcare costs.

Also flagged:neurodevelopmental disordersmonoamineserotoninaxon guidanceautism spectrum disorderpolybrominated diphenyl ethers
Journal Article 2023-08-09 No Snippets Marinello WP, Gillera SEA, Han Y, Richardson JR, St Armour G, Horman BM, Patisaul HB.
Show Full Abstract

Gestational flame retardant (FR) exposure has been linked to heightened risk of neurodevelopmental disorders, but the mechanisms remain largely unknown. Historically, toxicologists have relied on traditional, inbred rodent models, yet those do not always best model human vulnerability or biological systems, especially social systems. Here we used prairie voles (Microtus ochrogaster), a monogamous and bi-parental rodent, leveraged for decades to decipher the underpinnings of social behaviors, to examine the impact of fetal FR exposure on gene targets in the mid-gestational placenta and fetal brain. We previously established gestational exposure to the commercial mixture Firemaster 550 (FM 550) impairs sociality, particularly in males. FM 550 exposure disrupted placental monoamine production, particularly serotonin, and genes required for axon guidance and cellular respiration in the fetal brains. Effects were dose and sex specific. These data provide insights on the mechanisms by which FRs impair neurodevelopment and later in life social behaviors.

HFE
Also flagged:HydrazidehydrazonesSchiff basehydrazonetyrosinasecholinesterase
Journal Article 2023-08-09 ✓ 1 Snippet Rupa SA, Patwary MAM, Ghann WE, Abdullahi A, Uddin AKMR, Mahmud MM, Haque MA, Uddin J, Kazi M.
In-Text Gene Mentions

…resulting in anemia,hemochromatosis, liver/kidney damage, diabete…

Show Full Abstract

Hydrazone-hydrazide-based linkers perform a crucial role in environmental as well as biological fields. Such linkers are employed to detect exact metal ions at a minute level; hence, numerous probes are available. Even though thiophene-based molecules have a unique position in the medicinal arena, only very few chemosensors are reported based on such a moiety. In this current work, a novel hydrazide-hydrazone-based fluorogenic molecule 5-bromo-2-hydroxy-<i>N</i>'-[(1<i>E</i>)-1-(thiophen-2-yl)ethylidene]benzohydrazide (L) has been successfully designed and synthesized. The sensing studies of L demonstrated a ratio metric as well as turn-on-enhanced fluorescence and colorimetric response toward Fe<sup>3+</sup> and Cu<sup>2+</sup> ions, respectively and it was observed to be insensitive toward various metal ions. The Job plots revealed that the binding stoichiometry of L and metal ions is 2 : 1. In addition, density functional theory (DFT) results strongly suggested that L can be used as a powerful colorimetric sensor for the detection of Cu<sup>2+</sup> ions. <i>In vitro</i> antimicrobial activities of L were evaluated by disk diffusion and results revealed good antibacterial activities against <i>E. coli</i>. Further, molecular docking was executed with DNA gyrase (PDB ID: 1KZN) of <i>E. coli</i> and the calculated interaction energy value was found to be -7.7 kcal mol<sup>-1</sup>. Finally, molecular docking, fluorescence, colorimetry and the HOMO-LUMO energy gap of the compound can provide new insights into developing drugs and detecting metals in biomolecules.

HFE
Also flagged:liver diseasepathogenesischolestasishepatic steatosisgenetic diseaseshepatitis B
Journal Article 2023-08-09 ✓ 2 Snippets Zheng M, Hakim A, Konkwo C, Deaton AM, Ward LD, Alnylam Human Genetics, Silveira MG, Assis DN, Liapakis A, Jaffe A, Jiang ZG, Curry MP, Lai M, Cho MH, Dykas D, Bale A, Mistry PK, Vilarinho S.
In-Text Gene Mentions

…a patient with non-HFEiron overload…

…two most commonHFEvariants, and he…

Show Full Abstract

<h4>Background</h4>Whole-exome sequencing (WES) is an effective tool for diagnosis in patients who remain undiagnosed despite a comprehensive clinical work-up. While WES is being used increasingly in pediatrics and oncology, it remains underutilized in non-oncological adult medicine, including in patients with liver disease, in part based on the faulty premise that adults are unlikely to harbor rare genetic variants with large effect size. Here, we aim to assess the burden of rare genetic variants underlying liver disease in adults at two major tertiary referral academic medical centers.<h4>Methods</h4>WES analysis paired with comprehensive clinical evaluation was performed in fifty-two adult patients with liver disease of unknown etiology evaluated at two US tertiary academic health care centers.<h4>Findings</h4>Exome analysis uncovered a definitive or presumed diagnosis in 33% of patients (17/52) providing insight into their disease pathogenesis, with most of these patients (12/17) not having a known family history of liver disease. Our data shows that over two-thirds of undiagnosed liver disease patients attaining a genetic diagnosis were being evaluated for cholestasis or hepatic steatosis of unknown etiology.<h4>Interpretation</h4>This study reveals an underappreciated incidence and spectrum of genetic diseases presenting in adulthood and underscores the clinical value of incorporating exome sequencing in the evaluation and management of adults with liver disease of unknown etiology.<h4>Funding</h4>S.V. is supported by the NIH/NIDDK (K08 DK113109 and R01 DK131033-01A1) and the Doris Duke Charitable Foundation Grant #2019081. This work was supported in part by NIH-funded Yale Liver Center, P30 DK34989.

Also flagged:16S rRNAPCoAZapAZapA-sfGFPHupBftsZ
Journal Article 2023-08-09 No Snippets Umeda S, Sujino T, Miyamoto K, Yoshimatsu Y, Harada Y, Nishiyama K, Aoto Y, Adachi K, Hayashi N, Amafuji K, Moritoki N, Shibata S, Sasaki N, Mita M, Tanemoto S, Ono K, Mikami Y, Sasabe J, Takabayashi K, Hosoe N, Suzuki T, Sato T, Atarashi K, Teratani T, Ogata H, Nakamoto N, Shiomi D, Ashida H, Kanai T.
Show Full Abstract

<h4>Background & aims</h4>D-amino acids, the chiral counterparts of protein L-amino acids, were primarily produced and utilized by microbes, including those in the human gut. However, little was known about how orally administered or microbe-derived D-amino acids affected the gut microbial community or gut disease progression.<h4>Methods</h4>The ratio of D- to L-amino acids was analyzed in feces and blood from patients with ulcerative colitis (UC) and healthy controls. Also, composition of microbe was analyzed from patients with UC. Mice were treated with D-amino acid in dextran sulfate sodium colitis model and liver cholangitis model.<h4>Results</h4>The ratio of D- to L-amino acids was lower in the feces of patients with UC than that of healthy controls. Supplementation of D-amino acids ameliorated UC-related experimental colitis and liver cholangitis by inhibiting growth of Proteobacteria. Addition of D-alanine, a major building block for bacterial cell wall formation, to culture medium inhibited expression of the ftsZ gene required for cell fission in the Proteobacteria Escherichia coli and Klebsiella pneumoniae, thereby inhibiting growth. Overexpression of ftsZ restored growth of E. coli even when D-alanine was present. We found that D-alanine not only inhibited invasion of pathological K. pneumoniae into the host via pore formation in intestinal epithelial cells but also inhibited growth of E. coli and generation of antibiotic-resistant strains.<h4>Conclusions</h4>D-amino acids might have potential for use in novel therapeutic approaches targeting Proteobacteria-associated dysbiosis and antibiotic-resistant bacterial diseases by means of their effects on the intestinal microbiota community.

Also flagged:transcriptional coactivatorsWntGPCRestrogenmetabolismTAZ
Journal Article 2023-08-09 No Snippets Wei Y, Hui VLZ, Chen Y, Han R, Han X, Guo Y.
Show Full Abstract

The Yes-associated protein and its transcriptional coactivator with PDZ-binding motif (YAP/TAZ) are two homologous transcriptional coactivators that lie at the center of a key regulatory network of Hippo, Wnt, GPCR, estrogen, mechanical, and metabolism signaling. YAP/TAZ influences the expressions of downstream genes and proteins as well as enzyme activity in metabolic cycles, cell proliferation, inflammatory factor expression, and the transdifferentiation of fibroblasts into myofibroblasts. YAP/TAZ can also be regulated through epigenetic regulation and posttranslational modifications. Consequently, the regulatory function of these mechanisms implicates YAP/TAZ in the pathogenesis of metabolism-related diseases, atherosclerosis, fibrosis, and the delicate equilibrium between cancer progression and organ regeneration. As such, there arises a pressing need for thorough investigation of YAP/TAZ in clinical settings. In this paper, we aim to elucidate the signaling pathways that regulate YAP/TAZ and explore the mechanisms of YAP/TAZ-induce diseases and their potential therapeutic interventions. Furthermore, we summarize the current clinical studies investigating treatments targeting YAP/TAZ. We also address the limitations of existing research on YAP/TAZ and propose future directions for research. In conclusion, this review aims to provide fresh insights into the signaling mediated by YAP/TAZ and identify potential therapeutic targets to present innovative solutions to overcome the challenges associated with YAP/TAZ.

OLFM4SHISA6
Also flagged:Gastric Cancertumorpeptidesephrin A1EFNA1pepsinogen A3
Journal Article 2023-08-09 ✓ 2 Snippets Joshi N, Bhat F, Bellad A, Sathe G, Jain A, Chavan S, Sirdeshmukh R, Pandey A.
In-Text Gene Mentions

OLFM4

SHISA6

Show Full Abstract

For precision in clinical oncology practice, detection of tumor-derived peptides and proteins in urine offers an attractive and noninvasive alternative for diagnostic or screening purposes. In this study, we report comparative quantitative proteomic profiling of urine samples from patients with gastric cancer and healthy controls using tandem mass tags-based multiplexed mass spectrometry approach. We identified 1504 proteins, of which 246 were differentially expressed in gastric cancer cases. Notably, ephrin A1 (EFNA1), pepsinogen A3 (PGA3), sortilin 1 (SORT1), and vitronectin (VTN) were among the upregulated proteins, which are known to play crucial roles in the progression of gastric cancer. We also found other overexpressed proteins, including shisa family member 5 (SHISA5), mucin like 1 (MUCL1), and leukocyte cell derived chemotaxin 2 (LECT2), which had not previously been linked to gastric cancer. Using a novel approach for targeted proteomics, SureQuant, we validated changes in abundance of a subset of proteins discovered in this study. We confirmed the overexpression of vitronectin and sortilin 1 in an independent set of urine samples. Altogether, this study provides molecular candidates for biomarker development in gastric cancer, and the findings also support the promise of urinary proteomics for noninvasive diagnostics and personalized/precision medicine in the oncology clinic.

HTT
Also flagged:Huntington's diseaseHDCAPagingdegenerative diseasebehavioral
Journal Article 2023-08-09 ✓ 5 Snippets Hu B, Younes L, Bu X, Liu CF, Ratnanather JT, Paulsen J, Georgiou-Karistianis N, Miller MI, Ross C, Faria AV.
In-Text Gene Mentions

For example, these results support the hypothesis of circuit-based spread of pathology in HD, possibly due to the spread of mutant Htt protein (Cicchetti et al., 2014, Gosset et al., 2020, Lee, 2020, Pecho-Vrieseling, 2014, Masnata et al., 2019) or other mechanisms such as loss of growth factor transport, or altered synaptic connectivity (Virlogeux et al., 2018, Saudou and Humbert, 2016), perhaps due to abnormal complement-mediated pruning (Liddelow et al., 2017).

HD is caused by a CAG repeat expansion in the Huntingtin gene (HTT) on chromosome 4, which codes for polyglutamine in the Huntingtin protein (Htt).

…the Huntingtin gene (HTT) on chromosome 4,…

…the Huntingtin protein (Htt).…

…spread of mutantHttprotein ( Cicchetti…

Show Full Abstract

Changes in the brain of patients with Huntington's disease (HD) begin years before clinical onset, so it remains critical to identify biomarkers to track these early changes. Metrics derived from tensor modeling of diffusion-weighted MRIs (DTI), that indicate the microscopic brain structure, can add important information to regional volumetric measurements. This study uses two large-scale longitudinal, multicenter datasets, PREDICT-HD and IMAGE-HD, to trace changes in DTI of HD participants with a broad range of CAP scores (a product of CAG repeat expansion and age), including those with pre-manifest disease (i.e., prior to clinical onset). Utilizing a fully automated data-driven approach to study the whole brain divided in regions of interest, we traced changes in DTI metrics (diffusivity and fractional anisotropy) versus CAP scores, using sigmoidal and linear regression models. We identified points of inflection in the sigmoidal regression using change-point analysis. The deep gray matter showed more evident and earlier changes in DTI metrics over CAP scores, compared to the deep white matter. In the deep white matter, these changes were more evident and occurred earlier in superior and posterior areas, compared to anterior and inferior areas. The curves of mean diffusivity vs. age of HD participants within a fixed CAP score were different from those of controls, indicating that the disease has an additional effect to age on the microscopic brain structure. These results show the regional and temporal vulnerability of the white matter and deep gray matter in HD, with potential implications for experimental therapeutics.

HFE
Also flagged:Hepatocellular CarcinomaTumorcirrhosishTERTantibodyhepatitis C virus infection
Journal Article 2023-08-09 ✓ 1 Snippet Fischer AK, Semaan A, Wulf AL, Vokuhl C, Goltz D, Fischer HP.
In-Text Gene Mentions

…a background ofhemochromatosis, PSC, autoimmune hepatitis,…

Show Full Abstract

<h4>Background</h4>The <i>hTERT</i> promoter mutation represents a common and early event in hepatocarcinogenesis, but its linkage to the morphological status of the underlying liver tissue is poorly understood. We analyzed the connection between the histopathological changes in tumor-bearing liver tissue and the occurrence of the <i>hTERT</i> promoter mutation in hepatocellular carcinoma (HCC), correlated with clinical data.<h4>Methods</h4>The study cohort comprised 160 histologically confirmed HCC in patients with or without cirrhosis that were investigated for the <i>hTERT</i> promoter mutation. We evaluated the frequency of the <i>hTERT</i> promoter mutation in patients with HCC with or without cirrhosis and correlated it with potential clinical and histopathological drivers. In particular, we examined tumor-bearing noncirrhotic liver tissue regarding inflammation; the modified histological activity index (mHAI), fibrosis, and steatosis; and its correlation with the frequency of the <i>hTERT</i> promoter mutation in HCC. We evaluated overall survival with multivariate Cox regression. Furthermore, we compared hTERT antibody immunohistochemistry and molecular <i>hTERT</i> promoter mutation analysis of both HCC and background liver tissue.<h4>Results</h4>The <i>hTERT</i> promoter mutation was especially related to HCC in cirrhotic compared with noncirrhotic liver (<i>p</i> < 0.001) and independently of cirrhosis in patients ≥ 60 years (<i>p</i> = 0.005). Furthermore, the <i>hTERT</i> promoter mutation was associated with cirrhosis caused by alcohol toxicity and hepatitis C virus infection. In noncirrhotic liver tissue, the frequency of <i>hTERT</i>-promoter-mutated HCC increased with the degree of inflammation and fibrosis. Nevertheless, 25% of the <i>hTERT</i>-promoter-mutated HCC developed in normal liver tissue without HCC risk factors. Multivariate Cox regression analysis did not reveal an influence of the <i>hTERT</i> promoter mutation in HCC on overall survival at 3, 5, and 16 years. Immunohistochemical analysis with the hTERT antibodies LS-B95 and 2D8 in <i>hTERT</i>-promoter-mutated HCC and <i>hTERT</i>-wildtype HCC showed a mildly stronger immunoreaction compared with the tumor-bearing liver tissue (LS-B95: <i>p</i> < 0.01, 2D8: <i>p</i> < 0.01).<h4>Conclusions</h4>Our study reveals a connection between pathological changes in tumor-bearing liver tissue and the <i>hTERT</i> promoter mutation in most HCC, even in noncirrhotic liver tissue. Immunohistochemical hTERT antibodies do not discriminate between <i>hTERT</i>-promoter-mutated and wildtype HCC.

HFE
Also flagged:hepatic steatosisNAFLDdiabetesALTsteatosisNASH
Journal Article 2023-08-09 ✓ 1 Snippet Schneider CV, Li T, Zhang D, Mezina AI, Rattan P, Huang H, Creasy KT, Scorletti E, Zandvakili I, Vujkovic M, Hehl L, Fiksel J, Park J, Wangensteen K, Risman M, Chang KM, Serper M, Carr RM, Schneider KM, Chen J, Rader DJ.
In-Text Gene Mentions

…excluded: viral hepatitis,hemochromatosis, primary biliary cholangitis,…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) is a major cause of liver-related morbidity in people with and without diabetes, but it is underdiagnosed, posing challenges for research and clinical management. Here, we determine if natural language processing (NLP) of data in the electronic health record (EHR) could identify undiagnosed patients with hepatic steatosis based on pathology and radiology reports.<h4>Methods</h4>A rule-based NLP algorithm was built using a Linguamatics literature text mining tool to search 2.15 million pathology report and 2.7 million imaging reports in the Penn Medicine EHR from November 2014, through December 2020, for evidence of hepatic steatosis. For quality control, two independent physicians manually reviewed randomly chosen biopsy and imaging reports (n = 353, PPV 99.7%).<h4>Findings</h4>After exclusion of individuals with other causes of hepatic steatosis, 3007 patients with biopsy-proven NAFLD and 42,083 patients with imaging-proven NAFLD were identified. Interestingly, elevated ALT was not a sensitive predictor of the presence of steatosis, and only half of the biopsied patients with steatosis ever received an ICD diagnosis code for the presence of NAFLD/NASH. There was a robust association for <i>PNPLA3</i> and <i>TM6SF2</i> risk alleles and steatosis identified by NLP. We identified 234 disorders that were significantly over- or underrepresented in all subjects with steatosis and identified changes in serum markers (e.g., GGT) associated with presence of steatosis.<h4>Interpretation</h4>This study demonstrates clear feasibility of NLP-based approaches to identify patients whose steatosis was indicated in imaging and pathology reports within a large healthcare system and uncovers undercoding of NAFLD in the general population. Identification of patients at risk could link them to improved care and outcomes.<h4>Funding</h4>The study was funded by US and German funding sources that did provide financial support only and had no influence or control over the research process.

HFE
Also flagged:watervibriosishemorrhagic septicemiadeathsepticemiagastroenteritis
Journal Article 2023-08-09 ✓ 1 Snippet Roig Molina FJ, Amaro González C, Alcaine Otín A, Carro Fernández J.
In-Text Gene Mentions

…multiple pathologies (e.g.,hemochromatosis, diabetes, cirrhosis, and…

Show Full Abstract

<i>Vibrio vulnificus</i> is a multi-host pathogenic species currently subdivided into five phylogenetic lineages (L) plus one pathovar with the ability to infect fish due to a transmissible virulence plasmid. This plasmid (or a fragment of it) has been transmitted between lineages within the species, contributing to the evolution of <i>V. vulnificus</i>. This study aimed to provide an experimental approximation to the <i>V. vulnificus</i> mutation rate by determining spontaneous mutation rates from bacterial cultures of representants of the different lineages by whole-genome sequencing. To this purpose, synonymous SNP differences, i.e., spontaneous mutation not subjected to the evolutive forces, between initial and final culture after serial growth were evaluated and used for mutation rate calculation.

HFE
Also flagged:epilepsynervous system diseasemetal ionsseleniumironcopper
Journal Article 2023-08-09 ✓ 1 Snippet Liu W, Xu J, Zhang L, Li F, Zhang L, Tai Z, Yang J, Zhang H, Tuo J, Yu C, Xu Z.
In-Text Gene Mentions

…hemolytic anemias, orhemochromatosis.…

Show Full Abstract

Research investigating the correlation between human trace element levels and disease alterations is growing. Epilepsy, a common nervous system disease, has also been found to be closely related to abnormal levels of trace elements. Studies continue to explore mechanisms of various trace elements involved in epileptic seizures through experimental animal models of epilepsy. Thus, we reviewed the research progress on the correlation between trace element levels and epilepsy in recent years and found that the trace elements most closely related to epilepsy are mainly metal ions such as selenium, iron, copper, zinc, and manganese. These results indicate that the changes in some trace elements are closely related to the increase in epilepsy susceptibility. In addition, after treatment with drugs and a ketogenic diet, the concentration of trace elements in the serum of patients with epilepsy changes. In other words, the abnormality of trace element concentrations is of great significance in the occurrence and development of epilepsy. This article is a literature update on the potential role of trace element imbalance in the development of epilepsy, providing new references for the subsequent prevention and treatment of epilepsy.

NEGR1OLFM4
Also flagged:depressionobesitymental illnesssleep disordersdeathmetabolic disorders
Journal Article 2023-08-09 ✓ 3 Snippets Wang T, Dai B, Shi H, Li H, Fan K, Zhang D, Zhou Y.
In-Text Gene Mentions
⭐ same-sentence co-mention

Other biological mechanisms, such as neuroendocrine changes in the leptin-melanocortin pathway and overlapping genetic variation (e.g., OLFM4 and NEGR1), could also explain the correlation between obesity and depression.

⭐ same-sentence co-mention

…genetic variation (e.g.,OLFM4and NEGR1), could…

⭐ same-sentence co-mention

…(e.g., OLFM4 andNEGR1), could also explain…

Show Full Abstract

<h4>Background</h4>Studies examining weight change patterns and depression are scarce and report inconsistent findings. This study-aimed to elucidate the association between weight change patterns and the risk of depression in a large, representative sample of US adults.<h4>Methods</h4>Data from the National Health and Nutrition Examination Survey (NHANES) 2005-2018 was analyzed. Five weight change groups were categorized: stable normal, weight loss, weight gain, maximum overweight, and stable obesity. Depression was ascertained using the validated Patient Health Questionnaire (PHQ-9) and depression was defined as PHQ score ≥ 10.<h4>Results</h4>A total of 17,556 participants were included. Compared with participants who maintained normal weight, stable obesity participants had increased risks of depression across adulthood from age 25 years to 10 years before the survey (OR = 1.61, 95% CI =1.23 to 2.11), in the 10 years period before the survey (OR = 2.15, 95% CI =1.71 to 2.70), and from age 25 years to survey (OR = 1.88, 95% CI =1.44 to 2.44). Weight gain was associated with an increased risk of depression from age 25 years to 10 years before the survey (OR = 1.71, 95% CI = 1.41 to 2.04), in the 10 years period before the survey (OR = 1.73, 95% CI = 1.35 to 2.21), and for the period from age 25 years to survey (OR = 1.83, 95% CI = 1.49 to 2.24). In the stratified analyses, we found statistically significant interactions with sex.<h4>Conclusion</h4>Our study suggested that stable obesity and weight gain across adulthood were associated with increased risks of depression.

PEBP1
Also flagged:cuproptosisferroptosisautophagycancerlung adenocarcinomaLUAD
Journal Article 2023-08-09 ✓ 5 Snippets Zhang W, Qu H, Ma X, Li L, Wei Y, Wang Y, Zeng R, Nie Y, Zhang C, Yin K, Zhou F, Yang Z.
In-Text Gene Mentions

In NSCLC, the expression level of PEBP1 is closely related to the severity of lung cancer and patients’ prognosis.

PEBP1 and STXBP1 are opposite, while Znf671 has no difference in expression next to tumors and cancer (Figure 10A).

Studies have shown that PEBP1 is closely related to the occurrence, metastasis, and prognosis of various cancers.

Downregulation of PEBP1 expression can promote tumor development and metastasis, while overexpression of PEBP1 can inhibit tumor metastasis and is of significant importance for patients’ prognosis and treatment.

In addition to lung cancer, PEBP1 plays a regulatory role in multiple cancers such as breast cancer (39, 40), prostate cancer (41) and ovarian cancer (42).

Show Full Abstract

<h4>Background</h4>Cuproptosis is a novel form of programmed cell death that differs from other types such as pyroptosis, ferroptosis, and autophagy. It is a promising new target for cancer therapy. Additionally, immune-related genes play a crucial role in cancer progression and patient prognosis. Therefore, our study aimed to create a survival prediction model for lung adenocarcinoma patients based on cuproptosis and immune-related genes. This model can be utilized to enhance personalized treatment for patients.<h4>Methods</h4>RNA sequencing (RNA-seq) data of lung adenocarcinoma (LUAD) patients were collected from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. The levels of immune cell infiltration in the GSE68465 cohort were determined using gene set variation analysis (GSVA), and immune-related genes (IRGs) were identified using weighted gene coexpression network analysis (WGCNA). Additionally, cuproptosis-related genes (CRGs) were identified using unsupervised clustering. Univariate COX regression analysis and least absolute shrinkage selection operator (LASSO) regression analysis were performed to develop a risk prognostic model for cuproptosis and immune-related genes (CIRGs), which was subsequently validated. Various algorithms were utilized to explore the relationship between risk scores and immune infiltration levels, and model genes were analyzed based on single-cell sequencing. Finally, the expression of signature genes was confirmed through quantitative real-time PCR (qRT-PCR), immunohistochemistry (IHC), and Western blotting (WB).<h4>Results</h4>We have identified 5 Oncogenic Driver Genes namely CD79B, PEBP1, PTK2B, STXBP1, and ZNF671, and developed proportional hazards regression models. The results of the study indicate significantly reduced survival rates in both the training and validation sets among the high-risk group. Additionally, the high-risk group displayed lower levels of immune cell infiltration and expression of immune checkpoint compared to the low-risk group.

TRIM38
Also flagged:Tripartite motif (TRIM) proteinsinnate immunityTRIMPRYimmune responsesTRIM proteins
Journal Article 2023-08-09 ✓ 1 Snippet Campbell LK, Peery RM, Magor KE.
In-Text Gene Mentions

…reported, humans haveTRIM38and 27 telomeric…

Show Full Abstract

Tripartite motif (TRIM) proteins are involved in development, innate immunity, and viral restriction. TRIM gene repertoires vary between species, likely due to diversification caused by selective pressures from pathogens; however, this has not been explored in birds. We mined a <i>de novo</i> assembled transcriptome for the TRIM gene repertoire of the domestic mallard duck (<i>Anas platyrhynchos</i>), a reservoir host of influenza A viruses. We found 57 TRIM genes in the duck, which represent all 12 subfamilies based on their C-terminal domains. Members of the C-IV subfamily with C-terminal PRY-SPRY domains are known to augment immune responses in mammals. We compared C-IV TRIM proteins between reptiles, birds, and mammals and show that many C-IV subfamily members have arisen independently in these lineages. A comparison of the MHC-linked C-IV TRIM genes reveals expansions in birds and reptiles. The TRIM25 locus with related innate receptor modifiers is adjacent to the MHC in reptile and marsupial genomes, suggesting the ancestral organization. Within the avian lineage, both the MHC and TRIM25 loci have undergone significant TRIM gene reorganizations and divergence, both hallmarks of pathogen-driven selection. To assess the expression of TRIM genes, we aligned RNA-seq reads from duck tissues. C-IV TRIMs had high relative expression in immune relevant sites such as the lung, spleen, kidney, and intestine, and low expression in immune privileged sites such as in the brain or gonads. Gene loss and gain in the evolution of the TRIM repertoire in birds suggests candidate immune genes and potential targets of viral subversion.

Also flagged:Heart Failurereninangiotensinaldosteronenatriuretic peptideendothelial dysfunction
Journal Article 2023-08-09 No Snippets Bodnar P, Mazurkiewicz M, Chwalba T, Romuk E, Ciszek-Chwalba A, Jacheć W, Wojciechowska C.
Show Full Abstract

Heart failure (HF) is a multifactorial clinical syndrome involving many complex processes. The causes may be related to abnormal heart structure and/or function. Changes in the renin-angiotensin-aldosterone system, the sympathetic nervous system, and the natriuretic peptide system are important in the pathophysiology of HF. Dysregulation or overexpression of these processes leads to changes in cardiac preload and afterload, changes in the vascular system, peripheral vascular dysfunction and remodeling, and endothelial dysfunction. One of the important factors responsible for the development of heart failure at the cellular level is oxidative stress. This condition leads to deleterious cellular effects as increased levels of free radicals gradually disrupt the state of equilibrium, and, as a consequence, the internal antioxidant defense system is damaged. This review focuses on pharmacotherapy for chronic heart failure with regard to oxidation-reduction metabolism, with special attention paid to the latest group of drugs, SGLT2 inhibitors-an integral part of HF treatment. These drugs have been shown to have beneficial effects by protecting the antioxidant system at the cellular level.

SUDS3
Also flagged:host cellssecretioncell wallsgene silencingviral infectionsubiquitin
Journal Article 2023-08-09 ✓ 1 Snippet Sun H, Jing X, Wang C, Wang P, Huang Z, Sun B, Li P, Li H, Zhang C.
In-Text Gene Mentions

…AGOs and plantendogenous suppressor of gene silencing 3suppressor of gene…

Show Full Abstract

Plant viruses are tiny pathogenic obligate parasites that cause significant damage to global crop production. They exploit and manipulate the cellular components of host plants to ensure their own survival. In response, plants activate multiple defense signaling pathways, such as gene silencing and plant hormone signaling, to hinder virus propagation. Growing evidence suggests that the regulation of protein homeostasis plays a vital role in the ongoing battle between plants and viruses. The ubiquitin-proteasome-degradation system (UPS) and autophagy, as two major protein-degradation pathways, are widely utilized by plants and viruses in their arms race. One the one hand, these pathways act as essential components of plant's antiviral defense system by facilitating the degradation of viral proteins; on the other hand, viruses exploit the UPS and autophagy to create a favorable intracellular environment for viral infection. This review aims to provide a comprehensive summary of the events involved in protein homeostasis regulation during viral infection in plants. Gaining knowledge in this area will enhance our understanding of the complex interplay between plants and viruses.

SERPINC1
Also flagged:Pancreatic cancercancerdeathPancreatic adenocarcinomapancreatic neuroendocrine tumorPanNET
Journal Article 2023-08-09 ✓ 1 Snippet Marin AM, Batista M, Korte de Azevedo AL, Bombardelli Gomig TH, Soares Caldeira Brant R, Chammas R, Uno M, Dias Araújo D, Zanette DL, Nóbrega Aoki M.
In-Text Gene Mentions

…SERPINA1, SERPINA3,SERPINC1, SERPINAC1, and SERPINAG1…

Show Full Abstract

In the oncological area, pancreatic cancer is one of the most lethal diseases, with 5-year survival rising just 10% in high-development countries. This disease is genetically characterized by <i>KRAS</i> as a driven mutation followed by <i>SMAD4</i>, <i>CDKN2</i>, and <i>TP53</i>-associated mutations. In clinical aspects, pancreatic cancer presents unspecific clinical symptoms with the absence of screening and early plasmatic biomarker, being that CA19-9 is the unique plasmatic biomarker having specificity and sensitivity limitations. We analyzed the plasmatic exosome proteomic profile of 23 patients with pancreatic cancer and 10 healthy controls by using Nanoscale liquid chromatography coupled to tandem mass spectrometry (NanoLC-MS/MS). The pancreatic cancer patients were subdivided into IPMN and PDAC. Our findings show 33, 34, and 7 differentially expressed proteins when comparing the IPMN vs. control, PDAC-No treatment vs. control, and PDAC-No treatment vs. IPMN groups, highlighting proteins of the complement system and coagulation, such as C3, APOB, and SERPINA. Additionally, PDAC with no treatment showed 11 differentially expressed proteins when compared to Folfirinox neoadjuvant therapy or Gemcitabine adjuvant therapy. So here, we found plasmatic exosome-derived differentially expressed proteins among cancer patients (IPMN, PDAC) when comparing with healthy controls, which could represent alternative biomarkers for diagnostic and prognostic evaluation, supporting further scientific and clinical studies on pancreatic cancer.

Also flagged:neurodegenerative diseasedementiaPSEN1metabolismvesiclecytoskeleton
Journal Article 2023-08-09 No Snippets Rochín-Hernández LJ, Jiménez-Acosta MA, Ramírez-Reyes L, Figueroa-Corona MDP, Sánchez-González VJ, Orozco-Barajas M, Meraz-Ríos MA.
Show Full Abstract

Alzheimer's disease (AD), the most common neurodegenerative disease and the first cause of dementia worldwide, has no effective treatment, and its pathological mechanisms are not yet fully understood. We conducted this study to explore the proteomic differences associated with Familial Alzheimer's Disease (FAD) in olfactory ecto-mesenchymal stem cells (MSCs) derived from PSEN1 (A431E) mutation carriers compared with healthy donors paired by age and gender through two label-free liquid chromatography-mass spectrometry approaches. The first analysis compared carrier 1 (patient with symptoms, P1) and its control (healthy donor, C1), and the second compared carrier 2 (patient with pre-symptoms, P2) with its respective control cells (C2) to evaluate whether the protein alterations presented in the symptomatic carrier were also present in the pre-symptom stages. Finally, we analyzed the differentially expressed proteins (DEPs) for biological and functional enrichment. These proteins showed impaired expression in a stage-dependent manner and are involved in energy metabolism, vesicle transport, actin cytoskeleton, cell proliferation, and proteostasis pathways, in line with previous AD reports. Our study is the first to conduct a proteomic analysis of MSCs from the Jalisco FAD patients in two stages of the disease (symptomatic and presymptomatic), showing these cells as a new and excellent in vitro model for future AD studies.

Also flagged:Carbonic Anhydrase Icarbonic anhydrasesmethylbenzoatecyclothiazidehCA I
Journal Article 2023-08-09 No Snippets Zheng N, Jiang W, Zhang P, Ma L, Chen J, Zhang H.
Show Full Abstract

Human carbonic anhydrases (hCAs) have enzymatic activities for reversible hydration of CO<sub>2</sub> and are acknowledged as promising targets for the treatment of various diseases. Using molecular docking and molecular dynamics simulation approaches, we hit three compounds of methyl 4-chloranyl-2-(phenylsulfonyl)-5-sulfamoyl-benzoate (84Z for short), cyclothiazide, and 2,3,5,6-tetrafluoro-4-piperidin-1-ylbenzenesulfonamide (3UG for short) from the existing hCA I inhibitors and word-approved drugs. As a Zn<sup>2+</sup>-dependent metallo-enzyme, the influence of Zn<sup>2+</sup> ion models on the stability of metal-binding sites during MD simulations was addressed as well. MM-PBSA analysis predicted a strong binding affinity of -18, -16, and -14 kcal/mol, respectively, for these compounds, and identified key protein residues for binding. The sulfonamide moiety bound to the Zn<sup>2+</sup> ion appeared as an essential component of hCA I inhibitors. Vina software predicted a relatively large (unreasonable) Zn<sup>2+</sup>-sulfonamide distance, although the relative binding strength was reproduced with good accuracy. The selected compounds displayed potent inhibition against other hCA isoforms of II, XIII, and XIV. This work is valuable for molecular modeling of hCAs and further design of potent inhibitors.

HTT
Also flagged:neurodegenerative genetic disorderchromosomebehavioralHDMonoaminecell proliferation
Journal Article 2023-08-09 ✓ 2 Snippets Plácido E, Gomes Welter P, Wink A, Karasiak GD, Outeiro TF, Dafre AL, Gil-Mohapel J, Brocardo PS.
In-Text Gene Mentions

…the protein huntingtin (Htt) [ 3 ],…

…the number ofHttCAG repeats can…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative genetic disorder characterized by motor, psychiatric, cognitive, and peripheral symptoms without effective therapy. Evidence suggests that lifestyle factors can modulate disease onset and progression, and environmental enrichment (EE) has emerged as a potential approach to mitigate the progression and severity of neurodegenerative processes. Wild-type (WT) and yeast artificial chromosome (YAC) 128 mice were exposed to different EE conditions. Animals from cohort 1 were exposed to EE between postnatal days 21 and 60, and animals from cohort 2 were exposed to EE between postnatal days 60 and 120. Motor and non-motor behavioral tests were employed to evaluate the effects of EE on HD progression. Monoamine levels, hippocampal cell proliferation, neuronal differentiation, and dendritic arborization were also assessed. Here we show that EE had an antidepressant-like effect and slowed the progression of motor deficits in HD mice. It also reduced monoamine levels, which correlated with better motor performance, particularly in the striatum. EE also modulated neuronal differentiation in the YAC128 hippocampus. These results confirm that EE can impact behavior, hippocampal neuroplasticity, and monoamine levels in YAC128 mice, suggesting this could be a therapeutic strategy to modulate neuroplasticity deficits in HD. However, further research is needed to fully understand EE's mechanisms and long-term effects as an adjuvant therapy for this debilitating condition.

HFE
Also flagged:Iron HomeostasisLiver Diseaseironmetabolismchronic hepatitis Chepatic cirrhosis
Journal Article 2023-08-09 ✓ 5 Snippets Wróblewska A, Woziwodzka A, Rybicka M, Bielawski KP, Sikorska K.
In-Text Gene Mentions

Among SNPs selected according to their impact on iron metabolism only HFE C282Y and CYBRD1 rs884409 associated with serum iron indices in CHC patients.

In CHC patients, markers of serum and hepatocyte iron overload associate with genetic polymorphisms in IFNλ3 gene region, well known predictors of both spontaneous and IFN-treatment-induced HCV clearance [18] as well as HFE gene mutations [19].

Regulation of HAMP expression in response to increased circulating iron levels is maintained by interaction between hemochromatosis (HFE) protein, transferrin receptors (Trf2 and Trf1) and hemojuvelin (Hjv).

The most common mutations, responsible for the majority of hemochromatosis cases in patients with East European ancestry, are mutations in the coding region of HFE gene: C282Y rs1800562, H63D rs1799945, and S65C rs1800730.

…nine SNPs withinHFE, TFR2 ,…

Show Full Abstract

Dysregulation of iron metabolism in chronic hepatitis C (CHC) is a significant risk factor for hepatic cirrhosis and cancer. We studied if known genetic variants related to iron homeostasis associate with liver disease progression in CHC. Retrospective analysis included 249 CHC patients qualified for antiviral therapy between 2004 and 2014. For all patients, nine SNPs within <i>HFE</i>, <i>TFR2</i>, <i>HDAC2</i>, <i>HDAC3</i>, <i>HDAC5</i>, <i>TMPRSS6</i>, and <i>CYBRD1</i> genes were genotyped. Expression of selected iron-related genes, was determined with qRT-PCR in 124 liver biopsies, and mRNA expression of co-inhibitory receptors (<i>PD-1</i>, <i>Tim3</i>, <i>CTLA4</i>) was measured in 79 liver samples. <i>CYBRD1</i> rs884409, <i>HDAC5</i> rs368328, <i>TFR2</i> rs7385804, and <i>TMPRSS6</i> rs855791 associated with histopathological changes in liver tissue at baseline. The combination of minor allele in <i>HDAC3</i> rs976552 and <i>CYBRD1</i> rs884409 linked with higher prevalence of hepatocellular carcinoma (HCC) during follow up (OR 8.1 CI 2.2-29.2; <i>p</i> = 0.001). Minor allele in <i>HDAC3</i> rs976552 associated with lower hepatic expression of <i>CTLA4</i>. Tested polymorphisms related to iron homeostasis associate with histopathological changes in the liver. The presence of both <i>HDAC3</i> rs976552 G and <i>CYBRD1</i> rs884409 G alleles correlates with HCC occurrence, especially in the group of patients with elevated AST (>129 IU/L). rs976552 in <i>HDAC3</i> could impact immunological processes associated with carcinogenesis in CHC.

Also flagged:RiboflavinEosin YSilicasynthesisPhotocatalysiselectrons
Journal Article 2023-08-09 No Snippets Caminos DA, Rimondino GN, Gatica E, Massad WA, Argüello JE.
Show Full Abstract

The application of photocatalysis for organic synthesis, both in the laboratory and on an industrial scale, will depend on the achieving of good yields and the ease with which it can be applied. Selective irradiation of the photocatalyst with LED light has made it possible to activate the reactions easily, without the need for UV or heat filters. However, a common problem is the need to separate the photocatalyst from the reaction products through extraction and chromatography isolation processes. These procedures make it difficult to recover and reuse the catalyst, which is not compatible with scale-up applications. Photocatalysts attached to heterogeneous supports resulted in an alternative, which facilitates their removal and reuse. In this study, we use chromatographic silica gel as a low-cost heterogeneous support to bind photosensitizers such as Riboflavin or Eosin Y. The modified silica gel was analyzed by FTIR-ATR and diffuse reflectance UV-visible spectroscopy, thermogravimetric analysis, and optical microscopy. These hybrid materials have a suitable size for easy separation by decantation and were found to be photoactive against two photooxidation reactions. These easy-to-handle materials open the door to effective applications for photoinduced organic synthesis methods at medium to large scale.

TNFSF4
Also flagged:Eph receptor B6cancerephrinbladder cancerEph receptortumor
Journal Article 2023-08-09 ✓ 1 Snippet Jia X, Zhang D, Zhou C, Yan Z, Jiang Z, Xie L, Jiang J.
In-Text Gene Mentions

…t immunostimulators (includingTNFSF4, TNFSF14, TNFRSF9, TNFSF13B,…

Show Full Abstract

<h4>Background</h4>The role of Eph receptors and related ephrin (EFN) ligands (as the largest family of transmembrane-bound RTKs) in immunomodulation in many types of cancer, especially bladder cancer (BLCA), is scarcely known.<h4>Methods</h4>A pan-cancer dataset was retrieved from The Cancer Genome Atlas (TCGA) to explore the relation between Eph receptor/EFN ligand family genes and immunomodulators and tumor-infiltrated immune cells (TIICs). Local BLCA, GSE32894, and GSE31684 cohorts were applied to validate. The IMvigor210 cohort was employed to explore the relationship between EPHB6 and immunotherapy response. Moreover, association between EPHB6 and molecular subtype was investigated to explore potential therapeutic strategies. Immunohistochemical staining of CD8 and CD68 was performed to validate the correlation between EPHB6 and TIICs.<h4>Results</h4>The pan-cancer analysis revealed variations in the immunological effects of Eph receptor/EFN ligand family genes across different types of cancer. EPHB6 expression negatively correlated with the expression of the majority of immunomodulators (including HLA and immune checkpoints), and CD8 T cells and macrophages in both the TCGA-BLCA and validation BLCA cohorts, shaping a cold immune microenvironment with inhibited immunity. In the IMvigor210 cohort, patients with high-EPHB6 highly correlated with a non-inflamed, low PD-L1 expression immune phenotype, and correspondingly, with less responders to immunotherapy. The high-EPHB6 group, enriched with the basal subtype, presented significantly fewer <i>TP53</i> and more <i>FGFR3</i> genomic alterations. Finally, a novel EPHB6-related Genes signature, with reliable and robust ability in prognosis prediction, was constructed.<h4>Conclusions</h4>This study comprehensively investigated the immunological effects of Eph receptor/EFN ligand family genes pan-cancer, and specially identified the immunosuppressive role of EPHB6 in BLCA. Furthermore, EPHB6 may predict the molecular subtype and prognosis of BLCA, and serve as a novel therapeutic target to improve the sensitivity of immunotherapy.

HFE
Also flagged:Celiac DiseaseCardiac conduction disorderautoimmune disordergluten intolerancedilated cardiomyopathymyocarditis
Journal Article 2023-08-09 ✓ 1 Snippet Maadarani O, Bigdelu L, Bitar Z, Alhabibi M, Kabbara H.
In-Text Gene Mentions

…the diagnosis ofhemochromatosis.…

Show Full Abstract

Cardiac conduction disorder may have a wide range of aetiology and can manifest with symptomatic bradycardia and syncope. Celiac disease is a malabsorptive long-term autoimmune disorder where the small intestine is the primarily affected organ due to gluten intolerance in genetically predisposed individuals. The associations between celiac disease and cardiac pathology are uncommon. We report a case of a 50-year-old woman with a known case of celiac disease who presented with a symptomatic cardiac conduction abnormality that improved with a gluten-free diet.<h4>Learning points</h4>Celiac disease is a malabsorptive long-term autoimmune disorder where the small intestine is the primarily affected organ due to gluten intolerance and affects 1% of the general population.Cardiovascular pathology, including dilated cardiomyopathy, myocarditis, arrhythmias, and premature atherosclerosis, was found to be more prevalent in patients with celiac disease than in others without celiac disease.The association of celiac disease with isolated advanced atrioventricular conduction abnormality is rare and a gluten-free diet may help improve the conduction abnormality.

Also flagged:CD82transcription factorRUNX1hematopoiesisHEgestation
Journal Article 2023-08-09 No Snippets Menegatti S, Potts B, Paredes R, Garcia-Alegria E, Baker SM, Kouskoff V.
Show Full Abstract

During embryonic development, all blood progenitors are initially generated from endothelial cells that acquire a hemogenic potential. Blood progenitors emerge through an endothelial-to-hematopoietic transition regulated by the transcription factor RUNX1. To date, we still know very little about the molecular characteristics of hemogenic endothelium and the molecular changes underlying the transition from endothelium to hematopoiesis. Here, we analyzed at the single cell level a human embryonic stem cell-derived endothelial population containing hemogenic potential. RUNX1-expressing endothelial cells, which harbor enriched hemogenic potential, show very little molecular differences to their endothelial counterpart suggesting priming toward hemogenic potential rather than commitment. Additionally, we identify CD82 as a marker of the endothelium-to-hematopoietic transition. CD82 expression is rapidly upregulated in newly specified blood progenitors then rapidly downregulated as further differentiation occurs. Together our data suggest that endothelial cells are first primed toward hematopoietic fate, and then rapidly undergo the transition from endothelium to blood.

bioRxiv 2023-08-09 Preprint (No Snippets API) Zhao DY, Bäuerlein FJ, Saha I, Hartl FU, Baumeister W, Wilfling F.
Show Full Abstract

<h4>Summary</h4> Aggregation of proteins containing expanded polyglutamine (polyQ) repeats is the cytopathologic hallmark of a group of dominantly inherited neurodegenerative diseases, including Huntington’s disease (HD). Huntingtin (Htt), the disease protein of HD, forms amyloid-like fibrils by liquid-to-solid phase transition. Macroautophagy has been proposed to clear polyQ aggregates, but the efficiency of aggrephagy is limited. Here, we used cryo-electron tomography to visualize the interactions of autophagosomes with polyQ aggregates in cultured cells in situ . We found that an amorphous aggregate phase exists next to the radially organized polyQ fibrils. Autophagosomes preferentially engulfed this amorphous material, mediated by interactions between the autophagy receptor p62/SQSTM1 and the non-fibrillar aggregate surface. In contrast, amyloid fibrils excluded p62 and evaded clearance, resulting in trapping of autophagic structures. These results suggest that the limited efficiency of autophagy in clearing polyQ aggregates is due to the inability of autophagosomes to interact productively with the non-deformable, fibrillar disease aggregates.

Preprints.org 2023-08-09 Preprint (No Snippets API) Ferrari C, Capacci E, Bagnoli S, Ingannato A, Sorbi S, Nacmias B.
Show Full Abstract

<h4>Background: </h4> and objectives: Huntington disease (HD) is characterized by motor, cognitive and psychiatric manifestations and is caused by an expansion of CAG repeats over 35 triplets on the huntingtin (HTT) gene. However, expansions in the range 27-35 repeats (intermediate allele) can be associated with pathological phenotypes. The onset of HD is conventionally defined by the onset of motor symptoms, but psychiatric disturbances can precede the motor phase by up to twenty years. The aims of the present study are to identify HD patients in the pre-motor phase of the disease among patients diagnosed with bipolar disorders and to evaluate any differences between bipolar patients carrying normal HTT allele and patients with expanded HTT gene. <h4>Methods:</h4> We assessed the HTT genotype in an Italian cohort of 69 patients affected by bipolar disorder type 1 and type 2. <h4>Results:</h4> No patient was found to be a carrier of the pathological HTT allele, but 10% of bipolar subjects carried an intermediate allele. Carriers of the intermediate allele were older at onset of psychiatric symptoms than non-carriers. <h4>Conclusion:</h4> The pathological HTT gene was not associated with bipolar disorder, while we found a higher frequency of the intermediate allele among the bipolar population with respect to healthy controls.

Research Square 2023-08-09 Preprint (No Snippets API) Bausyte R, Mazeikiene BV-, Skliute G, Valatkaite E, Sabaityte E, Kazenaite E, Ramasauskaite D, Navakauskiene R.
Show Full Abstract

<h4>Background: </h4> Infertility can negatively affect mental health. Conversely, it is also hypothesized that psychological imbalance may exert a damaging influence on reproductive function. Unfortunately, until now it has been difficult to objectively explain these relations. Certain researchers suggest that genetic and epigenetic mechanisms could be factors. The aim of this study was to investigate the connection between infertility, anxiety and (or) depression by examining underlying genetics, so we can formulate future perspectives. <h4>Methods: </h4>. The present study was conducted in few stages: (a) psychological assessment of females undergoing assisted reproductive technology (ART) procedure due to couple infertility, using the Hospital Anxiety and Depression Scale (HADS); (b) collection of endometrial samples before ART cycle from study participants; (c) isolation and cultivation of human endometrial-derived mesenchymal stromal cells (EnSCs); (d) analysis of 26 EnSCs’ genes by the reverse transcription-quantitative polymerase chain reaction (RT-qPCR): cell cycle regulation related (SLC39A1, RBM6, BLCAP, GATAD2B, RNF123, RECQL4) , immune response related (AFF3, CD58, TNFSF4) , signal transduction related (ESR1, CRTC2, CXCL8, PPP1R16A, NDN, GRB10, HTR2A, RB1, NR3C1, AXL) , cell differentiation related (PAX8AS1, H19, EFNA5, IGF2) , secretion related genes (MON1A, CYR61) and embryogenesis related genes (TFPI2) ; (e) statistical analysis; (f) summarization. <h4>Results: </h4>. We investigated 32 females. 12 females expressed considerable symptoms of anxiety and 1 female showed symptoms of depression. 19 females conceived after ART procedures. Genetic analysis showed tendentious alterations in certain cell cycle regulation and transcription/translation, immune response, signal transduction, cell differentiation, secretion and embryogenesis process related gene expression according to female expression of anxiety. Moreover, it was observed that certain mechanisms could adversely affect pregnancy outcome after ART cycle or at least reflect it. <h4>Conclusions: </h4> . It is known that infertility can have a harmful impact on a person’s psychology. However, a perception can be made that some tendencies such as anxiety may affect fertility even through the gene profile. The results we obtained encourage a deeper exploration of the relationship between fertility disorders, psychology and genes, as it does seem that qualified and timely psychological assessment, counselling and support could be one of the keys to raising pregnancy rates among infertile couples.

DCC
Also flagged:ischemic strokeCNS diseasesStrokedeathacute stroke attacktransduction
Journal Article 2023-08-08 ✓ 1 Snippet Wang J, Zhu M, Sun J, Feng L, Yang M, Sun B, Mao L.
In-Text Gene Mentions

Secreted protein Netrin‐1 is an axon guidance molecule, and overexpression of AAV‐mediated Netrin‐1 in rats after pMCAO was found to increase the expression of the Netrin‐1 receptor DCC, activated the JNK1/c‐Jun pathway, and promoted synapse formation, axonal regeneration, and neurological function recovery in the subacute phase of stroke.74

Show Full Abstract

Stroke has been associated with devastating clinical outcomes, with current treatment strategies proving largely ineffective. Therefore, there is a need to explore alternative treatment options for addressing post-stroke functional deficits. Gene therapy utilizing adeno-associated viruses (AAVs) as a critical gene vector delivering genes to the central nervous system (CNS) gene delivery has emerged as a promising approach for treating various CNS diseases. This review aims to provide an overview of the biological characteristics of AAV vectors and the therapeutic advancements observed in preclinical models of ischemic stroke. The study further investigates the potential of manipulating AAV vectors in preclinical applications, emphasizing the challenges and prospects in the selection of viral vectors, drug delivery strategies, immune reactions, and clinical translation.

BTN3A3
Also flagged:tumorsoxygenIL1R1synthesisIL1βbreast cancer
Journal Article 2023-08-08 ✓ 3 Snippets Hao M, Huang B, Wu R, Peng Z, Luo KQ.
In-Text Gene Mentions

reported that the high expression of LSECtin on TAMs interacts with the receptor butyrophilin subfamily 3 member A3 (BTN3A3) on cancer cells and enhances cancer stemness and growth of xenografted breast tumors.[25] Animal experiments and clinical data also show that the high expression of various factors in TAMs, including lipocalin‐2 (LCN2), matrix metallopeptidase 9 (MMP9), macrophage inflammatory protein‐1β (MIP‐1β), chitinase‐3‐like protein 1 (CHI3L1), and cyclooxygenase‐2 (COX‐2), stimulate breast cancer cell migration and invasion.[26, 27, 28, 29, 30]

…with the receptorbutyrophilin subfamily 3 member A3subfamily 3 member…

…3 member A3 (BTN3A3) on cancer cells…

Show Full Abstract

Triple-negative breast cancer (TNBC) has higher mortality than non-TNBC because of its stronger metastatic capacity. Increasing studies reported that TNBC tumors had more macrophage infiltration than non-TNBC tumors, which promoted the metastasis of TNBC cells. However, how TNBC cells become more malignant after interacting with macrophages is less reported. In this study, it is observed that when TNBC cells are co-cultured with macrophages, they display higher viability and stronger metastatic ability than non-TNBC cells. Mechanistic studies reveal that TNBC cells acquired these abilities via interactions with macrophages in three phases. First, within 12 h of co-culture with macrophages, some TNBC cells have significantly elevated levels of reactive oxygen species (ROS), which upregulate interleukin 1α (IL1α) expression in ERK1/2-c-Jun- and NF-κB-dependent manners at 24-48 h. Second, the secreted IL1α bound to IL1R1 activates the ERK1/2-ZEB1-VIM pathway which increases metastasis. Third, IL1α/IL1R1 facilitates its own synthesis and induces the expression of IL1β and IL8 at 72-96 h through the MKK4-JNK-c-Jun and NF-κB signaling pathways. Moreover, a higher level of IL1α is positively correlated with more macrophage infiltration and shorter overall survival in breast cancer patients. Thus, reducing ROS elevation or downregulating IL1α expression can serve as new strategies to decrease metastasis of TNBC.

Also flagged:cognitiondomestication syndromepigmentationdomesticationgene expressionmethylation
Journal Article 2023-08-08 No Snippets Benítez-Burraco A, Uriagereka J, Nataf S.
Show Full Abstract

Domestication transforms once wild animals into tamed animals that can be then exploited by humans. The process entails modifications in the body, cognition, and behavior that are essentially driven by differences in gene expression patterns. Although genetic and epigenetic mechanisms were shown to underlie such differences, less is known about the role exerted by trans-regulatory molecules, notably transcription factors (TFs) in domestication. In this paper, we conducted extensive in silico analyses aimed to clarify the TF landscape of mammal domestication. We first searched the literature, so as to establish a large list of genes selected with domestication in mammals. From this list, we selected genes experimentally demonstrated to exhibit TF functions. We also considered TFs displaying a statistically significant number of targets among the entire list of (domestication) selected genes. This workflow allowed us to identify 5 candidate TFs (SOX2, KLF4, MITF, NR3C1, NR3C2) that were further assessed in terms of biochemical and functional properties. We found that such TFs-of-interest related to mammal domestication are all significantly involved in the development of the brain and the craniofacial region, as well as the immune response and lipid metabolism. A ranking strategy, essentially based on a survey of protein-protein interactions datasets, allowed us to identify SOX2 as the main candidate TF involved in domestication-associated evolutionary changes. These findings should help to clarify the molecular mechanics of domestication and are of interest for future studies aimed to understand the behavioral and cognitive changes associated to domestication.

OLFM4
Also flagged:acute kidney injurycritical illnesscreatininereninolfactomedin 4(IL)-9
Journal Article 2023-08-08 ✓ 1 Snippet Stanski NL, Rodrigues CE, Strader M, Murray PT, Endre ZH, Bagshaw SM.
In-Text Gene Mentions

…renin; olfactomedin 4 (OLFM4); interleukin (IL)-9) may…

Show Full Abstract

Acute kidney injury (AKI) is a prototypical example of a common syndrome in critical illness defined by consensus. The consensus definition for AKI, traditionally defined using only serum creatinine and urine output, was needed to standardize the description for epidemiology and to harmonize eligibility for clinical trials. However, AKI is not a simple disease, but rather a complex and multi-factorial syndrome characterized by a wide spectrum of pathobiology. AKI is now recognized to be comprised of numerous sub-phenotypes that can be discriminated through shared features such as etiology, prognosis, or common pathobiological mechanisms of injury and damage. The characterization of sub-phenotypes can serve to enable prognostic enrichment (i.e., identify subsets of patients more likely to share an outcome of interest) and predictive enrichment (identify subsets of patients more likely to respond favorably to a given therapy). Existing and emerging biomarkers will aid in discriminating sub-phenotypes of AKI, facilitate expansion of diagnostic criteria, and be leveraged to realize personalized approaches to management, particularly for recognizing treatment-responsive mechanisms (i.e., endotypes) and targets for intervention (i.e., treatable traits). Specific biomarkers (e.g., serum renin; olfactomedin 4 (OLFM4); interleukin (IL)-9) may further enable identification of pathobiological mechanisms to serve as treatment targets. However, even non-specific biomarkers of kidney injury (e.g., neutrophil gelatinase-associated lipocalin, NGAL; [tissue inhibitor of metalloproteinases 2, TIMP2]·[insulin like growth factor binding protein 7, IGFBP7]; kidney injury molecule 1, KIM-1) can direct greater precision management for specific sub-phenotypes of AKI. This review will summarize these evolving concepts and recent innovations in precision medicine approaches to the syndrome of AKI in critical illness, along with providing examples of how they can be leveraged to guide patient care.

POU3F2
Also flagged:Autism spectrum disorderneurodevelopmental disorderattention-deficit hyperactivity disorderepilepsyTransient receptor potential canonical-6calcium
Journal Article 2023-08-08 ✓ 1 Snippet Shin KC, Ali G, Ali Moussa HY, Gupta V, de la Fuente A, Kim HG, Stanton LW, Park Y.
In-Text Gene Mentions

…transcription factor 2 (POU3F2, also known as…

Show Full Abstract

Autism spectrum disorder (ASD) is a complex and heterogeneous neurodevelopmental disorder linked to numerous rare, inherited, and arising de novo genetic variants. ASD often co-occurs with attention-deficit hyperactivity disorder and epilepsy, which are associated with hyperexcitability of neurons. However, the physiological and molecular mechanisms underlying hyperexcitability in ASD remain poorly understood. Transient receptor potential canonical-6 (TRPC6) is a Ca<sup>2+</sup>-permeable cation channel that regulates store-operated calcium entry (SOCE) and is a candidate risk gene for ASD. Using human pluripotent stem cell (hPSC)-derived cortical neurons, single-cell calcium imaging, and electrophysiological recording, we show that TRPC6 knockout (KO) reduces SOCE signaling and leads to hyperexcitability of neurons by increasing action potential frequency and network burst frequency. Our data provide evidence that reduction of SOCE by TRPC6 KO results in neuronal hyperexcitability, which we hypothesize is an important contributor to the cellular pathophysiology underlying hyperactivity in some ASD.

HTTSOX6
Also flagged:Neurodegenerative disorderscognitionMultiple SclerosisMSneurodegenerative diseaseaxons
Journal Article 2023-08-08 ✓ 5 Snippets Pozojevic J, Spielmann M.
In-Text Gene Mentions

A study that applied snRNA-seq on white matter areas of post-mortem human brains found decreased amounts of nuclei from OPC (expressing PDGFRA, BCAN, and SOX6) and an intermediate ODC subpopulation (that expressed OPALIN and LINC00844) in MS lesions.

Initial neuroanatomical and molecular investigations established the brain regions affected in these disorders as well as the pathogenic events: the entorhinal cortex is primarily affected in AD, with deposits of amyloid beta and tau protein [2], and a progressive loss of dopaminergic neurons in the substantia nigra occurs in PD [3], while striatum is the affected tissue in HD that is caused by CAG repeat expansion in the huntingtin gene (HTT) [4] (Fig. 1).

…BCAN , andSOX6) and an…

…huntingtin gene (HTT) [ 4…

…huntingtin gene (HTT).…

Show Full Abstract

Neurodegenerative disorders are typically characterized by late onset progressive damage to specific (sub)populations of cells of the nervous system that are essential for mobility, coordination, strength, sensation, and cognition. Addressing this selective cellular vulnerability has become feasible with the emergence of single-cell-omics technologies, which now represent the state-of-the-art approach to profile heterogeneity of complex tissues including human post-mortem brain at unprecedented resolution. In this review, we briefly recapitulate the experimental workflow of single-cell RNA sequencing and summarize the recent knowledge acquired with it in the most common neurodegenerative diseases: Parkinson's, Alzheimer's, Huntington's disease, and multiple sclerosis. We also discuss the possibility of applying single-cell approaches in the diagnostics and therapy of neurodegenerative disorders, as well as the limitations. While we are currently at the point of deeply exploring the transcriptomic changes in the affected cells, further technological developments hold a promise of manipulating the affected pathways once we understand them better.

HTT
Also flagged:locomotionCas9Notchgene expressionkinasesion channels
Journal Article 2023-08-08 ✓ 1 Snippet Rocha JJ, Jayaram SA, Stevens TJ, Muschalik N, Shah RD, Emran S, Robles C, Freeman M, Munro S.
In-Text Gene Mentions

…extreme case ishtt, the Drosophila ortholog…

Show Full Abstract

The human genome encodes approximately 20,000 proteins, many still uncharacterised. It has become clear that scientific research tends to focus on well-studied proteins, leading to a concern that poorly understood genes are unjustifiably neglected. To address this, we have developed a publicly available and customisable "Unknome database" that ranks proteins based on how little is known about them. We applied RNA interference (RNAi) in Drosophila to 260 unknown genes that are conserved between flies and humans. Knockdown of some genes resulted in loss of viability, and functional screening of the rest revealed hits for fertility, development, locomotion, protein quality control, and resilience to stress. CRISPR/Cas9 gene disruption validated a component of Notch signalling and 2 genes contributing to male fertility. Our work illustrates the importance of poorly understood genes, provides a resource to accelerate future research, and highlights a need to support database curation to ensure that misannotation does not erode our awareness of our own ignorance.

Also flagged:Tamoxifenestrogen receptorhormone-responsive cancersTMXestrogen receptorsadiponectin
Journal Article 2023-08-08 No Snippets Morris EA, Abreu A, Scordilis SP.
Show Full Abstract

Tamoxifen (TMX), a selective estrogen receptor modulator, is commonly used in the treatment of hormone-responsive cancers. However, the effects of TMX in anabolic tissues harboring estrogen receptors, such as skeletal muscle, are poorly understood. We report a tandem mass-tag approach to TMX-treated myogenesis in C<sub>2</sub>C<sub>12</sub> cells, a well-characterized model of <i>in vitro</i> murine skeletal muscle differentiation. A longitudinal analysis of >10,000 proteins identified in untreated C<sub>2</sub>C<sub>12</sub> myogenesis revealed a novel subset of 1,062 myogenically regulated proteins. These proteins clustered into five distinct longitudinal expression trends which significantly overlap those obtained in similar analyses performed in human myocytes. We document a specific functional enrichment for adiponectin-signaling unique to TMX-treated myogenesis, as well as a subset of 198 proteins that are differentially expressed in TMX-treated cells relative to controls at one or more stages of myogenesis, the majority of which were involved in steroid and lipid metabolism. Further analysis highlights metallothionein-1 as a novel target of TMX treatment at each stage of C<sub>2</sub>C<sub>12</sub> myogenesis. Finally, we present a powerful, self-validating pipeline for analyzing the total proteomic response to <i>in vitro</i> treatment across every stage of muscle cell development which can be easily adapted to study the effects of other drugs on myogenesis.

HTT
Also flagged:IKBKBserinephosphorylationinhibitor of nuclear factor kappa B kinase subunit betaS13kinase
Journal Article 2023-08-08 ✓ 5 Snippets Cariulo C, Martufi P, Verani M, Toledo-Sherman L, Lee R, Dominguez C, Petricca L, Caricasole A.
In-Text Gene Mentions

Parallel advances in developing assays that can specifically detect and quantify HTT phosphorylation have provided the required tools to study these PTMs in HD models, identifying potential modulators of endogenous HTT phosphorylation (Cariulo et al, 2017, 2019).

Although these findings suggest that inhibition of canonical IKK signalling lead to decreased toxicity and lower expression of mutant HTT, conditional IKBKB knock-out worsens the phenotype in a mouse model of HD (Ochaba et al, 2019).

Recent discoveries of pharmacological modulators of kinase activity (Simpson et al, 2009; Ferguson & Gray, 2018), open the possibility of developing candidate tools to better increase our understanding of the mechanisms involved in modulating HTT phosphorylation and their contribution to HD pathophysiology.

Second, through the identification of non-canonical, IRF-mediated IKK-signalling pathway, resulting in increased pS13 HTT levels distinct from the canonical, IKK complex–mediated pathway, whose activity contributes to HD and to regulation of HTT expression.

Although some pharmacological tools demonstrated to increase pS13/pS16 HTT levels have shown benefit in animal and cellular models of HD, modifying different phenotypes including mutant HTT aggregation (Di Pardo et al, 2012; Alpaugh et al, 2017; Bowie et al, 2018), the lack of suitable direct genetic modulators of pS13/pS16 HTT levels have so far limited the capacity to determine if effects of phosphor-mimetic mutations are indeed a true phenocopy of increased phosphorylation.

Show Full Abstract

N-terminal phosphorylation at residues T3 and S13 is believed to have important beneficial implications for the biological and pathological properties of mutant huntingtin, where inhibitor of nuclear factor kappa B kinase subunit beta (IKBKB) was identified as a candidate regulator of huntingtin N-terminal phosphorylation. The paucity of mechanistic information on IKK pathways, together with the lack of sensitive methods to quantify endogenous huntingtin phosphorylation, prevented detailed study of the role of IKBKB in Huntington's disease. Using novel ultrasensitive assays, we demonstrate that IKBKB can regulate endogenous S13 huntingtin phosphorylation in a manner, dependent on its kinase activity and known regulators. We found that the ability of IKBKB to phosphorylate endogenous huntingtin S13 is mediated through a non-canonical interferon regulatory factor3-mediated IKK pathway, distinct from the established involvement of IKBKB in mutant huntingtin's pathological mechanisms mediated via the canonical pathway. Furthermore, increased huntingtin S13 phosphorylation by IKBKB resulted in decreased aggregation of mutant huntingtin in cells, again dependent on its kinase activity. These findings point to a non-canonical IKK pathway linking S13 huntingtin phosphorylation to the pathological properties of mutant huntingtin aggregation, thought to be significant to Huntington's disease.

HTT
Also flagged:cancerbreast cancerTP53tumor suppressor genesdegradationTSG
Journal Article 2023-08-08 ✓ 1 Snippet Wang F, Xu Y, Wang R, Zhang B, Smith N, Notaro A, Gaerlan S, Kutschera E, Kadash-Edmondson KE, Xing Y, Lin L.
In-Text Gene Mentions

…DAB1, DLG4, GRIN1,HTT, LRP8, MAPT, NRXN1,…

Show Full Abstract

Long-read RNA sequencing (RNA-seq) is a powerful technology for transcriptome analysis, but the relatively low throughput of current long-read sequencing platforms limits transcript coverage. One strategy for overcoming this bottleneck is targeted long-read RNA-seq for preselected gene panels. We present TEQUILA-seq, a versatile, easy-to-implement, and low-cost method for targeted long-read RNA-seq utilizing isothermally linear-amplified capture probes. When performed on the Oxford nanopore platform with multiple gene panels of varying sizes, TEQUILA-seq consistently and substantially enriches transcript coverage while preserving transcript quantification. We profile full-length transcript isoforms of 468 actionable cancer genes across 40 representative breast cancer cell lines. We identify transcript isoforms enriched in specific subtypes and discover novel transcript isoforms in extensively studied cancer genes such as TP53. Among cancer genes, tumor suppressor genes (TSGs) are significantly enriched for aberrant transcript isoforms targeted for degradation via mRNA nonsense-mediated decay, revealing a common RNA-associated mechanism for TSG inactivation. TEQUILA-seq reduces the per-reaction cost of targeted capture by 2-3 orders of magnitude, as compared to a standard commercial solution. TEQUILA-seq can be broadly used for targeted sequencing of full-length transcripts in diverse biomedical research settings.

Also flagged:reverse transcriptionbrain developmentChromiumgene expressiondeathparaformaldehyde
Journal Article 2023-08-08 No Snippets De Jonghe J, Kaminski TS, Morse DB, Tabaka M, Ellermann AL, Kohler TN, Amadei G, Handford CE, Findlay GM, Zernicka-Goetz M, Teichmann SA, Hollfelder F.
Show Full Abstract

Droplet microfluidic methods have massively increased the throughput of single-cell sequencing campaigns. The benefit of scale-up is, however, accompanied by increased background noise when processing challenging samples and the overall RNA capture efficiency is lower. These drawbacks stem from the lack of strategies to enrich for high-quality material or specific cell types at the moment of cell encapsulation and the absence of implementable multi-step enzymatic processes that increase capture. Here we alleviate both bottlenecks using fluorescence-activated droplet sorting to enrich for droplets that contain single viable cells, intact nuclei, fixed cells or target cell types and use reagent addition to droplets by picoinjection to perform multi-step lysis and reverse transcription. Our methodology increases gene detection rates fivefold, while reducing background noise by up to half. We harness these properties to deliver a high-quality molecular atlas of mouse brain development, despite starting with highly damaged input material, and provide an atlas of nascent RNA transcription during mouse organogenesis. Our method is broadly applicable to other droplet-based workflows to deliver sensitive and accurate single-cell profiling at a reduced cost.

Also flagged:Esophageal squamous precancerous lesionsesophageal squamous cell carcinomaESCCintraepithelial neoplasiaTAGLN2CRNN
Journal Article 2023-08-08 No Snippets Liu X, Zhao S, Wang K, Zhou L, Jiang M, Gao Y, Yang R, Yan S, Zhang W, Lu B, Liu F, Zhao R, Liu W, Zhang Z, Liu K, Li X, Dong Z.
Show Full Abstract

Esophageal squamous precancerous lesions (ESPL) are the precursors of esophageal squamous cell carcinoma (ESCC) including low-grade and high-grade intraepithelial neoplasia. Due to the absence of molecular indicators, which ESPL will eventually develop into ESCC and thus should be treated is not well defined. Indicators, for predicting risks of ESCC at ESPL stages, are an urgent need. We perform spatial whole-transcriptome atlas analysis, which can eliminate other tissue interference by sequencing the specific ESPL regions. In this study, the expression of TAGLN2 significantly increases, while CRNN expression level decreases along the progression of ESCC. Additionally, TAGLN2 protein level significantly increases in paired after-progression tissues compared with before-progression samples, while CRNN expression decreases. Functional studies suggest that TAGLN2 promotes ESCC progression, while CRNN inhibits it by regulating cell proliferation. Taken together, TAGLN2 and CRNN are suggested as candidate indicators for the risk of ESCC at ESPL stages.

FBXL4
Also flagged:Gene expressionerythropoiesissickle cell anemiaerythrocytosishypoxia inducible factorsLNX2
Journal Article 2023-08-08 ✓ 1 Snippet Zhang X, Song J, Shah BN, Han J, Hassan T, Miasniakova G, Sergueeva A, Nekhai S, Machado RF, Gladwin MT, Saraf SL, Prchal JT, Gordeuk VR.
In-Text Gene Mentions

…catabolic process" (FBXL4, FBXO9, GCLC, NEDD4L,…

Show Full Abstract

Transcriptional changes in compensatory erythropoiesis in sickle cell anemia (SCA) and their disease modulation are unclear. We detected 1226 differentially expressed genes in hemoglobin SS reticulocytes compared to non-anemic hemoglobin AA controls. Assessing developmental expression changes in hemoglobin AA erythroblasts for these genes suggests heightened terminal differentiation in early erythroblasts in SCA that diminishes toward the polychromatic to orthochromatic stage transition. Comparison of reticulocyte gene expression changes in SCA with that in Chuvash erythrocytosis, a non-anemic disorder of increased erythropoiesis due to constitutive activation of hypoxia inducible factors, identified 453 SCA-specific changes attributable to compensatory erythropoiesis. Peripheral blood mononuclear cells (PBMCs) in SCA contain elevated proportions of erythroid progenitors due to heightened erythropoiesis. Deconvolution analysis in PBMCs from 131 SCA patients detected 54 genes whose erythroid expression correlated with erythropoiesis efficiency, which were enriched with SCA-specific changes (OR = 2.9, P = 0.00063) and annotation keyword "ubiquitin-dependent protein catabolic process", "protein ubiquitination", and "protein polyubiquitination" (OR = 4.2, P = 7.5 × 10<sup>-5</sup>). An erythroid expression quantitative trait locus of one of these genes, LNX2 encoding an E3 ubiquitin ligase, associated with severe pain episodes in 774 SCA patients (OR = 1.7, P = 3.9 × 10<sup>-5</sup>). Thus, erythroid gene transcription responds to unique conditions within SCA erythroblasts and these changes potentially correspond to vaso-occlusive manifestations.

TNFSF4
Also flagged:Hepatocellular carcinomacell differentiationphosphoric ester hydrolaseeukaryotic initiation factor 4Ebindingribosome
Journal Article 2023-08-08 ✓ 1 Snippet Qiu J, Wang H, Lv X, Mao L, Huang J, Hao T, Li J, Qi S, Chen G, Jiang H.
In-Text Gene Mentions

…YTHDF1, VTCN1, TNFSF9,TNFSF4, TNFSF18, TNFRSF9, TNFRSF18,…

Show Full Abstract

The aim of this study is to explore a novel classification and investigate the clinical significance of hepatocellular carcinoma (HCC) cells. We analyzed integrated single-cell RNA sequencing and bulk RNA-seq data obtained from HCC samples. Cell trajectory analysis divided HCC cells into three subgroups with different differentiation states: state 1 was closely related to phosphoric ester hydrolase activity, state 2 was involved in eukaryotic initiation factor 4E binding, translation regulator activity and ribosome, and state 3 was associated with oxidoreductase activity and metabolism. Three molecular classes based on HCC differentiation-related genes (HDRGs) from HCC samples were identified, which revealed immune checkpoint gene expression and overall survival (OS) of HCC patients. Moreover, a prognostic risk scoring (RS) model was generated based on eight HDRGs, and the results showed that the OS of the high-risk group was worse than that of the low-risk group. Further, potential therapeutic drugs were screened out based on eight prognostic RS-HDRGs. This study highlights the importance of HCC cell differentiation in immunotherapy, clinical prognosis, and potential molecular-targeted drugs for HCC patients, and proposes a direction for the development of individualized treatments for HCC.

SERPINC1
Also flagged:glycocalyxsepsissynthesisglycosaminoglycansheparan sulfatesyndecan-1
Journal Article 2023-08-08 ✓ 1 Snippet Ying J, Zhang C, Wang Y, Liu T, Yu Z, Wang K, Chen W, Zhou Y, Lu G.
In-Text Gene Mentions

…that SDX decreasedheparinase-III-induced endothelial permeabil…

Show Full Abstract

<h4>Background</h4>Degradation of the endothelial glycocalyx is critical for sepsis-associated lung injury and pulmonary vascular permeability. We investigated whether sulodexide, a precursor for the synthesis of glycosaminoglycans, plays a biological role in glycocalyx remodeling and improves endothelial barrier dysfunction in sepsis.<h4>Methods</h4>The number of children with septic shock that were admitted to the PICU at Children's Hospital of Fudan University who enrolled in the study was 28. On days one and three after enrollment, venous blood samples were collected, and heparan sulfate, and syndecan-1 (SDC1) were assayed in the plasma. We established a cell model of glycocalyx shedding by heparinase III and induced sepsis in a mouse model via lipopolysaccharide (LPS) injection and cecal ligation and puncture (CLP). Sulodexide was administrated to prevent endothelial glycocalyx damage. Endothelial barrier function and expression of endothelial-related proteins were determined using permeability, western blot and immunofluorescent staining. The survival rate, histopathology evaluation of lungs and wet-to-dry lung weight ratio were also evaluated.<h4>Results</h4>We found that circulating SDC1 levels were persistently upregulated in the non-alive group on days 1 and 3 and were positively correlated with IL-6 levels. Receiver operating characteristic curve analysis showed that SDC1 could distinguish patients with mortality. We showed that SDC1-shedding caused endothelial permeability in the presence of heparinase III and sepsis conditions. Mechanistically, sulodexide (30 LSU/mL) administration markedly inhibited SDC1 shedding and prevented endothelial permeability with zonula occludens-1 (ZO-1) upregulation via NF-κB/ZO-1 pathway. In mice with LPS and CLP-induced sepsis, sulodexide (40 mg/kg) administration decreased the plasma levels of SDC1 and increased survival rate. Additionally, sulodexide alleviated lung injury and restored endothelial glycocalyx damage.<h4>Conlusions</h4>In conclusion, our data suggest that SDC1 predicts prognosis in children with septic shock and sulodexide may have therapeutic potential for the treatment of sepsis-associated endothelial dysfunction.

OLFM4
Also flagged:multifactorialtype 1 diabetestype 2 diabetespolyradiculoneuropathypathogenesisnucleotide
Journal Article 2023-08-08 ✓ 1 Snippet Glotov OS, Chernov AN, Glotov AS.
In-Text Gene Mentions

Among them, the most statistical significances with T2D were as follows: rs10916784 (1: 20729451, G, p = 5.2 × 10−12) in the von Willebrand factor A domain containing 5B1 (VWA5B1) gene, rs74790763 (5:122675214, C, p = 3.2 × 10−11) in the centrosomal protein 120 (CEP120) gene, rs62486442 (8:12623463, A, p = 2.4 × 10−10) in the LON peptidase N-terminal domain and ring finger 1 protein (LONRF1) gene, rs13257283 (8:105608497, G, p = 4.2 × 10−8) in the LDL receptor related protein 12 (LRP12) gene, and rs9568861 (13:54079446, T, p = 2.5 × 10−8) in the olfactomedin 4 (OLFM4) gene.

Show Full Abstract

Today, whole-exome sequencing (WES) is used to conduct the massive screening of structural and regulatory genes in order to identify the allele frequencies of disease-associated polymorphisms in various populations and thus detect pathogenic genetic changes (mutations or polymorphisms) conducive to malfunctional protein sequences. With its extensive capabilities, exome sequencing today allows both the diagnosis of monogenic diseases (MDs) and the examination of seemingly healthy populations to reveal a wide range of potential risks prior to disease manifestation (in the future, exome sequencing may outpace costly and less informative genome sequencing to become the first-line examination technique). This review establishes the human genetic passport as a new WES-based clinical concept for the identification of new candidate genes, gene variants, and molecular mechanisms in the diagnosis, prediction, and treatment of monogenic, oligogenic, and multifactorial diseases. Various diseases are addressed to demonstrate the extensive potential of WES and consider its advantages as well as disadvantages. Thus, WES can become a general test with a broad spectrum pf applications, including opportunistic screening.

PEBP1
Also flagged:cancernucleotidesnucleotidePseudogenesretrotranspositionsynthesis
Journal Article 2023-08-08 ✓ 1 Snippet Nakamura-García AK, Espinal-Enríquez J.
In-Text Gene Mentions

Exerts tumor suppressive effects by recruiting the YBX1/ELAVL1 complex to stabilize PEBP1; additionally, can act as a ceRNA for KLF13 sponging several miRNAs

Show Full Abstract

Pseudogenes are duplicates of protein-coding genes that have accumulated multiple detrimental alterations, rendering them unable to produce the protein they encode. Initially disregarded as "junk DNA" due to their perceived lack of functionality, research on their biological roles has been hindered by this assumption. Nevertheless, recent focus has shifted towards these molecules due to their abnormal expression in cancer phenotypes. In this review, our objective is to provide a thorough overview of the current understanding of pseudogene formation, the mechanisms governing their expression, and the roles they may play in promoting tumorigenesis.

POU3F2
Also flagged:BRAFMelanomaskin canceroncogenesMEKERK
Journal Article 2023-08-08 ✓ 1 Snippet Castellani G, Buccarelli M, Arasi MB, Rossi S, Pisanu ME, Bellenghi M, Lintas C, Tabolacci C.
In-Text Gene Mentions

ACAT2, Acetyl-Coenzyme A acetyltransferase 2; ADCY, adenylate cyclase; AIR, antisense of IGF2R non-protein coding RNA; AMPK, AMP-activated protein kinase; ARID2, AT-rich interaction domain 2; ASK1, apoptosis signal-regulating kinase 1; ATF4, activating transcription factor 4; AXL, AXL receptor tyrosine kinase; BCL-2, B-cell lymphoma 2; BIM, Bcl-2 interacting mediator of cell death; BRAF, v-raf murine sarcoma viral oncogene homolog B1; CAFs, cancer-associated fibroblasts; cAMP, cyclic adenosine monophosphate; Cdc42, cell division cycle 42; CDK2, cyclin-dependent kinase 2; CDKN2A, cyclin-dependent kinase inhibitor 2A; C-JUN, Jun proto-oncogene, AP-1 transcription factor subunit; C-MET, MET proto-oncogene, receptor tyrosine kinase; CREB, cAMP Response Element-binding Protein; CTLA-4; Cytotoxic T-Lymphocyte Antigen 4; CXCL, C-X-C motif chemokine ligand; CXCR, C-X-C motif chemokine receptor; DHCR24, 24-dehydrocholesterol reductase; DRP1, dynamin-related protein 1; DUSP9, dual specificity phosphatase 9; E2F, E2F transcription factor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; EMICERI, EQTN MOB3B IFNK C9orf72 enhancer RNA I; ER, endoplasmic reticulum; ERK, extracellular regulated MAP kinase; FASN, fatty acid synthase; FDA, U.S. Food and Drug Administration; FGF, fibroblast growth factor; FGFR, fibroblast growth factor receptor; FOXO, Forkhead Box O1; FRA1, FOS-related antigen 1; GLUT1, glucose transporter 1; HDAC, histone deacetylase; HGF, hepatocyte growth factor; HIF-1 α, hypoxia-inducible factor-1α; HK2, hexokinase 2; HOXD8, homeobox D8; IDH1, isocitrate dehydrogenase (NADP(+)) 1; IFN-γ, interferon-γ; IGF-1, insulin-like growth factor 1; IGFBP3, insulin-like growth factor binding protein 3; IGFR, insulin-like growth factor 1 receptor; IL, interleukin; IP-10, interferon γ-induced protein10; IQGAP1, IQ motif containing GTPase activating protein 1; IRE1, inositol requiring enzyme 1; JNK, jun N-terminal kinase; KDM, lysine demethylase; KIT, KIT proto-oncogene receptor tyrosine kinase; LDH, lactate dehydrogenase; LKB1, liver kinase B 1; MAP2K1, mitogen-activated protein kinase kinase 1; MAPK, mitogen-activated protein kinase; MART-1 (MELAN-A) melanoma antigen recognised by T cells 1; MCP2, monocyte chemoattractant protein 2; MHC, major histocompatibility complex; microRNAs, miRNAs; MIP, macrophage inflammatory protein; MIRAT, MAPK inhibitor resistance-associated transcript; MITF, melanocyte inducing transcription factor; MMP, matrix metalloproteinase; MOB3B, MOB kinase activator 3B; mTOR, mammalian target of rapamycin; MYC, MYC proto-oncogene, BHLH transcription factor; NAMPT, nicotinamide phosphoribosyltransferase; NF1, neurofibromin 1; NF-κB, nuclear factor kappa B; ncRNAs, non-coding RNAs; NK, natural killer cells; NKT, natural killer T cells; NRAS, neuroblastoma ras viral oncogene homolog; NRG1, neuregulin 1; PAR-1, protease-activated receptor 1; PARP-1, poly(ADP-ribose) polymerase 1; PC, pyruvate carboxylase; PD-1; programmed cell death receptor 1; PDGF-BB, platelet-derived growth factor-BB; PDGFR, platelet-derived growth factor receptor; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; PD-L1, programmed cell death ligand 1; PERK, protein kinase R (PKR)-like endoplasmic reticulum kinase; PGC-1α, peroxisome proliferator-activated receptor-γ coactivator 1α; PGES, prostaglandin E synthase; PI3K, phosphoinositide 3-kinase; PKA, protein kinase A; PKM2, Pyruvate Kinase M1/2; PMEL17, premelanosome protein; POU3F2, POU Class 3 Homeobox 2; PTEN, phosphatase and tensin homolog; RAC1, rac family small GTPase1; RANTES, regulated upon activation, normal T cell expressed and presumably secreted; RHOB, ras homolog family member B; ROR2, receptor tyrosine kinase-like orphan receptor 2; ROS, reactive oxygen species; RTK, receptor tyrosine kinase; S100B, S100 calcium binding protein B; SAMMSON, survival associated mitochondrial melanoma specific oncogenic non-coding RNA; SCD, Stearoyl-CoA desaturase 1; SDF-1, stromal cell-derived factor 1; SOAT, sterol O-acyltransferase; SOX, SRY-related transcription factor HMG box; SPRY2, sprouty 2; SREBP-1, sterol regulator element binding protein 1; STAT-3, signal transducer and activator of transcription 3; TAMs, tumour-associated macrophages; TAZ (WWTR1) WW domain containing transcription regulator 1; TEAD, TEA domain transcription factor; TERT, telomerase reverse transcriptase; TFEB, transcription factor EB; TGF-β, transforming growth factor-β; TME, tumour microenvironment; TNF-α, tumour necrosis factor α; TP53, tumour protein p53; TRAF2, TNF receptor associated factor 2; TRB3, tribbles pseudokinase 3; Tregs, regulatory T cells; TYRP, tyrosinase-related protein; ULK1, unc-51 like autophagy activating kinase 1; uPA, plasminogen activator, urokinase; uPAR, plasminogen activator, urokinase receptor; VEGF, vascular endothelial growth factor; WNT5A, Wnt family member 5A; YAP, Yes1 associated transcriptional regulator; ZEB, zinc finger E-box binding protein; Zeb2NAT, zinc finger AE-binding homeobox 2-natural antisense transcript; Zfas, antisense to zinc finger NFX1; α-MSH, α-melanocyte-stimulating hormone; α-SMA, α-smooth muscle actin.

Show Full Abstract

Melanoma is an aggressive form of skin cancer resulting from the malignant transformation of melanocytes. Recent therapeutic approaches, including targeted therapy and immunotherapy, have improved the prognosis and outcome of melanoma patients. BRAF is one of the most frequently mutated oncogenes recognised in melanoma. The most frequent oncogenic BRAF mutations consist of a single point mutation at codon 600 (mostly V600E) that leads to constitutive activation of the BRAF/MEK/ERK (MAPK) signalling pathway. Therefore, mutated BRAF has become a useful target for molecular therapy and the use of BRAF kinase inhibitors has shown promising results. However, several resistance mechanisms invariably develop leading to therapeutic failure. The aim of this manuscript is to review the role of BRAF mutational status in the pathogenesis of melanoma and its impact on differentiation and inflammation. Moreover, this review focuses on the mechanisms responsible for resistance to targeted therapies in BRAF-mutated melanoma and provides an overview of circulating biomarkers including circulating tumour cells, circulating tumour DNA, and non-coding RNAs.

ZNFX1
Also flagged:Notch1Cancerstissue developmenthealthtranslationalNOTCH receptors
Journal Article 2023-08-08 ✓ 2 Snippets Kałafut J, Czerwonka A, Czapla K, Przybyszewska-Podstawka A, Hermanowicz JM, Rivero-Müller A, Borkiewicz L.
In-Text Gene Mentions

A slightly different mode of NOTCH1 regulation via lncRNAs has been reported in head and neck squamous cell carcinoma (HNSCC) patients, whose low expression of lncRNA ZFAS1 (ZNFX1 antisense RNA 1) correlated with the upregulation of NOTCH1 and better survival, suggesting an oncogenic role of this lncRNA.

…lncRNA ZFAS1 (ZNFX1antisense RNA 1…

Show Full Abstract

Notch1 signalling plays a multifaceted role in tissue development and homeostasis. Currently, due to the pivotal role of Notch1 signalling, the relationship between NOTCH1 expression and the development of health disorders is being intensively studied. Nevertheless, Notch1 signalling is not only controlled at the transcriptional level but also by a variety of post-translational events. First is the ligand-dependent mechanical activation of NOTCH receptors and then the intracellular crosstalk with other signalling molecules-among those are long non-coding RNAs (lncRNAs). In this review, we provide a detailed overview of the specific role of lncRNAs in the modulation of Notch1 signalling, from expression to activity, and their connection with the development of health disorders, especially cancers.

Also flagged:Glycerol AdipateTocopherolCholesterolTriple-Negative Breast Cancerglycerolpolyesters
Journal Article 2023-08-08 No Snippets Suksiriworapong J, Achayawat C, Juangrattanakamjorn P, Taresco V, Crucitti VC, Sakchaisri K, Bunsupa S.
Show Full Abstract

This study aimed to fabricate new variations of glycerol-based polyesters by grafting poly(glycerol adipate) (PGA) with hydrophobic bioactive moieties, tocopherol (TOC), and cholesterol (CHO). Their effects on nanoparticle (NP) formation, drug release, and cellular responses in cancer and normal cells were evaluated. CHO and TOC were successfully grafted onto PGA backbones with 30% and 50% mole grafting. Increasing the percentage of mole grafting in both molecules increased the glass transition temperature and water contact angle of the final polymers but decreased the critical micelle concentration of the formulated particles. PGA-TOC NPs reduced the proliferation of MDA-MB-231 cancer cells. However, they enhanced the proliferation of primary dermal fibroblasts within a specific concentration range. PGA-CHO NPs minimally affected the growth of cancer and normal cells. Both types of NPs did not affect apoptosis or the cell cycle of cancer cells. PGA-CHO and PGA-TOC NPs were able to entrap SN-38, a hydrophobic anticancer drug, with a particle size <200 nm. PGA-CHO NPs had a higher drug loading capacity and a greater drug release than PGA-TOC NPs. However, SN-38-loaded PGA-TOC NPs showed higher toxicity than SN-38 and SN-38-loaded PGA-CHO NPs due to the combined effects of antiproliferation and higher cellular uptake. Compared with SN-38, the drug-loaded NPs more profoundly induced sub-G1 in the cell cycle analysis and apoptosis of cancer cells in a similar pattern. Therefore, PGA-CHO and PGA-TOC polymers have potential applications as delivery systems for anticancer drugs.

Also flagged:CADASILsmall vessel diseasechoreamovement disordersD2 receptorhaloperidol
Journal Article 2023-08-08 No Snippets Kim MS, Park DG, Yoon JH.
Show Full Abstract

No abstract available.

Also flagged:CAPHDHuntingtonneurogenerativehuntingtin gene 1aquaporin-4
Journal Article 2023-08-07 No Snippets Hett K, Eisma JJ, Hernandez AB, McKnight CD, Song A, Elenberger J, Considine C, Donahue MJ, Claassen DO.
Show Full Abstract

<h4>Objective</h4>Investigations of cerebrospinal fluid (CSF) flow aberrations in Huntington's disease (HD) are of growing interest, as impaired CSF flow may contribute to mutant Huntington retention and observed heterogeneous responsiveness to intrathecally administered therapies.<h4>Method</h4>We assessed net cerebral aqueduct CSF flow and velocity in 29 HD participants (17 premanifest and 12 manifest) and 51 age- and sex matched non-HD control participants using 3-Tesla magnetic resonance imaging methods. Regression models were applied to test hypotheses regarding: (i) net CSF flow and cohort, (ii) net CSF flow and disease severity (CAP-score), and (iii) CSF volume after correcting for age and sex.<h4>Results</h4>Group-wise analyses support a decrease in net CSF flow in HD (mean 0.14 ± 0.27 mL/min) relative to control (mean 0.32 ± 0.20 mL/min) participants (p = 0.02), with lowest flow in the manifest HD cohort (mean 0.04 ± 0.25 mL/min). This finding was explained by hyperdynamic CSF movement, manifesting as higher caudal systolic CSF flow velocity and higher diastolic cranial CSF flow velocity across the cardiac cycle, in HD (caudal flow: 0.17 ± 0.07 mL/s, cranial flow: 0.14 ± 0.08 mL/s) compared to control (caudal flow: 0.13 ± 0.06 mL/s, cranial flow: 0.11 ± 0.04 mL/s) participants. A positive correlation between cranial diastolic flow and disease severity was observed (p = 0.02).<h4>Interpretations</h4>Findings support aqueductal CSF flow dynamics changing with disease severity in HD. These accelerated changes are consistent with changes observed over the typical adult lifespan, and may have relevance to mutant Huntington retention and intrathecally administered therapeutics responsiveness. ANN NEUROL 2023;94:885-894.

Also flagged:Brugada syndromeventricular arrhythmiasdeathsudden infant death syndromesudden unexpected nocturnal death syndromeSCN5A
Journal Article 2023-08-07 No Snippets Pham HM, Dang DP, Ta TD, Le TP, Phan DP, Trinh HA, Tran TV, Luong TLA, Nguyen HM, Bui TH, Tran TH, Ta TV, Tran VK.
Show Full Abstract

<h4>Background</h4>Brugada syndrome (BrS) is a rare genetic disease that causes sudden cardiac death (SCD) and arrhythmia. SCN5A pathogenic variants (about 30% of diagnosed patients) are responsible for BrS.<h4>Aims</h4>Lack of knowledge regarding molecular characteristics and the correlation between genotype and phenotype interfere with the risk stratification and finding the optimal treatment in Vietnam. Therefore, we identified SCN5A variants and evaluated the genotype-phenotype correlation of BrS on 117 Vietnamese probands.<h4>Materials and methods</h4>The clinical characteristics and blood samples of BrS patients were collected. To determine SCN5A variants, Sanger sequencing was conducted, and subsequently, these variants were analyzed by bioinformatic tools.<h4>Results</h4>In this cohort, the overall rate of detected variants in SCN5A was 25.6%, which could include both pathogenic and benign variants. In genetic testing, 21 SCN5A variants were identified, including eight novels and 15 published variants. Multiple bioinformatic tools were used to predict variant effect with c.551A>G, c.1890+14G>A, c.3338C>T, c.3578G>A, and c.5484C>T as benign, while other variants were predicted as disease-causing. The family history of SCD (risk ratio [RR] = 4.324, 95% CI: 2.290-8.269, p < 0.001), syncope (RR = 3.147, 95% CI: 1.668-5.982, p = 0.0004), and ventricular tachycardia/ventricular fibrillation (RR = 3.406, 95% CI: 1.722-5.400, p = 0.0035) presented a significantly higher risk in the SCN5A (+) group, consisting of individuals carrying any variant in the SCN5A gene, compared to SCN5A (-) individuals.<h4>Conclusion</h4>The results contribute to clarifying the impact of SCN5A variants on these phenotypes. Further follow-up studies need to be carried out to understand the functional effects of these SCN5A variants on the severity of BrS.

HTT
Also flagged:polycystic ovary syndromecircadian rhythmsleepPCOShyperinsulinemiahyperandrogenism
Journal Article 2023-08-07 ✓ 1 Snippet Amin SN, Asali F, Aolymat I, Abuquteish D, Abu Al Karsaneh O, El Gazzar WB, Shaltout SA, Alabdallat YJ, Elberry DA, Kamar SS, Hosny SA, Mehesen MN, Rashed LA, Farag AM, ShamsEldeen AM.
In-Text Gene Mentions

Treatmentwith MitoQ10 or HTT partially reversed the reproductive, endocrine, and structural features of PCOS, leading to a decreased amplitude of isolated uterine contractions, ovarian cystic changes and size, and endometrial thickness.

Show Full Abstract

Environmental factors, such as sleep restriction, contribute to polycystic ovary syndrome (PCOS) by causing hyperinsulinemia, hyperandrogenism, insulin resistance, and oligo- or anovulation. This study aimed to evaluate the effects of circadian rhythm disruption on reproductive and metabolic functions and investigate the potential therapeutic benefits of MitoQ10 and hot tub therapy (HTT). Sixty female rats were divided into six groups: control, MitoQ10, HTT, and three groups with PCOS induced by continuous light exposure(L/L). The reproductive, endocrine, and structural manifestations ofL/L-induced PCOS were confirmed by serum biochemical measurements, ultrasound evaluation of ovarian size, and vaginal smear examination at week 14. Subsequently, the rats were divided into the L/L (untreated), L/L+MitoQ10-treated, andL/L+HTT-treated groups. At the end of week 22, all rats were sacrificed. Treatmentwith MitoQ10 or HTT partially reversed the reproductive, endocrine, and structural features of PCOS, leading to a decreased amplitude of isolated uterine contractions, ovarian cystic changes and size, and endometrial thickness. Furthermore, both interventions improved the elevated serum levels of anti-Mullerian hormone (AMH), kisspeptin, Fibulin-1, A disintegrin and metalloproteinase with thrombospondin motifs 19 (ADAMTS-19), lipid profile, homeostatic model assessment for insulin resistance (HOMA-IR), oxidative stress markers, androgen receptors (AR) and their transcription target genes, FKBP52 immunostaining in ovarian tissues, and uterine estrogen receptor alpha (ER-α) and PRimmunostaining. In conclusion, MitoQ10 supplementation and HTT demonstrated the potential for ameliorating metabolic, reproductive, and structural perturbations associated with PCOS induced by circadian rhythm disruption. These findings suggest a potential therapeutic role for these interventions in managing PCOS in women.

SOX6
Also flagged:Skeletal dysplasiasbone and cartilage disorderscleidocranial dysplasiaacromicric dysplasiaACMICDosteogenesis imperfecta
Journal Article 2023-08-07 ✓ 1 Snippet Tantibhaedhyangkul W, Tantrapornpong J, Yutchawit N, Theerapanon T, Intarak N, Thaweesapphithak S, Porntaveetus T, Shotelersuk V.
In-Text Gene Mentions

…and Sox2 ,Sox6, and Sox13…

Show Full Abstract

<h4>Objective</h4>Skeletal dysplasia (SD) comprises more than 450 separate disorders. We hypothesized that their dental features would be distinctive and investigated the tooth characteristics of four patients with different SDs.<h4>Material and methods</h4>Four SD patients with molecularly confirmed diagnoses, Pt-1 acromicric dysplasia, Pt-2 hypophosphatasia and hypochondroplasia, Pt-3 cleidocranial dysplasia, and Pt-4 achondroplasia, were recruited. A tooth from each patient was evaluated for mineral density (micro-computerized tomography), surface roughness (surface profilometer), microhardness, mineral contents (energy-dispersive X-ray), and ultrastructure (scanning electron microscopy and histology), and compared with three tooth-type matched controls.<h4>Results</h4>Pt-1 and Pt-3 had several unerupted teeth. Pt-2 had an intact-root-exfoliated tooth at 2 years old. The lingual surfaces of the patients' teeth were significantly smoother, while their buccal surfaces were rougher, than controls, except for Pt-1's buccal surface. The patients' teeth exhibited deep grooves around the enamel prisms and rough intertubular dentin. Pt-3 demonstrated a flat dentinoenamel junction and Pt-2 had an enlarged pulp, barely detectable cementum layer, and ill-defined cemento-dentinal junction. Reduced microhardnesses in enamel, dentin, and both layers were observed in Pt-3, Pt-4, and Pt-1, respectively. Pt-1 showed reduced Ca/P ratio in dentin, while both enamel and dentin of Pt-2 and Pt-3 showed reduced Ca/P ratio.<h4>Conclusion</h4>Each SD has distinctive dental characteristics with changes in surface roughness, ultrastructure, and mineral composition of dental hard tissues.<h4>Clinical relevance</h4>In this era of precision dentistry, identifying the specific potential dental problems for each patient with SD would help personalize dental management guidelines.

PRDX6
Also flagged:ribosomal proteinspentose phosphatefatty acidBreast diseasecardiomyopathyimmune deficiencies
Journal Article 2023-08-07 ✓ 2 Snippets Schmidt CJ, Kim DK, Pendarvis GK, Abasht B, McCarthy FM.
In-Text Gene Mentions

…Peroxiredoxin 6PRDX6and RAC1 associate…

…, PRDX4 ,PRDX6) and thioredoxin…

Show Full Abstract

Chicken domestication began at least 3,500 years ago for purposes of divination, cockfighting, and food. Prior to industrial scale chicken production, domestication selected larger birds with increased egg production. In the mid-20th century companies began intensive selection with the broiler (meat) industry focusing on improved feed conversion, rapid growth, and breast muscle yield. Here we present proteomic analysis comparing the modern broiler line, Ross 708, with the UIUC legacy line which is not selected for growth traits. Breast muscle proteome analysis identifies cellular processes that have responded to human directed artificial selection. Mass spectrometry was used to identify protein level differences in the breast muscle of 6-day old chicks from Modern and Legacy lines. Our results indicate elevated levels of stress proteins, ribosomal proteins and proteins that participate in the innate immune pathway in the Modern chickens. Furthermore, the comparative analyses indicated expression differences for proteins involved in multiple biochemical pathways. In particular, the Modern line had elevated levels of proteins affecting the pentose phosphate pathway, TCA cycle and fatty acid oxidation while proteins involved in the first phase of glycolysis were reduced compared to the Legacy line. These analyses provide hypotheses linking the morphometric changes driven by human directed selection to biochemical pathways. These results also have implications for the poultry industry, specifically Wooden Breast disease which is linked to rapid breast muscle growth.

Also flagged:ACE2bindingCoV-2 infectionspike (S) glycoproteinS glycoproteinhost cells
Journal Article 2023-08-07 No Snippets Xiao S, Alshahrani M, Gupta G, Tao P, Verkhivker G.
Show Full Abstract

The new generation of SARS-CoV-2 Omicron variants displayed a significant growth advantage and increased viral fitness by acquiring convergent mutations, suggesting that the immune pressure can promote convergent evolution leading to the sudden acceleration of SARS-CoV-2 evolution. In the current study, we combined structural modeling, microsecond molecular dynamics simulations, and Markov state models to characterize conformational landscapes and identify specific dynamic signatures of the SARS-CoV-2 spike complexes with the host receptor ACE2 for the recently emerged highly transmissible XBB.1, XBB.1.5, BQ.1, and BQ.1.1 Omicron variants. Microsecond simulations and Markovian modeling provided a detailed characterization of the functional conformational states and revealed the increased thermodynamic stabilization of the XBB.1.5 subvariant, which can be contrasted to more dynamic BQ.1 and BQ.1.1 subvariants. Despite considerable structural similarities, Omicron mutations can induce unique dynamic signatures and specific distributions of the conformational states. The results suggested that variant-specific changes of the conformational mobility in the functional interfacial loops of the receptor-binding domain in the SARS-CoV-2 spike protein can be fine-tuned through crosstalk between convergent mutations which could provide an evolutionary path for modulation of immune escape. By combining atomistic simulations and Markovian modeling analysis with perturbation-based approaches, we determined important complementary roles of convergent mutation sites as effectors and receivers of allosteric signaling involved in modulation of conformational plasticity and regulation of allosteric communications. This study also revealed hidden allosteric pockets and suggested that convergent mutation sites could control evolution and distribution of allosteric pockets through modulation of conformational plasticity in the flexible adaptable regions.

Also flagged:axonsserotoninembryogenesisDlx5Ebf1GFP
Journal Article 2023-08-07 No Snippets Sinclair-Wilson A, Lawrence A, Ferezou I, Cartonnet H, Mailhes C, Garel S, Lokmane L.
Show Full Abstract

Sensory inputs are conveyed to distinct primary areas of the neocortex through specific thalamocortical axons (TCA). While TCA have the ability to reorient postnatally to rescue embryonic mistargeting and target proper modality-specific areas, how this remarkable adaptive process is regulated remains largely unknown. Here, using a mutant mouse model with a shifted TCA trajectory during embryogenesis, we demonstrated that TCA rewiring occurs during a short postnatal time window, preceded by a prenatal apoptosis of thalamic neurons-two processes that together lead to the formation of properly innervated albeit reduced primary sensory areas. We furthermore showed that preterm birth, through serotonin modulation, impairs early postnatal TCA plasticity, as well as the subsequent delineation of cortical area boundary. Our study defines a birth and serotonin-sensitive period that enables concerted adaptations of TCA to primary cortical areas with major implications for our understanding of brain wiring in physiological and preterm conditions.

SLC2A14
Also flagged:class I glucose transportercancersGLUTNSCLCadenocarcinomassquamous cell carcinomas
Journal Article 2023-08-07 ✓ 1 Snippet Nakanishi Y, Iwai M, Hirotani Y, Kato R, Tanino T, Nishimaki-Watanabe H, Nozaki F, Ohni S, Tang X, Masuda S, Sasaki-Fukatsu K.
In-Text Gene Mentions

…SLC2A4 (GLUT4), andSLC2A14(GLUT14) are class…

Show Full Abstract

<h4>Background</h4>Glucose transporters (GLUTs) are highly expressed in various cancers. However, the implications of these variable expression patterns are unclear. This study aimed to clarify the correlation between class I GLUT expression patterns and clinical outcomes in non-small cell lung cancer (NSCLC), including their potential role in inflammatory signaling.<h4>Methods</h4>Biopsy tissues from 132 patients with NSCLC (92 adenocarcinomas [ADC] and 40 squamous cell carcinomas [SQCC]) were analyzed. mRNA expression levels of class I GLUTs (solute carrier 2A [SLC2A]1, SLC2A2, SLC2A3, and SLC2A4) and inflammation-related molecules (toll-like receptors TLR4, RelA/p65, and interleukins IL8 and IL6) were measured. Cellular localization of GLUT3 and GLUT4 was investigated using immunofluorescence.<h4>Results</h4>Single, combined, and negative GLUT (SLC2A) expression were observed in 27/92 (29.3%), 27/92 (29.3%), and 38/92 (41.3%, p < 0.001) of ADC and 8/40 (20.0%), 29/40 (72.5%, p < 0.001), and 3/40 (7.5%) of SQCC, respectively. In ADC, the single SLC2A3-expressed group had a significantly poorer prognosis, whereas the single SLC2A4-expressed group had a significantly better prognosis. The combined expression groups showed no significant difference. SLC2A expression was not correlated with SQCC prognosis. SLC2A4 expression correlated with lower IL8 expression. GLUT3 and GLUT4 expressions were localized in the tumor cytoplasm.<h4>Conclusions</h4>In lung ADC, single SLC2A3 expression correlated with poor prognosis, whereas single SLC2A4 expression correlated with better prognosis and lower IL8 expression. GLUT3 expression, which is increased by IL8 overexpression, may be suppressed by increasing the expression of GLUT4 through decreased IL8 expression.

Also flagged:capecitabineColorectal cancerxylanstearic acidfatty acidtumor
Journal Article 2023-08-07 No Snippets Lang T, Zhu R, Zhu X, Yan W, Li Y, Zhai Y, Wu T, Huang X, Yin Q, Li Y.
Show Full Abstract

Colorectal cancer (CRC) therapy efficiency can be influenced by the microbiota in the gastrointestinal tract. Compared with traditional intervention, prebiotics delivery into the gut is a more controllable method for gut microbiota modulatory therapy. Capecitabine (Cap), the first-line chemotherapeutic agent for CRC, lacks a carrier that can prolong its half-life. Here, we construct a Cap-loaded nanoparticle using the prebiotic xylan-stearic acid conjugate (SCXN). The oral administration of SCXN delays the drug clearance in the blood and increases the intra-tumoral Cap concentration in the CRC mouse model. SCXN also facilitates the probiotic proliferation and short chain fatty acid production. Compared with free Cap, SCXN enhances the anti-tumor immunity and increases the tumor inhibition rate from 5.29 to 71.78%. SCXN exhibits good biocompatibility and prolongs the median survival time of CRC mice from 14 to 33.5 d. This prebiotics-based nanoparticle provides a promising CRC treatment by combining gut microbiota modulation and chemotherapy.

Also flagged:peptideautosomal dominant ADADSMOC1SPON1
Journal Article 2023-08-07 No Snippets Johnson ECB, Bian S, Haque RU, Carter EK, Watson CM, Gordon BA, Ping L, Duong DM, Epstein MP, McDade E, Barthélemy NR, Karch CM, Xiong C, Cruchaga C, Perrin RJ, Wingo AP, Wingo TS, Chhatwal JP, Day GS, Noble JM, Berman SB, Martins R, Graff-Radford NR, Schofield PR, Ikeuchi T, Mori H, Levin J, Farlow M, Lah JJ, Haass C, Jucker M, Morris JC, Benzinger TLS, Roberts BR, Bateman RJ, Fagan AM, Seyfried NT, Levey AI, Dominantly Inherited Alzheimer Network.
Show Full Abstract

Alzheimer's disease (AD) pathology develops many years before the onset of cognitive symptoms. Two pathological processes-aggregation of the amyloid-β (Aβ) peptide into plaques and the microtubule protein tau into neurofibrillary tangles (NFTs)-are hallmarks of the disease. However, other pathological brain processes are thought to be key disease mediators of Aβ plaque and NFT pathology. How these additional pathologies evolve over the course of the disease is currently unknown. Here we show that proteomic measurements in autosomal dominant AD cerebrospinal fluid (CSF) linked to brain protein coexpression can be used to characterize the evolution of AD pathology over a timescale spanning six decades. SMOC1 and SPON1 proteins associated with Aβ plaques were elevated in AD CSF nearly 30 years before the onset of symptoms, followed by changes in synaptic proteins, metabolic proteins, axonal proteins, inflammatory proteins and finally decreases in neurosecretory proteins. The proteome discriminated mutation carriers from noncarriers before symptom onset as well or better than Aβ and tau measures. Our results highlight the multifaceted landscape of AD pathophysiology and its temporal evolution. Such knowledge will be critical for developing precision therapeutic interventions and biomarkers for AD beyond those associated with Aβ and tau.

Also flagged:agingPHB1metformincalcium channelVEGFAthiazolidinediones
Journal Article 2023-08-07 No Snippets Rosoff DB, Mavromatis LA, Bell AS, Wagner J, Jung J, Marioni RE, Davey Smith G, Horvath S, Lohoff FW.
Show Full Abstract

The concept of aging is complex, including many related phenotypes such as healthspan, lifespan, extreme longevity, frailty and epigenetic aging, suggesting shared biological underpinnings; however, aging-related endpoints have been primarily assessed individually. Using data from these traits and multivariate genome-wide association study methods, we modeled their underlying genetic factor ('mvAge'). mvAge (effective n = ~1.9 million participants of European ancestry) identified 52 independent variants in 38 genomic loci. Twenty variants were novel (not reported in input genome-wide association studies). Transcriptomic imputation identified age-relevant genes, including VEGFA and PHB1. Drug-target Mendelian randomization with metformin target genes showed a beneficial impact on mvAge (P value = 8.41 × 10<sup>-5</sup>). Similarly, genetically proxied thiazolidinediones (P value = 3.50 × 10<sup>-10</sup>), proprotein convertase subtilisin/kexin 9 inhibition (P value = 1.62 × 10<sup>-6</sup>), angiopoietin-like protein 4, beta blockers and calcium channel blockers also had beneficial Mendelian randomization estimates. Extending the drug-target Mendelian randomization framework to 3,947 protein-coding genes prioritized 122 targets. Together, these findings will inform future studies aimed at improving healthy aging.

HFE
Also flagged:eating disorderBEDobesityAPOEironmetabolism
Journal Article 2023-08-07 ✓ 3 Snippets Burstein D, Griffen TC, Therrien K, Bendl J, Venkatesh S, Dong P, Modabbernia A, Zeng B, Mathur D, Hoffman G, Sysko R, Hildebrandt T, Voloudakis G, Roussos P.
In-Text Gene Mentions

We perform a genome-wide association study of individuals of African (n = 77,574) and European (n = 285,138) ancestry while controlling for body mass index to identify three independent loci near the HFE, MCHR2 and LRP11 genes and suggest APOE as a risk gene for BED.

HFE

hemochromatosis

Show Full Abstract

Binge eating disorder (BED) is the most common eating disorder, yet its genetic architecture remains largely unknown. Studying BED is challenging because it is often comorbid with obesity, a common and highly polygenic trait, and it is underdiagnosed in biobank data sets. To address this limitation, we apply a supervised machine-learning approach (using 822 cases of individuals diagnosed with BED) to estimate the probability of each individual having BED based on electronic medical records from the Million Veteran Program. We perform a genome-wide association study of individuals of African (n = 77,574) and European (n = 285,138) ancestry while controlling for body mass index to identify three independent loci near the HFE, MCHR2 and LRP11 genes and suggest APOE as a risk gene for BED. We identify shared heritability between BED and several neuropsychiatric traits, and implicate iron metabolism in the pathophysiology of BED. Overall, our findings provide insights into the genetics underlying BED and suggest directions for future translational research.

OLFM4
Also flagged:CD34ETCALRPBXIP1MAN1A1MME
Journal Article 2023-08-07 ✓ 5 Snippets Guijarro-Hernández A, Vizmanos JL.
In-Text Gene Mentions

In samples from ET patients with JAK2 mutations, we focused on the analysis of 13 genes (ARG1, CAST, CD177, CLEC5A, DAPP1, EPS15, IGHM, IL18RAP, OLFM4, OLR1, RIOK3, SELP, and THBS1).

…, IL18RAP ,OLFM4, OLR1 ,…

…EPS15, IGHM, IL18RAP,OLFM4, OLR1, RIOK3, SELP…

…( CD177 ,OLFM4, SELP ,…

…DAPP1, EPS15, IL18RAP,OLFM4, OLR1, RIOK3, SELP…

Show Full Abstract

<h4>Background</h4>Essential thrombocythemia (ET) is one of the most common types of Ph-negative myeloproliferative neoplasms, an infrequent group of blood cancers that arise from a CD34 + hematopoietic stem cell (HSC) in the bone marrow (BM) primarily due to driver mutations in JAK2, CALR or MPL. These aberrations result in an overproduction of mature myeloid cells in peripheral blood (PB). To date, no targeted therapies have been approved for ET patients, so the study of the molecular mechanisms behind the disease and the identification of new therapeutic targets may be of interest. For this reason, in this study, we have compared the transcriptomic profile of undifferentiated CD34 + cells and mature myeloid cells from ET patients (CALR and JAK2-mutated) and healthy donors deposited in publicly available databases. The study of the similarities and differences between these samples might help to better understand the molecular mechanisms behind the disease according to the degree of maturation of the malignant clone and the type of mutation and ultimately help identify new therapeutic targets for these patients.<h4>Results</h4>The results show that most of the altered hallmarks in neutrophils were also found in CD34 + cells. However, only a few genes showed a similar aberrant expression pattern in both types of cells. We have identified a signature of six genes common to patients with CALR and JAK2 mutations (BPI, CRISP3, LTF, MMP8, and PTGS1 upregulated, and PBXIP1 downregulated), a different signature of seven genes for patients with CALR mutations (BMP6, CEACAM8, ITK, LCN2, and PRG2 upregulated, and MAN1A1 and MME downregulated) and a signature of 13 genes for patients with JAK2 mutations (ARG1, CAST, CD177, CLEC5A, DAPP1, EPS15, IL18RAP, OLFM4, OLR1, RIOK3, SELP, and THBS1 upregulated, and IGHM downregulated).<h4>Conclusions</h4>Our results highlight transcriptomic similarities and differences in ET patients according to the degree of maturation of the malignant clone and the type of mutation. The genes and processes altered in both CD34 + cells and mature neutrophils may reveal altered sustained processes that could be studied as future therapeutic targets for ET patients.

ZNFX1
Also flagged:extracellularNeurological disordersstrokemultiple sclerosisneurodegenerative diseasesParkinson's
Journal Article 2023-08-07 ✓ 1 Snippet Kunze R, Fischer S, Marti HH, Preissner KT.
In-Text Gene Mentions

ZNFX1antisense RNA 1…

Show Full Abstract

Neurological disorders such as stroke, multiple sclerosis, as well as the neurodegenerative diseases Parkinson's or Alzheimer's disease are accompanied or even powered by danger associated molecular patterns (DAMPs), defined as endogenous molecules released from stressed or damaged tissue. Besides protein-related DAMPs or "alarmins", numerous nucleic acid DAMPs exist in body fluids, such as cell-free nuclear and mitochondrial DNA as well as different species of extracellular RNA, collectively termed as self-extracellular nucleic acids (SENAs). Among these, microRNA, long non-coding RNAs, circular RNAs and extracellular ribosomal RNA constitute the majority of RNA-based DAMPs. Upon tissue injury, necrosis or apoptosis, such SENAs are released from neuronal, immune and other cells predominantly in association with extracellular vesicles and may be translocated to target cells where they can induce intracellular regulatory pathways in gene transcription and translation. The majority of SENA-induced signaling reactions in the brain appear to be related to neuroinflammatory processes, often causally associated with the onset or progression of the respective disease. In this review, the impact of the diverse types of SENAs on neuroinflammatory and neurodegenerative diseases will be discussed. Based on the accumulating knowledge in this field, several specific antagonistic approaches are presented that could serve as therapeutic interventions to lower the pathological outcome of the indicated brain disorders.

OLFM4
Also flagged:prostate cancerTMPRSS2ERGadenocarcinomaandrogengene expression
Journal Article 2023-08-07 ✓ 1 Snippet Huang FW, Song H, Weinstein HN, Xie J, Cooperberg MR, Hicks J, Mummert L, De Marzo AM, Sfanos KS.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Club cells are a type of bronchiolar epithelial cell that serve a protective role in the lung and regenerate damaged lung epithelium. Single-cell RNA sequencing (scRNA-seq) of young adult human prostate and urethra identified cell populations in the prostatic urethra and collecting ducts similar in morphology and transcriptomic profile to lung club cells. We further identified club cell-like epithelial cells by scRNA-seq of prostate peripheral zone tissues. Here, we aimed to identify and spatially localize club cells in situ in the prostate, including in the peripheral zone. We performed chromogenic RNA in situ hybridization for five club cell markers (CP, LTF, MMP7, PIGR, SCGB1A1) in a series of (1) nondiseased organ donor prostate and (2) radical prostatectomy specimens from individuals with prostate cancer. We report that expression of club cell genes in the peripheral zone is associated with inflammation and limited to luminal epithelial cells classified as intermediate cells in proliferative inflammatory atrophy (PIA). Club-like cells were enriched in radical prostatectomy specimens compared to nondiseased prostates and associated with high-grade prostate cancer. We previously reported that luminal epithelial cells in PIA can rarely harbor oncogenic TMPRSS2:ERG (ERG+) gene fusions, and we now demonstrate that club cells are present in association with ERG+ PIA that is transitioning to early adenocarcinoma. Finally, prostate epithelial organoids derived from prostatectomy specimens demonstrate that club-like epithelial cells can be established in organoids and are sensitive to anti-androgen-directed treatment in vitro in terms of decreased androgen signaling gene expression signatures compared to basal or hillock cells. Overall, our study identifies a population of club-like cells in PIA and proposes that these cells play an analogous role to that of club cells in bronchiolar epithelium. Our results further suggest that inflammation drives lineage plasticity in the human prostate and that club cells in PIA may be prone to oncogenic transformation. © 2023 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of The Pathological Society of Great Britain and Ireland.

UNC13C
Also flagged:neurocognitive disorderdeliriumsleep disorderspathogenesisandrogencognitive disorder
Journal Article 2023-08-07 ✓ 1 Snippet Liu L, Liu M, Zhang D, Song Z, Zhang H.
In-Text Gene Mentions

… mmu_circ_0000331/miR‐1224‐3p/Unc13cand mmu_circ_0000406/miR‐24‐3p…

Show Full Abstract

<h4>Background</h4>Perioperative neurocognitive disorder (PND) is the main cause of poor postoperative recovery in elderly patients with age-related reductions in androgen levels. However, the underlying mechanisms have not been completely elucidated.<h4>Methods</h4>A mouse model of PND was constructed using abdominal surgery. Dihydrotestosterone (DHT), as the primary androgen, can improve the cognitive function of mice with PNDs by reducing REDOX damage. To clarify the role of circular RNA (circRNA) in DHT in improving cognitive function in mice with PND, circRNA sequencing was performed to analyze the expression of circRNA in the hippocampus of mice.<h4>Results</h4>We confirmed that mmu_circ_0001442 is the primary circRNA responsive to DHT stimulation in mice with PND. The mmu_circ_0001442/miR-125a-3p/NUFIP2 axis was predicted and constructed according to the analysis of databases, including pita, miRanda, TargetScan, miRDB, micro-CDS, PolymiRTS, and TarBase v.8. Subsequently, the axis was verified by qPCR and double-luciferase reporter gene assays. In vitro, we found that DHT rarely had an effect on the growth of BV2 cells using the CCK-8 assay, but it attenuated the cytotoxic effect of lipopolysaccharide (LPS) on BV2 cells. In addition, we found that LPS stimulation promoted the release of proinflammatory cytokines, including IL-6 and TNF-α, in BV2 cells, whereas mmu_circ_0001442 knockdown and NUFIP2 knockdown partially abrogated this effect.<h4>Conclusions</h4>Taken together, DHT inhibited REDOX damage and neuroinflammation in the hippocampus to alleviate cognitive disorders in mice with PNDs via activation of the mmu_circ_0001442/miR-125a-3p/NUFIP2 axis. This study provides a novel rationale for developing DHT as a potential therapeutic agent for PND prevention.

CSE1LSTAU1
Also flagged:cytokinesisextracellularvesiclescell proliferationribonucleoproteinMKLP1
Journal Article 2023-08-07 ✓ 2 Snippets Park S, Dahn R, Kurt E, Presle A, VanDenHeuvel K, Moravec C, Jambhekar A, Olukoga O, Shepherd J, Echard A, Blower M, Skop AR.
In-Text Gene Mentions

Cse1l

Stau1

Show Full Abstract

Long ignored as a vestigial remnant of cytokinesis, the mammalian midbody (MB) is released post-abscission inside large extracellular vesicles called MB remnants (MBRs). Recent evidence suggests that MBRs can modulate cell proliferation and cell fate decisions. Here, we demonstrate that the MB matrix is the site of ribonucleoprotein assembly and is enriched in mRNAs that encode proteins involved in cell fate, oncogenesis, and pluripotency, which we are calling the MB granule. Both MBs and post-abscission MBRs are sites of spatiotemporally regulated translation, which is initiated when nascent daughter cells re-enter G1 and continues after extracellular release. MKLP1 and ARC are necessary for the localization and translation of RNA in the MB dark zone, whereas ESCRT-III is necessary to maintain translation levels in the MB. Our work reveals a unique translation event that occurs during abscission and within a large extracellular vesicle.

Also flagged:tumorlocalizationbladder cancerspliceosomecytoplasmnucleus
Journal Article 2023-08-07 No Snippets Rasmussen AM, Okholm TLH, Knudsen M, Vang S, Dyrskjøt L, Hansen TB, Pedersen JS.
Show Full Abstract

Until recently, intronic lariats were regarded as short-lasting splicing byproducts with no apparent function; however, increasing evidence of stable derivatives suggests regulatory roles. Yet little is known about their characteristics, functions, distribution, and expression in healthy and tumor tissue. Here, we profiled and characterized circular stable intronic sequence RNAs (sisRNAs) using total RNA-Seq data from bladder cancer (BC; <i>n</i> = 457, UROMOL cohort), healthy tissue (<i>n</i> = 46), and fractionated cell lines (<i>n</i> = 5). We found that the recently-discovered full-length intronic circles and the stable lariats formed distinct subclasses, with a surprisingly high intronic circle fraction in BC (∼45%) compared to healthy tissues (0-20%). The stable lariats and their host introns were characterized by small transcript sizes, highly conserved BP regions, enriched BP motifs, and localization in multiple cell fractions. Additionally, circular sisRNAs showed tissue-specific expression patterns. We found nine circular sisRNAs as differentially expressed across early-stage BC patients with different prognoses, and sisHNRNPK expression correlated with progression-free survival. In conclusion, we identify distinguishing biological features of circular sisRNAs and point to specific candidates (incl. sisHNRNPK, sisWDR13 and sisMBNL1) that were highly expressed, had evolutionary conserved sequences, or had clinical correlations, which may facilitate future studies and further insights into their functional roles.

SUDS3
Also flagged:chromosomechromosomesorganizationnucleuscohesinCTCF
Journal Article 2023-08-07 ✓ 1 Snippet Soroczynski J, Risca VI.
In-Text Gene Mentions

polycomb repressive

Show Full Abstract

The last two decades of work on chromosome conformation in eukaryotic nuclei have revealed a complex and highly regulated hierarchy of architectural features, from self-associating domains and compartmental interactions to locus-specific loops. Recent findings have shown that these structures are dynamic and heterogeneous, with emerging insights into the factors that shape them and implications for the control of transcription and other nuclear processes. Here, we review the latest advances in the DNA sequencing- and microscopy-based technologies for probing these features in space and time (4D) and discuss how they have been combined with complementary approaches such as genetic perturbations, protein and RNA measurements, and modeling to gain mechanistic insights about genome regulation across space and time.

HTT
Also flagged:Neurodegenerative dementiasextracellulardementiaantibodiesantibodybinding
Journal Article 2023-08-07 ✓ 1 Snippet Teunissen CE, Kimble L, Bayoumy S, Bolsewig K, Burtscher F, Coppens S, Das S, Gogishvili D, Fernandes Gomes B, Gómez de San José N, Mavrina E, Meda FJ, Mohaupt P, Mravinacová S, Waury K, Wojdała AL, Abeln S, Chiasserini D, Hirtz C, Gaetani L, Vermunt L, Bellomo G, Halbgebauer S, Lehmann S, Månberg A, Nilsson P, Otto M, Otto M, Vanmechelen E, Verberk IMW, Willemse E, Zetterberg H, MIRIADE consortium.
In-Text Gene Mentions

Antisense oligonucleotides have been designed to lower expression of C9orf in models for ALS and FTD (157), targeting CAG repeats in the gene HTT in Huntington's disease (158, 159) and blocking CGG repeats in the FMR1 gene associated with FXTAS (160).

Show Full Abstract

Neurodegenerative dementias are progressive diseases that cause neuronal network breakdown in different brain regions often because of accumulation of misfolded proteins in the brain extracellular matrix, such as amyloids or inside neurons or other cell types of the brain. Several diagnostic protein biomarkers in body fluids are being used and implemented, such as for Alzheimer's disease. However, there is still a lack of biomarkers for co-pathologies and other causes of dementia. Such biofluid-based biomarkers enable precision medicine approaches for diagnosis and treatment, allow to learn more about underlying disease processes, and facilitate the development of patient inclusion and evaluation tools in clinical trials. When designing studies to discover novel biofluid-based biomarkers, choice of technology is an important starting point. But there are so many technologies to choose among. To address this, we here review the technologies that are currently available in research settings and, in some cases, in clinical laboratory practice. This presents a form of lexicon on each technology addressing its use in research and clinics, its strengths and limitations, and a future perspective.

PRDX6
Also flagged:Response to Oxidative Stresspolyunsaturated fatty acidsoxygeninfertilityCoenzymecysteines
Journal Article 2023-08-07 ✓ 5 Snippets Petrone O, Serafini S, Yu BYK, Filonenko V, Gout I, O'Flaherty C.
In-Text Gene Mentions

They are classified into two groups, 2-Cys PRDXs (PRDX1-5) and 1-Cys PRDXs (PRDX6), which differ by the number of cysteine residues in their active site [12].

…and 1-Cys PRDXs (PRDX6), which differ by…

PRDX6is the primary…

PRDX6has peroxidase and…

…PRDXs or thePRDX6iPLA 2 activities…

Show Full Abstract

The spermatozoa have limited antioxidant defences, a high polyunsaturated fatty acids content and the impossibility of synthesizing proteins, thus being susceptible to oxidative stress. High levels of reactive oxygen species (ROS) harm human spermatozoa, promoting oxidative damage to sperm lipids, proteins and DNA, leading to infertility. Coenzyme A (CoA) is a key metabolic integrator in all living cells. Recently, CoA was shown to function as a major cellular antioxidant mediated by a covalent modification of surface-exposed cysteines by CoA (protein CoAlation) under oxidative or metabolic stresses. Here, the profile of protein CoAlation was examined in sperm capacitation and in human spermatozoa treated with different oxidizing agents (hydrogen peroxide, (H<sub>2</sub>O<sub>2</sub>), diamide and tert-butyl hydroperoxide (t-BHP). Sperm viability and motility were also investigated. We found that H<sub>2</sub>O<sub>2</sub> and diamide produced the highest levels of protein CoAlation and the greatest reduction of sperm motility without impairing viability. Protein CoAlation levels are regulated by 2-Cys peroxiredoxins (PRDXs). Capacitated spermatozoa showed lower levels of protein CoAlation than non-capacitation cells. This study is the first to demonstrate that PRDXs regulate protein CoAlation, which is part of the antioxidant response of human spermatozoa and participates in the redox regulation associated with sperm capacitation.

Also flagged:Lysophosphatidic Acidphospholipidcell migrationinflammation-related diseasescanceratherosclerosis
Journal Article 2023-08-07 No Snippets Jiang S, Yang H, Li M.
Show Full Abstract

Lysophosphatidic acid (LPA) is a bioactive phospholipid that regulates physiological and pathological processes in numerous cell biological functions, including cell migration, apoptosis, and proliferation. Macrophages are found in most human tissues and have multiple physiological and pathological functions. There is growing evidence that LPA signaling plays a significant role in the physiological function of macrophages and accelerates the development of diseases caused by macrophage dysfunction and inflammation, such as inflammation-related diseases, cancer, atherosclerosis, and fibrosis. In this review, we summarize the roles of LPA in macrophages, analyze numerous macrophage- and inflammation-associated diseases triggered by LPA, and discuss LPA-targeting therapeutic strategies.

HFE
Also flagged:Liver diseasesmalnutritionsarcopenialiver diseasemetabolismosteopathy
Journal Article 2023-08-07 ✓ 2 Snippets Espina S, Casas-Deza D, Bernal-Monterde V, Domper-Arnal MJ, García-Mateo S, Lué A.
In-Text Gene Mentions

…in the humanhemochromatosis(HFE) gene […

…the human hemochromatosis (HFE) gene [ 189…

Show Full Abstract

Liver diseases are the major predisposing conditions for the development of malnutrition, sarcopenia, and frailty. Recently, the mechanism of the onset of these complications has been better established. Regardless of the etiology of the underlying liver disease, the clinical manifestations are common. The main consequences are impaired dietary intake, altered macro- and micronutrient metabolism, energy metabolism disturbances, an increase in energy expenditure, nutrient malabsorption, sarcopenia, frailty, and osteopathy. These complications have direct effects on clinical outcomes, survival, and quality of life. The nutritional status should be assessed systematically and periodically during follow-up in these patients. Maintaining and preserving an adequate nutritional status is crucial and should be a mainstay of treatment. Although general nutritional interventions have been established, special considerations are needed in specific settings such as decompensated cirrhosis, alcohol-related liver disease, and metabolic-dysfunction-associated fatty liver disease. In this review, we summarize the physiopathology and factors that impact the nutritional status of liver disease. We review how to assess malnutrition and sarcopenia and how to prevent and manage these complications in this setting.

Also flagged:Cardiovascular diseasesdeathAtherosclerosisatheroscleroticischaemic heart diseasestroke
Journal Article 2023-08-07 No Snippets Perera B, Wu Y, Nguyen NT, Ta HT.
Show Full Abstract

Atherosclerosis is the build-up of fatty deposits in the arteries, which is the main underlying cause of cardiovascular diseases and the leading cause of global morbidity and mortality. Current pharmaceutical treatment options are unable to effectively treat the plaque in the later stages of the disease. Instead, they are aimed at resolving the risk factors. Nanomaterials and nanoparticle-mediated therapies have become increasingly popular for the treatment of atherosclerosis due to their targeted and controlled release of therapeutics. In this review, we discuss different types of therapeutics used to treat this disease and focus on the different nanomaterial strategies employed for the delivery of these drugs, enabling the effective and efficient resolution of the atherosclerotic plaque. The ideal nanomaterial strategy for each drug type (e.g. statins, nucleic acids, small molecule drugs, peptides) will be comprehensively discussed.

Also flagged:Gliomagene expressioncancerspathogenesismalignant tumorcancer
Journal Article 2023-08-07 No Snippets Gareev I, Encarnacion Ramirez MJ, Nurmukhametov R, Ivliev D, Shumadalova A, Ilyasova T, Beilerli A, Wang C.
Show Full Abstract

Glioma represents a complex and heterogeneous disease, posing significant challenges to both clinicians and researchers. Despite notable advancements in glioma treatment, the overall survival rate for most glioma patients remains dishearteningly low. Hence, there is an urgent necessity to discover novel biomarkers and therapeutic targets specifically tailored for glioma. In recent years, long non-coding RNAs (lncRNAs) have emerged as pivotal regulators of gene expression and have garnered attention for their involvement in the development and progression of various cancers, including glioma. The dysregulation of lncRNAs plays a critical role in glioma pathogenesis and influences clinical outcomes. Consequently, there is growing interest in exploring the potential of lncRNAs as diagnostic and prognostic biomarkers, as well as therapeutic targets. By understanding the functions and dysregulation of lncRNAs in glioma, researchers aim to unlock new avenues for the development of innovative treatment strategies catered to glioma patients. The identification and thorough characterization of lncRNAs hold the promise of novel therapeutic approaches that could potentially improve patient outcomes and enhance the management of glioma, ultimately striving for better prospects and enhanced quality of life for those affected by this challenging disease. The primary objective of this paper is to comprehensively review the current state of knowledge regarding lncRNA biology and their intricate roles in glioma. It also delves into the potential of lncRNAs as valuable diagnostic and prognostic indicators and explores their feasibility as promising targets for therapeutic interventions.

HTT
Also flagged:Huntingtin-associated protein 1MAPKHAP1microtubulesaxon growthTrkA
Journal Article 2023-08-07 ✓ 1 Snippet Miao L, Qing SW, Tao L.
In-Text Gene Mentions

…identified as anhtt-binding partner, and it…

Show Full Abstract

<h4>Aims</h4>Huntingtin-associated protein 1 (HAP1) is a neuronal protein closely associated with microtubules and might facilitate neurological function rehabilitation. This study aimed to investigate the effects of HAP1 on SCI and the underlying mechanisms.<h4>Methods</h4>the spinal cord injury (SCI) mouse model was induced by Allen's method. Then recombinant-HAP1 (r-HAP1) was administrated by intrathecal injection, and the BMS, Thermal nociceptive thresholds, tactile nociceptive thresholds, and neurofibrillary regeneration were identified to inspect the therapy outcome. Then NSCs were isolated from mice on embryonic day 14.5 and induced to differentiate into neurons. The efficiency of axon growth was calculated. Signaling pathway array was conducted to examine the signaling pathways in NSCs treated with r-HAP1. Antagonists and activators of TrkA were used to confirm the role of TrkA of HAP1 intervention both <i>in vitro</i> and <i>in vivo</i>.<h4>Results</h4>r-HAP1 ameliorates the neurological function rehabilitation after SCI, and benefits the regain of Tuj in injury spinal cord. Also significantly enhances neurite growth during neuronal differentiation of NSCs; Signaling pathway array and Western blot revealed that r-HAP1 significantly activates the phosphorylation of TrkA-MAPK/ERK in NSCs. TrkA selective inhibitor GW441756 blocks r-HAP1 on TrkA-MAPK/ERK signaling pathway and detracts from axonal growth after neuronal differentiation. TrkA selective activator gambogic amide can mimic the function of r-HAP1 by activating the foregoing pathway. ERK activator U-46619 reverses the blocking effect of GW441756 on r-HAP1.<h4>Conclusion</h4>HAP1 activates the TrkA-MAPK signaling pathway and is conducive to neurite elongation during NSC neuronal differentiation; by which to improve the prognosis of spinal cord injury in mice.

Also flagged:mitochondriaorganellesmitochondrial dynamics proteinsphospholipidmitochondrialmembrane
Journal Article 2023-08-07 No Snippets Muñoz JP, Basei FL, Rojas ML, Galvis D, Zorzano A.
Show Full Abstract

Mitochondrial network architecture plays a critical role in cellular physiology. Indeed, alterations in the shape of mitochondria upon exposure to cellular stress can cause the dysfunction of these organelles. In this scenario, mitochondrial dynamics proteins and the phospholipid composition of the mitochondrial membrane are key for fine-tuning the modulation of mitochondrial architecture. In addition, several factors including post-translational modifications such as the phosphorylation, acetylation, SUMOylation, and o-GlcNAcylation of mitochondrial dynamics proteins contribute to shaping the plasticity of this architecture. In this regard, several studies have evidenced that, upon metabolic stress, mitochondrial dynamics proteins are post-translationally modified, leading to the alteration of mitochondrial architecture. Interestingly, several proteins that sustain the mitochondrial lipid composition also modulate mitochondrial morphology and organelle communication. In this context, pharmacological studies have revealed that the modulation of mitochondrial shape and function emerges as a potential therapeutic strategy for metabolic diseases. Here, we review the factors that modulate mitochondrial architecture.

HFE
Also flagged:ClarithromycinHelicobacter pylori infection-induced liver injuryDILIH. pylori infectiondamage
Journal Article 2023-08-07 ✓ 1 Snippet Sharma NR, Wagle A, Bist M, Panthi B, Pokhrel Dahal R, Rokaya R, Shrestha R, Pokhrel M.
In-Text Gene Mentions

…Wilson’s disease andhemochromatosis.…

Show Full Abstract

<h4>Introduction and importance</h4>While 14-day triple therapy with clarithromycin is a common approach for eradicating <i>Helicobacter pylori</i> infection, it is essential to note that this treatment does not come without potential side effects.<h4>Case presentation</h4>We present the case of a 34-year-old male who presented to the emergency department with severe vomiting and abdominal pain. Subsequent evaluation revealed that the patient had developed drug-induced liver injury (DILI).<h4>Clinical discussion</h4>DILI can cause acute hepatocellular or cholestatic damage, and chronic injury can lead to hepatocellular, cholestatic, vascular, or neoplastic manifestations.<h4>Conclusion</h4>Clinicians should exercise caution and be alert to the potential hepatotoxic effects of medications, especially when initiating triple therapy for <i>H. pylori</i> infection.

HTTCCPG1
Also flagged:Neurodegenerative diseaseinclusion bodiesautophagyneurodegenerative disordersHuntington's diseaseglutamine
Journal Article 2023-08-07 ✓ 5 Snippets Folger A, Chen C, Kabbaj MH, Frey K, Wang Y.
In-Text Gene Mentions

One such disorder, Huntington's disease, is caused by an increased number of glutamine-encoding trinucleotide repeats CAG in the first exon of the huntingtin (<i>HTT</i>) gene.

…Mutant proteins ofHttexon 1 with…

…we use mutantHttexon 1 with…

HTT

CCPG1

Show Full Abstract

Protein misfolding, aggregation, and accumulation cause neurodegenerative disorders. One such disorder, Huntington's disease, is caused by an increased number of glutamine-encoding trinucleotide repeats CAG in the first exon of the huntingtin (<i>HTT</i>) gene. Mutant proteins of Htt exon 1 with polyglutamine expansion are prone to aggregation and form pathological inclusion bodies in neurons. Extensive studies have shown that misfolded proteins are cleared by the ubiquitin-proteasome system or autophagy to alleviate their cytotoxicity. Misfolded proteins can form small soluble aggregates or large insoluble inclusion bodies. Previous works have elucidated the role of autophagy in the clearance of misfolded protein aggregates, but autophagic clearance of inclusion bodies remains poorly characterized. Here we use mutant Htt exon 1 with 103 polyglutamine (Htt103QP) as a model substrate to study the autophagic clearance of inclusion bodies in budding yeast. We found that the core autophagy-related proteins were required for Htt103QP inclusion body autophagy. Moreover, our evidence indicates that the autophagy of Htt103QP inclusion bodies is selective. Interestingly, Cue5/Tollip, a known autophagy receptor for aggrephagy, is dispensable for this inclusion body autophagy. From the known selective autophagy receptors in budding yeast, we identified three that are essential for inclusion body autophagy. Amyloid beta peptide (Aβ42) is a major component of amyloid plaques found in Alzheimer's disease brains. Interestingly, a similar selective autophagy pathway contributes to the clearance of Aβ42 inclusion bodies in budding yeast. Therefore, our results reveal a novel autophagic pathway specific for inclusion bodies associated with neurodegenerative diseases, which we have termed IBophagy.

Also flagged:cyclodipeptideproteolysissynthesisalkaloidDiketopiperazineAlkaloids
Journal Article 2023-08-07 No Snippets Walker KL, Loach RP, Movassaghi M.
Show Full Abstract

The 2,5-diketopiperazine (DKP) motif is present in many biologically relevant, complex natural products. The cyclodipeptide substructure offers structural rigidity and stability to proteolysis that makes these compounds promising candidates for medical applications. Due to their fascinating molecular architecture, synthetic organic chemists have focused significant effort on the total synthesis of these compounds. This review covers many such efforts on the total synthesis of DKP containing complex alkaloid natural products.

LRRC7
Also flagged:anionVolume-regulated anion channelsLRRC8AAminoporeextracellular
Journal Article 2023-08-06 ✓ 1 Snippet Liu H, Polovitskaya MM, Yang L, Li M, Li H, Han Z, Wu J, Zhang Q, Jentsch TJ, Liao J.
In-Text Gene Mentions

…of VRAC currents,leucine-rich repeat-containing 8repeat-containing 8 (LRRC8)…

Show Full Abstract

Volume-regulated anion channels (VRACs) are hexamers of LRRC8 proteins that are crucial for cell volume regulation. N termini (NTs) of the obligatory LRRC8A subunit modulate VRACs activation and ion selectivity, but the underlying mechanisms remain poorly understood. Here, we report a 2.8-Å cryo-electron microscopy structure of human LRRC8A that displays well-resolved NTs. Amino-terminal halves of NTs fold back into the pore and constrict the permeation path, thereby determining ion selectivity together with an extracellular selectivity filter with which it works in series. They also interact with pore-surrounding helices and support their compact arrangement. The C-terminal halves of NTs interact with intracellular loops that are crucial for channel activation. Molecular dynamics simulations indicate that low ionic strength increases NT mobility and expands the radial distance between pore-surrounding helices. Our work suggests an unusual pore architecture with two selectivity filters in series and a mechanism for VRAC activation by cell swelling.

TNFSF4
Also flagged:tumorcolorectal cancercancerdeathdisulfidetumors
Journal Article 2023-08-06 ✓ 1 Snippet Li Y, Tang M, Dang W, Zhu S, Wang Y.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Background</h4>Colorectal cancer is the second leading cause of cancer-related deaths, which imposes a significant societal burden. Regular screening and emerging molecular tumor markers have important implications for detecting the progression and development of colorectal cancer. Disulfidptosis is a newly defined type of programmed cell death triggered by abnormal accumulation of disulfide compounds in cells that stimulate disulfide stress. Currently, there is no relevant discussion on this mechanism and colorectal cancer.<h4>Methods</h4>We classified the disulfidptosis-related subtypes of colorectal cancer using bioinformatics methods. Through secondary clustering of differentially expressed genes between subtypes, we identified characteristic genes of the disulfidptosis subtype, constructed a prognostic model, and searched for potential biomarkers through clinical validation.<h4>Results</h4>Using disulfidptosis-related genes collected from the literature, we classified colorectal cancer patients from public databases into three subtypes. The differentially expressed genes between subtypes were clustered into three gene subtypes, and eight characteristic genes were screened to construct a prognostic model.<h4>Conclusion</h4>The disulfidptosis mechanism has important value in the classification of colorectal cancer patients, and characteristic genes selected based on this mechanism can serve as a new potential biological marker for colorectal cancer.

PRDX6
Also flagged:NOX2obesityoxygenNADPH oxidase (NOX) 2insulin resistanceNcf1
Journal Article 2023-08-06 ✓ 1 Snippet Henriquez-Olguin C, Meneses-Valdes R, Raun SH, Gallero S, Knudsen JR, Li Z, Li J, Sylow L, Jaimovich E, Jensen TE.
In-Text Gene Mentions

…reductase 1 (TrxR1),PRDX6, the mitochondrially-located …

Show Full Abstract

The production of reactive oxygen species (ROS) by NADPH oxidase (NOX) 2 has been linked to both insulin resistance and exercise training adaptations in skeletal muscle. This study explores the previously unexamined role of NOX2 in the interplay between diet-induced insulin resistance and exercise training (ET). Using a mouse model that harbors a point mutation in the essential NOX2 regulatory subunit, p47phox (Ncf1*), we investigated the impact of this mutation on various metabolic adaptations. Wild-type (WT) and Ncf1* mice were assigned to three groups: chow diet, 60% energy fat diet (HFD), and HFD with access to running wheels (HFD + E). After a 16-week intervention, a comprehensive phenotypic assessment was performed, including body composition, glucose tolerance, energy intake, muscle insulin signaling, redox-related proteins, and mitochondrial adaptations. The results revealed that NOX2 deficiency exacerbated the impact of HFD on body weight, body composition, and glucose intolerance. Moreover, in Ncf1* mice, ET did not improve glucose tolerance or increase muscle cross-sectional area. ET normalized body fat independently of genotype. The lack of NOX2 activity during ET reduced several metabolic adaptations in skeletal muscle, including insulin signaling and expression of Hexokinase II and oxidative phosphorylation complexes. In conclusion, these findings suggest that NOX2 mediates key beneficial effects of exercise training in the context of diet-induced obesity.

UNC13C
Also flagged:Unc-13 Homolog Coral squamous cell carcinomaHepatocellular carcinomacancerinfectionalcoholic fatty liver disease
Journal Article 2023-08-06 ✓ 5 Snippets Kumar VB, Lee CH, Su TC, Lin CC, Mohammedsaleh ZM, Yeh CM, Kiefer R, Lin SH.
In-Text Gene Mentions

Unc-13 homolog C (UNC13C), a member of the Unc/Munc family is involved in aspects of cancer progression such as tumour development, cell migration 10, and metastasis.

In the current study, we found lower UNC13C expression in HCC patients (Figure 1), which is not consistent with our previous findings in OSCC 10, 19.

No significant correlation was observed in HCC patients between UNC13C expression and age, histological grade, lymph node metastasis, distant metastasis, smoking and drinking.

In the current study, immunohistochemical (IHC) analysis was used to examine the expression of UNC13C in HCC patients.

To examine the correlation between UNC13C expression levels and clinical parameters of HCC, the 265 cases were grouped based on different clinical parameters.

Show Full Abstract

Aberrant expression of UNC13C (Unc-13 Homolog C) has been observed during the progression of oral squamous cell carcinoma. However, the expression pattern and clinical relevance of UNC13C in Hepatocellular carcinoma (HCC) remain to be elucidated. The purpose of this study is to examine UNC13C expression in HCC and explore its role in clinicopathological factor or prognosis in HCC. Two hundred and sixty-five patients diagnosed with HCC were included in the present study. The expression of UNC13C in HCC tissues was analyzed by immunohistochemistry analysis. The relationship between UNC13C protein and clinicopathological characteristics in HCC was investigated. Moreover, the high expression of UNC13C was significantly correlated with T stage, AJCC stage and overall survival rates. Cox regression analysis identified UNC13C as an independent prognostic indicator for HCC patients. UNC13C might be a prognostic biomarker and therapeutic target in HCC. Further studies with larger sample sets are needed to understand the clinical implications of UNC13C in hepatocellular carcinoma.

SOX6
Also flagged:BCL11Aγ-globintriterpenoid glycosidesβ-hemoglobinopathiesglobinβ-thalassemia
Journal Article 2023-08-06 ✓ 1 Snippet Iftikhar F, Khan MBN, Tehreem S, Kanwal N, Musharraf SG.
In-Text Gene Mentions

…of BCL11A andSOX6, and overexpression of…

Show Full Abstract

Pharmacological induction of fetal hemoglobin has proven to be a promising therapeutic intervention in β-hemoglobinopathies by reducing the globin chain imbalance and inhibiting sickle cell polymerization. Fagonia indica has shown therapeutic relevance to β-thalassemia. Therefore, we study the ethnopharmacological potential of Fagonia indica and its biomarker compounds for their HbF induction ability for the treatment of β-thalassemia. Here, we identify, compound 8 (triterpenoid glycosides) of F. indica. as a prominent HbF inducer in-vitro and in-vivo. Compound 8 showed potent erythroid differentiation, enhanced cellular proliferation, ample accumulation of total hemoglobin, and a strong notion of γ-globin gene expression in K562 cultures. Compound 8 treatment also revealed strong induction of erythroid differentiation and fetal hemoglobin mRNA and protein in adult erythroid precursor cells. This induction was associated with simultaneous downregulation of BCL11A and SOX6, and overexpression of the GATA-1 gene, suggesting a compound 8-mediated partial mechanism involved in the reactivation of fetal-like globin genes. The in vivo study with compound 8 (10 mg/kg) in β-YAC mice resulted in significant HbF synthesis demonstrated by the enhanced level of F-cells (84.14 %) and an 8.85-fold increase in the γ-globin gene. Overall, the study identifies compound 8 as a new HbF-inducing entity and provides an early "proof-of-concept" to enable the initiation of preclinical and clinical studies in the development of this HbF-inducing agent for β-thalassemia.

SERPINC1
Also flagged:ThrombosisMultisystem Inflammatory SyndromeCOVID-19coronavirus infectionhyperinflammatory syndromecytokine storm
Journal Article 2023-08-06 ✓ 1 Snippet Bregel LV, Efremova OS, Kostyunin KY, Rudenko NY, Kozlov YA, Albot VV, Knyzeva NА, Tolmacheva OV, Ovanesyan SV, Barakin AO, Pak KO, Belousova LV, Korinets TS, Kostik MM.
In-Text Gene Mentions

…detection of theSERPINC1heterozygous genetic variant.…

Show Full Abstract

<b>Background:</b> The causative agent of the new coronavirus infection SARS-CoV-2 has unique properties causing hyperinflammatory syndrome and cytokine storm, as well as widespread endotheliitis and thrombotic microangiopathy, initially detected in the lungs of adult patients who died from a severe form of the disease. Venous and arterial thrombosis in adults were identified as common causes of severe complications and deaths in new coronavirus infections. There are very few reports of thrombotic events in children with COVID-19 in the literature. <b>Methods:</b> We conducted a retrospective analysis of the histories of 60 patients in the Irkutsk Regional Children's Clinical Hospital from November 2020 to November 2022 with a MIS-C diagnosis established according to WHO criteria, of which 8 (13.3%) were diagnosed with venous and/or arterial thrombosis, confirmed by laboratory and ultrasound and/or X-ray methods. <b>Results:</b> The average age of children with thrombosis (Me) was 7.5 years (min 4 months, max 17 years), with a M:F ratio of 3.0. Venous thrombosis was detected in six of the eight patients, including in the deep veins of the lower extremities in four. Pulmonary embolism occurred in two (one of them was fatal), and cerebral venous sinus thrombosis and thrombosis of the branches of the upper and lower vena cava were found in one patient. Extensive bilateral stroke due to thrombosis of the large cerebral arteries occurred in two patients, including one in combination with distal gangrene. Secondary thrombotic renal microangiopathy took place in three of the eight patients. Among these three, atypical HUS was diagnosed in one case. Multiple thrombosis involving the venous and arterial bed was detected in four of the eight patients. High levels of D-dimer, thrombocytopenia, increased NT-proBNP, cerebral coma, and aseptic meningitis were the events most often associated with thrombosis. All patients received immunomodulatory therapy (immunoglobulin, dexamethasone/methylprednisolone), pathogenetic therapy for multiorgan failure, anticoagulant therapy with heparin/LMWH, and acetylsalicylic acid. Biologics were used in two patients. <b>Conclusions:</b> The main predictors of thrombosis in children with MIS-C were increased D-dimer, thrombocytopenia, hospitalization in the ICU, and noncardiogenic pulmonary edema. Thrombosis of the deep veins of the lower extremities, large cerebral arteries, and secondary thrombotic microangiopathy was common. There was a single death (12.5% of the eight patients), associated with PE.

bioRxiv 2023-08-06 Preprint (No Snippets API) Zeylan ME, Senyuz S, Picón-Pagès P, García-Elías A, Tajes M, Muñoz FJ, Oliva B, Garcia-Ojalvo J, Barbu E, Vicente R, Nattel S, Ois-Santiago AJ, Puig-Pijoan A, Keskin O, Gursoy A.
Show Full Abstract

One of the primary goals of systems medicine is detecting putative proteins and pathways involved in disease progression and pathological phenotypes. Vascular Cognitive Impairment (VCI) is a heterogeneous condition manifesting as cognitive impairment resulting from vascular factors. The precise mechanisms underlying this relationship remain unclear, which poses challenges for experimental research. Here, we applied computational approaches like systems biology to unveil and select relevant proteins and pathways related to VCI by studying the crosstalk between cardiovascular and cognitive diseases. In addition, we specifically included signals related to oxidative stress, a common etiologic factor tightly linked to aging, a major determinant of VCI. Our results show that pathways associated with oxidative stress are quite relevant, as most of the prioritized vascular-cognitive genes/proteins were enriched in these pathways. Our analysis provided a short list of proteins that could be contributing to VCI: DOLK, TSC1, ATP1A1, MAPK14, YWHAZ, CREB3, HSPB1, PRDX6, and LMNA. Moreover, our experimental results suggest a high implication of glycative stress, generating oxidative processes and post-translational protein modifications through advanced glycation end-products (AGEs). We propose that these products interact with their specific receptors (RAGE) and Notch signaling to contribute to the etiology of VCI.

bioRxiv 2023-08-06 Preprint (No Snippets API) Haque R, Kurien SP, Setty H, Salzberg Y, Stelzer G, Litvak E, Gingold H, Rechavi O, Oren-Suissa M.
Show Full Abstract

<h4>ABSTRACT</h4> Sex-specific traits and behaviors emerge during development by the acquisition of unique properties in the nervous system of each sex. However, the genetic events responsible for introducing these sex-specific features remain poorly understood. In this study, we created a comprehensive gene expression atlas for both sexes of the nematode Caenorhabditis elegans across development. By comparing the transcriptome of pure populations of hermaphrodites and males from early larval stages to adulthood, we discovered numerous differentially expressed genes, including neuronal gene families like transcription factors, neuropeptides, and GPCRs. We identified INS-39, an insulin-like peptide, as a prominent male-biased gene expressed specifically in ciliated sensory neurons. We show that INS-39 serves as an early-stage male marker, facilitating the effective isolation of males in high-throughput experiments. Through complex and sex-specific regulation, ins-39 plays pleiotropic sexually-dimorphic roles in temperature sensation, survival in cold temperatures, resilience against high hydrogen peroxide levels, and dauer entry, while also playing a shared, dimorphic role in early life stress. This study offers a comparative sexual and developmental gene expression database for C. elegans , which will facilitate research into the genetic regulation of the sexual development of other organisms. Furthermore, it highlights conserved candidate genes that may underlie the sexually-dimorphic manifestation of different human diseases.

HFE
Also flagged:age-related macular degenerationASage-relatedatrophymacular neovascularizationgeographic atrophy
Journal Article 2023-08-05 ✓ 2 Snippets Sacconi R, Tombolini B, Zucchiatti I, Servillo A, Menean M, Alessandrini GF, Querques L, Prascina F, Charbel Issa P, Bandello F, Querques G.
In-Text Gene Mentions

…some patients withhemochromatosiswere previously reported…

…affected by subclinicalhemochromatosis.…

Show Full Abstract

<h4>Introduction</h4>To describe subclinical angioid streaks (AS) as a frequent, peculiar age-related macular degeneration (AMD) phenotype, comparing features of eyes with subclinical AS with those of eyes with AMD without AS.<h4>Methods</h4>This was a retrospective, observational study. Among a patient cohort with AMD, we selected patients without known causes for AS whose eyes showed signs of angioid streaks (AS) on structural optical coherence tomography (OCT) but not on fundus examination. Selected OCT features of AS were Bruch's membrane (BM) breaks and large BM dehiscences.<h4>Results</h4>Among 543 eyes of 274 patients with AMD (mean ± standard deviation: 82 ± 7 years), 73 eyes of 46 patients (81 ± 7 years; p = 0.432) showed AS features on OCT (OCT AS) that were not visible on fundus examination. Estimated prevalence of subclinical age-related AS was 13.4% (95% confidence interval 10.3-16.3%) in this AMD population. Fifty-three eyes (73%) with AS features were affected by peripapillary atrophy, often with a "petaloid-like" pattern, similar to typical features of AS disease. Almost all cases (97%) presented reticular pseudodrusen (RPD), with (41%) or without (59%) drusen showing a significant difference in RPD prevalence in OCT AS eyes in comparison to AMD eyes without subclinical AS using generalized estimating equations (P < 0.001). Among the 73 subclinical AS cases, 71 were affected by late AMD (57 with macular neovascularization, 14 with geographic atrophy), showing a more advanced AMD stage in comparison with AMD eyes without subclinical AS (P < 0.001). The following OCT features were disclosed: BM breaks in 100% of cases and BM dehiscences in 37%.<h4>Conclusions</h4>Subclinical AS in eyes with AMD is a peculiar phenotype of the disease, with features suggesting a primary involvement of Bruch's membrane and clinical similarities with mild, late-onset pseudoxanthoma elasticum.

SUDS3
Also flagged:Bladder cancerurothelial neoplasmcancerChromosomereproductionCancers of the breast
Journal Article 2023-08-05 ✓ 1 Snippet Ware AP, Satyamoorthy K, Paul B.
In-Text Gene Mentions

…ZNF444) and fivechromatin modifiersmodifiers (SMC3, KDMA1,…

Show Full Abstract

With 46 microRNAs (miRNAs) embedded tandemly over a distance of ~100 kb, chromosome 19 microRNA cluster (C19MC) is the largest miRNA cluster in the human genome. The C19MC is transcribed from a long noncoding genomic region and is usually expressed simultaneously at a higher level. Hence, we performed an integrative multiomics data analysis to examine C19MC regulation, expression patterns, and their impact on bladder cancer (BCa). We found that 43 members of C19MC were highly expressed in BCa. However, its co-localization with recurrent copy number variation (CNV) gain was not statistically significant to implicate its upregulation. It has been reported that C19MC expression is regulated by a well-established CpG island situated 17.6 kb upstream of the transcription start site, but we found that CpG probes at this island were hypomethylated, which was not statistically significant in the BCa cohort. In addition, the promoter region of C19MC is strongly regulated by a group of seven transcription factors (NR2F6, SREBF1, TBP, GATA3, GABPB1, ETV4, and ZNF444) and five chromatin modifiers (SMC3, KDMA1, EZH2, RAD21, and CHD7). Interestingly, these 12 genes were found to be overexpressed in BCa patients. Further, C19MC targeted 42 tumor suppressor (TS) genes that were downregulated, of which 15 were significantly correlated with patient survival. Our findings suggest that transcription factors and chromatin modifiers at the promoter region may regulate C19MC overexpression. The upregulated C19MC members, transcription regulators, and TS genes can be further exploited as potential diagnostic and prognostic indicators as well as for therapeutic management of BCa.

Also flagged:tumourcolon cancercancerangiogenesisgene expressionFGFR2
Journal Article 2023-08-05 No Snippets Sallinger K, Gruber M, Müller CT, Bonstingl L, Pritz E, Pankratz K, Gerger A, Smolle MA, Aigelsreiter A, Surova O, Svedlund J, Nilsson M, Kroneis T, El-Heliebi A.
Show Full Abstract

<h4>Background</h4>Opting for or against the administration of adjuvant chemotherapy in therapeutic management of stage II colon cancer remains challenging. Several studies report few survival benefits for patients treated with adjuvant therapy and additionally revealing potential side effects of overtreatment, including unnecessary exposure to chemotherapy-induced toxicities and reduced quality of life. Predictive biomarkers are urgently needed. We, therefore, hypothesise that the spatial tissue composition of relapsed and non-relapsed colon cancer stage II patients reveals relevant biomarkers.<h4>Methods</h4>The spatial tissue composition of stage II colon cancer patients was examined by a novel spatial transcriptomics technology with sub-cellular resolution, namely in situ sequencing. A panel of 176 genes investigating specific cancer-associated processes such as apoptosis, proliferation, angiogenesis, stemness, oxidative stress, hypoxia, invasion and components of the tumour microenvironment was designed to examine differentially expressed genes in tissue of relapsed versus non-relapsed patients. Therefore, FFPE slides of 10 colon cancer stage II patients either classified as relapsed (5 patients) or non-relapsed (5 patients) were in situ sequenced and computationally analysed.<h4>Results</h4>We identified a tumour gene signature that enables the subclassification of tissue into neoplastic and non-neoplastic compartments based on spatial expression patterns obtained through in situ sequencing. We developed a computational tool called Genes-To-Count (GTC), which automates the quantification of in situ signals, accurately mapping their position onto the spatial tissue map and automatically identifies neoplastic and non-neoplastic tissue compartments. The GTC tool was used to quantify gene expression of biological processes upregulated within the neoplastic tissue in comparison to non-neoplastic tissue and within relapsed versus non-relapsed stage II colon patients. Three differentially expressed genes (FGFR2, MMP11 and OTOP2) in the neoplastic tissue compartments of relapsed patients in comparison to non-relapsed patients were identified predicting recurrence in stage II colon cancer.<h4>Conclusions</h4>In depth spatial in situ sequencing showed potential to provide a deeper understanding of the underlying mechanisms involved in the recurrence of disease and revealed novel potential predictive biomarkers for disease relapse in colon cancer stage II patients. Our open-access GTC-tool allowed us to accurately capture the tumour compartment and quantify spatial gene expression in colon cancer tissue.

Also flagged:Acute myeloid leukemiaAMLblood cancercytarabinedaunorubicindeath
Journal Article 2023-08-05 No Snippets Miller D, Kerkhofs K, Abbas-Aghababazadeh F, Madahar SS, Minden MD, Hébert J, Haibe-Kains B, Bayfield MA, Benchimol S.
Show Full Abstract

Erythropoietin (EPO) suppresses drug-induced apoptosis in EPO-receptor-positive leukemia cells and allows cells to persist after drug treatment by promoting cellular senescence. Importantly a small proportion of senescent cells can re-enter the cell cycle and resume proliferation after drug treatment, resulting in disease recurrence/persistence. Using a single-cell assay to track individual cells that exit a drug-induced senescence-like state, we show that cells exhibit asynchronous exit from a senescent-like state, and display different rates of proliferation. Escaped cells retain sensitivity to drug treatment, but display inter-clonal variability. We also find heterogeneity in gene expression with some of the escaped clones retaining senescence-associated gene expression. Senescent leukemia cells exhibit changes in gene expression that affect metabolism and senescence-associated secretory phenotype (SASP)-related genes. Herein, we generate a senescence gene signature and show that this signature is a prognostic marker of worse overall survival in AML and multiple other cancers. A portion of senescent leukemia cells depend on lysosome activity; chloroquine, an inhibitor of lysosome activity, promotes senolysis of some senescent leukemia cells. Our study indicates that the serious risks associated with the use of erythropoietin-stimulating agents (ESAs) in anemic cancer patients may be attributed to their ability to promote drug-tolerant cancer cells through the senescence program.

SERPINC1
Also flagged:ofagingage-related cataractscataractsblindnessmethylation
Journal Article 2023-08-05 ✓ 1 Snippet You Y, Bai C, Wang W, Zhan T, Hu X, Hao F, Xia M, Liu Y, Ma T, Liu Y, Zheng C, Pu T, Zhang Y, Lu Y, Ding N, Li J, Yin Y, Chen Y, Wang L, Zhou J, Niu L, Xiu Y, Lu Y, Jia T, Liu X, Zhang C.
In-Text Gene Mentions

…downregulated (e.g., APOA2,SERPINC1, SERPING1, ITH1, ITH2,…

Show Full Abstract

Approximately 20% of aged captive giant pandas (Ailuropoda melanoleuca) have cataracts that impair their quality of life. To identify potential biomarkers of cataract formation, we carried out a quantitative proteomics analysis of 10 giant pandas to find proteins differing in abundance between healthy and cataract-bearing animals. We identified almost 150 proteins exceeding our threshold for differential abundance, most of which were associated with GO categories related to extracellular localization. The most significant differential abundance was associated with components of the proteasome and other proteins with a role in proteolysis or its regulation, most of which were depleted in pandas with cataracts. Other modulated proteins included components of the extracellular matrix or cytoskeleton, as well as associated signaling proteins and regulators, but we did not find any differentially expressed transcription factors. These results indicate that the formation of cataracts involves a complex post-transcriptional network of signaling inside and outside lens cells to drive stress responses as a means to address the accumulation of protein aggregates triggered by oxidative damage. The modulated proteins also indicate that it should be possible to predict the onset of cataracts in captive pandas by taking blood samples and testing them for the presence or absence of specific protein markers.

STAU1
Also flagged:RIG-Iimmune responseNSCLCESCCcancertumour
Journal Article 2023-08-05 ✓ 1 Snippet Du J, Kageyama SI, Yamashita R, Tanaka K, Okumura M, Motegi A, Hojo H, Nakamura M, Hirata H, Sunakawa H, Kotani D, Yano T, Kojima T, Hamaya Y, Kojima M, Nakamura Y, Suzuki A, Suzuki Y, Tsuchihara K, Akimoto T.
In-Text Gene Mentions

…expression, DDX3X andSTAU1are involved in…

Show Full Abstract

Radiotherapy (RT) plus immunotherapy is a promising modality; however, the therapeutic effects are insufficient, and the molecular mechanism requires clarification to further develop combination therapies. Here, we found that the RNA virus sensor pathway dominantly regulates the cellular immune response in NSCLC and ESCC cell lines. Notably, transposable elements (TEs), especially long terminal repeats (LTRs), functioned as key ligands for the RNA virus sensor RIG-I, and the mTOR-LTR-RIG-I axis induced the cellular immune response and dendritic cell and macrophage infiltration after irradiation. Moreover, RIG-I-dependent immune activation was observed in ESCC patient tissue. scRNA sequencing and spatial transcriptome analysis revealed that radiotherapy induced the expression of LTRs, and the RNA virus sensor pathway in immune and cancer cells; this pathway was also found to mediate tumour conversion to an immunological hot state. Here, we report the upstream and ligand of the RNA virus sensor pathway functions in irradiated cancer tissues.

HTT
Also flagged:Cas9zinc finger nucleasestranscription activator-like effector nucleasesCRISPRhost cellcancers
Journal Article 2023-08-05 ✓ 1 Snippet Khlidj Y.
In-Text Gene Mentions

Further, CRISPR-Cas9 system viro-delivered to the striatum of HD mice enabled the disruption of CAG trinucleotide repeat in exon 1 of the HTT (huntingtin) gene (the mutation responsible of HD) (54).

Show Full Abstract

It's been 10 years now from the debut of clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR/Cas9) era in which gene engineering has never been so accessible, precise and efficient. This technology, like a refined surgical procedure, has offered the ability of removing different types of disease causing mutations and restoring key proteins activity with ease of outperforming the previous resembling methods: zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Additionally, CRISPR-Cas9 systems can systematically introduce genetic sequences to the specific sites in the human genome allowing to stimulate desired functions such as anti-tumoral and anti-infectious faculties. The present brief review provides an updated resume of CRISPR-Cas9's top achievements from its first appearance to the current date focusing on the breakthrough research including <i>in vitro, in vivo</i> and human studies. This enables the evaluation of the previous phase 'the proof-of-concept phase' and marks the beginning of the next phase which will probably bring a spate of clinical trials.

B4GALT5
Also flagged:solid tumorneuroblastomaRASMAPKALKKRAS
Journal Article 2023-08-05 ✓ 1 Snippet Pilgrim AA, Jonus HC, Ho A, Cole AC, Shim J, Goldsmith KC.
In-Text Gene Mentions

…of GD2 (B4GALT5/6 , ST3GAL5 ,…

Show Full Abstract

Pediatric patients with high-risk neuroblastoma often relapse with chemotherapy-resistant, incurable disease. Relapsed neuroblastomas harbor chemo-resistant mesenchymal tumor cells and increased expression/activity of the transcriptional co-regulator, the Yes-Associated Protein (YAP). Patients with relapsed neuroblastoma are often treated with immunotherapy such as the anti-GD2 antibody, dinutuximab, in combination with chemotherapy. We have previously shown that YAP mediates both chemotherapy and MEK inhibitor resistance in relapsed <i>RAS</i> mutated neuroblastoma and so posited that YAP might also be involved in anti-GD2 antibody resistance. We now show that YAP genetic inhibition significantly enhances sensitivity of mesenchymal neuroblastomas to dinutuximab and gamma delta (γδ) T cells both <i>in vitro</i> and <i>in vivo</i>. Mechanistically, YAP inhibition induces increased GD2 cell surface expression through upregulation of <i>ST8SIA1</i>, the gene encoding GD3 synthase and the rate-limiting enzyme in GD2 biosynthesis. The mechanism of <i>ST8SIA1</i> suppression by YAP is independent of <i>PRRX1</i> expression, a mesenchymal master transcription factor, suggesting YAP may be the downstream effector of mesenchymal GD2 resistance. These results therefore identify YAP as a therapeutic target to augment GD2 immunotherapy responses in patients with neuroblastoma.

Also flagged:COVID-19anxiety-19long-termADAARCH
Journal Article 2023-08-05 No Snippets Ben-Ahmed K, Theiri S, Kasraoui N.
Show Full Abstract

This research examines the impact of the coronavirus index on the returns and volatility of ten major cryptocurrencies during the COVID-19 pandemic. For this purpose, we applied a multivariate volatility GARCH model with an integrated dynamic conditional correlation (DCC) approach to daily cryptocurrency values observed data during the January-December, 2020 period. Moreover, we used the Granger causality test to study return-volume correlations. The findings indicate that cryptocurrency volatility declined after the World Health Organization declared on March 11, 2020, that the coronavirus was a pandemic. Unlike most of the relevant previous studies, we found that the COVID-19 crisis did not have a long-term effect on cryptocurrency returns and volatility but only presented a short-term effect. Our results have implications for investors who need to determine an optimal portfolio for a scenario other than the base.

CCDC92
Also flagged:visceral obesitytype 2 diabetesco-localisationlocalisationPABPC4CCNE2
Journal Article 2023-08-04 ✓ 5 Snippets Tang H, Wang J, Deng P, Li Y, Cao Y, Yi B, Zhu L, Zhu S, Lu Y.
In-Text Gene Mentions

Besides, genetically elevated expression of CCNE2 on 8q22.1, HAUS6 on 9p22.1, CWF19L1 on 10q24.31, CCDC92 on 12q24.31 and DNAH10OS on 12q24.31 showed protective effects on type 2 diabetes risk.

In a bivariate GWAS, a novel signal at rs825476 near CCDC92, which is also an expression quantitative trait locus (eQTL) for this gene, was identified as a shared locus between type 2 diabetes and CHD [37].

Ten VAT-specific candidate genes were associated with type 2 diabetes after Bonferroni correction, including five causal genes supported by SMR and co-localisation: PABPC4 (1p34.3); CCNE2 (8q22.1); HAUS6 (9p22.1); CWF19L1 (10q24.31); and CCDC92 (12q24.31).

…CWF19L1 (10q24.31); andCCDC92(12q24.31).…

…CWF19L1 on 10q24.31,CCDC92on 12q24.31 and…

Show Full Abstract

<h4>Aims/hypothesis</h4>This study aimed to assess the causal relationship between visceral obesity and type 2 diabetes and subsequently to screen visceral adipose tissue (VAT)-specific targets for type 2 diabetes.<h4>Methods</h4>We examined the causal relationship between VAT and type 2 diabetes using bidirectional Mendelian randomisation (MR) followed by multivariable MR. We conducted a transcriptome-wide association study (TWAS) leveraging prediction models and a large-scale type 2 diabetes genome-wide association study (74,124 cases and 824,006 controls) to identify candidate genes in VAT and used summary-data-based MR (SMR) and co-localisation analysis to map causal genes. We performed enrichment and single-cell RNA-seq analyses to determine the cell-specific localisation of the TWAS-identified genes. We also conducted knockdown experiments in 3T3-L1 pre-adipocytes.<h4>Results</h4>MR analyses showed a causal relationship between genetically increased VAT mass and type 2 diabetes (inverse-variance weighted OR 2.48 [95% CI 2.21, 2.79]). Ten VAT-specific candidate genes were associated with type 2 diabetes after Bonferroni correction, including five causal genes supported by SMR and co-localisation: PABPC4 (1p34.3); CCNE2 (8q22.1); HAUS6 (9p22.1); CWF19L1 (10q24.31); and CCDC92 (12q24.31). Combined with enrichment analyses, clarifying cell-type specificity with single-cell RNA-seq data indicated that most TWAS-identified candidate genes appear more likely to be associated with adipocytes in VAT. Knockdown experiments suggested that Pabpc4 likely contributes to regulating differentiation and energy metabolism in 3T3-L1 adipocytes.<h4>Conclusions/interpretation</h4>Our findings provide new insights into the genetic basis and biological processes of the association between VAT accumulation and type 2 diabetes and warrant investigation through further functional studies to validate these VAT-specific candidate genes.

CCPG1
Also flagged:cell cycle progressiongene 1gene expressioncancerColorectal cancercell cycle progression gene 1
Journal Article 2023-08-04 ✓ 5 Snippets Fatima SA, Nasim MT, Malik A, Rehman SU, Waris S, Rauf M, Ali SS, Haq F, Awan HM.
In-Text Gene Mentions

…between miR-1183 andCCPG1in colorectal cancer…

CCPG1indirectly modulates the…

…between miR-1183 andCCPG1expression in colorectal…

…gene 1 (CCPG1) as strong,…

…gene 1 (CCPG1) negatively correlated…

Show Full Abstract

MicroRNAs (miRNAs) are small noncoding RNAs that post-transcriptionally regulate gene expression by binding to the 3' untranslated regions (UTR) of target genes. Aberrant expression of miRNAs can lead to disease, including cancer. Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Among several factors, differential expression of miRNA can have serious consequences on disease progression. This study was designed to computationally identify and experimentally verify strong miRNA candidates that could influence CRC progression. In silico analysis of publicly available gene expression microarray datasets revealed significant upregulation of miR-1183 in CRC. Comparison of mRNA microarray expression data with predicted miR-1183 targets led to the identification of cell cycle progression gene 1 (CCPG1) as strong, negatively correlated miR-1183 target. Expression analysis by means of quantitative PCR validated the inverse correlation between miR-1183 and CCPG1 in colorectal cancer tissues. CCPG1 indirectly modulates the cell cycle by interacting with the PH/DH domain of Dbs (Rho-specific guanine nucleotide exchange factor). Interestingly, the computational analysis also showed that miR-1183 is upregulated in liver and gastric cancer. This finding is notable as the liver and stomach are the primary metastatic sites for colorectal cancer and hepatocellular carcinoma respectively. This novel finding highlights the broader implications of miR-1183 dysregulation beyond primary CRC, potentially serving as a valuable prognostic marker and a therapeutic target for both primary and metastatic CRC.

Also flagged:GlioblastomaGBMgliomaprimarybrain tumortemozolomide
Journal Article 2023-08-04 No Snippets Zheng C, Wei Y, Zhang Q, Sun M, Wang Y, Hou J, Zhang P, Lv X, Su D, Jiang Y, Gumin J, Sahni N, Hu B, Wang W, Chen X, McGrail DJ, Zhang C, Huang S, Xu H, Chen J, Lang FF, Hu J, Chen Y.
Show Full Abstract

The glioblastoma (GBM) stem cell-like cells (GSCs) are critical for tumorigenesis/therapeutic resistance of GBM. Mounting evidence supports tumor-promoting function of long noncoding RNAs (lncRNAs), but their role in GSCs remains poorly understood. By combining CRISPRi screen with orthogonal multiomics approaches, we identified a lncRNA <i>DARS1-AS1</i>-controlled posttranscriptional circuitry that promoted the malignant properties of GBM cells/GSCs. Depleting <i>DARS1-AS1</i> inhibited the proliferation of GBM cells/GSCs and self-renewal of GSCs, prolonging survival in orthotopic GBM models. <i>DARS1-AS1</i> depletion also impaired the homologous recombination (HR)-mediated double-strand break (DSB) repair and enhanced the radiosensitivity of GBM cells/GSCs. Mechanistically, <i>DARS1-AS1</i> interacted with YBX1 to promote target mRNA binding and stabilization, forming a mixed transcriptional/posttranscriptional feed-forward loop to up-regulate expression of the key regulators of G<sub>1</sub>-S transition, including E2F1 and CCND1. <i>DARS1-AS1</i>/YBX1 also stabilized the mRNA of <i>FOXM1</i>, a master transcription factor regulating GSC self-renewal and DSB repair. Our findings suggest <i>DARS1-AS1</i>/YBX1 axis as a potential therapeutic target for sensitizing GBM to radiation/HR deficiency-targeted therapy.

Also flagged:C-C motif chemokine ligand 24insulin-like growth factor binding protein 7male infertilityspermatogenesisStem cell factortype A SPG
Journal Article 2023-08-04 No Snippets Jin C, Wang Z, Li P, Tang J, Jiao T, Li Y, Ou J, Zou D, Li M, Mang X, Liu J, Ma Y, Wu X, Shi J, Chen S, He M, Lu Y, Zhang N, Miao S, Sun F, Wang L, Li K, Yu J, Song W.
Show Full Abstract

The intricate interaction between spermatogonial stem cell (SSC) and testicular niche is essential for maintaining SSC homeostasis; however, this interaction remains largely uncharacterized. In this study, to characterize the underlying signaling pathways and related paracrine factors, we delineated the intercellular interactions between SSC and niche cell in both adult mice and humans under physiological conditions and dissected the niche-derived regulation of SSC maintenance under recovery conditions, thus uncovering the essential role of C-C motif chemokine ligand 24 and insulin-like growth factor binding protein 7 in SSC maintenance. We also established the clinical relevance of specific paracrine factors in human fertility. Collectively, our work on decoding the adult SSC niche serves as a valuable reference for future studies on the aetiology, diagnosis, and treatment of male infertility.

SOX6
Also flagged:retinoic acidRAcleft palateWntShhpathogenesis
Journal Article 2023-08-04 ✓ 1 Snippet Song C, Li T, Zhang C, Li S, Lu S, Zou Y.
In-Text Gene Mentions

…, Sox5 ,Sox6, Col2 ,…

Show Full Abstract

Proper retinoic acid (RA) signaling is essential for normal craniofacial development. Both excessive RA and RA deficiency in early embryonic stage may lead to a variety of craniofacial malformations, for example, cleft palate, which have been investigated extensively. Dysregulated Wnt and Shh signaling were shown to underlie the pathogenesis of RA-induced craniofacial defects. In our present study, we showed a spatiotemporal-specific effect of RA signaling in regulating early development of facial prominences. Although inhibited Wnt activities was observed in E12.5/E13.5 mouse palatal shelves, early exposure of excessive RA induced Wnt signaling and Wnt-related gene expression in E11.5/E12.5 mouse embryonic frontonasal/maxillary processes. A conserved regulatory network of <i>miR-484</i>-<i>Fzd5</i> was identified to play critical roles in RA-regulated craniofacial development using RNA-seq. In addition, subsequent osteogenic/chondrogenic differentiation were differentially regulated in discrete mouse embryonic facial prominences in response to early RA induction, demonstrated using both in vitro and in vivo analyses.

Also flagged:HCMV infectioncongenital infectionshearingcognitive disordersimmunosuppressionimmune response
Journal Article 2023-08-04 No Snippets Penner I, Dejung M, Freiwald A, Butter F, Chen JX, Plachter B.
Show Full Abstract

Human cytomegalovirus (HCMV) is a pathogen of high medical relevance. Subviral Dense Bodies (DB) were developed as a vaccine candidate to ameliorate the severe consequences of HCMV infection. Development of such a candidate vaccine for human application requires detailed knowledge of its interaction with the host. A comprehensive mass spectrometry (MS)- based analysis was performed regarding the changes in the proteome of cell culture cells, exposed to DB.

Also flagged:developmental impairmentgestationcentral nervous system disordercerebral palsydeafnessblindness
Journal Article 2023-08-04 No Snippets Green CE, Tyson JE, Heyne RJ, Hintz SR, Vohr BR, Bann CM, Das A, Bell EF, Debsareea SB, Stephens E, Gantz MG, Petrie Huitema CM, Johnson KJ, Watterberg KL, Mosquera R, Peralta-Carcelen M, Wilson-Costello DE, Colaizy TT, Maitre NL, Merhar SL, Adams-Chapman I, Fuller J, Hartley-McAndrew ME, Malcolm WF, Winter S, Duncan AF, Myer GJ, Kicklighter SD, Wyckoff MH, DeMauro SB, Hibbs AM, Stoll BJ, Carlo WA, Van Meurs KP, Rysavy MA, Patel RM, Sánchez PJ, Laptook AR, Cotten CM, D'Angio CT, Walsh MC, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>Extremely preterm (EP) impairment rates are likely underestimated using the Bayley III norm-based thresholds scores and may be better assessed relative to concurrent healthy term reference (TR) infants born in the same hospital.<h4>Study design</h4>Blinded, certified examiners in the Neonatal Research Network (NRN) evaluated EP survivors and a sample of healthy TR infants recruited near the 2-year assessment age.<h4>Results</h4>We assessed 1452 EP infants and 183 TR infants. TR-based thresholds showed higher overall EP impairment than Bayley norm-based thresholds (O.R. = 1.86; [95% CI 1.56-2.23], especially for severe impairment (36% vs. 24%; p ≤ 0.001). Difficulty recruiting TR patients at 2 years extended the study by 14 months and affected their demographics.<h4>Conclusion</h4>Impairment rates among EP infants appear to be substantially underestimated from Bayley III norms. These rates may be best assessed by comparison with healthy term infants followed with minimal attrition from birth in the same centers.<h4>Clinicaltrials</h4><h4>Gov id</h4>Term Reference (under the Generic Database Study): NCT00063063.

CCPG1
Also flagged:Primary liver cancermalignant tumoursHepatocellular carcinomaliver cancertumourcancer
Journal Article 2023-08-04 ✓ 1 Snippet Yang Y, Xiong L, Li M, Jiang P, Wang J, Li C.
In-Text Gene Mentions

Cell cycle checkpoint kinase 1cycle checkpoint kinase…

Show Full Abstract

Primary liver cancer is one of the most common malignant tumours worldwide; it caused approximately 830,000 deaths in 2020. Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer, accounting for over 80% of all cases. Various methods, including surgery, chemotherapy, radiotherapy, and radiofrequency ablation, have been widely used in the treatment of HCC. With the advancement of technology, radiotherapy has become increasingly important in the comprehensive treatment of HCC. However, due to the insufficient sensitivity of tumour cells to radiation, there are still multiple limitation in clinical application of radiotherapy. In recent years, the role of immunotherapy in cancer has been increasingly revealed, and more researchers have turned their attention to the combined application of immunotherapy and radiotherapy in the hope of achieving better treatment outcomes. This article reviews the progress on radiation therapy in HCC and the current status of its combined application with immunotherapy, and discusses the prospects and value of radioimmunotherapy in HCC.

Also flagged:cataractcrystallin proteins
Journal Article 2023-08-04 No Snippets Lerebours A, Regini J, Quinlan RA, Wada T, Pierscionek B, Devonshire M, Kalligeraki AA, Uwineza A, Young L, Girkin JM, Warwick P, Smith K, Hoshino M, Uesugi K, Yagi N, Terrill N, Shebanova O, Snow T, Smith JT.
Show Full Abstract

Recent studies apparently finding deleterious effects of radiation exposure on cataract formation in birds and voles living near Chernobyl represent a major challenge to current radiation protection regulations. This study conducted an integrated assessment of radiation exposure on cataractogenesis using the most advanced technologies available to assess the cataract status of lenses extracted from fish caught at both Chernobyl in Ukraine and Fukushima in Japan. It was hypothesised that these novel data would reveal positive correlations between radiation dose and early indicators of cataract formation. The structure, function and optical properties of lenses were analysed from atomic to millimetre length scales. We measured the short-range order of the lens crystallin proteins using Small Angle X-Ray Scattering (SAXS) at both the SPring-8 and DIAMOND synchrotrons, the profile of the graded refractive index generated by these proteins, the epithelial cell density and organisation and finally the focal length of each lens. The results showed no evidence of a difference between the focal length, the epithelial cell densities, the refractive indices, the interference functions and the short-range order of crystallin proteins (X-ray diffraction patterns) in lens from fish exposed to different radiation doses. It could be argued that animals in the natural environment which developed cataract would be more likely, for example, to suffer predation leading to survivor bias. But the cross-length scale study presented here, by evaluating small scale molecular and cellular changes in the lens (pre-cataract formation) significantly mitigates against this issue.

MLLT10
Also flagged:Reproductive Disordersdepressionfemale depressionovarian cystsendometriosisuterine fibroids
Journal Article 2023-08-04 ✓ 1 Snippet Kiewa J, Mortlock S, Meltzer-Brody S, Middeldorp C, Wray NR, Byrne EM.
In-Text Gene Mentions

…) intronic toMLLT10.…

Show Full Abstract

<h4>Introduction</h4>Sex steroid hormone fluctuations may underlie both reproductive disorders and sex differences in lifetime depression prevalence. Previous studies report high comorbidity among reproductive disorders and between reproductive disorders and depression. This study sought to assess the multivariate genetic architecture of reproductive disorders and their loading onto a common genetic factor and investigated whether this latent factor shares a common genetic architecture with female depression, including perinatal depression (PND).<h4>Method</h4>Using UK Biobank and FinnGen data, genome-wide association meta-analyses were conducted for nine reproductive disorders, and genetic correlation between disorders was estimated. Genomic Structural Equation Modelling identified a latent genetic factor underlying disorders, accounting for their significant genetic correlations. SNPs significantly associated with both latent factor and depression were identified.<h4>Results</h4>Excellent model fit existed between a latent factor underlying five reproductive disorders (χ2 (5) = 6.4; AIC = 26.4; CFI = 1.00; SRMR = 0.03) with high standardised loadings for menorrhagia (0.96, SE = 0.05); ovarian cysts (0.94, SE = 0.05); endometriosis (0.83, SE = 0.05); menopausal symptoms (0.77, SE = 0.10); and uterine fibroids (0.65, SE = 0.05). This latent factor was genetically correlated with PND (rG = 0.37, SE = 0.15, p = 1.4e-03), depression in females only (rG = 0.48, SE = 0.06, p = 7.2e-11), and depression in both males and females (MD) (rG = 0.35, SE = 0.03, p = 1.8e-30), with its top locus associated with FSHB/ARL14EP (rs11031006; p = 9.1e-33). SNPs intronic to ESR1, significantly associated with the latent factor, were also associated with PND, female depression, and MD.<h4>Conclusion</h4>A common genetic factor, correlated with depression, underlies risk of reproductive disorders, with implications for aetiology and treatment. Genetic variation in ESR1 is associated with reproductive disorders and depression, highlighting the importance of oestrogen signalling for both reproductive and mental health.

HTT
Also flagged:Puerperal psychosisMental illnessesbehavioral problemsanxiety disorderspostpartum psychosispsychotic illness
Journal Article 2023-08-04 ✓ 1 Snippet Baldaçara L, Leite VDS, Teles ALS, Silva AGD.
In-Text Gene Mentions

Additional possible risk factors include a history of bipolar disorder in the patient's family, particular genetic variants of the serotonin transporter gene (5-HTT), and a genome-wide significant linkage signal at chromosome 16p13 in patients with a history of both bipolar disorder and postpartum psychosis7.

Show Full Abstract

No abstract available.

Also flagged:post-myocardial infarction depressionMyocardial infarctionMIDepressioncoagulationstatins
Journal Article 2023-08-04 No Snippets Garrels E, Kainth T, Silva B, Yadav G, Gill G, Salehi M, Gunturu S.
Show Full Abstract

Myocardial infarction (MI) can have significant physical and mental consequences. Depression is a prevalent psychiatric condition after MI which can reduce the quality of life and increase the mortality rates of patients. However, the connection between MI and depression has remained under-appreciated. This review examines the potential connection between depression and MI by overviewing the possible pathophysiologic mechanisms including dysregulation of the hypothalamic-pituitary-adrenal axis and autonomic nervous system, coagulation system dysfunction, inflammation, environmental factors, as well as, genetic factors. Furthermore, depression can be an adverse event of medications used for MI treatment including beta-blockers, statins, or anti-platelet agents. The need for early detection and management of depression in patients with MI is, therefore, crucial for improving their overall prognosis. Adherence to treatments and regular follow-up visits can ensure the best response to treatment.

PEBP1
Also flagged:canceroxygendeathtumorautophagyferroptosis
Journal Article 2023-08-04 ✓ 1 Snippet Zheng Z, Su J, Bao X, Wang H, Bian C, Zhao Q, Jiang X.
In-Text Gene Mentions

ROS, reactive oxygen species; ATM, ataxia telangiectasia mutated protein; IFN, interferon; GSH, glutathione; GSSG, Glutathione Oxidized; GPX4, glutathione peroxidase 4; PUFAs, polyunsaturated fatty acids; ACSL4, acyl-CoA synthetase long-chain family member 4; ALOXs, Lipoxygenases; PEBP1, Phosphatidylethanolamine-binding Protein 1; DAMPs, damage-associated molecular patterns; TAM, tumor-associated macrophage.

Show Full Abstract

Radiotherapy (RT) is an effective treatment option for cancer patients, which induces the production of reactive oxygen species (ROS) and causes oxidative stress (OS), leading to the death of tumor cells. OS not only causes apoptosis, autophagy and ferroptosis, but also affects tumor immune response. The combination of RT and immunotherapy has revolutionized the management of various cancers. In this process, OS caused by ROS plays a critical role. Specifically, RT-induced ROS can promote the release of tumor-associated antigens (TAAs), regulate the infiltration and differentiation of immune cells, manipulate the expression of immune checkpoints, and change the tumor immune microenvironment (TME). In this review, we briefly summarize several ways in which IR induces tumor cell death and discuss the interrelationship between RT-induced OS and antitumor immunity, with a focus on the interaction of ferroptosis with immunogenic death. We also summarize the potential mechanisms by which ROS regulates immune checkpoint expression, immune cells activity, and differentiation. In addition, we conclude the therapeutic opportunity improving radiotherapy in combination with immunotherapy by regulating OS, which may be beneficial for clinical treatment.

POU3F2
Also flagged:Protein arginine methyltransferase 1Multiple myelomaplasma cell malignancyPRMT1pathogenesismethylation
Journal Article 2023-08-04 ✓ 1 Snippet Nguyen HP, Le AQ, Liu E, Cesarano A, DiMeo F, Perna F, Kapur R, Walker BA, Tran NT.
In-Text Gene Mentions

…genes (KIT andPOU3F2) ( Figure 5C…

Show Full Abstract

Multiple myeloma (MM) is a devastating plasma cell malignancy characterized by the expansion of aberrant monoclonal plasma cells in the bone marrow, leading to severe clinical manifestations and poor prognosis, particularly in relapsed/refractory cases. Identifying novel therapeutic targets is crucial to improve treatment outcomes in these patients. In this study, we investigated the role of the protein arginine methyltransferase 1 (PRMT1) in MM pathogenesis and explored its potential as a therapeutic target. We observed that PRMT1, responsible for most asymmetric di-methylation in cells, exhibited the highest expression among PRMT family members in MM cell lines and primary MM cells. Importantly, PRMT1 expression was significantly elevated in relapsed/refractory patients compared to newly diagnosed patients. High expression of PRMT1 expression was strongly associated with poor prognosis. We found that genetic or enzymatic inhibition of PRMT1 impaired MM cell growth, induced cell cycle arrest, and triggered cell death. Treatment with MS023, a potent PRMT type I inhibitor, demonstrated a robust inhibitory effect on the viability of primary cells isolated from newly diagnosed and proteasome inhibitor-relapsed/refractory patients in a dose-dependent manner. Suppression of PRMT1 downregulated genes related to cell division and upregulated genes associated with apoptosis pathway. We also found that genes related to immune response and lymphocyte activation were significantly upregulated in PRMT1-suppressed cells. Notably, the activation status of T cells was strikingly enhanced upon co-culturing with PRMT1-KO MM cells. <i>In vivo</i> studies using a xenograft model revealed that targeting PRMT1 by either CRISPR/Cas9-mediated knockout or MS023 treatment significantly attenuated MM tumor growth and prolonged the survival of tumor-bearing mice. Histological analysis further confirmed increased apoptotic cell death in MS023-treated tumors. Collectively, our findings establish PRMT1 as an indispensable and novel therapeutic vulnerability in MM. The elevated expression of PRMT1 in relapsed/refractory patients underscores its potential as a target for overcoming treatment resistance. Moreover, our results highlight the efficacy of MS023 as a promising therapeutic agent against MM, offering new avenues for therapeutic approaches in relapsed/refractory MM.

Also flagged:Severe Acute RespiratorypneumoniaRemdesivirBaricitinibtranslationalbinding
Journal Article 2023-08-04 No Snippets Elkashlan M, Ahmad RM, Hajar M, Al Jasmi F, Corchado JM, Nasarudin NA, Mohamad MS.
Show Full Abstract

The emergence of Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2) posed a serious worldwide threat and emphasized the urgency to find efficient solutions to combat the spread of the virus. Drug repurposing has attracted more attention than traditional approaches due to its potential for a time- and cost-effective discovery of new applications for the existing FDA-approved drugs. Given the reported success of machine learning (ML) in virtual drug screening, it is warranted as a promising approach to identify potential SARS-CoV-2 inhibitors. The implementation of ML in drug repurposing requires the presence of reliable digital databases for the extraction of the data of interest. Numerous databases archive research data from studies so that it can be used for different purposes. This article reviews two aspects: the frequently used databases in ML-based drug repurposing studies for SARS-CoV-2, and the recent ML models that have been developed for the prospective prediction of potential inhibitors against the new virus. Both types of ML models, Deep Learning models and conventional ML models, are reviewed in terms of introduction, methodology, and its recent applications in the prospective predictions of SARS-CoV-2 inhibitors. Furthermore, the features and limitations of the databases are provided to guide researchers in choosing suitable databases according to their research interests.

SOX6
Also flagged:LSCCcancerslaryngeal squamous cell carcinomacancer of the head and neckLarynx cancersdeath
Journal Article 2023-08-04 ✓ 1 Snippet Zhang L, Zhang Z, Zheng X, Lu Y, Dai L, Li W, Liu H, Wen S, Xie Q, Zhang X, Wang P, Wu Y, Gao W.
In-Text Gene Mentions

…PBX3, IPO7, COL1A1,SOX6, FMR1, COL1A1, APC,…

Show Full Abstract

<h4>Background</h4>Laryngeal squamous cell carcinoma (LSCC) is a common cancer of the head and neck in humans. The 5-years survival rate of patients with LSCC have declined in the past four decades. microRNAs (miRNAs) has been reported to be capable of predicting the prognosis outcomes of patients with different cancers. However, there are no reports on the usage of multi-miRNAs model as signature for the diagnosis or prognosis of LSCC.<h4>Methods</h4>To establish the miRNAs expression-associated model for diagnosis, prognosis prediction and aided therapy of patients with LSCC, the present study enrolled 107 patients with LSCC in clinic and obtained 117 LSCC samples data from TCGA database for evaluation, respectively. Next generation sequencing (NGS), raw data processing, the least absolute shrinkage and selection operator algorithm, Cox regression analysis, construction of nomogram and cell function assays (including proliferation, migration and invasion assays) were sequentially performed.<h4>Results</h4>There were massively dysregulated miRNAs in the LSCC compared to normal tissues. A six-miRNAs signature consists of miR-137-3p, miR-3934-5p, miR-1276, miR-129-5p, miR-7-5p and miR-105-5p was built for prognosis prediction of LSCC patients. The six-miRNAs signature is strongly associated with the poor overall survival (OS, p = 2.5e-05, HR: 4.30 [2.20-8.50]), progression free interval (PFI, p = 0.025, HR: 1.94 [1.08-3.46]) and disease specific survival (DSS, p = 1.1e-05, HR: 5.00 [2.50-10.00]). A nomogram for prediction of 2-, 3- and 5-years OS was also developed based on the six-miRNAs signature and clinical features. Furthermore, blocking the function of each of the six miRNAs inhibited proliferation, invasion and migration of LSCC cells.<h4>Conclusions</h4>The performance of six-miRNAs signature described in the current study demonstrated remarkable potential for progression assessment of LSCC. Moreover, the six-miRNAs signature may serve as predictive tool for prognosis and therapeutic targets of LSCC in clinic.

PRDX6
Also flagged:Congenital Disorders of glycosylationCDGgenetic disorderslipidglycosylationmitochondrial disorders
Journal Article 2023-08-04 ✓ 1 Snippet Ligezka AN, Budhraja R, Nishiyama Y, Fiesel FC, Preston G, Edmondson A, Ranatunga W, Van Hove JLK, Watzlawik JO, Springer W, Pandey A, Morava E, Kozicz T.
In-Text Gene Mentions

…ins included peroxiredoxin-6 (PRDX6), quinone oxidoreductase (CRY…

Show Full Abstract

Congenital disorders of glycosylation (CDG) and mitochondrial disorders are multisystem disorders with overlapping symptomatology. Pathogenic variants in the PMM2 gene lead to abnormal N-linked glycosylation. This disruption in glycosylation can induce endoplasmic reticulum stress, contributing to the disease pathology. Although impaired mitochondrial dysfunction has been reported in some CDG, cellular bioenergetics has never been evaluated in detail in PMM2-CDG. This prompted us to evaluate mitochondrial function and autophagy/mitophagy in vitro in <i>PMM2</i> patient-derived fibroblast lines of differing genotypes from our natural history study. We found secondary mitochondrial dysfunction in PMM2-CDG. This dysfunction was evidenced by decreased mitochondrial maximal and ATP-linked respiration, as well as decreased complex I function of the mitochondrial electron transport chain. Our study also revealed altered autophagy in PMM2-CDG patient-derived fibroblast lines. This was marked by an increased abundance of the autophagosome marker LC3-II. Additionally, changes in the abundance and glycosylation of proteins in the autophagy and mitophagy pathways further indicated dysregulation of these cellular processes. Interestingly, serum sorbitol levels (a biomarker of disease severity) and the CDG severity score showed an inverse correlation with the abundance of the autophagosome marker LC3-II. This suggests that autophagy may act as a modulator of biochemical and clinical markers of disease severity in PMM2-CDG. Overall, our research sheds light on the complex interplay between glycosylation, mitochondrial function, and autophagy/mitophagy in PMM2-CDG. Manipulating mitochondrial dysfunction and alterations in autophagy/mitophagy pathways could offer therapeutic benefits when combined with existing treatments for PMM2-CDG.

SERPINC1
Also flagged:ARDScoagulopathySerine proteaseSERPINSproteasescomplement proteases
Journal Article 2023-08-03 ✓ 4 Snippets Zhang L, Li YH, Kibler K, Kraberger S, Varsani A, Turk J, Elmadbouly N, Aliskevich E, Spaccarelli L, Estifanos B, Enow J, Zanetti IR, Saldevar N, Lim E, Schlievert J, Browder K, Wilson A, Juan FA, Pinteric A, Garg A, Monder H, Saju R, Gisriel S, Jacobs B, Karr TL, Florsheim EB, Kumar V, Wallen J, Rahman M, McFadden G, Hogue BG, Lucas AR.
In-Text Gene Mentions

Anti‐thrombin III (AT, SERPINC1) was previously investigated as a treatment for bacterial sepsis and associated disseminated intravascular coagulation (DIC).

Anti‐thrombin (AT, SERPINC1) has been investigated as a treatment for severe bacterial sepsis and DIC (Papageorgiou et al, 2018; Levi et al, 2020; Levi & Thachil, 2020).

…Anti‐thrombin III (AT,SERPINC1) was previously investigated…

…Anti‐thrombin (AT,SERPINC1) has been investigated…

Show Full Abstract

SARS-CoV-2 acute respiratory distress syndrome (ARDS) induces uncontrolled lung inflammation and coagulopathy with high mortality. Anti-viral drugs and monoclonal antibodies reduce early COVID-19 severity, but treatments for late-stage immuno-thrombotic syndromes and long COVID are limited. Serine protease inhibitors (SERPINS) regulate activated proteases. The myxoma virus-derived Serp-1 protein is a secreted immunomodulatory serpin that targets activated thrombotic, thrombolytic, and complement proteases as a self-defense strategy to combat clearance. Serp-1 is effective in multiple animal models of inflammatory lung disease and vasculitis. Here, we describe systemic treatment with purified PEGylated Serp-1 as a therapy for immuno-coagulopathic complications during ARDS. Treatment with PEGSerp-1 in two mouse-adapted SARS-CoV-2 models in C57Bl/6 and BALB/c mice reduced lung and heart inflammation, with improved outcomes. PEGSerp-1 significantly reduced M1 macrophages in the lung and heart by modifying urokinase-type plasminogen activator receptor (uPAR), thrombotic proteases, and complement membrane attack complex (MAC). Sequential changes in gene expression for uPAR and serpins (complement and plasminogen inhibitors) were observed. PEGSerp-1 is a highly effective immune-modulator with therapeutic potential for severe viral ARDS, immuno-coagulopathic responses, and Long COVID.

ECI2
Also flagged:Colorectal cancercancer5-fluorouracilleucovorinirinotecanoxaliplatin
Journal Article 2023-08-03 ✓ 5 Snippets Cheraghi-Shavi T, Jalal R, Minuchehr Z.
In-Text Gene Mentions

The qRT-PCR was performed to experimentally validate the expression level of FXYD3, LGALS4, USH1C, ECI2, TGM2, and HMGA2 genes in the parental and oxaliplatin-resistant HCT116 cells (Fig 10).

The mRNA expression level of FXYD3, LGALS4, USH1C, ECI2, TGM2, and HMGA2 genes which are involved in EMT, drug resistance, and cancer progression were measured in HCT116/OX-R4.3 and HCT116/OX-R10 cells by qRT-PCR.

Relative mRNA expression levels related to six selected hub genes (USH1C, TGM2, HMGA2, FXYD3, LGALS4, and ECI2) in the parental HCT116 cells and two oxaliplatin-resistant sub-lines, HCT116/OX-R4.3 and HCT116/OX-R10 cells.

ECI2 and SCHIP1 genes may probably be regarded as novel genes in oxaliplatin-resistant CRC cells.

In the next step, two novel up-regulated hub genes including ECI2 and SCHIP1 were identified to be related to oxaliplatin resistance.

Show Full Abstract

Acquired resistance to oxaliplatin is considered as the primary reason for failure in colorectal cancer (CRC) therapy. Identifying the underlying resistance mechanisms may improve CRC treatment. The present study aims to identify the key genes involved in acquired oxaliplatin-resistant in CRC by confirming the oxaliplatin resistance index (OX-RI). To this aim, two public microarray datasets regarding oxaliplatin-resistant CRC cells with different OX-RI, GSE42387, and GSE76092 were downloaded from GEO database to identify differentially expressed genes (DEGs). The results indicated that the OX-RI affects the gene expression pattern significantly. Then, 54 common DEGs in both datasets including 18 up- and 36 down-regulated genes were identified. Protein-protein interaction (PPI) analysis revealed 13 up- (MAGEA6, TGM2, MAGEA4, SCHIP1, ECI2, CD33, AKAP12, MAGEA12, CALD1, WFDC2, VSNL1, HMGA2, and MAGEA2B) and 12 down-regulated (PDZK1IP1, FXYD3, ALDH2, CEACAM6, QPRT, GRB10, TM4SF4, LGALS4, ALDH3A1, USH1C, KCNE3, and CA12) hub genes. In the next step, two novel up-regulated hub genes including ECI2 and SCHIP1 were identified to be related to oxaliplatin resistance. Functional enrichment and pathway analysis indicated that metabolic pathways, proliferation, and epithelial-mesenchymal transition may play dominant roles in CRC progression and oxaliplatin resistance. In the next procedure, two in vitro oxaliplatin-resistant sub-lines including HCT116/OX-R4.3 and HCT116/OX-R10 cells with OX-IR 3.93 and 10.06 were established, respectively. The results indicated the up-regulation of TGM2 and HMGA2 in HCT116/OX-R10 cells with high OX-RI and down-regulation of FXYD3, LGALS4, and ECI2 in both cell types. Based on the results, TGM2, HMGA2, FXYD3, and LGALS4 genes are related to oxaliplatin-resistant CRC and may serve as novel therapeutic targets.

SOX6
Also flagged:methylationcytosinenucleotidewatertumormental diseases
Journal Article 2023-08-03 ✓ 1 Snippet Zhang Q, Ma S, Liu Z, Zhu B, Zhou Z, Li G, Meana JJ, González-Maeso J, Lu C.
In-Text Gene Mentions

…GRIK3 , andSOX66 .…

Show Full Abstract

The genome-wide DNA methylation profile, or DNA methylome, is a critical component of the overall epigenomic landscape that modulates gene activities and cell fate. Single-cell DNA methylomic studies offer unprecedented resolution for detecting and profiling cell subsets based on methylomic features. However, existing single-cell methylomic technologies are based on use of tubes or well plates and these platforms are not easily scalable for handling a large number of single cells. Here we demonstrate a droplet-based microfluidic technology, Drop-BS, to construct single-cell bisulfite sequencing libraries for DNA methylome profiling. Drop-BS takes advantage of the ultrahigh throughput offered by droplet microfluidics to prepare bisulfite sequencing libraries of up to 10,000 single cells within 2 days. We apply the technology to profile mixed cell lines, mouse and human brain tissues to reveal cell type heterogeneity. Drop-BS offers a promising solution for single-cell methylomic studies requiring examination of a large cell population.

SOX6
Also flagged:DopamineaxonsSlc17a6Vglut2Calb1Anxa1
Journal Article 2023-08-03 ✓ 5 Snippets Azcorra M, Gaertner Z, Davidson C, He Q, Kim H, Nagappan S, Hayes CK, Ramakrishnan C, Fenno L, Kim YS, Deisseroth K, Longnecker R, Awatramani R, Dombeck DA.
In-Text Gene Mentions

…Determination ofSox6+ and Calb1…

…settings: features = c(‘Sox6’, ‘Calb1’), min.pct =…

…+ /Otx2 − /Sox6− /Aldh1a1 −…

…− /Otx2 − /Sox6− /Aldh1a1 −…

…significantly enriched forSox6(Wilcoxon rank-sum test,…

Show Full Abstract

Dopamine neurons are characterized by their response to unexpected rewards, but they also fire during movement and aversive stimuli. Dopamine neuron diversity has been observed based on molecular expression profiles; however, whether different functions map onto such genetic subtypes remains unclear. In this study, we established that three genetic dopamine neuron subtypes within the substantia nigra pars compacta, characterized by the expression of Slc17a6 (Vglut2), Calb1 and Anxa1, each have a unique set of responses to rewards, aversive stimuli and accelerations and decelerations, and these signaling patterns are highly correlated between somas and axons within subtypes. Remarkably, reward responses were almost entirely absent in the Anxa1<sup>+</sup> subtype, which instead displayed acceleration-correlated signaling. Our findings establish a connection between functional and genetic dopamine neuron subtypes and demonstrate that molecular expression patterns can serve as a common framework to dissect dopaminergic functions.

SHISA6
Also flagged:gene expressionDRD2DRD5CHRM4GABRDglutamate
Journal Article 2023-08-03 ✓ 5 Snippets Polzin BJ, Stevenson SA, Gammie SC, Riters LV.
In-Text Gene Mentions

…connected gene) wasSHISA6, which is thought…

…singing condition wasSHISA6, an auxiliary AMPA…

…functional role ofSHISA6in the mPOA,…

…shown that increasedSHISA6expression in the…

…AMPA receptor complex,SHISA6and GRIA1 standout…

Show Full Abstract

<h4>Background</h4>Song performed in flocks by European starlings (Sturnus vulgaris), referred to here as gregarious song, is a non-sexual, social behavior performed by adult birds. Gregarious song is thought to be an intrinsically reinforced behavior facilitated by a low-stress, positive affective state that increases social cohesion within a flock. The medial preoptic area (mPOA) is a region known to have a role in the production of gregarious song. However, the neurochemical systems that potentially act within this region to regulate song remain largely unexplored. In this study, we used RNA sequencing to characterize patterns of gene expression in the mPOA of male and female starlings singing gregarious song to identify possibly novel neurotransmitter, neuromodulator, and hormonal pathways that may be involved in the production of gregarious song.<h4>Results</h4>Differential gene expression analysis and rank rank hypergeometric analysis indicated that dopaminergic, cholinergic, and GABAergic systems were associated with the production of gregarious song, with multiple receptor genes (e.g., DRD2, DRD5, CHRM4, GABRD) upregulated in the mPOA of starlings who sang at high rates. Additionally, co-expression network analyses identified co-expressing gene clusters of glutamate signaling-related genes associated with song. One of these clusters contained five glutamate receptor genes and two glutamate scaffolding genes and was significantly enriched for genetic pathways involved in neurodevelopmental disorders associated with social deficits in humans. Two of these genes, GRIN1 and SHANK2, were positively correlated with performance of gregarious song.<h4>Conclusions</h4>This work provides new insights into the role of the mPOA in non-sexual, gregarious song in starlings and highlights candidate genes that may play a role in gregarious social interactions across vertebrates. The provided data will also allow other researchers to compare across species to identify conserved systems that regulate social behavior.

UNC13C
Also flagged:albuminmembraneEggshell formationion transportermineralsATP binding cassette subfamily C member 9
Journal Article 2023-08-03 ✓ 1 Snippet Sun T, Xiao C, Yang Z, Deng J, Yang X.
In-Text Gene Mentions

…homolog C (UNC13C), multiple EGF-like-domains…

Show Full Abstract

The avian eggshell is formed in the uterus. Changes in uterine function may have a significant effect on eggshell quality. To identify the vital genes impacting uterine functional maintenance in the chicken, uteri in three different periods (22W, 31W, 51W) were selected for RNA sequencing and bioinformatics analysis. In our study, 520, 706 and 736 differentially expressed genes (DEGs) were respectively detected in the W31 vs W22 group, W51 vs W31 group and W51 vs W22 group. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis indicated DEGs were enriched in the extracellular matrix, extracellular region part, extracellular region, extracellular matrix structural constituent, ECM receptor interaction, collagen-containing extracellular matrix and collagen trimer in the uterus (P < 0.05). Protein-protein interaction analysis revealed that FN1, LOX, THBS2, COL1A1, COL1A2, COL5A1, COL5A2, POSTN, MMP13, VANGL2, RAD54B, SPP1, SDC1, BTC, ANGPTL3 might be key candidate genes for uterine functional maintenance in chicken. This study discovered dominant genes and pathways which enhanced our knowledge of chicken uterine functional maintenance.

ECI2
Also flagged:tryptophanmetabolismtumorimmune responsecancerscatabolism
Journal Article 2023-08-03 ✓ 1 Snippet Long G, Wang D, Tang J, Tang W.
In-Text Gene Mentions

…ACOX1 , andECI2ranked the top…

Show Full Abstract

Tryptophan metabolism is associated with tumorigenesis and tumor immune response in various cancers. Liver is the main place where tryptophan catabolism is performed. However, the role of tryptophan metabolism in hepatocellular carcinoma (HCC) has not been well clarified. In the present study, we described the mutations of 42 tryptophan metabolism-related genes (TRPGs) in HCC cohorts. Then, HCC patients were well distributed into two subtypes based on the expression profiles of the 42 TRPGs. The clinicopathological characteristics and tumor microenvironmental landscape of the two subtypes were profiled. We also established a TRPGs scoring system and identified four hallmark TRPGs, including <i>ACSL3, ADH1B, ALDH2,</i> and <i>HADHA</i>. Univariate and multivariate Cox regression analysis revealed that the TRPG signature was an independent prognostic indicator for HCC patients. Besides, the predictive accuracy of the TRPG signature was assessed by the receiver operating characteristic curve (ROC) analysis. These results showed that the TRPG risk model had an excellent capability in predicting survival in both TCGA and GEO HCC cohorts. Moreover, we discovered that the TRPG signature was significantly related to the different immune infiltration and therapeutic drug sensitivity. The functional experiments and immunohistochemistry staining analysis also validated the results above. Our comprehensive analysis enhanced our understanding of TRPGs in HCC. A novel predictive model based on TRPGs was built, which may be considered as a beneficial tool for predicting the clinical outcomes of HCC patients.

NEGR1
Also flagged:Neuromuscular diseasescytoskeletonplasmalemmanucleusendoplasmic reticulummitochondria
Journal Article 2023-08-03 ✓ 2 Snippets Dowling P, Zweyer M, Sabir H, Henry M, Meleady P, Swandulla D, Ohlendieck K.
In-Text Gene Mentions

…NCAM1, NCAM2, NRCAM,NEGR1, L1CAM AND CADM3.…

neuronal growth regulator 1growth regulator 1…

Show Full Abstract

Neuromuscular diseases with primary muscle wasting symptoms may also display multi-systemic changes in the body and exhibit secondary pathophysiological alterations in various non-muscle tissues. In some cases, this includes proteome-wide alterations and/or adaptations in the central nervous system. Thus, in order to provide an improved bioanalytical basis for the comprehensive evaluation of animal models that are routinely used in muscle research, this report describes the mass spectrometry-based proteomic characterization of the mouse brain. Crude tissue extracts were examined by bottom-up proteomics and detected 4558 distinct protein species. The detailed analysis of the brain proteome revealed the presence of abundant cellular proteoforms in the neuronal cytoskeleton, as well as various brain region enriched proteins, including markers of the cerebral cortex, cerebellum, hippocampus and the olfactory bulb. Neuroproteomic markers of specific cell types in the brain were identified in association with various types of neurons and glia cells. Markers of subcellular structures were established for the plasmalemma, nucleus, endoplasmic reticulum, mitochondria and other crucial organelles, as well as synaptic components that are involved in presynaptic vesicle docking, neurotransmitter release and synapse remodelling.

POU3F2
Also flagged:CELSR3androgen receptorARprostate cancertumorsneuroendocrine prostate cancer
Journal Article 2023-08-03 ✓ 1 Snippet Van Emmenis L, Ku SY, Gayvert K, Branch JR, Brady NJ, Basu S, Russell M, Cyrta J, Vosoughi A, Sailer V, Alnajar H, Dardenne E, Koumis E, Puca L, Robinson BD, Feldkamp MD, Winkis A, Majewski N, Rupnow B, Gottardis MM, Elemento O, Rubin MA, Beltran H, Rickman DS.
In-Text Gene Mentions

…genes INSM1 ,POU3F2(encodes BRN2) and…

Show Full Abstract

Although recent efforts have led to the development of highly effective androgen receptor (AR)-directed therapies for the treatment of advanced prostate cancer, a significant subset of patients will progress with resistant disease including AR-negative tumors that display neuroendocrine features [neuroendocrine prostate cancer (NEPC)]. On the basis of RNA sequencing (RNA-seq) data from a clinical cohort of tissue from benign prostate, locally advanced prostate cancer, metastatic castration-resistant prostate cancer and NEPC, we developed a multi-step bioinformatics pipeline to identify NEPC-specific, overexpressed gene transcripts that encode cell surface proteins. This included the identification of known NEPC surface protein CEACAM5 as well as other potentially targetable proteins (e.g., HMMR and CESLR3). We further showed that cadherin EGF LAG seven-pass G-type receptor 3 (CELSR3) knockdown results in reduced NEPC tumor cell proliferation and migration <i>in vitro</i>. We provide <i>in vivo</i> data including laser capture microdissection followed by RNA-seq data supporting a causal role of CELSR3 in the development and/or maintenance of the phenotype associated with NEPC. Finally, we provide initial data that suggests CELSR3 is a target for T-cell redirection therapeutics. Further work is now needed to fully evaluate the utility of targeting CELSR3 with T-cell redirection or other similar therapeutics as a potential new strategy for patients with NEPC.<h4>Significance</h4>The development of effective treatment for patients with NEPC remains an unmet clinical need. We have identified specific surface proteins, including CELSR3, that may serve as novel biomarkers or therapeutic targets for NEPC.

Also flagged:benzylisothiocyanatetumor necrosis factor alphaTNF-αIL-1βIL-10
Journal Article 2023-08-03 No Snippets Herz C, Frei L, Tran HTT, Claßen S, Spöttel J, Krell M, Hanschen FS, Arvandi M, Binder N, Schreiner M, Rohn S, Lamy E.
Show Full Abstract

<h4>Scope</h4>As prostaglandin E2 (PGE<sub>2</sub>) has important roles in physiological and inflammatory functions, a double-blind randomized controlled crossover study to investigate the potential of nasturtium (<i>Tropaeolum majus</i>) for modulating PGE<sub>2</sub> was conducted, aiming at clarifying the role of benzyl isothiocyanate (BITC). As secondary parameters leukotriene 4 (LTB<sub>4</sub>), and cytokine release (tumor necrosis factor alpha, TNF-α; interleukins IL-1β, IL-10, and IL-12) were quantified.<h4>Methods and results</h4>Thirty-four healthy female participants consumed 1.5 g nasturtium containing BITC, (<i>verum</i>) or no BITC (control) twice a day for 2 weeks each. Nasturtium intervention resulted in an increase in mean PGE<sub>2</sub> levels in serum samples (<i>verum</i>: 1.76-fold, <i>p</i> ≤ 0.05; control: 1.78-fold, <i>p</i> ≤ 0.01), and <i>ex vivo</i> stimulated peripheral blood mononuclear cells (PBMC) (<i>verum</i>: 1.71-fold, <i>p</i> ≤ 0.01; control: 1.43-fold). Using a pre-to-post responder analysis approach, 18 of 34 subjects showed <i>a</i> > 25% PGE<sub>2</sub> increase in serum, while it was >25% decreased for 9 subjects (stimulated PBMC: 14 and 8 of 28, respectively). Under the selected conditions, the BITC content of nasturtium did not affect the observed changes in PGE<sub>2</sub>. <i>Verum</i> intervention also increased mean LTB<sub>4</sub> serum level (1.24-fold, <i>p</i> ≤ 0.01), but not in LPS stimulated PBMC, and significantly increased TNF-<i>α</i> release in stimulated PBMC after 3 h (<i>verum</i>: 1.65-fold, <i>p</i> = 0.0032; control: 1.22-fold, <i>p</i> = 0.7818). No change was seen in the anti-inflammatory cytokine IL-10, or the pro-inflammatory cytokines IL-1β, and IL-12.<h4>Conclusion</h4>In contrast to the previously reported <i>in vitro</i> results, on average, LPS activated PBMC and serum from both groups showed increased PGE<sub>2</sub> levels. Further analyses suggest that PGE<sub>2</sub> release after intervention could possibly depend on the baseline PGE<sub>2</sub> level. Identification of phenotypes that respond differently to the nasturtium intervention could be useful to establish personalized approaches for dosing phytopharmaceuticals medicines.

PRDX6
Also flagged:FerroptosisDiabetic nephropathyDNdiabetic retinopathydiabetesdeath
Journal Article 2023-08-03 ✓ 1 Snippet Li L, Dai Y, Ke D, Liu J, Chen P, Wei D, Wang T, Teng Y, Yuan X, Zhang Z.
In-Text Gene Mentions

In vitro studies demonstrate that Sp1-mediated upregulation of Prdx6 expression inhibits iron accumulation and increases the expression of SLC7A11 and GPX4, preventing podocyte injury in DN (52).

Show Full Abstract

Diabetic nephropathy (DN) and diabetic retinopathy (DR) are the most serious and common diabetes-associated complications. DN and DR are all highly prevalent and dangerous global diseases, but the underlying mechanism remains to be elucidated. Ferroptosis, a relatively recently described type of cell death, has been confirmed to be involved in the occurrence and development of various diabetic complications. The disturbance of cellular iron metabolism directly triggers ferroptosis, and abnormal iron metabolism is closely related to diabetes. However, the molecular mechanism underlying the role of ferroptosis in DN and DR is still unclear, and needs further study. In this review article, we summarize and evaluate the mechanism of ferroptosis and its role and progress in DN and DR, it provides new ideas for the diagnosis and treatment of DN and DR.

HTT
Also flagged:Alcohol use disorderalcoholemotional distressanxietydepressionIl1r1
Journal Article 2023-08-03 ✓ 1 Snippet Cruz B, Borgonetti V, Bajo M, Roberto M.
In-Text Gene Mentions

…(serotonin) transporter (5-HTT), sodium-dependent serotonin…

Show Full Abstract

Excessive alcohol use disrupts neuroimmune signaling across various cell types, including neurons, microglia, and astrocytes. The present review focuses on recent, albeit limited, evidence of sex differences in biological factors that mediate neuroimmune responses to alcohol and underlying neuroimmune systems that may influence alcohol drinking behaviors. Females are more vulnerable than males to the neurotoxic and negative consequences of chronic alcohol drinking, reflected by elevations of pro-inflammatory cytokines and inflammatory mediators. Differences in cytokine, microglial, astrocytic, genomic, and transcriptomic evidence suggest females are more reactive than males to neuroinflammatory changes after chronic alcohol exposure. The growing body of evidence supports that innate immune factors modulate synaptic transmission, providing a mechanistic framework to examine sex differences across neurocircuitry. Targeting neuroimmune signaling may be a viable strategy for treating AUD, but more research is needed to understand sex-specific differences in alcohol drinking and neuroimmune mechanisms.

MLLT10
Also flagged:leukemiablood cancersAcute myeloid leukemiaAMLtumorleukemias
Journal Article 2023-08-03 ✓ 1 Snippet Barbosa K, Deshpande AJ.
In-Text Gene Mentions

Since DOT1L is a highly selective regulator of the AML oncotranscriptome in several AML subtypes, such as KMT2A, MLLT10 or NUP98-rearranged AML, as well as of NPM1 mutant AML, further investigation of DOT1L inhibition with better pharmacological properties (85, 87) is warranted.

Show Full Abstract

One of the distinguishing properties of hematopoietic stem cells is their ability to self-renew. Since self-renewal is important for the continuous replenishment of the hematopoietic stem cell pool, this property is often hijacked in blood cancers. Acute myeloid leukemia (AML) is believed to be arranged in a hierarchy, with self-renewing leukemia stem cells (LSCs) giving rise to the bulk tumor. Some of the earliest characterizations of LSCs were made in seminal studies that assessed the ability of prospectively isolated candidate AML stem cells to repopulate the entire heterogeneity of the tumor in mice. Further studies indicated that LSCs may be responsible for chemotherapy resistance and therefore act as a reservoir for secondary disease and leukemia relapse. In recent years, a number of studies have helped illuminate the complexity of clonality in bone marrow pathologies, including leukemias. Many features distinguishing LSCs from normal hematopoietic stem cells have been identified, and these studies have opened up diverse avenues for targeting LSCs, with an impact on the clinical management of AML patients. This review will discuss the role of self-renewal in AML and its implications, distinguishing characteristics between normal and leukemia stem cells, and opportunities for therapeutic targeting of AML LSCs.

Also flagged:propanamidesulfonamideureasesynthesisnaproxenCOX-2
Journal Article 2023-08-03 No Snippets Ahmad S, Abdul Qadir M, Ahmed M, Imran M, Yousaf N, Wani TA, Zargar S, Ali I, Muddassar M.
Show Full Abstract

Derivative synthesis has been a crucial method for altering the effects of already-approved medications, especially to lessen adverse effects and enhance results. Making use of this multi-target approach, a series of naproxen-sulfa drug conjugates was designed and synthesized. The newly designed conjugates were confirmed by spectroscopic techniques like IR, <sup>1</sup>HNMR, <sup>13</sup>CNMR, and elemental analysis. The conjugates were screened for anti-inflammatory, urease, and cyclooxygenase-2 (COX-2) inhibition. Naproxen conjugated with sulfanilamide, sulfathiazole, and sulfaguanidine was found potent and showed a competitive mode of urease inhibition, with IC<sub>50</sub> (µM) values 6.69 ± 0.11, 5.82 ± 0.28, 5.06 ± 0.29, respectively. When compared to other screened conjugates, the naproxen-sulfamethoxazole conjugation showed better anti-inflammatory action by inhibiting induced edema by 82.8%, which is comparable to the medication indomethacin (86.8% inhibition). Whereas it exhibited 75.4% inhibition of COX-2 at 10 µM concentration which is comparable with the reference drug (celecoxib, 77.1% inhibition). Moreover, the binding modes of competitive inhibitors with the urease and COX-2 receptor were predicted through molecular docking studies and their stability analysis through MD simulations showed that these compounds made stable complexes with the respective targets and there were no conformational changes that occurred during simulation. The obtained results showed that the conjugates of approved therapeutic molecules may lead to the development of novel types of pharmacological agents in the treatment of several pathological disorders where urease and COX-2 enzymes are involved.

PTGIS
Also flagged:Hereditary Breast and Ovarian CancersyndromeLynch syndromerepairendometrial cancerscolorectal
Journal Article 2023-08-03 ✓ 5 Snippets Côrtes L, Basso TR, Villacis RAR, Souza JDS, Jørgensen MMA, Achatz MI, Rogatto SR.
In-Text Gene Mentions

High PTGIS expression can promote infiltration of immune cells, such as tumor-associated macrophages and regulatory T cells, into the tumor microenvironment, which impairs the prognosis of patients with lung, ovarian, and gastric cancer [68,69].

Index patient 2 presented three likely pathogenic variants SLC3A1 c.1400T > C, MAT1A c.826dupG, and PTGIS c.824G > A. Breast cancer cells have elevated expression of SLC3A1, which accelerates cysteine uptake and accumulates reduced glutathione and decreases reactive oxygen species in tumor cells [62,63].

In colorectal cancer, PTGIS dysregulation may contribute to chromosomal instability and tumor progression [67].

…MAT1A c.826dupG, andPTGISc.824G > A)…

…MAT1A c.826dupG, andPTGISc.824G > A.…

Show Full Abstract

Hereditary Breast and Ovarian Cancer (HBOC) syndrome is an autosomal dominant disease associated with a high risk of developing breast, ovarian, and other malignancies. Lynch syndrome is caused by mutations in mismatch repair genes predisposing to colorectal and endometrial cancers, among others. A rare phenotype overlapping hereditary colorectal and breast cancer syndromes is poorly characterized. Three breast and colorectal cancer unrelated patients fulfilling clinical criteria for HBOC were tested by whole exome sequencing. A family history of colorectal cancer was reported in two patients (cases 2 and 3). Several variants and copy number variations were identified, which potentially contribute to the cancer risk or prognosis. All patients presented copy number imbalances encompassing <i>PMS2</i> (two deletions and one duplication), a known gene involved in the DNA mismatch repair pathway. Two patients showed gains covering the <i>POLE2</i> (cases 1 and 3), which is associated with DNA replication. Germline potentially damaging variants were found in <i>PTCH1</i> (patient 3), <i>MAT1A</i>, and <i>WRN</i> (patient 2). Overall, concurrent genomic alterations were described that may increase the risk of cancer appearance in HBOC patients with breast and colorectal cancers.

HFE
Also flagged:Mucopolysaccharidosis-plus syndromeMPSPSVPS33AmucopolysaccharidosisMPSdysostosis multiplex
Journal Article 2023-08-03 ✓ 1 Snippet Sofronova V, Gotovtseva L, Danilova A, Sukhomyasova A, Moriwaki T, Terawaki S, Otomo T, Maksimova N.
In-Text Gene Mentions

…syndrome (OMIM #614800),methemoglobinemia type 1type 1 (OMIM…

Show Full Abstract

Mucopolysaccharidosis-plus syndrome (MPSPS) is an autosomal-recessive disorder caused by c.1492C>T (p.R498W) in the <i>VPS33A</i> gene. MPSPS is a severe disorder that causes a short lifespan in patients. Currently, there is no specific treatment for patients. The Yakut population is more prone to this disease than others. Diagnosing MPSPS relies on clinical manifestations, and genetic testing (GT) is used to confirm the diagnosis. In this research, we examined two pregnancy cases, one of which involved a prenatal diagnosis for MPSPS. Notably, neither pregnant woman had a known family history of the disorder. During their pregnancies, both women underwent prenatal ultrasonography, which revealed increased prenasal thickness during the second trimester. In the first case, ultrasonography indicated increased prenasal thickness in the second trimester, but a definitive diagnosis was not made at that time. The patient was eventually diagnosed with MPSPS at 11 months of age. On the contrary, in the second case, GT uncovered that the parents were carriers of MPSPS. Consequently, a placental biopsy was performed, leading to an early diagnosis of MPSPS. This study emphasizes the importance of ultrasonography findings in prenatal MPSPS diagnosis. Combining ultrasonography with GT can be a valuable approach to confirming MPSPS at an early stage, allowing for the appropriate planning of delivery methods and medical care. Ultimately, this comprehensive approach can significantly enhance the quality of life of both affected patients and their parents.

Preprints.org 2023-08-03 Preprint (No Snippets API) Wu S, Ootawa T, Smith H, Sekio R, Islam MZ, Nguyen HTT, Uno Y, Shiraishi M, Miyamoto A.
Show Full Abstract

The basilar arterial endothelium mediates blood-vessel relaxation, partly through release of nitric oxide (NO). Apoptosis of cerebrovascular endothelial cells is linked to high mortality rate in chickens infected with highly pathogenic avian influenza virus, but interestingly ducks exhibit greater resistance to this virus. In this study, we examined the responsiveness of duck basilar arteries (BAs) to various vasoactive substances, including 5-hydroxytryptamine (5-HT), histamine (His), angiotensin (Ang) II, noradrenaline (NA), acetylcholine (ACh), and avian bradykinin ornithokinin (OK), aiming to characterize the receptor subtypes involved and the role of endothelial NO in vitro. Our findings suggest that arterial contraction is mediated by 5-HT1 and H1 receptors, while relaxation is induced by β3-adrenergic and M3 receptors. Additionally, OK elicited a biphasic response in duck BAs, and Ang II had no effect. Endothelial NO appears to be crucial in relaxation mediated by M3 and OK receptors, but not β3-adrenergic receptors, in the duck BA. The reduced endothelial NO involvement in the receptor-mediated relaxation response in duck BAs represents a clear difference from the corresponding response reported in chicken BAs. This physiological difference may explain differences in lethality between ducks and chickens when vascular endothelial cells are infected by the virus.

PRDX6
Also flagged:corneal endothelial dysfunctionreverse transcriptionNa+/K+-ATPasehemidesmosomescorneal edemaCD200
Journal Article 2023-08-02 ✓ 1 Snippet Dong C, Zou D, Duan H, Hu X, Zhou Q, Shi W, Li Z.
In-Text Gene Mentions

…ETS1, HO1, andPRDX6( P >…

Show Full Abstract

<h4>Objective</h4>Stem cell therapy is a promising strategy for the treatment of corneal endothelial dysfunction, and the need to find functional alternative seed cells of corneal endothelial cells (CECs) is urgent. Here, we determined the feasibility of using the retinal pigment epithelium (RPE) as an equivalent substitute for the treatment of corneal endothelial dysfunction.<h4>Methods</h4>RPE cells and CECs in situ were obtained from healthy New Zealand male rabbits, and the similarities and differences between them were analyzed by electron microscopy, immunofluorescent staining, and quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Rabbit primary RPE cells and CECs were isolated and cultivated ex vivo, and Na+/K+-ATPase activity and cellular permeability were detected at passage 2. The injection of cultivated rabbit primary RPE cells, CECs and human embryonic stem cell (hESC)-derived RPE cells was performed on rabbits with corneal endothelial dysfunction. Then, the therapeutic effects were evaluated by corneal transparency, central corneal thickness, enzyme linked immunosorbent assay (ELISA), qRT-PCR and immunofluorescent staining.<h4>Results</h4>The rabbit RPE cells were similar in form to CECs in situ and ex vivo, showing a larger regular hexagonal shape and a lower cell density, with numerous tightly formed cell junctions and hemidesmosomes. Moreover, RPE cells presented a stronger barrier and ionic pumping capacity than CECs. When intracamerally injected into the rabbits, the transplanted primary RPE cells could dissolve corneal edema and decrease corneal thickness, with effects similar to those of CECs. In addition, the transplantation of hESC-derived RPE cells exhibited a similar therapeutic effect and restored corneal transparency and thickness within seven days. qRT-PCR results showed that the expressions of CEC markers, like CD200 and S100A4, increased, and the RPE markers OTX2, BEST1 and MITF significantly decreased in the transplanted RPE cells. Furthermore, we have demonstrated that rabbits transplanted with hESC-derived RPE cells maintained normal corneal thickness and exhibited slight pigmentation in the central cornea one month after surgery. Immunostaining results showed that the HuNu-positive transplanted cells survived and expressed ZO1, ATP1A1 and MITF.<h4>Conclusion</h4>RPE cells and CECs showed high structural and functional similarities in barrier and pump characteristics. Intracameral injection of primary RPE cells and hESC-derived RPE cells can effectively restore rabbit corneal clarity and thickness and maintain normal corneal function. This study is the first to report the effectiveness of RPE cells for corneal endothelial dysfunction, suggesting the feasibility of hESC-derived RPE cells as an equivalent substitute for CECs.

Also flagged:neurological diseasescardiovascular diseasesglomerulopathiescancerorganogenesismorpholino
Journal Article 2023-08-02 No Snippets Dash SN, Patnaik L.
Show Full Abstract

Human disease and biological practices are modelled in zebrafish (<i>Danio rerio</i>) at various phases of drug development as well as toxicity evaluation. The zebrafish is ideal for <i>in vivo</i> pathological research and high-resolution investigation of disease progress. Zebrafish has an advantage over other mammalian models, it is cost-effective, it has external development and embryo transparency, easy to apply genetic manipulations, and open to both forward and reverse genetic techniques. Drug screening in zebrafish is suitable for target identification, illness modelling, high-throughput screening of compounds for inhibition or prevention of disease phenotypes and developing new drugs. Several drugs that have recently entered the clinic or clinical trials have their origins in zebrafish. The sophisticated screening methods used in zebrafish models are expected to play a significant role in advancing drug development programmes. This review highlights the current developments in drug discovery processes, including understanding the action of drugs in the context of disease and screening novel candidates in neurological diseases, cardiovascular diseases, glomerulopathies and cancer. Additionally, it summarizes the current techniques and approaches for the selection of small molecules and current technical limitations on the execution of zebrafish drug screening tests.

Also flagged:transposasechromatinCas9nucleasedCas9morpholino
Journal Article 2023-08-02 No Snippets Jimenez Gonzalez A, Baranasic D, Müller F.
Show Full Abstract

In the past decades, the zebrafish has become a disease model with increasing popularity owing to its advantages that include fast development, easy genetic manipulation, simplicity for imaging, and sharing conserved disease-associated genes and pathways with those of human. In parallel, studies of disease mechanisms are increasingly focusing on non-coding mutations, which require genome annotation maps of regulatory elements, such as enhancers and promoters. In line with this, genomic resources for zebrafish research are expanding, producing a variety of genomic data that help in defining regulatory elements and their conservation between zebrafish and humans. Here, we discuss recent developments in generating functional annotation maps for regulatory elements of the zebrafish genome and how this can be applied to human diseases. We highlight community-driven developments, such as DANIO-CODE, in generating a centralised and standardised catalogue of zebrafish genomics data and functional annotations; consider the advantages and limitations of current annotation maps; and offer considerations for interpreting and integrating existing maps with comparative genomics tools. We also discuss the need for developing standardised genomics protocols and bioinformatic pipelines and provide suggestions for the development of analysis and visualisation tools that will integrate various multiomic bulk sequencing data together with fast-expanding data on single-cell methods, such as single-cell assay for transposase-accessible chromatin with sequencing. Such integration tools are essential to exploit the multiomic chromatin characterisation offered by bulk genomics together with the cell-type resolution offered by emerging single-cell methods. Together, these advances will build an expansive toolkit for interrogating the mechanisms of human disease in zebrafish.

Also flagged:peptideleucinepeptidesenvelopedimethylcarbonyl
Journal Article 2023-08-02 No Snippets Li M, Ma M, Li L.
Show Full Abstract

High-throughput quantitative analysis of the cells' proteomes across multiple conditions such as various perturbations and different time points is essential for gaining insights into treatment-induced biological responses or disease pathological states. The advancements in mass spectrometry instrumentation and isobaric labeling methods provided useful tools to help address such demands. However, the current widely adopted isobaric labeling methods such as tandem mass tag (TMT) and isobaric tags for relative and absolute quantitation (iTRAQ) are based on low-mass reporter ions, which are indistinguishable among different peptide analytes, to achieve relative quantification. Therefore, these methods intrinsically suffer from severe ratio distortion when analyzing complex samples due to peptide coelution and cofragmentation. Here, we developed a novel set of isobaric tags named dimethylated leucine complementary ion (DiLeuC) and relied on complementary ions for relative quantification, in which the complementary ions are the remanent peptide segments after fragmentation in the high-mass range. Since those residual peptide fragments are precursor-specific, they retain the relative abundance information in an interference-free manner even in a complex matrix environment. The quantification accuracy of our method was validated in a two-proteome model where the yeast proteome was spiked with a strong background human proteome as interference. In addition, we also applied this strategy to single-cell proteome analysis, demonstrating its potential utility for sensitive high-throughput quantitative proteomics.

HTT
Also flagged:serotonindopamineDRD4OXTRanxietytranslational
Journal Article 2023-08-02 ✓ 5 Snippets Howarth ERI, Szott ID, Witham CL, Wilding CS, Bethell EJ.
In-Text Gene Mentions

…droxytryptamine transporter or5-HTT) gene (also…

…a neurotransmitter and5-HTTregulates the signaling…

…a 65% lower5-HTTmRNA expression level…

…been studied, since5-HTTgenotype plays a…

…thalamic levels of5-HTT, and dysregulation of…

Show Full Abstract

Behaviour has a significant heritable component; however, unpicking the variants of interest in the neural circuits and molecular pathways that underpin these has proven difficult. Here, we present a comprehensive analysis of the relationship between known and new candidate genes from identified pathways and key behaviours for survival in 109 adult rhesus macaques (Macaca mulatta). Eight genes involved in emotion were analysed for variation at a total of nine loci. Genetic data were then correlated with cognitive and observational measures of behaviour associated with wellbeing and survival using MCMC-based Bayesian GLMM in R, to account for relatedness within the macaque population. For four loci the variants genotyped were length polymorphisms (SLC6A4 5-hydroxytryptamine transporter length-polymorphic repeat (5-HTTLPR), SLC6A4 STin polymorphism, Tryptophan 5-hydroxylase 2 (TPH2) and Monoamine oxidase A (MAOA)) whilst for the other five (5-hydroxytryptamine receptor 2A (HTR2A), Dopamine Receptor D4 (DRD4), Oxytocin receptor (OXTR), Arginine vasopressin receptor 1A (AVPR1a), Opioid receptor mu(μ) 1 (OPRM1)) SNPs were analysed. STin genotype, DRD4 haplotype and OXTR haplotype were significantly associated with the cognitive and observational measures of behaviour associated with wellbeing and survival. Genotype for 5-HTTLPR, STin and AVPR1a, and haplotype for HTR2A, DRD4 and OXTR were significantly associated with the duration of behaviours including fear and anxiety. Understanding the biological underpinnings of individual variation in negative emotion (e.g., fear and anxiety), together with their impact on social behaviour (e.g., social attention including vigilance for threat) has application for managing primate populations in the wild and captivity, as well as potential translational application for understanding of the genetic basis of emotions in humans.

POU3F2
Also flagged:Exportin 1SOX2prostate adenocarcinomassmall cell lung cancerSCLCnuclear transporter exportin 1
Journal Article 2023-08-02 ✓ 1 Snippet Quintanal-Villalonga A, Durani V, Sabet A, Redin E, Kawasaki K, Shafer M, Karthaus WR, Zaidi S, Zhan YA, Manoj P, Sridhar H, Shah NS, Chow A, Bhanot UK, Linkov I, Asher M, Yu HA, Qiu J, de Stanchina E, Patel RA, Morrissey C, Haffner MC, Koche RP, Sawyers CL, Rudin CM.
In-Text Gene Mentions

POU3F2

Show Full Abstract

In lung and prostate adenocarcinomas, neuroendocrine (NE) transformation to an aggressive derivative resembling small cell lung cancer (SCLC) is associated with poor prognosis. We previously described dependency of SCLC on the nuclear transporter exportin 1. Here, we explored the role of exportin 1 in NE transformation. We observed up-regulated exportin 1 in lung and prostate pretransformation adenocarcinomas. Exportin 1 was up-regulated after genetic inactivation of TP53 and RB1 in lung and prostate adenocarcinoma cell lines, accompanied by increased sensitivity to the exportin 1 inhibitor selinexor in vitro. Exportin 1 inhibition prevented NE transformation in different TP53/RB1-inactivated prostate adenocarcinoma xenograft models that acquire NE features upon treatment with the aromatase inhibitor enzalutamide and extended response to the EGFR inhibitor osimertinib in a lung cancer transformation patient-derived xenograft (PDX) model exhibiting combined adenocarcinoma/SCLC histology. Ectopic SOX2 expression restored the enzalutamide-promoted NE phenotype on adenocarcinoma-to-NE transformation xenograft models despite selinexor treatment. Selinexor sensitized NE-transformed lung and prostate small cell carcinoma PDXs to standard cytotoxics. Together, these data nominate exportin 1 inhibition as a potential therapeutic target to constrain lineage plasticity and prevent or treat NE transformation in lung and prostate adenocarcinoma.

Also flagged:osteoporosishydrogencalciumsecretioninterleukin-12osteoclast differentiation
Journal Article 2023-08-02 No Snippets Liu X, Li F, Dong Z, Gu C, Mao D, Chen J, Luo L, Huang Y, Xiao J, Li Z, Liu Z, Yang Y.
Show Full Abstract

Current clinical approaches to osteoporosis primarily target osteoclast biology, overlooking the synergistic role of bone cells, immune cells, cytokines, and inorganic components in creating an abnormal osteoporotic microenvironment. Here, metal-polyDNA nanoparticles (Ca-polyCpG MDNs) composed of Ca<sup>2+</sup> and ultralong single-stranded CpG sequences were developed to reconstruct the osteoporotic microenvironment and suppress osteoporosis. Ca-polyCpG MDNs can neutralize osteoclast-secreted hydrogen ions, provide calcium repletion, promote remineralization, and repair bone defects. Besides, the immune-adjuvant polyCpG in MDNs could induce the secretion of osteoclastogenesis inhibitor interleukin-12 and reduce the expression of osteoclast function effector protein to inhibit osteoclast differentiation, further reducing osteoclast-mediated bone resorption. PPi<sup>4-</sup> generated during the rolling circle amplification reaction acts as bisphosphonate analog and enhances bone targeting of Ca-polyCpG MDNs. In ovariectomized mouse and rabbit models, Ca-polyCpG MDNs prevented bone resorption and promoted bone repair by restoring the osteoporotic microenvironment, providing valuable insights into osteoporosis therapy.

VRK2
Also flagged:molybdate transporter 2Molybdenumnitrateabscisic-acidbiosynthesismolybdate transport proteins
Journal Article 2023-08-02 ✓ 1 Snippet Weber JN, Minner-Meinen R, Behnecke M, Biedendieck R, Hänsch VG, Hercher TW, Hertweck C, van den Hout L, Knüppel L, Sivov S, Schulze J, Mendel RR, Hänsch R, Kaufholdt D.
In-Text Gene Mentions

…( A. thalianaWall Associated-Kinase 2Associated-Kinase 2, AT1G21270…

Show Full Abstract

Molybdenum (Mo) as essential micronutrient for plants, acts as active component of molybdenum cofactor (Moco). Core metabolic processes like nitrate assimilation or abscisic-acid biosynthesis rely on Moco-dependent enzymes. Although a family of molybdate transport proteins (MOT1) is known to date in Arabidopsis, molybdate homeostasis remained unclear. Here we report a second family of molybdate transporters (MOT2) playing key roles in molybdate distribution and usage. KO phenotype-analyses, cellular and organ-specific localization, and connection to Moco-biosynthesis enzymes via protein-protein interaction suggest involvement in cellular import of molybdate in leaves and reproductive organs. Furthermore, we detected a glutathione-molybdate complex, which reveals how vacuolar storage is maintained. A putative Golgi S-adenosyl-methionine transport function was reported recently for the MOT2-family. Here, we propose a moonlighting function, since clear evidence of molybdate transport was found in a yeast-system. Our characterization of the MOT2-family and the detection of a glutathione-molybdate complex unveil the plant-wide way of molybdate.

SERPINC1
Also flagged:innervationreflexsecretiontissue homeostasisneurogenesisWnt
Journal Article 2023-08-02 ✓ 1 Snippet Scharr M, Scherer S, Hirt B, Neckel PH.
In-Text Gene Mentions

…and incubation withProtease-IIIat 40 °C…

Show Full Abstract

Neurogenesis in the postnatal enteric nervous system (ENS) is controversially discussed. Yet, deciphering the regenerative potential of the ENS is essential for our understanding and therapy of human enteric neuropathies. Dickkopf1 (DKK1) is a Wnt-antagonist and involved in the homeostasis of various tissues. We hypothesize that DKK1 could function as a negative regulator on the proliferation of ENS-progenitors in the postnatal gut of mice and human infants. Here, we provide evidence that DKK1 is expressed in the murine and human ENS. If applied to ENS-progenitors in vitro, DKK1 leads to an increased proliferation, however, followed by extensive apoptosis. Yet, once we block apoptosis, DKK1-stimulation markedly increases enteric neurogenesis in murine and human ENS-progenitors. Thus, DKK1 is a strong, ambivalent regulator of the ENS-progenitor cell pool in mice and humans. These results are fundamental steps to reshaping our understanding of the homeostasis of the ENS in health and disease.

DCC
Also flagged:netrin-1cancerantibodyPAX8oestrogen receptorsprogesterone receptor
Journal Article 2023-08-02 ✓ 1 Snippet Cassier PA, Navaridas R, Bellina M, Rama N, Ducarouge B, Hernandez-Vargas H, Delord JP, Lengrand J, Paradisi A, Fattet L, Garin G, Gheit H, Dalban C, Pastushenko I, Neves D, Jelin R, Gadot N, Braissand N, Léon S, Degletagne C, Matias-Guiu X, Devouassoux-Shisheboran M, Mery-Lamarche E, Allard J, Zindy E, Decaestecker C, Salmon I, Perol D, Dolcet X, Ray-Coquard I, Blanpain C, Bernet A, Mehlen P.
In-Text Gene Mentions

Its main receptor, UNC5B, was also found to be expressed more in tumour tissues than in normal endometrium (Extended Data Fig. 1a–c) while DCC, another netrin-1 receptor, is expressed neither in normal endometrium nor endometrial cancer.

Show Full Abstract

Netrin-1 is upregulated in cancers as a protumoural mechanism<sup>1</sup>. Here we describe netrin-1 upregulation in a majority of human endometrial carcinomas (ECs) and demonstrate that netrin-1 blockade, using an anti-netrin-1 antibody (NP137), is effective in reduction of tumour progression in an EC mouse model. We next examined the efficacy of NP137, as a first-in-class single agent, in a Phase I trial comprising 14 patients with advanced EC. As best response we observed 8 stable disease (8 out of 14, 57.1%) and 1 objective response as RECIST v.1.1 (partial response, 1 out of 14 (7.1%), 51.16% reduction in target lesions at 6 weeks and up to 54.65% reduction during the following 6 months). To evaluate the NP137 mechanism of action, mouse tumour gene profiling was performed, and we observed, in addition to cell death induction, that NP137 inhibited epithelial-to-mesenchymal transition (EMT). By performing bulk RNA sequencing (RNA-seq), spatial transcriptomics and single-cell RNA-seq on paired pre- and on-treatment biopsies from patients with EC from the NP137 trial, we noted a net reduction in tumour EMT. This was associated with changes in immune infiltrate and increased interactions between cancer cells and the tumour microenvironment. Given the importance of EMT in resistance to current standards of care<sup>2</sup>, we show in the EC mouse model that a combination of NP137 with carboplatin-paclitaxel outperformed carboplatin-paclitaxel alone. Our results identify netrin-1 blockade as a clinical strategy triggering both tumour debulking and EMT inhibition, thus potentially alleviating resistance to standard treatments.

RC3H1
Also flagged:multiple sclerosisneurodegenerative diseasegene expressionMScladribinecell adhesion
Journal Article 2023-08-02 ✓ 4 Snippets Hecker M, Fitzner B, Boxberger N, Putscher E, Engelmann R, Bergmann W, Müller M, Ludwig-Portugall I, Schwartz M, Meister S, Dudesek A, Winkelmann A, Koczan D, Zettl UK.
In-Text Gene Mentions

…ESR2, PHB andRC3H1.…

…(29 edges) andRC3H1(29 edges).…

…cladribine group) andRC3H1(cluster 8, low…

RC3H1is a post-transcriptional…

Show Full Abstract

<h4>Background</h4>Multiple sclerosis (MS) is a chronic, inflammatory and neurodegenerative disease that leads to irreversible damage to the brain and spinal cord. The goal of so-called "immune reconstitution therapies" (IRTs) is to achieve long-term disease remission by eliminating a pathogenic immune repertoire through intense short-term immune cell depletion. B cells are major targets for effective immunotherapy in MS.<h4>Objectives</h4>The aim of this study was to analyze the gene expression pattern of B cells before and during IRT (i.e., before B-cell depletion and after B-cell repopulation) to better understand the therapeutic effects and to identify biomarker candidates of the clinical response to therapy.<h4>Methods</h4>B cells were obtained from blood samples of patients with relapsing-remitting MS (n = 50), patients with primary progressive MS (n = 13) as well as healthy controls (n = 28). The patients with relapsing MS received either monthly infusions of natalizumab (n = 29) or a pulsed IRT with alemtuzumab (n = 15) or cladribine (n = 6). B-cell subpopulation frequencies were determined by flow cytometry, and transcriptome profiling was performed using Clariom D arrays. Differentially expressed genes (DEGs) between the patient groups and controls were examined with regard to their functions and interactions. We also tested for differences in gene expression between patients with and without relapse following alemtuzumab administration.<h4>Results</h4>Patients treated with alemtuzumab or cladribine showed on average a > 20% lower proportion of memory B cells as compared to before IRT. This was paralleled by profound transcriptome shifts, with > 6000 significant DEGs after adjustment for multiple comparisons. The top DEGs were found to regulate apoptosis, cell adhesion and RNA processing, and the most highly connected nodes in the network of encoded proteins were ESR2, PHB and RC3H1. Higher mRNA levels of BCL2, IL13RA1 and SLC38A11 were seen in patients with relapse despite IRT, though these differences did not pass the false discovery rate correction.<h4>Conclusions</h4>We show that B cells circulating in the blood of patients with MS undergoing IRT present a distinct gene expression signature, and we delineated the associated biological processes and gene interactions. Moreover, we identified genes whose expression may be an indicator of relapse risk, but further studies are needed to verify their potential value as biomarkers.

Also flagged:ischemic strokeoxygenimmune responsesangiopoietin-2leptin receptorintegrin-linked kinase
Journal Article 2023-08-02 No Snippets Luo J, Chen D, Mei Y, Li H, Qin B, Lin X, Chan TF, Lai KP, Kong D.
Show Full Abstract

<h4>Introduction</h4>Ischemic stroke accounts for 70-80% of all stroke cases, leading to over two million people dying every year. Poor diagnosis and late detection are the major causes of the high death and disability rate.<h4>Methods</h4>In the present study, we used the middle cerebral artery occlusion (MCAO) rat model and applied comparative transcriptomic analysis, followed by a systematic advanced bioinformatic analysis, including gene ontology enrichment analysis and Ingenuity Pathway Analysis (IPA). We aimed to identify novel biomarkers for the early detection of ischemic stroke. In addition, we aimed to delineate the molecular mechanisms underlying the development of ischemic stroke, in which we hoped to identify novel therapeutic targets for treating ischemic stroke.<h4>Results</h4>In the comparative transcriptomic analysis, we identified 2657 differentially expressed genes (DEGs) in the brain tissue of the MCAO model. The gene enrichment analysis highlighted the importance of these DEGs in oxygen regulation, neural functions, and inflammatory and immune responses. We identified the elevation of angiopoietin-2 and leptin receptor as potential novel biomarkers for early detection of ischemic stroke. Furthermore, the result of IPA suggested targeting the inflammasome pathway, integrin-linked kinase signaling pathway, and Th1 signaling pathway for treating ischemic stroke.<h4>Conclusion</h4>The results of the present study provide novel insight into the biomarkers and therapeutic targets as potential treatments of ischemic stroke.

SOX6
Also flagged:extracellularneurodegenerative diseasescytoskeletal proteinsglial fibrillary acidic proteinvimentinnucleus
Journal Article 2023-08-02 ✓ 1 Snippet Dai DL, Li M, Lee EB.
In-Text Gene Mentions

…NFIA, NFIB, andSOX6have been shown…

Show Full Abstract

Astrocytes are one of the brain's major cell types and are responsible for maintaining neuronal homeostasis via regulating the extracellular environment, providing metabolic support, and modulating synaptic activity. In neurodegenerative diseases, such as Alzheimer's disease, astrocytes can take on a hypertrophic appearance. These reactive astrocytes are canonically associated with increases in cytoskeletal proteins, such as glial fibrillary acidic protein and vimentin. However, the molecular alterations that characterize astrocytes in human disease tissues have not been extensively studied with single cell resolution. Using single nucleus RNA sequencing data from normal, pathologic aging, and Alzheimer's disease brains, we identified the transcriptomic changes associated with reactive astrocytes. Deep learning-based clustering algorithms denoised expression data for 17,012 genes and clustered 15,529 astrocyte nuclei, identifying protoplasmic, gray matter and fibrous, white matter astrocyte clusters. RNA trajectory analyses revealed a spectrum of reactivity within protoplasmic astrocytes characterized by a modest increase of reactive genes and a marked decrease in homeostatic genes. Amyloid but not tau pathology correlated with astrocyte reactivity. To identify reactivity-associated genes, linear regressions of gene expression versus reactivity were used to identify the top 52 upregulated and 144 downregulated genes. Gene Ontology analysis revealed that upregulated genes were associated with cellular growth, responses to metal ions, inflammation, and proteostasis. Downregulated genes were involved in cellular interactions, neuronal development, ERBB signaling, and synapse regulation. Transcription factors were significantly enriched among the downregulated genes. Using co-immunofluorescence staining of Alzheimer's disease brain tissues, we confirmed pathologic downregulation of ERBB4 and transcription factor NFIA in reactive astrocytes. Our findings reveal that protoplasmic, gray matter astrocytes in Alzheimer's disease exist within a spectrum of reactivity that is marked by a strong loss of normal function.

DCC
Also flagged:schizophreniabehavioralolanzapinecolorectal carcinomapsychiatric disordersglutamine synthetase
Journal Article 2023-08-02 ✓ 5 Snippets Sun J, Cong Q, Sun T, Xi S, Liu Y, Zeng R, Wang J, Zhang W, Gao J, Qian J, Qin S.
In-Text Gene Mentions

Notably, olanzapine rescued the SCZ-related behaviors in the MK801-treated mice but not in the cortex-specific Dcc KD mice, indicating that Dcc play a critical in the mechanism of antipsychotic effects of olanzapine.

Yet, little is known about the function of Dcc in schizophrenia (SCZ)-related behavioral abnormalities and the efficacy of antipsychotic drugs in vivo.

Prefrontal cortex-specific Dcc deletion induces schizophrenia-related behavioral phenotypes and fail to be rescued by olanzapine treatment.

As one of the major risk factors of the degree of antipsychotic response, Dcc deletion-induced glutamatergic dysfunction may be involved in the underlying mechanism of treatment resistance of olanzapine.

…Prefrontal cortex-specificDccdeletion induces schizophrenia…

Show Full Abstract

Multiple genome studies have discovered that variation in deleted in colorectal carcinoma (Dcc) at transcription and translation level were associated with the occurrences of psychiatric disorders. Yet, little is known about the function of Dcc in schizophrenia (SCZ)-related behavioral abnormalities and the efficacy of antipsychotic drugs in vivo. Here, we used an animal model of prefrontal cortex-specific knockdown (KD) of Dcc in adult C57BL/6 mice to study the attention deficits and impaired locomotor activity. Our results supported a critical role of Dcc deletion in SCZ-related behaviors. Notably, olanzapine rescued the SCZ-related behaviors in the MK801-treated mice but not in the cortex-specific Dcc KD mice, indicating that Dcc play a critical in the mechanism of antipsychotic effects of olanzapine. Knockdown of Dcc in prefrontal cortex results in glutamatergic dysfunction, including defects in glutamine synthetase and postsynaptic maturation. As one of the major risk factors of the degree of antipsychotic response, Dcc deletion-induced glutamatergic dysfunction may be involved in the underlying mechanism of treatment resistance of olanzapine. Our findings identified Dcc deletion-mediated SCZ-related behavioral defects, which serve as a valuable animal model for study of SCZ and amenable to targeted investigations in mechanistic hypotheses of the mechanism underlying glutamatergic dysfunction-induced antipsychotic treatment resistance.

OLFM4
Also flagged:CeramidesFatty Acidcolorectal cancerscancers of the gastric cardiaobesitycancers
Journal Article 2023-08-02 ✓ 1 Snippet Li Y, Chaurasia B, Rahman MM, Kaddai V, Maschek JA, Berg JA, Wilkerson JL, Mahmassani ZS, Cox J, Wei P, Meikle PJ, Atkinson D, Wang L, Poss AM, Playdon MC, Tippetts TS, Mousa EM, Nittayaboon K, Anandh Babu PV, Drummond MJ, Clevers H, Shayman JA, Hirabayashi Y, Holland WL, Rutter J, Edgar BA, Summers SA.
In-Text Gene Mentions

Olfm4

Show Full Abstract

<h4>Background & aims</h4>Cancers of the alimentary tract, including esophageal adenocarcinomas, colorectal cancers, and cancers of the gastric cardia, are common comorbidities of obesity. Prolonged, excessive delivery of macronutrients to the cells lining the gut can increase one's risk for these cancers by inducing imbalances in the rate of intestinal stem cell proliferation vs differentiation, which can produce polyps and other aberrant growths. We investigated whether ceramides, which are sphingolipids that serve as a signal of nutritional excess, alter stem cell behaviors to influence cancer risk.<h4>Methods</h4>We profiled sphingolipids and sphingolipid-synthesizing enzymes in human adenomas and tumors. Thereafter, we manipulated expression of sphingolipid-producing enzymes, including serine palmitoyltransferase (SPT), in intestinal progenitors of mice, cultured organoids, and Drosophila to discern whether sphingolipids altered stem cell proliferation and metabolism.<h4>Results</h4>SPT, which diverts dietary fatty acids and amino acids into the biosynthetic pathway that produces ceramides and other sphingolipids, is a critical modulator of intestinal stem cell homeostasis. SPT and other enzymes in the sphingolipid biosynthesis pathway are up-regulated in human intestinal adenomas. They produce ceramides, which serve as prostemness signals that stimulate peroxisome-proliferator activated receptor-α and induce fatty acid binding protein-1. These actions lead to increased lipid utilization and enhanced proliferation of intestinal progenitors.<h4>Conclusions</h4>Ceramides serve as critical links between dietary macronutrients, epithelial regeneration, and cancer risk.

HTT
Also flagged:protein misfolding diseasesHuntington's diseasestressmitochondrialheat shock responseneurodegenerative diseases
Journal Article 2023-08-02 ✓ 3 Snippets Almeida LM, Oliveira Â, Oliveira JMA, Pinho BR.
In-Text Gene Mentions

PC12 cells with inducible expression of the N-terminal fragment of mut-Htt are among the most used cell lines to model HD, however the activation of stress responses remains unclear in this model.

…of mutant huntingtin (mut-Htt).…

…N-terminal fragment of mut-Httare among the…

Show Full Abstract

Stress response pathways like the integrated stress response (ISR), the mitochondrial unfolded protein response (UPR<sup>mt</sup>) and the heat shock response (HSR) have emerged as part of the pathophysiology of neurodegenerative diseases, including Huntington's disease (HD) - a currently incurable disease caused by the production of mutant huntingtin (mut-Htt). Previous data from HD patients suggest that ISR is activated while UPR<sup>mt</sup> and HSR are impaired in HD. The study of these stress response pathways as potential therapeutic targets in HD requires cellular models that mimic the activation status found in HD patients of such pathways. PC12 cells with inducible expression of the N-terminal fragment of mut-Htt are among the most used cell lines to model HD, however the activation of stress responses remains unclear in this model. The goal of this study is to characterize the activation of ISR, UPR<sup>mt</sup> and HSR in this HD cell model and evaluate if it mimics the activation status found in HD patients. We show that PC12 HD cell model presents reduced levels of Hsp90 and mitochondrial chaperones, suggesting an impaired activation or function of HSR and UPR<sup>mt</sup>. This HD model also presents increased levels of phosphorylated eIF2α, the master regulator of the ISR, but overall similar levels of ATF4 and decreased levels of CHOP - transcription factors downstream to eIF2α - in comparison to control, suggesting an initial activation of ISR. These results show that this model mimics the ISR activation and the impaired UPR<sup>mt</sup> and HSR found in HD patients. This work suggests that the PC12 N-terminal HD model is suitable for studying the role of stress response pathways in the pathophysiology of HD and for exploratory studies investigating the therapeutic potential of drugs targeting stress responses.

Also flagged:Breast SarcomasPhyllodes TumorsDesmoid TumorsPTslymphedemaPIK3CA
Journal Article 2023-08-02 No Snippets Esperança-Martins M, Melo-Alvim C, Dâmaso S, Lopes-Brás R, Peniche T, Nogueira-Costa G, Abreu C, Luna Pais H, de Sousa RT, Torres S, Gallego-Paez LM, Martins M, Ribeiro L, Costa L.
Show Full Abstract

Breast sarcomas (BSs), phyllodes tumors (PTs), and desmoid tumors (DTs) are rare entities that arise from connective tissue. BSs can be classified as either primary or secondary, whether they develop de novo or after radiation exposure or lymphedema. PIK3CA seems to play an important common role in different BS. Malignant PTs show similar behavior to BSs, while DTs are locally aggressive but rarely metastasize. BSs usually present as unilateral, painless, rapidly growing masses with rare nodal involvement. The diagnosis should be based on magnetic resonance imaging and a core needle biopsy. Staging should comprise a chest computed tomography (CT) scan (except for benign PT and DT), while abdominal and pelvic CT scans and bone scans should be added in certain subtypes. The mainstay of treatment for localized BS is surgery, with margin goals that vary according to subtype. Radiotherapy and chemotherapy can be used as neoadjuvant or adjuvant approaches, but their use in these settings is not standard. Advanced BS should be treated with systemic therapy, consistent with recommendations for advanced soft tissue sarcomas of other topographies. Given the rarity and heterogeneity of these entities, multidisciplinary and multi-institutional collaboration and treatment at reference centers are critical.

Also flagged:digestionoxygennecrotizing enterocolitisNECanemiagestations
Journal Article 2023-08-02 No Snippets Murphy C, Baskind S, Aladangady N, Banerjee J.
Show Full Abstract

The gut is a relatively silent organ <i>in utero</i> but takes on a major role after birth for the absorption and digestion of feed for adequate nutrition and growth. The neonatal circulation undergoes a transition period after birth, and gut perfusion increases rapidly to satisfy the oxygen demand and consumption. If this process is compromised at any stage, preterm and fetal growth restricted infants are at particular risk of gut tissue injury secondary to hypoxia, leading to necrotizing enterocolitis. Feeding can also be a challenge in these high-risk groups due to gut dysmotility. Superior mesenteric artery (SMA) Doppler is a safe, bedside investigation that could rapidly aid clinicians with feeding strategies and in monitoring high-risk infants. This article aims to establish normal patterns of gut blood flow velocity in neonates using SMA Doppler and reviews how it might be used clinically in pathologic states.

Also flagged:Peptidefluconazolepeptidescell surfaceFLCcancer
Journal Article 2023-08-02 No Snippets Vargas-Casanova Y, Bravo-Chaucanés CP, Martínez AXH, Costa GM, Contreras-Herrera JL, Medina RF, Rivera-Monroy ZJ, García-Castañeda JE, Parra-Giraldo CM.
Show Full Abstract

The antifungal activity of palindromic peptide RWQWRWQWR and its derivatives was evaluated against clinical isolates of <i>Candida albicans</i> and <i>C. auris</i>. Also, <i>Bidens pilosa</i> ethanolic extracts of leaves and stem were evaluated. Furthermore, combinations of peptide, extract, and/or fluconazole (FLC) were evaluated. The cytotoxicity of peptides and extracts in erythrocytes and fibroblasts was determined. The original palindromic peptide, some derivative peptides, and the ethanolic extract of leaves of <i>B. pilosa</i> exhibited the highest activity in some of the strains evaluated. Synergy was obtained between the peptide and the FLC against <i>C. auris</i> 435. The combination of the extract and the original palindromic peptide against <i>C. albicans</i> SC5314, <i>C. auris</i> 435, and <i>C. auris</i> 537 decreased the minimal inhibitory concentrations (MICs) by a factor of between 4 and 16. These mixtures induced changes in cell morphology, such as deformations on the cell surface. The results suggest that the combination of RWQWRWQWR and <i>B. pilosa</i> extract is an alternative for enhancing antifungal activity and decreasing cytotoxicity and costs and should be considered to be a promising strategy for treating diseases caused by <i>Candida</i> spp.

Also flagged:GlutathioneNrf2PurpurinanthraquinoneNuclear transcription factor erythroid 2-related factor 2gene expression
Journal Article 2023-08-02 No Snippets Ren Q, Bakker W, Wesseling S, Bouwmeester H, Rietjens IMCM.
Show Full Abstract

Purpurin is a major anthraquinone present in the roots of <i>Rubia cordifolia</i> (madder). Purpurin is known to activate Nrf2 (Nuclear transcription factor erythroid 2-related factor 2) EpRE (electrophile responsive element) mediated gene expression as a potential beneficial effect. This study aimed to elucidate the balance between the electrophilicity or pro-oxidant activity of purpurin underlying the Nrf2 induction. For this, Nrf2 activation with modified intracellular glutathione (GSH) levels was measured in an Nrf2 CALUX reporter gene assay. In addition, both cell-free and intracellular ROS formation of purpurin with modified (intracellular) GSH levels at different pH were quantified using the DCF-DA assay. GSH adduct formation was evaluated by UPLC and LC-TOF-MS analysis. GSH and GSSG levels following purpurin incubations were quantified by LC-MS/MS. We show that Nrf2 induction by purpurin was significantly increased in cells with buthionine sulfoximine depleted GSH levels, while Nrf2 induction was decreased upon incubation of the cells with <i>N</i>-acetylcysteine being a precursor of GSH. In cell-free incubations, ROS formation increased with increasing pH pointing at a role for the deprotonated form of purpurin. Upon incubations of purpurin with GSH at physiological pH, GSH adduct formation appeared negligible (<1.5% of the added purpurin). The addition of GSH resulted in conversion of GSH to GSSG and significantly reduced the ROS formation. Together these results demonstrate that Nrf2 induction by purpurin originates from intracellular ROS formation and not from its electrophilicity, which becomes especially relevant when intracellular GSH levels can no longer scavenge the ROS. The present study demonstrated that the efficiency of intracellular Nrf2 activation by purpurin and related anthraquinones will depend on (i) their pKa and level of deprotonation at the intracellular pH, (ii) the oxidation potential of their deprotonated form and (iii) the intracellular GSH levels. Thus, the Nrf2 induction by purpurin depends on its pro-oxidant activity and not on its electrophilicity.

bioRxiv 2023-08-02 Preprint (No Snippets API) Lee A, Floyd K, Wu S, Fang Z, Tan TK, Li C, Hui H, Scoville D, Ruggiero AD, Liang Y, Pavenko A, Lujan V, Nolan GP, Arunachalam P, Suthar M, Pulendran B.
Show Full Abstract

<h4>ABSTRACT</h4> Bacille Calmette-Guérin (BCG) vaccination can confer non-specific protection against heterologous pathogens. However, the underlying mechanisms remain mysterious. Here, we show that mice immunized intravenously with BCG exhibited reduced weight loss and/or improved viral clearance when challenged with SARS-CoV-2 and influenza. Protection was first evident between 14 - 21 days post vaccination, and lasted for at least 42 days. Remarkably, BCG induced a biphasic innate response in the lung, initially at day 1 and a subsequent prolonged phase starting at ∼15 days post vaccination, and robust antigen-specific Th1 responses. MyD88-dependent TLR signaling was essential for the induction of the innate and Th1 responses, and protection against SARS-CoV-2. Depletion of CD4 + T cells or IFN-γ activity prior to infection obliterated innate activation and protection. Single cell and spatial transcriptomics revealed CD4-dependent expression of interferon-stimulated genes (ISGs) in myeloid, type II alveolar and lung epithelial cells. Thus, BCG elicits “integrated organ immunity” where CD4+ T cells act on local myeloid and epithelial cells to imprint prolonged antiviral innate resistance.

bioRxiv 2023-08-02 Preprint (No Snippets API) Higgins E, Galofre ZG, McAbney J, Leiper J, Dowsett L.
Show Full Abstract

The Calcium-sensing receptor (CaSR) is a G protein-coupled receptor activated by fluctuations in extracellular calcium concentrations. Its importance in calcium homeostasis has long been established, though its role in other tissues is not well understood. Obesity is a major epidemic with both clinical and social consequences, therefore, understanding the full function and regulation of adipocytes is of critical importance. Adipocyte CaSR has previously been linked to lipolysis and inflammation in vitro . In this study, we set out to further our understanding of adipocyte CaSR in vivo via the generation of an adipocyte specific CaSR knockout mouse (CaSR Ad-/- ). We found female CaSR Ad-/- mice weighed less than wildtype littermates with a significant reduction in visceral adipocyte size potentially due to increased expression of brown fat markers UCP-1 and Cidea. We also established that CaSR is expressed in perivascular adipose tissue (PVAT) and that its deletion protects female mice from PVAT driven hypercontractility. In contrast CaSR deletion had no effect on male body mass, adipocyte size or vascular reactivity. In conclusion, CaSR seems to be of importance in female but not male visceral and perivascular adipose tissue.

DCC
Also flagged:chronic lowintervertebral disc (fibromyalgiato treatmentLBPC-reactive protein
Journal Article 2023-08-01 ✓ 1 Snippet Fields AJ, Dudli S, Schrepf A, Kim A, Pham B, Gallego E, Mendoza S, Meropol SB, Darwin J, Sowa G, Vo NV.
In-Text Gene Mentions

…this study theDCCgene was found…

Show Full Abstract

The Biospecimen Collection and Processing Working Group of the National Institutes of Health (NIH) HEAL Initiative BACPAC Research Program was charged with identifying molecular biomarkers of interest to chronic low back pain (cLBP). Having identified biomarkers of interest, the Working Group worked with the New York University Grossman School of Medicine, Center for Biospecimen Research and Development-funded by the Early Phase Pain Investigation Clinical Network Data Coordinating Center-to harmonize consortium-wide and site-specific efforts for biospecimen collection and analysis. Biospecimen collected are saliva, blood (whole, plasma, serum), urine, stool, and spine tissue (paraspinal muscle, ligamentum flavum, vertebral bone, facet cartilage, disc endplate, annulus fibrosus, or nucleus pulposus). The omics data acquisition and analyses derived from the biospecimen include genomics and epigenetics from DNA, proteomics from protein, transcriptomics from RNA, and microbiomics from 16S rRNA. These analyses contribute to the overarching goal of BACPAC to phenotype cLBP and will guide future efforts for precision medicine treatment.

Also flagged:SynthesisanxietyC-reactive proteinCRPdiabetes(IL)-6
Journal Article 2023-08-01 No Snippets Chau A, Steib S, Whitaker E, Kohns D, Quinter A, Craig A, Chiodo A, Chandran S, Laidlaw A, Schott Z, Farlow N, Yarjanian J, Omwanghe A, Wasserman R, O'Neill C, Clauw D, Bowden A, Marras W, Carey T, Mehling W, Hunt CA, Lotz J.
Show Full Abstract

<h4>Background</h4>Chronic low back pain (cLBP) is a complex with a heterogenous clinical presentation. A better understanding of the factors that contribute to cLBP is needed for accurate diagnosis, optimal treatment, and identification of mechanistic targets for new therapies. The Back Pain Consortium (BACPAC) Research Program provides a unique opportunity in this regard, as it will generate large clinical datasets, including a diverse set of harmonized measurements. The Theoretical Model Working Group was established to guide BACPAC research and to organize new knowledge within a mechanistic framework. This article summarizes the initial work of the Theoretical Model Working Group. It includes a three-stage integration of expert opinion and an umbrella literature review of factors that affect cLBP severity and chronicity.<h4>Methods</h4>During Stage 1, experts from across BACPAC established a taxonomy for risk and prognostic factors (RPFs) and preliminary graphical depictions. During Stage 2, a separate team conducted a literature review according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines to establish working definitions, associated data elements, and overall strength of evidence for identified RPFs. These were subsequently integrated with expert opinion during Stage 3.<h4>Results</h4>The majority (∼80%) of RPFs had little strength-of-evidence confidence, whereas seven factors had substantial confidence for either a positive association with cLBP (pain-related anxiety, serum C-reactive protein, diabetes, and anticipatory/compensatory postural adjustments) or no association with cLBP (serum interleukin 1-beta / interleukin 6, transversus muscle morphology/activity, and quantitative sensory testing).<h4>Conclusion</h4>This theoretical perspective will evolve over time as BACPAC investigators link empirical results to theory, challenge current ideas of the biopsychosocial model, and use a systems approach to develop tools and algorithms that disentangle the dynamic interactions among cLBP factors.

Also flagged:Iron deficiencyIDinflammatory bowel diseaseironerythropoiesisanemia
Journal Article 2023-08-01 No Snippets Loveikyte R, Bourgonje AR, van der Reijden JJ, Bulthuis MLC, Hawinkels LJAC, Visschedijk MC, Festen EAM, van Dullemen HM, Weersma RK, van Goor H, van der Meulen-de Jong AE, Dijkstra G.
Show Full Abstract

<h4>Background</h4>Hepcidin, the systemic iron regulator, could be critical in differentiating iron deficiency (ID) from functional iron restriction in inflammatory bowel disease (IBD). We assessed hepcidin as a diagnostic ID marker and explored the relationship between hepcidin and its regulators in patients with IBD undergoing induction therapy with infliximab (IFX) or vedolizumab (VEDO).<h4>Methods</h4>Patients with active IBD receiving induction therapy with IFX or VEDO were included. Serum samples at baseline and after 6 weeks of induction therapy were analyzed for hepcidin, inflammation- and hypoxia-associated cytokines, and oxidative stress. Data were analyzed by stratifying based on the response at week 14. Results were compared with samples from age- and sex-matched healthy control subjects.<h4>Results</h4>Patients receiving induction therapy with IFX (n = 71) or VEDO (n = 51) and healthy control subjects (n = 50) were included. At baseline, hepcidin correlated positively with ferritin and negatively with soluble transferrin receptor/log ferritin index (P < .001). ID was prevalent in 96.7% of patients who had hepcidin levels below the median. Hepcidin accurately identified ID: the area under the curve (hepcidin) was 0.89 (95% confidence interval, 0.82-0.95; P < .001). In total, 75.4% of patients responded to induction therapy; inflammation, hepcidin, and ferritin decreased significantly, while transferrin increased during induction therapy. These changes were observed only in patients who responded to the therapy.<h4>Conclusions</h4>Hepcidin levels in IBD are primarily determined by ID, even in an inflammatory state. In addition, induction therapy can decrease hepcidin levels, which might lead to better bioavailability of iron supplements. Therefore, hepcidin is a potential diagnostic ID biomarker that could assist therapeutic decision making.

HTT
Also flagged:neurodegenerative diseasesβ-amyloidantibodiesamyloid precursor proteinpresenilin 1presenilin 2
Journal Article 2023-08-01 ✓ 4 Snippets Imbimbo BP, Triaca V, Imbimbo C, Nisticò R.
In-Text Gene Mentions

(B) In Huntington’s disease, the genetic expansion of the CAG triplet repeat of the HTT gene leads to extra glutamines in the poly-Q region near the N-terminus of the Htt protein.

HD is an autosomal dominant progressive neurodegenerative disorder with a cytosine-adenine-guanine (CAG) trinucleotide repeat expansion in the huntingtin gene (HTT) on chromosome 4p.

…huntingtin gene (HTT) on chromosome…

…repeats in theHTTgene and age…

Show Full Abstract

We reviewed recent major clinical trials with investigational drugs for the treatment of subjects with neurodegenerative diseases caused by inheritance of gene mutations or associated with genetic risk factors. Specifically, we discussed randomized clinical trials in subjects with Alzheimer's disease, Huntington's disease and amyotrophic lateral sclerosis bearing pathogenic gene mutations, and glucocerebrosidase-associated Parkinson's disease. Learning potential lessons to improve future therapeutic approaches is the aim of this review. Two long-term, controlled trials on three anti-β-amyloid monoclonal antibodies (solanezumab, gantenerumab and crenezumab) in subjects carrying Alzheimer's disease-linked mutated genes encoding for amyloid precursor protein or presenilin 1 or presenilin 2 failed to show cognitive or functional benefits. A major trial on tominersen, an antisense oligonucleotide designed to reduce the production of the huntingtin protein in subjects with Huntington's disease, was prematurely interrupted because the drug failed to show higher efficacy than placebo and, at highest doses, led to worsened outcomes. A 28-week trial of tofersen, an antisense oligonucleotide for superoxide dismutase 1 in patients with amyotrophic lateral sclerosis with superoxide dismutase 1 gene mutations failed to show significant beneficial effects but the 1-year open label extension of this study indicated better clinical and functional outcomes in the group with early tofersen therapy. A trial of venglustat, a potent and brain-penetrant glucosylceramide synthase inhibitor, in Parkinson's disease subjects with heterozygous glucocerebrosidase gene mutations revealed worsened clinical and cognitive performance of patients on the enzyme inhibitor compared to placebo. We concluded that clinical trials in neurodegenerative diseases with a genetic basis should test monoclonal antibodies, antisense oligonucleotides or gene editing directed against the mutated enzyme or the mutated substrate without dramatically affecting physiological wild-type variants.

VRK2
Also flagged:epilepsiesepilepsypsychiatric disordersattention deficit hyperactivity disorderfocal epilepsydepression
Journal Article 2023-08-01 ✓ 4 Snippets Karadag N, Shadrin AA, O'Connell KS, Hindley GFL, Rahman Z, Parker N, Bahrami S, Fominykh V, Cheng W, Holen B, Alvestad S, Taubøll E, Steen NE, Djurovic S, Dale AM, Frei O, Andreassen OA, Smeland OB.
In-Text Gene Mentions

…implicating the genesVRK2, GNL3 ,…

…genes MRPL33:RBKS ,VRK2, CD47 ,…

…three (at genesVRK2, ZSCAN23 and…

…implicated genes wereVRK2, GNL3 ,…

Show Full Abstract

Psychiatric disorders and common epilepsies are heritable disorders with a high comorbidity and overlapping symptoms. However, the causative mechanisms underlying this relationship are poorly understood. Here we aimed to identify overlapping genetic loci between epilepsy and psychiatric disorders to gain a better understanding of their comorbidity and shared clinical features. We analysed genome-wide association study data for all epilepsies (n = 44 889), genetic generalized epilepsy (n = 33 446), focal epilepsy (n = 39 348), schizophrenia (n = 77 096), bipolar disorder (n = 406 405), depression (n = 500 199), attention deficit hyperactivity disorder (n = 53 293) and autism spectrum disorder (n = 46 350). First, we applied the MiXeR tool to estimate the total number of causal variants influencing the disorders. Next, we used the conjunctional false discovery rate statistical framework to improve power to discover shared genomic loci. Additionally, we assessed the validity of the findings in independent cohorts, and functionally characterized the identified loci. The epilepsy phenotypes were considerably less polygenic (1.0 K to 3.4 K causal variants) than the psychiatric disorders (5.6 K to 13.9 K causal variants), with focal epilepsy being the least polygenic (1.0 K variants), and depression having the highest polygenicity (13.9 K variants). We observed cross-trait genetic enrichment between genetic generalized epilepsy and all psychiatric disorders and between all epilepsies and schizophrenia and depression. Using conjunctional false discovery rate analysis, we identified 40 distinct loci jointly associated with epilepsies and psychiatric disorders at conjunctional false discovery rate <0.05, four of which were associated with all epilepsies and 39 with genetic generalized epilepsy. Most epilepsy risk loci were shared with schizophrenia (n = 31). Among the identified loci, 32 were novel for genetic generalized epilepsy, and two were novel for all epilepsies. There was a mixture of concordant and discordant allelic effects in the shared loci. The sign concordance of the identified variants was highly consistent between the discovery and independent datasets for all disorders, supporting the validity of the findings. Gene-set analysis for the shared loci between schizophrenia and genetic generalized epilepsy implicated biological processes related to cell cycle regulation, protein phosphatase activity, and membrane and vesicle function; the gene-set analyses for the other loci were underpowered. The extensive genetic overlap with mixed effect directions between psychiatric disorders and common epilepsies demonstrates a complex genetic relationship between these disorders, in line with their bi-directional relationship, and indicates that overlapping genetic risk may contribute to shared pathophysiological and clinical features between epilepsy and psychiatric disorders.

HTT
Also flagged:cortical atrophyrapid eye movement sleep behaviour disordersleep disordersleepsynucleinopathydementia with Lewy bodies
Journal Article 2023-08-01 ✓ 2 Snippets Rahayel S, Tremblay C, Vo A, Misic B, Lehéricy S, Arnulf I, Vidailhet M, Corvol JC, ICEBERG Study Group, Gagnon JF, Postuma RB, Montplaisir J, Lewis S, Matar E, Ehgoetz Martens K, Borghammer P, Knudsen K, Hansen AK, Monchi O, Gan-Or Z, Dagher A, Alzheimer’s Disease Neuroimaging Initiative.
In-Text Gene Mentions

For the neurotransmitter systems, the previously curated regional density maps of 18 receptors, transporters, and receptor binding sites associated with dopamine [D1,53 D2,54,55 dopamine transporter (DAT)56], serotonin [5-HT1A,57 5-HT1B,57,58 5-HT2A,59 5-HT4,59 5-HT6,60 serotonin transporter (5-HTT)59], noradrenaline [noradrenaline transporter (NET)],61 acetylcholine [α4β2,62 M1,63 vesicular acetylcholine transporter (VAChT)46,64,65], GABA (GABAA/BZ),66 glutamate (mGluR5),46,67,68 histamine (H3),69 endocannabinoids (CB1),70 and opioids (μ)71 were generated from the PET images of 1238 healthy individuals (718 males and 520 females between 18 and 68 years old depending on the tracer; see Supplementary Table 3 in Hansen et al. 46 for demographic and methodological details for each PET tracer).

…60 serotonin transporter (5-HTT) 59 ], noradrenaline…

Show Full Abstract

Isolated rapid eye movement sleep behaviour disorder (iRBD) is a sleep disorder characterized by the loss of rapid eye movement sleep muscle atonia and the appearance of abnormal movements and vocalizations during rapid eye movement sleep. It is a strong marker of incipient synucleinopathy such as dementia with Lewy bodies and Parkinson's disease. Patients with iRBD already show brain changes that are reminiscent of manifest synucleinopathies including brain atrophy. However, the mechanisms underlying the development of this atrophy remain poorly understood. In this study, we performed cutting-edge imaging transcriptomics and comprehensive spatial mapping analyses in a multicentric cohort of 171 polysomnography-confirmed iRBD patients [67.7 ± 6.6 (49-87) years; 83% men] and 238 healthy controls [66.6 ± 7.9 (41-88) years; 77% men] with T1-weighted MRI to investigate the gene expression and connectivity patterns associated with changes in cortical thickness and surface area in iRBD. Partial least squares regression was performed to identify the gene expression patterns underlying cortical changes in iRBD. Gene set enrichment analysis and virtual histology were then done to assess the biological processes, cellular components, human disease gene terms, and cell types enriched in these gene expression patterns. We then used structural and functional neighbourhood analyses to assess whether the atrophy patterns in iRBD were constrained by the brain's structural and functional connectome. Moreover, we used comprehensive spatial mapping analyses to assess the specific neurotransmitter systems, functional networks, cytoarchitectonic classes, and cognitive brain systems associated with cortical changes in iRBD. All comparisons were tested against null models that preserved spatial autocorrelation between brain regions and compared to Alzheimer's disease to assess the specificity of findings to synucleinopathies. We found that genes involved in mitochondrial function and macroautophagy were the strongest contributors to the cortical thinning occurring in iRBD. Moreover, we demonstrated that cortical thinning was constrained by the brain's structural and functional connectome and that it mapped onto specific networks involved in motor and planning functions. In contrast with cortical thickness, changes in cortical surface area were related to distinct genes, namely genes involved in the inflammatory response, and to different spatial mapping patterns. The gene expression and connectivity patterns associated with iRBD were all distinct from those observed in Alzheimer's disease. In summary, this study demonstrates that the development of brain atrophy in synucleinopathies is constrained by specific genes and networks.

Also flagged:Multiple myelomablood cancerhematologic cancerspathogenesisoncogenestumor
Journal Article 2023-08-01 No Snippets Brownlie RJ, Kennedy R, Wilson EB, Milanovic M, Taylor CF, Wang D, Davies JR, Owston H, Adams EJ, Stephenson S, Caeser R, Gewurz BE, Giannoudis PV, Scuoppo C, McGonagle D, Hodson DJ, Tooze RM, Doody GM, Cook G, Westhead DR, Klein U.
Show Full Abstract

Multiple myeloma (MM) shows constitutive activation of canonical and noncanonical nuclear factor κB (NF-κB) signaling via genetic mutations or tumor microenvironment (TME) stimulations. A subset of MM cell lines showed dependency for cell growth and survival on the canonical NF-κB transcription factor RELA alone, suggesting a critical role for a RELA-mediated biological program in MM pathogenesis. Here, we determined the RELA-dependent transcriptional program in MM cell lines and found the expression of the cell surface molecules interleukin-27 receptor-α (IL-27Rα) and the adhesion molecule JAM2 to be responsive to RELA at the messenger RNA and protein levels. IL-27Rα and JAM2 were expressed on primary MM cells at higher levels than on healthy long-lived plasma cells (PCs) in the bone marrow. IL-27 activated STAT1, and to a lesser extent STAT3, in MM cell lines and in PCs generated from memory B cells in an IL-21-dependent in vitro PC differentiation assay. Concomitant activity of IL-21 and IL-27 enhanced differentiation into PCs and increased the cell-surface expression of the known STAT target gene CD38. In accordance, a subset of MM cell lines and primary MM cells cultured with IL-27 upregulated CD38 cell-surface expression, a finding with potential implications for enhancing the efficacy of CD38-directed monoclonal antibody therapies by increasing CD38 expression on tumor cells. The elevated expression of IL-27Rα and JAM2 on MM cells compared with that on healthy PCs may be exploited for the development of targeted therapeutic strategies that modulate the interaction of MM cells with the TME.

Also flagged:YPEL5YPEL1Yippee-likeYippeeHemolinMOH1
Journal Article 2023-08-01 No Snippets Deng Y, Han X, Chen H, Zhao C, Chen Y, Zhou J, de The H, Zhu J, Yuan H.
Show Full Abstract

YPEL5 is a member of the Yippee-like (YPEL) gene family that is evolutionarily conserved in eukaryotic species. To date, the physiological function of YPEL5 has not been assessed due to a paucity of genetic animal models. Here, using CRISPR/Cas9-mediated genome editing, we generated a stable ypel5-/- mutant zebrafish line. Disruption of ypel5 expression leads to liver enlargement associated with hepatic cell proliferation. Meanwhile, hepatic metabolism and function are dysregulated in ypel5-/- mutant zebrafish, as revealed by metabolomic and transcriptomic analyses. Mechanistically, Hnf4a is identified as a crucial downstream mediator that is positively regulated by Ypel5. Zebrafish hnf4a overexpression could largely rescue ypel5 deficiency-induced hepatic defects. Furthermore, PPARα signaling mediates the regulation of Hnf4a by Ypel5 through directly binding to the transcriptional enhancer of the Hnf4a gene. Herein, this work demonstrates an essential role of Ypel5 in hepatocyte proliferation and function and provides the first in vivo evidence for a physiological role of the ypel5 gene in vertebrates.

Also flagged:Toll-Like Receptor 9TLR-9diabetes mellituschronic kidney diseaseimmune responsesHBV infection
Journal Article 2023-08-01 No Snippets Marks KM, Kang M, Umbleja T, Avihingsanon A, Sugandhavesa P, Cox AL, Vigil K, Perazzo H, Price JC, Katsidzira L, Vernon C, Alston-Smith B, Sherman KE, ACTG 5379 Study Team.
Show Full Abstract

In this international, multicenter open-label study (ACTG A5379) of HepB-CpG vaccine in people with human immunodeficiency virus (HIV) without prior hepatitis B virus (HBV) vaccination, all 68 participants achieved HBV seroprotective titers after the 3-dose series in the primary analysis. No unexpected safety issues were observed.

DCC
Also flagged:β-amylase7nuclear-localized transcription factorBAM7plastid-starch hydrolase
Journal Article 2023-08-01 ✓ 1 Snippet Ozcan KE, Monroe JD.
In-Text Gene Mentions

…clearly fit theDCCmodel of gene…

Show Full Abstract

An unusual β-amylase7 (BAM7) gene in some angiosperms, including grasses such as maize (Zea mays), appears to encode 2 functionally distinct proteins: a nuclear-localized transcription factor (BAM7) and a plastid-localized starch hydrolase (BAM2). In Arabidopsis (Arabidopsis thaliana), these 2 proteins are encoded by separate genes on different chromosomes but their physiological functions are not well established. Using the maize BAM7 gene as a model, we detected 2 populations of transcripts by 5'-RACE which encode the predicted proteins. The 2 transcripts are apparently synthesized independently using separate core promoters about 1 kb apart, the second of which is located in the first intron of the full-length gene. The N-terminus of the shorter protein, ZmBAM7-S, begins near the 3' end of the first intron of ZmBAM7-L and starts with a predicted chloroplast transit peptide. We previously showed that ZmBAM7-S is catalytically active with properties like those of AtBAM2. Here, we report that ZmBAM7-S targets green fluorescent protein to plastids. The transcript encoding the longer protein, ZmBAM7-L, encodes an additional DNA-binding domain containing a functional nuclear localization signal. This putative dual-function gene originated at least 400 Mya, prior to the emergence of ferns, and has persisted in some angiosperms that lack a separate BAM2 gene. It appears to have been duplicated and subfunctionalized in at least 4 lineages of land plants, resulting in 2 genes resembling Arabidopsis BAM2 and BAM7. Targeting of 2 products from a single gene to different subcellular locations is not uncommon in plants, but it is unusual when they are predicted to serve completely different functions in the 2 locations.

Also flagged:cystic fibrosisclustered regularly interspaced shortWilms tumorpediatric kidney cancercancersnephrogenesis
Journal Article 2023-08-01 No Snippets Kaldunski ML, Smith JR, Brodie KC, De Pons JL, Demos WM, Gibson AC, Hayman GT, Lamers L, Laulederkind SJF, Thorat K, Thota J, Tutaj MA, Tutaj M, Vedi M, Wang SJ, Zacher S, Dwinell MR, Kwitek AE.
Show Full Abstract

Rare diseases individually affect relatively few people, but as a group they impact considerable numbers of people. The Rat Genome Database (https://rgd.mcw.edu) is a knowledgebase that offers resources for rare disease research. This includes disease definitions, genes, quantitative trail loci (QTLs), genetic variants, annotations to published literature, links to external resources, and more. One important resource is identifying relevant cell lines and rat strains that serve as models for disease research. Diseases, genes, and strains have report pages with consolidated data, and links to analysis tools. Utilizing these globally accessible resources for rare disease research, potentiating discovery of mechanisms and new treatments, can point researchers toward solutions to alleviate the suffering of those afflicted with these diseases.

MLLT10
Also flagged:acute lymphoblastic leukemiaALLubiquitin ligaseprotein degradationdegradationGSPT1
Journal Article 2023-08-01 ✓ 1 Snippet Chang Y, Keramatnia F, Ghate PS, Nishiguchi G, Gao Q, Iacobucci I, Yang L, Chepyala D, Mishra A, High AA, Goto H, Akahane K, Peng J, Yang JJ, Fischer M, Rankovic Z, Mullighan CG.
In-Text Gene Mentions

MLLT10

Show Full Abstract

Advancing cure rates for high-risk acute lymphoblastic leukemia (ALL) has been limited by the lack of agents that effectively kill leukemic cells, sparing normal hematopoietic tissue. Molecular glues direct the ubiquitin ligase cellular machinery to target neosubstrates for protein degradation. We developed a novel cereblon modulator, SJ6986, that exhibits potent and selective degradation of GSPT1 and GSPT2 and cytotoxic activity against childhood cancer cell lines. Here, we report in vitro and in vivo testing of the activity of this agent in a panel of ALL cell lines and xenografts. SJ6986 exhibited similar cytotoxicity to the previously described GSPT1 degrader CC-90009 in a panel of leukemia cell lines in vitro, resulting in apoptosis and perturbation of cell cycle progression. SJ6986 was more effective than CC-90009 in suppressing leukemic cell growth in vivo, partly attributable to favorable pharmacokinetic properties, and did not significantly impair differentiation of human CD34+ cells ex vivo. Genome-wide CRISPR/Cas9 screening of ALL cell lines treated with SJ6986 confirmed that components of the CRL4CRBN complex, associated adaptors, regulators, and effectors were integral in mediating the action of SJ6986. SJ6986 is a potent, selective, orally bioavailable GSPT1/2 degrader that shows broad antileukemic activity and has potential for clinical development.

DNAJC1
Also flagged:acute lymphoblastic leukemiachromosomeALLpathogenesisacute leukemiaCHAF1B
Journal Article 2023-08-01 ✓ 1 Snippet Gao Q, Ryan SL, Iacobucci I, Ghate PS, Cranston RE, Schwab C, Elsayed AH, Shi L, Pounds S, Lei S, Baviskar P, Pei D, Cheng C, Bashton M, Sinclair P, Bentley DR, Ross MT, Kingsbury Z, James T, Roberts KG, Devidas M, Fan Y, Chen W, Chang TC, Wu G, Carroll A, Heerema N, Valentine V, Valentine M, Yang W, Yang JJ, Moorman AV, Harrison CJ, Mullighan CG.
In-Text Gene Mentions

DNAJC1

Show Full Abstract

Intrachromosomal amplification of chromosome 21 defines a subtype of high-risk childhood acute lymphoblastic leukemia (iAMP21-ALL) characterized by copy number changes and complex rearrangements of chromosome 21. The genomic basis of iAMP21-ALL and the pathogenic role of the region of amplification of chromosome 21 to leukemogenesis remains incompletely understood. In this study, using integrated whole genome and transcriptome sequencing of 124 patients with iAMP21-ALL, including rare cases arising in the context of constitutional chromosomal aberrations, we identified subgroups of iAMP21-ALL based on the patterns of copy number alteration and structural variation. This large data set enabled formal delineation of a 7.8 Mb common region of amplification harboring 71 genes, 43 of which were differentially expressed compared with non-iAMP21-ALL ones, including multiple genes implicated in the pathogenesis of acute leukemia (CHAF1B, DYRK1A, ERG, HMGN1, and RUNX1). Using multimodal single-cell genomic profiling, including single-cell whole genome sequencing of 2 cases, we documented clonal heterogeneity and genomic evolution, demonstrating that the acquisition of the iAMP21 chromosome is an early event that may undergo progressive amplification during disease ontogeny. We show that UV-mutational signatures and high mutation load are characteristic secondary genetic features. Although the genomic alterations of chromosome 21 are variable, these integrated genomic analyses and demonstration of an extended common minimal region of amplification broaden the definition of iAMP21-ALL for more precise diagnosis using cytogenetic or genomic methods to inform clinical management.

Also flagged:opportunistic infectionscystic fibrosisCFMABC infectionlung infectionmacrolide
Journal Article 2023-08-01 No Snippets Choi J, Keen EC, Wallace MA, Fishbein S, Prusa J, Zimbric M, Mejia-Chew CR, Mehta SB, Bailey TC, Caverly LJ, Burnham CD, Dantas G.
Show Full Abstract

<h4>Background</h4>Nontuberculous mycobacteria (NTM) are ubiquitous in the environment and an increasingly frequent cause of opportunistic infections. Mycobacterium abscessus complex (MABC) is one of the major NTM lung pathogens that disproportionately colonize and infect the lungs of individuals with cystic fibrosis (CF). MABC infection can persist for years, and antimicrobial treatment is frequently ineffective.<h4>Methods</h4>We sequenced the genomes of 175 isolates longitudinally collected from 30 patients with MABC lung infection. We contextualized our cohort amidst the broader MABC phylogeny and investigated genes undergoing parallel adaptation across patients. Finally, we tested the phenotypic consequences of parallel mutations by conducting antimicrobial resistance and mercury-resistance assays.<h4>Results</h4>We identified highly related isolate pairs across hospital centers with low likelihood of transmission. We further annotated nonrandom parallel mutations in 22 genes and demonstrated altered macrolide susceptibility co-occurring with a nonsynonymous whiB1 mutation. Finally, we highlighted a 23-kb mercury-resistance plasmid whose loss during chronic infection conferred phenotypic susceptibility to organic and nonorganic mercury compounds.<h4>Conclusions</h4>We characterized parallel genomic processes through which MABC is adapting to promote survival within the host. The within-lineage polymorphisms we observed have phenotypic effects, potentially benefiting fitness in the host at the putative detriment of environmental survival.

HFE
Also flagged:Hepatocellular CarcinomaCirrhosisalcohol-associated liver diseasenonalcoholic fatty liver diseaseNAFLDLiver Disease
Journal Article 2023-08-01 ✓ 2 Snippets VoPham T, Cravero A, Feld LD, Green P, Feng Z, Berry K, Kim NJ, Vutien P, Mendoza JA, Ioannou GN.
In-Text Gene Mentions

…ICD-9 codes forhemochromatosis, primary biliary cirrhosis,…

…alcohol use disorders,hemochromatosis, primary biliary cirrhosis,…

Show Full Abstract

<h4>Background</h4>Among patients with cirrhosis, it remains unclear whether there are racial/ethnic differences in cirrhosis complications and mortality. We examined the associations between race/ethnicity and risk for hepatocellular carcinoma (HCC), cirrhosis decompensation, and all-cause mortality overall and by cirrhosis etiology.<h4>Methods</h4>US Veterans diagnosed with cirrhosis from 2001 to 2014 (n = 120,992), due to hepatitis C virus (HCV; n = 55,814), alcohol-associated liver disease (ALD; n = 36,323), hepatitis B virus (HBV; n = 1,972), nonalcoholic fatty liver disease (NAFLD; n = 17,789), or other (n = 9,094), were followed through 2020 for incident HCC (n = 10,242), cirrhosis decompensation (n = 27,887), and mortality (n = 81,441). Multivariable Cox proportional hazards regression was used to estimate adjusted hazard ratios (aHR) and 95% confidence intervals (CI).<h4>Results</h4>Compared with non-Hispanic White patients, Hispanic patients had higher risk for HCC overall (aHR, 1.32; 95% CI, 1.24-1.41) and by cirrhosis etiology, particularly for ALD- (aHR, 1.63; 95% CI, 1.42-1.87) and NAFLD-cirrhosis (aHR, 1.76; 95% CI, 1.41-2.20), whereas non-Hispanic Black patients had lower HCC risk in ALD- (aHR, 0.79; 95% CI, 0.63-0.98) and NAFLD-cirrhosis (aHR, 0.54; 95% CI, 0.33-0.89). Asian patients had higher HCC risk (aHR, 1.70; 95% CI, 1.29-2.23), driven by HCV- and HBV-cirrhosis. Non-Hispanic Black patients had lower risk for cirrhosis decompensation overall (aHR, 0.71; 95% CI, 0.68-0.74) and by cirrhosis etiology. There was lower risk for mortality among all other racial/ethnic groups compared with non-Hispanic White patients.<h4>Conclusions</h4>Race/ethnicity is an important predictor for risk of developing HCC, decompensation, and mortality.<h4>Impact</h4>Future research should examine factors underlying these racial/ethnic differences to inform prevention, screening, and treatment for patients with cirrhosis.

BTN2A1
Also flagged:colon cancercancerApctumortumorsbutyrophilin-like
Journal Article 2023-08-01 ✓ 2 Snippets Suzuki T, Kilbey A, Casa-Rodríguez N, Lawlor A, Georgakopoulou A, Hayman H, Yin Swe KL, Nordin A, Cantù C, Vantourout P, Ridgway RA, Byrne RM, Chen L, Verzi MP, Gay DM, Gil Vázquez E, Belnoue-Davis HL, Gilroy K, Køstner AH, Kersten C, Thuwajit C, Andersen DK, Wiesheu R, Jandke A, Blyth K, Roseweir AK, Leedham SJ, Dunne PD, Edwards J, Hayday A, Sansom OJ, Coffelt SB.
In-Text Gene Mentions

…namely BTN3A1 andBTN2A1, which bind Vγ9Vδ2…

…for CTNNB1 andBTN2A1expression levels (…

Show Full Abstract

Intraepithelial lymphocytes (IEL) expressing γδ T-cell receptors (γδTCR) play key roles in elimination of colon cancer. However, the precise mechanisms by which progressing cancer cells evade immunosurveillance by these innate T cells are unknown. Here, we investigated how loss of the Apc tumor suppressor in gut tissue could enable nascent cancer cells to escape immunosurveillance by cytotoxic γδIELs. In contrast with healthy intestinal or colonic tissue, we found that γδIELs were largely absent from the microenvironment of both mouse and human tumors, and that butyrophilin-like (BTNL) molecules, which can critically regulate γδIEL through direct γδTCR interactions, were also downregulated in tumors. We then demonstrated that β-catenin activation through loss of Apc rapidly suppressed expression of the mRNA encoding the HNF4A and HNF4G transcription factors, preventing their binding to promoter regions of Btnl genes. Reexpression of BTNL1 and BTNL6 in cancer cells increased γδIEL survival and activation in coculture assays but failed to augment their cancer-killing ability in vitro or their recruitment to orthotopic tumors. However, inhibition of β-catenin signaling via genetic deletion of Bcl9/Bcl9L in either Apc-deficient or mutant β-catenin mouse models restored Hnf4a, Hnf4g, and Btnl gene expression and γδ T-cell infiltration into tumors. These observations highlight an immune-evasion mechanism specific to WNT-driven colon cancer cells that disrupts γδIEL immunosurveillance and furthers cancer progression.

TNFSF4
Also flagged:DCLacute myeloid leukaemiacytokineCytokinesmicronucleimitoxantrone
Journal Article 2023-08-01 ✓ 1 Snippet Asurappulige HSH, Thomas AD, Morse HR.
In-Text Gene Mentions

…IL-29, LIF, andTNFSF4from TK6 cells…

Show Full Abstract

Donor cell leukaemia (DCL) is a complication of haematopoietic stem cell transplantation where donated cells become malignant within the patient's bone marrow. As DCL predominates as acute myeloid leukaemia, we hypothesized that the cytokine storm following chemotherapy played a role in promoting and supporting leukaemogenesis. Cytokines have also been implicated in genotoxicity; thus, we explored a cell line model of the human bone marrow (BM) to secrete myeloid cytokines following drug treatment and their potential to induce micronuclei. HS-5 human stromal cells were exposed to mitoxantrone (MTX) and chlorambucil (CHL) and, for the first time, were profiled for 80 cytokines using an array. Fifty-four cytokines were detected in untreated cells, of which 24 were upregulated and 10 were downregulated by both drugs. FGF-7 was the lowest cytokine to be detected in both untreated and treated cells. Eleven cytokines not detected at baseline were detected following drug exposure. TNFα, IL6, GM-CSF, G-CSF, and TGFβ1 were selected for micronuclei induction. TK6 cells were exposed to these cytokines in isolation and in paired combinations. Only TNFα and TGFβ1 induced micronuclei at healthy concentrations, but all five cytokines induced micronuclei at storm levels, which was further increased when combined in pairs. Of particular concern was that some combinations induced micronuclei at levels above the mitomycin C positive control; however, most combinations were less than the sum of micronuclei induced following exposure to each cytokine in isolation. These data infer a possible role for cytokines through chemotherapy-induced cytokine storm, in the instigation and support of leukaemogenesis in the BM, and implicate the need to evaluate individuals for variability in cytokine secretion as a potential risk factor for complications such as DCL.

Also flagged:RuxolitinibAcute graft-versus-host diseaseaGVHDmetabolismhematopoiesisJAK1
Journal Article 2023-08-01 No Snippets Lin Y, Gu Q, Lu S, Pan Z, Yang Z, Li Y, Yang S, Lv Y, Zheng Z, Sun G, Gou F, Xu C, Zhao X, Wang F, Wang C, Yuan S, Xie X, Cao Y, Liu Y, Gu W, Cheng T, Cheng H, Hu X.
Show Full Abstract

Acute graft-versus-host disease (aGVHD) is a severe complication of allogeneic hematopoietic stem cell transplantation. Hematopoietic dysfunction accompanied by severe aGVHD, which may be caused by niche impairment, is a long-standing clinical problem. However, how the bone marrow (BM) niche is damaged in aGVHD hosts is poorly defined. To comprehensively address this question, we used a haplo-MHC-matched transplantation aGVHD murine model and performed single-cell RNA-Seq of nonhematopoietic BM cells. Transcriptional analysis showed that BM mesenchymal stromal cells (BMSCs) were severely affected, with a reduction in cell ratio, abnormal metabolism, compromised differentiation potential, and defective hematopoiesis-supportive function, all of which were validated by functional assays. We found that ruxolitinib, a selective JAK1/2 inhibitor, ameliorated aGVHD-related hematopoietic dysfunction through a direct effect on recipient BMSCs, resulting in improved proliferation ability, adipogenesis/osteogenesis potential, mitochondria metabolism capacity, and crosstalk with donor-derived hematopoietic stem/progenitor cells. By inhibiting the JAK2/STAT1 pathway, ruxolitinib maintained long-term improvement of aGVHD BMSC function. Additionally, ruxolitinib pretreatment in vitro primed BMSCs to better support donor-derived hematopoiesis in vivo. These observations in the murine model were validated in patient samples. Overall, our findings suggest that ruxolitinib can directly restore BMSC function via the JAK2/STAT1 pathway and, in turn, improve the hematopoietic dysfunction caused by aGVHD.

HFE
Also flagged:glucoseexocrine diseasesdigestionofpancreas-associated transcription factor 1aPtf1a
Journal Article 2023-08-01 ✓ 1 Snippet Rizk AA, Dybala MP, Rodriguez KC, Slak Rupnik M, Hara M.
In-Text Gene Mentions

…fibrosis (CF), andhemochromatosis( 19 ).…

Show Full Abstract

An increasing number of studies have demonstrated that disease states of the endocrine or exocrine pancreas aggravate one another, which implies bidirectional blood flow between islets and exocrine cells. However, this is inconsistent with the current model of unidirectional blood flow, which is strictly from islets to exocrine tissues. This conventional model was first proposed in 1932, and it has never to our knowledge been revisited to date. Here, large-scale image capture was used to examine the spatial relationship between islets and blood vessels in the following species: human, monkey, pig, rabbit, ferret, and mouse. While some arterioles passed by or traveled through islets, the majority of islets had no association with them. Islets with direct contact with the arteriole were significantly larger in size and fewer in number than those without contact. Unique to the pancreas, capillaries directly branched out from the arterioles and have been labeled as "small arterioles" in past studies. Overall, the arterioles emerged to feed the pancreas regionally, not specifically targeting individual islets. Vascularizing the pancreas in this way may allow an entire downstream region of islets and acinar cells to be simultaneously exposed to changes in the blood levels of glucose, hormones, and other circulating factors.

HTT
Also flagged:peptidescalcitoninpolypeptidecalciumosteoporosisPaget's disease of the
Journal Article 2023-08-01 ✓ 1 Snippet Chuang YP, Chang YP, Tu LH.
In-Text Gene Mentions

htt

Show Full Abstract

The irreversible aggregation of proteins or peptides greatly limits their bioavailability; therefore, effective inhibition using small molecules or biocompatible materials is very difficult. Human calcitonin (hCT), a hormone polypeptide with 32 residues, is secreted by the C-cells of the thyroid gland. The biological function of this hormone is to regulate calcium and phosphate concentrations in the blood via several different pathways. One of these is to inhibit the activity of osteoclasts; thus, calcitonin could be used to treat osteoporosis and Paget's disease of the bone. However, hCT is prone to aggregation in aqueous solution and forms amyloid fibrils. Salmon and eel calcitonin are currently used as clinical substitutes for hCT. In a previous study, we found that the replacement of two residues at positions 12 and 17 of hCT with amino acids that appear in the salmon sequence can greatly suppress peptide aggregation. The double mutations of hCT (DM hCT) also act as good inhibitors by disrupting wild-type hCT fibrillization, although the inhibition mechanism is not clear. More importantly, we demonstrated that DM hCT is biologically active in interacting with the calcitonin receptor. To further understand the inhibitory effect of DM hCT on hCT fibrillization, we created four relevant peptide fragments based on the DM hCT sequence. Our examination revealed that the formation of a helix of DM hCT was possibly a key component contributing to its inhibitory effect. This finding could help in the development of peptide-based inhibitors and in understanding the aggregation mechanism of hCT.

Also flagged:type 2 diabetesdiabetesCYTIPCDKN2Bmetabolic diseaseglucose
Journal Article 2023-08-01 No Snippets Christiansen CE, Arathimos R, Pain O, Molokhia M, Bell JT, Lewis CM.
Show Full Abstract

Type 2 diabetes (T2D) is a heterogeneous illness caused by genetic and environmental factors. Previous genome-wide association studies (GWAS) have identified many genetic variants associated with T2D and found evidence of differing genetic profiles by age-at-onset. This study seeks to explore further the genetic and environmental drivers of T2D by analyzing subgroups on the basis of age-at-onset of diabetes and body mass index (BMI). In the UK Biobank, 36 494 T2D cases were stratified into three subgroups, and GWAS was performed for all T2D cases and for each subgroup relative to 421 021 controls. Altogether, 18 single nucleotide polymorphisms were significantly associated with T2D genome-wide in one or more subgroups and also showed evidence of heterogeneity between the subgroups (Cochrane's Q P < 0.01), with two SNPs remaining significant after multiple testing (in CDKN2B and CYTIP). Combined risk scores, on the basis of genetic profile, BMI and age, resulted in excellent diabetes prediction [area under the ROC curve (AUC) = 0.92]. A modest improvement in prediction (AUC = 0.93) was seen when the contribution of genetic and environmental factors was evaluated separately for each subgroup. Increasing sample sizes of genetic studies enables us to stratify disease cases into subgroups, which have sufficient power to highlight areas of genetic heterogeneity. Despite some evidence that optimizing combined risk scores by subgroup improves prediction, larger sample sizes are likely needed for prediction when using a stratification approach.

HFE
Also flagged:Metabolic liver cancer-carbonmetabolismmethylationhepatocellular carcinomacancer
Journal Article 2023-08-01 ✓ 1 Snippet Antwi SO, Heckman M, White L, Yan I, Sarangi V, Lauer KP, Reddy J, Ahmed F, Veliginti S, Mejías Febres ED, Hatia RI, Chang P, Izquierdo-Sanchez L, Boix L, Rojas A, Banales JM, Reig M, Stål P, Gómez MR, Singal AG, Li D, Hassan MM, Roberts LR, Patel T.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Animal studies implicate one-carbon metabolism and DNA methylation genes in hepatocellular carcinoma (HCC) development in the setting of metabolic perturbations. Using human samples, we investigated the associations between common and rare variants in these closely related biochemical pathways and risk for metabolic HCC development in a multicenter international study. We performed targeted exome sequencing of 64 genes among 556 metabolic HCC cases and 643 cancer-free controls with metabolic conditions. Multivariable logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs), adjusting for multiple comparisons. Gene-burden tests were used for rare variant associations. Analyses were performed in the overall sample and among non-Hispanic whites. The results show that among non-Hispanic whites, presence of rare functional variants in ABCC2 was associated with 7-fold higher risk of metabolic HCC (OR = 6.92, 95% CI: 2.38-20.15, P = 0.0004), and this association remained significant when analyses were restricted to functional rare variants observed in ≥2 participants (cases 3.2% versus controls 0.0%, P = 1.02 × 10-5). In the overall multiethnic sample, presence of rare functional variants in ABCC2 was nominally associated with metabolic HCC (OR = 3.60, 95% CI: 1.52-8.58, P = 0.004), with similar nominal association when analyses were restricted to functional rare variants observed in ≥2 participants (cases 2.9% versus controls 0.2%, P = 0.006). A common variant in PNPLA3 (rs738409[G]) was associated with higher HCC risk in the overall sample (P = 6.36 × 10-6) and in non-Hispanic whites (P = 0.0002). Our findings indicate that rare functional variants in ABCC2 are associated with susceptibility to metabolic HCC in non-Hispanic whites. PNPLA3-rs738409 is also associated with metabolic HCC risk.

Also flagged:PERKneurodegenerative diseasescancerPKRendoplasmic reticulum (ER) kinaseprotein synthesis
Journal Article 2023-08-01 No Snippets Talukdar G, Orr HT, Lei Z.
Show Full Abstract

Protein kinase R (PKR)-like endoplasmic reticulum (ER) kinase (PERK) is one of the three major sensors in the unfolded protein response (UPR). The UPR is involved in the modulation of protein synthesis as an adaptive response. Prolonged PERK activity correlates with the development of diseases and the attenuation of disease severity. Thus, the current debate focuses on the role of the PERK signaling pathway either in accelerating or preventing diseases such as neurodegenerative diseases, myelin disorders, and tumor growth and cancer. In this review, we examine the current findings on the PERK signaling pathway and whether it is beneficial or detrimental for the above-mentioned disorders.

DCC
Also flagged:Amyloid precursor proteinAPPpathogenesisAlzheimer's diseaseADamyloid-β
Journal Article 2023-08-01 ✓ 1 Snippet Chau DD, Ng LL, Zhai Y, Lau KF.
In-Text Gene Mentions

…to complex withDCC, a well-known receptor…

Show Full Abstract

Amyloid precursor protein (APP) is a key molecule in the pathogenesis of Alzheimer's disease (AD) as the pathogenic amyloid-β peptide is derived from it. Two closely related APP family proteins (APPs) have also been identified in mammals. Current knowledge, including genetic analyses of gain- and loss-of-function mutants, highlights the importance of APPs in various physiological functions. Notably, APPs consist of multiple extracellular and intracellular protein-binding regions/domains. Protein-protein interactions are crucial for many cellular processes. In past decades, many APPs interactors have been identified which assist the revelation of the putative roles of APPs. Importantly, some of these interactors have been shown to influence several APPs-mediated neuronal processes which are found defective in AD and other neurodegenerative disorders. Studying APPs-interactor complexes would not only advance our understanding of the physiological roles of APPs but also provide further insights into the association of these processes to neurodegeneration, which may lead to the development of novel therapies. In this mini-review, we summarize the roles of APPs-interactor complexes in neurodevelopmental processes including neurogenesis, neurite outgrowth, axonal guidance and synaptogenesis.

Also flagged:transcription factorTox2Cas9PvalbSstVip
Journal Article 2023-08-01 No Snippets Gomez L, Cadilhac C, Prados J, Mule N, Jabaudon D, Dayer A.
Show Full Abstract

GABAergic interneurons are key regulators of cortical circuit function. Among the dozens of reported transcriptionally distinct subtypes of cortical interneurons, neurogliaform cells (NGCs) are unique: they are recruited by long-range excitatory inputs, are a source of slow cortical inhibition and are able to modulate the activity of large neuronal populations. Despite their functional relevance, the developmental emergence and diversity of NGCs remains unclear. Here, by combining single-cell transcriptomics, genetic fate mapping, and electrophysiological and morphological characterization, we reveal that discrete molecular subtypes of NGCs, with distinctive anatomical and molecular profiles, populate the mouse neocortex. Furthermore, we show that NGC subtypes emerge gradually through development, as incipient discriminant molecular signatures are apparent in preoptic area (POA)-born NGC precursors. By identifying NGC developmentally conserved transcriptional programs, we report that the transcription factor Tox2 constitutes an identity hallmark across NGC subtypes. Using CRISPR-Cas9-mediated genetic loss of function, we show that Tox2 is essential for NGC development: POA-born cells lacking Tox2 fail to differentiate into NGCs. Together, these results reveal that NGCs are born from a spatially restricted pool of Tox2+ POA precursors, after which intra-type diverging molecular programs are gradually acquired post-mitotically and result in functionally and molecularly discrete NGC cortical subtypes.

Also flagged:Congenital Heart Diseaseobesitydiabetesfolate deficiencyinfectionsrubella
Journal Article 2023-08-01 No Snippets Schwartz BN, Pearson GD, Burns KM.
Show Full Abstract

Congenital heart disease (CHD) is the most common birth defect in the United States. Neonates with CHD are often cared for by neonatologists in addition to cardiologists. However, there is a paucity of rigorous evidence and limited clinical trials regarding the management of neonates with CHD. In this review, we will describe some of the challenges of research in this field. The Pediatric Heart Network serves as an example of how a research network can effectively overcome barriers to conduct and execute well-designed multicenter studies.

DCC
Also flagged:Frazzled receptoraxonFraaxon guidanceNetrinRobo1
Journal Article 2023-08-01 ✓ 5 Snippets Zang Y, Bashaw GJ.
In-Text Gene Mentions

…The Netrin receptorDccand its Drosophila…

…of Fra andDcc, including Netrin and…

…its vertebrate homologDcc.…

Dccis a multifunctional…

Dccand its Drosophila…

Show Full Abstract

The Netrin receptor Dcc and its Drosophila homolog Frazzled play crucial roles in diverse developmental process, including axon guidance. In Drosophila, Fra regulates midline axon guidance through a Netrin-dependent and a Netrin-independent pathway. However, what molecules regulate these distinct signaling pathways remain unclear. To identify Fra-interacting proteins, we performed affinity purification mass spectrometry to establish a neuronal-specific Fra interactome. In addition to known interactors of Fra and Dcc, including Netrin and Robo1, our screen identified 85 candidate proteins, the majority of which are conserved in humans. Many of these proteins are expressed in the ventral nerve cord, and gene ontology, pathway analysis and biochemical validation identified several previously unreported pathways, including the receptor tyrosine phosphatase Lar, subunits of the COP9 signalosome and Rho-5, a regulator of the metalloprotease Tace. Finally, genetic analysis demonstrates that these genes regulate axon guidance and may define as yet unknown signaling mechanisms for Fra and its vertebrate homolog Dcc. Thus, the Fra interactome represents a resource to guide future functional studies.

Also flagged:CDKN2Abrain metastasesSeizuresMelanomaBMoncogenes
Journal Article 2023-08-01 No Snippets Cummins DD, Garcia JH, Nguyen MP, Saggi S, Chung JE, Goldschmidt E, Berger MS, Theodosopoulos PV, Chang EF, Daras M, Hervey-Jumper SL, Aghi MK, Morshed RA.
Show Full Abstract

<h4>Objective</h4>Seizures are common and significantly disabling for patients with brain metastases (BMs). Although resection can provide seizure control, a subset of patients with BMs may continue to suffer seizures postoperatively. Genomic BM characteristics may influence which patients are at risk for postoperative seizures. This work explores correlations between genomic alterations and risk of postoperative seizures following BM resection.<h4>Methods</h4>All patients underwent BM resection at a single institution, with available clinical and sequencing data on more than 500 oncogenes. Clinical seizures were documented pre- and postoperatively. A random forest machine learning classification was used to determine candidate genomic alterations associated with postoperative seizures, and clinical and top genomic variables were correlated with postoperative seizures by using Cox proportional hazards models.<h4>Results</h4>There were 112 patients with BMs who underwent 114 surgeries and had at least 1 month of postoperative follow-up. Seizures occurred preoperatively in 26 (22.8%) patients and postoperatively in 25 (21.9%). The Engel classification achieved at 6 months for those with preoperative seizures was class I in 13 (50%); class II in 6 (23.1%); class III in 5 (19.2%), and class IV in 2 (7.7%). In those with postoperative seizures, only 8 (32.0%) had seizures preoperatively, and preoperative seizures were not a significant predictor of postoperative seizures (HR 1.84; 95% CI 0.79-4.37; p = 0.156). On random forest classification and multivariate Cox analysis controlling for factors including recurrence, extent of resection, and number of BMs, CDKN2A alterations were associated with postoperative seizures (HR 3.22; 95% CI 1.27-8.16; p = 0.014). Melanoma BMs were associated with higher risk of postoperative seizures compared with all other primary malignancies (HR 5.23; 95% CI 1.37-19.98; p = 0.016). Of 39 BMs with CDKN2A alteration, 35.9% (14/39) had postoperative seizures, compared to 14.7% (11/75) without CDKN2A alteration. The overall rate of postoperative seizures in melanoma BMs was 42.9% (15/35), compared with 12.7% (10/79) for all other primary malignancies.<h4>Conclusions</h4>CDKN2A alterations and melanoma primary malignancy are associated with increased postoperative seizure risk following resection of BMs. These results may help guide postoperative seizure prophylaxis in patients undergoing resection of BMs.

TNFSF4
Also flagged:breast carcinomas
Journal Article 2023-08-01 ✓ 1 Snippet Li K, Ma L, Sun Y, Li X, Ren H, Tang SC, Sun X.
In-Text Gene Mentions

…The immunotherapy candidateTNFSF4may help the…

Show Full Abstract

No abstract available.

DCC
Also flagged:Extrahepatic Cholangiocarcinomacolorectal carcinomaextrahepatic cholangiocarcinomasperihilar cholangiocarcinomadistal cholangiocarcinomatumor
Journal Article 2023-08-01 ✓ 4 Snippets Yoshida Y, Nakanishi Y, Mitsuhashi T, Yamamoto H, Hayashi MO, Oba M, Nitta T, Ueno T, Yamada T, Ono M, Kuwabara S, Hatanaka Y, Hirano S.
In-Text Gene Mentions

The association between DR categories and the distribution of fibroblasts with anti-α-smooth muscle actin (SMA) expression, seeming to be tumor-promoting cancer-associated fibroblasts (CAFs), was evaluated in 191 tissue microarray specimens of EHCCs.<h4>Results</h4>Intermediate/immature DR categories were significantly associated with a more invasive nature, including higher pT and pN stages and more tumor buds than the mature category in both PHCC and DCC.

…both PHCC andDCC.…

…both PHCC andDCCpatients.…

…both PHCC andDCC(p < 0.001).…

Show Full Abstract

<h4>Background</h4>Recent studies have demonstrated the importance of desmoplastic reaction (DR) in predicting postoperative prognosis for patients with colorectal carcinoma. However, the impact of DR on the prognosis of extrahepatic cholangiocarcinomas (EHCCs) is not established. This study aimed to clarify the associations of pathologic DR categories with clinicopathologic factors and postoperative prognosis of perihilar cholangiocarcinoma (PHCC) and distal cholangiocarcinoma (DCC).<h4>Methods</h4>A pathologic review of 174 patients with PHCC and 109 patients with DCC who underwent surgical resection was performed. The patients were classified into three DR categories (immature, intermediate, and mature) based on the histologic features within the fibrotic stroma in the invasive front. The association between DR categories and the distribution of fibroblasts with anti-α-smooth muscle actin (SMA) expression, seeming to be tumor-promoting cancer-associated fibroblasts (CAFs), was evaluated in 191 tissue microarray specimens of EHCCs.<h4>Results</h4>Intermediate/immature DR categories were significantly associated with a more invasive nature, including higher pT and pN stages and more tumor buds than the mature category in both PHCC and DCC. The DR categories could stratify overall survival (OS) and relapse-free survival (RFS) in both PHCC and DCC patients. In the multivariate analysis, the DR category was an independent prognostic factor for OS and RFS in both PHCC and DCC (p < 0.001). The mature and immature DR categories were significantly associated respectively with the confined and pervasive distribution of fibroblasts with α-SMA expression.<h4>Conclusion</h4>In patients with EHCCs, DR categorization was an independent prognostic factor reflecting the distribution of tumor-promoting CAFs in the invasive front.

Also flagged:irritable bowel syndromepsychiatric disordersgastrointestinal disordersIBSsomatic disordersgastrointestinal diseases
Journal Article 2023-08-01 No Snippets Tesfaye M, Jaholkowski P, Hindley GFL, Shadrin AA, Rahman Z, Bahrami S, Lin A, Holen B, Parker N, Cheng W, Rødevand L, Frei O, Djurovic S, Dale AM, Smeland OB, O'Connell KS, Andreassen OA.
Show Full Abstract

<h4>Background</h4>Irritable bowel syndrome (IBS) often co-occurs with psychiatric and gastrointestinal disorders. A recent genome-wide association study (GWAS) identified several genetic risk variants for IBS. However, most of the heritability remains unidentified, and the genetic overlap with psychiatric and somatic disorders is not quantified beyond genome-wide genetic correlations. Here, we characterize the genetic architecture of IBS, further, investigate its genetic overlap with psychiatric and gastrointestinal phenotypes, and identify novel genomic risk loci.<h4>Methods</h4>Using GWAS summary statistics of IBS (53,400 cases and 433,201 controls), and psychiatric and gastrointestinal phenotypes, we performed bivariate casual mixture model analysis to characterize the genetic architecture and genetic overlap between these phenotypes. We leveraged identified genetic overlap to boost the discovery of genomic loci associated with IBS, and to identify specific shared loci associated with both IBS and psychiatric and gastrointestinal phenotypes, using the conditional/conjunctional false discovery rate (condFDR/conjFDR) framework. We used functional mapping and gene annotation (FUMA) for functional analyses.<h4>Results</h4>IBS was highly polygenic with 12k trait-influencing variants. We found extensive polygenic overlap between IBS and psychiatric disorders and to a lesser extent with gastrointestinal diseases. We identified 132 independent IBS-associated loci (condFDR < 0.05) by conditioning on psychiatric disorders (n = 127) and gastrointestinal diseases (n = 24). Using conjFDR, 70 unique loci were shared between IBS and psychiatric disorders. Functional analyses of shared loci revealed enrichment for biological pathways of the nervous and immune systems. Genetic correlations and shared loci between psychiatric disorders and IBS subtypes were different.<h4>Conclusions</h4>We found extensive polygenic overlap of IBS and psychiatric and gastrointestinal phenotypes beyond what was revealed with genetic correlations. Leveraging the overlap, we discovered genetic loci associated with IBS which implicate a wide range of biological pathways beyond the gut-brain axis. Genetic differences may underlie the clinical subtype of IBS. These results increase our understanding of the pathophysiology of IBS which may form the basis for the development of individualized interventions.

HTT
Also flagged:primary congenital glaucomaOPTNglaucomaMyocilinMYOCCytochrome P450 family 1 subfamily B member 1
Journal Article 2023-08-01 ✓ 3 Snippets Yadav M, Yadav A, Bhardwaj A, Dhull CS, Sachdeva S, Yadav R, Tanwar M.
In-Text Gene Mentions

…Rab8, myosin VI,htt, TBC1D17 in various…

…Optineurin colocalizes withhttin the Golgi…

…VI, Rab8, andhtt,[ 45 ] which…

Show Full Abstract

<h4>Purpose</h4>This study focused on the genetic screening of Myocilin (MYOC), Cytochrome P450 family 1 subfamily B member 1 (CYP1B1), Optineurin (OPTN), and SIX homeobox 6 (SIX6) genes in a family with coexistence of primary congenital glaucoma (PCG) and juvenile open-angle glaucoma (JOAG).<h4>Methods</h4>Sanger sequencing was used to examine the coding region of all four genes. Six different online available algorithms were used for the pathogenicity prediction of missense variant. Structural analysis was done using Garnier-Osguthorpe-Robson (GOR), PyMol, ChimeraX, and Molecular Dynamic (MD) Simulations (using Graphics Processing Unit (GPU)-enabled Desmond module of Schrödinger).<h4>Results</h4>There were a total of three sequence variants within the family. All seven algorithms determined that a single mutation, G538E, in the OPTN gene is pathogenic. The loops connecting the strands became more flexible, as predicted structurally and functionally by pathogenic mutations. Mutations create perturbations and conformational rearrangements in proteins, hence impairing their functioning.<h4>Conclusion</h4>In this study, we describe a North Indian family in which members were having JOAG and PCG due to a rare homozygous/heterozygous mutation in OPTN. The coexistence of two types of glaucoma within a single pedigree suggests that certain OPTN mutations may be responsible for the onset of different glaucoma phenotypes.

DCC
Also flagged:Tryptophanmetabolismtype 1 diabetesinsulinHLA class IHLA-I
Journal Article 2023-08-01 ✓ 1 Snippet Rachdi L, Zhou Z, Berthault C, Lourenço C, Fouque A, Domet T, Armanet M, You S, Peakman M, Mallone R, Scharfmann R.
In-Text Gene Mentions

…through DOPA decarboxylase (DCC), an enzyme expressed…

Show Full Abstract

<h4>Background</h4>To resist the autoimmune attack characteristic of type 1 diabetes, insulin producing pancreatic β cells need to evade T-cell recognition. Such escape mechanisms may be conferred by low HLA class I (HLA-I) expression and upregulation of immune inhibitory molecules such as Programmed cell Death Ligand 1 (PD-L1).<h4>Methods</h4>The expression of PD-L1, HLA-I and CXCL10 was evaluated in the human β cell line, ECN90, and in primary human and mouse pancreatic islets. Most genes were determined by real-time RT-PCR, flow cytometry and Western blot. Activator and inhibitor of the AKT signaling were used to modulate PD-L1 induction. Key results were validated by monitoring activity of CD8+ Jurkat T cells presenting β cell specific T-cell receptor and transduced with reporter genes in contact culture with the human β cell line, ECN90.<h4>Findings</h4>In this study, we identify tryptophan (TRP) as an agonist of PD-L1 induction through the AKT signaling pathway. TRP also synergistically enhanced PD-L1 expression on β cells exposed to interferon-γ. Conversely, interferon-γ-mediated induction of HLA-I and CXCL10 genes was down-regulated upon TRP treatment. Finally, TRP and its derivatives inhibited the activation of islet-reactive CD8+ T cells by β cells.<h4>Interpretation</h4>Collectively, our findings indicate that TRP could induce immune tolerance to β cells by promoting their immune evasion through HLA-I downregulation and PD-L1 upregulation.<h4>Funding</h4>Dutch Diabetes Research Foundation, DON Foundation, the Laboratoire d'Excellence consortium Revive (ANR-10-LABX-0073), Agence Nationale de la Recherche (ANR-19-CE15-0014-01), Fondation pour la Recherche Médicale (EQ U201903007793-EQU20193007831), Innovative Medicines InitiativeINNODIA and INNODIA HARVEST, Aides aux Jeunes Diabetiques (AJD) and Juvenile Diabetes Research Foundation Ltd (JDRF).

Also flagged:Agingpeptideinfectionsinfectious diseasescancerautoimmune diseases
Journal Article 2023-08-01 No Snippets Kurioka A, Klenerman P.
Show Full Abstract

Unconventional T cells include γδ T cells, invariant Natural Killer T cells (iNKT) cells and Mucosal Associated Invariant T (MAIT) cells, which are distinguished from conventional T cells by their recognition of non-peptide ligands presented by non-polymorphic antigen presenting molecules and rapid effector functions that are pre-programmed during their development. Here we review current knowledge of the effect of age on unconventional T cells, from early life to old age, in both mice and humans. We then discuss the role of unconventional T cells in age-associated diseases and infections, highlighting the similarities between members of the unconventional T cell family in the context of aging.

SOX6
Also flagged:translationalCircadiantissue homeostasiscircadian rhythmosteoarthritismechano‐sensing
Journal Article 2023-08-01 ✓ 1 Snippet Dintwa L, Hughes CE, Blain EJ.
In-Text Gene Mentions

…rhythmic expression ofSox6, Sox9 ,…

Show Full Abstract

The circadian clock, a collection of endogenous cellular oscillators with an approximate 24-h cycle, involves autoregulatory transcriptional/translational feedback loops to enable synchronization within the body. Circadian rhythmicity is controlled by a master clock situated in the hypothalamus; however, peripheral tissues are also under the control of autonomous clocks which are coordinated by the master clock to regulate physiological processes. Although light is the primary signal required to entrain the body to the external day, non-photic zeitgeber including exercise also entrains circadian rhythmicity. Cellular mechano-sensing is imperative for functionality of physiological systems including musculoskeletal tissues. Over the last decade, mechano-regulation of circadian rhythmicity in skeletal muscle, intervertebral disc, and bone has been demonstrated to impact tissue homeostasis. In contrast, few publications exist characterizing the influence of mechanical loading on the circadian rhythm in articular cartilage, a musculoskeletal tissue in which loading is imperative for function; importantly, a dysregulated cartilage clock contributes to development of osteoarthritis. Hence, this review summarizes the literature on mechano-regulation of circadian clocks in musculoskeletal tissues and infers on their collective importance in understanding the circadian clock and its synchronicity for articular cartilage mechanobiology.

CACNA1E
Also flagged:neurodevelopmental disordersmitochondrialneurodevelopment disordersintellectual disabilitydevelopmental delayautism spectrum disorder
Journal Article 2023-08-01 ✓ 1 Snippet Sanchis-Juan A, Megy K, Stephens J, Armirola Ricaurte C, Dewhurst E, Low K, French CE, Grozeva D, Stirrups K, Erwood M, McTague A, Penkett CJ, Shamardina O, Tuna S, Daugherty LC, Gleadall N, Duarte ST, Hedrera-Fernández A, Vogt J, Ambegaonkar G, Chitre M, Josifova D, Kurian MA, Parker A, Rankin J, Reid E, Wakeling E, Wassmer E, Woods CG, NIHR BioResource, Raymond FL, Carss KJ.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Despite significant progress in unraveling the genetic causes of neurodevelopmental disorders (NDDs), a substantial proportion of individuals with NDDs remain without a genetic diagnosis after microarray and/or exome sequencing. Here, we aimed to assess the power of short-read genome sequencing (GS), complemented with long-read GS, to identify causal variants in participants with NDD from the National Institute for Health and Care Research (NIHR) BioResource project. Short-read GS was conducted on 692 individuals (489 affected and 203 unaffected relatives) from 465 families. Additionally, long-read GS was performed on five affected individuals who had structural variants (SVs) in technically challenging regions, had complex SVs, or required distal variant phasing. Causal variants were identified in 36% of affected individuals (177/489), and a further 23% (112/489) had a variant of uncertain significance after multiple rounds of re-analysis. Among all reported variants, 88% (333/380) were coding nuclear SNVs or insertions and deletions (indels), and the remainder were SVs, non-coding variants, and mitochondrial variants. Furthermore, long-read GS facilitated the resolution of challenging SVs and invalidated variants of difficult interpretation from short-read GS. This study demonstrates the value of short-read GS, complemented with long-read GS, in investigating the genetic causes of NDDs. GS provides a comprehensive and unbiased method of identifying all types of variants throughout the nuclear and mitochondrial genomes in individuals with NDD.

TNFSF4
Also flagged:clear-cell renal cell carcinomaccRCCrenal cell carcinomaRCCEndoplasmic reticulumtumor
Journal Article 2023-08-01 ✓ 2 Snippets Lian M, Feng Y, Wu Z, Zheng Z, Liu H, Li J, Yu H, Lian C.
In-Text Gene Mentions

…– 26 ]TNFSF4, CD244, CD40LG, CD48,…

…BTLA, TNFRSF14, LAIR1,TNFSF4, CD244, LAG3, ICOS,…

Show Full Abstract

Clear-cell renal cell carcinoma (ccRCC) is the most common subtype of renal cell carcinoma (RCC), which exhibits great variability in the prognosis of patients. Endoplasmic reticulum stress (ERS) is a persistent state triggered by disruption of endoplasmic reticulum (ER) homeostasis, which has been shown to control multiple pro-tumor-associated pathways in malignant cells while dynamically reprogramming immune cell function. This study aimed to identify ERS-related genetic risk signatures (ERSGRS) to ameliorate survival prediction in ccRCC patients. In this study, we adopted differentially expressed genes (DEGs) from the Cancer Genome Atlas (TCGA) and constructed ERSGRS with independent prognostic significance by least absolute shrinkage and selection operator (LASSO) regression. After separation of patients based on risk score, survival analysis showed that low-risk patients had longer overall survival (OS) than high-risk patients, and receiver operating characteristic (ROC) curve analysis confirmed the strong predictive ability of ERSGRS. Meanwhile, the tumor microenvironment (TME) of the high-risk group demonstrated an immunosuppressive phenotype, with more infiltration of regulatory T cells (Tregs) and macrophages. The TME in the low-risk group had a stronger potential for anti-tumor immunity. Overall, the ERSGRS could be a valuable predictive tool for ccRCC prognosis.

HFE
Also flagged:pigmentary disordersLaugier-Hunziker syndromemelasmamelanonychiaoral infectionsystemic diseases
Journal Article 2023-08-01 ✓ 1 Snippet Lee J, Lee JS, Park SM, Shin K, Ko HC, Kim BS, Kim MB, Kim HS.
In-Text Gene Mentions

…cious anemia, hyperinsulinism,hemochromatosis, scleroderma, lichen planus,…

Show Full Abstract

<h4>Background</h4>Pigmented fungiform papillae of the tongue (PFPT) is a rare benign pigmentary disorder of the tongue. In dark-skinned individuals, PFPT appears to be relatively common. However, limited data exist on PFPT in Korean patients.<h4>Objective</h4>We aimed to investigate the clinical characteristics of PFPT in Korean patients.<h4>Methods</h4>Patients diagnosed with PFPT between 1995 and 2021 at the Pusan National University Hospital were included. Clinical characteristics of PFPT, dermoscopic findings, and comorbidities were reviewed.<h4>Results</h4>A total of 19 patients diagnosed with PFPT were enrolled. The male to female ratio was approximately 1:5. The mean age at diagnosis was 41.1 years (range, 8~67 years). According to Holzwanger's classification, Type I was the most common (89.5%). PFPT was commonly concomitant with pigmentary disorders, including mucosal melanotic macules, Laugier-Hunziker syndrome, melasma, and melanonychia (6/19, 31.6%). Preceding oral infection or inflammatory lesions were found in four patients (21.1%), and systemic diseases and infectious diseases existed in two patients (10.5%). Dermoscopic examination was performed in seven patients; pigmented border with dichotomized vessels (rose petal pattern, 71.4%) and diffuse pigmentation (cobblestone pattern, 71.4%) were common findings.<h4>Conclusion</h4>Our study shows PFPT can coexist with pigmentary disorders. Concomitant pigmentary disorder shows an association with sex hormone or susceptibility to abnormal pigmentation may be a possible cause of PFPT.

HTT
Also flagged:serotonindepressionbiosynthesistryptophan hydroxylasesynapsesserotonin transporter
Journal Article 2023-08-01 ✓ 3 Snippets Fan Y, Yang Y, Shi L, Zhao W, Kong F, Gong P.
In-Text Gene Mentions

…transporter gene (5-HTT) are related…

…and 5-HTTVNTR of5-HTTare related to…

…of 5-HTTLPR in5-HTTand the −1019C/G…

Show Full Abstract

Serotonin influences mental health and well-being. To understand the influences of genetic variations in serotonin pathway on well-being, we examined the effects of seven serotonergic polymorphisms on subjective well-being (i.e. affective balance and global life satisfaction) and psychological well-being (i.e. optimal psychological functions in the face of existential challenges) in a larger sample. Results indicated that the cumulative genetic score, but single genetic effects of serotonergic polymorphisms, was related to individual differences in well-being. Specifically, individuals with a greater cumulative genetic score, which is related to a low risk of depression, tended to exhibit high levels of subjective well-being and psychological well-being. These findings suggest that the overall serotoninergic genetic profile, rather than a specific genetic polymorphism, could greatly influence the individual differences in well-being.

HFE
Also flagged:Hepatocellular CarcinomaNoncirrhosisChronic Hepatitis Cliver diseaseinfectionantibody
Journal Article 2023-08-01 ✓ 1 Snippet Hsu CC, Gopalakrishna H, Mironova M, Lee MH, Chen CJ, Yang HI, Wiese M, Chang KM, Wright EC, Abijo T, Feld JJ, Kaplan DE.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

In a hepatitis C virus (HCV)-controlled human infection model (CHIM), healthy volunteers are inoculated with HCV and then treated. Residual hepatocellular carcinoma (HCC) risk after viral clearance is an important consideration when evaluating the CHIM. We estimate HCC risk in spontaneously cleared HCV and in noncirrhosis after sustained virological response (SVR) to HCV treatment in a systematic review and using data from 3 cohorts: German anti-D, Taiwan, and US Veterans Affairs (VA). For noncirrhosis SVR, the overall HCC rate is 0.33 per 100 patient-years in meta-analysis. HCC rates for the German, Taiwan, and US Veterans Affairs cohorts are 0, 0.14, and 0.02 per 100 patient-years, respectively. Past hepatitis B virus exposure was not accounted for in the Taiwan cohort, while VA patients were likely tested based on liver disease/risk factors, which may confound HCC outcomes. The German cohort with no HCC after 44 years is most comparable to the CHIM participants. Although it is difficult to precisely estimate HCC risk from an HCV CHIM, the data suggest the risk to be very low or negligible.

LRRC7
Also flagged:chromosomeSmc5Rad50transfertransductionconjugation
Journal Article 2023-08-01 ✓ 1 Snippet Liu HW, Roisné-Hamelin F, Gruber S.
In-Text Gene Mentions

…three SMC complexes:Condensinis important for…

Show Full Abstract

SMC and SMC-like complexes promote chromosome folding and genome maintenance in all domains of life. Recently, they were also recognized as factors in cellular immunity against foreign DNA. In bacteria and archaea, Wadjet and Lamassu are anti-plasmid/phage defence systems, while Smc5/6 and Rad50 complexes play a role in anti-viral immunity in humans. This raises an intriguing paradox - how can the same, or closely related, complexes on one hand secure the integrity and maintenance of chromosomal DNA, while on the other recognize and restrict extrachromosomal DNA? In this minireview, we will briefly describe the latest understanding of each of these complexes in immunity including speculations on how principles of SMC(-like) function may explain how the systems recognize linear or circular forms of invading DNA.

Also flagged:autophagyorganellesUbiquitinationubiquitinautophagosomesvesicles
Journal Article 2023-08-01 No Snippets Cen X, Li Z, Chen X.
Show Full Abstract

Autophagy, an efficient and effective approach to clear rapidly damaged organelles, macromolecules, and other harmful cellular components, enables the recycling of nutrient materials and supply of nutrients to maintain cellular homeostasis. Ubiquitination plays an important regulatory role in autophagy. This paper summarizes the most recent progress in ubiquitin modification in various stages of autophagy, including initiation, elongation, and termination. Moreover, this paper shows that ubiquitination is an important way through which selective autophagy achieves substrate specificity. Furthermore, we note the distinction between monoubiquitination and polyubiquitination in the regulation of autophagy. Compared with monoubiquitination, polyubiquitination is a more common strategy to regulate the activity of the autophagy molecular machinery. In addition, the role of ubiquitination in the closure and fusion of autophagosomes warrants further study. This article not only clarifies the regulatory mechanism of autophagy but also contributes to a deeper understanding of the importance of ubiquitination modification.

HTT
Also flagged:alcoholAlcoholismaddictionethanolfetal alcohol syndromeAlcohol Abuse
Journal Article 2023-08-01 ✓ 1 Snippet Mendes PFS, Baia-da-Silva DC, Melo WWP, Bittencourt LO, Souza-Rodrigues RD, Fernandes LMP, Maia CDSF, Lima RR.
In-Text Gene Mentions

Evaluated the genetic variation of the serotonin transporter (5-HTT) and its association with susceptibility to the neurotoxic effects of chronic excessive alcohol consumption

Show Full Abstract

Alcohol consumption is common in many societies and has increased considerably, resulting in many socioeconomic and public health problems. In this sense, studies have been carried out in order to understand the mechanisms involved in alcohol consumption and related harmful effects. This study aimed to identify and map the knowledge and to perform bibliometric analysis of the neurotoxicology of alcohol based on the 100 most cited articles. A search was carried out in the Web of Science Core Collection database and information was extracted regarding the journal, authors, keywords, year of publication, number of citations, country and continent of the corresponding author. For each selected manuscript, the study design, alcohol exposure model, dose, period of exposure, and effect on the central nervous system and research hotspots were mapped. The journal with the highest number of publications was Alcoholism: Clinical and Experimental Research (n = 11 papers), the author who contributed the most was Crews FT (n = 8 papers), the studies had a total of 288 keywords and 75% of the publications were from the United States of America. The experimental studies evaluated the effects of prenatal and postnatal exposure and were conducted in rats and mice using doses ranging from 2.5 to 14 g/kg/day, with administration by subcutaneous, intraperitoneal, intragastric, or inhalation route or with free access through drinking bottles. Among the studies mapped, the oldest one (1989) aimed to understand the systemic damage and mechanisms of action involved, while the most recent focused on understanding the receptors and mechanisms involved in addiction, as well as genetic factors. Our results show the panorama of the most widespread scientific production in the scientific community on the neurotoxicology of ethanol, a high prevalence was observed in studies that addressed fetal alcohol syndrome and/or the effects of ethanol on neurodevelopment.

Also flagged:2-hydroxyethyl methacrylateSiliconecalciummagnesiumphosphorustumors
Journal Article 2023-08-01 No Snippets Wu YX, Choi EJ, Vu AA, Jiang P, Ali SN, Patel RM, Landman J, Clayman RV.
Show Full Abstract

Ureteral stent encrustation significantly limits indwelling time and can lead to downstream urological problems. However, no ideal polymeric biomaterials have been shown to completely resist encrustation in long-term urine exposure. Recently, 2-hydroxyethyl methacrylate (HEMA)-coated Pellethane was reported as a promising biomaterial resistant to encrustation. This study compared HEMA-coated Pellethane to commercially available stents under two different artificial urine environments. To evaluate the degree and composition of encrustation on HEMA-coated Pellethane, Boston Scientific Tria, Bard InLay Optima, Cook Universa Hydrogel, and Cook Black Silicone stents were used at various dwelling times in two different artificial urine environments. In a batch-flow model, samples of stents were suspended in an artificial urine solution (AUS) at 37 °C. Every 24 h for 11 weeks, 50% of the AUS would be replaced with fresh components using a programmable peristaltic pump system. The stent materials were removed at suitable time intervals and air-dried for 24 h under sterile conditions before follow-up analysis. SEM was used to assess the degree of encrustation, and inductively coupled plasma mass spectrometry (ICP-MS) was employed to quantify the encrusted compositions, specifically for calcium, magnesium, and phosphorus. We measured the weight gain over time due to encrusted deposits on the stents and quantified the amount of Ca, Mg, and P deposited on each encrusted stent. After the 11 week trial, HEMA-coated Pellethane showed the most average mass change. SEM showed that HEMA-coated Pellethane was fully encrusted in just 2 weeks in the AUS environments, and ICP-MS showed that Ca is the most abundant deposit. Among all the tested stents, Black Silicone performed the best. The two AUSs were formulated to encrust more rapidly than physiological conditions. HEMA-coated Pellethane is not an ideal stent material, while silicone is a promising material for advancing ureteral stents.

HFE
Also flagged:phosphatase and tensin homologautophagynon-alcoholic steatohepatitisNASHinsulinrelated
Journal Article 2023-08-01 ✓ 1 Snippet Lu MM, Ren Y, Zhou YW, Xu LL, Zhang MM, Ding LP, Cheng WX, Jin X.
In-Text Gene Mentions

…ncluding autoimmune hepatitis,hemochromatosis, Wilson’s disease[ 1…

Show Full Abstract

<h4>Background</h4>Obesity plays a vital role in the occurrence and development of non-alcoholic steatohepatitis (NASH). However, the underlining mechanism is still unclear, where adipose tissue (AT) derived exosomes may actively participate. MicroRNAs (miRNAs) are commonly secreted from exosomes for cell communication. Though the regulation of miR-103 on insulin sensitivity has been reported, the specific role of AT-derived exosomes miR-103 in NASH is still vague and further investigation may provide novel therapeutic choices.<h4>Aim</h4>To determine the specific role of AT-derived exosomes miR-103 in developing NASH through various methods.<h4>Methods</h4>The expression levels of miR-103 in the AT-derived exosomes and livers were detected and compared between NASH mice and control. The effect of miR-103 on NASH progression was also explored by antagonizing miR-103, including steatosis and inflammation degree changes. The interaction between miR-103 and the autophagy-related gene phosphatase and tensin homolog (PTEN) was confirmed by dual-luciferase reporter assay. The role of the interaction between miR-103 and PTEN on autophagy was verified in NASH-like cells. Finally, the effects of miR-103 from adipose-derived exosomes on NASH and autophagy were analyzed through animal experiments.<h4>Results</h4>The expression of miR-103 was increased in NASH mice, compared to the control, and inhibition of miR-103 could alleviate NASH. The results of the dual-luciferase reporter assay showed miR-103 could interact with PTEN. MiR-103-anta decreased p-AMPKa, p-mammalian target of rapamycin (mTOR), and p62 but increased the protein levels of PTEN and LC3-II/I and the number of autophagosomes in NASH mice. Similar results were also observed in NASH-like cells, and further experiments showed PTEN silencing inhibited the effect of miR-103-anta. AT derived-exosome miR-103 aggravated NASH and increased the expressions of p-AMPKa, p-mTOR, and p62 but decreased the protein levels of PTEN and LC3-II/I and the number of autophagosomes in mice.<h4>Conclusion</h4>AT derived-exosome increased the levels of miR-103 in the liver, and miR-103 aggravated NASH. Mechanically, miR-103 could interact with PTEN and inhibit autophagy.

Also flagged:Pancreatic ductal adenocarcinomaPDACcancergemcitabine5-fluorouracilleucovorin
Journal Article 2023-08-01 No Snippets Zhu Z, Tang H, Ying J, Cheng Y, Wang X, Wang Y, Bai C.
Show Full Abstract

<h4>Objective</h4>Gemcitabine plus nab-paclitaxel (GnP) is the standard first-line therapy for advanced pancreatic ductal adenocarcinoma (PDAC). S-1, an oral fluoropyrimidine derivative, as compared with gemcitabine, is non-inferior in terms of overall survival (OS) and is associated with lower hematologic toxicity. Accordingly, S-1 is a convenient oral alternative treatment for advanced PDAC. This study was aimed at comparing the efficacy and safety of gemcitabine plus S-1 (GS) <i>vs.</i> GnP as first-line chemotherapy for advanced PDAC.<h4>Methods</h4>Patients with advanced PDAC who received first-line GS or GnP at the Peking Union Medical College Hospital between March 2011 and November 2022 were evaluated.<h4>Results</h4>A total of 300 patients were assessed, of whom 84 received GS and 216 received GnP. The chemotherapy completion rate was higher with GS than GnP (50.0% <i>vs.</i> 30.3%, <i>P</i> = 0.0028). The objective response rate (ORR) was slightly higher (14.3% <i>vs.</i> 9.7%, <i>P</i> = 0.35), and the median OS was significantly longer (17.9 months <i>vs.</i> 13.3 months, <i>P</i> = 0.0078), in the GS group than the GnP group. However, the median progression-free survival (PFS) did not significantly differ between groups. Leukopenia risk was significantly lower in the GS group than the GnP group (14.9% <i>vs.</i> 28.1%, <i>P</i> = 0.049).<h4>Conclusions</h4>As first-line chemotherapy for advanced PDAC, the GS regimen led to a significantly longer OS than the GnP regimen. The PFS, ORR, and incidence of severe adverse events were comparable between the GS and GnP groups.

TNFSF4
Also flagged:Cuproptosisdeathmitochondrialmetabolic enzymestumorshepatocellular carcinoma
Journal Article 2023-08-01 ✓ 1 Snippet Peng H, Zou Z, Xiang Z, Lu X, Zhang Y, Peng X.
In-Text Gene Mentions

…HAVCR2, CD80, TNFRSF18,TNFSF4, TNFRSF4, CD200, TNFRSF9,…

Show Full Abstract

Cuproptosis, an unusual type of programmed cell death mechanism of cell death, involved the disruption of specific mitochondrial metabolic enzymes in the occurrence and development of tumors. However, it was still unclear how the relationship between cuproptosis-related genes (CRGs) may contribute to hepatocellular carcinoma (HCC) potential the prognosis of HCC remained limited. Here, the landscape of 14 CRGs in HCC was evaluated using the Cancer Genome Atlas and International Cancer Genome Consortium datasets. And then, 4 CRGs (ATP7A, MTF1, GLS, and CDKN2A) were screened for the construction of risk signatures for prognosis and drug therapy. The HCC patients with CRGs high-risk showed poor prognosis than those with low risk. Moreover, the CRGs risk signature was shown to be an independent prognostic factor and associated with the immune microenvironment in HCC. Meanwhile, we constructed and verified a prognostic model based on cuproptosis-related lncRNAs (Cr-lncRNAs). We obtained 291 Cr-lncRNAs and constructed Cr-lncRNA prognosis signature based on 3 key Cr-lncRNAs (AC026356.1, NRAV, AL031985.3). The Cr-lncRNA prognosis signature was also an independent prognostic factor and associated with the immune microenvironment in HCC. Finally, the drug sensitivity database showed that 8 candidate drugs related to CRGs signature and Cr-lncRNAs signature. In summary, we evaluated and validated the CRGs and Cr-lncRNAs as potential predictive markers for prognosis, immunotherapy, and drug candidate with the personalized diagnosis and treatment of HCC.

HFE
Also flagged:Coronavirus disease 2019COVID-19Remdesivirpneumoniaantibodiesinfection
Journal Article 2023-08-01 ✓ 1 Snippet Tanaka T, Tashiro M, Ota K, Fujita A, Sawai T, Kadota J, Fukuda Y, Sumiyoshi M, Ide S, Tachikawa N, Fujii H, Hibino M, Shiomi H, Izumida M, Matsui K, Yamauchi M, Takahashi K, Yamanashi H, Sugimoto T, Akabame S, Umeda M, Shimizu M, Hosogaya N, Kosai K, Takeda K, Iwanaga N, Ashizawa N, Hirayama T, Takazono T, Yamamoto K, Imamura Y, Miyazaki T, Kobayashi Y, Ariyoshi K, Mukae H, Yanagihara K, Kita K, Izumikawa K.
In-Text Gene Mentions

…History of porphyria,hemochromatosis, or viral hepatitis;…

Show Full Abstract

<h4>Background</h4>5-aminolevulinic acid (5-ALA), a natural amino acid that is marketed alongside sodium ferrous citrate (SFC) as a functional food, blocks severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) proliferation in vitro and exerts anti-inflammatory effects. In this phase II open-label, prospective, parallel-group, randomized trial, we aimed to evaluate the safety and efficacy of 5-ALA in patients with mild-to-moderate coronavirus disease 2019.<h4>Methods</h4>This trial was conducted in patients receiving 5-ALA/SFC (250/145 mg) orally thrice daily for 7 days, followed by 5-ALA/SFC (150/87 mg) orally thrice daily for 7 days. The primary endpoints were changes in SARS-CoV-2 viral load, clinical symptom scores, and 5-ALA/SFC safety (adverse events [AE] and changes in laboratory values and vital signs).<h4>Results</h4>A total of 50 patients were enrolled from 8 institutions in Japan. The change in SARS-CoV-2 viral load from baseline was not significantly different between the 5-ALA/SFC (n = 24) and control (n = 26) groups. The duration to improvement was shorter in the 5-ALA/SFC group than in the control group, although the difference was not significant. The 5-ALA/SFC group exhibited faster improvement rates in "taste abnormality," "cough," "lethargy," and "no appetite" than the control group. Eight AEs were observed in the 5-ALA/SFC group, with 22.7% of patients experiencing gastrointestinal symptoms (decreased appetite, constipation, and vomiting). AEs occurred with 750/435 mg/day in 25.0% of patients in the first phase and with 450/261 mg/day of 5-ALA/SFC in 6.3% of patients in the second phase.<h4>Conclusion</h4>5-ALA/SFC improved some symptoms but did not influence the SARS-CoV-2 viral load or clinical symptom scores over 14 days. The safety of 5-ALA/SFC in this study was acceptable. Further evaluation using a larger sample size or modified method is warranted.

Also flagged:tenofovir alafenamidetenofoviremtricitabinediphosphatetriphosphateHIV-1 infection
Journal Article 2023-08-01 No Snippets Tran HT, Tsuchiya K, Kawashima A, Watanabe K, Hayashi Y, Ryu S, Hamada A, Gatanaga H, Oka S.
Show Full Abstract

Emtricitabine (FTC) plus tenofovir alafenamide (TAF) has demonstrated efficacy and safety for pre-exposure prophylaxis (PrEP) to prevent HIV-1 infection. We measured the plasma PK of FTC, tenofovir (TFV), and TAF in a steady-state pharmacokinetic (PK) study of bictegravir/FTC/TAF in HIV-1-infected patients. Furthermore, validated liquid chromatography-tandem mass spectrometry was used to measure intracellular TFV-diphosphate (DP) and FTC-triphosphate (TP), the active metabolites of TFV and FTC, respectively. Plasma and dried blood spot samples were collected from 10 male patients aged ≥ 50 years at various time intervals: 0 (trough), 1, 2, 3, 4, 6, 8, 12, and 24 h after drug administration. The mean ± standard deviation of plasma PK parameters were as follows: The maximum concentrations of TAF, TFV, and FTC were 104.0 ± 72.5, 27.9 ± 5.2, and 3,976.0 ± 683.6 ng/mL, respectively. Additionally, their terminal elimination half-lives were 0.6 ± 0.5, 31.6 ± 10.4, and 6.9 ± 1.4 h, respectively. These results were consistent with previously reported data. The intracellular levels of TFV-DP and FTC-TP varied widely among individuals; however, they remained stable over 24 h in each individual at approximately 1,000-1,500 and 2,000-3,000 fmol/punch, respectively, indicating that plasma concentrations did not affect the intracellular concentrations of their active metabolites. These results demonstrated that measuring intracellular TFV-DP and FTC-TP could be useful for monitoring adherence to PrEP in clients on this regimen.

Also flagged:collagenHydroxyapatitecollagen IrhCol Inanocrystalsminerals
Journal Article 2023-08-01 No Snippets Huang Z, Wang C, Chen X, Ding S, Xiang Q, Xie M, Huang Y, Li H.
Show Full Abstract

Hydroxyapatite (HAP) in natural bone is formed under the regulation of natural collagen I. Here, we report how recombinant humanized collagen I (rhCol I) regulates the growth of HAP nanocrystals in a long belt shape 100-150 nm in width and 200-300 nm in length. MD simulation results showed that the interactions between rhCol I and the (001), (100), and (211) planes of HAP mainly contributed to the electrostatic force and van der Waals forces <i>via</i> COO⋯Ca, -NH⋯Ca, CH⋯OPO<sub>3</sub>, and NH⋯OPO<sub>3</sub> bonds, respectively. On the (001) plane, the interaction between -COO<sup>-</sup> and Ca was stronger than on the (100) and (211) planes, resulting in a large electrostatic force, which inhibited the growth of the (001) plane. The lowest energy of adsorption to the (211) plane resulted in the preferential growth of the (211) plane due to the weakest interaction with rhCol I. The detailed correlation between HAP and rhCol I could explain HAP growth under regulation by rhCol I. This study provides a reference for the bio-application of recombinant collagen.

ZNF322
Also flagged:Gastric Cancerwound healingbindingZFP36luciferasetumor
Journal Article 2023-08-01 ✓ 1 Snippet Pan Z, Yun H, Xiao Y, Tong F, Liu G, Zhang G, Han J.
In-Text Gene Mentions

…partly through targetingZNF322( 15 ).…

Show Full Abstract

<h4>Background</h4>In order to explore new targets for the treatment of gastric cancer (GC), we investigated the regulatory mechanism of miR-934 in the malignant phenotype of gastric cancer.<h4>Methods</h4>The miRNA and mRNA expressions were determined by RT-qPCR, and protein levels were quantified by western blotting assay. Malignancy of AGS cell line was evaluated by MTT, flow cytometry, wound healing and Transwell assays. The putative binding site between miR-934 and ZFP36 was validated using luciferase reporter assay. Immunohistochemistry (IHC) assay was used to visualize the ZFP36-positive cells in the xenograft sections. All experiments were conducted in General Surgery Laboratory of Nanjing Red Cross Hospital Jiangsu Province, China from June 2019 to June 2021.<h4>Results</h4>GC tissues and cell lines showed notably higher levels of miR-934. Overexpression of miR-934 promoted cell viability, migration and invasion, while inhibited cell apoptosis of GC cells. ZFP36 was predicted and verified to be the target of miR-934 and low protein levels of ZFP36 were observed in GC tissues. The ZFP36 protein expressions were suppressed by miR-934 overexpression, while were facilitated by miR-934 inhibition. Furthermore, the carcinogenic functions of miR-934 were partially reversed after ZFP36 overexpression. The results of in vivo experiments further demonstrated that miR-934 promoted tumor growth and repressed the protein expression of ZFP36.<h4>Conclusion</h4>miR-934 served as a tumor promoter in GC via targeting ZFP36, and ZFP36 overexpression could efficiently relieve malignant phenotypes caused by miR-934, which prompted an exploitable molecular target for GC treatment.

PRDX6
Also flagged:Peroxiredoxin 6Inflammatory Responseinflammatory responsesTNF-αpro-inflammatory cytokineIL-1β
Journal Article 2023-08-01 ✓ 5 Snippets Parfenyuk SB, Glushkova OV, Sharapov MG, Khrenov MO, Lunin SM, Kuzekova AA, Mubarakshina EK, Novoselova TV, Cherenkov DA, Novoselova EG.
In-Text Gene Mentions

…of peroxiredoxin 6 (PRDX6), a recombinant antioxidant…

…Moreover, addition ofPRDX6reduced production of…

…results showed thatPRDX6had a suppressive…

…the presence ofPRDX6, activity of these…

…protective effect ofPRDX6that reduced apoptosis…

Show Full Abstract

The aim of the work was to study effects of peroxiredoxin 6 (PRDX6), a recombinant antioxidant protein, on the level of pro-inflammatory responses of RAW 264.7 macrophages to endotoxin exposure. Addition of LPS to the RAW 264.7 cell culture medium expectedly increased production of TNF-α, and addition of PRDX6 led to a significant (15-20%) decrease in its production. The level of production of another pro-inflammatory cytokine, IL-1β, which was significantly activated by endotoxin, was completely normalized under the PRDX6 action. Moreover, addition of PRDX6 reduced production of reactive oxygen species (ROS) induced by endotoxin and also prevented overexpression of the iNos gene in the RAW 264.7 cells. The results showed that PRDX6 had a suppressive effect on the expression of Nrf-2 gene and production of the transcription factor NRF-2 during the first 6 h of cell cultivation. Addition of endotoxin caused activation of the NF-κB and SAPK/JNK signaling cascades, while in the presence of PRDX6, activity of these signaling cascades decreases. It is known that the pro-inflammatory response of cells caused by exposure to bacterial LPS leads to activation of apoptosis and elimination of the damaged cells. Our studies confirm this, since exposure to LPS led to activation of the expression of P53 gene, a marker of apoptosis. Peroxiredoxin 6 added within the first hours of the development of acute pro-inflammatory response suppressed the P53 gene expression, indicating protective effect of PRDX6 that reduced apoptosis in the RAW 264.7 macrophages.

Also flagged:Cell DifferentiationAgingFTOALKBH5HDAC1histone
Journal Article 2023-08-01 No Snippets Krejčí J, Arcidiacono OA, Čegan R, Radaszkiewicz K, Pacherník J, Pirk J, Pešl M, Fila P, Bártová E.
Show Full Abstract

FTO and ALKBH5 proteins are essential erasers of N6-adenosine methylation in RNA. We studied how levels of FTO and ALKBH5 proteins changed during mouse embryonic development, aging, cardiomyogenesis, and neuroectodermal differentiation. We observed that aging in male and female mice was associated with FTO up-regulation in mouse hearts, brains, lungs, and kidneys, while the ALKBH5 level remained stable. FTO and ALKBH5 proteins were up-regulated during experimentally induced cardiomyogenesis, but the level of ALKBH5 protein was not changed when neuroectodermal differentiation was induced. HDAC1 depletion in mouse ES cells caused FTO down-regulation. In these cells, mRNA, carrying information from genes that regulate histone signature, RNA processing, and cell differentiation, was characterized by a reduced level of N6-adenosine methylation in specific gene loci, primarily regulating cell differentiation into neuroectoderm. Together, when we compared both RNA demethylating proteins, the FTO protein level undergoes the most significant changes during cell differentiation and aging. Thus, we conclude that during aging and neuronal differentiation, m6A RNA demethylation is likely regulated by the FTO protein but not via the function of ALKBH5.

MLLT10
Also flagged:Acute myeloid leukemia
Journal Article 2023-08-01 ✓ 5 Snippets Hu DY, Shen K, Guo YS, Chen SN.
In-Text Gene Mentions

CALM-AF10最初发现于弥漫性组织细胞性淋巴瘤患者淋巴肿瘤组织内,并由此克隆建立U937细胞系[6]。PICALM-MLLT10融合基因是急性T淋巴细胞白血病(T-ALL)患者最常见的融合基因,占T-ALL患者的7%~10%[1],占AML患者的0.3%~2%[7]。患者临床表现为肝脾肿大、纵隔肿块、CNSL等,对常规化疗药物不敏感且易早期复发,预后不佳[1],[7]–[9]。由于发病率较低,目前大宗报道较少。Borel等[10]在2010年报道了1例AML-M0伴t(10;11)的患者在最初诊断后存活了15年,患者进行allo-HSCT并在11年后复发,在复发阶段检出了PICALM-MLLT10融合基因,后进行了二次allo-HSCT。结合患者初诊时有10和11号染色体易位,考虑患者在初诊即存在该融合基因。例3在初诊时染色体核型分析示10和11号染色体易位但未行RNA测序,复发后检出PICALM-MLLT10融合基因。可见,RNA测序筛查是复发/难治AML患者融合基因检测的有效手段。但结合既往文献研究,我们暂不考虑AML复发后继发PICALM-MLLT10融合基因的可能性,复发后检出该融合基因可能是患者初诊时由于检测技术的限制未检出。Borel等[7]在2012年报道了18例伴PICALM-MLLT10融合基因阳性的AML患者,是迄今为止最大宗的报道,18例融合基因阳性AML患者在总生存期、2年无病生存率以及2年总生存率方面与融合基因阴性患者无明显差异。其中7例患者接受了造血干细胞移植,3例患者移植后发。Huh等[11]报道了2例移植患者,1例患者在移植后4个月后复发,另1例患者移植后1个月随访期内处于CR状态。我们报道的4例患者中,在CR2状态及NR状态下移植的患者最终都复发死亡,2例患者在CR1状态下移植后分别缓解6个月及20个月,目前仍在缓解中。国内报道的PICALM-MLLT10融合基因阳性的AML患者仅2例,1例患者确诊2个月后死亡,另一例患者多次化疗仍未缓解,确诊11个月后死于脏器衰竭,均未行allo-HSCT,提示此类患者疾病进展快,预后不佳[12]。以往报道显示PICALM-MLLT10融合基因阳性的AML患者移植后复发风险仍旧很高,但移植似乎可以延长患者的生存期,这有待更大的样本去验证。

在PICALM-MLLT10融合基因阳性白血病中进行的研究中,常发现HOX基因家族表达上调,此被认为干扰了正常的造血分化,从而导致白血病的发生[13]–[14]。从治疗角度而言,目前尚无针对PICALM-MLLT10融合基因阳性AML的靶向药物和统一的治疗方案,此类患者单纯化疗预后不佳,移植可以延长患者的生存,但此类患者并非均有机会接受移植,寻找靶向药物至关重要。最近研究发现CALM-AF10蛋白依赖于Jak1激活JAK/STAT炎症信号通路[15],且Jak1抑制剂在AF10重排的AML模型中显示出强大的抗癌活性。先前研究表明,组蛋白甲基转移酶DOT1L是AF10重排AML中一个有效的靶点[16],但小分子DOT1L抑制剂pinometostat对AML的疗效有限。而Conway等[13],[17]研究发现核输出蛋白XPO1对于Hoxa基因上调是必不可少的,而且XPO1抑制剂对于AF10重排AML患者疗效较好。因此,XPO1抑制剂Selinexor有望成为治疗PICALM-MLLT10阳性AML的新型靶向药物。

例1,男,28岁,主诉咳嗽伴发热2 d至当地医院就诊。入院血常规:WBC 16.0×109/L,HGB 86 g/L,PLT 122×109/L;骨髓象:急性髓系白血病,不除外AML-M5(原幼单核细胞占85.5%,可见Auer小体);白血病免疫分型:异常髓系原始细胞占有核细胞90%,符合AML表型。骨髓活检:骨髓增生大致正常(50%~60%),幼稚阶段细胞弥漫增生,少量偏成熟阶段粒红系细胞散在分布,巨核细胞不少,分叶核为主,网状纤维染色(MF-0级)。染色体核型分析:所分析20个细胞中有16个为+4,t(10;11)(p13;q21),其中一个伴有+21,可见克隆性异常+4,t(10;11);43种急性白血病相关融合基因检测阴性。RNA测序检出PICALM-MLLT10融合基因,二代测序检出ASXL1-p.Gly646fs(变异比例30.53%)、PHF6-p.Ala41fs(变异比例72.1%)。予IAC方案诱导治疗后达完全缓解(CR),同日行腰穿鞘注,脑脊液未见异常。以地西他滨联合高剂量阿糖胞苷巩固1个疗程。期间复查骨髓均处于CR状态,行无关供者全相合造血干细胞移植,移植过程顺利,目前处于CR状态。

10号染色体上的PICALM基因与11号染色体上MLLT10基因融合形成PICALM-MLLT10融合基因,是淋巴细胞系及髓系血液系统恶性肿瘤中较为罕见的融合基因,该融合基因参与诱导白血病的发生且与不良预后密切相关[1]–[3]。由于发生率低,既往报道少,异基因造血干细胞移植(allo-HSCT)对于该类患者的疗效更是未知。我们回顾性分析了2017年至2021年在苏州大学附属第一医院接受allo-HSCT治疗的4例PICALM-MLLT10融合基因阳性急性髓系白血病(AML)患者的临床和实验室资料并进行相关文献复习。

…PICAML-MLLT10融合基因阳性急性髓系白血病4例报告并文献复习…

Show Full Abstract

No abstract available.

Also flagged:Amyloid-βCytokineSecretionmetabolismADaging
Journal Article 2023-08-01 No Snippets Kuhn MK, Fleeman RM, Beidler LM, Snyder AM, Chan DC, Proctor EA.
Show Full Abstract

<h4>Introduction</h4>Neuroinflammation and metabolic dysfunction are early alterations in Alzheimer's disease (AD) brain that are thought to contribute to disease onset and progression. Glial activation due to protein deposition results in cytokine secretion and shifts in brain metabolism, which have been observed in AD patients. However, the mechanism by which this immunometabolic feedback loop can injure neurons and cause neurodegeneration remains unclear.<h4>Methods</h4>We used Luminex XMAP technology to quantify hippocampal cytokine concentrations in the 5xFAD mouse model of AD at milestone timepoints in disease development. We used partial least squares regression to build cytokine signatures predictive of disease progression, as compared to healthy aging in wild-type littermates. We applied the disease-defining cytokine signature to wild-type primary neuron cultures and measured downstream changes in gene expression using the NanoString nCounter system and mitochondrial function using the Seahorse Extracellular Flux live-cell analyzer.<h4>Results</h4>We identified a pattern of up-regulated IFNγ, IP-10/CXCL10, and IL-9 as predictive of advanced disease. When healthy neurons were exposed to these cytokines in proportions found in diseased brain, gene expression of mitochondrial electron transport chain complexes, including ATP synthase, was suppressed. In live cells, basal and maximal mitochondrial respiration were impaired following cytokine stimulation.<h4>Conclusions</h4>We identify a pattern of cytokine secretion predictive of progressing amyloid-β pathology in the 5xFAD mouse model of AD that reduces expression of mitochondrial electron transport complexes and impairs mitochondrial respiration in healthy neurons. We establish a mechanistic link between disease-specific immune cues and impaired neuronal metabolism, potentially causing neuronal vulnerability and susceptibility to degeneration in AD.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s12195-023-00782-y.

Also flagged:Malnutritioncognitive impairmentanemiaalbumininfant malnutritiondeath
Journal Article 2023-08-01 No Snippets Nguyen LTT, Tran CD, Nguyen HTT, Phan HT, Nguyen LT, Nguyen HLT, Ta AHT, Pho CQT, Do KN, Dang AK, Le HT.
Show Full Abstract

<h4>Importance</h4>Nutritional status of infants, measured by birth weight and length, is an essential factor in neonatal development. Malnutrition in newborns may lead to a higher risk of mortality, neurological and cognitive impairment, and poor language development.<h4>Objective</h4>This study aims to assess the nutritional status of infants and related factors regarding maternal anthropometric characteristics and medical history.<h4>Methods</h4>A cross-sectional study was conducted at the National Hospital of Obstetrics and Gynecology, Vietnam from May 2021 to May 2022 on 340 infants and mothers. Low birth weight was defined following the Intergrowth-21 standards. Stunting was evaluated using the Fenton growth chart when the length was below the 10% percentile line of the gestational week. Multivariate regression models were applied to identify factors associated with the nutritional status of infants.<h4>Results</h4>We found that 12.4% and 14.1% of infants in our study fell into stunted and underweight categories, respectively. Infants of mothers over 35 years old, having a height lower than 150 cm or experiencing anemia during pregnancy were more likely to be stunted or have low birth weight. Serum albumin deficiency during pregnancy was strongly associated with the infant being underweight (odds ratio [OR]  =  2.8, 95% confidence interval [95%CI] 1.1-7.3). Newborns were more likely to be stunted if their mothers had a history of preterm birth (OR = 3.3, 95%CI 1.1-10.2).<h4>Interpretation</h4>Maternal nutritional status is closely related to infant malnutrition, particularly in preterm infants. Improving the understanding of mothers regarding prenatal care, reproductive healthcare, adequate nutritional diet, and multi-micronutrient supplements during pregnancy is therefore important.

Also flagged:zoonotic diseasesODHCOVID-19
Journal Article 2023-08-01 No Snippets Scott P, Kuziemsky C, Zhu X, Nøhr C, Ammenwerth E, Kukhareva P, Peute L, Marcilly R.
Show Full Abstract

<h4>Objectives</h4>To offer diverse but complementary perspectives on how biomedical and health informatics can be informed by and help to achieve the vision of One Health.<h4>Methods</h4>Overview of key considerations and critical discussion of common themes, barriers and opportunities, based on collaborative review by International Medical Informatics Association (IMIA) working group members active in related fields.<h4>Results</h4>Health and care systems are complex sociotechnical systems that need explicit design and implementation strategies to align with the goals of One Health. The evidence-based health informatics paradigm and associated frameworks for evaluation of digital health technologies need to broaden their scope to take full account of the One Health approach. Informatics has specific contributions to make to One Health, for example by improved user experience reducing energy consumption and effective app design enhancing medication adherence.<h4>Conclusions</h4>One Health is inherently intertwined with ergonomic, sociotechnical and evaluation perspectives in biomedical and health informatics. Health is a planetary issue that requires interdisciplinary collaborative action. The theories and principles of biomedical and health informatics offer many opportunities to transform digital health technology to better serve the One Health agenda.

HFE
Also flagged:chronic hepatitischronic liver diseaseCryptogenic cirrhosiscirrhosiscryptogenic hepatitisfatty liver disease
Journal Article 2023-08-01 ✓ 4 Snippets Cançado GGL, Candolo ACR, Nardelli MJ, Zitelli PM, Mazo DFC, Oliveira CP, Cunha-Silva M, Greca RD, Araújo RC, Alustau ASPT, Couto CA, Roque GRL, Farias AQ, Carrilho FJ, Pessôa MG.
In-Text Gene Mentions

…for p.C282Y inHFEand screened for…

…and screened forhemochromatosis.…

…in five (1.78%),hemochromatosisin five (1.78%),…

…disease, autoimmune hepatitis,hemochromatosis, biliary-related hepatitis, v…

Show Full Abstract

<h4>Introduction</h4>Cryptogenic chronic hepatitis is a growing cause of liver transplants, affecting 5%-15% of patients with chronic liver diseases. This study aimed to identify underlying causes of cryptogenic liver disease in a Brazilian cohort and propose a new diagnostic algorithm, including investigation for metabolic-dysfunction-associated fatty liver disease (MAFLD) and lysosomal acid lipase deficiency (LAL-D).<h4>Methods</h4>A retrospective analysis was conducted on 326 patients with presumed cryptogenic hepatitis.<h4>Results</h4>Using Czaja's algorithm, non-alcoholic fatty liver disease was diagnosed in 21.3% of patients, while alpha-1 antitrypsin deficiency, alcoholic liver disease, autoimmune hepatitis, hemochromatosis, biliary-related hepatitis, viral hepatitis, Budd-Chiari syndrome, glycogenosis, drug-induced liver injury, and Wilson's disease were diagnosed in smaller proportions (< 3.5% each). LAL-D was found in 1% of patients, and 53.6% of patients remained with cryptogenic hepatitis. The etiology of the liver disease in a subset of patients undergoing liver transplantation was updated <i>post hoc</i> based on explant histology, and non-alcoholic steatohepatitis was found in 52.5% of patients. By incorporating the concept of MAFLD, the new algorithm could diagnose 49.1% of patients, reducing the number of individuals without an etiological diagnosis by 11.4%.<h4>Conclusion</h4>One-third of patients with initially presumed cryptogenic liver disease were diagnosed with MAFLD. LAL-D should be considered in patients with chronic liver disease of unknown etiology. The updated diagnostic algorithm proposed in this study could improve diagnostic accuracy and aid in the management of patients with cryptogenic hepatitis.

TNFSF4
Also flagged:tumormemoryCanceradaptive immune responseacute myeloid leukemiagene expression
Journal Article 2023-08-01 ✓ 1 Snippet Rutella S, Cashen A, Muth J, Vadakekolathu J, Arthur L, Mahajan N, Berrien-Elliott M, Davidson-Moncada J, Fehniger T.
In-Text Gene Mentions

…ated T cells (GZMB, TNFSF4, LAG3, CD27, HAVCR2…

Show Full Abstract

No abstract available.

MLLT10
Also flagged:HematopoiesischromosomemetaphasesMpbanemialymphoblastic leukemia
Journal Article 2023-08-01 ✓ 2 Snippets Díaz González Á, Avetisyan G, Garcia-Ruiz C, Vicente Gil J, Santiago M, José Domínguez-García J, Llop M, Barragan E, Leonor Senent Peris M, DE LA Rubia J, Cervera J, Such E.
In-Text Gene Mentions

…ements in of DDX3X::MLLT10, ETV6::FOXO1, PICAL…

…V6::FOXO1, PICALM:: MLLT10 and STIL::TAL in 6/…

Show Full Abstract

No abstract available.

HFE
Also flagged:Thalassemiasalpha-globinbeta-thalassemiabeta globinthalassemiaanemia
Journal Article 2023-08-01 ✓ 1 Snippet Delaporta P, Vrettou C, Chouliara V, Chatzieleftheriou M, Kyriakopoulou D, Moraki M, Traeger-Synodinos J, Kattamis A.
In-Text Gene Mentions

…Cys282Tyr (C282Y) variant of the HFE gene. …

Show Full Abstract

No abstract available.

MLLT10
Also flagged:acute myeloid leukaemiaKMT2AMLLT1gene expressionMLLT3CEBPA
Journal Article 2023-08-01 ✓ 1 Snippet Severens J, Karakaslar O, Sánchez- López E, Van den Berg R, Veelken H, Reinders M, Griffioen M, Van den Akker E.
In-Text Gene Mentions

…T2A-MLLT1 and KMT2A-MLLT10 to share a gene exp…

Show Full Abstract

No abstract available.

HFE
Also flagged:IronmetabolismHereditary spherocytosishemolysiscell membraneiron overload
Journal Article 2023-08-01 ✓ 2 Snippets Donaty L, Blaizot M, Cunat S, Azoury V, Favier C, Debant V, Danton F, Navarro R, Mahé P, Martinez P.
In-Text Gene Mentions

… for HS, nor to the HFE:p.(Cys282Tyr) varia…

…olymorphisms on the HFE, KIF23 and GLRX5 ge…

Show Full Abstract

No abstract available.

HFE
Also flagged:IronmetabolismHereditary hemochromatosisgenetic disordershepcidiniron overload
Journal Article 2023-08-01 ✓ 5 Snippets Toreli A, Campos P, Toni I, Leonardo D, Lanaro C, de Albuquerque D, Fertrin K, Costa F.
In-Text Gene Mentions

…emic iron overload. HFE gene mutations are …

… Brazil can be explained by HFE mutations. …

…in iron physiology: HFE, TFR2, HJV, HAMP, S…

…A mutation in the HFE gene was found in 37 …

…Non-HFE HH mutations were found in five pat…

Show Full Abstract

No abstract available.

HFE
Also flagged:Ironmetabolismanemiainfectionmalariaerythropoiesis
Journal Article 2023-08-01 ✓ 5 Snippets Pêgo A, Lima I, Spasic M, Nai A, Silvestri L, Gozzelino R.
In-Text Gene Mentions

…AND THE IRON SENSOR HFE, IN SEVERE MALARIA-…

…tion, wild-type and HFE knockout mice were …

… iron sensors, like HFE, was analyzed, dete…

…mind, the action of HFE in the pathogenesis…

…improves in Pcc-induced HFE knockout mice. …

Show Full Abstract

No abstract available.

bioRxiv 2023-08-01 Preprint (No Snippets API) Ben-Ami R, Loyfer N, Cohen E, Fialkoff G, Sharkia I, Bogot N, Kochan D, Kalak G, Jarjoui A, Chen-Shuali C, Azulai H, Barhoum H, Arish N, Greenberger MM, Vellema D, Kurd R, Chetrit EB, Bohm D, Wolak T, Quteineh A, Cann G, Glaser B, Friedman N, Kaplan T, Shemer R, Rokach A, Dor Y.
Show Full Abstract

The full spectrum of tissues affected by SARS-CoV-2 infection is crucial for deciphering the heterogenous clinical course of COVID-19. Here, we analyzed DNA methylation and histone modification patterns in circulating chromatin to assess cell type-specific turnover in severe and asymptomatic COVID-19 patients, in relation to clinical outcome. Patients with severe COVID-19 had a massive elevation of circulating cell-free DNA (cfDNA) levels, which originated in lung epithelial cells, cardiomyocytes, vascular endothelial cells and erythroblasts, suggesting increased cell death or turnover in these tissues. The immune response to infection was reflected by elevated B cell and monocyte/macrophage cfDNA levels, and by evidence of an interferon response in cells prior to cfDNA release. Strikingly, monocyte/macrophage cfDNA levels (but not monocyte counts), as well as lung epithelium cfDNA and vascular endothelial cfDNA, predicted clinical deterioration and duration of hospitalization. Asymptomatic patients had elevated levels of immune-derived cfDNA but did not show evidence of pulmonary or cardiac damage. Surprisingly, these patients showed elevated levels of vascular endothelial cell and erythroblast cfDNA, suggesting that sub-clinical vascular and erythrocyte turnover are universal features of COVID-19, independent of disease severity. Epigenetic liquid biopsies provide non-invasive means of monitoring COVID-19 patients, and reveal sub-clinical vascular damage and red blood cell turnover.